WO2012175751A2 - Fc variants with reduced effector functions - Google Patents
Fc variants with reduced effector functions Download PDFInfo
- Publication number
- WO2012175751A2 WO2012175751A2 PCT/EP2012/062273 EP2012062273W WO2012175751A2 WO 2012175751 A2 WO2012175751 A2 WO 2012175751A2 EP 2012062273 W EP2012062273 W EP 2012062273W WO 2012175751 A2 WO2012175751 A2 WO 2012175751A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- region
- variant
- 294del
- amino acid
- polypeptide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2887—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against CD20
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P39/00—General protective or antinoxious agents
- A61P39/02—Antidotes
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/40—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against enzymes
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/31—Immunoglobulins specific features characterized by aspects of specificity or valency multispecific
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/52—Constant or Fc region; Isotype
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/71—Decreased effector function due to an Fc-modification
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
Definitions
- the present invention relates to a method for preparing Fc variants displaying reduced effector activities.
- Therapeutics derived from antibodies are more and more used in the treatment of a variety of pathological conditions such as cancers, autoimmune disorders, graft rejections and infectious diseases.
- pathological conditions such as cancers, autoimmune disorders, graft rejections and infectious diseases.
- mAbs monoclonal antibodies
- fusion proteins also called immunoadhesins
- ADCC antibody-dependent cell-mediated cytotoxicity
- CDC complement-dependent cytotoxicity
- ADCP antibody-dependent cellular phagocytosis
- FcyRs Fc gamma receptors
- Fc domain of antibodies are also involved in serum persistence through interaction with the neonatal Fc receptor (FcRn).
- the induction of ADCC, CDC and/or ADCP is not required for achieving therapeutic effect.
- inductions have to be avoided in order to reduce side-effects and prevent IgG- cytotoxicity such as in the case of the treatment of ongoing graft rejection with the anti- CD3 monoclonal antibody orthoclone OKT3.
- the administration of orthoclone OKT3 was shown to induce massive systemic release of pro-inflammatory cytokines which is a consequence of the binding of orthoclone OKT3 to Fc gamma receptors.
- FcyRs may have an adverse impact on the treatment such as for the EGFR-targeting antibody, cetuximab, which has been suggested to active tumor-promoting M2 macrophages and decrease progression-free survival of patients (Pander J. et al., 201 1 ).
- lgG1 and lgG3 trigger both ADCC and CDC activities.
- lgG2 elicits CDC activity but not ADCC and lgG4 displays a very poor ability to induce complement and cell activation because of low affinity for C1 q and Fc gamma receptors. Consequently, lgG4 has become the preferred subclass for immunotherapy, in which recruitment of host effector function is undesirable.
- Neutralizing lgG4 antibodies have been already approved for the treatment of specific conditions. For example, natalizumab is an anti-cc4 integrin mAb for the treatment of multiple sclerosis. Despite this fact, some reluctance concerning the use of lgG4 in immunotherapy remains due to its in vivo instability and dynamics.
- an lgG4 Fc variant comprising the amino acid modification.
- S228P was conceived. Said modification was shown to stabilize the heavy chain dimer formation with still possible Fab arm exchange in low proportions ( ⁇ 8,3%) (Labrijn et al., Nature Biotech, 2009, 27, 767-771 ). IgG hybrids were also engineered in order to generate new therapeutic mAbs with low effector activities and improved pharmacological profile (Reddy et al., The journal of Immunology, 2000, 164, 1925- 1933). Alexion Pharmaceuticals have developed a humanized lgG2/4 kappa antibody against the complement component C5 named Eculizumab.
- Eculizimab The heavy chains of Eculizimab are comprised of human lgG2 sequences in constant region 1 (CH1 ), the hinge and the adjacent portion of constant region 2 (CH2), and human lgG4 sequences in the remaining part of CH2 and constant region 3 (CH3).
- Eculizimab has been approved for the treatment of paroxysmal nocturnal hemoglobinuria and haemolytic uraemic syndrome by the European Medecines Agency.
- An et al. conceived an lgG2 variant with altered effector functions by introducing four amino acids from lgG4 (namely 268Q/309L/330S/331 S) into the corresponding positions in lgG2 backbone.
- the resulting IgG exhibited no detectable binding to C1 q, FcyRI and FcyRllla and a poor affinity for FcyRllb/c while still having a serum half-life similar to that of wild-type lgG2 (An et ai, mAbs, 2009,1 :6,572-579).
- Determinant positions were also found in CH2 domain such as amino acid positions 327, 330 and 331 which mutations may greatly reduce the ability to induce both ADCC and CDC responses. Accordingly, Xu et al. showed that the introduction of the mutations 234A/235A in a human lgG1 -based OKT3 antibody significantly reduces the binding to FcyRI, FcyRII and C1 q which prevents the cytokine release syndrome observed with unmodified OKT3 antibody while maintaining the ability to reverse ongoing graft rejection (Xu et al., Cell Immunol, 2000, 1 :16-26).
- InvivoGen marketed a plasmid encoding for a human engineered lgG1 Fc variant comprising the mutations 233P/234V/235A/236Del/327G/330S/331 S.
- Such mutations drastically reduce the ability of the lgG1 Fc variant to induce ADCC and CDC.
- glycosylation on asparagine at position 297 of the Fc region has a direct impact on the ability of monoclonal antibodies to bind FcyR and to trigger ADCC (for review see Abes et al., Pharmaceuticals, 2010, 3, 146-157).
- the invention relates to a method for producing a variant of a parent polypeptide comprising a Fc region, which variant exhibits reduced binding to the protein C1 q and to at least one receptor FcyR as compared to the said parent polypeptide, wherein an amino acid modification selected from the group consisting of 294Del, 293Del and 293Del/294Del is introduced within the Fc region of the parent polypeptide, the numbering of the Fc region referring to the numbering according to the EU index (as in Kabat), or its equivalent in Kabat (Kabat numbering).
- Another object of the invention is a variant of a parent polypeptide comprising a Fc region, which variant exhibits reduced binding to the protein C1 q and to at least one receptor FcyR as compared to the said parent polypeptide and comprises an amino acid modification selected from the group consisting of 294Del, 293Del and 293Del/294Del within its Fc region, the numbering of amino acids in the Fc region referring to the numbering according to the EU index, or equivalent in Kabat.
- the invention also relates to pharmaceutical composition comprising the said variant and to the use of the said variant for preventing or treating a pathological condition wherein the induction of ADCC and/or CDC response is not desirable.
- Figure 1 shows alignments of native human lgG1 sequences referring to positions 216-447 (according to EU index) with the corresponding sequences of human lgG2 (SEQ I D NO:7), human lgG3 (SEQ I D NO:8) and human lgG4 (SEQ I D NO:9).
- the lgG1 sequences refer to G1 m1 , 1 7 allotype (SEQ I D NO:5) and to G1 m3 allotype (SEQ I D NO:6).
- the "lower hinge-CH2-CH3" domain of lgG1 begins at position 226 (see arrow).
- Figure 2 shows the plasmid vector pMGM05-R603 in which human Fc gene encoding amino acid residues 226-447 (according to EU index) derived from a human lgG1 heavy chain (Fc226, SEQ n °1 ) was cloned into between the two restriction sites BamHI and Notl.
- the numbering of the residues in the Fc region is that of the immunoglobulin heavy chain according to the EU index as described in Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1 991 ), expressly incorporated herein by reference.
- the "EU index” or "EU index as in Kabat” herein refers to the residue numbering of the human lgG1 EU antibody.
- the equivalent in Kabat refers to the number in Kabat numbering.
- polypeptide or "protein” as used herein is meant at least two covalently attached amino acids, which includes proteins, polypeptides, oligopeptides and peptides.
- amino acid as used herein is meant one of the 20 naturally occurring amino acids or any non-natural analogues that may be present at a specific, defined position.
- amino acid modification herein is meant a change in the amino acid sequence of a polypeptide.
- amino acid modifications which may be also termed “amino acid changes”, herein include amino acid mutations such as substitution, insertion, and/or deletion in a polypeptide sequence.
- amino acid substitution or “substitution” herein is meant the replacement of an amino acid at a particular position in a parent polypeptide sequence with another amino acid.
- substitution N434S refers to a variant polypeptide, in this case an Fc variant, in which the asparagine at position 434 is replaced with serine.
- amino acid insertion or “insertion” as used herein is meant the addition of an amino acid at a particular position in a parent polypeptide sequence.
- insert G>235-236 designates an insertion of glycine between positions 235 and 236.
- amino acid deletion or “deletion” as used herein is meant the removal of an amino acid at a particular position in a parent polypeptide sequence.
- E294Del or 294Del designates that the amino acid at position 294 (herein a glutamate) is deleted.
- An amino acid modification may refer to a punctual mutation or a combination of mutations.
- the preferred format is the following: 294Del/259l/315D/434Y or E294Del/V259l/N315D/N434Y. That means that there are four amino acid mutations in the Fc region of the variant as compared to its parent polypeptide: one in position 294, one in position 259, one in position 315 and one in position 434, and that amino acid in position 294, i.e. glutamate, is deleted, the amino acid in position 259 of the parent polypeptide, i.e. valine, is replaced by isoleucine, that the amino acid in position 315 of the parent polypeptide, i.e.
- amino acid modification 293Del/294Del means that the amino acids on position 293 and 294 are deleted as compared to the polypeptide parent.
- antibody refers to any polypeptide which at least comprises (i) a Fc region and (ii) a binding polypeptide domain derived from a variable region of an immunoglobulin.
- Antibodies thus include, but are not limited to, full-length immunoglobulins, multi-specific antibodies, Fc-fusion protein comprising at least one variable region, synthetic antibodies (sometimes referred to herein as "antibody mimetics"), engineered antibodies comprising more than one Fc region, chimeric antibodies, humanized antibodies, fully human antibodies, antibody-fusion proteins, antibody conjugates and fragments of each respectively.
- full-length antibody or by “immunoglobulin” as used herein is meant the structure that constitutes the natural biological form of an antibody, including variable and constant regions.
- Full-length antibody covers monoclonal full-length antibodies, wild-type full-length antibodies, chimeric full-length antibodies, humanized full-length antibodies, fully human full-length antibodies, the list not being limitative.
- full-length antibodies In most mammals, including humans and mice, the structure of full-length antibodies is generally a tetramer. Said tetramer is composed of two identical pairs of polypeptide chains, each pair having one "light" chain (typically having a molecular weight of about 25 kDa) and one "heavy” chain (typically having a molecular weight of about 50-70 kDa). In some mammals, for example in camels and llamas, full-length antibodies may consist of only two heavy chains, each heavy chain comprising a variable domain attached to the Fc region.
- each chain includes a variable region of about 1 00 to 1 1 0 or more amino acids primarily responsible for antigen recognition and comprising the so-called complementarity-determining regions (CDR).
- CDR complementarity-determining regions
- each chain defines a constant region primarily responsible for effector functions.
- light chains are classified as kappa and lambda light chains.
- Heavy chains are classified as mu, delta, gamma, alpha, or epsilon, and define the antibody's isotype as IgM, IgD, IgG, IgA, and IgE, respectively.
- IgG as used herein is meant a polypeptide belonging to the class of antibodies that are substantially encoded by a recognized immunoglobulin gamma gene.
- IgG comprises the subclasses or isotypes lgG1 , lgG2, lgG3, and lgG4.
- mice IgG comprises lgG1 , lgG2a, lgG2b, lgG3.
- Full-length IgGs consist of two identical pairs of two immunoglobulin chains, each pair having one light and one heavy chain, each light chain comprising immunoglobulin domains VL and CL, and each heavy chain comprising immunoglobulin domains VH, Cyl (also called CH1 ), Cy2 (also called CH2), and C 3 (also called CH3).
- CH1 refers to positions 1 1 8-21 5
- CH2 domain refers to positions 231 -340
- CH3 domain refers to positions 341 -447 according to the EU index or respectively 1 14-223, 244-360 and 361 - 478 in Kabat numbering.
- lgG1 also comprises a hinge domain which refers to positions 21 6-230 in the case of lgG1 according to the EU index or 226-243 in Kabat.
- Fc or “Fc region”, as used herein is meant the constant region of a full- length immunoglobulin excluding the first constant region immunoglobulin domain.
- Fc refers to the last two constant region immunoglobulin domains of IgA, IgD, and IgG, the last three constant region immunoglobulin domains of IgE and IgM, and the flexible hinge N-terminal to these domains.
- Fc may include the J chain.
- Fc comprises immunoglobulin domains CH2, CH3 and the lower hinge region between CH1 and CH2.
- Fc region of lgG1 consists of "lower hinge-CH2- CH3" domain i.e the domain from amino acid C226 to the carboxyl-terminus end, wherein the numbering is according to the EU index or equivalent in Kabat .
- the analogous domains for other IgG sub-classes can be determined from amino acid sequence alignment of heavy chains or heavy chain fragments of said IgG sub-classes with that of human lgG1 .
- Fc polypeptide as used herein is meant a polypeptide that comprises all or a part of an Fc region.
- Fc polypeptides include, but are not limited to, antibodies, Fc fusions, isolated Fes, Fc-conjugates and Fc fragments.
- parent polypeptide or "polypeptide parent” as used herein is meant an unmodified polypeptide that is subsequently modified to generate a variant.
- Said polypeptide may comprise one single polypeptide chain or several polypeptide chains which are not covalently linked together.
- Said parent polypeptide may be a naturally occurring polypeptide (wild-type polypeptide), a variant or an engineered version of a naturally occurring polypeptide, or a synthetic polypeptide.
- An engineered or a variant version of a naturally occurring polypeptide is a polypeptide wich is not encoded by a naturally occurring gene.
- the engineered polypeptide may be a chimeric antibody or a humanized antibody.
- Parent polypeptide may refer to the polypeptide itself, or the amino acid sequence that encodes it.
- the parent polypeptide comprises an Fc region selected from the group of wild-type Fc regions, their fragments and their mutants. Accordingly, the parent polypeptide may optionally comprise preexisting amino acid modifications in its Fc region (i.e. an Fc mutant) as compared to wild-type Fc regions.
- the parent polypeptide is an antibody, an immunoglobulin, an Fc fusion polypeptide, an Fc conjugate, this list not being limitative.
- variant polypeptide By “variant polypeptide”, “polypeptide variant” or “variant” as used herein is meant a polypeptide sequence that differs from that of a parent polypeptide sequence by virtue of at least one amino acid modification in the Fc region.
- wild-type or WT herein is meant an amino acid sequence or a nucleotide sequence that is found in nature i.e. that is naturally-occurring, including allelic variations.
- a WT protein, polypeptide, antibody, immunoglobulin, IgG, etc. have an amino acid sequence or a nucleotide sequence that has not been intentionally modified by molecular biological techniques such as mutagenesis.
- wild-type Fc regions include, without being limited to, Fc region of lgG1 having the sequence SEQ ID ⁇ , Fc region of lgG2 having the sequence SEQ ID N °2, Fc region of lgG3 having the sequence SEQ ID N °3, and Fc region of lgG4 having the sequence SEQ ID N °4.
- Fc receptor or “FcR” are used to describe a receptor that binds to an
- Fc region e.g., the Fc region of an antibody.
- FcyRs refer to human receptors which bind Fc region of IgG antibodies.
- FcyRs include FcyRI (CD64), FcyRII (CD32), FcyRIII (CD16) subclasses including their allelic variants and alternatively spliced forms of these receptors.
- FcyRs are also defined as either activating receptors (FcyRI, FcyRlla/c, FcyRllla/b) or inhibitory receptor (FcyRllb) as they elicit or inhibit immune functions.
- FcyRI family is composed of three genes (FCGRIA, FCGRIB and FCGRIC) but only the product of FCGRIA has been identified as full length surface receptor.
- the said product, namely FcyRI is expressed by dendritic cells (DC), macrophages and also activated neutrophils.
- FcyRII family is composed of three genes (FCGR2A, FCGR2B and FCGR2C) which encode the FcyRlla, FcyRllb and FcyRllc proteins.
- FcyRlla is expressed on monocytes, certain dendritic cells and neutrophils.
- FcyRllc is expressed on natural killer (NK) cells.
- FcyRllb is the broadly expressed FcyR.
- FcyRllb is virtually present on all leukocytes with exception of NK cells and T cells.
- FcyRIII are composed of two genes FCGR3A and FCGR3B which encode FcyRllla and FcyRlllb.
- the FcyRllla protein is expressed as a transmembrane protein on monocytes, tissue specific macrophages, dendritic cells, ⁇ / ⁇ cells, and natural killer cells.
- FcyRlllb is a GPI-anchored receptor expressed on the surface of neutrophils and basophils.
- Two alleles of the gene encoding FcyRlla generate 2 variants differing at position 131 (low-responder FcyRllaR131 and high-responder FcyRllaH131 ).
- two alleles of the gene encoding FcyRllla generate 2 variants differing at position 158 (low- responder FcyRlllaFI 58 and high-responder FcYRIIIaV158).
- NK cells which are believed to be the crucial mediators of antibody- dependent cell-cytotoxicity, only express FcyRllla and FcyRllc and none of the other FcyRs, in particular, the inhibitory FcyRllb.
- Each FcyR protein has differential ligand binding preferences with respect to IgG subclasses and distinct affinities for IgG subclasses.
- FcyRs Activating FcyRs trigger various immune responses such as phagocytosis, respiratory burst and cytokine production (TNF-a, IL-6) by antigen presenting cells (APC), antibody-dependent cellular cytotoxicity (ADCC) and degranulation by neutrophils and NK cells.
- APC antigen presenting cells
- ADCC antibody-dependent cellular cytotoxicity
- Activating FcyRs also play an important role in the clearance of immune complex.
- the inhibitory receptor FcyRllb is a critical regulatory element in B-cell homeostasis. It controls the threshold and the extent of cell activation.
- ADCC antibody-dependent cell-mediated toxicity
- NK cells NK cells
- other immune cells such as neutrophils and eosinophils.
- ADCC results from the activation of NK cells.
- the activation of NK cells involves the binding of their Fc receptors to the Fc region of IgG bound to antigens present on the surface of target cells. Such interactions induce the release by NK cells of cytokines and cytotoxic granules.
- an assay as described in de Romeuf et al. Br J Haematol. 2008 Mar;140(6):635-43, may be performed.
- C1 q is a hexavalent molecule with a molecular weight of approximately 460,000 kDa and a structure likened to a bouquet of tulips in which six collagenous "stalks" are connected to six globular head regions.
- C1 q forms with the two serine proteases, C1 r and C1 s, the complex C1 which is the first component of the complement cascade pathway.
- “Complement-dependent cytotoxicity” or CDC refers to the lysis of a target cell in the presence of complement. Activation of the classical complement pathway is initiated by the binding of C1 q to antibodies which are bound to their cognate antigen. To activate the complement cascade, C1 q has to bind to at least two molecules of lgG1 , lgG2, or lgG3 but only one molecule of IgM. To assess the ability of an antibody to induce CDC, an assay as described in Romeuf et al., Br J Haematol. 2008 Mar;140(6) :635-43, may be performed.
- Fc gamma receptors and their functions are reviewed in Nimmerjahn and Ravetch, Nature reviews Immunology, 2008, 8, 34-47.
- FcRn or “neonatal Fc Receptor” as used herein is meant a protein that binds the IgG antibody Fc region and is encoded at least in part by an FCRN gene.
- the functional FcRn protein comprises two polypeptides, often referred to as the heavy chain and light chain. The light chain is beta-2-microglobulin and the heavy chain is encoded by the FCRN gene.
- FcRn or FcRn protein refers to the complex of cc-chain with beta-2-microglobulin.
- the gene coding for FcRn is called FCGRT.
- FcRn is involved in the transfer of passive humoral immunity for a mother to her fetus and also in the control of the clearance of IgGs.
- FcRn and its function is reviewed e.g. in Roopenian, Nature Reviews Immunology, 2007, 7, 71 5-725. b. Method for decreasing Fc binding to C1q and FcyRs
- the present invention relates to a method for preparing Fc variants displaying reduced affinity for C1 q and/or for at least one Fey receptor as compared to its parent polypeptide.
- Fc region of both wild-type and engineered IgGs enable to significantly reduce the binding of said IgGs for both the protein C1 q and Fey receptors.
- the said single mutation corresponds to the deletion of the amino acid on position 294 (called hereunder 294Del), the amino acid numbering referring to the numbering according to the EU index or equivalent in Kabat .
- the Applicant showed that the lgG1 variant obtained by introducing 294Del in the amino acid sequence of an lgG1 comprising wild-type Fc region (i.e. a Fc region having the amino acid sequence of SEQ I D ⁇ ) failed to bind, or display a reduced binding as compared to corresponding wild-type lgG1 variants, to C1 q protein, FcyRl lb (also called CD32b), FcyRl la (also called CD32a), FcyRl l la (also called CD1 6a) and FcyRI (also called CD64) through ELISA assay (see I I I.2.1 and I I I.2.2 in the example).
- FcyRl lb also called CD32b
- FcyRl la also called CD32a
- FcyRl l la also called CD1 6a
- FcyRI also called CD64
- the introduction of the mutation 294Del also enabled to abrogate or limit the binding affinity to C1 q and Fey receptors in lgG1 polypeptides initially engineered to exhibit increased affinity for FcRn as compared to wild-type lgG1 .
- the lgG1 variant having the mutations 294Del/256N/378V/383N/434Y as compared to wild-type lgG1 was unable to bind both C1 q and FcyR receptors.
- the said parent polypeptides had increased capacity to bind at least one protein selected from C1 q and Fey receptors as compared to wild-type IgGI .
- the applicant further showed that the lgG1 variant obtained by introducing 294Del in the amino acid sequence of an lgG1 comprising wild-type Fc region may display a similar binding to FcRn as compared to their respective parent lgG1 .
- the introduction of the 294Del amino acid modification, the said mutation only results less than 35 % alteration of FcRn binding for the variants as compared to their parent lgG1 .
- By less than 35 % it is intended, less than 30 %, less than 25 %, less than 20 %, less than 15 %, less than 10 % and less than 5 %.
- the amino acid at position 293 is also a glutamic acid. Its deletion leads to the same nucleotidic and amino acid sequence as the deletion of the glutamic acid at position 294. Therefore, the variants 293Del and 294Del are the same polypeptides.
- a first object of the present invention is to provide a method for producing a variant of a parent polypeptide comprising a Fc region, which variant exhibits reduced binding to at least one protein selected from C1 q and Fey receptors as compared to the said parent polypeptide, wherein an amino acid modification selected from the group consisting of 294Del or 293Del and 293Del/294Del is introduced within the Fc region of the parent polypeptide, the numbering of the amino acid in the Fc region referring to the numbering according to the EU index, or equivalent in Kabat.
- a parent polypeptide refers to a polypeptide comprising an Fc region.
- Said parent polypeptide may be a naturally occurring polypeptide (wild-type polypeptide), a variant or an engineered version of a naturally occurring polypeptide, or a synthetic polypeptide.
- Parent polypeptides include, but are not limited to, antibodies, Fc fusion proteins, Fc conjugates, Fc derivated polypeptides, isolated Fc and fragments thereof.
- the engineered polypeptide may be a chimeric antibody or a humanized antibody.
- the Fc region of the parent polypeptide is preferably selected from the group consisting of wild-type Fc regions of human IgG subclasses, fragments and mutants thereof.
- Fc region of human IgGs corresponds to the "lower hinge"-CH2-CH3 domain.
- the "lower hinge"-CH2-CH3 domain of the wild type human IgGI s refers to amino acids from position 226 to position 447 according to the EU indexor equivalent in Kabat .
- the analogous domains for other human IgG sub-classes can be determined from amino acid sequence alignment of heavy chains of said IgG sub-classes with that of human IgGI s as shown in Figure 1 .
- the human IgG subclasses comprise lgG1 , lgG2, lgG3, lgG4, including their various allotypes.
- the sequences of Fc regions of lgG1 , lgG2, lgG3 and lgG4 correlate with sequences of SEQ ID ⁇ , SEQ ID N °2, SEQ ID N °3 and SEQ ID N °4 respectively.
- Fragments of Fc region are defined as polypeptides which comprise one or more polypeptides derived from a wild-type Fc region.
- the said fragment of the Fc region preferably comprises at least 100 consecutive residues from wild-type Fc region. At least 100 consecutive residues from a wild-type Fc region encompasses at least 140, at least 160, at least 200, at least 210 consecutive residue of said wild-type Fc region.
- the parent polypeptide can comprise a wild-type Fc mutant i.e a Fc region which already comprises pre-existing amino acid mutations such as additions, insertions and/or substitutions as compared to wild-type Fc regions.
- variant polypeptide or “variant” as used herein is meant a polypeptide sequence which differs from that of a parent polypeptide in virtue of at least one amino acid modification.
- the at least one amino acid modification necessarily encompasses an amino acid modification selected from the mutation 294Del, the mutation 293Del and the combination of mutation 293Del/294Del.
- the variant polypeptide according to the present invention may exhibit a reduced binding to the first complement component C1 q as compared to its parent polypeptide.
- the affinity of the variant for C1 q is lower than that of the parent polypeptide.
- the variant polypeptide according to the present invention may also exhibit an affinity for at least one Fey receptor lower than that of its parent polypeptide.
- Fey receptors include FcyRI, FcyRIII and FcyRII receptors.
- the at least one FcyR is selected from the group consisting of FcyRllla, FcyRlla, FcyRI and FcyRllb.
- the variant polypeptide exhibits a reduced binding to both C1 q and FcyRllla as compared to its polypeptide parent.
- the variant polypeptide exhibits a reduced binding to C1 q, FcyRlla and FcyRllla as compared to its polypeptide parent.
- the variant polypeptide exhibits a reduced binding to C1 q
- FcyRllla, FcyRlla and FcyRI as compared to its polypeptide parent.
- the variant polypeptide exhibits a reduced binding to C1 q, FcyRllla, FcyRlla, FcyRI and FcyRllb as compared to its polypeptide parent.
- the binding for C1 q or for anyone of Fc gamma receptors can be evaluated by well-known methods of the prior art such as ELISA assay, flow cytometry and Surface Plamon Resonance (SPR).
- the bond strength of a variant of the invention for a protein of interest may be compared to that of its parent polypeptide by calculating the ratio of their specific signals obtained by ELISA assay as described in the section III of the example.
- a variant exhibits a reduced binding for a protein of interest such as C1 q or FcyR as compared to its parent polypeptide if the ratio obtained by dividing the specific signal of said variant by that of the parent polypeptide is lower than 0.50, the said specific signals being determined by ELISA assay.
- the specific signal of the variant is 0.50-fold lower than the specific signal of its parent polypeptide.
- a ratio lower than 0.50 includes a ratio lower than 0.45, lower than 0.40, lower than 0.35, lower than 0.30, lower than 0.25, lower than 0.20, lower than 0.15, lower than 0.10, lower than 0.05, lower than 0.01 .
- the ratio is lower than 0.20.
- the preferred format for ELISA assay comprises the coating of the protein of interest.
- the binding of the variant and that of its polypeptide parent for a protein of interest may be compared through the determination of EC50 by an appropriate ELISA assay.
- the EC50 refers to the concentration of the variant which provides a signal representing 50% of the saturation of the curve relating to the percentage of bound protein of interest versus the log of the concentration of the variant.
- a variant displays a reduced binding to a protein of interest as compared to its polypeptide parent if its EC50 is at least 1 .5-fold higher than that of its polypeptide parent.
- the binding affinity of the variant to a protein of interest may also be assessed by SPR through the determination of the constant of dissociation (KD).
- KD constant of dissociation
- the affinity of the variant for C1 q or for a FcyR may be so weak that the specific signal by ELISA assay and even the Kd by SPR or the EC50 by ELISA assay cannot be accurately determined since the binding signal is in the background noise or under the threshold of detection. In such a case, the variant is considered not to bind the protein of interest.
- the variant obtained by the method according to the invention may not bind to at least one FcyR and exhibits a reduced binding to C1 q.
- Such a variant is clearly illustrated in the examples of the present application.
- the variant of the invention does not bind to at least one protein selected from C1 q and Fey receptors.
- the mutation 294Del is thus the sole amino acid modification introduced in the Fc region of the parent polypeptide to obtain the said variant.
- the mutation 293Del is the sole amino acid modification introduced in the Fc region of the parent polypeptide to obtain the said variant.
- amino acid modification del293/del294 is the sole amino acid modification introduced in the Fc region of the parent polypeptide to obtain the said variant.
- certain embodiments of the invention encompass a method for producing a variant of a parent polypeptide comprising a Fc region, which variant exhibits reduced binding to the protein C1 q and/or to at least one receptor FcyR as compared to the said parent polypeptide, wherein an amino acid modification selected from the group consisting of:
- the numbering of amino acids in the Fc region referring to the numbering according to the EU index or equivalent in Kabat .
- inventions encompass a method for producing a variant of a parent polypeptide comprising a Fc region, which variant exhibits reduced binding to the protein C1 q and/or to at least one receptor FcyR as compared to the said parent polypeptide, wherein an amino acid modification selected from the group consisting of:
- the method of the invention provides variants which are different from the variant consisting in E294Del/T307P/N434Y
- the Applicant believes that the method provided by the present invention does not significantly cause major structural rearrangement in the Fc region so that in some cases, the other functions which are not mediated by the binding to C1 q and FcyRs are not significantly altered as compared to those of the polypeptide parent. Noticeably, the Applicant showed for various distinct parent polypeptides that the introduction of the mutation 294Del in their Fc region does not significantly impair their affinity for neonatal Fc Receptor (FcRn).
- the specific signal of the lgG1 variant 256N/294Del/378V/383N/434Y is equal to 0.75-fold that of its polypeptide parent 256N/378V/383N/434Y and the specific signal of the lgG1 variant 307A/294Del is equal to 0.97-fold that of its polypeptide parent 307A.
- said variants exhibit an increased binding to FcRn as compared to wild-type lgG1 (see table 1 -4 in the example).
- the Fc polypeptide parent and the variant obtained by the method of the present invention may display close binding property for FcRn.
- the variant obtained by the method of the present invention has a binding to FcRn close to that of its polypeptide parent when the specific signal of the variant is at least equal to 0.6-fold that of its parent polypeptide, the specific signals being determined through an ELISA assay in which FcRn molecules are preferably immobilized as described in the section III of the example.
- 0.6fold it is herein intended, 0.6 fold, 0.65 fold, 0.70 fold, 0.75 fold, 0.80 fold, 0.85 fold, 0.90 fold and 0.95 fold.
- the Fc region of the parent polypeptide may be selected from the group consisting of wild-type Fc regions of human IgGs, fragments and mutants thereof.
- the wild-type Fc regions of human IgGs encompass polypeptide of SEQ ID ⁇ , polypeptide of SEQ ID N °2, polypeptide of SEQ ID N °3, polypeptide of SEQ ID N °4, polypeptide of SEQ ID N °5.
- the Fc region of the parent polypeptide is selected from the group consisting of wild-type Fc regions from lgG1 and lgG2, fragments and mutants thereof.
- the Fc region of the polypeptide parent is an Fc region of a wild-type human lgG1 , fragments and mutants thereof.
- the Fc region of the parent polypeptide may comprise pre-existing amino acid modifications selecting from deletion, insertion and substitution of one or more amino acids.
- the Fc region of the parent polypeptide may be a mutant of a wild-type Fc regions, preferably a mutant of a wild-type Fc region of human IgGs, namely lgG1 , lgG2, lgG3 and lgG4.
- the Fc region of the polypeptide parent comprises from about 1 to about 20 amino acid mutations, preferably from about 1 to about 10 amino acid mutations as compared to its corresponding wild-type Fc region.
- From about 1 to about 20 amino acid mutations encompasses 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19 and 20 amino acid mutations.
- EMBOSS Needle (global); (ii) Gap extend: 0.5; (iii) Gap open: 10.0; (iv) Molecule: Protein; (v) Matrix: Blosum62.
- the percentage of identity may be determined by conventional methods, preferably by dividing the number of matches residues resulting from the alignment of (A) and (B) by the number of amino acids in the sequence of the longest polypeptide between (A) and (B).
- the parent polypeptide may comprise at least one amino acid mutation at an amino position selected from 227, 228, 230, 231 , 233, 234, 239, 241 , 243, 246, 250, 252, 256, 259, 264, 265, 267, 269, 270, 276, 284, 285, 288, 289, 301 , 302, 303, 305, 308, 309, 31 1 , 31 5,31 7, 320, 322, 325, 327, 330, 332, 334, 335, 338, 340, 342, 343, 345, 347, 350, 352, 354, 355, 356, 359, 360, 361 , 362, 369, 370, 371 , 375, 378, 380, 382, 383, 384, 385, 386, 387, 389, 390
- the parent polypeptide may also comprise only one amino acid mutation at an amino acid position selected from 227, 228, 230, 231 , 233, 234, 239, 241 , 243, 246, 250, 252, 256, 259, 264, 265, 267, 269, 270, 276, 284, 285, 288, 289, 301 , 302, 303, 305, 307, 308, 309, 31 1 , 31 5,31 7, 320, 322, 325, 327, 330, 332, 334, 335, 338, 340, 342, 343, 345, 347, 350, 352, 354, 355, 356, 359, 360, 361 , 362, 369, 370, 371 , 375, 378, 380, 382, 383, 384, 385, 386, 387, 389, 390, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401 , 403, 404, 408, 41 1 , 41 2, 4
- “Only one amino acid mutation” means that the parent polypeptide does not contain more than one modification on the positions cited hereabove.
- the parent polypeptide does not comprise amino acid modifications on both positions 307 and 434 of the Fc region.
- the sole mutation introduced within the Fc region of the polypeptide parent is 294Del or 293Del
- the resulting variant cannot comprise more than one amino acid mutation on amino acid positions cited hereabove, in particular the variant does not comprise amino acid mutations on both positions 307 and 434 of the Fc region
- the numbering of the amino acids in the Fc region is that of the EU index, or equivalent in Kabat.
- inventions encompass a method for producing a variant of a parent polypeptide comprising a Fc region, which variant exhibits reduced binding to at least one protein selected from C1 q and Fey receptors as compared to the said parent polypeptide, wherein an amino acid modification selected from the group consisting of 294Del or 293Del and 293Del/294Del is introduced within the Fc region of the parent polypeptide, with the proviso that said variant of the parent polypeptide does not comprise an amino acid modification consisting in 294Del or 293Del combined to mutations in both positions 307 and 434, the numbering of the amino acid in the Fc region referring to the numbering according to the EU index or equivalent in Kabat.
- polypeptide parent may or may not comprise at least one amino acid modification at positions from 290 to 292 and from 295 to 300 of the Fc region wherein the numbering of the amino acids in the Fc region is that of the EU index or equivalent in Kabat.
- the polypeptide parent does not comprise amino acid modifications at anyone of amino acid positions from 290 to 292 and from 295 to 300 of the Fc region wherein the numbering of the amino acids in the Fc region is that of the EU index, or equivalent in Kabat.
- amino acid positions from 290 to 292 and from 295 to 300 encompass 290
- the polypeptide parent does not comprise any mutation in its Fc region as compared to wild-type Fc regions.
- the parent polypeptide comprises a Fc region selected from the group consisting of wild-type Fc regions of human IgGs and fragments thereof.
- wild-type Fc regions of human IgGs encompass the Fc region of SEQ ID ⁇ , the Fc region of SEQ ID N °2, the Fc region of SEQ ID N °3 and the Fc region of SEQ ID N °4.
- the Fc region of the parent polypeptide is a variant of a wild-type IgG Fc region comprising at least an amino acid modification selected from 434Y, 378V, 397M, 302A, 434S, 315D, 230S, 307A, 228R, 230S/315D/428L/434Y, , 2591/315D/434Y and 256N/378V/383N/434Y.
- the Fc region of the parent polypeptide is a variant of a wild-type IgG Fc region selected from the group consisting of 434Y, 378V, 397M, 302A, 434S, 315D, 230S, 307A, 228R, 230S/315D/428L/434Y, 2591/315 D/434Y and 256N/378V/383N/434Y.
- the method for producing a variant of a parent polypeptide comprising a Fc region, which variant exhibits reduced binding to the protein C1 q and to at least one receptor FcyR as compared to the said parent polypeptide is characterized in that:
- amino acid modification selected from 294Del, 293Del and 293Del/294Del is the sole amino acid modification introduced in the Fc region of the parent polypeptide to obtain the said variant
- the Fc region of the parent polypeptide is selected from the group of wild-type Fc regions of IgGs and fragments thereof;
- the step of introducing an amino acid modification selected from 294Del, 293Del and 293Del/294Del within the Fc region of the parent polypeptide comprising the steps of:
- step (b) modifying the nucleic acid provided in step (i) so as to obtain a nucleic acid encoding the said variant
- step (c) expressing the nucleic acid obtained in step (ii) in a host cell
- the amino acid modification introduced in the Fc region of the parent polypeptide is 294Del. In other embodiments, the said modification is 293Del.
- Such a method may be performed by conventional practices of molecular biology.
- the one skilled in the art may refer to well-known procedures described in the prior art which may be found e.g. in Molecular Cloning - A Laboratory Manual, 3 rd Ed. (Maniatis, Cold Spring Harbor Laboratory Press, New York, 2001 ), The condensed protocols from Molecular cloning: a laboratory manual (Sambrook, Russell, CSHL Press, 2006), and Current Protocols in Molecular Biology (John Wiley & Sons, 2004).
- the nucleic acid of the parent polypeptide may be commercial or may be obtained by classical procedure of molecular biology or chemical synthesis.
- the nucleic acid encoding the variant as mentioned in step (b) may be achieved by modifying the nucleic acid of the parent polypeptide using a variety of methods known in the prior art. These methods include, but are not limited to site-directed mutagenesis, random mutagenesis, PCR mutagenesis and cassette mutagenesis.
- the nucleic acid encoding the said variant may be incorporated into an expression vector in view of its expression in a host cell.
- Expression vectors typically include a protein operably linked, that is, placed in a functional relationship, with control or regulatory sequences, selectable markers, any fusion partners, and/or additional elements.
- the variant of the present invention may be produced by culturing a host cell transformed with nucleic acid, preferably an expression vector, containing nucleic acid encoding the variant, under the appropriate conditions to induce or cause expression of the protein.
- nucleic acid preferably an expression vector, containing nucleic acid encoding the variant
- yeast a wide variety of appropriate host cell lines may be used, including but not limited to mammalian cells, plant cells, bacteria, insect cells, and yeast. In vitro synthesis may also be achieved in cell-free translation systems including but not limited to extracts from rabbit reticulocytes, wheat germ and Escherichia coli.
- Host cells may be, but not limited to, YB2/0 (YB2/3HL.P2.GII.IGAg.20 cell, deposit to the American Type Culture Collection, ATCC n °CRL-1662), SP2/0, YE2/0, 1 R983F, Namalwa, PERC6, CHO cell lines, particularly CHO-K-1 , CHO-LecIO, CHO-Lecl, CHO- Lecl3, CHO Pro-5, CHO dhfr-, Wil-2, Jurkat, Vera, Molt-4, COS-7, 293-HEK, BHK, KGH6, NSO, SP2/0-Ag 14, P3X63Ag8.653, C127, JC, LA7, ZR-45-30, hTERT, NM2C5, UACC-812 and the like.
- the host cell may belong to a transgenic non-human animal or to a transgenic plant per se.
- the variant is thus obtained from a transgenic organism.
- a transgenic non-human animal can be obtained by directly injecting a desired gene into a fertilized egg (Gordon et a/., 1980 Proc Natl Acad Sci U S A. ;77:7380-4).
- the transgenic non-human animals include mouse, rabbit, rat, goat, cow, cattle or fowl, and the like.
- a transgenic non-human animal having a desired gene can be obtained by introducing the desired gene into an embryonic stem cell and preparing the animal by an aggregation chimera method or injection chimera method ⁇ Manipulating the Mouse Embryo, A Laboratory Manual, Second edition, Cold Spring Harbor Laboratory Press (1994); Gene Targeting, A Practical Approach, IRL Press at Oxford University Press (1993)).
- embryonic stem cell examples include embryonic stem cells of mouse (Evans and Kaufman, 1981 , Nature; 292:154-156), rat, goat, rabbit, monkey, fowl, cattle and the like.
- a transgenic non-human animal can also be prepared using a clonal technique in which a nucleus into which a desired gene is introduced is transplanted into an enucleated egg (Ryan et a/., 1997 Science; 278: 873 - 876 ; Cibelli et a/., 1998 Science, 280 : 1256-1258).
- the polypeptide variant can be produced by introducing DNA encoding the variant molecule into an animal prepared by the above method to thereby form and accumulate the variant molecule in the animal, and then collecting the polypeptide variant from the animal.
- the polypeptide variant may be made to be formed and accumulated in the milk, egg or the like of the animal.
- the parent polypeptide may be a naturally occurring polypeptide (wild-type polypeptide), a variant or an engineered version of a naturally occurring polypeptide, or a synthetic polypeptide.
- the parent polypeptide is selected from the group consisting of Fc-fusion protein, Fc-conjugate and antibodies.
- Fc-fusion protein and Fc-conjugate consist of an Fc region linked to a partner.
- the Fc region can be linked to its partner with or without a spacer.
- an Fc fusion protein is a protein encoded by a single gene and comprises a protein, a polypeptide or a small peptide linked to an Fc region.
- An Fc fusion protein optionally comprises a peptide spacer. Virtually any protein or small peptide may be linked to Fc regions to generate an Fc fusion.
- Protein fusion partners may include, but are not limited to, the target-binding region of a receptor, an adhesion molecule, a ligand, an enzyme, a cytokine, a chemokine, or some other protein or protein domain.
- the Fc-fusion protein can be an immunoadhesin i.e antibody-like protein which combines the binding domain of a heterologous "adhesion" protein (i.e receptor, ligand or enzyme) with a fragment of immunoglobulin constant domain (i.e. an Fc region) (see for a review about immunoadhesins, Ashkenazi A, Chamow SM. 1 997, Curr Opin Immunol. ;9(2):1 95-200).
- adhesins i.e antibody-like protein which combines the binding domain of a heterologous "adhesion" protein (i.e receptor, ligand or enzyme) with a fragment of immunoglobulin constant domain (i.e. an Fc region)
- Small peptide may include, but are not limited to, any therapeutic agent that directs the Fc fusion to a therapeutic target.
- an Fc conjugate results from the chemical coupling of an Fc region with a conjugate partner and optionally comprises a spacer linking the Fc region to the conjugate partner.
- the conjugate partner can be proteinaceous or non-proteinaceous.
- the coupling reaction generally uses functional groups on the Fc region and on the conjugate partner.
- Suitable conjugate partners include, but are not limited to, therapeutic polypeptides, labels (for example of labels, see further below), drugs, cytotoxic agents, cytotoxic drugs (e.g., chemotherapeutic agents), toxins and active fragments of such toxins.
- Suitable toxins and their corresponding fragments include, but are not limited to, diptheria A chain, exotoxin A chain, ricin A chain, abrin A chain, and the like.
- a cytotoxic agent may be any radionuclide which can be directly conjugated to the Fc variant or sequestrated by a chelating agent which is covalently attached to the Fc variant.
- the conjugate partners can be selected from the group consisting of calicheamicin, auristatins, geldanamycin, maytansine, and duocarmycins and analogs.
- antibody refers to any polypeptide which at least comprises (i) a Fc region and (ii) a binding polypeptide domain derived from a variable domain of an immunoglobulin.
- the said binding polypeptide domain is able to bind specifically one given target antigen or a group of target antigens.
- a binding polypeptide domain which derives from a variable region of an immunoglobulin comprises at least one or more CDRs.
- antibodies include, but are not limited to, full-length antibodies, multi-specific antibodies, Fc-fusion protein comprising at least one variable region or synthetic antibodies (sometimes referred to herein as "antibody mimetics”), antibody-fusion proteins, antibody conjugates and fragments of each respectively.
- Fc-fusion protein comprising at least one variable region
- an engineered protein comprising (i) an Fc region and (ii) a binding polypeptide domain derived from a variable domain of an immunoglobulin.
- antibodies that comprise (a) a Fc variant of the inventions, and (b) one of the following binding polypeptide domains derived from a variable region of an immunoglobulin (i.e.
- full length antibody herein is meant an antibody having the natural-occurring biological form of an antibody, including variable and constant regions.
- a full-length antibody may be a wild-type antibody, a mutant of a wild-type antibody (e.g. comprising pre-existing modifications), an engineered version of a wild-type antibody (e.g. for example a chimeric, a humanized antibody or a fully human antibody, see further below), this list not being limitative.
- the structure of a full-length antibody is generally a tetramer except for some mammals such as llamas and camels in which some immunoglobulins are dimers.
- the scaffold components of the full-length antibody may be a mixture from different species.
- Such antibody variant may be a chimeric antibody and/or a humanized antibody.
- both “chimeric antibodies” and “humanized antibodies” refer to antibodies that combine regions from more than one species.
- “chimeric antibodies” traditionally comprise variable region(s) from a non-human animal, generally the mouse (or rat, in some cases) and the constant region(s) from a human.
- humanized antibodies are chimeric antibodies that contain minimal sequence derived from non human immunoglobulin.
- the entire antibody, except the CDRs is encoded by a polynucleotide of human origin or is identical to a human antibody except within its CDRs.
- the CDRs are grafted into the beta-sheet framework of a human antibody variable region to create an antibody, the specificity of which is determined by the engrafted CDRs.
- the method for preparing such antibodies are well-known and are described in, e.g., WO 92/1 1 01 8; Jones, 1986, Nature 321 :522-525 ; Verhoeyen et al., 1 988, Science 239:1 534-1 536, Tsurushita & Vasquez, 2004, Humanization of Monoclonal Antibodies, Molecular Biology of B Cells, 533-545, Elsevier Science (USA)).
- human antibody or “complete human antibody” refers to an antibody entirely comprising sequences originating from human genes. In some cases this may be human antibodies that have the gene sequence of an antibody derived from a human chromosome with the modifications outlined herein. Alternatively, the components of the antibody may be human but not be derived from a single gene. Thus, for example, human CDRs from one antibody can be combined with sequences, such as scaffold sequences, from one or more human antibodies. For example, a variety of germline sequences can be combined to form a human antibody or human scaffold.
- Labelling refers to the coupling of a detectable label with the full-length antibody.
- a label includes, without being limited to, : a) isotopic labels, which may be radioactive or heavy isotopes; b) magnetic labels (e.g., magnetic particles); c) redox active moieties; d) optical dyes such as chromophores, phosphors and fluorophores; enzymatic groups (e.g.
- a secondary reporter e.g., leucine zipper pair sequences, binding sites for secondary antibodies, metal binding domains, epitope tags, etc.
- Conjugation refers to the coupling of the full-length antibody with a polypeptide or a non-peptide molecule such as a target-binding region of a receptor, an adhesion molecule, a ligand, an enzyme, a cytokine, a chemokine, a drug, a cytotoxic agent (e.g., chemotherapeutic agents) or a toxin.
- a polypeptide or a non-peptide molecule such as a target-binding region of a receptor, an adhesion molecule, a ligand, an enzyme, a cytokine, a chemokine, a drug, a cytotoxic agent (e.g., chemotherapeutic agents) or a toxin.
- the polypeptide parent is selected from the group consisting of chimeric immunoglobulins, humanized immunoglobulins, fully-human immunoglobulins, immunoglobulins being preferably selected among IgGs and optionally conjugated or labelled. c. Variants of the invention
- Another object of the present invention is a variant of a parent polypeptide comprising an Fc region, exhibiting reduced binding to at least one protein selected from the protein C1 q and receptor FcyRs as compared to the said parent polypeptide and comprising an amino acid modification selected from 294Del, 293Del and 293Del/294Del within its Fc region, as compared to the Fc region of its polypeptide parent.
- Said variant may be obtainable by the method of the invention.
- the said variant exhibits reduced binding to at least one protein selected from the protein C1 q and receptor FcyRs as compared to the said parent polypeptide and comprises an amino acid modification selected from 294Del, 293Del and 293Del/294Del within its Fc region, as compared to the Fc region of its polypeptide parent.
- the said variant exhibits reduced binding to C1 q and at least one receptor Fey as compared to the said parent polypeptide.
- the mutation 294Del is the sole mutation that contains the
- the mutation 293Del is the sole mutation that contains the Fc region of the variant as compared to the Fc region of the parent polypeptide.
- amino acid modification 293Del/294Del is the sole modification that contains the Fc region of the variant as compared to that of the parent polypeptide.
- the properties of the variant can be generally deduced from those of the parent polypeptide except in terms of binding to C1 q and Fey receptors since the binding of the variant to C1 q and FcyRs are controlled by the amino acid modification at position 294 and/or at position 293.
- the variant polypeptide exhibits a reduced binding to C1 q and to at least one Fey receptors selected from FcyRl lla, FcyRl la, FcyRI and FcyRI lb, as compared to its polypeptide parent.
- a variant exhibits a reduced binding for a protein of interest such as C1 q or FcyR as compared to its parent polypeptide if the ratio obtained by dividing the specific signal of said variant by that of the parent polypeptide is lower than 0.5, the said specific signals being determined by ELISA assay.
- the specific signal of the variant is at most equal to 0.5-fold the specific signal of its parent polypeptide.
- the Fc region of the variant may comprise one or more amino acid modifications other than 294Del and 293Del as compared to wild-type Fc regions.
- the Fc region of the variant comprises from about 1 to about 21 amino acid modifications, preferably from about 1 to about 1 1 amino acid modifications as compared to its corresponding wild-type Fc region, the said modification including 294Del, 293Del or 293Del/294Del.
- the variant may further comprise at least one amino acid modification at an amino position selected from 227, 228, 230, 231 , 233, 234, 239, 241 , 243, 246, 250, 252, 256, 259, 264, 265, 267, 269, 270, 276, 284, 285, 288, 289, 301 , 302, 303, 305, 308, 309, 31 1 , 31 5,31 7, 320, 322, 325, 327, 330, 332, 334, 335, 338, 340, 342, 343, 345, 347, 350, 352, 354, 355, 356, 359, 360, 361 , 362, 369, 370, 371 , 375, 378, 380, 382, 383, 384, 385, 386, 387, 389, 390, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401 , 403, 404, 408, 41 1 , 41
- the variant may also comprise only one amino acid modification at an amino acid position selected from 227, 228, 230, 231 , 233, 234, 239, 241 , 243, 246, 250, 252, 256, 259, 264, 265, 267, 269, 270, 276, 284, 285, 288, 289, 301 , 302, 303, 305, 307, 308, 309, 31 1 , 31 5,317, 320, 322, 325, 327, 330, 332, 334, 335, 338, 340, 342, 343, 345, 347, 350, 352, 354, 355, 356, 359, 360, 361 , 362, 369, 370, 371 , 375, 378, 380, 382, 383, 384, 385, 386, 387, 389, 390, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401 , 403, 404, 408, 41 1 , 41 2, 414,
- “Only one amino acid modification” means that the variant does not contain more than one modification on the positions cited hereabove.
- the variant does not comprise amino acid modifications on both positions 307 and 434 of the Fc region, as compared to wild-type Fc regions.
- the variant does not comprise the amino acid modification consisting in 294Del/T307P/N434Y or 293Del/T307P/N434Y.
- the variant does not consist in the 294Del/T307P/N434Y or 293Del/T307P/N434Y variants.
- the variant does not comprise an amino acid modification consisting in 294del or 293del combined to mutations in both positions 307 and 434. Therefore an embodiment of the invention consists in a variant of a parent polypeptide comprising an Fc region, to the protein C1 q and to at least one receptor FcyR as compared to the said parent polypeptide and comprising an amino acid modification selected from 294Del, 293Del and 293Del/294Del within its Fc region, as compared to the Fc region of its polypeptide parent, with the proviso that said variant of the parent polypeptide does not comprise an amino acid modification consisting in 294del or 293del combined to mutations in both positions 307 and 434.
- the variant of the invention further comprises at least an amino acid modification selected from 378V, 434Y, 397M, 302A, 434S, 315D, 230S, 307A, 228R, 230S/31 5D/428L/434Y, 2591/31 5 D/434Y and the amino acid modification 256N/378V/383N/434Y in the Fc region.
- the Fc region of the variant of the invention is a variant of a wild-type IgG Fc region comprising at least one mutation selected from the group consisting of 294Del, 293Del, 293Del/294Del, 294Del/256N/378V/383N/434Y, 294Del/259l/31 5D/434Y, 294Del/397M, 294Del/302A, 294Del/434S, 294Del/315D, 294Del/230S, 294Del/307A, 294Del/228R, 230S/31 5D/428L/434Y, 294Del/378V and 294Del/434Y of Fc region wherein the numbering of the amino acids in the Fc region is that of the EU index, or equivalent in Kabat.
- the variant may or may not comprise one amino acid modification at anyone of positions from 290 to 292 and from 295 to 300 of the Fc region as compared to wild-type Fc regions wherein the numbering of the amino acids in the Fc region is that of the EU index, or its equivalent in Kabat.
- the variant does not comprise any mutation other than
- 294Del or 293Del in its Fc region which may decrease the binding to C1 q and to at least one FcyR as compared to wild-type Fc regions.
- the variant does not comprise any mutation other than 294Del or 293Del in its Fc region as compared to wild-type Fc regions.
- the Fc region of the variant is derived from wild-type Fc regions of IgGs.
- the Fc region of the variant is selected from the group of variants of IgG wild-type Fc regions consisting of 293Del, 294Del, 293Del/294Del, 378V/294Del, 434Y/294Del, 294Del/397M, 294Del/302A, 294Del/434S, 294Del/315D, 294Del/230S, 294Del/307A, 294Del/228R, 230S/315D/428L/434Y, 2591/315 D/434Y/294 Del and 256N/378V/383N/434Y/294Del, wherein the numbering of the amino acids refers to the Fc amino acid numbering of the EU index, or equivalent in Kabat .
- the variant is selected from the group consisting of Fc- fusion proteins, Fc-conjugates and antibodies.
- the variant is an antibody selected from the group consisting of chimeric immunoglobulins, humanized immunoglobulins and fully-human immunoglobulins, immunoglobulins being preferably selected among IgGs.
- a further object of the invention is an isolated nucleic acid encoding a variant as defined hereabove.
- the invention also relates to a vector comprising a nucleic acid encoding the said variant and to a host cell comprising the said vector.
- the nucleic acid encoding the said vector has been stably integrated in the genome of the host cell.
- the invention also relates to a non-human transgenic animal comprising the said nucleic acid or the said vector stably integrated within its genome. d.
- the Applicant showed that the mutation 294Del of the Fc region drastically impairs the affinity of the Fc variant for C1 q and for Fc gamma receptors such as FcyRI, FcyRlla, FcyRllb and FcyRllla.
- FcyRI, FcyRlla, FcyRllb and FcyRllla The decrease in the affinity for these effector molecules is so important that in some cases, the binding of the Fc variant to C1 q and/or to certain FcyRs cannot be observed in vitro by conventional ELISA assay.
- the binding of the Fc region to C1 q is essential for the induction of CDC in vivo.
- the binding of the Fc region to FcyRlla and FcyRllla is a key step for the induction of ADCC and ADCP in vivo. Consequently, due to their poor affinity for C1 q, the variants of the invention are anticipated to have no CDC activity or to induce a significantly lower CDC response in vivo as compared to their parent polypeptides and generally to polypeptides comprising a Fc region without the mutation 294Del or the mutation 293Del.
- the variants of the invention are anticipated to have no ADCC activity or to induce a significantly lower ADCC response in vivo as compared to their parent polypeptides and generally to polypeptides comprising Fc region without the mutation 294Del or the mutation 293Del.
- the same result is also expected for in vitro CDC and ADCC assays.
- the lgG1 variant obtained by introducing 294Del in the amino acid sequence of an lgG1 comprising wild-type Fc region i.e. a Fc region having the amino acid sequence of SEQ ID ⁇
- display no or reduced ADCC and/or CDC activity.
- the introduction of the mutation 294Del also enabled to limit or abrogate ADCC and/or CDC activities, while preferentially preserving affinity for FcRn in lgG1 polypeptides initially engineered to exhibit increased affinity for FcRn as compared to wild-type lgG1 .
- the lgG1 variant having the mutations 294Del/256N/378V/383N/434Y displayed neither ADCC nor CDC activity but display an affinity for FcRn at least similar to its lgG1 parent (see ELISA and SPR results in sections III and IV of the example).
- the variants of the invention may find use in a wide range of scientific fields.
- the variants of the invention may be used as research reagents, diagnostic agents or therapeutics.
- the variants may be labelled with a fluorophore or with an isotope such as indium-1 1 1 or technetium-99m and be used for in vivo imagery since in such an application, the activation of ADCC or CDC is not required.
- the variant When used as therapeutics, the variant may be used to convey a therapeutic agent such as radionuclides, toxins, cytokines or enzymes to a target cell for example a cancerous cell.
- a therapeutic agent such as radionuclides, toxins, cytokines or enzymes
- the variant may be a conjugate between an antibody and the cytotoxic agent and its therapeutic activity relies on the cytotoxic agent (e.g. Gilliland et al., PNAS, 1980, 77, 4539-4543).
- the polypeptide variants may also function as a blocking or neutralizing agents of a target molecule, but not killing of the cells bearing target antigen. It may also agonize, antagonize or inhibit a target molecule.
- variant according to the invention while exhibiting altered binding to the C1 q and to at least an Fcgamma receptor, display similar other functional characteristic such as antigen recognition or FcRn affinity. Therefore other important antibody properties, such as antibody stability, structural integrity, or ability to interact with other important Fc ligands such as FcRn and proteins A and G, are not perturbed.
- the target molecule may be of any kinds and includes both exogenous and endogenous molecules.
- Target molecules also called antigens when the polypeptide variant is an antibody
- Membrane receptors include, without being limited to,RhD antigen, CD3, CD4, CD19, CD20, CD22, CD25, CD28, CD32B, CD33, CD38, CD40, CD44, CD52, CD71 (transferrin receptor), CD80, CD86, CTLA-4, CD147, CD160, CD224, growth factor receptors like those belonging to the ErbB family of receptors ErbB1 , ErbB2, ErbB3, ErbB4 (EGFR, HER2/neu, HER3, HER4), VEGF-R1 , VEGF-R2, IGF-R1 , PIGF-R, MHC class I and MHC class II molecules, e.g.
- HLA-DR type I interferon receptor
- interleukin receptors like IL-1 R, IL-2R alpha, IL-2R beta and IL-2R gamma, IL-6R
- hormone receptors like Mullerian inhibitory substance type II receptor
- LDL receptor LDL receptor
- NKp44L chemokine receptors
- CXCR4 CXCR4
- CD137 CD137
- integrins adhesion molecules like CD2
- ICAM ICAM
- EpCAM EpCAM
- G-protein-coupled receptor G-protein-coupled receptor
- the membrane proteins also include tumour markers like GD2, GD3, CA125, MUC-1 , MUC-16, carcinoembrionic antigen (CEA), Tn, glycoprotein 72, PSMA, HMW- MAA other proteins such as BDCA-2 specific for DC cells, glucagon-like peptides (e.g., GLP-1 , etc.), enzymes (e.g., glucocerebrosidase, iduronate-2-sulfatase, alpha- galactosidase-A, agalsidase alpha and beta, alpha-L-iduronidase, butyrylcholinesterase, chitinase, glutamate decarboxylase, imiglucerase, lipase, uricase, platelet-activating factor acetyl hydrolase, neutral endopeptidase, myeloperoxidase, etc.), interleukin and cytokine binding proteins (e.g., IL-18 b
- Soluble proteins include, without being limited to, cytokines such as for instance IL-1 beta, IL-2, IL-6, IL-12, IL-23, TGF beta, TNF alpha, I FN gamma, chemokines, growth factors like VEGF, G-CSF, GM-CSF, EGF, PIGF, PDGF, IGF, hormones and inhibitory antibody such as a FVII I inhibitory, metastasis growth factor, alpha-1 antitrypsin, albumin, alpha-lactalbumin, apolipoprotein-E, erythropoietin, highly glycosylated erythropoietin, angiopoietins, hemoglobin, thrombin, anti-thrombin I I I, thrombin receptor activating peptide, thrombomodulin, factor VI I, factor Vi la, factor VI I I, factor IX, factor XI I I, plasminogen activating factor, fibrin-
- Variants according to the invention may be used for microbial toxin neutralisation (such as tetanus toxin or anthrax) or to prevent viral infection such as hepatitis, infections mediated by papillomavirus or respiratory syncytial virus.
- Neutralising variants according to the invention may also be used in case of poisoning.
- neutralising variants according to the invention may also be directed against auto-antigens such as VEGF for the treatment of cancer or other pathologies such as macular degenerescence due to age.
- the variants according to the invention may also be used to antagonize membrane receptor such as cytokine receptors, growth factor receptors, integrins.
- said variants may be used as immunosuppressor in transplantation such as an anti-IL-2R (CD25) that may inhibit lymphocyte T proliferation.
- Said variants may also be used to limit inflammatory processes (inflammatory bowel disease, atherosclerosis, rheumatoid arthritis), such as antibody directed against the achain of the IL-6 receptor in case of rheumatoid arthritis.
- Variants of the invention may also be used to inhibit tumoral growth, such as anti-EGFR antibodies or anti-HER-2 receptor antibodies.
- Anti- integrins variants according to the invention may also be used for limiting thrombosis formation, such as acute coronary syndrome, or for treating psoriasis. In other embodiments, variants according to the invention may also be used for treating multiple sclerosis.
- variants of the invention may be used as a neutralizing, antagonist or agonist of a target molecule for treating or preventing cancer, inflammatory disorders, infectious disease, auto-immune disease or poisoning.
- autoimmune diseases include allogenic islet graft rejection, alopecia greata, ankylosing spondylitis, antiphospholipid syndrome, autoimmune Addison's disease, antineutrophil cytoplasmic autoantibodies (ANCA), autoimmune diseases of the adrenal gland, autoimmune hemolytic anemia, autoimmune hepatitis, autoimmune myocarditis, autoimmune neutropenia, autoimmune oophoritis and orchitis, autoimmune thrombocytopenia, autoimmune urticaria, Behcet's disease, bullous pemphigoid, cardiomyopathy, Castleman's syndrome, celiac spruce-dermatitis, chronic fatigue immune disfunction syndrome, chronic inflammatory demyelinating polyneuropathy, Churg-Strauss syndrome, cicatrical pemphigoid, CREST syndrome, cold agglutinin disease, Crohn's disease, dermatomyositis, discoid lupus, essential mixed cryoglob
- inflammatory disorders include acute respiratory distress syndrome (ARDS), acute septic arthritis, adjuvant arthritis, allergic encephalomyelitis, allergic rhinitis, allergic vasculitis, allergy, asthma, atherosclerosis, chronic inflammation due to chronic bacterial or viral infections, chronic obstructive pulmonary disease (COPD), coronary artery disease, encephalitis, inflammatory bowel disease, inflammatory osteolysis, inflammation associated with acute and delayed hypersensitivity reactions, inflammation associated with tumors, peripheral nerve injury or demyelinating diseases, inflammation associated with tissue trauma such as burns and ischemia, inflammation due to meningitis, multiple organ injury syndrome, pulmonary fibrosis, sepsis and septic shock, Stevens-Johnson syndrome, undifferentiated arthropy, and undifferentiated spondyloarthropathy.
- ARDS acute respiratory distress syndrome
- acute septic arthritis adjuvant arthritis
- allergic encephalomyelitis allergic encephalomyelitis
- allergic rhinitis allergic vasculitis
- infectious diseases include diseases caused by pathogens such as viruses, bacteria, fungi, protozoa, and parasites. Infectious diseases may be caused by viruses including adenovirus, cytomegalovirus, dengue, Epstein-Barr, hanta, hepatitis A, hepatitis B, hepatitis C, herpes simplex type I, herpes simplex type II, human immunodeficiency virus, (HIV), human papilloma virus (HPV), influenza, measles, mumps, papova virus, polio, respiratory syncytial virus, rinderpest, rhinovirus, rotavirus, rubella, SARS virus, smallpox, viral meningitis, and the like.
- viruses including adenovirus, cytomegalovirus, dengue, Epstein-Barr, hanta, hepatitis A, hepatitis B, hepatitis C, herpes simplex type I, herpes
- Infections diseases may also be caused by bacteria including Bacillus antracis, Borrelia burgdorferi, Campylobacter jejuni, Chlamydia trachomatis, Clostridium botulinum, Clostridium tetani, Diptheria, E. coli, Legionella, Helicobacter pylori, Mycobacterium rickettsia, Mycoplasma nesisseria, Pertussis, Pseudomonas aeruginosa, S. pneumonia, Streptococcus, Staphylococcus, Vibria cholerae, Yersinia pestis, and the like.
- bacteria including Bacillus antracis, Borrelia burgdorferi, Campylobacter jejuni, Chlamydia trachomatis, Clostridium botulinum, Clostridium tetani, Diptheria, E. coli, Legionella, Helicobacter pylori, Mycobacterium
- Infectious diseases may also be caused by fungi such as Aspergillus fumigatus, Blastomyces dermatitidis, Candida albicans, Coccidioides immitis, Cryptococcus neoformans, Histoplasma capsulatum, Penicillium marneffei, and the like. Infectious diseases may also be caused by protozoa and parasites such as chlamydia, kokzidioa, leishmania, malaria, rickettsia, trypanosoma, and the like.
- variants of the present invention may be used to prevent or treat additional conditions including but not limited to heart conditions such as congestive heart failure (CHF), myocarditis and other conditions of the myocardium ; skin conditions such as rosecea, acne, and eczema; bone and tooth conditions such as bone loss, osteoporosis, Paget's disease, Langerhans' cell histiocytosis, periodontal disease, disuse osteopenia, osteomalacia, monostotic fibrous dysplasia, polyostotic fibrous dysplasia, bone metastasis, bone pain management, humoral malignant hypercalcemia, periodontal reconstruction, spinal cord injury, and bone fractures; metabolic conditions such as Gaucher's disease; endocrine conditions such as Cushing's syndrome; and neurological conditions.
- CHF congestive heart failure
- myocarditis and other conditions of the myocardium skin conditions such as rosecea, acne, and eczema
- bone and tooth conditions such as bone loss, osteoporosis
- anti-RhD variants according to the invention may be used for the treatment or the prevention of rhesus incompatibility.
- anti-CD20 variants according to the invention may be used for the treatment of lymphoid leukaemia.
- variants according to the invention may be used for the treatment and/or the prevention of autoimmune diseases such as immune thrombocytopenic purpura, thrombotic thrombocytopenic purpura, rheumatoid polyarthritis and lupus erythematous.
- autoimmune diseases such as immune thrombocytopenic purpura, thrombotic thrombocytopenic purpura, rheumatoid polyarthritis and lupus erythematous.
- the parent polypeptide maybe selected from commercial antibodies such as anti-RhD antibodies (see EMAB2® described in FR 09 5141 2 or MonoRho® of ZLB, Zurich) or anti-CD20 (see WO20060641 21 )
- the parent polypeptide may also be Avastin® (anti-VEGF), Remicade® (anti- TNF-cc), Erbitux® (anti-EGFR), Vectibix® (anti-EGFR), Tysabri® (anti-alpha4 chain of integrin), Herceptin® (anti-HER2/neu), the list not being limitative.
- Avastin® anti-VEGF
- Remicade® anti- TNF-cc
- Erbitux® anti-EGFR
- Vectibix® anti-EGFR
- Tysabri® anti-alpha4 chain of integrin
- Herceptin® anti-HER2/neu
- the variant is a neutralizing antibody directed to a target molecule selected from the group of membrane receptors, human soluble proteins, toxins, viral, bacterial and fungal proteins.
- the variant of the invention is particularly appropriate to be used for the treatment of conditions in which the recruitment of the immune system through ADCC or CDC is not crucial for the therapeutic efficiency.
- the administration of the polypeptide variant of the invention is anticipated to induce less side-effect and less IgG-mediated cytotoxicity than most of the antibodies and immunoadhesins which do not comprise 294Del or 293Del in their Fc region.
- a further object of the invention is thus the use of the variant of the invention for preventing or treating a pathological condition wherein the induction of ADCC and/or CDC responses is not desirable.
- certain embodiments of the invention relate to a variant of a parent polypeptide for use in preventing or treating a pathological condition wherein the induction of ADCC and/or CDC response is not desirable, said variant comprising an Fc region, exhibiting reduced binding to the protein C1 q and to at least one receptor FcyR as compared to the said parent polypeptide and comprising an amino acid modification selected from 294Del, 293Del and 293Del/294Del within its Fc region, as compared to the Fc region of its polypeptide parent, with the proviso that said variant of the parent polypeptide does not comprise an amino acid modification consisting in 294del or 293del combined to mutations in both positions 307 and 434, the numbering of amino acids in the Fc region referring to the numbering according to the EU index, or equivalent in Kabat.
- a variant of a parent polypeptide for use in preventing or treating a pathological condition wherein the induction of ADCC and/or CDC response is not desirable, said variant comprising an Fc region, exhibiting reduced binding to the protein C1 q and to at least one receptor FcyR as compared to the said parent polypeptide and comprising an amino acid modification selected from 294Del, 293Del and 293Del/294Del within its Fc region, as compared to the Fc region of its polypeptide parent, with the proviso that said variant of the parent polypeptide does not consist in 294Del/T307P/N434Y or 293Del/T307P/N434Y variants.
- ADCC and CDC responses are not desirable when the therapeutic efficacy of the variant does not require effector-cell activation or CDC activation.
- a variant includes for example blocking or neutralizing antibodies.
- Pathological conditions which treatment or prevention do not require the induction of CDC and ADCC include without being limited to, graft rejection, autoimmune diseases, inflammatory disorders, infectious diseases or cancer.
- Another object of the invention is the use of a variant of the invention for preparing a pharmaceutical composition.
- variants to be used as described above are variants exhibiting reduced binding to at least one protein selected from the protein C1 q and receptor FcyRs as compared to the said parent polypeptide and comprising an amino acid modification selected from 294Del, 293Del and 293Del/294Del within its Fc region, as compared to the Fc region of its polypeptide parent.
- the variant does not consist in the 294Del/T307P/N434Y or 293Del/T307P/N434Y variants.
- the variant of the invention further comprises at least an amino acid modification selected from 378V, 434Y, 397M, 302A, 434S, 315D, 230S, 307A, 228R, 230S/315D/428L/434Y, 2591/315 D/434Y and the amino acid modification 256 N/378 V/383N/434Y in the Fc region.
- the Fc region of the variant of the invention is a variant of a wild-type IgG Fc region comprising at least one mutation selected from the group consisting of 294Del, 293Del, 293Del/294Del, 294Del/256N/378V/383N/434Y, 294Del/259l/315D/434Y, 294Del/397M, 294Del/302A, 294Del/434S, 294Del/315D, 294Del/230S, 294Del/307A, 294Del/228R, 230S/315D/428L/434Y, 294Del/378V and 294Del/434Y of Fc region wherein the numbering of the amino acids in the Fc region is that of the EU index, or equivalent in Kabat.
- the Fc region of the variant is selected from the group of variants of IgG wild-type Fc regions consisting of 294Del, 293Del, 293Del/294Del, 378V/294Del, 434Y/294Del, 294Del/397M, 294Del/302A, 294Del/434S, 294Del/315D, 294Del/230S, 294Del/307A, 294Del/228R, 230S/315D/428L/434Y, 2591/315 D/434Y/294 Del and 256N/378V/383N/434Y/294Del, wherein the numbering of the amino acids refers to the Fc amino acid numbering of the EU index, or equivalent in Kabat.
- a further object of the invention is to provide pharmaceutical compositions comprising the said variant.
- the variant may be present in the form of monoclonal or polyclonal antibodies.
- the pharmaceutical compositions are prepared by mixing the polypeptide variant having the desired degree of purity with optional physiologically acceptable carrier, excipients or stabilizers in the form of lyophilised formulations or aqueous solutions.
- composition of the invention may be formulated according to standard methods such as those described in Remington: The Science and Practice of Pharmacy (Lippincott Williams & Wilkins; Twenty first Edition, 2005).
- compositions that may be used are, in particular, described in the Handbook of Pharmaceuticals Excipients, American Pharmaceutical Association (Pharmaceutical Press; 6th revised edition, 2009).
- a therapeutically effective dose of the variant may be administered.
- therapeutically effective dose herein is meant a dose that produces the effects for which it is administered. The exact dose will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques. Dosages may range from 0.001 to 100 mg/kg of body weight or greater, for example 0.1 , 1 .0, 10, or 50 mg/kg of body weight, with 1 to 10mg/kg being preferred.
- Administration of the pharmaceutical composition comprising a variant may be done in a variety of ways, including, but not limited to, orally, subcutaneously, intravenously, parenterally, intranasally, intraortically, intraocularly, rectally, vaginally, transdermal ⁇ , topically (e.g., gels), intraperitoneal ⁇ , intramuscularly, intrapulmonary.
- the variants described herein may be administered with other therapeutics concomitantly, i.e., the therapeutics described herein may be co-administered with other therapies or therapeutics, including for example, small molecules, other biologicals, radiation therapy, surgery, etc.
- Fc gene encoding amino acid residues 226-447 (EU index, or equivalent in Kabat) i.e. Fc fragment (Fc226, SEQ I D n °1 ), derived from a human lgG1 heavy chain (Poul MA et al., Eur. J. Immunol. 25(7) : 2005-2009 1 995), was cloned into the eukaryotic expression vector pMGM05-R603 ( Figure 2) as a BamHI/Notl fragment using standard PCR protocols.
- the pMGM05-R603 vector is derived from pCEP4 (Invitrogen) and contains the heavy chain of the R603 chimeric anti-CD20 antibody (LFB-R603).
- the light chain of this antibody was inserted into a similar vector derived from pCEP4 (pMGM01 -R603). All the mutations in the Fc fragment were inserted into the pMGM05- R603 vector by overlap PCR. For instance, the variant 294Del was obtained using two sets of primers.
- the 5' primer MG_61 9 5'- AGTACTGACTCTACCTAGGATCCTGCCCACCGTGC-3' (SEQ I D ⁇ 0) and the 3' primer MG_934 5'-GCTGTTGTACTGCTCCCGCGGCTT-3' (SEQ I D ⁇ 1 ) were used, and for the second PCR, the 5' primer MG_933 5'- AAGCCGCGGGAGCAGTACAACAGC-3' (SEQ I D ⁇ 2) and the 3' primer MG_621 5'- ACTGCTCGATGTCCGTAC TATGCGGCCGCGAATTC-3' (SEQ I D ⁇ 3) were used (where BamHI and Notl restriction sites are underlined and italic characters correspond to the non-specific tails removed during the cloning step).
- FreeStyleTM 293-F cells (Invitrogen) were co-transfected with pMGM01 -R603 and pMGM05-R603 vectors in equimolar amounts (250ng/ml) with FreeStyleTM MAX reagent (1 ⁇ /ml) using standard protocols (Invitrogen). Cells were cultured in suspension in serum-free medium for 7 days post-transfection and IgG containing supernatants were harvested after centrifugation of the cells at 1 00g for 1 0 minutes. Supernatants (1 ml) were then titrated (1.3) and frozen at -20 °C before binding characterization by ELISA (111.1 .1 ).
- IgG variants secreted in the supernatants previously harvested were quantified using an ELISA assay on recombinant protein L (Pierce), with purified R603 antibody used as standard.
- Supernatants and standard antibody, serially diluted in PBS/0.05% Tween-20, were tested on Maxisorp immunoplates (Nunc) previously coated with 0.25 ⁇ g protein L/well and blocked with 5% skimmed milk in PBS. After incubation for 1 hour at 37°C, wells were washed 3 times with PBS/0.05% Tween-20.
- Bound IgG variants were detected with an HRP goat anti-human IgG ( ⁇ chain specific) F(ab')2 fragment (Sigma). IgG variants produced were quantified (1 ⁇ g/ml) using the standard curve obtained with the purified R603 antibody.
- 256 N/378 V/383N/434Y and 256N/378V/383N/434Y_Del294 are prepared in an IgG format with anti-CD20 (R603) or anti- RhD + (R593) specificity in YB2/0 cell line.
- the full length heavy and light chains cDNA as well as the Fc fragment coding the 2591/31 5 D/434Y and 256 N/378 V/383N/434Y variants were neosynthesized with codon optimisation for Rattus norvegicus. Unwanted features such as cryptic splicing sites or restriction sites were removed. Only a restriction site (Apal) was present at the junction variable/constant region.
- 294Del mutation was introduced by assembly PCR by using in PCR1 DELI294P1 (5' primer 5'- CAACGCCAAGACCAAGCCCCGGGAGCAGTACAACAGCACCTACAGGG-3',SEQ ID NO 14) + HCH20GA-Ascl (3' primer 5'- AGCGGCGCCTCATCA-3', SEQ ID NO 15) leading to an amplicon of 501 bp, in PCR2 DEL294 P2 (5' primer 5' ACCAAGGGCCCAAGCGTGT -3', SEQ ID NO 17) + HCH20GA-Apal (3' primer 5'- CCCTGTAGGTGCTGTTGTACTGCTCCCGGGGCTTGGTCTTGGCGTTG -3', SEQ ID NO 16) leading to an amplicon of 541 bp, and finally in PCR3 HCH20GA-Ascl and HCH20GA-Apal leading to a PCR product of 998bp.
- the PCR product was digested with Ascl and A
- Transfections were realized in YB2/0 stable pools.
- Cells from the YB2/O cell line were electroporated with each linearized expression vector, then diluted at 25,000 cells/mL in EMS medium + 5 % v/v dyalised FCS (InvitroGen) and dispensed under 1 ml/well in 24-well plates.
- selection pressure was applied by adding G418 at 2g/l final and phenol red 1 % final in EMS + 5 % FCS medium.
- 3 pools of 8 P24 wells were made and cells were split at 2.10 5 cv/ml in F25.
- Antibody productions were conducted in roller bottles in EMS + 5% FCS with 0.5g/l G418 at a starting concentration between 2 - 8 10 5 cv/ml and a maximum cell production is achieved on 5 days, supernatant was then collected and titrated in FastElysa (RD Biotech).
- Antibodies were purified on protein A Sepahrose type HiTrap protein A FF (GE- Helthcare) then eluted in sodium citrate buffer 25 mM, pH 3.0 and fractions were neutralized, dialyzed into PBS, pH 6.0 overnight at 4 °C.
- protein A Sepahrose type HiTrap protein A FF GE- Helthcare
- the purified IgGs were characterised by SDS-PAGE under non-reducing and reducing conditions as well as with gel filtration in order to estimate aggregate contents. Whatever the mutations, IgGs were purified to greater than 85 % and most often to greater than 95 % and displayed the characteristic heavu and light chain bands for each IgG. LAL endotoxin test (Limulus Amebocyte Lysate) Gel Clot method was further used to test purified IgGs for the presence of endotoxins. The law endotoxin levels as well as the low aggregate content demonstrate that the produced antibodies are therefore compatible for functional testing. III. Binding characterization of the IgG variants by ELISA
- IgG variants produced in the supernatants of 293-F cells
- the IgG variants were tested for their binding to several receptors by ELISA: C1 q complement (Calbiochem), FcyRl llaV1 58 (R&D system), FcRn-p3 (FcRn-p3 refers to a fusion protein comprising the ⁇ 2 microglobulin chain and the cc-chain fused to the bacteriphage protein p3 and the CVDE protein and is produced in a baculovirus system as described in Popov et al., Mol. Immunol.
- FcyRl laR1 31 (R&D system), FcyRI (R&D system) and FcyRI lb (R&D system).
- ELISA tests were performed in PBS for all receptors except for FcRn which was realised in P6 (sodium phosphate 1 00mM, sodium chloride 50mM pH6.0) as FcRn/lgG binding is pH-dependent and optimum at pH6.0.
- F(ab')2-aggregated IgGs were then incubated under gentle agitation for 1 hour on the saturated ELISA plates without dilution for C1 q, FcyRllaR1 31 and FcyRl lb (i. e IgGs at O ⁇ g/ml), diluted in PBS at 0.25 ⁇ g/ml for FcyRl l laV1 58 and FcyRI, or diluted in P6 at 0.0375 ⁇ g/ml for FcRn-p3. Plates were then revealed with TMB (Pierce) and absorbance read at 450nm. 111.1.2 ELISA tests of purified IgG variants
- the IgG variants produced in Y2B/0 were tested for their binding to several receptors by ELISA: FcRn-p3 (as in 11.1 .1 ), FcyRI (R&D system), FcyRl l laV1 58 (R&D system), FcyRl l laFI 58 (produced transiently by PX Therapeutics in HEK293F cells as His-tagged protein), FcyRl laR1 31 (R&D system), FcyRl laH1 31 (produced transiently by PX Therapeutics in HEK293F cells as His-tagged protein) and FcyRl lb (R&D system).
- ELISA tests were performed in PBS for all receptors except for FcRn which was realised in P6 (sodium phosphate 1 00mM, sodium chloride 50mM, pH6.0).
- Maxisorp immunoplates (Nunc) were coated with 1 00ng recombinant protein/well in PBS for FcyRI, FcyRl l laV1 58, FcyRl l laFI 58 and FcyRl laH1 31 or 200ng FcRn-p3/well in P6.
- Immobilizer nickel chelate plates were coated with 100ng FcyRI laR1 31 /well or 400ng FcyRl lb/well in KCI 0.01 M.
- FcYRIIIaV158, FcyRlllaFI 58, FcyRllaR131 , FcyRllaH131 and FcyRllb binding tests purified IgGs were diluted in PBS at a final concentration of 2 ⁇ g/ml and mixed with HRP F(ab')2 goat anti-human F(ab')2 at the same concentration for 2 hours at room temperature. F(ab')2-aggregated IgGs were then incubated under gentle agitation for 1 hour at 30 °C on the saturated ELISA plates after serial dilution in PBS. Plates were then revealed with TMB (Pierce) and absorbance read at 450nm.
- FcyRI and FcRn a direct ELISA was performed. Purified IgGs were diluted in PBS (or P6 for FcRn) supplemented with 4% skimmed milk and 0.01 %Tween 20 and incubated on plates for 2 hours. Bound antibodies were then detected with HRP F(ab')2 goat anti- human F(ab')2 (1 /2500) diluted in the same buffer. After 2 hours incubation at 37°C, plates were revealed with TMB (Pierce) and absorbance read at 450nm.
- Table 1 Ratio of the specific signal of lgG1 variants with the specific signal obtained for wild-type lgG1 in ELISA assays for the target proteins C1 q, FcyRllaR131 , FcyRllb, FcYRIIIaV158, FcyRI and FcRn.
- Table 2 Impact of 294Del on the binding of lgG1 variants to FcyR, C1 q and FcRn receptors: the ratios obtained by dividing the specific signal for the variant obtained by the introduction of 294Del with that of the corresponding lgG1 which does not comprise 294Del are shown in the table hereunder for each protein of interest.
- ELISA results were expressed as a ratio of specific signal (OD450nm) obtained for the purified IgG variants obtained from Y2B/0 cells compared to the signal of the IgG-WT (R603, chimeric anti-CD20 antibody and R593, human anti-RhD + antibody) at a single antibody concentration (O ⁇ g/ml for FcyRIa and FcYRIIIaV158, ⁇ g/ml for FcyRlllaF158, FcyRllaR131 and FcYRIIaH131 , 2 ⁇ g/ml for FcyRllb and 5 ⁇ g/ml for FcRn).
- the mutation 294Del does not significantly modify the binding of variants to FcRn as compared to the corresponding wild type IgG.
- variant IgGs comprising the respective parent polypeptide (R603 or R593 2591/315 D/434Y and R603 or R593 256 N/378 V/383N/434Y)
- the said mutation only results in around 0-30% loss of FcRn binding for the variants 259l/294Del/315D/434Y and 256N/294Del/378V/383N/434Y (Table 4).
- the mutation 294Del drastically impairs the capacity of the variants to bind the FcyRs as compared to their respective parent polypeptides.
- Table 3 Ratio of the specific signal of lgG1 variants with the specific signal obtained for wild-type lgG1 in ELISA assays for the target proteins FcyRIa, FcYRIIIaV158, FcyRlllaF158, FcyRllaR131 , FcyRllal-1131 , FcyRllb and FcRn.
- the flow cells were activated for 3 min with a 1 :1 mixture of 0.1 M N-hydroxysuccinimide and 0.1 M 3- (N,N-dimethylamino)propyl-N-ethylcarbodiimide at a flow rate of 30 ⁇ /min.
- Recombinant human FcRn (5 ⁇ 9/ ⁇ in 1 0 mM sodium acetate, pH 5.0) was injected over flow cell 2 for 3 min at 1 0 ⁇ /min, which resulted in a surface density of 236 response units (RU). Surfaces were blocked with a 3-min injection at 30 ⁇ /min of 1 M ethanolamine-HCI, pH 8.5.
- Flow cell 1 was used as a control surface without FcRn and was prepared similarly to sample flow cell. The data from this blank flow cell were subtracted from the sample data.
- IgG variants were diluted in PBS/Tween-20 (50 mM phosphate buffer, pH 6.0, 1 50 mM NaCI, 0.02% NaN3, 0.05% Tween-20,) which is used as running buffer in equilibrium binding experiments. All measurements were performed at 25 °C with Fc fragment concentrations typically of 0, 8.75, 35, 70 and 200 nM at a flow rate of 1 0 ⁇ /min.
- the binding affinity (KD values) of R593 and R603 antibodies were 1 90 and 99 nM respectively.
- the KD values of 259V/31 5D/and in the context of R603 was 26 nM for 259V/31 5D/434Y illustrating an increased affinity for FcRn between 3 to 6 fold at pH 6.0.
- the KD values of 259V/294Del/315D/434Y was 28 nM and 20nM for R593 and R603 respectively showing that the 294Del does not significantly modify the affinity to FcRn as compared to the respective parent polypeptide variant.
- mAbs are visualized with a goat anti-human Fc gamma coupled to phycoerythrin (100 ⁇ of a dilution of 1 :100) at 4°C for 30 minutes.
- the cells were washed and studied with flow cytometer (FC500, Beckman Coulter).
- Lymphocytes were prepared from mononuclear cell fraction obtained from 3 individuals buffy-coat by density gradient centrifugation over Ficoll. Pack Plus (Pharmacia). Platelets were removed by centrifugation (190g, 15min) and residual cells were lysed in NH4CI. The monocytes were depleted by two successive adherences (2X30min) to plastic tissue culture flasks at 37°C in IMDM/FCS25%. Final percentage of monocytes should be less than 15% of total cells count. The non adherent lymphocytes were washed before resuspension at 8x107cells /ml in IMDM.
- Red cells from therapeutic concentrate (group O, Rhesus +) were treated for 10 min with papain (1 mg/ml) then washed three times with saline solution before resuspension at 4x107cells /ml in IMDM.
- Human immunoglobulin solution from therapeutic IV Ig (Tegeline, LFB) were diluted at 2 and 10mg/ml in IMDM. The assay was performed in 96 wells microtiter plates (NUNC).
- OD was measured at 620nm
- the percent of lysis was estimated using a calibration curve reconstituted with various dilutions of lysed red cells (NH4CI) corresponding to 100, 75, 50, 25 and 0% of lysis respectively.
- Lymphocytes were prepared from mononuclear cell fraction obtained from 1 individual buffy-coat by density gradient centrifugation over Ficoll Pack Plus (Pharmacia). Platelets were removed by centrifugation (1 90g, 1 5min) and residual red cells were lysed in NH4CI. NK cells were purified using a negative selection isolation kit (Miltenyi Biotec, Bergisch Gladbach, Germany). Purified cells were at least 90% CD56+. Less than 3% cells were stained with PE-conjugated anti-CD14, anti-CD3 or anti-CD1 9 antibodies. FCYRI I IA polymorphism was determined as previously described (Dall'Ozzo et al, 2003).
- Raji lymphoblastoid B cells cultured in RPMI-1 640 supplemented with 1 0% FCS, 2 mmol/l L-glutamine, and 1 mmol/l sodium pyruvate (complete medium).
- Target cells were mixed with NK cells at an effector-target (E/T) ratio of 1 5/1 in presence of monoclonal antibody (range, 500-5 ng/ml).
- E/T effector-target
- the release of LDH in supernatants was measured was measured by fluorimetry (Roche Applied Sciences Cytotoxicity Detection Kit ref 1 1 644793001 ) using a microplate spectrofluorimeter (Tecan, Mannedorf-Zurich, Switzerland).
- ADCC (% lysis in the presence of mAb) - (% lysis without mAb).
- Table 6 Binding of anti-RhD + lgG1 wt (R593) and variants to RBCs expressing the RhD + antigen.
- said variants displays no ADCC activity as compared to R593 or parent variant IgGs as illustrated in table 7
- Anti-RhD + 294Del variants display no ADCC activity.
- Anti-RhD+ lgG1 variants EC50 (ng/ml) Max. Lysis (%)
- R593 1 1 ,06 93 It has further been shown (see table 8 below) that introduction of Del294 mutation does not affect the binding of a wt anti-CD20 (R603) lgG1 or a V259l/N315D/N434Y anti-CD20 (R603) lgG1 variant for the CD20 antigen.
- Table 8 Binding of anti-CD20 lgG1 wt (R603) and R603_259I/315D/434Y, R603_259l/294Del/315D/434Y and R603_294Del IgG variants to Raji lymphoblastoid B cells expressing the CD20 antigen.
- R603_259l/294Del/315D/434Y and R603_294Del IgG variant for both the C1 q protein and the Fey receptors the said variants displays nor ADCC nor CDC activity as compared to R603 or parent variant IgGs as illustrated in table 9 and 10 below.
- Anti-CD20 294Del variants display no ADCC activity.
- Anti-CD20 lgG1 variants EC50 (ng/ml) Max. Lysis (%)
- Anti-CD20 294Del variants display no CDC activity. Half maximal effective concentration inducing 50 % lysis of target cells (EC50, ng/ml) in the presence of anti- CD20 variants and wt, as estimated in IV.1 .4.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Immunology (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- General Chemical & Material Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Animal Behavior & Ethology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Rheumatology (AREA)
- Engineering & Computer Science (AREA)
- Pain & Pain Management (AREA)
- Oncology (AREA)
- Communicable Diseases (AREA)
- Toxicology (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Description
Claims
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP12735242.5A EP2723770B1 (en) | 2011-06-24 | 2012-06-25 | Fc variants with reduced effector functions |
| JP2014516393A JP6080844B2 (en) | 2011-06-24 | 2012-06-25 | Fc mutant with reduced effector function |
| ES12735242T ES2755708T3 (en) | 2011-06-24 | 2012-06-25 | Fc variants with reduced effector functions |
| CA2840127A CA2840127C (en) | 2011-06-24 | 2012-06-25 | Fc variants with reduced effector functions |
| US14/128,828 US20140378663A1 (en) | 2011-06-24 | 2012-06-25 | Fc variants with reduced effector functions |
| BR112013033342A BR112013033342A2 (en) | 2011-06-24 | 2012-06-25 | fc variants with reduced actuator functions |
| CN201280031137.2A CN103827142A (en) | 2011-06-24 | 2012-06-25 | Fc variants with reduced effector function |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP11305811.9A EP2537864B1 (en) | 2011-06-24 | 2011-06-24 | Fc variants with reduced effector functions |
| EP11305811.9 | 2011-06-24 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2012175751A2 true WO2012175751A2 (en) | 2012-12-27 |
| WO2012175751A3 WO2012175751A3 (en) | 2013-08-08 |
Family
ID=45058478
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2012/062273 Ceased WO2012175751A2 (en) | 2011-06-24 | 2012-06-25 | Fc variants with reduced effector functions |
Country Status (8)
| Country | Link |
|---|---|
| US (1) | US20140378663A1 (en) |
| EP (2) | EP2537864B1 (en) |
| JP (1) | JP6080844B2 (en) |
| CN (2) | CN103827142A (en) |
| BR (1) | BR112013033342A2 (en) |
| CA (1) | CA2840127C (en) |
| ES (1) | ES2755708T3 (en) |
| WO (1) | WO2012175751A2 (en) |
Cited By (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015156268A1 (en) * | 2014-04-07 | 2015-10-15 | 中外製薬株式会社 | Immunoactivating antigen-binding molecule |
| WO2015157592A1 (en) | 2014-04-11 | 2015-10-15 | Medimmune, Llc | Bispecific her2 antibodies |
| JP2017522040A (en) * | 2014-08-01 | 2017-08-10 | ラボラトワール・フランセ・デュ・フラクシオンマン・エ・デ・ビョテクノロジーLaboratoire Francais Du Fractionnement Et Des Biotechnologies | Methods for making variants with Fc having improved sialylation |
| WO2018085400A1 (en) | 2016-11-02 | 2018-05-11 | Vanderbilt University | Human zika virus antibodies and methods of use therefor |
| US10611843B2 (en) | 2015-03-31 | 2020-04-07 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | Anti-CD303 monoclonal antibodies |
| CN111182915A (en) * | 2017-08-15 | 2020-05-19 | 金德雷德生物科学股份有限公司 | Veterinary IgG Fc variants |
| EP3789403A1 (en) | 2014-11-11 | 2021-03-10 | MedImmune Limited | Therapeutic combinations comprising anti-cd73 antibodies and a2a receptor inhibitor and uses thereof |
| US11066483B2 (en) | 2010-11-30 | 2021-07-20 | Chugai Seiyaku Kabushiki Kaisha | Cytotoxicity-inducing therapeutic agent |
| US11123438B2 (en) | 2016-08-19 | 2021-09-21 | Ampsource Biopharma Shanghai Inc. | Linker peptide for constructing fusion protein |
| US11471513B2 (en) | 2016-08-19 | 2022-10-18 | Ampsource Biopharma Shanghai Inc. | Highly glycosylated human blood-clotting factor VIII fusion protein, and manufacturing method and application of same |
| US11472863B2 (en) | 2016-08-19 | 2022-10-18 | Ampsource Biopharma Shanghai Inc. | Human coagulation factor IX (FIX) fusion protein, preparation method therefor, and use thereof |
| US11505605B2 (en) | 2014-05-13 | 2022-11-22 | Chugai Seiyaku Kabushiki Kaisha | T cell-redirected antigen-binding molecule for cells having immunosuppression function |
| US11649293B2 (en) | 2015-11-18 | 2023-05-16 | Chugai Seiyaku Kabushiki Kaisha | Method for enhancing humoral immune response |
| US11660340B2 (en) | 2015-11-18 | 2023-05-30 | Chugai Seiyaku Kabushiki Kaisha | Combination therapy using T cell redirection antigen binding molecule against cell having immunosuppressing function |
| US11981718B2 (en) | 2020-05-27 | 2024-05-14 | Ampsource Biopharma Shanghai Inc. | Dual-function protein for lipid and blood glucose regulation |
| WO2025022280A1 (en) | 2023-07-21 | 2025-01-30 | Astrazeneca Ab | Treatment of neurodegenerative diseases |
Families Citing this family (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10400029B2 (en) | 2011-06-28 | 2019-09-03 | Inhibrx, Lp | Serpin fusion polypeptides and methods of use thereof |
| KR102231139B1 (en) | 2011-06-28 | 2021-03-24 | 인히브릭스, 인크. | Serpin fusion polypeptides and methods of use thereof |
| GB2537445A (en) | 2014-11-10 | 2016-10-19 | Medimmune Ltd | Binding molecules specific for CD73 and uses thereof |
| FR3035879B1 (en) * | 2015-05-07 | 2025-02-28 | Lab Francais Du Fractionnement | FC MUTANTS WITH ALTERED FUNCTIONAL ACTIVITY |
| FR3038517B1 (en) * | 2015-07-06 | 2020-02-28 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | USE OF MODIFIED FC FRAGMENTS IN IMMUNOTHERAPY |
| EP3470424B1 (en) * | 2016-06-08 | 2025-04-23 | Shanghai Jiao Tong University School of Medicine | Sequence of antibody heavy chain constant region for enhancing agonist antibody activity |
| FR3081328B1 (en) * | 2018-05-24 | 2021-01-01 | Lab Francais Du Fractionnement | COMPOSITION OF CONCENTRATED HUMAN IMMUNOGLOBULINS |
| EP3902824A4 (en) | 2018-12-28 | 2023-01-04 | Sparx Therapeutics Inc. | CLAUDINE 18.2 SPECIFIC BINDING MOLECULES, COMPOSITIONS AND METHODS RELATED, FOR THE TREATMENT OF CANCER AND OTHER DISEASES |
| CN111514291B (en) * | 2020-05-05 | 2023-05-09 | 华中科技大学同济医学院附属协和医院 | Application of lupus erythematosus IgG in the preparation of drugs for inhibiting bone damage |
| CN115322255B (en) * | 2022-04-25 | 2025-03-07 | 上海药明生物医药有限公司 | An optimized Fc variant and its application |
| CN121712795A (en) * | 2023-08-30 | 2026-03-20 | 安斯泰来制药株式会社 | Fc area modification |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FR951412A (en) | 1943-01-05 | 1949-10-25 | Thomson Houston Comp Francaise | Improvements to voltage regulators |
| WO1992011018A1 (en) | 1990-12-19 | 1992-07-09 | Protein Design Labs, Inc. | Improved humanized immunoglobulins |
| WO2006064121A2 (en) | 2004-12-15 | 2006-06-22 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | Cytotoxic antibody directed against type b lymphoid hematopoietic proliferations |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| PL209392B1 (en) * | 1999-01-15 | 2011-08-31 | Genentech Inc | Polypeptide variants with altered effector function |
| EP2078091A4 (en) * | 2007-07-10 | 2010-09-01 | Medimmune Llc | CRYSTALS AND STRUCTURE OF HUMAN IgG Fc VARIANT |
| EP2233500A1 (en) * | 2009-03-20 | 2010-09-29 | LFB Biotechnologies | Optimized Fc variants |
-
2011
- 2011-06-24 EP EP11305811.9A patent/EP2537864B1/en active Active
-
2012
- 2012-06-25 ES ES12735242T patent/ES2755708T3/en active Active
- 2012-06-25 JP JP2014516393A patent/JP6080844B2/en not_active Expired - Fee Related
- 2012-06-25 CN CN201280031137.2A patent/CN103827142A/en active Pending
- 2012-06-25 CN CN201710810571.5A patent/CN107474138A/en active Pending
- 2012-06-25 WO PCT/EP2012/062273 patent/WO2012175751A2/en not_active Ceased
- 2012-06-25 CA CA2840127A patent/CA2840127C/en not_active Expired - Fee Related
- 2012-06-25 US US14/128,828 patent/US20140378663A1/en not_active Abandoned
- 2012-06-25 BR BR112013033342A patent/BR112013033342A2/en not_active Application Discontinuation
- 2012-06-25 EP EP12735242.5A patent/EP2723770B1/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FR951412A (en) | 1943-01-05 | 1949-10-25 | Thomson Houston Comp Francaise | Improvements to voltage regulators |
| WO1992011018A1 (en) | 1990-12-19 | 1992-07-09 | Protein Design Labs, Inc. | Improved humanized immunoglobulins |
| WO2006064121A2 (en) | 2004-12-15 | 2006-06-22 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | Cytotoxic antibody directed against type b lymphoid hematopoietic proliferations |
Non-Patent Citations (33)
| Title |
|---|
| "A Laboratory Manual", 1994, COLD SPRING HARBOR LABORATORY PRESS, article "Manipulating the Mouse Embryo" |
| "Current Protocols in Molecular Biology", 2004, JOHN WILEY & SONS |
| "Gene Targeting, A Practical Approach", 1993, IRL PRESS AT OXFORD UNIVERSITY PRESS |
| "Handbook of Pharmaceuticals Excipients", 2009, PHARMACEUTICAL PRESS |
| "Molecular Cloning - A Laboratory Manual", 2001, COLD SPRING HARBOR LABORATORY PRESS |
| "Remington: The Science and Practice of Pharmacy", 2005, LIPPINCOTT WILLIAMS & WILKINS |
| ABES ET AL., PHARMACEUTICALS, vol. 3, 2010, pages 146 - 157 |
| AN ET AL., MABS, vol. 1, no. 6, 2009, pages 572 - 579 |
| ASHKENAZI A; CHAMOW SM, CURR OPIN IMMUNOL., vol. 9, no. 2, 1997, pages 195 - 200 |
| CIBELLI ET AL., SCIENCE, vol. 280, 1998, pages 1256 - 1258 |
| DE ROMEUF ET AL., BR J HAEMATOL., vol. 140, no. 6, March 2008 (2008-03-01), pages 635 - 43 |
| EVANS; KAUFMAN, NATURE, vol. 292, 1981, pages 154 - 156 |
| GILLILAND ET AL., PNAS, vol. 77, 1980, pages 4539 - 4543 |
| GORDON ET AL., PROC NATL ACAD SCI U S A., vol. 77, 1980, pages 7380 - 4 |
| HEZAREH ET AL., JOURNAL OF VIROLOGY, 2001, pages 12161 - 12168 |
| JONES, NATURE, vol. 321, 1986, pages 522 - 525 |
| KISHORE ET AL., IMMUNOPHARMACOLOGY, vol. 49, 2000, pages 159 - 170 |
| LABRIJN ET AL., NATURE BIOTECH, vol. 27, 2009, pages 767 - 771 |
| NIMMERJAHN; RAVETCH, NATURE REVIEWS IMMUNOLOGY, vol. 8, 2008, pages 34 - 47 |
| OGANESYAN ET AL., ACTA CRYST., vol. D64, 2008, pages 700 - 704 |
| POPOV ET AL., MOL. IMMUNOL., vol. 33, 1996, pages 521 - 530 |
| POPOV S. ET AL., MOL IMMUNOL., vol. 33, no. 6, 1996, pages 521 - 530 |
| POUL MA ET AL., EUR. J. IMMUNOL., vol. 25, no. 7, 1995, pages 2005 - 2009 |
| REDDY ET AL., THE JOURNAL OF IMMUNOLOGY, vol. 164, 2000, pages 1925 - 1933 |
| ROMEUF ET AL., BR J HAEMATOL., vol. 140, no. 6, March 2008 (2008-03-01), pages 635 - 43 |
| ROOPENIAN, NATURE REVIEWS IMMUNOLOGY, vol. 7, 2007, pages 715 - 725 |
| RYAN ET AL., SCIENCE, vol. 278, 1997, pages 873 - 876 |
| SAMBROOK; RUSSELL: "Molecular cloning: a laboratory manual", 2006, CSHL PRESS |
| SJOBERG ET AL., TRENDS IMMUNOL., vol. 30, no. 2, 2009, pages 83 - 90 |
| STROHL, CURRENT OPINION IN BIOTECHNOL, vol. 20, 2009, pages 685 - 691 |
| TSURUSHITA; VASQUEZ: "Molecular Biology of B Cells", 2004, ELSEVIER SCIENCE, article "Humanization of Monoclonal Antibodies", pages: 533 - 545 |
| VERHOEYEN ET AL., SCIENCE, vol. 239, 1988, pages 1534 - 1536 |
| XU ET AL., CELL IMMUNOL, vol. 1, 2000, pages 16 - 26 |
Cited By (25)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12522669B2 (en) | 2010-11-30 | 2026-01-13 | Chugai Seiyaku Kabushiki Kaisha | Cytotoxicity-inducing therapeutic agent |
| US11066483B2 (en) | 2010-11-30 | 2021-07-20 | Chugai Seiyaku Kabushiki Kaisha | Cytotoxicity-inducing therapeutic agent |
| US12479929B2 (en) | 2010-11-30 | 2025-11-25 | Chugai Seiyaku Kabushiki Kaisha | Cytotoxicity-inducing therapeutic agent |
| WO2015156268A1 (en) * | 2014-04-07 | 2015-10-15 | 中外製薬株式会社 | Immunoactivating antigen-binding molecule |
| EP3130606A4 (en) * | 2014-04-07 | 2017-10-25 | Chugai Seiyaku Kabushiki Kaisha | Immunoactivating antigen-binding molecule |
| US11485790B2 (en) | 2014-04-07 | 2022-11-01 | Chugai Seiyaku Kabushiki Kaisha | Immunoactivating antigen-binding molecule |
| JPWO2015156268A1 (en) * | 2014-04-07 | 2017-04-13 | 中外製薬株式会社 | Immunostimulatory antigen binding molecule |
| EP3130606B1 (en) | 2014-04-07 | 2021-10-13 | Chugai Seiyaku Kabushiki Kaisha | Immunoactivating bispecific antibodies |
| IL247715B (en) * | 2014-04-07 | 2022-07-01 | Chugai Pharmaceutical Co Ltd | Immunoactivating antigen-binding molecule |
| WO2015157592A1 (en) | 2014-04-11 | 2015-10-15 | Medimmune, Llc | Bispecific her2 antibodies |
| US11505605B2 (en) | 2014-05-13 | 2022-11-22 | Chugai Seiyaku Kabushiki Kaisha | T cell-redirected antigen-binding molecule for cells having immunosuppression function |
| JP2017522040A (en) * | 2014-08-01 | 2017-08-10 | ラボラトワール・フランセ・デュ・フラクシオンマン・エ・デ・ビョテクノロジーLaboratoire Francais Du Fractionnement Et Des Biotechnologies | Methods for making variants with Fc having improved sialylation |
| EP3789403A1 (en) | 2014-11-11 | 2021-03-10 | MedImmune Limited | Therapeutic combinations comprising anti-cd73 antibodies and a2a receptor inhibitor and uses thereof |
| US10611843B2 (en) | 2015-03-31 | 2020-04-07 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | Anti-CD303 monoclonal antibodies |
| US11649293B2 (en) | 2015-11-18 | 2023-05-16 | Chugai Seiyaku Kabushiki Kaisha | Method for enhancing humoral immune response |
| US11660340B2 (en) | 2015-11-18 | 2023-05-30 | Chugai Seiyaku Kabushiki Kaisha | Combination therapy using T cell redirection antigen binding molecule against cell having immunosuppressing function |
| US11472863B2 (en) | 2016-08-19 | 2022-10-18 | Ampsource Biopharma Shanghai Inc. | Human coagulation factor IX (FIX) fusion protein, preparation method therefor, and use thereof |
| US11471513B2 (en) | 2016-08-19 | 2022-10-18 | Ampsource Biopharma Shanghai Inc. | Highly glycosylated human blood-clotting factor VIII fusion protein, and manufacturing method and application of same |
| US11123438B2 (en) | 2016-08-19 | 2021-09-21 | Ampsource Biopharma Shanghai Inc. | Linker peptide for constructing fusion protein |
| US11833212B2 (en) | 2016-08-19 | 2023-12-05 | Ampsource Biopharma Shanghai Inc. | Linker peptide for constructing fusion protein |
| WO2018085400A1 (en) | 2016-11-02 | 2018-05-11 | Vanderbilt University | Human zika virus antibodies and methods of use therefor |
| US12297272B2 (en) | 2017-08-15 | 2025-05-13 | Eianco US inc. | IgG Fc variants for veterinary use |
| CN111182915A (en) * | 2017-08-15 | 2020-05-19 | 金德雷德生物科学股份有限公司 | Veterinary IgG Fc variants |
| US11981718B2 (en) | 2020-05-27 | 2024-05-14 | Ampsource Biopharma Shanghai Inc. | Dual-function protein for lipid and blood glucose regulation |
| WO2025022280A1 (en) | 2023-07-21 | 2025-01-30 | Astrazeneca Ab | Treatment of neurodegenerative diseases |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107474138A (en) | 2017-12-15 |
| WO2012175751A3 (en) | 2013-08-08 |
| ES2755708T3 (en) | 2020-04-23 |
| EP2537864B1 (en) | 2019-08-07 |
| EP2723770A2 (en) | 2014-04-30 |
| BR112013033342A2 (en) | 2017-01-31 |
| CA2840127C (en) | 2020-02-18 |
| CN103827142A (en) | 2014-05-28 |
| CA2840127A1 (en) | 2012-12-27 |
| JP2014519836A (en) | 2014-08-21 |
| US20140378663A1 (en) | 2014-12-25 |
| EP2537864A1 (en) | 2012-12-26 |
| JP6080844B2 (en) | 2017-02-15 |
| EP2723770B1 (en) | 2019-07-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2840127C (en) | Fc variants with reduced effector functions | |
| AU2018344416B2 (en) | IgG1 Fc mutants with ablated effector functions | |
| US12559555B2 (en) | Anti-LILRB4 antibodies and derivative products | |
| US20230022731A1 (en) | Engineered antibodies and methods of treatment | |
| US20190153096A1 (en) | Cd3/cd33 bispecific binding molecules | |
| US20250206824A1 (en) | GLYCOENGINEERED Fc VARIANT POLYPEPTIDES WITH ENHANCED EFFECTOR FUNCTION | |
| US20250154262A1 (en) | Fc DOMAIN VARIANTS WITH ENHANCED Fc RECEPTOR BINDING | |
| US20260125467A1 (en) | Novel anti-lilrb4 antibodies and derivative products |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12735242 Country of ref document: EP Kind code of ref document: A2 |
|
| ENP | Entry into the national phase |
Ref document number: 2840127 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2014516393 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14128828 Country of ref document: US |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112013033342 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112013033342 Country of ref document: BR Kind code of ref document: A2 Effective date: 20131223 |




