WO2012135468A2 - Genetics of gender discrimination in date palm - Google Patents

Genetics of gender discrimination in date palm Download PDF

Info

Publication number
WO2012135468A2
WO2012135468A2 PCT/US2012/031166 US2012031166W WO2012135468A2 WO 2012135468 A2 WO2012135468 A2 WO 2012135468A2 US 2012031166 W US2012031166 W US 2012031166W WO 2012135468 A2 WO2012135468 A2 WO 2012135468A2
Authority
WO
WIPO (PCT)
Prior art keywords
plant
seed
germplasm
tissue
male
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2012/031166
Other languages
French (fr)
Other versions
WO2012135468A3 (en
Inventor
Joel A. Malek
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Cornell University
Original Assignee
Cornell University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cornell University filed Critical Cornell University
Priority to US14/008,012 priority Critical patent/US20140208449A1/en
Publication of WO2012135468A2 publication Critical patent/WO2012135468A2/en
Publication of WO2012135468A3 publication Critical patent/WO2012135468A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/172Haplotypes

Definitions

  • This invention relates to the genetics of gender discrimination in the dioecious date palm.
  • Date palm (Phoenix dactylifera), a member of the Palm family in the
  • Arecales order ⁇ see Figure 1 is one of the oldest cultivated trees in the world, with evidence of domestication dating back over 5,000 years (Zohary et al., "Beginnings of Fruit Growing in the Old World,” Science 187:319-327(1975)). Dates have been found in the tombs of Pharaohs and in neolithic sites dating 7,000 to 8,000 years ago ( waasi, DA TE PALMS, Elsevier Science Ltd. 2003). demonstrating their historical significance in human nutrition. Date palm trees grow in hot, arid environments and are critical to the agriculture in these regions. For many countries in the Arabian Gulf, date production is the most important agricultural product. Total global production of dates in 2007 reached 6.9 million tons (http://faostat.fao.org).
  • Date palm biotechnology faces multiple challenges, including long plant generation times, the inability to simply distinguish between the many varieties of date palm, and the inability to distinguish female from male trees at an early stage.
  • date varieties There are more than 2,000 date varieties with differences in fruit color, flavor, shape, size, and ripening time (Al-Farsi et al., "Nutritional and Functional Properties of Dates: A
  • the present invention is directed to overcoming these and other deficiencies in the art.
  • One aspect of the present invention relates to a method of identifying the sex of a date palm plant.
  • This method involves analyzing DNA or RNA from a date palm plant, tissue, germplasm, or seed for the presence of (i) a nucleic acid sequence that identi fies the sex of the plant, tissue, germplasm. or seed or (ii) a molecular marker in linkage disequilibrium with the nucleic acid sequence.
  • the sex of the plant, tissue, germplasm, or seed is identified based on w hether or not the plant, tissue, germplasm, or seed contains the nucleic acid sequence or the molecular marker.
  • Another aspect of the present invention relates to a method of identifying the sex of a date palm plant.
  • This method involves analyzing D A or RNA from a date palm plant, tissue, germplasm, or seed for the presence of (i) a genotype that identifies the sex of the plant, tissue, germplasm, or seed, or (ii) a molecular marker linked to the genotype.
  • the sex of the plant, tissue, germplasm, or seed is identified based on whether or not the plant, tissue, germplasm, or seed contains the genotype or the molecular marker.
  • a further aspect of the present invention relates to a method of selecting a male or female date palm plant prior to flowering. This method involves detecting in a date palm plant, tissue, germplasm, or seed (i) a genotype that identifies the plant, tissue, germplasm, or seed as male or female, or (ii) a molecular marker in linkage
  • the plant, tissue, germplasm, or seed possessing the genotype or the molecular marker is selected.
  • kits for selecting a male or female date palm plant prior to flowering includes primers or probes for detecting in a date palm plant, tissue, germplasm. or seed (i) a genotype that identifies the plant, tissue, germplasm, or seed as male or female, or (ii) a molecular marker in linkage disequilibrium with the genotype.
  • the kit also includes instructions for using the primers or probes for detecting the genotype or the molecular marker.
  • Yet a further aspect of the present invention relates to a method of selecting a male or female date palm plant prior to flowering.
  • This method involves detecting in a date palm plant, tissue, germplasm, or seed (i) a nucleic acid sequence that identifies the plant, tissue, germplasm, or seed as male or female or (ii) a molecular marker in linkage disequilibrium with the nucleic acid sequence.
  • the plant, tissue, germplasm, or seed possessing the nucleic acid sequence or the molecular marker is selected.
  • Still another aspect of the present invention relates to a kit for selecting a male or female date palm plant prior to flowering.
  • the kit includes primers or probes for detecting in a date palm plant, tissue, germplasm, or seed (i) a nucleic acid sequence that identifies the plant, tissue, germplasm, or seed as male or female or (ii) a molecular marker in linkage disequilibrium with the nucleic acid sequence.
  • the kit also includes instructions for using the primers or probes for detecting the nucleic acid sequence or the molecular marker.
  • Still a further aspect of the present invention relates to a method of breeding a date palm plant.
  • This method involves providing a date palm plant having a sex determined by detecting in the plant or a seed, tissue, or germplasm from which it was derived (i) a genotype that identifies the plant as either male or female, or (ii) a molecular marker in linkage disequilibrium with the genotype.
  • the date palm plant is bred with a plant of the opposite sex.
  • Yet another aspect of the present invention relates to a method of breeding a date palm plant.
  • This method involves providing a date palm plant having a sex determined by detecting in the plant or a seed, tissue, or germplasm from which it was derived (i) a nucleic acid sequence that identifies the plant as male or female or (ii) a molecular marker in linkage disequilibrium with the nucleic acid sequence.
  • the date palm plant is bred with a plant of the opposite sex.
  • Yet a further aspect of the present invention relates to a method of planting a date palm seed of a known sex. This method involves providing a seed having a known male or female sex and planting the seed.
  • Figure 1 is a taxonomic tree of sequenced plant genomes. Date palm is the first available monocot (Liliopsida) draft sequence in the Arecales order. Other sequenced monocot genomes are mainly grasses.
  • FIGS. 2A-A are tables setting forth 972 polymorphic sites for gender discrimination in date palm.
  • Each DNA sequence (SEQ ID NOs: 1 -972) is identified by scaffold name and single nucleotide polymorphism ("SNP") ID.
  • SNP single nucleotide polymorphism
  • Each DNA sequence is 100 nucleotides in length with the nucleotide at position 51 being the sex-determining nucleotide.
  • the male allele (MA) at position 5 1 is identified for each sequence.
  • Figures 3A-D are graphs illustrating date palm SNP analysis. SNPs were analyzed between parental alleles of the Khalas reference genome and between different varieties. Figure 3A shows that the distance between parental allele SNPs in Khalas is not normally distributed. The skewed distribution of adjacent S P distances
  • Figure 3FJ shows that backcrossed varieties of date palm, on average, show high levels of similarity to their recurrent parent with numbers of generations (ranging from Backcross 1 to 5 generations) of backcrossing having little effect on similarity levels (error bars are quite small). Inter- variety comparisons show significantly more sites with different genotypes.
  • Figure 3C is a graph showing Principal Component Analysis (''PCA " ) of sequenced genomes based on 3.5 million polymorphic sites. Khalas and backcrossed variants are essentially on top of each other.
  • Figure 4 is a graph showing 1 unbalanced Sequence Count Regions
  • ISCR ISCR analysis among date palm genomes.
  • the vertical axis represents the number of unique ISCRs remaining in each genome after comparison with other genomes. Only non-backcrossed genomes were considered to avoid bias from inbreeding.
  • FIG. 5 is a graph showing enrichment of Gene Ontology categories for genes covered by ISCRs. Gene Onotolgy categories from genes covered by IS Rs in at least 2 genomes were analyzed for enrichment. Gene counts in each category were normalized to total gene counts in either the genome or ISCRs, A false discovery rate of 0.2 was applied and only categories showing at least 2-fold enrichment in the ISCRs are reported.
  • FIGs 6A-B are illustrations showing pedigree and genotype information for gender-discriminating regions. Date palms of known genealogy were genotyped at multiple gender-discriminating regions.
  • Figure 6A shows a section of the full pedigree used for linkage analysis showing the complex relationship of the trees. DN is Deglet Noor, Dy is Dayri, Mj is Medjool, BC is Backcross, and DnPr represents the initial donor parents. Grey boxes indicate an unknown but theoretically determined genotype. The genotype in each individual is the genotype found at the first gender-discriminating SNP that was genotyped. Segregation of heterozygosity with the male phenotype is clear.
  • Figure 6B shows genotypes from 4 scaffolds (scales with exons annotated as ticks and repeats as rectangles) with the largest number of male-specific SNPs (MS-SNPs).
  • Genotypes from selected regions are presented with their scaffold base pair location above each genotype. The number observed (both empirically and theoretically) for each gender in each genotype is included.
  • Figure 7 is an illustration showing the workflow of SNP finding.
  • FIG. 8 is an illustration showing the comparison of seven fosmids to the assembly.
  • the horizontal axis shows coordinates in fosmids.
  • Regular genes in fosmids are shown as bars above (forward chain) and below (backward chain) the axes.
  • TE genes are also shown.
  • White bars in the black windows show matched regions between the indicated fosmid and assembly.
  • Figure 9 is a chart showing clustering of 13 genomes genotyped at 32 variety discriminating SNPs, Even closely related genomes like the backcrossed males and their recurrent parents separate well using this subset of the 3.5 million original polymorphisms.
  • “ 1 " represents homozygous match to the reference Khalas genome
  • "2" represents a heterozygous position
  • "3" indicates a homozygous mismatch to the reference Khalas genome.
  • Column titles include Scaffold ID followed by base pair location of the SNP.
  • Figure 10 is a graph showing coverage at ⁇ 1 .2 million locations in the genome by the test set of -210 million reads.
  • Figure 1 1 is a graph showing Kmer coverage in a test set of -210 million reads.
  • Figures 12A-B show results of the PCR-RFLP assay based on Bell digestion.
  • Figure 12A shows the scaffold ID (Gen Bank accession numbers) followed by the primer IDs lead ([4675] (SEQ ID NO;976; [4820]-[4830] (SEQ ID NO:977); [5090J (SEQ ID NO;978)).
  • PCR primer sites are in bold and underlined with an arrow showing the direction of amplification. DNA sequences are flanked by base pair coordinates in the scaffold. The restriction sites are in bold with the female/male allele in square brackets where they di ffer.
  • Figure 12B PCR-RFLP results are shown for each date palm variety assayed using the appropriate variety number from Table 10.
  • PCR product size is 405 bp and the Bell site is at bp 143. Expected product sizes from digestion are 143 bp and 262 bp. In this assay, the female allele does not contain the restriction site and is not digested while the male allele is.
  • Figures 13A-B show PCR-RFLP based on Hpall digestion.
  • Figure 13A shows the scaffold ID (GenBank accession numbers) followed by the primer IDs lead ([81 10] (SEQ ID NO:979); [8290]-[8300] (SEQ ID NO:980): [8475]-[8485] (SEQ ID NO:981); [ 8570] (SEQ II) NO:982)).
  • PCR primer sites are in bold and underlined with an arrow showing the direction of ampli fication.
  • DNA sequences are flanked by base pair coordinates in the scaffold.
  • the restriction sites are in bold with the female/male allele in square brackets where they differ.
  • PCR-RFLP results are shown for each date palm variety assayed using the appropriate variety number from Table 10.
  • PCR product size is 452 bp and Hpall sites are at bp 180, 369. and 393, although only the site at bp 180 is specific to the female allele. Digestion of the female allele results in products of size 24 bp, 59 bp, 180 bp, and 89 bp. Digestion of the male allele results in products of size 24 bp, 59 bp, and 369 bp,
  • Figures 14A-B show PCR-RFLP based on Rsal digestion.
  • Figure 14A shows the scaffold ID (GenBank accession numbers) followed by the primer IDs lead ([41360] (SEQ 1D N( ) :983 ; [41650]-[41660] (SEQ ID NO:984); [41870] (SEQ ID NO:
  • PCR primer sites are in bold and underlined with an arrow showing the direction of amplification. DNA sequences are flanked by base pair coordinates in the scaffold. The restriction sites are in bold with the female/male allele in square brackets where they differ.
  • PCR-RFLP results are shown for each date palm variety assayed using the appropriate variety number from Table 10. PCR product size is 493 bp and Rsal sites are at bp 5 and 288, Expected product sizes from digestion of the female allele are 5 bp, 205 bp, and 283 bp. Two males (1 M and 8M) did not contain the male-specific allele, resulting in digestion and suggesting that allele is not as widespread in the population.
  • Figures 15A-C are results of a PCR-only-based assay.
  • Figure 15A shows the scaffold ID (GenBank accession numbers) followed by the primer IDs lead
  • FIG. 15C shows PCR-only-based assay results on seven males and seven females. Abbreviations are as in Table 1 1. While all tests show primer dimers, female samples show the expected single band with the male samples showing the expected two bands.
  • the present invention pertains to date palm plants, which are dioecious plants of the species Phoenix dactylifera.
  • the present invention relates to a method of identifying the sex of a date palm plant. This method involves analyzing DNA or RNA from a date palm plant, tissue, germ plasm, or seed for the presence of (i) a nucleic acid sequence that identifies the sex of the plant, tissue, germplasm. or seed or (ii) a molecular marker in linkage disequilibrium with the nucleic acid sequence.
  • the sex of the plant, tissue, germplasm, or seed is identified based on whether or not the plant, tissue, germplasm. or seed contains the nucleic acid sequence or the molecular marker.
  • plant, tissue, germplasm, and seed refer to any of whole plants, plant parts, plant components or organs (e.g.. leaves, stems, roots, floral structures, etc.), plant tissue, seeds, plant cells, and/or progeny of the same.
  • a plant cell is a cell of a plant, taken from a plant, or derived through culture from a cell taken from a plant.
  • Analyzing DNA or RNA from a date palm plant, tissue, germplasm, or seed pursuant to the present invention can be carried out by methods well-known in the art. Such methods include, e.g., DNA sequencing, hybridization assays, PCR-based assays, detection of markers (e.g., SNPs, simple sequence repeats ("SSRs"), restriction fragment length polymorphisms C'RFLPs”), amplified fragment length polymorphisms C'AFLPs”), and isozyme markers).
  • markers e.g., SNPs, simple sequence repeats ("SSRs"), restriction fragment length polymorphisms C'RFLPs"), amplified fragment length polymorphisms C'AFLPs
  • isozyme markers e.g., DNA sequencing, hybridization assays, PCR-based assays, detection of markers (e.g., SNPs, simple sequence repeats ("SSRs”), restriction fragment length polymorphisms C'RFLPs"), amplified fragment
  • RNA from a date palm plant involves detecting, in a hybridization assay, whether a nucleic acid sequence that identifies the sex of the date palm plant, tissue, germplasm, or seed hybridizes to an oligonucleotide probe.
  • analyzing involves detecting, in a PCR-based assay, whether oligonucleotide primers amplify a nucleic acid sequence indicative of the gender of the date palm plant, tissue, germplasm, or seed being analyzed.
  • the presence of a nucleic acid sequence that identifies the sex of a date palm is detected using a direct sequencing technique. Specifically. DNA samples are first isolated from a date palm plant using any suitable method. The region of interest is cloned into a suitable vector and amplified by growth in a host cell (e.g., bacteria). Alternatively, DNA in the region of interest is ampl ified using PCR.
  • a host cell e.g., bacteria
  • DNA in the region of interest (e.g., the region containing the gender indicative SNP or marker) is sequenced using any suitable method including, but not limited to, manual sequencing using radioactive marker nucleotides and automated sequencing. The results of the sequencing are displayed using any suitable method. The sequence is examined and the presence or absence of a given SNP or marker is determined.
  • a PCR-based assay employs oligonucleotide primers that hybridize only to a gender indicative SNP or allele.
  • Primers are used to amplify a sample of DNA.
  • primers can be constructed pursuant to well- known methods in the art to amplify, e.g., only nucleotide sequences possessing a male allele. If the primers result in a PCR product, then the plant has the male allele and the plant is identified as male.
  • a hybridization assay the presence or absence of a given SNP (e.g., a gender indicative allele) or marker is determined based on the ability of the DNA from the sample to hybridize to a complementary DNA molecule (e.g., an oligonucleotide probe).
  • a complementary DNA molecule e.g., an oligonucleotide probe.
  • hybridization of a probe to the sequence of interest is detected directly by visualizing a bound probe (e.g., a Northern or Southern assay).
  • genomic DNA Southern or Southern assay
  • RNA Northern
  • the DNA or RNA is then cleaved with a series of restriction enzymes that cleave infrequently in the genome and not near any of the markers being assayed.
  • the DNA or RNA is then separated (e.g., on an agarose gel ) and transferred to a membrane.
  • a labeled e.g.
  • a radionucieotide probe or probes specific for the gender indicative SNP or marker being detected is allowed to contact the membrane under low, medium, or high stringency conditions. Unbound probe is removed and the presence of binding is detected by visualizing the labeled probe.
  • oligonucleotide probes are affixed to a solid support.
  • the oligonucleotide probes are designed to be unique to a given SNP or marker.
  • the DNA sample of interest is contacted with the DNA chip and hybridization is detected.
  • the DNA chip assay is a GeneChip (Affymetrix, Santa Clara, CA; see, e.g., U.S. Patent Nos. 6,045,996; 5,925,525; and 5,858.659: which are hereby incorporated by reference in their entirety) assay.
  • the GeneChip technology uses miniaturized, high-density arrays of oligonucleotide probes affixed to a chip.
  • .Probe arrays are manufactured, e.g., by Af ymetrix ' s light-directed chemical synthesis process, which combines solid-phase chemical synthesis with photolithographic fabrication techniques employed in the semiconductor industry.
  • Af ymetrix ' s light-directed chemical synthesis process which combines solid-phase chemical synthesis with photolithographic fabrication techniques employed in the semiconductor industry.
  • the process constructs high- density arrays of oligonucleotides, with each probe in a predefined position in the array.
  • Multiple probe arrays are synthesized simultaneously on a large glass wafer. The wafers are then diced, and individual probe arrays are packaged in injection-molded plastic cartridges, which protect them from the environment and serve as chambers for hybridization.
  • the nucleic acid to be analyzed is isolated, amplified by PGR, and labeled with a fluorescent reporter group.
  • the labeled nucleic acid is then incubated with the array using a fluidics station.
  • the array is then inserted into the scanner, where patterns of hybridization are detected.
  • the hybridization data are collected as light emitted from the fluorescent reporter groups are incorporated into the target, which is bound to the probe array.
  • Probes that perfectly match the target generally produce stronger signals than those that have mismatches. Since the sequence and position of each probe on the array are known, by complementarity, the identity of the target nucleic acid applied to the probe array can be determined.
  • a DNA microchip containing electronically captured probes (Nanogen, San Diego, CA) is utilized (see, e.g., U.S. Patent Nos.
  • Nanogen 's technology enables the active movement and concentration of charged molecules to and from designated test sites on its semiconductor microchip.
  • DNA capture probes unique to a given SNP or marker are electronically placed at, or "addressed" to, spec i lie sites on the microchip. Since DNA has a strong negative charge, it can be electronically moved to an area of positive charge.
  • a test site or a row of test sites on the microchip is electronically activated with a positive charge.
  • a solution containing the DNA probes is introduced onto the microchip.
  • the negatively charged probes rapidly move to the positively charged sites, where they concentrate and are chemically bound to a site on the microchip.
  • the microchip is then washed and another solution of distinct DNA probes is added until the array of specifically bound DNA probes is complete.
  • a test sample is then analyzed for the presence of target DNA molecules by determining which of the DNA capture probes hybridize, with complementary DNA in the test sample (e.g. , a PCR amplified gene of interest).
  • An electronic charge is also used to move and concentrate target molecules to one or more test sites on the microchip.
  • the electronic concentration of sample DN A at each test site promotes rapid hybridization of sample DNA with complementary capture probes (hybridization may occur in minutes).
  • To remove any unbound or nonspecifically bound DNA from each site the polarity or charge of the site is reversed to negative, thereby forcing any unbound or nonspecifically bound DNA back into solution away from the capture probes.
  • a laser-based fluorescence scanner is used to detect binding.
  • an array technology based upon the segregation of fluids on a flat surface (chip) by di ferences in surface tension (ProtoGene. Palo Alto, CA) is utilized (.see, e.g., U.S. Patent Nos. 6,001 ,31 1 ; 5,985,551 ; and
  • Protogene's technology is based on the fact that fluids can be segregated on a flat surface by differences in surface tension that have been imparted by chemical coatings. Once so segregated, oligonucleotide probes are synthesized directly on the chip by ink-jet printing of reagents.
  • the array with its reaction sites defined by surface tension, is mounted on an X/Y translation stage under a set of four piezoelectric nozzles, one for each of the four standard DNA bases.
  • the translation stage moves along each of the rows of the array and the appropriate reagent is delivered to each of the reaction sites.
  • the A amidite is delivered only to the sites where amidite A is to be coupled during that synthesis step and so on.
  • Common reagents and washes are delivered by flooding the entire surface and then remov ing them by spinning.
  • DNA probes unique for the SNP or marker of interest are affixed to the chip using Protogene's technology.
  • the chip is then contacted with the PCR-amplified genetic region of interest.
  • unbound DNA is removed and hybridization is detected using any suitable method (e.g. , by fluorescence de-quenching of an incorporated fluorescent group).
  • a "bead array” is used for the detection of polymorphisms (Illumina, San Diego, CA; see, e.g., WO 99/67641 and WO 00/39587, which are hereby incorporated by reference in their entirety),
  • Illum ina uses a BEAD ARRAY technology that combines fiber optic bundles and beads that self-assemble into an array. Each fiber optic bundle contains thousands to millions of individual fibers depending on the diameter of the bundle.
  • the beads are coated with an oligonucleotide specific for the detection of a given SNP or marker. Batches of beads are combined to form a pool specific to the array.
  • the BEAD ARRAY is contacted with a prepared subject sample (e.g., DNA). Hybridization is detected using any suitable method.
  • hybridization of a bound probe is detected using a TaqMan assay (PE Biosystems, Foster City, CA; see, e.g., U.S. Patent Nos. 5,962,233 and 5,538,848, which are hereby incorporated by reference in their entirety).
  • the assay is performed during a PCR reaction.
  • the TaqMan assay exploits the 5'-3' exonuclease activity of DNA polymerases such as AMPLITAQ DNA polymerase.
  • a probe, specific for a given SNP or marker, is included in the PCR reaction.
  • the probe consists of an oligonucleotide with a 5 '-reporter dye (e.g., a fluorescent dye) and a 3'- quencher dye.
  • a 5 '-reporter dye e.g., a fluorescent dye
  • 3'- quencher dye e.g., a 3'- quencher dye.
  • polymorphisms are detected using the SNP-
  • primer extension assay (Orchid Biosciences, Princeton, NJ; see, e.g., U.S. Patent Nos. 5,952, 174 and 5,919,626, which are hereby incorporated by reference in their entirety).
  • SNPs are identified by using a specially synthesized DNA primer and a DNA polymerase to selectively extend the DNA chain by one base at the suspected SNP location. DNA in the region of interest is amplified and denatured. Polymerase reactions are then performed using miniaturized systems called microfluidics. Detection is accomplished by adding a label to the nucleotide suspected of being at the SNP or marker location.
  • Incorporation of the label into the DNA can be detected by any suitable method (e.g., if the nucleotide contains a biotin label, detection is via a fluorescently labeled antibody specific for biotin). Numerous other assays are known in the art.
  • Additional detection assays that are suitable for use in the present invention include, but are not limited to, enzyme mismatch cleavage methods (e.g. , Variagenies, U.S. Patent Nos. 6,1 10,684; 5,958,692; and 5,851 ,770, which are hereby incorporated by reference in their entirety); polymerase chain reaction; branched hybridization methods (e.g., Chiron, U.S. Patent Nos. 5,849,481 ; 5,710,264; 5, 124,246; and 5,624,802; which are hereby incorporated by reference in their entirety); rolling circle replication (e.g., U.S. Patent Nos.
  • enzyme mismatch cleavage methods e.g. , Variagenies, U.S. Patent Nos. 6,1 10,684; 5,958,692; and 5,851 ,770, which are hereby incorporated by reference in their entirety
  • polymerase chain reaction e.g., Chiron, U.S. Patent Nos. 5,
  • a MassARRAY system (Sequenom, San Diego.
  • CA is used to detect variant sequences (see, e.g., U.S. Patent Nos. 6,043,031 ; 5,777,324; and 5,605,798; which are hereby incorporated by reference in their entirety).
  • DNA is isolated from cell samples using standard procedures.
  • specific DNA regions containing the SNP or marker of interest about 200 base pairs in length, are amplified by PGR.
  • the amplified fragments are then attached by one strand to a solid surface and the non-immobilized strands are removed by standard denaturation and washing. The remaining immobilized single strand then serves as a template for automated enzymatic reactions that produce genotype specific diagnostic products.
  • the diagnostic product As the diagnostic product is charged when an electrical field pulse is subsequently applied to the tube they are launched down the flight tube towards a detector.
  • the time between application of the electrical field pulse and collision of the diagnostic product with the detector is referred to as the time of flight.
  • This is a very precise measure of the product's molecular weight, as a molecule's mass correlates directly with time of flight with smaller molecules flying faster than larger molecules.
  • the entire assay is completed in less than one thousandth of a second, enabling samples to be analyzed in a total of 3-5 seconds, including repetitive data collection.
  • the SpectroTYPER software then calculates, records, compares, and reports the genotypes at the rate of three seconds per sample.
  • the methods of the present invention may involve an automated system for detecting nucleic acid sequences and/or markers.
  • an automated system may include a set of marker probes or primers configured to detect at least one gender indicative SNP or marker as described herein.
  • a typical system may include a detector that is configured to detect one or more signal outputs from the set of marker probes or primers, or amplieon thereof, thereby identifying the presence or absence of an allele.
  • a detector that is configured to detect one or more signal outputs from the set of marker probes or primers, or amplieon thereof, thereby identifying the presence or absence of an allele.
  • a wide variety of signal detection apparatus are available, including photo multiplier tubes, spectrophotometers, CCD arrays, arrays and array scanners, scanning detectors, phototubes and photodiodes, microscope stations, galvo-scans, microfluidic nucleic acid amplification detection appliances, and the like. 1 he precise configuration of the detector will depend, in part, on the type of label used to detect the marker allele, as well as the instrumentation that is most conveniently obtained for the user. Detectors that detect fluorescence,
  • Typical detector examples include light (e.g., fluorescence) detectors or radioactivity detectors.
  • detection of a light emission (e.g., a fluorescence emission) or other probe label is indicative of the presence or absence of an allele.
  • Fluorescent detection is generally used for detection of amplified nucleic acids (however, upstream and/or downstream operations can also be performed on ampl icons, which can involve other detection methods).
  • the detector detects one or more label (e.g., light) emission from a probe label, which is indicative of the presence or absence of a marker.
  • the detector(s) optionally monitors one or a plurality of signals from an amplification reaction.
  • the detector can monitor optical signals which correspond to "real time" amplification assay results.
  • System instructions that correlate the presence or absence of the gender indicative SNP or marker with the predicted tolerance are also contemplated by the present invention.
  • the instructions can include at least one look-up table that includes a correlation between the presence or absence of an allele and the predicted sex of the plant.
  • the precise form of the instructions can vary depending on the components of the system, e.g., they can be present as system software in one or more integrated units of the system (e.g., a microprocessor, computer, or computer readable medium), or can be present in one or more units (e.g., computers or computer readable media) operably coupled to the detector.
  • the system instructions may include at least one look-up table that includes a correlation between the presence or absence of the allele(s) and predicted tolerance or improved tolerance.
  • the instructions also typically include instructions providing a user interface with the system, e.g., to permit a user to view results of a sample analysis and to input parameters into the system.
  • a system may typically include components for storing or transmitting computer readable data representing or designating the allele(s) detected by the methods of the present invention, e.g., in an automated system.
  • the computer readable media can include, for example, cache, main, and storage memory and/or other electronic data storage components (hard drives, floppy drives, storage drives, etc.) for storage of computer code.
  • Data representing alleles detected by the methods of the present invention can also be electronically, optically, or magnetically transm itted in a computer data signal embodied in a transmission medium over a network such as an intranet or internet or combinations thereof.
  • the system can also, or alternatively, transmit data via wireless, or other available transmission alternatives.
  • the system may typically comprise a sample that is to be analyzed, such as a plant tissue, or material isolated from the tissue such as genomic DNA, amplified genomic DNA, cDNA, amplified cDNA, RNA, amplified RNA, or the like.
  • a sample that is to be analyzed such as a plant tissue, or material isolated from the tissue such as genomic DNA, amplified genomic DNA, cDNA, amplified cDNA, RNA, amplified RNA, or the like.
  • Automated systems for detecting nucleic acid sequences and/or markers and/or correlating the nucleic acid sequences and/or markers with a male or female phenotype may involve data entering a computer which corresponds to physical objects or processes external to the computer, e.g., a marker allele, and a process that, within a computer, causes a physical transformation of the input signals to different output signals.
  • the input data e.g., amplification of a particular marker allele
  • output data e.g., the identification of the allelic form of a chromosome segment.
  • the process within the computer is a set of instructions, or program, by which positive amplification or hybridization signals are recognized by the integrated system and attributed to individual samples as a genotype. Additional programs correlate the identity of individual samples with a sex-related phenotype or marker alleles, e.g., statistical methods.
  • C/C++ programs for computing
  • Delphi and/or Java programs for GUI interfaces
  • productivity tools e.g., Microsoft Excel and/or SigmaPlot
  • Other useful software tools in the context of the integrated systems of the invention include statistical packages such as SAS, Genstat, Matlab, Mathematica, and S- Plus and genetic modeling packages such as QU-GENE.
  • additional programming languages such as visual basic are also suitably employed in the integrated systems.
  • sex identifying marker alleles assigned to a population are recorded in a computer readable medium.
  • Data regarding genotype for one or m re molecular markers, e.g. SSR, RFLP, AFLP, SNP, isozyme markers or other markers as described herein, are similarly recorded in a computer accessible database.
  • marker data is obtained using an integrated system that automates one or more aspects of the assay (or assays) used to determine marker genotype.
  • a detector e.g., an array, a scanner, a CCD, or other detection device directly to files in a computer readable medium accessible to the central processing unit.
  • a set of system instructions (typically embodied in one or more programs) encoding the correlations between tolerance and the alleles of the invention is then executed by the computational device to identify correlations between marker alleles and predicted trait phcnotypes.
  • the system also includes a user input device, such as a keyboard, a mouse, a touchscreen, or the like, for, e.g., selecting files, retrieving data, reviewing tables of maker information, etc., and an output device (e.g., a monitor, a printer, etc.) for viewing or recovering the product of the statistical analysis.
  • a user input device such as a keyboard, a mouse, a touchscreen, or the like
  • an output device e.g., a monitor, a printer, etc.
  • Integrated systems comprising a computer or computer readable medium comprising set of files and/or a database with at least one data set that corresponds to the marker alleles herein are provided.
  • the system optionally also includes a user interface allowing a user to selectively view one or more of these databases.
  • standard text manipulation software such as word processing software (e.g. , Microsoft WordTM or Corel WordperfectTM) and database or spreadsheet software (e.g.
  • spreadsheet software such as Microsoft ExcelTM, Corel Quattro ProTM, or database programs such as Microsoft AccessTM or ParadoxTM
  • a user interface e.g., a GUI in a standard operating system such as a Windows, Macintosh, Unix or Linux system
  • a GUI in a standard operating system such as a Windows, Macintosh, Unix or Linux system
  • the system may optionally include components for sample manipulation, e.g., incorporating robotic devices.
  • a robotic liquid control armature for transferring solutions (e.g. , plant cell extracts) from a source to a destination, e.g., from a microtiter plate to an array substrate, is optionally operably linked to the digital computer (or to an additional computer in the integrated system).
  • An input device for entering data to the digital computer to control high throughput liquid transfer by the robotic liquid control armature and. optionally, to control transfer by the armature to the solid support is commonly a feature of the integrated system. Many such automated robotic fluid handling systems are commercially available.
  • Systems for molecular marker analysis can include a digital computer with one or more of high-throughput liquid control software, image analysis software for analyzing data from marker labels, data interpretation software, a robotic liquid control armature for transferring solutions from a source to a destination operably linked to the digital computer, an input device (e.g., a computer keyboard) for entering data to the digital computer to control high throughput liquid transfer by the robotic liquid control armature and, optionally, an image scanner for digitizing label signals from labeled probes hybridized, e.g., to markers on a solid support operably linked to the digital computer.
  • an input device e.g., a computer keyboard
  • an image scanner for digitizing label signals from labeled probes hybridized, e.g., to markers on a solid support operably linked to the digital computer.
  • the image scanner interfaces with the image analysis software to provide a measurement of, e.g., nucleic acid probe label intensity upon hybridization to an arrayed sample nucleic acid population (e.g., comprising one or more markers), where the probe label intensity measurement is interpreted by the data interpretation software to show whether, and to what degree, the labeled probe hybridizes to a marker nucleic acid (e.g., an amplified marker allele).
  • a marker nucleic acid e.g., an amplified marker allele
  • Optical images e.g., hybridization patterns viewed (and, optionally, recorded) by a camera or other recording device (e.g., a photodiode and data storage device) are optionally further processed in any of the embodiments herein, e.g., by digitizing the image and/or storing and analyzing the image on a computer.
  • a variety of commercially available peripheral equipment and software is available for digitizing, storing, and analyzing a digitized video or digitized optical image, e.g., using PC (Intel x86 or pentium chip-compatible DOSTM, OS2TM, WINDOWSTM, WINDOWS NTTM or WINDOWS95TM. based machines), MACINTOSHTM, LINUX, or UNIX based (e.g. SUNTM work station) computers.
  • nucleic acid sequences that identi fy the sex of a date palm plant include the nucleotide sequences of SEQ ID NOs: 1 -972 of Figures 2A-AK.
  • analyzing is carried out to determine the presence of a male allele at the nucleotide corresponding to position 5 1 of any one of SEQ ID NOs: 1 -972, as set forth in Figures 2A-AK.
  • the plant, tissue, germplasm, or seed does not contain the male allele of SEQ ID NOs: 1 -972, as set forth in Figures 2A-AK, and the plant, tissue, germplasm, or seed is identified as a female plant.
  • DNA or RNA from a date palm plant, tissue, germplasm, or seed is analyzed for the presence of a molecular marker in linkage disequilibrium with the nucleic acid sequence that identifies the sex of the date palm plant.
  • the molecular marker is present in SEQ ID NOs: 1 - 972, as set forth in Figures 2A-A , or a corresponding RNA molecule.
  • a marker is a nucleotide sequence or encoded product thereof (e.g., a protein) used as a point of reference.
  • markers to be useful at detecting recombinations they need to detect differences, or polymorphisms, within the population being monitored.
  • markers define a specific locus on the date palm genome. Each marker is therefore an indicator of a specific segment of DNA, having a unique nucleotide sequence.
  • genomic variability of a marker can be of any origin, for example, insertions, deletions, duplications, repetitive elements, point mutations, recombination events, or the presence and sequence of transposable elements (" ⁇ ' " ).
  • Molecular markers can be derived from genomic or expressed nucleic acids (e.g., ESTs) and can also refer to nucleic acids used as probes or primer pairs capable of amplifying sequence fragments via the use of PCR-based methods.
  • DNA or RNA is analyzed for the presence of a molecular marker in linkage disequilibrium with a nucleic acid sequence that identi fies the sex of the plant.
  • linkage disequilibrium it is meant that the nucleic acid and the trait are found together in progeny plants more often than if the nucleic acid and phenotype segregated separately.
  • Recombination frequency measures the extent to which a molecular marker is linked w ith a particular allele.
  • Lower recombination frequencies typically measured in centiMorgans ("cM"), indicate greater linkage between the allele and the molecular marker.
  • the extent to which two features are linked is often referred to as the genetic distance.
  • the genetic distance is also typically related to the physical distance between the marker and the allele.
  • certain biological phenomenon including recombinational "hot spots" can affect the relationship between physical distance and genetic distance.
  • the usefulness of a molecular marker is determined by the genetic and physical distance between the marker and the selectable trait of interest. The linkage relationship between a molecular marker and a phenotype is given as a
  • Linkage can be expressed as a desired limit or range.
  • any marker is linked (genetically and physically) to any other marker when the markers are separated by less than 50, 40, 30, 25, 20, or 15 map units (or cM).
  • it is advantageous to define a bracketed range of linkage for example, between 10 and 20 cM, between 10 and 30 cM, or between 10 and 40 cM. The more closely a marker is linked to a second locus, the better an indicator for the second locus that marker becomes.
  • "closely linked loci" such as a marker locus and a second locus display an inter-locus recombination frequency of 10% or less, preferably about 9% or less, still more preferably about 8% or less, yet more preferably about 7% or less, still more preferably about 6% or less, yet more preferably about 5% or less, still more preferably about 4% or less, yet more preferably about 3% or less, and still more preferably about 2% or less.
  • the relevant loci display a recombination frequency of about 1 % or less, e.g., about 0.75% or less, more preferably about 0.5% or less, or yet more preferably about 0.25% or less.
  • Two loci that are localized to the same chromosome, and at such a distance that recombination between the two loci occurs at a frequency of less than 10% (e.g., about 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1 %, 0.75%, 0.5%, 0.25%, or less) are also said to be "proximal to" each other. Since one cM is the distance between two markers that show a 1 % recombination frequency, any marker is closely linked (genetically and physically) to any other marker that is in close proximity, e.g. , at or less than 10 cM distant. Two closely linked markers on the same chromosome can be positioned 9, 8, 7, 6, 5, 4, 3, 2, 1 , 0.75, 0.5 or 0.25 cM or less from each other.
  • LOD score (Risch, “Genetic Linkage: Interpreting LOD Scores,” Science 255:803-804 (1992), which is hereby incorporated by reference in its entirety). This is used in interval mapping to describe the degree of linkage between two marker loci.
  • a LOD score of three (3.0) between two markers indicates that linkage is 1000 times more likely than no linkage, while a LOD score of two (2.0) indicates that linkage is 100 times more likely than no linkage. LOD scores greater than or equal to two (2.0) may be used to detect linkage.
  • markers linked to the markers described herein can be used to predict the sex of a date palm plant and are therefore also useful in carrying out the methods of the present invention.
  • Closely linked loci display an inter-locus cross-over frequency of about 10% or less, preferably about 9% or less, still more preferably about 8% or less, yet more preferably about 7% or less, still more preferably about 6% or less, yet more preferably about 5% or less, still more preferably about 4% or less, yet more preferably about 3% or less, and still more preferably about 2% or less.
  • the relevant loci e.g., a marker locus and a target locus
  • the loci are about 10 cM, 9 cM, 8 cM, 7 cM, 6 cM, 5 cV1. 4 cM, 3 cM. 2 cM, 1 cM. 0.75 cM, 0.5 cM or 0.25 cM or less apart.
  • Methods of the present invention are carried out to determine the sex of a date palm plant in a population, group, variety, or other classification of date palms where sex determinination by genetic analysis is not otherwise known.
  • the methods of the present invention may be carried out to determine the sex of a plant of the variety Khalas, Deglet Noor, or Medjool.
  • Other varieties of date palm are known and cultivated and are suited to the methods of the present invention.
  • the plant, tissue, seed, or germplasm may then be planted or transplanted in a location suitable for the identified sex.
  • a date palm orchard also referred to as a "garden”
  • it may be desirable in a date palm orchard also referred to as a "garden" to maximize the number of fruit-bearing (i.e., female) plants.
  • the ideal number of male to female plants may depend on several factors, including the size of the orchard, the fecundity of the male or female - 2 j - plants, the climate, etc.
  • male plants, which spread pollin to fertilize the female flowers of the female plants may be planted at locations in the orchard most likely to result in an ideal amount of pollination.
  • the present invention permits the
  • the methods of the present invention involve growing a fruit-bearing plant from a plant, tissue, germplasm, or seed identified as a female plant pursuant to the methods of the present invention. The fruit is then harvested from the fruit-bearing plant. 100801 The methods of the present invention also involve breeding a plant, after the sex of the plant has been determined pursuant to the methods of the present invention.
  • the methods of the present invention also involve marking a plant, tissue, seed, or germplasm based on its identified sex. For example, it may be desirable to analyze DNA or RNA from a date palm seed to identify the sex of the date palm seed. Upon identifying the sex of the seed, it is marked or segregated according to its sex. According to this embodiment, a grower can then select a seed based on its sex and plant the seed at a desirable location.
  • Another aspect of the present invention relates to a method of identifying the sex of a date palm plant.
  • This method involves analyzing DNA or RNA from a date palm plant, tissue, germplasm. or seed for the presence of (i) a genotype that identifies the sex of the plant, tissue, germplasm. or seed, or (ii) a molecular marker linked to the genotype and identifying the sex of the plant, tissue, germplasm. or seed based on whether or not the plant, tissue, germplasm. or seed contains the genotype or the molecular marker.
  • Genotypes of the present invention include three possible alleles (AA, AB,
  • the sex of a date palm plant can be determined by detecting a genotype at position 51 of any of SEQ ID NOs: 1 -972, as set forth in Figures 2A-A .
  • the homozygous female allele (A/A) is associated with a female plant.
  • the heterozygous (A/B) and homozygous male allele (B/B) are associated with a male plant.
  • the present invention also relates to methods of selecting a male or female date palm plant prior to flowering.
  • the method involves detecting in a date palm plant, tissue, germplasm, or seed (i) a genotype that identifies the plant, tissue, germplasm, or seed as male or female, or (ii) a molecular marker in linkage
  • the method involves detecting in a date palm plant, tissue, germplasm, or seed (i) a nucleic acid sequence that identifies the plant, tissue, germplasm, or seed as male or female or (ii) a molecular marker in linkage disequilibrium with the nucleic acid sequence and selecting the plant, tissue, germplasm, or seed possessing the nucleic acid sequence or the molecular marker, [0085]
  • a nucleic acid sequence that identifies the plant, tissue, germplasm, or seed as male or female
  • a molecular marker in linkage disequilibrium with the nucleic acid sequence and selecting the plant, tissue, germplasm, or seed possessing the nucleic acid sequence or the molecular marker
  • kits for selecting a male or female date palm plant prior to flowering includes primers or probes for detecting in a date palm plant, tissue, germplasm, or seed (i) a genotype that identifies the plant, tissue, germplasm, or seed as female, or (ii) a molecular marker in linkage disequilibrium with the genotype and instructions for using the primers or probes for detecting the genotype or the molecular marker.
  • the kit includes primers or probes for detecting in a date palm plant, tissue, germplasm, or seed (i) a nucleic acid sequence that identifies the plant, tissue, germplasm, or seed as male or female or (ii) a molecular marker in linkage disequilibrium with the nucleic acid sequence and instructions for using the primers or probes for detecting the nucleic acid sequence or the molecular marker.
  • Kits of the present invention may contain reagents speci fic for the detection of mRNA or cDNA (e.g., oligonucleotide probes or primers).
  • the kits of the present invention may contain al l of the components necessary to perform a detection assay, including all controls, directions for performing assays, and any necessary software for analysis and presentation of results.
  • individual probes and reagents for detection of nucleic acid sequences that identify the sex of a date palm plant or are provided as analyte specific reagents are included in the kit.
  • the kits are provided as in vitro diagnostics.
  • the present invention also relates to methods of breeding a date palm plant.
  • the method involves providing a date palm plant having a sex determined by detecting in the plant or a seed, tissue, or germplasm from which it was derived (i) a genotype that identifies the plant as either male or female, or (ii) a molecular marker in linkage disequilibrium with the genotype and breeding the date palm plant with a plant of the opposite sex.
  • the method involves providing a date palm plant having a sex determined by detecting in the plant or a seed, tissue, or germplasm from which it was derived (i) a nucleic acid sequence that identifies the plant as male or female or (ii) a molecular marker in linkage disequilibrium with the nucleic acid sequence and breeding the date palm plant with a plant of the opposite sex.
  • Yet a further aspect of the present invention relates to a method of planting a date palm seed of a known sex. This method involves providing a seed having a known male or female sex and planting the seed.
  • Date palm genomic DNA was extracted from leaves obtained from farmed trees in the Doha, Vietnamese area and at the USDA collection in Riverside, California. The halas female had been grown from well-documented plant tissue culture. The Alrijal female and halt male were seed grown but otherwise of unknown descent. Genomic libraries of various sizes were constructed. Paired-end sequencing on the Illumina Genome Analyzer II (Illumina, San Diego, CA) was carried out according to the manufacturer's protocols. The genome was assembled and scaffolded using
  • sequences where matched to the genome using BWA and SNPs called using the SAMTOOLS package (Li et al., "The Sequence Alignment/Map Format and SAMtools,” Bioinformatics 25:2078-9 (2009), which is hereby incorporated by reference in its entirety) with default parameters and requiring a minimum of 5 and no more than 70 sequences to call a SNP.
  • CNVs were detected using CNV-SFQ (Xie et al., "CNV-seq, a New Method to Detect Copy Number Variation Using High-throughput Sequencing," BMC Bioinformatics 10:80(2009), which is hereby incorporated by reference in its entirety).
  • a pedigree includes a heterozygote male (e.g. A/G) progeny from a backcross with a homozygous recurrent parent female (e.g. A/A), the male parent must have been the donor of the 'G' allele.
  • A/G homozygous recurrent parent
  • many donor parents are progeny of backcrosses themselves. Any progeny of a cross between a homozygous (A/A) parent and a heterozygous or homozygous B parent (A/G or G/G) will result in all progeny being either A/A or A/G.
  • qPCR primers were designed on the Khalas genome in 5 regions: 3 male- amplified regions and 2 male-deleted regions. Amplifications were preferred as these are less likely to produce false positive results caused by polymorphism within the PCR primers. QuantiFast SYBR Green PCR mix (QIAGEN) was used in a 20 ⁇ reaction. Samples were run on the Applied Biosystems 7500 real-time PCR machine a minimum of 4 times to produce an average. Delta-delta Ct was calculated against results from the Khalas genome using a region shown to be unam lilled in all genomes as a baseline. A second region with no ISCRs called was used as negative control.
  • QIAGEN QuantiFast SYBR Green PCR mix
  • Regions with suspected linkage to gender based on genome polymorphism data were selected for further genotyping using PCR and sequencing.
  • Primers were designed to create -400 bp PCR products. Regions were amplified with AmpliTaq Gold (Appl ied Biosystems, Foster City, CA) according to the manufacturer ' s protocol. PCR and cycle sequenced products were cleaned with Ampure XI . and CleanSeq (Beckman Coulter, Beverly, MA). Cycle sequencing was conducted with BigDye v3.1 (Applied Biosystems, Foster City, CA). Samples were loaded on a 3130XL DNA Analyzer and sequence traces were visually inspected at all genotyped locations to determine homozygous or heterozygous changes.
  • Fosmid library construction in vector pCC l FOS was as previously described (Pontaroli et al., "Gene Content and Distribution in the Nuclear Genome of Fragaria vesca," The Plant Genome 2:93-101 (2009), which is hereby incorporated by reference in its entirety).
  • TE identification and quantification were by a series of complementary approaches. Small non-coding TEs such as MITEs were found by MITE-Hunter (Han et al, » "MITE-Hunter; A Program for Discovering Miniature Inverted-repeat Transposable Elements from Genomic Sequences.” Nucleic Acids Research
  • Protein-coding TEs were mainly identified by homology to TE-encoded proteins using BLASTX and required Expect value of 10 "5 between predicted peptides. Intact 1.
  • LTRJFINDER Xu et aL "LTRJFINDER: An Efficient Tool for the Prediction of Full-length LTR Retrotransposons," Nucleic Acids Research 35:W265-8 (2007), which is hereby incorporated by reference in its entirety
  • LTR STRUC McCarthy et a ., "LTR STRUC: A Novel Search and Identification Program for LTR Retrotransposons," Bioinformati.es 19:362-367 (2003), which is hereby incorporated by reference in its entirety).
  • the window size for a detectable ISCR with an absolute log2 value of 0.6 or greater ranged in size from 800 bp to 1000 bp, depending on depth of sequence coverage for the test genome.
  • a universal window size of 1600 bp was set to call an ISCR. This was > 1 .5X larger than the window size required for statistically significant ISCR calling. At least 3 adjacent windows were required before annotating the region as an I SCR.
  • Global normalization was used to take into account the tack of chromosome sized contigs.
  • ISCRs were annotated by documenting all locations of an ISCR in each sequenced genome. If the regions between any two genomes overlapped, this was collapsed and considered one ISCR region. All genomes were then documented for their level of sequence variation in these ISCR regions. Only those ISCRs that overlapped a coding region were documented.
  • SNPs with the most distinguishing power in the decision tree 32 SNPs were chosen to provide a set from which a future subset can be selected once testing in a much larger and more diverse population is completed.
  • the date palm genome contains 1 pairs of chromosomes (Siljak-
  • sequences ranging from 36 to 84 bp in length from fragments of -170 bp or -370 bp were generated on the Genome Analyzer IIx (l l lumina.
  • N50 contiguous sequence the contig size above which half of the genome assembly length is contained, of 6,441 bp and a scaffold N50 size of 9,339 bp when scaffolds less than 500 bp were excluded.
  • SOA Pdenovo scaffolds were further joined into larger scaffolds with 28.6X physical coverage from Type 111 restriction enzyme libraries (2,000-5.000 bp) (McKernan et al., "Sequence and Structural Variation in a Human Genome Uncovered by Short-read, Massively Parallel Ligation Sequencing Using Two-base Encoding.” Genome Research 19: 1527-41 (2009), which is hereby
  • the secondary maximum is likely the result of heterozygous regions where the two alleles result in different k-mers. It is important to note that, given this test set contains half the number of high quality bases, k-mer coverage of both alleles is likely high enough (18-20X Kmer coverage per allele) in the full read set to assemble both alleles independently.
  • GC content within coding DNA sequence was 47.6%, while the entire assembled genome has a GC content of 38.5%.
  • 01 1 The top BLAST hits for 9,022 of the date palm, predicted proteins matched predicted proteins from Vitis vinifera, a eudicot, followed by 5,094 top matches to predicted proteins from the monocot Otyza sativa.
  • LTR long terminal repeat
  • LTR retrotransposon of the Copia superfamily was found on sequenced fosmid Rl by both I .TR FINDER (Xu et al., "LTR UNDER: An Efficient Tool for the Prediction of Full-length LTR Retrotransposons," Nucleic Acids Res.
  • LTR STRUC A Novel Search and Identification Program for LTR Retrotransposons
  • Bioinformatics 19:362-367 (2003) which is hereby incorporated by reference in its entirety.
  • This new LTR retrotransposon was given the name "vose,” Table 3 below represents its characteristics, and its sequence is provided. This element constitutes 0,4% of the assembly and 2.3% of the I random reads set. No intact LTR elements were detected in the other 6 fosmids that were sequenced.
  • CNVs Large scale polymorphisms, including CNVs can be detected from sequence data by identifying regions where the observed number of matching sequences from a genome significantly deviate (either up or down) from the expected numbers ( Figure 7).
  • CNV-SEQ software Xie et al.. "CNV-seq, a New Method to Detect Copy Number Variation Using High-throughput Sequencing," BMC Bio infor atics 10:80 (2009), which is hereby incorporated by reference in its entirety). These are termed ISCRs to distinguish them from more rigorously proven CNVs.
  • Plant cultivars are known to exhibit high levels of polymorphism across the genome, punctuated by regions of low polymorphism in gene regions (Ma et al., "Rapid Recent Growth and Divergence of Rice Nuclear Genomes,” PNAS 101 : 12404-10 (2004); Yu et al, "The Genomes of Oryza sativa: A History of Duplications," PLoS Biology 3:e38 (2005), which are hereby incorporated by reference in their entirety).
  • the date palm genome appears similar as uneven distribution of parental allele SNPs were observed in the Khalas female ( Figure 3A).
  • the method used to detect ISCRs is based on sequence alignment and thus requires reasonably high sequence similarity between compared genomes.
  • deletion ISCRs should be more likely to occur in genes that have high numbers of SNPs. This was checked with empirical SNP data. In fact, polymorphism rates were slightly higher in amplification ISCRs (0.74% heterozygosity) than in deletion ISCRs (0.66% heterozygosity). Correlation of the frequency of SNPs in a gene, detected from the Khalas parental alleles, was also checked with the likelihood that the same gene was involved in a deletion ISCR in any number of cultivars.
  • the Spearman's Rank Correlation Coefficient between the two ranked groups was 0.095 and -0.01 1 (uncorrected corrected) with a p- value of 0, showing a lack of correlation between levels of SNPs in a gene in Khalas and the propensity to call a deletion I SCR.
  • the number of SNPs was based on comparison of the sequenced male and female genomes. Regions of the scaffolds that show
  • This pattern of sequence degeneration between male and female haplotypes may be indicative of reduced recombination between the male and female haplotypes, which is a step that may be critical to the development of gender-specific regions (Charlesworth et a!., "A Model for the Evolution of Dioecy and Gynodioecy," The American Naturalist 1 1 2:975 - 997 ( 1978); Bergero et al., "The Evolution of Restricted Recombination in Sex Chromosomes," Trends in Ecology & Evolution 24:94-102 (2009), which are hereby incorporated by reference in their entirety).
  • red- 1 gene is important in sexual development in yeast (Okazaki et al., "Novel Factor Highly conserveed among Eukaryotes Controls Sexual Development in Fission Yeast," Mol. Cell. Biol. 18:887-895 (1998), which is hereby incorporated by reference in its entirety) and that it interacts with c-Myb (Haas et al., "c-Myb Protein Interacts with Red- 1. a Component of the CCR4 Transcription Mediator Complex, " Biochemistry 43:8152-9 (2004), which is hereby incorporated by reference in its entirety).
  • the number of SNPs was based on comparison of the sequenced male and female genomes. Regions of the scaffolds that show SNPs segregating with gender are documents.
  • PGR primers were designed against the scaffold: PDK_30sl 150131 at position 4031 in the forward orientation and at position 4431 in the reverse orientation. Primer sequences included:
  • PDKJOs l 150131 ⁇ 403 I F (GAGTTAATATCTCCTTGCCATCCT (SEQ I NO:973)
  • PDK_30sl 150131 4431 R (GTCAAGGGATCTCCCTATTGTA (SEQ ID NO:974).
  • Genotyping of the first (bold) polymorphic position in SEQ ID NO:975 results in linkage of the AA to female gender and the linkage of AG (heterozygous) to male gender.
  • Genotyping of other locations in the mentioned scaffolds showed linkage disequilibrium to the above genotype SNP. This is most likely due to their proximity in the genome to this scaffold. Therefore, all SNPs with linkage disequilibrium to the detected SNPs would be expected by chance to be included in the present invention.
  • polymorphism can be used in the development of assays to distinguish the two sexes at an early stage.
  • two approaches were employed to develop DNA-based assays for sex differentiation in date palm.
  • the first were PCR-based restriction fragment length polymorphism ("PCR-RFLP") approaches that require amplification followed by restriction digestion and gel electrophoresis.
  • the second approach is a PCR-only method that takes advantage of the high heterogeneity in the sex-linked region to remove the need for the restriction digestion step.
  • the PCR-only assay contained 1 pL of genomic DNA (15 ng/ ⁇ ) with 7.5 ⁇ L ⁇ of 1 .5 mM gCfe , 0.5 ⁇ L ⁇ of each female primer (5 pmol), and 1 pL of each male primer (5 pmol) in a total reaction volume of 25 pL using
  • AmpliTaq Gold master mix (Life Technologies). Reactions were cycled for 45 cycles using previous conditions.
  • BC backcross
  • USDA-CA USDA-ARS national clonal germplasm repository or citrus and dates. Date palm genomic DNA used in this project is documented with ID number used in images, variety name, gender, where the sample is maintained, and its collection ID number.
  • PCR-RFLP assay While the PCR-RFLP assay is l ikely to be quite specific, it was attempted to design an assay that would allow researchers to determine gender of a date palm with a single PGR reaction followed by gel electrophoresis. It was advantageous that the male and female haplotypes are quite diverged with multiple polymorphisms between them. PGR primers were designed to span multiple polymorphisms ( Figures 15A-B) that were unique to either the male or female haplotype in the hope that would allow specific amplification of each haplotype. The male is heterozygous containing both the male and female alleles and should yield two distinct PCR products.
  • the female is homozygous, which should yield a single band representing both copies of the female allele, interestingly, in the design of the male allele specific primers, a single polymorphism only found in the Deglet Noor males was encountered (F igure 15B). This did not seem to affect the ability of the primer to anneal to other males ( Figure 15C). In this case different date palm varieties were used for the validation (Table 1 1). The female varieties from the previous assays were used to establish the functionality of the assay across varieties. However, multiple backcrossed males were used from three varieties to demonstrate linkage of the allele to sex as would be done in a crossing program. That is to say. all females were homozygous and all male offspring shown here were
  • Table 1 Date Palm Varieties Used in the PCR-Only-Based Assay.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Botany (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

This invention relates to the genetics of gender discrimination in the dioecious date palm. Methods of the present invention involve analyzing DNA or RNA from a date palm plant, tissue, germplasm, or seed for the presence of (i) a nucleic acid sequence or genotype that identifies the sex of the plant, tissue, germplasm, or seed or (ii) a molecular marker in linkage disequilibrium with the nucleic acid sequence or genotype. Also disclosed are kits for selecting male and female date palm plants prior to flowering, methods of breeding a date palm plant, and a method of planting a date palm seed of a known sex.

Description

GENETICS OF GENDER DISCRIMINATION IN DATE PALM
[0001] This application claims the benefit of U.S. Provisional Patent Application
Serial No. 61 /469,032, filed March 29, 201 1 , which is hereby incorporated by reference in its entirety.
FIELD OF THE INVENTION
10002 ] This invention relates to the genetics of gender discrimination in the dioecious date palm.
BACKGROUND OF THE INVENTION
[0003] Date palm (Phoenix dactylifera), a member of the Palm family in the
Arecales order {see Figure 1 ), is one of the oldest cultivated trees in the world, with evidence of domestication dating back over 5,000 years (Zohary et al., "Beginnings of Fruit Growing in the Old World," Science 187:319-327(1975)). Dates have been found in the tombs of Pharaohs and in neolithic sites dating 7,000 to 8,000 years ago ( waasi, DA TE PALMS, Elsevier Science Ltd. 2003). demonstrating their historical significance in human nutrition. Date palm trees grow in hot, arid environments and are critical to the agriculture in these regions. For many countries in the Arabian Gulf, date production is the most important agricultural product. Total global production of dates in 2007 reached 6.9 million tons (http://faostat.fao.org).
[0004] Date palm biotechnology faces multiple challenges, including long plant generation times, the inability to simply distinguish between the many varieties of date palm, and the inability to distinguish female from male trees at an early stage. There are more than 2,000 date varieties with differences in fruit color, flavor, shape, size, and ripening time (Al-Farsi et al., "Nutritional and Functional Properties of Dates: A
Review," Critical Reviews in Food Science and Nutrition 48:877-887 (2008)). Likewise, the genetic component of gender determination is not well understood (Ainsworth et al., "Sex Determination in Plants," Current Topics in Developmental Biology 38: 167-223 (1997)). Specifically, date palms take 5-8 years after planting before they flower, at which point male and female trees can be distinguished. Date palm orchards can be rapidly ravished by disease, so the ability to quickly replant orchards from seeds known to be female would be of great benefit.
[§005] There are no easily distinguishable sex chromosomes in date palm, though there is some cytological evidence that they exist (Siljak-Yakovlev et al, "Chromosomal Sex Determination and Heterochromatin Structure in Date Palm," Sexual Plant
Reproduction 9: 127-132 (1 96)), Biochemical studies have yielded little plant gender- distinguishing power (Qacif et al., "Biochemical Investigations on Peroxidase Contents of Male and Female Inflorescences of Date Palm (Phoenix dactylifera L.)," Scientia Horticulturae 1 14:298-301 (2007)). A search for DNA sequences or sequence polymorphisms that are gender-specific could provide access to tools for efficient determination of date palm gender. Given the long generation time of date palm, it is not surprising that few genetic resources exist. However, a backcrossing program for date palm was initiated in California in the 1940's (Barrett, "Date Breeding and Improvement in North America," Fruit Varieties Journal 27:50-55 (1973)). This program provided a unique genetic resource that required over 30 years to generate and is still maintained.
[0006] There is no publicly available physical or genetic map for the genome of any date palm, and recently only -100 kbp of nuclear date palm DNA sequences were found in Gen Bank (http://www.nebi.nlm.nih.gov, which is hereby incorporated by reference in its entirety). Hence, date palm researchers need additional resources before comprehensive efforts to study or improve this important crop can begin.
[0007] The present invention is directed to overcoming these and other deficiencies in the art.
SUMMARY OF THE INVENTION
[0008] One aspect of the present invention relates to a method of identifying the sex of a date palm plant. This method involves analyzing DNA or RNA from a date palm plant, tissue, germplasm, or seed for the presence of (i) a nucleic acid sequence that identi fies the sex of the plant, tissue, germplasm. or seed or (ii) a molecular marker in linkage disequilibrium with the nucleic acid sequence. The sex of the plant, tissue, germplasm, or seed is identified based on w hether or not the plant, tissue, germplasm, or seed contains the nucleic acid sequence or the molecular marker. [0009] Another aspect of the present invention relates to a method of identifying the sex of a date palm plant. This method involves analyzing D A or RNA from a date palm plant, tissue, germplasm, or seed for the presence of (i) a genotype that identifies the sex of the plant, tissue, germplasm, or seed, or (ii) a molecular marker linked to the genotype. The sex of the plant, tissue, germplasm, or seed is identified based on whether or not the plant, tissue, germplasm, or seed contains the genotype or the molecular marker.
[0010] A further aspect of the present invention relates to a method of selecting a male or female date palm plant prior to flowering. This method involves detecting in a date palm plant, tissue, germplasm, or seed (i) a genotype that identifies the plant, tissue, germplasm, or seed as male or female, or (ii) a molecular marker in linkage
disequilibrium with the genotype. The plant, tissue, germplasm, or seed possessing the genotype or the molecular marker is selected.
[0011 ] Yet another aspect of the present invention relates to a kit for selecting a male or female date palm plant prior to flowering. The kit includes primers or probes for detecting in a date palm plant, tissue, germplasm. or seed (i) a genotype that identifies the plant, tissue, germplasm, or seed as male or female, or (ii) a molecular marker in linkage disequilibrium with the genotype. The kit also includes instructions for using the primers or probes for detecting the genotype or the molecular marker.
[0012] Yet a further aspect of the present invention relates to a method of selecting a male or female date palm plant prior to flowering. This method involves detecting in a date palm plant, tissue, germplasm, or seed (i) a nucleic acid sequence that identifies the plant, tissue, germplasm, or seed as male or female or (ii) a molecular marker in linkage disequilibrium with the nucleic acid sequence. The plant, tissue, germplasm, or seed possessing the nucleic acid sequence or the molecular marker is selected.
[0013] Still another aspect of the present invention relates to a kit for selecting a male or female date palm plant prior to flowering. The kit includes primers or probes for detecting in a date palm plant, tissue, germplasm, or seed (i) a nucleic acid sequence that identifies the plant, tissue, germplasm, or seed as male or female or (ii) a molecular marker in linkage disequilibrium with the nucleic acid sequence. The kit also includes instructions for using the primers or probes for detecting the nucleic acid sequence or the molecular marker. [0014] Still a further aspect of the present invention relates to a method of breeding a date palm plant. This method involves providing a date palm plant having a sex determined by detecting in the plant or a seed, tissue, or germplasm from which it was derived (i) a genotype that identifies the plant as either male or female, or (ii) a molecular marker in linkage disequilibrium with the genotype. The date palm plant is bred with a plant of the opposite sex.
[0015] Yet another aspect of the present invention relates to a method of breeding a date palm plant. This method involves providing a date palm plant having a sex determined by detecting in the plant or a seed, tissue, or germplasm from which it was derived (i) a nucleic acid sequence that identifies the plant as male or female or (ii) a molecular marker in linkage disequilibrium with the nucleic acid sequence. The date palm plant is bred with a plant of the opposite sex.
[0016] Yet a further aspect of the present invention relates to a method of planting a date palm seed of a known sex. This method involves providing a seed having a known male or female sex and planting the seed.
f 0 171 The ability of the date palm plant to withstand extremely harsh conditions, while producing highly nutritious fruit with relatively minimal care, makes it a good candidate for improving arid land agriculture. Challenges such as generation times of approximately 5-8 years and dioecy (separate male and female trees) have hindered genetic studies of the date palm. To provide the foundation for date palm genetic studies, the genome of a " halas" variety female date palm was shotgun sequenced using massively parallel sequencing. A de novo assembly of -380 Mbp, spanning mainly gene- rich regions, was generated using only the shotgun reads and over 25,000 gene models were predicted. To help energize date palm biotechnology, 8 additional genomes were sequenced, including those of the economically important Deglet Noor and Medjool variety females, together with their backcrossed males. Over 3.5 million polymorphic sites were identified, including >10,000 genie copy number variations. A small subset of polymorphisms capable of distinguishing multiple varieties was discovered. For the first time, a region of the genome linked to gender was identified, and evidence is presented herein that date palm employs an XY system of gender-inheritance. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 is a taxonomic tree of sequenced plant genomes. Date palm is the first available monocot (Liliopsida) draft sequence in the Arecales order. Other sequenced monocot genomes are mainly grasses.
(0019] Figures 2A-A are tables setting forth 972 polymorphic sites for gender discrimination in date palm. Each DNA sequence (SEQ ID NOs: 1 -972) is identified by scaffold name and single nucleotide polymorphism ("SNP") ID. Each DNA sequence is 100 nucleotides in length with the nucleotide at position 51 being the sex-determining nucleotide. The male allele (MA) at position 5 1 is identified for each sequence.
[0020] Figures 3A-D are graphs illustrating date palm SNP analysis. SNPs were analyzed between parental alleles of the Khalas reference genome and between different varieties. Figure 3A shows that the distance between parental allele SNPs in Khalas is not normally distributed. The skewed distribution of adjacent S P distances
demonstrates the occurrence of high and low polymorphism islands in the genome.
About 49% of SNPs occur within 50 bp of another SNP. This trend was maintained even after removing SNPs likely to be in repetitive regions (KhlsFilter). Figure 3FJ shows that backcrossed varieties of date palm, on average, show high levels of similarity to their recurrent parent with numbers of generations (ranging from Backcross 1 to 5 generations) of backcrossing having little effect on similarity levels (error bars are quite small). Inter- variety comparisons show significantly more sites with different genotypes. Figure 3C is a graph showing Principal Component Analysis (''PCA") of sequenced genomes based on 3.5 million polymorphic sites. Khalas and backcrossed variants are essentially on top of each other. In Figure 3D, PCA of sequenced genomes based on 32 Decision Tree selected polymorphic sites reveals little loss of discrimination quality with much reduced genotyping required. DN is Deglet Noor, Dy is Dayri, Mj is Medjool, BC is Backcross.
[0021] Figure 4 is a graph showing 1 unbalanced Sequence Count Regions
("ISCR") analysis among date palm genomes. The vertical axis represents the number of unique ISCRs remaining in each genome after comparison with other genomes. Only non-backcrossed genomes were considered to avoid bias from inbreeding.
Approximately 7% of ISCRs were unique to any single genome while the majority were observed in at least one other genome. [0022J Figure 5 is a graph showing enrichment of Gene Ontology categories for genes covered by ISCRs. Gene Onotolgy categories from genes covered by IS Rs in at least 2 genomes were analyzed for enrichment. Gene counts in each category were normalized to total gene counts in either the genome or ISCRs, A false discovery rate of 0.2 was applied and only categories showing at least 2-fold enrichment in the ISCRs are reported.
(00231 Figures 6A-B are illustrations showing pedigree and genotype information for gender-discriminating regions. Date palms of known genealogy were genotyped at multiple gender-discriminating regions. Figure 6A shows a section of the full pedigree used for linkage analysis showing the complex relationship of the trees. DN is Deglet Noor, Dy is Dayri, Mj is Medjool, BC is Backcross, and DnPr represents the initial donor parents. Grey boxes indicate an unknown but theoretically determined genotype. The genotype in each individual is the genotype found at the first gender-discriminating SNP that was genotyped. Segregation of heterozygosity with the male phenotype is clear. Figure 6B shows genotypes from 4 scaffolds (scales with exons annotated as ticks and repeats as rectangles) with the largest number of male-specific SNPs (MS-SNPs).
Genotypes from selected regions are presented with their scaffold base pair location above each genotype. The number observed (both empirically and theoretically) for each gender in each genotype is included.
[0024) Figure 7 is an illustration showing the workflow of SNP finding.
Assembly was conducted using paired-end sequences from small inserts that cannot span medium sized repeats (grey box in gene). Scaffolding utilized longer mate pairs of 2-5 kb to join adjacent contigs by spanning repeats. During "Annotation," genes were predicted along the scaffolds. SNP finding was conducted by matching sequences to the reference and detecting regions where multiple high quality sequence reads disagreed with the reference sequence. Copy Number Variation ("CNV") finding required matching sequence reads from a reference and test genome and detecting regions where the test genome had significantly deviated numbers of reads compared to the reference genome. For detecting regions associated with gender (M/F comparison), the genome was scanned for scaffolds containing high levels of gender segregating SNPs. In this case, scaffolds with large numbers of SNPs that were only heterozygous in males were found.
[0025] Figure 8 is an illustration showing the comparison of seven fosmids to the assembly. The horizontal axis shows coordinates in fosmids. Regular genes in fosmids are shown as bars above (forward chain) and below (backward chain) the axes. TE genes are also shown. White bars in the black windows show matched regions between the indicated fosmid and assembly.
[0026] Figure 9 is a chart showing clustering of 13 genomes genotyped at 32 variety discriminating SNPs, Even closely related genomes like the backcrossed males and their recurrent parents separate well using this subset of the 3.5 million original polymorphisms. " 1 " represents homozygous match to the reference Khalas genome, "2" represents a heterozygous position, and "3" indicates a homozygous mismatch to the reference Khalas genome. Column titles include Scaffold ID followed by base pair location of the SNP.
[0027] Figure 10 is a graph showing coverage at ~1 .2 million locations in the genome by the test set of -210 million reads.
[0028] Figure 1 1 is a graph showing Kmer coverage in a test set of -210 million reads.
[0029] Figures 12A-B show results of the PCR-RFLP assay based on Bell digestion. Figure 12A shows the scaffold ID (Gen Bank accession numbers) followed by the primer IDs lead ([4675] (SEQ ID NO;976; [4820]-[4830] (SEQ ID NO:977); [5090J (SEQ ID NO;978)). PCR primer sites are in bold and underlined with an arrow showing the direction of amplification. DNA sequences are flanked by base pair coordinates in the scaffold. The restriction sites are in bold with the female/male allele in square brackets where they di ffer. In Figure 12B, PCR-RFLP results are shown for each date palm variety assayed using the appropriate variety number from Table 10. PCR product size is 405 bp and the Bell site is at bp 143. Expected product sizes from digestion are 143 bp and 262 bp. In this assay, the female allele does not contain the restriction site and is not digested while the male allele is.
[0030] Figures 13A-B show PCR-RFLP based on Hpall digestion. Figure 13A shows the scaffold ID (GenBank accession numbers) followed by the primer IDs lead ([81 10] (SEQ ID NO:979); [8290]-[8300] (SEQ ID NO:980): [8475]-[8485] (SEQ ID NO:981); [ 8570] (SEQ II) NO:982)). PCR primer sites are in bold and underlined with an arrow showing the direction of ampli fication. DNA sequences are flanked by base pair coordinates in the scaffold. The restriction sites are in bold with the female/male allele in square brackets where they differ. In Figure 13B, PCR-RFLP results are shown for each date palm variety assayed using the appropriate variety number from Table 10. PCR product size is 452 bp and Hpall sites are at bp 180, 369. and 393, although only the site at bp 180 is specific to the female allele. Digestion of the female allele results in products of size 24 bp, 59 bp, 180 bp, and 89 bp. Digestion of the male allele results in products of size 24 bp, 59 bp, and 369 bp,
[OWIJ Figures 14A-B show PCR-RFLP based on Rsal digestion. Figure 14A shows the scaffold ID (GenBank accession numbers) followed by the primer IDs lead ([41360] (SEQ 1D N():983 ; [41650]-[41660] (SEQ ID NO:984); [41870] (SEQ ID
NO;985)). PCR primer sites are in bold and underlined with an arrow showing the direction of amplification. DNA sequences are flanked by base pair coordinates in the scaffold. The restriction sites are in bold with the female/male allele in square brackets where they differ. In Figure 1 4B, PCR-RFLP results are shown for each date palm variety assayed using the appropriate variety number from Table 10. PCR product size is 493 bp and Rsal sites are at bp 5 and 288, Expected product sizes from digestion of the female allele are 5 bp, 205 bp, and 283 bp. Two males (1 M and 8M) did not contain the male-specific allele, resulting in digestion and suggesting that allele is not as widespread in the population.
[0032] Figures 15A-C are results of a PCR-only-based assay. Figure 15A shows the scaffold ID (GenBank accession numbers) followed by the primer IDs lead
([4630Fem] (SEQ ID NO:986; [4630Mal] (SEQ ID NO:987); [5075Fem] (SEQ ID NO;988); [5075Mal] (SEQ I D NO:989)). Primers designed to match the female allele are highlighted while mismatched bases in the same strand of the male allele are shown. Arrows indicate direction of the primers. In Figure 15B, primers designed to match the male allele are shown ([4650Fem] (SEQ I D NO:990; [4650Mal] (SEQ I D NO:991 );
[4980Fem] (SEQ ID NO:992); [4980Mal] (SEQ I D NO:993)). A polymorphism detected only in Deglet Noor males and not in other male sequences is identified. Figure 15C shows PCR-only-based assay results on seven males and seven females. Abbreviations are as in Table 1 1. While all tests show primer dimers, female samples show the expected single band with the male samples showing the expected two bands.
DETAILED DESCRIPTION OF THE INVENTION
[0033] The present invention pertains to date palm plants, which are dioecious plants of the species Phoenix dactylifera. According to one aspect, the present invention relates to a method of identifying the sex of a date palm plant. This method involves analyzing DNA or RNA from a date palm plant, tissue, germ plasm, or seed for the presence of (i) a nucleic acid sequence that identifies the sex of the plant, tissue, germplasm. or seed or (ii) a molecular marker in linkage disequilibrium with the nucleic acid sequence. The sex of the plant, tissue, germplasm, or seed is identified based on whether or not the plant, tissue, germplasm. or seed contains the nucleic acid sequence or the molecular marker.
[§034) The terms plant, tissue, germplasm, and seed refer to any of whole plants, plant parts, plant components or organs (e.g.. leaves, stems, roots, floral structures, etc.), plant tissue, seeds, plant cells, and/or progeny of the same. A plant cell is a cell of a plant, taken from a plant, or derived through culture from a cell taken from a plant.
[0035] Analyzing DNA or RNA from a date palm plant, tissue, germplasm, or seed pursuant to the present invention can be carried out by methods well-known in the art. Such methods include, e.g., DNA sequencing, hybridization assays, PCR-based assays, detection of markers (e.g., SNPs, simple sequence repeats ("SSRs"), restriction fragment length polymorphisms C'RFLPs"), amplified fragment length polymorphisms C'AFLPs"), and isozyme markers). Well-established methods are also known for the detection of expressed sequence tags ("ESTs") and SSR markers derived from EST sequences and randomly amplified polymorphic DNA.
[0036] According to one embodiment of the present invention, analyzing DNA or
RNA from a date palm plant involves detecting, in a hybridization assay, whether a nucleic acid sequence that identifies the sex of the date palm plant, tissue, germplasm, or seed hybridizes to an oligonucleotide probe. Alternatively, analyzing involves detecting, in a PCR-based assay, whether oligonucleotide primers amplify a nucleic acid sequence indicative of the gender of the date palm plant, tissue, germplasm, or seed being analyzed.
[0037] In one embodiment of the present invention, the presence of a nucleic acid sequence that identifies the sex of a date palm is detected using a direct sequencing technique. Specifically. DNA samples are first isolated from a date palm plant using any suitable method. The region of interest is cloned into a suitable vector and amplified by growth in a host cell (e.g., bacteria). Alternatively, DNA in the region of interest is ampl ified using PCR.
[0038] Following amplification, DNA in the region of interest (e.g., the region containing the gender indicative SNP or marker) is sequenced using any suitable method including, but not limited to, manual sequencing using radioactive marker nucleotides and automated sequencing. The results of the sequencing are displayed using any suitable method. The sequence is examined and the presence or absence of a given SNP or marker is determined.
[0039] Alternatively, a PCR-based assay is used, which employs oligonucleotide primers that hybridize only to a gender indicative SNP or allele. Primers are used to amplify a sample of DNA. For example, primers can be constructed pursuant to well- known methods in the art to amplify, e.g., only nucleotide sequences possessing a male allele. If the primers result in a PCR product, then the plant has the male allele and the plant is identified as male.
[0040] In a hybridization assay, the presence or absence of a given SNP (e.g., a gender indicative allele) or marker is determined based on the ability of the DNA from the sample to hybridize to a complementary DNA molecule (e.g., an oligonucleotide probe). A variety of hybridization assays using a variety of technologies for hybridization and detection are available and include, without limitation, direct detection of hybridization, detection of hybridization using DNA chip assays, and enzymatic detection of hybridization.
[00411 In direct detection of hybridization, hybridization of a probe to the sequence of interest (e.g., a gender indicative SNP or marker) is detected directly by visualizing a bound probe (e.g., a Northern or Southern assay). In these assays, genomic DNA (Southern) or RNA (Northern) is isolated from a plant. The DNA or RNA is then cleaved with a series of restriction enzymes that cleave infrequently in the genome and not near any of the markers being assayed. The DNA or RNA is then separated (e.g., on an agarose gel ) and transferred to a membrane. A labeled (e.g. , by incorporating a radionucieotide) probe or probes specific for the gender indicative SNP or marker being detected is allowed to contact the membrane under low, medium, or high stringency conditions. Unbound probe is removed and the presence of binding is detected by visualizing the labeled probe.
[0042 J In detection of hybridization using DNA chip assays, a series of oligonucleotide probes are affixed to a solid support. The oligonucleotide probes are designed to be unique to a given SNP or marker. The DNA sample of interest is contacted with the DNA chip and hybridization is detected. In some embodiments, the DNA chip assay is a GeneChip (Affymetrix, Santa Clara, CA; see, e.g., U.S. Patent Nos. 6,045,996; 5,925,525; and 5,858.659: which are hereby incorporated by reference in their entirety) assay. The GeneChip technology uses miniaturized, high-density arrays of oligonucleotide probes affixed to a chip. .Probe arrays are manufactured, e.g., by Af ymetrix's light-directed chemical synthesis process, which combines solid-phase chemical synthesis with photolithographic fabrication techniques employed in the semiconductor industry. Using a series of photolithographic masks to define chip exposure sites, followed by specific chemical synthesis steps, the process constructs high- density arrays of oligonucleotides, with each probe in a predefined position in the array. Multiple probe arrays are synthesized simultaneously on a large glass wafer. The wafers are then diced, and individual probe arrays are packaged in injection-molded plastic cartridges, which protect them from the environment and serve as chambers for hybridization.
[0043] The nucleic acid to be analyzed is isolated, amplified by PGR, and labeled with a fluorescent reporter group. The labeled nucleic acid is then incubated with the array using a fluidics station. The array is then inserted into the scanner, where patterns of hybridization are detected. The hybridization data are collected as light emitted from the fluorescent reporter groups are incorporated into the target, which is bound to the probe array. Probes that perfectly match the target generally produce stronger signals than those that have mismatches. Since the sequence and position of each probe on the array are known, by complementarity, the identity of the target nucleic acid applied to the probe array can be determined.
100441 In other embodiments, a DNA microchip containing electronically captured probes (Nanogen, San Diego, CA) is utilized (see, e.g., U.S. Patent Nos.
6,017,696; 6,068. 1 8; and 6,051 ,380; which are hereby incorporated by reference in their entirety). Through the use of microelectronics, Nanogen 's technology enables the active movement and concentration of charged molecules to and from designated test sites on its semiconductor microchip. DNA capture probes unique to a given SNP or marker are electronically placed at, or "addressed" to, spec i lie sites on the microchip. Since DNA has a strong negative charge, it can be electronically moved to an area of positive charge.
[0045] First, a test site or a row of test sites on the microchip is electronically activated with a positive charge. Next, a solution containing the DNA probes is introduced onto the microchip. The negatively charged probes rapidly move to the positively charged sites, where they concentrate and are chemically bound to a site on the microchip. The microchip is then washed and another solution of distinct DNA probes is added until the array of specifically bound DNA probes is complete.
[0046] A test sample is then analyzed for the presence of target DNA molecules by determining which of the DNA capture probes hybridize, with complementary DNA in the test sample (e.g. , a PCR amplified gene of interest). An electronic charge is also used to move and concentrate target molecules to one or more test sites on the microchip. The electronic concentration of sample DN A at each test site promotes rapid hybridization of sample DNA with complementary capture probes (hybridization may occur in minutes). To remove any unbound or nonspecifically bound DNA from each site the polarity or charge of the site is reversed to negative, thereby forcing any unbound or nonspecifically bound DNA back into solution away from the capture probes. A laser-based fluorescence scanner is used to detect binding.
[0047] In still further embodiments, an array technology based upon the segregation of fluids on a flat surface (chip) by di ferences in surface tension (ProtoGene. Palo Alto, CA) is utilized (.see, e.g., U.S. Patent Nos. 6,001 ,31 1 ; 5,985,551 ; and
5,474,796; which are hereby incorporated by reference in their entirety). Protogene's technology is based on the fact that fluids can be segregated on a flat surface by differences in surface tension that have been imparted by chemical coatings. Once so segregated, oligonucleotide probes are synthesized directly on the chip by ink-jet printing of reagents. The array, with its reaction sites defined by surface tension, is mounted on an X/Y translation stage under a set of four piezoelectric nozzles, one for each of the four standard DNA bases. The translation stage moves along each of the rows of the array and the appropriate reagent is delivered to each of the reaction sites. For example, the A amidite is delivered only to the sites where amidite A is to be coupled during that synthesis step and so on. Common reagents and washes are delivered by flooding the entire surface and then remov ing them by spinning.
[0048] DNA probes unique for the SNP or marker of interest are affixed to the chip using Protogene's technology. The chip is then contacted with the PCR-amplified genetic region of interest. Following hybridization, unbound DNA is removed and hybridization is detected using any suitable method (e.g. , by fluorescence de-quenching of an incorporated fluorescent group).
[0049] In yet other embodiments, a "bead array" is used for the detection of polymorphisms (Illumina, San Diego, CA; see, e.g., WO 99/67641 and WO 00/39587, which are hereby incorporated by reference in their entirety), Illum ina uses a BEAD ARRAY technology that combines fiber optic bundles and beads that self-assemble into an array. Each fiber optic bundle contains thousands to millions of individual fibers depending on the diameter of the bundle. The beads are coated with an oligonucleotide specific for the detection of a given SNP or marker. Batches of beads are combined to form a pool specific to the array. To perform an assay, the BEAD ARRAY is contacted with a prepared subject sample (e.g., DNA). Hybridization is detected using any suitable method.
[00501 In enzymatic detection of hybridization, hybridization of a bound probe is detected using a TaqMan assay (PE Biosystems, Foster City, CA; see, e.g., U.S. Patent Nos. 5,962,233 and 5,538,848, which are hereby incorporated by reference in their entirety). The assay is performed during a PCR reaction. The TaqMan assay exploits the 5'-3' exonuclease activity of DNA polymerases such as AMPLITAQ DNA polymerase. A probe, specific for a given SNP or marker, is included in the PCR reaction. The probe consists of an oligonucleotide with a 5 '-reporter dye (e.g., a fluorescent dye) and a 3'- quencher dye. During PCR, if the probe is bound to its target, the 5'-3' nucleolytic activity of the AMPLITAQ polymerase cleaves the probe between the reporter and the quencher dye. The separation of the reporter dye from the quencher dye results in an increase of fluorescence. The signal accumulates with each cycle of PCR and can be monitored with a fluorimeter.
[0051] In still further embodiments, polymorphisms are detected using the SNP-
I I" primer extension assay (Orchid Biosciences, Princeton, NJ; see, e.g., U.S. Patent Nos. 5,952, 174 and 5,919,626, which are hereby incorporated by reference in their entirety). In this assay, SNPs are identified by using a specially synthesized DNA primer and a DNA polymerase to selectively extend the DNA chain by one base at the suspected SNP location. DNA in the region of interest is amplified and denatured. Polymerase reactions are then performed using miniaturized systems called microfluidics. Detection is accomplished by adding a label to the nucleotide suspected of being at the SNP or marker location. Incorporation of the label into the DNA can be detected by any suitable method (e.g., if the nucleotide contains a biotin label, detection is via a fluorescently labeled antibody specific for biotin). Numerous other assays are known in the art.
[0052] Additional detection assays that are suitable for use in the present invention include, but are not limited to, enzyme mismatch cleavage methods (e.g. , Variagenies, U.S. Patent Nos. 6,1 10,684; 5,958,692; and 5,851 ,770, which are hereby incorporated by reference in their entirety); polymerase chain reaction; branched hybridization methods (e.g., Chiron, U.S. Patent Nos. 5,849,481 ; 5,710,264; 5, 124,246; and 5,624,802; which are hereby incorporated by reference in their entirety); rolling circle replication (e.g., U.S. Patent Nos. 6,210,884 and 6, 183,960, which are hereby incorporated by reference in their entirety); NASBA (e.g., U.S. Patent No. 5,409,818, which is hereby incorporated by reference in its entirety); molecular beacon technology (e.g., U.S. Patent No. 6, 150,097, which is hereby incorporated by reference in its entirety); E-sensor technology (Motorola, U.S. Patent Nos. 6,248,229; 6,221 ,583;
6,013, 170; and 6,063,573; which are hereby incorporated by reference in their entirety); INVADER assay (Third Wave Technologies; see, e.g., U.S. Patent Nos. 5,846,717; 6,090,543; 6,001 ,567; 5,985,557; and 5,994,069; which are hereby incorporated by reference in their entirety); cycling probe technology (e.g., U.S. Patent Nos. 5,403,71 1 ; 5,01 1 ,769; and 5,660,988; which are hereby incorporated by reference in their entirety); Dade Behring signal amplification methods (e.g., U.S. Patent Nos. 6, 121 ,001 ; 6, 1 10,677; 5,914,230; 5,882,867; and 5,792,614; which are hereby incorporated by reference in their entirety); ligase chain reaction (Bamay, Proc. Natl. Acad. Sci USA 88: 189-93 (1991), which is hereby incorporated by reference in its entirety); and sandwich hybridization methods (e.g., U.S. Patent No. 5,288,609, which is hereby incorporated by reference in its entirety).
10053] In some embodiments, a MassARRAY system (Sequenom, San Diego.
CA) is used to detect variant sequences (see, e.g., U.S. Patent Nos. 6,043,031 ; 5,777,324; and 5,605,798; which are hereby incorporated by reference in their entirety). DNA is isolated from cell samples using standard procedures. Next, specific DNA regions containing the SNP or marker of interest, about 200 base pairs in length, are amplified by PGR. The amplified fragments are then attached by one strand to a solid surface and the non-immobilized strands are removed by standard denaturation and washing. The remaining immobilized single strand then serves as a template for automated enzymatic reactions that produce genotype specific diagnostic products.
[0054] Very small quantities of the enzymatic products, typically five to ten nanoliters, are then transferred to a SpectroCHIP array for subsequent automated analysis with the SpectroREADER mass spectrometer. Each spot is preloaded with light absorbing crystals that form a matrix with the dispensed diagnostic product. The MassARRAY system uses MALDI-TOF (Matrix Assisted Laser Desorption ionization— Time of Flight) mass spectrometry. In a process known as desorption, the matrix is hit with a pulse from a laser beam. Energy from the laser beam is transferred to the matrix and it is vaporized resulting in a small amount of the diagnostic product being expelled into a flight tube. As the diagnostic product is charged when an electrical field pulse is subsequently applied to the tube they are launched down the flight tube towards a detector. The time between application of the electrical field pulse and collision of the diagnostic product with the detector is referred to as the time of flight. This is a very precise measure of the product's molecular weight, as a molecule's mass correlates directly with time of flight with smaller molecules flying faster than larger molecules. The entire assay is completed in less than one thousandth of a second, enabling samples to be analyzed in a total of 3-5 seconds, including repetitive data collection. The SpectroTYPER software then calculates, records, compares, and reports the genotypes at the rate of three seconds per sample.
100551 The methods of the present invention may involve an automated system for detecting nucleic acid sequences and/or markers. For example, an automated system may include a set of marker probes or primers configured to detect at least one gender indicative SNP or marker as described herein.
[0056] A typical system may include a detector that is configured to detect one or more signal outputs from the set of marker probes or primers, or amplieon thereof, thereby identifying the presence or absence of an allele. A wide variety of signal detection apparatus are available, including photo multiplier tubes, spectrophotometers, CCD arrays, arrays and array scanners, scanning detectors, phototubes and photodiodes, microscope stations, galvo-scans, microfluidic nucleic acid amplification detection appliances, and the like. 1 he precise configuration of the detector will depend, in part, on the type of label used to detect the marker allele, as well as the instrumentation that is most conveniently obtained for the user. Detectors that detect fluorescence,
phosphorescence, radioactivity, pH, charge, absorbance, luminescence, temperature, magnetism, or the like can be used. Typical detector examples include light (e.g., fluorescence) detectors or radioactivity detectors. For example, detection of a light emission (e.g., a fluorescence emission) or other probe label is indicative of the presence or absence of an allele. Fluorescent detection is generally used for detection of amplified nucleic acids (however, upstream and/or downstream operations can also be performed on ampl icons, which can involve other detection methods). In general, the detector detects one or more label (e.g., light) emission from a probe label, which is indicative of the presence or absence of a marker.
[0057) The detector(s) optionally monitors one or a plurality of signals from an amplification reaction. For example, the detector can monitor optical signals which correspond to "real time" amplification assay results.
[0058] System instructions that correlate the presence or absence of the gender indicative SNP or marker with the predicted tolerance are also contemplated by the present invention. For example, the instructions can include at least one look-up table that includes a correlation between the presence or absence of an allele and the predicted sex of the plant. The precise form of the instructions can vary depending on the components of the system, e.g., they can be present as system software in one or more integrated units of the system (e.g., a microprocessor, computer, or computer readable medium), or can be present in one or more units (e.g., computers or computer readable media) operably coupled to the detector. In one typical example, the system instructions may include at least one look-up table that includes a correlation between the presence or absence of the allele(s) and predicted tolerance or improved tolerance. The instructions also typically include instructions providing a user interface with the system, e.g., to permit a user to view results of a sample analysis and to input parameters into the system. 1005 J A system may typically include components for storing or transmitting computer readable data representing or designating the allele(s) detected by the methods of the present invention, e.g., in an automated system. The computer readable media can include, for example, cache, main, and storage memory and/or other electronic data storage components (hard drives, floppy drives, storage drives, etc.) for storage of computer code. Data representing alleles detected by the methods of the present invention can also be electronically, optically, or magnetically transm itted in a computer data signal embodied in a transmission medium over a network such as an intranet or internet or combinations thereof. The system can also, or alternatively, transmit data via wireless, or other available transmission alternatives.
[0060] During operation, the system may typically comprise a sample that is to be analyzed, such as a plant tissue, or material isolated from the tissue such as genomic DNA, amplified genomic DNA, cDNA, amplified cDNA, RNA, amplified RNA, or the like. [00611 Automated systems for detecting nucleic acid sequences and/or markers and/or correlating the nucleic acid sequences and/or markers with a male or female phenotype may involve data entering a computer which corresponds to physical objects or processes external to the computer, e.g., a marker allele, and a process that, within a computer, causes a physical transformation of the input signals to different output signals. n other words, the input data, e.g., amplification of a particular marker allele, is transformed to output data, e.g., the identification of the allelic form of a chromosome segment. The process within the computer is a set of instructions, or program, by which positive amplification or hybridization signals are recognized by the integrated system and attributed to individual samples as a genotype. Additional programs correlate the identity of individual samples with a sex-related phenotype or marker alleles, e.g., statistical methods. In addition, there are numerous, e.g., C/C++ programs for computing, Delphi and/or Java programs for GUI interfaces, and productivity tools (e.g., Microsoft Excel and/or SigmaPlot) for charting or creating look up tables of relevant allele-trait correlations. Other useful software tools in the context of the integrated systems of the invention include statistical packages such as SAS, Genstat, Matlab, Mathematica, and S- Plus and genetic modeling packages such as QU-GENE. Furthermore, additional programming languages such as visual basic are also suitably employed in the integrated systems.
[0062] By way of example, sex identifying marker alleles assigned to a population are recorded in a computer readable medium. Data regarding genotype for one or m re molecular markers, e.g. SSR, RFLP, AFLP, SNP, isozyme markers or other markers as described herein, are similarly recorded in a computer accessible database. Optionally, marker data is obtained using an integrated system that automates one or more aspects of the assay (or assays) used to determine marker genotype. In such a system, input data corresponding to genotypes for molecular markers are relayed from a detector, e.g., an array, a scanner, a CCD, or other detection device directly to files in a computer readable medium accessible to the central processing unit. A set of system instructions (typically embodied in one or more programs) encoding the correlations between tolerance and the alleles of the invention is then executed by the computational device to identify correlations between marker alleles and predicted trait phcnotypes.
[0063] Typically, the system also includes a user input device, such as a keyboard, a mouse, a touchscreen, or the like, for, e.g., selecting files, retrieving data, reviewing tables of maker information, etc., and an output device (e.g., a monitor, a printer, etc.) for viewing or recovering the product of the statistical analysis.
[0064] Integrated systems comprising a computer or computer readable medium comprising set of files and/or a database with at least one data set that corresponds to the marker alleles herein are provided. The system optionally also includes a user interface allowing a user to selectively view one or more of these databases. In addition, standard text manipulation software such as word processing software (e.g. , Microsoft Word™ or Corel Wordperfect™) and database or spreadsheet software (e.g. , spreadsheet software such as Microsoft Excel™, Corel Quattro Pro™, or database programs such as Microsoft Access™ or Paradox™) can be used in conjunction with a user interface (e.g., a GUI in a standard operating system such as a Windows, Macintosh, Unix or Linux system) to manipulate strings of characters corresponding to the alleles or other features of the database.
[0065] The system may optionally include components for sample manipulation, e.g., incorporating robotic devices. For example, a robotic liquid control armature for transferring solutions (e.g. , plant cell extracts) from a source to a destination, e.g., from a microtiter plate to an array substrate, is optionally operably linked to the digital computer (or to an additional computer in the integrated system). An input device for entering data to the digital computer to control high throughput liquid transfer by the robotic liquid control armature and. optionally, to control transfer by the armature to the solid support is commonly a feature of the integrated system. Many such automated robotic fluid handling systems are commercially available. For example, a variety of automated systems are available from Caliper Technologies (Hopkinton, Mass.), which utilize various Zymate systems, which typically include, e.g., robotics and fluid handling modules. Similarly, the common ORCA® robot, which is used in a variety of laboratory systems, e.g., for microtiter tray manipulation, is also commercially available, e.g., from Beckman Coulter, Inc. (Fullerton, CA). As an alternative to conventional robotics, microfluidic systems for performin fluid handling and detection are now widely available, e.g., from Caliper Technologies Corp. ( I lopkinton. MA) and Agilent technologies (Palo Alto, CA).
[0066] Systems for molecular marker analysis can include a digital computer with one or more of high-throughput liquid control software, image analysis software for analyzing data from marker labels, data interpretation software, a robotic liquid control armature for transferring solutions from a source to a destination operably linked to the digital computer, an input device (e.g., a computer keyboard) for entering data to the digital computer to control high throughput liquid transfer by the robotic liquid control armature and, optionally, an image scanner for digitizing label signals from labeled probes hybridized, e.g., to markers on a solid support operably linked to the digital computer. The image scanner interfaces with the image analysis software to provide a measurement of, e.g., nucleic acid probe label intensity upon hybridization to an arrayed sample nucleic acid population (e.g., comprising one or more markers), where the probe label intensity measurement is interpreted by the data interpretation software to show whether, and to what degree, the labeled probe hybridizes to a marker nucleic acid (e.g., an amplified marker allele). The data so derived is then correlated with sample identity, to determine the gender of a date palm plant.
[0067 J Optical images, e.g., hybridization patterns viewed (and, optionally, recorded) by a camera or other recording device (e.g., a photodiode and data storage device) are optionally further processed in any of the embodiments herein, e.g., by digitizing the image and/or storing and analyzing the image on a computer. A variety of commercially available peripheral equipment and software is available for digitizing, storing, and analyzing a digitized video or digitized optical image, e.g., using PC (Intel x86 or pentium chip-compatible DOS™, OS2™, WINDOWS™, WINDOWS NT™ or WINDOWS95™. based machines), MACINTOSH™, LINUX, or UNIX based (e.g. SUN™ work station) computers.
[0068] Pursuant to the methods of the present invention, nucleic acid sequences that identi fy the sex of a date palm plant include the nucleotide sequences of SEQ ID NOs: 1 -972 of Figures 2A-AK. Thus, in one embodiment, analyzing is carried out to determine the presence of a male allele at the nucleotide corresponding to position 5 1 of any one of SEQ ID NOs: 1 -972, as set forth in Figures 2A-AK. In an alternative embodiment, the plant, tissue, germplasm, or seed does not contain the male allele of SEQ ID NOs: 1 -972, as set forth in Figures 2A-AK, and the plant, tissue, germplasm, or seed is identified as a female plant.
[0069] In an alternative embodiment, DNA or RNA from a date palm plant, tissue, germplasm, or seed is analyzed for the presence of a molecular marker in linkage disequilibrium with the nucleic acid sequence that identifies the sex of the date palm plant. According to this embodiment, the molecular marker is present in SEQ ID NOs: 1 - 972, as set forth in Figures 2A-A , or a corresponding RNA molecule. Molecular markers now known, or to be discovered, that are in linkage disequilibrium with a nucleic acid molecule that identifes the sex of a date palm plant are contemplated by the present invention,
[0070] As used herein, a marker is a nucleotide sequence or encoded product thereof (e.g., a protein) used as a point of reference. For markers to be useful at detecting recombinations, they need to detect differences, or polymorphisms, within the population being monitored. For molecular markers, this means differences at the DNA level due to polynucleotide sequence differences (e.g. , SNP, SSR, RFLP, AFLP). As used herein, markers define a specific locus on the date palm genome. Each marker is therefore an indicator of a specific segment of DNA, having a unique nucleotide sequence.
[0071 ] When a trait is stated to be linked to a given marker it will be understood that the actual DNA segment whose sequence affects or indicates the trait generally co- segregates with the marker. More precise and definite localization of a trait may be obtained if markers are identified on both sides of the trait. By measuring the appearance of the marker(s) in progeny of crosses, the existence of the trait can be detected by relatively simple m lecular tests without actually evaluating the trait itself, which can be difficult and time-consuming because the actual evaluation of the trait requires growing plants to a stage where the trait can be expressed.
[0072] The genomic variability of a marker can be of any origin, for example, insertions, deletions, duplications, repetitive elements, point mutations, recombination events, or the presence and sequence of transposable elements ("ΤΕ'"). Molecular markers can be derived from genomic or expressed nucleic acids (e.g., ESTs) and can also refer to nucleic acids used as probes or primer pairs capable of amplifying sequence fragments via the use of PCR-based methods.
[0073] In the context of the present invention, DNA or RNA is analyzed for the presence of a molecular marker in linkage disequilibrium with a nucleic acid sequence that identi fies the sex of the plant. By "linkage disequilibrium." it is meant that the nucleic acid and the trait are found together in progeny plants more often than if the nucleic acid and phenotype segregated separately.
[0074] Recombination frequency measures the extent to which a molecular marker is linked w ith a particular allele. Lower recombination frequencies, typically measured in centiMorgans ("cM"), indicate greater linkage between the allele and the molecular marker. The extent to which two features are linked is often referred to as the genetic distance. The genetic distance is also typically related to the physical distance between the marker and the allele. However, certain biological phenomenon (including recombinational "hot spots") can affect the relationship between physical distance and genetic distance. Generally, the usefulness of a molecular marker is determined by the genetic and physical distance between the marker and the selectable trait of interest. The linkage relationship between a molecular marker and a phenotype is given as a
"probability" or "adjusted probability." Linkage can be expressed as a desired limit or range. For example, in some embodiments, any marker is linked (genetically and physically) to any other marker when the markers are separated by less than 50, 40, 30, 25, 20, or 15 map units (or cM). In some aspects, it is advantageous to define a bracketed range of linkage, for example, between 10 and 20 cM, between 10 and 30 cM, or between 10 and 40 cM. The more closely a marker is linked to a second locus, the better an indicator for the second locus that marker becomes. Thus, "closely linked loci" such as a marker locus and a second locus display an inter-locus recombination frequency of 10% or less, preferably about 9% or less, still more preferably about 8% or less, yet more preferably about 7% or less, still more preferably about 6% or less, yet more preferably about 5% or less, still more preferably about 4% or less, yet more preferably about 3% or less, and still more preferably about 2% or less. In highly preferred embodiments, the relevant loci display a recombination frequency of about 1 % or less, e.g., about 0.75% or less, more preferably about 0.5% or less, or yet more preferably about 0.25% or less. Two loci that are localized to the same chromosome, and at such a distance that recombination between the two loci occurs at a frequency of less than 10% (e.g., about 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1 %, 0.75%, 0.5%, 0.25%, or less) are also said to be "proximal to" each other. Since one cM is the distance between two markers that show a 1 % recombination frequency, any marker is closely linked (genetically and physically) to any other marker that is in close proximity, e.g. , at or less than 10 cM distant. Two closely linked markers on the same chromosome can be positioned 9, 8, 7, 6, 5, 4, 3, 2, 1 , 0.75, 0.5 or 0.25 cM or less from each other.
[0075] Data provided herein set forth a "logarithm of odds (LOD) value" or
"LOD score" (Risch, "Genetic Linkage: Interpreting LOD Scores," Science 255:803-804 (1992), which is hereby incorporated by reference in its entirety). This is used in interval mapping to describe the degree of linkage between two marker loci. A LOD score of three (3.0) between two markers indicates that linkage is 1000 times more likely than no linkage, while a LOD score of two (2.0) indicates that linkage is 100 times more likely than no linkage. LOD scores greater than or equal to two (2.0) may be used to detect linkage.
[00761 In addition to the markers identified herein, other markers linked to the markers described herein can be used to predict the sex of a date palm plant and are therefore also useful in carrying out the methods of the present invention. This includes any marker within, e.g., 50 cM of the markers associated with sex identification in date palm at a p-level < 0.01 in the association analysis. The closer a marker is to a gene controlling a trait of interest, the more effective and advantageous that marker is as an indicator for the desired trait. Closely linked loci display an inter-locus cross-over frequency of about 10% or less, preferably about 9% or less, still more preferably about 8% or less, yet more preferably about 7% or less, still more preferably about 6% or less, yet more preferably about 5% or less, still more preferably about 4% or less, yet more preferably about 3% or less, and still more preferably about 2% or less. In highly preferred embodiments, the relevant loci (e.g., a marker locus and a target locus) display a recombination frequency of about 1 % or less, e.g. , about 0.75% or less, more preferably about 0.5% or less, or yet more preferably about 0.25% or less. Thus, the loci are about 10 cM, 9 cM, 8 cM, 7 cM, 6 cM, 5 cV1. 4 cM, 3 cM. 2 cM, 1 cM. 0.75 cM, 0.5 cM or 0.25 cM or less apart.
[0077] Methods of the present invention are carried out to determine the sex of a date palm plant in a population, group, variety, or other classification of date palms where sex determinination by genetic analysis is not otherwise known. For example, the methods of the present invention may be carried out to determine the sex of a plant of the variety Khalas, Deglet Noor, or Medjool. Other varieties of date palm are known and cultivated and are suited to the methods of the present invention.
[0078] Having identified the sex of a date palm plant, tissue, seed, or germplasm, the plant, tissue, seed, or germplasm may then be planted or transplanted in a location suitable for the identified sex. For example, it may be desirable in a date palm orchard (also referred to as a "garden") to maximize the number of fruit-bearing (i.e., female) plants. Thus, it may be desirable to have more female plants than male plants in a particular geographical location. The ideal number of male to female plants may depend on several factors, including the size of the orchard, the fecundity of the male or female - 2 j - plants, the climate, etc. In addition, male plants, which spread pollin to fertilize the female flowers of the female plants, may be planted at locations in the orchard most likely to result in an ideal amount of pollination. The present invention permits the
identification of plants of a particular male or female sex, which then permits a grower to determine the number and location of plants of a particular sex type to be planted in a given location. This can all be accomplished several years before the plant has reached a maturity sufficient to determine sex type based on floral structure.
|0()79] The methods of the present invention involve growing a fruit-bearing plant from a plant, tissue, germplasm, or seed identified as a female plant pursuant to the methods of the present invention. The fruit is then harvested from the fruit-bearing plant. 100801 The methods of the present invention also involve breeding a plant, after the sex of the plant has been determined pursuant to the methods of the present invention.
[0081] The methods of the present invention also involve marking a plant, tissue, seed, or germplasm based on its identified sex. For example, it may be desirable to analyze DNA or RNA from a date palm seed to identify the sex of the date palm seed. Upon identifying the sex of the seed, it is marked or segregated according to its sex. According to this embodiment, a grower can then select a seed based on its sex and plant the seed at a desirable location.
[0082] Another aspect of the present invention relates to a method of identifying the sex of a date palm plant. This method involves analyzing DNA or RNA from a date palm plant, tissue, germplasm. or seed for the presence of (i) a genotype that identifies the sex of the plant, tissue, germplasm. or seed, or (ii) a molecular marker linked to the genotype and identifying the sex of the plant, tissue, germplasm. or seed based on whether or not the plant, tissue, germplasm. or seed contains the genotype or the molecular marker.
[0083] Genotypes of the present invention include three possible alleles (AA, AB,
BB). Thus, in one embodiment of the present invention, the sex of a date palm plant can be determined by detecting a genotype at position 51 of any of SEQ ID NOs: 1 -972, as set forth in Figures 2A-A . In particular, the homozygous female allele (A/A) is associated with a female plant. The heterozygous (A/B) and homozygous male allele (B/B) are associated with a male plant.
[0084] The present invention also relates to methods of selecting a male or female date palm plant prior to flowering. In one aspect, the method involves detecting in a date palm plant, tissue, germplasm, or seed (i) a genotype that identifies the plant, tissue, germplasm, or seed as male or female, or (ii) a molecular marker in linkage
disequilibrium with the genotype and selecting the plant, tissue, germplasm. or seed possessing the genotype or the molecular marker. In another aspect, the method involves detecting in a date palm plant, tissue, germplasm, or seed (i) a nucleic acid sequence that identifies the plant, tissue, germplasm, or seed as male or female or (ii) a molecular marker in linkage disequilibrium with the nucleic acid sequence and selecting the plant, tissue, germplasm, or seed possessing the nucleic acid sequence or the molecular marker, [0085] The materials and methods described supra can be used to carry out the aspects of the present invention set forth in the preceding paragraph.
[0086] The present invention also relates to kits for selecting a male or female date palm plant prior to flowering. In one aspect, the kit includes primers or probes for detecting in a date palm plant, tissue, germplasm, or seed (i) a genotype that identifies the plant, tissue, germplasm, or seed as female, or (ii) a molecular marker in linkage disequilibrium with the genotype and instructions for using the primers or probes for detecting the genotype or the molecular marker. In another aspect, the kit includes primers or probes for detecting in a date palm plant, tissue, germplasm, or seed (i) a nucleic acid sequence that identifies the plant, tissue, germplasm, or seed as male or female or (ii) a molecular marker in linkage disequilibrium with the nucleic acid sequence and instructions for using the primers or probes for detecting the nucleic acid sequence or the molecular marker.
[0087] The materials and methods described supra can be used to carry out the aspects of the present invention set forth in the preceding paragraph.
1 088] Kits of the present invention may contain reagents speci fic for the detection of mRNA or cDNA (e.g., oligonucleotide probes or primers). The kits of the present invention may contain al l of the components necessary to perform a detection assay, including all controls, directions for performing assays, and any necessary software for analysis and presentation of results. In some embodiments, individual probes and reagents for detection of nucleic acid sequences that identify the sex of a date palm plant or are provided as analyte specific reagents are included in the kit. In other embodiments, the kits are provided as in vitro diagnostics.
[0089] The present invention also relates to methods of breeding a date palm plant. In one aspect, the method involves providing a date palm plant having a sex determined by detecting in the plant or a seed, tissue, or germplasm from which it was derived (i) a genotype that identifies the plant as either male or female, or (ii) a molecular marker in linkage disequilibrium with the genotype and breeding the date palm plant with a plant of the opposite sex. In another aspect, the method involves providing a date palm plant having a sex determined by detecting in the plant or a seed, tissue, or germplasm from which it was derived (i) a nucleic acid sequence that identifies the plant as male or female or (ii) a molecular marker in linkage disequilibrium with the nucleic acid sequence and breeding the date palm plant with a plant of the opposite sex.
(0090] The materials and methods described supra can be used to carry out the aspects of the present invention set forth in the preceding paragraph.
[0091] Yet a further aspect of the present invention relates to a method of planting a date palm seed of a known sex. This method involves providing a seed having a known male or female sex and planting the seed.
[0092] The materials and methods described supra can be used to carry out the aspect of the present invention set forth in the preceding paragraph.
EXAMPLES
[0093] The following examples are prov ided to illustrate embodiments of the present invention but are by no means intended to limit its scope.
Example 1 - Materials and Methods
[0094] Date palm genomic DNA was extracted from leaves obtained from farmed trees in the Doha, Qatar area and at the USDA collection in Riverside, California. The halas female had been grown from well-documented plant tissue culture. The Alrijal female and halt male were seed grown but otherwise of unknown descent. Genomic libraries of various sizes were constructed. Paired-end sequencing on the Illumina Genome Analyzer II (Illumina, San Diego, CA) was carried out according to the manufacturer's protocols. The genome was assembled and scaffolded using
SOAPdenovo vl .4 (Li et al, "De novo Assembly of Human Genomes with Massively Parallel Short Read Sequencing," Genome Research 20:265-72 (2010), which is hereby incorporated by reference in its entirety) with a kmer of 31. Scaffolding using type III restriction libraries was conducted in BAMBUS (Pop et al., "Hierarchical Scaffolding with Bantbus," Genome Research 14: 149-159 (2004), which is hereby incorporated by reference in its entirety) using 60 N's to designate a scaffold gap. Functional annotation was carried out using a local implementation of the BLAST2GO (Conesa et al.,
"Blast2GO: A Comprehensive Suite for Functional Analysis in Plant Genomics," Int. J, Plant Genomics Pub, ID No. 61 832 (2008), which is hereby incorporated by reference in its entirety) software. All predicted genes were searched using BLASTP (e-value cutoff of 10~s) against the NR database at NCB1 { htt ://w w . nc b i , n 1 m . n i h . g v, which is hereby incorporated by reference in its entirety) and also searched using the INTERPRO database at EBI. Functional assignments, Gene Ontology, and Enzyme Commission numbers were assigned whenever possible. For polymorphism calling, sequences where matched to the genome using BWA and SNPs called using the SAMTOOLS package (Li et al., "The Sequence Alignment/Map Format and SAMtools," Bioinformatics 25:2078-9 (2009), which is hereby incorporated by reference in its entirety) with default parameters and requiring a minimum of 5 and no more than 70 sequences to call a SNP. CNVs were detected using CNV-SFQ (Xie et al., "CNV-seq, a New Method to Detect Copy Number Variation Using High-throughput Sequencing," BMC Bioinformatics 10:80(2009), which is hereby incorporated by reference in its entirety).
Validation Sequencing
100951 Approximately 4900 bp fragments of halas DNA were cloned into a pBR322-based low-copy-number vector using Khalas female DNA randomly sheared by nebulization. Three clones were selected for repeated paired-end sequence analysis. Extracted DNA was sequenced on a 3730XL DNA Analyzer (Applied Biosystems, Foster City, CA) using the manufacturer's recommended protocol. Multiple sequences from the same clones were assembled and aligned to the date palm reference sequence using the STADEN Package (Staden, "The Staden Sequence Analysis Package," Mol. Biotechnol. 5:233-241 (1996), which is hereby incorporated by reference in its entirety).
TE-related Genes Annotation
[0096] Protein and intron sequences of the 19,414 annotated genes were compared with the database of known TE proteins and significant matches were verified maniially by further comparing them, with NCBl NR. database
( h tt : , vv w w . II c b i . n 1 m . n i h . K o v . which is hereby incorporated by reference in its entirety).
Inference of Backcross Genotypes
10097] When a pedigree includes a heterozygote male (e.g. A/G) progeny from a backcross with a homozygous recurrent parent female (e.g. A/A), the male parent must have been the donor of the 'G' allele. In the case of the pedigree used here, many donor parents are progeny of backcrosses themselves. Any progeny of a cross between a homozygous (A/A) parent and a heterozygous or homozygous B parent (A/G or G/G) will result in all progeny being either A/A or A/G. Because the 'G' allele was maintained through multiple backcross generations, all donor parents that are themselves progeny of a cross to the recurrent parent must have been the A/G genotype. One can therefore infer all donor parents (males) to have been heterozygous (A/G) up to the F l generation.
Quantitative PCR
[0098] qPCR primers were designed on the Khalas genome in 5 regions: 3 male- amplified regions and 2 male-deleted regions. Amplifications were preferred as these are less likely to produce false positive results caused by polymorphism within the PCR primers. QuantiFast SYBR Green PCR mix (QIAGEN) was used in a 20 μΐ reaction. Samples were run on the Applied Biosystems 7500 real-time PCR machine a minimum of 4 times to produce an average. Delta-delta Ct was calculated against results from the Khalas genome using a region shown to be unam lilled in all genomes as a baseline. A second region with no ISCRs called was used as negative control.
Genotyping Gender-Linked Regions
[0099] Regions with suspected linkage to gender based on genome polymorphism data were selected for further genotyping using PCR and sequencing. Primers were designed to create -400 bp PCR products. Regions were amplified with AmpliTaq Gold (Appl ied Biosystems, Foster City, CA) according to the manufacturer's protocol. PCR and cycle sequenced products were cleaned with Ampure XI . and CleanSeq (Beckman Coulter, Beverly, MA). Cycle sequencing was conducted with BigDye v3.1 (Applied Biosystems, Foster City, CA). Samples were loaded on a 3130XL DNA Analyzer and sequence traces were visually inspected at all genotyped locations to determine homozygous or heterozygous changes.
Example 2 - Genomic Libraries and Sequencing
[0100 J DNA was extracted from the fresh leaves of date palm trees using the
Wizard Genomic DNA preparation kit (Promega, Madison, Wl). Leaves used for preparation of DNA employed in generating the Deglet Noor fosmid library were derived from the seedling of a single germinated seed,
[OlOl] Library construction for the short-paired libraries was conducted according to the manufacturer's protocol (Illumina, San Diego, CA). Two paired libraries of average insert size 172 bp and 370 bp were utilized. Longer mate-pair libraries were constructed using a linker sequence-modified version of the Type HI restriction enzyme £eoP15I library method as used by McKernan et al., "Sequence and Structural Variation in a Human Genome Uncovered by Short-read, Massively Parallel Ligation Sequencing Using Two-base Encoding," Genome Research 19: 1527-41 (2009) (which is hereby incorporated by reference in its entirety), produc ing 25-27 bp from either end of a DNA molecule. Fosmid library construction in vector pCC l FOS (Epicentre, Madison, WI) was as previously described (Pontaroli et al., "Gene Content and Distribution in the Nuclear Genome of Fragaria vesca," The Plant Genome 2:93-101 (2009), which is hereby incorporated by reference in its entirety).
Example 3 - Annotation
[01021 A repeat masked version of the genome was utilized for gene prediction.
Ten million random short reads were assembled to create an initial repetitive region database to screen against the sequence data using ΚΕΡΕΛΊ MA S K ER . Previously trained monocot gene prediction parameters were used with the FGENESH++ pipeline, and the entire Plant section of REFSEQ was employed as input for homology searches. For the fosmid sequences, predicted Open Reading Frames ("ORFs") were searched against the GenBank nonredundant nt and EST databases using BLASTN and against the nr database using BLASTX. A cutoff value of e 0 was used as the significance similarity threshold for the comparison. Examplc 4 - Transposable Element (TE) Identification
[0103] TE identification and quantification were by a series of complementary approaches. Small non-coding TEs such as MITEs were found by MITE-Hunter (Han et al,» "MITE-Hunter; A Program for Discovering Miniature Inverted-repeat Transposable Elements from Genomic Sequences." Nucleic Acids Research
(2010).doi: 10.1093/nar/gkq862, which is hereby incorporated by reference in its entirety) and RepeatModeler (http://www.repeatmasker.org/RepeatModeler.html). Protein-coding TEs were mainly identified by homology to TE-encoded proteins using BLASTX and required Expect value of 10"5 between predicted peptides. Intact 1. 1 R retrotransposons were found using LTRJFINDER (Xu et aL "LTRJFINDER: An Efficient Tool for the Prediction of Full-length LTR Retrotransposons," Nucleic Acids Research 35:W265-8 (2007), which is hereby incorporated by reference in its entirety) and LTR STRUC (McCarthy et a ., "LTR STRUC: A Novel Search and Identification Program for LTR Retrotransposons," Bioinformati.es 19:362-367 (2003), which is hereby incorporated by reference in its entirety). Once TEs were identified, their multiple copies were found by homology in the full genome assembly and in the shotgun reads.
Example 5 - Polymorphism Detection
[0104] SNPs were called by matching the original shotgun sequences to the de novo assembly reference sequence and documenting regions where it was apparent that the reads represented two alleles (Figure 1). For SNP calling in Khalas, only the longest paired-end sequences were used, resulting in 29.3X (of a total 53.4X used in assembly) coverage of 84 bp sequences. To avoid calling SNPs due to low quality sequence or collapsed repetitive sequence, a SNP was required to have at least 5-fold, and not more than 70-fold, coverage. For filtered SNP analysis in the measure of inter-SNP distance (Figure 3A), 500 bp from either end of a contig and regions with greater than 38X or less than 20X (1.3X and 0.7X the mean sequence coverage) were removed.
[0105] Using CNV-SEQ, the window size for a detectable ISCR with an absolute log2 value of 0.6 or greater ranged in size from 800 bp to 1000 bp, depending on depth of sequence coverage for the test genome. To be conservative, a universal window size of 1600 bp was set to call an ISCR. This was > 1 .5X larger than the window size required for statistically significant ISCR calling. At least 3 adjacent windows were required before annotating the region as an I SCR. Global normalization was used to take into account the tack of chromosome sized contigs.
[0 106J ISCRs were annotated by documenting all locations of an ISCR in each sequenced genome. If the regions between any two genomes overlapped, this was collapsed and considered one ISCR region. All genomes were then documented for their level of sequence variation in these ISCR regions. Only those ISCRs that overlapped a coding region were documented.
[0107] Polymorphisms linked to gender were detected by scanning the genotypes of all genomes at the 3.5 million documented polymorphic sites. Scaffolds were identified that had more than 10 gender-segregating SNPs.
Example 6 - Statistical Analysis
[0108J LOD scores were calculated as described (Lathrop et al., "Easy
Calculations of LOD Scores and Genetic Risks on Small Computers," American Journal of Human Genetics 36:460-5 (1984), which is hereby incorporated by reference in its entirety). Gene Ontology enrichment was calculated using the GOSSIP algorithm within the BLAST2GO package (Conesa et al., "Blast2GO: A Comprehensive Suite for
Functional Analysis in Plant Genomics," Int. J. Plant Genomics Art. ID No. 61 832 (2008), which is hereby incorporated by reference in its entirety), which provides False Discovery Rates. Chi-Square Analysis was conducted using expected numbers of heterozygote SNPs based on the entire genome in a contingency table with heterozygous or homozygous as the two categories. Of all recorded genotyped positions in the genome, males were on average heterozygous in 25% while females were heterozygous in 36% of positions. In the suspected gender-linked scaffolds, all genotyped polymorphic sites in Deglet Noor and Medjool females and their backcrossed males were documented for homozygous or heterozygous changes and these used for the observed numbers.
[0109] Principal component analysis of the cultivar genotypes was carried out using the Partek Genomics Suite (Partek, St. Louis, Missouri). Genotypes were transformed to numeric genotypes with 1 representing homozygous matching the Khalas reference, 2 representing heterozygous, and 3 representing homozygous difference to the Khalas reference. The Decision Tree algorithm within the Willows package (/hang et al., "Willows: A Memory Efficient Tree and Forest Construction Package," BMC Bioinformatics 10: 130 (2009), which is hereby incorporated by reference in its entirety) was utilized to find the best cultivar-discriminating SNPs. The top 1 ,000 most informative SNPs were selected based on a showing of all 3 possible alleles (AA. AB, BB) in the 9 sequenced genomes. From this set, the Decision Tree algorithm was used to select the fewest number of SNPs that could distinguish the 9 sequenced varieties.
Though only 5 SNPs were enough to separate all 9 genomes, the backcrossed genomes did not always cluster with their recurrent parents accurately. SNPs with the most distinguishing power in the decision tree (32 SNPs) were chosen to provide a set from which a future subset can be selected once testing in a much larger and more diverse population is completed.
Example 7 - Genome Sequencing and Assembly
[0110] The date palm genome contains 1 pairs of chromosomes (Siljak-
Yakovlev et al., "Chromosomal Sex Determination and Heterochromatin Structure in Date Palm," Sexual Plant Reproduction 9: 127-132 (1996), which is hereby incorporated by reference in its entirety) and has been predicted to have a genome size of
approximately 658 Mbp. A flow cytometric analysis of the date palm genome in cultivar Deglet Noor indicated a genome size of -680 Mbp (compared to a 382 Mbp rice genome standard). Moreover, comparison of the date palm draft genome to fully sequenced fosmids revealed that draft genome scaffolds spanned approximately 60% of the fosmids. This suggests that the draft genome of 381 Mbp is missing approximately 40% of the total genome; primarily in repetitive regions. This leads to a calculated genome size of -633 Mbp using this approach. Averaging the results of the two methods a genome size of approximately 658 Mb is predicted.
[01 1 1 ] A de novo next-generation sequencing of the date palm genome was undertaken with the expectation that intragenic regions would have few large repeats, as is true in the similarly small genomes of rice (Yu et al., "A Draft Sequence of the Rice Genome (Or za sativa L. ssp. indica)," Science 296:79-92(2002), which is hereby incorporated by reference in its entirety) and sorghum (Ware et al., "Mehboob-ur- Rahman the Sorghum Bicolor Genome and the Diversification of Grasses," Nature 457:551 -556 (2009), which is hereby incorporated by reference in its entirety). If this is the case in date palm, then most genie regions should assemble uninterrupted by repeats, thiis allowing a relatively unbiased view of the gene space. To this end, sequences ranging from 36 to 84 bp in length from fragments of -170 bp or -370 bp were generated on the Genome Analyzer IIx (l l lumina. San Diego, CA), Assembly was conducted using the SOAPdenovo genome assembler (Li et al., "De Novo Assembly of Human Genomes with Massively Parallel Short Read Sequencing," Genome Research 20:265-72 (201 0), which is hereby incorporated by reference in its entirety) employed on other large genomes (Li et al., "The Sequence and De Novo Assembly of the Giant Panda Genome,1' Nature 463:3 1 1-7(2010), which is hereby incorporated by reference in its entirety) and which can utilize paired-end information for resolving repeats. Sequence reads were corrected prior to assembly using the SOAP Correction Tool and gaps were closed where possible with the SOAP GapC loser.
[011 J The assembly stage used 526,443,374 sequences as input and yielded an
N50 contiguous sequence (contig), the contig size above which half of the genome assembly length is contained, of 6,441 bp and a scaffold N50 size of 9,339 bp when scaffolds less than 500 bp were excluded. SOA Pdenovo scaffolds were further joined into larger scaffolds with 28.6X physical coverage from Type 111 restriction enzyme libraries (2,000-5.000 bp) (McKernan et al., "Sequence and Structural Variation in a Human Genome Uncovered by Short-read, Massively Parallel Ligation Sequencing Using Two-base Encoding." Genome Research 19: 1527-41 (2009), which is hereby
incorporated by reference in its entirety) using the RA BUS software (Pop et al., "Hierarchical Scaffolding with Bambus," Genome Research 14: 149- 1 59 (2004), which is hereby incorporated by reference in its enitirey) and requiring at least 3 longer mate-pair links to join contigs to scaffolds. This resulted in 57,277 scaffolds with an N50 size of 30,480 bp spanning 381 Mb of sequence. Post-assembly matching of sequences reve led sequence redundancy of 53.4X from reads of average length 64 bp. This coverage is greater than the theoretically determined minimum for a high quality assembly using reads of this length (Li et al., "De novo Assembly of Human Genomes with Massively Parallel Short Read Sequencing," Genome Research 20:265-72(2010), which is hereby incorporated by reference in its entirety). With a heterozygous genome, it is possible for the assembler to have split alleles and assemble them separately. This would result in contigs with half the sequence coverage of the genome average. However, distribution of coverage on the assembly showed no secondary peak at half the mean coverage (Figure 10), indicating that assembly of separate haplotypes is most likely localized to short areas. With this short read strategy, contigs broken by short repeats are joined to a scaffold by paired end information. Large repetitive regions are expected to be intractable with this approach and are not included in the assembly.
[01 13 j To investigate accuracy and completeness of the full genome assembly, comparisons were made to fully sequenced genomic DNA regions from both halas and Deglet Noor cultivars (Table 1 ; Figure 8). Six fosmids containing Deglet Noor inserts were fully sequenced using Sanger technology. Scaffolds from the assembly aligned to 60% of the mainly gene-rich total fosmid sequence giving an indication of the completeness of the draft genome sequence. Analysis of the fosmid sequence not captured in the fall genome assembly revealed that the majority of these regions are highly repetitive (Table 2). This investigation indicates that gene-rich regions were better reconstructed than TE-rich regions, and genes were much better recovered than repeat sequences.
Table 1. Results of Comparison of the Assembly to 6 Fosmids.
Figure imgf000034_0001
Table 2. Comparison of Fully Sequenced Fosmid Bases Covered or Missed by the WGS Assembly
Figure imgf000034_0002
It is clear that most missed bases in the WGS assembly are within very frequent repeats.
[0114] A test set of -210 million reads from the full set of -526 million (-50% of high quality bases) was used for this analysis. All possible k-mers were documented in the reads using JELLYFISH (Marcais et al., "Ά Fast Lock-free Approach for Efficient Parallel Counting of Occrrences of K-mers," Bknnformalies (Oxford, England) btr 01 1 (201 1 ), which is hereby incorporated by reference in its entirety) and plotted (Figure 1 1). It is clear that as the k-mer length increases from 17 to 29. the bimodal distribution becomes more pronounced. The primary maximum represents coverage of homozygous regions of the genome and is approximately twice the coverage of the secondary maximum. The secondary maximum is likely the result of heterozygous regions where the two alleles result in different k-mers. It is important to note that, given this test set contains half the number of high quality bases, k-mer coverage of both alleles is likely high enough (18-20X Kmer coverage per allele) in the full read set to assemble both alleles independently.
[0115] Independent assembly of alleles seems to have occurred relatively infrequently as coverage of the genome by the same test set of reads has a single maximum (Figure 10). If alleles had been assembled separately on a large scale, this would have been expected to be bimodal with split alleles obtaining half the level of coverage from the main maximum. This was not observed. Furthermore, the less stringent gap closing stage of the assembly likely fills gaps created by heterozygous regions.
[0116] It is possible that some regions of the genome are absent from the assembly because the two alleles were too different to join either at the graph stage or the more liberal gap filling stage. These would result in gaps rather than separately assembled alleles. From the fully sequenced fosmid data it is predicted that the regions of the genome absent due to high heterozygosity amount to less than 7% of the missing sequence. The remaining 93% of missing sequence is likely due to high frequency repeats that could not be correctly assembled. This is based on matching the test set of reads to the fully sequenced fosmids (which are homozygous). No restriction was placed on how frequently reads could match the fosmids. Coordinates of where scaffolds from the whole genome shotgun assembly (WGS) matched the fosmids were documented and sequence coverage from the test set of reads was inspected both within and outside these assembled regions (Table 2). Median coverage in regions where the WGS scaffolds matched the fosmids was similar to that obtained for the rest of the genome. In contrast, regions not captured by WGS scaffolds had extremely high coverage indicating they contain frequently repeated sequence (Table 2). ~7% of the fosmids bases that were not matched by the WGS scaffolds had coverage consistent with the non-repetitive portion of the genome. These regions were short regions interspersed among the repeats. Their length was such that they would not have made the SOObp cutoff required for a scaffold to be included in the assembly.
[01 17] The genome assembly was further compared to 109,244 contigs of assembled date palm ESTs. Using BLAT (Kent, "BLAT^the BLAST-like Alignment Tool," Genome Research 12:656-64 (2002), which is hereby incorporated by reference in its entirety ), 72% of EST contigs matched at least 90% of their length, while 86% of high quality EST bases could be aligned to the reference sequence with a minimum of 98% sequence identity. Furthermore, using the CEGMA pipeline (Parra et al., "Assessing the Gene Space in Draft Genomes," Nucleic Acids Research 37:289-297 (2009), which is hereby incorporated by reference in its entirey), which checks for full-length models of core genes, 94% of core eukaryotic genes were found in the assembly, and 71 % of these were recovered as full-length gene models. Taken together, the data suggest that -90% of date palm genes and -60% of the ful l date palm genome sequence are described in this assembly. The uncaptured regions of the genome are likely to be highly repetitive and thereby intractable to the assembly approach.
Example 8 - Genome Annotation
[0118] Repeat masked scaffolds were passed to the FGENESH++ pipeline for both de novo and homo logy-based gene prediction (Solovyev et al., "Automatic
Annotation of Eukaryotic Genes, Pseudogenes and Promoters," Genome Biology 7(Suppl 1):S10.1-12 (2006), which is hereby incorporated by reference in its entirey). A total of 28,890 gene models were predicted. Of these, 25,059 predicted protein-encoding genes had significant BLAST similarity to proteins from other organisms in the NR database at NCBI (http://www.ncbi.nlm.nih.gov. which is hereby incorporated by reference in its entirety). Gene ontology information was assigned using BLAST2GO (Conesa et al, "Blast2GO: A Comprehensive Suite for Functional Analysis in Plant Genomics," Int. J. Plant Genomics Pub. ID No. 619832 (2008), which is hereby incorporated by reference in its entirety). GC content within coding DNA sequence was 47.6%, while the entire assembled genome has a GC content of 38.5%. |01 1 ] The top BLAST hits for 9,022 of the date palm, predicted proteins matched predicted proteins from Vitis vinifera, a eudicot, followed by 5,094 top matches to predicted proteins from the monocot Otyza sativa. This higher protein sequence similarity between the two less phylogenetically-related plants (the monocot date palm and the eudicot grapevine) has been observed by others in gene families from oil palm (Adam et al, "MADS Box Genes in Oil Palm (Elaeis guineensis): Patterns in the Evolution of the SQUAMOSA, DEFICIENT, GLOBOSA, AGAMOUS, and
SEPALLATA Subfamilies," Journal of Molecular Evolution 62: 15-31 (2006), which is hereby incorporated by reference in its entirety) and for oil palm ESTs (Jouannic et al., "Analysis of Expressed Sequence Tags from Oil Palm (Elaeis guineensis) " FEBS Letters 579:2709-14 (2005), which is hereby incorporated by reference in its entirey). Initial suggestions are that the grasses are a more diverged monocot group.
[0120] A total of 2,949 (10%) gene models with high homology to TE genes were found. Among them, the protein coding regions of 2,097 models matched TE proteins (BLASTP, E-value = 10-5). The other 852 models matched predicted TE genes in their intron regions. These TEs within genes are likely to be low copy number in the genome, or they would not have been assembled. Overall, 55,855 sequences ere identified in the full genome assembly that had the characteristics of TEs. Some of these, including a few- long terminal repeat ("LTR") retrotransposons (45 families) and the tiny TEs called MITEs (35 families) were found by structural criteria (Xu et al., "LTR FINDER: An Efficient Tool for the Prediction of Full-length LTR Retrotransposons," Nucleic Acids Research 35:W265-8 (2007); McCarthy et al, "I . I R S I RUG: A Novel Search and Identification Program for LTR Retrotransposons," Bio informatics 19:362-367 (2003); Han et al., "MITE-Elunter: A Program for Discovering Miniature Inverted-repeat Transposable Elements from Genomic Sequences," Nucleic Acids Research
doi: 10.1093/nar/gkq862 (2010), which are hereby incorporated by reference in their entirety).
[0121] One intact LTR retrotransposon of the Copia superfamily was found on sequenced fosmid Rl by both I .TR FINDER (Xu et al., "LTR UNDER: An Efficient Tool for the Prediction of Full-length LTR Retrotransposons," Nucleic Acids Res.
35 AV265-8 (2007), which is hereby incorporated by reference in its entirety) and LTR STRUC (McCarthy et al., "LTR STRUC: A Novel Search and Identification Program for LTR Retrotransposons," Bioinformatics 19:362-367 (2003), which is hereby incorporated by reference in its entirety). This new LTR retrotransposon was given the name "vose," Table 3 below represents its characteristics, and its sequence is provided. This element constitutes 0,4% of the assembly and 2.3% of the I random reads set. No intact LTR elements were detected in the other 6 fosmids that were sequenced.
Table 3. MITE and LTR Families.
Figure imgf000038_0001
These MITE and LTR families identified by structural search accounted for 2% and 4% of the assembly, respectively.
|0122 j However, most MITE and TEs were found by homology to known TE proteins. The TEs found in the full genome assembly were compared with the raw genomic sequence data. As expected, because of the inability of short reads to resolve long repeats, many more TE-related sequences were identified in the raw shotgun data than in the assemblies (Table 4). The most abundant TEs identified in date palm, LTR retrotransposons of the Copia (-3.1% of reads) and Gypsy (-1.4% of reads)
superfamilies, were found to be a respective 50-fold and 25-fold lower in assembled reads than in shotgun reads. The most abundant DNA TEs were found to be the CACTA elements (0.03%> of shotgun reads) (Table 4). Because only predicted protein homologies were used to identify TEs and because all TEs contain extensive non-coding DNA, it is expected that the vast majority of the TE-related DNA in the date palm genome assembly was missed by this approach. Table 4. Date Palm Assembly TE Analysis,
Figure imgf000039_0001
Example 9 - Polymorphism and Comparative Genomics
[0123] Using massively parallel sequencing on a cultivar of date palm with no documented in-breeding allowed detection of a large number of parental allelic differences (Figure 7) using BWA (Li et al., "Fast and Accurate Short Read Alignment with Burrows- Wheeler Transform," Bioinformatics 25: 1754-60 (2009), which is hereby incorporated by reference in its entirey) and SA FOOLS software (Li et al., "The Sequence Alignment/Map Format and SAMtools," Bioinformatics 25 :2078-9 (2009), which is hereby incorporated by reference in its entirety). 1 ,748, 109 SNPs were called in 381 Mb of sequence, yielding a heterozygosity rate of 0.46% or 1 SNP/217 bp. However, the distribution was significantly skewed, with 49% of SNPs being found within 50 bp of another SNP (Figure 3A). These results were observed even when suspected repetitive regions, including ends of contigs and high sequence coverage regions were excluded from the analysis. These results suggest that there are islands of higher polymorphism within the genome, and this observation is important to subsequent large polymorphism analysis. A total of 100,019 of the parental SNPs occurred within a predicted gene- encoding sequence, and 53,890 of these would lead to an amino acid change. This yields a nonsynonomous-to-synonomous SNP ratio of 1.17; a ratio similar to that of 1.2 reported in rice (McNally et al., "Genomewide SNP Variation Reveals Relationships Among Landraces and Modern Varieties of Rice," PNAS 106: 12273- 12278 (2009), which is hereby incorporated by reference in its entirety).
[0124) To better characterize polymorphism in date palm from a biotechnology perspective, genomes from top commercial varieties Deglet Noor and Medjool, and one non-commercial female (AlrijalF), were sequenced to varying levels of coverage (Table 5). Additionally, to characterize possible gender differences, two backcrossed males, two backcrossed females, and one non-backcrossed male (Table 5) were also sequenced. A total of 3,518,029 SNPs were identified in 381 Mb that were polymorphic in at least one of the sequenced genomes. The genotypes of all sequenced genomes were documented at these sites. Genotypes were much more conserved across the backcrossed genomes and their recurrent parents than between different varieties (Figure 3B). Indeed, clustering of the genomes by the genotypes at 3.5 million locations revealed the close relationship of the backcrossed trees and their recurrent parents (Figure 3C). Moreover, the genome of a halas variety collected in Qatar clustered very close with trees backcrossed to a California Khalas believed to have been imported from Arabia almost 100 years ago (Hodel et al., Dates, Imported and American Varieties of Dates in the United States (ANR Publications 2007), which is hereby incorporated by reference in its entirety). Using a decision tree algorithm (Zhang et al., "Willows: A Memory Efficient Tree and Forest Construction Package," BMC Bioinformatics 10: 130 (2009), which is hereby incorporated by reference in its entirety), the fewest number of SNPs capable of separating the nine sequenced genomes were identified. Selecting for the most variety informative SNPs revealed a minimum of 5 SNPs could be used to separate the 9 sequenced varieties (Table 6). A total of 32 SNPs (Table 6) were highly informative in discriminating the varieties. Using just these 32 SNPs to separate the varieties provided little loss of discrimination power, with the top 3 principal components decreasing from 74% to 71 % when comparing results with 3.5 million versus the core 32 SNPs (Figure 3D). An additional 4 genomes were genotyped using these 32 SNPs and clustering again showed strong separation power (Figure 9). This set of SNPs will provide a resource for future development of a variety of specific DNA markers. Table 5. Date Palm Genomes Sequenced for this Study.
Date Palm Presumed Collected Gender Sequence
Cultivar Origin in coverage
Khalas Arabia Qatar Female 53.4X
Khalas x Khalas California California Female 19.3X
F1
Khalas BC2 California California Female 10.1 X
Deglet Noor North California Female 19 8X
Africa
Deglet Noor BC5 California California Male 19.6X
Medjool North California Female 14.9X
Africa
Medjool BC4 California California Male 13.1 X
Khalt Qatar Qatar Male 1 1 .2X
AlrijalF Qatar Qatar Female 10.7X
Three commercially important female genomes together with various backcrosses and uncultivated varieties were sequenced to various levels of sequence redundancy to permit SNP identification.
Table 6. SNPs with High Discriminating Power among Date Palm Varieties.
Figure imgf000042_0001
32 SNPs with the highest power to discriminate date palm varieties are presented. 5 SNPs (in bold font) could distinguish 9 sequenced genomes. The combination of 32 SNPs showed very little loss of discrimination power with respect to the total set of 3.5 million
SNPs.
[0125] Large scale polymorphisms, including CNVs can be detected from sequence data by identifying regions where the observed number of matching sequences from a genome significantly deviate (either up or down) from the expected numbers (Figure 7). By matching sequences from each genome to the Khalas reference, gene- sized regions with significantly imbalanced counts of sequences were detected using the CNV-SEQ software (Xie et al.. "CNV-seq, a New Method to Detect Copy Number Variation Using High-throughput Sequencing," BMC Bio infor atics 10:80 (2009), which is hereby incorporated by reference in its entirety). These are termed ISCRs to distinguish them from more rigorously proven CNVs. The analysis was restricted to only non-baekcrossed genomes to avoid duplication of results from inbreeding. As with the SNP data, extensive conservation of ISCRs was observed between backcrossed genomes and their recurrent parent. A total of 10,388 ISCRs were detected that both overlap a predicted gene-coding region and occur in at least two genomes. At most, 10% of ISCRs were unique to a given genome (Figure 4).
[0126] While uneven distribution of polymorphism with high sequence conservation in gene regions (Ma et al., "Rapid Recent Growth and Divergence of Rice Nuclear Genomes," PNAS 101 : 12404-10 (2004); Yu et al., "The Genomes of Oryza sativa: A History of Duplications," PLoS Biology 3 :e38 (2005), wich are hereby incorporated by reference in their entirety) may lead to false ISCR detection, modeling suggests that most of these ISCRs are real.
[0127] Plant cultivars are known to exhibit high levels of polymorphism across the genome, punctuated by regions of low polymorphism in gene regions (Ma et al., "Rapid Recent Growth and Divergence of Rice Nuclear Genomes," PNAS 101 : 12404-10 (2004); Yu et al, "The Genomes of Oryza sativa: A History of Duplications," PLoS Biology 3:e38 (2005), which are hereby incorporated by reference in their entirety). The date palm genome appears similar as uneven distribution of parental allele SNPs were observed in the Khalas female (Figure 3A). The method used to detect ISCRs is based on sequence alignment and thus requires reasonably high sequence similarity between compared genomes. If the genomes were too divergent, sequences from the test genome would not match in polymorphic regions, causing deletions to be called. Matching sequences would be distributed only to regions of higher similarity, resulting in these regions being called amplifications. However, there was not a correlation between SNP density and propensity to call ISCRs in genes. Moreover, modeling of ISCR calling on the genome with in silico created polymorphisms, punctuated by regions of low polymorphism, resulted in 56 false ISCRs compared to the 10,000 detected here. These results suggest that most ISCRs are either true CNVs or interesting regions of extremely high polymorphism.
[0128] If sequence-level polymorphism is indeed responsible for a large portion of the ISCRs, then deletion ISCRs should be more likely to occur in genes that have high numbers of SNPs. This was checked with empirical SNP data. In fact, polymorphism rates were slightly higher in amplification ISCRs (0.74% heterozygosity) than in deletion ISCRs (0.66% heterozygosity). Correlation of the frequency of SNPs in a gene, detected from the Khalas parental alleles, was also checked with the likelihood that the same gene was involved in a deletion ISCR in any number of cultivars. A positive correlation would only be observed if gene regions dense in polymorphisms between the parental alleles of the Khalas reference genome were also more likely to be polymorphic in other cultivars of date palm. Genes were ranked by how many times they were observed in a deletion ISCR in the multiple cultivars, and further ranked by how many SNPs per 1000 bp were observed in the parental alleles of the Khalas strain. All 1 ,91 1 genes that contained at least 1 SNP in the Khalas parental alleles and were in at least 1 1SCR among 4 genomes compared were utilized. The Spearman's Rank Correlation Coefficient between the two ranked groups was 0.095 and -0.01 1 (uncorrected corrected) with a p- value of 0, showing a lack of correlation between levels of SNPs in a gene in Khalas and the propensity to call a deletion I SCR.
[0129] To futher understand the level of ISCRs detected due to sequence dissimilarity between the genomes, 1SCR was modeled, calling on in silica mutated versions of the Khalas reference strain. The goal was to observe the frequency of lSCRs called on in silica mutated sequence and from this to estimate the number of ISCRs in the dataset that are most likely due to sequence dissimilarity, rather than true large scale amplifications or deletions. An in silica mutated genome that was a patchwork of polymorphism rates was created. A SNP rate of 1 .5% and an indel rate of 0.3%, punctuated by simulated gene regions, presumably more highly conserved, with 0.6% SNP and 0.12% indel rates were used. Gene regions were 4-6 kbp in length, summing to a total of 86 Mbp, which is the predicted amount of genie DNA in the Khalas genome. The modeled SNP rates are higher in intragenic regions than empirically observed date palm rates in order to exaggerate possible aggravation of ISCR detection. Using this model, 56 ISCRs were reported with 49 being called as deletions and 7 as amplifications. Across all modeled genie regions with the lower polymorphism rate there was an average log2 increase of 0.167 (ST). 0.027), which is well outside the log2 of 0.6 required to call an ISCR as significant. While detection of 56 ISCRs is significant, most of the genomes studied here had on the order of 10,000s ISCRs. The results of this modeling suggest that a large number of the regions detected as variable between the genomes are most likely either copy number variations or regions of extremely high polymorphism. Importantly, this modeling shows that standard polymorphism rates among cultivars alone, even in the presence of variable polymorphism rates in genes, should not cause detection of high numbers of false CNVs.
[0130] Furthermore, quantitative PCR ("qPCR") of 5 ISCRs on the 4 test genomes (20 different tests), gave 16 results consistent with expectation (amplified or deleted). Visual inspection of the sequence alignment in the 4 ISCR regions that fai led to validate revealed that, in some cases, sequence coverage variability is due to very high sequence polymorphism rather than absolute loss of sequence. [0131] Genes exhibiting ISCRs in at least 2 genomes were analyzed for Gene
Ontology enrichment using the GOSSIP package within BLAST2GO (Conesa et al., "Blast2GO: A Comprehensive Suite for Functional Analysis in Plant Genomics," Int. J. Plant Genomics Pub. ID, No. 61 832 (2008), which is hereby incorporated by reference in its entirety), and enrichment was found in certain functional categories (Figure 5). Interestingly, the categories for lignin, laccase, and phenylpropanoid metabolism were overreprcsented in I SCR regions. Genes in these processes are important in fruit flavor and ripening (Singh et al., "Phenylpropanoid Metabolism in Ripening Fruits,"
Comprehensive Reviews in Food Science and Food Safety 9:398-416 (2010), which is hereby incorporated by reference in its entirety), one of the most distinguishable differences between date palm varieties, and thus offer a resource for studying date palm fruit properties. The large number of ISCRs between the genomes analyzed here are not entirely unexpected. It has been shown that a significant amount of variation among genomes is related to indels (Britten et al., "Majority of Divergence Between Closely Related DNA Samples is Due to Indels," PNAS 100:4661 -4665 (2003), which is hereby incorporated by reference in its entirety) and, in some plants, this amounts to 10-20% of genome variation between cultivars (Ding et al., "Highly Asymmetric Rice Genomes," BMC Genomics 8: 154 (2007); Huang et al., "Genome-wide Analysis of Transposon Insertion Polymorphisms Reveals Intraspecific Variation in Cultivated Rice." Plant Physiology 148:25-40 (2008), which are hereby incorporated by reference in their entirety).
|0132] No ISCRs were found to segregate with gender. Recognizing that comparing all genomes to the Khalas female genome could only identify female-specific sequences, an attempt was made to assemble male-specific sequences. Reads from the male Deglet Noor BC5 genome were assembled. Very short contigs were expected, because sequence redundancy (20X) was not high, but this served as a first check for male-specific sequences. Sequences from the Medjool, Khalas, and Deglet Noor female genomes were matched to the Deglet Noor BC5 male contigs. No contigs were observed to be absent in all 6 female genomes. Annotation of the short contigs revealed high frequencies of LTR retrotransposons, but no distinguishable male-specific genes. Example 10 - Identification of Gender-linked Scaffolds
[0133] The 3.5 million SNP genotypes were scanned in the male and female genomes to identify polymorphisms segregating with gender ( figure 7). The observed results best fit an XY sex determination model with males being the heterogamete.
Applying a heterogamete male model, 1 ,605 SNPs were observed that segregated with gender. Of these, 934 (58%) localized to 344 kb within 24 scaffolds spanning 602 kb (Table 7). Specifically, all male genomes shared mainly the same heterozygous genotypes while female genomes shared mainly the same homozygous genotypes in these scaffolds. The scaffolds are broken by gaps that probably contain significant amounts of repetitive DNA . Analyzing two scaffolds with the most gender-segregating SNPs, an approximate 3-fold difference was observed in divergence from the reference sequence between male and female haplotypes. Furthermore, a near 30-fold difference was observed between the number of male and female heterozygous SNPs within these regions. The genotypes of polymorphic sites were recorded for all genomes in these regions, as set forth in Figures 2A-A .
Figure imgf000047_0001
Figure imgf000048_0001
The number of SNPs was based on comparison of the sequenced male and female genomes. Regions of the scaffolds that show
SNPs segregating with gender are documented.
[0134] In comparing Deglet Noor and Medjool females to the Khalas female reference, 253 and 271 sites differed from the Khalas reference and only 24 (9%) and 1 (7%) sites were heterozygous, respectively. At the same positions, their backcrossed males showed 736 and 770 sites differing from the Khalas reference and 584 (79%) and 578 (75%) of these were heterozygous. The significantly higher heterozygosity levels (%2 - 893.6 and 767.7, 1 d.f., p < 0.0001) in the males represents an ~3-fold increase in heterozygosity in these regions when compared to the rest of the genome. The females have significantly reduced heterozygosity with respect to the rest of the genome (%2 = 435.9 and 410.2, 1 d.f, p <0.000 l ), resulting in an ~ 14-fold decrease in heterozygosity in these regions versus the rest of the genome. This pattern of sequence degeneration between male and female haplotypes may be indicative of reduced recombination between the male and female haplotypes, which is a step that may be critical to the development of gender-specific regions (Charlesworth et a!., "A Model for the Evolution of Dioecy and Gynodioecy," The American Naturalist 1 1 2:975 - 997 ( 1978); Bergero et al., "The Evolution of Restricted Recombination in Sex Chromosomes," Trends in Ecology & Evolution 24:94-102 (2009), which are hereby incorporated by reference in their entirety). In these two scaffolds, 7 exons were observed in 3 of the 4 annotated genes (Figure 6B) that contained unusually long introns, ranging between 4 kb and 13.1 kb (compared to an average of less than 200 bp for most flowering plant introns). It has been shown that longer introns occur more frequently in regions of low recombination in Drosophila (Carvalho et al., "Intron Size and Natural Selection," Nature 401 :344( 1999), which is hereb incorporated by reference in its entirety).
[0135] To determine if the observed differences in heterozygosity were truly linked to gender, short regions from four scaffolds with the largest number of segregating SNPs were selected for genotyping in a pedigree containing 6 date palm female varieties and their 20 progeny (Table 8). Genotyping results indicate that these four scaffolds are linked to each other with no recombination between them (Figure 6B), suggesting they likely localize to the same region of the genome. Using only empirically-determined genotypes on males and females (excluding hermaphrodites), the genotyped scaffolds significantly link to gender with a LOD score of 5.3 (recombination frequency of 0.07), with only two males showing recombination. Furthermore, as backcrossed plants were used in the pedigree, theoretically-determined recurrent parents can be included, improving the LOD score to 8.9 (recombination frequency of 0.05) (Figure 6A). Cienotyping of date palms outside the pedigree continued the trend of male heterozygosity and female homozygosity. With a total of 63 empirically and theoretically genotyped males and females, 5 did not give the expected genotype (Figure 6B). Additionally, one male was observed to be homozygous for the male-specific allele (Table 8). Predicted genes in this region (Table 7) include an red- 1 homologue ("Required for Cell
Differentiation- 1 "), a Myb family gene, and a gene that should encode a rab
geranylgeranyl transferase-like protein (a prenyl-transferase). Interestingly, it has been shown that the red- 1 gene is important in sexual development in yeast (Okazaki et al., "Novel Factor Highly Conserved among Eukaryotes Controls Sexual Development in Fission Yeast," Mol. Cell. Biol. 18:887-895 (1998), which is hereby incorporated by reference in its entirety) and that it interacts with c-Myb (Haas et al., "c-Myb Protein Interacts with Red- 1. a Component of the CCR4 Transcription Mediator Complex," Biochemistry 43:8152-9 (2004), which is hereby incorporated by reference in its entirety). Moreover, it has been shown that cell differentiation control in date palm floral development is critical to sex organ development (Daher et al., "Cell Cycle Arrest Characterizes the Transition from a Bisexual Floral Bud to a Unisexual Flower in Phoenix dacfylifera," Annals of Botany 106:255-66(2010), which is hereby incorporated by reference in its entirety) and that there are sets of MADS box genes, which control flower development, and require preny lation for correct function (Yalovsky et al., "Prenylation of the Floral Transcription Factor APETALAl Modulates its Function," The Plant Cell 12: 1257-66 (2000), which is hereby incorporated by reference in its entirety). Multiple non-synonymous polymorphisms were observed between the male and female haplotypes in these genes though none were certain to be deleterious.
Table 8. Genotype Results at the Suspected Gender-specific Region.
Recurrent Accession USDCS Obs. Rep.
Parent Sex gen. Access. No. Parentage
halas F AA PI555437-PL2208 Khalasa X 61 -41 1
Figure imgf000051_0001
F AA PI555423-PL2200 Khalasa X 52-2 1 -4
69-155-51 KhlsBC2b . M AA PI555436-PL2197 Khalasa X 61-41 1
PI 461 1- Deglet Noor X 64-
Deglct Noor RIV2154 F AA 69-150-50 D BC5 I M A/G PI555433-PL2165 354
Deglet Noor X 64-
69-150-52 DNBC5b M A/G PI555432-PL2167 354
Deglet Noor X 64-
69-150-52 DNBC5c M A/G PI55543-PL7506 354
Deglet Noor X 64-
69-150-50 DNBC5d M A/G PI555432-PL2166 354
Deglet Noor X 60-
64-354-22 DNBC4 M A G PI555402-PL2144 272
Figure imgf000051_0002
Barhee RIV7479 F AA 70-41-30 BarheeBC4 m AA PI555415-RIV2132 Barhee X 60-270-9
60-270-9 BarheeBC3 M AA PI555412-R1V7544 Barhee X 55-94
MM
74-31-50 BarheeBC3b erm A/G PI555419-RIV2133 Barhee X 66-16-1 ,5
Medjool RPHOl- F AA 69-157-52 \kli l HC-l M A/G PI555438-RIV2219 Medjool X M63-
Recurrent Accession usuta KJUS. «.ep. M63- M63-
Figure imgf000052_0001
69-157-51 MdjlBC3 M PI555439-RIV2196
Medjool X 61-414-
PI5427-RIV2223 6
Medjool X 61-414-
PI5427-RIV2222 6
Figure imgf000052_0002
Khadrawy RIV2171 F AA 63-394-25 KhdrwBC3 M PI55444-RIV7426 Khadrawy X 57-32
Khadrawy X 62- PI555435-PL7491 430
Figure imgf000052_0003
Dayri RIV7490 F AA 60-271-2 DyriBC2 M PI555413-RIV7441 Dayri X 50-5-10
60-271-7 DyriBC2B M PI555414-RIV2149 Dayri X 50-5-10
60-271-2 DyriBC2C M PI555413-RIV7442
60-271-7 DyriBC2D M PI555414-RIV2150
rvci'ui cm vc essiun uauts \JUS. jtvep.
Parent No. sex Gen. No. Progeny Sex gen. Access. No. Parentage
70-39-53 DyriBC3 M A/G P1555417-RIV2145 Da riX 60-271-7 70-39-51 DyriBC3B M A/G P1555416-RIV7504 DayriX 60-271-7
70- 39-53 DyriBC3C M A/G PIR555417-RIV2146
61-414-6 DyxDNBC3 M A/G PI555422-RIV7393 Dayri X 55-100
71- 15-50 DyXDNBC4 M A/G PI555424-R1V2233 Dayri X 64-354-22
BC1 M A/G
Fl M
Non-Pedigree Genotyped Trees
78-9 Crane M AG P1555421-RIV2478
66-14-50 ZahidiBC2 F AA PI555407-RIV7429 Zahidi X 60-279 66-14-52 ZahidiBC2B M AG PI555408-RIV7523 Zahidi X 60-279 66-15-51 ZahidiBC2C M AG PI555409-RIV2236 Zahidi X 57-29
Saqie-1-95 F AA
Gar-F96 F AA
Lolo-FlOO F AA
AboMaian-
F104 F AA
honame-
F05 F A/G
Zamly-F106 F AA
Fard-F107 F AA
Khalt M AG
M62 M G/G
Kecurreni Accession Ι,ΛΚΙ.Λ JOS. κερ.
Parent No. sex Gen. No. Progeny Sex gen. Access. No. Parentage
AlrijalF F AA
M60 M AA
Airija!M VI AA
The number of SNPs was based on comparison of the sequenced male and female genomes. Regions of the scaffolds that show SNPs segregating with gender are documents.
Example 11 - Validation of Identified SNPs
[0136] Validation of identified SN s was carried out using PGR and sequencing.
For example, PGR primers were designed against the scaffold: PDK_30sl 150131 at position 4031 in the forward orientation and at position 4431 in the reverse orientation. Primer sequences included:
PDKJOs l 150131 ^403 I F (GAGTTAATATCTCCTTGCCATCCT (SEQ I NO:973) PDK_30sl 150131 4431 R (GTCAAGGGATCTCCCTATTGTA (SEQ ID NO:974).
[0137] DNA Sequencing using the forward primer results in the ability to genotype at 3 locations in the intervening sequence:
TATG ACACA [ A/ G ] GTAAG [ T/ G ] CTCCTTTTTC ACTTG [ C / G ] AG AC A G AG (SEQ ID O:975)
Genotyping of the first (bold) polymorphic position in SEQ ID NO:975 (with the possible genotype of homozygous A (AA), heterozygous (AG), or homozygous B (GG)) results in linkage of the AA to female gender and the linkage of AG (heterozygous) to male gender.
[0138] Results of the genotyping the polymorphic site in Pedigrees of Date Palm trees from the USDA collection in California below in Table 9. Trees that genotype contrary to the expected gender genotype are in bold. A significant linkage score (LOD score) of 3.2 is found between this marker and gender from this experimental data alone. Because many of the progeny are males from backrosses of multiple generations, their donor parents (fathers) genotype can be theoretically determined to be heterozygous (any progeny of a cross with an A A plant would produce AG or AA genotypes and, therefore, the male donor plants that are progeny of a cross must be AG). Using the added theoretical genotypes increases the LOD score to a minimum of 6.67, making the linkage between this marker and date palm gender very strong.
[0139] Genotyping of other locations in the mentioned scaffolds showed linkage disequilibrium to the above genotype SNP. This is most likely due to their proximity in the genome to this scaffold. Therefore, all SNPs with linkage disequilibrium to the detected SNPs would be expected by chance to be included in the present invention. Table 9. Genotypes of Male and Female Trees Showing Segregation of Genotype
Mother Se Genotype Progeny Sex Genoty pe
Khalas 1 AA hlsBCFx F AA
hlsBC2 F AA
KhlsBOB M AA
DegNoor p AA DNBC52167 M A/G
DNBC52165 M A/G
DNBC4 M A/G
Barhee F AA BarheeBC4-5415 Herm AA
BarheeBC3-5 12 M AA
BarheeBC3B(fruiting)-541 M A/G
edjool F AA MdjlBC4 M A/G
MdjlBC3 M A/G
Mdjlx(DyrXDN) F AA
hadrawy F AA KhdrwBC3 M A/G
AA KhdrwyNBC4 M A/G
Dayri F AA DyriBC2 M A/G
DyriBC2B M A/G
DyriBCS M A/G
DyriBC3B M A/G
DyxDNBC3 M A/G
DyXDNBC4 M A/G
[0140] Described herein is the first publicly available genome from the palm family. The date, oil, and coconut palms are important crops in several developing countries, and this sequence can serve as a vital resource for their improvement. Though short read assembly has its limitations in heterozygous and repetitive regions, gene regions with contiguity similar to other draft genome sequences (Yu et al., "A Draft Sequence of the Rice Genome {Oryza saliva L. ssp. indica)," Science 296:79-92 (2002); Ming et al., "The Draft Genome of the Transgenic Tropical Fruit Tree Papaya (Carica papaya Linnaeus)," Nature 452:991 -996 (2008), which are hereby incorporated by reference in their entirety) was obtained by utilizing paired-end libraries of varying sizes. The approach focused on obtaining the gene regions of the date palm by relying on the observation that most plants have fewer repeat sequences within genes. The next step in the improvement of this sequence should be its anchoring to physical and genetic maps. However, the utility of the current assembly is revealed in the ability to begin answering pressing needs in date palm improvement.
[01411 The aim in this study was to provide a date palm genome resource with which to begin addressing the main biotechnology issues in date palm development: cultivar genetic differentiation and tree gender discrimination. Annotation of the current assembly has dramatically improved the current knowledge of the date palm gene content and allelic variation. Sequence data from multiple genomes has provided the largest resource of polymorphic markers to date. Λ small subset of these markers have been identified that can serve as a resource in genotyping the more than 2,000 date palm varieties.
10142 J Three of the top date palm varieties that are important in three regions of date palm production have hereby been sequenced: halas favored in Arabia; Deglet Noor favored in North Africa; and Medjool increasingly favored in California (Hodel et al., Dates, Imported and American Varieties of Dates in the United States (ANR
Publications 2007), which is hereby incorporated by reference in its entirety). This resource will allow future comparisons of traits such as fruit quality and ripening time that vary among these favored varieties. Sequencing of the backcrossed males, a unique resource in any long-generation plant, allowed genomtc-level studies of male/female date palm di fferences. Scaffolds strongly linked to gender were identified, and the establishment of a DNA marker-based gender test may now be feasible. These regions will be further studied to identify a specific mutation, mutations, or other gene content difference that leads to a male or female progeny outcome.
[0143] For millennia, date palm cultivation of favored female varieties has taken the form of offshoot propagation. It has been essentially impossible to grow a specific female date palm variety from seed because seedling-grown fruit quality is too different from the mother to be economically useful. By combining the findings presented here with the backcrossed genetic resources that began to be generated decades ago (Barrett, "Date Breeding and Improvement in North America," Fruit Varieties Journal 27:50-55 ( 1973), which is hereby incorporated by reference in its entirety), seeds of backcrosses, identified as female at the earliest stages and genotyped to show similarity to the original mother, will now be available. The results provided herein have laid the foundation for date palm genomic-level research by providing the first genome-wide gene set, the first genome-wide multi-variety polymorphism set, and the first gender-linked regions. Exam le 12 - DNA-Based Assays to Distinguish Date Palm Gender
[0144] As described herein, regions in the date palm genome that are linked to gender have been identified (Al-Dous et al .. "De novo Genome Sequencing and
Comparative Genomics of Date Palm (Phoenix dactylifera)." Nature Biotechnology 29:521-527 (201 1 ), which is hereby incorporated by reference in its entirety).
Investigation of these regions revealed that the date palm employs a XX/XY sex determination system with the male being the heterogametic sex. The regions also showed significant polymorphism between the male and female alleles. This
polymorphism can be used in the development of assays to distinguish the two sexes at an early stage. In this example, two approaches were employed to develop DNA-based assays for sex differentiation in date palm. The first were PCR-based restriction fragment length polymorphism ("PCR-RFLP") approaches that require amplification followed by restriction digestion and gel electrophoresis. The second approach is a PCR-only method that takes advantage of the high heterogeneity in the sex-linked region to remove the need for the restriction digestion step. By designing primers on sex-linked polymorphisms, the process was simplified. Both approaches are presented.
Methods and Results
[0145 J Samples were collected from farms in Qatar and from the U.S. Department of Agriculture Agricultural Research Service ("USDA-ARS") national clonal germplasm repository for citrus and dates in Riverside, California, USA. Genomic DNA was extracted from leaves using the WIZARD DNA prep (Promega, Madison, Wisconsin, USA) according to the manufacturer's protocol.
[0146] For PCR amplification in the PCR-RFLP assays 1 ί. of genomic DNA
( 1 5 ng/μυ) was amplified using AmpliTaq Gold (Life Technologies, Foster City, California, USA) master mix in a total volume of 25 μL containing 5 pmol of each primer. Reactions were activated at 95°C for 5 min followed by 40 cycles of 95°C 15 s, 56°C for 30 s, and 72°C for 1 min. Digestion was carried out by adding directly to the 25 μL· amplified product 19 μί of water, 5 μΐ^ of the recommended New England Biolabs (Beverly, Massachusetts, USA) 10 χ restriction enzyme buffer, and 5 U of the restriction enzyme (see below). The total volume of 50 \iL was digested at the temperature recom mended by the manufacturer. The PCR-only assay contained 1 pL of genomic DNA (15 ng/ μΐΐ) with 7.5 μL· of 1 .5 mM gCfe , 0.5 μL· of each female primer (5 pmol), and 1 pL of each male primer (5 pmol) in a total reaction volume of 25 pL using
AmpliTaq Gold master mix (Life Technologies). Reactions were cycled for 45 cycles using previous conditions.
[01471 Three PCR-RFLP-based methods were designed and tested on various combinations of male and female date palms. These date palms represented 10 di fferent varieties, as some of the males were a result of backcrossing to tested females. The goal was to test whether the assay was specific enough to distinguish sex between backcrossed males and females while at the same time sensitive enough to distinguish sex in multiple varieties (Table 10). Testing of the three assays revealed that those based on Bell
(Figures 12Λ-Β) and If pal l (Figures 13A-B) were capable of distinguishing sex among all samples tested. The assay based on Rsal (Figures 14A-B) showed that it called two males as a female (Khalt and Zahidi BC2). Sequencing of the Rsal region in a larger set of date palms revealed that the six out of 25 males were homozygous for the female allele at this polymorphism. This suggests that the Rsal polymorphism is most likely a recent polymorphism that is on a haplotype that has not spread as widely in the population as the others.
Table 10. Date Palm Varieties Used in PCR-RFLP Assays,
Number Name Gender (Collecti n ID
I F Khalas Female Qatar Biol
2F Chichi Female Qatar Bio 14
3F Deglet Noor Female U & D ** d* PI 4 1 I -R I V2 1 54
*4'F Medjool Female USDA-CA RPH01 -RIV2134
5F Barhee Female USDA-C A Pi 8746-R1V7479
6F Helali Female Qatar F37
7F Saqie Female Qatar F95
8F Dayri Female PI 8567-R1V7490 l M Khalt Male Qatar M6
2M Khadrawy Male USDA-CA P1555435-PL7491
3M Medjool BC4 Male USDA-CA P1555438-R1V2219
4M Dayri IK 2 Male USDA-CA PI555413-RIV7441
5M Barhee BC3 Male/ P1555419-RIV2133 hermaphrodite
6M Deglet Noor Male USDA-CA P1555433-PL2165
BC5
7M Crane Male USDA-CA PI555421 -RIV2478
8M Zahidi BC2 Male PI555409-RIV2236
Note: BC = backcross; USDA-CA = USDA-ARS national clonal germplasm repository or citrus and dates. Date palm genomic DNA used in this project is documented with ID number used in images, variety name, gender, where the sample is maintained, and its collection ID number.
[0148] While the PCR-RFLP assay is l ikely to be quite specific, it was attempted to design an assay that would allow researchers to determine gender of a date palm with a single PGR reaction followed by gel electrophoresis. It was advantageous that the male and female haplotypes are quite diverged with multiple polymorphisms between them. PGR primers were designed to span multiple polymorphisms (Figures 15A-B) that were unique to either the male or female haplotype in the hope that would allow specific amplification of each haplotype. The male is heterozygous containing both the male and female alleles and should yield two distinct PCR products. The female is homozygous, which should yield a single band representing both copies of the female allele, interestingly, in the design of the male allele specific primers, a single polymorphism only found in the Deglet Noor males was encountered (F igure 15B). This did not seem to affect the ability of the primer to anneal to other males (Figure 15C). In this case different date palm varieties were used for the validation (Table 1 1). The female varieties from the previous assays were used to establish the functionality of the assay across varieties. However, multiple backcrossed males were used from three varieties to demonstrate linkage of the allele to sex as would be done in a crossing program. That is to say. all females were homozygous and all male offspring shown here were
heterozygous. While the assay showed some issues with primer dimers (Figure 15C). the results clearly show that a single step, PCR-only-based method distinguishes the male and females.
Table 1 1. Date Palm Varieties Used in the PCR-Only-Based Assay.
Number Name Gender Collection ID
I F Female Qatar Biol
2F Female Qatar Bio 14
3F Deglet Noor Female USDA- -CA PI 461 1 -RIV2154
4F Medjool Female USDA- -CA RPH01 -R1V2134
5F Barhee Female USDA- -CA PI 8746-RIV7479
6F Helali Female Qatar F37
7F Saqie Female Qatar F95
9M Deglet Noor BC5 Male USDA- -CA P155543-PL7506
10M Deglet Noor BC5 Male USDA- -CA PI555432-PL2166
1 1 M Medjool BC4 Male USDA- -CA PI555438-R1V7526
12M Medjool BC4 Male USDA- -CA P1555438-2220
13M Dayri BC3 Male U SD^\ * -CA PI555417-RIV2145
14M Dayri BC2 Male USDA- -CA PI555414-RIV2150
1 5M Dayri BC2 Male US1 A' CA PI55541 3-RIV7442
Note: C = backcross; USDA-CA = USDA-ARS national clonal germplasm repository or citrus and dates.
Conclusions
[0149] Multiple assays have been developed that will allow researchers to distinguish date palm sex at the earliest stages. The assays were shown to work across multiple date palm varieties indicating that most polymorphisms they are based on are widespread and most likely ancient. For sensitivity, the use of the PCR-RFLP approach based on both the Bel] and HpaM enzymes is recommended as these offer contrasting results (restriction digestions of male product in one and female product in the other). Due to high heterozygosity in the gender-linked region (Al-Dous et al., "De novo Genome Sequencing and Comparative Genomics of Date Palm (Phoenix dactyliferd)," Nature Biotechnology 29:521-527 (201 1 ), which is hereby incorporated by reference in its entirety), a PCR-only method was successfully developed and offers investigators a faster approach, although sensitivity may be reduced. As the sex-linked region is fine mapped and a single sex-controlling mutation is identified, these assays will be modified to take into account this information. For now, it is predicted that one can achieve at least 90% discrimination levels using these approaches.
fO 150] Although the invention has been described in detail for the purposes of illustration, it is understood that such detail is solely for that purpose, and variations can be made therein by those skilled in the art without departing from the spirit and scope of the invention which is defined by the following claims.

Claims

WHAT IS CLAIMED;
1 . A method of identifying the sex of a date palm plant, said method comprising:
analyzing DNA or RNA from a date palm plant, tissue, germplasm, or seed for the presence of (i) a nucleic acid sequence that identifies the sex of the plant, tissue, germplasm, or seed or (ii) a molecular marker in linkage disequilibrium with the nucleic acid sequence and
identifying the sex of the plant, tissue, germplasm, or seed based on whether or not the plant, tissue, germplasm, or seed contains the nucleic acid sequence or the molecular marker.
2. The method according to claim 1 , wherein said analyzing is carried out to determine the presence of the nucleic acid sequence.
3. The method according to claim 2, wherein said analyzing comprises determining the presence of a male allele at the nucleotide corresponding to position 1 of SEQ ID NOs: 1 -972, or a corresponding RNA sequence.
4. The method according to claim 3, wherein where the plant, tissue, germplasm, or seed does not contain the male allele the plant, tissue, germplasm. or seed is identified as female.
5. The method according to claim 1 , wherein said analyzing is carried out to determine the presence of the molecular marker.
6. The method according to claim 5, wherein the molecular marker is present in SEQ ID NOs: 1-972, or a corresponding RNA sequence.
7. The method according to claim 6, wherein where the plant, tissue, germplasm, or seed contains the molecular marker, the plant, tissue, germplasm. or seed is identified as male.
8. The method according to claim 1 , wherein said analyzing comprises detecting, in a hybridization assay, whether the nucleic acid sequence hybridizes to an oligonucleotide probe.
9. The method according to claim 1 , wherein said analyzing comprises detecting, in a PCR-based assay, whether oligonucleotide primers amplify the nucleic acid sequence.
10. The method according to claim 1 further comprising: planting or transplanting the date palm plant, tissue, seed, or germplasm in a location suitable for the identified sex.
1 1. The method according to claim 1 further comprising: growing a fruit-bearing plant from the plant, tissue, germplasm, or seed and
harvesting fruit from the fruit-bearing plant.
12. The method according to claim 1 further compring: breeding the plant whose sex is identified.
13. The method according to claim 1 further comprising: marking the plant, tissue, seed, or germplasm based on its identified sex.
14. A method of identifying the sex of a date palm plant, said method comprising:
analyzing DNA or RNA from a date palm plant, tissue, germplasm, or seed for the presence of (i) a genotype that identifies the sex of the plant, tissue, germplasm, or seed, or (ii) a molecular marker linked to the genotype and
identifying the sex of the plant, tissue, germplasm, or seed based on whether or not the plant, tissue, germplasm, or seed contains the genotype or the molecular marker.
15. The method according to claim 14, wherein a male genotype is present in the plant, tissue, germplasm, or seed and the plant, tissue, germplasm, or seed is identified as a male plant.
16. The method according to claim 15, wherein the genotype is selected from a heterozygous or homozygous male allele at the nucleotides corresponding to position 51 of SEQ ID NOs: 1-972.
17. The method according to claim 14, wherein a molecular marker associated with a male genotype is present in the plant, tissue, germplasm, or seed and the plant, tissue, germplasm, or seed is identified as a male plant.
1 8. The method according to claim 1 7, wherein the molecular marker is present in SEQ ID NOs: 1 -972, or a corresponding RNA sequence.
19. The method according to claim 14, wherein said analyzing is carried out with a hybridization assay or a PC R -based assay.
20. The method according to claim 14 further comprising; planting or transplanting the date palm plant, tissue, seed, or germplasm in a location suitable for the identified sex.
21 . The method according to claim 14 further comprising: growing a fruit-bearing plant from the plant, tissue, germplasm, or seed and
harvesting fruit from the fruit-bearing plant.
22. The method according to claim 14 further compring: breeding the plant whose sex is identified.
23. The method according to claim 14 further comprising: marking the plant, tissue, seed, or germplasm based on its identified sex.
24. A method of selecting a male or female date palm plant prior to flowering, said method comprising:
detecting in a date palm plant, tissue, germplasm, or seed (i) a genotype that identifies the plant, tissue, germplasm, or seed as male or female, or (ii) a molecular marker in linkage disequilibrium with the genotype and
selecting the plant, tissue, germplasm, or seed possessing the genotype or the molecular marker.
25. The method according to claim 24, wherein a male genotype is detected in the plant, tissue, germplasm, or seed.
26. The method according to claim 25, wherein the genotype is selected from a heterozygous or homozygous male allele at the nucleotides corresponding to position 51 of SEQ ID NOs: 1 -972.
27. The method according to claim 24, wherein a female genotype is detected in the plant, tissue, germplasm, or seed, said female genotype comprising a homozygous female allele at the nucleotides corresponding to position 5 1 of SEQ ID NOs: 1 -972.
28. The method according to claim 24, wherein the molecular marker is detected.
29. The method according to claim 28, wherein the molecular marker is present in SEQ I I ) NOs: 1 -972.
30. The method according to claim 24 further comprising: planting or transplanting the selected date palm plant, tissue, seed, or germplasm in a location suitable for its sex.
31. The method according to claim 24 further comprising: growing a fruit-bearing plant from the plant, tissue, germplasm, or seed and harvesting fruit from the fruit-bearing plant.
32. The method according to claim 24 further compring: breeding the plant whose sex is identified.
33. The method according to claim 24 further comprising: marking the selected plant, seed, or germplasm as male or female.
34. A kit for selecting a male or female date palm plant prior to flowering, said kit comprising;
primers or probes for detecting in a date palm plant, tissue, germplasm, or seed (i) a genotype that identifies the plant, tissue, germplasm, or seed as male or female, or (ii) a molecular marker in linkage disequilibrium with the genotype and
instructions for using the primers or probes for detecting the genotype or the molecular marker.
35. The kit according to claim 34, wherein the primers or probes detect the genotype.
36. The kit according to claim 35, wherein the genotype is a heterozygous or homozygous male allele at position 5 1 of SEQ ID NOs: 1 -972 for selecting a male date palm plant.
37. The kit according to claim 35, wherein the genotype is a homozygous female allele at the nucleotides corresponding to position 51 of SEQ ID NOs: 1 -972 for selecting a female date palm plant.
38. The kit according to claim 34, wherein the primers or probes detect the molecular marker.
39. A method of selecting a male or female date palm plant prior to flowering, said method comprising: detecting in a date palm plant, tissue, germplasm, or seed (i) a nucleic acid sequence that identifies the plant, tissue, germplasm, or seed as male or female or (ii) a molecular marker in linkage disequilibrium with the nucleic acid sequence and
selecting the plant, tissue, germplasm, or seed possessing the nucleic acid sequence or the molecular marker.
40. The method according to claim 39, wherein the nucleic acid sequence is detected.
41 . The method according to claim 40, wherein the nucleic acid sequence comprises a male allele at the nucleotide corresponding to position 5 1 of SEQ ID NOs: 1 -972, or a corresponding RNA sequence and the plant, tissue, germplasm, or seed selected is male.
42. The method according to claim 39, wherein the molecular marker is detected.
43. The method according to claim 42, wherein the molecular marker is present in SEQ ID NOs: 1 -972, or a corresponding RNA sequence.
44. The method according to claim 39 further comprising:
planting or transplanting the selected date palm plant, tissue, seed, or germplasm in a location suitable for its sex.
45. The method according to claim 39 further compring: breeding the plant whose sex is identified.
46. The method according to claim 39 further comprising: marking the selected plant, seed, or germplasm as male or female.
47. Λ kit for selecting a male or female date palm plant prior to flowering, said kit comprising: primers or probes for detecting in a date palm plant, tissue, germplasm, or seed (i) a nucleic acid sequence that identifies the plant, tissue, germplasm, or seed as male or female or (ii) a molecular marker in linkage disequilibrium with the nucleic acid sequence and
instructions for using the primers or probes for detecting the nucleic acid sequence or the molecular marker,
48. The kit according to claim 47, wherein the primers or probes detect the nucleic acid sequence,
49. The kit according to claim 48, wherein the nucleic acid sequence detected comprises a male allele at the nucleotide corresponding to position 51 of SEQ ID NOs: 1 -972, or a corresponding RNA molecule, and the plant, tissue, germplasm, or seed selected is male.
50. The kit according to claim 47, wherein the primers or probes detect the molecular marker.
51. A method of breeding a date palm plant, said method comprising: providing a date palm plant having a sex determined by detecting in the plant or a seed, tissue, or germplasm from which it was derived (i) a genotype that identifies the plant as either male or female, or (ii) a molecular marker in linkage disequilibrium with the genotype and
breeding the date palm plant with a plant of the opposite sex.
52. A method of breeding a date palm plant, said method comprising: providing a date palm plant having a sex determined by detecting in the plant or a seed, tissue, or germplasm from which it was derived (i) a nucleic acid sequence that identifies the plant as male or female or (ii) a molecular marker in linkage disequil ibrium with the nucleic acid sequence and
breeding the date palm plant with a plant of the opposite sex. 53, A method of planting a date palm seed of a known sex, said method comprising:
providing a seed having a known male or female sex and planting the seed.
PCT/US2012/031166 2011-03-29 2012-03-29 Genetics of gender discrimination in date palm Ceased WO2012135468A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US14/008,012 US20140208449A1 (en) 2011-03-29 2012-03-29 Genetics of gender discrimination in date palm

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201161469032P 2011-03-29 2011-03-29
US61/469,032 2011-03-29

Publications (2)

Publication Number Publication Date
WO2012135468A2 true WO2012135468A2 (en) 2012-10-04
WO2012135468A3 WO2012135468A3 (en) 2012-12-27

Family

ID=46932339

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2012/031166 Ceased WO2012135468A2 (en) 2011-03-29 2012-03-29 Genetics of gender discrimination in date palm

Country Status (2)

Country Link
US (1) US20140208449A1 (en)
WO (1) WO2012135468A2 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113215298A (en) * 2021-06-01 2021-08-06 海南大学 SNP locus for identifying coconut high and short varieties and application

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7702468B2 (en) 2006-05-03 2010-04-20 Population Diagnostics, Inc. Evaluating genetic disorders
US10522240B2 (en) * 2006-05-03 2019-12-31 Population Bio, Inc. Evaluating genetic disorders
WO2012018387A2 (en) 2010-08-02 2012-02-09 Population Diagnotics, Inc. Compositions and methods for discovery of causative mutations in genetic disorders
EP2773779B1 (en) 2011-11-04 2020-10-14 Population Bio, Inc. Methods and compositions for diagnosing, prognosing, and treating neurological conditions
US10407724B2 (en) 2012-02-09 2019-09-10 The Hospital For Sick Children Methods and compositions for screening and treating developmental disorders
DK2895621T3 (en) 2012-09-14 2020-11-30 Population Bio Inc METHODS AND COMPOSITION FOR DIAGNOSIS, FORECAST AND TREATMENT OF NEUROLOGICAL CONDITIONS
WO2014052855A1 (en) 2012-09-27 2014-04-03 Population Diagnostics, Inc. Methods and compositions for screening and treating developmental disorders
US10240205B2 (en) 2017-02-03 2019-03-26 Population Bio, Inc. Methods for assessing risk of developing a viral disease using a genetic test
EP4177356B1 (en) 2018-08-08 2024-05-08 PML Screening, LLC Methods for assessing risk of developing a viral disease using a genetic test

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5910412A (en) * 1996-05-14 1999-06-08 Sakata Seed Corporation Method for identifying the sex of spinach by DNA markers
US6500616B1 (en) * 1998-04-16 2002-12-31 Case Western Reserve University Methods of monitoring genomic integrity and detecting genomic destabilization of plant cells in tissue culture

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113215298A (en) * 2021-06-01 2021-08-06 海南大学 SNP locus for identifying coconut high and short varieties and application
CN113215298B (en) * 2021-06-01 2022-04-15 海南大学 SNP locus for identifying coconut high and short varieties and application

Also Published As

Publication number Publication date
WO2012135468A3 (en) 2012-12-27
US20140208449A1 (en) 2014-07-24

Similar Documents

Publication Publication Date Title
US20140208449A1 (en) Genetics of gender discrimination in date palm
Bensch et al. Ten years of AFLP in ecology and evolution: why so few animals?
Shen et al. Development of GBTS and KASP panels for genetic diversity, population structure, and fingerprinting of a large collection of broccoli (Brassica oleracea L. var. italica) in China
Xu et al. Phenotypic diversity and association mapping for fruit quality traits in cultivated tomato and related species
Hu et al. Assessment of genetic diversity in broomcorn millet (Panicum miliaceum L.) using SSR markers
Li et al. Construction of high-density genetic map and mapping quantitative trait loci for growth habit-related traits of peanut (Arachis hypogaea L.)
US20140255922A1 (en) Cotton polymorphisms and methods of genotyping
US10337072B2 (en) Copy number detection and methods
US20100021916A1 (en) Microsatellite-based fingerprinting system for saccharum complex
US10945391B2 (en) Yield traits for maize
Yang et al. Methods for developing molecular markers
Rajendran et al. Genotyping by sequencing advancements in barley
Coulton et al. Examining the effects of temperature on recombination in wheat
Newman et al. Initiation of genomics-assisted breeding in Virginia-type peanuts through the generation of a de novo reference genome and informative markers
JP2021532834A (en) Seed lot quality control method
US20130040826A1 (en) Methods for trait mapping in plants
CN108060247B (en) A haplotype associated with fiber strength of upland cotton chromosome 8
US20070192909A1 (en) Methods for screening for gene specific hybridization polymorphisms (GSHPs) and their use in genetic mapping ane marker development
WO2015195762A1 (en) Methods and compositions for producing sorghum plants with anthracnose resistance
Meyer et al. The ghost of outcrossing past in downy brome, an inbreeding annual grass
CA2804853C (en) Soybean gene cluster regions associated with aphid resistance and methods of use
Sanghvi et al. Molecular markers in plant biotechnology
Igartua et al. Genome-wide association studies (GWAS) in barley
Shende et al. Marker assisted selection (MAS) for crop improvement
WO2012017682A2 (en) Leaf-blade-length-related marker of plant of the genus saccharum and the use thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12764280

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 14008012

Country of ref document: US

122 Ep: pct application non-entry in european phase

Ref document number: 12764280

Country of ref document: EP

Kind code of ref document: A2