WO2012142238A2 - Compositions and methods for the treatment of tissue fibrosis - Google Patents

Compositions and methods for the treatment of tissue fibrosis Download PDF

Info

Publication number
WO2012142238A2
WO2012142238A2 PCT/US2012/033246 US2012033246W WO2012142238A2 WO 2012142238 A2 WO2012142238 A2 WO 2012142238A2 US 2012033246 W US2012033246 W US 2012033246W WO 2012142238 A2 WO2012142238 A2 WO 2012142238A2
Authority
WO
WIPO (PCT)
Prior art keywords
has2
expression
fibroblasts
ref
asma
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2012/033246
Other languages
French (fr)
Other versions
WO2012142238A3 (en
Inventor
Paul W. NOBLE
Dianhua JIANG
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Duke University
Original Assignee
Duke University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Duke University filed Critical Duke University
Priority to US14/111,338 priority Critical patent/US10232039B2/en
Publication of WO2012142238A2 publication Critical patent/WO2012142238A2/en
Publication of WO2012142238A3 publication Critical patent/WO2012142238A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/3955Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/34Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
    • C12Q1/37Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving peptidase or proteinase
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/81Protease inhibitors
    • G01N2333/8107Endopeptidase (E.C. 3.4.21-99) inhibitors
    • G01N2333/8146Metalloprotease (E.C. 3.4.24) inhibitors, e.g. tissue inhibitor of metallo proteinase, TIMP

Definitions

  • Tissue fibrosis is the formation of excess fibrous connective tissue in an organ or tissue in a reparative or reactive process, which is different from the formation of fibrous tissue as a normal constituent of an organ or tissue.
  • Scarring is confluent fibrosis that obliterates the architecture of the underlying organ or tissue.
  • Pulmonary fibrosis is the formation or development of excess fibrous connective tissue in the lungs.
  • Idiopathic pulmonary fibrosis (IPF) is a terminal illness characterized by progressive and unremitting matrix deposition in the interstitium of the lung. The clinical course of IPF is unrelenting and has characteristics reminiscent of cancer.
  • IPF patients suffer from the inexorable accumulation of extracellular matrix in the gas-exchanging regions of the lung.
  • One feature of IPF is the formation of fibroblastic foci, which are structures of accumulated myofibroblasts in the interstitium of the lung juxtaposed to the alveolar epithelium and are associated with destruction of the adjoining alveolar basement membrane.
  • Hyaluronan is a non-sulfated glycosaminoglycan produced by mesenchymal cells as well as a variety of tumor cells.
  • CD44 is a cell surface receptor for HA and plays a role in inflammatory cell recruitment and activation, as well as tumor growth and metastasis.
  • the disclosure relates to methods of treating pulmonary fibrosis comprising administering to a subject in need of treatment an effective amount of an agent that inhibits a hyaluron synthase (HAS) or CD44.
  • HAS hyaluron synthase
  • the disclosure relates to methods of inhibiting myofibroblast invasion comprising administering to a subject in need of treatment an effective amount of an agent that inhibits a hyaluron synthase (HAS) or CD44.
  • HAS hyaluron synthase
  • the disclosure relates to methods of reducing matrix deposition in the lung comprising administering to a subject in need of treatment an effective amount of an agent that inhibits a hyaluron synthase (HAS) or CD44.
  • HAS hyaluron synthase
  • the disclosure relates to methods of determining the progression of pulmonary fibrosis comprising determining the level of matrix metalloproteinase expression in a cell, and comparing the level of expression to that of a control cell, wherein an increased level of expression relative to the control cell indicates progression of the disease.
  • the disclosure relates to methods of determining the progression of pulmonary fibrosis comprising determining the level of metalloproteinase tissue inhibitor expression in a cell, and comparing the level of expression to that of a control cell, wherein a decreased level of expression relative to the control cell indicates progression of the disease.
  • FIG. 1 shows ASMA-HAS2 transgenic mice accumulate HA and show increased mortality following bleomycin challenging.
  • A Distribution of HA in lungs of ASMA-HAS2 + and Iittermate control mice (ASMA-HAS2 " ) as determined by immunohistochemical staining HA with biotin-HABP. Representative sections from 5 bleomycin-treated samples and 3 controls are shown. Scale bars, 50 ⁇ .
  • FIG. 2 shows that ASMA-HAS2 + mice exhibit an increase in neutrophil recruitment after lung injury.
  • C H&E staining of lung sections from ASMA-HAS2 + mice and their Iittermate controls at day 7 after bleomycin treatment. Pictures shown are representatives of 5 samples. Scale bars, 200 ⁇ .
  • Figure 3 shows increased HA fragment accumulation in ASMA-HAS2 + mouse lungs after bleomycin treatment.
  • A Representative images showing HA size from ASMA-HAS2 + and Iittermate controls 7 days after bleomycin treatment. HA peaks are annotated with arrows
  • B Quantification analysis of HA molecular weight distribution in lung tissues of ASMA-HAS2 + and Iittermate controls at day 0 and day 7 after 1 .75 U/kg and 2.5 U/kg bleomycin treatment.
  • FIG. 4 shows ASMA-HAS2 transgenic mice exhibit increased collagen content in lungs after bleomycin treatment.
  • Figure 5 shows targeted deletion of HAS2 in mesenchymal cells inhibits lung fibrosis and myofibroblast accumulation.
  • A Comparison of HA distribution in lung tissues of bleomycin- treated Has2 CKO/CKO and control (Has2 flox/+ ) mice by immunohistochemistry. Scale bars, 50 urn
  • B Lung sections of Has2 CKO CKO and Has? 10 * * on day 14 after bleomycin instillation were stained using Masson's Trichrome method and counterstained with hematoxylin. The experiments were repeated four times. Scale bars, 200 ⁇ .
  • FIG. 6 shows that fibroblast invasive capacity is dependent upon HAS2.
  • A The spontaneous matrigel-invading capacity of fibroblasts from bleomycin-treated (10 days) and saline- treated ASMA-HAS2 + and littermate control mice lungs was determined. Data are shown as the index of invasion value of the fibroblasts with or without bleomycin treatment over littermate control fibroblasts without bleomycin challenge. The experiments were repeated two MBF Ref. No. 028193-9120-WO00
  • (D) Relative thickness of HA coat was calculated in 20 randomly selected cells using the NIH Image J program (n 10; *** p ⁇ 0.001 by Wilcoxon rank sum test). Data represent one of two independent experiments.
  • (E) HA content in cultured media of Has2 flox/+ and Has2 CKO CKO fibroblasts was measured using the HA-ELISA assay (n 3; p values were indicated). The experiments were performed three times.
  • Figure 7 shows CD44 regulates lung fibrosis and fibroblast invasive capacity.
  • A Western blotting analysis of CD44 expression using KM 1 14 anti-CD44 antibodies in wild type lung tissues at indicated times after bleomycin treatment. Samples loaded at each time point was the mixture of equal amount of three samples collected per time point, ⁇ -actin was used as a loading control. CD44 standard form (82.0 kD) is indicated. The experiments were performed three times.
  • FIG. 8 shows HAS2 and CD44 are associated with human lung fibroblast invasion.
  • B Representative images of invasive IPF fibroblasts and normal fibroblasts.
  • D HAS2 knock down in human lung fibroblasts decreased cell surface HA and inhibited fibroblast invasive capacity.
  • E Suppression of HAS2 impaired IPF fibroblast invasion.
  • F Neutralizing anti-CD44 antibodies reduced IPF fibroblast invasive capacity.
  • FIG. 9 shows HAS2 siRNA reduces HAS2 gene expression and HA production in primary human lung fibroblasts.
  • A HAS2 gene expression levels in primary human lung MBF Ref. No. 028193-9120-WO00
  • FIG. 10 shows HAS2 promotes fibroblast invasion by regulating CD44 and MMP expression and function.
  • A-B qRT-PCR array of RNA extracted from invasive ASMA-HAS2 + fibroblasts.
  • D HAS2 knock down decreased CD44 mRNA expression.
  • E Suppression of HAS2 decreased MMP9 mRNA expression.
  • F Pro-MMP9 release was increased in the ASMA-HAS2 + fibroblast media.
  • G Gelatin zymographaphy of protein for MMP9 activity from concentrated fibroblast media (F). Representative image is shown.
  • Figure 11 shows that suppression of HAS2 decreased CD44 protein level.
  • Figure 12 is a non-limiting schematic illustration of an invasive fibroblast phenotype and severe lung fibrosis.
  • Myofibroblasts accumulate at sites of tissue remodeling and produce extracellular matrix components such as collagen and hyaluronan that can compromise organ function.
  • the inventors have identified several targets for the therapeutic intervention of disorders and diseases that are associated with tissue fibrosis, invasive fibroblast phenotypes, and other similar disorders.
  • targeted overexpression of a hyaluronan synthase (HAS) in myofibroblasts produced an aggressive phenotype leading to severe lung fibrosis and death following injury.
  • HAS hyaluronan synthase
  • conditional deletion of a HAS in mesenchymal cells abrogates an invasive fibroblast phenotype, impeded myofibroblast accumulation, and inhibited the development of lung fibrosis. Further, the disclosure describes that both the invasive phenotype MBF Ref. No. 028193-9120-WO00
  • the disclosure provides a method of treating tissue fibrosis comprising administering to a subject in need of treatment an effective amount of an agent that inhibits a hyaluron synthase (HAS) or CD44, or both a HAS and CD44.
  • HAS hyaluron synthase
  • Embodiments of the method provide for the inhibition of HAS, wherein HAS may include at least one of HAS1 , HAS2, and HAS3, or a combination thereof.
  • the HAS and/or CD44 may be mammalian such as, for example, a rodent (e.g. a guinea pig, a hamster, a rat, a mouse), canine (e.g. a dog), feline (e.g.
  • HAS is human and can comprise, for example, a HAS2 polypeptide of SEQ ID NO: 16, or a polynucleotide encoding the polypeptide such as, for example, a HAS2 polynucleotide of SEQ ID NO: 17, described by GenBank Accession Nos: AAC50692 and CCDS6335.1 .
  • the agent may inhibit HAS2.
  • Embodiments of the method also provide for the inhibition of CD44, wherein the CD44 is a mammalian CD44.
  • CD44 is human and may comprise, for example, a CD44 polypeptide of SEQ ID NO: 18, or a polynucleotide encoding the polypeptide such as, for example, a CD44 polynucleotide of SEQ ID NO: 19 described by GenBank Accession Nos: NM_000610 and CCDS7897.1 .
  • tissue fibrosis relates to the formation of excess fibrous connective tissue in an organ or tissue in a reparative or reactive process.
  • tissue fibrosis can be associated disorders and diseases of organs and tissues such as, for example, pulmonary fibrosis, (e.g., idiopathic pulmonary fibrosis); cirrhosis (liver); endomyocardial fibrosis (heart); mediastinal fibrosis (soft tissue of the mediastinum); myelofibrosis (bone marrow); retroperitoneal fibrosis (soft tissue of the retroperitoneum); progressive massive fibrosis (lungs); nephrogenic systemic fibrosis (skin); Crohn's Disease (intestine); keloid (skin); myocardial infarction (heart); scleroderma/systemic sclerosis (skin, lungs); arthrofibrosis (knee, shoulder, other joints); some forms of adhesive capsulitis (shoulder
  • the disclosure provides methods of inhibiting myofibroblast invasion.
  • the methods may comprise administering to a subject in need of treatment an effective amount of an agent that inhibits a HAS or CD44, or combination thereof.
  • myofibroblast invasion includes involvement, association, or promotion of neoplastic growth such as, for example, various tumors and/or cancers.
  • the disclosure provides methods of reducing matrix deposition in tissue.
  • the methods may comprise administering to a subject in need of treatment an effective amount of an agent that inhibits a HAS or CD44, or a combination thereof.
  • tissue may include lung, heart, liver, skin, bone marrow, intestine, or other tissue in the body.
  • an active agent suitably inhibits as least one of HAS or CD44, or both HAS and CD44.
  • Embodiments provide for an active agent that can inhibit biological function of a HAS enzyme or a CD44 receptor protein.
  • Other embodiments provide for an active agent that may inhibit the expression of mRNA encoding HAS and/or CD44.
  • Some embodiments provide an active agent that may inhibit the translation of mRNA encoding HAS and/or CD44 to protein.
  • an active agent may indirectly or directly bind and inhibit the activity of HAS or CD44 (e.g., binding activity or enzymatic activity), reduce the expression of HAS or CD44, prevent expression of HAS or CD44, or inhibit the production of HAS or CD44 in a cell.
  • HAS or CD44 e.g., binding activity or enzymatic activity
  • an active agent can increase the amount of, or the biological activity of a protein that can reduce the activity of HAS or CD44.
  • Agents capable of increasing the level of a protein may include any agent capable of increasing protein or mRNA levels or increasing the expression of the protein.
  • the agent may comprise the protein itself.
  • the agent may include exogenously expressed and isolated protein capable of being delivered to the cells.
  • the protein may be delivered to cells by a variety of methods, including fusion to Tat or VP16 or via a delivery vehicle, such as a liposome, all of which allow delivery of protein based agents across the cellular membrane. Those of skill in the art will appreciate that other delivery mechanisms for proteins may be used.
  • mRNA expression may be enhanced relative to control cells by contact with the agent.
  • the agent capable of increasing the level of natively expressed protein may include a gene expression activator or de-repressor.
  • the agent capable of increasing the level of protein may also include agents that bind to directly or indirectly and increase the effective level of protein, for example, by enhancing the binding or other activity of the protein.
  • the amount or level of expression of a biomolecule (e.g., mRNA or protein) in a cell may be evaluated by any variety of techniques that are known in the art.
  • inhibit or inhibiting such as, for example, the level of protein expression (e.g., HAS or CD44)
  • the level of protein expression may be evaluated at either the protein or mRNA level using techniques including, but not limited to, Western blot, ELISA, Northern blot, real time PCR, immunofluorescence, or FACS analysis.
  • the expression level of a protein may be evaluated by immunofluorescence by visualizing cells stained with a fluorescently-labeled protein-specific antibody, Western blot analysis of protein expression, and RT-PCR of protein transcripts.
  • Inhibit or inhibiting relates to any measurable reduction or attenuation of amounts or activity, e.g., amounts or activity of HAS or CD44 or myofibroblast invasion.
  • the expression level of HAS or CD44 may be compared to a control.
  • a control may include comparison to the level of expression in a control cell, such as a non-cancerous cell, a non-fibrotic cell, or other normal cell.
  • a control may include an average range of the level of expression from a population of normal cells.
  • a standard value developed by analyzing the results of a population of cells with known responses to therapies or agents may be used. Those skilled in the art will appreciate that a variety of controls may be used.
  • an agent may comprise a variety of compounds and compositions and agents.
  • the agent may comprise a biological molecule, including nucleic acid molecules, such as a polynucleotide having RNAi activity against HASs or a substrate thereof.
  • the nucleic acid molecules can include decoy RNAs, dsRNAs, miRNAs, siRNAs, nucleic acid aptamers, antisense nucleic acid molecules, and enzymatic nucleic acid molecules that comprise a sequence that is sufficient allow for binding to an encoding nucleic acid sequence and inhibit activity thereof (i.e., are complementary to such encoding nucleic acid sequences).
  • an RNAi molecule comprises sequence that is complementary to at least a portion of a target sequence such that the RNAi can hybridize to the target sequence under physiological or artificially defined (e.g., reaction) conditions.
  • an RNAi molecule comprises sequence that is complementary such that the molecule can hybridize to a target sequence under moderate or high stringency conditions, which are well known and can be determined by one of skill in the art.
  • an RNAi molecule has complete (100%) complementarity over its entire length to a target sequence.
  • a variety of RNAi molecules are known in the art, and can include chemical modifications, such as modifications to the sugar-phosphate backbone or nucleobase that are known in the art. The modifications may be selected by one of skill in the art to alter activity, binding, immune response, or other MBF Ref. No. 028193-9120-WO00
  • the RNAi can comprise an siRNA having a length from about 18 to about 24 nucleotides.
  • the inhibitory nucleic acid molecule can bind to a target nucleic acid sequence under stringent binding conditions.
  • stringent conditions or “stringent hybridization conditions” includes reference to conditions under which a polynucleotide will hybridize to its target sequence, to a detectably greater degree than other sequences (e.g., at least 2-fold over background).
  • An example of stringent conditions include those in which hybridization in 50% formamide, 1 M NaCI, 1 % SDS at 37°C, and a wash in 0.1x SSC at 60 to 65°C is performed.
  • Amino acid and polynucleotide identity, homology and/or similarity can be determined using the ClustalW algorithm, MEGALIGNTM, Lasergene, Wis.
  • an inhibitory nucleic acid molecule Given a target polynucleotide sequence, for example of HAS or CD44 or biological substrate thereof, an inhibitory nucleic acid molecule can be designed using motifs and targeted to a region that is anticipated to be effective for inhibitory activity, such as is known in the art.
  • the agent may comprise siRNA targeted to a particular region of SEQ ID NO: 17, such as, for example, a siRNA targeting SEQ ID NO:15 (CAGCTCGATCTAAGTGCCTTA), which corresponds to nucleotides 1530-1550 of the HAS2 cDNA.
  • siRNA or inhibitory RNA molecules e.g., RNA, mixed DNA RNA, DNA, chemically modified DNA and/or RNA, etc.
  • the inhibitor comprises an antibody that can specifically bind to a protein such as HAS or CD44 or a fragment thereof.
  • Embodiments also provide for an antibody that inhibits HAS or CD44 through specific binding to a HAS and/or CD44 substrate molecule.
  • the antibodies can be produced by any method known in the art, such as by immunization with a full-length protein such as HAS or CD44, or fragments thereof.
  • the antibodies can be polyclonal or monoclonal, and/or may be recombinant antibodies.
  • antibodies that are human antibodies can be prepared, for example, by immunization of transgenic animals capable of producing a human antibody (see, for example, International Patent Application, Publication WO 93/12227).
  • Monoclonal antibodies can be produced by a variety of techniques, including conventional monoclonal antibody methodology, e.g., the standard somatic cell hybridization technique of Kohler and Milstein (see, for example, Nature 1975, 256, 495), and other techniques, e.g., viral or oncogenic transformation of B-lymphocytes.
  • Animal systems for preparing hybridomas include mouse. MBF Ref. No. 028193-9120-WO00
  • Hybridoma production in the mouse is very well established, and immunization protocols and techniques for isolation of immunized splenocytes for fusion are well known in the art. Fusion partners (e.g., murine myeloma cells) and fusion procedures are also known.
  • an antibody can be a commercially available or otherwise publicly accessible antibody to either HAS or CD44 such as, for example, an antibody comprising anti-mouse CD44 blocking antibody (KM201 , available from ATCC, Manassa, VA).
  • KM201 anti-mouse CD44 blocking antibody
  • Any suitable methods can be used to evaluate a candidate active agent for inhibitory activity toward HAS or CD44.
  • Such methods can include, for example, in vitro assays, in vitro cell-based assays, ex vivo assays, and in vivo methods.
  • the methods can evaluate binding activity, or an activity downstream of the enzyme of interest.
  • Ex vivo assays may involve treatment of cells with an agent of the invention, followed by detection of changes in transcription levels of certain genes, such as HAS or CD44 through collection of cellular RNA, conversion to cDNA, and quantification by quantitative real time polymerase chain reaction (RT- QPCR). Additionally, the cell viability, proliferation, and migration of cells may be determined after treatment with an agent.
  • Suitable methods may further include matrigel invasion assays, HA pericellular coat determination, and microarray analysis.
  • administering refers to administration of agents as needed to achieve a desired effect.
  • routes of administration include, but are not limited to, oral, rectal, nasal, sublingual, buccal, intramuscular, subcutaneous, intravenous, intracisternal, transdermal, intrameningeal, and parenteral administration.
  • Such administration can be, in certain embodiments, by injection, inhalation, or implant.
  • the route of administration and dosage form of the preparation are selected to maximize the effect of the treatment.
  • Typical examples of the administration route include oral routes as well as parenteral routes, including intracerebral, intracisternal, intraperitoneal, intraoral, intrathecal, intrabronchial, intrarectal, subcutaneous, intramuscular and intravenous routes.
  • the therapeutic agent administered directly to a target site that is need of the treatment e.g., at the site fibrosis or to the fibrotic tissue
  • a target site that is need of the treatment e.g., at the site fibrosis or to the fibrotic tissue
  • Typical examples of the dosage form include sprays, capsules, liposomes, tablets, granules, syrups, emulsions, suppositories, injections, ointments and tapes.
  • a dosage is selected that balances the effectiveness with the potential side effects, considering the severity of the disease, disorder, or condition (e.g., tissue fibrosis and/or associated clinical conditions).
  • compositions may be combined with one or more carriers and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, chewing gums, foods and the like.
  • Such compositions and preparations should contain at least 0.1 % of active compound.
  • the percentage of the compositions and preparations may, of course, be varied and may conveniently be between about 0.1 to about 100% of the weight of a given unit dosage form.
  • the amount of active compound in such therapeutically useful compositions is such that an effective dosage level will be obtained.
  • the tablets, troches, pills, capsules, and the like may also contain the following: binders such as gum tragacanth, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, fructose, lactose or aspartame or a flavoring agent such as peppermint, oil of wintergreen, or cherry flavoring.
  • binders such as gum tragacanth, acacia, corn starch or gelatin
  • excipients such as dicalcium phosphate
  • a disintegrating agent such as corn starch, potato starch, alginic acid and the like
  • a lubricant such as magnesium stearate
  • a sweetening agent such as sucrose, fructose, lactose or aspartame or a flavoring
  • the unit dosage form When the unit dosage form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier, such as a vegetable oil or a polyethylene glycol. Various other materials may be present as coatings or to otherwise modify the physical form of the solid unit dosage form. For instance, tablets, pills, or capsules may be coated with gelatin, wax, shellac or sugar and the like.
  • a liquid carrier such as a vegetable oil or a polyethylene glycol.
  • Various other materials may be present as coatings or to otherwise modify the physical form of the solid unit dosage form. For instance, tablets, pills, or capsules may be coated with gelatin, wax, shellac or sugar and the like.
  • the selected dosage level will depend upon a variety of factors including the activity of the particular compound employed, the route of administration, the time of administration, the rate of excretion or metabolism of the particular compound being employed, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular compound employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts.
  • the daily dose contains from about 0.1 mg to about 2000 mg of the active ingredient, or about 0.5 to about 60 mg of the active ingredient.
  • This dosage form permits the full daily dosage to be administered in one or two oral doses. More than once daily or twice daily administrations, e.g., 3, 4, 5 or 6 administrations per day, are also contemplated herein.
  • administering relates to providing an amount effective at bringing about a desired in vivo effect such as inhibition of HAS or CD44 in an animal, such as a human.
  • a "subject in need of treatment” refers to a subject having been diagnosed with tissue fibrosis and/or a disorder or a disease associated with tissue fibrosis, e.g., pulmonary fibrosis.
  • a subject can also be one who has been determined as likely to develop tissue fibrosis such as, for example, a subject having a genetic disposition that is indicative of susceptibility of developing tissue fibrosis, or a subject in whose family the tissue fibrosis is more frequent than normal.
  • a subject may be a mammalian subject.
  • a subject can include human and non-human animals.
  • Exemplary human subjects include a human patient having tissue fibrosis or a disease or disorder associated with tissue fibrosis as described herein, or a normal subject.
  • the term "non-human animals” includes all vertebrates, e.g., non-mammals (such as chickens, amphibians, reptiles) and mammals, such as non-human primates, domesticated and/or agriculturally useful animals (such as sheep, dogs, cats, cows, pigs, etc.), and rodents (such as mice, rats, hamsters, guinea pigs, etc.).
  • embodiments of the methods described herein relate to treatment of a cell or tissue, a cell or tissue from a subject, or a subject that may be a eukaryote, an animal, a vertebrate animal, a mammal, a rodent (e.g. a guinea pig, a hamster, a rat, a mouse), murine (e.g. a mouse), canine (e.g. a dog), feline (e.g. a cat), equine (e.g. a horse), a primate, simian (e.g. a monkey or ape), a monkey (e.g. marmoset, baboon), an ape (e.g. gorilla, chimpanzee, orangutan, gibbon), or a human.
  • a rodent e.g. a guinea pig, a hamster, a rat, a mouse
  • murine e.g.
  • provided are methods of treating a subject comprising administering an inhibitor of HAS or CD44 in a pharmaceutically acceptable composition.
  • “Pharmaceutically acceptable” means suitable for use in a human or other mammal.
  • pharmaceutically acceptable carriers and “pharmaceutically acceptable excipients” are used interchangeably and refer to substances that are useful for the preparation of a pharmaceutically acceptable composition.
  • pharmaceutically acceptable carriers are generally compatible with the other ingredients of the composition, not deleterious to the recipient, and/or neither biologically nor otherwise undesirable.
  • Embodiments provide for pharmaceutically acceptable carriers including, but not limited to, substances useful for topical, intrathecal, ocular, parenteral, intravenous, intraperitoneal intramuscular, sublingual, nasal and oral administration.
  • “Pharmaceutically acceptable carrier” also includes agents for preparation of aqueous dispersions and sterile powders for injection or dispersions. Examples of pharmaceutically acceptable carriers and excipients are discussed, e.g., in Remington Pharmaceutical Science, 16th Ed. Certain exemplary techniques and compositions for making dosage forms are described in the following references: Modern Pharmaceutics, Chapters 9 and 10, Banker & Rhodes, eds. (1979); Lieberman et al., Pharmaceutical Dosage Forms: Tablets (1981 ); and Ansel, Introduction to Pharmaceutical Dosage Forms, 2nd Ed., (1976).
  • sample or “biological sample” relates to any material that is taken from its native or natural state, so as to facilitate any desirable manipulation or further processing and/or modification.
  • a sample or a biological sample can comprise a cell, a tissue, a fluid (e.g., a biological fluid), a protein (e.g., antibody, enzyme, soluble protein, insoluble protein), a polynucleotide (e.g., RNA, DNA), a membrane preparation, and the like, that can optionally be further isolated and/or purified from its native or natural state.
  • a “biological fluid” refers to any a fluid originating from a biological organism.
  • Exemplary biological fluids include, but are not limited to, blood, serum, plasma, lymph fluid, bile fluid, urine, saliva, mucus, sputum, tears, cerebrospinal fluid (CSF), bronchioalveolar lavage, nasopharyngeal lavage, rectal lavage, vaginal lavage, colonic lavage, nasal lavage, throat lavage, synovial fluid, semen, ascites fluid, pus, maternal milk, ear fluid, sweat, and amniotic fluid.
  • CSF cerebrospinal fluid
  • a biological fluid may be in its natural state or in a modified state by the addition of components such as reagents, or removal of one or more natural constituents (e.g., blood plasma).
  • the method comprises determining the level of matrix metalloproteinase expression in a cell, and comparing the level of expression to that of a control cell, wherein an increased level of expression relative to the control cell indicates progression of the disease.
  • the method comprises determining the level of a metalloproteinase tissue inhibitor expression in a cell, and comparing the level of expression to that of a control cell, wherein a decreased level of expression relative to the control cell indicates progression of the disease.
  • the matrix metalloproteinase comprises MMP-12 or MMP1 a, or a combination thereof.
  • the metalloproteinase tissue inhibitor may comprise Timp-3 or ADAMTS1 , or a combination thereof.
  • kits for determining the progression of tissue fibrosis comprising determining the level of matrix metalloproteinase expression in a cell, and comparing the level of expression to that of a control cell, wherein an increased level of expression relative to the control cell indicates progression of the disease.
  • ASMA-human HAS2 transgenic mice (ASMA-HAS2 + ) were used (Chai et al., 2005).
  • the conditional Has2 null allele was generated using the Cre/loxP system.
  • HAS2 protein is a multipass transmembrane protein. This conditional allele was designed in such a way that exon 2, which contains the start codon as well as two N-terminal transmembrane domains crucial for the insertion of HAS2 protein into the plasma membrane, was deleted upon Cre-mediated MBF Ref. No. 028193-9120-WO00
  • Has2 designates the intact conditional allele prior to recombination.
  • the Cre recombinase-expressing mice under the control of the collagen1 a2 promoter and enhance (Colla2-iCre 1 ) were used (Florin et a1 ., 2004).
  • two chimeras of Has2 flox/+ mice were crossbred to obtain Has2" ox/ "° x homozygous mice.
  • Has ox/ " ox homozygous mice were then crossed with Colla2-iCre + mice to generate Colla2-iCre + /Has2 flox/+ .
  • Has2 CK0/CK0 mice Further breeding with Has2"° x/,tox homozygous mice resulted in four genotypes in the offspring, including the conditional knock out mutant for Has2 (Colla2-iCre + /Has2 ⁇ ' ⁇ , termed Has2 CK0/CK0 ).
  • Mice expressing Cre under the control of the FSP-1 (also called S100A4) promoter (FSP-1-Cre) were used (Lawson et al., 2005; Tanjore et al., 2009).
  • CD44 " ' " mice were also used (Schmits et al., 1997).
  • ASMA-HAS2 + were crossed with CD44- " ' " to generate chimeras of ASMA-HAS2 + /CD44 +/” , and the two chimeras were then backcrossed to get ASMA-HAS2 + /CD44 " ' " mice.
  • C57B1/6J mice were from Jackson Laboratories. All mice were housed in a pathogen-free facility at Duke University, and all animal experiments were approved by the Institutional Animal Care and Use Committee at Duke University.
  • Primary fibroblasts were derived from mouse lungs as described (Jiang et al., 2010; Tager et al., 2008). The cells were used from 3 to 6 generations. Human lung fibroblasts were isolated from surgical lung biopsies or lung transplant explants obtained from patients with idiopathic pulmonary fibrosis. Normal lung fibroblasts were obtained from discarded portions of normal transplant donor lung tissue. The specimens were obtained under the auspices of IRB- approved protocols.
  • the tissues were minced, and cultured in DMEM medium supplemented with 15% FBS, 100 U/mL penicillin, 100 ⁇ g/mL streptomycin, 5 ⁇ g/mL gentamicin, and 0.25 ⁇ g/mL amphotericin B.
  • the cells of passage 5-7 were used for invasion assays, siRNA interference assays, HA coat, and HA amount measurements.
  • the diagnosis of IPF was arrived at by standard accepted American Thoracic Society recommendations (A TSIERS, 2000). All experiments were approved by the Duke University Institutional Review Board and in accordance with the guidelines outlined by the board.
  • Bleomycin was injected intratracheally at either a dose of 2.5 U/kg body weight for analysis of the early inflammatory response or 1 .75 U/kg body weight for analysis of the late MBF Ref. No. 028193-9120-WO00
  • BAL fluid (BALF) and lung tissues were collected at different times after bleomycin treatment. Lung tissues were excised, weighed, and homogenized as described previously (Teder et al., 2002). After centrifugation, the HA content in the tissue supernatants and in BALF were measured using the HA-ELISA (Teder et al., 2002). The HA content in cultured media of human lung fibroblasts was quantified using the same ELISA method.
  • mice in each group were sacrificed at various times after bleomycin treatment under anesthesia.
  • the trachea was cannulated, and the lungs inflated with 1 mL of 10% formalin.
  • the tissues were then fixed overnight, embedded in paraffin, and sectioned for staining with Hematoxylin and Eosin or Masson's Trichrome. Paraffin-embedded lung samples were also analyzed for HA localization.
  • tissues After being de-waxed and rehydrated, tissues were incubated with biotin-labeled HA binding protein (HABP) (4 g/mL) (Associates of CAPE COD incorporated) for 1 h, then incubated and developed using a Vectastain-Elite-ABC kit (Vector Laboratories, Burlingame, CA), The specificity of the staining was determined by preincubating tissue samples with 10 U/mL streptomyces hyaluronidase for 2 h at room temperature.
  • HABP biotin-labeled HA binding protein
  • tissue sections were incubated with HRP-conjugated anti-ASMA monoclonal antibody (Dako, Denmark), and then incubated with the Vectastain-Elite-ABC kit as described above.
  • HRP-conjugated anti-ASMA monoclonal antibody Dako, Denmark
  • Vectastain-Elite-ABC kit Vectastain-Elite-ABC kit
  • RNAqueousTM-4PCR kit (Ambion, Carlsbad, CA) and was reversed to cDNA using SuperscriptTM II RNase H Reverse Transcriptase Kit (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions.
  • HAS2 gene levels in the resultant cDNAs were examined using ABI Prism 7500 Detection system (Applied Biosystems, Carlsbad, CA) with SYBR-green as fluorescent dye enabling real time detection of PCR products according to the manufacturer's protocol (power SYBR Green PCR Master Mix, Applied Biosystems, Carlsbad, CA).
  • the relative expression levels of the gene were determined against GAPDH levels in the samples.
  • the same method was used to measure the relative mRNA levels of mouse HAS2 and human HAS2 genes in ASMA-HAS2 + mice and transgene negative littermate controls with or without bleomycin treatment, and was used to measure HAS2, MMP9, MP129 and MMP14 mRNA levels in mouse and human lung fibroblasts.
  • the primers used were: human HAS2 (NM _ 005328) forward, 5'-TCG CAA CAC GT A ACG CAA T (SEQ ID NO:1 ); human HAS2 reverse, 5'-ACT TCT CTT TTT CCA CCC CAT TT (SEQ ID NO:2); human MMP9 (NM_004994) forward, 5'-CCC ACT GCT GGC CCT TCT A (SEQ ID NO:3); human MMP9 reverse, 5'-TCA CGT T.GC AGG CAT CGT (SEQ ID NO:4); human MMP12 (NM _ 002426) forward, TGC ACG CAC CTC GAT GTG (SEQ ID NO:5); human MMP12 reverse: GGC CCC CCT GGC ATT (SEQ ID NO:6); human MMP14 (NM_004995) forward, 5'-CGA GAG GAA GGA TGG CAA ATT (SEQ ID NO:7); human MMP14 reverse, 5'-AGG G
  • Fibroblasts from bleomycin-treated ASMA-HAS2 + mice were loaded onto 6-well matrigel chambers or 6-well insert chambers without matrigel (BD Bioscience, Franklin Lakes, NJ), and cultured in C0 2 incubator for 48 h. Matrigel matrix and non-invading cells on the upper surface of the filter were removed by wiping with a cotton swap and the polycarbonate filters with the invaded cells or migrated cells were washed once with PBS, RNA were isolated from the cells using the RNAqueousTM-4PCR kit (Ambion, Carlsbad, CA).
  • RT2 First Strand cDNA Synthesis kit
  • 84 genes were assessed by RT-PCR using the Mouse Extracellular Matrix and Adhesion Molecules array (RT 2 Profiler PCR Array PAMM-013; SABiosciences, Frederick, MD) according to manufacturers instructions using ABI Prism 7500 Detection system (Applied Biosystems, Carlsbad, CA).
  • GOI Gene of interest
  • Fibroblasts isolated from Has2 flox/+ , Has2 CKO CKO mouse lungs, and fibroblasts from human lung tissues were incubated at 1 x 10 4 cells/well of 6-well plate for 24 h in 10% FBS- DMEM, and were then overlaid with 1 x 10 7 erythrocytes.
  • the erythrocytes were allowed to settle for 15 min at RT and the cells were observed with an inverted microscope with a phase contrast at 200 x magnification with a Zeiss camera.
  • the size of the pericellular coat was defined by the subtraction between the area excluding erythrocytes and cell area by using the NIH Image J program. MBF Ref. No. 028193-9120-WO00
  • CD44 effects on mouse and human lung fibroblasts invasion were assessed using anti-CD44 blocking antibodies (15 ⁇ g/mL, 5F12 clone for human CD44, KM201 for mouse CD44).
  • the cells were incubated with anti- CD44 or isotype-matched IgG for 20 min before performing the invasion assay.
  • the effects of HAS2 expression levels on human lung fibroblasts' invasion were investigated by performing the invasion assay at 48 h after HAS2 siRNA and control siRNA transfection.
  • siRNA duplexes designed to target different nucleotide sequences were obtained from Qiagen (Germantown, MD).
  • Sub confluent fibroblasts (about 50-60% confluent) grown in complete medium were transfected separately with each 1 of the 4 siRNA duplexes or with a control siRNA (control si) (Qiagen, Germantown, MD) at the concentration of 100 nM using HiperFect transfection reagent (Qiagen, Germantown, MD) according the manufacturer's instructions.
  • the suppression efficiency of each 1 of the 4 siRNA duplexes was examined by measuring the hyaluronan content in the conditioned culture media after 48 and 72 h of transfection, HAS2 mRNA at 72 h after transfection and HA coat, 48 h after transfection.
  • the HAS2 siRNA corresponding to nucleotide sequences 1530-1550 of the HAS2 cDNA (CAGCTCGATCTAAGTGCCTTA; SEQ ID NO: 15; HAS2 si) was used for all experiments.
  • Wild type, ASMA-HAS2 + , and littermate control lung tissues after bleomycin treatment were homogenized in RIPA buffer.
  • the proteins were fractionated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) using gradient gel (4-20%, Bio-Rad) and electroblotted onto nitrocellulose membrane (Bio-Rad).
  • the membranes were probed with a rat monoclonal anti-CD44 antibody (KM1 14, BD Pharmingen, Franklin Lakes, NJ), and then probed with relative second antibody.
  • B-actin was used as a loading control.
  • TIB-240 hybridoma cells producing rat anti-mouse CD44 blocking antibody were purchased from ATCC (Manassas, VA). The antibody was isolated using saturated ammonium sulfate method. Two schemes were used for the antibody administration. Preventive protocol, KM201 or isotype control rat Igd (300 ⁇ g in 500 ⁇ _ saline) was administered intraperitoneally 12 h before bleomycin challenge and repeated injections in the same way (200 ⁇ g/500 ⁇ _ saline) on day 5 after bleomycin treatment. 14 days after bleomycin challenge, mouse lungs were collected and collagen content in the mouse lungs was measured using hydroxyproline assay as described.
  • KM201 or isotype control rat IgG-i (300 ⁇ g in 500 ⁇ _ saline) was administered intraperitoneally at day 7 after bleomycin treatment, and repeated injections in the same way at day 14 and day 21 after bleomycin treatment. 28 days after bleomycin challenge, mouse lungs were collected and collagen content in the mouse lungs was measured using the hydroxyproline (Adamson and Bowden, 1974).
  • Example 2 Targeted overexpression of HAS2 in a-smooth muscle actin-expressing cells generates a severe fibrotic phenotype
  • Example 3 Conditional knockout of HAS2 in mesenchymal cells diminishes the accumulation of myofibroblasts and the development of pulmonary fibrosis
  • HAS2 deficient mice have an embryonic lethal phenotype.
  • Has2 flox + mice we generated Has2 flox + mice and crossed them with a Colla2-iCre transgenic line.
  • Has2 CKO CKO the vast majority of Colla2-iCre+//-/as2 flox/flox mice (Has2 CKO CKO ) also died in utero, suggesting that HA production by mesenchymal cells drove the phenotype.
  • Conditional Has2 CKO CKO mice were treated with bleomycin at 8 weeks of age. As shown in Fig.
  • Has2 CKO CKO mice had minimal HA staining in bronchial tissues at baseline and developed less fibrosis after lung injury as estimated by Trichrome staining. In addition, at sites of lung remodeling, there was a marked reduction in myofibroblast accumulation in the lung relative to wild type or ASMA-HA transgenic mice ( Figure 5C).
  • Cre line using the FSP-1 promoter. FSP-1 is expressed by lung fibroblasts. FSP-1-Cre mice were crossed with the Has2 f,ox/flox line to generate FSP-l-Cre7Has2 flox/flox ⁇ Has2 FKO/FKO ) mice.
  • mice were viable and demonstrated no overt phenotype in the unchallenged state.
  • two different fibroblast driver lines showed that HAS2 expression by mesenchymal cells was involved with the development of pulmonary fibrosis and myofibroblast accumulation after tissue in jury.
  • fibroblasts deficient in HAS2 expression and HA production We were able to isolate fibroblasts from Has2 CKO/CKO and Has2 FKO/FKO mice and examined HA production.
  • a hallmark of mesenchymall cell HA expression is the formation of cell surface HA coats, and HA is synthesized in the cell membrane and extruded to the external milieu.
  • Conditional Has2 null (Has2 CKO CKO ) fibroblasts show a marked reduction in the ability to form cell surface coats and exclude exogenous particles ( Figure 6C,D). They were severely deficient in HA production ( Figure 6E).
  • Example 5 Deficiency of CD44 inhibits the progression of pulmonary fibrosis and regulates fibroblast/myofibroblast invasion of extracellular matrix
  • the cell surface adhesion molecule CD44 is an HA receptor, and macrophage CD44 is involved with clearing HA fragments from injured lung tissue.
  • CD44 was upregulated following bleomycin-"induced lung injury (Figure 7A,B), and to a greater extent in ASMA-HAS2 transgenic mice ( Figure 7B).
  • CD44 null mice showed protection from the development of pulmonary fibrosis ( Figure 7C,D), but the effect was more pronounced when the ASMA- HAS2 transgenic mice were bred with the CD44 null mice ( Figure 7E).
  • systemic anti-CD44 blocking antibodies or an isotype matched control at the time of lung injury was administered systemic anti-CD44 blocking antibodies or an isotype matched control at the time of lung injury.
  • HAS2 siRNA HAS2 siRNA
  • control siRNA control siRNA
  • fibroblasts were stained for HA with biotin-HABP following by Alexa Fluor 488 conjugated streptavidin.
  • Photomicrographs were taken at a 100 x magnification with fixed exposure time.
  • Photomicrographs demonstrating the effects of HAS2 si on HA coat formation were taken at 200 x magnification. Images of invasive HAS2 si and control si transfected fibroblasts were shown at 100 x magnification. The experiments were repeated three times.
  • Example 7 HAS2 regulates fibroblast invasion by modulating CD44 and MMP expression levels
  • Control samples were the fibroblasts that penetrated the filter in the absence of matrigel.
  • 84 genes were analyzed by using a specialized qRT-PCR array for extracellular matrix synthesizing and degrading enzymes.
  • RNA from the fibroblasts that penetrated the filter in the absence of matrigel was used as control.
  • MMP9 mRNA expression in invasive IPF fibroblasts was compared with IPF fibroblasts that penetrated the filters in the absence of matrigel by using real- time PCR. Similar patterns of gene expression were also observed in invasive IPF fibroblasts, including an upregulation in MMP9 ( Figure 10C). We then investigated whether the alterations in gene expression was a direct consequence of Has2.
  • CD44 mRNA expression in HAS2 siRNA transfected fibroblasts and control siRNA transfectants were determined using a microarray assay. At 48 h after HAS2 siRNA and control siRNA transfection, fibroblasts were cultured on Matrigel for an additional 6 h. mRNA was then extracted and MMP9 mRNA expression was measured using real-time PCR. Cell lysates were collected from fibroblasts transfected with HAS2 siRNA or control siRNA at 48 h for western blot analysis using antibodies against CD44. Interestingly, we found that HAS2 knock down directly suppressed CD44 and MMP9 gene and protein expression ( Figure 10D,E, and Figure 11 ).
  • HAS2 is upregulated and synthesized HA for release as well as potentially interacting with CD44 on the cell surface.
  • CD44 is upregulated and "activated” to interact with MMPs to facilitate tissue invasion.
  • HAS2 upregulation also contributes to activation of a program of gene expression that further promotes a myofibroblast invasive phenotype and resultant severe fibrosis.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • Mycology (AREA)
  • Endocrinology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Provided are methods of treating tissue fibrosis comprising administering to a subject in need of treatment an effective amount of an agent that inhibits a hyaluron synthase (HAS) or CD44. Further provided are methods of inhibiting myofibroblast invasion, or of reducing matrix deposition in the lung, the methods comprising administering to a subject in need of treatment an effective amount of an agent that inhibits a HAS or CD44. Further provided are methods of determining the progression of pulmonary fibrosis, the methods comprising determining the level of matrix metalloproteinase expression in a cell, and comparing the level of expression to that of a control cell, wherein an increased level of expression relative to the control cell indicates progression of the disease.

Description

MBF Ref. No. 028193-9120-WO00
Duke Ref. No. 3676
COMPOSITIONS AND METHODS FOR THE TREATMENT OF TISSUE FIBROSIS
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This patent application claims the benefit of priority to United States Provisional Application No. 61/474,718, filed April 12, 201 1 , and United States Provisional Application No. 61/486,292, filed May 15, 201 1 , the disclosures of each of which are incorporated by reference herein in their entireties.
[0002] A sequence listing is filed with the application in electronic format and is incorporated by reference herein. The sequence listing text file "028193.9120. WO00_Seql_ist" was created on April 12, 2012, and is 19,239 bytes in size.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0003] The research detailed in this disclosure was supported by government funding under federal grant number R01 HL060539 from the NIH, and federal grant number R01A1052201 from the NIH. The U.S. government may have certain rights to this invention.
BACKGROUND
[0004] Progressive tissue fibrosis is a major cause of morbidity and mortality. Tissue fibrosis is the formation of excess fibrous connective tissue in an organ or tissue in a reparative or reactive process, which is different from the formation of fibrous tissue as a normal constituent of an organ or tissue. Scarring is confluent fibrosis that obliterates the architecture of the underlying organ or tissue. Pulmonary fibrosis is the formation or development of excess fibrous connective tissue in the lungs. Idiopathic pulmonary fibrosis (IPF) is a terminal illness characterized by progressive and unremitting matrix deposition in the interstitium of the lung. The clinical course of IPF is unrelenting and has characteristics reminiscent of cancer. IPF patients suffer from the inexorable accumulation of extracellular matrix in the gas-exchanging regions of the lung. One feature of IPF is the formation of fibroblastic foci, which are structures of accumulated myofibroblasts in the interstitium of the lung juxtaposed to the alveolar epithelium and are associated with destruction of the adjoining alveolar basement membrane. MBF Ref. No. 028193-9120-WO00
Duke Ref. No. 3676
[0005] Hyaluronan (HA) is a non-sulfated glycosaminoglycan produced by mesenchymal cells as well as a variety of tumor cells. CD44 is a cell surface receptor for HA and plays a role in inflammatory cell recruitment and activation, as well as tumor growth and metastasis.
[0006] While numerous mediators have been identified as initiating tissue fibrosis, the mechanisms that contribute to persistent fibrodestructive disease remain incompletely understood.
SUMMARY
[0007] In an aspect the disclosure relates to methods of treating pulmonary fibrosis comprising administering to a subject in need of treatment an effective amount of an agent that inhibits a hyaluron synthase (HAS) or CD44.
[0008] In another aspect, the disclosure relates to methods of inhibiting myofibroblast invasion comprising administering to a subject in need of treatment an effective amount of an agent that inhibits a hyaluron synthase (HAS) or CD44.
[0009] In another aspect, the disclosure relates to methods of reducing matrix deposition in the lung comprising administering to a subject in need of treatment an effective amount of an agent that inhibits a hyaluron synthase (HAS) or CD44.
[0010] In another aspect, the disclosure relates to methods of determining the progression of pulmonary fibrosis comprising determining the level of matrix metalloproteinase expression in a cell, and comparing the level of expression to that of a control cell, wherein an increased level of expression relative to the control cell indicates progression of the disease.
[0011] In another aspect, the disclosure relates to methods of determining the progression of pulmonary fibrosis comprising determining the level of metalloproteinase tissue inhibitor expression in a cell, and comparing the level of expression to that of a control cell, wherein a decreased level of expression relative to the control cell indicates progression of the disease.
[0012] The disclosure relates to other aspects and embodiments which will become apparent in view of the description and accompanying drawings.
BRIEF DESCRIPTION OF THE DRAWINGS MBF Ref. No. 028193-9120-WO00
Duke Ref. No. 3676
[0013] Figure 1 shows ASMA-HAS2 transgenic mice accumulate HA and show increased mortality following bleomycin challenging. (A) Distribution of HA in lungs of ASMA-HAS2+ and Iittermate control mice (ASMA-HAS2") as determined by immunohistochemical staining HA with biotin-HABP. Representative sections from 5 bleomycin-treated samples and 3 controls are shown. Scale bars, 50 μηη. (B, C) HA concentration in lung tissue (B) and bronchoalveolar lavage fluid (BALF) (C) from ASMA-HAS2+ mice and control mice (ASMA-HAS2") at different times after bleomycin treatment (n = 5 - 7, *p < 0.05, **p< 0.01 by 2-way ANOVA with Bonferroni post test). The experiments were performed three times, (D, E) Murine HAS2 (mHAS2) (D, E) and human HAS2 (hHAS2) (E) mRNA expression levels in ASMA-HAS2+ mice and controls (ASMA-HAS2") at various time points after bleomycin treatment were measured using real-time peR (n = 3 - 5, **p < 0.01 , ***p < 0.001 ). The experiments were performed three times. (F) Increased mortality was observed in ASMA-HAS2+ mice compared with their Iittermate controls (ASMA-HAS2") following bleomycin-induced lung injury.
[0014] Figure 2 shows that ASMA-HAS2+ mice exhibit an increase in neutrophil recruitment after lung injury. (A, B) BALF cells were collected on the indicated days after bleomycin treatment and total cell (A) and differential cell counting (B) were performed (n = 4 -12 for each group; P = 0.001 ). (C) H&E staining of lung sections from ASMA-HAS2+ mice and their Iittermate controls at day 7 after bleomycin treatment. Pictures shown are representatives of 5 samples. Scale bars, 200 μηη. (D) Chemokine KC levels were measured in BALF from ASMA-HAS2+ and its controls (n = 5 - 12) at day 0, day 7 after lung injury (* P < 0.05).
[0015] Figure 3 shows increased HA fragment accumulation in ASMA-HAS2+ mouse lungs after bleomycin treatment. (A) Representative images showing HA size from ASMA-HAS2+ and Iittermate controls 7 days after bleomycin treatment. HA peaks are annotated with arrows, (B) Quantification analysis of HA molecular weight distribution in lung tissues of ASMA-HAS2+ and Iittermate controls at day 0 and day 7 after 1 .75 U/kg and 2.5 U/kg bleomycin treatment. Black circle: ASMA-HAS2+; grey circle: ASMA-HAS2+.
[0016] Figure 4 shows ASMA-HAS2 transgenic mice exhibit increased collagen content in lungs after bleomycin treatment. (A) Lung sections of ASMA-HAS2+ and transgene negative controls 0, 14 and 28 days after bleomycin instillation were stained using Masson's Trichrome method. Representative images of the staining are shown (n = 6 - 7). Scale bars, 200 μηη. (B) Lung tissues from ASMA-HAS2+ and controls on day 0, 14,21 and 28 after bleomycin treatment were collected and assayed for collagen content using the hydroxyproline method (n = 6 - 7 per MBF Ref. No. 028193-9120-WO00
Duke Ref. No. 3676 group; *p < 0.05; ****p < 0.0001 by 2-way ANOVA with Bonferroni post test). The experiments were performed three times. (C) Immunohistochemical and (D) immunofluorescent analysis of ASMA and HA in lung sections of ASMA-HAS2+ and control mice 14 days after bleomycin treatment. Representative images of the staining are shown (n = 6 - 7 per group; *p < 0.05; ***p<0.0001 by 2-way ANOVA with Bonferroni post test). The experiments were performed three times. (C) Immunohistochemical and (D) immunfluorescent analysis of ASMA and HA in lung sections of ASMA-HAS2+ and control mice 14 days after bleomycin treatment. Representative images of the staining are shown (n = 6 - 7). (C) DAB Staining. Scale bar, 50 μηη; (D) immunofluorence staining. Scale bars, 200 μηη. (E) Representative image of IPF patients' lung tissue showing ASMA staining and similar fibrotic changes to bleomycin-induced lung fibrosis. Scale bars, 200 μηη.
[0017] Figure 5 shows targeted deletion of HAS2 in mesenchymal cells inhibits lung fibrosis and myofibroblast accumulation. (A) Comparison of HA distribution in lung tissues of bleomycin- treated Has2CKO/CKO and control (Has2flox/+) mice by immunohistochemistry. Scale bars, 50 urn, (B) Lung sections of Has2CKO CKO and Has?10* * on day 14 after bleomycin instillation were stained using Masson's Trichrome method and counterstained with hematoxylin. The experiments were repeated four times. Scale bars, 200 μηη. (C) Double staining of HA (green) and ASMA (red) in bleomycin-injured lung tissue 14 days after bleomycin. Scale bars, 200 μηη, (D) HA content in lung tissue from Has2FKO/FKO and Has2flox/+ mice on day 14 after bleomycin treatment (n = 3 - 8). (E) Lung tissues from Has2FKO/FKO and control Has2flox/+ mice on day 0, 14 and 21 after bleomycin treatment were collected and assayed for collagen content using the hydroxyproline method, n = 4 - 1 1 per group. *p < 0.05 by 2-way ANOVA with Bonferroni post test. The experiments were performed three times. (F) Lung sections of Has2FKO FKO and /-/as2flox/+ mice on day 0 and 14 after bleomycin instillation were stained using Masson's Trichrome method and counterstained with hematoxylin, n = 8 in each group. Scale bars, 200 μηι, (G) Double staining of HA (green) and ASMA (red) in bleomycin-treated /-/as2FKO/FKO and control /-/as2flox/+ mouse lung sections. Scale bars, 200 μηη.
[0018] Figure 6 shows that fibroblast invasive capacity is dependent upon HAS2. (A) The spontaneous matrigel-invading capacity of fibroblasts from bleomycin-treated (10 days) and saline- treated ASMA-HAS2+ and littermate control mice lungs was determined. Data are shown as the index of invasion value of the fibroblasts with or without bleomycin treatment over littermate control fibroblasts without bleomycin challenge. The experiments were repeated two MBF Ref. No. 028193-9120-WO00
Duke Ref. No. 3676 times (n = 4; p values were indicated). The experiments were performed three times. (B) Invasive fibroblasts exhibited increased HAS2 expression level. Message RNA relative levels of HAS2 in invasive and non-invasive fibroblasts isolated from bleomycin-treated (1 1 days) WT mouse lungs were determined using real-time PCR (n = 5, *p < 0.05 by Wilcoxon rank sum test). The experiments were performed three times. (C) Phase contrast photomicrographs of the pericellular matrices (HA coat) demonstrated reduced HA coat in Has2CKO CKO fibroblasts compared with those in Has2flox/+ fibroblasts. Scale bar, 50 μηη. Experiments were performed three times. (D) Relative thickness of HA coat was calculated in 20 randomly selected cells using the NIH Image J program (n = 10; ***p < 0.001 by Wilcoxon rank sum test). Data represent one of two independent experiments. (E) HA content in cultured media of Has2flox/+ and Has2CKO CKO fibroblasts was measured using the HA-ELISA assay (n = 3; p values were indicated). The experiments were performed three times. (F) Comparison of the invasive capacity between Has2f!ox/+ and Has2CKO/CKO fibroblasts. Data are shown as invasion index of Has2CKO/CKO fibroblasts over Has2flox/+ fibroblasts (data shown are representative of three independent experiments; p values are indicated). (G) Comparison of the invasive capacity between fibroblasts from bleomycin-treated /-/as2flox/+ and Has2FKO/FKO mice. Data are shown as invasion index of Has2FKO/FKO fibroblasts over Has2flox/+ fibroblasts (n = 3; p values are indicated). The experiments were performed three times.
[0019] Figure 7 shows CD44 regulates lung fibrosis and fibroblast invasive capacity. (A) Western blotting analysis of CD44 expression using KM 1 14 anti-CD44 antibodies in wild type lung tissues at indicated times after bleomycin treatment. Samples loaded at each time point was the mixture of equal amount of three samples collected per time point, β-actin was used as a loading control. CD44 standard form (82.0 kD) is indicated. The experiments were performed three times. (B) Immunoblot of CD44 in ASMA-HAS2+ (+) and control (-) mouse lung tissues on day 0 and day 7 after bleomycin treatment. The experiment was performed three times. (C) Lung tissues from CD44 null and WT mice on day 0 and 21 after bleomycin treatment were collected and assayed for collagen content using the hydroxyproline method, n = 14 - 17 per group. *p < 0.05 between WT and CD44 null at day 21 , as determined by Wilcoxon rank: sum test, The experiments were performed three times. (D) Lung sections of WT and CD44 null mice on day 21 after bleomycin instillation were stained using Masson's Trichrome method. Representative images of the staining are shown (n = 5 - 6). Scale bars, 200 μηη. The experiment was repeated twice. (E) Bleomycin-induced lung fibrosis in ASMA-HAS2+ mice was attenuated in ASMA- HAS27CD44"'" mice. Hydroxyproline content on day 21 after bleomycin treatment was analyzed MBF Ref. No. 028193-9120-WO00
Duke Ref. No. 3676
(n = 7 - 8, per group. **p < 0.01 by 2-way ANOVA with Bonferroni post test). The experiments were performed three times. (F) Neutralizing anti-CD44 antibodies installation 12 h before and 5 days after bleomycin treatment in ASMA-HAS2+ mice prevented bleomycin-induced lung fibrosis (n = 5 - 8 per group, p value is indicated). The experiment was performed three times. (G) Systemic installation of neutralizing anti-CD44 antibodies on day 7, day 14, and day 21 after bleomycin treatment in ASMA-HAS2+ mice inhibited bleomycin-induced lung fibrosis, (n = 6 - 9 per group; ***p < 0.001 by one-way ANOVA with Tukey-Kramer post test). The experiments were performed three times. (H) Lung sections of the mice described in (G) were stained using Masson's Trichrome method. Representative images of the staining are shown. Scale bars, 200 μηη. (1 ) The spontaneous matrigel-invading capacity of fibroblasts from bleomycin-treated (7 and 1 1 days) and saline-treated wild type (WT) C57B1/6J and CD44-null mouse lungs was determined. Data are shown as the index of invasion value of the fibroblasts with or without bleomycin treatment over WT fibroblasts without bleomycin challenge, n = 4 per group. The experiments were repeated three times. (J) Invasive capacity of mesenchymal cells from ASMA- HAS2", ASMA-HAS2+, ASMA-HAS27CD44"'" and ASMA-HAS2+CD44"'- mouse lungs with or without bleomycin challenge was compared. Data are shown as the index of invasion value of the fibroblasts with or without bleomycin treatment over ASMA-HAS2" fibroblasts without bleomycin challenge (n = 4 per group). The experiments were repeated three times. (K) Increased invasion of bleomycin-treated wild type mouse lung fibroblasts (IgG) was attenuated by neutralizing CD44 antibody (anti-CD44) (n = 4 per group). The experiments were performed three times, p values are indicated.
[0020] Figure 8 shows HAS2 and CD44 are associated with human lung fibroblast invasion. (A) Invasive capacity of human fibroblasts from normal subjects (NHF) (n = 5) and IPF patients (IPF) (n = 9). Results are for 5 separate experiments and are expressed as the invasion index of the IPF fibroblasts over the normal fibroblasts, p value is indicated. (B) Representative images of invasive IPF fibroblasts and normal fibroblasts. (C) Invasive fibroblasts exhibited increased HAS2 expression level (n = 7; *p < 0.05 by Wilcoxon rank sum test). (D) HAS2 knock down in human lung fibroblasts decreased cell surface HA and inhibited fibroblast invasive capacity. (E) Suppression of HAS2 impaired IPF fibroblast invasion. (F) Neutralizing anti-CD44 antibodies reduced IPF fibroblast invasive capacity.
[0021] Figure 9 shows HAS2 siRNA reduces HAS2 gene expression and HA production in primary human lung fibroblasts. (A) HAS2 gene expression levels in primary human lung MBF Ref. No. 028193-9120-WO00
Duke Ref. No. 3676 fibroblasts at 72 h after HAS2 siRNA transfection were measured using real-time PCR. Data shown are representatives of 4 independent experiments. (B) Cell culture media were collected at 48, 72 h after transfection, and HA amount in the media was measured using the HA-ELISA method. Data represent two independent experiments.
[0022] Figure 10 shows HAS2 promotes fibroblast invasion by regulating CD44 and MMP expression and function. (A-B) qRT-PCR array of RNA extracted from invasive ASMA-HAS2+ fibroblasts. (B) CD44 mRNA expression was increased in invasive fibroblasts from bleomycin treated ASMA-HAS2+ lungs (n = 5; P = 0.05). (C) Invasive IPF fibroblasts exhibited increased MMP9 expression (n = 5). (D) HAS2 knock down decreased CD44 mRNA expression. (E) Suppression of HAS2 decreased MMP9 mRNA expression. (F) Pro-MMP9 release was increased in the ASMA-HAS2+ fibroblast media. (G) Gelatin zymographaphy of protein for MMP9 activity from concentrated fibroblast media (F). Representative image is shown.
[0023] Figure 11 shows that suppression of HAS2 decreased CD44 protein level.
[0024] Figure 12 is a non-limiting schematic illustration of an invasive fibroblast phenotype and severe lung fibrosis.
DETAILED DESCRIPTION
[0025] Before any aspects and embodiments are described in detail, it is to be understood that the claims are not limited to the details of construction and the arrangement of components set forth in the following description or illustrated in the drawings.
[0026] Myofibroblasts accumulate at sites of tissue remodeling and produce extracellular matrix components such as collagen and hyaluronan that can compromise organ function. The inventors have identified several targets for the therapeutic intervention of disorders and diseases that are associated with tissue fibrosis, invasive fibroblast phenotypes, and other similar disorders. As disclosed in further detail herein, targeted overexpression of a hyaluronan synthase (HAS) in myofibroblasts produced an aggressive phenotype leading to severe lung fibrosis and death following injury. By way of illustration the Examples disclose that fibroblasts isolated from transgenic mice overexpressing a HAS showed capacity to invade matrix. The disclosure also describes that conditional deletion of a HAS in mesenchymal cells abrogates an invasive fibroblast phenotype, impeded myofibroblast accumulation, and inhibited the development of lung fibrosis. Further, the disclosure describes that both the invasive phenotype MBF Ref. No. 028193-9120-WO00
Duke Ref. No. 3676 and the progressive fibrosis are inhibited in the absence of CD44. As illustrated in the Examples, treatment with a blocking antibody to CD44 reduced lung fibrosis in mice in vivo, and fibroblasts isolated from patients with idiopathic pulmonary fibrosis (IDF) exhibited an invasive phenotype that was also dependent on activity of HAS2 and CD44.
[0027] In an aspect, the disclosure provides a method of treating tissue fibrosis comprising administering to a subject in need of treatment an effective amount of an agent that inhibits a hyaluron synthase (HAS) or CD44, or both a HAS and CD44. Embodiments of the method provide for the inhibition of HAS, wherein HAS may include at least one of HAS1 , HAS2, and HAS3, or a combination thereof. In embodiments the HAS and/or CD44 may be mammalian such as, for example, a rodent (e.g. a guinea pig, a hamster, a rat, a mouse), canine (e.g. a dog), feline (e.g. a cat), equine (e.g. a horse), a primate (e.g. a monkey, ape, marmoset, baboon, gorilla, chimpanzee, orangutan, gibbon), or a human. In some embodiments HAS is human and can comprise, for example, a HAS2 polypeptide of SEQ ID NO: 16, or a polynucleotide encoding the polypeptide such as, for example, a HAS2 polynucleotide of SEQ ID NO: 17, described by GenBank Accession Nos: AAC50692 and CCDS6335.1 . Suitably, the agent may inhibit HAS2. Embodiments of the method also provide for the inhibition of CD44, wherein the CD44 is a mammalian CD44. In some embodiments, CD44 is human and may comprise, for example, a CD44 polypeptide of SEQ ID NO: 18, or a polynucleotide encoding the polypeptide such as, for example, a CD44 polynucleotide of SEQ ID NO: 19 described by GenBank Accession Nos: NM_000610 and CCDS7897.1 .
[0028] "Tissue fibrosis" relates to the formation of excess fibrous connective tissue in an organ or tissue in a reparative or reactive process. Thus, tissue fibrosis can be associated disorders and diseases of organs and tissues such as, for example, pulmonary fibrosis, (e.g., idiopathic pulmonary fibrosis); cirrhosis (liver); endomyocardial fibrosis (heart); mediastinal fibrosis (soft tissue of the mediastinum); myelofibrosis (bone marrow); retroperitoneal fibrosis (soft tissue of the retroperitoneum); progressive massive fibrosis (lungs); nephrogenic systemic fibrosis (skin); Crohn's Disease (intestine); keloid (skin); myocardial infarction (heart); scleroderma/systemic sclerosis (skin, lungs); arthrofibrosis (knee, shoulder, other joints); some forms of adhesive capsulitis (shoulder); and the like. In some embodiments the treatment of tissue fibrosis can comprise the treatment of fibrosis associated with pulmonary (lung) tissue such as idiopathic pulmonary fibrosis (IPF). MBF Ref. No. 028193-9120-WO00
Duke Ref. No. 3676
[0029] In certain aspects, the disclosure provides methods of inhibiting myofibroblast invasion. The methods may comprise administering to a subject in need of treatment an effective amount of an agent that inhibits a HAS or CD44, or combination thereof. In some embodiments myofibroblast invasion includes involvement, association, or promotion of neoplastic growth such as, for example, various tumors and/or cancers.
[0030] In certain aspects, the disclosure provides methods of reducing matrix deposition in tissue. The methods may comprise administering to a subject in need of treatment an effective amount of an agent that inhibits a HAS or CD44, or a combination thereof. In embodiments, tissue may include lung, heart, liver, skin, bone marrow, intestine, or other tissue in the body.
[0031] In aspects disclosed herein that relate to methods and assays an active agent suitably inhibits as least one of HAS or CD44, or both HAS and CD44. Embodiments provide for an active agent that can inhibit biological function of a HAS enzyme or a CD44 receptor protein. Other embodiments provide for an active agent that may inhibit the expression of mRNA encoding HAS and/or CD44. Some embodiments provide an active agent that may inhibit the translation of mRNA encoding HAS and/or CD44 to protein. Thus, an active agent may indirectly or directly bind and inhibit the activity of HAS or CD44 (e.g., binding activity or enzymatic activity), reduce the expression of HAS or CD44, prevent expression of HAS or CD44, or inhibit the production of HAS or CD44 in a cell.
[0032] In some embodiments, an active agent can increase the amount of, or the biological activity of a protein that can reduce the activity of HAS or CD44. Agents capable of increasing the level of a protein may include any agent capable of increasing protein or mRNA levels or increasing the expression of the protein. In one embodiment, the agent may comprise the protein itself. For example, the agent may include exogenously expressed and isolated protein capable of being delivered to the cells. The protein may be delivered to cells by a variety of methods, including fusion to Tat or VP16 or via a delivery vehicle, such as a liposome, all of which allow delivery of protein based agents across the cellular membrane. Those of skill in the art will appreciate that other delivery mechanisms for proteins may be used. Alternatively, mRNA expression may be enhanced relative to control cells by contact with the agent. For example, the agent capable of increasing the level of natively expressed protein may include a gene expression activator or de-repressor. The agent capable of increasing the level of protein may also include agents that bind to directly or indirectly and increase the effective level of protein, for example, by enhancing the binding or other activity of the protein. MBF Ref. No. 028193-9120-WO00
Duke Ref. No. 3676
[0033] The amount or level of expression of a biomolecule (e.g., mRNA or protein) in a cell may be evaluated by any variety of techniques that are known in the art. Thus, inhibit or inhibiting, such as, for example, the level of protein expression (e.g., HAS or CD44), may be evaluated at either the protein or mRNA level using techniques including, but not limited to, Western blot, ELISA, Northern blot, real time PCR, immunofluorescence, or FACS analysis. For example, the expression level of a protein may be evaluated by immunofluorescence by visualizing cells stained with a fluorescently-labeled protein-specific antibody, Western blot analysis of protein expression, and RT-PCR of protein transcripts. Inhibit or inhibiting relates to any measurable reduction or attenuation of amounts or activity, e.g., amounts or activity of HAS or CD44 or myofibroblast invasion. The expression level of HAS or CD44 may be compared to a control. A control may include comparison to the level of expression in a control cell, such as a non-cancerous cell, a non-fibrotic cell, or other normal cell. Alternatively a control may include an average range of the level of expression from a population of normal cells. Alternatively, a standard value developed by analyzing the results of a population of cells with known responses to therapies or agents may be used. Those skilled in the art will appreciate that a variety of controls may be used.
[0034] An agent may comprise a variety of compounds and compositions and agents. For example, the agent may comprise a biological molecule, including nucleic acid molecules, such as a polynucleotide having RNAi activity against HASs or a substrate thereof. In embodiments, the nucleic acid molecules can include decoy RNAs, dsRNAs, miRNAs, siRNAs, nucleic acid aptamers, antisense nucleic acid molecules, and enzymatic nucleic acid molecules that comprise a sequence that is sufficient allow for binding to an encoding nucleic acid sequence and inhibit activity thereof (i.e., are complementary to such encoding nucleic acid sequences). Suitably, an RNAi molecule comprises sequence that is complementary to at least a portion of a target sequence such that the RNAi can hybridize to the target sequence under physiological or artificially defined (e.g., reaction) conditions. In some embodiments an RNAi molecule comprises sequence that is complementary such that the molecule can hybridize to a target sequence under moderate or high stringency conditions, which are well known and can be determined by one of skill in the art. In some embodiments an RNAi molecule has complete (100%) complementarity over its entire length to a target sequence. A variety of RNAi molecules are known in the art, and can include chemical modifications, such as modifications to the sugar-phosphate backbone or nucleobase that are known in the art. The modifications may be selected by one of skill in the art to alter activity, binding, immune response, or other MBF Ref. No. 028193-9120-WO00
Duke Ref. No. 3676 properties. In some embodiments, the RNAi can comprise an siRNA having a length from about 18 to about 24 nucleotides.
[0035] In some embodiments, the inhibitory nucleic acid molecule can bind to a target nucleic acid sequence under stringent binding conditions. The terms "stringent conditions" or "stringent hybridization conditions" includes reference to conditions under which a polynucleotide will hybridize to its target sequence, to a detectably greater degree than other sequences (e.g., at least 2-fold over background). An example of stringent conditions include those in which hybridization in 50% formamide, 1 M NaCI, 1 % SDS at 37°C, and a wash in 0.1x SSC at 60 to 65°C is performed. Amino acid and polynucleotide identity, homology and/or similarity can be determined using the ClustalW algorithm, MEGALIGN™, Lasergene, Wis.) Given a target polynucleotide sequence, for example of HAS or CD44 or biological substrate thereof, an inhibitory nucleic acid molecule can be designed using motifs and targeted to a region that is anticipated to be effective for inhibitory activity, such as is known in the art.
[0036] In certain non-limiting embodiments, the agent may comprise siRNA targeted to a particular region of SEQ ID NO: 17, such as, for example, a siRNA targeting SEQ ID NO:15 (CAGCTCGATCTAAGTGCCTTA), which corresponds to nucleotides 1530-1550 of the HAS2 cDNA. Any variety of siRNA or inhibitory RNA molecules (e.g., RNA, mixed DNA RNA, DNA, chemically modified DNA and/or RNA, etc.) can be designed using strategies known in the art or otherwise herein described.
[0037] In other embodiments, the inhibitor comprises an antibody that can specifically bind to a protein such as HAS or CD44 or a fragment thereof. Embodiments also provide for an antibody that inhibits HAS or CD44 through specific binding to a HAS and/or CD44 substrate molecule. The antibodies can be produced by any method known in the art, such as by immunization with a full-length protein such as HAS or CD44, or fragments thereof. The antibodies can be polyclonal or monoclonal, and/or may be recombinant antibodies. In embodiments, antibodies that are human antibodies can be prepared, for example, by immunization of transgenic animals capable of producing a human antibody (see, for example, International Patent Application, Publication WO 93/12227). Monoclonal antibodies (mAbs) can be produced by a variety of techniques, including conventional monoclonal antibody methodology, e.g., the standard somatic cell hybridization technique of Kohler and Milstein (see, for example, Nature 1975, 256, 495), and other techniques, e.g., viral or oncogenic transformation of B-lymphocytes. Animal systems for preparing hybridomas include mouse. MBF Ref. No. 028193-9120-WO00
Duke Ref. No. 3676
Hybridoma production in the mouse is very well established, and immunization protocols and techniques for isolation of immunized splenocytes for fusion are well known in the art. Fusion partners (e.g., murine myeloma cells) and fusion procedures are also known.
[0038] In some embodiments, an antibody can be a commercially available or otherwise publicly accessible antibody to either HAS or CD44 such as, for example, an antibody comprising anti-mouse CD44 blocking antibody (KM201 , available from ATCC, Manassa, VA).
[0039] Any suitable methods can be used to evaluate a candidate active agent for inhibitory activity toward HAS or CD44. Such methods can include, for example, in vitro assays, in vitro cell-based assays, ex vivo assays, and in vivo methods. The methods can evaluate binding activity, or an activity downstream of the enzyme of interest. Ex vivo assays may involve treatment of cells with an agent of the invention, followed by detection of changes in transcription levels of certain genes, such as HAS or CD44 through collection of cellular RNA, conversion to cDNA, and quantification by quantitative real time polymerase chain reaction (RT- QPCR). Additionally, the cell viability, proliferation, and migration of cells may be determined after treatment with an agent. Suitable methods may further include matrigel invasion assays, HA pericellular coat determination, and microarray analysis.
[0040] "Administering" refers to administration of agents as needed to achieve a desired effect. Exemplary routes of administration include, but are not limited to, oral, rectal, nasal, sublingual, buccal, intramuscular, subcutaneous, intravenous, intracisternal, transdermal, intrameningeal, and parenteral administration. Such administration can be, in certain embodiments, by injection, inhalation, or implant.
[0041] Suitably the route of administration and dosage form of the preparation are selected to maximize the effect of the treatment. Typical examples of the administration route include oral routes as well as parenteral routes, including intracerebral, intracisternal, intraperitoneal, intraoral, intrathecal, intrabronchial, intrarectal, subcutaneous, intramuscular and intravenous routes. In some embodiments the therapeutic agent administered directly to a target site that is need of the treatment (e.g., at the site fibrosis or to the fibrotic tissue) such as, for example, administered to the target site by injection, catheter, incision or other suitable means. Typical examples of the dosage form include sprays, capsules, liposomes, tablets, granules, syrups, emulsions, suppositories, injections, ointments and tapes. MBF Ref. No. 028193-9120-WO00
Duke Ref. No. 3676
[0042] One skilled in the art can select an appropriate dosage and route of administration depending on the patient, the particular disease, disorder, or condition being treated, the duration of the treatment, concurrent therapies, etc. In certain embodiments, a dosage is selected that balances the effectiveness with the potential side effects, considering the severity of the disease, disorder, or condition (e.g., tissue fibrosis and/or associated clinical conditions).
[0043] For oral therapeutic administration, the composition may be combined with one or more carriers and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, chewing gums, foods and the like. Such compositions and preparations should contain at least 0.1 % of active compound. The percentage of the compositions and preparations may, of course, be varied and may conveniently be between about 0.1 to about 100% of the weight of a given unit dosage form. The amount of active compound in such therapeutically useful compositions is such that an effective dosage level will be obtained.
[0044] The tablets, troches, pills, capsules, and the like may also contain the following: binders such as gum tragacanth, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, fructose, lactose or aspartame or a flavoring agent such as peppermint, oil of wintergreen, or cherry flavoring. The above listing is merely representative and one skilled in the art could envision other binders, excipients, sweetening agents and the like. When the unit dosage form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier, such as a vegetable oil or a polyethylene glycol. Various other materials may be present as coatings or to otherwise modify the physical form of the solid unit dosage form. For instance, tablets, pills, or capsules may be coated with gelatin, wax, shellac or sugar and the like.
[0045] The selected dosage level will depend upon a variety of factors including the activity of the particular compound employed, the route of administration, the time of administration, the rate of excretion or metabolism of the particular compound being employed, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular compound employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts. MBF Ref. No. 028193-9120-WO00
Duke Ref. No. 3676
[0046] In general, the daily dose contains from about 0.1 mg to about 2000 mg of the active ingredient, or about 0.5 to about 60 mg of the active ingredient. This dosage form permits the full daily dosage to be administered in one or two oral doses. More than once daily or twice daily administrations, e.g., 3, 4, 5 or 6 administrations per day, are also contemplated herein.
[0047] In some embodiments, as noted above, administering relates to providing an amount effective at bringing about a desired in vivo effect such as inhibition of HAS or CD44 in an animal, such as a human. As used herein, a "subject in need of treatment" refers to a subject having been diagnosed with tissue fibrosis and/or a disorder or a disease associated with tissue fibrosis, e.g., pulmonary fibrosis. A subject can also be one who has been determined as likely to develop tissue fibrosis such as, for example, a subject having a genetic disposition that is indicative of susceptibility of developing tissue fibrosis, or a subject in whose family the tissue fibrosis is more frequent than normal. A subject may be a mammalian subject. In embodiments a subject can include human and non-human animals. Exemplary human subjects include a human patient having tissue fibrosis or a disease or disorder associated with tissue fibrosis as described herein, or a normal subject. The term "non-human animals" includes all vertebrates, e.g., non-mammals (such as chickens, amphibians, reptiles) and mammals, such as non-human primates, domesticated and/or agriculturally useful animals (such as sheep, dogs, cats, cows, pigs, etc.), and rodents (such as mice, rats, hamsters, guinea pigs, etc.). Accordingly, embodiments of the methods described herein relate to treatment of a cell or tissue, a cell or tissue from a subject, or a subject that may be a eukaryote, an animal, a vertebrate animal, a mammal, a rodent (e.g. a guinea pig, a hamster, a rat, a mouse), murine (e.g. a mouse), canine (e.g. a dog), feline (e.g. a cat), equine (e.g. a horse), a primate, simian (e.g. a monkey or ape), a monkey (e.g. marmoset, baboon), an ape (e.g. gorilla, chimpanzee, orangutan, gibbon), or a human.
[0048] In some embodiments, provided are methods of treating a subject comprising administering an inhibitor of HAS or CD44 in a pharmaceutically acceptable composition.
[0049] "Pharmaceutically acceptable" means suitable for use in a human or other mammal. The terms "pharmaceutically acceptable carriers" and "pharmaceutically acceptable excipients" are used interchangeably and refer to substances that are useful for the preparation of a pharmaceutically acceptable composition. In certain embodiments, pharmaceutically acceptable carriers are generally compatible with the other ingredients of the composition, not deleterious to the recipient, and/or neither biologically nor otherwise undesirable. MBF Ref. No. 028193-9120-WO00
Duke Ref. No. 3676
[0050] Embodiments provide for pharmaceutically acceptable carriers including, but not limited to, substances useful for topical, intrathecal, ocular, parenteral, intravenous, intraperitoneal intramuscular, sublingual, nasal and oral administration. "Pharmaceutically acceptable carrier" also includes agents for preparation of aqueous dispersions and sterile powders for injection or dispersions. Examples of pharmaceutically acceptable carriers and excipients are discussed, e.g., in Remington Pharmaceutical Science, 16th Ed. Certain exemplary techniques and compositions for making dosage forms are described in the following references: Modern Pharmaceutics, Chapters 9 and 10, Banker & Rhodes, eds. (1979); Lieberman et al., Pharmaceutical Dosage Forms: Tablets (1981 ); and Ansel, Introduction to Pharmaceutical Dosage Forms, 2nd Ed., (1976).
[0051] In another aspect, the disclosure provides a method of determining the progression of tissue fibrosis in a biological sample. As used herein, the term "sample" or "biological sample" relates to any material that is taken from its native or natural state, so as to facilitate any desirable manipulation or further processing and/or modification. A sample or a biological sample can comprise a cell, a tissue, a fluid (e.g., a biological fluid), a protein (e.g., antibody, enzyme, soluble protein, insoluble protein), a polynucleotide (e.g., RNA, DNA), a membrane preparation, and the like, that can optionally be further isolated and/or purified from its native or natural state. A "biological fluid" refers to any a fluid originating from a biological organism. Exemplary biological fluids include, but are not limited to, blood, serum, plasma, lymph fluid, bile fluid, urine, saliva, mucus, sputum, tears, cerebrospinal fluid (CSF), bronchioalveolar lavage, nasopharyngeal lavage, rectal lavage, vaginal lavage, colonic lavage, nasal lavage, throat lavage, synovial fluid, semen, ascites fluid, pus, maternal milk, ear fluid, sweat, and amniotic fluid. A biological fluid may be in its natural state or in a modified state by the addition of components such as reagents, or removal of one or more natural constituents (e.g., blood plasma). In embodiments the method comprises determining the level of matrix metalloproteinase expression in a cell, and comparing the level of expression to that of a control cell, wherein an increased level of expression relative to the control cell indicates progression of the disease. In embodiments the method comprises determining the level of a metalloproteinase tissue inhibitor expression in a cell, and comparing the level of expression to that of a control cell, wherein a decreased level of expression relative to the control cell indicates progression of the disease. In some embodiments, the matrix metalloproteinase comprises MMP-12 or MMP1 a, or a combination thereof. In some embodiments, the metalloproteinase tissue inhibitor may comprise Timp-3 or ADAMTS1 , or a combination thereof. MBF Ref. No. 028193-9120-WO00
Duke Ref. No. 3676
[0052] In other embodiments, provided are methods of determining the progression of tissue fibrosis. The methods may comprise comprising determining the level of matrix metalloproteinase expression in a cell, and comparing the level of expression to that of a control cell, wherein an increased level of expression relative to the control cell indicates progression of the disease.
[0053] The use of the terms "a" and "an" and "the" and similar referents in the context of the disclosure are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms "comprising," "having," "including," and "containing" are to be construed as open-ended terms (i.e., meaning "including, but not limited to,") unless otherwise noted. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as") provided herein, is intended merely to illustrate aspects and embodiments of the disclosure and does not limit the scope of the claims. The use of the term "and/or" and similar referents in the context of the disclosure is to be construed to cover the terms surrounding the "and/or" in combination and in the alternative. For example, "HAS and/or CD44" is to be construed to cover "HAS" or "CD44" or the combination "HAS and CD44," unless otherwise indicated herein or clearly contradicted by the context.
[0054] The examples that follow provide further detailed description of some aspects and embodiments of the disclosure and are to be considered merely illustrative of optional ways in which these aspects and embodiments can be performed. Thus, these illustrative examples do not serve to limit to the claims.
EXAMPLES
Example 1. Materials and Methods [0055] Mice
[0056] ASMA-human HAS2 transgenic mice (ASMA-HAS2+) were used (Chai et al., 2005). The conditional Has2 null allele was generated using the Cre/loxP system. HAS2 protein is a multipass transmembrane protein. This conditional allele was designed in such a way that exon 2, which contains the start codon as well as two N-terminal transmembrane domains crucial for the insertion of HAS2 protein into the plasma membrane, was deleted upon Cre-mediated MBF Ref. No. 028193-9120-WO00
Duke Ref. No. 3676 recombination, and thereby no HAS2 protein was produced. Has2 designates the intact conditional allele prior to recombination. The Cre recombinase-expressing mice under the control of the collagen1 a2 promoter and enhance (Colla2-iCre1) were used (Florin et a1 ., 2004). For the conditional deletion of HAS2, two chimeras of Has2flox/+ mice were crossbred to obtain Has2"ox/x homozygous mice. Has ox/"ox homozygous mice were then crossed with Colla2-iCre+ mice to generate Colla2-iCre+/Has2flox/+. Further breeding with Has2"°x/,tox homozygous mice resulted in four genotypes in the offspring, including the conditional knock out mutant for Has2 (Colla2-iCre+/Has2~'~, termed Has2CK0/CK0). Mice expressing Cre under the control of the FSP-1 (also called S100A4) promoter (FSP-1-Cre) were used (Lawson et al., 2005; Tanjore et al., 2009). CD44"'" mice were also used (Schmits et al., 1997). ASMA-HAS2+ were crossed with CD44-"'" to generate chimeras of ASMA-HAS2+/CD44+/", and the two chimeras were then backcrossed to get ASMA-HAS2+/CD44"'"mice. C57B1/6J mice were from Jackson Laboratories. All mice were housed in a pathogen-free facility at Duke University, and all animal experiments were approved by the Institutional Animal Care and Use Committee at Duke University.
[0057] Fibroblast isolation and culture
[0058] Primary fibroblasts were derived from mouse lungs as described (Jiang et al., 2010; Tager et al., 2008). The cells were used from 3 to 6 generations. Human lung fibroblasts were isolated from surgical lung biopsies or lung transplant explants obtained from patients with idiopathic pulmonary fibrosis. Normal lung fibroblasts were obtained from discarded portions of normal transplant donor lung tissue. The specimens were obtained under the auspices of IRB- approved protocols. The tissues were minced, and cultured in DMEM medium supplemented with 15% FBS, 100 U/mL penicillin, 100 μg/mL streptomycin, 5 μg/mL gentamicin, and 0.25 μg/mL amphotericin B. The cells of passage 5-7 were used for invasion assays, siRNA interference assays, HA coat, and HA amount measurements. The diagnosis of IPF was arrived at by standard accepted American Thoracic Society recommendations (A TSIERS, 2000). All experiments were approved by the Duke University Institutional Review Board and in accordance with the guidelines outlined by the board.
[0059] Bleomycin administration and bronchoalveolar lavage
[0060] Bleomycin was injected intratracheally at either a dose of 2.5 U/kg body weight for analysis of the early inflammatory response or 1 .75 U/kg body weight for analysis of the late MBF Ref. No. 028193-9120-WO00
Duke Ref. No. 3676 fibrotic response. Anesthesia was provided with a mixture of Ketamine of 100 mg/Kg (Fort Dodge, Overland Park, KS) and Xylazine of 10 mg/Kg (Lloyd Laboratories, Shenandoah, IA). At designated time points after bleomycin injection, mice were euthanized by Ketamine mixture injection and lungs were harvested for RNA preparation, protein isolation, or for fibroblast isolation. For bronchoalveolar lavage, the trachea was lavaged 3 times with 0.8 mL sterile saline at room temperature. Samples were centrifuged at 1500 rpm for 5 min and the supernatant was collected and stored at -80°C until used. The cell-free supernatants were then analyzed for HA and chemokine KC concentrations by specific enzyme-linked immunosorbent assay (ELISA). The cell pellets were resolved in 1 mL sterile saline and the cells were counted with a hemocytometer. Approximately 40,000 cells from each specimen were loaded onto slides. These slides were stained using a Protocol HEMA 3 stain set (Fisher Diagnostics, Waltham, MA) and reviewed under light microscopy for white blood cell differential.
[0061] Hyaluronan quantification
[0062] BAL fluid (BALF) and lung tissues were collected at different times after bleomycin treatment. Lung tissues were excised, weighed, and homogenized as described previously (Teder et al., 2002). After centrifugation, the HA content in the tissue supernatants and in BALF were measured using the HA-ELISA (Teder et al., 2002). The HA content in cultured media of human lung fibroblasts was quantified using the same ELISA method.
[0063] Histology, ct-smooth muscle actin (ASMA), and HA immunohistochemistry
[0064] Three to eight mice in each group were sacrificed at various times after bleomycin treatment under anesthesia. The trachea was cannulated, and the lungs inflated with 1 mL of 10% formalin. The tissues were then fixed overnight, embedded in paraffin, and sectioned for staining with Hematoxylin and Eosin or Masson's Trichrome. Paraffin-embedded lung samples were also analyzed for HA localization. After being de-waxed and rehydrated, tissues were incubated with biotin-labeled HA binding protein (HABP) (4 g/mL) (Associates of CAPE COD incorporated) for 1 h, then incubated and developed using a Vectastain-Elite-ABC kit (Vector Laboratories, Burlingame, CA), The specificity of the staining was determined by preincubating tissue samples with 10 U/mL streptomyces hyaluronidase for 2 h at room temperature. For ASMA staining, tissue sections were incubated with HRP-conjugated anti-ASMA monoclonal antibody (Dako, Denmark), and then incubated with the Vectastain-Elite-ABC kit as described above. For HA and ASMA double staining, tissue sections were incubated with biotin-HABP MBF Ref. No. 028193-9120-WO00
Duke Ref. No. 3676 overnight at 4 GC, followed by incubation with Cy:3 labeld anti-ASMA antibody (Sigma, St. Louis, MO) to detect ASMA and streptavidin, Alexa Fluor® 488 conjugate (Invitrogen, Carlsband, CA) to detect HA. The processed sections were mounted in Fluoromount G (Immunokemi) containing DAPI and photographed with a Zeiss Microsystems microscope.
[0065] Hydroxyproline assay
[0066] Collagen content in lung tissue from six to eight mice per group was measured with the conventional hydroxyproline method (Adamson and Bowden, 1974). The ability of the assay to completely hydrolyze and recover hydroxyproline from collagen was confirmed using samples containing known amounts of purified collagen.
[0067] Quantification of mRNA expression
[0068] Real time RT-PCR was used to quantify the relative mRNA levels of HAS2 in C57B1/6J mice with or without bleomycin instillation using gene specific primers. In brief, total RNA was purified using RNAqueous™-4PCR kit (Ambion, Carlsbad, CA) and was reversed to cDNA using Superscript™ II RNase H Reverse Transcriptase Kit (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. HAS2 gene levels in the resultant cDNAs were examined using ABI Prism 7500 Detection system (Applied Biosystems, Carlsbad, CA) with SYBR-green as fluorescent dye enabling real time detection of PCR products according to the manufacturer's protocol (power SYBR Green PCR Master Mix, Applied Biosystems, Carlsbad, CA). The relative expression levels of the gene were determined against GAPDH levels in the samples. The same method was used to measure the relative mRNA levels of mouse HAS2 and human HAS2 genes in ASMA-HAS2+ mice and transgene negative littermate controls with or without bleomycin treatment, and was used to measure HAS2, MMP9, MP129 and MMP14 mRNA levels in mouse and human lung fibroblasts. The primers used were: human HAS2 (NM _ 005328) forward, 5'-TCG CAA CAC GT A ACG CAA T (SEQ ID NO:1 ); human HAS2 reverse, 5'-ACT TCT CTT TTT CCA CCC CAT TT (SEQ ID NO:2); human MMP9 (NM_004994) forward, 5'-CCC ACT GCT GGC CCT TCT A (SEQ ID NO:3); human MMP9 reverse, 5'-TCA CGT T.GC AGG CAT CGT (SEQ ID NO:4); human MMP12 (NM _ 002426) forward, TGC ACG CAC CTC GAT GTG (SEQ ID NO:5); human MMP12 reverse: GGC CCC CCT GGC ATT (SEQ ID NO:6); human MMP14 (NM_004995) forward, 5'-CGA GAG GAA GGA TGG CAA ATT (SEQ ID NO:7); human MMP14 reverse, 5'-AGG GAC GCC TCA TCA AAC AC (SEQ ID NO:8); human GAPDH (NM_002046) forward, 5'-CCC ATG TTC GTC ATG GGT GT (SEQ ID NO:9); human GAPDH MBF Ref. No. 028193-9120-WO00
Duke Ref. No. 3676 reverse, 5'-TGG TCA TGA GTC CTT CCA CGA TA (SEQ ID NO:10); mouse HAS2 (NM_009216) forward, 5'-ACG ACG ACC TTT ACA TGA TGG A (SEQ ID NO:1 1 ); mouse HAS2 reverse, 5'-GAT GTA CAT GGC CGA TTT GCT (SEQ ID NO: 12); mouse GAPDH forward, 5'- ATC ATC TCC GCC CCT TCT G (SEQ ID NO: 13); and mouse GAPDH reverse, 5'-GGT CAT GAG CCC TTC CAC AAC (SEQ ID NO:14).
[0069] qR T-PCR array assay
[0070] Fibroblasts from bleomycin-treated ASMA-HAS2+ mice were loaded onto 6-well matrigel chambers or 6-well insert chambers without matrigel (BD Bioscience, Franklin Lakes, NJ), and cultured in C02 incubator for 48 h. Matrigel matrix and non-invading cells on the upper surface of the filter were removed by wiping with a cotton swap and the polycarbonate filters with the invaded cells or migrated cells were washed once with PBS, RNA were isolated from the cells using the RNAqueous™-4PCR kit (Ambion, Carlsbad, CA). Reverse transcription was performed using the RT2 First Strand cDNA Synthesis kit (SABiosciences, Frederick, MD), and 84 genes were assessed by RT-PCR using the Mouse Extracellular Matrix and Adhesion Molecules array (RT2 Profiler PCR Array PAMM-013; SABiosciences, Frederick, MD) according to manufacturers instructions using ABI Prism 7500 Detection system (Applied Biosystems, Carlsbad, CA). For analysis, the expression level for each gene of interest (GOI) was calculated as 2-Ct followed by normalization to GAPDH (HKG), using the formula 2-(Ct GOI - Ct HKG). Ultimately the fold change in normalized gene expression was calculated by comparing values from the invaded fibroblasts through matrigel (with invasion) to the migrated fibroblasts through filter without matrigel (without invasion) according to the following formula: 2-Ct with invasion/2-Ct without invasion. Values were calculated for replicates of 5 independent experiments.
[0071] HA pericellular coat determination
[0072] Fibroblasts isolated from Has2flox/+, Has2CKO CKO mouse lungs, and fibroblasts from human lung tissues were incubated at 1 x 104 cells/well of 6-well plate for 24 h in 10% FBS- DMEM, and were then overlaid with 1 x 107 erythrocytes. The erythrocytes were allowed to settle for 15 min at RT and the cells were observed with an inverted microscope with a phase contrast at 200 x magnification with a Zeiss camera. The size of the pericellular coat was defined by the subtraction between the area excluding erythrocytes and cell area by using the NIH Image J program. MBF Ref. No. 028193-9120-WO00
Duke Ref. No. 3676
[0073] Matrigel invasion assay
[0074] The invasive behavior of fibroblasts isolated from WT, ASMA-HAS2+, ASMA-HAST, Has2CKO/CKO, Has2FKO/FKO, ASMA-HAS27CD44"'", ASMA-HAS2+/CD44"'" and CD44"'" mouse lungs were performed essentially as described previously (Hager et al., 2009; Li et al., 2007). Equal numbers of fibroblasts were plated onto the BioCoat Matrigel Invasion Chamber (BD Biosciences, Franklin Lakes, NJ); and the cell invasion was performed in the presence of 10% FBS complete medium. After 24 h of incubation in C02 incubator, media were removed and the polycarbonate filters with the invaded cells were washed once with PBS followed by fixing and staining with the Protocol Hema3 stain set. Matrigel matrix and non-invading cells on the upper surface of the filter were removed by wiping with a cotton swap, and the filters were removed from the insert by a scalpel blade, and were mounted onto glass slides. The invading cells of each sample were counted in 5 randomly selected fields of duplicate filters under microscope at 400 x magnification. The invasive capacity of fibroblasts from IPF patients was compared to fibroblasts from normal donators using the same invasion assay. CD44 effects on mouse and human lung fibroblasts invasion were assessed using anti-CD44 blocking antibodies (15 μg/mL, 5F12 clone for human CD44, KM201 for mouse CD44). The cells were incubated with anti- CD44 or isotype-matched IgG for 20 min before performing the invasion assay. The effects of HAS2 expression levels on human lung fibroblasts' invasion were investigated by performing the invasion assay at 48 h after HAS2 siRNA and control siRNA transfection.
[0075] RNA interference assay
[0076] Four siRNA duplexes designed to target different nucleotide sequences (HAS2 si, 1530-1550; HAS2 si2, 1051 -1071 ; HAS2 si3, 1424-1444; HAS2 si4, 1777-1797) of the human HAS2 gene [NM_005328] were obtained from Qiagen (Germantown, MD). Sub confluent fibroblasts (about 50-60% confluent) grown in complete medium were transfected separately with each 1 of the 4 siRNA duplexes or with a control siRNA (control si) (Qiagen, Germantown, MD) at the concentration of 100 nM using HiperFect transfection reagent (Qiagen, Germantown, MD) according the manufacturer's instructions. The suppression efficiency of each 1 of the 4 siRNA duplexes was examined by measuring the hyaluronan content in the conditioned culture media after 48 and 72 h of transfection, HAS2 mRNA at 72 h after transfection and HA coat, 48 h after transfection. The HAS2 siRNA corresponding to nucleotide sequences 1530-1550 of the HAS2 cDNA (CAGCTCGATCTAAGTGCCTTA; SEQ ID NO: 15; HAS2 si) was used for all experiments. MBF Ref. No. 028193-9120-WO00
Duke Ref. No. 3676
[0077] Western blotting
[0078] Wild type, ASMA-HAS2+, and littermate control lung tissues after bleomycin treatment were homogenized in RIPA buffer. The proteins were fractionated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) using gradient gel (4-20%, Bio-Rad) and electroblotted onto nitrocellulose membrane (Bio-Rad). The membranes were probed with a rat monoclonal anti-CD44 antibody (KM1 14, BD Pharmingen, Franklin Lakes, NJ), and then probed with relative second antibody. B-actin was used as a loading control.
[0079] Administration of neutralizing anti-CD44 monoclonal antibody
[0080] TIB-240 hybridoma cells producing rat anti-mouse CD44 blocking antibody (KM201 ) were purchased from ATCC (Manassas, VA). The antibody was isolated using saturated ammonium sulfate method. Two schemes were used for the antibody administration. Preventive protocol, KM201 or isotype control rat Igd (300 μg in 500 μΙ_ saline) was administered intraperitoneally 12 h before bleomycin challenge and repeated injections in the same way (200 μg/500 μΙ_ saline) on day 5 after bleomycin treatment. 14 days after bleomycin challenge, mouse lungs were collected and collagen content in the mouse lungs was measured using hydroxyproline assay as described. Therapeutic protocol, KM201 or isotype control rat IgG-i (300 μg in 500 μΙ_ saline) was administered intraperitoneally at day 7 after bleomycin treatment, and repeated injections in the same way at day 14 and day 21 after bleomycin treatment. 28 days after bleomycin challenge, mouse lungs were collected and collagen content in the mouse lungs was measured using the hydroxyproline (Adamson and Bowden, 1974).
[0081] Statistical analysis
[0082] Data are expressed as the mean ± SEM where applicable. We assessed differences in measured variables using the unpaired two-sided Student f-test, or Wilcoxon rank-sum test with nonparametric data. Differences between multiple groups were calculated using one-way ANOVA with Tukey-Kramer post test or two-way ANOVA with Bonferroni multiple comparisons. Statistic significance of survival curves was analyzed with the log-rank test. Statistical difference was accepted at P < 0.05. Prism 5.0 or JMP5 software was used to perform statistical analysis. MBF Ref. No. 028193-9120-WO00
Duke Ref. No. 3676
Example 2. Targeted overexpression of HAS2 in a-smooth muscle actin-expressing cells generates a severe fibrotic phenotype
[0083] In order to characterize the role of HAS2 expression by myofibroblasts in the pathogenesis of pulmonary fibrosis we evaluated transgenic mice with targeted human HAS2 expression in ASMA-expressing cells. ASMA-HAS2 transgenic mice develop normally and exhibit no overt phenotype in the unchallenged state. Intratracheal administration of bleomycin recruits myofibroblasts and causes pulmonary fibrosis. It was found that ASMA-HAS2 transgenic mice exhibited an increase in HA deposition around large airways and blood vessels at baseline and accumulate increased concentrations of HA in both the lung interstitium and alveolar space after injury (Figure 1A-C). The specificity of the staining was determined by preincubating tissue samples with 10 U/mL streptomyces hyaluronidase for 2 h at room temperature (data not shown). The experiment was performed three times. Endogenous murine HAS2 gene expression was upregulated following bleomycin treatment (Figure 1 D) but human HAS2 was only expressed in the transgenic mice (Figure 1 E). ASMA-HAS2 transgenic mice demonstrated a marked increase in mortality following lung injury over a dose range of bleomycin. Percentages of surviving mice with various doses of bleomycin treatment were plotted over a 21-day period (n = 8 - 16 per group; p values are indicated; Statistic significance of survival curves was determined by the log-rank test). Experiments were performed three times (Figure 1 F; red line: ASMA-HAS2"; blue line: ASMA-HAS2+). To evaluate the mechanisms leading to increased mortality in ASMA-HAS2 transgenic mice, we first examined the inflammatory response following lung injury. ASMA-HAS2 transgenic mice were found to have an increase in total inflammatory cells relative to transgene negative controls and the increase was largely due to an influx of neutrophils (Figure 2A-C). We analyzed the bronchoalveolar lavage fluid for neutrophil chemotactic peptides and found a marked increase in the chemokine KC in the ASMA-HAS2 transgenic mice (Figure 2D). It was previously known that HA fragments accumulate following lung injury and stimulate macrophages to produce inflammatory mediators. ASMA-HAS2 transgenic mice were found to accumulate abundant HA fragments in lung tissue (Figure 3A,B), and the experiments were repeated two times. We then examined the fibrotic response in ASMA-HAS2 transgenic mice and found evidence of progressive fibrosis at time points (28 days) when the fibrotic response in transgene negative mice was abating (Figure 4A,B)- Both the magnitude and duration of the fibrotic response was greater in the ASMA-HAS2 transgenic mice. Furthermore, a fibrodestructive response in the periphery of the lung was observed in the ASMA-HAS2 transgenic mice (Figure 4A) similar to MBF Ref. No. 028193-9120-WO00
Duke Ref. No. 3676 that observed in lung tissue from patients with IPF. We also found an impressive increase in the accumulation of ASMA-staining in lung tissue from ASMA-HAS2 transgenic mice consistent with greater accumulation of myofibroblasts (Figure 4C,D) that was similar to what was observed in IPF lung tissue (Figure 4E).
Example 3. Conditional knockout of HAS2 in mesenchymal cells diminishes the accumulation of myofibroblasts and the development of pulmonary fibrosis
[0084] HAS2 deficient mice have an embryonic lethal phenotype. In order to ascertain the role of HA in mesenchymal cell functions, we generated Has2flox + mice and crossed them with a Colla2-iCre transgenic line. Unfortunately, the vast majority of Colla2-iCre+//-/as2flox/flox mice (Has2CKO CKO) also died in utero, suggesting that HA production by mesenchymal cells drove the phenotype. Conditional Has2CKO CKO mice were treated with bleomycin at 8 weeks of age. As shown in Fig. 3 A, and B, Has2CKO CKO mice had minimal HA staining in bronchial tissues at baseline and developed less fibrosis after lung injury as estimated by Trichrome staining. In addition, at sites of lung remodeling, there was a marked reduction in myofibroblast accumulation in the lung relative to wild type or ASMA-HA transgenic mice (Figure 5C). In order to further assess the contribution of fibroblast expression of HAS2, we utilized an additional Cre line using the FSP-1 promoter. FSP-1 is expressed by lung fibroblasts. FSP-1-Cre mice were crossed with the Has2f,ox/flox line to generate FSP-l-Cre7Has2flox/flox {Has2FKO/FKO) mice. These mice were viable and demonstrated no overt phenotype in the unchallenged state. We challenged Has2FKO FKO mice with bleomycin and found a substantial inhibition in the accumulation of both hyaluronan (Figure 5D) and collagen in lung tissue following injury (Figure 5E,F). In addition, there was also a decrease in the accumulation of myofibroblasts as assessed by ASMA staining of lung tissues (Figure 5G). Thus, two different fibroblast driver lines showed that HAS2 expression by mesenchymal cells was involved with the development of pulmonary fibrosis and myofibroblast accumulation after tissue in jury. These gain and loss of function interventions supported a fundamental role for HAS2 in the development of pulmonary fibrosis.
Example 4. HAS2 expression in myofibroblasts promotes an invasive phenotype
[0085] We investigated whether or not fibrotic fibroblasts acquire an invasive phenotype that is essential for severe fibrogenesis and whether or not HAS2 regulates the process. We utilized an assay system in which fibroblasts were evaluated for their ability to spontaneously invade MBF Ref. No. 028193-9120-WO00
Duke Ref. No. 3676 matrigel, a composite matrix with basement membrane constituents. We compared fibroblasts isolated from ASMA-HAS2 transgenic mice and littermate control mice before and after bleomycin challenge. We found that fibrotic fibroblasts spontaneously invaded matrigel (Figure 6A). Interestingly, invasive fibroblasts demonstrated increased HAS2 mRNA expression relative to fibroblasts isolated that did not invade matrix (Figure 6B), suggesting that Has2 expression was an consistent feature of the subset of fibroblasts that invaded matrix. Fibroblasts isolated from bleomycin treated ASMA-HAS2 transgenic mice demonstrated greater invasive capacity than trans gene negative controls (Figure 6A). To determine the contribution of HA to the invasive phenotype we sought to identify fibroblasts deficient in HAS2 expression and HA production. We were able to isolate fibroblasts from Has2CKO/CKO and Has2FKO/FKO mice and examined HA production. A hallmark of mesenchymall cell HA expression is the formation of cell surface HA coats, and HA is synthesized in the cell membrane and extruded to the external milieu. Conditional Has2 null (Has2CKO CKO) fibroblasts show a marked reduction in the ability to form cell surface coats and exclude exogenous particles (Figure 6C,D). They were severely deficient in HA production (Figure 6E). We examined the ability of conditional Has2 null fibroblasts to invade matrigel and found a marked reduction in invasive capacity (Figure 6F,G). These gain and loss of function interventions supported a fundamental role for HAS2 in the development of an invasive myofibroblast phenotype.
Example 5. Deficiency of CD44 inhibits the progression of pulmonary fibrosis and regulates fibroblast/myofibroblast invasion of extracellular matrix
[0086] The cell surface adhesion molecule CD44 is an HA receptor, and macrophage CD44 is involved with clearing HA fragments from injured lung tissue. We found that CD44 was upregulated following bleomycin-"induced lung injury (Figure 7A,B), and to a greater extent in ASMA-HAS2 transgenic mice (Figure 7B). We evaluated the role of CD44 in mediating the fibrogenic response in several ways. CD44 null mice showed protection from the development of pulmonary fibrosis (Figure 7C,D), but the effect was more pronounced when the ASMA- HAS2 transgenic mice were bred with the CD44 null mice (Figure 7E). We then administered systemic anti-CD44 blocking antibodies or an isotype matched control at the time of lung injury. We found that lung collagen accumulation was largely prevented in the ASMA-HAS2 transgenic mice in the presence of anti-CD44 antibodies (Figure 7F). To determine if blocking CD44 could be of therapeutic benefit, we treated ASMA-HAS2 transgenic mice with systemic anti-CD44 antibodies or isotype matched control on day 7, 14, and 21 after the bleomycin treatment and MBF Ref. No. 028193-9120-WO00
Duke Ref. No. 3676 analyzed collagen content at day 28. Collagen content was reduced in the presence of CD44 inhibition (Figure 7G,H).
[0087] To determine the role of CD44 in fibroblast invasion we examined the invasive capacity of fibroblasts isolated from CD44 null mice after bleomycin treatment and found impaired invasive capacity (Figure 7I). Similar results were found from fibroblasts isolated from ASMA-HAS2+/CD44"'" mice relative to control mice (Figure 7J). Furthermore, treating fibroblasts isolated from bleomycin-challenged wild type C57B1/6J mice with anti-CD44 antibodies blunted fibroblast invasion (Figure 7K)
Example 6. HAS2 and CD44 regulate human IPF fibroblast invasion
[0088] To determine if these data obtained from mouse models of fibrosis were relevant to human lung fibrosis, we isolated primary lung fibroblasts from patients with IFF and analyzed their invasive capacity. We found a striking increase in the invasive capacity of IPF fibroblasts compared to fibroblasts isolated from normal lung tissue (Figure 8A,B)- These data suggested that fibroblasts from patients with progressive pulmonary fibrosis acquired an invasive phenotype. Relative HAS2 mRNA levels of invasive and non-invasive IPF fibroblasts were determined using real-time PCR. Interestingly, HAS2 mRNA expression was increased in IPF fibroblasts that invaded matrigel (Figure 8C; horizontal bars indicate the median expression values). The effect of HAS2 on human lung fibroblast invasion was then investigated by knocking down gene expression using siRNA in primary cells. At 48 h after transfection with HAS2 siRNA (HAS2 si) and control siRNA (control si), fibroblasts were stained for HA with biotin-HABP following by Alexa Fluor 488 conjugated streptavidin. Photomicrographs were taken at a 100 x magnification with fixed exposure time. Photomicrographs demonstrating the effects of HAS2 si on HA coat formation were taken at 200 x magnification. Images of invasive HAS2 si and control si transfected fibroblasts were shown at 100 x magnification. The experiments were repeated three times. At 48 h after HAS2 and control siRNA transfection, equal numbers of fibroblasts from normal donors (n = 2) and IPF patients (n = 3) were loaded into invasion chambers and incubated for another 24 h. Invasive cells were counted. We found that HAS2 suppression dramatically decreased constitutive HA production (Figure 8D, and Figure 9), and markedly inhibited the capacity to invade matrix (Figure 8D,E). In Figure 8E, data are shown as the invasion index of HAS2 si transfected normal, IPF fibroblasts, and control si transfected IPF fibroblasts over control si transfected normal fibroblasts. P values are indicated. The experiments were repeated three times. We then treated IFF fibroblasts with MBF Ref. No. 028193-9120-WO00
Duke Ref. No. 3676 anti-CD44 antibodies that recognize human CD44 and demonstrated a marked reduction in invasive capacity (Figure 8F). Following 20 min of incubation with anti-CD44 neutralizing or isotype-matched control IgG antibody, fibroblasts from normal donors (n = 3) and IPF patients (n = 6) were subjected to the invasion assay. In Figure 8F, data are depicted as the invasion index, and P values are indicated. The experiments were repeated three times. Collectively, these data suggested that unrelenting pulmonary fibrosis was dependent upon a matrix invading fibroblast phenotype regulated by HAS2 and CD44.
Example 7. HAS2 regulates fibroblast invasion by modulating CD44 and MMP expression levels
[0089] In order to gain additional insights into the potential mechanisms for the enhanced invasive phenotype of fibroblasts from both a mouse model of severe fibrosis as well as from patients with idiopathic pulmonary fibrosis, we examined patterns of gene expression induced during invasion. Fibroblasts are heterogenous and only a subset are invasive, so we reasoned that clues to the mechanisms regulating invasion could be gained by studying fibroblasts after invasion. Fibroblasts from ASMA-HAS2+ mice were layered onto matrigel-coated wells, and RNA from the fibroblasts that invaded the matrix through to the underlying filter were isolated and qRT-PCR array analysis was performed. Control samples were the fibroblasts that penetrated the filter in the absence of matrigel. 84 genes were analyzed by using a specialized qRT-PCR array for extracellular matrix synthesizing and degrading enzymes. RNA from the fibroblasts that penetrated the filter in the absence of matrigel was used as control. In addition to the upregulation of HAS2 (Figure 6B) and CD44 (Figure 10B) expression in invasive cells, we identified a marked up-regulation in the expression of matrix metalloproteinases (MMP9, 12 and 14) (Figure 10A), which promote fibroblast migration and invasion, and down-regulation of tissue inhibitor of metalloproteinase (TIMP3) (Figure 10A), which has been shown to inhibit cell invasion of matrix, and ADAMTS1 (Figure 10A), which has been reported to play a role in renal fibrosis. In Figure 10A, representative genes up-regulated or down-regulated in invasive ASMA- HAS2+ fibroblasts are shown as bar graphs (n = 5; *P < 0.05; =**P < 0.01 by Wilcoxon rank sum test). MMP9 mRNA expression in invasive IPF fibroblasts was compared with IPF fibroblasts that penetrated the filters in the absence of matrigel by using real- time PCR. Similar patterns of gene expression were also observed in invasive IPF fibroblasts, including an upregulation in MMP9 (Figure 10C). We then investigated whether the alterations in gene expression was a direct consequence of Has2. CD44 mRNA expression in HAS2 siRNA transfected fibroblasts and control siRNA transfectants were determined using a microarray assay. At 48 h after HAS2 siRNA and control siRNA transfection, fibroblasts were cultured on Matrigel for an additional 6 h. mRNA was then extracted and MMP9 mRNA expression was measured using real-time PCR. Cell lysates were collected from fibroblasts transfected with HAS2 siRNA or control siRNA at 48 h for western blot analysis using antibodies against CD44. Interestingly, we found that HAS2 knock down directly suppressed CD44 and MMP9 gene and protein expression (Figure 10D,E, and Figure 11 ). In Figure 10D, the horizontal bars indicate the median expression values (n= 4; *P < 0,05 by Wilcoxon rank sum test). In Figure 10E, data shown represent one of two separate experiments. Finally, we cultured fibroblasts from ASMA- HAS2+ and wild type mice in matrigel. Fibroblasts from ASMA-HAS2" and ASMA-HAS2+ mice were cultured on matrigel for 96 h. Pro-MMP9 protein in the media was measured using a Pro- MMP9 ELISA kit (n = 3 - 7 per group; P value is indicated). The experiments were performed three times. We found that fibroblasts from ASMA-HAS2+ fibroblasts secreted more pro-MMP9 than fibroblasts from control ASMA-HAS2" mice (Figure 10F) that was enzymatically active (Figure 10G; n = 4 -5 per group, p values are indicated). The media was concentrated 10x using Microsep centrifugal devices. The experiments were repeated two times. Protein amount was normalized and quantification analysis of gelatin zymographaphy for MMP9 activity results by using NIH Image J software. Collectively, these data suggested that HA-CD44 interactions and upregulation of HAS2 in the context of matrix induced the activation of a gene program that promoted an invasive fibroblast phenotype and severe fibrosis. We have schematically depicted this concept (Figure 12). Following lung injury, HAS2 is upregulated and synthesized HA for release as well as potentially interacting with CD44 on the cell surface. CD44 is upregulated and "activated" to interact with MMPs to facilitate tissue invasion. HAS2 upregulation also contributes to activation of a program of gene expression that further promotes a myofibroblast invasive phenotype and resultant severe fibrosis.

Claims

MBF Ref. No. 028193-9120-WO00 Duke Ref. No. 3676 CLAIMS What is claimed is:
1. A method of treating pulmonary fibrosis comprising administering to a subject in need of treatment an effective amount of an agent that inhibits a hyaluron synthase (HAS) or CD44.
2. The method of claim 1 , wherein the HAS is selected from HAS1 , HAS2, and HAS3.
3. The method of claim 1 , wherein the HAS is HAS2.
4. The method of claim 1 , wherein the agent inhibits CD44.
5. The method of claim 1 , wherein the agent inhibits the expression or biological activity of HAS or CD44.
6. The method of claim 5, wherein the agent comprises an inhibitory RNA molecule or an antibody.
7. The method of claim 5, wherein the expression of both HAS and CD44 are reduced.
8. A method of inhibiting myofibroblast invasion comprising administering to a subject in need of treatment an effective amount of an agent that inhibits a hyaluron synthase (HAS) or CD44.
9. The method of claim 8, wherein the HAS is selected from HAS1 , HAS2, and HAS3.
10. The method of claim 8, wherein the HAS is HAS2.
1 1 . The method of claim 8, wherein the agent inhibits CD44.
12. The method of claim 8, wherein the agent inhibits the expression or biological activity of HAS or CD44.
32 MBF Ref. No. 028193-9120-WO00
Duke Ref. No. 3676
13. The method of claim 12, wherein the agent comprises an inhibitory RNA molecule or an antibody.
14. The method of claim 12, wherein the expression of both HAS and CD44 are reduced.
15. The method of any of claims 8-14, wherein the myofibroblast invasion is associated with tumor formation or tumor growth.
16. A method of reducing matrix deposition in the lung comprising administering to a subject in need of treatment an effective amount of an agent that inhibits a hyaluron synthase (HAS) or CD44.
17. The method of claim 16, wherein the HAS is selected from HAS1 , HAS2, and HAS3.
18. The method of claim 16, wherein the HAS is HAS2.
19. The method of claim 16, wherein the agent inhibits CD44.
20. The method of claim 16, wherein the agent inhibits the expression or biological activity of HAS or CD44.
21 . The method of claim 20, wherein the agent comprises an inhibitory RNA molecule or an antibody.
22. The method of claim 20, wherein the expression of both HAS and CD44 are reduced.
23. A method of determining the progression of pulmonary fibrosis comprising determining the level of matrix metalloproteinase expression in a cell, and comparing the level of expression to that of a control cell, wherein an increased level of expression relative to the control cell indicates progression of the disease.
24. The method of claim 23, wherein the matrix metalloproteinase comprises MMP-12 or MMP1 a.
33 MBF Ref. No. 028193-9120-WO00
Duke Ref. No. 3676
25. A method of determining the progression of pulmonary fibrosis comprising determining the level of metalloproteinase tissue inhibitor expression in a cell, and comparing the level of expression to that of a control cell, wherein a decreased level of expression relative to the control cell indicates progression of the disease.
26. The method of claim 25, wherein the metalloproteinase tissue inhibitor comprises Timp-3 or ADAMTS1 .
34
PCT/US2012/033246 2011-04-12 2012-04-12 Compositions and methods for the treatment of tissue fibrosis Ceased WO2012142238A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US14/111,338 US10232039B2 (en) 2011-04-12 2012-04-12 Compositions and methods for the treatment of tissue fibrosis

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201161474718P 2011-04-12 2011-04-12
US61/474,718 2011-04-12
US201161486292P 2011-05-15 2011-05-15
US61/486,292 2011-05-15

Publications (2)

Publication Number Publication Date
WO2012142238A2 true WO2012142238A2 (en) 2012-10-18
WO2012142238A3 WO2012142238A3 (en) 2012-12-06

Family

ID=47009958

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2012/033246 Ceased WO2012142238A2 (en) 2011-04-12 2012-04-12 Compositions and methods for the treatment of tissue fibrosis

Country Status (2)

Country Link
US (1) US10232039B2 (en)
WO (1) WO2012142238A2 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150258192A1 (en) * 2014-03-14 2015-09-17 Colleen Brophy Compositions and methods for preventing or treating chronic lung allograft dysfunction (clad) and idiopathic pulmonary fibrosis (ipf)
US10232039B2 (en) 2011-04-12 2019-03-19 Duke University Compositions and methods for the treatment of tissue fibrosis

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3352792B1 (en) * 2015-09-25 2020-08-26 Cedars-Sinai Medical Center Targeting fibroblast invasion for pulmonary fibrosis
US11725056B2 (en) 2017-10-03 2023-08-15 Cedars-Sinai Medical Center Methods for targeting the immune checkpoint PD1 pathway for treating pulmonary fibrosis
JP7300642B2 (en) * 2019-06-14 2023-06-30 国立大学法人浜松医科大学 Prognostic method for idiopathic pulmonary fibrosis
WO2023038416A1 (en) * 2021-09-07 2023-03-16 주식회사 에프엔씨티바이오텍 Csf3r as biomarker and therapeutic target for pulmonary fibrosis

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993012227A1 (en) 1991-12-17 1993-06-24 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
US20030232440A1 (en) * 2002-06-17 2003-12-18 Isis Pharmaceuticals Inc. Antisense modulation of STAT1 expression
AU2004262494B2 (en) * 2003-07-29 2009-01-15 Universitaetsklinikum Muenster Means and methods for treating a disease which is associated with an excess transport of hyaluronan across a lipid bilayer
CA2541438C (en) * 2003-10-10 2013-11-26 Meditech Research Limited The modulation of hyaluronan synthesis and degradation in the treatment of disease
AU2004289265A1 (en) 2003-11-07 2005-05-26 Brigham And Women's Hospital, Inc. Antibodies to CD44 glycoforms and uses thereof
EA200970588A1 (en) * 2006-12-15 2009-12-30 Сентокор Орто Байотек Инк. METHODS AND COMPOSITIONS FOR THE TREATMENT OF PATHOLOGIES ASSOCIATED WITH MEDIATED IL-4 OR IL-13 FIBROSIS
UY30776A1 (en) 2006-12-21 2008-07-03 Medarex Inc CD44 ANTIBODIES
EP2217249A4 (en) * 2007-11-06 2011-10-12 Benaroya Res Inst INHIBITION OF VERSICANE BY ARNS AND OTHER MOLECULES
US9044492B2 (en) * 2011-02-04 2015-06-02 Cellectis Sa Method for modulating the efficiency of double-strand break-induced mutagenesis
US10232039B2 (en) 2011-04-12 2019-03-19 Duke University Compositions and methods for the treatment of tissue fibrosis

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10232039B2 (en) 2011-04-12 2019-03-19 Duke University Compositions and methods for the treatment of tissue fibrosis
US20150258192A1 (en) * 2014-03-14 2015-09-17 Colleen Brophy Compositions and methods for preventing or treating chronic lung allograft dysfunction (clad) and idiopathic pulmonary fibrosis (ipf)

Also Published As

Publication number Publication date
US10232039B2 (en) 2019-03-19
WO2012142238A3 (en) 2012-12-06
US20140050740A1 (en) 2014-02-20

Similar Documents

Publication Publication Date Title
US9982265B2 (en) Inhibition of Bruton&#39;s tyrosine kinase (Btk) in the lung to treat severe lung inflammation and lung injury
US10232039B2 (en) Compositions and methods for the treatment of tissue fibrosis
KR102513989B1 (en) How to treat or prevent liver disease
JP6437946B2 (en) Fibrosis detection and treatment
JP7225115B2 (en) Compositions and methods for treating lysosomal storage diseases and lysosomal storage disorders
JP2025037865A (en) Methods for diagnosing and/or treating acute or chronic liver, kidney or lung diseases - Patents.com
US11136383B2 (en) Methods and compositions for modulaton of transforming growth factor beta-regulated functions
WO2012071648A1 (en) Egfr antagonist for the treatment of heart disease
US11584792B2 (en) Antibody therapies and methods for treating coronavirus infection
WO2009077479A2 (en) Altering high-density lipoprotein levels through carboxylesterase 1 modulation
US20130202619A1 (en) Methods and materials for reducing liver fibrosis
US20140294854A1 (en) Target directed to adipocytes, methods and assays for treatment of obesity
US9709552B2 (en) Use of inhibitors of leukotriene B4 receptor BLT2 for treating asthma
KR20090125837A (en) Use of inhibitors of leukotriene B4 receptor TLT2 for the treatment of asthma
JPWO2008149980A1 (en) Fibrosis inhibitor
JPWO2008111520A1 (en) Longevity-related genes and their uses
US20230017666A1 (en) An ubiquitin ligase inhibitor for use for preventing and/or treating a disease linked with cerebral hypoperfusion
US11331388B1 (en) PTP4A1 as a therapeutic target for fibrotic diseases and disorders including systemic sclerosis
JP6020888B2 (en) Prevention or treatment of epoxyeicosatrienoic acid related diseases
JP2021001165A (en) Prevention and treatment of urolithiasis by oncostatin m receptor signaling control
WO2025155710A1 (en) Methods of treating, ameliorating and/or preventing vascular inflammation and diseases/disorders associated with the same
HK40050902A (en) Methods for diagnosing and/or treating acute or chronic liver, kidney or lung disease
JP2007537167A (en) Regulation of phospholipase C gamma and thereby regulation of pain and nociception

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12771739

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 14111338

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12771739

Country of ref document: EP

Kind code of ref document: A2