WO2012151636A1 - Actin binding agents - Google Patents
Actin binding agents Download PDFInfo
- Publication number
- WO2012151636A1 WO2012151636A1 PCT/AU2012/000524 AU2012000524W WO2012151636A1 WO 2012151636 A1 WO2012151636 A1 WO 2012151636A1 AU 2012000524 W AU2012000524 W AU 2012000524W WO 2012151636 A1 WO2012151636 A1 WO 2012151636A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- antibody
- seq
- actin
- fragment
- agent
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/20—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans from protozoa
- C07K16/205—Plasmodium
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P33/00—Antiparasitic agents
- A61P33/02—Antiprotozoals, e.g. for leishmaniasis, trichomoniasis, toxoplasmosis
- A61P33/06—Antimalarials
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/33—Crossreactivity, e.g. for species or epitope, or lack of said crossreactivity
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/34—Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
Definitions
- the present disclosure relates to agents that specifically bind to actin, to methods of identifying such agents, and to therapeutic applications of such agents.
- the present disclosure relates to agents that specifically bind apicomplexan actin and do not detectably bind human actin.
- Apicomplexa are unicellular obligate intracellular parasites that infect animals and other protists, and are the cause of significant human diseases including malaria and toxoplasmosis.
- apicomplexan parasites share a common cell architecture and mode of locomotion. This process - called gliding motility - underlies both cell motility and host cell invasion and relies on a conserved molecular machinery that is unique to the apicomplexan phylum (Morrissette and Sibley, 2002; Baum et al., 2008).
- the best model for gliding motility involves the precise linking of secreted ligands with an internal actomyosin motor (Frenal et al., 2010; Gaskins et al., 2004; Green et al., 2006; Jones et al., 2006; Baum et al., 2006a; Pinder et al., 1998).
- This motor is anchored within the pellicle, or supra-alveolar space, that lies between the outer plasma membrane and underlying inner membrane complex (IMC) (Raibaud et al. 2001) of the motile parasite (or zoite).
- IMC inner membrane complex
- core molecular components of the gliding motor are known, little is understood about their dynamics during cell movement. This is particularly true for actin, whose filament turnover is known to be essential for active gliding motilit and host cell invasion (reviewed in Baum et al., 2006b).
- Actin is a critical component of all eukaryotic cells. It exists in two states - a globular (G) and filamentous (F) form - with the dynamic interchange between the two used to drive a diversity of cell processes (Pollard and Cooper, 2009; Visa and Percipalle, 2010). Malaria parasites encode two actin isoforms, actin I and II (Gordon and Sibley, 2005). Actin II appears to play a restricted role during malaria parasite sexual stages (Wesseling et al., 1989).
- actin I drives cell motility (Siden-Kiamos et al., 2006; Miller et al., 1979; Munter et al., 2009; Mizuno et al., 2002; Ryning and Remington, 1978).
- Drugs that sequester monomelic or globular (G)-actin (Morrissette and Sibley, 2002; Siden-Kiamos et al., 2006) stall filamentous (F)-actin growth (Siden- iamos et al., 2006; Miller et al., 1979; Munter et al., 2009; Ryning and Remington, 1978; Dobrowolski and Sibley 1996; Field et al., 1993; Wetzel et al., 2003) or stabilize forming filaments (Siden-Kiamos et al., 2006; Munter et al., 2009; Mizuno et al., 2002; Shaw and Tilney, 1999; Wetzel et al., 2003), all prevent both cell movement and cell invasion demonstrating the importance of actin filament turnover to parasite gliding.
- Motile Toxoplasma gondii tachyzoites treated with JAS display both filamentous structures, presumed to be actin, under the plasma membrane (Wetzel et al., 2003) and patches of actin dynamics localized at the parasite poles (Shaw and Tilney, 1999; Wetzel et al., 2003), an observation mirrored in blood stage merozoites from the human malaria parasite Plasmodium falciparum (Mizuno et al., 2002).
- a gliding parasite such as a the mosquito stage ookinete (Vlachou et al., 2004), pre- erythrocytic sporozoites (Amino et al., 2008) or a Toxoplasma tachyzoite (Wetzel et al.,
- the present inventors have developed a novel antibody which specifically binds apicomplexan actin.
- This antibody can be used to inhibit apicomplexan actin dynamics and to identify further agents capable of inhibiting apicomplexan actin dynamics.
- the antibody has been raised against a particular epitope of apicomplexan actin whose
- 25 sequence differs from the corresponding epitope in human actin.
- the present disclosure provides an isolated or recombinant antibody or fragment thereof, which antibody or fragment specifically binds a polypeptide comprising the amino acid sequence KSYELPDGNIITVGN (SEQ ID NO: 2).
- the antibody or fragment may bind an epitope comprising or consisting of the
- KSYELPDGNIITVGN 30 amino acid sequence KSYELPDGNIITVGN (SEQ ID NO: 2), or an epitope comprising or consisting of a fragment of the amino acid sequence KSYELPDGNIITVGN (SEQ ID NO: 2).
- the fragment may comprise any number of amino acid residues of the sequence KSYELPDGNIITVGN (SEQ ID NO: 2).
- the fragment may contain only amino acid sequences within the sequence
- the fragment comprises or consists of the amino acid sequence NIITV (SEQ ID NO: 10).
- the epitope may comprise a fragment of the sequence KSYELPDGNIITVGN (SEQ ID NO: 2) and one or more amino acid residues found either side of this sequence in the amino acid sequence of P. falciparum actin (SEQ ID NO: 1).
- the epitope may comprise a fragment of the amino acid sequence of P. falciparum actin (SEQ ID NO: 1 ) that partially overlaps with the sequence KSYELPDGNIITVGN (SEQ ID NO: 2).
- the antibody or fragment does not detectably bind to the corresponding epitope in human actin.
- the antibody or fragment disclosed herein does not detectably bind a polypeptide comprising amino acids 237 to 251 of human ⁇ -actin as defined in SEQ ID NO: 3 and/or a polypeptide comprising amino acids 237 to 251 of mutant human ⁇ -actin as defined in SEQ ID NO: 4.
- the antibody or fragment disclosed herein does not detectably bind a polypeptide comprising the amino acid sequence QVITI (SEQ ID NO: 11 ; corresponding to amino acids 245 to 249 of human ⁇ -actin).
- the antibody or fragment thereof does not detectably bind mammalian actin. In one embodiment, the antibody or fragment thereof does not detectably bind human actin.
- the antibody or fragment thereof comprises one or more complementarity determining regions (CDRs) of the antibody produced by the hybridoma cell line 26/11-5H3- 1-2 deposited with the European Collection of Cell Cultures (EC ACQ under accession number 12041801.
- CDRs complementarity determining regions
- the monoclonal antibody produced by the hybridoma cell line 26/11-5H3-1-2 deposited with the European Collection of Cell Cultures (ECACC) under accession number 12041801 is referred to herein as "the monoclonal antibody 5H3".
- the antibody or fragment thereof may comprise 1, 2, 3, 4, 5, or 6 CDRs of the monoclonal antibody 5H3, in any combination.
- the antibody or fragment thereof comprises all 6 CDRs of the monoclonal antibody 5H3.
- the antibody or fragment thereof comprises one or more variable regions of the monoclonal antibody 5H3.
- the antibody or fragment may comprise one or both heavy chain variable regions and/or one or both light chain variable regions of the monoclonal antibody 5H3.
- the antibody comprises one or more of the light chains and/or heavy chains of the monoclonal antibody 5H3.
- the antibody or fragment thereof has the same binding affinity as the monoclonal antibody 5H3 for a polypeptide comprising the amino acid sequence KSYELPDGNIITVGN (SEQ ID NO: 2).
- the antibody is the monoclonal antibody 5H3.
- the antibody disclosed herein can be, for example, a polyclonal antibody, monoclonal antibody, bispecific antibody, diabody, triabody, heteroconjugate antibody, chimeric antibody or single chain antibody.
- the fragment of the antibody disclosed herein can be, for example, a Fab, F(ab')2, FabFc 2 , or Fv fragment.
- the present disclosure also provides an isolated or recombinant antibody or fragment thereof, which antibody or fragment thereof competitively inhibits the binding of the monoclonal antibody 5H3 to any one or more of: a polypeptide comprising the amino acid sequence KSYELPDGNIITVGN (SEQ ID NO: 2); a polypeptide consisting of the amino acid sequence KSYELPDGNIITVGN (SEQ ID NO: 2); an epitope comprising or consisting of the amino acid sequence KSYELPDGNIITVGN (SEQ ID NO: 2); and/or an epitope comprising or consisting of a fragment of the amino acid sequence KSYELPDGNIITVGN (SEQ ID NO: 2) (for example, the fragment NIITV (SEQ ID NO: 10)).
- a polypeptide comprising the amino acid sequence KSYELPDGNIITVGN SEQ ID NO: 2
- a polypeptide consisting of the amino acid sequence KSYELPDGNIITVGN SEQ ID NO: 2
- the antibody or fragment disclosed herein is detectably labelled.
- the antibody or fragment disclosed herein is conjugated to a cell penetrating agent.
- the antibody or fragment itself is intracellularly transmissible.
- the present disclosure also provides a composition comprising the antibody or fragment disclosed herein and a carrier.
- the carrier is a pharmaceutically acceptable carrier.
- the present disclosure also provides an isolated or recombinant polynucleotide encoding the antibody or fragment disclosed herein, or a chain thereof.
- the present disclosure also provides a vector comprising said polynucleotide, and further provides a host cell comprising said polynucleotide or said vector.
- the present disclosure also provides an epitope of apicomplexan actin, which can be used to generate an antibody or fragment which specifically binds apicomplexan actin. Accordingly, the present disclosure provides an isolated or recombinant peptide consisting of the amino acid sequence KSYELPDGNIITVGN (SEQ ID NO: 2).
- the present disclosure also provides an isolated or recombinant peptide consisting of the amino acid sequence -NIITV (SEQ ID NO: 10). Structural epitope analysis has indicated that this peptide may be suitable for generatingjui __antibody_or fragment which specifically binds apicomplexan actin.
- the present disclosure also provides an isolated or recombinant polynucleotide encoding the peptide of SEQ ID NO: 2 or the peptide of SEQ ID NO: 10, a vector comprising said polynucleotide, and a host cell comprising any one or more of the peptide of SEQ ID NO: 2 or the peptide of SEQ ID NO: 10, the polynucleotide encoding said peptide, or the vector comprising said polynucleotide.
- the present disclosure also provides a composition
- a composition comprising a carrier and any one of more of the peptide of SEQ ID NO: 2 or the peptide of SEQ ID NO: 10, the polynucleotide encoding said peptide, the vector comprising said polynucleotide and the host cell comprising said peptide, polynucleotide or vector.
- the composition further comprises an adjuvant.
- the present disclosure also provides a method of producing the antibody or fragment described herein, using the peptide despribed herein.
- the present disclosure provides a method of producing the antibody or fragment described herein, the method comprising administering to an animal any one or more of the peptide of SEQ ID NO: 2 or the peptide of SEQ ID NO: 10, the polynucleotide encoding said peptide, the vector comprising said polynucleotide, the host cell comprising said peptide, polynucleotide or vector, or the composition comprising a carrier and any one of said peptide, polynucleotide, vector, or host cell.
- the antibody or fragment disclosed herein can be used to identify agents which bind to apicomplexan actin. Accordingly, the present disclosure provides a method of identifying an agent which binds apicomplexan actin, the method comprising:
- the method may further comprise contacting the antibody or fragment disclosed herein with a polypeptide comprising SEQ ID NO: 2 or SEQ ID NO: 10 in the absence of a candidate agent; and identifying the candidate agent as an agent which binds apicomplexan actin if the binding of the antibody or fragment to the polypeptide comprising SEQ ID NO: 2 or SEQ ID NO: 10 is reduced in the presence of the candidate agent compared to the absence of the candidate agent.
- the method may further comprise contacting the candidate agent with a polypeptide which does not comprise an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10; and identifying the agent as an agent which specifically binds apicomplexan actin if the agent reduces the binding of the antibody or fragment to the polypeptide comprising SEQ ID NO: 2 or SEQ ID NO: 10 and does not detectably bind to the polypeptide which does not comprise an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10.
- the peptide disclosed herein can be used without the antibody to identify agents which bind apicomplexan actin.
- the present disclosure also provides a method of identifying an agent which binds apicomplexan actin, the method comprising:
- the method may further comprise contacting the candidate agent with a polypeptide which does not comprise an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10; and identifying the agent as an agent which specifically binds apicomplexan actin if the agent binds to the peptide of SEQ ID NO: 2 or SEQ ID NO: 10 and does not detectably bind to the polypeptide which does not comprise an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10.
- the polypeptide which does not comprise an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10 may be mammalian actin.
- the mammalian actin comprises a polypeptide comprising amino acids 237 to 251 of human ⁇ -actin as defined in SEQ ID NO: 3 or a polypeptide comprising amino acids 237 to 251 of mutant human ⁇ -actin as defined in SEQ ID NO: 4.
- the mammalian actin comprises a polypeptide comprising amino acids 245 to 249 of human ⁇ -actin, as defined in SEQ ID NO: 11.
- the methods of identifying an agent which binds apicomplexan actin further comprise detennining whether the agent is capable , of inhibiting, disrupting or stabilising apicomplexan actin polymerization. In another embodiment, the methods further comprise determining whether the agent is capable of inhibiting apicomplexan motility and/or host cell invasion and/or apicomplexan intra- cellular development.
- the agent and/or the antibody or fragment thereof is detectably labelled.
- the polypeptide comprising SEQ ID NO: 2 or peptide consisting of SEQ ID NO: 2 or the peptide comprising SEQ ID NO: 10 or peptide consisting of SEQ ID NO: 10 is detectably labelled.
- the present disclosure also provides an agent capable of binding apicomplexan actin identified by the methods described herein.
- the present disclosure also provides a method of treating a disease caused by an apicomplexan parasite, the method comprising administering the agent, the antibody or fragment, or the composition comprising the antibody or fragment and a carrier as described herein, to a subject in need thereof.
- the present disclosure also provides the agent, the antibody or fragment, or the composition comprising the antibody or fragment and a carrier as described herein for use in treating a disease caused by an apicomplexan parasite.
- the present disclosure also provides the use of the agent, the antibody or fragment, or the composition comprising the antibody or fragment and a carrier as described herein in the manufacture of a medicament for treating a disease caused by an apicomplexan parasite.
- the present disclosure also provides the use of the agent, the antibody or fragment, or the composition comprising the antibody or fragment and a carrier as described herein to inhibit, disrupt or stabilise apicomplexan actin polymerization.
- the present inventors have also identified a polynucleotide, which, when expressed, results in higher levels of production of P. falciparum actin than the levels achieved by expressing the endogenous P. falciparum actin gene.
- the sequence of this polynucleotide is set out in SEQ ID NO: 7.
- the present disclosure also provides a polynucleotide comprising the nucleotide sequence set out in SEQ ID NO: 7.
- the polynucleotide may comprise other nucleotide sequences in addition to the sequence of SEQ ID NO: 7, or may consist of the nucleotide sequence of SEQ ID NO: 7.
- the polynucleotide is an isolated or recombinant polynucleotide.
- the polynucleotide is operably linked to a promoter capable of directing expression of the polynucleotide in a cell.
- a vector comprising the polynucleotide.
- the present disclosure provides a host cell or extract thereof comprising the polynucleotide and/or vector.
- suitable host cells include, but are not limited to, a bacterial cell, a yeast cell or a plant cell.
- the host cell is a bacterial cell.
- the bacterial cell is an E. coli cell.
- the present disclosure also provides a method of producing P. falciparum actin, the method comprising expressing a polynucleotide encodin P. falciparum actin, or expressing a vector comprising a polynucleotide encoding P. falciparum actin under conditions suitable to produce the P. falciparum actin.
- the method comprises expressing a polynucleotide comprising the polynucleotide sequence of SEQ ID NO: 7, or expressing a vector comprising the polynucleotide sequence of SEQ ID NO: 7, under conditions suitable to produce P. falciparum actin.
- the methods can comprise expressing the polynucleotide in a host cell or in a cell-free system.
- suitable host cells include, but are not limited to, a bacterial cell, a yeast cell or a plant cell.
- the host cell is a bacterial cell.
- the bacterial cell is an E. coli cell.
- the cell-free system may comprise an extract of a host cell.
- P. falciparum actin produced using a method described herein.
- composition of matter, group of steps or group of compositions of matter shall be taken to encompass one and a plurality (i.e. one or more) of those steps, compositions of matter, groups of steps or group of compositions of matter.
- B) IF A of P. falciparum merozoites with anti-PfAct239-253 and IMC protein PfGAP45. Scale bar 2 ⁇ .
- C) Imuno-electron microscopy of free P. falciparum merozoites labelled with anti-PfAct 2 39.253. Scale bar 0.2 um.
- A) IFA of untreated and 1 ⁇ JAS treated T .gondii parasites probed with anti- PfAct 2 39-253 and anti-TgSAGl. Scale bar 5 ⁇ .
- B) IFA as in (A) following treatment with Clostridium septicum a toxin 1/100. Scale bar 5 ⁇ .
- P pellet fraction
- S supernatant fraction.
- A) IFA of invading P. falciparum merozoite labelled with antisera anti-PfRON4 and anti-PfAct239-253. Scale bar 2 ⁇ .
- B) Immuno-electron microscopy of invading P. falciparum merozoites stained with antisera ant.-PfAct239.253. Scale bar 0.2 ⁇ .
- G) IFA of invading P. berghei merozoite labelled with antisera anti-PfAct 239-253. Scale bar 2 ⁇ , arrows show direction of invasion.
- A) IFA of invading P. falciparum merozoites incubated with and without 1 ⁇ JAS and labelled with antisera anti-PfAct239-2S3 and anti-PfRON4. Scale bar 2 ⁇ .
- B) IFA and 3D reconstruction of P. berghei merozoites incubated with and without 1 ⁇ JAS and labelled with antisera anti-PfAct 2 39-2S3. Scale bar 2 ⁇ , arrow shows direction of invasion.
- Figure S BLAST analysis investigating P. falciparum actin epitope sequence conservation in apicomplexans.
- RSMA Rabbit Skeletal Muscle Actin
- rPf recombinant P. falciparum actin
- SEQ ID NO: 2 amino acid sequence of an immunogenic epitope of P. falciparum actin (spanning amino acids 239 to 253 of P. falciparum actin).
- SEQ ID NO: 3 amino acid sequence of amino acids 237 to 251 of human ⁇ -actin.
- SEQ ID NO: - amino acid sequence of amino acids 23 to 251 of mutant human ⁇ - actin.
- SEQ ID NO: 7 Codon optimised P. falciparum actin gene sequence.
- SEQ ID NO: 8 P. falciparum actin gene sequence.
- SEQ ID NO: 9 Alternative P. falciparum actin short peptide sequence.
- SEQ ID NO: 10 Exemplified fragment of an immunogenic epitope of P. falciparum actin.
- the term “about” followed by a designated value is to be interpreted as also encompassing the exact designated value itself (for example, “about 10" also encompasses 10 exactly).
- treating include administering a therapeutically effective amount of an agent sufficient to reduce or eliminate at least one symptom of disease caused by infection with an apicomplexan parasite.
- subject refers to an animal, e.g., a mammal. In a preferred embodiment, the subject is mammalian, for example a human. Other preferred embodiments include livestock animals such as horses, cattle, sheep and goats, as well as companion animals such as cats and dogs.
- conjugate As used herein, the terms “conjugate”, “conjugated” or variations thereof are used broadly to refer to any form to covalent or non-covalent association between a compound useful in the methods disclosed herein and another agent.
- cell penetrating agent includes compounds or functional groups which mediate transfer of a substance from an extracellular space to an intracellular compartment of a cell, such as an apicomplexan cell.
- a cell penetrating agent may be a hydrophobic moiety and the hydrophobic moiety may be, e.g., a mixed sequence peptide or a homopolymer peptide such as polyleucine or polyarginine at least about 11 amino acids long.
- the cell penetrating agent may be a peptide.
- cell penetrating peptides examples include Tat peptides, Penetratin, short amphipathic peptides such as those from the Pep-and MPG-families, oligoarginine, oligolysine and others.
- the cell-penetrating agent may be a lipid.
- the cell-penetrating lipid may be a straight chain fatty acid.
- intracellularly transmissible shall be understood to mean being capable of passing from an extracellular space to an intracellular compartment of a cell, such as an intracellular compartment of an apicomplexan cell.
- variable region and “variable domain” refer to the portion of the light and/or heavy chains of an antibody as defined herein that is capable of specifically binding to an antigen and includes amino acid sequences of complementarity determining regions (CDRs); i.e., CDR1, CDR2, and CDR3, and framework regions (FRs).
- CDRs complementarity determining regions
- FRs framework regions
- the variable region may comprise three or four FRs (e.g., FR1, FR2, FR3 and optionally FR4) together with three CDRs.
- V H refers to the variable region of the heavy chain.
- VL refers to the variable region of the light chain.
- a candidate agent for example, a small molecule or a test antibody or fragment thereof reduces or prevents binding of an antibody disclosed herein (for example, the monoclonal antibody 5H3) to any one or more of: a polypeptide comprising the amino acid sequence KSYELPDGNIITVGN (SEQ ID NO: 2) or the amino acid sequence NIITV (SEQ ID NO: 10); a polypeptide consisting of the amino acid sequence KSYELPDGNIITVGN (SEQ ID NO: 2) or the amino acid sequence NIITV (SEQ ID NO: 10); an epitope comprising or consisting of the amino acid sequence KSYELPDGNIITVGN (SEQ ID NO: 2); and/or an epitope comprising or consisting of a fragment of the amino acid sequence KSYELPDGNIITVGN (SEQ ID NO: 2) (for example, the amino acid sequence NIITV (SEQ ID NO: 10)
- the candidate agent need not completely inhibit binding of the antibody, rather it need only reduce binding by a statistically significant amount, for example ⁇ by at least about 10% or 20% or 30% or 40% or 50% or 60% or 70% or 80% or 90% or 95%.
- the candidate agent reduces binding of the antibody by at least about 30%, more preferably by at least about 50%, more0 preferably, by at least about 70%, still more preferably by at least about 75%, even more preferably, by at least about 80% or 85% and even more preferably, by at least about 90%.
- Methods for determining competitive inhibition of binding are known in the art and/or described herein.
- the antibody can be exposed to a polypeptide comprising the amino acid sequence KSYELPDGNIITVGN (SEQ ID NO:5 2) either in the presence or absence of the candidate agent. If less antibody binds in the presence of the candidate agent than in the absence of the candidate agent, the candidate agent is considered to competitively inhibit binding of the antibody. In one example, the competitive inhibition is not due to steric hindrance. 0 Apicomplexan Actin Epitope
- the present inventors have identified an epitope of apicomplexan actin that can be used to raise antibodies which specifically bind apicomplexan actin.
- the epitope disclosed herein comprises the amino acid sequence KSYELPDGNIITVGN (SEQ ID NO: 2). Accordingly, the present disclosure provides an isolated or recombinant5 peptide consisting of SEQ ID NO: 2.
- SEQ ID NO: 2 is contained in, for example, P. falciparum actin I.
- the epitope sequence set out in5 SEQ ID NO: 2 is conserved among other apicomplexan parasites including, for example, Plasmodium vivax, Babesia bovis, Babesia gibsoni, Toxoplasma gondii, Theileria parva strain Muguga, Theileria annulata strain Ankara, and others. Accordingly, the epitope identified in SEQ ID NO: 2 is an apicomplexan actin epitope.
- peptide generally used interchangeably and refer to a single polypeptide chain which may or may not be modified by addition of non-amino acid groups.
- peptide additionally implies that the length of the single polypeptide chain is reasonably short, such as less than 100, or less than 50, or less than 20 amino acids in length. It will be understood that such single polypeptide chains may associate with other peptides, polypeptides or proteins or other molecules such as co-factors.
- the terms “peptides”, “proteins” and “polypeptides” as used herein also include variants, mutants, biologically active fragments, modifications, analogs and/or derivatives of the peptides described herein.
- a biologically active fragment is a portion of a peptide which maintains a defined activity of the full-length peptide.
- a biologically active fragment of the peptide of SEQ ID NO: 2 may be a fragment which is capable of being used to generate an antibody which specifically binds apicomplexan actin.
- Biologically active fragments can be any size as long as they maintain the defined activity.
- One example of such a fragment is provided in SEQ ID NO: 10.
- unnatural amino acids or chemical amino acid analogues can be introduced as a substitution or addition into the peptides of the present disclosure.
- Such amino acids include, but are not limited to, the D-isomers of the common amino acids, 2,4-diaminobutyric acid, a-amino isobutyric acid, 4- aminobutyric acid, 2-aminobutyric acid, 6-amino hexanoic acid, 2-amino isobutyric acid, 3-amino propionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitrulline, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, ⁇ -alanine, fluoro-amino acids, designer amino acids such as ⁇ -methyl amino acids, Ca-methyl amino acids, Na-methyl amino acids, and
- the peptides disclosed herein may also be differentially modified during or after synthesis, e.g., by biotinylation, benzylation, glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, conjugation to a carrier such as a protein carrier, etc. These modifications may serve to increase the stability and/or bioactivity of the peptides disclosed herein, and may allow simpler isolation or purification of the peptide.
- isolated peptide or “purified peptide” is intended to mean a peptide that has generally been separated from the lipids, nucleic acids, other peptides and polypeptides, and other contaminating molecules with which it is associated in its native state.
- the isolated peptide is at least 60% free, more preferably at least 75% free, and more preferably at least 90% free from other components with which it is naturally associated.
- recombinant in the context of a peptide refers to the peptide when produced by a cell, or in a cell-free expression system, in an altered amount or at an altered rate compared to its native state.
- the cell is a cell that does not naturally produce the peptide.
- the cell may be a cell which comprises a non-endogenous gene that causes an altered, preferably increased, amount of the peptide to be produced.
- a recombinant peptide as described herein includes peptides which have not been separated from other components of the transgenic (recombinant) cell or cell-free expression system in which it is produced, and peptides produced in such cells or cell-free systems which are subsequently purified away from at least some other components.
- the peptides disclosed herein can be produced in a variety of ways, including production and recovery of natural peptides, production and recovery of recombinant peptides, and chemical synthesis of the peptides.
- the peptide is produced by chemical synthesis.
- the peptide disclosed herein can be isolated from naturally occurring apicomplexan actin by any suitable method known in the art.
- apicomplexan actin can be purified from apicomplexan cell lysates and protease enzymes can be used to cleave the purified actin to produce the peptide.
- the peptide can be produced by recombinant methods.
- the peptide can be made recombinantly by producing a polynucleotide encoding the peptide and expressing the polynucleotide in a suitable expression system such as a host cell.
- the present disclosure provides a polynucleotide encoding the peptide.
- the polynucleotide is an isolated or recombinant polynucleotide.
- the peptide can be produced by a method including a step of expressing the endogenous P. falciparum actin gene (whose sequence is set out in SEQ ID NO: 8).
- the peptide disclosed herein can be produced from the P. falciparum actin protein by any suitable means.
- the peptide can be produced by a method including a step of expressing a codon optimised polynucleotide sequence encoding P. falciparum actin, whose sequence has been modified from the sequence of the endogenous P. falciparum gene in order to result in enhanced expression of the actin protein.
- a codon optimised sequence is set out in SEQ ID NO: 7.
- the peptide disclosed herein can be produced from the P. falciparum actin protein by any suitable means.
- isolated polynucleotide is intended to mean a polynucleotide which has generally been separated from the polynucleotide sequences with which it is associated or linked in its native state.
- the isolated polynucleotide is at least 60% free, more preferably at least 75% free, and more preferably at least 90% free from other components with which it is naturally associated.
- polynucleotide is used interchangeably herein with the terms “nucleic acid molecule", “gene” and "mRNA”.
- the term "recombinant" in the context of a polynucleotide refers to the polynucleotide when present in a cell, or in a cell-free expression system, in an altered amount compared to its native state.
- the cell is a cell that does not naturally comprise the polynucleotide.
- the cell may be a cell which comprises a non-endogenous polynucleotide resulting in an altered, preferably increased, amount of production of the encoded polypeptide.
- a recombinant polynucleotide of the invention includes polynucleotides which have not been separated from other components of the transgenic (recombinant) cell, or cell-free expression system, in which it is present, and polynucleotides produced in such cells or cell-free systems which are subsequently purified away from at least some other components.
- Polynucleotide refers to an oligonucleotide, a polynucleotide or any fragment thereof. It may be DNA or RNA of genomic or synthetic origin, double-stranded or single-stranded, and combined with carbohydrate, lipids, protein, or other materials to perform a particular activity defined herein.
- the polynucleotides disclosed herein may possess, when compared to naturally occurring molecules (such as genomic polynucleotides encoding P. falciparum actin), one or more mutations which are deletions, insertions, or substitutions of nucleotide residues. Mutants can be either naturally occurring (that is to say, isolated from a natural source) or synthetic (for example, made by performing site-directed mutagenesis or DNA shuffling techniques as broadly described by Harayama (1998)).
- polynucleotides of the invention can be either naturally occurring or recombinant.
- the particular sequence of the polynucleotide can be determined from the peptide sequence. Due to the redundancy of the genetic code, different sequences can be used to encode the same peptide.
- the polynucleotide encoding the peptide epitope can be inserted into a nucleotide vector in order to facilitate expression of the peptide.
- the present disclosure provides a vector comprising a polynucleotide encoding the peptide of SEQ ID NO: 2 or SEQ ID NO: 10.
- the vector can be either RNA or DNA, either prokaryotic or eukaryotic, and typically is a transposon (such as described in US 5,792,294), a virus or a plasmid.
- the polynucleotide encoding the peptide epitope is operably linked to a promoter which is capable of expressing the peptide under suitable conditions.
- "Operably linked” as used herein refers to a functional relationship between two or more nucleic acid (e.g., DNA) segments. Typically, it refers to the functional relationship of a transcriptional regulatory element to a transcribed sequence.
- a promoter is operably linked to a coding sequence, such as a polynucleotide defined herein, if it stimulates or modulates the transcription of the coding sequence in an appropriate cell.
- promoter transcriptional regulatory elements that are operably linked to a transcribed sequence are physically contiguous to the transcribed sequence, i.e., they are cis-acting.
- some transcriptional regulatory elements, such as enhancers need not be physically contiguous or located in close proximity to the coding sequences whose transcription they enhance.
- the vector is preferably an expression vector.
- an expression vector is a DNA or RNA vector that is capable of transforming a host cell and of effecting expression of a specified polynucleotide molecule.
- the expression vector is also capable of replicating within the host cell.
- Expression vectors can be either prokaryotic or eukaryotic, and are typically viruses or plasmids.
- the expression vectors disclosed herein include any vectors that function (i.e., direct gene expression) in the recombinant cells disclosed herein, including in bacterial, fungal, endoparasite, arthropod, animal, and plant cells.
- the expression vectors disclosed herein may contain regulatory sequences such as transcription control sequences, translation control sequences, origins of replication, and other regulatory sequences that are compatible with the recombinant cell and that control the expression of polynucleotide molecules disclosed herein.
- the vectors disclosed herein may include transcription control sequences.
- Transcription control sequences are sequences which control the initiation, elongation, and termination of transcription.
- Particularly important transcription control sequences are those which control transcription initiation, such as promoter, enhancer, operator and repressor sequences.
- Suitable transcription control sequences include any transcription control sequence that can function in at least one of the recombinant cells disclosed herein. A variety of such transcription control sequences are known to those skilled in the art.
- the vectors disclosed herein may also contain (a) secretory signals (i.e., signal segment nucleic acid sequences) to enable an expressed peptide to be secreted from the cell that produces the peptide and/or (b) fusion sequences which lead to the expression of peptides disclosed herein as fusion proteins.
- suitable signal segments include any signal segment capable of directing the secretion of a polypeptide of the present invention.
- the vectors may also include intervening and/or untranslated sequences surrounding and/or within the nucleic acid sequence(s) encoding the peptide disclosed herein.
- the polynucleotide or vector can be expressed in a host cell in order to produce the peptide.
- the host cell can be any cell capable of producing the peptide disclosed herein. Suitable host cells can be readily identified by the skilled artisan, and include, for example, animal, plant, bacterial, fungal (including yeast), parasite, and arthropod cells. Preferably, the host cell is a bacterial cell. In one preferred embodiment, the host cell is an E. coli strain having the serotype H antigen, H10. Examples of suitable E. coli strains include CCEC22, CCEC31, and CCEC59 as described in WO 2007/025333.
- Transformation of a polynucleotide into a host cell can be accomplished by any suitable method known in the art. Transformation techniques include, but are not limited to, transfection, electroporation, microinjection, lipofection, adsorption, and protoplast fusion.
- a recombinant cell may remain unicellular or may grow into a tissue, organ or a multicellular organism.
- Transformed polynucleotide molecules as disclosed herei can remain extrachromosomal or can integrate into one or more sites within a chromosome of the transformed (i.e., recombinant) cell in such a manner that their ability to be expressed is retained.
- Suitable host cells to transform include any cell that can be transformed with a polynucleotide as disclosed herein.
- Host cells can be either endogenously (i.e., naturally) capable of producing polypeptides of the present invention or can be rendered capable of producing such polypeptides after being transformed with at least one polynucleotide molecule as disclosed herein.
- Recombinant DNA technologies can be used to improve expression of a transformed polynucleotide molecule by manipulating, for example, the number of copies of the polynucleotide molecule within a host cell, the efficiency with which those polynucleotide molecules are transcribed, the efficiency with which the resultant transcripts are translated, and the efficiency of post-translational modifications.
- Recombinant techniques useful for increasing the expression of polynucleotide molecules as disclosed herein include, but are not limited to, operatively linking polynucleotide molecules to high-copy number plasmids, integration of the polynucleotide molecule into one or more host cell chromosomes, addition of vector stability sequences to plasmids, substitutions or modifications of transcription control signals (e.g., promoters, operators, enhancers), substitutions or modifications of translational control signals (e.g., ribosome binding sites, Shine-Dalgarno sequences), modification of polynucleotide molecules as disclosed herein to correspond to the codon usage of the host cell, and the deletion of sequences that destabilize transcripts.
- transcription control signals e.g., promoters, operators, enhancers
- translational control signals e.g., ribosome binding sites, Shine-Dalgarno sequences
- the host cell may be cultured under conditions effective to produce the peptide.
- the peptide can be isolated by conventional methods known in the art.
- an isolated peptide as described herein is produced by culturing a cell capable of expressing the peptide under conditions effective to produce the peptide, and isolating the peptide.
- Effective culture conditions include, but are not limited to, effective media, bioreactor, temperature, pH and oxygen conditions that permit polypeptide production.
- An effective medium refers to any medium in which a cell is cultured to produce a peptide as disclosed herein.
- Such medium typically comprises an aqueous medium having assimilable carbon, nitrogen and phosphate sources, and appropriate salts, minerals, metals and other nutrients, such as vitamins.
- Host cells can be cultured in conventional fermentation bioreactors, shake flasks, test tubes, microtiter dishes, and petri plates. Culturing can be carried out at a temperature, pH and oxygen content appropriate for a recombinant cell. Such culturing conditions are within the expertise of one of ordinary skill in the art.
- the peptide of SEQ ID NO: 2 can be used to produce an antibody which specifically binds apicomplexan actin.
- the polynucleotide encoding the peptide of SEQ ID NO: 2, the vector comprising said polynucleotide, or the host cell comprising said peptide, polynucleotide and or vector can also be used to produce an antibody which specifically binds apicomplexan actin.
- the peptide of SEQ ID NO: 10 can also be used to produce an antibody which specifically binds apicomplexan actin.
- polynucleotide encoding the peptide of SEQ ID NO: 10 the vector comprising said polynucleotide, or the host cell comprising said peptide, polynucleotide and/or vector can also be used to produce an antibody which specifically binds apicomplexan actin.
- the peptide can be used alone, or can be used in combination with a carrier, such as an immunogenic carrier. Accordingly, the present disclosure provides a composition comprising the peptide of SEQ ID NO: 2 or SEQ ID NO: 10 and a carrier. In addition, the present disclosure provides a composition comprising a carrier and any one of the polynucleotide, the vector or the host cell as disclosed herein.
- the carrier may be an immunogenic carrier or adjuvant.
- the methods of producing an antibody which specifically binds apicomplexan actin can include a step of immunizing an animal with the peptide of SEQ ID NO: 2 or SEQ ID NO: 10, the polynucleotide encoding said peptide, the vector comprising said polynucleotide, the host cell comprising said peptide, polynucleotide and/or vector, and the composition comprising a carrier and any one of the peptide, polynucleotide, vector and host cell.
- Any suitable animal can be immunized, for example, a mouse, rat, rabbit, and others.
- the peptide may be administered in combination with an adjuvant.
- Adjuvants are useful for improving the immune response and/or increasing the stability of antigenic preparations.
- Adjuvants are typically described as non-specific stimulators of the immune system, but can also be useful for targeting specific arms of the immune system.
- One or more compounds which have this activity may be administered in combination with the peptide.
- Examples of chemical compounds that can be used as adjuvants include, but are not limited to aluminium compounds (e.g., aluminium hydroxide), metabolizable and non-metabolizable oils, mineral oils including mannide oleate derivatives in mineral oil solution (e.g., MONTANIDE ISA 70 from Seppic SA, France), and light mineral oils such as DRAKEOL 6VR, block polymers, ISCOM's (immune stimulating complexes), vitamins and minerals (including but not limited to: vitamin E, vitamin A, selenium, and vitamin B12) and CARBOPOL ® .
- aluminium compounds e.g., aluminium hydroxide
- metabolizable and non-metabolizable oils include mannide oleate derivatives in mineral oil solution (e.g., MONTANIDE ISA 70 from Seppic SA, France), and light mineral oils such as DRAKEOL 6VR, block polymers, ISCOM's (immune stimulating complexes), vitamins and minerals (including but not limited to:
- Suitable adjuvants include, but are not limited to: cytokines, growth factors, chemokines, superaatants from cell cultures of lymphocytes, monocytes, cells from lymphoid organs, cell preparations and/or extracts from plants, bacteria or parasites (e.g.
- Staphylococcus aureus or lipopoly saccharide preparations or mitogens.
- an adjuvant is administered at the same time as the peptide disclosed herein.
- adjuvants can also, or alternatively be administered within a two- week period prior to administration of the peptide, and/or for a period of time after administration of the peptide, i.e., so long as the peptide antigen persists in the tissues.
- Immunogenic compositions disclosed herein may include the peptides and nucleic acid molecules described herein, or immunogenic f agments thereof, and may be administered using any form of administration known in the art or described herein.
- the immunogenic composition may include a live bacterial pathogen, a killed bacterial pathogen, or components thereof.
- Live bacterial pathogens which may be administered in the form of an oral vaccine, may be attenuated so as to reduce the virulence of the bacterial pathogen, but not its induction of an immune response.
- a live vaccine may be capable of colonizing the intestines of the inoculated animal, e.g., avian.
- the peptides and nucleic acid molecules described herein may be administered to poultry, e.g., chicken, ducks, turkeys, etc., so as to elicit an immune response e.g., raise antibodies, in the poultry.
- Eggs, or products thereof, obtained from such poultry, that exhibit an immune response against the peptides and nucleic acid molecules described herein, or immunogenic fragments thereof may be administered to an animal, e.g., humans, cattle, goats, sheep, etc., to elicit an immune response to the peptides and nucleic acid molecules in the animal.
- Methods of raising antibodies in poultry, and administering such antibodies are described in for example, US 5,750,113 and US 6,730,822.
- the immunogenic compositions disclosed herein may be administered as a liquid, emulsion, dried powder and/or in a mist through any parenteral route, intravenously, intraperitoneally, intradermally, by scarification, subcutaneously, intramuscularly, or inoculated by a mucosal route, e.g., orally, intranasally, as an aerosol, by eye drop, by in ovo administration, or implanted as a freeze dried powder.
- the immunogenic compositions disclosed herein may further comprise a pharmaceutically acceptable carrier.
- a pharmaceutically acceptable carrier includes a veterinarily acceptable carrier.
- pharmaceutically acceptable means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
- carrier refers to a diluent, excipient, or vehicle with which the therapeutic is administered.
- Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like.
- the antibody or fragment thereof developed by the present inventors specifically binds a polypeptide comprising, more preferably consisting of, SEQ ID NO: 2.
- the antibody or fragment may bind to an epitope comprising or consisting of the amino acid sequence SYELPDGNIITVGN (SEQ ID NO: 2), or an epitope comprising or consisting of a fragment of the amino acid sequence KSYELPDGNIITVGN (SEQ ID NO: 2).
- the antibody or fragment may bind to an epitope comprising or consisting of the amino acid sequence NIITV (SEQ ID NO: 10).
- the antibody or fragment thereof does not detectably bind to an epitope comprising or consisting of the amino acid sequence DEEMKTSEQSSDI (SEQ ID NO: 9; corresponding to amino acid residues 225-237 of SEQ ID NO: 1 ).
- the term "specifically binds" shall be taken to mean that the antibody or fragment thereof reacts or associates more frequently, more rapidly, with greater duration and/or with greater affinity with a polypeptide comprising SEQ ID NO: 2 or SEQ ID NO: 10 than it does with another protein or epitope (e.g., with an epitope present on mammalian actin, more preferably human actin).
- an antibody or fragment that specifically binds to SEQ ID NO: 2 or SEQ ID NO: 10 binds with greater affinity, avidity, more readily, and or with greater duration than it binds to a polypeptide comprising amino acids 237 to 251 of human actin as defined in SEQ ID NO: 3 and/or amino acids 237 to 251 of human mutant ⁇ actin as defined in SEQ ID NO: 4 and/or amino acids 245 to 249 of human mutant ⁇ actin as defined in SEQ ID NO: 11.
- the antibody or fragment binds to SEQ ID NO: 2 or SEQ ID NO: 10 with greater affinity, avidity, more readily, and/or with greater duration than it binds to mammalian actin, such as human actin.
- the degree of greater affinity, avidity, more readily, and/or with greater duration will depend on the application of the antibody or fragment.
- the degree of specificity should be sufficiently high to permit quantification (where required).
- the degree of specificity should be sufficient to provide a therapeutic/prophylactic effect without serious adverse effects resulting from cross- reactivity of the antibody or fragment.
- the antibody or fragment thereof does not bind at a significant level to amino acids 237 to 251 of human actin as defined in SEQ ID NO: 3 and/or amino acids 237 to 251 of human mutant ⁇ actin as defined in SEQ ID NO: 4 and/or amino acids 245 to 249 of human mutant ⁇ actin as defined in SEQ ID NO: 11.
- the antibody or fragment does not bind at a significant level to mammalian actin, such as human actin.
- the level of binding to an alternative epitope is not significant if the binding to the apicomplexan actin epitope of the invention can be easily distinguished from the binding to an alternative epitope.
- the antibody or fragment thereof binds to a polypeptide comprising SEQ ID NO: 2 or SEQ ID NO: 10 and does not detectably bind to amino acids 237 to 251 of human ⁇ actin as defined in SEQ ID NO: 3 and/or amino acids 237 to 251 of human mutant ⁇ actin as defined in SEQ ID NO: 4 and/or amino acids 245 to 249 of human mutant ⁇ actin as defined in SEQ ID NO: 11, e.g., as determined by a Western blot and/or FACS and/or ELISA and/or antibody panning.
- the antibody or fragment does not detectably bind mammalian actin, such as human actin.
- the antibody or fragment does not bind to amino acids 237 to 251 of human ⁇ actin as defined in SEQ ID NO: 3 and/or amino acids 237 to 251 of human mutant ⁇ actin as defined in SEQ ID NO: 4 and/or amino acids 245 to 249 of human mutant ⁇ actin as defined in SEQ ID NO: 11 to a significantly greater level than an isotype control antibody, e.g., as determined by a Western blot or FACS analysis.
- the term "does not detectably bind” shall be understood to mean that the antibody or fragment thereof does not bind to an antigen (such as a polypeptide comprising amino acids 237 to 251 of human ⁇ actin as defined in SEQ ID NO: 3 and/or amino acids 237 to 251 of human mutant ⁇ actin as defined in SEQ ID NO: 4, and/or amino acids 245 to 249 of human mutant ⁇ actin as defined in SEQ ID NO: 11 , and/or an epitope comprising or consisting of the amino acid sequence DEEMKTSEQSSDI (SEQ ID NO: 9)) at a level significantly greater than background, e.g., does not bind to the antigen at a level greater than 10%, or 8% or 6% or 5% above background.
- an antigen such as a polypeptide comprising amino acids 237 to 251 of human ⁇ actin as defined in SEQ ID NO: 3 and/or amino acids 237 to 251 of human mutant ⁇ actin as defined in SEQ ID
- the antibody or fragment thereof does not bind to the antigen at a level greater than 10% or 8% or 6% or 5% greater than an isotype control antibody.
- the binding is detected by Western blotting and/or FACS and/or ELISA and/or antibody panning (e.g., with antibody variable regions on the surface of a particle, such as a phage) and/or Biacore analysis.
- the antibodies disclosed herein may exist as intact immunoglobulins, or as modifications in a variety of forms including, for example, but not limited to, domain antibodies including either the VH or VL domain, a dimer of the heavy chain variable region (VHH, as described for a camelid), a dimer of the light chain variable region (VLL), FV fragments containing only the light and heavy chain variable regions, or Fd fragments containing the heavy chain variable region and the CHI domain.
- domain antibodies including either the VH or VL domain, a dimer of the heavy chain variable region (VHH, as described for a camelid), a dimer of the light chain variable region (VLL), FV fragments containing only the light and heavy chain variable regions, or Fd fragments containing the heavy chain variable region and the CHI domain.
- the antibody may be a domain antibody including either the VH or VL domain of the monoclonal antibody 5H3; a dimer of the heavy chain variable region (VHH, as described for a camelid) of the monoclonal antibody 5H3; a dimer of the light chain variable region (VLL) of the monoclonal antibody 5H3; Fv fragments containing only the light and heavy chain variable regions of the monoclonal antibody 5H3; or Fd fragments containing the heavy chain variable region and the CHI domain of the monoclonal antibody 5H3.
- VHH heavy chain variable region
- VLL light chain variable region
- a scFv consisting of the variable regions of the heavy and light chains linked together to form a single-chain antibody (Bird et al., 1988; Huston et al., 1988) and oligomers of scFvs such as diabodies and triabodies are also encompassed by the term "antibody".
- the antibody may be a scFv consisting of the variable regions of the heavy and light chains of the monoclonal antibody 5H3 linked together to form a single-chain antibody, or may be an oligomer thereof (such as a diabody or triabody).
- fragments of antibodies such as Fab, (Fab')2 and FabFc 2 fragments which contain the variable regions and parts of the constant regions.
- the antibody may be a fragment such as a Fab, (Fab') 2 and FabFc 2 fragment containing the variable regions and parts of the constant regions of the monoclonal antibody 5H3.
- the antibody fragment or oligomers of antibody fragments may comprise any one or more of the CDRs present in the monoclonal antibody 5H3.
- CDRs refers to the amino acid residues of an antibody variable region the presence of which are major contributors to specific antigen binding.
- Each variable region domain typically has three CDR regions identified as CDR1, CDR2 and CDR3.
- the amino acid positions assigned to CDRs and framework regions are defined according to Kabat (1987) and (1991) (also referred to herein as "the Kabat numbering system”).
- the amino acid positions assigned to CDRs and FRs are defined according to the Enhanced Chothia Numbering Scheme (http://www.bioinfo.org.uk/mdex.html).
- V H FRs and CDRs are positioned as follows: residues 1-30 (FR1), 31-35 (CDR1), 36-49 (FR2), 50-65 (CDR2), 66-94 (FR3), 95-102 (CDR3) and 103- 113 (FR4).
- VL FRs and CDRs are positioned as follows: residues 1-23 (FR1), 24-34 (CDR1), 35-49 (FR2), 50-56 (CDR2), 57-88 (FR3), 89-97 (CDR3) and 98-107 (FR4).
- the present disclosure is not limited to FRs and CDRs as defined by the Kabat numbering system, but includes all numbering systems, including the canonical numbering system or of Chothia and Lesk (1987); Chothia et al., (1989); and/or Al- Lazikani et al., (1997); the numbering system of Honnegher and Pliikthun (2001); or the IMGT system discussed in Giudicelli et al., (1997).
- the CDRs are defined according to the Kabat numbering system.
- heavy chain CDR2 does not comprise the five C-terminal amino acids in the CDR2 sequence of the monoclonal antibody 5H3 or any one or more of those amino acids are substituted with another naturally-occurring amino acid.
- light chain CDR1 does not comprise the four N- terminal amino acids in the CDR1 sequence of the monoclonal antibody 5H3 or any one or more of those amino acids are substituted with another naturally-occurring amino acid.
- Padlan et al., (1995) established that the five C-terminal amino acids of heavy chain CDR2 and/or the four N-terminal amino acids of light chain CDR1 are not generally involved in antigen binding.
- Suitable methods for identifying CDRs within a given antibody are well known in the art.
- the amino acid sequence of the monoclonal antibody 5H3 can be determined by routine methods.
- the encoding nucleotide sequence can be determined by routine methods (e.g., as described herein) and the amino acid sequence of the antibody can be deduced therefrom. The entire coding sequence may be determined.
- the nucleotide sequence encoding only the variable regions of the antibody may be determined.
- primer sequences for the isolation of murine antibody variable region sequences are readily available in the art (e.g., as described in WO 2006/106331).
- primer sequences for the isolation of antibody variable region sequences from rat see, e.g., WO 2006/106336
- sheep see, e.g., WO 2006/106341
- pig see, e.g., WO 2006 106339
- CDRs from antibodies disclosed herein that are raised in rats, sheep, pigs and other species can also be determined.
- the amino acid sequence of the antibody is determined, the sequences of the CDRs can be determined as described above.
- the CDR sequences can be determined manually. Alternatively, publicly available software can be used to identify CDRs automatically.
- the heavy and light chain components of an Fv may be derived from the same antibody (e.g., the monoclonal antibody 5H3) or different antibodies thereby producing a chimeric Fv region.
- the antibody may be of animal (for example mouse, rabbit or rat) or human origin or may be chimeric (Morrison et al., 1984) or humanized (Jones et al., 1986; published UK patent application No. 8707252).
- the term "antibody or fragment thereof includes these various forms.
- the antibodies may be Fv regions comprising a variable light (VL) and a variable heavy (VH) chain.
- VL and/or VH chains are those of the monoclonal antibody 5H3.
- the light and heavy chains may be joined directly or through a linker.
- a linker refers to a molecule that is covalently linked to the light and heavy chain and provides enough spacing and flexibility between the two chains such that they are able to achieve a conformation in which they are capable of specifically binding the epitope to which they are directed. Protein linkers are particularly preferred as they may be expressed as an intrinsic component of the Ig portion of the fusion polypeptide.
- the antibody disclosed herein may be a polyclonal antibody.
- the antibody may be comprised in antisera produced by immunisation of an animal with the peptide disclosed herein. Any animal may be immunized with the peptide disclosed herein in order to produce said antisera. In one embodiment, the antisera is rabbit antisera.
- Monoclonal antibodies Alternatively, the antibody disclosed herein may be a monoclonal antibody. Monoclonal antibodies can be produced by methods known in the art. The general methodology for making monoclonal antibodies by hybridomas is well known. Immortal antibody-producing cell lines can be created by cell fusion, and also by other 5 techniques such as direct transformation of B lymphocytes with oncogenic DNA, or transfection with Epstein-Barr virus. Panels of monoclonal antibodies produced against the apicomplexan epitope disclosed herein can be screened for various properties; i.e. for isotype and epitope affinity.
- the monoclonal antibody may, for example, be the monoclonal antibody 5H3.0
- Animal-derived monoclonal antibodies can be used for both direct in vivo and extracorporeal immunotherapy. However, it has been observed that when, for example, mouse-derived monoclonal antibodies are used in humans as therapeutic agents, the patient produces human anti-mouse antibodies. Thus, animal-derived monoclonal antibodies are not preferred for therapy, especially for long term use. With established S genetic engineering techniques it is possible, however, to create chimeric or humanized antibodies that have animal-derived and human-derived portions.
- the animal can be, for example, a mouse or other rodent such as a rat.
- variable region . of the chimeric antibody is, for example, mouse-derived while the constant region is human-derived, the chimeric antibody will generally be0 less immunogenic than a "pure" mouse-derived monoclonal antibody. These chimeric antibodies would likely be more suited for therapeutic use, should it turn out that "pure" mouse-derived antibodies are unsuitable.
- the chimeric antibody may comprise one or more variable regions of the monoclonal antibody 5H3 and a human-derived constant region.
- the light and heavy chains can be expressed separately, using, for example, immunoglobulin light chain and immunoglobulin heavy chains in separate plasmids. These can then be purified and assembled in vitro into complete antibodies; methodologies for accomplishing such assembly have been described (see, for0 example, Sun et al., 1986).
- a DNA construct may comprise DNA encoding functionally rearranged genes for the variable region of a light or heavy chain of an anti-apicomplexan actin antibody linked to DNA encoding a human constant region. Lymphoid cells such as myelomas or hybridomas transfected with the DNA constructs for light and heavy chain can express and assemble the antibody chains.
- the anti-apicomplexan actin antibody is humanized, that is, an antibody produced by molecular modelling techniques wherein the human content of the antibody is maximised while causing little or no loss of binding affinity attributable to the variable region of, for example, a parental rat, rabbit or mouse antibody.
- An antibody may be humanized by grafting the desired CDRs onto a human framework according to the method described in EP-A-0239400.
- the CDRs may be selected from the monoclonal antibody 5H3.
- Preferably all 6 CDRs are selected.
- a DNA sequence encoding the desired reshaped antibody can be made beginning with the human DNA whose CDRs it is wished to reshape.
- the animal- derived variable domain amino acid sequence containing the desired CDRs e.g., the CDRs of the monoclonal antibody 5H3
- the residues in the human variable domain are marked that need to be changed to the corresponding residue in the animal to make the human variable region incorporate the animal-derived CDRs. There may also be residues that need substituting in, adding to or deleting from the human sequence.
- Oligonucleotides are synthesized that can be used to mutagenize the human variable domain framework to contain the desired residues. Those oligonucleotides can be of any convenient size. One is normally only limited in length by the capabilities of the particular synthesizer one has available. The method of oligonucleotide-directed in vitro mutagenesis is well known.
- humanisation may be achieved using the recombinant polymerase chain reaction (PCR) methodology of WO 92/07075.
- PCR polymerase chain reaction
- a CDR e.g., a CDR of the monoclonal antibody 5H3
- a donor CDR e.g., a donor CDR.
- Primers A and B are used to amplify the framework region AB.
- primers C and D used to amplify_tfie_ framework region CD.
- the primers B and C each also contain, at their 5' ends, an additional sequence corresponding to all or at least part of the donor CDR sequence. Primers B and C overlap by a length sufficient to permit annealing of their 5' ends to each other under conditions which allow a PCR to be performed. Thus, the amplified regions AB and CD may undergo gene splicing by overlap extension to produce the humanized product in a single reaction.
- the mutagenised DNAs can be linked to an appropriate DNA encoding a light or heavy chain constant region, cloned into an expression vector, and transfected into host cells, preferably mammalian cells. These steps can be carried out in routine fashion.
- a reshaped antibody may therefore be prepared by a process comprising:
- the DNA sequence in step (a) encodes both the variable domain and each constant domain of the human antibody chain.
- the humanized antibody can be prepared using any suitable recombinant expression system.
- the cell line which is transformed to produce the altered antibody may be a Chinese Hamster Ovary (CHO) cell line or an immortalised mammalian cell line, which is advantageously of lymphoid origin, such as a myeloma, hybridoma, trioma or quadroma cell line.
- the cell line may also comprise a normal lymphoid cell, such as a B-cell, which has been immortalised by transformation with a virus, such as the Epstein-Barr virus.
- the immortalised cell line is a myeloma cell line or a derivative thereof.
- the CHO cells used for expression of the antibodies may be dihydrofolate reductase (dhfr) deficient and so dependent on thymidine and hypoxanthine for growth (Urlaub and Chasin, 1980).
- the parental dhfr ' CHO cell line is transfected with the DNA encoding the antibody and dhfr gene which enables selection of CHO cell transformants of dhfr positive phenotype. Selection is carried out by culturing the colonies on media devoid of thymidine and hypoxanthine, the absence of which prevents untransformed cells from growing and transformed cells from resalvaging the folate pathway and thus bypassing the selection system.
- transformants usually express low levels of the DNA of interest by virtue of co-integration of transfected DNA of interest and DNA encoding dhfr.
- the expression levels of the DNA encoding the antibody may be increased by amplification using methotrexate (MTX).
- MTX methotrexate
- This drug is a direct inhibitor of the enzyme dhfr and allows isolation of resistant colonies which amplify their dhfr gene copy number sufficiently to survive under these conditions. Since the DNA sequences encoding dhfr and the antibody are closely linked in the original transformants, there is usually concomitant amplification, and therefore increased expression of the desired antibody.
- GS glutamine synthetase
- Msx methionine sulphoximine
- the cell line used to produce the humanized antibody is preferably a mammalian cell line
- any other suitable cell line such as a bacterial cell line or a yeast cell line
- E. coli-denved bacterial strains could be used.
- the antibody obtained is checked for functionality. If functionality is lost, it is necessary to alter the framework of the antibody.
- the whole antibodies, their dimers, individual light and heavy chains, or other immunoglobulin forms can be recovered and purified according to standard procedures of the art, including ammonium sulfate precipitation, affinity columns, column chromatography, gel electrophoresis and the like (See, generally, Scopes, R., Protein Purification, Springer- Verlag, N.Y. (1982)).
- Substantially pure immunoglobulins of at least about 90 to 95% homogeneity are preferred, and 98 to 99% or more homogeneity most preferred, for pharmaceutical uses.
- an antibody may then be used therapeutically or in developing and performing assay procedures, immunofluorescent stainings, and the like (See, generally, Immunological Methods, Vols. I and II, Lefkovits and Pernis, eds., Academic Press, New York, N.Y. (1979 and 1981)).
- Antibodies with fully human variable regions against apicomplexan actin can also be prepared by administering the antigen to a transgenic animal which has been modified to produce such antibodies in response to antigenic challenge, but whose endogenous loci have been disabled. Various subsequent manipulations can be performed to obtain either antibodies per se or analogs thereof (see, for example, US Patent No. 6,075,181).
- the antibodies disclosed herein have the capacity for intracellular transmission.
- Antibodies which have the capacity for intracellular transmission include antibodies such as camelids and llama antibodies, shark antibodies (IgNARs), scFv antibodies, intrabodies or nanobodies, for example, scFv intrabodies and VHH intrabodies.
- Such antigen binding agents can be made as described by Harmsen and De Haard, (2007); Tibary et al., (2007); Muyldermans, (2001); and references cited therein.
- Yeast SPLINT antibody libraries are available for testing for intrabodies which are able to disrupt protein-protein interactions (see for example, Visintin et al., (2008) and Visintin et al, (2008)b for methods for their production). Accordingly, in one embodiment, scFv intrabodies which are able to interfere with a protein-protein interaction are used in the methods disclosed herein.
- an isolated or recombinant polynucleotide sequence encoding the antibody or fragment thereof.
- the isolated or recombinant polynucleotide may encode both the heavy and light chains of the antibody, or any of the fragments described herein comprising portions of both the heavy and light chains.
- the isolated or recombinant polynucleotide may encode only a single heavy or light chain, or a fragment of only a single heavy or light chain.
- the polynucleotide may comprise DNA or RNA.
- the polynucleotide encoding the antibody or fragment thereof may be isolated from a natural source by any known methods.
- a recombinant polynucleotide encoding the antibody or fragment thereof may be produced by any known method.
- genes encoding antibodies, (both light and heavy chains or portions thereof, e.g., single chain Fv regions) may be cloned from a hybridoma cell line. They may all be cloned using the same general strategy.
- poly(A) mPv A extracted from hybridoma cells is reverse transcribed using random hexamers as primers.
- the VH and VL domains are amplified separately by two polymerase chain reactions (PCR).
- Heavy chain sequences may be amplified using 5' end primers which are designed according to the ammo-terminal protein sequences of the anti-apicomplexan actin antibody heavy chains respectively and 3' end primers according to consensus immunoglobulin constant region sequences (Kabat et al., Sequences of Proteins of Immunological Interest. 5th edition. U.S. Department of Health and Human Services, Public Health Service, National Institutes of Health, Bethesda, Md. (1991)).
- Light chain Fv regions are amplified using 5' end primers designed according to the amino-terminal protein sequences of anti- anti-apicomplexan actin antibody light chains and in combination with the primer C-kappa.
- One of skill in the art would recognize that many suitable primers may be employed to obtain Fv regions.
- the PCR products are subcloned into a suitable cloning vector. Clones containing the correct size insert by DNA restriction are identified. The nucleotide sequence of the heavy or light chain coding regions may then be determined from double stranded plasmid DNA using sequencing primers adjacent to the cloning site.
- kits e.g., the SequenaseTM kit, United States Biochemical
- DNA encoding the Fv regions may be prepared by any suitable method, including, for example, amplification techniques such as PCR and LCR.
- Chemical synthesis produces a single stranded oligonucleotide. This may be converted into double stranded DNA by hybridization with a complementary sequence, or by polymerization with a DNA polymerase using the single strand as a template. While it is possible to chemically synthesize an entire single chain Fv region, it is preferable to synthesize a number of shorter sequences (about 100 to 150 bases) that are later ligated together.
- sub-sequences may be cloned and the appropriate subsequences cleaved using appropriate restriction enzymes. The fragments may then be ligated to produce the desired DNA sequence.
- the sequences may be ligated together, either directly or through a DNA sequence encoding a peptide linker, using techniques well known to those of skill in the art.
- heavy and light chain regions are connected by a flexible peptide linker (e.g., (Gly 4 Ser 3 ) which starts at the carboxyl end of the heavy chain Fv domain and ends at the amino terminus of the light chain Fv domain.
- the entire sequence encodes the Fv domain in the form of a single-chain antigen binding protein.
- the polynucleotide encoding the antibody or fragment as disclosed herein may be used to produce the antibody or fragment.
- the present disclosure provides a method of producing an antibody or fragment which specifically binds apicomplexan actin, the method comprising expressing a polynucleotide encoding the antibody or fragment in a host cell.
- the polynucleotide may be incorporated into a vector in order to_ faciUtate_expra
- a host cell comprising said polynucleotide and/or said vector.
- Suitable vectors and host cells can be selected by the person skilled in the art.
- the antibody or fragment thereof as disclosed herein may be detectably labelled.
- Suitable labels include radioisotopes, or non-radioactive labels such as biotin, enzymes, chemiluminescent molecules, fluorophores, dye markers or other imaging reagents for detection and/or localisation of target molecules.
- a second labelled antibody or avidin which binds the compound can be used for detection.
- the detectable label may be conjugated to the antibody or fragment by any suitable means known in the art. Labelling the antibody or fragment may be particularly useful in screening and therapeutic applications. Screening Methods
- apicomplexan actin is intended to mean any isoform of actin, in either globular or filamentous form, derived from any apicomplexan species.
- the methods may comprise:
- the reduction in binding may be determined by comparison with the level of binding of the antibody or fragment disclosed herein with a polypeptide comprising SEQ ID NO: 2 or SEQ ID NO: 10 in the absence of a candidate agent.
- This "reference level" can be predetermined.
- the methods may comprise a step of determining the reference level.
- the methods may further comprise contacting the antibody or fragment disclosed herein with a polypeptide comprising SEQ ID NO: 2 or SEQ ID.
- the candidate agent need not completely inhibit the binding of the antibody or fragment disclosed herein to a polypeptide comprising SEQ ID NO: 2 or SEQ ID NO: 10, rather it need only reduce binding.
- the candidate agent may reduce the binding by a statistically significant amount, for example, by at least about 10% or 20% or 30% or 40% or 50% or 60% or 70% or 80% or 90% or 95%.
- the candidate agent reduces binding of the antibody or fragment disclosed herein by at least about 30%, more preferably by at least about 50%, more preferably, by at least about 70%, still more preferably by at least about 75%, even more preferably, by at least about 80% or 85% and even more preferably, by at least about 90%.
- the present disclosure provides methods of determining whether a candidate agent competitively inhibits the binding of an antibody or fragment disclosed herein to a polypeptide comprising SEQ ID NO: 2 or SEQ ID NO: 10.
- the specificity of the candidate agent for apicomplexan actin may be determined by determining the level of binding of the candidate agent to a suitable control polypeptide.
- the control polypeptide may be, for example, a polypeptide which does not comprise an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10. Any suitable control polypeptide may be used.
- the control polypeptide is a polypeptide comprising amino acids 237 to 251 of human ⁇ -actin as defined in SEQ ID NO: 3 or a polypeptide comprising amino acids 237 to 251 of mutant human ⁇ -actin as defined in SEQ ID NO: 4 or amino acids 245 to 249 of human mutant ⁇ actin as defined in SEQ ID NO: 11.
- control polypeptide is mammalian actin.
- the methods may further comprise contacting the candidate agent with a control polypeptide (for example, a polypeptide which does not comprise an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10); and identifying the agent as an agent which specifically binds apicomplexan actin if the agent reduces the binding of the antibody or fragment to the polypeptide comprising SEQ ID NO: 2 or SEQ ID NO: 10 and does not detectably bind to the control polypeptide (for example, the polypeptide which does not comprise an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10).
- a control polypeptide for example, a polypeptide which does not comprise an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10
- the screening methods may simply involve determining whether a candidate agent binds to the apicomplexan-specific actin epitope.
- the screening method may comprise:
- the level of binding of the candidate agent to the peptide of SEQ ID NO: 2 or SEQ ID NO: 10 may be compared to the level of binding of the candidate agent to a suitable control polypeptide.
- the control polypeptide may be, for example, a polypeptide which does not comprise an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10. Any suitable control polypeptide may be used.
- control polypeptide is a polypeptide comprising amino acids 237 to 251 of human ⁇ -actin as defined in SEQ ID NO: 3 or a polypeptide comprising amino acids 237 to 251 of mutant human ⁇ -actin as defined in SEQ ID NO: 4 or a polypeptide comprising amino acids 245 to 249 of human mutant ⁇ actin as defined in SEQ ID NO: 11.
- control polypeptide is mammalian actin.
- the level of binding of the candidate agent to a control polypeptide may be predetermined.
- the method disclosed herein may further comprise contacting the candidate agent with a control polypeptide (for example, a polypeptide which does not comprise an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10); and identifying the agent as an agent which specifically binds apicomplexan actin if the agent binds to the peptide of SEQ ID NO: 2 or SEQ ID NO: 10 and does not detectably bind to the control polypeptide (for example, the polypeptide which does not comprise an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10).
- the antibody or fragment thereof can be detectably labelled and used simply to identify apicomplexan actin, in globular or filamentous form, in any screening method intended to identify an agent which disrupts normal actin processing (e.g., which inhibits/stabilises the formation of apicomplexan actin filaments).
- the apicomplexan actin may be produced by a method including a step of expressing the endogenous P. falciparum actin gene (whose sequence is set out in SEQ ID NO: 8).
- the apicomplexan actin may be produced by a method including a step of expressing a codon optimised sequence encoding P. falciparum actin, whose sequence has been modified from the sequence of the endogenous P. falciparum actin gene in order to result in enhanced expression of the actin protein.
- a codon optimised sequence is set out in SEQ ID NO: 7.
- the screening methods may further comprise a step of producing apicomplexan actin.
- the screening methods comprise the use of the peptide of SEQ ID NO: 2
- the screening methods may comprise a step of producing apicomplexan actin by any of the methods described herein and a step of producing the peptide of SEQ ID ⁇ NO: 2 from the apicomplexan actin protein.
- any one or more of the candidate agent, the antibody or fragment, the polypeptide comprising SEQ ID NO: 2 or SEQ ID NO: 10 and the peptide of SEQ ID NO: 2 or SEQ ID NO: 10 may be detectably labelled.
- Any suitable label can be used, depending on the particular screening assay. In one example, the label is a fluorophore.
- Candidate agents may include, for example, small molecules, peptides or mimetics thereof, polypeptides, antibodies, nucleic acid molecules such as aptamers, peptide nucleic acid molecules, and components and derivatives thereof.
- the candidate agent may be any suitable compound, synthetic or naturally occurring.
- the compounds may encompass numerous chemical classes though typically they are organic molecules, preferably small organic compounds.
- a synthetic compound identified or designed by the methods of the invention has a molecular weight equal to or less than about 5000, 4000, 3000, 2000, 1000 or 500 daltons.
- the candidate agent is preferably soluble under physiological conditions.
- Such compounds can comprise functional groups necessary for structural interaction with proteins, for example hydrogen bonding, and may include at least an amine, carbonyl, hydroxyl or carboxyl group, or at least two of the functional chemical groups.
- the compound may comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups.
- Compounds can also comprise biomolecules including proteins, peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs, or combinations thereof.
- Candidate compounds can be obtained from a wide variety of sources including libraries of synthetic or natural compounds. Synthetic compound libraries are commercially available from, for example, Maybridge Chemical Co. (Tintagel, Cornwall, UK), AMRI (Budapest, Hungary) and ChemDiv (San Diego, CA), Specs (Delft, The Netherlands).
- Natural compound libraries comprising bacterial, fungal, plant or animal extracts are available from, for example, Pan Laboratories (Bothell, WA), TimTec (Newark, DE). In addition, numerous means are available for random and directed synthesis of a wide variety of organic compounds.
- libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts can be readily produced. Methods for the synthesis of molecular libraries are readily available (see, for example, DeWitt et al., 1993; Erb et al., 1994; Zuckermann et al., 1994; Cho et al., 1993; and Gallop et al., 1994).
- natural or synthetic compound libraries and compounds can be readily modified through conventional chemical, physical and biochemical means (see, for example, Blondelle and Houghton, 1996), and may be used to produce combinatorial libraries.
- previously identified pharmacological agents can be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification, and the analogs can be screened for a desired activity.
- a combinatorial chemical library is a collection of diverse chemical compounds generated by either chemical synthesis or biological synthesis by combining a number of chemical "building blocks” such as reagents. Millions of chemical compounds can be synthesized through such combinatorial mixing of chemical building blocks (Gallop et al., 1994). Preparation and screening of combinatorial chemical libraries is well known to those of skill in the art. Such combinatorial chemical libraries include, but are not limited to, small organic molecule libraries and carbohydrate libraries.
- Compounds also include those that may be synthesized from leads generated by computational techniques applied to predict the three dimensional structure of the apicomplexan actin epitope and to predict the three dimensional structure of compounds that may specifically bind this epitope.
- the candidate agent may be selected from a library of agents which have been shown to have some therapeutic activity.
- the candidate agent may be selected from a library of agents which have been shown to have low cytotoxicity in humans, and/or generic anti-malarial activity.
- the screening methods disclosed herein may be high throughput screening methods.
- new chemical entities with useful properties are generated by identifying a chemical compound (called a "lead compound") with some desirable property or activity, for example, binding to apicomplexan actin, creating variants of the lead compound, and evaluating the property and activity of those variant compounds.
- high throughput screening (HTS) methods are employed for such an analysis.
- HTS methods can be applied using candidate agents without first identifying a lead compound.
- HTS methods involve providing a library containing a large number of candidate compounds. Such "combinatorial chemical libraries" are then screened in one or more assays to identify those library members (particular chemical species or subclasses) that display a desired characteristic activity, such as binding to the apicomplexan actin epitope set out in SEQ ID NO: 2 or SEQ ID NO: 10.
- the compounds identified can serve as conventional lead compounds or can be used as potential or actual therapeutics.
- High throughput screening systems are commercially available and typically automate entire procedures, including all sample and reagent pipetting, liquid dispensing, timed incubations, and final readings of the microplate in detectors appropriate for the assay.
- the level of binding of the antibody or fragment, or the candidate agent, to the epitope defined by SEQ ID NO: 2 or SEQ ID NO: 10 may be determined by any suitable method known in the art.
- suitable methods include fluorescence resonance energy transfer (FRET) (also known as Forster resonance energy transfer), bioluminescence resonance energy transfer (BRET), competition binding assays, yeast-2-hybrid screening, Surface Plasmon Resonance, high-resolution NMR, phage display, affinity chromatography, Isothermal Titration Calorimetry (ITC), immunoprecipitation and GST pull downs coupled with mass spectroscopy, fluorescence polarization (FP), Amplified Luminescent Proximity Homogenous Assay (ALPHASCREENTM), and others.
- FRET fluorescence resonance energy transfer
- BRET bioluminescence resonance energy transfer
- competition binding assays yeast-2-hybrid screening
- Surface Plasmon Resonance high-resolution NMR
- phage display affinity chromatography
- the screening methods disclosed herein may comprise determining a candidate agent's ability to reduce, inhibit or disrupt the binding of an antibody disclosed herein (for example, the monoclonal antibody 5H3) to a polypeptide comprising or consisting of SEQ ID NO: 2 or SEQ ID NO: 10, or may comprise determining a candidate agent's ability to bind to a polypeptide comprising or consisting of SEQ ID NO: 2 or SEQ ID NO: 10, by any one or more of FRET, BRET, a competition binding assay, yeast-2-hybrid screening, Surface Plasmon Resonance, high-resolution NMR, phage display, affinity chromatography, Isothermal Titration Calorimetry (ITC), immunoprecipitation and GST pull downs coupled with mass spectroscopy, FP, ALPHASCREENTM, and others.
- an antibody disclosed herein for example, the monoclonal antibody 5H3
- FRET assays may comprise conjugating a donor or acceptor chromophore to any one of the polypeptide comprising SEQ ID NO:2 or SEQ ID NO: 10 (or the peptide consisting of SEQ ID NO: 2 or SEQ ID NO: 10), the candidate agent, and the antibody or fragment which binds the apicomplexan epitope set out in SEQ ID NO: 2 or SEQ ID NO: 10 (e.g., the monoclonal antibody 5H3), in any suitable combination.
- a donor chromophore can be conjugated to the antibody or fragment disclosed herein, and an acceptor chromophore can be conjugated to the polypeptide comprising SEQ ID NO: 2 (or peptide consisting of SEQ ID NO: 2).
- SEQ ID NO: 2 or peptide consisting of SEQ ID NO: 2.
- SPR Surface Plasmon Resonance
- BIA Biomolecular Interaction Analysis
- SPR Surface Plasmon Resonance
- BiA Biomolecular Interaction Analysis
- Changes in the mass at the binding surface (indicative of a binding event) of the BIA chip result in alterations of the refractive index of light near the surface.
- the changes in the refractivity generate a detectable signal, which are measured as an indication of real-time reactions between biological molecules.
- one of the binding partners for example, the polypeptide comprising SEQ ID NO:2 (or the peptide consisting of SEQ ID NO: 2), or the antibody or fragment thereof (e.g., the monoclonal antibody 5H3) can be immobilized on a solid support, such as, for example an array of polymeric pins or a glass support.
- the immobilized binding partner may be a fusion polypeptide comprising, for example, Glutathione-S- transferase, wherein the GST moiety facilitates immobilization of the protein to the solid phase support.
- the second binding partner for example, the antibody or fragment thereof disclosed herein, or alternatively, the polypeptide comprising or consisting of SEQ ID NO: 2
- the second binding partner in solution is brought into physical relation with the immobilized protein to form a protein complex in the presence of a candidate compound, which complex is then detected by methods known in the art. If a candidate compound is capable of inhibiting antibody binding to the peptide comprising SEQ ID NO: 2, this will be identified by a reduction in the formation of the polypeptide complex when compared to the same assay conditions in the absence of the candidate compound.
- Fluorescence Polarization can also be used to investigate molecular interactions between a candidate agent and a polypeptide comprising SEQ ID NO: 2 or SEQ ID NO: 10 (or the peptide consisting of SEQ ID NO: 2 or SEQ ID NO: 10).
- FP provides a direct, almost instantaneous quantification of a fluorescent tracer's bound/free ratio.
- FP relies on polarized light exciting a fluorophore-labelled small assay component (e.g., a polypeptide comprising or consisting of SEQ ID NO: 2 or SEQ ID NO: 10 conjugated to a fluorophore).
- the intensity of emitted light can be monitored in two different planes, with the degree of movement of emission intensity from one plane to the other plane being related to the mobility of the fluorophore bound to the small assay component. If a larger binding partner (e.g., the antibody as disclosed herein, and in a particular example, the monoclonal antibody 5H3) binds to the fluorophore-labelled small assay component, the complex formed will be relatively large, and little movement of the complex will occur during excitation, with the emitted light being highly polarized.
- a larger binding partner e.g., the antibody as disclosed herein, and in a particular example, the monoclonal antibody 5H3
- this assay can be used to determine if a candidate agent is able to disrupt the binding interaction between the antibody disclosed herein (and in one particular example, the monoclonal antibody SH3) and the polypeptide comprising or consisting of SEQ ID NO: 2 or SEQ ID NO: 10, by quantifying the amount of light emitted in two planes in the presence, compared to the absence of the candidate agent.
- Any suitable fluorophore can be used in such an FP assay, as will be appreciated by a person skilled in the art.
- Amplified Luminescent Proximity Homogenous Assay is another assay which can be used to determine a candidate agent's ability to bind to a polypeptide comprising or consisting of SEQ ID NO: 2 or SEQ ID NO: 10, or to disrupt the binding of an antibody disclosed herein (e.g., the monoclonal antibody 5H3) to a polypeptide comprising or consisting of SEQ ID NO: 2 or SEQ ID NO: 10.
- the assay comprises two hydrogel coated beads which, when brought into close proximity by a binding interaction, allow the transfer of singlet oxygen from a donor bead to an acceptor bead.
- any one or more of the antibody disclosed herein e.g., the monoclonal antibody 5H3, the polypeptide comprising or consisting of SEQ ID NO: 2 or SEQ ID NO: 10, and the candidate agent can be conjugated to a donor bead or an acceptor bead. If the donor and acceptor beads are in close proximity excitation with laser light at 680 nm causes a photosensitiser in the donor bead to convert ambient oxygen to a more excited singlet state. This singlet oxygen then diffuses up to 200nm to react with a chemiluminescer in the acceptor bead, if the acceptor bead is within 200nm. Fluorophores within the same bead are activated, resulting in the emission of light at 580-620 nm.
- the donor and acceptor beads are in close proximity excitation with laser light at 680 nm causes a photosensitiser in the donor bead to convert ambient oxygen to a more excited singlet state. This singlet oxygen then diffuses up
- the concentration of the candidate agent can be varied in order to determine whether that candidate agent has a dose-dependent effect on the binding interaction between the antibody disclosed herein (for example, the monoclonal antibody SH3) and the polypeptide comprising or consisting of SEQ ID NO: 2 or SEQ ID NO: 10.
- the apicomplexan actin epitope identified in SEQ ID NO: 2 may be represented either as a short 15 amino acid peptide or as a longer polypeptide comprising the epitope sequence.
- the longer polypeptide may be the P. falciparum protein.
- SEQ ID NO: 1 can be used.
- fragments of the peptide identified in SEQ ID NO: 2 can also be used, such as the peptide of SEQ ID NO: 10.
- the specificity of a binding agent for apicomplexan actin can be validated by further determining whether the agent binds to a polypeptide comprising amino acids 237 to 251 of human ⁇ actin as defined in SEQ ID NO: 3 and/or amino acids 237 to 251 of human mutant ⁇ actin as defined in SEQ ID NO: 4 and or amino acids 245 to 249 of human mutant ⁇ actin as defined in SEQ ID NO: 11.
- This validation may comprise determining whether the agent is able to bind mammalian actin, e.g. human actin.
- any of the methods described herein as being suitable for determining the level of binding of a candidate agent to apicomplexan actin can be used to perform this further validation process.
- the human actin epitope defined by amino acids 237 to 251 of human ⁇ actin as defined in SEQ ID NO: 3, or amino acids 237 to 251 of human mutant ⁇ actin as defined in SEQ ID NO: 4, or amino acids 245 to 249 of human mutant ⁇ actin as defined in SEQ ID NO: 11, or a human actin polypeptide or fragment thereof can replace the epitope defined by SEQ ID NO: 2 in any of the assays mentioned above.
- a candidate agent binds to the apicomplexan actin epitope but does not detectably bind to a human actin epitope, that agent is specific for apicomplexan actin and shows therapeutic potential. Actin Polymerization Assays
- the therapeutic potential of an agent shown to bind the peptide of SEQ ID NO: 2 or SEQ ID NO: 10 can be further investigated by determining whether the agent is able to disrupt normal actin processing as occurs in an apicomplexan parasite. For example, the ability of an agent to inhibit, disrupt or stabilise actin polymerization can be determined. Suitable actin polymerization assays are known in the art. For example, gel- based assays may be performed in which centrifugation is used to remove actin filaments from a solution. Due to their greater size, actin filaments can readily be removed from solution by centrifugation, forming a dense actin filament pellet.
- a candidate agent to the solution reduces the amount of actin removed from the solution by centrifugation, that agent will have been shown to inhibit actin polymerization.
- a candidate agent to the solution increases the amount of actin removed from the solution by centrifugation, that agent may have been shown to stabilise actin filaments.
- a particular example of a suitable actin polymerization assa is the Pyrene- Actin assay, wherein a proportion of actin is labelled with Pyrene, which increases in fluorescence when actin polymerizes. This assay platform permits high throughput screening of actin polymerization potential in the presence or absence of many candidate agents. Other suitable high-throughput screening methods can be used.
- the methods disclosed herein may further comprise a step of determining the level of actin filament formation in a system in which actin polymerization can occur, both in the presence and in the absence of a candidate agent.
- the candidate agent may be identified as an agent capable of preventing, inhibiting, or disrupting actin polymerization if the level of actin filament formation is reduced in the presence, compared to the absence of the candidate agent.
- the candidate agent may be identified as an agent capable of stabilising actin filaments if the level of actin filament formation is increased in the presence, compared to the absence of the candidate agent.
- the system in which actin polymerization can occur can be a cell-free solution or can comprise a host cell such as an apicomplexan cell.
- the determination of the level of actin filament formation can comprise centrifuging the components of the system to determine the amount of actin filaments which pellet during centrifuging.
- the methods of determining whether a candidate agent is able to disrupt normal actin processing may comprise a step of producing apicomplexan actin by any of the methods described herein.
- the methods may comprise a step of producing apicomplexan actin by expressing the endogenous P. falciparum actin gene (whose sequence is set out in SEQ ID NO: 8).
- the apicomplexan actin may be produced by expressing a codon optimised sequence encoding P. falciparum actin, whose sequence has been modified from the sequence of the endogenous P. falciparum actin gene in order to result in enhanced expression of the actin protein.
- a codon optimised sequence is set out in SEQ ID NO: 7.
- the therapeutic potential of an agent shown to bind the peptide of SEQ ID NO: 2 can also be investigated by determining the agent's ability to inhibit apicomplexan parasite motility in vivo.
- Suitable assays are known in the art, and include, for example, Toxoplasma gliding assays on a solid medium such as a coverslip (e.g. as set out in Hakansson et al., 1999), sporozoite motility assays on a solid medium such as a coverslip (e.g. as set out in Hegge et al., 2009), ookinete motility through a matrigel (e.g.
- the present disclosure also provides methods of determining a candidate agent's ability to disrupt, inhibit, or prevent apicomplexan motility, the methods comprising administering the candidate agent to an apicomplexan parasite and determining whether the candidate agent inhibits the apicomplexan parasite's motility.
- the person skilled in the art will appreciate that many such methods exist.
- the methods for determining apicomplexan motility comprise determining the ability of an apicomplexan ookinete expressing green fluorescent protein (GFP) to move though a three dimensional matrigel.
- GFP green fluorescent protein
- P. falciparum or P. berghei ookinetes expressing GFP can be placed on the surface of a matrigel pre-loaded with a candidate agent.
- the matrigel can be arranged in a flat, clear-bottomed imaging plate, enabling fluorescent imaging within a focal plane at low magnification/low fluorescence intensity (thereby retaining cell viability), either at a given time after initiation of the assay, or continuously during the assay.
- Ookinetes that retain their normal motility are able to migrate through the matrigel to reach the focal plane.
- Ookinetes whose motility is inhibited by the candidate agent will have a reduced ability to migrate through the matrigel to reach the focal plane, thereby identifying that candidate agent as one capable of inhibiting apicomplexan motility.
- Imaging analysis software can be used to analyse the fluorescent image output. For example, the proportion of ookinetes that reach the focal plane relative to untreated control assays can be calculated.
- the quantities of parasite-infected culture medium applied to the matrigel can be varied as desired. In one example, 20 ⁇ of parasite- infected culture is applied to 10 ⁇ of candidate agent-loaded matrigel.
- the dose of candidate agent can also be varied to verify a dose dependent inhibitory effect.
- This assay can be readily automated, lending itself to be particularly useful as a high throughput assay. It will be appreciated that other methods for determining apicomplexan motility can be used.
- the therapeutic potential of an agent shown to bind the peptide of SEQ ID NO: 2 or SEQ ID NO: 10 can be further investigated by determining the agent's ability to inhibit apicomplexan merozoite invasion of mammalian (preferably human) red blood cells (RBCs).
- Suitable merozoite invasion assays are known in the art.
- One example of a suitable assay is provided in WO 2011/000032 (and in particular, in Examples 8 and 9 of WO 2011/000032).
- Other merozoite invasion assays are known in the art.
- the antibody or fragment thereof as disclosed herein e.g., the monoclonal antibody 5H3
- the ability of a candidate agent identified using any of the screening methods described herein to inhibit apicomplexan motility specifically can be determined by investigating the candidate agent's propensity to inhibit intra-cellular development of an apicomplexan parasite, post host-cell invasion.
- the assay comprises determining a candidate agent's propensity to inhibit blood stage development of a malaria parasite. Since intra-cellular development does not require apicomplexan motility, motility-specific agents would not affect (e.g., inhibit/impede) intra-cellular development. Suitable assays are known in the art. For example, Guiguemde et al., (2010) describes one such assay for screening malaria parasite intra-erythrocytic development Other assays are known in the art.
- An agent identified by the screening methods described above can be used as a therapeutic to inhibit actin dynamics in apicomplexan parasites.
- the inhibition of actin dynamics may comprise inhibiting or disrupting actin polymerization, or stabilising actin filaments formed by actin polymerization.
- Inhibition of normal actin processing in the apicomplexan cell can disrupt parasite motility, nuclear gene regulation and haemoglobin uptake, all of which are essential to parasite survival. Accordingly, an agent that can disrupt apicomplexan actin dynamics could be a powerful therapeutic.
- the antibody or fragment disclosed herein which specifically binds apicomplexan actin, may be used as a therapeutic to inhibit actin dynamics in apicomplexan parasites.
- the antibody or fragment itself may inhibit actin dynamics in apicomplexan parasites.
- the antibody or fragment may be conjugated to an agent known to disrupt actin dynamics and/or which have a deleterious effect on the parasite such as a toxin. Suitable methods of conjugating the antibody or fragment to such an agent will be understood by the person skilled in the art The specific binding properties of the antibody or fragment allow targeted delivery of such an agent to apicomplexan cells.
- the agent or antibody or fragment may be prepared for delivery to a subject by combining the agent or antibody or fragment with a carrier.
- a composition comprising the agent or antibody or fragment and a carrier.
- the carrier is a pharmaceutically acceptable carrier.
- the carrier may facilitate intracellular delivery of the agent or antibody or fragment into apicomplexan cells.
- Suitable carriers will be known to the person skilled in the art, and include, for example, liposomes, microspheres, nanospheres, and others.
- the carriers may comprise one or more targeting molecules which bind to surface molecules present on the target apicomplexan cell.
- the agent or antibody or fragment is conjugated to a cell penetrating agent so as to deliver the agent or antibody or fragment into the intracellular region of an apicomplexan parasite.
- the cell penetrating agent may be a peptide.
- Cell penetrating peptides include Tat peptides, Penetratin, short amphipathic peptides such as those from the Pep-and MPG-families, oligoarginine and oligolysine.
- the cell penetrating peptide is also conjugated to a lipid (C6-C18 fatty acid) domain to improve intracellular delivery (Koppelhus et al., 2008).
- the antibodies and/or agents comprise a cell-penetrating peptide sequence or nuclear-localizing peptide sequence such as those disclosed in Constantini et al. (2008).
- a cell-penetrating peptide sequence or nuclear-localizing peptide sequence such as those disclosed in Constantini et al. (2008).
- Vectocell or Diato peptide vectors such as those disclosed in De Coupade et al. (2005) and Meyer-Losic et al. (2006).
- the present disclosure also provides the therapeutic use of antibodies conjugated via a covalent bond (e.g. a peptide bond), at optionally the N-terminus or the C-terminus, to a cell-penetrating peptide sequence.
- the agent and/or antibody or fragment may itself be able to penetrate apicomplexan cells.
- the agent or antibody or fragment may be small enough to be transported across the apicomplexan cell membrane.
- the agent, antibody or fragment, or composition comprising the agent or antibody or fragment can be used to treat a disease caused by an apicomplexan parasite.
- the disease may be caused by any parasite within the apicomplexan phylum.
- the disease may be caused by an apicomplexan parasite of the genus Plasmodium (such as Plasmodium falciparum, Plasmodium malar iae, Plasmodium ovale and Plasmodium vivax), Babesia, Cryptosporidium, Isospora, Cyclospora, Sarcocystis, Toxoplasma, Theileria, Eimeria and others.
- Diseases which may be treated include, for example, malaria, babesiosis, coccidian diseases such as cryptosporidiosis, cyclosporiasis, isosporiasis, toxoplasmosis and other coccidian diseases, and other apicomplexan diseases.
- the disease is malaria.
- Therapeutic compositions can be prepared by mixing the desired compounds having the appropriate degree of purity with optional pharmaceutically acceptable carriers, excipients, or stabilizers (Remington's Pharmaceutical Sciences, 16th edition, Osol, A. ed. (1980)), in the form of lyophilized formulations, aqueous solutions or aqueous suspensions.
- Acceptable carriers, excipients, or stabilizers are preferably nontoxic to recipients at the dosages and concentrations employed, and include buffers such as Tris, HEPES, PIPES, phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m- cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine,
- Such carriers include ion exchangers, alumina, aluminum stearate, lecithin, serum proteins, such as human serum albumin, buffer substances such as glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts, or electrolytes such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, colloidal silica, magnesium trisilicate. polyvinyl pyrrolidone, and cellulose-based substances.
- a pharmaceutical composition as disclosed herein is formulated to be compatible with its intended route of administration.
- routes of administration include parenteral (e.g., intravenous, intradermal, subcutaneous, intramuscular, intraperitoneal, intrathecal), mucosal (e.g., oral, rectal, intranasal, buccal, vaginal, respiratory), enteral (e.g., orally, such as by tablets, capsules or drops, rectally) and transdermal (topical, e.g., epicutaneous, inhalational, intranasal, eyedrops, vaginal).
- parenteral e.g., intravenous, intradermal, subcutaneous, intramuscular, intraperitoneal, intrathecal
- mucosal e.g., oral, rectal, intranasal, buccal, vaginal, respiratory
- enteral e.g., orally, such as by tablets, capsules or drops, rectally
- transdermal topical, e.g.
- Solutions or suspensions used for parenteral, intradermal, enteral or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide.
- the parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
- compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
- suitable carriers include physiological saline, bacteriostatic water, CremophorTM (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS).
- the composition must be sterile and should be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.
- the carrier is a solvent or dispersion medium containing for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof.
- the proper fluidity is maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
- Prevention of the action of microorganisms is achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid and the like.
- isotonic agents for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride in the composition.
- Prolonged absorption of the injectable compositions is brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
- Sterile injectable solutions may be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
- dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above.
- the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
- Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound is incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions are also prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition.
- the tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
- a binder such as microcrystalline cellulose, gum tragacanth or gelatin
- an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch
- a lubricant such as magnesium stearate or Sterotes
- a glidant such as colloidal silicon dioxide
- the compounds are delivered in the form of an aerosol spray from pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer.
- a suitable propellant e.g., a gas such as carbon dioxide, or a nebulizer.
- Systemic administration can also be by mucosal or transdermal means.
- penetrants appropriate to the barrier to be permeated are used in the formulation.
- penetrants are generally known in the art, and include, for example, for mucosal administration, detergents, bile salts, and fusidic acid derivatives.
- Mucosal administration is accomplished through the use of nasal sprays or suppositories.
- the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.
- a pharmaceutically acceptable vehicle is understood to designate a compound or a combination of compounds entering into a pharmaceutical composition which does not cause side effects and which makes it possible, for example, to facilitate the administration of the active compound, to increase its life and/or its efficacy in the body, to increase its solubility in solution or alternatively to enhance its preservation.
- These pharmaceutically acceptable vehicles are well known and will be adapted by persons skilled in the art according to the nature and the mode of administration of the active compound chosen.
- compositions to be used for in vivo administration should be sterile. This is readily accomplished by filtration through sterile filtration membranes, prior to or following lyophilization and reconstitution.
- the composition may be stored in lyophilized form or in solution if administered systemically. If in lyophilized form, it is typically formulated in combination with other ingredients for reconstitution with an appropriate diluent at the time for use.
- An example of a liquid formulation is a sterile, clear, colourless unpreserved solution filled in a single-dose vial for subcutaneous injection.
- compositions generally are placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle.
- the compositions are preferably administered parenterally, for example, as intravenous injections or infusions or administered into a body cavity.
- compositions disclosed herein may further comprise an antimalarial, such as an antimalarial that is useful for the treatment of Plasmodial infection.
- antimalarials for use in the compositions include the chloroquine phosphate, proguanil, primaquine, doxycycline, mefloquine, clindamycin, halofantrine, quinine sulphate, quinine dihydrochloride, gluconate, primaquine phosphate and sulfadoxine.
- EXAMPLE 1 Generation of an antibody that specifically binds P. falciparum actin
- a short peptide representing an epitope of P. falciparum actin I was used to generate an antibody.
- the specificity of the antibody was subsequently determined by immunoblot analysis.
- Ser-Tyr-Glu-Leu-Pro-Asp-Gly-Asn-Ile-Ile-Thr-Val-Gly-Asn was generated and used to raise polyclonal rabbit antisera (Genscript, USA).
- the resultant antisera (provided by Genscript) contained affinity purified IgG antibodies against P. falciparum actin.
- P. falciparum (3D7 strain), P. berghei (ANKA strain) and T. gondii (RH strain) parasites were each maintained using standard procedures.
- P. falciparum cultures were grown in human 0+ erythrocytes at 4% hematocrit with 0.5% Albumax II (Invitrogen).
- 3D7 is a cloned line derived from NF54, obtained from the late David Walliker at Edinburgh University, UK.
- P. berghei lines were maintained in Balb/c mice as described previously (Sinden et al., 2002), wild-type ANKA was obtained from Robert Sinden at Imperial College, London.
- T. gondii was propagated in human foreskin fibroblasts (HFF) grown in Dulbecco's modified Eagle's medium (DMEM) with 10% fetal calf serum (GIBCOBRL).
- HFF human foreskin fibroblasts
- DMEM Dulbecco's modified Eagle's medium
- GIBCOBRL 10% fetal calf serum
- Lysates from saponin-treated shizont stage in vitro cultures of both P. falicparum and P. berghei along with tachyzoites were harvested by centrifugation, resuspended in reduced sample buffer and analysed by Western blot probing with anti- Pf Actin antisera at 1/1000 or anti- Actin (clone C4, Millipore) at 1/1000. Signal was detected by anti-rabbit or mouse IgG horseradish peroxidase conjugate (HRP) (Millipore), and visualized via enhanced chemiluminescence (ECL, Amersham Biosciences). For solubility analysis of PfADFl, isolated 3D7 strain P.
- HRP horseradish peroxidase conjugate
- FIG. 1A The results of the immunoblot are shown in Figure 1A.
- the antibody recognized a specific product around 40 kD in lysate from P. falciparum, P. berghei and T. gondii tissue cultures, which is consistent with apicomplexan actin' s predicted mass (-41.8 kD).
- the antibody showed minimal cross-reaction with human erythrocyte (RBC) or human fibroblast (HFF) actin.
- RBC erythrocyte
- HFF human fibroblast
- EXAMPLE 2 Antibody binding to actin filaments in apicomplexan parasites
- the apicomplexan actin-specific antibody was delivered to P. falciparum, P. berghei and T. gondii in order to visualise intracellular actin.
- berghei sporozoites were dissected from infected Anopheles stephensi salivary glands and kept on ice in HepG2 culture media (Advanced MEM (Gibco®) supplemented with 10% FCS (Bovogen), 1% L-Glutamin (Thermo Scientific), 1% Penicillin/Streptomycin (Thermo Scientific), 0.1% Amphotericin B (Thermo Scientific) until dissection was completed.
- Sporozoites were added to lxlO 5 HepG2 cells per well in a 24 well plate. The plate was spun at 800 rpm and 4°C for 4 min to facilitate sporozoite - HepG2 cell interaction.
- the plate was put at 37°C and 5% C0 2 for 8 min, carefully washed once with PBS and invasion stopped by fixation with 0.0075% glutaraldehyde/ 4% paraformaldehyde.
- berghei merozoites or sporozoites allowed to invade for 2 or 10 min were then fixed in solution and prepared for IF A as described (Tonkin et al., 2004) using 0.0075% glutaraldehyde/ 4% paraformaldehyde (ProSciTech, Australia) in PBS. Free tachyzoites from culture supernatant or infected host cells and P. berghei ookinetes were fixed directly on coverslips and prepared for IFA using the same method.
- mice anti-PfAct 2 39-253 [1:300]; mouse anti-PfRON4 (Richard et al., 2010); rabbit anti-GAP45 (Baum et al., 2006) [1:500]; rabbit-anti-TgRON4 (Alexander et al., 2005) [1:1000]; mouse anti-TgSAGl (DG52) (Morisaki et al., 1995) [1:5,000]; mouse anti-PbCSP [1:5000] (Yoshida et al., 1980); mouse anti-Pb28 (Spano et al., 1996) [1:10,000].
- Free or invading merozoites were fixed in 1% glutaraldehyde (ProSciTech, Australia) on ice for 30 min. Samples were pelleted in low-melt agarose before being transferred into water, dehydrated in ethanol and embedded in LR Gold Resin (ProSciTech, Australia). Following polymerization by benzoyl peroxide (SPI-Chem, USA) samples were sectioned on a Leica Ultracut R ultramicrotome (Wetzlar).
- Sections were blocked in phosphate-buffered saline containing 0.8% (wt vol) bovine serum albumin and 0.01% (wt/vol) Tween 80 and then incubated in anti-PfAct239-253 diluted in the above-mentioned solution. Samples were washed and incubated with secondary antibodies conjugated to 10 nm diameter gold particles (BioCell). Post- staining with 2% aqueous uranyl-acetate and 5% triple lead was followed by observation at 120 kV on a Philips CM 120 BioTWIN Transmission Electron Microscope.
- Imaging was performed using a DeltaVision OMX 3D Structured Illumination Microscopy System® (OMX 3D-SIM, Applied Precision Inc, Issaquah, USA) as described (Riglar et al., 2011).
- KSYELPDGNIITVGN P. falciparum actin epitope
- Figure 5 shows that this peptide sequence is 100% conserved in several apicomplexan parasites, including major pathogens of . humans and animals. These pathogens include other human malarial parasites P. vivax, P. ovale, P. malariae and P. knowlesi, as well as T. gondii, B. bovis, B. annulata, T. parvum and T. annulata.
- Example 1 the antibody shown in Example 1 to bind specifically to a number of different apicomplexan parasites' actin without significantly binding human actin recognises an epitope that is conserved across the apicomplexan phylum. Therefore, the antibody can be used to specifically bind actin from parasites across the apicomplexan phylum.
- EXAMPLE 4 Determining a candidate agent's ability to inhibit actin polymerization.
- Recombinant methods can be used to generate actin monomers for use in such screening methods.
- Recombinant actin was produced as follows. A synthetic PfACTl gene encoding P. falciparum actin, with a sequence which has been modified from the endogenous P. falciparum actin gene sequence (SEQ ID NO: 8) in order to achieve enhanced expression levels, was amplified using primers PfACTl_NdeI_FL_codon+fwd,
- Purified products of the codon optimised sequence (SEQ ID NO: 7) were ligated into the Ndel Xhol site of the pET28 vector (Novagen) to generate recombinant proteins with ran N-terminal hexa-His ⁇ fusion tag and transformed into— DH101 E. coli competent cells (Invitrogen).
- the recombinant construct was confirmed by DNA sequencing. Positive clones were re-transformed into Rosetta2 (DE3) E. coli ceils for protein expression.
- Expression of PfACTl was induced by the addition of 1 mM isopropyl b-D-l-thiogalactopyranoside (IPTG) when the culture reached an OD600 of 0.6. Following addition of IPTG cultures were grown for 4 hr at 37 °C, cells harvested and ruptured by sonication.
- Soluble proteins were separated from the inclusion body, which contains the expressed His6x-PfACTl, by centrifugation at 15,000 rpm/ 4 °C/ 30 min.
- Inclusion body was solublised in solublisation buffer (6 M Guanidine hydrochloride, 50 mM Tris pH 8, 0.3 M NaCl and 10 mM 2-Mercaptoethanol) at 25 °C/ 1 hr with rocking.
- Solublised His6x-PfACTl was purified in denatured condition by incubating with NiNTA agarose (Qiagen) at 4 °C/1 hr with rocking.
- Proteins were initially washed with wash buffer 1 (6 M Guanidine hydrochloride, 50 mM Tris pH 8, 0.3 M NaCl, 30 mM imidazole and 10 mM 2-Mercaptoethanol) followed by refolding via washing the proteinrbound agarose with refolding buffer (20 mM Tris, pH 8, 0.1 mM CaC12, 0.1 mM ATP and 5 mM 2-Mercaptoethanol). His6x-PfACTl was eluted in elution buffer (20 mM Tris, pH8, 0.1 mM CaC12, 0.1 mM ATP, 250 mM imidazole and 5 mM 2- Mercaptoethanol).
- wash buffer 1 6 M Guanidine hydrochloride, 50 mM Tris pH 8, 0.3 M NaCl, 30 mM imidazole and 10 mM 2-Mercaptoethanol
- His6x-PfACTl was eluted in elution buffer (20 mM Tris, pH8,
- Purified protein was concentrated and further purified by size- exclusion chromatography using a Superdex S200 10/300 GL column (GE Healthcare) with 20 mM Tris, pH8, 0.1 mM CaC12, 0.1 mM ATP and 5 mM 2-Mercaptoethanol as elution buffer. Protein purity was assessed by SDS-PAGE.
- An alternative means of producing recombinant actin is to amplify the P. falciparum gene sequence shown as SEQ ID NO: 8 using primers designed as known in the art and preparing soluble proteins as described above.
- EXAMPLE 5 Generation of a monoclonal antibody that specifically binds P. falciparum actin.
- Plasmodium falciparum Actin (PlasmoDB ID: PFL2215w) was used to raise polyclonal mouse antisera against malaria actin (anti-Act239-253) as described in Example 1. Serum was raised by immunization of Balb/C mice. Immunogenic mice (as determined by ELISA and immunoblot (see below)) were selected for splenectomy followed by fusion with Sp2/0 myeloma to generate a hybridoma for monoclonal antibody generation. Supernatants (containing secreted antibody) harvested from cloned cells derived from the fusion were screened by ELISA and immunoblot (see below).
- the cloned hybridoma cell line 26/11-5H3- 1-2 (5H3) was selected as producing a monoclonal antibody (IgG3 subclass) that reacted specifically with malarial actin but reacted minimally with mammalian actin (see below).
- the cloned hybridoma cell line 26/11 -5H3- 1 -2 was deposited with the European Collection of Cell Cultures (ECACC), at the address: Health Protection Agency, Porton Down, Salisbury, Wiltshire, SP4 OJG, UK, on 18 April 2012 and was allocated the accession number 12041801. Accordingly, the deposit of the cloned hybridoma cell line 26/11-5H3- 1-2 (5H3) was made in accordance with the Budapest Treaty on the International Recognition of the Deposit of Microorganisms. Immunoblot screening
- Polyclonal serum or monoclonal antibody were screened by immunoblot against recombinant Actin (rPf) generated in Escherichia coli (Wong et al., 2011), commercially available Rabbit Skeletal Muscle Actin (RSMA) (Cytoskeleton Inc.), lysate from hypotonically lysed human or mouse red blood cells (hRBCs or mRBCs), human foreskin fibroblast (HFF) cell lysate, or saponin-treated cell lysate from the same cells infected with P. falciparum (Pf iRBC), P.
- rPf recombinant Actin
- RSMA Rabbit Skeletal Muscle Actin
- hRBCs or mRBCs hypotonically lysed human or mouse red blood cells
- HFF human foreskin fibroblast
- saponin-treated cell lysate from the same cells infected with P. falciparum (Pf
- berghei Pb iRBC
- Tg iHFF Toxoplasma gondii
- Parasites used P. falciparum 3D7 strain, P. berghei ANKA strain and T. gondii RH strain
- Immunoblots were undertaken according to standard protocols. Briefly, lysates or recombinant proteins were resuspended in reduced sample buffer, boiled and analysed by Western blot probing with mouse polyclonal or monoclonal (5H3) anti-Act239-253 antisera at 1:200 or 1:1000 concentration respectively. Signal was detected by anti-mouse IgG horseradish peroxidase . conjugate (HRP) (Millipore), and visualised via enhanced chemiluminescence (ECL, Amersham Biosciences).
- HRP horseradish peroxidase . conjugate
- ECL enhanced chemiluminescence
- the monoclonal antibody 5H3 specifically binds to recombinant P. falciparum actin and not to human actin (panel B), achieving a similar specificity to that seen with mouse polyclonal serum (panel A).
- 5H3 also specifically binds to P. falciparum actin in lysed P.falciparum-w ' fected human RBCs and not to uninfected human RBC lysate (panel B).
- the IFA analysis shown in panel C demonstrates that 5H3 binds to P. falciparum actin in vivo and can therefore be used in a variety of applications as described herein.
- EXAMPLE 6 ALPHASCREENTM assay to identify agents that bind a polypeptide comprising or consisting of SEQ ID NO: 2 or SEQ ID NO: 10, as indicated by their ability to reduce the binding of an antibody disclosed herein to a polypeptide comprising or consisting of SEQ ID NO: 2.
- An ALPHASCREENTM assay is used to identify active small molecules capable of binding a polypeptide comprising or consisting of SEQ ID NO: 2 or SEQ ID NO: 10, as indicated by their ability to reduce the binding of an antibody disclosed herein (e.g., the monoclonal antibody 5H3) to a polypeptide comprising or consisting of SEQ ID NO: 2 or SEQ ID NO: 10.
- the assay investigates the ability of a candidate agent to inhibit the binding of an antibody disclosed herein (e.g., the monoclonal antibody 5H3) to a polypeptide comprising or consisting of SEQ ID NO: 2 or SEQ ID NO: 10.
- the compounds are routinely tested at starting concentrations, ⁇ and/or ⁇ and serially titrated 3 fold over 11 dilutions.
- the assay uses ALPHASCREENTM technology that relies on hydrogel coated acceptor and donor beads which have functional groups for conjugation to a protein
- Donor beads contain a photosensitiser that converts oxygen to an excited form of 0 2 at an excitation of 680 nm. Energy is transformed from the singlet oxygen and reacts with chemilviminescers in the acceptor bead, resulting in light emission at 580 - 620 nm.
- Candidate agents when added to the ALPHASCREENTM assay, can interfere with the antibody binding to the peptide, resulting in failure of the donor and acceptor beads to come into close proximity to one and other, reducing the intensity of the luminescence signal. By adding various compound concentrations, the IC50 of each compound is calculated.
- Biotinylated-peptide are prepared in-house and stored as stock solutions at -80°C.
- the biotinylated-KSYELPDGNIITVGN (SEQ ID NO: 2) or biotinylated-NIITV (SEQ ID NO: 10) is stored as 500 ⁇ stock solutions in 100% DMSO at -80°C.
- the ALPHASCREENTM Protein A Detection Kit is obtained from Perkin Elmer Lifesciences. Microtitre plates are purchased from Interpath Services, Melbourne (eg. Cat #784075). Seals to cover the plates are purchased from Prescience, Melbourne (eg. Cat#784075). Polypropylene 50 ⁇ ,, V bottom polypropylene compound plates are purchased from Matrical.
- Compounds are prepared as 5mM stocks in 100% DMSO. These compounds are diluted in DMSO to achieve a desired final concentration. The assay and bead buffers are prepared fresh. Each titrated compound plate is assayed in duplicate. As an example, the following volumes are sufficient to run 12 384- well plates.
- the assay and bead buffers are used to prepare the acceptor and donor solutions.
- ALPHASCREENTM beads are light sensitive and therefore prepared in a room with subdued lighting. 2.5 of beads are added per 1 mL of buffer.
- the volume of antibody or peptide to add is calculated using the following formula:
- V2 Volume of stock antibody/peptide to add to Acceptor/Donor solution.
- the assay components are prepared as separate Acceptor and Donor Solutions.
- the Acceptor Solution contains Acceptor beads and target antibody, while the Donor Solution contains Donor beads and biotinylated peptide.
- a small volume of various compounds at various concentrations in 100% DMSO are transferred to the 384-well assay plate in columns 1-22 only, with the same volume of DMSO only transferred into columns 23- 24, and the plates are incubated for 3,0 rnins at RT, before addition of a volume of
- the percent inhibition is calculated using the following equation:
- Agents that reduce the binding of an antibody disclosed herein to a polypeptide comprising or consisting of SEQ ID NO: 2 or SEQ ID NO: 10 are selected for further analysis.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Veterinary Medicine (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Chemical & Material Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Animal Behavior & Ethology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Public Health (AREA)
- Immunology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Peptides Or Proteins (AREA)
Abstract
The present invention relates generally to antibodies and fragments thereof which are capable of specifically binding apicomplexan actin. The invention also relates to an epitope of apicomplexan actin which can be used to raise such antibodies, and to screening methods for identifying other agents that are capable of binding specifically to apicomplexan actin. The invention further relates to methods of treating diseases caused by apicomplexan parasites.
Description
ACTIN BINDING AGENTS
FIELD OF THE INVENTION
The present disclosure relates to agents that specifically bind to actin, to methods of identifying such agents, and to therapeutic applications of such agents. In particular, the present disclosure relates to agents that specifically bind apicomplexan actin and do not detectably bind human actin. BACKGROUND OF THE INVENTION
Apicomplexa are unicellular obligate intracellular parasites that infect animals and other protists, and are the cause of significant human diseases including malaria and toxoplasmosis. Despite their specific adaptations to various host and target tissues however, apicomplexan parasites share a common cell architecture and mode of locomotion. This process - called gliding motility - underlies both cell motility and host cell invasion and relies on a conserved molecular machinery that is unique to the apicomplexan phylum (Morrissette and Sibley, 2002; Baum et al., 2008). The best model for gliding motility involves the precise linking of secreted ligands with an internal actomyosin motor (Frenal et al., 2010; Gaskins et al., 2004; Green et al., 2006; Jones et al., 2006; Baum et al., 2006a; Pinder et al., 1998). This motor is anchored within the pellicle, or supra-alveolar space, that lies between the outer plasma membrane and underlying inner membrane complex (IMC) (Raibaud et al. 2001) of the motile parasite (or zoite). While core molecular components of the gliding motor are known, little is understood about their dynamics during cell movement. This is particularly true for actin, whose filament turnover is known to be essential for active gliding motilit and host cell invasion (reviewed in Baum et al., 2006b).
Actin is a critical component of all eukaryotic cells. It exists in two states - a globular (G) and filamentous (F) form - with the dynamic interchange between the two used to drive a diversity of cell processes (Pollard and Cooper, 2009; Visa and Percipalle, 2010). Malaria parasites encode two actin isoforms, actin I and II (Gordon and Sibley, 2005). Actin II appears to play a restricted role during malaria parasite sexual stages (Wesseling et al., 1989). Studies with actin-specific inhibitors have shown that actin I (referred to herein as actin) drives cell motility (Siden-Kiamos et al., 2006; Miller et al., 1979; Munter et al., 2009; Mizuno et al., 2002; Ryning and Remington, 1978). Drugs that sequester monomelic or globular (G)-actin (Morrissette and Sibley, 2002; Siden-Kiamos et al., 2006) stall filamentous (F)-actin growth (Siden-
iamos et al., 2006; Miller et al., 1979; Munter et al., 2009; Ryning and Remington, 1978; Dobrowolski and Sibley 1996; Field et al., 1993; Wetzel et al., 2003) or stabilize forming filaments (Siden-Kiamos et al., 2006; Munter et al., 2009; Mizuno et al., 2002; Shaw and Tilney, 1999; Wetzel et al., 2003), all prevent both cell movement and cell invasion demonstrating the importance of actin filament turnover to parasite gliding. However, despite this reliance on dynamic actin, F-actin presence in the supra-alveolar space and the prediction, based on current understanding, that actin filaments must be present at sites of motor engagement between parasite and substrate surface, filaments have not been definitively described in any apicomplexan cell (Dobrowolski et al. 1997; Kudryashev et al., 2010; Schatten et al., 2003).
Two important molecular tools for understanding the role of actin filaments in eukaryotic cell biology are jasplakinolide (JAS) and phalloidin (Holzinger and Meindl, 1997; Cooper, 1987). Whilst apicomplexan actin filaments show minimal labelling with phalloidin (Cintra and De Souza, 1985; Sahoo et al., 2006; Schmitz et al., 2005; Schmitz et al., 2010; Schuler et al., 2005) they have high affinity for JAS (Mizuno et al., 2002; Shaw and Tilney 1999; Wetzel et al., 2005) a cell-permeable, naturally occurring cyclodepsipeptide from the marine sponge that binds to and stabilizes formed filaments and prevents them from depolymerising, thus permitting detection of filaments within cells (Bubb et al., 1994). Motile Toxoplasma gondii tachyzoites treated with JAS display both filamentous structures, presumed to be actin, under the plasma membrane (Wetzel et al., 2003) and patches of actin dynamics localized at the parasite poles (Shaw and Tilney, 1999; Wetzel et al., 2003), an observation mirrored in blood stage merozoites from the human malaria parasite Plasmodium falciparum (Mizuno et al., 2002). Concentration of F-actin within the zoite pellicle and apex is further supported by EM studies that have observed filamentous structures with similar dimensions under native conditions (Kudryashev et al., 2010; Schatten et al., 2003). Most recently this involved using cryogenic electron tomography of mouse malaria Plasmodium berghei liver stage sporozoites, in which short filament like structures were observed again in the supra alveolar space (Kudryashev et al., 2010). However, beyond these encouraging observations no study has unambiguously assigned actin to such structures nor been able to demonstrate microfilament spatial organization during zoite movement.
These difficulties in ^identifying actin microfilaments under normal physiological conditions are surprising given that estimates for the cytosolic concentration of actin in apicomplexan cells are well above the critical concentration for spontaneous filament formation (Field et al., 1993; Sahoo et al., 2006). One
explanation for their elusiveness is the predicted inherent instability of formed - apicomplexan actin filaments (Schmitz et al., 2010), which are very short (-lOOnm) and unstable (Sahoo et al., 2006); Schmitz et al., 2005; Schuler et al., 2005). Second, evidence suggests that the majority of actin in apicomplexan cells exists in a 5 monomeric form (Dobrowolski and Sibley, 1996; Field et al., 1993; Dobrowolski et al., 1997). Finally, filaments likely form only transiently at sites relating to parasite traction with the substrate or host cell surface (Baum et al., 2008; Munter et al., 2009). For a gliding parasite, such as a the mosquito stage ookinete (Vlachou et al., 2004), pre- erythrocytic sporozoites (Amino et al., 2008) or a Toxoplasma tachyzoite (Wetzel et al.,
10 2003), this could be anywhere along the cell length (Munter et al., 2009), while for an invading parasites, including sporozoites, merozoites and tachyzoites this would presumably be at the tight junction - an electron dense interface formed between the invading parasite and its host cell (Amino et al., 2008; Aikawa et al., 1978; Riglar et al., 2011; Alexander et al., 2005). The inability to decisively determine the spatial
15 localization of dynamic actin filaments leaves our understanding of the molecular basis of apicomplexan motility incomplete.
Thus, there is a need for the identification of agents which specifically bind apicomplexan actin.
20 SUMMARY OF THE INVENTION
The present inventors have developed a novel antibody which specifically binds apicomplexan actin. This antibody can be used to inhibit apicomplexan actin dynamics and to identify further agents capable of inhibiting apicomplexan actin dynamics. The antibody has been raised against a particular epitope of apicomplexan actin whose
25 sequence differs from the corresponding epitope in human actin.
Accordingly, the present disclosure provides an isolated or recombinant antibody or fragment thereof, which antibody or fragment specifically binds a polypeptide comprising the amino acid sequence KSYELPDGNIITVGN (SEQ ID NO: 2). Thus, the antibody or fragment may bind an epitope comprising or consisting of the
30 amino acid sequence KSYELPDGNIITVGN (SEQ ID NO: 2), or an epitope comprising or consisting of a fragment of the amino acid sequence KSYELPDGNIITVGN (SEQ ID NO: 2). The fragment may comprise any number of amino acid residues of the sequence KSYELPDGNIITVGN (SEQ ID NO: 2). The fragment may contain only amino acid sequences within the sequence
35 KSYELPDGNIITVGN (SEQ ID NO: 2). In one example, the fragment comprises or consists of the amino acid sequence NIITV (SEQ ID NO: 10). Alternatively, the
epitope may comprise a fragment of the sequence KSYELPDGNIITVGN (SEQ ID NO: 2) and one or more amino acid residues found either side of this sequence in the amino acid sequence of P. falciparum actin (SEQ ID NO: 1). Thus, the epitope may comprise a fragment of the amino acid sequence of P. falciparum actin (SEQ ID NO: 1 ) that partially overlaps with the sequence KSYELPDGNIITVGN (SEQ ID NO: 2).
Preferably, the antibody or fragment does not detectably bind to the corresponding epitope in human actin. Thus, in one embodiment, the antibody or fragment disclosed herein does not detectably bind a polypeptide comprising amino acids 237 to 251 of human β-actin as defined in SEQ ID NO: 3 and/or a polypeptide comprising amino acids 237 to 251 of mutant human β-actin as defined in SEQ ID NO: 4. In another embodiment, the antibody or fragment disclosed herein does not detectably bind a polypeptide comprising the amino acid sequence QVITI (SEQ ID NO: 11 ; corresponding to amino acids 245 to 249 of human β-actin).
In one embodiment, the antibody or fragment thereof does not detectably bind mammalian actin. In one embodiment, the antibody or fragment thereof does not detectably bind human actin.
In one embodiment, the antibody or fragment thereof comprises one or more complementarity determining regions (CDRs) of the antibody produced by the hybridoma cell line 26/11-5H3- 1-2 deposited with the European Collection of Cell Cultures (EC ACQ under accession number 12041801. (For convenience, the monoclonal antibody produced by the hybridoma cell line 26/11-5H3-1-2 deposited with the European Collection of Cell Cultures (ECACC) under accession number 12041801 is referred to herein as "the monoclonal antibody 5H3".) For example, the antibody or fragment thereof may comprise 1, 2, 3, 4, 5, or 6 CDRs of the monoclonal antibody 5H3, in any combination. Preferably, the antibody or fragment thereof comprises all 6 CDRs of the monoclonal antibody 5H3.
In another embodiment, the antibody or fragment thereof comprises one or more variable regions of the monoclonal antibody 5H3. For example, the antibody or fragment may comprise one or both heavy chain variable regions and/or one or both light chain variable regions of the monoclonal antibody 5H3.
In another embodiment, the antibody comprises one or more of the light chains and/or heavy chains of the monoclonal antibody 5H3.
In another embodiment, the antibody or fragment thereof has the same binding affinity as the monoclonal antibody 5H3 for a polypeptide comprising the amino acid sequence KSYELPDGNIITVGN (SEQ ID NO: 2).
In another embodiment, the antibody is the monoclonal antibody 5H3.
The antibody disclosed herein can be, for example, a polyclonal antibody, monoclonal antibody, bispecific antibody, diabody, triabody, heteroconjugate antibody, chimeric antibody or single chain antibody. The fragment of the antibody disclosed herein can be, for example, a Fab, F(ab')2, FabFc2, or Fv fragment.
The present disclosure also provides an isolated or recombinant antibody or fragment thereof, which antibody or fragment thereof competitively inhibits the binding of the monoclonal antibody 5H3 to any one or more of: a polypeptide comprising the amino acid sequence KSYELPDGNIITVGN (SEQ ID NO: 2); a polypeptide consisting of the amino acid sequence KSYELPDGNIITVGN (SEQ ID NO: 2); an epitope comprising or consisting of the amino acid sequence KSYELPDGNIITVGN (SEQ ID NO: 2); and/or an epitope comprising or consisting of a fragment of the amino acid sequence KSYELPDGNIITVGN (SEQ ID NO: 2) (for example, the fragment NIITV (SEQ ID NO: 10)). Suitable assays for determining the competitive inhibition of antibody binding will be apparent to a person skilled in the art.
In one embodiment, the antibody or fragment disclosed herein is detectably labelled.
In another embodiment, the antibody or fragment disclosed herein is conjugated to a cell penetrating agent. In a further embodiment, the antibody or fragment itself is intracellularly transmissible.
The present disclosure also provides a composition comprising the antibody or fragment disclosed herein and a carrier. In one embodiment, the carrier is a pharmaceutically acceptable carrier.
The present disclosure also provides an isolated or recombinant polynucleotide encoding the antibody or fragment disclosed herein, or a chain thereof. The present disclosure also provides a vector comprising said polynucleotide, and further provides a host cell comprising said polynucleotide or said vector.
The present disclosure also provides an epitope of apicomplexan actin, which can be used to generate an antibody or fragment which specifically binds apicomplexan actin. Accordingly, the present disclosure provides an isolated or recombinant peptide consisting of the amino acid sequence KSYELPDGNIITVGN (SEQ ID NO: 2).
The present disclosure also provides an isolated or recombinant peptide consisting of the amino acid sequence -NIITV (SEQ ID NO: 10). Structural epitope analysis has indicated that this peptide may be suitable for generatingjui __antibody_or fragment which specifically binds apicomplexan actin.
The present disclosure also provides an isolated or recombinant polynucleotide encoding the peptide of SEQ ID NO: 2 or the peptide of SEQ ID NO: 10, a vector
comprising said polynucleotide, and a host cell comprising any one or more of the peptide of SEQ ID NO: 2 or the peptide of SEQ ID NO: 10, the polynucleotide encoding said peptide, or the vector comprising said polynucleotide.
The present disclosure also provides a composition comprising a carrier and any one of more of the peptide of SEQ ID NO: 2 or the peptide of SEQ ID NO: 10, the polynucleotide encoding said peptide, the vector comprising said polynucleotide and the host cell comprising said peptide, polynucleotide or vector. In one embodiment, the composition further comprises an adjuvant.
The present disclosure also provides a method of producing the antibody or fragment described herein, using the peptide despribed herein. Thus, the present disclosure provides a method of producing the antibody or fragment described herein, the method comprising administering to an animal any one or more of the peptide of SEQ ID NO: 2 or the peptide of SEQ ID NO: 10, the polynucleotide encoding said peptide, the vector comprising said polynucleotide, the host cell comprising said peptide, polynucleotide or vector, or the composition comprising a carrier and any one of said peptide, polynucleotide, vector, or host cell.
The antibody or fragment disclosed herein can be used to identify agents which bind to apicomplexan actin. Accordingly, the present disclosure provides a method of identifying an agent which binds apicomplexan actin, the method comprising:
i) contacting the antibody or fragment disclosed herein with a polypeptide comprising SEQ ID NO: 2 or SEQ ID NO: 10 in the presence of a candidate agent; and
ii) identifying the candidate agent as an agent which binds apicomplexan actin if the binding of the antibody or fragment to the polypeptide comprising SEQ ID NO: 2 or SEQ ID NO: 10 is reduced in the presence of the candidate agent.
The method may further comprise contacting the antibody or fragment disclosed herein with a polypeptide comprising SEQ ID NO: 2 or SEQ ID NO: 10 in the absence of a candidate agent; and identifying the candidate agent as an agent which binds apicomplexan actin if the binding of the antibody or fragment to the polypeptide comprising SEQ ID NO: 2 or SEQ ID NO: 10 is reduced in the presence of the candidate agent compared to the absence of the candidate agent. In addition, the method may further comprise contacting the candidate agent with a polypeptide which does not comprise an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10; and identifying the agent as an agent which specifically binds apicomplexan actin if the agent reduces the binding of the antibody or fragment to the polypeptide comprising
SEQ ID NO: 2 or SEQ ID NO: 10 and does not detectably bind to the polypeptide which does not comprise an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10.
Alternatively, the peptide disclosed herein can be used without the antibody to identify agents which bind apicomplexan actin. Thus, the present disclosure also provides a method of identifying an agent which binds apicomplexan actin, the method comprising:
i) contacting the peptide of SEQ ID NO: 2 or SEQ ID NO: 10 with a candidate agent; and
ii) identifying the agent as an agent which binds apicomplexan actin if the agent binds to the peptide of SEQ ID NO: 2 or SEQ ID NO: 10.
The method may further comprise contacting the candidate agent with a polypeptide which does not comprise an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10; and identifying the agent as an agent which specifically binds apicomplexan actin if the agent binds to the peptide of SEQ ID NO: 2 or SEQ ID NO: 10 and does not detectably bind to the polypeptide which does not comprise an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10.
Each of these methods can further comprise a step of determining whether the agent detectably binds mammalian actin. Thus, the polypeptide which does not comprise an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10 may be mammalian actin. In one embodiment, the mammalian actin comprises a polypeptide comprising amino acids 237 to 251 of human β-actin as defined in SEQ ID NO: 3 or a polypeptide comprising amino acids 237 to 251 of mutant human β-actin as defined in SEQ ID NO: 4. In another embodiment, the mammalian actin comprises a polypeptide comprising amino acids 245 to 249 of human β-actin, as defined in SEQ ID NO: 11.
In one embodiment, the methods of identifying an agent which binds apicomplexan actin further comprise detennining whether the agent is capable , of inhibiting, disrupting or stabilising apicomplexan actin polymerization. In another embodiment, the methods further comprise determining whether the agent is capable of inhibiting apicomplexan motility and/or host cell invasion and/or apicomplexan intra- cellular development.
In one embodiment of the methods of identifying an agent which binds apicomplexan actin, the agent and/or the antibody or fragment thereof is detectably labelled. In another embodiment, the polypeptide comprising SEQ ID NO: 2 or peptide consisting of SEQ ID NO: 2, or the peptide comprising SEQ ID NO: 10 or peptide consisting of SEQ ID NO: 10 is detectably labelled.
The present disclosure also provides an agent capable of binding apicomplexan actin identified by the methods described herein.
The present disclosure also provides a method of treating a disease caused by an apicomplexan parasite, the method comprising administering the agent, the antibody or fragment, or the composition comprising the antibody or fragment and a carrier as described herein, to a subject in need thereof.
The present disclosure also provides the agent, the antibody or fragment, or the composition comprising the antibody or fragment and a carrier as described herein for use in treating a disease caused by an apicomplexan parasite.
The present disclosure also provides the use of the agent, the antibody or fragment, or the composition comprising the antibody or fragment and a carrier as described herein in the manufacture of a medicament for treating a disease caused by an apicomplexan parasite.
The present disclosure also provides the use of the agent, the antibody or fragment, or the composition comprising the antibody or fragment and a carrier as described herein to inhibit, disrupt or stabilise apicomplexan actin polymerization.
The present inventors have also identified a polynucleotide, which, when expressed, results in higher levels of production of P. falciparum actin than the levels achieved by expressing the endogenous P. falciparum actin gene. The sequence of this polynucleotide is set out in SEQ ID NO: 7. Accordingly, the present disclosure also provides a polynucleotide comprising the nucleotide sequence set out in SEQ ID NO: 7. The polynucleotide may comprise other nucleotide sequences in addition to the sequence of SEQ ID NO: 7, or may consist of the nucleotide sequence of SEQ ID NO: 7. Preferably, the polynucleotide is an isolated or recombinant polynucleotide.
In a preferred embodiment, the polynucleotide is operably linked to a promoter capable of directing expression of the polynucleotide in a cell.
Also provided is a vector comprising the polynucleotide. In addition, the present disclosure provides a host cell or extract thereof comprising the polynucleotide and/or vector. Examples of suitable host cells are described herein and include, but are not limited to, a bacterial cell, a yeast cell or a plant cell. Preferably, the host cell is a bacterial cell. In one embodiment, the bacterial cell is an E. coli cell.
The present disclosure also provides a method of producing P. falciparum actin, the method comprising expressing a polynucleotide encodin P. falciparum actin, or expressing a vector comprising a polynucleotide encoding P. falciparum actin under conditions suitable to produce the P. falciparum actin. Preferably, the method comprises expressing a polynucleotide comprising the polynucleotide sequence of SEQ
ID NO: 7, or expressing a vector comprising the polynucleotide sequence of SEQ ID NO: 7, under conditions suitable to produce P. falciparum actin. The methods can comprise expressing the polynucleotide in a host cell or in a cell-free system. Examples of suitable host cells are described herein and include, but are not limited to, a bacterial cell, a yeast cell or a plant cell. Preferably, the host cell is a bacterial cell. In one embodiment, the bacterial cell is an E. coli cell. The cell-free system may comprise an extract of a host cell.
Any of the features described herein relating to the methods of producing a peptide of SEQ ID NO: 2 can apply equally to the methods of producing P. falciparum actin.
Also disclosed herein is P. falciparum actin produced using a method described herein.
The features of any embodiment described herein shall be taken to apply mutatis mutandis to any other embodiment unless specifically stated otherwise.
The present disclosure is not to be limited in scope by the specific embodiments described herein, which are intended for the purpose of exemplification only. Functionally-equivalent products, compositions and methods are clearly within the scope of the invention, as described herein.
Throughout this specification, unless specifically stated otherwise or the context requires otherwise, reference to a single step, composition of matter, group of steps or group of compositions of matter shall be taken to encompass one and a plurality (i.e. one or more) of those steps, compositions of matter, groups of steps or group of compositions of matter.
The invention is hereinafter described by way of the following non-limiting Examples and with reference to the accompanying figures.
BRIEF DESCRIPTION OF THE ACCOMPANYING DRAWINGS
Some figures contain coloured representations or entities. Coloured versions of the figures are available from the Patentee upon request or from an appropriate Patent Office. A fee may be imposed if obtained from a Patent Office.
Figure 1. Apicomplexan actin antibody (anti-PfAct239-2S3) specifically binds apicomplexan actin in vivo
A) Immunoblot of parasite lysates from P. falciparum, P.berghei, T. gondii and human erythrocyte and fibroblast samples probed with antisera anti actin (C4, vertebrate) and anti-PfAct239-253. B) IF A of P. falciparum merozoites with anti-PfAct239-253 and IMC
protein PfGAP45. Scale bar = 2 μπι. C) Imuno-electron microscopy of free P. falciparum merozoites labelled with anti-PfAct239.253. Scale bar = 0.2 um. D) IFA of P. berghei ookinetes with and without 1 μΜ JAS labelled with anti-PfAct239-253 and surface marker Pb28. Scale bar = 5μηι. E) IFA of sporozoites either untreated or following the addition of 1 μΜ JAS, stained with anti- PfAct239-253 and surface marker PbCSP. Scale bar = 5μπι. F) Maximum and total fluorescence levels of sporozoites treated with 1 μΜ JAS, cytochalasin D 1 μΜ and DMSO control. Significance as shown, unpaired t-test. Figure 2. Location of anti-P Act23 -2s3 labelling within the pellicular compartment
A) IFA of untreated and 1 μΜ JAS treated T .gondii parasites probed with anti- PfAct239-253 and anti-TgSAGl. Scale bar = 5μηι. B) IFA as in (A) following treatment with Clostridium septicum a toxin 1/100. Scale bar = 5μιη. C) Western blot of P. falciparum schizont lysate fractionated by hypotonic lysis with subsequent carbonate extraction: labelling with anti-MSPl-19 (a membrane bound control) and PfADFl (a cytosolic control). P = pellet fraction; S = supernatant fraction.
Figure 3. Anti-PfAct239-253 labelling shows actin ring forms during erythrocyte invasion
A) IFA of invading P. falciparum merozoite labelled with antisera anti-PfRON4 and anti-PfAct239-253. Scale bar = 2 μπι. B) Immuno-electron microscopy of invading P. falciparum merozoites stained with antisera ant.-PfAct239.253. Scale bar = 0.2 μπι. G) IFA of invading P. berghei merozoite labelled with antisera anti-PfAct 239-253. Scale bar = 2μπι, arrows show direction of invasion. D) IFA and of invading P. berghei sporozoites labelled with antisera anti-PfAct239.253 and anti-PbCSP. Scale bar = 2μπι, arrows show concentration of actin labelling. E) IFA of P. berghei spect- sporozoites labelled with antisera anti-PfAct239-253 and anti-PbCSP. Scale bar = 2μηι.
Figure 4. Actin filaments parallel with zoite invasion
A) IFA of invading P. falciparum merozoites incubated with and without 1 μΜ JAS and labelled with antisera anti-PfAct239-2S3 and anti-PfRON4. Scale bar = 2μιη. B) IFA and 3D reconstruction of P. berghei merozoites incubated with and without 1 μΜ JAS and labelled with antisera anti-PfAct239-2S3. Scale bar = 2μπι, arrow shows direction of invasion. C) Graphic representation of actin labelling in P. berghei merozoites with and without the addition of 5 μΜ JAS. N = 124 merozoites for each of 3 replicates, mean is shown, D) Three dimensional structured illumination microscopy (3D SIM) of three
separate invading P. falciparum merozoites labelled for actin (red), RON4 (green) and DAPI (blue). Scale bar = 0.3 μηι and arrows show direction of invasion.
Figure S. BLAST analysis investigating P. falciparum actin epitope sequence conservation in apicomplexans.
Figure 6. Apicomplexan actin monoclonal antibody (5H3) specifically binds apicomplexan actin.
A) Western blot of Rabbit Skeletal Muscle Actin (RSMA) versus recombinant P. falciparum actin (rPf) probed with mouse polyclonal serum raised against PfACT peptide 239-253. B) Western blot of RSMA versus recombinant PfActin (rPf) and separate blot of human uninfected red cells (hRBC) versus P. falciparum infected RBCs (PF iRBC), mouse uninfected RBCs (mRBC) versus P. berghei infected mRBC (Pb iRBC) and Human Foreskin Fibroblasts (HFF) versus Toxoplasma gondii (Tg) infected HFF cells (Tg iHFF); all probed with monoclonal antibody 5H3 derived from Mouse 1077 Hybridoma. C) Immunofluoresence microscopy of invading blood stage merozoite of P. falciparum into human red blood cells using Mab 5H3 co-labeled with junction marker RON4 and nucleus (DAPI). Scale bar in the brightfield image is 5 microns. KEY TO THE SEQUENCE LISTING
SEQ ID NO: 1 - amino acid sequence of P. falciparum actin (PlasmoDB ID: PFL2215w).
SEQ ID NO: 2 - amino acid sequence of an immunogenic epitope of P. falciparum actin (spanning amino acids 239 to 253 of P. falciparum actin).
SEQ ID NO: 3 - amino acid sequence of amino acids 237 to 251 of human β-actin. SEQ ID NO: - amino acid sequence of amino acids 23 to 251 of mutant human β- actin.
SEQ ID NO: 5 - Forward primer PfACTl_NdeI_FL_codon+fwd.
SEQ ID NO: 6 - Reverse primer PfACTl_Xhol_FL_codon+Rev.
SEQ ID NO: 7 - Codon optimised P. falciparum actin gene sequence.
SEQ ID NO: 8 - P. falciparum actin gene sequence.
SEQ ID NO: 9 - Alternative P. falciparum actin short peptide sequence.
SEQ ID NO: 10 - Exemplified fragment of an immunogenic epitope of P. falciparum actin.
SEQ ID NO: 11 - Peptide fragment corresponding to amino acids 245 to 249 of human β-actin.
DETAILED DESCRIPTION OF THE INVENTION
General Techniques and Definitions
Unless specifically defined otherwise, all technical and scientific terms used herein shall be taken to have the same meaning as commonly understood by one of ordinary skill in the art (e.g., in cell culture, molecular genetics, immunology, immunohistochemistry, protein chemistry, and biochemistry).
Unless otherwise indicated, the recombinant protein, cell culture, and immunological techniques utilized in the present invention are standard procedures, well known to those skilled in the art. Such techniques are described and explained throughout the literature in sources such as, J. Perbal, A Practical Guide to Molecular Cloning? John Wiley and Sons (1984), J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press (1989), T.A. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), D.M. Glover and B.D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), and F.M. Ausubel et al. (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley- Interscience (1988, including all updates until present), Ed Harlow and David Lane (editors) Antibodies: A Laboratory Manual, Cold Spring Harbour Laboratory, (1988), and J.E. Coligan et al. (editors) Current Protocols in Immunology, John Wiley & Sons (including all updates until present).
The term "and/or", e.g., "X and/or Y" shall be understood to mean either "X and Y" or "X or Y" and shall be taken to provide explicit support for both meanings or for either meaning.
As used herein, the term "about", unless stated to the contrary, refers to +/- 20%, more preferably +/- 10%, of the designated value. For the avoidance of doubt, the term "about" followed by a designated value is to be interpreted as also encompassing the exact designated value itself (for example, "about 10" also encompasses 10 exactly).
Throughout this specification the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.
As used herein the terms "treating", "treat" or "treatment" include administering a therapeutically effective amount of an agent sufficient to reduce or eliminate at least one symptom of disease caused by infection with an apicomplexan parasite.
As used herein, the term "subject" refers to an animal, e.g., a mammal. In a preferred embodiment, the subject is mammalian, for example a human. Other preferred embodiments include livestock animals such as horses, cattle, sheep and goats, as well as companion animals such as cats and dogs.
As used herein, the terms "conjugate", "conjugated" or variations thereof are used broadly to refer to any form to covalent or non-covalent association between a compound useful in the methods disclosed herein and another agent.
As used herein, the term "cell penetrating agent" includes compounds or functional groups which mediate transfer of a substance from an extracellular space to an intracellular compartment of a cell, such as an apicomplexan cell. For example, a cell penetrating agent may be a hydrophobic moiety and the hydrophobic moiety may be, e.g., a mixed sequence peptide or a homopolymer peptide such as polyleucine or polyarginine at least about 11 amino acids long. The cell penetrating agent may be a peptide. Examples of cell penetrating peptides include Tat peptides, Penetratin, short amphipathic peptides such as those from the Pep-and MPG-families, oligoarginine, oligolysine and others. Alternatively, the cell-penetrating agent may be a lipid. For example, the cell-penetrating lipid may be a straight chain fatty acid.
As used herein, the term "intracellularly transmissible" shall be understood to mean being capable of passing from an extracellular space to an intracellular compartment of a cell, such as an intracellular compartment of an apicomplexan cell.
As used herein, the terms "variable region" and "variable domain" refer to the portion of the light and/or heavy chains of an antibody as defined herein that is capable of specifically binding to an antigen and includes amino acid sequences of complementarity determining regions (CDRs); i.e., CDR1, CDR2, and CDR3, and framework regions (FRs). For example, the variable region may comprise three or four FRs (e.g., FR1, FR2, FR3 and optionally FR4) together with three CDRs. "VH" refers to the variable region of the heavy chain. "VL" refers to the variable region of the light chain.
As used herein, the term "competitively inhibits" shall be understood to mean that a candidate agent (for example, a small molecule or a test antibody or fragment thereof) reduces or prevents binding of an antibody disclosed herein (for example, the monoclonal antibody 5H3) to any one or more of: a polypeptide comprising the amino acid sequence KSYELPDGNIITVGN (SEQ ID NO: 2) or the amino acid sequence NIITV (SEQ ID NO: 10); a polypeptide consisting of the amino acid sequence KSYELPDGNIITVGN (SEQ ID NO: 2) or the amino acid sequence NIITV (SEQ ID NO: 10); an epitope comprising or consisting of the amino acid sequence
KSYELPDGNIITVGN (SEQ ID NO: 2); and/or an epitope comprising or consisting of a fragment of the amino acid sequence KSYELPDGNIITVGN (SEQ ID NO: 2) (for example, the amino acid sequence NIITV (SEQ ID NO: 10)). This may be due to the candidate agent and the antibody binding to the same or an overlapping epitope. It will S be apparent from the foregoing that the candidate agent need not completely inhibit binding of the antibody, rather it need only reduce binding by a statistically significant amount, for example^ by at least about 10% or 20% or 30% or 40% or 50% or 60% or 70% or 80% or 90% or 95%. Preferably, the candidate agent reduces binding of the antibody by at least about 30%, more preferably by at least about 50%, more0 preferably, by at least about 70%, still more preferably by at least about 75%, even more preferably, by at least about 80% or 85% and even more preferably, by at least about 90%. Methods for determining competitive inhibition of binding are known in the art and/or described herein. For example, the antibody can be exposed to a polypeptide comprising the amino acid sequence KSYELPDGNIITVGN (SEQ ID NO:5 2) either in the presence or absence of the candidate agent. If less antibody binds in the presence of the candidate agent than in the absence of the candidate agent, the candidate agent is considered to competitively inhibit binding of the antibody. In one example, the competitive inhibition is not due to steric hindrance. 0 Apicomplexan Actin Epitope
The present inventors have identified an epitope of apicomplexan actin that can be used to raise antibodies which specifically bind apicomplexan actin. The epitope disclosed herein comprises the amino acid sequence KSYELPDGNIITVGN (SEQ ID NO: 2). Accordingly, the present disclosure provides an isolated or recombinant5 peptide consisting of SEQ ID NO: 2.
Structural analysis of this epitope has revealed that a particular fragment of the amino acid sequence KSYELPDGNIITVGN (SEQ ID NO: 2) may be suitable for generating an antibody or fragment which specifically binds apicomplexan actin. Accordingly, the present disclosure also provides an isolated or recombinant peptide0 consisting of SEQ ID NO: 10.
Malaria parasites encode two actin isoforms, actin I and II (Gordon and Sibley, 2005). Actin II appears to play a restricted role during malaria parasite sexual stages (Wesseling et al., 1989). The epitope comprising the sequence set out in SEQ ID NO:
2 is contained in, for example, P. falciparum actin I. The epitope sequence set out in5 SEQ ID NO: 2 is conserved among other apicomplexan parasites including, for example, Plasmodium vivax, Babesia bovis, Babesia gibsoni, Toxoplasma gondii,
Theileria parva strain Muguga, Theileria annulata strain Ankara, and others. Accordingly, the epitope identified in SEQ ID NO: 2 is an apicomplexan actin epitope.
The terms "peptide", "polypeptide" and "protein" are generally used interchangeably and refer to a single polypeptide chain which may or may not be modified by addition of non-amino acid groups. The term "peptide" additionally implies that the length of the single polypeptide chain is reasonably short, such as less than 100, or less than 50, or less than 20 amino acids in length. It will be understood that such single polypeptide chains may associate with other peptides, polypeptides or proteins or other molecules such as co-factors. The terms "peptides", "proteins" and "polypeptides" as used herein also include variants, mutants, biologically active fragments, modifications, analogs and/or derivatives of the peptides described herein.
As used herein a "biologically active fragment" is a portion of a peptide which maintains a defined activity of the full-length peptide. For example, a biologically active fragment of the peptide of SEQ ID NO: 2 may be a fragment which is capable of being used to generate an antibody which specifically binds apicomplexan actin. Biologically active fragments can be any size as long as they maintain the defined activity. One example of such a fragment is provided in SEQ ID NO: 10. Techniques for identifying a biologically active fragment of a peptide or polypeptide are known in the art.
Furthermore, if desired, unnatural amino acids or chemical amino acid analogues can be introduced as a substitution or addition into the peptides of the present disclosure. Such amino acids include, but are not limited to, the D-isomers of the common amino acids, 2,4-diaminobutyric acid, a-amino isobutyric acid, 4- aminobutyric acid, 2-aminobutyric acid, 6-amino hexanoic acid, 2-amino isobutyric acid, 3-amino propionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitrulline, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, β-alanine, fluoro-amino acids, designer amino acids such as β-methyl amino acids, Ca-methyl amino acids, Na-methyl amino acids, and amino acid analogues in general.
The peptides disclosed herein may also be differentially modified during or after synthesis, e.g., by biotinylation, benzylation, glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, conjugation to a carrier such as a protein carrier, etc. These modifications may serve to increase the stability and/or bioactivity of the peptides disclosed herein, and may allow simpler isolation or purification of the peptide.
The term "isolated peptide" or "purified peptide" is intended to mean a peptide that has generally been separated from the lipids, nucleic acids, other peptides and polypeptides, and other contaminating molecules with which it is associated in its native state. Preferably, the isolated peptide is at least 60% free, more preferably at least 75% free, and more preferably at least 90% free from other components with which it is naturally associated.
The term "recombinant" in the context of a peptide refers to the peptide when produced by a cell, or in a cell-free expression system, in an altered amount or at an altered rate compared to its native state. In one embodiment the cell is a cell that does not naturally produce the peptide. However, the cell may be a cell which comprises a non-endogenous gene that causes an altered, preferably increased, amount of the peptide to be produced. A recombinant peptide as described herein includes peptides which have not been separated from other components of the transgenic (recombinant) cell or cell-free expression system in which it is produced, and peptides produced in such cells or cell-free systems which are subsequently purified away from at least some other components.
Methods of Producing the Peptide
The peptides disclosed herein can be produced in a variety of ways, including production and recovery of natural peptides, production and recovery of recombinant peptides, and chemical synthesis of the peptides.
In a preferred embodiment, the peptide is produced by chemical synthesis. In a further embodiment, the peptide disclosed herein can be isolated from naturally occurring apicomplexan actin by any suitable method known in the art. For example, apicomplexan actin can be purified from apicomplexan cell lysates and protease enzymes can be used to cleave the purified actin to produce the peptide.
In another embodiment, the peptide can be produced by recombinant methods. For example, the peptide can be made recombinantly by producing a polynucleotide encoding the peptide and expressing the polynucleotide in a suitable expression system such as a host cell. Accordingly, the present disclosure provides a polynucleotide encoding the peptide. Preferably, the polynucleotide is an isolated or recombinant polynucleotide. In one embodiment, the peptide can be produced by a method including a step of expressing the endogenous P. falciparum actin gene (whose sequence is set out in SEQ ID NO: 8). The peptide disclosed herein can be produced from the P. falciparum actin protein by any suitable means. Alternatively, the peptide can be produced by a method including a step of expressing a codon optimised
polynucleotide sequence encoding P. falciparum actin, whose sequence has been modified from the sequence of the endogenous P. falciparum gene in order to result in enhanced expression of the actin protein. One example of such a codon optimised sequence is set out in SEQ ID NO: 7. Again, the peptide disclosed herein can be produced from the P. falciparum actin protein by any suitable means.
The term "isolated polynucleotide" is intended to mean a polynucleotide which has generally been separated from the polynucleotide sequences with which it is associated or linked in its native state. Preferably, the isolated polynucleotide is at least 60% free, more preferably at least 75% free, and more preferably at least 90% free from other components with which it is naturally associated. Furthermore, the term "polynucleotide" is used interchangeably herein with the terms "nucleic acid molecule", "gene" and "mRNA".
The term "recombinant" in the context of a polynucleotide refers to the polynucleotide when present in a cell, or in a cell-free expression system, in an altered amount compared to its native state. In one embodiment, the cell is a cell that does not naturally comprise the polynucleotide. However, the cell may be a cell which comprises a non-endogenous polynucleotide resulting in an altered, preferably increased, amount of production of the encoded polypeptide. A recombinant polynucleotide of the invention includes polynucleotides which have not been separated from other components of the transgenic (recombinant) cell, or cell-free expression system, in which it is present, and polynucleotides produced in such cells or cell-free systems which are subsequently purified away from at least some other components.
"Polynucleotide" refers to an oligonucleotide, a polynucleotide or any fragment thereof. It may be DNA or RNA of genomic or synthetic origin, double-stranded or single-stranded, and combined with carbohydrate, lipids, protein, or other materials to perform a particular activity defined herein.
The polynucleotides disclosed herein may possess, when compared to naturally occurring molecules (such as genomic polynucleotides encoding P. falciparum actin), one or more mutations which are deletions, insertions, or substitutions of nucleotide residues. Mutants can be either naturally occurring (that is to say, isolated from a natural source) or synthetic (for example, made by performing site-directed mutagenesis or DNA shuffling techniques as broadly described by Harayama (1998)).
It is thus apparent that polynucleotides of the invention can be either naturally occurring or recombinant.
The particular sequence of the polynucleotide can be determined from the peptide sequence. Due to the redundancy of the genetic code, different sequences can be used to encode the same peptide.
The polynucleotide encoding the peptide epitope can be inserted into a nucleotide vector in order to facilitate expression of the peptide. Accordingly, the present disclosure provides a vector comprising a polynucleotide encoding the peptide of SEQ ID NO: 2 or SEQ ID NO: 10. The vector can be either RNA or DNA, either prokaryotic or eukaryotic, and typically is a transposon (such as described in US 5,792,294), a virus or a plasmid.
Preferably, the polynucleotide encoding the peptide epitope is operably linked to a promoter which is capable of expressing the peptide under suitable conditions. "Operably linked" as used herein refers to a functional relationship between two or more nucleic acid (e.g., DNA) segments. Typically, it refers to the functional relationship of a transcriptional regulatory element to a transcribed sequence. For example, a promoter is operably linked to a coding sequence, such as a polynucleotide defined herein, if it stimulates or modulates the transcription of the coding sequence in an appropriate cell. Generally, promoter transcriptional regulatory elements that are operably linked to a transcribed sequence are physically contiguous to the transcribed sequence, i.e., they are cis-acting. However, some transcriptional regulatory elements, such as enhancers, need not be physically contiguous or located in close proximity to the coding sequences whose transcription they enhance.
The vector is preferably an expression vector. As used herein, an expression vector is a DNA or RNA vector that is capable of transforming a host cell and of effecting expression of a specified polynucleotide molecule. Preferably, the expression vector is also capable of replicating within the host cell. Expression vectors can be either prokaryotic or eukaryotic, and are typically viruses or plasmids. The expression vectors disclosed herein include any vectors that function (i.e., direct gene expression) in the recombinant cells disclosed herein, including in bacterial, fungal, endoparasite, arthropod, animal, and plant cells.
In particular, the expression vectors disclosed herein may contain regulatory sequences such as transcription control sequences, translation control sequences, origins of replication, and other regulatory sequences that are compatible with the recombinant cell and that control the expression of polynucleotide molecules disclosed herein. In particular, the vectors disclosed herein may include transcription control sequences. Transcription control sequences are sequences which control the initiation, elongation, and termination of transcription. Particularly important transcription
control sequences are those which control transcription initiation, such as promoter, enhancer, operator and repressor sequences. Suitable transcription control sequences include any transcription control sequence that can function in at least one of the recombinant cells disclosed herein. A variety of such transcription control sequences are known to those skilled in the art.
The vectors disclosed herein may also contain (a) secretory signals (i.e., signal segment nucleic acid sequences) to enable an expressed peptide to be secreted from the cell that produces the peptide and/or (b) fusion sequences which lead to the expression of peptides disclosed herein as fusion proteins. Examples of suitable signal segments include any signal segment capable of directing the secretion of a polypeptide of the present invention. The vectors may also include intervening and/or untranslated sequences surrounding and/or within the nucleic acid sequence(s) encoding the peptide disclosed herein.
The polynucleotide or vector can be expressed in a host cell in order to produce the peptide. The host cell can be any cell capable of producing the peptide disclosed herein. Suitable host cells can be readily identified by the skilled artisan, and include, for example, animal, plant, bacterial, fungal (including yeast), parasite, and arthropod cells. Preferably, the host cell is a bacterial cell. In one preferred embodiment, the host cell is an E. coli strain having the serotype H antigen, H10. Examples of suitable E. coli strains include CCEC22, CCEC31, and CCEC59 as described in WO 2007/025333.
Transformation of a polynucleotide into a host cell can be accomplished by any suitable method known in the art. Transformation techniques include, but are not limited to, transfection, electroporation, microinjection, lipofection, adsorption, and protoplast fusion. A recombinant cell may remain unicellular or may grow into a tissue, organ or a multicellular organism. Transformed polynucleotide molecules as disclosed herei can remain extrachromosomal or can integrate into one or more sites within a chromosome of the transformed (i.e., recombinant) cell in such a manner that their ability to be expressed is retained.
Suitable host cells to transform include any cell that can be transformed with a polynucleotide as disclosed herein. Host cells can be either endogenously (i.e., naturally) capable of producing polypeptides of the present invention or can be rendered capable of producing such polypeptides after being transformed with at least one polynucleotide molecule as disclosed herein.
Recombinant DNA technologies can be used to improve expression of a transformed polynucleotide molecule by manipulating, for example, the number of
copies of the polynucleotide molecule within a host cell, the efficiency with which those polynucleotide molecules are transcribed, the efficiency with which the resultant transcripts are translated, and the efficiency of post-translational modifications. Recombinant techniques useful for increasing the expression of polynucleotide molecules as disclosed herein include, but are not limited to, operatively linking polynucleotide molecules to high-copy number plasmids, integration of the polynucleotide molecule into one or more host cell chromosomes, addition of vector stability sequences to plasmids, substitutions or modifications of transcription control signals (e.g., promoters, operators, enhancers), substitutions or modifications of translational control signals (e.g., ribosome binding sites, Shine-Dalgarno sequences), modification of polynucleotide molecules as disclosed herein to correspond to the codon usage of the host cell, and the deletion of sequences that destabilize transcripts.
The host cell may be cultured under conditions effective to produce the peptide. Once expressed in the host cell, the peptide can be isolated by conventional methods known in the art. Thus, in one embodiment, an isolated peptide as described herein is produced by culturing a cell capable of expressing the peptide under conditions effective to produce the peptide, and isolating the peptide. Effective culture conditions include, but are not limited to, effective media, bioreactor, temperature, pH and oxygen conditions that permit polypeptide production. An effective medium refers to any medium in which a cell is cultured to produce a peptide as disclosed herein. Such medium typically comprises an aqueous medium having assimilable carbon, nitrogen and phosphate sources, and appropriate salts, minerals, metals and other nutrients, such as vitamins. Host cells can be cultured in conventional fermentation bioreactors, shake flasks, test tubes, microtiter dishes, and petri plates. Culturing can be carried out at a temperature, pH and oxygen content appropriate for a recombinant cell. Such culturing conditions are within the expertise of one of ordinary skill in the art.
Producing an Antibody
The peptide of SEQ ID NO: 2 can be used to produce an antibody which specifically binds apicomplexan actin. In addition, the polynucleotide encoding the peptide of SEQ ID NO: 2, the vector comprising said polynucleotide, or the host cell comprising said peptide, polynucleotide and or vector can also be used to produce an antibody which specifically binds apicomplexan actin. Similarly, the peptide of SEQ ID NO: 10 can also be used to produce an antibody which specifically binds apicomplexan actin. Thus the polynucleotide encoding the peptide of SEQ ID NO: 10, the vector comprising said polynucleotide, or the host cell comprising said peptide,
polynucleotide and/or vector can also be used to produce an antibody which specifically binds apicomplexan actin.
The peptide can be used alone, or can be used in combination with a carrier, such as an immunogenic carrier. Accordingly, the present disclosure provides a composition comprising the peptide of SEQ ID NO: 2 or SEQ ID NO: 10 and a carrier. In addition, the present disclosure provides a composition comprising a carrier and any one of the polynucleotide, the vector or the host cell as disclosed herein. The carrier may be an immunogenic carrier or adjuvant.
Methods for producing antibodies are known in the art, and any suitable method can be used to produce an antibody which specifically binds apicomplexan actin. For example, the methods of producing an antibody which specifically binds apicomplexan actin can include a step of immunizing an animal with the peptide of SEQ ID NO: 2 or SEQ ID NO: 10, the polynucleotide encoding said peptide, the vector comprising said polynucleotide, the host cell comprising said peptide, polynucleotide and/or vector, and the composition comprising a carrier and any one of the peptide, polynucleotide, vector and host cell. Any suitable animal can be immunized, for example, a mouse, rat, rabbit, and others.
The peptide may be administered in combination with an adjuvant. Adjuvants are useful for improving the immune response and/or increasing the stability of antigenic preparations. Adjuvants are typically described as non-specific stimulators of the immune system, but can also be useful for targeting specific arms of the immune system. One or more compounds which have this activity may be administered in combination with the peptide. Examples of chemical compounds that can be used as adjuvants include, but are not limited to aluminium compounds (e.g., aluminium hydroxide), metabolizable and non-metabolizable oils, mineral oils including mannide oleate derivatives in mineral oil solution (e.g., MONTANIDE ISA 70 from Seppic SA, France), and light mineral oils such as DRAKEOL 6VR, block polymers, ISCOM's (immune stimulating complexes), vitamins and minerals (including but not limited to: vitamin E, vitamin A, selenium, and vitamin B12) and CARBOPOL®.
Other suitable adjuvants, which sometimes have been referred to as immune stimulants, include, but are not limited to: cytokines, growth factors, chemokines, superaatants from cell cultures of lymphocytes, monocytes, cells from lymphoid organs, cell preparations and/or extracts from plants, bacteria or parasites (e.g.
Staphylococcus aureus or lipopoly saccharide preparations) or mitogens.
Generally, an adjuvant is administered at the same time as the peptide disclosed herein. However, adjuvants can also, or alternatively be administered within a two-
week period prior to administration of the peptide, and/or for a period of time after administration of the peptide, i.e., so long as the peptide antigen persists in the tissues.
Immunogenic compositions disclosed herein may include the peptides and nucleic acid molecules described herein, or immunogenic f agments thereof, and may be administered using any form of administration known in the art or described herein. In some embodiments, the immunogenic composition may include a live bacterial pathogen, a killed bacterial pathogen, or components thereof. Live bacterial pathogens, which may be administered in the form of an oral vaccine, may be attenuated so as to reduce the virulence of the bacterial pathogen, but not its induction of an immune response. A live vaccine may be capable of colonizing the intestines of the inoculated animal, e.g., avian.
In some embodiments, the peptides and nucleic acid molecules described herein may be administered to poultry, e.g., chicken, ducks, turkeys, etc., so as to elicit an immune response e.g., raise antibodies, in the poultry. Eggs, or products thereof, obtained from such poultry, that exhibit an immune response against the peptides and nucleic acid molecules described herein, or immunogenic fragments thereof, may be administered to an animal, e.g., humans, cattle, goats, sheep, etc., to elicit an immune response to the peptides and nucleic acid molecules in the animal. Methods of raising antibodies in poultry, and administering such antibodies, are described in for example, US 5,750,113 and US 6,730,822.
The immunogenic compositions disclosed herein may be administered as a liquid, emulsion, dried powder and/or in a mist through any parenteral route, intravenously, intraperitoneally, intradermally, by scarification, subcutaneously, intramuscularly, or inoculated by a mucosal route, e.g., orally, intranasally, as an aerosol, by eye drop, by in ovo administration, or implanted as a freeze dried powder.
The immunogenic compositions disclosed herein may further comprise a pharmaceutically acceptable carrier. A pharmaceutically acceptable carrier includes a veterinarily acceptable carrier. In a specific embodiment, the term "pharmaceutically acceptable" means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. The term "carrier" refers to a diluent, excipient, or vehicle with which the therapeutic is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like.
Anti-Apicomplexan Actin Antibody
The antibody or fragment thereof developed by the present inventors specifically binds a polypeptide comprising, more preferably consisting of, SEQ ID NO: 2. Thus, the antibody or fragment may bind to an epitope comprising or consisting of the amino acid sequence SYELPDGNIITVGN (SEQ ID NO: 2), or an epitope comprising or consisting of a fragment of the amino acid sequence KSYELPDGNIITVGN (SEQ ID NO: 2). For example, the antibody or fragment may bind to an epitope comprising or consisting of the amino acid sequence NIITV (SEQ ID NO: 10). Preferably, the antibody or fragment thereof does not detectably bind to an epitope comprising or consisting of the amino acid sequence DEEMKTSEQSSDI (SEQ ID NO: 9; corresponding to amino acid residues 225-237 of SEQ ID NO: 1 ).
As used herein, the term "specifically binds" shall be taken to mean that the antibody or fragment thereof reacts or associates more frequently, more rapidly, with greater duration and/or with greater affinity with a polypeptide comprising SEQ ID NO: 2 or SEQ ID NO: 10 than it does with another protein or epitope (e.g., with an epitope present on mammalian actin, more preferably human actin). For example, an antibody or fragment that specifically binds to SEQ ID NO: 2 or SEQ ID NO: 10 binds with greater affinity, avidity, more readily, and or with greater duration than it binds to a polypeptide comprising amino acids 237 to 251 of human actin as defined in SEQ ID NO: 3 and/or amino acids 237 to 251 of human mutant β actin as defined in SEQ ID NO: 4 and/or amino acids 245 to 249 of human mutant β actin as defined in SEQ ID NO: 11. In another example, the antibody or fragment binds to SEQ ID NO: 2 or SEQ ID NO: 10 with greater affinity, avidity, more readily, and/or with greater duration than it binds to mammalian actin, such as human actin. In this regard, the degree of greater affinity, avidity, more readily, and/or with greater duration will depend on the application of the antibody or fragment. For example, for detection/diagnostic/prognostic purposes the degree of specificity should be sufficiently high to permit quantification (where required). For therapeutic/prophylactic applications, the degree of specificity should be sufficient to provide a therapeutic/prophylactic effect without serious adverse effects resulting from cross- reactivity of the antibody or fragment. It is also to be understood by reading this definition that the term "specifically binds" does not necessarily require exclusive binding or non-detectable binding of another molecule, this is encompassed by the term "selective binding". Generally, but not necessarily, reference to binding means specific binding.
Preferably, the antibody or fragment thereof does not bind at a significant level to amino acids 237 to 251 of human actin as defined in SEQ ID NO: 3 and/or amino acids 237 to 251 of human mutant β actin as defined in SEQ ID NO: 4 and/or amino acids 245 to 249 of human mutant β actin as defined in SEQ ID NO: 11. In one example, the antibody or fragment does not bind at a significant level to mammalian actin, such as human actin. The level of binding to an alternative epitope is not significant if the binding to the apicomplexan actin epitope of the invention can be easily distinguished from the binding to an alternative epitope. More preferably, the antibody or fragment thereof binds to a polypeptide comprising SEQ ID NO: 2 or SEQ ID NO: 10 and does not detectably bind to amino acids 237 to 251 of human β actin as defined in SEQ ID NO: 3 and/or amino acids 237 to 251 of human mutant β actin as defined in SEQ ID NO: 4 and/or amino acids 245 to 249 of human mutant β actin as defined in SEQ ID NO: 11, e.g., as determined by a Western blot and/or FACS and/or ELISA and/or antibody panning. In one example, the antibody or fragment does not detectably bind mammalian actin, such as human actin. In another example, the antibody or fragment does not bind to amino acids 237 to 251 of human β actin as defined in SEQ ID NO: 3 and/or amino acids 237 to 251 of human mutant β actin as defined in SEQ ID NO: 4 and/or amino acids 245 to 249 of human mutant β actin as defined in SEQ ID NO: 11 to a significantly greater level than an isotype control antibody, e.g., as determined by a Western blot or FACS analysis.
As used herein, the term "does not detectably bind" shall be understood to mean that the antibody or fragment thereof does not bind to an antigen (such as a polypeptide comprising amino acids 237 to 251 of human β actin as defined in SEQ ID NO: 3 and/or amino acids 237 to 251 of human mutant β actin as defined in SEQ ID NO: 4, and/or amino acids 245 to 249 of human mutant β actin as defined in SEQ ID NO: 11 , and/or an epitope comprising or consisting of the amino acid sequence DEEMKTSEQSSDI (SEQ ID NO: 9)) at a level significantly greater than background, e.g., does not bind to the antigen at a level greater than 10%, or 8% or 6% or 5% above background. For example, the antibody or fragment thereof does not bind to the antigen at a level greater than 10% or 8% or 6% or 5% greater than an isotype control antibody. In one example, the binding is detected by Western blotting and/or FACS and/or ELISA and/or antibody panning (e.g., with antibody variable regions on the surface of a particle, such as a phage) and/or Biacore analysis.
It will be appreciated that the particular measurement of binding will depend on the method used to assess binding, and that the binding levels may vary depending on the experimental conditions used. Several different methods of determining the level of
binding of an antibody of fragment thereof to a particular epitope are known. For example, a variety of immunoassay formats (such as solid-phase ELISA immunoassays) are routinely used to select antibodies specifically immunoreactive with a protein or carbohydrate. See Harlow and Lane (1988) Antibodies, a Laboratory Manual, Cold Spring Harbor Publications, New York, for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity.
The antibodies disclosed herein may exist as intact immunoglobulins, or as modifications in a variety of forms including, for example, but not limited to, domain antibodies including either the VH or VL domain, a dimer of the heavy chain variable region (VHH, as described for a camelid), a dimer of the light chain variable region (VLL), FV fragments containing only the light and heavy chain variable regions, or Fd fragments containing the heavy chain variable region and the CHI domain. For example, the antibody may be a domain antibody including either the VH or VL domain of the monoclonal antibody 5H3; a dimer of the heavy chain variable region (VHH, as described for a camelid) of the monoclonal antibody 5H3; a dimer of the light chain variable region (VLL) of the monoclonal antibody 5H3; Fv fragments containing only the light and heavy chain variable regions of the monoclonal antibody 5H3; or Fd fragments containing the heavy chain variable region and the CHI domain of the monoclonal antibody 5H3.
A scFv consisting of the variable regions of the heavy and light chains linked together to form a single-chain antibody (Bird et al., 1988; Huston et al., 1988) and oligomers of scFvs such as diabodies and triabodies are also encompassed by the term "antibody". Thus, the antibody may be a scFv consisting of the variable regions of the heavy and light chains of the monoclonal antibody 5H3 linked together to form a single-chain antibody, or may be an oligomer thereof (such as a diabody or triabody).
Also encompassed are fragments of antibodies such as Fab, (Fab')2 and FabFc2 fragments which contain the variable regions and parts of the constant regions. Thus, the antibody may be a fragment such as a Fab, (Fab')2 and FabFc2 fragment containing the variable regions and parts of the constant regions of the monoclonal antibody 5H3.
CDR-grafted antibody fragments and oligomers of antibody fragments are also encompassed. For example, the antibody fragment or oligomers of antibody fragments may comprise any one or more of the CDRs present in the monoclonal antibody 5H3.
As used herein, the term "CDRs" refers to the amino acid residues of an antibody variable region the presence of which are major contributors to specific antigen binding. Each variable region domain (VH or VL) typically has three CDR
regions identified as CDR1, CDR2 and CDR3. In one example, the amino acid positions assigned to CDRs and framework regions (FRs) are defined according to Kabat (1987) and (1991) (also referred to herein as "the Kabat numbering system"). In another example, the amino acid positions assigned to CDRs and FRs are defined according to the Enhanced Chothia Numbering Scheme (http://www.bioinfo.org.uk/mdex.html). According to the numbering system of Kabat, VH FRs and CDRs are positioned as follows: residues 1-30 (FR1), 31-35 (CDR1), 36-49 (FR2), 50-65 (CDR2), 66-94 (FR3), 95-102 (CDR3) and 103- 113 (FR4). According to the numbering system of Kabat, VL FRs and CDRs are positioned as follows: residues 1-23 (FR1), 24-34 (CDR1), 35-49 (FR2), 50-56 (CDR2), 57-88 (FR3), 89-97 (CDR3) and 98-107 (FR4).
The present disclosure is not limited to FRs and CDRs as defined by the Kabat numbering system, but includes all numbering systems, including the canonical numbering system or of Chothia and Lesk (1987); Chothia et al., (1989); and/or Al- Lazikani et al., (1997); the numbering system of Honnegher and Pliikthun (2001); or the IMGT system discussed in Giudicelli et al., (1997). In one example, the CDRs are defined according to the Kabat numbering system. Optionally, heavy chain CDR2 according to the Kabat numbering system does not comprise the five C-terminal amino acids in the CDR2 sequence of the monoclonal antibody 5H3 or any one or more of those amino acids are substituted with another naturally-occurring amino acid. In an additional, or alternative, option, light chain CDR1 does not comprise the four N- terminal amino acids in the CDR1 sequence of the monoclonal antibody 5H3 or any one or more of those amino acids are substituted with another naturally-occurring amino acid. In this regard, Padlan et al., (1995) established that the five C-terminal amino acids of heavy chain CDR2 and/or the four N-terminal amino acids of light chain CDR1 are not generally involved in antigen binding.
Suitable methods for identifying CDRs within a given antibody (such as a monoclonal antibody) are well known in the art.
The amino acid sequence of the monoclonal antibody 5H3 can be determined by routine methods. For example, the encoding nucleotide sequence can be determined by routine methods (e.g., as described herein) and the amino acid sequence of the antibody can be deduced therefrom. The entire coding sequence may be determined. Alternatively, the nucleotide sequence encoding only the variable regions of the antibody may be determined. For example, primer sequences for the isolation of murine antibody variable region sequences are readily available in the art (e.g., as described in WO 2006/106331). In other examples, primer sequences for the isolation
of antibody variable region sequences from rat (see, e.g., WO 2006/106336), sheep (see, e.g., WO 2006/106341), pig (see, e.g., WO 2006 106339), and other species are readily available. Thus, CDRs from antibodies disclosed herein that are raised in rats, sheep, pigs and other species can also be determined. Once the amino acid sequence of the antibody is determined, the sequences of the CDRs can be determined as described above. The CDR sequences can be determined manually. Alternatively, publicly available software can be used to identify CDRs automatically.
The heavy and light chain components of an Fv may be derived from the same antibody (e.g., the monoclonal antibody 5H3) or different antibodies thereby producing a chimeric Fv region. The antibody may be of animal (for example mouse, rabbit or rat) or human origin or may be chimeric (Morrison et al., 1984) or humanized (Jones et al., 1986; published UK patent application No. 8707252). As used herein the term "antibody or fragment thereof includes these various forms. Using the guidelines provided herein and those methods well known to those skilled in the art which are described in the references cited above and in such publications as Harlow & Lane, Antibodies: a Laboratory Manual, Cold Spring Harbor Laboratory, (1988) the antibodies or fragments thereof for use in the methods of the present invention can be readily made.
The antibodies may be Fv regions comprising a variable light (VL) and a variable heavy (VH) chain. In one example, the VL and/or VH chains are those of the monoclonal antibody 5H3. The light and heavy chains may be joined directly or through a linker. As used herein a linker refers to a molecule that is covalently linked to the light and heavy chain and provides enough spacing and flexibility between the two chains such that they are able to achieve a conformation in which they are capable of specifically binding the epitope to which they are directed. Protein linkers are particularly preferred as they may be expressed as an intrinsic component of the Ig portion of the fusion polypeptide.
Polyclonal antibodies
The antibody disclosed herein may be a polyclonal antibody. Thus, the antibody may be comprised in antisera produced by immunisation of an animal with the peptide disclosed herein. Any animal may be immunized with the peptide disclosed herein in order to produce said antisera. In one embodiment, the antisera is rabbit antisera. Monoclonal antibodies
Alternatively, the antibody disclosed herein may be a monoclonal antibody. Monoclonal antibodies can be produced by methods known in the art. The general methodology for making monoclonal antibodies by hybridomas is well known. Immortal antibody-producing cell lines can be created by cell fusion, and also by other 5 techniques such as direct transformation of B lymphocytes with oncogenic DNA, or transfection with Epstein-Barr virus. Panels of monoclonal antibodies produced against the apicomplexan epitope disclosed herein can be screened for various properties; i.e. for isotype and epitope affinity.
The monoclonal antibody may, for example, be the monoclonal antibody 5H3.0 Animal-derived monoclonal antibodies can be used for both direct in vivo and extracorporeal immunotherapy. However, it has been observed that when, for example, mouse-derived monoclonal antibodies are used in humans as therapeutic agents, the patient produces human anti-mouse antibodies. Thus, animal-derived monoclonal antibodies are not preferred for therapy, especially for long term use. With established S genetic engineering techniques it is possible, however, to create chimeric or humanized antibodies that have animal-derived and human-derived portions. The animal can be, for example, a mouse or other rodent such as a rat.
If the variable region . of the chimeric antibody is, for example, mouse-derived while the constant region is human-derived, the chimeric antibody will generally be0 less immunogenic than a "pure" mouse-derived monoclonal antibody. These chimeric antibodies would likely be more suited for therapeutic use, should it turn out that "pure" mouse-derived antibodies are unsuitable. Thus, the chimeric antibody may comprise one or more variable regions of the monoclonal antibody 5H3 and a human-derived constant region.
5 Methodologies for generating chimeric antibodies are available to those in the art. For example, the light and heavy chains can be expressed separately, using, for example, immunoglobulin light chain and immunoglobulin heavy chains in separate plasmids. These can then be purified and assembled in vitro into complete antibodies; methodologies for accomplishing such assembly have been described (see, for0 example, Sun et al., 1986). Such a DNA construct may comprise DNA encoding functionally rearranged genes for the variable region of a light or heavy chain of an anti-apicomplexan actin antibody linked to DNA encoding a human constant region. Lymphoid cells such as myelomas or hybridomas transfected with the DNA constructs for light and heavy chain can express and assemble the antibody chains.
5 In vitro reaction parameters for the formation of IgG antibodies from reduced isolated light and heavy chains have also been described (see, for example, Beychok,
1979). Co-expression of light and heavy chains in the same cells to achieve intracellular association and linkage of heavy and light chains into complete H2L2 IgG antibodies is also possible. Such co-expression can be accomplished using either the same or different plasmids in the same host cell.
Humanising methodologies/techniques
In one embodiment disclosed herein, the anti-apicomplexan actin antibody is humanized, that is, an antibody produced by molecular modelling techniques wherein the human content of the antibody is maximised while causing little or no loss of binding affinity attributable to the variable region of, for example, a parental rat, rabbit or mouse antibody.
An antibody may be humanized by grafting the desired CDRs onto a human framework according to the method described in EP-A-0239400. For example, the CDRs may be selected from the monoclonal antibody 5H3. Preferably all 6 CDRs are selected. A DNA sequence encoding the desired reshaped antibody can be made beginning with the human DNA whose CDRs it is wished to reshape. The animal- derived variable domain amino acid sequence containing the desired CDRs (e.g., the CDRs of the monoclonal antibody 5H3) is compared to that of the chosen human antibody variable domain sequence. The residues in the human variable domain are marked that need to be changed to the corresponding residue in the animal to make the human variable region incorporate the animal-derived CDRs. There may also be residues that need substituting in, adding to or deleting from the human sequence.
Oligonucleotides are synthesized that can be used to mutagenize the human variable domain framework to contain the desired residues. Those oligonucleotides can be of any convenient size. One is normally only limited in length by the capabilities of the particular synthesizer one has available. The method of oligonucleotide-directed in vitro mutagenesis is well known.
Alternatively, humanisation may be achieved using the recombinant polymerase chain reaction (PCR) methodology of WO 92/07075. Using this methodology, a CDR (e.g., a CDR of the monoclonal antibody 5H3) may be spliced between the framework regions of a human antibody. In general, the technique of WO 92/07075 can be performed using a template comprising two human framework regions, AB and CD, and between them, the CDR which is to be replaced by a donor CDR. Primers A and B are used to amplify the framework region AB. and primers C and D used to amplify_tfie_ framework region CD. However, the primers B and C each also contain, at their 5' ends, an additional sequence corresponding to all or at least part of the donor CDR sequence. Primers B and C overlap by a length sufficient to permit annealing of their 5'
ends to each other under conditions which allow a PCR to be performed. Thus, the amplified regions AB and CD may undergo gene splicing by overlap extension to produce the humanized product in a single reaction.
Following the mutagenesis reactions to reshape the antibody, the mutagenised DNAs can be linked to an appropriate DNA encoding a light or heavy chain constant region, cloned into an expression vector, and transfected into host cells, preferably mammalian cells. These steps can be carried out in routine fashion. A reshaped antibody may therefore be prepared by a process comprising:
(a) preparing a first replicable expression vector including a suitable promoter operably linked to a DNA sequence which encodes at least a variable domain of an Ig heavy or light chain, the variable domain comprising framework regions from a human antibody and the CDRs required for the humanized antibody of the invention;
(b) preparing a second replicable expression vector including a suitable promoter operably linked to a DNA sequence which encodes at least the variable domain of a complementary Ig light or heavy chain respectively;
(c) transforming a cell line with the first or both prepared vectors; and
(d) culturing said transformed cell line to produce said altered antibody.
Preferably the DNA sequence in step (a) encodes both the variable domain and each constant domain of the human antibody chain. The humanized antibody can be prepared using any suitable recombinant expression system. The cell line which is transformed to produce the altered antibody may be a Chinese Hamster Ovary (CHO) cell line or an immortalised mammalian cell line, which is advantageously of lymphoid origin, such as a myeloma, hybridoma, trioma or quadroma cell line. The cell line may also comprise a normal lymphoid cell, such as a B-cell, which has been immortalised by transformation with a virus, such as the Epstein-Barr virus. Most preferably, the immortalised cell line is a myeloma cell line or a derivative thereof.
The CHO cells used for expression of the antibodies may be dihydrofolate reductase (dhfr) deficient and so dependent on thymidine and hypoxanthine for growth (Urlaub and Chasin, 1980). The parental dhfr' CHO cell line is transfected with the DNA encoding the antibody and dhfr gene which enables selection of CHO cell transformants of dhfr positive phenotype. Selection is carried out by culturing the colonies on media devoid of thymidine and hypoxanthine, the absence of which prevents untransformed cells from growing and transformed cells from resalvaging the folate pathway and thus bypassing the selection system. These transformants usually express low levels of the DNA of interest by virtue of co-integration of transfected DNA of interest and DNA encoding dhfr. The expression levels of the DNA encoding
the antibody may be increased by amplification using methotrexate (MTX). This drug is a direct inhibitor of the enzyme dhfr and allows isolation of resistant colonies which amplify their dhfr gene copy number sufficiently to survive under these conditions. Since the DNA sequences encoding dhfr and the antibody are closely linked in the original transformants, there is usually concomitant amplification, and therefore increased expression of the desired antibody.
Another preferred expression system for use with CHO or myeloma cells is the glutamine synthetase (GS) amplification system described in WO 87/04462. This system involves the transfection of a cell with DNA encoding the enzyme GS and with DNA encoding the desired antibody. Cells are then selected which grow in glutamine free medium and can thus be assumed to have integrated the DNA encoding GS. These selected clones are then subjected to inhibition of the enzyme GS using methionine sulphoximine (Msx). The cells, in order to survive, will amplify the DNA encoding GS with concomitant amplification of the DNA encoding the antibody.
Although the cell line used to produce the humanized antibody is preferably a mammalian cell line, any other suitable cell line, such as a bacterial cell line or a yeast cell line, may alternatively be used. In particular, it is envisaged that E. coli-denved bacterial strains could be used. The antibody obtained is checked for functionality. If functionality is lost, it is necessary to alter the framework of the antibody.
Once expressed, the whole antibodies, their dimers, individual light and heavy chains, or other immunoglobulin forms can be recovered and purified according to standard procedures of the art, including ammonium sulfate precipitation, affinity columns, column chromatography, gel electrophoresis and the like (See, generally, Scopes, R., Protein Purification, Springer- Verlag, N.Y. (1982)). Substantially pure immunoglobulins of at least about 90 to 95% homogeneity are preferred, and 98 to 99% or more homogeneity most preferred, for pharmaceutical uses. Once purified, partially or to homogeneity as desired, an antibody may then be used therapeutically or in developing and performing assay procedures, immunofluorescent stainings, and the like (See, generally, Immunological Methods, Vols. I and II, Lefkovits and Pernis, eds., Academic Press, New York, N.Y. (1979 and 1981)).
Antibodies with fully human variable regions against apicomplexan actin can also be prepared by administering the antigen to a transgenic animal which has been modified to produce such antibodies in response to antigenic challenge, but whose endogenous loci have been disabled. Various subsequent manipulations can be performed to obtain either antibodies per se or analogs thereof (see, for example, US Patent No. 6,075,181).
In one embodiment, the antibodies disclosed herein have the capacity for intracellular transmission. Antibodies which have the capacity for intracellular transmission include antibodies such as camelids and llama antibodies, shark antibodies (IgNARs), scFv antibodies, intrabodies or nanobodies, for example, scFv intrabodies and VHH intrabodies. Such antigen binding agents can be made as described by Harmsen and De Haard, (2007); Tibary et al., (2007); Muyldermans, (2001); and references cited therein. Yeast SPLINT antibody libraries are available for testing for intrabodies which are able to disrupt protein-protein interactions (see for example, Visintin et al., (2008) and Visintin et al, (2008)b for methods for their production). Accordingly, in one embodiment, scFv intrabodies which are able to interfere with a protein-protein interaction are used in the methods disclosed herein.
Polynucleotides encoding antibodies or fragments
Also disclosed herein is an isolated or recombinant polynucleotide sequence encoding the antibody or fragment thereof. The isolated or recombinant polynucleotide may encode both the heavy and light chains of the antibody, or any of the fragments described herein comprising portions of both the heavy and light chains. Alternatively, the isolated or recombinant polynucleotide may encode only a single heavy or light chain, or a fragment of only a single heavy or light chain. The polynucleotide may comprise DNA or RNA.
The polynucleotide encoding the antibody or fragment thereof may be isolated from a natural source by any known methods. Alternatively, a recombinant polynucleotide encoding the antibody or fragment thereof may be produced by any known method. For example, genes encoding antibodies, (both light and heavy chains or portions thereof, e.g., single chain Fv regions) may be cloned from a hybridoma cell line. They may all be cloned using the same general strategy. Typically, for example, poly(A) mPv A extracted from hybridoma cells is reverse transcribed using random hexamers as primers. For Fv regions, the VH and VL domains are amplified separately by two polymerase chain reactions (PCR). Heavy chain sequences may be amplified using 5' end primers which are designed according to the ammo-terminal protein sequences of the anti-apicomplexan actin antibody heavy chains respectively and 3' end primers according to consensus immunoglobulin constant region sequences (Kabat et al., Sequences of Proteins of Immunological Interest. 5th edition. U.S. Department of Health and Human Services, Public Health Service, National Institutes of Health, Bethesda, Md. (1991)). Light chain Fv regions are amplified using 5' end primers designed according to the amino-terminal protein sequences of anti- anti-apicomplexan
actin antibody light chains and in combination with the primer C-kappa. One of skill in the art would recognize that many suitable primers may be employed to obtain Fv regions.
The PCR products are subcloned into a suitable cloning vector. Clones containing the correct size insert by DNA restriction are identified. The nucleotide sequence of the heavy or light chain coding regions may then be determined from double stranded plasmid DNA using sequencing primers adjacent to the cloning site.
Commercially available kits (e.g., the Sequenase™ kit, United States Biochemical
Corp., Cleveland, Ohio, USA) may be used to facilitate sequencing the DNA. DNA encoding the Fv regions may be prepared by any suitable method, including, for example, amplification techniques such as PCR and LCR.
Chemical synthesis produces a single stranded oligonucleotide. This may be converted into double stranded DNA by hybridization with a complementary sequence, or by polymerization with a DNA polymerase using the single strand as a template. While it is possible to chemically synthesize an entire single chain Fv region, it is preferable to synthesize a number of shorter sequences (about 100 to 150 bases) that are later ligated together.
Alternatively, sub-sequences may be cloned and the appropriate subsequences cleaved using appropriate restriction enzymes. The fragments may then be ligated to produce the desired DNA sequence.
Once the Fv variable light and heavy chain DNA is obtained, the sequences may be ligated together, either directly or through a DNA sequence encoding a peptide linker, using techniques well known to those of skill in the art. In one embodiment, heavy and light chain regions are connected by a flexible peptide linker (e.g., (Gly4Ser3) which starts at the carboxyl end of the heavy chain Fv domain and ends at the amino terminus of the light chain Fv domain. The entire sequence encodes the Fv domain in the form of a single-chain antigen binding protein.
The polynucleotide encoding the antibody or fragment as disclosed herein may be used to produce the antibody or fragment. Thus, the present disclosure provides a method of producing an antibody or fragment which specifically binds apicomplexan actin, the method comprising expressing a polynucleotide encoding the antibody or fragment in a host cell. The polynucleotide may be incorporated into a vector in order to_ faciUtate_expra
comprising a polynucleotide encoding the antibody or fragment described herein. In addition, the present disclosure provides a host cell comprising said polynucleotide
and/or said vector. Suitable vectors and host cells can be selected by the person skilled in the art.
It will be appreciated from the description of the different ways in which an antibody can be produced that the antibody or fragment disclosed herein can be an isolated or recombinant antibody or fragment.
The antibody or fragment thereof as disclosed herein may be detectably labelled. Suitable labels include radioisotopes, or non-radioactive labels such as biotin, enzymes, chemiluminescent molecules, fluorophores, dye markers or other imaging reagents for detection and/or localisation of target molecules. Alternatively, a second labelled antibody or avidin (for example) which binds the compound can be used for detection. The detectable label may be conjugated to the antibody or fragment by any suitable means known in the art. Labelling the antibody or fragment may be particularly useful in screening and therapeutic applications. Screening Methods
The antibody or fragment disclosed herein can be used to identify agents that bind to apicomplexan actin. As used herein, the term "apicomplexan actin" is intended to mean any isoform of actin, in either globular or filamentous form, derived from any apicomplexan species. The methods may comprise:
i) contacting the antibody or fragment disclosed herein with a polypeptide comprising SEQ ID NO: 2 or SEQ ID NO: 10 in the presence of a candidate agent; and ii) identifying the candidate agent as an agent which binds apicomplexan actin if the binding of the antibody or fragment to the polypeptide comprising SEQ ID NO: 2 or SEQ ID NO: 10 is reduced in the presence of the candidate agent.
The reduction in binding may be determined by comparison with the level of binding of the antibody or fragment disclosed herein with a polypeptide comprising SEQ ID NO: 2 or SEQ ID NO: 10 in the absence of a candidate agent. This "reference level" can be predetermined. Alternatively, the methods may comprise a step of determining the reference level. Thus, the methods may further comprise contacting the antibody or fragment disclosed herein with a polypeptide comprising SEQ ID NO: 2 or SEQ ID. NO: 10 in the absence of a candidate agent; and identifying the candidate agent as an agent which binds apicomplexan actin if the binding of the antibody or fragment to the polypeptide comprising SEQ ID NO: 2 or SEQ ID NO: 10 is reduced in the presence of the candidate agent compared to the absence of the candidate agent.
It will be appreciated that the candidate agent need not completely inhibit the binding of the antibody or fragment disclosed herein to a polypeptide comprising SEQ
ID NO: 2 or SEQ ID NO: 10, rather it need only reduce binding. For example, the candidate agent may reduce the binding by a statistically significant amount, for example, by at least about 10% or 20% or 30% or 40% or 50% or 60% or 70% or 80% or 90% or 95%. Preferably, the candidate agent reduces binding of the antibody or fragment disclosed herein by at least about 30%, more preferably by at least about 50%, more preferably, by at least about 70%, still more preferably by at least about 75%, even more preferably, by at least about 80% or 85% and even more preferably, by at least about 90%.
Thus, the present disclosure provides methods of determining whether a candidate agent competitively inhibits the binding of an antibody or fragment disclosed herein to a polypeptide comprising SEQ ID NO: 2 or SEQ ID NO: 10.
The specificity of the candidate agent for apicomplexan actin may be determined by determining the level of binding of the candidate agent to a suitable control polypeptide. The control polypeptide may be, for example, a polypeptide which does not comprise an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10. Any suitable control polypeptide may be used. In one example, the control polypeptide is a polypeptide comprising amino acids 237 to 251 of human β-actin as defined in SEQ ID NO: 3 or a polypeptide comprising amino acids 237 to 251 of mutant human β-actin as defined in SEQ ID NO: 4 or amino acids 245 to 249 of human mutant β actin as defined in SEQ ID NO: 11. In another example, the control polypeptide is mammalian actin. Thus, the methods may further comprise contacting the candidate agent with a control polypeptide (for example, a polypeptide which does not comprise an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10); and identifying the agent as an agent which specifically binds apicomplexan actin if the agent reduces the binding of the antibody or fragment to the polypeptide comprising SEQ ID NO: 2 or SEQ ID NO: 10 and does not detectably bind to the control polypeptide (for example, the polypeptide which does not comprise an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10).
Alternatively, the screening methods may simply involve determining whether a candidate agent binds to the apicomplexan-specific actin epitope. Thus, the screening method may comprise:
i) contacting the peptide of SEQ ID NO: 2 or SEQ ID NO: 10 with a candidate agent; and
ii) identifying the agent as an agent which binds apicomplexan actin if the agent binds to the peptide of SEQ ID NO: 2 or SEQ ID NO: 10.
The level of binding of the candidate agent to the peptide of SEQ ID NO: 2 or SEQ ID NO: 10 may be compared to the level of binding of the candidate agent to a suitable control polypeptide. The control polypeptide may be, for example, a polypeptide which does not comprise an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10. Any suitable control polypeptide may be used. In one example, the control polypeptide is a polypeptide comprising amino acids 237 to 251 of human β-actin as defined in SEQ ID NO: 3 or a polypeptide comprising amino acids 237 to 251 of mutant human β-actin as defined in SEQ ID NO: 4 or a polypeptide comprising amino acids 245 to 249 of human mutant β actin as defined in SEQ ID NO: 11. In another example, the control polypeptide is mammalian actin.
The level of binding of the candidate agent to a control polypeptide may be predetermined. Alternatively, the method disclosed herein may further comprise contacting the candidate agent with a control polypeptide (for example, a polypeptide which does not comprise an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10); and identifying the agent as an agent which specifically binds apicomplexan actin if the agent binds to the peptide of SEQ ID NO: 2 or SEQ ID NO: 10 and does not detectably bind to the control polypeptide (for example, the polypeptide which does not comprise an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10).
In addition, the antibody or fragment thereof can be detectably labelled and used simply to identify apicomplexan actin, in globular or filamentous form, in any screening method intended to identify an agent which disrupts normal actin processing (e.g., which inhibits/stabilises the formation of apicomplexan actin filaments).
The apicomplexan actin may be produced by a method including a step of expressing the endogenous P. falciparum actin gene (whose sequence is set out in SEQ ID NO: 8). Alternatively, the apicomplexan actin may be produced by a method including a step of expressing a codon optimised sequence encoding P. falciparum actin, whose sequence has been modified from the sequence of the endogenous P. falciparum actin gene in order to result in enhanced expression of the actin protein. One example of such a codon optimised sequence is set out in SEQ ID NO: 7. Thus, the screening methods may further comprise a step of producing apicomplexan actin. In addition, where the screening methods comprise the use of the peptide of SEQ ID NO: 2, the screening methods may comprise a step of producing apicomplexan actin by any of the methods described herein and a step of producing the peptide of SEQ ID^ NO: 2 from the apicomplexan actin protein.
In any of the screening assays disclosed herein, any one or more of the candidate agent, the antibody or fragment, the polypeptide comprising SEQ ID NO: 2 or SEQ ID
NO: 10 and the peptide of SEQ ID NO: 2 or SEQ ID NO: 10 may be detectably labelled. Any suitable label can be used, depending on the particular screening assay. In one example, the label is a fluorophore.
The term "candidate agent" is intended to mean an agent to be evaluated for its ability to bind to apicomplexan actin. Candidate agents may include, for example, small molecules, peptides or mimetics thereof, polypeptides, antibodies, nucleic acid molecules such as aptamers, peptide nucleic acid molecules, and components and derivatives thereof.
The candidate agent may be any suitable compound, synthetic or naturally occurring. The compounds may encompass numerous chemical classes though typically they are organic molecules, preferably small organic compounds. In one embodiment, a synthetic compound identified or designed by the methods of the invention has a molecular weight equal to or less than about 5000, 4000, 3000, 2000, 1000 or 500 daltons. The candidate agent is preferably soluble under physiological conditions.
Such compounds can comprise functional groups necessary for structural interaction with proteins, for example hydrogen bonding, and may include at least an amine, carbonyl, hydroxyl or carboxyl group, or at least two of the functional chemical groups. The compound may comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups. Compounds can also comprise biomolecules including proteins, peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs, or combinations thereof.
Candidate compounds can be obtained from a wide variety of sources including libraries of synthetic or natural compounds. Synthetic compound libraries are commercially available from, for example, Maybridge Chemical Co. (Tintagel, Cornwall, UK), AMRI (Budapest, Hungary) and ChemDiv (San Diego, CA), Specs (Delft, The Netherlands).
Natural compound libraries comprising bacterial, fungal, plant or animal extracts are available from, for example, Pan Laboratories (Bothell, WA), TimTec (Newark, DE). In addition, numerous means are available for random and directed synthesis of a wide variety of organic compounds.
Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts can be readily produced. Methods for the synthesis of molecular libraries are readily available (see, for example, DeWitt et al., 1993; Erb et al., 1994; Zuckermann et al., 1994; Cho et al., 1993; and Gallop et al., 1994). In
addition, natural or synthetic compound libraries and compounds can be readily modified through conventional chemical, physical and biochemical means (see, for example, Blondelle and Houghton, 1996), and may be used to produce combinatorial libraries. In another approach, previously identified pharmacological agents can be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification, and the analogs can be screened for a desired activity.
A combinatorial chemical library is a collection of diverse chemical compounds generated by either chemical synthesis or biological synthesis by combining a number of chemical "building blocks" such as reagents. Millions of chemical compounds can be synthesized through such combinatorial mixing of chemical building blocks (Gallop et al., 1994). Preparation and screening of combinatorial chemical libraries is well known to those of skill in the art. Such combinatorial chemical libraries include, but are not limited to, small organic molecule libraries and carbohydrate libraries.
Compounds also include those that may be synthesized from leads generated by computational techniques applied to predict the three dimensional structure of the apicomplexan actin epitope and to predict the three dimensional structure of compounds that may specifically bind this epitope.
The candidate agent may be selected from a library of agents which have been shown to have some therapeutic activity. For example, the candidate agent may be selected from a library of agents which have been shown to have low cytotoxicity in humans, and/or generic anti-malarial activity.
The screening methods disclosed herein may be high throughput screening methods. Conventionally, new chemical entities with useful properties are generated by identifying a chemical compound (called a "lead compound") with some desirable property or activity, for example, binding to apicomplexan actin, creating variants of the lead compound, and evaluating the property and activity of those variant compounds. Often, high throughput screening (HTS) methods are employed for such an analysis. Of course, HTS methods can be applied using candidate agents without first identifying a lead compound.
In one embodiment, HTS methods involve providing a library containing a large number of candidate compounds. Such "combinatorial chemical libraries" are then screened in one or more assays to identify those library members (particular chemical species or subclasses) that display a desired characteristic activity, such as binding to the apicomplexan actin epitope set out in SEQ ID NO: 2 or SEQ ID NO: 10. The compounds identified can serve as conventional lead compounds or can be used as potential or actual therapeutics.
High throughput screening systems are commercially available and typically automate entire procedures, including all sample and reagent pipetting, liquid dispensing, timed incubations, and final readings of the microplate in detectors appropriate for the assay. These configurable systems provide high throughput and rapid start up as well as a high degree of flexibility and customization. The manufacturers of such systems provide detailed protocols for various high throughput systems. Thus, for example, Zymark Corp. provides technical bulletins describing screening systems for detecting the modulation of gene transcription, ligarid binding, and the like.
The level of binding of the antibody or fragment, or the candidate agent, to the epitope defined by SEQ ID NO: 2 or SEQ ID NO: 10 (or to a control polypeptide) may be determined by any suitable method known in the art. Examples of such methods include fluorescence resonance energy transfer (FRET) (also known as Forster resonance energy transfer), bioluminescence resonance energy transfer (BRET), competition binding assays, yeast-2-hybrid screening, Surface Plasmon Resonance, high-resolution NMR, phage display, affinity chromatography, Isothermal Titration Calorimetry (ITC), immunoprecipitation and GST pull downs coupled with mass spectroscopy, fluorescence polarization (FP), Amplified Luminescent Proximity Homogenous Assay (ALPHASCREEN™), and others. Thus, the screening methods disclosed herein may comprise determining a candidate agent's ability to reduce, inhibit or disrupt the binding of an antibody disclosed herein (for example, the monoclonal antibody 5H3) to a polypeptide comprising or consisting of SEQ ID NO: 2 or SEQ ID NO: 10, or may comprise determining a candidate agent's ability to bind to a polypeptide comprising or consisting of SEQ ID NO: 2 or SEQ ID NO: 10, by any one or more of FRET, BRET, a competition binding assay, yeast-2-hybrid screening, Surface Plasmon Resonance, high-resolution NMR, phage display, affinity chromatography, Isothermal Titration Calorimetry (ITC), immunoprecipitation and GST pull downs coupled with mass spectroscopy, FP, ALPHASCREEN™, and others.
FRET assays may comprise conjugating a donor or acceptor chromophore to any one of the polypeptide comprising SEQ ID NO:2 or SEQ ID NO: 10 (or the peptide consisting of SEQ ID NO: 2 or SEQ ID NO: 10), the candidate agent, and the antibody or fragment which binds the apicomplexan epitope set out in SEQ ID NO: 2 or SEQ ID NO: 10 (e.g., the monoclonal antibody 5H3), in any suitable combination. _ For example, a donor chromophore can be conjugated to the antibody or fragment disclosed herein, and an acceptor chromophore can be conjugated to the polypeptide comprising SEQ ID NO: 2 (or peptide consisting of SEQ ID NO: 2). When the antibody or
fragment is bound to the epitope so that the donor and acceptor chromophores are brought into close proximity with each other, the wavelength of the acceptor chromophore will predominantly be detected upon excitation of the donor chromophore. When the antibody-peptide binding is inhibited and the donor and acceptor chromophores are no longer in close proximity of each other, the wavelength of the donor chromophore will predominantly be detected upon excitation of the donor chromophore. Alternative configurations of donor/acceptor chromophores conjugated to the different binding agents in the FRET assays disclosed herein will be readily understood by the person skilled in the art. Similarly, the person skilled in the art will understand that the donor and acceptor components of BRET . assays can be provided in the same configurations.
Surface Plasmon Resonance (SPR) or Biomolecular Interaction Analysis (BIA; e.g., Biacore) can be used to detect biospecific interactions in real time, without labeling any of the interactants. Changes in the mass at the binding surface (indicative of a binding event) of the BIA chip result in alterations of the refractive index of light near the surface. The changes in the refractivity generate a detectable signal, which are measured as an indication of real-time reactions between biological molecules.
Standard solid-phase ELISA assay formats are also useful for identifying antagonists of protein-protein interaction. In accordance with this embodiment, one of the binding partners, for example, the polypeptide comprising SEQ ID NO:2 (or the peptide consisting of SEQ ID NO: 2), or the antibody or fragment thereof (e.g., the monoclonal antibody 5H3) can be immobilized on a solid support, such as, for example an array of polymeric pins or a glass support. Conveniently, the immobilized binding partner may be a fusion polypeptide comprising, for example, Glutathione-S- transferase, wherein the GST moiety facilitates immobilization of the protein to the solid phase support. The second binding partner (for example, the antibody or fragment thereof disclosed herein, or alternatively, the polypeptide comprising or consisting of SEQ ID NO: 2) in solution is brought into physical relation with the immobilized protein to form a protein complex in the presence of a candidate compound, which complex is then detected by methods known in the art. If a candidate compound is capable of inhibiting antibody binding to the peptide comprising SEQ ID NO: 2, this will be identified by a reduction in the formation of the polypeptide complex when compared to the same assay conditions in the absence of the candidate compound.
Fluorescence Polarization (FP) can also be used to investigate molecular interactions between a candidate agent and a polypeptide comprising SEQ ID NO: 2 or SEQ ID NO: 10 (or the peptide consisting of SEQ ID NO: 2 or SEQ ID NO: 10). FP
provides a direct, almost instantaneous quantification of a fluorescent tracer's bound/free ratio. FP relies on polarized light exciting a fluorophore-labelled small assay component (e.g., a polypeptide comprising or consisting of SEQ ID NO: 2 or SEQ ID NO: 10 conjugated to a fluorophore). The intensity of emitted light can be monitored in two different planes, with the degree of movement of emission intensity from one plane to the other plane being related to the mobility of the fluorophore bound to the small assay component. If a larger binding partner (e.g., the antibody as disclosed herein, and in a particular example, the monoclonal antibody 5H3) binds to the fluorophore-labelled small assay component, the complex formed will be relatively large, and little movement of the complex will occur during excitation, with the emitted light being highly polarized. Therefore, this assay can be used to determine if a candidate agent is able to disrupt the binding interaction between the antibody disclosed herein (and in one particular example, the monoclonal antibody SH3) and the polypeptide comprising or consisting of SEQ ID NO: 2 or SEQ ID NO: 10, by quantifying the amount of light emitted in two planes in the presence, compared to the absence of the candidate agent. Any suitable fluorophore can be used in such an FP assay, as will be appreciated by a person skilled in the art.
Amplified Luminescent Proximity Homogenous Assay (ALPHASCREEN™) is another assay which can be used to determine a candidate agent's ability to bind to a polypeptide comprising or consisting of SEQ ID NO: 2 or SEQ ID NO: 10, or to disrupt the binding of an antibody disclosed herein (e.g., the monoclonal antibody 5H3) to a polypeptide comprising or consisting of SEQ ID NO: 2 or SEQ ID NO: 10. The assay comprises two hydrogel coated beads which, when brought into close proximity by a binding interaction, allow the transfer of singlet oxygen from a donor bead to an acceptor bead. Thus, any one or more of the antibody disclosed herein (e.g., the monoclonal antibody 5H3), the polypeptide comprising or consisting of SEQ ID NO: 2 or SEQ ID NO: 10, and the candidate agent can be conjugated to a donor bead or an acceptor bead. If the donor and acceptor beads are in close proximity excitation with laser light at 680 nm causes a photosensitiser in the donor bead to convert ambient oxygen to a more excited singlet state. This singlet oxygen then diffuses up to 200nm to react with a chemiluminescer in the acceptor bead, if the acceptor bead is within 200nm. Fluorophores within the same bead are activated, resulting in the emission of light at 580-620 nm.
In any of the screening methods described herein, the concentration of the candidate agent can be varied in order to determine whether that candidate agent has a dose-dependent effect on the binding interaction between the antibody disclosed herein
(for example, the monoclonal antibody SH3) and the polypeptide comprising or consisting of SEQ ID NO: 2 or SEQ ID NO: 10.
The skilled person will understand that when performing an assay to identify an agent capable of binding apicomplexan actin, the apicomplexan actin epitope identified in SEQ ID NO: 2 may be represented either as a short 15 amino acid peptide or as a longer polypeptide comprising the epitope sequence. For example, the longer polypeptide may be the P. falciparum protein. In one example, SEQ ID NO: 1 can be used. Alternatively, fragments of the peptide identified in SEQ ID NO: 2 can also be used, such as the peptide of SEQ ID NO: 10.
Determining the Specificity of a Binding Agent
The specificity of a binding agent for apicomplexan actin can be validated by further determining whether the agent binds to a polypeptide comprising amino acids 237 to 251 of human β actin as defined in SEQ ID NO: 3 and/or amino acids 237 to 251 of human mutant β actin as defined in SEQ ID NO: 4 and or amino acids 245 to 249 of human mutant β actin as defined in SEQ ID NO: 11. This validation may comprise determining whether the agent is able to bind mammalian actin, e.g. human actin.
Any of the methods described herein as being suitable for determining the level of binding of a candidate agent to apicomplexan actin can be used to perform this further validation process. Thus, the human actin epitope defined by amino acids 237 to 251 of human β actin as defined in SEQ ID NO: 3, or amino acids 237 to 251 of human mutant β actin as defined in SEQ ID NO: 4, or amino acids 245 to 249 of human mutant β actin as defined in SEQ ID NO: 11, or a human actin polypeptide or fragment thereof, can replace the epitope defined by SEQ ID NO: 2 in any of the assays mentioned above. When a candidate agent binds to the apicomplexan actin epitope but does not detectably bind to a human actin epitope, that agent is specific for apicomplexan actin and shows therapeutic potential. Actin Polymerization Assays
The therapeutic potential of an agent shown to bind the peptide of SEQ ID NO: 2 or SEQ ID NO: 10 can be further investigated by determining whether the agent is able to disrupt normal actin processing as occurs in an apicomplexan parasite. For example, the ability of an agent to inhibit, disrupt or stabilise actin polymerization can be determined.
Suitable actin polymerization assays are known in the art. For example, gel- based assays may be performed in which centrifugation is used to remove actin filaments from a solution. Due to their greater size, actin filaments can readily be removed from solution by centrifugation, forming a dense actin filament pellet. If the addition of a candidate agent to the solution reduces the amount of actin removed from the solution by centrifugation, that agent will have been shown to inhibit actin polymerization. Alternatively, if the addition of a candidate agent to the solution increases the amount of actin removed from the solution by centrifugation, that agent may have been shown to stabilise actin filaments. A particular example of a suitable actin polymerization assa is the Pyrene- Actin assay, wherein a proportion of actin is labelled with Pyrene, which increases in fluorescence when actin polymerizes. This assay platform permits high throughput screening of actin polymerization potential in the presence or absence of many candidate agents. Other suitable high-throughput screening methods can be used.
Thus, the methods disclosed herein may further comprise a step of determining the level of actin filament formation in a system in which actin polymerization can occur, both in the presence and in the absence of a candidate agent. The candidate agent may be identified as an agent capable of preventing, inhibiting, or disrupting actin polymerization if the level of actin filament formation is reduced in the presence, compared to the absence of the candidate agent. Alternatively, the candidate agent may be identified as an agent capable of stabilising actin filaments if the level of actin filament formation is increased in the presence, compared to the absence of the candidate agent. The system in which actin polymerization can occur can be a cell-free solution or can comprise a host cell such as an apicomplexan cell. The determination of the level of actin filament formation can comprise centrifuging the components of the system to determine the amount of actin filaments which pellet during centrifuging.
The methods of determining whether a candidate agent is able to disrupt normal actin processing may comprise a step of producing apicomplexan actin by any of the methods described herein. For example, the methods may comprise a step of producing apicomplexan actin by expressing the endogenous P. falciparum actin gene (whose sequence is set out in SEQ ID NO: 8). Alternatively, the apicomplexan actin may be produced by expressing a codon optimised sequence encoding P. falciparum actin, whose sequence has been modified from the sequence of the endogenous P. falciparum actin gene in order to result in enhanced expression of the actin protein. One example of such a codon optimised sequence is set out in SEQ ID NO: 7.
Apicomplexan Motility Assays
The therapeutic potential of an agent shown to bind the peptide of SEQ ID NO: 2 can also be investigated by determining the agent's ability to inhibit apicomplexan parasite motility in vivo. Suitable assays are known in the art, and include, for example, Toxoplasma gliding assays on a solid medium such as a coverslip (e.g. as set out in Hakansson et al., 1999), sporozoite motility assays on a solid medium such as a coverslip (e.g. as set out in Hegge et al., 2009), ookinete motility through a matrigel (e.g. as set out in Moon et al., 2009), merozoite erythrocyte invasion assays (e.g. as set out in Boyle et al., 2010), and others. Thus, the present disclosure also provides methods of determining a candidate agent's ability to disrupt, inhibit, or prevent apicomplexan motility, the methods comprising administering the candidate agent to an apicomplexan parasite and determining whether the candidate agent inhibits the apicomplexan parasite's motility. The person skilled in the art will appreciate that many such methods exist.
In one example, the methods for determining apicomplexan motility comprise determining the ability of an apicomplexan ookinete expressing green fluorescent protein (GFP) to move though a three dimensional matrigel. For example, P. falciparum or P. berghei ookinetes expressing GFP can be placed on the surface of a matrigel pre-loaded with a candidate agent. The matrigel can be arranged in a flat, clear-bottomed imaging plate, enabling fluorescent imaging within a focal plane at low magnification/low fluorescence intensity (thereby retaining cell viability), either at a given time after initiation of the assay, or continuously during the assay. Ookinetes that retain their normal motility are able to migrate through the matrigel to reach the focal plane. Ookinetes whose motility is inhibited by the candidate agent will have a reduced ability to migrate through the matrigel to reach the focal plane, thereby identifying that candidate agent as one capable of inhibiting apicomplexan motility. Imaging analysis software can be used to analyse the fluorescent image output. For example, the proportion of ookinetes that reach the focal plane relative to untreated control assays can be calculated. The quantities of parasite-infected culture medium applied to the matrigel can be varied as desired. In one example, 20 μΐ of parasite- infected culture is applied to 10 μΐ of candidate agent-loaded matrigel. The dose of candidate agent can also be varied to verify a dose dependent inhibitory effect. This assay can be readily automated, lending itself to be particularly useful as a high throughput assay. It will be appreciated that other methods for determining apicomplexan motility can be used.
Merozoite Invasion Assays
The therapeutic potential of an agent shown to bind the peptide of SEQ ID NO: 2 or SEQ ID NO: 10 can be further investigated by determining the agent's ability to inhibit apicomplexan merozoite invasion of mammalian (preferably human) red blood cells (RBCs). Suitable merozoite invasion assays are known in the art. One example of a suitable assay is provided in WO 2011/000032 (and in particular, in Examples 8 and 9 of WO 2011/000032). Other merozoite invasion assays are known in the art. In any such merozoite invasion assay, the antibody or fragment thereof as disclosed herein (e.g., the monoclonal antibody 5H3) can be detectably labelled and used to identify apicomplexan actin, in globular or filamentous form.
Intra-cellular Development Assays
The ability of a candidate agent identified using any of the screening methods described herein to inhibit apicomplexan motility specifically can be determined by investigating the candidate agent's propensity to inhibit intra-cellular development of an apicomplexan parasite, post host-cell invasion. In one example, the assay comprises determining a candidate agent's propensity to inhibit blood stage development of a malaria parasite. Since intra-cellular development does not require apicomplexan motility, motility-specific agents would not affect (e.g., inhibit/impede) intra-cellular development. Suitable assays are known in the art. For example, Guiguemde et al., (2010) describes one such assay for screening malaria parasite intra-erythrocytic development Other assays are known in the art.
Therapeutic Methods
An agent identified by the screening methods described above can be used as a therapeutic to inhibit actin dynamics in apicomplexan parasites. The inhibition of actin dynamics may comprise inhibiting or disrupting actin polymerization, or stabilising actin filaments formed by actin polymerization. Inhibition of normal actin processing in the apicomplexan cell can disrupt parasite motility, nuclear gene regulation and haemoglobin uptake, all of which are essential to parasite survival. Accordingly, an agent that can disrupt apicomplexan actin dynamics could be a powerful therapeutic.
In addition, the antibody or fragment disclosed herein, which specifically binds apicomplexan actin, may be used as a therapeutic to inhibit actin dynamics in apicomplexan parasites. The antibody or fragment itself may inhibit actin dynamics in apicomplexan parasites. Alternatively, the antibody or fragment may be conjugated to an agent known to disrupt actin dynamics and/or which have a deleterious effect on the
parasite such as a toxin. Suitable methods of conjugating the antibody or fragment to such an agent will be understood by the person skilled in the art The specific binding properties of the antibody or fragment allow targeted delivery of such an agent to apicomplexan cells.
The agent or antibody or fragment may be prepared for delivery to a subject by combining the agent or antibody or fragment with a carrier. Thus, the present disclosure provides a composition comprising the agent or antibody or fragment and a carrier. Preferably, the carrier is a pharmaceutically acceptable carrier.
The carrier may facilitate intracellular delivery of the agent or antibody or fragment into apicomplexan cells. Suitable carriers will be known to the person skilled in the art, and include, for example, liposomes, microspheres, nanospheres, and others. The carriers may comprise one or more targeting molecules which bind to surface molecules present on the target apicomplexan cell.
In another embodiment, the agent or antibody or fragment is conjugated to a cell penetrating agent so as to deliver the agent or antibody or fragment into the intracellular region of an apicomplexan parasite. The cell penetrating agent may be a peptide. Cell penetrating peptides include Tat peptides, Penetratin, short amphipathic peptides such as those from the Pep-and MPG-families, oligoarginine and oligolysine. In one example, the cell penetrating peptide is also conjugated to a lipid (C6-C18 fatty acid) domain to improve intracellular delivery (Koppelhus et al., 2008). Examples of cell penetrating peptides can be found in Howl et al. (2007) and in Deshayes et al. (2008). In one embodiment, the antibodies and/or agents comprise a cell-penetrating peptide sequence or nuclear-localizing peptide sequence such as those disclosed in Constantini et al. (2008). Also useful for in vivo delivery are Vectocell or Diato peptide vectors such as those disclosed in De Coupade et al. (2005) and Meyer-Losic et al. (2006). Thus, the present disclosure also provides the therapeutic use of antibodies conjugated via a covalent bond (e.g. a peptide bond), at optionally the N-terminus or the C-terminus, to a cell-penetrating peptide sequence.
Alternatively, the agent and/or antibody or fragment may itself be able to penetrate apicomplexan cells. For example, the agent or antibody or fragment may be small enough to be transported across the apicomplexan cell membrane.
Apicomplexan Diseases
The agent, antibody or fragment, or composition comprising the agent or antibody or fragment can be used to treat a disease caused by an apicomplexan parasite. The disease may be caused by any parasite within the apicomplexan phylum. For
example, the disease may be caused by an apicomplexan parasite of the genus Plasmodium (such as Plasmodium falciparum, Plasmodium malar iae, Plasmodium ovale and Plasmodium vivax), Babesia, Cryptosporidium, Isospora, Cyclospora, Sarcocystis, Toxoplasma, Theileria, Eimeria and others.
Diseases which may be treated include, for example, malaria, babesiosis, coccidian diseases such as cryptosporidiosis, cyclosporiasis, isosporiasis, toxoplasmosis and other coccidian diseases, and other apicomplexan diseases. Preferably, the disease is malaria. Pharmaceutical Compositions. Dosages, and Routes of Administration
Therapeutic compositions Can be prepared by mixing the desired compounds having the appropriate degree of purity with optional pharmaceutically acceptable carriers, excipients, or stabilizers (Remington's Pharmaceutical Sciences, 16th edition, Osol, A. ed. (1980)), in the form of lyophilized formulations, aqueous solutions or aqueous suspensions. Acceptable carriers, excipients, or stabilizers are preferably nontoxic to recipients at the dosages and concentrations employed, and include buffers such as Tris, HEPES, PIPES, phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m- cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counter-ions such as sodium; and/or non-ionic surfactants such as TWEEN™, PLURONICS™ or polyethylene glycol (PEG). Additional examples of such carriers include ion exchangers, alumina, aluminum stearate, lecithin, serum proteins, such as human serum albumin, buffer substances such as glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts, or electrolytes such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, colloidal silica, magnesium trisilicate. polyvinyl pyrrolidone, and cellulose-based substances.
A pharmaceutical composition as disclosed herein is formulated to be compatible with its intended route of administration. Examples of routes of
administration include parenteral (e.g., intravenous, intradermal, subcutaneous, intramuscular, intraperitoneal, intrathecal), mucosal (e.g., oral, rectal, intranasal, buccal, vaginal, respiratory), enteral (e.g., orally, such as by tablets, capsules or drops, rectally) and transdermal (topical, e.g., epicutaneous, inhalational, intranasal, eyedrops, vaginal). Solutions or suspensions used for parenteral, intradermal, enteral or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor™ (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier is a solvent or dispersion medium containing for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof. The proper fluidity is maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms is achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid and the like. In many cases, it is preferable to include isotonic agents, for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions is brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
Sterile injectable solutions may be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination
of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound is incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions are also prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
For administration by inhalation, the compounds are delivered in the form of an aerosol spray from pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer. Systemic administration can also be by mucosal or transdermal means. For mucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for mucosal administration, detergents, bile salts, and fusidic acid derivatives. Mucosal administration is accomplished through the use of nasal sprays or suppositories. For transdermal administration,, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.
A pharmaceutically acceptable vehicle is understood to designate a compound or a combination of compounds entering into a pharmaceutical composition which does not cause side effects and which makes it possible, for example, to facilitate the administration of the active compound, to increase its life and/or its efficacy in the body, to increase its solubility in solution or alternatively to enhance its preservation.
These pharmaceutically acceptable vehicles are well known and will be adapted by persons skilled in the art according to the nature and the mode of administration of the active compound chosen.
Therapeutic compositions to be used for in vivo administration should be sterile. This is readily accomplished by filtration through sterile filtration membranes, prior to or following lyophilization and reconstitution. The composition may be stored in lyophilized form or in solution if administered systemically. If in lyophilized form, it is typically formulated in combination with other ingredients for reconstitution with an appropriate diluent at the time for use. An example of a liquid formulation is a sterile, clear, colourless unpreserved solution filled in a single-dose vial for subcutaneous injection.
Therapeutic compositions generally are placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle. The compositions are preferably administered parenterally, for example, as intravenous injections or infusions or administered into a body cavity.
The therapeutic compositions disclosed herein may further comprise an antimalarial, such as an antimalarial that is useful for the treatment of Plasmodial infection. Preferred antimalarials for use in the compositions include the chloroquine phosphate, proguanil, primaquine, doxycycline, mefloquine, clindamycin, halofantrine, quinine sulphate, quinine dihydrochloride, gluconate, primaquine phosphate and sulfadoxine.
EXAMPLES
EXAMPLE 1: Generation of an antibody that specifically binds P. falciparum actin
A short peptide representing an epitope of P. falciparum actin I was used to generate an antibody. The specificity of the antibody was subsequently determined by immunoblot analysis.
Antibody production
A synthetic peptide spanning amino acids 239-253 of P falciparum actin (Lys-
Ser-Tyr-Glu-Leu-Pro-Asp-Gly-Asn-Ile-Ile-Thr-Val-Gly-Asn) (SEQ ID NO: 2) was generated and used to raise polyclonal rabbit antisera (Genscript, USA). The resultant
antisera (provided by Genscript) contained affinity purified IgG antibodies against P. falciparum actin.
Parasite culture and maintenance and immunoblot analysis
P. falciparum (3D7 strain), P. berghei (ANKA strain) and T. gondii (RH strain) parasites were each maintained using standard procedures. P. falciparum cultures were grown in human 0+ erythrocytes at 4% hematocrit with 0.5% Albumax II (Invitrogen). 3D7 is a cloned line derived from NF54, obtained from the late David Walliker at Edinburgh University, UK. P. berghei lines were maintained in Balb/c mice as described previously (Sinden et al., 2002), wild-type ANKA was obtained from Robert Sinden at Imperial College, London. In vitro conversion to ookinetes and ookinete motility assays followed Moon et al. (2009). T. gondii was propagated in human foreskin fibroblasts (HFF) grown in Dulbecco's modified Eagle's medium (DMEM) with 10% fetal calf serum (GIBCOBRL). For a-toxin treatment, needle passaged tachyzoites were incubated in 50ul of Clostridium septicum culture supernatant.
Lysates from saponin-treated shizont stage in vitro cultures of both P. falicparum and P. berghei along with tachyzoites were harvested by centrifugation, resuspended in reduced sample buffer and analysed by Western blot probing with anti- Pf Actin antisera at 1/1000 or anti- Actin (clone C4, Millipore) at 1/1000. Signal was detected by anti-rabbit or mouse IgG horseradish peroxidase conjugate (HRP) (Millipore), and visualized via enhanced chemiluminescence (ECL, Amersham Biosciences). For solubility analysis of PfADFl, isolated 3D7 strain P. falciparum merozoites resuspended in water (Complete Protease Inhibitors, Roche) were snap frozen and incubated on ice for 10 min for releasing the cell content. Water soluble and insoluble proteins were separated by ultracentrifugation at 100,000 x g for 30 min at 4 °C (TLAl 00.2 rotor, Beckman Optima TL Ultracentrifuge, Beckman Coulter). Water insoluble, fractions were further treated with Na2CC>3 pH 11.5 for 1 hour at 4 °C. Carbonate soluble and insoluble fractions were isolated by ultracentrifugation as described earlier. Samples were subject to SDS-PAGE and immunoblot analysis. Membranes were incubated with antisera (rabbit anti-PfAct239-253 [1:500], rabbit anti- PfADFl [1:1000] (unpublished data) and rabbit anti-MSPl(l-19) [1 :1000]).
Results
The results of the immunoblot are shown in Figure 1A. As shown in Figure 1 A, the antibody recognized a specific product around 40 kD in lysate from P. falciparum, P. berghei and T. gondii tissue cultures, which is consistent with apicomplexan actin' s
predicted mass (-41.8 kD). Importantly, the antibody showed minimal cross-reaction with human erythrocyte (RBC) or human fibroblast (HFF) actin. Thus, the antibody was specific to apicomplexan actin.
This is the first demonstration of an antibody which can bind to apicomplexan actin without also significantly binding to human actin, providing proof of the concept that a biological (chemical or protein) can be used to target malarial actin in a human host. The ability of such a compound to disrupt actin filament dynamics would stop all actin dependent processes in the parasite while leaving host actin untouched. Actin dependent processes include movement, nuclear gene regulation and haemoglobin uptake, all of which are essential to parasite survival. Therefore, an agent which specifically disrupts apicomplexan actin dynamics could be a powerful antimalarial.
EXAMPLE 2: Antibody binding to actin filaments in apicomplexan parasites
The apicomplexan actin-specific antibody was delivered to P. falciparum, P. berghei and T. gondii in order to visualise intracellular actin.
Zoite invasion preparation
Blood stage P. falciparum parasites (a derivative of D10 - Wilson et al., 2010) or wild type (ANKA) or transfectant P. berghei asexual parasites were cultured through to schizogony and prepared for merozoite invasion following Boyle et al., (2010). T. gondii tachyzoite invasion was captured using a potassium shift protocol (Kafsack et al., 2004). Sporozoite invasion - P. berghei sporozoites were dissected from infected Anopheles stephensi salivary glands and kept on ice in HepG2 culture media (Advanced MEM (Gibco®) supplemented with 10% FCS (Bovogen), 1% L-Glutamin (Thermo Scientific), 1% Penicillin/Streptomycin (Thermo Scientific), 0.1% Amphotericin B (Thermo Scientific) until dissection was completed. Sporozoites were added to lxlO5 HepG2 cells per well in a 24 well plate. The plate was spun at 800 rpm and 4°C for 4 min to facilitate sporozoite - HepG2 cell interaction. The plate was put at 37°C and 5% C02 for 8 min, carefully washed once with PBS and invasion stopped by fixation with 0.0075% glutaraldehyde/ 4% paraformaldehyde. JAS treatment invasion - Filtered P. falciparum and P. berghei merozoites allowed to invade erythrocytes, shaking at 37°C for 1.5 and 2 min respectively before the treatment with 5uM JAS and returned to invasion assay conditions for a further 1.5 or 2 min. Immunofluoresence assay (IFA) microscopy
P. falciparum merozoites, P. berghei merozoites or sporozoites allowed to invade for 2 or 10 min were then fixed in solution and prepared for IF A as described (Tonkin et al., 2004) using 0.0075% glutaraldehyde/ 4% paraformaldehyde (ProSciTech, Australia) in PBS. Free tachyzoites from culture supernatant or infected host cells and P. berghei ookinetes were fixed directly on coverslips and prepared for IFA using the same method. Primary antisera was used in 3% BSA/PBS with rabbit anti-PfAct239-253 [1:300]; mouse anti-PfRON4 (Richard et al., 2010); rabbit anti-GAP45 (Baum et al., 2006) [1:500]; rabbit-anti-TgRON4 (Alexander et al., 2005) [1:1000]; mouse anti-TgSAGl (DG52) (Morisaki et al., 1995) [1:5,000]; mouse anti-PbCSP [1:5000] (Yoshida et al., 1980); mouse anti-Pb28 (Spano et al., 1996) [1:10,000]. Following washes appropriate secondary antibodies were used including goat anti- mouse (Alexa Fluor-488) and -rabbit (Alexa Fluor-594), both at 1:500 before mounting in VectaShield® (Vector Laboratories) with O.lng/μΙ, 4',6-diamidino-2-phenylindoIe, DAPI (Invitrogen). Fluorescence images were obtained using a Plan-Apochromat 100x/ 1.40 oil immersion Phase contrast lens (Zeiss) on an AxioVert 200M microscope (Zeiss) equipped with an AxioCam Mrm camera (Zeiss). Z-stacks were taken well above and below parasites and processed using the Axiovision release 4.7 or 4.8 deconvolution software package. Immunoelectron microscopy (IEM)
Free or invading merozoites were fixed in 1% glutaraldehyde (ProSciTech, Australia) on ice for 30 min. Samples were pelleted in low-melt agarose before being transferred into water, dehydrated in ethanol and embedded in LR Gold Resin (ProSciTech, Australia). Following polymerization by benzoyl peroxide (SPI-Chem, USA) samples were sectioned on a Leica Ultracut R ultramicrotome (Wetzlar). Sections were blocked in phosphate-buffered saline containing 0.8% (wt vol) bovine serum albumin and 0.01% (wt/vol) Tween 80 and then incubated in anti-PfAct239-253 diluted in the above-mentioned solution. Samples were washed and incubated with secondary antibodies conjugated to 10 nm diameter gold particles (BioCell). Post- staining with 2% aqueous uranyl-acetate and 5% triple lead was followed by observation at 120 kV on a Philips CM 120 BioTWIN Transmission Electron Microscope.
3D structured illumination microscopy (3D SIM)
Samples were prepared as for IFA mounted in VectaShield® (Vector
Laboratories). Imaging was performed using a DeltaVision OMX 3D Structured
Illumination Microscopy System® (OMX 3D-SIM, Applied Precision Inc, Issaquah, USA) as described (Riglar et al., 2011).
Image processing and actin quantification
Deconvolved Z-stacks were reconstructed in 3D, with interpolation, using
Imaris version 7.1.0 (Bitplane Scientific). For clarity of display, gamma settings were altered on 3D reconstructions after deconvolution, however no comparisons of labelling levels were made from such altered images. Maximum and total actin fluorescence calculations were performed in Metamorph version 7.7.0 (Molecular Devices), within masked regions determined using the "auto threshold for light objects" function on the CSP labelling channel of sporozoites. Statistics were calculated using a students t-test in Prism version five, GraphPad. General image handling was undertaken using either Image J or Adobe Photoshop CS4. Final images were assembled in Adobe Illustrator CS4 for figure generation.
Results
IFA of P. falciparum merozoites with anti-PfAct239-2J3 showed strong labelling at the merozoite periphery (Figure IB). This localization partially overlapped with that of gliding associated protein GAP45 (Figure IB), a protein anchored to the IMC that lies under the plasma membrane in the parasite pellicle (Gaskins et al., 2004). Concentration of anti-PfAct239-233 labelling at the pellicle was further supported by serial section immuno-electron microscopy of free merozoites (Figure 1C).
Given the small size of merozoites (~1-2μπι in length), and their poor resolving power for localizing proteins to specific cellular compartments, the inventors explored anti-PfAct239.253 reactivity with other, larger, zoites. IFA with ookinetes showed a clear concentration of anti-PfAct239-253 at the periphery (Figure ID). This labelling was accentuated when parasites were treated with JAS (Figure ID), which also demonstrated apical concentrations of actin in structures similar to those seen with GFP-PbACTcoN ookinetes. Images with salivary gland sporozoites, either untreated or following addition of JAS (Figure IE), were entirely consistent with those of ookinetes.
Increase in the perceived signal of fluorescence following JAS treatment is consistent with the anti-PfAct239-2S3 antibody showing preference for actin filaments over monomers. To explore this, the inventors undertook quantitative imaging of^ sporozoites treated with JAS (to stabilize filaments), cytochalasin D (in which filaments are capped and will be less prevalent) or left untreated. It was reasoned that if the antibody recognizes filaments, fluorescence intensity should increase in cells that
have more F-actin. Consistent with this, maximum fluorescence intensity for JAS treated sporozoites (having increased quantities of F-actin) were significantly higher (p < 0.005, unpaired t-test), whereas that for cytochalasin D treated parasites (having reduced F-actin) was significantly lower (p < 0.05, unpaired t-test) than untreated controls (Figure 2F). Surprisingly, total fluorescence decreased for both treatments (Figure 2F). Although consistent with decreased maximal fluorescence for cytochalasin D, the situation following JAS-treatment likely results from the localized labelling that arises after treatment with this toxin. Whilst sporozoites that were relatively flat in the plane of view were selected, 3D reconstructions demonstrated that a significant proportion frequently lies outside the plane of imaging therefore removing a major proportion of actin labelling from quantification. This evidence - combined with the more localized labelling seen with anti-PfAct239-253 compared to GFP- Actin fluorescence - supports the antibody having a preference for filamentous (F) over globular (G) actin.
To determine the precise location of anti-PfAct239-2S3 labelling in the pellicular compartment the inventors imaged T. gondii tachyzoites treated with Clostridium septicum a-toxin, which leads to the selective separation of the plasma membrane from the IMC (Wichroski et al., 2002). Untreated tachyzoites showed a variable proportion of labelling again at the parasite pellicle though with additional cytosolic labelling (Figure 2A). Treatment with ΙμΜ JAS produced a pronounced concentration of labelling at the apex and pellicle consistent with that seen in YFP- and GFP-TgActin expressing lines (Wetzel et al., 2003). Treatment with a-toxin did not give rise to any marked differentiation in cortical labelling (Figure 2B). When this was combined with JAS, however, actin could clearly be seen to concentrate to the underside of the plasma membrane (Figure 2B). This confirms localization of actin dynamics to the supra- alveolar space and suggests that filaments do not reside freely within this compartment but instead concentrate at the plasma membrane. In line with this, carbonate extraction of P. falciparum schizont lysate (to separate membrane associated from cytosolic proteins) suggested a substantial portion of the actin pool does associate strongly with membranes (Figure 2C). Combined, these observations, provide the first definitive demonstration that dynamic actin filaments concentrate at the cell cortex of motile apicomplexan parasites and likely strongly associate with the plasma membrane.
An actin ring forms during zoite invasion of the host cell
It has recently been demonstrated the presence of a ring of actin labelling at the tight junction in invading P. falciparum merozoites (Riglar et al., 2011) (Figure 3A).
Immuno-electron microscopy of similar preparations using anti-PfAc.239-233 added further support to a concentration at this site (Figure 3B), which is the defined point of traction (and therefore actin-dependent motor engagement) for an invasive zoite. The present inventors sought to confirm whether this observation was conserved in other parasite species. T. gondii tachyzoites showed variable concentrations at the tight junction and pellicular regions. P. berghei merozoites however, showed clear and consistent rings of actin during invasion (Figure 3C). Despite the absence of a definitive marker for the P. berghei tight junction, this is entirely consistent with previous observations in P. falciparum merozoites (Figure 3A). Sporozoite invasion of hepatocytes is notoriously hard to capture. Nevertheless, sporozoites dissected from mosquito salivary glands and applied to cultured HepG2 liver cells showed a concentration of actin consistent with tight junction labelling (Figure 3D). This was confirmed using the P. berghei spect- knockout parasite (Figure 3E), a line that is defective for host cell traversal but not invasion (Ishino, 2004). These data suggest that concentration of actin at the host-parasite tight junction is a feature of all apicomplexan zoite host cell invasion where actin polymerization would be predicted to engage the invasion motor (Baum et al., 2008).
Imaging of actin at the tight junction suggests filaments form parallel with the plane of zoite invasion
Because localization of actin following JAS treatment in ookinetes fits with filament formation at sites of traction with the substrate surface, the present inventors sought to test whether actin labelling at the tight junction was comprised of filaments, as would be suggested by data supporting a preference for F-actin for this antibody (Figure IF). P. falciparum merozoites incubated with erythrocytes to permit invasion and treated with JAS showed a break down of PfRON4 and anti-PfAct239-2S3 labelling with no actin rings visible (Figure 4A). Similar results were seen with P. berghei merozoites (Figure 4B), which have a much greater efficiency of invasion in a merozoite invasion assay (data not shown). Whilst peripheral actin labelling of P. berghei merozoites associated with erythrocytes was similar for both treatments, no actin ring labelling was seen for any merozoite following JAS treatment (Figure 4C). The breakdown of ring structure during merozoite invasion following JAS treatment clearly demonstrates that blocking filament dynamics disrupts ring structure, providing strong evidence that the ring is composed of polymers of actin during normal invasion. To definitively explore this possibility, merozoites labelled with anti-PfAct239-253 were imaged by three dimensional structured illumination microscopy, 3D-SIM
(Schermelleh et al., 2008), an approach that has recently provided significant insight into the structures formed during P. falciparum merozoite invasion of the erythrocyte (Riglar et al., 2011). Anti-PfAct239-253 labelling could clearly be seen to concentrate at the leading edge, that is towards the posterior of the parasite, of the tight junction during merozoite invasion (Figure 4D). Furthermore, labelling clearly showed rod-like structures around the circumference of the tight junction, with each rod running approximately parallel to the plane of merozoite invasion (Figure 4D arrow). Although accurate sizing of filaments is beyond the resolution limits of 3D-SIM, their size (between 200-500nm) is entirely consistent with the in vitro determined length of actin filaments from apicomplexan parasites (Sahoo et al., 2006; Schmitz et al., 2005; Schuler et al., 2005). These images likely represent the first time that actin filaments have been seen under native conditions in motile apicomplexan parasites, and demonstrate the specific targeting affinity of the antibody disclosed herein. EXAMPLE 3: The P. falciparum actin epitope is conserved in apicomplexan parasites.
BLAST analysis of the P. falciparum actin epitope (KSYELPDGNIITVGN) (SEQ ID NO: 2) was performed in order to determine whether this sequence is conserved amongst apicomplexan parasites. Figure 5 shows that this peptide sequence is 100% conserved in several apicomplexan parasites, including major pathogens of . humans and animals. These pathogens include other human malarial parasites P. vivax, P. ovale, P. malariae and P. knowlesi, as well as T. gondii, B. bovis, B. annulata, T. parvum and T. annulata.
Accordingly, the antibody shown in Example 1 to bind specifically to a number of different apicomplexan parasites' actin without significantly binding human actin recognises an epitope that is conserved across the apicomplexan phylum. Therefore, the antibody can be used to specifically bind actin from parasites across the apicomplexan phylum. EXAMPLE 4: Determining a candidate agent's ability to inhibit actin polymerization.
Compounds identified in screening assays as agents that specifically bind apicomplexan actin can be assayed for their ability to inhibit actin polymerization. Recombinant methods can be used to generate actin monomers for use in such screening methods.
Recombinant actin was produced as follows. A synthetic PfACTl gene encoding P. falciparum actin, with a sequence which has been modified from the endogenous P. falciparum actin gene sequence (SEQ ID NO: 8) in order to achieve enhanced expression levels, was amplified using primers PfACTl_NdeI_FL_codon+fwd,
GATCcatatgGGTGAGGAGGACGTGCAGGCTC (SEQ ID NO: 5) and PfACTl_Xhol_FL_codon+Rev,
GATCctcgagTCAGAAGCACTTACGGTGCACGATGGAAG (SEQ ID NO: 6). Restriction sites are indicated in the above primer sequences in lower case letters. The amplification produced a sequence which was digested to produce the following codon optimised open reading frame (Genscript synthetic gene):
ATGGGTGAGGAGGACGTGCAGGCTCTGGTGGTGGACAACGGTTCCGG TAACGTGAAGGCTGGTGTGGCTGGTGACGATGCTCCTCGTTCCGTGTTCC CTTCCATCGTGGGTCGTCCTAAGAACCCTGGTATCATGGTGGGTATGGAA GAGAAGGACGCTTTCGTGGGTGACGAGGCTCAGACCAAGCGTGGTATCCT GACCCTGAAGTACCCTATCGAGCACGGTATCGTGACCAACTGGGACGACA TGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTGCGTGCTGCTCCT GAGGAGCACCCTGTGCTGCTGACCGAGGCTCCTCTGAACCCTAAGGGTAA CCGTGAGCGTATGACCCAGATCATGTTCGAGTCCTTCAACGTGCCTGCTA TGTACGTGGCTATCCAGGCTGTGCTGTCCCTGTACTCCTCTGGTCGTACT ACCGGTATCGTGCTGGACTCCGGTGACGGTGTGTCCCACACCGTGCCTAT CTACGAGGGTTACGCTCTGCCTCACGCTATCATGCGTCTGGACCTGGCTG GTCGTGACCTGACCGAGTACCTGATGAAGATCCTGCACGAGCGTGGTTAC GGTTTCTCCACCTCCGCTGAGAAGGAGATCGTGCGTGACATCAAGGAGAA GCTGTGCTACATCGCTCTGAACTTCGACGAGGAAATGAAGACCTCCGAGC AGTCTTCCGACATCGAGAAGTCCTACGAGCTGCCTGACGGTAACATCATC ACCGTGGGTAACGAGCGTTTCCGTTGCCCTGAGGCTCTGTTCCAGCCTTC CTTCCTGGGTAAGGAGGCTGCTGGTATCCACACTACCACCTTCAACTCCA TCAAGAAGTGCGACGTGGACATCCGTAAGGACCTGTACGGTAACATCGTG CTGTCCGGCGGTACCACTATGTACGAGGGTATCGGTGAGCGTCTGACCCG TGACATCACCACTCTGGCTCCTTCCACCATGAAGATCAAGGTGGTGGCTC CTCCCGAGCGTAAGTACTCCGTGTGGATCGGTGGCTCCATCCTGTCTTCC CTGTCCACCTTCCAGCAGATGTGGATCACCAAGGAAGAGTACGACGAGTC CGGTCCTTCCATCGTGCACCGTAAGTGCTTCTGA (SEQ ID NO: 7)
Purified products of the codon optimised sequence (SEQ ID NO: 7) were ligated into the Ndel Xhol site of the pET28 vector (Novagen) to generate recombinant proteins with ran N-terminal hexa-His^fusion tag and transformed into— DH101 E. coli competent cells (Invitrogen). The recombinant construct was confirmed by DNA sequencing. Positive clones were re-transformed into Rosetta2 (DE3) E. coli
ceils for protein expression. Expression of PfACTl was induced by the addition of 1 mM isopropyl b-D-l-thiogalactopyranoside (IPTG) when the culture reached an OD600 of 0.6. Following addition of IPTG cultures were grown for 4 hr at 37 °C, cells harvested and ruptured by sonication.
Soluble proteins were separated from the inclusion body, which contains the expressed His6x-PfACTl, by centrifugation at 15,000 rpm/ 4 °C/ 30 min. Inclusion body was solublised in solublisation buffer (6 M Guanidine hydrochloride, 50 mM Tris pH 8, 0.3 M NaCl and 10 mM 2-Mercaptoethanol) at 25 °C/ 1 hr with rocking. Solublised His6x-PfACTl was purified in denatured condition by incubating with NiNTA agarose (Qiagen) at 4 °C/1 hr with rocking. Proteins were initially washed with wash buffer 1 (6 M Guanidine hydrochloride, 50 mM Tris pH 8, 0.3 M NaCl, 30 mM imidazole and 10 mM 2-Mercaptoethanol) followed by refolding via washing the proteinrbound agarose with refolding buffer (20 mM Tris, pH 8, 0.1 mM CaC12, 0.1 mM ATP and 5 mM 2-Mercaptoethanol). His6x-PfACTl was eluted in elution buffer (20 mM Tris, pH8, 0.1 mM CaC12, 0.1 mM ATP, 250 mM imidazole and 5 mM 2- Mercaptoethanol). Purified protein was concentrated and further purified by size- exclusion chromatography using a Superdex S200 10/300 GL column (GE Healthcare) with 20 mM Tris, pH8, 0.1 mM CaC12, 0.1 mM ATP and 5 mM 2-Mercaptoethanol as elution buffer. Protein purity was assessed by SDS-PAGE.
An alternative means of producing recombinant actin is to amplify the P. falciparum gene sequence shown as SEQ ID NO: 8 using primers designed as known in the art and preparing soluble proteins as described above.
EXAMPLE 5: Generation of a monoclonal antibody that specifically binds P. falciparum actin.
Monoclonal antibody production
A synthetic peptide spanning amino acids 239-253 of Plasmodium falciparum Actin (PlasmoDB ID: PFL2215w) was used to raise polyclonal mouse antisera against malaria actin (anti-Act239-253) as described in Example 1. Serum was raised by immunization of Balb/C mice. Immunogenic mice (as determined by ELISA and immunoblot (see below)) were selected for splenectomy followed by fusion with Sp2/0 myeloma to generate a hybridoma for monoclonal antibody generation. Supernatants (containing secreted antibody) harvested from cloned cells derived from the fusion were screened by ELISA and immunoblot (see below). The cloned hybridoma cell line 26/11-5H3- 1-2 (5H3) was selected as producing a monoclonal antibody (IgG3
subclass) that reacted specifically with malarial actin but reacted minimally with mammalian actin (see below).
The cloned hybridoma cell line 26/11 -5H3- 1 -2 was deposited with the European Collection of Cell Cultures (ECACC), at the address: Health Protection Agency, Porton Down, Salisbury, Wiltshire, SP4 OJG, UK, on 18 April 2012 and was allocated the accession number 12041801. Accordingly, the deposit of the cloned hybridoma cell line 26/11-5H3- 1-2 (5H3) was made in accordance with the Budapest Treaty on the International Recognition of the Deposit of Microorganisms. Immunoblot screening
Polyclonal serum or monoclonal antibody were screened by immunoblot against recombinant Actin (rPf) generated in Escherichia coli (Wong et al., 2011), commercially available Rabbit Skeletal Muscle Actin (RSMA) (Cytoskeleton Inc.), lysate from hypotonically lysed human or mouse red blood cells (hRBCs or mRBCs), human foreskin fibroblast (HFF) cell lysate, or saponin-treated cell lysate from the same cells infected with P. falciparum (Pf iRBC), P. berghei (Pb iRBC) or Toxoplasma gondii (Tg iHFF) parasites, respectively. Parasites used (P. falciparum 3D7 strain, P. berghei ANKA strain and T. gondii RH strain) were cultured according to standard protocols (Angrisano et al, 2012). Immunoblots were undertaken according to standard protocols. Briefly, lysates or recombinant proteins were resuspended in reduced sample buffer, boiled and analysed by Western blot probing with mouse polyclonal or monoclonal (5H3) anti-Act239-253 antisera at 1:200 or 1:1000 concentration respectively. Signal was detected by anti-mouse IgG horseradish peroxidase . conjugate (HRP) (Millipore), and visualised via enhanced chemiluminescence (ECL, Amersham Biosciences).
Immunofluorescence
Blood stage P. falciparum parasites were cultured through to schizogony and prepared for merozoite invasion following Boyle et al (Boyle et al, 2010). Merozoites were allowed to invade for 2 minutes, fixed in solution and prepared for immunofluorescence assay (IF A) as described (Tonkin et al, 2004) using 0.0075% glutaraldehyde/4% paraformaldehyde (ProSciTech, Australia) in PBS. Primary antisera 5H3-anti-Act239-253 [1:100] and rabbit anti-PfRON4 (Richard et al, 2010) was made up in 3% BSA/PBS. Following washes appropriate secondary antibodies (Alexa Fluor- 488, 594, Invitrogen) were at 1:500 before mounting in VectaShield® (Vector Laboratories) with 0.1 ng^L 4',6-diarnidino-2-phenylindole, DAPI (Invitrogen).
Fluorescence images were obtained using a Plan-Apochromat lOOx/ 1.40 oil immersion Phase contrast lens (Zeiss) on an AxioVert 200M microscope (Zeiss) equipped with an AxioCam Mrm camera (Zeiss). Z-stacks were taken well above and below parasites and processed using the Axiovision release 4.7 or 4.8 deconvolution software package.
Results
As shown in Figure 6, the monoclonal antibody 5H3 specifically binds to recombinant P. falciparum actin and not to human actin (panel B), achieving a similar specificity to that seen with mouse polyclonal serum (panel A). 5H3 also specifically binds to P. falciparum actin in lysed P.falciparum-w' fected human RBCs and not to uninfected human RBC lysate (panel B). The IFA analysis shown in panel C demonstrates that 5H3 binds to P. falciparum actin in vivo and can therefore be used in a variety of applications as described herein. EXAMPLE 6: ALPHASCREEN™ assay to identify agents that bind a polypeptide comprising or consisting of SEQ ID NO: 2 or SEQ ID NO: 10, as indicated by their ability to reduce the binding of an antibody disclosed herein to a polypeptide comprising or consisting of SEQ ID NO: 2.
An ALPHASCREEN™ assay is used to identify active small molecules capable of binding a polypeptide comprising or consisting of SEQ ID NO: 2 or SEQ ID NO: 10, as indicated by their ability to reduce the binding of an antibody disclosed herein (e.g., the monoclonal antibody 5H3) to a polypeptide comprising or consisting of SEQ ID NO: 2 or SEQ ID NO: 10. Thus, the assay investigates the ability of a candidate agent to inhibit the binding of an antibody disclosed herein (e.g., the monoclonal antibody 5H3) to a polypeptide comprising or consisting of SEQ ID NO: 2 or SEQ ID NO: 10. To determine an accurate estimation of the IC50, the compounds are routinely tested at starting concentrations, ΙΟΟμΜ and/or ΙμΜ and serially titrated 3 fold over 11 dilutions.
The assay uses ALPHASCREEN™ technology that relies on hydrogel coated acceptor and donor beads which have functional groups for conjugation to a protein
(e.g., Protein-A-antibody) and a peptide [e.g., Biotin-KSYELPDGNIITVGN (SEQ ID
NO: 2)], respectively. The beads come into close proximity when the antibody and the peptide interact. Donor beads contain a photosensitiser that converts oxygen to an excited form of 02 at an excitation of 680 nm. Energy is transformed from the singlet oxygen and reacts with chemilviminescers in the acceptor bead, resulting in light emission at 580 - 620 nm. Candidate agents, when added to the ALPHASCREEN™
assay, can interfere with the antibody binding to the peptide, resulting in failure of the donor and acceptor beads to come into close proximity to one and other, reducing the intensity of the luminescence signal. By adding various compound concentrations, the IC50 of each compound is calculated.
Materials
Antibody and biotinylated-peptide are prepared in-house and stored as stock solutions at -80°C. The biotinylated-KSYELPDGNIITVGN (SEQ ID NO: 2) or biotinylated-NIITV (SEQ ID NO: 10) is stored as 500μΜ stock solutions in 100% DMSO at -80°C. The ALPHASCREEN™ Protein A Detection Kit is obtained from Perkin Elmer Lifesciences. Microtitre plates are purchased from Interpath Services, Melbourne (eg. Cat #784075). Seals to cover the plates are purchased from Prescience, Melbourne (eg. Cat#784075). Polypropylene 50 μΐ,, V bottom polypropylene compound plates are purchased from Matrical.
Preparation of compounds and buffers
Compounds are prepared as 5mM stocks in 100% DMSO. These compounds are diluted in DMSO to achieve a desired final concentration. The assay and bead buffers are prepared fresh. Each titrated compound plate is assayed in duplicate. As an example, the following volumes are sufficient to run 12 384- well plates.
Assay Buffer
[Stock! rFinall rVolume for 100 mLl
1 M Hepes pH 7.4 50 mM 5 mL
1 M DTT 10 mM 1 mL
4 M NaCl 100 mM 2.5 mL
10 % Tween-20 0.05 % 0.5 mL
10 mg/mL Casein 0.1 mg/mL 1 mL
Milli-Q H20 90 mL
Bead Buffer
[Stock] [Final] rVolume for 100 mL]
1 M Tris-HCL pH 7.5 50 mM 5 mL
10 % Tween-20 0.01 % 0.1 mL
10 mg/mL Casein 0.1 mg/mL 1 mL
Milli-Q H20 93.9 mL
Protein and Peptide Preparation; and Assay Per formance
The assay and bead buffers are used to prepare the acceptor and donor solutions. ALPHASCREEN™ beads are light sensitive and therefore prepared in a room with subdued lighting. 2.5 of beads are added per 1 mL of buffer. The volume of antibody or peptide to add is calculated using the following formula:
— x Vlx 2 = V2
C2
wherein:
CI = Fmal Concentration of antibody/peptide
C2 = Stock Concentration of antibody/peptide
Π = Total Volume of Acceptor/Donor Solution
V2 = Volume of stock antibody/peptide to add to Acceptor/Donor solution.
The assay components are prepared as separate Acceptor and Donor Solutions. The Acceptor Solution contains Acceptor beads and target antibody, while the Donor Solution contains Donor beads and biotinylated peptide.
For example:
[Acceptor Solution] [ mL] [Donor Solution] [ mL]
Assay buffer lOmL Assay buffer lOmL Bead buffer lOmL Bead buffer lOmL
Acceptor Beads 50μί Donor Beads 50μΙ.
Antibody at desired cone. Peptide (SEQ ID NO:2 or 10) at desired cone.
Final Antibody [as desired] Final Peptide [as desired] After the solutions are prepared, they are left to incubate for 30 minutes at room temperature to allow the beads to bind to the antibody and the peptide. A quantity of labelled peptide/donor solution is added into all columns of a 384-well assay plate except for a single column (column 24). The same volume of a control Assay/Bead buffer is added to column 24 (i.e., no labelled peptide/donor). A small volume of various compounds at various concentrations in 100% DMSO are transferred to the 384-well assay plate in columns 1-22 only, with the same volume of DMSO only transferred into columns 23- 24, and the plates are incubated for 3,0 rnins at RT, before addition of a volume of
the Acceptor solution, plates are sealed individually with adhesive film and incubated at RT in the dark for 4-24 hours. The plates are then loaded onto an appropriate plate
reader, for example an Envision 2103 plate reader, for quantification of ALPHASCREEN™.
The percent inhibition is calculated using the following equation:
(χ - μ')
%Inhibition= 100* (1 - ) wherein:
x = RFU obtained after compound treatment
μ~= RFU obtained for the negative controls (no peptide controls)
10 μ* = RFU obtained for the positive controls (DMSO vehicle controls)
ICso values are obtained by non-linear least squares fitting of the above data, e.g., to XLfit3 equation 205: y=A+((B-A)/(l+((C/x)AD))).
The quality of the assay results are monitored by determination of the Z Prime factor for each assay plate, where Z Prime => 0.5 for the results is considered as 15 reliable (Zhang et al., (1999)).
Agents that reduce the binding of an antibody disclosed herein to a polypeptide comprising or consisting of SEQ ID NO: 2 or SEQ ID NO: 10 are selected for further analysis.
20 It will be appreciated by persons skilled in the art that numerous variations and or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.
25 The present application claims priority from US 61/485,567 filed 12 May 2011, the entire contents of which are incorporated herein by reference.
All publications discussed and or referenced herein are incorporated herein in their entirety.
Any discussion of documents, acts, materials, devices, articles or the like which 30 has been included in the present specification is solely for the purpose of providing a context for the present invention. It is not to be taken as an admission that any or all of _ _„these Lmatters-form parLofihe ^^prior_art_base^orjwere_common^general knowledgeJn the field relevant to the present invention as it existed before the priority date of each claim of this application.
35
REFERENCES
Aikawa et al., (1978) J. Cell Biol. 77: 72-82.
Alexander et al., (2005). PLoS Pathog 1 : el7.
Al-Lazikani et al., (1997) J. Mol. Biol. 273: 927-948.
Amino et al. (2008) Cell Host Microbe. 3: 88-96.
Angrisano et al. (2012) PLoS One 7, e32188.
Baum et al., (2006a) J. Biol. Chem. 281 : 5197-5208.
Baum et al., (2006b) Nat. Rev. Microbiol. 4: 621-628.
Baum et al., (2008) Trends Parasitol. 24: 557-563.
Beychok (1979) Cells of Immunoglobulin Synthesis, Academic Press, New York, p69.
Bird et al., (1988) Science 242:423-426.
Blondelle and Houghten (1996) Trends Biotechnol. 14:60-65.
Boyle et al., (2010) Proc. Natl. Acad, Sc.i USA. 107: 14378-14383
Bubb et al., (1994) J. Biol. Chem. 269: 14869-14871.
Cho et al., (1993) Science 261:1303.
Chothia and Lesk (1989) J. Mol. Biol. 196:901-917.
Chothia et al., (1989) Nature 342, 877-883.
Cintra and De Souza W (1985) J. Submicrosc. Cytol. 17: 503-508.
Constantini et al., (2008) Cancer Biotherm. Radiopharm. 23 : 3-24.
Cooper (1987) J. Cell Biol. 105: 1473-1478.
De Coupade et al., (2005) Biochem. J. 390:407-418.
Deshayes et al., (2008) Adv. Drug. Deliv. Rev. 60:537-47.
DeWitt et al., (1993) Proc. Natl. Acad. Sci. USA, 90:6909-6913.
Dobrowolski and Sibley (1996) Cell 84: 933-939.
Dobrowolski et al., (1997) Cell Motil. Cytoskeleton 37: 253-262.
Erb et al., (1994) Proc. Natl. Acad. Sci. USA. 91:11422-11426.
Field et al., ( 1993) Cell Motil. Cytoskeleton 25 : 43-48.
Frenal et al., (2010) Cell Host Microbe 8: 343-357.
Gallop et al., (1994) J. Med. Chem. 37:1233 1251.
Gaskins et al., (2004) J. Cell. Biol. 165: 383-393.
Gordon and Sibley (2005) BMC Genomics 6: 179.
Green et al., (2006) J Mol. Biol. 355: 933-941.
Giudicelli et al.. (1997) Nucleic Acids Res.. 25: 206-211.
Guiguemde et al., (2010) Nature 465: 311 -315.
Hakansson et al., (1999) Mol. Biol. Cell 10: 3539-47.
Harayama (1998) Trends Biotechnol. 16:6-82.
Harmsen and De Haard (2007) Appl. Microbiol. Biotechnol. 77: 13-22.
Hay et al., (2004) Lancet Infect. Dis. 4:327-336.
Hegge et al., (2009) Biotechnol. J. 4, 403-913.
Holzinger and Meindl (1997 Cell Motil Cytoskeleton 38: 365-372.
Honnegher and Plukthun (2001) J. Mol. Biol., 309: 657-670.
Howl et al., (2007) Biochem. Soc. Trans. 35 :767-769.
Huston et al., (1988) Proc. Natl. Acad. Sci. USA. 85:5879-5883.
Ishino et al., (2004) PLoS Biol 2: E4.
Jones et al., (2006) Mol. Biochem. Parasitol. 147: 74-84.
Kabat (1987) and (1991) Sequences of Proteins of Immunological Interest, National Institutes of Health, Bethesda,.Md.
Kafsack et al., (2004) Mol. Biochem. Parasitol. 136: 309-311.
Koppelhus et al., (2008) Bioconj. Chem. 19:1526-34.
Kudryashev et al., (2010) PMC Biophys 3: 6.
Meyer-Losic et al., (2006) J. Med. Chem. 49:6908-6916!
Miller et al., (1979) J. Exp. Med. 149: 172- 184.
Mizuno et al., (2002) Parasitol. Res. 88: 844-848.
Moon et al., (2009) PLoS Pathogens 5 : el 000599.
Morisaki et al., (1995) J. Cell. Sci. 108: 2457-2464.
Morrison et al., (1984) Proc. Natl Acad. Sci. USA, 81: 6851-6855.
Morrissette and Sibley (2002) Microbiol Mol. Biol. Rev. 66: 21-38.
Munter et al., (2009) Cell Host Microbe. 6: 551-562.
Muyldermans (2001 ) J. Biotechnol. 74 :277- 302.
Padlan et al., (1995) FASEB J., 9: 133-139.
Pinder et al., (1998) J. Cell Sci. Ill: 183 839.
Pollard and Cooper (2009) Science 326: 1208-1212.
Raibaud et al., (2001) J. Struct. Biol. 135: 47-57.
Richard et al., (2010) J. Biol. Chem. 285: 14815-14822.
Riglar et al., (2011) Cell Host Microbe. 9: 9-20.
Ryning and Remington (1978) Infect. Immun. 20: 739-743.
Sahoo et al., (2006) Mol. Biol. Cell 17: 895-906.
Schatten et al., (2003) Microsc. Microana.l 9: 330-335.
Schermelleh et al., (2008) Science 320: 1332-1336
Schmitz et al., (2005) J. Mol. Biol. 349: 113-125.
' Schmitz et al., (2010) J. Biol. Chem. 285: 36577-36585.
• Schuler et al., (2005) FEBS Lett. 579: 655-660.
Shaw and Tilney (1999) Proc. Natl. Acad. Sci. U.S.A. 96: 9095-9099.
Siden-Kiamos et al., (2006) Mol. Biochem. Parasitol. 150: 308-317.
Sinden et al., (2002) Methods Mol Med 72: 25-40.
Spano et al., (1996) Parassitologia 38: 559-563.
Sun et al. ( 1986) Hybridoma 5 Suppl, 1:517-20.
Tibary et al., (2007) Soc Reprod. Fertil; Suppl. 64:297-313.
Tonkin et al., (2004) Mol. Biochem. Parasitol. 137: 13-21.
Urlaub et al., (1980) Proc. Natl. Acad. Sci. USA, 77: 4216.
Visa and Percipalle (2010) Harb Perspect. Biol. 2: a000620.
Visintin et al., (2008a) J. Biotechnol. 135:1-15.
Visintin et al., (2008b) J. Immunol. Methods 290:135-53.
Vlachou et al., (2004) Cell Microbiol. 6: 671-685.
Wesseling and Snijders et al., (1989) Mol. Biochem. Parasitol 35: 167-176.
Wetzel et al., (2003) Mol. Biol. Cell 14: 396-406.
Wetzel et al., (2005) Infect. Immun. 73: 5379-5387.
Wichroski et al., (2002) Infect. Immun. 70: 4353-4361.
Wilson et al., (2010) Malar. J. 9: 152.
Wong et al., (2011 ) Proc. Natl. Acad. Sci. USA, 108: 9869-9874.
Yoshida et al., (1980) Science 207: 71-73.
Zhang et al., (1999) J. Biomol. Screening, 4:67-73.
Zuckermann et al., (1994) J. Med. Chem. 37:2678-2685.
Claims
1. An isolated or recombinant antibody or fragment thereof, which antibody or fragment specifically binds a polypeptide comprising SEQ ID NO: 2 or SEQ ID NO: 10.
2. The antibody or fragment of claim 1 , which does not detectably bind a polypeptide comprising amino acids 237 to 251 of human β-actin as defined in SEQ ID NO: 3 and or a polypeptide comprising amino acids 237 to 251 of mutant human β- actin as defined in SEQ ID NO: 4 and/or amino acids 245 to 249 of human mutant β actin as defined in SEQ ID NO: 11.
3. The antibody or fragment of any preceding claim, which does not detectably bind mammalian actin.
4. The antibody or fragment of claim 3, which does not detectably bind human actin.
5. The antibody or fragment of any preceding claim, which specifically binds an epitope comprising or consisting of the amino acid sequence of SEQ ID NO: 2, or an epitope comprising or consisting of a fragment of the amino acid sequence of SEQ ID NO: 2.
6. The antibody or fragment of any preceding claim, wherein the antibody is a polyclonal antibody, monoclonal antibody, bispecific antibody, diabody, triabody, heteroconjugate antibody, chimeric antibody, single chain antibody, or wherein the fragment is a Fab, F(ab')2, FabFc2, or Fv fragment.
7. The antibody or fragment of any preceding claim, which comprises one or more CDRs of the antibody produced by the hybridoma cell line 26/11-5H3-1-2 deposited with the ECACC under accession number 12041801.
8. The antibody of any preceding claim, which is the antibody produced by the hybridoma cell line 26/11-5H3- 1-2 deposited with the ECACC under accession number 12041801.
9. The antibody or fragment of any preceding claim, which is detectably labelled.
10. The antibody or fragment of any preceding claim, which is conjugated to a cell penetrating agent.
11. A composition comprising the antibody or fragment of any preceding claim and a carrier.
12. An isolated or recombinant polynucleotide encoding the antibody or fragment of any preceding claim, or a chain thereof.
13. A vector comprising the polynucleotide of claim 12.
14. A host cell comprising the polynucleotide of claim 12 or vector of claim 13.
15. An isolated or recombinant peptide consisting of SEQ ID NO: 2 or SEQ ID NO: 10.
16. An isolated or recombinant polynucleotide encoding the peptide of claim 15.
17. A vector comprising the polynucleotide of claim 16.
18. A host cell comprising any one or more of the peptide of claim 15, the polynucleotide of claim 16 or the vector of claim 17.
19. A composition comprising a carrier and any one of more of the peptide of claim 15, the polynucleotide of claim 16, the vector of claim 17 and the host cell of claim 18.
20. A method of producing the antibody or fragment of any one of claims 1 to 6, 9 or 10, the method comprising administering to an animal any one or more of:
i) the peptide of claim 15;
ii) the polynucleotide of claim 16;
iii) the vector of claim 17;
iv) the host cell of claim 18; and
v) the composition of claim 19.
21. A method of identifying an agent which binds apicomplexan actin, the method comprising:
i) contacting the antibody or fragment of any one of claims 1 to 10 with a polypeptide comprising SEQ ID NO: 2 or SEQ ID NO: 10 in the presence of a candidate agent; and
ii) identifying the candidate agent as an agent which binds apicomplexan actin if the binding of the antibody or fragment to the polypeptide comprising SEQ ID NO: 2 or SEQ ID NO: 10 is reduced in the presence of the candidate agent.
22. The method of claim 21, comprising contacting the antibody or fragment of any one of claims 1 to 10 with a polypeptide comprising SEQ ID NO: 2 or SEQ ID NO: 10 in the absence of a candidate agent; and identifying the candidate agent as an agent which binds apicomplexan actin if the binding of the antibody or fragment to the polypeptide comprising SEQ ID NO: 2 or SEQ ID NO: 10 is reduced in the presence of the candidate agent compared to the absence of the candidate agent.
23. The method of claim 21 or claim 22, further comprising contacting the candidate agent with a polypeptide which does not comprise an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10; and identifying the agent as an agent which specifically binds apicomplexan actin if the agent reduces the binding of the antibody or fragment to the polypeptide comprising SEQ ID NO: 2 or SEQ ID NO: 10 and does not detectably bind to the polypeptide which does not comprise an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10.
24. A method of identifying an agent which binds apicomplexan actin, the method comprising:
i) contacting the peptide of claim 15 with a candidate agent; and
ii) identifying the agent as an agent which binds apicomplexan actin if the agent binds to the peptide of claim 15.
25. The method of claim 24, further comprising contacting the candidate agent with a polypeptide which does not comprise an amino acid sequence of SEQ ID NO: 2 or
SEQ ID NO: 10; and identifying the agent as an agent which specifically binds apicomplexan actin if the agent binds to the peptide of claim 15 and does not detectably bind to the polypeptide which does not comprise an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10.
26. The method of any one of claims 21 to 25, further comprising determining whether the agent detectably binds mammalian actin.
27. The method of claim 26, wherein the mammalian actin comprises a polypeptide comprising amino acids 237 to 251 of human β-actin as defined in SEQ ID NO: 3 or a polypeptide comprising amino acids 237 to 251 of mutant human β-actin as defined in SEQ ID NO: 4 or a polypeptide comprising amino acids 245 to 249 of human mutant β actin as defined in SEQ ID NO: 11.
28. The method of any one of claims 21 to 27, further comprising determining whether the agent is capable of inhibiting, disrupting or stabilising apicomplexan actin polymerization.
29. The method of any one of claims 21 to 28, further comprising determining whether the agent is capable of inhibiting apicomplexan motility and/or host cell invasion.
30. The method of any one of claims 21 to 29, wherein the agent is detectably labelled.
31. An agent capable of binding apicomplexan actin identified by the method of any one of claims 21 to 30.
32. A method of treating a disease caused by an apicomplexan parasite, the method comprising administering the agent of claim 31, the antibody or fragment of any one of claims 1 to 10, or the composition of claim 11 to a subject in need thereof.
33. The agent of claim 31, the antibody or fragment of any one of claims 1 to 10, or the composition of claim 11 for use in treating a disease caused by an apicomplexan parasite. '
34. Use of the agent of claim 31, the antibody or fragment of any one of claims 1 to 10, or the composition of claim 11 in the manufacture of a medicament for the treatment of a disease caused by an apicomplexan parasite.
35. Use of the agent of claim 31, the antibody or fragment of any one of claims 1 to 10, or the composition of claim 11 to inhibit, disrupt or stabilise apicomplexan actin polymerization.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201161485567P | 2011-05-12 | 2011-05-12 | |
| US61/485,567 | 2011-05-12 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2012151636A1 true WO2012151636A1 (en) | 2012-11-15 |
Family
ID=47138574
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/AU2012/000524 Ceased WO2012151636A1 (en) | 2011-05-12 | 2012-05-11 | Actin binding agents |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2012151636A1 (en) |
-
2012
- 2012-05-11 WO PCT/AU2012/000524 patent/WO2012151636A1/en not_active Ceased
Non-Patent Citations (5)
| Title |
|---|
| ANGRISANO, F. ET AL.: "Spatial Localisation of Actin Filaments across Developmental Stages of the Malaria Parasite", PLOS ONE, vol. 7, no. 2, February 2012 (2012-02-01) * |
| FIELD, S. J. ET AL.: "Actin in the merozoite of the malaria parasite, Plasmodium falciparum.", CELL MOTILITY AND THE CYTOSKELETON, vol. 25, 1993, pages 43 - 48 * |
| OWARIBE, K. ET AL.: "Induction of Antibody against Actin from Myxomycete Plasmodium and Its Properties", BIOCHEMISTRY, vol. 14, no. 13, 1975, pages 3024 - 3029 * |
| SAHASRABUDDHE, A. ET AL.: "A novel form of actin in Leishmania: molecular characterisation subcellular localisation and association with subpellicular microtubules", MOLECULAR AND BIOCHEMICAL PARASITOLOGY, vol. 134, 2004, pages 105 - 114 * |
| WEBB, S. E. ET AL.: "Contractile protein system in the asexual stages of the malaria parasite Plasmodium falciparum", PARASITOLOGY, vol. 112, 1996, pages 451 - 457 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Yang et al. | AMA1 and MAEBL are important for Plasmodium falciparum sporozoite infection of the liver | |
| Alexander et al. | Identification of the moving junction complex of Toxoplasma gondii: a collaboration between distinct secretory organelles | |
| US20250263478A1 (en) | Neutralizing antibodies to plasmodium falciparum circumsporozoite protein and their use | |
| Adjogble et al. | GRA9, a new Toxoplasma gondii dense granule protein associated with the intravacuolar network of tubular membranes | |
| US20190375831A1 (en) | Neutralizing antibodies to plasmodium falciparum circumsporozoite protein and their use | |
| Dutta et al. | Strain-transcending neutralization of malaria parasite by antibodies against Plasmodium falciparum enolase | |
| WO2018209265A1 (en) | Anti-malarial antibodies that bind circumsporozoite protein | |
| Quintana et al. | SURGE complex of Plasmodium falciparum in the rhoptry-neck (SURFIN4. 2-RON4-GLURP) contributes to merozoite invasion | |
| Meibalan et al. | Host erythrocyte environment influences the localization of exported protein 2, an essential component of the Plasmodium translocon | |
| US8318897B2 (en) | Nucleotide and amino acid sequences encoding an exported protein 1 derived from Plasmodium vivax and uses thereof | |
| Simons et al. | Extending the range of Plasmodium falciparum transmission blocking antibodies | |
| Lyons et al. | Pfs48/45 nanobodies block Plasmodium falciparum transmission | |
| US11066464B2 (en) | Anti-malarial antibodies that bind circumsporozoite protein | |
| WO2017163049A1 (en) | Anti-malarial antibodies that bind circumsporozoite protein | |
| Oda-Yokouchi et al. | Plasmodium RON12 localizes to the rhoptry body in sporozoites | |
| US12186380B2 (en) | Plasmodium falciparum and Plasmodium vivax vaccine | |
| WO2012151636A1 (en) | Actin binding agents | |
| US10577412B2 (en) | Anti-plasmodium parasite antibodies | |
| De Silva et al. | The antibody response to Plasmodium falciparum Merozoite Surface Protein 4: comparative assessment of specificity and growth inhibitory antibody activity to infection-acquired and immunization-induced epitopes | |
| WO2021257665A1 (en) | Human monoclonal antibody that targets a conserved site on the plasmodium falciparum circumsporozoite protein | |
| Cuccurullo et al. | Development of an anti-Pfs230 monoclonal antibody as a Plasmodium falciparum gametocyte blocker | |
| Dong et al. | Tracking Neospora caninum parasites using chimera monoclonal antibodies against its surface antigen-related sequences (rNcSRS2) | |
| Venkatesh | DESIGNING mRNA BASED MULTISTAGE VACCINE FOR MALARIA | |
| WO2025085979A1 (en) | Pan-specific malaria binding polypeptides | |
| Garza | Neutralizing and Polyreactive Antibody Responses to the Malaria Vaccine Candidate PF3D7_1136200 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12782794 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 12782794 Country of ref document: EP Kind code of ref document: A1 |