WO2012170911A2 - Gene therapy vectors for adrenoleukodystrophy and adrenomyeloneuropathy - Google Patents
Gene therapy vectors for adrenoleukodystrophy and adrenomyeloneuropathy Download PDFInfo
- Publication number
- WO2012170911A2 WO2012170911A2 PCT/US2012/041693 US2012041693W WO2012170911A2 WO 2012170911 A2 WO2012170911 A2 WO 2012170911A2 US 2012041693 W US2012041693 W US 2012041693W WO 2012170911 A2 WO2012170911 A2 WO 2012170911A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- vector
- cell
- ltr
- cells
- promoter
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/48—Reproductive organs
- A61K35/51—Umbilical cord; Umbilical cord blood; Umbilical stem cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
- C12N15/867—Retroviral vectors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/177—Receptors; Cell surface antigens; Cell surface determinants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
- A61K48/0058—Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0603—Embryonic cells ; Embryoid bodies
- C12N5/0606—Pluripotent embryonic cells, e.g. embryonic stem cells [ES]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0607—Non-embryonic pluripotent stem cells, e.g. MASC
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
- C12N5/0647—Haematopoietic stem cells; Uncommitted or multipotent progenitors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0684—Cells of the urinary tract or kidneys
- C12N5/0686—Kidney cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0696—Artificially induced pluripotent stem cells, e.g. iPS
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
- C12N2740/15041—Use of virus, viral particle or viral elements as a vector
- C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/16011—Human Immunodeficiency Virus, HIV
- C12N2740/16041—Use of virus, viral particle or viral elements as a vector
- C12N2740/16043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/24—Vectors characterised by the absence of particular element, e.g. selectable marker, viral origin of replication
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/008—Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/50—Vector systems having a special element relevant for transcription regulating RNA stability, not being an intron, e.g. poly A signal
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/60—Vector systems having a special element relevant for transcription from viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2840/00—Vectors comprising a special translation-regulating system
Definitions
- the present invention generally relates to gene therapy vectors.
- the present invention relates to lentiviral vectors that provide gene therapy for adrenoleukodystrophy and adrenomyeloneuropathy.
- CCALD Childhood cerebral adrenoleukodystrophy
- CCALD often initially presents as Addison's disease, but the diagnosis is usually made based on "sudden” decreases in attention, thinking, concentration, and other cerebral functions with confirmatory findings of cerebral demyelination on magnetic resonance imaging (MRI).
- MRI magnetic resonance imaging
- the MRI of the patient's brain Prior to demyelination, the MRI of the patient's brain is normal, and there are no neurodevelopmental abnormalities.
- the clinical course may be "slow” at first, but can become rapidly progressive and irreversible with the widespread loss of myelin in the brain.
- the terms “slow” and “sudden” are relative in that the duration of demyelination is not truly known, but the rapid decrease in cognitive and motor function can happen at any time and for unknown reasons.
- x-linked adrenoleukodystrophy in the United States is about 1 :21,000 male births with about 35% developing CCALD; about 35 to 40 boys are diagnosed with CCALD each year.
- the cause of the disease is a mutation of the ATP- binding cassette, sub-family D (ALD), member 1 (ABCD1) gene leading to a dysfunctional or absent adrenoleukodystrophy protein (ALDP) gene product.
- ALDP localizes to cellular peroxisomes, where it participates in the degradation of very long chain fatty acids (VLCFA) (chain lengths of > 20 carbons) to shorter fatty acids, which are used to maintain cellular structure and function.
- VLCFA very long chain fatty acids
- CNS central nervous system
- demyelination arises due to a local accumulation of VLCFA that cannot be metabolized because the defective ALDP does not support that process in the brain microglia.
- the rapidly progressive phase of the disease is caused by inflammation, possibly caused by acylation of cellular proteins by the VLCFA, which increases the loss of myelin.
- the rapidly progressive phase of CCALD can result in a boy deteriorating from normal function to severely disabled within months.
- HCT allogeneic hematopoietic stem cell transplant
- CBSCs cord blood stem cells
- the present invention contemplates, in part, a vector comprising: a left (5') retroviral LTR; a central polypurine tract/DNA flap (cPPT/FLAP); a retroviral export element; a promoter active in a microglial cell, operably linked to a polynucleotide encoding an ATP-binding cassette, sub-family D, member 1 (ABCD1) polypeptide; and a right (3') retroviral LTR; wherein the vector does not comprise a woodchuck post-transcriptional regulatory element (WPRE).
- WPRE woodchuck post-transcriptional regulatory element
- the vector is a lentivirus vector.
- the lentivirus is HIV.
- the lentivirus is HIV-1.
- the promoter of the 5' LTR is replaced with a heterologous promoter.
- the heterologous promoter is a
- CMV cytomegalovirus
- RSV Rous Sarcoma Virus
- SV40 Simian Virus 40
- the heterologous promoter is a CMV promoter.
- the 5' LTR or 3' LTR is a lentivirus LTR.
- the 5' LTR and 3' LTR are lentivirus LTRs.
- the lentivirus is HIV-1.
- the 3' LTR comprises one or more modifications.
- the 3' LTR comprises one or more deletions.
- the 3' LTR is a self-inactivating (SIN) LTR.
- the retroviral export element is a rev response element (RRE).
- RRE rev response element
- the cPPT/FLAP is from HIV-1.
- the promoter comprises a myeloproliferative sarcoma virus enhancer, negative control region deleted, dl587rev primer-binding site substituted (MND) promoter or transcriptionally active fragment thereof.
- MND primer-binding site substituted
- the polynucleotide encoding ABCDl polypeptide is a cDNA.
- the cDNA comprises an optimized Kozak sequence.
- the optimal Kozak sequence is (GCC)RCCATGG, wherein R is a purine (A or G).
- the polynucleotide encodes a human ABCDl polypeptide.
- the present invention contemplates, in part, a lenti viral vector comprising: a left (5') LTR; a cPPT/FLAP; an RRE; a MND promoter operably linked to a polynucleotide encoding a human ABCDl polypeptide; a right (3') LTR; and a polyadenylation sequence; wherein the vector does not comprise a woodchuck post-transcriptional regulatory element (WPRE).
- WPRE woodchuck post-transcriptional regulatory element
- the lentiviral vector comprises a Psi ( ⁇ ) packaging signal.
- the polyadenylation sequence is a bovine growth hormone polyadenylation or signal rabbit ⁇ -globin polyadenylation sequence.
- the lentiviral vector comprises a 5' LTR or 3 * LTR from HIV-1.
- the 3' LTR is a SIN LTR.
- the present invention contemplates, in part, a lentiviral vector comprising: a left (5') HIV-1 LTR; a Psi ( ⁇ ) packaging signal; a cPPT/FLAP; an RRE; a MND promoter, operably linked to a cDNA encoding a human ABCD1 polypeptide; a right (3') self-inactivating (SIN) HIV-1 LTR; and a rabbit ⁇ - globin polyadenylation sequence; wherein the vector does not comprise a woodchuck post-transcriptional regulatory element (WPRE).
- WPRE woodchuck post-transcriptional regulatory element
- the present invention contemplates, in part, a mammalian cell comprising a vector according to any one of preceding vectors described herein.
- the present invention contemplates, in part, a packaging cell comprising: a first polynucleotide encoding gag, a second
- polynucleotide encoding pol a third polynucleotide encoding env, and a vector according to any one of preceding vectors described herein.
- the present invention contemplates, in part, a producer cell comprising a vector according to any one of preceding vectors described herein.
- the present invention contemplates, in part, vector particles produced by the producer cell.
- the present invention contemplates, in part, a vector comprising: at least one LTR; a central polypurine tract/DNA flap (cPPT/FLAP); a retroviral export element; and a promoter active in a microglial cell, operably linked to a polynucleotide encoding an ATP-binding cassette, sub-family D, member 1 (ABCDl) polypeptide; wherein the vector does not comprise a woodchuck post-transcriptional regulatory element (WPRE).
- WPRE woodchuck post-transcriptional regulatory element
- the present invention contemplates, in part, a vector comprising: at least one LTR; a cPPT/FLAP; an RRE; a MND promoter operably linked to a polynucleotide encoding a human ABCDl polypeptide; and a polyadenylation sequence; wherein the vector does not comprise a woodchuck post- transcriptional regulatory element (WPRE).
- WPRE woodchuck post- transcriptional regulatory element
- the present invention contemplates, in part, a vector comprising: at least one SIN HIV-1 LTR; a Psi ( ⁇ ) packaging signal; a cPPT/FLAP; an RRE; a MND promoter, operably linked to a cDNA encoding a human ABCDl polypeptide; and a rabbit ⁇ -globin polyadenylation sequence, wherein the vector does not comprise a woodchuck post-transcriptional regulatory element (WPRE).
- WPRE woodchuck post-transcriptional regulatory element
- the present invention contemplates, in part, a host cell transduced with the vector.
- the host cell is an embryonic stem cell, a somatic stem cell, or a progenitor cell.
- the cell is a hematopoietic stem cell.
- the present invention further contemplates, in part use of the viral vectors of the invention in gene therapy.
- the gene therapy treats or prevents
- adrenoleukodystrophy or adrenomyeloneuropathy adrenoleukodystrophy or adrenomyeloneuropathy.
- the present invention contemplates, in part, a method of treating adrenoleukodystrophy or adrenomyeloneuropathy, comprising administering to a subject a cell transduced with a vector of the invention.
- the cell is an embryonic stem cell, a somatic stem cell, or a progenitor cell.
- the cell is a hematopoietic stem cell.
- SEQ ID NO: 1 is a cDNA sequence that encodes human ABCDl
- SEQ ID NO: 2 is a cDNA sequence that encodes human ABCDl
- SEQ ID NO: 3 is a MND promoter polynucleotide sequence.
- Figure 1 shows a schematic map of MND-ALD vector constructs used in preclinical and clinical studies. All vectors have the human ABCD-1 cDNA under the control of the MND promoter for high-level expression.
- Safety modifications to pLBPlOO and pLBP140 include: 2 stop codons in the gag coding region, a 400bp deletion in the U3 of the right HIV LTR and the rabbit ⁇ -globin polyA (rPgppA) signal.
- HIV LTR human immunodeficiency type-1 virus long terminal repeat
- ⁇ + packaging signal
- cPPT/flap central polypurine tract
- RRE Rev-responsive element
- ppt polypurine tract.
- the pLBP140 differs from the pLBPlOO vector by introduction of the mutated (mut6) but functional, woodchuck hepatitis virus post-transcriptional regulatory element (AWPRE).
- ABPRE woodchuck hepatitis virus post-transcriptional regulatory element
- Figure 2 shows transduction with pLBPlOO and pLBP140 lentiviral vectors and short-term liquid and methycellulose cultures in experiments.
- Figure 3 shows transduction with pLBPlOO and pLBP140 lentiviral vectors followed by short-term liquid and methycellulose cultures or long-term culture on supporting MS5 stromas.
- Figure 4 shows the number of myeloid (CFU-GM; Fig.4A) and erythroid (BFU-E; Fig.4B) progenitors after transduction of normal human CD34+ cells.
- Figure 5 shows the frequency of LTC-ICs. Following limiting dilution and 5 -week stromal co-culture with transfer into methylcellulose cultures for enumeration of secondary CFCs and estimation of frequencies with 95% confidence intervals using the L-CalcTM program.
- Figure 6 shows the efficiency of vector integration in short-term progenitors.
- A Vector copy number (VCN) on cells at 7, 14, 28, 31 and 35 days in liquid culture.
- B Average VCN from pooled day 14 CFC cultures.
- C Percent vector positive myeloid colonies. The positive and total colony numbers analyzed are indicated.
- Figure 7 shows the efficiency of vector integration in short-term versus long-term (LTC-IC) progenitors.
- A Average VCN from pooled day 14 CFC cultures.
- B Percent vector positive myeloid colonies. The positive and total colony numbers analyzed are indicated.
- Figure 8 shows ALD protein (ALDP) expression in transduced cells by flow cytometry.
- ALD protein ALD protein
- Aland A2 Histograms showing PE fluorescence for mock, pLBPlOO and pLBP140 transduced cells from different experiments.
- B Percent ALDP positive cells at 7 days (expts. 072010 and 091410), 14 days (expt. 081010) and 28 days (expt. 080610).
- C MFI as a ratio over mock controls showing relative levels of ALDP expression among ALDP+ cells.
- Figure 9 shows a schematic map of an MND-ALD vector construct.
- the vector has the human ABCD-1 cDNA under the control of the MND promoter for high- level expression.
- HIV LTR human immunodeficiency type-1 virus long terminal repeat
- ⁇ + packaging signal
- cPPT/flap central polypurine tract
- RRE Rev-responsive element
- ppt polypurine tract.
- the vector does not contain a WPRE sequence.
- Figure 10 shows the ratio of VLCFA correction to mock versus VCN in 4496 cells transduced with p 100 and p 140 at various MOI.
- the present invention is generally directed to safer and more efficient viral vectors and transduced cell therapies for adrenoleukodystrophies and
- hematopoietic stems cells of boys with ALD are otherwise normal and because microglia are of bone marrow origin, the
- compositions and methods of the present invention could represent a significant medical advance in the treatment of boys with ALD, since it will allow for rapid treatment with a significantly decreased risk of hematopoietic engraftment failure and elimination of acute and chronic GvHD.
- Time is very much of the essence in this population because of the potential for rapid CNS deterioration and the 12-18 month wait before disease stabilization seen with HCT.
- Retrovirus refers an RNA virus that reverse transcribes its genomic RNA into a linear double-stranded DNA copy and subsequently covalently integrates its genomic DNA into a host genome. Retroviruses belong to the family Retroviridae, which is composed of numerous non-icosahedral, enveloped viruses which possess two copies of a single-stranded RNA genome that has a short dimerized region. Retroviruses are a common tool for gene delivery (Miller, 2000, Nature. 357: 455-460). Once the virus is integrated into the host genome, it is referred to as a "provirus.” The provirus serves as a template for RNA polymerase II and directs the expression of RNA molecules which encode the structural proteins and enzymes needed to produce new viral particles.
- Illustrative retroviruses include, but are not limited to: Moloney murine leukemia virus (M-MuLV), Moloney murine sarcoma virus (MoMSV), Harvey murine sarcoma virus (HaMuSV), murine mammary tumor virus (MuMTV), gibbon ape leukemia virus (GaLV), feline leukemia virus (FLV), spumavirus, Friend murine leukemia virus, Murine Stem Cell Virus (MSCV) and Rous Sarcoma Virus (RSV)) and lenti virus.
- M-MuLV Moloney murine leukemia virus
- MoMSV Moloney murine sarcoma virus
- HaMuSV Harvey murine sarcoma virus
- MuMTV murine mammary tumor virus
- GaLV gibbon ape leukemia virus
- FLV feline leukemia virus
- RSV Rous Sarcoma Virus
- lentivirus refers to a group (or genus) of complex retroviruses.
- retroviruses include, but are not limited to: HIV (human immunodeficiency virus; including HIV type 1, and HIV type 2); visna-maedi virus (VMV) virus; the caprine arthritis-encephalitis virus (CAEV); equine infectious anemia virus (EIAV); feline immunodeficiency virus (FIV); bovine immune deficiency virus (BIV); and simian immunodeficiency virus (SIV).
- HIV based vector backbones ⁇ i.e., HIV cis-acting sequence elements) are preferred.
- Retroviral vectors and more particularly lentiviral vectors may be used in practicing the present invention. Accordingly, the term “retrovirus” or “retroviral vector”, as used herein is meant to include “lentivirus” and “lentiviral vectors” respectively.
- vector is used herein to refer to a nucleic acid molecule capable transferring or transporting another nucleic acid molecule.
- the transferred nucleic acid is generally linked to, e.g., inserted into, the vector nucleic acid molecule.
- a vector may include sequences that direct autonomous replication in a cell, or may include sequences sufficient to allow integration into host cell DNA.
- Useful vectors include, for example, plasmids ⁇ e.g., DNA plasmids or RNA plasmids), cosmids, bacterial artificial chromosomes, and viral vectors.
- Useful viral vectors include, e.g., replication defective retroviruses and lentiviruses.
- viral vector refers either to a nucleic acid molecule (e.g., a transfer plasmid) that includes virus-derived nucleic acid elements that typically facilitate transfer of the nucleic acid molecule or integration into the genome of a cell or to a viral particle that mediates nucleic acid transfer.
- Viral particles will typically include various viral components and sometimes also host cell components in addition to nucleic acid(s).
- viral vector may refer either to a virus or viral particle capable of transferring a nucleic acid into a cell or to the transferred nucleic acid itself.
- Viral vectors and transfer plasmids contain structural and/or functional genetic elements that are primarily derived from a virus.
- the term "retroviral vector” refers to a viral vector or plasmid containing structural and functional genetic elements that are primarily derived from a retrovirus.
- the term "lentiviral vector” refers to a viral vector or plasmid containing structural and functional genetic elements, including LTRs that are primarily derived from a lenti virus.
- hybrid refers to a vector, LTR or other nucleic acid containing both retroviral, e.g., lentiviral, sequences and non-lentiviral viral sequences.
- a hybrid vector refers to a vector or transfer plasmid comprising retroviral e.g., lentiviral, sequences for reverse transcription, replication, integration and/or packaging and alphavirus subgenomic promoter sequences, non-structural proteins, and/or polymerase recognition sites.
- lentiviral vector may be used to refer to lentiviral transfer plasmids and/or infectious lentiviral particles.
- elements such as cloning sites, promoters, regulatory elements, heterologous nucleic acids, etc., it is to be understood that the sequences of these elements are present in RNA form in the lentiviral particles of the invention and are present in DNA form in the DNA plasmids of the invention.
- LTRs Long terminal repeats
- LTRs generally provide functions fundamental to the expression of retroviral genes (e.g., promotion, initiation and polyadenylation of gene transcripts) and to viral replication.
- the LTR contains numerous regulatory signals including transcriptional control elements, polyadenylation signals and sequences needed for replication and integration of the viral genome.
- the viral LTR is divided into three regions called U3, R and U5.
- the U3 region contains the enhancer and promoter elements.
- the U5 region is the sequence between the primer binding site and the R region and contains the polyadenylation sequence.
- the R (repeat) region is flanked by the U3 and U5 regions.
- the term "packaging signal” or "packaging sequence” refers to sequences located within the retroviral genome which are required for insertion of the viral RNA into the viral capsid or particle, see e.g., Clever et ah, 1995. J. of Virology, Vol. 69, No. 4; pp. 2101-2109.
- Several retroviral vectors use the minimal packaging signal (also referred to as the psi [ ⁇ ] sequence) needed for encapsidation of the viral genome.
- the terms "packaging sequence,” “packaging signal,” “psi” and the symbol “ ⁇ ,” are used in reference to the non-coding sequence required for encapsidation of retroviral RNA strands during viral particle formation.
- vectors comprise modified 5' LTR and/or 3' LTRs. Modifications of the 3' LTR are often made to improve the safety of lentiviral or retroviral systems by rendering viruses replication-defective.
- replication-defective refers to virus that is not capable of complete, effective replication such that infective virions are not produced ⁇ e.g., replication-defective lentiviral progeny).
- replication-competent refers to wild-type virus or mutant virus that is capable of replication, such that viral replication of the virus is capable of producing infective virions ⁇ e.g., replication-competent lentiviral progeny).
- “Self-inactivating" (SIN) vectors refers to replication-defective vectors, e.g., retroviral or lentiviral vectors, in which the right (3') LTR enhancer-promoter region, known as the U3 region, has been modified ⁇ e.g., by deletion or substitution) to prevent viral transcription beyond the first round of viral replication. This is because the right (3') LTR U3 region is used as a template for the left (5') LTR U3 region during viral replication and, thus, the viral transcript cannot be made without the U3 enhancer- promoter.
- the 3' LTR is modified such that the U5 region is replaced, for example, with an ideal poly(A) sequence. It should be noted that modifications to the LTRs such as modifications to the 3' LTR, the 5' LTR, or both 3' and 5' LTRs, are also included in the invention.
- heterologous promoters which can be used include, for example, viral simian virus 40 (SV40) (e.g., early or late),
- CMV cytomegalovirus
- MoMLV Moloney murine leukemia virus
- RSV Rous sarcoma virus
- HSV herpes simplex virus
- Typical promoters are able to drive high levels of transcription in a Tat-independent manner. This replacement reduces the possibility of recombination to generate replication-competent virus because there is no complete U3 sequence in the virus production system.
- viral vectors comprise a TAR element.
- TAR refers to the "trans-activation response” genetic element located in the R region of lentiviral (e.g., HIV) LTRs. This element interacts with the lentiviral trans-activator (tat) genetic element to enhance viral replication.
- lentiviral e.g., HIV
- tat lentiviral trans-activator
- the "R region” refers to the region within retroviral LTRs beginning at the start of the capping group (i.e., the start of transcription) and ending immediately prior to the start of the poly A tract.
- the R region is also defined as being flanked by the U3 and U5 regions. The R region plays a role during reverse transcription in permitting the transfer of nascent DNA from one end of the genome to the other.
- FLAP element refers to a nucleic acid whose sequence includes the central polypurine tract and central termination sequences (cPPT and CTS) of a retrovirus, e.g., HIV-1 or HIV-2. Suitable FLAP elements are described in U.S. Pat. No. 6,682,907 and in Zennou, et al, 2000, Cell, 101 : 173.
- cPPT central polypurine tract
- CTS central termination at the central termination sequence
- the DNA flap may act as a cis-active
- the retroviral or lentiviral vector backbones comprise one or more FLAP elements upstream or downstream of the heterologous genes of interest in the vectors.
- a transfer plasmid includes a FLAP element.
- a vector of the invention comprises a FLAP element isolated from HIV-1.
- retroviral or lentiviral transfer vectors comprise one or more export elements.
- export element refers to a cis-acting posttranscriptional regulatory element which regulates the transport of an RNA transcript from the nucleus to the cytoplasm of a cell.
- RNA export elements include, but are not limited to, the human immunodeficiency virus (HIV) rev response element (RRE) (see e.g., Cullen et al, 1991. J. Virol. 65: 1053; and Cullen et al, 1991. Cell 58: 423), and the hepatitis B virus post-transcriptional regulatory element (HPRE).
- HCV human immunodeficiency virus
- RRE hepatitis B virus post-transcriptional regulatory element
- the RNA export element is placed within the 3' UTR of a gene, and can be inserted as one or multiple copies.
- expression of heterologous sequences in viral vectors is increased by incorporating posttranscriptional regulatory elements, and efficient polyadenylation sites and optionally, transcription termination signals into the vectors.
- posttranscriptional regulatory elements can increase expression of a heterologous nucleic acid at the protein , e.g., woodchuck hepatitis virus
- WPRE posttranscriptional regulatory element
- the posttranscriptional regulatory element present in hepatitis B virus (HPRE) (Huang et al, Mol. Cell. Biol, 5:3864); and the like (Liu et al, 1995, Genes Dev., 9: 1766).
- HPRE hepatitis B virus
- the posttranscriptional regulatory element is generally positioned at the 3' end the heterologous nucleic acid sequence. This configuration results in synthesis of an mRNA transcript whose 5' portion comprises the heterologous nucleic acid coding sequences and whose 3' portion comprises the posttranscriptional regulatory element sequence.
- vectors of the invention lack or do not comprise a posttranscriptional regulatory element such as a WPRE or HPRE because in some instances these elements increase the risk of cellular transformation and/or do not substantially or significantly increase the amount of mRNA transcript or increase mRNA stability. Therefore, in some embodiments, vectors of the invention lack or do not comprise a WPRE or HPRE as an added safety measure.
- a posttranscriptional regulatory element such as a WPRE or HPRE because in some instances these elements increase the risk of cellular transformation and/or do not substantially or significantly increase the amount of mRNA transcript or increase mRNA stability. Therefore, in some embodiments, vectors of the invention lack or do not comprise a WPRE or HPRE as an added safety measure.
- polyA site or "polyA sequence” as used herein denotes a DNA sequence which directs both the termination and polyadenylation of the nascent RNA transcript by RNA polymerase II. Efficient polyadenylation of the recombinant transcript is desirable as transcripts lacking a poly A tail are unstable and are rapidly degraded.
- Illustrative examples of polyA signals that can be used in a vector of the invention includes an ideal polyA sequence (e.g., AATAAA, ATTAAA
- BGHpA bovine growth hormone polyA sequence
- rPgpA rabbit ⁇ -globin polyA sequence
- AGTAAA AGTAAA
- BGHpA bovine growth hormone polyA sequence
- rPgpA rabbit ⁇ -globin polyA sequence
- a retroviral or lentiviral vector further comprises an insulator element.
- Insulators elements may contribute to protecting lentivirus- expressed sequences, e.g., therapeutic polypeptides, from integration site effects, which may be mediated by cis-acting elements present in genomic DNA and lead to deregulated expression of transferred sequences (i.e., position effect; see, e.g., Burgess- Beusse et al, 2002, Proc. Natl. Acad. ScL, USA, 99: 16433; and Zhan et al, 2001, Hum. Genet., 109:471)..
- transfer vectors comprise an insulator element in one or both LTRs or elsewhere in the region of the vector that integrates into the cellular genome.
- Suitable insulators for use in the invention include, but are not limited to, the chicken ⁇ -globin insulator (see Chung et al, 1993. Cell 74:505; Chung et al, 1997. PNAS 94:575; and Bell et al, 1999. Cell 98:387, incorporated by reference herein).
- Examples of insulator elements include, but are not limited to, an insulator from an ⁇ -globin locus, such as chicken HS4.
- most or all of the viral vector backbone sequences are derived from a lentivirus, e.g., HIV-1.
- lentiviral vectors are known in the art, see Naldini et al, (1996a, 1996b, and 1998); Zufferey et al, (1997); Dull et al, 1998, U.S. Pat. Nos. 6,013,516; and 5,994,136, any of which may be adapted to produce a viral vector or transfer plasmid of the present invention.
- polynucleotide or “nucleic acid” refers to messenger RNA (mR A), RNA, genomic RNA (gRNA), plus strand RNA (RNA(+)), minus strand RNA (RNA(-)), genomic DNA (gDNA), complementary DNA (cDNA) or DNA.
- Polynucleotides include single and double stranded polynucleotides.
- polynucleotides of the invention include polynucleotides or variants having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100%) sequence identity to any of the reference sequences described herein (see, e.g., Sequence Listing), typically where the variant maintains at least one biological activity of the reference sequence.
- the present invention contemplates, in part, viral vector and transfer plasmid polynucleotide sequences and compositions comprising the same.
- the invention provides polynucleotides encoding therapeutic polypeptides.
- polynucleotide variant and “variant” and the like refer to polynucleotides displaying substantial sequence identity with a reference polynucleotide sequence or polynucleotides that hybridize with a reference sequence under stringent conditions that are defined hereinafter. These terms include
- polynucleotides in which one or more nucleotides have been added or deleted, or replaced with different nucleotides compared to a reference polynucleotide.
- certain alterations inclusive of mutations, additions, deletions and substitutions can be made to a reference polynucleotide whereby the altered polynucleotide retains the biological function or activity of the reference polynucleotide.
- isolated means material that is substantially or essentially free from components that normally accompany it in its native state.
- an "isolated polynucleotide,” as used herein, refers to a polynucleotide that has been purified from the sequences which flank it in a naturally -occurring state, e.g. , a DNA fragment that has been removed from the sequences that are normally adjacent to the fragment.
- Polynucleotide sequences can be annotated in the 5' to 3' orientation or the 3' to 5' orientation.
- complementary and complementarity refer to polynucleotides (i.e., a sequence of nucleotides) related by the base-pairing rules.
- the complementary strand of the DNA sequence 5' A G T C A T G 3' is 3' T C A G T A C 5'.
- the latter sequence is often written as the reverse complement with the 5' end on the left and the 3' end on the right, 5' C A T G A C T 3'.
- a sequence that is equal to its reverse complement is said to be a palindromic sequence.
- Complementarity can be "partial,” in which only some of the nucleic acids' bases are matched according to the base pairing rules. Or, there can be “complete” or “total” complementarity between the nucleic acids.
- nucleic acid cassette refers to genetic sequences within the vector which can express a RNA, and subsequently a protein.
- the nucleic acid cassette contains the gene of interest.
- the nucleic acid cassette is positionally and sequentially oriented within the vector such that the nucleic acid in the cassette can be transcribed into RNA, and when necessary, translated into a protein or a polypeptide, undergo appropriate post-translational modifications required for activity in the transformed cell, and be translocated to the appropriate compartment for biological activity by targeting to appropriate intracellular compartments or secretion into extracellular compartments.
- the cassette has its 3' and 5' ends adapted for ready insertion into a vector, e.g., it has restriction endonuclease sites at each end.
- the nucleic acid cassette contains the sequence of a therapeutic gene used to treat adrenoleukodystrophy or adrenomyeloneuropathy.
- the cassette can be removed and inserted into a plasmid or viral vector as a single unit.
- Polynucleotides include a polynucleotide-of-interest.
- polynucleotide-of-interest refers to the polynucleotide, e.g., a polynucleotide encoding a polypeptide ⁇ i.e., a polypeptide-of-interest), inserted into an expression vector that is desired to be expressed.
- the polynucleotide-of- interest encodes a polypeptide that provides a therapeutic effect in the treatment or prevention of a disease or disorder, which may be referred to as a "therapeutic polypeptide," e.g., ATP -binding cassette, sub-family D (ALD), member 1 (ABCD1) gene.
- a therapeutic polypeptide e.g., ATP -binding cassette, sub-family D (ALD), member 1 (ABCD1) gene.
- Polynucleotides-of-interest, and polypeptides encoded therefrom include both polynucleotides that encode wild-type polypeptides, as well as functional variants and fragments thereof.
- a functional variant has at least 80%, at least 90%), at least 95%, or at least 99% identity to a corresponding wild-type reference polynucleotide or polypeptide sequence.
- a functional variant or fragment has at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of a biological activity of a corresponding wild-type polypeptide.
- Representative polynucleotides sequences suitable for use in the present invention include, but are not limited to, the human ACBD1 cDNAs set forth in SEQ ID NOs: 1-2.
- polynucleotides of the present invention may be combined with other DNA sequences, such as promoters and/or enhancers, untranslated regions (UTRs), Kozak sequences, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, internal ribosomal entry sites (IRES), recombinase recognition sites ⁇ e.g., LoxP, FRT, and Att sites), termination codons, transcriptional termination signals, and
- promoter refers to a recognition site of a polynucleotide (DNA or RNA) to which an RNA polymerase binds.
- enhancer refers to a segment of DNA which contains sequences capable of providing enhanced transcription and in some instances can function independent of their orientation relative to another control sequence. An enhancer can function
- a vector of the invention comprises a myeloproliferative sarcoma virus enhancer, negative control region deleted, dl587rev primer-binding site substituted (MND) promoter (Challita et al., J Virol. 69(2):748-55 (1995); SEQ ID NO: 3).
- a vector of the invention comprise exogenous, endogenous, or heterologous control sequences such as promoters and/or enhancers.
- An "endogenous” control sequence is one which is naturally linked with a given gene in the genome.
- An “exogenous” control sequence is one which is placed in juxtaposition to a gene by means of genetic manipulation (i.e., molecular biological techniques) such that transcription of that gene is directed by the linked
- a "heterologous" control sequence is an exogenous sequence that is from a different species than the cell being genetically manipulated.
- operably linked refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner.
- the term refers to a functional linkage between a nucleic acid expression control sequence (such as a promoter, and/or enhancer) and a second polynucleotide sequence, e.g., a polynucleotide-of-interest, wherein the expression control sequence directs transcription of the nucleic acid corresponding to the second sequence.
- constitutive promoter refers to a promoter that continually or continuously allows for transcription of an operably linked sequence.
- Constitutive promoters may be a "ubiquitous promoter” that allows expression in a wide variety of cell and tissue types or a "tissue-specific promoter” that allows expression in a restricted variety of cell and tissue types.
- Illustrative ubiquitous promoters include, but are not limited to, a cytomegalovirus (CMV) immediate early promoter, a viral simian virus 40 (S V40) (e.g.
- MoMLV Moloney murine leukemia virus
- RSV Rous sarcoma virus
- HSV herpes simplex virus
- H5 thymidine kinase
- H5 herpes simplex virus
- EGR1 early growth response 1
- EGR1 ferritin H
- FerL ferritin L
- GPDH glycogenase
- EIF4A1 eukaryotic translation initiation factor 4A1
- HSPA5 heat shock 70kDa protein 5
- HSPA5 heat shock protein 90kDa beta
- HSP90B1 heat shock protein 70kDa (HSP70), ⁇ -kinesin ( ⁇ - ⁇ ), the human ROSA 26 locus (Irions et ah, Nature Biotechnology 25, 1477 - 1482 (2007)), a Ubiquitin C promoter (UBC), a phosphoglycerate kinase- 1 (PGK) promoter, a cytomegalovirus enhancer/chicken ⁇ -actin (CAG) promoter, and a ⁇ -actin promoter.
- UBC Ubiquitin C promoter
- PGK phosphoglycerate kinase- 1
- CAG cytomegalovirus enhancer/chicken ⁇ -actin
- ⁇ -actin promoter a ⁇ -actin promoter.
- tissue-specific promoter it may be desirable to use a tissue-specific promoter to achieve cell type specific, lineage specific, or tissue-specific expression of a desired polynucleotide sequence ⁇ e.g., to express a particular nucleic acid encoding a polypeptide in only a subset of cell types or tissues or during specific stages of development).
- tissue specific promoters include, but are not limited to: an B29 promoter (B cell expression), a runt transcription factor (CBFa2) promoter (stem cell specific expression), an CD 14 promoter (monocytic cell expression), an CD43 promoter (leukocyte and platelet expression), an CD45 promoter (hematopoietic cell expression), an CD68 promoter (macrophage expression), a
- CYP450 3A4 promoter hepatocyte expression
- an desmin promoter muscle expression
- an elastase 1 promoter pancreatic acinar cell expression
- an endoglin promoter endothelial cell expression
- a fibroblast specific protein 1 promoter FSP1 promoter
- fibronectin promoter fibroblast cell
- FLT1 fms-related tyrosine kinase 1
- GFAP glial fibrillary acidic protein
- IFN- ⁇ interferon beta
- a vector of the present invention comprises a tissue specific promoter and/or enhancer that expresses a desired polypeptide, e.g. , ABCD1, in microglial cells, e.g., an MND promoter (SEQ ID NO: 3).
- a tissue specific promoter and/or enhancer that expresses a desired polypeptide, e.g. , ABCD1, in microglial cells, e.g., an MND promoter (SEQ ID NO: 3).
- conditional expression may refer to any type of conditional expression including, but not limited to, inducible expression; repressible expression; expression in cells or tissues having a particular physiological, biological, or disease state, etc. This definition is not intended to exclude cell type or tissue- specific expression.
- Certain embodiments of the invention provide conditional expression of a polynucleotide-of-interest e.g., expression is controlled by subjecting a cell, tissue, organism, etc., to a treatment or condition that causes the polynucleotide to be expressed or that causes an increase or decrease in expression of the polynucleotide encoded by the polynucleotide-of-interest.
- inducible promoters/sy stems include, but are not limited to, steroid-inducible promoters such as promoters for genes encoding glucocorticoid or estrogen receptors (inducible by treatment with the corresponding hormone), metallothionine promoter (inducible by treatment with various heavy metals), MX-1 promoter (inducible by interferon), the "GeneSwitch” mifepristone- regulatable system (Sirin et al, 2003, Gene, 323:67), the cumate inducible gene switch (WO 2002/088346), tetracycline-dependent regulatory systems, etc.
- steroid-inducible promoters such as promoters for genes encoding glucocorticoid or estrogen receptors (inducible by treatment with the corresponding hormone), metallothionine promoter (inducible by treatment with various heavy metals), MX-1 promoter (inducible by interferon), the "GeneSwitch” mif
- Conditional expression can also be achieved by using a site-specific DNA recombinase.
- the vector comprises at least one (typically two) site(s) for recombination mediated by a site- specific recombinase.
- recombinase or "site-specific recombinase” include excisive or integrative proteins, enzymes, co-factors or associated proteins that are involved in recombination reactions involving one or more recombination sites (e.g., two, three, four, five, seven, ten, twelve, fifteen, twenty, thirty, fifty, etc.), which may be wild-type proteins (see Landy, Current Opinion in Biotechnology 3:699-707 (1993)), or mutants, derivatives (e.g., fusion proteins containing the recombination protein sequences or fragments thereof), fragments, and variants thereof.
- Illustrative examples of recombinases suitable for use in particular embodiments of the present invention include, but are not limited to: Cre, Int, IHF, Xis, Flp, Fis, Hin, Gin, OC31, Cin, Tn3 resolvase, TndX, XerC, XerD, TnpX, Hjc, Gin, SpCCEl. and ParA.
- the vectors may comprise one or more recombination sites for any of a wide variety of site-specific recombinases. It is to be understood that the target site for a site-specific recombinase is in addition to any site(s) required for integration of a vector, e.g., a retroviral vector or lentiviral vector. As used herein, the terms
- recombination sequence refers to a particular nucleic acid sequence to which a recombinase recognizes and binds.
- loxP which is a 34 base pair sequence comprising two 13 base pair inverted repeats (serving as the recombinase binding sites) flanking an 8 base pair core sequence (see FIG. 1 of Sauer, B., Current Opinion in Biotechnology 5:521-527 (1994)).
- exemplary loxP sites include, but are not limited to: lox511 (Hoess et al, 1996; Bethke and Sauer, 1997), lox5171 (Lee and Saito, 1998), lox2272 (Lee and Saito, 1998), m2 (Langer et al, 2002), lox71 (Albert et al, 1995), and lox66 (Albert et al, 1995).
- Suitable recognition sites for the FLP recombinase include, but are not limited to: FRT (McLeod, et al, 1996), Fi, F 2 , F 3 (Schlake and Bode, 1994), F 4 , F 5 (Schlake and Bode, 1994), FRT(LE) (Senecoff et al, 1988), FRT(RE) (Senecoff ei al, 1988).
- recognition sequences are the attB, attP, attL, and attR sequences, which are recognized by the recombinase enzyme ⁇ Integrase, e.g, phi- c31.
- the ⁇ C31 SSR mediates recombination only between the heterotypic sites attB (34 bp in length) and attP (39 bp in length) (Groth et al, 2000).
- attB and attP named for the attachment sites for the phage integrase on the bacterial and phage genomes, respectively, both contain imperfect inverted repeats that are likely bound by ⁇ C31 homodimers (Groth et al, 2000).
- an "internal ribosome entry site” or “IRES” refers to an element that promotes direct internal ribosome entry to the initiation codon, such as ATG, of a cistron (a protein encoding region), thereby leading to the cap-independent translation of the gene. See, e.g., Jackson et al, 1990. Trends Biochem Sci 15(12):477- 83) and Jackson and Kaminski. 1995. RNA 1(10):985-1000.
- the vectors contemplated by the invention include one or more polynucleotides-of- interest that encode one or more polypeptides. To achieve efficient translation of each of the plurality of polypeptides, the polynucleotide sequences can be separated by one or more IRES sequences or polynucleotide sequences encoding self-cleaving polypeptides.
- Kanozak sequence refers to a short nucleotide sequence that greatly facilitates the initial binding of mRNA to the small subunit of the ribosome and increases translation.
- the consensus Kozak sequence is
- the vectors contemplated by the invention comprise polynucleotides that have a consensus Kozak sequence and that encode a desired polypeptide, e.g., ABCD1.
- vectors comprise a polyadenylation sequence
- Polyadenylation sequences can promote mRNA stability by addition of a polyA tail to the 3' end of the coding sequence and thus, contribute to increased translational efficiency. Recognized polyadenylation sites include an ideal polyA sequence ⁇ e.g., AATAAA, ATTAAA AGTAAA), a bovine growth hormone polyA sequence (BGHpA), a rabbit ⁇ -globin polyA sequence (rPgpA), or another suitable heterologous or endogenous polyA sequence known in the art.
- vectors comprise a selection gene, also termed a selectable marker.
- selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, e.g., ampicillin, neomycin, hygromycin, methotrexate, Zeocin, Blastocidin, or tetracycline, (b) complement auxotrophic deficiencies, or (c) supply critical nutrients not available from complex media, e.g., the gene encoding D- alanine racemase for Bacilli. Any number of selection systems may be used to recover transformed cell lines. These include, but are not limited to, the herpes simplex virus thymidine kinase (Wigler et al., 1977. Cell 11 :223-232) and adenine
- phosphoribosyltransferase (Lowy et al, 1990. Cell 22:817-823) genes which can be employed in tk- or aprt- cells, respectively.
- a "host cell” includes cells transfected or infected in vivo or in vitro with a recombinant vector or a polynucleotide of the invention.
- Host cells may include packaging cells, producer cells, and cells infected with viral vectors.
- host cells infected with viral vector of the invention are administered to a subject in need of therapy.
- Viral particles are produced by transfecting a transfer vector into a packaging cell line that comprises viral structural and/or accessory genes, e.g., gag, pol, env, tat, rev, vif, vpr, vpu, vpx, or nef genes or other retroviral genes.
- viral structural and/or accessory genes e.g., gag, pol, env, tat, rev, vif, vpr, vpu, vpx, or nef genes or other retroviral genes.
- packaging vector refers to an expression vector or viral vector that lacks a packaging signal and comprises a polynucleotide encoding one, two, three, four or more viral structural and/or accessory genes.
- the packaging vectors are included in a packaging cell, and are introduced into the cell via transfection, transduction or infection. Methods for transfection, transduction or infection are well known by those of skill in the art.
- retroviral/lentiviral transfer vector of the present invention can be introduced into a packaging cell line, via transfection, transduction or infection, to generate a producer cell or cell line.
- the packaging vectors of the present invention can be introduced into human cells or cell lines by standard methods including, e.g., calcium phosphate transfection, lipofection or electroporation.
- the packaging vectors are introduced into the cells together with a dominant selectable marker, such as neomycin, hygromycin, puromycin, blastocidin, zeocin, thymidine kinase, DHFR, Gin synthetase or ADA, followed by selection in the presence of the appropriate drug and isolation of clones.
- a selectable marker gene can be linked physically to genes encoding by the packaging vector, e.g., by IRES or self cleaving viral peptides.
- Viral envelope proteins determine the range of host cells which can ultimately be infected and transformed by recombinant retroviruses generated from the cell lines.
- the env proteins include gp41 and gpl20.
- the viral env proteins expressed by packaging cells of the invention are encoded on a separate vector from the viral gag and pol genes, as has been previously described.
- retroviral-derived env genes which can be employed in the invention include, but are not limited to: MLV envelopes, 10A1 envelope, BAEV, FeLV-B, RD114, SSAV, Ebola, Sendai, FPV (Fowl plague virus), and influenza virus envelopes.
- genes encoding envelopes from RNA viruses ⁇ e.g., RNA virus families of Picornaviridae, Calciviridae, Astroviridae, Togaviridae, Flaviviridae, Coronaviridae, Paramyxoviridae, Rhabdoviridae, Filoviridae,
- Orthomyxoviridae Bunyaviridae, Arenaviridae, Reoviridae, Bimaviridae, Retroviridae
- DNA viruses familialomyxoviridae, Bunyaviridae, Arenaviridae, Reoviridae, Bimaviridae, Retroviridae
- Parvoviridae Parvoviridae, Papovaviridae, Adenoviridae, Herpesviridae, Poxyiridae, and
- Iridoviridae may be utilized. Representative examples include , FeLV, VEE, HFVW, WDSV, SFV, Rabies, ALV, BIV, BLV, EBV, CAEV, SNV, ChTLV, STLV, MPMV, SMRV, RAV, FuSV, MH2, AEV, AMV, CT10, EIAV.
- envelope proteins for pseudotyping a virus of present invention include, but are not limited to any of the following virus: Influenza A such as H1N1, H1N2, H3N2 and H5N1 (bird flu), Influenza B, Influenza C virus, Hepatitis A virus, Hepatitis B virus, Hepatitis C virus, Hepatitis D virus, Hepatitis E virus, Rotavirus, any virus of the Norwalk virus group, enteric adenoviruses, parvovirus, Dengue fever virus, Monkey pox, Mononegavirales, Lyssavirus such as rabies virus, Lagos bat virus, Mokola virus, Duvenhage virus, European bat virus 1 & 2 and Australian bat virus, Ephemera virus, Vesiculovirus, Vesicular Stomatitis Virus (VSV), Herpesviruses such as Herpes simplex virus types 1 and 2, varicella zoster, cytomegalovirus, Epstein-Bar virus (EBV), human herpesvirus
- Venezuelan hemorrhagic fever virus Lassa fever virus, Machupo virus, Lymphocytic choriomeningitis virus (LCMV), Bunyaviridiae such as Crimean-Congo hemorrhagic fever virus, Hantavirus, hemorrhagic fever with renal syndrome causing virus, Rift Valley fever virus, Filoviridae (filovirus) including Ebola hemorrhagic fever and Marburg hemorrhagic fever, Flaviviridae including Kaysanur Forest disease virus, Omsk hemorrhagic fever virus, Tick-borne encephalitis causing virus and
- Paramyxoviridae such as Hendra virus and Nipah virus, variola major and variola minor (smallpox), alphaviruses such as Venezuelan equine encephalitis virus, eastern equine encephalitis virus, western equine encephalitis virus, SARS-associated coronavirus (SARS-CoV), West Nile virus, any encephaliltis causing virus.
- Hendra virus and Nipah virus variola major and variola minor (smallpox)
- alphaviruses such as Venezuelan equine encephalitis virus, eastern equine encephalitis virus, western equine encephalitis virus, SARS-associated coronavirus (SARS-CoV), West Nile virus, any encephaliltis causing virus.
- SARS-CoV SARS-associated coronavirus
- the invention provides packaging cells which produce recombinant retrovirus, e.g., lentivirus, pseudotyped with the VSV-G glycoprotein.
- retrovirus e.g., lentivirus
- lentiviral envelope proteins are pseudotyped with VSV-G.
- the invention provides packaging cells which produce recombinant retrovirus, e.g., lentivirus, pseudotyped with the VSV-G envelope glycoprotein.
- packaging cell lines is used in reference to cell lines that do not contain a packaging signal, but do stably or transiently express viral structural proteins and replication enzymes ⁇ e.g., gag, pol and env) which are necessary for the correct packaging of viral particles.
- Any suitable cell line can be employed to prepare packaging cells of the invention.
- the cells are mammalian cells.
- the cells used to produce the packaging cell line are human cells.
- Suitable cell lines which can be used include, for example, CHO cells, BHK cells, MDCK cells, C3H 10T1/2 cells, FLY cells, Psi-2 cells, BOSC 23 cells, PA317 cells, WEHI cells, COS cells, BSC 1 cells, BSC 40 cells, BMT 10 cells, VERO cells, W138 cells, MRC5 cells, A549 cells, HT1080 cells, 293 cells, 293T cells, B-50 cells, 3T3 cells, NIH3T3 cells, HepG2 cells, Saos-2 cells, Huh7 cells, HeLa cells, W163 cells, 211 cells, and 211 A cells.
- the packaging cells are 293 cells, 293T cells, or A549 cells.
- the cells are A549 cells.
- the term "producer cell line” refers to a cell line which is capable of producing recombinant retroviral particles, comprising a packaging cell line and a transfer vector construct comprising a packaging signal.
- the production of infectious viral particles and viral stock solutions may be carried out using conventional techniques. Methods of preparing viral stock solutions are known in the art and are illustrated by, e.g., Y. Soneoka et al. (1995) Nucl. Acids Res. 23:628-633, and N. R. Landau et al. (1992) J. Virol. 66:5110-5113. Infectious virus particles may be collected from the packaging cells using conventional techniques.
- the infectious particles can be collected by cell lysis, or collection of the supernatant of the cell culture, as is known in the art.
- the collected virus particles may be purified if desired. Suitable purification techniques are well known to those skilled in the art.
- retroviral vectors are transduced into a cell through infection and provirus integration.
- a cell is "transduced” if it comprises a gene or other polynucleotide sequence delivered to the cell by infection using a viral or retroviral vector.
- a transduced cell comprises the gene or other polynucleotide sequence delivered by a retroviral or lentiviral vector in its cellular genome.
- host cells transduced with viral vector of the invention that expresses a therapeutic polypeptide are administered to a subject to treat and/or prevent a disease, disorder, or condition, e.g., adrenoleukodystrophy or adrenomyeloneuropathy.
- a disease, disorder, or condition e.g., adrenoleukodystrophy or adrenomyeloneuropathy.
- Other methods relating to the use of viral vectors in gene therapy which may be utilized according to certain embodiments of the present invention, can be found in, e.g., Kay, M. A. (1997) Chest 111(6
- treatment indicates an approach for obtaining beneficial or desired results, including and preferably clinical results.
- Treatment can involve optionally either the reduction or amelioration of symptoms of the disease or condition, or the delaying of the progression of the disease or condition.
- prevention indicates an approach for preventing, inhibiting, or reducing the likelihood of the occurrence or recurrence of, a disease or condition. It also refers to delaying the onset or recurrence of a disease or condition or delaying the occurrence or recurrence of the symptoms of a disease or condition. As used herein, "prevention” and similar words also includes reducing the intensity, effect, symptoms and/or burden of a disease or condition prior to onset or recurrence of the disease or condition.
- an "effective amount” or a “therapeutically effective amount” of a transduced host cell or a substance is that amount sufficient to affect a desired biological effect, such as beneficial results, including clinical results.
- pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible, including pharmaceutically acceptable cell culture media.
- the carrier is suitable for parenteral administration.
- the carrier can be suitable for intravascular (e.g., intravenous or intraarterial), intraperitoneal or intramuscular administration.
- Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
- sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
- the use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is
- the term "about” or “approximately” refers to a quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length that varies by as much as 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% to a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length.
- the term "about” or “approximately” refers a range of quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length ⁇ 15%, ⁇ 10%, ⁇ 9%, ⁇ 8%, ⁇ 7%, ⁇ 6%, ⁇ 5%, ⁇ 4%, ⁇ 3%, ⁇ 2%>, or ⁇ 1%) about a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length.
- Retroviral and lentiviral vectors have been tested and found to be suitable delivery vehicles for the stable introduction of genes of interest into the genome of a broad range of target cells.
- Many vector designs have been optimized for maximum transduction efficiency and transgene expression by including FLAP, RRE, and HPRE or WPRE sequences.
- those having ordinary skill in the art often include posttranscriptional regulatory sequences to increase transgene expression.
- the present inventors have discovered that inclusion of a WPRE sequence does not significantly increase expression or
- This configuration results in synthesis of an mRNA transcript whose 5' portion comprises the heterologous nucleic acid coding sequences and whose 3' portion comprises the posttranscriptional regulatory element sequence.
- vectors of the invention lack or do not comprise a posttranscriptional regulatory element such as a WPRE or HPRE because in some instances these elements increase the risk of cellular transformation and/or do not substantially or significantly increase the amount of mRNA transcript or increase mRNA stability. Therefore, in some embodiments, vectors of the invention lack or do not comprise a WPRE or HPRE as an added safety measure.
- a posttranscriptional regulatory element such as a WPRE or HPRE because in some instances these elements increase the risk of cellular transformation and/or do not substantially or significantly increase the amount of mRNA transcript or increase mRNA stability. Therefore, in some embodiments, vectors of the invention lack or do not comprise a WPRE or HPRE as an added safety measure.
- the present invention further provides transfer vectors, which may be used to practice methods of the present invention.
- the transfer vector is a retroviral vector or a lentiviral vector, in part since lentiviral vectors are capable of providing efficient delivery, integration and long term expression of transgenes into non-dividing cells both in vitro and in vivo.
- lentiviral vectors are known in the art, see Naldini et ah, (1996a, 1996b, and 1998); Zufferey et al, (1997); Dull et al, 1998, U.S. Pat. Nos. 6,013,516; and 5,994,136, any of which may be adapted to produce a transfer vector of the present invention.
- these vectors are plasmid-based or virus-based, and are configured to carry the essential sequences for transfer of a nucleic acid encoding a therapeutic polypeptide into a host cell.
- the lentiviral genome and the proviral DNA include three genes found in retroviruses: gag, pol and env, which are flanked by two long terminal repeat (LTR) sequences.
- the gag gene encodes the internal structural (matrix, capsid and
- nucleocapsid proteins the pol gene encodes the RNA-directed DNA polymerase (reverse transcriptase), a protease and an integrase; and the env gene encodes viral envelope glycoproteins.
- the 5' and 3' LTR's serve to promote transcription and polyadenylation of the virion RNAs, respectively.
- Lentiviruses have additional genes including vif, vpr, tat, rev, vpu, nef and vpx. Adjacent to the 5' LTR are sequences necessary for reverse transcription of the genome (the tRNA primer binding site) and for efficient encapsidation of viral. RNA into particles (the Psi site).
- the lentiviral vector is an HIV vector.
- the vectors may be derived from human immunodeficiency- 1 (HIV-1), human
- HIV-2 immunodeficiency-2
- SIV simian immunodeficiency virus
- HIV based vector backbones i.e., HIV cis- acting sequence elements and HIV gag, pol and rev genes
- HIV -based constructs are generally be preferred in connection with most aspects of the present invention in that HIV -based constructs are the most efficient at transduction of human cells.
- the vectors of the invention comprise a promoter operably in a microglial cell operably linked to a gene encoding a polypeptide that provides therapy for adreno leukodystrophies and/or adrenomyeloneuropathies.
- the vectors may have one or more LTRs, wherein either LTR comprises one or more modifications, such as one or more nucleotide substitutions, additions, or deletions.
- the vectors may further comprise one of more accessory elements to increase transduction efficiency (e.g., a cPPT/FLAP), viral packaging (e.g., a Psi ( ⁇ ) packaging signal, RRE), and/or other elements that increase therapeutic gene expression (e.g., poly (A) sequences), except that the vectors of the invention do not comprise a WPRE or HPRE.
- accessory elements to increase transduction efficiency e.g., a cPPT/FLAP
- viral packaging e.g., a Psi ( ⁇ ) packaging signal, RRE
- other elements that increase therapeutic gene expression e.g., poly (A) sequences
- the transfer vector of the invention comprises a left (5') retroviral LTR; a central polypurine tract/DNA flap (cPPT/FLAP); a retroviral export element; a promoter active in a microglial cell, operably linked to a polynucleotide encoding an ATP -binding cassette, sub-family D, member 1 (ABCDl) polypeptide; and a right (3') retroviral LTR; wherein the vector does not comprise a woodchuck post-transcriptional regulatory element (WPRE).
- WPRE woodchuck post-transcriptional regulatory element
- the transfer vector of the invention comprises a left (5') retroviral LTR; a retroviral export element; a promoter active in a microglial cell, operably linked to a polynucleotide encoding an ATP -binding cassette, sub-family D, member 1 (ABCD1) polypeptide; a right (3') retroviral LTR; and a poly (A) sequence, wherein the vector does not comprise a woodchuck post-transcriptional regulatory element (WPRE).
- WPRE woodchuck post-transcriptional regulatory element
- the invention provides a lenti viral vector comprising: a left (5') LTR; a cPPT/FLAP; an RRE; a MND promoter operably linked to a polynucleotide encoding a human ABCD1 polypeptide (e.g., SEQ ID NO: 1-2); a right (3') LTR; and a polyadenylation sequence; wherein the vector does not comprise a woodchuck post-transcriptional regulatory element (WPRE).
- WPRE woodchuck post-transcriptional regulatory element
- the invention provides a lentiviral vector comprising: a left (5') HIV-1 LTR; a Psi ( ⁇ ) packaging signal; a cPPT/FLAP; an RRE; a MND promoter, operably linked to a cDNA encoding a human ABCD1 polypeptide; a right (3') self-inactivating (SIN) HIV-1 LTR; and a rabbit ⁇ -globin polyadenylation sequence; wherein the vector does not comprise a woodchuck post-transcriptional regulatory element (WPRE).
- WPRE woodchuck post-transcriptional regulatory element
- the invention provides a vector comprising: at least one LTR; a central polypurine tract/DNA flap (cPPT/FLAP); a retroviral export element; and a promoter active in a microglial cell, operably linked to a polynucleotide encoding an ATP-binding cassette, sub-family D, member 1 (ABCD1) polypeptide; wherein the vector does not comprise a woodchuck post-transcriptional regulatory element (WPRE).
- WPRE woodchuck post-transcriptional regulatory element
- the present invention provides a vector comprising at least one LTR; a cPPT/FLAP; an RRE; a MND promoter operably linked to a polynucleotide encoding a human ABCD1 polypeptide; and a polyadenylation sequence;wherein the vector does not comprise a woodchuck post-transcriptional regulatory element (WPRE).
- WPRE woodchuck post-transcriptional regulatory element
- the present invention provides at least one SIN
- HIV-1 LTR a Psi ( ⁇ ) packaging signal; a cPPT/FLAP; an RRE; a MND promoter, operably linked to a cDNA encoding a human ABCD1 polypeptide; and a rabbit ⁇ - globin polyadenylation sequence, wherein the vector does not comprise a woodchuck post-transcriptional regulatory element (WPRE).
- WPRE woodchuck post-transcriptional regulatory element
- the present invention further includes pharmaceutical compositions comprising transduced cells produced according to methods described herein and a pharmaceutically acceptable carrier.
- the carrier is suitable for parenteral administration.
- the carrier can be suitable for intravenous, intraperitoneal or intramuscular administration.
- Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. The use of such media and agents for pharmaceutically active substances is well known in the art.
- compositions of the invention may comprise one or more polypeptides, polynucleotides, vectors comprising same, transduced cells, etc., as described herein, formulated in pharmaceutically-acceptable or physiologically- acceptable solutions for administration to a cell or an animal, either alone, or in combination with one or more other modalities of therapy. It will also be understood that, if desired, the compositions of the invention may be administered in combination with other agents as well, such as, e.g., other proteins, polypeptides, small molecules or various pharmaceutically-active agents. There is virtually no limit to other components that may also be included in the compositions, provided that the additional agents do not adversely affect the ability of the composition to deliver the intended gene therapy.
- compositions of the invention formulation of pharmaceutically-acceptable excipients and carrier solutions is well-known to those of skill in the art, as is the development of suitable dosing and treatment regimens for using the particular compositions described herein in a variety of treatment regimens, including e.g., oral, parenteral, intravenous, intranasal, and intramuscular administration and formulation.
- Solutions of the active compounds as free base or pharmacologically acceptable salts may be prepared in water suitably mixed with a surfactant, such as
- Dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms .
- the pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (U.S. Pat. No. 5,466,468, specifically incorporated herein by reference in its entirety).
- the form should be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms, such as bacteria and fungi.
- the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils.
- polyol e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like
- suitable mixtures thereof e.g., vegetable oils
- vegetable oils e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like
- suitable mixtures thereof e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like
- vegetable oils e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like
- Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion
- isotonic agents for example, sugars or sodium chloride.
- Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
- aqueous solution for parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose.
- aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration.
- a sterile aqueous medium that can be employed will be known to those of skill in the art in light of the present disclosure.
- one dosage may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion (see, e.g.,
- Sterile injectable solutions can be prepared by incorporating the active compounds in the required amount in the appropriate solvent with the various other ingredients enumerated above, as required, followed by filtered sterilization.
- dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
- the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
- compositions disclosed herein may be formulated in a neutral or salt form.
- Pharmaceutically-acceptable salts include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective.
- carrier includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like.
- carrier includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like.
- the use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.
- phrases "pharmaceutically-acceptable" refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a human.
- the preparation of an aqueous composition that contains a protein as an active ingredient is well understood in the art. Typically, such
- compositions are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to injection can also be prepared.
- the preparation can also be emulsified.
- the compositions may be delivered by intranasal sprays, inhalation, and/or other aerosol delivery vehicles.
- Methods for delivering genes, polynucleotides, and peptide compositions directly to the lungs via nasal aerosol sprays has been described e.g., in U.S. Pat. No. 5,756,353 and U.S. Pat. No. 5,804,212 (each specifically incorporated herein by reference in its entirety).
- the delivery of drugs using intranasal microparticle resins Takenaga et ah, 1998) and lysophosphatidyl-glycerol compounds (U.S. Pat. No. 5,725,871, specifically
- transmucosal drug delivery in the form of a
- the delivery may occur by use of liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, optionally mixing with CPP polypeptides, and the like, for the introduction of the compositions of the present invention into suitable host cells.
- the compositions of the present invention may be formulated for delivery either encapsulated in a lipid particle, a liposome, a vesicle, a nanosphere, a nanoparticle or the like.
- the formulation and use of such delivery vehicles can be carried out using known and conventional techniques.
- the formulations and compositions of the invention may comprise one or more repressors and/or activators comprised of a combination of any number of polypeptides, polynucleotides, and small molecules, as described herein, formulated in
- compositions of the invention may be administered in combination with other agents as well, such as, e.g., cells, other proteins or polypeptides or various pharmaceutically- active agents.
- a formulation or composition according to the present invention comprises a cell contacted with a combination of any number of polypeptides, polynucleotides, and small molecules, as described herein.
- the present invention provides formulations or compositions suitable for the delivery of viral vector systems (i.e., viral-mediated transduction) including, but not limited to, retroviral (e.g., lentiviral) vectors.
- viral vector systems i.e., viral-mediated transduction
- retroviral vectors e.g., lentiviral
- Exemplary formulations for ex vivo delivery may also include the use of various transfection agents known in the art, such as calcium phosphate, electoporation, heat shock and various liposome formulations (i.e., lipid-mediated transfection).
- various transfection agents known in the art, such as calcium phosphate, electoporation, heat shock and various liposome formulations (i.e., lipid-mediated transfection).
- Liposomes are lipid bilayers entrapping a fraction of aqueous fluid. DNA spontaneously associates to the external surface of cationic liposomes (by virtue of its charge) and these liposomes will interact with the cell membrane.
- the present invention provides pharmaceutically acceptable compositions which comprise a therapeutically-effective amount of one or more polynucleotides or polypeptides, as described herein, formulated together with one or more pharmaceutically acceptable carriers (additives) and/or diluents (e.g., pharmaceutically acceptable cell culture medium).
- Particular embodiments of the invention may comprise other formulations, such as those that are well known in the pharmaceutical art, and are described, for example, in Remington: The Science and Practice of Pharmacy, 20th Edition. Baltimore, MD: Lippincott Williams & Wilkins, 2000.
- the retroviral vectors provide improved methods of
- a viral vector of the invention comprises a promoter that expresses a therapeutic transgene encoding a polypeptide that provides curative, preventative, or ameliorative benefits to a subject diagnosed with or that is suspected of having an adrenoleukodystrophy or adrenomyeloneuropathy.
- the virus can infect and transduce the cell in vivo, ex vivo, or in vitro.
- the transduced cells can then be administered to a subject in need of therapy.
- the present invention contemplates that the vector systems, viral particles, and transduced cells of the invention arecan be use to treat, prevent, and/or ameliorate an adrenoleukodystrophy or adrenomyeloneuropathy in a subject.
- the retroviral vectors are administered by direct injection to a cell, tissue, or organ of a subject in need of gene therapy, in vivo.
- cells are transduced in vitro or ex vivo with vectors of the invention. The transduced cells are then administered to a subject having
- adrenoleukodystrophy or adrenomyeloneuropathy adrenoleukodystrophy or adrenomyeloneuropathy.
- Cells suitable for transduction and administration in the gene therapy methods of the invention include, but are not limited to stem cells, progenitor cells, and differentiated cells.
- the transduced cells are bone marrow stem cells, umbilical cord stem cells, or mesenchymal stem cells.
- stem cell refers to a cell which is an undifferentiated cell capable of (1) long term self -renewal, or the ability to generate at least one identical copy of the original cell, (2) differentiation at the single cell level into multiple, and in some instance only one, specialized cell type and (3) of in vivo functional regeneration of tissues.
- Stem cells are subclassified according to their developmental potential as totipotent, pluripotent, multipotent and oligo/unipotent.
- Self-renewal refers a cell with a unique capacity to produce unaltered daughter cells and to generate specialized cell types (potency).
- Asymmetric cell division produces one daughter cell that is identical to the parental cell and one daughter cell that is different from the parental cell and is a progenitor or differentiated cell. Asymmetric cell division does not increase the number of cells. Symmetric cell division produces two identical daughter cells.
- Proliferation or “expansion” of cells refers to symmetrically dividing cells.
- pluripotent means the ability of a cell to form all lineages of the body or soma (i.e., the embryo proper).
- embryonic stem cells are a type of pluripotent stem cells that are able to form cells from each of the three germs layers, the ectoderm, the mesoderm, and the endoderm.
- multipotent refers to the ability of an adult stem cell to form multiple cell types of one lineage.
- hematopoietic stem cells are capable of forming all cells of the blood cell lineage, e.g., lymphoid and myeloid cells.
- progenitor or “progenitor cells” refers to cells have the capacity to self-renew and to differentiate into more mature cells. Many progenitor cells differentiate along a single lineage, but may have quite extensive proliferative capacity.
- Hematopoietic stem cells give rise to committed hematopoietic progenitor cells (HPCs) that are capable of generating the entire repertoire of mature blood cells over the lifetime of an organism.
- HPC hematopoietic stem cell
- myeloid e.g., monocytes and macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes/platelets, dendritic cells
- lymphoid lineages e.g., T-cells, B-cells, NK-cells
- hematopoietic stem and progenitor cells When transplanted into lethally irradiated animals or humans, hematopoietic stem and progenitor cells can repopulate the erythroid, neutrophil-macrophage, megakaryocyte and lymphoid hematopoietic cell pool.
- the transduced cells are hematopoeitic stem and/or progentior cells isolated from bone marrow, umbilical cord blood, or peripheral circulation.
- the transduced cells are hematopoeitic stem cells isolated from bone marrow, umbilical cord blood, or peripheral circulation.
- Cells of the invention can be autologous/autogeneic ("self) or non- autologous ("non-self,” e.g., allogeneic, syngeneic or xenogeneic).
- autologous refers to cells from the same subject.
- Allogeneic refers to cells of the same species that differ genetically to the cell in comparison.
- “Syngeneic,” as used herein, refers to cells of a different subject that are genetically identical to the cell in comparison.
- "Xenogeneic,” as used herein, refers to cells of a different species to the cell in comparison. In preferred embodiments, the cells of the invention are allogeneic.
- a "subject,” as used herein, includes any animal that exhibits a symptom of an adrenoleukodystrophy or adrenomyeloneuropathy that can be treated with the gene therapy vectors, cell-based therapeutics, and methods disclosed elsewhere herein.
- Suitable subjects ⁇ e.g., patients) include laboratory animals (such as mouse, rat, rabbit, or guinea pig), farm animals, and domestic animals or pets (such as a cat or dog).
- Non- human primates and, preferably, human patients, are included.
- Typical subjects include animals that exhibit aberrant amounts (lower or higher amounts than a "normal” or "healthy” subject) of one or more physiological activities that can be modulated by gene therapy.
- treatment includes any beneficial or desirable effect on the symptoms or pathology of a disease or pathological condition, and may include even minimal reductions in one or more measurable markers of the disease or condition being treated. Treatment can involve optionally either the reduction or amelioration of symptoms of the disease or condition, or the delaying of the progression of the disease or condition. “Treatment” does not necessarily indicate complete eradication or cure of the disease or condition, or associated symptoms thereof.
- prevention and similar words such as “prevented,” “preventing” etc., indicate an approach for preventing, inhibiting, or reducing the likelihood of the occurrence or recurrence of, a disease or condition. It also refers to delaying the onset or recurrence of a disease or condition or delaying the occurrence or recurrence of the symptoms of a disease or condition. As used herein, “prevention” and similar words also includes reducing the intensity, effect, symptoms and/or burden of a disease or condition prior to onset or recurrence of the disease or condition.
- the term “amount” refers to "an amount effective” or “an effective amount” of a virus or transduced therapeutic cell to achieve a beneficial or desired prophylactic or therapeutic result, including clinical results.
- a “prophylactically effective amount” refers to an amount of a virus or transduced therapeutic cell effective to achieve the desired prophylactic result.
- the prophylactically effective amount is less than the therapeutically effective amount.
- a “therapeutically effective amount” of a virus or transduced therapeutic cell may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the stem and progenitor cells to elicit a desired response in the individual.
- a therapeutically effective amount is also one in which any toxic or detrimental effects of the virus or transduced therapeutic cells are outweighed by the therapeutically beneficial effects.
- the term “therapeutically effective amount” includes an amount that is effective to "treat" a subject ⁇ e.g., a patient).
- the invention provides transduced cells with the potential to develop into brain microglial cells.
- hematopoietic stem cells are transduced with a vector of the invention and administered to an individual in need of therapy for an adrenoleukodystrophy or
- Hematopoietic stem cells are the origin of brain microglial cells and thus, are preferred.
- the transduced cells may be administered as part of a bone marrow transplant in an individual that has or has not undergone bone marrow ablative therapy.
- transduced cells of the invention are administered in a bone marrow transplant to an individual that has undergone chemoablative or radioablative bone marrow therapy.
- the subject is a young male.
- a dose of transduced cells is delivered to a subject intravenously.
- transduced hematopoietic stem cells are intravenously administered to a subject.
- patients receive a dose of transduced hematopoietic stem cells of about 1 x 10 5 cells/kg, about 5 x 10 5 cells/kg, about 1 x 10 6 cells/kg, about 2 x 10 6 cells/kg, about 3 x 10 6 cells/kg, about 4 x 10 6 cells/kg, about 5 x 10 6 cells/kg, about 6 x 10 6 cells/kg, about 7 x 10 6 cells/kg, about 8 x 10 6 cells/kg, about 9 x 10 6 cells/kg, about 1 x 10 7 cells/kg, about 5 x 10 7 cells/kg, about 1 x 10 8 cells/kg, or more in one single intravenous dose.
- patients receive a dose of transduced hematopoietic stem cells of about 1 x 10 5 cells/kg to about 1 x 10 8 cells/kg, about 1 x 10 6 cells/kg to about 1 x 10 8 cells/kg, about 1 x 10 6 cells/kg to about 9 x 10 6 cells/kg, about 2 x 10 6 cells/kg to about 8 x 10 6 cells/kg, about 2 x 10 6 cells/kg to about 8 x 10 6 cells/kg, about 2 x 10 6 cells/kg to about 5 x 10 6 cells/kg, about 3 x 10 6 cells/kg to about 5 x 10 6 cells/kg, about 3 x 10 6 cells/kg to about 4 x 10 8 cells/kg, or any intervening dose of cells/kg.
- Transduced cells can be stimulated with cytokines for expansion using existing methods in the art.
- subjects are administered 1, 2, 3, 4, 5, or more doses over days, months, or years, as needed to maintain or increase the therapy.
- hematopoietic stem cells are transduced with a vector of the invention comprising a promoter active in microglial cells, e.g., a MND promoter, that is operably linked to a gene encoding a polypeptide, e.g., ABCD1, that can be used to treat, prevent or ameliorate an adrenoleukodystrophy and/or
- adrenomyeloneuropathy in a subject adrenomyeloneuropathy in a subject.
- a lentiviral vector comprising a MND promoter operably linked to a cDNA encoding human ACBD1, and a WPRE element (see Figure 1; CG1711 MND- ALD) vector is not available for commercial development.
- a vector development program to identify an appropriate lentiviral vector to take forward into future clinical trials.
- the commercially acceptable vector was made as a result of the vector development program and did not alter the ABCD-1 gene operably linked to the MND promoter.
- the removal of the WPRE from the vector did not alter the transduction efficiency and transgene expression in human hematopoietic cells.
- All lentiviral vectors contained the normal human ATP -binding cassette, sub-family D (ALD), member 1 (ABCDl) cDNA under the control of the MND promoter.
- Figure 1 and Table 1 summarizes the different components and their position in the CGI 711, pLBPlOO and pLBP140 MND-ALD vectors.
- Table 1 Vector Summary
- Lentiviral pLBPlOO and pLBP140 supernatants were produced by calcium phosphate transfection of 293T cells with 5-plasmids (pLBPlOO or pLBP140 vectors, HPV 275 - gag-pol, ⁇ 15 - VSV-G env, p633 - rev, HPV601 - tat).
- Concentrated pLBPlOO was obtained after ultracentrifugation, resuspensed into SCGM (CellGenix Inc., Germany GMBH) medium, and cryopreserved at ⁇ -70°C in single-use cryo vials. Infectious titers were determined from flow cytometric analysis of transduced 3T3 cells.
- mPB human G-CSF mobilized peripheral blood
- CD34 + cells AUCells, LLC, Emeryville, CA
- SCGM serum-derived peripheral blood
- human recombinant IL-3 60 ng/ml
- Flt-3L 100 ng/ml
- TPO 100 ng/ml
- SCF 100 ng/ml
- transductions were performed in 96-well plates pre-coated with 20 ⁇ g/mL retronectin (Takara Bio Inc, Shiga, Japan) with overnight incubation at 4°C.
- retronectin Takara Bio Inc, Shiga, Japan
- the cells were washed and either (1) resuspended SCGM medium supplemented with the same concentration of cytokines and further incubated over 21 days or (2) 1 -cultured in MethoCult H4434 medium (Stem Cell Technologies) for colony forming cells (CFCs).
- MethoCult H4434 medium Stem Cell Technologies
- CFU-GM Total myeloid
- BFU-E erythroid
- LTC-IC Long-term culture initiating cell
- Eight 96well plates were inoculated with the mouse bone marrow stromal cell line MS-5 in Alpha medium supplemented with 10% fetal bovine serum and were gamma-irradiated (30 Gy) when they became nearly confluent.
- the pre-established MS-5 stromal layers were inoculated with human CD34+ test cells in 200 of StemSpan SFEM (Serum- free Medium, Stem Cell Technologies, Vancouver, Canada) at various dilutions with 16-wells per dilution (2000 cells per well in 16 wells, 1000 cells per well in 16 wells, 500 cells per well in 16 wells, 250 cells per well in 16 wells, 125 cells per well in 16 wells, 62 cells per well in 16 wells, 31 cells per well in 16 wells, 16 cells per well in 16 wells, 8 cells per well in 16 wells).
- An additional 100,000 CD34+ cells were cultured in bulk for 5 weeks on MS-5 feeder cells.
- VCN per cell was determined from quantitative (real time) PCR (QPCR) on DNA preparations from either liquid cultures or pooled colony cells in methylcellulose cultures following dilution and washing in PBS. QPCR was performed on the ABl Prism 7000 Sequence Detection System with ABl reagents and 96 well- plates.
- GAG-F forward primer
- GAG-R reverse primer 5 ' ggttgtagctgtcccagtatttgtc 3 '
- GAG-P probe, antisense 5'-(FAM)-acagccttctgatgtctctaaaggccagg-(TAMRA)-3'
- Human beta actin probe and primers used to quantify genomic DNA for normalization:
- ABCD1 (ALDP) protein was performed on fixed and permeabilized cells (Fix & Perm Reagents A and B, cat. Nos. GAS001 & GAS002, Invitrogen) using the mouse anti-human ALDP (ABCD1) monoclonal antibody (Clone 1D6, Lot# LV1383343, Chemicon) followed by staining with PE-conjugated rat anti- mouse IgGl mAb (clone A85-1, BD Pharmingen). The mouse IgGl monoclonal antibody clone MOPC-21 (BioLegend) was used as an isotype control.
- CFU-GM functional myeloid
- BFU-E erythroid progenitors
- Figure 7 shows that average VCN and the percent vector positive myeloid colonies decreased following the 5-week LTC-IC for both vector groups with the pLBPlOO transduced cells again having the higher VCN (1.1 vs. 0.4 copies) and proportion of positive colonies (51% vs. 35%).
- ALDP transsene expression by flow cytometry shows that average VCN and the percent vector positive myeloid colonies decreased following the 5-week LTC-IC for both vector groups with the pLBPlOO transduced cells again having the higher VCN (1.1 vs. 0.4 copies) and proportion of positive colonies (51% vs. 35%).
- the level of transgene expression given by the two vectors produced mixed results with two experiments showing a higher percent of ALDP + cells from pLBPlOO and one experiment showing a lower percent as compared to pLBP140. These differences were not statistically significant.
- vectors of the present invention provide increased safety and equal of superior efficacy compared to WPRE containing vectors. Moreover, the results show that vectors of the invention are well suited for further development and clinical application.
- VLCFA very long chain fatty acids
- C26 chain very long chain fatty acids
- ALD ALD protein
- the C26:0 lyso-PC assay (LPC assay), developed at the Kennedy Krieger Institute (Baltimore, MD), measures VLCFA by liquid chromatography and tandem mass spectrophotometry. This method was developed for newborn blood spots and was also validated on plasma and cultured skin fibroblasts.
- the C26:0 lyso-PC assay was used to demonstrate the functional correction of the biochemical defect in ALD patient fibroblasts.
- the purpose of this experiment was to compare the efficacy of the vectors pLBPlOO (pi 00) and pLBP140 (pi 40) in reducing VLCFA levels in vector-modified ALD-defective fibroblast cells.
- GM04496 and AGO 1440 were obtained from the Coriell Cell Repository (Camden, NJ, USA).
- the GM04496 cells are un- transformed human fibroblasts isolated from an ALD-negative patient with an unknown mutation of the ABCD1 gene.
- AGO 1440 cells are normal human fibroblasts. Cells were grown in DMEM (GIBCO Life Technologies, Carlsbad, CA) with 15% FBS (HyClone FBS, GIBCO Life Technologies) at 37°C, 5% C02 in a humidified incubator.
- TF-1 cells are a human lymphoblast line derived from a bone marrow erythroleukemia. Cells were grown in RPMI-1640 (GIBCO Life Technologies) with 10 % FBS.
- 293T cells (Stanford University) which are used to produce lentiviral vectors, were grown in DMEM with 10%FBS. Transduction protocol and plating for Lyso-PC assay
- Sub-confluent cells were transduced with viral supernatant in media + 8ug/ml polybrene (Hexadimethrine Bromide, Sigma, St Louis MO) for 14-16 hrs.
- the cells remaining after plating for LPC assay were kept in culture for genomic DNA harvest until at least day 9 post transduction for DNA isolation and VCN analysis. Lipid and Protein extraction was completed at the Kennedy Krieger Institute.
- the 4496 cells and normal-fibroblast 1440 cells were plated for analysis.
- the baseline levels of C26:0LPC ranged from 3-50 pmol/mg protein in cells with a normal phenotype, and the 4496 cells had elevated levels in each analysis. Overall, there was at least a 5-fold difference (ratio below 0.2) in the levels of
- the ratio of 0.2 was established as the level of cells with a normal phenotype compared to mock-txd 4496 cells. VLCFA accumulation in 4496 cells is corrected to the level of normal cells for both vectors when VCN > ⁇ 1.5. The trend for a decrease in correction is present with both vectors at VCN 1.0- 0.6.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Cell Biology (AREA)
- Medicinal Chemistry (AREA)
- Immunology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Developmental Biology & Embryology (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Microbiology (AREA)
- Epidemiology (AREA)
- Virology (AREA)
- Molecular Biology (AREA)
- Hematology (AREA)
- Biophysics (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Urology & Nephrology (AREA)
- Reproductive Health (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Toxicology (AREA)
- Gynecology & Obstetrics (AREA)
- Diabetes (AREA)
Abstract
Description
Claims
Priority Applications (15)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| MX2013014544A MX2013014544A (en) | 2011-06-10 | 2012-06-08 | Gene therapy vectors for adrenoleukodystrophy and adrenomyeloneuropathy. |
| ES12796252T ES2710452T3 (en) | 2011-06-10 | 2012-06-08 | Gene therapy vectors for adrenoleukodystrophy and adrenomyeloneuropathy |
| EP18193359.9A EP3492108A1 (en) | 2011-06-10 | 2012-06-08 | Gene therapy vectors for adrenoleukodystrophy and adrenomyeloneuropathy |
| RU2014100160/10A RU2014100160A (en) | 2011-06-10 | 2012-06-08 | VECTORS OF GENE THERAPY OF ADRENOLEUIC DYSTROPHY AND ADRENOMYELONEUROPATHY |
| AU2012267512A AU2012267512B2 (en) | 2011-06-10 | 2012-06-08 | Gene therapy vectors for adrenoleukodystrophy and adrenomyeloneuropathy |
| PL12796252T PL2717922T3 (en) | 2011-06-10 | 2012-06-08 | Gene therapy vectors for adrenoleukodystrophy and adrenomyeloneuropathy |
| KR1020147000344A KR101528440B1 (en) | 2011-06-10 | 2012-06-08 | Gene therapy vectors for adrenoleukodystrophy and adrenomyeloneuropathy |
| JP2014514899A JP6143231B2 (en) | 2011-06-10 | 2012-06-08 | Gene therapy vectors for adrenal cerebral white matter dystrophy and adrenal spinal neuropathy |
| DK12796252.0T DK2717922T3 (en) | 2011-06-10 | 2012-06-08 | GENERATIVE VECTORS FOR ADDRENOLEUCODYSTROPHY AND ADDRENOMYELONE EUROPE |
| EP12796252.0A EP2717922B1 (en) | 2011-06-10 | 2012-06-08 | Gene therapy vectors for adrenoleukodystrophy and adrenomyeloneuropathy |
| CA2838749A CA2838749A1 (en) | 2011-06-10 | 2012-06-08 | Gene therapy vectors for adrenoleukodystrophy and adrenomyeloneuropathy |
| US14/125,220 US9789139B2 (en) | 2011-06-10 | 2012-06-08 | Gene therapy vectors for adrenoleukodystrophy and adrenomyeloneuropathy |
| CN201280038832.1A CN103717240A (en) | 2011-06-10 | 2012-06-08 | Gene therapy vectors for adrenoleukodystrophy and adrenomyeloneuropathy |
| KR1020157004059A KR20150029756A (en) | 2011-06-10 | 2012-06-08 | Gene therapy vectors for adrenoleukodystrophy and adrenomyeloneuropathy |
| ZA2013/09515A ZA201309515B (en) | 2011-06-10 | 2013-12-17 | Gene therapy vectors for adrenoleukodystrophy and adrenomyeloneuropathy |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201161495857P | 2011-06-10 | 2011-06-10 | |
| US61/495,857 | 2011-06-10 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2012170911A2 true WO2012170911A2 (en) | 2012-12-13 |
| WO2012170911A3 WO2012170911A3 (en) | 2013-04-11 |
Family
ID=47296778
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2012/041693 Ceased WO2012170911A2 (en) | 2011-06-10 | 2012-06-08 | Gene therapy vectors for adrenoleukodystrophy and adrenomyeloneuropathy |
Country Status (16)
| Country | Link |
|---|---|
| US (3) | US8858928B2 (en) |
| EP (2) | EP3492108A1 (en) |
| JP (2) | JP6143231B2 (en) |
| KR (2) | KR20150029756A (en) |
| CN (1) | CN103717240A (en) |
| AU (1) | AU2012267512B2 (en) |
| CA (1) | CA2838749A1 (en) |
| DK (1) | DK2717922T3 (en) |
| ES (1) | ES2710452T3 (en) |
| MX (1) | MX2013014544A (en) |
| PL (1) | PL2717922T3 (en) |
| PT (1) | PT2717922T (en) |
| RU (1) | RU2014100160A (en) |
| TR (1) | TR201819015T4 (en) |
| WO (1) | WO2012170911A2 (en) |
| ZA (1) | ZA201309515B (en) |
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015059276A1 (en) * | 2013-10-24 | 2015-04-30 | Adaptimmune Limited | Vectors for transgene expression |
| US10383929B2 (en) | 2014-12-12 | 2019-08-20 | Bluebird Bio, Inc. | BCMA chimeric antigen receptors |
| US10479975B2 (en) | 2014-06-06 | 2019-11-19 | Bluebird Bio, Inc. | Methods of making T cell compositions |
| EP3689899A1 (en) | 2014-04-25 | 2020-08-05 | Bluebird Bio, Inc. | Mnd promoter chimeric antigen receptors |
| US20220175965A1 (en) * | 2019-12-31 | 2022-06-09 | Swanbio Therapeutics Limited | Aav-abcd1 constructs and use for treatment or prevention of adrenoleukodystrophy (ald) and/or adrenomyeloneuropathy (amn) |
| EP4035659A1 (en) | 2016-11-29 | 2022-08-03 | PureTech LYT, Inc. | Exosomes for delivery of therapeutic agents |
| US11479755B2 (en) | 2015-12-07 | 2022-10-25 | 2Seventy Bio, Inc. | T cell compositions |
| US12006369B2 (en) | 2014-07-24 | 2024-06-11 | 2Seventy Bio, Inc. | BCMA chimeric antigen receptors |
| US12109234B2 (en) | 2016-11-04 | 2024-10-08 | 2Seventy Bio, Inc. | Anti-BCMA CAR T cell compositions |
| WO2024229126A3 (en) * | 2023-05-01 | 2025-04-17 | Seattle Children's Hospital D/B/A Seattle Children's Research Institute | Mutant interleukin 15 expressing immune cells |
| US12291722B2 (en) | 2014-04-25 | 2025-05-06 | 2Seventy Bio, Inc. | Methods for manufacturing adoptive cell therapies |
| US12378578B2 (en) | 2018-07-09 | 2025-08-05 | Flagship Pioneering Innovations V, Inc. | Fusosome compositions and uses thereof |
| US12496274B2 (en) | 2018-11-14 | 2025-12-16 | Flagship Pioneering Innovations V, Inc. | Compositions and methods for compartment-specific cargo delivery |
Families Citing this family (28)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2838749A1 (en) | 2011-06-10 | 2012-12-13 | Bluebird Bio, Inc. | Gene therapy vectors for adrenoleukodystrophy and adrenomyeloneuropathy |
| US9822355B2 (en) | 2012-11-27 | 2017-11-21 | Children's Medical Center Corporation | Targeting BCL11A distal regulatory elements for fetal hemoglobin reinduction |
| CA2946309C (en) | 2014-04-25 | 2021-11-09 | Michael MILSOM | Synthetic bcl11a micrornas for treating hemoglobinopathies |
| US20180094280A1 (en) * | 2015-03-20 | 2018-04-05 | Bluebird Bio, Inc. | Vector formulations |
| CN104857014B (en) * | 2015-04-21 | 2017-12-08 | 武汉大学 | Application of the 2 hydroxypropyl beta cyclodextrins in the medicine for preparing the treatment chain adrenal gland white matter of brain degeneration diseases of X |
| US11572543B2 (en) | 2015-05-08 | 2023-02-07 | The Children's Medical Center. Corporation | Targeting BCL11A enhancer functional regions for fetal hemoglobin reinduction |
| IL246634B (en) * | 2015-07-23 | 2020-08-31 | Brett Buno | Method for generating high-titer hepatitis e virus stocks and titration assay for hepatitis e virus |
| ES2916325T3 (en) | 2015-11-05 | 2022-06-30 | Massachusetts Gen Hospital | Intrathecal administration of ABCD1-encoding nucleic acid sequences for the treatment of adrenomyeloneuropathy |
| BR112018016450A2 (en) | 2016-02-12 | 2018-12-26 | Bluebird Bio Inc | vcn enhancer compositions and methods of using them |
| WO2017139561A1 (en) | 2016-02-12 | 2017-08-17 | Bluebird Bio, Inc. | Vcn enhancer compositions and methods of using the same |
| AU2017233055A1 (en) * | 2016-03-18 | 2018-10-04 | Intrexon Corporation | Compositions and methods for treatment of type VII collagen deficiencies |
| JP2019517281A (en) * | 2016-06-13 | 2019-06-24 | ブルーバード バイオ, インコーポレイテッド | Gene therapy for neurotheloid lipofuscinosis |
| EP3471743B1 (en) * | 2016-06-17 | 2025-08-06 | Fred Hutchinson Cancer Center | Strategies to assess and/or produce cell populations with predictive engraftment potential |
| CA3046079A1 (en) * | 2016-12-06 | 2018-06-14 | Bluebird Bio, Inc. | Gene therapy for mucopolysaccharidosis, type i |
| AU2017370673A1 (en) * | 2016-12-06 | 2019-06-27 | Bluebird Bio, Inc. | Gene therapy for mucopolysaccharidosis, type II |
| US11261441B2 (en) * | 2017-03-29 | 2022-03-01 | Bluebird Bio, Inc. | Vectors and compositions for treating hemoglobinopathies |
| GB201706121D0 (en) * | 2017-04-18 | 2017-05-31 | Glaxosmithkline Ip Dev Ltd | Stable cell lines for retroviral production |
| WO2018218135A1 (en) | 2017-05-25 | 2018-11-29 | The Children's Medical Center Corporation | Bcl11a guide delivery |
| EP3675878A4 (en) | 2017-10-02 | 2021-06-16 | Fred Hutchinson Cancer Research Center | Luteinizing hormone receptor binding agents and luteinizing hormone agonists to identify, expand, ablate and modify primitive stem cell populations |
| CN108456697B (en) | 2018-03-29 | 2022-05-27 | 成都优娃生物科技有限公司 | Application of lentiviral vector EF1 alpha promoter to optimized expression of ABCD1 gene for treating adrenoleukodystrophy |
| EP3788144B1 (en) | 2018-05-01 | 2025-09-24 | The Children's Medical Center Corporation | Enhanced bcl11a rnp / crispr delivery & editing using a 3xnls-cas9 |
| US12350284B2 (en) | 2018-05-02 | 2025-07-08 | The Children's Medical Center Corporation | BCL11A microRNAs for treating hemoglobinopathies |
| JP7568513B2 (en) * | 2018-05-15 | 2024-10-16 | フラッグシップ パイオニアリング イノベーションズ ブイ, インコーポレイテッド | Fusosome Compositions and Uses Thereof |
| EP3774841A1 (en) | 2018-08-27 | 2021-02-17 | Regeneron Pharmaceuticals, Inc. | Use of raman spectroscopy in downstream purification |
| JP7676305B2 (en) * | 2018-11-14 | 2025-05-14 | フラッグシップ パイオニアリング イノベーションズ ブイ, インコーポレイテッド | Fusosome Compositions for CNS Delivery |
| KR102163889B1 (en) * | 2019-01-11 | 2020-10-12 | 동의대학교 산학협력단 | Composition for preventing and treating of neuropathic pain containing nypa fruticans wurmb extract |
| CN115838765A (en) * | 2021-09-18 | 2023-03-24 | 济南赛尔生物科技股份有限公司 | Lentiviral vector for treating metachromatic leukodystrophy |
| CN114478713B (en) * | 2022-02-21 | 2023-03-28 | 江苏蒙彼利生物科技有限公司 | CMV envelope protein packaging lentiviral vector and application thereof |
Citations (18)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5399363A (en) | 1991-01-25 | 1995-03-21 | Eastman Kodak Company | Surface modified anticancer nanoparticles |
| US5460964A (en) | 1992-04-03 | 1995-10-24 | Regents Of The University Of Minnesota | Method for culturing hematopoietic cells |
| US5466468A (en) | 1990-04-03 | 1995-11-14 | Ciba-Geigy Corporation | Parenterally administrable liposome formulation comprising synthetic lipids |
| US5543158A (en) | 1993-07-23 | 1996-08-06 | Massachusetts Institute Of Technology | Biodegradable injectable nanoparticles |
| US5635387A (en) | 1990-04-23 | 1997-06-03 | Cellpro, Inc. | Methods and device for culturing human hematopoietic cells and their precursors |
| US5641515A (en) | 1995-04-04 | 1997-06-24 | Elan Corporation, Plc | Controlled release biodegradable nanoparticles containing insulin |
| US5677136A (en) | 1994-11-14 | 1997-10-14 | Systemix, Inc. | Methods of obtaining compositions enriched for hematopoietic stem cells, compositions derived therefrom and methods of use thereof |
| US5716827A (en) | 1990-03-30 | 1998-02-10 | Systemix, Inc. | Human hematopoietic stem cell |
| US5725871A (en) | 1989-08-18 | 1998-03-10 | Danbiosyst Uk Limited | Drug delivery compositions comprising lysophosphoglycerolipid |
| US5756353A (en) | 1991-12-17 | 1998-05-26 | The Regents Of The University Of California | Expression of cloned genes in the lung by aerosol-and liposome-based delivery |
| US5759793A (en) | 1993-09-30 | 1998-06-02 | Systemix, Inc. | Method for mammalian cell separation from a mixture of cell populations |
| US5780045A (en) | 1992-05-18 | 1998-07-14 | Minnesota Mining And Manufacturing Company | Transmucosal drug delivery device |
| US5804212A (en) | 1989-11-04 | 1998-09-08 | Danbiosyst Uk Limited | Small particle compositions for intranasal drug delivery |
| US5994136A (en) | 1997-12-12 | 1999-11-30 | Cell Genesys, Inc. | Method and means for producing high titer, safe, recombinant lentivirus vectors |
| US6013516A (en) | 1995-10-06 | 2000-01-11 | The Salk Institute For Biological Studies | Vector and method of use for nucleic acid delivery to non-dividing cells |
| WO2002088346A2 (en) | 2001-05-01 | 2002-11-07 | National Research Council Of Canada | A system for inducible expression in eukaryotic cells |
| WO2002087341A1 (en) | 2001-05-01 | 2002-11-07 | Genetix Pharmaceuticals, Inc. | Novel self-inactivating (sin) lentiviral vectors |
| US6682907B1 (en) | 1998-04-24 | 2004-01-27 | Institut Pasteur | Use of triplex structure DNA in transferring nucleotide sequences |
Family Cites Families (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DK0681483T3 (en) | 1993-01-26 | 2005-11-21 | Univ Pennsylvania | Preparations and methods for administering genetic material |
| US5658784A (en) | 1994-04-14 | 1997-08-19 | Dana-Farber Cancer Institute, Inc. | Nucleic acid encoding transcription factor p300 and uses of p300 |
| FR2765578B1 (en) | 1997-07-03 | 1999-09-10 | Adir | PROCESS FOR THE PREPARATION OF A SUBSTITUTED PERHYDROISOINDOLE |
| US6136597A (en) * | 1997-09-18 | 2000-10-24 | The Salk Institute For Biological Studies | RNA export element |
| FR2778670B1 (en) | 1998-05-18 | 2002-12-13 | Rhone Poulenc Rorer Sa | METHODS AND COMPOSITIONS FOR THE PRODUCTION OF VIRAL PARTICLES |
| DE60333487D1 (en) | 2002-12-13 | 2010-09-02 | Genetix Pharmaceuticals Inc | THERAPEUTIC RETROVIRUS VECTORS FOR GENE THERAPY |
| EP2573185A3 (en) | 2005-02-16 | 2013-06-05 | Lentigen Corporation | Lentiviral vectors and their use |
| US20070048285A1 (en) | 2005-08-24 | 2007-03-01 | Christopher Baum | Self-inactivating retroviral vector |
| EP1835032A1 (en) | 2006-03-14 | 2007-09-19 | Université de Liège | A self-inactivating recombinant lentiviral vector for the inhibition of HIV replication |
| WO2008134878A1 (en) | 2007-05-04 | 2008-11-13 | University Health Network | Compositions and methods for cancer treatment |
| ES2634144T3 (en) * | 2007-08-03 | 2017-09-26 | Institut Pasteur | Defective lentiviral transfer vectors that are not integrated for vaccines |
| RU2012140691A (en) | 2009-03-13 | 2014-03-27 | Лентиген Корпорейшен | VACCINES BASED ON A NON-INTEGRABLE RETROVIRAL VECTOR |
| CA2838749A1 (en) | 2011-06-10 | 2012-12-13 | Bluebird Bio, Inc. | Gene therapy vectors for adrenoleukodystrophy and adrenomyeloneuropathy |
-
2012
- 2012-06-08 CA CA2838749A patent/CA2838749A1/en not_active Abandoned
- 2012-06-08 RU RU2014100160/10A patent/RU2014100160A/en not_active Application Discontinuation
- 2012-06-08 EP EP18193359.9A patent/EP3492108A1/en not_active Withdrawn
- 2012-06-08 MX MX2013014544A patent/MX2013014544A/en active IP Right Grant
- 2012-06-08 JP JP2014514899A patent/JP6143231B2/en not_active Expired - Fee Related
- 2012-06-08 US US13/492,553 patent/US8858928B2/en active Active
- 2012-06-08 KR KR1020157004059A patent/KR20150029756A/en not_active Withdrawn
- 2012-06-08 CN CN201280038832.1A patent/CN103717240A/en active Pending
- 2012-06-08 ES ES12796252T patent/ES2710452T3/en active Active
- 2012-06-08 AU AU2012267512A patent/AU2012267512B2/en not_active Ceased
- 2012-06-08 EP EP12796252.0A patent/EP2717922B1/en active Active
- 2012-06-08 KR KR1020147000344A patent/KR101528440B1/en not_active Expired - Fee Related
- 2012-06-08 PT PT12796252T patent/PT2717922T/en unknown
- 2012-06-08 PL PL12796252T patent/PL2717922T3/en unknown
- 2012-06-08 WO PCT/US2012/041693 patent/WO2012170911A2/en not_active Ceased
- 2012-06-08 TR TR2018/19015T patent/TR201819015T4/en unknown
- 2012-06-08 US US14/125,220 patent/US9789139B2/en active Active
- 2012-06-08 DK DK12796252.0T patent/DK2717922T3/en active
-
2013
- 2013-12-17 ZA ZA2013/09515A patent/ZA201309515B/en unknown
-
2014
- 2014-09-16 US US14/488,058 patent/US9061031B2/en active Active
-
2015
- 2015-03-04 JP JP2015042141A patent/JP2015107134A/en active Pending
Patent Citations (19)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5725871A (en) | 1989-08-18 | 1998-03-10 | Danbiosyst Uk Limited | Drug delivery compositions comprising lysophosphoglycerolipid |
| US5804212A (en) | 1989-11-04 | 1998-09-08 | Danbiosyst Uk Limited | Small particle compositions for intranasal drug delivery |
| US5716827A (en) | 1990-03-30 | 1998-02-10 | Systemix, Inc. | Human hematopoietic stem cell |
| US5750397A (en) | 1990-03-30 | 1998-05-12 | Systemix, Inc. | Human hematopoietic stem cell |
| US5466468A (en) | 1990-04-03 | 1995-11-14 | Ciba-Geigy Corporation | Parenterally administrable liposome formulation comprising synthetic lipids |
| US5635387A (en) | 1990-04-23 | 1997-06-03 | Cellpro, Inc. | Methods and device for culturing human hematopoietic cells and their precursors |
| US5399363A (en) | 1991-01-25 | 1995-03-21 | Eastman Kodak Company | Surface modified anticancer nanoparticles |
| US5756353A (en) | 1991-12-17 | 1998-05-26 | The Regents Of The University Of California | Expression of cloned genes in the lung by aerosol-and liposome-based delivery |
| US5460964A (en) | 1992-04-03 | 1995-10-24 | Regents Of The University Of Minnesota | Method for culturing hematopoietic cells |
| US5780045A (en) | 1992-05-18 | 1998-07-14 | Minnesota Mining And Manufacturing Company | Transmucosal drug delivery device |
| US5543158A (en) | 1993-07-23 | 1996-08-06 | Massachusetts Institute Of Technology | Biodegradable injectable nanoparticles |
| US5759793A (en) | 1993-09-30 | 1998-06-02 | Systemix, Inc. | Method for mammalian cell separation from a mixture of cell populations |
| US5677136A (en) | 1994-11-14 | 1997-10-14 | Systemix, Inc. | Methods of obtaining compositions enriched for hematopoietic stem cells, compositions derived therefrom and methods of use thereof |
| US5641515A (en) | 1995-04-04 | 1997-06-24 | Elan Corporation, Plc | Controlled release biodegradable nanoparticles containing insulin |
| US6013516A (en) | 1995-10-06 | 2000-01-11 | The Salk Institute For Biological Studies | Vector and method of use for nucleic acid delivery to non-dividing cells |
| US5994136A (en) | 1997-12-12 | 1999-11-30 | Cell Genesys, Inc. | Method and means for producing high titer, safe, recombinant lentivirus vectors |
| US6682907B1 (en) | 1998-04-24 | 2004-01-27 | Institut Pasteur | Use of triplex structure DNA in transferring nucleotide sequences |
| WO2002088346A2 (en) | 2001-05-01 | 2002-11-07 | National Research Council Of Canada | A system for inducible expression in eukaryotic cells |
| WO2002087341A1 (en) | 2001-05-01 | 2002-11-07 | Genetix Pharmaceuticals, Inc. | Novel self-inactivating (sin) lentiviral vectors |
Non-Patent Citations (49)
| Title |
|---|
| "Remington: The Science and Practice of Pharmacy, 20th ed.", 2000, LIPPINCOTT WILLIAMS & WILKINS |
| ALT, M., J. HEPATOL., vol. 23, 1995, pages 746 - 58 |
| B. HAMES & S. HIGGINS: "Nucleic Acid Hybridization", 1985 |
| B. HAMES & S. HIGGINS: "Transcription and Translation", 1984 |
| B. PERBAL: "A Practical Guide to Molecular Cloning", 1984 |
| BELL ET AL., CELL, vol. 98, 1999, pages 387 |
| BIFFI ET AL., HUM MOL GENET., vol. 20, no. Rl, 2011, pages R42 - 53 |
| BRODY, S. L.; CRYSTAL, R. G., ANN. N.Y. ACAD. SCI., vol. 716, 1994, pages 90 - 101 |
| BURGESS-BEUSSE ET AL., PROC. NATL. ACAD. SCI., USA, vol. 99, 2002, pages 16433 |
| CHALLITA ET AL., J VIROL., vol. 69, no. 2, 1995, pages 748 - 55 |
| CHUNG ET AL., CELL, vol. 74, 1993, pages 505 |
| CHUNG ET AL., PNAS, vol. 94, 1997, pages 575 |
| CLEVER ET AL., J. OF VIROLOGY, vol. 69, no. 4, 1995, pages 2101 - 2109 |
| CULLEN ET AL., CELL, vol. 58, 1991, pages 423 |
| CULLEN ET AL., J. VIROL., vol. 65, 1991, pages 1053 |
| D. GLOVER: "DNA Cloning: A Practical Approach", vol. I & II |
| FERRY, N.; HEARD, J. M., HUM. GENE THER., vol. 9, 1998, pages 1975 - 81 |
| HUANG ET AL., MOL. CELL. BIOL., vol. 5, pages 3864 |
| HUBBARD, MOL GENET. METAB., vol. 97, 2009, pages 212 - 220 |
| IRIONS ET AL., NATURE BIOTECHNOLOGY, vol. 25, 2007, pages 1477 - 1482 |
| JACKSON ET AL., TRENDS BIOCHEM SCI, vol. 15, no. 12, 1990, pages 477 - 83 |
| JACKSON; KAMINSKI, RNA, vol. 1, no. 10, 1995, pages 985 - 1000 |
| KAY, M. A., CHEST, vol. 111, no. 6, 1997, pages 138S - 142S |
| KOZAK, CELL, vol. 44, no. 2, 1986, pages 283 - 92 |
| KOZAK, NUCLEIC ACIDS RES., vol. 15, no. 20, 1987, pages 8125 - 48 |
| LANDY, CURRENT OPINION IN BIOTECHNOLOGY, vol. 3, 1993, pages 699 - 707 |
| LEE, H. C. ET AL., NATURE, vol. 408, 2000, pages 483 - 8 |
| LIU ET AL., GENES DEV., vol. 9, 1995, pages 1766 |
| LOWY ET AL., CELL, vol. 22, 1990, pages 817 - 823 |
| MANIATIS ET AL.: "Molecular Cloning: A Laboratory Manual", 1982 |
| MILLER, NATURE, vol. 357, 2000, pages 455 - 460 |
| N. GAIT: "Oligonucleotide Synthesis", 1984 |
| N. R. LANDAU ET AL., J. VIROL., vol. 66, 1992, pages 5110 - 5113 |
| OKA, K. ET AL., CURR. OPIN. LIPIDOL., vol. 11, 2000, pages 179 - 86 |
| R. FRESHNEY: "Animal Cell Culture", 1986 |
| SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual, 2nd ed", 1989 |
| SAUER, B., CURRENT OPINION IN BIOTECHNOLOGY, vol. 5, 1994, pages 521 - 527 |
| See also references of EP2717922A4 |
| SHIRATORY, Y. ET AL., LIVER, vol. 19, 1999, pages 265 - 74 |
| SIRIN ET AL., GENE, vol. 323, 2003, pages 67 |
| SMITH-ARICA, J. R.; BARTLETT, J. S., CURR. CARDIOL. REP., vol. 3, 2001, pages 43 - 49 |
| STRAYER, D. S., EXPERT OPIN. INVESTIG. DRUGS, vol. 8, 1999, pages 2159 - 2172 |
| THULE, P. M.; LIU, J. M., GENE THER., vol. 7, 2000, pages 1744 - 52 |
| WIGLER ET AL., CELL, vol. 11, 1977, pages 223 - 232 |
| Y. SONEOKA ET AL., NUCL. ACIDS RES., vol. 23, 1995, pages 628 - 633 |
| YANG, N. S., CRIT. REV. BIOTECHNOL., vol. 12, 1992, pages 335 - 56 |
| ZENNOU ET AL., CELL, vol. 101, 2000, pages 173 |
| ZHAN ET AL., HUM. GENET., vol. 109, 2001, pages 471 |
| ZUFFEREY ET AL., J. VIROL., vol. 73, 1999, pages 2886 |
Cited By (31)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105705646B (en) * | 2013-10-24 | 2020-07-17 | 艾达普特免疫有限公司 | Vectors for Transgene Expression |
| CN105705646A (en) * | 2013-10-24 | 2016-06-22 | 艾达普特免疫有限公司 | Vectors for transgene expression |
| US9932597B2 (en) | 2013-10-24 | 2018-04-03 | Adaptimmune Limited | Vectors for transgene expression |
| WO2015059276A1 (en) * | 2013-10-24 | 2015-04-30 | Adaptimmune Limited | Vectors for transgene expression |
| EP3587582A1 (en) * | 2013-10-24 | 2020-01-01 | Adaptimmune Limited | Vectors for transgene expression |
| EP3060668B2 (en) † | 2013-10-24 | 2022-10-19 | Adaptimmune Limited | Vectors for transgene expression |
| US12291722B2 (en) | 2014-04-25 | 2025-05-06 | 2Seventy Bio, Inc. | Methods for manufacturing adoptive cell therapies |
| EP3998278A1 (en) | 2014-04-25 | 2022-05-18 | 2seventy bio, Inc. | Mnd promoter chimeric antigen receptors |
| US10774343B2 (en) | 2014-04-25 | 2020-09-15 | Bluebird Bio, Inc. | MND promoter chimeric antigen receptors |
| EP3689899A1 (en) | 2014-04-25 | 2020-08-05 | Bluebird Bio, Inc. | Mnd promoter chimeric antigen receptors |
| US11560547B2 (en) | 2014-06-06 | 2023-01-24 | 2Seventy Bio, Inc. | Methods of making T cell compositions |
| US10479975B2 (en) | 2014-06-06 | 2019-11-19 | Bluebird Bio, Inc. | Methods of making T cell compositions |
| US12006369B2 (en) | 2014-07-24 | 2024-06-11 | 2Seventy Bio, Inc. | BCMA chimeric antigen receptors |
| US11382965B2 (en) | 2014-12-12 | 2022-07-12 | 2Seventy Bio, Inc. | BCMA chimeric antigen receptors |
| US10639358B2 (en) | 2014-12-12 | 2020-05-05 | Bluebird Bio, Inc. | BCMA chimeric antigen receptors |
| US11351236B2 (en) | 2014-12-12 | 2022-06-07 | 2Seventy Bio, Inc. | BCMA chimeric antigen receptors |
| US10383929B2 (en) | 2014-12-12 | 2019-08-20 | Bluebird Bio, Inc. | BCMA chimeric antigen receptors |
| US11020466B2 (en) | 2014-12-12 | 2021-06-01 | Bluebird Bio, Inc. | BCMA chimeric antigen receptors |
| US10646558B2 (en) | 2014-12-12 | 2020-05-12 | Bluebird Bio, Inc. | BCMA chimeric antigen receptors |
| US10624960B2 (en) | 2014-12-12 | 2020-04-21 | Bluebird Bio, Inc. | BCMA chimeric antigen receptors |
| US10639359B2 (en) | 2014-12-12 | 2020-05-05 | Bluebird Bio, Inc. | BCMA chimeric antigen receptors |
| US11633463B2 (en) | 2014-12-12 | 2023-04-25 | 2Seventy Bio, Inc. | BCMA chimeric antigen receptors |
| US12029784B2 (en) | 2014-12-12 | 2024-07-09 | 2Seventy Bio, Inc. | BCMA chimeric antigen receptors |
| US11479755B2 (en) | 2015-12-07 | 2022-10-25 | 2Seventy Bio, Inc. | T cell compositions |
| US12109234B2 (en) | 2016-11-04 | 2024-10-08 | 2Seventy Bio, Inc. | Anti-BCMA CAR T cell compositions |
| EP4035659A1 (en) | 2016-11-29 | 2022-08-03 | PureTech LYT, Inc. | Exosomes for delivery of therapeutic agents |
| US12378578B2 (en) | 2018-07-09 | 2025-08-05 | Flagship Pioneering Innovations V, Inc. | Fusosome compositions and uses thereof |
| US12496274B2 (en) | 2018-11-14 | 2025-12-16 | Flagship Pioneering Innovations V, Inc. | Compositions and methods for compartment-specific cargo delivery |
| US11779655B2 (en) * | 2019-12-31 | 2023-10-10 | Swanbio Therapeutics Limited | AAV-ABCD1 constructs and use for treatment or prevention of adrenoleukodystrophy (ALD) and/or adrenomyeloneuropathy (AMN) |
| US20220175965A1 (en) * | 2019-12-31 | 2022-06-09 | Swanbio Therapeutics Limited | Aav-abcd1 constructs and use for treatment or prevention of adrenoleukodystrophy (ald) and/or adrenomyeloneuropathy (amn) |
| WO2024229126A3 (en) * | 2023-05-01 | 2025-04-17 | Seattle Children's Hospital D/B/A Seattle Children's Research Institute | Mutant interleukin 15 expressing immune cells |
Also Published As
| Publication number | Publication date |
|---|---|
| ZA201309515B (en) | 2016-01-27 |
| KR20140039035A (en) | 2014-03-31 |
| EP2717922A4 (en) | 2015-01-07 |
| DK2717922T3 (en) | 2019-01-07 |
| KR101528440B1 (en) | 2015-06-26 |
| US9789139B2 (en) | 2017-10-17 |
| AU2012267512B2 (en) | 2014-11-20 |
| TR201819015T4 (en) | 2019-01-21 |
| US9061031B2 (en) | 2015-06-23 |
| US8858928B2 (en) | 2014-10-14 |
| WO2012170911A3 (en) | 2013-04-11 |
| JP6143231B2 (en) | 2017-06-07 |
| JP2015107134A (en) | 2015-06-11 |
| CA2838749A1 (en) | 2012-12-13 |
| EP3492108A1 (en) | 2019-06-05 |
| US20150064150A1 (en) | 2015-03-05 |
| PT2717922T (en) | 2018-12-18 |
| EP2717922A2 (en) | 2014-04-16 |
| US20150037296A1 (en) | 2015-02-05 |
| ES2710452T3 (en) | 2019-04-25 |
| US20130004471A1 (en) | 2013-01-03 |
| CN103717240A (en) | 2014-04-09 |
| PL2717922T3 (en) | 2019-03-29 |
| MX2013014544A (en) | 2014-04-30 |
| EP2717922B1 (en) | 2018-09-12 |
| KR20150029756A (en) | 2015-03-18 |
| JP2014519335A (en) | 2014-08-14 |
| RU2014100160A (en) | 2015-07-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9061031B2 (en) | Gene therapy vectors for adrenoleukodystrophy and adrenomyeloneuropathy | |
| US10280435B2 (en) | Gene therapy methods | |
| AU2012315699B2 (en) | Compounds for improved viral transduction | |
| US20150216903A1 (en) | Compounds for improved viral transduction | |
| US20220323612A1 (en) | Gene therapy of neuronal ceroid lipofuscinoses | |
| WO2018106807A1 (en) | Gene therapy for mucopolysaccharidosis, type i | |
| US20200071721A1 (en) | Gene therapy for mucopolysaccharidosis, type ii | |
| WO2014015318A1 (en) | Soluble compounds for improved gene therapy methods | |
| AU2014256388A1 (en) | Gene therapy vectors for adrenoleukodystrophy and adrenomyeloneuropathy |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| ENP | Entry into the national phase |
Ref document number: 2838749 Country of ref document: CA Ref document number: 2014514899 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2013/014544 Country of ref document: MX |
|
| ENP | Entry into the national phase |
Ref document number: 20147000344 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2014100160 Country of ref document: RU Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2012267512 Country of ref document: AU Date of ref document: 20120608 Kind code of ref document: A |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12796252 Country of ref document: EP Kind code of ref document: A2 |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112013031783 Country of ref document: BR |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01E Ref document number: 112013031783 Country of ref document: BR |
|
| ENPW | Started to enter national phase and was withdrawn or failed for other reasons |
Ref document number: 112013031783 Country of ref document: BR |


