WO2012135500A1 - Engineered thioredoxin-like fold proteins - Google Patents

Engineered thioredoxin-like fold proteins Download PDF

Info

Publication number
WO2012135500A1
WO2012135500A1 PCT/US2012/031212 US2012031212W WO2012135500A1 WO 2012135500 A1 WO2012135500 A1 WO 2012135500A1 US 2012031212 W US2012031212 W US 2012031212W WO 2012135500 A1 WO2012135500 A1 WO 2012135500A1
Authority
WO
WIPO (PCT)
Prior art keywords
thioredoxin
engineered
fold
proteins
loop
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2012/031212
Other languages
French (fr)
Inventor
Jia L. Wolfe
Glen S. Cho
Brian Seed
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
General Hospital Corp
Original Assignee
General Hospital Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by General Hospital Corp filed Critical General Hospital Corp
Priority to US14/006,237 priority Critical patent/US9340584B2/en
Publication of WO2012135500A1 publication Critical patent/WO2012135500A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/001Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof by chemical synthesis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1044Preparation or screening of libraries displayed on scaffold proteins
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/35Fusion polypeptide containing a fusion for enhanced stability/folding during expression, e.g. fusions with chaperones or thioredoxin
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor

Definitions

  • the present invention relates to engineered polypeptides comprising a thioredoxin-like fold protein domain with multiple disjoined regions of non-native sequences, methods for their production and for their use in binding or recognizing ligands of interest.
  • the adaptive immune system is a highly evolved, flexible system for the recognition and neutralization of foreign organisms and macromolecules.
  • At the core of adaptive immunity is an engine for the creation of a vast variety of different similar structures that have been diversified by combinatorial assembly of varied building blocks with highly random linker segments.
  • the two principle recognition complexes of the higher vertebrate adaptive immune system, antibodies and the T cell antigen receptor, are similarly assembled, and function through their cognate cell types, B cells and T cells, to produce a coordinated resistance to pathogens.
  • the effector proteins of the B cell arm of the adaptive immune system particularly antibodies of the
  • IgG subtype have many attractive properties as candidate therapeutic agents.
  • IgG antibodies are highly soluble proteins with a long in vivo half -life that have weak immunogenicity within a given species. They often can be selected to have high affinities for their targets and are known to have few intrinsic safety liabilities.
  • As a class IgG antibodies have relatively predictable behavior in vitro and in vivo, and in recent years recombinant antibodies of substantially human sequence have played a major role in therapeutic medicine as universal recognition moieties for a number of targets in different diseases.
  • monospecific antibodies of the IgG subtype provide high specificity, bivalency, fully human composition, and long plasma half-life.
  • the known limitations of antibodies relate largely to their biophysical properties (high molecular weight, multi-domain assemblage, disulfide bonds, glycosylation), which require eukaryotic manufacturing processes that are more complex and more expensive than their prokaryotic counterparts.
  • thioredoxin fold is found in thioredoxin superfamily of proteins that serve a wide variety of functions, including protein disulfide isomerases, DsbAs, the glutaredoxins, glutathione S- transferases, calsequestrins, and glutathione peroxidases and peroxiredoxins (Copley, S.D. et al. Biochemistry, 2004, 43: 13981-13995). These proteins have been shown to interact with many different types of protein substrates, demonstrating the ability of the thioredoxin fold to recognize diverse targets.
  • thioredoxin superfamily Many members of the thioredoxin superfamily share two features in common: they contain a short sequence motif that includes a -CPGC- sequence (the active site) and an overall structure containing this motif that bears the same topology as thioredoxin.
  • Laboratory evolution of the proteins with thioredoxin fold further demonstrates the flexibility of the fold and helps illustrate how various functions can be acquired by individual members that did not possess these functions prior to the imposed selection (Pan, J.L. & Bardwell, J.C., Protein Sci., 2006, 75:2217-2227).
  • substitution of thioredoxin's active site CGPC to DsbA's active site CPHC can result in a protein that functions very similarly to DsbA.
  • Another example of in vitro evolution is the selection of thioredoxin mutants that can compensate for the whole DsbA-DsbB pathway.
  • a mutation from CGPC to CACC in exported versions of thioredoxin
  • AhpC has lost its peroxidase activity while gaining a disulfide reductase activity.
  • some multi-domain thioredoxin super family proteins contain a non-catalytic thioredoxin-like domain that involves in substrate binding (Pedone, E. et al. Cell. Mol. Life Sci., 2010, July 13, Epub ahead of print).
  • human protein disulfide isomerase (PDI) contains two catalytic domains, a and a', and two non-catalytic domains, b and b'. Biochemical studies have established that the b' domain is sufficient for binding small peptide substrates, even though catalytic domains a and a' are also involved in binding of larger protein substrates.
  • the implicated ligand binding site is a small hydrophobic pocket located in a position homologous to that of the active site in the catalytic domains.
  • Thioredoxin (Trx) is the founding member of the thioredoxin superfamily (Martin, J.L. Curr. Biol. ,
  • Trx has anti-apoptotic and anti-inflammatory effects.
  • Trx overexpression has been shown to be effective in a wide variety of animal models for oxidative and inflammatory disorders.
  • An administration of recombinant Trx protein is also effective in animal models for severe acute lung diseases where Trx is likely to act with its anti-inflammatory properties (Nakamura H. et al., Adv. Drug Deliv. Rev. 2009, 6i(4):303-309).
  • Trx is released from cells in response to oxidative stress.
  • Trx is found in circulation and shows anti-chemotactic effects for neutrophils and inhibitory effects against macrophage migration inhibitory factor (MIF). Neovascularization is also suppressed by Trx via inhibition of the complement activation.
  • MIF macrophage migration inhibitory factor
  • Trx is circulating in plasma at the concentrations of 10-30 ng/ml and, in the kidney it is excreted through the glomerulus and mostly reabsorbed by the proximal tubules, such that Trx levels in the urine of healthy volunteers are quite low and usually undetectable.
  • Trx protein When an excess amount of Trx such as lOmg/kg is injected into animals, Trx protein is excreted into the urine as an immunologically intact form, suggesting that this protein is not likely to be metabolized. Tissue deposition of Trx after intravenous injection was limited. Five plasma proteins were identified to interact with recombinant Trx: apolipoprotein A-I, scavenger receptor (cysteine rich domain), fibrinogen (gamma polypeptide), complement factor H, and albumin. Interaction with albumin may be particularly beneficial for prolonged half -life in plasma.
  • the invention features an engineered thioredoxin-like fold protein with at least one of its domains comprising two or more loops being modified through loop-diversification.
  • the invention features a method for preparing an enriched composition of target- binding, loop-diversified engineered thioredoxin-like fold proteins by (i) providing a collection of nucleic acids encoding the loop-diversified engineered thioredoxin-like fold proteins in a display-conducive context, (ii) expressing the collection of nucleic acids in vivo or in vitro to provide a collection of loop-diversified engineered thioredoxin-like fold proteins operably linked to the nucleic acid that encodes them, (iii) contacting the expressed engineered thioredoxin-like fold proteins with a target; (iv) removing expressed engineered thioredoxin-like fold proteins that do not bind to the target; and (v) recovering the engineered thioredoxin-like fold proteins enriched for binding to the target.
  • the invention features another method for preparing an enriched composition of target-binding, loop-diversified engineered thioredoxin-like fold proteins by: (i) providing a collection of nucleic acids encoding the loop-diversified engineered thioredoxin-like fold proteins, (ii) expressing the collection of nucleic acids in vivo or in vitro to provide a collection of loop-diversified engineered thioredoxin-like fold proteins, (iii) contacting the expressed engineered thioredoxin-like fold proteins with a target; and (iv) identifying collections of expressed engineered thioredoxin-like fold proteins that bind to the target.
  • the invention also features a method for identifying individual target-binding, loop-diversified engineered thioredoxin-like fold proteins by: (i) providing a collection of nucleic acids encoding the loop- diversified engineered thioredoxin-like fold proteins, (ii) expressing the collection of nucleic acids in vivo or in vitro to provide a collection of optionally individually indexed, loop-diversified engineered thioredoxin- like fold proteins, (iii) contacting the optionally individually indexed engineered thioredoxin-like fold proteins with a target; and (iv) identifying collections or individual engineered thioredoxin-like fold proteins that bind to the target.
  • the invention features an isolated nucleic acid encoding an engineered thioredoxin-like fold protein or a loop-diversified engineered thioredoxin-like fold protein in an expression- conducive context.
  • Another aspect of the invention features the conjugates of a protein including at least one optionally engineered thioredoxin-like fold protein domain to one or more small molecule drugs or toxins.
  • Still another feature of the invention is a fusion protein between a protein including at least one optionally engineered thioredoxin-like fold protein domain and another protein such as a protein toxin or protoxin, an antibody, and an enzyme.
  • the invention also features a method for chemically modifying and purifying a protein including at least one optionally engineered thioredoxin-like fold protein domain to achieve optimal in vivo
  • pharmacokinetic properties of the protein by: (i) modifying the protein with a single cysteine near the c- terminus that is then modified with polyethelene glycol, and (ii) purifying the modified protein by anion exchange chromatography.
  • Another feature of this invention include modification with polyethelene glycol achieved by: (i) modifying the protein near its c-terminus with a peptide tag that is a substrate of a microbial transglutaminase (e.g., LLQG) or a substrate of a microbial sortase (e.g., LPETG), and (ii) conjugate the protein with amino- modified polyethelene glycol using the corresponding microbial transglutaminase or sortase.
  • a microbial transglutaminase e.g., LLQG
  • a microbial sortase e.g., LPETG
  • the invention also features engineered thioredoxin-like fold proteins as high affinity binding proteins to the selected targets of Tables 2 and 3, and cited in Supplementary Tables S1-S9 of U.S. Provisional Application No. 61/468,836, specifically incorporated herein by reference.
  • One preferred embodiment of the present invention is an engineered thioredoxin-like fold protein comprising an engineered protein domain of the thioredoxin superfamily.
  • a further preferred embodiment is an engineered thioredoxin-like fold protein comprising an engineered human protein domain of the thioredoxin superfamily.
  • Another preferred embodiment is an engineered thioredoxin-like fold protein comprising an engineered protein domain of the thioredoxin family.
  • a further preferred embodiment is an engineered thioredoxin-like fold protein comprising an engineered human protein domain of the thioredoxin family.
  • a still preferred embodiment is an engineered thioredoxin-like fold protein comprising an engineered thioredoxin domain, preferably that of Homo sapiens.
  • the invention features a sample containing a plurality of engineered thioredoxin-like fold proteins (e.g., 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , or more distinct engineered thioredoxin-like fold proteins).
  • a plurality of engineered thioredoxin-like fold proteins e.g., 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , or more distinct engineered thioredoxin-like fold proteins.
  • a further preferred embodiment of the invention features an engineered protein of the thioredoxin super family comprising a multiple loop-diversification within at least one of its thioredoxin-like fold domains.
  • the thioredoxin-like fold protein domain may contain additional point mutations, including mutations at the active site, e.g., - 32 CGPC 35 - to - 32 SGPS 35 - in a thioredoxin molecule.
  • the engineered thioredoxin-like fold protein is an engineered protein of the thioredoxin superfamily
  • the engineered thioredoxin-like fold protein preferably does not contain a peptide insertion at the active site corresponding to -CGPC- or its mutant -SGPS- to afford a protein comprising, e.g., -CG-peptide-PC- or its mutant -SG-peptide-PS-.
  • the engineered thioredoxin-like fold protein binds (e.g., specifically binds) a particular target (e.g., a target listed in Tables S1-S9 of U.S. Provisional
  • branched polyalkylene glycol is meant a branched polymer created by the joining of one or more optionally substituted oligomers or polymers of units of the form -(0-CRiR 2 -CR 3 R 4 ) n -0-R5, where Ri, R 2 , R 3 , R4, and R 5 are the same or different and selected from H, F, or lower alkyl optionally substituted with one or more F; and n is 3 or greater.
  • a branched polyalkylene glycol contains one or more linker structures (branches) of the form A-Y-linker-(XiX 2 ) where and Y may be a bond or a linear polyalkylene glycol and A is a group selected to provide covalent or stable noncovalent linkage to a protein.
  • the term branched polyalkylene glycol includes block or random copolymers of units corresponding to the formula above, wherein the substituents Ri, R 2 , R 3 , R 4 , and R 5 may vary from block to block or from monomer to monomer, for example as in a block or random copolymer of polyethylene and polypropylene glycols.
  • coding sequence is meant the sequence of nucleic acid residues that upon translation give rise to a polypeptide.
  • display is meant any system that permits the enrichment or identification of a target-binding protein by (i) contacting a mixture of target-binding and target-nonbinding proteins each operably linked to a nucleic acid encoding said target-binding or target-nonbinding protein and (ii) separating said target -binding proteins from said target-nonbinding proteins to provide a composition enriched in the target-binding proteins compared to the initial composition.
  • display-conducive context means any form in which a target-binding protein can be expressed such that it is available to both bind to a target and retain an operable linkage or physical relationship (for example, by association with the same host cell, phage, or fusion construct) to a nucleic acid encoding said target-binding protein.
  • engineered protein of the thioredoxin superfamily is meant a protein comprising one or more domains derived from a protein of the thioredoxin superfamily that have been modified by addition, deletion, replacement, or substitution of one or more amino acid residues.
  • engineered thioredoxin-like fold protein is meant a protein comprising one or more domains derived from a thioredoxin-like fold protein that have been modified by addition, deletion, replacement, or substitution of one or more amino acid residues.
  • expressible clone is meant a recombinant nucleic acid construct bearing an open reading frame that can be translated from N-terminus to C-terminus without termination.
  • non-expressible clone is a recombinant nucleic acid construct bearing an open reading frame that contains either frameshift or termination mutations that prevent complete translation of the coding sequence.
  • expression-conducive context is meant the appropriate combination of flanking sequences, vector elements, regulatory sequences, or other nucleic acid sequences empirically determined to support, improve, or regulate the production of a polypeptide chain from the sequence that encodes it.
  • the production of the polypeptide chain can be either in vitro or in vivo.
  • an expression-conducive context for a prokaryotic expression system might comprise an optionally regulated promoter of bacterial or bacteriophage origin, a ribosome binding sequence, the coding sequence of the protein to be expressed, and an optional transcriptional termination sequence.
  • An expression-conducive context for prokaryotic in vitro expression might comprise an RNA or translatable nucleic acid comprising a ribosome binding sequence and the coding sequence of the protein to be expressed, or such expression-conducive context for prokaryotic in vitro expression might comprise a DNA or transcribable nucleic acid encoding such RNA or translatable nucleic acid as well as regulatory sequences permitting the transcription of said DNA or transcribable nucleic acid to afford said RNA or translatable nucleic acid.
  • An expression-conducive context for eukaryotic in vitro expression might comprise an RNA or translatable nucleic acid bearing the coding sequence of the protein to be expressed and optionally bearing 5' and 3' flanking sequences that provide RNA stability or improve the efficiency of translation.
  • extension-diversified as applied to a thioredoxin-like fold protein is meant a thioredoxin-like fold protein wherein at least one terminus, either the N-terminus or the C-terminus, of a beta barrel has been replaced and/or extended with an amino acid sequence of no greater than 30 % (e.g., less than 25%, 20%, 15%, 10%, 5%, 1%, 0.1%, or less) identity to the original sequence.
  • An extension-diversified engineered thioredoxin-fold like protein may have one or both termini extended or modified.
  • individual indexed collection any collection of species constituted as mixtures or not, so composed that the activity of any individual member can be inferred from the analysis of the activities of all mixtures.
  • linear polyalkylene glycol an optionally substituted oligomer or polymer of units of the form A-(0-CRiR 2 -CR 3 R4) n -O-R5, where Ri, R 2 , R3, R 4 ,and R 5 are the same or different and selected from H, F, or lower alkyl optionally substituted with one or more F; A is a group selected to provide covalent or stable noncovalent linkage to a protein; and n is 3 or greater.
  • linear polyalkylene glycol includes linear block or random copolymers of units corresponding to the formula above, wherein the substituents R l 5 R 2 , R 3 , R 4 , and R 5 may vary from block to block or from monomer to monomer.
  • library or “pool” is meant a collection of two or more species constituted as a single mixed entity.
  • a “library” or “pool” includes at least 10 2 , 10 5 , 10 10 , 10 13 , or 10 15 members or some range within these numbers.
  • loop-diversification as applied to a thioredoxin-like fold protein domain or a protein domain of the thioredoxin superfamily is meant a thioredoxin-like fold protein or a protein of the thioredoxin superfamily wherein at least one loop connecting beta strands and alpha helices of the fold has been replaced with an amino acid sequence of no greater than 30 % identity (e.g., less than 25%, 20%, 15%, 10%, 5%, 1%, 0.1 %, or less identity) to the original sequence.
  • multiple loop-diversifications as applied to a thioredoxin-like fold protein domain or a protein domain of the thioredoxin superfamily is meant a thioredoxin-like fold protein or a protein of the thioredoxin superfamily wherein more than one loop connecting beta strands and alpha helices of the fold have been replaced with an amino acid sequence of no greater than 30 % identity (e.g., less than 25%, 20%, 15%, 10%, 5%, 1%, 0.1 %, or less identity) to the original sequence.
  • nucleic acid is meant an optionally substituted deoxyribonucleic acid or ribonucleic acid or homologous polymer of nucleic acid bases or base analogs that can be either copied to provide an image or replica of itself or that can be translated to form a peptide, polypeptide, or protein.
  • operably linked or “operable linkage” is meant a stable, covalent or noncovalent attachment of two or more species so described that is capable of providing a statistical association of the operably linked species sufficiently powerful that the identification or extraction of one element permits the identification or recovery of the other element in at least 10% (e.g., at least 20%, 30%, 40%, 50%, 75%, 90%, 95%, 99%, or more) of attempts.
  • peptide an optionally substituted oligomer or polymer of naturally occurring or unnatural amino acids covalently linked by one or more amide bonds.
  • protein domain of the thioredoxin superfamily is meant a member of the thioredoxin superfamily, a large, diverse group of proteins containing a thioredoxin fold, identified by databases of conserved protein domains, e.g., Pfam, as family cd01659. Many members contain a classic Trx domain with a redox active CXXC motif. They function as protein disulfide oxidoreductases (PDOs), altering the redox state of target proteins via the reversible oxidation of their active site dithiol.
  • PDOs protein disulfide oxidoreductases
  • the PDO members of this family include Trx, protein disulfide isomerase (PDI), tlpA-like, glutaredoxin, NrdH redoxin, and the bacterial Dsb (DsbA, DsbC, DsbG, DsbE, DsbDgamma) protein families.
  • Trx-fold domain include phosducins, peroxiredoxins and glutathione (GSH) peroxidases, SCO proteins, GSH transferases (GST, N-terminal domain), arsenic reductases, Trx-like ferredoxins and calsequestrin, among others.
  • protein domain of the thioredoxin family is meant a thioredoxin fold domain of member of the thioredoxin family identified by Pfam as family cd02947. It is composed of two groups: Group I, which includes proteins that exclusively encode a Trx domain; and Group II, which are composed of fusion proteins of Trx and additional domains.
  • Group I Trx is a small, ancient protein that can alter the redox state of target proteins via the reversible oxidation of an active site dithiol, present in a CXXC motif, partially exposed at the protein's surface. Trx reduces protein disulfide bonds, resulting in a disulfide bond at its active site.
  • Trx reductase is converted to the active form by Trx reductase, using reducing equivalents derived from either NADPH or ferredoxins.
  • Trx regulates the functions of at least 30 target proteins, some of which are enzymes and transcription factors. It also plays an important role in the defense against oxidative stress by directly reducing hydrogen peroxide and certain radicals, and by serving as a reductant for peroxiredoxins.
  • At least two major types of functional Trxs have been reported in most organisms; in eukaryotes, they are located in the cytoplasm and the mitochondria.
  • Trx genes have been detected in the genome of Arabidopsis thaliana
  • types f and m are located in the same compartment, the chloroplast.
  • TRX -like domains which show sequence homology to Trx but do not contain the redox active CXXC motif.
  • Group II proteins in addition to either a redox active Trx or a Trx-like domain, also contain additional domains, which may or may not possess homology to known proteins.
  • protein toxin or protoxin is meant a polypeptide that has the latent (protoxin) or manifest (toxin) ability to inhibit cell growth (cytostasis) or to cause cell death (cytotoxicity).
  • toxins or protoxins include, without limitation, Diphtheria toxin, Pseudomonas exotoxin A, Shiga toxin, and Shiga- like toxin, anthrax toxin PA, pore-forming toxins or protoxins such as Proaerolysin, hemolysins, pneumolysin, Cryl toxins, Vibrio pro-cytolysin, or listeriolysin; Cholera toxin, Clostridium septicum alpha-toxin,
  • Clostridial neurotoxins including tetanus toxin and botulinum toxin; gelonin; nucleic acid modifying agents such as ribonuclease A, human pancreatic ribonuclease, angiogenin, and pierisin-1, apoptosis-inducing enzymes such as caspases, and ribosome -inactivating proteins (RIPs) such as Ricin, Abrin, and Modeccin.
  • a protoxin is a form of toxin precursor that must undergo modification to become an active toxin.
  • Preferable forms of protoxins for the present invention include those that can be activated by a proteolytic cleavage event.
  • small molecule drug or toxin is meant a non-polymer (e.g., non-protein or nucleic acid) compound that exhibits cycotoxicity to mammalian cells.
  • stable noncovalent linkage is meant a noncovalent association that permits the continued proximity of the two or more elements such that after a period of time encompassing the expected duration of use of the two or more associated elements, no more than 50% (e.g., less than 40%, 30%, 25%, 20%, 15%, lo%, 5%, 1%, 0.1%, or less) of the elements have disassociated.
  • a stable noncovalent linkage for a complex intended to persist for 3 hours at 37 °C will have a half -life of at least 3 hours at 37 °C.
  • substitution in the context of an amino acid sequence is taken to mean the chemical or enzymatic modification of one or more amino acid residues of a polypeptide to afford a substituted polypeptide.
  • substitution include attachment of prosthetic groups, polymers, nucleic acids, linkers, small natural or synthetic molecules or fragments thereof, such as modifying radicals, for example methyl or other lower alkyl, formyl, acetyl, or other lower acyl, phosphoryl, or sulfonyl.
  • thioredoxin-like fold protein is meant a protein comprising one or more domains of the thioredoxin-like fold, a three -layer ⁇ / ⁇ / ⁇ sandwich with a central four-stranded ⁇ -sheet flanked by oc-helices on each side, as described in Qi, Y. & Grishin, N.V., Proteins., 2005, 58:376-388.
  • thioredoxin protein is meant a protein comprising one or more domains derived from a thioredoxin protein of the thioredoxin family cd02947; thioredoxin is a single Trx domain protein containing a CXXC motif capable of reducing protein disulfide bonds.
  • Figure 1A is the topological diagram of the thioredoxin-like fold.
  • the lines connecting different oc- helices (cylinders) and ⁇ -strands (arrows) represent loop regions. Dotted loops indicate the termini positions of the four types of circular permutations observed. No termini were observed at solid loop locations.
  • Figures IB-IE are a series three dimensional structures of the indicated proteins with a thioredoxin- like fold.
  • Figure 2 is the structure -based multiple sequence alignment of representative thiredoxin-like protein domains. Sequences are grouped according to 11 evolutionary families. The sequences corresponding to the four structures in Figure 1 are indicated. conserveed residues within each family are highlighted in black.
  • the diagram of secondary structures (oc-helices as cylinders and ⁇ -strands as arrows) is shown above the alignment. The termini of proteins of circular permutations different from that of thioredoxin are shown by a "I".
  • Figure 3 shows the list of protein domain subfamilies of the thioredoxin superfamily (Pfam cd01659) that encompass protein domains containing the thioredoxin-like fold. The list is obtained from NCBI's "Conserved Domains" database.
  • Figure 4 presents a compiled list of the GI numbers of the human proteins comprising a protein domain of the thioredoxin superfamily based on data obtained from the NCBI database.
  • the GI numbers corresponding to proteins associated with US patents are underlined.
  • Figure 5A shows the sequence of human thioredoxin aligned with corresponding secondary structures.
  • Figure 5B is a schematic showing the three dimensional structure of human thoredoxin with all loops specified. Loopl, 1 ⁇ 3, 1 ⁇ 3' , and loop5 are at the same side as the active site.
  • Figure 5C is the schematic showing the three dimensional structure of human thoredoxin (minus the OcO' and ⁇ ' motifs) with all loops specified.
  • Figure 6A shows the mutated human thioredoxin sequence that was used as template for generating the loop diversified protein libraries; mutations are highlighted by underlined amino acids. The loops are indicated by arches across the peptide sequences. The loop-diversification schemes were shown by the arrows pointing between the amino acids (three insertion sites), or an arrow pointing to a shaded stretch of amino acids (the replacement of shaded peptide with random peptide sequences in 1 ⁇ 3').
  • Library TRX-IB was generated using the template with wild type active site CGPC, and the other libraries were generated using the template with mutated SGPS sequence.
  • Figure 6B is the schematic presentation of four loop-diversified libraries.
  • TRX-IB library the insertion in loopl is done at the active site between C 32 G 33 and P 34 C 35.
  • TRX-1A library contains a 6 amino acid insertion between T 30 and W 31 in loopl, 6 amino acids replacing the 5 amino acids in 1 ⁇ 3' , and a 4 amino acid insertion between A 93 and N 94 in loop5.
  • TRX-2 and TRX-3 libraries contain loop-diversifications in loopl and 1 ⁇ 3', as indicated.
  • Figure 7A shows the solubility screen of protein samples from randomly selected in-frame members of TRX-1A and TRX-IB, with wild type thioredoxin (WT) as a reference using PAGE.
  • the expressed proteins were separated into soluble and insoluble fractions after high speed centrifugation.
  • L Protein Ladder
  • P Post Induction
  • S Soluble
  • I Insoluble.
  • Figure 7B is a graph showing the thermostability analysis results of all the clones tested along with the wild type thioredoxin (WT). Protein samples that remained in the supernatant after heat treatment and centrifugation were quantified and the % remained soluble plotted.
  • a clones are the soluble members of TRX-1A
  • the B clone is from TRX-1B
  • C clones are from TRX-2.
  • Figure 8A is the amino acid sequence of a fusion protein containing the extracellular domain (ECD) of CD5, ECD-CD5-SBP-H8, which was used as the target for phage display selections for CD5 binders from loop-diversified library TRX-3.
  • the underlined N-terminus sequence is the signal peptide, and the bold C- terminus sequence comprises the streptavidin binding protein (SBP) sequence and a His8 tag.
  • SBP streptavidin binding protein
  • Figure 8B is a graph showing the phage display selection elution titers after each round of selection from loop-diversified library TRX-3.
  • Figure 9A is a graph showing the sequences of CD5 binders E6, Al, E10, and A5 selected from library TRX-3 and its alignment with wild type thioredoxin and TRX-3 library. Underlined amino acids adjacent to the randomized/selected sequences are shown to indicate the specific locations of the amino acid insertion and/or replacement.
  • Figure 9B is a graph showing ELISA assay results with the selected CD5 binder E6, anti-CD5 scFv, non-CD5 binding control D6, or buffer alone, using CD5-biotin conjugate immobilized to wells of streptavidin plates.
  • Figure 9C is a graph showing cell-based ELISA results. Binding to the surface of CD5 expressing cells and CD19 expressing cells were tested with anti-CD5 scFv, anti-CD19 scFv, TRX-based CD5 binder E6, non-CD5 binding control A2, and buffer alone.
  • Figure 9D is a graph showing ELISA assay results with the selected CD5 binders Al, E10, and A5, anti-CD5 scFv, and non-CD5 binding clones A4 and A6, using CD5-biotin conjugate immobilized to wells of streptavidin plates.
  • Figure 10A is a graph showing FACS analysis results in the selective binding of anti-CD5 antibody (top panel), E6 (bottom panel), as well as an E60-aerolysin fusion protein (middle panel) to CD5+Raji cells, but not to CD5-Raji cells.
  • Figure 10B is a graph showing MTS cytotoxicity assay results of E6-aerolysin (wt) fusion protein on Raji cells and CD5 + Raji cells.
  • the cells were plated at 50,000 cells per well, the fusion protein was pre- treated with furin for 6 hr before applying to the cells. After a 48 hr incubation with the E6-aerolysin fusion, the cells were stained with MTS for 3 hr and percentage of live cells calculated.
  • Figure 11 A is a graph showing thermostability analysis results on CD5 binding E6 protein. The percentages of E6 protein that remained soluble after heating for 30 min. at each temperature are shown.
  • Figure 1 IB is a graph showing thermostability analysis results on E6-aerolysin fusion protein. The percentages of the fusion protein that remained soluble after heating for 30 min. at each temperature are shown.
  • Figure 12A shows the mutated human thioredoxin sequence that was used as template for generating loop diversified protein libraries; mutations are highlighted by underlined amino acids. The loops are indicated by arches across the peptide sequences. For loop diversifications the grey shaded amino acids, 4 in loopl, 4 in loop3, 6 in 1 ⁇ 3', and 4 in loop5, are replaced with random peptide sequences as indicated in Figure 12B.
  • Figure 12B is a schematic presentation of three loop-diversified libraries, TRX-L1 , TRX-L2, and TRX-L3. The differences among them are around loopl, where different numbers/variations of amino acids are used to replace the active site amino acids 32 SGPS 35 . All three libraries contain the same additional loop diversifications in 1 ⁇ 3, 1 ⁇ 3', and loop5, as indicated here and in Figure 12A.
  • Figure 13 shows the EpCAM binding clones selected by phage display using TRX-L1, TRX-L2, and TRX-L3, respectively.
  • the selected sequences are aligned with the template sequence from human thioredoxin.
  • Figure 14 is a graph showing the phage ELISA assay of EpCAM-Fc and BSA (control) binding with phages that display the selected, discrete EpCAM binders from libraries TRX-L1, TRX-L2, TRX-L3.
  • Figure 15A is a graph showing the phage ELISA assay results with phages that display the selected, discrete EpCAM binders from libraries TRX-L1 and TRX-L2.
  • the following proteins were immobilized on wells of nunc plates and reacted with phage: EpCAM-Fc, IgGl-Fc, CD22-Fc, CD5-Fc, hEphA2, mEphA2-Fc, BSA.
  • Bound phage was detected with an anti-M13 pVlll antibody conjugated to HRP.
  • Figure 15B is a graph showing the phage ELISA assays of EpCAM-Fc binding after the phages were heated at indicated temperatures for 10 min.
  • the clones from the TRX-L2 library are more stable than those selected from the TRX-L1 library.
  • Figure 16 shows a summary on phage display selection of mutated TRX proteins from the TRX-3 library for specific binders to various protein targets, including CD38, CD5, CD19, CD22, EpCAM, LGR5, and HSA.
  • CD38, CD5, CD19, CD22, EpCAM, LGR5, and HSA An example of the selected sequences for each target from randomized loopl and 1 ⁇ 3' are shown, demonstrating the large variability of the sequences selected for the divergent protein targets.
  • Figure 17 shows a summary of phage display selection of mutated TRX proteins that bind
  • Figure 18 A is a graph depicting phage ELISA results of phage selected HSA binders listed in Figure 17.
  • the ELISA experiments were performed in triplets on 96-well streptavidin coated plates immobilized with either HSA-biotin or CD5-biotin.
  • the phage display selected clones only showed strong binding to HSA, demonstrating target specificity of these TRX -based binders.
  • Figure 18B shows bar graphs depicting phage ELIS A assay results using human, rat, and mouse serum albumin as target proteins.
  • the ELISA experiments were performed on 96-well streptavidin coated plates, immobilized with HSA-biotin, RSA-biotin, and MSA-biotin, respectively.
  • the selected clones described in Figure 17 were tested and showed Loop3' motif dependent affinity to RSA and MSA.
  • Figure 18C summarizes the ELISA results of the phage selected HSA binders.
  • the binders comprising an F-rich motif in 1 ⁇ 3' are capable of binding to all three different serum albumins.
  • the binders comprising an AGPF motif in 1 ⁇ 3' or a unique 1 ⁇ 3' sequence of VYVSLSRHR only showed significant affinity for HSA, not to RSA or MSA.
  • Figure 19 shows the surface plasmon resonance (SPR) sensorgrams depicting the interactions between HSA and several selected HSA binding mutant TRX proteins (left panel) and their fusion with Renilla Luciferase (right panel).
  • the mutant TRX proteins E2, F3, and H6 (all with F-rich 1 ⁇ 3') showed slightly higher affinity to HSA (sub uMs) than the corresponding N-terminus fusion proteins with Renilla Luciferase RLuc-E2, RLuc-F3, and RLuc-H6 (sub to low uMs).
  • the fusion protein of wild type TRX with RLuc did not exhibit strong binding to HSA.
  • Figure 20A shows the time courses of four RLuc-TRX fusion proteins after intravascular injection into individual mice.
  • the amount of RLuc-E2, RLuc-F3, and RLuc-H6 fusion proteins in plasma decreased significantly slower compared with Rluc-TRX wt .
  • Figure 20B shows the pharmarcokinetic (PK) data obtained from Figure 20A.
  • the relative area under the curve (AUC) suggests that all the HSA binding mutant RLuc-TRX fusions possess superior plasma stability to RLuc-TRX wt .
  • the RLuc-E2 mutant is 8.8-fold more stable than RLuc-TRX wt , demonstrating the capability of E2 to prolong the half-life of the parent fusion protein to that extent.
  • the present invention provides compositions based on thioredoxin-like fold protein domains, described herein as engineered thioredoxin-like fold proteins (ETRXs). These proteins comprise one or more artificially diversified thioredoxin-like fold protein domains; each domain may be originated from the same or different thioredoxin-like fold protein domains. Of particular interest are the ETRXs that have been derived by substitution of two or more loops of a naturally occurring thioredoxin-like fold sequence. These loop-diversified ETRXs may contain additional sequence variations, for example improving affinity, stability, selectivity, or solubility, that have been introduced at any location in the molecule.
  • an ETRX may be optionally substituted with prosthetic groups, polymers, proteins, nucleic acids, carbohydrates, metals, or natural or synthetic small molecules and toxins.
  • 723 protein domains that may be grouped into eleven evolutionary families have been identified to date with a thioredoxin-like fold based on combined sequence, structural, and functional evidence (Qi and Grishin, Proteins, 2005, 58(2):376-88).
  • the protein domains that were unified into the thioredoxin-like fold group represent different circular permutations of the thioredoxin-like motif, which contains six secondary structural elements, i.e., four ⁇ -strands and two oc-helices, compiled into a three -layer ⁇ / ⁇ / ⁇ sandwich (Figure 1A).
  • Amino acid sequences of representatives of the eleven evolutionary families are shown in Figure 2, and the three-dimensional structures of four of these proteins are illustrated in Figures IB-IE.
  • Additional solvent exposed loops including loopl, 1 ⁇ 2, loop4, and loop5, are also highly tolerable to variations in loop length.
  • Many members of the thioredoxin superfamily contain the conserved active-site motif CXXC that is located at the N-terminus of oc-helix cel.
  • a cis-proline residue located at the 1 ⁇ 3' is conserved and is in spatial proximity to the CXXC motif.
  • the length of the sequences corresponding to the CGPC motif of thioredoxin is highly conserved within the ocl oc-helix in all of the thioredoxin-like fold protein domains, implying that any insertion of additional amino acids between the residues aligned with G33 and P34 may not be evolutionarily favored.
  • This information provides an explanation for the observed severe destabilization to the E. coli thioredoxin caused by an insertion of 21 amino acid aptamer eIF4G-SG into its active site (Brown et al. J. Mol. Biol. 2010, 395(4):871-83).
  • the loop diversification of the invention does not include the insertion of a peptide aptamer at this particular location (correspondingly between Gly33 and Pro34 of active site CGPC in thioredoxin) of the thioredoxin-like fold protein domains.
  • ETRX comprising an engineered protein domain of the thioredoxin superfamily.
  • Figure 3 obtained from NCBI's conserveed Domains Database
  • Figure 3 lists the protein subfamilies that belong to the thioredoxin super family (pfam cd01659).
  • a further preferred embodiment is an ETRX derived from a human thioredoxin-like fold domain of the thioredoxin superfamily.
  • Figure 4 shows the GI numbers of the human proteins, grouped in subfamilies, within the thioredoxin superfamily: 121672, 4467837, 13124748, 20810223, 33516901, 1B4Q_A, 6940947, 28193244, 1SJ6_A, 1WRY_A, 6010105, 31418324, 51464459, 1JHB, 5107031, 37537704, 37542493, 1EEM_A, 1GSE_B, 1IYI_D, 1XW5_B, 3LJR_B, 3PGT_B, 1K0N_A, 1XWK_A, 3GTU_D, 5GSS_A, 3GSS_A, 1K3Y_B, 1TDI_A, 1FW1_A, 1LJR_B, 1RK
  • ETRX comprising an engineered protein domain of the thioredoxin family (pfam cd02947).
  • a further preferred embodiment is an ETRX comprising an engineered protein domain of the thioredoxin family from Homo sapiens, including proteins with the following GI numbers: 1AUC, 1ERT, 1GH2_A, 6840947, 20455529, and 33340051.
  • Table 1 shows the selected human thioredoxin fold protein domains from the thioredoxin superfamily that have been disclosed in the list U.S. Patent documents.
  • Random or indexed collections of nucleic acids encoding different sequences can be prepared according to any of several methods known in the art. Such collections can be prepared in ways that favor specific sequences or residues, or disfavor specific sequences or residues, by altering the probability of appearance of specific nucleotides in a site-specific or site -non-specific manner, or by specifying triplets of nucleic acid residues corresponding to individual codons and varying the relative abundance of said triplets in a site-specific or site -non-specific manner.
  • a mix of triplet precursors corresponding to each of the individual amino acids could be prepared, from which the triplets TGT and TGC are excluded.
  • a common strategy is to randomize loops in the form (NNS) n , where n denotes the number of random triplets to be included, N represents any nucleotide, and S represents C or G in the standard IUPAC nucleotide nomenclature. Since two of three stop codons (TGA and TAA) have an A in the third position, an NNS strategy is expected to reduce the frequency of stop codons from 3/64 to 1/32 compared to an NNN strategy.
  • loop-diversified ETRXs may be carried out by any of several different schemes well known in the art.
  • libraries of ETRXs containing loop regions replaced by random peptide sequences of the same or different length can be prepared by recombinant DNA methods.
  • Such libraries can be prepared as variants of a single scaffold having up to six loops diversified in a single ETRX or can be prepared as separate libraries each having one diversified loop per ETRX, or by some combination of loop- diversified libraries, for example having two diversified loops at one end and one at the other.
  • a new library can be created in which that loop sequence is taken as the starting point and further randomization is introduced by partial or complete randomization of the other loops and/or by partial randomization of the predominant loop.
  • the template could be specified to contain at the first position 40% A and 20% of each other residue (C or G or T), at the second position 70% T and 10% of each other residue, and at the third position 75% of G and 25% C.
  • Such a mixture would weight the substituted residues toward hydrophobic amino acids (which often contain a T in the second position), consistent with the hydrophobic character of methionine.
  • the most likely encoded amino acid would be methionine itself.
  • the engineered thioredoxin-like fold proteins of the present invention are useful for the creation of binding proteins that adsorb with high affinity to selected targets.
  • the potential uses of such binding proteins are broad, and include, without limitation, the analytical detection and measurement of molecules or complexes of molecules, the interruption or neutralization of cellular or humoral signaling events via the blockade of enzymes, receptors or ligands, the normalization of homeostatic balance by return of functionality compromised by age, disease, or trauma, the induction of receptor-mediated signaling by receptor agonism, the targeting of undesired cells for destruction, and the localization of binding targets, for example of tumors, microbes, thromboses, or sites of tissue damage.
  • Targets of artificial binding proteins are often proteins or peptides but can also be carbohydrates, lipids, nucleic acids, small molecules such as drugs, metabolites, or toxins, or compositions formed from small molecules or inorganic species such as either natural or synthetic polymers, glasses, metals or alloys, semiconductors or insulators; targets can also comprise modifications or substitutions of proteins, carbohydrates, lipids, or nucleic acids, or combinations of one or more such agents, such as a carbohydrate-substituted proteins, carbohydrate-substituted lipid, RNA- protein complexes, etc.
  • Methods for identifying binding proteins that display high-affinity and high specificity for their targets are known in the art.
  • ETRXs One large set of preferred targets for ETRXs are human plasma proteins.
  • biomedical researchers and clinicians have used plasma to isolate and measure proteins that can be useful for the diagnosis or monitoring of disease.
  • identification of protein biomarkers for the early diagnosis, subtyping, and monitoring of treatment for chronic diseases, including cardiovascular diseases, cancer, arthritis, Alzheimer's disease, pulmonary disease, and autoimmune diseases is now a central focus in clinical proteomics.
  • the Healthy Human Individual's Integrated Plasma Proteome (HIP 2 ) database Saha, S. et al, BMC Med.
  • Genomics 2008, i:12 has so far collected a set of 12,680 unique human plasma proteins using shotgun mass spectrometry analysis, the Swiss-Prot accession numbers of which downloaded from http://bio.informatics.iupui.edu/HIP2/ and is cited in Table SI of U.S. Provisional Application No.
  • a set of further preferred binding targets for ETRXs are Human Proteome Organization (HUPO) Plasma Proteome Project (PPP) core dataset of 3020 plasma proteins (Omenn, G.S., et al, Proteomics, 2005, 5(73):3226-45), which have been described to be comprised of a diverse group of proteins from the human proteome, including glycoproteins, DNA-binding proteins, coagulation pathway, cardiovascular, liver, inflammation, and monocular phagocyte proteins.
  • a list of these 3020 plasma proteins with corresponding Uni-Prot accession numbers is available through BiomarkerDigger Database
  • ETRXs proteins of the main human peripheral blood constituents (Haudek, V.J. et al , J. Proteome Res. 2009, S(S):3834-43).
  • the identified proteins in T cells, monocytes, neutrophils, platelets, erythrocytes and plasma and PBMCs are sorted according to protein names and identified by their Swiss-Prot accession numbers cited in Table S3 of U.S. Provisional
  • Cancer biomarkers found in plasma are preferred targets for ETRXs.
  • the community of biomarker researchers has so far compiled from literature and other sources a list of 4531 proteins believed to represent a population of candidate plasma biomarkers that could be useful in early cancer detection and monitoring given sufficiently sensitive specific assays (Lee, B.T., et al. & Anderson, N.L., Biomark. Insights, 2008, 3:65-71).
  • These preferred targets, annotated with gene names and entrez gene ID numbers are cited in Table S4 of U.S. Provisional Application No. 61/468,836, and specifically incorporated herein by reference.
  • An updated list is downloadable from CLUB ("Candidate List of yoUr Biomarkers"), a freely available, web- based resource (http://club.bii.a-star.edu.sg).
  • Immunome is a term that describes all the genes and proteins taking part in immune responses, and comprises CD (cluster of differentiation) proteins for cell surface molecules, as well as classical and alternative complement system, lectin pathway and the components of the membrane attack complex included together with chemokines, cytokines, and their receptors.
  • CD cluster of differentiation
  • lectin pathway and the components of the membrane attack complex included together with chemokines, cytokines, and their receptors.
  • These preferred targets are cited in Table S5 of U.S. Provisional Application No. 61/468,836, and specifically incorporated herein by reference, which contains 893 gene products with corresponding Swiss-Prot accession numbers and GeneBank ID numbers.
  • An updated list is available from the Immunome Knowledge Base (1KB), a dedicated resource for immunological information
  • ETRXs Another set of preferred targets for ETRXs is the cell-surface proteins in the human immunome. Proteins located at the cell surface of immune cells are of particular relevance due not only to their participation in the network of interactions that regulate the immune response but also to their potential as excellent targets for diagnostic and therapeutic interventions.
  • a comprehensive database of the human cell- surface proteins expressed in immune cells and lymphoid tissues was generated by integrating information collected from primary literature, databases and electronic information sources (Diaz-Ramos, M.C., et al. Immunol. Lett. 2010, published online Nov 2. PMID: 20932860). This manually curated database catalogues 1015 genes and proteins, includes the gene symbol and name of each protein, describes the family that each protein belongs to, indicates their type of extracellular domains, and compiles data regarding their expression. The database is cited in Table S6 of U.S. Provisional Application No. 61/468,836, and specifically incorporated herein by reference.
  • ETRXs Therapeutic targets that have been established by research, development, and clinical applications are also the preferred targets of ETRXs.
  • DrugBank (Wishart, D.S., et al. Nucleic Acids Res. 2008, 36(Database issue):D901-6) is a richly annotated resource that combines detailed drug data with comprehensive drug target and drug action information, in which both FDA-approved small molecule and biotech drugs and experimental drugs are included. These drugs are linked to more than 2500 non-redundant protein or drug target sequences, comprising the "All Drug Targets" list of target proteins cited in Table S7 of U.S. Provisional Application No. 61/468,836, and specifically incorporated herein by reference.
  • the protein targets include approved drug targets, small molecule drug targets, nutraceutical drug targets, experimental drug targets, withdrawn drug targets, biotech drug targets, and illicit drug targets, and are available for download from DrugBank
  • MATADOR Manually Annotated Targets and Drugs Online Resource
  • MATADOR contains 2901 protein targets, which are cited in Table S8 of U.S. Provisional Application No. 61/468,836, and specifically incorporated herein by reference, and included as additional preferred targets of ETRXs.
  • Therapeutic Target Database has been developed to provide information about therapeutic targets and corresponding drugs (Zhu, F., et al. Nucleic Acids Res. 2010, 3S(Database issue):D787-91). This database currently contains 1906 targets, including 358 successful, 251 clinical trial, 43 discontinued and
  • ETRXs 1254 research targets, and 5124 drugs.
  • the protein sequences of these targets are available for download at http ://bidd. nus . edu. s /group/cj ttd/TTD Download. asp, which are cited in Table S9 of U.S. Provisional Application No. 61/468,836, and specifically incorporated herein by reference, and included as further preferred targets of ETRXs.
  • Yet another set of preferred targets for ETRXs are cancer cell surface markers. It has been demonstrated that in many types of cancer, some surface antigens are significantly upregulated in cancerous cells in comparison to normal cells. These differentiated expressions offer opportunities for selective binding of ETRXs to cancer cells for detection or destruction. Listed in Table 2 are some of the examples of these potential targets.
  • Cancer stem cell surface markers are further preferred targets for ETRXs. Cancer stem cells may have direct therapeutic relevance due to resistance to current treatment paradigms, suggesting novel multimodal therapies targeting the cancer stem cells may improve patient outcomes. Listed in Table 3 are examples of protein targets related to cancer stem cells reported in literature to date.
  • epithelial antigen stomach and uterus
  • ETRXs of the present invention can also be used to create novel activities, such as catalytic activity, or substrate activity, based on the incorporation of prosthetic groups or designed or randomly selected sequences that can be installed in the ETRX.
  • ETRXs can be used to generate substrates or inhibitors of proteases, or to provide proximity enrichment for substrates for enzymatic activities.
  • genetic selections or designed modifications that introduce catalytic potential can be incorporated into ETRXs through methods well known in the art, such as selection for affinity to a transition state analog of an intermediate that is found in a reaction to be facilitated by an ETRX.
  • ETRXs can be endowed with a novel surface complementary to a target of interest.
  • random libraries of proteins can be created and screened for rare variants that have desired properties; alternatively, specific variants can be designed by computational analysis of the target binding surface and construction of a series of candidate binding proteins that may have the appropriate behavior.
  • Random substitution schemes can be employed when the detailed molecular structure of the target is not known, or when the most appropriate site on a structurally well-characterized molecule cannot be determined in advance. Most contemporary scaffold diversification strategies are based on random substitution.
  • the invention further provides for mixed computational and random strategies, for example in which random diversification leads to candidates that are further optimized by directed substitution, or the use of computational techniques to predict families of candidates that can be screened for an activity of interest. Construction of libraries and designed variants
  • ETRXs can be prepared in various ways known to those skilled in the art.
  • Disseminated random substitution, clustered substitution, and designed (targeted) alteration are strategies that have been employed to increase the affinity of a given diversified scaffold for a particular target protein.
  • the objective of such diversification is to increase affinity without compromising the overall stability or solubility of the protein.
  • One of the most widely employed strategies is surface randomization, the replacement of endogenous sequences on one particular aspect or face of a protein in order to generate a highly diverse collection of surfaces.
  • Two common subtypes of surface randomization are loop and pocket diversification, used for proteins that are naturally convex or concave respectively. Randomizations may conserve or alter the length if the scaffold is appropriately stable.
  • the natural geometry of the scaffold may be altered by incorporation of structural elements that endow the randomized or grafted sequences with particular folds or shapes.
  • structural elements that may be employed for such purposes are the placement of cysteine residues such that a disulfide -linked loop is formed, the introduction of helix or sheet- destabilizing residues, such as glycine or proline, the incorporation of beta turns or Trp cage motifs, or the formation of additional secondary structure elements, such as short alpha helical or beta strand sequences.
  • the affinity and stability of ETRXs with randomized surface loops can be further improved by the inclusion of mutations in the beta strands that improve rigidity or alter the positioning of the loops.
  • Such favorable noncontact site mutations are well-known in the art and can be discovered by random mutagenesis once an initial candidate has been identified. Typically mutagenesis of the entire ETRX is performed, with selection for variants that exhibit higher binding affinity.
  • the engineered thioredoxin-like fold proteins of the present invention can be further adapted to include extensions/diversifications at their amino or carboxyl termini.
  • the additional diversity may enhance affinity by providing secondary binding sites to the target, or may enhance the functional properties of the protein by binding to proteins with enhanced plasma half -life, or proteins that are known to be enriched in the vicinity of the target, or that afford the possibility of concentration in an organ or tissue-specific manner by binding to organ or tissue-specific secondary targets.
  • measures may have to be employed to protect those elements from naturally occurring exopeptidases, such as the peptidyl peptidases, aminopeptidases, carboxypeptidases, and related enzymes.
  • Methods of predicting and defeating susceptibility to exopeptidases are well known in the art.
  • Methods of blocking exopeptidase activity include amino and carboxyl-terminal modification, incorporation of additional residues that are not substrates for the exopeptidases, or chemical modifications that destroy susceptibility.
  • a screening method typically requires two elements: a supply of candidate ETRXs to be tested for affinity to the target; and a systematic method for the enumeration of the candidates, such as an ordered array or systematically composed mixture that can be convoluted to reveal the identity of the most active variants. Screening methods often require that large numbers of ETRXs be evaluated; in such cases it is common to use pooling schemes to mix candidates, allowing the presence or absence of a desired candidate to be determined with fewer measurements. Active pools are further subdivided to identify active unique species. Candidates derived from such screens can be subjected to further randomization and screening to progressively derive ETRXs of higher binding affinity.
  • Selection methods typically require a library of candidate ETRXs, each prepared in a form that provides a genetic linkage between the protein and a nucleic acid that encodes or identifies the protein.
  • a mechanism must be provided to physically isolate and purify candidate binding proteins and their associated nucleic acids from the remaining library members that lack activity. In selection methods many fewer measurements are typically performed than in screening methods.
  • the present invention further provides methods for the identification of ETRXs having favorable affinity, selectivity, solubility, and thermal stability.
  • Numerous selection methods for the enrichment of nucleic acids encoding proteins of interest that bind to a specific target are known in the art and are useful for the generation of the desired ETRXs.
  • display technologies including phage display, yeast display, bacterial display, viral display, mammalian cell display, ribosome display, RNA display, and DNA display.
  • display technologies including phage display, yeast display, bacterial display, viral display, mammalian cell display, ribosome display, RNA display, and DNA display.
  • an appropriate vector must be provided that is suitable for the display of the ETRX in the context in which selection is to take place.
  • a plasmid encoding a translational fusion between a solvent-exposed phage structural protein and the ETRX must be created.
  • cellular display such as bacterial, yeast or mammalian cell display
  • a fusion or stable association is created between a surface protein and the ETRX.
  • ribosome or mRNA display a fusion or stable association must be created between the diversified binding protein and the mRNA that encodes it.
  • DNA display a fusion or stable association must be created between the ETRX and a high affinity, typically site-selective, DNA -binding protein.
  • physical association of the binding protein and the nucleic acid that encodes it is provided by physical compartmentalization.
  • physical association is provided by the compartmentalization afforded by the non-aqueous phase that separates the individual droplets.
  • Display-based selections consist of one or more cycles of enrichment, each of which comprises: (i) contacting the target of interest with a mixture of diversified proteins in display context, e.g. as phage particles, cells, or RNA fusions; (ii) physically separating those phage particles, cells or RNA fusions that bind the target from those that do not bind the target, or bind less avidly, and (iii) amplifying the resulting isolated binding population by in vivo or in vitro methods to generate a new, enriched collection of diversified proteins that can be subjected to additional rounds of contact and purification.
  • the target permit physical isolation of the complex of target and ETRX.
  • the target may be labeled with an antibody domain, peptide tag, fluorophore, biotin, or other affinity or labeling moiety, allowing the complex of ETRX and target to be physically separated from ETRXs that do not interact with the target.
  • antibodies or binding reagents specific for the target can be employed to effect separation. Often it is necessary to exclude unwanted ETRXs, for example those that bind to extraneous portions of the target, or to components of the apparatus used to effect physical separation.
  • Common separation strategies rely upon an affinity matrix for the antibody domain, peptide tag, biotin, epitope or affinity moiety, such as a bead or magnetic particle bearing the cognate binding element for such antibody domain, tag, biotin, epitope, or affinity moiety.
  • binding elements include protein A, streptavidin, monoclonal or polyclonal antibodies, and coordinated transition metal divalent cations.
  • separations based on fluorescence detection and sorting can be used.
  • Such separations typically distinguish the signal conveyed by a fluorescent moiety or fluorophore attached to the target, and permit the identification and selective separation of cells or particles bearing high concentrations of the target by fluorescence-activated cell sorting.
  • the contributions of undesired ETRXs can be reduced by pre-absorption steps that mimic target exposure and enrichment, but are conducted in the absence of target. Affinity
  • Selections or screens for ETRXs having the desired binding can be carried out by the methods described above followed by methods to identify candidate ETRXs of particular interest according to their affinity, activity, selectivity, solubility, or thermostability.
  • Many methods for the measurement of affinity are known in the art and include solid phase as well as solution phase measurements of association constant or reaction on and off rates for combination of the ETRX with a target, or for the measurement of the catalytic activity of a catalytic ETRX. From the analysis of such equilibrium or kinetic constants the affinity of the ETRX for its target can be measured.
  • Some methods of measuring affinity include, solid phase assays, such as planar or bead format assays, solution phase assays, or cell-based assays.
  • Detection in such assays can be based on the analysis of changes in a signal generated by a detectably labeled target or ETRX, such as a radiolabeled target or ETRX, targets/ETRXs conjugated to or associated with an enzymatic activity or a fluorophore/fluorescent protein, or an active prosthetic group that behaves as a catalyst for a reaction or a change in property that is easily monitored.
  • a detectably labeled target or ETRX such as a radiolabeled target or ETRX, targets/ETRXs conjugated to or associated with an enzymatic activity or a fluorophore/fluorescent protein, or an active prosthetic group that behaves as a catalyst for a reaction or a change in property that is easily monitored.
  • Common methods for measuring affinity include radiolabel or enzyme-linked immunosorbent assays, or assays based on surface plasmon resonance, fluorescence resonance, fluorescence polarization, or fluorescence autocorrelation
  • a common form of affinity measurement is one in which target is immobilized on the solid phase, and varying concentrations of a solution containing a detectable form of the ETRX is contacted with the immobilized target to measure the amount of ETRX bound as a function of ETRX concentration.
  • ETRX For therapeutic purposes it is often useful to determine the activity of a particular ETRX for its proposed utility. For example, if the ETRX is to exert a therapeutic action by inhibiting the binding of an enzyme to its substrate or a ligand to its receptor, candidate ETRXs with affinity for the enzyme, ligand or receptor can be tested for their ability to inhibit 'the functional association that should be compromised for the desired effect.
  • a bioassay is often used to determine the activity of a candidate ETRX, in which a cellular process or an in vivo response is measured in the presence or absence of progressively greater amounts of the ETRX of interest. Selectivity
  • ETRXs according to the present invention may bind to single members of families of targets, or multiple members of families of targets, to achieve the desired therapeutic, analytical, manufacturing, or research utility.
  • the neutralization of biological activity for therapeutic purposes may optimally require the antagonism of more than one target, or the quantitation of such biological activity for analytical purposes may require the recognition of more than one target, or the purification of some targets of interest may require the recognition of families of related molecules.
  • the selectivity of candidate ETRXs can be manipulated during selection or screening by including competitor targets for which binding affinity is either desired or not desired. For example, to create a highly selective ETRX that recognizes one member of a multimember family of targets, such as family of closely related proteins, a preselection can be made with the undesired targets, discarding the so-selected ETRXs, followed by a selection with the desired target. Or the activity of the ETRX identified by selection or screening methods can be assessed by comparing the binding affinity to the desired target with that of unrelated targets or related targets for which affinity is either desired or not desired. Such screening methods need not provide precise information, but for convenience may convey simple approximate measures of relative affinity, for example based on signal strength in an assay format similar to that of an enzyme linked immunosorbent assay (ELISA).
  • ELISA enzyme linked immunosorbent assay
  • Candidate ETRXs of the present invention that have been identified by selection or screening can be further evaluated and modified if necessary for additional properties that are required for the field of use. For example, for the manufacturing of ETRXs intended for most uses, a candidate ETRX can be highly soluble and thermostable. Methods are provided by the present invention for the evaluation of the solubility and thermostability of ETRXs as well as their suitability for expression in properly folded form in E. coli. In general methods for the evaluation of thermostability are well known in the art, and consist of thermal stress testing or extended storage testing at defined temperatures, followed by measurement of binding activity.
  • thermostability can be as simple as the measurement of the fraction of ETRX remaining soluble following incubation of the ETRX for a defined time at a particular temperature.
  • Another suitable method for measuring thermostability is differential scanning calorimetry.
  • Methods for the indirect assessment of folded status of proteins in E. coli are also known in the art, and in the present invention comprise fusion of the candidate ETRX to an easily monitored protein whose activity is only apparent in its properly folded form, such as GFP or an antibiotic resistance. The relative degree of folding has been found by others to be a property shared by both domains of a fusion protein in E.
  • compositions of nucleic acids and polypeptides, as well as substituted nucleic acids and substituted polypeptides, are included in the present invention.
  • Substituted ETRXs according to the present invention can be created by site-specific targeting methods that are either chemical or enzymatic in nature. Substitution may be provided either in vivo or in vitro, and can endow the nucleic acid or polypeptide with additional features useful for selection, purification, or therapeutic, analytical, manufacturing or research utility.
  • substitutions that are frequently encountered in the art include prosthetic groups, such as biotin and lipoic acid, N-terminal modifications such as various amides and cyclic amides, alkylations of cysteine or selenocysteine residues, replacement of natural with unnatural amino acids, as for example may be practiced by proteolytic resection and replacement, the formation of isopeptide bonds such as are formed between glutamine and lysine residues, polymer substituents, such as polyalkylene glycols of varying lengths and/or branch structures, small organic molecule substituents, including receptor or ligand binding molecules or their fragments, and various other peptide or nonpeptide adducts that may be attached to the ETRX for a particular utility.
  • prosthetic groups such as biotin and lipoic acid
  • N-terminal modifications such as various amides and cyclic amides, alkylations of cysteine or selenocysteine residues
  • replacement of natural with unnatural amino acids as
  • substitutions may aid in the detection, purification, or localization of the ETRXs and may confer favorable properties by virtue of such localization.
  • substituted ETRXs may bind to plasma or cell surface proteins to extend the half-life of the substituted ETRX, or may be concentrated on the surface of particular cells, or in certain organs or tissues, by virtue of their affinity for cell-, organ- or tissue- selective secondary targets, such as receptors, carbohydrates, lipids or combinations of such secondary targets as may be presented by the organism to be treated or exposed to the
  • the engineered thioredoxin-like fold proteins of the present invention may be delivered as pure proteins or may be generated in situ, for example following delivery by a gene targeting or genetic therapy that may involve the in vitro or in vivo modification of the genetic complement of an existing cell to produce the polypeptides of the present invention.
  • Engineered thioredoxin-like fold proteins may be modified to extend their plasma half-life, for example by modification with polyethylene glycols, by translational fusion or post-translational crosslinking to naturally occurring plasma proteins having extended half -life or by a combination of such methods.
  • Suitable naturally occurring plasma proteins having extended half -life include antibodies, albumin, apolipoproteins, serpins and some constituents of the complement and coagulation cascades.
  • translational fusion to human antibody Fc domains, particularly human lgGl Fc domain has been a widely used to improve plasma persistence of proteins.
  • ETRXs may also be endowed with extended half-life by dimerization or multimerization to produce polypeptides that are too large to be naturally subject to renal filtration.
  • Suitable methods for dimerization or multimerization include disulfide bond formation, translational fusion, and chemical or enzymatic crosslinking that is either site-selective or site-nonselective.
  • Such flexible linkers may consist of a plurality of glycine residues in combination with chiral amino acids that provide favorable aqueous solubility, such as the charged or uncharged hydrophilic amino acids aspartic acid, glutamic acid, arginine, histidine lysine, serine, threonine, tyrosine, asparagine, or glutamine.
  • Flexible linkers need not be confined to glycine and hydrophilic residues so long as the linker so constructed does not confer otherwise unfavorable biophysical properties on the ETRX, such as poor solubility, instability to aggregation, or susceptibility to proteolysis.
  • antibodies against ETRXs of the present invention can be minimized by the attachment of polymers, such as polyethylene glycols of varying size, branching morphology and attachment groups, to the core of the thioredoxin-like fold, their N terminal or C terminal extensions, or their prosthetic groups, using either site-selective or site-nonselective methods.
  • polymers such as polyethylene glycols of varying size, branching morphology and attachment groups
  • the engineered thioredoxin-like fold proteins of the present invention can be used as targeting principles to deliver other therapeutic or analytical elements to an organism in need of therapy or diagnosis.
  • they may be attached to highly active cytostatic or cytotoxic agents to effect the growth arrest or elimination of an undesired cell type, such as a neoplastic or pre -neoplastic cell, or for the reduction in mass of a hypertrophic tissue or organ such as a hypertrophic prostate, or for the elimination of populations of immune cells that are undesired, for example those promoting or causing autoimmune syndromes.
  • cytostatic or cytotoxic agents may be synthetic or natural small molecules, for example, maytansine and its derivatives, anthraquinones, alkylating agents such as cyclophosphamide or its prodrug forms, tubulin- binding agents, geldanamycin or its derivatives, or enediyne antibiotics such as calicheamycin, among others.
  • the cytostatic or cytotoxic agents may also be proteinaceous toxins or combinations of small molecules and proteinaceous toxins.
  • Proteinaceous toxins that may be employed for the purposes of cytostatic or cytotoxic therapies include bacterial toxins, members of which can be drawn from the 339 or more species or families that have been identified to date, including their natural variants, serotypes, isoforms, and allelic forms from both Gram-positive and Gram-negative bacteria (Alouf and Popoff, Eds. "The Comprehensive Sourcebook of Bacterial Protein Toxins, 3rd Ed.” Academic Press. 2006).
  • Exemplary bacterial toxins widely used for selective ablation of target cells or tissues include diphtheria toxin, Pseudomonas exotoxin A, anthrax lethal factor, and aerolysin.
  • Immunogenicity of recombinant therapeutic proteins is a safety concern that may be particularly important to consider for recombinant proteins derived from Trx due to its critical functions in biological systems.
  • any anti-drug antibodies generated by the host against engineered Trx are most likely targeted to the epitopes that are located within the solvent exposed loops of the Trx scaffold.
  • the loop surrounding its enzymatic active site 32 CGPC 35 is the most critical for the biological functions of Trx.
  • This active loop, along with a second solvent exposed loop can be mutated and randomized for binder selections in the present invention. Any host generated antibodies against the mutant Trx molecules will only recognize the epitopes located outside the active site of Trx, thus should spare the active site of endogenous Trx. Consequently it is unlikely for anti-drug antibodies against an engineered Trx to cause severe biological consequences stemming from autoimmunity against native Trx.
  • Dimeric or higher multimeric ETRXs can be used to juxtapose cells or induce cellular actions by receptor crosslinking that may have a favorable therapeutic effect.
  • therapeutic strategies aimed at amplifying the cytotoxic action of macrophages, natural killer cells, or cytotoxic T cells have been described which rely upon the use of bispecific antibodies or related compositions.
  • bispecific antibodies typically provide one antibody combining site that recognizes a target on the cell type to be ablated, and a second antibody combining site that recognizes a cell surface receptor on macrophages, natural killer cells, or T cells that, if engaged, induces the cytolytic effector program of those cells, leading to destruction of the target.
  • bispecific antibodies promote the selective disabling of responses by mast cells or B cells by producing crosslinks between activating receptors, such as the high affinity receptor for IgE on mast cells or the immunoglobulin receptor on B cells, and inactivating receptors, such as the inhibitory receptor for immunoglobulin FcyRIIB, also found on mast cells and B cells.
  • activating receptors such as the high affinity receptor for IgE on mast cells or the immunoglobulin receptor on B cells
  • inactivating receptors such as the inhibitory receptor for immunoglobulin FcyRIIB
  • the coordination of the activating receptor and the inhibitory receptor frustrates the signals emanating from the activating receptor, resulting in a favorable therapeutic effect.
  • Similar bispecific compositions can be provided by the ETRXs of the present invention, which can be joined by a variety of methods to provide bi- or multi-specific binding principles for therapeutic treatments.
  • ETRXs of the invention may be used to target prodrug activating enzymes to cells, tissues or organs that are desired to be made subject to the action of the drug of interest.
  • Such uses of ETRXs follow closely the uses of antibodies in antibody directed enzyme prodrug therapies, which rely upon antibodies for the targeting of a prodrug metabolizing moiety which converts a circulating prodrug to an active form.
  • Such local activation schemes have been developed to allow a more specific delivery of highly toxic chemotherapeutic agents to the vicinity of a neoplastic cell in vivo.
  • Engineered thioredoxin-like fold proteins can also be used to deliver bioactive principles to a cell, organ, or tissue that is desired to be targeted.
  • an ETRX can be used to convey an antagonist of that pathway to a specific tissue, by (as in the example cited) binding to a liver-specific cell surface protein.
  • a bioactive principle delivered by the ETRX can be attached to the ETRX by translational fusion or by chemical or enzymatic modification in a site-selective or site-nonselective manner. Diagnostic uses
  • ETRXs of the present invention can be used as antibody equivalents for many assay purposes.
  • ETRXs can serve as the capture or detection reagent for ELISA-type assays or as the detection reagent for ELlSpot assays or for the enumeration of protein abundance by flow cytometric measurement technologies.
  • ETRXs can be conjugated to fluorophores, fluorescent proteins or enzymes to aid in the detection and/or quantitation of analytes of interest.
  • Translational fusions of ETRXs to enzymes or other proteins that aid in the detection of analytes can be made and the resulting fusions can be expressed in prokaryotic or eukaryotic cells to provide a convenient renewable source of reagent.
  • thermostability properties of ETRXs allow their use in arrays of analyte detector, for example in the planar format of protein binding arrays, or in the bead format of multiplexed fluorophore ratio indexed bead systems, such as the Luminex system.
  • Detection of analyte binding with an ETRX can follow many of the assay format designs and detection schemes that have been disclosed for high sensitivity and selectivity detection by antibodies, such as light scattering, light surface plasmon scattering, fluorescence polarization, time resolved fluorescence, fluorescence autocorrelation, electroluminescence, chemiluminescence, fluorescence resonant energy transfer, fluorescence quenching or unmasking, coagulation or flocculation of beads, cells or other particles, or by providing nucleic acid or modified nucleic acid tags for detection by amplification methods including polymerase chain reaction, ligation-mediated probe amplification, branched nucleic acid assay, or isothermal amplification, with or without a ligation step; or by conveying enzymatic activities detectable by absorbance, fluorescence, evanescent field or surface potential perturbation.
  • Monospecific or multispecific ETRXs can be prepared to identify unique analytes or families of analytes. In addition
  • Labeled ETRXs can be used to image diseased cells, tissues or organs, either in vivo or in vitro.
  • ETRXs can be conjugated to radionuclides, or to prosthetic groups incorporating or binding to other molecules comprising radionuclides. Common radionuclides used in imaging include F-18, 1-131, 1-123, Tc-99m, In-111 or Ga-67. Alternatively ETRXs can be conjugated to groups enclosing caged
  • hyperpolarized xenon or can be joined or attached to beads, nanoparticles or nanocrystals susceptible to detection by magnetic resonance imaging.
  • Radionuclides can be detected by nuclear scintigraphy using equipment and methodology well known in the art, such as gamma cameras and positron emission tomography.
  • images obtained by one modality, such as magnetic resonance imaging can be superimposed on images obtained by other modalities, such as nuclear scintigraphy, or two or more radionuclides of different spectral properties can be combined with different ETRXs, to permit better localization of images and more precise staging or diagnosis of disease conditions.
  • ETRXs include the in vivo imaging of tumors, infections, regions of ischemic damage or poor perfusion, clots, bone or eroded bone, sites of inflammation or degeneration, accumulations of amyloids, paraproteins or prion proteins, or to interrogate the status of prosthetic devices and/or their interfaces with normal or diseased tissue.
  • ETRXs labeled with enzymes, fluorophores, fluorescent proteins, ferritin, gold or silver particles, or electron dense beads can be used in conjunction with microscopic or ultramicroscopic techniques to diagnose pathological conditions or to identify, enumerate or quantitate the burden of relevant targets that signify the disease status of the cells, tissues, organs or organisms being studied.
  • the imaging of tissues using labeled or conjugated ETRXs can be used to guide diagnostic or therapeutic procedures, such as biopsies, resections, radioablations, radiotherapy, or locally delivered chemotherapy.
  • thermostability and solubility properties of the ETRXs of the present invention also permit their use as adsorption reagents for the purification of proteins and complex biological structures, such as vaccine components.
  • the positive manufacturing economies of prokaryotic production allow ETRXs to be used in settings for which the routine use of antibody reagents or materials would be considered prohibitively expensive.
  • an ETRX having the desired selectivity, solubility, thermostability, and affinity for a target will be prepared in a form that allows its constitution into an adsorbent, which may comprise a column medium, bead, or coated surface to which a target stream is to be exposed.
  • an adsorbent which may comprise a column medium, bead, or coated surface to which a target stream is to be exposed.
  • the nonbound material will be removed by one or more washing steps and the desired target material will be eluted, typically by raising or lowering the pH, as is common in the elution of antibody-based affinity supports.
  • hydrophilic matrices that are used as supports for such affinity media are well known in the art and includes various, typically porous and crosslinked, polymers, such as crosslinked agaroses, dextrans, acrylamides, hydrophilic acrylates, or inorganic matrices such as controlled pore glass, or nonporous but fine particles such as magnetic beads, and functionalized or surface passivated silica or cellulose particles.
  • ETRXs can be attached to such media by methods such as electrophilic attack by aldehydes, oxiranes, activated carbonates, iminocarbonates, cyanate esters, haloacetamides, maleimides, or activated esters, including carbodiimide activated carboxylic acids.
  • ETRX can be engineered by the incorporation of specific residues or sequences that favor the attachment of the ETRX to the media in an ETRX site-selective manner.
  • the incorporation of cysteine or selenocysteine residues, or substrate sequences for transglutaminases or sortases can be used to provide specific sites at which the ETRX can be linked to a solid support.
  • ETRXs include the replacement of antibodies for detection and quantitation of analytes in various contexts, for example in immunoblotting, ELISA, ELISpot, flow cytometry, bead-based coagulation or detection systems, for detection of analytes by light scattering, surface plasmon scattering, chemiluminescent or electroluminescent detection, by fluorescence polarization, time- resolved fluorescence, fluorescence autocorrelation, fluorescence resonant energy transfer, or fluorescence quenching or unmasking.
  • ETRXs can be conjugated with various fluorophores or fluorescent proteins to provide probes for the presence or absence of analytes.
  • the analytes may include proteins, carbohydrates, nucleic acids, lipids, small molecules of natural, synthetic or semisynthetic origin, as well as polymers, glasses, metals and alloys, or combinations of these.
  • ETRXs can be conjugated to enzymes, proteins, nucleic acids, carbohydrates, lipids, polymers, small molecules of natural, synthetic or semisynthetic origin, to provide an analyte detection method or additional functionality, or can be endowed with additional substituents having utility for detection or amplification of signal, such as by providing covalent or stable noncovalent attachment of nucleic acid or modified nucleic acid tags for detection by amplification methods including polymerase chain reaction, ligation-mediated probe amplification, branched nucleic acid assay, or isothermal amplification, with or without a ligation step.
  • ETRXs can be adsorbed on solid surfaces, such as plates, trays, capillaries, fabrics, flexible or rigid sheets, beads, or particles, all of which may provide either surfaces for
  • ETRXsubstituted surfaces may be used to provide either capture reagents, or in the case of bead or particulate adsorbed material, detection reagents.
  • Examples of uses of labeled ETRXs include, without limitation, microscopy, ultramicroscopy, flow cytometry, flow microscopy, immunoblotting, immunoprecipitation, spectroscopy, or in vivo imaging.
  • TRX- IB was made with the same set of oligonucleotides except with MS003 replacing of MS002.
  • TRX-2 library was made with MS009 replacing MS006.
  • thioredoxin as a scaffold to display peptide aptamers at the active site - 32 CGPC 35 -.
  • One rationale was that the disulfide bond formed between the cysteine residues can provide added stability to the core structure of thioredoxin scaffold.
  • our analysis of evolutionary history of the thioredoxin-like fold suggests that peptide insertion at this location may not be well tolerated. Indeed, published studies have shown that specific peptide insertions at the active site between Gly33 and Pro34 can destabilize the thioredoxin structure severely, generating mutants with much reduced
  • thermostability Also based on sequence alignment of proteins with thioredoxin-like fold ( Figure 2), peptide insertions in loopl, N-terminus to the active site -CGPC- may be highly tolerable by the thioredoxin scaffold.
  • TRX-1 A and TRX-IB were examined to provide information on how the human thioredoxin would tolerate peptide insertions at the active site within the constraint of the disulfide bond between C32 and C35, as compared to a similar insertion within nearby loopl.
  • TRX-2 library is designed so that the suitability of loop5 as a peptide insertion site may be examined in comparison with TRX-1 A.
  • TRX-2 contains the same
  • TRX-1 A, TRX-IB, and TRX-2 cloned into pET28 randomly selected sequences that were in frame and had no stop codons were transformed into BL21 cells and then expressed at 37°C for 4 hours. Expressed bacterial pellets were spun down from 25 mL of culture and lysed using sonication and then separated into soluble and insoluble fractions after high speed centrifugation. Equal proportions of these fractions were analyzed by PAGE and those sequences having the protein in the soluble fraction determined. For those clones that yielded soluble proteins, the proteins were purified using the in frame-His tag from the pET28 vecor on Ni-NTA agarose (Qiagen).
  • the protein was eluted using 200 mM imidazole and then dialyzed in TBS.
  • the protein was diluted to 20 ⁇ and then subjected to 10 min at different temperatures: 50 °C, 60 °C, 70 °C, 80 °C, and 90 °C.
  • the protein was centrifuged at high speeds to separate precipitated and soluble proteins.
  • the supernatant was then analyzed using PAGE and the amount of soluble protein remaining was quantified using Krypton infrared stain (Pierce) and an Odyssey infrared scanner (LI-COR Biosciences).
  • a protein is considered stable if more than 70% of the original amount of protein remains in the supernatant after heat treatment.
  • TRX-IB 5 1 (20%) 1 0 (0%)
  • TRX-3 was created using a slightly different strategy in order to maintain loop diversity.
  • a primer extension reaction was performed for 10 cycles with MS041 and MS042 to create a fragment encoding a randomized loop 1.
  • a second primer extension using MS043 and MS044 was performed to create a fragment encoding a randomized Loop 3' .
  • These two fragments were mixed together to join the two loops in a primer extension reaction.
  • the resultant combined fragment was gel purified and the diversity was calculated from the yield which came out to be 5.6 x 10 12 molecules.
  • This fragment was amplified using PCR with primers MS040 and MS010 to create multiple copies of the library.
  • mRNA display Cho, G. et al., J. Mol. Biol, 2000, 297(2):309-l9.
  • the TRX-3 library was amplified by PCR using primers MS031 and MS032 in order to perform mRNA display enrichment.
  • the 5' primer contains the T7 RNA polymerase promoter as well as a portion of the TMV translational enhancer.
  • the 3' primer contains a poly- A sequence as well as a binding site for an oligo for UV induced psoralen crosslinking in order to covalently attach puromycin to the 3' end of the mRNA.
  • the puromycin crosslinking oligo is 5' Pso u age gga ugc XXX XXX CC Pu 3' , where Pso: C6-Psoralen; u, a, g, c are made from 2'OMe-RNA amidites; C: standard amidities; X: Spacer 9; Pu: Puromycin-CPG (Glen Research).
  • a 2 mL in vitro translation reaction was performed using 0.5 ⁇ crosslinked RNA concentration.
  • the protein-RNA fusions were purified using oligo-dT cellulose, and then reverse transcribed using MS032 as a reverse primer and superscript III (Invitrogen).
  • RNA -protein fusions were then enriched for open reading frames by binding to M2-anti-FLAG agarose (Sigma) and subsequent elution by free FLAG peptide. Those RNA sequences with frameshifts and stop codons cannot form RNA-protein fusions due to early termination, and therefore will not be enriched during the FLAG selection.
  • the diversity is calculated to be 2.5 x 10 11 unique clones based on the recovery from the FLAG column, the pool was subsequently PCR amplified using MS031 and MS032. Multiple copies of the library were made using PCR amplification with MS033 and MS044.
  • a unique asymmetric restriction site (BslI, NEB) was used to digest the amplified library into fragments containing each of the two randomized loops. These loops were then randomly recombined together using T4 DNA ligase (NEB) to regenerate the library diversity of 1 x 10 13 .
  • Phage libraries were constructed according to the procedure by a previously described procedure (Tonikian, R. et al., 2007, Nature protocols, 1368-1386).
  • Our library was fused to the C-terminal domain of gene III from Ml 3 phage in a phagemid vector derived from pUCl 19.
  • the library is preceded by an SRP signal sequence from DsbA.
  • SRP signal sequence from DsbA.
  • oligonucleotides instead of using degenerate oligonucleotides to anneal to the single stranded phagemid template, we used a long single stranded primer that spanned the entire thioredoxin gene that was generated from a primer extension reaction from the mRNA display pre-selected library, TRX-3 ( Figure 4).
  • single stranded primers were generated by repeated cycles of primer extension using a phosphorylated primer gc517.
  • the double stranded DNA (cccDNA) synthesis reaction with T7 DNA polymerase and T4 DNA ligase (NEB) was performed using 20 ⁇ g of single stranded phagemid DNA and a 3 -fold molar equivalent of the long single stranded primer.
  • the single stranded template molecule for the Kunkel reaction encodes the thioredoxin gene with stop codons in the two loop regions where the randomization was introduced.
  • the library was purified on a PCR purification column (Qiagen) and then electroporated into MC1061 F' variant or TGI competent cells and then amplified using M13K07 helper phage (NEB).
  • the total diversity of the library was calculated based on total number of unique clones. This process was repeated three times, and the combined library was estimated possess a total diversity of 9 x 10 9 .
  • Table 6 Primer sequences used for construction of phage library TRX-3.
  • the extracellular domain for the CD5 receptor (ECD-CD5) was fused to a tag sequence with a streptavidin binding protein sequence (SBP) ( Figure 8A) (Keefe, A.D. et al , 2001, Protein Expr. Purif., (23):440-446 and Wilson, D.S. et al , 2001, Proc. Nat. Acad. Sc , (98):3750-3755) followed by a His8 tag in a mammalian expression vector.
  • SBP streptavidin binding protein sequence
  • Streptavidin magnetic beads (MyOne streptavidin Tl beads, Invitrogen) were pre -immobilized with biotinylated target protein ECD-CD5-SBP-H8. Approximately 200 ⁇ g of beads was incubated with a 200 nM solution of the target protein in a total volume of 500 ⁇ , and subsequently blocked with 0.5% BSA in PBS. Approximately 10 x 10 12 phage were incubated with the beads for approximately an hour at room temperature and then washed ten times with 1 mL of the same buffer. The bound phage were eluted with 100 mM HC1 and quickly neutralized with 1/5* volume of 1M Tris pH 8.3.
  • the phage were recovered by infecting log phase XL-1 blue cells for 30 min and subsequently adding 10 10 /mL M13K07 helper phage. The mixture was diluted into 2YT/Ampicillin and then amplified overnight. Phage were harvested from the media and precipitated with 20% PEG8000/2.5 M NaCl and then redissolved in PBS with 20% glycerol.
  • the enriched clones were sequenced, which revealed a unique CD5-binding clone E6 with the sequence shown in Figure 9A. Based on the X-ray crystal structure of human thioredoxin, the mutation/insertion sequences in loopl and 1 ⁇ 3' of E6 are located in close proximity and could interact with the target CD5 in a concerted fashion.
  • the phage expressing E6 protein was tested for its CD5 binding activity using ECD-CD5-SBP-H8 protein immobilized to streptavidin plates or HEK293T cells transfected with a vector that provide cell surface expression of CD5.
  • Protein based phage ELISA was performed as described (Tonikian, R. et al., 2007, Nature protocols,
  • Biotinylated CD5 was diluted to 1 ⁇ g/mL and then 100 ⁇ was incubated in each well of a streptavidin coated plate (Nunc). The wells were then blocked with 0.5% BSA in PBS. Phage were produced by inoculating an XL-1 blue cell with a unique phagemid clone into 2YT media containing 10 10 /mL helper M13K07 helper phage. The growth media was diluted two-fold with PBT (PBS, 0.5% BSA, 0.05% Tween-20) and 100 ⁇ was added to each of the wells; wells without immobilized CD5 was used as a control.
  • PBT PBS, 0.5% BSA, 0.05% Tween-20
  • the plate was washed eight times with 200 ⁇ of PT (PBS, 0.05% Tween-20). Fifty ⁇ of Anti-pVIII-HRP antibody was added at a 1 :5000 dilution in PBT and incubated for 30 minutes at room temperature. After the plate was washed six times with 200 ⁇ PT and then twice with PBS, 100 ⁇ of a freshly mixed PT (PBS, 0.05% Tween-20).
  • the cell-based phage ELISA was performed in a similar fashion, except the target CD5 was expressed on transiently transfected HEK293T cells.
  • a confluent 10 cm plate of cells was split into 4 lysine - coated 96-well plates (BD Biosciences). One half of the plate was transfected with a mammalian expression vector encoding CD5 and the other half with an unrelated receptor, CD19, using 0.1 ⁇ g of DNA and 0.2 xL of transfectin per well.
  • the transfected cells were grown for three days and then crosslinked to the well using 1% formalin solution in PBS after washing.
  • the cells were blocked with PB for several hours to overnight and then phage were added and detected as described above.
  • the results are shown in Figure 7C.
  • E6 clone from the CD5 selection was PCR amplified with gc615 and gc617 (Table 7), digested with EcoRI and Nhel, and then cloned into modified pET28 based vectors designed to produce the free E6 protein and an N-terminal fusion to the large lobe of the aerolysin toxin protein, respectively.
  • the protein was expressed in E. coli and then purified on Ni-NTA agarose then subsequently eluted with 200 mM imidazole. The eluted protein was dialyzed against TBS to remove free imidazole.
  • the protein was diluted to 100 ⁇ and then coupled with NHS -fluorescein at 1:3 ratio respectively.
  • the free fluorescein was removed with dialysis and then the labeled protein was incubated with wild type Raji cells that do not express CD5 and modified Raji cell line ectopically expressing wild type CD5.
  • the cells were harvested and washed with PBS with 0.5% BSA and then incubated with the labeled protein for 1 hr.
  • the cells were briefly washed with PBS twice and then analyzed on a Facscalibur cell counter (BD Biosciences).
  • the E6-aerolysin fusion protein was tested against Raji cells ectopically expressing or not expressing CD5 on the surface of the cell. Approximately 50,000 CD5 negative and positive cells were split into individual wells in a 96-well plate in RPMI media. The E6-aerolysin fusion was added at various concentrations in triplicate. After incubation for 48 hours, the cells were analyzed using MTS cytotoxicity assay (Promega) for 3 hours and then analyzed on a plate reader. PBS was used as a negative control and 0.1% Triton X-100 was used a positive control for toxicity. The dose response curves are shown in Figure 8B.
  • both E6 and E6-aerolysin fusion were analyzed for their tolerance to heat treatment.
  • 50 ⁇ of PBS buffer 20 ⁇ of E6 protein and E6-aerolysion fusion protein were incubated at 0 °C, 37 °C, 55 °C, 72 °C, and 95 °C, for 30 min, respectively. After centrifugation for 10 min.
  • E6 The superior stability of E6 makes it an excellent candidate for affinity maturation and further optimization for binding of CD5 or other targets.
  • Phagemid vector with DsbA secretion leader sequence was used to construct human thioredoxin based libraries. Wild type template (as shown in Figure 12A) was inserted in front of truncated pill gene. Libraries were built with Kunkel mutagenesis methods. The oligonucleotides used for mutagenesis in the loop region have 5' and 3 'overlaps to ensure proper annealing the uridine containing single stranded phagemid template. Designed primers were annealed onto the uridine -containing single strand phagemid, full length heteroduplex were synthesized by T7 DNA polymerase and ligated with T4 DNA ligase.
  • Library TRX -LI uses Y/S code for randomized sequences in loopl, 1 ⁇ 3/1 ⁇ 3' , and loop5. Specifically, the active site peptide 32 SGPS 35 is replaced by 4, 8, or 12 residues, 10 out of 12 residues within peptide D 61 ⁇ A 73 of 1 ⁇ 3/1 ⁇ 3' are replaced with randomized sequences as indicated, and 4 random residues are used to replace the 90 SGAN 93 peptide within loop5.
  • a randomized amino acid that replaces an existing residue is 50% NNS so that the wt residue is kept at 50%, while any insertion residue is NNS randomized.
  • the heteroduplex DNA and enzyme mixture were purified with Qiagen PCR purification kit and eluted with 120 ⁇ of deionized H 2 0. They were mixed with 400 ⁇ of XLl-blue electrocompetent cells (Stratagene) and electroporated at 2.5Kv, 200 ohm, 25 ⁇ . SOC was added immediately after electroporation. The culture was incubated for 30 minutes at 37 °C with gentle shaking (200 rpm). The mixture was added into 300 mL of 2YT with helper phage at 10 10 /mL concentration and ampicilin to grow overnight. The phage was purified by PEG and its
  • TRX-L3 1.0 x 10 9 50% 0.5 x 10 9
  • recombinant EpCAM-Fc (R & D) was used as the target for selections.
  • the phage display selection was done using Tl streptavidin magnetic beads (Invitrogen) coated with biotinylated recombinant EpCAM-Fc, and the selection was done with column based wash and elution to minimize non-specific background.
  • the target concentration for coating in round 1 and round 2 selections is 250 nM, which is reduced to 125 nM in the 3 rd round. This process works efficiently as only two rounds were necessary to recover specific binders. The progression of phage titer for rounds 2 and 3 was monitored.
  • Sequencing of the pools from post round 2 indicated a convergence of binders.
  • the hit rates of post round 2 are 24/26 for TRX-L1, 21/23 for TRX-L2, and 21/24 for TRX-L3, respectively.
  • the hit rate of post round 3 is 24/24 for both TRX-L2 and TRX-L3.
  • the 2 nd round of selection was done by washing for 8 times and flow wash of 50 mL.
  • the 3 rd round of selection was done with 125 nM target concentration and 10 times of wash followed by 50 mL of flow wash.
  • a total of 22 different binders have been obtained from three combined libraries ( Figure 13).
  • the selected phages from libraries TRX-L1, TRX-L2, and TRX-L3 that display TRX-based EpCAM binders were analyzed by phage ELISA. Specifically, a single bacterial colony was inoculated into 1 mL of 2YT media with ampcillin and helper phage M13 at 10 10 /mL. After the culture was incubated at 37 °C overnight, it was spun at Max speed in a microcentrifuge and the supernatant was used for phage ELISA. The nunc plate wells were coated with EpCAM-Fc at 1 ⁇ g/mL overnight at 4 °C. The plate wells were blocked by 1% BSA in PBS.
  • the phage supernatant was diluted with blocking buffer for ten fold and was applied to the wells for 1 hr.
  • the wells were washed 5 times with PBS containing 0.05% tween-20.
  • Bound phage was detected with an anti-M13 pVlll antibody conjugated to HRP.
  • the wells were incubated with anti M13 pVIII-HRP conjugate at 1 :5000 in blocking buffer for 1 hr. Detection was done with ELISA reagent (R&D) and measured at 450 nm. Specific binding to EpCAM as compared to BSA control was observed for all 22 selected binders ( Figure 14).
  • EpCAM-Fc EpCAM-Fc
  • IgGl-Fc IgGl-Fc
  • CD22-Fc CD5-Fc
  • hEphA2 mEphA2-Fc
  • BSA a control clone, which was not selected as an EpCAM binder
  • the corresponding phage ELISA results are shown in Figure 15 A. While the selected EpCAM binders from TRX-Ll and TRX-L2 libraries showed excellent binding selectivity towards target EpCAM, they did not bind to any of the control proteins. Furthermore, the control phage clone showed weak and non-specific interactions with almost all of the other proteins tested.
  • the individual phage clones were heat treated before ELISA analysis. Specifically, the selected phage supernatant was incubated at the indicated temperatures for 10 min, followed by centrifugation to remove precipitated aggregates. The supernatants were used for phage ELISA analysis ( Figure 15B). The results show that the selected clone F6 from TRX-Ll lost its binding activity after heated at 60 °C. Meanwhile, the selected clones from library TRX-L2 were stable at 70 °C and retained their binding activity. We did not heat the phage clones at temperatures higher than 70 °C, at which phage itself becomes less stable.
  • phage display selections were carried out to select specific binders for CD38, CD19, CD22, EpCAM, LGR5, and human serum albumin (HSA) using TRX-3 library and the phage display procedures similar to that described in Example 6.
  • HSA human serum albumin
  • 0.125% casein was used in place of the 0.5% BSA as a blocking agent during selection and ELISA analysis.
  • the recombinant target proteins were prepared using methods summarized in Table 9.
  • Phage ELISA experiments on the HSA binders were performed as described in Example 7 and the results are shown in Figure 18 A. Selective binding to HSA vs. CD5 was observed for all the HSA binders tested. The Al 1 clone was omitted due to the presence of a stop codon in its Loopl sequence. The sequences of the seven remaining HSA binders shown in Table 10 and Figure 7 were similarly tested for their specific binding to serum albumins of human, rat, and mouse (HSA, RSA, and MSA, respectively) by phage ELISA ( Figure 18B).
  • HSA binding clones comprising the F-rich Loop3' motif are capable of specific binding to all three serum albumins, while the clones containing the AGPF Loop3' motif and the unique Loop3' sequence VYVSLSRHR can only bind to HSA, not RSA or MSA.
  • HSA binders were performed on a Biacore T100 instrument according to manufacturer's instructions.
  • the target protein (HSA) was immobilized on the Biacore CM5 sensor chip using EDC/NHS coupling chemistry.
  • a kinetic model was used to fit the binding affinity after measuring the sensograms while varying the concentration of the purified thioredoxin based binders.
  • the resulting K d values are shown in the left panel of Figure 19 along with the corresponding surface plasmon resonance (SPR) sensorgrams.
  • SPR surface plasmon resonance
  • HSA-binding thioredoxin clones E2, F3, and H6 (all with F-rich motif), as well as the wild type sequence were cloned as his-tagged C-terminal fusions to a stabilized mutant Renilla Lucif erase and subsequently purified using Ni-NTA (Loening et al. Protein Engineering, Design & Selection vol. 19 no. 9 pp. 391-400, 2006).
  • the proteins were dialyzed in PBS prior to administration to mice.
  • the affinity of each fusion protein was measured using Biacore T100 as described above and the resulting K d values are shown in the right panel of Figure 19 along with the corresponding SPR sensorgrams.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Hematology (AREA)
  • Immunology (AREA)
  • Urology & Nephrology (AREA)
  • Plant Pathology (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention features compositions based on thioredoxin-like fold protein domains described as engineered thioredoxin-like fold proteins (ETRXs). These proteins include one or more artificially diversified thioredoxin-like fold protein domains; each domain may be originated from the same or different thioredoxin-like fold protein domains. Features of the invention also include methods for identifying and preparing an enriched composition of target binding, loop-diversified ETRXs with additional sequence variations to improve affinity, stability, selectivity, or solubility. The invention also features compositions of ETRXs substituted with prosthetic groups, polymers, proteins, nucleic acids, carbohydrates, metals, natural or synthetic small molecules and toxins.

Description

Engineered Thioredoxin-Like Fold Proteins
Field of the invention
The present invention relates to engineered polypeptides comprising a thioredoxin-like fold protein domain with multiple disjoined regions of non-native sequences, methods for their production and for their use in binding or recognizing ligands of interest.
Background of the invention
The adaptive immune system is a highly evolved, flexible system for the recognition and neutralization of foreign organisms and macromolecules. At the core of adaptive immunity is an engine for the creation of a vast variety of different similar structures that have been diversified by combinatorial assembly of varied building blocks with highly random linker segments. The two principle recognition complexes of the higher vertebrate adaptive immune system, antibodies and the T cell antigen receptor, are similarly assembled, and function through their cognate cell types, B cells and T cells, to produce a coordinated resistance to pathogens. Although all elements of the adaptive recognition system of higher vertebrates are based on assemblies of monomer domains of the immunoglobulin fold, in cyclostomes, convergent evolution has created an adaptive immune system that is constructed by the assembly of recognition elements derived from leucine rich repeats.
The effector proteins of the B cell arm of the adaptive immune system, particularly antibodies of the
IgG subtype, have many attractive properties as candidate therapeutic agents. IgG antibodies are highly soluble proteins with a long in vivo half -life that have weak immunogenicity within a given species. They often can be selected to have high affinities for their targets and are known to have few intrinsic safety liabilities. As a class IgG antibodies have relatively predictable behavior in vitro and in vivo, and in recent years recombinant antibodies of substantially human sequence have played a major role in therapeutic medicine as universal recognition moieties for a number of targets in different diseases. Human
monospecific antibodies of the IgG subtype provide high specificity, bivalency, fully human composition, and long plasma half-life. The known limitations of antibodies relate largely to their biophysical properties (high molecular weight, multi-domain assemblage, disulfide bonds, glycosylation), which require eukaryotic manufacturing processes that are more complex and more expensive than their prokaryotic counterparts.
Scaffolds based on different human or non-human proteins or protein domains have emerged as an independent class of alternative therapeutic molecules. The status of alternative scaffolds and selection procedures used to identify high affinity binding proteins based on those scaffolds has been reviewed (Gebauer, M. & Skerra, A. Curr. Opin. Chem. Biol. 2009, 73:245-255). Different proteins have been investigated as frameworks for bringing the diversified sequences to targets, including affibodies, lipocalins, ankyrin-repeat proteins, natural peptide binding domains, enzymes, GFP, small disulfide-bonded peptides, protease inhibitors, and others.
Although for prospective therapeutic applications to date, alternative scaffolds have largely been employed as neutralizing agents for ligand-receptor interaction, cytokine, toxin, or Fc-fusions are being investigated to confer on the binding protein a cytostatic or cytotoxic effect similar to that achieved through antibody-dependent cellular cytotoxicity (ADCC). The potential role of alternative scaffolds in diagnosis is important since large arrays of specific small reagents could be produced to many different targets.
Compared to antibodies, small scaffolds should have better tissue penetration which could be advantageous for solid tumor targets (Zahnd C, et al. Cancer Res. 2010, 70(4): 1595-1605).
Even though it has not heretofore been emphasized in the development of antibody-like binders using engineered scaffold proteins, the evolvability of a parent protein has been recognized as a key factor for successful directed evolution of enzymatic activities (Bloom, J.D. & Arnold, F.H, Proc. Natl. Acad. Sci. , 2009, 706:9995-10000). Two evolutionary concepts have been used to provide rational basis for increased evolvability of enzymes: (i) the conservation of catalytic mechanisms, and (ii) the functional promiscuity. First, the knowledge of the catalytic motifs responsible for conserved aspects of catalysis in mechanistically diverse superfamilies could be used to identify promising templates for protein engineering. Second, protein evolutions often proceed through promiscuous intermediates, suggesting that naturally promiscuous templates (for a target reaction) could enhance protein engineering strategies (Khersonsky, O., et al., Curr. Opin. Chem. Biol. 2006, 70:498-508).
Catalysis of different chemical reactions by evolutionarily related proteins has been observed in several protein fold classes. The thioredoxin fold is found in thioredoxin superfamily of proteins that serve a wide variety of functions, including protein disulfide isomerases, DsbAs, the glutaredoxins, glutathione S- transferases, calsequestrins, and glutathione peroxidases and peroxiredoxins (Copley, S.D. et al. Biochemistry, 2004, 43: 13981-13995). These proteins have been shown to interact with many different types of protein substrates, demonstrating the ability of the thioredoxin fold to recognize diverse targets. Moreover, based on combined sequence, structural, and functional evidence for homology, more than 723 proteins have been identified to possess a thioredoxin-like fold (containing different circular permutations including that of thioredoxin fold) and may be divided into at least eleven different evolutionary families (Qi, Y. & Grishin, N.V., Proteins 2005, 58:376-388). Further computational analysis revealed that the thioredoxin-like fold class, as described in Qi, Y. & Grishin, N.V., Proteins 2005, 58:376-388, is the largest sets of proteins likely to have evolved from a common ancestor, incorporating at least eighteen individual superfamilies and comprising 29,206 sequences (Atkinson, H.J. & Babbitt, P.C., PloS Comput. Biol. 2009, 5(70):elOOO541). The evolutionary relationships among some of these protein families have been documented. The observed flexibility and adaptation of thioredoxin-like fold makes it extremely suitable for the construction of proteins with novel functions. Sequence alignment of proteins from the thioredoxin-like fold families also reveals the high degree of sequence variations in the fold, implying its potential to allow large numbers of mutations to be explored during directed evolution experiments for the selection of prospective binders.
Many members of the thioredoxin superfamily share two features in common: they contain a short sequence motif that includes a -CPGC- sequence (the active site) and an overall structure containing this motif that bears the same topology as thioredoxin. Laboratory evolution of the proteins with thioredoxin fold further demonstrates the flexibility of the fold and helps illustrate how various functions can be acquired by individual members that did not possess these functions prior to the imposed selection (Pan, J.L. & Bardwell, J.C., Protein Sci., 2006, 75:2217-2227). For example, substitution of thioredoxin's active site CGPC to DsbA's active site CPHC can result in a protein that functions very similarly to DsbA. Another example of in vitro evolution is the selection of thioredoxin mutants that can compensate for the whole DsbA-DsbB pathway. A mutation from CGPC to CACC in exported versions of thioredoxin was capable of
complementing null mutations in the DsbA-DsbB pathway. They do so by acquiring a 2Fe-2S iron-sulfur cluster, and presumably a whole new mechanism of action. This shows that thioredoxin is extremely amenable to mutation, conferring the protein with new catalytic properties and the ability to participate in new redox reactions. Conversion of a peroxiredoxin into a disulfide reductase was accomplished by a single TCT insertion in the gene ahpC, which allowed the AhpC protein product to function as a disulfide reductase as opposed to the peroxiredoxin role that it normally participates in within the cell. AhpC has lost its peroxidase activity while gaining a disulfide reductase activity. Additionally, some multi-domain thioredoxin super family proteins contain a non-catalytic thioredoxin-like domain that involves in substrate binding (Pedone, E. et al. Cell. Mol. Life Sci., 2010, July 13, Epub ahead of print). For example, human protein disulfide isomerase (PDI) contains two catalytic domains, a and a', and two non-catalytic domains, b and b'. Biochemical studies have established that the b' domain is sufficient for binding small peptide substrates, even though catalytic domains a and a' are also involved in binding of larger protein substrates. Within the b' domain, the implicated ligand binding site is a small hydrophobic pocket located in a position homologous to that of the active site in the catalytic domains.
These examples show that thioredoxin and thioredoxin-like proteins can evolve, both in function and substrate specificity, with only a few amino acid changes in the protein. Although the function and specificity has changed, the thioredoxin fold is still conserved.
Thioredoxin (Trx) is the founding member of the thioredoxin superfamily (Martin, J.L. Curr. Biol. ,
1995, 3:245-250). It is a 12-kDa protein that is involved in many reactions including reducing improper disulfides that have formed in the cytosol, donating reductive equivalents to ribonucleotide reductase, and being an indicator of the intracellular redox status. The function of thioredoxin has been implicated in numerous pathways; principally, it provides a protective role against many different types of damaging stresses (Lillig, C.H. & Holmgren, A., Antioxid. Redox Signal , 2007, 9(l):25-47). In addition to its anti- oxidative effect by dithiol-disulfide exchange in its active site, Trx has anti-apoptotic and anti-inflammatory effects. Trx overexpression has been shown to be effective in a wide variety of animal models for oxidative and inflammatory disorders. An administration of recombinant Trx protein is also effective in animal models for severe acute lung diseases where Trx is likely to act with its anti-inflammatory properties (Nakamura H. et al., Adv. Drug Deliv. Rev. 2009, 6i(4):303-309). Although it has no signal peptide, Trx is released from cells in response to oxidative stress. Trx is found in circulation and shows anti-chemotactic effects for neutrophils and inhibitory effects against macrophage migration inhibitory factor (MIF). Neovascularization is also suppressed by Trx via inhibition of the complement activation. The anti-inflammatory effects of Trx suggest that it is not likely to elicit immunogenic responses in vivo.
Pharmacokinetics of Trx has also been studied (Nakamura H. et al., Adv. Drug Deliv. Rev. 2009, 6i(4):303-309). When recombinant human Trx was injected intravenously, its half-life in plasma was measured to be roughly 1 h in mouse, 2 h in rat, and 8 h in monkey. In healthy volunteers, Trx is circulating in plasma at the concentrations of 10-30 ng/ml and, in the kidney it is excreted through the glomerulus and mostly reabsorbed by the proximal tubules, such that Trx levels in the urine of healthy volunteers are quite low and usually undetectable. When an excess amount of Trx such as lOmg/kg is injected into animals, Trx protein is excreted into the urine as an immunologically intact form, suggesting that this protein is not likely to be metabolized. Tissue deposition of Trx after intravenous injection was limited. Five plasma proteins were identified to interact with recombinant Trx: apolipoprotein A-I, scavenger receptor (cysteine rich domain), fibrinogen (gamma polypeptide), complement factor H, and albumin. Interaction with albumin may be particularly beneficial for prolonged half -life in plasma.
Summary of the Invention
In one aspect, the invention features an engineered thioredoxin-like fold protein with at least one of its domains comprising two or more loops being modified through loop-diversification.
In another aspect, the invention features a method for preparing an enriched composition of target- binding, loop-diversified engineered thioredoxin-like fold proteins by (i) providing a collection of nucleic acids encoding the loop-diversified engineered thioredoxin-like fold proteins in a display-conducive context, (ii) expressing the collection of nucleic acids in vivo or in vitro to provide a collection of loop-diversified engineered thioredoxin-like fold proteins operably linked to the nucleic acid that encodes them, (iii) contacting the expressed engineered thioredoxin-like fold proteins with a target; (iv) removing expressed engineered thioredoxin-like fold proteins that do not bind to the target; and (v) recovering the engineered thioredoxin-like fold proteins enriched for binding to the target. In another aspect, the invention features another method for preparing an enriched composition of target-binding, loop-diversified engineered thioredoxin-like fold proteins by: (i) providing a collection of nucleic acids encoding the loop-diversified engineered thioredoxin-like fold proteins, (ii) expressing the collection of nucleic acids in vivo or in vitro to provide a collection of loop-diversified engineered thioredoxin-like fold proteins, (iii) contacting the expressed engineered thioredoxin-like fold proteins with a target; and (iv) identifying collections of expressed engineered thioredoxin-like fold proteins that bind to the target.
The invention also features a method for identifying individual target-binding, loop-diversified engineered thioredoxin-like fold proteins by: (i) providing a collection of nucleic acids encoding the loop- diversified engineered thioredoxin-like fold proteins, (ii) expressing the collection of nucleic acids in vivo or in vitro to provide a collection of optionally individually indexed, loop-diversified engineered thioredoxin- like fold proteins, (iii) contacting the optionally individually indexed engineered thioredoxin-like fold proteins with a target; and (iv) identifying collections or individual engineered thioredoxin-like fold proteins that bind to the target.
In yet another aspect, the invention features an isolated nucleic acid encoding an engineered thioredoxin-like fold protein or a loop-diversified engineered thioredoxin-like fold protein in an expression- conducive context.
Another aspect of the invention features the conjugates of a protein including at least one optionally engineered thioredoxin-like fold protein domain to one or more small molecule drugs or toxins.
Still another feature of the invention is a fusion protein between a protein including at least one optionally engineered thioredoxin-like fold protein domain and another protein such as a protein toxin or protoxin, an antibody, and an enzyme.
The invention also features a method for chemically modifying and purifying a protein including at least one optionally engineered thioredoxin-like fold protein domain to achieve optimal in vivo
pharmacokinetic properties of the protein by: (i) modifying the protein with a single cysteine near the c- terminus that is then modified with polyethelene glycol, and (ii) purifying the modified protein by anion exchange chromatography.
Another feature of this invention include modification with polyethelene glycol achieved by: (i) modifying the protein near its c-terminus with a peptide tag that is a substrate of a microbial transglutaminase (e.g., LLQG) or a substrate of a microbial sortase (e.g., LPETG), and (ii) conjugate the protein with amino- modified polyethelene glycol using the corresponding microbial transglutaminase or sortase.
The invention also features engineered thioredoxin-like fold proteins as high affinity binding proteins to the selected targets of Tables 2 and 3, and cited in Supplementary Tables S1-S9 of U.S. Provisional Application No. 61/468,836, specifically incorporated herein by reference. One preferred embodiment of the present invention is an engineered thioredoxin-like fold protein comprising an engineered protein domain of the thioredoxin superfamily. A further preferred embodiment is an engineered thioredoxin-like fold protein comprising an engineered human protein domain of the thioredoxin superfamily.
Another preferred embodiment is an engineered thioredoxin-like fold protein comprising an engineered protein domain of the thioredoxin family. A further preferred embodiment is an engineered thioredoxin-like fold protein comprising an engineered human protein domain of the thioredoxin family.
A still preferred embodiment is an engineered thioredoxin-like fold protein comprising an engineered thioredoxin domain, preferably that of Homo sapiens.
In another embodiment, the invention features a sample containing a plurality of engineered thioredoxin-like fold proteins (e.g., 102, 103, 104, 105, 106, 107, 108, 109, or more distinct engineered thioredoxin-like fold proteins).
A further preferred embodiment of the invention features an engineered protein of the thioredoxin super family comprising a multiple loop-diversification within at least one of its thioredoxin-like fold domains.
In any of the foregoing aspects, the thioredoxin-like fold protein domain may contain additional point mutations, including mutations at the active site, e.g., - 32 CGPC 35 - to - 32 SGPS 35 - in a thioredoxin molecule.
In any of the foregoing aspects where the engineered thioredoxin-like fold protein is an engineered protein of the thioredoxin superfamily, the engineered thioredoxin-like fold protein preferably does not contain a peptide insertion at the active site corresponding to -CGPC- or its mutant -SGPS- to afford a protein comprising, e.g., -CG-peptide-PC- or its mutant -SG-peptide-PS-.
In any of the foregoing aspects of the invention, the engineered thioredoxin-like fold protein binds (e.g., specifically binds) a particular target (e.g., a target listed in Tables S1-S9 of U.S. Provisional
Application No. 61/468,836, specifically incorporated herein by reference, 2, or 3).
By "branched polyalkylene glycol" is meant a branched polymer created by the joining of one or more optionally substituted oligomers or polymers of units of the form -(0-CRiR2-CR3R4)n-0-R5, where Ri, R2, R3, R4, and R5 are the same or different and selected from H, F, or lower alkyl optionally substituted with one or more F; and n is 3 or greater. A branched polyalkylene glycol contains one or more linker structures (branches) of the form A-Y-linker-(XiX2) where
Figure imgf000007_0001
and Y may be a bond or a linear polyalkylene glycol and A is a group selected to provide covalent or stable noncovalent linkage to a protein. As used, the term branched polyalkylene glycol includes block or random copolymers of units corresponding to the formula above, wherein the substituents Ri, R2, R3, R4, and R5 may vary from block to block or from monomer to monomer, for example as in a block or random copolymer of polyethylene and polypropylene glycols. By "coding sequence" is meant the sequence of nucleic acid residues that upon translation give rise to a polypeptide.
By "display" is meant any system that permits the enrichment or identification of a target-binding protein by (i) contacting a mixture of target-binding and target-nonbinding proteins each operably linked to a nucleic acid encoding said target-binding or target-nonbinding protein and (ii) separating said target -binding proteins from said target-nonbinding proteins to provide a composition enriched in the target-binding proteins compared to the initial composition.
By "display-conducive context" means any form in which a target-binding protein can be expressed such that it is available to both bind to a target and retain an operable linkage or physical relationship (for example, by association with the same host cell, phage, or fusion construct) to a nucleic acid encoding said target-binding protein.
By "engineered protein of the thioredoxin superfamily" is meant a protein comprising one or more domains derived from a protein of the thioredoxin superfamily that have been modified by addition, deletion, replacement, or substitution of one or more amino acid residues.
By "engineered thioredoxin-like fold protein" is meant a protein comprising one or more domains derived from a thioredoxin-like fold protein that have been modified by addition, deletion, replacement, or substitution of one or more amino acid residues.
By "expressible clone" is meant a recombinant nucleic acid construct bearing an open reading frame that can be translated from N-terminus to C-terminus without termination. A "non-expressible clone" is a recombinant nucleic acid construct bearing an open reading frame that contains either frameshift or termination mutations that prevent complete translation of the coding sequence.
By "expression-conducive context" is meant the appropriate combination of flanking sequences, vector elements, regulatory sequences, or other nucleic acid sequences empirically determined to support, improve, or regulate the production of a polypeptide chain from the sequence that encodes it. The production of the polypeptide chain can be either in vitro or in vivo. For example, an expression-conducive context for a prokaryotic expression system might comprise an optionally regulated promoter of bacterial or bacteriophage origin, a ribosome binding sequence, the coding sequence of the protein to be expressed, and an optional transcriptional termination sequence. An expression-conducive context for prokaryotic in vitro expression might comprise an RNA or translatable nucleic acid comprising a ribosome binding sequence and the coding sequence of the protein to be expressed, or such expression-conducive context for prokaryotic in vitro expression might comprise a DNA or transcribable nucleic acid encoding such RNA or translatable nucleic acid as well as regulatory sequences permitting the transcription of said DNA or transcribable nucleic acid to afford said RNA or translatable nucleic acid. An expression-conducive context for eukaryotic in vitro expression might comprise an RNA or translatable nucleic acid bearing the coding sequence of the protein to be expressed and optionally bearing 5' and 3' flanking sequences that provide RNA stability or improve the efficiency of translation.
By "extension-diversified" as applied to a thioredoxin-like fold protein is meant a thioredoxin-like fold protein wherein at least one terminus, either the N-terminus or the C-terminus, of a beta barrel has been replaced and/or extended with an amino acid sequence of no greater than 30 % (e.g., less than 25%, 20%, 15%, 10%, 5%, 1%, 0.1%, or less) identity to the original sequence. An extension-diversified engineered thioredoxin-fold like protein may have one or both termini extended or modified.
By "individually indexed collection" is meant any collection of species constituted as mixtures or not, so composed that the activity of any individual member can be inferred from the analysis of the activities of all mixtures.
By "linear polyalkylene glycol" is meant an optionally substituted oligomer or polymer of units of the form A-(0-CRiR2-CR3R4)n-O-R5, where Ri, R2, R3, R4,and R5 are the same or different and selected from H, F, or lower alkyl optionally substituted with one or more F; A is a group selected to provide covalent or stable noncovalent linkage to a protein; and n is 3 or greater. As used the term linear polyalkylene glycol includes linear block or random copolymers of units corresponding to the formula above, wherein the substituents Rl 5 R2, R3, R4, and R5 may vary from block to block or from monomer to monomer.
By "library" or "pool" is meant a collection of two or more species constituted as a single mixed entity. Preferably, a "library" or "pool" includes at least 102, 105, 1010, 1013, or 1015 members or some range within these numbers.
By "loop-diversification" as applied to a thioredoxin-like fold protein domain or a protein domain of the thioredoxin superfamily is meant a thioredoxin-like fold protein or a protein of the thioredoxin superfamily wherein at least one loop connecting beta strands and alpha helices of the fold has been replaced with an amino acid sequence of no greater than 30 % identity (e.g., less than 25%, 20%, 15%, 10%, 5%, 1%, 0.1 %, or less identity) to the original sequence.
By "multiple loop-diversifications" as applied to a thioredoxin-like fold protein domain or a protein domain of the thioredoxin superfamily is meant a thioredoxin-like fold protein or a protein of the thioredoxin superfamily wherein more than one loop connecting beta strands and alpha helices of the fold have been replaced with an amino acid sequence of no greater than 30 % identity (e.g., less than 25%, 20%, 15%, 10%, 5%, 1%, 0.1 %, or less identity) to the original sequence.
By "nucleic acid" is meant an optionally substituted deoxyribonucleic acid or ribonucleic acid or homologous polymer of nucleic acid bases or base analogs that can be either copied to provide an image or replica of itself or that can be translated to form a peptide, polypeptide, or protein.
By "operably linked" or "operable linkage" is meant a stable, covalent or noncovalent attachment of two or more species so described that is capable of providing a statistical association of the operably linked species sufficiently powerful that the identification or extraction of one element permits the identification or recovery of the other element in at least 10% (e.g., at least 20%, 30%, 40%, 50%, 75%, 90%, 95%, 99%, or more) of attempts.
By "peptide" is meant an optionally substituted oligomer or polymer of naturally occurring or unnatural amino acids covalently linked by one or more amide bonds.
By "protein domain of the thioredoxin superfamily" is meant a member of the thioredoxin superfamily, a large, diverse group of proteins containing a thioredoxin fold, identified by databases of conserved protein domains, e.g., Pfam, as family cd01659. Many members contain a classic Trx domain with a redox active CXXC motif. They function as protein disulfide oxidoreductases (PDOs), altering the redox state of target proteins via the reversible oxidation of their active site dithiol. The PDO members of this family include Trx, protein disulfide isomerase (PDI), tlpA-like, glutaredoxin, NrdH redoxin, and the bacterial Dsb (DsbA, DsbC, DsbG, DsbE, DsbDgamma) protein families. Members of the family that do not function as PDOs but contain a Trx-fold domain include phosducins, peroxiredoxins and glutathione (GSH) peroxidases, SCO proteins, GSH transferases (GST, N-terminal domain), arsenic reductases, Trx-like ferredoxins and calsequestrin, among others.
By "protein domain of the thioredoxin family" is meant a thioredoxin fold domain of member of the thioredoxin family identified by Pfam as family cd02947. It is composed of two groups: Group I, which includes proteins that exclusively encode a Trx domain; and Group II, which are composed of fusion proteins of Trx and additional domains. Group I Trx is a small, ancient protein that can alter the redox state of target proteins via the reversible oxidation of an active site dithiol, present in a CXXC motif, partially exposed at the protein's surface. Trx reduces protein disulfide bonds, resulting in a disulfide bond at its active site.
Oxidized Trx is converted to the active form by Trx reductase, using reducing equivalents derived from either NADPH or ferredoxins. By altering their redox state, Trx regulates the functions of at least 30 target proteins, some of which are enzymes and transcription factors. It also plays an important role in the defense against oxidative stress by directly reducing hydrogen peroxide and certain radicals, and by serving as a reductant for peroxiredoxins. At least two major types of functional Trxs have been reported in most organisms; in eukaryotes, they are located in the cytoplasm and the mitochondria. Higher plants contain more types (at least 20 Trx genes have been detected in the genome of Arabidopsis thaliana), two of which (types f and m) are located in the same compartment, the chloroplast. Also included in the alignment are TRX -like domains which show sequence homology to Trx but do not contain the redox active CXXC motif. Group II proteins, in addition to either a redox active Trx or a Trx-like domain, also contain additional domains, which may or may not possess homology to known proteins.
By "protein toxin or protoxin" is meant a polypeptide that has the latent (protoxin) or manifest (toxin) ability to inhibit cell growth (cytostasis) or to cause cell death (cytotoxicity). Examples of such toxins or protoxins include, without limitation, Diphtheria toxin, Pseudomonas exotoxin A, Shiga toxin, and Shiga- like toxin, anthrax toxin PA, pore-forming toxins or protoxins such as Proaerolysin, hemolysins, pneumolysin, Cryl toxins, Vibrio pro-cytolysin, or listeriolysin; Cholera toxin, Clostridium septicum alpha-toxin,
Clostridial neurotoxins including tetanus toxin and botulinum toxin; gelonin; nucleic acid modifying agents such as ribonuclease A, human pancreatic ribonuclease, angiogenin, and pierisin-1, apoptosis-inducing enzymes such as caspases, and ribosome -inactivating proteins (RIPs) such as Ricin, Abrin, and Modeccin. A protoxin is a form of toxin precursor that must undergo modification to become an active toxin. Preferable forms of protoxins for the present invention include those that can be activated by a proteolytic cleavage event.
By "small molecule drug or toxin" is meant a non-polymer (e.g., non-protein or nucleic acid) compound that exhibits cycotoxicity to mammalian cells.
By "stable noncovalent linkage" is meant a noncovalent association that permits the continued proximity of the two or more elements such that after a period of time encompassing the expected duration of use of the two or more associated elements, no more than 50% (e.g., less than 40%, 30%, 25%, 20%, 15%, lo%, 5%, 1%, 0.1%, or less) of the elements have disassociated. For example, a stable noncovalent linkage for a complex intended to persist for 3 hours at 37 °C will have a half -life of at least 3 hours at 37 °C. The term "substitution" in the context of an amino acid sequence is taken to mean the chemical or enzymatic modification of one or more amino acid residues of a polypeptide to afford a substituted polypeptide.
Common forms of substitution include attachment of prosthetic groups, polymers, nucleic acids, linkers, small natural or synthetic molecules or fragments thereof, such as modifying radicals, for example methyl or other lower alkyl, formyl, acetyl, or other lower acyl, phosphoryl, or sulfonyl.
By "thioredoxin-like fold protein" is meant a protein comprising one or more domains of the thioredoxin-like fold, a three -layer α/β/α sandwich with a central four-stranded β-sheet flanked by oc-helices on each side, as described in Qi, Y. & Grishin, N.V., Proteins., 2005, 58:376-388.
By "thioredoxin protein" is meant a protein comprising one or more domains derived from a thioredoxin protein of the thioredoxin family cd02947; thioredoxin is a single Trx domain protein containing a CXXC motif capable of reducing protein disulfide bonds.
Brief Description of the Drawings
Figure 1A is the topological diagram of the thioredoxin-like fold. The lines connecting different oc- helices (cylinders) and β-strands (arrows) represent loop regions. Dotted loops indicate the termini positions of the four types of circular permutations observed. No termini were observed at solid loop locations.
Figures IB-IE are a series three dimensional structures of the indicated proteins with a thioredoxin- like fold. Figure 2 is the structure -based multiple sequence alignment of representative thiredoxin-like protein domains. Sequences are grouped according to 11 evolutionary families. The sequences corresponding to the four structures in Figure 1 are indicated. Conserved residues within each family are highlighted in black. The diagram of secondary structures (oc-helices as cylinders and β-strands as arrows) is shown above the alignment. The termini of proteins of circular permutations different from that of thioredoxin are shown by a "I".
Figure 3 shows the list of protein domain subfamilies of the thioredoxin superfamily (Pfam cd01659) that encompass protein domains containing the thioredoxin-like fold. The list is obtained from NCBI's "Conserved Domains" database.
Figure 4 presents a compiled list of the GI numbers of the human proteins comprising a protein domain of the thioredoxin superfamily based on data obtained from the NCBI database. The GI numbers corresponding to proteins associated with US patents are underlined.
Figure 5A shows the sequence of human thioredoxin aligned with corresponding secondary structures.
Figure 5B is a schematic showing the three dimensional structure of human thoredoxin with all loops specified. Loopl, 1οορ3, 1οορ3' , and loop5 are at the same side as the active site.
Figure 5C is the schematic showing the three dimensional structure of human thoredoxin (minus the OcO' and βθ' motifs) with all loops specified.
Figure 6A shows the mutated human thioredoxin sequence that was used as template for generating the loop diversified protein libraries; mutations are highlighted by underlined amino acids. The loops are indicated by arches across the peptide sequences. The loop-diversification schemes were shown by the arrows pointing between the amino acids (three insertion sites), or an arrow pointing to a shaded stretch of amino acids (the replacement of shaded peptide with random peptide sequences in 1οορ3'). Library TRX-IB was generated using the template with wild type active site CGPC, and the other libraries were generated using the template with mutated SGPS sequence.
Figure 6B is the schematic presentation of four loop-diversified libraries. For example, in TRX-IB library the insertion in loopl is done at the active site between C 32 G 33 and P 34 C 35. In TRX-1A library contains a 6 amino acid insertion between T30 and W31 in loopl, 6 amino acids replacing the 5 amino acids in 1οορ3' , and a 4 amino acid insertion between A93 and N94 in loop5. Both TRX-2 and TRX-3 libraries contain loop-diversifications in loopl and 1οορ3', as indicated.
Figure 7A shows the solubility screen of protein samples from randomly selected in-frame members of TRX-1A and TRX-IB, with wild type thioredoxin (WT) as a reference using PAGE. The expressed proteins were separated into soluble and insoluble fractions after high speed centrifugation. L: Protein Ladder, P: Post Induction, S: Soluble, I: Insoluble. Figure 7B is a graph showing the thermostability analysis results of all the clones tested along with the wild type thioredoxin (WT). Protein samples that remained in the supernatant after heat treatment and centrifugation were quantified and the % remained soluble plotted. A clones are the soluble members of TRX-1A, the B clone is from TRX-1B, and C clones are from TRX-2.
Figure 8A is the amino acid sequence of a fusion protein containing the extracellular domain (ECD) of CD5, ECD-CD5-SBP-H8, which was used as the target for phage display selections for CD5 binders from loop-diversified library TRX-3. The underlined N-terminus sequence is the signal peptide, and the bold C- terminus sequence comprises the streptavidin binding protein (SBP) sequence and a His8 tag.
Figure 8B is a graph showing the phage display selection elution titers after each round of selection from loop-diversified library TRX-3.
Figure 9A is a graph showing the sequences of CD5 binders E6, Al, E10, and A5 selected from library TRX-3 and its alignment with wild type thioredoxin and TRX-3 library. Underlined amino acids adjacent to the randomized/selected sequences are shown to indicate the specific locations of the amino acid insertion and/or replacement.
Figure 9B is a graph showing ELISA assay results with the selected CD5 binder E6, anti-CD5 scFv, non-CD5 binding control D6, or buffer alone, using CD5-biotin conjugate immobilized to wells of streptavidin plates.
Figure 9C is a graph showing cell-based ELISA results. Binding to the surface of CD5 expressing cells and CD19 expressing cells were tested with anti-CD5 scFv, anti-CD19 scFv, TRX-based CD5 binder E6, non-CD5 binding control A2, and buffer alone.
Figure 9D is a graph showing ELISA assay results with the selected CD5 binders Al, E10, and A5, anti-CD5 scFv, and non-CD5 binding clones A4 and A6, using CD5-biotin conjugate immobilized to wells of streptavidin plates.
Figure 10A is a graph showing FACS analysis results in the selective binding of anti-CD5 antibody (top panel), E6 (bottom panel), as well as an E60-aerolysin fusion protein (middle panel) to CD5+Raji cells, but not to CD5-Raji cells.
Figure 10B is a graph showing MTS cytotoxicity assay results of E6-aerolysin (wt) fusion protein on Raji cells and CD5+ Raji cells. The cells were plated at 50,000 cells per well, the fusion protein was pre- treated with furin for 6 hr before applying to the cells. After a 48 hr incubation with the E6-aerolysin fusion, the cells were stained with MTS for 3 hr and percentage of live cells calculated.
Figure 11 A is a graph showing thermostability analysis results on CD5 binding E6 protein. The percentages of E6 protein that remained soluble after heating for 30 min. at each temperature are shown. Figure 1 IB is a graph showing thermostability analysis results on E6-aerolysin fusion protein. The percentages of the fusion protein that remained soluble after heating for 30 min. at each temperature are shown.
Figure 12A shows the mutated human thioredoxin sequence that was used as template for generating loop diversified protein libraries; mutations are highlighted by underlined amino acids. The loops are indicated by arches across the peptide sequences. For loop diversifications the grey shaded amino acids, 4 in loopl, 4 in loop3, 6 in 1οορ3', and 4 in loop5, are replaced with random peptide sequences as indicated in Figure 12B.
Figure 12B is a schematic presentation of three loop-diversified libraries, TRX-L1 , TRX-L2, and TRX-L3. The differences among them are around loopl, where different numbers/variations of amino acids are used to replace the active site amino acids 32SGPS35. All three libraries contain the same additional loop diversifications in 1οορ3, 1οορ3', and loop5, as indicated here and in Figure 12A.
Figure 13 shows the EpCAM binding clones selected by phage display using TRX-L1, TRX-L2, and TRX-L3, respectively. The selected sequences are aligned with the template sequence from human thioredoxin.
Figure 14 is a graph showing the phage ELISA assay of EpCAM-Fc and BSA (control) binding with phages that display the selected, discrete EpCAM binders from libraries TRX-L1, TRX-L2, TRX-L3.
Figure 15A is a graph showing the phage ELISA assay results with phages that display the selected, discrete EpCAM binders from libraries TRX-L1 and TRX-L2. The following proteins were immobilized on wells of nunc plates and reacted with phage: EpCAM-Fc, IgGl-Fc, CD22-Fc, CD5-Fc, hEphA2, mEphA2-Fc, BSA. Bound phage was detected with an anti-M13 pVlll antibody conjugated to HRP.
Figure 15B is a graph showing the phage ELISA assays of EpCAM-Fc binding after the phages were heated at indicated temperatures for 10 min. The clones from the TRX-L2 library are more stable than those selected from the TRX-L1 library.
Figure 16 shows a summary on phage display selection of mutated TRX proteins from the TRX-3 library for specific binders to various protein targets, including CD38, CD5, CD19, CD22, EpCAM, LGR5, and HSA. An example of the selected sequences for each target from randomized loopl and 1οορ3' are shown, demonstrating the large variability of the sequences selected for the divergent protein targets.
Figure 17 shows a summary of phage display selection of mutated TRX proteins that bind
specifically to human serum albumin. The alignment of selected loopl and 1οορ3' sequences with that of wild type TRX at corresponding sites revealed two sets of 1οορ3' motifs specific for HSA binding, i.e., the F- rich motif (FXXFXFPXX) and the AGPF motif (LXAGPFXXX).
Figure 18 A is a graph depicting phage ELISA results of phage selected HSA binders listed in Figure 17. The ELISA experiments were performed in triplets on 96-well streptavidin coated plates immobilized with either HSA-biotin or CD5-biotin. The phage display selected clones only showed strong binding to HSA, demonstrating target specificity of these TRX -based binders.
Figure 18B shows bar graphs depicting phage ELIS A assay results using human, rat, and mouse serum albumin as target proteins. The ELISA experiments were performed on 96-well streptavidin coated plates, immobilized with HSA-biotin, RSA-biotin, and MSA-biotin, respectively. The selected clones described in Figure 17 were tested and showed Loop3' motif dependent affinity to RSA and MSA.
Figure 18C summarizes the ELISA results of the phage selected HSA binders. The binders comprising an F-rich motif in 1οορ3' are capable of binding to all three different serum albumins. The binders comprising an AGPF motif in 1οορ3' or a unique 1οορ3' sequence of VYVSLSRHR only showed significant affinity for HSA, not to RSA or MSA.
Figure 19 shows the surface plasmon resonance (SPR) sensorgrams depicting the interactions between HSA and several selected HSA binding mutant TRX proteins (left panel) and their fusion with Renilla Luciferase (right panel). The mutant TRX proteins E2, F3, and H6 (all with F-rich 1οορ3') showed slightly higher affinity to HSA (sub uMs) than the corresponding N-terminus fusion proteins with Renilla Luciferase RLuc-E2, RLuc-F3, and RLuc-H6 (sub to low uMs). The fusion protein of wild type TRX with RLuc (RLuc-TRXwt) did not exhibit strong binding to HSA.
Figure 20A shows the time courses of four RLuc-TRX fusion proteins after intravascular injection into individual mice. The amount of RLuc-E2, RLuc-F3, and RLuc-H6 fusion proteins in plasma decreased significantly slower compared with Rluc-TRXwt.
Figure 20B shows the pharmarcokinetic (PK) data obtained from Figure 20A. The relative area under the curve (AUC) suggests that all the HSA binding mutant RLuc-TRX fusions possess superior plasma stability to RLuc-TRXwt. The RLuc-E2 mutant is 8.8-fold more stable than RLuc-TRXwt, demonstrating the capability of E2 to prolong the half-life of the parent fusion protein to that extent. Detailed Description of the Invention
The present invention provides compositions based on thioredoxin-like fold protein domains, described herein as engineered thioredoxin-like fold proteins (ETRXs). These proteins comprise one or more artificially diversified thioredoxin-like fold protein domains; each domain may be originated from the same or different thioredoxin-like fold protein domains. Of particular interest are the ETRXs that have been derived by substitution of two or more loops of a naturally occurring thioredoxin-like fold sequence. These loop-diversified ETRXs may contain additional sequence variations, for example improving affinity, stability, selectivity, or solubility, that have been introduced at any location in the molecule. In addition, an ETRX may be optionally substituted with prosthetic groups, polymers, proteins, nucleic acids, carbohydrates, metals, or natural or synthetic small molecules and toxins. 723 protein domains that may be grouped into eleven evolutionary families have been identified to date with a thioredoxin-like fold based on combined sequence, structural, and functional evidence (Qi and Grishin, Proteins, 2005, 58(2):376-88). The protein domains that were unified into the thioredoxin-like fold group represent different circular permutations of the thioredoxin-like motif, which contains six secondary structural elements, i.e., four β-strands and two oc-helices, compiled into a three -layer α/β/α sandwich (Figure 1A). Amino acid sequences of representatives of the eleven evolutionary families are shown in Figure 2, and the three-dimensional structures of four of these proteins are illustrated in Figures IB-IE.
A structure-based multiple sequence alignment of 90 representative thioredoxin-like fold protein domains was manually constructed (Figure 2, from Qi and Grishin, Proteins, 2005, 58(2):376-88). From this alignment, it is evident that some protein domains of the thioredoxin-like fold incorporate insertions of secondary structure elements into its common structural motif. Specifically, a number of proteins from four families possess the oc-helix oc3' , and proteins from other four families have an extra αβ unit inserted between the β-strands β2 and β3. This demonstrates that the thioredoxin-like fold can easily accommodate exceedingly variable sequences between β2 and β3 (including loop3 and 1οορ3'). Additional solvent exposed loops, including loopl, 1οορ2, loop4, and loop5, are also highly tolerable to variations in loop length. Many members of the thioredoxin superfamily contain the conserved active-site motif CXXC that is located at the N-terminus of oc-helix cel. In addition, a cis-proline residue located at the 1οορ3' is conserved and is in spatial proximity to the CXXC motif.
Importantly, the length of the sequences corresponding to the CGPC motif of thioredoxin is highly conserved within the ocl oc-helix in all of the thioredoxin-like fold protein domains, implying that any insertion of additional amino acids between the residues aligned with G33 and P34 may not be evolutionarily favored. This information provides an explanation for the observed severe destabilization to the E. coli thioredoxin caused by an insertion of 21 amino acid aptamer eIF4G-SG into its active site (Brown et al. J. Mol. Biol. 2010, 395(4):871-83). The loop diversification of the invention does not include the insertion of a peptide aptamer at this particular location (correspondingly between Gly33 and Pro34 of active site CGPC in thioredoxin) of the thioredoxin-like fold protein domains.
One preferred embodiment of the present invention is an ETRX comprising an engineered protein domain of the thioredoxin superfamily. Figure 3 (obtained from NCBI's Conserved Domains Database) lists the protein subfamilies that belong to the thioredoxin super family (pfam cd01659).
A further preferred embodiment is an ETRX derived from a human thioredoxin-like fold domain of the thioredoxin superfamily. Figure 4 shows the GI numbers of the human proteins, grouped in subfamilies, within the thioredoxin superfamily: 121672, 4467837, 13124748, 20810223, 33516901, 1B4Q_A, 6940947, 28193244, 1SJ6_A, 1WRY_A, 6010105, 31418324, 51464459, 1JHB, 5107031, 37537704, 37542493, 1EEM_A, 1GSE_B, 1IYI_D, 1XW5_B, 3LJR_B, 3PGT_B, 1K0N_A, 1XWK_A, 3GTU_D, 5GSS_A, 3GSS_A, 1K3Y_B, 1TDI_A, 1FW1_A, 1LJR_B, 1RK4_B, 38257679, 56203088, 55961068, 119165, 38257738, 52632405, 57997510, 56789715, 2570009, 55962678, 20141285, 1AUC, 1ERT, 1GH2_A, 6840947, 20455529, 33340051, 31543836, 47606157, 1W0U_A, 1QGV_A, 1PQN_A, 51702156, 31542723, 50401164, 5430701, 27808673, 21706735, 23503035, 20454906, 24414114, 3882309, 1SEN_A, 29839560, 2507460, 24308127, 31077035, 47117631, 2501205, 54633317, 38505222, 20521894, 119530, 1208427, 30842594, 1203965, 30173124, 54633317, 28372543, 1208427, 119530, 2501208, 37182420, 24308127, 29839560, 49456295, 5453541, 66774045, 7705726, 55960250, 19923987, 33149331, 42476013, 1WP0_C 8134662, 33150834, 37183236, 46395720, 1QMV_A, 1PRX_A, 10C3_B, 1H40_H, 20455499, 2BJX_A, 1BJX, 119530, 21264492, 21757251, 37182195, 4557409, 55957226, 34531342, 2507461, 33150564, 21264492, 27502832, 37182195, 119530, 33149331, 4557549, 55957226, 34531342, and 2501205.
Another preferred embodiment is an ETRX comprising an engineered protein domain of the thioredoxin family (pfam cd02947). A further preferred embodiment is an ETRX comprising an engineered protein domain of the thioredoxin family from Homo sapiens, including proteins with the following GI numbers: 1AUC, 1ERT, 1GH2_A, 6840947, 20455529, and 33340051.
Table 1 shows the selected human thioredoxin fold protein domains from the thioredoxin superfamily that have been disclosed in the list U.S. Patent documents.
Table 1 .
Patent Disclosures on Human Proteins from TRX Superfamily
Figure imgf000018_0001
Diversity in the loop regions of ETRXs is introduced through the incorporation of diversity in nucleic acids encoding ETRXs. For this purpose, random or indexed collections of nucleic acids encoding different sequences can be prepared according to any of several methods known in the art. Such collections can be prepared in ways that favor specific sequences or residues, or disfavor specific sequences or residues, by altering the probability of appearance of specific nucleotides in a site-specific or site -non-specific manner, or by specifying triplets of nucleic acid residues corresponding to individual codons and varying the relative abundance of said triplets in a site-specific or site -non-specific manner. For example, to reduce the abundance of cysteine residues, encoded in DNA by TGY, the relative abundance of T in the first position, G in the second position, or a pyrimidine (Y = C or T) in the third position, can be reduced in the template nucleic acid, illustrated here as DNA. Alternatively a mix of triplet precursors corresponding to each of the individual amino acids could be prepared, from which the triplets TGT and TGC are excluded. To reduce the frequency of termination codons, a common strategy is to randomize loops in the form (NNS)n, where n denotes the number of random triplets to be included, N represents any nucleotide, and S represents C or G in the standard IUPAC nucleotide nomenclature. Since two of three stop codons (TGA and TAA) have an A in the third position, an NNS strategy is expected to reduce the frequency of stop codons from 3/64 to 1/32 compared to an NNN strategy.
The preparation of loop-diversified ETRXs may be carried out by any of several different schemes well known in the art. For example, libraries of ETRXs containing loop regions replaced by random peptide sequences of the same or different length can be prepared by recombinant DNA methods. Such libraries can be prepared as variants of a single scaffold having up to six loops diversified in a single ETRX or can be prepared as separate libraries each having one diversified loop per ETRX, or by some combination of loop- diversified libraries, for example having two diversified loops at one end and one at the other. Schemes in which individual libraries of loops are provided are often coupled with a facility for the interchange of the individual libraries, for example by the placement of restriction enzyme cleavage sites in the non-diversified regions that permit shuffling and reassembly of the library templates by restriction enzyme digestion and ligation. Other methods for shuffling of existing sequences are well-known in the art, and include recombination in vitro or in vivo, and nucleic acid shuffling and rejoining by PCR or isothermal amplification. In some cases it may be useful to create sub-libraries from existing libraries, or sub-libraries that incorporate some previously selected candidate ETRX as a starting point for the generation of further diversity focused on a particular ETRX with desirable properties. For example, to further improve the affinity of a pool of candidate ETRXs that shows a predominance of one loop sequence, a new library can be created in which that loop sequence is taken as the starting point and further randomization is introduced by partial or complete randomization of the other loops and/or by partial randomization of the predominant loop.
To retain proximity in sequence space to a favored sequence, many different strategies are known in the art. By way of example and without limitation, to diversify around the codon for methionine, ATG, and retain hydrophobic character, the template could be specified to contain at the first position 40% A and 20% of each other residue (C or G or T), at the second position 70% T and 10% of each other residue, and at the third position 75% of G and 25% C. Such a mixture would weight the substituted residues toward hydrophobic amino acids (which often contain a T in the second position), consistent with the hydrophobic character of methionine. The most likely encoded amino acid would be methionine itself. Depending on practical limitations for the preparation of the template nucleic acids, it may be more or less convenient to randomize each position in a manner specific for that residue, and in practice randomization schemes are frequently chosen that introduce an invariant probability of retaining one dominant residue and a fixed proportion of alternate residues, for example 70% A, 30% B for A, 70% C, 30% D for C, 70% G, 30% H for G and 70% T, 30% V for T. B, D, H and V are respectively the IUPAC codes for "not A"=C,G, or T, "not C"=A, G, or T, "not G"=A,C or T, and "not T (and not U)"=A, C or G.
The engineered thioredoxin-like fold proteins of the present invention are useful for the creation of binding proteins that adsorb with high affinity to selected targets. The potential uses of such binding proteins are broad, and include, without limitation, the analytical detection and measurement of molecules or complexes of molecules, the interruption or neutralization of cellular or humoral signaling events via the blockade of enzymes, receptors or ligands, the normalization of homeostatic balance by return of functionality compromised by age, disease, or trauma, the induction of receptor-mediated signaling by receptor agonism, the targeting of undesired cells for destruction, and the localization of binding targets, for example of tumors, microbes, thromboses, or sites of tissue damage. Targets of artificial binding proteins are often proteins or peptides but can also be carbohydrates, lipids, nucleic acids, small molecules such as drugs, metabolites, or toxins, or compositions formed from small molecules or inorganic species such as either natural or synthetic polymers, glasses, metals or alloys, semiconductors or insulators; targets can also comprise modifications or substitutions of proteins, carbohydrates, lipids, or nucleic acids, or combinations of one or more such agents, such as a carbohydrate-substituted proteins, carbohydrate-substituted lipid, RNA- protein complexes, etc. Methods for identifying binding proteins that display high-affinity and high specificity for their targets are known in the art.
One large set of preferred targets for ETRXs are human plasma proteins. For decades, biomedical researchers and clinicians have used plasma to isolate and measure proteins that can be useful for the diagnosis or monitoring of disease. In particular, the identification of protein biomarkers for the early diagnosis, subtyping, and monitoring of treatment for chronic diseases, including cardiovascular diseases, cancer, arthritis, Alzheimer's disease, pulmonary disease, and autoimmune diseases, is now a central focus in clinical proteomics. The Healthy Human Individual's Integrated Plasma Proteome (HIP2) database (Saha, S. et al, BMC Med. Genomics 2008, i:12) has so far collected a set of 12,680 unique human plasma proteins using shotgun mass spectrometry analysis, the Swiss-Prot accession numbers of which downloaded from http://bio.informatics.iupui.edu/HIP2/ and is cited in Table SI of U.S. Provisional Application No.
61/468,836 as preferred targets, and specifically incorporated herein by reference.
A set of further preferred binding targets for ETRXs are Human Proteome Organization (HUPO) Plasma Proteome Project (PPP) core dataset of 3020 plasma proteins (Omenn, G.S., et al, Proteomics, 2005, 5(73):3226-45), which have been described to be comprised of a diverse group of proteins from the human proteome, including glycoproteins, DNA-binding proteins, coagulation pathway, cardiovascular, liver, inflammation, and monocular phagocyte proteins. A list of these 3020 plasma proteins with corresponding Uni-Prot accession numbers is available through BiomarkerDigger Database
http://biomarkerdigger.org/frontpage.html, and is cited in Table S2 of U.S. Provisional Application No. 61/468,836, and specifically incorporated herein by reference.
Another collection of preferred targets for ETRXs comprises proteins of the main human peripheral blood constituents (Haudek, V.J. et al , J. Proteome Res. 2009, S(S):3834-43). The identified proteins in T cells, monocytes, neutrophils, platelets, erythrocytes and plasma and PBMCs are sorted according to protein names and identified by their Swiss-Prot accession numbers cited in Table S3 of U.S. Provisional
Application No. 61/468,836, and specifically incorporated herein by reference. .
Cancer biomarkers found in plasma are preferred targets for ETRXs. The community of biomarker researchers has so far compiled from literature and other sources a list of 4531 proteins believed to represent a population of candidate plasma biomarkers that could be useful in early cancer detection and monitoring given sufficiently sensitive specific assays (Lee, B.T., et al. & Anderson, N.L., Biomark. Insights, 2008, 3:65-71). These preferred targets, annotated with gene names and entrez gene ID numbers, are cited in Table S4 of U.S. Provisional Application No. 61/468,836, and specifically incorporated herein by reference. An updated list is downloadable from CLUB ("Candidate List of yoUr Biomarkers"), a freely available, web- based resource (http://club.bii.a-star.edu.sg).
Human immunome proteins represent another set of preferred targets for ETRXs. Immunome is a term that describes all the genes and proteins taking part in immune responses, and comprises CD (cluster of differentiation) proteins for cell surface molecules, as well as classical and alternative complement system, lectin pathway and the components of the membrane attack complex included together with chemokines, cytokines, and their receptors. These preferred targets are cited in Table S5 of U.S. Provisional Application No. 61/468,836, and specifically incorporated herein by reference, which contains 893 gene products with corresponding Swiss-Prot accession numbers and GeneBank ID numbers. An updated list is available from the Immunome Knowledge Base (1KB), a dedicated resource for immunological information
(http://bioinf.uta.fi/IKB/).
Another set of preferred targets for ETRXs is the cell-surface proteins in the human immunome. Proteins located at the cell surface of immune cells are of particular relevance due not only to their participation in the network of interactions that regulate the immune response but also to their potential as excellent targets for diagnostic and therapeutic interventions. A comprehensive database of the human cell- surface proteins expressed in immune cells and lymphoid tissues was generated by integrating information collected from primary literature, databases and electronic information sources (Diaz-Ramos, M.C., et al. Immunol. Lett. 2010, published online Nov 2. PMID: 20932860). This manually curated database catalogues 1015 genes and proteins, includes the gene symbol and name of each protein, describes the family that each protein belongs to, indicates their type of extracellular domains, and compiles data regarding their expression. The database is cited in Table S6 of U.S. Provisional Application No. 61/468,836, and specifically incorporated herein by reference.
Therapeutic targets that have been established by research, development, and clinical applications are also the preferred targets of ETRXs. The proven efficacy of drugs interacting with these targets, either clinically or experimentally, suggests that ETRXs binders to such targets are potential candidate agents to elicit therapeutic responses.
DrugBank (Wishart, D.S., et al. Nucleic Acids Res. 2008, 36(Database issue):D901-6) is a richly annotated resource that combines detailed drug data with comprehensive drug target and drug action information, in which both FDA-approved small molecule and biotech drugs and experimental drugs are included. These drugs are linked to more than 2500 non-redundant protein or drug target sequences, comprising the "All Drug Targets" list of target proteins cited in Table S7 of U.S. Provisional Application No. 61/468,836, and specifically incorporated herein by reference. The protein targets include approved drug targets, small molecule drug targets, nutraceutical drug targets, experimental drug targets, withdrawn drug targets, biotech drug targets, and illicit drug targets, and are available for download from DrugBank
(http://www.drugbank.ca/downloads).
MATADOR (Manually Annotated Targets and Drugs Online Resource) is a resource for protein- chemical interactions. It differs from other resources in its inclusion of as many direct and indirect interactions (Giinther. S. et al. Nucleic Acids Res. 2008, 36(Database issue):D919-22). MATADOR contains 2901 protein targets, which are cited in Table S8 of U.S. Provisional Application No. 61/468,836, and specifically incorporated herein by reference, and included as additional preferred targets of ETRXs.
Therapeutic Target Database (TTD) has been developed to provide information about therapeutic targets and corresponding drugs (Zhu, F., et al. Nucleic Acids Res. 2010, 3S(Database issue):D787-91). This database currently contains 1906 targets, including 358 successful, 251 clinical trial, 43 discontinued and
1254 research targets, and 5124 drugs. The protein sequences of these targets are available for download at http ://bidd. nus . edu. s /group/cj ttd/TTD Download. asp, which are cited in Table S9 of U.S. Provisional Application No. 61/468,836, and specifically incorporated herein by reference, and included as further preferred targets of ETRXs. Yet another set of preferred targets for ETRXs are cancer cell surface markers. It has been demonstrated that in many types of cancer, some surface antigens are significantly upregulated in cancerous cells in comparison to normal cells. These differentiated expressions offer opportunities for selective binding of ETRXs to cancer cells for detection or destruction. Listed in Table 2 are some of the examples of these potential targets.
Cancer stem cell surface markers are further preferred targets for ETRXs. Cancer stem cells may have direct therapeutic relevance due to resistance to current treatment paradigms, suggesting novel multimodal therapies targeting the cancer stem cells may improve patient outcomes. Listed in Table 3 are examples of protein targets related to cancer stem cells reported in literature to date.
able 2. Cancer Cell Surface Anti en Tar ets
Figure imgf000023_0001
(Six-trans- some presence in bladder; low and breast cancer membrane level in colon, pancreas,
epithelial antigen stomach, and uterus
of the prostate)
CSPG4 High expression in >80%
(chondroitin Restricted distribution in melanoma lesions; preferentially
Q6UVK1
sulfate pronormal tissues expressed in -73% triple negative teoglycan 4) breast cancer tissues
Table 2. Continued
Figure imgf000025_0001
Table 2. Continued
Figure imgf000026_0001
Table 2. Continued
Figure imgf000027_0001
Table 2. Continued
Figure imgf000028_0001
Table 2. Continued
Figure imgf000029_0001
Table 2. Continued
Figure imgf000030_0001
Table 2. Continued
Figure imgf000031_0001
Table 2. Continued
Figure imgf000032_0001
Table 2. Continued
Figure imgf000033_0001
Table 3. Protein Targets Associated with Cancer Stem Cells
Figure imgf000034_0001
Figure imgf000035_0001
aDeonarain M.P. et al. niAbs, 2009, 1(1): 12-26.
*Liu, H.G. & Zhang, X.H. Asian Pac. J. Cancer Prev. 2009, 70: 177-179.
"Alison, M.R., et al. J. Pathol. 2010, 222:335-344.
dChan, K.S., et al. Curr. Opin. Urol. 2010, 20:393-397.
"Todaro, M. et al. Gastroenterol. 2010, 735:2151-2162.
Lee, T.K.W. et al. Liver Int. 2009, 29(7):955-965.
¾ramo, A. et al. Oncogene, 2010, 29:4625-4635.
'Ma, Allan, A.L., Stem Cell Rev. Rep. 2010, PMID: 21103958. 'Liu, T. et al. Mol. Cell. Biochem. 2010, 340( 1 -2 ):265 -73
^Trerotola, M. et al. Am. J. Transl. Res. 2010, 2f2j: 135-144.
^Maitland, NJ, & Collins, A,T. /. Clin. Oncol. 2008, 26( 7):2862-2870.
'Chen Z.G., /. Oncol. 2009, 2009:894064.
"D'Alterio C, et al. Cell Cycle, 2010, 9(22 j:4492-4500.
"Majeti, R., Oncogene, 2010, PMID: 21076471. ETRXs of the present invention can also be used to create novel activities, such as catalytic activity, or substrate activity, based on the incorporation of prosthetic groups or designed or randomly selected sequences that can be installed in the ETRX. For example, ETRXs can be used to generate substrates or inhibitors of proteases, or to provide proximity enrichment for substrates for enzymatic activities. In keeping with their utility as antibody equivalents, genetic selections or designed modifications that introduce catalytic potential can be incorporated into ETRXs through methods well known in the art, such as selection for affinity to a transition state analog of an intermediate that is found in a reaction to be facilitated by an ETRX.
To achieve high affinity and selectivity, ETRXs can be endowed with a novel surface complementary to a target of interest. For this purpose, random libraries of proteins can be created and screened for rare variants that have desired properties; alternatively, specific variants can be designed by computational analysis of the target binding surface and construction of a series of candidate binding proteins that may have the appropriate behavior. Random substitution schemes can be employed when the detailed molecular structure of the target is not known, or when the most appropriate site on a structurally well-characterized molecule cannot be determined in advance. Most contemporary scaffold diversification strategies are based on random substitution. The invention further provides for mixed computational and random strategies, for example in which random diversification leads to candidates that are further optimized by directed substitution, or the use of computational techniques to predict families of candidates that can be screened for an activity of interest. Construction of libraries and designed variants
Libraries of ETRXs can be prepared in various ways known to those skilled in the art. Disseminated random substitution, clustered substitution, and designed (targeted) alteration are strategies that have been employed to increase the affinity of a given diversified scaffold for a particular target protein. In general, the objective of such diversification is to increase affinity without compromising the overall stability or solubility of the protein. One of the most widely employed strategies is surface randomization, the replacement of endogenous sequences on one particular aspect or face of a protein in order to generate a highly diverse collection of surfaces. Two common subtypes of surface randomization are loop and pocket diversification, used for proteins that are naturally convex or concave respectively. Randomizations may conserve or alter the length if the scaffold is appropriately stable. In addition, the natural geometry of the scaffold may be altered by incorporation of structural elements that endow the randomized or grafted sequences with particular folds or shapes. Among the known elements that may be employed for such purposes are the placement of cysteine residues such that a disulfide -linked loop is formed, the introduction of helix or sheet- destabilizing residues, such as glycine or proline, the incorporation of beta turns or Trp cage motifs, or the formation of additional secondary structure elements, such as short alpha helical or beta strand sequences. The affinity and stability of ETRXs with randomized surface loops can be further improved by the inclusion of mutations in the beta strands that improve rigidity or alter the positioning of the loops. Such favorable noncontact site mutations are well-known in the art and can be discovered by random mutagenesis once an initial candidate has been identified. Typically mutagenesis of the entire ETRX is performed, with selection for variants that exhibit higher binding affinity.
The engineered thioredoxin-like fold proteins of the present invention can be further adapted to include extensions/diversifications at their amino or carboxyl termini. The additional diversity may enhance affinity by providing secondary binding sites to the target, or may enhance the functional properties of the protein by binding to proteins with enhanced plasma half -life, or proteins that are known to be enriched in the vicinity of the target, or that afford the possibility of concentration in an organ or tissue-specific manner by binding to organ or tissue-specific secondary targets. When additional diversity elements are incorporated at the amino or carboxyl termini, measures may have to be employed to protect those elements from naturally occurring exopeptidases, such as the peptidyl peptidases, aminopeptidases, carboxypeptidases, and related enzymes. Methods of predicting and defeating susceptibility to exopeptidases are well known in the art. Methods of blocking exopeptidase activity include amino and carboxyl-terminal modification, incorporation of additional residues that are not substrates for the exopeptidases, or chemical modifications that destroy susceptibility.
The identification of a high-affinity, high selectivity ETRX can be achieved by either screening methods or selection methods. A screening method typically requires two elements: a supply of candidate ETRXs to be tested for affinity to the target; and a systematic method for the enumeration of the candidates, such as an ordered array or systematically composed mixture that can be convoluted to reveal the identity of the most active variants. Screening methods often require that large numbers of ETRXs be evaluated; in such cases it is common to use pooling schemes to mix candidates, allowing the presence or absence of a desired candidate to be determined with fewer measurements. Active pools are further subdivided to identify active unique species. Candidates derived from such screens can be subjected to further randomization and screening to progressively derive ETRXs of higher binding affinity.
Selection methods typically require a library of candidate ETRXs, each prepared in a form that provides a genetic linkage between the protein and a nucleic acid that encodes or identifies the protein. A mechanism must be provided to physically isolate and purify candidate binding proteins and their associated nucleic acids from the remaining library members that lack activity. In selection methods many fewer measurements are typically performed than in screening methods.
The present invention further provides methods for the identification of ETRXs having favorable affinity, selectivity, solubility, and thermal stability. Numerous selection methods for the enrichment of nucleic acids encoding proteins of interest that bind to a specific target are known in the art and are useful for the generation of the desired ETRXs. Among these are the so-called display technologies, including phage display, yeast display, bacterial display, viral display, mammalian cell display, ribosome display, RNA display, and DNA display. For the application of a particular form of display, an appropriate vector must be provided that is suitable for the display of the ETRX in the context in which selection is to take place. For example for commonly practiced forms of bacteriophage display, a plasmid encoding a translational fusion between a solvent-exposed phage structural protein and the ETRX must be created. For cellular display, such as bacterial, yeast or mammalian cell display, a fusion or stable association is created between a surface protein and the ETRX. For ribosome or mRNA display, a fusion or stable association must be created between the diversified binding protein and the mRNA that encodes it. For DNA display a fusion or stable association must be created between the ETRX and a high affinity, typically site-selective, DNA -binding protein. For some types of selection methods, physical association of the binding protein and the nucleic acid that encodes it is provided by physical compartmentalization. For example, in emulsion selection methods, a small aqueous droplet is provided in which the ETRX is synthesized from a template nucleic acid. In this case the physical association is provided by the compartmentalization afforded by the non-aqueous phase that separates the individual droplets.
Display-based selections consist of one or more cycles of enrichment, each of which comprises: (i) contacting the target of interest with a mixture of diversified proteins in display context, e.g. as phage particles, cells, or RNA fusions; (ii) physically separating those phage particles, cells or RNA fusions that bind the target from those that do not bind the target, or bind less avidly, and (iii) amplifying the resulting isolated binding population by in vivo or in vitro methods to generate a new, enriched collection of diversified proteins that can be subjected to additional rounds of contact and purification. For display-based selections it is a requirement that the target permit physical isolation of the complex of target and ETRX. For example, the target may be labeled with an antibody domain, peptide tag, fluorophore, biotin, or other affinity or labeling moiety, allowing the complex of ETRX and target to be physically separated from ETRXs that do not interact with the target.
Alternatively, antibodies or binding reagents specific for the target can be employed to effect separation. Often it is necessary to exclude unwanted ETRXs, for example those that bind to extraneous portions of the target, or to components of the apparatus used to effect physical separation. Common separation strategies rely upon an affinity matrix for the antibody domain, peptide tag, biotin, epitope or affinity moiety, such as a bead or magnetic particle bearing the cognate binding element for such antibody domain, tag, biotin, epitope, or affinity moiety. Examples of commonly encountered binding elements include protein A, streptavidin, monoclonal or polyclonal antibodies, and coordinated transition metal divalent cations. Alternatively, separations based on fluorescence detection and sorting can be used. Such separations typically distinguish the signal conveyed by a fluorescent moiety or fluorophore attached to the target, and permit the identification and selective separation of cells or particles bearing high concentrations of the target by fluorescence-activated cell sorting. The contributions of undesired ETRXs can be reduced by pre-absorption steps that mimic target exposure and enrichment, but are conducted in the absence of target. Affinity
Selections or screens for ETRXs having the desired binding can be carried out by the methods described above followed by methods to identify candidate ETRXs of particular interest according to their affinity, activity, selectivity, solubility, or thermostability. Many methods for the measurement of affinity are known in the art and include solid phase as well as solution phase measurements of association constant or reaction on and off rates for combination of the ETRX with a target, or for the measurement of the catalytic activity of a catalytic ETRX. From the analysis of such equilibrium or kinetic constants the affinity of the ETRX for its target can be measured. Some methods of measuring affinity include, solid phase assays, such as planar or bead format assays, solution phase assays, or cell-based assays. Detection in such assays can be based on the analysis of changes in a signal generated by a detectably labeled target or ETRX, such as a radiolabeled target or ETRX, targets/ETRXs conjugated to or associated with an enzymatic activity or a fluorophore/fluorescent protein, or an active prosthetic group that behaves as a catalyst for a reaction or a change in property that is easily monitored. Common methods for measuring affinity include radiolabel or enzyme-linked immunosorbent assays, or assays based on surface plasmon resonance, fluorescence resonance, fluorescence polarization, or fluorescence autocorrelation spectroscopy/ microscopy. A common form of affinity measurement is one in which target is immobilized on the solid phase, and varying concentrations of a solution containing a detectable form of the ETRX is contacted with the immobilized target to measure the amount of ETRX bound as a function of ETRX concentration.
Activity
For therapeutic purposes it is often useful to determine the activity of a particular ETRX for its proposed utility. For example, if the ETRX is to exert a therapeutic action by inhibiting the binding of an enzyme to its substrate or a ligand to its receptor, candidate ETRXs with affinity for the enzyme, ligand or receptor can be tested for their ability to inhibit 'the functional association that should be compromised for the desired effect. A bioassay is often used to determine the activity of a candidate ETRX, in which a cellular process or an in vivo response is measured in the presence or absence of progressively greater amounts of the ETRX of interest. Selectivity
ETRXs according to the present invention may bind to single members of families of targets, or multiple members of families of targets, to achieve the desired therapeutic, analytical, manufacturing, or research utility. For example, the neutralization of biological activity for therapeutic purposes may optimally require the antagonism of more than one target, or the quantitation of such biological activity for analytical purposes may require the recognition of more than one target, or the purification of some targets of interest may require the recognition of families of related molecules.
The selectivity of candidate ETRXs can be manipulated during selection or screening by including competitor targets for which binding affinity is either desired or not desired. For example, to create a highly selective ETRX that recognizes one member of a multimember family of targets, such as family of closely related proteins, a preselection can be made with the undesired targets, discarding the so-selected ETRXs, followed by a selection with the desired target. Or the activity of the ETRX identified by selection or screening methods can be assessed by comparing the binding affinity to the desired target with that of unrelated targets or related targets for which affinity is either desired or not desired. Such screening methods need not provide precise information, but for convenience may convey simple approximate measures of relative affinity, for example based on signal strength in an assay format similar to that of an enzyme linked immunosorbent assay (ELISA).
Solubility and Stability
Candidate ETRXs of the present invention that have been identified by selection or screening can be further evaluated and modified if necessary for additional properties that are required for the field of use. For example, for the manufacturing of ETRXs intended for most uses, a candidate ETRX can be highly soluble and thermostable. Methods are provided by the present invention for the evaluation of the solubility and thermostability of ETRXs as well as their suitability for expression in properly folded form in E. coli. In general methods for the evaluation of thermostability are well known in the art, and consist of thermal stress testing or extended storage testing at defined temperatures, followed by measurement of binding activity. In some cases a test for relative thermostability can be as simple as the measurement of the fraction of ETRX remaining soluble following incubation of the ETRX for a defined time at a particular temperature. Another suitable method for measuring thermostability is differential scanning calorimetry. Methods for the indirect assessment of folded status of proteins in E. coli are also known in the art, and in the present invention comprise fusion of the candidate ETRX to an easily monitored protein whose activity is only apparent in its properly folded form, such as GFP or an antibiotic resistance. The relative degree of folding has been found by others to be a property shared by both domains of a fusion protein in E. coli, so that if the ETRX moiety is not properly folded, the likelihood that the GFP or antibiotic resistance moiety will be folded is commensurately low. In such cases cells expressing inactive or improperly folded ETRX fusion proteins will not show high green fluorescence or high antibiotic resistance.
Compositions
Compositions of nucleic acids and polypeptides, as well as substituted nucleic acids and substituted polypeptides, are included in the present invention.
Substituted ETRXs
Substituted ETRXs according to the present invention can be created by site-specific targeting methods that are either chemical or enzymatic in nature. Substitution may be provided either in vivo or in vitro, and can endow the nucleic acid or polypeptide with additional features useful for selection, purification, or therapeutic, analytical, manufacturing or research utility.
Exemplary substitutions that are frequently encountered in the art include prosthetic groups, such as biotin and lipoic acid, N-terminal modifications such as various amides and cyclic amides, alkylations of cysteine or selenocysteine residues, replacement of natural with unnatural amino acids, as for example may be practiced by proteolytic resection and replacement, the formation of isopeptide bonds such as are formed between glutamine and lysine residues, polymer substituents, such as polyalkylene glycols of varying lengths and/or branch structures, small organic molecule substituents, including receptor or ligand binding molecules or their fragments, and various other peptide or nonpeptide adducts that may be attached to the ETRX for a particular utility. The substitutions may aid in the detection, purification, or localization of the ETRXs and may confer favorable properties by virtue of such localization. For example substituted ETRXs may bind to plasma or cell surface proteins to extend the half-life of the substituted ETRX, or may be concentrated on the surface of particular cells, or in certain organs or tissues, by virtue of their affinity for cell-, organ- or tissue- selective secondary targets, such as receptors, carbohydrates, lipids or combinations of such secondary targets as may be presented by the organism to be treated or exposed to the
ETRX.
The engineered thioredoxin-like fold proteins of the present invention may be delivered as pure proteins or may be generated in situ, for example following delivery by a gene targeting or genetic therapy that may involve the in vitro or in vivo modification of the genetic complement of an existing cell to produce the polypeptides of the present invention.
Substitution or modification to achieve extended in vivo half-life
Engineered thioredoxin-like fold proteins may be modified to extend their plasma half-life, for example by modification with polyethylene glycols, by translational fusion or post-translational crosslinking to naturally occurring plasma proteins having extended half -life or by a combination of such methods.
Suitable naturally occurring plasma proteins having extended half -life include antibodies, albumin, apolipoproteins, serpins and some constituents of the complement and coagulation cascades. For example, translational fusion to human antibody Fc domains, particularly human lgGl Fc domain, has been a widely used to improve plasma persistence of proteins. ETRXs may also be endowed with extended half-life by dimerization or multimerization to produce polypeptides that are too large to be naturally subject to renal filtration. Suitable methods for dimerization or multimerization include disulfide bond formation, translational fusion, and chemical or enzymatic crosslinking that is either site-selective or site-nonselective. When translational fusion is employed it may be necessary to provide one or more flexible linkers connecting monomers of the diversified thioredoxin-like fold domains. Such flexible linkers are well known in the art and may consist of a plurality of glycine residues in combination with chiral amino acids that provide favorable aqueous solubility, such as the charged or uncharged hydrophilic amino acids aspartic acid, glutamic acid, arginine, histidine lysine, serine, threonine, tyrosine, asparagine, or glutamine. Flexible linkers need not be confined to glycine and hydrophilic residues so long as the linker so constructed does not confer otherwise unfavorable biophysical properties on the ETRX, such as poor solubility, instability to aggregation, or susceptibility to proteolysis.
The formation of antibodies against ETRXs of the present invention can be minimized by the attachment of polymers, such as polyethylene glycols of varying size, branching morphology and attachment groups, to the core of the thioredoxin-like fold, their N terminal or C terminal extensions, or their prosthetic groups, using either site-selective or site-nonselective methods.
Additional uses of ETRXs
Therapeutic Uses The engineered thioredoxin-like fold proteins of the present invention can be used as targeting principles to deliver other therapeutic or analytical elements to an organism in need of therapy or diagnosis. For example, they may be attached to highly active cytostatic or cytotoxic agents to effect the growth arrest or elimination of an undesired cell type, such as a neoplastic or pre -neoplastic cell, or for the reduction in mass of a hypertrophic tissue or organ such as a hypertrophic prostate, or for the elimination of populations of immune cells that are undesired, for example those promoting or causing autoimmune syndromes. Such cytostatic or cytotoxic agents may be synthetic or natural small molecules, for example, maytansine and its derivatives, anthraquinones, alkylating agents such as cyclophosphamide or its prodrug forms, tubulin- binding agents, geldanamycin or its derivatives, or enediyne antibiotics such as calicheamycin, among others. The cytostatic or cytotoxic agents may also be proteinaceous toxins or combinations of small molecules and proteinaceous toxins. Proteinaceous toxins that may be employed for the purposes of cytostatic or cytotoxic therapies include bacterial toxins, members of which can be drawn from the 339 or more species or families that have been identified to date, including their natural variants, serotypes, isoforms, and allelic forms from both Gram-positive and Gram-negative bacteria (Alouf and Popoff, Eds. "The Comprehensive Sourcebook of Bacterial Protein Toxins, 3rd Ed." Academic Press. 2006). Exemplary bacterial toxins widely used for selective ablation of target cells or tissues include diphtheria toxin, Pseudomonas exotoxin A, anthrax lethal factor, and aerolysin.
Immunogenicity of recombinant therapeutic proteins is a safety concern that may be particularly important to consider for recombinant proteins derived from Trx due to its critical functions in biological systems. However, any anti-drug antibodies generated by the host against engineered Trx are most likely targeted to the epitopes that are located within the solvent exposed loops of the Trx scaffold. Among the solvent exposed loops the loop surrounding its enzymatic active site 32CGPC35 is the most critical for the biological functions of Trx. This active loop, along with a second solvent exposed loop, can be mutated and randomized for binder selections in the present invention. Any host generated antibodies against the mutant Trx molecules will only recognize the epitopes located outside the active site of Trx, thus should spare the active site of endogenous Trx. Consequently it is unlikely for anti-drug antibodies against an engineered Trx to cause severe biological consequences stemming from autoimmunity against native Trx.
Bispecific ETRXs
Dimeric or higher multimeric ETRXs can be used to juxtapose cells or induce cellular actions by receptor crosslinking that may have a favorable therapeutic effect. For example, therapeutic strategies aimed at amplifying the cytotoxic action of macrophages, natural killer cells, or cytotoxic T cells have been described which rely upon the use of bispecific antibodies or related compositions. Such bispecific antibodies typically provide one antibody combining site that recognizes a target on the cell type to be ablated, and a second antibody combining site that recognizes a cell surface receptor on macrophages, natural killer cells, or T cells that, if engaged, induces the cytolytic effector program of those cells, leading to destruction of the target. Alternate forms of bispecific antibodies promote the selective disabling of responses by mast cells or B cells by producing crosslinks between activating receptors, such as the high affinity receptor for IgE on mast cells or the immunoglobulin receptor on B cells, and inactivating receptors, such as the inhibitory receptor for immunoglobulin FcyRIIB, also found on mast cells and B cells. The coordination of the activating receptor and the inhibitory receptor frustrates the signals emanating from the activating receptor, resulting in a favorable therapeutic effect. Similar bispecific compositions can be provided by the ETRXs of the present invention, which can be joined by a variety of methods to provide bi- or multi-specific binding principles for therapeutic treatments. In addition, ETRXs of the invention may be used to target prodrug activating enzymes to cells, tissues or organs that are desired to be made subject to the action of the drug of interest. Such uses of ETRXs follow closely the uses of antibodies in antibody directed enzyme prodrug therapies, which rely upon antibodies for the targeting of a prodrug metabolizing moiety which converts a circulating prodrug to an active form. Such local activation schemes have been developed to allow a more specific delivery of highly toxic chemotherapeutic agents to the vicinity of a neoplastic cell in vivo.
Engineered thioredoxin-like fold proteins can also be used to deliver bioactive principles to a cell, organ, or tissue that is desired to be targeted. To produce interference with the function of a particular pathway that may be essential systemically but undesired in a specific organ, for example to block a hepatic action but not a central nervous system or renal or muscular action, an ETRX can be used to convey an antagonist of that pathway to a specific tissue, by (as in the example cited) binding to a liver-specific cell surface protein. A bioactive principle delivered by the ETRX can be attached to the ETRX by translational fusion or by chemical or enzymatic modification in a site-selective or site-nonselective manner. Diagnostic uses
ETRXs of the present invention can be used as antibody equivalents for many assay purposes.
ETRXs can serve as the capture or detection reagent for ELISA-type assays or as the detection reagent for ELlSpot assays or for the enumeration of protein abundance by flow cytometric measurement technologies. ETRXs can be conjugated to fluorophores, fluorescent proteins or enzymes to aid in the detection and/or quantitation of analytes of interest. Translational fusions of ETRXs to enzymes or other proteins that aid in the detection of analytes can be made and the resulting fusions can be expressed in prokaryotic or eukaryotic cells to provide a convenient renewable source of reagent. The favorable thermostability properties of ETRXs allow their use in arrays of analyte detector, for example in the planar format of protein binding arrays, or in the bead format of multiplexed fluorophore ratio indexed bead systems, such as the Luminex system. Detection of analyte binding with an ETRX can follow many of the assay format designs and detection schemes that have been disclosed for high sensitivity and selectivity detection by antibodies, such as light scattering, light surface plasmon scattering, fluorescence polarization, time resolved fluorescence, fluorescence autocorrelation, electroluminescence, chemiluminescence, fluorescence resonant energy transfer, fluorescence quenching or unmasking, coagulation or flocculation of beads, cells or other particles, or by providing nucleic acid or modified nucleic acid tags for detection by amplification methods including polymerase chain reaction, ligation-mediated probe amplification, branched nucleic acid assay, or isothermal amplification, with or without a ligation step; or by conveying enzymatic activities detectable by absorbance, fluorescence, evanescent field or surface potential perturbation. Monospecific or multispecific ETRXs can be prepared to identify unique analytes or families of analytes. In addition, monomeric, or multimeric ETRXs can be used as capture or detection reagents.
Labeled ETRXs can be used to image diseased cells, tissues or organs, either in vivo or in vitro.
ETRXs can be conjugated to radionuclides, or to prosthetic groups incorporating or binding to other molecules comprising radionuclides. Common radionuclides used in imaging include F-18, 1-131, 1-123, Tc-99m, In-111 or Ga-67. Alternatively ETRXs can be conjugated to groups enclosing caged
hyperpolarized xenon, or can be joined or attached to beads, nanoparticles or nanocrystals susceptible to detection by magnetic resonance imaging. Radionuclides can be detected by nuclear scintigraphy using equipment and methodology well known in the art, such as gamma cameras and positron emission tomography. In addition, images obtained by one modality, such as magnetic resonance imaging can be superimposed on images obtained by other modalities, such as nuclear scintigraphy, or two or more radionuclides of different spectral properties can be combined with different ETRXs, to permit better localization of images and more precise staging or diagnosis of disease conditions. Uses of such conjugated ETRXs include the in vivo imaging of tumors, infections, regions of ischemic damage or poor perfusion, clots, bone or eroded bone, sites of inflammation or degeneration, accumulations of amyloids, paraproteins or prion proteins, or to interrogate the status of prosthetic devices and/or their interfaces with normal or diseased tissue. ETRXs labeled with enzymes, fluorophores, fluorescent proteins, ferritin, gold or silver particles, or electron dense beads, can be used in conjunction with microscopic or ultramicroscopic techniques to diagnose pathological conditions or to identify, enumerate or quantitate the burden of relevant targets that signify the disease status of the cells, tissues, organs or organisms being studied. The imaging of tissues using labeled or conjugated ETRXs can be used to guide diagnostic or therapeutic procedures, such as biopsies, resections, radioablations, radiotherapy, or locally delivered chemotherapy.
Manufacturing uses
The favorable thermostability and solubility properties of the ETRXs of the present invention also permit their use as adsorption reagents for the purification of proteins and complex biological structures, such as vaccine components. The positive manufacturing economies of prokaryotic production allow ETRXs to be used in settings for which the routine use of antibody reagents or materials would be considered prohibitively expensive.
Typically, for a manufacturing use an ETRX having the desired selectivity, solubility, thermostability, and affinity for a target will be prepared in a form that allows its constitution into an adsorbent, which may comprise a column medium, bead, or coated surface to which a target stream is to be exposed. Following adsorption of the target to the solid support, the nonbound material will be removed by one or more washing steps and the desired target material will be eluted, typically by raising or lowering the pH, as is common in the elution of antibody-based affinity supports. Various hydrophilic matrices that are used as supports for such affinity media are well known in the art and includes various, typically porous and crosslinked, polymers, such as crosslinked agaroses, dextrans, acrylamides, hydrophilic acrylates, or inorganic matrices such as controlled pore glass, or nonporous but fine particles such as magnetic beads, and functionalized or surface passivated silica or cellulose particles. ETRXs can be attached to such media by methods such as electrophilic attack by aldehydes, oxiranes, activated carbonates, iminocarbonates, cyanate esters, haloacetamides, maleimides, or activated esters, including carbodiimide activated carboxylic acids. Many commercial suppliers of pre-activated media suitable for attachment of the ETRX are known. In addition, the ETRX can be engineered by the incorporation of specific residues or sequences that favor the attachment of the ETRX to the media in an ETRX site-selective manner. For example, the incorporation of cysteine or selenocysteine residues, or substrate sequences for transglutaminases or sortases can be used to provide specific sites at which the ETRX can be linked to a solid support.
Research uses
Research and analytical uses of ETRXs include the replacement of antibodies for detection and quantitation of analytes in various contexts, for example in immunoblotting, ELISA, ELISpot, flow cytometry, bead-based coagulation or detection systems, for detection of analytes by light scattering, surface plasmon scattering, chemiluminescent or electroluminescent detection, by fluorescence polarization, time- resolved fluorescence, fluorescence autocorrelation, fluorescence resonant energy transfer, or fluorescence quenching or unmasking. ETRXs can be conjugated with various fluorophores or fluorescent proteins to provide probes for the presence or absence of analytes. The analytes may include proteins, carbohydrates, nucleic acids, lipids, small molecules of natural, synthetic or semisynthetic origin, as well as polymers, glasses, metals and alloys, or combinations of these. ETRXs can be conjugated to enzymes, proteins, nucleic acids, carbohydrates, lipids, polymers, small molecules of natural, synthetic or semisynthetic origin, to provide an analyte detection method or additional functionality, or can be endowed with additional substituents having utility for detection or amplification of signal, such as by providing covalent or stable noncovalent attachment of nucleic acid or modified nucleic acid tags for detection by amplification methods including polymerase chain reaction, ligation-mediated probe amplification, branched nucleic acid assay, or isothermal amplification, with or without a ligation step. ETRXs can be adsorbed on solid surfaces, such as plates, trays, capillaries, fabrics, flexible or rigid sheets, beads, or particles, all of which may provide either surfaces for noncovalent absorption or chemically activated surfaces for covalent attachment. Such
ETRXsubstituted surfaces may be used to provide either capture reagents, or in the case of bead or particulate adsorbed material, detection reagents. Examples of uses of labeled ETRXs include, without limitation, microscopy, ultramicroscopy, flow cytometry, flow microscopy, immunoblotting, immunoprecipitation, spectroscopy, or in vivo imaging.
The invention will now be further illustrated by the following non-limiting examples. EXAMPLES
Example 1
Thioredoxin Library Construction for Biochemical Characterization
DNA libraries encoding thioredoxin with mutations and randomized residues (Figures 6A and 6B) were built using PCR extension of synthetic oligonucleotides with overlapping complementary ends. The synthetic oligonucleotides (listed in Table 4) were obtained from Integrated DNA Technologies (IDT).
Random positions were introduced using the NNS nucleotide distribution. Library TRX-1 A was built using oligos MS001, MS002 (Loopl insert), MS004, MS005 (loop 3' insert), MS006 (loop 5 insert), MS010, and MSOl 1. MS004 and MS005 were annealed and extended first and the product of this extension was used as a template for PCR using MS002 and MS006 as primers. The PCR product was gel purified and used as a template in the next round of PCR using MS001 and MS006 as primers. Cloning sites were added using MS010 and MSOl 1. PCR was performed using Pfu polymerase or Phusion polymerase (New England Biolabs, NEB) and then cloned into pET28a using Ncol and Notl. A "wild type" thioredoxin (Figure 6A) was made with MS007, MS008, and MS009 replacing MS002, MS005, and MS006 respectively. TRX- IB was made with the same set of oligonucleotides except with MS003 replacing of MS002. TRX-2 library was made with MS009 replacing MS006.
Table 4. Synthetic oligonucleotides used for thioredoxin template and library construction.
Figure imgf000047_0001
NNSNNGGCGCCGGAGAACTCGCCAACCTTCTGACCTTT
GATAAACTGGTTGTGGTTGACTTCTCTGCCACCTGGTCCGGCCCAT
MS007 CCAAGATGATCAAGCCTTTCTTCCAC
CTCGCCAACCTTCTGACCTTTCTTGAAAAACTGGAAGGTTGGCAT
MS008 AGCTTTCACCTCAGCCTCGGAGGCCACGTCCTGAGCATCGTC
CACCAGTTCGTTGATGGTGGCCTCCAGCTTTTCTTTGTTGGCGCCG
MS009 GAGAACTCGCCAACCTTCTGACCTTT
MS010 AATATATGCGGCCGCCACCAGTTCGTTGATGGTGGC
MS011 ATATTACCATGGTGAAGCAGATCGAGTCC
ATGGTGAAGCAGATCGAGTCCAAGACCGCCTTCCAGGAAGCTCTG
MS040 GACGCTGCCGGCGATAAACTGGTTGTGGTTGACTTC
GAT A A ACTGGTTGTGGTTG ACTTCTCTGCC ACCNNS NNS NNS NNS N NS NNS NNS NNS NNS TGGTCCGGCCC ATCC A AG ATG ATC A AGCCTTT
MS041 CTTCCAC
GGCCACGTCCTGAGCATCGTCAACATCCACCTCGAGGAAAATCAC
MS042 GTTAGAGTACTTCTCGGACAGGGAGTGGAAGAAAGGCTTGATCAT
GACG ATGCTC AGG ACGTGGCCTCCG AGGCTNNS NNS NNS NNS NNS NNS NNS NNS NNS CC A ACCTTCC AGTTTTTC A AG A A AGGTC AG A AG
MS043 GTTGGCGAG
CACCAGTTCGTTGATGGTGGCCTCCAGCTTTTCTTTGTTGGCGCCG
MS044 GAGAACTCGCCAACCTTCTGACCTTT
MS033 GCTAATACGACTCACTATAGGGACAATTACTATTTACAATTACA
MS034 TTTTTTTTTTTTTTTTTTTTAAATAGCGGATGCGCTgcGTCAG
GCTAATACGACTCACTATAGGGACAATTACTATTTACAATTACAA TGGATTATAAAGACGACGACGATAAGGGTGGACCAGTGAAGCAG
MS031 ATCGAGTCCAAG
TTTTTTTTTTTTTTTTTTTTAAATAGCGGATGCGCTGTCAGCTACCA
MS032 CCAGTTCGTTGATGGTGGCC
Example 2 Effect of Peptide Insertion on Solubility and Thermostability
An established prior art is the use of thioredoxin as a scaffold to display peptide aptamers at the active site -32CGPC35-. One rationale was that the disulfide bond formed between the cysteine residues can provide added stability to the core structure of thioredoxin scaffold. However, our analysis of evolutionary history of the thioredoxin-like fold suggests that peptide insertion at this location may not be well tolerated. Indeed, published studies have shown that specific peptide insertions at the active site between Gly33 and Pro34 can destabilize the thioredoxin structure severely, generating mutants with much reduced
thermostability. Also based on sequence alignment of proteins with thioredoxin-like fold (Figure 2), peptide insertions in loopl, N-terminus to the active site -CGPC- may be highly tolerable by the thioredoxin scaffold.
To investigate whether our evolution-based analysis on peptide insertion tolerability is applicable to random peptide insertions, we designed and prepared DNA libraries TRX-1 A and TRX-IB (Figure 6B & Example 1), each encoding a human thioredoxin library with nucleotide insertions corresponding to six random amino acids within loopl (between T30 and W31) or at the active site (between G33 and P34), but both with the identical two additional mutations and/or insertions at 1οορ3' (six amino acids of random sequence replacing five wild type amino acid sequence between A69 and P75) and loop5 (four amino acid insertion between A92 and N93). The solubility and thermostability of libraries TRX-1 A and TRX-IB were examined to provide information on how the human thioredoxin would tolerate peptide insertions at the active site within the constraint of the disulfide bond between C32 and C35, as compared to a similar insertion within nearby loopl. Separately, TRX-2 library is designed so that the suitability of loop5 as a peptide insertion site may be examined in comparison with TRX-1 A. TRX-2 contains the same
insertion/mutation as TRX-1 A minus the loop5 modification (Figure 6B & Example 1), and sequence alignment of thioredoxin-like fold proteins predicts that loop5 can tolerate peptide insertions well (Figure 2).
For TRX-1 A, TRX-IB, and TRX-2 cloned into pET28, randomly selected sequences that were in frame and had no stop codons were transformed into BL21 cells and then expressed at 37°C for 4 hours. Expressed bacterial pellets were spun down from 25 mL of culture and lysed using sonication and then separated into soluble and insoluble fractions after high speed centrifugation. Equal proportions of these fractions were analyzed by PAGE and those sequences having the protein in the soluble fraction determined. For those clones that yielded soluble proteins, the proteins were purified using the in frame-His tag from the pET28 vecor on Ni-NTA agarose (Qiagen). The protein was eluted using 200 mM imidazole and then dialyzed in TBS. The protein was diluted to 20 μΜ and then subjected to 10 min at different temperatures: 50 °C, 60 °C, 70 °C, 80 °C, and 90 °C. The protein was centrifuged at high speeds to separate precipitated and soluble proteins. The supernatant was then analyzed using PAGE and the amount of soluble protein remaining was quantified using Krypton infrared stain (Pierce) and an Odyssey infrared scanner (LI-COR Biosciences). A protein is considered stable if more than 70% of the original amount of protein remains in the supernatant after heat treatment.
The results of these solubility and thermostability assays are summarized in Table 5. Whereas 70% and 80% of the proteins from TRX-1 A and TRX-2 libraries are soluble, respectively, only 20% of TRX-IB members, with peptide insertion at the active site, are soluble. The thermostability results are even more lopsided; none from TRX-IB is stable at 80 °C, while 80% from either TRX-IB or TRX-2 are stable. These results clearly show that peptide insertions within loopl, 1οορ3' , and loop5 into thioredoxin are well tolerated and generated mutants with superior biochemical properties. On the other hand, insertions within the active site of thioredoxin between G33 and P34 are severely detrimental to the solubility and stability of thioredoxin, even though such aptamer insertions had been proposed to be stabilized by C32-C35 disulfide bond and previously used for studies of peptide -protein interactions.
Table 5. Solubility and themostability screen of insertion mutants of thioredoxin.
Number of In-frame Number (%) of Number of Soluble Number (%) of Soluble
TRX Library
Clones Expressed Soluble Clones Clones Tested Clones w/ Tm > 80 °C
TRX-1A 10 7 (70%) 5 4 (80%)
TRX-IB 5 1 (20%) 1 0 (0%)
TRX-2 10 9 (90%) 5 4 (80%)
Example 3
Large Scale Thioredoxin Library Construction and mRNA Pre-Selection
TRX-3 was created using a slightly different strategy in order to maintain loop diversity. A primer extension reaction was performed for 10 cycles with MS041 and MS042 to create a fragment encoding a randomized loop 1. In a separate reaction, a second primer extension using MS043 and MS044 was performed to create a fragment encoding a randomized Loop 3' . These two fragments were mixed together to join the two loops in a primer extension reaction. The resultant combined fragment was gel purified and the diversity was calculated from the yield which came out to be 5.6 x 1012 molecules. This fragment was amplified using PCR with primers MS040 and MS010 to create multiple copies of the library.
In order to purge the synthetic library of frameshifts and stop codons a pre-selection for "intact" sequences was performed using mRNA display (Cho, G. et al., J. Mol. Biol, 2000, 297(2):309-l9.). The TRX-3 library was amplified by PCR using primers MS031 and MS032 in order to perform mRNA display enrichment. The 5' primer contains the T7 RNA polymerase promoter as well as a portion of the TMV translational enhancer. The 3' primer contains a poly- A sequence as well as a binding site for an oligo for UV induced psoralen crosslinking in order to covalently attach puromycin to the 3' end of the mRNA. The puromycin crosslinking oligo is 5' Pso u age gga ugc XXX XXX CC Pu 3' , where Pso: C6-Psoralen; u, a, g, c are made from 2'OMe-RNA amidites; C: standard amidities; X: Spacer 9; Pu: Puromycin-CPG (Glen Research). A 2 mL in vitro translation reaction was performed using 0.5 μΜ crosslinked RNA concentration. The protein-RNA fusions were purified using oligo-dT cellulose, and then reverse transcribed using MS032 as a reverse primer and superscript III (Invitrogen). The RNA -protein fusions were then enriched for open reading frames by binding to M2-anti-FLAG agarose (Sigma) and subsequent elution by free FLAG peptide. Those RNA sequences with frameshifts and stop codons cannot form RNA-protein fusions due to early termination, and therefore will not be enriched during the FLAG selection. The diversity is calculated to be 2.5 x 1011 unique clones based on the recovery from the FLAG column, the pool was subsequently PCR amplified using MS031 and MS032. Multiple copies of the library were made using PCR amplification with MS033 and MS044. In order to increase the diversity of the selected library, a unique asymmetric restriction site (BslI, NEB) was used to digest the amplified library into fragments containing each of the two randomized loops. These loops were then randomly recombined together using T4 DNA ligase (NEB) to regenerate the library diversity of 1 x 1013.
Example 4
Phage Library Construction for CD5 Binder Selections
Phage libraries were constructed according to the procedure by a previously described procedure (Tonikian, R. et al., 2007, Nature protocols, 1368-1386). Our library was fused to the C-terminal domain of gene III from Ml 3 phage in a phagemid vector derived from pUCl 19. The library is preceded by an SRP signal sequence from DsbA. Instead of using degenerate oligonucleotides to anneal to the single stranded phagemid template, we used a long single stranded primer that spanned the entire thioredoxin gene that was generated from a primer extension reaction from the mRNA display pre-selected library, TRX-3 (Figure 4). After PCR amplification of the TRX-3 library with gc517 and gc519 (Table 6), single stranded primers were generated by repeated cycles of primer extension using a phosphorylated primer gc517. The double stranded DNA (cccDNA) synthesis reaction with T7 DNA polymerase and T4 DNA ligase (NEB) was performed using 20 μg of single stranded phagemid DNA and a 3 -fold molar equivalent of the long single stranded primer. The single stranded template molecule for the Kunkel reaction encodes the thioredoxin gene with stop codons in the two loop regions where the randomization was introduced. The library was purified on a PCR purification column (Qiagen) and then electroporated into MC1061 F' variant or TGI competent cells and then amplified using M13K07 helper phage (NEB). The total diversity of the library was calculated based on total number of unique clones. This process was repeated three times, and the combined library was estimated possess a total diversity of 9 x 109. Table 6. Primer sequences used for construction of phage library TRX-3.
gc517 P-CAGATCGAGTCCAAGACCGCC (P=5 ' -phosphate)
gc519 CAC CAG TTC GTT GAT GGT GGC
Example 5
Preparation of Extracellular Domain of CD5 for Selections
The extracellular domain for the CD5 receptor (ECD-CD5) was fused to a tag sequence with a streptavidin binding protein sequence (SBP) (Figure 8A) (Keefe, A.D. et al , 2001, Protein Expr. Purif., (23):440-446 and Wilson, D.S. et al , 2001, Proc. Nat. Acad. Sc , (98):3750-3755) followed by a His8 tag in a mammalian expression vector. The construct was transiently transfected into HEK293T cells using tranfectin (Biorad) and allowed to express protein ECD-CD5-SBP-H8 for 5 days after changing the media to OptiMEM (Invitrogen). Media was harvested and then purified first using Ni-NTA agarose with 200 mM imidazole elution in PBS. A second purification on streptavidin-agarose (Pierce) was performed and the protein was eluted with 10 mM d-biotin in PBS. The purified protein was biotinylated using NHS-PE04- biotin (Pierce) reagent and then dialyzed to remove free biotin. Example 6
Phage Display Selections Using ECD-CD5-SBP-H8 as Target
Streptavidin magnetic beads (MyOne streptavidin Tl beads, Invitrogen) were pre -immobilized with biotinylated target protein ECD-CD5-SBP-H8. Approximately 200 μg of beads was incubated with a 200 nM solution of the target protein in a total volume of 500 μΕ, and subsequently blocked with 0.5% BSA in PBS. Approximately 10 x 1012 phage were incubated with the beads for approximately an hour at room temperature and then washed ten times with 1 mL of the same buffer. The bound phage were eluted with 100 mM HC1 and quickly neutralized with 1/5* volume of 1M Tris pH 8.3. The phage were recovered by infecting log phase XL-1 blue cells for 30 min and subsequently adding 1010/mL M13K07 helper phage. The mixture was diluted into 2YT/Ampicillin and then amplified overnight. Phage were harvested from the media and precipitated with 20% PEG8000/2.5 M NaCl and then redissolved in PBS with 20% glycerol.
Approximately 1011 phage were used in the next round of selection. For Rounds 2-4, the bound phage were washed with 1 mL PBS, pH 7.4 with 0.3 M NaCl, 0.5% BSA, 0.2% Tween-20 and 2 mM d-biotin in order to increase the stringency of the selection. The amount of phage recovery was calculated after tittering phage infection of XI- 1 blue cells after elution. A titer increase was observed after three rounds of selection, the increase was further amplified after round 4 (Figure 8B).
The enriched clones were sequenced, which revealed a unique CD5-binding clone E6 with the sequence shown in Figure 9A. Based on the X-ray crystal structure of human thioredoxin, the mutation/insertion sequences in loopl and 1οορ3' of E6 are located in close proximity and could interact with the target CD5 in a concerted fashion.
A subsequent phage display experiment was done in which the phage were induced with 0.2 mM IPTG before the first round of selection and in between rounds in order to increase the display level of the thioredoxin-pIII fusion on the surface of each phage particle. Sequencing revealed that a higher proportion of the sequences from the selected pool were positive binders compared with the first selection. Binders designated as Al, A5, and E10 were identified from this experiment. The selection protocol remained the similar to that described above. Example 7
Characterization of Selected E6 Phage Using ELISA
The phage expressing E6 protein was tested for its CD5 binding activity using ECD-CD5-SBP-H8 protein immobilized to streptavidin plates or HEK293T cells transfected with a vector that provide cell surface expression of CD5.
Protein based phage ELISA was performed as described (Tonikian, R. et al., 2007, Nature protocols,
(2^: 1368-1386). Biotinylated CD5 was diluted to 1 μg/mL and then 100 μΕ was incubated in each well of a streptavidin coated plate (Nunc). The wells were then blocked with 0.5% BSA in PBS. Phage were produced by inoculating an XL-1 blue cell with a unique phagemid clone into 2YT media containing 1010/mL helper M13K07 helper phage. The growth media was diluted two-fold with PBT (PBS, 0.5% BSA, 0.05% Tween-20) and 100 μΕ was added to each of the wells; wells without immobilized CD5 was used as a control. The plate was washed eight times with 200 μΕ of PT (PBS, 0.05% Tween-20). Fifty μΕ of Anti-pVIII-HRP antibody was added at a 1 :5000 dilution in PBT and incubated for 30 minutes at room temperature. After the plate was washed six times with 200 μΕ PT and then twice with PBS, 100 μΕ of a freshly mixed
TMB/peroxide mixture (Bethyl Laboratories) was added to each well and incubated for 15 min. An acid stop solution was added and the plate was read at 450 nm. The results shown in Figure 7B demonstrate that E6 binds to CD5, but not to the control streptavidin. As expected, the positive control anti-CD5 scFv antibody also showed similarly high CD5 selectivity. In comparison, neither a non-binder clone D6 nor the negative control (buffer only) shows any CD5 binding activity. Clones from the second phage selection; Al, A5, and E10 all show preferred binding to the biotinylated CD5 protein and not the control CD 19 protein.
The cell-based phage ELISA was performed in a similar fashion, except the target CD5 was expressed on transiently transfected HEK293T cells. A confluent 10 cm plate of cells was split into 4 lysine - coated 96-well plates (BD Biosciences). One half of the plate was transfected with a mammalian expression vector encoding CD5 and the other half with an unrelated receptor, CD19, using 0.1 μg of DNA and 0.2 xL of transfectin per well. The transfected cells were grown for three days and then crosslinked to the well using 1% formalin solution in PBS after washing. The cells were blocked with PB for several hours to overnight and then phage were added and detected as described above. The results are shown in Figure 7C. Whereas the positive controls anti-CD5 scFv and anti-CD19 scFv showed excellent binding to CD5-and CD19- expressing cells, respectively, E6 showed specific binding to CD5 expressing cells. Non-related TRX clone A2 did not bind to either cells.
Example 8
Expression, Characterization, and Cytotoxicity of a CD5-Binder-Aerolysin Fusion
E6 clone from the CD5 selection was PCR amplified with gc615 and gc617 (Table 7), digested with EcoRI and Nhel, and then cloned into modified pET28 based vectors designed to produce the free E6 protein and an N-terminal fusion to the large lobe of the aerolysin toxin protein, respectively. The protein was expressed in E. coli and then purified on Ni-NTA agarose then subsequently eluted with 200 mM imidazole. The eluted protein was dialyzed against TBS to remove free imidazole.
Table 7. Sequences of PCR primers used for cloning of CD5 binder E6.
Figure imgf000054_0001
The protein was diluted to 100 μΜ and then coupled with NHS -fluorescein at 1:3 ratio respectively. The free fluorescein was removed with dialysis and then the labeled protein was incubated with wild type Raji cells that do not express CD5 and modified Raji cell line ectopically expressing wild type CD5. The cells were harvested and washed with PBS with 0.5% BSA and then incubated with the labeled protein for 1 hr. The cells were briefly washed with PBS twice and then analyzed on a Facscalibur cell counter (BD Biosciences). The results shown in Figure 10A illustrate that both free protein E6 and E6-aerolysin fusion protein can bind to the cell surface of CD5+ Raji cells, but not the CD5- Raji cells. The positive control of this experiment was provided by anti-CD5 antibody, which also showed specific binding to CD5+ Raji cells only. This experiment established that E6 is capable of specific binding to cell surface CD5, and can direct a fused toxin to cells that express CD5.
The E6-aerolysin fusion protein was tested against Raji cells ectopically expressing or not expressing CD5 on the surface of the cell. Approximately 50,000 CD5 negative and positive cells were split into individual wells in a 96-well plate in RPMI media. The E6-aerolysin fusion was added at various concentrations in triplicate. After incubation for 48 hours, the cells were analyzed using MTS cytotoxicity assay (Promega) for 3 hours and then analyzed on a plate reader. PBS was used as a negative control and 0.1% Triton X-100 was used a positive control for toxicity. The dose response curves are shown in Figure 8B. E6-aerolysin killed CD5+ cells with much lower EC50 (132.1 nM) than CD5- cells (EC50 = 1.56 μΜ), demonstrating CD5-selective affinity of E6-aerolysin. Example 9
Thermostability Analysis of E6 and E6-Aerolysin Fusion Protein
To investigate whether the selected TRX -based CD5 binder E6 retained the thermostability of the wild type TRX, both E6 and E6-aerolysin fusion were analyzed for their tolerance to heat treatment. In 50 μΕ of PBS buffer, 20 μΜ of E6 protein and E6-aerolysion fusion protein were incubated at 0 °C, 37 °C, 55 °C, 72 °C, and 95 °C, for 30 min, respectively. After centrifugation for 10 min. at 12,000 rpm, 30 μΕ of each supernatant was analyzed using PAGE and the amount of soluble protein remaining quantified using Krypton infrared stain (Pierce) and an Odyssey infrared scanner (LI-COR Biosciences). The results are summarized in Figure 9.
The results indicate that E6 is remarkably stable. It did not lose any activity after heating for 30 min at 55 °C, and more than 80% of the E6 protein remained soluble even after heating for 30 min at 95 °C
(Figure 11 A). On the other hand, E6-aerolysin fusion lost most of its solubility after heated at 55 °C (Figure 1 IB), suggesting that the aerolysin portion of the fusion protein was responsible for its lower stability.
The superior stability of E6 makes it an excellent candidate for affinity maturation and further optimization for binding of CD5 or other targets.
Example 10
Phage Library Construction for EpCAM Binder Selections
Phagemid vector with DsbA secretion leader sequence was used to construct human thioredoxin based libraries. Wild type template (as shown in Figure 12A) was inserted in front of truncated pill gene. Libraries were built with Kunkel mutagenesis methods. The oligonucleotides used for mutagenesis in the loop region have 5' and 3 'overlaps to ensure proper annealing the uridine containing single stranded phagemid template. Designed primers were annealed onto the uridine -containing single strand phagemid, full length heteroduplex were synthesized by T7 DNA polymerase and ligated with T4 DNA ligase.
Three libraries based on human thioredoxin scaffold were constructed for EpCAM binder selections (Figure 10). Library TRX -LI uses Y/S code for randomized sequences in loopl, 1οορ3/1οορ3' , and loop5. Specifically, the active site peptide 32SGPS35 is replaced by 4, 8, or 12 residues, 10 out of 12 residues within peptide D61→A73 of 1οορ3/1οορ3' are replaced with randomized sequences as indicated, and 4 random residues are used to replace the 90SGAN93 peptide within loop5. In library TRX-L2 and TRX-L3, a randomized amino acid that replaces an existing residue is 50% NNS so that the wt residue is kept at 50%, while any insertion residue is NNS randomized.
Fifteen μg of single stranded DNA was used for each library. The heteroduplex DNA and enzyme mixture were purified with Qiagen PCR purification kit and eluted with 120 μί of deionized H20. They were mixed with 400 μί of XLl-blue electrocompetent cells (Stratagene) and electroporated at 2.5Kv, 200 ohm, 25 μΕ. SOC was added immediately after electroporation. The culture was incubated for 30 minutes at 37 °C with gentle shaking (200 rpm). The mixture was added into 300 mL of 2YT with helper phage at 1010/mL concentration and ampicilin to grow overnight. The phage was purified by PEG and its
concentration determined by OD268mn- The number of transformant, percentage of mutants, and calibrated diversity is shown in Table 8.
Table 8. Thioredoxin based library design and construction.
Percentage of Adjusted
T X Library Randomization Diversity
Viable Clones Diversity
TRX-L1 Y/S 5.4 x 108 44% 2.4 x 108
TRX-L2 50% NNS 5.5 x 109 50% 2.7 x 109
50% NNS for replacement,
TRX-L3 1.0 x 109 50% 0.5 x 109
NNS for insertions
Example 11
Phage Display Selections Using EpCAM as Target
To find specific binders from libraries TRX-L1, TRX-L2, and TRX-L3, recombinant EpCAM-Fc (R & D) was used as the target for selections. The phage display selection was done using Tl streptavidin magnetic beads (Invitrogen) coated with biotinylated recombinant EpCAM-Fc, and the selection was done with column based wash and elution to minimize non-specific background. The target concentration for coating in round 1 and round 2 selections is 250 nM, which is reduced to 125 nM in the 3rd round. This process works efficiently as only two rounds were necessary to recover specific binders. The progression of phage titer for rounds 2 and 3 was monitored. Sequencing of the pools from post round 2 indicated a convergence of binders. The hit rates of post round 2 are 24/26 for TRX-L1, 21/23 for TRX-L2, and 21/24 for TRX-L3, respectively. The hit rate of post round 3 is 24/24 for both TRX-L2 and TRX-L3.
More specifically, 250 nM of biotinylated EpCAM-Fc was coated onto 50 μΐ of Tl beads for 30 min at RT. The coated beads were washed with selection buffer twice and then incubated with the library for 1 hr. After binding, the beads were washed quickly for 5 times with 1 mL of wash buffer and loaded onto column for flow wash by 50 mL of wash buffer. Elution was done with 100 μΐ of 100 mM HCl for 10 min followed by neutralization with 15 ih of 1M Tris pH 9.1. The last wash and elution were titered with XL 1 -blue cells. The 1st round elution was amplified with XL-1 blue cells at OD 0.5. The 2nd round of selection was done by washing for 8 times and flow wash of 50 mL. The 3rd round of selection was done with 125 nM target concentration and 10 times of wash followed by 50 mL of flow wash. A total of 22 different binders have been obtained from three combined libraries (Figure 13).
Example 12
Characterization of Phage Display Selected EpCAM Binders
The selected phages from libraries TRX-L1, TRX-L2, and TRX-L3 that display TRX-based EpCAM binders were analyzed by phage ELISA. Specifically, a single bacterial colony was inoculated into 1 mL of 2YT media with ampcillin and helper phage M13 at 1010/mL. After the culture was incubated at 37 °C overnight, it was spun at Max speed in a microcentrifuge and the supernatant was used for phage ELISA. The nunc plate wells were coated with EpCAM-Fc at 1 μg/mL overnight at 4 °C. The plate wells were blocked by 1% BSA in PBS. The phage supernatant was diluted with blocking buffer for ten fold and was applied to the wells for 1 hr. The wells were washed 5 times with PBS containing 0.05% tween-20. Bound phage was detected with an anti-M13 pVlll antibody conjugated to HRP. The wells were incubated with anti M13 pVIII-HRP conjugate at 1 :5000 in blocking buffer for 1 hr. Detection was done with ELISA reagent (R&D) and measured at 450 nm. Specific binding to EpCAM as compared to BSA control was observed for all 22 selected binders (Figure 14).
An examination of the selected sequences from all three libraries (Figure 13) showed that the mutations in loop5 are limited, and five clones completely retained the wild type sequence S90GAN93. In contrast, many selected amino acids different from the wild type are observed in the region of 1οορ3/1οορ3' , suggesting that this motif may be involved in interactions with the target EpCAM. Similarly, a wide range of variability in both length and sequence has been observed in the loopl/active site region, pointing to its involvement in target recognition. A closer look at the locations of loopl, loop3, and 1οορ3' in the X-ray crystal structure (Figure 5B) revealed that these three loops are in close spatial proximity and are pointing to the same direction, presumably on the same face as the binding surface with EpCAM. Interestingly all the selected sequences from TRX-L2 and TRX-L3 in loopl possess a Pro at position 32, which may be favored to make a turn at the location that corresponds to Cys32 in wild type thioredoxin (Figure 5B). Somewhat surprisingly, 16 out of 17 selected binders from the TRX-L3 library, which contained randomized 4aa, 5aa, 6aa, and 7aa in replacement of 4aa 32SGPS35, prefer a 5aa peptide at the site. This feature could be very useful for the design of the second generation libraries for affinity maturation.
To demonstrate binding specificity as compared to other cell surface targets, the following proteins were immobilized on wells of nunc plates and reacted with phage: EpCAM-Fc, IgGl-Fc, CD22-Fc, CD5-Fc, hEphA2, mEphA2-Fc, BSA. In addition, a control clone, which was not selected as an EpCAM binder, was also analyzed. The corresponding phage ELISA results are shown in Figure 15 A. While the selected EpCAM binders from TRX-Ll and TRX-L2 libraries showed excellent binding selectivity towards target EpCAM, they did not bind to any of the control proteins. Furthermore, the control phage clone showed weak and non-specific interactions with almost all of the other proteins tested.
To examine the thermostability of the selected clones, the individual phage clones were heat treated before ELISA analysis. Specifically, the selected phage supernatant was incubated at the indicated temperatures for 10 min, followed by centrifugation to remove precipitated aggregates. The supernatants were used for phage ELISA analysis (Figure 15B). The results show that the selected clone F6 from TRX-Ll lost its binding activity after heated at 60 °C. Meanwhile, the selected clones from library TRX-L2 were stable at 70 °C and retained their binding activity. We did not heat the phage clones at temperatures higher than 70 °C, at which phage itself becomes less stable. These results seem to be in agreement with the notion that an insertion of long peptide sequences at the TRX active site markedly destabilizes the scaffold. The F6 clone contains 12 amino acids at the active site, whereas the wild type template has only 4 amino acids located at the corresponding location.
Example 13
Additional Binders for Various Protein Targets
Additional phage display selections were carried out to select specific binders for CD38, CD19, CD22, EpCAM, LGR5, and human serum albumin (HSA) using TRX-3 library and the phage display procedures similar to that described in Example 6. For the HSA selection, 0.125% casein was used in place of the 0.5% BSA as a blocking agent during selection and ELISA analysis. The recombinant target proteins were prepared using methods summarized in Table 9.
Table 9. Preparation of Target Proteins
Figure imgf000058_0001
HSA Purchased (Sigma) NHS-PE04-biotin 1 :5 ratio
CD19-Fc domains 293T Protein A agarose BirA+ ATP + Biotin
CD22-Fc domain 293T Protein A agarose BirA+ ATP + Biotin
From the TRX-3 library and using phage display, binders to the target proteins listed in Table 9 were selected. The selected loopl and loop 3' sequences are listed in Table 10. Representative sequences are also shown in Figure 16.
Table 10. Sequences of loopl and 1οορ3' in the selected binders to target proteins
Figure imgf000059_0001
E7 GSSPESRVH ACKHRVCFF
Fl NWSSSSGKD RYVFPPEAV
F2 QCWARRRDR GPRNTLLCF
F3 DTTKDRGGT LPWTVQFGY
F10 GKVCGGKRR ARPHFCPVM
Fl l RDARAAPPS LPWPSYFGL
G9 WNTRAHCSR LLPPLCTID
H2 KENNGWRGN MAGPRVMGP
H3 NKRGEGWQK SVIMWPQLW
H9 CYAVREGQG LYTALLYCT
LG 5 A7 S AWLTPNRVP
B2 SANSGWCCG LDIESFLYF
B5 EEKGYEGRR YVPFSLSGY
D2 RYEETTRQH RVASKRSAF
E7 KWESPYEAV LSHSVPYYL
HSA C6 CQTGTKQLP FGHFGFPTL
El RSENDRWNE LIAGPFWYS
E2 KNEKRDVAE FGFFGFPVL
E5 RRNERARDW LAAGPFYLL
F3 GGTPGRRNR FCEFCFPFL
G5 RLRTGGHPY VYVSLSRHR
H6 DRKPWKTRG FGLFSFPLL
An alignment of selected HSA binders revealed that three types of Loop3' motifs (Figure 17), i.e., the F-rich motif (Al l, C6, E2, F3, and H6), the AGPF motif (El and E5), and a unique sequence motif (G5), were selected.
Phage ELISA experiments on the HSA binders were performed as described in Example 7 and the results are shown in Figure 18 A. Selective binding to HSA vs. CD5 was observed for all the HSA binders tested. The Al 1 clone was omitted due to the presence of a stop codon in its Loopl sequence. The sequences of the seven remaining HSA binders shown in Table 10 and Figure 7 were similarly tested for their specific binding to serum albumins of human, rat, and mouse (HSA, RSA, and MSA, respectively) by phage ELISA (Figure 18B). As summarized in Figure 18C, HSA binding clones comprising the F-rich Loop3' motif are capable of specific binding to all three serum albumins, while the clones containing the AGPF Loop3' motif and the unique Loop3' sequence VYVSLSRHR can only bind to HSA, not RSA or MSA. These findings suggest that different HSA epitopes are recognized by the selected binders with different Loop3' motifs, and the diversity of the selected binders may have a variety of different applications depending on their species specificity.
Affinity measurements on HSA binders were performed on a Biacore T100 instrument according to manufacturer's instructions. The target protein (HSA) was immobilized on the Biacore CM5 sensor chip using EDC/NHS coupling chemistry. A kinetic model was used to fit the binding affinity after measuring the sensograms while varying the concentration of the purified thioredoxin based binders. The resulting Kd values are shown in the left panel of Figure 19 along with the corresponding surface plasmon resonance (SPR) sensorgrams. Example 14
Pharmakokinetics Studies on HSA Binders
The HSA-binding thioredoxin clones E2, F3, and H6 (all with F-rich motif), as well as the wild type sequence were cloned as his-tagged C-terminal fusions to a stabilized mutant Renilla Lucif erase and subsequently purified using Ni-NTA (Loening et al. Protein Engineering, Design & Selection vol. 19 no. 9 pp. 391-400, 2006). The proteins were dialyzed in PBS prior to administration to mice. The affinity of each fusion protein was measured using Biacore T100 as described above and the resulting Kd values are shown in the right panel of Figure 19 along with the corresponding SPR sensorgrams.
For each Luciferase-thioredoxin fusion, three Swiss Webster mice were injected with 50 ug of protein diluted in 200 uL PBS. Blood samples were collected at 30 min, 3 hrs, 6 hrs, 24 hrs, and 48 hrs after the injection. Each sample was mixed with EDTA and the blood cells were removed; the plasma was flash frozen and stored at -80°C until samples at all of the time points were collected. The plasma was thawed and then 1 uL equivalent from each sample was diluted into 100 uL of PBS/coelenterazine in 0.5% BSA and the light output was measured on a TopCount reader. The average light output from the three mice was plotted for each clone and time point, and the resulting curves are shown in Figure 20A. The resulting areas under the curve (AUC) for each Luciferase-thioredoxin fusion are shown in Figure 20B. The E2, F3, and H6 fusions showed ~ 5-9 fold longer half-lives than the wild type TRX fusion, in general agreement with their increased affinity for HSA (Figure 19, right panel). While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure that come within known or customary practice within the art to which the invention pertains and may be applied to the essential features hereinbefore set forth, and follows in the scope of the claims. Other embodiments are within the claims.
What is claimed is:

Claims

1. A loop-diversified engineered thioredoxin-like fold protein comprising at least one thioredoxin-like fold domain wherein multiple loops are diversified.
2. The loop-diversified engineered thioredoxin-like fold protein of claim 1 , wherein the thioredoxin-like fold domain comprising multiple loop-diversifications is derived from a thioredoxin-like fold domain of Homo sapiens.
3. The loop-diversified engineered thioredoxin-like fold protein of claim 1, wherein the thioredoxin-like fold domain comprising multiple loop-diversifications is derived from a member of the thioredoxin superfamily.
4. The loop-diversified engineered thioredoxin-like fold protein of claim 2, wherein the human thioredoxin-like fold domain comprising multiple loop-diversifications is derived from a member of the thioredoxin superfamily.
5. The loop-diversified engineered thioredoxin-like fold protein of claim 3, wherein the thioredoxin-like fold domain comprising multiple loop-diversifications is derived from a member of the thioredoxin family.
6. The loop-diversified engineered thioredoxin-like fold protein of claim 4, wherein the human thioredoxin-like fold domain comprising multiple loop-diversifications is derived from a member of the thioredoxin family.
7. The loop-diversified engineered thioredoxin-like fold protein of claim 5, wherein the thioredoxin-like fold domain comprising multiple loop-diversifications is derived from thioredoxin.
8. The loop-diversified engineered thioredoxin-like fold protein of claim 5 or claim 6, wherein the thioredoxin-like fold domain comprising multiple loop-diversifications is derived from human thioredoxin.
9. An undivided sample comprising a plurality of loop-diversified engineered thioredoxin-like fold proteins according to any one of claims 1-8.
10. The undivided sample of claim 9 comprising at least 100 distinct loop-diversified engineered thioredoxin-like fold proteins.
11. A method for preparing an enriched composition of target -binding, loop-diversified engineered thioredoxin-like fold proteins, comprising the steps of:
(i) providing a collection of nucleic acids encoding said loop-diversified engineered
thioredoxin-like fold proteins in a display-conducive context,
(ii) expressing said collection of nucleic acids in vivo or in vitro to provide a collection of loop- diversified engineered thioredoxin-like fold proteins operably linked to the nucleic acid that encodes them,
(iii) contacting said expressed engineered thioredoxin-like fold proteins with a target,
(iv) removing expressed engineered thioredoxin-like fold proteins that do not bind to the target; and recovering the engineered thioredoxin-like fold proteins enriched for binding to the target.
12. A method for preparing an enriched composition of target -binding, loop-diversified engineered thioredoxin-like fold proteins derived from Homo sapiens, comprising the steps of:
(i) providing a collection of nucleic acids encoding said loop-diversified engineered
thioredoxin-like fold proteins in a display-conducive context,
(ii) expressing said collection of nucleic acids in vivo or in vitro to provide a collection of loop- diversified engineered thioredoxin-like fold proteins operably linked to the nucleic acid that encodes them,
(iii) contacting said expressed engineered thioredoxin-like fold proteins with a target,
(iv) removing expressed engineered thioredoxin-like fold proteins that do not bind to the target; and recovering the engineered thioredoxin-like fold proteins enriched for binding to the target.
13. A method for preparing an enriched composition of target -binding, loop-diversified engineered thioredoxin-like fold proteins comprising the steps of:
(i) providing a collection of nucleic acids encoding said loop-diversified engineered
thioredoxin-like fold proteins,
(ii) expressing said collection of nucleic acids in vivo or in vitro to provide a collection of loop- diversified engineered thioredoxin-like fold proteins, (ill) contacting said expressed engineered thioredoxin-like fold proteins with a target; and (iv) identifying collections of expressed engineered thioredoxin-like fold proteins that bind to the target.
14. A method for preparing an enriched composition of target -binding, loop-diversified engineered thioredoxin-like fold proteins derived from Homo sapiens, comprising the steps of:
(i) providing a collection of nucleic acids encoding said loop-diversified engineered
thioredoxin-like fold proteins,
(ii) expressing said collection of nucleic acids in vivo or in vitro to provide a collection of loop- diversified engineered thioredoxin-like fold proteins,
(iii) contacting said expressed engineered thioredoxin-like fold proteins with a target; and
(iv) identifying collections of expressed engineered thioredoxin-like fold proteins that bind to the target.
15. A method for identifying individual target-binding, loop-diversified engineered thioredoxin-like fold proteins comprising the steps of:
(i) providing a collection of nucleic acids encoding said loop-diversified engineered
thioredoxin-like fold proteins,
(ii) expressing said collection of nucleic acids in vivo or in vitro to provide a collection of
optionally individually indexed, loop-diversified engineered thioredoxin-like fold proteins,
(iii) contacting said optionally individually indexed engineered thioredoxin-like fold proteins with a target; and
(iv) identifying collections or individual engineered thioredoxin-like fold proteins that bind to the target.
16. A method for identifying individual target-binding, loop-diversified engineered thioredoxin-like fold proteins derived from Homo sapiens, comprising the steps of:
(i) providing a collection of nucleic acids encoding said loop-diversified engineered
thioredoxin-like fold proteins,
(ii) expressing said collection of nucleic acids in vivo or in vitro to provide a collection of
optionally individually indexed, loop-diversified engineered thioredoxin-like fold proteins,
(iii) contacting said optionally individually indexed engineered thioredoxin-like fold proteins with a target; and identifying collections or individual engineered thioredoxin-like fold proteins that bind to the target.
PCT/US2012/031212 2011-03-29 2012-03-29 Engineered thioredoxin-like fold proteins Ceased WO2012135500A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US14/006,237 US9340584B2 (en) 2011-03-29 2012-03-29 Engineered thioredoxin-like fold proteins

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201161468836P 2011-03-29 2011-03-29
US61/468,836 2011-03-29

Publications (1)

Publication Number Publication Date
WO2012135500A1 true WO2012135500A1 (en) 2012-10-04

Family

ID=46931914

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2012/031212 Ceased WO2012135500A1 (en) 2011-03-29 2012-03-29 Engineered thioredoxin-like fold proteins

Country Status (2)

Country Link
US (1) US9340584B2 (en)
WO (1) WO2012135500A1 (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3419670A2 (en) 2016-02-26 2019-01-02 Regeneron Pharmaceuticals, Inc. Optimized transglutaminase site-specific antibody conjugation
US10738338B2 (en) 2016-10-18 2020-08-11 The Research Foundation for the State University Method and composition for biocatalytic protein-oligonucleotide conjugation and protein-oligonucleotide conjugate
US12331320B2 (en) 2018-10-10 2025-06-17 The Research Foundation For The State University Of New York Genome edited cancer cell vaccines

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6143524A (en) * 1991-02-06 2000-11-07 Genetics Institute, Inc. Peptide and protein fusions to thioredoxin, thioredoxin-like molecules, and modified thioredoxin-like molecules
US20030113749A1 (en) * 1994-07-20 2003-06-19 Roger Brent Interaction trap systems for detecting protein interactions

Family Cites Families (38)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6171816B1 (en) 1996-08-23 2001-01-09 Human Genome Sciences, Inc. Human XAG-1 polynucleotides and polypeptides
US5968737A (en) 1996-11-12 1999-10-19 The University Of Mississippi Method of identifying inhibitors of glutathione S-transferase (GST) gene expression
US7411051B2 (en) 1997-03-07 2008-08-12 Human Genome Sciences, Inc. Antibodies to HDPPA04 polypeptide
US7368531B2 (en) 1997-03-07 2008-05-06 Human Genome Sciences, Inc. Human secreted proteins
US5858714A (en) 1997-05-29 1999-01-12 Incyte Pharmaceuticals, Inc. Human metaxin protein
US20030068623A1 (en) 1997-06-16 2003-04-10 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
US20030092002A1 (en) 1997-09-17 2003-05-15 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
US6391311B1 (en) 1998-03-17 2002-05-21 Genentech, Inc. Polypeptides having homology to vascular endothelial cell growth factor and bone morphogenetic protein 1
AU764441B2 (en) 1998-02-09 2003-08-21 Genset S.A. cDNAs encoding secreted proteins
US7060479B2 (en) 1999-12-08 2006-06-13 Serono Genetics Institute, S.A. Full-length human cDNAs encoding potentially secreted proteins
EP0987552A3 (en) 1998-08-31 2000-06-07 Pfizer Products Inc. Diarylsulfonylurea binding proteins
US6936697B2 (en) 1998-09-01 2005-08-30 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
US6753314B1 (en) 1999-04-01 2004-06-22 Curagen Corporation Protein-protein complexes and methods of using same
US6444425B1 (en) 1999-04-02 2002-09-03 Corixa Corporation Compounds for therapy and diagnosis of lung cancer and methods for their use
US7129324B2 (en) 1999-06-22 2006-10-31 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
US7129338B1 (en) 1999-07-08 2006-10-31 Research Association For Biotechnology Secretory protein or membrane protein
US6984519B2 (en) 2000-03-01 2006-01-10 Genetech, Inc. Nucleic acids encoding peptides that induce chondrocyte redifferentiation
EP2213743A1 (en) 2000-04-12 2010-08-04 Human Genome Sciences, Inc. Albumin fusion proteins
US6812339B1 (en) 2000-09-08 2004-11-02 Applera Corporation Polymorphisms in known genes associated with human disease, methods of detection and uses thereof
US7582293B2 (en) 2000-09-15 2009-09-01 Genentech, Inc. Anti-PRO6308 antibodies
US7192587B2 (en) 2001-04-03 2007-03-20 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
JP2003088388A (en) 2001-09-14 2003-03-25 Herikkusu Kenkyusho:Kk NEW FULL-LENGTH cDNA
JP2003135075A (en) 2001-11-05 2003-05-13 Research Association For Biotechnology NEW FULL-LENGTH cDNA
JP4071477B2 (en) 2001-11-12 2008-04-02 財団法人大阪バイオサイエンス研究所 Three-dimensional structure of prostaglandin D synthase and use thereof
FR2836687A1 (en) 2002-03-04 2003-09-05 Gene Signal GENES INVOLVED IN THE REGULATION OF ANGIOGENESIS, PHARMACEUTICAL PREPARATIONS CONTAINING SAME AND THEIR APPLICATIONS
US7193069B2 (en) 2002-03-22 2007-03-20 Research Association For Biotechnology Full-length cDNA
AU2003234445B2 (en) 2002-05-02 2009-11-26 Vanderbilt University Mammalian genes involved in viral infection and tumor suppression
WO2004013283A2 (en) * 2002-08-02 2004-02-12 University Of Rochester Thioredoxin mutants and uses thereof
EP1613774A2 (en) 2003-03-10 2006-01-11 Applera Corporation Genetic polymorphisms associated with stenosis, methods of detection and uses thereof
WO2004106495A2 (en) 2003-05-29 2004-12-09 Millennium Pharmaceuticals, Inc. Compositions, kits, and methods for identification, assessment, prevention, and therapy of breast cancer
US7452678B2 (en) 2003-06-24 2008-11-18 Bristol-Myers Squibb Company Identification of biomarkers for liver toxicity
US7473531B1 (en) 2003-08-08 2009-01-06 Colora Corporation Pancreatic cancer targets and uses thereof
WO2005063983A1 (en) 2003-12-29 2005-07-14 Galapagos Genomics N.V. Modulators of bone homeostasis identified in a high-throughput screen
US7345142B2 (en) 2004-01-27 2008-03-18 Compugen Ltd. Nucleotide and amino acid sequences, and assays and methods of use thereof for diagnosis of cardiac disease
US7560233B2 (en) 2004-06-16 2009-07-14 University Of Massachusetts Oxidative DNA damage protection
KR100601504B1 (en) 2004-06-28 2006-07-19 삼성에스디아이 주식회사 Electrode assembly and lithium ion secondary battery using same
US7608413B1 (en) 2005-03-25 2009-10-27 Celera Corporation Kidney disease targets and uses thereof
US7521195B1 (en) 2005-07-21 2009-04-21 Celera Corporation Lung disease targets and uses thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6143524A (en) * 1991-02-06 2000-11-07 Genetics Institute, Inc. Peptide and protein fusions to thioredoxin, thioredoxin-like molecules, and modified thioredoxin-like molecules
US20030113749A1 (en) * 1994-07-20 2003-06-19 Roger Brent Interaction trap systems for detecting protein interactions

Also Published As

Publication number Publication date
US20140113832A1 (en) 2014-04-24
US9340584B2 (en) 2016-05-17

Similar Documents

Publication Publication Date Title
Yu et al. Beyond antibodies as binding partners: the role of antibody mimetics in bioanalysis
JP4907542B2 (en) Protein complexes for use in therapy, diagnosis and chromatography
ES2602782T3 (en) OB-FOLD used as a structure for engineering design of new specific binding agents
CA2837804C (en) Dimeric binding proteins based on modified ubiquitins
EP2513138A1 (en) Modified ubiquitin proteins having a specific binding activity for the extradomain b of fibronectin
CN105008393A (en) Methods for screening
AU2011245225A1 (en) Stabilized fibronectin domain compositions, methods and uses
WO2011137319A2 (en) Stabilized fibronectin domain compositions, methods and uses
CN101563456A (en) Artificial binding proteins based on a modified alpha helical region of ubiquitin
ES2493465T3 (en) Library based on mutant toxins and utilization processes
AU2012268970A1 (en) Dimeric binding proteins based on modified ubiquitins
CN114456252A (en) Muteins of human lipocalin 2 having affinity for glypican-3 (GPC3)
ES2344844T3 (en) COLLECTION OF MUTANTS OF TOXINS AND METHODS FOR USE.
Li et al. De novo discovery of cysteine frameworks for developing multicyclic peptide libraries for ligand discovery
JP2019163270A (en) Affinity proteins and uses thereof
TW202304971A (en) Cd71 binding fibronectin type iii domains
US9340584B2 (en) Engineered thioredoxin-like fold proteins
WO2012172054A1 (en) Modified multimeric ubiquitin proteins binding vegf-a
JP2017530726A (en) Antibody-like protein
KR20220023985A (en) Efficient method for constructing blood protein and its use
AU2015271900B2 (en) Stabilized fibronectin domain compositions, methods and uses
Dias CIS display: DNA-based technology as a platform for discovery of therapeutic biologics
Park mRNA Display selection of a novel activated leukocyte cell adhesion molecule (ALCAM) binding protein from a modified combinatorial protein library based on the tenth domain of human fibronection III (10FnIII)

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12763519

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 14006237

Country of ref document: US

122 Ep: pct application non-entry in european phase

Ref document number: 12763519

Country of ref document: EP

Kind code of ref document: A1