WO2012155071A1 - Methods of identifying lysyl oxidase - like - 2 (loxl2) binding partners - Google Patents

Methods of identifying lysyl oxidase - like - 2 (loxl2) binding partners Download PDF

Info

Publication number
WO2012155071A1
WO2012155071A1 PCT/US2012/037580 US2012037580W WO2012155071A1 WO 2012155071 A1 WO2012155071 A1 WO 2012155071A1 US 2012037580 W US2012037580 W US 2012037580W WO 2012155071 A1 WO2012155071 A1 WO 2012155071A1
Authority
WO
WIPO (PCT)
Prior art keywords
loxl2
polypeptide
cells
tag
sample
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2012/037580
Other languages
French (fr)
Inventor
Jennie LUGASSY
Shelly ZAFFRYAR-EILOT
Sharon SOUEID
Amit MORDOVIZ
Victoria Smith
Ofra Kessler
Gera Neufeld
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Technion Research and Development Foundation Ltd
Gilead Biologics Inc
Original Assignee
Technion Research and Development Foundation Ltd
Gilead Biologics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Technion Research and Development Foundation Ltd, Gilead Biologics Inc filed Critical Technion Research and Development Foundation Ltd
Publication of WO2012155071A1 publication Critical patent/WO2012155071A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/573Immunoassay; Biospecific binding assay; Materials therefor for enzymes or isoenzymes
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6803General methods of protein analysis not limited to specific proteins or families of proteins
    • G01N33/6845Methods of identifying protein-protein interactions in protein mixtures

Definitions

  • Lysyl-oxidase like protein-2 (LOXL2) was initially identified as an upregulated gene in Werner's syndrome. It belongs to the family of the lysyl-oxidases and catalyses the deamination of the ⁇ -amino group of lysines of collagen monomers resulting in the formation of covalent cross-linkages.
  • the catalytic domain of the lysyl-oxidases is highly conserved among lysyl-oxidases as is the amino-acids sequence of the lysyl tyrosyl quinone (LTQ) cofactor domain that is unique to these copper binding enzyme family.
  • LOXL2 The enzyme activity of LOXL2 can be inhibited, like the enzyme activity of other lysyl-oxidases, by the irreversible competitive lysyl-oxidase inhibitor b-aminoproprionitrile (BAPN).
  • BAPN irreversible competitive lysyl-oxidase inhibitor b-aminoproprionitrile
  • LOXL2 was found to enhance tumor invasion and tumor fibrosis and to induce tumoral and hepatic fibrosis.
  • EMT epithelial to mesenchymal transition
  • LOXL2 High levels of LOXL2 have been found to be correlated with higher levels of snail expression. Furthermore, silencing of LOXL2 up regulated genes associated with epidermal differentiation. Lysyl- oxidase (LOX) and LOXL2 were found to exert opposite effects on the LOXL2
  • LOX was found to promote differentiation while LOXL2 was found to inhibit the differentiation of keratinocytes and to be up- regulated in differentiating keratinocytes.
  • the present disclosure in certain embodiments provides methods of identifying
  • LOXL2 lysyl oxidase-like-2
  • the methods are carried out in vitro. In some aspects, the methods are carried out by a) contacting a LOXL2 polypeptide with components of a sample; and b) identifying a component in the sample that binds to the LOXL2 polypeptide. In some aspects, a component or factor that binds to the LOXL2 polypeptide is a candidate binding partner.
  • the sample is a whole cell lysate.
  • identifying the binding partners includes separating components of the lysate, for example, via gel electrophoresis. In one example, it further includes transferring separated components to a membrane, thereby immobilizing the components on the membrane, contacting the LOXL2 polypeptide with the immobilized components, and detecting binding of the LOXL2 polypeptide with one or more immobilized components.
  • the contacting is carried out by immunoprecipitation.
  • the LOXL2 polypeptide includes an immunological tag.
  • co-immunoprecipitation is carried out using an antibody that specifically binds the tag.
  • the identifying includes identifying a component in the sample that co-immunoprecipitates with the tagged LOXL2 polypeptide.
  • FIGs. 1 A and IB depict levels of LOXL2 mRNA expression in HaCaT cells in
  • FIG. 1C depicts a 3 kb fragment containing part of the LOXL2 promoter.
  • FIG. ID depicts levels of expression of a luciferase reporter gene fused downstream to the fragment of FIG. 1C in HaCaT cells transfected with this construct, under various conditions.
  • FIG. IE depicts expression levels of the keratinocyte differentiation marker involucrin in HaCaT cells under various conditions.
  • FIG. IF depicts the effect of LOXL2 on involucrin expression induced by keratinocyte differentiation inducing factors.
  • FIGs. 2A and 2B depict effects of a specific shRNA on endogenous LOXL2
  • FIG. 2C depicts the effects of the antibody AB0023 on involucrin mRNA expression in HaCaT cells in low calcium concentrations.
  • FIG. 2D depicts effects of AB0023 or a polyclonal antibody directed against LOXL2 on the effect of LOXL2 myc on involucrin expression.
  • FIG. 2E depicts the effect of the lysyl-oxidase enzyme activity inhibitor BAPN on the inhibitory effect of LOXL2 on involucrin expression.
  • FIG. 3A schematically depicts an enzyme dead LOXL2 point mutant (LOXL2 Y689F ) .
  • FIG. 3B depicts a comparison of enzymatic activities of LOXL2 and LOXL2 Y689R
  • FIG. 3C depicts effects on expression of involucrin mRNA of LOXL2 and
  • FIGs. 3D and 3E depict effects of purified LOXL2 myc and LOXL2 Y689F on the expression of involucrin mRNA and protein, respectively.
  • FIG. 3F depicts the effect of tthe enzyme dead LOXL2 point mutant on the differentiation of HACAT cells.
  • FIGs. 4A-C depict a schematic illustration showing the various SRCR deletion
  • FIGs. 5A and B depict evidence for a putative LOXL2 receptor of HaCaT cells.
  • FIG. 6 provides a LOXL2 amino acid sequence (SEQ ID NO:9).
  • FIGs. 7A and 7B depict the effect of various parameters on endogenous LOXL2 mRNA expression.
  • polypeptide refers to a polymeric form of amino acids of any length, which can include genetically coded and non-genetically coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having modified peptide backbones.
  • the term includes fusion proteins, including, but not limited to, fusion proteins with a heterologous amino acid sequence, fusions with heterologous and homologous leader sequences, with or without N-terminal methionine residues; immunologically tagged proteins; and the like.
  • nucleic acid molecule and “polynucleotide” are used interchangeably and refer to a polymeric form of nucleotides of any length, either
  • Non-limiting examples of polynucleotides include linear and circular nucleic acids, messenger RNA
  • mRNA mRNA
  • cDNA recombinant polynucleotides
  • vectors probes, and primers.
  • operably linked refers to functional linkage between molecules to provide a desired function.
  • “operably linked” in the context of nucleic acids refers to a functional linkage between nucleic acids to provide a desired function such as transcription, translation, and the like, e.g., a functional linkage between a nucleic acid expression control sequence (such as a promoter, signal sequence, or array of transcription factor binding sites) and a second polynucleotide, wherein the expression control sequence affects transcription and/or translation of the second polynucleotide.
  • “Operably linked” in the context of a polypeptide refers to a functional linkage between amino acid sequences (e.g., of different domains) to provide for a described activity of the polypeptide.
  • isolated refers to a protein of interest that, if naturally occurring, is in an
  • isolated is meant to include proteins that are within samples that are substantially enriched for the protein of interest and/or in which the protein of interest is partially or substantially purified. Where the protein is not naturally occurring, “isolated” indicates the protein has been separated from an environment in which it was made by either synthetic or recombinant means.
  • substantially pure indicates that an entity (e.g., polypeptide) makes up greater than about 75% of the total content of the composition (e.g., total protein of the composition).
  • a “substantially pure” polypeptide refers to compositions in which at least 75%, at least 85%, or at least 90%, or more than 90%, of the total composition is the polypeptide.
  • the polypeptide can make up greater than about 90%, greater than about 95%, or greater than about 98% of the total protein in the composition.
  • the present disclosure provides in vitro methods of identifying LOXL2 binding
  • the methods generally involve contacting a LOXL2 polypeptide with a sample (e.g., a sample that may include a LOXL2 binding partner); and identifying components of the sample that bind LOXL2.
  • a sample e.g., a sample that may include a LOXL2 binding partner
  • a LOXL2 polypeptide can bind to a LOXL2 binding partner with an affinity of from about 10 "6 M to about 5 x 10 "6 M, from about 5 x 10 "6 M to about 10 "7 M, from about 10 "7 M to about 5 x 10 "7 M, from about 5 x 10 "7 M to about 10 ⁇ 8 M, from about 10 ⁇ 8 M to 10 "9 M, or greater than 10 "9 M.
  • Amino acid sequences of LOXL2 polypeptides, and nucleotide sequences encoding the LOXL2 polypeptides are known in the art, and can be used in a screening method of the present disclosure. See, e.g., GenBank Accession No. NP_002309 (Homo sapiens LOXL2); and GenBank Accession No. NM_0023318 (nucleotide sequence encoding the amino acid sequence provided in GenBank Accession No. NP_002309); and Jourdan-Le Saux et al. (1999) J. Biol. Chem. 274: 12939.
  • a LOXL2 polypeptide suitable for use in a subject screening method can comprise an amino acid sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to a contiguous stretch of from about 100 amino acids (aa) to about 200 aa, from about 200 aa to about 300 aa, from about 300 aa to about 400 aa, from about 400 aa to about 500 aa, from about 500 aa to about 600 aa, from about 600 aa to about 700 aa, or from about 700 aa to 774 aa, of the amino acid sequence depicted in Figure 6.
  • a LOXL2 polypeptide suitable for use in a subject screening method can comprise an amino acid sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to a contiguous stretch of from about 100 amino acids (aa) to about 200 aa, from about 200 aa to about 300 aa, from about 300 aa to about 400 aa, from about 400 aa to about 500 aa, from about 500 aa to about 600 aa, from about 600 aa to about 700 aa, or from about 700 aa to 774 aa, of the amino acid sequence depicted in Figure 6, and can have a Y689F amino acid substitution.
  • a LOXL2 polypeptide suitable for use in a subject screening method can comprise an amino acid sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to a contiguous stretch of from about 100 amino acids (aa) to about 200 aa, from about 200 aa to about 300 aa, from about 300 aa to about 400 aa, from about 400 aa to about 500 aa, from about 500 aa to about 600 aa, from about 600 aa to about 700 aa, or from about 700 aa to 774 aa, of the amino acid sequence depicted in Figure 6, and can lack one or more domains, e.g., an SRC1 domain, an SRC2 domain, an SRC3 domain, an SRC4 domain, a copper binding domain, an LTQ domain, or a catalytic domain, as depicted schematic
  • a LOXL2 polypeptide suitable for use in a subject screening method can comprise an amino acid sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to an SRC1 domain, an SRC2 domain, an SRC3 domain, an SRC4 domain, a copper binding domain, an LTQ domain, or a catalytic domain, of LOXL2.
  • the LOXL2 polypeptide used in the screening assay have a length of from about 25 amino acids (aa) to about 50 aa, from about 50 aa to about 100 aa, from about 100 aa to about 150 aa, from about 150 aa to about 200 aa, from about 200 aa to about 300 aa, from about 300 aa to about 400 aa, from about 400 aa to about 500 aa, from about 500 aa to about 600 aa, from about 600 aa to about 700 aa, or from about 700 aa to 774 aa.
  • Suitable methods to identify proteins which bind or interact with LOXL2 include, but are not limited to, Far Western Blotting, Protein-Protein binding arrays, Co- Immunoprecipitation (IP) as well as cell-based assays and enzyme linked
  • ELISA immunosorbent assay
  • the screening method is carried out in vitro, in a cell-free
  • the in vitro cell-free assay will employ an isolated LOXL2 polypeptide, where "purified” refers to free of contaminants or any other undesired components.
  • Purified LOXL2 polypeptide that is suitable for a subject screening method will in some embodiments be at least about 50% pure, at least about 60% pure, at least about 70% pure, at least about 75% pure, at least about 80% pure, at least about 85% pure, at least about 90% pure, at least about 95% pure, at least about 98% pure, at least about 99% pure, or greater than 99% pure.
  • the screening method is carried out in vitro, in a cell-based assay, where the LOXL2 polypeptide and any binding partner are present in or on a cell.
  • a FRET- or BRET-based assay may be used.
  • the cell is genetically modified with a nucleic acid comprising a nucleotide sequence encoding the LOXL2 polypeptides.
  • the nucleic acid can be an expression construct which provides for production of a LOXL2 polypeptide in the cell.
  • the assay is carried out in a mammalian cell. Suitable mammalian cells include primary cells and immortalized cell lines.
  • Suitable mammalian cell lines include human cell lines, non-human primate cell lines, rodent (e.g., mouse, rat) cell lines, and the like.
  • Suitable mammalian cell lines include, but are not limited to, HeLa cells (e.g., American Type Culture Collection (ATCC) No. CCL-2), CHO cells (e.g., ATCC Nos. CRL9618, CCL61, CRL9096), 293 cells (e.g., ATCC No. CRL- 1573), Vero cells, NIH 3T3 cells (e.g., ATCC No. CRL-1658), Huh-7 cells, BHK cells (e.g., ATCC No. CCL10), PC12 cells (ATCC No.
  • HeLa cells e.g., American Type Culture Collection (ATCC) No. CCL-2
  • CHO cells e.g., ATCC Nos. CRL9618, CCL61, CRL9096
  • 293 cells e.g., ATCC No. C
  • COS cells COS- 7 cells (ATCC No. CRL1651), RATI cells, mouse L cells (ATCC No. CCLI.3), human embryonic kidney (HEK) cells (ATCC No. CRL1573), HLHepG2 cells, and the like.
  • the assay can also be carried out in a yeast cell.
  • reagents such as salts, neutral proteins, e.g. albumin, detergents, etc., including agents that are used to facilitate optimal enzyme activity and/or reduce non-specific or background activity.
  • Reagents that improve the efficiency of the assay such as protease inhibitors, anti- microbial agents, etc. may be used.
  • the components of the assay mixture are added in any order that provides for the requisite activity. Incubations are performed at any suitable temperature, typically between 4°C and 40°C. Incubation periods are selected for optimum activity, but may also be optimized to facilitate rapid high- throughput screening. Typically between 0.1 hour and 1 hour will be sufficient.
  • Assays of the present disclosure include controls, where suitable controls include a sample (e.g., a sample comprising the LOXL2 polypeptide and a known binding partner, e.g., an antibody specific for LOXL2; a sample comprising the LOXL2 polypeptide and an irrelevant antibody, e.g., an antibody that does not bind LOXL2).
  • a sample e.g., a sample comprising the LOXL2 polypeptide and a known binding partner, e.g., an antibody specific for LOXL2; a sample comprising the LOXL2 polypeptide and an irrelevant antibody, e.g., an antibody that does not bind LOXL2.
  • a plurality of assay mixtures can be run in parallel with samples.
  • a LOXL2 polypeptide is contacted with a sample, such that the LOXL2 polypeptide comes into contact with components of the sample, which components may include a LOXL2 binding partner.
  • Samples include, e.g., cell lysates; conditioned medium; tissue homogenates; arrays of polypeptides; and the like.
  • a cell lysate can be made from a mammalian cell.
  • Suitable mammalian cells include primary cells and immortalized cell lines.
  • Suitable mammalian cell lines include human cell lines, non-human primate cell lines, rodent (e.g., mouse, rat) cell lines, and the like.
  • Suitable mammalian cell lines include, but are not limited to, HeLa cells (e.g., American Type Culture Collection (ATCC) No. CCL-2), CHO cells (e.g., ATCC Nos. CRL9618, CCL61, CRL9096), 293 cells (e.g., ATCC No. CRL-1573), Vero cells, NIH 3T3 cells (e.g., ATCC No.
  • Huh-7 cells BHK cells (e.g., ATCC No. CCL10), PC12 cells (ATCC No. CRL1721), COS cells, COS-7 cells (ATCC No. CRL1651), RATI cells, mouse L cells (ATCC No. CCLI.3), human embryonic kidney (HEK) cells (ATCC No. CRL1573), HLHepG2 cells, and the like.
  • BHK cells e.g., ATCC No. CCL10
  • PC12 cells ATCC No. CRL1721
  • COS cells COS-7 cells
  • RATI cells RATI cells
  • mouse L cells ATCC No. CCLI.3
  • HEK human embryonic kidney
  • HLHepG2 cells Detectably labeled polypeptides
  • the LOXL2 polypeptide will be detectably labeled ("tagged").
  • tag is meant an attached molecule or molecules useful for the identification or isolation of the attached molecule(s), which can be substrate binding molecules.
  • a tag can be an attachment tag or a label tag.
  • Components having a tag are referred to as "tag-X", wherein X is the component (e.g., a LOXL2 polypeptide).
  • tag refers to any suitable tag that can be directly (i.e., a primary label) or indirectly (i.e., a secondary label) detected; for example a label can be visualized and/or measured or otherwise identified so that its presence or absence can be known.
  • label include, but are not limited to, fluorescent labels (e.g. a green fluorescent protein, a red fluorescent protein, a yellow fluorescent protein, etc.) and label enzymes.
  • Exemplary tags include, but are not limited to, an optically-detectable label, a partner of a binding pair, and a surface substrate binding molecule (or attachment tag). As will be evident to the skilled artisan, many molecules may find use as more than one type of tag, depending upon how the tag is used. In one embodiment, the tag or label as described below is incorporated into the polypeptide as a fusion protein.
  • tag-components can be made in various ways, depending largely upon the form of the tag.
  • Components and tags can be linked by a covalent bond. Examples of tags are described below.
  • the tag is a polypeptide which is provided as a portion of a chimeric molecule comprising a first polypeptide fused to another, heterologous polypeptide or amino acid sequence.
  • a chimeric molecule comprises a fusion of a first polypeptide with a tag polypeptide.
  • the tag is generally placed at the amino-or carboxyl-terminus of the polypeptide.
  • the tag is usually a genetically encodable tag (e.g., fluorescent polypeptide, immunodetectable polypeptide, and the like).
  • the tag polypeptide can be, for example, an immunodetectable label (i.e., a
  • Tag polypeptides provide for, for example, detection using an antibody against the tag polypeptide, and/or a ready means of isolating or purifying the tagged polypeptide (e.g., by affinity purification using an anti-tag antibody or another type of receptor- ligand matrix that binds to the tag).
  • the production of tag- polypeptides by recombinant means is within the knowledge and skill in the art.
  • An "optically detectable label” includes labels that are detectably due to inherent properties (e.g., a fluorescent label), or which can be reacted with a substrate or act as a substrate to provide an optically detectable (e.g., colored) reaction product (e.g., horse radish peroxidase).
  • fluorescent label any molecule that may be detected via its inherent fluorescent properties, which include fluorescence detectable upon excitation.
  • Suitable fluorescent labels include, but are not limited to, fluorescein, rhodamine, tetramethylrhodamine, eosin, erythrosin, coumarin, methyl-coumarins, pyrene, Malacite green, stilbene, Lucifer Yellow, Cascade BlueTM, Texas Red, IAEDANS, EDANS, BODIPY FL, LC Red 640, Cy 5, Cy 5.5, LC Red 705 and Oregon green.
  • Suitable optical dyes are described in the 2002 Molecular Probes Handbook, 9th Ed., by Richard P. Haugland, hereby expressly incorporated by reference.
  • Suitable fluorescent labels include, but are not limited to, green fluorescent protein (GFP; Chalfie, et al., Science 263(5148):802-805 (Feb 11, 1994); and EGFP;
  • BFP blue fluorescent protein
  • Quantum Biotechnologies, Inc. 1801 de Maisonneuve Blvd. West, 8th Floor, Montreal (Quebec) Canada H3H 1J9; 2. Stauber, R. H. Biotechniques 24(3):462-471 (1998); 3. Heim, R. and Tsien, R. Y. Curr. Biol. 6: 178-182 (1996))
  • enhanced yellow fluorescent protein EYFP; 1. Clontech Laboratories, Inc., 1020 East Meadow Circle, Palo Alto, CA 94303
  • luciferase Ichiki, et al., J. Immunol.
  • fluorescent labels are employed.
  • at least two fluorescent labels are used which are members of a Forster resonance energy transfer (FRET) pair.
  • FRET can be used to detect association/dissociation of LOXL2 and a binding partner; and the like.
  • FRET pairs are used in in vitro assays.
  • FRET is phenomenon known in the art wherein excitation of one fluorescent dye is transferred to another without emission of a photon.
  • a FRET pair consists of a donor fluorophore and an acceptor fluorophore (where the acceptor fluorophore may be a quencher molecule).
  • the fluorescence emission spectrum of the donor and the fluorescence absorption spectrum of the acceptor must overlap, and the two molecules must be in close proximity.
  • the distance between donor and acceptor at which 50% of donors are deactivated (transfer energy to the acceptor) is defined by the Forster radius, which is typically 10-100 angstroms.
  • Changes in the fluorescence emission spectrum comprising FRET pairs can be detected, indicating changes in the number of that are in close proximity (i.e., within 100 angstroms of each other). This will typically result from the binding or dissociation of two molecules, one of which is labeled with a FRET donor and the other of which is labeled with a FRET acceptor, wherein such binding brings the FRET pair in close proximity.
  • FRET pairs (donor/acceptor) useful in the invention include, but are not limited to,
  • EDANS/fluorescein IAEDANS/fluorescein, fluorescein/tetramethylrhodamine, fluorescein/Cy 5, IEDANS/DABCYL, fluorescein/QSY-7, fluorescein/LC Red 640, fluorescein/Cy 5.5 and fluorescein/LC Red 705.
  • a fluorescent donor molecule and a nonfluorescent acceptor molecule may be employed.
  • fluorescent emission of the donor will increase when quencher is displaced from close proximity to the donor and fluorescent emission will decrease when the quencher is brought into close proximity to the donor.
  • Useful quenchers include, but are not limited to, DABCYL, QSY 7 and QSY 33.
  • Useful fluorescent donor/quencher pairs include, but are not limited to EDANS/DABCYL, Texas Red/DABCYL, BODIPY/DABCYL, Lucifer yellow/DABCYL, coumarin/DABCYL and fluorescein/QSY 7 dye.
  • FRET and fluorescence quenching allow for monitoring of binding of labeled molecules over time, providing continuous information regarding the time course of binding reactions. Attachment of labels or other tags should not interfere with active groups on the interacting polypeptides.
  • Amino acids or other moieties may be added to the sequence of a protein, through means well known in the art and described herein, for the express purpose of providing a linker and/or point of attachment for a label. In one embodiment, one or more amino acids are added to the sequence of a component for attaching a tag thereto, with a fluorescent label being of particular interest.
  • detection involves bioluminescence resonance energy transfer (BRET).
  • BRET is a protein-protein interaction assay based on energy transfer from a bioluminescent donor to a fluorescent acceptor protein.
  • the BRET signal is measured by the amount of light emitted by the acceptor to the amount of light emitted by the donor. The ratio of these two values increases as the two proteins are brought into proximity.
  • the BRET assay has been amply described in the literature. See, e.g., U.S. Patent Nos. 6,020,192; 5,968,750; and 5,874,304; and Xu et al. (1999) Proc. Natl. Acad. Sci. USA 96: 151-156.
  • BRET assays may be performed by analyzing transfer between a bioluminescent donor protein and a fluorescent acceptor protein. Interaction between the donor and acceptor proteins can be monitored by a change in the ratio of light emitted by the bioluminescent and fluorescent proteins.
  • binding may be assayed by fluorescence anisotropy.
  • Fluorescence anisotropy assays are amply described in the literature. See, e.g., Jameson and Sawyer (1995) Methods Enzymol. 246:283-300.
  • label enzyme an enzyme which may be reacted in the presence of a label enzyme substrate which produces a detectable product.
  • Suitable label enzymes also include optically detectable labels (e.g., in the case of HRP).
  • Suitable label enzymes for use in the present invention include but are not limited to, horseradish peroxidase (HRP), alkaline phosphatase and glucose oxidase. Methods for the use of such substrates are well known in the art.
  • HRP horseradish peroxidase
  • alkaline phosphatase alkaline phosphatase
  • glucose oxidase glucose oxidase
  • Such products may be opaque, such as the reaction of horseradish peroxidase with tetramethyl benzedine, and may have a variety of colors.
  • Other label enzyme substrates such as Luminol (available from Pierce Chemical Co.), have been developed that produce fluorescent reaction products. Methods for identifying label enzymes with label enzyme substrates are well known in the art and many commercial kits are available. Examples and methods for the use of various label enzymes are described in Savage et al., Previews 247:6-9 (1998), Young, J. Virol. Methods 24:227-236 (1989), which are each hereby incorporated by reference in their entirety.
  • radioisotope any radioactive molecule. Suitable radioisotopes for use in the invention include, but are not limited to 14 C, 3 H, 32 P, 33 P, 35 S, 125 1, and 131 I. The use of radioisotopes as labels is well known in the art.
  • labels may be indirectly detected, that is, the tag is a partner of a binding pair.
  • partner of a binding pair is meant one of a first and a second moiety, wherein said first and said second moiety have a specific binding affinity for each other.
  • Suitable binding pairs for use in the invention include, but are not limited to, antigen/antibodies (for example, digoxigenin/anti-digoxigenin, dinitrophenyl (DNP)/anti-DNP, dansyl-X-anti-dansyl, fluorescein/anti-fluorescein, lucifer yellow/anti-lucifer yellow, and rhodamine anti-rhodamine), biotin/avidin (or biotin/streptavidin) and calmodulin binding protein (CBP)/calmodulin.
  • antigen/antibodies for example, digoxigenin/anti-digoxigenin, dinitrophenyl (DNP)/anti-DNP, dansyl-X-anti-dansyl, fluorescein/anti-fluorescein, lucifer yellow/anti-lucifer yellow, and rhodamine anti-rhodamine
  • biotin/avidin or biotin/streptavidin
  • CBP
  • binding pair partners may be used in applications other than for labeling, such as immobilization of the protein on a substrate and other uses as described below.
  • a partner of one binding pair may also be a partner of another binding pair.
  • an antigen first moiety
  • first moiety may bind to a first antibody (second moiety) which may, in turn, be an antigen for a second antibody (third moiety).
  • second moiety an antigen for a second antibody
  • a partner of a binding pair may comprise a label, as described above.
  • the tag is surface substrate binding molecule.
  • substrate binding molecule and grammatical equivalents thereof is meant a molecule have binding affinity for a specific surface substrate, which substrate is generally a member of a binding pair applied, incorporated or otherwise attached to a surface.
  • Suitable surface substrate binding molecules and their surface substrates include, but are not limited to poly-histidine (poly-his) or poly-histidine-glycine (poly- his-gly) tags and Nickel substrate; the Glutathione-S Transferase tag and its antibody substrate (available from Pierce Chemical); the influenza hemagglutinin (HA) tag polypeptide and its antibody 12CA5 substrate (Field et al., Mol. Cell.
  • surface binding substrate molecules useful in the present invention include, but are not limited to, polyhistidine structures (His-tags) that bind nickel substrates, antigens that bind to surface substrates comprising antibody, haptens that bind to avidin substrate (e.g., biotin) and CBP that binds to surface substrate comprising calmodulin.
  • His-tags polyhistidine structures
  • antigens that bind to surface substrates comprising antibody
  • haptens that bind to avidin substrate (e.g., biotin)
  • CBP that binds to surface substrate comprising calmodulin.
  • tags with chemically reactive groups such as thiols, amines, carboxyls, etc. is generally known in the art.
  • the tag is functionalized to facilitate covalent attachment.
  • biotinylation agents are known, including amine-reactive and thiol-reactive agents, for the biotinylation of proteins, nucleic acids, carbohydrates, carboxylic acids; see, e.g., chapter 4, Molecular Probes Catalog, Haugland, 6th Ed. 1996, hereby incorporated by reference.
  • a biotinylated substrate can be attached to a biotinylated component via avidin or streptavidin.
  • haptenylation reagents are also known.
  • Methods for labeling of proteins with radioisotopes are known in the art. For example, such methods are found in Ohta et al., Molec. Cell 3:535-541 (1999), which is hereby incorporated by reference in its entirety.
  • the covalent attachment of the tag may be either direct or via a linker.
  • the linker is a relatively short coupling moiety that is used to attach the molecules.
  • a coupling moiety may be synthesized directly onto a component of the invention, ubiquitin for example, and contains at least one functional group to facilitate attachment of the tag.
  • the coupling moiety may have at least two functional groups, which are used to attach a functionalized component to a functionalized tag, for example.
  • the linker is a polymer. In this embodiment, covalent attachment is accomplished either directly, or through the use of coupling moieties from the component or tag to the polymer.
  • the covalent attachment is direct, that is, no linker is used.
  • the component can contain a functional group such as a carboxylic acid which is used for direct attachment to the functionalized tag. It should be understood that the component and tag may be attached in a variety of ways, including those listed above.
  • the LOXL2 polypeptide and/or the components of a sample to be tested can be
  • Suitable insoluble supports include, but are not limited to agarose beads, magnetic beads, a test strip, a multi-well dish, and the like.
  • the insoluble support can comprise a variety of substances (glass, polystyrene, polyvinyl chloride, polypropylene, polyethylene, polycarbonate, dextran, nylon, amylose, natural and modified celluloses, polyacrylamides, agaroses, and magnetite) and can be provided in a variety of forms, including, e.g., agarose beads, polystyrene beads, latex beads, magnetic beads, colloid metal particles, glass and/or silicon chips and surfaces, nitrocellulose strips, nylon membranes, sheets, wells of reaction trays (e.g., multi-well plates), plastic tubes, etc.
  • a binding partner identified by a subject screening method can be isolated, e.g., purified, and can in some cases be characterized. Characterization can be amino acid sequencing, mass spectrometry analysis, functional analysis, gel electrophoresis analysis, and the like.
  • Standard abbreviations may be used, e.g., bp, base pair(s); kb, kilobase(s); pi, picoliter(s); s or sec, second(s); min, minute(s); h or hr, hour(s); aa, amino acid(s); kb, kilobase(s); bp, base pair(s); nt, nucleotide(s); i.m., intramuscular(ly); i.p., intraperitoneal(ly); s.c, subcutaneous(ly); and the like.
  • Lysyl-oxidase like-2 (LOXL2) is an inducer of tumor progression and fibrosis. It also inhibits the differentiation of skin keratinocytes and promotes the development of squamous cell carcinomas. It was found that addition of exogenous LOXL2 or expression of recombinant LOXL2 in human HaCaT dermal keratinocyte derived cells inhibits their differentiation as determined by involucrin expression levels regardless of the differentiation inducing agent used. The inhibition was negated by the LOXL2 function blocking monoclonal antibody AB0023 as well as by an anti- LOXL2 polyclonal antibody. Interestingly, a point mutated form of LOXL2
  • LOXL2 Y689F was internalized at 37°C by HaCaT cells and the internalization was inhibited by AB0023 and by competition with unlabeled LOXL2, indicating that HaCaT cells express a signal transducing LOXL2 receptor.
  • the results indicate that the enzymatic activity of LOXL2 is not required for some LOXL2 induced activities, and further suggest that inhibition of LOXL2 enzymatic activity may not inhibit all the effects of LOXL2 on tumor progression.
  • DMEM nonessential amino acids
  • trypsin-EDTA solution trypsin-EDTA solution
  • fungizone fetal bovine serum
  • Cell culture plates were obtained from Corning Inc. (Corning, NY).
  • PerfectPure RNA Cultured Cell kit for RNA purification was from 5Prime (Hamburg, Germany).
  • Verso cDNA synthesis kit and AbsoluteTM Blue QPCR SYBR ® Green Rox Mix were from Thermo Scientific (Lafayette, CO).
  • the polyclonal LOXL2 antibody was described previously and was purified on protein-A sepharose as previously described (6).
  • Mouse anti-myc (sc-40) was from Santa Cruz Biotechnologies (Santa Cruz, CA, USA).
  • Mouse anti-human ⁇ -actin (A5316) and mouse anti-human involucrin (19018) were from Sigma (St. Louis, MO, USA).
  • ATRA 9-cis-retinoic acid (9- cis-RA)
  • Troglitazone 9- cis-RA
  • Clofibrinic acid purchased from Sigma- Aldrich (St. Louis, MO) and Vitamin D was purchased from Biomol (Hamburg, Germany).
  • Dynabeads protein G were from Invitrogen (Carlsbad, CA). ⁇ -aminopropionitrile fumarate (BAPN) was from Sigma (St Louis, MO). Anti-myc antibody conjugated beads were from Enco Diagnostics (Petach Tikva, Israel). BamHI, Kpnl, Bglll and Xhol were from New England Biolabs (Ipswich, MA ). Lopofecamine 2000 was from Invitrogen (Carlsbad, CA)
  • HaCaT cells were kindly provided by Dr. Fusenig (DKFZ, Heidelberg, Germany). The cells were cultured in MEM-Eagle's medium supplemented with 10% fetal calf serum, 1% L-glutamine, 0.1% penicillin/streptomycin (Biological).
  • HEK293 and HEK293T cells were purchased from the American Type Culture Collection (Manassas, VA, USA).
  • Plasmids and lentiviral vector The NSPI-CMV-myc lentiviral expression vector was previously described (15). LOXL2 shRNA constructs were previously described (11). Plasmids used for functional analysis of the LOXL2 promoter activity were generated using the pGL2 basic vector (Promega, Madison, WI) that contains a promoter less luciferase reporter gene.
  • GCGTCACTGACTGCAAGCAC and 5'-CGAATCCGAATGTCCTCCAC) (SEQ ID NOS: l-2)
  • human involucrin (5 - TGTTCCTCCTCCAGTCAATA and 5'- GCTTTGATGGGACCTCCACT)
  • -actin (5'- TTGCCGACAGGATGCAGAAGGA and 5 '- AGGTGGACAGCGAGGCCAGGAT) (SEQ ID NOS:5-6).
  • Amplified cDNA levels were normalized using the -actin cDNA as a reference. Products were resolved on a 2% agarose gel to confirm amplification the identity of the amplified cDNA.
  • the target gene expression level was calculated by the 2-AAct method (18). In experiments in which the expression is shown as percent of control the control was always the expression level of the gene of interest in untreated cells cultured for 3 days in the presence of high or low calcium
  • LOXL2 variants HEK293 or HaCaT cell lines expressing either LOXL2 myc , LOXL2 Y689F or various deletion mutants of LOXL2 Y689F were generated using lentiviral vectors as previously described (20). Some of these recombinant LOXL2 species were purified from serum free conditioned medium as follows: HEK293 cells expressing LOXL2 myc were grown to 70% confluence and incubated for 48 hrs with serum free DMEM medium.
  • Conditioned medium 200 ml was incubated with 1 ml of anti-myc conjugated beads for 24 h at 4 °C. The beads were then collected and washed with 20 volumes of PBS. LOXL2 was eluted with ammonium-hydroxide (0.1 M). Acetic-acid (1 M) was used to neutralize the eluant back to pH-7.
  • LOXL2 internalization assay HaCaT cells were seeded in 10 cm dishes (16xl0 4 cells/dish) and cultured in medium containing a high calcium concentration over night. The following day the cells were supplemented with 4 ⁇ g/ml of LOXL2 myc or with LOXL2 myc that was pre-incubated for 30 min at 4°C with AB0023. After 30 min incubation at 37°C or 4°C, cells were trypsinized, washed and lysed at 4°C using western blot lysis buffer. The lysate was mixed with anti-myc antibody (200 ⁇ g/ml) for 2 hrs at 4°C. LOXL2 myc was then precipitated from the lysate using protein-G magnetic beads. The beads were washed for 3 times with PBS, boiled with
  • Proliferation assay HaCaT cells were seeded in 24 wells dishes (5xl0 3 cells/well) and cultured in medium containing a high calcium concentration. Wells received either no additions, elution buffer (17 ⁇ /ml, the same volume in which LOXL2 was added), LOXL2 myc (5 ⁇ g/ml) or LOXL2 Y689F (5 ⁇ g/ml). Added factors were replenished every other day. Adherent cells were counted every other day using a coulter counter.
  • the HaCaT cell line is a spontaneously transformed non-tumorigenic human epithelial cell line derived from adult skin, which maintains full epidermal differentiation capacity. It undergoes differentiation when exposed to calcium or to additional inducers of keratinocyte differentiation such as vitamin-D which is manifested by the up-regulation of the expression of keratinocyte differentiation markers such as involucrin or filaggrin (23).
  • HaCaT cells express the LOXL2 mRNA when cultured in medium containing a low calcium concentration (Fig. 1A).
  • LOXL2 mRNA The expression of the LOXL2 mRNA is strongly down regulated when these cells are cultured in medium containing a high calcium concentration or when stimulated with vitamin-D (Fig. 1A). Likewise, the expression of LOXL2 is also down regulated by calcium at the protein level (Fig 2B).
  • Fig. 1C We have cloned a 3 kb fragment containing part of the LOXL2 promoter (Fig. 1C) and have shown that this DNA fragment is able to down-regulate the expression of a luciferase reporter gene fused downstream to this fragment when HaCaT cells transfected with this construct are exposed to high calcium concentrations or to vitamin-D, suggesting that the increased LOXL2 mRNA concentrations found in such cells are due to decreased transcription (Fig.
  • LOXL2 myc is internalized by HaCaT cells and the internalization is inhibited by an excess of unlabeled LOXL2:
  • LOXL2 may bind to a cell membrane anchored LOXL2 receptor to transduce its inhibitory signals.
  • LOXL2 may also internalize LOXL2 in analogy with other receptors (26,27).
  • To examine this possibility we incubated HaCaT cells at 37°C or at 4°C with LOXL2 myc . After 30 minutes we treated the cells with a mixture of proteases so as to digest any
  • HaCaT cells cultured in medium containing high calcium concentrations were infected or not with empty lentivirus expression vector (NSPI) or with lentiviruses directing expression of LOXL2 myc (LOXL2) as indicated.
  • Some dishes containing cells infected with lentiviruses directing expression of LOXL2 myc were supplemented with 10 - " 8 M vitamin-D (Vit D), 2 ⁇ ATRA (ATRA), 20 ⁇ Troglitazone or 2 ⁇ 9-cis-RA or 400 ⁇ clofibrinic acid.
  • the differentiation inducers were added every other day. Involucrin mRNA expression was measured after 10 days using real time qPCR and normalized to ⁇ -actin mRNA expression..
  • FIGS. 2A-E The lysyl-oxidase enzyme activity inhibitor BAPN fails to neutralize the inhibitory effect ofLOXL2 on involucrin expression:
  • HaCaT cells were cultured in low calcium medium and infected with lentiviruses expressing a non- targeting shRNA (She) or with lentiviruses expressing a shRNA directed against LOXL2 (shLOXL2) for 10 days.
  • the LOXL2 mRNA concentrations in the cells were then measured by real time qPCR.
  • HACAT cells expressing a non-targeting shRNA (She) or a LOXL2 targeting shRNA (sh-LOXL2) as described under A for the LOXL2 mRNA.
  • C HACAT cells were cultured in medium containing low calcium concentrations in the absence of any additions (No-Add), in the presence of 5 g/ml of a control monoclonal antibody that binds to the enzymatic site of LOXL2 but does not inhibit the enzymatic activity (AB0050) or in the presence of 5 g/ml of a LOXL2 neutralizing antibody (AB0023) which were replenished every other day.
  • HACAT cells were cultured in medium containing high calcium concentrations in the absence of any additions (No-Add), 5 g/ml LOXL2 myc (LOXL2), 20 ⁇ AB0023 or 20 ⁇ of a purified anti-LOXL2 polyclonal antibody (ccLOXL2). Some of the wells the received LOXL2 also received antibodies as indicated. Added proteins were replenished every other day. After 10 days the concentration if involucrin mRNA was determined by real time qPCR as described.
  • E HACAT cells were cultured in medium containing high or low calcium
  • FIG. 3A-F An enzyme dead LOXL2 point mutant inhibits the differentiation of HACAT cells.
  • HACAT cells were grown in medium containing high calcium concentration without additions (No- add), or in medium supplemented with elution buffer (control), purified LOXL2 myc (LOXL2) or LOXL2 Y6 8 9F (LOXL2 Y6 8 9F )- After 10 days involucrin mRNA levels were determined using real time qPCR.
  • E Cell lysates were prepared from cells treated as described under Fig. 3D). The presence of involucrin complex and involucrin precursor in the cell lysates was determined by western blot analysis.
  • F HACAT cells were seeded in 24 well plates (5x10 cells/well) in the presence of high calcium concentration.
  • FIGS 4A-C The non-enzymatic effects ofLOXL2 on the differentiation ofHACAT cells are mediated by the 4 th SRCR domain ofLOXLl.
  • A A schematic showing the various SRCR deletion mutants of LOXL2 Y689F -
  • B and C HACAT cells grown in medium containing high calcium concentrations were infected with empty lentiviruses (Empty vector) or with lentiviruses directing expression of LOXL2 Y689F or the various LOXL2 Y689F deletion mutants depicted in (A) as indicated. The cells were cultured in 6 well plates for 10 days. The expression of involucrin mRNA was then determined using real time qPCR.
  • FIGS 5A and 5B Evidence for a putative LOXL2 receptor ofHaCaT cells.
  • HaCaT cells were cultured in medium containing high calcium concentration to confluence in 10 cm dishes. They were then incubated without or with purified LOXL2 myc as indicated for half an hour at 4°C or at 37°C. At the end of the incubation the cells were washed and trypsinized to remove cell surface associated LOXL2 myc . The cells were then lysed and lysate aliquots containing equal amounts of protein analyzed by western blot using an anti-myc antibody to detect LOXL2 myc .
  • B HACAT cells were cultured as described above.
  • conditioned medium high calcium
  • HACAT growth medium high calcium
  • HACAT growth medium high calcium
  • conditioned medium from HEK293 cells producing recombinant untagged LOXL2 lane 4
  • LOXL2 myc (2 ⁇ g/ml) or AB0023 antibody (20 g/ml) were added as indicated. After a 30 min. incubation at 37°C the cells were trypsinized, lysed and LOXL2 myc in cell lysates visualized as described under Fig. 5A.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

The present disclosure provides methods of identifying binding partners of lysyl oxidase-like-2 polypeptides.

Description

METHODS OF IDENTIFYING LYSYL OXIDASE - LIKE - 2
(LOXL2) BINDING PARTNERS
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims benefit of United States provisional application
No. 61/485,315, filed May 12, 2011, the disclosure of which is hereby incorporated by reference in its entirety for all purposes.
REFERENCE TO SEQUENCE LISTING SUBMITTED VIA EFS-WEB
[0002] The entire content of the following electronic submission of the sequence listing via the USPTO EFS-WEB server, as authorized and set forth in MPEP § 1730
II.B.2(a)(C), is incorporated herein by reference in its entirety for all purposes. The sequence listing is identified on the electronically filed text file as follows:
Figure imgf000003_0001
BACKGROUND
[0003] Lysyl-oxidase like protein-2 (LOXL2) was initially identified as an upregulated gene in Werner's syndrome. It belongs to the family of the lysyl-oxidases and catalyses the deamination of the ε-amino group of lysines of collagen monomers resulting in the formation of covalent cross-linkages. The catalytic domain of the lysyl-oxidases is highly conserved among lysyl-oxidases as is the amino-acids sequence of the lysyl tyrosyl quinone (LTQ) cofactor domain that is unique to these copper binding enzyme family. The enzyme activity of LOXL2 can be inhibited, like the enzyme activity of other lysyl-oxidases, by the irreversible competitive lysyl-oxidase inhibitor b-aminoproprionitrile (BAPN). LOXL2 was found to enhance tumor invasion and tumor fibrosis and to induce tumoral and hepatic fibrosis. Subsequent studies revealed that LOXL2 promotes tumor cells invasiveness by induction of epithelial to mesenchymal transition (EMT), and suggested that it oxidized the transcription factor Snail and that this oxidation results in increased stability of snail leading to the down regulation of E-cadherin and increased tumor cells invasiveness. In addition, it was found that excessive oxidation of collagen in the tumor microenvironment by lysyl-oxidase can induce the "stiffening" of the extracellular matrix and thereby promote tumor metastasis. It was suggested that hydrogen- peroxide produced as a side effect of lysyl-oxidase activity activates src dependent signaling that results in increased metastasis. It was observed that at least part of the increase in tumor cells invasiveness observed in response to LOXL2 over-expression is due to a LOXL2 induced increase in the expression of receptor activity modulating protein-3 (RAMP3). The progression of squamous cell carcinoma tumors is also associated with increased LOXL2 expression. High levels of LOXL2 have been found to be correlated with higher levels of snail expression. Furthermore, silencing of LOXL2 up regulated genes associated with epidermal differentiation. Lysyl- oxidase (LOX) and LOXL2 were found to exert opposite effects on the
differentiation of skin keratinocytes. LOX was found to promote differentiation while LOXL2 was found to inhibit the differentiation of keratinocytes and to be up- regulated in differentiating keratinocytes.
SUMMARY
[0004] The present disclosure in certain embodiments provides methods of identifying
binding partners of lysyl oxidase-like-2 (LOXL2) polypeptides. In some
embodiments, the methods are carried out in vitro. In some aspects, the methods are carried out by a) contacting a LOXL2 polypeptide with components of a sample; and b) identifying a component in the sample that binds to the LOXL2 polypeptide. In some aspects, a component or factor that binds to the LOXL2 polypeptide is a candidate binding partner.
[0005] In one embodiment, the sample is a whole cell lysate. In some aspects, identifying the binding partners includes separating components of the lysate, for example, via gel electrophoresis. In one example, it further includes transferring separated components to a membrane, thereby immobilizing the components on the membrane, contacting the LOXL2 polypeptide with the immobilized components, and detecting binding of the LOXL2 polypeptide with one or more immobilized components.
[0006] In some embodiments, the contacting is carried out by immunoprecipitation. In some aspects, the LOXL2 polypeptide includes an immunological tag. In some aspects, co-immunoprecipitation is carried out using an antibody that specifically binds the tag. In some cases, the identifying includes identifying a component in the sample that co-immunoprecipitates with the tagged LOXL2 polypeptide.
BRIEF DESCRIPTION OF THE DRAWINGS
[0007] FIGs. 1 A and IB depict levels of LOXL2 mRNA expression in HaCaT cells in
medium with various concentrations of calcium. FIG. 1C depicts a 3 kb fragment containing part of the LOXL2 promoter. FIG. ID depicts levels of expression of a luciferase reporter gene fused downstream to the fragment of FIG. 1C in HaCaT cells transfected with this construct, under various conditions. FIG. IE depicts expression levels of the keratinocyte differentiation marker involucrin in HaCaT cells under various conditions. FIG. IF depicts the effect of LOXL2 on involucrin expression induced by keratinocyte differentiation inducing factors.
[0008] FIGs. 2A and 2B depict effects of a specific shRNA on endogenous LOXL2
expression and involucrin mRNA expression in HaCaT cells in low calcium concentrations. FIG. 2C depicts the effects of the antibody AB0023 on involucrin mRNA expression in HaCaT cells in low calcium concentrations. FIG. 2D depicts effects of AB0023 or a polyclonal antibody directed against LOXL2 on the effect of LOXL2myc on involucrin expression. FIG. 2E depicts the effect of the lysyl-oxidase enzyme activity inhibitor BAPN on the inhibitory effect of LOXL2 on involucrin expression.
[0009] FIG. 3A schematically depicts an enzyme dead LOXL2 point mutant (LOXL2Y689F).
FIG. 3B depicts a comparison of enzymatic activities of LOXL2 and LOXL2Y689R FIG. 3C depicts effects on expression of involucrin mRNA of LOXL2 and
LOXL2Y689F- FIGs. 3D and 3E depict effects of purified LOXL2myc and LOXL2Y689F on the expression of involucrin mRNA and protein, respectively. FIG. 3F depicts the effect of tthe enzyme dead LOXL2 point mutant on the differentiation of HACAT cells.
[0010] FIGs. 4A-C depict a schematic illustration showing the various SRCR deletion
mutants of LOXL2Y689F (FIG. 4A); and the non-enzymatic effects of the 4th SRCR domain of LOXL2 on the differentiation of HACAT cells.
[0011] FIGs. 5A and B depict evidence for a putative LOXL2 receptor of HaCaT cells.
[0012] FIG. 6 provides a LOXL2 amino acid sequence (SEQ ID NO:9).
[0013] FIGs. 7A and 7B depict the effect of various parameters on endogenous LOXL2 mRNA expression.
DEFINITIONS
[0014] The terms "polypeptide," "peptide," and "protein", used interchangeably herein, refer to a polymeric form of amino acids of any length, which can include genetically coded and non-genetically coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having modified peptide backbones. The term includes fusion proteins, including, but not limited to, fusion proteins with a heterologous amino acid sequence, fusions with heterologous and homologous leader sequences, with or without N-terminal methionine residues; immunologically tagged proteins; and the like.
[0015] The terms "nucleic acid molecule" and "polynucleotide" are used interchangeably and refer to a polymeric form of nucleotides of any length, either
deoxyribonucleotides or ribonucleotides, or analogs thereof. Non-limiting examples of polynucleotides include linear and circular nucleic acids, messenger RNA
(mRNA), cDNA, recombinant polynucleotides, vectors, probes, and primers.
[0016] The term "operably linked" refers to functional linkage between molecules to provide a desired function. For example, "operably linked" in the context of nucleic acids refers to a functional linkage between nucleic acids to provide a desired function such as transcription, translation, and the like, e.g., a functional linkage between a nucleic acid expression control sequence (such as a promoter, signal sequence, or array of transcription factor binding sites) and a second polynucleotide, wherein the expression control sequence affects transcription and/or translation of the second polynucleotide. "Operably linked" in the context of a polypeptide refers to a functional linkage between amino acid sequences (e.g., of different domains) to provide for a described activity of the polypeptide.
[0017] "Isolated" refers to a protein of interest that, if naturally occurring, is in an
environment different from that in which it may naturally occur. "Isolated" is meant to include proteins that are within samples that are substantially enriched for the protein of interest and/or in which the protein of interest is partially or substantially purified. Where the protein is not naturally occurring, "isolated" indicates the protein has been separated from an environment in which it was made by either synthetic or recombinant means.
[0018] "Substantially pure" indicates that an entity (e.g., polypeptide) makes up greater than about 75% of the total content of the composition (e.g., total protein of the composition). For example, a "substantially pure" polypeptide refers to compositions in which at least 75%, at least 85%, or at least 90%, or more than 90%, of the total composition is the polypeptide. For example, the polypeptide can make up greater than about 90%, greater than about 95%, or greater than about 98% of the total protein in the composition.
[0019] Before the present invention is further described, it is to be understood that this
invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.
[0020] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.
[0021] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited.
[0022] It must be noted that as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a LOXL2 polypeptide" includes a plurality of such polypeptides and reference to "the binding partner" includes reference to one or more binding partners and equivalents thereof known to those skilled in the art, and so forth. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as "solely," "only" and the like in connection with the recitation of claim elements, or use of a "negative" limitation.
[0023] It is appreciated that certain features of the invention, which are, for clarity,
described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub -combination. All combinations of the embodiments pertaining to the invention are specifically embraced by the present invention and are disclosed herein just as if each and every combination was individually and explicitly disclosed. In addition, all sub-combinations of the various embodiments and elements thereof are also specifically embraced by the present invention and are disclosed herein just as if each and every such sub-combination was individually and explicitly disclosed herein.
[0024] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.
DETAILED DESCRIPTION
[0025] The present disclosure provides in vitro methods of identifying LOXL2 binding
partners. The methods generally involve contacting a LOXL2 polypeptide with a sample (e.g., a sample that may include a LOXL2 binding partner); and identifying components of the sample that bind LOXL2.
[0026] A LOXL2 polypeptide can bind to a LOXL2 binding partner with an affinity of from about 10"6 M to about 5 x 10"6 M, from about 5 x 10"6 M to about 10"7 M, from about 10"7 M to about 5 x 10"7 M, from about 5 x 10"7 M to about 10~8 M, from about 10~8 M to 10"9 M, or greater than 10"9 M.
[0027] Amino acid sequences of LOXL2 polypeptides, and nucleotide sequences encoding the LOXL2 polypeptides, are known in the art, and can be used in a screening method of the present disclosure. See, e.g., GenBank Accession No. NP_002309 (Homo sapiens LOXL2); and GenBank Accession No. NM_0023318 (nucleotide sequence encoding the amino acid sequence provided in GenBank Accession No. NP_002309); and Jourdan-Le Saux et al. (1999) J. Biol. Chem. 274: 12939.
[0028] For example, a LOXL2 polypeptide suitable for use in a subject screening method can comprise an amino acid sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to a contiguous stretch of from about 100 amino acids (aa) to about 200 aa, from about 200 aa to about 300 aa, from about 300 aa to about 400 aa, from about 400 aa to about 500 aa, from about 500 aa to about 600 aa, from about 600 aa to about 700 aa, or from about 700 aa to 774 aa, of the amino acid sequence depicted in Figure 6.
[0029] For example, a LOXL2 polypeptide suitable for use in a subject screening method can comprise an amino acid sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to a contiguous stretch of from about 100 amino acids (aa) to about 200 aa, from about 200 aa to about 300 aa, from about 300 aa to about 400 aa, from about 400 aa to about 500 aa, from about 500 aa to about 600 aa, from about 600 aa to about 700 aa, or from about 700 aa to 774 aa, of the amino acid sequence depicted in Figure 6, and can have a Y689F amino acid substitution.
[0030] A LOXL2 polypeptide suitable for use in a subject screening method can comprise an amino acid sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to a contiguous stretch of from about 100 amino acids (aa) to about 200 aa, from about 200 aa to about 300 aa, from about 300 aa to about 400 aa, from about 400 aa to about 500 aa, from about 500 aa to about 600 aa, from about 600 aa to about 700 aa, or from about 700 aa to 774 aa, of the amino acid sequence depicted in Figure 6, and can lack one or more domains, e.g., an SRC1 domain, an SRC2 domain, an SRC3 domain, an SRC4 domain, a copper binding domain, an LTQ domain, or a catalytic domain, as depicted schematically in Figure 3A. See, e.g., U.S. Patent Publication No. 2009/0053224.
[0031] A LOXL2 polypeptide suitable for use in a subject screening method can comprise an amino acid sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to an SRC1 domain, an SRC2 domain, an SRC3 domain, an SRC4 domain, a copper binding domain, an LTQ domain, or a catalytic domain, of LOXL2. The LOXL2 polypeptide used in the screening assay have a length of from about 25 amino acids (aa) to about 50 aa, from about 50 aa to about 100 aa, from about 100 aa to about 150 aa, from about 150 aa to about 200 aa, from about 200 aa to about 300 aa, from about 300 aa to about 400 aa, from about 400 aa to about 500 aa, from about 500 aa to about 600 aa, from about 600 aa to about 700 aa, or from about 700 aa to 774 aa. [0032] Suitable methods to identify proteins which bind or interact with LOXL2 include, but are not limited to, Far Western Blotting, Protein-Protein binding arrays, Co- Immunoprecipitation (IP) as well as cell-based assays and enzyme linked
immunosorbent assay (ELISA)-based binding assays.
[0033] In some embodiments, the screening method is carried out in vitro, in a cell-free
assay. In some embodiments, the in vitro cell-free assay will employ an isolated LOXL2 polypeptide, where "purified" refers to free of contaminants or any other undesired components. Purified LOXL2 polypeptide that is suitable for a subject screening method will in some embodiments be at least about 50% pure, at least about 60% pure, at least about 70% pure, at least about 75% pure, at least about 80% pure, at least about 85% pure, at least about 90% pure, at least about 95% pure, at least about 98% pure, at least about 99% pure, or greater than 99% pure.
[0034] In other embodiments, the screening method is carried out in vitro, in a cell-based assay, where the LOXL2 polypeptide and any binding partner are present in or on a cell. For these assays, a FRET- or BRET-based assay may be used. In some embodiments, the cell is genetically modified with a nucleic acid comprising a nucleotide sequence encoding the LOXL2 polypeptides. The nucleic acid can be an expression construct which provides for production of a LOXL2 polypeptide in the cell. In some cases, the assay is carried out in a mammalian cell. Suitable mammalian cells include primary cells and immortalized cell lines. Suitable mammalian cell lines include human cell lines, non-human primate cell lines, rodent (e.g., mouse, rat) cell lines, and the like. Suitable mammalian cell lines include, but are not limited to, HeLa cells (e.g., American Type Culture Collection (ATCC) No. CCL-2), CHO cells (e.g., ATCC Nos. CRL9618, CCL61, CRL9096), 293 cells (e.g., ATCC No. CRL- 1573), Vero cells, NIH 3T3 cells (e.g., ATCC No. CRL-1658), Huh-7 cells, BHK cells (e.g., ATCC No. CCL10), PC12 cells (ATCC No. CRL1721), COS cells, COS- 7 cells (ATCC No. CRL1651), RATI cells, mouse L cells (ATCC No. CCLI.3), human embryonic kidney (HEK) cells (ATCC No. CRL1573), HLHepG2 cells, and the like. The assay can also be carried out in a yeast cell.
[0035] In addition to a LOXL2 polypeptide, and putative binding partner, a variety of other reagents may be included in the screening assay. These include reagents such as salts, neutral proteins, e.g. albumin, detergents, etc., including agents that are used to facilitate optimal enzyme activity and/or reduce non-specific or background activity. Reagents that improve the efficiency of the assay, such as protease inhibitors, anti- microbial agents, etc. may be used. The components of the assay mixture are added in any order that provides for the requisite activity. Incubations are performed at any suitable temperature, typically between 4°C and 40°C. Incubation periods are selected for optimum activity, but may also be optimized to facilitate rapid high- throughput screening. Typically between 0.1 hour and 1 hour will be sufficient.
[0036] Assays of the present disclosure include controls, where suitable controls include a sample (e.g., a sample comprising the LOXL2 polypeptide and a known binding partner, e.g., an antibody specific for LOXL2; a sample comprising the LOXL2 polypeptide and an irrelevant antibody, e.g., an antibody that does not bind LOXL2). A plurality of assay mixtures can be run in parallel with samples.
Samples
[0037] A LOXL2 polypeptide is contacted with a sample, such that the LOXL2 polypeptide comes into contact with components of the sample, which components may include a LOXL2 binding partner. Samples include, e.g., cell lysates; conditioned medium; tissue homogenates; arrays of polypeptides; and the like.
[0038] A cell lysate can be made from a mammalian cell. Suitable mammalian cells include primary cells and immortalized cell lines. Suitable mammalian cell lines include human cell lines, non-human primate cell lines, rodent (e.g., mouse, rat) cell lines, and the like. Suitable mammalian cell lines include, but are not limited to, HeLa cells (e.g., American Type Culture Collection (ATCC) No. CCL-2), CHO cells (e.g., ATCC Nos. CRL9618, CCL61, CRL9096), 293 cells (e.g., ATCC No. CRL-1573), Vero cells, NIH 3T3 cells (e.g., ATCC No. CRL-1658), Huh-7 cells, BHK cells (e.g., ATCC No. CCL10), PC12 cells (ATCC No. CRL1721), COS cells, COS-7 cells (ATCC No. CRL1651), RATI cells, mouse L cells (ATCC No. CCLI.3), human embryonic kidney (HEK) cells (ATCC No. CRL1573), HLHepG2 cells, and the like. Detectably labeled polypeptides
[0039] In carrying out a subject method for identifying a LOXL2 binding partner, in some cases the LOXL2 polypeptide will be detectably labeled ("tagged"). By "tag" is meant an attached molecule or molecules useful for the identification or isolation of the attached molecule(s), which can be substrate binding molecules. For example, a tag can be an attachment tag or a label tag. Components having a tag are referred to as "tag-X", wherein X is the component (e.g., a LOXL2 polypeptide).
[0040] The terms "tag", "detectable label" and "detectable tag" are used interchangeably herein without limitation. In some embodiments, the tag is covalently bound to the attached component. By "tag," "label," "detectable label," or "detectable tag" is meant a molecule that can be directly (i.e., a primary label) or indirectly (i.e., a secondary label) detected; for example a label can be visualized and/or measured or otherwise identified so that its presence or absence can be known. As will be appreciated by those in the art, the manner in which this is performed will depend on the label. Exemplary labels include, but are not limited to, fluorescent labels (e.g. a green fluorescent protein, a red fluorescent protein, a yellow fluorescent protein, etc.) and label enzymes.
[0041] Exemplary tags include, but are not limited to, an optically-detectable label, a partner of a binding pair, and a surface substrate binding molecule (or attachment tag). As will be evident to the skilled artisan, many molecules may find use as more than one type of tag, depending upon how the tag is used. In one embodiment, the tag or label as described below is incorporated into the polypeptide as a fusion protein.
[0042] As will be appreciated by those in the art, tag-components can be made in various ways, depending largely upon the form of the tag. Components and tags can be linked by a covalent bond. Examples of tags are described below.
Exemplary tags
[0043] In some cases, the tag is a polypeptide which is provided as a portion of a chimeric molecule comprising a first polypeptide fused to another, heterologous polypeptide or amino acid sequence. In one embodiment, such a chimeric molecule comprises a fusion of a first polypeptide with a tag polypeptide. The tag is generally placed at the amino-or carboxyl-terminus of the polypeptide. In embodiments in which the tagged polypeptide is to be used in a cell-based assay and is to be expressed a recombinant protein, the tag is usually a genetically encodable tag (e.g., fluorescent polypeptide, immunodetectable polypeptide, and the like).
[0044] The tag polypeptide can be, for example, an immunodetectable label (i.e., a
polypeptide or other moiety which provides an epitope to which an anti-tag antibody can selectively bind), a polypeptide which serves as a ligand for binding to a receptor (e.g., to facilitate immobilization of the chimeric molecule on a substrate); an enzyme label (e.g., as described further below); or a fluorescent label (e.g., as described further below). Tag polypeptides provide for, for example, detection using an antibody against the tag polypeptide, and/or a ready means of isolating or purifying the tagged polypeptide (e.g., by affinity purification using an anti-tag antibody or another type of receptor- ligand matrix that binds to the tag). The production of tag- polypeptides by recombinant means is within the knowledge and skill in the art.
[0045] Production of immunodetectably-labeled proteins (e.g., use of FLAG, HIS, and the like, as a tag) is well known in the art and kits for such production are commercially available (for example, from Kodak and Sigma). See, e.g., Winston et al., Genes and Devel. 13:270-283 (1999), incorporated herein in its entirety, as well as product handbooks provided with the above-mentioned kits. Production of proteins having His-tags by recombinant means is well known, and kits for producing such proteins are commercially available. Such a kit and its use is described in the QIAexpress Handbook from Qiagen by Joanne Crowe et al., hereby expressly incorporated by reference.
[0046] Methods of producing polypeptides having an optically-detectable label are well known. An "optically detectable label" includes labels that are detectably due to inherent properties (e.g., a fluorescent label), or which can be reacted with a substrate or act as a substrate to provide an optically detectable (e.g., colored) reaction product (e.g., horse radish peroxidase).
[0047] By "fluorescent label" is meant any molecule that may be detected via its inherent fluorescent properties, which include fluorescence detectable upon excitation.
Suitable fluorescent labels include, but are not limited to, fluorescein, rhodamine, tetramethylrhodamine, eosin, erythrosin, coumarin, methyl-coumarins, pyrene, Malacite green, stilbene, Lucifer Yellow, Cascade Blue™, Texas Red, IAEDANS, EDANS, BODIPY FL, LC Red 640, Cy 5, Cy 5.5, LC Red 705 and Oregon green. Suitable optical dyes are described in the 2002 Molecular Probes Handbook, 9th Ed., by Richard P. Haugland, hereby expressly incorporated by reference.
[0048] Suitable fluorescent labels include, but are not limited to, green fluorescent protein (GFP; Chalfie, et al., Science 263(5148):802-805 (Feb 11, 1994); and EGFP;
Clontech - Genbank Accession Number U55762 ), blue fluorescent protein (BFP; 1. Quantum Biotechnologies, Inc. 1801 de Maisonneuve Blvd. West, 8th Floor, Montreal (Quebec) Canada H3H 1J9; 2. Stauber, R. H. Biotechniques 24(3):462-471 (1998); 3. Heim, R. and Tsien, R. Y. Curr. Biol. 6: 178-182 (1996)), enhanced yellow fluorescent protein (EYFP; 1. Clontech Laboratories, Inc., 1020 East Meadow Circle, Palo Alto, CA 94303), luciferase (Ichiki, et al., J. Immunol. 150(12):5408-5417 (1993)), β -galactosidase (Nolan, et al., Proc Natl Acad Sci USA 85(8):2603-2607 (Apr 1988)) and Renilla WO 92/15673; WO 95/07463; WO 98/14605; WO 98/26277; WO 99/49019; U.S. patent 5,292,658; U.S. patent 5,418,155; U.S. patent 5,683,888; U.S. patent 5,741,668; U.S. patent 5,777,079; U.S. patent 5,804,387; U.S. patent 5,874,304; U.S. patent 5,876,995; and U.S. patent 5,925,558), a GFP from species such as Renilla reniformis, Renilla mulleri, or Ptilosarcus guernyi, as described in, e.g., WO 99/49019 and Peelle et al. (2001) J. Protein Chem. 20:507- 519; "humanized" recombinant GFP (hrGFP) (Stratagene); any of a variety of fluorescent and colored proteins from Anthozoan species, as described in, e.g., Matz et al. (1999) Nature Biotechnol. 17:969-973; U.S. Patent Publication No.
2002/0197676, or U.S. Patent Publication No. 2005/0032085; and the like.
[0049] In some instances, multiple fluorescent labels are employed. In one embodiment, at least two fluorescent labels are used which are members of a Forster resonance energy transfer (FRET) pair. FRET can be used to detect association/dissociation of LOXL2 and a binding partner; and the like. In general, such FRET pairs are used in in vitro assays.
[0050] FRET is phenomenon known in the art wherein excitation of one fluorescent dye is transferred to another without emission of a photon. A FRET pair consists of a donor fluorophore and an acceptor fluorophore (where the acceptor fluorophore may be a quencher molecule). The fluorescence emission spectrum of the donor and the fluorescence absorption spectrum of the acceptor must overlap, and the two molecules must be in close proximity. The distance between donor and acceptor at which 50% of donors are deactivated (transfer energy to the acceptor) is defined by the Forster radius, which is typically 10-100 angstroms. Changes in the fluorescence emission spectrum comprising FRET pairs can be detected, indicating changes in the number of that are in close proximity (i.e., within 100 angstroms of each other). This will typically result from the binding or dissociation of two molecules, one of which is labeled with a FRET donor and the other of which is labeled with a FRET acceptor, wherein such binding brings the FRET pair in close proximity.
[0051] Binding of such molecules will result in an increased fluorescence emission of the acceptor and/or quenching of the fluorescence 15 emission of the donor. FRET pairs (donor/acceptor) useful in the invention include, but are not limited to,
EDANS/fluorescein, IAEDANS/fluorescein, fluorescein/tetramethylrhodamine, fluorescein/Cy 5, IEDANS/DABCYL, fluorescein/QSY-7, fluorescein/LC Red 640, fluorescein/Cy 5.5 and fluorescein/LC Red 705. [0052] In another aspect of FRET, a fluorescent donor molecule and a nonfluorescent acceptor molecule ("quencher") may be employed. In this application, fluorescent emission of the donor will increase when quencher is displaced from close proximity to the donor and fluorescent emission will decrease when the quencher is brought into close proximity to the donor. Useful quenchers include, but are not limited to, DABCYL, QSY 7 and QSY 33. Useful fluorescent donor/quencher pairs include, but are not limited to EDANS/DABCYL, Texas Red/DABCYL, BODIPY/DABCYL, Lucifer yellow/DABCYL, coumarin/DABCYL and fluorescein/QSY 7 dye.
[0053] The skilled artisan will appreciate that FRET and fluorescence quenching allow for monitoring of binding of labeled molecules over time, providing continuous information regarding the time course of binding reactions. Attachment of labels or other tags should not interfere with active groups on the interacting polypeptides. Amino acids or other moieties may be added to the sequence of a protein, through means well known in the art and described herein, for the express purpose of providing a linker and/or point of attachment for a label. In one embodiment, one or more amino acids are added to the sequence of a component for attaching a tag thereto, with a fluorescent label being of particular interest.
[0054] In other embodiments, detection involves bioluminescence resonance energy transfer (BRET). BRET is a protein-protein interaction assay based on energy transfer from a bioluminescent donor to a fluorescent acceptor protein. The BRET signal is measured by the amount of light emitted by the acceptor to the amount of light emitted by the donor. The ratio of these two values increases as the two proteins are brought into proximity. The BRET assay has been amply described in the literature. See, e.g., U.S. Patent Nos. 6,020,192; 5,968,750; and 5,874,304; and Xu et al. (1999) Proc. Natl. Acad. Sci. USA 96: 151-156. BRET assays may be performed by analyzing transfer between a bioluminescent donor protein and a fluorescent acceptor protein. Interaction between the donor and acceptor proteins can be monitored by a change in the ratio of light emitted by the bioluminescent and fluorescent proteins.
[0055] Alternatively, binding may be assayed by fluorescence anisotropy. Fluorescence anisotropy assays are amply described in the literature. See, e.g., Jameson and Sawyer (1995) Methods Enzymol. 246:283-300.
[0056] By "label enzyme" is meant an enzyme which may be reacted in the presence of a label enzyme substrate which produces a detectable product. Suitable label enzymes also include optically detectable labels (e.g., in the case of HRP). Suitable label enzymes for use in the present invention include but are not limited to, horseradish peroxidase (HRP), alkaline phosphatase and glucose oxidase. Methods for the use of such substrates are well known in the art. The presence of the label enzyme is generally revealed through the enzyme's catalysis of a reaction with a label enzyme substrate, producing an identifiable product. Such products may be opaque, such as the reaction of horseradish peroxidase with tetramethyl benzedine, and may have a variety of colors. Other label enzyme substrates, such as Luminol (available from Pierce Chemical Co.), have been developed that produce fluorescent reaction products. Methods for identifying label enzymes with label enzyme substrates are well known in the art and many commercial kits are available. Examples and methods for the use of various label enzymes are described in Savage et al., Previews 247:6-9 (1998), Young, J. Virol. Methods 24:227-236 (1989), which are each hereby incorporated by reference in their entirety.
[0057] By "radioisotope" is meant any radioactive molecule. Suitable radioisotopes for use in the invention include, but are not limited to 14C, 3H, 32P, 33P, 35S, 1251, and 131I. The use of radioisotopes as labels is well known in the art.
[0058] In addition, labels may be indirectly detected, that is, the tag is a partner of a binding pair. By "partner of a binding pair" is meant one of a first and a second moiety, wherein said first and said second moiety have a specific binding affinity for each other. Suitable binding pairs for use in the invention include, but are not limited to, antigen/antibodies (for example, digoxigenin/anti-digoxigenin, dinitrophenyl (DNP)/anti-DNP, dansyl-X-anti-dansyl, fluorescein/anti-fluorescein, lucifer yellow/anti-lucifer yellow, and rhodamine anti-rhodamine), biotin/avidin (or biotin/streptavidin) and calmodulin binding protein (CBP)/calmodulin. Other suitable binding pairs include polypeptides such as the FLAG-peptide (Hopp et al.,
BioTechnol, 6: 1204-1210 (1988)); the KT3 epitope peptide (Martin et al., Science, 255: 192-194 (1992)); tubulin epitope peptide (Skinner et al., J. Biol. Chem., 266: 15 163- 15 166 (1991)); and the T7 gene 10 protein peptide tag (Lutz-Freyemuth et al., Proc. Natl. Acad. Sci. USA, a:6393-6397 (1990)) and the antibodies each thereto. Generally, in one embodiment, the smaller of the binding pair partners serves as the tag, as steric considerations in ubiquitin ligation may be important. As will be appreciated by those in the art, binding pair partners may be used in applications other than for labeling, such as immobilization of the protein on a substrate and other uses as described below. [0059] As will be appreciated by those in the art, a partner of one binding pair may also be a partner of another binding pair. For example, an antigen (first moiety) may bind to a first antibody (second moiety) which may, in turn, be an antigen for a second antibody (third moiety). It will be further appreciated that such a circumstance allows indirect binding of a first moiety and a third moiety via an intermediary second moiety that is a binding pair partner to each. As will be appreciated by those in the art, a partner of a binding pair may comprise a label, as described above. It will further be appreciated that this allows for a tag to be indirectly labeled upon the binding of a binding partner comprising a label. Attaching a label to a tag which is a partner of a binding pair, as just described, is referred to herein as "indirect labeling."
[0060] In one embodiment, the tag is surface substrate binding molecule. By "surface
substrate binding molecule" and grammatical equivalents thereof is meant a molecule have binding affinity for a specific surface substrate, which substrate is generally a member of a binding pair applied, incorporated or otherwise attached to a surface. Suitable surface substrate binding molecules and their surface substrates include, but are not limited to poly-histidine (poly-his) or poly-histidine-glycine (poly- his-gly) tags and Nickel substrate; the Glutathione-S Transferase tag and its antibody substrate (available from Pierce Chemical); the influenza hemagglutinin (HA) tag polypeptide and its antibody 12CA5 substrate (Field et al., Mol. Cell. Biol., 8:2159- 2165 (1988)); the c- myc tag and the 8F9, 3C7, 6E107 G4, B7 and 9E10 antibody substrates thereto (Evan et al., Molecular and Cellular Biol, 5:3610-3616 (1985)]; and the Herpes Simplex virus glycoprotein D (gD) tag and its antibody substrate (Paborsky et al., Protein Engineering, 3(6):547-553 (1990)). In general, surface binding substrate molecules useful in the present invention include, but are not limited to, polyhistidine structures (His-tags) that bind nickel substrates, antigens that bind to surface substrates comprising antibody, haptens that bind to avidin substrate (e.g., biotin) and CBP that binds to surface substrate comprising calmodulin.
[0061] Where appropriate, functionalization of labels with chemically reactive groups such as thiols, amines, carboxyls, etc. is generally known in the art. In one embodiment, the tag is functionalized to facilitate covalent attachment.
[0062] Biotinylation of polypeptides is well known, for example, a large number of
biotinylation agents are known, including amine-reactive and thiol-reactive agents, for the biotinylation of proteins, nucleic acids, carbohydrates, carboxylic acids; see, e.g., chapter 4, Molecular Probes Catalog, Haugland, 6th Ed. 1996, hereby incorporated by reference. A biotinylated substrate can be attached to a biotinylated component via avidin or streptavidin. Similarly, a large number of haptenylation reagents are also known. Methods for labeling of proteins with radioisotopes are known in the art. For example, such methods are found in Ohta et al., Molec. Cell 3:535-541 (1999), which is hereby incorporated by reference in its entirety.
[0063] The covalent attachment of the tag may be either direct or via a linker. In one
embodiment, the linker is a relatively short coupling moiety that is used to attach the molecules. A coupling moiety may be synthesized directly onto a component of the invention, ubiquitin for example, and contains at least one functional group to facilitate attachment of the tag. Alternatively, the coupling moiety may have at least two functional groups, which are used to attach a functionalized component to a functionalized tag, for example. In an additional embodiment, the linker is a polymer. In this embodiment, covalent attachment is accomplished either directly, or through the use of coupling moieties from the component or tag to the polymer.
[0064] In one embodiment, the covalent attachment is direct, that is, no linker is used. In this embodiment, the component can contain a functional group such as a carboxylic acid which is used for direct attachment to the functionalized tag. It should be understood that the component and tag may be attached in a variety of ways, including those listed above.
Immobilization
[0065] The LOXL2 polypeptide and/or the components of a sample to be tested, can be
immobilized on an insoluble support. Suitable insoluble supports include, but are not limited to agarose beads, magnetic beads, a test strip, a multi-well dish, and the like. The insoluble support can comprise a variety of substances (glass, polystyrene, polyvinyl chloride, polypropylene, polyethylene, polycarbonate, dextran, nylon, amylose, natural and modified celluloses, polyacrylamides, agaroses, and magnetite) and can be provided in a variety of forms, including, e.g., agarose beads, polystyrene beads, latex beads, magnetic beads, colloid metal particles, glass and/or silicon chips and surfaces, nitrocellulose strips, nylon membranes, sheets, wells of reaction trays (e.g., multi-well plates), plastic tubes, etc.
Further characterization
[0066] A binding partner identified by a subject screening method can be isolated, e.g., purified, and can in some cases be characterized. Characterization can be amino acid sequencing, mass spectrometry analysis, functional analysis, gel electrophoresis analysis, and the like.
EXAMPLES
[0067] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention nor are they intended to represent that the experiments below are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g. amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Celsius, and pressure is at or near atmospheric. Standard abbreviations may be used, e.g., bp, base pair(s); kb, kilobase(s); pi, picoliter(s); s or sec, second(s); min, minute(s); h or hr, hour(s); aa, amino acid(s); kb, kilobase(s); bp, base pair(s); nt, nucleotide(s); i.m., intramuscular(ly); i.p., intraperitoneal(ly); s.c, subcutaneous(ly); and the like.
Example 1:
[0068] Lysyl-oxidase like-2 (LOXL2) is an inducer of tumor progression and fibrosis. It also inhibits the differentiation of skin keratinocytes and promotes the development of squamous cell carcinomas. It was found that addition of exogenous LOXL2 or expression of recombinant LOXL2 in human HaCaT dermal keratinocyte derived cells inhibits their differentiation as determined by involucrin expression levels regardless of the differentiation inducing agent used. The inhibition was negated by the LOXL2 function blocking monoclonal antibody AB0023 as well as by an anti- LOXL2 polyclonal antibody. Interestingly, a point mutated form of LOXL2
(LOXL2Y689F) lacking enzymatic activity was also able to inhibit calcium and Vitamin-D induced differentiation of HaCaT cells suggesting that the enzymatic activity is not required for the differentiation inhibiting effect of LOXL2. This conclusion was supported by experiments that showed that beta-amino-propionitryl (BAPN), an irreversible inhibitor of lysyl-oxidases was not able to inhibit LOXL2 induced inhibition of HaCaT cell differentiation. It was found that the activity of LOXL2Y689F requires the presence of the fourth scavenger receptor cysteine rich (SRCR) domain of LOXL2 which is also the binding target of AB0023. Labeled
LOXL2Y689F was internalized at 37°C by HaCaT cells and the internalization was inhibited by AB0023 and by competition with unlabeled LOXL2, indicating that HaCaT cells express a signal transducing LOXL2 receptor. The results indicate that the enzymatic activity of LOXL2 is not required for some LOXL2 induced activities, and further suggest that inhibition of LOXL2 enzymatic activity may not inhibit all the effects of LOXL2 on tumor progression.
MATERIALS AND METHODS
[0069] Materials: DMEM, nonessential amino acids, trypsin-EDTA solution, fungizone and fetal bovine serum were from Biological Industries, (Beit Haemek, Israel). Cell culture plates were obtained from Corning Inc. (Corning, NY). PerfectPure RNA Cultured Cell kit for RNA purification was from 5Prime (Hamburg, Germany). Verso cDNA synthesis kit and Absolute™ Blue QPCR SYBR® Green Rox Mix were from Thermo Scientific (Lafayette, CO). The polyclonal LOXL2 antibody was described previously and was purified on protein-A sepharose as previously described (6). Mouse anti-myc (sc-40) was from Santa Cruz Biotechnologies (Santa Cruz, CA, USA). Mouse anti-human β-actin (A5316) and mouse anti-human involucrin (19018) were from Sigma (St. Louis, MO, USA). The AB0023
monoclonal antibody was previously described (5,14). ATRA, 9-cis-retinoic acid (9- cis-RA), Troglitazone and Clofibrinic acid were purchased from Sigma- Aldrich (St. Louis, MO) and Vitamin D was purchased from Biomol (Hamburg, Germany).
Dynabeads protein G were from Invitrogen (Carlsbad, CA). β-aminopropionitrile fumarate (BAPN) was from Sigma (St Louis, MO). Anti-myc antibody conjugated beads were from Enco Diagnostics (Petach Tikva, Israel). BamHI, Kpnl, Bglll and Xhol were from New England Biolabs (Ipswich, MA ). Lopofecamine 2000 was from Invitrogen (Carlsbad, CA)
[0070] Cell culture. HaCaT cells, were kindly provided by Dr. Fusenig (DKFZ, Heidelberg, Germany). The cells were cultured in MEM-Eagle's medium supplemented with 10% fetal calf serum, 1% L-glutamine, 0.1% penicillin/streptomycin (Biological
Industries, Beit Haemek, Israel) supplemented with a low (0.03 mM) or high (1.2 mM) concentration of calcium. HEK293 and HEK293T cells were purchased from the American Type Culture Collection (Manassas, VA, USA).
[0071] Plasmids and lentiviral vector: The NSPI-CMV-myc lentiviral expression vector was previously described (15). LOXL2 shRNA constructs were previously described (11). Plasmids used for functional analysis of the LOXL2 promoter activity were generated using the pGL2 basic vector (Promega, Madison, WI) that contains a promoter less luciferase reporter gene.
[0072] Isolation of the LOXL2 promoter and measurements of LOXL2 promoter
activity: In order to identify the LOXL2 promoter, we cloned a -3.2 Kb fragment of DNA located upstream to the translation start site of LOXL2. The first untranslated intron of LOXL2 which was previously found to contain a functional hypoxia response element (HRE) (16) was not included in this fragment (Fig. 1C) due to its size (-35 kb). Thus this fragment contains 300 bp located downstream to intron 1 and 2.9 Kb from the DNA region located upstream of intron 1 of LOXL2. This promoter fragment was inserted upstream to the luciferase reporter of the pGL2 plasmid and transfected into HaCaT cells using lipofecamine 2000 according to the
manufacturer's instructions. Measurements of LOXL2 promoter activity using the firefly and renilla luciferase assay were performed as described (17).
[0073] Quantitative RT-PCR. Cells (5xl04) were seeded in 6 well dishes and grown to confluence. Total RNA was isolated using the 5-Prime kit. CDNA was synthesized from ^g of total RNA and random hexamers using the Verso cDNA synthesis kit (Thermo Scientific, Lafayette, CO). PCR amplification of cDNA was carried out using the Absolute™ Blue QPCR SYBR® Green Rox Mix (Thermo Scientific, Lafayette, CO) using an ABI Prism 7000 sequence detection system with
oligonucleotide pairs specific for human LOXL2 (5'-
GCGTCACTGACTGCAAGCAC and 5'-CGAATCCGAATGTCCTCCAC) (SEQ ID NOS: l-2), human involucrin (5 - TGTTCCTCCTCCAGTCAATA and 5'- GCTTTGATGGGACCTCCACT) (SEQ ID NOS:3-4)or -actin (5'- TTGCCGACAGGATGCAGAAGGA and 5 '- AGGTGGACAGCGAGGCCAGGAT) (SEQ ID NOS:5-6). In order to measure the expression levels of endogenous LOXL2 mRNA we used another pair of primers of which one is derived from the 3' UTR of the LOXL2 mRNA 5'-GGTTGACATCACTGACGTGC and 5'- GAGTTGACCACGCAGGCTTC (SEQ ID NOS:7-8). To ensure the specificity of the reaction conditions, at the end of the individual runs, the melting temperature (Tm) of the amplified products was measured to confirm its homogeneity. The following conditions were used: 50°C for 2 minutes, 95°C for 15 minutes, 95°C for lOseconds, and 60°C for 1 minute for a total of 40 cycles. Each sample was analyzed in duplicate. Amplified cDNA levels were normalized using the -actin cDNA as a reference. Products were resolved on a 2% agarose gel to confirm amplification the identity of the amplified cDNA. The target gene expression level was calculated by the 2-AAct method (18). In experiments in which the expression is shown as percent of control the control was always the expression level of the gene of interest in untreated cells cultured for 3 days in the presence of high or low calcium
concentrations as indicated.
[0074] Western blot analysis: Cell lysis and Western blot analysis were performed as
described previously (19).
[0075] Inhibition ofLOXL2 expression: ShRNA targeting LOXL2 (11) were generated in HaCaT cells using lentiviral vectors as previously described (20).
[0076] Production and purification of Recombinant LOXL2 variants: HEK293 or HaCaT cell lines expressing either LOXL2myc, LOXL2Y689F or various deletion mutants of LOXL2Y689F were generated using lentiviral vectors as previously described (20). Some of these recombinant LOXL2 species were purified from serum free conditioned medium as follows: HEK293 cells expressing LOXL2myc were grown to 70% confluence and incubated for 48 hrs with serum free DMEM medium.
Conditioned medium (200 ml) was incubated with 1 ml of anti-myc conjugated beads for 24 h at 4 °C. The beads were then collected and washed with 20 volumes of PBS. LOXL2 was eluted with ammonium-hydroxide (0.1 M). Acetic-acid (1 M) was used to neutralize the eluant back to pH-7.
[0077] Determination ofLOXL2 enzyme activity: The fluorimetric amplex red assay was performed essentially as described (21). Purified LOXL2myc or LOXL2Y689F (2.5 μg) or a corresponding volume of a similarly purified fraction from control conditioned medium were added to a reaction mix (lOmM Κ2ΗΡ04 pH 7.2, 10μΜ amplex red and 0.1 units Horseradish peroxidase). The substrate was a lysine rich PF4-derived peptide LYKKIIKKLLES that we identified as a good LOXL2 substrate. This peptide was added to a final concentration of 20 μΜ in a final reaction volume of 100 μΐ. The enzymatic reaction was carried out at 37°C for 4h. Fluorescence was measured with excitation at 540 and emission at 580 nm.
[0078] Generation of deletions in human LOXL2 SRCR domains: The cDNA encoding LOXL2Y689F was used as a template for the generation of the depicted SRCR deletions (Fig. 4A). For each deletion the cDNA upstream and downstream of deletion was amplified using PfuUltra II fusion HS DNA polymerase (Stratagene, Santa Clara, CA) and primer pairs. Amplified fragments upstream and downstream from the deletions were joined using the expand long template PCR system (Roche, Mannheim, Germany), sequenced, and stitched together following essentially a previously described protocol (22). The cDNA containing the deletion was then ligated into the NSPTCMV-myc lentiviral expression vector.
[0079] LOXL2 internalization assay. HaCaT cells were seeded in 10 cm dishes (16xl04 cells/dish) and cultured in medium containing a high calcium concentration over night. The following day the cells were supplemented with 4 μg/ml of LOXL2myc or with LOXL2myc that was pre-incubated for 30 min at 4°C with AB0023. After 30 min incubation at 37°C or 4°C, cells were trypsinized, washed and lysed at 4°C using western blot lysis buffer. The lysate was mixed with anti-myc antibody (200 μg/ml) for 2 hrs at 4°C. LOXL2myc was then precipitated from the lysate using protein-G magnetic beads. The beads were washed for 3 times with PBS, boiled with
SDS/PAGE, and subjected to western blot analysis using anti-myc antibodies to detect internalized LOXL2myc.
[0080] Proliferation assay: HaCaT cells were seeded in 24 wells dishes (5xl03 cells/well) and cultured in medium containing a high calcium concentration. Wells received either no additions, elution buffer (17 μΐ/ml, the same volume in which LOXL2 was added), LOXL2myc (5 μg/ml) or LOXL2Y689F (5 μg/ml). Added factors were replenished every other day. Adherent cells were counted every other day using a coulter counter.
[0081] Statistical analysis: The one tailed unpaired with Welch's correction student's T-test was used. Error bars represent the standard error of the mean. Statistical significance is presented in the following manner: *p<0.05, **p<0.01 and ***p<0.001. All experiments were repeated independently at least two times with similar results. Unless otherwise stated, figures display representative experiments.
RESULTS
[0082] Expression of LOXL2 in HaCaT cells is regulated by inducers of keratinocyte
differentiation and high levels of LOXL2 inhibit the differentiation of these cells: The HaCaT cell line is a spontaneously transformed non-tumorigenic human epithelial cell line derived from adult skin, which maintains full epidermal differentiation capacity. It undergoes differentiation when exposed to calcium or to additional inducers of keratinocyte differentiation such as vitamin-D which is manifested by the up-regulation of the expression of keratinocyte differentiation markers such as involucrin or filaggrin (23). HaCaT cells express the LOXL2 mRNA when cultured in medium containing a low calcium concentration (Fig. 1A). The expression of the LOXL2 mRNA is strongly down regulated when these cells are cultured in medium containing a high calcium concentration or when stimulated with vitamin-D (Fig. 1A). Likewise, the expression of LOXL2 is also down regulated by calcium at the protein level (Fig 2B). We have cloned a 3 kb fragment containing part of the LOXL2 promoter (Fig. 1C) and have shown that this DNA fragment is able to down-regulate the expression of a luciferase reporter gene fused downstream to this fragment when HaCaT cells transfected with this construct are exposed to high calcium concentrations or to vitamin-D, suggesting that the increased LOXL2 mRNA concentrations found in such cells are due to decreased transcription (Fig. ID). As expected, stimulation of HaCaT cells with high calcium concentrations or with vitamin-D upregulated the expression of the keratinocyte differentiation marker involucrin (Fig. IE). However, HaCaT cells over-expressing recombinant LOXL2 tagged at their c-terminal with a myc epitope tag (LOXL2myc) (7) failed to up- regulate involucrin expression in response to either calcium, vitamin-D, or to several other known inducers of keratinocyte differentiation (Fig. IF) (24). As far as we could tell, the addition of the myc tag did not alter the biological properties of LOXL2 (6,11). In contrast, inhibition of endogenous LOXL2 expression in HaCaT cells cultured in the presence of low calcium concentrations using a specific shRNA (Fig. 2A) (11) induced the expression of involucrin (Fig. 2B), suggesting that endogenously produced LOXL2 functions in keratinocytes as a gate keeper that inhibits differentiation regardless of the nature of the external stimuli. The induction of differentiation following the expression of this shRNA was not due to up regulation of LOX or other lysyl-oxidases since the expression levels of other lysyl- oxidases did not change significantly in response to this shRNA. Interestingly, the LOXL2 function blocking antibody AB0023 was also able to induce involucrin mRNA expression in HaCaT cell cultured in medium containing low calcium concentrations, suggesting that the differentiation inhibiting effect of LOXL2 was induced by secreted extracellular LOXL2 (Fig. 2C). This last conclusion was supported by another experiment in which we observed that addition of purified LOXL2myc to HaCaT cells cultured in the presence of high calcium concentration also inhibits the up regulation of involucrin. In this experiment too addition of AB0023 or addition of a polyclonal antibody directed against LOXL2 (6) inhibited the effect of LOXL2myc on involucrin expression suggesting that the inhibitory effect was transduced by extracellular LOXL2myc (Fig. 2D).
[0083] The enzymatic activity ofLOXL2 is not required for the inhibition ofHaCaT
differentiation: It was previously observed that the LOXL2 function inhibiting antibody AB0023 inhibits the effects of LOXL2 on tumor progression more efficiently than BAPN (14). At saturating concentrations, BAPN inhibits the enzymatic activity of LOXL2 in in-vitro enzyme assays more efficiently than AB0023 (5), possibly because AB0023 targets the 4th SRCR domain of LOXL2 (2,5). These observations suggest that some of the activities of LOXL2, such as the effects of LOXL2 on tumor cells invasiveness, may not depend entirely on the enzymatic activity of LOXL2. This hypothesis agrees with the results of the experiment showing that unlike addition of AB0023, addition of BAPN to HaCaT cells cultured in the presence of low calcium concentrations, fails to alleviate the LOXL2 induced repression of involucrin expression (Compare Figs. 2D and 2E). The failure to restore involucrin expression was not due to cytotoxicity since the cells proliferated normally in the presence of BAPN (data not shown). This experiment suggests that the enzymatic activity of LOXL2 is not required for LOXL2 induced repression of involucrin expression.
[0084] In order to further examine this hypothesis, we introduced a point mutation into the conserved LTQ domain of LOXL2myc to generate LOXL2Y689F (Fig. 3A). This mutation was based on previous work showing that mutation of a conserved tyrosine residue required for the formation of the LTQ of lysyl-oxidase results in complete loss of enzymatic activity (25). Indeed, we found that LOXL2Y689F also lacks enzymatic activity (Fig. 3B). The expression of LOXL2myc or LOXL2Y689F in HaCaT cells did not affect significantly the expression levels of endogenously produced LOXL2 mPvNA. However, in HaCaT cells cultured in the presence of high calcium concentrations expression of recombinant LOXL2Y689F inhibited the expression of the involucrin mRNA efficiently (Fig. 3C). Furthermore, purified LOXL2Y689F that was added to HaCaT cells cultured in the presence of a high calcium concentration was able to inhibit the expression of involucrin mRNA and protein as efficiently as non-mutated LOXL2myc (Figs. 3D & 3E). Addition of LOXL2myc to the growth medium of HaCaT cells enhanced their proliferation in medium containing high calcium concentrations, probably because LOXL2 inhibits their differentiation. In this experiment too LOXL2Y689F enhanced the proliferation of the cells as efficiently as LOXL2myc (Fig. 3F).
[0085] Inhibition of involucrin expression by LOXL2 requires the presence of the fourth SRCR domain ofLOXL2: The experiments described above suggested that the catalytic activity is not involved in LOXL2 induced inhibition of keratinocyte differentiation, suggesting that the SRCR domains of LOXL2 may be important for that activity. To examine this hypothesis, we produced deletion mutants of
LOXL2Y689F lacking one or several SRCR domains as depicted (Fig. 4A). We then determined if these mutated LOXL2 variants are still able to inhibit calcium induced induction of involucrin in HaCaT cells. These experiments indicated that inhibition of involucrin expression in HaCaT depended on the retention of the fourth SRCR domain in these mutants. Loss of this fourth SRCR domain resulted in the loss of the ability to inhibit involucrin expression while the loss of any of the other SRCR domains did not affect that ability (Figs. 4B & 4C). Interestingly, AB0023, which is also able to inhibit LOXL2myc induced inhibition of involucrin expression (Fig. 2D) also binds to the 4th SRCR domain of LOXL2 (5). Thus, the finding that AB0023 also inhibits LOXL2myc induced inhibition of involucrin expression independently supports the identification of that domain as the domain that mediates LOXL2 induced inhibition of keratinocyte differentiation.
[0086] LOXL2myc is internalized by HaCaT cells and the internalization is inhibited by an excess of unlabeled LOXL2: The realization that inhibition of keratinocyte differentiation can be inhibited by the addition of exogenous, enzyme-dead LOXL2, suggested that LOXL2 may bind to a cell membrane anchored LOXL2 receptor to transduce its inhibitory signals. We hypothesized that if such a receptor exists, it may also internalize LOXL2 in analogy with other receptors (26,27). To examine this possibility we incubated HaCaT cells at 37°C or at 4°C with LOXL2myc. After 30 minutes we treated the cells with a mixture of proteases so as to digest any
LOXL2myc exposed on the cell surface, and lysed the cells. This experiment revealed that LOXL2myc is internalized by the cells, and that the internalization occurs only at 37°C (Fig. 5A). Interestingly the internalization could be inhibited by AB0023 as well as by incubation with conditioned medium containing unlabeled LOXL2, suggesting that the internalization of LOXL2myc is mediated by a saturable receptor (Fig. 5B). [0087] Figures 1A-E. LOXL2 inhibits involucrin expression induced by keratinocyte differentiation inducing factors: (A) HaCaT cells were cultured in medium containing low or high calcium concentrations. Some low calcium dished received in addition vitamin-D (10 -"8 M) as indicated. After 10 days endogenous LOXL2 mRNA levels were measured using real time qPCR. (B) Cell lysates were prepared from HaCaT cells cultured in low and high Ca+2 after 3 or 10 days as indicated. Aliquots containing equal protein concentrations were subjected to Western blot analysis using polyclonal anti-LOXL2 antibodies. Blots were then stripped and probed for β- actin. (C) Picture showing the structure of the LOXL2 promoter fragment used. The large intron containing the hypoxia response element (16) downstream to
untranslated exon-1 is not included in the promoter fragment. (D) The luciferase activity induced by the LOXL2 promoter in HACAT cells In response to high calcium concentrations or in response to 10 -"8 M vitamin-D was measured. The Y axis represents luciferase activity normalized to a renilla control. Data shown represent mean values of two independent experiments preformed in triplicate. (E) The effects of calcium and vitamin-D on involucrin mRNA expression were measured as described under A for LOXL2 mRNA expression. (F) HaCaT cells cultured in medium containing high calcium concentrations were infected or not with empty lentivirus expression vector (NSPI) or with lentiviruses directing expression of LOXL2myc (LOXL2) as indicated. Some dishes containing cells infected with lentiviruses directing expression of LOXL2myc were supplemented with 10 -"8 M vitamin-D (Vit D), 2 μΜ ATRA (ATRA), 20 μΜ Troglitazone or 2 μΜ 9-cis-RA or 400 μΜ clofibrinic acid. The differentiation inducers were added every other day. Involucrin mRNA expression was measured after 10 days using real time qPCR and normalized to β-actin mRNA expression..
[0088] Figures 2A-E. The lysyl-oxidase enzyme activity inhibitor BAPN fails to neutralize the inhibitory effect ofLOXL2 on involucrin expression: (A) HaCaT cells were cultured in low calcium medium and infected with lentiviruses expressing a non- targeting shRNA (She) or with lentiviruses expressing a shRNA directed against LOXL2 (shLOXL2) for 10 days. The LOXL2 mRNA concentrations in the cells were then measured by real time qPCR. (B) The expression of involucrin mRNA was measured in HACAT cells expressing a non-targeting shRNA (She) or a LOXL2 targeting shRNA (sh-LOXL2) as described under A for the LOXL2 mRNA. (C) HACAT cells were cultured in medium containing low calcium concentrations in the absence of any additions (No-Add), in the presence of 5 g/ml of a control monoclonal antibody that binds to the enzymatic site of LOXL2 but does not inhibit the enzymatic activity (AB0050) or in the presence of 5 g/ml of a LOXL2 neutralizing antibody (AB0023) which were replenished every other day. The relative concentrations of the involucrin mRNA were measured using real time qPCR as described. (D) HACAT cells were cultured in medium containing high calcium concentrations in the absence of any additions (No-Add), 5 g/ml LOXL2myc (LOXL2), 20 μ^πύ AB0023 or 20 μ^πύ of a purified anti-LOXL2 polyclonal antibody (ccLOXL2). Some of the wells the received LOXL2 also received antibodies as indicated. Added proteins were replenished every other day. After 10 days the concentration if involucrin mRNA was determined by real time qPCR as described. (E) HACAT cells were cultured in medium containing high or low calcium
concentrations as indicated for 10 days. Some of the low calcium wells received in addition BAPN (0.2 mM). Media and BAPN were replenished every other day. After 10 days involucrin mRNA expression levels were determined using real time qPCR. Figures 3A-F. An enzyme dead LOXL2 point mutant inhibits the differentiation of HACAT cells. (A) A schematic showing the location of the Y689F point mutation introduced into the LOXL2 LTQ domain. (B) The enzymatic activity of affinity purified LOXL2myc, LOXL2Y689F or of purified conditioned medium derived from control cells infected with empty lentiviruses and purified identically (Empty vector) were determined using the amplex red assay as described in experimental procedures. (C) HaCaT cells were cultured in medium containing high calcium and infected with empty lentiviruses (Empty vector) or lentiviruses directing expression of LOXL2myc or LOXL2Y689F as indicated. Additions were made every other day. After 10 days involucrin mRNA levels were determined using real time qPCR. (D). HACAT cells were grown in medium containing high calcium concentration without additions (No- add), or in medium supplemented with elution buffer (control), purified LOXL2myc (LOXL2) or LOXL2Y689F (LOXL2Y689F)- After 10 days involucrin mRNA levels were determined using real time qPCR. (E) Cell lysates were prepared from cells treated as described under Fig. 3D). The presence of involucrin complex and involucrin precursor in the cell lysates was determined by western blot analysis. (F) HACAT cells were seeded in 24 well plates (5x10 cells/well) in the presence of high calcium concentration. Wells received either no additions (No add), elution buffer (Vehicle), LOXL2myc (5 μg/ml) or LOXL2Y689F (5 μg/ml). Added factors were replenished every other day. Adherent cells were counted every other day using a coulter counter.
[0090] Figures 4A-C. The non-enzymatic effects ofLOXL2 on the differentiation ofHACAT cells are mediated by the 4th SRCR domain ofLOXLl. (A) A schematic showing the various SRCR deletion mutants of LOXL2Y689F- (B and C) HACAT cells grown in medium containing high calcium concentrations were infected with empty lentiviruses (Empty vector) or with lentiviruses directing expression of LOXL2Y689F or the various LOXL2Y689F deletion mutants depicted in (A) as indicated. The cells were cultured in 6 well plates for 10 days. The expression of involucrin mRNA was then determined using real time qPCR.
[0091] Figures 5A and 5B. Evidence for a putative LOXL2 receptor ofHaCaT cells. (A) HaCaT cells were cultured in medium containing high calcium concentration to confluence in 10 cm dishes. They were then incubated without or with purified LOXL2myc as indicated for half an hour at 4°C or at 37°C. At the end of the incubation the cells were washed and trypsinized to remove cell surface associated LOXL2myc. The cells were then lysed and lysate aliquots containing equal amounts of protein analyzed by western blot using an anti-myc antibody to detect LOXL2myc. (B) HACAT cells were cultured as described above. Upon reaching confluence the medium was exchanged with conditioned medium (high calcium) derived from HEK293 cells infected with empty lentiviruses (lane 1), with fresh HACAT growth medium containing high calcium (lanes 2, 3 and 5), or conditioned medium from HEK293 cells producing recombinant untagged LOXL2 (lane 4). LOXL2myc (2 μg/ml) or AB0023 antibody (20 g/ml) were added as indicated. After a 30 min. incubation at 37°C the cells were trypsinized, lysed and LOXL2myc in cell lysates visualized as described under Fig. 5A.
REFERENCES
[0092] 1. Saito, H., Papaconstantinou, J., Sato, H., and Goldstein, S. (1997) /. Biol.
Chem. 272, 8157-8160
[0093] 2. Lucero, H. A. and Kagan, H. M. (2006) Cell Mol. Life Sci. 63, 2304-2316
[0094] 3. Maki, J. M. (2009) Histol. Histopathol. 24, 651-660
[0095] 4. Tang, S. S., Trackman, P. C, and Kagan, H. M. (1983) /. Biol. Chem. 258,
4331-4338
[0096] 5. Rodriguez, H. M., Vaysberg, M., Mikels, A., McCauley, S., Velayo, A. C, Garcia, C, and Smith, V. (2010) /. Biol. Chem. 285, 20964-20974 [0097] 6. Akiri, G., Sabo, E., Dafni, H., Vadasz, Z., Kartvelishvily, Y., Gan, N.,
Kessler, O., Cohen, T., Resnick, M., Neeman, M., and Neufeld, G. (2003) Cancer Res. 63, 1657-1666
[0098] 7. Vadasz, Z., Kessler, O., Akiri, G., Gengrinovitch, S., Kagan, H. M., Baruch, Y., Izhak, O. B., and Neufeld, G. (2005) J. Hepatol. 43, 499-507
[0099] 8. Peinado, H., Del Carmen Iglesias-de la Cruz, Olmeda, D., Csiszar, K., Fong, K. S., Vega, S., Nieto, M. A., Cano, A., and PortiUo, F. (2005) EMBO J 24, 3446- 3458
[00100] 9. Levental, K. R., Yu, H., Kass, L., Lakins, J. N., Egeblad, M., Erler, J.
T., Fong, S. F., Csiszar, K., Giaccia, A., Weninger, W., Yamauchi, M., Gasser, D. L., and Weaver, V. M. (2009) Cell. 139, 891-906
[00101] 10. Payne, S. L., Fogelgren, B., Hess, A. R., Seftor, E. A., Wiley, E. L.,
Fong, S. F., Csiszar, K., Hendrix, M. J., and Kirschmann, D. A. (2005) Cancer Res.
65, 11429-11436
[00102] 11. Brekhman, V. and Neufeld, G. (2009) BMC. Cancer 9, 415-427
[00103] 12. Peinado, H., Moreno-Bueno, G., Hardisson, D., Perez-Gomez, E.,
Santos, V., Mendiola, M., de Diego, J. I., Nistal, M., QuintaniUa, M., PortiUo, F., and
Cano, A. (2008) Cancer Res. 68, 4541-4550
[00104] 13. Fujimoto, E. and Tajima, S. (2009) / Dermatol. Sci. 55, 91-98
[00105] 14. Barry-Hamilton, V., Spangler, R., Marshall, D., McCauley, S.,
Rodriguez, H. M., Oyasu, M., Mikels, A., Vaysberg, M., Ghermazien, H., Wai, C,
Garcia, C. A., Velayo, A. C, Jorgensen, B., Biermann, D., Tsai, D., Green, J.,
Zaffryar-Eilot, S., Holzer, A., Ogg, S., Thai, D., Neufeld, G., Van, V. P., and Smith,
V. (2010) Nat. Med. 16, 1009-1017
[00106] 15. Akiri, G., Cherian, M. M., Vijayakumar, S., Liu, G., Bafico, A., and
Aaronson, S. A. (2009) Oncogene 28, 2163-2172
[00107] 16. Schietke, R., Warnecke, C, Wacker, I., Schodel, J., Mole, D. R.,
Campean, V., Amann, K., Goppelt-Struebe, M., Behrens, J., Eckardt, K. U., and
Wiesener, M. S. (2010) /. Biol. Chem. 285, 6658-6669
[00108] 17. Ohman, T., Parish, G., and Jackson, R. M. (1999) Am. J. Respir. Cell
Mol. Biol. 21, 119-127
[00109] 18. Huggett, J., Dheda, K., Bustin, S., and Zumla, A. (2005) Genes
Immun. 6, 279-284 [00110] 19. Varshavsky, A., Kessler, O., Abramovitch, S., Kigel, B., Zaffryar, S.,
Akiri, G., and Neufeld, G. (2008) Cancer Res. 68, 6922-6931
[00111] 20. Kigel, B., Varshavsky, A., Kessler, O., and Neufeld, G. (2008) PLoS.
ONE. 3, e3287
[00112] 21. Palamakumbura, A. H. and Trackman, P. C. (2002) Anal. Biochem.
300, 245-251
[00113] 22. Horton, R. M., Cai, Z. L., Ho, S. N., and Pease, L. R. (1990)
Biotechniques 8, 528-535
[00114] 23. Boukamp, P., Petrussevska, R. T., Breitkreutz, D., Hornung, J.,
Markham, A., and Fusenig, N. E. (1988) /. Cell Biol. 106, 761-771
[00115] 24. Jiang, Y. J., Lu, B., Kim, P., Paragh, G., Schmitz, G., Elias, P. M., and
Feingold, K. R. (2008) /. Invest Dermatol. 128, 104-109
[00116] 25. Wang, S. X., Mure, M., Medzihradszky, K. F., Burlingame, A. L.,
Brown, D. E., Dooley, D. M., Smith, A. J., Kagan, H. M., and Klinman, J. P. (1996)
Science 273, 1078-1084
[00117] 26. Kikuchi, A. and Yamamoto, H. (2007) /. Biochem. 141, 443-451
[00118] 27. Hussain, M. M. (2001) Front Biosci. 6, D417-D428
[00119] 28. Kirschmann, D. A., Seftor, E. A., Fong, S. F., Nieva, D. R., Sullivan,
C. M., Edwards, E. M., Sommer, P., Csiszar, K., and Hendrix, M. J. (2002) Cancer
Res. 62, 4478-4483
[00120] 29. Levy-Adam, F., Ilan, N., and Vlodavsky, I. (2010) Semin. Cancer
Biol. 20, 153-160
[00121] While the present invention has been described with reference to the specific embodiments thereof, it should be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the true spirit and scope of the invention. In addition, many modifications may be made to adapt a particular situation, material, composition of matter, process, process step or steps, to the objective, spirit and scope of the present invention. All such modifications are intended to be within the scope of the claims appended hereto.

Claims

CLAIMS What is claimed is:
1. An in vitro method of identifying a binding partner of a lysyl oxidase-like-2 (LOXL2) polypeptide, the method comprising:
a) contacting the LOXL2 polypeptide with components of a sample; and
b) identifying a component in the sample that binds to the LOXL2 polypeptide, wherein a factor that binds to the LOXL2 polypeptide is a candidate binding partner.
2. The method of claim 1, wherein the method is a cell-free method.
3. The method of claim 1, wherein the method is a cell-based method.
4. The method of claim 1, wherein the sample is a whole cell lysate.
5. The method of claim 1, wherein the LOXL2 polypeptide is detectably labeled.
6. The method of claim 1, wherein the sample is a whole cell lysate, and wherein the method further comprises, prior to said contacting, separating components of the lysate via gel electrophoresis, transferring the separated components to a membrane, thereby immobilizing the components on the membrane, said contacting comprises contacting the LOXL2 polypeptide with the immobilized components, and said identifying in step (b) comprises detecting binding of the LOXL2 polypeptide with one or more immobilized components.
7. The method of claim 1, wherein said contacting comprises co- immunoprecipitation .
8. The method of claim 7, wherein said LOXL2 polypeptide comprises an immunological tag, wherein said co-immunoprecipitation is carried out using an antibody that specifically binds the tag, and wherein said identifying comprises identifying a component in the sample that co-immunoprecipitates with the tagged LOXL2 polypeptide.
9. The method of claim 1, wherein said LOXL2 polypeptide is immobilized on an insoluble support.
10. The method of claim 1, wherein said components of said sample are members of a polypeptide array.
11. The method of claim 10, wherein the members of the polypeptide array are immobilized on an insoluble support.
12. The method of claim 1, wherein the sample is conditioned medium.
13. The method of claim 1, further comprising isolating the binding partner.
14. The method of claim 13, further comprising characterizing the isolated binding partner.
15. The method of claim 14, wherein said characterizing comprises amino acid sequencing, mass spectrometry, gel electrophoresis, or enzyme digestion.
PCT/US2012/037580 2011-05-12 2012-05-11 Methods of identifying lysyl oxidase - like - 2 (loxl2) binding partners Ceased WO2012155071A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201161485315P 2011-05-12 2011-05-12
US61/485,315 2011-05-12

Publications (1)

Publication Number Publication Date
WO2012155071A1 true WO2012155071A1 (en) 2012-11-15

Family

ID=46124776

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2012/037580 Ceased WO2012155071A1 (en) 2011-05-12 2012-05-11 Methods of identifying lysyl oxidase - like - 2 (loxl2) binding partners

Country Status (1)

Country Link
WO (1) WO2012155071A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104792998A (en) * 2015-03-09 2015-07-22 中国人民解放军第四军医大学 Application of LOXL2 antigen in preparation of thyroid carcinoma indication, invasion and transfer kit
EP4256349A1 (en) * 2020-12-01 2023-10-11 Genentech, Inc. Biological vesicles displaying cell surface proteins and methods related to same

Citations (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992015673A1 (en) 1991-03-11 1992-09-17 The University Of Georgia Research Foundation, Inc. Cloning and expression of renilla luciferase
US5292658A (en) 1989-12-29 1994-03-08 University Of Georgia Research Foundation, Inc. Boyd Graduate Studies Research Center Cloning and expressions of Renilla luciferase
WO1995007463A1 (en) 1993-09-10 1995-03-16 The Trustees Of Columbia University In The City Of New York Uses of green fluorescent protein
US5683888A (en) 1989-07-22 1997-11-04 University Of Wales College Of Medicine Modified bioluminescent proteins and their use
WO1998014605A1 (en) 1996-10-04 1998-04-09 Loma Linda University Renilla luciferase and green fluorescent protein fusion genes
US5741668A (en) 1994-02-04 1998-04-21 Rutgers, The State University Of New Jersey Expression of a gene for a modified green-fluorescent protein
WO1998026277A2 (en) 1996-12-12 1998-06-18 Prolume, Ltd. Apparatus and method for detecting and identifying infectious agents
US5777079A (en) 1994-11-10 1998-07-07 The Regents Of The University Of California Modified green fluorescent proteins
US5804387A (en) 1996-02-01 1998-09-08 The Board Of Trustees Of The Leland Stanford Junior University FACS-optimized mutants of the green fluorescent protein (GFP)
US5874304A (en) 1996-01-18 1999-02-23 University Of Florida Research Foundation, Inc. Humanized green fluorescent protein genes and methods
US5876995A (en) 1996-02-06 1999-03-02 Bryan; Bruce Bioluminescent novelty items
US5925558A (en) 1996-07-16 1999-07-20 The Regents Of The University Of California Assays for protein kinases using fluorescent protein substrates
WO1999049019A2 (en) 1998-03-27 1999-09-30 Prolume, Ltd. Luciferases, fluorescent proteins, nucleic acids encoding the luciferases and fluorescent proteins and the use thereof in diagnostics
US6020192A (en) 1996-01-18 2000-02-01 University Of Florida Humanized green fluorescent protein genes and methods
WO2000044910A1 (en) * 1999-01-27 2000-08-03 Millennium Pharmaceuticals, Inc. Methods of use of a novel lysyl oxidase-related protein
US20020197676A1 (en) 1999-10-14 2002-12-26 Lukyanov Sergey A. Novel chromophores/fluorophores and methods for using the same
US20050032085A1 (en) 2001-11-13 2005-02-10 Labas Yulii Aleksandrovich Novel chromophores/fluorophores and methods for using the same
WO2009017833A2 (en) * 2007-08-02 2009-02-05 Arresto Biosciences Methods and compositions for treatment and diagnosis of fibrosis, tumor invasion, angiogenesis, and metastasis

Patent Citations (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5683888A (en) 1989-07-22 1997-11-04 University Of Wales College Of Medicine Modified bioluminescent proteins and their use
US5292658A (en) 1989-12-29 1994-03-08 University Of Georgia Research Foundation, Inc. Boyd Graduate Studies Research Center Cloning and expressions of Renilla luciferase
US5418155A (en) 1989-12-29 1995-05-23 University Of Georgia Research Foundation, Inc. Isolated Renilla luciferase and method of use thereof
WO1992015673A1 (en) 1991-03-11 1992-09-17 The University Of Georgia Research Foundation, Inc. Cloning and expression of renilla luciferase
WO1995007463A1 (en) 1993-09-10 1995-03-16 The Trustees Of Columbia University In The City Of New York Uses of green fluorescent protein
US5741668A (en) 1994-02-04 1998-04-21 Rutgers, The State University Of New Jersey Expression of a gene for a modified green-fluorescent protein
US5777079A (en) 1994-11-10 1998-07-07 The Regents Of The University Of California Modified green fluorescent proteins
US6020192A (en) 1996-01-18 2000-02-01 University Of Florida Humanized green fluorescent protein genes and methods
US5968750A (en) 1996-01-18 1999-10-19 The University Of Florida Research Foundation Inc. Humanized green fluorescent protein genes and methods
US5874304A (en) 1996-01-18 1999-02-23 University Of Florida Research Foundation, Inc. Humanized green fluorescent protein genes and methods
US5804387A (en) 1996-02-01 1998-09-08 The Board Of Trustees Of The Leland Stanford Junior University FACS-optimized mutants of the green fluorescent protein (GFP)
US5876995A (en) 1996-02-06 1999-03-02 Bryan; Bruce Bioluminescent novelty items
US5925558A (en) 1996-07-16 1999-07-20 The Regents Of The University Of California Assays for protein kinases using fluorescent protein substrates
WO1998014605A1 (en) 1996-10-04 1998-04-09 Loma Linda University Renilla luciferase and green fluorescent protein fusion genes
WO1998026277A2 (en) 1996-12-12 1998-06-18 Prolume, Ltd. Apparatus and method for detecting and identifying infectious agents
WO1999049019A2 (en) 1998-03-27 1999-09-30 Prolume, Ltd. Luciferases, fluorescent proteins, nucleic acids encoding the luciferases and fluorescent proteins and the use thereof in diagnostics
WO2000044910A1 (en) * 1999-01-27 2000-08-03 Millennium Pharmaceuticals, Inc. Methods of use of a novel lysyl oxidase-related protein
US20020197676A1 (en) 1999-10-14 2002-12-26 Lukyanov Sergey A. Novel chromophores/fluorophores and methods for using the same
US20050032085A1 (en) 2001-11-13 2005-02-10 Labas Yulii Aleksandrovich Novel chromophores/fluorophores and methods for using the same
WO2009017833A2 (en) * 2007-08-02 2009-02-05 Arresto Biosciences Methods and compositions for treatment and diagnosis of fibrosis, tumor invasion, angiogenesis, and metastasis
US20090053224A1 (en) 2007-08-02 2009-02-26 Arresto Biosciences Lox and loxl2 inhibitors and uses thereof

Non-Patent Citations (54)

* Cited by examiner, † Cited by third party
Title
AKIRI, G.; CHERIAN, M. M.; VIJAYAKUMAR, S.; LIU, G.; BAFICO, A.; AARONSON, S. A., ONCOGENE, vol. 28, 2009, pages 2163 - 2172
AKIRI, G.; SABO, E.; DAFNI, H.; VADASZ, Z.; KARTVELISHVILY, Y.; GAN, N.; KESSLER, O.; COHEN, T.; RESNICK, M.; NEEMAN, M., CANCER RES., vol. 63, 2003, pages 1657 - 1666
ATSAWASUWAN PHIMON ET AL: "Lysyl Oxidase Binds Transforming Growth Factor-beta and Regulates Its Signaling via Amine Oxidase Activity", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 283, no. 49, December 2008 (2008-12-01), pages 34229 - 34240, XP002680674, ISSN: 0021-9258 *
BARRY-HAMILTON, V.; SPANGLER, R.; MARSHALL, D.; MCCAULEY, S.; RODRIGUEZ, H. M.; OYASU, M.; MIKELS, A.; VAYSBERG, M.; GHERMAZIEN, H, NAT. MED., vol. 16, 2010, pages 1009 - 1017
BOUKAMP, P.; PETRUSSEVSKA, R. T.; BREITKREUTZ, D.; HORNUNG, J.; MARKHAM, A.; FUSENIG, N. E., J. CELL BIOL., vol. 106, 1988, pages 761 - 771
BREKHMAN, V.; NEUFELD, G., BMC. CANCER, vol. 9, 2009, pages 415 - 427
CHALFIE ET AL., SCIENCE, vol. 263, no. 5148, 11 February 1994 (1994-02-11), pages 802 - 805
EVAN ET AL., MOLECULAR AND CELLULAR BIOL, vol. 5, 1985, pages 3610 - 3616
FIELD ET AL., CELL, vol. 8, 1988, pages 2159 - 2165
FUJIMOTO, E.; TAJIMA, S., J DERMATOL. SCI., vol. 55, 2009, pages 91 - 98
HEIM, R.; TSIEN, R. Y., CURR. BIOL., vol. 6, 1996, pages 178 - 182
HOPP ET AL., BIOTECHNOL, vol. 6, 1988, pages 1204 - 1210
HORTON, R. M.; CAI, Z. L.; HO, S. N.; PEASE, L. R., BIOTECHNIQUES, vol. 8, 1990, pages 528 - 535
HUGGETT, J.; DHEDA, K.; BUSTIN, S.; ZUMLA, A., GENES IMMUN., vol. 6, 2005, pages 279 - 284
HUSSAIN, M. M., FRONT BIOSCI., vol. 6, 2001, pages D417 - D428
ICHIKI ET AL., J. IMMUNOL., vol. 150, no. 12, 1993, pages 5408 - 5417
JAMESON; SAWYER, METHODS ENZYMOL., vol. 246, 1995, pages 283 - 300
JIANG, Y. J.; LU, B.; KIM, P.; PARAGH, G.; SCHMITZ, G.; ELIAS, P. M.; FEINGOLD, K. R., J. INVEST DERMATOL., vol. 128, 2008, pages 104 - 109
JOURDAN-LE SAUX ET AL., J. BIOL. CHEM., vol. 274, 1999, pages 12939
KIGEL, B.; VARSHAVSKY, A.; KESSLER, O.; NEUFELD, G., PLOS. ONE., vol. 3, 2008, pages E3287
KIKUCHI, A.; YAMAMOTO, H., J. BIOCHEM., vol. 141, 2007, pages 443 - 451
KIRSCHMANN, D. A.; SEFTOR, E. A.; FONG, S. F.; NIEVA, D. R.; SULLIVAN, C. M.; EDWARDS, E. M.; SOMMER, P.; CSISZAR, K.; HENDRIX, M., CANCER RES., vol. 62, 2002, pages 4478 - 4483
LEVENTAL, K. R.; YU, H.; KASS, L.; LAKINS, J. N.; EGEBLAD, M.; ERLER, J. T.; FONG, S. F.; CSISZAR, K.; GIACCIA, A.; WENINGER, W., CELL, vol. 139, 2009, pages 891 - 906
LEVY-ADAM, F.; ILAN, N.; VLODAVSKY, I., SEMIN. CANCER BIOL., vol. 20, 2010, pages 153 - 160
LUCERO, H. A.; KAGAN, H. M., CELL MOL. LIFE SCI., vol. 63, 2006, pages 2304 - 2316
LUGASSY JENNIE ET AL: "The Enzymatic Activity of Lysyl Oxidas-like-2 (LOXL2) Is Not Required for LOXL2-induced Inhibition of Keratinocyte Differentiation", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 287, no. 5, January 2012 (2012-01-01), pages 3541 - 3549, XP002680675 *
LUTZ-FREYEMUTH ET AL., PROC. NATL. ACAD. SCI. USA, 1990, pages 6393 - 6397
MAKI, J. M., HISTOL. HISTOPATHOL., vol. 24, 2009, pages 651 - 660
MARTIN ET AL., SCIENCE, vol. 255, 1992, pages 192 - 194
MATZ ET AL., NATURE BIOTECHNOL., vol. 17, 1999, pages 969 - 973
NOLAN ET AL., PROC NATL ACAD SCI USA, vol. 85, no. 8, April 1988 (1988-04-01), pages 2603 - 2607
OHMAN, T.; PARISH, G.; JACKSON, R. M., AM../. RESPIR. CELL MOL. BIOL., vol. 21, 1999, pages 119 - 127
OHTA ET AL., MOLEC. CELL, vol. 3, 1999, pages 535 - 541
PABORSKY ET AL., PROTEIN ENGINEERING, vol. 3, no. 6, 1990, pages 547 - 553
PALAMAKUMBURA, A. H.; TRACKMAN, P. C., ANAL. BIOCHEM., vol. 300, 2002, pages 245 - 251
PAYNE, S. L.; FOGELGREN, B.; HESS, A. R.; SEFTOR, E. A.; WILEY, E. L.; FONG, S. F.; CSISZAR, K.; HENDRIX, M. J.; KIRSCHMANN, D. A., CANCER RES., vol. 65, 2005, pages 11429 - 11436
PEELLE ET AL., J. PROTEIN CLZEM., vol. 20, 2001, pages 507 - 519
PEINADO, H.; DEL CARMEN IGLESIAS-DE LA CRUZ; OLMEDA, D.; CSISZAR, K.; FONG, K. S.; VEGA, S.; NIETO, M. A.; CANO, A.; PORTILLO, F., EMBO J, vol. 24, 2005, pages 3446 - 3458
PEINADO, H.; MORENO-BUENO, G.; HARDISSON, D.; PEREZ-GOMEZ, E.; SANTOS, V.; MENDIOLA, M.; DE DIEGO, J. I.; NISTAL, M.; QUINTANILLA,, CANCER RES., vol. 68, 2008, pages 4541 - 4550
RICHARD P. HAUGLAND: "Molecular Probes Handbook", 2002
RODRIGUEZ, H. M.; VAYSBERG, M.; MIKELS, A.; MCCAULEY, S.; VELAYO, A. C.; GARCIA, C.; SMITH, V., J. BIOL. CHEM., vol. 285, 2010, pages 20964 - 20974
SAITO, H.; PAPACONSTANTINOU, J.; SATO, H.; GOLDSTEIN, S., J. BIOL. CHEM., vol. 272, 1997, pages 8157 - 8160
SAVAGE ET AL., PREVIEWS, vol. 247, 1998, pages 6 - 9
SCHIETKE, R.; WARNECKE, C.; WACKER, I.; SCHODEL, J.; MOLE, D. R.; CAMPEAN, V.; AMANN, K.; GOPPELT-STRUEBE, M.; BEHRENS, J.; ECKARD, J. BIOL. CHEM., vol. 285, 2010, pages 6658 - 6669
SKINNER ET AL., J. BIOL. CHEM., vol. 266, 1991, pages 15 163 - 15 166
STAUBER, R. H., BIOTECHNIQUES, vol. 24, no. 3, 1998, pages 462 - 471
TANG, S. S.; TRACKMAN, P. C.; KAGAN, H. M., J. BIOL. CHEM., vol. 258, 1983, pages 4331 - 4338
VADASZ, Z.; KESSLER, O.; AKIRI, G.; GENGRINOVITCH, S.; KAGAN, H. M.; BARUCH, Y.; IZHAK, O. B.; NEUFELD, G., J. HEPATOL., vol. 43, 2005, pages 499 - 507
VARSHAVSKY, A.; KESSLER, 0.; ABRAMOVITCH, S.; KIGEL, B.; ZAFFRYAR, S.; AKIRI, G.; NEUFELD, G., CANCER RES., vol. 68, 2008, pages 6922 - 6931
WANG, S. X.; MURE, M.; MEDZIHRADSZKY, K. F.; BURLINGAME, A. L.; BROWN, D. E.; DOOLEY, D. M.; SMITH, A. J.; KAGAN, H. M.; KLINMAN,, SCIENCE, vol. 273, 1996, pages 1078 - 1084
WATANABE TATSURO ET AL: "Nucleolin as cell surface receptor for tumor necrosis factor-alpha inducing protein: a carcinogenic factor of Helicobacter pylori", JOURNAL OF CANCER RESEARCH AND CLINICAL ONCOLOGY, vol. 136, no. 6, June 2010 (2010-06-01), pages 911 - 921, XP002680673, ISSN: 0171-5216 *
WINSTON ET AL., GENES AND DEVEL., vol. 13, 1999, pages 270 - 283
XU ET AL., PROC. NATL. ACAD. SCI. USA, vol. 96, 1999, pages 151 - 156
YOUNG, J. VIROL. METHODS, vol. 24, 1989, pages 227 - 236

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104792998A (en) * 2015-03-09 2015-07-22 中国人民解放军第四军医大学 Application of LOXL2 antigen in preparation of thyroid carcinoma indication, invasion and transfer kit
EP4256349A1 (en) * 2020-12-01 2023-10-11 Genentech, Inc. Biological vesicles displaying cell surface proteins and methods related to same

Similar Documents

Publication Publication Date Title
Mann et al. Modulation of p27Kip1 levels by the cyclin encoded by Kaposi's sarcoma‐associated herpesvirus
JP5571696B2 (en) Novel diagnostic marker for type 1 diabetes
Yamauchi et al. Ubiquitination of E3 ubiquitin ligase TRIM5α and its potential role
JP4246259B2 (en) Toxin assay
WO2013190013A1 (en) Cell of hepatocyte phenotype
US9347942B2 (en) Ultrasensitive cell based sensors and uses thereof
JP4948728B2 (en) Antibodies for cancer diagnosis
JP2013534415A (en) N-terminal rule protease identification method and use thereof
Andrade et al. Interactions among p22, glyceraldehyde-3-phosphate dehydrogenase and microtubules
KR20180023912A (en) Electrochemical biosensor
Yuan et al. Homo-and hetero-dimerization of human UDP-glucuronosyltransferase 2B7 (UGT2B7) wild type and its allelic variants affect zidovudine glucuronidation activity
CN104844704B (en) Ub Nanoluc, Ub Ub GS Nanoluc Reporter Systems and its structure and application
WO2012155071A1 (en) Methods of identifying lysyl oxidase - like - 2 (loxl2) binding partners
JP2009501900A (en) Methods and compositions for detecting herpes simplex virus type 2
US20110171675A1 (en) Fret-based membrane-type 1 matrix metalloproteinase biosensor and methods for using the same
US8148110B2 (en) Detection of molecular interactions by β-lactamase reporter fragment complementation
US20150299764A1 (en) Immobilised cyclin-dependent kinase 4 fusion proteins and uses thereof
JP7212955B2 (en) Methods and kits for assaying activity of thyroid-stimulating hormone receptor-inhibiting autoantibodies
CN114317730B (en) Application of TTPAL as gastric cancer monitoring or prognosis judgment marker
CA2519259A1 (en) Test methods for determining the intracellular concentration of cyclic nucleotides
US8450066B2 (en) Methods for identifying the activity of gene products
JP2012127694A (en) Detection method of intracellular ubiquitination
US20060088901A1 (en) Methods and kits for determining ubiquitin protein ligase (E3) activity
KR20220124646A (en) Composition for detection of neutralizing antibody against sars-cov2 variants, dectection method and kit comprising thereof
Jiang et al. Membrane Protein Proteolysis Assayed by Fluorescence Quenching: Assay ofO-Sialoglycoprotein Endopeptidase

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12722050

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12722050

Country of ref document: EP

Kind code of ref document: A1