WO2013017702A1 - Method for determining the genotype of multiple sequences - Google Patents

Abstract

Method for determining the genotype of multiple sequences. A method is disclosed for the determination of the genotype of multiple sequences of interest, in particular single nucleotide polymorphisms (SNPs). The method uses a single amplification reaction for the amplification of the target sequences that comprise multiple sequences of interest, in particular SNP sites, and a single genotyping reaction for the sequencing of multiple sequences of interest, in particular SNP sites, in a simultaneous manner. The method reduces the number of reactions needed to sequence small regions of interest in longer lengths of DNA of little interest. The method also reduces the cost of the tests that would otherwise require a high number of sequencing reactions, reduces the amount of starting template DNA required for sequencing multiple regions of interest, and yields a product that is technically less complex.

Description

 METHOD FOR THE DETERMINATION OF THE SEQUENCE GENOTYPE

 MULTIPLE

TECHNICAL SECTOR OF THE INVENTION

The present invention describes a method for the determination of the genotype of multiple sequences of interest, more specifically, it describes a method for determining the genotype of multiple sequences simultaneously in a single reaction, and in particular, a method for the determination of the genotype of single nucleotide polymorphisms (SNPs) simultaneously in a single reaction.

BACKGROUND OF THE INVENTION

The characterization of multiple sequences is a requirement in the diagnosis of polygenic syndromes and / or diseases whose cause is the result of different genetic / chromosomal variations. Such sequences, which are the basis of the aforementioned syndromes, are very often separated long distances upstream / downstream of a particular genetic marker, therefore their parallel analysis is a requirement to be able to provide an accurate diagnosis. A significant number of clinical uses occur when this kind of distant sequences (which often show different coupling patterns) are analyzed, including the determination of the consequences of complex diseases, uses in farmocogenetics, legal medicine, and epidemiological studies. In this sense, a significant number of genetic disorders are the result of the interaction between sequences distant from each other, contributing to the risk of developing a particular disease.

Single nucleotide polymorphisms (SNPs) represent the most abundant type of sequence variation in the human genome and can be useful for many diverse uses, including determining the genetic architecture of complex traits and diseases, applications in pharmacogenetics, legal medicine , and evolutionary studies. Many genetic disorders are the result of the interaction of more than one SNP, each contributing to the risk of developing a particular disease. In many cases these SNPs with which the risk of disease development are associated are very separated in the same gene, or even present in different genes. Traditionally the genotype of sequences and in particular SNPs is determined by microsequencing reactions. The conventional method includes a PCR reaction to amplify a region of DNA that contains the sequence of interest and in particular the SNP of interest and to amplify a DNA sequence that flanks the sequence / SNP of interest and that can be used as a quality control. internal. The microsequencing reaction is then carried out with which the sequence flanking the sequence / SNP of interest as well as the sequence of interest itself and in particular the SNP can be read and its genotype can be resolved.

Genotyping of multiple sequences and in particular of multiple SNPs is carried out by doing a PCR reaction and a sequencing reaction for each sequence and / or SNP of interest. For example see Lin YS, Liu FG, Wang TY, Pan CT, Chang WT, Li WH (2010) "A simple method using Pyrosequencing ™ to identify de novo SNPs in pooled DNA samples." Nucleic Acids Res 39 (5): e28; Mashayekhi F, Ronaghi M. (2007) "Analysis of read length limiting factors in Pyrosequencing chemistry." Anal Biochem 363 (2): 275-287. The method requires multiple sequencing reactions that make it more expensive as well as lengthen the test. In addition, with this method, large quantities of starting template DNA necessary to sequence the multiple regions of interest are required, thus making this process unfeasible for cases where the amount of starting template DNA sequencing is very low.

In addition, although the pyrosequencing processes used are relatively simple, users face challenges due to the wide variety of parameters to be considered in the development of the PCR, as well as those related to the design of sequencing primers, and those that affect both to the sample preparation as to the dispensing of nucleotides. These challenges are laborious and expensive. For example, see Gharizadeh B, Akhras M, Nourizad N, Ghaderi M, Yasuda K, Nyrén P, Pourmand N. (2006) "Methodological improvements of pyrosequencing technology." J Biotechnol. 124 (3): 504-51 1.

Therefore, the need for a method for the determination of the genotype of multiple sequences and in particular of multiple SNPs that solves the disadvantages of the methods described to date as a state of the art is clear. SUMMARY OF THE INVENTION The present invention aims at determining the genotype of multiple sequences of interest, in particular, of multiple single nucleotide polymorphisms (SNPs) simultaneously in a single sequencing reaction.

It is an object of the present invention to reduce the number of reactions required for the sequencing of multiple sequences of interest, in particular of multiple single nucleotide polymorphisms (SNPs) by using a single multiplex genotyping reaction.

It is another object of the present invention to reduce the work and cost of genotyping multiple sequences of interest, in particular multiple single nucleotide polymorphisms (SNPs). It is still another object of the present invention to provide a method for genotyping multiple sequences of interest, in particular SNPs, this method consists of amplification in a sample of at least one objective sequence to produce an amplified product, wherein said objective sequence it consists of at least one or more sites of a sequence of interest, in particular, single nucleotide polymorphisms (SNPs); and genotyping said amplified product by using a mixture of sequencing oligonucleotides, wherein said mixture consists of at least one sequencing oligonucleotide for each of the aforementioned sequences, in particular SNP sites

It is still another object of the present invention to determine the genotype of multiple sequences of interest, in particular, SNPs that are located no more than 1 kB from each other by the use of a simple amplification reaction and a multiplex genotyping reaction.

It is still another object of the present invention to determine the genotype of multiple sequences of interest, in particular, SNPs that are located at a distance greater than 1 kb through the use of a multiplex amplification reaction and a multiplex genotyping reaction.

It is still another object of the present invention to determine the genotype of multiple sequences of interest, in particular SNPs through the use of gelled amplification reagents to produce amplified products, which will subsequently be subject to multiple sequencing. The objects, embodiments, features and the preceding and other advantages of the present invention will be apparent from the more detailed and particular description thereof as well as from the claims derived therefrom.

DESCRIPTION OF THE FIGURES

Examples are described below in conjunction with figures that are intended to illustrate and not limit the scope of the inventive concept of the present invention.

FIG. 1 shows a simple PCR reaction with a multiplex genotyping reaction.

FIG. 2 shows a multiplex PCR reaction with a multiplex genotyping reaction. FIG. 3 shows the image of the agarose gel that results from the simple PCR, according to example 1.

FIG. 4 shows an overview of the overall quality of pyrosequencing reactions, according to example 1.

FIG. 5 shows the image of the pyrograms obtained from the simple and multiplex genotyping of SNP, according to example 1.

FIG. 6 shows the results of the genotype obtained for the template DNA, according to example 1.

FIG. 7 shows the image of the agarose gel that results from the simple PCR, according to example 2. FIG. 8 shows a view of the quality of pyrosequencing reactions, according to example 2.

FIG. 9 shows the image of the pyrograms of the simple and multiplex genotyping of SNP, according to example 2.

FIG. 10 shows the genotype results obtained for the template DNA, according to example 2. FIG. 1 1 shows the image of the agarose gel that results from the simple PCR, according to example 3.

FIG. 12 shows the image of the agarose gel that results from multiplex PCR, according to example 3.

FIG. 13 shows an overview of the overall quality of pyrosequencing reactions, according to example 3.

FIG. 14 shows the genotype results obtained for the template DNA, according to example 3.

FIG. 15 shows the image of the agarose gel that results from the gelled PCR, according to example 4. FIG. 16 shows an overview of the overall quality of pyrosequencing reactions, according to example 4.

DETAILED DESCRIPTION OF THE INVENTION

The following description of the preferred embodiments and examples is provided by way of explanation and illustration. As such, they should not be seen as limiting the scope of the invention as defined by the claims. In addition, when the examples are provided, it is done by way of illustration only and not for the purpose of being restrictive.

Throughout the description and claims of the present invention, the following terminology will be used according to the explanations detailed below. The term "sequences of interest" includes, but is not limited to, genetic areas encoding or not (ie introns / exons), repetitions in tanden and satellites, 5 'UTR leader regions, high mutational intensity points ... and, in general, any DNA fragment whose modification leads to changes in the behavior of a particular organism in relation to the development of abnormalities. These modifications can work at any level, genetic, genomic or metagenomic, therefore it is necessary to cover the parallel analysis of each of them The term "target" includes, but is not limited to, molecules, genes, or genomes, which contain a nucleic acid sequence or segment of a sequence that is interested in being characterized by identification, quantification or amplification. Targets contemplated under this invention can be derived from any organism, including mammals and non-mammals, bacteria, viruses or fungi. A retrovirus is an example of a target that can be identified or quantified using highly conserved sequences to make genomic mapping. It should be understood that where appropriate, the terms "nucleic acid analyte", "target", and "target nucleic acid analyte" may alternatively be used to identify a nucleic acid, a nucleic acid sequence, or a segment of a sequence of a nucleic acid within an organism, bacteria, or virus, which is subject to characterization.

The term "gene" includes, but is not limited to, a particular nucleic acid sequence within a DNA molecule that occupies a precise position on a chromosome and is capable of self-replication by encoding a specific polypeptide chain. The term "genome" refers to a complete set of genes in the chromosomes of each cell of a specific organism.

It will be understood, as described below, that the terms "nucleotide" and "nucleoside" include, but are not limited to, nucleosides that contain not only the four nucleotide bases of natural DNA, ie, guanine purine bases (G ) and adenine (A) and pyrimidine cytosine (C) and thymine (T) bases, but also the uracil (U) RNA purine base, iso-G and iso-C non-natural nucleotide bases, universal bases , degenerate bases, and other modified nucleotides and nucleosides.

As described below, the term "oligonucleotide" includes, but is not limited to, polydeoxosiribonucleotides (containing 2-dexosi-D-ribose), polybibonucleotides (containing D-ribose), and any other type of polynucleotide that is a N-glycoside of a purine or pyrimidine base, and other polymers containing non-nucleotide characters (for example, any type of modified DNA or RNA chain from those used in different applications in molecular biology and medicine, where they can be used as a probe to investigate diseases, viral infections, identify genes, specific target regions within a chromosome ... etc. These modified oligonucleotides can be made of different nucleotide-derived base units, organized in various forms such as nucleic acids from proteins and polymers of synthetic nucleic acids with a specific sequence commercially available through Anti-Gene Development Group, Corvallis, Oregon, such as NEUGENE ™ polymers) or non-standard junctions, provided that the polymers contain core-bases in a configuration that allows for matching and alignment of the bases, such as found in DNA and RNA. Thus, "oligonucleotides" mentioned herein include double and single stranded DNA, as well as double and single stranded RNA and DNA: RNA hybrids, and also includes known types of modified oligonucleotides, such as, for example, oligonucleotides where one or more of the natural nucleotides are replaced by an analog; oligonucleotides that contain inter-nucleotide modifications such as, for example, those with non-anionic / non-cationic junctions (e.g., methyl phosphonates, phosphotriesters, phosphoromidates, carbamates, etc.), anionic junctions (e.g., phosphorothioates, phosphorodithioates, etc.) , and cationic junctions (eg amino-alkyl phosphoromidates, amino-alkyl phosphotriesters), which contain interaction domains such as, for example, proteins (including nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), those with intercalating agents (for example, acridine, psoralen, etc.), those with chelators (for example, metals, radioactive metals, boron, oxidative metals, etc.), and those with alkylators. It is not intended to distinguish between the terms "polynucleotide" and "oligonucleotide" that will be used alternately. These terms refer only to the primary structure of the molecule. As described below, the symbols for nucleotides and polynucleotides correspond to those established by the lUPAC-lUBMB joint commission on biochemical nomenclature.

The term "amplification oligonucleotide" includes, but is not limited to, an oligonucleotide that is complementary to the cDNA or RNA target molecule and provides the 3'-OH end as a substrate to which any DNA polymerase can add the nucleosides of a chain. increasing DNA in the 5'-3 'direction.

The term "simple" includes, but is not limited to, a single test that is not carried out simultaneously with any other test. Singleplex tests include individual tests that are carried out sequentially.

The term "multiplex" includes, but is not limited to, multiple tests that are carried out simultaneously, in which the detection and analysis steps are generally carried out in parallel. Within the context of the present invention, a multiplex assay will include the use of primers and probes, alone or in combination with other primers and additional probes for the identification, for example, of the influenza virus together with one or more additional viruses. It is understood that within the context of the present invention, primers and probes for internal controls and assays may include for example oligonucleotides.

The term "gelled amplification reagents" includes, but is not limited to, stabilized amplification reagents that preserve their chemical and biochemical qualities. Such amplification reagents include but are not limited to, reaction buffers, reaction enhancers, and enzymes involved in an enzymatic reaction, in this case the amplification of nucleic acids and the reactions associated with sequencing by synthesis, once all are included. these reagents, reaction buffers, reaction enhancers and enzymes in the same container, in this case multi-well tubes or plates, so that they are each dosed in the optimal reaction amounts, and do not interact or react with each other, immobilizing the biochemical reaction in which they intervene, being able to activate the enzymatic reaction at the will of the user, without having produced a significant decrease in their activity, having elapsed days, weeks, months or even years after mixing and stabilization.

The stabilization thus understood is achieved by the addition of a stabilizing mixture to a solution containing the reaction mixture, and the subsequent elimination of all or part of the water present in the resulting solution. This removal of all or part of the water can be achieved by lyophilization processes, dried in a fluid bed, dried at room temperature and atmospheric pressure, dried at room temperature and low pressure, dried at high temperature and atmospheric pressure, and dried at high Temperature and low pressure.

In the present invention, the stabilization method preferably used is the stabilization by gelation, described in WO 02/072002, assigned to Biotools Biotechnological & Medical Laboratories, SA The stabilizing mixture of the reaction mixture is preferably composed of trehalose, melezitosa , lysine or betaine and glycogen or raffinose, at different concentrations depending on the enzymatic reaction to stabilize. More preferably the gelation mixture is composed of trehalose, melezitose, glycogen and lysine. The method of extracting water from the reaction mixture after the addition of the agent mixture In the present invention, stabilizers are preferably desiccation by vacuum at a temperature between 30 ⁵ C and 40 ⁵ C, depending on the enzymatic reaction to be stabilized. Specifically, in the present invention the moisture content is maintained between 10-30% water.

The definition or nomenclature indicated is only intended to be exemplary and not to be restrictive. It should not be understood as a limitation of the scope of the invention as defined.

Some of the preferred embodiments and examples of the claimed invention are described below. Additional embodiments and modifications in the function, purpose, or structure of the disclosed embodiments are intended to be covered by the claims of this application.

The present invention discloses a method for the determination of multiple sequences, in particular, single nucleotide polymorphisms (SNPs) simultaneously. The method comprises the amplification of one or more target sequences present in a sample to produce an amplified product, and the genotyping of the amplified product with multiple sequencing oligonucleotides simultaneously. The sample may be a DNA sample or an RNA sample and the target sequence is a sequence in the DNA sample or in the RNA sample comprising one or more sequences to be identified, in particular, SNP sites of interest and a adjacent sequence which can be used as internal quality control. The amplification reaction may be a simple amplification reaction or a multiplex amplification reaction depending on the location of the sequence of interest, in particular the SNP sites in the sample. The simple amplification reaction is used when two or more sequences of interest, in particular SNP sites of interest, are located at a distance not exceeding 1 kbp from each other. In the single amplification reaction, a single reaction is designed with a pair of amplification oligonucleotides that covers all relevant sequences, in particular SNP sites in a single amplicon. The multiplex amplification reaction is used when the sequences of interest, in particular the SNP sites of interest are located too far from each other to be included in a single amplicon, or due to the presence of a long intermediate sequence, or because the sequences of interest, particularly SNP sites are located in different genes or chromosomes Multiplex amplification reactions are designed with a mixture of pairs of amplification oligonucleotides that share similar chemical compositions, so they can be used under the same concentrations of some reagents, same alignment temperatures and same extension times. Similar chemical compositions should be understood as nucleotide base units that need to be organized so that each unit has a complementary base to which it will bind. This will result in a thread that has a set of bases opposite to the one that joins, and it is this combination of bases that reports the required sequence in multiplex or simple format. The mixture of amplification oligonucleotide pairs comprises at least one pair of amplification oligonucleotides corresponding to each of the target sequences to be amplified.

The primers and amplification oligonucleotides used are complementary to the 3 '(three prime) ends of each parallel and anti-parallel strand of the strand of the target sequence. The oligonucleotides align first to the sample and then the amplification reaction takes place. One of the oligonucleotides of the amplification oligonucleotide pair is biotinylated so that the amplified product obtained is biotinylated.

In an exemplary embodiment, the amplification reaction is the polymerase chain reaction (PCR), however, other amplification reactions such as, but not limited to, the ligase chain reaction (LCR), mutagenesis systems synthesis-directed (ARMS), specific allele PCR (ASPCR), degenerate PCR can be used for amplification of the target sequence without altering the scope or spirit of the present invention.

In an exemplary embodiment, the amplification reaction is stabilized by the process and gelation reagents described in WO 02/072002.

In an exemplary embodiment, the sequencing oligos are stabilized by the process and gelation reagents described in WO 02/072002.

The amplified product produced by a simple amplification reaction or a multiplex amplification reaction is a hybrid of at least two sequences of interest, in particular SNPs sites and their adjacent sequences. This amplified product is then genotyped with a mixture of sequencing oligonucleotides. simultaneously in a single multiplex genotyping reaction. The sequencing oligonucleotide mixture comprises at least one sequencing oligonucleotide for each of the sequences of interest, in particular SNP sites of interest. The sequencing oligonucleotides bind a few bases upstream to the sequence of interest, in particular the SNP site to initiate the sequencing process.

In an exemplary embodiment, genotyping of the amplified product is done by the pyrosequencing method, however, other genotyping methods such as, but not limited to, Sanger sequencing, mass sequencing systems by fragment stacking (MPSS), sequencing polarized, Illumination sequencing, SOLiD sequencing, SANGER microfluidic sequencing, hybridization sequencing or the like can also be used for genotyping the amplified product without altering the scope and spirit of the present invention.

In an exemplary embodiment, the genotyping reaction is carried out as follows: an oligonucleotide or hybrid sequencing primer with a single stranded amplified product or amplified amplicon or PCR amplicon serving as a template, and is incubated with the enzymes, DNA polymerase, ATP sulphorylase, luciferase and apyrase as well as with the substrates, 5 'phosphosulfate adenosine (APS), and luciferin.

Then, the first deoxyribonucleotide triphosphate (dNTP) is added to the reaction. DNA polymerase catalyzes the incorporation of dNTPs into the DNA strand, if it is complementary to the base present in the template strand. Each time an incorporation occurs, it is accompanied by the release of pyrophosphate (PPi) in an amount equimolar to the amount of nucleotide incorporated. ATP sulphorylase converts PPi to ATP in the presence of APS. This ATP conducts the luciferase-mediated conversion of luciferin to oxyluciferin that produces visible light in amounts proportional to the amount of ATP. The light produced in the reaction catalyzed by luciferase is detected by a camera or a photomultiplier and is observed as a peak in the information of the raw data obtained (Pyrogram). The height of each peak corresponds to the light signal that is proportional to the number of nucleotides incorporated during the genotyping reaction. An enzyme that degrades nucleotides such as apyrase, degrades nucleotides that have not been incorporated and ATP. When degradation is complete, another nucleotide is added. This is a continuous process during the genotyping reaction. The addition of dNTPs is sequential.

In an exemplary embodiment, during the genotyping reaction dexosiadenosine alpha-thio-triphosphate (dATP.S) is used as a substitute for natural dexosiadenosine triphosphate (dATP) since it is very efficiently used by DNA polymerase., But it is not recognized for the luciferase. As the process continues, the complementary strand of DNA is generated and the nucleotide sequence is determined from the signal peaks that are plotted in the Pyrogram.

In an exemplary embodiment, the sequencer such as, but not limited to, microsequencer used during the genotyping reaction is programmed with a target sequence that includes the sequences adjacent to each of the multiple sequences of interest, in particular SNPs sites. This allows the genotyping software to determine if the correct reference sequence is present.

FIG. 1 shows a simple PCR reaction with a multiplex genotyping reaction according to an exemplary embodiment of the present invention. The DNA sample contains two SNP sites of interest (SNP1 and SNP2) that are located less than 1 kb from each other. A target sequence of the DNA sample containing both SNP sites (SNP1 and SNP2) is amplified by polymerase chain reaction (PCR). To carry out the PCR, a pair of amplification oligonucleotides A01 and A01 'are used, of which one of them, A01' is biotinylated. The resulting PCR product is biotinylated and contains both SNP SNP1 and SNP2 sites. After producing single stranded DNA to serve as a sequencing template, two sequencing oligonucleotides S01 and S02 are aligned to the PCR product. During genotyping reactions adjacent sequences and those that include both SNPs overlap.

FIG.2 shows a multiplex PCR with a multiplex genotyping reaction according to an exemplary embodiment of the present invention. The DNA sample contains two SNP sites of interest (SNP1 and SNP2) that are located in two different genes. Two target sequences of the DNA sample, each containing one of the SNP sites of interest, are amplified by the use of two pairs of amplification oligonucleotides, wherein the first pair of amplification oligonucleotides (A01 and A01 ') It is for the first SNP site of interest (SNP1) and the second couple of amplification oligonucleotides (A02 and A02 ') is for the second SNP site of interest. The amplification oligonucleotides A01 'and A02' are biotinylated. The resulting PCR products are biotinylated and contain an SNP site. After the production of single-stranded DNA that serves as a template for sequencing, two sequencing oligonucleotides S01 and S02 are aligned to the PCR products. During genotyping reactions adjacent sequences and those that include both SNPs overlap

The method according to one of the exemplary embodiments of the present invention uses a single amplification reaction and a single genotyping reaction reducing the work and costs related to the preparation of the sample, numerous tests, need to have a large amount of Starting DNA and large number of sequencing reactions. In addition, the method is technically less complicated and also reduces the overall cost.

With the purpose of carrying out the process of the present invention, kits are described that consist of: i) all the necessary reagents in the optimal amounts and concentrations for the generation of a simple or multiplex amplification reaction of the targets of interest ( precisely amplification oligonucleotides, DNA polymerase, dexosinucleotides and reaction buffer) all pre-mixed and stabilized by means of the gelation process and,

I) sequencing oligonucleotides for multiplex genotyping of the sequences of interest, which are stabilized by the gelation process.

The following examples are provided merely as illustrative of the various aspects of the invention and will not be construed as limiting the invention in any way. In the following examples, it should be understood that while efforts have been made to ensure the accuracy of the experimental parameters (eg, quantities, temperature etc.), a certain experimental error and deviation should be considered when reproducing the experiments that are described below. EXAMPLES Example 1 :

TEST CDKN2a SIMPLE PCR, MULTIPLEX GENOTIPATE A. Materials

The CDKN2a gene contains two SNPs, Rs10757283 and Rs1081 1661, which are associated with an increased risk of suffering from type II diabetes mellitus. These SNPs are linked in equilibrium and are separated by 77 bases. To generate a 246 bp amplicon, the following amplification oligonucleotides are designed: (i) a 23-base unmodified forward oligonucleotide and (ii) a 20-base reverse-biotinylated oligonucleotide. The forward oligonucleotide has a theoretical alignment temperature of 60.8 ⁵ C and the reverse oligonucleotide has an alignment temperature of 62.4 ⁵ C. The optimal reaction alignment temperature was determined experimentally at 55 ⁵ C. The two SNPs are read by the sequencing oligonucleotide 1 of 17 bases, which hybridizes 3 bases upstream of Rs1081 1661 and has an alignment temperature of 50.0 ⁵ C, and sequencing oligonucleotide 2 of 19 bases, which hybrid adjacent to Rs10757283 and has an alignment temperature of 53.7 ⁵ C.

When used individually, the sequencing oligonucleotide 1 reads the sequence SEQ ID NO: 1 (TTCYCATGAC) with the dispensing order SEQ ID NO: 2 (GTCTCGATGA), and the sequencing oligonucleotide 2 reads the sequence SEQ ID NO: 3 ( YTGATATTCT) with the dispensing order SEQ ID NO: 4 (GCTCGATAT). In multiplex mode the sequences are read in the order of dispensing SEQ ID NO: 5 (GCTAGCTCGATGA).

B. Methods

Amplification Reaction

A reaction mixture is prepared with the amplification oligonucleotides of CDKN2a. To this reaction mixture is added 3 μΙ of DNA polymerase enzyme, manufactured by Biotools Biotechnological & Medical Laboratories SA, 5 μΙ of a reaction that is marketed together with the enzyme, between 0.1 μΙ and 0.3 μΙ of a 10mM solution containing the four dexosiribonucleotides that form the dexosiribonucleic acid chain (dATP, dTTP, dGTP, dCTP) and between 0.2 μΙ and 0.5 μΙ of a solution 10 μΜ of the pair of amplification oligonucleotides described in the materials section to generate a 246 bp amplicon containing the two SNPs of interest (Rs10757283 and Rs1081 1661).

Prepare 3 aliquots of 47.0 μΙ each. Also add 3.0 μΙ of template DNA at a concentration of 10ng / μΙ or Milli-Q water. Incubate at 95 ⁵ C for 3 minutes; at 95 ⁵ C 20 seconds, at 55 ⁵ C 20 seconds, at 72 ⁵ C 30 seconds for approximately 45 cycles. Incubate at 72 ⁵ C for 5 minutes. Cool the aliquot to 10 ⁵ C. After the amplification, add to 2 μΙ of PCR product 2 μΙ of loading buffer and make an electrophoresis in a 2% agarose gel in 0.5x TBE buffer, stained with SYBRsafe 1 x. Run the gel for 30 minutes at 100V in 0.5x TBE buffer, and load in a lateral well next to the PCR product 2 μΙ of 10Opb DNA marker as standard for band size. I. Genotyping reaction

Prepare a 96-well Q96 plate with 20 μΙ hybridization buffer, and with the following combinations of sequencing oligos:

Program the dispensing order: (a) Pocilio A1 + A2, SEQ ID NO: 6 (GTCTCATGA) (b) Pocilio A3 + A4, SEQ ID NO: 7 (GCTGATAT) (c) Pocilio A5 + A6, SEQ ID NO: 8 (GCTAGCTCGATGA). Add 40 μΙ of binding buffer and 4 μΙ of sepharose streptavidin to each PCR product. Shake it for 5 minutes. In the workstation of the Q96 the DNA chains are separated and then the single chain template is added to the plate of the Q96. Incubate at 80 ⁵ C for 2 minutes and cool to room temperature. Now start the genotyping program. C. Results

I. Amplification Reaction

FIG. 3 shows the results of the agarose gel. 30ng of template DNA was loaded onto the agarose gel together with a control without template DNA (NTC), where 10 µΙ of PCR product was mixed with 2 µΙ of loading buffer and ran on a 2% agarose gel in TBE 0.5x to 100V for 30 minutes. The theoretical size of the PCR product is 246bp

II. Genotyping reaction

FIG. 4 shows the overall quality of pyrosequencing reactions. (a) Wells A1 and A2 correspond to the single-stranded PCR product with oligo sequencing 1. (b) Wells A3 and A4 correspond to the single-stranded PCR product with sequencing oligo 2. (c) Wells A5 and A6 correspond to the single-stranded PCR product with oligos sequencing 1 and 2 at equimolar concentrations. The blue circles represent the high quality of the sequence obtained.

FIG. 5 represents the pyrograms of SNP simple and multiplex genotyping. The first pyrogram represents the resulting peaks when the sequencing oligo 1 is added to the template DNA. The second pyrogram represents the resulting peaks when oligo sequencing 2 is added to the template DNA. The third pyrogram represents the resulting peaks when the oligos of sequencing 1 and 2 are added at equimolar concentrations. The peaks determine the incorporation of each new additional dexosinucleotide.

FIG. 6 shows the genotypic results obtained for the template DNA, (a) Wells A1 and A2 correspond to the single stranded PCR product with the sequencing oligo 1. (b) Wells A3 and A4 correspond to the single-stranded PCR product with the sequencing oligo 2. (c) Wells A5 and A6 correspond to the single-stranded PCR product with the sequencing oligos 1 and 2 at equimolar concentrations. Consequently, any person skilled in the art understands that in wells from A1 to A4 where only one SNP was genotyped and the result of a single genotype is shown. The multiplex reactions shown in wells A5 to A6 give two results, of course.

D. Discussion

The image described in FIG. 3 shows that the amount of PCR product produced is approximately equivalent as long as 30ng of template DNA is added to the reaction. Slight differences appear due to errors in the pipetting, during the assembly of the PCR, or when the gel is loaded. In addition, the control without template DNA (NTCs) shows some signals that occur as a result of a residual signal from the PCR product loaded into the adjacent well in the gel or due to aerosol formation during PCR assembly. In any case, the difference between PCR reactions and controls without template DNA is evident. Since the amount of PCR products is very similar, any difference in genotyping results is due to simple versus multiple genotyping methods. The quality of the PCR products remains similar in all cases and is not variable, which is evident to one skilled in the art. The results illustrated in FIG. 4 show high quality data in genotyping reactions as expected. The blue circles appear to confirm the high quality obtained. A reaction failure would have been indicated by a red circle and a poor quality result. The inconsistency between the reference sequence and the results obtained or poor signal / noise ratios would have appeared yellow. It is clear to one skilled in the art, that all reactions in this case pass the quality test regardless of the number of sequencing oligos added.

The image illustrated in FIG. 5 describes the resulting pyrograms obtained. Well-defined peaks appear at the expected positions, coinciding with the reference sequence, (a) the first pyrogram was obtained from the genotyping reaction where only oligo sequencing 1 was used. (b) the second pyrogram was obtained from the genotyping reaction where only the sequencing oligo 2 was used. (c) the third pyrogram was obtained from the genotyping reaction where the sequencing oligos 1 and 2 were used The resulting pyrogram of the multiplex genotyping corresponds to the sequences obtained with the sequencing oligo 1 superimposed with the sequence obtained with the sequencing oligo. 2. The two polymorphic bases present a great approximation with the results of simple reactions.

The results illustrated in FIG. 6 describe the genotypes obtained by multiple sequencing according to the genotypes obtained by simple sequencing. The genotype of SNP 1 is shown in wells A1, A2, A5 and A6 with position 1, and is T / T in all cases. While the genotype of SNP 2 is shown in wells A2 and A3 with position 1 and in wells A5 and A6 with position 2. Therefore, the result of the same genotypes from both single genotyping and multiple genotyping is shown. . Therefore, it is apparent to any person skilled in the art that it is possible to obtain genotype data related to multiple SNPs using multiple sequencing oligos with the same single stranded template DNA.

Example 2:

 TCF7L2 MULTIPLEX PCR, MULTIPLEX GENOTIPATE A. Material

The TCF7a gene contains two SNPs, Rs12255372 and Rs7903146, which are associated with damage to sulfonylurea metabolism. These SNPs are linked in equilibrium and are separated by more than 50,000 bases of coding and non-coding sequence. The following amplification oligonucleotides are designed to generate a 278 bp amplicon and a 246 bp amplicon. The 278 bp amplicon uses (i) an 18-base unmodified forward oligonucleotide and (ii) a 21-base reverse-biotinylated oligonucleotide. The forward oligonucleotide has a theoretical alignment temperature of 56.9 ⁵ C and the reverse oligonucleotide has an alignment temperature of 57.9 ⁵ C. The optimal reaction alignment temperature was determined experimentally at 55 ⁵ C. The 246 bp amplicon uses (i ) a 20-base unmodified forward oligonucleotide and (ii) a 20-base reverse-biotinylated oligonucleotide. The forward oligonucleotide has a theoretical alignment temperature of 54.9 ⁵ C and the reverse oligonucleotide has an alignment temperature of 54.9 ⁵ C. The optimal reaction alignment temperature was determined experimentally at 55 ⁵ C. The two SNPs are read by the 16 base sequencing oligonucleotide 1, which hybridizes from the third base prior to Rs1081 1661 and has a alignment temperature of 53.3 ⁵ C, and the 19 base sequencing oligonucleotide 2, which hybridizes from first base prior to Rs10757283 and has an alignment temperature of 48.1 ⁵ C.

When used individually, the sequencing oligonucleotide 1 reads the sequence SEQ ID NO: 9 (AATKACCATA) with the dispensing order SEQ ID NO: 10 (GATGACAT), and the sequencing oligonucleotide 2 reads the sequence SEQ ID NO: 1 1 (AYTATATAATTTAATTGCCGTATGAGG) with the dispensing order SEQ ID NO: 12 (GACTGATAT). In multiplex mode the sequences are read in the order of dispensing SEQ ID NO: 13 (GACTGCATACA).

B. Methods I. Amplification reaction

A reaction mixture is prepared with the amplification oligonucleotides of TCF7L2. To this reaction mixture is added 3 μΙ of DNA polymerase enzyme, manufactured by Biotools Biotechnological & Medical Laboratories SA, 5 μΙ of reaction buffer that is sold together with the enzyme, between 0.1 μΙ and 0.3 μΙ of a 10mM solution containing the four deoxyribonucleotides that make up the deoxyribonucleic acid chain (dATP, dTTP, dGTP, dCTP) and between 0.2 μΙ and 0.5 μΙ of a 10 μΜ solution of the pair (four in total) of amplification oligonucleotides described in the materials section for generate a 278 bp amplicon and a 246 bp amplicon in a single multiplex amplification reaction. Each amplicon contains SNP Rs12255372 and SNP Rs7903146 respectively.

Prepare volume for triplicate aliquots of 47.0 μΙ. Also add 3.0 μΙ of 10ng / μΙ template DNA or Milli-Q water. Incubate at 95 ⁵ C for 3 minutes; at 95 ⁵ C 20 seconds, at 55 ⁵ C 20 seconds, at 72 ⁵ C 30 seconds for approximately 45 cycles. Incubate at 72 ⁵ C for 5 minutes. Cool the aliquot to 10 ⁵ C. After completion of amplification, add to 2 μ PCR of PCR product 2 μΙ of orange loading buffer and make an electrophoresis in a 2% agarose gel in 0.5x TBE buffer, stained with SYBRsafe 1 x . Run the gel for 30 minutes at 100V in 0.5x TBE buffer, and load in a lateral well next to the PCR product 2 μΙ of 10Opb DNA marker as standard for band size. II. Genotyping reaction

Prepare a 96-well plate Q96 with 20 μΙ hybridization buffer, and following combinations of sequencing oligos:

Program the dispensing order: (a) Pocilio B1 +2, SEQ ID NO: 14 (GATGACAT) (b) Pocilio B3 + A, SEQ ID NO: 15 (GACTGATAT) (c) Pocilio B5 + 6, SEQ ID NO: 16 (GACTGCATACA). Add 40 μΙ of binding buffer and 4 μΙ of sepharose streptavidin to each PCR product. Shake it for 5 minutes. In the workstation of the Q96 the DNA chains are separated and then the single chain template is added to the plate of the Q96. The plate is incubated at 80 ⁵ C for 2 minutes and allowed to cool to room temperature. Put the genotyping program into operation.

C. Results

I. Amplification Reaction

FIG. 7 Shows the results of the agarose gel. 30ng 2% agarose gel was loaded onto the template DNA together with a control without template DNA (NTC). Each PCR replica should have approximately equivalent amounts of the PCR products. The theoretical sizes of the PCR products are 278pb and 246pb.

I. Genotyping reaction

FIG. 8 Shows the overall quality of pyrosequencing reactions. (a) Wells B1 and B2 contain two single chain PCR products only with oligo 1 sequencing. (b) Wells B3 and B4 contain two single chain PCR products only with oligo 2 sequencing. (c) Wells B5 and B6 contain two single chain PCR products with oligo 1 and 2 sequencing at equimolar concentrations. The blue circles represent the high quality of the sequence obtained. FIG. 9 represents the pyrograms of SNP simple and multiplex genotyping. The first pyrogram represents the resulting peaks when oligo 1 sequencing is added to the template DNA. The second pyrogram represents the resulting peaks when oligo 2 sequencing is added to the template DNA. The third pyrogram represents the resulting peaks when sequencing oligos 1 and 2 are added at equimolar concentrations to the template DNA. The peaks determine the incorporation of each new additional dexosinucleotide.

FIG. 10 shows the genotypic results obtained for the template DNA, (a) Wells B1 and B2 contain two single chain PCR products only with oligo 1 sequencing. (b) Wells B3 and B4 contain two single chain PCR products only with oligo 2 sequencing. (c) Wells B5 and B6 contain two single chain PCR products with oligo 1 and 2 sequencing at equimolar concentrations. Consequently, any person skilled in the art understands that in wells B1 to B4 a single SNP was genotyped since only one genotype is shown. The multiplex sequencing reactions shown in wells B5 and B6 clearly yield two results.

D. Discussion

The image described in FIG. 7 shows that the amount of PCR product produced is approximately equivalent as long as 30ng of template DNA is added to the reaction. Slight differences appear due to errors in the pipetting, during the assembly of the PCR, or when the gel is loaded. In addition, the control without template DNA can give signal drawn from the PCR product loaded into the adjacent well in the gel or by aerosol formation during PCR assembly. The signal strength of the PCR product may be such that it is difficult to distinguish between the 278 bp PCR product and the 246 bp PCR product, however this seems to be uniform for both reactions in all wells. In any case, the difference between the PCR reaction and the control without template DNA is evident. Since the amount of PCR products is very similar, any difference in genotyping results is due to simple versus multiple genotyping methods. The quality of the PCR products remains similar in all cases and is not variable, which is evident to one skilled in the art. The results illustrated in FIG. 8 show high quality data in genotyping reactions as expected. The blue circles appear to confirm the high quality. A failure in the reaction is indicated by a red circle and means low quality. The inconsistency between the reference sequence and the results obtained or a poor signal ratio appears yellow. All reactions in this case pass the quality test regardless of the number of sequencing oligos that were added.

The image illustrated in FIG. 9 describes the pyrograms obtained. Well defined peaks appear in the expected positions, coinciding with the reference sequence, (a) the first pyrogram was obtained from the genotyping reaction using only oligo 1 sequencing. (b) the second pyrogram was obtained from the genotyping reaction using only oligo 2 sequencing. (c) the third pyrogram was obtained from the genotyping reaction using oligos 1 and 2 sequencing. The pyrogram resulting from multiple genotyping corresponds to the sequences obtained with the sequencing oligo 1 superimposed with the sequence obtained with the sequencing oligo 2. The two polymorphic bases present a great approximation with the results of simple reactions.

The results illustrated in FIG. 10 describe the genotypes obtained by multiple sequencing according to the genotypes obtained by simple sequencing. The genotype of SNP 1 is shown in wells B1, B2, B5 and B6 with position 1, and is G / G in all cases. While the genotype of SNP 2 is shown in wells B2 and B3 with position 1 and in wells B5 and B6 with position 2, and is T / C in each case.

This illustrates that with both simple genotyping and multiple genotyping the results of the genotypes obtained are the same. Then, from the results above, a person skilled in the art would be able to obtain genotype information from several SNPs using multiple sequencing oligos with the same single stranded template DNA.

Example 3:

TCF7L2: MULTIPLEX GELIFIED PCR, MULTIPLE GENOTIPATE WITH GELIFIED SEQUENCING OLIGONUCLEOTIDES Introduction:

This example reproduces Example 2 using the gelation process applied to multiplex PCR reactions and sequencing oligos used for multiple genotyping.

A. Materials See section A. Materials (Example 2).

B. Methods

I. Amplification Reaction

A reaction mixture is prepared with the amplification oligonucleotides of TCF7L2. This reaction mixture is composed of DNA polymerase enzyme at a final concentration of 6 U, manufactured by Biotools Biotechnological & Medical Laboratories SA, reaction buffer that is marketed together with the enzyme at a final concentration of 1 X, the four dexosiribonucleotides that form the dexosiribonucleic acid chain (dATP, dTTP, dGTP, dCTP) at a final concentration between 200 μΜ and 250 μΜ each and a solution at a final concentration between 75 nM and 150 nM each of: i) the two pairs (four oligos in total) of amplification oligos described in the materials section to generate at the same time in a multiplex amplification reaction a 278bp amplicon and a 246bp amplicon. Each amplicon contains SNP Rs12255372 and SNP Rs7903146 respectively, ii) the pair of amplification oligonucleotides individually for the simple PCR reactions corresponding to the amplification of SNP Rs12255372 and SNP Rs7903146 independently. The reaction mixtures (both simple and multiplex) are stabilized by the gelation process. In particular a gelation mixture composed of trehalose, melezitose, glycogen and lysine is added to the reaction mixtures described above which contain all the reagents necessary to carry out the PCR reactions. The gelation process is completed after drying under vacuum conditions and at a temperature below 40 ⁵ C, resulting in a stabilized reaction mixture containing between 10% and 30% water. 47μΙ of Milli-Q water and 3 μΙ of TaqMan Human Control DNA at a concentration of 10ng / μΙ are dispensed into each of the gelled tubes. Incubate at 95 ⁵ C for 5 minutes. Then incubate at 95 ⁵ C for 20 seconds, at 55 ⁵ C for 20 seconds and at 72 ⁵ C for 40 seconds for approximately 45 cycles. Additionally incubate at 72 ⁵ C for 5 minutes. Cool the aliquot to 10 ⁵ C. After the amplification, add to 2 μΙ of PCR product 2μΙ of loading buffer and make an electrophoresis in a 2% agarose gel in 0.5X TBE buffer, stained with SYBRsafe 1 x. Run the gel for 30 minutes at 100V in 0.5x TBE buffer, and load in a lateral well next to the PCR product 2 μΙ of 100 bp DNA marker as standard for the band size. II. Genotyping reaction

The two sequencing oligos were stabilized by the gelation process following the same protocol described above for the PCR reaction mixture.

The gelled oligos are re-hydrated with 85 μΙ of Milli-Q water. Prepare a 96 Q96 plate with 20 μΙ hybridization buffer, and with the following combinations of sequencing oligos:

Program the dispensing order: (a) Well C1 + 2 + 3, SEQ ID NO: 14 (GATGACAT) (b) Well C4 + 5 + 6, SEQ ID NO: 15 (GACTGATAT) (c) Well C7 + 8 + 9, SEQ ID NO: 16 (GACTGCATACA). Add 40μΙ of binding buffer and 4μΙ of sepharose streptavidin to each PCR product. Shake it for 5 minutes. In the workstation of the Q96 the DNA chains are separated and then the single chain template is added to the plate of the Q96. Incubate at 80 ⁵ C for 2 minutes and cool to room temperature. Now start the genotyping program. C. Results I. Amplification Reaction

FIG. 1 1 shows the results of the agarose gel. 10 μΙ of the simple PCR products were loaded on the 2% agarose gel. Each replica of the PCR reaction must contain approximately equivalent amounts of PCR product. The expected product sizes are 278bp and 246bp.

FIG. 12 shows the results of the agarose gel. 10 μΙ of the products of the multiplex PCR reaction were loaded on the 2% agarose gel. Each replica of the PCR reaction must contain approximately equivalent amounts of PCR product. The expected product sizes are 278bp and 246bp, although with a 2% agarose gel it is not possible to distinguish between these two bands individually.

II. Genotyping reaction

FIG. 13 shows the overall quality of pyrosequencing reactions. (a) Wells C1, C2 and C3 correspond to the two single-stranded PCR products obtained only with oligo sequencing 1. (b) Wells C4, C5 and C6 correspond to the two single-stranded PCR products obtained only with the sequencing oligo 2. (c) Wells C7, C8 and C9 correspond to the two single-stranded PCR products obtained with a mixing at equimolar concentration of the oligos of sequencing 1 and 2. The blue circles represent the high quality of the sequence obtained.

FIG. 14 shows the genotypic results obtained for the template DNA, (a) Pocilios C1, C2 and C3 correspond to the two single-stranded PCR products obtained with only the oligo of sequencing 1. (b) C4, C5 and C6 wells correspond to the two single stranded PCR products obtained with only sequencing oligo 2. (c) C7, C8 and C9 wells correspond to the two single stranded PCR products obtained with a mixing at equimolar concentrations of the oligos of sequencing 1 and 2. Consequently, any person skilled in the art understands that in the wells of C1 to C6 where only one SNP was genotyped, the result of a single genotype is shown. The multiple genotyping reactions shown in wells C7, C8 and C9 give two results, of course.

D. Discussion The image described in FIG. 1 and FIG. 12 shows that the amount of PCR product produced is approximately equivalent as long as 30 ng of template DNA is added to the gelled simple reaction (FIG. 1 1) and to the gelled multiplex reaction. (FIG. 12). Slight differences appear due to errors in the pipetting, during the assembly of the PCR, or when the gel is loaded. The signal strength of the PCR products is such that it is difficult to distinguish between the band of the PCR product of 278bp and the band of the PCR product of 246bp however a uniformity is maintained between the products obtained in the simple reaction and in the multiplex in all wells. Since the amount of PCR products remains very similar, any difference in genotyping results is due to simple versus multiple genotyping methods. The quality of the PCR products remains similar in all cases and is not variable, which is evident to one skilled in the art.

The results obtained in FIG. 13 show high quality data in genotyping reactions as expected. The blue circles appear to confirm the high quality obtained. A reaction failure would have been indicated by a red circle and a poor quality result. The inconsistency between the reference sequence and the results obtained or poor signal / noise ratios would have appeared yellow. It is clear to one skilled in the art that all reactions in this case pass the quality test regardless of the number of gelled sequencing oligos added. The results illustrated in FIG. 14 describe the genotypes obtained by multiple sequencing in accordance with the genotypes obtained by simple sequencing. The genotype of SNP 1 is shown in wells C1, C2, C3, C7, C8 and C9 with position 1, and is GG / in all cases. While the genotype of SNP 2 is shown in wells C4, C5 and C6 with position 1 and wells C7, C8 and C9 with position 2 and is T / C in all cases.

Then, it is clear that the results of single and multiple genotyping are the same.

Therefore, it is apparent to any person skilled in the art that it is possible to obtain genotype data related to multiple SNPs using multiple sequencing oligonucleotides gelled with the same single stranded template DNA. Example 4 EmbB: PCR, MULTIPLE SEQUENCE GENOTIPATE A. Introduction

Mutations in the EmbB gene can result in strains of Mycobacterium ethambutol-resistant. There are two regions in the EmbB gene that appear to be critical targets for ethambutol activity. These two regions of the EmbB gene are separated by approximately 300 DNA bases. These two regions can be amplified by a simple PCR reaction generating a product of more than 300bp. Both regions are small, covering a maximum of 3 bases, and are likely to be sequenced by microsequencing techniques. Microsequencing normally yields information on 40 base sequences with good quality, so that both regions related to ethambutol resistance within the EmbB gene should be sequenced with two sequencing oligos individually. The conventional method for sequencing the two regions of the EmbB gene mentioned would involve carrying out the same PCR reaction twice for each sample, and sequencing the two products with different sequencing oligos independently. With the conventional method it is clear that two PCR reactions and two sequencing reactions are needed. In order to reduce the cost per sample, both in economic terms and in terms relative to the volume of sample needed, it would be preferable to make a single PCR reaction and a single sequencing reaction to read both sequences at the same time. This method would reduce the costs of the test and reduce the workload necessary to complete said test, as well as allow a greater number of samples to be sequenced at the same time.

The fundamental difference between the simple conventional protocol and the multiple sequencing protocol is that in the latter case only a single PCR reaction to cover both regions and a single sequencing reaction would be carried out to solve both sequences simultaneously. A total coverage of the two regions related to ethambutol resistance is obtained by using two sequencing oligonucleotides in a single sequencing reaction. The resulting sequence is an overlap of the sequences read by each of the sequencing oligonucleotides. This overlapping sequence can be predicted by knowing all possible combinations of mutations. sought and the order in which dexosinucleotides are dispensed during the sequencing reaction.

To demonstrate that multiple genotyping of sequences is possible, DNA from a wild-type Mycobacterium fortuitum reference strain was amplified using gelled reagents. After two rounds of PCR amplification, the sample is sequenced individually with the gelled TB2a and TB2b sequencing oligos and is also sequenced in a single reaction with a mixture of the two gelled TB2a and TB2b oligos. The same information is generated both with the multiple sequencing reactions that contain the gelled sequencing oligos and with the two simple sequencing reactions each containing one of the gelled sequencing oligos.

B. Methods

DNA isolated from a wild reference strain of Mycobacterium fortuitum is prepared at a concentration of 10 ng / μΙ. This DNA is previously characterized and the sequence of the EmbB gene in the wild strain is confirmed. The colonies from which this DNA is obtained grew under standard Mycobacterium culture conditions and their growth was inhibited by the presence of ethambutol. Growth inhibition in the presence of ethambutol as well as DNA sequencing undoubtedly confirms that this DNA does not contain mutations in any of the two regions of the EmbB gene studied in this experiment. The DNA is stored at 4 ⁵ C at high concentration and diluted to a concentration of 10ng / μΙ just before use.

I. Pre-amplification reaction

In this particular experiment, a pre-amplification reaction was made to enrich the PCR templates used to amplify the regions related to ethambutol resistance. Although this is not essential since in this experiment the concentration of the isolated DNA is known, it is considered that it should be a standard step in the protocol when working with unknown samples, in which the quality and quantity of DNA in the cells is normally unknown. same. This step in this experiment is done to demonstrate that the pre-amplification phase does not interfere with the sequencing reaction either in its simple mode or in its multiple mode. The pre-amplification reaction mixture consists of 511 of ultrapure DNA polymerase enzyme, manufactured by Biotools Biotechnologial & Medical Laboratories SA, reaction buffer at a final concentration 1 x that is marketed together with the enzyme, between 200μηι and 250μΜ concentration final of each of the four dexosiribonucleotides that form the dexosiribonucleic acid chain (dATP, dTTP, dGTP, dCTP), and between 50nM and 75nM final concentration of each of the amplification oligonucleotides designed for pre-amplification of the EmbB target gene . These amplification oligonucleotides included in the pre-amplification reaction are not biotinylated and cannot be used for sequencing. They are used only to improve the amount of template DNA available for the subsequent amplification reaction. The pre-amplification reaction mixture including all the reagents described above is stabilized by the gelation process. In particular a gelation mixture composed of trehalose, melezitose, glycogen and lysine is added to the reaction mixture described above which contains all the reagents necessary to carry out the pre-amplification PCR reaction. The gelation process is completed after drying under vacuum conditions and at a temperature below 40 ⁵ C, resulting in a stabilized reaction mixture containing between 10% and 30% water.

42μΙ of Milli-Q water and 3 μΙ of Mycobacterium fortuitum DNA at a concentration of 10ng / μΙ are dispensed into each of the gelled tubes. Incubate at 95 ⁵ C for 5 minutes. Then incubate at 95 ⁵ C for 20 seconds, at 58 ⁵ C for 20 seconds and at 72 ⁵ C for 40 seconds for 10 cycles. Additionally incubate at 72 ⁵ C for 5 minutes. Cool the aliquot to 10 ⁵ C.

II. Amplification Reaction

Following the pre-amplification reaction, a gelled PCR reaction is prepared to amplify the two regions of the EmbB gene related to ethambutol resistance. This reaction includes all the reagents necessary to amplify a 409bp region of the EmbB gene that incorporates the two mutation points related to ethambutol resistance. The reverse amplification oligonucleotide TB2 is biotinylated to allow separation of the strands of the PCR product obtained and thus have a single stranded template DNA for sequencing. The PCR reaction is carried out 9 times so that the PCR product obtained can be sequenced three times with the TB2a gelled sequencing oligo, three times with the TB2b gelled sequencing oligo and three times with the mixture of both TB2a and Tb2b sequenced oligos gelled in a multiplex format. The composition of the mastermix is composed of 5U of ultrapure DNA polymerase enzyme, manufactured by Biotools Biotechnologial & Medical Laboratories SA, reaction buffer at a final concentration 1 x that is marketed together with the enzyme, between 200μηι and 250μΜ final concentration of each of the four dexosiribonucleotides that form the dexosiribonucleic acid chain (dATP, dTTP, dGTP, dCTP), and between 100nM and 200nM final concentration of each of the amplification oligonucleotides designed for amplification of the EmbB target gene. The amplification reaction mixture including all the reagents described above is stabilized by the gelation process. In particular a gelation mixture composed of trehalose, melezitose, glycogen and lysine is added to the reaction mixture described above which contains all the reagents necessary to carry out the amplification PCR reaction. The gelation process is completed after drying under vacuum conditions and at a temperature below 40 ⁵ C, resulting in a stabilized reaction mixture containing between 10% and 30% water.

42μΙ of Milli-Q water and 3 μΙ of product resulting from the amplification are dispensed into each of the 9 gelled TB2 tubes. Incubate at 95 ⁵ C for 5 minutes. Then incubate at 95 ⁵ C for 20 seconds, at 58 ⁵ C for 20 seconds and at 72 ⁵ C for 40 seconds for 35 cycles. Additionally incubate at 72 ⁵ C for 5 minutes. Cool the aliquot to 10 ⁵ C.

Once the amplification is finished, 10 μΙ of PCR product is mixed with 2 μΙ of loading buffer and electrophoresis is performed on a 2% agarose gel in 0.5X TBE buffer, stained with 1 x SYBRsafe. Run the gel for 30 minutes at 100V in 0.5x TBE buffer, and load in a lateral well next to the PCR product 2 μΙ of 100 bp DNA marker as standard for the band size.

III. Genotyping

Two sequencing oligos are used to cover the two regions of the Mycobacterium EmbB gene related to ethambutol resistance, these oligos are TB2a and TB2b. The sequencing oligo TB2a covers the resistance mutations Met306Val, Met306Leu, and two mutations Met306lle (one is the substitution of G by T and the other is the substitution of G for A) and read SEQ ID NO: 17 (CATGGCCCG AGTCGCCG ACCACGCC) ■ The sequencing oligo TB2b covers the resistance mutations Arg406Cys, Arg406Ser, Arg406Ala, and Arg406Asp and reads SEQ ID NO: 18 (CCGGAGGGCATCATCGCGCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCAT . The mixture of both oligo of sequencing TB2a and TB2b in the multiple genotyping sequence mode reads SEQ ID NO: 19

(CCCATGGGGCCCAGGGGCAATGCATTCCGGCCCGGCATCCCAGGCCTGCCC).

The remaining product of the PCR reaction is used to prepare single stranded DNA for pyrosequencing. 44μΙ of a 10: 1 mixture of binding buffer and streptavidin sepharose are added to the PCR products and mixed for 5 minutes. The mixture is then aspirated on the filters of the Q96 vacuum work station and immersed in 70% ethanol, denaturation buffer and wash solution all under vacuum conditions. The resulting single strand of DNA is dispensed in a multi-well plate Q96 containing 20μΙ of hybridization buffer and 3μΙ of sequencing oligonucleotides at 10μΜ concentration (once they have been re-hydrated by adding 100μΙ of Milli-Q water to its gelled form) in the case of simple reactions, or 3μΙ of the mixture of sequencing oligos at a concentration of 10μΜ (once they have been re-hydrated by adding 100μΙ of Milli-Q water to its gelled form) in the case of multiple reactions.

The multiwell plate Q96 already containing single stranded DNA, oligonucleotides and annealing buffer is then sequencing incubated at 80 ⁵ C for 2 minutes and then cooled to room temperature. While the samples are cooling, the Q96ID pyrosequencer is programmed including the names of the samples, the choice of the cartridge as well as the dispensing order, which in this case are 10 TGCA dispensations. Deoxynucleotides, enzyme mixing and substrate mixing are then added to the cartridge in the volumes indicated by the program and thus sequencing begins.

C. Results

I. Amplification Reaction FIG. 15 shows the results of the agarose gel. 10 μΙ of the PCR product was run on a 2% agarose gel. Each replication of the PCR reaction must contain approximately equivalent amounts of the PCR product. The theoretical size of the PCR product is 409bp

II. Genotyping reaction FIG. 16 shows the overall quality of pyrosequencing reactions. The blue circles represent the high quality of the sequence obtained.

Table 1 shows the sequence data obtained by using the oligo of sequencing of the EmbB gene in its simple mode. The reference sequence for this region of the EmbB gene of Mycobacteríum fortuitum is shown in black, with sites related to the mutation responsible for ethambutol resistance underlined. The text below shows the high quality of the sequence data obtained in the three sequencing replicas carried out with the oligos TB2a and TB2b separately.

Sequence Data - Simple EmbB

SEQ ID: NO 20 CATGGCCCGAGTCGCCGACCACGCC SEQ ID: NO 20 Simple 1 CATGGCCCGAGTCGCCGACCACGCC SEQ ID: NO 20 Simple 2 CATGGCCCGAGTCGCCGACCACGCC SEQ ID: NO 20 Simple 3 CATGGCCCGAGTCGCCGACCACGCC

SEQ ID: NO 21 CCGGAGGGCATCATCGCGCTCGGCTC SEQ ID: NO 21 Simple 1 CCGGAGGGCATCATCGCGCTCGGCTC

SEQ ID: NO 21 Simple 2 CCGGAGGGCATCATCGCGCTCGGCTC

SEQ ID: NO 21 Simple 3 CCGGAGGGCATCATCGCGCTCGGCTC

Table 2 shows the sequence data obtained, in triplicate, using the EmbB sequencing oligos in their multiple mode. The upper lines of the text show the expected multiple sequence, the sequence obtained with the sequencing oligo TB2a is shown in red and the sequence obtained with the sequencing oligo TB2b is shown in blue. The underlined bases show the positions where they are located sites related to mutation related to ethambutol resistance. Below the expected sequence, the sequence data obtained for the three replicates of the multiple sequencing reactions are shown. The color code to indicate the sequence quality is, blue for high quality sequences, orange if the sequence quality is acceptable and red if the sequence is of poor quality. Sequence Data - Multiple EmbB

SEQ ID: NO 22

 CCCATGGGGCCCAGGGGCAATGCATTCCGGCCCGGCATCCCAGGCCTGCCC SEQ ID: NO 22 multiple 1

 CCCATGGGGCCCAGGGGCAATGCATTCCGGCCCGGCATCCCAGGCCTGCCC SEQ ID: NO 22 multiple 2

 CCCATGGGGCCCAGGGGCAATGCATTCCGGCCCGGCATCCCAGGCCTGCCC

SEQ ID: NO 22 multiple 3

 CCCATGGGGCCCAGGGGCAATGCATTCCGGCCCGGCATCCCAGGCCTGCCC D. Discussion The image depicted in FIG. 15 shows that the amount of PCR product produced when 10μΙ of PCR product is added to the reactions is equivalent in all PCR reactions. Slight differences appear due to errors in the pipetting, during the assembly of the PCR, or when the gel is loaded. The expected size of the band, 409 bp is achieved in all reactions. In no case the difference between the PCR reactions is apparent. The quality of the PCR products remains similar in all cases and is not variable, which is evident to one skilled in the art.

The results illustrated in FIG. 16 show high quality data in the genotyping reactions of sequences as expected. The blue circles appear to confirm the high quality obtained. A reaction failure would have been indicated by a red circle and a poor quality result. The inconsistency between the reference sequence and the results obtained or poor signal / noise ratios would have appeared yellow. It is evident to an expert in the field that all reactions in this case pass the quality test regardless of the number of sequencing oligos added.

The results obtained in Table 1 show that the two simple sequencing reactions yield the expected reference sequences with high quality.

The results illustrated in Table 2 show that the multiple sequencing mode is possible through the use of a single sequencing reaction and that the information that can usually only be obtained with two microsequencing reactions is achieved with the genotyping of multiple mode sequences. . The sequence obtained through the multiple mode can be foreseen in advance and generate consistent results. Then, it is evident that the same genotypic sequences are obtained as a result of both sequencing in its single and multiple mode.

Therefore, it is apparent to any person skilled in the art that it is possible to obtain genotype data relating to multiple sequences using multiple sequencing oligonucleotides gelled with the same single stranded template DNA. While the present invention has been shown and described in particular with reference to the exemplary embodiments reported, it will be understood by any person skilled in the art that various changes in form and details can be made without this implying a modification or spirit nor of the scope of the present invention as defined by the following claims:

Claims

A method for the determination of the genotype of multiple sequences of interest, wherein said method comprises the following steps:

 a) amplification of at least one or more target sequences of a sample to produce an amplified product, wherein said target sequence comprises at least one or more sites of the sequence of interest; Y

 b) genotyping said amplified product with a mixture of sequencing oligonucleotides simultaneously, wherein said mixture comprises at least one sequencing oligonucleotide for each of said sequences of interest.

Method according to claim 1, wherein said amplification step amplifies multiple sequences of interest on a single target sequence wherein said sequences of interest are located at a distance less than or equal to 1 kb from each other in said sample. .

Method according to any of the preceding claims, wherein said amplification step amplifies multiple sequences of interest on multiple target sequences wherein said sequences of interest are located at a distance greater than 1 kb from each other.

Method according to any of the preceding claims, wherein said amplification is carried out by polymerase chain reaction (PCR). 5. Method according to any of the preceding claims, wherein said polymerase chain reaction is a simple polymerase chain reaction when said multiple sequences of interest are located maximum 1 kb from each other. Method according to any of the preceding claims, wherein said polymerase chain reaction is a multiplex polymerase chain reaction when said multiple sequences of interest are located at a distance greater than 1 kb from each other.

Method according to any of the preceding claims, wherein said multiplex polymerase chain reaction uses amplification oligonucleotides that are used under the same reagent concentrations, alignment temperatures and extension times, wherein said amplification oligonucleotides are assemblies. of oligonucleotides that are completely or partially specific to the outer end or limits of the target sequence without sharing in any homology with the alignment region.

Method according to any of the preceding claims, wherein said amplification step uses at least one pair of amplification oligonucleotides corresponding to each of the target sequences to be amplified.

9. Method according to any of the preceding claims, wherein at least one amplification oligonucleotide of which constitute the amplification oligonucleotide pair is biotinylated.

10. Method according to any of the preceding claims, wherein said amplification reaction is characterized by the use of gelled amplification reagents to produce amplified products.

eleven . Method according to any of the preceding claims, wherein said target sequence comprises at least one sequence of interest and an adjacent DNA sequence.

12. Method according to any of the preceding claims, wherein said amplified product is biotinylated.

13. Method according to any of the preceding claims, wherein said amplified product comprises multiple sequences of interest.

14. Method according to any of the preceding claims, wherein said genotyping is carried out by using the pyrosequencing method.

 15. Method according to any of the preceding claims, wherein during said genotyping step, the sequence adjacent to said multiple sequences of interest and the sequence including said multiple sequences overlap.

16. Method according to any of the preceding claims, wherein the amplification step a) is carried out in a simple amplification reaction and the genotyping step b) is carried out in a single multiplex genotyping reaction.

17. Method according to any of the preceding claims wherein the genotyping reaction is carried out simultaneously to the amplification reaction.

18. Method according to any of the preceding claims wherein the sequences of interest are single nucleotide polymorphism sites (SNPs).

19. Kit comprising: i) all the necessary reagents dosed at the optimum concentrations for the generation of a single or multiplex amplification reaction of the pre-mixed and stabilized targets of interest by the gelation process and ii) sequencing oligonucleotides for multiplex genotyping of the sequences of interest which are stabilized by the gelation process, for use in the method of claims 1 to 18.