WO2012178136A2 - Fusion proteins of bacterial luciferase as multicolor luminescent sensors - Google Patents
Fusion proteins of bacterial luciferase as multicolor luminescent sensors Download PDFInfo
- Publication number
- WO2012178136A2 WO2012178136A2 PCT/US2012/043913 US2012043913W WO2012178136A2 WO 2012178136 A2 WO2012178136 A2 WO 2012178136A2 US 2012043913 W US2012043913 W US 2012043913W WO 2012178136 A2 WO2012178136 A2 WO 2012178136A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- luciferase
- ofp
- sensor system
- fluorescent protein
- fusion
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/62—DNA sequences coding for fusion proteins
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/60—Fusion polypeptide containing spectroscopic/fluorescent detection, e.g. green fluorescent protein [GFP]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/61—Fusion polypeptide containing an enzyme fusion for detection (lacZ, luciferase)
Definitions
- This disclosure relates in general to the field of luminescent sensors and more particularly to fusion proteins of luciferase as luminescent sensors.
- bacterial luciferase-catalyzed bioluminescence has some unique advantages over other luciferase systems.
- Oxygen and reduced riboflavin 5 '-phosphate (FMNH 2 ) e.g., two of the three substrates required by bacterial luciferase for producing luminescence, are readily available in various cell types.
- the long-chain aldehydes may be synthesized by the luxCDE genes in luminous bacteria.
- aldehydes have very high binding affinities for luciferase, with K m below micromolar levels, and due to their highly hydrophobic nature, can easily diffuse through cell membranes for in vivo imaging applications.
- the aldehyde-generating genes may be cloned along with luxAB genes for bacterial luciferase a and ⁇ subunits into the cell systems.
- the codon-optimized Vibrio harveyi luciferase lux genes and the frp gene for flavin reductase P (FRP), which generates FMNH 2 from FMN using NADPH as a reductant, have been successfully expressed in mammalian HEK 293 cells with significant signals for bioluminescence imaging.
- the lux genes have been well characterized, and the structures and reaction mechanisms of bacterial luciferase have also been extensively studied, making bacterial luciferase particularly suitable for serving as a reporting system.
- luciferase a subunit was also subjected to controlled single- to triple-residue mutations for altering the emission spectrum.
- bacterial bioluminescence color in vitro and in vivo, may also be changed by the formation of a non-covalent complex of luciferase with specific fluorescent proteins co-existing in luminous bacteria. These fluorescent proteins include a lumazine protein from Photobacterium phosphoreum and Photobactreum leiognothi, two forms of yellow-fluorescent proteins, and a blue-fluorescent protein from Vibrio fischeri strain Yl.
- compositions and methods for altering the color of luciferase luminescence are known to the art, all, or almost all of them suffer from one or more than one disadvantage and have shortcomings. Therefore a need has arisen for compositions and methods for changing the color of luciferase bioluminescence which corrects the problems identified above, and enables its use in vivo or as part of multi-color sensor systems.
- compositions that are well suited for biological applications including in vitro and in vivo sensing, and enhancement of tissue imaging.
- Another object of the present disclosure is to permit various aspects and embodiments of a luminescent sensor system and its associated methods of use and methods of manufacture.
- the compositions exhibit luciferases from desired luminous bacteria or engineered luciferases as the energy donor, and desired species of fluorescent proteins as the energy acceptor.
- energy donors may generally encompass native or engineered luciferases including, but not limited to: alpha-beta non-fused or fused luciferase or any bacterial luciferase genes which have been modified for expression in eukaryotic cells.
- energy acceptors may include any appropriate fluorescent proteins provided that their absorption spectra overlap somehow with the emission of normal bioluminescence, and that their fluorescence emission spectra are in a wavelength range higher than the normal luciferase bioluminescence.
- fusion of bacterial luciferase with a GFP- type fluorescent protein takes advantage of the proximity between these two partners of the fusion protein to allow the alteration of the luciferase' s original 490-nm emission through bioluminescence resonance energy transfer (BRET) to the fluorescent protein.
- BRET bioluminescence resonance energy transfer
- FIGURE 1 is a graph of exemplary spectra of lucif erase bioluminescence
- FIGURE 2 displays a graph of the time courses of bioluminescence catalyzed by exemplary embodiments in a single turnover reaction.
- FIGURE 3 displays a graph of bioluminescence spectra of the reactions catalyzed by various exemplary embodiments of the present disclosure.
- FIGURE 4 depicts photographic images of the bioluminescence catalyzed by various exemplary embodiments of the present disclosure.
- FIGURE 5 illustrates a table of bioluminescence activities of exemplary embodiments of the present disclosure and those of wild-type luciferases.
- FIGURE 6 illustrates a table of kinetic properties of exemplary embodiments of the present disclosure and those of wild-type luciferases.
- FIGURE 1 is a graph of exemplary spectra of luciferase bioluminescence
- the present disclosure relates to methods for the regulation of the emission spectrum of bacterial luciferase. Additional embodiments of the present disclosure relate to the compositions of fusion enzymes, methods for making the same, and methods for their use.
- the compositions exhibit luciferases from desired luminous bacteria or engineered luciferases as the energy donor, and desired species of fluorescent proteins as the energy acceptor.
- Energy donors may generally encompass native or engineered luciferases including, but is not limited to: alpha-beta non-fused or fused luciferase or any bacterial luciferase genes which have been modified for expression in eukaryotic cells.
- Energy acceptors include any appropriate fluorescent proteins with the requirement that their absorption spectra overlap with the emission of normal bioluminescence, and that their fluorescence emission spectra are in a wavelength range higher than the normal luciferase bioluminescence.
- the benefit of such a composition is that it alters the color of bioluminescence derived from luciferase- catalyzed reactions.
- Embodiments of these compositions are well suited for biological applications including in vitro and in vivo sensing, and enhancement of tissue imaging.
- a variety of fluorescent proteins related to the jellyfish Aequorea green fluorescent protein (GFP) have been developed to exhibit a wide range of fluorescence colors.
- An exemplary embodiment of the present disclosure includes a series of fusion proteins by linking Vibrio harveyi luciferase to Discosoma sp. fluorescent protein mOrange (OFP).
- the normal bioluminescence spectrum of native bacterial luciferase significantly overlaps with the absorption of OFP, and the fluorescence emission peak of OFP is at a longer wavelength than the peak of the luciferase bioluminescence. These properties indicate that OFP may be an appropriate energy acceptor for the energy donor bacterial luciferase.
- the absorption and fluorescence emission spectra of 13 ⁇ OFP in the standard buffer may be determined using an excitation light at 480 nm for the latter measurement.
- the luciferase bioluminescence emission spectrum was measured by the luciferase-FRP coupled assay in 1 mL standard buffer containing 0.5 mM dithiothreitol (DTT), 5.4 ⁇ FRP, 2 mM NADPH, 100 ⁇ decanal, 36 ⁇ FMN, and 0.5 ⁇ luciferase. All spectra may be measured at 23 °C.
- OFP may be fused to any species of bacterial luciferase of choice, for exemplary purposes, the present disclosure describes how OFP interacts with the bacterial luciferase, Vibrio harveyi luciferase.
- V. harveyi NADPH-specific flavin reductase FRP is used to continuously generate the required FMNH 2 substrate, and the resulting emission spectra produced by such fusion enzymes is disclosed. Expansion of this approach includes, for exemplary purposes, the substitution of OFP with any desired fluorescent proteins, or by tagging luciferase with a suitable fluorescent acceptor chromophore.
- Another exemplary embodiment of the present invention discloses the bioluminescence profiles and kinetic properties of fusion enzymes made of wild type luciferase, such as Vibrio harveyi luciferase, and Discosoma sp. fluorescent protein mOrange. These fusion proteins retain wild-type like bioluminescence activities.
- the following plasmids encoding the following fusion enzymes are constructed: OFP-Ls-a:P, OFP-L 5 - :a, :a-L 5 -OFP, a: -L 5 -OFP, and OFP-L 10 -a: .
- OFP is fused to the N- or C-terminus of either the a or ⁇ subunit of bacterial luciferase through a GGGGS five-residue (abbreviated L5) or, in one case, a GGGGSGGGGS 10-residue (abbreviated L 10 ) linker to generate five fusion enzymes.
- GGGGS five-residue abbreviated L5
- GGGGSGGGGS 10-residue abbreviated L 10 linker
- the present disclosure teaches exemplary embodiments capable of generating emissions at wavelengths longer than 490 nm, such as the 560 nm emission by OFP fused to luciferase.
- Both OFP-Ls-a:P and OFP-Lio- : as described herein retain activities similar to that of the wild-type luciferase, and both show a substantial emission component at 560 nm, a 70 nm red shift from the known bacterial bioluminescence.
- These emissions at longer wavelengths suffer from much less absorption and have better efficiencies in penetrating tissues.
- exemplary methods disclosed herein take advantage of BRET mechanics, wherein the energy of emission from the luciferase-fluorescent protein fusion is derived from the luciferase-catalyzed reaction. Since luciferase is a catalytic enzyme, even a trace amount of the fusion enzyme can magnify the output of light by the multiple turnovers of luciferase. In contrast, fluorescent proteins are not enzymes and, hence, cannot magnify light output by catalytic turnovers. Any low levels of fluorescent proteins can only produce low levels of fluorescence signals, which would be highly distorted by any excitation lights used to generate emissions from the fluorescent proteins alone.
- an extension of the present disclosure consists in using the methods for OFP described herein to alter the bacterial luciferase bioluminescence spectrum by fusing luciferase with either other fluorescent proteins (GFP-related or not), or by chemically attachment of suitable fluorescent acceptor chromophores to luciferase.
- FIGURE 2 displays a graph of the time courses of bioluminescence catalyzed by exemplary embodiments in a single turnover reaction, or more specifically, the decay of bioluminescence catalyzed by OFP-Ls-a: in a single turnover reaction.
- Light emissions from OFP-Ls- ⁇ in the dithionite assay may be monitored as either the total light, or intensities at 480 nm and 570 nm. The intensities may be normalized for comparison of the decay kinetics.
- FIGURE 3 displays a graph of bioluminescence spectra of the reactions catalyzed by various exemplary embodiments of the present disclosure, or more specifically, the spectra of the reactions catalyzed by the wild-type luciferase ( ⁇ : ⁇ ), OFP-Ls-a:P, and OFP- L 10 -a: p.
- the bioluminescence emission spectra may be measured by using the FRP-luciferase coupled assay at 23 °C in the standard buffer containing 0.5 mM DTT, 5.4 ⁇ FRP, 2 mM NADPH, 100 ⁇ decanal, and 36-70 ⁇ FMN.
- Luciferase is also included at 0.5-1.2 ⁇ as the wild-type enzyme, OFP-Ls-a:P, or OFP-Lio- : .
- another reaction may be carried out under identical condition except that the solution contained a mixture of free luciferase and OFP, each at 0.5 ⁇ .
- the emission intensities may be normalized to near the same level at 490 nm for spectral comparisons.
- FIGURE 4 depicts photographic images of the bioluminescence catalyzed by various exemplary embodiments of the present disclosure, which include bioluminescence catalyzed by the wild-type luciferase, OFP-Ls-a:P, and OFP-Lio- : .
- the FRP-luciferase coupled reactions may be carried out in fluorescent cuvettes identically as that described above except FMN may be at 69 ⁇ and OFP-Li 0 - : may be at 1 ⁇ (Sample 3).
- the levels of wild-type luciferase (Sample 1) and OFP-Ls-a:P (Sample 2) may be similar to that of OFP-Lio- : but slightly adjusted to emit about the same intensity of light as that by OFP- L lo -a: p. Photographs of these three samples may be taken in a dark room without filter (Panel A), or with a yellow filter ( ⁇ 1 transmission at ⁇ 460 nm) (Panel B) or an amber filter ( ⁇ 1 transmission at ⁇ 532 nm) (Panel C).
- FIGURE 5 illustrates a table of bioluminescence activities of exemplary embodiments of the present disclosure and those of wild-type luciferases. Bioluminescence activities (peak intensities) of wild-type luciferase and luciferase-fluorescent protein fusion enzymes are shown for the activities of these fusion enzymes when examined using the dithionite assay.
- FIGURE 6 illustrates a table of kinetic properties of exemplary embodiments of the present disclosure and those of wild-type luciferases.
- the time course of the bioluminescence decay of the wild-type luciferase in the non-turnover dithionite assay closely resembles that of a first-order process, with about the same decay rate when monitored as the total light or intensity at 480 nm. Similar results are also observed for OFP- Ls- ⁇ when the bioluminescence emission is monitored as the total light, 480-nm intensity, or 570-nm intensity, except that the day rates are slightly faster relative to the wild-type luciferase.
- luciferase is mixed with free OFP, no 560-nm emission component is observed.
- BRET Bioluminescence Resonance Energy Transfer
- the emission spectra of OFP-L5- : , :a-Ls-OFP and i -Ls-OFP are identical to that of the wild-type luciferase.
- Decanal, riboflavin 5 '-phosphate (FMN), dihydronicotinamide adenine dinucleotide phosphate (NADPH), dithiothreitol (DTT), kanamycin, ampicillin, isopropyl ⁇ - D-l-thiogalactopyranoside (IPTG), albumin from chicken egg white, sodium hydrosulfite and oligonucleotide primers may be purchased from various vendors.
- the vector pmOrange carrying the OFP-encoding ofp gene may be purchased from various vendors.
- Escherichia coli BL21(DE3) and BL21(DE3)pLysS competent cells and the pET28b plasmid may be purchased from various vendors.
- the E. coli strain JM109 carrying the pUC19 plasmid (which contained the V. harveyi lucif erase luxAB genes) and the E. coli strain BL21 carrying the pET21d plasmid (in which the frp gene encoding the NADPH-pref erring flavin reductase FRP may be inserted between the Ncol and BamHl cutting sites) may be prepared as described previously. Restriction enzymes, T4 DNA ligase, Quick ligation kit and Phusion high-fidelity PCR kit may be purchased from various vendors.
- the QuikChange II site- directed mutagenesis kit and QuikChange lightning site-directed mutagenesis kit may be purchased from various vendors.
- QIAprep spin miniprep kit QIA quick PCR purification kit and QIAquick gel extraction kit may be purchased from various vendors.
- Wizard SV gel and PCR clean-up system may be purchased from Promega.
- the DC Protein Assay Kit may be purchased from various vendors.
- the HisTrap HP column, HiPrep 26/10 desalting column, Hi-trap DEAE Sepharose column and Mono Q 5/50 GL column may be purchased from various vendors. Unless stated otherwise, a standard buffer of 50 mM phospate, pH 7.0, may be used.
- a PTC-200 thermal cycler may be used for polymerase chain reaction
- PCR amplification products may be purified by agarose gel (0.75%) electrophoresis and extracted by using either the QIA quick gel extraction kit or the Wizard SV gel and PCR clean-up system. After restriction enzyme digestions, DNA fragments may be purified by using a QIA quick PCR purification kit or a Wizard SV gel and PCR clean-up system. Desired DNA fragments may be ligated by using a Quick ligation kit or T4 ligase.
- Cell transformations may be carried out by following the protocol provided, and cells may be subsequently plated on LB agar plates containing 50 mg/L kanamycin or ampicillin with or without IPTG (100 ⁇ 10 mM IPTG water solution may be spread on the agar surface of each plate 1 h before use). After overnight growth at 37 °C, several colonies may be picked. Each colony may be cultured at 37 °C in a 15-mL tube containing 10 mL LB and 50 mg/L kanamycin or ampicillin with shaking at 250 revolutions per minute (rpm) for 12 h. Cells may be harvested and a QIAprep spin miniprep kit used to extract plasmids. After isolation, the desired plasmids may be all confirmed by sequencing.
- Vectors pET28b-OFP and pET28b-OFP:a:B The ofp gene may be amplified by PCR using the pmOrange plasmid and primers (forward) 5'- GGAATTCCATATGGTGAGCA-3' and (reverse) 5'-CGCGGATCCTACTTGTACAGC-3'.
- the underlined sequences are recognized by the restriction enzymes Ndel and BamHl, respectively.
- the PCR amplification product may be purified and extracted.
- the purified sample so obtained and the pET28b plasmid may be double-digested by Ndel and BamHl, purified, and ligated.
- the ligation mixture may then be added to E.
- coli BL21(DE3) competent cells for transformation may then be plated on LB agar plates containing kanamycin and IPTG. Colony selection (by pink color), cell growth (in LB medium containing kanamycin), and plasmid extraction may be carried out as described above to obtain the pET28b-OFP vector.
- the lucif erase luxAB genes may be amplified by PCR using the pUC19 vector harboring luciferase luxAB genes and the primers (forward) 5'- AGC GG ATC C ATGA A ATTTGG- 3 ' and (reverse) 5 ' -C GTC AA 3CTT ACGAGTGGT ATTT- 3'.
- the underlined sequences are recognized by the restriction enzymes BamHl and Hindlll, respectively.
- the purified PCR amplification product and pET28b-OFP plasmid may be separately double-digested by BamHl and Hindlll.
- the DNA fragments may be purified and may be ligated. The ligation mixture may then be added to E.
- coli BL21(DE3) competent cells for transformation The cells may be plated on LB agar plates containing kanamycin and several colonies may be picked. Cell growth (in LB medium containing kanamycin) and plasmid extraction may be carried out.
- the desired plasmid, designated pET28b-OFG:a: so obtained harbored both the ofp gene and the luciferase luxAB genes.
- the symbol ":" indicates that the two proteins on both sides of it are not fused.
- a DNA fragment encoding a 20-residue peptide (MGS SHHHHHHS S GL VPRGSH) immediately precedes the start codon of the ofp gene, which is followed sequentially by a non-coding sequence, luxA, another non-coding sequence, and luxB.
- the pET28b-OFP:a: plasmid may be mutated using the QuikChange II kit and the primers 5'- GCATGGACGAGCTGTACAAGGGAGGAGGAGGAACAATGAAATTTGGAAACTTCC
- the individual protein components and the linker are also arranged (from left to right) in the same sequence as the locations of their encoding genes, with the most upstream gene corresponding to the first protein component in the designation (i.e. the ofp gene and OFP, respectively, in the present case). All other plasmids and their encoding fusion enzymes are designated following the same set of rules.
- the plasmid pET28b-OFP-Lio-a:P in which the non-coding region between ofp and luciferase luxA may be replaced by a sequence encoding a ten-amino-acid GGGGSGGGGS (abbreviated L 10 ) linker may be constructed the same way as that for pET28b-OFP-L5-a: except by using the primers 5'-
- the encoded fusion enzyme OFP-Lio- is similar to OFP-Ls-a:P except that the C terminus of OFP may be fused to the N terminus of a via the L lo linker mentioned above.
- luciferase luxAB genes may be amplified by PCR using the pUC19 vector and primers (forward) 5'- CGTCC ATATGAAATTTGGAAAC-3 ' and (reverse) 5'-
- the underlined sequences are recognized by the restriction enzymes Ndel and Hindlll, respectively.
- the purified PCR amplification product and pET21b plasmid may be separately double-digested by Ndel and Hindlll, and the digested products may be purified.
- DNA fragments so obtained 50 ng from plasmid template and 150 ng from PCR amplification product in 20 ⁇ L ligation solution
- T4 ligase 400 U of in 1 ⁇
- the ligated products may be used to transform the E.
- coli BL21(DE3)pLysS competent cells and the treated cells may be plated on LB agar plates containing ampicillin and IPTG. As described above, several colonies may be selected and grown in LB medium containing ampicillin. Plasmids may be extracted from the harvested cells, and the desired pET21b-a: vector may be isolated.
- the ofp gene may be amplified by PCR using pmOrange and primers:
- the underlined sequences are recognized by the restriction enzymes Hindlll and Eagl, respectively.
- the purified PCR amplification product and pET21b-a: plasmid may be separately double-digested by Hindlll and Eagl, and ligations may be carried out using T4 DNA ligase.
- E. coli BL21(DE3)pLysS competent cells may be transformed with the ligated products, and may be plated on LB agar plates containing ampicillin and IPTG. Selected individual colonies may be grown in LB medium containing ampicillin, and plasmids may be extracted from harvested cells for the isolation of the desired pET21b-a:P:OFP plasmid.
- Vector pET21b-a:fi-L -OFP The non-coding region between lucif erase luxB and ofp in pET21b-a:P:OFP may be mutated to the same DNA sequence encoding the L5 linker as stated above by using the QuikChange lightning site-directed mutagenesis kit and the primers 5'-
- Cell transformation, colony selection, cell growth, and plasmid extraction may be the same as that described for the preparation of pET28b-OFP-Ls-a: except that ampicillin may be used replacing kanamycin in both the LB agar and liquid media.
- the luciferase luxB gene may be amplified by PCR using the pUC19 vector and the primers: (forward) 5'- GACCATATGAAATTTGGATTATTCTTC-3 ' and (reverse) 5'-
- the luciferase luxA may also be amplified by PCR using with the pUC19 vector and primers (forward) 5 ' -C AGAGCTCATGAAATTTGGAAAC-3 ' and (reverse) 5'- CGTCAAGCTTACTGTTTTTCTTTGA-3 ' .
- the underlined sequences are recognized by the restriction enzymes Sacl and Hindlll, respectively.
- the purified PCR amplification product and pET21b- may be independently double-digested by Sacl and Hindlll, and ligated using T4 DNA ligase.
- pET21b- The same procedures described for pET21b- may be then followed for the isolation of a plasmid which contained, sequentially, the luciferase luxB, a non-coding sequence, and luxA.
- the non-coding sequence had no ribosome binding site (rbs) upstream of the luciferase luxA.
- the rbs is needed for the translation of luciferase a. Therefore, the non-coding region may be replaced by 5'-AAGGAGAGAGAC-3' for the insertion of the rbs site by mutation using the primers 5'- AACATCGTCAAATACCACTCGTAAAAGGAGAGACATGAAATTTGGAAACTTC CTTC-3' and 5'-
- pET21b- ⁇ : ⁇ may be obtained the expression of which produced active native luciferase.
- the ofp may be amplified by PCR using the mOrange plasmid and the primers (forward) 5 ' -CGTC AAGCTTATGGTGAGCAA-3 ' and (reverse) 5'- TACGGCCGACTTGTACAGC-3' .
- the underlined sequences are recognized by the restriction enzymes Hindlll and Eagl, respectively.
- the purified PCR amplification product and the pET21b-P:a plasmid may be independently double-digested by Hindlll and Eagl, and may be ligated using T4 DNA ligase. Same as described above, the desired plasmid pET21b- :a:OFP may be isolated which encodes the functionally active luciferase and OFP but none of these protein components will be fused.
- Vector pET21b-fi:a-L -OFP The replacement of the non-coding region between the luciferase luxA and ofp with the same sequence encoding the L5 linker may be conducted using the pET28b-OFP:a:P plasmid and the primers 5'- ATATCTCAAAGAAAAACAGGGAGGAGGAGGAACAATGGTGAGCAAGGGCGAGG
- the non-coding region between the mOrange and luciferase a may be replaced by 5 ' -GGAGGAGGAGG AAC A-3 ' .
- IPTG may also be included in the LB agar medium, for the isolation of the plasmid pET21b- :a-Ls-OFP.
- the expression of this plasmid gives rise to the production of the fusion enzyme :a-Ls-OFP, in which the C terminus of a is fused with the N terminus of OFP via the L5 linker and the ⁇ is non-covalently associated with this modified a.
- Vectors pET28b-OFP:B:a and pET28b-OFP-L 1 -B:a may be used for PCR along with primers (forward) 5'- TACGGATCCATGAAATTTGGATT-3 ' and (reverse) 5'-CGTCAAGCTTACTGTTTTTCTTTGA-3' .
- the underlined sequences are recognized by the restriction enzymes BamHl and Hindlll, respectively.
- the purified PCR amplification product and pET28b-OFP may be independently double-digested by BamHl and Hindlll, and may be ligated using T4 DNA ligase. The sample may then be used to transform E.
- coli BL21(DE3)pLysS competent cells The same procedures as stated for pET28b-OFP may be then followed for the isolation of the plasmid pET28b-OFP ': ⁇ : ⁇ .
- the replacement of the non-coding region between ofp and luciferase luxB with the same sequence for the L5 linker may be conducted by mutation of pET28b-OFP ': ⁇ : ⁇ . using the primers 5'-
- the plasmid solution may then be used to transform E. coli BL21(DE3) competent cells.
- the transformed cells may be subsequently subjected to the same treatments as described for pET28b-OFP ': ⁇ : ⁇ cells for the isolation of the vector pET28b-OFP-Ls- :a.
- OFP-Fs- encoded by this plasmid, the F5 linker is fused to the N terminus of luciferase ⁇ while a is non-covalently associated with this modified ⁇ .
- V. harveyi luciferase and FRP may be purified as previously describe.
- coli BF21(DE3)pFysS cells carrying the plasmids for luciferase-OFP fusion enzymes or OFP may be grown in 1 F Furia-Bertani with 50 mg/F kanamycin (for plasmids originated from pET28b) or 50 mg/F ampicillin (for plasmids originated from pET21b) at 37 °C and may be shaken at 250 rpm in a C25KC Incubator Shaker (New Brunswick Scientific) until OD 6 oo nm reaches about 1.0. IPTG may be added into the cell culture at 1 mM. The cell culture may be incubated at 28 °C at 250 rpm for another 20 h.
- Cells may be harvested by centrifugation at 7000 rpm for 1 h using a Beckman Coutler J2-HS centrifuge.
- the cell pellet so obtained may be suspended in 35 mL ice-cooled binding buffer (i.e. the standard buffer of 50 mM Pi, pH 7.0, supplemented with 0.5 M NaCl, 0.5 mM DTT and 20 mM imidazole) and sonicated on ice for 7.5 min by using a Fisher Scientific sonic dismembrator model 500.
- the cell lysate may be centrifuged at 14,000 g for 30 min, and the supernatant may be collected and filtered through a 0.2- ⁇ PES filter.
- the filtrate may be loaded on a 5-mF HisTrap HP column equilibrated with the binding buffer.
- the column may be eluted first with the same binding buffer until absorbance at 280 nm reaches near zero, and then with an elution buffer (standard buffer containing 0.5 M NaCl, 0.5 mM DTT and 500 mM imidazole).
- elution buffer standard buffer containing 0.5 M NaCl, 0.5 mM DTT and 500 mM imidazole.
- Fractions containing the desired fusion protein may be identified by A 2 8o and the fluorescent-protein color for collection.
- the pooled fractions may be applied to a HiPrep 26/10 desalting column, and recovered in the standard buffer containing 0.5 mM DTT.
- the sample may be then loaded on a Mono Q 5/50 GL column pre-equilibrated and then eluted with the same standard buffer containing 0.5 mM DTT until the absorbance at 280 nm reaches near zero. Subsequently, a (15 column volume) gradient of 0-0.5 M NaCl in the standard buffer containing 0.5 mM DTT may be applied. Fractions containing the desired fusion enzymes may be collected, pooled, and loaded on a HiPrep 26/10 desalting column for recovering the fusion enzymes in the standard buffer containing 0.5 mM DTT. Protein concentrations may be determined by using the DC protein assay kit from Bio-Rad and chicken egg white albumin as a standard.
- Enzyme assays Activities of native lucif erase and all luciferase-OFP fusion enzymes may be determined at room temperature by the dithionite assay or by the photoreduction assay, both in the standard buffer without (for the former) or with 20 mM EDTA (for the latter assay). In both assays, luciferase catalyzes a non-turnover single cycle reaction, for which the bioluminescence peak intensity, the total quantum output and, for the dithionite assay, the light decay rate may be measured. The arbitrary light intensities recorded may be converted to quantum (q) per second by calibration with a liquid light standard (19).
- a yellow cut-off filter (10BPF10- 480 7G311 ; 480 ⁇ 2 nm bandpass and ⁇ 1 transmission at ⁇ 460 nm) and an amber cut-off filter (10BPF10-570 7C299; 570 ⁇ 2 nm bandpass and ⁇ % transmission at ⁇ 532 nm) from Newport Company may also e used.
- a Varian Cary 50 spectrometer and a Varian Cary Eclipse fluorometer may be used for the measurements of absorption spectra and fluorescence/bioluminescence spectra, respectively.
- an FRP-coupled bioluminescence reaction may be initiated by rapidly mixing FRP with NADPH, FMN, decanal and luciferase (or fusion enzymes) in a fluorescence cuvette.
- the bioluminescence emission spectrum may be measured when the bioluminescence emission reaches a steady level.
- Natural extensions of the present disclosure may be improvements in the energy transfer efficiencies observed with OFP-Ls- i and OFP-Lio- : by using other fluorescent proteins or linkers of choice following the same approach as described above. Further, similar approaches may be used to generate various fluorescent protein- or fluorescent chromophore-attached luciferases as multiple color emitters. For exemplary purposes, where a fluorescent protein is used as the energy acceptor, the fusion enzyme may be used as sensor for both in vitro and in vivo systems.
- Suitable organic fluorophores may also be used as the energy acceptor after chemical linking to luciferase as long as their absorption overlaps with the normal bacterial bioluminescence, and their fluorescence emission is in a wavelength range higher than the luciferase bioluminescence.
- organic fluorophores By using organic fluorophores, bacterial luciferase may also be converted to multi-color sensors.
- the fluorophore-attached luciferase is best suited for in vitro systems.
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
The present invention discloses systems and methods for altering the color of bacterial bioluminescence via a fusion protein complex by fusing Discosoma sp. fluorescent protein mOrange (OFP) with Vibrio harveyi luciferase. The fusion of OFP to the N- or C-terminus of either a or β subunit of luciferase, via a short peptide linker produces fully active fusion enzymes. The fusion of OFP to the N-terminus of luciferase a gives rise to a new 560-nm emission component. The same methodology may be used to alter bacterial bioluminescence color by covalent attachment of other suitable fluorescent proteins or chromophores to luciferase for generating multi-color sensors.
Description
FUSION PROTEINS OF BACTERIAL LUCIFERASE AS MULTICOLOR
LUMINESCENT SENSORS CROSS-REFERENCE TO RELATED APPLICATIONS
[ 0001 ] This application claims priority to U.S. Provisional Patent Application Serial No. 61/500,826, filed June 24, 2011, which is hereby incorporated by reference for all purposes. TECHNICAL FIELD
[ 0002 ] This disclosure relates in general to the field of luminescent sensors and more particularly to fusion proteins of luciferase as luminescent sensors.
BACKGROUND
[ 0003 ] Multiple color emissions from a single bioluminescence system have often been the focus for extensive studies either for elucidation of luciferase or fluorescent protein structure-function relationships. Additionally, they have been studied for the development of improved sensors.
[ 0004 ] Bioluminescence derived from lucif erase-catalyzed reactions and fluorescent protein emissions has been widely used in life sciences for both basic and applied studies. For most luciferases, the required luciferins that undergo luciferase-catalyzed oxidation are unusual metabolites specialized for bioluminescence reactions. If used for signaling or imaging purposes, it may be difficult or inconvenient to provide these unusual luciferins to the systems under investigation, especially for in vivo studies.
[ 0005 ] In this way, bacterial luciferase-catalyzed bioluminescence has some unique advantages over other luciferase systems. Oxygen and reduced riboflavin 5 '-phosphate (FMNH2), e.g., two of the three substrates required by bacterial luciferase for producing luminescence, are readily available in various cell types. The third substrate for the bacterial luciferase-catalyzed oxidative process, long-chain aliphatic aldehyde, cannot be generated by most other cell types. However, the long-chain aldehydes may be synthesized by the luxCDE genes in luminous bacteria. Further, these long-chain aldehydes have very high binding affinities for luciferase, with Km below micromolar levels, and due to their highly hydrophobic nature, can easily diffuse through cell membranes for in vivo imaging applications.
[ 0006 ] The aldehyde-generating genes may be cloned along with luxAB genes for bacterial luciferase a and β subunits into the cell systems. Moreover, the codon-optimized Vibrio harveyi luciferase lux genes and the frp gene for flavin reductase P (FRP), which generates FMNH2 from FMN using NADPH as a reductant, have been successfully expressed in mammalian HEK 293 cells with significant signals for bioluminescence imaging. The lux genes have been well characterized, and the structures and reaction mechanisms of bacterial luciferase have also been extensively studied, making bacterial luciferase particularly suitable for serving as a reporting system.
[ 0007 ] However, as applied for current in vivo systems, the normal 490 nm emission by bacterial luciferase suffers from two disadvantages, namely absorption by some cellular components and a lower ability to penetrate tissue.
[ 0008 ] In this connection, changes in the color of bacterial luciferase bioluminescence have previously been reported in three lines of studies. First, replacements of the FMNH2 substrate by reduced 2-thioFMN and iso-FMN were found to shift the 490 nm peak of the bioluminescence to 530 and 470 nm, respectively. Second, certain mutations of the bacterial luciferase active center structure also led to changes of the bioluminescence color. In another study, the luciferase a subunit was randomly mutated and five luciferase variants were found to emit bioluminescence with significant but limited shifts from that of the normal 490 nm emission. This finding suggested that the excited emitter is bound to luciferase and its emission is sensitive to the environment of the luciferase active site. The luciferase a subunit was also subjected to controlled single- to triple-residue mutations for altering the emission spectrum. Third, bacterial bioluminescence color, in vitro and in vivo, may also be changed by the formation of a non-covalent complex of luciferase with specific fluorescent proteins co-existing in luminous bacteria. These fluorescent proteins include a lumazine protein from Photobacterium phosphoreum and Photobactreum leiognothi, two forms of yellow-fluorescent proteins, and a blue-fluorescent protein from Vibrio fischeri strain Yl.
[ 0009 ] Some have used certain flavin analogs for altering the bacterial luciferase emission color in vitro, however, it is not applicable to in vivo systems. Additionally, due to the rather stringent specificity of luciferase for the flavin substrate, color changes of bacterial luciferase bioluminescence by flavin analogs other than 2-thioFMN and iso-FMN have not been reported. Others have changed the luciferase active site structure as a way to alter bacterial luminescence color by either random mutation or site-directed mutagenesis, and
producing luciferase variants that generally have substantially reduced activities and their emission spectral changes are limited (up to 12 nm shifts to the red).
[ 0010 ] Others have blue-shifted, by about 10- and 20-nm peak, the normal 490-nm bioluminescence of luciferase by the blue fluorescent protein and lumazine protein, respectively, and red shifted to near 540 nm by the yellow fluorescent proteins. Lumazine protein and yellow fluorescent protein each interacts specifically and directly with luciferase reaction intermediate(s) to alter not only the color but also the reaction kinetics of the luciferase-catalyzed emission. This may be best demonstrated by the single turnover reaction by luciferase in the presence of yellow fluorescent protein, in which the decay rates of the 490 nm normal bioluminescence by luciferase and the 540 nm emission from yellow fluorescent protein were distinct. Therefore, the emission spectrum actually changes over time and resonance energy transfer alone cannot account for the change of emission color.
[ 0011 ] Prior studies have reported that lumazine protein, blue and yellow fluorescent proteins do not have the ability to alter the bioluminescence spectra of all known bacterial luciferases; one species of fluorescent protein can change the bioluminescence color of only one or a very limited few species of luciferase. Moreover, it has been reported that their non-covalent interactions with corresponding luciferases are sensitive to perturbations by factors such as temperature and concentration.
[ 0012 ] Although various compositions and methods for altering the color of luciferase luminescence are known to the art, all, or almost all of them suffer from one or more than one disadvantage and have shortcomings. Therefore a need has arisen for compositions and methods for changing the color of luciferase bioluminescence which corrects the problems identified above, and enables its use in vivo or as part of multi-color sensor systems.
SUMMARY
[ 0013 ] The following disclosure presents concepts for regulation of the emission spectrum of bacterial luciferase. The disclosed subject matter significantly improves upon prior art aimed at altering the color of bioluminescence derived from luciferase-catalyzed reactions.
[ 0014 ] It is an object of the present disclosure to permit compositions that are well suited for biological applications including in vitro and in vivo sensing, and enhancement of tissue imaging. Another object of the present disclosure is to permit various aspects and
embodiments of a luminescent sensor system and its associated methods of use and methods of manufacture.
[ 0015 ] In preferred embodiments, the compositions exhibit luciferases from desired luminous bacteria or engineered luciferases as the energy donor, and desired species of fluorescent proteins as the energy acceptor.
[ 0016 ] One aspect of the disclosed subject matter is that energy donors may generally encompass native or engineered luciferases including, but not limited to: alpha-beta non-fused or fused luciferase or any bacterial luciferase genes which have been modified for expression in eukaryotic cells.
[ 0017 ] In another aspect of preferred embodiments, energy acceptors may include any appropriate fluorescent proteins provided that their absorption spectra overlap somehow with the emission of normal bioluminescence, and that their fluorescence emission spectra are in a wavelength range higher than the normal luciferase bioluminescence.
[ 0018 ] In other preferred embodiments, fusion of bacterial luciferase with a GFP- type fluorescent protein takes advantage of the proximity between these two partners of the fusion protein to allow the alteration of the luciferase' s original 490-nm emission through bioluminescence resonance energy transfer (BRET) to the fluorescent protein.
[ 0019 ] These and other aspects of the disclosed subject matter, as well as additional novel features, will be more apparent from the following detailed description of preferred embodiments of the invention, along with the accompanying drawings in which like numerals represent like components. The intent of this summary is not to be a comprehensive description of the claimed subject matter, but rather to provide a short overview of some of the subject matter's functionality. Other systems, methods, objects, features, aspects, and advantages here provided will become apparent to one with skill in the art upon examination of the following FIGURES and detailed description. It is intended that all such additional systems, methods, features and advantages that are included within this description, be within the scope of any claims filed later.
BRIEF DESCRIPTIONS OF THE DRAWINGS
[ 0020 ] The novel features believed characteristic of the presently disclosed subject matter will be set forth in any claims that are filed later. The presently disclosed subject matter itself, however, as well as a preferred mode of use, further objectives, and advantages thereof, will best be understood by reference to the following detailed description of an illustrative embodiment when read in conjunction with the accompanying drawings, wherein:
[ 0021 ] FIGURE 1 is a graph of exemplary spectra of lucif erase bioluminescence,
OFP absorption, and OFP fluorescence as taught by the present disclosure.
[ 0022 ] FIGURE 2 displays a graph of the time courses of bioluminescence catalyzed by exemplary embodiments in a single turnover reaction.
[ 0023] FIGURE 3 displays a graph of bioluminescence spectra of the reactions catalyzed by various exemplary embodiments of the present disclosure.
[ 0024 ] FIGURE 4 depicts photographic images of the bioluminescence catalyzed by various exemplary embodiments of the present disclosure.
[ 0025] FIGURE 5 illustrates a table of bioluminescence activities of exemplary embodiments of the present disclosure and those of wild-type luciferases.
[ 0026] FIGURE 6 illustrates a table of kinetic properties of exemplary embodiments of the present disclosure and those of wild-type luciferases.
DETAILED DESCRIPTION OF THE SPECIFIC EMBODIMENTS
[ 0027 ] Although described with particular reference to compositions of fusion proteins and methods for the regulation of the emission spectrum of bacterial luciferases, those with skill in the arts will recognize that the disclosed embodiments have relevance to a wide variety of areas in addition to those specific examples described below.
[ 0028 ] All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein.
[ 0029 ] FIGURE 1 is a graph of exemplary spectra of luciferase bioluminescence,
OFP absorption, and OFP fluorescence as taught by the present disclosure.
[ 0030 ] The present disclosure relates to methods for the regulation of the emission spectrum of bacterial luciferase. Additional embodiments of the present disclosure relate to the compositions of fusion enzymes, methods for making the same, and methods for their use. The compositions exhibit luciferases from desired luminous bacteria or engineered luciferases as the energy donor, and desired species of fluorescent proteins as the energy acceptor. Energy donors may generally encompass native or engineered luciferases including, but is not limited to: alpha-beta non-fused or fused luciferase or any bacterial luciferase genes which have been modified for expression in eukaryotic cells. Energy acceptors include any appropriate fluorescent proteins with the requirement that their absorption spectra overlap with the emission of normal bioluminescence, and that their fluorescence emission spectra are in a wavelength range higher than the normal luciferase bioluminescence. The benefit of such a composition is that it alters the color of bioluminescence derived from luciferase- catalyzed reactions. Embodiments of these compositions are well suited for biological applications including in vitro and in vivo sensing, and enhancement of tissue imaging.
[ 0031 ] A variety of fluorescent proteins related to the jellyfish Aequorea green fluorescent protein (GFP) have been developed to exhibit a wide range of fluorescence colors. An exemplary embodiment of the present disclosure includes a series of fusion proteins by linking Vibrio harveyi luciferase to Discosoma sp. fluorescent protein mOrange (OFP). The normal bioluminescence spectrum of native bacterial luciferase significantly overlaps with the absorption of OFP, and the fluorescence emission peak of OFP is at a longer wavelength than the peak of the luciferase bioluminescence. These properties indicate that OFP may be an appropriate energy acceptor for the energy donor bacterial luciferase. The absorption and fluorescence emission spectra of 13 μΜ OFP in the standard buffer (50
mM phosphate, pH 7.0) may be determined using an excitation light at 480 nm for the latter measurement. The luciferase bioluminescence emission spectrum was measured by the luciferase-FRP coupled assay in 1 mL standard buffer containing 0.5 mM dithiothreitol (DTT), 5.4 μΜ FRP, 2 mM NADPH, 100 μΜ decanal, 36 μΜ FMN, and 0.5 μΜ luciferase. All spectra may be measured at 23 °C.
[ 0032 ] Although OFP may be fused to any species of bacterial luciferase of choice, for exemplary purposes, the present disclosure describes how OFP interacts with the bacterial luciferase, Vibrio harveyi luciferase. In one example, V. harveyi NADPH-specific flavin reductase FRP is used to continuously generate the required FMNH2 substrate, and the resulting emission spectra produced by such fusion enzymes is disclosed. Expansion of this approach includes, for exemplary purposes, the substitution of OFP with any desired fluorescent proteins, or by tagging luciferase with a suitable fluorescent acceptor chromophore.
[ 0033 ] Another exemplary embodiment of the present invention discloses the bioluminescence profiles and kinetic properties of fusion enzymes made of wild type luciferase, such as Vibrio harveyi luciferase, and Discosoma sp. fluorescent protein mOrange. These fusion proteins retain wild-type like bioluminescence activities. To achieve this, the following plasmids encoding the following fusion enzymes are constructed: OFP-Ls-a:P, OFP-L5- :a, :a-L5-OFP, a: -L5-OFP, and OFP-L10-a: .
[ 0034 ] OFP is fused to the N- or C-terminus of either the a or β subunit of bacterial luciferase through a GGGGS five-residue (abbreviated L5) or, in one case, a GGGGSGGGGS 10-residue (abbreviated L10) linker to generate five fusion enzymes. After expression and purification, these fusion enzymes are obtained at 90% or greater purities and the expected molecular weights for luciferase a or β fused with OFP are confirmed by patterns of SDS gel electrophoresis. Due to the tight binding between the two subunits of luciferase, the fusion enzymes are each isolated as a single complex of non-modified subunit and the OFP-fused counter subunit.
[ 0035 ] The present disclosure teaches exemplary embodiments capable of generating emissions at wavelengths longer than 490 nm, such as the 560 nm emission by OFP fused to luciferase. Both OFP-Ls-a:P and OFP-Lio- : as described herein retain activities similar to that of the wild-type luciferase, and both show a substantial emission component at 560 nm, a 70 nm red shift from the known bacterial bioluminescence. These emissions at longer wavelengths suffer from much less absorption and have better efficiencies in penetrating tissues.
[ 0036 ] The new 560-nm component in the bioluminescence catalyzed by OFP-L5- α:β and OFP-Li0- : as described herein is a direct consequence of bioluminescence resonance energy transfer (BRET). The fusion of a luciferase with a fluorescent protein of choice, and the related bioluminescence resonance energy transfer properties, results in a new emission component from such protein or any other appropriate acceptor. This offers a significant advantage in that no excitation light is required. Existing imaging systems often require an excitation light for the fluorescence of proteins, and have undesirable effects of generating unwanted background fluorescence and/or photo-bleaching of the fluorescent molecules. By contrast, the present disclosure does not require an excitation light and it is therefore a significant improvement over existing systems.
[ 0037 ] Rather, exemplary methods disclosed herein take advantage of BRET mechanics, wherein the energy of emission from the luciferase-fluorescent protein fusion is derived from the luciferase-catalyzed reaction. Since luciferase is a catalytic enzyme, even a trace amount of the fusion enzyme can magnify the output of light by the multiple turnovers of luciferase. In contrast, fluorescent proteins are not enzymes and, hence, cannot magnify light output by catalytic turnovers. Any low levels of fluorescent proteins can only produce low levels of fluorescence signals, which would be highly distorted by any excitation lights used to generate emissions from the fluorescent proteins alone.
[ 0038 ] By using covalent linkages between a luciferase and a fluorescent protein to vary the bioluminescent spectrum of fusion enzymes, the presence of the OFP acceptor within proximity of the luciferase donor assures that energy transfer occurs. In addition to OFP, a variety of GFP-related variants for a wide range of fluorescence emissions may be used. Therefore an extension of the present disclosure consists in using the methods for OFP described herein to alter the bacterial luciferase bioluminescence spectrum by fusing luciferase with either other fluorescent proteins (GFP-related or not), or by chemically attachment of suitable fluorescent acceptor chromophores to luciferase.
[ 0039 ] FIGURE 2 displays a graph of the time courses of bioluminescence catalyzed by exemplary embodiments in a single turnover reaction, or more specifically, the decay of bioluminescence catalyzed by OFP-Ls-a: in a single turnover reaction. Light emissions from OFP-Ls-αβ in the dithionite assay may be monitored as either the total light, or intensities at 480 nm and 570 nm. The intensities may be normalized for comparison of the decay kinetics.
[ 0040 ] FIGURE 3 displays a graph of bioluminescence spectra of the reactions catalyzed by various exemplary embodiments of the present disclosure, or more specifically,
the spectra of the reactions catalyzed by the wild-type luciferase (α:β), OFP-Ls-a:P, and OFP- L10-a: p. The bioluminescence emission spectra may be measured by using the FRP-luciferase coupled assay at 23 °C in the standard buffer containing 0.5 mM DTT, 5.4 μΜ FRP, 2 mM NADPH, 100 μΜ decanal, and 36-70 μΜ FMN. Luciferase is also included at 0.5-1.2 μΜ as the wild-type enzyme, OFP-Ls-a:P, or OFP-Lio- : . As a control, another reaction may be carried out under identical condition except that the solution contained a mixture of free luciferase and OFP, each at 0.5 μΜ. The emission intensities may be normalized to near the same level at 490 nm for spectral comparisons.
[ 0041 ] FIGURE 4 depicts photographic images of the bioluminescence catalyzed by various exemplary embodiments of the present disclosure, which include bioluminescence catalyzed by the wild-type luciferase, OFP-Ls-a:P, and OFP-Lio- : . The FRP-luciferase coupled reactions may be carried out in fluorescent cuvettes identically as that described above except FMN may be at 69 μΜ and OFP-Li0- : may be at 1 μΜ (Sample 3). The levels of wild-type luciferase (Sample 1) and OFP-Ls-a:P (Sample 2) may be similar to that of OFP-Lio- : but slightly adjusted to emit about the same intensity of light as that by OFP- Llo-a: p. Photographs of these three samples may be taken in a dark room without filter (Panel A), or with a yellow filter (<1 transmission at <460 nm) (Panel B) or an amber filter (<1 transmission at <532 nm) (Panel C).
[ 0042 ] The differences in color of the bioluminescence emissions by the wild-type luciferase, OFP-Ls-a:P and OFP-Lio- : are evident by vision or direct photography. Panel A shows the bioluminescence from the three luciferase samples mentioned above, respectively, as images 1 , 2, and 3. As such, the differences in color are not that apparent. However, when the sample is observed through a yellow cut-off filter (<1 transmission at <460 nm), the emission from the wild-type luciferase is mostly filtered out while the longer- wavelength emissions are clearly viewed for the OFP-Ls-a:P and, more so, OFP-Lio- : (Panel B). An even more pronounced difference in the emissions is observed when an amber cut-off filter (<1 transmission at <532 nm) is used (Panel C). In this case, the wild-type luciferase emission is almost entirely filtered out. Significant changes in luciferase bioluminescence color only occur when OFP is fused to the N-terminus of the a subunit (e.g., OFP-L5- : and OFP-Lio- : ). No change of bioluminescence spectrum is observed when OFP is attached to the N- or C-terminus of β or the C-terminus of a. The bioluminescent color varies depending upon (1) where on the luciferase the OFP is attached to, and (2) the length of the residue linker.
[ 0043 ] FIGURE 5 illustrates a table of bioluminescence activities of exemplary embodiments of the present disclosure and those of wild-type luciferases. Bioluminescence activities (peak intensities) of wild-type luciferase and luciferase-fluorescent protein fusion enzymes are shown for the activities of these fusion enzymes when examined using the dithionite assay. A general pattern emerges for all fusion enzymes: No significant change is observed in their bioluminescence activities in comparison with that of the wild-type luciferase, regardless whether OFP is fused to the N- or C-terminus of either the luciferase a or β subunit. This is also the case for fusion enzyme OFP-Ls-a:P where the change of the linker from 5 to 10 amino acid residues leads to no change in the fusion enzyme activity. The kinetic properties of OFP-Ls-a:P closely resembles that of the wild-type luciferase with respect to Km values for decanal and FMNH2, as shown the table of kinetic properties.
[ 0044 ] FIGURE 6 illustrates a table of kinetic properties of exemplary embodiments of the present disclosure and those of wild-type luciferases. The time course of the bioluminescence decay of the wild-type luciferase in the non-turnover dithionite assay closely resembles that of a first-order process, with about the same decay rate when monitored as the total light or intensity at 480 nm. Similar results are also observed for OFP- Ls-α when the bioluminescence emission is monitored as the total light, 480-nm intensity, or 570-nm intensity, except that the day rates are slightly faster relative to the wild-type luciferase. Additionally, when the intensities at the 490 nm peak are normalized to the same level, both OFP-Ls-a: and OFP-Lio- : exhibit in their bioluminescence spectra an additional longer-wavelength emission shoulder near 560 nm, with a higher intensity for the latter. However, when luciferase is mixed with free OFP, no 560-nm emission component is observed. These results clearly demonstrated that the 560-nm emissions from OFP-Ls-a:P and OFP-Lio- : are due to Bioluminescence Resonance Energy Transfer (BRET) from luciferase to the fused OFP, as previously discussed. In contrast, the emission spectra of OFP-L5- : , :a-Ls-OFP and i -Ls-OFP are identical to that of the wild-type luciferase.
[ 0045 ] The following disclosure teaches exemplary materials and general molecular biological methods for practicing the above disclosed inventions.
[ 0046 ] Decanal, riboflavin 5 '-phosphate (FMN), dihydronicotinamide adenine dinucleotide phosphate (NADPH), dithiothreitol (DTT), kanamycin, ampicillin, isopropyl β- D-l-thiogalactopyranoside (IPTG), albumin from chicken egg white, sodium hydrosulfite and oligonucleotide primers may be purchased from various vendors. The vector pmOrange carrying the OFP-encoding ofp gene may be purchased from various vendors. Escherichia coli BL21(DE3) and BL21(DE3)pLysS competent cells and the pET28b plasmid may be
purchased from various vendors. The E. coli strain JM109 carrying the pUC19 plasmid (which contained the V. harveyi lucif erase luxAB genes) and the E. coli strain BL21 carrying the pET21d plasmid (in which the frp gene encoding the NADPH-pref erring flavin reductase FRP may be inserted between the Ncol and BamHl cutting sites) may be prepared as described previously. Restriction enzymes, T4 DNA ligase, Quick ligation kit and Phusion high-fidelity PCR kit may be purchased from various vendors. The QuikChange II site- directed mutagenesis kit and QuikChange lightning site-directed mutagenesis kit may be purchased from various vendors. QIAprep spin miniprep kit, QIA quick PCR purification kit and QIAquick gel extraction kit may be purchased from various vendors. Wizard SV gel and PCR clean-up system may be purchased from Promega. The DC Protein Assay Kit may be purchased from various vendors. The HisTrap HP column, HiPrep 26/10 desalting column, Hi-trap DEAE Sepharose column and Mono Q 5/50 GL column may be purchased from various vendors. Unless stated otherwise, a standard buffer of 50 mM phospate, pH 7.0, may be used.
[0047] A PTC-200 thermal cycler may be used for polymerase chain reaction
(PCR). PCR amplification products may be purified by agarose gel (0.75%) electrophoresis and extracted by using either the QIA quick gel extraction kit or the Wizard SV gel and PCR clean-up system. After restriction enzyme digestions, DNA fragments may be purified by using a QIA quick PCR purification kit or a Wizard SV gel and PCR clean-up system. Desired DNA fragments may be ligated by using a Quick ligation kit or T4 ligase. Cell transformations may be carried out by following the protocol provided, and cells may be subsequently plated on LB agar plates containing 50 mg/L kanamycin or ampicillin with or without IPTG (100 μΕ 10 mM IPTG water solution may be spread on the agar surface of each plate 1 h before use). After overnight growth at 37 °C, several colonies may be picked. Each colony may be cultured at 37 °C in a 15-mL tube containing 10 mL LB and 50 mg/L kanamycin or ampicillin with shaking at 250 revolutions per minute (rpm) for 12 h. Cells may be harvested and a QIAprep spin miniprep kit used to extract plasmids. After isolation, the desired plasmids may be all confirmed by sequencing.
[0048] Vectors pET28b-OFP and pET28b-OFP:a:B. The ofp gene may be amplified by PCR using the pmOrange plasmid and primers (forward) 5'- GGAATTCCATATGGTGAGCA-3' and (reverse) 5'-CGCGGATCCTACTTGTACAGC-3'. The underlined sequences are recognized by the restriction enzymes Ndel and BamHl, respectively. The PCR amplification product may be purified and extracted. The purified sample so obtained and the pET28b plasmid may be double-digested by Ndel and BamHl,
purified, and ligated. The ligation mixture may then be added to E. coli BL21(DE3) competent cells for transformation. Cells may then be plated on LB agar plates containing kanamycin and IPTG. Colony selection (by pink color), cell growth (in LB medium containing kanamycin), and plasmid extraction may be carried out as described above to obtain the pET28b-OFP vector.
[ 0049 ] The lucif erase luxAB genes may be amplified by PCR using the pUC19 vector harboring luciferase luxAB genes and the primers (forward) 5'- AGC GG ATC C ATGA A ATTTGG- 3 ' and (reverse) 5 ' -C GTC AA 3CTT ACGAGTGGT ATTT- 3'. The underlined sequences are recognized by the restriction enzymes BamHl and Hindlll, respectively. The purified PCR amplification product and pET28b-OFP plasmid may be separately double-digested by BamHl and Hindlll. The DNA fragments may be purified and may be ligated. The ligation mixture may then be added to E. coli BL21(DE3) competent cells for transformation. The cells may be plated on LB agar plates containing kanamycin and several colonies may be picked. Cell growth (in LB medium containing kanamycin) and plasmid extraction may be carried out. The desired plasmid, designated pET28b-OFG:a: , so obtained harbored both the ofp gene and the luciferase luxAB genes. The symbol ":" indicates that the two proteins on both sides of it are not fused. In this plasmid, a DNA fragment encoding a 20-residue peptide (MGS SHHHHHHS S GL VPRGSH) immediately precedes the start codon of the ofp gene, which is followed sequentially by a non-coding sequence, luxA, another non-coding sequence, and luxB.
[ 0050 ] Vectors vET28b-OFP- -a:B and vET28b-OFP-Lw-a:B. The replacement of the non-coding region between ofp and luciferase luxA with the sequence (5'- GGAGGAGGAGGAAC A-3 ' ) encoding a peptapeptide linker GGGGS (abbreviated L5) gives rise to the plasmid designated pET28b-OFP-Ls-a: . To this end, the pET28b-OFP:a: plasmid may be mutated using the QuikChange II kit and the primers 5'- GCATGGACGAGCTGTACAAGGGAGGAGGAGGAACAATGAAATTTGGAAACTTCC
T-3' and 5'-
AGGAAGTTTCCAAATTTCATTGTTCCTCCTCCTCCCTTGTACAGCTCGTCCATGC- 3'.
[ 0051 ] The same procedures described above for the preparation of pET28b-OFG may be followed for the transformation of E. coli strain BL21(DE3) competent cells with the plasmid so obtained, cell growth, and isolation of the desired pET28b-OFP-Ls-a: plasmid. The expression of this plasmid produced the OFP-Ls-a: fusion enzyme in which the C terminus of OFP may be fused (as indicated by "-") to the N terminus of the luciferase a
subunit via the L5 linker while the luciferase β remained non-covalently associated (as indicated by ":") with this modified a. For this OFP-Ls- i designation, the individual protein components and the linker are also arranged (from left to right) in the same sequence as the locations of their encoding genes, with the most upstream gene corresponding to the first protein component in the designation (i.e. the ofp gene and OFP, respectively, in the present case). All other plasmids and their encoding fusion enzymes are designated following the same set of rules.
[ 0052 ] The plasmid pET28b-OFP-Lio-a:P in which the non-coding region between ofp and luciferase luxA may be replaced by a sequence encoding a ten-amino-acid GGGGSGGGGS (abbreviated L10) linker may be constructed the same way as that for pET28b-OFP-L5-a: except by using the primers 5'-
GGACGAGCTGTACAAGGGAGGAGGAGGAACAGGAGGAGGAGGAACAA-3' and 5'- TTGTTCCTCCTCCTCCTGTTCCTCCTCCTCCCTTGTACAGCTCGTCC-3'. The encoded fusion enzyme OFP-Lio- : is similar to OFP-Ls-a:P except that the C terminus of OFP may be fused to the N terminus of a via the Llo linker mentioned above.
[ 0053 ] Vectors ρΕΤ21ϋ-α:β and pET21b- ^:OFP . The luciferase luxAB genes may be amplified by PCR using the pUC19 vector and primers (forward) 5'- CGTCC ATATGAAATTTGGAAAC-3 ' and (reverse) 5'-
CGTC A AGCTT AC G AGTGGT ATTT- 3 ' . The underlined sequences are recognized by the restriction enzymes Ndel and Hindlll, respectively. The purified PCR amplification product and pET21b plasmid may be separately double-digested by Ndel and Hindlll, and the digested products may be purified. DNA fragments so obtained (50 ng from plasmid template and 150 ng from PCR amplification product in 20 μL ligation solution) may be mixed with T4 ligase (400 U of in 1 μί), and incubated at 16 °C for 12 h for ligation. The ligated products may be used to transform the E. coli BL21(DE3)pLysS competent cells, and the treated cells may be plated on LB agar plates containing ampicillin and IPTG. As described above, several colonies may be selected and grown in LB medium containing ampicillin. Plasmids may be extracted from the harvested cells, and the desired pET21b-a: vector may be isolated.
[ 0054 ] The ofp gene may be amplified by PCR using pmOrange and primers:
(forward) 5 ' -CGTCAAGCTTATGGTGAGCAA-3 ' and (reverse) 5'- TACGGCCGACTTGTACAGC-3'. The underlined sequences are recognized by the restriction enzymes Hindlll and Eagl, respectively. The purified PCR amplification product and pET21b-a: plasmid may be separately double-digested by Hindlll and Eagl, and
ligations may be carried out using T4 DNA ligase. E. coli BL21(DE3)pLysS competent cells may be transformed with the ligated products, and may be plated on LB agar plates containing ampicillin and IPTG. Selected individual colonies may be grown in LB medium containing ampicillin, and plasmids may be extracted from harvested cells for the isolation of the desired pET21b-a:P:OFP plasmid.
[ 0055 ] Vector pET21b-a:fi-L -OFP. The non-coding region between lucif erase luxB and ofp in pET21b-a:P:OFP may be mutated to the same DNA sequence encoding the L5 linker as stated above by using the QuikChange lightning site-directed mutagenesis kit and the primers 5'-
CGTCAAATACCACTCGGGAGGAGGAGGAACAATGGTGAGCAAGGGCG-3' and 5'- CGCCCTTGCTCACCATTGTTCCTCCTCCTCCCGAGTGGTATTTGACG-3'. Cell transformation, colony selection, cell growth, and plasmid extraction may be the same as that described for the preparation of pET28b-OFP-Ls-a: except that ampicillin may be used replacing kanamycin in both the LB agar and liquid media. The desired pET21b-a: -Ls-OFP plasmid so obtained encoded the fusion enzyme i -Ls-OFP in which the C terminus of luciferase β may be fused with the N terminus of OFP via the L5 linker and this modified β may be non-covalently associated with the luciferase a.
[ 0056 ] Vectors pET21b-B. pET21b-B:a. and pET21b-B:a:OFP. The luciferase luxB gene may be amplified by PCR using the pUC19 vector and the primers: (forward) 5'- GACCATATGAAATTTGGATTATTCTTC-3 ' and (reverse) 5'-
[ 0057 ] GATGGATCCTTACGAGTGGTATTT-3 ' . The underlined sequences are recognized by restriction enzymes Ndel and BamHl, respectively. The purified PCR amplification product and pET21b plasmid may be independently double-digested by Ndel and BamHl, and ligated using T4 DNA ligase. The sample so obtained may be used to transform E. coli BL21(DE3)pLysS competent cells. The cells may then be plated on LB agar plates and several single colonies may be individually grown in LB medium, both containing ampicillin. Plasmids may be extracted and the desired pET21b- plasmid may be isolated. The luciferase luxA may also be amplified by PCR using with the pUC19 vector and primers (forward) 5 ' -C AGAGCTCATGAAATTTGGAAAC-3 ' and (reverse) 5'- CGTCAAGCTTACTGTTTTTCTTTGA-3 ' . The underlined sequences are recognized by the restriction enzymes Sacl and Hindlll, respectively. The purified PCR amplification product and pET21b- may be independently double-digested by Sacl and Hindlll, and ligated using T4 DNA ligase. The same procedures described for pET21b- may be then followed for the isolation of a plasmid which contained, sequentially, the luciferase luxB, a non-coding
sequence, and luxA. However, the non-coding sequence had no ribosome binding site (rbs) upstream of the luciferase luxA. The rbs is needed for the translation of luciferase a. Therefore, the non-coding region may be replaced by 5'-AAGGAGAGAGAC-3' for the insertion of the rbs site by mutation using the primers 5'- AACATCGTCAAATACCACTCGTAAAAGGAGAGAGACATGAAATTTGGAAACTTC CTTCTC-3' and 5'-
GAGAAGGAAGTTTCCAAATTTCATGTCTCTCTCCTTTTACGAGTGGTATTTGACG ATGTT-3'. Following the same procedures as stated above, a plasmid designated pET21b- β:α may be obtained the expression of which produced active native luciferase.
[ 0058 ] The ofp may be amplified by PCR using the mOrange plasmid and the primers (forward) 5 ' -CGTC AAGCTTATGGTGAGCAA-3 ' and (reverse) 5'- TACGGCCGACTTGTACAGC-3' . The underlined sequences are recognized by the restriction enzymes Hindlll and Eagl, respectively. The purified PCR amplification product and the pET21b-P:a plasmid may be independently double-digested by Hindlll and Eagl, and may be ligated using T4 DNA ligase. Same as described above, the desired plasmid pET21b- :a:OFP may be isolated which encodes the functionally active luciferase and OFP but none of these protein components will be fused.
[ 0059 ] Vector pET21b-fi:a-L -OFP. The replacement of the non-coding region between the luciferase luxA and ofp with the same sequence encoding the L5 linker may be conducted using the pET28b-OFP:a:P plasmid and the primers 5'- ATATCTCAAAGAAAAACAGGGAGGAGGAGGAACAATGGTGAGCAAGGGCGAGG
-3' and 5'-
CCTCGCCCTTGCTCACCATTGTTCCTCCTCCTCCCTGTTTTTCTTTGAGATAT-3'.
[ 0060 ] The non-coding region between the mOrange and luciferase a may be replaced by 5 ' -GGAGGAGGAGG AAC A-3 ' . The same procedures as stated for pET21b- may be followed, except that IPTG may also be included in the LB agar medium, for the isolation of the plasmid pET21b- :a-Ls-OFP. The expression of this plasmid gives rise to the production of the fusion enzyme :a-Ls-OFP, in which the C terminus of a is fused with the N terminus of OFP via the L5 linker and the β is non-covalently associated with this modified a.
[ 0061 ] Vectors pET28b-OFP:B:a and pET28b-OFP-L1-B:a. The pET21b- :a may be used for PCR along with primers (forward) 5'- TACGGATCCATGAAATTTGGATT-3 ' and (reverse) 5'-CGTCAAGCTTACTGTTTTTCTTTGA-3' . The underlined sequences are recognized by the restriction enzymes BamHl and Hindlll, respectively. The purified PCR
amplification product and pET28b-OFP may be independently double-digested by BamHl and Hindlll, and may be ligated using T4 DNA ligase. The sample may then be used to transform E. coli BL21(DE3)pLysS competent cells. The same procedures as stated for pET28b-OFP may be then followed for the isolation of the plasmid pET28b-OFP ':β:α. The replacement of the non-coding region between ofp and luciferase luxB with the same sequence for the L5 linker may be conducted by mutation of pET28b-OFP ':β:α. using the primers 5'-
[ 0062 ] GGCATGGACGAGCTGTAC AAGGGAGGAGGAGGAAC AATGAAATT
TGGATTATTCTTCC-3' and 5'-
GGAAGAATAATCCAAATTTCATTGTTCCTCCTCCTCCCTTGTACAGCTCGTCCATG CC
[ 0063 ] -3'. The plasmid solution may then be used to transform E. coli BL21(DE3) competent cells. The transformed cells may be subsequently subjected to the same treatments as described for pET28b-OFP ':β:α cells for the isolation of the vector pET28b-OFP-Ls- :a. For the fusion enzyme OFP-Fs- : encoded by this plasmid, the F5 linker is fused to the N terminus of luciferase β while a is non-covalently associated with this modified β.
[ 0064 ] Protein purification. V. harveyi luciferase and FRP may be purified as previously describe. For the expression and isolation of luciferase-OFP fusion enzymes, E. coli BF21(DE3) or E. coli BF21(DE3)pFysS cells carrying the plasmids for luciferase-OFP fusion enzymes or OFP may be grown in 1 F Furia-Bertani with 50 mg/F kanamycin (for plasmids originated from pET28b) or 50 mg/F ampicillin (for plasmids originated from pET21b) at 37 °C and may be shaken at 250 rpm in a C25KC Incubator Shaker (New Brunswick Scientific) until OD6oo nm reaches about 1.0. IPTG may be added into the cell culture at 1 mM. The cell culture may be incubated at 28 °C at 250 rpm for another 20 h. Cells may be harvested by centrifugation at 7000 rpm for 1 h using a Beckman Coutler J2-HS centrifuge. The cell pellet so obtained may be suspended in 35 mL ice-cooled binding buffer (i.e. the standard buffer of 50 mM Pi, pH 7.0, supplemented with 0.5 M NaCl, 0.5 mM DTT and 20 mM imidazole) and sonicated on ice for 7.5 min by using a Fisher Scientific sonic dismembrator model 500. The cell lysate may be centrifuged at 14,000 g for 30 min, and the supernatant may be collected and filtered through a 0.2-μιη PES filter. The filtrate may be loaded on a 5-mF HisTrap HP column equilibrated with the binding buffer. The column may be eluted first with the same binding buffer until absorbance at 280 nm reaches near zero, and then with an elution buffer (standard buffer containing 0.5 M NaCl, 0.5 mM DTT and 500 mM imidazole). Fractions containing the desired fusion protein may be identified by A28o
and the fluorescent-protein color for collection. The pooled fractions may be applied to a HiPrep 26/10 desalting column, and recovered in the standard buffer containing 0.5 mM DTT. The sample may be then loaded on a Mono Q 5/50 GL column pre-equilibrated and then eluted with the same standard buffer containing 0.5 mM DTT until the absorbance at 280 nm reaches near zero. Subsequently, a (15 column volume) gradient of 0-0.5 M NaCl in the standard buffer containing 0.5 mM DTT may be applied. Fractions containing the desired fusion enzymes may be collected, pooled, and loaded on a HiPrep 26/10 desalting column for recovering the fusion enzymes in the standard buffer containing 0.5 mM DTT. Protein concentrations may be determined by using the DC protein assay kit from Bio-Rad and chicken egg white albumin as a standard.
[ 0065 ] Enzyme assays. Activities of native lucif erase and all luciferase-OFP fusion enzymes may be determined at room temperature by the dithionite assay or by the photoreduction assay, both in the standard buffer without (for the former) or with 20 mM EDTA (for the latter assay). In both assays, luciferase catalyzes a non-turnover single cycle reaction, for which the bioluminescence peak intensity, the total quantum output and, for the dithionite assay, the light decay rate may be measured. The arbitrary light intensities recorded may be converted to quantum (q) per second by calibration with a liquid light standard (19). For some bioluminescence measurements, a yellow cut-off filter (10BPF10- 480 7G311 ; 480 ±2 nm bandpass and <1 transmission at <460 nm) and an amber cut-off filter (10BPF10-570 7C299; 570 ±2 nm bandpass and <\% transmission at <532 nm) from Newport Company may also e used.
[ 0066 ] Measurement of bioluminescence spectra. A Varian Cary 50 spectrometer and a Varian Cary Eclipse fluorometer may be used for the measurements of absorption spectra and fluorescence/bioluminescence spectra, respectively. For the bioluminescence emission spectral measurements, an FRP-coupled bioluminescence reaction may be initiated by rapidly mixing FRP with NADPH, FMN, decanal and luciferase (or fusion enzymes) in a fluorescence cuvette. The bioluminescence emission spectrum may be measured when the bioluminescence emission reaches a steady level.
[ 0067 ] Natural extensions of the present disclosure may be improvements in the energy transfer efficiencies observed with OFP-Ls- i and OFP-Lio- : by using other fluorescent proteins or linkers of choice following the same approach as described above. Further, similar approaches may be used to generate various fluorescent protein- or fluorescent chromophore-attached luciferases as multiple color emitters. For exemplary purposes, where a fluorescent protein is used as the energy acceptor, the fusion enzyme may
be used as sensor for both in vitro and in vivo systems. Suitable organic fluorophores may also be used as the energy acceptor after chemical linking to luciferase as long as their absorption overlaps with the normal bacterial bioluminescence, and their fluorescence emission is in a wavelength range higher than the luciferase bioluminescence. By using organic fluorophores, bacterial luciferase may also be converted to multi-color sensors. However, the fluorophore-attached luciferase is best suited for in vitro systems.
[ 0068 ] The foregoing description of the preferred embodiments is provided to enable any person skilled in the art to make or use the claimed subject matter. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without the use of the innovative faculty. Thus, the claimed subject matter is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
[ 0069 ] The detailed description set forth above in connection with the appended drawings is intended as a description of exemplary embodiments in which the presently disclosed compositions and methods can be practiced. The term "exemplary" used throughout this description means "serving as an example, instance, or illustration," and should not necessarily be construed as preferred or advantageous over other embodiments.
[ 0070 ] Further, although exemplary embodiments disclosed above implement the elements of the disclosed subject matter have been provided, one skilled in the art, using this disclosure, could develop additional compositions, methods, hardware, and/or software to practice the disclosed subject matter and each is intended to be included herein.
[ 0071 ] In addition to the above described embodiments, those skilled in the art will appreciate that this disclosure has application in a variety of arts and situations and this disclosure is intended to include the same.
Claims
claimed is:
A luminescent sensor system comprising:
a fusion molecule complex, wherein said fusion molecule complex is comprised of an energy donor molecule attached to an energy acceptor molecule, and further wherein after said energy donor molecule is attached to said energy acceptor molecule, said energy acceptor molecule produces a different luminescence, and further wherein said energy donor maintains wild-type luminescent activity; and
a plurality of substrates, wherein said plurality of substrates interact with said fusion molecule complex for producing luminescence.
The luminescent sensor system of Claim 1, wherein at least one of said plurality of substrates supports the reaction catalyst such that there is not necessarily an external substrate required.
The luminescent sensor system of Claim 1, wherein said energy donor molecule is comprised of a bacterial luciferase.
The luminescent sensor system of Claim 1, wherein said energy acceptor molecule is comprised of a fluorescent protein.
The luminescent sensor system of Claim 4, further wherein said fluorescent protein being fluorescent protein mOrange.
The luminescent sensor system of Claim 1, wherein said energy acceptor molecule is comprised of a fluorescent acceptor chromophore.
The luminescent sensor system of Claim 1, wherein said energy acceptor molecule is comprised of an organic fluorophore.
The luminescent sensor system of Claim 7, further comprised of a plurality of multicolor sensors.
9. The luminescent sensor system of Claim 3, further wherein said bacterial luciferase is attached to a fluorescent protein by a covalent linkage.
10. The luminescent sensor system of Claim 9, further wherein said energy transfer between said bacterial luciferase and said fluorescent protein causes a shift in its emission spectrum.
11. The luminescent sensor system of Claim 9, further wherein said fluorescent protein is attached to an alpha-subunit of said bacterial luciferase.
12. The luminescent sensor system of Claim 11, further wherein said fluorescent protein is attached to an N-terminus of said alpha-subunit of said bacterial luciferase.
13. The luminescent sensor system of Claim 12, further wherein said covalent linkage is comprised of a short peptide linker.
14. The luminescent sensor system of Claim 12, further wherein said covalent linkage is comprised of an appropriate linker for improving energy transfer efficiencies.
15. The luminescent sensor system of Claim 1, wherein a trace amount of said fusion molecule complex is capable of magnifying luminescent emission.
16. A method of making a fusion protein, the method comprising the steps of:
(a) amplifying a fluorescent protein gene and a luciferase gene;
(b) inserting a peptide linker between said fluorescent protein gene and said luciferase; and
(c) constructing a plasmid, said plasmid encoding said fusion protein, and wherein said fusion protein is produced by expressing said plasmid.
17. The method of Claim 16, further comprising said fluorescent protein being fluorescent protein mOrange.
18. The method of Claim 16, further comprising said luciferase being bacterial luciferase.
19. The method of Claim 16, further comprising said peptide linking capable of improving energy transfer efficiencies.
20. The method of Claim 16, further comprising the step of expressing said plasmid.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201161500826P | 2011-06-24 | 2011-06-24 | |
| US61/500,826 | 2011-06-24 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2012178136A2 true WO2012178136A2 (en) | 2012-12-27 |
| WO2012178136A3 WO2012178136A3 (en) | 2013-04-11 |
Family
ID=47423257
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2012/043913 Ceased WO2012178136A2 (en) | 2011-06-24 | 2012-06-24 | Fusion proteins of bacterial luciferase as multicolor luminescent sensors |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US9127282B2 (en) |
| WO (1) | WO2012178136A2 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP7553993B1 (en) | 2023-10-18 | 2024-09-19 | 国立大学法人大阪大学 | Photoproteins |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10446700B2 (en) * | 2013-05-22 | 2019-10-15 | W&Wsens Devices, Inc. | Microstructure enhanced absorption photosensitive devices |
| CN103616502B (en) * | 2013-09-12 | 2016-05-25 | 西北农林科技大学 | Based on the method for bacterial luciferase BRET technology for detection protein interaction |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5976796A (en) | 1996-10-04 | 1999-11-02 | Loma Linda University | Construction and expression of renilla luciferase and green fluorescent protein fusion genes |
| JP2002507410A (en) | 1998-03-27 | 2002-03-12 | プロルーム・リミテッド | Luciferases, fluorescent proteins, nucleic acids encoding luciferases and fluorescent proteins and their use in diagnostics, high-throughput screening and novel items |
| CA2335305C (en) | 1998-06-16 | 2006-05-23 | Biosignal Packard Inc. | A bioluminescence resonance energy transfer (bret) system and its use |
| WO2001046694A2 (en) * | 1999-12-22 | 2001-06-28 | Biosignal Packard Inc. | A bioluminescence resonance energy transfer (bret) fusion molecule and method of use |
-
2012
- 2012-06-24 WO PCT/US2012/043913 patent/WO2012178136A2/en not_active Ceased
- 2012-06-24 US US13/531,558 patent/US9127282B2/en active Active
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP7553993B1 (en) | 2023-10-18 | 2024-09-19 | 国立大学法人大阪大学 | Photoproteins |
| WO2025084218A1 (en) * | 2023-10-18 | 2025-04-24 | 国立大学法人大阪大学 | Luminescent protein |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2012178136A3 (en) | 2013-04-11 |
| US9127282B2 (en) | 2015-09-08 |
| US20130023027A1 (en) | 2013-01-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Branchini et al. | Red-emitting luciferases for bioluminescence reporter and imaging applications | |
| Kelley et al. | Replacement of proline-76 with alanine eliminates the slowest kinetic phase in thioredoxin folding | |
| RU2251571C2 (en) | RECOMBINANT THERMOSTABLE LUCIFERASE, METHOD FOR PRODUCTION THEREOF, ISOLATED NUCLEAR ACID, EXPRESSING VECTOR, KIT FOR BIOLUMINESCENT ASSAY, ANALYTICAL TEST FOR CoA DETECTION IN THE SAMPLE | |
| JP7780560B2 (en) | Luciferase sequences that utilize infrared-emitting substrates to produce enhanced luminescence | |
| EP1978092A1 (en) | Mutant luciferases | |
| Nakamura et al. | A luminescent Nanoluc-GFP fusion protein enables readout of cellular pH in photosynthetic organisms | |
| Dunuweera et al. | A comprehensive exploration of bioluminescence systems, mechanisms, and advanced assays for versatile applications | |
| Kotlobay et al. | Palette of luciferases: natural biotools for new applications in biomedicine | |
| Rogers et al. | mRhubarb: Engineering of monomeric, red-shifted, and brighter variants of iRFP using structure-guided multi-site mutagenesis | |
| Oliveira Paiva et al. | Practical observations on the use of fluorescent reporter systems in Clostridioides difficile | |
| US9127282B2 (en) | Fusion proteins of bacterial luciferase as multicolor luminescent sensors | |
| Tinikul et al. | The fusion Vibrio campbellii luciferase as a eukaryotic gene reporter | |
| Oba et al. | Functional conversion of fatty acyl-CoA synthetase to firefly luciferase by site-directed mutagenesis: a key substitution responsible for luminescence activity | |
| Branchini et al. | Mutagenesis and structural studies reveal the basis for the activity and stability properties that distinguish the Photinus Luciferases scintillans and pyralis | |
| CN117106097A (en) | An RNA-protein complex and its application | |
| Ke et al. | Activities, kinetics and emission spectra of bacterial luciferase‐fluorescent protein fusion enzymes | |
| WO2017059002A1 (en) | An optogenetic system based on bacterial phytochrome controllable with near infra-red light | |
| WO2024089297A1 (en) | Novel fluorescent and bioluminescent proteins and reporter systems for ratiometric measurement of luminescence | |
| Chang et al. | A low-cost, sensitive reporter system using membrane-tethered horseradish peroxidase for efficient gene expression analysis | |
| Halliwell | Protein engineering utilising single amino acid deletions within Photinus pyralis firefly luciferase | |
| US20150152395A1 (en) | Chimeric luciferases | |
| Brovko et al. | Illuminating cellular physiology: recent developments | |
| JP7553993B1 (en) | Photoproteins | |
| Ke | Isoniazid Activation by Mycobacterium tuberculosis Catalase-Peroxidase R104A/H108A Double Mutant-Kinetics and Emission Spectra of Vibrio harveyi Luciferase-Discosoma sp. Fluorescent Protein Fusion Proteins | |
| Huang et al. | Engineering of prevalent luciferase–luciferin pairs toward tunable light and applications in the field of bioluminescence imaging |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12802367 Country of ref document: EP Kind code of ref document: A2 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 12802367 Country of ref document: EP Kind code of ref document: A2 |