WO2012160027A1 - Recombinant expression of soluble interferon - Google Patents

Recombinant expression of soluble interferon Download PDF

Info

Publication number
WO2012160027A1
WO2012160027A1 PCT/EP2012/059373 EP2012059373W WO2012160027A1 WO 2012160027 A1 WO2012160027 A1 WO 2012160027A1 EP 2012059373 W EP2012059373 W EP 2012059373W WO 2012160027 A1 WO2012160027 A1 WO 2012160027A1
Authority
WO
WIPO (PCT)
Prior art keywords
interferon
host cell
protein
gene
cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2012/059373
Other languages
French (fr)
Inventor
Ralf Schilling
Bettina Diederich
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Richter-Helm Biotec & Co KG GmbH
Original Assignee
Richter-Helm Biotec & Co KG GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Richter-Helm Biotec & Co KG GmbH filed Critical Richter-Helm Biotec & Co KG GmbH
Priority to MDA20130099A priority Critical patent/MD4384C1/en
Priority to EP12723449.0A priority patent/EP2714890B1/en
Priority to EA201391666A priority patent/EA027218B1/en
Priority to DK12723449.0T priority patent/DK2714890T3/en
Priority to UAA201314555A priority patent/UA110831C2/en
Publication of WO2012160027A1 publication Critical patent/WO2012160027A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/555Interferons [IFN]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0051Oxidoreductases (1.) acting on a sulfur group of donors (1.8)

Definitions

  • the present invention generally relates to the field of recombinant gene expression in host cells.
  • the invention relates to a host cell for the recombinant expression of a mammalian interferon protein, said cell comprising (a) a functional endogenous trxB . gene; and (b) an inactivated endogenous gor gene.
  • the invention further relates to the use of such host cells for the recombinant expression of an interferon protein.
  • the invention also provides a method for the recombinant expression of a soluble interferon in a host cell.
  • Interferons are a group of glycoproteins that are secreted by mammalian cells in response to different stimuli, such as viral or bacterial infection. Interferons possess various therapeutically useful characteristics, such as immunostimmul- ating, anti-proliferative, and anti-viral activities. Accordingly, these proteins are widely applied for the treatment of a number of diseases and disorders, including viral infections and cancers, such as multiple myeloma, leukemias, renal-cell carcinoma, and the like. Based on their cellular origin and antigenicity, human interferons are classified into three groups. In humans, alpha interferons are produced by leukocytes, beta interferons are produced by fibroblasts, and gamma interferons are produced by B cells.
  • Interferons were originally obtained by purifying the proteins from natural sources, e.g., from blood leukocytes and fibroblasts .
  • the advent of recombinant DNA technology has made the production of interferons feasible also on an industrial scale, e.g., by recombinant expression of interferon proteins in bacterial host cells.
  • Escherichia coli is one of the most commonly used bacterial host organisms for the recombinant ex- pression of heterologous proteins owing to the ability to grow rapidly to high cell densities, the availability of a vast number of cloning vectors and the ease of introducing such vectors into the cells for subsequent expression.
  • Most of the interferons which are available today for use in human medicine have been produced in E. coli expression systems.
  • heterologous proteins in E. coli is known to be associated with certain limitations which render the production of high amounts of pharmaceutically active proteins challenging.
  • a problem often encountered in E. coli expression systems is the inability of the host cell to produce considerable amounts of the recombinant proteins in soluble and active form. Instead, most of the protein is stored in form of inclusion bodies, i.e. in aggregates of denatured proteins.
  • the main reason for the inability to create soluble recombinant proteins resides in the fact that the cytoplasm of E. coli is a reducing environment which hampers the formation of disulfide bonds.
  • host cells were developed in which certain reductase genes were inactivated to create a more oxidative environment that enables disulfide bond formation.
  • These modified host cells have mutations in the genes encoding the thioredoxin reductase (trxB) and the glutathione oxidoreductase (gor) .
  • trxB thioredoxin reductase
  • gor glutathione oxidoreductase
  • Host cells having a deficiency both in the trxB and the gor gene are available, for example, under the trade names OrigamiTM (Novagen) or SHuffleTM (NEB).
  • Origami trxB ⁇ /gor ⁇ OrigamiTM B (DE3) cells (referred to herein as Origami (DE3) in the following; Novagen) can be successfully used for expressing recombinant interferon a2b as described in the published US application 2009/0258394.
  • the new expression systems should enable the production of high amounts of soluble interferon proteins while at the same time minimize the portion of denatured protein. Ideally, the expression systems are easy to handle and allow the production of cytokines such as interferons at reduced costs.
  • the present invention provides novel host cells which are particularly suitable for the recombinant expression of mammalian interferon proteins. It was found that improved host cells for the expression of interferon proteins can be generated by inactivating the endogenous gor gene of the host cell and at the same time maintaining a functional endogenous trxB gene. Unexpectedly, the maintenance of a functional endogenous trxB gene in the host cell results in significantly increased yields of recombinant interferon proteins. It may be speculated that the trxB gene product is involved in different regulatory pathways that have an impact on expression yields.
  • the novel host cells By use of the novel host cells for the recombinant production of interferon, high amounts of soluble proteins are obtained without any substantial formation of inclusion bodies. As shown in the below examples, the host cells of the invention produce considerably higher amounts of soluble interferon than corresponding cells having mutations in both the gor and trxB gene. Thus, the novel host cells constitute a significant improvement over the art, as they simplify the production of in- terferon proteins and at the same time reduce production costs .
  • the present invention thus relates to a host cell which is suitable for the recombinant expression of an interferon protein, said host cell comprising (a) a functional endogenous trxB gene; and (b) an inactivated endogenous gor gene.
  • Recombinant expression means that expression of the desired protein is effected by a nucleic acid that has been produced by genetic engineering.
  • a host cell that has been provided with an expression vector comprising a polynucleotide sequence that encodes an interferon protein is cultured under suitable conditions so that the interferon is expressed.
  • the invention further relates to the use of such host cells for the recombinant expression of an interferon protein .
  • any cell that is known in the art to be suitable as a host for the expression of heterologous proteins and that has been modified by inactivating the endogenous gor gene can be used.
  • the cell can be of eukaryotic or prokaryotic origin.
  • the host cell is a mammalian cell, e.g. a primary cell or cell line that is derived from a mouse, rat, hamster, dog, or non-human primate.
  • Mammalian cells that have been proven useful for the heterologous expression of proteins include both primary cells (e.g. murine bone marrow cells, haematopoietic stem cells, murine lymphocytes, muscle cells, hepatocytes, and the like) and established cell lines (e.g. Chinese hamster ovary (CHO) cells, monkey kidney cells (COS) , baby hamster kidney (BHK) cells, African green monkey kidney (Vero) cells, Madin Darby canine kidney ( DCK) cells, and the like) .
  • primary cells
  • the host cell of the invention is a yeast cell.
  • yeast cells which have been derived from the species Saccharomyces cerevisiae, Schizosaccharomyces pombe, Yarrowia lipolytica, Kluyveromyces lactis and Pichia pastoris have been shown to be useful for the expression of interferon proteins (Skoko et al . (2003) Biotechnol. Appl . Biochem. 38 (Pt3) : 257-65) .
  • the host cell of the invention can also be derived from insect cells, such as from cells of the insect species Aedes aegypti , Autographa californica, Bombyx mori, Spodoptera frugiperda, or Trichoplusia ni.
  • bacterial host cells In view of the ease of handling and the rapid cell growth, the use of bacterial host cells is particularly preferred herein. Bacterial cells from numerous species have been used in the art for the expression of heterologous proteins. Commonly used host cells comprise strains of Escherichia coli, Corynebacte- rium glutamicum and Bacillus subtilis . In a preferred embodiment, the bacterial host cell is an E. coli cell, such as a cell that has been derived from E. coli strain BL21.
  • the host cell contemplated herein for the expression of the interferon proteins has been genetically manipulated to inactivate the endogenous gor gene, i.e. the gene encoding the glutathione oxidoreductase native to the host cell.
  • the gene encoding the glutathione oxidoreductase has been described in the literature in several different organisms.
  • the nucleotide sequence of the gor gene of E. coli K12 is provided herein as SEQ ID NO: 5. Based on the nucleotide sequence of the gor gene, the skilled person will readily be able to inactivate said gene by standard genetic methods, such as site-directed mutagenesis.
  • the inacti- vation of the gor gene will be such that no or substantially no biologically active glutathione oxidoreductase enzyme is expressed in the host cell.
  • the gor gene will be considered as inactivated if the genetic manipulation has decreased the amount of functional glutathione oxidoreductase enzyme by at least 90%, preferably 95% or more compared to the unmodified host cell.
  • the inactivation may be accomplished by deleting part of or the whole of the coding sequence of the gor gene in the host cell.
  • the gor gene is inactivated by insertion and excision of another polynucleotide, e.g., a gene conferring resistance to an antibiotic which can be used for selection.
  • site-directed mutagenesis kits are commercially available, e.g. the Quick- Change mutagenesis kit of Stratagene, the Transformer mutagenesis kit of Clontech, the GenTaylor mutagenesis system of Invitrogen, the Altered Sites II in vitro mutagenesis kit of Promega, and the Red/ET Recombination Kit of Gene Bridges.
  • the host cells contemplated by the present invention comprise a functional endogenous trxB gene, i.e. a trxB gene that is native to the host cell and gives rise to enzymati- cally active thioredoxin reductase.
  • the host cell of the invention is capable of producing a native functional thioredoxin reductase enzyme.
  • trxB ⁇ /gor ⁇ double knock-out strains are only viable if they also exhibit a mutation in the gene encoding the alkyl hydroperoxide reductase (ahpC*) .
  • ahpC* alkyl hydroperoxide reductase
  • strains harbouring only an inactivating gor mutation are viable without an ahpC* mutation, since inactivation of the gor gene as such does not have any lethal effect.
  • the RHB-T7Agor strain prepared in the below Example 2 did not contain an ahpC* suppressor mutation .
  • the host cells contemplated by the present invention comprise an endogenous, unmodified, functional ahpC gene, i.e. an ahpC gene that is native to the host cell, does not contain a suppressor mutation, and is capable of producing enzymatically active alkyl hydroperoxide reductase.
  • the host cell of the invention can comprise a RNA polymerase from a bacteriophage, such as the T7 RNA polymerase.
  • the T7 RNA polymerase ensures a strong and controlled expression of a polynucleotide sequence that is contained in an expression vector and preceded by a T7 promoter.
  • the T7 RNA polymerase gene can be provided to the host cell in form of an expression vector.
  • the expression vector that harbours the T7 RNA polymerase gene may be identical to or different from the vector that includes the interferon sequence for expression.
  • the sequence comprising the T7 RNA polymerase gene is inserted into the genome of the host cell, e.g., into the bacterial chromosome.
  • the T7 RNA polymerase gene can be inserted into the genome of an E. coli host cell, and the polynucleotide encoding the interferon protein, such as IFN-x2a, is expressed from an expression vector that enables expression in E. coli cells.
  • a corresponding gene cassette which comprises the T7 RNA polymerase gene can be introduced into the genome of a bacterial host cell, e.g., by homologous recombination as described in the below examples.
  • T7 RNA polymerase gene is also commercially available, for example, from New England Biolabs (Frankfurt, Germany) , see for example NEB Cat# C2566, C3016, C3010, C3013, and vectors of the SHUffle series, such as C3026, C3027, C3029 and C3030.
  • the T7 RNA polymerase gene is used in combination with an interferon polynucleotide that has been codon- optimized for being expressed in a prokaryotic microorganism, such as an E. coli cell.
  • the host cell that has been manipulated as described above will then be provided with a polynucleotide sequence encoding an exogenous interferon protein, preferably a human interferon gene.
  • exogenous refers to the fact that the host cell which is selected for the expression of the interferon does not naturally comprise the polynucleotide which encodes the interferon.
  • the polynucleotide can be introduced into the host cell, e.g., by transformation or transfection .
  • the polynucleotide sequence encoding the interferon protein to be expressed is included in an expression vector. The choice of the expression vector will mainly depend on the nature of the host cell.
  • the expression vector may be, for example, a viral or non-viral expression vector useful for introducing an interferon-encoding polynucleotide into the cell for subsequent expression of the interferon protein encoded by said polynucleotide.
  • the expression " vector can be an episomal vector, i.e. one that is capable of self-replicating autonomously within the host cell, or an integrating vector, i.e. one which stably incorporates into the genome of the mammalian cell.
  • a mammalian expression vector will normally comprise a promoter which is functionally linked to the polynucleotide which encodes the interferon.
  • Suitable promoters include, but are not limited to, the cytomegalovirus immediate early promoter (CMV-IE) , the Spleen Focus Forming Virus (SFFV) U3 promoter and the adenoviral major late promoter (Ad MLP) .
  • the mammalian expression vector may include a suitable enhancer element for increasing the expression level. Examples include the SV40 early gene enhancer (Dijkema et al (1985) EMBO J. 4: 761) and the enhancer of the long terminal repeat (LTR) of Rous Sarcoma Virus (Gorman et al. (1982b) Proc. Natl. Acad. Sci. 79: 6777).
  • the expression vector also optionally comprises transcription termination sequences and polyadenylation sequences for improved expression of interferon protein.
  • Suitable transcription terminator and polyadenylation signals can, for example, be derived from SV40 (Sambrook et al (1989) , Molecular Cloning: A Laboratory Manual). Any other element which is known in the art to support efficient expression may be added to the expression vector, such as the Woodchuck hepatitis post-transcriptional regulatory element (wPRE) .
  • wPRE Woodchuck hepatitis post-transcriptional regulatory element
  • the expression vector is a viral expression vector.
  • Viral vectors for use in the present invention typically comprise a viral genome in which a portion of the native sequence has been deleted in order to introduce a heterogeneous polynucleotide without destroying the infec- tivity of the virus. Due to the specific interaction between virus components and host cell receptors, viral vectors are highly suitable for efficient transfer of genes into target cells.
  • Suitable viral vectors for facilitating gene transfer into a mammalian cell are well known in the art and can be derived from different types of virus, for example, from a retrovirus, adenovirus and adeno-associated virus (AAV) , orthomyxovirus, paramyxovirus, papovavirus, picornavirus, or al- phavirus.
  • AAV adeno-associated virus
  • orthomyxovirus paramyxovirus
  • paramyxovirus papovavirus
  • picornavirus picornavirus
  • al- phavirus al- phavirus
  • the expression vector will be adapted to protein expression in a prokaryotic cell environment.
  • a vast number of expression vectors have been described for E. coli and other bacterial hosts.
  • Examples for vectors suitable for protein expression in E. coli cells comprise, for example, the vectors of the pBluescript series, the vectors of the pUC series, e.g.
  • a preferred vector is one that belongs to the pET group of vectors.
  • pET vectors typically comprise a lacl gene which codes for the lac repressor protein, a T7 promoter which is specific to T7 RNA polymerase, a transcription termination sequence, a Jac operator which can block transcription, a polylinker for cloning, an fl origin of replication, an ampicillin or kanamycin resistance gene, and a ColEl origin of replication.
  • pET vectors for use in the methods of the present invention comprise, but are not limited to, pET-21a(+), pET-24a(+), pET-28a(+), pET-29a(+), pET-30a(+), pET-41a(+), pET-44a(+), pET-21b(+), pET-24b(+), pET-26b(+), pET-28b(+), pET-29b(+), pET-30b(+), pET-42b (+) , pET-44b (+) .
  • Vectors which are based on the pET-26b(+) backbone are particularly preferred. Further examples of suitable vectors are described, e.g. in "Cloning Vectors" (Pouwels et al . (eds.) Elsevier, Amsterdam New York Oxford, 1985) .
  • An expression vector for use in bacterial cells may be transformed into the host cell by any suitable method.
  • an expression vector for use in E. coli may be introduced into the host cell, e.g. . by electroporation or by chemical methods such as calcium phosphate-mediated transformation, as de- scribed in Maniatis et al . 1982, Molecular Cloning, A laboratory Manual, Cold Spring Harbor Laboratory.
  • the host cells and methods of the invention are useful for the recombinant expression of high amounts of soluble interferon proteins.
  • the type of interferon is not particularly limited.
  • the interferon proteins selected for expression in the host cells of the invention can be of human or non-human origin.
  • Interferon polypeptides of non-human origin comprise, for example, bovine, equine, porcine, and murine interferons, as well as the respective proteins from dogs, cats, rabbits and sheep.
  • Other types of non-human interferons include those that can be found in primates, such as chimpanzees and gorillas.
  • the interferon proteins selected for expression in the host cells of the invention are human interferons, i.e. interferons that occur naturally in humans, including allelic variants.
  • the interferon protein can belong to any interferon subclass that is known in the art.
  • the interferon protein to be expressed in the host cell of the invention can be an alpha-interferon (IFN- ) , a beta-interferon (IFN- ⁇ ) or a gamma-interferon (IFN- ⁇ ) .
  • the interferon protein to be expressed is human IFN-oi, IFN- ⁇ or IFN- ⁇ or a biologically active fragment thereof.
  • the methods of the invention can further be useful for expressing biologically active variants or fragments of IFN-a, IFN- ⁇ or IFN- ⁇ proteins as described below.
  • the IFN expressed in the host cells- of the invention is the mature native human IFN-a protein.
  • the present invention also encompasses the expression of biologically active IFN-a variants and fragments as described elsewhere herein.
  • Human IFN-a occurs as a family of at least 25 highly homologous proteins of 166 amino acids that are encoded by distinct genes. The IFN-a proteins inhibit viral replication and cellular proliferation and modulate certain immune responses. Recombinant IFN-oi is currently used in the treatment of hepatitis B and hepatitis C and also in the treatment of leukemia, malignant melanoma, and AIDS-related Kaposi's sarcoma.
  • IFN-a for expression according to the method of the invention include IFN- 2a, IFN- 2b, and IFN- 0i2c.
  • the amino acid sequence of mature native human IFN-a2a is depicted in SEQ ID NO:l.
  • the IFN expressed in the host cells of the invention is the mature native human IFN- ⁇ protein or a biologically active IFN- ⁇ variant or fragment as described below.
  • Human IFN- ⁇ is a glycoprotein having a molecular weight of about 20 kd. Like IFN-a, it shows a potent antiviral activity and is known to inhibit cell proliferation.
  • the mature form of human IFN- ⁇ has 166 amino acids. Mature human IFN- ⁇ is shown in SEQ ID NO: 2. IFN- ⁇ was found to bind to the same receptors as IFN-a.
  • the IFN expressed in the host cells of the invention is the mature native human IFN- ⁇ protein.
  • the present invention also encompasses the expression of biologically active IFN- ⁇ variants and fragments as described elsewhere herein.
  • IFN- ⁇ is a glycoprotein that exerts several regulatory functions in the immune system. For example, the release of IFN- ⁇ promotes the differentiation of B cells, and stimulates the production of TNF-a. Further, IFN- ⁇ was found to activate epithelial and endothelial cells, fibroblasts and macrophages so as to eradicate intracellular pathogens. The effects of IFN- ⁇ are mediated by binding of the regulatory protein to distinct forms of receptors at the surface of IFN- ⁇ responsive cells.
  • monomeric human IFN- ⁇ encompasses 143 amino acids and has a molecular weight of about 17 kd.
  • the amino acid sequence of mature native human IFN- ⁇ is .depicted in SEQ ID NO : 3. It is of course also possible to use the host cells and methods of the invention for the production of interferon variants which differ to some extent from the interferon proteins mentioned above, and in particular those set forth in SEQ ID NOs:l-3.
  • the " variants will typically be biologically active variants, i.e. they retain at least part of the biological activity of the naturally occurring interferon, e.g. the ability to bind to their respective receptor molecules.
  • Suitable assays for determining the binding of a variant to interferon receptor type I are described, for example, in US Patent No. 5,766,864.
  • the biological activity of an interferon variant may be determined by measuring its antiproliferative or anti-viral activities, as described, e.g., in US Patents 5,770,191 and 5,690,925.
  • the variant interferon retains a considerable part of the biological activity of the interferon protein from which it derives, e.g., at least about 50% of the activity, more preferably, 60%, 70%, 80%, 90%, 95%, or more.
  • Variants include naturally occurring and recombinantly produced proteins which differ from the original reference amino acid sequence by one or more amino acid substitutions, deletions or additions.
  • a variant of human interferon a2a may have an amino acid sequence which differs in 2, 3, 4, 5, 6, or up to 10, 20, 30 or more positions from the sequences of native human interferon u2a depicted in SEQ ID NO:l.
  • the substitutions are conservative substitutions, i.e. substitutions of one or more amino acid residues by an amino acid of a similar polarity, which acts as a functional equivalent.
  • the amino acid residue used as a substitute is selected from the same group of amino acids as the amino acid residue to be substituted.
  • a hydrophobic residue can be substituted with another hydrophobic residue, or a polar residue can be substituted with another polar residue having the same charge.
  • Functionally homologous amino acids which may be used for a conservative substitution comprise, for example, non-polar amino acids such as glycine, valine, alanine, isoleucine, leucine, methionine, proline, phenylalanine, and tryptophan.
  • uncharged polar amino acids comprise serine, threonine, glutamine, asparagine, tyrosine and cysteine.
  • charged polar (basic) amino acids comprise histidine, arginine and lysine.
  • Examples of charged polar (acidic) amino acids comprise aspartic acid and glutamic acid.
  • interferon variants proteins which differ from the original interferon by one or more (e.g. 2, 3, 4, 5, 10, or 15) additional amino acids.
  • additional amino acids may be present within the amino acid sequence of the original interferon proteins (i.e. as an insertion), or they may be added to one or both termini of the protein.
  • insertions can take place at any position provided that the addition of amino acids does not impair the capability of the protein to exert at least part of the biological activity that is exerted by the naturally occurring interferon protein.
  • variants also comprise those proteins in which, compared to the original protein, one or more amino acids are lacking. Such deletions may affect any amino acid position provided that they do not impair the capability of the variant to exert at least part of the biological activity that is exerted by the naturally occurring interferon protein.
  • modified amino acids are amino acids which have been modified either by natural processes, such as processing or post-translational modifications, or by chemical modification processes.
  • Amino acid modifications that can occur in the interferon variants produced according to the invention may comprise phosphorylation, glycosylation, acetylation, acyla- tion, branching, ADP ribosylation, crosslinking, disulfide bridge formation, formylation, hydroxylation, carboxylation, methylation, demethylation, amidation, cyclization and/or co- valent or non-covalent bonding to phosphatidylinositol, fla- vine derivatives, lipoteichonic acids, fatty acids or lipids.
  • Such modifications have been extensively described in the literature, e.g., in Proteins: Structure and Molecular Properties, T. Creighton, 2 nd edition, . H. Freeman and Company, New York (1993) .
  • the interferon variants referred to herein preferably exhibit a significant amino acid sequence identity compared to the original interferon protein.
  • the amino acid identity amounts to about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, and more preferably to more than 96%, 97%, 98%, or 99%.
  • Methods and computer programs for determining amino acid homology are well known in the art. For the purpose of the present invention, sequence identity is determined using the Smith- Waterman homology search algorithm (Smith and Waterman, Adv. Appl. Math. (1981), 2:482-489).
  • Human IFN-oi variants can be found, for example, in US Patent 5,676,942, which also provides information regarding the residues and regions of the IFN- protein that can be altered without the loss of biological activity.
  • Variants of human IFN- ⁇ are described, e.g., in US Patents 5,690,925 and 6,046,034.
  • a fragment of an interferon protein is a protein, polypeptide or peptide which differs from the corresponding interferon protein by the lack of one or more amino acids at the N-terminus and/or the C- terminus, wherein at least a part of the biological activity of the reference interferon molecule, e.g., its receptor binding properties, or its anti-viral or anti-proliferative activity, is retained.
  • the biologically active fragments of naturally occurring interferon proteins or the fragments of the corresponding interferon variants 1 will retain at least about 50%, at least about 75%, preferably at least about 80%, at least about 85%, at least about 90% or even up to at least about 99% of the biological activity of the reference interferon.
  • fragments of IFN- ⁇ are known from US Patent 5,770,191 which discloses fragments comprising amino acids 95-134 of mature full-length human IFN- ⁇ . The fragments exert the biological activity of the mature IFN- ⁇ .
  • EP 0 306 870 discloses fragments of human IFN- ⁇ having a deletion at the C-terminal amino acids 7-11. The fragments show significantly increased activity compared to full-length human IFN- ⁇ .
  • the polynucleotide sequence which encodes the interferon protein to be expressed in the host cells is manipulated by adapting the codon usage to the codon bias of E. coli. Regions of very high (> 80%) and very low ( ⁇ 30%) GC content were avoided where possible. Also, cis-acting sequence motifs, such as internal TATA-boxes, chi-sites and ribosomal entry sites, repeated sequences, RNA secondary structures and AT- rich or GC-rich sequence stretches were avoided.
  • the optimization of gene sequences, such as human gene sequences, for expression in bacterial host cells like E. coli is also carried out by providers like Geneart (Regensburg, Germany) .
  • a polynucleotide sequence encoding human IFN-oi2a that has been optimized for expression in E. coli is provided in SEQ ID NO: 4.
  • the invention also relates to a method for the recombinant expression of a soluble interferon which makes use of a host cell described in more detail above.
  • the method comprises the steps of
  • the host cell preferably comprises a copy of a bacteriophage RNA polymerase integrated in its genome, e.g. the T7 RNA polymerase, and is transformed with an episomal expression construct, e.g. an expression vector, comprising a polynucleotide sequence which codes for an exogenous interferon protein.
  • the host used in the method for the recombinant expression of a soluble interferon can generally be any type of eukaryotic or prokaryotic cell, as discussed elsewhere herein.
  • the host cell is a bacterial cell, more preferably an E. coli cell.
  • the host cells are cultured under conditions that allow the expression of the interferon protein.
  • the specific conditions will depend on the choice of the specific expression system and will also depend on factors like the nature of the host cell, the nature of the inducible promoter, and the like. The skilled person will readily be able to select and optimize the conditions which are required for the effective expression of the interferon protein in the cell culture without any inventive effort.
  • E. coli host cells expressing an interferon protein can be performed in accordance with standard fermentation methods.
  • E. coli cells can be cultured in a batch or fed-batch process.
  • Culturing methods for bacterial host cells are generally described in Encyclopedia of Bioprocess Technology: Fermentation, Biocatalysis, and Bio- separation, Volumes 1-5, Flickinger, M.C., Drew, S.W. (eds.), 1999 John Wiley & Sons.
  • Typical temperature conditions will be in the range of 20°C to 42°C, more commonly 30°C to 40°C, and preferably 35°C to 38°C.
  • the culture medium will typically have a pH of between 6.5 and 9.0, more typically 7.0 to 8.0, e.g. 7.5. Fermentation of the culture will be continued for a time period ranging from several hours to several days. In particular, if the culturing is performed as a batch process, the culturing time normally ranges from about 12 hours to about 36 hours. When using a continuous process, fermentation times might be up to 21 days or longer.
  • the soluble interferon protein is obtained from the host cell.
  • the protein is isolated from the cytosol of the host cells.
  • the cells can be disrupted, e.g., by a French press, by repeating cycles of freezing and thawing, or by sonication. Cellular debris can be easily removed from the protein fraction by centrifugation .
  • the soluble interferon proteins can then be purified from other protein and non-protein components by standard chromatography methods, including, for example, size exclusion chromatography and/or ion exchange chromatography. Other methods which are typically applied in protein purification, such as ammonium sulphate precipitation and filtration and/or dialysis may also be used.
  • the interferon protein expressed by the host cell of the invention may also be purified by affinity purification using, e.g., monoclonal or polyclonal anti-interferon antibodies .
  • the interferon produced according to the method of the invention may be expressed as a fusion protein which comprises an affinity tag that facilitates binding of the fusion protein via a compound exhibiting binding affinity to the tag.
  • the affinity tag may be a poly- histidine tag comprising 6-12 histidine residues which specifically interacts with a nickel ion chelate matrix.
  • the tag may be glutathione-S-transferase allowing the purification on a glutathione matrix.
  • affinity tags are well-known in the art.
  • Non-limiting examples for pairs of affinity tag and affinity ligand include maltose-binding- protein (MBP) and maltose; avidin and biotin; Streptag and streptavidin; myc epitope and antibody.
  • MBP maltose-binding- protein
  • affinity tag is a peptide or polypeptide
  • such tag may conveniently be expressed together with the interferon protein as a single expression product.
  • affinity tag is not of proteina- ceous origin, it may be attached by chemical coupling reactions.
  • biotin may be chemically coupled to the fusion protein.
  • At least 50% of the interferon produced according to the method of the invention is active interferon. More preferably, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% of the interferon obtained from the method of the invention is active interferon.
  • Fig. 1 shows a comparison of IFNa2a protein levels in RHB-T7/pET26b (+) .
  • IFNa2a as determined in the SDS-PAGE before (tO) and 3 hours after IPTG induction (t3) . It can be seen that both clones express the IFNa2a in similar amounts.
  • Fig. 2 shows the results from an SDS-PAGE-analysis of soluble and insoluble protein fractions of RHB-T7/pET26b (+) .
  • IFN 2a 3 hours after IPTG induction (t3) .
  • RHB-T7/pET26 (+) While the RHB-T7/pET26 (+) .
  • IFNa2a culture produced mostly insoluble interferon (third lane in the left panel)
  • IFNa2a showed predominantly soluble protein product (second lane in the right panel) .
  • Fig. 3 shows the comparison of IFNot2a expression in the strains RHB-T7Agor, RHB-T7Agor/trx and Origami (DE3) , all of which were previously transformed with the expression vector pET26b (+) .
  • IFNa2a Panel A shows the results after SDS-PAGE and coomassie staining.
  • Panel B shows the results of immunoblot- ting and chemoluminescence detection.
  • tO non-induced
  • t4 induced for 4h with IPTG
  • I inclusion body or insoluble fraction
  • C cytosol or soluble fraction
  • ctrl recombinant IFNa2a (Roferon®)
  • LM molecular weight marker Invitrogen
  • Fig. 4 shows the nucleotide sequence coding for human IFNa2a which has been optimized in terms of the codon usage for recombinant expression in an E. coli host.
  • the invention will be illustrated by the following Examples which are given by way of example only. Specifically, the Examples describe the preparation of an E. coli host cell with an exogenous T7 RNA Polymerase gene and an endogenous gor gene that has been inactivated by homologous recombination. The Examples further describe the recombinant expression of human interferon alpha, beta and gamma in said E. coli host cell.
  • Example 1 Preparation of a T7-controlled E. coli strain
  • An E. coli producer strain containing a genomic T7 RNA polymerase gene under control of the lacl repressor was prepared using the Red/ET technology for homologous recombination (Gene Bridges, Heidelberg, Germany) starting from the BL21 strain.
  • the preparation of the producer strain included the following steps : a) Amplification and cloning of a T7 gene cassette
  • Genomic DNA of E. coli BL21-DE3 was prepared by use of a standard kit (Qiagen, Hilden, Germany).
  • the 4.44 kb la- CUV5-T7 gene cassette of BL21-DE3 was amplified by PCR reaction.
  • the DNA cassette contained the lacJ gene, the regulatory domains of the lac operon, a partial lacZ gene, and the E. coli phage T7 gene 1 which encodes the T7 RNA polymerase.
  • the PCR reaction mixtures contained KOD Hot Start DNA polymerase buffer, 2 mM gS0 4 , 200 ⁇ dNTPs, 1 U KOD Hot Start DNA polymerase (Novagen) , 10 ⁇ forward primer (Aintl) , 10 u ' M reverse primer (Xint2) and 50 ng DNA-template .
  • a Mastercycler gradient cycler (Eppendorf) was used with the following settings: dena- turation for 2 min at 98°C, followed by 34 cycles with 30 sec 98°C, 30 sec 60.5°C annealing temperature, and 2 min of elongation at 72 °C. Final elongation was done for 7 min at 72 °C.
  • the following primers were used:-
  • a ligation reaction (Rapid DNA ligation kit, Roche) was performed with a Pstl/Sail digested pIBD5 plasmid (which includes a T5 promoter, inducible by IPTG) .
  • 100 ⁇ of E. coli K12 DH10B cells were transformed by electroporation as described elsewhere herein, plated on LB agar plates containing kanamycin (Kan) and cultured at 37 °C over night.
  • the T7 cassette and the kanamycin resistance gene from pSI were amplified by PCR, adding homology arms on either side that are DNA stretches homologous to the DNA of the desired genomic integration locus, i.e. recA locus of E. coli.
  • the PCR reaction mixtures contained KOD Hot Start DNA polymerase buffer, 2 mM MgS0 4 , 200 ⁇ dNTPs, 1 U KOD Hot Start DNA polymerase (Novagen) , 10 ⁇ forward primer (5 'harecA), 10 ⁇ reverse primer (3'harecA) and 50 ng DNA-template .
  • a Mastercycler gradient (Eppendorf) was used with the following settings: denaturation for 2 min at 98°C, followed by 35 cycles with 30 sec 98°C, 30 sec 65.5°C annealing temperature, and 2 min of elongation at 72 °C. Final elongation was- done for 7 min at 72 °C.
  • the following primers were used:
  • PCR products were purified with the QIAquick PCR purification kit (Qiagen) and digested with 10 units of Dpnl for 30 min at 37°C. c) Transforming competent E. coli cells
  • E. coli cells were transformed with the pRed/ET plasmid by electroporation of BL21 cells (Novagen) . Briefly, 1 ⁇ pRed/ET plasmid DNA was added to a 50 ⁇ aliquot of electrocompetent cells, transferred to a 1 mm electroporation cuvette and elec- troporated with 1350 Volt using the Electroporator #2510 (Eppendorf) . The time constant should be between 5.0 and 5.4 msec.
  • the new strain RHB-T7 Kan r harbours a kanamycin resistance gene in the bacterial genome. Since the cells generated by the recombination events were intended to be used with pET vectors, further optimisation was required to avoid a double resistance (genomic and episoraal resistance) .
  • the genomic kanamycin resistance gene was disrupted by inserting into the kanamycin locus a FRT-flanked chloramphenicol resistance cassette via homologous recombination. Subsequently, another recombination event controlled by the flp protein led to a deletion of about 60% of the kanamycin resistance gene. This knockout mutant allows selection of pET transformants due to the episomal kanamycin resistance gene (Kan) .
  • the kanamycin resistance gene was removed from the genome as follows: A linear PCR product of the FRT-flanked chloramphenicol resistance cassette with 5' and 3' DNA stretches homologous to parts of the kanamycin resistance gene was integrated into the genomic kanamycin locus of RHB-T7 Kan r by homologous recombination. For this purpose, the Red/ET technology for homologous recombination (Gene Bridges, Heidelberg, Germany) was used. Briefly, electrocompetent RHB-T7 Kan r cells were transformed with the pRed/ET plasmid according to the protocol of the manufacturer (see above) .
  • a single clone of this transformation was cultivated at 30°C.
  • a shift in temperature to 37 °C induced both the expression of the flp recombinase protein and the loss of pFLP707 plasmid including the tetracycline resistance.
  • the cells were plated on LB agar and single clones were analysed by colony PCR for positive flp recombination events.
  • the pellet was resuspended in 1 ml chilled ddf ⁇ O. The centrifugation and resuspension was repeated once. Following centrifugation the supernatant was tipped out once more and 20-30 ul were normally left in the tube with the pellet. Cells were resuspended and permanently kept on ice. Electroporation was performed with 1 ⁇ pFLP707 DNA. Subsequent to overnight incubation on tetracycline plates at 30 °C 1. ml of LB medium was inoculated with a single colony and incubated at 30 °C for 2-3h. The temperature was changed to 37 °C and the culture was incubated overnight. One drop of the cell suspension was plated on LB agar.
  • 1 ⁇ pRed/ET plasmid DNA was added to a 50 ⁇ aliquot of elec- trocompetent cells. After mixing, the sample was kept on ice. The transformation sample was transferred to a 1 mm electropo- ration cuvette and electroporated at 1350 Volt using the Elec- troporator #2510 from Eppendorf with a time constant between 5.0 and 5.4 msec. 1 ml of pre-chilled LB medium was added, the sample was transferred to a 1.5 ml tube, and incubated in a thermocycler for 1 h at 30°C and 800 rpm. 100 ⁇ of the cell suspension were plated on LB agar plus tetracycline (3 ⁇ g/ml) and plates were incubated over night at 30°C.
  • a single colony was picked from the plates of the pRed/ET plasmid electroporation and incubated over night in 1 ml LB medium plus tetracycline at 30°C, shaking at 800 rpm. 30 ⁇ of that culture were transferred to two tubes containing 1.4 ml of LB medium plus antibiotic. Cells were grown for approximately 2 h at 30 °C until they reached an OD of around 0.3. One culture was induced by addition of 50 ⁇ 10% L-arabinose while the other remained non-induced and served as negative control. Both cultures were incubated at 37 °C, 800 rpm for about an hour.
  • both cultures were centrifuged at 4°C, 13.000 rpm, washed twice with 1 ml of pre- chilled 10% glycerol and resuspended in about 50 ⁇ of 10% glycerol. These cells were used for transformation with a linear PCR fragment containing 5' and 3' homology arms of the gor gene sequence.
  • the FRT-Cm-FRT resistance cassette as supplied by Gene Bridges (Heidelberg, Germany) was used as a template for the disruption of the chromosomal gor gene in the RHB-T7 obtained from Example 1.
  • PCR reactions were performed using a Mastercycler gradient from Eppendorf with the following settings: initial denaturatioh for 2 min at 98°C, followed by 34 cycles with 30 sec ' 98°C, 30 sec 60°C annealing temperature, and 1.5 min of elongation at 72 °C. Final elongation was done for 7 min at 72 °C and storage occurred at 4°C.
  • the KOD Hot Start DNA Polymerase (Novagen) was used, and the primers were as follows:
  • PCR products were purified with the QIAquick PCR purification kit (Qiagen) . 400 to 800 ng of the linear PCR fragment containing 5' and 3' homology arms of the gor gene sequence and the FRT-flanked Cm resistance gene were added to both the induced and non-induced cells prepared above and the suspension was electroporated with 1350 Volt.
  • Qiagen QIAquick PCR purification kit
  • the purified PCR product was used to electroporate RHB-T7 transformed with the vector pRed/ET (Gene-Bridges) and thus prepared for homologous recombination.
  • the recombination event resulted in the precise integration of the resistance marker cassette into the gor locus of the RHB-T7 genome.
  • Successful disruption of the gor gene was confirmed by PCR. Care was taken that the volume of the DNA sample did not exceed 4 ⁇ . 1 ml ice-cold LB medium was added and cells were incubated for 3 hours at 37 °C, 800 rpm.
  • the construction of the pET26b (+) IFNa2a expression vector was performed after agarose gel electrophoresis and gel elution of the Nde/Sal-digested pET26b(+) (Invitrogen) plasmid fragment as well as the Nde/Sal-digested and codon-optimized IFNa2a in- sert fragment (pMA0813119, GeneArt) . Based on these two isolated DNA fragments (Qiagen minelute gel extraction kit) a ligation reaction was performed using the Roche Rapid DNA Ligation kit. After transformation of chemically competent E.
  • coli DH10B cells with an aliquot of the ligation mixture, individual colonies were picked from kanamycin-containing LB- plates and cultured overnight at 37°C in liquid .
  • LB-medium containing 50 pg/ml of the selection marker.
  • plasmid DNA was isolated from each clone, followed by a digest using the Nde/Sal restriction enzymes . The digest resulted in a Nde/Sal-fragment of about 550 bp in. two clones with a vector fragment of the correct size of >5000 bp.
  • clone 1 was subjected to a more specific cleavage using different restriction enzymes, such as Pstl, Bglll, BspHI and Sspl. The result of the restriction cleavage and agarose gel electrophoresis confirmed the correct number and sizes of DNA-fragments .
  • the expression vector pET26b (+) IFNa2a was transformed into competent RHB-T7Agor cells and resulted in kanamycin resistant colonies from which five were randomly chosen for inoculation of 3 mL kanamycin- containing liquid cultures and storage of corresponding cry- ostocks at -80°C.
  • E. coli cells from the strains RHB-T7 and RHB-T7Agor described above were cultured to the mid-log growth phase. Cells were centrifuged (1 min/16.100 x g/0°C) and resuspended in ice-cold 10% glycerol and centrifuged again (1 min/16.100 x g/0°C). This washing step was repeated once. After the second washing cells were resuspended in 50 pL ice-cold 10% glycerol and the suspension was transferred into a pre-chilled electroporation cuvette (Gap: 2 mm) . An aliquot of the pET26b (+ ) .
  • IFNa2a expression vector was added to the cuvette and electroporation was carried out with an Electroporator 2510 (Eppendorf AG, Germany) applying 1350 Volts (V) . After electroporation, 1 mL of pre-chilled LB medium was added and the cell suspension was transferred to a fresh tube. Following an incubation of one hour at 37 °C with agitation (250 rpm) an aliquot of 50 i was spread out on a LB agar plate, supplemented with 50 g/mL kanamycin and incubated overnight at 37 °C. Single colonies from transformation plates were picked and used for inoculation of 3 mL cultures (LB medium, supplemented with 50 g/mL kanamycin) .
  • cryo-preservation stocks were prepared as follows: a 1 mL sample of culture was mixed with 0.5 mL sterile 30% ice-cold glycerol in a cryo tube (final: 10% glycerol). After shock- freezing in liquid nitrogen (LN2) the tubes were stored at -80°C.
  • IFNa2a expression vector The clones obtained by transformation of RHB-T7 and RHB-T7Agor with the pET26b (+) .
  • IFNa2a expression vector were designated RHB-T7/pET26b (+) .
  • IFNa2a respectively.
  • IFNoc2a expression vector in the different clones obtained by transformation was confirmed by a DNA-fragmentation analysis using the restriction enzymes Bglll, BspHI, Ndel, Pstl, Sail and Sspl .
  • IFNa2a and RHB-T7Agor/pET- 26b (+) IFN 2a for IFN production was started by inoculation of 3 mL complex medium [veg.] (27.0 g/L vegetable-peptone, 14.0 g/L yeast extract, 5.0 g/L NaCl, 0.5 g/L MnS0 4 *H 2 0, 25.0 g/L (w/v) Glycerol, 8.65 g/L K 2 HP0 4 , 6.85 g/L KH 2 P0 ; pH 7.0 ⁇ 0.1) from cryo stocks. The medium was supplemented with 50 g/mL kanamycin.
  • 3 mL complex medium [veg.] (27.0 g/L vegetable-peptone, 14.0 g/L yeast extract, 5.0 g/L NaCl, 0.5 g/L MnS0 4 *H 2 0, 25.0 g/L (w/v) Glycerol, 8.65 g/L K 2 HP0 4
  • the cultures were incubated at 37 °C with 250 rpm overnight. 15 mL expression cultures were initiated by using aliquots of the 3 mL overnight cultures to achieve a starting OD 60 o of 0.1 in 15 mL of complex medium [veg.] without antibiotics in a baffled shaker flask at 37°C with 250 rpm. After reaching mid-log phase with an OD 6 oo of 0.5 to 0.8, IPTG was added (final concentration of 1 mM) and cultures were further cultivated for 3 hours. 1 mL culture samples were taken immediately before (to) and 3 hours after (t3> IPTG-induction .
  • the 1 mL culture samples were centrifuged (1 min/16.100 x g/0°C) .
  • Cell pellets were resuspended in 4 mL Tris-EDTA-Buffer (pH 7.4), transferred into a glass-tube (inner width 22 mm) and placed in an ice-bath.
  • Fractionation of the cells was achieved using the sonication device UP 400S (Hielscher Ultrasonic GmbH; device parameter: 400W, 24 kHz) equipped with the sonotrode H3.
  • Technical settings immersion depth: approx. 15 mm; capacity: 75%; cycle: 30 seconds sonication - 30 seconds off; total treatment time: 10 min.
  • TCP Total cell protein
  • soluble and insoluble protein fractions were applied to SDS-PAGE with coomassie staining.
  • SDS-PAGE gel runs pre-cast NuPAGE ® Novex ® 12% Bis-Tris gels (Invitrogen, Düsseldorf, Germany) were used in combination with the corresponding XCell SureLock Mini-Cells (Invitrogen) .
  • a MES buffer system Invitrogen was deployed to achieve the best gel resolution. All samples were dissolved in 0.25 vol. LDS sample buffer (Invitrogen), substituted with 0.1 vol.
  • human IFN- ⁇ and human IFN- ⁇ were cloned into a pET26b(+) expression vector.
  • IFN- ⁇ were transformed into the strains RHB-T7Agor and RHB-T7.
  • the RHB-T7Agor strain prepared in accordance with Example 2 was then used to create a trxB ' /gor ' double knock-out strain.
  • the inactivating mutation in the trxB gene was generated essentially as discussed above in Example 2 in connection with the gor gene.
  • the primers used for inactivation of the trxB gene were the following:
  • the resulting strain was designated RHB-T7Agor/trx.
  • trxB ⁇ /gor ⁇ double knock-out strains can only grow if they exhibit a mutation in the ahpC* . Therefore, . in the RHB-T7Agor/trx described herein, the ahpC* suppressor mutation was achieved by homologous recombination. No such mutation was necessary in the RHB-T7Agor strain.
  • competent Origami (DE3) cells Novagen
  • 100 ng pET26b (+) IFNa2a DNA were transformed with 100 ng pET26b (+) IFNa2a DNA and incubated overnight at 37 °C on selective LB agar plates with either 50 pg/ml or 150 pg/ml kanamycin. 20 colonies were found on the 150 pg/ml plate, whereas ⁇ 500 colonies grew on the 50 pg/ml plate.
  • Plas- mid DNA preparation Qiagen miniprep kit
  • subsequent restriction digest of three independent clones picked from the 150 g/ml plate revealed that all three clones were carrying the pET26 (+) .
  • IFNa2a expression vector One clone was chosen for the following expression experiments (Origami (DE3) / pET26b (+) IFNa2a.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention generally relates to the field of recombinant gene expression in host cells. In particular, the invention relates to a host cell for the recombinant expression of a mammalian interferon protein, said cell comprising (a) a functional endogenous trxB gene; and (b) an inactivated endogenous gor gene. The invention further relates to the use of such host cells for the recombinant expression of an interferon protein. The invention also provides a method for the recombinant expression of a soluble interferon in a host cell.

Description

RECOMBINANT EXPRESSION OF SOLUBLE INTERFERON
The present invention generally relates to the field of recombinant gene expression in host cells. In particular, the invention relates to a host cell for the recombinant expression of a mammalian interferon protein, said cell comprising (a) a functional endogenous trxB . gene; and (b) an inactivated endogenous gor gene. The invention further relates to the use of such host cells for the recombinant expression of an interferon protein. The invention also provides a method for the recombinant expression of a soluble interferon in a host cell.
BACKGROUND OF THE INVENTION
Interferons are a group of glycoproteins that are secreted by mammalian cells in response to different stimuli, such as viral or bacterial infection. Interferons possess various therapeutically useful characteristics, such as immunostimmul- ating, anti-proliferative, and anti-viral activities. Accordingly, these proteins are widely applied for the treatment of a number of diseases and disorders, including viral infections and cancers, such as multiple myeloma, leukemias, renal-cell carcinoma, and the like. Based on their cellular origin and antigenicity, human interferons are classified into three groups. In humans, alpha interferons are produced by leukocytes, beta interferons are produced by fibroblasts, and gamma interferons are produced by B cells.
Interferons were originally obtained by purifying the proteins from natural sources, e.g., from blood leukocytes and fibroblasts . The advent of recombinant DNA technology has made the production of interferons feasible also on an industrial scale, e.g., by recombinant expression of interferon proteins in bacterial host cells. Escherichia coli is one of the most commonly used bacterial host organisms for the recombinant ex- pression of heterologous proteins owing to the ability to grow rapidly to high cell densities, the availability of a vast number of cloning vectors and the ease of introducing such vectors into the cells for subsequent expression. Most of the interferons which are available today for use in human medicine have been produced in E. coli expression systems. On the other hand, the expression of heterologous proteins in E. coli is known to be associated with certain limitations which render the production of high amounts of pharmaceutically active proteins challenging. A problem often encountered in E. coli expression systems is the inability of the host cell to produce considerable amounts of the recombinant proteins in soluble and active form. Instead, most of the protein is stored in form of inclusion bodies, i.e. in aggregates of denatured proteins. The main reason for the inability to create soluble recombinant proteins resides in the fact that the cytoplasm of E. coli is a reducing environment which hampers the formation of disulfide bonds. The recovery of active protein from inclusion bodies requires refolding the proteins by use of reducing agents, such as dithiothreitol and β-rnercaptoethanol, or dena- turants, such as guanidine-HCl and urea, which is often inefficient and associated with unacceptable product losses.
To overcome these drawbacks, host cells were developed in which certain reductase genes were inactivated to create a more oxidative environment that enables disulfide bond formation. These modified host cells have mutations in the genes encoding the thioredoxin reductase (trxB) and the glutathione oxidoreductase (gor) . By virtue of these mutations, disulfide bond formation in the cytoplasm becomes possible and the yield of soluble product is increased. Host cells having a deficiency both in the trxB and the gor gene are available, for example, under the trade names Origami™ (Novagen) or SHuffle™ (NEB). It was shown that trxB~/gor~ Origami™ B (DE3) cells (referred to herein as Origami (DE3) in the following; Novagen) can be successfully used for expressing recombinant interferon a2b as described in the published US application 2009/0258394.
Despite these improvements, there is still a need for more efficient expression systems which can be used for the reliable production of interferon proteins, in particular human interferon proteins. The new expression systems should enable the production of high amounts of soluble interferon proteins while at the same time minimize the portion of denatured protein. Ideally, the expression systems are easy to handle and allow the production of cytokines such as interferons at reduced costs.
DISCLOSURE OF THE INVENTION
The present invention provides novel host cells which are particularly suitable for the recombinant expression of mammalian interferon proteins. It was found that improved host cells for the expression of interferon proteins can be generated by inactivating the endogenous gor gene of the host cell and at the same time maintaining a functional endogenous trxB gene. Unexpectedly, the maintenance of a functional endogenous trxB gene in the host cell results in significantly increased yields of recombinant interferon proteins. It may be speculated that the trxB gene product is involved in different regulatory pathways that have an impact on expression yields.
By use of the novel host cells for the recombinant production of interferon, high amounts of soluble proteins are obtained without any substantial formation of inclusion bodies. As shown in the below examples, the host cells of the invention produce considerably higher amounts of soluble interferon than corresponding cells having mutations in both the gor and trxB gene. Thus, the novel host cells constitute a significant improvement over the art, as they simplify the production of in- terferon proteins and at the same time reduce production costs .
In a first aspect, the present invention thus relates to a host cell which is suitable for the recombinant expression of an interferon protein, said host cell comprising (a) a functional endogenous trxB gene; and (b) an inactivated endogenous gor gene. Recombinant expression means that expression of the desired protein is effected by a nucleic acid that has been produced by genetic engineering. Preferably, a host cell that has been provided with an expression vector comprising a polynucleotide sequence that encodes an interferon protein is cultured under suitable conditions so that the interferon is expressed. The invention further relates to the use of such host cells for the recombinant expression of an interferon protein .
According to the invention, any cell that is known in the art to be suitable as a host for the expression of heterologous proteins and that has been modified by inactivating the endogenous gor gene can be used. The cell can be of eukaryotic or prokaryotic origin. In one embodiment, the host cell is a mammalian cell, e.g. a primary cell or cell line that is derived from a mouse, rat, hamster, dog, or non-human primate. Mammalian cells that have been proven useful for the heterologous expression of proteins include both primary cells (e.g. murine bone marrow cells, haematopoietic stem cells, murine lymphocytes, muscle cells, hepatocytes, and the like) and established cell lines (e.g. Chinese hamster ovary (CHO) cells, monkey kidney cells (COS) , baby hamster kidney (BHK) cells, African green monkey kidney (Vero) cells, Madin Darby canine kidney ( DCK) cells, and the like) .
In a further embodiment, the host cell of the invention is a yeast cell. For example, yeast cells which have been derived from the species Saccharomyces cerevisiae, Schizosaccharomyces pombe, Yarrowia lipolytica, Kluyveromyces lactis and Pichia pastoris have been shown to be useful for the expression of interferon proteins (Skoko et al . (2003) Biotechnol. Appl . Biochem. 38 (Pt3) : 257-65) . In a- still further embodiment, the host cell of the invention can also be derived from insect cells, such as from cells of the insect species Aedes aegypti , Autographa californica, Bombyx mori, Spodoptera frugiperda, or Trichoplusia ni.
In view of the ease of handling and the rapid cell growth, the use of bacterial host cells is particularly preferred herein. Bacterial cells from numerous species have been used in the art for the expression of heterologous proteins. Commonly used host cells comprise strains of Escherichia coli, Corynebacte- rium glutamicum and Bacillus subtilis . In a preferred embodiment, the bacterial host cell is an E. coli cell, such as a cell that has been derived from E. coli strain BL21.
According to the invention, the host cell contemplated herein for the expression of the interferon proteins has been genetically manipulated to inactivate the endogenous gor gene, i.e. the gene encoding the glutathione oxidoreductase native to the host cell. The gene encoding the glutathione oxidoreductase has been described in the literature in several different organisms. As an example, the nucleotide sequence of the gor gene of E. coli K12 is provided herein as SEQ ID NO: 5. Based on the nucleotide sequence of the gor gene, the skilled person will readily be able to inactivate said gene by standard genetic methods, such as site-directed mutagenesis. The inacti- vation of the gor gene will be such that no or substantially no biologically active glutathione oxidoreductase enzyme is expressed in the host cell. For the purpose of the present invention, the gor gene will be considered as inactivated if the genetic manipulation has decreased the amount of functional glutathione oxidoreductase enzyme by at least 90%, preferably 95% or more compared to the unmodified host cell. The inactivation may be accomplished by deleting part of or the whole of the coding sequence of the gor gene in the host cell. Alternatively, it is also be possible to introduce a single nucleotide substitution into the coding sequence of the gene, provided that this substitution occurs in a triplet that codes for an essential residue of the oxidoreductase enzyme. One may also insert one or more nucleotides into the coding region so as to alter the reading frame of the gor gene. In another preferred embodiment of the invention, the gor gene is inactivated by insertion and excision of another polynucleotide, e.g., a gene conferring resistance to an antibiotic which can be used for selection. Methods that can be used for the inactivation of genes in bacterial, mammalian and yeast cells are well known to a person skilled in the art. For example, numerous methods are described in the literature for the inactivation of a bacterial gene. In addition, site-directed mutagenesis kits are commercially available, e.g. the Quick- Change mutagenesis kit of Stratagene, the Transformer mutagenesis kit of Clontech, the GenTaylor mutagenesis system of Invitrogen, the Altered Sites II in vitro mutagenesis kit of Promega, and the Red/ET Recombination Kit of Gene Bridges.
It has been found by the inventors that inactivation of the host cell's endogenous gor gene is advantageous to obtain high amounts of the recombinantly expressed soluble interferons. Surprisingly, host cells in which only the endogenous gor gene has been inactivated produce significantly higher amounts of interferon proteins when compared to corresponding cells having of the trxB~/gor~ genotype (see below Example 6) . Therefore, the host cells contemplated by the present invention comprise a functional endogenous trxB gene, i.e. a trxB gene that is native to the host cell and gives rise to enzymati- cally active thioredoxin reductase. As a result, the host cell of the invention is capable of producing a native functional thioredoxin reductase enzyme. It is to be noted that trxB~/gor~ double knock-out strains are only viable if they also exhibit a mutation in the gene encoding the alkyl hydroperoxide reductase (ahpC*) . See Faulkner et al. (2008), PNAS, 105 (18) : 6735-40. Both the RHB-T7Agor/trx described herein and the Origami (DE3) strains thus contained an ahpC* suppressor mutation. In contrast, strains harbouring only an inactivating gor mutation are viable without an ahpC* mutation, since inactivation of the gor gene as such does not have any lethal effect. Thus, the RHB-T7Agor strain prepared in the below Example 2 did not contain an ahpC* suppressor mutation .
Accordingly, it is preferred herein that the host cells contemplated by the present invention comprise an endogenous, unmodified, functional ahpC gene, i.e. an ahpC gene that is native to the host cell, does not contain a suppressor mutation, and is capable of producing enzymatically active alkyl hydroperoxide reductase.
To increase the expression level of the interferon protein to be expressed, the host cell of the invention can comprise a RNA polymerase from a bacteriophage, such as the T7 RNA polymerase. The T7 RNA polymerase ensures a strong and controlled expression of a polynucleotide sequence that is contained in an expression vector and preceded by a T7 promoter. The T7 RNA polymerase gene can be provided to the host cell in form of an expression vector. The expression vector that harbours the T7 RNA polymerase gene may be identical to or different from the vector that includes the interferon sequence for expression. It is preferred, however, that the sequence comprising the T7 RNA polymerase gene is inserted into the genome of the host cell, e.g., into the bacterial chromosome. For example, the T7 RNA polymerase gene can be inserted into the genome of an E. coli host cell, and the polynucleotide encoding the interferon protein, such as IFN-x2a, is expressed from an expression vector that enables expression in E. coli cells. A corresponding gene cassette which comprises the T7 RNA polymerase gene can be introduced into the genome of a bacterial host cell, e.g., by homologous recombination as described in the below examples. In addition, E. coli host cells which comprise the T7 RNA polymerase gene are also commercially available, for example, from New England Biolabs (Frankfurt, Germany) , see for example NEB Cat# C2566, C3016, C3010, C3013, and vectors of the SHUffle series, such as C3026, C3027, C3029 and C3030. Preferably, the T7 RNA polymerase gene is used in combination with an interferon polynucleotide that has been codon- optimized for being expressed in a prokaryotic microorganism, such as an E. coli cell.
The host cell that has been manipulated as described above will then be provided with a polynucleotide sequence encoding an exogenous interferon protein, preferably a human interferon gene. The term "exogenous" refers to the fact that the host cell which is selected for the expression of the interferon does not naturally comprise the polynucleotide which encodes the interferon. The polynucleotide can be introduced into the host cell, e.g., by transformation or transfection . Preferably, the polynucleotide sequence encoding the interferon protein to be expressed is included in an expression vector. The choice of the expression vector will mainly depend on the nature of the host cell.
For example, where the host cell is a mammalian cell, such, as a CHO or Vero cell, the expression vector may be, for example, a viral or non-viral expression vector useful for introducing an interferon-encoding polynucleotide into the cell for subsequent expression of the interferon protein encoded by said polynucleotide. The expression" vector can be an episomal vector, i.e. one that is capable of self-replicating autonomously within the host cell, or an integrating vector, i.e. one which stably incorporates into the genome of the mammalian cell. A mammalian expression vector will normally comprise a promoter which is functionally linked to the polynucleotide which encodes the interferon. Suitable promoters include, but are not limited to, the cytomegalovirus immediate early promoter (CMV-IE) , the Spleen Focus Forming Virus (SFFV) U3 promoter and the adenoviral major late promoter (Ad MLP) . As an optional component, the mammalian expression vector may include a suitable enhancer element for increasing the expression level. Examples include the SV40 early gene enhancer (Dijkema et al (1985) EMBO J. 4: 761) and the enhancer of the long terminal repeat (LTR) of Rous Sarcoma Virus (Gorman et al. (1982b) Proc. Natl. Acad. Sci. 79: 6777). The expression vector also optionally comprises transcription termination sequences and polyadenylation sequences for improved expression of interferon protein. Suitable transcription terminator and polyadenylation signals can, for example, be derived from SV40 (Sambrook et al (1989) , Molecular Cloning: A Laboratory Manual). Any other element which is known in the art to support efficient expression may be added to the expression vector, such as the Woodchuck hepatitis post-transcriptional regulatory element (wPRE) .
In a particularly preferred aspect, the expression vector is a viral expression vector. Viral vectors for use in the present invention typically comprise a viral genome in which a portion of the native sequence has been deleted in order to introduce a heterogeneous polynucleotide without destroying the infec- tivity of the virus. Due to the specific interaction between virus components and host cell receptors, viral vectors are highly suitable for efficient transfer of genes into target cells. Suitable viral vectors for facilitating gene transfer into a mammalian cell are well known in the art and can be derived from different types of virus, for example, from a retrovirus, adenovirus and adeno-associated virus (AAV) , orthomyxovirus, paramyxovirus, papovavirus, picornavirus, or al- phavirus. For an overview of the different viral vector sys- terns, see Nienhuis et al . , Hematology, Vol. 16: Viruses and Bone Marrow, N.S. Young (ed.), 353-414 (1993).
On the other hand, where the host cell is a bacterial cell, such as an E. coli cell, the expression vector will be adapted to protein expression in a prokaryotic cell environment. A vast number of expression vectors have been described for E. coli and other bacterial hosts. Examples for vectors suitable for protein expression in E. coli cells comprise, for example, the vectors of the pBluescript series, the vectors of the pUC series, e.g. pUC18, pUC19, pBR322, pBR329, pQE70, pQE60, pQE- 9, pNH8A, pNH16a, pNH18A, pNH46A, ptrc99a, pKK233-3, pDR540, pRIT5, pLG338, pKC30, pHSG299, pHSG399, pACYC177, pACYC184, pRSFlOlO, pBW22, and the like. A preferred vector is one that belongs to the pET group of vectors. pET vectors typically comprise a lacl gene which codes for the lac repressor protein, a T7 promoter which is specific to T7 RNA polymerase, a transcription termination sequence, a Jac operator which can block transcription, a polylinker for cloning, an fl origin of replication, an ampicillin or kanamycin resistance gene, and a ColEl origin of replication. pET vectors for use in the methods of the present invention comprise, but are not limited to, pET-21a(+), pET-24a(+), pET-28a(+), pET-29a(+), pET-30a(+), pET-41a(+), pET-44a(+), pET-21b(+), pET-24b(+), pET-26b(+), pET-28b(+), pET-29b(+), pET-30b(+), pET-42b (+) , pET-44b (+) . Vectors which are based on the pET-26b(+) backbone are particularly preferred. Further examples of suitable vectors are described, e.g. in "Cloning Vectors" (Pouwels et al . (eds.) Elsevier, Amsterdam New York Oxford, 1985) .
An expression vector for use in bacterial cells may be transformed into the host cell by any suitable method. For example, an expression vector for use in E. coli may be introduced into the host cell, e.g.. by electroporation or by chemical methods such as calcium phosphate-mediated transformation, as de- scribed in Maniatis et al . 1982, Molecular Cloning, A laboratory Manual, Cold Spring Harbor Laboratory.
The host cells and methods of the invention are useful for the recombinant expression of high amounts of soluble interferon proteins. The type of interferon is not particularly limited. Generally, the interferon proteins selected for expression in the host cells of the invention can be of human or non-human origin. Interferon polypeptides of non-human origin comprise, for example, bovine, equine, porcine, and murine interferons, as well as the respective proteins from dogs, cats, rabbits and sheep. Other types of non-human interferons include those that can be found in primates, such as chimpanzees and gorillas. In a preferred embodiment, the interferon proteins selected for expression in the host cells of the invention are human interferons, i.e. interferons that occur naturally in humans, including allelic variants.
The interferon protein can belong to any interferon subclass that is known in the art. In particular, the interferon protein to be expressed in the host cell of the invention can be an alpha-interferon (IFN- ) , a beta-interferon (IFN-β) or a gamma-interferon (IFN-γ) . In a particularly preferred embodiment, the interferon protein to be expressed is human IFN-oi, IFN-β or IFN-γ or a biologically active fragment thereof. The methods of the invention can further be useful for expressing biologically active variants or fragments of IFN-a, IFN-β or IFN-γ proteins as described below.
In one embodiment of the invention, the IFN expressed in the host cells- of the invention is the mature native human IFN-a protein. However, the present invention also encompasses the expression of biologically active IFN-a variants and fragments as described elsewhere herein. Human IFN-a occurs as a family of at least 25 highly homologous proteins of 166 amino acids that are encoded by distinct genes. The IFN-a proteins inhibit viral replication and cellular proliferation and modulate certain immune responses. Recombinant IFN-oi is currently used in the treatment of hepatitis B and hepatitis C and also in the treatment of leukemia, malignant melanoma, and AIDS-related Kaposi's sarcoma. Preferred IFN-a for expression according to the method of the invention include IFN- 2a, IFN- 2b, and IFN- 0i2c. The amino acid sequence of mature native human IFN-a2a is depicted in SEQ ID NO:l.
In another embodiment, the IFN expressed in the host cells of the invention is the mature native human IFN-β protein or a biologically active IFN-β variant or fragment as described below. Human IFN-β is a glycoprotein having a molecular weight of about 20 kd. Like IFN-a, it shows a potent antiviral activity and is known to inhibit cell proliferation. The mature form of human IFN-β has 166 amino acids. Mature human IFN-β is shown in SEQ ID NO: 2. IFN-β was found to bind to the same receptors as IFN-a.
In still another embodiment of the invention, the IFN expressed in the host cells of the invention is the mature native human IFN-γ protein. However, the present invention also encompasses the expression of biologically active IFN-γ variants and fragments as described elsewhere herein. IFN-γ is a glycoprotein that exerts several regulatory functions in the immune system. For example, the release of IFN-γ promotes the differentiation of B cells, and stimulates the production of TNF-a. Further, IFN-γ was found to activate epithelial and endothelial cells, fibroblasts and macrophages so as to eradicate intracellular pathogens. The effects of IFN-γ are mediated by binding of the regulatory protein to distinct forms of receptors at the surface of IFN-γ responsive cells. In its mature form, monomeric human IFN-γ encompasses 143 amino acids and has a molecular weight of about 17 kd. The amino acid sequence of mature native human IFN-γ is .depicted in SEQ ID NO : 3. It is of course also possible to use the host cells and methods of the invention for the production of interferon variants which differ to some extent from the interferon proteins mentioned above, and in particular those set forth in SEQ ID NOs:l-3. The" variants will typically be biologically active variants, i.e. they retain at least part of the biological activity of the naturally occurring interferon, e.g. the ability to bind to their respective receptor molecules. Suitable assays for determining the binding of a variant to interferon receptor type I are described, for example, in US Patent No. 5,766,864. Alternatively, the biological activity of an interferon variant may be determined by measuring its antiproliferative or anti-viral activities, as described, e.g., in US Patents 5,770,191 and 5,690,925. Preferably, the variant interferon retains a considerable part of the biological activity of the interferon protein from which it derives, e.g., at least about 50% of the activity, more preferably, 60%, 70%, 80%, 90%, 95%, or more.
Variants include naturally occurring and recombinantly produced proteins which differ from the original reference amino acid sequence by one or more amino acid substitutions, deletions or additions. For example, a variant of human interferon a2a may have an amino acid sequence which differs in 2, 3, 4, 5, 6, or up to 10, 20, 30 or more positions from the sequences of native human interferon u2a depicted in SEQ ID NO:l. It is preferred that the substitutions are conservative substitutions, i.e. substitutions of one or more amino acid residues by an amino acid of a similar polarity, which acts as a functional equivalent. Preferably, the amino acid residue used as a substitute is selected from the same group of amino acids as the amino acid residue to be substituted. For example, a hydrophobic residue can be substituted with another hydrophobic residue, or a polar residue can be substituted with another polar residue having the same charge. Functionally homologous amino acids which may be used for a conservative substitution comprise, for example, non-polar amino acids such as glycine, valine, alanine, isoleucine, leucine, methionine, proline, phenylalanine, and tryptophan. Examples of uncharged polar amino acids comprise serine, threonine, glutamine, asparagine, tyrosine and cysteine. Examples of charged polar (basic) amino acids comprise histidine, arginine and lysine. Examples of charged polar (acidic) amino acids comprise aspartic acid and glutamic acid.
Also considered as interferon variants are proteins which differ from the original interferon by one or more (e.g. 2, 3, 4, 5, 10, or 15) additional amino acids. These additional amino acids may be present within the amino acid sequence of the original interferon proteins (i.e. as an insertion), or they may be added to one or both termini of the protein. Basically, insertions can take place at any position provided that the addition of amino acids does not impair the capability of the protein to exert at least part of the biological activity that is exerted by the naturally occurring interferon protein. Moreover, variants also comprise those proteins in which, compared to the original protein, one or more amino acids are lacking. Such deletions may affect any amino acid position provided that they do not impair the capability of the variant to exert at least part of the biological activity that is exerted by the naturally occurring interferon protein.
Variants of the interferon proteins also encompass proteins with structural modifications relative to the naturally occurring proteins, such as modified amino acids. According to the invention, modified amino acids are amino acids which have been modified either by natural processes, such as processing or post-translational modifications, or by chemical modification processes. Amino acid modifications that can occur in the interferon variants produced according to the invention may comprise phosphorylation, glycosylation, acetylation, acyla- tion, branching, ADP ribosylation, crosslinking, disulfide bridge formation, formylation, hydroxylation, carboxylation, methylation, demethylation, amidation, cyclization and/or co- valent or non-covalent bonding to phosphatidylinositol, fla- vine derivatives, lipoteichonic acids, fatty acids or lipids. Such modifications have been extensively described in the literature, e.g., in Proteins: Structure and Molecular Properties, T. Creighton, 2nd edition, . H. Freeman and Company, New York (1993) .
The interferon variants referred to herein preferably exhibit a significant amino acid sequence identity compared to the original interferon protein. Preferably, the amino acid identity amounts to about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, and more preferably to more than 96%, 97%, 98%, or 99%. Methods and computer programs for determining amino acid homology are well known in the art. For the purpose of the present invention, sequence identity is determined using the Smith- Waterman homology search algorithm (Smith and Waterman, Adv. Appl. Math. (1981), 2:482-489).
Biologically active variants of human interferon proteins have been described in the art. Human IFN-oi variants can be found, for example, in US Patent 5,676,942, which also provides information regarding the residues and regions of the IFN- protein that can be altered without the loss of biological activity. Variants of human IFN-γ are described, e.g., in US Patents 5,690,925 and 6,046,034.
The host cells and methods provided by the present invention may also be useful for the expression of biologically active fragments of the full-length interferon proteins or their variants as defined above. As used herein, a fragment of an interferon protein is a protein, polypeptide or peptide which differs from the corresponding interferon protein by the lack of one or more amino acids at the N-terminus and/or the C- terminus, wherein at least a part of the biological activity of the reference interferon molecule, e.g., its receptor binding properties, or its anti-viral or anti-proliferative activity, is retained. It is preferred that the biologically active fragments of naturally occurring interferon proteins or the fragments of the corresponding interferon variants1 will retain at least about 50%, at least about 75%, preferably at least about 80%, at least about 85%, at least about 90% or even up to at least about 99% of the biological activity of the reference interferon.
Biologically active fragments of human interferons have been described earlier. For example, fragments of IFN-γ are known from US Patent 5,770,191 which discloses fragments comprising amino acids 95-134 of mature full-length human IFN-γ. The fragments exert the biological activity of the mature IFN-γ. EP 0 306 870 discloses fragments of human IFN-γ having a deletion at the C-terminal amino acids 7-11. The fragments show significantly increased activity compared to full-length human IFN-γ.
When cloning a polynucleotide sequence which encodes one of the above interferon proteins or a biologically active variant or fragment thereof into a bacterial expression vector, it should be considered that it may be helpful to modify the in- terferon-encoding polynucleotide sequence in order to adapt it to prokaryotic expression. Methods for optimizing the codon- usage of a polynucleotide sequence to be expressed to render it amenable for expression in bacterial host cells, such as E. coli, are well known in the art and are described, e.g. in Maertens et al . (2010), Protein Science, 19: 1312-1326.
Briefly, the polynucleotide sequence which encodes the interferon protein to be expressed in the host cells is manipulated by adapting the codon usage to the codon bias of E. coli. Regions of very high (> 80%) and very low (< 30%) GC content were avoided where possible. Also, cis-acting sequence motifs, such as internal TATA-boxes, chi-sites and ribosomal entry sites, repeated sequences, RNA secondary structures and AT- rich or GC-rich sequence stretches were avoided. The optimization of gene sequences, such as human gene sequences, for expression in bacterial host cells like E. coli is also carried out by providers like Geneart (Regensburg, Germany) .
A polynucleotide sequence encoding human IFN-oi2a that has been optimized for expression in E. coli is provided in SEQ ID NO: 4.
The invention also relates to a method for the recombinant expression of a soluble interferon which makes use of a host cell described in more detail above. The method comprises the steps of
(a) providing a host cell that comprises a functional endogenous trxB gene, an inactivated endogenous gor gene, and a polynucleotide sequence encoding an exogenous interferon protein;
(b) culturing the host cell under conditions that allow the expression of the interferon protein; and
(c) obtaining the soluble interferon protein from the host cell.
The host cell preferably comprises a copy of a bacteriophage RNA polymerase integrated in its genome, e.g. the T7 RNA polymerase, and is transformed with an episomal expression construct, e.g. an expression vector, comprising a polynucleotide sequence which codes for an exogenous interferon protein. The host used in the method for the recombinant expression of a soluble interferon can generally be any type of eukaryotic or prokaryotic cell, as discussed elsewhere herein. Preferably, the host cell is a bacterial cell, more preferably an E. coli cell. According to the method provided by the present invention, the host cells are cultured under conditions that allow the expression of the interferon protein. The specific conditions will depend on the choice of the specific expression system and will also depend on factors like the nature of the host cell, the nature of the inducible promoter, and the like. The skilled person will readily be able to select and optimize the conditions which are required for the effective expression of the interferon protein in the cell culture without any inventive effort.
For example, culturing of E. coli host cells expressing an interferon protein can be performed in accordance with standard fermentation methods. Typically, E. coli cells can be cultured in a batch or fed-batch process. Culturing methods for bacterial host cells are generally described in Encyclopedia of Bioprocess Technology: Fermentation, Biocatalysis, and Bio- separation, Volumes 1-5, Flickinger, M.C., Drew, S.W. (eds.), 1999 John Wiley & Sons. Typical temperature conditions will be in the range of 20°C to 42°C, more commonly 30°C to 40°C, and preferably 35°C to 38°C. The culture medium will typically have a pH of between 6.5 and 9.0, more typically 7.0 to 8.0, e.g. 7.5. Fermentation of the culture will be continued for a time period ranging from several hours to several days. In particular, if the culturing is performed as a batch process, the culturing time normally ranges from about 12 hours to about 36 hours. When using a continuous process, fermentation times might be up to 21 days or longer.
In the last step of the method, the soluble interferon protein is obtained from the host cell. Typically, the protein is isolated from the cytosol of the host cells. The cells can be disrupted, e.g., by a French press, by repeating cycles of freezing and thawing, or by sonication. Cellular debris can be easily removed from the protein fraction by centrifugation . The soluble interferon proteins can then be purified from other protein and non-protein components by standard chromatography methods, including, for example, size exclusion chromatography and/or ion exchange chromatography. Other methods which are typically applied in protein purification, such as ammonium sulphate precipitation and filtration and/or dialysis may also be used. The interferon protein expressed by the host cell of the invention may also be purified by affinity purification using, e.g., monoclonal or polyclonal anti-interferon antibodies .
To simplify purification, the interferon produced according to the method of the invention may be expressed as a fusion protein which comprises an affinity tag that facilitates binding of the fusion protein via a compound exhibiting binding affinity to the tag. For example, the affinity tag may be a poly- histidine tag comprising 6-12 histidine residues which specifically interacts with a nickel ion chelate matrix. Alternatively, the tag may be glutathione-S-transferase allowing the purification on a glutathione matrix. Further affinity tags are well-known in the art. Non-limiting examples for pairs of affinity tag and affinity ligand include maltose-binding- protein (MBP) and maltose; avidin and biotin; Streptag and streptavidin; myc epitope and antibody. Where the affinity tag is a peptide or polypeptide, such tag may conveniently be expressed together with the interferon protein as a single expression product. Where the affinity tag is not of proteina- ceous origin, it may be attached by chemical coupling reactions. For example, biotin may be chemically coupled to the fusion protein.
Preferably, at least 50% of the interferon produced according to the method of the invention is active interferon. More preferably, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% of the interferon obtained from the method of the invention is active interferon. BRIEF DESCRIPTION OF THE FIGURES
Fig. 1 shows a comparison of IFNa2a protein levels in RHB-T7/pET26b (+) . IFNa2a and RHB-T7Agor/pET26b (+) . IFNa2a as determined in the SDS-PAGE before (tO) and 3 hours after IPTG induction (t3) . It can be seen that both clones express the IFNa2a in similar amounts.
Fig. 2 shows the results from an SDS-PAGE-analysis of soluble and insoluble protein fractions of RHB-T7/pET26b (+) . IFNa2a and RHB-T7Agor/pET26b (+) . IFN 2a 3 hours after IPTG induction (t3) . While the RHB-T7/pET26 (+) . IFNa2a culture produced mostly insoluble interferon (third lane in the left panel) , RHB-T7A- gor/pET26b (+) . IFNa2a showed predominantly soluble protein product (second lane in the right panel) .
Fig. 3 shows the comparison of IFNot2a expression in the strains RHB-T7Agor, RHB-T7Agor/trx and Origami (DE3) , all of which were previously transformed with the expression vector pET26b (+) . IFNa2a. Panel A shows the results after SDS-PAGE and coomassie staining. Panel B shows the results of immunoblot- ting and chemoluminescence detection. tO: non-induced; t4: induced for 4h with IPTG; I: inclusion body or insoluble fraction; C: cytosol or soluble fraction; ctrl: recombinant IFNa2a (Roferon®) ; LM: molecular weight marker Invitrogen) .
Fig. 4 shows the nucleotide sequence coding for human IFNa2a which has been optimized in terms of the codon usage for recombinant expression in an E. coli host.
EXAMPLES
The invention will be illustrated by the following Examples which are given by way of example only. Specifically, the Examples describe the preparation of an E. coli host cell with an exogenous T7 RNA Polymerase gene and an endogenous gor gene that has been inactivated by homologous recombination. The Examples further describe the recombinant expression of human interferon alpha, beta and gamma in said E. coli host cell.
Example 1 : Preparation of a T7-controlled E. coli strain
An E. coli producer strain containing a genomic T7 RNA polymerase gene under control of the lacl repressor was prepared using the Red/ET technology for homologous recombination (Gene Bridges, Heidelberg, Germany) starting from the BL21 strain. The preparation of the producer strain included the following steps : a) Amplification and cloning of a T7 gene cassette
Genomic DNA of E. coli BL21-DE3 (Novagen) was prepared by use of a standard kit (Qiagen, Hilden, Germany). The 4.44 kb la- CUV5-T7 gene cassette of BL21-DE3 was amplified by PCR reaction. The DNA cassette contained the lacJ gene, the regulatory domains of the lac operon, a partial lacZ gene, and the E. coli phage T7 gene 1 which encodes the T7 RNA polymerase. The PCR reaction mixtures contained KOD Hot Start DNA polymerase buffer, 2 mM gS04, 200 μΜ dNTPs, 1 U KOD Hot Start DNA polymerase (Novagen) , 10 μΜ forward primer (Aintl) , 10 u'M reverse primer (Xint2) and 50 ng DNA-template . A Mastercycler gradient cycler (Eppendorf) was used with the following settings: dena- turation for 2 min at 98°C, followed by 34 cycles with 30 sec 98°C, 30 sec 60.5°C annealing temperature, and 2 min of elongation at 72 °C. Final elongation was done for 7 min at 72 °C. The following primers were used:-
Aintl : GTCCGACTTATGCCCGAGAAGATGTTGAGCAAACTTATCGCTTATC
(SEQ ID NO: 6) ;
Xint2 : TGCAAAGAGATTCTTGGCGGAGAAACCATAATTGCATCTACTCG
(SEQ ID NO: 7) ; The resulting PCR product was subsequently used as template for a re-amplification using the same PCR conditions, designed to generate restriction sites for Pstl and Sail to the T7 cassette. For the re-amplification PCR, the following primers were used:
Pstl-forward: GGAAGCGGGCCTGCAGCGGACACCATCGAATGGCGC
(SEQ ID NO: 8) ; and
Sall-reverse : GGGGGGGGGGGTCGACGGAGTCGTATTGATTTGGCG
(SEQ ID NO: 9) .
Following restriction analysis and elution of the resulting fragment from the agarose gel using the QIAquick gel extraction kit (Qiagen, Hilden, Germany) a ligation reaction (Rapid DNA ligation kit, Roche) was performed with a Pstl/Sail digested pIBD5 plasmid (which includes a T5 promoter, inducible by IPTG) . 100 μΐ of E. coli K12 DH10B cells were transformed by electroporation as described elsewhere herein, plated on LB agar plates containing kanamycin (Kan) and cultured at 37 °C over night. One clone on the plates was cultivated for plas- mid-DNA preparation (Qiaprep Spin Miniprep kit; Qiagen) , digested with Pstl and Sail and the correct insertion of the T7- RNA Polymerase (RNAP) cassette was verified by Agarose gel electrophoresis. The newly constructed vector was named pSI. The T7 RNAP gene in pSI was confirmed by sequencing (GATC Biotech AG) . The approved pSI plasmid was used as a template to generate linear DNA for the recombination step, according to the technical protocol of the manufacturer (Gene Bridges) . b) Preparing linear DNA for homologous recombination
To generate linear DNA for recombination, the T7 cassette and the kanamycin resistance gene from pSI were amplified by PCR, adding homology arms on either side that are DNA stretches homologous to the DNA of the desired genomic integration locus, i.e. recA locus of E. coli. The PCR reaction mixtures contained KOD Hot Start DNA polymerase buffer, 2 mM MgS04, 200 μΜ dNTPs, 1 U KOD Hot Start DNA polymerase (Novagen) , 10 μΜ forward primer (5 'harecA), 10 μΜ reverse primer (3'harecA) and 50 ng DNA-template . A Mastercycler gradient (Eppendorf) was used with the following settings: denaturation for 2 min at 98°C, followed by 35 cycles with 30 sec 98°C, 30 sec 65.5°C annealing temperature, and 2 min of elongation at 72 °C. Final elongation was- done for 7 min at 72 °C. The following primers were used:
5 'harecA:
TCGCTATCATCTACAGAGAAATCCGGCGTTGAGTTCGGGTTGCTCAGCAGCTAGATGCATGC TCGAGCGG (SEQ ID NO:10);
31 harecA:
GTAAAGGCTCCATCATGCGCCTGGGTGAAGACCGTTCCATGGATGTGGAACTCTGCTGAAGC CAGTTACC (SEQ ID NO: 11).
PCR products were purified with the QIAquick PCR purification kit (Qiagen) and digested with 10 units of Dpnl for 30 min at 37°C. c) Transforming competent E. coli cells
E. coli cells were transformed with the pRed/ET plasmid by electroporation of BL21 cells (Novagen) . Briefly, 1 μΐ pRed/ET plasmid DNA was added to a 50 μΐ aliquot of electrocompetent cells, transferred to a 1 mm electroporation cuvette and elec- troporated with 1350 Volt using the Electroporator #2510 (Eppendorf) . The time constant should be between 5.0 and 5.4 msec. 1 ml of pre-chilled LB medium (1% soy-peptone, 0.5% yeast extract, 1 % NaCl, pH 7.0) was added, the sample was transferred to a 1.5 ml tube, and incubated in a thermocycler for 1 h at 30°C and 800 rpm. 100 μΐ of the cell suspension were plated on LB agar plus tetracycline (3 g/ml) and plates were incubated over night at 30°C. A single colony was picked from the plates of the pRed/ET electroporation and incubated over night in 1 ml LB medium plus tetracycline at 30 °C, shak- ing at 800 rpm. 30 μΐ of that culture were transferred to two tubes containing 1.4 ml of LB medium plus antibiotic. Cells were grown for approximately 2 h at 30 °C until they reached an optical density (OD) of 0.3. One culture was induced by addition of 50 μΐ 10% L-arabinose while . the other remained non- induced and served as negative control. Both cultures were incubated at 37 °C, 800 rpm for about 1 hour. In order to produce competent cells, both cultures were centrifuged at 4°C, 13000 rpm, washed twice with 1 ml of pre-chilled 10% glycerol and resuspended in about 50 μΐ of 10% glycerol.
These cultures were then transformed with the linear DNA (see above) that contained the T7 and the kanamycin resistance gene from pSI as well as the homology arms for recombination. 400 to 800 ng of linear PCR fragment were added to both the induced and non-induced cells and the suspension was electropo- rated with 1350 Volt. Care was taken that the volume of the DNA sample did not exceed 4 μΐ . 1 ml ice-cold LB medium was added and cells were incubated for 3 hours at 37 °C, 800 rpm. Following centrifugation cells were resuspended in■ 100 μΐ of LB medium, plated on LB agar plus the selected antibiotic in the recommended concentration and incubated over night at 37°C. Two clones were identified. Successful recombination of the cassette into the recA locus in BL21 in these clones was confirmed by colony PCR. Sequence analysis of the whole integrated sequence (lacl, AlacZ, and T7 RNA polymerase gene) revealed absolute identity with the original sequence of this region in BL21-DE3. The new strain was designated RHB-T7 Kahr. d) Removing kanamycin resistance gene
As described above, the new strain RHB-T7 Kanr harbours a kanamycin resistance gene in the bacterial genome. Since the cells generated by the recombination events were intended to be used with pET vectors, further optimisation was required to avoid a double resistance (genomic and episoraal resistance) . Thus, the genomic kanamycin resistance gene was disrupted by inserting into the kanamycin locus a FRT-flanked chloramphenicol resistance cassette via homologous recombination. Subsequently, another recombination event controlled by the flp protein led to a deletion of about 60% of the kanamycin resistance gene. This knockout mutant allows selection of pET transformants due to the episomal kanamycin resistance gene (Kan) .
The kanamycin resistance gene was removed from the genome as follows: A linear PCR product of the FRT-flanked chloramphenicol resistance cassette with 5' and 3' DNA stretches homologous to parts of the kanamycin resistance gene was integrated into the genomic kanamycin locus of RHB-T7 Kanr by homologous recombination. For this purpose, the Red/ET technology for homologous recombination (Gene Bridges, Heidelberg, Germany) was used. Briefly, electrocompetent RHB-T7 Kanr cells were transformed with the pRed/ET plasmid according to the protocol of the manufacturer (see above) . Selection occurred on tetracycline plates and positive clones were transformed with a linear PCR fragment containing 5' and 3' homology arms of the Kanr gene sequence and the FRT-flanked Cm resistance gene. Trans- formants were checked by PCR analysis to verify the modified genome. Seven single clones were picked and analysed by colony PCR for correct insertion into the kanamycin locus of RHB-T7 Kanr. All seven clones analysed were positive. One of these clones was transformed with the pFLP707 plasmid supplied by Gene Bridges. This plasmid carries the flp recombinase gene under transcriptional control of a thermo sensitive promoter, a thermo sensitive origin of replication, and the tetracycline resistance gene for selection of transformants .
A single clone of this transformation was cultivated at 30°C. A shift in temperature to 37 °C induced both the expression of the flp recombinase protein and the loss of pFLP707 plasmid including the tetracycline resistance. The cells were plated on LB agar and single clones were analysed by colony PCR for positive flp recombination events.
Three colonies carrying the FRT-flanked chloramphenicol resistance cassette were cultivated in a microfuge tube containing 1.0 ml LB medium and 15 pg/ml chloramphenicol. A hole was punctured in the lid for air supply. The culture was incubated overnight at 37 °C with shaking at 800 rpm. A microfuge tube with 1.4 ml LB medium and 15 yg chloramphenicol was inoculated with 30 μΐ of the fresh overnight culture, incubated for 2-3 h at 37 °C with shaking at 900 rpm. Cells were centrifuged for 30 sec at 11.000 rpm in a cooled microfuge and the supernatant was discarded by tipping. The pellet was resuspended in 1 ml chilled ddf^O. The centrifugation and resuspension was repeated once. Following centrifugation the supernatant was tipped out once more and 20-30 ul were normally left in the tube with the pellet. Cells were resuspended and permanently kept on ice. Electroporation was performed with 1 μΐ pFLP707 DNA. Subsequent to overnight incubation on tetracycline plates at 30 °C 1. ml of LB medium was inoculated with a single colony and incubated at 30 °C for 2-3h. The temperature was changed to 37 °C and the culture was incubated overnight. One drop of the cell suspension was plated on LB agar. Following incubation overnight at 37 °C single colonies were analysed by PCR for the successful removal of the selection marker chloramphenicol. Additionally, colonies were replica-plated on both LB agar and LB agar conditioned with 15 yg/ml chloramphenicol for selection of positive clones. Two positive clones were identified by loss of chloramphenicol resistance. The clones were confirmed by sequence analysis of the respective genomic region. The new strain was named RHB-T7.
Example 2 : Disruption of the gor gene
For the preparation of electrocompetent cells, 20 ml LB medium were inoculated with an overnight culture of RHB-T7 to reach a start OD600 of around 0.1. Cells were grown at 37 °C up to an OD600 of approximately 0.6. The culture was centrifuged at 4°C for 10 min and 4600 rpm. The supernatant was discarded while the pellet was resuspended in 14 ml of ice-cooled 10% glycerol. Subsequent to centrifugation (same conditions as above) the washing step was repeated. Finally the pellet was resuspended in 700 μΐ 10% glycerol and 50 μΐ aliquots of the cell suspension were immediately frozen in liquid nitrogen.
1 μΐ pRed/ET plasmid DNA was added to a 50 μΐ aliquot of elec- trocompetent cells. After mixing, the sample was kept on ice. The transformation sample was transferred to a 1 mm electropo- ration cuvette and electroporated at 1350 Volt using the Elec- troporator #2510 from Eppendorf with a time constant between 5.0 and 5.4 msec. 1 ml of pre-chilled LB medium was added, the sample was transferred to a 1.5 ml tube, and incubated in a thermocycler for 1 h at 30°C and 800 rpm. 100 μΐ of the cell suspension were plated on LB agar plus tetracycline (3 μg/ml) and plates were incubated over night at 30°C.
A single colony was picked from the plates of the pRed/ET plasmid electroporation and incubated over night in 1 ml LB medium plus tetracycline at 30°C, shaking at 800 rpm. 30 μΐ of that culture were transferred to two tubes containing 1.4 ml of LB medium plus antibiotic. Cells were grown for approximately 2 h at 30 °C until they reached an OD of around 0.3. One culture was induced by addition of 50 μΐ 10% L-arabinose while the other remained non-induced and served as negative control. Both cultures were incubated at 37 °C, 800 rpm for about an hour. In order to produce competent cells, both cultures were centrifuged at 4°C, 13.000 rpm, washed twice with 1 ml of pre- chilled 10% glycerol and resuspended in about 50 μΐ of 10% glycerol. These cells were used for transformation with a linear PCR fragment containing 5' and 3' homology arms of the gor gene sequence. The FRT-Cm-FRT resistance cassette as supplied by Gene Bridges (Heidelberg, Germany) was used as a template for the disruption of the chromosomal gor gene in the RHB-T7 obtained from Example 1. PCR reactions were performed using a Mastercycler gradient from Eppendorf with the following settings: initial denaturatioh for 2 min at 98°C, followed by 34 cycles with 30 sec '98°C, 30 sec 60°C annealing temperature, and 1.5 min of elongation at 72 °C. Final elongation was done for 7 min at 72 °C and storage occurred at 4°C. The KOD Hot Start DNA Polymerase (Novagen) was used, and the primers were as follows:
5 ' hagor :
AACGTGCTCGGTAAAAATAACGTTGATGTAATCAAAGGCTTTGCCCGCTTAATTAACCCTCA CTAAAGGGCGG (SEQ ID NO:12);
3 'hagor:
GATCGGCCGTGATGGTTTCGCCGTTTACCTCCAGCGTTTTGGCATCAACGTAATACGACTCA CTATAGGGCTCG (SEQ ID NO: 13);
In this way, a 1.5 kb PCR product containing the chloramphenicol resistance gene flanked by the FRT sites and the 50 bp gor homology arms was created. PCR products were purified with the QIAquick PCR purification kit (Qiagen) . 400 to 800 ng of the linear PCR fragment containing 5' and 3' homology arms of the gor gene sequence and the FRT-flanked Cm resistance gene were added to both the induced and non-induced cells prepared above and the suspension was electroporated with 1350 Volt.
The purified PCR product was used to electroporate RHB-T7 transformed with the vector pRed/ET (Gene-Bridges) and thus prepared for homologous recombination. The recombination event resulted in the precise integration of the resistance marker cassette into the gor locus of the RHB-T7 genome. Successful disruption of the gor gene was confirmed by PCR. Care was taken that the volume of the DNA sample did not exceed 4 μΐ. 1 ml ice-cold LB medium was added and cells were incubated for 3 hours at 37 °C, 800 rpm. Following centrifugation cells were resuspended in 100 μΐ of LB medium, plated on LB agar with chloramphenicol and incubated over night at 37 °C. Successful recombination into the genome was checked by colony PCR. These PCR reactions as well as the results from replica plating experiments demonstrated that the resistance marker cassette was successfully integrated. Positive clones were transformed with pFLP707 plasmid (Gene Bridges) as described in Example 1 in order to initiate the elimination of the resistance marker. Loss of the resistance marker was confirmed by PCR and replica plating.
Integration and flipping resulted in the disruption of the gor open reading frame and thereby created a gor deficient mutant strain. This was verified by sequencing analysis. The gor open reading frame in RHB-T7 gor" produces a truncated protein with the translation stop at TAA at position 364-366 (triplet 116 of the wild type protein) . The T3 promoter sequence, Flipase Recombination Target site (FRT) and the T7 promoter sequence remain in the chromosome after the flipping event and thereby evoke the disruption of the reading frame. The new strain was named RHB-T7Agror.
Example 3: Construction of pET26b (+) . IFNa2a
The construction of the pET26b (+) IFNa2a expression vector was performed after agarose gel electrophoresis and gel elution of the Nde/Sal-digested pET26b(+) (Invitrogen) plasmid fragment as well as the Nde/Sal-digested and codon-optimized IFNa2a in- sert fragment (pMA0813119, GeneArt) . Based on these two isolated DNA fragments (Qiagen minelute gel extraction kit) a ligation reaction was performed using the Roche Rapid DNA Ligation kit. After transformation of chemically competent E. coli DH10B cells with an aliquot of the ligation mixture, individual colonies were picked from kanamycin-containing LB- plates and cultured overnight at 37°C in liquid . LB-medium containing 50 pg/ml of the selection marker. Afterwards, plasmid DNA was isolated from each clone, followed by a digest using the Nde/Sal restriction enzymes . The digest resulted in a Nde/Sal-fragment of about 550 bp in. two clones with a vector fragment of the correct size of >5000 bp. In order to confirm that the clones comprise the correct expression vector pET26b (+) IFNa2a, clone 1 was subjected to a more specific cleavage using different restriction enzymes, such as Pstl, Bglll, BspHI and Sspl. The result of the restriction cleavage and agarose gel electrophoresis confirmed the correct number and sizes of DNA-fragments . Thus, the expression vector pET26b (+) IFNa2a was transformed into competent RHB-T7Agor cells and resulted in kanamycin resistant colonies from which five were randomly chosen for inoculation of 3 mL kanamycin- containing liquid cultures and storage of corresponding cry- ostocks at -80°C.
Example 4 : Expression analysis of IFNa2a
E. coli cells from the strains RHB-T7 and RHB-T7Agor described above were cultured to the mid-log growth phase. Cells were centrifuged (1 min/16.100 x g/0°C) and resuspended in ice-cold 10% glycerol and centrifuged again (1 min/16.100 x g/0°C). This washing step was repeated once. After the second washing cells were resuspended in 50 pL ice-cold 10% glycerol and the suspension was transferred into a pre-chilled electroporation cuvette (Gap: 2 mm) . An aliquot of the pET26b (+ ) . IFNa2a expression vector was added to the cuvette and electroporation was carried out with an Electroporator 2510 (Eppendorf AG, Germany) applying 1350 Volts (V) . After electroporation, 1 mL of pre-chilled LB medium was added and the cell suspension was transferred to a fresh tube. Following an incubation of one hour at 37 °C with agitation (250 rpm) an aliquot of 50 i was spread out on a LB agar plate, supplemented with 50 g/mL kanamycin and incubated overnight at 37 °C. Single colonies from transformation plates were picked and used for inoculation of 3 mL cultures (LB medium, supplemented with 50 g/mL kanamycin) . After overnight incubation (37°C/250 rpm) primary cryo-preservation stocks were prepared as follows: a 1 mL sample of culture was mixed with 0.5 mL sterile 30% ice-cold glycerol in a cryo tube (final: 10% glycerol). After shock- freezing in liquid nitrogen (LN2) the tubes were stored at -80°C.
The clones obtained by transformation of RHB-T7 and RHB-T7Agor with the pET26b (+) . IFNa2a expression vector were designated RHB-T7/pET26b (+) . IFNa2a and RHB-T7Agor/pET26b (+) . IFNa2a, respectively. The identity and integrity of the pET26b (+) . IFNoc2a expression vector in the different clones obtained by transformation was confirmed by a DNA-fragmentation analysis using the restriction enzymes Bglll, BspHI, Ndel, Pstl, Sail and Sspl .
Cultivation of RHB-T7/pET26b (+) . IFNa2a and RHB-T7Agor/pET- 26b (+) . IFN 2a for IFN production was started by inoculation of 3 mL complex medium [veg.] (27.0 g/L vegetable-peptone, 14.0 g/L yeast extract, 5.0 g/L NaCl, 0.5 g/L MnS04*H20, 25.0 g/L (w/v) Glycerol, 8.65 g/L K2HP04, 6.85 g/L KH2P0 ; pH 7.0 ±0.1) from cryo stocks. The medium was supplemented with 50 g/mL kanamycin. The cultures were incubated at 37 °C with 250 rpm overnight. 15 mL expression cultures were initiated by using aliquots of the 3 mL overnight cultures to achieve a starting OD60o of 0.1 in 15 mL of complex medium [veg.] without antibiotics in a baffled shaker flask at 37°C with 250 rpm. After reaching mid-log phase with an OD6oo of 0.5 to 0.8, IPTG was added (final concentration of 1 mM) and cultures were further cultivated for 3 hours. 1 mL culture samples were taken immediately before (to) and 3 hours after (t3> IPTG-induction .
The 1 mL culture samples were centrifuged (1 min/16.100 x g/0°C) . Cell pellets were resuspended in 4 mL Tris-EDTA-Buffer (pH 7.4), transferred into a glass-tube (inner width 22 mm) and placed in an ice-bath. Fractionation of the cells was achieved using the sonication device UP 400S (Hielscher Ultrasonic GmbH; device parameter: 400W, 24 kHz) equipped with the sonotrode H3. Technical settings: immersion depth: approx. 15 mm; capacity: 75%; cycle: 30 seconds sonication - 30 seconds off; total treatment time: 10 min. Afterwards the sample was transferred to a 15 mL Falcon tube and centrifuged (30 min/4.080 x g/4°C). The insoluble protein fraction was forming a pellet. The supernatant, containing the soluble proteins, was transferred to a fresh 15 mL Falcon tube, spiked with 600 pL 100% trichloroacetic acid (final concentration: 15%) and incubated for one hour at 4°C before centrifugation (30 min/4.080 x g/4°C). The pellet from this step represents the soluble protein fraction. Both pellets were solubilized and adjusted to an OD6oo = 10 by adding IB buffer (8 M Urea, 50 mM DTT, 100 mM Tris-HCl; pH 8.0). A standardization step to OD60o = 10 permitted the direct comparability of relative protein amounts in different lanes of a gel run. For the estimation of protein production rates the effectively measured Οϋεοο of the analyzed culture had to be taken into account.
Total cell protein (TCP) and soluble and insoluble protein fractions were applied to SDS-PAGE with coomassie staining. For all SDS-PAGE gel runs pre-cast NuPAGE® Novex® 12% Bis-Tris gels (Invitrogen, Karlsruhe, Germany) were used in combination with the corresponding XCell SureLock Mini-Cells (Invitrogen) . According to the size of recombinant INFa2a (19 kDa) , a MES buffer system (Invitrogen) was deployed to achieve the best gel resolution. All samples were dissolved in 0.25 vol. LDS sample buffer (Invitrogen), substituted with 0.1 vol. Sample Reducing Agent (Invitrogen) , and heated for 10 min to 95 °C before loaded on a gel. For Coomassie staining the Bio-Safe Coomassie Stain system (Bio-Rad, Munich, Germany) was used according to the supplier's recommendations. Samples to be analyzed by the Electrophoresis Station (Experion, Bio-Rad Laboratories, Hercules, USA) were treated following the instruction of the manufacturer for reducing conditions (Experion Pro260 Analysis Kit Instruction Manual) and loaded on an Expe- rion Pro260 chip (Bio-Rad) . Recording and further analysis of data was carried out with Experion Software System Operation and Data Analysis Tool (Bio-Rad, Version 3.0.226.0).
Results : 3 hours after induction both RHB-T7/pET26b (+) . IFNa2a and RHB-T7Agor/pET26b (+) . IFN 2a showed prominent protein bands at about 19 kDa in SDS-PAGE analysis (the expected molecular weight of human IFNa2a is approx. 18.8 kDa). The protein band was exclusively detected in IPTG-induced cultures which demonstrates that the expression in both clones is tightly controlled (see Fig. 1) . Immunoblot analysis using an anti-IFNa2a antibody confirmed that the protein band observed in the SDS- PAGE was IFNa2a (data not shown) . A comparison of the intensities of the protein bands in the SDS-PAGE of RHB- T7/pET26b (+) . IFN 2a and RHB-T7Agor/pET26b (+) . IFNa2a revealed that both clones express the interferon protein in similar amounts (see Fig. 1) .
When analyzing the soluble and insoluble protein fractions of the clones, it was found that in RHB-T7/pET26b (+) . IFNa2a, the recombinant IFNa2a is almost completely present in inclusion bodies. Conversely, in RHB-T7Agor/pET26b (+) . IFNot2a the produced IFNot2a was nearly completely soluble (see Fig. 2).
Example 5 : Expression analysis of IFN-β and IFN-γ
In accordance with the methods described in Examples 3-4, human IFN-β and human IFN-γ were cloned into a pET26b(+) expression vector. The resulting plasmids pET26b (+) . IFN-β and pET26b (+) . IFN-γ were transformed into the strains RHB-T7Agor and RHB-T7.
Results : Similar to the results observed above with IFN-a2a, it could be shown that in RHB-T7, both human IFN-β and human IFN-γ were produced mainly in the form of inclusion bodies, whereas in RHB-T7Agor, at least about 90% of the recombinant protein was expressed in soluble form (data not shown) .
Example 6 : Comparative expression analysis of IFNa2a
The RHB-T7Agor strain prepared in accordance with Example 2 was then used to create a trxB'/gor' double knock-out strain. The inactivating mutation in the trxB gene was generated essentially as discussed above in Example 2 in connection with the gor gene. The primers used for inactivation of the trxB gene were the following:
5 'hatrx:
5 ' -CACCAAGTTTGAAACTGAGATCATTTTTGATCATATCAACAAGGTGGATCAATTAA CCCTCACTAAAGGGCGG-31 (SEQ ID NO:14);
3 'hatrx:
5 ' -GCAAGTGTATTCGCCGTTATCGCCATTCAGACGGAACGGACGGTTTTGCATAATACGA CTCACTATAGGGCTCG-31 (SEQ ID NO:15);
The resulting strain was designated RHB-T7Agor/trx. As explained above, trxB~/gor~ double knock-out strains can only grow if they exhibit a mutation in the ahpC* . Therefore, . in the RHB-T7Agor/trx described herein, the ahpC* suppressor mutation was achieved by homologous recombination. No such mutation was necessary in the RHB-T7Agor strain.
Both RHB-T7Agor and RHB-ΎΊAgor/trx were transformed with 100 ng pET26b (+) IFNa2a DNA which led to strains RHB-T7A- gor/pET26b (+) .IFNa2a and RHB-T7Agor/trx-pET26b (+) . IFNa2a, respectively .
Similarly, competent Origami (DE3) cells (Novagen) were transformed with 100 ng pET26b (+) IFNa2a DNA and incubated overnight at 37 °C on selective LB agar plates with either 50 pg/ml or 150 pg/ml kanamycin. 20 colonies were found on the 150 pg/ml plate, whereas ≥500 colonies grew on the 50 pg/ml plate. Plas- mid DNA preparation (Qiagen miniprep kit) and subsequent restriction digest of three independent clones picked from the 150 g/ml plate revealed that all three clones were carrying the pET26 (+) . IFNa2a expression vector. One clone was chosen for the following expression experiments (Origami (DE3) / pET26b (+) IFNa2a.
Expression analysis and further fractionation steps, SDS-PAGE of the recombinant IFN-cx2a protein and immunoblot detection were performed in accordance with the methods described in examples 3-4.
Results : It was observed that in all tested strains the majority of the recombinantly expressed IFN-a2a protein was produced in the soluble fraction. Only small amounts of protein were detected in inclusion bodies. Interestingly, the amounts of soluble IFN-a2a protein were significantly higher in RHB-T7Agor-pET26b (+) . IFNa2a when compared to RHB-T7Agor/trx- pET26b (+) . IFN 2a or Origami (DE3) /pET26b (+). IFN 2a. The amounts detected in RHB-T7Agor/trx-pET26b (+) . IFNcc2a were higher than those in Origami (DE3) /pET26b (+). IFNa2a (see Fig. 3).

Claims

Host cell for the recombinant expression of a mammalian interferon protein, said cell comprising (a) a functional endogenous trxB gene; and (b) an inactivated endogenous gor gene .
Host cell of claim 1, wherein said host cell further comprises a polynucleotide sequence encoding an exogenous interferon protein.
Host cell of claim 2, wherein said polynucleotide sequence is included in an expression vector.
Host cell of claim 2 or 3, wherein said interferon is selected from the group consisting of interferon alpha, interferon beta, and interferon gamma or an active fragment thereof .
Host cell of claim 4, wherein said interferon protein is a human interferon protein or a biologically active fragment thereof.
Host cell of claim 5, wherein said interferon protein is human interferon a2a or a biologically active fragment thereof .
Host cell of any of claims 1-6, wherein said host cell is a bacterial cell.
Host cell of claim 7, wherein said bacterial cell is an Escherichia coli cell.
Host cell of claim 8, wherein said Escherichia coli cell has been derived from Escherichia coli strain BL21.
Host cell of any of claims 1 9, wherein said cell comprises a T7 RNA polymerase gene.
11. Host cell of claim 10, wherein said T7 RNA polymerase gene is inserted into the genome of the host cell.
12. Method for the recombinant expression of a soluble interferon in a host cell, comprising-
(a) providing a host cell of any of claims 2-11;
(b) culturing the host cell under conditions that allow the expression of the interferon protein;
(c) obtaining the soluble interferon protein from the host cell.
13. Method of claim 12, wherein step (c) comprises disruption of the cells.
14. Method of claim 13, wherein step (c) further comprises purification of the protein by chromatography.
15. Use of a host cell according to any of claims 1-11 for the recombinant expression of a soluble interferon.
PCT/EP2012/059373 2011-05-26 2012-05-21 Recombinant expression of soluble interferon Ceased WO2012160027A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
MDA20130099A MD4384C1 (en) 2011-05-26 2012-05-21 Host cell and method for the recombinant expression of a soluble interferon
EP12723449.0A EP2714890B1 (en) 2011-05-26 2012-05-21 Recombinant expression of soluble interferon
EA201391666A EA027218B1 (en) 2011-05-26 2012-05-21 Recombinant expression of soluble interferon
DK12723449.0T DK2714890T3 (en) 2011-05-26 2012-05-21 Recombinant expression of soluble interferon
UAA201314555A UA110831C2 (en) 2011-05-26 2012-05-21 Recombinant expression of soluble interferon

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP11167761A EP2527424A1 (en) 2011-05-26 2011-05-26 Recombinant expression of soluble Interferon
EP11167761.3 2011-05-26

Publications (1)

Publication Number Publication Date
WO2012160027A1 true WO2012160027A1 (en) 2012-11-29

Family

ID=46149442

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2012/059373 Ceased WO2012160027A1 (en) 2011-05-26 2012-05-21 Recombinant expression of soluble interferon

Country Status (9)

Country Link
EP (2) EP2527424A1 (en)
AR (1) AR086556A1 (en)
DK (1) DK2714890T3 (en)
EA (1) EA027218B1 (en)
GE (1) GEP201606542B (en)
HU (1) HUE026998T2 (en)
MD (1) MD4384C1 (en)
UA (1) UA110831C2 (en)
WO (1) WO2012160027A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2796556A1 (en) 2013-04-25 2014-10-29 Rijksuniversiteit Groningen Improved means and methods for expressing recombinant proteins
CN111647614A (en) * 2019-12-31 2020-09-11 北京宝易生物技术有限公司 Construction method and application of recombinant bacterium for producing canine alpha-interferon

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106399321A (en) * 2016-08-27 2017-02-15 华南农业大学 Production process of fusion expression recombinant chicken interferon alpha
CN111172184A (en) * 2020-03-10 2020-05-19 大连理工大学 Fusion gene and fusion protein for obtaining human recombinant interferon based on gene modification and preparation method thereof

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0306870A2 (en) 1987-09-10 1989-03-15 BASF Aktiengesellschaft Gamma-interferon derivatives, process for their manufacture, vectors and medicines obtained therefrom
US5676942A (en) 1992-02-10 1997-10-14 Interferon Sciences, Inc. Composition containing human alpha interferon species proteins and method for use thereof
US5690925A (en) 1983-12-16 1997-11-25 Genentech, Inc. Recombinant gamma interferons having enhanced stability and methods therefor
US5766864A (en) 1994-11-01 1998-06-16 Sumitomo Pharmaceuticals Company, Ltd. Method of measuring interferon acitivity
US5770191A (en) 1995-05-24 1998-06-23 University Of Florida Active C-terminal peptides of interferon--gamma and their use
US6046034A (en) 1995-09-18 2000-04-04 Fraunhofer-Gesellschaft Zur Forderung Der Angewandten Forschung E. V. Thermostable variants of human interferon-γ(IFN-γ)
US20060246541A1 (en) * 2005-02-11 2006-11-02 Minea Radu O Method of expressing proteins with disulfide bridges
EP2000480A1 (en) * 2007-06-07 2008-12-10 Institut Pasteur Method for the production of high-level soluble human recombinant interferon alpha in e. coli and vectors useful for such a production
US20090258394A1 (en) 2008-04-10 2009-10-15 Institut Pasteur Method for the production of high-level soluble human recombinant interferon alpha in e. coli and vectors useful for such a production

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5510472A (en) * 1979-11-21 1996-04-23 Yeda Research And Development Co. Ltd. Production of recombinant human interferon-beta2
US5554513A (en) * 1979-11-21 1996-09-10 Yeda Research & Development Co. Ltd. Production of recombinant human interferon-beta2
JP3757281B2 (en) * 2003-03-25 2006-03-22 独立行政法人酒類総合研究所 Production system of polygalacturonase by Escherichia coli
CN101225398A (en) * 2007-01-18 2008-07-23 王尚武 Technology for preparing active t-PA by procaryotic cells
CN101921330B (en) * 2010-06-02 2013-07-17 北京三元基因工程有限公司 Recombinant human interferon alpha 1b mutant and preparation method thereof
CN102978276B (en) * 2012-12-24 2015-11-04 丁兆明 A kind of method of rapid detection cell GSH-PX activity

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5690925A (en) 1983-12-16 1997-11-25 Genentech, Inc. Recombinant gamma interferons having enhanced stability and methods therefor
EP0306870A2 (en) 1987-09-10 1989-03-15 BASF Aktiengesellschaft Gamma-interferon derivatives, process for their manufacture, vectors and medicines obtained therefrom
US5676942A (en) 1992-02-10 1997-10-14 Interferon Sciences, Inc. Composition containing human alpha interferon species proteins and method for use thereof
US5766864A (en) 1994-11-01 1998-06-16 Sumitomo Pharmaceuticals Company, Ltd. Method of measuring interferon acitivity
US5770191A (en) 1995-05-24 1998-06-23 University Of Florida Active C-terminal peptides of interferon--gamma and their use
US6046034A (en) 1995-09-18 2000-04-04 Fraunhofer-Gesellschaft Zur Forderung Der Angewandten Forschung E. V. Thermostable variants of human interferon-γ(IFN-γ)
US20060246541A1 (en) * 2005-02-11 2006-11-02 Minea Radu O Method of expressing proteins with disulfide bridges
EP2000480A1 (en) * 2007-06-07 2008-12-10 Institut Pasteur Method for the production of high-level soluble human recombinant interferon alpha in e. coli and vectors useful for such a production
US20090258394A1 (en) 2008-04-10 2009-10-15 Institut Pasteur Method for the production of high-level soluble human recombinant interferon alpha in e. coli and vectors useful for such a production

Non-Patent Citations (16)

* Cited by examiner, † Cited by third party
Title
BESSETTE P H ET AL: "Efficient folding of proteins with multiple disulfide bonds in the Escherichia coli cytoplasm", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, NATIONAL ACADEMY OF SCIENCES, US, vol. 96, no. 24, 23 November 1999 (1999-11-23), pages 13703 - 13708, XP002233564, ISSN: 0027-8424, DOI: 10.1073/PNAS.96.24.13703 *
DIJKEMA ET AL., EMBO J., vol. 4, 1985, pages 761
FAULKNER ET AL., PNAS, vol. 105, no. 18, 2008, pages 6735 - 40
FLICKINGER, M.C., DREW, S.W.: "Encyclopedia of Bioprocess Technology: Fermentation, Biocatalysis, and Bio- separation", vol. 1-5, 1999, JOHN WILEY & SONS
GORMAN ET AL., PROC. NATL. ACAD. SCI., vol. 79, 1982, pages 6777
HATAHET FERAS ET AL: "Disruption of reducing pathways is not essential for efficient disulfide bond formation in the cytoplasm of E. coli", MICROBIAL CELL FACTORIES, vol. 9, 67, 13 September 2010 (2010-09-13), XP002679010, ISSN: 1475-2859 *
M BECKER-HAPAK ET AL: "Role of rpoS in the regulation of glutathione oxidoreductase ( gor) in Escherichia coli", FEMS MICROBIOLOGY LETTERS, vol. 134, no. 1, 1 December 1995 (1995-12-01), pages 39 - 44, XP055009670, ISSN: 0378-1097, DOI: 10.1016/0378-1097(95)00378-I *
MAERTENS ET AL., PROTEIN SCIENCE, vol. 19, 2010, pages 1312 - 1326
MANIATIS ET AL.: "Molecular Cloning, A laboratory Manual", 1982, COLD SPRING HARBOR LABORATORY
NIENHUIS ET AL.: "Viruses and Bone Marrow", vol. 16, 1993, article "Hematology", pages: 353 - 414
POUWELS ET AL.: "Cloning Vectors", 1985, ELSEVIER
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989
SKOKO ET AL., BIOTECHNOL. APPL. BIOCHEM., vol. 38, 2003, pages 257 - 65
SMIRNOVA G V ET AL: "Effects of Cystine and Hydrogen Peroxide on Glutathione Status and Expression of Antioxidant Genes in Escherichia coli", BIOCHEMISTRY (MOSCOW), KLUWER ACADEMIC PUBLISHERS-PLENUM PUBLISHERS, NE, vol. 70, no. 8, 1 August 2005 (2005-08-01), pages 926 - 934, XP019294660, ISSN: 1608-3040 *
SMITH; WATERMAN, ADV. APPL. MATH., vol. 2, 1981, pages 482 - 489
T. CREIGHTON: "Proteins: Structure and Molecular Properties, 2nd edition,", 1993, W. H. FREEMAN AND COMPANY

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2796556A1 (en) 2013-04-25 2014-10-29 Rijksuniversiteit Groningen Improved means and methods for expressing recombinant proteins
CN111647614A (en) * 2019-12-31 2020-09-11 北京宝易生物技术有限公司 Construction method and application of recombinant bacterium for producing canine alpha-interferon
CN111647614B (en) * 2019-12-31 2022-07-12 北京宝易生物技术有限公司 Construction method and application of recombinant bacterium for producing canine alpha-interferon

Also Published As

Publication number Publication date
MD20130099A2 (en) 2014-06-30
HUE026998T2 (en) 2016-08-29
EA027218B1 (en) 2017-07-31
DK2714890T3 (en) 2015-11-30
UA110831C2 (en) 2016-02-25
MD4384C1 (en) 2016-06-30
MD4384B1 (en) 2015-11-30
EP2714890B1 (en) 2015-09-16
EP2527424A1 (en) 2012-11-28
EP2714890A1 (en) 2014-04-09
GEP201606542B (en) 2016-09-26
EA201391666A1 (en) 2014-03-31
AR086556A1 (en) 2014-01-08

Similar Documents

Publication Publication Date Title
JP6817939B2 (en) Fusion partner for peptide production
EP2714890B1 (en) Recombinant expression of soluble interferon
AU2016382134B2 (en) Peptide tag and tagged protein including same
US9493804B2 (en) Agents and methods for the expression and secretion of peptides and proteins
KR100761486B1 (en) Mass production of bioactive proteins and peptides using phage
AU2001284914A1 (en) Phage-dependent Superproduction of Biologically Active Protein and Peptides
JP2012519476A (en) Nucleic acids for cloning and expression of multiprotein complexes
EP1609867B1 (en) Nucleic acid construct, expression vector and method for enhancing the production of recombinant protein
AU2011223627B2 (en) Method for producing soluble recombinant interferon protein without denaturing
KR101884384B1 (en) Carbonic Anhydrase Mutant Having Enhanced Thermostability and Activity
RU2230116C2 (en) VECTOR FOR EXPRESSION AND SECRETION OF HUMAN ALPHA-INTERFERON (HIFN(hIFNα)), STR AIN ESCHERICHIA COLI FOR EXPRESSION AND SECRETION OF HIFNhIFNα, (VARIANTS) AND METHOD FOR PRODUCING HIFNhIFNα,
CN111793118B (en) CheY2 mutant protein and application thereof
TW201300533A (en) Recombinant expression of soluble interferon
Sato et al. Expression of tuna growth hormone cDNA in Escherichia coli
JP2006006312A (en) Nucleic acid constructs and expression vectors for enhanced production of recombinant proteins and methods for mass production of recombinant proteins
KR102921222B1 (en) Novel variant of ABC transporter ATP-binding subunit and method for producing L-histidine using the same
Mudiyanselage et al. Cloning of DNA Polymerase-ǀ Gene from Thermophilic Bacillus licheniformis Strain NWMF1 into an E. coli Expression System
RU2790662C1 (en) AMINOACIL-tRNA SYNTHASE, EFFECTIVE INTRODUCTION OF LYSINE DERIVATIVES
CN118272338A (en) Muteins, nucleic acid molecules, fusion tags and uses thereof
US20050069975A1 (en) Methods of enhancing yields of soluble proteins
US20050095672A1 (en) Recombinant IGF expression systems
KR101860103B1 (en) Interferon-beta signal peptide variant and use thereof
JPH0892292A (en) Protein having biological activity of canine interferon-β
JP2021040596A (en) Reverse transcriptase

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12723449

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2012723449

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 201391666

Country of ref document: EA

ENP Entry into the national phase

Ref document number: 20130099

Country of ref document: MD

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: A 2013 0099

Country of ref document: MD

WWE Wipo information: entry into national phase

Ref document number: 13338

Country of ref document: GE

WWE Wipo information: entry into national phase

Ref document number: A201314555

Country of ref document: UA