WO2012133947A1 - Functional nucleic acid molecule and use thereof - Google Patents

Functional nucleic acid molecule and use thereof Download PDF

Info

Publication number
WO2012133947A1
WO2012133947A1 PCT/JP2012/059430 JP2012059430W WO2012133947A1 WO 2012133947 A1 WO2012133947 A1 WO 2012133947A1 JP 2012059430 W JP2012059430 W JP 2012059430W WO 2012133947 A1 WO2012133947 A1 WO 2012133947A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
sine
protein
nucleic acid
acid molecule
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/JP2012/059430
Other languages
French (fr)
Inventor
Piero Carninci
Alistair Forrest
Stefano GUSTINCICH
Claudia CARRIERI
Silvia ZUCCHELLI
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
International School For Advanced Studies
RIKEN
Original Assignee
International School For Advanced Studies
RIKEN
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by International School For Advanced Studies, RIKEN filed Critical International School For Advanced Studies
Priority to EP20203177.9A priority Critical patent/EP3792359A1/en
Priority to US14/008,186 priority patent/US9353370B2/en
Priority to ES12763652T priority patent/ES2855577T3/en
Priority to JP2014501947A priority patent/JP2014514921A/en
Priority to EP12763652.0A priority patent/EP2691522B1/en
Publication of WO2012133947A1 publication Critical patent/WO2012133947A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67General methods for enhancing the expression
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111General methods applicable to biologically active non-coding nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • C12N2310/3519Fusion with another nucleic acid

Definitions

  • the present invention relates to (a) a functional nucleic acid molecule having a function of increasing the protein synthesis efficiency, and (b) a use of the functional nucleic acid molecule.
  • RNA molecules There are various types of functional nucleic acid molecules, typified by relatively long functional RNA molecules such as antisense RNA, for example.
  • Other typical examples of the functional nucleic acid molecules are relatively short functional RNA molecules such as shRNA (short hairpin RNA), siRNA (small interfering RNA), and miRNA (micro interfering RNA).
  • shRNA short hairpin RNA
  • siRNA small interfering RNA
  • miRNA micro interfering RNA
  • An antisense RNA technique is excellent in target specificity.
  • this technique has a disadvantage that an antiviral re sponse in a cell is activated .
  • the technique using the relatively short functional RNA molecules such as shRNA does not activate the antiviral re sponse practically.
  • the relative short functional RNA molecules have the po ssibility of causing the off-target effects because it is difficult for short sequence length to keep high specificity to the target sequences .
  • the relatively short functional RNA molecules tend to exhibit poor target specificity as compared with the antisense RNA technique .
  • Patent Literature 1 discloses a functional nucleic acid molecule (D NA molecule) comprising: a pol III type III promoter; a sequence identical or complementary to a target sequence that performs downregulation ; and a 7 SL small-RNA derived sequence (more specifically, a fragment of an Alu derived sequence) including at least binding domains to srp9 and srp l 4 proteins .
  • the srp9 and srp l 4 protein s are members of a family of proteins that bind to a 7 SL RNA in gene transcription to form a 7SL RNA complex.
  • the functional nucleic acid molecule disclosed in Patent Literature 1 is used as a gene expres sion downregulation technique in which an RNA molecule transcribed from the functional nucleic acid molecule practically cause s no antiviral response activation and has excellent target specificity.
  • Alu is classified into one group of SINEs (Short Interspersed Elements). Note that the Alu derived sequence of the functional nucleic acid molecule disclosed in Patent Literature 1 is inserted in a particular orientation and considered to be involved in RNA stability.
  • the present inventors consider that there are many conditions in which acting only on translation is desired. For instance, enhancement of translation of an animal protein for therapeutic purposes without interfering with its transcription may be highly desired because it does not require reprogramming of mRNA transcription in the nucleus.
  • An object of the present invention is to provide a functional nucleic acid molecule having a function of increasing the protein synthesis efficiency, and a use of the functional nucleic acid molecule.
  • Solution to Problem The present inventors ' current knowledge suggested that translation of protein may be regulated by factors including the structure of the regions of the mRNAs that is placed upstream the tran slated fraction of the mRNAs . This region is known as 5 ' UTR (5 ' untranslated region) .
  • the 5 ' UTR can be a natural one (found in natural RNAs , from the transcription starting site to the protein initiation codon) , or can be an artificial sequence , such as the sequence pre sent in a cloning vector or any other recombinant sequence .
  • RNA molecules known as non-coding RNAs RNA molecules known as non-coding RNAs
  • the inventors found a surprising fact that a particular structure of such an RNA molecule has a function of increasing the protein synthe sis efficiency.
  • This functional nucleic acid exhibited the effect against a specific targeted protein through antisense sequence to a target sequence .
  • the inventors have accomplished the pre sent invention .
  • a functional nucleic acid molecule according to the present invention comprises :
  • a target determinant sequence comprising antisen se sequence to a target sequence in the protein- encoding RNA for which protein synthe sis efficiency is to be increased ; and (b) a regulatory sequence having an activity of increasing of the protein synthesis efficiency.
  • the regulatory sequence comprises a SINE (Short Interspersed Element)-derived sequence.
  • SINE-derived sequence may be a tRNA derived SINE, for example SINE B2, ID element, MEN, 4.5S1, DIP-derived sequence, or sequences that comprise joining separate elements of these sequences or similar sequences.
  • SINE-derived sequence may be a sequence which comprises substantially potential predicted structures formed by parts of the SINE sequences, for example.
  • the regulatory sequence may be selected from the group consisting of the following (1) through (5):
  • RNA which is encoded by a DNA consisting of the nucleotide sequence shown in SEQ ID No:l (SINE/B2 in AS Uchll)
  • RNA which is encoded by a DNA consisting of the nucleotide sequence shown in SEQ ID No:2 (SINE/ B2 , 39nt spacer indicated as underline and SINE/Alu in AS Uchll)
  • RNA which is encoded by a DNA consisting of the nucleotide sequence shown in SEQ ID No:3 (SINE/B2 in AS Uxt)
  • nucleic acids which is at least 25 % similarity to the RNA, which is encoded by a DNA consisting of the nucleotide sequence shown in SEQ ID No : 1 , 2 or 3 and (ii) which has a function of increasing the protein synthesis efficiency;
  • nucleic acids (i) which is encoded by a DNA in which not le ss than 1 but not more than 200 nucleotide s are deleted , substituted , added , and / or inserted in the nucleotide sequence shown in SEQ ID No : 1 , 2 or 3 and (ii) which has a function of increasing the protein synthesis efficiency.
  • the target determinant sequence comprises an antisense sequence to a target sequence in the protein-encoding RNA for which protein synthesis efficiency is to be increased .
  • the target determinant sequence may be located between a 5 '- terminal and the regulatory sequence in the functional nucleic acid molecule .
  • the antisen se sequence in the target determinant sequence have a length more than 7 nucleotide s but less than 250 nucleotides .
  • the antisense sequence in the target determinant sequence be at least 60% similarity to a target sequence in the protein-encoding RNA or to the plasmid sequence upstream of the ATG in the protein-encoding RNA for which protein synthe sis efficiency is to be increased .
  • the direction of the SINE-derived sequence which is annotated as forward in the regulatory sequence is oriented in a reverse direction relative to the direction (forward direction as defined above) , wherein SINE-derived sequence is oriented in the same direction of the consensus sequence of SINE . That is , the regulatory sequence of the functional nucleic acid molecule is oriented in a direct direction relative to the direction of translation and reverse orientation relative to the direction of transcription of the antisense nucleic acid molecule .
  • the SI NE-derived sequence in this invention is embedded in the reverse direction of the functional nucleic acid molecule in this invention .
  • the antisense sequence in the target determinant sequence may be de signed to hybridize with a target sequence in the 5 '-UTR of the protein-encoding RNA for which protein synthe sis efficiency is to be increased .
  • the target determinant sequence may be designed to hybridize with a target sequence in the coding region of the protein-encoding RNA for which protein synthesis efficiency is to be increased .
  • the target determinant sequence may overlap to the sequence of plasmid upstream of the starting codon or including the starting codon in the target sequence of the protein encoding RNA.
  • the functional nucleic acid molecule according to the present invention can be targeted to specific splicing variants at the 5 - ends of the protein coding RNA or in other parts of the molecule .
  • the functional nucleic acid molecule according to the present invention can be appropriately designed and produced by a skilled person in the related art, as long as the functional nucleic acid molecule includes : a target determinant sequence comprising antisense sequence to a target sequence in the protein-encoding RNA for which protein synthe sis efficiency is to be increased ; and a regulatory sequence having an activity of increasing of the protein synthesis efficiency . Any modification during or po st/ synthesis can be applied to the functional nucleic acid molecule by a skilled person in the related art according to the know/ how in RNA therapeutics or the like .
  • a D NA molecule according to the present invention encodes any one of the RNA molecules as aforementioned functional nucleic acid molecule s .
  • An expres sion vector according to the present invention includes any one of the RNA molecules or the D NA molecule as aforementioned functional nucleic acid molecules .
  • a compo sition for increasing protein synthesis efficiency comprises any one of the aforementioned functional nucleic acid molecules and / or the aforementioned expre ssion vector.
  • a method for increasing the protein synthe sis efficiency comprises the step of allowing any one of the aforementioned functional nucleic acid molecule s or the aforementioned expre ssion vector to coexist with a protein-encoding RNA for which protein synthesis efficiency is to be increased .
  • the protein-encoding RNA is hybridizable with the antisen se in the target determinant sequence of the functional nucleic acid molecule .
  • the method may comprise the step of transfecting (or transducing) into a cell any one of the aforementioned functional nucleic acid molecules or the aforementioned expre s sion vector.
  • a protein synthesis method according to the pre sent invention is a method for synthesizing a protein, comprising the step of increasing the protein synthesis efficiency by any one of the aforementioned protein synthe sis efficiency- increasing methods .
  • a method for treating a disease according to the present invention comprises the step of increasing the protein synthesis efficiency in a subj ect by any one of the aforementioned protein synthe sis efficiency- increasing methods .
  • the subj ect may have a disease or a predisposition to the disease , wherein the disease is caused by a quantitative decrease in a predetermined normal protein or haploinsufficiency.
  • the functional nucleic acid molecule may increase the efficiency of synthe sizing of the predetermined normal protein .
  • the treatment method of the present invention can be used in combination with a conventional method for suppre ssing the expres sion of the another protein by siRNA, shRNA, or the like , and / or a conventional method for inactivating a function of a protein by use of an antibody, a low-molecular-weight compound, or the like, as appropriate.
  • the disease may be a neurodegenerative disease or cancer, for example.
  • Fig.l related to the experiment 1, is a schematic diagram of Uchll/AS Uchll genomic organization. Uchll exons are in black; 3' and 5' UTRs in white.
  • Fig.2 related to the experiment2, is a schematic diagram of AS Uchll domain organization.
  • AS Uchll exons are in grey; repetitive elements are in red (Alu/SINEBl) and blue (SINEB2). Introns are indicated as lines.
  • Fig.3 is a view showingfjAS Uchll regulates UchLl protein levels.
  • AS Uchl 1 -transfected MN9D cells show increased levels of endogenous UchLl protein relative to empty vector control, with unchanged mRNA quantity.
  • Fig.4 related to the experiment4, is a view showingHAS Uchll regulates UchLl protein levels. Increasing doses of transfected AS Uchll titrate quantity of UchLl protein in HEK cells. No changes in Uchll mRNA levels.
  • Fig.5 is a view showingrjAS Uchll regulates UchLl protein levels.
  • Full length (FL) AS Uchll is required for regulating endogenous (MN9D cells, left panel) and overexpressed (HEK cells, right panel) UchLl protein levels.
  • Scheme of ⁇ 5' or ⁇ 3' deletion mutants is shown.
  • Fig.6 related to the experiment6, is a view showing AS Uchll regulates UchLl protein levels via embedded SINEB2. Inverted SINEB2 is sufficient to control UchLl protein levels. Scheme of mutants is shown.
  • Fig.7 related to the experiment7, is a view showing Family of AS transcripts with embedded SINEB2.
  • Family of FANTOM 3 non-coding clones that are AS to protein coding genes and contain embedded SINEB2 in inverted orientation.
  • Fig.8 related to the experiments, is a view showing Family of AS transcripts with embedded SINEB2. Schematic diagram of Uxt/AS Uxt genomic organization. AS Uxt increases endogenous Uxt protein levels in transfected MN9D cells (left), without affecting its transcription (right).
  • Fig.9 related to the experiment 9, is a view showing
  • AS Uchll in the nucleus of dopaminergic neurons.
  • AS Uchll (red) and Uchll (green) transcripts are expressed in the nucleus and cytoplasm of TH-positive DA neurons of the Substantia Nigra (blue). Details of localization are in zoom images.
  • Fig.10 related to the experiment 10, is a view showing AS Uchll translocates to the cytoplasm upon rapamycin treatment in MN9D cells. mRNA levels measured with primers spanning 5' overlapping or 3' distal portions of the transcript. Data indicate mean ⁇ s.d., n>3 (3). **p ⁇ 0.01; ***p ⁇ 0.005.
  • Fig.11 related to the experiment 11 , is a view showing Rapamycin treatment induces UchLl protein expression. UchLl protein level is increased in rapamycin-treated MN9D cells.
  • Fig.12 is a view showing AS Uchll-embedded SINEB2 induces translation of Uchll upon rapamycin treatment.
  • Silencing AS Uchll transcription in MN9D cells (shRNA, encompassing -15/+4 position of target sequence) inhibits rapamycin-induced UchLl protein level.
  • Scramble shRNA regulatory sequence. Left, mRNA levels; right, protein levels.
  • Fig.13 related to the experiment 13, is a view showing AS Uchll-embedded SINEB2 induces translation of Uchll upon rapamycin treatment. Deletion of embedded SINEB2 (ASINEB2) is sufficient to inhibit rapamycin-induced UchLl protein up-regulation.
  • ASINEB2 embedded SINEB2
  • Fig.14 is a view showing an artificial AS transcript with embedded SINEB2 (AS Gfp) to an artificial humanized enhanced Green Fluorescent Protein (Gfp) mRNA increases GFP protein synthesis:
  • AS Gfp AS transcript with embedded SINEB2
  • Gfp humanized enhanced Green Fluorescent Protein
  • Fig.15 related to the experimentl5, is a view showing an artificial AS transcript with embedded SINEB2 (AS Fc clone) to an artificial recombinant antibody in pHYGRO (pHYGRO clones) increases the synthesis of the protein encoded in pHYGRO.
  • AS Fc increases the encoded protein levels in transfected HEK cells while a scramble overlapping sequence or an empty plasmid do not, detected through the SV5 tag.
  • Fig.16 is a view showing how an artificial AS transcript with embedded SINEB2 to an artificial Green Fluorescent Protein (EGFP) mRNA increases EGFP protein synthesis.
  • EGFP Green Fluorescent Protein
  • Fig.17 is a view showing the examples of the potential predicted structures of SINE B2-derived sequence.
  • a functional nucleic acid molecule according to the present invention has a feature that it comprise s : a target determinant sequence comprising an antisense sequence to a target sequence in the protein-encoding RNA for which protein synthe sis efficiency is to be increased ; and a regulatory sequence having an activity of increasing of the protein synthesis efficiency.
  • the functional nucleic acid molecule according to the present invention can be appropriately designed and produced by a skilled person in the related art based on the description herein .
  • the protein synthe sis efficiency is increased according to the present invention .
  • the protein synthesis efficiency is increased as a result of increase in the translation efficiency, preferably, without changing the transcription efficiency substantially.
  • the protein synthe sis efficiency may be increased by increasing the translation efficiency .
  • both transcription and translation can be increased by independent means; obviously, it may be the case that an RNA may result lower expre ssion level, and yet the protein re sults higher expression level .
  • the protein-encoding RNA for which protein synthesis efficiency is to be increased by the functional nucleic acid molecule according to the present invention is not especially limited in regard to its sequence, origin, and the like, provided that the RNA comprises a translation domain (coding region) having a 5'-terminal start codon and a 3'-terminal stop codon.
  • the protein-encoding RNA for which protein synthesis efficiency (the target RNA) is to be increased by the functional nucleic acid molecule according to the present invention may further have a 5'-cap structure, a 5' untranslated region (5'-UTR) and/or a 3' untranslated region. These regions may be derived from endogenous sequence in a cell or artificially synthesized sequence.
  • the ORFeome in which Open Reading Frames (coding sequences) of genes are placed in expression vectors, is one of the examples.
  • the 3' untranslated region includes, at its 3' terminal, a sequence (poly-A addition signal) so that a poly-A sequence can be added.
  • the poly-A addition signal may be, for example, a nucleotide sequence consisting of AAUAAA, a SV40 early poly-A signal having two sequences of AAUAAA, a sequence in which SV40 early poly-A signals are aligned in a tandem manner, or the like.
  • the poly-A addition signal is not limited to them.
  • the protein-encoding RNA for which protein synthesis efficiency is to be increased according to the present invention may have a poly-A sequence at its 3' terminal.
  • An RNA having a poly-A sequence at its 3' terminal has excellent protein synthesis efficiency from a translation domain and excellent stability of the RNA itself.
  • Such an RNA may be, for example, any one of RNAs shown in Uchll, Uxt, GFP or a homologue of any one of these RNAs, although such an RNA is not limited to them.
  • the Uchll DNA sequence which encodes the Uchll RNA is shown in SEQ ID NO.4.
  • the Uxt DNA sequence which encodes the Uxt RNA is shown in SEQ ID NO.5.
  • the GFP DNA sequence which encodes the GFP RNA sequence is shown in SEQ ID NO.6.
  • RNA for which protein synthesis efficiency is to be increased may be endogenous RNA of biological origin (for example , mRNA) or artificially synthesized .
  • mRNA derived from eucaryotes encompass mature mRNA that has been subj ected to what i s called proce ssing, and precursor mRNA that has not been subj ected to proce ssing.
  • the target determinant sequence is a sequence that comprises an antisense sequence to a target sequence in the protein-encoding RNA for which protein synthesis efficiency is to be increased .
  • a target sequence is arbitrarily selected from a partial sequence of protein-encoding RNA for which protein synthe sis efficiency is to be increased in the present invention .
  • a target sequence may derive from the RNA sequence transcribed from the plasmid DNA in which the protein-encoding cDNA is inserted and around the first 5 '-terminal start codon .
  • a length of the antisense sequence is not especially limited .
  • the antisense sequence may have a length of preferably more than 7 nucleotides , more preferably 10 , more preferably 15. Furthermore, the antisense sequence may have a length of preferably less than 250 nucleotides , more preferably 200 , more preferably 150 , more preferably 100 , more preferably 90 , more preferably 80 , more preferably 77 nucleotides , more preferably 70 nucleotides, more preferably 60 nucleotides , more preferably 50 nucleotide s, more preferably 40 nucleotides , more preferably 30 nucleotide s .
  • more than one different antisense sequence s can be included in the target determinant sequence . These multiple antisense sequences can be applied to targeting of multiple proteins , for example . Alternatively, the multiple antisense sequence s can be applied to improving the specificity to a protein - encoding RNA wherein the multiple antisense sequences are hybridizable with the same protein-encoding RNA.
  • the target determinant sequence of the pre sent invention may contain mismatches again st the target RNA on purpose to prevent the reaction of gamma interferon that may take place in the cells in presented of long double strand nucleic acids molecule , like long double strand RNAs .
  • the antisense sequence in a target determinant sequence is designed to be preferably at least 60% similarity, more preferably at least 65% similarity, more preferably at least 70% similarity, more preferably at least 75% similarity, more preferably at least 80% similarity, more preferably at least 85% similarity , more preferably at least 90% similarity, more preferably at least 95% similarity to a corresponding target sequence in the protein-encoding RNA for which protein synthesis efficiency is to be increased, as long as the antisense sequence can hybridize to the target sequence in the protein-encoding RNA and / or to the plasmid-derived RNA that contain s the target sequence .
  • I t is specifically preferable that the antisense sequence in the target determinant sequence be designed to be thoroughly identical with the corresponding sequence of the target sequence .
  • an antisense sequence in a target determinant sequence can be designed to hybridize with a 5 '- UTR of the protein-encoding RNA for which protein synthesis efficiency is to be increased .
  • This design can be applied to the synthesizing full length encoded-protein .
  • 5 '-UTR may be derived from endogenous sequence in a cell or artificial sequence .
  • the antisense sequence in the target determinant sequence may be designed to be hybridizable with other regions , except the 5 '-UTR, of the target RNA, such as a coding region of the target RNA .
  • the antisense sequence in the target determinant sequence can be designed to be hybridizable with a given part of the coding region of the target RNA . This design is useful for a dystrophin gene or the like in which a protein to be encoded by an RNA is very large and has a domain that exhibits bioactivity by itself.
  • the antisense sequence in the target determinant sequence can be designed to hybridize both the 5' UTR and a part of the other functional part of the sequence, like the coding sequence or the 3' UTRs of the protein coding mRNAs.
  • the regulatory sequence has an activity of increasing of the protein synthesis efficiency.
  • the regulatory sequence may comprise a SINE-derived sequence.
  • SINE-derived sequence may be a tRNA-derived SINE, for example SINE-B2, ID element, MEN, 4.5S1, DlP-derived sequence.
  • 7SL-RNA-derived sequence such as Alu may be comprised in the regulatory sequence.
  • multiple SINE-derived sequences can be included in the regulatory sequence. These multiple SINE-derived sequences may be with combination of different sequences, for example a combination of SINE B2-derived sequence and Alu-derived sequence or a combination of different SINE B2-derived sequence.
  • the SINE-derived sequence indicates a sequence entirely or partially identical with or similar to the consensus sequence of each species of SINE .
  • the SI NE-B2 -derived sequence indicates a sequence entirely or partially identical with or similar to the consensus sequence of a SINE B2.
  • Even a truncated SINE derived sequence against the consensus sequence of SINE can be used as the SINE derived sequence in the present invention as long as a function of increasing the protein synthesize efficiency is kept.
  • SINE-derived sequence may be a sequence which comprises substantially potential predicted structures formed by parts of the SINE sequence s, for example .
  • the examples of the potential predicted structures of SINE B 2 -derived sequence are as shown in (a) and (b) of Fig. 16.
  • the similar sequence indicates a sequence that is at least 25 % similarity, preferably at least 50% similarity, more preferably at least 55% similarity, more preferably at least 60% similarity, more preferably at least 65% similarity, more preferably at least 70% similarity, more preferably at least 75% similarity, more preferably at least 80% similarity, more preferably at least 85% similarity, more preferably at least 90% similarity, more preferably at least 95% similarity to the consensus sequence of the SINE.
  • the sequence of a SINE may deviate from the se conservative con sensus described above .
  • the analysis of the consensus similarity between the SINE B2 sequences of three sequences alone, the SINE B2 fraction of SEQ ID NO:l, SEQ ID NO:3, and another SINE B2 randomly taken from the literature clearly indicates that the SINE B2 fractions alone can share as little as 9 bases out of 36, with only 25% of similarity.
  • the length can be limited to the shortest sequences with similarity to SINE elements, which are capable to cause increased the efficiency of protein synthesis.
  • the functional nucleic acid molecule according to the present invention may include a plurality of regulatory sequences aligned in a tandem manner, for the purpose of further promoting the protein synthesis efficiency.
  • SINE broadly indicates, among non-LTR (long terminal repeat) retrotransposon, an interspersed repetitive sequence (a) which encodes a protein having neither reverse-transcription activity nor endonuclease activity or the like and (b) whose complete or incomplete copy sequences exist abundantly in genomes of living organisms. That is, SINE is a DNA sequence that is inserted into a genome through the reverse transcription from RNA to cDNA, depending on other host factors in these processes.
  • a length of the SINE is not especially limited, but generally, in a range of not less than 20 bp, preferably not less than 30bp, more preferably not less than 50bp, more preferably not less than 50bp, but not more than 700 bp, preferably not more than 600 bp, more preferably not more than 500 bp, more preferably not more than 400 bp.
  • the origin of SINE is not limited, but is generally derived from tRNA and has a sequence having a sequence corresponding to the tRNA on its 5'-terminal side.
  • the SINE may be a 7SL RNA-derived sequence such as Alu, and a 5S rRNA-derived sequence such as SINE 3.
  • the regulatory sequence may be, for example, selected from the following (1) to (5): (1) an RNA, which is encoded by a DNA consisting of the nucleotide sequence shown in SEQ ID No:l
  • RNA which is encoded by a DNA consisting of the nucleotide sequence shown in SEQ ID No:2
  • RNA which is encoded by a DNA consisting of the nucleotide sequence shown in SEQ ID No:3
  • nucleic acids which is at least 25 % similarity to the RNA, which is encoded by a DNA consisting of the nucleotide sequence shown in SEQ ID No: 1, 2 or 3 and (ii) which has a function of increasing the protein synthesis efficiency;
  • nucleic acids (i) which is encoded by an DNA in which not less than 1 but not more than 200 nucleotides are deleted, substituted, added, and/or inserted in the nucleotide sequence shown in SEQ ID No: 1, 2 or 3 and (ii) which has a function of increasing the protein synthesis efficiency.
  • the number of nucleotides to be deleted, substituted, added, and/or inserted is preferably not less than 1 but not more than 175, more preferably not less than 1 but not more than 150, more preferably not less than 1 but not more than 125, more preferably not less than 1 but not more than 100, more preferably not less than 1 but not more than 75, more preferably not less than 1 but not more than 50, more preferably not less than 1 but not more than 30, more preferably not less than 1 but not more than 20.
  • a direction (a sense- strand direction) along which a target protein is translated is defined as " forward direction”
  • the direction opposite to the forward direction is defined as “reverse direction”
  • a positional relationship between the target determinant sequence and the regulatory sequence is not especially limited .
  • the target determinant sequence be located clo ser to a forward-direction side in the functional nucleic acid molecule than the regulatory sequence .
  • the target determinant sequence may be directly linked to the regulatory sequence .
  • a linker sequence and / or the like sequence for connecting the target determinant sequence and the regulatory sequence may be inserted there between .
  • the direction of the SINE-derived sequence which is annotated as forward in the regulatory sequence is oriented in a reverse direction relative to the direction (forward direction as defined above) , wherein SINE-derived sequence is oriented in the same direction of the consensus sequence of SINE. That is, the regulatory sequence of the functional nucleic acid molecule is oriented in a forward direction relative to the direction of translation.
  • the SINE-derived sequence in this invention wherein its 5' to 3'orientation accords with the SINE consensus sequence, is embedded in the reverse direction of the functional nucleic acid molecule in this invention.
  • Abox site of SINE B2-derived sequence is located on the 3' side of the functional nucleic acid molecule compared to Bbox site of SINE B2-derived sequence.
  • a method according to the present invention for producing a functional nucleic acid molecule comprises the step of preparing the aforementioned RNA molecule.
  • the functional nucleic acid molecules may be prepared by a well-known nucleic acid biosynthesis method, or such a method that (i) a DNA molecule encoding the functional RNA molecule is produced and (ii) the DNA molecule is transcribed into the functional RNA molecule, for example.
  • a size of the functional nucleic acid molecule is not especially limited, but the functional nucleic acid molecule has a size of preferably not more than 2000 nucleotides, more preferably not more than 250 nucleotide s, for example , from the viewpoint of producing the functional nucleic acid molecule by the nucleic acid biosynthesis method .
  • a D NA molecule according to the present invention encodes any one of the aforementioned functional nucleic acid molecules according to the present invention .
  • an expression vector according to the present invention is an RNA vector comprising any one of the aforementioned functional RNA molecules of the present invention or a DNA vector comprising the DNA molecule according to the present invention .
  • a composition for increasing protein synthesis efficiency according to the present invention comprises any one of the aforementioned functional nucleic acid molecules or the aforementioned expression vector.
  • the composition according to the present invention may comprise a translation agent based on in vitro system like reticulocyte extract to produce protein in vitro ; or to produce protein in vivo in mammalian cells expressing a protein for industrial use, for re search purpose , or for any other screening, for example .
  • a translation agent based on in vitro system like reticulocyte extract to produce protein in vitro ; or to produce protein in vivo in mammalian cells expressing a protein for industrial use, for re search purpose , or for any other screening, for example .
  • the backbone of the expression vector according to the present invention is not e specially limited to any particular type , and may be appropriately selected from a plasmid vector.
  • the plasmid vector may be a mammalian , yeast, insect expression vector, a virus vector (for example a lentiviral or retroviral expression vector, adenovirus or adeno-associated virus vectors) , a phage vector, a cosmid vector, and the like , depending on types of host cells to be used and the purpo se of use .
  • the present invention may be prepared in a form of a virus vector, such as an adenovirus or adeno-associated vector or a lentivirus vector.
  • a virus vector such as an adenovirus or adeno-associated vector or a lentivirus vector.
  • the expression vector may ultimately be integrated in the genome of the expressing cells or organism to be targeted .
  • a method for increasing protein synthesis efficiency according to the present invention comprises the step of allowing a functional nucleic acid molecule according to the present invention or the aforementioned expression vector to coexist with a protein-encoding RNA for which protein synthe sis efficiency is to be increased .
  • This step can be carried out in vivo or in vitro using, for example , cell-free protein synthesis system .
  • in vivo means a system of using either cell culture or whole animal specifically
  • in vitro means a system using cell-free assay specifically .
  • the functional nucleic acid molecule or the aforementioned expres sion vector may be allowed to coexist, in an isolated cell or tissue , with a protein- encoding RNA for which protein synthe sis efficiency is to be increased
  • the functional nucleic acid molecule or the aforementioned expre ssion vector may be allowed to coexist, in a living organism , with an RNA for which protein synthe sis efficiency is to be increased .
  • the method for increasing protein synthe sis efficiency may comprise transfecting into a cell an aforementioned expre ssion vector encoding the functional nucleic acid molecule or the functional nucleic acid molecule itself so as to allow the functional nucleic acid molecule to coexist with the protein-encoding RNA .
  • the "cell” indicates not only an isolated cell but also cells constituting an individual .
  • the RNA for which protein synthe sis efficiency is to be increased may be derived from an endogenous sequence in a cell or an RNA encoding a protein synthe sized artificially .
  • the transfection (or gene induction) of a nucleic acid molecule into a cell may be carried out appropriately by conventional methods , for example , self-infection by a vector, a microinjection technique, a lipofection technique, an electroporation technique, a calcium phosphate method, transduction of a virus and the like.
  • the vector may or may not be permanently integrated in the host genome.
  • the cells may be derived from any one of cells from any organism including animals and plants, or any one of cells selected from the established cell lines.
  • animals include vertebrate, preferably mammals including a human, but are not limited to these examples.
  • plants include both monocotyledons and dicotyledons.
  • the plants are crop plants (for example, cereals and pulses, maize, wheat, potatoes, tapioca, rice, sorghum, millet, cassava, barley, or pea), or other legumes.
  • the plants may be vegetables or ornamental plants.
  • the plants of the invention may be: corn (Zea mays), canola (Brassica napus, Brassica rapa ssp.), flax (Linum usitatissimum) , alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cerale), sorghum (Sorghum bicolour, Sorghum vulgare), sunflower (Helianthus annus), wheat (Tritium aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato, (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium hirsutum), sweet potato (Lopmoea batatus), cassava (Manihot esculenta), coffee (Cofea spp.), coconut (Cocos nucifera), pineapple (Anana comosus), citris tree (Citrus spp.), cocoa (Theo
  • the established cell lines including mammalian derived cell such as COS-1 (ATCC No.CRL 1650), COS-7 (ATCC CRL 1651 ), human embryonic kidney line 293 (ATCC NO.CRL 1573), PerC6 (Crucell), baby hamster kidney cell (BHK) (ATCC CRL.1632), BHK570 (ATCC NO: CRL 10314), Chinese hamster ovary cells CHO (e.g.
  • CHO-K1 ATCC NO: CCL 61 , DHFR minus CHO cell line such as DG44, particularly those CHO cell lines adapted for suspension culture, mouse Sertoli cell, monkey kidney cell, African green monkey kidney cell (ATCC CRL-1587), HeLa cell, SH-Y5Y cell, canine kidney cell (ATCC CCL 34), human lung cell (ATCC CCL 75), Hep G2 and myeloma or lymphoma cells e.g. NSO (see US 5,807,715), Sp2/0, YO, other animals derived cells such as Sf9 cell,DT40, but are not limited to these examples.
  • the established cell lines can be hybridoma or a cell given a particular feature by gene transfer, nuclear transfer and/or treatment of chemical compound, for example a nuclear transfer embryonic stem cell or an iPS cell(WO2007/ 069666, JP-A 2010-273680, JP-A 2010-284088, JP-A 2011-50379, JP-A 2011-4674, etc), a neuronal cell differentiated from neural stem cell, iPS cell or the like, or neuronal cells derived from re-programmed fibroblasts or the like, but are not limited to these examples.
  • a nuclear transfer embryonic stem cell or an iPS cell WO2007/ 069666, JP-A 2010-273680, JP-A 2010-284088, JP-A 2011-50379, JP-A 2011-4674, etc
  • a neuronal cell differentiated from neural stem cell iPS cell or the like
  • neuronal cells derived from re-programmed fibroblasts or the like but are
  • the protein synthesis efficiency increasing method according to the present invention optimally contributes to increase the efficiency of the translation from RNA.
  • the increase of the protein synthesis efficiency indicates that the protein synthesis efficiency is increased as compared with a case where the functional nucleic acid molecule according to the present invention or aforementioned expression vector is not allowed to coexist with the target RNA in a system. How much the protein synthesis efficiency is to be increased is not limited especially. However, it is preferable that an amount of a protein to be synthesized by the protein synthesis efficiency-increasing method be at least 1.5 times, more preferably at least 2 times more than an amount of a protein to be produced in the case where the functional RNA molecule is not allowed to coexist with the target RNA in the system.
  • a quantitative ratio between the functional nucleic acid molecule (or the expres sion vector) and the target RNA is not e specially limited .
  • the quantitative ratio between them may be , for example , 1 : 1 to 1 : 10.
  • the aforementioned protein synthesis efficiency-increasing method according to the present invention can be used as a protein synthesis method . That is, a protein synthesis method according to the pre sent invention is a method for producing a target protein , comprising the step of increasing the protein synthesis efficiency by any one of the aforementioned protein synthesis efficiency-increasing methods . It is preferable that the protein synthesis method allow for efficient synthe sis of the target protein through the increasing the efficiency of protein translation from the target RNA .
  • one example of the protein to be synthe sized is an antibody, particularly synthe sizing a light or a heavy chain or both of the antibody or single chain recombinant version of an antibody.
  • the synthesis of the antibody is carried out preferably in an in vitro system or in an isolated cell system so that a functional nucleic acid molecule according to the present invention or aforementioned expre ssion vector can be allowed to coexist, in the system, with a target RNA for which protein synthesis efficiency is to be increased.
  • the protein synthesis efficiency-increasing method according to the present invention can be used for treatment of a disease caused by a quantitative decrease in a predetermined normal protein, for example.
  • the disease is not especially limited, but may be, for example; myodegeneration such as muscular dystrophy; neurodegenerative disease such as Alzheimer's disease, Parkinson's disease, Amyotrophic Lateral Sclerosis, and triplet repeat diseases both at the protein encoding level (i.e. Huntington's disease) or at DNA/RNA level (i.e. Fragile X).
  • a tumor can be also applied to the present invention through the increase of expression of a pro-apoptotic protein or a tumor suppression protein for tumor treatment as for instance for p53 family members.
  • Such a tumor including a cancer, may be any one of tumors including without limitation carcinoma, melanoma and sarcoma, bladder carcinoma, brain tumor, breast tumor, cervical tumor, colorectal tumor, esophageal tumor, endometrial tumor, hepatocellular carcinoma, gastrointestinal stromal tumor, laryngeal tumor, lung tumor, osteosarcoma, ovarian tumor, pancreatic tumor, prostate tumor, renal cell carcinoma, skin tumor, or thyroid tumor.
  • tumors including without limitation carcinoma, melanoma and sarcoma, bladder carcinoma, brain tumor, breast tumor, cervical tumor, colorectal tumor, esophageal tumor, endometrial tumor, hepatocellular carcinoma, gastrointestinal stromal tumor, laryngeal tumor, lung tumor, osteosarcoma, ovarian tumor, pancreatic tumor, prostate tumor, renal cell carcinoma, skin tumor, or thyroid tumor.
  • the treatment method comprises the step of increasing the protein synthesis efficiency by the aforementioned protein synthe sis efficiency-increasing method which comprises allowing a functional nucleic acid molecule according to the present invention or aforementioned expre ssion vector to coexist, in a body of a subj ect, with a target RNA .
  • the functional nucleic acid molecule itself or an aforementioned expression vector is transfected into a cell of the subj ect.
  • the target RNA may be an endogenous RNA (mRNA or the like) in the cell of the subj ect or artificially synthesized RNA .
  • the target RNA or a DNA molecule encoding the RNA may be transfected into the cell of the subj ect .
  • the protein synthesis efficiency-increasing method according to the present invention is applicable to treatment of a disease by amplifying in a body of a subj ect a protein factor (e . g. , interferon , an apoptosis-inducing factor, or the like) that ameliorates the disease .
  • a protein factor e . g. , interferon , an apoptosis-inducing factor, or the like
  • an apoptosis-inducing factor amplified in accordance with the present invention can be effectively used for treatment of tumors or the like .
  • the treatment method may comprise the step of allowing a functional nucleic acid molecule according to the present invention or aforementioned expression vector to coexist with a target RNA encoding a protein that ameliorates a disease in a body of a subj ect, wherein the target RNA hybridizes the antisense in the target determinant sequence of the functional nucleic acid molecule .
  • the functional nucleic acid molecule itself or the aforementioned expression vector is transfected into a cell of the subj ect.
  • the RNA encoding the protein that ameliorates the disease may be an endogenous RNA in the cell of the subj ect .
  • the RNA encoding the protein that ameliorates the disease or a DNA molecule encoding the RNA may be transfected into the cell of the subj ect .
  • any of the aforementioned treatment methods can be carried out as a pretreatment to an isolated cell to be transplanted into a body of the subj ect.
  • the cell may be isolated from the body of the subj ect before treatment and transplantation .
  • the aforementioned treatment methods may be a treatment method comprising the steps of (a) allowing a functional nucleic acid molecule according to the present invention or aforementioned expression vector to coexist in an isolated cell with a target RNA; and (b) , after the step (a) , transplanting the cell into a body of a subj ect.
  • An isolated cell may be a cell which has the ability of differentiation , for example an Embryonic Stem cell (ES cell) , an Embryonic Germ cell (EG cell) , a somatic stem cell , especially a multi potent adult progenitor cell, stem cell, a hematopoietic stem cell, a vascular endothelia stem cell, a mesenchymal stem cell, a hepatic stem cell, a neural stem cell, an endothelial stem cell, a pancreatic stem cell, a primordial germ cell, or a multilineage-differentiating cell like a Muse cell (Kuroda et al., 2010, PNAS).
  • ES cell Embryonic Stem cell
  • EG cell Embryonic Germ cell
  • somatic stem cell especially a multi potent adult progenitor cell, stem cell, a hematopoietic stem cell, a vascular endothelia stem cell, a mesenchymal stem cell, a
  • an isolated cell may be also an artificial undifferentiated cell, for example a nuclear transfer embryonic stem cell or a cell acquired the pluripotent ability by gene transfer and/or treatment of chemical compound, like an induced pluripotent stem cell (iPS cell (WO2007/ 069666, JP-A
  • an isolated cell may also be a fibroblast or an adult somatic cells that acquired the ability to become another somatic cells upon reprogramming. Additionally, after the step (a) but before the step (b), the isolated cell may be grown undifferentiated. Alternatively, after the step (a) but before the step (b), the isolated cell may be differentiated to obtain a differentiated cell or a group of differentiated cells (cell sheet or the like), and the differentiated cell or the group of differentiated cells may be transplanted into the body.
  • the subject indicates animals, wherein the animals include a human, preferably mammals including a human, more preferably a human. Further, the subject generally encompasses (a) one who has already shown the symptoms of a disease and (b) one who has a genetic predisposing cause but has not shown the symptoms of a disease yet.
  • treatment in the present invention includes therapeutic treatment and preventive treatment of a disease .
  • the FANTOM2 clone Rik6430596G22 was identified as a putative spliced AntiSense (AS) noncoding RNA (ncRNA9 of the Ubiquitin Carboxy Terminal Hydrolase 1 (UCHL l ) gene 7 (Experiment 1 ) .
  • AS AntiSense
  • ncRNA9 of the Ubiquitin Carboxy Terminal Hydrolase 1
  • UchL l is a neuron-re stricted protein that acts as deubiquinating enzyme , ubiquitin ligase or monoubiquitin stabilizer (Reference 1; Liu, Y., Fallon, L., Lashuel, H.A., Liu, Z. & Lansbury, P.T., Jr.
  • the UCH-L1 gene encodes two opposing enzymatic activities that affect alpha-synuclein degradation and Parkinson's disease susceptibility.
  • Ubiquitin carboxy-terminal hydrolase LI binds to and stabilizes monoubiquitin in neuron. Hum Mol Genet 12, 1945-1958 (2003).). It is mutated in an autosomal dominant form of PD (PARK5) (Reference 3; Leroy, E., et al. The ubiquitin pathway in Parkinson's disease. Nature 395, 451-452 (1998).).
  • Rik6430596G22 is a typical 5' head to head transcript that initiates within the second intron of Uchll and overlaps the first 72 nts of the Sense (S) mRNA including the AUG codon (Experiment 1).
  • the non overlapping part of the transcript also contains two embedded repetitive sequences, SINEB2 and Alu, identified by Repeatmasker.
  • the FANTOM2 cDNA clone spans a genomic region of 70kb and is a spliced transcript composed of four exons whose intron-junctions follow the traditional GT-AG rule (Experiment 2).
  • Rik6430596G22 is referred as a natural AntiSense transcript to Uchll (AS Uchll).
  • AS Uchll increases UchLl protein levels with a mechanism that requires an embedded inverted SINEB2 repeat.
  • A-SINEB2 mutant has a dominant negative activity on the full-length AS Uchll.
  • deletion mutant A-SINEB2 lacks 170 nucleotides potentially impairing AS Uchll RNA secondary structure, a mutant was produced with the SINEB2 sequence flipped in between nucleotide 764-934. Interestingly, SINEB2 flip was unable to increase UchLl protein levels thus proving the orientation-dependent activity of the SINEB2 domain embedded within AS Uchll (Experiment 6).
  • the FANTOM3 collection of non-coding cDNAs was bioinformatically screened for other examples of natural AS transcripts that contain SINEB2 elements (B3 subclass) in the correct orientation and 5' head to head overlapping to a protein coding gene. This identified 31 S/AS pairs similar to the Uchll/AS Uchll structure (Experiment 7).
  • AS Uchll is a nuclear-enriched transcript expressed in dopaminergic neurons.
  • transcripts for Uchll and AS were expressed in the same DA neurons of the SN.
  • transcripts for the S/AS pair were prevalently localized in two different subcellular compartments: mature Uchll mRNA was mainly observed in the cytoplasm, while the AS RNA was nuclear, accumulating in specific subnuclear regions (Experiment 9). 50% of cellular transcripts have been recently found enriched in the nucleus representing mainly ncRNAs with unknown function.
  • RNAs tend to accumulate in areas, called paraspeckles, that strongly resemble sites of AS Uchll localization and which association is regulated by embedded SINEs (Reference 7; Chen, L.L., DeCerbo, J.N. & Carmichael, G.G. Alu element-mediated gene silencing. Embo J 27, 1694-1705 (2008).).
  • TSS transcriptional start site
  • a 70-kb region of the mouse genome encompassing the AS UchLl locus was then compared to the corresponding human genomic sequence using Genome Vista alignment (http:/ / genome.lbl.gov/ cgi-bin/ GenomeVista) .
  • Genome Vista alignment http:/ / genome.lbl.gov/ cgi-bin/ GenomeVista
  • a 1.6 kb non-coding transcript 5' head to head AS to human UCHL1 gene, was cloned from human brain RNA.
  • the anatomical organization of hAS UCHL1 gene was very similar to its mouse counterpart including the extension of the S/AS pair overlapping region as well as the presence of embedded repetitive elements.
  • hAS UCHL1 expression was highly restricted to neuronal tissues as found for mouse.
  • UCH-L1 protein synthesis is increased upon rapamycin treatment through nucleus-cytoplasmic shuttling of AS Uchll RNA and AS-dependent recruitment of Uchll mRNA to active polysomes.
  • AS ncRNA is able to increase S protein levels with no change in the quantity of S mRNA. Since in physiological conditions S mRNA and AS ncRNA seem to be localized in different subcellular compartments, several stressors that have been implicated in PD pathogenesis for their ability to redistribute the nuclear AS ncRNA into the cytoplasm, where translation takes place, were assayed. MN9D cells were exposed to hydrogen peroxide ImM, serum starvation, rapamycin 1 ug/ml, tunycamycin 20nM and TNFalpha 20 nM for 45 minutes and AS Uchll mRNA content was independently measured in the cytoplasm and nucleus by qRT-PCR. The majority of treatments had no effect, however rapamycin strongly up-regulated the amount of AS Uchll cytoplasmic mRNA (Experiment 10) .
  • Rapamycin is a well known inhibitor of CAP-dependent translation through its effect on mTORCl and subsequent repression of S6K and 4E-BP1 activities. It is currently tested as anti-cancer drug and proposed for clinical trials for neurodegenerative diseases. Block of translation initiation mediated by rapamycin is able to rescue DA cell loss observed in knock-out flies for parkin and pinkl as well as in those over-expressing the dominant PD-associated mutation of LRRK2 (Reference 8; Tain, L.S., et al. Rapamycin activation of 4E-BP prevents parkinsonian dopaminergic neuron loss. Nat Neurosci 12, 1129-1135 (2009).).
  • RTP801 is elevated in Parkinson brain substantia nigral neurons and mediates death in cellular models of Parkinson's disease by a mechanism involving mammalian target of rapamycin inactivation. J Neurosci 26, 9996-10005 (2006).) ⁇ Recently, rapamycin was shown to prevent L-DOPA-induced dyskinesia, a common severe motor side effect of the symptomatic treatment for PD (reference 11; Santini, E., Heiman, M., Greengard, P., Valjent, E. 8s Fisone, G. Inhibition of mTOR signaling in Parkinson's disease prevents L-DOPA-induced dyskinesia. Sci Signal 2, ra36 (2009).).
  • AS Uchll were confirmed by the presence of a concomitant decrease in its nuclear steady state levels, and by the absence of any de-novo transcription of AS Uchll (Experiment 10). Total cellular content of these transcripts remained constant. Uchll mRNA showed no changes in subcellular distribution, de novo transcription or total cellular content.
  • Stable MN9D cell lines were then established expressing constitutively shRNA for AS Uchll, targeting the AS Uchll promoter region from -4 to + 15 nt around the RACE-validated TSS (Reference 12; Hawkins, P.G., Santoso, S., Adams, C, Anest, V. 85 Morris, K.V. Promoter targeted small RNAs induce long-term transcriptional gene silencing in human cells. Nucleic Acids Res 37, 2984-2995 (2009)).
  • mTORCl signaling is required for proliferation and controls CAP-dependent translation machinery through the phosphorylation of its downstream substrates 4E-BPs and S6K.
  • the cytostatic drug rapamycin inhibits mTORCl activity leading to block of CAP-dependent translation.
  • AS transcription is required for protein synthesis of selected mRNAs .
  • the nuclear-enriched ncRNA AS Uchl l is transported into the cytoplasm where it recruits mRNAs of its S protein-encoding partner to polysomes for translation .
  • AS Uchl l is thus the repre sentative member of a new functional class of ncRNAs that are associated to S / AS pairs in the mammalian genome and appears to be composed by two domains .
  • the overlapping region at the 5 ' provide s specificity to a protein-encoding mRNA partner transcribed from the complementary strand .
  • An inverted SINEB2 element at 3 ' is required for translational activation, representing a new function for embedded SINEB2 in the cytoplasm .
  • Rapamycin is currently under intense scrutiny in biomedical research both as neuroprotective agent for neurodegenerative diseases and as anti-cancer drug.
  • mice rapamycin prevents L- D O PA-induced dyskinesia, a common severe motor side effect of the symptomatic treatment for PD .
  • it protects neurons from apoptosis both in Drosophila genetic models as well as upon neurochemical intoxication in mammals making it an attractive molecule for anti-parkinsonian therapies (Reference 11; Santini, E et al., (2009)). It is thus important to better understand its modes of action in vivo and its interplay with pathways involved in familiar cases of PD, as shown here for Uchll.
  • the role of AS transcription in rapamycin-induced protein synthesis adds an unexpected switch to its activities.
  • EGFP enhanced green fluorescent protein
  • the expression of the artificial AS for up-regulating EGFP expression was designed.
  • the fragments encoding the artificial AS was cloned into pcDNA3.1- vector (Invitrogen) . This proves that a functional nucleic acid molecule with a target determinant sequence and a regulatory sequence can increase protein synthesis efficiency of any gene of interest.
  • the antibody can be applied as shown in Experiment 1 5.
  • An artificial AS for up-regulating a recombinant antibody was de signed to target the leader sequence of the recombinant antibody (overlap is 72bp around the ATG) and embedded into the vector (AS Fc) .
  • An artificial AS comprising a scramble sequence as the target determinant sequence was also produced as control (Fig. 1 5) .
  • the target sequence of the antibody was included in pHYGRO vectors (pHYGRO) .
  • HEK cell line was co-tran sfected with pHYGRO and AS Fc or control .
  • Transient transfection in HEK cells produced an AS Fc specific upregulation of the recombinant antibody in cell lysates .
  • AS Fc increases the encoded protein levels in transfected H EK cells while a scramble overlapping sequence or an empty plasmid does not, detected through the SV5 tag.
  • HEK cell line was transfected with EGFP expression vector pEGFP- C2 (Clontech) with Lipofectamine 2000 (Invitorgen) in accordance with manufacture 's instructions . Then , the transfectants which stably expres s low EGFP expres sion were selected .
  • AS GFP comprises target determinant sequence against EGFP and it was artificially designed to increase the efficiency of EGFP protein synthesis (Fig . 16) .
  • the stable transfectants were further transfected with the vector encoding AS GFP or control vector. After 24 hours or 48 hours from the transfection of AS GFP construct or control vector, the cells were collected and lysed . The GFP level in the cell lysate was monitored by western blotting. The low expre ssion of EGFP in the transfectant was increased by transfection of the AS GFP construct (Fig. 16) .
  • the new type of AS which the inventors found can be artificially de signed as long as the functional nucleic acid molecule includes a target determinant sequence comprising an antisense sequence to a target sequence in the protein- encoding RNA for which protein synthesis efficiency is to be increased and a regulatory sequence having an activity of increasing of the protein synthesis efficiency.
  • RACE fragment The 5 ' UTR of AS Uchl l was amplified by RACE PCR (GeneRacer, Invitrogen) by MN9D total RNA and cloned into pGEM®-T Easy vector (Promega).
  • Full length AS Uchll Full length DNA sequence of AS was amplified via fusion PCR starting from RACE fragment and FANTOM clone Rik 6430596G22 with following primers For mAS Uchll fl 5'-ACAAAGCTCAGCCCACACGT- 3' (SEQ ID No: 13) and Rev mAS Uchllfl 5'-CATAGGGTTCATT -3'(SEQ ID No: 14).
  • Uchll Mouse Uchll mRNA was cloned from FANTOM 2900059022 with following primers: For mUchll 5'-ATGCAGCTGAAGCCGATG-3'(SEQ ID No: 15) and Rev mUchll 5 '-TTAAGCTGCTTTGCAGAGAGC-3' (SEQ ID No: 16)
  • AS Uchll shRNA Oligo containing the sequence -14/+4 around the TSS of AS Uchll CGCGCAGTGACACAGCACAAA (SEQ ID No: 17) are cloned into pSUPER.retro.puro vector (OligoEngine, Seattle, WA), scrambled sequence was used as control.
  • PCR fragment I For mAS Uchll fl and Rev pre-SINE B2 5'-CAATGGATTCCATGT-3' (SEQ ID No:20).
  • PCR fragment II For post-ALU 5 '-GATATAAGGAGAATCTG-3' (SEQ ID No:21) and Rev mAS fl.
  • PCR fragment I mAS Uchll fl and Rev pre-Alu 5'- TTATAG TATGTGTTGTC-3' (SEQ ID No:22).
  • PCR fragment II For post-ALU 5 '-GATATAAGGAGAATCTG-3' (SEQ ID No:23) and Rev mAS fl cloned into EcoRI-Hindll site.
  • PCR fragment I For mAS Uchll fl and and Rev pre-SINE B2 5'-CAATGGATTCCATGT-3' (SEQ ID No:24).
  • PCR fragment II For post-SINE B2 5'- GAATTCCTCCAGTCTCTTA -3' (SEQ ID No:25) and Rev mAS fl.
  • AS uchll (Alu + SINEB2) flip PCR fragment I: obtained with For SINE B2 inside 5'-TGCTAGAGGAGG-3' (SEQ ID No:26) and Rev Alu flip 5'- GTCAGGCAATCC -3' (SEQ ID No:27) are cloned in the unique EcoRI site of AS Uchll ⁇ ( Alu + SINEB2).
  • AS uchll SINEB2 flip PCR fragment obtained with For SINE B2 inside 5'-TGCTAGAGGAGG-3' (SEQ ID No:28) and Rev SINE flip 5'-AAAGAGATGGC-3' (SEQ ID No:29) are cloned in the unique EcoRI site of AS Uchll ⁇ (SINEB2).
  • Cells MN9D cells were seeded in 10 mm petri-dishes in Dulbecco's modified Eagle's medium containing 10% of fetal bovine serum and, penicillin (50 units/ml), streptomycin (50 units/ml). Treatments were done by adding Rapamycin (R0395, Sigma) at final concentration of lug/ml in fresh medium for 45 minutes.
  • MN9D stable cells siRNA -15/+4, siRNA scrambled, pcDNA 3.1- and ⁇ SINE B2
  • MN9D cells were seeded in 100mm petri-dishes and transfected with Lipofectamine 2000 (Invitrogen) according to manufacturer's instruction, the day after cells seeded for selection with 500uM of Neomycin (#N1142, Sigma).
  • HEK-293T cells were grown in DMEM (GIBCO) supplemented with 10% fetal bovine serum (Sigma-Aldrich), 100 units/mL penicillin, and 100 ⁇ /mL streptomycin (Sigma) at 37 °C in a humidified CO2 incubator.
  • Uchll sense 5'- CCCGCCGATAGAGCCAAG (SEQ ID No:38), antisense 5'-ATGGTTCACTGGAAAGGG-3' (SEQ ID No:39).
  • ASUchll pre RNA 5'-CCATGCACCGCACAGAATG-3' (SEQ ID No:40), antisense 5 '-GAAAGCTCCCTCAAATAGGC-3 ' (SEQ ID No:41).
  • Pre_A0ribosomal RNA sense
  • AS_Uxt sense5'-CAACGTTGGGGATGACTTCT (SEQ ID No:44), antisense5'-TCGATTCCCATTACCCACAT (SEQ ID No:45);
  • Multiplex RT PCR was performed with Superscript® III One-Step RT-PCR System with Platinum® Taq DNA Polymerase (Invitrogen) .500 mg of total DNAse traeated RNA was incubated with reverse primers for Gapdh, Uchll, AS Uchll. The reaction was performed for 60 minutes at 60 degrees.
  • the PCR reaction comprised 40 cycles of 95 degrees for 15 seconds, followed by 60 degrees for 45 seconds, and final 68 degrees for 30 seconds.
  • Nucleo cytoplasmic fractionation was performed using Nucleo Cytoplasmic separation kit (Norgen) according to manufacturer's instruction. RNA was eluted and DNAsel treated. The purity of the cytoplasmic fraction was confirmed by Real Time qRT-PCR on Pre-ribosomal RNA. Two colour In situ hybridization (ISH)
  • Reagents anti DIG antibody D8156 (Sigma); streptavidin HRP RPN 1231-100UL (Amersham Bioscience) ; DIG labeling mix #11277073910 (Roche) BlO-labelling Mix #11685597 910 (Roche), Ribonucleic acid, transfer from baker's yeast R8759 (Sigma), Deoxyribonucleic acid, single stranded from salmon testes D7656 (Sigma), Blocking reagent #11096 176 001 (Roche), TSA Cy3 system (Perkin Elmer, Heidelberg, Germany) .
  • Hybridization was performed with probes at a concentration of 1 mg/ml (Uchll) and 3 mg/ml for AS Uchll at 60°C for 16 h.
  • streptavidin-HRP was used 1:250 for 2 hours in TNB buffer (Tris HC1 PH 7,5 lOOmM, NaCl 150 mM, 0,5% Blocking Reagent), and signals are visualized using the TSA Cy3 system after washing in TNT buffer (Tris HC1 PH 7,5 lOOmM, NaCl 150 mM, 0,05% tween).
  • ISH on DIG-labeled probe was performed by incubating slices with monoclonal anti-DIG antibody after TSA reaction.
  • slice were incubated with the antibody anti TH (#AB152, Chemicon) 1:1000. Signals are then detected with fluorescent dye-conjugated secondary antibody goat anti-rabbit 405 and goat anti-mouse 488. Sections were then washed, mounted with Vectashield (Vector lab) mounting medium and observed at confocal microscope (Leica).
  • the inventors searched for FANTOM3 full-length cDNAs that were non-coding RNAs and overlap the 5' end of coding transcripts in a head to head configuration [PMID: 16141072].
  • the filtered set of 8535 FANTOM3 ncRNA transcripts described in the Nordstrom et al 2009 (Nordstrom, K.J., et al. Critical evaluation of the FANTOM3 non-coding RNA transcripts. Genomics 94, 169-176 (2009).) was used as our starting point. Genomic locations of these ncRNA transcripts and REFSEQ (Maglott, D.R., Katz, K.S., Sicotte, H. & Pruitt, K.D.
  • NCBI's LocusLink and RefSeq. Nucleic Acids Res 28, 126-128 (2000)) coding transcripts were extracted from the alignments in the UCSC Genome browser (Kent, W.J., et al. The human genome browser at UCSC. Genome Res 12, 996-1006 (2002)) to identify a set of 788 coding-sense: non-coding-antisense pairs. The ncRNAs were then checked by repeat masker to identify SINEB2 related sequences (Smit, AFA, Hubley, R 86 Green, P. RepeatMasker Open-3.0.1996-2010
  • the following is a list of sequences that are complementary to protein coding mRNAs. They contain a fraction that provides examples of a target determinant sequence [now in light blue highlight] and a regulatory sequence [how highlighted in red].
  • the regulatory sequence in this list of natural antisense is as short at 89 nucleotides in this example.
  • the length of the adaptor sequences in this partial list of antisense RNAs is as short as 44 nt.
  • ⁇ Th boxed nucleotide CAT is complementary to the CDS starting ATG
  • KatiiK 25p43g -matrix
  • A.K029359.1 259 GC CAC-TGCTCTTAACTACTGA5GTG CATTTCT 250
  • AED2935 .1 314 AGTACCCACAGAGACTAGAAGAGGG-GGCAGATCTCC GAG S54 i i i i i i v i i ii C B 3 tS IHE ,'B2 139 TGCGTGCCTGGTGCCCGCGGAG CC GAAGAGGGCGTCGGATCCCCTGGA 11 AE029355.1 855 ACTGGAGTTA A ⁇ GC1 GTGAGCTGC ATGTGGATGC TGGAAATCAAA 901 v i i i C B3#SIME/B2 109 ACTGGAGT C GAT GT GTGAGCCGCC T GGT CTGGGAATCGAA SO AK029359.1 902 CCAGGTCCTT GGAAG - GCAGGC GT TC T A C T GAA C T T 950 i i - - i iv iv
  • SINE B2 embedded in cD NA clone s sequence are as following, but is limited to them .
  • NM_175 SINE/ 10 >A 132737_1829 551 1829 1928 -480 + B3 B2 1 213 -3 1928_+_B3 NM_007 SINE/ >AK133325_951_1 921 951 1 134 - 1650 + B3A B2 3 187 - 1 1 134_+_B3A
  • RNA nucleic acid molecule having a function of improving efficiency of translation from an RNA, and a use thereof.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Developing Agents For Electrophotography (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention provides (a) a functional nucleic acid molecule comprises: a target determinant sequence comprising antisense sequence to a target sequence in the protein-encoding RNA for which protein synthesis efficiency is to be increased and a regulatory sequence having an activity of increasing of the protein synthesis efficiency, and (b) a use of the functional nucleic acid molecule.

Description

Description
Title of Invention
FUNCTIONAL NUCLEIC ACID MOLECULE AND USE THEREOF
Technical Field
The present invention relates to (a) a functional nucleic acid molecule having a function of increasing the protein synthesis efficiency, and (b) a use of the functional nucleic acid molecule.
Background Art
There are various types of functional nucleic acid molecules, typified by relatively long functional RNA molecules such as antisense RNA, for example. Other typical examples of the functional nucleic acid molecules are relatively short functional RNA molecules such as shRNA (short hairpin RNA), siRNA (small interfering RNA), and miRNA (micro interfering RNA). These functional RNA molecules are generally known to contribute to down-regulation of gene expression. Various examples have been broadly reviewed as "interfering RNA" like in (Non Patent Literature 1).
An antisense RNA technique is excellent in target specificity. However, this technique has a disadvantage that an antiviral re sponse in a cell is activated . In contrast, the technique using the relatively short functional RNA molecules such as shRNA does not activate the antiviral re sponse practically. Instead , the relative short functional RNA molecules have the po ssibility of causing the off-target effects because it is difficult for short sequence length to keep high specificity to the target sequences . Thus, the relatively short functional RNA molecules tend to exhibit poor target specificity as compared with the antisense RNA technique .
Patent Literature 1 discloses a functional nucleic acid molecule (D NA molecule) comprising: a pol III type III promoter; a sequence identical or complementary to a target sequence that performs downregulation ; and a 7 SL small-RNA derived sequence (more specifically, a fragment of an Alu derived sequence) including at least binding domains to srp9 and srp l 4 proteins . The srp9 and srp l 4 protein s are members of a family of proteins that bind to a 7 SL RNA in gene transcription to form a 7SL RNA complex.
It is described that the functional nucleic acid molecule disclosed in Patent Literature 1 is used as a gene expres sion downregulation technique in which an RNA molecule transcribed from the functional nucleic acid molecule practically cause s no antiviral response activation and has excellent target specificity. Alu is classified into one group of SINEs (Short Interspersed Elements). Note that the Alu derived sequence of the functional nucleic acid molecule disclosed in Patent Literature 1 is inserted in a particular orientation and considered to be involved in RNA stability.
On the other hand, it has been reported that some small RNA molecules can also enhance the level of transcription.
Citation List
Patent Literature 1
International Publication WO 2008/113773 A2 (Publication Date: September 25, 2008)
Non Patent Literature 1
He L, Hannon GJ. Nat Rev Genet.2004 Jul;5(7) :522-31. PMID: 15211354
Summary of Invention
Technical Problem
As widely reported in Patent Literature 1 and other documents, many types of functional nucleic acid molecules that down-regulate gene expression or the like, are well known. Although there have been some techniques for up-regulating gene expression by increasing the transcription efficiency (like in the case of Nature Chemical Biology 3, 166 - 173 (2007), B. Janowski et al), increasing of the transcription efficiency does not always increase the efficiency of protein synthesis in direct proportion because of the plateau effect. In this regard, the synthesis of translated protein may depend on many other factors, including the ability of a given RNA to interact efficiently with the ribosomes. Additionally, increasing transcription of the natural mRNA is not always possible in the cells or organisms. That is, any functional nucleic acid molecule that increases the protein synthesis efficiency directly has not been reported.
The present inventors consider that there are many conditions in which acting only on translation is desired. For instance, enhancement of translation of an animal protein for therapeutic purposes without interfering with its transcription may be highly desired because it does not require reprogramming of mRNA transcription in the nucleus.
The present invention is accomplished in view of the above problem. An object of the present invention is to provide a functional nucleic acid molecule having a function of increasing the protein synthesis efficiency, and a use of the functional nucleic acid molecule. Solution to Problem The present inventors ' current knowledge suggested that translation of protein may be regulated by factors including the structure of the regions of the mRNAs that is placed upstream the tran slated fraction of the mRNAs . This region is known as 5 ' UTR (5 ' untranslated region) . For the purpose of this invention, the 5 ' UTR can be a natural one (found in natural RNAs , from the transcription starting site to the protein initiation codon) , or can be an artificial sequence , such as the sequence pre sent in a cloning vector or any other recombinant sequence .
The pre sent inventors studied diligently to achieve the above obj ect . Con sequently, through analyses of functions of RNA molecules known as non-coding RNAs , the inventors found a surprising fact that a particular structure of such an RNA molecule has a function of increasing the protein synthe sis efficiency. This functional nucleic acid exhibited the effect against a specific targeted protein through antisense sequence to a target sequence . Based on the findings , the inventors have accomplished the pre sent invention .
That is , a functional nucleic acid molecule according to the present invention comprises :
(a) a target determinant sequence comprising antisen se sequence to a target sequence in the protein- encoding RNA for which protein synthe sis efficiency is to be increased ; and (b) a regulatory sequence having an activity of increasing of the protein synthesis efficiency.
In the functional nucleic acid molecule according to the present invention, the regulatory sequence comprises a SINE (Short Interspersed Element)-derived sequence. Specifically, SINE-derived sequence may be a tRNA derived SINE, for example SINE B2, ID element, MEN, 4.5S1, DIP-derived sequence, or sequences that comprise joining separate elements of these sequences or similar sequences. SINE-derived sequence may be a sequence which comprises substantially potential predicted structures formed by parts of the SINE sequences, for example.
In the functional nucleic acid molecule according to the present invention, the regulatory sequence may be selected from the group consisting of the following (1) through (5):
(1) an RNA, which is encoded by a DNA consisting of the nucleotide sequence shown in SEQ ID No:l (SINE/B2 in AS Uchll)
(2) an RNA, which is encoded by a DNA consisting of the nucleotide sequence shown in SEQ ID No:2 (SINE/ B2 , 39nt spacer indicated as underline and SINE/Alu in AS Uchll)
(3) an RNA, which is encoded by a DNA consisting of the nucleotide sequence shown in SEQ ID No:3 (SINE/B2 in AS Uxt)
(4) nucleic acids (i) which is at least 25 % similarity to the RNA, which is encoded by a DNA consisting of the nucleotide sequence shown in SEQ ID No : 1 , 2 or 3 and (ii) which has a function of increasing the protein synthesis efficiency; and
(5) nucleic acids (i) , which is encoded by a DNA in which not le ss than 1 but not more than 200 nucleotide s are deleted , substituted , added , and / or inserted in the nucleotide sequence shown in SEQ ID No : 1 , 2 or 3 and (ii) which has a function of increasing the protein synthesis efficiency.
In the functional nucleic acid molecule according to the present invention , the target determinant sequence comprises an antisense sequence to a target sequence in the protein-encoding RNA for which protein synthesis efficiency is to be increased .
In the functional nucleic acid molecule according to the present invention , the target determinant sequence may be located between a 5 '- terminal and the regulatory sequence in the functional nucleic acid molecule .
In the functional nucleic acid molecule according to the pre sent invention, it is preferable that the antisen se sequence in the target determinant sequence have a length more than 7 nucleotide s but less than 250 nucleotides .
In the functional nucleic acid molecule according to the present invention , it is preferable that the antisense sequence in the target determinant sequence be at least 60% similarity to a target sequence in the protein-encoding RNA or to the plasmid sequence upstream of the ATG in the protein-encoding RNA for which protein synthe sis efficiency is to be increased .
In the functional nucleic acid molecule according to the present invention, it is preferable that the direction of the SINE-derived sequence which is annotated as forward in the regulatory sequence is oriented in a reverse direction relative to the direction (forward direction as defined above) , wherein SINE-derived sequence is oriented in the same direction of the consensus sequence of SINE . That is , the regulatory sequence of the functional nucleic acid molecule is oriented in a direct direction relative to the direction of translation and reverse orientation relative to the direction of transcription of the antisense nucleic acid molecule .
If the direction from 5 ' to 3 ' is defined as the forward direction , the SI NE-derived sequence in this invention , wherein its 5 ' to 3 ' orientation accords with the SI NE consensus sequence , is embedded in the reverse direction of the functional nucleic acid molecule in this invention .
In the functional nucleic acid molecule according to the present invention , the antisense sequence in the target determinant sequence may be de signed to hybridize with a target sequence in the 5 '-UTR of the protein-encoding RNA for which protein synthe sis efficiency is to be increased . Alternatively, the target determinant sequence may be designed to hybridize with a target sequence in the coding region of the protein-encoding RNA for which protein synthesis efficiency is to be increased . In addition , the target determinant sequence may overlap to the sequence of plasmid upstream of the starting codon or including the starting codon in the target sequence of the protein encoding RNA. The functional nucleic acid molecule according to the present invention can be targeted to specific splicing variants at the 5 - ends of the protein coding RNA or in other parts of the molecule .
The functional nucleic acid molecule according to the present invention can be appropriately designed and produced by a skilled person in the related art, as long as the functional nucleic acid molecule includes : a target determinant sequence comprising antisense sequence to a target sequence in the protein-encoding RNA for which protein synthe sis efficiency is to be increased ; and a regulatory sequence having an activity of increasing of the protein synthesis efficiency . Any modification during or po st/ synthesis can be applied to the functional nucleic acid molecule by a skilled person in the related art according to the know/ how in RNA therapeutics or the like .
A D NA molecule according to the present invention encodes any one of the RNA molecules as aforementioned functional nucleic acid molecule s .
An expres sion vector according to the present invention includes any one of the RNA molecules or the D NA molecule as aforementioned functional nucleic acid molecules .
A compo sition for increasing protein synthesis efficiency according to the present invention comprises any one of the aforementioned functional nucleic acid molecules and / or the aforementioned expre ssion vector.
A method for increasing the protein synthe sis efficiency according to the present invention comprises the step of allowing any one of the aforementioned functional nucleic acid molecule s or the aforementioned expre ssion vector to coexist with a protein-encoding RNA for which protein synthesis efficiency is to be increased . The protein-encoding RNA is hybridizable with the antisen se in the target determinant sequence of the functional nucleic acid molecule .
In the protein synthesis efficiency- increasing method of the present invention , the method may comprise the step of transfecting (or transducing) into a cell any one of the aforementioned functional nucleic acid molecules or the aforementioned expre s sion vector.
A protein synthesis method according to the pre sent invention is a method for synthesizing a protein, comprising the step of increasing the protein synthesis efficiency by any one of the aforementioned protein synthe sis efficiency- increasing methods .
A method for treating a disease according to the present invention , wherein the disease is caused by a quantitative decrease in a predetermined normal protein or haploinsufficiency, comprises the step of increasing the protein synthesis efficiency in a subj ect by any one of the aforementioned protein synthe sis efficiency- increasing methods .
In the treatment method according to the present invention , the subj ect may have a disease or a predisposition to the disease , wherein the disease is caused by a quantitative decrease in a predetermined normal protein or haploinsufficiency. Furthermore , the functional nucleic acid molecule may increase the efficiency of synthe sizing of the predetermined normal protein .
Further, in case that the disease is caused by a quantitative decrease in a predetermined normal protein or haploinsufficiency, and caused by a quantitative increase of another protein including an abnormal protein like mutant protein , the treatment method of the present invention can be used in combination with a conventional method for suppre ssing the expres sion of the another protein by siRNA, shRNA, or the like , and / or a conventional method for inactivating a function of a protein by use of an antibody, a low-molecular-weight compound, or the like, as appropriate.
Further, in the treatment method according to the present invention, the disease may be a neurodegenerative disease or cancer, for example.
Advantageous Effects of Invention
According to the present invention, it is successfully possible to provide (a) a functional nucleic acid molecule having a function of increasing the protein synthesis efficiency and (b) a use of the functional nucleic acid molecule.
Brief Description of Drawings
Fig.l
Fig.l, related to the experiment 1, is a schematic diagram of Uchll/AS Uchll genomic organization. Uchll exons are in black; 3' and 5' UTRs in white.
Fig.2
Fig.2, related to the experiment2, is a schematic diagram of AS Uchll domain organization. AS Uchll exons are in grey; repetitive elements are in red (Alu/SINEBl) and blue (SINEB2). Introns are indicated as lines.
Fig.3
Fig.3, related to the experiments, is a view showingfjAS Uchll regulates UchLl protein levels. AS Uchl 1 -transfected MN9D cells show increased levels of endogenous UchLl protein relative to empty vector control, with unchanged mRNA quantity.
Fig.4
Fig.4, related to the experiment4, is a view showingHAS Uchll regulates UchLl protein levels. Increasing doses of transfected AS Uchll titrate quantity of UchLl protein in HEK cells. No changes in Uchll mRNA levels.
Fig.5
Fig.5, related to the experiments, is a view showingrjAS Uchll regulates UchLl protein levels. Full length (FL) AS Uchll is required for regulating endogenous (MN9D cells, left panel) and overexpressed (HEK cells, right panel) UchLl protein levels. Scheme of Δ5' or Δ3' deletion mutants is shown.
Fig.6
Fig.6, related to the experiment6, is a view showing AS Uchll regulates UchLl protein levels via embedded SINEB2. Inverted SINEB2 is sufficient to control UchLl protein levels. Scheme of mutants is shown.
Fig.7
Fig.7, related to the experiment7, is a view showing Family of AS transcripts with embedded SINEB2. Family of FANTOM 3 non-coding clones that are AS to protein coding genes and contain embedded SINEB2 in inverted orientation.
Fig.8
Fig.8, related to the experiments, is a view showing Family of AS transcripts with embedded SINEB2. Schematic diagram of Uxt/AS Uxt genomic organization. AS Uxt increases endogenous Uxt protein levels in transfected MN9D cells (left), without affecting its transcription (right).
Fig.9
Fig.9, related to the experiment 9, is a view showing
Expression of AS Uchll in the nucleus of dopaminergic neurons. AS Uchll (red) and Uchll (green) transcripts are expressed in the nucleus and cytoplasm of TH-positive DA neurons of the Substantia Nigra (blue). Details of localization are in zoom images.
Fig.10
Fig.10, related to the experiment 10, is a view showing AS Uchll translocates to the cytoplasm upon rapamycin treatment in MN9D cells. mRNA levels measured with primers spanning 5' overlapping or 3' distal portions of the transcript. Data indicate mean ± s.d., n>3 (3). **p<0.01; ***p<0.005.
Fig.11
Fig.11, related to the experiment 11 , is a view showing Rapamycin treatment induces UchLl protein expression. UchLl protein level is increased in rapamycin-treated MN9D cells.
Fig.12
Fig.12, related to the experiment 12, is a view showing AS Uchll-embedded SINEB2 induces translation of Uchll upon rapamycin treatment. Silencing AS Uchll transcription in MN9D cells (shRNA, encompassing -15/+4 position of target sequence) inhibits rapamycin-induced UchLl protein level. Scramble, shRNA regulatory sequence. Left, mRNA levels; right, protein levels.
Fig.13
Fig.13, related to the experiment 13, is a view showing AS Uchll-embedded SINEB2 induces translation of Uchll upon rapamycin treatment. Deletion of embedded SINEB2 (ASINEB2) is sufficient to inhibit rapamycin-induced UchLl protein up-regulation.
Fig.14
Fig.14, related to the experiments, is a view showing an artificial AS transcript with embedded SINEB2 (AS Gfp) to an artificial humanized enhanced Green Fluorescent Protein (Gfp) mRNA increases GFP protein synthesis: (a) of Fig. 14 shows Schematic diagram of Gfp/AS Gfp constructs, (b) of Fig,. 14 shows how AS Gfp increases Gfp protein levels in transfected HEK cells while a scramble overlapping sequence or an empty plasmid does not increases Gfp protein levels in transfected HEK cells. The overlap is 72nt long and it is centered on the ATG.
Fig.15
Fig.15, related to the experimentl5, is a view showing an artificial AS transcript with embedded SINEB2 (AS Fc clone) to an artificial recombinant antibody in pHYGRO (pHYGRO clones) increases the synthesis of the protein encoded in pHYGRO. a, Schematic diagram of pHYGRO /AS Fc constructs, b, AS Fc increases the encoded protein levels in transfected HEK cells while a scramble overlapping sequence or an empty plasmid do not, detected through the SV5 tag.
Fig.16
Fig.16, related to the experiments, is a view showing how an artificial AS transcript with embedded SINEB2 to an artificial Green Fluorescent Protein (EGFP) mRNA increases EGFP protein synthesis.
Fig.17
Fig.17 is a view showing the examples of the potential predicted structures of SINE B2-derived sequence.
Description of Embodiments
The following describes an embodiment of the present invention, more specifically.
[1. Functional RNA Molecule] (Constitution of Functional nucleic acid Molecule)
A functional nucleic acid molecule according to the present invention has a feature that it comprise s : a target determinant sequence comprising an antisense sequence to a target sequence in the protein-encoding RNA for which protein synthe sis efficiency is to be increased ; and a regulatory sequence having an activity of increasing of the protein synthesis efficiency. The functional nucleic acid molecule according to the present invention can be appropriately designed and produced by a skilled person in the related art based on the description herein .
The protein synthe sis efficiency is increased according to the present invention . In one embodiment, the protein synthesis efficiency is increased as a result of increase in the translation efficiency, preferably, without changing the transcription efficiency substantially. Thus , the protein synthe sis efficiency may be increased by increasing the translation efficiency . In another embodiment, both transcription and translation can be increased by independent means; obviously, it may be the case that an RNA may result lower expre ssion level, and yet the protein re sults higher expression level .
(Protein-Encoding RNA for Which Protein Synthesis Efficiency is to be Increased)
The protein-encoding RNA for which protein synthesis efficiency is to be increased by the functional nucleic acid molecule according to the present invention is not especially limited in regard to its sequence, origin, and the like, provided that the RNA comprises a translation domain (coding region) having a 5'-terminal start codon and a 3'-terminal stop codon. Specifically, the protein-encoding RNA for which protein synthesis efficiency (the target RNA) is to be increased by the functional nucleic acid molecule according to the present invention may further have a 5'-cap structure, a 5' untranslated region (5'-UTR) and/or a 3' untranslated region. These regions may be derived from endogenous sequence in a cell or artificially synthesized sequence. The ORFeome, in which Open Reading Frames (coding sequences) of genes are placed in expression vectors, is one of the examples.
Further, it is preferable that the 3' untranslated region includes, at its 3' terminal, a sequence (poly-A addition signal) so that a poly-A sequence can be added. The poly-A addition signal may be, for example, a nucleotide sequence consisting of AAUAAA, a SV40 early poly-A signal having two sequences of AAUAAA, a sequence in which SV40 early poly-A signals are aligned in a tandem manner, or the like. The poly-A addition signal is not limited to them. As examples, various alternative polyadenylation sites have been described in the literature, and some mRNA do not even carry conventional polyadenylation signals (Carninci et al, Genome Res.2003 Jun; 13(6B): 1273-89. PMID: 12819125).
The protein-encoding RNA for which protein synthesis efficiency is to be increased according to the present invention may have a poly-A sequence at its 3' terminal. An RNA having a poly-A sequence at its 3' terminal has excellent protein synthesis efficiency from a translation domain and excellent stability of the RNA itself. Such an RNA may be, for example, any one of RNAs shown in Uchll, Uxt, GFP or a homologue of any one of these RNAs, although such an RNA is not limited to them.
Mus musculus ubiquitin carboxy-terminal hydrolase LI (Uchll) RefSeq: NM_011670.2
The Uchll DNA sequence which encodes the Uchll RNA is shown in SEQ ID NO.4.
Mus musculus ubiquitously expressed transcript (Uxt) RefSeq: NM_013840.3
The Uxt DNA sequence which encodes the Uxt RNA is shown in SEQ ID NO.5.
GFP(Sequence from pEGFP vector)
The GFP DNA sequence which encodes the GFP RNA sequence is shown in SEQ ID NO.6.
The protein-encoding RNA for which protein synthesis efficiency is to be increased may be endogenous RNA of biological origin (for example , mRNA) or artificially synthesized . Further, mRNA derived from eucaryotes encompass mature mRNA that has been subj ected to what i s called proce ssing, and precursor mRNA that has not been subj ected to proce ssing.
(Target D eterminant Sequence)
The target determinant sequence is a sequence that comprises an antisense sequence to a target sequence in the protein-encoding RNA for which protein synthesis efficiency is to be increased . A target sequence is arbitrarily selected from a partial sequence of protein-encoding RNA for which protein synthe sis efficiency is to be increased in the present invention . A target sequence may derive from the RNA sequence transcribed from the plasmid DNA in which the protein-encoding cDNA is inserted and around the first 5 '-terminal start codon . A length of the antisense sequence is not especially limited . However, from the viewpoint of increasing specificity for a target RNA in a system including different RNAs , the antisense sequence may have a length of preferably more than 7 nucleotides , more preferably 10 , more preferably 15. Furthermore, the antisense sequence may have a length of preferably less than 250 nucleotides , more preferably 200 , more preferably 150 , more preferably 100 , more preferably 90 , more preferably 80 , more preferably 77 nucleotides , more preferably 70 nucleotides, more preferably 60 nucleotides , more preferably 50 nucleotide s, more preferably 40 nucleotides , more preferably 30 nucleotide s .
In one embodiment, more than one different antisense sequence s can be included in the target determinant sequence . These multiple antisense sequences can be applied to targeting of multiple proteins , for example . Alternatively, the multiple antisense sequence s can be applied to improving the specificity to a protein - encoding RNA wherein the multiple antisense sequences are hybridizable with the same protein-encoding RNA. In one embodiment, the target determinant sequence of the pre sent invention may contain mismatches again st the target RNA on purpose to prevent the reaction of gamma interferon that may take place in the cells in presented of long double strand nucleic acids molecule , like long double strand RNAs .
Further, from the viewpoint of increasing specificity between the functional nucleic acid molecule of the present invention and the target RNA, the antisense sequence in a target determinant sequence is designed to be preferably at least 60% similarity, more preferably at least 65% similarity, more preferably at least 70% similarity, more preferably at least 75% similarity, more preferably at least 80% similarity, more preferably at least 85% similarity , more preferably at least 90% similarity, more preferably at least 95% similarity to a corresponding target sequence in the protein-encoding RNA for which protein synthesis efficiency is to be increased, as long as the antisense sequence can hybridize to the target sequence in the protein-encoding RNA and / or to the plasmid-derived RNA that contain s the target sequence . I t is specifically preferable that the antisense sequence in the target determinant sequence be designed to be thoroughly identical with the corresponding sequence of the target sequence .
Further, an antisense sequence in a target determinant sequence can be designed to hybridize with a 5 '- UTR of the protein-encoding RNA for which protein synthesis efficiency is to be increased . This design can be applied to the synthesizing full length encoded-protein . 5 '-UTR may be derived from endogenous sequence in a cell or artificial sequence . The antisense sequence in the target determinant sequence may be designed to be hybridizable with other regions , except the 5 '-UTR, of the target RNA, such as a coding region of the target RNA . For example , the antisense sequence in the target determinant sequence can be designed to be hybridizable with a given part of the coding region of the target RNA . This design is useful for a dystrophin gene or the like in which a protein to be encoded by an RNA is very large and has a domain that exhibits bioactivity by itself.
Additionally, the antisense sequence in the target determinant sequence can be designed to hybridize both the 5' UTR and a part of the other functional part of the sequence, like the coding sequence or the 3' UTRs of the protein coding mRNAs.
(Regulatory sequence)
In the functional nucleic acid molecule according to the present invention, the regulatory sequence has an activity of increasing of the protein synthesis efficiency.
In one embodiment of the invention, the regulatory sequence may comprise a SINE-derived sequence. Specifically, SINE-derived sequence may be a tRNA-derived SINE, for example SINE-B2, ID element, MEN, 4.5S1, DlP-derived sequence. Additionally, 7SL-RNA-derived sequence such as Alu may be comprised in the regulatory sequence.
In one embodiment, multiple SINE-derived sequences can be included in the regulatory sequence. These multiple SINE-derived sequences may be with combination of different sequences, for example a combination of SINE B2-derived sequence and Alu-derived sequence or a combination of different SINE B2-derived sequence.
The SINE-derived sequence indicates a sequence entirely or partially identical with or similar to the consensus sequence of each species of SINE . For example , the SI NE-B2 -derived sequence indicates a sequence entirely or partially identical with or similar to the consensus sequence of a SINE B2. Even a truncated SINE derived sequence against the consensus sequence of SINE can be used as the SINE derived sequence in the present invention as long as a function of increasing the protein synthesize efficiency is kept. SINE-derived sequence may be a sequence which comprises substantially potential predicted structures formed by parts of the SINE sequence s, for example . The examples of the potential predicted structures of SINE B 2 -derived sequence are as shown in (a) and (b) of Fig. 16.
The similar sequence indicates a sequence that is at least 25 % similarity, preferably at least 50% similarity, more preferably at least 55% similarity, more preferably at least 60% similarity, more preferably at least 65% similarity, more preferably at least 70% similarity, more preferably at least 75% similarity, more preferably at least 80% similarity, more preferably at least 85% similarity, more preferably at least 90% similarity, more preferably at least 95% similarity to the consensus sequence of the SINE.
The sequence of a SINE may deviate from the se conservative con sensus described above . For instance, the analysis of the consensus similarity between the SINE B2 sequences of three sequences alone, the SINE B2 fraction of SEQ ID NO:l, SEQ ID NO:3, and another SINE B2 randomly taken from the literature (reference: Espinosa et al, http://rnajourn al.cshlp.org /con tent/13/4 / 583. full), clearly indicates that the SINE B2 fractions alone can share as little as 9 bases out of 36, with only 25% of similarity.
Yet, despite diverging, these are still recognizable as a SINE B2 element using programs like RepeatMask as published (Bioinformatics. 2000 Nov;16(l 1): 1040-1.MaskerAid: a performance enhancement to RepeatMasker. Bedell JA, Korf I, Gish W.).
In one embodiment, the length can be limited to the shortest sequences with similarity to SINE elements, which are capable to cause increased the efficiency of protein synthesis.
In one embodiment, it is possible to synthesize artificial nucleic acid sequences that have partial similarity to the SINE elements described in the present invention and act to increase the level of synthesized protein.
Further, the functional nucleic acid molecule according to the present invention may include a plurality of regulatory sequences aligned in a tandem manner, for the purpose of further promoting the protein synthesis efficiency.
In the description of the present invention, "SINE" broadly indicates, among non-LTR (long terminal repeat) retrotransposon, an interspersed repetitive sequence (a) which encodes a protein having neither reverse-transcription activity nor endonuclease activity or the like and (b) whose complete or incomplete copy sequences exist abundantly in genomes of living organisms. That is, SINE is a DNA sequence that is inserted into a genome through the reverse transcription from RNA to cDNA, depending on other host factors in these processes. A length of the SINE is not especially limited, but generally, in a range of not less than 20 bp, preferably not less than 30bp, more preferably not less than 50bp, more preferably not less than 50bp, but not more than 700 bp, preferably not more than 600 bp, more preferably not more than 500 bp, more preferably not more than 400 bp. Further, the origin of SINE is not limited, but is generally derived from tRNA and has a sequence having a sequence corresponding to the tRNA on its 5'-terminal side. Further, the SINE may be a 7SL RNA-derived sequence such as Alu, and a 5S rRNA-derived sequence such as SINE 3. In regard to the SINE 3, the document by Kapitonov et al (Vladimir V. Kapitonov and Jerzy Jurka: Molecular Biology AND Evolution 20(5): p694-702, 2003) and the like document can be referred to.
The regulatory sequence may be, for example, selected from the following (1) to (5): (1) an RNA, which is encoded by a DNA consisting of the nucleotide sequence shown in SEQ ID No:l
(2) an RNA, which is encoded by a DNA consisting of the nucleotide sequence shown in SEQ ID No:2
(3) an RNA, which is encoded by a DNA consisting of the nucleotide sequence shown in SEQ ID No:3
(4) nucleic acids (i) which is at least 25 % similarity to the RNA, which is encoded by a DNA consisting of the nucleotide sequence shown in SEQ ID No: 1, 2 or 3 and (ii) which has a function of increasing the protein synthesis efficiency; and
(5) nucleic acids (i) , which is encoded by an DNA in which not less than 1 but not more than 200 nucleotides are deleted, substituted, added, and/or inserted in the nucleotide sequence shown in SEQ ID No: 1, 2 or 3 and (ii) which has a function of increasing the protein synthesis efficiency.
The number of nucleotides to be deleted, substituted, added, and/or inserted is preferably not less than 1 but not more than 175, more preferably not less than 1 but not more than 150, more preferably not less than 1 but not more than 125, more preferably not less than 1 but not more than 100, more preferably not less than 1 but not more than 75, more preferably not less than 1 but not more than 50, more preferably not less than 1 but not more than 30, more preferably not less than 1 but not more than 20.
(Po sitional Relationship between Target Determinant Sequence and Regulatory sequence)
In the pre sent invention , a direction (a sense- strand direction) along which a target protein is translated is defined as " forward direction" , and the direction opposite to the forward direction is defined as "reverse direction" . In the functional nucleic acid molecule according to the present invention , a positional relationship between the target determinant sequence and the regulatory sequence is not especially limited . However, it is preferable that the target determinant sequence be located clo ser to a forward-direction side in the functional nucleic acid molecule than the regulatory sequence . The target determinant sequence may be directly linked to the regulatory sequence . Alternatively, a linker sequence and / or the like sequence for connecting the target determinant sequence and the regulatory sequence may be inserted there between .
In the functional nucleic acid molecule according to the present invention, it is preferable that the direction of the SINE-derived sequence which is annotated as forward in the regulatory sequence is oriented in a reverse direction relative to the direction (forward direction as defined above) , wherein SINE-derived sequence is oriented in the same direction of the consensus sequence of SINE. That is, the regulatory sequence of the functional nucleic acid molecule is oriented in a forward direction relative to the direction of translation.
If the direction from 5' to 3' is defined as the forward direction, the SINE-derived sequence in this invention, wherein its 5' to 3'orientation accords with the SINE consensus sequence, is embedded in the reverse direction of the functional nucleic acid molecule in this invention. For example, in case of one of SINE B2-derived sequence, Abox site of SINE B2-derived sequence is located on the 3' side of the functional nucleic acid molecule compared to Bbox site of SINE B2-derived sequence.
(Production of Functional nucleic acid Molecule)
A method according to the present invention for producing a functional nucleic acid molecule comprises the step of preparing the aforementioned RNA molecule. The functional nucleic acid molecules may be prepared by a well-known nucleic acid biosynthesis method, or such a method that (i) a DNA molecule encoding the functional RNA molecule is produced and (ii) the DNA molecule is transcribed into the functional RNA molecule, for example. A size of the functional nucleic acid molecule is not especially limited, but the functional nucleic acid molecule has a size of preferably not more than 2000 nucleotides, more preferably not more than 250 nucleotide s, for example , from the viewpoint of producing the functional nucleic acid molecule by the nucleic acid biosynthesis method .
[2. DNA M olecule , Expres sion Vector, Compo sition for Increasing Protein Synthesis Efficiency]
A D NA molecule according to the present invention encodes any one of the aforementioned functional nucleic acid molecules according to the present invention . Further, an expression vector according to the present invention is an RNA vector comprising any one of the aforementioned functional RNA molecules of the present invention or a DNA vector comprising the DNA molecule according to the present invention . Further, a composition for increasing protein synthesis efficiency according to the present invention comprises any one of the aforementioned functional nucleic acid molecules or the aforementioned expression vector.
In one embodiment, the composition according to the present invention may comprise a translation agent based on in vitro system like reticulocyte extract to produce protein in vitro ; or to produce protein in vivo in mammalian cells expressing a protein for industrial use, for re search purpose , or for any other screening, for example .
The backbone of the expression vector according to the present invention is not e specially limited to any particular type , and may be appropriately selected from a plasmid vector. The plasmid vector may be a mammalian , yeast, insect expression vector, a virus vector (for example a lentiviral or retroviral expression vector, adenovirus or adeno-associated virus vectors) , a phage vector, a cosmid vector, and the like , depending on types of host cells to be used and the purpo se of use . For example , in a case where the present invention is used for gene treatment of mammals including a human , the present invention may be prepared in a form of a virus vector, such as an adenovirus or adeno-associated vector or a lentivirus vector.
Alternatively, the expression vector may ultimately be integrated in the genome of the expressing cells or organism to be targeted .
[3. Method for Increasing Protein Synthe sis Efficiency] (Method for Increasing Protein Synthesis Efficiency)
A method for increasing protein synthesis efficiency according to the present invention comprises the step of allowing a functional nucleic acid molecule according to the present invention or the aforementioned expression vector to coexist with a protein-encoding RNA for which protein synthe sis efficiency is to be increased . This step can be carried out in vivo or in vitro using, for example , cell-free protein synthesis system . In the pre sent invention , "in vivo" means a system of using either cell culture or whole animal specifically, and "in vitro" means a system using cell-free assay specifically . In a case where the step is carried out in vivo , the functional nucleic acid molecule or the aforementioned expres sion vector may be allowed to coexist, in an isolated cell or tissue , with a protein- encoding RNA for which protein synthe sis efficiency is to be increased Alternatively, the functional nucleic acid molecule or the aforementioned expre ssion vector may be allowed to coexist, in a living organism , with an RNA for which protein synthe sis efficiency is to be increased .
The method for increasing protein synthe sis efficiency according to the present invention may comprise transfecting into a cell an aforementioned expre ssion vector encoding the functional nucleic acid molecule or the functional nucleic acid molecule itself so as to allow the functional nucleic acid molecule to coexist with the protein-encoding RNA . The "cell" indicates not only an isolated cell but also cells constituting an individual . The RNA for which protein synthe sis efficiency is to be increased may be derived from an endogenous sequence in a cell or an RNA encoding a protein synthe sized artificially . The transfection (or gene induction) of a nucleic acid molecule into a cell may be carried out appropriately by conventional methods , for example , self-infection by a vector, a microinjection technique, a lipofection technique, an electroporation technique, a calcium phosphate method, transduction of a virus and the like. The vector may or may not be permanently integrated in the host genome.
The cells may be derived from any one of cells from any organism including animals and plants, or any one of cells selected from the established cell lines.
In the present invention, animals include vertebrate, preferably mammals including a human, but are not limited to these examples.
In the present invention, plants include both monocotyledons and dicotyledons. In one embodiment, the plants are crop plants (for example, cereals and pulses, maize, wheat, potatoes, tapioca, rice, sorghum, millet, cassava, barley, or pea), or other legumes. In another embodiment, the plants may be vegetables or ornamental plants. The plants of the invention may be: corn (Zea mays), canola (Brassica napus, Brassica rapa ssp.), flax (Linum usitatissimum) , alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cerale), sorghum (Sorghum bicolour, Sorghum vulgare), sunflower (Helianthus annus), wheat (Tritium aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato, (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium hirsutum), sweet potato (Lopmoea batatus), cassava (Manihot esculenta), coffee (Cofea spp.), coconut (Cocos nucifera), pineapple (Anana comosus), citris tree (Citrus spp.), cocoa (Theobroma cacao), tea (Camellia senensis), banana (Musa spp.), avocado (Persea americana), fig (Ficus casica), guava (Psidium guajava), mango, (Mangifer indica), olive (Olea europaea), papaya (Carica papaya), cashew (Anacardium occidentale), macadamia (Macadamia intergrifolia) , almond (Prunus amygdalus), sugar beets (Beta vulgaris), oats, or barley, but are not limited to these examples.
In the present invention, the established cell lines including mammalian derived cell such as COS-1 (ATCC No.CRL 1650), COS-7 (ATCC CRL 1651 ), human embryonic kidney line 293 (ATCC NO.CRL 1573), PerC6 (Crucell), baby hamster kidney cell (BHK) (ATCC CRL.1632), BHK570 (ATCC NO: CRL 10314), Chinese hamster ovary cells CHO (e.g. CHO-K1 , ATCC NO: CCL 61 , DHFR minus CHO cell line such as DG44, particularly those CHO cell lines adapted for suspension culture, mouse Sertoli cell, monkey kidney cell, African green monkey kidney cell (ATCC CRL-1587), HeLa cell, SH-Y5Y cell, canine kidney cell (ATCC CCL 34), human lung cell (ATCC CCL 75), Hep G2 and myeloma or lymphoma cells e.g. NSO (see US 5,807,715), Sp2/0, YO, other animals derived cells such as Sf9 cell,DT40, but are not limited to these examples. Furthermore, the established cell lines can be hybridoma or a cell given a particular feature by gene transfer, nuclear transfer and/or treatment of chemical compound, for example a nuclear transfer embryonic stem cell or an iPS cell(WO2007/ 069666, JP-A 2010-273680, JP-A 2010-284088, JP-A 2011-50379, JP-A 2011-4674, etc), a neuronal cell differentiated from neural stem cell, iPS cell or the like, or neuronal cells derived from re-programmed fibroblasts or the like, but are not limited to these examples.
The protein synthesis efficiency increasing method according to the present invention optimally contributes to increase the efficiency of the translation from RNA. The increase of the protein synthesis efficiency indicates that the protein synthesis efficiency is increased as compared with a case where the functional nucleic acid molecule according to the present invention or aforementioned expression vector is not allowed to coexist with the target RNA in a system. How much the protein synthesis efficiency is to be increased is not limited especially. However, it is preferable that an amount of a protein to be synthesized by the protein synthesis efficiency-increasing method be at least 1.5 times, more preferably at least 2 times more than an amount of a protein to be produced in the case where the functional RNA molecule is not allowed to coexist with the target RNA in the system.
In a case where the functional nucleic acid molecule or aforementioned expression vector is allowed to coexist with the target RNA in the system, a quantitative ratio between the functional nucleic acid molecule (or the expres sion vector) and the target RNA is not e specially limited . The quantitative ratio between them may be , for example , 1 : 1 to 1 : 10.
(Method for synthe sizing Protein)
The aforementioned protein synthesis efficiency-increasing method according to the present invention can be used as a protein synthesis method . That is, a protein synthesis method according to the pre sent invention is a method for producing a target protein , comprising the step of increasing the protein synthesis efficiency by any one of the aforementioned protein synthesis efficiency-increasing methods . It is preferable that the protein synthesis method allow for efficient synthe sis of the target protein through the increasing the efficiency of protein translation from the target RNA .
In the protein synthesis method of the present invention , one example of the protein to be synthe sized is an antibody, particularly synthe sizing a light or a heavy chain or both of the antibody or single chain recombinant version of an antibody. The synthesis of the antibody is carried out preferably in an in vitro system or in an isolated cell system so that a functional nucleic acid molecule according to the present invention or aforementioned expre ssion vector can be allowed to coexist, in the system, with a target RNA for which protein synthesis efficiency is to be increased.
(Method for Treating Disease)
The protein synthesis efficiency-increasing method according to the present invention can be used for treatment of a disease caused by a quantitative decrease in a predetermined normal protein, for example. The disease is not especially limited, but may be, for example; myodegeneration such as muscular dystrophy; neurodegenerative disease such as Alzheimer's disease, Parkinson's disease, Amyotrophic Lateral Sclerosis, and triplet repeat diseases both at the protein encoding level (i.e. Huntington's disease) or at DNA/RNA level (i.e. Fragile X).
Furthermore, a tumor can be also applied to the present invention through the increase of expression of a pro-apoptotic protein or a tumor suppression protein for tumor treatment as for instance for p53 family members.
Such a tumor, including a cancer, may be any one of tumors including without limitation carcinoma, melanoma and sarcoma, bladder carcinoma, brain tumor, breast tumor, cervical tumor, colorectal tumor, esophageal tumor, endometrial tumor, hepatocellular carcinoma, gastrointestinal stromal tumor, laryngeal tumor, lung tumor, osteosarcoma, ovarian tumor, pancreatic tumor, prostate tumor, renal cell carcinoma, skin tumor, or thyroid tumor. The treatment method comprises the step of increasing the protein synthesis efficiency by the aforementioned protein synthe sis efficiency-increasing method which comprises allowing a functional nucleic acid molecule according to the present invention or aforementioned expre ssion vector to coexist, in a body of a subj ect, with a target RNA . In this step, the functional nucleic acid molecule itself or an aforementioned expression vector is transfected into a cell of the subj ect. The target RNA may be an endogenous RNA (mRNA or the like) in the cell of the subj ect or artificially synthesized RNA . Alternatively, the target RNA or a DNA molecule encoding the RNA may be transfected into the cell of the subj ect .
Further, the protein synthesis efficiency-increasing method according to the present invention is applicable to treatment of a disease by amplifying in a body of a subj ect a protein factor (e . g. , interferon , an apoptosis-inducing factor, or the like) that ameliorates the disease . For example , an apoptosis-inducing factor amplified in accordance with the present invention can be effectively used for treatment of tumors or the like .
The treatment method may comprise the step of allowing a functional nucleic acid molecule according to the present invention or aforementioned expression vector to coexist with a target RNA encoding a protein that ameliorates a disease in a body of a subj ect, wherein the target RNA hybridizes the antisense in the target determinant sequence of the functional nucleic acid molecule . In this step , the functional nucleic acid molecule itself or the aforementioned expression vector is transfected into a cell of the subj ect. The RNA encoding the protein that ameliorates the disease may be an endogenous RNA in the cell of the subj ect . Alternatively, the RNA encoding the protein that ameliorates the disease or a DNA molecule encoding the RNA may be transfected into the cell of the subj ect .
Any of the aforementioned treatment methods can be carried out as a pretreatment to an isolated cell to be transplanted into a body of the subj ect. The cell may be isolated from the body of the subj ect before treatment and transplantation . The aforementioned treatment methods may be a treatment method comprising the steps of (a) allowing a functional nucleic acid molecule according to the present invention or aforementioned expression vector to coexist in an isolated cell with a target RNA; and (b) , after the step (a) , transplanting the cell into a body of a subj ect. An isolated cell may be a cell which has the ability of differentiation , for example an Embryonic Stem cell (ES cell) , an Embryonic Germ cell (EG cell) , a somatic stem cell , especially a multi potent adult progenitor cell, stem cell, a hematopoietic stem cell, a vascular endothelia stem cell, a mesenchymal stem cell, a hepatic stem cell, a neural stem cell, an endothelial stem cell, a pancreatic stem cell, a primordial germ cell, or a multilineage-differentiating cell like a Muse cell (Kuroda et al., 2010, PNAS). Additionally, an isolated cell may be also an artificial undifferentiated cell, for example a nuclear transfer embryonic stem cell or a cell acquired the pluripotent ability by gene transfer and/or treatment of chemical compound, like an induced pluripotent stem cell (iPS cell (WO2007/ 069666, JP-A
2010- 273680, JP-A 2010-284088, JP-A 2011-50379, JP-A
2011- 4674, etc)). Additionally, an isolated cell may also be a fibroblast or an adult somatic cells that acquired the ability to become another somatic cells upon reprogramming. Additionally, after the step (a) but before the step (b), the isolated cell may be grown undifferentiated. Alternatively, after the step (a) but before the step (b), the isolated cell may be differentiated to obtain a differentiated cell or a group of differentiated cells (cell sheet or the like), and the differentiated cell or the group of differentiated cells may be transplanted into the body.
The subject indicates animals, wherein the animals include a human, preferably mammals including a human, more preferably a human. Further, the subject generally encompasses (a) one who has already shown the symptoms of a disease and (b) one who has a genetic predisposing cause but has not shown the symptoms of a disease yet. In view of this , the concept of "treatment" in the present invention includes therapeutic treatment and preventive treatment of a disease .
[Example]
The present invention will be described below more specifically based on Examples , Comparative Examples , and the like . Note that the present invention is not limited to them .
The embodiments and concrete examples of implementation discus sed in the foregoing detailed explanation serve solely to illustrate the technical details of the pre sent invention , which should not be narrowly interpreted within the limits of such embodiments and concrete examples , but rather may be applied in many variations within the spirit of the pre sent invention , provided such variations do not exceed the scope of the patent claims se t forth below.
Antisense transcription in synthenic PARK5 / Uchl l locus .
The FANTOM2 clone Rik6430596G22 was identified as a putative spliced AntiSense (AS) noncoding RNA (ncRNA9 of the Ubiquitin Carboxy Terminal Hydrolase 1 (UCHL l ) gene 7 (Experiment 1 ) . UchL l is a neuron-re stricted protein that acts as deubiquinating enzyme , ubiquitin ligase or monoubiquitin stabilizer (Reference 1; Liu, Y., Fallon, L., Lashuel, H.A., Liu, Z. & Lansbury, P.T., Jr. The UCH-L1 gene encodes two opposing enzymatic activities that affect alpha-synuclein degradation and Parkinson's disease susceptibility. Cell 111, 209-218 (2002)., Reference 2; Osaka, H., et al. Ubiquitin carboxy-terminal hydrolase LI binds to and stabilizes monoubiquitin in neuron. Hum Mol Genet 12, 1945-1958 (2003).). It is mutated in an autosomal dominant form of PD (PARK5) (Reference 3; Leroy, E., et al. The ubiquitin pathway in Parkinson's disease. Nature 395, 451-452 (1998).). In Substantia Nigra (SN) of sporadic post-mortem brains UchLl expression was found reduced and correlated to the formation of aSYN aggregates. Loss of Uchll activity has been also associated to Dementia with Lewy bodies (DLB) and Alzheimer's disease (AD). Increasing Uchll expression has been proposed as therapeutic strategy for AD since its ectopic expression rescued beta-amyloid-induced loss of synaptic function and contextual memory in a mouse model (Reference 1, Reference 4; Butterfield, D.A., et al. Redox proteomics identification of oxidatively modified hippocampal proteins in mild cognitive impairment: insights into the development of Alzheimer's disease. Neurobiol Dis 22, 223-232 (2006)., Reference 5; Castegna, A., et al. Proteomic identification of oxidatively modified proteins in Alzheimer's disease brain. Part II: dihydropyrimidinase-related protein 2, alpha-enolase and heat shock cognate 71. J Neurochem 82, 1524-1532 (2002)., Reference 6; Choi, J., et al. Oxidative modifications and down-regulation of ubiquitin carboxyl-terminal hydrolase LI associated with idiopathic Parkinson's and Alzheimer's diseases. J Biol Chem 279, 13256-13264 (2004).).
Rik6430596G22 is a typical 5' head to head transcript that initiates within the second intron of Uchll and overlaps the first 72 nts of the Sense (S) mRNA including the AUG codon (Experiment 1). The non overlapping part of the transcript also contains two embedded repetitive sequences, SINEB2 and Alu, identified by Repeatmasker. The FANTOM2 cDNA clone spans a genomic region of 70kb and is a spliced transcript composed of four exons whose intron-junctions follow the traditional GT-AG rule (Experiment 2). In the remaining part of the disclosure Rik6430596G22 is referred as a natural AntiSense transcript to Uchll (AS Uchll).
AS Uchll increases UchLl protein levels with a mechanism that requires an embedded inverted SINEB2 repeat.
The interplay between S and AS transcripts was then examined. After cloning the full length cDNA for AS Uchll from MN9D cells with 5' rapid amplification of cDNA ends (RACE), a CMV-driven AS Uchll was transiently overexpressed in MN9D dopaminergic cells and endogenous Uchll mRNA and protein levels were monitored by qRT-PCR and western blotting. While no significant change in Uchll mRNA endogenous levels was observed, a strong and reproducible upregulation of UchLl protein product was detected within 24 hours (Experiment 3). The inventors tested whether co-transfection of both cDNAs into HEK cells which do not express either transcript could recapitulate what was seen in MN9D cells. When increasing amounts of AS Uchll were co-transfected with murine Uchll, a dose-dependent UchLl protein upregulation was recorded in absence of any significant change in exogenous Uchll mRNA level (Experiment 4). This specific effect was not observed for unrelated controls such as GFP. To identify sequences and/or structural elements of AS Uchll mRNA that elicit its functional activity on UchLl protein, deletion mutants were produced and tested in MN9D cells as well as in co-transfection in HEK cells. AS Uchll deletion constructs lacking the 5' first exon (AS Uchll Δ 5'), or the last three exons (AS Uchll Δ 3') failed to induce Uchll protein levels in both MN9D and HEK cell models, suggesting both 5' and 3' components were important to AS Uchll function (Experiment 5).
Additional deletion mutants were thus synthesized to assess the role of the embedded repetitive sequences, Alu and SINEB2, in UchLl protein upregulation.
Targeted deletion of the region containing both the SINEB2 and Alu repeat elements (AS Uchll Δ SINEB2+ALU) prevented Uchll protein induction. Deletion of a single repetitive element, (Δ-SINE B2 (764-934) and Δ-ALU (1000-1045), revealed the SINEB2 was the functional region of the transcript required for UchLl protein increase (Experiment 6). In all cases no change in Uchll mRNA level was detected by transfection of AS Uchll wild type and deletion constructs.
Additionally the A-SINEB2 mutant has a dominant negative activity on the full-length AS Uchll.
Since the deletion mutant A-SINEB2 lacks 170 nucleotides potentially impairing AS Uchll RNA secondary structure, a mutant was produced with the SINEB2 sequence flipped in between nucleotide 764-934. Interestingly, SINEB2 flip was unable to increase UchLl protein levels thus proving the orientation-dependent activity of the SINEB2 domain embedded within AS Uchll (Experiment 6).
S/AS pairs with an embedded inverted SINEB2 repeat in the AS transcript identify a new functional class of ncRNA. :
The FANTOM3 collection of non-coding cDNAs was bioinformatically screened for other examples of natural AS transcripts that contain SINEB2 elements (B3 subclass) in the correct orientation and 5' head to head overlapping to a protein coding gene. This identified 31 S/AS pairs similar to the Uchll/AS Uchll structure (Experiment 7).
To test whether the observation for Uchll/AS Uchll generalizes to other examples, the AS overlapping transcript of Uxt (ubiquitously-expressed transcript), AS Uxt (Rik4833404H03) were cloned and over-expressed. Transfection of AS Uxt in MN9D dopaminergic cells showed up-regulation of Uxt protein product with no change in the total mRNA levels confirming a more general mechanism is at work (Experiment 8).
AS Uchll is a nuclear-enriched transcript expressed in dopaminergic neurons. :
Multiplex RT-PCR on a panel of mouse adult tissues, macroscopically dissected brain regions and neuronal cell lines found that AS Uchll expression was restricted to ventral midbrain, cortex and MN9D dopaminergic cells but absent in non-neuronal tissues, and cell lines. Double in situ hybridization with riboprobes targeting the non-overlapping region of Uchll showed that the mRNA was prevalent in the cytoplasm of cells of the hippocampus, cortex and subcortical regions as well as of the dorsal and ventral midbrain. AS Uchll riboprobe decorated similar structures. A combination of double in situ hybridization with anti-tyrosine hydroxylase immunohystofluorescence showed that mRNAs for Uchll and AS were expressed in the same DA neurons of the SN. Intriguingly, transcripts for the S/AS pair were prevalently localized in two different subcellular compartments: mature Uchll mRNA was mainly observed in the cytoplasm, while the AS RNA was nuclear, accumulating in specific subnuclear regions (Experiment 9). 50% of cellular transcripts have been recently found enriched in the nucleus representing mainly ncRNAs with unknown function. Nuclear-retained RNAs tend to accumulate in areas, called paraspeckles, that strongly resemble sites of AS Uchll localization and which association is regulated by embedded SINEs (Reference 7; Chen, L.L., DeCerbo, J.N. & Carmichael, G.G. Alu element-mediated gene silencing. Embo J 27, 1694-1705 (2008).).
By taking advantage of RACE, the precise transcriptional start site (TSS) of the AS Uchll gene was mapped in MN9D cells. As shown in Experiment 2, the TSS lies 250 bps upstream the previously annotated sequence and is localized in the second intron of Uchll.
AS Uchll is down-regulated in PD neurochemical models and human post-mortem brains. :
A 70-kb region of the mouse genome encompassing the AS UchLl locus was then compared to the corresponding human genomic sequence using Genome Vista alignment (http:/ / genome.lbl.gov/ cgi-bin/ GenomeVista) . By the use of primers designed on the human sequence in correspondence to CST peaks, a 1.6 kb non-coding transcript, 5' head to head AS to human UCHL1 gene, was cloned from human brain RNA. The anatomical organization of hAS UCHL1 gene was very similar to its mouse counterpart including the extension of the S/AS pair overlapping region as well as the presence of embedded repetitive elements. hAS UCHL1 expression was highly restricted to neuronal tissues as found for mouse.
UCH-L1 protein synthesis is increased upon rapamycin treatment through nucleus-cytoplasmic shuttling of AS Uchll RNA and AS-dependent recruitment of Uchll mRNA to active polysomes.
So far, AS ncRNA is able to increase S protein levels with no change in the quantity of S mRNA. Since in physiological conditions S mRNA and AS ncRNA seem to be localized in different subcellular compartments, several stressors that have been implicated in PD pathogenesis for their ability to redistribute the nuclear AS ncRNA into the cytoplasm, where translation takes place, were assayed. MN9D cells were exposed to hydrogen peroxide ImM, serum starvation, rapamycin 1 ug/ml, tunycamycin 20nM and TNFalpha 20 nM for 45 minutes and AS Uchll mRNA content was independently measured in the cytoplasm and nucleus by qRT-PCR. The majority of treatments had no effect, however rapamycin strongly up-regulated the amount of AS Uchll cytoplasmic mRNA (Experiment 10) .
Rapamycin is a well known inhibitor of CAP-dependent translation through its effect on mTORCl and subsequent repression of S6K and 4E-BP1 activities. It is currently tested as anti-cancer drug and proposed for clinical trials for neurodegenerative diseases. Block of translation initiation mediated by rapamycin is able to rescue DA cell loss observed in knock-out flies for parkin and pinkl as well as in those over-expressing the dominant PD-associated mutation of LRRK2 (Reference 8; Tain, L.S., et al. Rapamycin activation of 4E-BP prevents parkinsonian dopaminergic neuron loss. Nat Neurosci 12, 1129-1135 (2009).). Furthermore, it protects mammalian DA cells from neurochemical intoxication in vitro and in mice (Reference 9; Malagelada, C, Jin, Z.H., Jackson-Lewis, V., Przedborski, S.8B Greene, L.A. Rapamycin protects against neuron death in in vitro and in vivo models of Parkinson's disease. J Neurosci 30, 1166-1175 (2010)., Reference 10; Malagelada, C, Ryu, E.J., Biswas, S.C., Jackson-Lewis, V. & Greene, L.A. RTP801 is elevated in Parkinson brain substantia nigral neurons and mediates death in cellular models of Parkinson's disease by a mechanism involving mammalian target of rapamycin inactivation. J Neurosci 26, 9996-10005 (2006).)· Recently, rapamycin was shown to prevent L-DOPA-induced dyskinesia, a common severe motor side effect of the symptomatic treatment for PD (reference 11; Santini, E., Heiman, M., Greengard, P., Valjent, E. 8s Fisone, G. Inhibition of mTOR signaling in Parkinson's disease prevents L-DOPA-induced dyskinesia. Sci Signal 2, ra36 (2009).).
The effects of rapamycin on the cytoplasmic content of
AS Uchll were confirmed by the presence of a concomitant decrease in its nuclear steady state levels, and by the absence of any de-novo transcription of AS Uchll (Experiment 10). Total cellular content of these transcripts remained constant. Uchll mRNA showed no changes in subcellular distribution, de novo transcription or total cellular content.
Despite the block in CAP-dependent translation, upon rapamycin treatment UchLl protein level increased several fold (Experiment 11).
The inventors assessed whether AS Uchll was required for UchLl induction. Stable MN9D cell lines were then established expressing constitutively shRNA for AS Uchll, targeting the AS Uchll promoter region from -4 to + 15 nt around the RACE-validated TSS (Reference 12; Hawkins, P.G., Santoso, S., Adams, C, Anest, V. 85 Morris, K.V. Promoter targeted small RNAs induce long-term transcriptional gene silencing in human cells. Nucleic Acids Res 37, 2984-2995 (2009)). As expected, scrambled cells showed UchLl protein up-regulation as in MN9D parental line while cells expressing shRNA for AS Uchll lacked any changes in UchLl protein levels proving a causal link between rapamycin induction of Uchll protein and AS Uchll ncRNA expression (Experiment 12). As independent model, stable cell lines with expression of a dominant negative mutant of AS Uchl 1 (A-SINEB2) were established. When control MN9D cells stable for empty vector were treated with rapamycin, UchLl protein was found increased. In presence of the dominant negative form of AS Uchll this upregulation was no longer visible (Experiment 13).
A model for AS-dependent increase in S-encoded protein levels upon rapamycin treatment. :
In growing cells mTORCl signaling is required for proliferation and controls CAP-dependent translation machinery through the phosphorylation of its downstream substrates 4E-BPs and S6K. The cytostatic drug rapamycin inhibits mTORCl activity leading to block of CAP-dependent translation. Here, the inventors show that in these conditions AS transcription is required for protein synthesis of selected mRNAs . Upon rapamycin addition , the nuclear-enriched ncRNA AS Uchl l is transported into the cytoplasm where it recruits mRNAs of its S protein-encoding partner to polysomes for translation .
AS Uchl l is thus the repre sentative member of a new functional class of ncRNAs that are associated to S / AS pairs in the mammalian genome and appears to be composed by two domains . The overlapping region at the 5 ' provide s specificity to a protein-encoding mRNA partner transcribed from the complementary strand . An inverted SINEB2 element at 3 ' is required for translational activation, representing a new function for embedded SINEB2 in the cytoplasm .
The manipulation of Uchl l expre ssion in vivo has been proposed for therapeutic intervention in neurodegenerative disease s, including PD and AD . Natural AS transcripts with embedded repetitive elements may thus represent endogenous molecular tools to increase protein synthe sis of selected mRNAs defining a potential new clas s of RNA therapeutic s .
Rapamycin is currently under intense scrutiny in biomedical research both as neuroprotective agent for neurodegenerative diseases and as anti-cancer drug. In mice rapamycin prevents L- D O PA-induced dyskinesia, a common severe motor side effect of the symptomatic treatment for PD . Furthermore, it protects neurons from apoptosis both in Drosophila genetic models as well as upon neurochemical intoxication in mammals making it an attractive molecule for anti-parkinsonian therapies (Reference 11; Santini, E et al., (2009)). It is thus important to better understand its modes of action in vivo and its interplay with pathways involved in familiar cases of PD, as shown here for Uchll. The role of AS transcription in rapamycin-induced protein synthesis adds an unexpected switch to its activities.
Artificially synthesized AS for increasing EGFP expression or antibody expression up-regulates the expression of each target in the cell. :
The inventors tested whether or not increased protein synthesis can be achieved on a synthetic RNA by inserting a 72 nt long target determinant sequence antisense to the enhanced green fluorescent protein (EGFP) into the appropriate sequence in AS Uchll. As in Experiment 14, the expression of the artificial AS for up-regulating EGFP expression was designed. The fragments encoding the artificial AS was cloned into pcDNA3.1- vector (Invitrogen) . This proves that a functional nucleic acid molecule with a target determinant sequence and a regulatory sequence can increase protein synthesis efficiency of any gene of interest.
In the same manner, the antibody can be applied as shown in Experiment 1 5. An artificial AS for up-regulating a recombinant antibody was de signed to target the leader sequence of the recombinant antibody (overlap is 72bp around the ATG) and embedded into the vector (AS Fc) . An artificial AS comprising a scramble sequence as the target determinant sequence (Scrambled) was also produced as control (Fig. 1 5) . The target sequence of the antibody was included in pHYGRO vectors (pHYGRO) . HEK cell line was co-tran sfected with pHYGRO and AS Fc or control . Transient transfection in HEK cells produced an AS Fc specific upregulation of the recombinant antibody in cell lysates . AS Fc increases the encoded protein levels in transfected H EK cells while a scramble overlapping sequence or an empty plasmid does not, detected through the SV5 tag.
For further examination (Experiment 16) , HEK cell line was transfected with EGFP expression vector pEGFP- C2 (Clontech) with Lipofectamine 2000 (Invitorgen) in accordance with manufacture 's instructions . Then , the transfectants which stably expres s low EGFP expres sion were selected . AS GFP comprises target determinant sequence against EGFP and it was artificially designed to increase the efficiency of EGFP protein synthesis (Fig . 16) . The stable transfectants were further transfected with the vector encoding AS GFP or control vector. After 24 hours or 48 hours from the transfection of AS GFP construct or control vector, the cells were collected and lysed . The GFP level in the cell lysate was monitored by western blotting. The low expre ssion of EGFP in the transfectant was increased by transfection of the AS GFP construct (Fig. 16) .
In an additional experiment, a construct with a target determinant sequence that overlaps for 44nt to the plasmid backbone till the ATG codon for EGFP has been synthesized . This contruct (SINEup005) increases protein synthe sis of the target gene very efficiently (more than 10 fold) .
Therefore , this is one of evidences that the new type of AS which the inventors found can be artificially de signed as long as the functional nucleic acid molecule includes a target determinant sequence comprising an antisense sequence to a target sequence in the protein- encoding RNA for which protein synthesis efficiency is to be increased and a regulatory sequence having an activity of increasing of the protein synthesis efficiency.
Methods
Plasmids
RACE fragment : The 5 ' UTR of AS Uchl l was amplified by RACE PCR (GeneRacer, Invitrogen) by MN9D total RNA and cloned into pGEM®-T Easy vector (Promega).
Full length AS Uchll : Full length DNA sequence of AS was amplified via fusion PCR starting from RACE fragment and FANTOM clone Rik 6430596G22 with following primers For mAS Uchll fl 5'-ACAAAGCTCAGCCCACACGT- 3' (SEQ ID No: 13) and Rev mAS Uchllfl 5'-CATAGGGTTCATT -3'(SEQ ID No: 14).
Uchll : Mouse Uchll mRNA was cloned from FANTOM 2900059022 with following primers: For mUchll 5'-ATGCAGCTGAAGCCGATG-3'(SEQ ID No: 15) and Rev mUchll 5 '-TTAAGCTGCTTTGCAGAGAGC-3' (SEQ ID No: 16) AS Uchll shRNA : Oligo containing the sequence -14/+4 around the TSS of AS Uchll CGCGCAGTGACACAGCACAAA (SEQ ID No: 17) are cloned into pSUPER.retro.puro vector (OligoEngine, Seattle, WA), scrambled sequence was used as control.
Deletional mutants :
Δ5': For mAS Uchll fl and Rev Δ 5'AS Uchll5' TACCATTCTGTGCGGTGCA-3' (SEQ ID No: 18).
Δ3': For mAS Uchll GACCTCCTCTAGCACTGCACA-3' (SEQ ID No: 19) and Rev mAS Uchll fl.
For fine deletional mutants, PCR fragment I is cloned Nhel-EcoRI site in PcDNA3.1- and PCR fragment II into following EcoRI-Hindll site. AS Uchll Δ ( Alu + SINEB2) :
PCR fragment I: For mAS Uchll fl and Rev pre-SINE B2 5'-CAATGGATTCCATGT-3' (SEQ ID No:20). PCR fragment II: For post-ALU 5 '-GATATAAGGAGAATCTG-3' (SEQ ID No:21) and Rev mAS fl.
AS Uchll A(Alu) :
PCR fragment I: mAS Uchll fl and Rev pre-Alu 5'- TTATAG TATGTGTTGTC-3' (SEQ ID No:22). PCR fragment II: For post-ALU 5 '-GATATAAGGAGAATCTG-3' (SEQ ID No:23) and Rev mAS fl cloned into EcoRI-Hindll site.
AS Uchll Δ (SINEB2) :
PCR fragment I: For mAS Uchll fl and and Rev pre-SINE B2 5'-CAATGGATTCCATGT-3' (SEQ ID No:24). PCR fragment II: For post-SINE B2 5'- GAATTCCTCCAGTCTCTTA -3' (SEQ ID No:25) and Rev mAS fl.
AS uchll (Alu + SINEB2) flip : PCR fragment I: obtained with For SINE B2 inside 5'-TGCTAGAGGAGG-3' (SEQ ID No:26) and Rev Alu flip 5'- GTCAGGCAATCC -3' (SEQ ID No:27) are cloned in the unique EcoRI site of AS Uchll Δ ( Alu + SINEB2). AS uchll SINEB2 flip: PCR fragment obtained with For SINE B2 inside 5'-TGCTAGAGGAGG-3' (SEQ ID No:28) and Rev SINE flip 5'-AAAGAGATGGC-3' (SEQ ID No:29) are cloned in the unique EcoRI site of AS Uchll Δ (SINEB2). Cells MN9D cells were seeded in 10 mm petri-dishes in Dulbecco's modified Eagle's medium containing 10% of fetal bovine serum and, penicillin (50 units/ml), streptomycin (50 units/ml). Treatments were done by adding Rapamycin (R0395, Sigma) at final concentration of lug/ml in fresh medium for 45 minutes.
For the establishment of MN9D stable cells (siRNA -15/+4, siRNA scrambled, pcDNA 3.1- and Δ SINE B2) MN9D cells were seeded in 100mm petri-dishes and transfected with Lipofectamine 2000 (Invitrogen) according to manufacturer's instruction, the day after cells seeded for selection with 500uM of Neomycin (#N1142, Sigma). HEK-293T cells were grown in DMEM (GIBCO) supplemented with 10% fetal bovine serum (Sigma-Aldrich), 100 units/mL penicillin, and 100 μπι/mL streptomycin (Sigma) at 37 °C in a humidified CO2 incubator.
PCR
PCR analysis: Total RNA was extracted using Trizol reagent (Invitrogen) according to manufacturers instruction. It was subjected to DNAse I treatment (Ambion) and 1 ug was retrotranscribed using iScript cDNA Synthesis Kit (BioRad). Real Time qRT-PCR was carried out using Sybr green fluorescence dye (2X iQ5 SYBR Green supermix, BioRad). Actin and GAPDH were used as internal standard. Relative quantification was performed with the comparative Ct method.
Actin: sense 5'- CACACCCGCCACCAGTTC-3' (SEQ ID No:30), antisense 5'-CCCATTCCCACCATCACACC-3' (SEQ ID No:31). Gapdh: sense 5'-GCAGTGGCAAAGTGGAGATT-3' (SEQ ID No:32), antisense 5'-GCAGAAGGGGCGGAGATGAT-3' (SEQ ID No:33).
AS Uchll overlap: sense 5'-GCACCTGCAGACACAAACC-3' (SEQ ID No:34), antisense 5'-TCTCTCAGCTGCTGGAATCA-3' (SEQ ID No:35).
AS Uchll : 5'CTGGTGTGTATCTCTTATGC (SEQ ID No:36) antisense 5'CTCCCGAGTCTCTGTAGC (SEQ ID No:37).
Uchll : sense 5'- CCCGCCGATAGAGCCAAG (SEQ ID No:38), antisense 5'-ATGGTTCACTGGAAAGGG-3' (SEQ ID No:39). ASUchll pre RNA : 5'-CCATGCACCGCACAGAATG-3' (SEQ ID No:40), antisense 5 '-GAAAGCTCCCTCAAATAGGC-3 ' (SEQ ID No:41).
Pre_A0ribosomal RNA : sense
5'-TGTGGTGTCCAAGTGTTCATGC-3' (SEQ ID No:42), antisense5'-CGGAGCACCACATCGATCTAAG-3 (SEQ ID No:43).
AS_Uxt: sense5'-CAACGTTGGGGATGACTTCT (SEQ ID No:44), antisense5'-TCGATTCCCATTACCCACAT (SEQ ID No:45);
Uxt: sense5'-TTGAGCGACTCCAGGAAACT-3' (SEQ ID No:46), antisense 5'-GAGTCCTGGTGAGGCTGTC-3' (SEQ ID No:47).
Multiplex RT PCR was performed with Superscript® III One-Step RT-PCR System with Platinum® Taq DNA Polymerase (Invitrogen) .500 mg of total DNAse traeated RNA was incubated with reverse primers for Gapdh, Uchll, AS Uchll. The reaction was performed for 60 minutes at 60 degrees.
Each volume was then splitted in three and forward primers were added at final concentration of 200nM to the reaction. The PCR reaction comprised 40 cycles of 95 degrees for 15 seconds, followed by 60 degrees for 45 seconds, and final 68 degrees for 30 seconds. Western blot
Cells were lysed in SDS sample buffer 2X. Proteins were separated in 15% SDS-polyacrilamide gel and transferred to nitrocellulose membrane. Immunoblotting was performed with the primary antbodies: anti-Uchll (#3524 Cell Signalling) 1:300 and anti-b actin (A5441, Sigma) 1:5000. Signals were revealed after incubation with recommended secondary antibodies conjugated with horseradish peroxidase by using enhanced chemioluminescence for Uchll (#WBKLS0500 Immobilion Western Chemioluminescent HRP substrate) and ECL detection reagent (RPN2105, GE Healthcare)
Cellular fractionation
Nucleo cytoplasmic fractionation was performed using Nucleo Cytoplasmic separation kit (Norgen) according to manufacturer's instruction. RNA was eluted and DNAsel treated. The purity of the cytoplasmic fraction was confirmed by Real Time qRT-PCR on Pre-ribosomal RNA. Two colour In situ hybridization (ISH)
Reagents: anti DIG antibody D8156 (Sigma); streptavidin HRP RPN 1231-100UL (Amersham Bioscience) ; DIG labeling mix #11277073910 (Roche) BlO-labelling Mix #11685597 910 (Roche), Ribonucleic acid, transfer from baker's yeast R8759 (Sigma), Deoxyribonucleic acid, single stranded from salmon testes D7656 (Sigma), Blocking reagent #11096 176 001 (Roche), TSA Cy3 system (Perkin Elmer, Heidelberg, Germany) .
After perfusion with 4% formaldehyde, the mouse brain was cryoprotected overnight in 30% sucrose. In situ hybridization was performed on cryostat slices (16 um). Sense and antisense probes were generated by in vitro transcription from the cDNA encoding the distal 600 bps of mouse Uchll cDNA and the last 1000 bps of mouse AS Uchll. The probes for Uchll were labeled with digoxigenin, probes for AS Uchll were labeled with biotin. Incorporation of both bioting and digoxigenin was checked via Northern Blot. Slices were pretreated with hydrogenum peroxide 3% for 30 minutes. Hybridization was performed with probes at a concentration of 1 mg/ml (Uchll) and 3 mg/ml for AS Uchll at 60°C for 16 h. For biotinilated RNA detection, streptavidin-HRP was used 1:250 for 2 hours in TNB buffer (Tris HC1 PH 7,5 lOOmM, NaCl 150 mM, 0,5% Blocking Reagent), and signals are visualized using the TSA Cy3 system after washing in TNT buffer (Tris HC1 PH 7,5 lOOmM, NaCl 150 mM, 0,05% tween).
ISH on DIG-labeled probe was performed by incubating slices with monoclonal anti-DIG antibody after TSA reaction. To combine RNA ISH with immunofluorescence, slice were incubated with the antibody anti TH (#AB152, Chemicon) 1:1000. Signals are then detected with fluorescent dye-conjugated secondary antibody goat anti-rabbit 405 and goat anti-mouse 488. Sections were then washed, mounted with Vectashield (Vector lab) mounting medium and observed at confocal microscope (Leica).
Post-mortem human brain samples
Brain samples were obtained from the brain bank at the Institute of Neuropathology, Bellvitge Hospital (University of Barcelona, Spain). Samples were dissected at autopsy with the informed consent of patients or their relatives and the institutional approval of the Ethics Committee of the University of Barcelona. Brains were obtained from Caucasian , pathologically confirmed PD case s and age-matched controls (Navarro et al . , 2009) . Briefly, all case s of PD had suffered from classical PD , none of them had cognitive impairment and their neuropathological characterization was made according to established criteria. Control healthy subj ects showed absence of neurological symptoms and of metabolic and vascular disease s , and the neuropathological study disclosed no abnormalitie s, including lack of Alzheimer disease and related pathology. The time between death and tis sue preparation was in the range of 3 to 5 hours .
Bioinformatic analysis
For the identification of a cadidate human hortologue of AS Uchl l , conservation between human and mouse in the orthologus region of AS uchl l was performed using VI STA genome browser. The inventors selected parameters for conserved sequence tags (CTS) that have a minimum of 75% identity between the mouse and human genome . For each conserved element a primer on the homologus human region was designed .
For the identification of additional translational activator candidates, the inventors searched for FANTOM3 full-length cDNAs that were non-coding RNAs and overlap the 5' end of coding transcripts in a head to head configuration [PMID: 16141072]. The filtered set of 8535 FANTOM3 ncRNA transcripts described in the Nordstrom et al 2009 (Nordstrom, K.J., et al. Critical evaluation of the FANTOM3 non-coding RNA transcripts. Genomics 94, 169-176 (2009).) was used as our starting point. Genomic locations of these ncRNA transcripts and REFSEQ (Maglott, D.R., Katz, K.S., Sicotte, H. & Pruitt, K.D. NCBI's LocusLink and RefSeq. Nucleic Acids Res 28, 126-128 (2000)) coding transcripts were extracted from the alignments in the UCSC Genome browser (Kent, W.J., et al. The human genome browser at UCSC. Genome Res 12, 996-1006 (2002)) to identify a set of 788 coding-sense: non-coding-antisense pairs. The ncRNAs were then checked by repeat masker to identify SINEB2 related sequences (Smit, AFA, Hubley, R 86 Green, P. RepeatMasker Open-3.0.1996-2010
<http://www.repeatmasker.org>). This reduced the number of pairs to 127 protein coding transcripts with overlap at the 5' end (60 with a sense strand version of the repeat, 53 with an antisense version and 14 with both sense and antisense versions) .
Alignment of the SINEB2 related elements was then carried out using Clustalw (http: / / www. ebi.ac.uk/Tools/clustalw2 /index. html. From this analysis the antisense overlapping transcripts with a repeat most like that of Uchll-as and in the same orientation were chosen for experimental testing (Uxtl-AS).
Sequences
As example, the following is a list of sequences that are complementary to protein coding mRNAs. They contain a fraction that provides examples of a target determinant sequence [now in light blue highlight] and a regulatory sequence [how highlighted in red]. The regulatory sequence in this list of natural antisense is as short at 89 nucleotides in this example. The length of the adaptor sequences in this partial list of antisense RNAs is as short as 44 nt.
Below each sequence there is a summary of the alignments with the retrotransposon elements as determined by Repeatmask program.
AK078321 (A3 !Jchll)
Figure imgf000067_0001
ccccacccciccccataaaggcagaataaaagaacgtcctataaacaaataaacaaacaacccaataaaacaaaa ccaagatctctccaccttttotttgctttttcagactitgtaataaggccctttggagtgcaggatattcggcag gaca gcagagagggag ccatcagttctttctttgatcaag agactatgttccttagc aactggtgtgtatt atctcttatgcaat aqcctggaaagagggc cagccaccg ggatggtacagcatggatggatg tacgctaca g gactcgggagcccaactgtgagtggctgactggcacggtaggt. tc ggqaagaattggcctgtgaagaaaatg 11 c τ. t g a a aa g t g a a c a a a g t g c a g g ag g t a g g a g t g ci g t cc t g g g c a a a g c a g g q g g r g c a t c. c c a g o c t c a q g gaaragcacacfcagaggtctgttgatgcatgcg cftgcatga-ccgcttgccaatagacgatcaagaatgggcaa agcatcatgggtgatgagtgggagaggggatgagaca: tc ttt t ccctgctgagacttccattgaaccgatga gttctgaatagaagatgcccccccacecccccaccagtgtagaatctgaagggaggcaiatattaccctatatta ctct gtgttggcggcgagctatctgacagccaaccttcccatacatt tcattgggcatacactaatgacaggaag ttccttttgcttgtatgcaagagatggctcacacgatggagaatttaatcttgttagtttgttatitatgtgtcc taaattttgttcaataaaaatgaaacactcctatg
In Bold overlap region (UchLl) Italic is 72 t>t>
^Th boxed nucleotide CAT is complementary to the CDS starting ATG|
perc :: p-erc q ÷ry pcsitiori i query matching r eat osition in re eat
sc re div. del. ins. sequence igi^ -end (left) at c 1 a≤ s/ f ra 1 y begin end (left) ID
-'01 i¾.7 1.2 10.3 AK078321.1 521 690 (&S5) C 83 SINE/B2 <£G)
156 1 1
303 29.2 2.1 0.0 &K078321.1 730 802 ( 353 < + E1F1 SJLHE Alu 1
77 (50) 2
ANNOTATION EVIDENCE :
701 19.67 1.18 10.se &K078321.1 S21 690 995 CM SINE B2
136 £0 0
AR078321.1 521 G T G C - -ASTGCIiSAC- GA5G TC.¾Gi.¾G.¾SGSCAITG5AT CCC CC iGAsCT 568
--i iv v i i i ii
C B3#SINE/B" 156 GTGCCTGGTGCCCSCGGftC-eOCAGAA iAC-GGCGTCGGATCC C GGAACS 107
AE078321.1 569 SGAGTTATA C-GTAACCTCGTOG^GGTTSTGAi.CCACGf.TGTSGf.TGGM «13 i i i i i
C B3#SINE B2 106 C-GAGTTACA GA TG G TTGTGAG CC GC CAT G TG G GT 72
AK07S321.1 619 AT TGAGTTC CAAACAC TSGT ',- C T GJGCAAGAG CAT C CAC-TGC X C TTAAGT 668
-i i vvi i v " v v v
C B3f SIRE/B2 71 -CTGGGAATCGAACCCGGGTCGTCSGGAAGAGCAGCCAGIGCTCTfAA C 23
AK07S321.1 €€9 GCT'GAGCCAIC3CTII.¾GCTCC 690
ii i
C B3#SIHE/B3 2 GCTGAGCC ATCTCTCCi.G CCC 1
KatiiK = 25p43g -matrix
Transitions / transvsrsions = 2.00 (20 10)
Gap_init rate = 0.02 (3 / 1S¾) , ivg . gap size = 6.00 (18 / 3) AK 029359.1 (AS Uxt) ( SEQ ID No : 8 )
t aq-tctcqctqcaqtaccttcactqataaaq? cactcaacgttggggatgacttctttcggctcgagctacggagt tgcttctgcccaacccg ttttggaactcgttcactcaccqqtacaqqag ^
qcaataaetaccaaaacfaacrttcTtq rgattccct c!aact qaacaaccaacaatttctta acaecatatrjgqta argcrqaatcqaac t gqctcct eta t aactac t gaecaatqe tc 11 aac t a c c aaaat qcat 11 ct t cgg a a g aLtcacataactattatgctatactgtttgaagtatrtattagaaaaacatcagaaagagatttggaccactttc atttacatgaagaaa£atcttagggtttct:ttcaggtaictttgagtatcttctgaoactagaa3atcctgtaa a c t c ac ag a c 11 aa a g aa 11 ga a ga ac c t gg a ag ag - a gacjΐ ta c ca ac aaga g a ccag gg ata g c a r t aacatggrggtta tcaa iac taactcagccagggagacataccaaggcct. at. gaggtg agggaaaagaa gg tgaccc aagggc gcjaatt tttatccrga rtttg gc rtatagaaaaacataatttgttgggcatgtttt ctgaccoteatacagttuta:aaccatttgaagatatagttctagctctagtaggctctacaggaaggtatatc aMetttttaaeafl.¾eactitattattttaaat.t»t..otattteaectgcat«aac8caeaotaceeac«.a qactagaacjaa atgttcacia ctcctqaaactqgaa taatacttqtaaqc-gccatqtj atctctaaaaatcaa acccaaqtccttragaagacacTacaaatqctcttaatca-.aaaaacat tcttcaGctccraccctaattcttta
Figure imgf000068_0001
In Bold overlap region,, (UehLl.)
SB pe rc f ?:c p ere guery po s i ti- n i que y mat c i ng rep at po si t ion in r epe a t
sco e div. sequenc begin nd (left) eat c 1 a s s / f ami iy begi (left) It
617 1 S .5 0.3 2.3 1€ 0 2S0 (355) C E3
179} IS5 1
SS3 IS .9 12.3 0.5 774 950 t 135 ) C 33 ??Ν5/Β
(7) 209 1 2
327 27.5 6.1 4.3 077 10 SO ! 55 ) C PE1 10 srns Aiu
(0) 117 2 3
ANNOTATION EVIDENCE:
617 19.54 0.76 2.33 OnnamedSe que nee 160 290 556 C B3 SI E B2
9 137 79 2
AK0293S .1 160 SCCAGAAGAAGTTGTGGGATTCCCTGGAACTGGAGCAACCAACAGTTTGT 209 i vi v i iv vi ii
C B3#SIME,'B2 137 GCCAGAAGAGGGCGTCGGATCCCCTGGAACTGGAC-TTACA ATSGI -GT 89
AK0293S9.1 210 GTGC- CCATGTGGGTA T GG TCGAAC TGGGICC ICTA AAG CTG 253
V -i iv i i
- E3#SINE B2 33 OAGCCGCCATG GGGTGCTGGGAATCGAACCCGGGTC'CTCTGGAAGA.GCA 39
A.K029359.1 259 GC CAC-TGCTCTTAACTACTGA5GTG CATTTCT 250
i i v - - i
C B3tSINE B2 3S GCCAG GCTCTTAACCGCTGAGC- -CATCTCT 9
Matrix = 25p43g.«-«trix
Transitions / trans vers i ns -- 1.72- (16 5)
Gap_iiiit rate = 0.02 {3 130), avg. gap size = 1.33 (4 3>
ANNOTATION EVIDENCE:
383 19.39 12.30 0.48 'un.namedSequence 774 960 72 C B3 SINE/E2
1 209 1
AK029359.1 774 T ATTTTAAATAT T AGTATTTCACCTGC TAG GCG AC 9-3 vi i i ii iv i
C E2#SIBE B2 2C9 TTATΓΤ TATGTGTA GAGTGTTTTGCCTGCATG ATGTCTC-TGCAC ACG 150
AED2935 .1 314 AGTACCCACAGAGACTAGAAGAGGG-GGCAGATCTCC GAG S54 i i i i i i i v i i ii C B 3 tS IHE ,'B2 139 TGCGTGCCTGGTGCCCGCGGAG CC GAAGAGGGCGTCGGATCCCCTGGA 11 AE029355.1 855 ACTGGAGTTA AΓGC1 GTGAGCTGC ATGTGGATGC TGGAAATCAAA 901 v i i i i C B3#SIME/B2 109 ACTGGAGT C GAT GT GTGAGCCGCC T GGT CTGGGAATCGAA SO AK029359.1 902 CCAGGTCCTT GGAAG - GCAGGC GT TC T A C T GAA C T T 950 i i - - i iiv iv
C B3#SIHS,'B2 59 CCGOGTCCTC GGAAGAGCAGCCAG-TGCT TTAACCGC GAGCCATCT 11 AK0293S .1 951 CTTCAGCTCC 960
i i
C B3#SINE B2 10 CTCCAGCCCC 1 Other sequences in the study:
B2#S 1 NE/B2 (SEQ ID No: 9)
gggctggagagatggctcagtggttaagagcacctgactgctcttccagcggtcct agttcaattcccagcaaccacat ggtggctcacaaccatctgtaatgagatctgatgccctcttetggt tgtctgaagacagctacagtgtacttacatata ataaataaataaataaataaatcttaaaaaaaaaaaaaagaaagaaaaa
>B3#S1 NE/B2 216 b (SEO ID Mo: 10)
GGGGCTGGAGAGATAGCTCAGCGGTTAAGAGCACTGGCTGCTCTTCCAGAGGACCCGGGTTCGGTTCCCAGCACCCACAT GGCGGCTCACAACCGTCTGTAACTCTAGTTCCAGGGGATCTRACNCCCTCTTCTGACCTCCACGGGCACCAGGCACGCAC GTGGTACACAGACGTACATGCARGCAAAACACTCATACACATAAAATAAAAATAAATMTTTWAAAAAA
UchM cloned i to Pme-blunt site of pcDMA 3.1-(SE0 ID No: 10
CGGCTCCTCGGGTTTGTGTCTGCAGGTGCCATCCGCGAAGATGCAGCTGAAGCCGATGGAGATTAACCCCGAGATGCTGA ACAAAGTGTTGGCCAAGCTGGGGGTCGCCGGCCAGTGGCGCTTCGCCGACGTGCTAGGGCTGGAGGAGGAGACTCTGGGC TCAGTGCCATCCCCTGCCTGCGCCCTGCTGCTCCTGTTTCCCCTCACGGCCCAGCATGAAAACTTCAGGAAAAAGCAAAT TGAGGAACTGAAGGGACAGGAAGTTAGCCCTAAAGTTTACTTCATGAAGCAGAGCATCGiGAAACTCGTGTGGTACCATCG GGTTGATCCAGGCAGTGGCCAACAACCAAGACAAGCTGGAATTTGAGGATGGATCCGTCCTGAAACAGTTTCTGTCTGAA ACGGAGAAGCTGTCCCCCGAAGATAGAGCCAAGTGTTTCGAGAAGAACGAGGCCATCCAGGCGGCCCATGACTCCGTGGC CCAGGAGGGCCAGTGTCGGGTAGATGACAAAGTGAATTTCCATTTTATTCTGTTCAACAACGTGGACGGCCATCTGTACG AGCTCGATGGGCGAATGCCCTTTCCAGTGAACCATGGCGCCAGCTCAGAGGACTCTCTGCTGCAGGATGCTGCCAAGGTC TGCAGAGAATTCACTGAGCGCGAGCAGGGGGAGGTCCGCTTCTCTGCCGTGGCTCTCTGCAAAGCAGCTTAAGTCTGGGG AGAGAGAACCAGCCGATCCCCCCTTCCCTG6GCAGGTGCGCGCGGCCCGCCCTTGGTTTGCAGCTTTAGCACTTAGAACC ACAGCTGTCTTCTTGCGTTCTACAGCCCCATCCCCTCCACCCCACCCAGGCCACCAGGGGGCTCTGTCACAGCCACACCA
G6CTGAGCACTTTCCCTCGTGTGT6TCTCGTACCTTGCTCTCTACGGTCTCTTTGGTTTCTGTCTGTAAGTTACGGCCCT GGATGTGGTTTGTCTAGTCCTTAAGAGGAAGAATAAAACTTTGCTGGTGAGAG
AS Uch 11 full length cloned into Xba-Hindl I site in pcDNA3, 1-(SE0 ID Ho: 12)
ACAAAGCTCAGCGCACACGTGGCTCGCGCGAAGCCCTCGGACTAGAGTCCGCGGGCCGTCGCCACGCCCTCGAGAGCTGC
TCCCCGCGCTCGTTGCTGTCCGGGTCCATCCTCCGCCACCTCCCCGTGATCGATCTCTCAGTCACTCCCAAACCCCTAGA
TAACTCAGGGCAGAGACGACACCCAGCTGGGCGcCCCAGCCCAGCCACCTCCATTGCACAGGGCGCGGCCGGCTGGGCGT
CTCCAAACGATGCTCTTGGAGGATAGG6ACAGAGACTGCGCGCCGCGCCACTCACTTT6TTCAGCATCTGAAAGCCAAAA
GCAAAGAGGAAAATGATAATAAAACTAAATGATTCAGCTACCGAGCTGTAGCTAAGGGTCAGCCTTATTTCTCCCGAAGC
GACCCAGCAGCTATGCTTACCTCGGGGTTAATCTCCATCGGCTTCAGCTGCATCTTCGCGGATGGCACCTGCAGACACAA
ACCCGiAGGAGCGGAAAAAACAGCCGGTGGiAGCCGCCCAGGCTGCTGTTATAAAGCGCCGGCCTCGCTCACTGGGAAAGCC
TGAGCAGGGGAGACGGGAGCAGAAACAAGCAGAGGAGGAAGGCCAAGAGGGCTCGAACTCCCCCATGCACCGCACAGAAT
GGTACAAGCCAAGCCCCCAAACCTTGCAGTCTCACTCGCCGAAGTGCTCCCCGGACTGGGCATGGTAGCACGCACCTGIG
ATTCCAGCAGCTGAGAGAGAGGCCGAGCCCACATGGAATCCATTGTGCAGTGCTAGAGGAGGTCAGAAGAGGGCATTGGA
TCCCCCAGAACTGGAGTTATACGGIAACCTCGTGGTGGTTGTGAACCACCATGTGGATGGATATTGAGTTCCAAACACTG
GTCCTGTGCAAGAGCATCCAGTGCTCTTAAGTGCTGAGCCATCTCTTTAGCTCCAGTCTCTTAAAAAACAAACAAACGAA
CGAACAGCAAGGGAGCTGGGTATGACAACACATACTATAATTCTAGTACTCAGGATGCTGAAACAGGAGGATTGCCTGAC
TGGGAGATATAAGGAGAATCTGTTGTCACCCCCACGCCTCCCCATAAAGGCAGAATAAAAGAACGTCGTATAAACAAATA
AACAAAGAACCCAATAAAACAAAAGCAAGATCTCTCCACCTTTTCTTTGC!TTTTCAGACTTTGTAArAAGGCCCTTTGG
AGTGCAGGATATTCGGCAGGACAAGCAGAGAGGGAGACCATCAGTTCTTTCTTTGATCAAGAAGACTATGTTCCTTAGCA
AACTGGTGTGTATTATCTCTTATGGAATGAGCCTGGAAAGAGGGCACAGCCACCGAGGATGGTACAGCATGGATGGATGG
TACGCTACAGAGACTCGGGAGCCGAACTGTGAGTGGCTGACTGGCATGGTAGGTTCAGGGAAGAATTGGCCTGTGAAGAA
AATGTTCTTGAAAAGTGAACAAGGTGCAGGAGGTAGGAGTGGGTCCTGGGCAAAGCAGGGGGTGCATCCCAGCCTCAGGG
AATAGCACAGCAGAGGTCTGTTGATGCATGCGAGTGCATGACCTGCTTGCCAATAGACGATCAAGAATGGGCAAAGCATC
ATGGGTGATGAGTGGGAGAGGGGATGAGACATTCCTTTCTCCCTGCTGAGACTTCCATTGAACCGATGAGTTCTGAATAG
AAGATGCCCCCCCACCCCCCCACCAGTGTAGAATCTGAAGGGAGGCATATATTAGCCTATATTACTCTGTGTTGGCGGCG
AGCTATCTGACAGCCAACGTTCCCATACATTTCATTGGGCATACACTAATGACAG6AAGTTCCTTTTGCTTGTATGCAAG
AGATGGCTCACACGATGGAGAATTTAATCTIGTTAGTTTGTTATTTATGTGTCCTAAATTTTGTTCAATAAAAATGAAAC
ACTCCTATG The examples of SINE B2 embedded in cD NA clone s sequence are as following, but is limited to them .
Legend; cDNA cloneID_alignment
Gene Start
with St position_Alignent
AS_refse start end ra subty end_type of Repeat q B2 B2 nd pe element
NM 177 B2_M SINE/ >AK032380_973_1 182 973 1013 -2766 + m2 B2 2 42 - 153 013_+_B2_Mm2
NM 009 B2_M SINE/ >A 033525_859_1 351 859 1044 - 1470 + m lt B2 2 185 -8 044_+_B2_Mm lt
NM_1 4 B2_M SINE/ >AK033993_1564_ 515 1564 1718 -761 + m2 B2 1 158 -37 1718_+_B2_Mm2
NM 198 B2_M SINE/ >AK039361_520_7 300 520 712 - 1 160 + m2 B2 1 188 -7 12_+_B2_Mm2
NM 028 B2_M SINE/ >AK042841_1801_ 428 1801 1997 -245 + m lt B2 1 193 0 1997_+_B2_Mm lt
NM 010 B2_M SINE/ >AK043817 946_1 661 946 11 11 - 1515 + m2 B2 1 195 0 1 1 l_+_B2_Mm2
NM 007 B2_M SINE/ >AK044205_722_9 485 722 912 -417 + m2 B2 1 194 - 1 12_+_B2_Mm2
NM 010 B2_M SINE/ >AK047213_971_1 633 971 1 164 -67 + m2 B2 1 195 o^ ; 164 +_B2_Mm2
NM 030 B2_M SINE/ >AK079217_714_7 207 714 787 -446 + m2 B2 1 88 - 107 87 + B2 Mm2
NM 145 B2_M SINE/ >AK081722_1498_ 470 1498 1697 - 1057 + m2 B2 1 193 -2 1697_+_B2_Mm2
NM 024 B2_M SINE/ >AK132990_1379_ 282 1379 1555 -2 + m2 B2 2 187 -8 1555_+_B2_Mm2
NM 133 B2_M SINE/ >A 133457_1001_ 994 1001 1057 -86 + m2 B2 2 58 - 137 1057_+_B2_Mm2
NM 133 B2_M SINE/ >AK133457_1057_ 994 1057 1 137 -6 + m2 B2 91 171 -24 U37_+_B2_Mm2
NM 178 B2_M SINE/ >AK133632_2323_ 244 2323 2513 -45 + m2 B2 1 195 0 2513_+_B2_Mm2
NM 008 B2_M SINE/ >A 133808_734_9 997 734 923 -3 + m2 B2 1 186 -9 23_+_B2_Mm2
NM 080 B2_M SINE/ >AK134674_286_3 555 286 382 -4 + mlt B2 75 171 -22 82 + B2 Mmlt
NM 010 B2_M SINE/ >AK135599_2428_ 332 2428 2606 - 1 + m2 B2 1 183 -12 2606_+_B2_Mm2
NM 172 B2_M SINE/ >A 137583_2948_ 467 2948 3108 -3 + m2 B2 1 162 -33 3108_+_B2_Mm2
NM_175 B2_M SINE/ >AK138675_81_27 1 15 81 274 -2006 + m2 B2 2 195 0 4 + B2 Mm2
NM 010 B2_M SINE/ >AK155102_3150_ 071 3150 3339 -54 + m2 B2 1 195 0 3339_+_B2_Mm2
NM_183 SINE/ >AK015655_288_4 014 288 442 -20 + B3A B2 48 198 0 42_+_B3A
NM 026 SINE/ >A 021299_277_4 555 277 435 -24 + B3A B2 40 198 0 35_+JB3A
NM 033 SINE/ >AK029689_1 109_ 077 1 109 1295 - 1732 + B3A B2 5 189 -9 1295_+_B3A
NM 019 SINE/ >A 030353_1052_ 789 1052 121 1 - 1 195 + B3 B2 33 196 -20 121 1_+_B3
NM_178 SINE/ >AK030551_2403_ 891 2403 2558 -3 + B3 B2 20 176 -40 2558_+_B3
NM 145 SINE/ >A 031007 2546_ 579 2546 2719 -346 + B3 B2 2 206 - 10 2719_+_B3 NM_008 SINE/ >AK034030_2255_ 510 2255 2404 -429 + B3A B2 57 198 0 2404_+_B3A
NM 153 SINE/ >AK035406_1071_ 579 1071 1262 -798 + B3 B2 1 214 -2 1262_+_B3
NM 145 SINE/ >AK037188_1006_ 942 1006 1219 -681 + B3 B2 2 216 0 1219_+_B3
NM 025 SINE/ >AK039409 1871 788 1871 2045 -757 + B3 B2 1 215 - 1 2045_+_B3
NM_008 SINE/ >AK040162_877_1 019 877 1044 - 1057 + B3 B2 2 21 1 -5 044_+_B3
NM 001 SINE/ >A 040401_1431_ 081475 1431 1582 -6 + B3 B2 69 216 0 1582_+_B3
NM 001 SINE/ >AK040401_1586 081475 1586 1745 -2 + B3 B2 3 206 -10 1745_+_B3
NM_007 SINE/ >AK044205_722_8 485 722 810 -519 + B3 B2 1 89 - 127 10_+_B3
NM 007 SINE/ 13 >AK044205 835 9 485 835 912 -417 + B3 B2 8 215 - 1 12_+_B3
NM 178 SINE/ >A 045196 826 9 794 826 959 -986 + B3A B2 2 129 -69 59_+_B3A
NM 008 SINE/ >AK046652_737_9 915 737 940 -298 + B3 B2 8 201 - 15 40_+_B3
NM 010 SINE/ >AK047213 971 1 633 971 1096 - 135 + B3 B2 1 129 -87 096_+_B3
NM 199 SINE/ >AK047540 3267 476 3267 3405 - 1039 + B3 B2 2 149 -67 3405_+_B3
NM 144 SINE/ >AK048854_2052_ 795 2052 2248 -546 + B3 B2 2 210 -6 2248_+_B3
SINE/ >AK049524_1858
#N/A 1858 2028 -5 + B3A B2 1 176 -22 2028_+_B3A
NM 001 SINE/ >AK053130_1207_ 038621 1207 1363 -359 + B3A B2 2 160 -38 1363_+_B3A
NM 181 SINE/ >AK054359_1666_ 423 1666 1733 -71 + B3A B2 2 72 - 126 1733_+_B3A
NM 153 SINE/ >AK078013 1403 515 1403 1520 -470 + B3A B2 63 183 - 15 1520 + B3A
NM 198 SINE/ >A 078328_403_6 415 403 623 - 1212 + B3 B2 1 216 0 23_+_B3
NM 152 SINE/ >AK078537_1794 220 1794 1979 -561 + B3 B2 3 213 -3 1979_+_B3
NM 025 SINE/ >AK079403_1_165 729 1 165 -203 + B3 B2 15 177 -39 _+_B3
NM 016 SINE/ >A 080235 1307 693 1307 1517 - 13 + B3 B2 2 216 0 1517_+_B3
NM 010 SINE/ >AK082108_814_1 151 814 1024 -451 + B3 B2 2 216 0 024_+_B3
NM 009 SINE/ >A 082325_1690_ 713 1690 1882 -5 + B3 B2 1 199 - 17 1882_+_B3
NM_001 SINE/ 10 >AK084376_221_2 029985 221 280 - 1 179 + B3 B2 8 168 -48 80_+_B3
NM 009 SINE/ >A 085337_1805_ 737 1805 2005 -406 + B3 B2 1 207 -9 2005_+_B3
NM_027 SINE/ >AK086470 984 1 081 984 1 130 - 1 155 + B3 B2 1 162 -54 130_+_B3
NM 018 SINE/ >AK089148_876 1 779 876 1062 -530 + B3A B2 2 188 - 10 062_+_B3A
NM_027 SINE/ >AK090182_1468_ 919 1468 1667 - 185 + B3 B2 1 213 -3 1667_+_B3
NM_01 1 SINE/ >AK131819_434_6 034 434 608 - 12 + B3 B2 2 216 0 08_+_B3
NM 175 SINE/ >AK132737_1802_ 551 1802 1895 -513 + B3A B2 64 176 -22 1895_+_B3A
NM_175 SINE/ 10 >A 132737_1829 551 1829 1928 -480 + B3 B2 1 213 -3 1928_+_B3 NM_007 SINE/ >AK133325_951_1 921 951 1 134 - 1650 + B3A B2 3 187 - 1 1 134_+_B3A
NM_001 SINE/ >A 134755_1220_ 039042 1220 1315 -292 + B3A B2 48 142 -56 1315_+_B3A
NM_177 SINE/ >A 134874_1378_ 328 1378 1504 -285 + B3 B2 85 216 0 1504_+_B3
NM 021 SINE/ >AK135206 1172 899 1172 1259 - 140 + B3 B2 1 95 - 121 1259_+_B3
NM_008 SINE/ >A 136279_1521_ 705 1521 1717 -572 + B3A B2 1 197 - 1 1717_+_B3A
NM_001 SINE/ >AK137643 21 16 079932 21 16 2299 -702 + B3 B2 6 208 -8 2299_+_B3
NM 001 SINE/ >AK137643_3059_ 079932 3059 3253 -2 + B3 B2 4 205 - 1 1 3253_+_B3
NM_001 SINE/ >AK138296_2524_ 033286 2524 2698 -63 + B3A B2 4 181 - 17 2698_+_B3A
NM 008 SINE/ >AK138521_928_1 962 928 1095 -375 + B3 B2 1 153 -63 095_+_B3
NM_175 SINE/ >A 139254 2151 349 2151 2347 - 181 + B3A B2 1 1 196 -2 2347_+_B3A
NM 177 SINE/ >A 139647_1277_ 003 1277 1466 0 + B3 B2 1 200 - 16 1466_+_B3
NM 007 SINE/ >A 140072_1338_ 965 1338 1488 -5 + B3 B2 51 216 0 1488_+_B3
NM_010 SINE/ >A 140346 1808 192 1808 1933 -45 + B3 B2 1 126 -90 1933_+_B3
NM_027 SINE/ >A 140616_1871_ 446 1871 1983 -2794 + B3A B2 1 130 -68 1983_+_B3A
NM_027 SINE/ 13 >A 140616_2318_ 446 2318 2342 -2435 + B3A B2 1 156 -42 2342 + B3A
NM_177 SINE/ 13 >AK142359_2061_ 186 2061 2142 -351 + B3 B2 0 21 1 -5 2142_+_B3
NM_145 SINE/ >AK142507_2963_ 134 2963 3148 - 1292 + B3 B2 28 210 -6 3148_+_B3
NM 009 SINE/ >A 142879_2740_ 890 2740 2968 - 135 + B3 B2 1 216 0 2968_+_B3
NM 146 SINE/ >AK143143_5202_ 055 5202 5272 -94 + B3 B2 60 141 -75 5272_+_B3
NM 008 SINE/ >AK143279_1344_ 977 1344 1513 -645 + B3 B2 11 205 - 11 1513_+_B3
NM 026 SINE/ >AK149843_2001_ 036 2001 2167 -272 + B3A B2 1 169 -29 167_+_B3A
NM 001 SINE/ >AK157402_1440_ 159519 1440 1548 - 1422 + B3A B2 55 163 -35 1548_+_B3A
NM_001 SINE/ >AK157402_2503_ 159519 2503 2556 -558 + B3 B2 1 56 - 160 2556_+_B3
NM 001 SINE/ 10 >AK157402_2544_ 159519 2544 2616 -498 + B3 B2 9 177 -39 2616_+_B3
NM 001 SINE/ >AK157402_2702_ 159519 2702 2896 -412 + B3A B2 1 198 0 2896_+_B3A
NM_001 SINE/ >AK160921_1778_ 1 10504 1778 1909 -25 + B3 B2 58 210 -6 1909_+_B3
NM 030 SINE/ >AK165234_2153_ 714 2153 2335 -62 + B3 B2 40 216 0 2335_+_B3
NM 025 R B2_M SINE/ >AK014613_945_1 825 945 1052 -383 C mla B2 -85 108 1 052_RC_B2_Mml a
NM 133 R B2_M SINE/ >AK016234_1 102_ 756 1 102 1289 -246 C m2 B2 -4 191 1 1289_RC_B2_Mm2
>AK029702 1565
NM_183 R B2_M SINE/ 1750_RC_B2_Mml 294 1565 1750 - 1384 C m la B2 -8 185 4 a
NM 009 R B2_M SINE/ >AK030803 531 7 446 531 710 -2730 C m2 B2 -6 189 2 10_RC_B2_Mm2 NM 025 R B2_M SINE/ >A 039409_1687_ 788 1687 1839 -963 C m2 B2 - 1 1 184 1 1839_RC_B2_Mm2
NM 177 R B2_M SINE/ >AK040275_1626_ 785 1626 1682 - 1130 C m2 B2 -4 191 137 1682_RCJB2_Mm2
NM 177 R B2_M SINE/ >AK040275_1682_ 785 1682 1739 - 1073 C m2 B2 -94 101 46 1739_RC_B2_Mm2
NM 177 R B2_M SINE/ >AK040275_1776_ 785 1776 1952 - 1036 C mlt B2 - 13 180 2 1952_RC_B2_Mmlt
NM 007 R B2_M SINE/ >A 044205_1 137_ 485 1 137 1341 - 192 C m2 B2 0 195 2 1341_RCJ32_Mm2
NM 175 R B2_M SINE/ >AK048762_537_7 273 537 714 -1793 C m2 B2 -5 190 1 14_RC_B2_Mm2
NM 029 R B2_M SINE/ >AK049449_1005 409 1005 1172 -2204 C mlt B2 - 14 179 1 U72_RC_B2_Mmlt
NM_007 R B2_M SINE/ >AK054076_282_4 836 282 407 -2067 C m2 B2 -67 128 2 07_RC_B2_Mm2
NM 007 R B2_M SINE/ >AK054076_1764_ 836 1764 1860 -614 C m2 B2 -97 98 2 1860_RC_B2_Mm2
NR 0028 R B2_M SINE/ >AK076350_1_181 91 1 181 -2344 C mla B2 - 10 183 2 RC B2 Mmla
NM 026 R B2_M SINE/ >AK076438_984_1 500 984 1 157 - 1501 C m2 B2 - 14 181 1 157_RC_B2_Mm2
NM 052 R B2_M SINE/ >A 079094_2158 994 2158 2323 - 1225 C m2 B2 -4 191 8 2323JRC_B2_Mm2
NM 153 R B2_M SINE/ >AK086953_1870_ 100 1870 2057 - 1774 C m2 B2 0 195 1 2057_RC_B2_Mm2
NM 175 R B2_M SINE/ >AK132441_2088_ 313 2088 2261 -2958 C m2 B2 -9 186 14 2261_RC_B2_Mm2
NM 001 R B2_M SINE/ >A 133162_5305_ 114140 5305 5461 -1 145 C m.2 B2 : -38 ; 1-57 2· 5461_RC_B2_Mm2
NM 009 R B2_M SINE/ >AK137370_1059_ 579 1059 1251 -2941 C m2 B2 0 195 1 1251_RC_B2_Mm2
NM 010 R B2_M SINE/ >AK138181_1613_ 567 1613 1794 - 1882 C m2 B2 -2 193 1 1794_RC_B2_Mm2
NM_001 R B2_M SINE/ >AK141 165_2088_ 008423 2088 2222 -57 C m2 B2 -60 135 1 2222_RCJ32_Mm2
NM 199 R B2_M SINE/ >AK14141 1_935_1 027 935 1064 -63 C m2 B2 -65 130 1 064_RC_B2_Mm2
NM_001 R B2_M SINE/ >AK145736_3103_ 033316 3103 3283 -440 C m2 B2 -5 190 2 3283_RC_B2_Mm2
NR 0034 R B2_M SINE/ >A 147092_748_8 92 748 810 -977 C mla B2 -6 187 123 10_RC_B2_Mmla
NM 010 R B2_M SINE/ >AK148373_935_1 567 935 1129 -78 C m2 B2 0 195 2 129_RC_B2_Mm2
NM 026 R B2_M SINE/ >AK155374_3593_ 1 15 3593 3791 -204 C m2 B2 - 1 194 1 3791_RC_B2_Mm2
NM 010 R B2_M SINE/ >AK157261_1080_ 398 1080 1265 -909 C m2 B2 -8 187 1 1265_RC_B2_Mm2
NM 007 R B2_M SINE/ >AK163105_764_8 893 764 820 - 1012 C m2 B2 -94 101 47 20_RC_B2_Mm2
NM_007 R B2_M SINE/ >AK163105_894_1 893 894 1062 -938 C m2 B2 - 13 182 1 062_RC_B2_Mm2
NM_007 R B2_M SINE/ >AK163105_1390_ 893 1390 1436 -564 C m2 B2 -5 190 137 1436_RC_B2_Mm2
NM 007 R B2_M SINE/ >AK163105_1436_ 893 1436 1490 -510 C m2 B2 -94 101 47 1490_RC_B2_Mm2
NM 007 R B2_M SINE/ >AK163105_1543_ 893 1543 1701 -299 C mlt B2 -24 169 1 1701_RC_B2_Mmlt
NM 177 R B2_M SINE/ >A 163831_1783_ 186 1783 1964 -258 C mlt B2 -7 186 2 1964_RC_B2_Mm lt
NM 030 R B2_M SINE/ >AK165234_1401_ 714 1401 1588 -809 C m2 B2 0 195 3 1588_RC_B2_Mm2
NM 001 R B2_M SINE/ >A 169421_1253_ 1 10101 1253 1420 - 1 139 C m2 B2 -22 173 2 1420_RC_B2_Mm2 NM_007 R SINE/ >A 016423_387_5 601 387 544 -1715 C B3A B2 -22 176 1 44_RC_B3A
NM_027 R SINE/ >AKO 19925 1459_ 346 1459 1690 -74 C B3 B2 -2 214 1 1690_RC_B3
NM_138 R SINE/ - 14 >AK028982_1382_ 664 1382 141 1 - 1334 C B3A B2 8 50 21 141 1_RC_B3A
NM_013 R SINE/ >A 029359 160 2 840 160 290 -556 C B3 B2 -79 137 9 90 RC B3
NM_013 R SINE/ >AK029359 774_9 840 774 960 -72 C B3 B2 -7 209 1 60_RC_B3
NM_153 R SINE/ >AK032194_769_9 591 769 982 - 1569 C B3 B2 -6 210 1 82_RC_B3
NM_028 R SINE/ >AK032215 1926 794 1926 2130 -654 C B3 B2 - 12 204 2 2130_RC_B3
NM_001 R SINE/ >AK034331_1317_ 01231 1 1317 1437 - 1013 C B3 B2 -44 172 38 1437_RC_B3
NM_001 R SINE/ >A 034331 1335 01231 1 1335 1437 - 1013 C B3A B2 -54 144 38 1437_RC_B3A
NM 134 R SINE/ >A 035015 1094 122 1094 1205 -719 C B3 B2 -88 128 1 1205_RC_B3
NM_153 R SINE/ >A 035406 1443 579 1443 1617 -577 C B3 B2 -2 214 45 1617_RC_B3
NM 153 R SINE/ >AK035406 1483 579 1483 1633 -561 C B3A B2 - 18 180 27 1633_RC_B3A
NM 001 R SINE/ >AK039704 1615 081014 1615 1715 -218 C B3A B2 -88 1 10 1 1715_RC_B3A
NM_018 R SINE/ >A 040672 432_5 747 432 531 - 1672 C B3A B2 -31 167 49 31_RC_B3A
NM_176 R SINE/ >A 041236 1677_ 841 1677 1886 -64 C B3 B2 0 216 2 1886 RC B3
NM 133 R SINE/ >A 041654 1676 878 1676 1882 -314 C B3 B2 -7 209 1 1882_RC_B3
NM_145 R SINE/ >AK041742 2334 215 2334 2533 -484 C B3 B2 0 216 3 2533_RC_B3
NM_145 R SINE/ >A 042861 1 132 369 1 132 1336 -593 C B3 B2 -7 209 5 1336 RC B3
NM 172 R SINE/ >A 043958 248 4 691 248 442 - 151 C B3A B2 - 18 180 10 42_RC_B3A
NM_007 R SINE/ >A 044205_938_1 485 938 1 127 -202 C B3 B2 -37 179 2 127_RC_B3
NM_007 R SINE/ >AK044205 989_1 485 989 1 127 -202 C B3A B2 -57 141 2 127_RC_B3A
NM 007 R SINE/ >AK045677 592_7 925 592 713 -719 C B3 B2 -54 162 39 13_RC_B3
NM_177 R SINE/ - 16 >AK046828_3566_ 006 3566 3620 - 1 104 C B3 B2 0 56 2 3620_RC_B3
NM 010 R SINE/ >AK047213 431_6 633 431 640 -591 C B3 B2 -4 212 8 40_RC_B3
NM 010 R SINE/ >AK047213 457_6 633 457 640 -591 C B3A B2 -7 191 8 40_RC_B3A
NM_008 R SINE/ >AK047301_1460_ 842 1460 1636 -53 C B3A B2 -4 194 10 1636_RC_B3A
NM 199 R SINE/ >AK047540 2716 476 2716 2780 - 1664 C B3A B2 -36 162 98 2780 RC B3A
NM 013 R SINE/ >AK048309_1203_ 514 1203 1416 -31 1 C B3 B2 0 216 1 1416_RC_B3
NM 080 R SINE/ >A 048747_2342_ 793 2342 2396 - 1333 C B3A B2 -5 193 144 2396_RC_B3A
NM_080 R SINE/ >AK048747_2430_ 793 2430 2530 - 1 199 C B3A B2 -55 143 47 2530_RC_B3A
NM_001 R SINE/ >AK053130 159 2 038621 159 275 - 1447 C B3 B2 -56 160 34 75_RC_B3
NM_007 R SINE/ >AK054076_1747_ 836 1747 1860 -614 C B3 B2 -97 1 19 2 1860_RC_B3 NM_010 R SINE/ >AK078161_1134_ 878 1134 1337 -1192 C B3 B2 0 216 1 1337 RC B3
NNL.011 R SINE/ >A 078321_521_6 670 521 690 -995 C B3 B2 -60 156 1 90_RC_B3
NM 026 R SINE/ >A 079515_882_1 086 882 1046 -355 C B3A B2 -18 180 1 046_RC_B3A
NM_025 R SINE/ >A 080749 1081 396 1081 1179 -370 C B3 B2 -27 189 75 1179_RC_B3
NM_007 R SINE/ >A 086589_2420_ 923 2420 2567 -582 C B3A B2 -48 150 4 2567_RC_B3A
NM 028 R SINE/ >AK090347 1420 427 1420 1597 -495 C B3 B2 -5 211 2 1597_RC_B3
NM_026 R SINE/ >AK132393_1871_ 157 1871 2066 -1227 C B3A B2 0 198 5 2066_RC_B3A
NM_026 R SINE/ -13 >AK132393_2342_ 157 2342 2408 -885 C B3A B2 1 67 1 2408_RC_B3A
NMJD26 R SINE/ >AK132393_2473_ 157 2473 2606 -687 C B3A B2 -25 173 28 2606_RC_B3A
NM 175 R SINE/ >AK132441 2113 313 2113 2261 -2958 C B3 B2 -40 176 14 2261 RC B3
NM_175 R SINE/ >AK132441_4127_ 313 4127 4308 -948 C B3 B2 -6 210 28 4308_RC_B3
NM_024 R SINE/ >A 132990 1137 282 1137 1290 -91 C B3A B2 -39 159 1 1290_RC_B3A
NM 177 R SINE/ >AK134874 277 3 328 277 358 -1283 C B3A B2 -56 142 66 58_RC_B3A
NM_177 R SINE/ -13 >AK134874_405_4 328 405 484 -1157 C B3A B2 3 65 1 84_RC_B3A
NM_177 R SINE/ >A 134874_545_7 328 545 713 -928 C B3A B2 -4 194 14 13_RC_B3A
NM 177 R SINE/ >AK134874 787 9 328 787 971 -670 C B3A B2 -4 194 7 71_RC_B3A
NM_021 R SINE/ >AK135206_161 3 899 161 307 -1092 C B3A B2 -46 152 1 07_RC_B3A
NM_010 R SINE/ >AK135599_228_4 332 228 409 -1967 C B3 B2 -28 188 2 09_RC_B3
NM 172 R SINE/ >AK143014 1470 407 1470 1683 -74 C B3 B2 -5 211 2 1683_RC_B3
NM_001 R SINE/ >AK143784_1389_ 009935 1389 1495 -157 C B3 B2 -96 120 1 1495_RC_B3
NM_019 R SINE/ >AK145079_2953_ 827 2953 3143 -1064 C B3 B2 -1 215 1 3143_RC_B3
NM Oil R SINE/ >AK148045 2131_ 212 2131 2283 -1263 C B3A B2 -47 151 2 2283_RC_B3A
NM_010 R SINE/ >AK148373_984_1 567 984 1129 -78 C B3A B2 -60 138 2 129_RC_B3A
NM_001 R SINE/ >AK149403_1406_ 110504 1406 1594 -400 C B3A B2 -10 188 2 1594_RC_B3A
NM_026 R SINE/ >AK149843_2270_ 036 2270 2439 0 C B3 B2 -4 212 27 2439_RC_B3
NM_010 R SINE/ >AK157261_1292_ 398 1292 1476 -698 C B3A B2 -11 187 3 1476_RC_B3A
NM_001 R SINE/ -11 >AK160921 1292 110504 1292 1362 -572 C B3A B2 2 86 11 1362_RC_B3A
NM_007 R SINE/ >AK163105 1080 893 1080 1254 -746 C B3 B2 0 216 21 1254 RC B3
NM_007 R SINE/ >A 163105 1427 893 1427 1491 -509 C B3A B2 -82 116 46 1 91_RC_B3A
NM_030 R SINE/ >AK165234_1954_ 714 1954 2064 -333 C B3 B2 -95 121 2 2064_RC_B3
NM_001 R SINE/ >A 169421 853 1 110101 853 1043 -1516 C B3 B2 -5 211 6 043_RC_B3
NM_001 R SINE/ >A 169421_1742_ 110101 1742 1936 -623 C B3 B2 -2 214 8 1936_RC_B3 Industrial Applicability
According to the pre sent invention , it is possible to provide a functional nucleic acid molecule having a function of improving efficiency of translation from an RNA, and a use thereof.
[Sequence Listing]
RK23223PCT Sequence Listing

Claims

Claims Claim 1 A functional nucleic acid molecule comprising: (a) a target determinant sequence comprising antisense sequence to a target sequence in the protein-encoding RNA for which protein synthesis efficiency is to be increased; and (b) a regulatory sequence having an activity of increasing of the protein synthesis efficiency. Claim 2 The functional nucleic acid molecule as set forth in claim 1 , wherein the regulatory sequence comprises a SINE (Short Interspersed Element) derived sequence . Claim 3 The functional nucleic acid molecule as set forth in claim 2 , wherein the SINE derived sequence is a SINE-B2 -derived sequence. Claim 4 The functional nucleic acid molecule as set forth in claim 1 , wherein : the regulatory sequence is selected from the group consisting of the following ( 1 ) through (5) :
( 1 ) an RNA, which is encoded by a D NA consisting of the nucleotide sequence shown in SEQ ID No : l
(2) an RNA, which is encoded by a DNA consisting of the nucleotide sequence shown in SEQ ID No : 2
(3) an RNA, which is encoded by a DNA consisting of the nucleotide sequence shown in SEQ ID No : 3
(4) nucleic acids (i) which is at least 25% similarity to the RNA, which is encoded by a DNA consisting of the nucleotide sequence shown in SEQ ID No : 1 , 2 or 3 and (ii) which has a function of increasing the protein synthesis efficiency; and
(5) nucleic acids (i) which is encoded by a DNA in which not less than 1 but not more than 200 nucleotides are deleted, substituted, added, and / or inserted in the nucleotide sequence shown in SEQ ID No : 1 , 2 or 3 and (ii) which has a function of increasing the protein synthesis efficiency.
Claim 5
The functional nucleic acid molecule as set forth in any one of claims 1 to 4 , wherein the target determinant sequence is located between a 5 '-terminal and the regulatory sequence in the functional nucleic acid molecule .
Claim 6
The functional nucleic acid molecule as set forth in any one of claims 1 to 5, wherein the target determinant sequence has a length of 7 nucleotides to 250 nucleotides . Claim 7
The functional nucleic acid molecule as set forth in any one of claims 1 to 6 , wherein the target determinant sequence has at least 60% similarity to a sequence complementary to a corresponding sequence in the protein-encoding RNA or a sequence around the first 5 '-terminal start codon of the protein-encoding sequence .
Claim 8
The functional nucleic acid molecule as set forth in any one of claims 1 to 7, wherein the regulatory sequence of the functional nucleic acid molecule is oriented in a reverse direction relative to the direction of translation .
Claim 9
The functional nucleic acid molecule as set forth in any one of claims 1 to 8 , wherein the target determinant sequence is designed to be hybridizable with a 5 '-UTR (untranslated region) of the protein-encoding RNA or a sequence around the first 5 '-terminal start codon of the protein-encoding sequence .
Claim 10
A method for producing a functional nucleic acid molecule, comprising the step of preparing an RNA molecule that comprises:
(a) a target determinant sequence comprising antisense sequence to a target sequence in the protein-encoding RNA for which protein synthesis efficiency is to be increased; and
(b) a regulatory sequence having an activity of increasing of the protein synthesis efficiency.
Claim 1 1
A DNA molecule encoding a functional nucleic acid molecule as set forth in any one of claims 1 to 9.
Claim 12
An expression vector comprising a functional nucleic acid molecule as set forth in any one of claims 1 to 9 , or a DNA molecule as set forth in claim 1 1 .
Claim 13
A composition for increasing protein synthesis efficiency, which comprises a functional nucleic acid molecule as set forth in any one of claims 1 to 9 , a DNA molecule as set forth in clam 1 1 , or an expression vector as set forth in claim 12.
Claim 14
A method for increasing the protein synthesis efficiency, comprising the step of: (a) allowing a functional nucleic acid molecule as set forth in any one of claims 1 to 9 to coexist with a protein-encoding RNA, which partial sequence of the protein-encoding RNA has similarity with the target determinant sequence of the functional RNA molecule .
Claim 15
The method as set forth in claim 14 , wherein :
the step (a) comprises transfecting into a cell the functional nucleic acid molecule or a DNA molecule as set forth in claim 1 1 .
Claim 16
A method for producing a protein, comprising the step of increasing the protein synthesis efficiency by a method for increasing the protein synthesis efficiency as set forth in claim 14 or 15.
Claim 17
A method for treating a disease that is caused by a quantitative decrease in a protein, comprising the step of increasing the protein synthesis efficiency by a method for increasing the protein synthesis efficiency as set forth in claim 14 or 15 in a a subject having the disease or a predisposition to the disease .
PCT/JP2012/059430 2011-03-30 2012-03-30 Functional nucleic acid molecule and use thereof Ceased WO2012133947A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
EP20203177.9A EP3792359A1 (en) 2011-03-30 2012-03-30 Functional nucleic acid molecule and use thereof
US14/008,186 US9353370B2 (en) 2011-03-30 2012-03-30 Functional nucleic acid molecule and use thereof
ES12763652T ES2855577T3 (en) 2011-03-30 2012-03-30 Functional nucleic acid molecule and its use
JP2014501947A JP2014514921A (en) 2011-03-30 2012-03-30 Functional nucleic acid molecule and use thereof
EP12763652.0A EP2691522B1 (en) 2011-03-30 2012-03-30 Functional nucleic acid molecule and use thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201161469399P 2011-03-30 2011-03-30
US61/469,399 2011-03-30

Publications (1)

Publication Number Publication Date
WO2012133947A1 true WO2012133947A1 (en) 2012-10-04

Family

ID=46931619

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2012/059430 Ceased WO2012133947A1 (en) 2011-03-30 2012-03-30 Functional nucleic acid molecule and use thereof

Country Status (5)

Country Link
US (1) US9353370B2 (en)
EP (2) EP3792359A1 (en)
JP (3) JP2014514921A (en)
ES (1) ES2855577T3 (en)
WO (1) WO2012133947A1 (en)

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016070853A1 (en) * 2014-11-04 2016-05-12 清华大学 Synthetic non-coding rna having reverse sineb2 repeated sequence and use thereof in enhancing target protein translation
IT201700105372A1 (en) * 2017-09-20 2019-03-20 Fondazione St Italiano Tecnologia FUNCTIONAL NUCLEIC ACID MOLECULE AND ITS USE
IT201800002411A1 (en) * 2018-02-05 2019-08-05 Scuola Int Superiore Di Studi Avanzati Sissa STRUCTURAL DOMAINS OF ANTISENSE RNA MOLECULES THAT INCREASE TRANSLATION
IT201900011490A1 (en) 2019-07-11 2021-01-11 Scuola Int Superiore Di Studi Avanzati Sissa FUNCTIONAL NUCLEIC ACID MOLECULES THAT INCREASE THE TRANSLATION OF A FRATASSIN mRNA
WO2022064221A1 (en) 2020-09-24 2022-03-31 Fondazione Istituto Italiano Di Tecnologia Modified functional nucleic acid molecules
WO2022074396A1 (en) 2020-10-08 2022-04-14 Transine Therapeutics Limited Functional nucleic acid molecules
EP3992289A1 (en) 2020-10-30 2022-05-04 Transine Therapeutics Limited Functional nucleic acid molecules incorporating protein binding domain
IT202200011546A1 (en) 2022-06-01 2022-09-01 Univ Degli Studi Di Trento Non-coding RNA sequences capable of increasing the expression of CHD8 and CHD2 proteins
EP4063505A1 (en) 2021-03-22 2022-09-28 Fondazione Istituto Italiano di Tecnologia Functional nucleic acid molecules directed to targets for nervous system disorders
WO2022214635A1 (en) 2021-04-08 2022-10-13 Stichting Vu Nucleic acid molecules for compensation of stxbp1 haploinsufficiency and their use in the treatment of stxbp1-related disorders
WO2023199039A1 (en) 2022-04-12 2023-10-19 Transine Therapeutics Limited Functional nucleic acid molecule
WO2023227769A1 (en) 2022-05-26 2023-11-30 Fondazione Istituto Italiano Di Technologia Functional nucleic acid molecule
WO2023227770A1 (en) 2022-05-26 2023-11-30 Fondazione Istituto Italiano Di Technologia Functional nucleic acid molecule
WO2025133858A1 (en) 2023-12-18 2025-06-26 Fondazione Istituto Italiano Di Tecnologia Functional nucleic acid molecule capable of increasing bdnf production

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114981409A (en) 2019-09-03 2022-08-30 美洛德生物医药公司 Methods and compositions for genomic integration
WO2022154107A1 (en) 2021-01-18 2022-07-21 イビデン株式会社 Heat transfer suppression sheet for battery pack, and battery pack
BR112023023642A2 (en) 2021-05-11 2024-01-30 Myeloid Therapeutics Inc METHODS AND COMPOSITIONS FOR GENOMIC INTEGRATION

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5807715A (en) 1984-08-27 1998-09-15 The Board Of Trustees Of The Leland Stanford Junior University Methods and transformed mammalian lymphocyte cells for producing functional antigen-binding protein including chimeric immunoglobulin
WO2007069666A1 (en) 2005-12-13 2007-06-21 Kyoto University Nuclear reprogramming factor
WO2008113773A2 (en) 2007-03-16 2008-09-25 Biorigen S.R.L. Gene expression regulation technology and noncoding rnas for diagnosis and therapy
JP2010273680A (en) 2009-05-29 2010-12-09 Kyoto Univ Method for producing induced pluripotent stem cells from which reprogramming factor has been removed
JP2010284088A (en) 2009-06-10 2010-12-24 Kyoto Univ Artificial pluripotent stem cell establishment efficiency improving agent
JP2011004674A (en) 2009-06-26 2011-01-13 Fujitsu Ltd METHOD FOR PRODUCING INDUCED PLURIPOTENT STEM CELL (iPS CELL)
JP2011050379A (en) 2009-08-07 2011-03-17 Kyoto Univ CANINE iPS CELL AND METHOD OF PRODUCING THE SAME

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2302055B1 (en) * 2004-11-12 2014-08-27 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
US8367320B2 (en) * 2007-12-28 2013-02-05 Qiagen Sciences, Inc. Apoptosis inducing positive control for expression modulation experiments

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5807715A (en) 1984-08-27 1998-09-15 The Board Of Trustees Of The Leland Stanford Junior University Methods and transformed mammalian lymphocyte cells for producing functional antigen-binding protein including chimeric immunoglobulin
WO2007069666A1 (en) 2005-12-13 2007-06-21 Kyoto University Nuclear reprogramming factor
WO2008113773A2 (en) 2007-03-16 2008-09-25 Biorigen S.R.L. Gene expression regulation technology and noncoding rnas for diagnosis and therapy
JP2010273680A (en) 2009-05-29 2010-12-09 Kyoto Univ Method for producing induced pluripotent stem cells from which reprogramming factor has been removed
JP2010284088A (en) 2009-06-10 2010-12-24 Kyoto Univ Artificial pluripotent stem cell establishment efficiency improving agent
JP2011004674A (en) 2009-06-26 2011-01-13 Fujitsu Ltd METHOD FOR PRODUCING INDUCED PLURIPOTENT STEM CELL (iPS CELL)
JP2011050379A (en) 2009-08-07 2011-03-17 Kyoto Univ CANINE iPS CELL AND METHOD OF PRODUCING THE SAME

Non-Patent Citations (30)

* Cited by examiner, † Cited by third party
Title
B. JANOWSKI, NATURE CHEMICAL BIOLOGY, vol. 3, 2007, pages 166 - 173
BUTTERFIELD, D.A. ET AL.: "Redox proteomics identification of oxidatively modified hippocampal proteins in mild cognitive impairment: insights into the development of Alzheimer's disease", NEUROBIOL DIS, vol. 22, 2006, pages 223 - 232, XP024901613, DOI: doi:10.1016/j.nbd.2005.11.002
CARNINCI ET AL., GENOME RES., vol. 13, no. 6B, June 2003 (2003-06-01), pages 1273 - 89
CARNINCI P. ET AL.: "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes", GENOME RES., vol. 10, 2000, pages 1617 - 1630, XP002944079 *
CARNINCI P. ET AL.: "The transcriptional landscape of the mammalian genome", SCIENCE, vol. 309, 2005, pages 1559 - 1563, XP008055983 *
CASTEGNA, A. ET AL.: "Proteomic identification of oxidatively modified proteins in Alzheimer's disease brain. Part II: dihydropyrimidinase-related protein 2, alpha-enolase and heat shock cognate 71", J NEUROCHEM, vol. 82, 2002, pages 1524 - 1532, XP009169552, DOI: doi:10.1046/j.1471-4159.2002.01103.x
CHEN, L.L.DECERBO, J.N.CARMICHAEL, G.G.: "Alu element-mediated gene silencing", EMBO J, vol. 27, 2008, pages 1694 - 1705, XP002573373, DOI: doi:10.1038/emboj.2008.94
CHOI, J. ET AL.: "Oxidative modifications and down-regulation of ubiquitin carboxyl-terminal hydrolase L1 associated with idiopathic Parkinson's and Alzheimer's diseases", J BIOL CHEM, vol. 279, 2004, pages 13256 - 13264, XP009056559, DOI: doi:10.1074/jbc.M314124200
DATABASE MEDLINE [online] 6 October 2010 (2010-10-06), CARNINCI P. ET AL.: "Mus musculus 0 day neonate head cDNA, RIKEN full-length enriched library, clone:4833404H03 product:unclassifiable, full insert sequence", XP003030224, Database accession no. AK029359 *
DATABASE MEDLINE [online] 6 October 2010 (2010-10-06), CARNINCI P., ET AL.: "Mus musculus adult male olfactorybrain cDNA, RIKEN full-length enrichted library, clone 6430596G22", XP003030223, Database accession no. AK078321 *
HAWKINS, P.G.SANTOSO, S.ADAMS, C.ANEST, V.MORRIS, K.V.: "Promoter targeted small RNAs induce long-term transcriptional gene silencing in human cells", NUCLEIC ACIDS RES, vol. 37, 2009, pages 2984 - 2995, XP055509588, DOI: doi:10.1093/nar/gkp127
HE LHANNON GJ, NAT REV GENET, vol. 5, no. 7, July 2004 (2004-07-01), pages 522 - 31
KATAYAMA S. ET AL.: "Antisense transcription in the mammalian transcriptome", SCIENCE, vol. 309, 2005, pages 1564 - 1566, XP003020135 *
KAWAI J. ET AL.: "Functional annotation of a full-length mouse cDNA collection", NATURE, vol. 409, 2001, pages 685 - 690, XP001009930 *
KENT, W.J. ET AL.: "The human genome browser at UCSC", GENOME RES, vol. 12, 2002, pages 996 - 1006, XP007901725, DOI: doi:10.1101/gr.229102. Article published online before print in May 2002
KURODA ET AL., PNAS, 2010
LEROY, E. ET AL.: "The ubiquitin pathway in Parkinson's disease", NATURE, vol. 395, 1998, pages 451 - 452, XP002370699, DOI: doi:10.1038/26652
LIU, Y.FALLON, L.LASHUEL, H.A.LIU, Z.LANSBURY, P.T., JR.: "The UCH-L1 gene encodes two opposing enzymatic activities that affect alpha-synuclein degradation and Parkinson's disease susceptibility", CELL, vol. 111, 2002, pages 209 - 218, XP002370697, DOI: doi:10.1016/S0092-8674(02)01012-7
MAGLOTT, D.R.KATZ, K.S.SICOTTE, H.PRUITT, K.D.: "NCBI's LocusLink and RefSeq", NUCLEIC ACIDS RES, vol. 28, 2000, pages 126 - 128
MALAGELADA, C.JIN, Z.H.JACKSON-LEWIS, V.PRZEDBORSKI, S.GREENE, L.A.: "Rapamycin protects against neuron death in in vitro and in vivo models of Parkinson's disease", J NEUROSCI, vol. 30, 2010, pages 1166 - 1175
MALAGELADA, C.RYU, E.J.BISWAS, S.C.JACKSON-LEWIS, V.GREENE, L.A.: "RTP801 is elevated in Parkinson brain substantia nigral neurons and mediates death in cellular models of Parkinson's disease by a mechanism involving mammalian target of rapamycin inactivation", J NEUROSCI, vol. 26, 2006, pages 9996 - 10005
NORDSTROM, K.J. ET AL.: "Critical evaluation of the FANTOM3 non-coding RNA transcripts", GENOMICS, vol. 94, 2009, pages 169 - 176, XP026458760
OKAZAKI Y. ET AL.: "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs", NATURE, vol. 420, 2002, pages 563 - 573, XP001165660 *
OSAKA, H. ET AL.: "Ubiquitin carboxy-terminal hydrolase L1 binds to and stabilizes monoubiquitin in neuron", HUM MOL GENET, vol. 12, 2003, pages 1945 - 1958
SANTINI, E.HEIMAN, M.GREENGARD, P.VALJENT, E.FISONE, G.: "Inhibition of mTOR signaling in Parkinson's disease prevents L-DOPA-induced dyskinesia", SCI SIGNAL, vol. 2, 2009, pages ra36
See also references of EP2691522A4
SHIBATA K. ET AL.: "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer", GENOME RES., vol. 10, 2000, pages 1757 - 1771, XP002982061 *
SMIT, AFAHUBLEY, RGREEN, P., REPEATMASKER OPEN-3.0.1996-2010, Retrieved from the Internet <URL:<http://www.repeatmasker.org>>
TAIN, L.S. ET AL.: "Rapamycin activation of 4E-BP prevents parkinsonian dopaminergic neuron loss", NAT NEUROSCI, vol. 12, 2009, pages 1129 - 1135
VLADIMIR V. KAPITONOVJERZY JURKA, MOLECULAR BIOLOGY AND EVOLUTION, vol. 20, no. 5, 2003, pages 694 - 702

Cited By (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016070853A1 (en) * 2014-11-04 2016-05-12 清华大学 Synthetic non-coding rna having reverse sineb2 repeated sequence and use thereof in enhancing target protein translation
JP7258031B2 (en) 2017-09-20 2023-04-14 フォンダジオネ イスティツト イタリアノ ディ テクノロジア Functional nucleic acid molecule and use thereof
WO2019058304A1 (en) * 2017-09-20 2019-03-28 Fondazione Istituto Italiano Di Tecnologia Functional nucleic acid molecule and use thereof
IT201700105372A1 (en) * 2017-09-20 2019-03-20 Fondazione St Italiano Tecnologia FUNCTIONAL NUCLEIC ACID MOLECULE AND ITS USE
US11649456B2 (en) 2017-09-20 2023-05-16 Fondazione Istituto Italiano Di Tecnologia Functional nucleic acid molecule and use thereof
KR20200117975A (en) * 2017-09-20 2020-10-14 폰다치오네 이스티튜토 이탈리아노 디 테크놀로지아 Functional nucleic acid molecules and uses thereof
JP2020535845A (en) * 2017-09-20 2020-12-10 フォンダジオネ イスティツト イタリアノ ディ テクノロジア Functional nucleic acid molecules and their use
KR102677300B1 (en) 2017-09-20 2024-06-24 폰다치오네 이스티튜토 이탈리아노 디 테크놀로지아 Functional nucleic acid molecules and their uses
US12134768B2 (en) 2018-02-05 2024-11-05 Fondazione Istituto Italiano Di Tecnologia Structural domains of antisense RNA molecules up-regulating translation
EP3749772A1 (en) * 2018-02-05 2020-12-16 Scuola Internazionale Superiore di Studi Avanzati - SISSA Structural domains of antisense rna molecules up-regulating translation
WO2019150346A1 (en) 2018-02-05 2019-08-08 Scuola Internazionale Superiore Di Studi Avanzati - Sissa Structural domains of antisense rna molecules up-regulating translation
IT201800002411A1 (en) * 2018-02-05 2019-08-05 Scuola Int Superiore Di Studi Avanzati Sissa STRUCTURAL DOMAINS OF ANTISENSE RNA MOLECULES THAT INCREASE TRANSLATION
WO2021005203A1 (en) 2019-07-11 2021-01-14 Scuola Internazionale Superiore Di Studi Avanzati - Sissa FUNCTIONAL NUCLEIC ACID MOLECULES UPREGULATING THE TRANSLATION OF A FRATAXIN mRNA
IT201900011490A1 (en) 2019-07-11 2021-01-11 Scuola Int Superiore Di Studi Avanzati Sissa FUNCTIONAL NUCLEIC ACID MOLECULES THAT INCREASE THE TRANSLATION OF A FRATASSIN mRNA
WO2022064221A1 (en) 2020-09-24 2022-03-31 Fondazione Istituto Italiano Di Tecnologia Modified functional nucleic acid molecules
WO2022074396A1 (en) 2020-10-08 2022-04-14 Transine Therapeutics Limited Functional nucleic acid molecules
EP3992289A1 (en) 2020-10-30 2022-05-04 Transine Therapeutics Limited Functional nucleic acid molecules incorporating protein binding domain
WO2022090733A1 (en) 2020-10-30 2022-05-05 Transine Therapeutics Limited Functional nucleic acid molecules incorporating protein binding domains
WO2022200774A1 (en) 2021-03-22 2022-09-29 Transine Therapeutics Limited Functional nucleic acid molecules directed to targets for nervous system disorders
EP4063505A1 (en) 2021-03-22 2022-09-28 Fondazione Istituto Italiano di Tecnologia Functional nucleic acid molecules directed to targets for nervous system disorders
WO2022214635A1 (en) 2021-04-08 2022-10-13 Stichting Vu Nucleic acid molecules for compensation of stxbp1 haploinsufficiency and their use in the treatment of stxbp1-related disorders
WO2023199039A1 (en) 2022-04-12 2023-10-19 Transine Therapeutics Limited Functional nucleic acid molecule
WO2023227770A1 (en) 2022-05-26 2023-11-30 Fondazione Istituto Italiano Di Technologia Functional nucleic acid molecule
WO2023227769A1 (en) 2022-05-26 2023-11-30 Fondazione Istituto Italiano Di Technologia Functional nucleic acid molecule
IT202200011546A1 (en) 2022-06-01 2022-09-01 Univ Degli Studi Di Trento Non-coding RNA sequences capable of increasing the expression of CHD8 and CHD2 proteins
WO2023233437A1 (en) 2022-06-01 2023-12-07 Universita' Degli Studi Di Trento Non-coding rna sequences capable of increasing the expression of chd8 and chd2 proteins
WO2025133858A1 (en) 2023-12-18 2025-06-26 Fondazione Istituto Italiano Di Tecnologia Functional nucleic acid molecule capable of increasing bdnf production

Also Published As

Publication number Publication date
EP2691522A4 (en) 2014-11-05
EP3792359A1 (en) 2021-03-17
EP2691522B1 (en) 2020-11-25
JP2017169573A (en) 2017-09-28
JP6770921B2 (en) 2020-10-21
US9353370B2 (en) 2016-05-31
EP2691522A1 (en) 2014-02-05
JP7229487B2 (en) 2023-02-28
JP2021006047A (en) 2021-01-21
US20140107187A1 (en) 2014-04-17
JP2014514921A (en) 2014-06-26
ES2855577T3 (en) 2021-09-23

Similar Documents

Publication Publication Date Title
US9353370B2 (en) Functional nucleic acid molecule and use thereof
Buratti et al. RNA folding affects the recruitment of SR proteins by mouse and human polypurinic enhancer elements in the fibronectin EDA exon
Li et al. Attenuation of microRNA-1 derepresses the cytoskeleton regulatory protein twinfilin-1 to provoke cardiac hypertrophy
Packer et al. The bifunctional microRNA miR-9/miR-9* regulates REST and CoREST and is downregulated in Huntington's disease
Fukuoka et al. Supplemental treatment for Huntington’s disease with miR-132 that is deficient in Huntington’s disease brain
Hansen et al. Argonaute-associated short introns are a novel class of gene regulators
Edbauer et al. Regulation of synaptic structure and function by FMRP-associated microRNAs miR-125b and miR-132
Zongaro et al. The 3′ UTR of FMR1 mRNA is a target of miR-101, miR-129-5p and miR-221: implications for the molecular pathology of FXTAS at the synapse
Benson et al. Identification of a homeodomain binding element in the bone sialoprotein gene promoter that is required for its osteoblast-selective expression
Galka-Marciniak et al. Triplet repeats in transcripts: structural insights into RNA toxicity.
Shanmugam et al. SRSF9 selectively represses ADAR2-mediated editing of brain-specific sites in primates
Brosseau et al. Redirecting splicing with bifunctional oligonucleotides
Busan et al. Role of context in RNA structure: flanking sequences reconfigure CAG motif folding in huntingtin exon 1 transcripts
WO2008084319A2 (en) Novel nucleic acid
Fontana et al. Oxidative stress controls the choice of alternative last exons via a Brahma–BRCA1–CstF pathway
Masuda et al. hnRNP H enhances skipping of a nonfunctional exon P3A in CHRNA1 and a mutation disrupting its binding causes congenital myasthenic syndrome
Passoni et al. UG repeats/TDP-43 interactions near 5′ splice sites exert unpredictable effects on splicing modulation
Overby et al. Proof of concept of peptide-linked blockmiR-induced MBNL functional rescue in myotonic dystrophy type 1 mouse model
Hosokawa et al. Structural organization and characterization of the regulatory element of the human carboxylesterase (CES1A1 and CES1A2) genes
Winkelsas et al. Targeting the 5′ untranslated region of SMN2 as a therapeutic strategy for spinal muscular atrophy
Afroze et al. c-Myb-binding sites mediate G1/S-associated repression of the plasma membrane Ca2+-ATPase-1 promoter
Fuchs Wightman et al. Influence of RNA circularity on target RNA-directed MicroRNA degradation
Yanaizu et al. Small nuclear RNA-mediated modulation of splicing reveals a therapeutic strategy for a TREM2 mutation and its post-transcriptional regulation
Scamborova et al. An intronic enhancer regulates splicing of the twintron of Drosophila melanogaster prospero pre-mRNA by two different spliceosomes
Marcucci et al. Complex splicing control of the human Thrombopoietin gene by intronic G runs

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12763652

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2014501947

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2012763652

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 14008186

Country of ref document: US