WO2012170478A2 - Methods and kits for detecting adenomas, colorectal cancer, and uses thereof - Google Patents
Methods and kits for detecting adenomas, colorectal cancer, and uses thereof Download PDFInfo
- Publication number
- WO2012170478A2 WO2012170478A2 PCT/US2012/041020 US2012041020W WO2012170478A2 WO 2012170478 A2 WO2012170478 A2 WO 2012170478A2 US 2012041020 W US2012041020 W US 2012041020W WO 2012170478 A2 WO2012170478 A2 WO 2012170478A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- incertae sedis
- patient
- levels
- lachnospiraceae incertae
- lachnospiraceae
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57535—Immunoassay; Biospecific binding assay; Materials therefor for cancer of the large intestine, e.g. colon, rectum or anus
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
- G01N2500/04—Screening involving studying the effect of compounds C directly on molecule A (e.g. C are potential ligands for a receptor A, or potential substrates for an enzyme A)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
Definitions
- This invention relates generally to the discovery of a novel method to detect adenomas and colorectal cancer ("CRC") using a microbial signature. Included in the invention are methods of (a) determining an individual's risk developing adenomas or CRC; (b) determing whether or not a patient should have a colonoscopy; (c) differential diagnosis; (d) staging; (e) selecting therapies; (f) monitoring therapies; (g) patient surveillance; and (h) drug screening. Kits and reagents for detecting adenomas and CRC and/or drug screening are also part of the invention.
- CRC Colorectal Cancer
- CRC is categorized by the American Cancer Society ("ACS") as a cancer which originates in the colon or rectum. In the United States CRC for men and women combined is the second most common cause of cancer death. In 2011 the ACS estimates that there will be about 101,700 new cases of colon cancer and 39,510 new cases of rectal cancer in the United States alone. CRC will cause an estimated 49,380 deaths. More than 95% of CRC cases are adenocarcinomas.
- ACS Guide CRC Colorectal Cancer
- Adenomas originate in the glandular epithelium and have a dysplastic morphology. Fearon, E. R. Annu. Rev. Pathol. Mech. Dis. 6: 479-507 (201 1). Some of these adenomas mature into large polyps, undergo abnormal growth and development, and ultimately progress into CRC. M. L. Davila & A. D. Davila, Screening for Colon and Rectal Cancer, in Colon and Rectal Cancer 55-56 (Peter S. Edelstein ed., 2000). This progression would appear to take at least 10 years in most patients, rendering it a readily treatable form of cancer if diagnosed early and the CRC is localized. Davila at 56; Walter J. Burdette, Cancer: Etiology, Diagnosis, and Treatment 125
- a number of hereditary and nonhereditary conditions have also been linked to a heightened risk of developing CRC, including familial adenomatous polyposis ("FAP"), hereditary nonpolyposis CRC (Lynch syndrome or HNPCC), a personal and/or family history of CRC or adenomatous polyps, inflammatory bowel disease, diabetes mellitus, and obesity. Davila at 47; Henry T. Lynch & Jane F. Lynch, Hereditary Nonpolyposis Colorectal Cancer (Lynch Syndromes), in Colon and Rectal Cancer 67-68 (Peter S. Edelstein ed., 2000).
- FAP familial adenomatous polyposis
- HNPCC hereditary nonpolyposis CRC
- Environmental/dietary factors associated with an increased risk of CRC include diets high in red or processed meats, physical inactivity, obesity, smoking, excessive alcohol consumption and type 2 diabetes.
- ACS Guide CRC Conversely, environmental/dietary factors associated with a reduced risk of CRC include a diet high in fruits and vegetables and increased physical activity. Folate, vitamin D, and calcium supplements may lower CRC risk also.
- aspirin or other non-steroidal anti-inflammatory drugs (“NSAIDs") have been associated with lower CRC risk.
- NSAIDs non-steroidal anti-inflammatory drugs
- the changes may be (i) mutations that inactivate tumor suppressors; (ii) loss of heterozygosity (LOH) destroying or eliminating entirely tumor suppressors; or (iii) epigenetic silencing such as methylation that reduce or shut down expression. Fearon at 480.
- APC adenomatous polyposis coli
- APC defects are present in the majority of CRC cases. APC defects are present also in >90% of the cases of FAP.
- Other major factors in the multi-step development of CRC are point mutations in oncogenes KRAS and BRAF; gene amplification of EGFR; and either mutations or allele loss for the tumor suppressor gene p53. Additional point mutations implicated are found in NRAS, PIK3CA, CDK8, CMYC, CCNE1, CTN B1, NEU (HER2) and MYB.
- Other tumor suppressor genes implicated in the cascade are FBXW7, PTEN, SMAD4, SMAD2, SMAD3, TGF IIR, TCF7L2, ACVR2 and BAX.
- fecal tests are (i) the fecal occult blood test ("FOBT”); (ii) the fecal immunochemical test (“FIT”); and (iii) the stool DNA (“sDNA”) test.
- FOBT fecal occult blood test
- FIT fecal immunochemical test
- sDNA stool DNA
- Structural examination tests are (i) colonoscopy; (ii) flexible sigmoidoscopy; (iii) double-contrast barium enema ("DCBE"); (iv) CT colonography (virtual colonoscopy); and (v) capsule endoscopy.
- Both the FOBT and FIT screen for CRC by detecting the amount of blood in the stool.
- the tests are based on the premise that neoplastic tissue, particularly malignant tissue, bleeds more than typical mucosa, with the amount of bleeding increasing with polyp size and cancer stage. Davila at 56-57. Multiple testing is recommended because of intermittent bleeding. While fecal blood tests may detect some early stage tumors in the lower colon, they are unable to detect (i) CRC in the upper colon because any blood will be metabolized and/or (ii) smaller adenomatous polyps, thus creating false negatives.
- FOBTs are guaiac -based and measure the peroxidase activity of heme or hemoglobin. They are inexpensive and relatively easy to administer. Commercially available products are HemeOccult® II, and HemeOccult® Sensa® (Beckman-Coulter Inc., Los Angeles, CA). In addition to the false positives and false negatives mentioned above, certain foods with peroxidase activity (uncooked fruits and vegetables, red meat) also create false positives. 2.3.3. Fecal Immunochemistry Test (“FIT”)
- FIT is generally more accurate than FOBT. Rather than FOBT's chemical reaction to detect heme from blood, FIT uses antibodies to detect blood related proteins such as hemoglobin.
- Commercially available products are InSure® (Enterix Inc., a Quest Diagnostics company, Lyndhurst, NJ); Hemoccult®-ICT (Beckman Coulter, Inc.); MonoHaem (Chemicon International, Inc., Temecula, CA); OC Auto Micro 80 (Polymedco, Cortland Manor. NY); and Magstream 1000/Hem SP (Fujirebio Inc. Tokyo, Japan).
- any metabolic denaturing or digestion of globin proteins or post-collection sample handling that denatures globin epitopes will create false negatives for the FIT.
- the sDNA test measures a variety of DNA markers measured in a lab from a stool sample collected by the patient.
- Current sDNA tests available from Exact Sciences Corp. (Madison, WI), measure mutations in K-ras, APC, P53 genes; BAT -26 (an MSI marker); a marker for DNA integrity; and methylation of the vimentin gene.
- sigmoidoscopy by definition, is limited to the sigmoid colon.
- a sigmoidscope is about 60 cm long ( ⁇ 2 feet).
- a doctor can only examine the rectum and the lower half of the colon.
- Sigmoidoscopy requires the same preparation and invasiveness as colonoscopy, with those drawbacks. For the portions examined, it has the advantages of the colonoscopy.
- flexible sigmoidoscopy does only half the job.
- Double-contrast barium enema (“DCBE”) is also referred to as air-contrast enema. It requires the same prep as a colonoscopy to purge the patient's colon and the patient's colon is imaged using X-rays with a barium contrast agent. While it is recommended by most guidelines, DCBE suffers from two shortcomings. One, patient discomfort during the prep and examination and two, if something suspicious is seen, it does not provide the opportunity for a biopsy or polypectomy. Thus, if there is a positive test result, the patient will need a colonoscopy follow up.
- CT colonography also known as a virtual colonoscopy uses a computed tomography (CT or CAT) scan to image the rectum and colon. Though it requires a colon preparation, it is minimally invasive and gaining acceptance. Unfortunately, like the DCBE, a positive test will require a colonoscopy to investigate and intervene if necessary.
- Capsule endoscopy involves the ingestion of a small capsule with video cameras at each end. Lieberman. Progress and Challenges in Colorectal Cancer Screening and Surveillance. Gastroenterology 138: 2115-2126 (2010). As it passes through the colon images are transmitted and recorded. Some studies have reported detection of 73% of the advanced adenomas and 74% of the CRC cases. Lieberman at 2119. The shortcomings are similar to DCBE or CT colonography because it requires similar patient preparation and positive results require a subsequent colonoscopy. In addition, insufficient battery life and inadequate imaging in periods of rapid motility are disadvantages for the current generation capsule endoscopy products.
- stage of cancer progression A number of techniques are employed to stage the cancer (some of which are also used to screen for colon cancer), including pathologic examination of resected colon, sigmoidoscopy, colonoscopy, and various imaging techniques.
- pathologic examination of resected colon sigmoidoscopy, colonoscopy, and various imaging techniques.
- AJCC Cancer Staging Handbook 143-164, Edge et al. eds., 7 th ed. 2011).
- Proximal lymph node evaluation, sentinel node evaluation, chest/abdominal/pelvic CT, MRI scans, positron emission tomography (“PET”) scans, liver functionality tests (for liver metastases), and blood tests (complete blood count (“CBC"), carcinoembryonic antigen (“CEA”), CA 19-9) are employed to determine the stage.
- TNM staging system Several classification systems have been devised to stage the extent of CRC, including the Dukes' system and the more detailed International Union against Cancer- American Joint Committee on Cancer TNM staging system. Burdette at 126-27.
- the TNM system which is used for either clinical or pathological staging, is divided into four stages, each of which evaluates the extent of cancer growth with respect to primary tumor (T), regional lymph nodes (N), and distant metastasis (M). Fleming at 84-85.
- T primary tumor
- N regional lymph nodes
- M distant metastasis
- Fleming at 84-85.
- the system focuses on the extent of tumor invasion into the intestinal wall; invasion of adjacent structures; the number of regional lymph nodes that have been affected; and whether distant metastasis has occurred. Fleming at 81.
- Stage 0 is characterized by in situ carcinoma (Tis), in which the cancer cells are located inside the glandular basement membrane (intraepithelial) or lamina basement (intramucosal).
- Tis in situ carcinoma
- the cancer has not spread to the regional lymph nodes (NO), and there is no distant metastasis (MO).
- NO regional lymph nodes
- MO distant metastasis
- stage I there is still no spread of the cancer to the regional lymph nodes and no distant metastasis, but the tumor has invaded the submucosa (Tl) or has progressed further to invade the muscularislitis (T2).
- Stage II also involves no spread of the cancer to the regional lymph nodes and no distant metastasis, but the tumor has invaded the subserosa, or the nonperitonealized horric or perirectal tissues (T3), or has progressed to invade other organs or structures, and/or has perforated the visceral peritoneum (T4).
- Stage III is characterized by any of the T substages, no distant metastasis, and either spread to 1 to 3 regional lymph nodes (Nl) or spread to four or more regional lymph nodes (N2).
- stage IV involves any of the T or N substages, as well as distant metastasis (Mia or Mlb).
- Physicians will also assign a grade, that is, characterize CRC based on the appearance of the cells ranging from Gl (well-differentiated, almost normal) to G4 (undifferentiated, very abnormal) where a high grade is an indication of a poor prognosis.
- ACS Guide CRC Fleming at 84-85; Burdette at 127.
- Chemotherapeutic agents particularly 5-fluorouracil (5-FU) are powerful weapons in treating CRC.
- Other agents include oxaliplatin (Eloxatin®), irinotecan (Camptosar®), leucovorin, capecitabine (Xeloda®), bevacizumab (Avastin®), cetuximab (Erbitux®), and panitumumab (Vectibix®). These drugs are frequently combined.
- FOLFOX 5-FU, leucovorin, oxaliplatin
- FOLFIRI 5-FU, leucovorin, irinotecan
- FOLFOXIRI 5-FU, leucovorin, irinotecan, oxaliplatin
- Bevacizumab is a targeted therapeutic, specifically a monoclonal antibody that binds to vascular endothelial growth factor (VEGF) to prevent formation of blood vessels around the tumor.
- VEGF vascular endothelial growth factor
- Cetuximab and panitumumab are monoclonal antibodies that target epidermal growth factor receptor (EGFR).
- CRC patients will develop a recurrence of CRC following surgical resection, particularly in the first 2 or 3 years. Accordingly, CRC patients must be closely monitored to determine response to therapy and to detect persistent or recurrent disease and metastasis.
- this disclosure is directed to a method for detecting colorectal adenoma in a patient which comprises: (a) obtaining a suitable patient sample; (b) measuring a level of five or more bacteria selected from a group consisting of Acidovorax, Acinetobacter, Agrobacterium, Akkermansia, Alistipes, Allobaculum, Aquabacterium, Azonexus, Bacillaceae l, Bryantella, Carnobacteriaceae l, Chryseobacterium, Chryseomonas, Cloacibacterium, Comamonas, Dechloromonas, Delftia, Enterobacter, Erwinia, Exiguobacterium, Flavimonas, Fusobacterium, Gpl, Gp2, Helicobacter, Lactobacillus, Lactococcus, Leuconostoc, Methylobacterium, Micrococcineae, Novosphingo
- kits for detecting colorectal adenoma in a patient sample which comprises: (a) a means for measuring a level of five or more bacteria selected from a group consisting of Acidovorax, Acinetobacter, Agrobacterium, Akkermansia, Alistipes, Allobaculum, Aquabacterium, Azonexus, Bacillaceae l, Bryantella, Carnobacteriaceae l, Chryseobacterium, Chryseomonas, Cloacibacterium, Comamonas, Dechloromonas, Delftia, Enterobacter, Erwinia, Exiguobacterium, Flavimonas, Fusobacterium, Gpl, Gp2, Helicobacter, Lactobacillus, Lactococcus, Leuconostoc, Methylobacterium, Micrococcineae, Novosphingobium, Pantoea, Pseudom
- the disclosure is also directed to a method of identifying a compound that prevents or treats colorectal adenomas, the method comprising the steps of: (a) contacting a tissue or an animal model with a compound; (b) measuring a level of four or more bacteria selected from group consisting of Acidovorax, Acinetobacter, Agrobacterium, Akkermansia, Alistipes, Allobaculum, Aquabacterium, Azonexus, Bacillaceae l, Bryantella, Carnobacteriaceae l, Chryseobacterium, Chryseomonas, Cloacibacterium, Comamonas, Dechloromonas, Delftia, Enterobacter, Erwinia, Exiguobacterium, Flavimonas, Fusobacterium, Gpl, Gp2, Helicobacter, Lactobacillus, Lactococcus, Leuconostoc, Methylobacterium, Micrococcinea
- OTUs were created with the program AbundantOTU x.
- the x-axis is proportional to the number of subjects in each category.
- Figure 2 Maximum likelihood tree generated from the 371 OTUs in which the OTU was observed in at least 25% of the patients studied.
- the tree was generated using the RaxXML EPA server (http://il2k-exelixis3.informatik.tu-muenchen.de/raxml) (see methods).
- Branches are colored based on RDP Phylum level assignments. Black branches represent OTUs significantly different between cases and controls within each Phylum (at 10% False Discovery Rate (“FDR”)).
- FDR False Discovery Rate
- Figure 3 Richness (left panel) and evenness (right panel) at the phylum level in cases
- Figure 4 Richness (left panel) and evenness (right panel) at the genus level, in cases
- FIG. 5 Principal Component Analysis (PCoA) PCoA generated from Fast UniFrac analysis on the tree displayed in Figure. 2. (Cases- squares; controls- circles).
- Figure 7 Rank-abundance curve in which the x-axis is the log abundance rank of the top 371 OTUs and the y-axis is the average log normalized sequence count across all samples.
- the OTU is marked by squares if the difference between cases and controls is significant at 10% FDR and by open circles if the difference is not significant at 10% FDR.
- Figure 10 Regressions on log-normalized abundance of OTU 16 (top ranking OTU based on regression p-Value) vs. BMI of all samples. Note that after correction for multiple hypothesis testing, this regression is not significant at a 10% FDR threshold (see Table 6).
- Figure 11 Regressions on log-normalized abundance of OTU4 (top ranking OTU based on regression p-Value) vs. WHR of all samples. Note that after correction for multiple hypothesis testing, this regression is not significant at a 10% FDR threshold (see Table 7).
- Figures 12-1-12-7 Maximum likelihood tree generated from the top 371 OTUs using RaxXML EPA server.
- Leaf nodes are labeled with the Ribosomal Database Project (RDP) Classifier call of the consensus sequence at 80%. Wang, Q., Garrity, G.M., Tiedje, J.M. & Cole, J.R. Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Appl Environ Microbiol 73, 5261-5267 (2007). Branches are black if the OTU was significantly different between cases and controls and gray if not significant (at 10% FDR).
- RDP Ribosomal Database Project
- Figure 13 Abundance of Fusobacterium in rectal mucosal biopsies from adenoma cases and non-adenoma controls. qPCR results show that Fusobacterium is more abundant in cases than controls.
- Figure 16 Hierarchical clustering of bacterial community profiles in rectal swabs and rectal biopsies. Bray-Curtis similarities were used to construct a dendrogram composed of the samples provided by the participants (1-11). Each participant is represented twice: rectal swab (light gray triangles) and rectal biopsy (dark gray triangles).
- FIG. 17 Distribution of Terminal-restriction fragments (T-RFs) in rectal swabs and rectal biopsies. Bars represent the average abundance of each T-RF grouped by biopsies (dark gray) or swabs (light gray). Asterisks represent T-RFs that are significantly different (p ⁇ 0.05) between rectal biopsies and rectal swabs as assessed by t-test.
- T-RFs Terminal-restriction fragments
- Figure 20 Hierarchical Clustering of bacterial communities in rectal swabs and rectal biopsies by adenoma status. Bray-Curtis similarities were used to construct dendrograms composed of the samples provided by the participants (1-11). Each participant is represented twice: for the rectal swab (light gray triangles) and rectal biopsy (dark triangles). Fig. 20A: adenoma cases Fig. 20B: non-adenoma controls. Significance values were calculated from Analysis of Similarity (ANOSIM).
- Figure 21 Pair-wise comparisons of bacterial community composition based on Bray- Curtis similarities; swabs (top row); biopsies (left column).
- This disclosure is directed to a method for detecting colorectal adenoma in a patient which comprises: (a) obtaining a suitable patient sample; (b) measuring a level of five or more bacteria selected from a group consisting of Acidovorax, Acinetobacter, Agrobacterium, Akkermansia, Alistipes, Allobaculum, Aquabacterium, Azonexus, Bacillaceae l, Bryantella, Carnobacteriaceae l, Chryseobacterium, Chryseomonas, Cloacibacterium, Comamonas, Dechloromonas, Delftia, Enterobacter, Erwinia, Exiguobacterium, Flavimonas, Fusobacterium, Gpl, Gp2, Helicobacter, Lactobacillus, Lactococcus, Leuconostoc, Methylobacterium, Micrococcineae, Novosphingobium, Pantoea,
- the bacteria are selected from the group consisting of Acidovorax, Acinetobacter, Aquabacterium, Azonexus, Cloacibacterium, Dechloromonas, Delftia, Fusobacterium, Helicobacter, Lactobacillus, Lactococcus, Leuconostoc, Sphingobium, Stenotrophomonas, Succinivibrio, Turicibacter, and Weissella.
- the Fusobacterium may be F. nucleatum.
- the method may further comprising measuring levels of Bacteroides, Bifidobacteriaceae, Dorea, or Streptococcus, wherein decreased levels of Bacteroides, Bifidobacteriaceae, Dorea, or Streptococcus, are indicative of whether or not adenoma is present or absent in the patient.
- 8, 12, 15, 20 or 30 bacteria are measured.
- the bacteria are measured using the Operational Taxonomic Units (OTUs), such as those exemplified in Table 3.
- OTUs Operational Taxonomic Units
- the specific OTUs correspond to the consensus sequences in the sequence listing, e.g., OTU72
- Aquabacterium corresponds to consensus sequence #72 in US Prov. Patent Appl. No.
- OTU1 corresponds to SEQ ID No. 11, OTU100 to SEQ ID No. 1 10, OTU110 to SEQ ID No. 120, OTU353 to SEQ ID No. 363...0TU613 to SEQ ID No. 623.
- OTUs of interest and the sequence listing could readily use the OTUs of interest and the sequence listing to find the name and additional details for any individual bacterial genus and species of interest or combinations or sets of bacteria to select patients likely to have adenomas.
- sequences in the sequence listing may readily be entered into databases such as the SEQ MATCH section of the Ribosomal Database project (http://rdp.cme.msu.edu/index.jsp) or BLAST search in the 16S ribosomal RNA database of the National Center for Biotechnology Information (NCBI)( http://blast.ncbi.nlm.nih.gov/Blast.cgi).
- NCBI National Center for Biotechnology Information
- Examples of OTUs/SEQ ID Nos.(#) of particular interest in combination for the claimed invention include up-regulation of OTUl l(#21), OTU36(#46), OTU59(#69), OTU67(#77), OTU86(#96), OTU91(#101), OTU124(#134), OTU133(#143), OTU159(#169), OTU186(#196), OTU197(#207), OTU242(#252), OTU313(#323), OTU322(#332), OTU330(#340), OTU353(#463), OTU370(#380), OTU442(#452), OTU491(#501), OTU501(#511) and down-regulation of OTU8 (#18), OTU66(#76), OTU169(#179).
- bacteria may be selected such that 2 or more bacteria are from the phyla, Proteobacteria; 2 or more bacteria are from the phyla Bacteriodetes; and 2 or more bacteria are from the phyla Firmicutes.
- One of ordinary skill could select multiple bacteria from different phyla or similar phyla that are different between cases and controls using groupings in Figure 12- 1—12-7.
- the bacteria levels may be measured using bacterial nucleic acids such as 16S rRNA genes. They may also be measured using terminal restriction fragment length polymorphism ("T- RFLP”), fluorescence in-situ hybridization (“FISH”), polymerase chain reaction (“PCR”), pyrosequencing, or microarray.
- T- RFLP terminal restriction fragment length polymorphism
- FISH fluorescence in-situ hybridization
- PCR polymerase chain reaction
- pyrosequencing or microarray.
- the bacteria in the patient sample are cultured prior to measuring the levels.
- the bacteria levels may also be measured using antibodies.
- the patient sample may be a fecal sample.
- the patient sample is a biopsy sample such as a mucosal biopsy sample.
- the patient sample may also be a sample obtained by a rectal swab.
- the colorectal adenoma may be an adenocarcinoma.
- the disclosure is also directed to a method for determining whether or not a patient should have a colonoscopy or a method for monitoring a patient for colorectal adenoma recurrence using the steps described above.
- kits for detecting colorectal adenoma in a patient sample which comprises: (a) a means for measuring a level of five or more bacteria selected from a group consisting of Acidovorax, Acinetobacter, Agrobacterium, Akkermansia, Alistipes, Allobaculum, Aquabacterium, Azonexus, Bacillaceae l, Bryantella, Carnobacteriaceae l, Chryseobacterium, Chryseomonas, Cloacibacterium, Comamonas, Dechloromonas, Delftia, Enterobacter, Erwinia, Exiguobacterium, Flavimonas, Fusobacterium, Gpl, Gp2, Helicobacter, Lactobacillus, Lactococcus, Leuconostoc, Methylobacterium, Micrococcineae, Novosphingobium, Pantoea, Pseudom
- kits comprising: (a) a reagent selected from a group consisting of: (i) nucleic acid probes capable of specifically hybridizing with nucleic acids from five or more bacteria selected from a group consisting of Acidovorax, Acinetobacter, Agrobacterium, Akkermansia, Alistipes, Allobaculum, Aquabacterium, Azonexus, Bacillaceae l, Bryantella, Carnobacteriaceae l, Chryseobacterium, Chryseomonas, Cloacibacterium, Comamonas, Dechloromonas, Delftia, Enterobacter, Erwinia, Exiguobacterium, Flavimonas, Fusobacterium, Gpl, Gp2, Helicobacter, Lactobacillus, Lactococcus, Leuconostoc, Methylobacterium, Micrococcineae, Novosphingobium, Panto
- the disclosure is also directed to a method of identifying a compound that prevents or treats colorectal adenomas, the method comprising the steps of: (a) contacting a tissue or an animal model with a compound; (b) measuring a level of four or more bacteria selected from group consisting of Acidovorax, Acinetobacter, Agrobacterium, Akkermansia, Alistipes, Allobaculum, Aquabacterium, Azonexus, Bacillaceae l, Bryantella, Carnobacteriaceae l, Chryseobacterium, Chryseomonas, Cloacibacterium, Comamonas, Dechloromonas, Delftia, Enterobacter, Erwinia, Exiguobacterium, Flavimonas, Fusobacterium, Gpl, Gp2, Helicobacter, Lactobacillus, Lactococcus, Leuconostoc, Methylobacterium, Micrococcinea
- kits further comprising measuring analytes in a fecal test such as FOBT, FIT, or sDNA test.
- a fecal test such as FOBT, FIT, or sDNA test.
- the methods disclosed above are complementary and may be used in combination with structural tests such as colonoscopy, flexible sigmoidoscopy, DCBE, CT colonography or capsule endoscopy.
- CRC staging one may use the methods or kits described above in combination with pathologic examination of a colon biopsy, proximal lymph node evaluation, sentinel node evaluation, chest/abdominal/pelvic CT, MRI scans, positron emission tomography (“PET”) scans, liver functionality tests (for liver metastases), and blood tests (complete blood count (“CBC”), carcinoembryonic antigen (“CEA”), CA 19-9).
- pathologic examination of a colon biopsy proximal lymph node evaluation
- sentinel node evaluation sentinel node evaluation
- chest/abdominal/pelvic CT MRI scans
- PET positron emission tomography
- liver functionality tests for liver metastases
- CEA carcinoembryonic antigen
- adenoma refers to a growth of epithelial cells of glandular origin which may be benign or malignant. They are also referred to as adenomatous polyps. Adenomas may be peduculated (large head with a narrow stalk) or sessile (broad based). They may be classified as tubular adenomas, tubulovillous adenomas, villous adenomas, and flat adenomas. The adenoma may be an adenocarcinoma.
- the adenoma may be an adenoma from a human patient which may be a large adenoma >10cm, a small adenoma ⁇ 5 cm, or an adenoma between 0.5 cm and 15 cm in length.
- nucleic acid and “nucleic acid molecule” may be used interchangeably throughout the disclosure.
- the terms refer to nucleic acids of any composition from, such as DNA (e.g., complementary DNA (“cDNA”), genomic DNA (“gDNA”) and the like), ribosomal DNA (“rDNA”), RNA (e.g., messager RNA (“mRNA”), short inhibitory RNA (“siRNA”), ribosomal RNA (“rRNA”), transfer RNA (“tRNA”), microRNA, and the like), and/or DNA or RNA analogs (e.g., containing base analogs, sugar analogs and/or a non-native backbone and the like), RNA/DNA hybrids and polyamide nucleic acids (“PNAs”), all of which can be in single- or double-stranded form, and unless otherwise limited, can encompass known analogs of natural nucleotides that can function in a similar manner as naturally occurring nucleotides. Examples of nucleic acids are SEQ ID NOSEQ ID NO
- a nucleic acid in some examples may be from a microorganism which may be cultured (Cannon et al, App Envir Microbiol 3878-3885 (2002); Eckburg et al, Sci 308 1635- 1638 (2005); Moore and Moore 1995; or Anaerobe Laboratory Manual. Holdeman et al. eds. 1977, 4 th Ed. p. 1-156); uncultured (Jurgens et al., FEMS Microbiol Ecol. 34(1) 45-56 (2000); Palmer et al, Nuc Acids Res 34(1) e5 (2006); Palmer et al. PLoS Biol 5(7) el77 1556-1573 (2007); Scanlon et al, Envir. Micro.
- a nucleic acid may be a small subunit ("SSU") rDNA, 16S, or 23S rRNA fragment or full-length rRNA sequence. It may be a nucleic acid encoding a 16S variable region such as VI, V2, V3, V4, V5, V6, V7, V8, V9, or a combination thereof. In some examples, the V2, V3, or V6 regions may be used.
- a nucleic acid may also be a ribosomal intergenic spacer ("RIS”) or internal transcribed spacer ("ITS”) fragment. It may be a sequence found using microarray or FISH analysis.
- a template nucleic acid in some embodiments may be specific for a single bacteria taxa or a nucleic acid capable of binding to a variety of taxa. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses methylated forms, conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, single nucleotide polymorphisms ("SNPs”), and complementary sequences as well as the sequence explicitly indicated.
- SNPs single nucleotide polymorphisms
- nucleic acid is used interchangeably with locus, gene, cDNA, and mRNA encoded by a gene.
- the term also may include, as equivalents, derivatives, variants and analogs of RNA or DNA synthesized from nucleotide analogs, single- stranded ("sense” or “antisense”, “plus” strand or “minus” strand, "forward” reading frame or “reverse” reading frame) and double-stranded polynucleotides.
- Deoxyribonucleotides include deoxy adenosine, deoxycytidine, deoxyguanosine and deoxythymidine.
- the base cytosine is replaced with uracil.
- a "methylated nucleotide” or a “methylated nucleotide base” refers to the presence of a methyl moiety on a nucleotide base, where the methyl moiety is not present in a recognized typical nucleotide base.
- cytosine does not contain a methyl moiety on its pyrimidine ring, but 5-methylcytosine contains a methyl moiety at position 5 of its pyrimidine ring. Therefore, cytosine is not a methylated nucleotide and 5-methylcytosine is a methylated nucleotide.
- thymine contains a methyl moiety at position 5 of its pyrimidine ring, however, for purposes herein, thymine is not considered a methylated nucleotide when present in DNA since thymine is a typical nucleotide base of DNA.
- Typical nucleoside bases for DNA are thymine, adenine, cytosine and guanine.
- Typical bases for RNA are uracil, adenine, cytosine and guanine.
- a "methylation site" is the location in the target gene nucleic acid region where methylation has, or has the possibility of occurring. For example a location containing CpG is a methylation site wherein the cytosine may or may not be methylated.
- a "CpG site” or “methylation site” is a nucleotide within a nucleic acid that is susceptible to methylation either by natural occurring events in vivo or by an event instituted to chemically methylate the nucleotide in vitro.
- a "methylated nucleic acid molecule” refers to a nucleic acid molecule that contains one or more nucleotides that is/are methylated.
- An example of a methylated nucleic acid associated with CRC is vimentin. Shirahata et al, Anticancer Res. 30(12) 5015-5018 (2010).
- a "CpG island” as used herein describes a segment of DNA sequence that comprises a functionally or structurally deviated CpG density.
- Yamada et al. have described a set of standards for determining a CpG island: it must be at least 400 nucleotides in length, has a greater than 50% GC content, and an OCF/ECF ratio greater than 0.6 (Yamada et al, Genome Research, 14, 247-266 (2004)).
- Others have defined a CpG island less stringently as a sequence at least 200 nucleotides in length, having a greater than 50% GC content, and an OCF/ECF ratio greater than 0.6 (Takai et al, Proc. Natl. Acad. Sci. USA, 99, 3740-3745 (2002)).
- gene means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) involved in the transcription/translation of the gene product and the regulation of the transcription/translation, as well as intervening sequences (introns) between individual coding segments (exons).
- polypeptide polypeptide
- peptide protein
- protein protein
- amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymers.
- the terms encompass amino acid chains of any length, including full-length proteins (i.e., antigens), wherein the amino acid residues are linked by covalent peptide bonds.
- amino acid refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids.
- Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, gamma-carboxyglutamate, and O-phosphoserine.
- Amino acids may be referred to herein by either the commonly known three letter symbols or by the one- letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.
- Primers refer to oligonucleotides that can be used in an amplification method, such as a polymerase chain reaction ("PCR"), to amplify a nucleotide sequence based on the polynucleotide sequence corresponding to a particular genomic sequence, e.g., one specific for a particular bacteria. At least one of the PCR primers for amplification of a polynucleotide sequence is sequence-specific for the sequence.
- PCR polymerase chain reaction
- template refers to any nucleic acid molecule that can be used for amplification in the technology. RNA or DNA that is not naturally double stranded can be made into double stranded DNA so as to be used as template DNA. Any double stranded DNA or preparation containing multiple, different double stranded DNA molecules can be used as template DNA to amplify a locus or loci of interest contained in the template DNA.
- amplification reaction refers to a process for copying nucleic acid one or more times.
- the method of amplification includes, but is not limited to, polymerase chain reaction, self-sustained sequence reaction, ligase chain reaction, rapid amplification of cDNA ends, polymerase chain reaction and ligase chain reaction, Q- ⁇ replicase amplification, strand displacement amplification, rolling circle amplification, or splice overlap extension polymerase chain reaction.
- a single molecule of nucleic acid may be amplified.
- sensitivity refers to the number of true positives divided by the number of true positives plus the number of false negatives, where sensitivity (“sens”) may be within the range of 0 ⁇ sens ⁇ 1.
- method embodiments herein have the number of false negatives equaling zero or close to equaling zero, so that no subject is wrongly identified as not having adenoma when they indeed have adenoma.
- an assessment often is made of the ability of a prediction algorithm to classify negatives correctly, a complementary measurement to sensitivity.
- specificity refers to the number of true negatives divided by the number of true negatives plus the number of false positives, where specificity ("spec") may be within the range of 0 ⁇ spec ⁇ 1.
- the methods described herein have the number of false positives equaling zero or close to equaling zero, so that no subject is wrongly identified as having adenoma when they do not in fact have adenoma.
- a method that has both sensitivity and specificity equaling one, or 100% is preferred.
- the phrase "functional effects" in the context of assays for testing means compounds that modulate a phenotype or a gene associated with adenoma either in vitro, in cell culture, in tissue samples, or in vivo. This may also be a chemical or phenotypic effect such as altered bacterial profiles in vivo, e.g., changing from a high risk of adenoma or CRC bacterial profile to a low risk profile; altered expression of genes associated with adenoma or CRC; altered transcriptional activity of a gene hyper- or hypomethylated in adenoma; or altered activities and the downstream effects of proteins encoded by these genes.
- a functional effect may include transcriptional activation or repression, the ability of cells to proliferate, expression in cells during adenoma progression, and other characteristics of colorectal cells.
- “Functional effects” include in vitro, in vivo, and ex vivo activities.
- determining the functional effect is meant assaying for a compound that increases or decreases the transcription of genes or the translation of proteins that are indirectly or directly under the influence of a gene hyper- or hypomethylated in adenoma or adenocarcinoma.
- Such functional effects can be measured by any means known to those skilled in the art, e.g., changes in spectroscopic characteristics (e.g., fluorescence, absorbance, refractive index); hydrodynamic (e.g., shape), chromatographic; or solubility properties for the protein; ligand binding assays, e.g., binding to antibodies; measuring inducible markers or transcriptional activation of the marker; measuring changes in enzymatic activity; the ability to increase or decrease cellular proliferation, apoptosis, cell cycle arrest, measuring changes in cell surface markers.
- spectroscopic characteristics e.g., fluorescence, absorbance, refractive index
- hydrodynamic e.g., shape
- solubility properties for the protein e.g., changes in spectroscopic characteristics (e.g., fluorescence, absorbance, refractive index); hydrodynamic (e.g., shape), chromatographic; or solubility properties for the protein
- ligand binding assays e.g., binding
- Validation of the functional effect of a compound on adenoma occurence or progression can also be performed using assays known to those of skill in the art such as studies using Min (multiple intestinal neoplasia) mice. Alternatively, a colon tissue may be maintained in culture. Bareiss et ah, Histochem Cell Biol 129 795-804 (2008).
- the functional effects can be evaluated by many means known to those skilled in the art, e.g., microscopy for quantitative or qualitative measures of alterations in morphological features, measurement of changes in RNA or protein levels for other genes associated with bacteria differentially expressed in adenoma, measurement of RNA stability, identification of downstream or reporter gene expression (CAT, luciferase, ⁇ - gal, GFP, and the like), e.g., via chemiluminescence, fluorescence, colorimetric reactions, antibody binding, inducible markers, etc.
- Inhibitors “Inhibitors,” “activators,” and “modulators” of the markers are used to refer to activating, inhibitory, or modulating molecules identified using in vitro and in vivo assays of the expression of genes hyper- or hypomethylated in adenoma, mutations associated with adenoma, or the translation proteins encoded thereby.
- Inhibitors, activators, or modulators also include naturally occurring and synthetic ligands, antagonists, agonists, antibodies, peptides, cyclic peptides, nucleic acids, antisense molecules, ribozymes, RNAi molecules, small organic molecules and the like.
- Such assays for inhibitors and activators include, e.g., (l)(a) the mRNA expression, or (b) proteins expressed by genes hyper- or hypomethylated in adenoma in vitro, in cells, or cell extracts; (2) applying putative modulator compounds; and (3) determining the functional effects on activity, as described above.
- Assays comprising in vivo measurement of bacterial profiles associated with a high risk of adenoma or CRC; or genes hyper- or hypomethylated in adenoma are treated with a potential activator, inhibitor, or modulator are compared to control assays without the inhibitor, activator, or modulator to examine the extent of inhibition.
- Controls (untreated) are assigned a relative activity value of 100%.
- Inhibition of a bacterial profile, or methylation, expression, or proteins encoded by genes hyper- or hypomethylated in adenoma is achieved when the activity value relative to the control is about 80%, preferably 50%, more preferably 25-0%.
- Activation of a bacterial profile or methylation, expression, or proteins encoded by genes hyper- or hypomethylated in adenoma is achieved when the activity value relative to the control (untreated with activators) is 1 10%, more preferably 150%, more preferably 200- 500% (i.e., two to five fold higher relative to the control), more preferably 1000-3000% higher.
- test compound or “drug candidate” or “modulator” or grammatical equivalents as used herein describes any molecule, either naturally occurring or synthetic, e.g., protein, oligopeptide, small organic molecule, polysaccharide, peptide, circular peptide, lipid, fatty acid, siRNA, polynucleotide, oligonucleotide, etc., to be tested for the capacity to directly or indirectly modulate associated with adenoma.
- the test compound can be in the form of a library of test compounds, such as a combinatorial or randomized library that provides a sufficient range of diversity.
- Test compounds are optionally linked to a fusion partner, e.g., targeting compounds, rescue compounds, dimerization compounds, stabilizing compounds, addressable compounds, and other functional moieties.
- a fusion partner e.g., targeting compounds, rescue compounds, dimerization compounds, stabilizing compounds, addressable compounds, and other functional moieties.
- new chemical entities with useful properties are generated by identifying a test compound (called a "lead compound") with some desirable property or activity, e.g., inhibiting activity, creating variants of the lead compound, and evaluating the property and activity of those variant compounds.
- HTS high throughput screening
- the compound may be "small organic molecule” that is an organic molecule, either naturally occurring or synthetic, that has a molecular weight of more than about 50 daltons and less than about 2500 daltons, preferably less than about 2000 daltons, preferably between about 100 to about 1000 daltons, more preferably between about 200 to about 500 daltons.
- the sample may be from a patient suspected of having adenoma or from a patient diagnosed with CRC.
- the biological sample may also be from a subject with an ambiguous diagnosis in order to clarify the diagnosis.
- the sample may be obtained for the purpose of differential diagnosis, e.g., to confirm the diagnosis.
- the sample may also be obtained for the purpose of prognosis, i.e., determining the course of the disease and selecting primary treatment options. Tumor staging and grading are examples of prognosis.
- the sample may also be evaluated to select or monitor therapy, selecting likely responders in advance from non-responders or monitoring response in the course of therapy.
- the sample may be evaluated as part of post-treatment ongoing surveillance of patients who have had adenoma or CRC.
- Bio samples may be obtained using any of a number of methods in the art.
- biological samples comprising bacteria include those obtained from excised biopsies, such as punch biopsies, shave biopsies, fine needle aspirates ("FNA"), or surgical excisions; or biopsy from non- cutaneous tissues such as lymph node tissue, mucosa, conjuctiva, or uvea, other embodiments.
- Representative biopsy techniques include, but are not limited to, mucosal biopsy, excisional biopsy, incisional biopsy, needle biopsy, surgical biopsy.
- a diagnosis or prognosis made by endoscopy or fluoroscopy can require a "core-needle biopsy" of the tumor mass, or a "fine-needle aspiration biopsy” which generally contains a suspension of cells from within the tumor mass.
- a sample may also be a sample from a muscosal surface, such as a fecal or rectal swab sample, a blood and blood fractions or products (e.g., serum, plasma, platelets, red blood cells, white blood cells, circulating tumor cells isolated from blood, free DNA isolated from blood, and the like), sputum, lymph and tongue tissue, cultured cells, e.g., primary cultures, explants, and transformed cells, stool, urine, etc.
- a muscosal surface such as a fecal or rectal swab sample, a blood and blood fractions or products (e.g., serum, plasma, platelets, red blood cells, white blood cells, circulating tumor cells isolated from blood, free DNA isolated from blood, and the like), sputum, lymph and tongue tissue, cultured cells, e.g., primary cultures, explants, and transformed cells, stool, urine, etc.
- a sample is typically obtained from a eukaryotic organism, most preferably a mammal such as a primate e.g., chimpanzee or human; cow; dog; cat; a rodent, e.g., guinea pig; rat; mouse; rabbit.
- a primate e.g., chimpanzee or human
- cow cow
- dog cat
- rodent e.g., guinea pig
- rat rat
- mouse rabbit
- a sample can be treated with a fixative such as Carnoy's fixative and embedded in paraffin ("FFPE") and sectioned for use in the methods of the invention.
- a fixative such as Carnoy's fixative and embedded in paraffin ("FFPE")
- FFPE Carnoy's fixative and embedded in paraffin
- biological samples, once obtained, are harvested and processed prior to hybridization using standard methods known in the art. Such processing typically includes fixation in chloroform-acetic acid- alcohol based solution such as Carnoy's fixative and protease treatment.
- nucleic acid amplification is the chemical or enzymatic synthesis of nucleic acid copies which contain a sequence that is complementary to a nucleic acid sequence being amplified (template).
- the methods and kits of the invention may use any nucleic acid amplification or detection methods known to one skilled in the art, such as those described in U.S. Pat. Nos.
- the nucleic acids are amplified by PCR amplification using methodologies known to one skilled in the art.
- amplification can be accomplished by any known method, such as polymerase chain reaction (PCR), ligase chain reaction (LCR), Q -replicase amplification, rolling circle amplification, transcription amplification, self-sustained sequence replication, nucleic acid sequence-based amplification (NASBA), each of which provides sufficient amplification.
- Branched-DNA technology may also be used to qualitatively demonstrate the presence of a sequence of the technology or to quantitatively determine the amount of this particular genomic sequence in a sample. Nolte reviews branched-DNA signal amplification for direct quantitation of nucleic acid sequences in clinical samples (Nolte, 1998, Adv. Clin. Chem. 33:201-235).
- PCR process is well known in the art and is thus not described in detail herein.
- PCR methods and protocols see, e.g., Innis et al, eds., PCR Protocols, A Guide to Methods and Application. Academic Press, Inc., San Diego, Calif. 1990; U.S. Pat. No. 4,683,202 (Mullis); which are incorporated herein by reference in their entirety.
- PCR reagents and protocols are also available from commercial vendors, such as Roche Molecular Systems.
- PCR may be carried out as an automated process with a thermostable enzyme. In this process, the temperature of the reaction mixture is cycled through a denaturing region, a primer annealing region, and an extension reaction region automatically. Machines specifically adapted for this purpose are commercially available.
- Pyrosequencing is a nucleic acid sequencing method based on sequencing by synthesis, which relies on detection of a pyrophosphate released on nucleotide incorporation.
- sequencing by synthesis involves synthesizing, one nucleotide at a time, a DNA strand complimentary to the strand whose sequence is being sought.
- Study nucleic acids may be immobilized to a solid support, hybridized with a sequencing primer, incubated with DNA polymerase, ATP sulfurylase, luciferase, apyrase, adenosine 5' phosphsulfate and luciferin. Nucleotide solutions are sequentially added and removed.
- An example of a system that can be used by a person of ordinary skill based on pyrosequencing generally involves the following steps: ligating an adaptor nucleic acid to a study nucleic acid and hybridizing the study nucleic acid to a bead; amplifying a nucleotide sequence in the study nucleic acid in an emulsion; sorting beads using a picoliter multiwell solid support; and sequencing amplified nucleotide sequences by pyrosequencing methodology (e.g., Nakano et ah, J. Biotech. 102, 1 17-124 (2003)).
- Such a system can be used to exponentially amplify amplification products generated by a process described herein, e.g., by ligating a heterologous nucleic acid to the first amplification product generated by a process described herein.
- Amplified sequences may also be measured using the Agilent 2100 Bioanalyzer to quantify amplified PCR products prior to pooling and pyrosequencing, or invasive cleavage reactions such as the Invader® technology (Zou et ah, Association of Clinical Chemistry (AACC) poster presentation on July 28, 2010, "Sensitive Quantification of Methylated Markers with a Novel Methylation Specific Technology,” available at www.exactsciences.com; and U.S. Pat. No. 7,011,944 (Prudent et ah) which are incorporated herein by reference in their entirety).
- Invader® technology Zaou et ah, Association of Clinical Chemistry (AACC) poster presentation on July 28, 2010, "Sensitive Quantification of Methylated Markers with a Novel Methylation Specific Technology," available at www.exactsciences.com; and U.S. Pat. No. 7,011,944 (Prudent et ah) which are incorporated
- Suitable next generation nucleic acid sequencing and detection technologies are widely available. Examples include the 454 Life Sciences platform (Roche, Branford, CT) (Margulies et ah Nature, 437, 376-380 (2005)); lllumina's Genome Analyzer, GoldenGate Methylation Assay, or Infinium Methylation Assays (Illumina, San Diego, CA; Bibkova et ah, 2006, Genome Res. 16, 383-393; U.S. Pat. Nos.
- Each of these platforms allows sequencing of clonally expanded or non-amplified single molecules of nucleic acid fragments.
- Certain platforms involve, for example, (i) sequencing by ligation of dye-modified probes (including cyclic ligation and cleavage), (ii) pyrosequencing, and (iii) single-molecule sequencing.
- Certain single-molecule sequencing embodiments are based on the principal of sequencing by synthesis, and utilize single-pair Fluorescence Resonance Energy Transfer (single pair FRET) as a mechanism by which photons are emitted as a result of successful nucleotide incorporation.
- the emitted photons often are detected using intensified or high sensitivity cooled charge-couple-devices in conjunction with total internal reflection microscopy (“TIRM"). Photons are only emitted when the introduced reaction solution contains the correct nucleotide for incorporation into the growing nucleic acid chain that is synthesized as a result of the sequencing process.
- FRET FRET based single-molecule sequencing or detection
- energy is transferred between two fluorescent dyes, sometimes polymethine cyanine dyes Cy3 and Cy5, through long-range dipole interactions.
- the donor is excited at its specific excitation wavelength and the excited state energy is transferred, non-radiatively to the acceptor dye, which in turn becomes excited.
- the acceptor dye eventually returns to the ground state by radiative emission of a photon.
- the two dyes used in the energy transfer process represent the "single pair", in single pair FRET. Cy3 often is used as the donor fluorophore and often is incorporated as the first labeled nucleotide.
- Cy5 often is used as the acceptor fluorophore and is used as the nucleotide label for successive nucleotide additions after incorporation of a first Cy3 labeled nucleotide.
- the fluorophores generally are within 10 nanometers of each other for energy transfer to occur successfully.
- Bailey et al. recently reported a highly sensitive (15pg methylated DNA) method using quantum dots to detect methylation status using fluorescence resonance energy transfer (MS-qFRET)(Bailey et al. Genome Res. 19(8), 1455-1461 (2009), which is incorporated herein by reference in its entirety).
- An example of a system that can be used based on single-molecule sequencing generally involves hybridizing a primer to a study nucleic acid to generate a complex; associating the complex with a solid phase; iteratively extending the primer by a nucleotide tagged with a fluorescent molecule; and capturing an image of fluorescence resonance energy transfer signals after each iteration (e.g., Braslavsky et al., PNAS 100(7): 3960-3964 (2003); U.S. Pat. No. 7,297,518 (Quake et al.) which are incorporated herein by reference in their entirety).
- Such a system can be used to directly sequence amplification products generated by processes described herein.
- the released linear amplification product can be hybridized to a primer that contains sequences complementary to immobilized capture sequences present on a solid support, a bead or glass slide for example.
- Hybridization of the primer-released linear amplification product complexes with the immobilized capture sequences immobilizes released linear amplification products to solid supports for single pair FRET based sequencing by synthesis.
- the primer often is fluorescent, so that an initial reference image of the surface of the slide with immobilized nucleic acids can be generated. The initial reference image is useful for determining locations at which true nucleotide incorporation is occurring. Fluorescence signals detected in array locations not initially identified in the "primer only" reference image are discarded as non-specific fluorescence.
- the bound nucleic acids often are sequenced in parallel by the iterative steps of, a) polymerase extension in the presence of one fluorescently labeled nucleotide, b) detection of fluorescence using appropriate microscopy, TIRM for example, c) removal of fluorescent nucleotide, and d) return to step a with a different fluorescently labeled nucleotide.
- the technology may be practiced with digital PCR.
- Digital PCR was developed by Kalinina and colleagues (Kalinina et al., Nucleic Acids Res. 25; 1999-2004 (1997)) and further developed by Vogelstein and Kinzler, Proc. Natl. Acad. Sci. U.S.A. 96; 9236-9241 (1999)).
- the application of digital PCR is described by Cantor et al. (PCT Pub. Nos. WO 2005/023091A2 (Cantor et al.); WO 2007/092473 A2, (Quake et al.)), which are hereby incorporated by reference in their entirety.
- Digital PCR takes advantage of nucleic acid (DNA, cDNA or RNA) amplification on a single molecule level, and offers a highly sensitive method for quantifying low copy number nucleic acid.
- Fluidigm® Corporation offers systems for the digital analysis of nucleic acids.
- nucleotide sequencing may be by solid phase single nucleotide sequencing methods and processes.
- Solid phase single nucleotide sequencing methods involve contacting sample nucleic acid and solid support under conditions in which a single molecule of sample nucleic acid hybridizes to a single molecule of a solid support.
- Such conditions can include providing the solid support molecules and a single molecule of sample nucleic acid in a "microreactor.”
- Such conditions also can include providing a mixture in which the sample nucleic acid molecule can hybridize to solid phase nucleic acid on the solid support.
- Single nucleotide sequencing methods useful in the embodiments described herein are described in PCT Pub. No. WO 2009/091934 (Cantor).
- nanopore sequencing detection methods include (a) contacting a nucleic acid for sequencing ("base nucleic acid,” e.g., linked probe molecule) with sequence-specific detectors, under conditions in which the detectors specifically hybridize to substantially complementary subsequences of the base nucleic acid; (b) detecting signals from the detectors and (c) determining the sequence of the base nucleic acid according to the signals detected.
- the detectors hybridized to the base nucleic acid are disassociated from the base nucleic acid (e.g., sequentially dissociated) when the detectors interfere with a nanopore structure as the base nucleic acid passes through a pore, and the detectors disassociated from the base sequence are detected.
- a detector also may include one or more regions of nucleotides that do not hybridize to the base nucleic acid.
- a detector is a molecular beacon.
- a detector often comprises one or more detectable labels independently selected from those described herein. Each detectable label can be detected by any convenient detection process capable of detecting a signal generated by each label (e.g., magnetic, electric, chemical, optical and the like). For example, a CD camera can be used to detect signals from one or more distinguishable quantum dots linked to a detector.
- the invention encompasses any method known in the art for enhancing the sensitivity of the detectable signal in such assays, including, but not limited to, the use of cyclic probe technology (Bakkaoui et al., 1996, BioTechniques 20: 240-8, which is incorporated herein by reference in its entirety); and the use of branched probes (Urdea et al., 1993, Clin. Chem. 39, 725- 6; which is incorporated herein by reference in its entirety).
- the hybridization complexes are detected according to well-known techniques in the art.
- Reverse transcribed or amplified nucleic acids may be modified nucleic acids.
- Modified nucleic acids can include nucleotide analogs, and in certain embodiments include a detectable label and/or a capture agent.
- detectable labels include, without limitation, fluorophores, radioisotopes, colorimetric agents, light emitting agents, chemiluminescent agents, light scattering agents, enzymes and the like.
- capture agents include, without limitation, an agent from a binding pair selected from antibody/antigen, antibody/antibody, antibody/antibody fragment, antibody/antibody receptor, antibody/protein A or protein G, hapten/anti-hapten, biotin/avidin, biotin/streptavidin, folic acid/folate binding protein, vitamin B12/intrinsic factor, chemical reactive group/complementary chemical reactive group (e.g., sulfhydryl/maleimide, sulfhydryl/haloacetyl derivative, amine/isotriocyanate, amine/succinimidyl ester, and amine/sulfonyl halides) pairs, and the like.
- Modified nucleic acids having a capture agent can be immobilized to a solid support in certain embodiments.
- Mass spectrometry is a particularly effective method for the detection of specific polypeptides or polynucleotides associated with bacteria. See for example, Identification of Microorganisms by Mass Spectrometry, Ed. Wilkons and Lay, Wiley- Interscience, 2006; U.S. Patent Nos. 7,070,739 (Anderson and Anderson); 6,177,266 (Krishnamurthy and Ross); PCT Pub Nos.
- WO 2010/062354 Al (Hyman et al); WO 2008/058024 A2 (Eckstein and Eckstein); WO 2001/079523 A2 (Pineda and Lin); European Patent Pub. No. EP 1437673 B l (Kallow et al); U.S. Patent Pub. No. US 2005/0142584 Al (Willson et al.); which are hereby incorporated by reference in their entirety.
- the invention may further encompass detecting and/or quantitating using fluorescence in situ hybridization (FISH) in a sample, preferably a tissue sample, obtained from a subject in accordance with the methods of the invention.
- FISH fluorescence in situ hybridization
- a sample preferably a tissue sample, obtained from a subject in accordance with the methods of the invention.
- FISH is a common methodology used in the art, especially in the detection of specific chromosomal aberrations in tumor cells, for example, to aid in diagnosis and tumor staging. As applied in the methods of the invention, it can be used to detect types and levels of bacteria.
- the invention encompasses use of bacteria specific gene expression and/or antibody assays either in situ, i.e., directly upon tissue sections (fixed and/or frozen) of patient tissue obtained from biopsies or resections, such that no nucleic acid purification is necessary; or based on extracted and/or amplified nucleic acids.
- Targets for such assays are disclosed in Haqq et al, Proc. Nat. Acad. Sci. USA, 102(17), 6092-6097 (2005); Riker et al, BMC Med. Genomics, 1, 13, pub. 28 April 2008; Hoek et al, Can. Res. 64, 5270-5282
- DNA microarrays may be used. Methods for making nucleic acid microarrays are known to the skilled artisan and are described, for example, in Lockhart et al, Nat. Biotech. 14, 1675-1680 (1996) Schena et al, Proc. Natl. Acad. Sci. USA, 93, 10614-10619 (1996), U.S. Pat. No. 5,837,832 (Chee et al) and PCT Pub. No. WO 00/56934 (Englert et al), herein incorporated by reference.
- Microarrays specific for gut microbes have been described, for example, Paliy et al Appl Environ Microbiol 75 3572-3579 (2009); Palmer et al. (2006); and Palmer et al. (2007), herein incorporated by reference. Additional examples of microarray analysis for bacteria include Al-Khaldi et al. Nutrition 20 32-38 (2004); Apte and Singh Methods Mol Biol 402:329-346 (2007); Cleven et al. J Clin Microbiol 44(7) 2389-2397(2006); Dols et al. Am J Obstet Gyn 204(4) 305.el-305.e7 (April 201 1); Franke-Whittle et al.
- oligonucleotides may be synthesized or bound to the surface of a substrate using a chemical coupling procedure and an ink jet application apparatus, as described U.S. Pat. No. 6,015,880 (Baldeschweiler et al), incorporated herein by reference.
- a gridded array may be used to arrange and link cDNA fragments or oligonucleotides to the surface of a substrate using a vacuum system, thermal, UV, mechanical or chemical bonding procedure. 5.2.6. Antibody Staining/Detection
- the invention may encompass detecting and/or quantitating using antibodies either alone or in conjunction with measurement of bacterial nucleic acid levels.
- Antibodies are already used in current practice in the classification and/or diagnosis of bacteria.
- Antibody reagents can be used in assays to detect expression levels of in patient samples using any of a number of immunoassays known to those skilled in the art. Immunoassay techniques and protocols are generally described in Price and Newman, “Principles and Practice of Immunoassay,” 2nd Edition, Grove's Dictionaries, 1997; and Gosling, "Immunoassays: A Practical Approach,” Oxford University Press, 2000. A variety of immunoassay techniques, including competitive and non-competitive immunoassays, can be used. See, e.g., Self et ah, 1996, Curr. Opin. Biotechnol. , 7, 60-65.
- immunoassay encompasses techniques including, without limitation, enzyme immunoassays (EIA) such as enzyme multiplied immunoassay technique (EMIT), enzyme-linked immunosorbent assay (ELISA), IgM antibody capture ELISA (MAC ELISA), and microparticle enzyme immunoassay (MEIA); capillary electrophoresis immunoassays (CEIA); radioimmunoassays (RIA); immunoradiometric assays (IRMA); fluorescence polarization immunoassays (FPIA); and chemiluminescence assays (CL). If desired, such immunoassays can be automated. Immunoassays can also be used in conjunction with laser induced fluorescence.
- EIA enzyme multiplied immunoassay technique
- ELISA enzyme-linked immunosorbent assay
- MAC ELISA IgM antibody capture ELISA
- MEIA microparticle enzyme immunoassay
- CEIA capillary electrophoresis immunoassay
- Liposome immunoassays such as flow-injection liposome immunoassays and liposome immunosensors, are also suitable for use in the present invention. See, e.g., Rongen et ah, 1997, J. Immunol. Methods, 204, 105-133.
- nephelometry assays in which the formation of protein/antibody complexes results in increased light scatter that is converted to a peak rate signal as a function of the marker concentration, are suitable for use in the methods of the present invention.
- Nephelometry assays are commercially available from Beckman Coulter (Brea, CA) and can be performed using a Behring Nephelometer Analyzer (Fink et ah, 1989, J. Clin. Chem. Clin. Biochem., 27, 261-276).
- Direct labels include fluorescent or luminescent tags, metals, dyes, radionuclides, and the like, attached to the antibody.
- An antibody labeled with iodine- 125 125 I can be used.
- a chemiluminescence assay using a chemiluminescent antibody specific for the nucleic acid is suitable for sensitive, non-radioactive detection of protein levels.
- An antibody labeled with fluorochrome is also suitable.
- fluorochromes examples include, without limitation, DAPI, fluorescein, Hoechst 33258, R-phycocyanin, B-phycoerythrin, R- phycoerythrin, rhodamine, Texas red, and lissamine.
- Indirect labels include various enzymes well known in the art, such as horseradish peroxidase (HRP), alkaline phosphatase (AP), ⁇ -galactosidase, urease, and the like.
- a horseradish-peroxidase detection system can be used, for example, with the chromogenic substrate tetramethylbenzidine (TMB), which yields a soluble product in the presence of hydrogen peroxide that is detectable at 450 nm.
- TMB chromogenic substrate tetramethylbenzidine
- An alkaline phosphatase detection system can be used with the chromogenic substrate p-nitrophenyl phosphate, for example, which yields a soluble product readily detectable at 405 nm.
- a ⁇ -galactosidase detection system can be used with the chromogenic substrate o-nitrophenyl-/3-D-galactopyranoside (ONPG), which yields a soluble product detectable at 410 nm.
- An urease detection system can be used with a substrate such as urea- bromocresol purple (Sigma Immunochemicals; St. Louis, MO).
- a signal from the direct or indirect label can be analyzed, for example, using a spectrophotometer to detect color from a chromogenic substrate; a radiation counter to detect radiation such as a gamma counter for detection of 125 I; or a fluorometer to detect fluorescence in the presence of light of a certain wavelength.
- a quantitative analysis can be made using a spectrophotometer such as an EMAX Microplate Reader (Molecular Devices; Menlo Park, CA) in accordance with the manufacturer's instructions.
- the assays of the present invention can be automated or performed robotically, and the signal from multiple samples can be detected simultaneously.
- the antibodies can be immobilized onto a variety of solid supports, such as magnetic or chromatographic matrix particles, the surface of an assay plate (e.g., microtiter wells), pieces of a solid substrate material or membrane (e.g., plastic, nylon, paper), and the like.
- An assay strip can be prepared by coating the antibody or a plurality of antibodies in an array on a solid support. This strip can then be dipped into the test sample and processed quickly through washes and detection steps to generate a measurable signal, such as a colored spot.
- the antibodies may be in an array one or more antibodies, single or double stranded nucleic acids, proteins, peptides or fragments thereof, amino acid probes, or phage display libraries.
- fingerprinting methods such as denaturing gradient gel electrophoresis (DGGE) or terminal restriction fragment length polymorphism (T-RFLP) may be used.
- DGGE studies the electrophoretic migration patterns of PCR amplicons of bacterial sequences such as the V6-V8 regions of the 16S rRNA gene. Differences in the DGGE patterns can be used to identify the bacterial communities.
- T-RFLP analysis a bacterial gene is amplified by PCR, such as the 16S rRNA gene and digested with a series of restriction endonucleases. Based on the sequence of the 16S gene, fragments of differing lengths will be generated.
- kits for detecting and/or measuring types and levels of bacteria using DNA assays, antibodies specific for the polypeptides or nucleic acids specific for the polynucleotides typically include, a suitable container means, (i) a probe that comprises an antibody or nucleic acid sequence that specifically binds to the marker polypeptides or polynucleotides of the invention; (ii) a label for detecting the presence of the probe; and (iii) instructions for how to measure the type and level of a particular bacteria (or polypeptide or polynucleotide).
- kits may include several antibodies or polynucleotide sequences encoding polypeptides of the invention, e.g., a a first antibody and/or second and/or third and/or additional antibodies that recognize a protein associated with a particular bacteria.
- the container means of the kits will generally include at least one vial, test tube, flask, bottle, syringe and/or other container into which a first antibody specific for one of the polypeptides or a first nucleic acid specific for one of the polynucleotides of the present invention may be placed and/or suitably aliquoted. Where a second and/or third and/or additional component is provided, the kit will also generally contain a second, third and/or other additional container into which this component may be placed.
- kits may contain a mixture of more than one antibody or nucleic acid reagent, each reagent specifically binding a different marker in accordance with the present invention.
- the kits of the present invention will also typically include means for containing the antibody or nucleic acid probes in close confinement for commercial sale. Such containers may include injection and/or blow-molded plastic containers into which the desired vials are retained. [00112] The kits may further comprise positive and negative controls, as well as instructions for the use of kit components contained therein, in accordance with the methods of the present invention.
- the various markers of the invention also provide reagents for in vivo imaging such as, for instance, the imaging of adenoma specific bacteria using labeled reagents that detect (i) nucleic acids associated with particular bacteria, (ii) a polypeptides associated with a particular bacteria.
- In vivo imaging techniques may be used, for example, as guides for surgical resection or to detect the distant spread of CRC.
- reagents that detect the presence of these proteins or genes, such as antibodies may be labeled with a positron-emitting isotope (e.g., 18F) for positron emission tomography (PET), gamma-ray isotope (e.g., 99mTc) for single photon emission computed tomography (SPECT), a paramagnetic molecule or nanoparticle (e.g.,Gd 3+ chelate or coated magnetite nanoparticle) for magnetic resonance imaging (MRI), a near-infrared fluorophore for near- infra red (near-IR) imaging, a luciferase (firefly, bacterial, or coelenterate), green fluorescent protein, or other luminescent molecule for bioluminescence imaging, or a perfluorocarbon- filled vesicle for ultrasound.
- a positron-emitting isotope e.g., 18F
- PET positron emission tomography
- such reagents may include a fluorescent moiety, such as a fluorescent protein, peptide, or fluorescent dye molecule.
- fluorescent dyes include, but are not limited to, xanthenes such as rhodamines, rhodols and fluoresceins, and their derivatives; bimanes; coumarins and their derivatives such as umbelliferone and aminomethyl coumarins; aromatic amines such as dansyl; squarate dyes; benzofurans; fluorescent cyanines; carbazoles; dicyanomethylene pyranes, polymethine, oxabenzanthrane, xanthene, pyrylium, carbostyl, perylene, acridone, quinacridone, rubrene, anthracene, coronene, phenanthrecene, pyrene, butadiene, stilbene, lanthanide metal chelate complexes, rare-earth
- Fluorescent dyes are discussed, for example, in U.S. Pat. Nos. 4,452,720 (Harada et al); 5,227,487 (Haugland and Whitaker); and 5,543,295 (Bronstein et al).
- Other fluorescent labels suitable for use in the practice of this invention include a fluorescein dye.
- Typical fluorescein dyes include, but are not limited to, 5- carboxyfluorescein, fluorescein-5- isothiocyanate, and 6-carboxyfluorescein; examples of other fluorescein dyes can be found, for example, in U.S. Pat. Nos.
- kits may include a rhodamine dye, such as, for example, tetramethylrhodamine-6-isothiocyanate, 5- carboxytetramethylrhodamine, 5-carboxy rhodol derivatives, tetramethyl and tetraethyl rhodamine, diphenyldimethyl and diphenyldiethyl rhodamine, dinaphthyl rhodamine, rhodamine 101 sulfonyl chloride (sold under the tradename of TEXAS RED®, and other rhodamine dyes.
- a rhodamine dye such as, for example, tetramethylrhodamine-6-isothiocyanate, 5- carboxytetramethylrhodamine, 5-carboxy rhodol derivatives, tetramethyl and tetraethyl rhodamine, diphenyl
- kits may include a cyanine dye, such as, for example, Cy3, Cy3B, Cy3.5, Cy5, Cy5.5, Cy7.
- Phosphorescent compounds including porphyrins, phthalocyanines, polyaromatic compounds such as pyrenes, anthracenes and acenaphthenes, and so forth, may also be used.
- a variety of methods may be used to identify compounds that modulate the growth of adenomas and prevent or treat adenocarcinoma progression.
- an assay that provides a readily measured parameter is adapted to be performed in the wells of multi-well plates in order to facilitate the screening of members of a library of test compounds as described herein.
- an appropriate number of cells can be plated into the cells of a multi-well plate, and the effect of a test compound on bacteria associated with adenoma can be determined.
- the compounds to be tested can be any small chemical compound, or a macromolecule, such as a protein, sugar, nucleic acid or lipid.
- test compounds will be small chemical molecules and peptides.
- any chemical compound can be used as a test compound in this aspect of the invention, although most often compounds that can be dissolved in aqueous or organic (especially DMSO-based) solutions are used.
- the assays are designed to screen large chemical libraries by automating the assay steps and providing compounds from any convenient source to assays, which are typically run in parallel (e.g., in microtiter formats on microtiter plates in robotic assays). It will be appreciated that there are many suppliers of chemical compounds, including Sigma (St. Louis, MO), Aldrich (St. Louis, MO), Sigma- Aldrich (St. Louis, MO), Fluka Chemika-Biochemica Analytika (Buchs Switzerland) and the like.
- high throughput screening methods are used which involve providing a combinatorial chemical or peptide library containing a large number of potential therapeutic compounds.
- Such "combinatorial chemical libraries” or “ligand libraries” are then screened in one or more assays, as described herein, to identify those library members (particular chemical species or subclasses) that display a desired characteristic activity. In this instance, such compounds are screened for their ability to modulate the expression patterns of bacteria differentially detected in adenoma.
- a combinatorial chemical library is a collection of diverse chemical compounds generated by either chemical synthesis or biological synthesis, by combining a number of chemical "building blocks” such as reagents.
- a linear combinatorial chemical library such as a polypeptide library is formed by combining a set of chemical building blocks (amino acids) in every possible way for a given compound length (i.e., the number of amino acids in a polypeptide compound). Millions of chemical compounds can be synthesized through such combinatorial mixing of chemical building blocks.
- combinatorial chemical libraries include, but are not limited to, peptide libraries (see, e.g., U.S. Pat. No. 5,010,175 (Rutter and Santi), Furka, Int. J. Pept. Prot. Res., 37:487-493 (1991); and Houghton et al, Nature, 354:84-88 (1991)).
- peptide libraries see, e.g., U.S. Pat. No. 5,010,175 (Rutter and Santi), Furka, Int. J. Pept. Prot. Res., 37:487-493 (1991); and Houghton et al, Nature, 354:84-88 (1991)
- Other chemistries for generating chemical diversity libraries can also be used. Such chemistries include, but are not limited to: U.S. Pat. Nos.
- Devices for the preparation of combinatorial libraries are commercially available (see, e.g., 357 MPS, 390 MPS, Advanced Chem Tech, Louisville KY, Symphony, Rainin, Woburn, MA, 433 A Applied Biosystems, Foster City, CA, 9050 Plus, Millipore, Bedford, MA).
- Methylation modifiers are known and have been the basis for several approved drugs.
- Major classes of enzymes are DNA methyl transferases (DNMTs), histone deacetylases (HDACs), histone methyl transferases (HMTs), and histone acetylases (HATs).
- DNMT inhibitors azacitidine (Vidaza®) and decitabine have been approved for myelodysplastic syndromes (for a review see Musolino et al, Eur. J. Haematol. 84, 463-473 (2010); Issa, Hematol. Oncol. Clin. North Am.
- HDAC inhibitor has been approved by FDA for treating cutaneous T-cell lymphoma (CTCL) for patients with progressive, persistent, or recurrent disease (Marks and Breslow, Nat. Biotech. 25(1), 84-90 (2007)).
- compound libraries include: DNA methyl transferase (DNMT) inhibitor libraries available from Chem Div (San Diego, CA); cyclic peptides (Nauman et al, ChemBioChem 9, 194 - 197 (2008)); natural product DNMT libraries (Medina-Franco et al, Mol. Divers., 15(2):293-304 (2010)); HDAC inhibitors from a cyclic a3 ⁇ -tetrapeptide library (Olsen and Ghadiri, J. Med. Chem. 52(23), 7836-7846 (2009)); HDAC inhibitors from chlamydocin (Nishino et al, Amer. Peptide Symp. 9(7), 393-394 (2006)).
- DNMT DNA methyl transferase
- nucleic acids such as antisense nucleic acids, siRNAs or ribozymes
- Ribozymes that cleave mRNA at site-specific recognition sequences can be used to destroy target mRNAs, particularly through the use of hammerhead ribozymes.
- Hammerhead ribozymes cleave mRNAs at locat ions dictated by flanking regions that form complementary base pairs with the target mRNA.
- the target mRNA has the following sequence of two bases: 5'- UG-3'. The construction and production of hammerhead ribozymes is well known in the art.
- One aim of this study was to use high throughput pyrosequencing approaches to explore the microbiome of the distal gut in individuals who have colorectal adenomas compared to a control group of individuals without adenomas. Associations of the microbiota with Body Mass Index (BMI) and Waist-to-Hip Ratio (WHR), which are known risk factors for colorectal cancer, were also evaluated.
- BMI Body Mass Index
- WHR Waist-to-Hip Ratio
- mucosal biopsies were collected from the same region (-10-12 cm regions from the anal verge) from 33 adenoma subjects and 38 controls.
- One analyses looked at global signatures of the entire microbial community.
- genus and Operational Taxonomic Unit (OTU) levels significant differences were found in richness (i.e. the number of taxa present in a sample), but no differences in evenness (i.e. how evenly distributed taxa are within a sample), between cases and controls ( Figures 1, 3 & 4).
- Cyanobacteria may in fact originate from plastids or from non-Cyanobacteria, other human and animal gut studies have also observed sequences classified to Cyanobacteria. Ley, R.E., et al. Obesity alters gut microbial ecology. Proc Natl Acad Sci USA 102, 1 1070-11075 (2005).
- Streptococcus had a higher relative abundance in the control group. In other words, Streptococcus was down-regulated in the cases with a statistical significance of p ⁇ 0.05.
- qPCR assays were prepared for a subset of observed genera that were significantly different in their relative abundances between cases and controls (i.e., Helicobacter spp, Acidovorax spp and Cloacibacteria spp.). The two methods correlated as expected ( Figure 6), validating the pyrosequencing results.
- OTUs Operational Taxonomic Units
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Pathology (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Biomedical Technology (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Food Science & Technology (AREA)
- Cell Biology (AREA)
- Medicinal Chemistry (AREA)
- Toxicology (AREA)
- General Physics & Mathematics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
This invention is directed to a novel method to detect adenomas and colorectal cancer (CRC) using a bacterial signature. Included in the invention are methods of (a) determining an individual's risk developing adenomas or CRC; (b) determing whether or not a patient should have a colonoscopy; (c) differential diagnosis; (d) staging; (e) selecting therapies; (f) monitoring therapies; (g) patient surveillance; and (h) drug screening. Kits and reagents for detecting adenomas and CRC and/or drug screening are also part of the invention.
Description
METHODS AND KITS FOR DETECTING ADENOMAS, COLORECTAL CANCER,
AND USES THEREOF
RELATED APPLICATION
[0001] This application claims the benefit of US Prov. Patent Appl. No. 61/493,770, filed June 6, 201 1 entitled "Methods and Kits for Detecting Adenomas, Colorectal Cancer and Uses Thereof naming Keku et al. as inventors with Atty. Dkt. No. UNC10007USV. The entire contents of which are hereby incorporated by reference including all text, tables, and drawings.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0002] This invention was made in part with government support under grant number ROl CA 136887 awarded by the National Cancer Institute. The United States Government has certain rights in the invention.
1. FIELD OF THE INVENTION
[0003] This invention relates generally to the discovery of a novel method to detect adenomas and colorectal cancer ("CRC") using a microbial signature. Included in the invention are methods of (a) determining an individual's risk developing adenomas or CRC; (b) determing whether or not a patient should have a colonoscopy; (c) differential diagnosis; (d) staging; (e) selecting therapies; (f) monitoring therapies; (g) patient surveillance; and (h) drug screening. Kits and reagents for detecting adenomas and CRC and/or drug screening are also part of the invention.
2. BACKGROUND OF THE INVENTION
2.1. Colorectal Cancer ("CRC")
[0004] CRC is categorized by the American Cancer Society ("ACS") as a cancer which originates in the colon or rectum. In the United States CRC for men and women combined is the second most common cause of cancer death. In 2011 the ACS estimates that there will be about 101,700 new cases of colon cancer and 39,510 new cases of rectal cancer in the United States alone. CRC will cause an estimated 49,380 deaths. More than 95% of CRC cases are adenocarcinomas. American Cancer Society Detailed Guide: Colorectal Cancer ("ACS Guide CRC"), March 2, 2011 http://www.cancer.org/Cancer/ColonandRectumCancer/DetailedGuide.
[0005] The majority (-90%) of CRC cases arise sporadically from benign adenomatous polyps. Lance P. Recent developments in colorectal cancer. J R Coll Physicians Lond 31 :483-7
(1997) . The risk of developing CRC varies markedly within populations and geographical regions and, as not all adenomas ultimately progress to cancer, there is a strong indication that other factors are crucial to malignant transformation. Moore, W.E. & Moore, L.H. Intestinal floras of populations that have a high risk of colon cancer. Appl Environ Microbiol 61, 3202-3207 (1995). Although age, tobacco and alcohol consumption, lack of physical activity, and body weight are considered important risk factors for CRC (Cope, G.F. et ah, Alcohol consumption in patients with colorectal adenomatous polyps. Gut 32, 70-72 (1991)), the most significant risk factor appears to be diet. Bingham, S.A. Diet and colorectal cancer prevention. Biochem Soc Trans 28, 12-16 (2000). Another routinely cited critical factor in CRC development is the role of host microbiota. Moore & Moore (1995).
[0006] Adenomas originate in the glandular epithelium and have a dysplastic morphology. Fearon, E. R. Annu. Rev. Pathol. Mech. Dis. 6: 479-507 (201 1). Some of these adenomas mature into large polyps, undergo abnormal growth and development, and ultimately progress into CRC. M. L. Davila & A. D. Davila, Screening for Colon and Rectal Cancer, in Colon and Rectal Cancer 55-56 (Peter S. Edelstein ed., 2000). This progression would appear to take at least 10 years in most patients, rendering it a readily treatable form of cancer if diagnosed early and the CRC is localized. Davila at 56; Walter J. Burdette, Cancer: Etiology, Diagnosis, and Treatment 125
(1998) .
[0007] A number of hereditary and nonhereditary conditions have also been linked to a heightened risk of developing CRC, including familial adenomatous polyposis ("FAP"), hereditary nonpolyposis CRC (Lynch syndrome or HNPCC), a personal and/or family history of CRC or adenomatous polyps, inflammatory bowel disease, diabetes mellitus, and obesity. Davila at 47; Henry T. Lynch & Jane F. Lynch, Hereditary Nonpolyposis Colorectal Cancer (Lynch Syndromes), in Colon and Rectal Cancer 67-68 (Peter S. Edelstein ed., 2000).
[0008] Environmental/dietary factors associated with an increased risk of CRC include diets high in red or processed meats, physical inactivity, obesity, smoking, excessive alcohol consumption and type 2 diabetes. ACS Guide CRC. Conversely, environmental/dietary factors associated with a reduced risk of CRC include a diet high in fruits and vegetables and increased physical activity. Folate, vitamin D, and calcium supplements may lower CRC risk also. Similarly, aspirin or other non-steroidal anti-inflammatory drugs ("NSAIDs") have been associated with lower CRC risk. ACS Guide CRC.
2.2. CRC Molecular Biology
[0009] Researchers have spent many years studying the molecular biology associated with CRC. Approximately 15-30% of CRC instances have a major hereditary component, the remainder are due to somatic, or acquired defects. Fearon at 480. The genetic changes fall into several categories. For oncogenes they may be (i) mutations that activate or up-regulate; (ii) gene rearrangements that alter function; or (iii) gene rearrangements leading to upregulation and/or unregulated gene expression. For tumor suppressor genes the changes may be (i) mutations that inactivate tumor suppressors; (ii) loss of heterozygosity (LOH) destroying or eliminating entirely tumor suppressors; or (iii) epigenetic silencing such as methylation that reduce or shut down expression. Fearon at 480.
[0010] Defects in the tumor suppressor gene, adenomatous polyposis coli ("APC"), are present in the majority of CRC cases. APC defects are present also in >90% of the cases of FAP. Fearon at 481. Other major factors in the multi-step development of CRC are point mutations in oncogenes KRAS and BRAF; gene amplification of EGFR; and either mutations or allele loss for the tumor suppressor gene p53. Additional point mutations implicated are found in NRAS, PIK3CA, CDK8, CMYC, CCNE1, CTN B1, NEU (HER2) and MYB. Other tumor suppressor genes implicated in the cascade are FBXW7, PTEN, SMAD4, SMAD2, SMAD3, TGF IIR, TCF7L2, ACVR2 and BAX. Fearon at 488.
[0011] As discussed above, epigenetic silencing by DNA methylation also accounts for the lost of tumor suppressor genes. A strong association between micros atellite instability ("MSI") and CpG island methylation has been well characterized in sporadic CRC with high MSI but not in those of hereditary origin. In one experiment, DNA methylation of MLH1, CDKN2A, MGMT, THBS 1, RARB, APC, and pl4ARF genes has been shown in 80%, 55%, 23%, 23%, 58%, 35%, and 50% of 40 sporadic CRCs with high MSI, respectively. Yamamoto, H. et al. Genes Chromosomes Cancer 33: 322-325 (2002); and Kim, K.M. et al. Oncogene. 12;21(35): 5441-9 (2002). Others have reported hypermethylation and transcriptional silencing of secreted Frizzled- related proteins ("SFRPs") and putative tumor suppressor, hypermethylated in cancer 1 ("HICl"). Fearon at 496.
2.3. CRC Detection
[0012] Because CRC is often treatable when detected at an early, localized stage, current guidelines recommend screening tests should be a part of routine care for all adults starting at age 50. The current tests may be divided into two types: fecal tests and structural examination tests.
Examples of fecal tests are (i) the fecal occult blood test ("FOBT"); (ii) the fecal immunochemical test ("FIT"); and (iii) the stool DNA ("sDNA") test. Structural examination tests are (i) colonoscopy; (ii) flexible sigmoidoscopy; (iii) double-contrast barium enema ("DCBE"); (iv) CT colonography (virtual colonoscopy); and (v) capsule endoscopy.
[0013] These tests have advantages and disadvantages. Current fecal tests suffer from issues of accuracy, precision, inter- and intra- individual variability, and compliance due to patient's being uncomfortable with sample collection. If a fecal test is positive, a patient will be referred for a colonoscopy for a thorough examination and intervention (removal of adenomas) if necessary. The structural examination tests require both purging of a patient's bowels and pumping air into the colon to aid visualization. Each of the tests is described in greater detail below.
2.3.1. Fecal Blood Tests
[0014] Both the FOBT and FIT screen for CRC by detecting the amount of blood in the stool. The tests are based on the premise that neoplastic tissue, particularly malignant tissue, bleeds more than typical mucosa, with the amount of bleeding increasing with polyp size and cancer stage. Davila at 56-57. Multiple testing is recommended because of intermittent bleeding. While fecal blood tests may detect some early stage tumors in the lower colon, they are unable to detect (i) CRC in the upper colon because any blood will be metabolized and/or (ii) smaller adenomatous polyps, thus creating false negatives. Any gastro-intestinal bleeding due to hemorrhoids, fissures, inflammatory disorders (ulcerative colitis, Crohn's disease), infectious diseases, even long distance running, will create false positives. Beg et al. Occult Gastrointestinal Bleeding: Detection, Interpretation and Evaluation. J Indian Acad Clin Med 3(2) 153- 158 (2002).
2.3.2. Fecal Occult Blood Test ("FOBT")
[0015] FOBTs are guaiac -based and measure the peroxidase activity of heme or hemoglobin. They are inexpensive and relatively easy to administer. Commercially available products are HemeOccult® II, and HemeOccult® Sensa® (Beckman-Coulter Inc., Los Angeles, CA). In addition to the false positives and false negatives mentioned above, certain foods with peroxidase activity (uncooked fruits and vegetables, red meat) also create false positives.
2.3.3. Fecal Immunochemistry Test ("FIT")
[0016] FIT is generally more accurate than FOBT. Rather than FOBT's chemical reaction to detect heme from blood, FIT uses antibodies to detect blood related proteins such as hemoglobin. Commercially available products are InSure® (Enterix Inc., a Quest Diagnostics company, Lyndhurst, NJ); Hemoccult®-ICT (Beckman Coulter, Inc.); MonoHaem (Chemicon International, Inc., Temecula, CA); OC Auto Micro 80 (Polymedco, Cortland Manor. NY); and Magstream 1000/Hem SP (Fujirebio Inc. Tokyo, Japan). In addition to the issues from false positives or false negatives associated with blood in stools and/or metabolism, any metabolic denaturing or digestion of globin proteins or post-collection sample handling that denatures globin epitopes will create false negatives for the FIT.
2.3.4. Stool DNA ("sDNA") Test
[0017] The sDNA test measures a variety of DNA markers measured in a lab from a stool sample collected by the patient. Current sDNA tests, available from Exact Sciences Corp. (Madison, WI), measure mutations in K-ras, APC, P53 genes; BAT -26 (an MSI marker); a marker for DNA integrity; and methylation of the vimentin gene. Levin et al. Screening and Surveillance for the Early Detection of Colorectal Cancer and Adenomatos Polyps. CA Cancer J Clinicians 58(3) 130-160 (2008). While some guidelines recommend sDNA testing other guidelines are more conservative and do not recommend sDNA testing. In one study a version of the sDNA test was superior to FOBT, but it still only detected 15% of the advanced adenomas. Imperiale et al. Fecal DNA versus fecal occult blood for colorectal-cancer screening in an average-risk population. N Engl J Med 351:2704-2714 (2004).
2.3.5. Colonoscopy and Sigmoidoscopy
[0018] Colonoscopy allows direct visualization of the bowel, and enables one to detect, biopsy, and remove adenomatous polyps. Davila at 59-61. Colonoscopy is the "gold standard" diagnostic for colon cancer. Despite these advantages, there are downsides. In addition to the patient discomfort discussed above, colonoscopy is a relatively expensive procedure and there are risks of possible bowel perforation and hemorrhaging. Davila at 59-60. Moreover, the skill and experience of doctors vary and some studies have reported missing 6-12% of large adenomas (=10 mm) and failing to detect cancer in 5% of the cases. Levin et al. at 145.
[0019] Flexible sigmoidoscopy, by definition, is limited to the sigmoid colon. A sigmoidscope is about 60 cm long (~2 feet). Thus, a doctor can only examine the rectum and the lower half of the colon. Sigmoidoscopy requires the same preparation and invasiveness as
colonoscopy, with those drawbacks. For the portions examined, it has the advantages of the colonoscopy. However, flexible sigmoidoscopy does only half the job.
2.3.6. Double-Contrast Barium Enema and CT Colonography
[0020] Double-contrast barium enema ("DCBE") is also referred to as air-contrast enema. It requires the same prep as a colonoscopy to purge the patient's colon and the patient's colon is imaged using X-rays with a barium contrast agent. While it is recommended by most guidelines, DCBE suffers from two shortcomings. One, patient discomfort during the prep and examination and two, if something suspicious is seen, it does not provide the opportunity for a biopsy or polypectomy. Thus, if there is a positive test result, the patient will need a colonoscopy follow up. CT colonography also known as a virtual colonoscopy uses a computed tomography (CT or CAT) scan to image the rectum and colon. Though it requires a colon preparation, it is minimally invasive and gaining acceptance. Unfortunately, like the DCBE, a positive test will require a colonoscopy to investigate and intervene if necessary.
2.3.7. Capsule Endoscopy
[0021] Capsule endoscopy involves the ingestion of a small capsule with video cameras at each end. Lieberman. Progress and Challenges in Colorectal Cancer Screening and Surveillance. Gastroenterology 138: 2115-2126 (2010). As it passes through the colon images are transmitted and recorded. Some studies have reported detection of 73% of the advanced adenomas and 74% of the CRC cases. Lieberman at 2119. The shortcomings are similar to DCBE or CT colonography because it requires similar patient preparation and positive results require a subsequent colonoscopy. In addition, insufficient battery life and inadequate imaging in periods of rapid motility are disadvantages for the current generation capsule endoscopy products.
2.4. CRC Staging
[0022] Once CRC has been diagnosed, treatment decisions are typically made using the stage of cancer progression. A number of techniques are employed to stage the cancer (some of which are also used to screen for colon cancer), including pathologic examination of resected colon, sigmoidoscopy, colonoscopy, and various imaging techniques. AJCC Cancer Staging Handbook, 143-164, Edge et al. eds., 7th ed. 2011). Proximal lymph node evaluation, sentinel node evaluation, chest/abdominal/pelvic CT, MRI scans, positron emission tomography ("PET") scans, liver functionality tests (for liver metastases), and blood tests (complete blood count ("CBC"), carcinoembryonic antigen ("CEA"), CA 19-9) are employed to determine the stage. NCCN
Clinical Practice Guidelines in Oncology: Colon Cancer Version 3.201 1, February 25, 201 1 http://www.nccn.org/professionals/physician_gls/pdf/colon.pdf.
[0023] Several classification systems have been devised to stage the extent of CRC, including the Dukes' system and the more detailed International Union against Cancer- American Joint Committee on Cancer TNM staging system. Burdette at 126-27. The TNM system, which is used for either clinical or pathological staging, is divided into four stages, each of which evaluates the extent of cancer growth with respect to primary tumor (T), regional lymph nodes (N), and distant metastasis (M). Fleming at 84-85. The system focuses on the extent of tumor invasion into the intestinal wall; invasion of adjacent structures; the number of regional lymph nodes that have been affected; and whether distant metastasis has occurred. Fleming at 81.
[0024] Stage 0 is characterized by in situ carcinoma (Tis), in which the cancer cells are located inside the glandular basement membrane (intraepithelial) or lamina propria (intramucosal). In this stage, the cancer has not spread to the regional lymph nodes (NO), and there is no distant metastasis (MO). In stage I, there is still no spread of the cancer to the regional lymph nodes and no distant metastasis, but the tumor has invaded the submucosa (Tl) or has progressed further to invade the muscularis propria (T2). Stage II also involves no spread of the cancer to the regional lymph nodes and no distant metastasis, but the tumor has invaded the subserosa, or the nonperitonealized pericolic or perirectal tissues (T3), or has progressed to invade other organs or structures, and/or has perforated the visceral peritoneum (T4). Stage III is characterized by any of the T substages, no distant metastasis, and either spread to 1 to 3 regional lymph nodes (Nl) or spread to four or more regional lymph nodes (N2). Lastly, stage IV involves any of the T or N substages, as well as distant metastasis (Mia or Mlb). Physicians will also assign a grade, that is, characterize CRC based on the appearance of the cells ranging from Gl (well-differentiated, almost normal) to G4 (undifferentiated, very abnormal) where a high grade is an indication of a poor prognosis. ACS Guide CRC; Fleming at 84-85; Burdette at 127.
2.5. CRC Therapy
[0025] For the treatment of CRC, surgical resection results in a cure for roughly 50% of patients. Chemotherapy and irradiation maybe used both preoperatively (neoadjuvant) and postoperatively (adjuvant) in treating CRC. Chemotherapeutic agents, particularly 5-fluorouracil (5-FU), are powerful weapons in treating CRC. Other agents include oxaliplatin (Eloxatin®), irinotecan (Camptosar®), leucovorin, capecitabine (Xeloda®), bevacizumab (Avastin®), cetuximab (Erbitux®), and panitumumab (Vectibix®). These drugs are frequently combined. Common combinations are FOLFOX (5-FU, leucovorin, oxaliplatin); FOLFIRI (5-FU,
leucovorin, irinotecan); and FOLFOXIRI (5-FU, leucovorin, irinotecan, oxaliplatin). Bevacizumab is a targeted therapeutic, specifically a monoclonal antibody that binds to vascular endothelial growth factor (VEGF) to prevent formation of blood vessels around the tumor. Cetuximab and panitumumab are monoclonal antibodies that target epidermal growth factor receptor (EGFR).
[0026] Many patients will develop a recurrence of CRC following surgical resection, particularly in the first 2 or 3 years. Accordingly, CRC patients must be closely monitored to determine response to therapy and to detect persistent or recurrent disease and metastasis.
[0027] From the foregoing, it is clear that improved procedures used for detecting, diagnosing, monitoring, staging, prognosticating, and preventing the recurrence of CRC are of critical importance to the outcome of the patient. Moreover, current procedures, while helpful in each of these analyses, are limited by their specificity, sensitivity, invasiveness, and/or cost effectiveness. As such, minimally invasive, highly specific and sensitive procedures would be highly desirable. Accordingly, there is a great need for more sensitive and accurate methods for predicting whether a person is likely to develop CRC, for diagnosing CRC, for monitoring the progression of the disease, for staging CRC, for determining whether CRC has metastasized, and for imaging CRC.
3. SUMMARY OF THE INVENTION
[0028] In particular non-limiting embodiments, this disclosure is directed to a method for detecting colorectal adenoma in a patient which comprises: (a) obtaining a suitable patient sample; (b) measuring a level of five or more bacteria selected from a group consisting of Acidovorax, Acinetobacter, Agrobacterium, Akkermansia, Alistipes, Allobaculum, Aquabacterium, Azonexus, Bacillaceae l, Bryantella, Carnobacteriaceae l, Chryseobacterium, Chryseomonas, Cloacibacterium, Comamonas, Dechloromonas, Delftia, Enterobacter, Erwinia, Exiguobacterium, Flavimonas, Fusobacterium, Gpl, Gp2, Helicobacter, Lactobacillus, Lactococcus, Leuconostoc, Methylobacterium, Micrococcineae, Novosphingobium, Pantoea, Pseudomonas, Pseudoxanthomonas, Roseburia, Rubrobacterineae, Serratia, Shinella, Sphingobium, Staphylococcus, Stenotrophomonas, Succinivibrio, Sutterella, Syntrophococcus, Turicibacter, Variovorax, and Weissella; and (c) comparing the patient sample levels with levels associated with a control sample, wherein elevated levels are indicative of whether or not colorectal adenoma is present or absent in the patient.
[0029] The disclosure is also directed to a kit for detecting colorectal adenoma in a patient sample which comprises: (a) a means for measuring a level of five or more bacteria selected from
a group consisting of Acidovorax, Acinetobacter, Agrobacterium, Akkermansia, Alistipes, Allobaculum, Aquabacterium, Azonexus, Bacillaceae l, Bryantella, Carnobacteriaceae l, Chryseobacterium, Chryseomonas, Cloacibacterium, Comamonas, Dechloromonas, Delftia, Enterobacter, Erwinia, Exiguobacterium, Flavimonas, Fusobacterium, Gpl, Gp2, Helicobacter, Lactobacillus, Lactococcus, Leuconostoc, Methylobacterium, Micrococcineae, Novosphingobium, Pantoea, Pseudomonas, Pseudoxanthomonas, Roseburia, Rubrobacterineae, Serratia, Shinella, Sphingobium, Staphylococcus, Stenotrophomonas, Succinivibrio, Sutterella, Syntrophococcus, Turicibacter, Variovorax, and Weissella; and (b) instructions for comparing the patient sample levels with levels associated with healthy patient controls. In the kit elevated levels are indicative of whether or not colorectal adenoma is present or absent in the patient.
[0030] The disclosure is also directed to a method of identifying a compound that prevents or treats colorectal adenomas, the method comprising the steps of: (a) contacting a tissue or an animal model with a compound; (b) measuring a level of four or more bacteria selected from group consisting of Acidovorax, Acinetobacter, Agrobacterium, Akkermansia, Alistipes, Allobaculum, Aquabacterium, Azonexus, Bacillaceae l, Bryantella, Carnobacteriaceae l, Chryseobacterium, Chryseomonas, Cloacibacterium, Comamonas, Dechloromonas, Delftia, Enterobacter, Erwinia, Exiguobacterium, Flavimonas, Fusobacterium, Gpl, Gp2, Helicobacter, Lactobacillus, Lactococcus, Leuconostoc, Methylobacterium, Micrococcineae, Novosphingobium, Pantoea, Pseudomonas, Pseudoxanthomonas, Roseburia, Rubrobacterineae, Serratia, Shinella, Sphingobium, Staphylococcus, Stenotrophomonas, Succinivibrio, Sutterella, Syntrophococcus, Turicibacter, Variovorax, and Weissella; and (c) determining a functional effect of the compound on the bacteria levels.
4. BRIEF DESCRIPTION OF THE FIGURES
[0031] Figure 1 : Richness (left panel) and evenness (right panel) for the Operational Taxonomic Units ("OTUs") observed for cases (n=33) vs. controls (n=38). OTUs were created with the program AbundantOTU x. Ye, Y. Identification and Quantification of Abundant Species from Pyrosequences of 16S rRNA by Consensus Alignment. Proc BIBM 153-157 (2010). The x-axis is proportional to the number of subjects in each category. By the Wilcoxon test, cases had a significantly higher richness (p= 0.0061) than controls, but there was no significant difference in evenness (p = 0.36).
[0032] Figure 2: Maximum likelihood tree generated from the 371 OTUs in which the OTU was observed in at least 25% of the patients studied. The tree was generated using the RaxXML EPA server (http://il2k-exelixis3.informatik.tu-muenchen.de/raxml) (see methods). Branches are
colored based on RDP Phylum level assignments. Black branches represent OTUs significantly different between cases and controls within each Phylum (at 10% False Discovery Rate ("FDR")).
[0033] Figure 3 : Richness (left panel) and evenness (right panel) at the phylum level in cases
(n=33) vs. controls (n=38). By the Wilcoxon test, cases had a significantly higher richness (p=
0.0041) than controls, but there was no significant difference in evenness (p = 0.75).
[0034] Figure 4: Richness (left panel) and evenness (right panel) at the genus level, in cases
(n=33) vs. controls (n=38). By the Wilcoxon test, cases had a significantly higher richness (p=
0.0013) than controls, but there was no significant difference in evenness (p = 0.56).
[0035] Figure 5: Principal Component Analysis (PCoA) PCoA generated from Fast UniFrac analysis on the tree displayed in Figure. 2. (Cases- squares; controls- circles).
[0036] Figure 6: Regressions between q-PCR results and results from pyrosequencing data for genera Helicobacter, Acidovorax and Cloacibacterium. Reasonable correlations were obtained using the two methods; by linear regression: Acidovorax R= 0.6, p< 0.001 ; Cloacibacterium R=
0.61, p<0.001 and Helicobacter R= 0.56, p < 0.0001.
[0037] Figure 7: Rank-abundance curve in which the x-axis is the log abundance rank of the top 371 OTUs and the y-axis is the average log normalized sequence count across all samples. The OTU is marked by squares if the difference between cases and controls is significant at 10% FDR and by open circles if the difference is not significant at 10% FDR.
[0038] Figure 8: Richness (left panel) and evenness (right panel) at the OTU level, in Normal (n=27) vs. Overweight (n=25) vs. Obese (n=18) Body Mass Index ("ΒΜΊ") categories. No significant difference was seen by the Kruskal-Wallis test in richness (p = 0.21) or evenness (p = 0.42) between the 3 categories.
[0039] Figure 9: Richness (left panel) and evenness (right panel) at the OTU level, in Low- Risk (n=25) vs. Medium-Risk (n=16) vs. High-Risk (n=30) Waist-to-hip ratio ("WHR") categories. No significant difference was seen by the Kruskal-Wallis test in richness (p = 0.26) or evenness (p = 0.76) between the 3 categories.
[0040] Figure 10: Regressions on log-normalized abundance of OTU 16 (top ranking OTU based on regression p-Value) vs. BMI of all samples. Note that after correction for multiple hypothesis testing, this regression is not significant at a 10% FDR threshold (see Table 6).
[0041] Figure 11 : Regressions on log-normalized abundance of OTU4 (top ranking OTU based on regression p-Value) vs. WHR of all samples. Note that after correction for multiple hypothesis testing, this regression is not significant at a 10% FDR threshold (see Table 7).
[0042] Figures 12-1-12-7: Maximum likelihood tree generated from the top 371 OTUs using RaxXML EPA server. Figure 12-1 Proteobacteria; Figure 12-2Bacteriodes; Figure 12-3— 12-6
Firmicutes; Figure 12-7 Other. In bold associated with the black axes are the OTUs significantly different. Leaf nodes are labeled with the Ribosomal Database Project (RDP) Classifier call of the consensus sequence at 80%. Wang, Q., Garrity, G.M., Tiedje, J.M. & Cole, J.R. Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Appl Environ Microbiol 73, 5261-5267 (2007). Branches are black if the OTU was significantly different between cases and controls and gray if not significant (at 10% FDR).
[0043] Figure 13 : Abundance of Fusobacterium in rectal mucosal biopsies from adenoma cases and non-adenoma controls. qPCR results show that Fusobacterium is more abundant in cases than controls.
[0044] Figure 14: Correlations between Fusobacterium abundance and local cytokine gene expression in adenoma cases and non-adenoma controls. Results suggest a significant positive correlation between Fusobacterium abundance and local inflammation in cases but not controls. The correlations were significant for IL-10 (r= 0.44, p=0.01) and TNF-a (r = 0.33, p=0.06).
[0045] Figure 15: Log Abundance of Fusobacterium in matched normal colon and colorectal cancer tissue. Fusobacterium abundance was evaluated in DNA samples from normal colon and tumor tissue by qPCR using Fusobacterium-specific primers. Results suggest that Fusobacterium is increased in colon cancer tissue compared to normal tissue (ttest p=0.0005).
[0046] Figure 16: Hierarchical clustering of bacterial community profiles in rectal swabs and rectal biopsies. Bray-Curtis similarities were used to construct a dendrogram composed of the samples provided by the participants (1-11). Each participant is represented twice: rectal swab (light gray triangles) and rectal biopsy (dark gray triangles).
[0047] Figure 17: Distribution of Terminal-restriction fragments (T-RFs) in rectal swabs and rectal biopsies. Bars represent the average abundance of each T-RF grouped by biopsies (dark gray) or swabs (light gray). Asterisks represent T-RFs that are significantly different (p<0.05) between rectal biopsies and rectal swabs as assessed by t-test.
[0048] Figure 18: Measures of T-RF Diversity in rectal swabs and rectal biopsies. Bars represent average diversity as estimated by T-RF richness (p=0.014), evenness (p=0.058) and Shannon's diversity (p=0.04). Calculated standard error is represented atop each bar graph. Statistical significance (*) was calculated by t-test.
[0049] Figure 19: Quantitative PCR of Bacterial 16S RNA Gene of (Fig. 19A) Lactobacillus spp., (Fig. 19B) Eubacteria, (Fig. 19C) Bacteroides spp., (Fig. 19D) E. coli, (Fig. 19E) Clostridium spp. and (Fig. 19F) Bifidobacterium spp. in rectal swabs and rectal biopsies. A significant increase in Lactobacillus spp. (p = 0.04) and Eubacterium spp. (p = 0.01 1) was observed in rectal swabs compared to rectal biopsies (*).
[0050] Figure 20: Hierarchical Clustering of bacterial communities in rectal swabs and rectal biopsies by adenoma status. Bray-Curtis similarities were used to construct dendrograms composed of the samples provided by the participants (1-11). Each participant is represented twice: for the rectal swab (light gray triangles) and rectal biopsy (dark triangles). Fig. 20A: adenoma cases Fig. 20B: non-adenoma controls. Significance values were calculated from Analysis of Similarity (ANOSIM).
[0051] Figure 21 : Pair-wise comparisons of bacterial community composition based on Bray- Curtis similarities; swabs (top row); biopsies (left column).
5. DETAILED DESCRIPTION OF THE INVENTION
[0052] This disclosure is directed to a method for detecting colorectal adenoma in a patient which comprises: (a) obtaining a suitable patient sample; (b) measuring a level of five or more bacteria selected from a group consisting of Acidovorax, Acinetobacter, Agrobacterium, Akkermansia, Alistipes, Allobaculum, Aquabacterium, Azonexus, Bacillaceae l, Bryantella, Carnobacteriaceae l, Chryseobacterium, Chryseomonas, Cloacibacterium, Comamonas, Dechloromonas, Delftia, Enterobacter, Erwinia, Exiguobacterium, Flavimonas, Fusobacterium, Gpl, Gp2, Helicobacter, Lactobacillus, Lactococcus, Leuconostoc, Methylobacterium, Micrococcineae, Novosphingobium, Pantoea, Pseudomonas, Pseudoxanthomonas, Roseburia, Rubrobacterineae, Serratia, Shinella, Sphingobium, Staphylococcus, Stenotrophomonas, Succinivibrio, Sutterella, Syntrophococcus, Turicibacter, Variovorax, and Weissella; and (c) comparing the patient sample levels with levels associated with a control sample, wherein elevated levels are indicative of whether or not colorectal adenoma is present or absent in the patient.
[0053] In some embodiments, the bacteria are selected from the group consisting of Acidovorax, Acinetobacter, Aquabacterium, Azonexus, Cloacibacterium, Dechloromonas, Delftia, Fusobacterium, Helicobacter, Lactobacillus, Lactococcus, Leuconostoc, Sphingobium, Stenotrophomonas, Succinivibrio, Turicibacter, and Weissella. The Fusobacterium may be F. nucleatum. The method may further comprising measuring levels of Bacteroides, Bifidobacteriaceae, Dorea, or Streptococcus, wherein decreased levels of Bacteroides, Bifidobacteriaceae, Dorea, or Streptococcus, are indicative of whether or not adenoma is present or absent in the patient. In one aspect of the disclosure, 8, 12, 15, 20 or 30 bacteria are measured. In another aspect, the bacteria are measured using the Operational Taxonomic Units (OTUs), such as those exemplified in Table 3. The specific OTUs correspond to the consensus sequences in the sequence listing, e.g., OTU72, Aquabacterium corresponds to consensus sequence #72 in US
Prov. Patent Appl. No. 61/493,770, which is SEQ ID No. 82 in in the sequence listing. Similarly, OTU1 corresponds to SEQ ID No. 11, OTU100 to SEQ ID No. 1 10, OTU110 to SEQ ID No. 120, OTU353 to SEQ ID No. 363...0TU613 to SEQ ID No. 623. One of ordinary skill could readily use the OTUs of interest and the sequence listing to find the name and additional details for any individual bacterial genus and species of interest or combinations or sets of bacteria to select patients likely to have adenomas. The sequences in the sequence listing may readily be entered into databases such as the SEQ MATCH section of the Ribosomal Database project (http://rdp.cme.msu.edu/index.jsp) or BLAST search in the 16S ribosomal RNA database of the National Center for Biotechnology Information (NCBI)( http://blast.ncbi.nlm.nih.gov/Blast.cgi).
[0054] Examples of OTUs/SEQ ID Nos.(#) of particular interest in combination for the claimed invention include up-regulation of OTUl l(#21), OTU36(#46), OTU59(#69), OTU67(#77), OTU86(#96), OTU91(#101), OTU124(#134), OTU133(#143), OTU159(#169), OTU186(#196), OTU197(#207), OTU242(#252), OTU313(#323), OTU322(#332), OTU330(#340), OTU353(#463), OTU370(#380), OTU442(#452), OTU491(#501), OTU501(#511) and down-regulation of OTU8 (#18), OTU66(#76), OTU169(#179).
[0055] Alternatively, bacteria may be selected such that 2 or more bacteria are from the phyla, Proteobacteria; 2 or more bacteria are from the phyla Bacteriodetes; and 2 or more bacteria are from the phyla Firmicutes. One of ordinary skill could select multiple bacteria from different phyla or similar phyla that are different between cases and controls using groupings in Figure 12- 1—12-7.
[0056] The bacteria levels may be measured using bacterial nucleic acids such as 16S rRNA genes. They may also be measured using terminal restriction fragment length polymorphism ("T- RFLP"), fluorescence in-situ hybridization ("FISH"), polymerase chain reaction ("PCR"), pyrosequencing, or microarray.
[0057] The bacteria in the patient sample are cultured prior to measuring the levels. The bacteria levels may also be measured using antibodies. In some aspects of the disclosure, the patient sample may be a fecal sample. Alternatively, the patient sample is a biopsy sample such as a mucosal biopsy sample. The patient sample may also be a sample obtained by a rectal swab. The colorectal adenoma may be an adenocarcinoma.
[0058] The disclosure is also directed to a method for determining whether or not a patient should have a colonoscopy or a method for monitoring a patient for colorectal adenoma recurrence using the steps described above.
[0059] The disclosure is also directed to a kit for detecting colorectal adenoma in a patient sample which comprises: (a) a means for measuring a level of five or more bacteria selected from
a group consisting of Acidovorax, Acinetobacter, Agrobacterium, Akkermansia, Alistipes, Allobaculum, Aquabacterium, Azonexus, Bacillaceae l, Bryantella, Carnobacteriaceae l, Chryseobacterium, Chryseomonas, Cloacibacterium, Comamonas, Dechloromonas, Delftia, Enterobacter, Erwinia, Exiguobacterium, Flavimonas, Fusobacterium, Gpl, Gp2, Helicobacter, Lactobacillus, Lactococcus, Leuconostoc, Methylobacterium, Micrococcineae, Novosphingobium, Pantoea, Pseudomonas, Pseudoxanthomonas, Roseburia, Rubrobacterineae, Serratia, Shinella, Sphingobium, Staphylococcus, Stenotrophomonas, Succinivibrio, Sutterella, Syntrophococcus, Turicibacter, Variovorax, and Weissella; and (b) instructions for comparing the patient sample levels with levels associated with healthy patient controls. In the kit elevated levels are indicative of whether or not colorectal adenoma is present or absent in the patient.
[0060] The disclosure is also directed to a kit comprising: (a) a reagent selected from a group consisting of: (i) nucleic acid probes capable of specifically hybridizing with nucleic acids from five or more bacteria selected from a group consisting of Acidovorax, Acinetobacter, Agrobacterium, Akkermansia, Alistipes, Allobaculum, Aquabacterium, Azonexus, Bacillaceae l, Bryantella, Carnobacteriaceae l, Chryseobacterium, Chryseomonas, Cloacibacterium, Comamonas, Dechloromonas, Delftia, Enterobacter, Erwinia, Exiguobacterium, Flavimonas, Fusobacterium, Gpl, Gp2, Helicobacter, Lactobacillus, Lactococcus, Leuconostoc, Methylobacterium, Micrococcineae, Novosphingobium, Pantoea, Pseudomonas, Pseudoxanthomonas, Roseburia, Rubrobacterineae, Serratia, Shinella, Sphingobium, Staphylococcus, Stenotrophomonas, Succinivibrio, Sutterella, Syntrophococcus, Turicibacter, Variovorax, and Weissella; (ii) a pair of nucleic acid primers capable of PCR amplification of five or more said bacteria; and (iii) four or more antibodies specific for said bacteria; and (b) instructions for use in measuring levels in a tissue sample from a patient suspected of having colorectal adenoma.
[0061] The disclosure is also directed to a method of identifying a compound that prevents or treats colorectal adenomas, the method comprising the steps of: (a) contacting a tissue or an animal model with a compound; (b) measuring a level of four or more bacteria selected from group consisting of Acidovorax, Acinetobacter, Agrobacterium, Akkermansia, Alistipes, Allobaculum, Aquabacterium, Azonexus, Bacillaceae l, Bryantella, Carnobacteriaceae l, Chryseobacterium, Chryseomonas, Cloacibacterium, Comamonas, Dechloromonas, Delftia, Enterobacter, Erwinia, Exiguobacterium, Flavimonas, Fusobacterium, Gpl, Gp2, Helicobacter, Lactobacillus, Lactococcus, Leuconostoc, Methylobacterium, Micrococcineae, Novosphingobium, Pantoea, Pseudomonas, Pseudoxanthomonas, Roseburia, Rubrobacterineae, Serratia, Shinella, Sphingobium, Staphylococcus, Stenotrophomonas, Succinivibrio, Sutterella,
Syntrophococcus, Turicibacter, Variovorax, and Weissella; and (c) determining a functional effect of the compound on the bacteria levels. Thus by determining functional effects, one of ordinary skill may identify a compound that prevents or treats colorectal adenomas.
[0062] Also included in the methods and kits disclosed above are methods further comprising measuring analytes in a fecal test such as FOBT, FIT, or sDNA test. The methods disclosed above are complementary and may be used in combination with structural tests such as colonoscopy, flexible sigmoidoscopy, DCBE, CT colonography or capsule endoscopy. For CRC staging one may use the methods or kits described above in combination with pathologic examination of a colon biopsy, proximal lymph node evaluation, sentinel node evaluation, chest/abdominal/pelvic CT, MRI scans, positron emission tomography ("PET") scans, liver functionality tests (for liver metastases), and blood tests (complete blood count ("CBC"), carcinoembryonic antigen ("CEA"), CA 19-9).
5.1. Definitions
[0063] The term "adenoma" refers to a growth of epithelial cells of glandular origin which may be benign or malignant. They are also referred to as adenomatous polyps. Adenomas may be peduculated (large head with a narrow stalk) or sessile (broad based). They may be classified as tubular adenomas, tubulovillous adenomas, villous adenomas, and flat adenomas. The adenoma may be an adenocarcinoma. The adenoma may be an adenoma from a human patient which may be a large adenoma >10cm, a small adenoma < 5 cm, or an adenoma between 0.5 cm and 15 cm in length.
[0064] The terms "nucleic acid" and "nucleic acid molecule" may be used interchangeably throughout the disclosure. The terms refer to nucleic acids of any composition from, such as DNA (e.g., complementary DNA ("cDNA"), genomic DNA ("gDNA") and the like), ribosomal DNA ("rDNA"), RNA (e.g., messager RNA ("mRNA"), short inhibitory RNA ("siRNA"), ribosomal RNA ("rRNA"), transfer RNA ("tRNA"), microRNA, and the like), and/or DNA or RNA analogs (e.g., containing base analogs, sugar analogs and/or a non-native backbone and the like), RNA/DNA hybrids and polyamide nucleic acids ("PNAs"), all of which can be in single- or double-stranded form, and unless otherwise limited, can encompass known analogs of natural nucleotides that can function in a similar manner as naturally occurring nucleotides. Examples of nucleic acids are SEQ ID Nos. 1-623.
[0065] A nucleic acid in some examples may be from a microorganism which may be cultured (Cannon et al, App Envir Microbiol 3878-3885 (2002); Eckburg et al, Sci 308 1635- 1638 (2005); Moore and Moore 1995; or Anaerobe Laboratory Manual. Holdeman et al. eds.
1977, 4th Ed. p. 1-156); uncultured (Jurgens et al., FEMS Microbiol Ecol. 34(1) 45-56 (2000); Palmer et al, Nuc Acids Res 34(1) e5 (2006); Palmer et al. PLoS Biol 5(7) el77 1556-1573 (2007); Scanlon et al, Envir. Micro. 10(3) 789-798 (2008); Zengler et al, Proc Nat Acad Sci 99(24) 15681-15686 (2002), the contents of which are hereby incorporated by reference in their entireties. A nucleic acid may be a small subunit ("SSU") rDNA, 16S, or 23S rRNA fragment or full-length rRNA sequence. It may be a nucleic acid encoding a 16S variable region such as VI, V2, V3, V4, V5, V6, V7, V8, V9, or a combination thereof. In some examples, the V2, V3, or V6 regions may be used. A nucleic acid may also be a ribosomal intergenic spacer ("RIS") or internal transcribed spacer ("ITS") fragment. It may be a sequence found using microarray or FISH analysis.
[0066] A template nucleic acid in some embodiments may be specific for a single bacteria taxa or a nucleic acid capable of binding to a variety of taxa. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses methylated forms, conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, single nucleotide polymorphisms ("SNPs"), and complementary sequences as well as the sequence explicitly indicated. The term nucleic acid is used interchangeably with locus, gene, cDNA, and mRNA encoded by a gene. The term also may include, as equivalents, derivatives, variants and analogs of RNA or DNA synthesized from nucleotide analogs, single- stranded ("sense" or "antisense", "plus" strand or "minus" strand, "forward" reading frame or "reverse" reading frame) and double-stranded polynucleotides. Deoxyribonucleotides include deoxy adenosine, deoxycytidine, deoxyguanosine and deoxythymidine. For RNA, the base cytosine is replaced with uracil.
[0067] As used herein, a "methylated nucleotide" or a "methylated nucleotide base" refers to the presence of a methyl moiety on a nucleotide base, where the methyl moiety is not present in a recognized typical nucleotide base. For example, cytosine does not contain a methyl moiety on its pyrimidine ring, but 5-methylcytosine contains a methyl moiety at position 5 of its pyrimidine ring. Therefore, cytosine is not a methylated nucleotide and 5-methylcytosine is a methylated nucleotide. In another example, thymine contains a methyl moiety at position 5 of its pyrimidine ring, however, for purposes herein, thymine is not considered a methylated nucleotide when present in DNA since thymine is a typical nucleotide base of DNA. Typical nucleoside bases for DNA are thymine, adenine, cytosine and guanine. Typical bases for RNA are uracil, adenine, cytosine and guanine. Correspondingly a "methylation site" is the location in the target gene
nucleic acid region where methylation has, or has the possibility of occurring. For example a location containing CpG is a methylation site wherein the cytosine may or may not be methylated.
[0068] As used herein, a "CpG site" or "methylation site" is a nucleotide within a nucleic acid that is susceptible to methylation either by natural occurring events in vivo or by an event instituted to chemically methylate the nucleotide in vitro.
[0069] As used herein, a "methylated nucleic acid molecule" refers to a nucleic acid molecule that contains one or more nucleotides that is/are methylated. An example of a methylated nucleic acid associated with CRC is vimentin. Shirahata et al, Anticancer Res. 30(12) 5015-5018 (2010).
[0070] A "CpG island" as used herein describes a segment of DNA sequence that comprises a functionally or structurally deviated CpG density. For example, Yamada et al. have described a set of standards for determining a CpG island: it must be at least 400 nucleotides in length, has a greater than 50% GC content, and an OCF/ECF ratio greater than 0.6 (Yamada et al, Genome Research, 14, 247-266 (2004)). Others have defined a CpG island less stringently as a sequence at least 200 nucleotides in length, having a greater than 50% GC content, and an OCF/ECF ratio greater than 0.6 (Takai et al, Proc. Natl. Acad. Sci. USA, 99, 3740-3745 (2002)).
[0071] The term "gene" means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) involved in the transcription/translation of the gene product and the regulation of the transcription/translation, as well as intervening sequences (introns) between individual coding segments (exons).
[0072] In this application, the terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymers. As used herein, the terms encompass amino acid chains of any length, including full-length proteins (i.e., antigens), wherein the amino acid residues are linked by covalent peptide bonds.
[0073] The term "amino acid" refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, gamma-carboxyglutamate, and O-phosphoserine. Amino acids may be referred to herein by either the commonly known three letter symbols or by the one- letter symbols recommended by the IUPAC-IUB Biochemical
Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.
[0074] "Primers" as used herein refer to oligonucleotides that can be used in an amplification method, such as a polymerase chain reaction ("PCR"), to amplify a nucleotide sequence based on the polynucleotide sequence corresponding to a particular genomic sequence, e.g., one specific for a particular bacteria. At least one of the PCR primers for amplification of a polynucleotide sequence is sequence-specific for the sequence.
[0075] The term "template" refers to any nucleic acid molecule that can be used for amplification in the technology. RNA or DNA that is not naturally double stranded can be made into double stranded DNA so as to be used as template DNA. Any double stranded DNA or preparation containing multiple, different double stranded DNA molecules can be used as template DNA to amplify a locus or loci of interest contained in the template DNA.
[0076] The term "amplification reaction" as used herein refers to a process for copying nucleic acid one or more times. In embodiments, the method of amplification includes, but is not limited to, polymerase chain reaction, self-sustained sequence reaction, ligase chain reaction, rapid amplification of cDNA ends, polymerase chain reaction and ligase chain reaction, Q-β replicase amplification, strand displacement amplification, rolling circle amplification, or splice overlap extension polymerase chain reaction. In some embodiments, a single molecule of nucleic acid may be amplified.
[0077] The term "sensitivity" as used herein refers to the number of true positives divided by the number of true positives plus the number of false negatives, where sensitivity ("sens") may be within the range of 0 < sens < 1. Ideally, method embodiments herein have the number of false negatives equaling zero or close to equaling zero, so that no subject is wrongly identified as not having adenoma when they indeed have adenoma. Conversely, an assessment often is made of the ability of a prediction algorithm to classify negatives correctly, a complementary measurement to sensitivity. The term "specificity" as used herein refers to the number of true negatives divided by the number of true negatives plus the number of false positives, where specificity ("spec") may be within the range of 0 < spec < 1. Ideally, the methods described herein have the number of false positives equaling zero or close to equaling zero, so that no subject is wrongly identified as having adenoma when they do not in fact have adenoma. Hence, a method that has both sensitivity and specificity equaling one, or 100%, is preferred.
[0078] The phrase "functional effects" in the context of assays for testing means compounds that modulate a phenotype or a gene associated with adenoma either in vitro, in cell culture, in tissue samples, or in vivo. This may also be a chemical or phenotypic effect such as altered
bacterial profiles in vivo, e.g., changing from a high risk of adenoma or CRC bacterial profile to a low risk profile; altered expression of genes associated with adenoma or CRC; altered transcriptional activity of a gene hyper- or hypomethylated in adenoma; or altered activities and the downstream effects of proteins encoded by these genes. A functional effect may include transcriptional activation or repression, the ability of cells to proliferate, expression in cells during adenoma progression, and other characteristics of colorectal cells. "Functional effects" include in vitro, in vivo, and ex vivo activities. By "determining the functional effect" is meant assaying for a compound that increases or decreases the transcription of genes or the translation of proteins that are indirectly or directly under the influence of a gene hyper- or hypomethylated in adenoma or adenocarcinoma. Such functional effects can be measured by any means known to those skilled in the art, e.g., changes in spectroscopic characteristics (e.g., fluorescence, absorbance, refractive index); hydrodynamic (e.g., shape), chromatographic; or solubility properties for the protein; ligand binding assays, e.g., binding to antibodies; measuring inducible markers or transcriptional activation of the marker; measuring changes in enzymatic activity; the ability to increase or decrease cellular proliferation, apoptosis, cell cycle arrest, measuring changes in cell surface markers. Validation of the functional effect of a compound on adenoma occurence or progression can also be performed using assays known to those of skill in the art such as studies using Min (multiple intestinal neoplasia) mice. Alternatively, a colon tissue may be maintained in culture. Bareiss et ah, Histochem Cell Biol 129 795-804 (2008). The functional effects can be evaluated by many means known to those skilled in the art, e.g., microscopy for quantitative or qualitative measures of alterations in morphological features, measurement of changes in RNA or protein levels for other genes associated with bacteria differentially expressed in adenoma, measurement of RNA stability, identification of downstream or reporter gene expression (CAT, luciferase, β- gal, GFP, and the like), e.g., via chemiluminescence, fluorescence, colorimetric reactions, antibody binding, inducible markers, etc.
[0079] "Inhibitors," "activators," and "modulators" of the markers are used to refer to activating, inhibitory, or modulating molecules identified using in vitro and in vivo assays of the expression of genes hyper- or hypomethylated in adenoma, mutations associated with adenoma, or the translation proteins encoded thereby. Inhibitors, activators, or modulators also include naturally occurring and synthetic ligands, antagonists, agonists, antibodies, peptides, cyclic peptides, nucleic acids, antisense molecules, ribozymes, RNAi molecules, small organic molecules and the like. Such assays for inhibitors and activators include, e.g., (l)(a) the mRNA expression, or (b) proteins expressed by genes hyper- or hypomethylated in adenoma in vitro, in
cells, or cell extracts; (2) applying putative modulator compounds; and (3) determining the functional effects on activity, as described above.
[0080] Assays comprising in vivo measurement of bacterial profiles associated with a high risk of adenoma or CRC; or genes hyper- or hypomethylated in adenoma are treated with a potential activator, inhibitor, or modulator are compared to control assays without the inhibitor, activator, or modulator to examine the extent of inhibition. Controls (untreated) are assigned a relative activity value of 100%. Inhibition of a bacterial profile, or methylation, expression, or proteins encoded by genes hyper- or hypomethylated in adenoma is achieved when the activity value relative to the control is about 80%, preferably 50%, more preferably 25-0%. Activation of a bacterial profile or methylation, expression, or proteins encoded by genes hyper- or hypomethylated in adenoma is achieved when the activity value relative to the control (untreated with activators) is 1 10%, more preferably 150%, more preferably 200- 500% (i.e., two to five fold higher relative to the control), more preferably 1000-3000% higher.
[0081] The term "test compound" or "drug candidate" or "modulator" or grammatical equivalents as used herein describes any molecule, either naturally occurring or synthetic, e.g., protein, oligopeptide, small organic molecule, polysaccharide, peptide, circular peptide, lipid, fatty acid, siRNA, polynucleotide, oligonucleotide, etc., to be tested for the capacity to directly or indirectly modulate associated with adenoma. The test compound can be in the form of a library of test compounds, such as a combinatorial or randomized library that provides a sufficient range of diversity. Test compounds are optionally linked to a fusion partner, e.g., targeting compounds, rescue compounds, dimerization compounds, stabilizing compounds, addressable compounds, and other functional moieties. Conventionally, new chemical entities with useful properties are generated by identifying a test compound (called a "lead compound") with some desirable property or activity, e.g., inhibiting activity, creating variants of the lead compound, and evaluating the property and activity of those variant compounds. Often, high throughput screening ("HTS") methods are employed for such an analysis. The compound may be "small organic molecule" that is an organic molecule, either naturally occurring or synthetic, that has a molecular weight of more than about 50 daltons and less than about 2500 daltons, preferably less than about 2000 daltons, preferably between about 100 to about 1000 daltons, more preferably between about 200 to about 500 daltons.
5.2. Samples
[0082] The sample may be from a patient suspected of having adenoma or from a patient diagnosed with CRC. The biological sample may also be from a subject with an ambiguous
diagnosis in order to clarify the diagnosis. The sample may be obtained for the purpose of differential diagnosis, e.g., to confirm the diagnosis. The sample may also be obtained for the purpose of prognosis, i.e., determining the course of the disease and selecting primary treatment options. Tumor staging and grading are examples of prognosis. The sample may also be evaluated to select or monitor therapy, selecting likely responders in advance from non-responders or monitoring response in the course of therapy. In addition, the sample may be evaluated as part of post-treatment ongoing surveillance of patients who have had adenoma or CRC.
[0083] Biological samples may be obtained using any of a number of methods in the art. Examples of biological samples comprising bacteria include those obtained from excised biopsies, such as punch biopsies, shave biopsies, fine needle aspirates ("FNA"), or surgical excisions; or biopsy from non- cutaneous tissues such as lymph node tissue, mucosa, conjuctiva, or uvea, other embodiments. Representative biopsy techniques include, but are not limited to, mucosal biopsy, excisional biopsy, incisional biopsy, needle biopsy, surgical biopsy. A diagnosis or prognosis made by endoscopy or fluoroscopy can require a "core-needle biopsy" of the tumor mass, or a "fine-needle aspiration biopsy" which generally contains a suspension of cells from within the tumor mass.
[0084] A sample may also be a sample from a muscosal surface, such as a fecal or rectal swab sample, a blood and blood fractions or products (e.g., serum, plasma, platelets, red blood cells, white blood cells, circulating tumor cells isolated from blood, free DNA isolated from blood, and the like), sputum, lymph and tongue tissue, cultured cells, e.g., primary cultures, explants, and transformed cells, stool, urine, etc. A sample is typically obtained from a eukaryotic organism, most preferably a mammal such as a primate e.g., chimpanzee or human; cow; dog; cat; a rodent, e.g., guinea pig; rat; mouse; rabbit. Example 6.3 below shows rectal swab sample collection and and analysis.
[0085] Sample handling for bacterial analysis in stool samples is described in Wu et al. Sampling and pyrosequencing methods for characterizing bacterial communities in the human gut using 16S sequence tags. BMC Microbiology 10: 206 (2010), the contents of which is hereby incorporated by reference in its entirety. Commercially available kits include QIAamp DNA Stool Minikit (Cat#51504, Qiagen, Valencia, CA), PSP Spin Stool DNA Plus Kit (Cat#10381102, Invitek, Berlin, Germany), MoBio PowerSoil DNA Isolation Kit (Cat#12888-05, Mo Bio Laboratories, Carlsbad, CA).
[0086] A sample can be treated with a fixative such as Carnoy's fixative and embedded in paraffin ("FFPE") and sectioned for use in the methods of the invention. Alternatively, fresh or frozen tissue may be used. These cells may be fixed, e.g., in alcoholic solutions such as 100%
ethanol or 3: 1 methanol: acetic acid. Nuclei can also be extracted from thick sections of paraffin- embedded specimens to reduce truncation artifacts and eliminate extraneous embedded material. Typically, biological samples, once obtained, are harvested and processed prior to hybridization using standard methods known in the art. Such processing typically includes fixation in chloroform-acetic acid- alcohol based solution such as Carnoy's fixative and protease treatment.
5.2.1. Nucleic Acid Sequence Amplification and Detection
[0087] In many instances, it is desirable to amplify a nucleic acid sequence using any of several nucleic acid amplification procedures which are well known in the art. Specifically, nucleic acid amplification is the chemical or enzymatic synthesis of nucleic acid copies which contain a sequence that is complementary to a nucleic acid sequence being amplified (template). The methods and kits of the invention may use any nucleic acid amplification or detection methods known to one skilled in the art, such as those described in U.S. Pat. Nos. 5,525,462 (Takarada et al); 6, 1 14, 117 (Hepp et al); 6, 127, 120 (Graham et al); 6,344,317 (Urnovitz); 6,448,001 (Oku); 6,528,632 (Catanzariti et al); and PCT Pub. No. WO 2005/11 1209 (Nakajima et al); all of which are incorporated herein by reference in their entirety.
[0088] In some embodiments, the nucleic acids are amplified by PCR amplification using methodologies known to one skilled in the art. One skilled in the art will recognize, however, that amplification can be accomplished by any known method, such as polymerase chain reaction (PCR), ligase chain reaction (LCR), Q -replicase amplification, rolling circle amplification, transcription amplification, self-sustained sequence replication, nucleic acid sequence-based amplification (NASBA), each of which provides sufficient amplification. Branched-DNA technology may also be used to qualitatively demonstrate the presence of a sequence of the technology or to quantitatively determine the amount of this particular genomic sequence in a sample. Nolte reviews branched-DNA signal amplification for direct quantitation of nucleic acid sequences in clinical samples (Nolte, 1998, Adv. Clin. Chem. 33:201-235).
[0089] The PCR process is well known in the art and is thus not described in detail herein. For a review of PCR methods and protocols, see, e.g., Innis et al, eds., PCR Protocols, A Guide to Methods and Application. Academic Press, Inc., San Diego, Calif. 1990; U.S. Pat. No. 4,683,202 (Mullis); which are incorporated herein by reference in their entirety. PCR reagents and protocols are also available from commercial vendors, such as Roche Molecular Systems. PCR may be carried out as an automated process with a thermostable enzyme. In this process, the temperature of the reaction mixture is cycled through a denaturing region, a primer annealing region, and an
extension reaction region automatically. Machines specifically adapted for this purpose are commercially available.
[0090] Pyrosequencing is a nucleic acid sequencing method based on sequencing by synthesis, which relies on detection of a pyrophosphate released on nucleotide incorporation. Generally, sequencing by synthesis involves synthesizing, one nucleotide at a time, a DNA strand complimentary to the strand whose sequence is being sought. Study nucleic acids may be immobilized to a solid support, hybridized with a sequencing primer, incubated with DNA polymerase, ATP sulfurylase, luciferase, apyrase, adenosine 5' phosphsulfate and luciferin. Nucleotide solutions are sequentially added and removed. Correct incorporation of a nucleotide releases a pyrophosphate, which interacts with ATP sulfurylase and produces ATP in the presence of adenosine 5' phosphsulfate, fueling the luciferin reaction, which produces a chemiluminescent signal allowing sequence determination. Machines for pyrosequencing and methylation specific reagents are available from Qiagen, Inc. (Valencia, CA). An example of a system that can be used by a person of ordinary skill based on pyrosequencing generally involves the following steps: ligating an adaptor nucleic acid to a study nucleic acid and hybridizing the study nucleic acid to a bead; amplifying a nucleotide sequence in the study nucleic acid in an emulsion; sorting beads using a picoliter multiwell solid support; and sequencing amplified nucleotide sequences by pyrosequencing methodology (e.g., Nakano et ah, J. Biotech. 102, 1 17-124 (2003)). Such a system can be used to exponentially amplify amplification products generated by a process described herein, e.g., by ligating a heterologous nucleic acid to the first amplification product generated by a process described herein.
[0091] Amplified sequences may also be measured using the Agilent 2100 Bioanalyzer to quantify amplified PCR products prior to pooling and pyrosequencing, or invasive cleavage reactions such as the Invader® technology (Zou et ah, Association of Clinical Chemistry (AACC) poster presentation on July 28, 2010, "Sensitive Quantification of Methylated Markers with a Novel Methylation Specific Technology," available at www.exactsciences.com; and U.S. Pat. No. 7,011,944 (Prudent et ah) which are incorporated herein by reference in their entirety).
5.2.2. High Throughput and Single Molecule Sequencing Technology
[0092] Suitable next generation nucleic acid sequencing and detection technologies are widely available. Examples include the 454 Life Sciences platform (Roche, Branford, CT) (Margulies et ah Nature, 437, 376-380 (2005)); lllumina's Genome Analyzer, GoldenGate Methylation Assay, or Infinium Methylation Assays (Illumina, San Diego, CA; Bibkova et ah, 2006, Genome Res. 16, 383-393; U.S. Pat. Nos. 6,306,597 and 7,598,035 (Macevicz); 7,232,656 (Balasubramanian et
al.)); or DNA Sequencing by Ligation, SOLiD System (Applied Biosy stems/Life Technologies; U.S. Pat. Nos. 6,797,470, 7,083,917, 7, 166,434, 7,320,865, 7,332,285, 7,364,858, and 7,429,453 (Barany et al); or the Helicos True Single Molecule DNA sequencing technology (Harris et al, 2008 Science, 320, 106-109; U.S. Pat. Nos. 7,037,687 and 7,645,596 (Williams et al); 7, 169,560 (Lapidus et al); 7,769,400 (Harris)), the single molecule, real-time (SMRT™) technology of Pacific Biosciences, and sequencing (Soni and Meller, Clin. Chem. 53, 1996-2001 (2007)) which are incorporated herein by reference in their entirety. These systems allow the sequencing of many nucleic acid molecules isolated from a specimen at high orders of multiplexing in a parallel fashion (Dear, Brief Fund. Genomic Proteomic, 1(4), 397-416 (2003) and McCaughan and Dear, J. Pathol, 220, 297-306 (2010)). Each of these platforms allows sequencing of clonally expanded or non-amplified single molecules of nucleic acid fragments. Certain platforms involve, for example, (i) sequencing by ligation of dye-modified probes (including cyclic ligation and cleavage), (ii) pyrosequencing, and (iii) single-molecule sequencing.
[0093] Certain single-molecule sequencing embodiments are based on the principal of sequencing by synthesis, and utilize single-pair Fluorescence Resonance Energy Transfer (single pair FRET) as a mechanism by which photons are emitted as a result of successful nucleotide incorporation. The emitted photons often are detected using intensified or high sensitivity cooled charge-couple-devices in conjunction with total internal reflection microscopy ("TIRM"). Photons are only emitted when the introduced reaction solution contains the correct nucleotide for incorporation into the growing nucleic acid chain that is synthesized as a result of the sequencing process. In FRET based single-molecule sequencing or detection, energy is transferred between two fluorescent dyes, sometimes polymethine cyanine dyes Cy3 and Cy5, through long-range dipole interactions. The donor is excited at its specific excitation wavelength and the excited state energy is transferred, non-radiatively to the acceptor dye, which in turn becomes excited. The acceptor dye eventually returns to the ground state by radiative emission of a photon. The two dyes used in the energy transfer process represent the "single pair", in single pair FRET. Cy3 often is used as the donor fluorophore and often is incorporated as the first labeled nucleotide. Cy5 often is used as the acceptor fluorophore and is used as the nucleotide label for successive nucleotide additions after incorporation of a first Cy3 labeled nucleotide. The fluorophores generally are within 10 nanometers of each other for energy transfer to occur successfully. Bailey et al. recently reported a highly sensitive (15pg methylated DNA) method using quantum dots to detect methylation status using fluorescence resonance energy transfer (MS-qFRET)(Bailey et al. Genome Res. 19(8), 1455-1461 (2009), which is incorporated herein by reference in its entirety).
[0094] An example of a system that can be used based on single-molecule sequencing generally involves hybridizing a primer to a study nucleic acid to generate a complex; associating the complex with a solid phase; iteratively extending the primer by a nucleotide tagged with a fluorescent molecule; and capturing an image of fluorescence resonance energy transfer signals after each iteration (e.g., Braslavsky et al., PNAS 100(7): 3960-3964 (2003); U.S. Pat. No. 7,297,518 (Quake et al.) which are incorporated herein by reference in their entirety). Such a system can be used to directly sequence amplification products generated by processes described herein. In some embodiments the released linear amplification product can be hybridized to a primer that contains sequences complementary to immobilized capture sequences present on a solid support, a bead or glass slide for example. Hybridization of the primer-released linear amplification product complexes with the immobilized capture sequences, immobilizes released linear amplification products to solid supports for single pair FRET based sequencing by synthesis. The primer often is fluorescent, so that an initial reference image of the surface of the slide with immobilized nucleic acids can be generated. The initial reference image is useful for determining locations at which true nucleotide incorporation is occurring. Fluorescence signals detected in array locations not initially identified in the "primer only" reference image are discarded as non-specific fluorescence. Following immobilization of the primer-released linear amplification product complexes, the bound nucleic acids often are sequenced in parallel by the iterative steps of, a) polymerase extension in the presence of one fluorescently labeled nucleotide, b) detection of fluorescence using appropriate microscopy, TIRM for example, c) removal of fluorescent nucleotide, and d) return to step a with a different fluorescently labeled nucleotide.
[0095] The technology may be practiced with digital PCR. Digital PCR was developed by Kalinina and colleagues (Kalinina et al., Nucleic Acids Res. 25; 1999-2004 (1997)) and further developed by Vogelstein and Kinzler, Proc. Natl. Acad. Sci. U.S.A. 96; 9236-9241 (1999)). The application of digital PCR is described by Cantor et al. (PCT Pub. Nos. WO 2005/023091A2 (Cantor et al.); WO 2007/092473 A2, (Quake et al.)), which are hereby incorporated by reference in their entirety. Digital PCR takes advantage of nucleic acid (DNA, cDNA or RNA) amplification on a single molecule level, and offers a highly sensitive method for quantifying low copy number nucleic acid. Fluidigm® Corporation offers systems for the digital analysis of nucleic acids.
[0096] In some embodiments, nucleotide sequencing may be by solid phase single nucleotide sequencing methods and processes. Solid phase single nucleotide sequencing methods involve contacting sample nucleic acid and solid support under conditions in which a single molecule of sample nucleic acid hybridizes to a single molecule of a solid support. Such conditions can
include providing the solid support molecules and a single molecule of sample nucleic acid in a "microreactor." Such conditions also can include providing a mixture in which the sample nucleic acid molecule can hybridize to solid phase nucleic acid on the solid support. Single nucleotide sequencing methods useful in the embodiments described herein are described in PCT Pub. No. WO 2009/091934 (Cantor).
[0097] In certain embodiments, nanopore sequencing detection methods include (a) contacting a nucleic acid for sequencing ("base nucleic acid," e.g., linked probe molecule) with sequence-specific detectors, under conditions in which the detectors specifically hybridize to substantially complementary subsequences of the base nucleic acid; (b) detecting signals from the detectors and (c) determining the sequence of the base nucleic acid according to the signals detected. In certain embodiments, the detectors hybridized to the base nucleic acid are disassociated from the base nucleic acid (e.g., sequentially dissociated) when the detectors interfere with a nanopore structure as the base nucleic acid passes through a pore, and the detectors disassociated from the base sequence are detected.
[0098] A detector also may include one or more regions of nucleotides that do not hybridize to the base nucleic acid. In some embodiments, a detector is a molecular beacon. A detector often comprises one or more detectable labels independently selected from those described herein. Each detectable label can be detected by any convenient detection process capable of detecting a signal generated by each label (e.g., magnetic, electric, chemical, optical and the like). For example, a CD camera can be used to detect signals from one or more distinguishable quantum dots linked to a detector.
[0099] The invention encompasses any method known in the art for enhancing the sensitivity of the detectable signal in such assays, including, but not limited to, the use of cyclic probe technology (Bakkaoui et al., 1996, BioTechniques 20: 240-8, which is incorporated herein by reference in its entirety); and the use of branched probes (Urdea et al., 1993, Clin. Chem. 39, 725- 6; which is incorporated herein by reference in its entirety). The hybridization complexes are detected according to well-known techniques in the art.
[00100] Reverse transcribed or amplified nucleic acids may be modified nucleic acids. Modified nucleic acids can include nucleotide analogs, and in certain embodiments include a detectable label and/or a capture agent. Examples of detectable labels include, without limitation, fluorophores, radioisotopes, colorimetric agents, light emitting agents, chemiluminescent agents, light scattering agents, enzymes and the like. Examples of capture agents include, without limitation, an agent from a binding pair selected from antibody/antigen, antibody/antibody, antibody/antibody fragment, antibody/antibody receptor, antibody/protein A or protein G,
hapten/anti-hapten, biotin/avidin, biotin/streptavidin, folic acid/folate binding protein, vitamin B12/intrinsic factor, chemical reactive group/complementary chemical reactive group (e.g., sulfhydryl/maleimide, sulfhydryl/haloacetyl derivative, amine/isotriocyanate, amine/succinimidyl ester, and amine/sulfonyl halides) pairs, and the like. Modified nucleic acids having a capture agent can be immobilized to a solid support in certain embodiments.
5.2.3. Mass Spectroscopic Detection Methods
[00101] Another method for analyzing bacteria in samples is mass spectrometry. The assay can also be done in multiplex. Mass spectrometry is a particularly effective method for the detection of specific polypeptides or polynucleotides associated with bacteria. See for example, Identification of Microorganisms by Mass Spectrometry, Ed. Wilkons and Lay, Wiley- Interscience, 2006; U.S. Patent Nos. 7,070,739 (Anderson and Anderson); 6,177,266 (Krishnamurthy and Ross); PCT Pub Nos. WO 2010/062354 Al (Hyman et al); WO 2008/058024 A2 (Eckstein and Eckstein); WO 2001/079523 A2 (Pineda and Lin); European Patent Pub. No. EP 1437673 B l (Kallow et al); U.S. Patent Pub. No. US 2005/0142584 Al (Willson et al.); which are hereby incorporated by reference in their entirety.
5.2.4. Fluorescence in situ Hybridization (FISH)
[00102] In some examples, the invention may further encompass detecting and/or quantitating using fluorescence in situ hybridization (FISH) in a sample, preferably a tissue sample, obtained from a subject in accordance with the methods of the invention. FISH is a common methodology used in the art, especially in the detection of specific chromosomal aberrations in tumor cells, for example, to aid in diagnosis and tumor staging. As applied in the methods of the invention, it can be used to detect types and levels of bacteria. For reviews of FISH methodology, see, e.g., Harmsen et al, Appl Environ Microbiol 68 2982-2990 (2002); Kalliomaki et al, J Allerg Clin Immunol 107 129-134 (2001); Tkachuk et al, Genet. Anal. Tech. Appl. 8: 67-74 (1991); Trask et al, Trends Genet. 7 (5): 149-154 (1991); and Weier et al, Expert Rev. Mol. Diagn. 2 (2): 109-119 (2002); U.S. Pat. No. 6, 174,681 (Hailing et al); all of which are incorporated herein by reference in their entirety. Example 6.2 below shows FISH staining for Fusobacterium.
[00103] In alternative embodiments, the invention encompasses use of bacteria specific gene expression and/or antibody assays either in situ, i.e., directly upon tissue sections (fixed and/or frozen) of patient tissue obtained from biopsies or resections, such that no nucleic acid purification is necessary; or based on extracted and/or amplified nucleic acids. Targets for such assays are disclosed in Haqq et al, Proc. Nat. Acad. Sci. USA, 102(17), 6092-6097 (2005); Riker
et al, BMC Med. Genomics, 1, 13, pub. 28 April 2008; Hoek et al, Can. Res. 64, 5270-5282
(2004) ; PCT Pub. Nos. WO 2008/030986 and WO 2009/11 1661 (Kashani-Sabet & Haqq); U.S. Pat. No. 7,247,426 (Yakhini et al), all of which are incorporated herein by reference in their entirety. For in situ procedures see, e.g., Nuovo, G. J., 1992, PCR In Situ Hybridization : Protocols And Applications, Raven Press, NY, which is incorporated herein by reference in its entirety.
5.2.5. Microarrays
[00104] In some examples, DNA microarrays may used. Methods for making nucleic acid microarrays are known to the skilled artisan and are described, for example, in Lockhart et al, Nat. Biotech. 14, 1675-1680 (1996) Schena et al, Proc. Natl. Acad. Sci. USA, 93, 10614-10619 (1996), U.S. Pat. No. 5,837,832 (Chee et al) and PCT Pub. No. WO 00/56934 (Englert et al), herein incorporated by reference. Microarrays specific for gut microbes have been described, for example, Paliy et al Appl Environ Microbiol 75 3572-3579 (2009); Palmer et al. (2006); and Palmer et al. (2007), herein incorporated by reference. Additional examples of microarray analysis for bacteria include Al-Khaldi et al. Nutrition 20 32-38 (2004); Apte and Singh Methods Mol Biol 402:329-346 (2007); Cleven et al. J Clin Microbiol 44(7) 2389-2397(2006); Dols et al. Am J Obstet Gyn 204(4) 305.el-305.e7 (April 201 1); Franke-Whittle et al. Application of COMPOCHIP Microarray to Investigate the Bacterial Communities of Different Composts. Microbial Ecol 57(3) 510-521 (2009); Huyghe et al. Appl Environ Microbiol 74(6): 1876-85 (2008); Jarvinen et al. BMC Microbiol 9 161 (2009); Liu et al. Exp Biol Med 230(8) 587-591
(2005) ; Mao et al. Digestion 78 131-138 (2008); Pathak et al. Appl Microbiol Biotechnol 90(5) 1739-1754 (2011); Reyes-Lopez et al. Fingerprinting of prokaryotic 16S rRNA genes using oligodeoxyribonucleotide microarrays and virtual hybridization. Nucleic Acids Res 31 :779-789 (2003); Thomassen et al. Custom Design and Analysis of High-Density Oligonucleotide Bacterial Tiling Microarrays PLoS ONE 4(6): e5943. doi: 10.1371/journal.pone.0005943 (2009); Tissari et al. Lancet 375 224-230 (2010); PCT Publ. Nos. WO 2008/130394 (Andersen & Desantis) and WO 2010/151842 (Andersen et al); herein incorporated by reference. To produce a nucleic acid microarray, oligonucleotides may be synthesized or bound to the surface of a substrate using a chemical coupling procedure and an ink jet application apparatus, as described U.S. Pat. No. 6,015,880 (Baldeschweiler et al), incorporated herein by reference. Alternatively, a gridded array may be used to arrange and link cDNA fragments or oligonucleotides to the surface of a substrate using a vacuum system, thermal, UV, mechanical or chemical bonding procedure.
5.2.6. Antibody Staining/Detection
[00105] In some embodiments, the invention may encompass detecting and/or quantitating using antibodies either alone or in conjunction with measurement of bacterial nucleic acid levels. Antibodies are already used in current practice in the classification and/or diagnosis of bacteria.
[00106] Antibody reagents can be used in assays to detect expression levels of in patient samples using any of a number of immunoassays known to those skilled in the art. Immunoassay techniques and protocols are generally described in Price and Newman, "Principles and Practice of Immunoassay," 2nd Edition, Grove's Dictionaries, 1997; and Gosling, "Immunoassays: A Practical Approach," Oxford University Press, 2000. A variety of immunoassay techniques, including competitive and non-competitive immunoassays, can be used. See, e.g., Self et ah, 1996, Curr. Opin. Biotechnol. , 7, 60-65. The term immunoassay encompasses techniques including, without limitation, enzyme immunoassays (EIA) such as enzyme multiplied immunoassay technique (EMIT), enzyme-linked immunosorbent assay (ELISA), IgM antibody capture ELISA (MAC ELISA), and microparticle enzyme immunoassay (MEIA); capillary electrophoresis immunoassays (CEIA); radioimmunoassays (RIA); immunoradiometric assays (IRMA); fluorescence polarization immunoassays (FPIA); and chemiluminescence assays (CL). If desired, such immunoassays can be automated. Immunoassays can also be used in conjunction with laser induced fluorescence. See, e.g., Schmalzing et ah, 1997, Electrophoresis, 18, 2184- 2193; Bao, 1997, J. Chromatogr. B. Biomed. Set, 699, 463-480. Liposome immunoassays, such as flow-injection liposome immunoassays and liposome immunosensors, are also suitable for use in the present invention. See, e.g., Rongen et ah, 1997, J. Immunol. Methods, 204, 105-133. In addition, nephelometry assays, in which the formation of protein/antibody complexes results in increased light scatter that is converted to a peak rate signal as a function of the marker concentration, are suitable for use in the methods of the present invention. Nephelometry assays are commercially available from Beckman Coulter (Brea, CA) and can be performed using a Behring Nephelometer Analyzer (Fink et ah, 1989, J. Clin. Chem. Clin. Biochem., 27, 261-276).
[00107] Specific immunological binding of the antibody to nucleic acids can be detected directly or indirectly. Direct labels include fluorescent or luminescent tags, metals, dyes, radionuclides, and the like, attached to the antibody. An antibody labeled with iodine- 125 125I can be used. A chemiluminescence assay using a chemiluminescent antibody specific for the nucleic acid is suitable for sensitive, non-radioactive detection of protein levels. An antibody labeled with fluorochrome is also suitable. Examples of fluorochromes include, without limitation, DAPI, fluorescein, Hoechst 33258, R-phycocyanin, B-phycoerythrin, R- phycoerythrin, rhodamine, Texas red, and lissamine. Indirect labels include various enzymes well known in the art, such as
horseradish peroxidase (HRP), alkaline phosphatase (AP), β-galactosidase, urease, and the like. A horseradish-peroxidase detection system can be used, for example, with the chromogenic substrate tetramethylbenzidine (TMB), which yields a soluble product in the presence of hydrogen peroxide that is detectable at 450 nm. An alkaline phosphatase detection system can be used with the chromogenic substrate p-nitrophenyl phosphate, for example, which yields a soluble product readily detectable at 405 nm. Similarly, a β-galactosidase detection system can be used with the chromogenic substrate o-nitrophenyl-/3-D-galactopyranoside (ONPG), which yields a soluble product detectable at 410 nm. An urease detection system can be used with a substrate such as urea- bromocresol purple (Sigma Immunochemicals; St. Louis, MO).
[00108] A signal from the direct or indirect label can be analyzed, for example, using a spectrophotometer to detect color from a chromogenic substrate; a radiation counter to detect radiation such as a gamma counter for detection of 125I; or a fluorometer to detect fluorescence in the presence of light of a certain wavelength. For detection of enzyme-linked antibodies, a quantitative analysis can be made using a spectrophotometer such as an EMAX Microplate Reader (Molecular Devices; Menlo Park, CA) in accordance with the manufacturer's instructions. If desired, the assays of the present invention can be automated or performed robotically, and the signal from multiple samples can be detected simultaneously.
[00109] The antibodies can be immobilized onto a variety of solid supports, such as magnetic or chromatographic matrix particles, the surface of an assay plate (e.g., microtiter wells), pieces of a solid substrate material or membrane (e.g., plastic, nylon, paper), and the like. An assay strip can be prepared by coating the antibody or a plurality of antibodies in an array on a solid support. This strip can then be dipped into the test sample and processed quickly through washes and detection steps to generate a measurable signal, such as a colored spot. The antibodies may be in an array one or more antibodies, single or double stranded nucleic acids, proteins, peptides or fragments thereof, amino acid probes, or phage display libraries. Many protein/antibody arrays are described in the art. These include, for example, arrays produced by Ciphergen Biosystems (Fremont, CA), Packard Bioscience Company (Meriden CT), Zyomyx (Hayward, CA) and Phylos (Lexington, MA). Examples of such arrays are described in the following patents: U.S. Pat. Nos. 6,225,047 (Hutchens and Yip); 6,537,749 (Kuimelis and Wagner); and 6,329,209 (Wagner et ah), all of which are incorporated herein by reference in their entirety.
5.2.7. Fingerprinting Methods
[00110] In some examples, fingerprinting methods such as denaturing gradient gel electrophoresis (DGGE) or terminal restriction fragment length polymorphism (T-RFLP) may be
used. DGGE studies the electrophoretic migration patterns of PCR amplicons of bacterial sequences such as the V6-V8 regions of the 16S rRNA gene. Differences in the DGGE patterns can be used to identify the bacterial communities. In T-RFLP analysis, a bacterial gene is amplified by PCR, such as the 16S rRNA gene and digested with a series of restriction endonucleases. Based on the sequence of the 16S gene, fragments of differing lengths will be generated. Those restriction fragments will give rise to a distinctive pattern in a capillary sequencer or gel electrophoresis. For DGGE, see Zoetendal et al, Appl Environ Microbiol 68 3401-3407 (2002), for T-RFLP, see Li et al, J Microbiol Methods 68 303-31 1 (2007); Osborn et al, Environ Microbiol 2 39-50 (2000); and Shen, X.J., et al. Gut Microbes 1, 138-147 (2010), incorporated herein by reference.
5.3. Compositions and Kits
[00111] The invention provides compositions and kits for detecting and/or measuring types and levels of bacteria using DNA assays, antibodies specific for the polypeptides or nucleic acids specific for the polynucleotides. Kits for carrying out the diagnostic assays of the invention typically include, a suitable container means, (i) a probe that comprises an antibody or nucleic acid sequence that specifically binds to the marker polypeptides or polynucleotides of the invention; (ii) a label for detecting the presence of the probe; and (iii) instructions for how to measure the type and level of a particular bacteria (or polypeptide or polynucleotide). The kits may include several antibodies or polynucleotide sequences encoding polypeptides of the invention, e.g., a a first antibody and/or second and/or third and/or additional antibodies that recognize a protein associated with a particular bacteria. The container means of the kits will generally include at least one vial, test tube, flask, bottle, syringe and/or other container into which a first antibody specific for one of the polypeptides or a first nucleic acid specific for one of the polynucleotides of the present invention may be placed and/or suitably aliquoted. Where a second and/or third and/or additional component is provided, the kit will also generally contain a second, third and/or other additional container into which this component may be placed. Alternatively, a container may contain a mixture of more than one antibody or nucleic acid reagent, each reagent specifically binding a different marker in accordance with the present invention. The kits of the present invention will also typically include means for containing the antibody or nucleic acid probes in close confinement for commercial sale. Such containers may include injection and/or blow-molded plastic containers into which the desired vials are retained.
[00112] The kits may further comprise positive and negative controls, as well as instructions for the use of kit components contained therein, in accordance with the methods of the present invention.
5.4. In Vivo Imaging
[00113] The various markers of the invention also provide reagents for in vivo imaging such as, for instance, the imaging of adenoma specific bacteria using labeled reagents that detect (i) nucleic acids associated with particular bacteria, (ii) a polypeptides associated with a particular bacteria. In vivo imaging techniques may be used, for example, as guides for surgical resection or to detect the distant spread of CRC. For in vivo imaging purposes, reagents that detect the presence of these proteins or genes, such as antibodies, may be labeled with a positron-emitting isotope (e.g., 18F) for positron emission tomography (PET), gamma-ray isotope (e.g., 99mTc) for single photon emission computed tomography (SPECT), a paramagnetic molecule or nanoparticle (e.g.,Gd3+ chelate or coated magnetite nanoparticle) for magnetic resonance imaging (MRI), a near-infrared fluorophore for near- infra red (near-IR) imaging, a luciferase (firefly, bacterial, or coelenterate), green fluorescent protein, or other luminescent molecule for bioluminescence imaging, or a perfluorocarbon- filled vesicle for ultrasound.
[00114] Furthermore, such reagents may include a fluorescent moiety, such as a fluorescent protein, peptide, or fluorescent dye molecule. Common classes of fluorescent dyes include, but are not limited to, xanthenes such as rhodamines, rhodols and fluoresceins, and their derivatives; bimanes; coumarins and their derivatives such as umbelliferone and aminomethyl coumarins; aromatic amines such as dansyl; squarate dyes; benzofurans; fluorescent cyanines; carbazoles; dicyanomethylene pyranes, polymethine, oxabenzanthrane, xanthene, pyrylium, carbostyl, perylene, acridone, quinacridone, rubrene, anthracene, coronene, phenanthrecene, pyrene, butadiene, stilbene, lanthanide metal chelate complexes, rare-earth metal chelate complexes, and derivatives of such dyes. Fluorescent dyes are discussed, for example, in U.S. Pat. Nos. 4,452,720 (Harada et al); 5,227,487 (Haugland and Whitaker); and 5,543,295 (Bronstein et al). Other fluorescent labels suitable for use in the practice of this invention include a fluorescein dye. Typical fluorescein dyes include, but are not limited to, 5- carboxyfluorescein, fluorescein-5- isothiocyanate, and 6-carboxyfluorescein; examples of other fluorescein dyes can be found, for example, in U.S. Pat. Nos. 4,439,356 (Khanna and Colvin); 5,066,580 (Lee), 5,750,409 (Hermann et al); and 6,008,379 (Benson et al). The kits may include a rhodamine dye, such as, for example, tetramethylrhodamine-6-isothiocyanate, 5- carboxytetramethylrhodamine, 5-carboxy rhodol derivatives, tetramethyl and tetraethyl rhodamine, diphenyldimethyl and diphenyldiethyl
rhodamine, dinaphthyl rhodamine, rhodamine 101 sulfonyl chloride (sold under the tradename of TEXAS RED®, and other rhodamine dyes. Other rhodamine dyes can be found, for example, in U.S. Pat. Nos. 5,936,087 (Benson et al), 6,025,505 (Lee et al); 6,080,852 (Lee et al). The kits may include a cyanine dye, such as, for example, Cy3, Cy3B, Cy3.5, Cy5, Cy5.5, Cy7. Phosphorescent compounds including porphyrins, phthalocyanines, polyaromatic compounds such as pyrenes, anthracenes and acenaphthenes, and so forth, may also be used.
5.5. Methods to Identify Compounds
[00115] A variety of methods may be used to identify compounds that modulate the growth of adenomas and prevent or treat adenocarcinoma progression. Typically, an assay that provides a readily measured parameter is adapted to be performed in the wells of multi-well plates in order to facilitate the screening of members of a library of test compounds as described herein. Thus, in one embodiment, an appropriate number of cells can be plated into the cells of a multi-well plate, and the effect of a test compound on bacteria associated with adenoma can be determined. The compounds to be tested can be any small chemical compound, or a macromolecule, such as a protein, sugar, nucleic acid or lipid. Typically, test compounds will be small chemical molecules and peptides. Essentially any chemical compound can be used as a test compound in this aspect of the invention, although most often compounds that can be dissolved in aqueous or organic (especially DMSO-based) solutions are used. The assays are designed to screen large chemical libraries by automating the assay steps and providing compounds from any convenient source to assays, which are typically run in parallel (e.g., in microtiter formats on microtiter plates in robotic assays). It will be appreciated that there are many suppliers of chemical compounds, including Sigma (St. Louis, MO), Aldrich (St. Louis, MO), Sigma- Aldrich (St. Louis, MO), Fluka Chemika-Biochemica Analytika (Buchs Switzerland) and the like.
[00116] In one preferred embodiment, high throughput screening methods are used which involve providing a combinatorial chemical or peptide library containing a large number of potential therapeutic compounds. Such "combinatorial chemical libraries" or "ligand libraries" are then screened in one or more assays, as described herein, to identify those library members (particular chemical species or subclasses) that display a desired characteristic activity. In this instance, such compounds are screened for their ability to modulate the expression patterns of bacteria differentially detected in adenoma. A combinatorial chemical library is a collection of diverse chemical compounds generated by either chemical synthesis or biological synthesis, by combining a number of chemical "building blocks" such as reagents. For example, a linear combinatorial chemical library such as a polypeptide library is formed by combining a set of
chemical building blocks (amino acids) in every possible way for a given compound length (i.e., the number of amino acids in a polypeptide compound). Millions of chemical compounds can be synthesized through such combinatorial mixing of chemical building blocks.
[00117] Preparation and screening of combinatorial chemical libraries are well known to those of skill in the art. Such combinatorial chemical libraries include, but are not limited to, peptide libraries (see, e.g., U.S. Pat. No. 5,010,175 (Rutter and Santi), Furka, Int. J. Pept. Prot. Res., 37:487-493 (1991); and Houghton et al, Nature, 354:84-88 (1991)). Other chemistries for generating chemical diversity libraries can also be used. Such chemistries include, but are not limited to: U.S. Pat. Nos. 6,075, 121 (Bartlett et al.) peptoids; 6,060,596 (Lerner et al.) encoded peptides; 5,858,670 (Lam et al.) random bio-oligomers; 5,288,514 (Ellman) benzodiazepines; 5,539,083 (Cook et al.) peptide nucleic acid libraries; 5,593,853 (Chen and Radmer) carbohydrate libraries; 5,569,588 (Ashby and Rine) isoprenoids; 5,549,974 (Holmes) thiazolidinones and metathiazanones; 5,525,735 (Takarada et al.) and 5,519, 134 (Acevado and Hebert) pyrrolidines; 5,506,337 (Summerton and Weller) morpholino compounds; 5,288,514 (Ellman) benzodiazepines; diversomers such as hydantoins, benzodiazepines and dipeptides (Hobbs et al, 1993, Proc. Nat. Acad. Sci. USA, 90, 6909-6913), vinylogous polypeptides (Hagihara et al., 1992, J. Amer. Chem. Soc., 114, 6568), nonpeptidal peptidomimetics with glucose scaffolding (Hirschmann et al., 1992, J. Amer. Chem. Soc, 1 14, 9217-9218), analogous organic syntheses of small compound libraries (Chen et al., 1994, J. Amer. Chem. Soc, 116:2661 (1994)), oligocarbamates (Cho et al., 1993, Science, 261, 1303 (1993)), and/or peptidyl phosphonates (Campbell et al., 1994, J. Org. Chem., 59:658), nucleic acid libraries (see Ausubel, Berger and Sambrook, all supra); antibody libraries (see, e.g., Vaughn et al., 1996, Nat. Biotech., 14(3):309- 314, carbohydrate libraries, e.g., Liang et al., 1996, Science, 274: 1520-1522, small organic molecule libraries (see, e.g., benzodiazepines, Baum, 1993, C&EN, Jan 18, page 33. Devices for the preparation of combinatorial libraries are commercially available (see, e.g., 357 MPS, 390 MPS, Advanced Chem Tech, Louisville KY, Symphony, Rainin, Woburn, MA, 433 A Applied Biosystems, Foster City, CA, 9050 Plus, Millipore, Bedford, MA). In addition, numerous combinatorial libraries are themselves commercially available (see, e.g., ComGenex (Princeton, NJ), Asinex (Moscow, RU), Tripos, Inc. (St. Louis, MO), ChemStar, Ltd., (Moscow, RU), 3D Pharmaceuticals (Exton, PA), Martek Biosciences (Columbia, MD), etc.).
[00118] Methylation modifiers are known and have been the basis for several approved drugs. Major classes of enzymes are DNA methyl transferases (DNMTs), histone deacetylases (HDACs), histone methyl transferases (HMTs), and histone acetylases (HATs). DNMT inhibitors azacitidine (Vidaza®) and decitabine have been approved for myelodysplastic syndromes (for a
review see Musolino et al, Eur. J. Haematol. 84, 463-473 (2010); Issa, Hematol. Oncol. Clin. North Am. 24(2), 317-330 (2010); Howell et al, Cancer Control, 16(3) 200-218 (2009); which are hereby incorporated by reference in their entirety). HDAC inhibitor, vorinostat (Zolinza®, SAHA) has been approved by FDA for treating cutaneous T-cell lymphoma (CTCL) for patients with progressive, persistent, or recurrent disease (Marks and Breslow, Nat. Biotech. 25(1), 84-90 (2007)). Specific examples of compound libraries include: DNA methyl transferase (DNMT) inhibitor libraries available from Chem Div (San Diego, CA); cyclic peptides (Nauman et al, ChemBioChem 9, 194 - 197 (2008)); natural product DNMT libraries (Medina-Franco et al, Mol. Divers., 15(2):293-304 (2010)); HDAC inhibitors from a cyclic a3 β-tetrapeptide library (Olsen and Ghadiri, J. Med. Chem. 52(23), 7836-7846 (2009)); HDAC inhibitors from chlamydocin (Nishino et al, Amer. Peptide Symp. 9(7), 393-394 (2006)).
5.6. Methods of Inhibition Using Nucleic Acids
[00119] A variety of nucleic acids, such as antisense nucleic acids, siRNAs or ribozymes, may be used to inhibit the function of the markers of this invention. Ribozymes that cleave mRNA at site-specific recognition sequences can be used to destroy target mRNAs, particularly through the use of hammerhead ribozymes. Hammerhead ribozymes cleave mRNAs at locat ions dictated by flanking regions that form complementary base pairs with the target mRNA. Preferably, the target mRNA has the following sequence of two bases: 5'- UG-3'. The construction and production of hammerhead ribozymes is well known in the art.
[00120] The following Examples further illustrate the invention and are not intended to limit the scope of the invention.
6. EXAMPLES
6.1. Microbial Signature Associated with Adenoma and CRC
[00121] 454 titanium pyrosequencing of the V1-V2 region of thel6S rRNA gene was used to characterize adherent bacterial communities from mucosal biopsies of 33 adenoma subjects and 38 non-adenoma subjects. 87 taxa (including known pathogens) were found that had significantly higher relative abundances in cases vs. controls while only 5 taxa were more abundant in control samples. In addition adenoma samples had a pronounced increase in average microbial richness suggesting that conditions associated with colorectal adenomas create an environment in which potentially pathogenic microbes can flourish. Intriguingly, the magnitude of the differences between adenoma case and control in the gut microbiota was more pronounced than differences in the microbiota associated with patient obesity. Because the microbial signature associated with
colorectal adenomas is generally distinct from microbial signatures associated with known risk factors such as increased body mass index (BMI), these results suggest that detection gut microbiota has potential utility as a diagnostic tool indicating the presence of adenomas.
[00122] One aim of this study was to use high throughput pyrosequencing approaches to explore the microbiome of the distal gut in individuals who have colorectal adenomas compared to a control group of individuals without adenomas. Associations of the microbiota with Body Mass Index (BMI) and Waist-to-Hip Ratio (WHR), which are known risk factors for colorectal cancer, were also evaluated. Caan, B.J., et al. Body size and the risk of colon cancer in a large case-control study. Int J Obes Relat Metab Disord 22, 178-184 (1998).
[00123] To evaluate associations between the gut microbiota and the presence of adenomas, mucosal biopsies were collected from the same region (-10-12 cm regions from the anal verge) from 33 adenoma subjects and 38 controls. One analyses looked at global signatures of the entire microbial community. At the phylum, genus and Operational Taxonomic Unit (OTU) levels significant differences were found in richness (i.e. the number of taxa present in a sample), but no differences in evenness (i.e. how evenly distributed taxa are within a sample), between cases and controls (Figures 1, 3 & 4). In order to see whether case samples cluster separately from control samples, UniFrac was used to cluster the sequences based on their placement in the phylogenetic tree shown in Figure 2. Lozupone C, Knight R. UniFrac: a new phylogenetic method for comparing microbial communities. Appl Environ Microbiol 71 :8228-35 (2005). Running 100 permutations on the abundance weighted tree using the UniFrac significance test resulted in a p- value of 0.02 suggesting a marginally significant separation between cases and controls when considering all of the nodes of the phylogenetic tree. Similarly, weak clustering was seen when principle co-ordinate analysis (PCoA) was used on the same tree using FastUnifrac (Figure 5).
[00124] Many individual bacterial taxa were different between cases and controls. By examining the results of the Ribosomal Database Project ("RDP") classification algorithm at the phylum level at a 10% false discovery rate ("FDR") threshold cases had higher relative abundance of TM7, Cyanobacteria and Verrucomicrobia compared to controls (Table 1). Wang Q, Garrity GM, Tiedje JM, Cole JR. Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Appl Environ Microbiol 2007; 73 :5261-7.
[00125] Table 1: Wilcoxon-tests on log-normalized abundances of all phyla in cases (33 subjects) vs. controls (38 subjects). Only phyla which have at least 1 sequence assigned to them in 25% of the samples are shown. The direction of change shows the relative abundance in cases compared to controls. Wilcoxon p-Values were corrected for multiple testing using (n*p)/R where n= total number of taxa tested, p= raw p-Value and R= sorted Rank of the taxon. Benjamini, Y. &
Hochberg, Y. A Practical and Powerful Approach to Multiple Testing. J Royal Statistical Soc Series B (Methodological) Vol. 57, 12 (1995).
TABLE 1
[00126] *While the sequences classified to Cyanobacteria may in fact originate from plastids or from non-Cyanobacteria, other human and animal gut studies have also observed sequences classified to Cyanobacteria. Ley, R.E., et al. Obesity alters gut microbial ecology. Proc Natl Acad Sci USA 102, 1 1070-11075 (2005).
[00127] At the genus level, the relative abundance levels of 24 genera including Acidovorax, Aquabacterium, Cloacibacterium, Helicobacter, Lactococcus, Lactobacillus and Pseudomonas were higher in case vs. control (Table 2).
[00128] Table 2: Wilcoxon-tests on log-normalized abundances of genera in cases (33 subjects) vs. controls (38 subjects). Only genera which have at least 1 sequence assigned to them in 25% of the samples are shown. The direction of change shows the relative abundance in cases compared to controls. Wilcoxon p-Values were corrected for multiple testing using (n*p)/R where n= total number of taxa tested, p= raw p-Value and R= sorted Rank of the taxon. Benjamini & Hochberg (1995).
TABLE 2
Stenotrophomonas 0.00171 10 0.01709 Up
Succinivibrio 0.00261 11 0.02374 Up
Azonexus 0.00324 12 0.02702 Up
Leuconostoc 0.00326 13 0.02504 Up
Delftia 0.00385 14 0.02752 Up
Dechloromonas 0.00401 15 0.02673 Up
Akkermansia 0.00595 16 0.03717 Up
Bryantella 0.00682 17 0.04012 Up
Acinetobacter 0.00711 18 0.03947 Up
Agrobacterium 0.00882 19 0.04643 Up
Streptococcus 0.01006 20 0.05028 Down
Bacillaceae_l 0.01384 21 0.06590 Up
Allobaculum 0.01408 22 0.06400 Up
Serratia 0.01620 23 0.07044 Up
Rubrobacterineae 0.01729 24 0.07206 Up
Chryseobacterium 0.01947 25 0.07788 Up
Micrococcineae 0.01948 26 0.07493 Up
Panto ea 0.02126 27 0.07873 Up
Gp2 0.02315 28 0.08267 Up
Pseudomonas 0.02367 29 0.08161 Up
Exiguobacterium 0.02493 30 0.08310 Up
Gpl 0.02806 31 0.09051 Up
Pseudoxanthomonas 0.04403 32 0.13759 Up
Dorea 0.04758 33 0.14418 Down
Novosphingobium 0.04910 34 0.14441 Up
Sutterella 0.05041 35 0.14403 Up
Bifidobacteriaceae 0.05077 36 0.14102 Down
Chryseomonas 0.05792 37 0.15654 Up
Comamonas 0.07497 38 0.19730 Up
Camobacteriaceae_l 0.07831 39 0.20080 Up
Alistipes 0.08070 40 0.20175 Up
Bacteroides 0.09360 41 0.22829 Down
Staphylococcus 0.10208 42 0.24304 Up
Variovorax 0.10572 43 0.24585 Up
Flavimonas 0.11058 44 0.25131 Up
Shinella 0.12952 45 0.28783 Up
Syntrophococcus 0.13651 46 0.29676 Up
Methylobacterium 0.13766 47 0.29290 Up
Roseburia 0.15451 48 0.32189 Up
Enterobacter 0.15715 49 0.32072 Up
Erwinia 0.16696 50 0.33392 Up
Rheinheimera 0.17078 51 0.33486 Down
Prevotella 0.19727 52 0.37936 Up
Succinispira 0.20400 53 0.38491 Up
Pedobacter 0.23060 54 0.42704 Up
Fusobacterium 0.23880 55 0.43419 Up
Sphingomonas 0.25308 56 0.45192 Up
Bradyrhizobium 0.25361 57 0.44492 Down
Propionibacterineae 0.26446 58 0.45596 Up
Burkholderia 0.26620 59 0.45119 Up
Veillonella 0.28595 60 0.47659 Down
Vibrio 0.28683 61 0.47022 Down
Papillibacter 0.28810 62 0.46468 Up
Marinomonas 0.31275 63 0.49643 Down
Bilophila 0.40399 64 0.63123 Up
Gemella 0.40841 65 0.62832 Up
Enhydrobacter 0.44562 66 0.67518 Up
Anaerococcus 0.45866 67 0.68456 Up
Pseudoalteromonas 0.47369 68 0.69660 Down
Finegoldia 0.49275 69 0.71413 Down
Haemophilus 0.49499 70 0.70712 Down
Butyrivibrio 0.52466 71 0.73896 Up
Coprococcus 0.53663 72 0.74532 Up
Clostridiaceae_l 0.57343 73 0.78553 Up
Ruminococcaceae_Incertae_Sedis 0.59101 74 0.79867 Up
Paracoccus 0.61333 75 0.81777 Up
Anaerotruncus 0.64579 76 0.84973 Down
Parabacteroides 0.64883 77 0.84264 Up
Lachno spirac eae_Inc ertae_S edis 0.68417 78 0.87714 Up
Citrobacter 0.68862 79 0.87167 Up
Coprobacillus 0.69082 80 0.86352 Down
Desulfovibrio 0.71148 81 0.87837 Down
Shigella 0.72933 82 0.88943 Down
Actinomycineae 0.74703 83 0.90004 Down
Uruburuella 0.75252 84 0.89586 Down
Corynebacterineae 0.78329 85 0.92152 Down
Megamonas 0.84097 86 0.97787 Down
Aeromonas 0.85775 87 0.98592 Down
Holdemania 0.86825 88 0.98665 Up
Subdoligranulum 0.87174 89 0.97948 Up
Coriobacterineae 0.87710 90 0.97456 Down
Ralstonia 0.88637 91 0.97403 Up
Erysipelotrichaceae_Incertae_Sedis 0.89520 92 0.97304 Up
Allomonas 0.91827 93 0.98739 Down
Peptostreptococcaceae_Incertae_Sedis 0.93100 94 0.99043 Up
Brevundimonas 0.94692 95 0.99676 Down
Camobacteriaceae_2 0.94786 96 0.98736 Up
Anaerovorax 0.96308 97 0.99286 Down
Faecalibacterium 0.97701 98 0.99695 Up
Ruminococcus 0.98616 99 0.99612 Up
Dialister 0.99025 100 0.99025 Up
[00129] Remarkably, only one genus, Streptococcus, had a higher relative abundance in the control group. In other words, Streptococcus was down-regulated in the cases with a statistical significance of p < 0.05. In order to validate these pyrosequencing results, qPCR assays were prepared for a subset of observed genera that were significantly different in their relative abundances between cases and controls (i.e., Helicobacter spp, Acidovorax spp and Cloacibacteria spp.). The two methods correlated as expected (Figure 6), validating the pyrosequencing results.
[00130] Operational Taxonomic Units (OTUs), which are clusters of sequences in which the average percent identity of all of the sequences within a cluster is >=97%, were analyzed. At the OTU level at a 10% false discovery rate threshold 87 OTUs were found with significantly higher relative abundance in cases vs. controls and only 5 OTUs higher in controls (Table 3).
[00131] Table 3: Wilcoxon-tests on log-normalized abundances of OTUs (97%) in cases (33 subjects) vs. controls (38 subjects). Only OTUs which have at least 1 sequence assigned to them in 25% of the samples are shown. RDP classification of consensus sequences at genus level shown. Wilcoxon p-Values were corrected for multiple testing using (n*p)/R where n = total number of taxa tested, p = raw p-Value and R = sorted Rank of the taxon. Benjamini & Hochberg
(1995).
TABLE 3
OTU109 0.001008 19 0.019674 Up Turicibacter
OTU100 0.001258 20 0.023329 Up Xylanibacter
OTU122 0.001335 21 0.023579 Up Prevotella
OTU46 0.001398 22 0.023569 Up Bacillaceae 1
OTU525 0.001497 23 0.024146 Up Catonella
OTU70 0.001582 24 0.02446 Up Sphingobium
OTU91 0.001641 25 0.024351 Up Lactobacillus
OTU75 0.001703 26 0.024306 Up Stenotrophomonas
OTU328 0.00179 27 0.02459 Up Parasporobacterium
OTU309 0.002063 28 0.027333 Up Paludibacter
OTU230 0.002084 29 0.026658 Up Butyri vibrio
OTU371 0.002129 30 0.02633 Up Comamonas
OTU177 0.002213 31 0.026484 Up Butyri vibrio
OTU136 0.002304 32 0.026712 Up Micrococcineae
OTU357 0.002384 33 0.026803 Up Coprococcus
OTU387 0.002449 34 0.026723 Up Coprococcus
OTU124 0.002547 35 0.026996 Up Lactobacillus
OTU38 0.002829 36 0.029152 Up Pseudomonas
OTU56 0.002884 37 0.028914 Up Delftia
OTU202 0.002913 38 0.028437 Up Lachnospiraceae Incertae Sedis
OTU133 0.002963 39 0.028182 Up Faecalibacterium
OTU242 0.003059 40 0.028371 Up Coriobacterineae
OTU189 0.00349 41 0.031576 Up Acidovorax
OTU439 0.003755 42 0.033171 Down Algibacter
OTU265 0.003802 43 0.032805 Up Sphingomonas
OTU139 0.003893 44 0.032827 Up Azonexus
OTU95 0.004005 45 0.03302 Up Ruminococcus
OTU23 0.004051 46 0.032674 Up Lachnospiraceae Incertae Sedis
OTU59 0.004084 47 0.032241 Up Acinetobacter
OTU502 0.004279 48 0.033077 Up Paludibacter
OTU64 0.004323 49 0.032735 Up Erwinia
OTU454 0.004669 50 0.034641 Up Paludibacter
OTU286 0.005422 51 0.039446 Up Hallella
OTU464 0.005427 52 0.038721 Up Marinilabilia
OTU161 0.006285 53 0.043997 Up Prevotella
OTU423 0.007065 54 0.048543 Up Parasporobacterium
OTU53 0.007612 55 0.051345 Up Succinivibrio
OTU239 0.007843 56 0.051957 Up Succinispira
OTU319 0.008701 57 0.056633 Up Agrobacterium
OTU193 0.008755 58 0.056004 Up Xylanibacter
OTU61 0.009098 59 0.057207 Up Papillibacter
OTU365 0.009827 60 0.060762 Up Succinispira
OTU437 0.010114 61 0.061514 Up Marinilabilia
OTU225 0.010608 62 0.063477 Up Prevotella
OTU366 0.01081 63 0.063657 Up Coprococcus
OTU92 0.01095 64 0.063478 Up Rubrobacterineae
OTU463 0.01103 65 0.062958 Up Lachnospiraceae Incertae Sedis
OTU97 0.011294 66 0.063484 Up Pseudomonas
OTU21 0.011865 67 0.065699 Up Finegoldia
OTU149 0.012682 68 0.069192 Down Haemophilus
OTU241 0.013048 69 0.070156 Up Chryseobacterium
OTU250 0.013254 70 0.070246 Up Paludibacter
OTU210 0.013651 71 0.071332 Up Allobaculum
OTU347 0.013893 72 0.071586 Down Vitellibacter
OTU191 0.014678 73 0.074597 Up Subdoligranulum
OTU404 0.014845 74 0.074425 Up Hallella
OTU396 0.014935 75 0.073878 Up Coprococcus
OTU345 0.01502 76 0.073319 Up Butyri vibrio
OTU401 0.015426 77 0.074324 Up Alistipes
OTU67 0.015821 78 0.075251 Up Lactobacillus
OTU407 0.016533 79 0.077644 Up Turicibacter
OTU313 0.016785 80 0.077842 Up Enterobacter
OTU353 0.017139 81 0.0785 Up Dorea
OTU418 0.019841 82 0.08977 Up Stenotrophomonas
OTU393 0.020465 83 0.091478 Up Micrococcineae
OTU120 0.020843 84 0.092056 Up Micrococcineae
OTU413 0.021269 85 0.092833 Up Subdoligranulum
OTU341 0.021427 86 0.092433 Up Prevotella
OTU93 0.021869 87 0.093258 Up Alistipes
OTU186 0.022338 88 0.094173 Up Faecalibacterium
OTU79 0.022545 89 0.093981 Up Lachnospiraceae Incertae Sedis
OTU197 0.023847 90 0.098304 Up Lactobacillus
OTU219 0.024265 91 0.098928 Up Rikenella
OTU86 0.02429 92 0.097951 Up Fusobacterium
OTU297 0.0273 93 0.108905 Up Bacillaceae 1
OTU442 0.02802 94 0.110588 Up Roseburia
OTU389 0.028617 95 0.111759 Up Parabacteroides
OTU352 0.028801 96 0.111304 Down Saprospira
OTU49 0.031048 97 0.118749 Up Sutterella
OTU329 0.032674 98 0.123693 Down Methanohalobium
OTU176 0.033016 99 0.123727 Up Erwinia
OTU484 0.033734 100 0.125152 Down Effluviibacter
OTU569 0.033751 101 0.123975 Up Erwinia
OTU66 0.034683 102 0.126152 Down Streptococcus
OTU391 0.03501 103 0.126103 Up Aquiflexum
OTU356 0.036933 104 0.131753 Up Novosphingobium
OTU11 0.041357 105 0.146129 Up Bacteroides
OTU330 0.04391 106 0.153686 Up Coriobacterineae
OTU361 0.04391 107 0.152249 Up Succinivibrio
OTU113 0.044104 108 0.151507 Up Rikenella
OTU45 0.04423 109 0.150544 Down Xenohaliotis
OTU471 0.045642 110 0.153937 Up Lachnospiraceae Incertae Sedis
OTU247 0.047313 111 0.158135 Up Xylanibacter
OTU283 0.050651 112 0.16778 Up Anaerophaga
OTU128 0.055374 113 0.181802 Up Prevotella
OTU270 0.056309 114 0.183252 Up Succinispira
OTU57 0.061822 115 0.199442 Down Lachnospiraceae Incertae Sedis
OTU77 0.06775 116 0.216684 Up Coprococcus
OTU138 0.068101 117 0.215945 Down Simkania
OTU491 0.068451 118 0.215214 Up Clostridiaceae 1
OTU169 0.069264 119 0.215941 Down Streptococcus
OTU207 0.070648 120 0.218419 Up Succinispira
OTU237 0.072858 121 0.223392 Up Prevotella
OTU499 0.075097 122 0.22837 Down Lachnospiraceae Incertae Sedis
OTU14 0.07526 123 0.227004 Up Erysipelotrichaceae Incertae Sedis
OTU417 0.07743 124 0.231665 Up Lachnobacterium
OTU111 0.080236 125 0.23814 Up Peptostreptococcaceae Incertae
Sedis
OTU322 0.080575 126 0.237249 Up Roseburia
OTU244 0.081081 127 0.236857 Up Prevotella
OTU350 0.083008 128 0.240595 Up Coprococcus
OTU159 0.084952 129 0.244319 Up Faecalibacterium
OTU224 0.088054 130 0.251292 Up Prevotella
OTU338 0.09269 131 0.262503 Up Micrococcineae
OTU376 0.093281 132 0.262177 Up Methylobacterium
OTU254 0.093506 133 0.260833 Down Lachnospiraceae Incertae Sedis
OTU36 0.094305 134 0.261099 Up Bacteroides
OTU8 0.095901 135 0.263551 Down Dorea
OTU326 0.096151 136 0.262295 Down Lachnospiraceae Incertae Sedis
OTU282 0.104442 137 0.282832 Down Streptococcus
OTU264 0.107146 138 0.288052 Up Comamonas
OTU26 0.11087 139 0.29592 Down Dorea
OTU137 0.1132 140 0.299979 Up Prevotella
OTU222 0.116058 141 0.305373 Up Prevotella
OTU85 0.117436 142 0.306821 Up Bacteroides
OTU397 0.12782 143 0.331617 Up Peptostreptococcaceae Incertae
Sedis
OTU167 0.129522 144 0.333699 Up Allobaculum
OTU420 0.13338 145 0.341269 Up Dorea
OTU474 0.13338 146 0.338931 Up Sphingobium
OTU29 0.137289 147 0.346491 Down Lachnospiraceae Incertae Sedis
OTU144 0.138737 148 0.347779 Down Dorea
OTU172 0.140932 149 0.350912 Down Marinilabilia
OTU409 0.141562 150 0.350129 Up Alkalilimnicola
OTU68 0.145429 151 0.357313 Up Dorea
OTU216 0.146992 152 0.358776 Up Sphingomonas
OTU421 0.150949 153 0.366028 Down Streptococcus
OTU476 0.157687 154 0.379882 Down Streptococcus
OTU519 0.159874 155 0.382665 Up Catonella
OTU143 0.160715 156 0.382213 Down Lachnospiraceae Incertae Sedis
OTU275 0.160841 157 0.380078 Up Lachnospiraceae Incertae Sedis
OTU206 0.161316 158 0.378785 Up Paludibacter
OTU419 0.161556 159 0.376965 Up Micrococcineae
OTU1 0.163025 160 0.378015 Down Bacteroides
OTU248 0.16912 161 0.389711 Up Lachnospiraceae Incertae Sedis
OTU134 0.169695 162 0.388622 Down Ruminococcaceae Incertae Sedis
OTU141 0.174538 163 0.397262 Up Faecalibacterium
OTU368 0.176676 164 0.399676 Up Ruminococcaceae Incertae Sedis
OTU205 0.17885 165 0.402142 Up Erysipelotrichaceae Incertae Sedis
OTU300 0.17925 166 0.400614 Down Lachnospiraceae Incertae Sedis
OTU152 0.183253 167 0.407108 Down Faecalibacterium
OTU82 0.189641 168 0.418791 Up Roseburia
OTU28 0.194628 169 0.427261 Down Bacteroides
OTU299 0.195265 170 0.426137 Up Lachnospiraceae Incertae Sedis
OTU135 0.19551 171 0.424178 Up Clostridiaceae 1
OTU267 0.197149 172 0.425246 Up Parabacteroides
OTU249 0.197702 173 0.423974 Up Faecalibacterium
OTU334 0.205736 174 0.438667 Up Citrobacter
OTU34 0.206355 175 0.437473 Down Dorea
OTU192 0.212037 176 0.446964 Up Sphingomonas
OTU153 0.213057 177 0.446576 Up Roseburia
OTU266 0.214087 178 0.446215 Down Bacteroides
OTU87 0.215609 179 0.446876 Up Propionibacterineae
OTU235 0.224633 180 0.462994 Up Desulfovibrio
OTU50 0.226155 181 0.463556 Up Sutterella
OTU33 0.229786 182 0.468411 Down Lachnospiraceae Incertae Sedis
OTU90 0.231703 183 0.469737 Up Lachnospiraceae Incertae Sedis
OTU204 0.231703 184 0.467184 Up Dialister
OTU395 0.236361 185 0.474 Up Subdoligranulum
OTU317 0.237329 186 0.473383 Up Prevotella
OTU203 0.238017 187 0.472215 Down Rheinheimera
OTU165 0.23893 188 0.471505 Up Alistipes
OTU303 0.245272 189 0.481459 Down Faecalibacterium
OTU15 0.246531 190 0.481385 Up Roseburia
OTU127 0.246632 191 0.479061 Down Lachnospiraceae Incertae Sedis
OTU412 0.248001 192 0.47921 Up Sphingomonas
OTU178 0.250803 193 0.482114 Up Lachnospiraceae Incertae Sedis
OTU195 0.252465 194 0.482808 Down Pseudoalteromonas
OTU162 0.255823 195 0.486719 Down Veillonella
OTU154 0.260826 196 0.493707 Down Faecalibacterium
OTU190 0.260891 197 0.491324 Up Ruminococcaceae Incertae Sedis
OTU74 0.263322 198 0.493397 Up Ruminococcus
OTU425 0.264265 199 0.492674 Up Enhydrobacter
OTU118 0.26768 200 0.496547 Up Burkholderia
OTU83 0.268729 201 0.496012 Down Dorea
OTU188 0.269309 202 0.494622 Down Lachnospiraceae Incertae Sedis
OTU156 0.275877 203 0.504188 Up Lachnospiraceae Incertae Sedis
OTU146 0.277131 204 0.503998 Down Vibrio
OTU84 0.277838 205 0.50282 Down Marinomonas
OTU3 0.286165 206 0.515375 Down Lachnospiraceae Incertae Sedis
OTU170 0.2869 207 0.514203 Down Bacteroides
OTU5 0.293459 208 0.52343 Up Sphingomonas
OTU19 0.296777 209 0.526814 Up Syntrophococcus
OTU142 0.301855 210 0.533278 Down Lachnospiraceae Incertae Sedis
OTU307 0.303841 211 0.534242 Up Megamonas
OTU360 0.310287 212 0.543003 Down Faecalibacterium
OTU227 0.314679 213 0.548103 Down Lachnospiraceae Incertae Sedis
OTU145 0.31593 214 0.54771 Up Afipia
OTU453 0.318042 215 0.548807 Up Faecalibacterium
OTU296 0.326377 216 0.560583 Up Papillibacter
OTU166 0.328441 217 0.561529 Down Lachnospiraceae Incertae Sedis
OTU7 0.330993 218 0.563296 Up Bacteroides
OTU256 0.33172 219 0.561955 Up Anaerotruncus
OTU274 0.333905 220 0.563085 Down Lachnospiraceae Incertae Sedis
OTU65 0.334251 221 0.561118 Up Lachnospiraceae Incertae Sedis
OTU327 0.337489 222 0.564002 Up Pelomonas
OTU168 0.342414 223 0.569666 Down Roseburia
OTU89 0.347493 224 0.575535 Up Bacteroides
OTU71 0.353559 225 0.582979 Up Lachnospiraceae Incertae Sedis
OTU47 0.353621 226 0.580501 Down Succinispira
OTU349 0.371504 227 0.607171 Up Syntrophococcus
OTU495 0.372554 228 0.606217 Down Streptococcus
OTU304 0.375615 229 0.608529 Down Faecalibacterium
OTU181 0.376974 230 0.608075 Up Bacteroides
OTU199 0.379331 231 0.609229 Up Acetanaerobacterium
OTU44 0.383199 232 0.612788 Up Lachnospiraceae Incertae Sedis
OTU183 0.383518 233 0.610665 Down Bacteroides
OTU364 0.384954 234 0.610333 Up Exiguobacterium
OTU6 0.403239 235 0.636604 Down Lachnospiraceae Incertae Sedis
OTU553 0.403416 236 0.634184 Up Syntrophococcus
OTU88 0.409553 237 0.641115 Down Streptococcus
OTU268 0.412992 238 0.643782 Up Staphylococcus
OTU198 0.417755 239 0.648482 Up Lachnospiraceae Incertae Sedis
OTU160 0.428286 240 0.662059 Down Lachnospiraceae Incertae Sedis
OTU315 0.440228 241 0.677696 Down Coriobacterineae
OTU20 0.44566 242 0.683222 Down Lachnospiraceae Incertae Sedis
OTU354 0.450531 243 0.687848 Up Anaerotruncus
OTU179 0.450803 244 0.685442 Up Rummococcaceae Incertae Sedis
OTU76 0.454998 245 0.688997 Down Lachnobacterium
OTU374 0.455869 246 0.687509 Down Lachnospiraceae Incertae Sedis
OTU4 0.464125 247 0.697128 Up Lachnospiraceae Incertae Sedis
OTU24 0.466828 248 0.69836 Up Lachnospiraceae Incertae Sedis
OTU173 0.473245 249 0.705117 Down Anaerotruncus
OTU54 0.476242 250 0.706743 Up Lachnospiraceae Incertae Sedis
OTU288 0.477369 251 0.705593 Up Rummococcaceae Incertae Sedis
OTU229 0.478121 252 0.703901 Down Coriobacterineae
OTU367 0.484431 253 0.710371 Up Pseudomonas
OTU233 0.495265 254 0.723399 Up Syntrophococcus
OTU359 0.499339 255 0.72649 Up Faecalibacterium
OTU452 0.505628 256 0.732766 Down Butyri vibrio
OTU455 0.508508 257 0.734071 Down Finegoldia
OTU41 0.508672 258 0.731462 Down Subdoligranulum
OTU62 0.508801 259 0.728823 Down Ruminococcus
OTU400 0.515068 260 0.734962 Up Bryantella
OTU42 0.519408 261 0.738315 Up Prevotella
OTU470 0.521033 262 0.737799 Down Lachnospiraceae Incertae Sedis
OTU422 0.524664 263 0.740116 Up Peptococcaceae 1
OTU566 0.531236 264 0.746548 Down Dorea
OTU214 0.531345 265 0.743883 Down Roseburia
OTU375 0.534803 266 0.74591 Up Pseudomonas
OTU456 0.541252 267 0.752076 Down Anaerovorax
OTU538 0.541252 268 0.74927 Down Lachnospiraceae Incertae Sedis
OTU272 0.543323 269 0.749342 Down Sporobacter
OTU182 0.544691 270 0.748446 Down Lachnospiraceae Incertae Sedis
OTU260 0.549257 271 0.751935 Down Erysipelotrichaceae Incertae Sedis
OTU406 0.551284 272 0.751935 Up Bacteroides
OTU17 0.554959 273 0.754175 Down Escherichia
OTU123 0.562088 274 0.761075 Up Papillibacter
OTU58 0.577186 275 0.778677 Down Peptostreptococcaceae Incertae
Sedis
OTU380 0.597757 276 0.803507 Down Sporobacter
OTU372 0.598207 277 0.801208 Up Allomonas
OTU460 0.598207 278 0.798326 Up Lachnospiraceae Incertae Sedis
OTU164 0.598254 279 0.795527 Down Faecalibacterium
OTU9 0.606837 280 0.804058 Up Bacteroides
OTU493 0.611938 281 0.807932 Down Lachnospiraceae Incertae Sedis
OTU411 0.61495 282 0.80903 Up Faecalibacterium
OTU506 0.61495 283 0.806172 Up Syntrophococcus
OTU104 0.620801 284 0.810976 Down Syntrophococcus
OTU184 0.621999 285 0.80969 Down Lachnospiraceae Incertae Sedis
OTU60 0.622167 286 0.807077 Up Subdoligranulum
OTU196 0.627379 287 0.811003 Down Bacteroides
OTU305 0.635906 288 0.819171 Down Lachnospiraceae Incertae Sedis
OTU408 0.636907 289 0.817621 Up Bryantella
OTU217 0.637392 290 0.815422 Up Prevotella
OTU27 0.644638 291 0.821858 Up Lachnospiraceae Incertae Sedis
OTU117 0.644751 292 0.819187 Down Naxibacter
OTU238 0.648684 293 0.821372 Down Lachnospiraceae Incertae Sedis
OTU129 0.649316 294 0.819374 Down Roseburia
OTU148 0.651838 295 0.819769 Down Lachnospiraceae Incertae Sedis
OTU343 0.668166 296 0.837465 Up Lachnobacterium
OTU429 0.668166 297 0.834645 Down Dorea
OTU363 0.670411 298 0.834639 Up Faecalibacterium
OTU140 0.671784 299 0.833551 Up Faecalibacterium
OTU52 0.672431 300 0.831573 Up Lachnospiraceae Incertae Sedis
OTU378 0.689349 301 0.849663 Down Bacillaceae 1
OTU508 0.689557 302 0.847104 Down Lachnospiraceae Incertae Sedis
OTU10 0.689926 303 0.844761 Up Coprobacillus
OTU32 0.690686 304 0.84291 Down Erysipelotrichaceae Incertae Sedis
OTU80 0.698714 305 0.849911 Down Lachnospiraceae Incertae Sedis
OTU110 0.712924 306 0.864363 Up Lachnospiraceae Incertae Sedis
OTU106 0.715991 307 0.865253 Down Lachnospiraceae Incertae Sedis
OTU379 0.716925 308 0.863568 Up Roseburia
OTU171 0.716992 309 0.860854 Down Bacteroides
OTU30 0.725113 310 0.867797 Up Bryantella
OTU324 0.738903 311 0.881456 Up Faecalibacterium
OTU311 0.740828 312 0.880921 Up Lachnospiraceae Incertae Sedis
OTU101 0.745441 313 0.883574 Down Pseudoalteromonas
OTU287 0.751988 314 0.888496 Down Anaerovorax
OTU212 0.757145 315 0.891749 Down Coprobacillus
OTU55 0.767222 316 0.900757 Up Parabacteroides
OTU392 0.768645 317 0.899582 Up Lachnospiraceae Incertae Sedis
OTU114 0.768686 318 0.8968 Up Megamonas
OTU243 0.772843 319 0.898824 Up Anaerotruncus
OTU108 0.77323 320 0.896464 Up Lachnospiraceae Incertae Sedis
OTU231 0.775025 321 0.895745 Up Anaerotruncus
OTU316 0.775025 322 0.892964 Up Alistipes
OTU403 0.784314 323 0.900868 Up Methylobacterium
OTU131 0.784488 324 0.898287 Up Lachnospiraceae Incertae Sedis
OTU103 0.789604 325 0.901363 Up Roseburia
OTU105 0.793064 326 0.902536 Up Bacteroides
OTU155 0.800433 327 0.908137 Down Roseburia
OTU107 0.811899 328 0.918337 Down Ruminococcus
OTU269 0.815747 329 0.919885 Down Butyrivibrio
OTU312 0.819071 330 0.920834 Down Coriobacterineae
OTU18 0.822123 331 0.921474 Up Faecalibacterium
OTU115 0.825146 332 0.922076 Down Roseburia
OTU126 0.825636 333 0.919852 Down Aeromonas
OTU40 0.830942 334 0.922993 Up Lachnospiraceae Incertae Sedis
OTU12 0.832163 335 0.921589 Up Bryantella
OTU416 0.838341 336 0.925668 Up Lachnospiraceae Incertae Sedis
OTU102 0.839205 337 0.923873 Down Lachnospiraceae Incertae Sedis
OTU130 0.847691 338 0.930453 Up Lachnospiraceae Incertae Sedis
OTU51 0.849066 339 0.929213 Down Klebsiella
OTU187 0.853675 340 0.93151 Down Erysipelotrichaceae Incertae Sedis
OTU492 0.860391 341 0.936085 Down Coriobacterineae
OTU158 0.870215 342 0.944005 Down Bacteroides
OTU43 0.871472 343 0.942613 Down Lachnospiraceae Incertae Sedis
OTU445 0.874152 344 0.942763 Down Corynebacterineae
OTU424 0.874975 345 0.940915 Down Streptococcus
OTU35 0.885406 346 0.949381 Down Bryantella
OTU358 0.886366 347 0.947671 Up Roseburia
OTU39 0.889892 348 0.948707 Down Coriobacterineae
OTU291 0.890838 349 0.946994 Up Syntrophococcus
OTU292 0.892843 350 0.946414 Down Alistipes
OTU94 0.894124 351 0.945072 Down Anaerotruncus
OTU31 0.903421 352 0.952185 Up Coprococcus
OTU399 0.913216 353 0.959782 Down Ralstonia
OTU253 0.914073 354 0.957969 Down Uruburuella
OTU69 0.921491 355 0.963023 Down Lachnospiraceae Incertae Sedis
OTU547 0.921893 356 0.960737 Up Subdoligranulum
OTU25 0.931086 357 0.967599 Up Parabacteroides
OTU277 0.933541 358 0.967441 Down Lachnospiraceae Incertae Sedis
OTU293 0.935543 359 0.966814 Down Lachnospiraceae Incertae Sedis
OTU98 0.93936 360 0.968063 Up Lachnospiraceae Incertae Sedis
OTU194 0.949283 361 0.975579 Down Alistipes
OTU344 0.961288 362 0.985187 Down Carnobacteriaceae 1
OTU48 0.967805 363 0.989134 Down Bacteroides
OTU132 0.972304 364 0.991002 Down Parabacteroides
OTU355 0.973371 365 0.989371 Down Corynebacterineae
OTU458 0.984021 366 0.997463 Up Roseburia
OTU180 0.98511 367 0.995847 Down Roseburia
OTU151 0.985591 368 0.993626 Down Subdoligranulum
OTU16 0.986197 369 0.991542 Down Lachnospiraceae Incertae Sedis
OTU2 0.986203 370 0.988868 Up Faecalibacterium
OTU150 0.995379 371 0.995379 Up Ruminococcaceae Incertae Sedis
[00132] When the RDP classification algorithm was used to classify the consensus sequence for each of the 92 significantly different OTUs, bacteria with higher relative abundance in cases were mostly members of the phyla Firmicutes (42.6%), Bacteroidetes (25.5%) and Proteobacteria (24.5%) (Figure 2 & Figure 12-1— 12-7). A rank-abundance curve demonstrates that the OTU differences between cases and controls (significant at 10% FDR) are entirely in low abundance taxa (Figure 7). This observation explains why there are differences between case and control in richness (Figure 1), which depends on the total number of taxa observed, but not evenness, which is more sensitive to changes in high-abundance taxa.
[00133] Since obesity is a risk-factor for development of colorectal cancer, and changes in the human microbiome have been associated with obesity, the relationship between the relative abundance levels of the individual taxa and the risk factors, BMI and Waist-to-Hip Ratio (WHR) was evaluated. Turnbaugh, P.J., et al. A core gut microbiome in obese and lean twins. Nature 457, 480-484 (2009); Zhang, FL, et al. Human gut microbiota in obesity and after gastric bypass. Proc Natl Acad Sci U S A 106, 2365-2370 (2009). Subjects were classified into one of three BMI categories; Normal (BMK25), Overweight (BMI = 25-29) and Obese (BMI 30 and above) and three WHR levels; low, medium and high based on accepted thresholds (http://www.bmi- calculator.net/waist-to-hip-ratio-calculator/waist-to-hip-ratio-chart.php). For each OTU, the non- parametric Kruskal-Wallis test was performed between the three groups for BMI and WHR. There were no OTUs that showed significant differences between the various BMI and WHR risk factor categories even if a false discovery rate threshold as high as <200% (Tables 4 & 5).
[00134] Table 4: Kruskal-Wallis tests on log-normalized abundances of OTUs (97%) in BMI categories Normal (<25) vs. Overweight (26- 30) vs. Obese (>30). RDP classification of consensus sequences at genus level shown. Only OTUs which have at least 1 sequence assigned to them in 25% of the samples are shown. Kruskal-Wallis p-Values were corrected for multiple testing using (n*p)/R where n = total number of taxa tested, p = raw p-Value and R = sorted Rank of the taxon. Benjamini & Hochberg (1995).
TABLE 4
OTUname KW p-Value RANK (n*p)/R RDP Assignment
OTU153 0.0125 1 4.6375 Roseburia
OTU306 0.0202 2 3.7471 Oligotropha
OTU445 0.0252 3 3.1164 Corynebacterineae
OTU4 0.0256 4 2.3744 Lachnospiraceae Incertae Sedis
OTU538 0.0295 5 2.1889 Lachnospiraceae Incertae Sedis
OTU439 0.037 6 2.28783 Algibacter
OTU72 0.0371 7 1.9663 Aquabacterium
OTU525 0.0374 8 1.73443 Catonella
OTU75 0.0376 9 1.54996 Stenotrophomonas
OTUl lO 0.0412 10 1.52852 Lachnospiraceae Incertae Sedis
OTU98 0.0416 11 1.40305 Lachnospiraceae Incertae Sedis
OTU277 0.0429 12 1.32633 Lachnospiraceae Incertae Sedis
OTU28 0.0442 13 1.2614 Bacteroides
OTU156 0.0452 14 1.1978 Lachnospiraceae Incertae Sedis
OTU16 0.0517 15 1.27871 Lachnospiraceae Incertae Sedis
OTU43 0.054 16 1.25213 Lachnospiraceae Incertae Sedis
OTU27 0.0549 17 1.19811 Lachnospiraceae Incertae Sedis
OTU470 0.0686 18 1.41392 Lachnospiraceae Incertae Sedis
OTU39 0.0705 19 1.37661 Coriobacterineae
OTU506 0.0736 20 1.36528 Syntrophococcus
OTU157 0.0758 21 1.33913 Marinilabilia
OTU9 0.0786 22 1.32548 Bacteroides
OTU131 0.0788 23 1.27108 Lachnospiraceae Incertae Sedis
OTU240 0.0798 24 1.23358 Weissella
OTU566 0.0815 25 1.20946 Dorea
OTU288 0.0848 26 1.21003 Ruminococcaceae Incertae Sedis
OTU1 0.0869 27 1.19407 Bacteroides
OTU341 0.0879 28 1.16468 Prevotella
OTU326 0.0911 29 1.16545 Lachnospiraceae Incertae Sedis
OTU380 0.0947 30 1.17112 Sporobacter
OTU214 0.0954 31 1.14172 Roseburia
OTU11 0.0984 32 1.14083 Bacteroides
OTU172 0.0997 33 1.12087 Marinilabilia
OTU173 0.1008 34 1.09991 Anaerotruncus
OTU499 0.1021 35 1.08226 Lachnospiraceae Incertae Sedis
OTU7 0.1026 36 1.05735 Bacteroides
OTU357 0.1084 37 1.08693 Coprococcus
OTU356 0.1086 38 1.06028 Novosphingobium
OTU248 0.1124 39 1.06924 Lachnospiraceae Incertae Sedis
OTU328 0.1146 40 1.06292 Parasporobacterium
OTU56 0.119 41 1.0768 Delftia
OTU96 0.1197 42 1.05735 Diaphorobacter
OTU372 0.1223 43 1.05519 Allomonas
OTU241 0.1272 44 1.07253 Chryseobacterium
OTU371 0.1295 45 1.06766 Comamonas
OTU305 0.1297 46 1.04606 Lachnospiraceae Incertae Sedis
OTU47 0.1317 47 1.03959 Succinispira
OTU204 0.1363 48 1.05349 Dialister
OTU59 0.1363 49 1.03199 Acinetobacter
OTU138 0.147 50 1.09074 Simkania
OTU519 0.1476 51 1.07372 Catonella
OTU197 0.1479 52 1.05521 Lactobacillus
OTU132 0.1487 53 1.0409 Parabacteroides
OTU79 0.1491 54 1.02437 Lachnospiraceae Incertae Sedis
OTU370 0.1519 55 1.02463 Lactobacillus
OTU97 0.152 56 1.007 Pseudomonas
OTU501 0.1567 57 1.01992 Ruminococcaceae Incertae Sedis
OTU329 0.1616 58 1.03368 Methanohalobium
OTU266 0.1618 59 1.01742 Bacteroides
OTU464 0.1618 60 1.00046 Marinilabilia
OTU338 0.1692 61 1.02907 Micrococcineae
OTU304 0.1731 62 1.03581 Faecalibacterium
OTU374 0.1784 63 1.05058 Lachnospiraceae Incertae Sedis
OTU411 0.1827 64 1.05909 Faecalibacterium
OTU139 0.1839 65 1.04964 Azonexus
OTU399 0.1849 66 1.03936 Ralstonia
OTU40 0.1864 67 1.03216 Lachnospiraceae Incertae Sedis
OTU200 0.1891 68 1.03171 Helicobacter
OTU12 0.1918 69 1.03127 Bryantella
OTU432 0.1919 70 1.01707 Paludibacter
OTU452 0.1938 71 1.01267 Butyri vibrio
OTU86 0.1953 72 1.00634 Fusobacterium
OTU547 0.1959 73 0.9956 Subdoligranulum
OTU51 0.1975 74 0.99017 Klebsiella
OTU148 0.1994 75 0.98637 Lachnospiraceae Incertae Sedis
OTU391 0.2026 76 0.98901 Aquiflexum
OTU120 0.2027 77 0.97665 Micrococcineae
OTU367 0.2053 78 0.97649 Pseudomonas
OTU287 0.2077 79 0.9754 Anaerovorax
OTU412 0.2092 80 0.97017 Sphingomonas
OTU502 0.2095 81 0.95956 Paludibacter
OTU319 0.2113 82 0.956 Agrobacterium
OTU23 0.215 83 0.96102 Lachnospiraceae Incertae Sedis
OTU269 0.2155 84 0.95179 Butyri vibrio
OTU177 0.2167 85 0.94583 Butyri vibrio
OTU437 0.2182 86 0.9413 Marinilabilia
OTU136 0.2206 87 0.94072 Micrococcineae
OTU182 0.2221 88 0.93635 Lachnospiraceae Incertae Sedis
OTU243 0.223 89 0.92958 Anaerotruncus
OTU14 0.2291 90 0.9444 Erysipelotrichaceae Incertae Sedis
OTU283 0.2296 91 0.93606 Anaerophaga
OTU421 0.2297 92 0.92629 Streptococcus
OTU238 0.2308 93 0.92072 Lachnospiraceae Incertae Sedis
OTU442 0.2308 94 0.91092 Roseburia
OTU492 0.2332 95 0.91071 Coriobacterineae
OTU29 0.235 96 0.90818 Lachnospiraceae Incertae Sedis
OTU406 0.2368 97 0.9057 Bacteroides
OTU265 0.2376 98 0.89949 Sphingomonas
OTU90 0.2431 99 0.91101 Lachnospiraceae Incertae Sedis
OTU38 0.2507 100 0.9301 Pseudomonas
OTU32 0.251 101 0.92199 Erysipelotrichaceae Incertae Sedis
OTU458 0.2529 102 0.91986 Roseburia
OTU474 0.2555 103 0.9203 Sphingobium
OTU569 0.259 104 0.92393 Erwinia
OTU101 0.2611 105 0.92255 Pseudoalteromonas
OTU162 0.2672 106 0.9352 Veillonella
OTU22 0.2693 107 0.93374 Acidovorax
OTU37 0.2702 108 0.92819 Cloacibacterium
OTU416 0.2715 109 0.9241 Lachnospiraceae Incertae Sedis
OTU80 0.273 110 0.92075 Lachnospiraceae Incertae Sedis
OTU392 0.2753 111 0.92015 Lachnospiraceae Incertae Sedis
OTU87 0.2765 112 0.91591 Propionibacterineae
OTU161 0.2781 113 0.91305 Prevotella
OTU109 0.2825 114 0.91936 Turicibacter
OTU297 0.2949 115 0.95137 Bacillaceae 1
OTU216 0.3 116 0.95948 Sphingomonas
OTU127 0.3011 117 0.95477 Lachnospiraceae Incertae Sedis
OTU256 0.3017 118 0.94857 Anaerotruncus
OTU195 0.3058 119 0.95338 Pseudoalteromonas
OTU119 0.3065 120 0.9476 Lachnobacterium
OTU239 0.3065 121 0.93976 Succinispira
OTU183 0.3107 122 0.94483 Bacteroides
OTU146 0.3111 123 0.93836 Vibrio
OTU70 0.3138 124 0.93887 Sphingobium
OTU300 0.3145 125 0.93344 Lachnospiraceae Incertae Sedis
OTU354 0.3245 126 0.95547 Anaerotruncus
OTU128 0.3258 127 0.95175 Prevotella
OTU345 0.3295 128 0.95504 Butyri vibrio
OTU144 0.3315 129 0.95338 Dorea
OTU133 0.3389 130 0.96717 Faecalibacterium
OTU393 0.3441 131 0.97451 Micrococcineae
OTU401 0.3465 132 0.97388 Alistipes
OTU226 0.3468 133 0.96739 Rikenella
OTU313 0.347 134 0.96072 Enterobacter
OTU454 0.3474 135 0.95471 Paludibacter
OTU6 0.3478 136 0.94878 Lachnospiraceae Incertae Sedis
OTU118 0.3482 137 0.94294 Burkholderia
OTU176 0.3533 138 0.94981 Erwinia
OTU397 0.357 139 0.95286 Peptostreptococcaceae Incertae Sedis
OTU180 0.3577 140 0.94791 Roseburia
OTU168 0.3627 141 0.95434 Roseburia
OTU419 0.3647 142 0.95284 Micrococcineae
OTU50 0.3647 143 0.94618 Sutterella
OTU34 0.3652 144 0.9409 Dorea
OTU71 0.3653 145 0.93466 Lachnospiraceae Incertae Sedis
OTU64 0.3681 146 0.93538 Erwinia
OTU159 0.375 147 0.94643 Faecalibacterium
OTU199 0.376 148 0.94254 Acetanaerobacterium
OTU88 0.3762 149 0.93671 Streptococcus
OTU178 0.3777 150 0.93418 Lachnospiraceae Incertae Sedis
OTU352 0.3778 151 0.92824 Saprospira
OTU237 0.381 152 0.92994 Prevotella
OTU210 0.3815 153 0.92508 Allobaculum
OTU225 0.3842 154 0.92557 Prevotella
OTU74 0.3866 155 0.92535 Ruminococcus
OTU334 0.3908 156 0.9294 Citrobacter
OTU192 0.3917 157 0.92561 Sphingomonas
OTU158 0.3954 158 0.92844 Bacteroides
OTU353 0.396 159 0.924 Dorea
OTU229 0.4 160 0.9275 Coriobacterineae
OTU193 0.4004 161 0.92266 Xylanibacter
OTU230 0.4021 162 0.92086 Butyri vibrio
OTU57 0.4051 163 0.92204 Lachnospiraceae Incertae Sedis
OTU19 0.409 164 0.92524 Syntrophococcus
OTU363 0.4092 165 0.92008 Faecalibacterium
OTU65 0.4105 166 0.91744 Lachnospiraceae Incertae Sedis
OTU145 0.4157 167 0.9235 Afipia
OTU270 0.4187 168 0.92463 Succinispira
OTU84 0.4201 169 0.92223 Marinomonas
OTU100 0.4225 170 0.92204 Xylanibacter
OTU366 0.4227 171 0.91709 Coprococcus
OTU403 0.4238 172 0.91413 Methylobacterium
OTU267 0.4253 173 0.91206 Parabacteroides
OTU170 0.4256 174 0.90746 Bacteroides
OTU423 0.43 175 0.9116 Parasporobacterium
OTU268 0.4307 176 0.9079 Staphylococcus
OTU365 0.4311 177 0.90361 Succinispira
OTU181 0.4312 178 0.89874 Bacteroides
OTU364 0.4323 179 0.896 Exiguobacterium
OTU491 0.4335 180 0.89349 Clostridiaceae 1
OTU105 0.4364 181 0.8945 Bacteroides
OTU5 0.4368 182 0.8904 Sphingomonas
OTU322 0.4414 183 0.89486 Roseburia
OTU224 0.4432 184 0.89363 Prevotella
OTU213 0.4468 185 0.89602 Lactococcus
OTU343 0.4495 186 0.89658 Lachnobacterium
OTU26 0.4516 187 0.89596 Dorea
OTU49 0.4579 188 0.90362 Sutterella
OTU186 0.4584 189 0.89982 Faecalibacterium
OTU45 0.4603 190 0.8988 Xenohaliotis
OTU344 0.4722 191 0.91721 Carnobacteriaceae 1
OTU114 0.4744 192 0.91668 Megamonas
OTU194 0.478 193 0.91885 Alistipes
OTU249 0.4809 194 0.91966 Faecalibacterium
OTU73 0.4888 195 0.92997 Lactococcus
OTU122 0.4898 196 0.92712 Prevotella
OTU307 0.4912 197 0.92505 Megamonas
OTU124 0.5009 198 0.93856 Lactobacillus
OTU187 0.5039 199 0.93943 Erysipelotrichaceae Incertae Sedis
OTU235 0.5047 200 0.93622 Desulfovibrio
OTU149 0.5059 201 0.93378 Haemophilus
OTU309 0.5061 202 0.92952 Paludibacter
OTU143 0.5074 203 0.92732 Lachnospiraceae Incertae Sedis
OTU31 0.5076 204 0.92314 Coprococcus
OTU30 0.5115 205 0.92569 Bryantella
OTU151 0.5116 206 0.92138 Subdoligranulum
OTU425 0.5166 207 0.92589 Enhydrobacter
OTU41 0.5176 208 0.92322 Subdoligranulum
OTU291 0.5193 209 0.92182 Syntrophococcus
OTU82 0.5226 210 0.92326 Roseburia
OTU206 0.5229 211 0.91941 Paludibacter
OTU160 0.5232 212 0.9156 Lachnospiraceae Incertae Sedis
OTU135 0.5243 213 0.91322 Clostridiaceae 1
OTU418 0.5253 214 0.91068 Stenotrophomonas
OTU152 0.5303 215 0.91508 Faecalibacterium
OTU46 0.5305 216 0.91118 Bacillaceae 1
OTU76 0.5306 217 0.90715 Lachnobacterium
OTU89 0.5315 218 0.90453 Bacteroides
OTU330 0.532 219 0.90124 Coriobacterineae
OTU471 0.535 220 0.9022 Lachnospiraceae Incertae Sedis
OTU171 0.5368 221 0.90114 Bacteroides
OTU103 0.5438 222 0.90878 Roseburia
OTU244 0.5447 223 0.9062 Prevotella
OTU358 0.5453 224 0.90315 Roseburia
OTU453 0.5461 225 0.90046 Faecalibacterium
OTU111 0.5483 226 0.90009 Peptostreptococcaceae Incertae Sedis
OTU189 0.5493 227 0.89775 Acidovorax
OTU24 0.55 228 0.89496 Lachnospiraceae Incertae Sedis
OTU376 0.5502 229 0.89137 Methylobacterium
OTU203 0.5533 230 0.8925 Rheinheimera
OTU455 0.5625 231 0.90341 Finegoldia
OTU484 0.5693 232 0.91039 Effluviibacter
OTU350 0.5747 233 0.91508 Coprococcus
OTU35 0.5757 234 0.91276 Bryantella
OTU69 0.5784 235 0.91313 Lachnospiraceae Incertae Sedis
OTU91 0.5813 236 0.91382 Lactobacillus
OTU66 0.5835 237 0.91341 Streptococcus
OTU463 0.5846 238 0.91129 Lachnospiraceae Incertae Sedis
OTU387 0.58818 239 0.91303 Coprococcus
OTU378 0.589 240 0.9105 Bacillaceae 1
OTU126 0.5937 241 0.91395 Aeromonas
OTU373 0.5949 242 0.91202 Sporobacter
OTU169 0.595 243 0.90842 Streptococcus
OTU233 0.5959 244 0.90606 Syntrophococcus
OTU284 0.5973 245 0.90448 Rubritepida
OTU108 0.6038 246 0.91061 Lachnospiraceae Incertae Sedis
OTU247 0.6044 247 0.90782 Xylanibacter
OTU130 0.6073 248 0.9085 Lachnospiraceae Incertae Sedis
OTU165 0.6145 249 0.91558 Alistipes
OTU327 0.615 250 0.91266 Pelomonas
OTU106 0.6165 251 0.91124 Lachnospiraceae Incertae Sedis
OTU420 0.6168 252 0.90807 Dorea
OTU207 0.6187 253 0.90726 Succinispira
OTU324 0.6203 254 0.90603 Faecalibacterium
OTU275 0.6213 255 0.90393 Lachnospiraceae Incertae Sedis
OTU347 0.6235 256 0.90359 Vitellibacter
OTU198 0.6266 257 0.90455 Lachnospiraceae Incertae Sedis
OTU493 0.6268 258 0.90133 Lachnospiraceae Incertae Sedis
OTU60 0.6291 259 0.90114 Subdoligranulum
OTU164 0.6307 260 0.89996 Faecalibacterium
OTU85 0.6349 261 0.90248 Bacteroides
OTU155 0.6395 262 0.90555 Roseburia
OTU188 0.6396 263 0.90225 Lachnospiraceae Incertae Sedis
OTU117 0.6399 264 0.89925 Naxibacter
OTU404 0.6453 265 0.90342 Hallella
OTU53 0.6509 266 0.90783 Succinivibrio
OTU67 0.6584 267 0.91486 Lactobacillus
OTU134 0.6601 268 0.9138 Ruminococcaceae Incertae Sedis
OTU286 0.6604 269 0.91081 Hallella
OTU476 0.6642 270 0.91266 Streptococcus
OTU508 0.6654 271 0.91094 Lachnospiraceae Incertae Sedis
OTU361 0.6727 272 0.91754 Succinivibrio
OTU274 0.681 273 0.92546 Lachnospiraceae Incertae Sedis
OTU113 0.6855 274 0.92818 Rikenella
OTU212 0.6881 275 0.92831 Coprobacillus
OTU52 0.69227 276 0.93055 Lachnospiraceae Incertae Sedis
OTU299 0.6954 277 0.93138 Lachnospiraceae Incertae Sedis
OTU315 0.6976 278 0.93097 Coriobacterineae
OTU429 0.6982 279 0.92843 Dorea
OTU107 0.6991 280 0.92631 Ruminococcus
OTU42 0.7035 281 0.92882 Prevotella
OTU20 0.7054 282 0.92803 Lachnospiraceae Incertae Sedis
OTU15 0.7074 283 0.92737 Roseburia
OTU285 0.7114 284 0.92933 Butyri vibrio
OTU102 0.7156 285 0.93154 Lachnospiraceae Incertae Sedis
OTU375 0.7256 286 0.94125 Pseudomonas
OTU389 0.7273 287 0.94017 Parabacteroides
OTU202 0.7275 288 0.93716 Lachnospiraceae Incertae Sedis
OTU222 0.7295 289 0.93649 Prevotella
OTU395 0.7357 290 0.94119 Subdoligranulum
OTU250 0.7363 291 0.93872 Paludibacter
OTU115 0.7405 292 0.94084 Roseburia
OTU21 0.7508 293 0.95067 Finegoldia
OTU33 0.7525 294 0.94958 Lachnospiraceae Incertae Sedis
OTU360 0.7528 295 0.94674 Faecalibacterium
OTU231 0.7545 296 0.94567 Anaerotruncus
OTU292 0.7554 297 0.94361 Alistipes
OTU242 0.7656 298 0.95315 Coriobacterineae
OTU311 0.7664 299 0.95095 Lachnospiraceae Incertae Sedis
OTU205 0.7694 300 0.95149 Erysipelotrichaceae Incertae Sedis
OTU217 0.7694 301 0.94833 Prevotella
OTU140 0.77 302 0.94593 Faecalibacterium
OTU317 0.7757 303 0.94978 Prevotella
OTU190 0.7768 304 0.948 Rummococcaceae Incertae Sedis
OTU282 0.7852 305 0.95511 Streptococcus
OTU312 0.7899 306 0.95769 Coriobacterineae
OTU303 0.798 307 0.96436 Faecalibacterium
OTU296 0.8006 308 0.96436 Papillibacter
OTU150 0.8055 309 0.96712 Rummococcaceae Incertae Sedis
OTU184 0.8057 310 0.96424 Lachnospiraceae Incertae Sedis
OTU104 0.8059 311 0.96138 Syntrophococcus
OTU154 0.808 312 0.96079 Faecalibacterium
OTU553 0.8125 313 0.96306 Syntrophococcus
OTU254 0.8131 314 0.9607 Lachnospiraceae Incertae Sedis
OTU359 0.8214 315 0.96743 Faecalibacterium
OTU166 0.8253 316 0.96894 Lachnospiraceae Incertae Sedis
OTU142 0.8254 317 0.966 Lachnospiraceae Incertae Sedis
OTU417 0.8299 318 0.96822 Lachnobacterium
OTU10 0.833 319 0.96879 Coprobacillus
OTU18 0.837 320 0.9704 Faecalibacterium
OTU68 0.8376 321 0.96807 Dorea
OTU3 0.8382 322 0.96575 Lachnospiraceae Incertae Sedis
OTU407 0.839 323 0.96368 Turicibacter
OTU495 0.8404 324 0.96231 Streptococcus
OTU61 0.8405 325 0.95946 Papillibacter
OTU17 0.846 326 0.96278 Escherichia
OTU83 0.8462 327 0.96006 Dorea
OTU54 0.8468 328 0.95781 Lachnospiraceae Incertae Sedis
OTU409 0.848 329 0.95626 Alkalilimnicola
OTU25 0.8491 330 0.95459 Parabacteroides
OTU253 0.8496 331 0.95227 Uruburuella
OTU355 0.8553 332 0.95577 Corynebacterineae
OTU264 0.8585 333 0.95647 Comamonas
OTU129 0.8632 334 0.95882 Roseburia
OTU94 0.8638 335 0.95663 Anaerotruncus
OTU227 0.868 336 0.95842 Lachnospiraceae Incertae Sedis
OTU413 0.8732 337 0.9613 Subdoligranulum
OTU8 0.8757 338 0.9612 Dorea
OTU92 0.8801 339 0.96318 Rubrobacterineae
OTU36 0.8815 340 0.96187 Bacteroides
OTU191 0.8823 341 0.95992 Subdoligranulum
OTU422 0.8834 342 0.95831 Peptococcaceae 1
OTU396 0.8849 343 0.95714 Coprococcus
OTU167 0.8882 344 0.95791 Allobaculum
OTU93 0.895 345 0.96245 Alistipes
OTU408 0.8976 346 0.96246 Bryantella
OTU260 0.9 347 0.96225 Erysipelotnchaceae Incertae Sedis
OTU2 0.9165 348 0.97707 Faecalibacterium
OTU456 0.9187 349 0.97661 Anaerovorax
OTU293 0.9214 350 0.97668 Lachnospiraceae Incertae Sedis
OTU219 0.9222 351 0.97475 Rikenella
OTU349 0.9245 352 0.9744 Syntrophococcus
OTU460 0.9246 353 0.97175 Lachnospiraceae Incertae Sedis
OTU95 0.9326 354 0.97739 Ruminococcus
OTU48 0.9459 355 0.98853 Bacteroides
OTU55 0.9609 356 1.00139 Parabacteroides
OTU196 0.9689 357 1.0069 Bacteroides
OTU368 0.9705 358 1.00574 Ruminococcaceae Incertae Sedis
OTU424 0.9713 359 1.00377 Streptococcus
OTU1 7 0.9718 360 1.00149 Prevotella
OTU123 0.9789 361 1.00602 Papillibacter
OTU316 0.9789 362 1.00324 Alistipes
OTU62 0.9824 363 1.00405 Ruminococcus
OTU272 0.9832 364 1.00211 Sporobacter
OTU379 0.9862 365 1.00241 Roseburia
OTU44 0.9892 366 1.00271 Lachnospiraceae Incertae Sedis
OTU141 0.9895 367 1.00028 Faecalibacterium
OTU58 0.9913 368 0.99938 Peptostreptococcaceae Incertae Sedis
OTU400 0.9926 369 0.99798 Bryantella
OTU179 0.9933 370 0.99598 Ruminococcaceae Incertae Sedis
OTU77 0.9993 371 0.9993 Coprococcus
[00135] Table 5: KruskalWallis-tests on log-normalized abundances of OTUs (97%) in WHR levels low, medium and high. Only OTUs which have at least 1 sequence assigned to them in 25% of the samples are shown. RDP classification of consensus sequences at genus level shown. Kruskal- Wallis p-Values were corrected for multiple testing using (n*p)/R where n = total number of taxa tested, p = raw p-Value and R = sorted rank of the taxon. Benjamini & Hochberg (1995).
TABLE 5
OTUname KW_p-Value RANK (n*p)/R RDP Assignment
OTU299 0.0059 1 2.1889 Lachnospiraceae Incertae Sedis
OTU538 0.0068 2 1.2614 Lachnospiraceae Incertae Sedis
OTU306 0.0149 3 1.84263 Oligotropha
OTU569 0.0174 4 1.61385 Erwinia
OTU387 0.022 5 1.6324 Coprococcus
OTU349 0.0265 6 1.63858 Syntrophococcus
OTU8 0.0268 7 1.4204 Dorea
OTU419 0.0338 8 1.56748 Micrococcineae
OTU484 0.0349 9 1.43866 Effluviibacter
OTU19 0.0404 10 1.49884 Syntrophococcus
OTU464 0.0406 11 1.36933 Marinilabilia
OTU156 0.0414 12 1.27995 Lachnospiraceae Incertae Sedis
OTU248 0.0432 13 1.23286 Lachnospiraceae Incertae Sedis
OTU48 0.046 14 1.219 Bacteroides
OTU210 0.0463 15 1.14515 Allobaculum
OTU172 0.048 16 1.113 Marinilabilia
OTU93 0.0497 17 1.08463 Alistipes
OTU373 0.0556 18 1.14598 Sporobacter
OTU168 0.0571 19 1.11495 Roseburia
OTU250 0.0588 20 1.09074 Paludibacter
OTU375 0.0613 21 1.08297 Pseudomonas
OTU291 0.0616 22 1.0388 Syntrophococcus
OTU35 0.0698 23 1.1259 Bryantella
OTU357 0.0708 24 1.09445 Coprococcus
OTU439 0.071 25 1.05364 Algibacter
OTU110 0.0715 26 1.02025 Lachnospiraceae Incertae Sedis
OTU525 0.0717 27 0.98521 Catonella
OTU67 0.0736 28 0.9752 Lactobacillus
OTU5 0.0741 29 0.94797 Sphingomonas
OTU96 0.0766 30 0.94729 Diaphorobacter
OTU493 0.0787 31 0.94186 Lachnospiraceae Incertae Sedis
OTU566 0.0835 32 0.96808 Dorea
OTU84 0.0839 33 0.94324 Marinomonas
OTU34 0.0849 34 0.92641 Dorea
OTU399 0.0853 35 0.90418 Ralstonia
OTU366 0.0882 36 0.90895 Coprococcus
OTU142 0.0913 37 0.91547 Lachnospiraceae Incertae Sedis
OTU95 0.0916 38 0.89431 Ruminococcus
OTU360 0.0918 39 0.87328 Faecalibacterium
OTU45 0.0918 40 0.85145 Xenohaliotis
OTU508 0.0926 41 0.83792 Lachnospiraceae Incertae Sedis
OTU329 0.0961 42 0.84888 Methanohalobium
OTU151 0.0962 43 0.83 Subdoligranulum
OTU501 0.0979 44 0.82548 Rummococcaceae Incertae Sedis
OTU244 0.1002 45 0.82609 Prevotella
OTU315 0.1064 46 0.85814 Coriobacterineae
OTU553 0.1072 47 0.8462 Syntrophococcus
OTU230 0.1095 48 0.84634 Butyrivibrio
OTU316 0.1102 49 0.83437 Alistipes
OTU197 0.1107 50 0.82139 Lactobacillus
OTU104 0.1147 51 0.83439 Syntrophococcus
OTU191 0.1181 52 0.8426 Subdoligranulum
OTU161 0.1184 53 0.8288 Prevotella
OTU243 0.1184 54 0.81345 Anaerotruncus
OTU62 0.1192 55 0.80406 Ruminococcus
OTU23 0.1193 56 0.79036 Lachnospiraceae Incertae Sedis
OTU205 0.1197 57 0.7791 Erysipelotrichaceae Incertae Sedis
OTU106 0.125 58 0.79957 Lachnospiraceae Incertae Sedis
OTU224 0.1271 59 0.79922 Prevotella
OTU74 0.131 60 0.81002 Ruminococcus
OTU372 0.1312 61 0.79795 Allomonas
OTU470 0.1338 62 0.80064 Lachnospiraceae Incertae Sedis
OTU160 0.1368 63 0.8056 Lachnospiraceae Incertae Sedis
OTU404 0.1385 64 0.80287 Hallella
OTU190 0.1394 65 0.79565 Rummococcaceae Incertae Sedis
OTU432 0.1402 66 0.78809 Paludibacter
OTU471 0.1412 67 0.78187 Lachnospiraceae Incertae Sedis
OTU28 0.144 68 0.78565 Bacteroides
OTU233 0.145 69 0.77964 Syntrophococcus
OTU41 0.1468 70 0.77804 Subdoligranulum
OTU365 0.1534 71 0.80157 Succinispira
OTU395 0.1557 72 0.80229 Subdoligranulum
OTU305 0.1573 73 0.79943 Lachnospiraceae Incertae Sedis
OTU30 0.1594 74 0.79915 Bryantella
OTU154 0.1597 75 0.78998 Faecalibacterium
OTU46 0.1602 76 0.78203 Bacillaceae 1
OTU100 0.1611 77 0.77621 Xylanibacter
OTU254 0.1671 78 0.7948 Lachnospiraceae Incertae Sedis
OTU200 0.1725 79 0.81009 Helicobacter
OTU421 0.1763 80 0.81759 Streptococcus
OTU277 0.1773 81 0.81208 Lachnospiraceae Incertae Sedis
OTU239 0.1778 82 0.80444 Succinispira
OTU1 0.1808 83 0.80815 Bacteroides
OTU68 0.1814 84 0.80118 Dorea
OTU72 0.1816 85 0.79263 Aquabacterium
OTU495 0.1891 86 0.81577 Streptococcus
OTU275 0.1938 87 0.82643 Lachnospiraceae Incertae Sedis
OTU370 0.1946 88 0.82042 Lactobacillus
OTU284 0.1958 89 0.8162 Rubritepida
OTU195 0.1959 90 0.80754 Pseudoalteromonas
OTU91 0.1979 91 0.80682 Lactobacillus
OTU82 0.198 92 0.79846 Roseburia
OTU378 0.1982 93 0.79067 Bacillaceae 1
OTU206 0.2061 94 0.81344 Paludibacter
OTU317 0.2063 95 0.80566 Prevotella
OTU165 0.2065 96 0.79804 Alistipes
OTU113 0.2074 97 0.79325 Rikenella
OTU130 0.2101 98 0.79538 Lachnospiraceae Incertae Sedis
OTU138 0.2157 99 0.80833 Acidovorax
OTU22 0.2166 100 0.80359 Coriobacterineae
OTU492 0.2189 101 0.80408 Lactococcus
OTU73 0.2211 102 0.8042 Prevotella
OTU137 0.225 103 0.81044 Afipia
OTU145 0.23 104 0.82048 Erwinia
OTU64 0.2302 105 0.81337 Streptococcus
OTU282 0.2306 106 0.8071 Prevotella
OTU42 0.231 107 0.80094 Enhydrobacter
OTU425 0.2351 108 0.80761 Cloacibacterium
OTU37 0.2366 109 0.80531 Papillibacter
OTU61 0.2382 110 0.80338 Roseburia
OTU180 0.2389 111 0.79849 Streptococcus
OTU169 0.2395 112 0.79334 Micrococcineae
OTU136 0.2416 113 0.79322 Faecalibacterium
OTU304 0.2444 114 0.79537 Lachnospiraceae Incertae Sedis
OTU188 0.2467 115 0.79588 Coprobacillus
OTU10 0.2477 116 0.79221 Prevotella
OTU128 0.2568 117 0.8143 Dorea
OTU420 0.2582 118 0.8118 Paludibacter
OTU454 0.2585 119 0.80591 Uruburuella
OTU253 0.2599 120 0.80352 Bacteroides
OTU406 0.2601 121 0.7975 Bacteroides
OTU7 0.2613 122 0.79461 Weissella
OTU240 0.2614 123 0.78845 Coriobacterineae
OTU312 0.2621 124 0.78419 Acinetobacter
OTU59 0.2645 125 0.78504 Acidovorax
OTU189 0.2663 126 0.78411 Rubrobacterineae
OTU92 0.2691 127 0.78611 Xylanibacter
OTU193 0.2737 128 0.7933 Streptococcus
OTU424 0.2749 129 0.7906 Papillibacter
OTU123 0.2753 130 0.78566 Rummococcaceae Incertae Sedis
OTU368 0.2773 131 0.78533 Faecalibacterium
OTU18 0.2803 132 0.78781 Bryantella
OTU12 0.2818 133 0.78607 Sphingomonas
OTU192 0.284 134 0.7863 Succinispira
OTU207 0.284 135 0.78047 Lachnospiraceae Incertae Sedis
OTU416 0.2856 136 0.7791 Allobaculum
OTU167 0.2875 137 0.77856 Lachnospiraceae Incertae Sedis
OTU98 0.2908 138 0.78179 Faecalibacterium
OTU249 0.2916 139 0.7783 Lachnospiraceae Incertae Sedis
OTU300 0.2948 140 0.78122 Roseburia
OTU214 0.2976 141 0.78305 Klebsiella
OTU51 0.299 142 0.78119 Streptococcus
OTU476 0.3015 143 0.78221 Marinilabilia
OTU437 0.3067 144 0.79018 Faecalibacterium
OTU453 0.3096 145 0.79215 Paludibacter
OTU309 0.3132 146 0.79587 Sporobacter
OTU380 0.321 147 0.81014 Pseudomonas
OTU367 0.3238 148 0.81169 Faecalibacterium
OTU133 0.3241 149 0.80699 Prevotella
OTU225 0.3246 150 0.80284 Vitellibacter
OTU347 0.3294 151 0.80932 Propionibacterineae
OTU87 0.3324 152 0.81132 Coprococcus
OTU350 0.3391 153 0.82226 Streptococcus
OTU66 0.3455 154 0.83234 Pelomonas
OTU327 0.3464 155 0.82913 Exiguobacterium
OTU364 0.3494 156 0.83094 Lachnospiraceae Incertae Sedis
OTU127 0.3529 157 0.83392 Finegoldia
OTU21 0.3576 158 0.83968 Rikenella
OTU226 0.3623 159 0.84537 Rummococcaceae Incertae Sedis
OTU150 0.3626 160 0.84078 Lachnospiraceae Incertae Sedis
OTU71 0.3626 161 0.83556 Bacteroides
OTU183 0.364 162 0.8336 Corynebacterineae
OTU445 0.3681 163 0.83782 Lactococcus
OTU213 0.369 164 0.83475 Anaerotruncus
OTU231 0.3705 165 0.83306 Lachnobacterium
OTU119 0.3712 166 0.82961 Lachnospiraceae Incertae Sedis
OTU460 0.3766 167 0.83664 Chryseobacterium
OTU241 0.3767 168 0.83188 Sphingomonas
OTU412 0.3778 169 0.82937 Carnobacteriaceae 1
OTU344 0.3792 170 0.82755 Vibrio
OTU146 0.3819 171 0.82857 Megamonas
OTU114 0.3867 172 0.8341 Micrococcineae
OTU393 0.3888 173 0.83378 Lachnobacterium
OTU417 0.3916 174 0.83496 Lachnospiraceae Incertae Sedis
OTU131 0.3917 175 0.8304 Saprospira
OTU352 0.3921 176 0.82653 Roseburia
OTU358 0.3996 177 0.83758 Lachnospiraceae Incertae Sedis
OTU227 0.4027 178 0.83934 Succinivibrio
OTU53 0.4074 179 0.84439 Bacteroides
OTU36 0.4117 180 0.84856 Coriobacterineae
OTU39 0.4129 181 0.84633 Pseudomonas
OTU97 0.4193 182 0.85473 Bacteroides
OTU89 0.4203 183 0.85208 Faecalibacterium
OTU186 0.4216 184 0.85007 Streptococcus
OTU88 0.4223 185 0.84688 Anaerophaga
OTU283 0.4327 186 0.86307 Lachnospiraceae Incertae Sedis
OTU16 0.4394 187 0.87175 Faecalibacterium
OTU324 0.44 188 0.8683 Coprobacillus
OTU212 0.4402 189 0.8641 Succinivibrio
OTU361 0.4418 190 0.86267 Butyrivibrio
OTU177 0.4429 191 0.86029 Roseburia
OTU379 0.4443 192 0.85852 Lachnospiraceae Incertae Sedis
OTU3 0.4476 193 0.86041 Agrobacterium
OTU319 0.4476 194 0.85598 Coriobacterineae
OTU229 0.4528 195 0.86148 Lachnospiraceae Incertae Sedis
OTU202 0.4564 196 0.8639 Lachnospiraceae Incertae Sedis
OTU311 0.461 197 0.86818 Sphingomonas
OTU265 0.4622 198 0.86604 Aquiflexum
OTU391 0.4654 199 0.86766 Peptostreptococcaceae Incertae Sedis
OTU397 0.4706 200 0.87296 Prevotella
OTU222 0.4779 201 0.88209 Lachnospiraceae Incertae Sedis
OTU40 0.4816 202 0.88452 Bacteroides
OTU196 0.4846 203 0.88565 Lachnospiraceae Incertae Sedis
OTU24 0.4884 204 0.88822 Bryantella
OTU408 0.4951 205 0.89601 Roseburia
OTU153 0.4971 206 0.89526 Fusobacterium
OTU86 0.5011 207 0.89811 Lachnospiraceae Incertae Sedis
OTU326 0.5018 208 0.89504 Clostridiaceae 1
OTU491 0.5047 209 0.8959 Bacteroides
OTU171 0.5061 210 0.89411 Citrobacter
OTU334 0.5071 211 0.89163 Alistipes
OTU194 0.508 212 0.889 Aeromonas
OTU126 0.5122 213 0.89214 Prevotella
OTU237 0.5138 214 0.89075 Dorea
OTU26 0.5169 215 0.89195 Subdoligranulum
OTU60 0.517 216 0.888 Lachnospiraceae Incertae Sedis
OTU52 0.5335 217 0.91211 Ruminococcus
OTU107 0.5352 218 0.91082 Catonella
OTU519 0.5367 219 0.9092 Faecalibacterium
OTU140 0.5398 220 0.9103 Papillibacter
OTU296 0.5432 221 0.91189 Sutterella
OTU49 0.548 222 0.9158 Lachnobacterium
OTU343 0.5663 223 0.94214 Lactobacillus
OTU124 0.5814 224 0.96294 Ruminococcaceae Incertae Sedis
OTU288 0.5881 225 0.96971 Marinilabilia
OTU157 0.5897 226 0.96805 Megamonas
OTU307 0.5901 227 0.96444 Bacteroides
OTU266 0.5921 228 0.96346 Finegoldia
OTU455 0.5928 229 0.96039 Bacteroides
OTU11 0.5944 230 0.95879 Anaerotruncus
OTU94 0.6022 231 0.96717 Turicibacter
OTU109 0.6054 232 0.96812 Bacteroides
OTU85 0.6056 233 0.96428 Roseburia
OTU115 0.6061 234 0.96095 Butyrivibrio
OTU452 0.6141 235 0.96949 Xylanibacter
OTU247 0.6152 236 0.96712 Faecalibacterium
OTU359 0.6155 237 0.9635 Bacteroides
OTU170 0.6263 238 0.97629 Prevotella
OTU341 0.6266 239 0.97267 Lachnospiraceae Incertae Sedis
OTU392 0.6282 240 0.97109 Faecalibacterium
OTU164 0.6284 241 0.96737 Lachnospiraceae Incertae Sedis
OTU57 0.631 242 0.96736 Lachnospiraceae Incertae Sedis
OTU166 0.6318 243 0.9646 Rikenella
OTU219 0.6379 244 0.96992 Parabacteroides
OTU389 0.6418 245 0.97187 Clostridiaceae 1
OTU135 0.6419 246 0.96807 Haemophilus
OTU149 0.6421 247 0.96445 Alkalilimnicola
OTU409 0.6428 248 0.96161 Lachnospiraceae Incertae Sedis
OTU102 0.643 249 0.95804 Peptostreptococcaceae Incertae Sedis
OTU58 0.644 250 0.9557 Burkholderia
OTU118 0.6467 251 0.95588 Parabacteroides
OTU55 0.6552 252 0.9646 Parasporobacterium
OTU328 0.6559 253 0.96181 Lachnospiraceae Incertae Sedis
OTU238 0.6571 254 0.95978 Stenotrophomonas
OTU75 0.6579 255 0.95718 Dorea
OTU429 0.6587 256 0.9546 Peptococcaceae 1
OTU422 0.6675 257 0.96359 Prevotella
OTU122 0.6782 258 0.97524 Rheinheimera
OTU203 0.6874 259 0.98465 Stenotrophomonas
OTU418 0.6879 260 0.98158 Lachnospiraceae Incertae Sedis
OTU463 0.6882 261 0.97825 Prevotella
OTU217 0.6897 262 0.97664 Ruminococcaceae Incertae Sedis
OTU179 0.69 263 0.97335 Dorea
OTU353 0.6943 264 0.9757 Lachnospiraceae Incertae Sedis
OTU20 0.6949 265 0.97286 Lachnospiraceae Incertae Sedis
OTU6 0.6964 266 0.97129 Anaerovorax
OTU456 0.6974 267 0.96905 Bacteroides
OTU158 0.6984 268 0.96681 Alistipes
OTU292 0.6998 269 0.96515 Lachnospiraceae Incertae Sedis
OTU65 0.7036 270 0.9668 Butyrivibrio
OTU345 0.7042 271 0.96405 Lachnospiraceae Incertae Sedis
OTU69 0.7079 272 0.96555 Parabacteroides
OTU267 0.7093 273 0.96392 Sphingobium
OTU474 0.7138 274 0.9665 Lachnospiraceae Incertae Sedis
OTU184 0.7144 275 0.96379 Syntrophococcus
OTU506 0.7161 276 0.96258 Lachnospiraceae Incertae Sedis
OTU44 0.7174 277 0.96085 Roseburia
OTU15 0.7254 278 0.96807 Bacteroides
OTU105 0.7299 279 0.97058 Lachnospiraceae Incertae Sedis
OTU374 0.7312 280 0.96884 Butyrivibrio
OTU285 0.7314 281 0.96566 Methylobacterium
OTU376 0.732 282 0.96302 Anaerotruncus
OTU256 0.7326 283 0.9604 Lachnospiraceae Incertae Sedis
OTU27 0.7346 284 0.95964 Parasporobacterium
OTU423 0.7388 285 0.96174 Anaerovorax
OTU287 0.7472 286 0.96927 Paludibacter
OTU502 0.7498 287 0.96925 Lachnospiraceae Incertae Sedis
OTU274 0.7517 288 0.96834 Lachnospiraceae Incertae Sedis
OTU293 0.7548 289 0.96896 Pseudoalteromonas
OTU101 0.7558 290 0.9669 Faecalibacterium
OTU141 0.761 291 0.97021 Roseburia
OTU129 0.7628 292 0.96917 Comamonas
OTU264 0.7667 293 0.9708 Coprococcus
OTU77 0.7678 294 0.96889 Lachnospiraceae Incertae Sedis
OTU182 0.7731 295 0.97227 Corynebacterineae
OTU355 0.7757 296 0.97225 Lachnospiraceae Incertae Sedis
OTU90 0.777 297 0.9706 Lachnospiraceae Incertae Sedis
OTU29 0.7788 298 0.96958 Lachnospiraceae Incertae Sedis
OTU178 0.7861 299 0.97539 Veillonella
OTU162 0.7889 300 0.97561 Dorea
OTU83 0.7948 301 0.97964 Parabacteroides
OTU25 0.7955 302 0.97725 Acetanaerobacterium
OTU199 0.7962 303 0.97489 Dialister
OTU204 0.808 304 0.98608 Anaerotruncus
OTU354 0.8095 305 0.98467 Lachnospiraceae Incertae Sedis
OTU143 0.8198 306 0.99394 Roseburia
OTU458 0.8218 307 0.99312 Erysipelotrichaceae Incertae Sedis
OTU187 0.8256 308 0.99447 Lachnospiraceae Incertae Sedis
OTU54 0.8309 309 0.99762 Hallella
OTU286 0.8311 310 0.99464 Comamonas
OTU371 0.8371 311 0.9986 Lachnospiraceae Incertae Sedis
OTU4 0.8391 312 0.99778 Micrococcineae
OTU120 0.8398 313 0.99542 Alistipes
OTU401 0.8408 314 0.99343 Peptostreptococcaceae Incertae Sedis
OTU111 0.8414 315 0.99098 Sutterella
OTU50 0.8421 316 0.98867 Pseudomonas
OTU38 0.8472 317 0.99152 Micrococcineae
OTU338 0.8506 318 0.99237 Lachnospiraceae Incertae Sedis
OTU80 0.8517 319 0.99054 Erysipelotrichaceae Incertae Sedis
OTU260 0.8519 320 0.98767 Erysipelotrichaceae Incertae Sedis
OTU32 0.8541 321 0.98714 Lachnobacterium
OTU76 0.8553 322 0.98545 Delftia
OTU56 0.8691 323 0.99825 Enterobacter
OTU313 0.8702 324 0.99643 Faecalibacterium
OTU411 0.871 325 0.99428 Succinispira
OTU47 0.8731 326 0.99362 Azonexus
OTU139 0.8742 327 0.99183 Roseburia
OTU103 0.8747 328 0.98937 Lachnospiraceae Incertae Sedis
OTU198 0.8811 329 0.99358 Sphingobium
OTU70 0.8829 330 0.99259 Faecalibacterium
OTU303 0.8873 331 0.99453 Novosphingobium
OTU356 0.8948 332 0.99991 Turicibacter
OTU407 0.8955 333 0.99769 Parabacteroides
OTU132 0.8999 334 0.99959 Lachnospiraceae Incertae Sedis
OTU79 0.9073 335 1.0048 Subdoligranulum
OTU413 0.9088 336 1.00347 Sporobacter
OTU272 0.9089 337 1.0006 Subdoligranulum
OTU547 0.9101 338 0.99896 Erwinia
OTU176 0.9119 339 0.99798 Coriobacterineae
OTU330 0.913 340 0.99624 Faecalibacterium
OTU363 0.9162 341 0.9968 Coprococcus
OTU396 0.9174 342 0.99519 Anaerotruncus
OTU173 0.9183 343 0.99326 Staphylococcus
OTU268 0.9239 344 0.99642 Lachnospiraceae Incertae Sedis
OTU108 0.926 345 0.99579 Escherichia
OTU17 0.9269 346 0.99387 Bacteroides
OTU9 0.9287 347 0.99293 Erysipelotrichaceae Incertae Sedis
OTU14 0.9289 348 0.99029 Lachnospiraceae Incertae Sedis
OTU148 0.9313 349 0.99001 Roseburia
OTU155 0.9313 350 0.98718 Butyrivibrio
OTU269 0.9376 351 0.99102 Coprococcus
OTU31 0.9397 352 0.99042 Lachnospiraceae Incertae Sedis
OTU499 0.9451 353 0.99329 Lachnospiraceae Incertae Sedis
OTU33 0.9497 354 0.99531 Roseburia
OTU322 0.9515 355 0.99438 Desulfovibrio
OTU235 0.9547 356 0.99493 Sphingomonas
OTU216 0.9582 357 0.99578 Naxibacter
OTU117 0.9598 358 0.99465 Faecalibacterium
OTU2 0.9697 359 1.00211 Faecalibacterium
OTU152 0.9698 360 0.99943 Lachnospiraceae Incertae Sedis
OTU43 0.9713 361 0.99821 Succinispira
OTU270 0.9719 362 0.99606 Bacteroides
OTU181 0.9731 363 0.99455 Ruminococcaceae Incertae Sedis
OTU134 0.9734 364 0.99212 Faecalibacterium
OTU159 0.9739 365 0.98991 Dorea
OTU144 0.9784 366 0.99177 Bacillaceae 1
OTU297 0.9809 367 0.99159 Methylobacterium
OTU403 0.9815 368 0.9895 Coriobacterineae
OTU242 0.9892 369 0.99456 Roseburia
OTU442 0.9918 370 0.99448 Bryantella
OTU400 0.9995 371 0.9995 Simkania
[00136] Likewise, there were no significant differences in the diversity measures, richness and evenness, between the various risk factor categories (Figures 8 & 9). Finally, regressions between BMI values and WHR values against each taxa at the OTU level also showed no significant association between the OTUs with either BMI or WHR at an FDR threshold of <10% (Figures 10 & 11, Tables 6 & 7). Subjects were classified into one of three BMI categories; Normal (<25), Overweight (25-29) and Obese (30 and above) and three WHR levels; low, medium and high based on the accepted thresholds in the medical field (http://www.bmi- calculator.net/waist-to-hip-ratio-calculator/waist-to-hip-ratio-chart.php). For each OTU, the non- parametric Kruskal-Wallis test was performed between the three groups for BMI and WHR. Results indicate that there were no OTUs that showed significant differences between the various BMI and WHR risk factor categories even if a false discovery rate threshold was set as high as <600% (Tables 4 & 5).
[00137] Table 6: Regressions on log-normalized abundances of OTUs (97%) vs BMIs of all samples with RDP classifications of consensus sequences at genus level shown. Only OTUs which have at least 1 sequence assigned to them in 25% of the samples are shown. Regression p- Values were corrected for multiple testing using (n*p)/R where n = total number of taxa tested, p
= raw p-Value and R = sorted rank of the taxon. Benjamini & Hochberg (1995).
TABLE 6
OtuName R2 p-Value RANK (n*p)/R RDP assignment
OTU16 0.12079 0.00320 1 1.18672 Lachnospiraceae Incertae Sedis
OTU492 0.08200 0.01624 2 3.01333 Coriobacterineae
OTU39 0.07881 0.01857 3 2.29692 Coriobacterineae
OTU306 0.07825 0.01901 4 1.76333 Oligotropha
OTU40 0.07472 0.02204 5 1.63559 Lachnospiraceae Incertae Sedis
OTU43 0.07415 0.02257 6 1.39583 Lachnospiraceae Incertae Sedis
OTU305 0.07331 0.02339 7 1.23956 Lachnospiraceae Incertae Sedis
OTU357 0.07070 0.02609 8 1.20976 Coprococcus
OTU4 0.06895 0.02808 9 1.15764 Lachnospiraceae Incertae Sedis
OTU138 0.06863 0.02846 10 1.05595 Simkania
OTU277 0.06168 0.03817 11 1.28733 Lachnospiraceae Incertae Sedis
OTU237 0.05815 0.04432 12 1.37034 Prevotella
OTU131 0.05790 0.04479 13 1.27825 Lachnospiraceae Incertae Sedis
OTU372 0.05470 0.05141 14 1.36242 Allomonas
OTU329 0.05378 0.05339 15 1.32046 Methanohalobium
OTU105 0.05349 0.05406 16 1.25351 Bacteroides
OTU172 0.05309 0.05498 17 1.19992 Marinilabilia
OTU370 0.05290 0.05540 18 1.14185 Lactobacillus
OTU397 0.05190 0.05789 19 1.13039 Peptostreptococcaceae Incertae Sedis
OTU27 0.05132 0.05932 20 1.10034 Lachnospiraceae Incertae Sedis
OTU67 0.05116 0.05973 21 1.05515 Lactobacillus
OTU439 0.05040 0.06178 22 1.0418 Algibacter
OTUl lO 0.04969 0.06362 23 1.02621 Lachnospiraceae Incertae Sedis
OTU210 0.04921 0.06494 24 1.00386 Allobaculum
OTU380 0.04900 0.06547 25 0.9715 Sporobacter
OTU401 0.04780 0.06903 26 0.98507 Alistipes
OTU204 0.04685 0.07191 27 0.98812 Dialister
OTU288 0.04564 0.07576 28 1.00382 Ruminococcaceae Incertae Sedis
OTU66 0.04482 0.07851 29 1.00441 Streptococcus
OTU432 0.04450 0.07967 30 0.98528 Paludibacter
OTU72 0.04432 0.08022 31 0.96009 Aquabacterium
OTU151 0.04226 0.08778 32 1.01767 Subdoligranulum
OTU167 0.04143 0.09100 33 1.02308 Allobaculum
OTU80 0.04059 0.09443 34 1.03038 Lachnospiraceae Incertae Sedis
OTU153 0.04043 0.09509 35 1.00798 Roseburia
OTU146 0.03945 0.09927 36 1.02302 Vibrio
OTU95 0.03897 0.10141 37 1.01683 Ruminococcus
OTU420 0.03810 0.10547 38 1.02974 Dorea
OTU547 0.03780 0.10677 39 1.01571 Subdoligranulum
OTU352 0.03760 0.10776 40 0.99945 Saprospira
OTU164 0.03704 0.11044 41 0.99931 Faecalibacterium
OTU26 0.03681 0.11160 42 0.98578 Dorea
OTU180 0.03632 0.11402 43 0.98373 Roseburia
OTU373 0.03570 0.11708 44 0.98718 Sporobacter
OTU23 0.03559 0.11780 45 0.97118 Lachnospiraceae Incertae Sedis
OTU230 0.03428 0.12490 46 1.00738 Butyrivibrio
OTU350 0.03420 0.12520 47 0.98831 Coprococcus
OTU88 0.03418 0.12545 48 0.96966 Streptococcus
OTU241 0.03414 0.12570 49 0.95172 Chryseobacterium
OTU309 0.03300 0.13230 50 0.98164 Paludibacter
OTU154 0.03088 0.14566 51 1.05962 Faecalibacterium
OTU499 0.03070 0.14702 52 1.04891 Lachnospiraceae Incertae Sedis
OTU21 0.03053 0.14799 53 1.03595 Finegoldia
OTU452 0.03010 0.15062 54 1.03479 Butyrivibrio
OTU399 0.02990 0.15230 55 1.02734 Ralstonia
OTU96 0.02898 0.15887 56 1.05251 Diaphorobacter
OTU195 0.02838 0.16331 57 1.06294 Pseudoalteromonas
OTU186 0.02821 0.16461 58 1.05293 Faecalibacterium
OTU470 0.02760 0.16933 59 1.06475 Lachnospiraceae Incertae Sedis
OTU84 0.02759 0.16939 60 1.04742 Marinomonas
OTU229 0.02747 0.17030 61 1.03575 Coriobacterineae
OTU566 0.02738 0.17105 62 1.02355 Dorea
OTU98 0.02716 0.17278 63 1.01746 Lachnospiraceae Incertae Sedis
OTU104 0.02705 0.17369 64 1.00683 Syntrophococcus
OTU111 0.02684 0.17532 65 1.00067 Peptostreptococcaceae Incertae Sedis
OTU59 0.02682 0.17553 66 0.98668 Acinetobacter
OTU267 0.02664 0.17697 67 0.97997 Parabacteroides
OTU157 0.02651 0.17809 68 0.97165 Marinilabilia
OTU182 0.02499 0.19123 69 1.02819 Lachnospiraceae Incertae Sedis
OTU231 0.02456 0.19512 70 1.03411 Anaerotruncus
OTU30 0.02451 0.19561 71 1.02215 Bryantella
OTU214 0.02440 0.19663 72 1.0132 Roseburia
OTU538 0.02330 0.20675 73 1.05076 Lachnospiraceae Incertae Sedis
OTU464 0.02320 0.20799 74 1.04277 Marinilabilia
OTU356 0.02290 0.21102 75 1.04383 Novosphingobium
OTU376 0.02220 0.21838 76 1.06602 Methylobacterium
OTU3 0.02217 0.21861 77 1.05332 Lachnospiraceae Incertae Sedis
OTU416 0.02120 0.22887 78 1.0886 Lachnospiraceae Incertae Sedis
OTU358 0.02080 0.23330 79 1.09562 Roseburia
OTU197 0.02052 0.23674 80 1.0979 Lactobacillus
OTU200 0.02050 0.23707 81 1.08584 Helicobacter
OTU495 0.02040 0.23841 82 1.07867 Streptococcus
OTU65 0.01999 0.24295 83 1.08596 Lachnospiraceae Incertae Sedis
OTU454 0.02000 0.24329 84 1.07452 Paludibacter
OTU425 0.01990 0.24367 85 1.06355 Enhydrobacter
OTU46 0.01953 0.24861 86 1.07251 Bacillaceae 1
OTU155 0.01951 0.24887 87 1.06126 Roseburia
OTU240 0.01947 0.24930 88 1.05105 Weissella
OTU266 0.01923 0.25225 89 1.05153 Bacteroides
OTU463 0.01920 0.25304 90 1.04308 Lachnospiraceae Incertae Sedis
OTU107 0.01902 0.25492 91 1.03928 Ruminococcus
OTU101 0.01890 0.25641 92 1.03401 Pseudoalteromonas
OTU102 0.01859 0.26038 93 1.03872 Lachnospiraceae Incertae Sedis
OTU82 0.01851 0.26140 94 1.03169 Roseburia
OTU115 0.01843 0.26242 95 1.02482 Roseburia
OTU51 0.01794 0.26901 96 1.0396 Klebsiella
OTU392 0.01770 0.27267 97 1.04288 Lachnospiraceae Incertae Sedis
OTU198 0.01753 0.27460 98 1.03955 Lachnospiraceae Incertae Sedis
OTU334 0.01747 0.27545 99 1.03225 Citrobacter
OTU423 0.01720 0.27857 100 1.03349 Parasporobacterium
OTU371 0.01710 0.28002 101 1.02858 Comamonas
OTU365 0.01710 0.28007 102 1.01868 Succinispira
OTU367 0.01670 0.28614 103 1.03066 Pseudomonas
OTU378 0.01660 0.28836 104 1.02867 Bacillaceae 1
OTU12 0.01642 0.29042 105 1.02615 Bryantella
OTU47 0.01639 0.29086 106 1.01801 Succinispira
OTU124 0.01633 0.29173 107 1.01152 Lactobacillus
OTU212 0.01631 0.29201 108 1.00313 Coprobacillus
OTU203 0.01613 0.29472 109 1.00314 Rheinheimera
OTU456 0.01590 0.29808 110 1.00533 Anaerovorax
OTU19 0.01563 0.30240 111 1.01072 Syntrophococcus
OTU268 0.01537 0.30653 112 1.01537 Staphylococcus
OTU60 0.01513 0.31036 113 1.01896 Subdoligranulum
OTU50 0.01506 0.31153 114 1.01382 Sutterella
OTU75 0.01487 0.31460 115 1.01494 Stenotrophomonas
OTU192 0.01447 0.32129 116 1.02757 Sphingomonas
OTU36 0.01438 0.32279 117 1.02354 Bacteroides
OTU389 0.01430 0.32348 118 1.01705 Parabacteroides
OTU28 0.01423 0.32534 119 1.01429 Bacteroides
OTU6 0.01415 0.32671 120 1.01009 Lachnospiraceae Incertae Sedis
OTU292 0.01378 0.33313 121 1.0214 Alistipes
OTU282 0.01372 0.33422 122 1.01634 Streptococcus
OTU194 0.01359 0.33650 123 1.01497 Alistipes
OTU15 0.01342 0.33965 124 1.01622 Roseburia
OTU37 0.01340 0.33987 125 1.00874 Cloacibacterium
OTU300 0.01337 0.34042 126 1.00234 Lachnospiraceae Incertae Sedis
OTU165 0.01333 0.34119 127 0.9967 Alistipes
OTU188 0.01329 0.34201 128 0.99129 Lachnospiraceae Incertae Sedis
OTU156 0.01310 0.34551 129 0.99369 Lachnospiraceae Incertae Sedis
OTU304 0.01300 0.34727 130 0.99105 Faecalibacterium
OTU299 0.01299 0.34741 131 0.98388 Lachnospiraceae Incertae Sedis
OTU406 0.01300 0.34761 132 0.97701 Bacteroides
OTU177 0.01289 0.34929 133 0.97433 Butyrivibrio
OTU553 0.01251 0.35656 134 0.98718 Syntrophococcus
OTU190 0.01250 0.35680 135 0.98053 Rummococcaceae Incertae Sedis
OTU429 0.01210 0.36396 136 0.99285 Dorea
OTU149 0.01212 0.36424 137 0.98637 Haemophilus
OTU24 0.01209 0.36477 138 0.98066 Lachnospiraceae Incertae Sedis
OTU42 0.01196 0.36740 139 0.98061 Prevotella
OTU136 0.01194 0.36780 140 0.97468 Micrococcineae
OTU286 0.01183 0.37015 141 0.97395 Hallella
OTU33 0.01131 0.38093 142 0.99523 Lachnospiraceae Incertae Sedis
OTU455 0.01130 0.38152 143 0.98982 Finegoldia
OTU418 0.01100 0.38698 144 0.997 Stenotrophomonas
OTU91 0.01089 0.38984 145 0.99745 Lactobacillus
OTU256 0.01057 0.39700 146 1.00883 Anaerotruncus
OTU41 0.01030 0.40320 147 1.0176 Subdoligranulum
OTU126 0.01009 0.40791 148 1.02254 Aeromonas
OTU134 0.01007 0.40846 149 1.01703 Ruminococcaceae Incertae Sedis
OTU396 0.00984 0.41387 150 1.02364 Coprococcus
OTU244 0.00967 0.41805 151 1.02712 Prevotella
OTU403 0.00966 0.41823 152 1.02081 Methylobacterium
OTU344 0.00957 0.42046 153 1.01954 Carnobacteriaceae 1
OTU17 0.00947 0.42293 154 1.01888 Escherichia
OTU491 0.00942 0.42407 155 1.01503 Clostridiaceae 1
OTU44 0.00929 0.42739 156 1.01641 Lachnospiraceae Incertae Sedis
OTU29 0.00920 0.42964 157 1.01526 Lachnospiraceae Incertae Sedis
OTU79 0.00897 0.43556 158 1.02274 Lachnospiraceae Incertae Sedis
OTU284 0.00891 0.43701 159 1.01969 Rubritepida
OTU324 0.00890 0.43714 160 1.01362 Faecalibacterium
OTU366 0.00888 0.43768 161 1.00857 Coprococcus
OTU248 0.00884 0.43878 162 1.00486 Lachnospiraceae Incertae Sedis
OTU476 0.00881 0.43963 163 1.00062 Streptococcus
OTU94 0.00876 0.44084 164 0.99725 Anaerotruncus
OTU319 0.00861 0.44499 165 1.00054 Agrobacterium
OTU87 0.00860 0.44510 166 0.99478 Propionibacterineae
OTU11 0.00856 0.44623 167 0.99133 Bacteroides
OTU404 0.00834 0.45223 168 0.99867 Hallella
OTU45 0.00830 0.45326 169 0.99502 Xenohaliotis
OTU61 0.00826 0.45441 170 0.99169 Papillibacter
OTU283 0.00824 0.45488 171 0.9869 Anaerophaga
OTU22 0.00814 0.45764 172 0.98711 Acidovorax
OTU144 0.00814 0.45765 173 0.98144 Dorea
OTU347 0.00805 0.46007 174 0.98094 Vitellibacter
OTU285 0.00766 0.47129 175 0.99914 Butyrivibrio
OTU424 0.00762 0.47244 176 0.99589 Streptococcus
OTU189 0.00739 0.47908 177 1.00417 Acidovorax
OTU417 0.00736 0.47998 178 1.0004 Lachnobacterium
OTU34 0.00734 0.48061 179 0.99612 Dorea
OTU525 0.00724 0.48367 180 0.99691 Catonella
OTU7 0.00717 0.48574 181 0.99564 Bacteroides
OTU32 0.00699 0.49123 182 1.00136 Erysipelotrichaceae Incertae Sedis
OTU168 0.00696 0.49246 183 0.99838 Roseburia
OTU265 0.00694 0.49309 184 0.99422 Sphingomonas
OTU445 0.00686 0.49542 185 0.99352 Corynebacterineae
OTU272 0.00661 0.50356 186 1.00441 Sporobacter
OTU143 0.00640 0.51031 187 1.01243 Lachnospiraceae Incertae Sedis
OTU31 0.00633 0.51268 188 1.01172 Coprococcus
OTU48 0.00615 0.51875 189 1.01829 Bacteroides
OTU184 0.00604 0.52262 190 1.02049 Lachnospiraceae Incertae Sedis
OTU361 0.00599 0.52411 191 1.01804 Succinivibrio
OTU243 0.00590 0.52745 192 1.01919 Anaerotruncus
OTU159 0.00582 0.53006 193 1.01892 Faecalibacterium
OTU400 0.00581 0.53056 194 1.01464 Bryantella
OTU458 0.00574 0.53301 195 1.01409 Roseburia
OTU253 0.00565 0.53639 196 1.01531 Uruburuella
OTU74 0.00557 0.53901 197 1.01509 Ruminococcus
OTU139 0.00546 0.54311 198 1.01765 Azonexus
OTU199 0.00544 0.54396 199 1.01411 Acetanaerobacterium
OTU364 0.00541 0.54523 200 1.0114 Exiguobacterium
OTU129 0.00538 0.54619 201 1.00815 Roseburia
OTU71 0.00534 0.54778 202 1.00608 Lachnospiraceae Incertae Sedis
OTU317 0.00530 0.54939 203 1.00405 Prevotella
OTU52 0.00529 0.54965 204 0.99961 Lachnospiraceae Incertae Sedis
OTU53 0.00528 0.54981 205 0.99502 Succinivibrio
OTU62 0.00497 0.56195 206 1.01205 Ruminococcus
OTU9 0.00494 0.56331 207 1.00961 Bacteroides
OTU311 0.00484 0.56729 208 1.01184 Lachnospiraceae Incertae Sedis
OTU76 0.00483 0.56755 209 1.00747 Lachnobacterium
OTU89 0.00483 0.56764 210 1.00282 Bacteroides
OTU216 0.00471 0.57232 211 1.0063 Sphingomonas
OTU58 0.00470 0.57286 212 1.00251 Peptostreptococcaceae Incertae Sedis
OTU133 0.00469 0.57321 213 0.99841 Faecalibacterium
OTU493 0.00435 0.58737 214 1.01829 Lachnospiraceae Incertae Sedis
OTU327 0.00434 0.58810 215 1.01482 Pelomonas
OTU49 0.00427 0.59075 216 1.01466 Sutterella
OTU242 0.00427 0.59078 217 1.01005 Coriobacterineae
OTU359 0.00427 0.59097 218 1.00573 Faecalibacterium
OTU316 0.00424 0.59231 219 1.00341 Alistipes
OTU73 0.00421 0.59368 220 1.00116 Lactococcus
OTU2 0.00416 0.59600 221 1.00053 Faecalibacterium
OTU484 0.00410 0.59856 222 1.00029 Effluviibacter
OTU297 0.00408 0.59957 223 0.99749 Bacillaceae 1
OTU150 0.00406 0.60032 224 0.99428 Ruminococcaceae Incertae Sedis
OTU239 0.00388 0.60851 225 1.00337 Succinispira
OTU205 0.00376 0.61391 226 1.00778 Erysipelotrichaceae Incertae Sedis
OTU38 0.00375 0.61436 227 1.00408 Pseudomonas
OTU117 0.00370 0.61669 228 1.00347 Naxibacter
OTU274 0.00366 0.61881 229 1.00253 Lachnospiraceae Incertae Sedis
OTU341 0.00361 0.62128 230 1.00214 Prevotella
OTU170 0.00359 0.62208 231 0.9991 Bacteroides
OTU207 0.00358 0.62246 232 0.9954 Succinispira
OTU90 0.00346 0.62846 233 1.00069 Lachnospiraceae Incertae Sedis
OTU296 0.00337 0.63322 234 1.00396 Papillibacter
OTU238 0.00333 0.63519 235 1.00279 Lachnospiraceae Incertae Sedis
OTU227 0.00333 0.63529 236 0.9987 Lachnospiraceae Incertae Sedis
OTU374 0.00321 0.64151 237 1.00423 Lachnospiraceae Incertae Sedis
OTU114 0.00320 0.64157 238 1.0001 Megamonas
OTU152 0.00316 0.64412 239 0.99986 Faecalibacterium
OTU395 0.00315 0.64466 240 0.99653 Subdoligranulum
OTU326 0.00296 0.65473 241 1.0079 Lachnospiraceae Incertae Sedis
OTU226 0.00293 0.65630 242 1.00615 Rikenella
OTU56 0.00271 0.66884 243 1.02115 Delftia
OTU57 0.00270 0.66907 244 1.01731 Lachnospiraceae Incertae Sedis
OTU249 0.00269 0.66999 245 1.01456 Faecalibacterium
OTU187 0.00262 0.67379 246 1.01616 Erysipelotrichaceae Incertae Sedis
OTU173 0.00255 0.67803 247 1.01842 Anaerotruncus
OTU77 0.00255 0.67813 248 1.01446 Coprococcus
OTU519 0.00254 0.67847 249 1.01089 Catonella
OTU313 0.00252 0.67991 250 1.00899 Enterobacter
OTU233 0.00249 0.68143 251 1.00722 Syntrophococcus
OTU179 0.00241 0.68654 252 1.01074 Ruminococcaceae Incertae Sedis
OTU506 0.00237 0.68930 253 1.01079 Syntrophococcus
OTU103 0.00225 0.69653 254 1.01738 Roseburia
OTU407 0.00223 0.69779 255 1.01521 Turicibacter
OTU269 0.00222 0.69851 256 1.0123 Butyrivibrio
OTU222 0.00220 0.69989 257 1.01035 Prevotella
OTU193 0.00215 0.70341 258 1.01149 Xylanibacter
OTU132 0.00199 0.71391 259 1.02263 Parabacteroides
OTU411 0.00192 0.71867 260 1.02548 Faecalibacterium
OTU109 0.00191 0.71934 261 1.02251 Turicibacter
OTU181 0.00189 0.72104 262 1.02101 Bacteroides
OTU413 0.00183 0.72484 263 1.0225 Subdoligranulum
OTU508 0.00183 0.72503 264 1.01889 Lachnospiraceae Incertae Sedis
OTU127 0.00172 0.73283 265 1.02596 Lachnospiraceae Incertae Sedis
OTU219 0.00164 0.73945 266 1.03134 Rikenella
OTU202 0.00152 0.74899 267 1.04073 Lachnospiraceae Incertae Sedis
OTU158 0.00145 0.75455 268 1.04455 Bacteroides
OTU113 0.00145 0.75468 269 1.04084 Rikenella
OTU291 0.00143 0.75607 270 1.0389 Syntrophococcus
OTU35 0.00138 0.75983 271 1.0402 Bryantella
OTU69 0.00138 0.76032 272 1.03706 Lachnospiraceae Incertae Sedis
OTU360 0.00138 0.76046 273 1.03345 Faecalibacterium
OTU270 0.00137 0.76063 274 1.0299 Succinispira
OTU569 0.00136 0.76170 275 1.0276 Erwinia
OTU148 0.00121 0.77482 276 1.04151 Lachnospiraceae Incertae Sedis
OTU206 0.00118 0.77735 277 1.04114 Paludibacter
OTU338 0.00110 0.78478 278 1.04732 Micrococcineae
OTU25 0.00110 0.78564 279 1.04471 Parabacteroides
OTU108 0.00109 0.78588 280 1.04129 Lachnospiraceae Incertae Sedis
OTU328 0.00104 0.79060 281 1.04382 Parasporobacterium
OTU419 0.00104 0.79110 282 1.04078 Micrococcineae
OTU225 0.00104 0.79121 283 1.03725 Prevotella
OTU123 0.00104 0.79133 284 1.03375 Papillibacter
OTU460 0.00098 0.79703 285 1.03754 Lachnospiraceae Incertae Sedis
OTU70 0.00094 0.80105 286 1.03913 Sphingobium
OTU1 0.00093 0.80167 287 1.0363 Bacteroides
OTU387 0.00093 0.80206 288 1.03321 Coprococcus
OTU345 0.00090 0.80526 289 1.03374 Butyrivibrio
OTU137 0.00090 0.80547 290 1.03045 Prevotella
OTU10 0.00089 0.80605 291 1.02764 Coprobacillus
OTU312 0.00083 0.81254 292 1.03237 Coriobacterineae
OTU307 0.00080 0.81611 293 1.03337 Megamonas
OTU353 0.00079 0.81796 294 1.03218 Dorea
OTU196 0.00078 0.81801 295 1.02875 Bacteroides
OTU8 0.00078 0.81824 296 1.02556 Dorea
OTU178 0.00072 0.82507 297 1.03064 Lachnospiraceae Incertae Sedis
OTU106 0.00072 0.82581 298 1.02811 Lachnospiraceae Incertae Sedis
OTU437 0.00071 0.82714 299 1.02632 Marinilabilia
OTU393 0.00069 0.82865 300 1.02476 Micrococcineae
OTU502 0.00067 0.83190 301 1.02536 Paludibacter
OTU349 0.00066 0.83311 302 1.02345 Syntrophococcus
OTU343 0.00065 0.83398 303 1.02115 Lachnobacterium
OTU354 0.00064 0.83515 304 1.01921 Anaerotruncus
OTU120 0.00064 0.83562 305 1.01644 Micrococcineae
OTU368 0.00060 0.83993 306 1.01835 Ruminococcaceae Incertae Sedis
OTU330 0.00060 0.84109 307 1.01643 Coriobacterineae
OTU18 0.00058 0.84311 308 1.01557 Faecalibacterium
OTU379 0.00055 0.84661 309 1.01647 Roseburia
OTU355 0.00052 0.85194 310 1.01958 Corynebacterineae
OTU169 0.00048 0.85685 31 1 1.02216 Streptococcus
OTU217 0.00044 0.86299 312 1.02619 Prevotella
OTU97 0.00044 0.86362 313 1.02365 Pseudomonas
OTU315 0.00043 0.86508 314 1.02211 Coriobacterineae
OTU453 0.00041 0.86851 315 1.02292 Faecalibacterium
OTU293 0.00041 0.86858 316 1.01975 Lachnospiraceae Incertae Sedis
OTU160 0.00039 0.87159 317 1.02006 Lachnospiraceae Incertae Sedis
OTU93 0.00038 0.87290 318 1.01839 Alistipes
OTU303 0.00037 0.87374 319 1.01617 Faecalibacterium
OTU128 0.00036 0.87555 320 1.01509 Prevotella
OTU86 0.00035 0.87754 321 1.01423 Fusobacterium
OTU264 0.00035 0.87829 322 1.01195 Comamonas
OTU171 0.00034 0.87891 323 1.00952 Bacteroides
OTU100 0.00032 0.88369 324 1.01187 Xylanibacter
OTU176 0.00032 0.88369 325 1.00877 Erwinia
OTU235 0.00030 0.88760 326 1.01013 Desulfovibrio
OTU142 0.00027 0.89298 327 1.01314 Lachnospiraceae Incertae Sedis
OTU183 0.00025 0.89598 328 1.01344 Bacteroides
OTU391 0.00024 0.89806 329 1.01271 Aquiflexum
OTU85 0.00024 0.89815 330 1.00974 Bacteroides
OTU224 0.00023 0.90135 331 1.01028 Prevotella
OTU55 0.00023 0.90176 332 1.00769 Parabacteroides
OTU166 0.00022 0.90242 333 1.00539 Lachnospiraceae Incertae Sedis
OTU322 0.00021 0.90433 334 1.00451 Roseburia
OTU14 0.00020 0.90785 335 1.0054 Erysipelotrichaceae Incertae Sedis
OTU408 0.00019 0.90951 336 1.00425 Bryantella
OTU54 0.00018 0.91151 337 1.00347 Lachnospiraceae Incertae Sedis
OTU64 0.00017 0.91495 338 1.00428 Erwinia
OTU83 0.00017 0.91541 339 1.00182 Dorea
OTU68 0.00016 0.91804 340 1.00175 Dorea
OTU5 0.00015 0.92125 341 1.0023 Sphingomonas
OTU145 0.00014 0.92320 342 1.00149 Afipia
OTU119 0.00014 0.92370 343 0.9991 Lachnobacterium
OTU442 0.0001 1 0.93035 344 1.00337 Roseburia
OTU412 0.0001 1 0.93055 345 1.00068 Sphingomonas
OTU474 0.0001 1 0.93058 346 0.99781 Sphingobium
OTU20 0.0001 1 0.93225 347 0.99673 Lachnospiraceae Incertae Sedis
OTU254 0.00010 0.93343 348 0.99512 Lachnospiraceae Incertae Sedis
OTU260 0.00010 0.93363 349 0.99248 Erysipelotrichaceae Incertae Sedis
OTU287 0.00010 0.93561 350 0.99175 Anaerovorax
OTU250 0.00009 0.93893 351 0.99243 Paludibacter
OTU422 0.00009 0.93947 352 0.99018 Peptococcaceae 1
OTU140 0.00008 0.94086 353 0.98883 Faecalibacterium
OTU421 0.00008 0.94289 354 0.98817 Streptococcus
OTU161 0.00006 0.94925 355 0.99203 Prevotella
OTU135 0.00006 0.94978 356 0.9898 Clostridiaceae 1
OTU375 0.00005 0.95255 357 0.98991 Pseudomonas
OTU191 0.00005 0.95294 358 0.98754 Subdoligranulum
OTU122 0.00004 0.95860 359 0.99064 Prevotella
OTU162 0.00004 0.95894 360 0.98824 Veillonella
OTU501 0.00004 0.95986 361 0.98645 Ruminococcaceae Incertae Sedis
OTU275 0.00004 0.96063 362 0.98452 Lachnospiraceae Incertae Sedis
OTU213 0.00004 0.96094 363 0.98212 Lactococcus
OTU141 0.00003 0.96233 364 0.98084 Faecalibacterium
OTU363 0.00003 0.96649 365 0.98238 Faecalibacterium
OTU130 0.00002 0.97345 366 0.98675 Lachnospiraceae Incertae Sedis
OTU409 0.00001 0.97609 367 0.98673 Alkalilimnicola
OTU471 0.00001 0.97787 368 0.98584 Lachnospiraceae Incertae Sedis
OTU247 0.00000 0.98560 369 0.99095 Xylanibacter
OTU118 0.00000 0.99027 370 0.99295 Burkholderia
OTU92 0.00000 0.99641 371 0.99641 Rubrobacterineae
[00138] Table 7: Regressions on log-normalized abundances of OTUs (97%) vs. WHRs of all samples with RDP classification of consensus sequences at genus level shown. Only OTUs which have at least 1 sequence assigned to them in 25% of the samples are shown. Regression p-Values were corrected for multiple testing using (n*p)/R where n = total number of taxa tested, p = raw p-Value and R = sorted rank of the taxon. Benjamini & Hochberg (1995).
TABLE 7
OTU162 0.05520 0.04858 16 1.12656 Veillonella
OTU11 0.05483 0.04936 17 1.07724 Bacteroides
OTU420 0.05420 0.05065 18 1.04393 Dorea
OTU2 0.05334 0.05265 19 1.02803 Faecalibacterium
OTU306 0.05307 0.05327 20 0.98819 Oligotropha
OTU14 0.05298 0.05347 21 0.94458 Erysipelotrichaceae Incertae Sedis
OTU122 0.04952 0.06214 22 1.04792 Prevotella
OTU65 0.04587 0.07291 23 1.17604 Lachnospiraceae Incertae Sedis
OTU242 0.04413 0.07870 24 1.21653 Coriobacterineae
OTU199 0.04234 0.08517 25 1.26385 Acetanaerobacterium
OTU330 0.04207 0.08618 26 1.22971 Coriobacterineae
OTU239 0.04187 0.08696 27 1.19491 Succinispira
OTU197 0.04077 0.09130 28 1.20971 Lactobacillus
OTU229 0.03893 0.09909 29 1.26763 Coriobacterineae
OTU149 0.03824 0.10219 30 1.26381 Haemophilus
OTU28 0.03786 0.10396 31 1.24416 Bacteroides
OTU49 0.03752 0.10553 32 1.2235 Sutterella
OTU237 0.03741 0.10605 33 1.19224 Prevotella
OTU29 0.03739 0.10616 34 1.15839 Lachnospiraceae Incertae Sedis
OTU27 0.03664 0.10980 35 1.16391 Lachnospiraceae Incertae Sedis
OTU74 0.03641 0.11095 36 1.14341 Ruminococcus
OTU284 0.03627 0.11165 37 1.11954 Rubritepida
OTU198 0.03622 0.11189 38 1.09235 Lachnospiraceae Incertae Sedis
OTU329 0.03581 0.11399 39 1.08437 Methanohalobium
OTU283 0.03545 0.11583 40 1.07435 Anaerophaga
OTU72 0.03517 0.11730 41 1.06145 Aquabacterium
OTU309 0.03504 0.11804 42 1.04269 Paludibacter
OTU59 0.03413 0.12299 43 1.06115 Acinetobacter
OTU470 0.03410 0.12300 44 1.03708 Lachnospiraceae Incertae Sedis
OTU173 0.03391 0.12420 45 1.02394 Anaerotruncus
OTU454 0.03280 0.13051 46 1.05262 Paludibacter
OTU16 0.03271 0.13118 47 1.03546 Lachnospiraceae Incertae Sedis
OTU356 0.03220 0.13429 48 1.03794 Novosphingobium
OTU46 0.03150 0.13869 49 1.05007 Bacillaceae 1
OTU98 0.03113 0.14105 50 1.04662 Lachnospiraceae Incertae Sedis
OTU288 0.03108 0.14138 51 1.02847 Ruminococcaceae Incertae Sedis
OTU474 0.03040 0.14608 52 1.04224 Sphingobium
OTU104 0.02913 0.15475 53 1.08326 Syntrophococcus
OTU429 0.02890 0.15635 54 1.07418 Dorea
OTU41 0.02856 0.15889 55 1.07178 Subdoligranulum
OTU117 0.02834 0.16052 56 1.06347 Naxibacter
OTU96 0.02828 0.16096 57 1.04767 Diaphorobacter
OTU143 0.02795 0.16346 58 1.04555 Lachnospiraceae Incertae Sedis
OTU367 0.02760 0.16620 59 1.04507 Pseudomonas
OTU34 0.02734 0.16820 60 1.04003 Dorea
OTU200 0.02721 0.16926 61 1.02946 Helicobacter
OTU525 0.02660 0.17395 62 1.04092 Catonella
OTU42 0.02657 0.17443 63 1.02721 Prevotella
OTU376 0.02630 0.17634 64 1.02221 Methylobacterium
OTU128 0.02590 0.18004 65 1.02761 Prevotella
OTU368 0.02540 0.18463 66 1.03784 Rummococcaceae Incertae Sedis
OTU58 0.02536 0.18466 67 1.0225 Peptostreptococcaceae Incertae Sedis
OTU349 0.02528 0.18537 68 1.01137 Syntrophococcus
OTU268 0.02473 0.19030 69 1.02319 Staphylococcus
OTU88 0.02472 0.19038 70 1.00902 Streptococcus
OTU327 0.02412 0.19593 71 1.02381 Pelomonas
OTU370 0.02370 0.19945 72 1.02772 Lactobacillus
OTU134 0.02349 0.20191 73 1.02617 Ruminococcaceae Incertae Sedis
OTU150 0.02343 0.20256 74 1.01552 Ruminococcaceae Incertae Sedis
OTU203 0.02326 0.20419 75 1.01007 Rheinheimera
OTU391 0.02320 0.20459 76 0.99874 Aquiflexum
OTU363 0.02250 0.21188 77 1.02088 Faecalibacterium
OTU413 0.02250 0.21201 78 1.00838 Subdoligranulum
OTU231 0.02211 0.21589 79 1.01386 Anaerotruncus
OTU66 0.02207 0.21626 80 1.00289 Streptococcus
OTU350 0.02190 0.21793 81 0.99816 Coprococcus
OTU269 0.02141 0.22340 82 1.01077 Butyrivibrio
OTU131 0.02120 0.22564 83 1.0086 Lachnospiraceae Incertae Sedis
OTU61 0.02022 0.23682 84 1.04596 Papillibacter
OTU235 0.02020 0.23709 85 1.03484 Desulfovibrio
OTU343 0.02019 0.23722 86 1.02337 Lachnobacterium
OTU172 0.01971 0.24294 87 1.03601 Marinilabilia
OTU299 0.01952 0.24515 88 1.03353 Lachnospiraceae Incertae Sedis
OTU425 0.01920 0.24895 89 1.03778 Enhydrobacter
OTU213 0.01908 0.25071 90 1.0335 Lactococcus
OTU25 0.01902 0.25143 91 1.02507 Parabacteroides
OTU140 0.01892 0.25267 92 1.01892 Faecalibacterium
OTU403 0.01870 0.25498 93 1.01717 Methylobacterium
OTU204 0.01831 0.26054 94 1.02831 Dialister
OTU157 0.01811 0.26320 95 1.02788 Marinilabilia
OTU359 0.01780 0.26799 96 1.03568 Faecalibacterium
OTU214 0.01759 0.27025 97 1.03365 Roseburia
OTU566 0.01752 0.27111 98 1.02633 Dorea
OTU37 0.01740 0.27290 99 1.02267 Cloacibacterium
OTU371 0.01740 0.27331 100 1.01397 Comamonas
OTU18 0.01721 0.27546 101 1.01184 Faecalibacterium
OTU146 0.01721 0.27553 102 1.00216 Vibrio
OTU354 0.01710 0.27690 103 0.99738 Anaerotruncus
OTU357 0.01690 0.27932 104 0.99642 Coprococcus
OTU334 0.01680 0.28133 105 0.99405 Citrobacter
OTU352 0.01630 0.28894 106 1.0113 Saprospira
OTU274 0.01605 0.29249 107 1.01413 Lachnospiraceae Incertae Sedis
OTU326 0.01598 0.29346 108 1.0081 Lachnospiraceae Incertae Sedis
OTU1 0.01594 0.29407 109 1.00092 Bacteroides
OTU191 0.01560 0.29941 110 1.00983 Subdoligranulum
OTU40 0.01507 0.30780 111 1.02877 Lachnospiraceae Incertae Sedis
OTU226 0.01504 0.30832 1 12 1.0213 Rikenella
OTU48 0.01480 0.31210 113 1.02469 Bacteroides
OTU39 0.01476 0.31278 114 1.0179 Coriobacterineae
OTU364 0.01470 0.31323 115 1.0105 Exiguobacterium
OTU178 0.01467 0.31438 116 1.00547 Lachnospiraceae Incertae Sedis
OTU113 0.01446 0.31778 117 1.00765 Rikenella
OTU32 0.01434 0.31990 118 1.0058 Erysipelotrichaceae Incertae Sedis
OTU296 0.01416 0.32295 119 1.00685 Papillibacter
OTU153 0.01415 0.3231 1 120 0.99894 Roseburia
OTU502 0.01410 0.32410 121 0.99373 Paludibacter
OTU324 0.01390 0.32745 122 0.99577 Faecalibacterium
OTU1 10 0.01387 0.32801 123 0.98936 Lachnospiraceae Incertae Sedis
OTU315 0.01382 0.32888 124 0.98397 Coriobacterineae
OTU102 0.01344 0.33568 125 0.99631 Lachnospiraceae Incertae Sedis
OTU193 0.01339 0.33664 126 0.99121 Xylanibacter
OTU15 0.01337 0.33695 127 0.98432 Roseburia
OTU103 0.01314 0.34116 128 0.98882 Roseburia
OTU184 0.01280 0.34746 129 0.99928 Lachnospiraceae Incertae Sedis
OTU169 0.01267 0.34993 130 0.99865 Streptococcus
OTU23 0.01263 0.35081 131 0.99351 Lachnospiraceae Incertae Sedis
OTU53 0.01249 0.35340 132 0.99326 Succinivibrio
OTU247 0.01237 0.35585 133 0.99263 Xylanibacter
OTU7 0.01232 0.35687 134 0.98806 Bacteroides
OTU20 0.01229 0.35738 135 0.98213 Lachnospiraceae Incertae Sedis
OTU77 0.01223 0.35855 136 0.97811 Coprococcus
OTU358 0.01210 0.36096 137 0.97748 Roseburia
OTU423 0.01200 0.36253 138 0.97464 Parasporobacterium
OTU508 0.01190 0.36508 139 0.97443 Lachnospiraceae Incertae Sedis
OTU322 0.01160 0.37141 140 0.98423 Roseburia
OTU84 0.01 152 0.37297 141 0.98135 Marinomonas
OTU210 0.01152 0.37298 142 0.97447 Allobaculum
OTU22 0.01147 0.37410 143 0.97058 Acidovorax
OTU380 0.01120 0.37870 144 0.97568 Sporobacter
OTU553 0.01109 0.38216 145 0.97781 Syntrophococcus
OTU389 0.01090 0.38598 146 0.9808 Parabacteroides
OTU392 0.01060 0.39195 147 0.98921 Lachnospiraceae Incertae Sedis
OTU344 0.01063 0.39231 148 0.98343 Carnobacteriaceae 1
OTU506 0.01060 0.39366 149 0.98018 Syntrophococcus
OTU177 0.01020 0.40194 150 0.99414 Butyrivibrio
OTU399 0.01000 0.40554 151 0.99638 Ralstonia
OTU300 0.00991 0.40888 152 0.99798 Lachnospiraceae Incertae Sedis
OTU316 0.00972 0.41345 153 1.00255 Alistipes
OTU456 0.00959 0.41661 154 1.00364 Anaerovorax
OTU293 0.00946 0.41960 155 1.00433 Lachnospiraceae Incertae Sedis
OTU21 0.00935 0.42250 156 1.0048 Finegoldia
OTU361 0.00922 0.42574 157 1.00604 Succinivibrio
OTU202 0.00914 0.42775 158 1.00439 Lachnospiraceae Incertae Sedis
OTU366 0.00895 0.43267 159 1.00957 Coprococcus
OTU35 0.00884 0.43540 160 1.00958 Bryantella
OTU275 0.00833 0.44901 161 1.03468 Lachnospiraceae Incertae Sedis
OTU126 0.00830 0.44997 162 1.03049 Aeromonas
OTU189 0.00828 0.45054 163 1.02547 Acidovorax
OTU158 0.00826 0.45096 164 1.02016 Bacteroides
OTU43 0.00807 0.45634 165 1.02607 Lachnospiraceae Incertae Sedis
OTU105 0.00801 0.45787 166 1.02332 Bacteroides
OTU9 0.00797 0.45913 167 1.01997 Bacteroides
OTU297 0.00745 0.47430 168 1.04742 Bacillaceae 1
OTU80 0.00741 0.47546 169 1.04376 Lachnospiraceae Incertae Sedis
OTU277 0.00732 0.47801 170 1.04318 Lachnospiraceae Incertae Sedis
OTU395 0.00727 0.47963 171 1.04061 Subdoligranulum
OTU365 0.00727 0.47972 172 1.03475 Succinispira
OTU67 0.00726 0.47982 173 1.02898 Lactobacillus
OTU372 0.00714 0.48370 174 1.03133 Allomonas
OTU419 0.00701 0.48759 175 1.03368 Micrococcineae
OTU101 0.00697 0.48875 176 1.03027 Pseudoalteromonas
OTU10 0.00692 0.49053 177 1.02818 Coprobacillus
OTU154 0.00685 0.49266 178 1.02683 Faecalibacterium
OTU93 0.00677 0.49515 179 1.02626 Alistipes
OTU62 0.00672 0.49684 180 1.02404 Ruminococcus
OTU404 0.00645 0.50544 181 1.03602 Hallella
OTU406 0.00645 0.50564 182 1.03073 Bacteroides
OTU241 0.00635 0.50892 183 1.03175 Chryseobacterium
OTU151 0.00634 0.50932 184 1.02695 Subdoligranulum
OTU307 0.00629 0.51093 185 1.02461 Megamonas
OTU155 0.00621 0.51362 186 1.02448 Roseburia
OTU264 0.00619 0.51413 187 1.02 Comamonas
OTU124 0.00607 0.51856 188 1.02333 Lactobacillus
OTU227 0.00595 0.52273 189 1.0261 Lachnospiraceae Incertae Sedis
OTU12 0.00581 0.52761 190 1.03023 Bryantella
OTU442 0.00580 0.52800 191 1.02559 Roseburia
OTU187 0.00572 0.53082 192 1.0257 Erysipelotrichaceae Incertae Sedis
OTU45 0.00570 0.53138 193 1.02145 Xenohaliotis
OTU240 0.00562 0.53429 194 1.02176 Weissella
OTU95 0.00533 0.54511 195 1.03711 Ruminococcus
OTU87 0.00532 0.54540 196 1.03237 Propionibacterineae
OTU129 0.00524 0.54849 197 1.03295 Roseburia
OTU243 0.00519 0.55054 198 1.03156 Anaerotruncus
OTU133 0.00517 0.55109 199 1.02741 Faecalibacterium
OTU401 0.00516 0.55153 200 1.0231 Alistipes
OTU421 0.00511 0.55354 201 1.02171 Streptococcus
OTU152 0.00508 0.55466 202 1.01871 Faecalibacterium
OTU253 0.00503 0.55669 203 1.0174 Uruburuella
OTU171 0.00501 0.55767 204 1.01419 Bacteroides
OTU109 0.00499 0.55827 205 1.01034 Turicibacter
OTU445 0.00483 0.56471 206 1.01703 Corynebacterineae
OTU137 0.00471 0.56939 207 1.0205 Prevotella
OTU100 0.00458 0.57482 208 1.02527 Xylanibacter
OTU130 0.00454 0.57648 209 1.02333 Lachnospiraceae Incertae Sedis
OTU328 0.00454 0.57671 210 1.01885 Parasporobacterium
OTU378 0.00452 0.57768 211 1.01573 Bacillaceae 1
OTU183 0.00442 0.58181 212 1.01816 Bacteroides
OTU26 0.00438 0.58344 213 1.01623 Dorea
OTU432 0.00438 0.58352 214 1.01161 Paludibacter
OTU317 0.00426 0.58867 215 1.01579 Prevotella
OTU256 0.00424 0.58935 216 1.01226 Anaerotruncus
OTU353 0.00424 0.58952 217 1.00789 Dorea
OTU114 0.00424 0.58957 218 1.00335 Megamonas
OTU453 0.00421 0.59104 219 1.00126 Faecalibacterium
OTU94 0.00411 0.59542 220 1.0041 Anaerotruncus
OTU460 0.00405 0.59791 221 1.00373 Lachnospiraceae Incertae Sedis
OTU194 0.00393 0.60353 222 1.0086 Alistipes
OTU159 0.00384 0.60749 223 1.01066 Faecalibacterium
OTU141 0.00369 0.61465 224 1.01802 Faecalibacterium
OTU90 0.00369 0.61470 225 1.01357 Lachnospiraceae Incertae Sedis
OTU217 0.00367 0.61566 226 1.01066 Prevotella
OTU397 0.00363 0.61788 227 1.00983 Peptostreptococcaceae Incertae Sedis
OTU374 0.00353 0.62263 228 1.01314 Lachnospiraceae Incertae Sedis
OTU148 0.00345 0.62636 229 1.01476 Lachnospiraceae Incertae Sedis
OTU19 0.00337 0.63044 230 1.01693 Syntrophococcus
OTU422 0.00334 0.63195 231 1.01495 Peptococcaceae 1
OTU418 0.00309 0.64516 232 1.0317 Stenotrophomonas
OTU33 0.00308 0.64573 233 1.02818 Lachnospiraceae Incertae Sedis
OTU38 0.00307 0.64629 234 1.02467 Pseudomonas
OTU75 0.00303 0.64841 235 1.02366 Stenotrophomonas
OTU138 0.00287 0.65749 236 1.0336 Simkania
OTU396 0.00276 0.66333 237 1.03838 Coprococcus
OTU311 0.00274 0.66482 238 1.03634 Lachnospiraceae Incertae Sedis
OTU73 0.00270 0.66679 239 1.03505 Lactococcus
OTU455 0.00255 0.67552 240 1.04424 Finegoldia
OTU407 0.00250 0.67877 241 1.04492 Turicibacter
OTU238 0.00247 0.68035 242 1.04301 Lachnospiraceae Incertae Sedis
OTU501 0.00245 0.68189 243 1.04107 Ruminococcaceae Incertae Sedis
OTU6 0.00241 0.68430 244 1.04047 Lachnospiraceae Incertae Sedis
OTU225 0.00236 0.68772 245 1.04141 Prevotella
OTU347 0.00233 0.68910 246 1.03925 Vitellibacter
OTU355 0.00229 0.69179 247 1.03909 Corynebacterineae
OTU135 0.00229 0.69192 248 1.03508 Clostridiaceae 1
OTU8 0.00225 0.69454 249 1.03483 Dorea
OTU417 0.00225 0.69474 250 1.031 Lachnobacterium
OTU30 0.00217 0.69963 251 1.03412 Bryantella
OTU484 0.00210 0.70453 252 1.03722 Effluviibacter
OTU265 0.00199 0.71215 253 1.04431 Sphingomonas
OTU24 0.00195 0.71462 254 1.04379 Lachnospiraceae Incertae Sedis
OTU224 0.00194 0.71545 255 1.04092 Prevotella
OTU219 0.00181 0.72457 256 1.05005 Rikenella
OTU499 0.00174 0.72958 257 1.0532 Lachnospiraceae Incertae Sedis
OTU192 0.00171 0.73229 258 1.05302 Sphingomonas
OTU212 0.00169 0.73349 259 1.05067 Coprobacillus
OTU312 0.00164 0.73726 260 1.05202 Coriobacterineae
OTU55 0.00163 0.73794 261 1.04895 Parabacteroides
OTU286 0.00163 0.73815 262 1.04524 Hallella
OTU142 0.00158 0.74217 263 1.04693 Lachnospiraceae Incertae Sedis
OTU106 0.00155 0.74467 264 1.04648 Lachnospiraceae Incertae Sedis
OTU161 0.00144 0.75323 265 1.05452 Prevotella
OTU165 0.00141 0.75569 266 1.05399 Alistipes
OTU186 0.00139 0.75723 267 1.05218 Faecalibacterium
OTU439 0.00136 0.76031 268 1.05251 Algibacter
OTU291 0.00135 0.76100 269 1.04956 Syntrophococcus
OTU108 0.00123 0.77123 270 1.05973 Lachnospiraceae Incertae Sedis
OTU424 0.00123 0.77154 271 1.05624 Streptococcus
OTU176 0.00120 0.77451 272 1.05641 Erwinia
OTU119 0.00117 0.77710 273 1.05605 Lachnobacterium
OTU338 0.00116 0.77791 274 1.0533 Micrococcineae
OTU206 0.00106 0.78756 275 1.06249 Paludibacter
OTU182 0.00105 0.78893 276 1.06048 Lachnospiraceae Incertae Sedis
OTU118 0.00104 0.78945 277 1.05735 Burkholderia
OTU57 0.00104 0.78976 278 1.05395 Lachnospiraceae Incertae Sedis
OTU17 0.00098 0.79508 279 1.05725 Escherichia
OTU60 0.00096 0.79778 280 1.05705 Subdoligranulum
OTU89 0.00094 0.79996 281 1.05618 Bacteroides
OTU111 0.00092 0.80186 282 1.05493 Peptostreptococcaceae Incertae Sedis
OTU144 0.00088 0.80648 283 1.05726 Dorea
OTU181 0.00087 0.80664 284 1.05375 Bacteroides
OTU411 0.00081 0.81405 285 1.0597 Faecalibacterium
OTU127 0.00080 0.81495 286 1.05715 Lachnospiraceae Incertae Sedis
OTU91 0.00069 0.82817 287 1.07056 Lactobacillus
OTU285 0.00068 0.82973 288 1.06886 Butyrivibrio
OTU195 0.00067 0.83061 289 1.06628 Pseudoalteromonas
OTU379 0.00067 0.83079 290 1.06284 Roseburia
OTU266 0.00065 0.83282 291 1.06177 Bacteroides
OTU145 0.00063 0.83611 292 1.06231 Afipia
OTU56 0.00062 0.83641 293 1.05907 Delftia
OTU76 0.00062 0.83735 294 1.05666 Lachnobacterium
OTU292 0.00057 0.84278 295 1.05991 Alistipes
OTU168 0.00056 0.84464 296 1.05865 Roseburia
OTU179 0.00056 0.84494 297 1.05546 Ruminococcaceae Incertae Sedis
OTU538 0.00046 0.85925 298 1.06974 Lachnospiraceae Incertae Sedis
OTU319 0.00043 0.86444 299 1.07259 Agrobacterium
OTU360 0.00042 0.86578 300 1.07068 Faecalibacterium
OTU120 0.00041 0.86755 301 1.06931 Micrococcineae
OTU188 0.00040 0.86888 302 1.0674 Lachnospiraceae Incertae Sedis
OTU50 0.00040 0.86920 303 1.06427 Sutterella
OTU387 0.00040 0.86939 304 1.061 Coprococcus
OTU493 0.00038 0.87259 305 1.06141 Lachnospiraceae Incertae Sedis
OTU167 0.00036 0.87483 306 1.06066 Allobaculum
OTU375 0.00036 0.87558 307 1.05811 Pseudomonas
OTU412 0.00035 0.87630 308 1.05554 Sphingomonas
OTU250 0.00033 0.87983 309 1.05636 Paludibacter
OTU409 0.00032 0.88166 310 1.05514 Alkalilimnicola
OTU136 0.00032 0.88268 311 1.05298 Micrococcineae
OTU51 0.00031 0.88342 312 1.05047 Klebsiella
OTU373 0.00029 0.88727 313 1.05168 Sporobacter
OTU164 0.00029 0.88754 314 1.04866 Faecalibacterium
OTU115 0.00028 0.89031 315 1.04859 Roseburia
OTU260 0.00028 0.89035 316 1.04532 Erysipelotrichaceae Incertae Sedis
OTU491 0.00028 0.89058 317 1.04229 Clostridiaceae 1
OTU97 0.00027 0.89157 318 1.04016 Pseudomonas
OTU408 0.00025 0.89598 319 1.04204 Bryantella
OTU207 0.00023 0.90106 320 1.04466 Succinispira
OTU107 0.00023 0.90113 321 1.04149 Ruminococcus
OTU452 0.00020 0.90578 322 1.04362 Butyrivibrio
OTU341 0.00020 0.90713 323 1.04193 Prevotella
OTU287 0.00020 0.90727 324 1.03888 Anaerovorax
OTU156 0.00019 0.90839 325 1.03696 Lachnospiraceae Incertae Sedis
OTU216 0.00016 0.91636 326 1.04285 Sphingomonas
OTU86 0.00016 0.91719 327 1.0406 Fusobacterium
OTU92 0.00016 0.91754 328 1.03783 Rubrobacterineae
OTU205 0.00013 0.92564 329 1.04381 Erysipelotrichaceae Incertae Sedis
OTU180 0.00013 0.92568 330 1.04068 Roseburia
OTU230 0.00012 0.92648 331 1.03844 Butyrivibrio
OTU196 0.00012 0.92666 332 1.03552 Bacteroides
OTU166 0.00012 0.92794 333 1.03383 Lachnospiraceae Incertae Sedis
OTU139 0.00011 0.93013 334 1.03317 Azonexus
OTU83 0.00011 0.93076 335 1.03078 Dorea
OTU82 0.00010 0.93505 336 1.03245 Roseburia
OTU254 0.00009 0.93617 337 1.03062 Lachnospiraceae Incertae Sedis
OTU304 0.00009 0.93661 338 1.02806 Faecalibacterium
OTU222 0.00009 0.93812 339 1.02667 Prevotella
OTU5 0.00008 0.93979 340 1.02547 Sphingomonas
OTU85 0.00008 0.94221 341 1.0251 Bacteroides
OTU313 0.00006 0.94976 342 1.0303 Enterobacter
OTU233 0.00006 0.94995 343 1.0275 Syntrophococcus
OTU569 0.00005 0.95462 344 1.02955 Erwinia
OTU463 0.00004 0.95591 345 1.02795 Lachnospiraceae Incertae Sedis
OTU345 0.00004 0.95812 346 1.02735 Butyrivibrio
OTU190 0.00004 0.96018 347 1.02659 Ruminococcaceae Incertae Sedis
OTU68 0.00004 0.96091 348 1.02442 Dorea
OTU519 0.00003 0.96198 349 1.02262 Catonella
OTU44 0.00003 0.96309 350 1.02087 Lachnospiraceae Incertae Sedis
OTU71 0.00003 0.96365 351 1.01856 Lachnospiraceae Incertae Sedis
OTU64 0.00003 0.96397 352 1.016 Erwinia
OTU464 0.00002 0.97445 353 1.02414 Marinilabilia
OTU495 0.00001 0.97451 354 1.02131 Streptococcus
OTU248 0.00001 0.97479 355 1.01873 Lachnospiraceae Incertae Sedis
OTU70 0.00001 0.97564 356 1.01675 Sphingobium
OTU160 0.00001 0.97732 357 1.01564 Lachnospiraceae Incertae Sedis
OTU244 0.00001 0.97775 358 1.01325 Prevotella
OTU272 0.00001 0.97876 359 1.01147 Sporobacter
OTU267 0.00001 0.97889 360 1.0088 Parabacteroides
OTU170 0.00001 0.98074 361 1.00791 Bacteroides
OTU303 0.00001 0.98274 362 1.00717 Faecalibacterium
OTU458 0.00000 0.98693 363 1.00868 Roseburia
OTU270 0.00000 0.98704 364 1.00602 Succinispira
OTU393 0.00000 0.98709 365 1.00331 Micrococcineae
OTU400 0.00000 0.98754 366 1.00103 Bryantella
OTU547 0.00000 0.98883 367 0.99961 Subdoligranulum
OTU52 0.00000 0.99158 368 0.99966 Lachnospiraceae Incertae Sedis
OTU69 0.00000 0.99172 369 0.9971 Lachnospiraceae Incertae Sedis
OTU47 0.00000 0.99456 370 0.99725 Succinispira
OTU437 0.00000 0.99660 371 0.9966 Marinilabilia
[00139] Taken together, these findings demonstrate that the development of adenomas is associated with changes in the relative abundance of various taxa, including pathogens, present in the gut mucosa and that these changes are distinct from those associated with obesity. Analogous to the mechanism suggested for inflammatory bowel diseases, a potential explanation for this observation could be that the presence of adenomas compromises gut mucosal immunity, leading to an increased relative abundance in known pathogens such as Pseudomonas, Helicobacter, Acinetobacter (Table 2 and 3) and other genera belonging to the phylum Proteobacteria (Figure. 2). For IBD, see Chichlowski, M. & Hale, L.P. Bacterial-mucosal interactions in inflammatory bowel disease: an alliance gone bad. Am J Physiol Gastrointest Liver Physiol 295, Gl 139-1 149 (2008). This increased relative abundance of various taxa including pathogens is in turn responsible for an overall increase in microbial richness in cases compared to controls (Figure 1).
[00140] Alternatively, the presence of these pathogens may directly increase the risk of adenoma development by changing the gut environment. For example, Helicobacter has a much higher relative abundance in cases vs. controls (Table 2 & 3) consistent with previous studies, which implicate the role of this bacterium in colorectal adenomas; a possible explanation for this association is that this microbe alters the pH of the gastrointestinal tract. See, Jones, M., Helliwell, P., Pritchard, C, Tharakan, J. & Mathew, J. Helicobacter pylori in colorectal neoplasms: is there an aetiological relationship? World J Surg Oncol 5, 51 (2007); Burnett-Hartman, A.N., Newcomb, P.A. & Potter, J.D. Infectious agents and colorectal cancer: a review of Helicobacter pylori, Streptococcus bovis, JC virus, and human papillomavirus. Cancer Epidemiol Biomarkers Prev 17, 2970-2979 (2008); Zumkeller, N., Brenner, H., Zwahlen, M. & Rothenbacher, D. Helicobacter pylori infection and colorectal cancer risk: a meta-analysis. Helicobacter 11, 75-80 (2006); Abbolito, M.R., et al. The association of Helicobacter pylori infection with low levels of urea and pH in the gastric juices. Ital J Gastroenterol 24, 389-392 (1992); and Chen, G., Fournier, R.L., Varanasi, S. & Mahama-Relue, P.A. Helicobacter pylori survival in gastric mucosa by generation of a pH gradient. Biophys J 73, 1081-1088 (1997).
[00141] Acidovorax spp, another member of the bacterial signature identified as significantly different between case and control in this study, is a flagellated, Gram-negative acid-degrading member of the phylum Proteobacteria. Although, not much is known about its clinical epidemiology and pathogenicity in humans, it has been associated with induction of local inflammation. Tanaka, N., et al. Flagellin from an incompatible strain of Acidovorax avenae mediates ¾(¾ generation accompanying hypersensitive cell death and expression of PAL, Cht-1, and PBZ1, but not of Lox in rice. Mol Plant Microbe Interact 16, 422-428 (2003); and Takakura,
Y., et al. Expression of a bacterial flagellin gene triggers plant immune responses and confers disease resistance in transgenic rice plants. Mol Plant Pathol 9, 525-529 (2008).
[00142] Lactobacillus, another taxa found to be higher in cases than controls, is an acid producing bacteria known to lower gut pH and regulate the growth of other bacteria. Biasco, G., et al. Effect of lactobacillus acidophilus and bifidobacterium bifidum on rectal cell kinetics and fecal pH. Ital J Gastroenterol 23, 142 (1991). While Lactobacillus is generally considered a beneficial microbe its presence in this case may help to lower pH to create favorable conditions for bacterial dysbiosis. This is consistent with suggestions by Duncan and co-workers that bacteria that grow in acidic pH create an environment that can be exploited by more low pH- tolerant microbes.. Gibson, G.R. & Roberfroid, M.B. Dietary modulation of the human colonic microbiota: introducing the concept of prebiotics. J Nutr 125, 1401-1412 (1995); Macfarlane, S., Macfarlane, G.T. & Cummings, J.H. Review article: prebiotics in the gastrointestinal tract. Aliment Pharmacol Ther 24, 701-714 (2006); and Duncan, S.H., Louis, P. & Flint, H.J. Lactate- utilizing bacteria, isolated from human feces, that produce butyrate as a major fermentation product. Appl Environ Microbiol 70, 5810-5817 (2004).
[00143] While further experiments will be required to determine if and how increased microbial richness causes the development of adenomas, the observation that the microbial signature associated with adenomas is largely distinct from that associated with obesity suggests that next-generation sequencing of microbial communities may have considerable value as a diagnostic that can separate risk- factors from the actual presence of adenomas.
[00144] Methods Summary:
[00145] Bacterial genomic DNA was extracted from mucosal biopsies using the Qiagen DNA isolation kit (cat # 14123) per the manufacturer's recommended protocol (Qiagen Inc. Valencia, CA). The adherent mucosal microbiome was analyzed by Roche 454 titanium pyrosequencing of V1-V2 region (F8-R357) of the 16S rRNA gene from genomic DNAs. After initial data filtering, to remove low quality sequences and to trim primers, the RDP Classifier 2.0 was used to assign the reads to genus and phylum as well as the algorithm AbundantOTU (http ://omics .informatics . indiana. edu/ AbundantOTU/ and http://mendel.informatics.indiana.edu/~yye/lab/mypaper/AbundantOTU-BIBM-Ye.pdf) to group the sequences into clusters in which every sequence within a cluster is on average 97% identical.
[00146] All analyses (with the exception of UNIFRAC and calculation of diversity indices which use unlogged counts) were performed on the log-normalized counts at the phylum, genus and OTU levels. Shannon- Wiener Diversity Index, H, was calculated using the equation, H = -∑ Pi (InPi), where Pi is the proportion of each species (taxa) in the sample. Richness was calculated
as the number of OTUs, genera or phyla observed in 1542 sequences (where 1542 is the number of sequences seen in the sample with the fewest sequences). For each sample, 1542 sequences were randomly chosen 1,000 times and the average number of OTUs, genera or phyla observed over these 1,000 permutations was reported as richness.
[00147] Evenness measures how evenly the individuals are distributed among the different species/taxa and is calculated by the following equation J= H'/Log (S) where FT is Shannon diversity and S is the number of species or taxa in each sample. Wilcoxon-tests and Student's t- tests were performed to compare the mean similarities of the groups, case and control. The false discovery rate was set at 10% using the Benjamini and Hochberg procedure to avoid type 1 error due to multiple comparisons on a single data set. Benjamini et al, (2001).
[00148] Patient characteristics: Subjects were screening colonoscopy patients at U C Hospitals who agreed to participate in the Diet and Health Study (DHS V) and the characteristics of these subjects are shown in Table 8. The enrollment procedure as well as colonoscopy and biopsy procedures and sample collection have been previously described. Keku, T.O., et al. Insulin resistance, apoptosis, and colorectal adenoma risk. Cancer Epidemiol Biomarkers Prev 14, 2076-2081 (2005); Shen, X.J., et al. Molecular characterization of mucosal adherent bacteria and associations with colorectal adenomas. Gut Microbes 1, 138-147 (2010). The study was approved by the Institutional Review Board (IRB) at the University of North Carolina, School of Medicine.
[00149] Table 8: Descriptive characteristics of the study participants, cases (33) and controls (38). p-Values are based on t-tests between case and control (age, WHR and caloric intake) or the Chi square test (% Male and %BMI). The *p-Value for BMI is from the chi-quare test comparing across the groups. Caloric intake is reported as kilocalories (kcal) and is based on responses from a food frequency questionnaire that was administered to subjects during phone interviews. Keku TO, Sandler RS, Simmons JG, Galanko J, Woosley JT, Proffitt M, Omofoye O, McDoom M, Lund PK. Local IGFBP-3 mRNA expression, apoptosis and risk of colorectal adenomas. BMC Cancer 8: 143 (2008).
TABLE 8
[00150] DNA extraction and sequencing: Bacterial genomic DNA was extracted from mucosal biopsies. The biopsies ranged in weight between 10-20 mg. Two biopsies per subject were used for bacterial DNA extraction and these were placed in lysozyme (30mg/ml; Sigma, St. Louis MO) for 30 minutes. The biopsy-lysozyme mixture was homogenized on a bead beater (Biospec Products Inc., Bartlesville, OK) at 4,800 rpm for 3 minutes at room temperature followed by DNA extraction using the Qiagen DNA isolation kit (cat # 14123) per the manufacturer's recommended protocol. The mucosal adherent microbiome was analyzed by Roche 454 titanium pyrosequencing of 16S rRNA tags from genomic DNAs. Pyrosequencing was conducted at the University of Nebraska Lincoln Core for Applied Genomics and Ecology (CAGE). Margulies et al, Genome sequencing in microfabricated high-density picolitre reactors. Nature 437:376-80 (2005). Briefly, the V1-V2 region (F8-R357) of the 16S rRNA gene from mucosal biopsies was amplified, followed by titanium-based pyrosequence analyses. The 16S primers contained the Roche 454 Life Science's A or B Titanium sequencing adapter (italicized), followed immediately by a unique 8-base barcode sequence (BBBBBBBB) and finally the 5' end of primer A-8FM, 5' - CCATCTCATCCCTGCGTGTCTCGACTCAGBBBBBBBBAG AGTTTGATCMTGGCTCAG-y (SEQ ID No. 1) and B-357R, 5'-
CCTATCCCCTGTGTGCCTTGGCA GTCrC4 GBBBBBBBBCTGCTGCCTYCCGTA-3 ' (SEQ ID No. 2). Each DNA sample was amplified with uniquely bar-coded primers, which allowed mixing of PCR products from many samples in a single run.
[00151] Data Filtering:
[00152] Sample filtering: All the samples were screened for a batch effect that correlated with the date of submission to the sequencing center. Samples were shipped on 3 separate dates to the sequencing center. Samples shipped on one particular date were found to cluster separately from samples shipped on other dates. The DNA stocks of these 2 groups of samples were also stored in different freezers at the lab. In addition, the sum of Bacteroidetes and Firmicutes observed in samples shipped on this date was much lower than expected based on both previously published human gut microbial 454 datasets and internal 454 datasets. Sequences generated from samples sent to the sequencing center on this date were therefore removed from further analysis. Leek et al. recently showed the importance of screening high throughput datasets for batch effectsmand screening for batch effects indeed proved useful in removing the technical artifacts from the dataset. Leek et al., Tackling the widespread and critical impact of batch effects in high-
throughput data. Nat Rev Genet 1 1 :733-9 (2010). The descriptive characteristics and of the 71 samples, 33 cases and 38 controls selected after sample filtering, are shown in Table 8 above.
[00153] Sequence filtering:
[00154] RDP Pipeline: The first step in the data analysis process involved a preliminary QC (quality control) filter (downstream of the Roche-454 GS-FLX software filtering). Sequences were removed from the dataset if there were any Ns in the sequence or the 5' primer did not exactly match the expected 5' primer or if the average quality score was less than 20. Then the 5' primer sequence was removed from the reads that have survived above filtering. Only trimmed filtered sequences with a length between 200-500bp were kept in the data set for RDP analysis.
[00155] OTU Pipeline: Sequences were removed from inclusion in the OTU dataset if there were any Ns in the trimmed sequence or if the 5 ' primer did not exactly match the expected 5 ' primer. As recommended by Kunin et al. , sequences were end-trimmed with the Lucy algorithm at a threshold of 0.002 (quality score of 27). Leek et al. (2010); Kunin et al, Wrinkles in the rare biosphere: pyrosequencing errors can lead to artificial inflation of diversity estimates. Environ Microbiol 12: 1 18-23 (2010). Only reads with trimmed lengths between 150 and 450 were retained for OTU analysis. Table 9 shows the characteristics and number of sequences removed by the RDP and OTU pipelines.
TABLE 9: 454 dataset characteristics before and after QC for RDP and OTU pipelines.
[00156] Bacterial Identification: The sequences in the dataset were given taxonomic assignments based on two methods.
[00157] RDP assignment method: Sequences that have been filtered using the RDP pipeline
(Table 9) were submitted to the RDP Classifier 2.1 algorithm for taxonomic identification at various taxonomic levels. Sequences assigned in each sample to various taxa, from phylum level and genus level, were counted at the RDP confidence threshold of 80.
[00158] OTU assignment method: OTU analysis is more sensitive to sequencing error and therefore additional QC steps were applied in the OTU analysis pipeline (Table 9). Kunin et al, (2010). Sequences filtered through the OTU pipeline were submitted to AbundantOTU (http://omics.informatics.indiana.edu/AbundantOTU/) for assignment of each sequence to operational taxonomic units (OTUs; 97% identity). Sequences assigned in each sample to various OTUs were counted and then normalized and log transformed (see Data Preprocessing), before proceeding to further downstream analyses. Consensus sequences generated by AbundantOTU during construction of OTUs were submitted to RDP classifier 2.1 to assign taxonomy to each of the OTU groups. Consensus sequences of the 613 OTUs generated by AbundantOTU (Consensus sequences 1-613, Seq. ID Nos. 11-623) were also submitted to ChimeraSlayer20 ( http://microbiomeutil.sourceforge.net/) and the 9 consensus OTUs identified by chimera slayer as chimeras were removed from the dataset. Haas, B.J., et al. Chimeric 16S rRNA sequence formation and detection in Sanger and 454-pyrosequenced PCR amplicons. Genome Res (2011). In addition consensus sequences of 4 OTUs on BLAST(http://blast.ncbi.nlm.nih.gov/Blast.cgi) search against the Silva reference 16S database failed to match >97% sequence identity so these were also removed from further analysis. This left a total of 600 OTUs.
[00159] Richness and Evenness: Shannon-Wiener Diversity Index, H, was calculated using the equation, H = -∑ Pi (InPi), where Pi is the proportion of each species (taxa) in the sample. Richness was calculated as the number of OTUs, genera or phyla observed in 2,636 sequences (where 2,636 is the number of sequences seen in the sample with the fewest sequences). For each sample, 2,636 sequences were randomly chosen 1,000 times and the average number of OTUs, genera or phyla observed over these 1,000 permutations was reported as richness.
[00160] Evenness measures how evenly the individuals are distributed among the different species/taxa and is calculated by J= H'/Log (S) where H' is Shannon diversity and S is the number of species or taxa in each sample. Wilcoxon-tests and Student's t-tests were performed to compare the mean similarities of the groups, case and control. The false discovery rate was set at 10% using the Benjamini and Hochberg procedure to avoid type 1 error due to multiple comparisons on a single data set. Benjamini & Hochberg, 1995.
[00161] Data Preprocessing: Raw counts were normalized then log transformed using the normalization scheme mentioned below, before proceeding with the rest of the analyses.
[00162] LOG 10 ((Raw count / # of sequences in that sample)* Average # of sequences per sample +1).
[00163] Removal of rare taxa: In order to minimize the number of null hypotheses needed to correct for multiple hypothesis testing, rarely occurring taxa were removed. Those that occurred
in so few patients that they could not be significantly associated with case-control or obesity phenotypes. In all of the analyses (except richness calculations), only included taxa which occurred in at least 25% of all samples were included. For the RDP approach, 9 phyla and 100 genera met this criterion. For the OTU approach, 371 OTUs met this criterion.
[00164] Tree Generation: For each of the 371 consensus sequences from OTUs that met the above criteria, BLASTN (http://blast.ncbi.nlm.nih.gov/Blast.cgi) was used to find the top 10 hits in the Silva reference tree release 104 (http://www.arb-silva.de/download/arb-files/). In this way, a set of 3,594 aligned sequences was identified to serve as the reference tree. The program align.seqs within MOTHUR (http://www.mothur.org/) was used to align the 371 AbundantOTU consensus sequences that passed all QC steps to these 3,594 aligned sequences as extracted from the Silva reference alignment. With custom Java code based on the Archaeopteryx code base (http://www.phylosoft.org/archaeopteryx/), all but the 3,594 sequences were removed from the Silva reference tree. The alignment of the 3,594 reference sequences plus the 371 AbundantOTU sequences was loaded onto the RaxXML EPA server (http://il2k-exelixis3.informatik.tu- muenchen.de/raxml) which uses maximum likelihood to place new sequences within a reference tree. Custom Java code (available upon request) was used to add RDP calls from each consensus sequence (Figure 12-1— 12-7) and significant differences (Figure 2 & 12-1— 12-7) to the tree. Trees were visualized with Archaeopteryx. Leaf nodes in Supplementary Figure 5 are labeled with the RDP call of the consensus sequence at 80%.
[00165] UniFrac Analysis: The tree generated from the 371 OTU consensus sequences (using Rax XML EPA server described above) along with the environment file with the abundance information of each of the 371 OTUs within the case and control environments were submitted to UniFrac and Fast UniFrac to see if cases cluster separately from controls. Lozupone C, Knight R. UniFrac: a new phylogenetic method for comparing microbial communities. Appl Environ Microbiol 71 :8228-35 (2005). 100 permutations were run on the abundance weighted tree using the UniFrac significance test.
[00166] Data Validation:
[00167] Real-time quantitative PCR validation: q-PCR primers were designed based on no less than 95% sequence similarity from bacterial 16s ribosomal DNA sequence alignments obtained from pyrosequencing. To measure the abundance of a specific taxon, three primer pairs where designed: one generic for all bacterial groups (Universal Primer): [EUB341-F 5'- CCTACGGGAGGCAGCAG-3 ' (SEQ ID No. 3) EUB518-R 5 '-ATTACCGCGGCTGCTGG-3 ' (SEQ ID No. 4)] and three taxon-specific primer pairs: first for the Helicobacter genus (Heli_F 5' AGTGGCGCACGGGTGAGTA 3' (SEQ ID No. 5)
Heli_R 5' GTGTCCGTTCACCCTCTCA 3 ' (SEQ ID No. 6)), the next one for the Acidovorax genus (Aci_F 5 ' -TGCTGACGAGTGGCGAAC-3 ' (SEQ ID No. 7) Aci R 5'- GTGGCTGGTCGTCCTCTC-3 ' (SEQ ID No. 8)) and another for the Cloacibacterium genus (Clo_F 5 ' -TGCGGAACACGTGTGCAA-3 ' (SEQ ID No. 9) Clo_R 5'- CCGTTACCTCACCAACTAGC-3 '(SEQ ID No. 10)).
[00168] 10 μϊ^ PCR reactions were prepared containing lOOng of DNA extracted from colonic mucosal biopsies, 10 μΜ of each primer, and 5 of Fast-SYBR Green Master Mix (Applied Biosystems). Cycling conditions were: 1 cycle at 95°C for 10 minutes followed by 45 cycles of 95°C for 15 seconds, 60°C for 1 minute, and 72°C for 30 seconds. A single dissociation curve cycle was run as follows: 95°C for 30 seconds, 60°C for 30 minute, and 90°C for 30 seconds. A pool of samples was prepared to serve as the standard for the qPCR by mixing equal volumes from each sample. Abundance of a specific taxon was calculated by the delta-delta threshold cycle ( Ct) method in which: AACt = (CtTSE - CtUE) - (CtTSP - CtUP). Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402-8 (2001).
[00169] Where: QTSE: Ct of experimental samples for taxon-specific primers, QUE: Ct of experimental samples for universal primer, Ctxsp: Ct for DNA Pool for taxon-specific primers, Ctup: Ct for DNA pool for universal primers. Theoretically, the abundance of a taxon is 2~ddct.
[00170] Nucleotide sequence accession numbers: All gene sequences in this study are available in the Genbank® database under the accession # SRS 166138.1-172960.2. They are listed as Consensus Sequences 1-613 (SEQ ID Nos. 11-623) in the Sequence Listing below.
6.2. Fusobacterium Associated with Colorectal Adenomas and Cancer
[00171] Summary
[00172] The human gut microbiota is increasingly recognized as a player in colorectal cancer (CRC). While particular imbalances in the gut microbiota have been linked to colorectal adenomas and cancer, no specific bacterium has been identified as a risk factor. Recent studies have reported a high abundance of Fusobacterium in CRC tumor samples compared to normal subjects, but this observation has not been reported for adenomas, CRC precursors. The abundance of Fusobacterium nucleatum in the normal rectal mucosa of subjects with (n=48) and without adenomas (n=67) was assessed. DNA was extracted from rectal mucosal biopsies and measured bacterial levels by quantitative PCR of the 16S ribosomal RNA gene. Local cytokine gene expression was determined in mucosal biopsies by quantitative PCR. The mean log abundance of Fusobacterium or cytokine gene expression between cases and controls was
compared by T-test. Logistic regression was used to compare tertiles of Fusobacteium. Adenoma subjects had a significantly higher abundance of F. nucleatum compared to controls (p=0.01). Compared to the lowest tertile, subjects with high abundance of Fusobacterium were significantly more likely to have adenomas (OR 3.66, 95% CI 1.37-9.74, ptrend 0.005). Cases but not controls had significant positive correlation between local cytokine gene expression and Fusobacterium abundance. Among cases, the correlation for local TNF-a and Fusobacterium was r=0.33, p=0.06 while it was 0.44, p=0.01 for fusobacterium and IL-10. These results support a link between the abundance of Fusobacterium in colonic mucosa and adenomas. They also implicate mucosal inflammation in the Fusobacterium-adQnoma association.
[00173] Introduction
[00174] The human intestinal microflora is a complex and diverse environment populated by hundreds of different bacterial species. The amount of bacterial cells in the gut outnumbers all other eukaryotic cells in the human body by a factor of 10. Chow, Host-Bacterial Symbiosis in Health and Disease, Adv Immunol. 2010 ; 107: 243-274; Savage, Microbial ecology of the gastrointestinal tract. Annual review of microbiology 1977; 31 : 107-33. These bacteria are regulated in the gut by the mucosal immune system, which is made up of a complex network of functions and immune responses aimed at maintaining a cooperative system between the intestinal microbiota and the host (Chow, 2010). In a healthy gut these bacteria maintain homeostasis with the host. However when an imbalance, or bacterial dysbiosis, occurs in the gut, the host experiences inflammation, and a loss of barrier function. Mutch, Impact of commensal microbiota on murine gastrointestinal tract gene ontologies, Physiol Genomics 2004 19(1):22-31 ; Arthur, The Struggle Within: Microbial Influences on Colorectal Cancer, Inflamm Bowel Dis. 201 1 17(l):396-409.
[00175] Bacterial dysbiosis has been linked to several diseases including ulcerative colitis, IBD and colorectal cancer (CRC). Kaur, Intestinal dysbiosis in inflammatory bowel disease, 2011 Gut Microbes. 201 1 Jul-Aug;2(4):211-6; Marchesi JR, Dutilh BE, Hall , Peters WHM, Roelofs R, et al. (2011) Towards the Human Colorectal Cancer Microbiome. PLoS ONE 6(5): e20447. doi: 10.1371/journal.pone.0020447; Sasaki The role of bacteria in the pathogenesis of ulcerative colitis. J Signal Transduct. 2012:704953; Sobhani, Microbial dysbiosis in colorectal cancer (CRC) patients. PLoS One. 201 1 Jan 27;6(l):el6393; Wang, Gut bacterial translocation contributes to microinflammation in experimental uremia. Dig Dis Sci. 2012 May 22. [Epub ahead of print].
[00176] Current research is focused on identifying key players in this imbalance as well as their specific contribution to colorectal carcinogenesis. No single bacterial species has been
identified as a risk factor for CRC, but recent studies report an increase in the abundance of Fusobacterium by direct examination of samples human colorectal tumors compared to controls (Marchesi 201 1). Castellarin, Fusobacterium nucleatum infection is prevalent in human colorectal carcinoma Genome Res. 2012 22: 299-306; Kostic, Genomic analysis identifies association of Fusobacterium with colorectal carcinoma, Genome Res. 2012 22: 292-298. These studies report Fusobacterium in the actual tumor sample as opposed to studies of the mucosal lining biopsies taken distant from a tumor. While these studies suggest that Fusobacterium may be involved in the later stages of CRC, they did not examine their role in either the early stages of colorectal carcinogenesis (adenomas) or the intestinal lining distant from the actual CRC tumor. The data suggests data suggest a field effect- that the presence of Fusobacterium in the rectum reflects adenomas or CRC elsewhere in the colon. While the causes of colorectal cancer are not fully known, it is becoming increasingly clear that the gut microbiota provide an important contribution. Whether Fusobacterium nucleatum in normal rectal mucosal biopsies is associated with colorectal adenomas or whether this relationship is mediated by local inflammation was evaluated. Fusobacterium is more abundant in adenoma cases than controls and that local inflammation, specifically inflammatory cytokines IL-10 and TNFa, are associated with increased abundance of Fusobacterium in cases.
[00177] Results
[00178] Fusobacterium abundance is higher in adenoma cases compared to controls.
Adherent F. nucleatum in normal mucosal biopsies from 1 15 subjects, 48 cases and 67 controls were evaluated. Subject characteristics are shown in Table 10. All subjects were similar in age, with cases having a mean age of 56.38 and controls 55.90 years. There were no significant differences between adenoma cases and non-adenoma controls for several dietary factors evaluated including alcohol intake, caloric intake, waist-hip ratio, body mass index and total fat intake. The abundance of F. nucleatum was significantly higher in adenoma cases compared to controls (cases, mean log copy number and standard error, 8.44 ± 0.38; controls 7.40 ± 0.22 p=0.01) (Fig. 13). Compared to those with low copy number or abundance of Fusobacterium, those with high abundance of Fusobacterium are more likely to be adenoma cases (ptrend=0.005) (Table 11). The correlation between Fusobacterium abundance and the frequency and size (small, medium, large) of adenomas among cases was assessed also. There was no significant correlation between F. nucleatum and adenoma size or number of adenomas (data not shown).
[00179] Localization of Fusobacterium in colonic mucosal by FISH analysis
[00180] Given that Fusobacterium was over-represented in cases compared to controls, we performed histological evaluation by FISH to localize Fusobacterium in colonic mucosal tissue
sections. The results showed that Fusobacterium was localized in the mucus layer above the epithelium as well as within the colonic crypts.
[00181] There is a significant positive correlation between F. nucleatum abundance and local inflammation in cases. Correlation of local inflammatory cytokine gene expression and F. nucleatum abundance was analyzed separately for cases and controls. Analysis of cytokines IL-6, IL-10, IL-12, IL-17 and TNFa and F. nucleatum was observed to have a significant positive correlation with local inflammation in cases, but not controls (Fig. 3). A significant positive correlation was found between abundance of F. nucleatum and IL-10 (r=0.443 p=0.01). The correlation for TNFa (r=0.335 p=0.06) was borderline significant. Although the correlations for IL-6 and IL-17 were positive, they did not reach statistical significance.
[00182] Analysis of colorectal tumors and matched normal tissue revealed higher F. nucleatum abundance in colon cancer tissue compared to normal tissue. Previous studies reported an association between F. nucleatum and colorectal cancer tumor biopsies. These results were reproduced by conducting high-throughput pyrosequence analysis on 19 matched samples, 10 tumor and 9 control non-malignant from adjacent mucosa. All subjects were Caucasian, predominantly female with ages ranging from 37-78 years. High-throughput sequencing revealed differences in abundance and richness in tumor compared to normal tissue. 13 phyla, 24 classes and 176 bacteria genera were identified. Overall, Shannon diversity and richness were higher in the tumor samples than matched normal tissue. Abundance of individual bacteria varied between groups. A reduced abundance of Bacteroidetes in tumor tissue compared to normal colon tissue was observed, however the distribution of the phylum Fusobacteria was higher in tumor tissue. The pyrosequencing results were validated by qPCR and a significantly positive correlation between the 2 methods (r= 0.76, p=0.0001) was observed. The results showed a higher abundance of Fusobacterium in the CRC tissue compared to normal tissue. (Fig. 19)
[00183] qPCR
qPCR analysis of F. nucleatum in tumor versus normal tissue revealed a significant increase in abundance among colorectal cancer tissue compared to normal tissue, confirming previously reported results of higher Fusobacterium abundance in CRC patients. qPCR and pyrosequence data for Fusobacterium were compared and the relationship between tumor characteristics such as tumor location, treatment and F. nucleatum abundance was also evaluated for colorectal tumor samples. A significant association for tumor characteristics was not observed; however, higher abundance of F. nucleatum was found in the sigmoid than right side tumor location (Table 12).
[00184] Discussion
[00185] The human gut microbiota has been shown to have a dynamic and observable impact on the human host (Shen, 2010; Mutch, 2004). While many of these bacteria are commensal and facilitate the maintenance of a healthy and functioning gastrointestinal tract, current research has shown that interactions between the host and the bacteria colonizing the gut can contribute to various diseases including colorectal carcinogenesis (Shen, 2010). Hakansson and Molin, Gut microbiota and inflammation, 201 1 Nutrients. 201 1 3(6):637-82; Round JL, Mazmanian SK (2009) The gut microbiota shapes intestinal immune responses during health and disease. Nature Reviews Immunology 9: 313-323.
[00186] In particular, bacterial dysbiosis in the gut has been implicated in colorectal neoplasia, although no specific bacteria or bacterial signatures have been identified for colorectal adenomas have been reported previously (Sobhani, 201 1; Marchesi, 201 1). The abundance of Fusobacterium in relation to colorectal adenomas in a case-control study was evaluated and compared to controls, cases had significantly higher levels of Fusobacterium.
[00187] There has been a recent focus on Fusobacterium as it relates to human CRC. Fusobacterium nucleatum is a Gram-negative bacterium, which usually colonizes the oral cavity (Castellarin 2012). Swidsindki, Acute appendicitis is characterised by local invasion with Fusobacterium nucleatum/necrophorum, 2009, Gut. 201 1 60(l):34-40.Recently, several groups identified Fusobacterium, particularly Fusobacterium nucleatum, in tumors of patients with colorectal carcinoma. Their findings reporting a link between colorectal tumor presence and high abundance of Fusobacteria, finding that the tumor microenvironment is characterized by a higher abundance of Fusobacteria than that of the normal colon (Castellarin 2012, Kostic 2011 Marchesi 2011). These results suggest F. nucleatum as potential biomarkers for colorectal carcinogenesis. However, it is not known whether F. nucleatum is associated with adenomas, early precursors of CRC. Several reports have shown early detection and/or removal of adenomas yields positive health benefits. Citarda, Efficacy in standard clinical practice of colonoscopic polypectomy in reducing colorectal cancer incidence, 2001 Gut. 2001 48(6):812-5; Fenoglio, The anatomical precursor of colorectal carcinoma, 1974 Cancer. 1974 34(3):suppl:819-23; Jaramillo, Small colorectal serrated adenomas: endoscopic findings, 1997, Endoscopy. 1997 29(1): 1-3; Kapsoritakis, Diminutive polyps of large bowel should be an early target for endoscopic treatment, 2002 Dig Liver Dis. 2002 34(2): 137-40.
[00188] One purpose of this study was to identify the association between F. nucleatum and adenomas by quantifying its abundance in subjects with and without adenomatous polyps. Significant differences in bacterial richness between adenoma versus non-adenoma subjects were observed and there was a strong positive correlation between high abundance of F. nucleatum and
the presence of colorectal adenomas (p=0.01). In particular those with high levels of Fusobacterium had about three and half fold increased risk of adenomas. It is interesting to observe increased F. nucleatum abundance in adenoma cases. As a CRC precursor, adenomas have become increasingly important in the study of colorectal carcinogenesis. Our results suggest that the changes in gut microflora are associated with the earliest stages of tumor development. Specifically that the normal mucosa rather than actual adenomas were studied. Our purpose was to demonstrate that the abundance of F. nucleatum in the gut is associated with adenoma status. While others observed a difference in Fusobacterium abundance between the colorectal tumor and adjacent non-neoplastic tissue (Kostic 201 1, Castellarin 2012), it would also be beneficial in future studies to assess the actual adenomas, specifically, compared to normal rectal mucosa.
[00189] Our findings raise several important questions. Does Fusobacterium act alone or in concert with other bacteria to promote CRC? What are the mechanisms involved in this process? These questions will need to be addressed in future studies, particularly in animal models of CRC to uncover the mechanisms by which Fusobacterium and other bacteria promote colorectal adenomas and cancer.
[00190] Interestingly, intestinal inflammation has been repeatedly linked to the gut microbiota. Rogler et al. Microbiota in Chronic Mucosal Inflammation Int J Inflam. 2010; 2010: 395032; Tlaskalova-Hogenova, Commensal bacteria (normal microflora), mucosal immunity and chronic inflammatory and autoimmune diseases, 2004, Immunol Lett. 2004 93(2-3):97-108. Commensal gut bacteria interact with the host in a symbiotic way to facilitate the operation of the intestinal immune system. However, as reported by several studies, bacterial dysbiosis may lead to a breakdown in immune response and mucous production in the gut, ultimately disrupting the delicate homeostatic relationship between commensal bacteria and the human host (Arthur, 2011). Dharmani Chadee Biologic therapies against inflammatory bowel disease: a dysregulated immune system and the cross talk with gastrointestinal mucosa hold the key. Curr Mol Pharmacol. 2008 1(3): 195-212. Uronis, Modulation of the intestinal microbiota alters colitis-associated colorectal cancer susceptibility, 2009, PLoS One. 2009 Jun 24;4(6):e6026. Although F. nucleatum has been found to flourish primarily in the oral microbiome, it has also been observed to be a highly adherent bacterium (Weiss). Edwards, Fusobacterium nucleatum Transports
Noninvasive Streptococcus cristatus into Human Epithelial Cells, 2006 Infect Immun. 2006 74(l):654-62; Han, Identification and Characterization of a Novel Adhesin Unique to Oral Fusobacteria, 2005 J Bacteriol. 2005 187(15):5330-40.The ability of F. nucleatum to attach to mucosal surfaces (Swidsinski, 201 1) makes it an ideal candidate to study in relation to host immunity and adenomas.
[00191] By Fluorescent in Situ Hybridization (FISH) analysis, Fusobacterium was observed on the mucosal surface as well as within crypts. Specifically, FISH of colorectal biopsy sections targeting members of the Fusobacterium genus in mucus layer and crypts was performed. A pure E.coli culture preparation hybridized with general bacterial probe labeled with Cy3 and a pure Fusobacterium nucleatum culture preparation hybridized with Fusobacterium-specific probe labeled with Cy3 (red) served as positive controls. The Fusobacterium was localized within the mucus layer of colorectal section and simultaneously stained with DAPI. These FISH experiments showed that the Fusobacterium localized within the colorectal crypts of section (data not shown).
[00192] Uronis et al. successfully demonstrated a link between the microbiota, intestinal inflammation and increased risk of colitis-associated colorectal cancer (CAC) in a mouse model (Uronis, 2009). mRNA expression of local inflammatory cytokines IL-6, IL-10, IL-12, IL-17 and TNFa in normal rectal biopsies was assessed and their expression levels were correlated with abundance of F. nucleatum in our adenoma and non-adenoma subjects. There was a positive correlation between the gene expression of several local cytokines and F. nucleatum in adenoma cases, but not in controls. Specifically, similar to previously published findings (Dharmani et al 2011), a significant association between increased abundance of F. nucleatum and TNFa was observed. The increased abundance of F. nucleatum in adenoma cases coupled with positive correlation with local inflammation suggests that Fusobacteria may contribute to increased mucosal inflammation in adenoma subjects. This finding highlights the complex and multifactorial relationship between the host and its enteric intestinal bacteria.
[00193] The relationship between F. nucleatum and adenoma size and frequency was also studied. However, there were no significant relationships observed between Fusobacterium and adenoma size (small, medium and large) or number of adenomas, suggesting that Fusobacterium richness in colonic mucosa may not have an impact on adenoma size or frequency.
[00194] Results for colorectal adenomas and increased Fusobacterium levels are similar to previously reported studies involving Fusobacterium and colorectal cancer (Kostic; Castellarin; Marchesi). The previously reported association between F. nucleatum and colorectal carcinoma was validated in a set of matched CRC tumor and normal human colon tissue samples. Using both pyrosequencing and qPCR analysis of the 16S bacterial rRNA gene these published results were successfully reproduced. Among CRC tumors and matched controls, F. nucleatum abundance was significantly higher in tumor tissue based on both qPCR as well as pyrosequence analysis, with a significant correlation between both methods (r= 0.76, p=0.0001).
[00195] The fact that Fusobacterium is associated with colorectal adenomas implicates its involvement early in the carcinogenesis. Also, the results linking Fusobacterium and
inflammation to adenomas suggest that this relationship may ultimately mediated by inflammation. Future studies in animal models of colorectal neoplasia could help to determine the mechanisms by which Fusobacterium and other bacteria promote cancer.
[00196] Materials and Methods
[00197] Study Population and Sampling: Subjects were drawn from participants in the studies who underwent routine colonoscopy screening at UNC Hospitals, Chapel Hill, NC. Eligible subjects 30 years of age or older gave written informed consent to provide colorectal biopsies as well as a phone interview involving questions about diet and lifestyle. At the time of the colonoscopy procedure, the research assistant obtained anthropometric measures to determine body mass index (BMI) and waist-hip ratio (WHR) (Shen, 2010; Section 6.1 above). Biopsy samples from a total of 1 15 randomly selected subjects (48 adenoma cases and 67 non-adenoma controls) were used in this study. Subjects with known or suspected colorectal cancer or with insufficient colon prep were excluded from the study. Before the endoscopy procedure was performed, biopsies were taken 8- 12cm from the anal verge of the normal rectal mucosa, and immediately flash frozen in liquid nitrogen. Biopsies were stored at -80°C. After completion of the endoscopy as well as the procedure report, participants with reported adenomas were classified as "cases" and those with no adenomas as "controls" (Section 6.1 above).
[00198] Additionally, matched tumor and normal tissue biopsies from 10 patients with colorectal cancer were obtained from UNC Tissue Procurement Facility to confirm previously reported studies. The study was approved by the Institutional Review Board at the University of North Carolina, School of Medicine.
[00199] Fusobacterium Culture: Fusobacterium nucleatum subs, nucleatum ATCC® 25586™ was obtained and revived according to the manufacturer's instructions for use as a positive control. Reactivated bacteria were grown on reinforced clostridial media (Difco, Becton Dickinson, Franklin Lakes, NJ) under anaerobic conditions at 37°C.
[00200] DNA Extraction: DNA was extracted from normal rectal mucosal biopsies as well as matched tumor/normal tissue using the Qiagen DNeasy Blood and Tissue Kit (Cat# 69504) which included a modified protocol with lysozyme and bead-beating (Shen, 2010; Section 6.1 above). F. nucleatum bacterial cells were centrifuged to form a pellet, re-suspended in kit-provided lysis buffer, and DNA extraction was performed using the same extraction method used for biopsies.
[00201] Quantitative Real-Time PCR (qPCR): qPCR was performed to quantify the abundance of F. nucleatum. A standard curve was generated by amplifying the 16S rDNA region of F. nucleatum (ATCC® 25586™) using a 16S PCR with Fusobacterium-specific primers. Walter, Detection of Fusobacterium species in human feces using genus-specific PCR primers and
denaturing gradient gel electrophoresis, Br J Biomed Sci. 2007;64(2):74-7. The concentration of PCR product was checked by spectrophotometer and the number of fragment copies was calculated using the following formula:
grams
DNA
1 Λ 23 χ ^ ,, , Molecules.
■ x (6.22 x 1023 ) = Copy# ( )
[00202] (Length of fragment inbasepairs)
[00203] Copy number was adjusted to a starting concentration of l .OOxlO10 and serial dilutions were performed to create nine standards. 25 μΐ reactions were prepared containing template DNA, 10μΜ primer mix, and Fast-SYBR Green Master Mix (Applied Biosystems). The qPCR was performed with an annealing temperature of 60° for 40 cycles. Finally, the copy number was calculated based on the standard curve, which was adjusted to a starting DNA concentration of 50ng^L using the following formula to the unadjusted values:
^.H x Unadjusted Copy #
[00204] / o
[00205] , where A is the concentration of the template DNA and B is dilution; either 1 : 10.
[00206] qPCR was also performed for local mRNA expression of inflammatory cytokines IL-6, IL-10, IL-12, IL-17 and TNF-a using ready to use optimized primers (SA Biosciences). Expression of each inflammatory cytokine was assessed relative to the housekeeping gene hydroxymethylbilane synthase (HMBS). The qPCR was performed using SYBR Green Master Mix (Applied Biosystems) and each sample was run in duplicate. qPCR results were normalized using the expression of the HMBS gene. Jovov, Differential gene expression between African American and European American colorectal cancer patients, 2011, PLoS One. 2012;7(l):e30168.
[00207] Fluorescence in situ Hybridization (FISH): FISH was performed on Carnoy's fixed mucosal biopsy sections using a universal bacteria probe and a Fusobacterium-specific probe. These assays used a previously described protocol (Shen, 2010).
[00208] Table 10: Characteristics of Study Participants.
Calories (mean, se) 2108.70 ± 2140.38 ± 144.0 0.87
114.78
Total Fat intake (mean, se) 82.36 ± 5.31 79.36 ± 4.78 0.67
Red meat intake (mean, se) 1.59 ± 0.17 1.36 ± 0.14 0.30
Dietary Fiber (mean, se) 23.03 ± 1.28 25.58 ± 1.76 0.27
[00209] Table 11: Association between Fusobacterium abundance and colorectal adenomas. Compared to subjects with a low copy number, subjects with high abundance of Fusobacterium are more likely to be adenoma cases than controls.
[00210] Table 12: Relationship between Fusobacterium and colorectal tumor characteristics
Variable 1 Fusobacterium (copy #, 1 P-value
1 mean, se)
Tumor Location
Right 1.82 ± 0.13
Transverse 1.94 ± 0.09 NS
Sigmoid \ 2.21 ± 0.31 ! 0.04 Sigmoid vs. Right
Stage
T-2 1.83 ± 0.29
T-3 1.98 ±0.11 j 0.56
Adjuvant Therapy j j
N 2.16 ± 0.03 0.20
J
Y : 2.01 ± 0.10
6.3. Signature of Rectal Mucosal Biopsies and Rectal Swabs [00211] Summary
[00212] There is growing evidence the microbiota of the large bowel may influence the risk of developing colorectal cancer as well as other diseases including Type-1 Diabetes, Inflammatory Bowel Diseases and Irritable Bowel Syndrome. Current sampling methods to obtain microbial specimens, such as feces and mucosal biopsies, are inconvenient and unappealing to patients. Obtaining samples through rectal swabs could prove to be a quicker and relatively easier method, but it is unclear if swabs are an adequate substitute. We compared bacterial diversity and composition from rectal swabs and rectal mucosal biopsies in order to examine the viability of rectal swabs as an alternative to biopsies. Paired rectal swabs and mucosal biopsy samples were collected in un-prepped participants (n=l 1) and microbial diversity was characterized by Terminal Restriction Fragment Length polymorphism (T-RFLP) analysis and quantitative polymerase chain reaction (qPCR) of the 16S ribosomal RNA gene. Microbial community composition from swab samples was different from rectal mucosal biopsies (p=0.001). Overall the bacterial diversity was higher in swab samples than in biopsies as assessed by diversity indexes such as: richness (p=0.01), evenness (p=0.06) and Shannon's diversity (p=0.04). Analysis of specific bacterial groups by qPCR showed higher copy number of Lactobacillus (p=0.04) and Eubacteria (p=0.01) in swab samples compared to biopsies. Our findings suggest that rectal swabs and rectal mucosal samples provide different views of the microbiota in the large intestine.
INTRODUCTION
[00214] Increasing evidence suggests a role for the intestinal microbiota in colorectal cancer (CRC) (Sobhani et al. Microbial dysbiosis in colorectal cancer (CRC) patients. PloS one 201 1; 6:el6393), colorectal adenomas (Shen 2010) and several other conditions such as Inflammatory Bowel Diseases (Ulcerative Colitis and Crohn's Disease)(Gersemann et al. Innate immune dysfunction in inflammatory bowel disease. Journal of internal medicine 2012), Irritable Bowel Syndrome (IBS)(Carroll et al. Luminal and mucosal-associated intestinal microbiota in patients with diarrhea-predominant irritable bowel syndrome. Gut pathogens 2010; 2: 19), Obesity (Turnbaugh et al. An obesity-associated gut microbiome with increased capacity for energy harvest. Nature 2006; 444: 1027-31) and Type-1 Diabetes (Brown et al. Gut microbiome metagenomics analysis suggests a functional model for the development of autoimmunity for type 1 diabetes. PloS one 201 1 ; 6:e25792). The launch of the Human Microbiome Project and the advent of molecular techniques that reduce the bias imposed by culture-based methods has begun to improve our understanding of the role of the microbiota in common chronic diseases. Turnbaugh et al. The human microbiome project. Nature 2007; 449:804-10
[00215] Currently, gut bacterial diversity in the human colon is determined through analysis of the luminal content (stool) and mucosal biopsies. Colorectal biopsies capture the diversity of flora in the mucosal layer of the large intestine where adherent bacteria reside. Savage 1977; Sonnenburg et al. Getting a grip on things: how do communities of bacterial symbionts become established in our intestine? Nature immunology 2004; 5:569-73. The bacteria in this compartment are of interest because of their direct interaction with the host immune system, and by consequence, their possible direct link to disease development. Goto Y, Kiyono H. Epithelial barrier: an interface for the cross-communication between gut flora and immune system. Immunological reviews 2012; 245: 147-63. Unfortunately, methods for obtaining colorectal biopsies such as sigmoidoscopy, anoscopy or colonoscopy are expensive and time consuming and may subject the patient to discomfort and inconveniences associated with the procedures. ACS. Colorectal Cancer Facts & Figures. In: Society AC, ed., 2011 : 1-30. Stool sampling, which does not pose a major risk to patients, is least liked because of the patient distaste for handling feces. A simpler, standardized, risk-free and inexpensive method to sample the gut bacteria would represent an important contribution.
[00216] In this Section, rectal swabs as a noninvasive low-risk sampling method and rectal mucosal biopsies obtained via unprepped, rigid sigmoidoscopy were assessed to study the bacterial community composition and diversity of the human gut using terminal restriction fragment length polymorphism (T-RFLP) and quantitative PCR (qPCR) of the bacterial 16S
ribosomal RNA gene. It was hypothesized that rectal swabs have comparable bacterial diversity to rectal mucosal biopsies from the same participant.
[00217] RESULTS
[00218] Study population
[00219] The mean age of participants was 56.3 years ± 5.6. Forty-five percent of the participants were male, and the average body mass index (BMI) was 30.5 ± 6.4 (Table 15 below). Rectal mucosal biopsies were obtained via rigid sigmodoscopy at approximately 10cm from the anal verge while swabs were obtained 1-2 cm from the anal verge. Participants did not undergo colonic cleansing preparation prior to sample collection.
[00220] Analysis of T-RFLP profiles showed overall differences in community composition between swabs and biopsy samples.
[00221] Hierarchical clustering of the 16S rRNA gene T-RFs based on Bray-Curtis similarities showed two main clusters suggesting differences in bacterial communities between samples collected from rectal swabs and biopsies (ANOSIM R=0.387, p=0.001) (Figure 16). Cluster-1 was comprised entirely of rectal swab samples (100%) while cluster-2 was composed mainly of biopsy samples (73% biopsies and 27% swabs). The clusters were independent of adenoma status (Figure 20).
[00222] Using similarity percentage analysis (SIMPER), specific T-RFs contributed to the differences between swabs and biopsies were assessed. A total of 26 T-RFs accounted for the overall diversity for the two groups, with a higher number of unique T-RFs in rectal swab samples than rectal biopsies (Figure 16). 16 T-RFs were unique to swab samples (107, 108, 110, 112, 113, 146, 35, 387, 39, 399, 51, 53, 58, 59, 61, 62), while 2 TRFs (369 and 72) were unique to biopsy samples. Distribution of T-RFs for each individual sample as well as Bray-Curtis similarities matrix showed marked differences between swabs and biopsies from the same participant (Figure21). Distribution of top contributing TRFs based on similarity percentage analysis (SIMPER). The swabs (S 1-11) or the biopsy samples (B l-Bl l) collected from each of patient. Tables 13 and 14 lists the TRFs and the percentage contribution.
[00223] TABLE 13 Swabs and TRF contributions.
55.4B 0.00 1.46 3.16 2.96 13.58 2.61 13.80 10.25 8.32 4.01 14.29
57.0B 4.30 0.00 10.59 4.12 18.02 0.00 18.52 12.00 14.87 10.92 19.12
58.4B 0.00 2.92 0.00 10.24 11.26 11.96 13.28 14.73 0.00 1.50 0.00
59.6G 0.00 0.00 5.62 6.92 5.73 6.23 5.76 2.93 0.00 0.60 0.00
61.2B 0.00 0.00 8.57 6.84 0.00 8.84 0.00 2.85 1.59 2.63 2.52
62.5B 0.00 0.00 6.31 6.45 0.00 6.18 0.00 2.30 0.00 0.46 0.00
72.1G 2.91 10.35 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.74 0.00
107.8B 0.00 0.00 3.49 7.97 0.00 3.00 4.72 2.77 0.00 0.00 0.00
108.9G 0.00 0.00 3.37 7.44 0.00 2.52 0.00 2.53 0.00 0.00 0.00
110.8G 0.00 0.00 5.65 10.12 3.96 3.89 6.20 4.04 0.00 0.00 0.00
112.6G 0.00 0.00 4.60 10.37 4.10 4.10 6.20 4.43 0.00 0.00 0.00
113.7B 0.00 0.00 4.79 9.43 5.05 4.18 7.25 3.52 0.00 0.00 0.00
146.4G 9.92 1.62 1.32 5.13 0.00 2.30 0.00 3.25 0.00 0.00 0.00
246.3B 0.00 6.32 4.20 0.00 0.00 0.00 0.00 0.00 4.49 7.97 0.00
250.5B 0.00 0.00 3.15 0.00 0.00 0.00 0.00 0.00 7.69 12.11 0.00
369.2B 6.59 18.40 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
387.4G 3.47 1.71 0.00 0.00 0.00 1.91 0.00 0.00 0.00 1.27 0.00
393.5G 5.64 5.68 5.97 0.00 0.00 0.64 0.00 0.00 20.06 11.56 0.00
399.7G 27.94 28.65 1.26 0.00 0.00 16.66 0.00 0.00 0.00 0.00 0.00
402.1G 23.80 8.59 10.52 1.58 15.70 9.86 0.00 0.00 15.99 35.30 0.00
[00224] TABLE 14 Mucosal biopsies and TRF contributions.
Spec # Bl B2 B3 B4 B5 B6 B7 B8 B9 B10 Bll
T- F
32. IB 11.91 74.65 33.21 21.80 28.67 76.41 89.57 16.95 13.37 33.28 34.10
33.4B 0.58 4.05 1.18 0.96 1.52 2.30 3.01 0.71 0.88 1.28 1.90
35.6B 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
39.2B 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
51.5G 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
53.9B 1.21 0.00 0.00 0.00 3.31 0.00 0.00 2.43 6.17 4.55 0.00
55.4B 0.00 4.31 5.05 2.37 0.00 4.41 4.31 0.00 0.00 0.00 2.73
57.0B 1.72 1.76 7.48 4.42 4.58 5.05 3.11 3.20 11.23 6.48 2.87
58.4B 0.00 2.81 0.00 0.00 0.00 0.00 0.00 0.00 0.19 0.00 0.00
59.6G 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
61.2B 0.00 0.00 0.00 0.00 0.00 7.13 0.00 0.00 0.00 0.00 0.49
62.5B 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
72.1G 15.83 2.59 2.11 12.07 0.00 1.98 0.00 4.63 0.90 0.77 16.17
107.8B 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
108.9G 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.44 0.00 0.00
110.8G 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
112.6G 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
113.7B 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
146.4G 2.02 0.00 0.00 1.17 0.68 0.00 0.00 3.75 1.38 0.00 2.27
246.3B 15.57 3.09 8.41 5.15 14.49 0.00 0.00 14.23 7.95 6.15 1.94
250.5B 0.00 0.00 8.26 0.41 9.30 0.00 0.00 19.29 16.66 13.22 0.74
369.2B 26.46 4.77 0.00 20.99 0.00 0.00 0.00 0.00 0.00 0.00 30.35
387.4G 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
393.5G 2.07 0.00 11.80 0.00 5.57 0.00 0.00 3.36 14.98 8.63 0.39
399.7G 3.73 0.00 2.52 15.12 0.00 0.00 0.00 0.00 2.97 0.00 0.00
402.1G 18.91 1.97 19.98 15.54 31.89 2.72 0.00 31.45 22.88 25.64 6.05
[00225] Measures of microbial diversity were also assessed namely richness (N), evenness (J') and Shannon's H (diversity) and observed that overall diversity measures were higher in rectal swabs compared to rectal biopsies (Figure 18). Altogether, the T-RFLP results demonstrate that the bacterial community composition from rectal swabs and rectal biopsies are different.
[00226] Quantitative PCR showed differences in abundance of specific bacterial groups between swabs and biopsy samples.
[00227] Bacterial genera common in the human gut were quantified by qPCR of the bacterial 16S rRNA gene. All quantified bacterial groups (Clostridium spp., Bifidobacterium spp., Bacteroides spp., Lactobacillus spp. and E. coli,) and Eubacteria bacterial groups (as assessed by Universal 16S rRNA primers) showed higher abundance in swab specimens compared to biopsy samples. However, statistically significant differences were only observed for Lactobacillus spp. and Eubacteria (Figure 19).
[00228] DISCUSSION AND CONCLUSIONS
[00229] The association between colorectal adenomas and dysbiosis of gut microbes has been previously reported and could serve as the basis to identify microbial signatures that could lead to the development of tests to identify individuals at risk of developing colorectal cancer. Shen 2010; Section 6.1 above. Biopsies collected during colonoscopy, as well as stool samples, are the current methods to characterize the microbiota of the large intestine. A simple, standardized, risk- free and inexpensive method to assess bacterial community composition of the gut could lower the risks and inconvenience associated with collection of these samples. In the present study, the bacterial composition of rectal swabs and rectal mucosal biopsies collected during an un-prepped sigmoidoscopy from 1 1 participants was systematically compared. The bacterial community composition from these two sampling sites was compared to determine whether rectal swabs could be a viable alternative to currently used methods.
[00230] 16S rRNA gene T-RFLP fingerprinting analysis was used to reveal significant differences in the bacteria community profiles of samples collected via rectal swabs versus mucosal biopsies. Similarly, bacterial diversity indexes showed significant differences between the two sampling sites. Swab samples had higher bacterial abundance and diversity compared to
rectal mucosal biopsies. Durban et al. compared bacterial community composition of stool samples and rectal mucosal biopsies obtained from an un-prepped population of healthy participants. Durban et al. Assessing gut microbial diversity from feces and rectal mucosa. Microbial ecology 2011 ; 61 : 123-33. They reported that fecal and mucosal bacterial diversity from the same subject are different. In a study that compared healthy subjects to IBS subjects, Carroll et al. observed reduced bacterial abundance and diversity in mucosal samples compared to stool samples from the same subjects. Carroll 2010. These findings are compatible with the reports of Carroll et al. and Durban et al. although we extended those findings to rectal swabs compared to biopsies. Similar to these and previous studies, our results suggest that different niches within the large intestine possess distinct bacterial populations. Hong et al. Pyrosequencing-based analysis of the mucosal microbiota in healthy individuals reveals ubiquitous bacterial groups and micro-heterogeneity. PloS one 201 1; 6:e25042.
[00231] It is believed that this is the first study to compare gut microbial composition of samples collected via rectal swabs versus rectal biopsies. Additionally, investigating noninvasive alternatives for stratification of risk for colorectal cancer has the potential to increase screening rate and screening compliance among the population at risk since some participants may prefer to utilize easier and more convenient screening methods. DeBourcy et al. Community-based preferences for stool cards versus colonoscopy in colorectal cancer screening. Journal of general internal medicine 2008; 23 : 169-74; Wolf et al. Patient preferences and adherence to colorectal cancer screening in an urban population. American journal of public health 2006; 96:809-1 1.
[00232] T-RFLP analysis showed statistically significant differences in the bacterial profiles from rectal swabs and mucosal biopsies. These results suggest that a quick and inexpensive fingerprinting technique could be efficiently used to compare bacterial community profiles before investing additional costs and time with more advanced sequencing technologies.
[00233] The samples were obtained from un-prepped participants, which may be a problem because it could increase the chances of contamination of rectal swabs with luminal content. Since previous studies have observed that the luminal cavity and the colonic mucosa contain distinct bacterial communities, use of un-prepped participants for sampling may have mixed those two bacterial communities. Durban 2011 ; Eckburg et al. Diversity of the human intestinal microbial flora. Science 2005; 308: 1635-8; Lepage et al. Biodiversity of the mucosa-associated microbiota is stable along the distal digestive tract in healthy individuals and patients with IBD. Inflammatory bowel diseases 2005; 1 1 :473-80; Zoetendal et al. Mucosa-associated bacteria in the human gastrointestinal tract are uniformly distributed along the colon and differ from the community recovered from feces. Applied and environmental microbiology 2002; 68:3401-7.
Another source of swab contamination may have been from local skin flora due to inadvertent swab contact with adjacent skin prior to insertion through the anus. Finally, future studies may include a larger study population that samples several sites such as luminal, rectal swabs and biopsies in order to get a better picture of the microbial populations in the large intestine. Moreover, the use of a sleeve to introduce the swab may reduce the contamination by local flora. Alternatively, computational or analytical methods may be used to remove the bacterial species/signatures from either luminal or local skin associated species.
[00234] In summary, the data suggests that the bacterial diversity in samples collected via rectal swabs and mucosal biopsies are different. While differences in bacterial community composition can be attributed to a whole array of factors, including host genetics and the environment, our sampling scheme enabled us to observe the diversity associated with two different sampling locations. Our results suggest potential differences in the niches within the human large intestine in relation to bacterial communities. Moreover, the differences in bacterial community composition observed may suggest that both, swab sampling and biopsy collection, are needed in order to get the full spectrum of the microbial community composition of the gut. Characterizing these unique bacterial communities of the large intestine is a first step toward understanding the complex association between bacterial diversity in the gut and intestine and disease development.
[00235] METHODS
[00236] Study population and sampling:
[00237] Study population included 1 1 participants enrolled as part of an ongoing studies at U C Hospitals. Eligibility criteria included: good general health, age 40-80 years, willingness to follow the study protocol and provision of informed consent. As part of the study protocol, two swab samples were collected for each participant prior to sigmoidoscopy. Swab specimens were collected by inserting a sterile cotton-tipped swab 1-2 cm beyond the anus and rotating for several seconds. Swabs were then placed into sterile phosphate buffered saline (PBS), vortexed for at least 2 minutes to ensure release of bacteria and stored at -80°C until further processing. Rectal mucosal biopsies were obtained through a rigid disposable sigmoidoscope (Welch Allyn KleenSpec Disposable Sigmoidoscope with Obturator) coated with gel and inserted to approximately 10 cm with the participant in the left lateral position. Disposable flexible biopsy forceps (Olympus EndoJaw Alligator Jaw-Step, Shinjuku, Tokyo, Japan) were used to obtain single mucosal pinches from two separate sites. Biopsy samples were rinsed in sterile PBS as previously described above, snap-frozen, and then stored at -80°C until further processing. All
samples for this study were collected prior to initiating treatment for all participants. Swab samples for two participants were excluded from qPCR analysis because of insufficient DNA. The study was approved by the Institutional Review Board (IRB) at the University of North Carolina School of Medicine.
[00238] DNA Extractions and Terminal Restriction Fragments Length Polymorphisms (T-RFLPs):
[00239] T-RFLP is a fingerprinting method to assess bacterial composition in gut samples. Samples were treated with lysozyme followed by bead beating on a bullet blender homogenizer (Next Advance, Inc. Averill Park, NY), using a modified protocol. Savage 1977. DNA extraction was performed using Qiagen's DNeasy Blood & Tissue kit (Cat # 69504, Maryland, USA). T- RFLP profiles were collected on both biopsy and swab samples following a previously described protocol described by Shen et al. 2010. Swab samples for two participants were excluded from qPCR analysis because of insufficient DNA.
[00240] Quantitative PCR (qPCR) to assess specific bacteria known to be present in the human gut:
[00241] Bacterial genera common in the human gut as described by previous studies were quantified using primers for PCR amplification of the 16S ribosomal RNA (rRNA) gene for specific bacteria groups. Carroll 2010. Quantified bacterial groups included: Clostridium spp., Bifidobacteria spp., Bacteroides spp., and Lactobacillus spp. and E. coli. Additionally, universal 16S rRNA primers were used to capture all bacterial diversity for each sample henceforth referred as Eubacteria. Modifications to the original protocol by Carroll et al.- included: the use of Fast SYBR Green Master Mix (Applied Biosystems, P/N: 4385614, California, USA) and dilution of template DNA to a 1 : 10 (Clostridium, Bifidobacteria, Lactobacillus and Eubacteria) and 1 : 100 (Bifidobacteria and E. coli). Finally, the copy number for group-specific bacterial 16S ribosomal RNA gene was calculated based on a standard curve, which was adjusted to a starting DNA concentration of 50ng^L using the following formula to the unadjusted values:
[00242] x Undjusted Copy#
[00243] A is the concentration of the template DNA and B is the dilution factor; either 1 : 10 or 1 : 100. Swab samples for two participants were excluded from qPCR analysis because of insufficient DNA leaving 9 swab samples for analysis.
[00244] Data Analysis:
[00245] T-RFLP profiles from swabs and biopsies were compared to determine bacterial community composition and diversity. The T-RF (phylotype) peaks size and area were determined by GeneMapper (Applied Biosystems Inc.). Peak area and fluorescence data were normalized and processed as described by Abdo et al. Abdo Z, Schuette UM, Bent SJ, Williams CJ, Forney LJ, Joyce P. Statistical methods for characterizing diversity of microbial communities by analysis of terminal restriction fragment length polymorphisms of 16S rRNA genes. Environmental microbiology 2006; 8:929-38. The contribution of individual T-RFs was calculated as a proportion of the total T-RF peak area for each sample. For this analysis, these proportions were used rather than absolute numbers. The data matrix was used to generate Bray- Curtis similarities and hierarchical clustering to observe grouping of samples based on TRF abundance. The similarities between groups (rectal swab/biopsy) were compared by analysis of similarities (ANOSIM), a non-parametric test, where the significance is computed by permutation of group membership with 999 replicates. The test statistic R, which measures the strength of the correlations ranges from -1 to 1. An R value of 1 signifies differences between groups while an R value of 0 signifies that the groups are identical.
[00246] To determine the specific phylotypes that contributed to the differences in bacterial composition between swabs and biopsies similarity percentage (SIMPER) was used to compute the proportions of phylotypes for each group. Differences in bacterial richness (measure of the number of phylotypes) evenness (measure of how evenly the individuals are distributed among different phylotypes) and Shannon diversity index (measure of diversity) as well as mean bacterial 16S gene copy number between rectal swabs and biopsies were evaluated by t-test. The data analysis protocol has been previously described Shen et al. 2010 and was performed with the Primer 6 statistical package (PRIMER E, Plymouth, United Kingdom).
[00247] Table 15 Characteristic of Study Population (N=l 1) Rectal mucosal biopsies and rectal swabs were collected for all participants. Swab samples for two participants were excluded from qPCR analysis because of insufficient DNA. *se- standard error
Waist-hip-ratio (WHR) 0.97 (0.04)
Race - White (%) 81 .8
[00248] It is to be understood that, while the invention has been described in conjunction with the detailed description, thereof, the foregoing description is intended to illustrate and not limit the scope of the invention. Other aspects, advantages, and modifications of the invention are within the scope of the claims set forth below. All publications, patents, and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference.
Claims
Claims
What is claimed is:
1. A method for detecting colorectal adenoma in a patient which comprises:
(a) obtaining a suitable patient sample;
(b) measuring a level of five or more bacteria selected from a group consisting of Acidovorax, Acinetobacter, Agrobacterium, Akkermansia, Alistipes, Allobaculum, Aquabacterium, Azonexus, Bacillaceae l, Bryantella, Carnobacteriaceae l, Chryseobacterium, Chryseomonas, Cloacibacterium, Comamonas, Dechloromonas, Delftia, Enterobacter, Erwinia, Exiguobacterium, Flavimonas, Fusobacterium, Gpl, Gp2, Helicobacter, Lactobacillus, Lactococcus, Leuconostoc, Methylobacterium, Micrococcineae, Novosphingobium, Pantoea, Pseudomonas, Pseudoxanthomonas, Roseburia, Rubrobacterineae, Serratia, Shinella, Sphingobium, Staphylococcus, Stenotrophomonas, Succinivibrio, Sutterella, Syntrophococcus, Turicibacter, Variovorax, and Weissella; and
(c) comparing the patient sample levels with levels associated with a control sample, wherein elevated levels are indicative of whether or not colorectal adenoma is present or absent in the patient.
2. The method of claim 1, wherein the bacteria are selected from the group consisting of Acidovorax, Acinetobacter, Aquabacterium, Azonexus, Cloacibacterium, Dechloromonas, Delftia, Fusobacterium, Helicobacter, Lactobacillus, Lactococcus, Leuconostoc, Sphingobium, Stenotrophomonas, Succinivibrio, Turicibacter, and Weissella.
3. The method of claim 1, further comprising measuring levels of Bacteroides, Bifidobacteriaceae, Dorea, or Streptococcus, wherein decreased levels of Bacteroides, Bifidobacteriaceae, Dorea, or Streptococcus, are indicative of whether or not adenoma is present or absent in the patient.
4. The method of claim 1 , wherein the bacteria levels are measured using bacterial nucleic acids.
5. The method of claim 4, wherein the bacterial nucleic acids are 16S rRNA genes.
I l l
6. The method of claim 4, wherein the bacterial nucleic acids are measured using terminal restriction fragment length polymorphism (T-RFLP).
7. The method of claim 4, wherein the bacterial nucleic acids are measured by fluorescence in-situ hybridization (FISH).
8. The method of claim 4, wherein the bacterial nucleic acids are measured by polymerase chain reaction (PCR).
9. The method of claim 4, wherein the bacterial nucleic acids are measured by pyrosequencing.
10. The method of claim 4, wherein the bacterial nucleic acids are measured by a microarray.
11. The method of claim 1 , wherein the bacteria in the patient sample are cultured prior to measuring the levels.
12. The method of claim I, wherein the bacteria levels are measured using antibodies.
13. The method of claim I, wherein the patient sample is a fecal sample.
14. The method of claim 1, wherein the patient sample is a biopsy sample.
15. The method of claim 14, wherein the biopsy sample is a mucosal biopsy sample.
16. The method of claim 1, wherein the patient sample is a sample obtained by a rectal swab.
17. The method of claim 1, wherein the colorectal adenoma is an adenocarcinoma.
18. A method for determining whether or not a patient should have a colonoscopy which comprises:
(a) obtaining a suitable patient sample;
(b) measuring a level of five or more bacteria selected from a group consisting of Acidovorax, Acinetobacter, Agrobacterium, Akkermansia, Alistipes, Allobaculum, Aquabacterium, Azonexus, Bacillaceae l, Bryantella, Carnobacteriaceae l,
Chryseobacterium, Chryseomonas, Cloacibacterium, Comamonas, Dechloromonas, Delftia, Enterobacter, Erwinia, Exiguobacterium, Flavimonas, Fusobacterium, Gpl, Gp2, Helicobacter, Lactobacillus, Lactococcus, Leuconostoc, Methylobacterium, Micrococcineae, Novosphingobium, Pantoea, Pseudomonas, Pseudoxanthomonas, Roseburia, Rubrobacterineae, Serratia, Shinella, Sphingobium, Staphylococcus, Stenotrophomonas, Succinivibrio, Sutterella, Syntrophococcus, Turicibacter, Variovorax, and Weissella; and
(c) comparing the patient sample levels with levels associated with a control sample, wherein elevated levels are indicative of whether or not the patient should have a colonoscopy.
19. A method for monitoring a patient for colorectal adenoma recurrence which comprises:
(a) obtaining a suitable patient sample;
(b) measuring a level of five or more bacteria selected from a group consisting of Acidovorax, Acinetobacter, Agrobacterium, Akkermansia, Alistipes, Allobaculum, Aquabacterium, Azonexus, Bacillaceae l, Bryantella, Carnobacteriaceae l, Chryseobacterium, Chryseomonas, Cloacibacterium, Comamonas, Dechloromonas, Delftia, Enterobacter, Erwinia, Exiguobacterium, Flavimonas, Fusobacterium, Gpl, Gp2, Helicobacter, Lactobacillus, Lactococcus, Leuconostoc, Methylobacterium, Micrococcineae, Novosphingobium, Pantoea, Pseudomonas, Pseudoxanthomonas, Roseburia, Rubrobacterineae, Serratia, Shinella, Sphingobium, Staphylococcus, Stenotrophomonas, Succinivibrio, Sutterella, Syntrophococcus, Turicibacter, Variovorax, and Weissella; and
(c) comparing the patient sample levels with levels associated with appropriate controls, wherein elevated levels are indicative of adenoma recurrence in the patient.
20. A method for monitoring the progress of a treatment protocol for a patient which comprises:
(a) obtaining a suitable patient sample;
(b) measuring a level of five or more bacteria selected from group consisting of Acidovorax, Acinetobacter, Agrobacterium, Akkermansia, Alistipes, Allobaculum, Aquabacterium, Azonexus, Bacillaceae l, Bryantella, Carnobacteriaceae l, Chryseobacterium, Chryseomonas, Cloacibacterium, Comamonas,
Dechloromonas, Delftia, Enterobacter, Erwinia, Exiguobacterium, Flavimonas, Fusobacterium, Gpl, Gp2, Helicobacter, Lactobacillus, Lactococcus, Leuconostoc, Methylobacterium, Micrococcineae, Novosphingobium, Pantoea, Pseudomonas, Pseudoxanthomonas, Roseburia, Rubrobacterineae, Serratia, Shinella, Sphingobium, Staphylococcus, Stenotrophomonas, Succinivibrio, Sutterella, Syntrophococcus, Turicibacter, Variovorax, and Weissella; and
comparing the patient sample levels with levels associated with appropriate controls, wherein modulated levels are indicative of the progress of the treatment for the patient.
A kit for detecting colorectal adenoma in a patient sample which comprises:
(a) a means for measuring a level of five more bacteria selected from a group consisting of Acidovorax, Acinetobacter, Agrobacterium, Akkermansia, Alistipes, Allobaculum, Aquabacterium, Azonexus, Bacillaceae l, Bryantella, Carnobacteriaceae l, Chryseobacterium, Chryseomonas, Cloacibacterium, Comamonas, Dechloromonas, Delftia, Enterobacter, Erwinia, Exiguobacterium, Flavimonas, Fusobacterium, Gpl, Gp2, Helicobacter, Lactobacillus, Lactococcus, Leuconostoc, Methylobacterium, Micrococcineae, Novosphingobium, Pantoea, Pseudomonas, Pseudoxanthomonas, Roseburia, Rubrobacterineae, Serratia, Shinella, Sphingobium, Staphylococcus, Stenotrophomonas, Succinivibrio, Sutterella, Syntrophococcus, Turicibacter, Variovorax, and Weissella; and
(b) instructions for comparing the patient sample levels with levels associated with healthy patient controls, wherein elevated levels are indicative of whether or not colorectal adenoma is present or absent in the patient.
22. A kit comprising:
(a) a reagent selected from a group consisting of:
(i) nucleic acid probes capable of specifically hybridizing with nucleic acids from five or more bacteria selected from a group consisting of Acidovorax, Acinetobacter, Agrobacterium, Akkermansia, Alistipes, Allobaculum, Aquabacterium, Azonexus, Bacillaceae l, Bryantella,
Carnobacteriaceae l, Chryseobacterium, Chryseomonas, Cloacibacterium, Comamonas, Dechloromonas, Delftia, Enterobacter, Erwinia, Exiguobacterium, Flavimonas, Fusobacterium, Gpl, Gp2, Helicobacter,
Lactobacillus, Lactococcus, Leuconostoc, Methylobacterium, Micrococcineae, Novosphingobium, Pantoea, Pseudomonas, Pseudoxanthomonas, Roseburia, Rubrobacterineae, Serratia, Shinella, Sphingobium, Staphylococcus, Stenotrophomonas, Succinivibrio, Sutterella, Syntrophococcus, Turicibacter, Variovorax, and Weissella;
(ii) a pair of nucleic acid primers capable of PCR amplification of five or more said bacteria; and
(iii) four or more antibodies specific for said bacteria; and
instructions for use in measuring levels in a tissue sample from a patient suspected of having colorectal adenoma.
A method of identifying a compound that prevents or treats colorectal adenomas, the method comprising the steps of:
(a) contacting a tissue or an animal model with a compound;
(b) measuring a level of four or more bacteria selected from group consisting of Acidovorax, Acinetobacter, Agrobacterium, Akkermansia, Alistipes, Allobaculum, Aquabacterium, Azonexus, Bacillaceae l, Bryantella, Carnobacteriaceae l, Chryseobacterium, Chryseomonas, Cloacibacterium, Comamonas, Dechloromonas, Delftia, Enterobacter, Erwinia, Exiguobacterium, Flavimonas, Fusobacterium, Gpl, Gp2, Helicobacter, Lactobacillus, Lactococcus, Leuconostoc, Methylobacterium, Micrococcineae, Novosphingobium, Pantoea, Pseudomonas, Pseudoxanthomonas, Roseburia, Rubrobacterineae, Serratia, Shinella, Sphingobium, Staphylococcus, Stenotrophomonas, Succinivibrio, Sutterella, Syntrophococcus, Turicibacter, Variovorax, and Weissella; and
(c) determining a functional effect of the compound on the bacteria levels, thereby identifying a compound that prevents or treats colorectal adenomas.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US14/124,443 US20140171339A1 (en) | 2011-06-06 | 2012-06-06 | Methods and kits for detecting adenomas, colorectal cancer, and uses thereof |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201161493770P | 2011-06-06 | 2011-06-06 | |
| US61/493,770 | 2011-06-06 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2012170478A2 true WO2012170478A2 (en) | 2012-12-13 |
| WO2012170478A3 WO2012170478A3 (en) | 2013-04-25 |
Family
ID=47296708
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2012/041020 Ceased WO2012170478A2 (en) | 2011-06-06 | 2012-06-06 | Methods and kits for detecting adenomas, colorectal cancer, and uses thereof |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US20140171339A1 (en) |
| WO (1) | WO2012170478A2 (en) |
Cited By (39)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015123205A1 (en) * | 2014-02-11 | 2015-08-20 | Children's Research Institute, Children's National Medical Center | Compositions and methods for determining the likelihood of appendicitis |
| EP2915884A1 (en) * | 2014-03-03 | 2015-09-09 | Institut d'Investigacio Biomedica de Girona Dr. Josep Trueta | Method for diagnosing colorectal cancer from a human feces sample by quantitive pcr, primers and kit |
| EP2955232A1 (en) * | 2014-06-12 | 2015-12-16 | Peer Bork | Method for diagnosing adenomas and/or colorectal cancer (CRC) based on analyzing the gut microbiome |
| US20150376716A1 (en) * | 2013-02-12 | 2015-12-31 | Japanese Foundation For Cancer Research | Method for examination of carcinogenic risk |
| WO2017062625A1 (en) * | 2015-10-06 | 2017-04-13 | Regents Of The University Of Minnesota | Method to detect colon cancer by means of the microbiome |
| EP3250708A4 (en) * | 2015-01-30 | 2018-06-27 | BGI Shenzhen | Biomarkers for colorectal cancer related diseases |
| JP2018525035A (en) * | 2015-08-11 | 2018-09-06 | ウニベルシタ デ ジローナ | Methods for quantifying members of Faecalibacterium prausnitzii phylogenetic group I and/or phylogenetic group II and their use as biomarkers |
| EP3262215A4 (en) * | 2015-02-27 | 2018-11-14 | Alere Inc. | Microbiome diagnostics |
| CN109557311A (en) * | 2018-12-13 | 2019-04-02 | 中南大学湘雅医院 | Colorectal cancer diagnostic markers and colorectal cancer detection products and their applications |
| EP3342864A4 (en) * | 2015-08-27 | 2019-04-10 | National Center of Neurology and Psychiatry | METHOD FOR DIAGNOSING AUTOIMMUNE DISEASE, BIOMARKER FOR DIAGNOSIS OF AUTOIMMUNE DISEASE, AND AGENT FOR PREVENTING OR TREATING AUTOIMMUNE DISEASE |
| CN109852714A (en) * | 2019-03-07 | 2019-06-07 | 南京世和基因生物技术有限公司 | A kind of early diagnosis of intestinal cancer and Diagnosis of Pituitary marker and purposes |
| US10471108B2 (en) | 2015-11-20 | 2019-11-12 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US10485830B2 (en) | 2016-12-12 | 2019-11-26 | 4D Pharma Plc | Compositions comprising bacterial strains |
| US10493112B2 (en) | 2015-06-15 | 2019-12-03 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US10500237B2 (en) | 2015-06-15 | 2019-12-10 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US10583158B2 (en) | 2016-03-04 | 2020-03-10 | 4D Pharma Plc | Compositions comprising bacterial strains |
| EP3464610A4 (en) * | 2016-06-01 | 2020-03-11 | University Of Ottawa | PROTEIN COMPOSITION AND METHODS FOR MICROBIOTE ANALYSIS |
| US10610549B2 (en) | 2016-07-13 | 2020-04-07 | 4D Pharma Plc | Composition comprising bacterial strains |
| US10610550B2 (en) | 2015-11-20 | 2020-04-07 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| KR20200037731A (en) * | 2018-10-01 | 2020-04-09 | 한국생명공학연구원 | A composition for inhibiting senescence comprising Akkermansia muciniphila or culture of the same |
| US10736926B2 (en) | 2015-06-15 | 2020-08-11 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US10780134B2 (en) | 2015-06-15 | 2020-09-22 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US10851137B2 (en) | 2013-04-10 | 2020-12-01 | 4D Pharma Research Limited | Polypeptide and immune modulation |
| EP3604557A4 (en) * | 2017-12-12 | 2021-01-13 | Suzhou Precision Gene Co., Ltd | Primer composition for analyzing intestinal flora and application thereof |
| US10973872B2 (en) | 2014-12-23 | 2021-04-13 | 4D Pharma Research Limited | Pirin polypeptide and immune modulation |
| US10987387B2 (en) | 2017-05-24 | 2021-04-27 | 4D Pharma Research Limited | Compositions comprising bacterial strain |
| US11007233B2 (en) | 2017-06-14 | 2021-05-18 | 4D Pharma Research Limited | Compositions comprising a bacterial strain of the genus Megasphera and uses thereof |
| WO2021146639A1 (en) * | 2020-01-17 | 2021-07-22 | Second Genome, Inc. | Methods and compositions for treating colorectal cancer |
| US11123378B2 (en) | 2017-05-22 | 2021-09-21 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US11123379B2 (en) | 2017-06-14 | 2021-09-21 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US11224620B2 (en) | 2016-07-13 | 2022-01-18 | 4D Pharma Plc | Compositions comprising bacterial strains |
| US11266698B2 (en) | 2011-10-07 | 2022-03-08 | 4D Pharma Research Limited | Bacterium for use as a probiotic for nutritional and medical applications |
| CN114729404A (en) * | 2019-08-26 | 2022-07-08 | 以色列国家农业和农村发展农业研究组织沃尔坎尼中心 | Fish skin microbiome |
| US11389493B2 (en) | 2015-06-15 | 2022-07-19 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US20220340979A1 (en) * | 2019-10-11 | 2022-10-27 | Guardant Health, Inc. | Use of cell free bacterial nucleic acids for detection of cancer |
| CN116144809A (en) * | 2023-04-06 | 2023-05-23 | 爱科睿特生物医疗科技(南京)有限公司 | Multiplex RT-PCR method for simultaneously detecting 5 probiotics for children, kit and application thereof |
| US11723933B2 (en) | 2014-12-23 | 2023-08-15 | Cj Bioscience, Inc. | Composition of bacteroides thetaiotaomicron for immune modulation |
| US12048720B2 (en) | 2017-06-14 | 2024-07-30 | Cj Bioscience, Inc. | Compositions comprising bacterial strains |
| WO2025147625A1 (en) * | 2024-01-05 | 2025-07-10 | Harbinger Health, Inc. | Tiered testing for high risk populations |
Families Citing this family (20)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AUPQ899700A0 (en) | 2000-07-25 | 2000-08-17 | Borody, Thomas Julius | Probiotic recolonisation therapy |
| WO2011151941A1 (en) | 2010-06-04 | 2011-12-08 | 国立大学法人東京大学 | Composition having activity of inducing proliferation or accumulation of regulatory t cell |
| EP2785828B1 (en) | 2011-12-01 | 2020-04-08 | The University of Tokyo | Human-derived bacteria that induce proliferation or accumulation of regulatory t cells |
| US10039777B2 (en) | 2012-03-20 | 2018-08-07 | Neuro-Lm Sas | Methods and pharmaceutical compositions of the treatment of autistic syndrome disorders |
| US10851399B2 (en) | 2015-06-25 | 2020-12-01 | Native Microbials, Inc. | Methods, apparatuses, and systems for microorganism strain analysis of complex heterogeneous communities, predicting and identifying functional relationships and interactions thereof, and selecting and synthesizing microbial ensembles based thereon |
| AU2016282996A1 (en) | 2015-06-25 | 2018-01-18 | Ascus Biosciences, Inc. | Methods, apparatuses, and systems for analyzing microorganism strains from complex heterogeneous communities, predicting and identifying functional relationships and interactions thereof, and selecting and synthesizing microbial ensembles based thereon |
| US9938558B2 (en) | 2015-06-25 | 2018-04-10 | Ascus Biosciences, Inc. | Methods, apparatuses, and systems for analyzing microorganism strains from complex heterogeneous communities, predicting and identifying functional relationships and interactions thereof, and selecting and synthesizing microbial ensembles based thereon |
| BR112018004532B1 (en) * | 2015-09-10 | 2022-03-15 | Université Catholique de Louvain | Use of pasteurized akkermansia for the treatment of metabolic disorders |
| CA3010505A1 (en) | 2016-01-07 | 2017-07-13 | Ascus Biosciences, Inc. | Methods for improving milk production by administration of microbial consortia |
| CN110366596A (en) | 2016-12-28 | 2019-10-22 | 埃斯库斯生物科技股份公司 | Methods, apparatus and systems for the analysis, determination of functional relationships and interactions, and identification and synthesis of biologically active modifiers based on intact microbial strains in complex heterogeneous communities |
| AU2017388535A1 (en) | 2016-12-28 | 2019-07-25 | Native Microbials, Inc. | Methods, apparatuses, and systems for microorganism strain analysis of complex heterogeneous communities with tracer analytics, determination of functional relationships and interactions thereof, and synthesis of microbial ensembles including dosed microbial ensembles and inoculative microbial ensembles |
| WO2018201049A1 (en) | 2017-04-28 | 2018-11-01 | Ascus Biosciences, Inc. | Methods for supporting grain intensive and/or energy intensive diets in ruminants with a synthetic bioensemble of microbes |
| CN107287332A (en) * | 2017-08-03 | 2017-10-24 | 华子昂 | The method that liquid ferment strain idenfication is carried out using SMRT sequencing technologies |
| WO2019060716A1 (en) | 2017-09-25 | 2019-03-28 | Freenome Holdings, Inc. | Methods and systems for sample extraction |
| WO2019200177A1 (en) * | 2018-04-12 | 2019-10-17 | Board Of Regents, The University Of Texas System | Biomarker for detecting cancer |
| WO2019226035A1 (en) * | 2018-05-25 | 2019-11-28 | 주식회사 엠디헬스케어 | Method for diagnosing colon cancer through qpcr analysis |
| CN114965733B (en) * | 2022-04-07 | 2023-12-01 | 中国人民解放军总医院第一医学中心 | Colorectal advanced adenoma diagnosis metabolic marker combination and application thereof |
| WO2025071560A1 (en) * | 2023-09-28 | 2025-04-03 | Rutgers, The State University Of New Jersey | Methods of diagnosing b cell malignancies, detecting b cell malignancy relapse, and treating thereof |
| CN116356026B (en) * | 2023-03-06 | 2024-10-01 | 臻傲生物科技检测(深圳)有限公司 | Novel microbial markers for predicting colorectal cancer or colorectal adenoma risk |
| KR20250097515A (en) * | 2023-12-21 | 2025-06-30 | 주식회사 휴앤바이옴 | Method for Providing Information for Colorectal Cancer Screening and Compositions Therefor |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU765082B2 (en) * | 1998-10-01 | 2003-09-11 | Medical College Of Georgia Research Institute | Screen for risk for gastric adenocarcinoma |
| US6335193B1 (en) * | 1999-04-15 | 2002-01-01 | Padmanabhan P Nair | Isolated colonocytes |
-
2012
- 2012-06-06 US US14/124,443 patent/US20140171339A1/en not_active Abandoned
- 2012-06-06 WO PCT/US2012/041020 patent/WO2012170478A2/en not_active Ceased
Cited By (68)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11266698B2 (en) | 2011-10-07 | 2022-03-08 | 4D Pharma Research Limited | Bacterium for use as a probiotic for nutritional and medical applications |
| US9670550B2 (en) * | 2013-02-12 | 2017-06-06 | Japanese Foundation For Cancer Research | Method for examination of carcinogenic risk |
| US20150376716A1 (en) * | 2013-02-12 | 2015-12-31 | Japanese Foundation For Cancer Research | Method for examination of carcinogenic risk |
| US11414463B2 (en) | 2013-04-10 | 2022-08-16 | 4D Pharma Research Limited | Polypeptide and immune modulation |
| US10851137B2 (en) | 2013-04-10 | 2020-12-01 | 4D Pharma Research Limited | Polypeptide and immune modulation |
| WO2015123205A1 (en) * | 2014-02-11 | 2015-08-20 | Children's Research Institute, Children's National Medical Center | Compositions and methods for determining the likelihood of appendicitis |
| US10520503B2 (en) | 2014-02-11 | 2019-12-31 | Children's Research Institute, Children's National Medical Center | Compositions and methods for determining the likelihood of appendicitis |
| EP2915884A1 (en) * | 2014-03-03 | 2015-09-09 | Institut d'Investigacio Biomedica de Girona Dr. Josep Trueta | Method for diagnosing colorectal cancer from a human feces sample by quantitive pcr, primers and kit |
| WO2015132273A1 (en) * | 2014-03-03 | 2015-09-11 | Institut D´Investigació Biomèdica De Girona Dr. Josep Trueta | Method for diagnosing colorectal cancer from a human feces sample by quantitive pcr, primers and kit |
| US10927416B2 (en) | 2014-03-03 | 2021-02-23 | Fundació Institut D'investigació Biomèdica De Girona Dr. Josep Trueta | Method for diagnosing colorectal cancer from a human feces sample by quantitative PCR, primers and kit |
| RU2692555C2 (en) * | 2014-03-03 | 2019-06-25 | Фундасио Институт Д'Инвестигасио Биомедика Де Жирона Др. Хосеп Труэта | Method for diagnosing colorectal cancer from human feces sample by quantitative pcr, primers and kit |
| EP2955232A1 (en) * | 2014-06-12 | 2015-12-16 | Peer Bork | Method for diagnosing adenomas and/or colorectal cancer (CRC) based on analyzing the gut microbiome |
| US10973872B2 (en) | 2014-12-23 | 2021-04-13 | 4D Pharma Research Limited | Pirin polypeptide and immune modulation |
| US11723933B2 (en) | 2014-12-23 | 2023-08-15 | Cj Bioscience, Inc. | Composition of bacteroides thetaiotaomicron for immune modulation |
| EP3250708A4 (en) * | 2015-01-30 | 2018-06-27 | BGI Shenzhen | Biomarkers for colorectal cancer related diseases |
| EP3262215A4 (en) * | 2015-02-27 | 2018-11-14 | Alere Inc. | Microbiome diagnostics |
| US10493112B2 (en) | 2015-06-15 | 2019-12-03 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US10500237B2 (en) | 2015-06-15 | 2019-12-10 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US11331352B2 (en) | 2015-06-15 | 2022-05-17 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US10780134B2 (en) | 2015-06-15 | 2020-09-22 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US10864236B2 (en) | 2015-06-15 | 2020-12-15 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US11433106B2 (en) | 2015-06-15 | 2022-09-06 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US11273185B2 (en) | 2015-06-15 | 2022-03-15 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US11040075B2 (en) | 2015-06-15 | 2021-06-22 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US11389493B2 (en) | 2015-06-15 | 2022-07-19 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US10736926B2 (en) | 2015-06-15 | 2020-08-11 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US10744167B2 (en) | 2015-06-15 | 2020-08-18 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| JP7095210B2 (en) | 2015-08-11 | 2022-07-05 | ウニベルシタ デ ジローナ | Methods for quantifying members of Faecalibacterium prausnitzii phylogenetic group I and/or phylogenetic group II and their use as biomarkers |
| US11299788B2 (en) | 2015-08-11 | 2022-04-12 | Universitat De Girona | Method for the quantification of Faecalibacterium prausnitzii phylogroup I and/or phylogroup II members and the use thereof as biomarkers |
| JP2022031644A (en) * | 2015-08-11 | 2022-02-22 | ウニベルシタ デ ジローナ | Methods for quantifying members of Faecalibacterium prausnitzii phylogenetic group I and/or phylogenetic group II and their use as biomarkers |
| JP2018525035A (en) * | 2015-08-11 | 2018-09-06 | ウニベルシタ デ ジローナ | Methods for quantifying members of Faecalibacterium prausnitzii phylogenetic group I and/or phylogenetic group II and their use as biomarkers |
| US12516386B2 (en) | 2015-08-11 | 2026-01-06 | Universitat De Girona | Kit for the quantification of Faecalibacterium prausnitzii phylogroup I and/or phylogroup II members and the use thereof as biomarkers |
| EP3342864A4 (en) * | 2015-08-27 | 2019-04-10 | National Center of Neurology and Psychiatry | METHOD FOR DIAGNOSING AUTOIMMUNE DISEASE, BIOMARKER FOR DIAGNOSIS OF AUTOIMMUNE DISEASE, AND AGENT FOR PREVENTING OR TREATING AUTOIMMUNE DISEASE |
| WO2017062625A1 (en) * | 2015-10-06 | 2017-04-13 | Regents Of The University Of Minnesota | Method to detect colon cancer by means of the microbiome |
| US10610550B2 (en) | 2015-11-20 | 2020-04-07 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US10471108B2 (en) | 2015-11-20 | 2019-11-12 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US11058732B2 (en) | 2015-11-20 | 2021-07-13 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US10583158B2 (en) | 2016-03-04 | 2020-03-10 | 4D Pharma Plc | Compositions comprising bacterial strains |
| US11933790B2 (en) | 2016-06-01 | 2024-03-19 | University Of Ottawa | Protein composition and methods for analysing microbiota |
| US11175294B2 (en) | 2016-06-01 | 2021-11-16 | University Of Ottawa | Protein composition and methods for analysing microbiota |
| EP3464610A4 (en) * | 2016-06-01 | 2020-03-11 | University Of Ottawa | PROTEIN COMPOSITION AND METHODS FOR MICROBIOTE ANALYSIS |
| US10967010B2 (en) | 2016-07-13 | 2021-04-06 | 4D Pharma Plc | Compositions comprising bacterial strains |
| US11224620B2 (en) | 2016-07-13 | 2022-01-18 | 4D Pharma Plc | Compositions comprising bacterial strains |
| US10610549B2 (en) | 2016-07-13 | 2020-04-07 | 4D Pharma Plc | Composition comprising bacterial strains |
| US10610548B2 (en) | 2016-07-13 | 2020-04-07 | 4D Pharma Plc | Compositions comprising bacterial strains |
| US10960031B2 (en) | 2016-07-13 | 2021-03-30 | 4D Pharma Plc | Compositions comprising bacterial strains |
| US10485830B2 (en) | 2016-12-12 | 2019-11-26 | 4D Pharma Plc | Compositions comprising bacterial strains |
| US11376284B2 (en) | 2017-05-22 | 2022-07-05 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US11123378B2 (en) | 2017-05-22 | 2021-09-21 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US11382936B2 (en) | 2017-05-22 | 2022-07-12 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US10987387B2 (en) | 2017-05-24 | 2021-04-27 | 4D Pharma Research Limited | Compositions comprising bacterial strain |
| US11660319B2 (en) | 2017-06-14 | 2023-05-30 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US11123379B2 (en) | 2017-06-14 | 2021-09-21 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US12048720B2 (en) | 2017-06-14 | 2024-07-30 | Cj Bioscience, Inc. | Compositions comprising bacterial strains |
| US11779613B2 (en) | 2017-06-14 | 2023-10-10 | Cj Bioscience, Inc. | Compositions comprising a bacterial strain of the genus Megasphera and uses thereof |
| US11007233B2 (en) | 2017-06-14 | 2021-05-18 | 4D Pharma Research Limited | Compositions comprising a bacterial strain of the genus Megasphera and uses thereof |
| EP3604557A4 (en) * | 2017-12-12 | 2021-01-13 | Suzhou Precision Gene Co., Ltd | Primer composition for analyzing intestinal flora and application thereof |
| US11401561B2 (en) | 2017-12-12 | 2022-08-02 | Suzhou Precision Gene Co. Ltd. | Primer composition for analyzing intestinal flora and application thereof |
| KR102377407B1 (en) | 2018-10-01 | 2022-03-22 | 한국생명공학연구원 | A composition for inhibiting senescence comprising Akkermansia muciniphila or culture of the same |
| KR20200037731A (en) * | 2018-10-01 | 2020-04-09 | 한국생명공학연구원 | A composition for inhibiting senescence comprising Akkermansia muciniphila or culture of the same |
| CN109557311A (en) * | 2018-12-13 | 2019-04-02 | 中南大学湘雅医院 | Colorectal cancer diagnostic markers and colorectal cancer detection products and their applications |
| CN109852714A (en) * | 2019-03-07 | 2019-06-07 | 南京世和基因生物技术有限公司 | A kind of early diagnosis of intestinal cancer and Diagnosis of Pituitary marker and purposes |
| CN114729404A (en) * | 2019-08-26 | 2022-07-08 | 以色列国家农业和农村发展农业研究组织沃尔坎尼中心 | Fish skin microbiome |
| US20220340979A1 (en) * | 2019-10-11 | 2022-10-27 | Guardant Health, Inc. | Use of cell free bacterial nucleic acids for detection of cancer |
| WO2021146639A1 (en) * | 2020-01-17 | 2021-07-22 | Second Genome, Inc. | Methods and compositions for treating colorectal cancer |
| CN116144809A (en) * | 2023-04-06 | 2023-05-23 | 爱科睿特生物医疗科技(南京)有限公司 | Multiplex RT-PCR method for simultaneously detecting 5 probiotics for children, kit and application thereof |
| CN116144809B (en) * | 2023-04-06 | 2023-09-19 | 爱科睿特生物医疗科技(南京)有限公司 | Multiplex RT-PCR method for simultaneously detecting 5 probiotics for children, kit and application thereof |
| WO2025147625A1 (en) * | 2024-01-05 | 2025-07-10 | Harbinger Health, Inc. | Tiered testing for high risk populations |
Also Published As
| Publication number | Publication date |
|---|---|
| US20140171339A1 (en) | 2014-06-19 |
| WO2012170478A3 (en) | 2013-04-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20140171339A1 (en) | Methods and kits for detecting adenomas, colorectal cancer, and uses thereof | |
| Chan et al. | Advances in tests for colorectal cancer screening and diagnosis | |
| Gao et al. | Mucosa-associated microbiota signature in colorectal cancer | |
| Tunsjø et al. | Detection of Fusobacterium nucleatum in stool and colonic tissues from Norwegian colorectal cancer patients | |
| EP2572000B1 (en) | Methods for diagnosing colorectal cancer | |
| KR102354660B1 (en) | Method for diagnosing colorectal cancer from a human feces sample by quantitative pcr, primers and kit | |
| CN111424093B (en) | Kit, device and method for diagnosis of lung cancer | |
| Enomoto et al. | Lack of association between CpG island methylator phenotype in human gastric cancers and methylation in their background non‐cancerous gastric mucosae | |
| Abbes et al. | Molecular methods for colorectal cancer screening: Progress with next-generation sequencing evolution | |
| EP2927327A1 (en) | Non-invasive in vitro method for diagnosis and prognosis of colorectal cancer | |
| EP2584045A1 (en) | Method for detection of colorectal tumor | |
| Shen et al. | Microbiome in intestinal lavage fluid may be a better indicator in evaluating the risk of developing colorectal cancer compared with fecal samples | |
| EP3532637B1 (en) | Method for isolation of eukaryotic nucleic acids from stool samples | |
| Lyngby et al. | Association of fecal and serum microRNA profiles with gastrointestinal cancer and chronic inflammatory enteropathy in dogs | |
| US12116634B2 (en) | Marker genes for colorectal cancer classification, method for judging lymph node metastasis for prognosis of colorectal cancer and kit therefor | |
| Vedeld et al. | Distinct longitudinal patterns of urine tumor DNA in patients undergoing surveillance for bladder cancer | |
| US12473590B2 (en) | Detection of microorganisms in the esophagus | |
| CN110283910A (en) | Application of target gene DNA methylation as a molecular marker in the preparation of a kit for discriminating colorectal cancer progression | |
| CN114207150A (en) | Improved method for screening, diagnosing and/or monitoring advanced colorectal tumors, advanced adenomas and/or colorectal carcinomas | |
| AU2009213671A1 (en) | Colon cancer associated transcript 1 (CCAT1) as a cancer marker | |
| JP6103866B2 (en) | Colorectal cancer detection method, diagnostic kit and DNA chip | |
| US20170130277A1 (en) | Biomarker for colorectal cancer | |
| CN108064273A (en) | The biomarker of colorectal cancer relevant disease | |
| CN113774138B (en) | Kit, device and method for diagnosis of lung cancer | |
| Liu et al. | Digestive tract disease |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12796261 Country of ref document: EP Kind code of ref document: A2 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14124443 Country of ref document: US |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 12796261 Country of ref document: EP Kind code of ref document: A2 |









