WO2012151289A2 - Method and system to detect aggregate formation on a substrate - Google Patents

Method and system to detect aggregate formation on a substrate Download PDF

Info

Publication number
WO2012151289A2
WO2012151289A2 PCT/US2012/036139 US2012036139W WO2012151289A2 WO 2012151289 A2 WO2012151289 A2 WO 2012151289A2 US 2012036139 W US2012036139 W US 2012036139W WO 2012151289 A2 WO2012151289 A2 WO 2012151289A2
Authority
WO
WIPO (PCT)
Prior art keywords
beads
sample
dna
nucleic acid
phage
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2012/036139
Other languages
French (fr)
Other versions
WO2012151289A3 (en
Inventor
James P. Landers
Jingyi Li
Qian Liu
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
UVA Licensing and Ventures Group
Original Assignee
University of Virginia Patent Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Virginia Patent Foundation filed Critical University of Virginia Patent Foundation
Publication of WO2012151289A2 publication Critical patent/WO2012151289A2/en
Publication of WO2012151289A3 publication Critical patent/WO2012151289A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/536Immunoassay; Biospecific binding assay; Materials therefor with immune complex formed in liquid phase
    • G01N33/537Immunoassay; Biospecific binding assay; Materials therefor with immune complex formed in liquid phase with separation of immune complex from unbound antigen or antibody
    • G01N33/538Immunoassay; Biospecific binding assay; Materials therefor with immune complex formed in liquid phase with separation of immune complex from unbound antigen or antibody by sorbent column, particles or resin strip, i.e. sorbent materials
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/543Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
    • G01N33/54313Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals the carrier being characterised by its particulate form
    • G01N33/54326Magnetic particles
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/543Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
    • G01N33/54313Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals the carrier being characterised by its particulate form
    • G01N33/54326Magnetic particles
    • G01N33/54333Modification of conditions of immunological binding reaction, e.g. use of more than one type of particle, use of chemical agents to improve binding, choice of incubation time or application of magnetic field during binding reaction
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N27/00Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
    • G01N27/72Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating magnetic variables
    • G01N27/74Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating magnetic variables of fluids
    • G01N27/745Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating magnetic variables of fluids for detecting magnetic beads used in biochemical assays

Definitions

  • Polymeric analytes can be detected using methods, such as chromatography, electrophoresis, binding assays, spectrophotometry, and the like.
  • DNA detection for instance, may require expensive, bulky optics for either absorbance-based techniques or intercalating-dye fluorescence based techniques.
  • DNA concentration has routinely been detected spectrometrically by measuring absorbance ratio of a sample at 260/280 nm, the method suffers from poor sensitivity at low concentrations of DNA.
  • DNA detection include DNA binding to a fluorescence dye and detecting the fluorescence using a fluorometer.
  • a fluorescence dye examples include PicoGreen ® , which is commercially available through Invitrogen (Carlsbad, CA) (see Ahn et al., Nucl. Acids Res., 24:2623 (1996); Vitzthum et al., Anal. Biochem., 276:59 (1999), and dyes disclosed in U.S. Patent Nos. 6,664,047; 5,582,977 and 5,321 , 130.
  • Additional DNA quantification methods based on fluorescence have been developed and include oligonucleotide hybridization (Sanchez et al., J. Clin.
  • Haque et al. (BMC Biotech., 3:20 (2003)) compared three popular DNA quantification methods with regard to accuracy: OD 2 6o/OD 2 8o (OD), PicoGreen ® double stranded DNA (PG), and detection of fluorescent signal from a 5' exonuclease assay (quantitative genomic method (QG), based on the TaqMan® assay).
  • OD OD 2 6o/OD 2 8o
  • PG PicoGreen ® double stranded DNA
  • QG quantitative genomic method
  • fluorometric methods are the use of very small sample volumes due to the high sensitivity of the methods and that fluorescence detection is easily implemented in microdevices.
  • some reagents are not compatible with fluorescence based DNA quantification due to signal quenching.
  • a typical experimental process includes DNA preparation and quantification, amplification by polymerase chain reaction (PCR), and subsequent detection.
  • PCR polymerase chain reaction
  • the success of amplification often depends on the quality of prepared DNA, specifically purity and concentration, so a quantification step between preparation and amplification is critical to acquire reliable results.
  • UV-Vis absorbance and fluorescence spectroscopy are commonly used to quantify DNA at concentrations from nanograms down to picograms per microliter prior to PCR, while a variety of amplification kits and post- PCR analysis methods on the PCR products have been and are continuously being developed to provide accurate information for different applications.
  • Microfluidic genetic analysis involves integration of DNA preparation, quantification, amplification, separation, and detection for point-of-care applications.
  • DNA quantification is critical to the success rate of amplification and subsequent detection, and a simple technique to quantify DNA at the point of care will promote further development of microfluidic systems.
  • the present method may be employed as a label- free lab-on-paper assay for DNA quantification, or other polymeric analytes, based on the aggregation of silica-coated paramagnetic microbeads induced by the analyte in a magnetic field.
  • the invention provides label-free detection technology based on aggregation of particles, e.g., magnetic particle (bead) aggregation, in the presence of polymeric molecules, such as DNA in biological samples, including those that have been subject to an amplification reaction, and an energy source that induces particle aggregation such as a rotating magnetic field (RMF), which aggregates can be detected and/or quantified.
  • particles e.g., magnetic particle (bead) aggregation
  • polymeric molecules such as DNA in biological samples, including those that have been subject to an amplification reaction
  • an energy source that induces particle aggregation
  • RMF rotating magnetic field
  • the assays described herein employed aggregation of particles in a RMF
  • other forms of energy such as pulsatile heating (via microwave or IR heating), acoustic energy and vigorous mechanical agitation may be used for aggregation induction.
  • an open ended micro-container, or micro-transfer device such as a pipette tip or other hollow cylinder that functions like a pipette tip (e.g., to draw up and expel fluids), is employed to mix the particles and the sample having the polymeric analyte.
  • the particles are introduced to the open ended container and then the sample is introduced to the container so as to mix the particles and the sample.
  • the sample is introduced to the open ended container and then the particles introduced to the container so as to mix the particles and the sample.
  • the sample and the particles are combined before being introduced to the open ended container.
  • the mixture is then subjected to a form of energy that induces aggregation of the particles and polymeric analyte.
  • the aggregates are transferred to an adsorbent substrate (support), e.g., glass or other hydrophobic substrate (support) such as a polyethylene, polycarbonate or polystyrene based substrate, or an absorbant substrate, e.g., a substrate that is formed of any semi-permeable material that allows liquids such as aqueous liquids to diffuse through the material with or without applied force but retains the particles and/or aggregates on its surface in a manner that suppresses or inhibits the dissociation of the aggregates.
  • adsorbent substrate e.g., glass or other hydrophobic substrate (support) such as a polyethylene, polycarbonate or polystyrene based substrate, or an absorbant substrate, e.g., a substrate that is formed of any semi-permeable material that allows liquids such as aqueous liquids to diffuse through
  • the substrate is a membrane such as cloth, wax supported paper, filter paper, for instance, FTA paper, nitrocellulose or a polyvinylidene fluoride (PVDF) membrane.
  • the presence or amount of the aggregates is detected, for instance, using image analysis.
  • the method provides for non-free solution detection of aggregates.
  • the magnetic beads are about 1 micron to about 10 microns in diameter, and may be modified, e.g., with silica or with molecules such as ssDNA, antibodies or aptamers that are useful to detect specific targets.
  • the aggregates are formed in a pipette tip and dispensed on filter paper, of which the digital images provide quantitative information on DNA concentration through simple analysis.
  • the limit of detection, sensitivity, and accuracy of the assay were determined, and an application on quantification of DNA templates for polymerase chain reaction (PCR) was demonstrated.
  • PCR polymerase chain reaction
  • Cell phone cameras also suffice the need of quantification, allowing for development of truly portable and cost- effective point-of-care testing.
  • the bead surface can be readily modified, rendering the assay great versatility for detection and quantification of various analytes.
  • a robotic system that can dispense multiple samples onto the substrate can be employed for a high throughput assay.
  • the formation of aggregates is specific for the presence of DNA and/or RNA (nucleic acid), such as amplified nucleic acid, in a sample and that formation is not inhibited by the presence of other cellular components, even at concentrations that greatly exceed that of the nucleic acid, e.g., DNA.
  • RNA nucleic acid
  • amplification of nucleic acid e.g., amplification of phage or viruses in cells of interest that are to be detected, which occurs during phage or virus replication, e.g., during culture with host cells, or amplification of the nucleic acid of interest in vitro, such as polymerase chain reaction (PCR) amplification, ligase chain reaction (LCR) amplification or transcription mediated amplification (TMA), prior to induction of aggregate formation.
  • PCR polymerase chain reaction
  • LCR ligase chain reaction
  • TMA transcription mediated amplification
  • the method is useful to detect and quantify high molecular weight DNA (ss and dsDNA), e.g., genomic DNA, or RNA, or amplified nucleic, such as that in the presence of an abundance of protein, under chaotropic conditions.
  • the invention provides a label-free technique where DNA-bound magnetic beads are subjected to a rotating magnetic field thereby forming aggregates which are detected by introducing the aggregates to
  • nucleic acid amplification together with aggregate formation provide a different approach to organism detection.
  • this approach provides for the use of bacteriophage to detect specific organisms, e.g., phage D29 may be employed to detect
  • the specificity of the assay can be increased by measuring the quantitative replication of host-specific bacteriophage following infection of bacteria by the phage.
  • aggregate based DNA detection in a chaotrope is generic, specificity in this context is provided by a phage or virus (which in one embodiment only infects one or a few types of bacteria or eukaryotic species) and a signal amplification of at least about 10 2 to about 10 10 , e.g., about 10 4 to about 10 9 , about 10 5 to about 10 8 , or about 10 7 (e.g., 100 starting copies of phage may replicate to 10 9 copies in about 4 to about 5 hours).
  • the number of amplification cycles for aggregate formation may be inversely related to the size of the phage genome, e.g., fewer amplification cycles may be needed for larger phage genomes.
  • whole phage (at sufficient concentrations) can induce an effect at a 75-fold higher sensitivity than that observed for phage DNA alone.
  • Aggregate formation is not limited to nucleic acid; a positively-charged high molecular weight polysaccharide polymer, chitosan, that electrostatically binds to silica-coated beads under low ionic strength conditions, also forms aggregates when subjected to an external magnetic field.
  • Aggregate formation may be detected visually, which requires minimal footprint or expensive optical equipment, and can be employed to quantify the amount of a polymeric analyte in a sample, such as a complex biological sample, e.g., one having protein, carbohydrates such as polysaccharides, nucleic acid, and/or lipid, or any combination thereof.
  • Aggregate formation may be detected using microscopy, photography, scanners, magnetic sensing and the like.
  • the invention provides a method for detecting the presence or amount of a nucleic acid analyte in a sample, such as a complex biological sample.
  • the method includes contacting the sample with magnetic beads, e.g., from about 1 nm to about 300 micrometers in diameter, under conditions that allow for binding of the analyte to the beads so as to form a mixture in an open ended contained.
  • the beads include a paramagnetic metal.
  • the mixture is subjected to energy, e.g., a magnetic field or acoustic energy, so as to form aggregates, which are then placed on a membrane, and the presence or amount of aggregates on the membrane (or on multiple locations on the membrane) is detected or determined.
  • the mixture is contacted with a magnet which induces aggregate formation.
  • aggregates are isolated from the mixture, thereby isolating the analyte.
  • the aggregates may first be magnetically isolated and then an elution buffer is added to the aggregates on the membrane.
  • an elution buffer is added to the aggregates on the support.
  • the invention provides a quantitative method. Unlike methods that purify an analyte, such as DNA, before quantitation, methods described herein allow for quantitation without prior purification. In one embodiment, concentrations of DNA as low as about 1 to about 100 pg/ ⁇ or about 3 to about 1 to about 100 ng/ ⁇ . of nucleic acid in a sample may be detected.
  • the invention provides a method for detecting the
  • a pathogen e.g., a virus, fungus (e.g., yeast) or bacteria
  • a sample e.g., a physiological sample such as blood, serum, plasma, cerebrospinal fluid, tissue sample, nasal swab and the like, suspected of having a pathogen is subjected to nucleic acid amplification of pathogen-specific sequences, for instance, using the polymerase chain reaction, so as to yield pathogen-specific fragments of greater than about 1 ,000 bp in length, e.g., greater than about 3,000 bp up to 6,000 bp, in length.
  • An open ended container such as a pipette tip or other hollow cylinder, is employed to mix the beads and the sample having the amplified DNA, which is then subjected to an energy that induces aggregate formation.
  • the aggregates are then applied to a membrane prior to detection or quantification.
  • at least about 1000 copies of the amplified viral genome, for instance, obtained after about 10 minutes of in vitro nucleic acid amplification, may be detected by aggregate formation.
  • the invention provides a method for detecting the presence or amount of a specific bacterium or eukaryotic cell.
  • a sample suspected of having a bacterium is contacted with phage that infect the bacterium.
  • the phage containing supernatant is contacted with beads and subjected to conditions that result in aggregate formation.
  • the aggregates are then applied to a membrane prior to detection or quantification.
  • the method may detect as few as 10 bacterial cells in a sample.
  • the invention provides a method to determine the specific amount of an analyte in a solution using silica-coated magnetic beads. This may be accomplished with a camera and routine image processing software. The method may be applied to quantifying nucleic acids undergoing amplification, for instance, rolling circle amplification and whole genome amplification, where the products have higher molecular weights than products produced using some other nucleic amplification methods, such as the polymerase chain reaction. In one embodiment, the method is sensitive to about 20 human cells in 20 microliters of solution.
  • the quantification method may also be applied to non-nucleic acid polymeric analytes, such as the polysaccharide chitosan, where a dose-dependent aggregation was also observed in a similar manner to the DNA induced aggregate formation on beads under non-chaotropic conditions. Under these conditions, the negatively charged silica bead surface is electrostatically attracted to the cationic chitosan (protonated amine) under low ionic strength conditions at physiological pH.
  • the method may be altered to include fluorescently labeled magnetic beads or measurements of the magnetic susceptibility of the aggregates, to increase the sensitivity of the assay.
  • the method may be employed as a step in the purification of molecules bound to the beads, e.g., nucleic acids.
  • the aggregation for instance, the formation of pinwheel shaped structures, can be visually detected and/or quantified.
  • the opaque nature of the aggregated particles makes the transition very easy to monitor optically, and simple image analysis techniques can be used to extract quantitative information.
  • the combination of high sensitivity and simplicity of the method provides in one embodiment a label-free approach to, for instance, DNA or RNA detection and/or quantification, and thereby nucleic acid containing cell quantification.
  • the observable effect for nucleic acid is also quite robust even in the presence of proteins and lipids at concentrations typically encountered in biological samples.
  • the methods of the invention may have specific advantages in conjunction with automated assays in microfluidic platforms.
  • the stark differences in optical contrast of images in the absence and presence of DNA allows for the use simple digital image processing to define a quantitative relationship between the mass of DNA and the extent of particle (e.g., bead) aggregation.
  • This relationship was determined via an algorithm based on the gray value of the digital image.
  • a threshold gray level is set such that dispersed beads and clusters are counted as "dark,” whereas areas in the image cleared of beads are counted as "bright.”
  • the number of dark pixels in the image is then used as a measure of aggregation, with 100% dark area representing a sample without aggregation, whereas low dark area percentages correspond to nearly complete aggregation.
  • the dynamic range of aggregate formation as a metric for DNA quantitation may be about 2.5 orders of magnitude.
  • the same effect observed for purified DNA is observed for cultured mouse cells pipetted directly into a guanidine HCI-bead solution and for complex samples like human whole blood. Smaller bead sizes may increase sensitivity for shorter nucleic acid fragment lengths, e.g., amplified DNA , e.g., beads of about 5 microns
  • ( ⁇ ) may be useful in detecting and/or quantitating nucleic acid of about 1 ,000 to about 5,000 base pairs in length.
  • an adsorbent substrate e.g., a one having a hydrophobic surface, or an absorbant substrate
  • an adsorbent substrate may be employed to detect or quantitate aggregate formation, e.g., using a hybridization induced aggregration assay.
  • a hybridization induced aggregration assay Unlike inducing pinwheel formation with high molecular weight (long molecules) of DNA under chaotropic conditions, the invention provides for the detection and/or quantification of sequence-specific DNA (or other nucleic acid of appropriate length) via pinwheel formation under physiological conditions.
  • the magnetic beads (or other magnetic substrates) employed in one embodiment of the hybridization-induced aggregation assay include oligonucleotides specific for a target nucleic acid sequence.
  • the use of non-covalent interactions may allow for easier coupling and post-pinwheel release of target sequences and/or oligonucleotides.
  • the length of a target nucleic acid sequence can be as short as 10 bases to as long as hundreds of millions of bases in length with a binding sequence of 4 bases on each end with sequences in the bead bound oligonucleotides.
  • a mixture with the beads and the target nucleic acid sequence e.g., in an open ended micro-container, when heated to an appropriate temperature (annealing T), results in hybridized (annealed) sequences, which subsequently induce aggregation.
  • annealing T an appropriate temperature
  • sequence-specific induced pinwheeling can be used to detect target sequences in long molecules of DNA, e.g., genomic DNA
  • efficient hybridization induced aggregration occurs with shorter target nucleic acid molecules and under non-chaotropic conditions.
  • hydrodynamic shear forces are used to cause covalent bond breakage.
  • the aggregates in one or more samples are placed on an adsorbent substrate and the aqueous liquid allowed to evaporate (with or without external force being applied). In one embodiment, the aggregates in one or more samples are placed on an absorbant substrate.
  • the hybridization based assay is particularly useful to detect markers including, but are not limited to, cancer markers, genetically-modified food, genetically-modified organisms, human genomic markers (relative to other DNA), or bacterial genome markers.
  • the homogenous assay may contain a series of the same type of beads with different oligonucleotides, where each pair of beads has sequences specific for a different target sequence having a different annealing temperature, or may have beads with different properties (such as in size or surface chemistry) that allow for distinguishing the presence of different target sequences in a sample.
  • the detection of pinwheeling at select temperature (T) as the sample traverses a temperature range of annealing T allows for the detection of the presence of certain DNA sequences.
  • FIG. 1 HeLa cells were mixed with MagnaSilTM paramagnetic particles and imaging used to determine the normalized percent of dark area in the sample.
  • B A graph of the percent of the dark area. Values are normalized by that of a negative control (no DNA) as a function of the amount of DNA or cell.
  • A Bar graph of WBC per ⁇ _ in three samples detected by the two methods. The results show that the pinwheel assay can be used to determine cell number.
  • B The pinwheel effect can be utilized to define the concentration of DNA directly from blood samples. Using normalized percentage of 'dark' pixels with constant volume (3.5 nl_) the comparison of three different human blood samples was accomplished. Different concentrations for each of the samples correlated with measurement of DNA via the conventional method (panel A).
  • the inset shows the result of diluting each sample to equalize the number of nucleated cells (white blood cells-WBCs) per microliter in each sample.
  • the results are displayed as the normalized percentage of 'dark' pixels with increasing amount of human blood (scaled by DNA amount).
  • Figure 4 (A) A negative control in a pinwheel assay. (B) A positive control in a pinwheel assay of purified phage DNA. (C) Correlation between the percent dark area and DNA in a pinwheel assay of purified phage DNA.
  • Figure 5 Quantitation of phage using a pinwheel assay.
  • A Graph of percent dark area versus number of phage.
  • B Graph of percent dark area versus phage concentration.
  • Figure 6 Detection of bacteria using phage. Graph of percent dark area versus percent of phage used to infect 100 bacterial cells.
  • FIG. 7A Schematic of one exemplary method that employs a pipette tip as a receptacle for mixing a sample and particles and for inducing aggregate formation.
  • Blotted beads alone in 2) provide a distinct 'dispersed' pattern akin to the free solution microwell images. Turbulent mixing when pipetted in 3) exposes any sample DNA to beads.
  • Blotted aggregated beads in 4) provide a distinct 'pinwheel-like' pattern akin to the free solution microwell images that can be interpreted quantitatively.
  • Figure 7B-D The pinwheel assay via the pipette and blot approach.
  • B General experimental procedure.
  • C and (D) illustrate the scanned images of magnetic beads blotted on filter paper without and with DNA, respectively.
  • the saturation histograms in HSB denote the differences between the two samples.
  • the red curve represents the average of the 14 experiments (gray curves).
  • Figure 8 Algorithm and standard curve for DNA quantification.
  • Figures 10A-B Quantification of human genomic DNA extracted from blood samples.
  • A A standard curve was generated with serially diluted DNA samples.
  • B The DNA concentrations of seven samples were measured with the PAB assay and compared with the results from UV-Vis spectroscopy.
  • Figures 1 1A-C Application for short tandem repeat (STR) analysis.
  • the PCR reaction for STR analysis typically requires 1.0-2.5 ng/ ⁇ .. DNA.
  • Three DNA samples were measured with the PAB assay, and Sample C was determined as > 2.83 pg/ ⁇ because the result locates outside the dynamic range shown in Figure 10A.
  • a comparison of the electropherograms shows that the interpretable result was only generated from the sample with appropriate DNA concentration.
  • FIGS 12A-B Calibration curves for 1 ⁇ (panel A) and 8 ⁇ (panel B) beads with lambda
  • Figure 15 Towards a portable assay for point-of-care applications.
  • the images of blotted beads on filter paper can also be acquired by a camera phone, which still yield quantitative results despite the noise generated from low image resolution. Error bars denote the standard deviation of four experiments.
  • Switching from a desktop photo scanner to a 3M-pixel cell phone camera represents a change from 599k to 32k pixels per image.
  • the noise looks large when it is plotted at log scale.
  • the peak area from 30 to 1000 saturation still dominates in the dark area results, and the area of the noisy part (100-255 saturation) is actually too small to affect dark area values.
  • FIG. 16 (A) Schematic of hybridization induced aggregation and exemplary oligonucleotides and target sequences. (B) The effect of altering amount of connector in the hybridization induced aggregration assay.
  • Figure 17 Detection of a PCR product using hybridization induced aggregation.
  • Figure 19 Exemplary method to detect non-absorptive chaotrope induced aggregation.
  • Figure 20 Graph of percent dark area versus DNA amounts in non-absorptive chaotrope induced aggregation.
  • a “detectable moiety” is a label molecule attached to, or synthesized as part of, a solid substrate for use in the methods of the invention.
  • detectable moieties include but are not limited to radioisotopes, colorimetric, fluorometric or chemiluminescent molecules, enzymes, haptens, redox-active electron transfer moieties such as transition metal complexes, metal labels such as silver or gold particles, or even unique oligonucleotide sequences.
  • label refers to a marker that may be detected by photonic, electronic, opto-electronic, magnetic, gravimetric, acoustic, enzymatic, magnetic, paramagnetic, or other physical or chemical means.
  • label refers to incorporation of such a marker, e.g., by incorporation of a radiolabeled molecule or attachment to a solid substrate that may be suspended in solution such as a bead.
  • a “biological sample” can be obtained from an organism, e.g., it can be a physiological fluid or tissue sample, such as one from a human patient, a laboratory mammal such as a mouse, rat, pig, monkey or other member of the primate family, by drawing a blood sample, sputum sample, spinal fluid sample, a urine sample, a rectal swab, a peri-rectal swab, a nasal swab, a throat swab, or a culture of such a sample, or from a plant or a culture of plant cells.
  • a physiological fluid or tissue sample such as one from a human patient, a laboratory mammal such as a mouse, rat, pig, monkey or other member of the primate family, by drawing a blood sample, sputum sample, spinal fluid sample, a urine sample, a rectal swab, a peri-rectal swab, a nasal swab,
  • biological samples include, but are not limited to, whole blood or components thereof, blood or components thereof, blood or components thereof, semen, cell lysates, saliva, tears, urine, fecal material, sweat, buccal, skin, cerebrospinal fluid, and hair.
  • the biological sample comprises cells.
  • Analyte or “target analyte” is a substance to be detected in a biological sample such as a physiological sample using the present invention.
  • Polymeric analyte as used herein refers to
  • the polymeric analyte can include biopolymers or non-biopolymers.
  • Biopolymers include, but are not limited to, nucleic acids (such as DNA or RNA), proteins, polypeptides, polysaccharides (such as starch, glycogen, cellulose, or chitin), and lipids.
  • Capture moiety is a specific binding member, capable of binding another molecule (a ligand), which moiety or its ligand may be directly or indirectly attached through covalent or noncovalent interactions to a substrate (bead). When the interaction of the two species produces a non-covalently bound complex, the binding which occurs may be the result of electrostatic interactions, hydrogen- bonding, or lipophilic interactions.
  • ligand refers to any organic compound for which a receptor or other binding molecule naturally exists or can be prepared.
  • Binding pairs useful as capture moieties and ligands include, but are not limited to, complementary nucleic acid sequences capable of forming a stable hybrid under suitable conditions, antibodies and the ligands therefore, enzymes and substrates therefore, receptors and agonists therefore, lectins and carbohydrates, avidin and biotin, streptavidin and biotin, and combinations thereof.
  • the affinity of a capture moiety and its ligand may be greater than about 10 "5 M, such as greater than about 10 "6 M, including greater than about 10 "8 M and greater than about 10 "9 M.
  • oligonucleotides having biotin labels are bound to beads coupled to streptavidin.
  • homology refers to sequence similarity between two nucleic acid molecules. Homology may be determined by comparing a position in each sequence, which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base, then the molecules are homologous at that position. A degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences.
  • Identity means the degree of sequence relatedness between polynucleotide sequences, as the case may be, as determined by the match between strings of such sequences. "Identity” and “homology” can be readily calculated by known methods. Suitable computer program methods to determine identity and homology between two sequences include, but are not limited to, the GCG program package
  • a reference or control amount may be a normal reference level or a disease-state reference level.
  • a normal reference level may be an amount of expression of a biomarker in a non-diseased subject or subjects.
  • a disease-state reference level may be an amount of expression of a biomarker in a subject with a positive diagnosis for the disease or condition.
  • the term "subject" means the subject is a mammal, such as a human, but can also be an animal, e.g., domestic animals (e.g., dogs, cats and the like), farm animals (e.g., cows, sheep, pigs, horses and the like) and laboratory.
  • domestic animals e.g., dogs, cats and the like
  • farm animals e.g., cows, sheep, pigs, horses and the like
  • a "paramagnetic metal” is a metal with unpaired electrons.
  • Suitable paramagnetic metals include transition elements and lanthanide series inner transition elements. Additional suitable paramagnetic metals include, e.g., Yttrium (Y), Molybdenum (Mo), Technetium (Tc), Ruthenium (Ru), Rhodium (Rh), Tungsten (W), and Gold (Au). Additional specific suitable specific paramagnetic metals include, e.g., Y(lll), Mo(VI), Tc(IV), Tc(VI), Tc(VII), Ru(lll), Rh(lll), W(VI), Au(l), and Au(lll).
  • a Alanthanide refers to Cerium (Ce), Praseodymium (Pr), Neodymium (Nd), Promethium (Pm), Samarium (Sm), Europium (Eu), Gadolinium (Gd), Terbium (Tb), Dysprosium (Dy), Holmium (Ho), Erbium (Er), Thulium (Tm), Ytterbium(Yb), or Lutetium (Lu).
  • lanthanides include, e.g., Ce(lll), Ce(IV), Pr(lll), Nd(lll), Pm(lll), Sm(ll), Sm(lll), Eu(ll), Eu(lll), Gd(lll), Tb(lll), Dy(lll), Ho(lll), Er(lll), Tm(lll), Yb(ll), Yb(lll), and Lu(lll).
  • transition metal oxides include, but are not limited to: Cr0 2 , COFe 2 0 4 , CuFe 2 0 4 , Dy 3 Fe 5 0 12 , DyFe0 3 , ErFe0 3 , Fe 5 Gd 3 0 12 , Fe 5 H0 3 0 12 , FeMnNi0 4 , Fe 2 0 3 , y-Fe 3 0 4 (magnetite), a-Fe 3 0 4 (hematite), FeLa0 3 , MgFe 2 0 4 , Fe 2 Mn0 4 , Mn0 2 , Nd 2 0 7 Ti 2 , AI 0 2Fe-
  • Oxides of two or more of the following metal ions can also be used: AI(+3), Ti(+4), V(+3), Mn(+2), Co(+2), Ni(+2), Mo(+5), Pd(+3), Ag(+1 ), Cd(+2), Gd(+3), Tb(+3), Dy(+3), Er(+3), Tm(+3) and Hg(+1 ).
  • nucleic acid sequence refers to one or more oligonucleotides or polynucleotides as defined herein.
  • target nucleic acid molecule or “target nucleic acid sequence” refers to an oligonucleotide or polynucleotide comprising a sequence that a user of a method of the invention desires to detect in a sample.
  • polynucleotide as referred to herein means a single-stranded or double-stranded nucleic acid polymer composed of multiple nucleotides.
  • the nucleotides comprising the polynucleotide can be ribonucleotides or deoxyribonucleotides or a modified form of either type of nucleotide.
  • Said modifications include base modifications such as bromouridine, ribose modifications such as arabinoside and 2',3'-dideoxyribose and internucleotide linkage modifications such as phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phoshoraniladate and phosphoroamidate.
  • base modifications such as bromouridine, ribose modifications such as arabinoside and 2',3'-dideoxyribose and internucleotide linkage modifications such as phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phoshoraniladate and phosphoroamidate.
  • polynucleotide specifically includes single and double stranded forms of DNA.
  • oligonucleotide includes naturally occurring, and modified nucleotides linked together by naturally occurring, and/or non-naturally occurring oligonucleotide linkages. Oligonucleotides are a polynucleotide subset comprising members that are generally single-stranded and have a length of 200 bases or fewer. In certain embodiments, oligonucleotides are 2 to 60 bases in length.
  • oligonucleotides are 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, or 25 to 40 bases in length. In certain other embodiments, oligonucleotides are 25 or fewer bases in length.
  • Oligonucleotides of the invention may be sense or antisense oligonucleotides with reference to a protein- coding sequence.
  • nucleotides includes deoxyribonucleotides and ribonucleotides.
  • modified nucleotides includes nucleotides with modified or substituted sugar groups and the like.
  • oligonucleotide linkages includes oligonucleotide linkages such as phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate,
  • An oligonucleotide can include a detectable label to enable detection of the oligonucleotide or hybridization thereof.
  • highly stringent conditions refers to those conditions that are designed to permit hybridization of nucleic acid strands whose sequences are highly complementary, and to exclude hybridization of significantly mismatched sequences.
  • Hybridization stringency is principally determined by temperature, ionic strength, and the concentration of denaturing agents such as formamide.
  • Examples of "highly stringent conditions" for solution (e.g., without bead aggregation) hybridization and washing are 0.015 M sodium chloride, 0.0015 M sodium citrate at 65-68°C. or 0.015 M sodium chloride, 0.0015 M sodium citrate, and 50% formamide at 42°C. See Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual (2nd ed., Cold Spring Harbor Laboratory, 1989); Anderson et al., Nucleic Acid
  • More stringent conditions may also be used-however, the rate of hybridization will be affected.
  • Other agents may be included in the solution hybridization and washing buffers for the purpose of reducing nonspecific and/or background hybridization. Examples are 0.1 % bovine serum albumin, 0.1 % polyvinyl- pyrrolidone, 0.1 % sodium pyrophosphate, 0.1 % sodium dodecylsulfate, NaDodS0 4 , (SDS), ficoll,
  • Denhardt's solution Denhardt's solution, sonicated salmon sperm DNA (or another non-complementary DNA), and dextran sulfate, although other suitable agents can also be used.
  • concentration and types of these additives can be changed without substantially affecting the stringency of the hybridization conditions.
  • Hybridization experiments are usually carried out at pH 6.8-7.4; however, at typical ionic strength conditions, the rate of hybridization is nearly independent of pH. See Anderson et al., Nucleic Acid Hybridisation: A Practical Approach Ch. 4 (IRL Press Limited).
  • Factors affecting the stability of duplexes include base composition, length, and degree of base pair mismatch.
  • Hybridization conditions can be adjusted by one skilled in the art in order to accommodate these variables and allow nucleic acids of different sequence relatedness to form hybrids.
  • G+C is the percentage of (guanine+cytosine) bases in the hybrid.
  • the melting temperature is reduced by approximately 1 °C for each 1 % mismatch.
  • moderately stringent conditions refers to conditions under which a duplex with a greater degree of base pair mismatching than could occur under “highly stringent conditions” is able to form.
  • typical “moderately stringent conditions” in solution are 0.015 M sodium chloride, 0.0015 M sodium citrate at 50-65°C. or 0.015 M sodium chloride, 0.0015 M sodium citrate, and 20% formamide at 37-50°C.
  • “moderately stringent conditions” of 50 degree C in 0.015 M sodium ion will allow about a 21 % mismatch.
  • high stringent conditions and “moderately stringent conditions.”
  • the melting temperature of perfectly matched long DNA is about 71 °C.
  • a wash at 65°C. at the same ionic strength, this would allow for approximately a 6% mismatch.
  • one skilled in the art can simply lower the temperature or raise the ionic strength.
  • T m 2°C. per A-T base pair+4°C. per G-C base pair *
  • SSC salt sodium citrate
  • High stringency washing conditions for oligonucleotides may be at a temperature of 0-5°C below the Tm of the oligonucleotide, e.g., in 6 x SSC, 0.1 % SDS.
  • Efficient molecular analysis usually requires detecting the presence of an analyte in a very small sample at very low concentration.
  • the use of an external magnetic field in microdevices to implement magnetic bead control has previously been disclosed, e.g., by U.S. Patent Nos. 7,452,726; 6,664, 104;
  • the present invention uses magnetic beads in a magnetic field to provide a visual detection of the presence or quantity of a polymeric analyte, such as nucleic acids, lipids, polysaccharides, proteins, etc, although any source of energy that induces aggregation, such as acoustic energy or vibration may be employed.
  • a polymeric analyte such as nucleic acids, lipids, polysaccharides, proteins, etc
  • any source of energy that induces aggregation such as acoustic energy or vibration may be employed.
  • the movement and conformation of the magnetic beads induced by the magnetic field differs significantly from the aggregates.
  • the aggregate formation is specific to the presence of the binding between the polymeric analyte and the magnetic beads, and the magnetic field, and therefore, can be used to detect the presence of the analyte.
  • Aggregate formation in a mixture with a polymeric analyte may be enhanced by applying other forms of energy, e.g., by vibrating the sample.
  • the present invention relates to a method for detecting the presence of polymeric analyte in a sample by combining in an open ended hollow container, e.g., a pipette tip, the sample with magnetic beads, or another magnetic solid substrate that can be suspended in solution, and exposing the mixture to a magnetic field.
  • the presence of aggregates indicates the presence of the bound polymeric analyte.
  • the magnetic beads are coated or derivatized to specifically bind or to enhance the binding of the polymeric analyte to the magnetic beads.
  • the environment can also be manipulated to enhance the binding of the polymeric analyte to the magnetic beads. Aggregate formation is detected after the aggregate containing mixture is placed on an adsorbent substrate or absorbant substrate.
  • the substrate may contain a plurality of samples, including a positive and/or negative control sample, and/or a dilution series useful for a calibration curve.
  • a calibration curve is useful for correlating the aggregates to the polymeric analyte concentration. Such a calibration curve may be generated, for example, by subjecting known concentrations of the polymeric analyte to the energy source and determining the aggregates for each concentration.
  • the method of the invention can be added onto already existing assays or apparatuses, especially a micro-total analysis system ( ⁇ -TAS), to act as a polymeric analyte detector.
  • ⁇ -TAS micro-total analysis system
  • the presence of an antibody/antigen reaction may initiate the coupling of nucleic acids and the
  • the present invention is based on the observation that polymeric analytes, when bound to magnetic beads and in the presence a magnetic field, produce aggregates, e.g., a pinwheel effect.
  • the pinwheel effect is not seen in a static magnetic field and appears to be specific to a rotating magnetic field.
  • "Pinwheel formation” as used herein refers to a rotating mass having a circular or disc-like cross- section. The mass is made of clumps or aggregates of magnetic beads tethered by a polymeric analyte. When viewed in a still photograph, the pinwheel formation looks like a disc shaped object made of an aggregate of magnetic beads.
  • the disc shaped object when viewed visually or by imaging, the disc shaped object actually spins around its center axis similar to that of a spinning pinwheel.
  • the pinwheel formations sometimes collide together to form larger pinwheels, and sometimes collide with the wall of the chamber to break up into smaller pinwheels.
  • the method of the invention may be practiced in conjunction with an apparatus having a detection chamber that may be any fluid container that is part of or a component of a microfluidic device or micro- total analysis system ( ⁇ -TAS).
  • a microfluidic device or ⁇ -TAS contains at least one micro- channel.
  • ⁇ -TAS There are many formats, materials, and size scales for constructing ⁇ -TAS. Common ⁇ -TAS devices are disclosed in U.S. Patent Nos.
  • a ⁇ -TAS device is made up of two or more substrates that are bonded together. Microscale components for processing fluids are disposed on a surface of one or more of the substrates.
  • microscale components include, but are not limited to, reaction chambers, electrophoresis modules, microchannels, fluid reservoirs, detectors, valves, or mixers. When the substrates are bonded together, the microscale components are enclosed and sandwiched between the substrates.
  • a detection chamber may include a microchannel. At both ends of the microchannel are inlet and outlet ports for adding and removing samples from the microchannel.
  • the detection chamber may be linked to other microscale components of a ⁇ -TAS as part of an integrated system for analysis.
  • the magnetic beads may be introduced to the hollow open ended container prior to the addition of the sample or the magnetic beads may be added to the hollow open ended container after the sample is introduced to the hollow open ended container.
  • the magnetic beads may contain a surface that is derivatized or coated with a substance that binds or enhances the binding of the polymeric analyte to the magnetic beads. Some coatings or derivatizations include, but are not limited to, amine-based charge switch, boronic acid, silanization, reverse phase, oligonucleotide, lectin, antibody-antigen, peptide-nucleic acid (PNA)-oligonucleotide, locked nucleic acid (LNA)-oligonucleotide, and avidin-biotin.
  • the magnetic beads can be silica coated to specifically bind nucleic acids when exposed to a high ionic strength, chaotropic buffer.
  • a bead may also be coated with positively charged amines or oligomers for binding with nucleic acids.
  • the magnetic beads may contain a boronic acid- modified surface.
  • carbohydrates including glucose
  • the magnetic beads may be modified with hydrophobic groups, such as benzyl groups, alkanes of various lengths (6-20), or vinyl groups.
  • hydrophobic groups such as benzyl groups, alkanes of various lengths (6-20), or vinyl groups.
  • the lipids are bound to the beads by hydrophobic forces.
  • the magnetic beads may contain a protein modified surface.
  • the surface of the beads may be coated with an antibody specific for the protein of interest.
  • the bead surface may be coated with avidin or biotin and the protein of interest may be derivatized with biotin or avidin. The avidin- biotin binding thus allows the protein to bind to the beads.
  • the physical environment where the polymeric analyte comes into contact with the magnetic beads may also be altered to allow the beads to specifically bind or to enhance the binding of the magnetic beads to the polymeric analyte.
  • a silica coated bead may be manipulated to specifically bind nucleic acid, carbohydrate, or protein depending on the conditions used: binding of DNA occurs in chaotropic salt solution, binding of positively charged carbohydrates occurs in low ionic strength solutions, and binding of proteins occurs under denaturing conditions (in the presence of urea, heat, and the like).
  • the number of beads may be about 100 to about 10 8 , such as about 10 4 to 10 7 for visual detection. Fluorescence detection may allow for a smaller number of beads, e.g., about 10. The higher the concentration of analyte in the sample, the higher the amount of magnetic beads that should be employed.
  • hybridization induced aggregration assay A mixture with the beads and the target nucleic acid sequence, when heated to an appropriate temperature (annealing T), results in hybridized (annealed) sequences, which subsequently induce aggregation. Efficient hybridization induced aggregration occurs with shorter target nucleic acid molecules and under non-chaotropic conditions.
  • the assay may contain a series of the same type of beads with different oligonucleotides, where each pair of beads has sequences specific for a different target sequence having a different annealing temperature, or may have beads with different properties (such as in size or surface chemistry) that allow for distinguishing the presence of different target sequences in a sample. Once aggregation occurs, the mixture is placed on an adsorbent substrate and the aqueous solution removed, e.g., via evaporation, or placed on an absorbant substrate, and aggregate formation detected or quantitated.
  • the components of the magnetic field in the x-axis and z-axis are essentially negligible in the center of the magnetic field and thus are likely not critical to pinwheel formation.
  • the magnetic field in the y-axis may have a strength of about 1 to 5,000 gauss, e.g., about 10 to 1000 gauss. Additionally, regardless of the shape of the magnet, the magnetic field component in the y-axis may obtain its maximum strength at the center of rotation and is at its minimum strength at both poles of the magnet.
  • the field component may be maximized along the length of the magnet and may abruptly drop to its minimum at the poles.
  • the field component does not significantly decrease off either side of the magnet.
  • the magnetic field lines at the detection chamber may be parallel to the xy-plane in which the detection chamber lies.
  • the presence of aggregates can be detected visually, or using optical or imaging instrumentation.
  • One way to detect aggregates is to photograph or record a video of the detection chamber. This may be accomplished by the image or recording of one chamber at a time or multiple chambers.
  • a computer program can then be used to detect the aggregates in the photograph or video.
  • the program may initially upload and crop the image (photograph or frames of a video) so that only the detection chamber is shown.
  • the cropped image may then converted to gray scale.
  • An extended minima transformation is then performed with a threshold between about 40 to 70 to isolate the magnetic microparticles from the background pixels.
  • Once holes within each object are filled in, each object may then be labeled, e.g., with a separate RGB color. A boundary is then created around each distinct object.
  • m is greater than about 0.8, such as greater than about 0.95, that object is defined as a pinwheel.
  • a centroid is then plotted over each object having m greater than about 0.8 (a pinwheel). If a photograph is used, the number of pinwheels is then counted. If a video is used, the steps are repeated for each frame of the video and the average number of pinwheels per frame is calculated.
  • the program returns the result that polymeric analyte is present in the sample. See, for example, WO 2009/1 14709, the disclosure of which is incorporated by reference herein.
  • one possible system contains at least a camera and a computer for running the computer program.
  • the camera takes pictures or video of the detection chamber and the images from the camera is analyzed by the computer.
  • the computer may be electronically connected to the camera for automatically downloading and processing the images from the camera as discussed above.
  • Particles useful in the practice of the invention include metal (e.g., gold, silver, copper and platinum), semiconductor (e.g., CdSe, CdS, and CdS or CdSe coated with ZnS) and magnetic (e.g., ferromagnetite) as colloidal materials, as well ZnS, ZnO, Ti02, Agl, AgBr, Hgl 2 , PbS, PbSe, ZnTe, CdTe, ln 2 S 3 , ln 2 Se 3 , Cd 3 P 2 , Cd 3 As 2 , InAs, and GaAs, and silica and polymer (e.g., latex) particles.
  • metal e.g., gold, silver, copper and platinum
  • semiconductor e.g., CdSe, CdS, and CdS or CdSe coated with ZnS
  • magnetic e.g., ferromagnetite
  • the particles may have any shape, e.g., spheres (generally referred to as beads) or rods, or irregular shapes, and a population of particles may have particles that vary in shape or size, e.g., beads in a population of beads may not have a uniform shape or diameter.
  • the size of the particles may be from about 1 nm to about 300 micrometers ( ⁇ ) (mean diameter for rods or spheres), such as from about 0.5 to about 250 ⁇ , or from about 2 to about 10 ⁇ .
  • the particles may be coated or derivatized with agents, e.g., to enhance binding of a selected analyte.
  • particles may include a silica coating or be derivatized with streptavidin.
  • the methods provided include those utilizing particles which range in size from about 1 micrometers to about 250 micrometers in mean diameter, about 1 micrometers to about 240 micrometers in mean diameter, about 1 micrometers to about 230 micrometers in mean diameter, about 1 micrometers to about 220 micrometers in mean diameter, about 1 micrometers to about 210 micrometers in mean diameter, about 1 micrometers to about 200 micrometers in mean diameter, about 1 micrometers to about 190 micrometers in mean diameter, about 1 micrometers to about 180 micrometers in mean diameter, about 1 micrometers to about 170 micrometers in mean diameter, about 1 micrometers to about 160 micrometers in mean diameter, about 1 micrometers to about 150 micrometers in mean diameter, about 1 micrometers to about 140 micrometers in mean diameter, about 1 micrometers to about 130 micrometers in mean diameter, about 1 micrometers to about 120 micrometers in mean diameter, about 1 micrometers to about 1 10 micrometers in mean diameter, about 1 micrometers to
  • the size of the particles is from about 5 micrometers to about 150 micrometers, from about 5 to about 50 micrometers, from about 10 to about 30 micrometers.
  • the size of the particles is from about 5 micrometers to about 150 micrometers, from about 30 to about 100 micrometers, from about 40 to about 80 micrometers.
  • the magnetic particle may have an effective diameter of about 0.25 to 50 micrometers, including from about 0.5 to about 1.5 micrometers or from about 3 to about 15 micrometers.
  • the size of the beads may be matched with the expected size of the polymeric analyte, e.g., nucleic acid, being detected.
  • Bead size can be tuned to the specific cutoff in size needed for discrimination, including optical properties or amount surface area that can be derivatized.
  • MagneSil particles (Promega Corp, Madison, Wl) are employed. MagneSil particles are paramagnetic particles (iron-cored silicon dioxide beads) of about 8 micrometers in average diameter with the overall range of about 4 to about 12 microns in diameter. Those particles can be loaded into an open ended container and contacted with sample DNA, and then subjected to an energy that induces aggregate formation, e.g., a magnetic field from an external magnet.
  • an energy that induces aggregate formation e.g., a magnetic field from an external magnet.
  • oligonucleotides of a predetermined sequence are well-known. See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual (2nd ed. 1989) and F. Eckstein (ed.) Oligonucleotides and Analogues, 1st Ed. (Oxford University Press, New York, 1991 ). Solid-phase synthesis methods are contemplated for both oligoribonucleotides and oligodeoxyribonucleotides (the well-known methods of synthesizing DNA are also useful for synthesizing RNA). Oligoribonucleotides and oligodeoxyribonucleotides can also be prepared enzymatically.
  • Non-naturally occurring nucleobases can be incorporated into the oligonucleotide, as well. See, e.g., Katz, J. Am. Chem. Soc, 74:2238 (1951 ); Yamane, et al., J. Am. Chem. Soc, 83:2599 (1961 ); Kosturko, et al., Biochemistry, 13:3949 (1974); Thomas, J. Am. Chem. Soc, 76:6032 (1954); Zhang, et al., J. Am. Chem. Soc, 127:74-75 (2005); and Zimmermann, et al., J. Am. Chem. Soc, 124: 13684-13685 (2002).
  • oligonucleotide as used herein includes modified forms as discussed herein as well as those otherwise known in the art which are used to regulate gene expression. Likewise, the term “oligonucleotide” as used herein includes modified forms as discussed herein as well as those otherwise known in the art which are used to regulate gene expression. Likewise, the term “oligonucleotide” as used herein includes modified forms as discussed herein as well as those otherwise known in the art which are used to regulate gene expression. Likewise, the term
  • nucleotides as used herein is interchangeable with modified forms as discussed herein and otherwise known in the art.
  • the art uses the term “nucleobase” which embraces naturally- occurring nucleotides as well as modifications of nucleotides that can be polymerized.
  • nucleotides and nucleobases are used interchangeably to embrace the same scope unless otherwise noted.
  • the methods may employ oligonucleotides which are DNA oligonucleotides,
  • RNA oligonucleotides or combinations of the two types.
  • Modified forms of oligonucleotides are also contemplated which include those having at least one modified internucleotide linkage.
  • the oligonucleotide is all or in part a peptide nucleic acid (PNA) or includes LNA (see Koskin et al., Tetrahedron, 54:3607 (1998)).
  • Other modified internucleoside linkages include at least one phosphorothioate linkage.
  • Still other modified oligonucleotides include those comprising one or more universal bases.
  • Universal base refers to molecules capable of substituting for binding to any one of A, C, G, T and U in nucleic acids by forming hydrogen bonds without significant structure destabilization.
  • the oligonucleotide incorporated with the universal base analogues is able to function as a probe in hybridization, as a primer in PCR and DNA sequencing.
  • Examples of universal bases include but are not limited to 5'-nitroindole-2'-deoxyriboside, 3-nitropyrrole, inosine, and hypoxanthine.
  • oligonucleotides include those containing modified backbones or non-natural internucleoside linkages. Oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. Modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone are considered to be within the meaning of "oligonucleotide.”
  • Modified oligonucleotide backbones containing a phosphorus atom include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters,
  • aminoalkylphosphotriesters methyl and other alkyl phosphonates including 3'-alkylene phosphonates, 5'- alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3' to 3', 5' to 5' or 2' to 2' linkage.
  • oligonucleotides having inverted polarity comprising a single 3' to 3' linkage at the 3'-most internucleotide linkage, i.e. a single inverted nucleoside residue which may be abasic (the nucleotide is missing or has a hydroxyl group in place thereof).
  • Salts, mixed salts and free acid forms are also contemplated.
  • Representative United States patents that teach the preparation of the above phosphorus-containing linkages include, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301 ; 5,023,243; 5,177,196; 5, 188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717;
  • Modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyi internucleoside linkages, mixed heteroatom and alkyl or cycloalkyi internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
  • oligonucleotide mimetics wherein both one or more sugar and/or one or more internucleotide linkage of the nucleotide units are replaced with "non-naturally occurring" groups.
  • this embodiment contemplates a peptide nucleic acid (PNA).
  • PNA compounds the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone. See, for example US Patent Nos. 5,539,082; 5,714,331 ; and 5,719,262, and Nielsen et al., Science, 1991 , 254, 1497-1500, the disclosures of which are herein incorporated by reference.
  • oligonucleotides are provided with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and including— CH 2 — NH— O— CH 2 — ,— CH 2 — N(CH 3 )— O— CH 2 — ,— CH 2 — O— N(CH 3 )— CH 2 — ,— CH 2 — N(CH 3 )— N(CH 3 )— CH 2 — and— O— N(CH 3 )— CH 2 — CH 2 — described in US Patent Nos. 5,489,677, and 5,602,240. Also contemplated are oligonucleotides with morpholino backbone structures described in US Patent No. 5,034,506.
  • Modified oligonucleotides may also contain one or more substituted sugar moieties.
  • oligonucleotides comprise one of the following at the 2' position: OH; F; 0-, S-, or N-alkyl; 0-, S-, or N-alkenyl; 0-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C-i to C 10 alkyl or C 2 to C 10 alkenyl and alkynyl.
  • Other embodiments include 0[(CH 2 ) n O] m CH 3 , 0(CH 2 ) n OCH 3 , 0(CH 2 ) n NH 2 , 0(CH 2 ) n CH 3 , 0(CH 2 ) n ONH 2 , and 0(CH 2 ) n ON[(CH 2 ) n CH 3 ] 2 , where n and m are from 1 to about 10.
  • oligonucleotides comprise one of the following at the 2' position: C-i to C 10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O- aralkyl, SH, SCH 3 , OCN, CI, Br, CN, CF 3 , OCF 3 , SOCH 3 , S0 2 CH 3 , ON0 2 , N0 2 , N 3 , NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties.
  • a modification includes 2'-methoxyethoxy (2'-0-CH 2 CH 2 OCH 3 , also known as 2'-0-(2-methoxyethyl) or 2 -MOE) (Martin et al., Helv. Chim. Acta, 78:486-504 (1995)) i.e., an alkoxyalkoxy group.
  • modifications include 2'-dimethylaminooxyethoxy, i.e., a 0(CH 2 ) 2 ON(CH 3 ) 2 group, also known as 2 -DMAOE, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-0- dimethyl-amino-ethoxy-ethyl or 2 -DMAEOE), i.e., 2'-0— CH 2 — O— CH 2 — N(CH 3 ) 2 , also described in examples herein below.
  • 2'-dimethylaminooxyethoxy i.e., a 0(CH 2 ) 2 ON(CH 3 ) 2 group, also known as 2 -DMAOE
  • 2'-dimethylaminoethoxyethoxy also known in the art as 2'-0- dimethyl-amino-ethoxy-ethyl or 2 -DMAEOE
  • Still other modifications include 2'-methoxy (2'-0— CH 3 ), 2'-aminopropoxy (2'-OCH 2 CH 2 CH 2 NH 2 ),
  • the 2'-modification may be in the arabino (up) position or ribo (down) position.
  • a 2'-arabino modification is 2'-F.
  • Similar modifications may also be made at other positions on the oligonucleotide, for example, at the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked oligonucleotides and the 5' position of 5' terminal nucleotide.
  • Oligonucleotides may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. See, for example, U.S. Pat. Nos. 4,981 ,957; 5,1 18,800; 5,319,080;
  • a modification of the sugar includes Locked Nucleic Acids (LNAs) in which the 2'- hydroxyl group is linked to the 3' or 4' carbon atom of the sugar ring, thereby forming a bicyclic sugar moiety.
  • the linkage is in certain aspects is a methylene (— CH 2 — ) n group bridging the 2' oxygen atom and the 4' carbon atom wherein n is 1 or 2.
  • LNAs and preparation thereof are described in WO 98/39352 and WO 99/14226.
  • Oligonucleotides may also include base modifications or
  • unmodified or “natural” bases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
  • Modified bases include other synthetic and natural bases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2- propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8- thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5- trifluoro
  • Further modified bases include tricyclic pyrimidines such as phenoxazine cytidine(1 H-pyrimido[5 ,4-b][1 ,4]benzoxazin-2(3H)-one), phenothiazine cytidine (1 H- pyrimido[5 ,4-b][1 ,4]benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g.
  • Modified bases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further bases include those disclosed in U.S. Pat. No.
  • bases are useful for increasing the binding affinity and include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2- aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.
  • 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C. and are, in certain aspects combined with 2'- O-methoxyethyl sugar modifications. See, U.S. Pat. Nos. 3,687,808, U.S. Pat. Nos. 4,845,205;
  • a “modified base” or other similar term refers to a composition which can pair with a natural base (e.g., adenine, guanine, cytosine, uracil, and/or thymine) and/or can pair with a non-naturally occurring base.
  • the modified base provides a T m differential of 15, 12, 10, 8, 6, 4, or 2°C or less.
  • Exemplary modified bases are described in EP 1 072 679 and WO 97/12896.
  • An oligonucleotide, or modified form thereof may be from about 20 to about 100 nucleotides in length. In one embodiment, the oligonucelotide is from 5 to 50 nucleotides in length or any integer in between.
  • the oligonucleotide is about 20 to about 90 nucleotides in length, about 20 to about 80 nucleotides in length, about 20 to about 70 nucleotides in length, about 20 to about 60 nucleotides in length, about 20 to about 50 nucleotides in length about 20 to about 45 nucleotides in length, about 20 to about 40 nucleotides in length, about 20 to about 35 nucleotides in length, about 20 to about 30 nucleotides in length, about 20 to about 25 nucleotides in length, or about 15 to about 90 nucleotides in length, about 15 to about 80 nucleotides in length, about 15 to about 70 nucleotides in length, about 15 to about 60 nucleotides in length, about 15 to about 50 nucleotides in length about 15 to about 45 nucleotides in length, about 15 to about 40 nucleotides in length, about 15 to about 35 nucleotides in length, about 15 to about
  • oligonucleotides of 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, and 100 nucleotides in length are contemplated.
  • Hybridization which is used interchangeably with the term “complex formation” herein, means an interaction between two or three strands of nucleic acids by hydrogen bonds in accordance with the rules of Watson-Crick DNA complementarity, Hoogstein binding, or other sequence-specific binding known in the art. Hybridization can be performed under different stringency conditions known in the art.
  • the methods include use of oligonucleotides which are 100% complementary to another sequence, i.e., a perfect match, while in other aspects, the individual oligonucleotides are at least (meaning greater than or equal to) about 95% complementary to all or part of another sequence , at least about 90%, at least about 85%, at least about 80%, at least about 75%, at least about 70%, at least about 65%, at least about 60%, at least about 55%, at least about 50%, at least about 45%, at least about 40%, at least about 35%, at least about 30%, at least about 25%, at least about 20%
  • oligonucleotide is capable of hybridizing to the target sequence.
  • sequence of the oligonucleotide used in the methods need not be 100% complementary to a target sequence to be specifically hybridizable. Moreover, an
  • oligonucleotide may hybridize to a target sequence over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure).
  • Percent complementarity between any given oligonucleotide and a target sequence can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 215: 403 ⁇ 10 (1990); Zhang and Madden, Genome Res., 7:649-656 (1997)).
  • the stability of the hybrids is chosen to be compatible with the assay conditions. This may be accomplished by designing the nucleotide sequences in such a way that the T m will be appropriate for standard conditions to be employed in the assay.
  • the position at which the mismatch occurs may be chosen to minimize the instability of hybrids. This may be accomplished by increasing the length of perfect complementarity on either side of the mismatch, as the longest stretch of perfectly homologous base sequence is ordinarily the primary determinant of hybrid stability.
  • the regions of complementarity may include G:C rich regions of homology.
  • the length of the sequence may be a factor when selecting oligonucleotides for use with particles. In one embodiment, at least one of the
  • oligonucleotides has 100 or fewer nucleotides, e.g., has 15 to 50, 20 to 40, 15 to 30, or any integer from 15 to 50, nucleotides. Oligonucleotides having extensive self-complementarity should be avoided. Less than 15 nucleotides may result in a oligonucleotide complex having a too low a melting temperature to be suitable in the disclosed methods. More than 100 nucleotides may result in a oligonucleotide complex having a too high melting temperature to be suitable in the disclosed methods. Thus, oligonucleotides are of about 15 to about 100 nucleotides, e.g., about 20 to about 70, about 22 to about 60, or about 25 to about 50 nucleotides in length.
  • a functionalized particle has at least a portion of its surface modified, e.g., with an oligonucleotide.
  • any particle having oligonucleotides attached thereto suitable for use in detection assays and that do not interfere with oligonucleotide complex formation, i.e., hybridization to form a double-strand complex.
  • oligonucleotides with sequences (a and b) complementary to a target nucleic acid sequence (having a' and b') are prepared.
  • the oligonucleotides a and b are functionalized to two types of particles in a way that oligonucleotide a is attached to the particle by its 3' OH group, and oligonucleotide b is attached to the particle by the 5' P0 4 3 - group.
  • At least one oligonucleotide is bound through a spacer to the particle.
  • the spacer is an organic moiety, a polymer, a water-soluble polymer, a nucleic acid, a polypeptide, and/or an oligosaccharide.
  • 555-557 (1996) (describes a method of attaching 3' thiol DNA to flat gold surfaces; this method can be used to attach oligonucleotides to particles).
  • the alkanethiol method can also be used to attach oligonucleotides to other metal, semiconductor and magnetic colloids and to the other particles listed above.
  • Other functional groups for attaching oligonucleotides to solid surfaces include phosphorothioate groups (see, e.g., U.S. Patent No. 5,472,881 for the binding of oligonucleotide-phosphorothioates to gold surfaces), substituted alkylsiloxanes (see, e.g. Burwell, Chemical Technology, 4:370-377 (1974) and Matteucci and Caruthers, J. Am. Chem. Soc,
  • Oligonucleotides terminated with a 5' thionucleoside or a 3' thionucleoside may also be used for attaching oligonucleotides to solid surfaces.
  • the particles, the oligonucleotides or both are functionalized in order to attach the
  • oligonucleotides to the particles. Such methods are known in the art.
  • Each particle will have a plurality of oligonucleotides attached to it.
  • each particle- oligonucleotide conjugate can bind to a plurality of oligonucleotides or nucleic acids having the complementary sequence.
  • a RMF centered on a microfluidic chamber containing a minute mass of magnetic silica beads reveals the presence of a select polymeric analyte in the sample through bead aggregation and the formation of 'pinwheels'.
  • the beads remain in the 'dispersed' formation.
  • a dynamic range of hgDNA-induced pinwheel formation o was observed ver three orders of magnitude, from 10 ng/ ⁇ to 10 pg/ ⁇ .
  • the mass of beads in the chamber was tuned to match the mass of hgDNA needed for pinwheel formation.
  • the system described above provides a versatile, visual detection technique and related apparatus to detect and quantify polymeric molecules that bind to magnetic beads under certain conditions, e.g., conditions related to binding chemistries. Moreover, the technique may be conducted with only a minute mass of magnetic beads, e.g. as low as a few beads per assay, in a microfluidic chamber.
  • Pre-purified DNA dilute using 8 M GuHCI solution to appropriate concentrations
  • step 5 for unknown DNA samples.
  • PMMA plate up to 16 DNA-magnetic beads mixtures can be prepared and measured together.
  • step 8 for all the other wells containing samples.
  • Open 8-bit images set threshold using triangle method in the multithresholder, click analyze- >analyze particle to acquire the number of pixels below the threshold since beads are darker than background.
  • Figure 1 shows the results of 5 and 10 ⁇ _ of MagneSil paramagnetic particle suspension mixed with different amounts of HeLa cells. The graph is based on the assumption that there was 6.25 pg of DNA per cell.
  • magnetic particles with DNA concentration may be at least 1 to 5 pg/uL, assuming 6.25 pg/cell
  • detection of aggregates may be accomplished using a camera, a light source, a rotating magnetic field (RMF), a substrate for the sample such as PDMS-glass microwell chip, and magnetic particles, e.g., magnetic beads such as super paramagnetic silica-coated particles (about 5 ⁇ in diameter).
  • a threshold value is set automatically by isodata algorithm. Pixels below threshold are considered dark, and the dark area of a sample without DNA is used to normalize DNA sample data. The dark area of a sample with DNA over the dark area of a sample without DNA times 100 is the dark area percent (%) (see Figure 2).
  • pinwheel effect can be utilized to define the concentration of DNA directly from blood samples, and that different concentrations for each correlated with measurement of DNA via the conventional method.
  • the results show that the pinwheel assay can be used to determine cell number.
  • a pinwheel assay of the diluted samples yielded overlapping curves, certifying that a consistent pinwheel response was obtained and that the degree of bead aggregation tracked with the number of WBC in each sample.
  • the results for the pinwheel assay correlate quite well with those from the Coulter Counter.
  • WBC counts between 5,000 and 10,000 per ⁇ _ of blood were generally within 25% error, while outside of that range, > 50% error was observed. This may be corrected by dilution of the blood sample.
  • the concentration of WBCs was plotted as a function of dark area and dilution factor, from which the concentration of WBC can be read directly after a pinwheel assay. For example, one could dilute an unknown sample to a certain fold, obtain the dark area, and find its position.
  • the method can be used to test if the concentration of WBCs in an unknown blood sample is within the normal range (4,000 to 1 1 ,000 per ⁇ _).
  • Phages specifically infect certain bacteria and reproduce many times over during the course of several hours. This reproduction can be quantified via a pinwheel assay of the DNA in the phage.
  • Figure 4 shows a graph with results from a pinwheel assay using purified phage DNA.
  • Figure 5 shows the percent of dark area versus phage number (A) or concentration (B).
  • M13 Phage (From Ph.DTM -7 Phage Display Peptide Library) were amplified through ER2738 E. coli, and phage were suspended in 1x TE (5 x 10 7 phage/ ⁇ .).
  • 2.5 to 3 ⁇ _ beads + a 5 ⁇ _ phage sample in TE + about 10 to 12.5 ⁇ _ GuHCI (8M) were mixed.
  • Figure 5B show the limit of detection for these phage under the tested conditions, which is around 10 5 phage per ⁇ _.
  • a 10 ml_ sample with 100 E. coli bacteria was incubated with 1000 phage for 5 hours ( Figure 6), and then the culture was centrifuged at 10,000 rpm for 10 minutes. The supernatant containing phage was transferred to a new tube and the phage were concentrated via standard polyethylene glycol precipitation (1/6 volume added). Phage samples were then analyzed by both titering and a pinwheel assay. 5 ⁇ _ of the original sample, and of a 1 : 100 diluted, and a 1 : 1000 diluted sample, were mixed with 2.5 ⁇ _ beads.
  • phage were able to produce a pinwheel at a concentration of 40,000 phage/ ⁇ ., indicating the ability to positively detect a bacteria contaminated sample via this method.
  • 100 E. coli in 10 mL did not result in pinwheel formation, the infection of the same number of cells with phage allowed for detection by a pinwheel assay, regardless of phage concentration.
  • Phage diluted 1 : 1000 and 1 : 100 resulted in a 70% and 25% dark area, respectively, corresponding to about 10 and 100 x 10 4 phage per ⁇ _. Considering the dilution factor, it was calculated that 4 x 10 8 phage/ ⁇ . were present in the nondiluted sample 5 hours after infection.
  • the assay may detect as few as 1 to 10 cells in a sample.
  • Phage useful in the invention include, but are not limited, to those in one of the following families: Myoviridae, Siphoviridae, Podoviridae, Tectiviridae, Corticoviridae, Lipothrixviridae,
  • Plasmaviridaa Rudiviridae, Fuselloviridae, Inoviridae, Microviridae, Leviviridae, or Cystoviridae.
  • Exemplary Myoviridae include Mycobacterium phage 13, Enterobacteria phage Mu,
  • Enterobacteria phage P1 Aeromonas phage 43, Haemophilus phage HP1 , Halobacterium phage phiH, Pseudomonas phage phiKZ, Pseudomonas phage EL, Pseudomonas phage Lin68, Bacillus phage SP01 , Enterobacteria phage T4, Acinetobacter phage 133, Aeromonas phage 44RR2.8f, Aeromonas phage 65, Aeromonas phage Aeh1 , Enterobacteria phage SV14, Enterobacteria phage T2, Pseudomonas phage 42, Vibrio phage nt-1 , Bacillus phage G, Bacillus phage PBS1 , and Microcystis aeruginosa phage Ma-LMM01.
  • Exemplary Siphoviridae include Lactococcus phage c2, Lactococcus phage bll_6, Mycobacterium phage L5, Mycobacteria phage D29, Enterobacteria phage lambda, Enterobacteria phage HK022, Enterobacteria phage HK97, Enterobacteria phage N15, Streptomyces phage phiC31 , Methanobacterium phage psiM1 , Bacillus phage SPbeta, Enterobacteria phage T1 , Enterobacteria phage T5 and Vibrio phage 149 (type IV).
  • Exemplary Podoviridae include Salmonella phage BPP-1, Bordetella phage BPP-1 , Burkholderia phage BcepC6B, Salmonella phage epsilon 15, Escherichia phage PhiV10, Pseudomonas phage LUZ24, Pseudomonas phage PaP3, Enterobacteria phage N4, Enterobacteria phage P22, Salmonella phage HK620, Salmonella phage ST64T, Shigella phage Sf6, Enterobacteria phage Phieco32, Endosymbiont phage APSE-1 , Lactococcus phage KSY1 , Phormidium phage Pf-WMP3, Phormidium phage Pf-WMP4, Pseudomonas phage 1 19X, Pseudomonas phage F1 16, Roseobacter phage SI01
  • Microviridae include Enterobacteria phage ⁇ 174, Spiroplasma phage 4, Bdellovibrio phage MAC7 and Chlamydia phage 1.
  • Specific phage tha may be useful include, but are not limited to, ⁇ phage, T2 phage, T4 phage, T7 phage, T12 phage, R17 phage, MS2 phage, G4 phage, P1 phage, Enterobacteria phage P2, P4 phage, Phi X 174 phage, N4 phage, ⁇ 6 phage, ⁇ 29 phage, 186 phage or D29 phage.
  • WGA whole genome amplification
  • PCR protocols have been employed for amplification of a sizable fraction of the genome, leading to about 6 Kbp amplified fragments. If fragments can be generated using PCR that are > about 3 Kbp, a pinwheel assay may be employed to detect those viruses (see Figure 5).
  • the aggregation observed in a RMF allows for the qualitative detection of DNA and other (e.g., polysaccharides) polymeric analytes, quantitative determination of DNA by coupling to simple image analysis, quantitative determination of polymeric analytes such as DNA in crude samples, cell counts in cells that contain DNA (e.g., WBCs, and cultured bacteria), coupling with PCR to amplify large sections of viral genomes for virus detection, and coupling with phage infection of bacteria to amplify the phage so that, upon quantitating the number of phage by the aggregates, the original number of bacteria can be back-calculated.
  • DNA e.g., polysaccharides
  • the data described above used free solution interaction of the beads with the DNA in an open microliter volume well (e.g., a simple microchip) as a means of allowing the observation of aggregate, e.g., pinwheel, formation, which after terminating the RMF stays 'locked' for image analysis.
  • the present method induces aggregate formation in an open ended container, such as a pipette tip, where the sample is drawn into a tip already containing beads, and then the tip is subjected to a brief exposure of a magnetic field (not necessarily a rotating one) to induce aggregation.
  • the aggregates are then expelled onto an absorbant substrate, such as filter paper, to 'lock' the aggregate formation into one that can be interpreted by image analysis.
  • Image analysis of the 'blot' can yield quantitative information about the mass of polymeric analyte, e.g., DNA, present.
  • Example VII the color saturation histogram of each image was taken, and the pixels were counted representing all the dispersed beads and aggregates as 'dark area', which decreases with DNA concentration.
  • the new 'dark area' values are higher than the old ones for the same aggregation. This effect was demonstrated by the use of a cell phone camera with 3M pixels, which has a much lower resolution than the scanner.
  • Figure 7A is a schematic of one exemplary method that employs a pipette tip as a receptacle for mixing a sample and particles.
  • Blotted beads alone provide a distinct 'dispersed' pattern akin to the free solution microwell images, while blotted aggregated beads with DNA in provide a distinct 'pinwheel-like' pattern akin to the free solution microwell images that could be interpreted quantitatively.
  • drawing up of a sample suspected of having a polymeric analyte into a pipette tip with magnetic beads provides sufficient turbulence to expose the polymeric analyte to the beads.
  • Exposure of the mixture to an energy form that induces aggregation yields aggregates that are transferred to a support. The support is scanned to detect the aggregates and image analysis used to quantify aggregate formation.
  • a more portable and cost-effective approach is one in which the aggregates are prepared in an 'image-ready' form on filter paper and transformed into quantitative digital information by a photo scanner or a cell phone camera.
  • the assay (“PAB” assay, pipette, aggregate and blot) enables rapid quantification of nanogram-scale samples prior to downstream analysis with enhanced simplicity, portability and cost-effectiveness compared with conventional techniques.
  • the PAB assay could serve as a starting point towards more integrated lab-on-paper devices for point-of-care genetic analysis in resource-limited regions.
  • Dynabeads® MyOneTM SILANE was purchased from Life Technologies. 8 ⁇ Magnesil paramagnetic beads were purchased from Promega. Lambda phage genomic DNA (48.5 kb long) was purchased from USB (Cleveland, OH). Human genomic DNA was purified from whole blood with DNA isolation kit purchased from QIAGEN. Whole blood samples were donated by consenting donors.
  • STR analysis was performed according to manufacture's instruction. Briefly, DNA samples were amplified using the AmpFISTR COfiler kit reagents, and the PCR products were separated on ABI PRISM 310 Genetic Analyzer, which generates electropherograms for further interpretation.
  • the pinwheel assay has been shown as a simple, cost-effective, and accurate method for DNA guantification, and towards more specific and practical applications, two formats of the assay are evolving: (1 ) a multiplexed version that can accept multiple samples in parallel and generate guantitative results with high throughput, and (2) a simplified version with enhanced portability and cost-effectiveness.
  • (1 ) a multiplexed version that can accept multiple samples in parallel and generate guantitative results with high throughput
  • (2) a simplified version with enhanced portability and cost-effectiveness For point-of-care testing, especially in developing regions, cost-effectiveness is often of more importance than performance because of economics, and due to the lack of well-trained personnel, simplicity is also necessary.
  • the aim was to develop a new DNA guantification method at the point of care.
  • the PAB assay utilizes the most simple, inexpensive, and readily available materials in research laboratories, such as pipette tips and filter paper, and uses one of the most prevalent electronic devices - cell phones- as the modality for data acguisition, transmission and analysis.
  • the PAB assay includes: (1 ) pipetting silica-coated magnetic beads in 8 M GuHCI and DNA sample, (2) promoting aggregation of DNA and beads by exposure to a magnetic field, (3) dispensing the pipetted volume (blotting) onto filter paper, (4) acguiring the image of blotted filter paper with a photo scanner or a cell phone camera, and (5) transferring the data from the scanner to a computer for guantitative processing.
  • a cell phone camera iphone 3GS with 3 M pixels
  • acguire images also suffices the need of guantification.
  • cell phones can also send the data to a central laboratory and receive results through cellular network, or with the computing power of a smartphone, the data can be processed on site.
  • the beads in the absence of DNA, remain in a dispersed state in the droplet in pipette tip, and they spread over a large area when dispensed onto filter paper.
  • DNA strands adsorb onto the silica surface of beads driven by 8 M GdnHCI, and the applied magnetic field brings the DNA-coated beads into proximity to promote bead aggregation, which only occupies a small area after blotted on the filter paper.
  • the sensitivity of the PAB assay can be tuned by varying the bead size, since the same amount of DNA can bind to more beads with smaller diameter.
  • the aggregation of 1 ⁇ beads was visually detectable at 0.8 ng/ ⁇ .. DNA while for 8 ⁇ beads, the same aggregation does not happen until DNA concentration rises to 6.4 ng/ ⁇ ..
  • a quantitative analysis clearly shows that the sensitivity increased by 6 fold as the diameter decreased from 8 ⁇ to 1 ⁇ , and that a 1 : 1 mixture of the two sizes resulted in a moderate sensitivity between the previous two values.
  • the effect of bead size on aggregation indicated that the standard curve can be tuned by adjusting the mean bead diameter, and better sensitivity could be achieved with magnetic beads at nanometer scale.
  • a Qiagen DNA extraction kit was selected to purify human genomic DNA (hgDNA) from raw blood, and after the PAB assay, the samples with appropriate DNA concentrations were selected for PCR and STR analysis.
  • the Qiagen kit and conventional PCR-based STR analysis are not ideal for cost-effective point- of-care testing, but due to the lack of commercially available lab-on-paper devices, they were combined with the PAB assay to demonstrate the significance of DNA quantification in genetic analysis.
  • Figure 10A illustrates the standard curve for the quantification of purified hgDNA with 1 ⁇ beads, based on which the DNA concentration of seven unknown samples was measured and correlated with the results from UV-Vis spectroscopy ( Figure 10B).
  • the Bland-Altman plot (not shown) showed a moderate accuracy of the PAB assay ( ⁇ 0.7 ng/ ⁇ . difference at 95% confidence comparing to UV-Vis).
  • STR analysis has been a standard technique to discriminate DNA samples in molecular biology and forensic science.
  • a COfiler PCR amplification kit was used to amplify 7 STR loci, which were separated and detected via capillary electrophoresis. The PCR reaction requires 1 .0 - 2.5 ng/ ⁇ .
  • a cell phone camera was tested as the detector instead of desktop photo scanner.
  • the photo scanner generated digital images with high resolution and consistent lighting conditions, which may be challenging for cell phone camera under ambient light.
  • the 3M-pixel camera on iphone 3GS was used to acquire the images of aggregation on filter paper, resulting in a 18.7-fold decrease of the number of pixels per image.
  • this change of digital resolution leads to failure of quantifying small aggregates represented the noisy profile above 100 saturation ( Figure 14B), the dark area values remained distinguishable at different DNA concentrations because the camera can still quantify the area of dispersed beads, which is the major contributor of dark area.
  • the PAB assay quantifies DNA concentration by measuring the aggregation of magnetic beads, and it significantly lowers the cost of DNA quantification by eliminating the need of fluorescent labels. Similar approaches exist, such as colorimetric detection with gold nanoparticles with paper-based device (Zhao et al., Anal. Chem., 80:8431 (2008)).
  • the PAB assay surpasses the reported method in two aspects: (1 ) magnetic field induces bead aggregation much more effectively than diffusion, which shortens reaction time from hours to several minutes; (2) a more sophisticated algorithm provides more quantitative analysis than in the previous report.
  • sample 1 ⁇ _ of sample (suspected of having a specific target sequence).
  • the sample may be heated using a heated stir plate at max RPM, covering the wall with a piece of glass to prevent evaporation, after which the following are added:
  • a pinwheel forms in the center of the well when the complementary connector anneals to primer sequences and RMF is applied, which brings the beads together, then a picture is taken.
  • a 100 bp connection was formed when a connector (target) sequence
  • the size of the pinwheel did not change with concentration, just the amount of pinwheels formed.
  • the hybridization induced aggregation method can not only quantify the amount of connection but also can give a range of length of connection.
  • Lambda_probe_5' - [BioTEG]TTTTTTGGTTATCGAAATCAGCCACAGCGCC (SEQ ID NO:5) were employed to detect a 500 bp PCR product
  • Primer sequences typically used for qPCR are bound to a silica-like beads through streptavidin- biotin linkages. Beads having oligonucleotides with those linkages were prepared; forward primer:
  • CGGGAAGGGAACAGGAGTAAG SEQ ID NO:7; and reverse primer: CCAATCCCAGGTCTTCTGAACA (SEQ ID NO:8).
  • Those sequences are specific for a 68 bp target region of a human TPOX locus (cgggaagggaacaggagtaagAccagcgcacagcccgacttgTgttcagaagacctgggattgg; SEQ ID NO:9).
  • Pinwheels formed upon addition of hgDNA For some hybridization induced aggregation assays, restriction enzymes or other nucleases may be employed to create smaller hgDNA fragments.
  • the hybridization induced aggregation assay may be employed to detect specific DNAs in complex matrices, e.g., whole blood, DNAs such as cancer biomarkers, species specific DNA, e.g., human vs. animal detection in an unknown sample, male versus female detection or in an unknown sample, or exclusion of a suspect's DNA in criminal investigations.
  • the assay allows for fluorescent label- free detection of specific sequences, is rapid (5 minutes) and is low cost, e.g., due to minimal instrumentation.
  • the assay can be used to determine specific sequences of varying length and annealing temperatures, and so is a format suitable for multiplexing.
  • a hybridization induced aggregation assay employs an absorptive substrate with a read-out that provides sequence-specific information. Since the beads only aggregate when the target is present, the stark contrast on the absorptive substrate, e.g., filter paper, between aggregated and non-aggregated is, at the very least, qualitative for the presence of that specific sequence.
  • Figure 18 shows this effect on Whatman filter paper with oligo-adducted magbeads specific for a 26 base target.
  • Preliminary results indicate sensitivity as low about 10 4 to about 10 6 copies of target.
  • Such an assay may be quantitative as well.
  • a nonabsorptive substrate can be used along with evaporation.
  • a hydrophobic surface e.g., polyethylene terephthalate (PETE, PET), polystyrene (PS), polyethylene (PE), polycarbonate (PC), or poly(methyl methacrylate) (PMMA)
  • PETE polyethylene terephthalate
  • PS polystyrene
  • PE polyethylene
  • PC polycarbonate
  • PMMA poly(methyl methacrylate)
  • hydrophobic surface is selected to allow the beads or bead/DNA aggregates to adsorpt to the surface.
  • a similar approach may be employed with DNA-based bead aggregation in the presence of GuHCI.
  • a hydrophobic surface e.g., polyethylene terephthalate (PETE, PET), polystyrene (PS), polyethylene (PE), polycarbonate (PC), or poly(methyl methacrylate) (PMMA)
  • PETE polyethylene terephthalate
  • PS polystyrene
  • PE polyethylene
  • PC polycarbonate
  • PMMA poly(methyl methacrylate)
  • Figure 20 The types of images that can be obtained are shown in Figure 20 (aggregates of beads form in the presence of 1 ng hgDNA resulting in low dark area, while the beads remain dispersed without DNA).
  • a nonabsorptive substrate was used (one that repels aqueous solution).

Landscapes

  • Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analyzing Materials By The Use Of Magnetic Means (AREA)

Abstract

The invention provides methods to detect or determine the presence or amount of a polymeric analyte in a sample, which employ magnetic particles and subjects the sample and the magnetic substrate to forms of energy so as to induce aggregate formation, which is then detected on a substrate, e.g., filter paper.

Description

METHOD AND SYSTEM TO DETECT AGGREGATE FORMATION ON A SUBSTRATE Cross-Reference to Related Applications
This application claims the benefit of the filing date of U.S. application Serial No. 61/481 ,594, filed on May 2, 201 1 , the disclosure of which is incorporated by reference herein.
Background
Polymeric analytes can be detected using methods, such as chromatography, electrophoresis, binding assays, spectrophotometry, and the like. DNA detection, for instance, may require expensive, bulky optics for either absorbance-based techniques or intercalating-dye fluorescence based techniques. Although DNA concentration has routinely been detected spectrometrically by measuring absorbance ratio of a sample at 260/280 nm, the method suffers from poor sensitivity at low concentrations of DNA.
Other methods for DNA detection include DNA binding to a fluorescence dye and detecting the fluorescence using a fluorometer. Examples of such a dye are PicoGreen®, which is commercially available through Invitrogen (Carlsbad, CA) (see Ahn et al., Nucl. Acids Res., 24:2623 (1996); Vitzthum et al., Anal. Biochem., 276:59 (1999), and dyes disclosed in U.S. Patent Nos. 6,664,047; 5,582,977 and 5,321 , 130. Additional DNA quantification methods based on fluorescence have been developed and include oligonucleotide hybridization (Sanchez et al., J. Clin. Microbiol., 40:2381 (2002)) and real-time quantitative PCR (Heid et al., Genome Res., 6:986 (1996)). While highly sensitive, fluorometer-based methods are generally cumbersome, requiring reagent preparation and handling and a special fluorometer for exciting and measuring fluoro-emission.
Haque et al. (BMC Biotech., 3:20 (2003)) compared three popular DNA quantification methods with regard to accuracy: OD26o/OD28o (OD), PicoGreen® double stranded DNA (PG), and detection of fluorescent signal from a 5' exonuclease assay (quantitative genomic method (QG), based on the TaqMan® assay). Their exhaustive analysis, involving nearly 15,000 measurements, revealed that OD measurement was the most precise and least biased method for estimating DNA concentration. Among the benefits of that method are the relatively wide availability of absorbance spectrophotometers in contrast to fluorometers, that OD measurement does not consume sample or additional reagents, and that no time is required for incubation or reaction time, as is the case with a fluorophore. On the other hand, a large amount of sample is needed for OD measurement, and this method does not discriminate between single stranded and double stranded DNA (as PG does) (Singer et al., Anal. Biochem., 249:228 (1997)) or contaminating DNA (as the sequence specific QG method does). In addition, the presence of protein, RNA and salt can lead to an overestimate of DNA concentration from OD measurements.
Among the benefits of fluorometric methods are the use of very small sample volumes due to the high sensitivity of the methods and that fluorescence detection is easily implemented in microdevices. However, some reagents are not compatible with fluorescence based DNA quantification due to signal quenching.
Genetic analysis has greatly promoted the development of clinical diagnosis and forensic applications. A typical experimental process includes DNA preparation and quantification, amplification by polymerase chain reaction (PCR), and subsequent detection. The success of amplification often depends on the quality of prepared DNA, specifically purity and concentration, so a quantification step between preparation and amplification is critical to acquire reliable results. In standard laboratories, UV-Vis absorbance and fluorescence spectroscopy are commonly used to quantify DNA at concentrations from nanograms down to picograms per microliter prior to PCR, while a variety of amplification kits and post- PCR analysis methods on the PCR products have been and are continuously being developed to provide accurate information for different applications.
Towards point-of-care applications, paper-based microfluidic systems have been emerging due to their high portability and low requirements on cost and power. The majority of publications in this area have been focusing on detecting various analytes, e.g., ions (Mentele et al., Anal. Chem., 2012), organic molecules (Lankelma et al., Anal. Chem., 2012 and Zhao et al., Anal. Chem., 80:6431 (2008)), proteins (Martinez et al., Anal. Chem., 80:3699 (2008)), and DNA sequences (Araujo et al., Anal. Chem., 84:331 1 (2012)), optically or electrochemically as endpoint sensors. Govindarajan et al. recently reported a lab- on-paper device for cell lysis and DNA extraction as the preparation step of genetic analysis at the point of care (Govindarajan et al., Lab on a chip, 12: 174 (2012)), which could be combined with microfluidic PCR systems (Asiello et al., Lab on a chip, 29:830 (201 1 ); Zhang et al., Anal. Chim Acta, 638:1 15 (2009);
Leslie et al., J. Am. Chem. Soc, 134:5689 (2012)); and Lee et al., Lab on a chip, 1 1 :120 (201 1 )) for rapid sample-to-result tests. However, DNA quantification remains difficult in microfluidic systems because of the large footprint, complexity and cost associated with the conventional techniques, and the lack of a simple DNA quantification method at the point of care may compromise the success rate of PCR and hinder further analysis.
Summary of the Invention
Microfluidic genetic analysis involves integration of DNA preparation, quantification, amplification, separation, and detection for point-of-care applications. DNA quantification is critical to the success rate of amplification and subsequent detection, and a simple technique to quantify DNA at the point of care will promote further development of microfluidic systems. The present method may be employed as a label- free lab-on-paper assay for DNA quantification, or other polymeric analytes, based on the aggregation of silica-coated paramagnetic microbeads induced by the analyte in a magnetic field.
Thus, the invention provides label-free detection technology based on aggregation of particles, e.g., magnetic particle (bead) aggregation, in the presence of polymeric molecules, such as DNA in biological samples, including those that have been subject to an amplification reaction, and an energy source that induces particle aggregation such as a rotating magnetic field (RMF), which aggregates can be detected and/or quantified. Although the assays described herein employed aggregation of particles in a RMF, other forms of energy, such as pulsatile heating (via microwave or IR heating), acoustic energy and vigorous mechanical agitation may be used for aggregation induction.
As described herein below, an open ended micro-container, or micro-transfer device such as a pipette tip or other hollow cylinder that functions like a pipette tip (e.g., to draw up and expel fluids), is employed to mix the particles and the sample having the polymeric analyte. In one embodiment, the particles are introduced to the open ended container and then the sample is introduced to the container so as to mix the particles and the sample. In one embodiment, the sample is introduced to the open ended container and then the particles introduced to the container so as to mix the particles and the sample. In yet another embodiment, the sample and the particles are combined before being introduced to the open ended container. The mixture is then subjected to a form of energy that induces aggregation of the particles and polymeric analyte. The aggregates are transferred to an adsorbent substrate (support), e.g., glass or other hydrophobic substrate (support) such as a polyethylene, polycarbonate or polystyrene based substrate, or an absorbant substrate, e.g., a substrate that is formed of any semi-permeable material that allows liquids such as aqueous liquids to diffuse through the material with or without applied force but retains the particles and/or aggregates on its surface in a manner that suppresses or inhibits the dissociation of the aggregates. In one embodiment, the substrate is a membrane such as cloth, wax supported paper, filter paper, for instance, FTA paper, nitrocellulose or a polyvinylidene fluoride (PVDF) membrane. Then the presence or amount of the aggregates is detected, for instance, using image analysis. Thus, the method provides for non-free solution detection of aggregates. In one embodiment, the magnetic beads are about 1 micron to about 10 microns in diameter, and may be modified, e.g., with silica or with molecules such as ssDNA, antibodies or aptamers that are useful to detect specific targets.
In one embodiment, the aggregates are formed in a pipette tip and dispensed on filter paper, of which the digital images provide quantitative information on DNA concentration through simple analysis. The limit of detection, sensitivity, and accuracy of the assay were determined, and an application on quantification of DNA templates for polymerase chain reaction (PCR) was demonstrated. Cell phone cameras also suffice the need of quantification, allowing for development of truly portable and cost- effective point-of-care testing. The bead surface can be readily modified, rendering the assay great versatility for detection and quantification of various analytes. Moreover, a robotic system that can dispense multiple samples onto the substrate can be employed for a high throughput assay.
In one embodiment, under concentrated chaotropic salt conditions, e.g., salts such as guanidine hydrochloride, guanidine thiocyanate, ammonium perchlorate and the like, the formation of aggregates is specific for the presence of DNA and/or RNA (nucleic acid), such as amplified nucleic acid, in a sample and that formation is not inhibited by the presence of other cellular components, even at concentrations that greatly exceed that of the nucleic acid, e.g., DNA. In one embodiment, amplification of nucleic acid, e.g., amplification of phage or viruses in cells of interest that are to be detected, which occurs during phage or virus replication, e.g., during culture with host cells, or amplification of the nucleic acid of interest in vitro, such as polymerase chain reaction (PCR) amplification, ligase chain reaction (LCR) amplification or transcription mediated amplification (TMA), prior to induction of aggregate formation. Thus, the method is useful to detect and quantify high molecular weight DNA (ss and dsDNA), e.g., genomic DNA, or RNA, or amplified nucleic, such as that in the presence of an abundance of protein, under chaotropic conditions. In one embodiment, the invention provides a label-free technique where DNA-bound magnetic beads are subjected to a rotating magnetic field thereby forming aggregates which are detected by introducing the aggregates to an adsorbent or absorbant substrate (support).
As described herein, the use of nucleic acid amplification together with aggregate formation, provide a different approach to organism detection. In one embodiment, this approach provides for the use of bacteriophage to detect specific organisms, e.g., phage D29 may be employed to detect
Mycobacterium smegmatis. For example, the specificity of the assay can be increased by measuring the quantitative replication of host-specific bacteriophage following infection of bacteria by the phage. While aggregate based DNA detection in a chaotrope is generic, specificity in this context is provided by a phage or virus (which in one embodiment only infects one or a few types of bacteria or eukaryotic species) and a signal amplification of at least about 102 to about 1010, e.g., about 104 to about 109, about 105 to about 108, or about 107 (e.g., 100 starting copies of phage may replicate to 109 copies in about 4 to about 5 hours). The number of amplification cycles for aggregate formation may be inversely related to the size of the phage genome, e.g., fewer amplification cycles may be needed for larger phage genomes.
Moreover, whole phage (at sufficient concentrations) can induce an effect at a 75-fold higher sensitivity than that observed for phage DNA alone.
Aggregate formation is not limited to nucleic acid; a positively-charged high molecular weight polysaccharide polymer, chitosan, that electrostatically binds to silica-coated beads under low ionic strength conditions, also forms aggregates when subjected to an external magnetic field. Aggregate formation may be detected visually, which requires minimal footprint or expensive optical equipment, and can be employed to quantify the amount of a polymeric analyte in a sample, such as a complex biological sample, e.g., one having protein, carbohydrates such as polysaccharides, nucleic acid, and/or lipid, or any combination thereof. Aggregate formation may be detected using microscopy, photography, scanners, magnetic sensing and the like.
Thus, the invention provides a method for detecting the presence or amount of a nucleic acid analyte in a sample, such as a complex biological sample. The method includes contacting the sample with magnetic beads, e.g., from about 1 nm to about 300 micrometers in diameter, under conditions that allow for binding of the analyte to the beads so as to form a mixture in an open ended contained. In one embodiment, the beads include a paramagnetic metal. The mixture is subjected to energy, e.g., a magnetic field or acoustic energy, so as to form aggregates, which are then placed on a membrane, and the presence or amount of aggregates on the membrane (or on multiple locations on the membrane) is detected or determined. In one embodiment, the mixture is contacted with a magnet which induces aggregate formation. In one embodiment, aggregates are isolated from the mixture, thereby isolating the analyte. For example, the aggregates may first be magnetically isolated and then an elution buffer is added to the aggregates on the membrane. In one embodiment, after aggregate formation is detected or determined, in the absence of contact with a magnet or the rotating magnetic field (e.g., the field is turned off) or other applied energy, an elution buffer is added to the aggregates on the support.
Thus, the invention provides a quantitative method. Unlike methods that purify an analyte, such as DNA, before quantitation, methods described herein allow for quantitation without prior purification. In one embodiment, concentrations of DNA as low as about 1 to about 100 pg/μί or about 3 to about 1 to about 100 ng/μί. of nucleic acid in a sample may be detected.
In one embodiment, the invention provides a method for detecting the
presence or amount of a pathogen, e.g., a virus, fungus (e.g., yeast) or bacteria, in a sample. In one embodiment, a sample, e.g., a physiological sample such as blood, serum, plasma, cerebrospinal fluid, tissue sample, nasal swab and the like, suspected of having a pathogen is subjected to nucleic acid amplification of pathogen-specific sequences, for instance, using the polymerase chain reaction, so as to yield pathogen-specific fragments of greater than about 1 ,000 bp in length, e.g., greater than about 3,000 bp up to 6,000 bp, in length. Only 6 to 7 amplification cycles, which cycles may be completed in about 10 minutes, may yield sufficient DNA for aggregate formation, using beads with a diameter, for instance, of about 8 microns. An open ended container, such as a pipette tip or other hollow cylinder, is employed to mix the beads and the sample having the amplified DNA, which is then subjected to an energy that induces aggregate formation. The aggregates are then applied to a membrane prior to detection or quantification. In one embodiment, at least about 1000 copies of the amplified viral genome, for instance, obtained after about 10 minutes of in vitro nucleic acid amplification, may be detected by aggregate formation.
In one embodiment, the invention provides a method for detecting the presence or amount of a specific bacterium or eukaryotic cell. In one embodiment, a sample suspected of having a bacterium, is contacted with phage that infect the bacterium. After phage replication, the phage containing supernatant is contacted with beads and subjected to conditions that result in aggregate formation. The aggregates are then applied to a membrane prior to detection or quantification. The method may detect as few as 10 bacterial cells in a sample.
In one embodiment, the invention provides a method to determine the specific amount of an analyte in a solution using silica-coated magnetic beads. This may be accomplished with a camera and routine image processing software. The method may be applied to quantifying nucleic acids undergoing amplification, for instance, rolling circle amplification and whole genome amplification, where the products have higher molecular weights than products produced using some other nucleic amplification methods, such as the polymerase chain reaction. In one embodiment, the method is sensitive to about 20 human cells in 20 microliters of solution. The quantification method may also be applied to non-nucleic acid polymeric analytes, such as the polysaccharide chitosan, where a dose-dependent aggregation was also observed in a similar manner to the DNA induced aggregate formation on beads under non-chaotropic conditions. Under these conditions, the negatively charged silica bead surface is electrostatically attracted to the cationic chitosan (protonated amine) under low ionic strength conditions at physiological pH. The method may be altered to include fluorescently labeled magnetic beads or measurements of the magnetic susceptibility of the aggregates, to increase the sensitivity of the assay. Moreover, the method may be employed as a step in the purification of molecules bound to the beads, e.g., nucleic acids.
The aggregation, for instance, the formation of pinwheel shaped structures, can be visually detected and/or quantified. Moreover, the opaque nature of the aggregated particles makes the transition very easy to monitor optically, and simple image analysis techniques can be used to extract quantitative information. The combination of high sensitivity and simplicity of the method provides in one embodiment a label-free approach to, for instance, DNA or RNA detection and/or quantification, and thereby nucleic acid containing cell quantification. The observable effect for nucleic acid is also quite robust even in the presence of proteins and lipids at concentrations typically encountered in biological samples. The methods of the invention may have specific advantages in conjunction with automated assays in microfluidic platforms.
For example, the stark differences in optical contrast of images in the absence and presence of DNA allows for the use simple digital image processing to define a quantitative relationship between the mass of DNA and the extent of particle (e.g., bead) aggregation. This relationship was determined via an algorithm based on the gray value of the digital image. In one embodiment, a threshold gray level is set such that dispersed beads and clusters are counted as "dark," whereas areas in the image cleared of beads are counted as "bright." The number of dark pixels in the image is then used as a measure of aggregation, with 100% dark area representing a sample without aggregation, whereas low dark area percentages correspond to nearly complete aggregation. Even without optimization, the dynamic range of aggregate formation as a metric for DNA quantitation may be about 2.5 orders of magnitude. The same effect observed for purified DNA is observed for cultured mouse cells pipetted directly into a guanidine HCI-bead solution and for complex samples like human whole blood. Smaller bead sizes may increase sensitivity for shorter nucleic acid fragment lengths, e.g., amplified DNA , e.g., beads of about 5 microns
(μΐη) may be useful in detecting and/or quantitating nucleic acid of about 1 ,000 to about 5,000 base pairs in length.
In one embodiment, an adsorbent substrate, e.g., a one having a hydrophobic surface, or an absorbant substrate, may be employed to detect or quantitate aggregate formation, e.g., using a hybridization induced aggregration assay. Unlike inducing pinwheel formation with high molecular weight (long molecules) of DNA under chaotropic conditions, the invention provides for the detection and/or quantification of sequence-specific DNA (or other nucleic acid of appropriate length) via pinwheel formation under physiological conditions. The magnetic beads (or other magnetic substrates) employed in one embodiment of the hybridization-induced aggregation assay include oligonucleotides specific for a target nucleic acid sequence. Pairs of oligonucleotides bound to beads, e.g., via non-covalent interactions, aggregate when 'connector' (target) sequences are present. The use of non-covalent interactions may allow for easier coupling and post-pinwheel release of target sequences and/or oligonucleotides. The length of a target nucleic acid sequence can be as short as 10 bases to as long as hundreds of millions of bases in length with a binding sequence of 4 bases on each end with sequences in the bead bound oligonucleotides. A mixture with the beads and the target nucleic acid sequence, e.g., in an open ended micro-container, when heated to an appropriate temperature (annealing T), results in hybridized (annealed) sequences, which subsequently induce aggregation. Although sequence-specific induced pinwheeling can be used to detect target sequences in long molecules of DNA, e.g., genomic DNA, efficient hybridization induced aggregration occurs with shorter target nucleic acid molecules and under non-chaotropic conditions. To provide for shorter fragments of high molecular weight nucleic acids (intact cellular DNA), hydrodynamic shear forces are used to cause covalent bond breakage. Simply mixing, pouring, pipetting, or centrifuging DNA containing solutions, or subjecting high molecular weight DNA to sonication or shearing through a needle or nuclease treatment, may generate shorter fragments. In one embodiment, the aggregates in one or more samples are placed on an adsorbent substrate and the aqueous liquid allowed to evaporate (with or without external force being applied). In one embodiment, the aggregates in one or more samples are placed on an absorbant substrate.
The hybridization based assay is particularly useful to detect markers including, but are not limited to, cancer markers, genetically-modified food, genetically-modified organisms, human genomic markers (relative to other DNA), or bacterial genome markers. The homogenous assay may contain a series of the same type of beads with different oligonucleotides, where each pair of beads has sequences specific for a different target sequence having a different annealing temperature, or may have beads with different properties (such as in size or surface chemistry) that allow for distinguishing the presence of different target sequences in a sample. In one embodiment, the detection of pinwheeling at select temperature (T) as the sample traverses a temperature range of annealing T, allows for the detection of the presence of certain DNA sequences.
Brief Description of the Figures
Figure 1. HeLa cells were mixed with MagnaSil™ paramagnetic particles and imaging used to determine the normalized percent of dark area in the sample.
Figure 2. (A) Photograph of a blood sample analyzed by the pinwheel assay. The pinwheel results are given as an average (+ SD) for an n=3 with image processing involving 5 photographs shot over 30 seconds. The pictures are analyzed using ImageJ v1.41. For each picture, a threshold value is set automatically by isodata algorithm, which defines pixels representing the particles, and then the number of these pixels is counted. (B) A graph of the percent of the dark area. Values are normalized by that of a negative control (no DNA) as a function of the amount of DNA or cell.
Figure 3. Blood samples analyzed by the pinwheel assay and by Coulter Counter cell count. The pinwheel results are given as an average (+ SD) for an n = 3 with image processing involving 5 photographs shot over 30 seconds. (A) Bar graph of WBC per μΙ_ in three samples detected by the two methods. The results show that the pinwheel assay can be used to determine cell number. (B) The pinwheel effect can be utilized to define the concentration of DNA directly from blood samples. Using normalized percentage of 'dark' pixels with constant volume (3.5 nl_) the comparison of three different human blood samples was accomplished. Different concentrations for each of the samples correlated with measurement of DNA via the conventional method (panel A). The inset shows the result of diluting each sample to equalize the number of nucleated cells (white blood cells-WBCs) per microliter in each sample. The results are displayed as the normalized percentage of 'dark' pixels with increasing amount of human blood (scaled by DNA amount).
Figure 4. (A) A negative control in a pinwheel assay. (B) A positive control in a pinwheel assay of purified phage DNA. (C) Correlation between the percent dark area and DNA in a pinwheel assay of purified phage DNA.
Figure 5. Quantitation of phage using a pinwheel assay. (A) Graph of percent dark area versus number of phage. (B) Graph of percent dark area versus phage concentration.
Figure 6. Detection of bacteria using phage. Graph of percent dark area versus percent of phage used to infect 100 bacterial cells.
Figure 7A. Schematic of one exemplary method that employs a pipette tip as a receptacle for mixing a sample and particles and for inducing aggregate formation. Blotted beads alone in 2) provide a distinct 'dispersed' pattern akin to the free solution microwell images. Turbulent mixing when pipetted in 3) exposes any sample DNA to beads. Blotted aggregated beads in 4) provide a distinct 'pinwheel-like' pattern akin to the free solution microwell images that can be interpreted quantitatively.
Figure 7B-D. The pinwheel assay via the pipette and blot approach. (B) General experimental procedure. (C) and (D) illustrate the scanned images of magnetic beads blotted on filter paper without and with DNA, respectively. The saturation histograms in HSB (hue-saturation-brightness) color space denote the differences between the two samples. The red curve represents the average of the 14 experiments (gray curves).
Figure 8. Algorithm and standard curve for DNA quantification. (A) The average histograms at saturation channel (n=14) at various [DNA] illustrate dispersed beads converting to tight aggregates. A threshold was set [2] by a negative control to define 'Dark Area'. (B) The dark area values were normalized with the negative control and correlated with [DNA]. Error bars denote SD (n=14), with the 95% (purple lines) and 99% (golden lines) confidence intervals are shown.
Figures 9A-B. Dependence of sensitivity of the method on bead size. (A) 1 μιη beads
(monodisperse and spherical; top panel) or 8 μιη beads (irregularly shaped; lower panel) were mixed with DNA and aggregate formation detected. (B) 1 μιη beads (2 μΙ_) were mixed with increasing amounts of hg DNA (1 μΙ_) in a pipette tip, aggregate formation was induced with a magnetic field, after which aggregates were transferred to filter paper and detected. Figures 9C-D. Adjusting the sensitivity by varying the size of beads. (C) DNA strands are more effective to induce the aggregation of smaller beads. (D) The standard curves of 1 μιη beads and 8 μιη beads are shown in red and blue, respectively. The green curve represents the standard curve of a bead mixture with 50% 1 μιη beads and 50% 8 μιη beads.
Figure 9E. Exemplary quantitative data with image histogram (set threshold = 120).
Figures 10A-B. Quantification of human genomic DNA extracted from blood samples. (A) A standard curve was generated with serially diluted DNA samples. (B) The DNA concentrations of seven samples were measured with the PAB assay and compared with the results from UV-Vis spectroscopy.
Error bars denote the standard deviation of four experiments.
Figures 1 1A-C. Application for short tandem repeat (STR) analysis. The PCR reaction for STR analysis typically requires 1.0-2.5 ng/μ.. DNA. Three DNA samples were measured with the PAB assay, and Sample C was determined as > 2.83 pg/μί because the result locates outside the dynamic range shown in Figure 10A. A comparison of the electropherograms shows that the interpretable result was only generated from the sample with appropriate DNA concentration.
Figures 12A-B. Calibration curves for 1 μιη (panel A) and 8 μιη (panel B) beads with lambda
DNA.
Figure 13. Comparison of sensitivity versus scanner resolution using 1
μιη beads and hgDNA.
Figure 14. Illustration of the visually-distinct effect of in-tip aggregation
followed by blotting.
Figure 15. Towards a portable assay for point-of-care applications. The images of blotted beads on filter paper can also be acquired by a camera phone, which still yield quantitative results despite the noise generated from low image resolution. Error bars denote the standard deviation of four experiments. Switching from a desktop photo scanner to a 3M-pixel cell phone camera, represents a change from 599k to 32k pixels per image. The noise looks large when it is plotted at log scale. The peak area from 30 to 1000 saturation still dominates in the dark area results, and the area of the noisy part (100-255 saturation) is actually too small to affect dark area values.
Figure 16. (A) Schematic of hybridization induced aggregation and exemplary oligonucleotides and target sequences. (B) The effect of altering amount of connector in the hybridization induced aggregration assay.
Figure 17. Detection of a PCR product using hybridization induced aggregation.
Figure 18. Hybridization induced aggregation on an absorbant substrate.
Figure 19. Exemplary method to detect non-absorptive chaotrope induced aggregation.
Figure 20. Graph of percent dark area versus DNA amounts in non-absorptive chaotrope induced aggregation.
Detailed Description of the Invention
Definitions
A "detectable moiety" is a label molecule attached to, or synthesized as part of, a solid substrate for use in the methods of the invention. These detectable moieties include but are not limited to radioisotopes, colorimetric, fluorometric or chemiluminescent molecules, enzymes, haptens, redox-active electron transfer moieties such as transition metal complexes, metal labels such as silver or gold particles, or even unique oligonucleotide sequences.
As used herein, the terms "label" refers to a marker that may be detected by photonic, electronic, opto-electronic, magnetic, gravimetric, acoustic, enzymatic, magnetic, paramagnetic, or other physical or chemical means. The term "labeled" refers to incorporation of such a marker, e.g., by incorporation of a radiolabeled molecule or attachment to a solid substrate that may be suspended in solution such as a bead.
A "biological sample" can be obtained from an organism, e.g., it can be a physiological fluid or tissue sample, such as one from a human patient, a laboratory mammal such as a mouse, rat, pig, monkey or other member of the primate family, by drawing a blood sample, sputum sample, spinal fluid sample, a urine sample, a rectal swab, a peri-rectal swab, a nasal swab, a throat swab, or a culture of such a sample, or from a plant or a culture of plant cells. Thus, biological samples include, but are not limited to, whole blood or components thereof, blood or components thereof, blood or components thereof, semen, cell lysates, saliva, tears, urine, fecal material, sweat, buccal, skin, cerebrospinal fluid, and hair. In one embodiment, the biological sample comprises cells.
"Analyte" or "target analyte" is a substance to be detected in a biological sample such as a physiological sample using the present invention. "Polymeric analyte" as used herein refers to
macromolecules that are made up of repeating structural units that may or may not be identical. The polymeric analyte can include biopolymers or non-biopolymers. Biopolymers include, but are not limited to, nucleic acids (such as DNA or RNA), proteins, polypeptides, polysaccharides (such as starch, glycogen, cellulose, or chitin), and lipids.
"Capture moiety" is a specific binding member, capable of binding another molecule (a ligand), which moiety or its ligand may be directly or indirectly attached through covalent or noncovalent interactions to a substrate (bead). When the interaction of the two species produces a non-covalently bound complex, the binding which occurs may be the result of electrostatic interactions, hydrogen- bonding, or lipophilic interactions. The term "ligand" refers to any organic compound for which a receptor or other binding molecule naturally exists or can be prepared. Binding pairs useful as capture moieties and ligands include, but are not limited to, complementary nucleic acid sequences capable of forming a stable hybrid under suitable conditions, antibodies and the ligands therefore, enzymes and substrates therefore, receptors and agonists therefore, lectins and carbohydrates, avidin and biotin, streptavidin and biotin, and combinations thereof. In one embodiment, the affinity of a capture moiety and its ligand may be greater than about 10"5 M, such as greater than about 10"6 M, including greater than about 10"8 M and greater than about 10"9 M. In embodiment, oligonucleotides having biotin labels are bound to beads coupled to streptavidin.
The term "homology" refers to sequence similarity between two nucleic acid molecules. Homology may be determined by comparing a position in each sequence, which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base, then the molecules are homologous at that position. A degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences.
"Identity" means the degree of sequence relatedness between polynucleotide sequences, as the case may be, as determined by the match between strings of such sequences. "Identity" and "homology" can be readily calculated by known methods. Suitable computer program methods to determine identity and homology between two sequences include, but are not limited to, the GCG program package
(Devereux, et al., Nucleic Acids Research, 12:387 (1984)), BLASTN, and FASTA (Atschul et al., J. Molec.
Biol., 215:403 (1990)). The BLAST X program is publicly available from NCBI and other sources (BLAST
Manual, Altschul et al., NCBI NLM NIH Bethesda, Md. 20894; Altschul et al., J. Mol. Biol.. 215:403 (1990)).
As used herein, the term "amount" is intended to mean the level of a molecule. The term can be used to refer to an absolute amount of a molecule in a sample or relative to a control molecule. For example, when detecting specific sequences, a reference or control amount may be a normal reference level or a disease-state reference level. A normal reference level may be an amount of expression of a biomarker in a non-diseased subject or subjects. A disease-state reference level may be an amount of expression of a biomarker in a subject with a positive diagnosis for the disease or condition.
As used herein, the term "subject" means the subject is a mammal, such as a human, but can also be an animal, e.g., domestic animals (e.g., dogs, cats and the like), farm animals (e.g., cows, sheep, pigs, horses and the like) and laboratory.
A "paramagnetic metal" is a metal with unpaired electrons. Suitable paramagnetic metals include transition elements and lanthanide series inner transition elements. Additional suitable paramagnetic metals include, e.g., Yttrium (Y), Molybdenum (Mo), Technetium (Tc), Ruthenium (Ru), Rhodium (Rh), Tungsten (W), and Gold (Au). Additional specific suitable specific paramagnetic metals include, e.g., Y(lll), Mo(VI), Tc(IV), Tc(VI), Tc(VII), Ru(lll), Rh(lll), W(VI), Au(l), and Au(lll).
A Alanthanide," "lanthanide series element" or "lanthanide series inner transition element" refers to Cerium (Ce), Praseodymium (Pr), Neodymium (Nd), Promethium (Pm), Samarium (Sm), Europium (Eu), Gadolinium (Gd), Terbium (Tb), Dysprosium (Dy), Holmium (Ho), Erbium (Er), Thulium (Tm), Ytterbium(Yb), or Lutetium (Lu). Specific suitable lanthanides include, e.g., Ce(lll), Ce(IV), Pr(lll), Nd(lll), Pm(lll), Sm(ll), Sm(lll), Eu(ll), Eu(lll), Gd(lll), Tb(lll), Dy(lll), Ho(lll), Er(lll), Tm(lll), Yb(ll), Yb(lll), and Lu(lll).
Examples of transition metal oxides include, but are not limited to: Cr02, COFe204, CuFe204, Dy3Fe5012, DyFe03, ErFe03, Fe5Gd3012, Fe5H03012, FeMnNi04, Fe203, y-Fe304 (magnetite), a-Fe304 (hematite), FeLa03, MgFe204, Fe2Mn04, Mn02, Nd207Ti2, AI02Fe-|8NiO4, Fe2Nio.504Zn0.5, Fe2Ni0.4Zn0 6, Fe2Ni0.8Zn0.2, NiO, Fe2Ni04, Fe5012Sm3, Ago.5Fe12La0.5019, Fe5012Y3, and Fe03Y. Oxides of two or more of the following metal ions can also be used: AI(+3), Ti(+4), V(+3), Mn(+2), Co(+2), Ni(+2), Mo(+5), Pd(+3), Ag(+1 ), Cd(+2), Gd(+3), Tb(+3), Dy(+3), Er(+3), Tm(+3) and Hg(+1 ).
As used herein, a "nucleic acid sequence," a "nucleic acid molecule," or "nucleic acids" refers to one or more oligonucleotides or polynucleotides as defined herein. As used herein, a "target nucleic acid molecule" or "target nucleic acid sequence" refers to an oligonucleotide or polynucleotide comprising a sequence that a user of a method of the invention desires to detect in a sample.
The term "polynucleotide" as referred to herein means a single-stranded or double-stranded nucleic acid polymer composed of multiple nucleotides. In certain embodiments, the nucleotides comprising the polynucleotide can be ribonucleotides or deoxyribonucleotides or a modified form of either type of nucleotide. Said modifications include base modifications such as bromouridine, ribose modifications such as arabinoside and 2',3'-dideoxyribose and internucleotide linkage modifications such as phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phoshoraniladate and phosphoroamidate. The term "polynucleotide" specifically includes single and double stranded forms of DNA.
The term "oligonucleotide" referred to herein includes naturally occurring, and modified nucleotides linked together by naturally occurring, and/or non-naturally occurring oligonucleotide linkages. Oligonucleotides are a polynucleotide subset comprising members that are generally single-stranded and have a length of 200 bases or fewer. In certain embodiments, oligonucleotides are 2 to 60 bases in length.
In certain embodiments, oligonucleotides are 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, or 25 to 40 bases in length. In certain other embodiments, oligonucleotides are 25 or fewer bases in length.
Oligonucleotides of the invention may be sense or antisense oligonucleotides with reference to a protein- coding sequence.
The term "naturally occurring nucleotides" includes deoxyribonucleotides and ribonucleotides. The term "modified nucleotides" includes nucleotides with modified or substituted sugar groups and the like. The term "oligonucleotide linkages" includes oligonucleotide linkages such as phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate,
phoshoraniladate, phosphoroamidate, and the like. See, e.g., LaPlanche et al., Nucl. Acids Res., 14:9081 (1986); Stec et al., J. Am. Chem. Soc. 106:6077 (1984); Stein et al., Nucl. Acids Res.. 16:3209 (1988); Zon et al., Anti-Cancer Drug Design. 6:539 (1991 ); Zon et al., OLIGONUCLEOTIDES AND ANALOGUES: A PRACTICAL APPROACH, pp. 87-108 (F. Eckstein, Ed.), Oxford University Press, Oxford England (1991 ); U.S. Patent No. 5,151 ,510; Uhlmann and Peyman, Chemical Reviews, 90:543 (1990), the disclosures of which are hereby incorporated by reference for any purpose. An oligonucleotide can include a detectable label to enable detection of the oligonucleotide or hybridization thereof.
The term "highly stringent conditions" refers to those conditions that are designed to permit hybridization of nucleic acid strands whose sequences are highly complementary, and to exclude hybridization of significantly mismatched sequences. Hybridization stringency is principally determined by temperature, ionic strength, and the concentration of denaturing agents such as formamide. Examples of "highly stringent conditions" for solution (e.g., without bead aggregation) hybridization and washing are 0.015 M sodium chloride, 0.0015 M sodium citrate at 65-68°C. or 0.015 M sodium chloride, 0.0015 M sodium citrate, and 50% formamide at 42°C. See Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual (2nd ed., Cold Spring Harbor Laboratory, 1989); Anderson et al., Nucleic Acid
Hybridisation: A Practical Approach Ch. 4 (IRL Press Limited).
More stringent conditions (such as higher temperature, lower ionic strength, higher formamide, or other denaturing agent) may also be used-however, the rate of hybridization will be affected. Other agents may be included in the solution hybridization and washing buffers for the purpose of reducing nonspecific and/or background hybridization. Examples are 0.1 % bovine serum albumin, 0.1 % polyvinyl- pyrrolidone, 0.1 % sodium pyrophosphate, 0.1 % sodium dodecylsulfate, NaDodS04, (SDS), ficoll,
Denhardt's solution, sonicated salmon sperm DNA (or another non-complementary DNA), and dextran sulfate, although other suitable agents can also be used. The concentration and types of these additives can be changed without substantially affecting the stringency of the hybridization conditions. Hybridization experiments are usually carried out at pH 6.8-7.4; however, at typical ionic strength conditions, the rate of hybridization is nearly independent of pH. See Anderson et al., Nucleic Acid Hybridisation: A Practical Approach Ch. 4 (IRL Press Limited). Factors affecting the stability of duplexes include base composition, length, and degree of base pair mismatch. Hybridization conditions can be adjusted by one skilled in the art in order to accommodate these variables and allow nucleic acids of different sequence relatedness to form hybrids. For example, the melting temperature of a perfectly matched DNA duplex can be estimated by the following equation: Tm(°C.)=81.5+16.6(log[Na+])+0.41 (% G+C)-600/N-0.72(% formamide) where N is the length of the duplex formed, [Na+] is the molar concentration of the sodium ion in the hybridization or washing solution, %
G+C is the percentage of (guanine+cytosine) bases in the hybrid. For imperfectly matched hybrids, the melting temperature is reduced by approximately 1 °C for each 1 % mismatch.
The term "moderately stringent conditions" refers to conditions under which a duplex with a greater degree of base pair mismatching than could occur under "highly stringent conditions" is able to form. Examples of typical "moderately stringent conditions" in solution are 0.015 M sodium chloride, 0.0015 M sodium citrate at 50-65°C. or 0.015 M sodium chloride, 0.0015 M sodium citrate, and 20% formamide at 37-50°C. By way of example, "moderately stringent conditions" of 50 degree C in 0.015 M sodium ion will allow about a 21 % mismatch.
It will be appreciated by those skilled in the art that there is no absolute distinction between
"highly stringent conditions" and "moderately stringent conditions." For example, at 0.015 M sodium ion (no formamide), the melting temperature of perfectly matched long DNA is about 71 °C. With a wash at 65°C. (at the same ionic strength), this would allow for approximately a 6% mismatch. To capture more distantly related sequences, one skilled in the art can simply lower the temperature or raise the ionic strength.
A good estimate of the melting temperature in 1 M NaCI* for oligonucleotide probes up to about 20 nt is given by: Tm=2°C. per A-T base pair+4°C. per G-C base pair *The sodium ion concentration in 6. times, salt sodium citrate (SSC) is 1 M. See Suggs et al., Developmental Biology Using Purified Genes 683 (Brown and Fox, eds., 1981 ).
High stringency washing conditions for oligonucleotides may be at a temperature of 0-5°C below the Tm of the oligonucleotide, e.g., in 6 x SSC, 0.1 % SDS.
Exemplary Methods
Efficient molecular analysis usually requires detecting the presence of an analyte in a very small sample at very low concentration. The use of an external magnetic field in microdevices to implement magnetic bead control has previously been disclosed, e.g., by U.S. Patent Nos. 7,452,726; 6,664, 104;
6,632,655; and 6,344,326, PCT/US2010/002883 and PCT/US2009/036983; which are incorporated herein by reference. In one embodiment, the present invention uses magnetic beads in a magnetic field to provide a visual detection of the presence or quantity of a polymeric analyte, such as nucleic acids, lipids, polysaccharides, proteins, etc, although any source of energy that induces aggregation, such as acoustic energy or vibration may be employed. This method arises from the observation that when a polymeric analyte binds to the magnetic beads, application of a magnetic field (or other energy) to the beads results in aggregates, including pinwheel-like formations. Without the presence of the polymeric analyte, the movement and conformation of the magnetic beads induced by the magnetic field (non-aggregated) differs significantly from the aggregates. As such, the aggregate formation is specific to the presence of the binding between the polymeric analyte and the magnetic beads, and the magnetic field, and therefore, can be used to detect the presence of the analyte. Aggregate formation in a mixture with a polymeric analyte may be enhanced by applying other forms of energy, e.g., by vibrating the sample.
In one embodiment, the present invention relates to a method for detecting the presence of polymeric analyte in a sample by combining in an open ended hollow container, e.g., a pipette tip, the sample with magnetic beads, or another magnetic solid substrate that can be suspended in solution, and exposing the mixture to a magnetic field. The presence of aggregates indicates the presence of the bound polymeric analyte. In one embodiment, the magnetic beads are coated or derivatized to specifically bind or to enhance the binding of the polymeric analyte to the magnetic beads. The environment can also be manipulated to enhance the binding of the polymeric analyte to the magnetic beads. Aggregate formation is detected after the aggregate containing mixture is placed on an adsorbent substrate or absorbant substrate. The substrate may contain a plurality of samples, including a positive and/or negative control sample, and/or a dilution series useful for a calibration curve. A calibration curve is useful for correlating the aggregates to the polymeric analyte concentration. Such a calibration curve may be generated, for example, by subjecting known concentrations of the polymeric analyte to the energy source and determining the aggregates for each concentration.
The method of the invention can be added onto already existing assays or apparatuses, especially a micro-total analysis system (μ-TAS), to act as a polymeric analyte detector. For example, the presence of an antibody/antigen reaction may initiate the coupling of nucleic acids and the
presence/absence of the aggregate formations determines whether the antibody/antigen binding has occurred. This is analogous to an immuno-PCR method, where instead of using PCR and fluorescent probes for the detection of nucleic acids, the aggregate formations are employed.
The present invention is based on the observation that polymeric analytes, when bound to magnetic beads and in the presence a magnetic field, produce aggregates, e.g., a pinwheel effect. The pinwheel effect is not seen in a static magnetic field and appears to be specific to a rotating magnetic field. "Pinwheel formation" as used herein refers to a rotating mass having a circular or disc-like cross- section. The mass is made of clumps or aggregates of magnetic beads tethered by a polymeric analyte. When viewed in a still photograph, the pinwheel formation looks like a disc shaped object made of an aggregate of magnetic beads. However, when viewed visually or by imaging, the disc shaped object actually spins around its center axis similar to that of a spinning pinwheel. Within a detection chamber, the pinwheel formations sometimes collide together to form larger pinwheels, and sometimes collide with the wall of the chamber to break up into smaller pinwheels.
The method of the invention may be practiced in conjunction with an apparatus having a detection chamber that may be any fluid container that is part of or a component of a microfluidic device or micro- total analysis system (μ-TAS). Generally, a microfluidic device or μ-TAS contains at least one micro- channel. There are many formats, materials, and size scales for constructing μ-TAS. Common μ-TAS devices are disclosed in U.S. Patent Nos. 6,692,700 to Handique et al.; 6,919,046 to O'Connor et al; 6,551 ,841 to Wilding et al.; 6,630,353 to Parce et al.; 6,620,625 to Wolk et al.; and 6,517,234 to Kopf-Sill et al.; the disclosures of which are incorporated herein by reference. Typically, a μ-TAS device is made up of two or more substrates that are bonded together. Microscale components for processing fluids are disposed on a surface of one or more of the substrates. These microscale components include, but are not limited to, reaction chambers, electrophoresis modules, microchannels, fluid reservoirs, detectors, valves, or mixers. When the substrates are bonded together, the microscale components are enclosed and sandwiched between the substrates. A detection chamber may include a microchannel. At both ends of the microchannel are inlet and outlet ports for adding and removing samples from the microchannel. The detection chamber may be linked to other microscale components of a μ-TAS as part of an integrated system for analysis.
The magnetic beads may be introduced to the hollow open ended container prior to the addition of the sample or the magnetic beads may be added to the hollow open ended container after the sample is introduced to the hollow open ended container. The magnetic beads may contain a surface that is derivatized or coated with a substance that binds or enhances the binding of the polymeric analyte to the magnetic beads. Some coatings or derivatizations include, but are not limited to, amine-based charge switch, boronic acid, silanization, reverse phase, oligonucleotide, lectin, antibody-antigen, peptide-nucleic acid (PNA)-oligonucleotide, locked nucleic acid (LNA)-oligonucleotide, and avidin-biotin. For example, for the detection of nucleic acid, the magnetic beads can be silica coated to specifically bind nucleic acids when exposed to a high ionic strength, chaotropic buffer. A bead may also be coated with positively charged amines or oligomers for binding with nucleic acids.
To bind carbohydrates, the magnetic beads may contain a boronic acid- modified surface.
Boronic acid bonds covalently and specifically to -cis dialcohols, a moiety common in certain
carbohydrates including glucose.
To bind lipids, the magnetic beads may be modified with hydrophobic groups, such as benzyl groups, alkanes of various lengths (6-20), or vinyl groups. The lipids are bound to the beads by hydrophobic forces.
To bind proteins, the magnetic beads may contain a protein modified surface. For example, the surface of the beads may be coated with an antibody specific for the protein of interest. For general protein detection, the bead surface may be coated with avidin or biotin and the protein of interest may be derivatized with biotin or avidin. The avidin- biotin binding thus allows the protein to bind to the beads.
In addition to derivatization or coating of the magnetic beads, the physical environment where the polymeric analyte comes into contact with the magnetic beads may also be altered to allow the beads to specifically bind or to enhance the binding of the magnetic beads to the polymeric analyte. For example, a silica coated bead may be manipulated to specifically bind nucleic acid, carbohydrate, or protein depending on the conditions used: binding of DNA occurs in chaotropic salt solution, binding of positively charged carbohydrates occurs in low ionic strength solutions, and binding of proteins occurs under denaturing conditions (in the presence of urea, heat, and the like).
Depending on the concentration of polymeric analyte to be detected, the number of beads may be about 100 to about 108, such as about 104 to 107 for visual detection. Fluorescence detection may allow for a smaller number of beads, e.g., about 10. The higher the concentration of analyte in the sample, the higher the amount of magnetic beads that should be employed.
Further provided is a hybridization induced aggregration assay. A mixture with the beads and the target nucleic acid sequence, when heated to an appropriate temperature (annealing T), results in hybridized (annealed) sequences, which subsequently induce aggregation. Efficient hybridization induced aggregration occurs with shorter target nucleic acid molecules and under non-chaotropic conditions. The assay may contain a series of the same type of beads with different oligonucleotides, where each pair of beads has sequences specific for a different target sequence having a different annealing temperature, or may have beads with different properties (such as in size or surface chemistry) that allow for distinguishing the presence of different target sequences in a sample. Once aggregation occurs, the mixture is placed on an adsorbent substrate and the aqueous solution removed, e.g., via evaporation, or placed on an absorbant substrate, and aggregate formation detected or quantitated.
The components of the magnetic field in the x-axis and z-axis are essentially negligible in the center of the magnetic field and thus are likely not critical to pinwheel formation. The magnetic field in the y-axis may have a strength of about 1 to 5,000 gauss, e.g., about 10 to 1000 gauss. Additionally, regardless of the shape of the magnet, the magnetic field component in the y-axis may obtain its maximum strength at the center of rotation and is at its minimum strength at both poles of the magnet.
The field component may be maximized along the length of the magnet and may abruptly drop to its minimum at the poles. The field component does not significantly decrease off either side of the magnet.
The magnetic field lines at the detection chamber may be parallel to the xy-plane in which the detection chamber lies.
The presence of aggregates can be detected visually, or using optical or imaging instrumentation. One way to detect aggregates is to photograph or record a video of the detection chamber. This may be accomplished by the image or recording of one chamber at a time or multiple chambers. A computer program can then be used to detect the aggregates in the photograph or video. The program may initially upload and crop the image (photograph or frames of a video) so that only the detection chamber is shown. The cropped image may then converted to gray scale. An extended minima transformation is then performed with a threshold between about 40 to 70 to isolate the magnetic microparticles from the background pixels. Once holes within each object are filled in, each object may then be labeled, e.g., with a separate RGB color. A boundary is then created around each distinct object. For each boundary, a metric m = 4na/p2 is calculated, where a is the area of the object and p is the perimeter of the object. The metric m is a measure of the roundness of the object, for a perfect circle m = I. For each object, if m is greater than about 0.8, such as greater than about 0.95, that object is defined as a pinwheel. A centroid is then plotted over each object having m greater than about 0.8 (a pinwheel). If a photograph is used, the number of pinwheels is then counted. If a video is used, the steps are repeated for each frame of the video and the average number of pinwheels per frame is calculated. If the number of pinwheels or aggregates or average number of pinwheels or aggregates per frame is greater than a set value from 0.5 to 10 (depending upon the polymeric analyte and bead concentration), the program returns the result that polymeric analyte is present in the sample. See, for example, WO 2009/1 14709, the disclosure of which is incorporated by reference herein.
For software based automated detection, one possible system contains at least a camera and a computer for running the computer program. In this system, the camera takes pictures or video of the detection chamber and the images from the camera is analyzed by the computer. The computer may be electronically connected to the camera for automatically downloading and processing the images from the camera as discussed above.
Particles
Particles useful in the practice of the invention include metal (e.g., gold, silver, copper and platinum), semiconductor (e.g., CdSe, CdS, and CdS or CdSe coated with ZnS) and magnetic (e.g., ferromagnetite) as colloidal materials, as well ZnS, ZnO, Ti02, Agl, AgBr, Hgl2, PbS, PbSe, ZnTe, CdTe, ln2S3, ln2Se3, Cd3P2, Cd3As2, InAs, and GaAs, and silica and polymer (e.g., latex) particles. The particles may have any shape, e.g., spheres (generally referred to as beads) or rods, or irregular shapes, and a population of particles may have particles that vary in shape or size, e.g., beads in a population of beads may not have a uniform shape or diameter. The size of the particles may be from about 1 nm to about 300 micrometers (μιη) (mean diameter for rods or spheres), such as from about 0.5 to about 250 μιη, or from about 2 to about 10 μιη. The particles may be coated or derivatized with agents, e.g., to enhance binding of a selected analyte. For example, particles may include a silica coating or be derivatized with streptavidin.
In various aspects, the methods provided include those utilizing particles which range in size from about 1 micrometers to about 250 micrometers in mean diameter, about 1 micrometers to about 240 micrometers in mean diameter, about 1 micrometers to about 230 micrometers in mean diameter, about 1 micrometers to about 220 micrometers in mean diameter, about 1 micrometers to about 210 micrometers in mean diameter, about 1 micrometers to about 200 micrometers in mean diameter, about 1 micrometers to about 190 micrometers in mean diameter, about 1 micrometers to about 180 micrometers in mean diameter, about 1 micrometers to about 170 micrometers in mean diameter, about 1 micrometers to about 160 micrometers in mean diameter, about 1 micrometers to about 150 micrometers in mean diameter, about 1 micrometers to about 140 micrometers in mean diameter, about 1 micrometers to about 130 micrometers in mean diameter, about 1 micrometers to about 120 micrometers in mean diameter, about 1 micrometers to about 1 10 micrometers in mean diameter, about 1 micrometers to about 100 micrometers in mean diameter, about 1 micrometers to about 90 micrometers in mean diameter, about 1 micrometers to about 80 micrometers in mean diameter, about 1 micrometers to about 70 micrometers in mean diameter, about 1 micrometers to about 60 micrometers in mean diameter, about 1 micrometers to about 50 micrometers in mean diameter, about 1 micrometers to about 40 micrometers in mean diameter, about 1 micrometers to about 30 micrometers in mean diameter, or about 1 micrometers to about 20 micrometers in mean diameter, about 1 micrometers to about 10 micrometers in mean diameter. In other aspects, the size of the particles is from about 5 micrometers to about 150 micrometers, from about 5 to about 50 micrometers, from about 10 to about 30 micrometers. The size of the particles is from about 5 micrometers to about 150 micrometers, from about 30 to about 100 micrometers, from about 40 to about 80 micrometers. In one embodiment, the magnetic particle may have an effective diameter of about 0.25 to 50 micrometers, including from about 0.5 to about 1.5 micrometers or from about 3 to about 15 micrometers. The size of the beads may be matched with the expected size of the polymeric analyte, e.g., nucleic acid, being detected. Smaller beads form pinwheels with shorter polymer analytes and smaller beads may be more sensitive to shorter polymeric analytes. Bead size can be tuned to the specific cutoff in size needed for discrimination, including optical properties or amount surface area that can be derivatized.
In one embodiment, MagneSil particles (Promega Corp, Madison, Wl) are employed. MagneSil particles are paramagnetic particles (iron-cored silicon dioxide beads) of about 8 micrometers in average diameter with the overall range of about 4 to about 12 microns in diameter. Those particles can be loaded into an open ended container and contacted with sample DNA, and then subjected to an energy that induces aggregate formation, e.g., a magnetic field from an external magnet.
Oligonucleotides
Methods of making oligonucleotides of a predetermined sequence are well-known. See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual (2nd ed. 1989) and F. Eckstein (ed.) Oligonucleotides and Analogues, 1st Ed. (Oxford University Press, New York, 1991 ). Solid-phase synthesis methods are contemplated for both oligoribonucleotides and oligodeoxyribonucleotides (the well-known methods of synthesizing DNA are also useful for synthesizing RNA). Oligoribonucleotides and oligodeoxyribonucleotides can also be prepared enzymatically. Non-naturally occurring nucleobases can be incorporated into the oligonucleotide, as well. See, e.g., Katz, J. Am. Chem. Soc, 74:2238 (1951 ); Yamane, et al., J. Am. Chem. Soc, 83:2599 (1961 ); Kosturko, et al., Biochemistry, 13:3949 (1974); Thomas, J. Am. Chem. Soc, 76:6032 (1954); Zhang, et al., J. Am. Chem. Soc, 127:74-75 (2005); and Zimmermann, et al., J. Am. Chem. Soc, 124: 13684-13685 (2002).
The term "oligonucleotide" as used herein includes modified forms as discussed herein as well as those otherwise known in the art which are used to regulate gene expression. Likewise, the term
"nucleotides" as used herein is interchangeable with modified forms as discussed herein and otherwise known in the art. In certain instances, the art uses the term "nucleobase" which embraces naturally- occurring nucleotides as well as modifications of nucleotides that can be polymerized. Herein, the terms "nucleotides" and "nucleobases" are used interchangeably to embrace the same scope unless otherwise noted.
In various aspects, the methods may employ oligonucleotides which are DNA oligonucleotides,
RNA oligonucleotides, or combinations of the two types. Modified forms of oligonucleotides are also contemplated which include those having at least one modified internucleotide linkage. In one embodiment, the oligonucleotide is all or in part a peptide nucleic acid (PNA) or includes LNA (see Koskin et al., Tetrahedron, 54:3607 (1998)). Other modified internucleoside linkages include at least one phosphorothioate linkage. Still other modified oligonucleotides include those comprising one or more universal bases. "Universal base" refers to molecules capable of substituting for binding to any one of A, C, G, T and U in nucleic acids by forming hydrogen bonds without significant structure destabilization. The oligonucleotide incorporated with the universal base analogues is able to function as a probe in hybridization, as a primer in PCR and DNA sequencing. Examples of universal bases include but are not limited to 5'-nitroindole-2'-deoxyriboside, 3-nitropyrrole, inosine, and hypoxanthine.
Modified Backbones. Specific examples of oligonucleotides include those containing modified backbones or non-natural internucleoside linkages. Oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. Modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone are considered to be within the meaning of "oligonucleotide."
Modified oligonucleotide backbones containing a phosphorus atom include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters,
aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates, 5'- alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3' to 3', 5' to 5' or 2' to 2' linkage. Also contemplated are oligonucleotides having inverted polarity comprising a single 3' to 3' linkage at the 3'-most internucleotide linkage, i.e. a single inverted nucleoside residue which may be abasic (the nucleotide is missing or has a hydroxyl group in place thereof). Salts, mixed salts and free acid forms are also contemplated. Representative United States patents that teach the preparation of the above phosphorus-containing linkages include, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301 ; 5,023,243; 5,177,196; 5, 188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717;
5,321 , 131 ; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821 ;
5,541 ,306; 5,550,1 1 1 ; 5,563,253; 5,571 ,799; 5,587,361 ; 5, 194,599; 5,565,555; 5,527,899; 5,721 ,218;
5,672,697 and 5,625,050, the disclosures of which are incorporated by reference herein.
Modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyi internucleoside linkages, mixed heteroatom and alkyl or cycloalkyi internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages; siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; riboacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts. See, for example, U.S. Patent Nos. 5,034,506; 5,166,315; 5, 185,444; 5,214,134; 5,216, 141 ; 5,235,033; 5,264,562; 5,264,564;
5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541 ,307; 5,561 ,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608; 5,646,269 and 5,677,439, the disclosures of which are incorporated herein by reference in their entireties.
Modified Sugar and Internucleoside Linkages. In still other embodiments, oligonucleotide mimetics wherein both one or more sugar and/or one or more internucleotide linkage of the nucleotide units are replaced with "non-naturally occurring" groups. In one aspect, this embodiment contemplates a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone. See, for example US Patent Nos. 5,539,082; 5,714,331 ; and 5,719,262, and Nielsen et al., Science, 1991 , 254, 1497-1500, the disclosures of which are herein incorporated by reference.
In still other embodiments, oligonucleotides are provided with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and including— CH2— NH— O— CH2— ,— CH2— N(CH3)— O— CH2— ,— CH2— O— N(CH3)— CH2— ,— CH2— N(CH3)— N(CH3)— CH2— and— O— N(CH3)— CH2— CH2— described in US Patent Nos. 5,489,677, and 5,602,240. Also contemplated are oligonucleotides with morpholino backbone structures described in US Patent No. 5,034,506.
In various forms, the linkage between two successive monomers in the oligo consists of 2 to 4, desirably 3, groups/atoms selected from— CH2— ,— O— ,— S— ,— NRH— , C=0, C=NRH, >C=S,— Si(R")2— ,—SO—,— S(0)2— ,— P(0)2— ,— PO(BH3)— ,— P(0,S)— ,— P(S)2— ,— PO(R")— ,—
PO(OCH3)— , and— PO(NHRH)— , where RH is selected from hydrogen and C-^-alkyl, and R" is selected from C-|.6-alkyl and phenyl. Illustrative examples of such linkages are— CH2— CH2— CH2— ,— CH2— CO— CH2— ,— CH2— CHOH— CH2— ,— O— CH2— O— ,— O— CH2— CH2— ,— O— CH2— CH=(including R5 when used as a linkage to a succeeding monomer),— CH2— CH2— O— ,— NRH— CH2— CH2— ,— CH2— CH2— NRH— ,— CH2— NRH— CH2— -,— O— CH2— CH2— NRH— ,— NRH— CO— O— ,— NRH— CO— NRH— ,— NRH— CS— NRH— ,— NRH— C(=NRH)— NRH— ,— NRH— CO— CH2— NRH— O— CO— O— ,— O— CO— CH2— O— ,— O— CH2— CO— O— ,— CH2— CO— NRH— ,— O— CO— NRH— ,— NRH— CO— CH2 — ,— O— CH2— CO— NRH— ,— O— CH2— CH2— NRH— ,— CH=N— O— ,— CH2— NRH— O— ,— CH2— O— N=(including R5 when used as a linkage to a succeeding monomer),— CH2— O— NRH— ,— CO— NRH— CH2— ,— CH2— NRH— O— ,— CH2— NRH— CO— ,— O— NRH— CH2— ,— O— NRH,— O— CH2— S— ,— S— CH2— O— ,— CH2— CH2— S— ,— O— CH2— CH2— S— ,— S— CH2— CH=(including R5 when used as a linkage to a succeeding monomer),— S— CH2— CH2— ,— S— CH2— CH2— O— ,— S— CH2— CH2— S— ,— CH2— S— CH2— ,— CH2— SO— CH2— ,— CH2— S02— CH2— ,— O— SO— O— ,— O— S(0)2— O— ,— O— S(0)2— CH2— ,— O— S(0)2— NRH— ,— NRH— S(0)2— CH2— ;— O— S(0)2— CH2— , — O— P(0)2— O— ,— O— P(0,S)— O— ,— O— P(S)2— O— ,— S— P(0)2— O— ,— S— P(0,S)— O— ,— S— P(S)2— O— ,— O— P(0)2— S— ,— O— P(0,S)— S— ,— O— P(S)2— S— ,— S— P(0)2— S— ,— S— P(0,S)— S— ,— S— P(S)2— S— ,— O— PO(R")— O— ,— O— PO(OCH3)— O— ,— O— PO(0 CH2CH3)— O— ,— O— PO(0 CH2CH2S— R)— O— ,— O— PO(BH3)— O— ,— O— PO(NHRN)— O— ,— O— P(0)2— NRH H— ,— NRH— P(0)2— O— ,— O— P(0,NRH)— O— ,— CH2— P(0)2— O— ,— O— P(0)2— CH2— , and— O— Si(R")2— O— ; among which— CH2— CO— NRH— ,— CH2— NRH— O— ,— S— CH2— O— ,— O— P(0)2— O— O— P(- 0,S)— O— ,— O— P(S)2— O— ,— NRH P(0)2— O— ,— O— P(0,NRH)— O— ,— O— PO(R")— O— ,— O— PO(CH3)— O— , and— O— PO(NHRN)— O— , where RH is selected form hydrogen and C1-4- alkyl, and R" is selected from C-|.6-alkyl and phenyl, are contemplated. Further illustrative examples are given in Mesmaeker et. al., Current Opinion in Structural Biology, 5:343-355 (1995) and Susan M. Freier and Karl-Heinz Altmann, Nucleic Acids Research, 25:4429-4443 (1997).
Still other modified forms of oligonucleotides are described in detail in U.S. Patent Publication No. 20040219565, the disclosure of which is incorporated by reference herein in its entirety.
Modified oligonucleotides may also contain one or more substituted sugar moieties. In certain aspects, oligonucleotides comprise one of the following at the 2' position: OH; F; 0-, S-, or N-alkyl; 0-, S-, or N-alkenyl; 0-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C-i to C10 alkyl or C2 to C10 alkenyl and alkynyl. Other embodiments include 0[(CH2)nO]mCH3, 0(CH2)nOCH3, 0(CH2)nNH2, 0(CH2)nCH3, 0(CH2)nONH2, and 0(CH2)nON[(CH2)nCH3]2, where n and m are from 1 to about 10. Other oligonucleotides comprise one of the following at the 2' position: C-i to C10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O- aralkyl, SH, SCH3, OCN, CI, Br, CN, CF3, OCF3, SOCH3, S02CH3, ON02, N02, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties. In one aspect, a modification includes 2'-methoxyethoxy (2'-0-CH2CH2OCH3, also known as 2'-0-(2-methoxyethyl) or 2 -MOE) (Martin et al., Helv. Chim. Acta, 78:486-504 (1995)) i.e., an alkoxyalkoxy group. Other modifications include 2'-dimethylaminooxyethoxy, i.e., a 0(CH2)2ON(CH3)2 group, also known as 2 -DMAOE, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-0- dimethyl-amino-ethoxy-ethyl or 2 -DMAEOE), i.e., 2'-0— CH2— O— CH2— N(CH3)2, also described in examples herein below.
Still other modifications include 2'-methoxy (2'-0— CH3), 2'-aminopropoxy (2'-OCH2CH2CH2NH2),
2'-allyl (2'-CH2— CH=CH2), 2'-0-allyl (2'-0— CH2— CH=CH2) and 2'-fluoro (2'-F). The 2'-modification may be in the arabino (up) position or ribo (down) position. In one aspect, a 2'-arabino modification is 2'-F. Similar modifications may also be made at other positions on the oligonucleotide, for example, at the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked oligonucleotides and the 5' position of 5' terminal nucleotide. Oligonucleotides may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. See, for example, U.S. Pat. Nos. 4,981 ,957; 5,1 18,800; 5,319,080;
5,359,044; 5,393,878; 5,446, 137; 5,466,786; 5,514,785; 5,519,134; 5,567,81 1 ; 5,576,427; 5,591 ,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792,747; and 5,700,920, the disclosures of which are incorporated by reference in their entireties herein.
In one aspect, a modification of the sugar includes Locked Nucleic Acids (LNAs) in which the 2'- hydroxyl group is linked to the 3' or 4' carbon atom of the sugar ring, thereby forming a bicyclic sugar moiety. The linkage is in certain aspects is a methylene (— CH2— )n group bridging the 2' oxygen atom and the 4' carbon atom wherein n is 1 or 2. LNAs and preparation thereof are described in WO 98/39352 and WO 99/14226.
Natural and Modified Bases. Oligonucleotides may also include base modifications or
substitutions. As used herein, "unmodified" or "natural" bases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified bases include other synthetic and natural bases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2- propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8- thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5- trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F- adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3- deazaguanine and 3-deazaadenine. Further modified bases include tricyclic pyrimidines such as phenoxazine cytidine(1 H-pyrimido[5 ,4-b][1 ,4]benzoxazin-2(3H)-one), phenothiazine cytidine (1 H- pyrimido[5 ,4-b][1 ,4]benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g. 9-(2-aminoethoxy)-H-pyrimido[5,4-b][1 ,4]benzox- azin-2(3H)-one), carbazole cytidine (2H-pyrimido[4,5- b]indol-2-one), pyridoindole cytidine (H-pyrido[3',2':4,5]pyrrolo[2,3-d]pyrimidin-2-one). Modified bases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further bases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., Anqewandte Chemie, International Edition, 1991 , 30:613 (1991 ), and those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., ed., CRC Press, 1993. Certain of these bases are useful for increasing the binding affinity and include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2- aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C. and are, in certain aspects combined with 2'- O-methoxyethyl sugar modifications. See, U.S. Pat. Nos. 3,687,808, U.S. Pat. Nos. 4,845,205;
5, 130,302; 5,134,066; 5, 175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,71 1 ; 5,552,540; 5,587,469; 5,594,121 , 5,596,091 ; 5,614,617; 5,645,985; 5,830,653; 5,763,588; 6,005,096; 5,750,692 and 5,681 ,941 , the disclosures of which are incorporated herein by reference.
A "modified base" or other similar term refers to a composition which can pair with a natural base (e.g., adenine, guanine, cytosine, uracil, and/or thymine) and/or can pair with a non-naturally occurring base. In certain aspects, the modified base provides a Tm differential of 15, 12, 10, 8, 6, 4, or 2°C or less. Exemplary modified bases are described in EP 1 072 679 and WO 97/12896. An oligonucleotide, or modified form thereof, may be from about 20 to about 100 nucleotides in length. In one embodiment, the oligonucelotide is from 5 to 50 nucleotides in length or any integer in between. It is also contemplated wherein the oligonucleotide is about 20 to about 90 nucleotides in length, about 20 to about 80 nucleotides in length, about 20 to about 70 nucleotides in length, about 20 to about 60 nucleotides in length, about 20 to about 50 nucleotides in length about 20 to about 45 nucleotides in length, about 20 to about 40 nucleotides in length, about 20 to about 35 nucleotides in length, about 20 to about 30 nucleotides in length, about 20 to about 25 nucleotides in length, or about 15 to about 90 nucleotides in length, about 15 to about 80 nucleotides in length, about 15 to about 70 nucleotides in length, about 15 to about 60 nucleotides in length, about 15 to about 50 nucleotides in length about 15 to about 45 nucleotides in length, about 15 to about 40 nucleotides in length, about 15 to about 35 nucleotides in length, about 15 to about 30 nucleotides in length, about 15 to about 25 nucleotides in length, or about 15 to about 20 nucleotides in length, and all oligonucleotides intermediate in length of the sizes specifically disclosed to the extent that the oligonucleotide is able to achieve the desired result. Accordingly, oligonucleotides of 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, and 100 nucleotides in length are contemplated.
"Hybridization," which is used interchangeably with the term "complex formation" herein, means an interaction between two or three strands of nucleic acids by hydrogen bonds in accordance with the rules of Watson-Crick DNA complementarity, Hoogstein binding, or other sequence-specific binding known in the art. Hybridization can be performed under different stringency conditions known in the art.
In various aspects, the methods include use of oligonucleotides which are 100% complementary to another sequence, i.e., a perfect match, while in other aspects, the individual oligonucleotides are at least (meaning greater than or equal to) about 95% complementary to all or part of another sequence , at least about 90%, at least about 85%, at least about 80%, at least about 75%, at least about 70%, at least about 65%, at least about 60%, at least about 55%, at least about 50%, at least about 45%, at least about 40%, at least about 35%, at least about 30%, at least about 25%, at least about 20%
complementary to that sequence, so long as the oligonucleotide is capable of hybridizing to the target sequence.
It is understood in the art that the sequence of the oligonucleotide used in the methods need not be 100% complementary to a target sequence to be specifically hybridizable. Moreover, an
oligonucleotide may hybridize to a target sequence over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure). Percent complementarity between any given oligonucleotide and a target sequence can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 215: 403^10 (1990); Zhang and Madden, Genome Res., 7:649-656 (1997)).
The stability of the hybrids is chosen to be compatible with the assay conditions. This may be accomplished by designing the nucleotide sequences in such a way that the Tm will be appropriate for standard conditions to be employed in the assay. The position at which the mismatch occurs may be chosen to minimize the instability of hybrids. This may be accomplished by increasing the length of perfect complementarity on either side of the mismatch, as the longest stretch of perfectly homologous base sequence is ordinarily the primary determinant of hybrid stability. In one embodiment, the regions of complementarity may include G:C rich regions of homology. The length of the sequence may be a factor when selecting oligonucleotides for use with particles. In one embodiment, at least one of the
oligonucleotides has 100 or fewer nucleotides, e.g., has 15 to 50, 20 to 40, 15 to 30, or any integer from 15 to 50, nucleotides. Oligonucleotides having extensive self-complementarity should be avoided. Less than 15 nucleotides may result in a oligonucleotide complex having a too low a melting temperature to be suitable in the disclosed methods. More than 100 nucleotides may result in a oligonucleotide complex having a too high melting temperature to be suitable in the disclosed methods. Thus, oligonucleotides are of about 15 to about 100 nucleotides, e.g., about 20 to about 70, about 22 to about 60, or about 25 to about 50 nucleotides in length.
Particles for Hybridization Induced Aggregation
A functionalized particle has at least a portion of its surface modified, e.g., with an oligonucleotide. In one embodiment, any particle having oligonucleotides attached thereto suitable for use in detection assays and that do not interfere with oligonucleotide complex formation, i.e., hybridization to form a double-strand complex.
For a hybridization induced aggregation assay, at least two types of particles having attached thereto oligonucleotides with sequences (a and b) complementary to a target nucleic acid sequence (having a' and b') are prepared. In one embodiment, the oligonucleotides a and b are functionalized to two types of particles in a way that oligonucleotide a is attached to the particle by its 3' OH group, and oligonucleotide b is attached to the particle by the 5' P04 3- group.
In various aspects, at least one oligonucleotide is bound through a spacer to the particle. In these aspects, the spacer is an organic moiety, a polymer, a water-soluble polymer, a nucleic acid, a polypeptide, and/or an oligosaccharide. Methods of functionalizing the oligonucleotides to attach to a surface of a particle are well known in the art. See Whitesides, Proceedings of the Robert A. Welch Foundation 39th Conference On Chemical Research Nanophase Chemistry, Houston, Tex., pages 109- 121 (1995). See also, Mucic et al., Chem. Comm. 555-557 (1996) (describes a method of attaching 3' thiol DNA to flat gold surfaces; this method can be used to attach oligonucleotides to particles). The alkanethiol method can also be used to attach oligonucleotides to other metal, semiconductor and magnetic colloids and to the other particles listed above. Other functional groups for attaching oligonucleotides to solid surfaces include phosphorothioate groups (see, e.g., U.S. Patent No. 5,472,881 for the binding of oligonucleotide-phosphorothioates to gold surfaces), substituted alkylsiloxanes (see, e.g. Burwell, Chemical Technology, 4:370-377 (1974) and Matteucci and Caruthers, J. Am. Chem. Soc,
103:3185-3191 (1981 ) for binding of oligonucleotides to silica and glass surfaces, and Grabaretal, Anal. Chem., 67:735-743 for binding of aminoalkylsiloxanes and for similar binding of mercaptoaklylsiloxanes). Oligonucleotides terminated with a 5' thionucleoside or a 3' thionucleoside may also be used for attaching oligonucleotides to solid surfaces. The following references describe other methods which may be employed to attach oligonucleotides to particles: Nuzzo et al., J. Am. Chem. Soc, 109:2358 (1987) (disulfides on gold); Allara and Nuzzo, Langmuir, 1:45 (1985) (carboxylic acids on aluminum); Allara and Tompkins, J. Colloid Interface ScL, 49:410-421 (1974) (carboxylic acids on copper); Her, The Chemistry Of Silica, Chapter 6, (Wiley 1979) (carboxylic acids on silica); Timmons and Zisman, J. Phys. Chem., 69:984-990 (1965) (carboxylic acids on platinum); Soriaga and Hubbard, J. Am. Chem. Soc, 104:3937 (1982) (aromatic ring compounds on platinum); Hubbard, Acc. Chem. Res., 13:177 (1980) (sulfolanes, sulfoxides and other functionalized solvents on platinum); Hickman et al., J. Am. Chem. Soc, 1 1 1 :7271
(1989) (isonitriles on platinum); Maoz and Sagiv, Lanqmuir, 3:1045 (1987) (silanes on silica); Maoz and
Sagiv, Langmuir, 3:1034 (1987) (silanes on silica); Wasserman et al., Lanqmuir, 5: 1074 (1989) (silanes on silica); Eltekova and Eltekov, Lanqmuir, 3:951 (1987) (aromatic carboxylic acids, aldehydes, alcohols and methoxy groups on titanium dioxide and silica); Lec et al., J. Phvs. Chem., 92:2597 (1988) (rigid phosphates on metals).
The particles, the oligonucleotides or both are functionalized in order to attach the
oligonucleotides to the particles. Such methods are known in the art.
Each particle will have a plurality of oligonucleotides attached to it. As a result, each particle- oligonucleotide conjugate can bind to a plurality of oligonucleotides or nucleic acids having the complementary sequence.
The following examples are given to illustrate the present invention. It should be understood that the invention is not to be limited to the specific conditions or details described in those examples.
Example I
A RMF centered on a microfluidic chamber containing a minute mass of magnetic silica beads) reveals the presence of a select polymeric analyte in the sample through bead aggregation and the formation of 'pinwheels'. When the sample is devoid of specific polymeric analytes, the beads remain in the 'dispersed' formation.
To characterize the pinwheel effect in the presence of DNA and protein, and provide evidence of a polymer size-dependence on pinwheel formation, the following experiments were conducted. Using commercially-available silica-coated, iron-cored magnetic beads added to a microfluidic chamber in 4 to 8 M guanidine hydrochloride, conditions for driving nucleic acids to bind the silica surface, the RMF circulates the beads freely in a manner that has them reasonably distributed. The dispersed formation is stable and reproducible upon addition of 1 to about 10 mg/mL bovine serum albumin), representing a 1000-fold excess mass of protein. However, a distinct transition to the 'pinwheel' formation was observed upon addition of nanogram levels of human genomic DNA (hgDNA), even with protein present. This indicates that protein, even at excessively high concentrations, does not interfere with nucleic acid- induced pinwheel formation.
A dynamic range of hgDNA-induced pinwheel formation owas observed ver three orders of magnitude, from 10 ng/μί to 10 pg/μί. The mass of beads in the chamber was tuned to match the mass of hgDNA needed for pinwheel formation.
To further support the premise that DNA is the only analyte causing pinwheel formation under chaotropic salt conditions, sheared and unsheared hgDNA were evaluated. While extracted hgDNA resulted in pinwheel formation, the same mass of sonicated DNA was similar to the negative control (dispersed. Interestingly, pinwheel formation is not exclusive to DNA or chaotropic conditions. Chitosan, a cationic polysaccharide (MW about 310 kDa), formed distinct pinwheels with the very same silica beads in a low-salt buffer (50 mM MES [2-(N-morpholino)ethanesulfonic acid] at pH 5). Here the binding is governed by electrostatic attraction, demonstrating that this detection method can be extrapolated with a different binding chemistry. This supports the position that this effect is a general phenomenon applicable to a wide variety of polymeric analytes.
The system described above provides a versatile, visual detection technique and related apparatus to detect and quantify polymeric molecules that bind to magnetic beads under certain conditions, e.g., conditions related to binding chemistries. Moreover, the technique may be conducted with only a minute mass of magnetic beads, e.g. as low as a few beads per assay, in a microfluidic chamber.
Example II
Exemplary Materials and Methods
Magnetic beads: MagneSil paramagnetic particle purchased from Promega Corporation, diameter = 8+4 μΐη.
PMMA array: 4x4 array made by laser engraver, diameter of each well = 0.2 in, capacity of each well = 20 μΙ_
Camera: Canon EOS Rebel XS
Microscope: Leica S8 APO
Stir plate: Thermix Stirrer Model 120S purchased from Fisher Scientific, Inc.
Exemplary Procedure
1. Prepare GuHCI solution in 1 χ TE buffer with a concentration of 8 M. Concentrations of from about 100 mM to about 8 M may be employed. Other concentrations of guanidine hydrochloride, and other chaotropic salts, may be employed to drive nucleic acid to bind magnetic particles, such as magnetic particles having diameters disclosed herein. Moreover, different concentrations of salts may result in enhanced aggregation with certain diameters of magnetic beads, e.g., lower concentration of salts may result in enhanced aggregation of smaller diameter magnetic beads. 2. Prepare suspension of magnetic beads: take 30 μΙ_ of stock beads suspension, wash with water and GuHCI solution and resuspend in 1 ml_ GuHCI solution.
3. Prepare DNA sample:
a. Pre-purified DNA: dilute using 8 M GuHCI solution to appropriate concentrations b. Cells or blood: mix cells or blood with copious 8 M GuHCI (e.g., volume ratio = 1 : 100) to ensure cells are lysed and all the DNA is released.
4. Use DNA with a known concentration and with the same size of unknown DNA as standard, and prepare standard DNA solutions by serial dilution.
5. Mix a certain number of beads (e.g., 2-15 μΙ_ of suspension, depending on desired detection limit, sensitivity, and dynamic range) and a certain volume of standard DNA solutions (typically 5 μΙ_) in the wells of PMMA plate. Adjust the total volume to 20 μΙ_ and GuHCI concentration to 6 M using
GuHCI and/or H20.
6. Repeat step 5 for unknown DNA samples. With the PMMA plate, up to 16 DNA-magnetic beads mixtures can be prepared and measured together.
7. Put the PMMA array on stir plate and turn on the stir plate to mix the beads and DNA until the mixture system reaches equilibrium (about 5 minutes).
8. Adjust the PMMA array position on the stir plate so that one of the wells is at the center of stir plate. Turn on the stir plate to disperse beads in the centered well and take pictures.
9. Repeat step 8 for all the other wells containing samples.
10. Collect 5 pictures for each well.
1 1. Analyze pictures using ImageJ (see image processing). 12. Normalize the dark area values acquired from ImageJ by the area of dispersed beads without
DNA, and plot the area percentage versus concentration of DNA.
Exemplary Image Processing
Software: ImageJ v1 .41 (Rasband, W.S., ImageJ, U. S. National Institutes of Health, Bethesda, Maryland, USA, http://rsb.info.nih.gov/ij/, 1997-2009), with multithresholder plugin
(http://rsbweb.nih.gov/ij/plugins/multi-thresholder.html, Nov 2nd, 2009).
Open 8-bit images, set threshold using triangle method in the multithresholder, click analyze- >analyze particle to acquire the number of pixels below the threshold since beads are darker than background.
In triangle algorithm, the software sets the value of grey level that gives the maximum distance as shown below to be the threshold. (Zack et al., J. Histochem. Cvtochem., 25:741 (1977)).
Results
Figure 1 shows the results of 5 and 10 μΙ_ of MagneSil paramagnetic particle suspension mixed with different amounts of HeLa cells. The graph is based on the assumption that there was 6.25 pg of DNA per cell.
Example III
Detection and Quantification of Nucleated Cells
To determine if cell number can be quantitated using the pinwheel assay, magnetic particles with DNA (concentrations may be at least 1 to 5 pg/uL, assuming 6.25 pg/cell) and without DNA from whole blood were subjected to RMF. As discussed above, detection of aggregates may be accomplished using a camera, a light source, a rotating magnetic field (RMF), a substrate for the sample such as PDMS-glass microwell chip, and magnetic particles, e.g., magnetic beads such as super paramagnetic silica-coated particles (about 5 μΐη in diameter).
Approximately 5 photographs are taken over 30 seconds after RMF is applied. For image analysis, a threshold value is set automatically by isodata algorithm. Pixels below threshold are considered dark, and the dark area of a sample without DNA is used to normalize DNA sample data. The dark area of a sample with DNA over the dark area of a sample without DNA times 100 is the dark area percent (%) (see Figure 2).
The results demonstrated that the pinwheel effect can be utilized to define the concentration of DNA directly from blood samples, and that different concentrations for each correlated with measurement of DNA via the conventional method. The results show that the pinwheel assay can be used to determine cell number.
A pinwheel assay of the diluted samples yielded overlapping curves, certifying that a consistent pinwheel response was obtained and that the degree of bead aggregation tracked with the number of WBC in each sample.
The results for the pinwheel assay correlate quite well with those from the Coulter Counter. WBC counts between 5,000 and 10,000 per μΙ_ of blood were generally within 25% error, while outside of that range, > 50% error was observed. This may be corrected by dilution of the blood sample. Thus, given an unknown blood sample, once could dilute it to a certain fold, and acquire a dark area value from the pinwheel assay. Based on a standard graph, the concentration of WBCs was plotted as a function of dark area and dilution factor, from which the concentration of WBC can be read directly after a pinwheel assay. For example, one could dilute an unknown sample to a certain fold, obtain the dark area, and find its position. Thus, the method can be used to test if the concentration of WBCs in an unknown blood sample is within the normal range (4,000 to 1 1 ,000 per μΙ_).
The following parameters were used for cell quantification.
SetDirectory["Desktop/Pinwheel X/201 1_02_21_M13 samples"];
fund [histodata_,thresholdJ:=
Module[{mean1 ,mean2,thr,greylevel,i},
greylevel=Table[i,{i,256}];
lf[Total[Take[histodata,threshold]]==0, mean 1 =0, mean 1 =Round[Total[Take[greyleve histodata,threshold]]/
Total[Take[histodata,threshold]]]j;
lf[Total[Take[histodata,threshold-
256]]==0,mean2=0,mean2=Round[Total[Take[greyleve histodata,threshold-
256]]/Total[Take[histodata,threshold-256]]]];
thr=Round[(mean1 +mean2)/2]
];
func2[filenames_]:=
Module[{data1 ,data2,data3,threshold,darkarea,a},
data1 =lmageData[lmageResize[lmport[filenames],Scaled[1/10]]];
data2=data1 //. {a_,b_,cj->a;
data3=BinCounts[Flatten[data2],{0, 1 , 1/256}];
threshold=FixedPoint[func1 [data3,#]&, 128];
darkarea=Total[Take[data3, threshold]]
];
filenames=FileNames["*.JPG"];
filenumber=Total[Dimensions[filenames]];
results=Table[func2[filenames[[i]]],{i,filenumber}];
Export[DateString[{"YearYJ\"MonthYJ7OayYJ\^ourYM^^
e[Join[{filenames}, {results}]]}];
Example IV
Method to Detect Cells Using Pathogen-Specific Virus or Phage
Phages specifically infect certain bacteria and reproduce many times over during the course of several hours. This reproduction can be quantified via a pinwheel assay of the DNA in the phage. Figure 4 shows a graph with results from a pinwheel assay using purified phage DNA.
Figure 5 shows the percent of dark area versus phage number (A) or concentration (B). M13 Phage (From Ph.D™ -7 Phage Display Peptide Library) were amplified through ER2738 E. coli, and phage were suspended in 1x TE (5 x 107 phage/μί.). 2.5 to 3 μΙ_ beads + a 5 μΙ_ phage sample in TE + about 10 to 12.5 μΙ_ GuHCI (8M) were mixed. Figure 5B show the limit of detection for these phage under the tested conditions, which is around 105 phage per μΙ_.
To detect bacteria in a sample using phage, a 10 ml_ sample with 100 E. coli bacteria was incubated with 1000 phage for 5 hours (Figure 6), and then the culture was centrifuged at 10,000 rpm for 10 minutes. The supernatant containing phage was transferred to a new tube and the phage were concentrated via standard polyethylene glycol precipitation (1/6 volume added). Phage samples were then analyzed by both titering and a pinwheel assay. 5 μΙ_ of the original sample, and of a 1 : 100 diluted, and a 1 : 1000 diluted sample, were mixed with 2.5 μΙ_ beads. From the data analysis, phage were able to produce a pinwheel at a concentration of 40,000 phage/μί., indicating the ability to positively detect a bacteria contaminated sample via this method. Although 100 E. coli in 10 mL did not result in pinwheel formation, the infection of the same number of cells with phage allowed for detection by a pinwheel assay, regardless of phage concentration. Phage diluted 1 : 1000 and 1 : 100 resulted in a 70% and 25% dark area, respectively, corresponding to about 10 and 100 x 104 phage per μΙ_. Considering the dilution factor, it was calculated that 4 x 108 phage/μί. were present in the nondiluted sample 5 hours after infection. The assay may detect as few as 1 to 10 cells in a sample.
Although exemplified with M13 phage and E. coli, other phage may be employed to detect E. coli or other bacteria. Phage useful in the invention include, but are not limited, to those in one of the following families: Myoviridae, Siphoviridae, Podoviridae, Tectiviridae, Corticoviridae, Lipothrixviridae,
Plasmaviridaa, Rudiviridae, Fuselloviridae, Inoviridae, Microviridae, Leviviridae, or Cystoviridae.
Exemplary Myoviridae include Mycobacterium phage 13, Enterobacteria phage Mu,
Enterobacteria phage P1 , Aeromonas phage 43, Haemophilus phage HP1 , Halobacterium phage phiH, Pseudomonas phage phiKZ, Pseudomonas phage EL, Pseudomonas phage Lin68, Bacillus phage SP01 , Enterobacteria phage T4, Acinetobacter phage 133, Aeromonas phage 44RR2.8f, Aeromonas phage 65, Aeromonas phage Aeh1 , Enterobacteria phage SV14, Enterobacteria phage T2, Pseudomonas phage 42, Vibrio phage nt-1 , Bacillus phage G, Bacillus phage PBS1 , and Microcystis aeruginosa phage Ma-LMM01.
Exemplary Siphoviridae include Lactococcus phage c2, Lactococcus phage bll_6, Mycobacterium phage L5, Mycobacteria phage D29, Enterobacteria phage lambda, Enterobacteria phage HK022, Enterobacteria phage HK97, Enterobacteria phage N15, Streptomyces phage phiC31 , Methanobacterium phage psiM1 , Bacillus phage SPbeta, Enterobacteria phage T1 , Enterobacteria phage T5 and Vibrio phage 149 (type IV).
Exemplary Podoviridae include Salmonella phage BPP-1, Bordetella phage BPP-1 , Burkholderia phage BcepC6B, Salmonella phage epsilon 15, Escherichia phage PhiV10, Pseudomonas phage LUZ24, Pseudomonas phage PaP3, Enterobacteria phage N4, Enterobacteria phage P22, Salmonella phage HK620, Salmonella phage ST64T, Shigella phage Sf6, Enterobacteria phage Phieco32, Endosymbiont phage APSE-1 , Lactococcus phage KSY1 , Phormidium phage Pf-WMP3, Phormidium phage Pf-WMP4, Pseudomonas phage 1 19X, Pseudomonas phage F1 16, Roseobacter phage SI01 , and Vibrio phage VpV262.
Exemplary Microviridae include Enterobacteria phage φΧ174, Spiroplasma phage 4, Bdellovibrio phage MAC7 and Chlamydia phage 1.
Specific phage tha may be useful include, but are not limited to, λ phage, T2 phage, T4 phage, T7 phage, T12 phage, R17 phage, MS2 phage, G4 phage, P1 phage, Enterobacteria phage P2, P4 phage, Phi X 174 phage, N4 phage, Φ6 phage, Φ29 phage, 186 phage or D29 phage.
Example V
For smaller genome viruses, e.g., those with genomes smaller than phage genomes, whole genome amplification (WGA) may be employed to replicate the entire genome or a substantial portion of the genome in vitro. In particular, for some viruses, PCR protocols have been employed for amplification of a sizable fraction of the genome, leading to about 6 Kbp amplified fragments. If fragments can be generated using PCR that are > about 3 Kbp, a pinwheel assay may be employed to detect those viruses (see Figure 5). Example VI
Method to Detect Polymeric Analytes Using a Pipette Tip and Filter Paper The aggregation observed in a RMF, as discussed above, allows for the qualitative detection of DNA and other (e.g., polysaccharides) polymeric analytes, quantitative determination of DNA by coupling to simple image analysis, quantitative determination of polymeric analytes such as DNA in crude samples, cell counts in cells that contain DNA (e.g., WBCs, and cultured bacteria), coupling with PCR to amplify large sections of viral genomes for virus detection, and coupling with phage infection of bacteria to amplify the phage so that, upon quantitating the number of phage by the aggregates, the original number of bacteria can be back-calculated.
The data described above used free solution interaction of the beads with the DNA in an open microliter volume well (e.g., a simple microchip) as a means of allowing the observation of aggregate, e.g., pinwheel, formation, which after terminating the RMF stays 'locked' for image analysis. The present method induces aggregate formation in an open ended container, such as a pipette tip, where the sample is drawn into a tip already containing beads, and then the tip is subjected to a brief exposure of a magnetic field (not necessarily a rotating one) to induce aggregation. The aggregates are then expelled onto an absorbant substrate, such as filter paper, to 'lock' the aggregate formation into one that can be interpreted by image analysis. Image analysis of the 'blot' can yield quantitative information about the mass of polymeric analyte, e.g., DNA, present.
Data shown in Figures 7, 9A-B, 9F, and 12-14 were generated using a
magnetic field strength of about 1000 gauss, length of application of the field was about 40 seconds, and the distance between magnet and pipette tip (which contains the sample and beads) was < 1 cm. The brightness histogram of each image was determined and the pixels representing the aggregates as 'dark area' counted, which increases with DNA concentration. In contrast, in Example VII, the color saturation histogram of each image was taken, and the pixels were counted representing all the dispersed beads and aggregates as 'dark area', which decreases with DNA concentration. The new 'dark area' values are higher than the old ones for the same aggregation. This effect was demonstrated by the use of a cell phone camera with 3M pixels, which has a much lower resolution than the scanner.
Figure 7A is a schematic of one exemplary method that employs a pipette tip as a receptacle for mixing a sample and particles. Blotted beads alone provide a distinct 'dispersed' pattern akin to the free solution microwell images, while blotted aggregated beads with DNA in provide a distinct 'pinwheel-like' pattern akin to the free solution microwell images that could be interpreted quantitatively. Thus, drawing up of a sample suspected of having a polymeric analyte into a pipette tip with magnetic beads provides sufficient turbulence to expose the polymeric analyte to the beads. Exposure of the mixture to an energy form that induces aggregation yields aggregates that are transferred to a support. The support is scanned to detect the aggregates and image analysis used to quantify aggregate formation.
The dependence of sensitivity of the method on bead size is shown in Figure 9. Aggregate formation was seen with 1 μιη beads in the presence but not the absence of DNA. Aggregate formation was not observed with 8 μιη beads even in the presence of 10 times the DNA concentration. The quantitative nature of aggregate formation with 1 μιη beads is shown in Figure 12. The higher the resolution of the scanner, the better the sensitivity (Figure 13), when the ark areas increase with DNA concentration. Figure 14 is an image of a filer paper with aggregates formed with increasing
concentrations of DNA. Example VII
Method to Detect Polymeric Analytes Using a Pipette Tip and Filter Paper Simple image analysis of aggregation eliminates the need of fluorescent labels and
corresponding optics and enables integration of the pinwheel assay into microfluidic systems. As discussed in Example VI and below, a more portable and cost-effective approach is one in which the aggregates are prepared in an 'image-ready' form on filter paper and transformed into quantitative digital information by a photo scanner or a cell phone camera.
In accordance with developing simple telemedicine with camera phones and paper-based microfluidic devices for developing regions (Martinez et al., Anal. Chem., 80:3699 (2008); Lee et al., Lab on a chip, 1J_:120 (201 1 )), the assay ("PAB" assay, pipette, aggregate and blot) enables rapid quantification of nanogram-scale samples prior to downstream analysis with enhanced simplicity, portability and cost-effectiveness compared with conventional techniques. Combining with paper-based DNA extraction and detection modalities, the PAB assay could serve as a starting point towards more integrated lab-on-paper devices for point-of-care genetic analysis in resource-limited regions.
Experimental
Materials
1 μιη Dynabeads® MyOne™ SILANE was purchased from Life Technologies. 8 μιη Magnesil paramagnetic beads were purchased from Promega. Lambda phage genomic DNA (48.5 kb long) was purchased from USB (Cleveland, OH). Human genomic DNA was purified from whole blood with DNA isolation kit purchased from QIAGEN. Whole blood samples were donated by consenting donors.
Qualitative Grade 3 Filter Paper with 6 micrometer particle retention was purchased from Whatman®. Pipet tips (VWR Universal Fit Bevel Point Pipet Tip) were purchased from VWR. AmpFISTR® COfiler® PCR Amplification Kit purchased from Applied Biosystems was used for STR analysis.
Reagent and Sample Preparation
Dynabead preparation.
Thirty microliters of stock Magnesil beads were washed once with deionized, distilled water (Nanopure) followed by one wash with GdnHCI solution (8 M, 1 x TE, adjusted to pH 6.1 with 100 mM MES) and resuspended in 1 mL of GdnHCI solution to make the suspension, which was further diluted in the individual pinwheel assays. Human genomic DNA was purified from whole blood with QIAGEN DNA isolation kit following instructions from the manufacture. The DNA concentration of standard samples was determined with UV-Vis spectroscopy. DNA samples were diluted serially with 1 * TE buffer (10 mM Tris base, 1 mM EDTA, pH 8.0) to appropriate concentrations, aliquoted, and stored at -20 °C until use. DNA Quantification with the PAB assay
2 [it of magnetic beads and 1 μί of DNA sample were mixed in a pipette tip, and the mixture was exposed to a magnetic field around 1000 Gauss for 40 seconds to induce bead aggregation. The 3-μί droplet was dispensed onto filter paper, forming a wet area around 1 cm in diameter. After the area dried by evaporation at room temperature, the image of aggregates on the paper was acquired with EPSON Perfection V100 Photo Scanner or iphone 3GS for data analysis. Image Processing
Images of each dispensed area were cropped from the original photo in TIF format. The images were imported into Mathematica in HSB (hue-saturation-brightness) mode, and the saturation data was extracted for further analysis. An isodata algorithm written in Mathematica was applied to the saturation data of negative controls (beads without DNA), and it defined a threshold for all the images, above which the pixels represent the beads and aggregates. The total number of these pixels in each image (i.e., dark area) was normalized to the negative controls, and correlated with DNA concentration.
STR Analysis
STR analysis was performed according to manufacture's instruction. Briefly, DNA samples were amplified using the AmpFISTR COfiler kit reagents, and the PCR products were separated on ABI PRISM 310 Genetic Analyzer, which generates electropherograms for further interpretation.
Results and Discussion
The pinwheel assay has been shown as a simple, cost-effective, and accurate method for DNA guantification, and towards more specific and practical applications, two formats of the assay are evolving: (1 ) a multiplexed version that can accept multiple samples in parallel and generate guantitative results with high throughput, and (2) a simplified version with enhanced portability and cost-effectiveness. For point-of-care testing, especially in developing regions, cost-effectiveness is often of more importance than performance because of economics, and due to the lack of well-trained personnel, simplicity is also necessary. As for the PAB approach of the pinwheel assay, the aim was to develop a new DNA guantification method at the point of care. Therefore, the PAB assay utilizes the most simple, inexpensive, and readily available materials in research laboratories, such as pipette tips and filter paper, and uses one of the most prevalent electronic devices - cell phones- as the modality for data acguisition, transmission and analysis.
In one embodiment, the PAB assay, as shown in Figure 7, includes: (1 ) pipetting silica-coated magnetic beads in 8 M GuHCI and DNA sample, (2) promoting aggregation of DNA and beads by exposure to a magnetic field, (3) dispensing the pipetted volume (blotting) onto filter paper, (4) acguiring the image of blotted filter paper with a photo scanner or a cell phone camera, and (5) transferring the data from the scanner to a computer for guantitative processing. Using a cell phone camera (iphone 3GS with 3 M pixels) to acguire images also suffices the need of guantification. At the point of care, cell phones can also send the data to a central laboratory and receive results through cellular network, or with the computing power of a smartphone, the data can be processed on site. For a negative control, the beads, in the absence of DNA, remain in a dispersed state in the droplet in pipette tip, and they spread over a large area when dispensed onto filter paper. For a positive control, DNA strands adsorb onto the silica surface of beads driven by 8 M GdnHCI, and the applied magnetic field brings the DNA-coated beads into proximity to promote bead aggregation, which only occupies a small area after blotted on the filter paper.
The images of the negative and positive controls were imported into Mathematica in HSB (hue- saturation-brightness) mode. The hue data is not well defined for white color, and the change of brightness data appears less sensitive to bead aggregation than saturation, so the saturation data was selected to characterize the difference between images. Two peaks evolve in the saturation histogram of negative controls, corresponding to the white background (saturation = 0 - 20) and light brown beads (saturation > 20). In the histogram of positive controls, the white background peak remains while the other peak shift to saturation above 250, which represents the dark brown aggregates (Figures 7C-D). The change of saturation histogram thus provides a simple means to quantify the aggregation, which is correlated with DNA concentration.
In order to extract quantitative information from the images, serially diluted DNA samples were applied to the PAB assay, and the saturation histograms of each sample clearly illustrate the transition from dispersed beads to tight aggregates as DNA concentration rises (Figure 8A). To subtract the white background from each image, a threshold that can distinguish the pixels representing the
beads/aggregates was required, which was achieved by applying the isodata algorithm reported previously to the negative controls. In all the images at different DNA concentrations, the beads and aggregates were now defined as the pixels with saturation above the threshold, and the total number of these pixels (i.e. dark area) decreases due to the loss of dispersed beads as the aggregates evolve in the presence of DNA. The dark area values were normalized with the negative control, and correlated with DNA concentration, which fits well in an exponential model (Figure 8B). The sensitivity was not as high as the previously reported value of the pinwheel assay, because the possibility that the dispersed beads were not evenly distributed in the image rises significantly on the filter paper, which compromises the reproducibility leading to larger standard deviation than previous results in the pinwheel assay. However, good sensitivity is often accompanied by high cost, and decrease of sensitivity was necessary in order to improve simplicity and cost-effectiveness for a broader range of applications as long as the resultant sensitivity still suffices.
The sensitivity of the PAB assay can be tuned by varying the bead size, since the same amount of DNA can bind to more beads with smaller diameter. As shown in Figure 9C, the aggregation of 1 μιη beads was visually detectable at 0.8 ng/μ.. DNA while for 8 μιη beads, the same aggregation does not happen until DNA concentration rises to 6.4 ng/μΙ.. A quantitative analysis clearly shows that the sensitivity increased by 6 fold as the diameter decreased from 8 μιη to 1 μιη, and that a 1 : 1 mixture of the two sizes resulted in a moderate sensitivity between the previous two values. The effect of bead size on aggregation indicated that the standard curve can be tuned by adjusting the mean bead diameter, and better sensitivity could be achieved with magnetic beads at nanometer scale.
To demonstrate the application of the PAB assay as an integrated step in genetic analysis, a Qiagen DNA extraction kit was selected to purify human genomic DNA (hgDNA) from raw blood, and after the PAB assay, the samples with appropriate DNA concentrations were selected for PCR and STR analysis. The Qiagen kit and conventional PCR-based STR analysis are not ideal for cost-effective point- of-care testing, but due to the lack of commercially available lab-on-paper devices, they were combined with the PAB assay to demonstrate the significance of DNA quantification in genetic analysis. Figure 10A illustrates the standard curve for the quantification of purified hgDNA with 1 μιη beads, based on which the DNA concentration of seven unknown samples was measured and correlated with the results from UV-Vis spectroscopy (Figure 10B). The Bland-Altman plot (not shown) showed a moderate accuracy of the PAB assay (± 0.7 ng/μί. difference at 95% confidence comparing to UV-Vis). STR analysis has been a standard technique to discriminate DNA samples in molecular biology and forensic science. A COfiler PCR amplification kit was used to amplify 7 STR loci, which were separated and detected via capillary electrophoresis. The PCR reaction requires 1 .0 - 2.5 ng/μί. [COfiler manual] of DNA templates. Three DNA samples with DNA concentrations 0.67, 1.24, and >2.83 ng/μί. were analyzed with the STR kit, and only the one with 1.24 ng/μί. DNA yielded successful detection of all 7 loci. Low input concentration (e.g., 0.67 ng/μί. as determined with the PAB assay) caused insufficient amplification, while too many templates (e.g., > 2.83 ng/μΙ.) resulted in fluorescence intensity exceeding the dynamic range of detection leading to inaccurate multicomponent analysis (Figure 1 1 C).
Consistent with the concept of simplicity and portability, a cell phone camera was tested as the detector instead of desktop photo scanner. The photo scanner generated digital images with high resolution and consistent lighting conditions, which may be challenging for cell phone camera under ambient light. The 3M-pixel camera on iphone 3GS was used to acquire the images of aggregation on filter paper, resulting in a 18.7-fold decrease of the number of pixels per image. Although this change of digital resolution leads to failure of quantifying small aggregates represented the noisy profile above 100 saturation (Figure 14B), the dark area values remained distinguishable at different DNA concentrations because the camera can still quantify the area of dispersed beads, which is the major contributor of dark area. The standard curve generated by the cell phone camera (Figure 14A) was comparable to the one from photo scanner (Figure 8B), denoting the feasibility of cell phone-based PAB assay. Considering the wide accessibility of cell phones worldwide, the use of cell phone camera enables a truly portable and cost-effective assay for the point of care.
Conclusions
The PAB assay quantifies DNA concentration by measuring the aggregation of magnetic beads, and it significantly lowers the cost of DNA quantification by eliminating the need of fluorescent labels. Similar approaches exist, such as colorimetric detection with gold nanoparticles with paper-based device (Zhao et al., Anal. Chem., 80:8431 (2008)). The PAB assay surpasses the reported method in two aspects: (1 ) magnetic field induces bead aggregation much more effectively than diffusion, which shortens reaction time from hours to several minutes; (2) a more sophisticated algorithm provides more quantitative analysis than in the previous report.
In conclusion, a simple, portable, and label-free lab-on-paper assay for DNA quantification is provided, which can be further combined with paper-based DNA extraction method and microfluidic PCR for sample-to-result genetic analysis at the point of care. Since the filter paper and magnetic beads can be readily functionalized, thoughtfully designed surface modification will bring great versatility to this approach, and quantitative assays for a variety of targets can be developed.
Example VIII
Hybridization Induced Aggregation
Methods
Into each well: 17 μΙ_ of 1 x PCR buffer
1 μΙ_ of sample (suspected of having a specific target sequence). The sample may be heated using a heated stir plate at max RPM, covering the wall with a piece of glass to prevent evaporation, after which the following are added:
1 μΙ_ of 5' primer (oligonucleotide) containing beads
1 μΙ_ of 3' primer (oligonucleotide) containing beads
A pinwheel forms in the center of the well when the complementary connector anneals to primer sequences and RMF is applied, which brings the beads together, then a picture is taken.
A. A 100 bp connection was formed when a connector (target) sequence
5'-AAATACGCCTCGAGTGCAGCCCATTT-3' (SEQ ID NO:3) was mixed with beads having 5'-
[BioTEG]TTTTTTATGTGGTCTATGTCGTCGTTCGCTAGTAGTTCCTGGGCTGCAC-3' (SEQ ID NO: 1 ) and 5'-TCGAGGCGTAGAATTCCCCCGATGCGCGCTGTTCTTACTCATTTTT[BioTEG-Q]-3' (SEQ ID
NO:2), and that mixture subjected to an annealing temperature of 25°C.
The size of the pinwheel did not change with concentration, just the amount of pinwheels formed. Thus, the hybridization induced aggregation method can not only quantify the amount of connection but also can give a range of length of connection.
B. To detect a λ-DNA PCR product, a different working temperature was employed (70°C). Primer Lambda_probe_3' -
CCAGTTGTACGAACACGAACTCATCTTTTTT[BioTEG-Q] (SEQ ID NO:4)
Lambda_probe_5' - [BioTEG]TTTTTTGGTTATCGAAATCAGCCACAGCGCC (SEQ ID NO:5) were employed to detect a 500 bp PCR product
(GATGAGTTCGTGTTCGTACAACTGGCGTAATCATGGCCCTTCGGGGCCATTGTTTCTCTGTGGAGGA GTCCATGACGAAAGATGAACTGATTGCCCGTCTCCGCTCGCTGGGTGAACAACTGAACCGTGATGTC AGCCTGACGGGGACGAAAGAAGAACTGGCGCTCCGTGTGGCAGAGCTGAAAGAGGAGCTTGATGA CACGGATGAAACTGCCGGTCAGGACACCCCTCTCAGCCGGGAAAATGTGCTGACCGGACATGAAAA TGAGGTGGGATCAGCGCAGCCGGATACCGTGATTCTGGATACGTCTGAACTGGTCACGGTCGTGGC ACTGGTGAAGCTGCATACTGATGCACTTCACGCCACGCGGGATGAACCTGTGGCATTTGTGCTGCC GGGAACGGCGTTTCGTGTCTCTGCCGGTGTGGCAGCCGAAATGACAGAGCGCGGCCTGGCCAGAA TGCAATAACGGGAGGCGCTGTGGCTGATTTCGATAACC; SEQ ID NO:6).
However, a longer sequence (full length λ genomic DNA) had no effect, thus demonstrating specificity. The pinwheel size was different from that in A (above) due to the longer length of sequence between beads that were connected via hybridization, resulting in a pinwheel that is less tight (compact) and so it appears larger.
C. Primer sequences typically used for qPCR are bound to a silica-like beads through streptavidin- biotin linkages. Beads having oligonucleotides with those linkages were prepared; forward primer:
CGGGAAGGGAACAGGAGTAAG (SEQ ID NO:7); and reverse primer: CCAATCCCAGGTCTTCTGAACA (SEQ ID NO:8). Those sequences are specific for a 68 bp target region of a human TPOX locus (cgggaagggaacaggagtaagAccagcgcacagcccgacttgTgttcagaagacctgggattgg; SEQ ID NO:9). Pinwheels formed upon addition of hgDNA. For some hybridization induced aggregation assays, restriction enzymes or other nucleases may be employed to create smaller hgDNA fragments.
Exemplary Applications for Hybridzation Induced Aggregation Assays
The hybridization induced aggregation assay may be employed to detect specific DNAs in complex matrices, e.g., whole blood, DNAs such as cancer biomarkers, species specific DNA, e.g., human vs. animal detection in an unknown sample, male versus female detection or in an unknown sample, or exclusion of a suspect's DNA in criminal investigations. The assay allows for fluorescent label- free detection of specific sequences, is rapid (5 minutes) and is low cost, e.g., due to minimal instrumentation. The assay can be used to determine specific sequences of varying length and annealing temperatures, and so is a format suitable for multiplexing.
Example IX
In one embodiment, a hybridization induced aggregation assay employs an absorptive substrate with a read-out that provides sequence-specific information. Since the beads only aggregate when the target is present, the stark contrast on the absorptive substrate, e.g., filter paper, between aggregated and non-aggregated is, at the very least, qualitative for the presence of that specific sequence. Figure 18 shows this effect on Whatman filter paper with oligo-adducted magbeads specific for a 26 base target.
Preliminary results indicate sensitivity as low about 104 to about 106 copies of target. Such an assay may be quantitative as well.
Moreover, because of the conditions employed for hybridization in a hybridization induced aggregation assay, a nonabsorptive substrate can be used along with evaporation. For instance, if the small volume (e.g., in microliters) is dispensed onto a hydrophobic surface (e.g., polyethylene terephthalate (PETE, PET), polystyrene (PS), polyethylene (PE), polycarbonate (PC), or poly(methyl methacrylate) (PMMA)), the solution 'beads' with a large contact angle allowing individual droplets to remain spatially separated on the surface. If the aqueous solution is then evaporated (actively or passively), the aggregation state of the beads is "locked" on the surface, thereby allowing for image capture. In one embodiment, hydrophobic surface is selected to allow the beads or bead/DNA aggregates to adsorpt to the surface.
A similar approach may be employed with DNA-based bead aggregation in the presence of GuHCI. If the small volume (e.g., microloiters) of that solution is dispensed onto a hydrophobic surface (e.g., polyethylene terephthalate (PETE, PET), polystyrene (PS), polyethylene (PE), polycarbonate (PC), or poly(methyl methacrylate) (PMMA)), the solution 'beads' with a large contact angle allowing individual droplets to remain spatially separated on the surface. Following exposure to a magnetic field before or after the sample is covered with a cover slip, the extent of aggregation is retained so that an optical image is captured (Figure 19). The types of images that can be obtained are shown in Figure 20 (aggregates of beads form in the presence of 1 ng hgDNA resulting in low dark area, while the beads remain dispersed without DNA). Here, a nonabsorptive substrate was used (one that repels aqueous solution).
All publications, patents and patent applications are incorporated herein by reference. While in the foregoing specification, this invention has been described in relation to certain preferred embodiments thereof, and many details have been set forth for purposes of illustration, it will be apparent to those skilled in the art that the invention is susceptible to additional embodiments and that certain of the details herein may be varied considerably without departing from the basic principles of the invention.

Claims

WHAT IS CLAIMED IS:
1. A method for detecting the presence of a polymeric analyte in a sample, comprising:
a) providing a sample having a polymeric analyte, a population of magnetic beads and an open ended container;
b) mixing the sample and the beads in the container under conditions that allow for binding of the analyte to the beads;
c) subjecting the container to an amount of energy effective to form a population of aggregates between the beads and the analyte;
d) transferring the population of aggregates to a substrate; and
e) detecting the presence or amount of aggregates on the substrate, which indicates the presence or amount of the polymeric analyte.
2. A method for detecting the presence or amount of a polymeric analyte in a sample, comprising: a) providing a substrate having samples each at a distinct position on
the substrate, wherein a plurality of samples comprise aggregates formed with a polymeric analyte and magnetic beads; and
b) detecting the presence or amount of aggregates at a plurality of the distinct positions on the substrate, which indicates the presence or amount of the polymeric analyte.
3. The method of claim 1 wherein the container is a pipette tip.
4. The method of claim 1 or 3 wherein container is subjected to a magnetic field.
5. The method of any one of claims 1 to 4 wherein the substrate is an absorbant membrane.
6. The method of claim 5 wherein the membrane is filter paper.
7. The method of claim 5 wherein the substrate comprises cellulose.
8. The method of claim 5 wherein the substrate comprises PVDF.
9. The method of any one of claims 1 to 8 wherein the polymeric analyte is nucleic acid, lipid, polysacharride, or protein.
10. The method of claim 9 wherein the nucleic acid is DNA or RNA.
1 1. The method of any one of claims 1 to 10 wherein the magnetic beads are coated or derivatized to bind or enhance binding to the polymeric analyte.
12. The method of any one of claims 1 to 1 1 wherein the beads are about 1 μιη to about 10 μιη in diameter.
13. The method of any one of claims 1 to 12 wherein the magnetic beads are coated with silica, amine-based charge switch, boronic acid, silane, oligonucleotides, lectins, reverse phase, antibody, antigen, avidin, or biotin.
14. The method of any one of claims 1 to 12 wherein the polymeric analyte is nucleic acid, the
magnetic beads are silica coated, and the conditions include the presence of a chaotropic agent.
15. The method of any one of claims 1 to 12 wherein the polymeric analyte is positively charged polysacharride, the magnetic beads are silica coated, and the conditions include the presence of low ionic strength.
16. The method of any one of claims 1 to 12 wherein the polymeric analyte is protein, the magnetic beads are silica coated, and the conditions include denaturing conditions for the protein.
17. The method of any one of claims 1 or 3 to 15 wherein the beads are introduced to the container before the sample.
18. The method of any one of claims 1 to 17 wherein the aggregates are detected using a camera and a computer electronically connected to the camera for analyzing images from the camera.
19. The method of any one of claims 1 to 18 wherein the analyte is genomic DNA.
20. The method of claim 19 wherein the genomic DNA is subjected to sonication, shearing or a nuclease.
21. The method of any one of claims 1 to 14 or 16 to 20 wherein the analyte is nucleic acid and the binding is not sequence specific.
22. The method of any one of claims 1 to 21 wherein the sample comprises lysed cells.
23. The method of any one of claims 1 to 21 wherein the sample comprises amplified DNA.
24. A method for detecting the presence or amount of a target nucleic acid in a sample, comprising:
a) contacting in an open ended container a sample suspected of having a first target nucleic acid, a first population of magnetic beads having attached thereto oligonucleotides comprising a first nucleotide sequence which has sequences complementary to sequences in the target nucleic acid, and a second population of magnetic beads having attached thereto oligonucleotides comprising a second nucleotide sequence which has sequences complementary to sequences in the target nucleic acid which are different than the complementary sequences in the first nucleotide sequence, under conditions that allow for binding of the complementary sequences in the oligonucleotides to the first target nucleic acid if the first target nucleic acid is present in the sample, so as to form a mixture having aggregates;
b) transferring the aggregates to a substrate; and
c) detecting the presence or amount of aggregates on the substrate, which indicates the presence or amount of the first target nucleic acid.
25. The method of claim 24 wherein the mixture is subjected to an energy that induces or enhances aggregate formation.
26. The method of claim 24 or 25 wherein the target nucleic acid comprises a cancer biomarker, a species specific sequence or a gender specific sequence.
27. The method of any one of claims 24 to 26 wherein the sample comprises genomic DNA, amplified nucleic acid, cells or a physiological fluid sample.
28. The method of claim 27 wherein the genomic DNA is sheared or subjected to nuclease treatment prior to contact with the magnetic beads.
29. The method of claim 28 wherein the nuclease is a restriction endonuclease.
30. The method of any one of claims 24 to 29 wherein the oligonucleotides are bound to the beads via a non-covalent interaction.
31. The method of claim 30 wherein the non-covalent interaction is between streptavidin or avidin and biotin.
32. The method of claim 27 wherein the sample is a blood sample.
33. The method of claim 27 wherein the cells are human cells.
34. The method of any one of claims 24 to 33 wherein the sample is further contacted with third population of magnetic beads having attached thereto oligonucleotides comprising a third nucleotide sequence which has sequences complementary to sequences in a second target nucleic acid sequence and a fourth population of magnetic beads having attached thereto oligonucleotides comprising a fourth nucleotide sequence which has sequences complementary to sequences in the second target nucleic acid sequence which are different than the sequences in the first nucleotide sequence, under conditions that allow for binding of the complementary sequences to the second target nucleic acid sequence if the second target nucleic acid sequence is present in the sample, wherein the first or second population of beads can be distinguished from the third or fourth population of beads.
35. The method of any one of claims 24 to 33 wherein the substrate is an absorbant membrane. The method of any one of claims 24 to 33 wherein the substrate is an adsorbent substrate.
PCT/US2012/036139 2011-05-02 2012-05-02 Method and system to detect aggregate formation on a substrate Ceased WO2012151289A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201161481594P 2011-05-02 2011-05-02
US61/481,594 2011-05-02

Publications (2)

Publication Number Publication Date
WO2012151289A2 true WO2012151289A2 (en) 2012-11-08
WO2012151289A3 WO2012151289A3 (en) 2013-03-07

Family

ID=46208759

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2012/036139 Ceased WO2012151289A2 (en) 2011-05-02 2012-05-02 Method and system to detect aggregate formation on a substrate

Country Status (1)

Country Link
WO (1) WO2012151289A2 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014113598A3 (en) * 2013-01-16 2015-01-29 The Regents Of The University Of California Microfluidic devices to extract, concentrate and isolate molecules
CN107328931A (en) * 2017-05-16 2017-11-07 中山大学 A kind of quick continuous detection technique based on nano-probe and magnetic micro-nano granules
US10656146B2 (en) 2008-03-12 2020-05-19 University Of Virginia Patent Foundation Detection of polymeric analytes
US11207677B2 (en) 2018-03-07 2021-12-28 University Of Virginia Patent Foundation Devices, systems, and methods for detecting substances
US12551885B2 (en) 2020-10-28 2026-02-17 University Of Virgina Patent Foundation Storage of corrosive materials on a fiber-based fluidic device and related methods thereof

Citations (111)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3687808A (en) 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US4469863A (en) 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US4476301A (en) 1982-04-29 1984-10-09 Centre National De La Recherche Scientifique Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon
US4845205A (en) 1985-01-08 1989-07-04 Institut Pasteur 2,N6 -disubstituted and 2,N6 -trisubstituted adenosine-3'-phosphoramidites
US4981957A (en) 1984-07-19 1991-01-01 Centre National De La Recherche Scientifique Oligonucleotides with modified phosphate and modified carbohydrate moieties at the respective chain termini
US5023243A (en) 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5118800A (en) 1983-12-20 1992-06-02 California Institute Of Technology Oligonucleotides possessing a primary amino group in the terminal nucleotide
US5130302A (en) 1989-12-20 1992-07-14 Boron Bilogicals, Inc. Boronated nucleoside, nucleotide and oligonucleotide compounds, compositions and methods for using same
US5134066A (en) 1989-08-29 1992-07-28 Monsanto Company Improved probes using nucleosides containing 3-dezauracil analogs
US5151510A (en) 1990-04-20 1992-09-29 Applied Biosystems, Inc. Method of synethesizing sulfurized oligonucleotide analogs
US5166315A (en) 1989-12-20 1992-11-24 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5175273A (en) 1988-07-01 1992-12-29 Genentech, Inc. Nucleic acid intercalating agents
US5177196A (en) 1990-08-16 1993-01-05 Microprobe Corporation Oligo (α-arabinofuranosyl nucleotides) and α-arabinofuranosyl precursors thereof
US5185444A (en) 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
US5188897A (en) 1987-10-22 1993-02-23 Temple University Of The Commonwealth System Of Higher Education Encapsulated 2',5'-phosphorothioate oligoadenylates
US5194599A (en) 1988-09-23 1993-03-16 Gilead Sciences, Inc. Hydrogen phosphonodithioate compositions
US5214134A (en) 1990-09-12 1993-05-25 Sterling Winthrop Inc. Process of linking nucleosides with a siloxane bridge
US5216141A (en) 1988-06-06 1993-06-01 Benner Steven A Oligonucleotide analogs containing sulfur linkages
US5235033A (en) 1985-03-15 1993-08-10 Anti-Gene Development Group Alpha-morpholino ribonucleoside derivatives and polymers thereof
US5264562A (en) 1989-10-24 1993-11-23 Gilead Sciences, Inc. Oligonucleotide analogs with novel linkages
US5264423A (en) 1987-03-25 1993-11-23 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5264564A (en) 1989-10-24 1993-11-23 Gilead Sciences Oligonucleotide analogs with novel linkages
US5276019A (en) 1987-03-25 1994-01-04 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5278302A (en) 1988-05-26 1994-01-11 University Patents, Inc. Polynucleotide phosphorodithioates
US5319080A (en) 1991-10-17 1994-06-07 Ciba-Geigy Corporation Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates
US5321130A (en) 1992-02-10 1994-06-14 Molecular Probes, Inc. Unsymmetrical cyanine dyes with a cationic side chain
US5321131A (en) 1990-03-08 1994-06-14 Hybridon, Inc. Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling
US5359044A (en) 1991-12-13 1994-10-25 Isis Pharmaceuticals Cyclobutyl oligonucleotide surrogates
US5367066A (en) 1984-10-16 1994-11-22 Chiron Corporation Oligonucleotides with selectably cleavable and/or abasic sites
US5399676A (en) 1989-10-23 1995-03-21 Gilead Sciences Oligonucleotides with inverted polarity
US5405939A (en) 1987-10-22 1995-04-11 Temple University Of The Commonwealth System Of Higher Education 2',5'-phosphorothioate oligoadenylates and their covalent conjugates with polylysine
US5405938A (en) 1989-12-20 1995-04-11 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5432272A (en) 1990-10-09 1995-07-11 Benner; Steven A. Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases
US5434257A (en) 1992-06-01 1995-07-18 Gilead Sciences, Inc. Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages
US5446137A (en) 1993-12-09 1995-08-29 Syntex (U.S.A.) Inc. Oligonucleotides containing 4'-substituted nucleotides
US5455233A (en) 1989-11-30 1995-10-03 University Of North Carolina Oligoribonucleoside and oligodeoxyribonucleoside boranophosphates
US5457187A (en) 1993-12-08 1995-10-10 Board Of Regents University Of Nebraska Oligonucleotides containing 5-fluorouracil
US5459255A (en) 1990-01-11 1995-10-17 Isis Pharmaceuticals, Inc. N-2 substituted purines
US5466786A (en) 1989-10-24 1995-11-14 Gilead Sciences 2'modified nucleoside and nucleotide compounds
US5466677A (en) 1993-03-06 1995-11-14 Ciba-Geigy Corporation Dinucleoside phosphinates and their pharmaceutical compositions
US5470967A (en) 1990-04-10 1995-11-28 The Dupont Merck Pharmaceutical Company Oligonucleotide analogs with sulfamate linkages
US5472881A (en) 1992-11-12 1995-12-05 University Of Utah Research Foundation Thiol labeling of DNA for attachment to gold surfaces
US5476925A (en) 1993-02-01 1995-12-19 Northwestern University Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups
US5484908A (en) 1991-11-26 1996-01-16 Gilead Sciences, Inc. Oligonucleotides containing 5-propynyl pyrimidines
US5489677A (en) 1990-07-27 1996-02-06 Isis Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
US5502177A (en) 1993-09-17 1996-03-26 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US5514785A (en) 1990-05-11 1996-05-07 Becton Dickinson And Company Solid supports for nucleic acid hybridization assays
US5519134A (en) 1994-01-11 1996-05-21 Isis Pharmaceuticals, Inc. Pyrrolidine-containing monomers and oligomers
US5519126A (en) 1988-03-25 1996-05-21 University Of Virginia Alumni Patents Foundation Oligonucleotide N-alkylphosphoramidates
US5525711A (en) 1994-05-18 1996-06-11 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Pteridine nucleotide analogs as fluorescent DNA probes
US5539082A (en) 1993-04-26 1996-07-23 Nielsen; Peter E. Peptide nucleic acids
US5541307A (en) 1990-07-27 1996-07-30 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs and solid phase synthesis thereof
US5550111A (en) 1984-07-11 1996-08-27 Temple University-Of The Commonwealth System Of Higher Education Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof
US5552540A (en) 1987-06-24 1996-09-03 Howard Florey Institute Of Experimental Physiology And Medicine Nucleoside derivatives
US5561225A (en) 1990-09-19 1996-10-01 Southern Research Institute Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages
US5567811A (en) 1990-05-03 1996-10-22 Amersham International Plc Phosphoramidite derivatives, their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides
US5571799A (en) 1991-08-12 1996-11-05 Basco, Ltd. (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response
US5576427A (en) 1993-03-30 1996-11-19 Sterling Winthrop, Inc. Acyclic nucleoside analogs and oligonucleotide sequences containing them
US5582977A (en) 1991-09-16 1996-12-10 Molecular Probes, Inc. Dimers of unsymmetrical cyanine dyes
US5587361A (en) 1991-10-15 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US5591722A (en) 1989-09-15 1997-01-07 Southern Research Institute 2'-deoxy-4'-thioribonucleosides and their antiviral activity
US5594121A (en) 1991-11-07 1997-01-14 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified purines
US5596086A (en) 1990-09-20 1997-01-21 Gilead Sciences, Inc. Modified internucleoside linkages having one nitrogen and two carbon atoms
US5596091A (en) 1994-03-18 1997-01-21 The Regents Of The University Of California Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides
US5597909A (en) 1994-08-25 1997-01-28 Chiron Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
US5602240A (en) 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
US5608046A (en) 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
US5610289A (en) 1990-07-27 1997-03-11 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogues
US5610300A (en) 1992-07-01 1997-03-11 Ciba-Geigy Corporation Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates
US5614617A (en) 1990-07-27 1997-03-25 Isis Pharmaceuticals, Inc. Nuclease resistant, pyrimidine modified oligonucleotides that detect and modulate gene expression
US5618704A (en) 1990-07-27 1997-04-08 Isis Pharmacueticals, Inc. Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling
WO1997012896A1 (en) 1995-10-04 1997-04-10 Epoch Pharmaceuticals, Inc. Selective binding complementary oligonucleotides
US5623070A (en) 1990-07-27 1997-04-22 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5625050A (en) 1994-03-31 1997-04-29 Amgen Inc. Modified oligonucleotides and intermediates useful in nucleic acid therapeutics
US5627053A (en) 1994-03-29 1997-05-06 Ribozyme Pharmaceuticals, Inc. 2'deoxy-2'-alkylnucleotide containing nucleic acid
US5633360A (en) 1992-04-14 1997-05-27 Gilead Sciences, Inc. Oligonucleotide analogs capable of passive cell membrane permeation
US5639873A (en) 1992-02-05 1997-06-17 Centre National De La Recherche Scientifique (Cnrs) Oligothionucleotides
US5645985A (en) 1991-11-26 1997-07-08 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines
US5646265A (en) 1990-01-11 1997-07-08 Isis Pharmceuticals, Inc. Process for the preparation of 2'-O-alkyl purine phosphoramidites
US5646269A (en) 1994-04-28 1997-07-08 Gilead Sciences, Inc. Method for oligonucleotide analog synthesis
US5658873A (en) 1993-04-10 1997-08-19 Degussa Aktiengesellschaft Coated sodium percarbonate particles, a process for their production and detergent, cleaning and bleaching compositions containing them
US5663312A (en) 1993-03-31 1997-09-02 Sanofi Oligonucleotide dimers with amide linkages replacing phosphodiester linkages
US5670633A (en) 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
US5672697A (en) 1991-02-08 1997-09-30 Gilead Sciences, Inc. Nucleoside 5'-methylene phosphonates
US5677437A (en) 1990-07-27 1997-10-14 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5677439A (en) 1990-08-03 1997-10-14 Sanofi Oligonucleotide analogues containing phosphate diester linkage substitutes, compositions thereof, and precursor dinucleotide analogues
US5681941A (en) 1990-01-11 1997-10-28 Isis Pharmaceuticals, Inc. Substituted purines and oligonucleotide cross-linking
US5714331A (en) 1991-05-24 1998-02-03 Buchardt, Deceased; Ole Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility
US5719262A (en) 1993-11-22 1998-02-17 Buchardt, Deceased; Ole Peptide nucleic acids having amino acid side chains
US5721218A (en) 1989-10-23 1998-02-24 Gilead Sciences, Inc. Oligonucleotides with inverted polarity
US5750692A (en) 1990-01-11 1998-05-12 Isis Pharmaceuticals, Inc. Synthesis of 3-deazapurines
US5792608A (en) 1991-12-12 1998-08-11 Gilead Sciences, Inc. Nuclease stable and binding competent oligomers and methods for their use
US5792747A (en) 1995-01-24 1998-08-11 The Administrators Of The Tulane Educational Fund Highly potent agonists of growth hormone releasing hormone
WO1998039352A1 (en) 1997-03-07 1998-09-11 Takeshi Imanishi Novel bicyclonucleoside and oligonucleotide analogues
US5830653A (en) 1991-11-26 1998-11-03 Gilead Sciences, Inc. Methods of using oligomers containing modified pyrimidines
WO1999014226A2 (en) 1997-09-12 1999-03-25 Exiqon A/S Bi- and tri-cyclic nucleoside, nucleotide and oligonucleotide analogues
EP1072679A2 (en) 1999-07-20 2001-01-31 Agilent Technologies Inc. Method of producing nucleic acid molecules with reduced secondary structure
US6344326B1 (en) 1996-07-30 2002-02-05 Aclara Bio Sciences, Inc. Microfluidic method for nucleic acid purification and processing
US6517234B1 (en) 1997-10-09 2003-02-11 Caliper Technologies Corp. Microfluidic systems incorporating varied channel dimensions
US6551841B1 (en) 1992-05-01 2003-04-22 The Trustees Of The University Of Pennsylvania Device and method for the detection of an analyte utilizing mesoscale flow systems
US6620625B2 (en) 2000-01-06 2003-09-16 Caliper Technologies Corp. Ultra high throughput sampling and analysis systems and methods
US6630353B1 (en) 1996-06-28 2003-10-07 Caliper Technologies Corp. High throughput screening assay systems in microscale fluidic devices
US6632655B1 (en) 1999-02-23 2003-10-14 Caliper Technologies Corp. Manipulation of microparticles in microfluidic systems
US6664047B1 (en) 1999-04-30 2003-12-16 Molecular Probes, Inc. Aza-benzazolium containing cyanine dyes
US6664104B2 (en) 1999-06-25 2003-12-16 Cepheid Device incorporating a microfluidic chip for separating analyte from a sample
US6692700B2 (en) 2001-02-14 2004-02-17 Handylab, Inc. Heat-reduction methods and systems related to microfluidic devices
US20040219565A1 (en) 2002-10-21 2004-11-04 Sakari Kauppinen Oligonucleotides useful for detecting and analyzing nucleic acids of interest
US6919046B2 (en) 2001-06-07 2005-07-19 Nanostream, Inc. Microfluidic analytical devices and methods
US7452726B2 (en) 2002-04-01 2008-11-18 Fluidigm Corporation Microfluidic particle-analysis systems
WO2009114709A2 (en) 2008-03-12 2009-09-17 Uva Patent Foundation Detection of polymeric analytes

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7682837B2 (en) * 2000-05-05 2010-03-23 Board Of Trustees Of Leland Stanford Junior University Devices and methods to form a randomly ordered array of magnetic beads and uses thereof
EP1512009A2 (en) * 2002-05-08 2005-03-09 Yissum Research Development Company Of The Hebrew University Of Jerusalem Magneto-controlled method and system for determining an analyte in a liquid medium
US20130084565A1 (en) * 2009-11-03 2013-04-04 University Of Virginia Patent Foundation Versatile, visible method for detecting polymeric analytes

Patent Citations (125)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3687808A (en) 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US4469863A (en) 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US5023243A (en) 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
US4476301A (en) 1982-04-29 1984-10-09 Centre National De La Recherche Scientifique Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon
US5118800A (en) 1983-12-20 1992-06-02 California Institute Of Technology Oligonucleotides possessing a primary amino group in the terminal nucleotide
US5550111A (en) 1984-07-11 1996-08-27 Temple University-Of The Commonwealth System Of Higher Education Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof
US4981957A (en) 1984-07-19 1991-01-01 Centre National De La Recherche Scientifique Oligonucleotides with modified phosphate and modified carbohydrate moieties at the respective chain termini
US5367066A (en) 1984-10-16 1994-11-22 Chiron Corporation Oligonucleotides with selectably cleavable and/or abasic sites
US4845205A (en) 1985-01-08 1989-07-04 Institut Pasteur 2,N6 -disubstituted and 2,N6 -trisubstituted adenosine-3'-phosphoramidites
US5185444A (en) 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
US5235033A (en) 1985-03-15 1993-08-10 Anti-Gene Development Group Alpha-morpholino ribonucleoside derivatives and polymers thereof
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5286717A (en) 1987-03-25 1994-02-15 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5264423A (en) 1987-03-25 1993-11-23 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5276019A (en) 1987-03-25 1994-01-04 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5552540A (en) 1987-06-24 1996-09-03 Howard Florey Institute Of Experimental Physiology And Medicine Nucleoside derivatives
US5405939A (en) 1987-10-22 1995-04-11 Temple University Of The Commonwealth System Of Higher Education 2',5'-phosphorothioate oligoadenylates and their covalent conjugates with polylysine
US5188897A (en) 1987-10-22 1993-02-23 Temple University Of The Commonwealth System Of Higher Education Encapsulated 2',5'-phosphorothioate oligoadenylates
US5519126A (en) 1988-03-25 1996-05-21 University Of Virginia Alumni Patents Foundation Oligonucleotide N-alkylphosphoramidates
US5453496A (en) 1988-05-26 1995-09-26 University Patents, Inc. Polynucleotide phosphorodithioate
US5278302A (en) 1988-05-26 1994-01-11 University Patents, Inc. Polynucleotide phosphorodithioates
US5216141A (en) 1988-06-06 1993-06-01 Benner Steven A Oligonucleotide analogs containing sulfur linkages
US5175273A (en) 1988-07-01 1992-12-29 Genentech, Inc. Nucleic acid intercalating agents
US5194599A (en) 1988-09-23 1993-03-16 Gilead Sciences, Inc. Hydrogen phosphonodithioate compositions
US5565555A (en) 1988-09-23 1996-10-15 Gilead Sciences, Inc. Nucleoside hydrogen phosphonodithioate diesters and activated phosphonodithioate analogues
US5134066A (en) 1989-08-29 1992-07-28 Monsanto Company Improved probes using nucleosides containing 3-dezauracil analogs
US5591722A (en) 1989-09-15 1997-01-07 Southern Research Institute 2'-deoxy-4'-thioribonucleosides and their antiviral activity
US5721218A (en) 1989-10-23 1998-02-24 Gilead Sciences, Inc. Oligonucleotides with inverted polarity
US5527899A (en) 1989-10-23 1996-06-18 Gilead Sciences, Inc. Oligonucleotides with inverted polarity
US5399676A (en) 1989-10-23 1995-03-21 Gilead Sciences Oligonucleotides with inverted polarity
US5264564A (en) 1989-10-24 1993-11-23 Gilead Sciences Oligonucleotide analogs with novel linkages
US5264562A (en) 1989-10-24 1993-11-23 Gilead Sciences, Inc. Oligonucleotide analogs with novel linkages
US5466786A (en) 1989-10-24 1995-11-14 Gilead Sciences 2'modified nucleoside and nucleotide compounds
US5466786B1 (en) 1989-10-24 1998-04-07 Gilead Sciences 2' Modified nucleoside and nucleotide compounds
US5455233A (en) 1989-11-30 1995-10-03 University Of North Carolina Oligoribonucleoside and oligodeoxyribonucleoside boranophosphates
US5405938A (en) 1989-12-20 1995-04-11 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5166315A (en) 1989-12-20 1992-11-24 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5130302A (en) 1989-12-20 1992-07-14 Boron Bilogicals, Inc. Boronated nucleoside, nucleotide and oligonucleotide compounds, compositions and methods for using same
US5681941A (en) 1990-01-11 1997-10-28 Isis Pharmaceuticals, Inc. Substituted purines and oligonucleotide cross-linking
US5587469A (en) 1990-01-11 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides containing N-2 substituted purines
US5670633A (en) 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
US5750692A (en) 1990-01-11 1998-05-12 Isis Pharmaceuticals, Inc. Synthesis of 3-deazapurines
US5459255A (en) 1990-01-11 1995-10-17 Isis Pharmaceuticals, Inc. N-2 substituted purines
US5646265A (en) 1990-01-11 1997-07-08 Isis Pharmceuticals, Inc. Process for the preparation of 2'-O-alkyl purine phosphoramidites
US5563253A (en) 1990-03-08 1996-10-08 Worcester Foundation For Biomedical Research Linear aminoalkylphosphoramidate oligonucleotide derivatives
US5321131A (en) 1990-03-08 1994-06-14 Hybridon, Inc. Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling
US5541306A (en) 1990-03-08 1996-07-30 Worcester Foundation For Biomedical Research Aminoalkylphosphotriester oligonucleotide derivatives
US5536821A (en) 1990-03-08 1996-07-16 Worcester Foundation For Biomedical Research Aminoalkylphosphorothioamidate oligonucleotide deratives
US5470967A (en) 1990-04-10 1995-11-28 The Dupont Merck Pharmaceutical Company Oligonucleotide analogs with sulfamate linkages
US5151510A (en) 1990-04-20 1992-09-29 Applied Biosystems, Inc. Method of synethesizing sulfurized oligonucleotide analogs
US5567811A (en) 1990-05-03 1996-10-22 Amersham International Plc Phosphoramidite derivatives, their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides
US5514785A (en) 1990-05-11 1996-05-07 Becton Dickinson And Company Solid supports for nucleic acid hybridization assays
US5541307A (en) 1990-07-27 1996-07-30 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs and solid phase synthesis thereof
US5610289A (en) 1990-07-27 1997-03-11 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogues
US5608046A (en) 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
US5489677A (en) 1990-07-27 1996-02-06 Isis Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
US5623070A (en) 1990-07-27 1997-04-22 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5602240A (en) 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
US5677437A (en) 1990-07-27 1997-10-14 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5614617A (en) 1990-07-27 1997-03-25 Isis Pharmaceuticals, Inc. Nuclease resistant, pyrimidine modified oligonucleotides that detect and modulate gene expression
US5618704A (en) 1990-07-27 1997-04-08 Isis Pharmacueticals, Inc. Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling
US5677439A (en) 1990-08-03 1997-10-14 Sanofi Oligonucleotide analogues containing phosphate diester linkage substitutes, compositions thereof, and precursor dinucleotide analogues
US5177196A (en) 1990-08-16 1993-01-05 Microprobe Corporation Oligo (α-arabinofuranosyl nucleotides) and α-arabinofuranosyl precursors thereof
US5214134A (en) 1990-09-12 1993-05-25 Sterling Winthrop Inc. Process of linking nucleosides with a siloxane bridge
US5561225A (en) 1990-09-19 1996-10-01 Southern Research Institute Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages
US5596086A (en) 1990-09-20 1997-01-21 Gilead Sciences, Inc. Modified internucleoside linkages having one nitrogen and two carbon atoms
US5432272A (en) 1990-10-09 1995-07-11 Benner; Steven A. Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases
US5672697A (en) 1991-02-08 1997-09-30 Gilead Sciences, Inc. Nucleoside 5'-methylene phosphonates
US5714331A (en) 1991-05-24 1998-02-03 Buchardt, Deceased; Ole Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility
US5571799A (en) 1991-08-12 1996-11-05 Basco, Ltd. (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response
US5582977A (en) 1991-09-16 1996-12-10 Molecular Probes, Inc. Dimers of unsymmetrical cyanine dyes
US5587361A (en) 1991-10-15 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US5319080A (en) 1991-10-17 1994-06-07 Ciba-Geigy Corporation Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates
US5393878A (en) 1991-10-17 1995-02-28 Ciba-Geigy Corporation Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates
US5594121A (en) 1991-11-07 1997-01-14 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified purines
US5645985A (en) 1991-11-26 1997-07-08 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines
US5484908A (en) 1991-11-26 1996-01-16 Gilead Sciences, Inc. Oligonucleotides containing 5-propynyl pyrimidines
US5830653A (en) 1991-11-26 1998-11-03 Gilead Sciences, Inc. Methods of using oligomers containing modified pyrimidines
US5792608A (en) 1991-12-12 1998-08-11 Gilead Sciences, Inc. Nuclease stable and binding competent oligomers and methods for their use
US5359044A (en) 1991-12-13 1994-10-25 Isis Pharmaceuticals Cyclobutyl oligonucleotide surrogates
US5639873A (en) 1992-02-05 1997-06-17 Centre National De La Recherche Scientifique (Cnrs) Oligothionucleotides
US5321130A (en) 1992-02-10 1994-06-14 Molecular Probes, Inc. Unsymmetrical cyanine dyes with a cationic side chain
US5633360A (en) 1992-04-14 1997-05-27 Gilead Sciences, Inc. Oligonucleotide analogs capable of passive cell membrane permeation
US6551841B1 (en) 1992-05-01 2003-04-22 The Trustees Of The University Of Pennsylvania Device and method for the detection of an analyte utilizing mesoscale flow systems
US5434257A (en) 1992-06-01 1995-07-18 Gilead Sciences, Inc. Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages
US5610300A (en) 1992-07-01 1997-03-11 Ciba-Geigy Corporation Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates
US5700920A (en) 1992-07-01 1997-12-23 Novartis Corporation Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates
US5472881A (en) 1992-11-12 1995-12-05 University Of Utah Research Foundation Thiol labeling of DNA for attachment to gold surfaces
US5476925A (en) 1993-02-01 1995-12-19 Northwestern University Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups
US5466677A (en) 1993-03-06 1995-11-14 Ciba-Geigy Corporation Dinucleoside phosphinates and their pharmaceutical compositions
US5576427A (en) 1993-03-30 1996-11-19 Sterling Winthrop, Inc. Acyclic nucleoside analogs and oligonucleotide sequences containing them
US5663312A (en) 1993-03-31 1997-09-02 Sanofi Oligonucleotide dimers with amide linkages replacing phosphodiester linkages
US5658873A (en) 1993-04-10 1997-08-19 Degussa Aktiengesellschaft Coated sodium percarbonate particles, a process for their production and detergent, cleaning and bleaching compositions containing them
US5539082A (en) 1993-04-26 1996-07-23 Nielsen; Peter E. Peptide nucleic acids
US5763588A (en) 1993-09-17 1998-06-09 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US6005096A (en) 1993-09-17 1999-12-21 Gilead Sciences, Inc. Pyrimidine derivatives
US5502177A (en) 1993-09-17 1996-03-26 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US5719262A (en) 1993-11-22 1998-02-17 Buchardt, Deceased; Ole Peptide nucleic acids having amino acid side chains
US5457187A (en) 1993-12-08 1995-10-10 Board Of Regents University Of Nebraska Oligonucleotides containing 5-fluorouracil
US5446137A (en) 1993-12-09 1995-08-29 Syntex (U.S.A.) Inc. Oligonucleotides containing 4'-substituted nucleotides
US5446137B1 (en) 1993-12-09 1998-10-06 Behringwerke Ag Oligonucleotides containing 4'-substituted nucleotides
US5519134A (en) 1994-01-11 1996-05-21 Isis Pharmaceuticals, Inc. Pyrrolidine-containing monomers and oligomers
US5596091A (en) 1994-03-18 1997-01-21 The Regents Of The University Of California Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides
US5627053A (en) 1994-03-29 1997-05-06 Ribozyme Pharmaceuticals, Inc. 2'deoxy-2'-alkylnucleotide containing nucleic acid
US5625050A (en) 1994-03-31 1997-04-29 Amgen Inc. Modified oligonucleotides and intermediates useful in nucleic acid therapeutics
US5646269A (en) 1994-04-28 1997-07-08 Gilead Sciences, Inc. Method for oligonucleotide analog synthesis
US5525711A (en) 1994-05-18 1996-06-11 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Pteridine nucleotide analogs as fluorescent DNA probes
US5597909A (en) 1994-08-25 1997-01-28 Chiron Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
US5792747A (en) 1995-01-24 1998-08-11 The Administrators Of The Tulane Educational Fund Highly potent agonists of growth hormone releasing hormone
WO1997012896A1 (en) 1995-10-04 1997-04-10 Epoch Pharmaceuticals, Inc. Selective binding complementary oligonucleotides
US6630353B1 (en) 1996-06-28 2003-10-07 Caliper Technologies Corp. High throughput screening assay systems in microscale fluidic devices
US6344326B1 (en) 1996-07-30 2002-02-05 Aclara Bio Sciences, Inc. Microfluidic method for nucleic acid purification and processing
WO1998039352A1 (en) 1997-03-07 1998-09-11 Takeshi Imanishi Novel bicyclonucleoside and oligonucleotide analogues
WO1999014226A2 (en) 1997-09-12 1999-03-25 Exiqon A/S Bi- and tri-cyclic nucleoside, nucleotide and oligonucleotide analogues
US6517234B1 (en) 1997-10-09 2003-02-11 Caliper Technologies Corp. Microfluidic systems incorporating varied channel dimensions
US6632655B1 (en) 1999-02-23 2003-10-14 Caliper Technologies Corp. Manipulation of microparticles in microfluidic systems
US6664047B1 (en) 1999-04-30 2003-12-16 Molecular Probes, Inc. Aza-benzazolium containing cyanine dyes
US6664104B2 (en) 1999-06-25 2003-12-16 Cepheid Device incorporating a microfluidic chip for separating analyte from a sample
EP1072679A2 (en) 1999-07-20 2001-01-31 Agilent Technologies Inc. Method of producing nucleic acid molecules with reduced secondary structure
US6620625B2 (en) 2000-01-06 2003-09-16 Caliper Technologies Corp. Ultra high throughput sampling and analysis systems and methods
US6692700B2 (en) 2001-02-14 2004-02-17 Handylab, Inc. Heat-reduction methods and systems related to microfluidic devices
US6919046B2 (en) 2001-06-07 2005-07-19 Nanostream, Inc. Microfluidic analytical devices and methods
US7452726B2 (en) 2002-04-01 2008-11-18 Fluidigm Corporation Microfluidic particle-analysis systems
US20040219565A1 (en) 2002-10-21 2004-11-04 Sakari Kauppinen Oligonucleotides useful for detecting and analyzing nucleic acids of interest
WO2009114709A2 (en) 2008-03-12 2009-09-17 Uva Patent Foundation Detection of polymeric analytes

Non-Patent Citations (69)

* Cited by examiner, † Cited by third party
Title
AHN ET AL., NUCL. ACIDS RES., vol. 24, 1996, pages 2623
ALLARA; NUZZO, LANDMUIR, vol. 1, 1985, pages 45
ALLARA; TOMPKINS, J. COLLOID INTERFACE SCI., vol. 49, 1974, pages 410 - 421
ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403
ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 410
ALTSCHUL ET AL.: "BLAST Manual", NCBI NLM NIH
ANDERSON ET AL.: "Nucleic Acid Hybridisation: A Practical Approach", IRL PRESS LIMITED, article "Ch. 4"
ARAUJO ET AL., ANAL. CHEM., vol. 84, 2012, pages 3311
ASIELLO ET AL., LAB ON A CHIP, vol. 29, 2011, pages 830
ATSCHUL ET AL., J. MOLEC. BIOI., vol. 215, 1990, pages 403
BURWELL, CHEMICAL TECHNOLOGY, vol. 4, 1974, pages 370 - 377
CROOKE, S. T. AND LEBLEU, B.,: "Antisense Research and Applications", 1993, CRC PRESS, article SANGHVI, Y. S.: "Chapter 15,", pages: 289 - 302
DEVEREUX ET AL., NUCLEIC ACIDS RESEARCH, vol. 12, 1984, pages 387
ELTEKOVA; ELTEKOV, LANGMUIR, vol. 3, 1987, pages 951
ENGLISCH ET AL., ANOEWANDTE CHEMIE. INTERNATIONAL EDITION, vol. 30, 1991, pages 613
F. ECKSTEIN: "Oligonucleotides and Analogues", 1991, OXFORD UNIVERSITY PRESS
GOVINDARAJAN ET AL., LAB ON A CHIP, vol. 12, 2012, pages 174
GRABAR ET AL., ANAL. CHEM., vol. 67, pages 735 - 743
HAQUE ET AL., BMC BIOTECH., vol. 3, 2003, pages 20
HEID ET AL., GENOME RES., vol. 6, 1996, pages 986
HICKMAN ET AL., J. AM. CHEM. SOC., vol. 111, 1989, pages 7271
HUBBARD, ACC. CHEM. RES., vol. 13, 1980, pages 177
ILER: "The Chemistry Of Silica", 1979, WILEY, article "Chapter 6,"
KATZ, J. AM. CHEM. SOC., vol. 74, 1951, pages 2238
KOSKIN ET AL., TETRAHEDRON, vol. 54, 1998, pages 3607
KOSTURKO ET AL., BIOCHEMISTRY, vol. 13, 1974, pages 3949
KROSCHWITZ, J. I.,: "The Concise Encyclopedia Of Polymer Science And Engineering", 1990, JOHN WILEY & SONS, pages: 858 - 859
LANKELMA ET AL., ANAL. CHEM., 2012
LAPLANCHE ET AL., NUCL. ACIDS RES., vol. 14, 1986, pages 9081
LEC ET AL., J. PHYS. CHEM., vol. 92, 1988, pages 2597
LEE ET AL., AB ON A CHIP, vol. 11, 2011, pages 120
LEE ET AL., LAB ON A CHIP, vol. 11, 2011, pages 120
LESLIE ET AL., J. AM. CHEM. SOC., vol. 134, 2012, pages 5689
MAOZ; SAGIV, LANDMUIR, vol. 3, 1987, pages 1045
MAOZ; SAGIV, LANGMUIR, vol. 3, 1987, pages 1034
MARTIN ET AL., HELV. CHIM. ACTA, vol. 78, 1995, pages 486 - 504
MARTINEZ ET AL., ANAL. CHEM., vol. 80, 2008, pages 3699
MATTEUCCI; CARUTHERS, J. AM. CHEM. SOC., vol. 103, 1981, pages 3185 - 3191
MENTELE ET AL., ANAL. CHEM., 2012
MESMAEKER, CURRENT OPINION IN STRUCTURAL BIOLOGY, vol. 5, 1995, pages 343 - 355
MUCIC ET AL., CHEM. COMM., 1996, pages 555 - 557
NIELSEN ET AL., SCIENCE, vol. 254, 1991, pages 1497 - 1500
NUZZO ET AL., J. AM. CHEM. SOC., vol. 109, 1987, pages 2358
RASBAND, W.S.: "ImageJ", vol. 41, 1997, U. S. NATIONAL INSTITUTES OF HEALTH
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual(2nd ed.", 1989
SAMBROOK; FRITSCH; MANIATIS: "Molecular Cloning: A Laboratory Manual(2nd ed.,", 1989, COLD SPRING HARBOR LABORATORY
SANCHEZ ET AL., J. CLIN. MICROBIOL., vol. 40, 2002, pages 2381
SINGER ET AL., ANAL. BIOCHEM., vol. 249, 1997, pages 228
SORIAGA; HUBBARD, J. AM. CHEM. SOC., vol. 104, 1982, pages 3937
STEC ET AL., J. AM. CHEM. SOC., vol. 106, 1984, pages 6077
STEIN ET AL., NUCL. ACIDS RES., vol. 16, 1988, pages 3209
SUGGS ET AL.: "Developmental Biology Using Purified Genes", 1981, pages: 683
SUSAN M. FREIER; KARL-HEINZ ALTMANN, NUCLEIC ACIDS RESEARCH, vol. 25, 1997, pages 4429 - 4443
THOMAS, J. AM. CHEM. SOC., vol. 76, 1954, pages 6032
TIMMONS; ZISMAN, J. PHYS. CHEM., vol. 69, 1965, pages 984 - 990
UHLMANN; PEYMAN, CHEMICAL REVIEWS, vol. 90, 1990, pages 543
VITZTHUM ET AL., ANAL. BIOCHEM., vol. 276, 1999, pages 59
WASSERMAN ET AL., LANGMUIR, vol. 5, 1989, pages 1074
WHITESIDES: "Proceedings of the Robert A. Welch Foundation 39th Conference On Chemical Research Nanophase Chemistry", 1995, pages: 109 - 121
YAMANE ET AL., J. AM. CHEM. SOC., vol. 83, 1961, pages 2599
ZACK ET AL., J. HISTOCHEM. CYTOCHEM., vol. 25, 1977, pages 741
ZHANG ET AL., ANAL. CHIM ACTA, vol. 638, 2009, pages 115
ZHANG ET AL., J. AM. CHEM. SOC., vol. 127, 2005, pages 74 - 75
ZHANG; MADDEN, GENOME RES., vol. 7, 1997, pages 649 - 656
ZHAO ET AL., ANAL. CHEM., vol. 80, 2008, pages 6431
ZHAO ET AL., ANAL. CHEM., vol. 80, 2008, pages 8431
ZIMMERMANN ET AL., J. AM. CHEM. SOC., vol. 124, 2002, pages 13684 - 13685
ZON ET AL., ANTI-CANCER DRUG DESIGN., vol. 6, 1991, pages 539
ZON ET AL.: "OLIGONUCLEOTIDES AND ANALOGUES: A PRACTICAL APPROACH", 1991, OXFORD UNIVERSITY PRESS, pages: 87 - 108

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10656146B2 (en) 2008-03-12 2020-05-19 University Of Virginia Patent Foundation Detection of polymeric analytes
WO2014113598A3 (en) * 2013-01-16 2015-01-29 The Regents Of The University Of California Microfluidic devices to extract, concentrate and isolate molecules
US9994839B2 (en) 2013-01-16 2018-06-12 The Regents Of The University Of California Microfluidic devices to extract, concentrate and isolate molecules
CN107328931A (en) * 2017-05-16 2017-11-07 中山大学 A kind of quick continuous detection technique based on nano-probe and magnetic micro-nano granules
US11207677B2 (en) 2018-03-07 2021-12-28 University Of Virginia Patent Foundation Devices, systems, and methods for detecting substances
US12551885B2 (en) 2020-10-28 2026-02-17 University Of Virgina Patent Foundation Storage of corrosive materials on a fiber-based fluidic device and related methods thereof

Also Published As

Publication number Publication date
WO2012151289A3 (en) 2013-03-07

Similar Documents

Publication Publication Date Title
US20130084565A1 (en) Versatile, visible method for detecting polymeric analytes
Tang et al. Application of magnetic nanoparticles in nucleic acid detection
Varona et al. Visual detection of single-nucleotide polymorphisms using molecular beacon loop-mediated isothermal amplification with centrifuge-free DNA extraction
US20130203045A1 (en) Method for detecting nucleic acids based on aggregate formation
Bian et al. A microfluidic droplet digital PCR for simultaneous detection of pathogenic Escherichia coli O157 and Listeria monocytogenes
Dou et al. A versatile PDMS/paper hybrid microfluidic platform for sensitive infectious disease diagnosis
Adams et al. Comparison of three magnetic bead surface functionalities for RNA extraction and detection
Song et al. Label-free and non-enzymatic detection of DNA based on hybridization chain reaction amplification and dsDNA-templated copper nanoparticles
US10968474B2 (en) Devices for detecting target biological molecules from cells and viruses
Saleh et al. Rapid detection of Cyprinid herpesvirus-3 (CyHV-3) using a gold nanoparticle-based hybridization assay
JP4268944B2 (en) Nucleic acid detection or quantification method
Lin et al. Colorimetric determination of DNA methylation based on the strength of the hydrophobic interactions between DNA and gold nanoparticles
CN113302312A (en) Multiplexing of highly evolved virus variants using the SHERLock detection method
KR20220156007A (en) Nucleic acid fluorescence detection
Wang et al. Amine-functionalized quantum dots as a universal fluorescent nanoprobe for a one-step loop-mediated isothermal amplification assay with single-copy sensitivity
Zhu et al. Enhancing point-of-care diagnosis of African swine fever virus (ASFV) DNA with the CRISPR-Cas12a-assisted triplex amplified assay
EP3074533B1 (en) Method and device for accelerated surface-based reactions
US20120149587A1 (en) Method for detecting nucleated cells
Fang et al. Nucleic acid plate culture: Label-free and naked-eye-based digital loop-mediated isothermal amplification in hydrogel with machine learning
WO2012151268A1 (en) Method and system for high throughput optical and label free detection of analytes
Lee et al. Rapid Visible Detection of African Swine Fever Virus Using Hybridization Chain Reaction‐Sensitized Magnetic Nanoclusters and Affinity Chromatography
Eitzmann et al. Versatile dual-channel loop-mediated isothermal amplification assay featuring smartphone imaging enables determination of fecal indicator bacteria in environmental waters
CN108026591B (en) Diagnostic methods and compositions
WO2015170190A2 (en) Devices and kits for measuring biological results
CA2692882C (en) Ultrasensitive detection of target using target-ready particles

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12725906

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12725906

Country of ref document: EP

Kind code of ref document: A2