WO2012131365A1 - Therapeutic molecules for use in the suppression of parkinson's disease - Google Patents

Therapeutic molecules for use in the suppression of parkinson's disease Download PDF

Info

Publication number
WO2012131365A1
WO2012131365A1 PCT/GB2012/050692 GB2012050692W WO2012131365A1 WO 2012131365 A1 WO2012131365 A1 WO 2012131365A1 GB 2012050692 W GB2012050692 W GB 2012050692W WO 2012131365 A1 WO2012131365 A1 WO 2012131365A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleotide
nucleic acid
rna
antisense strand
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/GB2012/050692
Other languages
French (fr)
Inventor
Christopher Sibley
Matthew Wood
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Oxford University Innovation Ltd
Original Assignee
Oxford University Innovation Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Oxford University Innovation Ltd filed Critical Oxford University Innovation Ltd
Publication of WO2012131365A1 publication Critical patent/WO2012131365A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/713Double-stranded nucleic acids or oligonucleotides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y207/00Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/11Protein-serine/threonine kinases (2.7.11)
    • C12Y207/11001Non-specific serine/threonine protein kinase (2.7.11.1), i.e. casein kinase or checkpoint kinase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/344Position-specific modifications, e.g. on every purine, at the 3'-end
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/50Physical structure
    • C12N2310/53Physical structure partially self-complementary or closed
    • C12N2310/531Stem-loop; Hairpin

Definitions

  • the present invention relates to therapeutic molecules and the use of such therapeutic molecules in the suppression or prevention of Parkinson's disease.
  • Parkinson's disease is a progressive neurological condition that is associated with the loss of dopamine-producing neurons in the substantia nigra area of the brain.
  • PD affects approximately 120,000 people in the United Kingdom, with an average age of onset of 60 years.
  • Clinical symptoms of PD include bradykinesia (slowness of movement), tremor, muscle rigidity and postural instability. Due to the progressive nature of the disease, the symptoms may worsen over time and have a significant impact on the patient's quality of life. In addition, cognitive impairment may develop during the later stages of the disease. The need for high levels of support and care for PD patients can also use significant resources of health care systems.
  • dsNA double stranded nucleic acid
  • the invention provides a double stranded nucleic acid (dsNA) molecule comprising a nucleic acid sense strand and an RNA antisense strand; wherein the RNA antisense strand binds to position 6176 on a target RNA nucleotide sequence that comprises the nucleotide sequence of SEQ ID NO: 10; wherein at least a portion of the RNA antisense strand and the nucleic acid sense strand together define a base-paired nucleic acid duplex having the structure of Formula (I):
  • nucleotides of the antisense RNA strand define consecutively numbered antisense nucleotide positions, said numbers increasing in a 5' to 3' direction on the antisense strand, with position 1 (p1 ) defined as the extreme 5' nucleotide present on the RNA antisense strand of the nucleic acid duplex that is base paired with a corresponding nucleotide present on the nucleic acid sense strand of the nucleic acid duplex;
  • RNA antisense strand has a uracil nucleotide located at any one of positions p1 to p9 that binds to an adenine nucleotide located at position 6176 of an RNA nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 10.
  • hereditary PD While the precise causes of PD are yet to be fully elucidated, it is believed that certain cases of PD have a hereditary component.
  • Research into the genetics of hereditary PD has identified 16 chromosomal "PARK" loci with linkage to the disease. Subsequently, a group of ten genes have been identified which are implicated in molecular pathways leading to PD pathogenesis. In some cases, a mutant form of a gene is created by the presence of a single nucleotide polymorphism (SNP).
  • SNP single nucleotide polymorphism
  • the LRRK2-G2019S mutation is the most common PD-linked mutation at present and represents the most attractive PD-mutation for allele-specific silencing.
  • the mutation leads to a G:A conversion in the LRRK2 mRNA.
  • the mutant LRRK2 gene may be present in heterozygous form, such that an affected individual carries one mutant LRRK2 allele and one wildtype LRRK2 allele.
  • the nucleotide sequence of SEQ ID NO: 10 is an mRNA sequence encoding the product of a human LRRK2 gene that has a G2019S single nucleotide polymorphism (also referred to herein as mutant LRRK2 or LRRK2-G2019S).
  • the G2019S SNP causes the presence in the mutant LRRK2 mRNA (SEQ ID NO: 10) of an adenine nucleotide (mutant residue) at position 6176, whereas the wildtype LRRK2 mRNA sequence (SEQ ID NO: 1 1 ) has a guanine nucleotide at position 6176.
  • the dsNA molecule of the invention targets and/or binds to the LRRK2 gene, in particular to the LRRK2-G2019S mutant.
  • RNAi RNA interference
  • RNA interference has emerged as a highly credible strategy with which to sequence-specifically silence genes-of-interest by preventing the translation of targeted mRNA transcripts into proteins.
  • the endogenous RNAi pathway is now well characterised and involves the processing of non-coding RNA sequences with characteristic stem-loop secondary structures, termed primary-microRNAs (pri-miRNAs), into short 21 -23nt single-stranded mature miRNAs that are antisense to targeted transcripts - see Fig. 1 .
  • pri-miRNAs primary-microRNAs
  • Complete complementarity of the mature miRNA sequence to the target mRNA leads to target cleavage and inhibition of protein synthesis, whereas incomplete pairing leads to translational repression either through mRNA destabilization or removal of the 5' cap or 3' poly-A termination signal.
  • RNAi pathway precursors termed short hairpin RNAs (shRNAs) or primary-miRNA (pri-miRNA) mimics. These precursors are recognised and processed by the enzyme Dicer.
  • shRNAs short hairpin RNAs
  • pri-miRNA primary-miRNA
  • Dicer The resulting short lengths of double stranded RNA are termed short interfering RNAs (siRNA).
  • siRNA short interfering RNAs
  • Dicer In addition to cleaving RNA, Dicer also promotes incorporation of siRNA into the RNA-induced silencing complex (RISC).
  • RISC RNA-induced silencing complex
  • RNA strands termed the guide strand and the passenger strand.
  • the guide strand binds to an exonuclease enzyme present in the RISC complex termed Argonaute, while the passenger strand is degraded.
  • Argonaute an exonuclease enzyme present in the RISC complex
  • the strand with the most thermodynamically unstable 5' end is favoured.
  • Argonaute targets and cleaves mRNA molecules complementary to the guide strand.
  • the guide strand must contain the antisense sequence of the target mRNA.
  • the dsNA molecules of the present invention reduce the expression of the mutant LRRK2 allele in preference to reducing the expression of the wildtype LRRK2 allele. This provides an advantage in that the negative effects of the mutant LRRK2 allele are reduced, while necessary wildtype LRRK2 activity is retained.
  • the antisense strand of a dsNA molecule of the invention binds to a region of the mutant LRRK2 mRNA sequence that encodes the mutant residue defining the G2019S mutation.
  • the antisense strand is then capable of activating the RNAi mechanisms that will lead to degradation of the mutant LRRK2 mRNA and thus decrease mutant LRRK2 expression.
  • the antisense strand is complementary to, and binds to, a region of the mutant LRRK2 mRNA sequence that includes the mutant adenine (A) residue defining the G2019S mutation.
  • the wildtype LRRK2 mRNA sequence does not possess the mutant adenine (A) residue defining the G2019S SNP, and thus the antisense strand of the dsNA molecule of the invention is not complementary to the wildtype LRRK2 mRNA strand at the site of the G2019S polymorphism.
  • the wildtype possesses a guanine (G) residue at the same position.
  • the antisense strand binds more weakly to the wildtype LRRK2 mRNA sequence than it does to the mutant LRRK2 mRNA sequence - i.e.
  • the antisense strand has a greater affinity for the mutant LRRK2 mRNA sequence than for the wildtype LRRK2 sequence.
  • the antisense nucleotide located immediately 5' to position p1 (as defined above), to the extent that any such 5' nucleotide is present, is not base-paired with a corresponding nucleotide on the sense strand.
  • complementary refers to a nucleic acid molecule that forms hydrogen bonds with another nucleic acid molecule, or with itself, with Watson-Crick base pairing.
  • Watson-Crick base pairing refers to the following hydrogen bonded nucleotide pairings: A:T and C:G (for DNA); and A:U and C:G (for RNA).
  • two or more complementary nucleic acid molecule strands can have the same number of nucleotides (i.e. have the same length and form one double-stranded region, with or without an overhang) or have a different number of nucleotides (e.g. one strand may be shorter than but fully contained within another strand or one strand may overhang the other strand).
  • the double stranded nucleic acid (dsNA) molecule is any type of double stranded nucleic acid molecule that is able to mediate sequence- specific RNA interference against the target mutant LRRK2 gene.
  • the dsNA molecule may be a double stranded RNA, an siRNA, a short interfering nucleic acid, an shRNA, or a pri-miRNA.
  • One or both of the sense strand and antisense strand of the dsNA molecule may comprise additional nucleotides that do not form part of the double stranded duplex portion.
  • one or both of the sense strand and antisense strand may have a 3' and/ or a 5' overhang region.
  • the uracil nucleotide located at any one of positions p1 to p9 on the antisense strand is located at a position selected from p1 , p2, p3, p4, p5, p6, p7 p8 or p9.
  • the uracil nucleotide located at any one of positions p1 to p9 on the antisense strand is located at a position selected from p1 , p2, p3, p4, p5, p6 or p7.
  • the uracil nucleotide located at any one of positions p1 to p9 on the antisense strand is located at a position selected from p2, p3, p4, p5, or p6.
  • the uracil nucleotide located at any one of positions p1 to p9 on the antisense strand is located at a position selected from p3, p4, or p5.
  • the uracil nucleotide located at any one of positions p1 to p9 on the antisense strand is located at a position selected from p3 or p4, or from p4 or p5. In another embodiment, the uracil nucleotide located at any one of positions p1 to p9 on the antisense strand is located at position p4.
  • the antisense strand of the dsNA molecule comprises or consists of a nucleic acid sequence selected from any one of SEQ ID NOs: 1 -9, wherein the first nucleotide position of said SEQ ID NO occupies position p1 on the antisense strand.
  • the antisense strand of the dsNA molecule comprises or consists of SEQ ID NO: 4, wherein the first nucleotide position of said SEQ ID NO occupies position p1 on the antisense strand.
  • the underlined uracil nucleotide in said nucleic acid sequence binds to the adenine nucleotide located at position 6176 of a nucleotide sequence having the sequence of SEQ ID NO: 10.
  • the antisense strand binds to a mutant LRRK2 mRNA sequence at the site of the G2019S mutation.
  • the antisense strand of the dsNA molecule comprises a nucleic acid sequence selected from any of SEQ ID NOs: 1 -9, wherein the first nucleotide position of said SEQ ID NO occupies position p1 on the antisense strand, and wherein said antisense strand is up to 21 nucleotides in length (for example, 20 or 21 nucleotides).
  • the antisense strand of the dsNA molecule comprises a nucleic acid sequence selected from any of SEQ ID NOs: 1 -9, wherein the first nucleotide position of said SEQ ID NO occupies position p1 on the antisense strand, and wherein said antisense strand is up to 27 nucleotides in length (for example, 20, 21 , 22, 23, 24, 25, 26 or 27 nucleotides).
  • the antisense strand of the dsNA molecule comprises or consists of a nucleic acid sequence that differs from SEQ ID NO: 3 by a single nucleotide, wherein the first nucleotide position of said SEQ ID NO occupies position p1 on the antisense strand, and wherein said difference is that the final 3' uracil (U) nucleotide in said SEQ ID NO has been replaced with a cytosine (C) nucleotide.
  • the antisense strand of the dsNA molecule comprises or consists of a nucleic acid sequence that differs from SEQ ID NO: 4 by a single nucleotide, wherein the first nucleotide position of said SEQ ID NO occupies position p1 on the antisense strand, and wherein said difference is that the final 3' uracil (U) nucleotide in said SEQ ID NO has been replaced with a cytosine (C) nucleotide.
  • the antisense strand of the dsNA molecule comprises or consists of a nucleic acid sequence that differs (by at most 3, or 4 nucleotides) from a nucleotide sequence selected from any one of SEQ ID NOs: 1 -9, wherein the first nucleotide position of said SEQ ID NO occupies position p1 on the antisense strand, and with the proviso that said difference does not occur at the underlined uracil nucleotide identified in any of SEQ ID NOs: 1 -9.
  • the antisense strand of the dsNA molecule comprises or consists of a nucleic acid sequence that differs (by at most 1 , or 2 nucleotides) from a nucleotide sequence selected from any one of SEQ ID NOs: 1 -9, wherein the first nucleotide position of said SEQ ID NO occupies position p1 on the antisense strand, and with the proviso that said difference does not occur at the underlined uracil nucleotide identified in any of SEQ ID NOs: 1 -9.
  • the dsNA molecule is a dsNA molecule that is capable of being processed in the cytoplasm of a target cell by the enzyme Dicer.
  • Dicer is an endoribonuclease enzyme present in eukaryotic cells that catalyses the breakdown of double stranded RNA molecules (including pre-microRNA molecules and short hairpin RNA molecules) into short double stranded RNA fragments approximately 20-25 nucleotides in length.
  • the fragments produced by Dicer may be incorporated into the RNA-induced Silencing Complex (RISC).
  • RISC RNA-induced Silencing Complex
  • the dsNA molecule is a short hairpin RNA (shRNA).
  • shRNA has a length of from about 40 nucleotides to about 50 nucleotides (for example, 40, 41 , 42, 43, 43, 45, 46, 47, 48, 49 or 50 nucleotides). In one embodiment, the shRNA has a maximum length of 120 nucleotides.
  • the antisense strand and the sense strand comprise part of a single strand of ribonucleic acid that is folded upon itself to form a short hairpin RNA.
  • the shRNA molecule is typically transcribed as a single length of ribonucleic acid comprising self-complementary nucleotide sequences that enable the ribonucleic acid to fold upon itself to form the short hairpin RNA that is recognised by the RNAi pathway elements.
  • a short hairpin RNA of the invention is delivered into target cells using a nucleic acid vector as described in more detail below.
  • the dsNA molecule comprises or consists of a nucleic acid sequence selected from any one of SEQ ID NOs: 12-20.
  • the dsNA molecule is an shRNA comprising, or consisting of, a nucleic acid sequence that differs (by at most 1 , 2, 3, 4, or 5 nucleotides) from a nucleotide sequence selected from any one of SEQ ID NOs: 12-20.
  • the antisense strand and the sense strand comprise part of a single strand of ribonucleic acid that is folded upon itself to form a mimic of precursors of the miRNA pathway, referred to as pri-miRNAs or pre-miRNAs.
  • the pri-miRNA or pre-miRNA molecule is typically transcribed as a single length of ribonucleic acid comprising self-complementary nucleotide sequences that enable the ribonucleic acid to fold upon itself to form the pri-miRNA or pre-miRNA that is recognised by the RNAi pathway elements.
  • the dsNA molecule is a sequencing mimicking a primary microRNA (pri-miRNA) or a pre-miRNA.
  • the dsNA molecule is a small internally segmented interfering RNA (sisiRNA), an asymmetric interfering RNA (aiRNA), or a DNA- RNA chimeric interfering RNA.
  • miRNA small internally segmented interfering RNA
  • aiRNA asymmetric interfering RNA
  • DNA- RNA chimeric interfering RNA a DNA- RNA chimeric interfering RNA.
  • the dsNA molecule is an siRNA molecule. Such molecules are typically 21 -23 base pairs in length, and may include 3' and/or 5' overhangs (typically 1 -4, 1 -3 or 1 -2 base overhangs). siRNA molecules typically have unphosphorylated hydroxyl groups at the 2' and 3' positions.
  • the dsNA molecule is a dicer substrate siRNA (D-siRNA) molecule.
  • D-siRNA dicer substrate siRNA
  • the dsNA molecule is 25-27 base pairs in length (for example, 25, 26 or 27 base pairs).
  • the dsNA molecule that is a dicer substrate siRNA molecule includes 3' and/or 5' overhangs (typically 1 -4, 1 -3 or 1 -2 base overhangs).
  • D-siRNAs are recognised and processed by Dicer into siRNAs of 21 -23 base pairs and facilitate loading into the RNA induced silencing complex.
  • D-siRNA molecules typically have unphosphorylated hydroxyl groups at the 2' and 3' positions.
  • the dsNA molecule that is a dicer substrate siRNA molecule has unphosphorylated hydroxyl groups at the 2' and 3' positions
  • the antisense strand of a dsNA molecule of the present invention may further comprise one or more nucleotides, wherein, when the antisense strand binds to position 6176 on the target RNA nucleotide sequence (e.g. SEQ ID NO: 10), said one or more nucleotides forms mismatch base-pairing with the corresponding nucleotide(s) located on the target RNA nucleotide sequence.
  • the target RNA nucleotide sequence e.g. SEQ ID NO: 10
  • the antisense strand contains a nucleotide that does not form a standard Watson- Crick base pair when the antisense strand is bound to the target mutant LRRK2 mRNA sequence.
  • the present inventors have found that the deliberate incorporation of a nucleotide that introduces a mismatch base pairing with the target mutant LRRK2 mRNA sequence surprisingly improves the discrimination of dsNA molecules of the invention with regard to mutant (i.e. target) and corresponding wildtype LRRK2 mRNA.
  • mutant i.e. target
  • mutant i.e. target
  • mutant i.e. target
  • the antisense nucleotide that forms the mismatch pairing as described above may be any nucleotide capable of forming such a mismatch pairing.
  • the presence of a mismatch pairing disrupts the surrounding nucleic acid duplex formed between the antisense strand of a dsNA molecule of the invention and an LRRK2 mRNA molecule.
  • purine bases A and G
  • pyrimidine bases U and C
  • a purine:purine mismatch occupies more space than a standard C:G or A:U pairing and so disrupts the surrounding nucleic acid duplex to a greater extent than a pyrimidine:purine or pyrimidine:pyrimidine mismatch - see Fig. 4B & 5.
  • the extent of the disruption to the nucleic acid duplex surrounding the mismatch is believed to influence the ability of the antisense strand to direct cleavage (via RISC) of the LRRK2 mRNA sequence.
  • the presence (in the antisense strand) of a nucleotide that gives rise to a mismatch pairing occupying a large amount of space is understood to result in a maximum decrease in the ability of said antisense strand to direct cleavage of the LRRK2 mRNA sequence.
  • the present inventor believes that the presence of mismatch pairing decreases the affinity with which the antisense strand binds to both the mutant LRRK2 mRNA sequence and the wildtype LRRK2 mRNA sequence.
  • the antisense strand already has a first mismatch nucleotide for the wildtype LRRK2 mRNA sequence (i.e. the uracil (U) nucleotide that binds to the mutant G2019S SNP)
  • U uracil
  • the presence of a second mismatch nucleotide provides a much greater mismatch effect between the antisense strand and the wildtype LRRK2 mRNA sequence.
  • the effect of a second (or subsequent) mismatch on the affinity of the antisense strand for the wildtype LRRK2 sequence is more pronounced compared to LRRK2-G2019S.
  • a hierarchy of mismatch pairs showing the extent to which the formation of a given mismatch increases the ability of the antisense strand to discriminate between target LRRK2-G2019S and wildtype LRRK2 is shown in Figure 5.
  • the above-described mismatch is provided at a position adjacent to the uracil nucleotide on the antisense strand that binds to position 6176 on SEQ ID NO: 10.
  • the mismatch nucleotide is located immediately 5' and/or 3' to the uracil nucleotide (i.e. the uracil that binds to position 6176 on SEQ ID NO: 10).
  • the mismatch nucleotide may be located 2, 3, 4, 5 or 6 nucleotide positions 3' and/or 5' away from the uracil nucleotide (i.e. the uracil that binds to position 6176 on SEQ ID NO: 10).
  • the mismatch nucleotide may be located up to 18 nucleotide positions (for example, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, or 18 nucleotide positions) 3' and/or 5' away from the uracil nucleotide (i.e. the uracil that binds to position 6176 on SEQ ID NO: 10).
  • the antisense strand of a dsNA molecule of the invention comprises a variant sequence of any one of SEQ ID NOs: 1 -9.
  • the antisense strand of a dsNA molecule of the invention comprises or consists of a variant of any one of SEQ ID NOs: 1 -9, wherein one or more (e.g. at most 1 , at most 2, at most 3, at most 4, or at most 5) mismatch nucleotides other than the underlined uracil nucleotide is replaced by a different nucleotide.
  • the variant retains the underlined uracil nucleotide as depicted in SEQ ID NOs: 1 -9 as a uracil nucleotide.
  • the one or more mismatch nucleotide(s) forms a mismatch pairing with the corresponding nucleotide located on the target mRNA, wherein said mismatch pairing is selected from a purine:purine, a purine:pyrimidine, or a pyrimidine:pyrimidine mismatch pairing.
  • At least one strand of the dsNA molecule of the invention may comprise one or more chemical modifications. Said chemical modification may be introduced to the antisense strand and/ or to the sense strand.
  • the at least one chemical modification improves the stability of the dsNA molecule.
  • a chemical modification increases the half-life of a dsNA molecule of the invention (e.g. in an aqueous solution).
  • a chemical modification increases the half-life of a dsNA molecule of the invention when introduced into a target cell.
  • the chemical modification may comprise a substitution or modification in which the substitution or modification may be in a phosphate backbone bond, a sugar, a base, or a nucleoside.
  • nucleoside substitutions can include natural nonstandard nucleosides (e.g., 5-methyluridine or 5-methylcytidine or a 2- thioribothymidine), and such backbone, sugar, or nucleoside modifications can include an alkyl or heteroatom substitution or addition, such as a methyl, alkoxyalkyl, halogen, nitrogen or sulphur, or other modifications known in the art.
  • Reference to nucleic acid(s) and/or nucleotide(s) embraces modified nucleic acid(s).
  • a nucleic acid or nucleotide may be modified to increase or decrease the stability of said nucleic acid or nucleotide.
  • a modified nucleic acid comprises a locked nucleotide (LNA).
  • LNA locked nucleotide
  • the ribose moiety of an LNA nucleotide is modified with an extra bridge connecting the 2' oxygen and 4' carbon. The bridge "locks" the ribose in the 3'-endo (North) conformation, which is often found in the A-form duplexes.
  • LNA nucleotides can be mixed with DNA or RNA residues in the oligonucleotide whenever desired. Such oligomers are commercially available.
  • the locked ribose conformation enhances base stacking and backbone pre-organization. This significantly increases the hybridization properties (melting temperature) of oligonucleotides.
  • nucleic acid analogues are composed of three parts: a phosphate backbone, a pucker-shaped pentose sugar, either ribose or deoxyribose, and one of four nucleobases.
  • An analogue may have any of these altered.
  • the analogue nucleobases confer, among other things, different base pairing and base stacking proprieties. Examples include universal bases, which can pair with all four canon bases, and phosphate-sugar backbone analogues such as PNA, which affect the properties of the chain (PNA can even form a triple helix).
  • Artificial nucleic acids include peptide nucleic acid (PNA), Morpholino and LNA, as well as glycol nucleic acid (GNA) and threose nucleic acid (TNA). Each of these is distinguished from naturally-occurring DNA or RNA by changes to the backbone of the molecule.
  • the dsNA molecules of the present invention may be made using any suitable process known in the art.
  • the dsNA molecules of the present invention may be made using chemical synthesis techniques.
  • the dsNA molecules of the present invention may be made using molecular biology techniques (for example, as reported in Yu et al. 2002, PMID: 1 1972060, which is hereby incorporated by reference in its entirety).
  • the dsNA molecules of the present invention may be synthesized by a commercial supplier.
  • the invention provides a nucleic acid vector comprising a nucleic acid sequence encoding a dsNA molecule as described herein.
  • the resultant RNA may be produced in vivo.
  • the dsNA molecules of the present invention may be made by conventional expression of a nucleic acid vector encoding said dsNA molecule, followed by conventional RNA recovery.
  • the RNA is produced in vitro.
  • the nucleic acid vector is a plasmid.
  • the nucleic acid vector is a viral vector.
  • the dsNA molecules of the present invention may be delivered into a target cell using a viral vector.
  • the viral vector may be any virus which can serve as a viral vector. Suitable viruses are those which infect the target cells, can be propagated in vitro, and can be modified by recombinant nucleotide technology known in the art.
  • the viral vector is selected from the group consisting of: an adenovirus vector; an adeno-associated virus vector; a pox virus vector, such as a fowlpox virus vector; an alpha virus vector; a bacloviral vector; a herpes virus vector; a retrovirus vector, such as a lentivirus vector; a Modified Vaccinia virus Ankara vector; a Ross River virus vector; a Sindbis virus vector; a Semliki Forest virus vector; and a Venezuelan Equine Encephalitis virus vector.
  • the invention provides a method for reducing the expression in a cell of a human LRRK2 gene having the G2019S SNP, comprising administering a therapeutically effective amount of a dsNA molecule as described above to a patient in need thereof, wherein the antisense strand of the dsNA molecule is capable of binding to position 6176 on an RNA nucleotide sequence having the sequence of SEQ ID NO: 10
  • the invention provides a dsNA molecule as described herein, or a nucleic acid vector as described herein, for use in the treatment of Parkinson's disease.
  • the treatment of Parkinson's disease comprises the treatment of a human subject having Parkinson's disease.
  • the invention provides a therapeutic and/or prophylactic formulation, comprising a dsNA molecule as described above.
  • the therapeutic and/or prophylactic formulation may be used in the therapeutic and/or prophylactic treatment of Parkinson's Disease.
  • the invention provides a pharmaceutical composition, comprising a dsNA molecule as described above; and a pharmaceutically acceptable carrier.
  • the dsNA molecule of the invention may be formulated into a pharmaceutical composition as neutral or salt forms.
  • Pharmaceutically acceptable salts include acid addition salts formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or with organic acids such as acetic, oxalic, tartaric, maleic, and the like. Salts formed with the free carboxyl groups may also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine, and the like.
  • compositions of the invention are generally by conventional routes e.g. intravenous, subcutaneous, intraperitoneal, or mucosal routes.
  • the administration may be by parenteral administration; for example, a subcutaneous or intramuscular injection.
  • the pharmaceutical compositions of the invention may be prepared as injectables, either as liquid solutions or suspensions. Solid forms suitable for solution in, or suspension in, liquid prior to injection may alternatively be prepared.
  • the preparation may also be emulsified, or the peptide encapsulated in liposomes or microcapsules.
  • the active ingredients are often mixed with excipients which are pharmaceutically acceptable and compatible with the active ingredient.
  • excipients are, for example, water, saline, dextrose, glycerol, ethanol, or the like and combinations thereof.
  • the pharmaceutical compositions may contain minor amounts of auxiliary substances such as wetting or emulsifying agents, and/or pH buffering agents.
  • Non-limiting examples of pharmaceutically acceptable carriers include water, saline, and phosphate-buffered saline.
  • the composition is in lyophilized form, in which case it may include a stabilizer, such as bovine serum albumin (BSA).
  • BSA bovine serum albumin
  • buffering agents include, but are not limited to, sodium succinate (pH 6.5), and phosphate buffered saline (PBS; pH 6.5 and 7.5).
  • Additional formulations which are suitable for other modes of administration include suppositories and, in some cases, oral formulations or formulations suitable for distribution as aerosols.
  • traditional binders and carriers may include, for example, polyalkylene glycols or triglycerides; such suppositories may be formed from mixtures containing the active ingredient in the range of 0.5% to 10%, preferably 1 %-2%.
  • Oral formulations include such normally employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like. These compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations or powders.
  • dsNA molecules of the present invention may be desired to direct the dsNA molecules of the present invention (as described above) to the respiratory system of a subject. Efficient transmission of a therapeutic/prophylactic formulation or medicament to the site of infection in the lungs may be achieved by oral or intra-nasal administration.
  • Formulations for intranasal administration may be in the form of nasal droplets or a nasal spray.
  • An intranasal formulation may comprise droplets having approximate diameters in the range of 100-5000 ⁇ , such as 500-4000 ⁇ , 1000-3000 ⁇ or 100-1000 ⁇ .
  • the droplets may be in the range of about 0.001 -100 ⁇ , such as 0.1 -50 ⁇ or 1 .0-25 ⁇ , or such as 0.001 -1 ⁇ .
  • the therapeutic/prophylactic formulation or medicament may be an aerosol formulation.
  • the aerosol formulation may take the form of a powder, suspension or solution.
  • the size of aerosol particles is relevant to the delivery capability of an aerosol . Smaller particles may travel further down the respiratory airway towards the alveoli than would larger particles.
  • the aerosol particles have a diameter distribution to facilitate delivery along the entire length of the bronchi, bronchioles, and alveoli.
  • the particle size distribution may be selected to target a particular section of the respiratory airway, for example the alveoli.
  • the particles may have diameters in the approximate range of 0.1 - 50 ⁇ , preferably 1 -25 ⁇ , more preferably 1 -5 ⁇ .
  • Aerosol particles may be for delivery using a nebulizer (e.g. via the mouth) or nasal spray.
  • An aerosol formulation may optionally contain a propellant and/or surfactant.
  • the therapeutic formulations and pharmaceutical compositions of the invention comprise a pharmaceutically acceptable carrier, and optionally one or more of a salt, excipient, diluent and/ or adjuvant.
  • the therapeutic formulations and pharmaceutical compositions of the invention may comprise one or more immunoregulatory agents selected from, for example, immunoglobulins, antibiotics, interleukins (e.g. IL-2, IL-12), and/or cytokines (e.g. IFNy).
  • immunoregulatory agents selected from, for example, immunoglobulins, antibiotics, interleukins (e.g. IL-2, IL-12), and/or cytokines (e.g. IFNy).
  • the therapeutic formulations and pharmaceutical compositions of the invention may comprise one or more antimicrobial compounds, (for example, conventional anti-tuberculosis drugs such as rifampicin, isoniazid, ethambutol or pyrizinamide).
  • antimicrobial compounds for example, conventional anti-tuberculosis drugs such as rifampicin, isoniazid, ethambutol or pyrizinamide.
  • the therapeutic formulations and pharmaceutical compositions of the invention may be given in a single dose schedule (i.e. the full dose is given at substantially one time).
  • the immunogenic compositions, therapeutic formulations, medicaments, pharmaceutical compositions, and prophylactic formulations of the invention may be given in a multiple dose schedule.
  • a multiple dose schedule is one in which a primary course of treatment (e.g. vaccination) may be with 1 -6 separate doses, followed by other doses given at subsequent time intervals required to maintain and or reinforce the immune response, for example (for human subjects), at 1 -4 months for a second dose, and if needed, a subsequent dose(s) after a further 1 -4 months.
  • the dosage regimen will be determined, at least in part, by the need of the individual and be dependent upon the judgment of the practitioner (e.g. doctor)
  • Simultaneous administration means administration at (substantially) the same time.
  • Sequential administration of two or more compositions/therapeutic agents means that the compositions/therapeutic agents are administered at (substantially) different times, one after the other.
  • the therapeutic formulations and pharmaceutical compositions may contain 5% to 95% of active ingredient, such as at least 10% or 25% of active ingredient, or at least 40% of active ingredient or at least 50, 55, 60, 70 or 75% active ingredient.
  • the therapeutic formulations and pharmaceutical compositions are administered in a manner compatible with the dosage formulation, and in such amount as will be prophylactically and/or therapeutically effective.
  • an “effective amount” is a dosage or amount that is sufficient to achieve a desired biological outcome.
  • a “therapeutically effective amount” is an amount which is effective, upon single or multiple dose administration to a subject (e.g. a human) for treating, preventing, curing, delaying, reducing the severity of, ameliorating at least one symptom of a disorder or recurring disorder, or prolonging the survival of the subject beyond that expected in the absence of such treatment.
  • the quantity of active ingredient to be administered depends on the subject to be treated, capacity of the subject's immune system to generate a protective immune response, and the degree of protection desired. Precise amounts of active ingredient required to be administered may depend on the judgment of the practitioner and may be particular to each subject.
  • SEQ ID NOs 1 -9 Nucleotide sequences of an RNA antisense strand complementary to LRRK2-G2019S wherein the uracil nucleotide at position p1 -9 (underlined), respectively, binds to the site of the G2019S SNP on the LRRK2-G2019S mRNA.
  • SEQ ID NO: 10 mRNA sequence of LRRK2 gene having G2019S SNP.
  • SEQ ID NO: 1 1 mRNA sequence of wildtype LRRK2 gene.
  • SEQ ID NO: 12-20 shRNA molecules directed against LRRK2-G2019S, having an antisense strand corresponding to SEQ ID NOs 1 -9, respectively (i.e. wherein the nucleotide that binds the G2019S SNP location on the target mRNA is located on the shRNA antisense strand at positions p1 -p9, respectively (as defined above)).
  • RNA interference Mechanisms of RNA interference that reduce expression of a target gene.
  • Figures 2a-b show a comparison of multiple shRNA molecules directed against the LRRK2-G2019S mRNA.
  • the position of the nucleotide in the shRNA antisense strand that binds the G2019S SNP location on the target mRNA varies from positions p1 to p9 (wherein the positions are defined as above). Changes to the sense strand in order to bias correct processing of the shRNA are indicated in bold.
  • FIGS 3a-c show the effect on LRRK2 mutant and wildtype expression of the shRNA molecules depicted in Figure 2.
  • Figures 4a-b show examples of how the presence of a mismatch nucleotide decreases targeting of non-target wildtype sequence.
  • a hierarchy of mismatch pairs showing the extent to which the formation of a given mismatch increases the ability of the antisense strand to discriminate between a given target nucleotide is shown.
  • the mismatch of a G:U that results between an antisense strand targeting the LRRK2-G2019S RNA and the wildtype LRRK2 RNA sequence is shown with a box.
  • siRNAs with alignment of the mutations at p3, p4 and p5 were screened against the luciferase targets.
  • siRNA p4 displayed a 7.7-fold ( ⁇ , ⁇ . ⁇ ) discrimination that was improved upon that seen with shRNA p4 at this time point ( Figure 6a).
  • siRNAs p3 and p5 displayed less discrimination between the two alleles, agreeing with the trends from previous shRNA data which showed alignment at p4 to be superior to these two constructs.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Epidemiology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Virology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

There is provided a double stranded nucleic acid (dsNA) molecule comprising a nucleic acid sense strand and an RNA antisense strand wherein the RNA antisense strand binds to position 6176 on a target RNA nucleotide sequence that comprises the nucleotide sequence of SEQ ID NO: 10; wherein at least a portion of the RNA antisense strand and the nucleic acid sense strand together define a base-paired nucleic acid duplex wherein the nucleotides of the antisense RNA strand define consecutively numbered antisense nucleotide positions, said numbers increasing in a 5' to 3' direction on the antisense strand, with position 1 (p1 ) defined as the extreme 5' nucleotide present on the RNA antisense strand of the nucleic acid duplex that is base paired with a corresponding nucleotide present on the nucleic acid sense strand of the nucleic acid duplex; and wherein the RNA antisense strand has a uracil nucleotide located at any one of positions p1 to p9 that binds to an adenine nucleotide located at position 6176 of an RNA nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 10. Also provided are vectors encoding said dsNA, and therapeutic uses of the dsNA molecule for suppressing/preventing Parkinson's disease.

Description

Therapeutic molecules for
use in the suppression of Parkinson's disease
This patent application claims priority to GB 1 105137.2 filed on 28 March 201 1 , which is hereby incorporated by reference in its entirety.
The present invention relates to therapeutic molecules and the use of such therapeutic molecules in the suppression or prevention of Parkinson's disease. Parkinson's disease (PD) is a progressive neurological condition that is associated with the loss of dopamine-producing neurons in the substantia nigra area of the brain.
PD affects approximately 120,000 people in the United Kingdom, with an average age of onset of 60 years.
Clinical symptoms of PD include bradykinesia (slowness of movement), tremor, muscle rigidity and postural instability. Due to the progressive nature of the disease, the symptoms may worsen over time and have a significant impact on the patient's quality of life. In addition, cognitive impairment may develop during the later stages of the disease. The need for high levels of support and care for PD patients can also use significant resources of health care systems.
There is no known cure for PD. Current treatments focus on the relief of disease symptoms, and include the use of a variety of different pharmaceutical agents to compensate for the decreased dopamine production in the brain. However, many of these treatments are associated with undesirable side effects.
There is therefore a need for new therapies that can be used to suppress and/ or prevent Parkinson's disease. The present invention addresses one or more of the above needs by providing double stranded nucleic acid (dsNA) molecules and nucleic acid vectors according to the present claims.
In one aspect the invention provides a double stranded nucleic acid (dsNA) molecule comprising a nucleic acid sense strand and an RNA antisense strand; wherein the RNA antisense strand binds to position 6176 on a target RNA nucleotide sequence that comprises the nucleotide sequence of SEQ ID NO: 10; wherein at least a portion of the RNA antisense strand and the nucleic acid sense strand together define a base-paired nucleic acid duplex having the structure of Formula (I):
Formula (I):
3'
Figure imgf000003_0001
[sense]
5' » 3' [antisense]
pi p9
wherein the nucleotides of the antisense RNA strand define consecutively numbered antisense nucleotide positions, said numbers increasing in a 5' to 3' direction on the antisense strand, with position 1 (p1 ) defined as the extreme 5' nucleotide present on the RNA antisense strand of the nucleic acid duplex that is base paired with a corresponding nucleotide present on the nucleic acid sense strand of the nucleic acid duplex;
and wherein the RNA antisense strand has a uracil nucleotide located at any one of positions p1 to p9 that binds to an adenine nucleotide located at position 6176 of an RNA nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 10.
While the precise causes of PD are yet to be fully elucidated, it is believed that certain cases of PD have a hereditary component. Research into the genetics of hereditary PD has identified 16 chromosomal "PARK" loci with linkage to the disease. Subsequently, a group of ten genes have been identified which are implicated in molecular pathways leading to PD pathogenesis. In some cases, a mutant form of a gene is created by the presence of a single nucleotide polymorphism (SNP). Collectively, these hereditary cases of PD account for approximately five percent of all cases of PD and offer defined therapeutic targets for those patients bearing these genetic mutations.
One of the genes involved in hereditary PD is LRRK2. A particular mutation in this gene - the G2019S single nucleotide polymorphism - has been linked to PD.
The LRRK2-G2019S mutation is the most common PD-linked mutation at present and represents the most attractive PD-mutation for allele-specific silencing. The mutation leads to a G:A conversion in the LRRK2 mRNA. The mutant LRRK2 gene may be present in heterozygous form, such that an affected individual carries one mutant LRRK2 allele and one wildtype LRRK2 allele.
The nucleotide sequence of SEQ ID NO: 10 is an mRNA sequence encoding the product of a human LRRK2 gene that has a G2019S single nucleotide polymorphism (also referred to herein as mutant LRRK2 or LRRK2-G2019S). The G2019S SNP causes the presence in the mutant LRRK2 mRNA (SEQ ID NO: 10) of an adenine nucleotide (mutant residue) at position 6176, whereas the wildtype LRRK2 mRNA sequence (SEQ ID NO: 1 1 ) has a guanine nucleotide at position 6176.
Thus, in use the dsNA molecule of the invention targets and/or binds to the LRRK2 gene, in particular to the LRRK2-G2019S mutant.
In more detail, the present inventors have identified that it is possible to create dsNA molecules that can be used to selectively reduce the expression in a target cell of the above-described mutant LRRK2 allele, while preserving expression of wildtype LRRK2. This effect is mediated via the mechanism of RNA interference (RNAi).
RNA interference (RNAi) has emerged as a highly credible strategy with which to sequence-specifically silence genes-of-interest by preventing the translation of targeted mRNA transcripts into proteins. The endogenous RNAi pathway is now well characterised and involves the processing of non-coding RNA sequences with characteristic stem-loop secondary structures, termed primary-microRNAs (pri-miRNAs), into short 21 -23nt single-stranded mature miRNAs that are antisense to targeted transcripts - see Fig. 1 . Complete complementarity of the mature miRNA sequence to the target mRNA leads to target cleavage and inhibition of protein synthesis, whereas incomplete pairing leads to translational repression either through mRNA destabilization or removal of the 5' cap or 3' poly-A termination signal.
Activation of the endogenous RNAi pathway may be achieved by the introduction into a cell of exogenous double stranded RNA, or by using DNA-encoded plasmids that transcribe RNA mimics of RNAi pathway precursors termed short hairpin RNAs (shRNAs) or primary-miRNA (pri-miRNA) mimics. These precursors are recognised and processed by the enzyme Dicer. The resulting short lengths of double stranded RNA are termed short interfering RNAs (siRNA). In addition to cleaving RNA, Dicer also promotes incorporation of siRNA into the RNA-induced silencing complex (RISC). Incorporation of siRNA into RISC leads to separation of the two RNA strands, termed the guide strand and the passenger strand. The guide strand binds to an exonuclease enzyme present in the RISC complex termed Argonaute, while the passenger strand is degraded. Whilst either strand of an siRNA molecule could in principle be incorporated as the guide strand, in practice the strand with the most thermodynamically unstable 5' end is favoured. Once the guide strand is bound, Argonaute targets and cleaves mRNA molecules complementary to the guide strand. Thus, the guide strand must contain the antisense sequence of the target mRNA. In many autosomal dominant disease settings where removal of a mutant allele is expected to be beneficial, a complete silencing of both mutant and wild-type alleles could be detrimental due to important roles of the wild-type protein. It is therefore advantageous to target the disease-causing genes involved in hereditary PD in such a way that expression of the mutant allele can be selectively limited whilst as much expression as possible of the wild-type allele is retained to carry out the endogenous function. Thus, the dsNA molecules of the present invention reduce the expression of the mutant LRRK2 allele in preference to reducing the expression of the wildtype LRRK2 allele. This provides an advantage in that the negative effects of the mutant LRRK2 allele are reduced, while necessary wildtype LRRK2 activity is retained.
In one embodiment, the antisense strand of a dsNA molecule of the invention binds to a region of the mutant LRRK2 mRNA sequence that encodes the mutant residue defining the G2019S mutation. The antisense strand is then capable of activating the RNAi mechanisms that will lead to degradation of the mutant LRRK2 mRNA and thus decrease mutant LRRK2 expression.
In one embodiment, the antisense strand is complementary to, and binds to, a region of the mutant LRRK2 mRNA sequence that includes the mutant adenine (A) residue defining the G2019S mutation.
The wildtype LRRK2 mRNA sequence does not possess the mutant adenine (A) residue defining the G2019S SNP, and thus the antisense strand of the dsNA molecule of the invention is not complementary to the wildtype LRRK2 mRNA strand at the site of the G2019S polymorphism. Instead of an adenine (A) residue, the wildtype possesses a guanine (G) residue at the same position. Thus, the antisense strand binds more weakly to the wildtype LRRK2 mRNA sequence than it does to the mutant LRRK2 mRNA sequence - i.e. the antisense strand has a greater affinity for the mutant LRRK2 mRNA sequence than for the wildtype LRRK2 sequence. The antisense nucleotide located immediately 5' to position p1 (as defined above), to the extent that any such 5' nucleotide is present, is not base-paired with a corresponding nucleotide on the sense strand.
As used herein, the term "complementary" refers to a nucleic acid molecule that forms hydrogen bonds with another nucleic acid molecule, or with itself, with Watson-Crick base pairing. Watson-Crick base pairing refers to the following hydrogen bonded nucleotide pairings: A:T and C:G (for DNA); and A:U and C:G (for RNA). For example, two or more complementary nucleic acid molecule strands can have the same number of nucleotides (i.e. have the same length and form one double-stranded region, with or without an overhang) or have a different number of nucleotides (e.g. one strand may be shorter than but fully contained within another strand or one strand may overhang the other strand).
In one embodiment, the double stranded nucleic acid (dsNA) molecule is any type of double stranded nucleic acid molecule that is able to mediate sequence- specific RNA interference against the target mutant LRRK2 gene. Thus, for example, the dsNA molecule may be a double stranded RNA, an siRNA, a short interfering nucleic acid, an shRNA, or a pri-miRNA. One or both of the sense strand and antisense strand of the dsNA molecule may comprise additional nucleotides that do not form part of the double stranded duplex portion. For example, one or both of the sense strand and antisense strand may have a 3' and/ or a 5' overhang region. In one embodiment, the uracil nucleotide located at any one of positions p1 to p9 on the antisense strand is located at a position selected from p1 , p2, p3, p4, p5, p6, p7 p8 or p9. In another embodiment, the uracil nucleotide located at any one of positions p1 to p9 on the antisense strand is located at a position selected from p1 , p2, p3, p4, p5, p6 or p7.
In another embodiment, the uracil nucleotide located at any one of positions p1 to p9 on the antisense strand is located at a position selected from p2, p3, p4, p5, or p6.
In another embodiment, the uracil nucleotide located at any one of positions p1 to p9 on the antisense strand is located at a position selected from p3, p4, or p5.
In another embodiment, the uracil nucleotide located at any one of positions p1 to p9 on the antisense strand is located at a position selected from p3 or p4, or from p4 or p5. In another embodiment, the uracil nucleotide located at any one of positions p1 to p9 on the antisense strand is located at position p4.
In one embodiment, the antisense strand of the dsNA molecule comprises or consists of a nucleic acid sequence selected from any one of SEQ ID NOs: 1 -9, wherein the first nucleotide position of said SEQ ID NO occupies position p1 on the antisense strand. In one embodiment, the antisense strand of the dsNA molecule comprises or consists of SEQ ID NO: 4, wherein the first nucleotide position of said SEQ ID NO occupies position p1 on the antisense strand.
In use, the underlined uracil nucleotide in said nucleic acid sequence binds to the adenine nucleotide located at position 6176 of a nucleotide sequence having the sequence of SEQ ID NO: 10. Thus, the antisense strand binds to a mutant LRRK2 mRNA sequence at the site of the G2019S mutation.
In one embodiment, the antisense strand of the dsNA molecule comprises a nucleic acid sequence selected from any of SEQ ID NOs: 1 -9, wherein the first nucleotide position of said SEQ ID NO occupies position p1 on the antisense strand, and wherein said antisense strand is up to 21 nucleotides in length (for example, 20 or 21 nucleotides). In one embodiment, the antisense strand of the dsNA molecule comprises a nucleic acid sequence selected from any of SEQ ID NOs: 1 -9, wherein the first nucleotide position of said SEQ ID NO occupies position p1 on the antisense strand, and wherein said antisense strand is up to 27 nucleotides in length (for example, 20, 21 , 22, 23, 24, 25, 26 or 27 nucleotides).
In one embodiment, the antisense strand of the dsNA molecule comprises or consists of a nucleic acid sequence that differs from SEQ ID NO: 3 by a single nucleotide, wherein the first nucleotide position of said SEQ ID NO occupies position p1 on the antisense strand, and wherein said difference is that the final 3' uracil (U) nucleotide in said SEQ ID NO has been replaced with a cytosine (C) nucleotide.
In one embodiment, the antisense strand of the dsNA molecule comprises or consists of a nucleic acid sequence that differs from SEQ ID NO: 4 by a single nucleotide, wherein the first nucleotide position of said SEQ ID NO occupies position p1 on the antisense strand, and wherein said difference is that the final 3' uracil (U) nucleotide in said SEQ ID NO has been replaced with a cytosine (C) nucleotide. In another embodiment, the antisense strand of the dsNA molecule comprises or consists of a nucleic acid sequence that differs (by at most 3, or 4 nucleotides) from a nucleotide sequence selected from any one of SEQ ID NOs: 1 -9, wherein the first nucleotide position of said SEQ ID NO occupies position p1 on the antisense strand, and with the proviso that said difference does not occur at the underlined uracil nucleotide identified in any of SEQ ID NOs: 1 -9.
In another embodiment, the antisense strand of the dsNA molecule comprises or consists of a nucleic acid sequence that differs (by at most 1 , or 2 nucleotides) from a nucleotide sequence selected from any one of SEQ ID NOs: 1 -9, wherein the first nucleotide position of said SEQ ID NO occupies position p1 on the antisense strand, and with the proviso that said difference does not occur at the underlined uracil nucleotide identified in any of SEQ ID NOs: 1 -9.
In one embodiment, the dsNA molecule is a dsNA molecule that is capable of being processed in the cytoplasm of a target cell by the enzyme Dicer. Dicer is an endoribonuclease enzyme present in eukaryotic cells that catalyses the breakdown of double stranded RNA molecules (including pre-microRNA molecules and short hairpin RNA molecules) into short double stranded RNA fragments approximately 20-25 nucleotides in length. The fragments produced by Dicer may be incorporated into the RNA-induced Silencing Complex (RISC).
In one embodiment, the dsNA molecule is a short hairpin RNA (shRNA). In one embodiment, the shRNA has a length of from about 40 nucleotides to about 50 nucleotides (for example, 40, 41 , 42, 43, 43, 45, 46, 47, 48, 49 or 50 nucleotides). In one embodiment, the shRNA has a maximum length of 120 nucleotides.
Thus, in one embodiment the antisense strand and the sense strand comprise part of a single strand of ribonucleic acid that is folded upon itself to form a short hairpin RNA. The shRNA molecule is typically transcribed as a single length of ribonucleic acid comprising self-complementary nucleotide sequences that enable the ribonucleic acid to fold upon itself to form the short hairpin RNA that is recognised by the RNAi pathway elements. In one embodiment, a short hairpin RNA of the invention is delivered into target cells using a nucleic acid vector as described in more detail below. In one embodiment, the dsNA molecule comprises or consists of a nucleic acid sequence selected from any one of SEQ ID NOs: 12-20.
In one embodiment, the dsNA molecule is an shRNA comprising, or consisting of, a nucleic acid sequence that differs (by at most 1 , 2, 3, 4, or 5 nucleotides) from a nucleotide sequence selected from any one of SEQ ID NOs: 12-20.
In one embodiment, the antisense strand and the sense strand comprise part of a single strand of ribonucleic acid that is folded upon itself to form a mimic of precursors of the miRNA pathway, referred to as pri-miRNAs or pre-miRNAs. The pri-miRNA or pre-miRNA molecule is typically transcribed as a single length of ribonucleic acid comprising self-complementary nucleotide sequences that enable the ribonucleic acid to fold upon itself to form the pri-miRNA or pre-miRNA that is recognised by the RNAi pathway elements. Thus, in one embodiment the dsNA molecule is a sequencing mimicking a primary microRNA (pri-miRNA) or a pre-miRNA.
In one embodiment, the dsNA molecule is a small internally segmented interfering RNA (sisiRNA), an asymmetric interfering RNA (aiRNA), or a DNA- RNA chimeric interfering RNA. These types of dsNA molecule are reviewed in Sibley et al., 2010 (PMID [PubMed unique identifier]: 20087319).
In one embodiment, the dsNA molecule is an siRNA molecule. Such molecules are typically 21 -23 base pairs in length, and may include 3' and/or 5' overhangs (typically 1 -4, 1 -3 or 1 -2 base overhangs). siRNA molecules typically have unphosphorylated hydroxyl groups at the 2' and 3' positions. In one embodiment, the dsNA molecule is a dicer substrate siRNA (D-siRNA) molecule. Thus, in one embodiment, the dsNA molecule is 25-27 base pairs in length (for example, 25, 26 or 27 base pairs). In one embodiment, the dsNA molecule that is a dicer substrate siRNA molecule includes 3' and/or 5' overhangs (typically 1 -4, 1 -3 or 1 -2 base overhangs).
D-siRNAs are recognised and processed by Dicer into siRNAs of 21 -23 base pairs and facilitate loading into the RNA induced silencing complex. D-siRNA molecules typically have unphosphorylated hydroxyl groups at the 2' and 3' positions. Thus, in one embodiment, the dsNA molecule that is a dicer substrate siRNA molecule has unphosphorylated hydroxyl groups at the 2' and 3' positions
The antisense strand of a dsNA molecule of the present invention may further comprise one or more nucleotides, wherein, when the antisense strand binds to position 6176 on the target RNA nucleotide sequence (e.g. SEQ ID NO: 10), said one or more nucleotides forms mismatch base-pairing with the corresponding nucleotide(s) located on the target RNA nucleotide sequence.
Mismatch pairings are formed between any two nucleotide bases that together do not form one of the hydrogen-bonded standard Watson-Crick base pairs of (in RNA) A:U and C:G (or A:T and C:G in DNA). Thus, in one embodiment, the antisense strand contains a nucleotide that does not form a standard Watson- Crick base pair when the antisense strand is bound to the target mutant LRRK2 mRNA sequence.
The present inventors have found that the deliberate incorporation of a nucleotide that introduces a mismatch base pairing with the target mutant LRRK2 mRNA sequence surprisingly improves the discrimination of dsNA molecules of the invention with regard to mutant (i.e. target) and corresponding wildtype LRRK2 mRNA. Thus, the presence of the mismatch nucleotide leads to a decrease in the inhibition of the wildtype LRRK2 allele while preserving the inhibition of the mutant LRRK2 allele.
The antisense nucleotide that forms the mismatch pairing as described above may be any nucleotide capable of forming such a mismatch pairing.
In one embodiment, the presence of a mismatch pairing disrupts the surrounding nucleic acid duplex formed between the antisense strand of a dsNA molecule of the invention and an LRRK2 mRNA molecule.
Due to the fact that purine bases (A and G) are larger than pyrimidine bases (U and C), a purine:purine mismatch occupies more space than a standard C:G or A:U pairing and so disrupts the surrounding nucleic acid duplex to a greater extent than a pyrimidine:purine or pyrimidine:pyrimidine mismatch - see Fig. 4B & 5.
The extent of the disruption to the nucleic acid duplex surrounding the mismatch is believed to influence the ability of the antisense strand to direct cleavage (via RISC) of the LRRK2 mRNA sequence. Thus, the presence (in the antisense strand) of a nucleotide that gives rise to a mismatch pairing occupying a large amount of space (for example a purine:purine mismatch) is understood to result in a maximum decrease in the ability of said antisense strand to direct cleavage of the LRRK2 mRNA sequence. Thus, without wishing to be bound by any theory, the present inventor believes that the presence of mismatch pairing decreases the affinity with which the antisense strand binds to both the mutant LRRK2 mRNA sequence and the wildtype LRRK2 mRNA sequence. However, because the antisense strand already has a first mismatch nucleotide for the wildtype LRRK2 mRNA sequence (i.e. the uracil (U) nucleotide that binds to the mutant G2019S SNP), the presence of a second mismatch nucleotide provides a much greater mismatch effect between the antisense strand and the wildtype LRRK2 mRNA sequence. Thus, the effect of a second (or subsequent) mismatch on the affinity of the antisense strand for the wildtype LRRK2 sequence is more pronounced compared to LRRK2-G2019S.
A hierarchy of mismatch pairs showing the extent to which the formation of a given mismatch increases the ability of the antisense strand to discriminate between target LRRK2-G2019S and wildtype LRRK2 is shown in Figure 5. In one embodiment, the above-described mismatch is provided at a position adjacent to the uracil nucleotide on the antisense strand that binds to position 6176 on SEQ ID NO: 10.
Thus, in one embodiment, the mismatch nucleotide is located immediately 5' and/or 3' to the uracil nucleotide (i.e. the uracil that binds to position 6176 on SEQ ID NO: 10).
In another embodiment, the mismatch nucleotide may be located 2, 3, 4, 5 or 6 nucleotide positions 3' and/or 5' away from the uracil nucleotide (i.e. the uracil that binds to position 6176 on SEQ ID NO: 10).
In another embodiment, the mismatch nucleotide may be located up to 18 nucleotide positions (for example, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, or 18 nucleotide positions) 3' and/or 5' away from the uracil nucleotide (i.e. the uracil that binds to position 6176 on SEQ ID NO: 10).
In one embodiment, the antisense strand of a dsNA molecule of the invention comprises a variant sequence of any one of SEQ ID NOs: 1 -9. Thus, in one embodiment, the antisense strand of a dsNA molecule of the invention comprises or consists of a variant of any one of SEQ ID NOs: 1 -9, wherein one or more (e.g. at most 1 , at most 2, at most 3, at most 4, or at most 5) mismatch nucleotides other than the underlined uracil nucleotide is replaced by a different nucleotide. This may include inclusion of cognate ribonucleotide bases of A, C, G or U, or synthetic ribonucleotide analogues such as, but not exclusively, locked nucleic acids (LNA) or peptide nucleic acids (PNA). In this embodiment, the variant retains the underlined uracil nucleotide as depicted in SEQ ID NOs: 1 -9 as a uracil nucleotide.
In one embodiment, the one or more mismatch nucleotide(s) forms a mismatch pairing with the corresponding nucleotide located on the target mRNA, wherein said mismatch pairing is selected from a purine:purine, a purine:pyrimidine, or a pyrimidine:pyrimidine mismatch pairing.
In one embodiment at least one strand of the dsNA molecule of the invention may comprise one or more chemical modifications. Said chemical modification may be introduced to the antisense strand and/ or to the sense strand.
In one embodiment, the at least one chemical modification improves the stability of the dsNA molecule. Thus, in one embodiment, a chemical modification increases the half-life of a dsNA molecule of the invention (e.g. in an aqueous solution). In one embodiment, a chemical modification increases the half-life of a dsNA molecule of the invention when introduced into a target cell.
The chemical modification may comprise a substitution or modification in which the substitution or modification may be in a phosphate backbone bond, a sugar, a base, or a nucleoside. Such nucleoside substitutions can include natural nonstandard nucleosides (e.g., 5-methyluridine or 5-methylcytidine or a 2- thioribothymidine), and such backbone, sugar, or nucleoside modifications can include an alkyl or heteroatom substitution or addition, such as a methyl, alkoxyalkyl, halogen, nitrogen or sulphur, or other modifications known in the art. Reference to nucleic acid(s) and/or nucleotide(s) embraces modified nucleic acid(s). For example a nucleic acid or nucleotide may be modified to increase or decrease the stability of said nucleic acid or nucleotide. In one embodiment, a modified nucleic acid comprises a locked nucleotide (LNA). In more detail, the ribose moiety of an LNA nucleotide is modified with an extra bridge connecting the 2' oxygen and 4' carbon. The bridge "locks" the ribose in the 3'-endo (North) conformation, which is often found in the A-form duplexes. LNA nucleotides can be mixed with DNA or RNA residues in the oligonucleotide whenever desired. Such oligomers are commercially available. The locked ribose conformation enhances base stacking and backbone pre-organization. This significantly increases the hybridization properties (melting temperature) of oligonucleotides.
Reference to modified nucleic acid(s) and/or to modified nucleotide(s) also embraces nucleic acid analogues. Nucleic acid analogues are composed of three parts: a phosphate backbone, a pucker-shaped pentose sugar, either ribose or deoxyribose, and one of four nucleobases. An analogue may have any of these altered. Typically the analogue nucleobases confer, among other things, different base pairing and base stacking proprieties. Examples include universal bases, which can pair with all four canon bases, and phosphate-sugar backbone analogues such as PNA, which affect the properties of the chain (PNA can even form a triple helix). Artificial nucleic acids include peptide nucleic acid (PNA), Morpholino and LNA, as well as glycol nucleic acid (GNA) and threose nucleic acid (TNA). Each of these is distinguished from naturally-occurring DNA or RNA by changes to the backbone of the molecule.
The dsNA molecules of the present invention may be made using any suitable process known in the art. Thus, the dsNA molecules of the present invention may be made using chemical synthesis techniques. Alternatively, the dsNA molecules of the present invention may be made using molecular biology techniques (for example, as reported in Yu et al. 2002, PMID: 1 1972060, which is hereby incorporated by reference in its entirety). Alternatively, the dsNA molecules of the present invention may be synthesized by a commercial supplier.
In one aspect, the invention provides a nucleic acid vector comprising a nucleic acid sequence encoding a dsNA molecule as described herein. In this scenario, the resultant RNA may be produced in vivo.
The dsNA molecules of the present invention may be made by conventional expression of a nucleic acid vector encoding said dsNA molecule, followed by conventional RNA recovery. Thus, in this scenario, the RNA is produced in vitro.
In one embodiment the nucleic acid vector is a plasmid.
In one embodiment the nucleic acid vector is a viral vector. Thus, in one embodiment the dsNA molecules of the present invention may be delivered into a target cell using a viral vector. The viral vector may be any virus which can serve as a viral vector. Suitable viruses are those which infect the target cells, can be propagated in vitro, and can be modified by recombinant nucleotide technology known in the art.
In one embodiment, the viral vector is selected from the group consisting of: an adenovirus vector; an adeno-associated virus vector; a pox virus vector, such as a fowlpox virus vector; an alpha virus vector; a bacloviral vector; a herpes virus vector; a retrovirus vector, such as a lentivirus vector; a Modified Vaccinia virus Ankara vector; a Ross River virus vector; a Sindbis virus vector; a Semliki Forest virus vector; and a Venezuelan Equine Encephalitis virus vector.
In one aspect, the invention provides a method for reducing the expression in a cell of a human LRRK2 gene having the G2019S SNP, comprising administering a therapeutically effective amount of a dsNA molecule as described above to a patient in need thereof, wherein the antisense strand of the dsNA molecule is capable of binding to position 6176 on an RNA nucleotide sequence having the sequence of SEQ ID NO: 10
In one aspect, the invention provides a dsNA molecule as described herein, or a nucleic acid vector as described herein, for use in the treatment of Parkinson's disease. In one embodiment, the treatment of Parkinson's disease comprises the treatment of a human subject having Parkinson's disease.
In one aspect, the invention provides a therapeutic and/or prophylactic formulation, comprising a dsNA molecule as described above. In one embodiment, the therapeutic and/or prophylactic formulation may be used in the therapeutic and/or prophylactic treatment of Parkinson's Disease.
In one aspect, the invention provides a pharmaceutical composition, comprising a dsNA molecule as described above; and a pharmaceutically acceptable carrier.
The dsNA molecule of the invention may be formulated into a pharmaceutical composition as neutral or salt forms. Pharmaceutically acceptable salts include acid addition salts formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or with organic acids such as acetic, oxalic, tartaric, maleic, and the like. Salts formed with the free carboxyl groups may also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine, and the like.
Administration of pharmaceutical compositions is generally by conventional routes e.g. intravenous, subcutaneous, intraperitoneal, or mucosal routes. The administration may be by parenteral administration; for example, a subcutaneous or intramuscular injection. Accordingly, the pharmaceutical compositions of the invention may be prepared as injectables, either as liquid solutions or suspensions. Solid forms suitable for solution in, or suspension in, liquid prior to injection may alternatively be prepared. The preparation may also be emulsified, or the peptide encapsulated in liposomes or microcapsules.
The active ingredients are often mixed with excipients which are pharmaceutically acceptable and compatible with the active ingredient. Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol, or the like and combinations thereof. In addition, if desired, the pharmaceutical compositions may contain minor amounts of auxiliary substances such as wetting or emulsifying agents, and/or pH buffering agents.
Non-limiting examples of pharmaceutically acceptable carriers include water, saline, and phosphate-buffered saline. In some embodiments, however, the composition is in lyophilized form, in which case it may include a stabilizer, such as bovine serum albumin (BSA). In some embodiments, it may be desirable to formulate the composition with a preservative, such as thiomersal or sodium azide, to facilitate long term storage.
Examples of buffering agents include, but are not limited to, sodium succinate (pH 6.5), and phosphate buffered saline (PBS; pH 6.5 and 7.5).
Additional formulations which are suitable for other modes of administration include suppositories and, in some cases, oral formulations or formulations suitable for distribution as aerosols. For suppositories, traditional binders and carriers may include, for example, polyalkylene glycols or triglycerides; such suppositories may be formed from mixtures containing the active ingredient in the range of 0.5% to 10%, preferably 1 %-2%. Oral formulations include such normally employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like. These compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations or powders.
It may be desired to direct the dsNA molecules of the present invention (as described above) to the respiratory system of a subject. Efficient transmission of a therapeutic/prophylactic formulation or medicament to the site of infection in the lungs may be achieved by oral or intra-nasal administration.
Formulations for intranasal administration may be in the form of nasal droplets or a nasal spray. An intranasal formulation may comprise droplets having approximate diameters in the range of 100-5000 μιτι, such as 500-4000 μιτι, 1000-3000 μηη or 100-1000 μηη. Alternatively, in terms of volume, the droplets may be in the range of about 0.001 -100 μΙ, such as 0.1 -50 μΙ or 1 .0-25 μΙ, or such as 0.001 -1 μΙ.
Alternatively, the therapeutic/prophylactic formulation or medicament may be an aerosol formulation. The aerosol formulation may take the form of a powder, suspension or solution. The size of aerosol particles is relevant to the delivery capability of an aerosol . Smaller particles may travel further down the respiratory airway towards the alveoli than would larger particles. In one embodiment, the aerosol particles have a diameter distribution to facilitate delivery along the entire length of the bronchi, bronchioles, and alveoli. Alternatively, the particle size distribution may be selected to target a particular section of the respiratory airway, for example the alveoli. In the case of aerosol delivery of the medicament, the particles may have diameters in the approximate range of 0.1 - 50 μιτι, preferably 1 -25 μιτι, more preferably 1 -5 μιτι. Aerosol particles may be for delivery using a nebulizer (e.g. via the mouth) or nasal spray. An aerosol formulation may optionally contain a propellant and/or surfactant. By controlling the size of the droplets/particles to within the defined range of the present invention, it is possible to avoid (or minimize) inadvertent medicament delivery to the alveoli and thus avoid alveoli-associated pathological problems such as inflammation and fibrotic scarring of the lungs. In one embodiment, the therapeutic formulations and pharmaceutical compositions of the invention comprise a pharmaceutically acceptable carrier, and optionally one or more of a salt, excipient, diluent and/ or adjuvant.
In one embodiment, the therapeutic formulations and pharmaceutical compositions of the invention may comprise one or more immunoregulatory agents selected from, for example, immunoglobulins, antibiotics, interleukins (e.g. IL-2, IL-12), and/or cytokines (e.g. IFNy).
In one embodiment, the therapeutic formulations and pharmaceutical compositions of the invention may comprise one or more antimicrobial compounds, (for example, conventional anti-tuberculosis drugs such as rifampicin, isoniazid, ethambutol or pyrizinamide).
The therapeutic formulations and pharmaceutical compositions of the invention may be given in a single dose schedule (i.e. the full dose is given at substantially one time). Alternatively, the immunogenic compositions, therapeutic formulations, medicaments, pharmaceutical compositions, and prophylactic formulations of the invention may be given in a multiple dose schedule.
A multiple dose schedule is one in which a primary course of treatment (e.g. vaccination) may be with 1 -6 separate doses, followed by other doses given at subsequent time intervals required to maintain and or reinforce the immune response, for example (for human subjects), at 1 -4 months for a second dose, and if needed, a subsequent dose(s) after a further 1 -4 months. The dosage regimen will be determined, at least in part, by the need of the individual and be dependent upon the judgment of the practitioner (e.g. doctor)
Simultaneous administration means administration at (substantially) the same time.
Sequential administration of two or more compositions/therapeutic agents means that the compositions/therapeutic agents are administered at (substantially) different times, one after the other. The therapeutic formulations and pharmaceutical compositions may contain 5% to 95% of active ingredient, such as at least 10% or 25% of active ingredient, or at least 40% of active ingredient or at least 50, 55, 60, 70 or 75% active ingredient. The therapeutic formulations and pharmaceutical compositions are administered in a manner compatible with the dosage formulation, and in such amount as will be prophylactically and/or therapeutically effective.
In this regard, as used herein, an "effective amount" is a dosage or amount that is sufficient to achieve a desired biological outcome. As used herein, a "therapeutically effective amount" is an amount which is effective, upon single or multiple dose administration to a subject (e.g. a human) for treating, preventing, curing, delaying, reducing the severity of, ameliorating at least one symptom of a disorder or recurring disorder, or prolonging the survival of the subject beyond that expected in the absence of such treatment. Accordingly, the quantity of active ingredient to be administered depends on the subject to be treated, capacity of the subject's immune system to generate a protective immune response, and the degree of protection desired. Precise amounts of active ingredient required to be administered may depend on the judgment of the practitioner and may be particular to each subject.
Key to SEQ ID NOs.
All nucleotide sequences are written in the direction 5' - 3'.
SEQ ID NOs 1 -9 Nucleotide sequences of an RNA antisense strand complementary to LRRK2-G2019S wherein the uracil nucleotide at position p1 -9 (underlined), respectively, binds to the site of the G2019S SNP on the LRRK2-G2019S mRNA.
SEQ ID NO: 10 mRNA sequence of LRRK2 gene having G2019S SNP.
SEQ ID NO: 1 1 mRNA sequence of wildtype LRRK2 gene.
SEQ ID NO: 12-20 shRNA molecules directed against LRRK2-G2019S, having an antisense strand corresponding to SEQ ID NOs 1 -9, respectively (i.e. wherein the nucleotide that binds the G2019S SNP location on the target mRNA is located on the shRNA antisense strand at positions p1 -p9, respectively (as defined above)).
Sequences
SEQ ID NO: 1 UGUAGUCAGCAAUCUUUGC
SEQ ID NO: 2 CUGUAGUCAGCAAUCUUUG
SEQ ID NO: 3 GCUGUAGUCAGCAAUCUUU
SEQ ID NO: 4 UGCUGUAGUCAGCAAUCUU
SEQ ID NO: 5 AUGCUGUAGUCAGCAAUCU
SEQ ID NO: 6 AAUGCUGUAGUCAGCAAUC
SEQ ID NO: 7 CAAUGCUGUAGUCAGCAAU
SEQ ID NO: 8 GCAAUGCUGUAGUCAGCAA
SEQ ID NO: 9 AGCAAUGCUGUAGUCAGCA
SEQ ID NO: 10
1 gcgctggctg cgggcggtga gctgagctcg cccccgggga gctgtggccg gcgcccctgc 61 cggttccctg agcagcggac gttcatgctg ggagggcggc gggttggaag caggtgccac 121 catggctagt ggcagctgtc aggggtgcga agaggacgag gaaactctga agaagttgat 181 agtcaggctg aacaatgtcc aggaaggaaa acagatagaa acgctggtcc aaatcctgga 241 ggatctgctg gtgttcacgt actccgagca cgcctccaag ttatttcaag gcaaaaatat 301 ccatgtgcct ctgttgatcg tcttggactc ctatatgaga gtcgcgagtg tgcagcaggt 361 gggttggtca cttctgtgca aattaataga agtctgtcca ggtacaatgc aaagcttaat 421 gggaccccag gatgttggaa atgattggga agtccttggt gttcaccaat tgattcttaa 481 aatgctaaca gttcataatg ccagtgtaaa cttgtcagtg attggactga agaccttaga 541 tctcctccta acttcaggta aaatcacctt gctgatattg gatgaagaaa gtgatatttt 601 catgttaatt tttgatgcca tgcactcatt tccagccaat gatgaagtcc agaaacttgg 661 atgcaaagct ttacatgtgc tgtttgagag agtctcagag gagcaactga ctgaatttgt 721 tgagaacaaa gattatatga tattgttaag tgcgttaaca aattttaaag atgaagagga 781 aattgtgctt catgtgctgc attgtttaca ttccctagcg attccttgca ataatgtgga 841 agtcctcatg agtggcaatg tcaggtgtta taatattgtg gtggaagcta tgaaagcatt 901 ccctatgagt gaaagaattc aagaagtgag ttgctgtttg ctccataggc ttacattagg 961 taattttttc aatatcctgg tattaaacga agtccatgag tttgtggtga aagctgtgca 1021 gcagtaccca gagaatgcag cattgcagat ctcagcgctc agctgtttgg ccctcctcac 1081 tgagactatt ttcttaaatc aagatttaga ggaaaagaat gagaatcaag agaatgatga 1141 tgagggggaa gaagataaat tgttttggct ggaagcctgt tacaaagcat taacgtggca 1201 tagaaagaac aagcacgtgc aggaggccgc atgctgggca ctaaataatc tccttatgta 1261 ccaaaacagt ttacatgaga agattggaga tgaagatggc catttcccag ctcataggga 1321 agtgatgctc tccatgctga tgcattcttc atcaaaggaa gttttccagg catctgcgaa 1381 tgcattgtca actctcttag aacaaaatgt taatttcaga aaaatactgt tatcaaaagg 1441 aatacacctg aatgttttgg agttaatgca gaagcatata cattctcctg aagtggctga 1501 aagtggctgt aaaatgctaa atcatctttt tgaaggaagc aacacttccc tggatataat 1561 ggcagcagtg gtccccaaaa tactaacagt tatgaaacgt catgagacat cattaccagt 1621 gcagctggag gcgcttcgag ctattttaca ttttatagtg cctggcatgc cagaagaatc 1681 cagggaggat acagaatttc atcataagct aaatatggtt aaaaaacagt gtttcaagaa 1741 tgatattcac aaactggtcc tagcagcttt gaacaggttc attggaaatc ctgggattca 1801 gaaatgtgga ttaaaagtaa tttcttctat tgtacatttt cctgatgcat tagagatgtt 1861 atccctggaa ggtgctatgg attcagtgct tcacacactg cagatgtatc cagatgacca 1921 agaaattcag tgtctgggtt taagtcttat aggatacttg attacaaaga agaatgtgtt 1981 cataggaact ggacatctgc tggcaaaaat tctggtttcc agcttatacc gatttaagga 2041 tgttgctgaa atacagacta aaggatttca gacaatctta gcaatcctca aattgtcagc 2101 atctttttct aagctgctgg tgcatcattc atttgactta gtaatattcc atcaaatgtc 2161 ttccaatatc atggaacaaa aggatcaaca gtttctaaac ctctgttgca agtgttttgc 2221 aaaagtagct atggatgatt acttaaaaaa tgtgatgcta gagagagcgt gtgatcagaa 2281 taacagcatc atggttgaat gcttgcttct attgggagca gatgccaatc aagcaaagga 2341 gggatcttct ttaatttgtc aggtatgtga gaaagagagc agtcccaaat tggtggaact 2401 cttactgaat agtggatctc gtgaacaaga tgtacgaaaa gcgttgacga taagcattgg 2461 gaaaggtgac agccagatca tcagcttgct cttaaggagg ctggccctgg atgtggccaa 2521 caatagcatt tgccttggag gattttgtat aggaaaagtt gaaccttctt ggcttggtcc 2581 tttatttcca gataagactt ctaatttaag gaaacaaaca aatatagcat ctacactagc 2641 aagaatggtg atcagatatc agatgaaaag tgctgtggaa gaaggaacag cctcaggcag 2701 cgatggaaat ttttctgaag atgtgctgtc taaatttgat gaatggacct ttattcctga 2761 ctcttctatg gacagtgtgt ttgctcaaag tgatgacctg gatagtgaag gaagtgaagg 2821 ctcatttctt gtgaaaaaga aatctaattc aattagtgta ggagaatttt accgagatgc 2881 cgtattacag cgttgctcac caaatttgca aagacattcc aattccttgg ggcccatttt 2941 tgatcatgaa gatttactga agcgaaaaag aaaaatatta tcttcagatg attcactcag 3001 gtcatcaaaa cttcaatccc atatgaggca ttcagacagc atttcttctc tggcttctga 3061 gagagaatat attacatcac tagacctttc agcaaatgaa ctaagagata ttgatgccct 3121 aagccagaaa tgctgtataa gtgttcattt ggagcatctt gaaaagctgg agcttcacca 3181 gaatgcactc acgagctttc cacaacagct atgtgaaact ctgaagagtt tgacacattt 3241 ggacttgcac agtaataaat ttacatcatt tccttcttat ttgttgaaaa tgagttgtat 3301 tgctaatctt gatgtctctc gaaatgacat tggaccctca gtggttttag atcctacagt 3361 gaaatgtcca actctgaaac agtttaacct gtcatataac cagctgtctt ttgtacctga 3421 gaacctcact gatgtggtag agaaactgga gcagctcatt ttagaaggaa ataaaatatc 3481 agggatatgc tcccccttga gactgaagga actgaagatt ttaaacctta gtaagaacca 3541 catttcatcc ctatcagaga actttcttga ggcttgtcct aaagtggaga gtttcagtgc 3601 cagaatgaat tttcttgctg ctatgccttt cttgcctcct tctatgacaa tcctaaaatt 3661 atctcagaac aaattttcct gtattccaga agcaatttta aatcttccac acttgcggtc 3721 tttagatatg agcagcaatg atattcagta cctaccaggt cccgcacact ggaaatcttt 3781 gaacttaagg gaactcttat ttagccataa tcagatcagc atcttggact tgagtgaaaa 3841 agcatattta tggtctagag tagagaaact gcatctttct cacaataaac tgaaagagat 3901 tcctcctgag attggctgtc ttgaaaatct gacatctctg gatgtcagtt acaacttgga 3961 actaagatcc tttcccaatg aaatggggaa attaagcaaa atatgggatc ttcctttgga 4021 tgaactgcat cttaactttg attttaaaca tataggatgt aaagccaaag acatcataag 4081 gtttcttcaa cagcgattaa aaaaggctgt gccttataac cgaatgaaac ttatgattgt 4141 gggaaatact gggagtggta aaaccacctt attgcagcaa ttaatgaaaa ccaagaaatc 4201 agatcttgga atgcaaagtg ccacagttgg catagatgtg aaagactggc ctatccaaat 4261 aagagacaaa agaaagagag atctcgtcct aaatgtgtgg gattttgcag gtcgtgagga 4321 attctatagt actcatcccc attttatgac gcagcgagca ttgtaccttg ctgtctatga 4381 cctcagcaag ggacaggctg aagttgatgc catgaagcct tggctcttca atataaaggc 4441 tcgcgcttct tcttcccctg tgattctcgt tggcacacat ttggatgttt ctgatgagaa 4501 gcaacgcaaa gcctgcatga gtaaaatcac caaggaactc ctgaataagc gagggttccc 4561 tgccatacga gattaccact ttgtgaatgc caccgaggaa tctgatgctt tggcaaaact 4621 tcggaaaacc atcataaacg agagccttaa tttcaagatc cgagatcagc ttgttgttgg 4681 acagctgatt ccagactgct atgtagaact tgaaaaaatc attttatcgg agcgtaaaaa 4741 tgtgccaatt gaatttcccg taattgaccg gaaacgatta ttacaactag tgagagaaaa 4801 tcagctgcag ttagatgaaa atgagcttcc tcacgcagtt cactttctaa atgaatcagg 4861 agtccttctt cattttcaag acccagcact gcagttaagt gacttgtact ttgtggaacc 4921 caagtggctt tgtaaaatca tggcacagat tttgacagtg aaagtggaag gttgtccaaa 4981 acaccctaag ggcattattt cgcgtagaga tgtggaaaaa tttctttcaa aaaaaaggaa 5041 atttccaaag aactacatgt cacagtattt taagctccta gaaaaattcc agattgcttt 5101 gccaatagga gaagaatatt tgctggttcc aagcagtttg tctgaccaca ggcctgtgat 5161 agagcttccc cattgtgaga actctgaaat tatcatccga ctatatgaaa tgccttattt 5221 tccaatggga ttttggtcaa gattaatcaa tcgattactt gagatttcac cttacatgct 5281 ttcagggaga gaacgagcac ttcgcccaaa cagaatgtat tggcgacaag gcatttactt 5341 aaattggtct cctgaagctt attgtctggt aggatctgaa gtcttagaca atcatccaga 5401 gagtttctta aaaattacag ttccttcttg tagaaaaggc tgtattcttt tgggccaagt 5461 tgtggaccac attgattctc tcatggaaga atggtttcct gggttgctgg agattgatat 5521 ttgtggtgaa ggagaaactc tgttgaagaa atgggcatta tatagtttta atgatggtga 5581 agaacatcaa aaaatcttac ttgatgactt gatgaagaaa gcagaggaag gagatctctt 5641 agtaaatcca gatcaaccaa ggctcaccat tccaatatct cagattgccc ctgacttgat 5701 tttggctgac ctgcctagaa atattatgtt gaataatgat gagttggaat ttgaacaagc 5761 tccagagttt ctcctaggtg atggcagttt tggatcagtt taccgagcag cctatgaagg 5821 agaagaagtg gctgtgaaga tttttaataa acatacatca ctcaggctgt taagacaaga 5881 gcttgtggtg ctttgccacc tccaccaccc cagtttgata tctttgctgg cagctgggat 5941 tcgtccccgg atgttggtga tggagttagc ctccaagggt tccttggatc gcctgcttca 6001 gcaggacaaa gccagcctca ctagaaccct acagcacagg attgcactcc acgtagctga 6061 tggtttgaga tacctccact cagccatgat tatataccga gacctgaaac cccacaatgt 6121 gctgcttttc acactgtatc ccaatgctgc catcattgca aagattgctg actacSgcat 6181 tgctcagtac tgctgtagaa tggggataaa aacatcagag ggcacaccag ggtttcgtgc 6241 acctgaagtt gccagaggaa atgtcattta taaccaacag gctgatgttt attcatttgg 6301 tttactactc tatgacattt tgacaactgg aggtagaata gtagagggtt tgaagtttcc 6361 aaatgagttt gatgaattag aaatacaagg aaaattacct gatccagtta aagaatatgg 6421 ttgtgcccca tggcctatgg ttgagaaatt aattaaacag tgtttgaaag aaaatcctca 6481 agaaaggcct acttctgccc aggtctttga cattttgaat tcagctgaat tagtctgtct 6541 gacgagacgc attttattac ctaaaaacgt aattgttgaa tgcatggttg ctacacatca 6601 caacagcagg aatgcaagca tttggctggg ctgtgggcac accgacagag gacagctctc 6661 atttcttgac ttaaatactg aaggatacac ttctgaggaa gttgctgata gtagaatatt 6721 gtgcttagcc ttggtgcatc ttcctgttga aaaggaaagc tggattgtgt ctgggacaca 6781 gtctggtact ctcctggtca tcaataccga agatgggaaa aagagacata ccctagaaaa 6841 gatgactgat tctgtcactt gtttgtattg caattccttt tccaagcaaa gcaaacaaaa 6901 aaattttctt ttggttggaa ccgctgatgg caagttagca atttttgaag ataagactgt 6961 taagcttaaa ggagctgctc ctttgaagat actaaatata ggaaatgtca gtactccatt 7021 gatgtgtttg agtgaatcca caaattcaac ggaaagaaat gtaatgtggg gaggatgtgg 7081 cacaaagatt ttctcctttt ctaatgattt caccattcag aaactcattg agacaagaac 7141 aagccaactg ttttcttatg cagctttcag tgattccaac atcataacag tggtggtaga 7201 cactgctctc tatattgcta agcaaaatag ccctgttgtg gaagtgtggg ataagaaaac 7261 tgaaaaactc tgtggactaa tagactgcgt gcacttttta agggaggtaa tggtaaaaga 7321 aaacaaggaa tcaaaacaca aaatgtctta ttctgggaga gtgaaaaccc tctgccttca 7381 gaagaacact gctctttgga taggaactgg aggaggccat attttactcc tggatctttc 7441 aactcgtcga cttatacgtg taatttacaa cttttgtaat tcggtcagag tcatgatgac 7501 agcacagcta ggaagcctta aaaatgtcat gctggtattg ggctacaacc ggaaaaatac 7561 tgaaggtaca caaaagcaga aagagataca atcttgcttg accgtttggg acatcaatct 7621 tccacatgaa gtgcaaaatt tagaaaaaca cattgaagtg agaaaagaat tagctgaaaa 7681 aatgagacga acatctgttg agtaagagag aaataggaat tgtctttgga taggaaaatt 7741 attctctcct cttgtaaata tttattttaa aaatgttcac atggaaaggg tactcacatt 7801 ttttgaaata gctcgtgtgt atgaaggaat gttattattt ttaatttaaa tatatgtaaa 7861 aatacttacc agtaaatgtg tattttaaag aactatttaa aacacaatgt tatatttctt 7921 ataaatacca gttactttcg ttcattaatt aatgaaaata aatctgtgaa gtacctaatt 7981 taagtactca tactaaaatt tataaggccg ataatttttt gttttcttgt ctgtaatgga 8041 ggtaaacttt attttaaatt ctgtgcttaa gacaggacta ttgcttgtcg atttttctag 8101 aaatctgcac ggtataatga aaatattaag acagtttccc atgtaatgta ttccttctta 8161 gattgcatcg aaatgcacta tcatatatgc ttgtaaatat tcaaatgaat ttgcactaat 8221 aaagtccttt gttggtatgt gaattctctt tgttgctgtt gcaaacagtg catcttacac 8281 aacttcactc aattcaaaag aaaactccat taaaagtact aatgaaaaaa catgacatac 8341 tgtcaaagtc ctcatatcta ggaaagacac agaaactctc tttgtcacag aaactctctg 8401 tgtctttcct agacataata gagttgtttt tcaactctat gtttgaatgt ggataccctg 8461 aattttgtat aattagtgta aatacagtgt tcagtccttc aagtgatatt tttatttttt 8521 tattcatacc actagctact tgttttctaa tctgcttcat tctaatgctt atattcatct 8581 tttccctaaa tttgtgatgc tgcagatcct acatcattca gatagaaacc tttttttttt 8641 tcagaattat agaattccac agctcctacc aagaccatga ggataaatat ctaacacttt 8701 tcagttgctg aaggagaaag gagctttagt tatgatggat aaaaatatct gccaccctag 8761 gcttccaaat tatacttaaa ttgtttacat agcttaccac aataggagta tcagggccaa 8821 atacctatgt aataatttga ggtcatttct gctttaggaa aagtactttc ggtaaattct
8881 ttggccctga ccagtattca ttatttcaga taattccctg tgataggaca actagtacat
8941 ttaatattct cagaacttat ggcattttac tatgtgaaaa ctttaaattt atttatatta
9001 agggtaatca aattcttaaa gatgaaagat tttctgtatt ttaaaggaag ctatgcttta
9061 acttgttatg taattaacaa aaaaatcata tataatagag ctctttgttc cagtgttatc
9121 tctttcattg ttactttgta tttgcaattt tttttaccaa agacaaatta aaaaaatgaa
9181 taccatattt aaatggaata ataaaggttt tttaaaaact ttaaaaaaaa aaaaaaaaa
NM 198578.3
1 gcgctggctg cgggcggtga gctgagctcg cccccgggga gctgtggccg gcgcccctgc 61 cggttccctg agcagcggac gttcatgctg ggagggcggc gggttggaag caggtgccac 121 catggctagt ggcagctgtc aggggtgcga agaggacgag gaaactctga agaagttgat 181 agtcaggctg aacaatgtcc aggaaggaaa acagatagaa acgctggtcc aaatcctgga 241 ggatctgctg gtgttcacgt actccgagca cgcctccaag ttatttcaag gcaaaaatat 301 ccatgtgcct ctgttgatcg tcttggactc ctatatgaga gtcgcgagtg tgcagcaggt 361 gggttggtca cttctgtgca aattaataga agtctgtcca ggtacaatgc aaagcttaat 421 gggaccccag gatgttggaa atgattggga agtccttggt gttcaccaat tgattcttaa 481 aatgctaaca gttcataatg ccagtgtaaa cttgtcagtg attggactga agaccttaga 541 tctcctccta acttcaggta aaatcacctt gctgatattg gatgaagaaa gtgatatttt 601 catgttaatt tttgatgcca tgcactcatt tccagccaat gatgaagtcc agaaacttgg 661 atgcaaagct ttacatgtgc tgtttgagag agtctcagag gagcaactga ctgaatttgt 721 tgagaacaaa gattatatga tattgttaag tgcgttaaca aattttaaag atgaagagga 781 aattgtgctt catgtgctgc attgtttaca ttccctagcg attccttgca ataatgtgga 841 agtcctcatg agtggcaatg tcaggtgtta taatattgtg gtggaagcta tgaaagcatt 901 ccctatgagt gaaagaattc aagaagtgag ttgctgtttg ctccataggc ttacattagg 961 taattttttc aatatcctgg tattaaacga agtccatgag tttgtggtga aagctgtgca 1021 gcagtaccca gagaatgcag cattgcagat ctcagcgctc agctgtttgg ccctcctcac 1081 tgagactatt ttcttaaatc aagatttaga ggaaaagaat gagaatcaag agaatgatga 1141 tgagggggaa gaagataaat tgttttggct ggaagcctgt tacaaagcat taacgtggca 1201 tagaaagaac aagcacgtgc aggaggccgc atgctgggca ctaaataatc tccttatgta 1261 ccaaaacagt ttacatgaga agattggaga tgaagatggc catttcccag ctcataggga 1321 agtgatgctc tccatgctga tgcattcttc atcaaaggaa gttttccagg catctgcgaa 1381 tgcattgtca actctcttag aacaaaatgt taatttcaga aaaatactgt tatcaaaagg 1441 aatacacctg aatgttttgg agttaatgca gaagcatata cattctcctg aagtggctga 1501 aagtggctgt aaaatgctaa atcatctttt tgaaggaagc aacacttccc tggatataat 1561 ggcagcagtg gtccccaaaa tactaacagt tatgaaacgt catgagacat cattaccagt 1621 gcagctggag gcgcttcgag ctattttaca ttttatagtg cctggcatgc cagaagaatc 1681 cagggaggat acagaatttc atcataagct aaatatggtt aaaaaacagt gtttcaagaa 1741 tgatattcac aaactggtcc tagcagcttt gaacaggttc attggaaatc ctgggattca 1801 gaaatgtgga ttaaaagtaa tttcttctat tgtacatttt cctgatgcat tagagatgtt 1861 atccctggaa ggtgctatgg attcagtgct tcacacactg cagatgtatc cagatgacca 1921 agaaattcag tgtctgggtt taagtcttat aggatacttg attacaaaga agaatgtgtt 1981 cataggaact ggacatctgc tggcaaaaat tctggtttcc agcttatacc gatttaagga 2041 tgttgctgaa atacagacta aaggatttca gacaatctta gcaatcctca aattgtcagc 2101 atctttttct aagctgctgg tgcatcattc atttgactta gtaatattcc atcaaatgtc 2161 ttccaatatc atggaacaaa aggatcaaca gtttctaaac ctctgttgca agtgttttgc 2221 aaaagtagct atggatgatt acttaaaaaa tgtgatgcta gagagagcgt gtgatcagaa 2281 taacagcatc atggttgaat gcttgcttct attgggagca gatgccaatc aagcaaagga 2341 gggatcttct ttaatttgtc aggtatgtga gaaagagagc agtcccaaat tggtggaact 2401 cttactgaat agtggatctc gtgaacaaga tgtacgaaaa gcgttgacga taagcattgg 2461 gaaaggtgac agccagatca tcagcttgct cttaaggagg ctggccctgg atgtggccaa 2521 caatagcatt tgccttggag gattttgtat aggaaaagtt gaaccttctt ggcttggtcc 2581 tttatttcca gataagactt ctaatttaag gaaacaaaca aatatagcat ctacactagc 2641 aagaatggtg atcagatatc agatgaaaag tgctgtggaa gaaggaacag cctcaggcag 2701 cgatggaaat ttttctgaag atgtgctgtc taaatttgat gaatggacct ttattcctga 2761 ctcttctatg gacagtgtgt ttgctcaaag tgatgacctg gatagtgaag gaagtgaagg 2821 ctcatttctt gtgaaaaaga aatctaattc aattagtgta ggagaatttt accgagatgc 2881 cgtattacag cgttgctcac caaatttgca aagacattcc aattccttgg ggcccatttt 2941 tgatcatgaa gatttactga agcgaaaaag aaaaatatta tcttcagatg attcactcag 3001 gtcatcaaaa cttcaatccc atatgaggca ttcagacagc atttcttctc tggcttctga 3061 gagagaatat attacatcac tagacctttc agcaaatgaa ctaagagata ttgatgccct 3121 aagccagaaa tgctgtataa gtgttcattt ggagcatctt gaaaagctgg agcttcacca 3181 gaatgcactc acgagctttc cacaacagct atgtgaaact ctgaagagtt tgacacattt 3241 ggacttgcac agtaataaat ttacatcatt tccttcttat ttgttgaaaa tgagttgtat 3301 tgctaatctt gatgtctctc gaaatgacat tggaccctca gtggttttag atcctacagt 3361 gaaatgtcca actctgaaac agtttaacct gtcatataac cagctgtctt ttgtacctga 3421 gaacctcact gatgtggtag agaaactgga gcagctcatt ttagaaggaa ataaaatatc 3481 agggatatgc tcccccttga gactgaagga actgaagatt ttaaacctta gtaagaacca 3541 catttcatcc ctatcagaga actttcttga ggcttgtcct aaagtggaga gtttcagtgc 3601 cagaatgaat tttcttgctg ctatgccttt cttgcctcct tctatgacaa tcctaaaatt 3661 atctcagaac aaattttcct gtattccaga agcaatttta aatcttccac acttgcggtc 3721 tttagatatg agcagcaatg atattcagta cctaccaggt cccgcacact ggaaatcttt 3781 gaacttaagg gaactcttat ttagccataa tcagatcagc atcttggact tgagtgaaaa 3841 agcatattta tggtctagag tagagaaact gcatctttct cacaataaac tgaaagagat 3901 tcctcctgag attggctgtc ttgaaaatct gacatctctg gatgtcagtt acaacttgga 3961 actaagatcc tttcccaatg aaatggggaa attaagcaaa atatgggatc ttcctttgga 4021 tgaactgcat cttaactttg attttaaaca tataggatgt aaagccaaag acatcataag 4081 gtttcttcaa cagcgattaa aaaaggctgt gccttataac cgaatgaaac ttatgattgt 4141 gggaaatact gggagtggta aaaccacctt attgcagcaa ttaatgaaaa ccaagaaatc 4201 agatcttgga atgcaaagtg ccacagttgg catagatgtg aaagactggc ctatccaaat 4261 aagagacaaa agaaagagag atctcgtcct aaatgtgtgg gattttgcag gtcgtgagga 4321 attctatagt actcatcccc attttatgac gcagcgagca ttgtaccttg ctgtctatga 4381 cctcagcaag ggacaggctg aagttgatgc catgaagcct tggctcttca atataaaggc 4441 tcgcgcttct tcttcccctg tgattctcgt tggcacacat ttggatgttt ctgatgagaa 4501 gcaacgcaaa gcctgcatga gtaaaatcac caaggaactc ctgaataagc gagggttccc 4561 tgccatacga gattaccact ttgtgaatgc caccgaggaa tctgatgctt tggcaaaact 4621 tcggaaaacc atcataaacg agagccttaa tttcaagatc cgagatcagc ttgttgttgg 4681 acagctgatt ccagactgct atgtagaact tgaaaaaatc attttatcgg agcgtaaaaa 4741 tgtgccaatt gaatttcccg taattgaccg gaaacgatta ttacaactag tgagagaaaa 4801 tcagctgcag ttagatgaaa atgagcttcc tcacgcagtt cactttctaa atgaatcagg 4861 agtccttctt cattttcaag acccagcact gcagttaagt gacttgtact ttgtggaacc 4921 caagtggctt tgtaaaatca tggcacagat tttgacagtg aaagtggaag gttgtccaaa 4981 acaccctaag ggcattattt cgcgtagaga tgtggaaaaa tttctttcaa aaaaaaggaa 5041 atttccaaag aactacatgt cacagtattt taagctccta gaaaaattcc agattgcttt 5101 gccaatagga gaagaatatt tgctggttcc aagcagtttg tctgaccaca ggcctgtgat 5161 agagcttccc cattgtgaga actctgaaat tatcatccga ctatatgaaa tgccttattt 5221 tccaatggga ttttggtcaa gattaatcaa tcgattactt gagatttcac cttacatgct 5281 ttcagggaga gaacgagcac ttcgcccaaa cagaatgtat tggcgacaag gcatttactt 5341 aaattggtct cctgaagctt attgtctggt aggatctgaa gtcttagaca atcatccaga 5401 gagtttctta aaaattacag ttccttcttg tagaaaaggc tgtattcttt tgggccaagt 5461 tgtggaccac attgattctc tcatggaaga atggtttcct gggttgctgg agattgatat 5521 ttgtggtgaa ggagaaactc tgttgaagaa atgggcatta tatagtttta atgatggtga 5581 agaacatcaa aaaatcttac ttgatgactt gatgaagaaa gcagaggaag gagatctctt 5641 agtaaatcca gatcaaccaa ggctcaccat tccaatatct cagattgccc ctgacttgat 5701 tttggctgac ctgcctagaa atattatgtt gaataatgat gagttggaat ttgaacaagc 5761 tccagagttt ctcctaggtg atggcagttt tggatcagtt taccgagcag cctatgaagg 5821 agaagaagtg gctgtgaaga tttttaataa acatacatca ctcaggctgt taagacaaga 5881 gcttgtggtg ctttgccacc tccaccaccc cagtttgata tctttgctgg cagctgggat 5941 tcgtccccgg atgttggtga tggagttagc ctccaagggt tccttggatc gcctgcttca 6001 gcaggacaaa gccagcctca ctagaaccct acagcacagg attgcactcc acgtagctga 6061 tggtttgaga tacctccact cagccatgat tatataccga gacctgaaac cccacaatgt 6121 gctgcttttc acactgtatc ccaatgctgc catcattgca aagattgctg actacggcat 6181 tgctcagtac tgctgtagaa tggggataaa aacatcagag ggcacaccag ggtttcgtgc 6241 acctgaagtt gccagaggaa atgtcattta taaccaacag gctgatgttt attcatttgg 6301 tttactactc tatgacattt tgacaactgg aggtagaata gtagagggtt tgaagtttcc 6361 aaatgagttt gatgaattag aaatacaagg aaaattacct gatccagtta aagaatatgg 6421 ttgtgcccca tggcctatgg ttgagaaatt aattaaacag tgtttgaaag aaaatcctca 6481 agaaaggcct acttctgccc aggtctttga cattttgaat tcagctgaat tagtctgtct 6541 gacgagacgc attttattac ctaaaaacgt aattgttgaa tgcatggttg ctacacatca 6601 caacagcagg aatgcaagca tttggctggg ctgtgggcac accgacagag gacagctctc 6661 atttcttgac ttaaatactg aaggatacac ttctgaggaa gttgctgata gtagaatatt 6721 gtgcttagcc ttggtgcatc ttcctgttga aaaggaaagc tggattgtgt ctgggacaca 6781 gtctggtact ctcctggtca tcaataccga agatgggaaa aagagacata ccctagaaaa 6841 gatgactgat tctgtcactt gtttgtattg caattccttt tccaagcaaa gcaaacaaaa 6901 aaattttctt ttggttggaa ccgctgatgg caagttagca atttttgaag ataagactgt 6961 taagcttaaa ggagctgctc ctttgaagat actaaatata ggaaatgtca gtactccatt 7021 gatgtgtttg agtgaatcca caaattcaac ggaaagaaat gtaatgtggg gaggatgtgg 7081 cacaaagatt ttctcctttt ctaatgattt caccattcag aaactcattg agacaagaac 7141 aagccaactg ttttcttatg cagctttcag tgattccaac atcataacag tggtggtaga 7201 cactgctctc tatattgcta agcaaaatag ccctgttgtg gaagtgtggg ataagaaaac 7261 tgaaaaactc tgtggactaa tagactgcgt gcacttttta agggaggtaa tggtaaaaga 7321 aaacaaggaa tcaaaacaca aaatgtctta ttctgggaga gtgaaaaccc tctgccttca 7381 gaagaacact gctctttgga taggaactgg aggaggccat attttactcc tggatctttc 7441 aactcgtcga cttatacgtg taatttacaa cttttgtaat tcggtcagag tcatgatgac 7501 agcacagcta ggaagcctta aaaatgtcat gctggtattg ggctacaacc ggaaaaatac 7561 tgaaggtaca caaaagcaga aagagataca atcttgcttg accgtttggg acatcaatct 7621 tccacatgaa gtgcaaaatt tagaaaaaca cattgaagtg agaaaagaat tagctgaaaa 7681 aatgagacga acatctgttg agtaagagag aaataggaat tgtctttgga taggaaaatt 7741 attctctcct cttgtaaata tttattttaa aaatgttcac atggaaaggg tactcacatt 7801 ttttgaaata gctcgtgtgt atgaaggaat gttattattt ttaatttaaa tatatgtaaa 7861 aatacttacc agtaaatgtg tattttaaag aactatttaa aacacaatgt tatatttctt 7921 ataaatacca gttactttcg ttcattaatt aatgaaaata aatctgtgaa gtacctaatt 7981 taagtactca tactaaaatt tataaggccg ataatttttt gttttcttgt ctgtaatgga 8041 ggtaaacttt attttaaatt ctgtgcttaa gacaggacta ttgcttgtcg atttttctag 8101 aaatctgcac ggtataatga aaatattaag acagtttccc atgtaatgta ttccttctta 8161 gattgcatcg aaatgcacta tcatatatgc ttgtaaatat tcaaatgaat ttgcactaat 8221 aaagtccttt gttggtatgt gaattctctt tgttgctgtt gcaaacagtg catcttacac 8281 aacttcactc aattcaaaag aaaactccat taaaagtact aatgaaaaaa catgacatac 8341 tgtcaaagtc ctcatatcta ggaaagacac agaaactctc tttgtcacag aaactctctg 8401 tgtctttcct agacataata gagttgtttt tcaactctat gtttgaatgt ggataccctg 8461 aattttgtat aattagtgta aatacagtgt tcagtccttc aagtgatatt tttatttttt 8521 tattcatacc actagctact tgttttctaa tctgcttcat tctaatgctt atattcatct 8581 tttccctaaa tttgtgatgc tgcagatcct acatcattca gatagaaacc tttttttttt 8641 tcagaattat agaattccac agctcctacc aagaccatga ggataaatat ctaacacttt 8701 tcagttgctg aaggagaaag gagctttagt tatgatggat aaaaatatct gccaccctag 8761 gcttccaaat tatacttaaa ttgtttacat agcttaccac aataggagta tcagggccaa 8821 atacctatgt aataatttga ggtcatttct gctttaggaa aagtactttc ggtaaattct 8881 ttggccctga ccagtattca ttatttcaga taattccctg tgataggaca actagtacat 8941 ttaatattct cagaacttat ggcattttac tatgtgaaaa ctttaaattt atttatatta 9001 agggtaatca aattcttaaa gatgaaagat tttctgtatt ttaaaggaag ctatgcttta 9061 acttgttatg taattaacaa aaaaatcata tataatagag ctctttgttc cagtgttatc 9121 tctttcattg ttactttgta tttgcaattt tttttaccaa agacaaatta aaaaaatgaa 9181 taccatattt aaatggaata ataaaggttt tttaaaaact ttaaaaaaaa aaaaaaaaa
SEQ ID NO: 12
GCAAAGATTGCTGATTGCACCTGACCCATGTAGTCAGCAATCTTTGCTT
SEQ ID NO: 13
GAAAGATTGCTGATTGCAGCCTGACCCACTGTAGTCAGCAATCTTTGTT SEQ ID NO: 14
GAAGATTGCTGACTGCAGCCCTGACCCAGCTGTAGTCAGCAATCTTCTT SEQ ID NO: 15
GAGATTGCTGACTGCAGTACCTGACCCATGCTGTAGTCAGCAATCTCTT
SEQ ID NO: 16
GGATTGCTGACTACAGTGTCCTGACCCAATGCTGTAGTCAGCAATCTTT
SEQ ID NO: 17
GATTGCTGACTACAGTGTTCCTGACCCAAATGCTGTAGTCAGCAATCTT SEQ ID NO: 18
GTTGCTGACTACAGTGTTGCCTGACCCACAATGCTGTAGTCAGCAATTT SEQ ID NO: 19
GTGCTGACTACAGTGTTGCCCTGACCCAGCAATGCTGTAGTCAGCAATT SEQ ID NO: 20
GGCTGACTACAGCGTTGTTCCTGACCCAAGCAATGCTGTAGTCAGCATT
Description of figures
Figure 1
Mechanisms of RNA interference that reduce expression of a target gene.
Figure 2
Figures 2a-b show a comparison of multiple shRNA molecules directed against the LRRK2-G2019S mRNA. The position of the nucleotide in the shRNA antisense strand that binds the G2019S SNP location on the target mRNA varies from positions p1 to p9 (wherein the positions are defined as above). Changes to the sense strand in order to bias correct processing of the shRNA are indicated in bold.
Figure 3
Figures 3a-c show the effect on LRRK2 mutant and wildtype expression of the shRNA molecules depicted in Figure 2.
Figure 4
Figures 4a-b show examples of how the presence of a mismatch nucleotide decreases targeting of non-target wildtype sequence.
Figure 5
A hierarchy of mismatch pairs showing the extent to which the formation of a given mismatch increases the ability of the antisense strand to discriminate between a given target nucleotide is shown. The mismatch of a G:U that results between an antisense strand targeting the LRRK2-G2019S RNA and the wildtype LRRK2 RNA sequence is shown with a box.
Figure 6
Screening of LRRK2 G2019S-targeting siRNAs against dual-luciferase targets. (A) Dual-luciferase assays at 48 hrs with stated siRNAs targeting the G2019S LRRK2 mutant following co-transfection with wild-type (dark grey lines - left hand bar of each pair) or mutant (light grey lines - right hand bar of each pair) luciferase targets.
(B) Dual luciferase assays at 48 hrs with siRNA p4 targeting the G2019S LRRK2 mutant at stated concentration following co-transfection with wild-type (dark grey - upper line) or mutant (light grey - lower line) luciferase targets. Values represent mean ratios of Renilla:Firefly luciferase +12 S.D. from n = 6. Values are normalized to cells transfected with non-specific shRNA and respective luciferase target. * = P,0.05 relative to respective normalising control .
Example 1
Dual-luciferase screening reveals shRNAs that can discriminate the LRRK2- G2019S mutant allele from the wild-type allele
Kinetic studies on RNAi suggest that alignments in the 5' region of the antisense species could lead to improved discrimination of the G2019S mutation. Introduction of G:U wobbles, which the targeting shRNA will create with the wild- type allele, have been reported to strongly interfere with pairings of antisense species to mRNA when placed either 5' or centrally in the RNAi effector. To test this hypothesis, shRNAs were designed with mutation at sequential positions from p1 -9 of the antisense arm (Figure 2a-b).
Screening of shRNAs against partial-length LRRK2 dual-luciferase targets revealed sequences that displayed significant allele-specific discrimination (Fig 3a-c) at 24hrs post-transfection. Alignment of the G2019S mutation at p4, displayed 1 .88 (p<0.005) fold discrimination. Analysis at different points post- transfection revealed that all shRNAs led to increased levels of silencing of both the mutant and wild-type alleles over time (Fig 3a-c). At 72hrs, three shRNAs displayed significant discrimination between the mutant and wild-type alleles; p2, p4 and p5. Construct p4 displayed the greatest 3.7-fold (p<0.001 ) discrimination between mutant and wild-type alleles respectively.
Example 2
In order to verify the sequence alignment of the G2019S mutation in the generated antisense species of the p4 construct, siRNAs with alignment of the mutations at p3, p4 and p5 were screened against the luciferase targets. At 48 hrs post-transfection, siRNA p4 displayed a 7.7-fold (ρ,Ο.ΟΟΊ ) discrimination that was improved upon that seen with shRNA p4 at this time point (Figure 6a). siRNAs p3 and p5 displayed less discrimination between the two alleles, agreeing with the trends from previous shRNA data which showed alignment at p4 to be superior to these two constructs. Further, discrimination by siRNA p4 was evident using siRNA concentrations as low as 0.1 nM, and was increased to .8-fold by concentrations of siRNA greater than 1 nM in separate experiments (Figure 6b). The greatest discrimination was 10.8-fold (ρ,Ο.ΟΟΊ ) when using 10 nM siRNA, and at this concentration a 96% silencing of the mutant target was seen which was accompanied by a modest 58% silencing of the wild-type target. However, the greatest difference in target silencing was the 61 % difference between the 92% silencing of the mutant target and 31 % silencing of the wild- type target when using 1 nM siRNA. Collectively this data strongly suggests that the alignment of the G2019S mutation in shRNA p4 is as stated, whilst additionally demonstrating that siRNA p4 has impressive and potent discriminating ability that makes it useful in future preclinical models of G2019S associated pathology.

Claims

Claims
1 . A double stranded nucleic acid (dsNA) molecule comprising a nucleic acid sense strand and an RNA antisense strand;
wherein the RNA antisense strand binds to position 6176 on a target RNA nucleotide sequence that comprises the nucleotide sequence of SEQ ID NO: 10; wherein at least a portion of the RNA antisense strand and the nucleic acid sense strand together define a base-paired nucleic acid duplex having the structure of Formula (I):
3'
Figure imgf000037_0001
[sense]
5' » 3' [antisense]
p1 p9 wherein the nucleotides of the antisense RNA strand define consecutively numbered antisense nucleotide positions, said numbers increasing in a 5' to 3' direction on the antisense strand, with position 1 (p1 ) defined as the extreme 5' nucleotide present on the RNA antisense strand of the nucleic acid duplex that is base paired with a corresponding nucleotide present on the nucleic acid sense strand of the nucleic acid duplex;
and wherein the RNA antisense strand has a uracil nucleotide located at any one of positions p1 to p9 that binds to an adenine nucleotide located at position 6176 of an RNA nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 10.
2. The dsNA molecule of claim 1 wherein the uracil nucleotide located at any one of positions p1 to p9 is located at position selected from p3, p4 or p5.
The dsNA molecule of claim 1 wherein the uracil nucleotide located at of positions p1 to p9 is located at position p4.
4. The dsNA molecule of claim 1 wherein the antisense strand comprises a nucleic acid sequence selected from SEQ ID NOs: 1 -9.
5. The dsNA molecule of claim 4 wherein the antisense strand comprises SEQ ID NO: 4.
6. The dsNA molecule of any preceding claim wherein the dsRNA molecule is selected from a short hairpin RNA (shRNA), a pri-miRNA, a pre-miRNA, and an siRNA molecule.
7. The dsNA molecule of any preceding claim wherein the antisense strand comprises one or more nucleotides, wherein, when the antisense strand binds to position 6176 on an RNA nucleotide sequence having the sequence of SEQ ID NO: 10, said one or more nucleotides forms mismatch base-pairing with the corresponding nucleotide(s) located on the target RNA sequence.
8. The dsNA molecule of claim 7 wherein the one or more nucleotides on the antisense strand that forms the mismatch base-pairing is located at a position adjacent to the uracil nucleotide that binds to position 6176 on the target RNA sequence.
9. The dsNA molecule of any preceding claim, wherein the antisense strand comprises or consists of a variant sequence of any one of reference SEQ ID NOs: 1 -9, wherein said variant sequence comprises at most 1 , at most 2, at most 3, or at most 4 nucleotide changes compared with the nucleotide sequence of the reference SEQ ID NO, though with the proviso that the underlined uracil nucleotide is retained as uracil.
10. The dsNA molecule of claim 1 , wherein the dsNA molecule comprises or consists of any one of SEQ ID NOs: 12-20.
1 1 . A nucleic acid vector comprising a nucleic acid sequence wherein the nucleic acid sequence encodes a dsNA molecule according to any one of claims 1 to 10.
12. The nucleic acid vector of claim 1 1 , wherein the vector is a plasmid or a viral vector.
13. The dsNA molecule of any one of claims 1 to 10, or the nucleic acid vector of claim 1 1 or claim 12, for use in preventing or suppressing Parkinson's disease.
PCT/GB2012/050692 2011-03-28 2012-03-28 Therapeutic molecules for use in the suppression of parkinson's disease Ceased WO2012131365A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB201105137A GB201105137D0 (en) 2011-03-28 2011-03-28 Therapeutic molecules for use in the suppression of Parkinson's disease
GB1105137.2 2011-03-28

Publications (1)

Publication Number Publication Date
WO2012131365A1 true WO2012131365A1 (en) 2012-10-04

Family

ID=44067449

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2012/050692 Ceased WO2012131365A1 (en) 2011-03-28 2012-03-28 Therapeutic molecules for use in the suppression of parkinson's disease

Country Status (2)

Country Link
GB (1) GB201105137D0 (en)
WO (1) WO2012131365A1 (en)

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9156845B2 (en) 2012-06-29 2015-10-13 Pfizer Inc. 4-(substituted amino)-7H-pyrrolo[2,3-d] pyrimidines as LRRK2 inhibitors
US9695171B2 (en) 2013-12-17 2017-07-04 Pfizer Inc. 3,4-disubstituted-1 H-pyrrolo[2,3-b]pyridines and 4,5-disubstituted-7H-pyrrolo[2,3-c]pyridazines as LRRK2 inhibitors
WO2017120365A1 (en) * 2016-01-05 2017-07-13 Ionis Pharmaceuticals, Inc. Methods for reducing lrrk2 expression
US9840710B2 (en) 2015-11-18 2017-12-12 Rosalind Franklin University Of Medicine And Science Antisense compounds targeting leucine-rich repeat kinase 2 (LRRK2) for the treatment of parkinsons disease
US10039753B2 (en) 2015-09-14 2018-08-07 Pfizer Inc. Imidazo[4,5-c]quinoline and imidazo[4,5-c][1,5]naphthyridine derivatives as LRRK2 inhibitors
WO2019118325A1 (en) * 2017-12-11 2019-06-20 Rosalind Franklin University Of Medicine And Science Antisense compounds targeting leucine-rich repeat kinase 2 (lrrk2) for the treatment of parkinsons disease
US10370667B2 (en) 2015-11-18 2019-08-06 Rosalind Franklin University Of Medicine And Science Antisense compounds targeting leucine-rich repeat kinase 2 (LRRK2) for the treatment of parkinsons disease
KR20210093227A (en) * 2018-08-10 2021-07-27 유니버시티 오브 매사추세츠 Modified oligonucleotides targeting SNPs
US11332746B1 (en) 2018-06-27 2022-05-17 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing LRRK2 expression
US11820985B2 (en) 2019-03-26 2023-11-21 University Of Massachusetts Modified oligonucleotides with increased stability
EP4010476A4 (en) * 2019-08-09 2023-12-27 University Of Massachusetts Chemically modified oligonucleotides targeting snps
US11896669B2 (en) 2016-01-31 2024-02-13 University Of Massachusetts Branched oligonucleotides
US12049627B2 (en) 2017-06-23 2024-07-30 University Of Massachusetts Two-tailed self-delivering siRNA
US12077755B2 (en) 2015-08-14 2024-09-03 University Of Massachusetts Bioactive conjugates for oligonucleotide delivery
US12146136B2 (en) 2020-03-26 2024-11-19 University Of Massachusetts Synthesis of modified oligonucleotides with increased stability
US12173286B2 (en) 2015-04-03 2024-12-24 University Of Massachusetts Fully stabilized asymmetric siRNA
US12180477B2 (en) 2019-01-18 2024-12-31 University Of Massachusetts Dynamic pharmacokinetic-modifying anchors
US12297430B2 (en) 2018-08-23 2025-05-13 University Of Massachusetts O-methyl rich fully stabilized oligonucleotides
US12365894B2 (en) 2019-09-16 2025-07-22 University Of Massachusetts Branched lipid conjugates of siRNA for specific tissue delivery
US12534724B2 (en) 2020-05-26 2026-01-27 University Of Massachusetts Synthetic oligonucleotides having regions of block and cluster modifications

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB1105137A (en) 1964-04-06 1968-03-06 Chloride Overseas Ltd Improvements relating to fuel battery plants
WO2004042027A2 (en) * 2002-11-04 2004-05-21 University Of Massachusetts Allele-specific rna interference
WO2007044362A2 (en) * 2005-09-30 2007-04-19 University Of Massachusetts Allele-specific rna interference
WO2007124096A2 (en) * 2006-04-21 2007-11-01 The Trustees Of Columbia University In The City Of New York Lrrk2 regulaton of neuronal process morphology

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB1105137A (en) 1964-04-06 1968-03-06 Chloride Overseas Ltd Improvements relating to fuel battery plants
WO2004042027A2 (en) * 2002-11-04 2004-05-21 University Of Massachusetts Allele-specific rna interference
WO2007044362A2 (en) * 2005-09-30 2007-04-19 University Of Massachusetts Allele-specific rna interference
WO2007124096A2 (en) * 2006-04-21 2007-11-01 The Trustees Of Columbia University In The City Of New York Lrrk2 regulaton of neuronal process morphology

Non-Patent Citations (11)

* Cited by examiner, † Cited by third party
Title
A DESSY ET AL: "The Emerging Therapeutic Role of RNA Interference in Disorders of the Central Nervous System", CLINICAL PHARMACOLOGY & THERAPEUTICS, vol. 89, no. 3, 19 January 2011 (2011-01-19), pages 450 - 454, XP055031277, ISSN: 0009-9236, DOI: 10.1038/clpt.2010.312 *
ABDELGANY A ET AL: "Allele-specific silencing of a pathogenic mutant acetylcholine receptor subunit by RNA interference", HUMAN MOLECULAR GENETICS, OXFORD UNIVERSITY PRESS, SURREY, vol. 12, no. 20, 15 October 2003 (2003-10-15), pages 2637 - 2644, XP002354611, ISSN: 0964-6906, DOI: 10.1093/HMG/DDG280 *
ANONYMOUS: "LRRK2 Cohort Workshop", 6 May 2010 (2010-05-06), pages 1 - 29, XP002678904, Retrieved from the Internet <URL:www.pdonlineresearch.org/sites/default/files/Meeting%20Booklet%20-%20Final.doc> [retrieved on 20120629] *
CHRISTOPHER R. SIBLEY ET AL: "Identification of Allele-Specific RNAi Effectors Targeting Genetic Forms of Parkinson's Disease", PLOS ONE, vol. 6, no. 10, 21 October 2011 (2011-10-21), pages E26194, XP055031183, ISSN: 1932-6203, DOI: 10.1371/journal.pone.0026194 *
FENG X ET AL: "Allele-specific silencing of Alzheimer's disease genes", GENE, ELSEVIER, AMSTERDAM, NL, vol. 371, no. 1, 12 April 2006 (2006-04-12), pages 68 - 74, XP024934331, ISSN: 0378-1119, [retrieved on 20060412], DOI: 10.1016/J.GENE.2005.11.006 *
J. ALEGRE-ABARRATEGUI ET AL: "LRRK2 regulates autophagic activity and localizes to specific membrane microdomains in a novel human genomic reporter cellular model", HUMAN MOLECULAR GENETICS, vol. 18, no. 21, 29 July 2009 (2009-07-29), pages 4022 - 4034, XP055004708, ISSN: 0964-6906, DOI: 10.1093/hmg/ddp346 *
JEREMY NICHOLS R ET AL: "Substrate specificity and inhibitors of LRRK2, a protein kinase mutated in Parkinson's disease", BIOCHEMICAL JOURNAL, THE BIOCHEMICAL SOCIETY, LONDON, GB, vol. 424, 9 September 2009 (2009-09-09), pages 47 - 60, XP002654035, ISSN: 0264-6021, DOI: 10.1042/BJ20091035 *
LAURA DE YÑIGO-MOJADO ET AL: "Efficient Allele-Specific Targeting of LRRK2 R1441 Mutations Mediated by RNAi", PLOS ONE, vol. 6, no. 6, 17 June 2011 (2011-06-17), pages E21352, XP055031179, ISSN: 1932-6203, DOI: 10.1371/journal.pone.0021352 *
MILLER V M ET AL: "Allele-specific silencing of dominant disease genes", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, NATIONAL ACADEMY OF SCIENCES, US, vol. 100, no. 12, 10 June 2003 (2003-06-10), pages 7195 - 7200, XP002278730, ISSN: 0027-8424, DOI: 10.1073/PNAS.1231012100 *
SAPRU M K ET AL: "Silencing of human alpha-synuclein in vitro and in rat brain using lentiviral-mediated RNAi", EXPERIMENTAL NEUROLOGY, ACADEMIC PRESS, NEW YORK, NY, US, vol. 198, no. 2, 1 April 2006 (2006-04-01), pages 382 - 390, XP024945762, ISSN: 0014-4886, [retrieved on 20060401], DOI: 10.1016/J.EXPNEUROL.2005.12.024 *
SCHOLEFIELD J ET AL: "Therapeutic gene silencing strategies for polyglutamine disorders", TRENDS IN GENETICS, ELSEVIER SCIENCE PUBLISHERS B.V. AMSTERDAM, NL, vol. 26, no. 1, 1 January 2010 (2010-01-01), pages 29 - 38, XP026816557, ISSN: 0168-9525, [retrieved on 20091203] *

Cited By (32)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9642855B2 (en) 2012-06-29 2017-05-09 Pfizer Inc. Substituted pyrrolo[2,3-d]pyrimidines as LRRK2 inhibitors
US9156845B2 (en) 2012-06-29 2015-10-13 Pfizer Inc. 4-(substituted amino)-7H-pyrrolo[2,3-d] pyrimidines as LRRK2 inhibitors
US9695171B2 (en) 2013-12-17 2017-07-04 Pfizer Inc. 3,4-disubstituted-1 H-pyrrolo[2,3-b]pyridines and 4,5-disubstituted-7H-pyrrolo[2,3-c]pyridazines as LRRK2 inhibitors
US12173286B2 (en) 2015-04-03 2024-12-24 University Of Massachusetts Fully stabilized asymmetric siRNA
US12077755B2 (en) 2015-08-14 2024-09-03 University Of Massachusetts Bioactive conjugates for oligonucleotide delivery
US10039753B2 (en) 2015-09-14 2018-08-07 Pfizer Inc. Imidazo[4,5-c]quinoline and imidazo[4,5-c][1,5]naphthyridine derivatives as LRRK2 inhibitors
US10787669B2 (en) 2015-11-18 2020-09-29 Rosalind Franklin University Of Medicine And Science Antisense compounds targeting Leucine-Rich repeat kinase 2(LRRK2) for the treatment of Parkinsons disease
US10370667B2 (en) 2015-11-18 2019-08-06 Rosalind Franklin University Of Medicine And Science Antisense compounds targeting leucine-rich repeat kinase 2 (LRRK2) for the treatment of parkinsons disease
US9840710B2 (en) 2015-11-18 2017-12-12 Rosalind Franklin University Of Medicine And Science Antisense compounds targeting leucine-rich repeat kinase 2 (LRRK2) for the treatment of parkinsons disease
US11530411B2 (en) 2016-01-05 2022-12-20 Ionis Pharmaceuticals, Inc. Methods for reducing LRRK2 expression
EP3400300A4 (en) * 2016-01-05 2019-08-07 Ionis Pharmaceuticals, Inc. METHODS FOR REDUCING LRRK2 EXPRESSION
WO2017120365A1 (en) * 2016-01-05 2017-07-13 Ionis Pharmaceuticals, Inc. Methods for reducing lrrk2 expression
US10907160B2 (en) 2016-01-05 2021-02-02 Ionis Pharmaceuticals, Inc. Methods for reducing LRRK2 expression
US20180362988A1 (en) * 2016-01-05 2018-12-20 Ionis Pharmaceuticals, Inc. Methods for reducing lrrk2 expression
US11896669B2 (en) 2016-01-31 2024-02-13 University Of Massachusetts Branched oligonucleotides
US12049627B2 (en) 2017-06-23 2024-07-30 University Of Massachusetts Two-tailed self-delivering siRNA
WO2019118325A1 (en) * 2017-12-11 2019-06-20 Rosalind Franklin University Of Medicine And Science Antisense compounds targeting leucine-rich repeat kinase 2 (lrrk2) for the treatment of parkinsons disease
US12241067B2 (en) 2018-06-27 2025-03-04 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing LRRK2 expression
US11332746B1 (en) 2018-06-27 2022-05-17 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing LRRK2 expression
US11873495B2 (en) 2018-06-27 2024-01-16 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing LRRK2 expression
KR20210093227A (en) * 2018-08-10 2021-07-27 유니버시티 오브 매사추세츠 Modified oligonucleotides targeting SNPs
KR102916447B1 (en) 2018-08-10 2026-01-23 유니버시티 오브 매사추세츠 Modified oligonucleotides targeting SNPs
US11827882B2 (en) 2018-08-10 2023-11-28 University Of Massachusetts Modified oligonucleotides targeting SNPs
EP3833763A4 (en) * 2018-08-10 2023-07-19 University of Massachusetts MODIFIED OLIGONUCLEOTIDES TARGETING SNPs
US12297430B2 (en) 2018-08-23 2025-05-13 University Of Massachusetts O-methyl rich fully stabilized oligonucleotides
US12180477B2 (en) 2019-01-18 2024-12-31 University Of Massachusetts Dynamic pharmacokinetic-modifying anchors
US11820985B2 (en) 2019-03-26 2023-11-21 University Of Massachusetts Modified oligonucleotides with increased stability
US12024706B2 (en) 2019-08-09 2024-07-02 University Of Massachusetts Modified oligonucleotides targeting SNPs
EP4010476A4 (en) * 2019-08-09 2023-12-27 University Of Massachusetts Chemically modified oligonucleotides targeting snps
US12365894B2 (en) 2019-09-16 2025-07-22 University Of Massachusetts Branched lipid conjugates of siRNA for specific tissue delivery
US12146136B2 (en) 2020-03-26 2024-11-19 University Of Massachusetts Synthesis of modified oligonucleotides with increased stability
US12534724B2 (en) 2020-05-26 2026-01-27 University Of Massachusetts Synthetic oligonucleotides having regions of block and cluster modifications

Also Published As

Publication number Publication date
GB201105137D0 (en) 2011-05-11

Similar Documents

Publication Publication Date Title
WO2012131365A1 (en) Therapeutic molecules for use in the suppression of parkinson&#39;s disease
RU2426544C2 (en) Treatment of cns disorders
EP1670518B1 (en) Rna interference for the treatment of gain-of-function disorders
WO2010118263A1 (en) Single-nucleotide polymorphism (snp) targeting therapies for the treatment of huntington&#39;s disease
WO2010151755A2 (en) TREATMENT OF INFLAMMATORY DISEASES USING miR-124
KR20180104075A (en) Treatment of atopic dermatitis and asthma using RNA complexes targeting IL4Ra, TRPA1, or F2RL1
WO2006066203A2 (en) Small interfering rna (sirna) molecules for modulating superoxide dismutase (sod)
WO2023020574A1 (en) Engineered adar-recruiting rnas and methods of use thereof
US20240150754A1 (en) Guide rna for editing polyadenylation signal sequence of target rna
AU2017231865B2 (en) Allele-specific gene suppression
US20090023670A1 (en) Regulation of Transgene Expression by RNA Interference
WO2020047234A1 (en) Feedback enabled synthetic genes, target seed match cassettes, and their uses
EP4421173A1 (en) Use of micrornas in the treatment of lung diseases
EP3680334B1 (en) Double-stranded rna molecule targeting ckip-1 and use thereof
WO2023185231A1 (en) Engineered adar-recruiting rnas and methods of use for usher syndrome
US20250179497A1 (en) Use of dinucleotide repeat rnas to treat cancer
WO2023143539A1 (en) Engineered adar-recruiting rnas and methods of use thereof
WO2025155773A1 (en) Telomerase upregulating polynucleotide and method of use and treatment thereof
WO2025128134A1 (en) Crispri targeting alpha-synuclein
WO2024254243A2 (en) Rnai targeting ppp2r5d missense mutations for treatment of jordan&#39;s syndrome
WO2024077262A2 (en) Methods and compositions for silencing elavl2 expression for the treatment of disease
US20240229031A9 (en) Microrna compositions and methods of use thereof for the treatment of nervous system dysfunction
EP4185693A1 (en) Combinatorial inhibition of transcription factors for treatment of heart failure
CN101351231A (en) Small interfering ribonucleic acid double helix containing arabinose-modified nucleotides
WO2026095015A1 (en) Nucleic acid molecule inhibiting expression of tslp

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12717449

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12717449

Country of ref document: EP

Kind code of ref document: A1