WO2012162741A1 - Enrichment of cardiomyocytes - Google Patents
Enrichment of cardiomyocytes Download PDFInfo
- Publication number
- WO2012162741A1 WO2012162741A1 PCT/AU2012/000607 AU2012000607W WO2012162741A1 WO 2012162741 A1 WO2012162741 A1 WO 2012162741A1 AU 2012000607 W AU2012000607 W AU 2012000607W WO 2012162741 A1 WO2012162741 A1 WO 2012162741A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cells
- cardiomyocytes
- population
- cell
- gfp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
- G01N33/5061—Muscle cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
- C12N5/0657—Cardiomyocytes; Heart cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/50—Cell markers; Cell surface determinants
- C12N2501/58—Adhesion molecules, e.g. ICAM, VCAM, CD18 (ligand), CD11 (ligand), CD49 (ligand)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
- G01N2333/70503—Immunoglobulin superfamily, e.g. VCAMs, PECAM, LFA-3
Definitions
- the present disclosure relates generally to the field of cardiology. More particularly, the present disclosure relates to methods of enriching for cardiomyocytes in a sample and to a population of cells comprising purified cardiomyocytes isolated using cell surface markers VCAM 1 and SIRPa.
- Heart disease is one of the most serious health concerns of the western world.
- Conditions include coronary heart disease, congenital cardiovascular defects and congestive heart failure.
- a central challenge for research in regenerative medicine is to develop cell compositions that can help reconstitute cardiac function in these conditions.
- Myocardial infarction is a life threatening event and may cause cardiac sudden death or heart failure.
- cardiac dysfunction after M l is still the major cardiovascular disorder that is increasing in incidence, prevalence and overall mortality.
- the damaged cardiomyocytes are gradually replaced by fibroid non-functional tissue.
- Ventricular remodelling results in wall thinning and loss of regional contractile function.
- the ventricular dysfunction is primarily due to a massive loss of cardiomyocytes. It is widely accepted that adult cardiomyocytes have little regenerative capacity. Therefore, the loss of cardiac myocytes after Ml is irreversible.
- Human cardiomyocytes can be generated from human embryonic stem cells in vitro by a variety of methods, including co-culture with visceral endoderm-like cell lines and growth factor directed differentiation as monolayers or three-dimensional cell aggregates (embryoid bodies, EBs).
- EBs three-dimensional cell aggregates
- one the challenges facing these methods is the ability to obtain substantially pure populations of cardiomyocytes free of other cells such as endothelial cells, smooth muscle, keratinocytes etc.
- the present inventors generated a genetically modified human embryonic stem cell line, NKX2-5 GFP/W in which green fluorescent protein (GFP) was under the control of the pan- cardiac marker NKX2-5.
- GFP green fluorescent protein
- Human cardiomyocytes were isolated from differentiating NKX2- gGFP / w n E50 S anc
- the inventors Based on the identified cell surface markers, the inventors have been able to generate a method for the rapid and efficient isolation of functional cardiomyocytes.
- the present disclosure is based on methods for enriching for cardiomyocytes (CM) based on their expression of cell surface markers VCAM 1 and SIRPa.
- CM cardiomyocytes
- VCAM 1 and SIRPa cell surface markers
- methods for enriching, or purifying cardiomyocytes have relied upon differentiation of hES cell aggregates or embryoid bodies and appropriate culture conditions that biases for cells of the desired phenotype either by outgrowth of the desired cells, or by inhibition or killing of other cell types.
- the enrichment that can be achieved using such methods is highly variable (typically around 20-50% of cardiomyocytes in the population).
- the methods of the present disclosure provide significantly greater levels of enrichment of cardiomyocytes compared with prior art methods available to date. Furthermore, existing methods for selecting for cardiomyocytes have relied upon the use of mitochondrial staining in combination with flow cytometry or magnetic cell separation methods. Older methodologies require cent rifugat ion across percoll gradients, which are technically challenging and time consuming.
- the present disclosure thus permits the facile enrichment of cardiomyocytes based on recognition of cell surface markers.
- cell populations enriched for cardiomyocytes can be selected based on expression of cell surface marker SIRPa or VCAM1 , or the combination of cell surface markers VCAM1 , and SIRPa.
- SIRPa expression can be discriminatory for cardiomyocytes (Dubois NC et al. (2011 ) vol 29(1 1 ): 1011 -1018) but is even more discriminatory for cardiomyocytes when combined with VCAM 1.
- VCAM 1 represents a cardiomyocyte commitment marker.
- the present disclosure provides a method for enriching for cardiomyocytes from a sample, the method comprising selecting for cells bearing the cell surface markers SIRPa and/or VCAM1.
- the method comprises selecting for cells bearing cell surface markers SIRPa and VCAM1.
- the selecting for cells comprises:
- binding agent that binds to SI RPa and/or a binding agent that binds to VCAM 1 , for a time and under conditions sufficient for said binding agents to bind;
- the method for enriching for cardiomyocytes according to the disclosure may further comprise the step of, prior to selecting for cells, generating a culture of the sample and causing differentiation of the cells in the sample. I n one example, the cells will be caused to differentiate in vitro.
- the sample according to the present disclosure may be a cell or tissue sample.
- a person skilled in the art will appreciate that where necessary, a single cell suspension of the tissue sample will be required to be generated. Such methods will be known to the skilled artisan and are described herein. For example, where the sample is an embryoid body, it may be necessary to dissociate the cells in the embryoid body.
- the sample comprises cardiosphere-derived cells (CDCs).
- CDCs cardiosphere-derived cells
- the sample comprises cardiomyocytes differentiated in culture from a stem cell or progenitor cell.
- the stem cell is a pluripotent stem cell.
- the pluripotent stem cell is a human embryonic stem cell (hES cell).
- Methods for causing differentiation of stem (including pluripotent stem) or progenitor cells are known in the art and are explained in further detail elsewhere in this document.
- the differentiation of the cells is biased towards cells of the cardiac lineage. Methods for biasing differentiation of cells towards the cardiac lineage will be known to persons skilled in the art. The cells may be in the process of becoming fully differentiated or may be fully differentiated.
- Suitable pluripotent cells include human embryonic stem cells (hES), embryonic stem cells from other primates, such as Rhesus stem cells or marmoset stem cells and human embryonic germ (hEG) cells, induced pluripotent stem cells (iPS), or stem cells lines such as but not limited to BG01 , BG02, HUES cell lines e.g. HUES1 -17, HES2 or HES3 or human ESC-derived cardiac progenitor cells (e.g. hESC-CPCs).
- hES human embryonic stem cells
- hEG human embryonic germ
- iPS induced pluripotent stem cells
- stem cells lines such as but not limited to BG01 , BG02, HUES cell lines e.g. HUES1 -17, HES2 or HES3 or human ESC-derived cardiac progenitor cells (e.g. hESC-CPCs).
- the sample comprises a mixed population of cells comprising cardiomyocytes.
- the mixed population of cells comprises any cell type that is capable of differentiating down the cardiac lineage.
- the mixed population of cells includes pluripotent cells, cardiac progenitor cells, induced pluripotent stem cells (iPS), induced/re-programmed cardiomyocyte cells, umbilical tissue, left atrial appendage, cardiac tissue, circulating endothelial cells, cardiac fibroblasts, adipose tissue or skin tissue and combinations thereof.
- the mixed population of cells comprises differentiating pluripotent cells and/or the progeny thereof.
- the sample or the mixed population of cells according to the present disclosure are human derived.
- the cells are human derived pluripotent cells.
- primate pluripotent cells may be suitable for use according to any method disclosed therein.
- the sample or the mixed population of cells according to the present disclosure may be autologous, or allogeneic.
- the pluripotent cells are human embryonic stem (hES) cells.
- the preferred progeny may include committed cardiac progenitor cells (CPCs) or cells derived from committed cardiac progenitor cells.
- CPCs committed cardiac progenitor cells
- the progeny cells are cardiomyocytes.
- the cardimyocytes are human cardiomyocytes.
- the method of the present disclsoure enriches for human cardiomyocytes.
- the step of selecting for cells bearing the cell surface markers SIRPa and/or VCAM 1 is achieved by contacting the sample using a binding agent that binds to SIRPa and/or a binding agent that binds to VCAM 1 , for a time and under conditions sufficient for said binding agents to bind.
- the binding agent specifically binds SI RPa or specifically binds VCAM 1.
- the sample is contacted with a binding agent that specifically binds SIRPa and a binding agent that specifically binds VCAM1.
- the selected cells to which the binding agent(s) is bound may then be isolated.
- Isolation of cells may be achieved by any of the methods known in the art, including affinity based interaction, affinity panning, magnetic beads (e.g. Dynabeads) or flow cytometry.
- the flow cytometry preferably employs a cell sorter so that the cells bearing surface markers SIRPa and/or VCAM1 (and therefore staining positive for SIRPa and/or VCAM 1 ) can be removed from cells that do not stain positive for these cell surface markers.
- the cells are selected using the binding agents described herein, and optionally one or more other cell surface markers, and isolated using fluorescence activated cell sorting (FACS) or magnetic activated cell sorting (MACSTM).
- FACS fluorescence activated cell sorting
- MCSTM magnetic activated cell sorting
- the cells may be isolated by binding to an immobilised support and then harvested by removing them from the support.
- the harvesting of cells may be achieved by collecting the isolated cells into a suitable receptacle or collection dish, tube etc.
- the population of cells enriched for cardiomyocytes are VCAM 1 + /SIRPa cells.
- the cells may comprise one or more additional cell surface markers, typically markers which are known to be expressed on cardiomyocytes.
- the cells selected according to the methods disclosed herein constitute a population of cells having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 87%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% cardiomyocyte cells.
- the selected or isolated cells have at least about 70% cardiomyocytes.
- the selected or isolated cells have at least about 80% cardiomyocytes.
- the selected cells have at least about 90% cardiomyocytes.
- the present disclosure also provides a population of cells enriched for cardiomyocytes according to a method described herein.
- the population of cells has at least about 70% cardiomyocytes.
- the population of cells has at least about 80% cardiomyocytes.
- the population of cells has at least about 90% cardiomyocytes.
- the present disclosure also provides a method for detecting cardiomyocytes in a sample, the method comprising contacting the sample with a binding agent that binds to SIRPa and/or a binding agent that binds to VCAM 1 for a time and under conditions sufficient for said binding agents to bind, wherein the cells to which the binding agent(s) binds are cardiomyocytes.
- the method comprises contacting the sample with a binding agent that specifically binds to SIPRa and a binding agent that specifically binds to VCAM1.
- the detection is performed by immunohistochemistry or ELISA.
- the mixed population of cells includes human embryonic stem cells (hES), embryonic stem cells from other primates, embryonic germ (hEG) cells, induced pluripotent stem cells (iPS), induced/re-programmed cardiomyocyte cells, stem cells lines such as BG01 , BG02, HUES cell lines such as HUES1-17, HES2 or HES3), umbilical tissue, left atrial appendage, cardiac tissue, circulating endothelial progenitor cells, cardiac fibroblasts, adipose tissue, skin tissue and cardiac progenitor cells and combinations thereof.
- hES human embryonic stem cells
- hEG embryonic germ
- iPS induced pluripotent stem cells
- iPS induced/re-programmed cardiomyocyte cells
- stem cells lines such as BG01 , BG02, HUES cell lines such as HUES1-17, HES2 or HES3
- umbilical tissue left atrial appendage
- cardiac tissue circulating endotheli
- the binding agent according to the present disclosure may be an antibody or a protein comprising an antibody variable region.
- Exemplary antibodies are chimeric antibodies, humanized antibodies or human antibodies.
- the antibody may be produced recombinantly or by hybridoma generation according to standard techniques.
- the antibody may be polyclonal or monoclonal.
- the antibody or protein comprising an antibody variable region may be unconjugated or conjugated to a moiety.
- suitable moieties include biotin or a fluorescent label e.g. FITC. Any suitable label that facilitates the enrichment or detection of cardiomyocytes according to the invention is intended to be included within the scope of the present disclosure.
- the binding agents may be used simultaneously or sequentially.
- the cells may be first selected on the basis of cell surface binding to SIRPa and then isolated by flow cytometry and then further selected with a binding agent to the VCAM 1 cell surface marker followed by further flow cytometry.
- the cells may be selected using binding agents simultaneously to both cell surface markers, wherein one of the binding agents may be labelled with e.g. FITC (fluorescein isothiocyanate) and the second binding agent labelled with e.g. phycoerythrin (PE) which facilitates isolation by flow cytometry.
- FITC fluorescein isothiocyanate
- PE phycoerythrin
- the binding agent is an antibody which specifically binds to human
- the binding agent is an antibody which specifically binds to human
- the present disclosure also provides a purified population of cells comprising at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 87%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) cardiomyocytes.
- the purified population of cells comprises at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 87%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% VCAM 1 + /SIRPcT cardiomyocytes.
- the cardiomyocytes may further comprise one or more additional cell surface markers selected from the group consisting of CORIN, GJA3, ESRRG, CACNB2, TMEM 163, TRPM4, HTR4, SLC20A2, CADPS, CADPS2, TSPAN13, ERBB2, CACNA1 C, TPCN2, FSD2, TSPAN32, CRHBP, JPH2, VSTM2L, NES, THBS1 , GCOM 1 , CACNB2, EDNRA, and CLCNKA.
- additional cell surface markers selected from the group consisting of CORIN, GJA3, ESRRG, CACNB2, TMEM 163, TRPM4, HTR4, SLC20A2, CADPS, CADPS2, TSPAN13, ERBB2, CACNA1 C, TPCN2, FSD2, TSPAN32, CRHBP, JPH2, VSTM2L, NES, THBS1 , GCOM 1 , CACNB2, EDNRA, and CLCNKA.
- the cardiomyocytes may further comprise one or more additional cell surface markers selected from the group consisting of FSD2, TSPAN32, THBS1 , CORIN, GJA3 and ERBB2.
- the cardiomyocytes are VCAM 1 + , SI RPa + and CORIlsT.
- the cardiomyocytes are VCAM1 + , SIRPa + and FSD2 + .
- the cardiomyocytes of the present disclosure may also be characterised by expression of one or more genes selected from the group consisting of Nkx2.5, IRX4, RPL9, RPL23, PABPC1, NNT, COX7B, IMMT, DSTN, TBX-20, MYL2 and NEBL.
- the cardiomyocytes of the present disclosure can possess one or more phenotypic characteristics of naturally occurring cardiomyocytes for example, spontaneous cell beating.
- the characteristic of spontaneous cell beating may be present at the time the cell is enriched or the cell may acquire or develop this phenotype in time or due to agents or compounds that are added to the cell to force this phenotypic development.
- the cardiomyocytes may express other characteristics of natural cardiomyocytes such as ion channel or appropriate electrophysiology.
- the present disclosure also provides a pharmaceutical composition
- a pharmaceutical composition comprising a therapeutically effective amount of population of cells disclosed herein, together with a pharmaceutically acceptable carrier.
- the present disclosure also provides a method of screening a compound for an effect on cardiomyocytes, comprising combining the compound with the population of cells as described herein, and determining any modulatory effect resulting from the compound. This may include examination of the cells for toxicity, metabolic change, or an effect on contractile activity.
- the disclosure also provides a method for treating a subject suffering from a cardiovascular disease or disorder, comprising administering to the subject a therapeutically effective amount of a population of cells as described herein or a pharmaceutical composition according to the present disclosure.
- cardiovascular diseases or disorders that are amenable to treatment include coronary heart disease, cardiomyopathy, endocarditis, congenital cardiovascular defects and congestive heart failure, long QT syndrome and other ion channel pathologies.
- the present disclosure also provides a method of repairing or treating damaged myocardium comprising the step of administering to a subject a therapeutically effective amount of a population of cells as described herein, or a pharmaceutical composition as described herein. Repairing damaged myocardium comprises at least partially restoring structural integrity or functional integrity to the damaged myocardium.
- the method for repairing or treating damaged myocardium may comprise intrauterine administration of a therapeutically effective amount of a population of cells as described herein, or a pharmaceutical composition as described herein to the developing foetus.
- the present disclosure also provides a composition comprising a population of cells as described herein, or a pharmaceutical composition as described herein for use in medicine, in particular for use in treating a cardiovascular disease or disorder or for repairing or treating damaged myocardium.
- the present disclosure also provides use a population of cells as described herein, or a pharmaceutical composition as described herein in the manufacture of a medicament or in a delivery device for treating a cardiovascular disease or disorder, or for repairing or treating damaged myocardium.
- cardiomyocytes may be used as a research tool to elucidate mechanisms underlying conditions such as cardiomyopathies or muscular dystrophy or complex genetic diseases such as progeria (premature ageing) or for elucidating mechanisms of heart disease linked to the gene expression profile.
- the cardiomyocytes may also be used for functional analysis of disease specific inducible pluripotent (iPS) cells.
- the disclosure also provides a method for examining the function of cardiac disease-specific iPS cells, comprising:
- the cells are selected using a binding agent that binds to VCAM 1 and a binding agent that binds to SIRPa.
- Examining the functionality of cells may include examining action potential/electrophysiology, arrhythmogenicity, or ion channel behaviour. Other suitable parameters will be familiar to person skilled in the art.
- a disease specific iPS cell line can be generated from a subject for example, with congenital long QT syndrome (LQTS) and then differentiated into the cardiac lineage.
- the differentiated cells can be enriched for cardiomyocytes according to a method exemplified herein.
- the functional properties of the cardiomyocytes can then be examined in order to elucidate the underlying mechanisms of the disease.
- the disclosure also extends to the use of cardiomyocytes derived from a differentiated disease-specific human iPS cell line, to evaluate drugs that may either ameliorate or aggravate the disease phenotype.
- the present disclosure also provides a kit comprising a binding agent which binds to VCAM 1 and a binding agent which binds to SIRPa, together with instructions for use in enriching cardiomyocytes.
- the present disclosure also provides a purified population of cells or a composition described herein packaged in a suitable container with written instructions for a desired purpose.
- the purpose is reconstitution of cardiomyocyte cell function to improve some abnormality of the cardiac muscle.
- the purpose is for use in screening or diagnostic applications.
- FIG. 1 Characterisation of cardiomyocytes generated from NKX2-5 GFP W hESCs
- a Wild type and targeted NKX2-5 alleles
- GFP Green fluorescence
- BF brightfield
- RGE Relative gene expression
- FIG. 1 Images for GFP + cells stained with antibodies to cardiac markers GATA4, ISL1 , MYL2 (ventricular myosin light chain 2) and MYL7 (regulatory myosin light chain 7) (Scalebar: 10 ⁇ ).
- FIG. 2 Gene targeting of the NKX2-5 locus, (a) Schematic representation of the targeting strategy to introduce GFP into the first exon of NKX2-5. The two NKX2-5 coding exons (e1 and e2) are shown as black boxes and the translational start site is marked atg.
- NeoR denotes the pGKNeo cassette encoding G418 resistance flanked by loxP sites.
- the eGFP sequences are shown as the box marked GFP. Positions of the Hindlll restriction sites and the primers (p1-p5) used to map the structure of the modified locus are shown, (b) PCR amplification of a specific 5.4 kb band (p1 - p2; 3' homology arm) identifies a targeted clone (GFPNeoR denotes NKX2-5 GFPNeoR allele), (c) PCR amplification across the 5' homology arm results in an 8.5 kb band confirming the recombination event in both MEL 1 (M 1 ) and HES 3 (H3) targeted clones.
- Non-contiguous lanes from the same gel are shown, (d) Removal of the pGKNeoR cassette by CRE/LoxP recombination was demonstrated by amplification of a 4.5 kb band using primers p3 and p2 (GFP denotes NKX2-5 GFP allele). All PCR products (b-d) were sequenced, (e) Southern blot analysis of Hindlll digested genomic DNA with a GFP probe detects a 10.5 kb band. This demonstrates that only single integration event has occurred in both M 1 and H3 NKX2-5 GFP W lines.
- Genomic DNA from a previously targeted line H3 M IXL -
- Numbers indicate the percentage of positive cells for each marker, (i-k) Hematoxylin and eosin stained histological sections of teratomas from H3 NKX2-5 GFP W cells showing derivatives of (i) ectoderm, (j) mesoderm and (k) endoderm. Arrow denote structures that derived from the three germ layers; neural rosettes (i) cartilage (j) and secretory columnar epithelium (k).
- NKX2-5 GFP W CMs display similar electrophysiological and pharmacological phenotypes to CMs from genetically unmanipulated hESC lines, (a) Representative single electrode recording of the field potential of NKX2-5 GFP W derived cardiomyocytes measured on a multi electrode array, (b) Graphical representation of calcium level cycling during contractions determined by confocal imaging of the calcium dependent dye Fura red. (c) NKX2-5 GFP W CMs increase both contraction amplitude and frequency in response to Endothelin (ET-1 ).
- NKX2-5 GFP W hESCs facilitate real-time monitoring of cardiac differentiation,
- (d) Quantification of percentage of GFP + cells during EB differentiation (n 4; Error Bars, SEM).
- Figure s Improving cardiac differentiation from NKX2-5 GFP W hESCs using the spin EB platform,
- the visual score assigned to GFP intensity is indicated in top right corner (BF, Bright Field; GFP, green fluorescence), (d, e) Heat maps showing cardiac differentiation induced by a range of BMP4 and ACTIVIN A concentrations in (d) H3 NKX2-5 GFPA,V and (e) M1 NKX2-5 GFP W .
- Four plates were scored per experiment; data shown is the average of two experiments.
- media was supplemented with SCF 40 ng/ml, VEGF 30 ng/ml and WNT3a 50 ng/ml.
- the color scale shown correlates with the visual scoring system shown in (c), with dark green (far left of the panel) representing 0, and dark red (far right of the panel) representing 5.
- the medium also contained SCF 40 ng ml “1 , VEGF 30 ng ml “ and WNT3A 100 ng ml "1 .
- the medium contained BMP4 20 ng ml “1 , ACTIVIN A 20 ng ml “1 , SCF 40 ng ml “1 and VEGF 30 ng ml “1 , (i-k) Spin EBs cultured in LI-BEL media remain contractile and continue to express GFP for 120 days (Scalebar, 100 Mm).
- FIG. 6 Flow cytometric analysis showing accumulation of the mitochondrial dye tetramethylrhodamine methyl ester perchlorate (TMRM) in undifferentiated (Un) hESCs and in GFP + and GFP " cells.
- RHOD Rhodamine
- FIG. 7 The mitochondrial dye TMRM accumulates in mitochondria in undifferentiated hESC as well as in GFP + and GFP " .
- RHOD Rhodamine
- the boxed regions in panels m-p are shown enlarged in panels q-t.
- the images show perinuclear accumulation of rhodamine fluorescence, consistent with mitochondrial localization, in (g, h) undifferentiated ES cells and in (o, p, s, t) d11 NKX2- 5 GFP W cells where it is clearly present in both GFP + (arrows in t) and in GFP (arrowheads in t) cells.
- Scale bar 20 ⁇ in a-p and 50 ⁇ in q-t.
- FIG. 8 Expression profiling of NKX2-5 + hESCs cells identifies cardiac cell surface markers,
- DN PDGFRa " GFP " ;
- P + PDGFRa + GFP " ;
- PG+ PDGFR a + GFP + ).
- Figure 9 Gene expression profiling of committed human CPCs and early CMs. Key differentially regulated genes are listed along with the fold change of expression level observed (a, c).
- FIG. 10 Characterisation of cell populations isolated based on expression of GFP, SIRPa and VCAM1.
- b) Time course of SIRPa and VCAM1 expression during EB differentiation.
- the percent GFP + cells is shown, f) Flow cytometric analysis of cultured SIRPa + cells demonstrating that the GFP + cells become SIRPa + VCAM1 + after 7d in culture, (g) Microarray analysis comparing gene expression profiles of d14 GFP + cell populations fractionated on the basis of VCAM 1 (d14 GV + , GFP + VCAM 1 + and d14 GFP + , GFP + VCAM 1 " ).
- the GFP + VCAM 1 + population has higher levels of myocardial markers including IRX4, MYL2 and LAMA4 whilst endothelial markers including CD34, TEK ( ⁇ / ⁇ 2), and CDH5 ⁇ VE- CADHERIN) are higher in GFP + VCAM 1 " cells,
- (h) Comparison of gene expression profiles of d14 GFP + cell populations isolated on the basis of co-expression of VCAM 1 (d14 GV + ) or PDGFRa (d14 PG + ). Key differentially regulated genes are listed along with the fold change of expression level observed (g, h). Note that the nuclear encoded mitochondrial genes, NNT, COX7B and IMMT were also up-regulated in the d14 GV + population.
- VCAM 1 acts as a maturation marker for CMs.
- (I) Percentage of cells expressing VCAM 1 in GS + and GSV + fractions at day 10 (lighter bars) and at 4 days post re-aggregation (Day 10+4; darker bars) as determined by flow cytometry (n 3; Error Bars, SEM).
- FIG. 13 Putative CMs from the GSV + population are more mature than those of the GS + fraction
- (a) Percent of cells from GS + (lighter bars) and GSV + (darker bars) fractions that display Ca 2+ flux after 3, 5 and 6 days of culture after a day 10 FACS (n 1 )
- (c) Percent of cells from the GSV + fraction that significantly increase in their rate of spontaneous activity in response Isoprenaline (GSV + Iso) and the Isoprenaline vehicle control (GSV + Veh) (n 1 ).
- FIG. 14 VCAM 1 and SIRPa together facilitate selection of enriched CM populations,
- (a-b) Flow cytometric analysis of SI RPa " VCAM1 " (SV " ), SIRPa + (S + ) and VCAM 1 + SIRPA high (SV + ) cells from (a) day 7 EBs after 7 days in culture and (b) day 11 EBs after 7 days in culture and day 14 EBs after 7 days in culture. The percent GFP + cells is shown.
- n 1
- composition of matter, group of steps or group of compositions of matter shall be taken to encompass one and a plurality (i.e. one or more) of those steps, compositions of matter, groups of steps or group of compositions of matter.
- allogeneic refers to tissue, cells or stem cells being genetically different, but deriving from the same species.
- autologous refers to tissue, cells or stem cells that are derived from the same subject's body.
- the term "bearing the cell surface marker” is understood to mean a protein, glycoprotein or other molecule which is present or displayed on the surface of a cell which serves to identify the cell. It will be also understood by persons skilled in the art to mean that the protein, glycoprotein or other molecule is expressed on the cell surface.
- a cell surface marker can generally be detected by conventional methods, for example, fluorescence activated cell sorting (FACS) or enzymatic analysis.
- FACS fluorescence activated cell sorting
- Cell surface markers can be utilized for positive or negative selection processes. For example, a positive selection marker such as VCAM 1 or SIRPa is present on the differentiating cells of interest. Markers for negative selection are absent on the differentiating cells or interest but will typically be present on other cells in the sample e.g. endodermal cells, fibroblasts etc. Negative selection markers may therefore also be utilized in the methods of the present disclosure.
- CDCs cardiac-derived cells
- autologous percutaneous endomyocardial biopies can be used to obtain source tissue and a cardiosphere culture method (Messina E, et al. (2004) Circ Res 95:911 -21 ) used to yield CDCs.
- CDCs are clonogenic and have multilineage potential. CDCs can be differentiated into mature cardiac lineage cells in hygrogels (Li Z et al. (201 1 ) Biomaterials 32(12): 3220-32).
- cardiovascular disease or disorder refers to a disease or disorder related to the cardiovascular or circulatory system.
- Cardiovascular disease and/or disorders include, but are not limited to, diseases and/or disorders of the pericardium, heart valves (i.e. incompetent valves, stenosed valves, rheumatic heart disease, mitral valve prolapse, aortic regurgitation), myocardium (cornonary artery disease, myocardial infarction, heart failure, ischemic heart disease, angina).
- heart valves i.e. incompetent valves, stenosed valves, rheumatic heart disease, mitral valve prolapse, aortic regurgitation
- myocardium cornonary artery disease, myocardial infarction, heart failure, ischemic heart disease, angina.
- the person skilled in the art would be aware that cardiovascular diseases and/or disorders can result from congenital defects, environmental influences (i.e. dietary, lifestyle, stress etc) and other defects or influences.
- cardiomyocyte refers to any cell in the cardiac myocyte lineage that shows at least one phenotypic characteristic of a cardiac muscle cell. Such phenotypic characteristics include expression of cardiac proteins, such as cardiac sarcomeric or myofibrillar proteins or atrial natriuretic factor, or electrophysiological characteristics.
- cardiac proteins such as cardiac sarcomeric or myofibrillar proteins or atrial natriuretic factor, or electrophysiological characteristics.
- cardiac proteins such as cardiac sarcomeric or myofibrillar proteins or atrial natriuretic factor
- electrophysiological characteristics electrophysiological characteristics.
- cardiomyocyte and myocyte are used interchangeably.
- a cardiomyocyte is defined as any cell in the cardiac myocyte lineage expressing cell surface markers VCAM 1 and SIRPa.
- the cell may also express one or more additional markers (not necessary cell surface markers) including alpha-actinin, annexin, atrial natriuretic peptide (ANP), brain natriuretic peptides (BNP), cardiac troponin I (cTnl ), cardiac troponin-T, caveolin- 2, caveolin-3, connexin-43, dHAND, eHAND, GATA-4, myosin heavy chain, myosin light chain, Nkx2.5.
- additional markers including alpha-actinin, annexin, atrial natriuretic peptide (ANP), brain natriuretic peptides (BNP), cardiac troponin I (cTnl ), cardiac troponin-T, caveolin- 2, caveolin-3, connexin-43, dHAND, eHAND, GATA-4, myosin heavy chain, myosin light chain, Nkx2.5.
- CAD coronary artery disease
- atherosclerosis causes patches of fatty tissue (called plaques) to form on the inside walls of the coronary arteries. As the plaque thickens, the artery narrows and blood flow decreases resulting in a decrease in oxygen to the myocardium, leading to an infarct or heart attack.
- heart failure refers to the loss of cardiomyocytes such that progressive cardiomyocyte loss over time leads to the development of a pathophysiological state whereby the heart is unable to pump at a rate commensurate with the requirements of the metabolizing tissues or can do so only from an elevated filling pressure.
- flow cytometry is understood to involve the separation of cells in a liquid sample. Generally the purpose of flow cytometry is to analyse the separated cells for one or more characteristics thereof. A fluid sample is directed through an apparatus such that a liquid stream passes through a sensing region. The cells pass the sensor one at a time and are categorized based on size, refraction, light scattering, opacity, roughness, shape, fluorescence, etc. In the context of the present disclosure, the term “flow cytometry” is also understood to encompass cell sorting (fluorescence activated cell sorting).
- inducible pluripotent stem cell iPS
- iPS inducible pluripotent stem cell
- inducible/re-programmed cardiomyocytes refer to cells which are derived from fibroblasts which have been reprogrammed into cardiomyocyte-like cells in cell culture.
- Micro RNAs can be used to regulate gene expression via translational and transcriptional modulation, to reprogram in vitro cultured and endogenous cardiac fibroblasts toward a cardiomyocyte phenotype (Jayawardena TM et al. (2012) Circ Res 1 10(1 1 ): 1465-73).
- Another study has demonstrated that three developmental transcription factors (Gata4, Mef2c and Tbx5) reprogrammed post-natal cardiac or dermal fibrobalsts directly into differentiated cardiomyocyte-like cells ( leda M et al. (2010) Cell 142(3):375-386).
- isolated is intended to refer to a cell, isolatable or purified from other components.
- An isolated cell refers to a cell free from the environment in which it may naturally occur. The isolated cell may be purified to any degree relative to its naturally- obtainable state.
- heart disease or "heart failure” refers to a lack of oxygen due to inadequate perfusion or blood supply.
- ischemic heart disease is the consequence of atherosclerosis of the coronary arteries.
- pluripotent stem cells are taken to mean that such cells have the ability to differentiate into all types of cells in an adult organism.
- induced pluripotent stem cell encompasses pluripotent cells, that, like embryonic stem (ES) cells, can be cultured over a long period of time which maintaining the ability to differentiate into all types of cells in an organism, but that, unlike ES cells (which are derived from the inner cell mass of blastocysts), are derived from differentiated somatic cells, that is, cells that had a narrower, more defined potential and that in the absence of experimental manipulation could not give rise to all types of cells in the organism.
- iPS cells By having the potential to become iPS cells, it is meant that the differentiated somatic cells can be induced to become, i.e. reprogrammed to become, iPS cells.
- the somatic cell can be induced to redifferentiate so as to establish cells having the morphological characteristics, growth ability and pluripotency of pluripotent cells.
- iPS cells have an hESC-like morphology, growing as flat colonies with large nucleo-cytoplasmic ratios, defined borders and prominent nucleoli.
- iPS cells express one or more key pluripotency markers by one of ordinary skill in the art, including but not limited to Alkaline Phosphatase, SSEA3, SSEA4, Sox2, Oct3/4, Nanog, TRA160, TRA181 , TDGF 1 , Dnmt3b, FoxD3, GDF3, Cyp26a1 , TERT, and zfp42.
- pluripotent cells are capable of forming teratomas.
- the term "specifically binds" shall be taken to mean that the binding agent e.g. antibody or protein comprising an antibody variable region reacts or associates more frequently, more rapidly, with greater duration and/or with greater affinity with a particular cell or substance than it does with alternative cells or substances.
- a binding agent that specifically binds to a target protein is a agent that binds that protein or an epitope or immunogenic fragment thereof with greater affinity, avidity, more readily, and/or with greater duration than it binds to unrelated protein and/or epitopes or immunogenic fragments thereof.
- binding agent that specifically binds to a first target may or may not specifically bind to a second target.
- binding does not necessarily require exclusive binding or non-detectable binding of another molecule, this is encompassed by the term "selective binding”.
- selective binding Generally, but not necessarily, reference to binding means specific binding.
- the term "subject” shall be taken to mean any subject, including a human or non-human subject.
- the non-human subject may include non-human primates, ungulate (bovines, porcines, ovines, caprines, equines, buffalo and bison), canine, feline, lagomorph (rabbits, hares and pikas), rodent (mouse, rat, guinea pig, hamster and gerbil), avian, and fish.
- the subject is a human.
- the term "therapeutically effective amount” shall be taken to mean a sufficient quantity of a population of cells enriched for cardiomyocytes, or otherwise VCAM 1 + /SIRPa + cells that results in an improvement or remediation of the symptoms of the disease or condition.
- the skilled artisan will be aware that such an amount will vary depending upon, for example, the particular subject and/or the type or severity or level of disease.
- the term is not to be construed to limit the present disclosure to a specific quantity, e.g. weight or number of cells, rather the present disclosure encompasses any number of cells sufficient to achieve the stated result in a subject.
- treating include administering a therapeutically effective amount of a population of cells enriched for cardiomyocytes or otherwise VCAM 1 + /SIRPa + cells or a composition comprising such cells described herein sufficient to reduce or eliminate at least one symptom of a specified disease or condition.
- VCAM-1 positive or (+) or SIRPa positive or (+) refers to expression of the cell surface marker compared with a suitable isotype matched control.
- a cell that is referred to as being "positive” for a given marker may express either a low (lo or dim) or a high (bright, bri) level of that marker depending on the degree to which the marker is present on the cell surface, wherein the terms relate to intensity of fluorescence or other marker used in the sorting process of the cells. The distinction of lo and bri will be understood in the context of the marker used on a particular cell population being sorted.
- a cell that is referred to as being "negative” for a given marker is not necessarily completely absent from that cell. This term means that the marker is expressed at a relatively very low level by that cell, and that it generated a very low signal when detectably labeled or is undetectable above background levels, e.g. , levels detected using an isotype control antibody.
- Bright cells express more of the target marker protein (for example the antigens recognized by VCAM 1 and/or SI RPa) than other cells in the sample.
- positive expression of any given marker will be at least one log magnitude greater, preferably two log magnitude higher expression of the surface marker compared with the isotype matched negative control.
- SIRPA is intended to be used interchangeably with SIRPa.
- a "pluripotent cell” is preferably one which is derived from any kind of embryonic tissue (fetal or pre-fetal tissue) and has the characteristics of being capable under appropriate conditions of producing progeny of different cell types that are derivatives of all the three germinal layers (endoderm, mesoderm and ectoderm), according to standard tests, such as the ability to form a teratoma in 8-12 week old SCID mice, or the ability to form identifiable cells of all three germ layers in tissue culture.
- Stem cells of interest include embryonic cells of various types, exemplified by human embryonic stem (hES) cells, described by Thomson et al. , (Science 282: 1145, 1998); embryonic stem cells from other primates, such as Rhesus stem cells (Thomson et al. , Proc. Natl. Acad. Sci USA 92:7844, 1995), marmoset stem cells (Thomson et al. , Biol. Reprod. 55:254, 1996) and human embryonic germ (hEG) cells (Shamblott et al. , Proc. Natl. Acad. Sci. USA 95: 13726, 1998).
- hES human embryonic stem
- cell types may be provided in the form of an established cell line, or they may be obtained directly from primary embryonic tissue and used immediately for differentiation.
- Examples of cell lines include those listed in the NIH Human Embryonic Stem Cell Registry, e.g. hESBGN-01 , hESBGN-02, hESBGN-03, hESBGN-04 (BresaGen, Inc), HES-1 , HES-2 (Reubinoff et al. , Nat Biotechnol. 18:399-404, 2000), HES-3 (Mummery C et al. , J Anat 200:233-242, 2002; Passier R et al.
- HES-4, HES-5, HES-6 ES Cell International
- Miz-hES1 MizMedi Hospital-Seoul National University
- HSF-1 HSF-6
- HSF-6 Universality of California at San Francisco
- H1 , H7, H9, H13, H14 WiCell Research Institute
- lineage committed stem cells such as mesodermal stem cells and other early cardiogenic cells (Reyes et al. (2001 ) Blood 98:2615; Eisenberg & Bader (1996) Cic Res. 78(2):205).
- Other types of pluripotent cells are also included in the term.
- Any cells of primate (including human) origin that are capable of producing progeny that are derivatives of all three germinal layers are included, regardless of whether they were derived from embryonic tissue, fetal tissue, or other sources.
- ES cells are considered to be undifferentiated when they have not committed to a specific differentiation lineage. Such cells display morphological characteristics that distinguish them from differentiated cells of embryo or adult origin. Undifferentiated ES cells are easily recognised by those skilled in the art, and typically appear under the microscope as colonies of cells with high nuclear/cytoplasmic ratios and prominent nucleoli. Undifferentiated ES cells express genes that may be used as markers to detect the presence of undifferentiated cells, and whose polypeptide products may be used as markers for negative selection.
- Embryonic stem cells have been isolated from blastocyts of members of the primate species (Thomson et al. , Proc. Natl. Acad. Sci USA 92:7844, 1995).
- Human embryonic stem (hES) cells can be prepared from human blastocyst cells using the techniques described by Thomson et al., (US Patent No. 5,843,780; Science 282: 1 145, 1998) and Reubinoff et al. , (Nature Biotech. 18:399, 2000).
- Equivalent cell types to hES cells include their pluripotent derivatives, such as primitive endoderm-like (EPL) cells, described in WO 01/51610.
- human blastocytes are obtained from human in vivo preimplantation embryos.
- in vitro fertilised (IVF) embryos can be used, or one cell human embryos can be expanded to the blastocyst stage (Bongso et al. , Human Reprod 4:706, 1989). Embryos are cultured to the blastocyst stage in G1.2 and G2.2 medium. The zona pellucida is removed from the developed blastocyts by brief exposure to pronase. The inner cell masses are isolated (for example by immunosurgery using rabbit anti-human spleen cell antiserum). The intact inner cell mass is plated on mEF feeder cells (US Patent No.
- a “differentiated cell” is a cell that has progressed further down the developmental pathway than a cell with which it is being compared.
- embryonic stem cells can differentiate to lineage restricted progenitor cells (such as a mesodermal stem cell), which in turn can differentiate into other types of progenitor cells further down the pathway (such as cardiomyocyte progenitors), and then to an end-stage differentiated cells, which plays a characteristic role in a certain tissue type, and may or may not retain the capability to proliferate further.
- ES cells to give rise to all differentiated cells provides a means of giving rise to any mammalian cells type, and so a range of culture conditions may be used to induce differentiation.
- differentiated cells of interest are cells not readily grown from somatic stem cells, or cells that may be required in large numbers and hence are not readily produced in useful quantities by somatic stem cells.
- the sample according to the present disclosure may be a tissue sample or a cell sample which may comprise a mixed population of cells.
- the sample comprises a mixed population of cells comprising cardiomyocytes.
- the mixed population of cells comprises cells which are capable of being differentiated down the cardiac lineage.
- the mixed population of cells may first be cultured under appropriate conditions and with appropriate factors, to facilitate differentiation of the mixed population of cells down the cardiac lineage.
- the differentiated cells may then be selected according to the methods of the present disclosure described herein.
- the pluripotent embryonic stem cells may first be propagated continuously in culture using culture conditions that promote proliferation without promoting differentiation.
- Exemplary mediums are described in, for example, WO 98/30679 and WO 99/20741.
- ES cells are cultured on a layer of feeder free cells, typically fibroblasts derived from embryonic or fetal tissue.
- feeder free cells typically fibroblasts derived from embryonic or fetal tissue.
- ES cells are irradiated to inhibit proliferation but permit synthesis of factors that support ES cells.
- ES cells can also be propagated in an environment essentially free of feeder cells (see for example WO 01/51616).
- Cells can be cultured on an extracellular matrix of Matrigel ® or laminin, in medium contained by feeder cells or medium supplemented with growth factors such as FGF and SCF.
- Feeder-free cultures are supported by a nutrient medium typically conditioned by culturing irradiated primary mouse embryonic fibroblasts, telomerised mouse fibroblasts, or fibroblast-like cells derived from hES cells. Following this initial propagation, the pluripotent/embryonic stem cells may then be induced to undergo differentiation down the cardiac lineage prior to selection. Cardiomvocvte cells
- the cranio-lateral part of the visceral mesoderm becomes committed to the cardiogenic lineage.
- Several heart associated transcription factors such as Nkx2.5, Handl , 2, Srf, Tbx5, Gata4, 5,6 and Mef2c, become expressed in the cardiogenic region.
- the first possible overt sign restriction of gastrulating mesodermal cells to the cardiogenic lineage is the expression of the basic helix-loop— helix transcription factor Mespl Cardiogenic mesoderm expressing Mespl is pluripotent and contains the precursors for the endocardial/endothelial, the epicardial and myocardial lineages.
- the cardiomyocytes of the primary heart tube are characterised by low abundance of sarcomeric and sarcoplamatic reticular transcripts.
- Mysoin light chain (Mlc) 2v is expressed in a part of the tube that gives rise not only to ventricular chamber myocardium, but also to parts of the atrial chambers and to the atroventricular node, a and ⁇ -myosin heavy chain (Mhc), Mica, 1v and 2a are initially expressed in the entire heart-tube in gradients, and are later restricted to their compartments.
- the chamber myocardium of the developing atria and ventricles are distinguished from the primary myocardium of the linear heart tube.
- the chamber myocardium becomes trabeculated, whereas the primary myocardium is smooth and covered with cardiac cushions.
- Markers that in mammals identify the developing chamber myocardium include the atrial natriuretic factor (Anf) and Cx40 genes, which are not expressed in the myocardium of the primary heart tube.
- the smooth-walled dorsal atrial wall comprising the pulmonary and caval myocardium
- the atrial septa are incorporated into the atria. These components do not express Anf, but do express Cx40.
- a gene that is clearly upregulated in the cardiac chambers is sarco-endoplasmic reticulum Ca2+ ATPase (Serca2a), but because it is also expressed in the primary myocardium it is less suited as a marker for the developing chambers.
- the functional significance of the chamber program of gene expression is that it allows fast, synchronous contractions.
- Phenotypes that arise during development of the mammalian heart can be distinguished: primary cardiomyocytes; nodal cardiomyocytes; conducting cardiomyocytes and working cardiomyocytes. All cardiomyocytes have sarcomeres and a sarcoplasmic reticulum (SR), are coupled by gap junctions, and display automaticity. Cells of the primary heart tube are characterized by high automaticity, low conduction velocity, low contractility, and low SR activity. This phenotype largely persists in nodal cells. In contrast, atrial and ventricular working myocardial cells display virtually no automaticity, are well coupled intercellularly, have well developed sarcomeres, and have a high SR activity.
- SR sarcoplasmic reticulum
- Cardiomyocytes and cardiac progenitor cells derived from pluripotent/embryonic stem cells often have morphological characteristics of cardiomyocytes from other sources. They can be spindle, round, triangular or multi-angular shaped and they may show striations characteristic of sarcomeric structures detectable by immunostaining. They may form flattened sheets of cells, or aggregates that stay attached to the substrate or float in suspension, showing typical sarcomeres and atrial granules when examined by electron microscopy.
- the pluripotent/embryonic stem cell derived cardiomyocytes and their progenitors typically have at least one of the following cardiomyocyte specific markers:
- Cardiac troponin I (cTnl ), a subunit of troponin complex that provides a calcium- sensitive molecular switch for the regulation of striated muscle contraction;
- Nkx2.5 a cardiac transcription factor expressed in cardiac mesoderm during early mouse embryonic development, which persists in the developing heart.
- the cells will also typically express at least one (and often at least 3, 5, or more) of the following markers:
- Atrial natriuretic factor a hormone expressed in developing heart and fetal cardiomyocytes but down-regulated in adults. It is considered a good marker for cardiomyocytes because it is expressed in a highly specific manner in cardiac cells but not skeletal myocytes;
- myosin heavy chain particularly the ⁇ chain which is cardiac specific
- GATA-4 a transcription factor that is highly expressed in cardiac mesoderm and persists in the developing heart. It regulates many cardiac genes and plays a role in cardiogenesis;
- MEF-2A, MEF-2B, MEF-2C, MEF-2D transcription factors that are expressed in cardiac mesoderm and persist in developing heart;
- N-cadherin which mediates adhesion among cardiac cells
- Connexin 43 which forms the gap junction between cardiomyocytes
- ⁇ -adrenoceptor ⁇ -AR
- CK-MB creatine kinase MB
- myoglobin which are elevated in serum following myocardial infarction
- a-cardiac actin a-cardiac actin, early growth response-l, and cyclin D2.
- Tissue-specific markers can be detected using any suitable immunological technique—such as flow immunocytometry or affinity adsorption for cell-surface markers, immunocytochemistry (for example, of fixed cells or tissue sections) for intracellular or cell- surface markers, Western blot analysis of cellular extracts, and enzyme-linked immunoassay, for cellular extracts or products secreted into the medium.
- immunological technique such as flow immunocytometry or affinity adsorption for cell-surface markers, immunocytochemistry (for example, of fixed cells or tissue sections) for intracellular or cell- surface markers, Western blot analysis of cellular extracts, and enzyme-linked immunoassay, for cellular extracts or products secreted into the medium.
- Antibodies that distinguish cardiac markers like cTnl and cTnT from other isoforms are available commercially from suppliers like Sigma and Spectral Diagnostics.
- tissue-specific gene products can be detected at the mRNA levels by Northern blot analysis, dot-blot hybridization analysis, or by reverse transcriptase initiated polymerase chain reaction (RT-PCR) using sequence-specific primers in standard amplification methods using publicly available sequence data (GenBank).
- RT-PCR reverse transcriptase initiated polymerase chain reaction
- Expression of tissue-specific markers as detected at the protein or mRNA level is considered positive if the level is at least 2- fold, and preferably more than 10- or 50-fold above that of a suitable control.
- the pluripotent/embryonic stem cell derived cardiomyocytes typically demonstrate spontaneous periodic contractile activity. This means that when they are cultured in a suitable tissue culture environment with an appropriate Ca ++ concentration and electrolyte balance, the cells can be observed to contract across one axis of the cell, and then release from contraction, without having to add any additional components to the culture medium.
- the contractile activity of the cells can be characterized according to the influence of culture conditions on the nature and frequency of contractions. Compounds that reduce available Ca ++ concentration or otherwise interfere with transmembrane transport of Ca ++ often affect contractile activity. Characterisation of functional properties of the cell can involve characterizing channels for Na + , K + , and Ca ++ .
- Electrophysiology can be studied by patch clamp analysis for cardiomyocyte like action potentials (see Igelmund et al., Pflugers Arch. 437:669, 1999; Wobus et al. , Ann. N.Y. Acad. Sci. 27:752, 1995; and Doevendans et al. , J. Mol. Cell Cardiol. 32:839, 2000).
- Cardiomyocyte lineage cells can be obtained from undifferentiated pluripotent/embryonic stem cells by culturing or differentiating in a special growth environment that enriches for cells (typically by outgrowth of the desired cells) with the desired phenotype.
- EB embryoid bodies
- aggregates can be generated for example by forming spin embryoid bodies (Ng et al., Nat. Protoc. 3(5):768, 2008; Ng et al. , Blood 106(5): 1601 , 2005).
- the pluripotent/embryonic stem cells are harvested by brief collagenase digestion, dissociated into clusters and plated into nonadherent cell culture plates (see for example, WO 01/51616).
- the EBs can be produced encapsulated in alginate or other suitable nutrient-permeable matrix, which may help to improve the uniformity of EB diameter and consistency of the cells produced.
- a medium that contains serum or serum equivalent promotes foci of contracting cells of the cardiomyocyte lineage: for example, approx 20% fetal bovine serum, or a serum supplement such as B27 or N2 in a suitable growth medium such as RPM I.
- the cells can be cultured with factors and factor combinations that enhance proliferation or survival of cardiomyocyte type cells, or inhibit the growth of other cell types.
- the effect may be due to a direct effect on the cell itself, or due to an effect on another cell type, which in turn enhances cardiomyocyte formation.
- Factors thought to facilitate differentiation of pluripotent/embryonic stem cells towards the cardiomyocyte lineages include:
- Transforming growth factor beta related ligands (exemplified by TGF- ⁇ , TGF- 2, TGF- ⁇ 3 and other members of the TGF- ⁇ superfamily;
- ACTIVIN A and ACTIVIN B members of the TGF- ⁇ superfamily
- Insulin-like growth factors such as IGF I and IGF II );
- Bone morphogenic proteins members of the TGF- ⁇ superfamily, exemplified by BMP-2 and BMP-4;
- Fibroblast growth factors (exemplified by bFGF, FGF-4, and FGF-8), other ligands that activate cytosolic kinase raf-1 and mitogen activated protein kinase (MAPK), and mitogens such as epidermal growth factor (EGF);
- Nucleotide analogs that affect DNA methylation and altering expression of cardiomyocyte-related genes eg 5-aza-deoxy-cytidine
- the cells can be co-cultured with cells (such as endothelial cells e.g. END2 cells) that secrete factors enhancing cardiomyocte differentiation.
- cells such as endothelial cells e.g. END2 cells
- Particularly effective combination of cardiotropic agents include use of a morphogen like Activin A and a plurality of growth factors, such as those included in the TGF- ⁇ and IGF families during the early commitment stage, optionally supplemented with additional cardiotropins such as one or more fibroblast growth factors, cone morphogenic proteins, and platelet derived growth factors.
- the pluripotent/embryonic stem cells are harvested from the culture in which they are expanded and plated onto a substrate or matrix that is adherent for undifferentiated hES cells, and is compatible with cardiomyocyte differentiation. Exemplary are 0.5% gelatine, 20 ⁇ 9/ ⁇ fibronectin or Matrigel ® . If desired, the pluripotent/embryonic stem cells can be established onto the substrate before initiating differentiation. The differentiation process is initiated by culturing the plated cells in a medium that contains factors referred to elsewhere in this disclosure that promote cardiomyocyte differentiation.
- BSA bovine serum albumin
- Cardiomyocytes may also be prepared by differentiating cardiosphere-derived cells
- the cardiomyocytes are enriched from a sample.
- the sample may be a tissue sample.
- the method of enriching for cardiomyocytes might also include the harvesting of source of cells prior to selection using known techniques.
- the tissue will be surgically removed.
- Cells comprising the source tissue will then be separated into a so called single cells suspension. This separation may be achieved by physical and or enzymatic means.
- the sample is a cell sample.
- sample comprises a mixed population of cells.
- mixed population of cells it is meant that the cells may be comprised of cell types that are differentiating, have differentiated or are capable of being differentiated down the cardiac lineage.
- the mixed population of cells is a population of cells comprising cardiomyocytes.
- the term “medium” as used in reference to cell culture includes the components of the environment surrounding the cells. Media may be solid, liquid, gaseous or a mixture of phases ad materials.
- Media include liquid growth media as well as liquid media that do not sustain cell growth.
- Media also include gelatinous media such as agar, agarose, gelatin and collagen matrices.
- Exemplary gaseous media include the gaseous phase that cells growing on a petri dish or other solid or semisolid support are exposed to.
- the term “medium” also refers to material that is intended for use in a cell culture, even if it has not yet been contacted with cells.
- the sample may be a cell line such as a stem cell line described herein.
- enriched enrichment or variations thereof are used herein to describe a population of cells in which the proportion, or percentage of cells of one particular cell type or the proportion or percentage of a number of particular cell types is increased when compared with an untreated population of the cells (e.g. cells in their native environment).
- the term "enriched” is taken to mean that the proportion or percentage of cardiomyocytes is greater than the proportion or percentage of cardiomyocytes in the population of cells from which it was originally contained. In another example, the term “enriched” is taken to mean that the proportion or percentage of VCAM 1 + , or SIRPa + or VCAM 1 + /SIRPa + double positive cells is greater than the proportion or percentage of VCAM 1 + , or SIRPa + or VCAM1 + /SI RPa + double positive cells in the population of cells from which it was originally contained.
- a population of cells enriched for cardiomyocytes is made up of at least about 60% of said cells or at least about 65% of said cells, or at least about 70% of said cells, or at least about 75% of said cells or at least about 80% of said cells, or at least about 85% of said cells, or at least about 87% of said cells, or at least about 90% of said cells, or at least about 95% of said cells, or at least about 96% of said cells, or at least about 97% of said cells, or at least about 97% of said cells, or at least about 98% of said cells, or at least about 99% of said cells, or 100% of said cells.
- population of cells enriched for cardiomyocytes will be taken to provide explicit support for the term “population of cells comprising X% cardiomyocytes, wherein X is a percentage as recited herein.
- the population of cells is enriched from a mixed population of cells comprising cardiomyocytes in a selectable form.
- selectable form will be understood to mean that the cells express a marker (e.g. a cell surface marker) permitting selection of the cardiomyocytes.
- the cells are selected by expression of cell surface markers VCAM 1 and/or SIRPa.
- Reference to selection of a cell or population thereof does not require selection from a specific tissue source, provided that the tissue comprises cells expressing cell surface markers VCAM 1 and/or SIRPa.
- separation of cells carrying any given cell surface marker can be effected by a number of different methods, however, some methods rely upon binding a binding agent (e.g. , an antibody or antigen binding fragment thereof) to the marker concerned followed by a separation of those that exhibit binding, being either high level binding, or low level binding or no binding.
- a binding agent e.g. , an antibody or antigen binding fragment thereof
- the most convenient binding agents are antibodies or antibody-based molecules, such as monoclonal antibodies or based on monoclonal antibodies because of the specificity of these latter agents.
- Antibodies can be used for both steps, however other agents might also be used, thus ligands for these markers may also be employed to enrich for cells carrying them, or lacking them.
- the sample may be optionally enriched using crude techniques such as drug selection, panning, density gradient centrifugation etc.
- the particular technique employed will depend upon efficiency of separation, associated cytotoxicity, ease and speed of performance, and necessity for sophisticated equipment and/or technical skill.
- a negative selection is performed, where the selection is based on expression of one or more markers found on ES cells, fibroblasts, epithelial cells and the like. Selection may utilise panning methods, magnetic particle selection, particle cell sorter selection, and the like.
- Antibodies or ligands may be attached to a solid support to allow for crude separation.
- the separation techniques maximize the retention of viability of the fraction to be collected.
- Techniques providing accurate separation include but are not limited to flow cytometry, including magnetic activated cell sorting (MACS) or fluorescence activated cell sorting (FACS).
- flow cytometry including magnetic activated cell sorting (MACS) or fluorescence activated cell sorting (FACS).
- MCS magnetic activated cell sorting
- FACS fluorescence activated cell sorting
- the sorting utilizes FACS. Methods for performing cell sorting will be apparent to the skilled artisan.
- Antibodies against each of the markers described herein are commercially available (see later), available from ATCC or other depositary organization and/or can be produced using art recognized techniques.
- the disclosure can be practised using cells from a human or any non-human animal species, including but not limited to non-human primate cells, ungulate, canine, feline, lagomorph, rodent, avian and fish cells.
- Primate cells with which the disclosure may be performed include but are not limited to cells of chimpanzees, baboons, cynomogus monkeys, and any other New or Old World monkeys.
- the purified cardiomyocyte cells of the present disclosure have a variety of uses in clinical therapy, research, development, and commercial purposes.
- the cells can be used to prepare a cDNA library.
- mRNA can be prepared from the cells using standard techniques (e.g. Sambrook et al., A Laboratory Manuel Harbor Laboratory Press 2001 ; Ausubel et al. , Short Protocols in Molecular Biology eds. , John Wiley & Sons 1999) and reverse transcribed to produce cDNA.
- the preparation can then be subtracted with cDNA from undifferentiated ES cells, other progenitor cells, or end- stage cells from the cardiomyocyte or any other developmental pathway.
- the cells of the present disclosure can also be used to generate antibodies that may be specific for additional markers of cardiomyocytes not yet recognised.
- Polyclonal antibodies can be prepared by injecting vertebrate animal with cells of the present disclosure in an immunogenic form. Production of monoclonal antibodies is described in standard references and US 4, 491 ,632; US 4,472,500 and 4,444,887. Specific antibody molecules can also be produced by contacting a library of immunocompetent cells or viral particles with the target antigen, and growing out positively selected clones. The antibodies in turn can be used to identify or rescue cells of a desired phenotype from a mixed cell population.
- the cells of present invention are also of interest in identifying expression patterns of transcripts and newly synthesised proteins that are characteristic for cardiomyocytes.
- the expression patterns can be compared with control cell lines, such as undifferentiated pi uri potent/embryonic stem cells.
- a microarray can be used to analyse gene expression (see Fritz et al., Science 288: 316, 2000; www.Gene-Chips.com).
- An exemplary method is conducted using a Genetic Microsystems array generator, and an AxonGenepixTM Scanner.
- Microarrays are prepared by first amplifying cDNA fragments encoding marker sequences to be analysed, and spotted directly onto glass slides. To compare mRNA preparations from two cells of interest, one preparation is converted into Cy5-labeled cDA, while the other is converted into Cy3-labeled cDNA. The two cDNA preparations are hybridised simultaneously to the microarray slide, and then washed to eliminate non-specific binding. The slide is then scanned at wavelengths appropriate for each of the labels, the resulting fluorescence is quantified, and the results are formatted to give an indication of the relative abundance of mRNA for each marker on the array.
- mRNA expression levels can in a sample can be determined by generation of a library of expressed sequence tags (ESTs) from a sample. Enumeration of the relative representation of ESTs within the library can be used to approximate the relative representation of a gene transcript within the starting sample. The results of EST analysis of the test sample of a test sample can then be compared to EST analysis of a reference sample to determine the relative expression levels of a selected polynucleotide, particularly a polynucleotide corresponding to one or more of the differentially expressed genes described herein.
- ESTs expressed sequence tags
- gene expression in a test sample can be performed using serial analysis of gene expression (SAGE) methodology (Velculescu et al. , Science (1995) 270:484).
- SAGE serial analysis of gene expression
- SAGE involves the isolation of short unique sequence tags from a specific location within each transcript. The sequence tags are concatenated, cloned, and sequenced. The frequency of particular transcripts within the starting sample is reflected by the number of times the associated sequence tag is encountered with the sequence population.
- Gene expression in a test sample can also be analysed using differential display (DD) methodology.
- DD fragments defined by specific sequence delimiters (e.g. , restriction enzyme sites) are used as unique identifiers of genes, coupled with information about fragment length or fragment location within the expressed gene.
- the relative representation of an expressed gene with a sample can then be estimated based on the relative representation of the fragment associated with that gene within the pool of all possible fragments.
- Methods and compositions for carrying out DD are well known in the art, see, e.g. , U.S. 5,776,683; and U.S. 5,807,680.
- gene expression in a sample can be performed using hybridization analysis, which is based on the specificity of nucleotide interactions. Oligonucleotides or cDNA can be used to selectively identify or capture DNA or RNA of specific sequence composition, and the amount of RNA or cDNA hybridized to a known capture sequence determined qualitatively or quantitatively, to provide information about the relative representation of a particular message within the pool of cellular messages in a sample.
- Hybridization analysis can be designed to allow for concurrent screening of the relative expression of hundreds to thousands of genes by using, for example, array-based technologies having high density formats, including filters, microscope slides, or microchips, or solution-based technologies that use spectroscopic analysis (e.g. , mass spectrometry).
- Hybridization to arrays may be performed, where the arrays can be produced according to any suitable methods known in the art. For example, methods of producing large arrays of oligonucleotides are described in U.S. 5, 134,854, and U.S. 5,445,934 using light-directed synthesis techniques. Using a computer controlled system, a heterogeneous array of monomers is converted, through simultaneous coupling at a number of reaction sites, into a heterogeneous array of polymers. Alternatively, microarrays are generated by deposition of pre-synthesized oligonucleotides onto a solid substrate, for example as described in PCT WO 95/35505.
- the test sample is assayed for the level of polypeptide of interest. Diagnosis can be accomplished using any of a number of methods to determine the absence or presence or altered amounts of a differentially expressed polypeptide in the test sample. For example, detection can utilize staining of cells or histological sections (e.g. , from a biopsy sample) with labelled antibodies, performed in accordance with conventional methods. Cells can be permeabilised to stain cytoplasmic molecules. In general, antibodies that bind a differentially expressed polypeptide of the present disclosure are added to a sample, and incubated for a period of time sufficient to allow binding to the epitope, usually at least about 10 minutes. The antibody can be detectably labelled for direct detection (e.g.
- a second stage antibody or reagent to detect binding e.g., biotin with horseradish peroxidase- conjugated avidin, a secondary antibody conjugated to a fluorescent compound, e.g. fluorescein, rhodamine, Texas red, etc.
- the absence or presence of antibody binding can be determined by various methods, including flow cytometry of dissociated cells, microscopy, radiography, scintillation counting, etc. Any suitable alternative methods can of qualitative or quantitative detection of levels or amounts of differentially expressed polypeptide can be used, for example ELISA, western blot, immunoprecipitation, radioimmunoassay, etc.
- the cells of the present disclosure are also useful for in vitro assays and screening to detect factors that are active on cells of the cardiomyocyte lineage.
- screening assays for agents that are active on human cells are also useful.
- a wide variety of assays may be used for this purpose, including immunoassays for protein binding; determination of cell growth, differentiation and functional activity; production of factors; and the like.
- the cells of the present disclosure may be genetically modified, e.g., to express and/or secrete a protein of interest, e.g. , a protein providing a therapeutic and/or prophylactic benefit in heart disease.
- Cells may also be genetically modified to enhance survival, control proliferation and the like.
- the cells of the present disclosure can also be genetically altered in order to enhance their ability to be involved in tissue regeneration.
- cardiotropic factors such as atrial natriuretic factor, cripto and cardiac transcription regulation factors, such as GATA-4, Nkx2.5 and MEF2-C.
- a nucleic acid that is to be expressed in a cell is operably-linked to a promoter for inducing expression in the cell.
- the nucleic acid is linked to a promoter operable in a variety of cells of a subject, such as, for example, a viral promoter, e.g. , a CMV promoter (e.g. , a CMV-IE promoter) or a SV-40 promoter. Additional suitable promoters are known in the art and shall be taken to apply mutatis mutandis to the present example of the disclosure.
- the nucleic acid is provided in the form of an expression construct.
- expression construct refers to a nucleic acid that has the ability to confer expression on a nucleic acid (e.g. a reporter gene and/or a counter-selectable reporter gene) to which it is operably connected, in a cell.
- a nucleic acid e.g. a reporter gene and/or a counter-selectable reporter gene
- an expression construct may comprise or be a plasmid, bacteriophage, phagemid, cosmid, virus sub-genomic or genomic fragment, or other nucleic acid capable of maintaining and/or replicating heterologous DNA in an expressible format.
- Vectors suitable for such an expression construct are known in the art and/or described herein. The skilled artisan will be aware of additional vectors and sources of such vectors, such as, for example, Life Technologies Corporation, Clontech or Promega.
- the binding agents according to the present disclosure may be non-antibody based binding agents or antibodies or proteins containing an antibody variable region.
- Typical non-antibody based binding agents include peptides, peptidomimetics, nucleic acid aptamers, peptide aptamers, dendrimers and small organic molecules.
- a nucleic acid aptamer is a nucleic acid molecule that is capable of forming a secondary and/or tertiary structure that provides the ability to bind to a molecular target.
- An aptamer library is produced, for example, by cloning random oligonucleotides into a vector (or an expression vector in the case of an RNA aptamer), wherein the random sequence is flanked by known sequences that provide the site of binding for PCR primers.
- An aptamer with increased activity is selected, for example, using SELEX (Sytematic Evolution of Ligands by Exponential enrichment). Suitable methods for producing and/or screening an aptamer library are described, for example, in Elloington and Szostak, Nature 346:818-22, 1990.
- informatics is used to select suitable chemical building blocks from known compounds, for producing a combinatorial library.
- QSAR Quantitative Structure Activity Relationship
- the software of the Chemical Computing Group, Inc. uses high-throughput screening experimental data on active as well as inactive compounds, to create a probabilistic QSAR model, which is subsequently used to select lead compounds.
- the Binary QSAR method is based upon three characteristic properties of compounds that form a "descriptor" of the likelihood that a particular compound will or will not perform a required function: partial charge, molar refractivity (bonding interactions), and logP (lipophilicity of molecule). Each atom has a surface area in the molecule and it has these three properties associated with it. All atoms of a compound having a partial charge in a certain range are determined and the surface areas (Van der Walls Surface Area descriptor) are summed.
- the binary QSAR models are then used to make activity models or ADMET models, which are used to build a combinatorial library. Accordingly, lead compounds identified in initial screens can be used to expand the list of compounds being screened to thereby identify highly active compounds.
- binding agents are antibodies or antigen binding fragments thereof or proteins comprising an antibody variable region.
- antibody refers to an immunoglobulin molecule capable of binding to a target, such as VCAM 1 or SI RPa and/or an epitope thereof and/or an immunogenic fragment thereof and/or a modified form thereof (e.g. , glycosylated) through at least one epitope recognition site, located in the variable region of the immunoglobulin molecule.
- This term encompasses not only intact polyclonal or monoclonal antibodies, but also variants, fusion proteins comprising an antibody portion with an epitope recognition site of the required specificity, humanized antibodies, human antibodies, chimeric antibodies, and any other modified configuration of the immunoglobulin molecule that comprises an epitope recognition site of the required specificity.
- antigen binding fragment or "protein comprising an antibody variable region” shall be taken to mean any fragment of an antibody that retains the ability to bind to a target, such as VCAM 1 or SI RPa.
- Such fragments typically include Fab, Fab', (Fab') 2 , Fv, single chain antibody (e.g. scFv), single domain antibody (e.g. dAb).
- Methods of making these fragments are known in the art. See for example, Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbour Laboratory, New York (1988), incorporated herein by reference.
- the term “monoclonal antibody” refers to a homogeneous antibody population capable of binding to the same antigen(s) and, preferably, to the same epitopic determinant within the antigen(s). This term is not intended to be limited as regards to the source of the antibody or the manner in which it is made.
- chimeric antibody refers to antibodies in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species (e.g., murine, such as mouse) or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species (e.g. , primate, such as human) or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity (U.S. Patent No. 4, 816, 567; and Morrison et al. (1984) Proc. Natl Acad. Sci USA 87:6851-6855).
- a particular species e.g., murine, such as mouse
- primate such as human
- humanized antibody shall be understood to refer to a chimeric molecule, generally prepared using recombinant techniques, having an epitope binding site derived from an immunoglobulin from a non-human species and the remaining immunoglobulin structure of the molecule based upon the structure and/or sequence of a human immunoglobulin.
- the antigen- binding site preferably comprises the complementarity determining regions (CDRs) from the non-human antibody grafted onto appropriate framework regions in the variable domains of human antibodies and the remaining regions from a human antibody.
- CDRs complementarity determining regions
- Epitope binding sites may be wild type or modified by one or more amino acid substitutions.
- variable regions of both heavy and light chains contain three complementarity- determining regions (CDRs) which vary in response to the epitopes in question and determine binding capability, flanked by four framework regions (FRs) which are relatively conserved in a given species and which putatively provide a scaffolding for the CDRs.
- CDRs complementarity- determining regions
- FRs framework regions
- the variable regions can be "reshaped” or “humanized” by grafting CDRs derived from nonhuman antibody on the FRs present in the human antibody to be modified.
- anti-VCAM 1 Vascular Cell Adhesion Protein-1
- Vascular cell adhesion protein 1 also known as vascular cell adhesion molecule-1
- VCAM1 is a protein that in humans is encoded by the VCAM1 gene.
- the protein mediates the adhesion of lymphocytes, monocytes, eosinophils and basophils to vascular endothelium. It also functions in leukocyte-endothelial cell signal transduction, and it may play a role in the development of atherosclerosis and rheumatoid arthritis.
- the protein is an endothelial ligand for VLA-4 of the ⁇ 1 subfamily of integrins, and for integrin ⁇ 4 ⁇ 7.
- VCAM1 as used herein is understood to include its aliases, including the following, vascular cell adhesion protein-1 , vascular cell adhesion molecule-1 , CD106, INCAM- 100, MGC9956, DKFZp779G2333, OTTHUMP00000012652, V-CAM, and L1 CAM. The term also includes other aliases by which VCAM1 is known which are not listed above.
- VCAM 1 Commercial antibodies to VCAM 1 are available from companies such as Covance,
- antibodies for use in the present invention are those that bind to human VCAM-1.
- antibodies are those from Abeam for use in flow cytometry such as ab7224, ab7219, ab95139, ab47159, ab82438, ab24628, ab27352, and ab33228.
- anti-SIRP alpha antibodies are those from Abeam for use in flow cytometry such as ab7224, ab7219, ab95139, ab47159, ab82438, ab24628, ab27352, and ab33228.
- SIRP alpha Signal regulatory protein alpha, (SIRP alpha, designated CD172a, or SIRPA), is a transmembrane glycoprotein belonging to the signal-regulatory-protein (SIRP) family within the immunoglobulin superfamily.
- SIRPa contains cytoplasmic ITI M domains and produces negative regulatory signals.
- CD47/IAP integrated protein
- SIRPa inhibits clearance of CD47 hl young erythrocyte and platelets and promotes macrophage fusion during osteoclastogenesis.
- SIRPa recognition of surfactants SP-A and SP-D in the lung can inhibit alveolar macrophage cytokine production.
- SIRPa as used herein is understood to include its aliases, including the following SIRPa 1 , SHPS, macrophage fusion receptor (MFR), SIRP, BIT, P84, MYD-1 , SHPS- 1 , MyD-1 antigen, inhibitory receptor SHPS-1 , PTPNS, CD172 antigen-like family member A (CD172a), and protein tyrosine phosphatase non-receptor type substrate 1.
- SIRPa also includes other aliases by which SIRPa is known which are not listed above.
- antibodies to SIRPa are available from companies such as Abeam, BioLegend, Abnova Corporation, R & D Systems, BD Biosciences, Cell Sciences, GeneTex, GenWay Biotech, I nc, Santa Cruz Biotechnology, Inc, and Sigma-Aldrich.
- antibodies for use in the present invention are those that bind to human SIRPa.
- antibodies are those from BioLegend for use in flow cytometry such as clone SE5A5, or clone 148.
- the cardiomyocytes according to the present disclosure can be used to screen for factors (e.g. solvents, small molecule drugs, peptides, oligonucleotides) or environmental conditions (e.g. cell culture) that affect the characteristics of the cells.
- factors e.g. solvents, small molecule drugs, peptides, oligonucleotides
- environmental conditions e.g. cell culture
- One application of the disclosure herein relates to the testing of pharmaceutical compounds for their effect on cardiac muscle tissue maintenance or repair. Screening may be done either because the compound is designed to have a pharmacological effect on the cell, or because a compound designed to have effects elsewhere may have unintended side effects on cardiomyocytes.
- the screening is preferably done using the enriched VACM-1 + / SI RPa + double positive cells of the present disclosure.
- Assessment of the activity of a candidate pharmaceutical compound generally involves combining the cells of the present disclosure with the candidate compound, either alone or in combination with other drugs. A determination is then made of any change in the morphology, marker phenotype or functional activity of the cells that is attributable to the compound
- Cytotoxicity can be determined by the effect on cell viability, survival, morphology and the expression of certain markers and receptors. Effects of a compound on chromosomal DNA can be determined by measuring DNA synthesis or repair. An example includes measuring BrdU incorporation. Unwanted effects can also include unusual rates of sister chromatid exchange, determined by metaphase spread.
- Effect on cell function can be assessed using any standard assay to observe phenotype or activity of cardiomyocytes, such as marker expression, receptor binding, contractile activity or electrophysiology. Where an effects is observed, the concentration of the compound can be titrated to determine the median effective dose (ED 50 ).
- Agents of interest for screening include known and unknown compounds that encompass numerous chemical classes, primarily organic molecules, which may include organometallic molecules, inorganic molecules, genetic sequences etc.
- Candidate agents are also found biomolecules, including peptides, polynucleotides, sacchardies, fatty acids, steroids, purine, pyrimidines, derivatives, structural analogs or combinations thereof.
- pharmacologically active drugs include chemotherapeutic agents, hormones or hormone antagonists, etc.
- chemotherapeutic agents include chemotherapeutic agents, hormones or hormone antagonists, etc.
- Exemplary of pharmaceutical agents suitable for this invention are those described in, "The Pharmacological Basis of Therapeutics,” Goodman and Gilman, McGraw-Hill, New York, New York, (1996), Ninth edition, under the sections: Water, Salts and Ions; Drugs Affecting Renal Function and Electrolyte Metabolism; Drugs Affecting Gastrointestinal Function; Chemotherapy of Microbial Diseases; Chemotherapy of Neoplastic Diseases; Drugs Acting on Blood-Forming organs; Hormones and Hormone Antagonists; Vitamins, Dermatology; and Toxicology, all incorporated herein by reference. Also included are toxins, and biological and chemical warfare agents, for example see Somani, S. M. (Ed. ), “Chemical Warfare Agents,” Academic Press, New York
- Test compounds include all of the classes of molecules described above, and may further comprise samples of unknown content. Of interest are complex mixtures of naturally occurring compounds derived from natural sources such as plants.
- iPS cells are generally derived by transfection of certain stem-cell associated genes into non-pluri potent cells such as adult fibroblasts. Transfection is achieved through viral vectors bearing the genes Oct-3/4 and Sox2 and may include others that enhance the efficiency of induction. After 3-4 weeks, transfected cells begin to become morphologically and biochemically similar to pluripotent stem cells, and are usually isolated through morphological selection, doubling time, or through a reporter gene and antibiotic selection. Examples of methods to generate iPS cells can be found in Yu J et al. , Science 318(5850), 1917-1920 (2007) and Takahashi K et al. , Cell 131 (5), 861-872 (2007).
- patient-specific human iPS cells can be produced from a subject suffering from a cardiac disorder such as long QT syndrome.
- Congenital long QT syndrome is a familial arrhythmogenic syndrome characterised by abnormal ion channel function and sudden cardiac death (Goldenberg I et al., J. Am. Coll. Cardiol. 51 , 2291 -2300 (2008)).
- the subject specific iPS cells can then be coaxed to differentiate into the cardiac lineage, for example using embryoid body differentiation.
- the method of the present disclosure can then be applied to enrich for VCAM 1 + , or SIRPa + or VCAM 1 + /SIRPa + expressing cardiomyocytes.
- the functionality of the cells can then be determined by examining one or more of the following: expression of cardiac specific transcription factors (e.g.
- NKX2-5) structural genes (e.g. MYL2, MYH6 and MYH7, KCNH2), chronotropic responses, ion channel function, and electrophysiology (including arrhymogenicity).
- structural genes e.g. MYL2, MYH6 and MYH7, KCNH2
- chronotropic responses e.g. KCNH2
- ion channel function e.g. KCNH2
- electrophysiology including arrhymogenicity
- the present disclosure also provides for the use of the cardiomyocyte cells of the invention to enhance tissue maintenance or repair of cardiac muscle in a human patient or other subject in need of such treatment.
- the cells are first tested in an animal model.
- the cells can be administered to immunodeficient animals. Tissues are harvested after a period of regrowth, and assessed as to whether they are still present.
- the cells can be labelled with a detectable label e.g. green fluorescent protein.
- the presence of the administered cells can be assessed by immunohistochemistry or ELISA.
- Suitability can be determined by assessing the degree of cardiac recuperation that ensures from treatment of the cells of the invention.
- hearts can be cryoinjured by placing a placing a precooled aluminium rod in contact with the surface of the anterior left ventricle wall, or by placing a 30-50mm copper disk probe cooled in liquid nitrogen on the anterior wall of the left ventricle.
- Infarction can be induced by ligating the left main coronary artery.
- I njured sites are treated with cell preparations of this disclosure and the heart tissue examined by histology for the presence of the cells in the damaged area.
- Cardiac function can be monitored by determining such parameters as left ventricular end diastolic pressure, developed pressure, rate of pressure rise, and rate of pressure decay.
- the cardiomyocyte cells of the present disclosure can be used for tissue reconstitution or regeneration in a human subject or other subject by administering in a manner that permits then to graft or migrate to the intended tissue site and reconstitute or regenerate the functionally deficient area.
- Special devices are available that are adapted for administering cells capable of reconstituting cardiac function directly to the chambers of the heart, the pericardium, or the interior of the cardiac muscle at the desired location.
- the cells may be administered to a recipient heart by intracoronary injection, e.g. into the coronary circulation.
- the cells may also be administered by intramuscular injection into the wall of the heart.
- Subjects which are suitable candidates for treatment according to the methods of the present disclosure include those with acute or chronic heart conditions of various kinds, including coronary heart disease, cardiomyopathy, endocarditis, congenital cardiovascular defects and congestive heart failure.
- the enriched cardiomyocyte cells of the present disclosure are administered to a subject suffering from myocardial infarction.
- the injected cells migrate to the infracted myocardium.
- the cardiomyocytes assemble into myocardium tissue resulting in repair or regeneration of the infracted myocardium.
- the enriched cardiomyocyte cells of the present disclosure are administered to a subject suffering from heart failure, wherein the mount is effective in at least partially restoring cardiac function.
- Heart failure can be considered as a progressive disease of apoptotically-mediated cardiomyocyte loss that eventually results in an impaired functional capacity of the cardiac muscle.
- Efficacy of treatment can be monitored by clinically accepted criteria, such as reduction in area occupied by scar tissue or revascularisation of scar tissue, and in the frequency and severity of angina; or an improvement in developed pressure, systolic pressure, end diastolic pressure, Apressure/Atime, patient mobility and quality of life.
- Treatment of subjects with enriched SIRPa + , VCAM 1 + , or VCAM 1 + /SIRPa + cells of the present disclosure according to any of the above described methods may be used in conjunction with other procedures such as surgery.
- the purified cardiomyocyte cells of the present disclosure can be supplied in the form of a pharmaceutical composition, comprising a carrier or excipient.
- a pharmaceutical composition comprising a carrier or excipient.
- excipient or other elements of the composition can be adapted in accordance with the route and device used for administration.
- carrier and “excipient” refer to compositions of matter that are conventionally used in the art to facilitate the storage, administration, and/or the biological activity of an active compound (see, e.g. , Remington's Pharmaceutical Sciences, 16th Ed. , Mac Publishing Company (1980).
- a carrier may also reduce any undesirable side effects of the active compound.
- a suitable carrier is, for example, stable, e.g. , incapable of reacting with other ingredients in the carrier. I n one example, the carrier does not produce significant local or systemic adverse effect in recipients at the dosages and concentrations employed for treatment.
- the carrier or excipient can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (i. e. glycerol, propylene, glycol and liquid polyethylene glycol and the like), suitable mixtures thereof and/or vegetable oils.
- the prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. It may also be preferable to include isotonic agents e.g. sugars or sodium chloride. Stabilising agents can also be added to protect the composition from loss of therapeutic activity. Examples include buffers, amino acids e.g. lysine, carbohydrates such as dextrose, mannose, galactose, fructose, lactose, sucrose, maltose, sorbitol, mannitol etc.
- a carrier is a media composition, e.g. , in which a cell is grown or suspended.
- a media composition does not induce any adverse effects in a subject to whom it is administered.
- Exemplary carriers and excipients do not adversely affect the viability of a cell and/or the ability of a cell to function as a cardiomyocyte.
- the carrier or excipient provides a buffering activity to maintain the cells and/or soluble factors at a suitable pH to thereby exert a biological activity
- the carrier or excipient is phosphate buffered saline (PBS).
- PBS represents an attractive carrier or excipient because it interacts with cells and factors minimally and permits rapid release of the cells and factors, in such a case, the composition of the disclosure may be produced as a liquid for direct application to the blood stream or into a tissue or a region surrounding or adjacent to a tissue, e.g. , by injection.
- composition may also comprises or be accompanied with one or more other ingredients that facilitate the engraftment or functional mobilisation of the cells.
- suitable ingredients include matrix proteins or gel polymer that support or promote adhesion of the cells or complementary cell types, especially endothelial cells.
- scaffolds include, but are not limited to biological, degradable scaffolds.
- Natural biodegradable scaffolds include collagen, fibronectin, and laminin scaffolds.
- Suitable synthetic material for a cell transplantation scaffold should be able to support extensive cell growth and cell function. Such scaffolds may also be resorbable.
- Suitable scaffolds include polyglycolic acid scaffolds, e.g. , as described by Vacanti, ef al. J. Ped. Surg. 23:3-9 1988;
- the cells may be administered in a gel scaffold (such as Gelfoam from Upjohn Company.
- the purified cardiomyocyte cells can be combined with the carrier or excipient in any convenient or practical manner e.g. suspension, emulsification, admixture, encapsulation, absorption and the like.
- compositions described herein may be administered alone or as admixtures with other cells.
- Cells that may be administered in conjunction with the compositions of the present disclosure include, but are not limited to, other multipotent or pluripotent cells or stem cells, or bone marrow cells.
- the cells of different types may be admixed with a composition of the disclosure immediately or shortly prior to administration, or they may be co-cultured together for a period of time prior to administration.
- the exact amount of cells to be administered is dependent upon a variety of factors, including the age, weight, and sex of the patient, and the extent and severity of the condition to be treated.
- Means for reducing or eliminating an immune response to the transplanted cells are known in the art.
- the cells may be genetically modified to reduce their immunogenicity.
- the purified cardiomyocytes may be administered with other beneficial drugs or biological molecules (growth factors, trophic factors).
- beneficial drugs or biological molecules growth factors, trophic factors
- they may be administered together in a single pharmaceutical compositions, or in separate pharmaceutical compositions, simultaneously or sequentially with other agents (either before or after administration of the other agents).
- the present disclosure also provides medical devices for use or when used in a method as described herein according to any example.
- the present disclosure provides a syringe or catheter or other suitable delivery device comprising purified cardiomyocytes or a composition according to the present disclosure.
- the syringe or catheter is packaged with instructions for use in a method as described herein according to any example.
- the purified cardiomyocytes or pharmaceutical compositions disclosed herein may be surgically implanted, injected, delivered (e.g. by way of a catheter or syringe), or otherwise administered directly or indirectly to the site in need of repair or augmentation.
- routes of parenteral administration include intravenous, intra-arterial, intramuscular, intraperitoneal, intramyocardial, transendocardial, transepicardial, intranasal or intrathecal, and infusion techniques.
- Intra-arterial administration includes delivery into an aorta, into an atrium or ventricle of the heart or into a blood vessel. In the case of cell delivery to an atrium or ventricle of the heart, cells can be administered to the left atrium or ventricle to avoid complications that may arise from rapid delivery of cells to the lungs.
- the purified cardiomyocytes or compositions disclosed herein may optionally be packaged in a suitable container with written instructions for a desired purpose, such as the reconstitution of cardiomyocyte cell function to improve some abnormality of the cardiac muscle or for use in screening or diagnostic applications.
- kits comprising a binding agent for VCAM 1 and/or a binding agent for SIPRa.
- the components of the kit may be packaged with in aqueous media or in lyophilised form.
- the kit will typically also contain instructions for use.
- NKX2-5 gene targeting
- the 5' homology arm of the NKX2-5 targeting vector was cloned from BAC RP11 - 466H21 (Roswell Park Cancer Institute; Osoegawa, K et al., Genome Res 11 (3), 483 (2001 )) by recombineering (www.genebridges.com).
- the 3' homology arm was amplified by PCR with oligonucleotides (2-5RarmAsiSls gcgatcgccgcccttctcagtcaaagacatcc & 2-5 RarmAsiSlas gcgatcgcttccacgggcgtgtggcacttaccc) introducing AsiSI restriction sites to facilitate sub-cloning into the targeting vector.
- the final vector comprised a 7.9 kb 5' homology arm, eGFP (Invitrogen), loxP-flanked G418 resistance cassette and a 4.2 kb 3' homology arm.
- the targeting vector was linearized by Pad digestion and electroporated into hESCs as described (Costa M et al. , Nat Protoc. 2(4), 792 (2007)).
- Targeted clones were identified using a 3' homology arm PCR screening strategy utilizing the primers Neo4 (cgatgcctgcttgccgaatatcatg - p1 ) and NKX2-5 RarmRev (cttgtatcctactgtgtccagtgg - p2), a primer complementary to genomic sequences immediately 3' of the targeting vector (Fig. 2).
- GFPrev gtcgccgtccagctcgaccaggatg-p4
- NKX2-5 LarmFwd gacactggtgcatcctgttagagg - p5
- HES3 Reubinoff, BE et al. , Nay Biotechnol 18(4), 399 (2000)
- MEL 1 Millipore
- NKX2-5 GFPM clones contained a single integration event, expressed markers of undifferentiated hESCs, were karyotypically normal and formed teratomas following injection of undifferentiated cells in testes of immunodeficient mice (Fig. 2).
- Karyotyping was performed by Southern Cross Pathology Australia located at the Monash Medical Centre and a total of 20 metaphase chromosome spreads was examined for each line. Animal experimentation was performed under the auspices and approval of the Monash University School of Biomedical Sciences animal ethics committee (approval number SOBSAI MIS/2009/107) or the Walter and Eliza Hall Institutes animal ethics committee (approval number 2009.015).
- hESC /V X2-5 GFP/,V cells were cultured on 75 cm 2 tissue culture flasks (Falcon, BD Biosciences) and passaged using TrypLE Select (Invitrogen Corporation) as described (Costa et al. , supra). One day before differentiation, cells were passaged onto a new flask seeded with irradiated MEFs at low density (1 x 10 4 cm “2 ). Forced aggregation of hESC to form spin embryoid bodies (EBs) was performed as previously described (Ng et al. , Nat Protoc. 3(5), 768 (2008); Ng et al. , Blood 106(5), 1601 (2005)).
- EBs spin embryoid bodies
- NKX2-i FP w cells were differentiated in FGF2 (Protech) at 100 ng ml "1 from dO to d7.
- FGF2 prevents mesoderm formation (Davis RP et al., Blood 1 11 (4), 1876 (2008)) and promotes neuroectoderm differentiation (Goulburn AL et al Stem Cells 29(3), 462 (201 1 )).
- hESC-CPCs and hESC-CMs were also derived using the END2 co-culture system, as previously described (Mummery C et al. , Circulation 107(21 ), 2733 (2003); Passier R et al. , Stem Cells 23 (6), 772 (2005)).
- hESCs For monolayer differentiation, 5 to 10 x 10 4 NKX2-5 GFP/W hESC cells were plated per well of a Matrigel (BO Biosciences; Growth Factor Reduced, Phenol Red Free) coated 6 well tissue culture plate in 3 ml hESC media. After 24 hours the media was changed to LI-APEL with the same cytokine cocktail described above, this time point was designated as dO. At d3 of differentiation the media was changed to LI-APEL and differentiation was allowed to proceed without further addition of exogenous cytokines. Comparable results were obtained with hESCs passaged on MEF feeder layers (Fig 4c, e-f) or in feeder-free Matrigel cultures in mTeSRI (Stem Cell Technologies) media.
- MEF feeder layers Fig 4c, e-f
- mTeSRI StemTeSRI
- Single cell cloning was performed using the single cell deposition function of a FACSAria or a BD Influx cell sorter (Monash Flowcore). Briefly, GFP + cells from dissociated d7 EBs were deposited at 1 , 3, 10 or 30 cells per well of a 96 well plate. After 7 days in culture in LI-APEL wells were scored for colonies with greater than 8 cells. Data shown are the results of three independent experiments performed in duplicate. Cells were fixed and stained as described below (immunohistochemistry). To examine the differentiation capacity of NKX2-5 GFP * cells, individual GFP + cells from d6 EBs (the earliest time point for GFP expression) were deposited in individual wells of 96 well plates.
- EBs, grown on coverslips, and single cell clones were fixed in 4% paraformaldehyde (PFA) and permeablised with 0.1 % Triton-X 100 in phosphate buffered saline (PBS) and blocked with 1 % normal goat serum in PBS.
- PFA paraformaldehyde
- PBS phosphate buffered saline
- Fluorescence images were captured on a Zeiss Axiovert 200 microscope fitted with an Axiocam HRc digital camera. Confocal images were collected on either a Leica SP5 or Nikon C1 confocal laser scanning microscope (40x and 63x oil immersion objectives, Monash Microimaging).
- hESCs and EBs were dissociated using TrypLE SelectTM (I nvitrogen) and filtered through a 40 ⁇ cell strainer (Falcon).
- Mouse anti-human primary antibodies reacting to cell surface antigens anti-E-CADHERIN (Zymed), anti-TRA-1-60, anti-SSEA4 (both from Chemicon), anti-KDR (Invitrogen), anti-SIRPA (Biolegend), anti-PDGFRa, anti-VCAM 1 , FITC- conjugated anti-CD9, phycoerythrin (PE) conjugated anti-CXCR4 (all from BD Biosciences), and biotin-conjugated anti-VCAM 1 (Abeam).
- Intracellular flow cytometry with anti-OCT 4 was performed as previously described (Ng ES et al., Blood 106(5), 1601 (2005)). Unconjugated antibodies were detected with allophycocyanin (APC)-conjugated goat anti-mouse IgG (BO Biosciences), biotinylated antibodies were detected with Streptavidin-PE (BO Bioscencies). Live cells were gated on the basis of side scatter, forward scatter and propidium iodide exclusion. Flow cytometric gates were set using control cells labeled with the appropriate isotype control antibody. Analyses were carried out using a FACScalibur flow cytometer (Becton Dickinson). Cells were sorted from EBs using either a FACSDiva or BD Influx cell sorter (Monash Flowcore)
- EBs were harvested on d10 of differentiation. EBs from four replicate plates were dissociated in TrypLE SelectTM (Invitrogen), filtered across a 40 ⁇ cell strainer (Falcon) and pooled. The resultant single cell suspensions were resuspended in FACS wash (Phosphate Buffered Saline with 2% foetal calf serum) containing propidium iodide. Plates were analysed for GFP expression using the BDTM High Throughput Sampler on the LSRI I flow cytometer (Becton Dickinson). Live cell gates were established as above.
- RNA was prepared using the High Pure RNA Isolation Kit according to manufacturer's instructions (Roche). Gene expression was examined on the l llumina HumanWG-6 v3.0 BeadChip at the Australian Genome Research Facility. Labelling, hybridization and scanning was performed in accordance with manufacturer's instructions. Expression profiles were established from three independent samples for d7 GFP + , d7 GFP " , d14 GFPPDGFRa " , d14 GFP " PDGFRa + and d14 GFP + PDGFRa + populations sorted from spin EBs and d8 and d13 GFP + and GFP " populations sorted from END2 co-cultures.
- PDGFRa is a surface receptor with a known role in mesoderm development and cardiogenesis (Prall, OW et al. , Cell 128(5), 947 (2007))
- Samples from fetal heart at 9, 10 and 12 weeks, adult heart and two independent late- stage heart failure samples were also analysed by microarray. Data was analyzed using Beadstudio Gene Expression Module v3.4 (l l lumina) using average normalization across all samples with further analysis performed using GeneSpring (Agilent).
- Q-PCR quantitative real time PCR
- Contractile regions were recorded through a Nikon Eclipse TS100 inverted microscope with Hoffman modulation contrast optics, coupled to a Basler (model A602f) camera and captured using Quick Caliper (SDR Clinical Technologies) software at 80 frames/second. Analysis was performed using the Metamorph® Imaging System (Molecular Devices Ltd) to establish contraction amplitude and frequency. Briefly, the intensity centroid of a selected particle was tracked throughout a 10 second (s) image stack. The amplitude of contraction of the selected particle (in pixels) was plotted against time for each time point. The number of peaks within the 10s was converted to beats per minute to represent the contraction frequency.
- Baseline contractions were recorded for 10s prior to the incubation with forskolin (1 ⁇ for 2 min) or endothelin-1 (ET-1 ; 10nM, for 5 min), isoprenaline (Iso; 1 ⁇ , for 10 min), Angiotensin (Angl l; 100 nM for 20 min), Carachol (1 ⁇ , for 5 mins) or vehicle controls. Following this incubation, a further 10s recording was taken. The data are presented as a percentage of the basal spontaneous rate (i.e. prior to agonist addition).
- ET-1 was dissolved in physiological salt solution (PSS) buffer consisting of 140 mM NaCI , 6 mM KCI, 2 mM CaCI 2 , 1 mM MgCI 2 , 20 mM HEPES and 10% glucose, supplemented with 1.4 % (w/v) BSA (pH 7.4, 37°C).
- PSS physiological salt solution
- Forskolin was dissolved in ethanol and the final ethanol concentration did not exceed 0.01 % of the media volume in the well.
- Re-aggregates of cell fractions from FACS were formed by centrifuging cells (for 5 minutes at 478 RCF) suspended in LI-APEL media at 5000 cells per well of low-adherent U bottom 96 well plates. Re-aggregates were left for 4 days until re-analysis by flow cytometry.
- Adherent cultures of cell fractions from day 7 FACS were formed by plating 5000 cells per well of adherent flat bottom 96 well plates in LI-APEL media. Adherent cultures were left for 7, 11 and 14 days until re-analysis by flow cytometry.
- GFP + SIRPa + VCAM 1 + GSV +
- GFP + SIRPa + VCAM 1 " GS +
- GFP " VCAM1 " SIRPA” TN
- Presence of spontaneous activity for each cell was measured for 10 minutes and used as the basal Ca 2+ flux. After 10 minutes either 1 ⁇ of Isoprenaline, or an isoprenaline vehicle control, was added to the well. Change in fluorescent fluctuation was measured for a further 10 minutes and tested for significance against the basal Ca 2+ flux.
- Example 1 Generation and characterisation of NKX2-5 GFPA
- hESC-derived committed cardiac progenitor cells hESC-CPCs
- hESC-CMs cardiomyocytes
- eGFP enhanced green fluorescent protein
- NKX2-5 GFP/W hESCs differentiated as spin embryoid bodies (EBs) or by co-culture with END2 cells developed GFP + contractile areas at day (d) 8 (END2) or d9 (EB) respectively ( Figure 1 b, c & I).
- Quantitative (Q) PCR analysis showed d14 GFP + cells purified by flow cytometry were enriched for cardiac markers ⁇ NKX2-5, TBX5, GATA4, NPPA, MYL7, MYH7) ( Figure 1d).
- GFP + cells expressed nuclear localized NKX2-5 confirming that GFP fluorescence faithfully reported NKX2-5 expression.
- GFP + beating foci also expressed the cardiac transcription factors GATA4 and ISL 1 and the myofilament components a-actinin, cardiac ventricular myosin light chain 2 (MYL2) and regulatory myosin light chain 7 (MYL7) (Fig. 1 e-k).
- Limit dilution analysis revealed that approx 1.4% of d7 GFP + cells produced colonies, and of these 23 + 9.2% (N 3) remained contractile and GFP + .
- N X2-5 GFP/W hESCs differentiate into functional CMs that display electrical properties, chronotropic and ionotropic responses similar to those reported for wild type hESC-CMs (Kehat I et al., J Clin I nvest 108(3), 407 (2001 ); Dick E et al. , Biochem Soc Trans 38(4): 1037 (2010)).
- GFP + contracting areas were scored visually and quantified by flow cytometry (d10) to generate a heat map for two independently derived NKX2-5 GFPM hESC lines ( Figure 4b and Figure 5c-e). Comparable heat maps were observed with d7 EBs, a timepoint preceding strong expression of myofilament proteins and the onset of contractility (Figure 5f). Mesendoderm was induced by a range of BMP4/ ACTIVIN-A concentrations, however, a 1 : 1 - 1 :2 ratio of BMP4:ACTIVIN-A was found to be optimal for cardiogenesis, in two independent laboratories ( Figure 4b, Figure 5 a-h).
- TMRM mitochondrial dye tetramethylrhodamine methyl ester perchlorate
- NKX2-5 + cells were compared with samples from fetal and adult heart (Fig, 8a-b and Fig 9). Cells were fractionated on the basis of GFP expression and, at d14, the mesodermal marker PDGFRa (Fig. 8a). Comparison of d7 GFP + and GFP " cells identified 471 differentially (> 3-fold) expressed transcripts (Fig. 9a). Unsupervised hierarchical clustering identified ontological relationships (Fig 8b) that suggests hESC-CMs most closely resembled fetal heart, consistent with their immature electrophysiological phenotype (Fig. 1 k). Gene ontology (GO) analysis showed that d7 NKX2-5 + cells expressed genes implicated in cardiogenesis and myocardial function (Fig. 9b and Table 2).
- d14 GFP + PDGFRa + cells expressed a larger cohort of genes associated with working myocardium and fewer genes involved in heart morphogenesis (Fig. 9 c-d and Table 3).
- VCAM1 Vascular Cell Adhesion Molecule 1
- SIRPa Signal Receptor Protein a
- SIRPa + or SIRPa + VCAM1 + fractions were cultured as monolayers, only SIRPa + and SIRPa + VCAM 1 + cells formed GFP + contractile areas (Fig 8k-m and Fig 10 c-f). Whilst d11 SIRPa + VCAM 1 + population yielded a higher percentage of GFP + cells than SIRPa + cells (Fig 8m), cultured SIRPa + cells upregulated VCAM1 , suggesting acquisition of this marker accompanies ongoing CM differentiation (Fig 8m, Fig 10 d,f).
- d14 GFP + VCAM 1 + cells expressed elevated levels of myocardial markers and lower levels of endothelial genes compared with GFP + VCAM 1 " cells (Fig 10g).
- d14 GFP + VCAM 1 + cells were enriched for genes involved in translational regulation, (RPL9, RPL23, PABPC1 ), mitochondrial components (NNT, COX7B, I M MT) and myofilament homeostasis (DSTN, NEBL) (Fig. 0h).
- VCAM 1 is found in the ventricular myocardium at 9.5 days post coital (dpc) and throughout the myocardium of the atria, ventricles and interventricular septum at 14.5 dpc (Fig. 8h-j).
- dpc days post coital
- Fig. 8h-j interventricular septum
- GS + population is phenotypically different to the GSV + cells.
- NKX2-5 + cells are multipotent, forming CMs, smooth muscle and endothelial cells
- the GS + population contains mutlipotential CPCs, cardiac smooth muscle or possibly cardiac endothelial cells. Therefore, the inventors performed RT-PCR analysis for the smooth muscle markers ACTA2 and CNN1 and the endothelial marker CD34. All three markers had significantly higher expression levels in the GS + population compared to the GSV + cells (P ⁇ 0.05) (Fig. 1 1 b, c).
- Fig. 1 1 b, c Fig. 1 1 b, c
- the GSV + population consists of cells that have committed to the CM lineage.
- the GS + fraction represents either a) a less differentiated pool of common CPCs that retain the ability to differentiate in a wider variety of cells or b) a wider range of cell types including smooth muscle and endothelial cells.
- TNNT2 + Cells which showed both positive TNNT2 staining and structure were counted as TNNT2 + .
- these immunohistochemistry data support the findings of our gene expression profiling (Fig. 11 a-c) strongly suggesting that the GSV + fractions contain a higher proportion of committed CMs than the GS + population.
- Example 5 VCAM 1 as a maturation marker.
- GS + cells were sorted and re-cultured. Briefly, cells from day 10 EBs were sorted by FACS into triple negative (TN), GS + and GSV + fractions and each fraction was separately re-aggregated and cultured for four days before being analysed for GFP expression and VCAM 1 expression by flow cytometry ( Figure 12 a). Re-aggregates from both the GS + fraction and GSV + fraction were found to be contractile and expressed GFP after four days of culture (Fig. 12b-j).
- the percentage of cells expressing VCAM 1 in the GSV + fraction did not significantly change (P>0.05) and remained at 95%.
- CMs CMs that regulate intracellular calcium by mature CMs can occur via multiple channels (e.g. Transmembrane ⁇ 1- and 2-adrenoceptors and sarcoplasmic Ryanodine receptors) and is essential for the normal contractile activity of the functional heart.
- increases in intracellular Ca 2+ initiates contraction and removal of Ca 2+ results in relaxation.
- Analysis of Ca 2+ flux was performed on GS + and GSV + fractions sorted from day 10 EBs and cultured as adherent cells for an additional 3, 5 or 6 days to determine if there was a difference in Ca 2+ handling between these fractions. This analysis was used as an indication of spontaneous contractility, thereby acting as a measure for maturity.
- Isoprenaline is a transmembrane ⁇ 1 - and 2-adrenoceptor agonist and has been shown to enhance Ca 2+ flux and contractility of CMs in the functional heart (Davis ef a/. 2008).
- GS + and GSV + cells were treated with Isoprenaline (Iso) or a vehicle control (veh) (ethanol) (Figure 13b-e).
- Iso Isoprenaline
- vehicle control vehicle control
- Figure 13b-e we used the calcium responsive flurophore, Flo-4, to measure Ca 2+ flux, a positive response results in a significant increase in spontaneous activity (as determined by increased fluroescence) above the basal rate of spontaneous activity (Fig.
- Example 7 Cell isolation based on VCAM 1 and SIRPA
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Cell Biology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Urology & Nephrology (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Hematology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Physics & Mathematics (AREA)
- Toxicology (AREA)
- Rheumatology (AREA)
- General Engineering & Computer Science (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Cardiology (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
The present disclosure relates generally to the field of cardiology. More particularly, the present disclosure relates to methods of enriching for cardiomyocytes in a sample and to a population of cells comprising purified cardiomyocytes isolated using cell surface markers VCAM 1 and SIRPα
Description
"Enrichment of cardiomyocytes"
Related Applications and Incorporation by Reference
All documents cited or referenced herein, and all documents cited or referenced in herein cited documents, together with any manufacturer's instructions, descriptions, product specifications, and product sheets for any products mentioned herein or in any document incorporated by reference herein, are hereby incorporated herein by reference in their entirety.
This application claims priority from United States provisional application 61/492,099 filed 1 June 2011 and Australian provisional application 2010904903 filed 4 October 2011 , the entire contents of these documents are incorporated by reference.
Field of the Invention
The present disclosure relates generally to the field of cardiology. More particularly, the present disclosure relates to methods of enriching for cardiomyocytes in a sample and to a population of cells comprising purified cardiomyocytes isolated using cell surface markers VCAM 1 and SIRPa.
Background of the Invention
Heart disease is one of the most serious health concerns of the western world.
Conditions include coronary heart disease, congenital cardiovascular defects and congestive heart failure. A central challenge for research in regenerative medicine is to develop cell compositions that can help reconstitute cardiac function in these conditions.
Myocardial infarction (Ml) is a life threatening event and may cause cardiac sudden death or heart failure. Despite considerable advances in the diagnosis and treatment of heart disease, cardiac dysfunction after M l is still the major cardiovascular disorder that is increasing in incidence, prevalence and overall mortality. After acute M l, the damaged cardiomyocytes are gradually replaced by fibroid non-functional tissue. Ventricular remodelling results in wall thinning and loss of regional contractile function. The ventricular dysfunction is primarily due to a massive loss of cardiomyocytes. It is widely accepted that adult cardiomyocytes have little regenerative capacity. Therefore, the loss of cardiac myocytes after Ml is irreversible.
Each year thousands of people die from heart failure. The relative shortage of donor hearts forces clinicians and researchers to look to alternative approaches for treating cardiac dysfunction in Ml and heart failure.
Human cardiomyocytes can be generated from human embryonic stem cells in vitro by a variety of methods, including co-culture with visceral endoderm-like cell lines and growth
factor directed differentiation as monolayers or three-dimensional cell aggregates (embryoid bodies, EBs). However, one the challenges facing these methods is the ability to obtain substantially pure populations of cardiomyocytes free of other cells such as endothelial cells, smooth muscle, keratinocytes etc.
The present inventors generated a genetically modified human embryonic stem cell line, NKX2-5GFP/W in which green fluorescent protein (GFP) was under the control of the pan- cardiac marker NKX2-5. Human cardiomyocytes were isolated from differentiating NKX2- gGFP/w nE50S anc| ana|ySec| by microarray. This analysis identified cell surface markers that were found to enrich for cardiomyocytes to a substantially greater extent than that seen with traditional cell culture methods alone.
Based on the identified cell surface markers, the inventors have been able to generate a method for the rapid and efficient isolation of functional cardiomyocytes.
Citation or identification of any document in this application is not an admission that such document is available as prior art to the present disclosure.
Summary of the Invention
The present disclosure is based on methods for enriching for cardiomyocytes (CM) based on their expression of cell surface markers VCAM 1 and SIRPa. To date, there have been no published methods for enriching for cardiomyocytes based on cell surface markers. Previously, methods for enriching, or purifying cardiomyocytes have relied upon differentiation of hES cell aggregates or embryoid bodies and appropriate culture conditions that biases for cells of the desired phenotype either by outgrowth of the desired cells, or by inhibition or killing of other cell types. However, the enrichment that can be achieved using such methods is highly variable (typically around 20-50% of cardiomyocytes in the population).
The methods of the present disclosure provide significantly greater levels of enrichment of cardiomyocytes compared with prior art methods available to date. Furthermore, existing methods for selecting for cardiomyocytes have relied upon the use of mitochondrial staining in combination with flow cytometry or magnetic cell separation methods. Older methodologies require cent rifugat ion across percoll gradients, which are technically challenging and time consuming.
The present disclosure thus permits the facile enrichment of cardiomyocytes based on recognition of cell surface markers. The inventors have found that cell populations enriched for cardiomyocytes can be selected based on expression of cell surface marker SIRPa or VCAM1 , or the combination of cell surface markers VCAM1 , and SIRPa. The inventors have found that SIRPa expression can be discriminatory for cardiomyocytes (Dubois NC et al. (2011 ) vol 29(1 1 ): 1011 -1018) but is even more discriminatory for cardiomyocytes when combined with
VCAM 1. Without wishing to be bound by theory, it is postulated that VCAM 1 represents a cardiomyocyte commitment marker.
The present disclosure provides a method for enriching for cardiomyocytes from a sample, the method comprising selecting for cells bearing the cell surface markers SIRPa and/or VCAM1.
In one example, the method comprises selecting for cells bearing cell surface markers SIRPa and VCAM1.
In another example, the selecting for cells comprises:
contacting said sample with a binding agent that binds to SI RPa and/or a binding agent that binds to VCAM 1 , for a time and under conditions sufficient for said binding agents to bind; and
isolating the cells in the sample to which the binding agent(s) bind. The method for enriching for cardiomyocytes according to the disclosure may further comprise the step of, prior to selecting for cells, generating a culture of the sample and causing differentiation of the cells in the sample. I n one example, the cells will be caused to differentiate in vitro.
Methods for culturing a sample according to the present disclosure will be known to persons skilled in the art and are described elsewhere in this document.
The sample according to the present disclosure may be a cell or tissue sample. A person skilled in the art will appreciate that where necessary, a single cell suspension of the tissue sample will be required to be generated. Such methods will be known to the skilled artisan and are described herein. For example, where the sample is an embryoid body, it may be necessary to dissociate the cells in the embryoid body.
In one example, the sample comprises cardiosphere-derived cells (CDCs).
I n one example, the sample comprises cardiomyocytes differentiated in culture from a stem cell or progenitor cell. In one example, the stem cell is a pluripotent stem cell. In another example, the pluripotent stem cell is a human embryonic stem cell (hES cell). Methods for causing differentiation of stem (including pluripotent stem) or progenitor cells are known in the art and are explained in further detail elsewhere in this document. In one example, the differentiation of the cells is biased towards cells of the cardiac lineage. Methods for biasing differentiation of cells towards the cardiac lineage will be known to persons skilled in the art. The cells may be in the process of becoming fully differentiated or may be fully differentiated. Suitable pluripotent cells according to the present disclosure include human embryonic stem cells (hES), embryonic stem cells from other primates, such as Rhesus stem cells or marmoset stem cells and human embryonic germ (hEG) cells, induced pluripotent stem cells (iPS), or
stem cells lines such as but not limited to BG01 , BG02, HUES cell lines e.g. HUES1 -17, HES2 or HES3 or human ESC-derived cardiac progenitor cells (e.g. hESC-CPCs).
In another example, the sample comprises a mixed population of cells comprising cardiomyocytes. In another example, the mixed population of cells comprises any cell type that is capable of differentiating down the cardiac lineage. I n a further example, the mixed population of cells includes pluripotent cells, cardiac progenitor cells, induced pluripotent stem cells (iPS), induced/re-programmed cardiomyocyte cells, umbilical tissue, left atrial appendage, cardiac tissue, circulating endothelial cells, cardiac fibroblasts, adipose tissue or skin tissue and combinations thereof.
In one example, the mixed population of cells comprises differentiating pluripotent cells and/or the progeny thereof.
In another example, the sample or the mixed population of cells according to the present disclosure are human derived. In one example, the cells are human derived pluripotent cells. However, it is also envisaged that primate pluripotent cells may be suitable for use according to any method disclosed therein. The sample or the mixed population of cells according to the present disclosure may be autologous, or allogeneic.
I n one particular example, the pluripotent cells are human embryonic stem (hES) cells. The preferred progeny may include committed cardiac progenitor cells (CPCs) or cells derived from committed cardiac progenitor cells. In one example, the progeny cells are cardiomyocytes. In one example, the cardimyocytes are human cardiomyocytes.
In a preferred example, the method of the present disclsoure enriches for human cardiomyocytes.
Methods for selecting for cells based on expression of cell surface markers will be familiar to persons skilled in the art. In one example, the step of selecting for cells bearing the cell surface markers SIRPa and/or VCAM 1 , is achieved by contacting the sample using a binding agent that binds to SIRPa and/or a binding agent that binds to VCAM 1 , for a time and under conditions sufficient for said binding agents to bind. In one example, the binding agent specifically binds SI RPa or specifically binds VCAM 1. I n another example, the sample is contacted with a binding agent that specifically binds SIRPa and a binding agent that specifically binds VCAM1.
The selected cells to which the binding agent(s) is bound may then be isolated.
Isolation of cells may be achieved by any of the methods known in the art, including affinity based interaction, affinity panning, magnetic beads (e.g. Dynabeads) or flow cytometry. The flow cytometry preferably employs a cell sorter so that the cells bearing surface markers SIRPa and/or VCAM1 (and therefore staining positive for SIRPa and/or VCAM 1 ) can be removed from cells that do not stain positive for these cell surface markers.
In one example, the cells are selected using the binding agents described herein, and optionally one or more other cell surface markers, and isolated using fluorescence activated cell sorting (FACS) or magnetic activated cell sorting (MACS™). I n one example, the cells are selected using MACS™, where the cells are required for in vivo studies or in vivo administered compositions.
In another example, the cells may be isolated by binding to an immobilised support and then harvested by removing them from the support.
The harvesting of cells may be achieved by collecting the isolated cells into a suitable receptacle or collection dish, tube etc.
In one example, the population of cells enriched for cardiomyocytes according to the methods disclosed herein, are VCAM 1 +/SIRPa cells. However, it is understood that the cells may comprise one or more additional cell surface markers, typically markers which are known to be expressed on cardiomyocytes.
According to the present disclosure, the cells selected according to the methods disclosed herein constitute a population of cells having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 87%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% cardiomyocyte cells. In one example, the selected or isolated cells have at least about 70% cardiomyocytes. In another example, the selected or isolated cells have at least about 80% cardiomyocytes. In another example, the selected cells have at least about 90% cardiomyocytes.
The present disclosure also provides a population of cells enriched for cardiomyocytes according to a method described herein. In one example, the population of cells has at least about 70% cardiomyocytes. In another example, the population of cells has at least about 80% cardiomyocytes. In another example, the population of cells has at least about 90% cardiomyocytes.
The present disclosure also provides a method for detecting cardiomyocytes in a sample, the method comprising contacting the sample with a binding agent that binds to SIRPa and/or a binding agent that binds to VCAM 1 for a time and under conditions sufficient for said binding agents to bind, wherein the cells to which the binding agent(s) binds are cardiomyocytes. In one example, the method comprises contacting the sample with a binding agent that specifically binds to SIPRa and a binding agent that specifically binds to VCAM1.
In one example, the detection is performed by immunohistochemistry or ELISA.
The sample used in the detection method disclosed herein may be as described above. In one example, for the detection method disclosed herein, the mixed population of cells includes human embryonic stem cells (hES), embryonic stem cells from other primates, embryonic germ (hEG) cells, induced pluripotent stem cells (iPS), induced/re-programmed cardiomyocyte cells, stem cells lines such as BG01 , BG02, HUES cell lines such as HUES1-17,
HES2 or HES3), umbilical tissue, left atrial appendage, cardiac tissue, circulating endothelial progenitor cells, cardiac fibroblasts, adipose tissue, skin tissue and cardiac progenitor cells and combinations thereof.
The binding agent according to the present disclosure may be an antibody or a protein comprising an antibody variable region. Exemplary antibodies are chimeric antibodies, humanized antibodies or human antibodies. The antibody may be produced recombinantly or by hybridoma generation according to standard techniques. The antibody may be polyclonal or monoclonal.
The antibody or protein comprising an antibody variable region may be unconjugated or conjugated to a moiety. Examples of suitable moieties include biotin or a fluorescent label e.g. FITC. Any suitable label that facilitates the enrichment or detection of cardiomyocytes according to the invention is intended to be included within the scope of the present disclosure.
It will be appreciated that the binding agents may be used simultaneously or sequentially. For example, the cells may be first selected on the basis of cell surface binding to SIRPa and then isolated by flow cytometry and then further selected with a binding agent to the VCAM 1 cell surface marker followed by further flow cytometry. Alternatively, the cells may be selected using binding agents simultaneously to both cell surface markers, wherein one of the binding agents may be labelled with e.g. FITC (fluorescein isothiocyanate) and the second binding agent labelled with e.g. phycoerythrin (PE) which facilitates isolation by flow cytometry.
In one example, the binding agent is an antibody which specifically binds to human
VCAM 1.
In one example, the binding agent is an antibody which specifically binds to human
SIRPa.
The present disclosure also provides a purified population of cells comprising at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 87%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) cardiomyocytes. I n another example, the purified population of cells comprises at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 87%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% VCAM 1 +/SIRPcT cardiomyocytes.
The cardiomyocytes may further comprise one or more additional cell surface markers selected from the group consisting of CORIN, GJA3, ESRRG, CACNB2, TMEM 163, TRPM4, HTR4, SLC20A2, CADPS, CADPS2, TSPAN13, ERBB2, CACNA1 C, TPCN2, FSD2, TSPAN32, CRHBP, JPH2, VSTM2L, NES, THBS1 , GCOM 1 , CACNB2, EDNRA, and CLCNKA.
The cardiomyocytes may further comprise one or more additional cell surface markers selected from the group consisting of FSD2, TSPAN32, THBS1 , CORIN, GJA3 and ERBB2.
In one example, the cardiomyocytes are VCAM 1+, SI RPa+ and CORIlsT.
In another example, the cardiomyocytes are VCAM1+, SIRPa+ and FSD2+.
The cardiomyocytes of the present disclosure may also be characterised by expression of one or more genes selected from the group consisting of Nkx2.5, IRX4, RPL9, RPL23, PABPC1, NNT, COX7B, IMMT, DSTN, TBX-20, MYL2 and NEBL.
The cardiomyocytes of the present disclosure can possess one or more phenotypic characteristics of naturally occurring cardiomyocytes for example, spontaneous cell beating. The characteristic of spontaneous cell beating may be present at the time the cell is enriched or the cell may acquire or develop this phenotype in time or due to agents or compounds that are added to the cell to force this phenotypic development. Additionally, the cardiomyocytes may express other characteristics of natural cardiomyocytes such as ion channel or appropriate electrophysiology.
The present disclosure also provides a pharmaceutical composition comprising a therapeutically effective amount of population of cells disclosed herein, together with a pharmaceutically acceptable carrier.
The present disclosure also provides a method of screening a compound for an effect on cardiomyocytes, comprising combining the compound with the population of cells as described herein, and determining any modulatory effect resulting from the compound. This may include examination of the cells for toxicity, metabolic change, or an effect on contractile activity.
The disclosure also provides a method for treating a subject suffering from a cardiovascular disease or disorder, comprising administering to the subject a therapeutically effective amount of a population of cells as described herein or a pharmaceutical composition according to the present disclosure. The cardiovascular diseases or disorders that are amenable to treatment include coronary heart disease, cardiomyopathy, endocarditis, congenital cardiovascular defects and congestive heart failure, long QT syndrome and other ion channel pathologies.
The present disclosure also provides a method of repairing or treating damaged myocardium comprising the step of administering to a subject a therapeutically effective amount of a population of cells as described herein, or a pharmaceutical composition as described herein. Repairing damaged myocardium comprises at least partially restoring structural integrity or functional integrity to the damaged myocardium.
In one example, the method for repairing or treating damaged myocardium may comprise intrauterine administration of a therapeutically effective amount of a population of cells as described herein, or a pharmaceutical composition as described herein to the developing foetus.
The present disclosure also provides a composition comprising a population of cells as described herein, or a pharmaceutical composition as described herein for use in medicine, in
particular for use in treating a cardiovascular disease or disorder or for repairing or treating damaged myocardium.
The present disclosure also provides use a population of cells as described herein, or a pharmaceutical composition as described herein in the manufacture of a medicament or in a delivery device for treating a cardiovascular disease or disorder, or for repairing or treating damaged myocardium.
It will also be appreciated by persons skilled in the art that the cardiomyocytes according to the disclosure may be used as a research tool to elucidate mechanisms underlying conditions such as cardiomyopathies or muscular dystrophy or complex genetic diseases such as progeria (premature ageing) or for elucidating mechanisms of heart disease linked to the gene expression profile. The cardiomyocytes may also be used for functional analysis of disease specific inducible pluripotent (iPS) cells.
Thus, in one example, the disclosure also provides a method for examining the function of cardiac disease-specific iPS cells, comprising:
(i) developing a disease-specific human iPS line from a subject;
(ii) causing the iPS cells to differentiate into the cardiac lineage;
(iii) selecting for cells bearing the cell surface markers VCAM 1 and SI RPa; and
(iv) examining the functionality of the selected cells.
In one example, the cells are selected using a binding agent that binds to VCAM 1 and a binding agent that binds to SIRPa.
Examining the functionality of cells may include examining action potential/electrophysiology, arrhythmogenicity, or ion channel behaviour. Other suitable parameters will be familiar to person skilled in the art.
In one example, a disease specific iPS cell line can be generated from a subject for example, with congenital long QT syndrome (LQTS) and then differentiated into the cardiac lineage. The differentiated cells can be enriched for cardiomyocytes according to a method exemplified herein. The functional properties of the cardiomyocytes can then be examined in order to elucidate the underlying mechanisms of the disease.
The disclosure also extends to the use of cardiomyocytes derived from a differentiated disease-specific human iPS cell line, to evaluate drugs that may either ameliorate or aggravate the disease phenotype.
The present disclosure also provides a kit comprising a binding agent which binds to VCAM 1 and a binding agent which binds to SIRPa, together with instructions for use in enriching cardiomyocytes.
The present disclosure also provides a purified population of cells or a composition described herein packaged in a suitable container with written instructions for a desired
purpose. In one example, the purpose is reconstitution of cardiomyocyte cell function to improve some abnormality of the cardiac muscle. In another example, the purpose is for use in screening or diagnostic applications. Brief Description of the Drawings
Figure 1 Characterisation of cardiomyocytes generated from NKX2-5GFP W hESCs (a) Wild type and targeted NKX2-5 alleles, (b) Green fluorescence (GFP) and (c) overlayed GFP and brightfield (BF) of d14 EBs derived from NKX2-5GFP/W hESCs (Scalebar: 100 μηι), (d) Relative gene expression (RGE) for the indicated genes, (e) Green fluorescence, (f) NKX2-5, (g) aACTIN IN and (h) merged images of purified GFP+ cells (Scalebar: 50 μπι). (i-k) Images for GFP+ cells stained with antibodies to cardiac markers GATA4, ISL1 , MYL2 (ventricular myosin light chain 2) and MYL7 (regulatory myosin light chain 7) (Scalebar: 10 μηι). (I) Representative action potential from END2-derived GFP+ CMs. Figure 2 Gene targeting of the NKX2-5 locus, (a) Schematic representation of the targeting strategy to introduce GFP into the first exon of NKX2-5. The two NKX2-5 coding exons (e1 and e2) are shown as black boxes and the translational start site is marked atg. NeoR denotes the pGKNeo cassette encoding G418 resistance flanked by loxP sites. The eGFP sequences are shown as the box marked GFP. Positions of the Hindlll restriction sites and the primers (p1-p5) used to map the structure of the modified locus are shown, (b) PCR amplification of a specific 5.4 kb band (p1 - p2; 3' homology arm) identifies a targeted clone (GFPNeoR denotes NKX2-5GFPNeoR allele), (c) PCR amplification across the 5' homology arm results in an 8.5 kb band confirming the recombination event in both MEL 1 (M 1 ) and HES 3 (H3) targeted clones. Non-contiguous lanes from the same gel are shown, (d) Removal of the pGKNeoR cassette by CRE/LoxP recombination was demonstrated by amplification of a 4.5 kb band using primers p3 and p2 (GFP denotes NKX2-5GFP allele). All PCR products (b-d) were sequenced, (e) Southern blot analysis of Hindlll digested genomic DNA with a GFP probe detects a 10.5 kb band. This demonstrates that only single integration event has occurred in both M 1 and H3 NKX2-5GFP W lines. Genomic DNA from a previously targeted line, H3 M IXL -|GFP W was usec| as a positive control, (f, g) Representative chromosomal preparations of (f) M 1 NKX2-5GFP W (male) and (g) H3 NKX2-5GFP W (female) show a normal karyotype, (h) Flow cytometric analysis shows that H3 NKX2-5GFP W cells express the stem cell surface markers ECADHERIN, TRA-160, SSEA-4 and CD9 and the intracellular marker OCT4. Numbers indicate the percentage of positive cells for each marker, (i-k) Hematoxylin and eosin stained histological sections of teratomas from H3 NKX2-5GFP W cells showing derivatives of (i)
ectoderm, (j) mesoderm and (k) endoderm. Arrow denote structures that derived from the three germ layers; neural rosettes (i) cartilage (j) and secretory columnar epithelium (k).
Figure 3 NKX2-5GFP W CMs display similar electrophysiological and pharmacological phenotypes to CMs from genetically unmanipulated hESC lines, (a) Representative single electrode recording of the field potential of NKX2-5GFP W derived cardiomyocytes measured on a multi electrode array, (b) Graphical representation of calcium level cycling during contractions determined by confocal imaging of the calcium dependent dye Fura red. (c) NKX2-5GFP W CMs increase both contraction amplitude and frequency in response to Endothelin (ET-1 ). (d) increased contraction frequency of NKX2-5GFP W EBs treated with Angiotensin I I (Ang II) (**P < 0.0005 one-way ANOVA; n = 3) and Forskolin (***P < 0.001 Students T-Test, N=5). The cholinergic agonist Carbachol (*** pO.0001 one-way ANOVA; N = 4) reduced contraction rate, e) NKX2-5GFPA" d14 EBs exhibit similar responses to ET-1 (***P < 0.0001 one-way ANOVA, n = 3) and Isoprenaline (*** P < 0.001 Students T-Test, n = 6-7) as d14 EBs derived from NKX2- 5w/w (Wildtype) hESCs. Mean response is shown and errors bars represent SEM for graphs in e and d.
Figure 4 NKX2-5GFP W hESCs facilitate real-time monitoring of cardiac differentiation, (a) Schematic representation of cardiac differentiation protocols (BVSAW, BMP4; VEGF; SCF; ACTIVIN A; WNT3a. MG, Matrigel, d, day) (b) Heat map of flow cytometric quantification of GFP+ cells from d10 NKX2-5GFP W EBs generated across a range of BMP4 and ACTIVI N A concentrations. Representative FACS plots showing the percentages GFP+ cells observed in selected EBs. (c) Time course of GFP expression during EB and monolayer differentiation, (d) Quantification of percentage of GFP+ cells during EB differentiation (n=4; Error Bars, SEM). (e, f) Syncytium of GFP+ contracting cells in monolayer cultures (Scalebar, 100 μηι).
Figure s Improving cardiac differentiation from NKX2-5GFP W hESCs using the spin EB platform, (a) Induction of mesendoderm during treatment with BVSAW from dO to d3 of differentiation as shown by flow cytometric analysis of PDGFRa and CXCR4 expression. Generally, 60-90% of cells expressed surface PDGFRa at d3 of differentiation under these conditions, (b) Flow cytometric analysis of d7 EBs showing the inhibitory effect on cardiac differentiation if growth factors were not removed after 3 days, (c) Representative EBs from BMP4 and ACTIVIN A titration analysis (Scalebar, 100 μηι). The visual score assigned to GFP intensity is indicated in top right corner (BF, Bright Field; GFP, green fluorescence), (d, e) Heat maps showing cardiac differentiation induced by a range of BMP4 and ACTIVIN A concentrations in (d) H3 NKX2-5GFPA,V and (e) M1 NKX2-5GFP W. Four plates were scored per
experiment; data shown is the average of two experiments. For all experiments media was supplemented with SCF 40 ng/ml, VEGF 30 ng/ml and WNT3a 50 ng/ml. The color scale shown correlates with the visual scoring system shown in (c), with dark green (far left of the panel) representing 0, and dark red (far right of the panel) representing 5. (f) Heat map of flow flow cytometric quantification of GFP+ cells from d7 NKX2-5GFP/W EBs. For all experiments media was supplemented with SCF 40 ng ml"1 , VEGF 30 ng ml"1 and WNT3a 50 ng ml"1 , (g, h) Representative data of BMP4 and ACTIVIN A titration analysis showing flow cytometric analysis of GFP expression in d12 EBs formed in LI-APEL supplemented with the indicated concentrations of (g) BMP4 and ACTIVIN A (ACT. A) and (h) titration of WNT3A for the first 3 days of differentiation (n = 1 ). For the experiment shown in (g), the medium also contained SCF 40 ng ml"1 , VEGF 30 ng ml" and WNT3A 100 ng ml"1. For the experiment shown in (h), the medium contained BMP4 20 ng ml"1, ACTIVIN A 20 ng ml"1, SCF 40 ng ml"1 and VEGF 30 ng ml"1 , (i-k) Spin EBs cultured in LI-BEL media remain contractile and continue to express GFP for 120 days (Scalebar, 100 Mm).
Figure 6 Flow cytometric analysis showing accumulation of the mitochondrial dye tetramethylrhodamine methyl ester perchlorate (TMRM) in undifferentiated (Un) hESCs and in GFP+ and GFP" cells. Live (a, b) undifferentiated hESCs and (c, d) cells harvested from d11 embryoid bodies generated from NKX2-5GFP/W cells (a, c) incubated without mitochondrial dyes and (b, d) with 10 nM TMRM for 30 min, were evaluated for GFP and Rhodamine (RHOD) fluorescence. In d1 1 NKX2-5GFP W cells, GFP fluorescence marks NKX2-5 expression. I n each panel (a-d), dot plots are shown for unfractionated cultures, and for cultures gated to show the distribution of rhodamine fluorescence on GFP+ and GFP" cells. Bright rhodamine fluorescence indicating TMRM accumulation is observed in (b) approx. 83% of undifferentiated hESC and in (d) approx. 40% of d11 NKX2-5GFP W cells, (d) Whilst most NKX2-5 GFP+ cells accumulate TMRM (approx. 86%), rhodamine fluorescence is also seen in approx. 30% of GFP" cells.
Figure 7 The mitochondrial dye TMRM accumulates in mitochondria in undifferentiated hESC as well as in GFP+ and GFP". Images of live cultures of (a-h) undifferentiated (Un) hESCs and (i-t) cells harvested from d11 embryoid bodies generated from NKX2-5GFP W cells (d11 ) incubated (a-d, i-l) without mitochondrial dyes (-TMRM) and (e-h, m-t) with 10 nM TMRM for 30 min (+TMRM) showing (a, e, i, m, q) brightfield (BF), (b, f, j, n, r) GFP and (c, g, k, o, s) Rhodamine (RHOD) fluorescence and overlaid fluorescence images (d, h, I, p, t) (GFP RHOD). The boxed regions in panels m-p are shown enlarged in panels q-t. The images show perinuclear accumulation of rhodamine fluorescence, consistent with mitochondrial localization, in (g, h) undifferentiated ES cells and in (o, p, s, t) d11 NKX2- 5GFP W cells where it is clearly
present in both GFP+ (arrows in t) and in GFP (arrowheads in t) cells. Scale bar, 20 μηη in a-p and 50 μηι in q-t.
Figure 8 Expression profiling of NKX2-5+ hESCs cells identifies cardiac cell surface markers, (a) Cell populations used for array analysis (G- =GFP"; G+ = GFP+; DN = PDGFRa" GFP"; P+ = PDGFRa+GFP"; PG+ = PDGFR a+GFP+). (b) Clustering of cardiac samples based on gene expression (Heart = adult heart; Heat Fail = heart failure; FH = fetal heart; wk = week; E = END2 co-culture). Co-expression of VCAM1 and SIRPa in d14 GFP+ cells by flow cytometry (c) and (d-f) immunofluorescence in EBs (Scalebar: 25 μιτι). (g-i) VCAM1 myocardial expression at (g) 9.5 and (h-i) 14.5 dpc (Scalebar: 100 μιτι) (j) Expression of key lineage markers in GFP", GFP+SIRPa+ and GFP+SIRPa+VCAM1+. (k,l) SIRPa+VCAM1+ cells form contractile syncytia (Scalebar: 100 μιτι). (m) Flow cytometry of cultured (7d) SIRPa+ and SIRPa+VCAM1+ populations. Figure 9 Gene expression profiling of committed human CPCs and early CMs. Key differentially regulated genes are listed along with the fold change of expression level observed (a, c). (a) Microarray comparison of gene expression of d7 GFP+ and GFP" cells identified 471 differentially expressed transcripts. The fold change in expression between the indicated fractions is listed for several key genes, (b) Gene ontology analysis of d7 GFP+ cells shows that genes associated with cardiogenesis are overrepresented. (c) Comparison of gene expression profiles between d14 GFP+PDGFRa+ (d14 GP+) and GFP"PDGFRa+ (d14 PDGFRa) cell populations identified 407 differentially regulated transcripts, (d) Genes encoding myocardial proteins were overrepresented in the d14 GFP+PDGFRa+ fraction, (e) splenic anlage transcription factors are not enriched in the GFP+ (d7G+ and d14PG+) cell fractions.
Figure 10 Characterisation of cell populations isolated based on expression of GFP, SIRPa and VCAM1. (a) Relative gene expression levels of the cell surface markers VCAM1 and SIRPa in FACS isolated fractions from EBs, hESCs, adult heart (AH) and fetal heart (FH 9wk) (G-, GFP"; G+, GFP+; DN, PDGFRa GFP"; P+, PDGFRa+GFP"; PG+, PDGFRa+GFP+; n = 3, error bars, s.e.m.) b) Time course of SIRPa and VCAM1 expression during EB differentiation. NKX2-5+ cells are highlighted in green, c) FACS isolated SIRPa+ cells from NKX2-^FPM EBs give rise to GFP+ CMs (BF, brightfield, GFP, green fluoresence; Scalebar, 100 μιτι). d) Expression level of cadiac markers in GFP", GFP+SIRPa+ and GFP+SIRPa+VCAM1+ fractions (n = 3, error bars, s.e.m.). e) FACS analysis of SIRPa+ and SIRPa+VCAM1+ cells from d14 EBs after 7d in culture. The percent GFP+ cells is shown, f) Flow cytometric analysis of cultured SIRPa+ cells demonstrating that the GFP+ cells become SIRPa+VCAM1+ after 7d in culture, (g)
Microarray analysis comparing gene expression profiles of d14 GFP+ cell populations fractionated on the basis of VCAM 1 (d14 GV+, GFP+VCAM 1+ and d14 GFP+, GFP+VCAM 1 "). The GFP+VCAM 1+ population has higher levels of myocardial markers including IRX4, MYL2 and LAMA4 whilst endothelial markers including CD34, TEK (Γ/Ε2), and CDH5 { VE- CADHERIN) are higher in GFP+VCAM 1" cells, (h) Comparison of gene expression profiles of d14 GFP+ cell populations isolated on the basis of co-expression of VCAM 1 (d14 GV+) or PDGFRa (d14 PG+). Key differentially regulated genes are listed along with the fold change of expression level observed (g, h). Note that the nuclear encoded mitochondrial genes, NNT, COX7B and IMMT were also up-regulated in the d14 GV+ population.
Figure 11 The GSV+ fraction is more enriched for CMs than the GS+ fraction, (a-c) Relative gene expression of cardiac markers (a), smooth muscle markers (b), and an endothelial marker (c) to GAPDH in GFP- (black), GS+ (grey) and GSV+ (green) fractions (n=3; Error Bars, SEM). (d-i) Immunohistochemistry staining for TNNT2 (red), GFP (green) and nuclei (blue) of triple negative (TN) (d,g), GS+ (e, h) and GSV+ (f,i) fractions (d-f Scalebar, 50μηι; h-i Scalebar, 10μηι). (j) Percentage of TNNT2+ cells from GS+ and GSV+ fractions as determined by immunohistological staining (n=1 ). Numbers above bars represent TNNT+ cells / total cells counted for each fraction. Figure 12 VCAM 1 acts as a maturation marker for CMs. (a) Schematic representation of the experimental protocol. Day 10 EBs were harvested and dissociated into a single cell suspension and sorted into triple negative (TN), GS+ and GSV+ fractions. These fractions were separately re-aggregated for analysis of VCAM 1 expression by flow cytometry at day 14. (b- i)Green fluorescence (GFP), Brightfield (BF) and overlayed GFP and BF from day 4 re- aggregates of triple negative (TN) (b-d), GS+ (e-g) and GSV+ (h-j) fractions obtained from day 10 FACS. (k) Flow cytometric analysis of VCAM 1 in GS+ and GSV+ fractions at day 10 and at 4 days post re-aggregation (Day 10+4). (I) Percentage of cells expressing VCAM 1 in GS+ and GSV+ fractions at day 10 (lighter bars) and at 4 days post re-aggregation (Day 10+4; darker bars) as determined by flow cytometry (n=3; Error Bars, SEM).
Figure 13 Putative CMs from the GSV+ population are more mature than those of the GS+ fraction (a) Percent of cells from GS+ (lighter bars) and GSV+ (darker bars) fractions that display Ca2+ flux after 3, 5 and 6 days of culture after a day 10 FACS (n=1 ) (b) Example of Ca2+ flux in a contractile cell that does not response to Isoprenaline (no response) and a contractile cell that does response to Isoprenaline (Iso response), (c) Percent of cells from the GSV+ fraction that significantly increase in their rate of spontaneous activity in response
Isoprenaline (GSV+ Iso) and the Isoprenaline vehicle control (GSV+ Veh) (n=1 ). (d) Percent of cells from the contractile GS+ fraction that significantly increase in their rate of spontaneous activity in response Isoprenaline (GS+ Iso) and the Isoprenaline vehicle control (GS+ Veh) (n=1 ).
Figure 14 VCAM 1 and SIRPa together facilitate selection of enriched CM populations, (a-b) Flow cytometric analysis of SI RPa"VCAM1 " (SV"), SIRPa+ (S+) and VCAM 1 +SIRPAhigh (SV+) cells from (a) day 7 EBs after 7 days in culture and (b) day 11 EBs after 7 days in culture and day 14 EBs after 7 days in culture. The percent GFP+ cells is shown. (n=1 ) (c-d) Green fluorescence (c) and GFP and bright field overlay (d) of a contractile syncytia formed from SV+ cells (Scalebar, 100μηι). (e) Flow cytometric analysis of SV-, S+ and SV+ cells of day 14 EBs after 7 days in culture. The percent GFP+ cells is shown (n=1 ). (f) Flow cytometric analysis showing GFP expression of the VCAM 1+SIRPAhigh population from day 14 EBs. (g) Percent GFP expression of the VCAM 1 +SIRPAhigh population from day 10 and day 14 EBs as determined by flow cytometry (n=3; Error Bars, SEM).
Detailed Description of the Invention
Selected Definitions
The term "and/or", e.g. , "X and/or Y" shall be understood to mean either "X and Y" or "X or Y" and shall be taken to provide explicit support for both meanings or for either meaning.
Throughout this specification, unless specifically stated otherwise or the context requires otherwise, reference to a single step, composition of matter, group of steps or group of compositions of matter shall be taken to encompass one and a plurality (i.e. one or more) of those steps, compositions of matter, groups of steps or group of compositions of matter.
Each example described herein is to be applied mutatis mutandis to each and every other example of the disclosure unless specifically stated otherwise.
Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The present disclosure also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations or any two or more of said steps or features.
The present disclosure is not to be limited in scope by the specific examples described herein, which are intended for the purpose of exemplification only. Functionally-equivalent products, compositions and methods are clearly within the scope of the disclosure, as described herein.
The present disclosure is performed without undue experimentation using, unless otherwise indicated, conventional techniques of molecular biology, microbiology, recombinant DNA technology, and immunology. Such procedures are described, for example, in Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, New York, Second Edition (1989), whole of Vols I, I I , and I I I; DNA Cloning: A Practical Approach, Vols. I and II (D. N. Glover, ed. , 1985), IRL Press, Oxford, whole of text; Oligonucleotide Synthesis: A Practical Approach (M. J. Gait, ed, 1984) IRL Press, Oxford, whole of text, and particularly the papers therein by Gait, ppl-22; Atkinson ef al, pp35-81 ; Sproat et al, pp 83-115; and Wu et al, pp 135-151 ; 4.
Throughout this specification, unless the context requires otherwise, the word
"comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.
As used herein, the term "allogeneic" refers to tissue, cells or stem cells being genetically different, but deriving from the same species.
As used herein, the term "autologous" refers to tissue, cells or stem cells that are derived from the same subject's body.
The term "bearing the cell surface marker" is understood to mean a protein, glycoprotein or other molecule which is present or displayed on the surface of a cell which serves to identify the cell. It will be also understood by persons skilled in the art to mean that the protein, glycoprotein or other molecule is expressed on the cell surface. A cell surface marker can generally be detected by conventional methods, for example, fluorescence activated cell sorting (FACS) or enzymatic analysis. Cell surface markers can be utilized for positive or negative selection processes. For example, a positive selection marker such as VCAM 1 or SIRPa is present on the differentiating cells of interest. Markers for negative selection are absent on the differentiating cells or interest but will typically be present on other cells in the sample e.g. endodermal cells, fibroblasts etc. Negative selection markers may therefore also be utilized in the methods of the present disclosure.
The term "cardiosphere-derived cells (CDCs)" are described herein refers to cells which are derived from endomyocardium. For example, autologous percutaneous endomyocardial biopies can be used to obtain source tissue and a cardiosphere culture method (Messina E, et al. (2004) Circ Res 95:911 -21 ) used to yield CDCs. CDCs are clonogenic and have multilineage potential. CDCs can be differentiated into mature cardiac lineage cells in hygrogels (Li Z et al. (201 1 ) Biomaterials 32(12): 3220-32). Animal and human studies have demonstrated that CDCs delivered via the intracoronary route can improve heart function after myocardial infarction (Makkar RR et al. (2012) The Lancet 379: 895-904).
As used herein, the term "cardiovascular disease or disorder" refers to a disease or disorder related to the cardiovascular or circulatory system. Cardiovascular disease and/or disorders include, but are not limited to, diseases and/or disorders of the pericardium, heart valves (i.e. incompetent valves, stenosed valves, rheumatic heart disease, mitral valve prolapse, aortic regurgitation), myocardium (cornonary artery disease, myocardial infarction, heart failure, ischemic heart disease, angina). The person skilled in the art would be aware that cardiovascular diseases and/or disorders can result from congenital defects, environmental influences (i.e. dietary, lifestyle, stress etc) and other defects or influences.
The term "cardiomyocyte" as used herein refers to any cell in the cardiac myocyte lineage that shows at least one phenotypic characteristic of a cardiac muscle cell. Such phenotypic characteristics include expression of cardiac proteins, such as cardiac sarcomeric or myofibrillar proteins or atrial natriuretic factor, or electrophysiological characteristics. The term "cardiomyocyte" and "myocyte" are used interchangeably. In one example, a cardiomyocyte is defined as any cell in the cardiac myocyte lineage expressing cell surface markers VCAM 1 and SIRPa. The cell may also express one or more additional markers (not necessary cell surface markers) including alpha-actinin, annexin, atrial natriuretic peptide (ANP), brain natriuretic peptides (BNP), cardiac troponin I (cTnl ), cardiac troponin-T, caveolin- 2, caveolin-3, connexin-43, dHAND, eHAND, GATA-4, myosin heavy chain, myosin light chain, Nkx2.5.
As used herein, the term "coronary artery disease" (CAD) refers to a type of cardiovascular disease. CAD is caused by gradual blockage of the coronary arteries. In CAD, atherosclerosis causes patches of fatty tissue (called plaques) to form on the inside walls of the coronary arteries. As the plaque thickens, the artery narrows and blood flow decreases resulting in a decrease in oxygen to the myocardium, leading to an infarct or heart attack.
As used herein the term "heart failure" refers to the loss of cardiomyocytes such that progressive cardiomyocyte loss over time leads to the development of a pathophysiological state whereby the heart is unable to pump at a rate commensurate with the requirements of the metabolizing tissues or can do so only from an elevated filling pressure.
As used herein, the term "flow cytometry", is understood to involve the separation of cells in a liquid sample. Generally the purpose of flow cytometry is to analyse the separated cells for one or more characteristics thereof. A fluid sample is directed through an apparatus such that a liquid stream passes through a sensing region. The cells pass the sensor one at a time and are categorized based on size, refraction, light scattering, opacity, roughness, shape, fluorescence, etc. In the context of the present disclosure, the term "flow cytometry" is also understood to encompass cell sorting (fluorescence activated cell sorting).
As used herein, the term "inducible pluripotent stem cell (iPS)" is understood to mean a pluripotent stem cell artificially derived from a non-pluripotent cell, typically an adult somatic cell, by inducing forced expression of specific genes.
The term "inducible/re-programmed cardiomyocytes" refer to cells which are derived from fibroblasts which have been reprogrammed into cardiomyocyte-like cells in cell culture. Micro RNAs can be used to regulate gene expression via translational and transcriptional modulation, to reprogram in vitro cultured and endogenous cardiac fibroblasts toward a cardiomyocyte phenotype (Jayawardena TM et al. (2012) Circ Res 1 10(1 1 ): 1465-73). Another study has demonstrated that three developmental transcription factors (Gata4, Mef2c and Tbx5) reprogrammed post-natal cardiac or dermal fibrobalsts directly into differentiated cardiomyocyte-like cells ( leda M et al. (2010) Cell 142(3):375-386).
As used herein, the term "isolated" is intended to refer to a cell, isolatable or purified from other components. An isolated cell refers to a cell free from the environment in which it may naturally occur. The isolated cell may be purified to any degree relative to its naturally- obtainable state.
As used herein the term " heart disease" or "heart failure" refers to a lack of oxygen due to inadequate perfusion or blood supply. One specific etiology of ischemic heart disease is the consequence of atherosclerosis of the coronary arteries.
The term "pluropotency" and "pluripotent stem cells" is taken to mean that such cells have the ability to differentiate into all types of cells in an adult organism.
The term "induced pluripotent stem cell" encompasses pluripotent cells, that, like embryonic stem (ES) cells, can be cultured over a long period of time which maintaining the ability to differentiate into all types of cells in an organism, but that, unlike ES cells (which are derived from the inner cell mass of blastocysts), are derived from differentiated somatic cells, that is, cells that had a narrower, more defined potential and that in the absence of experimental manipulation could not give rise to all types of cells in the organism. By having the potential to become iPS cells, it is meant that the differentiated somatic cells can be induced to become, i.e. reprogrammed to become, iPS cells. In other words, the somatic cell can be induced to redifferentiate so as to establish cells having the morphological characteristics, growth ability and pluripotency of pluripotent cells. iPS cells have an hESC-like morphology, growing as flat colonies with large nucleo-cytoplasmic ratios, defined borders and prominent nucleoli. In addition, iPS cells express one or more key pluripotency markers by one of ordinary skill in the art, including but not limited to Alkaline Phosphatase, SSEA3, SSEA4, Sox2, Oct3/4, Nanog, TRA160, TRA181 , TDGF 1 , Dnmt3b, FoxD3, GDF3, Cyp26a1 , TERT, and zfp42. I n addition, pluripotent cells are capable of forming teratomas.
As used herein, the term "specifically binds" shall be taken to mean that the binding agent e.g. antibody or protein comprising an antibody variable region reacts or associates more frequently, more rapidly, with greater duration and/or with greater affinity with a particular cell or substance than it does with alternative cells or substances. For example, a binding agent that specifically binds to a target protein is a agent that binds that protein or an epitope or immunogenic fragment thereof with greater affinity, avidity, more readily, and/or with greater duration than it binds to unrelated protein and/or epitopes or immunogenic fragments thereof. It is also understood by reading this definition that, for example, a binding agent that specifically binds to a first target may or may not specifically bind to a second target. As such, "specific binding" does not necessarily require exclusive binding or non-detectable binding of another molecule, this is encompassed by the term "selective binding". Generally, but not necessarily, reference to binding means specific binding.
As used herein, the term "subject" shall be taken to mean any subject, including a human or non-human subject. The non-human subject may include non-human primates, ungulate (bovines, porcines, ovines, caprines, equines, buffalo and bison), canine, feline, lagomorph (rabbits, hares and pikas), rodent (mouse, rat, guinea pig, hamster and gerbil), avian, and fish. I n one example, the subject is a human.
As used herein, the term "therapeutically effective amount" shall be taken to mean a sufficient quantity of a population of cells enriched for cardiomyocytes, or otherwise VCAM 1+/SIRPa+ cells that results in an improvement or remediation of the symptoms of the disease or condition. The skilled artisan will be aware that such an amount will vary depending upon, for example, the particular subject and/or the type or severity or level of disease. The term is not to be construed to limit the present disclosure to a specific quantity, e.g. weight or number of cells, rather the present disclosure encompasses any number of cells sufficient to achieve the stated result in a subject.
As used herein, the terms "treating", "treat" or "treatment" include administering a therapeutically effective amount of a population of cells enriched for cardiomyocytes or otherwise VCAM 1 +/SIRPa+ cells or a composition comprising such cells described herein sufficient to reduce or eliminate at least one symptom of a specified disease or condition.
As used herein the term VCAM-1 positive or (+) or SIRPa positive or (+)" as used herein refers to expression of the cell surface marker compared with a suitable isotype matched control. A cell that is referred to as being "positive" for a given marker may express either a low (lo or dim) or a high (bright, bri) level of that marker depending on the degree to which the marker is present on the cell surface, wherein the terms relate to intensity of fluorescence or other marker used in the sorting process of the cells. The distinction of lo and bri will be understood in the context of the marker used on a particular cell population being sorted. A cell
that is referred to as being "negative" for a given marker is not necessarily completely absent from that cell. This term means that the marker is expressed at a relatively very low level by that cell, and that it generated a very low signal when detectably labeled or is undetectable above background levels, e.g. , levels detected using an isotype control antibody.
While not wishing to be bound by theory, it is proposed that "bright" cells express more of the target marker protein (for example the antigens recognized by VCAM 1 and/or SI RPa) than other cells in the sample. Typically, positive expression of any given marker will be at least one log magnitude greater, preferably two log magnitude higher expression of the surface marker compared with the isotype matched negative control. The term SIRPA is intended to be used interchangeably with SIRPa.
Stem cells and Pluripotent cells
A "pluripotent cell" is preferably one which is derived from any kind of embryonic tissue (fetal or pre-fetal tissue) and has the characteristics of being capable under appropriate conditions of producing progeny of different cell types that are derivatives of all the three germinal layers (endoderm, mesoderm and ectoderm), according to standard tests, such as the ability to form a teratoma in 8-12 week old SCID mice, or the ability to form identifiable cells of all three germ layers in tissue culture.
Stem cells of interest according to the present disclosure include embryonic cells of various types, exemplified by human embryonic stem (hES) cells, described by Thomson et al. , (Science 282: 1145, 1998); embryonic stem cells from other primates, such as Rhesus stem cells (Thomson et al. , Proc. Natl. Acad. Sci USA 92:7844, 1995), marmoset stem cells (Thomson et al. , Biol. Reprod. 55:254, 1996) and human embryonic germ (hEG) cells (Shamblott et al. , Proc. Natl. Acad. Sci. USA 95: 13726, 1998). These cell types may be provided in the form of an established cell line, or they may be obtained directly from primary embryonic tissue and used immediately for differentiation. Examples of cell lines include those listed in the NIH Human Embryonic Stem Cell Registry, e.g. hESBGN-01 , hESBGN-02, hESBGN-03, hESBGN-04 (BresaGen, Inc), HES-1 , HES-2 (Reubinoff et al. , Nat Biotechnol. 18:399-404, 2000), HES-3 (Mummery C et al. , J Anat 200:233-242, 2002; Passier R et al. , Stem Cells 23: 772-780, 2005), HES-4, HES-5, HES-6 (ES Cell International), Miz-hES1 (MizMedi Hospital-Seoul National University), HSF-1 , HSF-6 (University of California at San Francisco); and H1 , H7, H9, H13, H14 (Wisconsin Alumni Research Foundation (WiCell Research Institute)).
Also of interest are lineage committed stem cells, such as mesodermal stem cells and other early cardiogenic cells (Reyes et al. (2001 ) Blood 98:2615; Eisenberg & Bader (1996) Cic Res. 78(2):205).
Other types of pluripotent cells are also included in the term. Any cells of primate (including human) origin that are capable of producing progeny that are derivatives of all three germinal layers are included, regardless of whether they were derived from embryonic tissue, fetal tissue, or other sources.
Embryonic Stem Cells
ES cells are considered to be undifferentiated when they have not committed to a specific differentiation lineage. Such cells display morphological characteristics that distinguish them from differentiated cells of embryo or adult origin. Undifferentiated ES cells are easily recognised by those skilled in the art, and typically appear under the microscope as colonies of cells with high nuclear/cytoplasmic ratios and prominent nucleoli. Undifferentiated ES cells express genes that may be used as markers to detect the presence of undifferentiated cells, and whose polypeptide products may be used as markers for negative selection.
Embryonic stem cells have been isolated from blastocyts of members of the primate species (Thomson et al. , Proc. Natl. Acad. Sci USA 92:7844, 1995). Human embryonic stem (hES) cells can be prepared from human blastocyst cells using the techniques described by Thomson et al., (US Patent No. 5,843,780; Science 282: 1 145, 1998) and Reubinoff et al. , (Nature Biotech. 18:399, 2000). Equivalent cell types to hES cells include their pluripotent derivatives, such as primitive endoderm-like (EPL) cells, described in WO 01/51610.
Briefly, human blastocytes are obtained from human in vivo preimplantation embryos.
Alternatively, in vitro fertilised (IVF) embryos can be used, or one cell human embryos can be expanded to the blastocyst stage (Bongso et al. , Human Reprod 4:706, 1989). Embryos are cultured to the blastocyst stage in G1.2 and G2.2 medium. The zona pellucida is removed from the developed blastocyts by brief exposure to pronase. The inner cell masses are isolated (for example by immunosurgery using rabbit anti-human spleen cell antiserum). The intact inner cell mass is plated on mEF feeder cells (US Patent No. 5, 843, 780), human feeder cells (US 2002/0072117), or in a suitable feeder-free environment that supports undifferentiated hES cell growth (US 2002/0081724; WO 03/020920). Growing colonies having undifferentiated morphology are dissociated into clumps, and replated.
Differentiated cells
A "differentiated cell" is a cell that has progressed further down the developmental pathway than a cell with which it is being compared. Thus, embryonic stem cells can differentiate to lineage restricted progenitor cells (such as a mesodermal stem cell), which in turn can differentiate into other types of progenitor cells further down the pathway (such as cardiomyocyte progenitors), and then to an end-stage differentiated cells, which plays a
characteristic role in a certain tissue type, and may or may not retain the capability to proliferate further.
The potential of ES cells to give rise to all differentiated cells provides a means of giving rise to any mammalian cells type, and so a range of culture conditions may be used to induce differentiation.
The relative term "differentiating" describes the active process whereby the cell is progressing down the developmental pathways to become more lineage restricted and mature.
Among the differentiated cells of interest are cells not readily grown from somatic stem cells, or cells that may be required in large numbers and hence are not readily produced in useful quantities by somatic stem cells.
Propagation of the sample
The sample according to the present disclosure may be a tissue sample or a cell sample which may comprise a mixed population of cells. In one example, the sample comprises a mixed population of cells comprising cardiomyocytes. I n another example, the mixed population of cells comprises cells which are capable of being differentiated down the cardiac lineage.
Thus, in one example according to the present disclosure, the mixed population of cells may first be cultured under appropriate conditions and with appropriate factors, to facilitate differentiation of the mixed population of cells down the cardiac lineage. The differentiated cells may then be selected according to the methods of the present disclosure described herein.
In another example, the pluripotent embryonic stem cells may first be propagated continuously in culture using culture conditions that promote proliferation without promoting differentiation. Exemplary mediums are described in, for example, WO 98/30679 and WO 99/20741. Conventionally, ES cells are cultured on a layer of feeder free cells, typically fibroblasts derived from embryonic or fetal tissue. To prepare a feeder layer, cells are irradiated to inhibit proliferation but permit synthesis of factors that support ES cells. ES cells can also be propagated in an environment essentially free of feeder cells (see for example WO 01/51616). Cells can be cultured on an extracellular matrix of Matrigel® or laminin, in medium contained by feeder cells or medium supplemented with growth factors such as FGF and SCF. Feeder-free cultures are supported by a nutrient medium typically conditioned by culturing irradiated primary mouse embryonic fibroblasts, telomerised mouse fibroblasts, or fibroblast-like cells derived from hES cells. Following this initial propagation, the pluripotent/embryonic stem cells may then be induced to undergo differentiation down the cardiac lineage prior to selection.
Cardiomvocvte cells
During normal cardiac morphogenesis, the cranio-lateral part of the visceral mesoderm becomes committed to the cardiogenic lineage. Several heart associated transcription factors, such as Nkx2.5, Handl , 2, Srf, Tbx5, Gata4, 5,6 and Mef2c, become expressed in the cardiogenic region. The first possible overt sign restriction of gastrulating mesodermal cells to the cardiogenic lineage is the expression of the basic helix-loop— helix transcription factor Mespl Cardiogenic mesoderm expressing Mespl is pluripotent and contains the precursors for the endocardial/endothelial, the epicardial and myocardial lineages. The cardiomyocytes of the primary heart tube are characterised by low abundance of sarcomeric and sarcoplamatic reticular transcripts. Mysoin light chain (Mlc) 2v is expressed in a part of the tube that gives rise not only to ventricular chamber myocardium, but also to parts of the atrial chambers and to the atroventricular node, a and β-myosin heavy chain (Mhc), Mica, 1v and 2a are initially expressed in the entire heart-tube in gradients, and are later restricted to their compartments.
Morphologically and functionally, the chamber myocardium of the developing atria and ventricles are distinguished from the primary myocardium of the linear heart tube. The chamber myocardium becomes trabeculated, whereas the primary myocardium is smooth and covered with cardiac cushions. Markers that in mammals identify the developing chamber myocardium include the atrial natriuretic factor (Anf) and Cx40 genes, which are not expressed in the myocardium of the primary heart tube. During further development, the smooth-walled dorsal atrial wall (comprising the pulmonary and caval myocardium) as well as the atrial septa are incorporated into the atria. These components do not express Anf, but do express Cx40. A gene that is clearly upregulated in the cardiac chambers is sarco-endoplasmic reticulum Ca2+ ATPase (Serca2a), but because it is also expressed in the primary myocardium it is less suited as a marker for the developing chambers. The functional significance of the chamber program of gene expression is that it allows fast, synchronous contractions.
Phenotypes that arise during development of the mammalian heart can be distinguished: primary cardiomyocytes; nodal cardiomyocytes; conducting cardiomyocytes and working cardiomyocytes. All cardiomyocytes have sarcomeres and a sarcoplasmic reticulum (SR), are coupled by gap junctions, and display automaticity. Cells of the primary heart tube are characterized by high automaticity, low conduction velocity, low contractility, and low SR activity. This phenotype largely persists in nodal cells. In contrast, atrial and ventricular working myocardial cells display virtually no automaticity, are well coupled intercellularly, have well developed sarcomeres, and have a high SR activity. Conducting cells from the atrioventricular bundle, bundle branches and peripheral ventricular conduction system have poorly developed sarcomeres, low SR activity, but are well coupled and display high automaticity.
Cardiomyocytes and cardiac progenitor cells derived from pluripotent/embryonic stem cells often have morphological characteristics of cardiomyocytes from other sources. They can be spindle, round, triangular or multi-angular shaped and they may show striations characteristic of sarcomeric structures detectable by immunostaining. They may form flattened sheets of cells, or aggregates that stay attached to the substrate or float in suspension, showing typical sarcomeres and atrial granules when examined by electron microscopy.
The pluripotent/embryonic stem cell derived cardiomyocytes and their progenitors typically have at least one of the following cardiomyocyte specific markers:
Cardiac troponin I (cTnl ), a subunit of troponin complex that provides a calcium- sensitive molecular switch for the regulation of striated muscle contraction;
Cardiac troponin T (cTnT);
Nkx2.5, a cardiac transcription factor expressed in cardiac mesoderm during early mouse embryonic development, which persists in the developing heart.
The cells will also typically express at least one (and often at least 3, 5, or more) of the following markers:
Atrial natriuretic factor (ANF), a hormone expressed in developing heart and fetal cardiomyocytes but down-regulated in adults. It is considered a good marker for cardiomyocytes because it is expressed in a highly specific manner in cardiac cells but not skeletal myocytes;
myosin heavy chain ( MHC), particularly the β chain which is cardiac specific;
Titin, tropomyosin, a-sarcomeric actinin, and desmin;
GATA-4, a transcription factor that is highly expressed in cardiac mesoderm and persists in the developing heart. It regulates many cardiac genes and plays a role in cardiogenesis;
MEF-2A, MEF-2B, MEF-2C, MEF-2D; transcription factors that are expressed in cardiac mesoderm and persist in developing heart;
N-cadherin, which mediates adhesion among cardiac cells;
Connexin 43, which forms the gap junction between cardiomyocytes;
βΐ-adrenoceptor (βΙ-AR);
creatine kinase MB (CK-MB) and myoglobin, which are elevated in serum following myocardial infarction;
a-cardiac actin, early growth response-l, and cyclin D2.
Tissue-specific markers can be detected using any suitable immunological technique— such as flow immunocytometry or affinity adsorption for cell-surface markers, immunocytochemistry (for example, of fixed cells or tissue sections) for intracellular or cell- surface markers, Western blot analysis of cellular extracts, and enzyme-linked immunoassay,
for cellular extracts or products secreted into the medium. Antibodies that distinguish cardiac markers like cTnl and cTnT from other isoforms are available commercially from suppliers like Sigma and Spectral Diagnostics.
Expression of tissue-specific gene products can be detected at the mRNA levels by Northern blot analysis, dot-blot hybridization analysis, or by reverse transcriptase initiated polymerase chain reaction (RT-PCR) using sequence-specific primers in standard amplification methods using publicly available sequence data (GenBank). Expression of tissue-specific markers as detected at the protein or mRNA level is considered positive if the level is at least 2- fold, and preferably more than 10- or 50-fold above that of a suitable control.
The pluripotent/embryonic stem cell derived cardiomyocytes typically demonstrate spontaneous periodic contractile activity. This means that when they are cultured in a suitable tissue culture environment with an appropriate Ca++ concentration and electrolyte balance, the cells can be observed to contract across one axis of the cell, and then release from contraction, without having to add any additional components to the culture medium. The contractile activity of the cells can be characterized according to the influence of culture conditions on the nature and frequency of contractions. Compounds that reduce available Ca++ concentration or otherwise interfere with transmembrane transport of Ca++ often affect contractile activity. Characterisation of functional properties of the cell can involve characterizing channels for Na+, K+, and Ca++. Electrophysiology can be studied by patch clamp analysis for cardiomyocyte like action potentials (see Igelmund et al., Pflugers Arch. 437:669, 1999; Wobus et al. , Ann. N.Y. Acad. Sci. 27:752, 1995; and Doevendans et al. , J. Mol. Cell Cardiol. 32:839, 2000).
Preparation of Cardiomyocytes
Cardiomyocyte lineage cells can be obtained from undifferentiated pluripotent/embryonic stem cells by culturing or differentiating in a special growth environment that enriches for cells (typically by outgrowth of the desired cells) with the desired phenotype.
Differentiation can be initiated by forming embryoid bodies (EB) or aggregates. Such aggregates can be generated for example by forming spin embryoid bodies (Ng et al., Nat. Protoc. 3(5):768, 2008; Ng et al. , Blood 106(5): 1601 , 2005). The pluripotent/embryonic stem cells are harvested by brief collagenase digestion, dissociated into clusters and plated into nonadherent cell culture plates (see for example, WO 01/51616). Optionally, the EBs can be produced encapsulated in alginate or other suitable nutrient-permeable matrix, which may help to improve the uniformity of EB diameter and consistency of the cells produced. Whether or not the process involved EB formation, using a medium that contains serum or serum equivalent promotes foci of contracting cells of the cardiomyocyte lineage: for example, approx 20% fetal
bovine serum, or a serum supplement such as B27 or N2 in a suitable growth medium such as RPM I.
To promote the cardiomyocyte phenotype, the cells can be cultured with factors and factor combinations that enhance proliferation or survival of cardiomyocyte type cells, or inhibit the growth of other cell types. The effect may be due to a direct effect on the cell itself, or due to an effect on another cell type, which in turn enhances cardiomyocyte formation. For example, factors that induce the formation of hypoblast or epiblast equivalent cells, or cause these cells to produce their own cardiac promoting elements, all come within the rubric of cardiotropic factors.
Factors thought to facilitate differentiation of pluripotent/embryonic stem cells towards the cardiomyocyte lineages include:
Transforming growth factor beta related ligands (exemplified by TGF-βΙ , TGF- 2, TGF- β3 and other members of the TGF-β superfamily;
Morphogens like ACTIVIN A and ACTIVIN B (members of the TGF-β superfamily); Insulin-like growth factors (such as IGF I and IGF II );
Bone morphogenic proteins (members of the TGF-β superfamily, exemplified by BMP-2 and BMP-4);
Fibroblast growth factors (exemplified by bFGF, FGF-4, and FGF-8), other ligands that activate cytosolic kinase raf-1 and mitogen activated protein kinase (MAPK), and mitogens such as epidermal growth factor (EGF);
Nucleotide analogs that affect DNA methylation and altering expression of cardiomyocyte-related genes (eg 5-aza-deoxy-cytidine);
The pituitary hormone oxytocin, or nitric oxide (NO); and
Specific antibodies or synthetic compounds with agonist activity for same receptors. Alternatively, or in addition, the cells can be co-cultured with cells (such as endothelial cells e.g. END2 cells) that secrete factors enhancing cardiomyocte differentiation. Particularly effective combination of cardiotropic agents include use of a morphogen like Activin A and a plurality of growth factors, such as those included in the TGF- β and IGF families during the early commitment stage, optionally supplemented with additional cardiotropins such as one or more fibroblast growth factors, cone morphogenic proteins, and platelet derived growth factors.
Further examples of procedures for preparing cardiomyocytes can be found in US 7,452, 718 and US 7,425,448 in the name of Geron Corporation, the entire contents of which are incorporated by reference. One such example is a direct differentiation technique which does not require the formation of embryoid bodies or the use of serum or serum supplements. Briefly, the pluripotent/embryonic stem cells are harvested from the culture in which they are expanded and plated onto a substrate or matrix that is adherent for undifferentiated hES cells,
and is compatible with cardiomyocyte differentiation. Exemplary are 0.5% gelatine, 20 μ9/ηιΙ fibronectin or Matrigel®. If desired, the pluripotent/embryonic stem cells can be established onto the substrate before initiating differentiation. The differentiation process is initiated by culturing the plated cells in a medium that contains factors referred to elsewhere in this disclosure that promote cardiomyocyte differentiation.
The present inventors have found that because they have observed variable results with BMP4/ACTIVI N A driven cardiac differentiation performed in bovine serum albumin (BSA) containing medium, they instead chose to use fully defined recombinant protein based medium, APEL (Ng ES et al., Nat. Protoc 3(5), 768 (2008); US 2010/0317104) in low insulin supplemented with growth factors (VEGF, SCF, WNT3a, BMP4 and ACTIVIN A).
Cardiomyocytes may also be prepared by differentiating cardiosphere-derived cells
(CDCs).
Enrichment of cardiomyocytes
In one example, the cardiomyocytes are enriched from a sample. I n one example, the sample may be a tissue sample. Thus, the method of enriching for cardiomyocytes might also include the harvesting of source of cells prior to selection using known techniques. Thus, the tissue will be surgically removed. Cells comprising the source tissue will then be separated into a so called single cells suspension. This separation may be achieved by physical and or enzymatic means.
In another example, the sample is a cell sample. In a further example, sample comprises a mixed population of cells. By "mixed population of cells" it is meant that the cells may be comprised of cell types that are differentiating, have differentiated or are capable of being differentiated down the cardiac lineage. I n other examples, the mixed population of cells is a population of cells comprising cardiomyocytes. In certain examples it may be first necessary to culture the mixed population of cells in a suitable medium to induce cell differentiation down the cardiomyocyte pathway according to methods as described herein. The term "medium" as used in reference to cell culture, includes the components of the environment surrounding the cells. Media may be solid, liquid, gaseous or a mixture of phases ad materials. Media include liquid growth media as well as liquid media that do not sustain cell growth. Media also include gelatinous media such as agar, agarose, gelatin and collagen matrices. Exemplary gaseous media include the gaseous phase that cells growing on a petri dish or other solid or semisolid support are exposed to. The term "medium" also refers to material that is intended for use in a cell culture, even if it has not yet been contacted with cells.
In another example, the sample may be a cell line such as a stem cell line described herein.
The terms "enriched", "enrichment" or variations thereof are used herein to describe a population of cells in which the proportion, or percentage of cells of one particular cell type or the proportion or percentage of a number of particular cell types is increased when compared with an untreated population of the cells (e.g. cells in their native environment).
In one example, the term "enriched" is taken to mean that the proportion or percentage of cardiomyocytes is greater than the proportion or percentage of cardiomyocytes in the population of cells from which it was originally contained. In another example, the term "enriched" is taken to mean that the proportion or percentage of VCAM 1+, or SIRPa+ or VCAM 1+/SIRPa+ double positive cells is greater than the proportion or percentage of VCAM 1+, or SIRPa+ or VCAM1 +/SI RPa+ double positive cells in the population of cells from which it was originally contained.
In one example, a population of cells enriched for cardiomyocytes is made up of at least about 60% of said cells or at least about 65% of said cells, or at least about 70% of said cells, or at least about 75% of said cells or at least about 80% of said cells, or at least about 85% of said cells, or at least about 87% of said cells, or at least about 90% of said cells, or at least about 95% of said cells, or at least about 96% of said cells, or at least about 97% of said cells, or at least about 97% of said cells, or at least about 98% of said cells, or at least about 99% of said cells, or 100% of said cells.
The term "population of cells enriched for cardiomyocytes" will be taken to provide explicit support for the term "population of cells comprising X% cardiomyocytes, wherein X is a percentage as recited herein.
In one example, the population of cells is enriched from a mixed population of cells comprising cardiomyocytes in a selectable form. In this regard, the term "selectable form" will be understood to mean that the cells express a marker (e.g. a cell surface marker) permitting selection of the cardiomyocytes. In a further example, the cells are selected by expression of cell surface markers VCAM 1 and/or SIRPa.
Reference to selection of a cell or population thereof does not require selection from a specific tissue source, provided that the tissue comprises cells expressing cell surface markers VCAM 1 and/or SIRPa.
Selection of cells
It will be understood that in performing the present disclosure, separation of cells carrying any given cell surface marker can be effected by a number of different methods, however, some methods rely upon binding a binding agent (e.g. , an antibody or antigen binding fragment thereof) to the marker concerned followed by a separation of those that exhibit binding, being either high level binding, or low level binding or no binding. The most
convenient binding agents are antibodies or antibody-based molecules, such as monoclonal antibodies or based on monoclonal antibodies because of the specificity of these latter agents. Antibodies can be used for both steps, however other agents might also be used, thus ligands for these markers may also be employed to enrich for cells carrying them, or lacking them.
In certain examples, the sample may be optionally enriched using crude techniques such as drug selection, panning, density gradient centrifugation etc. The particular technique employed will depend upon efficiency of separation, associated cytotoxicity, ease and speed of performance, and necessity for sophisticated equipment and/or technical skill. In another example, a negative selection is performed, where the selection is based on expression of one or more markers found on ES cells, fibroblasts, epithelial cells and the like. Selection may utilise panning methods, magnetic particle selection, particle cell sorter selection, and the like.
Antibodies or ligands may be attached to a solid support to allow for crude separation. Preferably, the separation techniques maximize the retention of viability of the fraction to be collected.
Techniques providing accurate separation include but are not limited to flow cytometry, including magnetic activated cell sorting (MACS) or fluorescence activated cell sorting (FACS).
In a preferred example, the sorting utilizes FACS. Methods for performing cell sorting will be apparent to the skilled artisan.
Antibodies against each of the markers described herein are commercially available (see later), available from ATCC or other depositary organization and/or can be produced using art recognized techniques.
The disclosure can be practised using cells from a human or any non-human animal species, including but not limited to non-human primate cells, ungulate, canine, feline, lagomorph, rodent, avian and fish cells. Primate cells with which the disclosure may be performed include but are not limited to cells of chimpanzees, baboons, cynomogus monkeys, and any other New or Old World monkeys.
Uses of the cardiomyocyte cells of the disclosure
The purified cardiomyocyte cells of the present disclosure have a variety of uses in clinical therapy, research, development, and commercial purposes.
For example, the cells can be used to prepare a cDNA library. For example, mRNA can be prepared from the cells using standard techniques (e.g. Sambrook et al., A Laboratory Manuel Harbor Laboratory Press 2001 ; Ausubel et al. , Short Protocols in Molecular Biology eds. , John Wiley & Sons 1999) and reverse transcribed to produce cDNA. The preparation can then be subtracted with cDNA from undifferentiated ES cells, other progenitor cells, or end- stage cells from the cardiomyocyte or any other developmental pathway.
The cells of the present disclosure can also be used to generate antibodies that may be specific for additional markers of cardiomyocytes not yet recognised. Polyclonal antibodies can be prepared by injecting vertebrate animal with cells of the present disclosure in an immunogenic form. Production of monoclonal antibodies is described in standard references and US 4, 491 ,632; US 4,472,500 and 4,444,887. Specific antibody molecules can also be produced by contacting a library of immunocompetent cells or viral particles with the target antigen, and growing out positively selected clones. The antibodies in turn can be used to identify or rescue cells of a desired phenotype from a mixed cell population.
The cells of present invention are also of interest in identifying expression patterns of transcripts and newly synthesised proteins that are characteristic for cardiomyocytes. The expression patterns can be compared with control cell lines, such as undifferentiated pi uri potent/embryonic stem cells.
A microarray can be used to analyse gene expression (see Fritz et al., Science 288: 316, 2000; www.Gene-Chips.com). An exemplary method is conducted using a Genetic Microsystems array generator, and an AxonGenepix™ Scanner. Microarrays are prepared by first amplifying cDNA fragments encoding marker sequences to be analysed, and spotted directly onto glass slides. To compare mRNA preparations from two cells of interest, one preparation is converted into Cy5-labeled cDA, while the other is converted into Cy3-labeled cDNA. The two cDNA preparations are hybridised simultaneously to the microarray slide, and then washed to eliminate non-specific binding. The slide is then scanned at wavelengths appropriate for each of the labels, the resulting fluorescence is quantified, and the results are formatted to give an indication of the relative abundance of mRNA for each marker on the array.
mRNA expression levels can in a sample can be determined by generation of a library of expressed sequence tags (ESTs) from a sample. Enumeration of the relative representation of ESTs within the library can be used to approximate the relative representation of a gene transcript within the starting sample. The results of EST analysis of the test sample of a test sample can then be compared to EST analysis of a reference sample to determine the relative expression levels of a selected polynucleotide, particularly a polynucleotide corresponding to one or more of the differentially expressed genes described herein.
Alternatively, gene expression in a test sample can be performed using serial analysis of gene expression (SAGE) methodology (Velculescu et al. , Science (1995) 270:484). In short, SAGE involves the isolation of short unique sequence tags from a specific location within each transcript. The sequence tags are concatenated, cloned, and sequenced. The frequency of particular transcripts within the starting sample is reflected by the number of times the associated sequence tag is encountered with the sequence population.
Gene expression in a test sample can also be analysed using differential display (DD) methodology. In DD, fragments defined by specific sequence delimiters (e.g. , restriction enzyme sites) are used as unique identifiers of genes, coupled with information about fragment length or fragment location within the expressed gene. The relative representation of an expressed gene with a sample can then be estimated based on the relative representation of the fragment associated with that gene within the pool of all possible fragments. Methods and compositions for carrying out DD are well known in the art, see, e.g. , U.S. 5,776,683; and U.S. 5,807,680.
Alternatively, gene expression in a sample can be performed using hybridization analysis, which is based on the specificity of nucleotide interactions. Oligonucleotides or cDNA can be used to selectively identify or capture DNA or RNA of specific sequence composition, and the amount of RNA or cDNA hybridized to a known capture sequence determined qualitatively or quantitatively, to provide information about the relative representation of a particular message within the pool of cellular messages in a sample. Hybridization analysis can be designed to allow for concurrent screening of the relative expression of hundreds to thousands of genes by using, for example, array-based technologies having high density formats, including filters, microscope slides, or microchips, or solution-based technologies that use spectroscopic analysis (e.g. , mass spectrometry).
Hybridization to arrays may be performed, where the arrays can be produced according to any suitable methods known in the art. For example, methods of producing large arrays of oligonucleotides are described in U.S. 5, 134,854, and U.S. 5,445,934 using light-directed synthesis techniques. Using a computer controlled system, a heterogeneous array of monomers is converted, through simultaneous coupling at a number of reaction sites, into a heterogeneous array of polymers. Alternatively, microarrays are generated by deposition of pre-synthesized oligonucleotides onto a solid substrate, for example as described in PCT WO 95/35505.
In another screening method, the test sample is assayed for the level of polypeptide of interest. Diagnosis can be accomplished using any of a number of methods to determine the absence or presence or altered amounts of a differentially expressed polypeptide in the test sample. For example, detection can utilize staining of cells or histological sections (e.g. , from a biopsy sample) with labelled antibodies, performed in accordance with conventional methods. Cells can be permeabilised to stain cytoplasmic molecules. In general, antibodies that bind a differentially expressed polypeptide of the present disclosure are added to a sample, and incubated for a period of time sufficient to allow binding to the epitope, usually at least about 10 minutes. The antibody can be detectably labelled for direct detection (e.g. , using radioisotopes, enzymes, fluorescers, chemiluminescers, and the like), or can be used in conjunction with a
second stage antibody or reagent to detect binding (e.g., biotin with horseradish peroxidase- conjugated avidin, a secondary antibody conjugated to a fluorescent compound, e.g. fluorescein, rhodamine, Texas red, etc. ) The absence or presence of antibody binding can be determined by various methods, including flow cytometry of dissociated cells, microscopy, radiography, scintillation counting, etc. Any suitable alternative methods can of qualitative or quantitative detection of levels or amounts of differentially expressed polypeptide can be used, for example ELISA, western blot, immunoprecipitation, radioimmunoassay, etc.
The cells of the present disclosure are also useful for in vitro assays and screening to detect factors that are active on cells of the cardiomyocyte lineage. Of particular interest are screening assays for agents that are active on human cells. A wide variety of assays may be used for this purpose, including immunoassays for protein binding; determination of cell growth, differentiation and functional activity; production of factors; and the like.
The cells of the present disclosure may be genetically modified, e.g., to express and/or secrete a protein of interest, e.g. , a protein providing a therapeutic and/or prophylactic benefit in heart disease. Cells may also be genetically modified to enhance survival, control proliferation and the like. The cells of the present disclosure can also be genetically altered in order to enhance their ability to be involved in tissue regeneration. Of particular interest are cells that are genetically altered to express one or more growth factors of various types, cardiotropic factors such as atrial natriuretic factor, cripto and cardiac transcription regulation factors, such as GATA-4, Nkx2.5 and MEF2-C.
Methods for genetically modifying a cell will be apparent to the skilled artisan. For example, a nucleic acid that is to be expressed in a cell is operably-linked to a promoter for inducing expression in the cell. For example, the nucleic acid is linked to a promoter operable in a variety of cells of a subject, such as, for example, a viral promoter, e.g. , a CMV promoter (e.g. , a CMV-IE promoter) or a SV-40 promoter. Additional suitable promoters are known in the art and shall be taken to apply mutatis mutandis to the present example of the disclosure.
For example, the nucleic acid is provided in the form of an expression construct. As used herein, the term "expression construct" refers to a nucleic acid that has the ability to confer expression on a nucleic acid (e.g. a reporter gene and/or a counter-selectable reporter gene) to which it is operably connected, in a cell. Within the context of the present disclosure, it is to be understood that an expression construct may comprise or be a plasmid, bacteriophage, phagemid, cosmid, virus sub-genomic or genomic fragment, or other nucleic acid capable of maintaining and/or replicating heterologous DNA in an expressible format.
Methods for the construction of a suitable expression construct for performance of the disclosure will be apparent to the skilled artisan and are described, for example, in Ausubel et al (In: Current Protocols in Molecular Biology. Wiley I nterscience, ISBN 047 150338, 1987) or
Sambrook et al (In: Molecular Cloning: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, New York, Third Edition 2001 ).
Vectors suitable for such an expression construct are known in the art and/or described herein. The skilled artisan will be aware of additional vectors and sources of such vectors, such as, for example, Life Technologies Corporation, Clontech or Promega.
Binding agents
The binding agents according to the present disclosure may be non-antibody based binding agents or antibodies or proteins containing an antibody variable region.
Typical non-antibody based binding agents include peptides, peptidomimetics, nucleic acid aptamers, peptide aptamers, dendrimers and small organic molecules.
A nucleic acid aptamer (adaptable oligomer) is a nucleic acid molecule that is capable of forming a secondary and/or tertiary structure that provides the ability to bind to a molecular target. An aptamer library is produced, for example, by cloning random oligonucleotides into a vector (or an expression vector in the case of an RNA aptamer), wherein the random sequence is flanked by known sequences that provide the site of binding for PCR primers. An aptamer with increased activity is selected, for example, using SELEX (Sytematic Evolution of Ligands by Exponential enrichment). Suitable methods for producing and/or screening an aptamer library are described, for example, in Elloington and Szostak, Nature 346:818-22, 1990.
Techniques for synthesizing small organic compounds will vary considerably depending upon the compound, however such methods will be well known to those skilled in the art. In one embodiment, informatics is used to select suitable chemical building blocks from known compounds, for producing a combinatorial library. For example, QSAR (Quantitative Structure Activity Relationship) modelling approach uses linear regressions or regression trees of compound structures to determine suitability. The software of the Chemical Computing Group, Inc. (Montreal, Canada) uses high-throughput screening experimental data on active as well as inactive compounds, to create a probabilistic QSAR model, which is subsequently used to select lead compounds. The Binary QSAR method is based upon three characteristic properties of compounds that form a "descriptor" of the likelihood that a particular compound will or will not perform a required function: partial charge, molar refractivity (bonding interactions), and logP (lipophilicity of molecule). Each atom has a surface area in the molecule and it has these three properties associated with it. All atoms of a compound having a partial charge in a certain range are determined and the surface areas (Van der Walls Surface Area descriptor) are summed. The binary QSAR models are then used to make activity models or ADMET models, which are used to build a combinatorial library. Accordingly, lead
compounds identified in initial screens can be used to expand the list of compounds being screened to thereby identify highly active compounds.
Particularly preferred binding agents are antibodies or antigen binding fragments thereof or proteins comprising an antibody variable region. As used herein the term "antibody" refers to an immunoglobulin molecule capable of binding to a target, such as VCAM 1 or SI RPa and/or an epitope thereof and/or an immunogenic fragment thereof and/or a modified form thereof (e.g. , glycosylated) through at least one epitope recognition site, located in the variable region of the immunoglobulin molecule. This term encompasses not only intact polyclonal or monoclonal antibodies, but also variants, fusion proteins comprising an antibody portion with an epitope recognition site of the required specificity, humanized antibodies, human antibodies, chimeric antibodies, and any other modified configuration of the immunoglobulin molecule that comprises an epitope recognition site of the required specificity.
The term "antigen binding fragment" or "protein comprising an antibody variable region" shall be taken to mean any fragment of an antibody that retains the ability to bind to a target, such as VCAM 1 or SI RPa. Such fragments typically include Fab, Fab', (Fab')2, Fv, single chain antibody (e.g. scFv), single domain antibody (e.g. dAb). Methods of making these fragments are known in the art. See for example, Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbour Laboratory, New York (1988), incorporated herein by reference.
The term "monoclonal antibody" refers to a homogeneous antibody population capable of binding to the same antigen(s) and, preferably, to the same epitopic determinant within the antigen(s). This term is not intended to be limited as regards to the source of the antibody or the manner in which it is made.
The term "chimeric antibody" refers to antibodies in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species (e.g., murine, such as mouse) or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species (e.g. , primate, such as human) or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity (U.S. Patent No. 4, 816, 567; and Morrison et al. (1984) Proc. Natl Acad. Sci USA 87:6851-6855).
The term "humanized antibody" shall be understood to refer to a chimeric molecule, generally prepared using recombinant techniques, having an epitope binding site derived from an immunoglobulin from a non-human species and the remaining immunoglobulin structure of the molecule based upon the structure and/or sequence of a human immunoglobulin. The antigen- binding site preferably comprises the complementarity determining regions (CDRs) from the non-human antibody grafted onto appropriate framework regions in the variable
domains of human antibodies and the remaining regions from a human antibody. Epitope binding sites may be wild type or modified by one or more amino acid substitutions. It is known that the variable regions of both heavy and light chains contain three complementarity- determining regions (CDRs) which vary in response to the epitopes in question and determine binding capability, flanked by four framework regions (FRs) which are relatively conserved in a given species and which putatively provide a scaffolding for the CDRs. When nonhuman antibodies are prepared with respect to a particular epitope, the variable regions can be "reshaped" or "humanized" by grafting CDRs derived from nonhuman antibody on the FRs present in the human antibody to be modified. Application of this approach is known in the art. anti-VCAM 1 (Vascular Cell Adhesion Protein-1 ) Antibodies
Vascular cell adhesion protein 1 (also known as vascular cell adhesion molecule-1
(VCAM1 ) is a protein that in humans is encoded by the VCAM1 gene. The protein mediates the adhesion of lymphocytes, monocytes, eosinophils and basophils to vascular endothelium. It also functions in leukocyte-endothelial cell signal transduction, and it may play a role in the development of atherosclerosis and rheumatoid arthritis. The protein is an endothelial ligand for VLA-4 of the β1 subfamily of integrins, and for integrin α4β7.
The term "VCAM1 " as used herein is understood to include its aliases, including the following, vascular cell adhesion protein-1 , vascular cell adhesion molecule-1 , CD106, INCAM- 100, MGC9956, DKFZp779G2333, OTTHUMP00000012652, V-CAM, and L1 CAM. The term also includes other aliases by which VCAM1 is known which are not listed above.
Commercial antibodies to VCAM 1 are available from companies such as Covance,
Abeam, eBioscience, Cell Sciences and Santa Cruz Biotechnology. In one example, antibodies for use in the present invention are those that bind to human VCAM-1. I n another example, antibodies are those from Abeam for use in flow cytometry such as ab7224, ab7219, ab95139, ab47159, ab82438, ab24628, ab27352, and ab33228. anti-SIRP alpha antibodies
Signal regulatory protein alpha, (SIRP alpha, designated CD172a, or SIRPA), is a transmembrane glycoprotein belonging to the signal-regulatory-protein (SIRP) family within the immunoglobulin superfamily. SIRPa contains cytoplasmic ITI M domains and produces negative regulatory signals. Through adhesion to CD47/IAP (integrin-associated protein), SIRPa inhibits clearance of CD47hl young erythrocyte and platelets and promotes macrophage fusion during osteoclastogenesis. SIRPa recognition of surfactants SP-A and SP-D in the lung can inhibit alveolar macrophage cytokine production.
The term "SIRPa" as used herein is understood to include its aliases, including the following SIRPa 1 , SHPS, macrophage fusion receptor (MFR), SIRP, BIT, P84, MYD-1 , SHPS- 1 , MyD-1 antigen, inhibitory receptor SHPS-1 , PTPNS, CD172 antigen-like family member A (CD172a), and protein tyrosine phosphatase non-receptor type substrate 1. The term also includes other aliases by which SIRPa is known which are not listed above.
Commercial antibodies to SIRPa are available from companies such as Abeam, BioLegend, Abnova Corporation, R & D Systems, BD Biosciences, Cell Sciences, GeneTex, GenWay Biotech, I nc, Santa Cruz Biotechnology, Inc, and Sigma-Aldrich. In one example, antibodies for use in the present invention are those that bind to human SIRPa. IN antoher example, antibodies are those from BioLegend for use in flow cytometry such as clone SE5A5, or clone 148.
Drug Screening
The cardiomyocytes according to the present disclosure can be used to screen for factors (e.g. solvents, small molecule drugs, peptides, oligonucleotides) or environmental conditions (e.g. cell culture) that affect the characteristics of the cells.
One application of the disclosure herein relates to the testing of pharmaceutical compounds for their effect on cardiac muscle tissue maintenance or repair. Screening may be done either because the compound is designed to have a pharmacological effect on the cell, or because a compound designed to have effects elsewhere may have unintended side effects on cardiomyocytes. The screening is preferably done using the enriched VACM-1+/ SI RPa+ double positive cells of the present disclosure.
Assessment of the activity of a candidate pharmaceutical compound generally involves combining the cells of the present disclosure with the candidate compound, either alone or in combination with other drugs. A determination is then made of any change in the morphology, marker phenotype or functional activity of the cells that is attributable to the compound
(compared with control untreated cells) and then the effect(s) of the compound correlated with the observed change.
Cytotoxicity can be determined by the effect on cell viability, survival, morphology and the expression of certain markers and receptors. Effects of a compound on chromosomal DNA can be determined by measuring DNA synthesis or repair. An example includes measuring BrdU incorporation. Unwanted effects can also include unusual rates of sister chromatid exchange, determined by metaphase spread.
Effect on cell function can be assessed using any standard assay to observe phenotype or activity of cardiomyocytes, such as marker expression, receptor binding, contractile activity
or electrophysiology. Where an effects is observed, the concentration of the compound can be titrated to determine the median effective dose (ED50).
Agents of interest for screening include known and unknown compounds that encompass numerous chemical classes, primarily organic molecules, which may include organometallic molecules, inorganic molecules, genetic sequences etc. Candidate agents are also found biomolecules, including peptides, polynucleotides, sacchardies, fatty acids, steroids, purine, pyrimidines, derivatives, structural analogs or combinations thereof.
Included are pharmacologically active drugs, genetically active molecules, etc. Compounds of interest include chemotherapeutic agents, hormones or hormone antagonists, etc. Exemplary of pharmaceutical agents suitable for this invention are those described in, "The Pharmacological Basis of Therapeutics," Goodman and Gilman, McGraw-Hill, New York, New York, (1996), Ninth edition, under the sections: Water, Salts and Ions; Drugs Affecting Renal Function and Electrolyte Metabolism; Drugs Affecting Gastrointestinal Function; Chemotherapy of Microbial Diseases; Chemotherapy of Neoplastic Diseases; Drugs Acting on Blood-Forming organs; Hormones and Hormone Antagonists; Vitamins, Dermatology; and Toxicology, all incorporated herein by reference. Also included are toxins, and biological and chemical warfare agents, for example see Somani, S. M. (Ed. ), "Chemical Warfare Agents," Academic Press, New York, 1992).
Test compounds include all of the classes of molecules described above, and may further comprise samples of unknown content. Of interest are complex mixtures of naturally occurring compounds derived from natural sources such as plants.
Functional analysis of disease specific iPS cells
The present disclosure also provides a mechanism for conducting a functional analysis of disease specific induced pluripotent stem (iPS) cells. iPS cells are generally derived by transfection of certain stem-cell associated genes into non-pluri potent cells such as adult fibroblasts. Transfection is achieved through viral vectors bearing the genes Oct-3/4 and Sox2 and may include others that enhance the efficiency of induction. After 3-4 weeks, transfected cells begin to become morphologically and biochemically similar to pluripotent stem cells, and are usually isolated through morphological selection, doubling time, or through a reporter gene and antibiotic selection. Examples of methods to generate iPS cells can be found in Yu J et al. , Science 318(5850), 1917-1920 (2007) and Takahashi K et al. , Cell 131 (5), 861-872 (2007).
For example, patient-specific human iPS cells can be produced from a subject suffering from a cardiac disorder such as long QT syndrome. Congenital long QT syndrome is a familial arrhythmogenic syndrome characterised by abnormal ion channel function and sudden cardiac death (Goldenberg I et al., J. Am. Coll. Cardiol. 51 , 2291 -2300 (2008)). The subject specific
iPS cells can then be coaxed to differentiate into the cardiac lineage, for example using embryoid body differentiation. The method of the present disclosure can then be applied to enrich for VCAM 1+, or SIRPa+ or VCAM 1+/SIRPa+ expressing cardiomyocytes. The functionality of the cells can then be determined by examining one or more of the following: expression of cardiac specific transcription factors (e.g. NKX2-5), structural genes (e.g. MYL2, MYH6 and MYH7, KCNH2), chronotropic responses, ion channel function, and electrophysiology (including arrhymogenicity). The cells can also be used to evaluate drugs that may either ameliorate or aggravate the disease phenotype.
Persons skilled in the art would be aware of other cardiac disorders and/or channelopathies that can be investigated using the above method including idiopathic ventricular fibrillation in which previously well individuals die suddenly of a tachyarrhythmia; heart failure in which affected individuals suffer from a decreased ability to exercise and shortness of breath caused by a decrease in cardiac pump function; atrial fibrillation etc. Therapeutic use
The present disclosure also provides for the use of the cardiomyocyte cells of the invention to enhance tissue maintenance or repair of cardiac muscle in a human patient or other subject in need of such treatment.
To determine the suitability of cell compositions for therapeutic administration, the cells are first tested in an animal model. The cells can be administered to immunodeficient animals. Tissues are harvested after a period of regrowth, and assessed as to whether they are still present. The cells can be labelled with a detectable label e.g. green fluorescent protein. The presence of the administered cells can be assessed by immunohistochemistry or ELISA.
Suitability can be determined by assessing the degree of cardiac recuperation that ensures from treatment of the cells of the invention. For example, hearts can be cryoinjured by placing a placing a precooled aluminium rod in contact with the surface of the anterior left ventricle wall, or by placing a 30-50mm copper disk probe cooled in liquid nitrogen on the anterior wall of the left ventricle. Infarction can be induced by ligating the left main coronary artery. I njured sites are treated with cell preparations of this disclosure and the heart tissue examined by histology for the presence of the cells in the damaged area. Cardiac function can be monitored by determining such parameters as left ventricular end diastolic pressure, developed pressure, rate of pressure rise, and rate of pressure decay.
The cardiomyocyte cells of the present disclosure can be used for tissue reconstitution or regeneration in a human subject or other subject by administering in a manner that permits then to graft or migrate to the intended tissue site and reconstitute or regenerate the functionally deficient area. Special devices are available that are adapted for administering
cells capable of reconstituting cardiac function directly to the chambers of the heart, the pericardium, or the interior of the cardiac muscle at the desired location. The cells may be administered to a recipient heart by intracoronary injection, e.g. into the coronary circulation. The cells may also be administered by intramuscular injection into the wall of the heart.
Subjects which are suitable candidates for treatment according to the methods of the present disclosure include those with acute or chronic heart conditions of various kinds, including coronary heart disease, cardiomyopathy, endocarditis, congenital cardiovascular defects and congestive heart failure.
In one example, the enriched cardiomyocyte cells of the present disclosure are administered to a subject suffering from myocardial infarction. For example, the injected cells migrate to the infracted myocardium. The cardiomyocytes assemble into myocardium tissue resulting in repair or regeneration of the infracted myocardium.
In another example, the enriched cardiomyocyte cells of the present disclosure are administered to a subject suffering from heart failure, wherein the mount is effective in at least partially restoring cardiac function. Heart failure can be considered as a progressive disease of apoptotically-mediated cardiomyocyte loss that eventually results in an impaired functional capacity of the cardiac muscle.
Efficacy of treatment can be monitored by clinically accepted criteria, such as reduction in area occupied by scar tissue or revascularisation of scar tissue, and in the frequency and severity of angina; or an improvement in developed pressure, systolic pressure, end diastolic pressure, Apressure/Atime, patient mobility and quality of life.
Treatment of subjects with enriched SIRPa+, VCAM 1+, or VCAM 1 +/SIRPa+ cells of the present disclosure according to any of the above described methods may be used in conjunction with other procedures such as surgery.
Pharmaceutical compositions
The purified cardiomyocyte cells of the present disclosure can be supplied in the form of a pharmaceutical composition, comprising a carrier or excipient. The choice of excipient or other elements of the composition can be adapted in accordance with the route and device used for administration.
The terms "carrier" and "excipient" refer to compositions of matter that are conventionally used in the art to facilitate the storage, administration, and/or the biological activity of an active compound (see, e.g. , Remington's Pharmaceutical Sciences, 16th Ed. , Mac Publishing Company (1980). A carrier may also reduce any undesirable side effects of the active compound. A suitable carrier is, for example, stable, e.g. , incapable of reacting with other ingredients in the carrier. I n one example, the carrier does not produce significant local or
systemic adverse effect in recipients at the dosages and concentrations employed for treatment.
The carrier or excipient can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (i. e. glycerol, propylene, glycol and liquid polyethylene glycol and the like), suitable mixtures thereof and/or vegetable oils. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. It may also be preferable to include isotonic agents e.g. sugars or sodium chloride. Stabilising agents can also be added to protect the composition from loss of therapeutic activity. Examples include buffers, amino acids e.g. lysine, carbohydrates such as dextrose, mannose, galactose, fructose, lactose, sucrose, maltose, sorbitol, mannitol etc.
In another example, a carrier is a media composition, e.g. , in which a cell is grown or suspended. For example, such a media composition does not induce any adverse effects in a subject to whom it is administered.
Exemplary carriers and excipients do not adversely affect the viability of a cell and/or the ability of a cell to function as a cardiomyocyte.
In one example, the carrier or excipient provides a buffering activity to maintain the cells and/or soluble factors at a suitable pH to thereby exert a biological activity, e.g., the carrier or excipient is phosphate buffered saline (PBS). PBS represents an attractive carrier or excipient because it interacts with cells and factors minimally and permits rapid release of the cells and factors, in such a case, the composition of the disclosure may be produced as a liquid for direct application to the blood stream or into a tissue or a region surrounding or adjacent to a tissue, e.g. , by injection.
The composition may also comprises or be accompanied with one or more other ingredients that facilitate the engraftment or functional mobilisation of the cells. Suitable ingredients include matrix proteins or gel polymer that support or promote adhesion of the cells or complementary cell types, especially endothelial cells.
A variety of different scaffolds may be used successfully in the practice of the disclosure. Exemplary scaffolds include, but are not limited to biological, degradable scaffolds. Natural biodegradable scaffolds include collagen, fibronectin, and laminin scaffolds. Suitable synthetic material for a cell transplantation scaffold should be able to support extensive cell growth and cell function. Such scaffolds may also be resorbable. Suitable scaffolds include polyglycolic acid scaffolds, e.g. , as described by Vacanti, ef al. J. Ped. Surg. 23:3-9 1988;
Cima, ef al. Biotechnol. Bioeng. 38: 145 1991 ; Vacanti, ef al. Plast. Reconstr. Surg. 88:753-9 1991 ; or synthetic polymers such as polyanhydrides, polyorthoesters, and polylactic acid.
In another example, the cells may be administered in a gel scaffold (such as Gelfoam from Upjohn Company.
The purified cardiomyocyte cells can be combined with the carrier or excipient in any convenient or practical manner e.g. suspension, emulsification, admixture, encapsulation, absorption and the like.
The compositions described herein may be administered alone or as admixtures with other cells. Cells that may be administered in conjunction with the compositions of the present disclosure include, but are not limited to, other multipotent or pluripotent cells or stem cells, or bone marrow cells. The cells of different types may be admixed with a composition of the disclosure immediately or shortly prior to administration, or they may be co-cultured together for a period of time prior to administration.
The exact amount of cells to be administered is dependent upon a variety of factors, including the age, weight, and sex of the patient, and the extent and severity of the condition to be treated.
In some instances it may be desirable or appropriate to pharmacologically immunosuppress a subject prior to initiating cell therapy and/or reduce an immune response of a subject against the cellular composition. Means for reducing or eliminating an immune response to the transplanted cells are known in the art. As an alternative, the cells may be genetically modified to reduce their immunogenicity.
In another example, the purified cardiomyocytes may be administered with other beneficial drugs or biological molecules (growth factors, trophic factors). When administered with other agents, they may be administered together in a single pharmaceutical compositions, or in separate pharmaceutical compositions, simultaneously or sequentially with other agents (either before or after administration of the other agents).
The present disclosure also provides medical devices for use or when used in a method as described herein according to any example. For example, the present disclosure provides a syringe or catheter or other suitable delivery device comprising purified cardiomyocytes or a composition according to the present disclosure. Optionally, the syringe or catheter is packaged with instructions for use in a method as described herein according to any example.
The purified cardiomyocytes or pharmaceutical compositions disclosed herein may be surgically implanted, injected, delivered (e.g. by way of a catheter or syringe), or otherwise administered directly or indirectly to the site in need of repair or augmentation. Exemplary routes of parenteral administration include intravenous, intra-arterial, intramuscular, intraperitoneal, intramyocardial, transendocardial, transepicardial, intranasal or intrathecal, and infusion techniques.
Intra-arterial administration includes delivery into an aorta, into an atrium or ventricle of the heart or into a blood vessel. In the case of cell delivery to an atrium or ventricle of the heart, cells can be administered to the left atrium or ventricle to avoid complications that may arise from rapid delivery of cells to the lungs.
Kits
The purified cardiomyocytes or compositions disclosed herein may optionally be packaged in a suitable container with written instructions for a desired purpose, such as the reconstitution of cardiomyocyte cell function to improve some abnormality of the cardiac muscle or for use in screening or diagnostic applications.
The present disclosure also extends to a kit comprising a binding agent for VCAM 1 and/or a binding agent for SIPRa. The components of the kit may be packaged with in aqueous media or in lyophilised form. The kit will typically also contain instructions for use. It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the invention as shown in the specific embodiments without departing from the scope of the invention as broadly described. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.
METHODS
NKX2-5 gene targeting:
The 5' homology arm of the NKX2-5 targeting vector was cloned from BAC RP11 - 466H21 (Roswell Park Cancer Institute; Osoegawa, K et al., Genome Res 11 (3), 483 (2001 )) by recombineering (www.genebridges.com). The 3' homology arm was amplified by PCR with oligonucleotides (2-5RarmAsiSls gcgatcgccgcccttctcagtcaaagacatcc & 2-5 RarmAsiSlas gcgatcgcttccacgggcgtgtggcacttaccc) introducing AsiSI restriction sites to facilitate sub-cloning into the targeting vector. The final vector comprised a 7.9 kb 5' homology arm, eGFP (Invitrogen), loxP-flanked G418 resistance cassette and a 4.2 kb 3' homology arm. The targeting vector was linearized by Pad digestion and electroporated into hESCs as described (Costa M et al. , Nat Protoc. 2(4), 792 (2007)). Targeted clones were identified using a 3' homology arm PCR screening strategy utilizing the primers Neo4 (cgatgcctgcttgccgaatatcatg - p1 ) and NKX2-5 RarmRev (cttgtatcctactgtgtccagtgg - p2), a primer complementary to genomic sequences immediately 3' of the targeting vector (Fig. 2). Seven (out of 164) correctly targeted clones were obtained and subclones of these in which the loxP flanked neomycin resistance cassette was excised using Cre-recombinase (Davis RP et al., Nat. Protoc 3(10), 1550 (2008)) were identified using primers GFP4 (gtgcagctcgccgaccactaccag - p3) and NKX2-5 RarmRev (p2). Homologous integration of the 5' homology arm was confirmed by PCR amplification using primers GFPrev (gtcgccgtccagctcgaccaggatg-p4) and NKX2-5 LarmFwd (gacactggtgcatcctgttagagg - p5) (Fig. 2). Two independent hESC lines, HES3 (Reubinoff, BE et al. , Nay Biotechnol 18(4), 399 (2000)) and MEL 1 (Millipore) were targeted in this manner to generate H3 NKX2-5GFPA" and M1 NKX2-5GFPM, respectively. All NKX2-5GFPM clones contained a single integration event, expressed markers of undifferentiated hESCs, were karyotypically normal and formed teratomas following injection of undifferentiated cells in testes of immunodeficient mice (Fig. 2). Karyotyping was performed by Southern Cross Pathology Australia located at the Monash Medical Centre and a total of 20 metaphase chromosome spreads was examined for each line. Animal experimentation was performed under the auspices and approval of the Monash University School of Biomedical Sciences animal ethics committee (approval number SOBSAI MIS/2009/107) or the Walter and Eliza Hall Institutes animal ethics committee (approval number 2009.015). hESC cell culture and differentiation:
hESC /V X2-5GFP/,V cells were cultured on 75 cm2 tissue culture flasks (Falcon, BD Biosciences) and passaged using TrypLE Select (Invitrogen Corporation) as described (Costa et al. , supra). One day before differentiation, cells were passaged onto a new flask seeded with irradiated MEFs at low density (1 x 104 cm"2). Forced aggregation of hESC to form spin
embryoid bodies (EBs) was performed as previously described (Ng et al. , Nat Protoc. 3(5), 768 (2008); Ng et al. , Blood 106(5), 1601 (2005)). Briefly, at day (d) 0 cells were harvested and resuspended at 6 x 104 cells ml"1 in LI-APEL medium (1 μg ml"1 INSULIN) containing 20-40 ng ml"1 of BMP4 (R&D Systems) and 20 ng ml"1 ACTIVI N A (R&D Systems), 30 ng ml"1 VEGF (PeproTech), 40 ng ml"1 SCF (PeproTech), (Pick M et al. , Stem Cells 25(9), 2206 (2007)) and 50 to 80 ng ml"1 WNT3A (Millipore) and 50 μΙ of this mix was placed into each well of a 96 well round bottomed non-adherent plate, and briefly centrifuged (3 min at 480 g) yielding EBs composed of 3000 cells. At d3 the differentiation media was replaced with LI- APEL without growth factors and at d7 EBs were transferred to 96 well flat bottom tissue culture plates in Ll- AEL (APEL without Polyvinylalcohol) or LI-BEL (BSA used as a low cost replacement for recombinant human albumin). The removal of growth factors at d3 greatly improved cardiac differentiation (Figure 5b). For negative control experiments NKX2-i FP w cells were differentiated in FGF2 (Protech) at 100 ng ml"1 from dO to d7. The inventors have previously shown that FGF2 prevents mesoderm formation (Davis RP et al., Blood 1 11 (4), 1876 (2008)) and promotes neuroectoderm differentiation (Goulburn AL et al Stem Cells 29(3), 462 (201 1 )). hESC-CPCs and hESC-CMs were also derived using the END2 co-culture system, as previously described (Mummery C et al. , Circulation 107(21 ), 2733 (2003); Passier R et al. , Stem Cells 23 (6), 772 (2005)).
For monolayer differentiation, 5 to 10 x 104 NKX2-5GFP/W hESC cells were plated per well of a Matrigel (BO Biosciences; Growth Factor Reduced, Phenol Red Free) coated 6 well tissue culture plate in 3 ml hESC media. After 24 hours the media was changed to LI-APEL with the same cytokine cocktail described above, this time point was designated as dO. At d3 of differentiation the media was changed to LI-APEL and differentiation was allowed to proceed without further addition of exogenous cytokines. Comparable results were obtained with hESCs passaged on MEF feeder layers (Fig 4c, e-f) or in feeder-free Matrigel cultures in mTeSRI (Stem Cell Technologies) media.
Clonal growth assays of NKX2-i FP+ cells:
Single cell cloning was performed using the single cell deposition function of a FACSAria or a BD Influx cell sorter (Monash Flowcore). Briefly, GFP+ cells from dissociated d7 EBs were deposited at 1 , 3, 10 or 30 cells per well of a 96 well plate. After 7 days in culture in LI-APEL wells were scored for colonies with greater than 8 cells. Data shown are the results of three independent experiments performed in duplicate. Cells were fixed and stained as described below (immunohistochemistry).
To examine the differentiation capacity of NKX2-5GFP* cells, individual GFP+ cells from d6 EBs (the earliest time point for GFP expression) were deposited in individual wells of 96 well plates. Cells were plated in LI-BEL supplemented with PDGFA B (50 ng ml"1 , R & D systems), WNT3a (50 ng ml"1 ), VEGF (25 ng ml"1 ), FGF2 (5 ng ml"1 ) and BMP4 (20 ng ml"1). Media was changed on d3. On d7 post-sorting cell clusters were scored for GFP and beating. Cells were then fixed and stained for GFP (Abeam, ab13970), CALPONIN and PECAM as described below.
Immunohistochemistry:
EBs, grown on coverslips, and single cell clones were fixed in 4% paraformaldehyde (PFA) and permeablised with 0.1 % Triton-X 100 in phosphate buffered saline (PBS) and blocked with 1 % normal goat serum in PBS. Samples were incubated with primary antibodies directed against a-ACTIN IN (clone EA53, Sigma), PECAM (DAKO), SMOOTH MUSCLE ACTIN (Abeam or DAKO), NKX2-5 (Abeam), MLC2V (Synaptic Systems), MLC2A (Synaptic Systems), MYH6 (Chemicon), GATA4 (Santa Cruz), and CALPONIN (EP798Y, Abeam). Primary antibodies were detected with either goat anti-mouse or anti-rabbit immunoglobulin G conjugated to Alexa-405, -568, or -647 (Invitrogen) or donkey anti-chicken immunoglobulin G conjugated to Alexa-405. Fluorescence images were captured on a Zeiss Axiovert 200 microscope fitted with an Axiocam HRc digital camera. Confocal images were collected on either a Leica SP5 or Nikon C1 confocal laser scanning microscope (40x and 63x oil immersion objectives, Monash Microimaging).
For live cell imaging, cells were cultured on MatTek dishes (MatTek Corp. Amsterdam) and imaged on a Leica SP5 using the resonance scanner at a resolution of 512x256 (30fps). For calcium imaging, cells were loaded with Fura Red (Molecular Probes, Invitrogen). The 488nm laser was used to excite GFP and Fura Red (calcium free). Two PMTs were used simultaneously for detecting GFP and Fura Red specific photons respectively. Fura Red fluorescence normalization to GFP and data analysis was performed with ImageJ software.
For the immunohistochemistry analysis shown in Figure 11 , three cell fractions from day 10 or day 14 EBs, GFP+SIRPa+VCAM 1+ (GSV+), GFP+SIRPa+VCAM 1" (GS+), and GFP" VCAM 1"SIRPA" (TN), were used. These fractions were allowed to adhere to serum coated plastic cover slips in BEL media containing 20% fetal bovine serum. After 24 hours, fractions were fixed by incubation with 5% PFA in PBS for 5 minutes and permeabilised using 0.1 % Triton in PBS (5 minute incubation). Cells were then blocked by incubation with 10% normal goat serum in PBS for 30 minutes at room temperature. Primary labelling of cells was performed using both anti-Cardiac tryponin type 2 (TNNT2) and anti-GFP. Primary labelling was detected with Alexa-488 (anti-GFP) and Alexa-568 (anti-TNNT2). Three washes with PBS were performed between each stain. Coverslips were treated with Prolong Gold® Antifade +
DAPI (Invitrogen) before imaging. Confocal imaging was performed on either a Zeiss Axiovert or Nikon C1 (Monash Microimaging).
Flow cytometry:
hESCs and EBs were dissociated using TrypLE Select™ (I nvitrogen) and filtered through a 40 μηι cell strainer (Falcon). Mouse anti-human primary antibodies reacting to cell surface antigens anti-E-CADHERIN (Zymed), anti-TRA-1-60, anti-SSEA4 (both from Chemicon), anti-KDR (Invitrogen), anti-SIRPA (Biolegend), anti-PDGFRa, anti-VCAM 1 , FITC- conjugated anti-CD9, phycoerythrin (PE) conjugated anti-CXCR4 (all from BD Biosciences), and biotin-conjugated anti-VCAM 1 (Abeam). Intracellular flow cytometry with anti-OCT 4 (Santa Cruz Biotechnology) was performed as previously described (Ng ES et al., Blood 106(5), 1601 (2005)). Unconjugated antibodies were detected with allophycocyanin (APC)-conjugated goat anti-mouse IgG (BO Biosciences), biotinylated antibodies were detected with Streptavidin-PE (BO Bioscencies). Live cells were gated on the basis of side scatter, forward scatter and propidium iodide exclusion. Flow cytometric gates were set using control cells labeled with the appropriate isotype control antibody. Analyses were carried out using a FACScalibur flow cytometer (Becton Dickinson). Cells were sorted from EBs using either a FACSDiva or BD Influx cell sorter (Monash Flowcore)
To quantify BMP4 and ACTIVIN A induced cardiac differentiation, 96 well plates of EBs were harvested on d10 of differentiation. EBs from four replicate plates were dissociated in TrypLE Select™ (Invitrogen), filtered across a 40 μηι cell strainer (Falcon) and pooled. The resultant single cell suspensions were resuspended in FACS wash (Phosphate Buffered Saline with 2% foetal calf serum) containing propidium iodide. Plates were analysed for GFP expression using the BD™ High Throughput Sampler on the LSRI I flow cytometer (Becton Dickinson). Live cell gates were established as above.
Gene expression analysis:
RNA was prepared using the High Pure RNA Isolation Kit according to manufacturer's instructions (Roche). Gene expression was examined on the l llumina HumanWG-6 v3.0 BeadChip at the Australian Genome Research Facility. Labelling, hybridization and scanning was performed in accordance with manufacturer's instructions. Expression profiles were established from three independent samples for d7 GFP+, d7 GFP", d14 GFPPDGFRa", d14 GFP"PDGFRa+ and d14 GFP+PDGFRa+ populations sorted from spin EBs and d8 and d13 GFP+ and GFP" populations sorted from END2 co-cultures. PDGFRa is a surface receptor with a known role in mesoderm development and cardiogenesis (Prall, OW et al. , Cell 128(5), 947 (2007)) Samples from fetal heart at 9, 10 and 12 weeks, adult heart and two independent late-
stage heart failure samples were also analysed by microarray. Data was analyzed using Beadstudio Gene Expression Module v3.4 (l l lumina) using average normalization across all samples with further analysis performed using GeneSpring (Agilent). For quantitative real time PCR (Q-PCR) RNA samples were reverse transcribed using Superscript® I I I (Invitrogen) and relative gene expression levels determined by Taqman assays as described (David, RP et al. , Blood 11 1 (4), 1876 (2008)).
Human fetal tissues were obtained following therapeutic termination of pregnancies, at Monash Medical Centre, with appropriate consents. The experiments were conducted according to the guidelines and approval of the Southern Health Human Research Ethics Committee (Number 08056B), Monash University Human Research Ethics Committee (Number CF08/2177), Leiden University Medical Centre Medical Ethics Committee (P08.0B7/Sh/sh). Adult human ventricular myocardial samples were from unused donor hearts and from end- stage failing hearts in patients undergoing heart transplantation. Samples were snap frozen in liquid N2 at the time of collection. Tissue was obtained with the approval of the Baker/IDI Heart and Diabetes Institute Institutional Ethics Committee.
Electrophvsioloqy:
Patch clamp electrophysiology was carried out as described previously, with minor modifications (Graichen R et al., Differentiation 76(4), 357 (2007)). Briefly, beating clumps of cardiomyocytes were dissociated using TrypLE select, replated on gelatin- coated coverslips and measured in current clamp mode between 7 and 14 days after plating. For multiple electrode array (MEA) electrophysiology, contractile hESC-CM clusters were micro-dissected and transferred to plasma cleaned fibronectin-coated 60 electrode MEAs. Extracellular recording was performed using a MEA1060INV MEA amplifier (Multi Channel Systems, Reutlingen, Germany) at 37°C. Output signals were digitized at 10kHz by use of a PC equipped with a MC-card data acquisition board (Multi Channel Systems, Reutlingen, Germany).
Pharmacology:
Contractile regions were recorded through a Nikon Eclipse TS100 inverted microscope with Hoffman modulation contrast optics, coupled to a Basler (model A602f) camera and captured using Quick Caliper (SDR Clinical Technologies) software at 80 frames/second. Analysis was performed using the Metamorph® Imaging System (Molecular Devices Ltd) to establish contraction amplitude and frequency. Briefly, the intensity centroid of a selected particle was tracked throughout a 10 second (s) image stack. The amplitude of contraction of the selected particle (in pixels) was plotted against time for each time point. The number of peaks within the 10s was converted to beats per minute to represent the contraction frequency.
Baseline contractions were recorded for 10s prior to the incubation with forskolin (1 μΜ for 2 min) or endothelin-1 (ET-1 ; 10nM, for 5 min), isoprenaline (Iso; 1 μΜ, for 10 min), Angiotensin (Angl l; 100 nM for 20 min), Carachol (1 μΜ, for 5 mins) or vehicle controls. Following this incubation, a further 10s recording was taken. The data are presented as a percentage of the basal spontaneous rate (i.e. prior to agonist addition). ET-1 was dissolved in physiological salt solution (PSS) buffer consisting of 140 mM NaCI , 6 mM KCI, 2 mM CaCI2, 1 mM MgCI2, 20 mM HEPES and 10% glucose, supplemented with 1.4 % (w/v) BSA (pH 7.4, 37°C). Forskolin was dissolved in ethanol and the final ethanol concentration did not exceed 0.01 % of the media volume in the well. Mean responses to endothelin-1 , angiotensin II and carbachol were analysed using one-way ANOVA, post-hoc Dunnett's (n=3-4). Mean responses to forskolin and isoprenaline were analysed using Student's t-test (n=5-7). Values of PO.05 were considered statistically significant.
Re-culture experiments:
Re-aggregates of cell fractions from FACS were formed by centrifuging cells (for 5 minutes at 478 RCF) suspended in LI-APEL media at 5000 cells per well of low-adherent U bottom 96 well plates. Re-aggregates were left for 4 days until re-analysis by flow cytometry. Adherent cultures of cell fractions from day 7 FACS were formed by plating 5000 cells per well of adherent flat bottom 96 well plates in LI-APEL media. Adherent cultures were left for 7, 11 and 14 days until re-analysis by flow cytometry.
Functional Analysis:
Three cell fractions from day 10 EBs, GFP+SIRPa+VCAM 1 + (GSV+), GFP+SIRPa+VCAM 1 " (GS+), and GFP"VCAM1 "SIRPA" (TN), were used for functional analysis. These fractions were plated onto FBS coated adherent flat-96-well plates (4 wells per plate, 5000 cells per well) in LI-BEL media. Cells were analysed at 3, 5 or 6 days post-plating 30 minutes prior to analysis of a plate, fluorescent calcium sensor, Fluo 4 (Invitrogen) was added to the wells. Ca2+ flux was measured by the rate and pattern in fluorescent fluctuation of a cell. Only those cells displaying oscillating fluorescence were considered to be spontaneous active (contractile). Presence of spontaneous activity for each cell was measured for 10 minutes and used as the basal Ca2+ flux. After 10 minutes either 1 μΜ of Isoprenaline, or an isoprenaline vehicle control, was added to the well. Change in fluorescent fluctuation was measured for a further 10 minutes and tested for significance against the basal Ca2+ flux.
EXPERIMENTAL
Example 1 Generation and characterisation of NKX2-5GFPA|V hESCs for isolation of human cardiac progenitors and cardiomyocytes.
To enable the identification, purification and characterisation of hESC-derived committed cardiac progenitor cells (hESC-CPCs) and cardiomyocytes (hESC-CMs), sequences encoding enhanced green fluorescent protein (eGFP) were introduced into the NKX2-5 locus of human embryonic stem cells (hESCs) by homologous recombination (Figures 1 a and 2a). NKX2-5GFP/W hESCs differentiated as spin embryoid bodies (EBs) or by co-culture with END2 cells developed GFP+ contractile areas at day (d) 8 (END2) or d9 (EB) respectively (Figure 1 b, c & I). Quantitative (Q) PCR analysis showed d14 GFP+ cells purified by flow cytometry were enriched for cardiac markers {NKX2-5, TBX5, GATA4, NPPA, MYL7, MYH7) (Figure 1d).
Immunofluorescence analysis demonstrated that GFP+ cells expressed nuclear localized NKX2-5 confirming that GFP fluorescence faithfully reported NKX2-5 expression. GFP+ beating foci also expressed the cardiac transcription factors GATA4 and ISL 1 and the myofilament components a-actinin, cardiac ventricular myosin light chain 2 (MYL2) and regulatory myosin light chain 7 (MYL7) (Fig. 1 e-k).
The GFP+ population isolated from EBs and END2 co-cultures contained progenitors that gave rise to CMs (GFP+), endothelial and smooth muscle cells (GFP"). Limit dilution analysis revealed that approx 1.4% of d7 GFP+ cells produced colonies, and of these 23 + 9.2% (N=3) remained contractile and GFP+. Non-contractile, GFP" clusters expressed the smooth muscle marker CALPONIN (CNN1 ), or the endothelial marker, PECAM. Similarly, the clonal frequency in single cell deposition experiments was 1.5% (24 of 1632), of which 8% were GFP+, 29% were CNN1+ and 58% expressed both. Thus, although most d6 GFP+ cells were bipotential, there is a possibility that some NKX2-5GFP W were tripotent cardiovascular progenitors.
The majority of END2 co-culture derived hESC-CMs displayed a fetal ventricular-like action potential (Figure 11 and Figure 3a and Table 1 ). Table 1 Patch clamp measurements from H3 NKX2-5GFPM GFP+ END2 co-culture derived cardiomyocytes.
Measurement Ave. ± stdev (N=16)
Upstroke velocity (V/s) 6.4±2.3
90 % Repolarization (ms) 522.6±199.6
Amplitude (mV) 88.8±6.6
Resting Membrane Potential (mV) | -43.5±5.7
To establish that excitation-coupling of GFP+ hESC-CMs was driven by calcium signalling, the inventors imaged changes in intracellular calcium across the contraction cycle. This analysis showed that NKX2-5GFP/W CMs exhibited transients similar to that observed in other hESC-CMs (Figure 3b) (Satin J et al., Stem Cells 26(8), 1961 (2008)). Furthermore, the contraction rate of NKX2-i FP/w EBs increased following treatment with angiotensin I I and forskolin whereas the muscarinic agonist Carbachol decreased the beating rate (Figure 3d). Tratment with endothelin 1 (ET-1 ), which elevates intracellular calcium, or activation of the β- adrenergic pathway with isoprenaline increased contractility to the same extent in both NKX2- FPM and NKX2-5wA" EBs (Figure 3e). Therefore, N X2-5GFP/W hESCs differentiate into functional CMs that display electrical properties, chronotropic and ionotropic responses similar to those reported for wild type hESC-CMs (Kehat I et al., J Clin I nvest 108(3), 407 (2001 ); Dick E et al. , Biochem Soc Trans 38(4): 1037 (2010)).
Variable results have been observed with BMP4/ ACTIVIN-A driven cardiac differentiation performed in bovine serum albumin containing medium (Paige SL et al. , PLoS ONE 5(6), e1 1134 (2010)). Therefore NKX2-5GFFYw hESCs were used to examine combinations of these factors that favour CM production in the fully defined recombinant protein based medium, albumin polyvinylalcohol essential lipids (APEL) medium(Ng ES et al. , Nat Protoc 3(5), 768 (2008)). Spin EBs were formed in 96-well plates in low insulin (L1 )-APEL (1 g/ml INSULIN) supplemented with VEGF (Yang L et al., Nature 453 (7194), 524 (2008), SCF, WNT3a (Paige SL et al, supra; Bu L et al. Nature 460(7251 ), 113 (2009)) and varying concentrations of both BMP4 and ACTIVI N A (Yao S et al, Proc Natl Acad Sci USA 103(18), 6907 (2006); Burridge PW et al, Stem Cells 25(4), 929 (2007); Yang L et al, Nature 453 (7194), 524 (2008); Laflamme MA et al, Nat Biotechnol 25(9), 1015 (2007)) (Figure. 4a). In this assay, each EB was subjected to a different concentration of BMP4 and ACTIVIN-A as indicated (Fig. 4b). GFP+ contracting areas were scored visually and quantified by flow cytometry (d10) to generate a heat map for two independently derived NKX2-5GFPM hESC lines (Figure 4b and Figure 5c-e). Comparable heat maps were observed with d7 EBs, a timepoint preceding strong expression of myofilament proteins and the onset of contractility (Figure 5f). Mesendoderm was induced by a range of BMP4/ ACTIVIN-A concentrations, however, a 1 : 1 - 1 :2 ratio of BMP4:ACTIVIN-A was found to be optimal for cardiogenesis, in two independent laboratories (Figure 4b, Figure 5 a-h). Therefore, 20 or 40 ng/ml of both BMP4 and ACTIVIN A were used to generate GFP+ cells. Researchers in both laboratories also confirmed that WNT3a (dO-3) increased CM yield (Figure 5h). Under these conditions, 96.4 ± 4.2% (n=5) of H3 NKX2-5GFP/W EBs included contractile foci. GFP+ cells were evident as early as d6 (Fig. 4c)
whereas EBs formed in FGF2 never expressed GFP (Fig. 4c). The frequency of GFP+ cells (26.8 ± 7.0 %; n=4) peaked at differentiation d10 and GFP+ contracting areas were retained in EBs cultured for over 120 days (Figure 4d and Fig. 5i-k). Applying the above conditions to hESC monolayers (Paige SL et al supra; Laflamme MA et al., Nat Biotechnol 25(9), 1015 (2007)) (Fig 4a) suggested a comparable frequency of CMs could be readily obtained from adherent cultures (Figure 4c, e, f).
It has been reported that uptake of the mitochondrial dye tetramethylrhodamine methyl ester perchlorate (TMRM) identifies late differentiation stage hESC-CMs (Hattori F et al., Nat Methods 7(1 ), 61 (2010). While most d11 GFP+ cells took up TMRM (approx 86%), a similar perinuclear rhodamine fluorescence was observed in approx 30% of GFP" cells and in most undifferentiated hESCs (approx 83%), suggesting that mitochondrial content is not a specific discriminator for CMs early in differentiation (Figs. 6 and 7).
Example 2 Gene Expression Profiling
Gene expression profiles of NKX2-5+ cells were compared with samples from fetal and adult heart (Fig, 8a-b and Fig 9). Cells were fractionated on the basis of GFP expression and, at d14, the mesodermal marker PDGFRa (Fig. 8a). Comparison of d7 GFP+ and GFP" cells identified 471 differentially (> 3-fold) expressed transcripts (Fig. 9a). Unsupervised hierarchical clustering identified ontological relationships (Fig 8b) that suggests hESC-CMs most closely resembled fetal heart, consistent with their immature electrophysiological phenotype (Fig. 1 k). Gene ontology (GO) analysis showed that d7 NKX2-5+ cells expressed genes implicated in cardiogenesis and myocardial function (Fig. 9b and Table 2).
Table 2 Gene Ontogeny classes overrepresented in d7 GFP+ cells
GO ACCESSION GO Term p-value
Phosphatidylcholine-sterol O-
GO: 0060228 acyltransferase acivator activity 1.10x10"5
GO:0032781 positive regulation of ATPase activity 3.50x 10"5
GO: 0043462 regulation of ATPase activity 2.57x10"11
GO:0055010 ventricular cardiac muscle morphogenesis 1.50x10"10
GO: 0048644 muscle morphogenesis 1.22x10"11
GO:0055008 cardiac muscle morphogenesis 1.22x10"11
GO:0031672 A band 3.50x10"06
GO:0008307 structural constituent of muscle 1.18x10"13
GO: 0060048 cardiac muscle contraction 1.33x10"5
GO ACCESSION GO Term p-value
GO:0048738 cardiac muscle development 3.71 x10"06
GO:0003015 heart process 2.49x1 O"06
GO: 0060047 heart contraction 2.49x10"06
GO:0003007 heart morphogenesis 1.40x10"11
GO:0006941 striated muscle contraction 9.51 x10"07
GO:0007507/GO:000751 1 heart development 1.86x10"17 actomyosin structure organization and
GO:0031032 Biogenesis 4.63x10"07
GO: 0006936 muscle contraction 8.30x10"12
GO:0003012 muscle system process 1.48x10"11
GO:0005859 muscle myosin process 8.73x10"07
GO:0016460 myosin II complex 1.17x10"06
GO:0016459 myosin complex 7.62x10"06
GO007517 muscle development 1.37x10"17
GO: 0043292 contractile fiber 1.99x10"19
GO:0030016 myofibril 5.76x10"19
GO: 0044449 contractile fiber part 1.08x10"18
GO:0030017 sarcomere 7.64x10"16
GO:0008016 regulation of heart contraction 2.21 x10"07
GO:0006937 regulation of muscle contraction 4.93x1 O"06
GO:0005865 striated muscle thin filament 1.76x10"07
GO:0003779 actin binding 1.32X1 Q-8
As anticipated, d14 GFP+ PDGFRa+ cells expressed a larger cohort of genes associated with working myocardium and fewer genes involved in heart morphogenesis (Fig. 9 c-d and Table 3).
Table 3 Gene Ontogeny classes overrepresented in d14 PDGFRa+GFP+ cells.
GO ACCESSION GO Term p-value
GO:0031672 A band 2.30x10"5
GO: 0002027 cardiac chronotropy 9.01 x10"5
GO:0045214 sarcomere organization 3.69x10"7
GO:0032781 positive regulation of ATPase activity 9.34x10"6
GO: 0043034 costamere 2.20x10"4
GO: 0042462 regulation of ATPase activity 1.02x10"8
GO: 0032036 myosin heavy chain binding 6.52x10 7
GO: 0048644 muscle morphogenesis 4.32x10 9
GO:0055008 cardiac muscle morphogenesis 4.32x10 9
GO:0055010 ventricular cardiac muscle morphogenesis 4.22x10"8
Actomyosin structure organization and
GO:0031032 biogenesis 8.56x10"11
GO: 0002026 cardiac inotropy 1.19x10"4
GO:0007512 adult heart development 1.19x10"4
GO:0008307 structural constituent of muscle 7.87x10"15
GO: 0042383 sarcolemma 3.26x10 s
GO:0015671 oxygen transport 1.83x10"4
GO:0048041 focal adhesion formation 1.83x10"4
GO: 0005344 oxygen transporter activity 2.69x10"4
GO:0005863 striated muscle thick filament 7.20x10"6
GO:0015669 gas transport 3.80x10"4
GO:0006941 striated muscle contraction 1.33x10"7
GO:0030239 myofibril assembly 2.13x10"5
GO:0030018 Z disc 4.51 x10"5
GO:0017022 myosin binding 2.22x10"7
GO: 0044449 contractile fiber part 1.37x1017
GO:0008016 regulation of heart contraction 9.74x10"7
GO: 0005924 cell-substrate adherens junction 8.71 x10"7
GO: 0006936 muscle contraction 5.54x10"10
GO:0016459 myosin complex 2.28x10"5
GO:0030055 Cell-matrix junction 1.45x10"5
The array data also confirmed the GFP+ population generated under these conditions comprised cardiac cells and did not contain other cell types in which NKX2-5 is expressed (Kwee L et al. , Development 121 (2), 489 (1995)), such as the splenic anlage (Fig 9e) or endoderm; a conclusion supported by the fact GFP+ cells are negative for the endodermal markers EpCAM or ECAD (Fig 9f).
Example 3 VCAM 1 and SIRPa are uprequlated in the GFP+ population
Expression profiling also identified two up-regulated transcripts encoding cell surface proteins, Vascular Cell Adhesion Molecule 1 (VCAM1) and Signal Receptor Protein a (SIRPa or SIRPA) (Fig 8c-f, Fig 10 a, b). VCAM 1 mediates contact with the overlaying epicardium via interactions with a4-integrins during heart development (Kwee L et al. , Development 121 (2), 489 (1995)) while the function of SIRPa during cardiogenesis is unknown. Flow cytometry demonstrated that most d14 GFP+ cells expressed VCAM1 (70.9 ± 6.3%; n=3) or SIRPa+ (85.3 ± 1 1.6 %; n=3) and that 37.4 ± 1 % (n=3) GFP+ cells were VCAM1 +SI RPa+. Importantly, most d14 VCAM1 +SIRPa+ cells (67.7 ± 1 1.1 %; n=3) were GFP+ (Fig. 8c).
Q-PCR analysis of flow cytometrically purified d14 GFP", GFP+SIRPa+ , and GFP+ SIRPa+VCAM1 + cell populations showed that triple positive cells expressed higher levels of cardiac transcription factors (NKX2-5, I RX4, TBX20) and myofilament genes (MYH7, MLC2v), whilst GFP+SIRPa+ cells expressed higher levels of smooth muscle (ACTA2, CNN1 ) and endothelial (CD34) markers (Fig 8j and Fig 10d). Other cardiac genes examined (NPPA, TBX5, GATA4) were similarly expressed in the GFP+SI RPa+, and GFP+SIRPa+VCAM 1 + cell populations (Fig 10d). When flow cytometrically purified SIRPa VCAM I", SIRPa+ or SIRPa+VCAM1 + fractions were cultured as monolayers, only SIRPa+ and SIRPa+VCAM 1 + cells formed GFP+ contractile areas (Fig 8k-m and Fig 10 c-f). Whilst d11 SIRPa+VCAM 1 + population yielded a higher percentage of GFP+ cells than SIRPa+ cells (Fig 8m), cultured SIRPa+ cells upregulated VCAM1 , suggesting acquisition of this marker accompanies ongoing CM differentiation (Fig 8m, Fig 10 d,f). Consistent with this hypothesis, d14 GFP+VCAM 1 + cells expressed elevated levels of myocardial markers and lower levels of endothelial genes compared with GFP+VCAM 1 " cells (Fig 10g). Relative to the d14 d 14 GFP+PDGFRa+ population, d14 GFP+VCAM 1 + cells were enriched for genes involved in translational regulation, (RPL9, RPL23, PABPC1 ), mitochondrial components (NNT, COX7B, I M MT) and myofilament homeostasis (DSTN, NEBL) (Fig. 0h). Notably in the mouse, VCAM 1 is found in the ventricular myocardium at 9.5 days post coital (dpc) and throughout the myocardium of the atria, ventricles and interventricular septum at 14.5 dpc (Fig. 8h-j). Taken together, these data suggests that the GFP+VCAM 1 + cells represent a myogenically committed NKX2-5+ sub- population.
Example 4 Characterisation of cells purified by SIRPA and VCAM1
A number of transcription factors and genes have been suggested to mark emerging CPCs and CMs (Hatcher and Basson 2009; Martin-Puig ef al. 2008, see Fig. 1.2). Using these key lineage markers, RT-PCR was performed to establish the gene expression profiles of GFP+SIRPa+ (GS+) and GFP+ SIRPa+VCAM 1 + (GSV+) fractions (Fig. 11 a-c). Both the GS+ and GSV+ fractions express higher levels of cardiac markers than that of the GFP- control fraction (Fig. 11 a-c). The markers IRX4, NKX2-5, TBX20 and MYL2, were found to have significantly higher expression in the GSV+ population than the GS+ cells (PO.05). Furthermore, of the cardiac markers those which specifically mark CMs (MYL2 and MYH7) were expressed at higher levels in the GSV+ than GS+ cells (Fig. 11 a). These results suggest that the GSV+ populations are enriched for cardiomyocytes.
Differences in the cardiac markers described above suggest that the GS+ population is phenotypically different to the GSV+ cells. As some NKX2-5+ cells are multipotent, forming CMs, smooth muscle and endothelial cells, it is possible that the GS+ population contains mutlipotential CPCs, cardiac smooth muscle or possibly cardiac endothelial cells. Therefore, the inventors performed RT-PCR analysis for the smooth muscle markers ACTA2 and CNN1 and the endothelial marker CD34. All three markers had significantly higher expression levels in the GS+ population compared to the GSV+ cells (P<0.05) (Fig. 1 1 b, c). These results indicate that the GSV+ population consists of cells that have committed to the CM lineage. Furthermore, these data suggest that the GS+ fraction represents either a) a less differentiated pool of common CPCs that retain the ability to differentiate in a wider variety of cells or b) a wider range of cell types including smooth muscle and endothelial cells.
Immunohistochemistry analysis was used to further characterise the cardiac phenotype of the GS+ and GSV+ fractions (Fig 11 d-i). Each fraction was stained for GFP and the filament specific cardiomyocyte marker, TNNT2 (Takeda ef al. 2003; Kobayashi and Solaro, 2005). A triple negative fraction (TN) was also stained as a control (Figure 11 d,g). Five random fields of each fraction were imaged. NKX2-5GFP expression was difficult to detect in the GS+ fraction. Nonetheless both RT-PCR results and FACS analysis indicate that that GFP is expressed in GS+ cells, albeit at lower level than GSV+ cells. As such GFP was omitted from cell counts. Cells which showed both positive TNNT2 staining and structure were counted as TNNT2+. This revealed that the GSV+ fraction had a higher proportion of TNNT2+ cells (72% (82 out of 1 14 cells)) than the GS+ fraction (20% (15 out of 75 cells)) (Fig. 11 j). This supports RT-PCR data suggesting that the GSV+ fraction represent a more CM enriched population than the GS+ fraction. Whilst preliminary, these immunohistochemistry data support the findings of our gene
expression profiling (Fig. 11 a-c) strongly suggesting that the GSV+ fractions contain a higher proportion of committed CMs than the GS+ population.
Example 5 VCAM 1 as a maturation marker.
To determine if the GS+ populations contain GSV+ precursors, GS+ cells were sorted and re-cultured. Briefly, cells from day 10 EBs were sorted by FACS into triple negative (TN), GS+ and GSV+ fractions and each fraction was separately re-aggregated and cultured for four days before being analysed for GFP expression and VCAM 1 expression by flow cytometry (Figure 12 a). Re-aggregates from both the GS+ fraction and GSV+ fraction were found to be contractile and expressed GFP after four days of culture (Fig. 12b-j). As expected, the GSV+ fraction was initially 94.7% (± 2.6, n=3) positive for VCAM 1 , whilst the GS+ fraction only had a low level of VCAM 1 positive cells (3.7 ± 2.3%, n=3) (Fig. 12k, j). At day 10+4 the percentage of cells expressing VCAM 1 in the GSV+ fraction did not significantly change (P>0.05) and remained at 95%. However, the percentage of cells expressing VCAM 1 in the GS+ fraction increased significantly (PO.05), increasing to 58.9% (± 15.6, n=3) (Fig. 121).
Example 6 Functional analysis of cells isolated by SIRPA and VCAM 1
Regulation of intracellular calcium by mature CMs can occur via multiple channels (e.g. Transmembrane β1- and 2-adrenoceptors and sarcoplasmic Ryanodine receptors) and is essential for the normal contractile activity of the functional heart. In mature CMs, increases in intracellular Ca2+ initiates contraction and removal of Ca2+ results in relaxation. Analysis of Ca2+ flux was performed on GS+ and GSV+ fractions sorted from day 10 EBs and cultured as adherent cells for an additional 3, 5 or 6 days to determine if there was a difference in Ca2+ handling between these fractions. This analysis was used as an indication of spontaneous contractility, thereby acting as a measure for maturity. At day 10+3, 40.6% (out of 64 cells) of GS+ cells and 75% (out of 64 cells) of GSV+ cells displayed Ca2+ flux (Fig. 13a). These results suggest that at day 10+3, many cells within the GS+ fraction have not yet established spontaneous contractility and thus are functionally less mature than putative CMs of the GSV+ fraction, most of which are contractile by day 10+3.
However by day 10+5 and 10+6 the percentage of GS+ cells that exhibited Ca2+ flux was equivalent to the GSV+ population, 67.2% to 61.7%) respectively (out of 64 cells) at day 10+5 and 67.2% to 70.3% respectively (out of 128 cells) at day 6 (Fig. 13a). The similarity in percentage of Ca2+ flux between GS+ and GSV+ cell fractions of day 10+5 and 10+ 6 suggest that many GS+ cells continue to differentiate from day 10+3 to day 10+5 and mature to a functionally similar state as CMs of the GSV+ fraction. This data supports the observation of a transition from GS+ to GSV+ during culture.
Isoprenaline is a transmembrane β1 - and 2-adrenoceptor agonist and has been shown to enhance Ca2+ flux and contractility of CMs in the functional heart (Davis ef a/. 2008). To investigate whether our hESC-CMs were responsive to isoprenaline (as in mature CMs), GS+ and GSV+ cells were treated with Isoprenaline (Iso) or a vehicle control (veh) (ethanol) (Figure 13b-e). We used the calcium responsive flurophore, Flo-4, to measure Ca2+ flux, a positive response results in a significant increase in spontaneous activity (as determined by increased fluroescence) above the basal rate of spontaneous activity (Fig. 13b). The GSV+ fraction had only a small response to the vehicle control in the sample from day 10+5 (16%) and no response in day 10+3 and 10+6 samples (Fig. 13c). At day 10+3, 25% (out of 16 cells) of the GSV+ cells responded to Iso. By day 10+5 the proportion of GSV+ cells had increased to 53.1 % (out of 32 cells), and increased again at day 10+6 to 68.8% (out of 16 cells) (Fig. 13c). This result suggests that at day 10+3 a large proportion of GSV* putative CMs are not responsive to isoprenaline, which is characteristic of immature CMs. However, at day 10+6 a majority of GSV+ cells respond to β1- and 2-adrenoceptor stimulation. This increase in β1 - and 2-adrenoceptor mediated Ca2+ flux of GSV+ cells from day 10+3 to day 10+6 indicates that the maturation process is continuing between these time points.
Example 7 Cell isolation based on VCAM 1 and SIRPA
To further investigate the use of VCAM 1 and SIRPa in isolating enriched CM populations, the inventors sorted cells on the basis of SIRPa alone (S+) and SIRPa and VCAM 1 together (SV+) from EBs at different time points. S+ and SV+ fractions were re-plated as adherent cultures for an additional 7 days before being analysed for GFP expression by flow cytometry (Figure 14 a-e). FACS analysis of cells sorted from d7 EBs and subsequently cultured for a further 7 days as adherent cultures (day 7+7), showed that both the S+ and SV+ fractions gave rise to similar levels of GFP+ cells (28% and 33% respectively) (Figure 14 a). However, a different result was found in cells from the day 11 +7 and day 14+7 cultures in which the S+ fraction had a much lower GFP expression (2.8% and 5% respectively) than the SV+ fraction (69% and 55 % respectively) (Figure 14 b, e). Collectively these results suggest that at day 7 the S+ fraction can differentiate towards a NKX2-5GFP+ cell type, however, at time points past day 1 1 of differentiation, the S+ fraction largely loses this capacity because it is then expressed predominantly in non-cardiac linages. I n light of findings suggesting VCAM1 as a CM commitment marker, this result may indicate that a large proportion of S+ cells from the day 7 sort may go on to express VCAM1 , which would account for the similar GFP+ percentages between S+ and SV+ fractions from the day 7 sort after 7 days in culture. Nonetheless, these data convincingly demonstrate that after day 10 of differentiation the isolation of SIRPA+VCAM 1+ cells results in a dramatically enriched CM culture.
Re-analysis of flow cytometry data showed that the SIRPA(high)VCAM 1 + populations consist of 99% GFP+ cells (Figure 14f). Further analysis by flow cytometry revealed that 91 % (± 4.2%) of ShigV cell from day 10 EBs express GFP, whilst 86.7% (±3.8%) of ShigV cell from day 14 EBs express GFP (Figure 14g). This suggests that SIRPA and VCAM 1 together identify a very highly enriched CM population.
Claims
1. A method for enriching for cardiomyocytes from a sample the method comprising selecting for cells in the sample bearing cell surface markers SI RPa and/or VCAM 1.
2. The method according to claim 1 , wherein selecting for cells comprises:
contacting said sample with a binding agent that binds to SIRPa and/or a binding agent that binds to VCAM 1 , for a time and under conditions sufficient for said binding agents to bind; and
isolating the cells in the sample to which the binding agent(s) bind.
3. The method according to claim 1 or 2, wherein the method further comprises the step of, prior to selecting for cells, generating a culture of the sample and causing differentiation of the cells in the sample.
4. The method according to any one of claims 1 to 3, wherein the sample is a cell or tissue sample.
5. The method according to 4, wherein the cells in the sample are isolated using fluorescence activated cell sorting (FACS) or magnetic activated cell sorting (MACS).
6. The method according to any preceding claim, wherein the sample comprises cardiomyocytes differentiated in culture from stem cells or progenitor cells.
7. The method according to any preceding claim, wherein the sample is a cardiosphere- derived cell (CDC).
8. The method according claim 2, wherein said sample is contacted with a binding agent that specifically binds to VCAM 1 and a binding agent that specifically binds to SIRPa.
9. The method according to any preceding claim, wherein the sample comprises a mixed population of cells comprising cardiomyocytes.
10. The method according to any preceding claim, wherein the mixed population of cells comprises any cell type that is capable of differentiating down the cardiac lineage.
11. The method according to claim 9 or 10, wherein the mixed population of cells is selected from the group consisting of pluripotent cells, cardiac progenitor cells, induced pluripotent stem cells (iPS), induced/re-programmed cardiomyocyte cells, umbilical tissue, left atrial appendage, cardiac tissue, circulating endothelial cells, cardiac fibroblasts, adipose tissue, skin tissue and combinations thereof.
12. The method according to any one of claims 9 to 11 , wherein the mixed population of cells comprise differentiating pluripotent cells and/or the progeny thereof.
13. The method according to claim 11 or 12 wherein the pluripotent cells are selected from the group consisting of human embryonic stem cells (hES), embryonic stem cells from other primates, human embryonic germ (hEG) cells, induced pluripotent stem cells (iPS), stem cells lines such as BG01 , BG02, HUES cell lines such as HUES1-17, HES2 or HES3, and human ESC-derived cardiac progenitor cells (e.g. hESC-CPCs) and combinations thereof.
14. The method according to any one of claims 11 to 13, wherein the pluripotent cell is a human embryonic stem (hES) cell.
15. The method according to any preceding claim wherein the cardiomyocytes are human cells.
16. The method according to any preceding claim, wherein the selected cells comprise a population of cells having at least about 70% cardiomyocytes.
17. The method according to any preceding claim, wherein the selected cells comprise a population of cells having at least about 80% cardiomyocytes.
18. The method according to any preceding claim, wherein the selected cells comprise a population of cells having at least about 90% cardiomyocytes.
19. A population of cells enriched for cardiomyocytes according to the method of any preceding claim.
20. A population of cells according to claim 19, wherein at least about 70% of the cells are cardiomyocytes.
21. A population of cells according to claim 19, wherein at least about 80% of the cells are cardiomyocytes.
22. A population of cells according to claim 19, wherein at least about 90% of the cells are cardiomyocytes.
23. The method according to any one of claims 2 to 18, wherein the binding agent is an antibody or a protein comprising an antibody variable region.
24. A method for detecting cardiomyocytes in a sample, the method comprising contacting the sample with a binding agent that binds to SIRPa and/or a binding agent that binds to VCAM 1 , for a time and under conditions sufficient for said binding agents to bind, wherein the cells to which the agent(s) bind are cardiomyocytes.
25. The method according to claim 24, comprising contacting the sample with a binding agent that specifically binds to VCAM 1 and a binding agent that specifically binds to SIRPa.
26. The method according to claim 24 or 25, wherein the sample is a tissue or a cell sample.
27. The method according to any one of claims 24 to 26, wherein said detecting is by immunohistochemistry.
28. The method according to claim 24 or 25, wherein the sample is a mixed population of cells comprising cardiomyocytes.
29. The method according to claim 28, wherein the mixed population of cells comprises any cell type that is capable of differentiating down the cardiac lineage.
30. The method according to claim 29 or 30, wherein the mixed population of cells is selected from the group consisting of human embryonic stem cells (hES), embryonic stem cells from other primates, embryonic germ (hEG) cells, induced pluripotent stem cells (iPS), induced/re-programmed cardiomyocyte cells, stem cells lines such as BG01 , BG02, HUES cell lines such as HUES1-17, HES2 or HES3), umbilical tissue, left atrial appendage, cardiac tissue, circulating endothelial progenitor cells, cardiac fibroblasts, adipose tissue, skin tissue and cardiac progenitor cells and combinations thereof.
31. The method according to any one of claims 24 to 30, wherein the binding agent is an antibody or a protein comprising an antibody variable region.
32. The method according to claim 23 or 31 , wherein the binding agent is unconjugated or conjugated to a moiety.
33. A purified population of cells comprising at least about 70% VCAM1+/SIRPa+ cardiomyocytes.
34. A population of cells according to claim 33, wherein at least about 80%, 85%, 90% of the cells are VCAM1+/SIRPa+ cardiomyocytes.
35. A population of cells according to claim 33 or 34, wherein the cardiomyocytes further comprise one or more additional cell surface markers selected from the group consisting of
CORIN, GJA3, ESRRG, CACNB2, TMEM163, TRPM4, HTR4, SLC20A2, CADPS, CADPS2, TSPAN13, ERBB2, CACNA1 C, TPCN2, FSD2, TSPAN32, CRHBP, JPH2, VSTM2L, NES, THBS1 , GCOM1 , CACNB2, EDNRA, and CLCNKA.
36. A population of cells according to claim 33 or 34, wherein the cardiomyocytes further comprise one or more additional cell surface markers selected from the group consisting of FSD2, TSPAN32, THBS1 , CORIN, GJA3 and ERBB2.
37. A population according to any one of claims 33 to 36, wherein the cardiomyocytes are VCAM1+, SIRPa+ and CORIlsT.
38. A population according to any one of claims 33 to 36, wherein the cardiomyocytes are VCAM1+, SIRPa+ and FSD2+.
39. A population of cells to any one of claims 33 to 38, wherein the cells comprise one or more phenotypic characteristics of naturally occurring cardiomyocytes, including spontaneous cell beating, ion channel function and electrophysiology.
40. A pharmaceutical composition comprising a therapeutically effective amount of a population of cells according to any one of claims 19 to 22 or 33 to 39, together with a pharmaceutically acceptable carrier.
41. A method of screening a compound for an effect on cardiomyocytes, comprising combining the compound with a population of cells according to any one of claims 19 to 22, or claims 33 to 39, and determining any modulatory effect resulting from the compound.
42. A method for treating a subject suffering from a cardiovascular disease or disorder, comprising administering to the subject a therapeutically effective amount of a population of cells according to any one of claims 19 to 22, or claims 33 to 39 or a pharmaceutical composition according to claim 40.
43. A composition comprising a population of cells according to any one of claims 19 to 22 or claims 33 to 39, or a pharmaceutical composition according to claim 40 for use in treating a cardiovascular disease or disorder.
44. The method according to claim 42 or the composition according to claim 43, wherein the cardiovascular disease or disorder is selected from the group consisting of coronary heart disease, cardiomyopathy, endocarditis, congenital cardiovascular defects and congestive heart failure, long QT syndrome and other ion channel pathologies.
45. A method of repairing or treating damaged myocardium comprising the step of administering to a subject a therapeutically effective amount of a population of cells according to any one of claims 19 to 22 or claims 33 to 39 or a pharmaceutical composition according to claim 40.
46. A composition comprising a population of cells according to any one of claims 19 to 22 or claims 33 to 39, or a pharmaceutical composition according to claim 40 for use in repairing or treating damaged myocardium.
47. The method according to claim 42 or 45, or the composition according to claim 43 or 46, wherein the population of cells or pharmaceutical composition are administered to the subject via a parenteral route or via direct injection into the heart of the subject.
48. A composition comprising a population of cells according to any one of claims 19 to 22 or claims 33 to 39, or a pharmaceutical composition according to claim 40 for use in medicine.
49. Use of a population of cells according to any one of claims 19 to 22 or claims 33 to 39, or a pharmaceutical composition according to claim 40, in the manufacture of a medicament for treating a cardiovascular disease or disorder.
50. Use of a population of cells according to any one of claims 19 to 22 or claims 33 to 39, or a pharmaceutical composition according to claim 40, in the manufacture of a medicament for repairing or treating damaged myocardium.
51. A method for examining the function of cardiac disease-specific inducible pluripotent stem (iPS) cells, comprising:
(i) developing a disease-specific human iPS line from a subject;
(ii) causing the iPS cells to differentiate into the cardiac lineage;
(iii) selecting for cells bearing the cell surface markers VCAM 1 and/or SIRPa; and
(iv) examining the functionality of the selected cells.
52. The method according to claim 51 , wherein the cells are selected using a binding agent that binds to VCAM 1 and a binding agent that binds to SI RPa.
53. The method according to claim 51 or 52, wherein the disease-specific iPS cell line is generated from a subject with congenital long QT syndrome (LQTS).
54. A kit comprising a binding agent which binds to VCAM 1 and a binding agent which binds to SI RPa, together with instructions for use in enriching cardiomyocytes.
55. A purified population of cells according to any one of claims 19 to 22 or claims 33 to 39 or a composition according to claim 40 packaged in a suitable container with written instructions for a desired purpose.
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201161492099P | 2011-06-01 | 2011-06-01 | |
| US61/492,099 | 2011-06-01 | ||
| AU2011904103 | 2011-10-04 | ||
| AU2011904103A AU2011904103A0 (en) | 2011-10-04 | A method for enriching cardiomyocytes |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2012162741A1 true WO2012162741A1 (en) | 2012-12-06 |
Family
ID=47258162
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/AU2012/000607 Ceased WO2012162741A1 (en) | 2011-06-01 | 2012-05-31 | Enrichment of cardiomyocytes |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2012162741A1 (en) |
Cited By (25)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014014119A1 (en) * | 2012-07-17 | 2014-01-23 | Kyoto University | Novel cardiomyocyte marker |
| EP2609194A4 (en) * | 2010-08-27 | 2014-02-19 | Univ Health Network | METHOD FOR ENRICHING PROGENITOR CELLS OF CARDIOMYOCITIES DERIVED FROM PLURIPOTENT STEM CELLS AND CARDIOMYOCITY CELLS BASED ON SIRPA EXPRESSION |
| WO2016104614A1 (en) * | 2014-12-25 | 2016-06-30 | 国立大学法人京都大学 | Novel mature cardiac muscle cell marker |
| KR20170023188A (en) * | 2014-07-11 | 2017-03-02 | 가부시키가이샤 메토세라 | Cardiac cell culture material |
| WO2018057542A1 (en) * | 2016-09-20 | 2018-03-29 | Cedars-Sinai Medical Center | Cardiosphere-derived cells and their extracellular vesicles to retard or reverse aging and age-related disorders |
| EP3524673A1 (en) * | 2014-08-22 | 2019-08-14 | Procella Therapeutics AB | Use of jagged 1/frizzled 4 as a cell surface marker for isolating human cardiac ventricular progenitor cells |
| US10457942B2 (en) | 2012-08-13 | 2019-10-29 | Cedars-Sinai Medical Center | Exosomes and micro-ribonucleic acids for tissue regeneration |
| US10612094B2 (en) | 2016-02-19 | 2020-04-07 | Procella Therapeutics Ab | Genetic markers for engraftment of human cardiac ventricular progenitor cells |
| US10717981B2 (en) | 2018-01-18 | 2020-07-21 | Advanced ReGen Medical Technologies, LLC | Therapeutic compositions and methods of making and using the same |
| US10772911B2 (en) | 2013-12-20 | 2020-09-15 | Advanced ReGen Medical Technologies, LLC | Cell free compositions for cellular restoration and methods of making and using same |
| US10961318B2 (en) | 2017-07-26 | 2021-03-30 | Forty Seven, Inc. | Anti-SIRP-α antibodies and related methods |
| US11186820B2 (en) | 2017-08-23 | 2021-11-30 | Procella Therapeutics Ab | Use of Neuropilin-1 (NRP1) as a cell surface marker for isolating human cardiac ventricular progenitor cells |
| US11203754B2 (en) | 2016-04-29 | 2021-12-21 | Advanced ReGen Medical Technologies, LLC | Microrna compositions and methods of making and using same |
| US11219643B2 (en) | 2013-12-20 | 2022-01-11 | Advanced ReGen Medical Technologies, LLC | Compositions for cellular restoration and methods of making and using same |
| US11253551B2 (en) | 2016-01-11 | 2022-02-22 | Cedars-Sinai Medical Center | Cardiosphere-derived cells and exosomes secreted by such cells in the treatment of heart failure with preserved ejection fraction |
| US11286463B2 (en) | 2012-03-08 | 2022-03-29 | Advanced ReGen Medical Technologies, LLC | Reprogramming of aged adult stem cells |
| US11351200B2 (en) | 2016-06-03 | 2022-06-07 | Cedars-Sinai Medical Center | CDC-derived exosomes for treatment of ventricular tachyarrythmias |
| US11357799B2 (en) | 2014-10-03 | 2022-06-14 | Cedars-Sinai Medical Center | Cardiosphere-derived cells and exosomes secreted by such cells in the treatment of muscular dystrophy |
| US11401508B2 (en) | 2016-11-29 | 2022-08-02 | Procella Therapeutics Ab | Methods for isolating human cardiac ventricular progenitor cells |
| US11555179B2 (en) | 2019-02-01 | 2023-01-17 | The University Of Hong Kong | Identification of subpopulations of cardiomyocytes |
| US11660355B2 (en) | 2017-12-20 | 2023-05-30 | Cedars-Sinai Medical Center | Engineered extracellular vesicles for enhanced tissue delivery |
| US11660317B2 (en) | 2004-11-08 | 2023-05-30 | The Johns Hopkins University | Compositions comprising cardiosphere-derived cells for use in cell therapy |
| US11759482B2 (en) | 2017-04-19 | 2023-09-19 | Cedars-Sinai Medical Center | Methods and compositions for treating skeletal muscular dystrophy |
| WO2024076605A1 (en) * | 2022-10-05 | 2024-04-11 | The University Of Chicago | Multilineage cardiovascular organoids and methods of generating the same |
| US12146137B2 (en) | 2018-02-05 | 2024-11-19 | Cedars-Sinai Medical Center | Methods for therapeutic use of exosomes and Y-RNAS |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009114133A1 (en) * | 2008-03-10 | 2009-09-17 | The J. David Gladstone Institutes | Cells and assays for use in detecting long qt syndrome |
| WO2009118928A1 (en) * | 2008-03-26 | 2009-10-01 | Kyoto University | Efficient production and use of highly cardiogenic progenitors and cardiomyocytes from embryonic and induced pluripotent stem cells |
| WO2012024782A1 (en) * | 2010-08-27 | 2012-03-01 | University Health Network | Methods for enriching pluripotent stem cell-derived cardiomyocyte progenitor cells and cardiomyocyte cells based on sirpa expression |
-
2012
- 2012-05-31 WO PCT/AU2012/000607 patent/WO2012162741A1/en not_active Ceased
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009114133A1 (en) * | 2008-03-10 | 2009-09-17 | The J. David Gladstone Institutes | Cells and assays for use in detecting long qt syndrome |
| WO2009118928A1 (en) * | 2008-03-26 | 2009-10-01 | Kyoto University | Efficient production and use of highly cardiogenic progenitors and cardiomyocytes from embryonic and induced pluripotent stem cells |
| WO2012024782A1 (en) * | 2010-08-27 | 2012-03-01 | University Health Network | Methods for enriching pluripotent stem cell-derived cardiomyocyte progenitor cells and cardiomyocyte cells based on sirpa expression |
Non-Patent Citations (3)
| Title |
|---|
| DUBOIS, N. C. ET AL.: "SIRPA is a specific cell-surface marker for isolating cardiomyocytes derived from human pluripotent stem cells", NATURE BIOTECHNOLOGY, vol. 29, no. 11, November 2011 (2011-11-01), pages 1011 - 1018 * |
| ELLIOTT, D. ET AL.: "NKX2-5eGFP/W hESCs for isolation of human cardiac progenitors and cardiomyocytes", NATURE METHODS, vol. 8, no. 12, December 2011 (2011-12-01), pages 1037 - 1040 * |
| UOSAKI, H. ET AL.: "Efficient and scalable purification of cardiomyocytes from human embryonic and induced pluripotent stem cells by VCAMI surface expression", PLOS ONE, vol. 6, no. ISSUE, August 2011 (2011-08-01), pages 1 - 9 * |
Cited By (38)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11660317B2 (en) | 2004-11-08 | 2023-05-30 | The Johns Hopkins University | Compositions comprising cardiosphere-derived cells for use in cell therapy |
| EP2609194A4 (en) * | 2010-08-27 | 2014-02-19 | Univ Health Network | METHOD FOR ENRICHING PROGENITOR CELLS OF CARDIOMYOCITIES DERIVED FROM PLURIPOTENT STEM CELLS AND CARDIOMYOCITY CELLS BASED ON SIRPA EXPRESSION |
| US9994821B2 (en) | 2010-08-27 | 2018-06-12 | University Health Network | Methods for enriching pluripotent stem cell-derived cardiomyocyte progenitor cells and cardiomyocyte cells based on SIRPA expression |
| US11286463B2 (en) | 2012-03-08 | 2022-03-29 | Advanced ReGen Medical Technologies, LLC | Reprogramming of aged adult stem cells |
| WO2014014119A1 (en) * | 2012-07-17 | 2014-01-23 | Kyoto University | Novel cardiomyocyte marker |
| US10150949B2 (en) | 2012-07-17 | 2018-12-11 | Kyoto University | Cardiomyocyte marker |
| US12584127B2 (en) | 2012-08-13 | 2026-03-24 | Cedars-Sinai Medical Center | Exosomes and micro-ribonucleic acids for tissue regeneration |
| US11220687B2 (en) | 2012-08-13 | 2022-01-11 | Cedars-Sinai Medical Center | Exosomes and micro-ribonucleic acids for tissue regeneration |
| US10457942B2 (en) | 2012-08-13 | 2019-10-29 | Cedars-Sinai Medical Center | Exosomes and micro-ribonucleic acids for tissue regeneration |
| US10772911B2 (en) | 2013-12-20 | 2020-09-15 | Advanced ReGen Medical Technologies, LLC | Cell free compositions for cellular restoration and methods of making and using same |
| US11219643B2 (en) | 2013-12-20 | 2022-01-11 | Advanced ReGen Medical Technologies, LLC | Compositions for cellular restoration and methods of making and using same |
| KR20170023188A (en) * | 2014-07-11 | 2017-03-02 | 가부시키가이샤 메토세라 | Cardiac cell culture material |
| KR102263824B1 (en) | 2014-07-11 | 2021-06-10 | 가부시키가이샤 메토세라 | Cardiac cell culture material |
| EP3524673A1 (en) * | 2014-08-22 | 2019-08-14 | Procella Therapeutics AB | Use of jagged 1/frizzled 4 as a cell surface marker for isolating human cardiac ventricular progenitor cells |
| US12544409B2 (en) | 2014-10-03 | 2026-02-10 | Cedars-Sinai Medical Center | Cardiosphere-derived cells and exosomes secreted by such cells in the treatment of muscular dystrophy |
| US11357799B2 (en) | 2014-10-03 | 2022-06-14 | Cedars-Sinai Medical Center | Cardiosphere-derived cells and exosomes secreted by such cells in the treatment of muscular dystrophy |
| EP3252149A4 (en) * | 2014-12-25 | 2018-09-12 | Kyoto University | Novel mature cardiac muscle cell marker |
| WO2016104614A1 (en) * | 2014-12-25 | 2016-06-30 | 国立大学法人京都大学 | Novel mature cardiac muscle cell marker |
| JPWO2016104614A1 (en) * | 2014-12-25 | 2017-10-05 | 国立大学法人京都大学 | Novel mature cardiomyocyte marker |
| US11872251B2 (en) | 2016-01-11 | 2024-01-16 | Cedars-Sinai Medical Center | Cardiosphere-derived cells and exosomes secreted by such cells in the treatment of heart failure with preserved ejection fraction |
| US11253551B2 (en) | 2016-01-11 | 2022-02-22 | Cedars-Sinai Medical Center | Cardiosphere-derived cells and exosomes secreted by such cells in the treatment of heart failure with preserved ejection fraction |
| US10612094B2 (en) | 2016-02-19 | 2020-04-07 | Procella Therapeutics Ab | Genetic markers for engraftment of human cardiac ventricular progenitor cells |
| US11725244B2 (en) | 2016-02-19 | 2023-08-15 | Procella Therapeutics Ab | Genetic markers for engraftment of human cardiac ventricular progenitor cells |
| US11203754B2 (en) | 2016-04-29 | 2021-12-21 | Advanced ReGen Medical Technologies, LLC | Microrna compositions and methods of making and using same |
| US11351200B2 (en) | 2016-06-03 | 2022-06-07 | Cedars-Sinai Medical Center | CDC-derived exosomes for treatment of ventricular tachyarrythmias |
| WO2018057542A1 (en) * | 2016-09-20 | 2018-03-29 | Cedars-Sinai Medical Center | Cardiosphere-derived cells and their extracellular vesicles to retard or reverse aging and age-related disorders |
| US11541078B2 (en) | 2016-09-20 | 2023-01-03 | Cedars-Sinai Medical Center | Cardiosphere-derived cells and their extracellular vesicles to retard or reverse aging and age-related disorders |
| US11401508B2 (en) | 2016-11-29 | 2022-08-02 | Procella Therapeutics Ab | Methods for isolating human cardiac ventricular progenitor cells |
| US11759482B2 (en) | 2017-04-19 | 2023-09-19 | Cedars-Sinai Medical Center | Methods and compositions for treating skeletal muscular dystrophy |
| US11753480B2 (en) | 2017-07-26 | 2023-09-12 | Forty Seven, Inc. | Anti-SIRP-alpha antibodies and related methods |
| US10961318B2 (en) | 2017-07-26 | 2021-03-30 | Forty Seven, Inc. | Anti-SIRP-α antibodies and related methods |
| US12404488B2 (en) | 2017-08-23 | 2025-09-02 | Procella Therapeutics Ab | Use of neuropilin-1 (NRP1) as a cell surface marker for isolating human cardiac ventricular progenitor cells |
| US11186820B2 (en) | 2017-08-23 | 2021-11-30 | Procella Therapeutics Ab | Use of Neuropilin-1 (NRP1) as a cell surface marker for isolating human cardiac ventricular progenitor cells |
| US11660355B2 (en) | 2017-12-20 | 2023-05-30 | Cedars-Sinai Medical Center | Engineered extracellular vesicles for enhanced tissue delivery |
| US10717981B2 (en) | 2018-01-18 | 2020-07-21 | Advanced ReGen Medical Technologies, LLC | Therapeutic compositions and methods of making and using the same |
| US12146137B2 (en) | 2018-02-05 | 2024-11-19 | Cedars-Sinai Medical Center | Methods for therapeutic use of exosomes and Y-RNAS |
| US11555179B2 (en) | 2019-02-01 | 2023-01-17 | The University Of Hong Kong | Identification of subpopulations of cardiomyocytes |
| WO2024076605A1 (en) * | 2022-10-05 | 2024-04-11 | The University Of Chicago | Multilineage cardiovascular organoids and methods of generating the same |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2012162741A1 (en) | Enrichment of cardiomyocytes | |
| JP7386290B2 (en) | Genetic markers for engraftment of human ventricular progenitor cells | |
| AU2004278634B2 (en) | Method of inducing the differentiation of stem cells into cardiomyocytes | |
| EP3183337B1 (en) | Use of jagged 1/frizzled 4 as a cell surface marker for isolating human cardiac ventricular progenitor cells | |
| WO2008054819A2 (en) | Cardiovascular stem cells, methods for stem cell isolation, and uses thereof | |
| JP7275109B2 (en) | Use of Neuropilin-1 (NRP1) as a Cell Surface Marker to Isolate Human Ventricular Progenitor Cells | |
| US20160320409A1 (en) | Method for identifying and selecting cardiomyocytes | |
| WO2018100433A1 (en) | Methods for isolating human cardiac ventricular progenitor cells | |
| US20110003327A1 (en) | Methods for production of atrial progenitors and their differentiation into smooth muscle cells and cardiomyocytes | |
| US20130209415A1 (en) | Purified compositions of cardiovascular progenitor cells | |
| EP2154242B1 (en) | Method of inducing differentiation into myocardial cells using g-csf | |
| US20150299659A1 (en) | Muscle cell production | |
| US12559721B2 (en) | Method for isolating a cardiomyocyte population | |
| US20100189697A1 (en) | Cardiac-specific progenitor cells | |
| Laposa | Stem cells for drug screening | |
| TW202530399A (en) | Cell therapy | |
| HK40112481A (en) | Method for separating pituitary cells and hypothalamic cells using cell surface marker | |
| CN121986157A (en) | Cell therapy | |
| HK40022436A (en) | Use of jagged 1/frizzled 4 as a cell surface marker for isolating human cardiac ventricular progenitor cells | |
| HK1232911A1 (en) | Use of jagged 1/frizzled 4 as a cell surface marker for isolating human cardiac ventricular progenitor cells | |
| HK1232911B (en) | Use of jagged 1/frizzled 4 as a cell surface marker for isolating human cardiac ventricular progenitor cells | |
| SG183071A1 (en) | Method for identifying and selecting cardiomyocytes | |
| HK1112940A (en) | Use of islet 1 as a marker for isolating or generating stem cells |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12792984 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 12792984 Country of ref document: EP Kind code of ref document: A1 |