WO2012129697A1 - Novel cell wall deconstruction enzymes of talaromyces thermophilus and uses thereof - Google Patents

Novel cell wall deconstruction enzymes of talaromyces thermophilus and uses thereof Download PDF

Info

Publication number
WO2012129697A1
WO2012129697A1 PCT/CA2012/050198 CA2012050198W WO2012129697A1 WO 2012129697 A1 WO2012129697 A1 WO 2012129697A1 CA 2012050198 W CA2012050198 W CA 2012050198W WO 2012129697 A1 WO2012129697 A1 WO 2012129697A1
Authority
WO
WIPO (PCT)
Prior art keywords
polynucleotide
seq
polypeptide
nos
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/CA2012/050198
Other languages
French (fr)
Inventor
Adrian Tsang
Justin Powlowski
Gregory Butler
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Publication of WO2012129697A1 publication Critical patent/WO2012129697A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/24Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405Glucanases
    • C12N9/2434Glucanases acting on beta-1,4-glucosidic bonds
    • CCHEMISTRY; METALLURGY
    • C11ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
    • C11DDETERGENT COMPOSITIONS; USE OF SINGLE SUBSTANCES AS DETERGENTS; SOAP OR SOAP-MAKING; RESIN SOAPS; RECOVERY OF GLYCEROL
    • C11D3/00Other compounding ingredients of detergent compositions covered in group C11D1/00
    • C11D3/16Organic compounds
    • C11D3/38Products with no well-defined composition, e.g. natural products
    • C11D3/386Preparations containing enzymes, e.g. protease or amylase
    • C11D3/38636Preparations containing enzymes, e.g. protease or amylase containing enzymes other than protease, amylase, lipase, cellulase, oxidase or reductase
    • CCHEMISTRY; METALLURGY
    • C11ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
    • C11DDETERGENT COMPOSITIONS; USE OF SINGLE SUBSTANCES AS DETERGENTS; SOAP OR SOAP-MAKING; RESIN SOAPS; RECOVERY OF GLYCEROL
    • C11D3/00Other compounding ingredients of detergent compositions covered in group C11D1/00
    • C11D3/16Organic compounds
    • C11D3/38Products with no well-defined composition, e.g. natural products
    • C11D3/386Preparations containing enzymes, e.g. protease or amylase
    • C11D3/38645Preparations containing enzymes, e.g. protease or amylase containing cellulase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00Preparation of compounds containing saccharide radicals
    • C12P19/02Monosaccharides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/02Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/06Ethanol, i.e. non-beverage
    • C12P7/08Ethanol, i.e. non-beverage produced as by-product or from waste or cellulosic material substrate
    • C12P7/10Ethanol, i.e. non-beverage produced as by-product or from waste or cellulosic material substrate substrate containing cellulosic material
    • DTEXTILES; PAPER
    • D21PAPER-MAKING; PRODUCTION OF CELLULOSE
    • D21CPRODUCTION OF CELLULOSE BY REMOVING NON-CELLULOSE SUBSTANCES FROM CELLULOSE-CONTAINING MATERIALS; REGENERATION OF PULPING LIQUORS; APPARATUS THEREFOR
    • D21C9/00After-treatment of cellulose pulp, e.g. of wood pulp, or cotton linters ; Treatment of dilute or dewatered pulp or process improvement taking place after obtaining the raw cellulosic material and not provided for elsewhere
    • D21C9/10Bleaching ; Apparatus therefor
    • D21C9/1026Other features in bleaching processes
    • D21C9/1036Use of compounds accelerating or improving the efficiency of the processes
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02EREDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00Technologies for the production of fuel of non-fossil origin
    • Y02E50/10Biofuels, e.g. bio-diesel

Definitions

  • the invention relates to newly identified polynucleotide sequences comprising genes that encode novel cell wall deconstruction enzymes.
  • the enzymes may be isolated from the fungus, Talaromyces thermophilus NRRL 2155.
  • the invention features the full length coding sequences of the novel genes, the genomic sequences of each gene, as well as the amino acid sequences of the full-length functional proteins and functional equivalents of the genes or the amino acid sequences.
  • the invention also relates to methods of using these proteins in industrial processes. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins and cells wherein a protein according to the invention is genetically modified to enhance or reduce its activity and/or level of expression. Background of the invention
  • the present invention relates to novel cell wall deconstruction enzymes, suitable for use in several industrial applications, for example in food applications, such as for example cereal-based food products, in the textile industry for the treatment of cellulose-based fabrics; in the feed-enzyme industry such as for example increasing the digestibility of nutrients; in the pulp and paper industry such as enhancing bleachability of the pulp; in the waste treatment industry for the decolorization of synthetic dyes; and in the bioethanol industry such as for example improving the ethanol yield and increasing the efficiency and economy of ethanol production.
  • Conversion of plant biomass to glucose may also be enhanced by supplementing cellulose cocktails with enzymes that degrade the other components of biomass, including hemicelluloses, pectins and lignins, and their linkages, to improve the accessibility of cellulose to the cellulase enzymes.
  • enzymes include: xylanases, mannanases, arabinanases, esterases, glucuronidases, xyloglucanases and arabinofuranosidases for hemicelluloses; lignin peroxidases, manganese-dependent peroxidases, versatile peroxidases, and laccases for lignin; and pectate lyase, pectin lyase, polygalacturonase, pectin acetyl esterase, alpha-arabinofuranosidase, beta-galactosidase, galactanase, arabinanase, rhamnogalacturonase, rhamnoga!acturonan lyase, and rhamnogalacturonan acetyl esterase, xylogalacturonosidase, xylogalacturonase, and rhamnogalacturonan
  • the enzymes described may also be useful for other purposes in processing biomass.
  • the lignin modifying enzymes may be used to alter the structure of lignin to produce novel materials, and hemicelluases may be employed to produce 5-carbon sugars from hemicelluloses, which may then be further converted to chemical products.
  • Cereal-based food products such as pasta, noodles and bread can be prepared from dough which is usually made from the basic ingredients (cereal) flour, water and optionally salt.
  • Suitable enzymes include xylanase, starch degrading enzymes, oxidizing enzymes, fatty material splitting enzymes, protein degrading, and modifying or crosslinking enzymes. Many of these enzymes are also used for treating animal feed or animal feed additives, to make them more digestible or to improve their nutritional quality.
  • Amylases are used for the conversion of plant starches to glucose.
  • Pectin-active enzymes are used in fruit processing, for example to increase the yield of juices, and in fruit juice clarification, as well as in other food processing steps. Object of the invention
  • a further object is to provide naturally and recombinantly produced cell wall deconstruction enzymes as well as recombinant strains producing these.
  • fusion polypeptides are part of the invention as well as methods of making and using the polynucleotides and polypeptides according to the invention.
  • the invention provides for novel polynucleotides encoding novel cell wall deconstruction enzymes.
  • the invention provides for polynucleotides having a nucleotide sequences that hybridize preferably under high stringent conditions to the complement of any one sequence according to SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 11 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 110, 112, 113, 1 15, 1 16, 118, 1 19, 121 , 122, 124, 125, 127, 128, 130, 131 , 133,
  • nucleic acids that are at least 30%, preferably at least 40%, 50%, 60%, or 70%, more preferably at least 80% or 90%, even more preferably at least 95%, 96%, 97%, 98% or 99% homologous to the sequences listed above. Actual percentage will differ per gene/protein depending on closest known homologues in prior art.
  • the invention provides for an isolated polynucleotide selected from the group consisting of: a) a polynucleotide comprising nucleic acid sequence as set forth in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 11 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 110, 112, 113, 115, 116, 118, 119, 121 , 122, 124, 125, 127, 12
  • the nucleic acid sequence is one selected from the subset as represented by SEQ ID NO:13, 14, 22, 23, 34, 35, 40, 41 , 43, 44, 46, 47, 49, 50, 61 , 62, 64, 65, 73, 74, 76, 77, 91 , 92, 121 , 122, 139, AND 140, or a functional equivalent thereof.
  • the polynucleotide is one that encodes a polypeptide as set forth in any one of SEQ ID Nos: 15, 24, 36, 42, 45, 48, 51 , 63, 66, 75, 78, 93, 123, and 141 , or a functional equivalent thereof.
  • the invention provides for such an isolated polynucleotide obtainable from a fungus, in particular Talaromyces is preferred and even more preferred Talaromyces thermophilus.
  • the invention provides for a vector comprising the polynucleotide of the present invention.
  • the vector may further comprise a regulatory sequence operatively linked to the polynucleotide for expression of same in a suitable host cell, preferably a filamentous fungus.
  • the invention provides a host cell comprising the polynucleotide or the vector of the present invention.
  • the invention provides an isolated polypeptide as set forth in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 111 , 114, 117, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144, or a functional equivalent thereof.
  • the invention provides an isolated polypeptide as set forth in any one of SEQ ID Nos: 15, 24, 36, 42, 45, 48, 51 , 63, 66, 75, 78, 93, 123, and 141 , or a functional equivalent thereof.
  • the invention provides an isolated polypeptide that is at least 60%, preferably at least 70%, more preferably at least 80%, even more preferably at least 90%, 95%, 96%, 97%, 98% or 99% homologous to any one Of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 111 , 1 14, 1 17, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144, or a functional equivalent thereof, or even more preferably to any one of SEQ ID Nos: 15, 24, 36, 42, 45, 48, 51 , 63, 66, 75, 78, 93, 123, and 141 ;
  • the isolated polypeptide has a sequence encoded by nucleic acid sequence as set forth in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 11 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 110, 112, 113, 1 15, 1 16, 1 18, 119, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136, 137, 139,
  • the isolated polypeptide has a sequence encoded by a nucleic acid sequence hybridizing under stringent conditions to the polynucleotide as set forth in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 1 1 , 13, 14,
  • the polypeptide is preferably obtainable from Talaromyces thermophilus.
  • the polypeptide is obtainable by expressing the polynucleotide or the vector of the present invention in an appropriate host cell.
  • the invention also provides a process for degrading biomass or pretreated biomass to sugars wherein an enzyme is used comprising a polypeptide having a sequence as defined above.
  • the polypeptide is obtainable from a white rot fungus, more preferably obtainable from Talaromyces thermophilus.
  • the enzyme is preferably a cellulase-enhancing protein, a glycoside hydrolase, preferably a glycoside of the GH61 family, a glycosidase (for example a glycosidase crf1 or a beta-glucosidase such as a glucan 1 ,3-beta-glucosidase), an endoglucanase (for example endoglucanase-1 ), a beta-xylosidase (for example exo-1 ,4-beta-xylosidase xlnD), a beta-hexosaminidase, a beta-N-acetylhexosaminidase or a xylanase (for example an endo-1 ,4-beta-xylanase).
  • a glycosidase for
  • the invention provides for novel polynucleotides encoding novel cell wall deconstruction enzymes.
  • the invention provides a method for manufacturing the polypeptide comprising the steps of transforming a suitable host cell with the isolated polynucleotide or the vector of the present invention, culturing said cell under conditions allowing expression of said polynucleotide and optionally purifying the encoded polypeptide from said cell or culture medium.
  • the polypeptide of the present invention can be used in the preparation of a food product, in the preparation of a detergent, in the preparation of an animal feed, for prebleaching kraft pulp, for processing lignin, for producing ethanol, for treating textiles or dyed textiles or for degrading biomass or pretreated biomass.
  • Enzymes that hydrolyze cellulose including endoglucanases (EG) ((E.C. 3.2.1.4) hydrolyze the beta-1 ,4-linkages between glucose units); exoglucanases, also known as cellobiohydrolases 1 and 2 (CBH1 or CBHI and CBH2 or CBHII) ((E.C. 3.2.1.91 ) hydrolyze cellobiose, a glucose disaccharide, from the reducing and non-reducing ends of cellulose); and beta-glucosidases (BG) ((E.C. 3.2.1.21 ) hydrolyze the beta-1 ,4 glycoside bond of cellobiose to glucose)
  • EG endoglucanases
  • CBH1 or CBHI and CBH2 or CBHII cellobiohydrolases 1 and 2
  • BG beta-glucosidases
  • Glycoside hydrolase family 61 proteins, which enhance the action of cellulose enzymes on lignocellulose substrates.
  • Glycoside hydrolase family 61 (GH61 or sometimes referred to EGIV or EG4) proteins are proteins which enhance the action of cellulases on lignocellulose substrates. GH61 was originally classified as endogluconase based on measurement of very weak endo-1 ,4-P-d-glucanase activity in one family member.
  • Enzymes that degrade or modify xylan and/or xylan-lignin complexes including xylanase ((E.C. 3.2.1 .8) catalyzes random cleavage of beta-1 ,4 bonds in xylan or xyloglucan), xylan 1 ,4-beta-xylosidase (EC 3.2.1.37) catalyzes hydrolysis of 1 ,4-beta-D-xylans, to remove successive D-xylose residues from the non-reducing terminals, and also cleaves xylobiose), aipha-arabinofuranosidase ((EC 3.2.1.55) hydrolyzes terminal non- reducing alpha-L-arabinofuranoside residues in alpha-L-arabinosides including arabinoxylans and arabinogalactans), alpha-glucuronidase ((EC 3.2.1.139) hydrolyzes an alpha-D-glucuron
  • Enzymes that degrade or modify mannan including mannanase ((EC 3.2.1.78) catalyzes random hydrolysis of 1 ,4-beta-D-mannosidic linkages in mannans, galactomannans and glucomannans), mannosidase ((EC 3.2.1.25) hydrolyzes terminal, non-reducing beta-D-mannose residues in beta-D-mannosides), alpha-galactosidase ((EC 3.2.1.22) hydrolyzes terminal, non-reducing alpha-D-galactose residues in alpha-D- galactosides, including galactose oligosaccharides, galactomannans and galactohydrolase), and mannan acetyl esterase .
  • mannanase (EC 3.2.1.78) catalyzes random hydrolysis of 1 ,4-beta-D-mannosidic linkages in mannans, galactomannans and
  • Enzymes that degrade xyloglucans including xyloglucanase involves endohydrolysis of 1 ,4-beta-D-g!ucosidic linkages in xyloglucan while (EC 3.2.1.155) catalyzes exohydrolysis of 1 ,4-beta-D- glucosidic linkages in xyloglucan), endoglucanase, and cellulase.
  • Enzymes that degrade beta-1 ,4-glucan including endoglucanase, cellobiohydrolase, and beta-glucosidase.
  • Enzymes that degrade beta-1 ,3-1 ,4-glucan including endo-beta-1,3(4)- glucanase ((EC 3.2.1 .6) catalyzes endohydrolysis of 1 ,3- or 1 ,4-linkages in beta-D-glucans when the glucose residue whose reducing group is involved in the linkage to be hydrolysed is itself substituted at C-3), endoglucanase (beta-glucanase, cellulase), and beta-glucosidase.
  • Enzymes that degrade galactan include galactanases ((EC 3.2.1.23) hydrolyzes terminal non-reducing beta-D-galactose residues in beta-D- galactosides).
  • Enzymes that degrade arabtnan include arabinanases ((EC 3.2.1.99) catalyze endohydrolysis of 1 ,5-alpha-arabinofuranosidic linkages in 1 ,5- arabinans).
  • Enzymes that degrade starch including alpha-amylase ((EC 3.2.1.1 catalyzes endohydrolysis of 1 ,4-alpha-D-glucosidic linkages in polysaccharides containing three or more 1 ,4-alpha-linked D-glucose units) and alpha-glucosidase ((EC 3.2.1.20) hydrolyzes terminal, non- reducing 1 ,4-linked alpha-D-glucose residues with release of alpha-D- glucose)
  • alpha-amylase (EC 3.2.1.1 catalyzes endohydrolysis of 1 ,4-alpha-D-glucosidic linkages in polysaccharides containing three or more 1 ,4-alpha-linked D-glucose units)
  • alpha-glucosidase (EC 3.2.1.20) hydrolyzes terminal, non- reducing 1 ,4-linked alpha-D-glucose residues with release of alpha-
  • Enzymes that degrade or modify pectin including pectate lyase ((EC 4.2.2.2) carries out eliminative cleavage of pectate to give oligosaccharides with 4-deoxy-alpha-D-gluc-4-enuronosyl groups at their non-reducing ends), pectin lyase ((EC 4.2.2.10) catalyzes eliminative cleavage of (1-4)-alpha-D-galacturonan methyl ester to give oligosaccharides with 4-deoxy-6-0-methyl-alpha-D-galact-4-enuronosyl groups at their non-reducing ends), polygalacturonase ((EC 3.2.1.15) carries out random hydrolysis of 1 ,4-alpha-D-galactosiduronic linkages in pectate and other galacturonans), pectin acetyl esterase ((EC 3.1.1.1 1 ) hydrolyzes acetate from pectin
  • Enzymes that degrade or modify lignin including lignln peroxidases ((EC 1.11.1.14) oxidize lignin and lignin model compounds using hydrogen peroxide) , manganese-dependent peroxidases ((EC 1.11.1.13) oxidizes lignin and lignin model compounds using Mn 2+ and hydrogen peroxide), versatile peroxidases ((EC 1.1 1.1.16) oxidizes lignin and lignin model compounds using an electron donor and hydrogen peroxide and combines the substrate-specificity characteristics of the two other ligninolytic peroxidases, EC 1.11.1.13, manganese peroxidase and EC 1.11.1.14, lignin peroxidase), and laccases ((EC 1.10.3.2) a group of multi-copper proteins of low specificity acting on both o- and p-quinols, and often acting also on lignin)
  • Enzymes acting on chitin including chitinase ((EC 3.2.1.14) which catalyzes random hydrolysis of N-acetyl-beta-D-glucosaminide 1 ,4-beta- linkages in chitin and chitodextrins) and beta-N-acetylhexosaminidase ((EC 3.2.1.52) which hydrolyzes terminal non-reducing N-acetyl-D- hexosamine residues in N-acetyl-beta-D-hexosaminides).
  • chitinase (EC 3.2.1.14) which catalyzes random hydrolysis of N-acetyl-beta-D-glucosaminide 1 ,4-beta- linkages in chitin and chitodextrins)
  • beta-N-acetylhexosaminidase (EC 3.2.1.52) which hydrolyzes
  • the invention also relates to vectors comprising a polynucleotide sequence according to the invention, as well as primers, probes and fragments that may be used to amplify or detect the DNA according to the invention.
  • a vector wherein the polynucleotide sequence according to the invention is functionally linked with at least one regulatory sequence suitable for expression of the encoded amino acid sequence in a suitable host cell, such as a filamentous fungus, for example Aspergillus.
  • a suitable host cell such as a filamentous fungus, for example Aspergillus.
  • the invention also provides methods for preparing polynucleotides and vectors according to the invention.
  • the invention also relates to recombinantiy produced host cells that contain heterologous or homologous polynucleotides according to the invention.
  • the invention provides recombinant host cells wherein the expression of an enzyme according to the invention is significantly increased or wherein the activity of the enzyme is increased.
  • the invention provides for a recombinantly produced host cell that contains heterologous or homologous DNA according to the invention and wherein the cell is capable of producing a functional enzyme according to the invention, preferably a cell capable of over-expressing the enzyme according to the invention, for example an Aspergillus niger strain comprising an increased copy number of a gene according to the invention.
  • polypeptides according to the invention include the polypeptides encoded by the polynucleotides according to the invention. Especially preferred are polypeptides according to any one of SEQ ID Nos: 114, 162, 231 , 282, 306, 315, 324, 357, 372, 393, 417, 504, 582, and 771.
  • Fusion proteins comprising a polypeptide according to the invention are also within the scope of the invention.
  • the invention also provides methods of making the polypeptides according to the invention.
  • the invention also relates to the use of the enzyme according to the invention in any industrial process as described herein.
  • Fig. 1 illustrates the structure of pGBFIN-49
  • Fig. 2 illustrates the effect of a set of Talaromyces thermophilus proteins spiked on TEC-210 using hWS substrate;
  • Fig. 3 illustrates the effect of a set of Talaromyces thermophilus proteins spiked on 4E mix using hWS substrate
  • Fig. 4 illustrates the effect of a set of Talaromyces thermophilus proteins spiked on TEC-210 using hWS substrate;
  • Fig. 5 illustrates the effect of a set of Talaromyces thermophilus proteins spiked on 4E mix using hWS substrate
  • Fig. 6 illustrates the effect of a set of Talaromyces thermophilus proteins spiked on TEC-210 using hWS substrate
  • Fig. 7 illustrates the effect of a set of Talaromyces thermophilus proteins spiked on 4E mix using hWS substrate
  • Fig. 8 illustrates the effect of a set of Talaromyces thermophilus proteins spiked on TEC-210 using aCS substrate
  • Fig. 9 illustrates the effect of a set of Talaromyces thermophilus proteins spiked on 4E mix using aCS substrate
  • Fig. 10 illustrates the effect of a set of Talaromyces thermophilus proteins spiked on TEC-210 using aCS substrate
  • Fig. 1 1 illustrates the effect of a set of Talaromyces thermophilus proteins spiked on 4E mix using aCS substrate;
  • Fig. 12 illustrates the effect of a set of Talaromyces thermophilus proteins spiked on TEC-210 using aCS substrate
  • Fig. 13 illustrates the effect of a set of Talaromyces thermophilus proteins spiked on 4E mix using aCS substrate
  • Fig. 14 illustrates the effect of a set of Talaromyces thermophilus proteins spiked based on protein dosage on TEC-210 mix using aCS substrate;
  • Fig. 15 illustrates the effect of a set of Talaromyces thermophilus proteins spiked based on protein volume on TEC-210 mix using aCS substrate;
  • Fig. 16 illustrates the effect of a Talaromyces thermophilus GH61 protein spiked based on protein dosage on a 3E mix using aCS substrate;
  • Fig. 17 illustrates the effect of a Talaromyces thermophilus BG protein spiked based on protein dosage on a 3E mix using aCS substrate;
  • Fig. 18 illustrates the effect of a Talaromyces thermophilus GH61 protein spiked based on protein dosage on a 3E mix using aCS substrate at high DM;
  • Fig. 19 illustrates the effect of a Talaromyces thermophilus BG protein spiked based on protein dosage on a 3E mix using aCS substrate at high DM
  • the present invention provides polynucleotides encoding enzymes, having amino acid sequences according to any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 111 , 1 14, 1 17, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144, or preferably according to any one of SEQ ID NOs:1 14, 162, 231 , 282, 306, 315, 324, 357, 372, 393, 417, 504, 582, and 771.
  • sequences of the genes were determined by sequencing cDNA clones, mRNA transcripts, or genomic DNA obtained from Talaromyces thermophilus NRRL 2155.
  • the invention provides polynucleotide sequences comprising the genes encoding the enzymes listed in Table 21 as well as their coding sequences.
  • the invention relates to an isolated polynucleotide comprising the nucleotide sequences according to any one of SEQ ID NOs: 1, 2, 4, 5, 7, 8, 10, 11, 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41, 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61, 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91, 92, 94, 95, 97, 98, 100, 101, 103, 104, 106, 107, 109, 110, 112, 113, 115, 116, 118, 119, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136, 137, 139, 140, 142
  • the invention relates to an isolated polynucleotide hybridizable under stringent conditions, preferably under high stringent conditions, to the complement of the polynucleotide listed above.
  • isolated polynucleotide may be obtained from fungi, in particular from Talaromyces, preferably from Talaromyces thermophilus.
  • the invention relates to isolated polynucleotides having nucleotide sequences according to any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 0, 11 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71, 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91, 92, 94, 95, 97, 98, 100, 101, 103, 104, 106, 107, 109, 110, 112, 113, 115, 116, 118, 119, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136, 137, 139, 140,
  • the terms “gene” and “recombinant gene” refer to nucleic acid molecules which may be isolated from chromosomal DNA, which include an open reading frame encoding a protein, e.g. Talaromyces thermophilus enzymes according to the present invention.
  • a gene may include coding sequences, non- coding sequences, introns and regulatory sequences.
  • a gene refers to an isolated nucleic acid molecule as defined herein.
  • nucleic acid molecule of the present invention such as a nucleic acid molecule having the nucleotide sequences listed above can be isolated using standard molecular biology techniques and the sequence information provided herein. For example, using all or a portion of these nucleic acid sequences as hybridization probes, nucleic acid molecules according to the invention can be isolated using standard hybridization and cloning techniques (e. g., as described in Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual.2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989).
  • nucleic acid molecule encompassing all or a portion of any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 11 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 110, 112, 113, 115, 116, 118, 119, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136, 137, 139, 140, 142, AND
  • a nucleic acid of the invention can be amplified using cDNA, mRNA or alternatively, genomic DNA, as a template and appropriate oligonucleotide primers according to standard PCR amplification techniques.
  • the nucleic acid so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis.
  • oligonucleotides corresponding to or hybridizable to nucleotide sequences according to the invention can be prepared by standard synthetic techniques, e.g., using an automated DNA synthesizer.
  • isolated nucleic acid molecules of the invention comprise the nucleotide sequences shown in any one of SEQ ID Nos: 2, 5, 8, 11 , 14, 17, 20, 23, 26, 29, 32, 35, 38, 41 , 44, 47, 50, 53, 56, 59, 62, 65, 68, 71 , 74, 77, 80, 83, 86, 89, 92, 95, 98, 101 , 104, 107, 1 10, 1 13, 116, 1 19, 122, 125, 128, 131 , 134,
  • These sequences correspond to the coding regions of the Talaromyces thermophilus genes shown in Table 21 .
  • These DNA sequences encode the Talaromyces thermophilus polypeptides according to any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 111 , 1 14, 1 17, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144.
  • an isolated nucleic acid molecule of the invention comprises a nucleic acid molecule which is a reverse complement of the nucleotide sequences shown in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 11 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 1 10, 112, 113, 115, 116, 118, 119, 121 , 122, 124, 125, 127, 128, 130, 131
  • a nucleic acid molecule which is complementary to another nucleotide sequence is one which is sufficiently complementary to the other nucleotide sequence such that it can hybridize to the other nucleotide sequence thereby forming a stable duplex.
  • One aspect of the invention pertains to isolated nucleic acid molecules that encode a polypeptide of the invention or a functional equivalent thereof such as a biologically active fragment or domain, as well as nucleic acid molecules sufficient for use as hybridization probes to identify nucleic acid molecules encoding a polypeptide of the invention and fragments of such nucleic acid molecules suitable for use as PCR primers for the amplification or mutation of nucleic acid molecules.
  • an "isolated polynucleotide” or “isolated nucleic acid” is a DNA or RNA that is not immediately contiguous with both of the coding sequences with which it is immediately contiguous (one on the 5' end and one on the 3' end) in the naturally occurring genome of the organism from which it is derived.
  • an isolated nucleic acid includes some or all of the 5' non-coding (e.g., promoter) sequences that are immediately contiguous to the coding sequence.
  • the term therefore includes, for example, a recombinant DNA that is incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g., a cDNA or a genomic DNA fragment produced by PCR or restriction endonuclease treatment) independent of other sequences. It also includes a recombinant DNA that is part of a hybrid gene encoding an additional polypeptide that is substantially free of cellular material, viral material, or culture medium (when produced by recombinant DNA techniques), or chemical precursors or other chemicals (when chemically synthesized). Moreover, an "isolated nucleic acid fragment" is a nucleic acid fragment that is not naturally occurring as a fragment and would not be found in the natural state.
  • nucleic acid molecule As used herein, the terms “polynucleotide” or “nucleic acid molecule” are intended to include DNA molecules (e.g., cDNA or genomic DNA) and RNA molecules (e.g., imRNA) and analogs of the DNA or RNA generated using nucleotide analogs.
  • the nucleic acid molecule can be single-stranded or double- stranded, but preferably is double-stranded DNA.
  • the nucleic acid may be synthesized using oligonucleotide analogs or derivatives (e.g., inosine or phosphorothioate nucleotides). Such oligonucleotides can be used, for example, to prepare nucleic acids that have altered base-pairing abilities or increased resistance to nucleases.
  • an antisense molecule which hybridizes with at least 10 contiguous, 20 contiguous, 40 contiguous, more preferably 50 contiguous, 60 contiguous, at least 80 contiguous and more preferably 100 contiguous nucleotides to any sequences shown in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 11 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 110, 112, 113,
  • sequence information as provided herein should not be so narrowly construed as to require inclusion of erroneously identified bases.
  • the specific sequences disclosed herein can be readily used to isolate the complete gene from filamentous fungi, in particular from Talaromyces thermophilus which in turn can easily be subjected to further sequence analyses thereby identifying sequencing errors.
  • nucleotide sequences determined by sequencing a DNA molecule herein were determined using an automated DNA sequencer and all amino acid sequences of polypeptides encoded by DNA molecules determined herein were predicted by translation of a DNA sequence determined as above. Therefore, as is known in the art for any DNA sequence determined by this automated approach, any nucleotide sequence determined herein may contain some errors. Nucleotide sequences determined by automation are typically at least about 90% identical, more typically at least about 95% to at least about 99.9% identical to the actual nucleotide sequence of the sequenced DNA molecule. The actual sequence can be more precisely determined by other approaches including manual DNA sequencing methods well known in the art.
  • a single insertion or deletion in a determined nucleotide sequence compared to the actual sequence will cause a frame shift in translation of the nucleotide sequence such that the predicted amino acid sequence encoded by a determined nucleotide sequence will be completely different from the amino acid sequence actually encoded by the sequenced DNA molecule, beginning at the point of such an insertion or deletion.
  • Nucleic acid molecules according to the invention may comprise only a portion or a fragment of the nucleic acid sequences shown in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 11 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 1 10, 112, 113, 115, 116, 118, 119, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136,
  • the nucleotide sequence determined from the cloning of the genes shown in Table 21 allows for the generation of probes and primers designed for use in identifying and/or cloning other family members, as well as homologues from other species.
  • the probe/primer typically comprises substantially purified oligonucleotide which typically comprises a region of nucleotide sequence that hybridizes preferably under highly stringent conditions to at least about 12 or 15, preferably about 18 or 20, preferably about 22 or 25, more preferably about 30, 35, 40, 45, 50, 55, 60, 65, or 75 or more consecutive nucleotides of a nucleotide sequence shown in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 11 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68
  • Probes based on these nucleotide sequences can be used to detect transcripts or genomic sequences encoding the same or homologous proteins for instance in other organisms.
  • the probe further comprises a label group attached thereto, e.g., the label group can be a radioisotope, a fluorescent compound, an enzyme, or an enzyme cofactor.
  • the label group can be a radioisotope, a fluorescent compound, an enzyme, or an enzyme cofactor.
  • Such probes can also be used as part of a diagnostic test kit for identifying cells which express a protein encoded by the genes shown in Table 2 .
  • the terms “homology” or “percent identity” are used interchangeably herein.
  • the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first amino acid or nucleic acid sequence for optimal alignment with a second amino or nucleic acid sequence).
  • the amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position.
  • % identity number of identical positions/total number of positions (i.e. overlapping positions) x 100).
  • the two sequences are the same length.
  • the skilled person will be aware of the fact that several different computer programs are available to determine the homology between two sequences. For instance, a comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. In a preferred embodiment, the percent identity between two amino acid sequences is determined using the Needleman and Wunsch (J. Mol. Biol. (48): 444-453 (1970)) algorithm which has been incorporated into the GAP program in the Accelrys GCG software package (available at http://www.
  • the percent identity between two nucleotide sequences is determined using the GAP program in the Accelrys GCG software package (available at http://www.accelrys.com/products/qcg/), using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1 , 2, 3, 4, 5, or 6.
  • the percent identity two amino acid or nucleotide sequence is determined using the algorithm of E. Meyers and W.
  • the nucleic acid and protein sequences of the present invention can further be used as a "query sequence" to perform a search against public databases to, for example, identify other family members or related sequences.
  • Such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403—10.
  • Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25(17): 3389-3402.
  • the default parameters of the respective programs e.g., XBLAST and NBLAST
  • hybridizing is intended to describe conditions for hybridization and washing under which nucleotide sequences at least about 60%, at least about 70%, at least about 80%, more preferably at least about 85%, even more preferably at least about 90%, more preferably at least 95%, more preferably at least 98% or more preferably at least 99% homologous to each other typically remain hybridized to each other.
  • hybridization conditions are hybridization in 6X sodium chloride/sodium citrate (SSC) at about 45 °C, followed by one or more washes in 1 X SSC, 0.1% SDS at 50 °C, preferably at 55 °C, preferably at 60 °C and even more preferably at 65 °C.
  • SSC sodium chloride/sodium citrate
  • Highly stringent conditions include, for example, hybridizing at 68 °C in 5x
  • a polynucleotide which hybridizes only to a poly A sequence such as the 3' terminal poly(A) tract of mRNAs), or to a complementary stretch of T (or U) residues, would not be included in a polynucleotide of the invention used to specifically hybridize to a portion of a nucleic acid of the invention, since such a polynucleotide would hybridize to any nucleic acid molecule containing a poly (A) stretch or the complement thereof (e.g., practically any double-stranded cDNA clone).
  • cDNA libraries constructed from other organisms e.g. brown rot fungi, in particular from the micro-organism family Talaromyces can be screened.
  • Talaromyces strains can be screened for homologous polynucleotides shown in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 11 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 110, 1 12, 113, 115, 116, 118, 119, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136, 137,
  • cDNA libraries can be constructed from RNA isolated from the appropriate strain, utilizing standard techniques well known to those of skill in the art. Alternatively, a total genomic DNA library can be screened using a probe hybridizable to a polynucleotide shown above.
  • Homologous gene sequences can be isolated, for example, by performing PCR using two degenerate oligonucleotide primer pools designed on the basis of nucleotide sequences as taught herein.
  • the template for the reaction can be cDNA obtained by reverse transcription of mRNA prepared from strains known or suspected to express a polynucleotide according to the invention.
  • the PCR product can be subcloned and sequenced to ensure that the amplified sequences represent the sequences of a new nucleic acid sequence corresponding to those shown in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 1 1 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107
  • the PCR fragment can then be used to isolate a full-length cDNA clone by a variety of known methods.
  • the amplified fragment can be labelled and used to screen a bacteriophage or cosmid cDNA library.
  • the labelled fragment can be used to screen a genomic library.
  • RNA can be isolated, following standard procedures, from an appropriate cellular or tissue source.
  • a reverse transcription reaction can be performed on the RNA using an oligonucleotide primer specific for the most 5' end of the amplified fragment for the priming of first strand synthesis.
  • RNA/DNA hybrid can then be "tailed" (e.g., with guanines) using a standard terminal transferase reaction, the hybrid can be digested with RNase H, and second strand synthesis can then be primed (e.g., with a poly-C primer).
  • second strand synthesis can then be primed (e.g., with a poly-C primer).
  • Another aspect of the invention pertains to vectors, preferably expression vectors, containing a nucleic acid encoding a protein shown in Table 21 and whose sequence may be found in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 1 11 , 114, 117, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144.
  • vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
  • plasmid refers to a circular double stranded DNA loop into which additional DNA segments can be ligated.
  • viral vector Another type of vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome.
  • Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors).
  • vectors e.g., non-episomal mammalian vectors
  • Other vectors are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome.
  • certain vectors are capable of directing the expression of genes to which they are operatively linked.
  • Such vectors are referred to herein as "expression vectors".
  • expression vectors of utility in recombinant DNA techniques are often in the form of plasmids.
  • plasmid and vector can be used interchangeably herein as the plasmid is the most commonly used form of vector.
  • the invention is intended to include such other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses), which serve equivalent functions.
  • the recombinant expression vectors of the invention comprise a nucleic acid of the invention in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vector includes one or more regulatory sequences, selected on the basis of the host cells to be used for expression, which is operatively linked to the nucleic acid sequence to be expressed.
  • "operatively linked" is intended to mean that the nucleotide sequence of interest is linked to the regulatory sequence(s) in a manner which allows for expression of the nucleotide sequence (e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell).
  • regulatory sequence is intended to include promoters, enhancers and other expression control elements (e.g., polyadenylation signal). Such regulatory sequences are described, for example, in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990). Regulatory sequences include those which direct constitutive expression of a nucleotide sequence in many types of host cells and those which direct expression of the nucleotide sequence only in a certain host cell (e.g. tissue-specific regulatory sequences). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, etc.
  • the expression vectors of the invention can be introduced into host cells to thereby produce proteins or peptides, encoded by nucleic acids as described herein (e.g. proteins whose sequences are shown in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 111 , 114, 117, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144, mutant forms of these proteins, fragments, variants or functional equivalents thereof, fusion proteins, etc.).
  • nucleic acids e.g. proteins whose sequences are shown in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54,
  • the recombinant expression vectors of the invention can be designed for expression of proteins whose sequences are shown in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 1 1 1 , 1 14, 117, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144, in prokaryotic or eukaryotic cells.
  • these proteins can be expressed in bacterial cells such as £ coli, insect cells (using baculovirus expression vectors) yeast cells or mammalian cells. Suitable host cells are discussed further in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).
  • the recombinant expression vector can be transcribed and translated in vitro, for example using 11 promoter regulatory sequences and T7 polymerase.
  • Expression vectors useful in the present invention include chromosomal-, episomal- and virus-derived vectors e.g., vectors derived from bacterial plasmids, bacteriophage, yeast episome, yeast chromosomal elements, viruses such as baculoviruses, papova viruses, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors derived from combinations thereof, such as those derived from plasmid and bacteriophage genetic elements, such as cosmids and phagemids.
  • vectors derived from bacterial plasmids, bacteriophage, yeast episome, yeast chromosomal elements viruses such as baculoviruses, papova viruses, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses
  • vectors derived from combinations thereof such as those derived from plasmid and bacteriophage
  • the DNA insert should be operatively linked to an appropriate promoter, such as the phage lambda PL promoter, the E. coli lac, trp and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs, to name a few.
  • an appropriate promoter such as the phage lambda PL promoter, the E. coli lac, trp and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs, to name a few.
  • promoters are preferred that are capable of directing a high expression level of lignocellulose active proteins from fungi. Such promoters are known in the art.
  • the expression constructs may contain sites for transcription initiation, termination, and, in the transcribed region, a ribosome binding site for translation.
  • the coding portion of the mature transcripts expressed by the constructs will include a translation initiating AUG at the beginning and a termination codon appropriately positioned at
  • Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques.
  • transformation and “transfection” are intended to refer to a variety of art- recognized techniques for introducing foreign nucleic acid (e.g., DNA) into a host cell, including calcium phosphate or calcium chloride co-precipitation, DEAE- dextran-mediated transfection, transduction, infection, lipofection, cationic lipid- mediated transfection or electroporation.
  • Suitable methods for transforming or transfecting host cells can be found in Sambrook, et al. (Molecular Cloning: A Laboratory Manual, 2" d ed. Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989), Davis et al., Basic Methods in Molecular Biology (1986) and other laboratory manuals.
  • a gene that encodes a selectable marker e.g., resistance to antibiotics
  • Preferred selectable markers include those which confer resistance to drugs, such as G418, hygromycin and methatrexate.
  • Nucleic acid encoding a selectable marker can be introduced into a host cell on the same vector as those encoding proteins whose sequences are shown in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 111 , 114, 117, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144 can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g. cells that have incorporated the selectable marker gene will survive, while the other cells die).
  • Fusion vectors add a number of amino acids to a protein encoded therein, e.g. to the amino terminus of the recombinant protein.
  • Such fusion vectors typically serve three purposes: 1 ) to increase expression of recombinant protein; 2) to increase the solubility of the recombinant protein; and 3) to aid in the purification of the recombinant protein by acting as a ligand in affinity purification.
  • a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant protein to enable separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein.
  • the expression vectors will preferably contain selectable markers.
  • markers include dihydrofolate reductase or neomycin resistance for eukaryotic cell culture and tetracyline or ampicillin resistance for culturing in E. coli and other bacteria.
  • Representative examples of appropriate host include bacterial cells, such as E. coli, Streptomyces Salmonella typhimurium and certain Bacillus species; fungal cells such as Aspergillus species, for example A. niger, A. oryzae and A. nidulans, yeast cells such as Kluyveromyces, for example K. lactis and/or Pichia, for example P.
  • insects such as Drosophila S2 and Spodoptera Sf9
  • animal cells such as CHO, COS and Bowes melanoma
  • plant cells Appropriate culture mediums and conditions for the above-described host cells are known in the art.
  • Vectors preferred for use in bacteria are for example disclosed in WO-A1 - 2004/074468, which are hereby enclosed by reference. Other suitable vectors will be readily apparent to the skilled artisan.
  • Known bacterial promoters suitable for use in the present invention include the promoters disclosed in WO-A 1-2004/074468, which are hereby enclosed by reference.
  • Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp that act to increase transcriptional activity of a promoter in a given host cell-type.
  • enhancers include the SV40 enhancer, which is located on the late side of the replication origin at bp 100 to 270, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
  • secretion of the translated protein into the lumen of the endoplasmic reticulum, into the periplasmic space or into the extracellular environment appropriate secretion signal may be incorporated into the expressed polypeptide.
  • the signals may be endogenous to the polypeptide or they may be heterologous signals.
  • polypeptide whose sequences are shown in any one of SEQ ID Nos: 114, 162, 231 , 282, 306, 3 5, 324, 357, 372, 393, 417, 504, 582, and 771 may be expressed in a modified form, such as a fusion protein, and may include not only secretion signals but also additional heterologous functional regions.
  • a region of additional amino acids, particularly charged amino acids may be added to the N-terminus of the polypeptide to improve stability and persistence in the host cell, during purification or during subsequent handling and storage.
  • peptide moieties may be added to the polypeptide to facilitate purification.
  • the invention provides isolated polypeptides having the amino acid sequences shown in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 111 , 114, 117, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144 alone or in an appropriate host.
  • a peptide or polypeptide comprising a functional equivalent of the above polypeptides is comprised within the present invention.
  • the above polypeptides are collectively comprised in the term "polypeptides according to the invention"
  • peptide and oligopeptide are considered synonymous (as is commonly recognized) and each term can be used interchangeably as the context required to indicate a chain of at least two amino acids coupled by peptidyl linkages.
  • polypeptide is used herein for chains containing more than seven amino acid residues. All oligopeptide and polypeptide formulas or sequences herein are written from left to right and in the direction from amino terminus to carboxyl terminus.
  • the one-letter code of amino acids used herein is commonly known in the art and can be found in Sambrook, et al. (Molecular Cloning: A Laboratory Manual, 2 nd , ed. Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989). Sequence Listings programs can convert easily this one-letter code of amino acids sequence into a three-letter code.
  • isolated polypeptide or protein is intended a polypeptide or protein removed from its native environment.
  • recombinantly produced polypeptides and proteins expressed in host cells are considered isolated for the purpose of the invention as are native or recombinant polypeptides which have been substantially purified by any suitable technique such as, for example, the single-step purification method disclosed in Smith and Johnson, Gene 67:31-40 (1988).
  • HPLC high performance liquid chromatography
  • Polypeptides of the present invention include naturally purified products, products of chemical synthetic procedures, and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher plant, insect and mammalian cells. Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated. In addition, polypeptides of the invention may also include an initial modified methionine residue, in some cases as a result of host-mediated processes. Protein fragments
  • the invention also features biologically active fragments of the polypeptides according to the invention.
  • Biologically active fragments of a polypeptide of the invention include polypeptides comprising amino acid sequences sufficiently identical to or derived from the amino acid sequences shown in any one of SEQ ID Nos: 3, 6, 9, 12, 15,
  • biologically active fragments comprise a domain or motif with at least one activity of the full-length protein.
  • a biologically active fragment of a protein of the invention can be a polypeptide which is, for example, 10, 25, 50, 100 or more amino acids in length.
  • other biologically active portions, in which other regions of the protein are deleted can be prepared by recombinant techniques and evaluated for one or more of the biological activities of the native form of a polypeptide of the invention.
  • the invention also features nucleic acid fragments which encode the above biologically active fragments of the proteins whose sequences are shown in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 111 , 114, 117, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144.
  • the proteins of the present invention or functional equivalents thereof, e.g., biologically active portions thereof, can be operatively linked to unrelated polypeptides (e.g., heterologous amino acid sequences) to form fusion proteins.
  • unrelated polypeptides refer to polypeptides having amino acid sequences corresponding to proteins which are not substantially homologous to the proteins whose sequences are shown in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 1 11 , 114, 1 17, 120, 123, 126, 129, 132, 135, 138, 141, AND 144.
  • Such "unrelated polypeptides” can be derived from the same or a different organism.
  • a fusion protein comprises at least two biologically active portions of proteins whose sequences are shown above.
  • the term "operatively linked" is intended to indicate that the polypeptide whose sequence is shown above, and the unrelated polypeptide are fused in-frame to each other.
  • the unrelated polypeptide can be fused to the N-terminus or C-terminus of the polypeptide whose sequence is one of those shown above.
  • the fusion protein is a fusion protein in which the protein whose sequence as shown above is fused to the C-terminus of the GST sequences.
  • Such fusion proteins can facilitate the purification of recombinant protein from Talaromyces thermophilus.
  • the fusion protein is a protein whose sequence is one of those shown above, containing a heterologous signal sequence at its N-terminus.
  • expression and/or secretion of proteins whose sequences are shown in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 111 , 114, 1 17, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144 can be increased through use of a heterologous signal sequence.
  • the gp67 secretory sequence of the baculovirus envelope protein can be used as a heterologous signal sequence ⁇ Current Protocols in Molecular Biology, Ausubel et al., eds., John Wiley & Sons, 1992).
  • Other examples of eukaryotic heterologous signal sequences include the secretory sequences of melittin and human placental alkaline phosphatase (Stratagene; La Jolla, California).
  • useful prokaryotic heterologous signal sequences include the phoA secretory signal (Sambrook et al., supra) and the protein A secretory signal (Pharmacia Biotech; Piscataway, New Jersey).
  • a signal sequence can be used to facilitate secretion and isolation of a protein or polypeptide of the invention.
  • Signal sequences are typically characterized by a core of hydrophobic amino acids, which are generally cleaved from the mature protein during secretion in one or more cleavage events.
  • Such signal peptides contain processing sites that allow cleavage of the signal sequence from the mature proteins as they pass through the secretory pathway.
  • the signal sequence directs secretion of the protein, such as from a eukaryotic host into which the expression vector is transformed, and the signal sequence is subsequently or concurrently cleaved.
  • the protein can then be readily purified from the extracellular medium by known methods.
  • the signal sequence can be linked to the protein of interest using a sequence, which facilitates purification, such as with a GST domain.
  • the sequence encoding the polypeptide may be fused to a marker sequence, such as a sequence encoding a peptide, which facilitates purification of the fused polypeptide.
  • the marker sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector (Qiagen, Inc.), among others, many of which are commercially available. As described in Geniz ef al, Proc. Natl. Acad. Sci.
  • hexa-histidine provides for convenient purification of the fusion protein.
  • the HA tag is another peptide useful for purification which corresponds to an epitope derived of influenza hemaglutinin protein, which has been described by Wilson er a/., Cell 37:767 (1984), for instance.
  • a fusion protein of the invention (corresponding to one of those whose sequences shown above) is produced by standard recombinant DNA techniques.
  • DNA fragments coding for the different polypeptide sequences are ligated together in-frame in accordance with conventional techniques, for example by employing blunt-ended or stagger-ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and enzymatic ligation.
  • the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers.
  • PCR amplification of gene fragments can be carried out using anchor primers, which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed and reamplified to generate a chimeric gene sequence (see, for example, Current Protocols in Molecular Biology, eds. Ausubel ef al. John Wiley & Sons: 1992).
  • anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed and reamplified to generate a chimeric gene sequence
  • many expression vectors are commercially available that already encode a fusion moiety (e.g., a GST polypeptide).
  • a nucleic acid encoding one of the proteins shown in Table 21 can be cloned into such an expression vector such that the fusion moiety is linked in-frame to the this protein.
  • Functional protein or polypeptide equivalents may contain only conservative substitutions of one or more amino acids of proteins whose sequences are shown in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 111 , 114, 117, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144 or substitutions, insertions or deletions of non-essential amino acids.
  • a non-essential amino acid is a residue that can be altered in proteins whose sequences are shown above, without substantially altering the biological function.
  • amino acid residues that are conserved among the proteins of the present invention are predicted to be particularly unamenable to alteration.
  • amino acids conserved among the proteins according to the present invention are not likely to be amenable to alteration.
  • conservative substitution is intended to indicate a substitution in which the amino acid residue is replaced with an amino acid residue having a similar side chain.
  • These families are known in the art and include amino acids with basic side chains (e.g. lysine, arginine and hystidine), acidic side chains (e.g.
  • aspartic acid glutamic acid
  • uncharged polar side chains e.g., glycine, asparagines, glutamine, serine, threonine, tyrosine, cysteine
  • non-polar side chains e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan
  • beta-branched side chains e.g., threonine, valine, isoleucine
  • aromatic side chains e.g., tyrosine, phenylalanine tryptophan, histidine
  • nucleic acid equivalents may typically contain silent mutations or mutations that do not alter the biological function of encoded polypeptide. Accordingly, the invention provides nucleic acid molecules encoding the proteins whose sequences are shown above, that contain changes in amino acid residues that are not essential for a particular biological activity. Such proteins differ in amino acid sequence from those shown yet retain at least one biological activity thereof.
  • the isolated nucleic acid molecule comprises a nucleotide sequence encoding a protein, wherein the protein comprises a substantially homologous amino acid sequence of at least about 72%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more homologous to the amino acid sequences shown above.
  • orthologues of the Talaromyces thermophilus proteins are proteins that can be isolated from other strains or species and possess a similar or identical biological activity. Such orthologues can readily be identified as comprising an amino acid sequence that is substantially homologous to one of the sequences shown in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 111 , 114, 117, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144.
  • substantially homologous refers to a first amino acid or nucleotide sequence which contains a sufficient or minimum number of identical or equivalent (e.g., with similar side chain) amino acids or nucleotides to a second amino acid or nucleotide sequence such that the first and the second amino acid or nucleotide sequences have a common domain.
  • amino acid or nucleotide sequences which contain a common domain having about 72%, preferably 75%, more preferably 80%, even more preferably 85%, 90%, 95%, 96%, 97%, 98% or 99% identity or more are defined herein as sufficiently identical.
  • nucleic acids encoding other family members related to those proteins whose sequences are shown above which thus have a nucleotide sequences that differ from sequences shown in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 1 1 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 110, 112, 113, 15, 116, 118, 119, 121 , 122, 124, 125, 127, 128, 130, 131
  • nucleic acids encoding proteins corresponding to those whose sequences are shown above from different species which can have a nucleotide sequences which differ from those shown in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 1 1 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 1 10, 112, 113, 1 15, 116, 1 18, 1 19,
  • Nucleic acid molecules corresponding to variants (e.g. natural allelic variants) and homologues of the DNA of the invention shown in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 11 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 1 10, 1 12, 113, 115, 116, 118, 119, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134
  • improved proteins derived from the sequences shown above are provided.
  • Improved proteins are proteins wherein at least one biological activity is improved.
  • Such proteins may be obtained by randomly introducing mutations along all or part of the coding sequences of the polypeptides shown in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 111 , 114, 1 17, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144 such as by saturation mutagenesis, and the resulting mutants can be expressed recombinantly and screened for biological activity.
  • the art provides for standard assays for measuring the enzymatic activity of the resulting protein and thus improved proteins may easily be selected.
  • the protein has an amino acid sequence according to a sequence shown in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 ,
  • the polypeptide is substantially homologous to the amino acid sequence according to a sequence shown above and retains at least one biological activity of a polypeptide according to the sequence shown above, yet differs in amino acid sequence due to natural variation or mutagenesis as described above.
  • the protein has an amino acid sequence encoded by an isolated nucleic acid fragment capable of hybridizing to a nucleic acid according to the sequences shown in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 11 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 110, 1 12, 1 13, 115, 116, 118, 119, 121 , 122, 124, 125, 127, 128, 130, 131
  • the protein is preferably a protein which comprises an amino acid sequence at least about 72%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more homologous to an amino acid sequence shown in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 111 , 114, 117, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144 and retains at least one functional activity of the polypeptide according to the sequences shown above.
  • a variegated library of variants is generated by combinatorial mutagenesis at the nucleic acid level.
  • a variegated library of variants can be produced by, for example, enzymatically ligating a mixture of synthetic oligonucleotides into gene sequences such that a degenerate set of potential protein sequences is expressible as individual polypeptides, or alternatively, as a set of larger fusion proteins (e.g. for phage display).
  • libraries of fragments of the coding sequence of a polypeptide of the invention can be used to generate a variegated population of polypeptides for screening a subsequent selection of variants.
  • a library of coding sequence fragments can be generated by treating a double stranded PCR fragment of the coding sequence of interest with a nuclease under conditions wherein nicking occurs only about once per molecule, denaturing the double stranded DNA, renaturing the DNA to form double stranded DNA which can include sense/antisense pairs from different nicked products, removing single stranded portions from reformed duplexes by treatment with S1 nuclease, and ligating the resulting fragment library into an expression vector.
  • an expression library can be derived which encodes N-terminal and internal fragments of various sizes of the protein of interest.
  • REM Recursive ensemble mutagenesis
  • Fragments of a polynucleotide according to the invention may also comprise polynucleotides not encoding functional polypeptides. Such polynucleotides may function as probes or primers for a PCR reaction.
  • Nucleic acids according to the invention irrespective of whether they encode functional or non-functional polypeptides can be used as hybridization probes or polymerase chain reaction (PCR) primers.
  • FISH FISH to metaphase chromosomal spreads to provide precise chromosomal location of the gene as described in Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988); (3) Northern blot analysis for detecting expression of mRNA corresponding to one of those shown in any one of SEQ ID NOs: 1, 2, 4, 5, 7, 8, 10, 1 1, 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31, 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 1 10,
  • Also encompassed by the invention is a method of obtaining a functional equivalent of a gene corresponding to one of those shown in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 1 1 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91, 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 110, 1 12, 1 13, 115, 116, 118, 119, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136,
  • Such a method entails obtaining a labelled probe that includes an isolated nucleic acid which encodes all or a portion of the protein sequence according to any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 11 1 , 114, 117, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144 and to Table 21 or a variant thereof; screening a nucleic acid fragment library with the labelled probe under conditions that allow hybridization of the probe to nucleic acid fragments in the library, thereby forming nucleic acid duplexes, and preparing a full-length gene sequence from the nucleic acid fragments in any labelled duplex to obtain a gene related to the gene shown in any
  • a nucleic acid of the invention is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more homologous to a nucleic acid sequence shown herein or to the reverse complement thereof.
  • the invention features cells, e.g., transformed host cells or recombinant host cells that contain a nucleic acid or vector encompassed by the invention.
  • a "transformed cell” or “recombinant cell” is a cell into which (or into an ancestor of which) has been introduced, by means of recombinant DNA techniques, a nucleic acid or vector according to the invention.
  • Both prokaryotic and eukaryotic cells are included, e.g., bacteria, fungi, yeast, and the like, especially preferred are cells from filamentous fungi, in particular Talaromyces thermophilus.
  • a cell of the invention is typically not a wild-type Talaromyces thermophilus or a naturally-occurring cell.
  • fungi such as Aspergillus niger, Trichoderma reesii, Myceliophthora thermophila or Talaromyces emersonii
  • yeasts such as Saccharomyces cerevisiae, Yarrowia lipolytica and Pichia pastoris
  • bacteria such as Escherichia coli and Bacillus sp.
  • plants such as Nicotiana benthamiana, Nicotiana tabacum and Medicago sativa.
  • a nucleic acid molecule (or a nucleic acid molecule which is comprised within a vector) may be homologous or heterologous with respect to the cell into which it is introduced.
  • a nucleic acid molecule is homologous to a cell if the nucleic acid molecule naturally occurs in that cell.
  • a nucleic acid molecule is heterologous to a cell if the nucleic acid molecule does not naturally occur in that cell.
  • the invention provides a cell which comprises a heterologous or a homologous sequence corresponding to one of those shown in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 11 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 110, 112, 113, 115, 116, 118, 119, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136,
  • a host cell can be chosen that modulates the expression of the inserted sequences, or modifies and processes the gene product in a specific, desired fashion. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products may facilitate optimal functioning of the protein.
  • Various host cells have characteristic and specific mechanisms for post- translational processing and modification of proteins and gene products.
  • Appropriate cell lines or host systems familiar to those of skill in the art of molecular biology and/or microbiology can be chosen to ensure the desired and correct modification and processing of the foreign protein expressed.
  • eukaryotic host cells that possess the cellular machinery for proper processing of the primary transcript, glycosylation, and phosphorylation of the gene product can be used.
  • Such host cells are well known in the art.
  • Host cells also include, but are not limited to, mammalian cell lines such as CHO, VERO, BHK, HeLa, COS, MDCK, 293, 3T3, WI38, and choroid plexus cell lines.
  • mammalian cell lines such as CHO, VERO, BHK, HeLa, COS, MDCK, 293, 3T3, WI38, and choroid plexus cell lines.
  • a stably transfected cell line can produce the polypeptides according to the invention.
  • a number of vectors suitable for stable transfection of mammalian cells are available to the public, methods for constructing such cell lines are also publicly known, e.g., in Ausubel et al. (supra).
  • the invention also relates to the use of the enzymes according to the invention in a selected number of industrial processes.
  • the enzymes according to the invention feature a number of significant advantages over the enzymes currently used. Depending on the specific application, these advantages can include aspects such as lower production costs, higher specificity towards the substrate, greater synergies with existing enzymes, less antigenic effect, less undesirable side activities, higher yields when produced in a suitable microorganism, more suitable pH and temperature ranges, better properties of the final product, and food grade or kosher aspects.
  • the present invention also relates to methods for preparing a food product comprising incorporating into the food product an effective amount of an enzyme of the present invention. This improves one or more properties of the food product relative to a food product in which the polypeptide is not incorporated.
  • the phrase "incorporated into the food product” is defined herein as adding the enzyme according to the invention to the food product, any ingredient from which the food product is to be made, and/or any mixture of food ingredients from which the food product is to be made.
  • the enzyme according to the invention may be added in any step of the food product preparation and may be added in one, two or more steps.
  • the enzyme according to the invention is added to the ingredients of a food product which can then be treated by methods including cooking, boiling, drying, frying, steaming or baking as is known in the art.
  • an effective amount is defined herein as an amount of the enzyme according to the invention that is sufficient for providing a measurable effect on at least one property of interest of the food product.
  • improved property is defined herein as any property of a food product which is improved by the action of an enzyme according to the invention relative to a food product in which the enzyme according to the invention is not incorporated.
  • the improved property may be determined by comparison of a food product prepared with and without addition of a polypeptide of the present invention.
  • Organoleptic qualities may be evaluated using procedures well established in the food industry, and may include, for example, the use of a panel of trained taste-testers.
  • the enzymes of the present invention may be in any form suitable for the use in question, e.g., in the form of a dry powder, agglomerated powder, or granulate, in particular a non-dusting granulate, liquid, in particular a stabilized liquid, or protected enzyme such as described in WO01/11974 and WO02/26044.
  • Granulates and agglomerated powders may be prepared by conventional methods, e.g., by spraying the enzyme according to the invention onto a carrier in a fluid-bed granulator.
  • the carrier may consist of particulate cores having a suitable particle size.
  • the carrier may be soluble or insoluble, e.g., a salt (such as NaCI or sodium sulphate), sugar (such as sucrose or lactose), sugar alcohol (such as sorbitol), starch, rice, corn grits, or soy.
  • a salt such as NaCI or sodium sulphate
  • sugar such as sucrose or lactose
  • sugar alcohol such as sorbitol
  • starch rice, corn grits, or soy.
  • the enzyme according to the invention and/or additional enzymes may be contained in slow-release formulations. Methods for preparing slow-release formulations are well known in the art. Adding nutritionally acceptable stabilizers such as sugar, sugar alcohol, or another polyol, and/or lactic acid or another organic acid according to established methods may for instance, stabilize liquid enzyme preparations.
  • the enzyme according to the invention may also be incorporated in yeast comprising compositions such as disclosed in EP-A-0619947, EP-A-0659344 and WO02/49441.
  • the additional enzyme may be of any origin, including mammalian and plant, and preferably of microbial (bacterial, yeast or fungal) origin and may be obtained by techniques conventionally used in the art. Enzymes may conveniently be produced in microorganisms. Microbial enzymes are available from a variety of sources; Bacillus species are a common source of bacterial enzymes, whereas fungal enzymes are commonly produced in Aspergillus species.
  • Suitable additional enzymes include other starch degrading enzymes, xylanases, oxidizing enzymes, fatty material splitting enzymes, or protein- degrading, modifying or crosslinking enzymes.
  • Starch degrading enzymes are for instance endo-acting enzymes such as alpha-amylase, mattogenic amylase, puliulanase or other debranching enzymes and exo-acting enzymes that cleave off glucose (amyloglucosidase), maltose (beta- amylase), maltotriose, maltotetraose and higher oligosaccharides.
  • Suitable xylanases are for instance xylanases, pentosanases, hemicellulase, arabinofuranosidase, glucanase, cellulase, cellobiohydrolase, beta- glucosidase, and others.
  • Oxidizing enzymes are for instance glucose oxidase, hexose oxidase, pyranose oxidase, sulfhydryl oxidase, lipoxygenase, laccase, polyphenol oxidases and others.
  • Fatty material splitting enzymes are for instance triacylglycerol lipases, phospholipases (such as At, A 2 , B, C and D) and galactolipases.
  • Protein degrading, modifying or crosslinking enzymes are for instance endo-acting proteases (serine proteases, metalloproteases, aspartyl proteases, thiol proteases), exo-acting peptidases that cleave off one amino acid, or dipeptide, tripeptide etceteras from the N-terminal (aminopeptidases) or C- terminal (carboxypeptidases) ends of the polypeptide chain, asparagines or glutamine deamidating enzymes such as deamidase and peptidoglutaminase or crosslinking enzymes such as transglutaminase.
  • endo-acting proteases serine proteases, metalloproteases, aspartyl proteases, thiol proteases
  • exo-acting peptidases that cleave off one amino acid, or dipeptide, tripeptide etceteras from the N-terminal (aminopeptidases) or C- terminal (car
  • the additional enzyme may be an amylase, such as an alpha-amylase (can be useful for providing sugars fermentable by yeast) or beta-amylase, cyclodextrin glucanotransferase, peptidase, in particular, an exopeptidase (can be useful in flavour enhancement), transglutaminase, lipase (can be useful for the modification of lipids present in the food or food constituents), phospholipase, cellulase, hemicellulase, protein disulfide isomerase, peroxidase, laccase, or oxidase, e.g., an glucose oxidase, hexose oxidase, aldose oxidase, pyranose oxidase, lipoxygenase or L-amino acid oxidase..
  • an amylase such as an alpha-amylase (can be useful for providing sugars fermentable by yeast) or beta-
  • the present invention also relates to the use of the enzymes according to the present invention in other industrial applications.
  • the enzymes of the current invention may be used in new or improved methods for enzymatically degrading or converting plant cell wall polysaccharides from biomass into various useful products.
  • plant cell walls contain associated pectins and lignins, the removal of which by enzymes of the current invention can improve accessibility to cellulases and hemicellulases, or which can themselves be converted to useful products.
  • Pretreatment technologies may involve chemical, physical, or biological treatments. Examples of pre-treatment technologies include but are not limited to: steam explosion; ammonia; acid hydrolysis; alkaline hydrolysis; solvent extraction; crushing; milling; etc.
  • Bioethanol is usually produced by the fermentation of glucose to ethanoi by yeasts such as Saccharomyces cerevisiae: in addition to ethanoi, other chemicals may be synthesized starting from glucose.
  • Ethanoi today, is produced mostly from sugars or starches, obtained from sugar cane, fruits and grains.
  • cellulosic ethanol is obtained from cellulose, the main component of wood, straw and much of the plants.
  • Sources of biomass for cellulosic ethanol production comprise agricultural residues (such as leftover crop materials from stalks, leaves, and husks of corn plants), forestry wastes (such as chips and sawdust from lumber mills, dead trees, and tree branches), energy crops (such as dedicated fast-growing trees and grasses such as switch grass), municipal solid waste (such as household garbage and paper products), food processing and other industrial wastes (such as black liquor, paper manufacturing by-product, etc.).
  • agricultural residues such as leftover crop materials from stalks, leaves, and husks of corn plants
  • forestry wastes such as chips and sawdust from lumber mills, dead trees, and tree branches
  • energy crops such as dedicated fast-growing trees and grasses such as switch grass
  • municipal solid waste such as household garbage and paper products
  • food processing and other industrial wastes such as black liquor, paper manufacturing by-product, etc.
  • Plant biomass is a mixture of plant polysaccharides, including cellulose, hemicelluloses, and pectin, together with the structural polymer, lignin.
  • Glucose is released from cellulose by the action of mixtures of enzymes, including: endoglucanases, exoglucanases (cellobiohydrolases 1 and 2) and beta- glucosidases.
  • Efficient large-scale conversion of cellulosic materials by such mixtures requires the full complement of enzymes, and can be enhanced by the addition of enzymes that attack the other plant cell wall components (hemicelluloses, pectins, and lignins), as well as chemical linkages between these components.
  • enzymes of the current invention that are highly expressed, or have high specific activity, stability, or resistance to inhibitors would improve the efficiency of the process, and lower enzyme costs. It would be an advantage to the art to improve the degradation and conversion of plant cell wall polysaccharides by composing cellulase mixtures using cellulase enzymes with such properties. Furthermore, enzymes of the current invention that are able to function at extremes of pH and temperature are desirable, both since improved enzyme robustness decreases costs, and because enzymes that function at high temperature will allow high processing temperatures under high substrate consistency conditions that decrease viscosity and thus improve yields.
  • Glycoside hydrolases from family GH61 are known to stimulate the activity of cellulose cocktails on lignocellulosic substrates and are thus considered to exhibit cellulose-enhancing activity (P. V. Harris et al., Biochemistry 49, 3305 (2010)). They have no known enzymatic activities of their own. Enhancement of cellulase cocktail efficiency by GH61 proteins of the current invention would contribute to lowering the costs of cellulase enzymes used for the production of glucose from plant cell biomass, as described above.
  • Enzymatic hydrolysis of plant hemicellulose yields 5-carbon sugars that either may be fermented to ethanol by some species of yeast, or converted to 2012/050198
  • Enzymatic deconstruction of hemicellulose is also known to improve the accessibility of plant cell wall cellulose to cellulase enzymes for the production of glucose from lignocellulosic materials.
  • Hemicellulase enzymes of the current invention that enhance glucose production from lignocellulose would find utility in the bioethanol industry and in other process that rely on glucose or pentose streams from lignocellulose.
  • Lignin is composed of methoxylated phenyl-propane units linked by ether linkages and carbon-carbon bonds.
  • the chemical composition of lignin may, depending on species, include guaiacyl, 4-hydroxyphenyl, and syringyl groups.
  • Enzymatic modification of lignin by the enzymes of the current invention can be used for the production of structural materials from plant biomass, or alternatively improve the accessibility of plant cellulose and hemicelluloses to cellulase enzymes for the release of glucose from biomass as described above.
  • Enzymes that degrade the lignin component of lignocellulose include lignin peroxidases, manganese-dependent peroxidases, versatile peroxidases, and laccases (Vicuna, 2000, Molecular Biotechnology 14: 173-176; Broda et al., 1996, Molecular Microbiology 19: 923-932). These enzymes of the current invention may also in certain instances be active in the decolourization of industrial dyes, and thus useful for the treatment and detoxification of chemical wastes.
  • Pectin degrading enzymes of the current invention can also enhance the action of cellulases on plant biomass by improving the accessibility of cellulase to the cellulose component of lignocellulose.
  • the enzymes of the present invention may also be used in other applications for hydrolyzing non-starch polysaccharide (NSP).
  • NSP non-starch polysaccharide
  • Enzymes are used in detergents in order to improve its efficacy to remove most types of dirt. Enzymes have been used in textile processing since the early part of this century to remove starch-based sizing, but only in the past decade has serious attention been given to using enzymes for a wide range of textile applications. Enzymes are expected to have an even greater impact on effluent quality as more fibre preparation, pre-treatment and value-added finishing processes convert to biotreatment. In addition, enzymes are very effective catalysts even under mild conditions and do not require the high energy input often associated with chemical processes. The use of enzymes of the present invention finds utility in the detergent industry for removal from laundry of carbohydrate-based stains.
  • Feed enzymes have an important role to play in current farming systems. They can increase the digestibility of nutrients, leading to greater efficiency in the production of animal products such as meat and eggs. At the same time they can play a role in minimizing the environmental impact of increased animal production.
  • Non-starch polysaccharides can increase the viscosity of the digesta which can, in turn, decrease nutrient availability and animal performance.
  • Endoxylanases and phytases are the best-known feed-enzyme products.
  • Phytase enzymes hydrolyse phytic acid and release inorganic phosphate, thereby avoiding the need to add inorganic phosphates to the diet and reducing phosphorus excretion.
  • Addition of xylanases to feed has also been shown to have positive effects on animal growth. Adding specific nutrients to feed improves animal digestion and thereby reduces feed costs.
  • feed additives are being currently used and new concepts are continuously developed.
  • Use of specific enzymes like non-starch carbohydrate degrading enzymes could breakdown the fibre releasing energy as well as increasing the protein digestibility due to better accessibility of the protein when the fibre gets broken down. In this way the feed cost could come down as well as the protein levels in the feed also could be reduced.
  • Non-starch polysaccharides are also present in virtually all feed ingredients of plant origin. NSPs are poorly utilized and can, when solubilized, exert adverse effects on digestion. Exogenous enzymes can contribute to a better utilization of these NSPs and as a consequence reduce any antinutritional effects.
  • the hemicellulases and other polysaccharide-active enzymes of the present invention can be used for this purpose in cereal-based diets for poultry and, to a lesser extent, for pigs and other species.
  • the xylanases of the present invention can be used for prebleaching of kraft pulp. Xylanases have been found to be most effective for that purpose.
  • Xylanases attract increasing scientific and commercial attention due to applications in the pulp and paper industry for removal of hemicellulose from dissolving pulps or for enhancement of the bleachability of pulp and, thus, reduction of the use of environmentally harmful bleaching chemicals.
  • a similar application of xylanases for pulp prebleaching is an already well-established technology and has greatly stimulated research on hemicellulases in the past decade.
  • lignin-active peroxidases of the present invention may also be active in modification of lignin and hence have bleaching properties, such enzymes are generally less attractive for bleaching dues to the need to use and recycle expensive redox mediators.
  • Xylanases of the present invention can be used to pre-bleach pulp to reduce the amount of bleaching chemicals to obtain a given brightness. It is suggested that xylanase depolymerises xylan blocks and increases accessibility or helps liberation of residual lignin by releasing xylan-chromophore fragments. In addition to brownstock prior to bleaching, xylanases of the present invention can save on bleaching chemicals.
  • the enzymes hydrolyze surface xylans and are able to break linkages between hemicellulose and lignin. Other hemicellulase active enzymes of the present invention which can break these linkages can function effectively in bleaching or pre-bleaching of pulp.
  • xylanases of the present invention can also be used in antibacterial formulation as well as in pharmaceutical products such as throat lozenges, toothpastes, and mouthwash.
  • Chitin is a -(1 ,4)-linked polymer of N-acetyl D-glucosamine (GlcNAc), found as a structural polysaccharide in fungal cell walls as well as in the exoskeleton of arthropods and the outer shell of crustaceans. Approximately 75% the total weight of shellfish is considered waste and a large proportion of the material making up the waste is chitin.
  • GlcNAc N-acetyl D-glucosamine
  • Chitin degrading enzymes of the current invention are useful in the modification and degradation of chitin, allowing the production of chitin-derived material, such as chitooligosaccharides and N-acetyl D-glucosamine, from chitin waste; another use of chitinase enzymes as antifungal agents.
  • Houbraken et al. Antonie van Leeuwenhoek 2012 Feb; 101 (2): 403-21 ). Based on phenotypic, physiological and molecular data, Houbraken et al proposed to transfer the species 7. emersonii, T. byssochlamydoides, T. eburneus, G. argillacea and G. cylindrospora to Rasamsonia gen. nov.
  • starter mycelium was grown in rich medium (either mycological broth or yeast malt broth (the latter being indicated with YM in the growth conditions table)) and then washed with water. The starter was then used to inoculate different liquid media or solid substrate and the resulting mycelium was used for RNA extraction and library construction.
  • Trace Element Solution contains 2mM Iron(ll) sulphate heptahydrate (FeS0 4 7H 2 0), 1 mM Copper (II) sulphate pentahydrate (CuS0 4 ' 5H 2 0), 5 mM Zinc sulphate heptahydrate (ZnS0 '7H 2 0), 10 mM Manganese sulphate monohydrate (MnS0 4 ⁇ 2 0), 5 mM Cobalt(ll) chloride hexahydrate (CoCI 2 ' 6H 2 0), 0.5 mM Ammonium molybdate tetrahydrate ((NH 4 ) 6 Mo 7 0 24 -4H 2 0), and 95 mM Hydrochloric acid (HCI)dissolved in double-distilled water.
  • TDM Talaromyces thermophilus Defined Medium
  • TDM-14 The medium's pH was raised to 7.5.
  • the strain was incubated at 5°C above its optimum growth
  • the strain was incubated at 10°C below its optimum growth
  • TDM-19 Asparagine monohydrate was increased to 4g per liter.
  • Asparagine monohydrate was increased to 4g per liter and glucose
  • TDM-20 was replaced with 2% fructose.
  • Asparagine monohydrate was increased to 4g per liter; 100ml of
  • TDM-21 double-distilled water was replaced with 100ml kerosene 4 .
  • Glucose was omitted.
  • Asparagine monohydrate was increased to 4g per liter; 100ml of
  • TDM-22 double-distilled water was replaced with 100ml hexadecane (Sigma cat. # H0255). Glucose was omitted.
  • Asparagine monohydrate was increased to 4g per liter; one half of the double-distilled water was replaced with 25% Whitewater from
  • Asparagine monohydrate was increased to 4g per liter and the
  • TDM-24 quantity of manganese sulphate monohydrate was raised to 0.2mM final concentration in the medium.
  • Asparagine monohydrate was increased to 4g per liter and
  • Asparagine monohydrate was increased to 4g per liter.
  • potassium phosphate monobasic was replaced with 5mM phytic acid from rice (Sigma Cat. # P3168).
  • Glucose was replaced with 10g per liter of olive oil (Sigma cat. #
  • TDM-29 Glucose was replaced with 10g per liter of tallow.
  • TDM-30 Glucose was replaced with 10g per liter of yellow grease.
  • Glucose was replaced with 10g per liter of defined lipid (Sigma cat. #
  • TDM-32 Glucose was replaced with 50g per liter of D-xylose.
  • Glucose was replaced with 20g per liter of glycerol and 20ml per liter
  • Glucose was reduced to 1g per liter and 10g per liter of bran was
  • Glucose was reduced to 1g per liter and 10g per liter of pectin (Sigma).
  • TDM-36 Glucose was replaced with 10g per liter of biodiesel.
  • TDM-37 Glucose was replaced with 10g per liter of soy feedstock.
  • Glucose was replaced with 10g per liter of locust bean gum (Sigma
  • TDM-39 Whitewater from newsprint manufacture and white water from peroxide bleaching. Glucose was omitted.
  • TDM-40 The medium's pH was raised to 8.5.
  • TDM-41 peroxide bleaching; plus yeast extract was added to 1 g per liter.
  • Glucose was replaced with 5g per liter of yellow grease and 5g per
  • TDM-43 Glucose was replaced with 20g per liter of fructose.
  • Glucose was replaced with 10g per liter of cellulose (Solka-Floc,
  • TDM-45 The medium's pH was raised to 8.84.
  • Kerosene was sourced from a general hardware store.
  • the Talaromyces thermophilus strain was grown according to the methods described above under the following growth conditions: TDM-1 , -2, -3, -4, -5, -6, -7, -8, 9, -10, -13, -14, -15, -39; YM, whereby the following optimal growth temperature was used: 25°C.
  • strains carrying the recombinant genes were grown according to the methods described above under the following growth conditions: minimal medium as described in Kafer (1977, Adv Genet. 19:33-131) except that the salt concentrations were raised ten-fold and the glucose concentration was 150 grams per litre, at 30°C
  • Genomic DNA was isolated from mycelium when the growth culture had reached the mid log phase. Genomic DNA was sequenced using the Roche 454 Titanium technology (http://www.454.com) to a genome coverage of over 20-fold according to the instruction of the manufacturer. The sequences were assembled using the Newbler and Celera assemblers.
  • the mycelia were collected by filtration through Miracloth and washed with water by filtration. The mycelia were padded dry using paper towels, and frozen in liquid nitrogen and stored at -80°C.
  • To extract total RNA the frozen mycelia or cells were ground to a fine powder in liquid nitrogen using pestle and mortar. Approximately 1-1.5 gram of frozen fungal powder was dissolved in 10 ml of TRizol ® reagent and RNA was extracted according to the manufacturer's protocol (Invitrogen Life Sciences, Catalog #15596-018). Following extraction, the RNA was dissolved at 1-1.5 mg/ml of DEPC-treated water.
  • the PolyATtract ® mRNA Isolation Systems (Promega, Catalog #Z5300) was used to isolate poly(A)+RNA. In general, equal amounts of total RNA extracted from up to ten culture conditions were pooled. One milligram of total RNA was used for isolation of poly(A)+RNA according to the protocol provided by the manufacturer. The purified poly(A)+RNA was dissolved at 200-500 Mg/ml of DEPC-treated water.
  • Double-stranded cDNA was synthesized using the ZAP-cDNA ® Synthesis Kit (Stratagene, Catalog #200400) according to the manufacturer's protocol with the following modifications.
  • An anchored oligo(dT) linker-primer was used in the first-strand synthesis reaction to force the primer to anneal to the beginning of the poly(A) tail of the mRNA.
  • the anchored oligo(dT) linker-primer has the sequence: 5'-GAGAGAGAGAGAGAGAGAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTTVN- 3' (SEQ ID NO: 145) where V is A, C, or G and N is A, C, G, or T.
  • a second modification was made by adding trehalose at a final concentration of 0.6M and betaine at a final concentration of 2M in the buffer of the first-strand synthesis reaction to promote full-length synthesis. Following synthesis and size fractionation, fractions of double-stranded cDNA with sizes longer than 600 bp were pooled.
  • the pooled cDNA was cloned directionally into the plasmid vector BlueScript KS+ ® (Stratagene) or a modified BlueScript KS+ vector that contained Gateway ® (Invitrogen) recombination sites.
  • the cDNA library was transformed into £. coli strain XL10-Gold ultracompetent cells (Stratagene, Catalog #Z00315) for propagation.
  • Bacterial cells carrying cDNA clones were grown on LB agar containing the antibiotic Ampicillin for selection of plasmid-borne bacteria and X-gal and IPTG to use the blue/white system to screen for the presence cDNA inserts.
  • the white bacterial colonies, those carrying cDNA inserts, were transferred by a colony-picking robot to 384-well MTP for replication and storage.
  • Clones that were to be analyzed by sequencing were transferred to 96-well deep blocks using liquid-handling robots. The bacteria were cultured at 37°C with shaking at 150 rpm.
  • plasmid DNA from the cDNA clones was prepared by alkaline lysis and sequenced from the 5' end using ABI 3730x1 DNA analyzers (Applied Biosystems).
  • the chromatograms obtained following single-pass sequencing of the cDNA clones were processed using Phred (available at http://www.phrap.org) to assign sequence quality values, Lucy as described in Chou and Holmes (2001 , Bioinformatics, 17(12) 1093-1104) to remove vector and low quality sequences, and Phrap (available at http://www.phrap.org/) to assemble overlapping sequences derived from the same gene into contigs.
  • Phred available at http://www.phrap.org
  • Phrap available at http://www.phrap.org/
  • Proteins targeted to the extracellular space by the classical secretory pathway possess an N-terminal signal peptide, composed of a central hydrophobic core surrounded by N- and C- terminal hydrophilic regions.
  • Phobius available at http://phobius.cqb.ki.se
  • SignalP version 3 available at http://www.cbs.dtu.dk/services/SiqnalP
  • TargetP available at http://www.cbs.dtu.dk services/TargetP
  • Big-PI Fungal Predictor available at http://mendel.imp.ac.at/gpi/fungi_server.html
  • TEC-210 was fermented according to the inoculation and fermentation procedures described in WO2011/000949.
  • the 4E mix (4 enzymes mixture or 4 enzyme mix) containing CBHI, CBHII, GH61 and BG (30%, 25%, 36% and 9%, respectively as described in WO2011/098577) was used. Construction of pGBFIN49 expression plasmids
  • FIG. 1 represents a schematic map of pGBFIN-49 and the complete nucleotide sequence is presented as SEQ ID NO: 146.
  • TtrpC terminator was PCR amplified using purified pGBFIN33 plasmid as a template. The following primers and PCR program were used:
  • Primer-3 S'-GTCCGTCGCCGTCCJTCAccgccggtccgacg-S' (SEQ ID NO: 147)
  • Primer-4 5'-GCGGCCGGCGTATTGGGTGttacggagc-3' (SEQ ID NO: 148)
  • Primer-4 is entirely specific to TtrpC 3' end.
  • Primer-3 was designed to suit the LIC cloning strategy but also to keep TtrpC sequence as close as the original sequence. To do so, five adenines were replaced by thymines (underlined).
  • Primer-3 (10mM) 1 ⁇
  • Primer-4 (10mM) 1 ⁇
  • Reaction conditions 5 ⁇ of the PCR reaction was ran on 1.0% agarose gel and remaining was purified using QIAEX II gel Extraction kit (QIAGEN) and resuspended in nuclease-free water.
  • Vector backbone was PCR amplified using pGBF!N41 as a template. Primers were designed outside of the ccdA region (not included in pGBFIN49). The following primers and PCR program were used:
  • Primer-2 5'-CACCCAATACGCCGGCCGCgcttccagacagctc-3' (SEQ ID NO: 149)
  • Primer-1 C S'-GGTGTJTTGTTGCTGGGGAtgaagctcaggctctcagttgcgtc-S' (SEQ ID NO: 150)
  • Primer-2 contains a pgpdA-specific region and an extra sequence specific to TtrpC 3' end (also included in Primer-4).
  • Primer-1 C was designed to suit the LIC cloning strategy but also to keep PgalA region as close as the original sequence. To do so, three thymines were replaced by adenines (underlined).
  • PCR program 1x98°C - 3 min; 10x (98°C - 30 sec, 68°C - 30 sec, 72°C - 5 min); 20 x ( 98°C - 30 sec, 68°C - 30 sec, 72°C - 5 min+10 sec/cycle); 72°C - 10 min.
  • Reaction conditions 5 ⁇ of the PCR reaction was ran on 0.5% agarose gel and remaining was purified using QIAEX II gel Extraction kit (QIAGEN) and resuspended in nuclease-free water.
  • Overlap-extension / Long range PCR was performed to a) fused the two PCR pieces together; b) add Sfol restriction site to re-circulate the vector. No primers were used in the overlap-extension stage. Primer-11 and Primer-12 were used for the long range PCR reaction.
  • Primer-11 5'-CACCGGCGCCGTCCGTCGCCGTCCTTC -3' (SEQ ID NO: 151 )
  • Primer-12 5'-ACGGCGCCGGTGTTTTGTTGCTGGGGATG -3' (SEQ ID NO: 152)
  • Primers-11 is specific to the LIC tag located on the TtrpC terminator while Primer-12 is specific to the LIC tag located on the PglaA region. Sfol restriction site sequence is underlined.
  • a standard PCR master mix was prepared to perform overlap-extension PCR using pGBFIN41 and TtrpC purified PCR products as templates. No primers were added.
  • PCR program - overlap (no primers): 1x 98°C - 2 min; 5x (98°C - 15 sec, 58° - C30 sec, 72°C - 5 min), 5x (98°C - 15 sec, 63°C - 30 sec, 72°C - 5 min), 5x
  • the overlap-extension PCR product was then, purified on QIAEX II column and 5 ⁇ of the purified reaction was used as template DNA for Long range PCR step with primers-11 and -12.
  • PCR program - Long range 1 ⁇ 98°C - 3 min; 10x (98°C - 30 sec, 68°C - 30 sec, 72°C - 5 min); 20 x (98°C - 30 sec, 68°C - 30 sec, 72°C - 5 min+10 sec/cycle); 72°C - 10 min.
  • Reaction conditions 5 ⁇ of the PCR reaction was ran on 0.5% agarose gel and remaining was purified using QIAEX II gel Extraction kit and resuspended in nuclease-free water. Then, Sfol digestion was performed and digested product was purified using QIAEX II gel extraction kit follow the procedure as described by the manufacture.
  • Cloning genes of interest in the pGBFIN-49 expression vector was performed using the Ligation-independent cloning (LIC) method according to Aslanidis, C, de Jong, P. (1990) Nucleic Acids Research Vol. 18 No. 20, 6069- 6074.
  • LIC Ligation-independent cloning
  • Coding sequences from genes of interest were amplified by PCR using primers containing LIC tags which are homologous to Pg/a and TrpC sequences in the pGBFIN-49 cloning vector fused to sequences homologous to the coding sequences of the gene of interest, and either genomic DNA or cDNA as template.
  • Primers have following sequences:
  • Reverse primer 5'- GAAGGACGGCGACGGACTTCA...15-20 nucleotides specific to each gene to be cloned (SEQ ID NO:154
  • PCR mix consists of following components:
  • Expression vector pGBFIN-49 was PCR amplified using primers with following sequences:
  • Forward primer 5'- GTCCGTCGCCGTCCTTCACCG -3' (SEQ ID NO:155)
  • Reverse primer 5'- GGTGTTTTGTTGCTGGGGATGAAGC -3' (SEQ ID NO: 156) (Primers are located at either site of the Sfol restriction site.)
  • PCR mix consists of following components:
  • Obtained PCR fragments were treated with T4 DNA polymerase in the presence of dTTP to create single stranded tails at the ends of the PCR fragments.
  • the single stranded tails of the PCR fragment are complementary to those at the vector, thus permitting non-covalent bi-molecular associations e.g. circularization between molecules.
  • Reaction mix of T4 DNA polymerase treatment pGBFIN-49 PCR fragment consists of following components:
  • PCR fragment consists of following components:
  • A. niger GBA307 As host strain for enzyme production, A. niger GBA307 was used. Construction of A. niger GBA307 is described in WO201 1009700.
  • Transformation of A. niger was performed essentially according to the method described by Tilburn, J. et. al. (1983) Gene 26, 205-221 and Kelly, J & Hynes, M. (1985) EMBO J., 4, 475-479 with the following modifications:
  • Aspergillus minimal medium contains per liter: 6 g NaN0 3 ; 0.52 g KCI; 1 .52 g KH 2 P0 4 ; 1 .12 ml 4 M KOH; 0.52 g MgS0 4 .7H 2 0; 10 g glucose; 1 g casamino acids; 22 mg ZnS0 4 .7H 2 0; 1 1 mg H 3 B0 3 ; 5 mg FeS0 4 .7H 2 0; 1 .7 mg CoCI 2 .6H 2 0; 1 .6 mg CuS0 4 .5H 2 0; 5 mg MnCI 2 .2H 2 0; 1 .5 mg Na 2 Mo0 4 .2 H 2 0; 50 mg EDTA; 2 mg riboflavin; 2 mg thiamine-HCI; 2 mg nicotinamide
  • Glucanex 200G (Novozymes) was used for the preparation of protoplasts; After protoplast formation (2-3 hours) 10 ml TB layer (per liter: 109.32 g Sorbitol; 100 ml 1 M Tris-HCI pH 7.5) was pipetted gently on top of the protoplast suspension. After centrifugation for 10 min at 4330 x g at 4°C in a swinging bucket rotor, the protoplasts on the interface were transferred to a fresh tube and washed with STC buffer (1.2 M Sorbitol, 10 mM Tris-HCI pH7.5, 50 mM CaCI 2 ). The protoplast suspension was centrifuged for 10 min at 1560 x g in a swinging bucket rotor and resuspended in STC-buffer at a concentration of 10 s protoplasts/ml;
  • the protoplasts were resuspended gently in 1 ml 1.2 M sorbitol and plated onto selective regeneration medium consisting of Aspergillus minimal medium without riboflavin, thiamine.
  • HCI nicotinamide, pyridoxine, panthotenic acid, biotin, casaminoacids and glucose, supplemented with 150 pg/ml Phieomycin (Invitrogen), 0.07 M NaN0 3 , 1 M sucrose, solidified with 2 % bacteriological agar #1 (Oxoid, England).
  • MTP microtiter plates
  • sporulated Aspergillus niger strains were used to harvest spores for MTP fermentations.
  • 200 ⁇ of 10% glycerol was added to each well and after resuspending the mixture, 40 ⁇ of spore suspension was used to inoculate 2 ml A. niger medium (70 g/l glucose.
  • the MTP's were incubated in a humidity shaker (Infors) at 34 ° C at 550 rpm, and 80% humidity for 6 days. Plates were centrifuged 10 minutes 2750 rpm at 4°C and the supernatants were harvested.
  • a humidity shaker Infors
  • TEC-210 was fermented according to the inoculation and fermentation procedures described in WO2011/000949.
  • Concentrated protein samples were diluted with water to a concentration between 2 and 8 mg/ml.
  • Bovine serum albumin (BSA) dilutions (0, 1 , 2, 5, 8 and 10 mg/ml) were made and included as samples to generate a calibration curve.
  • 1 ml of each diluted protein sample was transferred into a 10 ml tube containing 1 ml of a 20% (w/v) trichloro acetic acid solution in water and mixed thoroughly. Subsequently, the tubes were incubated on ice water for one hour and centrifuged for 30 minutes, at 4°C and 6000 rpm.
  • the supernatant was discarded and pellets were dried by inverting the tubes on a tissue and letting them stand for 30 minutes at room temperature.
  • 4 ml BioQuant Biuret reagent mix was added to the pellet in the tube and the pellet was solubilised upon mixing.
  • 1 ml water was added to the tube, the tube was mixed thoroughly and incubated at room temperature for 30 minutes. The absorption of the mixture was measured at 546 nm with a water sample used as a blank measurement and the protein concentration was calculated via the BSA calibration line.
  • MTP Microtiter plate
  • the stored samples were analyzed twice; 100 ⁇ _ sample and 100 ⁇ of a (hemi-)cellulase base mix [3.5 mg/g DM TEC-210 or a 4 enzyme mix at a total dosage of 3.5 mg/g DM consisting of 0.3 mg/g DM BG 2012/050198
  • the other vial consist of a blank, where the 800 pL 2.5 % f7 w ) dry matter, acid pre treated corn stover, hot water treated wheat straw, or hot water treated corn fiber substrate suspension was replaced by 800 pl_ 50 mM citrate buffer, buffered at pH 4.5.
  • the assay samples were incubated for 72 hrs at 65 °C. After incubation of the assay samples, a fixed volume of D 2 0 (with 0.5 g/L 4,4-dimethyl-4-silapentane-1 -sulfonic acid (DSS)) containing an internal standard, maleic acid (20 g/L) and EDTA (40 g/L), was added.
  • D 2 0 with 0.5 g/L 4,4-dimethyl-4-silapentane-1 -sulfonic acid (DSS)
  • the amount of sugar released is based on the signal between 4.65 - 4.61 ppm, relative to DSS, and is determined by means of 1 D 1 H NMR operating at a proton frequency of 500 MHz, using a pulseprogram with water suppression, at a temperature of 27°C.
  • the (hemi)-cellulase enzyme solution may contain residual sugars. Therefore, the results of the assay are corrected for the sugar content measured after incubation of the enzyme solution.
  • A. niger strains expressing Talaromyces clones were fermented in shake flask cultures, as described above, in order to obtain more material for further testing.
  • the fermentation supernatants (volume between 75 and 100 ml) were concentrated using a 10 kDa spin filter to a volume of approximately 5 ml.
  • the protein concentration in the concentrated supernatant was determined via a TCA-biuret method, as described above.
  • the (hemi-)cellulase activity of these protein samples was tested in an assay where the supernatants were spiked on top of an enzyme base mix in the presence of 2% (w/w) acid pretreated corn stover.
  • 'To spike' or 'spiking of a supernatant or an enzyme indicates in this context the addition of a supernatant or an enzyme to a (hemi)- cellulase base mix.
  • a 3E mix (3 enzymes mixture or 3 enzyme mix) is spiked with a fourth enzyme to form the 4E mix.
  • the proteins were spiked based on dosage or volume.
  • the concentrated supernatant samples were added in a final concentration of 2.5 mg/gDM to the base enzyme mix (TEC-210 2.5 mg/gDM) in a total volume of 1 ml at a feedstock concentration of 2% aCS (w/w) in a 2 ml tube.
  • a blank sample was included.
  • 50 ⁇ supernatant was added to 1 ml water in the absence of feedstock or base enzyme mix. This allowed a determination of the background sugar present in the concentrated supernatant.
  • base enzyme mix (TEC-210 2.5 mg/gDM) alone was incubated with 2% aCS (w/w) feedstock in a total volume of 1 ml in a 2 ml tube.
  • the blank and base enzyme mix-only samples were also performed in duplicate.
  • a-arabinose peak at 4.50 ppm (d, 0.60 H, J 8 Hz)
  • cellobiose is present in the samples.
  • Talaromyces thermophilus (hemi)cellulosic proteins were cloned and expressed in A. rtiger as described above. Supernatants from MTP fermentations were used in MTP sugar release activity assays as described above, using two different feedstocks.
  • Table 3 Effect of Talaromyces thermophilus proteins spiked on TEC-210 using hWS substrate
  • Table 4 Effect of a set of Talaromyces thermophilus proteins spiked on 4E mix using hWS substrate In a second set of experiments with hot-water pretreated wheat straw
  • Table 5 Effect of a different set of Talaromyces thermophilus proteins spiked TEC-210 using hWS substrate
  • Table 7 Effect of another different Talaromyces thermophilus protein spiked TEC-210 using hWS substrate
  • Table 8 Effect of another different Talaromyces thermophilus protein spiked on 4E mix using hWS substrate
  • Table 9 Effect of a set of Talaromyces thermophilus proteins spiked on TEC-210 using aCS substrate
  • Table 10 Effect of a set of Talaromyces thermophilus proteins spiked on 4E mix using aCS substrate
  • aCS acid pretreated corn stover
  • Table 1 1 Effect of a different set of Talaromyces thermophilus proteins spiked TEC-210 using aCS substrate
  • Table 12 Effect of a different set of Talaromyces thermophilus proteins spiked on 4E mix using aCS substrate.
  • aCS acid pretreated corn stover
  • TEC-210 two different cellulase enzyme base mixes
  • Different proteins from Talaromyces thermophilus showed increased sugar release as shown below in Table 13 / Figure 12 and Table 14/ Figure 13:
  • Table 13 Effect of another different set of Talaromyces thermophilus proteins spiked on TEC-2 0 using aCS substrate
  • Table 14 Effect of another different Talaromyces thermophilus protein spiked on 4E mix using aCS substrate.
  • Example 3 Improvement of thermophilic cellulase mixture by Talaromyces thermophilus proteins in the lab scale activity assay
  • Talaromyces thermophilus proteins were cloned and expressed in A. niger as described above. Concentrated supematants from shake flask fermentations were used in sugar release activity assays as described above, using aCS NREL as feedstock. In one set of experiments, supematants of Taiaromyces thermophilus protein fermentations were spiked based on protein dosage op top of a TEC-210 base mix, as described above. Several proteins showed increased sugar release as shown below in Table 15 / Figure 14.
  • Table 15 Effect of a set of Taiaromyces thermophilus proteins spiked based on protein dosage on TEC-210 using aCS substrate; st dev, standard deviation.
  • Table 16 Effect of a set of Taiaromyces thermophilus proteins spiked based on supernatant volume on TEC-210 using aCS substrate; st dev, standard deviation.
  • Example 4 Substitution of Rasamsonia emersonii GH61 with Taiaromyces thermophilus TALTH_3_00094 in the 4 enzyme mixture activity assay The cellulase enhancing activity of Taiaromyces thermophilus GH61 protein (TALTH _3_00094) was further analysed. The TALTH_3_00094 gene was cloned and expressed in A. niger as described above. The supernatant of an A.
  • niger expressing TALTH_3_00094 shake flask fermentation was concentrated and spiked in a dosage of 1 ,8 mg/g DM on top of a base activity of a three enzyme base mix (3.2 mg/g DM composed of: BG at 0.45 g/g DM, CBHI at 1.5 mg/g DM and CBHII at 1.25 mg/g DM) at a feedstock concentration of 2% (w/w) aCS.
  • the 4 enzyme base mix was taken into account, which effectively consisted of the 3 E mix as mentioned here, spiked with 1.8 mg/g DM GH61.
  • thermophilus GH61 protein showed increased sugar release up to similar levels as the 3E mix spiked with GH61 , which is present in a standard 4E base mix, shown below in Table 17/ Figure 16.
  • Table 17 Effect of GH61 TALTH_3_00094 protein spiked on top of a 3E mix using aCS substrate; st dev, standard deviation.
  • Example 5 Substitution of R. emersonii BG with Talaromyces thermophilus TALTH_2__00031 in the 4 enzyme mixture activity assay.
  • the cellulase enhancing activity of TALTH_2_00031 was further analysed.
  • the Talaromyces thermophilus BG gene (TALTH_2_00031 ) was cloned and expressed in A. niger as described above.
  • Supernatant of an A. niger expressing TALTH_2_00031 shake flask fermentation was concentrated and spiked in a dosage of 0.45 mg/g DM on top of a base activity of a three enzyme base mix (4.55 mg/gDM composed of: CBHI at 1.5 mg/g DM, CBHII at 1 .25 mg/g DM and GH61 at 1.8 mg/gDM) at a feedstock concentration of 2% (w/w) aCS.
  • the 4 enzyme base mix was taken into account, which effectively consisted of the 3 E mix as mentioned here, spiked with 0.45 mg/g DM BG. All four enzymes were added in a combined volume of 0.5 ml (125 ⁇ of each enzyme) to a 0.5 ml solution of 4% (w/w) aCS solution in 50mM acetate buffer, pH 4.5, in a 2 ml tube. As blank, the 3 enzyme base mix with addition of 125 ⁇ 50mM acetate buffer, pH 4.5, was taken into account.
  • TALTH_2_00031 background sugars in the supernatant sample of TALTH_2_00031 were determined by adding 125 ⁇ TALTH_2_00031 (in the same dosage as in the experiment) into 875 ⁇ 50mM acetate buffer, pH 4.5. All experiments were performed at least in duplicate and were incubated for 72 hours at 65°C and 600 rpm in a shaking eppendorf incubator.
  • thermophilus BG protein showed increased sugar release up to similar levels as the 3E mix spiked with BG, which is present in a standard 4E base mix, as shown below in Table 18/ Figure 17. Furthermore, the cellobiose levels were almost zero when the 3 enzyme base mix was spiked with TALTH_2_00031 and BG, suggesting the presence of an active beta-glucosidase in the mixture.
  • Table 18 Effect of BG TALTH_2_00031 protein spiked on top of a 3E mix using aCS substrate; st dev, standard deviation.
  • Example 6 Substitution of R. emersonii GH61 with Talaromyces thermophilus TALTH_3_00094 in the 4 enzyme mixture activity assay at high DM.
  • the cellulase enhancing activity of Talaromyces thermophilus GH61 protein was further analysed.
  • the dosage of TALTH_3_00094 was 1.8 mg/g DM and the final DM concentration of the mixture was 9% pCS.
  • the 4 enzyme base mix was taken into account, which effectively consisted of the 3 E mix as mentioned here, spiked with 1 ,8 mg/gDM GH61in a volume of 100 ⁇ on top of 870 ⁇ 10% (w/w) aCS solution in water, pH 4.5.
  • the 3 enzyme base mix with addition of 100 ⁇ water was taken into account. All experiments were performed at least in duplicate and were incubated for 72 hours at 65°C and 600rpm. After incubation, the samples were centrifuged and 500 ⁇ of the supernatant was transferred to a deep-well microtiter plate (MTP). Subsequently, soluble sugars were analysed by proton NMR as described above.
  • thermophilus GH61 protein showed increased sugar release, also at higher DM, up to similar levels as the 3E mix spiked with GH61 , which is present in a standard 4E base mix, shown below in Table 19/ Figure 17.
  • Table 19 Effect of GH61 TALTH_3_00094 protein spiked on top of a 3E mix using aCS substrate; st dev, standard deviation.
  • Example 7 Substitution of R. emersonii BG with Talaromyces thermophilus TALTH_2_00031 in the 4 enzyme mixture activity assay at high DM.
  • TALTH_2_00031 was further analysed. 100 ⁇ of the concentrated supernatant of an A. niger expressing TALTH_2_00031 shake flask fermentation, obtained as described above, was spiked on top of 870 ⁇ 10% (w/w) aCS solution in water, pH 4.5, and 30 pi of a three enzyme base mix (4.5 mg/g DM composed of: CBHI at 1.5 mg/g DM, CBHII at 1.25 mg/g DM and GH61 at 1.8 mg/g DM) in a 2 ml tube. By adding 100 ⁇ supernatant, the dosage of TALTH_2_00031 was 0.45 mg/g DM and the final DM concentration of the mixture was 9% pCS.
  • a three enzyme base mix 4.5 mg/g DM composed of: CBHI at 1.5 mg/g DM, CBHII at 1.25 mg/g DM and GH61 at 1.8 mg/g DM
  • the 4 enzyme base mix was taken into account, which effectively consisted of the 3 E mix as mentioned here, spiked with 0.45 mg/gDM BG in a volume of 100 ⁇ on top of 870 ⁇ 10% (w/w) aCS solution in water, pH 4.5.
  • the 3 enzyme base mix with addition of 100 ⁇ water, pH 4.5, was taken into account. All experiments were performed at least in duplicate and were incubated for 72 hours at 65°C and 600 rpm. After incubation, the samples were centrifuged and 500 ⁇ of the supernatant was transferred to a deep-well microliter plate (MTP). Subsequently, soluble sugars were analysed by proton NMR as described above.
  • thermophilus BG protein showed increased sugar release, also at higher DM, up to similar levels as the 3E mix spiked with BG, which is present in a standard 4E base mix, shown below in Table 20/ Figure 18.
  • Table 20 Effect of GH61 TALTH_2_00031 protein spiked on top of a 3E mix using aCS substrate; st dev, standard deviation.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The present invention relates to novel enzymes or proteins for cell wall deconstruction obtainable from Talaromyces thermophilus, polynucleotide sequences encoding the polypeptides according to the invention, a production process for the enzymes according to the invention and the use of the enzymes according to the invention in various industrial processes.

Description

NOVEL CELL WALL DECONSTRUCTION ENZYMES OF TALAROMYCES THERMOPHILUS AND USES THEREOF
Field of the invention
The invention relates to newly identified polynucleotide sequences comprising genes that encode novel cell wall deconstruction enzymes. The enzymes may be isolated from the fungus, Talaromyces thermophilus NRRL 2155. The invention features the full length coding sequences of the novel genes, the genomic sequences of each gene, as well as the amino acid sequences of the full-length functional proteins and functional equivalents of the genes or the amino acid sequences. The invention also relates to methods of using these proteins in industrial processes. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins and cells wherein a protein according to the invention is genetically modified to enhance or reduce its activity and/or level of expression. Background of the invention
The present invention relates to novel cell wall deconstruction enzymes, suitable for use in several industrial applications, for example in food applications, such as for example cereal-based food products, in the textile industry for the treatment of cellulose-based fabrics; in the feed-enzyme industry such as for example increasing the digestibility of nutrients; in the pulp and paper industry such as enhancing bleachability of the pulp; in the waste treatment industry for the decolorization of synthetic dyes; and in the bioethanol industry such as for example improving the ethanol yield and increasing the efficiency and economy of ethanol production.
The conversion of biomass into second-generation biofuels, driven by the limited availability of fossil fuels, is heavily dependent on inexpensive and effective enzymes for the conversion of lignocellulose to ethanol. Cellulase enzyme cocktails require the concerted action of endoglucanases, cellobiohydrolases, and beta-glucosidases. The current cost of cellulose enzymes is too high for bioethanol to compete economically with fossil fuels: lowered cellulose costs may result from the discovery of cellulase enzymes with higher specific activity, lower production costs, or greater compatibility with processing conditions including temperature, pH and the presence of inhibitors in the biomass, or produced as the result of biomass pre-treatment.
Conversion of plant biomass to glucose may also be enhanced by supplementing cellulose cocktails with enzymes that degrade the other components of biomass, including hemicelluloses, pectins and lignins, and their linkages, to improve the accessibility of cellulose to the cellulase enzymes. These enzymes include: xylanases, mannanases, arabinanases, esterases, glucuronidases, xyloglucanases and arabinofuranosidases for hemicelluloses; lignin peroxidases, manganese-dependent peroxidases, versatile peroxidases, and laccases for lignin; and pectate lyase, pectin lyase, polygalacturonase, pectin acetyl esterase, alpha-arabinofuranosidase, beta-galactosidase, galactanase, arabinanase, rhamnogalacturonase, rhamnoga!acturonan lyase, and rhamnogalacturonan acetyl esterase, xylogalacturonosidase, xylogalacturonase, and rhamnogalacturonan lyase. Additionally, glycoside hydrolase family 61 (GH61 ) proteins have been shown to stimulate the activity of cellulase preparations.
The enzymes described may also be useful for other purposes in processing biomass. The lignin modifying enzymes may be used to alter the structure of lignin to produce novel materials, and hemicelluases may be employed to produce 5-carbon sugars from hemicelluloses, which may then be further converted to chemical products.
There is also a need for improved enzymes for feed and food processing applications. Cereal-based food products such as pasta, noodles and bread can be prepared from dough which is usually made from the basic ingredients (cereal) flour, water and optionally salt. As a result of a consumer-driven need to replace the chemical additives by more natural products, several enzymes have been developed with dough and/or cereal-based food product improving properties and which are used in all possible combinations depending on the specific application conditions. Suitable enzymes include xylanase, starch degrading enzymes, oxidizing enzymes, fatty material splitting enzymes, protein degrading, and modifying or crosslinking enzymes. Many of these enzymes are also used for treating animal feed or animal feed additives, to make them more digestible or to improve their nutritional quality. Amylases are used for the conversion of plant starches to glucose. Pectin-active enzymes are used in fruit processing, for example to increase the yield of juices, and in fruit juice clarification, as well as in other food processing steps. Object of the invention
It is an object of the invention to provide novel polynucleotides encoding novel cell wall deconstruction enzymes. A further object is to provide naturally and recombinantly produced cell wall deconstruction enzymes as well as recombinant strains producing these. Also fusion polypeptides are part of the invention as well as methods of making and using the polynucleotides and polypeptides according to the invention.
Summary of the invention
The invention provides for novel polynucleotides encoding novel cell wall deconstruction enzymes.
In particular, the invention provides for polynucleotides having a nucleotide sequences that hybridize preferably under high stringent conditions to the complement of any one sequence according to SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 11 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 110, 112, 113, 1 15, 1 16, 118, 1 19, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136, 137, 139, 140, 142, AND 143, or a functional equivalent thereof. Consequently, the invention provides nucleic acids that are at least 30%, preferably at least 40%, 50%, 60%, or 70%, more preferably at least 80% or 90%, even more preferably at least 95%, 96%, 97%, 98% or 99% homologous to the sequences listed above. Actual percentage will differ per gene/protein depending on closest known homologues in prior art.
In one embodiment the invention provides for an isolated polynucleotide selected from the group consisting of: a) a polynucleotide comprising nucleic acid sequence as set forth in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 11 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 110, 112, 113, 115, 116, 118, 119, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136, 137, 139, 140, 142, AND 143, or a functional equivalent thereof; b) a polynucleotide encoding a polypeptide comprising a polypeptide sequence as set forth in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30,
33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99,
102, 105, 108, 111, 114, 117, 120, 123, 126, 129, 132, 135, 138, 141, AND 144, or a functional equivalent thereof; c) a polynucleotide hybridizing under stringent conditions to the polynucleotide of a) or b); and d) a polynucleotide hybridizing under stringent conditions to the reverse complement of the polynucleotide of a) or b), said polynucleotide.
In another embodiment, the nucleic acid sequence is one selected from the subset as represented by SEQ ID NO:13, 14, 22, 23, 34, 35, 40, 41 , 43, 44, 46, 47, 49, 50, 61 , 62, 64, 65, 73, 74, 76, 77, 91 , 92, 121 , 122, 139, AND 140, or a functional equivalent thereof. Alternatively, in another embodiment, the polynucleotide is one that encodes a polypeptide as set forth in any one of SEQ ID Nos: 15, 24, 36, 42, 45, 48, 51 , 63, 66, 75, 78, 93, 123, and 141 , or a functional equivalent thereof.
In another embodiment the invention provides for such an isolated polynucleotide obtainable from a fungus, in particular Talaromyces is preferred and even more preferred Talaromyces thermophilus.
Still in another embodiment, the invention provides for a vector comprising the polynucleotide of the present invention. The vector may further comprise a regulatory sequence operatively linked to the polynucleotide for expression of same in a suitable host cell, preferably a filamentous fungus.
In a further embodiment, the invention provides a host cell comprising the polynucleotide or the vector of the present invention.
In another embodiment the invention provides an isolated polypeptide as set forth in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 111 , 114, 117, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144, or a functional equivalent thereof. Preferably, in still another embodiment, the invention provides an isolated polypeptide as set forth in any one of SEQ ID Nos: 15, 24, 36, 42, 45, 48, 51 , 63, 66, 75, 78, 93, 123, and 141 , or a functional equivalent thereof.
In another embodiment the invention provides an isolated polypeptide that is at least 60%, preferably at least 70%, more preferably at least 80%, even more preferably at least 90%, 95%, 96%, 97%, 98% or 99% homologous to any one Of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 111 , 1 14, 1 17, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144, or a functional equivalent thereof, or even more preferably to any one of SEQ ID Nos: 15, 24, 36, 42, 45, 48, 51 , 63, 66, 75, 78, 93, 123, and 141 ;
In yet a further embodiment, the isolated polypeptide has a sequence encoded by nucleic acid sequence as set forth in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 11 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 110, 112, 113, 1 15, 1 16, 1 18, 119, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136, 137, 139, 140, 142, AND 143, or a functional equivalent thereof; or more preferably a sequence encoded by nucleic acid sequence as set forth in any one of SEQ ID NOs: 13, 14, 22, 23, 34, 35, 40, 41 , 43, 44, 46, 47, 49, 50, 61 , 62, 64, 65, 73, 74, 76, 77, 91 , 92, 121 , 122, 139, AND 140; or nucleic acid sequences that are at least 60%, preferably at least 70%, more preferably at least 80%, even more preferably at least 90%, 95%, 96%, 97%, 98% or 99% homologous to any one of those sequences above.
In another embodiment, the isolated polypeptide has a sequence encoded by a nucleic acid sequence hybridizing under stringent conditions to the polynucleotide as set forth in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 1 1 , 13, 14,
16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 110, 112, 113, 1 15, 116, 118, 119, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136, 137, 139, 140, 142, AND 143, or a functional equivalent thereof; or more preferably a sequence encoded by a nucleic acid sequence hybridizing under stringent conditions to the polynucleotide as set forth in any one of SEQ ID NOs: 13, 14, 22, 23, 34, 35, 40, 41 , 43, 44, 46, 47, 49, 50, 61 , 62, 64, 65, 73, 74, 76, 77, 91 , 92, 121 , 122, 139, AND 140; or nucleic acid sequences that are at least 60%, preferably at least 70%, more preferably at least 80%, even more preferably at least 90%, 95%, 96%, 97%, 98% or 99% homologous to any one of those sequences above.
The polypeptide is preferably obtainable from Talaromyces thermophilus. In an alternate embodiment, the polypeptide is obtainable by expressing the polynucleotide or the vector of the present invention in an appropriate host cell.
The invention also provides a process for degrading biomass or pretreated biomass to sugars wherein an enzyme is used comprising a polypeptide having a sequence as defined above.
Preferably the polypeptide is obtainable from a white rot fungus, more preferably obtainable from Talaromyces thermophilus. The enzyme is preferably a cellulase-enhancing protein, a glycoside hydrolase, preferably a glycoside of the GH61 family, a glycosidase (for example a glycosidase crf1 or a beta-glucosidase such as a glucan 1 ,3-beta-glucosidase), an endoglucanase (for example endoglucanase-1 ), a beta-xylosidase (for example exo-1 ,4-beta-xylosidase xlnD), a beta-hexosaminidase, a beta-N-acetylhexosaminidase or a xylanase (for example an endo-1 ,4-beta-xylanase).
The invention provides for novel polynucleotides encoding novel cell wall deconstruction enzymes.
Still in another embodiment, the invention provides a method for manufacturing the polypeptide comprising the steps of transforming a suitable host cell with the isolated polynucleotide or the vector of the present invention, culturing said cell under conditions allowing expression of said polynucleotide and optionally purifying the encoded polypeptide from said cell or culture medium.
The polypeptide of the present invention can be used in the preparation of a food product, in the preparation of a detergent, in the preparation of an animal feed, for prebleaching kraft pulp, for processing lignin, for producing ethanol, for treating textiles or dyed textiles or for degrading biomass or pretreated biomass.
The examples of activities of enzymes according to the invention are herein intended to at least cover any of the following:
• Enzymes that hydrolyze cellulose, including endoglucanases (EG) ((E.C. 3.2.1.4) hydrolyze the beta-1 ,4-linkages between glucose units); exoglucanases, also known as cellobiohydrolases 1 and 2 (CBH1 or CBHI and CBH2 or CBHII) ((E.C. 3.2.1.91 ) hydrolyze cellobiose, a glucose disaccharide, from the reducing and non-reducing ends of cellulose); and beta-glucosidases (BG) ((E.C. 3.2.1.21 ) hydrolyze the beta-1 ,4 glycoside bond of cellobiose to glucose)
Glycoside hydrolase family 61 (GH61) proteins, which enhance the action of cellulose enzymes on lignocellulose substrates. Glycoside hydrolase family 61 (GH61 or sometimes referred to EGIV or EG4) proteins are proteins which enhance the action of cellulases on lignocellulose substrates. GH61 was originally classified as endogluconase based on measurement of very weak endo-1 ,4-P-d-glucanase activity in one family member.
Enzymes that degrade or modify xylan and/or xylan-lignin complexes including xylanase ((E.C. 3.2.1 .8) catalyzes random cleavage of beta-1 ,4 bonds in xylan or xyloglucan), xylan 1 ,4-beta-xylosidase (EC 3.2.1.37) catalyzes hydrolysis of 1 ,4-beta-D-xylans, to remove successive D-xylose residues from the non-reducing terminals, and also cleaves xylobiose), aipha-arabinofuranosidase ((EC 3.2.1.55) hydrolyzes terminal non- reducing alpha-L-arabinofuranoside residues in alpha-L-arabinosides including arabinoxylans and arabinogalactans), alpha-glucuronidase ((EC 3.2.1.139) hydrolyzes an alpha-D-glucuronoside to the corresponding alcohol and D-glucuronate), feruloyl esterase ((EC 3.1.1.73) catalyzes hydrolysis of the 4-hydroxy-3-methoxycinnamoyl (feruloyl) group from an esterified sugar, which is usually arabinose in natural substrates), and acetyl xylan esterase ((EC 3.1.1.72) catalyzes deacetylation of xylans and xylo-oligosaccharides)
Enzymes that degrade or modify mannan including mannanase ((EC 3.2.1.78) catalyzes random hydrolysis of 1 ,4-beta-D-mannosidic linkages in mannans, galactomannans and glucomannans), mannosidase ((EC 3.2.1.25) hydrolyzes terminal, non-reducing beta-D-mannose residues in beta-D-mannosides), alpha-galactosidase ((EC 3.2.1.22) hydrolyzes terminal, non-reducing alpha-D-galactose residues in alpha-D- galactosides, including galactose oligosaccharides, galactomannans and galactohydrolase), and mannan acetyl esterase . Enzymes that degrade xyloglucans including xyloglucanase ((EC 3.2.1.151 ) involves endohydrolysis of 1 ,4-beta-D-g!ucosidic linkages in xyloglucan while (EC 3.2.1.155) catalyzes exohydrolysis of 1 ,4-beta-D- glucosidic linkages in xyloglucan), endoglucanase, and cellulase.
Enzymes that degrade beta-1 ,4-glucan including endoglucanase, cellobiohydrolase, and beta-glucosidase.
Enzymes that degrade beta-1 ,3-1 ,4-glucan including endo-beta-1,3(4)- glucanase ((EC 3.2.1 .6) catalyzes endohydrolysis of 1 ,3- or 1 ,4-linkages in beta-D-glucans when the glucose residue whose reducing group is involved in the linkage to be hydrolysed is itself substituted at C-3), endoglucanase (beta-glucanase, cellulase), and beta-glucosidase. Enzymes that degrade galactan include galactanases ((EC 3.2.1.23) hydrolyzes terminal non-reducing beta-D-galactose residues in beta-D- galactosides).
Enzymes that degrade arabtnan include arabinanases ((EC 3.2.1.99) catalyze endohydrolysis of 1 ,5-alpha-arabinofuranosidic linkages in 1 ,5- arabinans).
Enzymes that degrade starch, including alpha-amylase ((EC 3.2.1.1 catalyzes endohydrolysis of 1 ,4-alpha-D-glucosidic linkages in polysaccharides containing three or more 1 ,4-alpha-linked D-glucose units) and alpha-glucosidase ((EC 3.2.1.20) hydrolyzes terminal, non- reducing 1 ,4-linked alpha-D-glucose residues with release of alpha-D- glucose)
Enzymes that degrade or modify pectin, including pectate lyase ((EC 4.2.2.2) carries out eliminative cleavage of pectate to give oligosaccharides with 4-deoxy-alpha-D-gluc-4-enuronosyl groups at their non-reducing ends), pectin lyase ((EC 4.2.2.10) catalyzes eliminative cleavage of (1-4)-alpha-D-galacturonan methyl ester to give oligosaccharides with 4-deoxy-6-0-methyl-alpha-D-galact-4-enuronosyl groups at their non-reducing ends), polygalacturonase ((EC 3.2.1.15) carries out random hydrolysis of 1 ,4-alpha-D-galactosiduronic linkages in pectate and other galacturonans), pectin acetyl esterase ((EC 3.1.1.1 1 ) hydrolyzes acetate from pectin acetyl esters), alpha- arabinofuranosidase, beta-galactosidase galactanase, arabinanase, rhamnogalacturonase (EC 3.2.1 .-) hydrolyzes alpha-D- galacturonopyranosyl-(1 ,2)-alpha-L-rhamnopyranosyl linkages in the backbone of the hairy regions of pectins), rhamnogalacturonan lyase (EC 4.2.2.-) degrades type I rhamnogalacturonan from plant cell walls and releases disaccharide products), rhamnogalacturonan acetyl esterase ((EC 3.1.1.-) hydrolyzes acetate from rhamnogalacturonan), xylogalacturonosidase, and xylogalacturonase ((EC 3.2.1.-) hydrolyzes xylogalacturonan (xga), a galacturonan backbone heavily substituted with xylose, and which is one important component of the hairy regions of pectin)
• Enzymes that degrade or modify lignin, including lignln peroxidases ((EC 1.11.1.14) oxidize lignin and lignin model compounds using hydrogen peroxide) , manganese-dependent peroxidases ((EC 1.11.1.13) oxidizes lignin and lignin model compounds using Mn2+ and hydrogen peroxide), versatile peroxidases ((EC 1.1 1.1.16) oxidizes lignin and lignin model compounds using an electron donor and hydrogen peroxide and combines the substrate-specificity characteristics of the two other ligninolytic peroxidases, EC 1.11.1.13, manganese peroxidase and EC 1.11.1.14, lignin peroxidase), and laccases ((EC 1.10.3.2) a group of multi-copper proteins of low specificity acting on both o- and p-quinols, and often acting also on lignin)
• Enzymes acting on chitin, including chitinase ((EC 3.2.1.14) which catalyzes random hydrolysis of N-acetyl-beta-D-glucosaminide 1 ,4-beta- linkages in chitin and chitodextrins) and beta-N-acetylhexosaminidase ((EC 3.2.1.52) which hydrolyzes terminal non-reducing N-acetyl-D- hexosamine residues in N-acetyl-beta-D-hexosaminides).
The invention also relates to vectors comprising a polynucleotide sequence according to the invention, as well as primers, probes and fragments that may be used to amplify or detect the DNA according to the invention.
In a further preferred embodiment, a vector is provided wherein the polynucleotide sequence according to the invention is functionally linked with at least one regulatory sequence suitable for expression of the encoded amino acid sequence in a suitable host cell, such as a filamentous fungus, for example Aspergillus. The invention also provides methods for preparing polynucleotides and vectors according to the invention.
The invention also relates to recombinantiy produced host cells that contain heterologous or homologous polynucleotides according to the invention.
In another embodiment, the invention provides recombinant host cells wherein the expression of an enzyme according to the invention is significantly increased or wherein the activity of the enzyme is increased.
In another embodiment the invention provides for a recombinantly produced host cell that contains heterologous or homologous DNA according to the invention and wherein the cell is capable of producing a functional enzyme according to the invention, preferably a cell capable of over-expressing the enzyme according to the invention, for example an Aspergillus niger strain comprising an increased copy number of a gene according to the invention.
In yet another aspect of the invention, a purified polypeptide is provided. The polypeptides according to the invention include the polypeptides encoded by the polynucleotides according to the invention. Especially preferred are polypeptides according to any one of SEQ ID Nos: 114, 162, 231 , 282, 306, 315, 324, 357, 372, 393, 417, 504, 582, and 771.
Fusion proteins comprising a polypeptide according to the invention are also within the scope of the invention. The invention also provides methods of making the polypeptides according to the invention.
The invention also relates to the use of the enzyme according to the invention in any industrial process as described herein.
Brief description of the drawings
Fig. 1 illustrates the structure of pGBFIN-49;
Fig. 2 illustrates the effect of a set of Talaromyces thermophilus proteins spiked on TEC-210 using hWS substrate;
Fig. 3 illustrates the effect of a set of Talaromyces thermophilus proteins spiked on 4E mix using hWS substrate;
Fig. 4 illustrates the effect of a set of Talaromyces thermophilus proteins spiked on TEC-210 using hWS substrate;
Fig. 5 illustrates the effect of a set of Talaromyces thermophilus proteins spiked on 4E mix using hWS substrate;
Fig. 6 illustrates the effect of a set of Talaromyces thermophilus proteins spiked on TEC-210 using hWS substrate;
Fig. 7 illustrates the effect of a set of Talaromyces thermophilus proteins spiked on 4E mix using hWS substrate;
Fig. 8 illustrates the effect of a set of Talaromyces thermophilus proteins spiked on TEC-210 using aCS substrate;
Fig. 9 illustrates the effect of a set of Talaromyces thermophilus proteins spiked on 4E mix using aCS substrate;
Fig. 10 illustrates the effect of a set of Talaromyces thermophilus proteins spiked on TEC-210 using aCS substrate;
Fig. 1 1 illustrates the effect of a set of Talaromyces thermophilus proteins spiked on 4E mix using aCS substrate;
Fig. 12 illustrates the effect of a set of Talaromyces thermophilus proteins spiked on TEC-210 using aCS substrate;
Fig. 13 illustrates the effect of a set of Talaromyces thermophilus proteins spiked on 4E mix using aCS substrate;
Fig. 14 illustrates the effect of a set of Talaromyces thermophilus proteins spiked based on protein dosage on TEC-210 mix using aCS substrate;
Fig. 15 illustrates the effect of a set of Talaromyces thermophilus proteins spiked based on protein volume on TEC-210 mix using aCS substrate;
Fig. 16 illustrates the effect of a Talaromyces thermophilus GH61 protein spiked based on protein dosage on a 3E mix using aCS substrate;
Fig. 17 illustrates the effect of a Talaromyces thermophilus BG protein spiked based on protein dosage on a 3E mix using aCS substrate;
Fig. 18 illustrates the effect of a Talaromyces thermophilus GH61 protein spiked based on protein dosage on a 3E mix using aCS substrate at high DM; and
Fig. 19 illustrates the effect of a Talaromyces thermophilus BG protein spiked based on protein dosage on a 3E mix using aCS substrate at high DM
Detailed description of the invention
Polynucleotides
The present invention provides polynucleotides encoding enzymes, having amino acid sequences according to any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 111 , 1 14, 1 17, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144, or preferably according to any one of SEQ ID NOs:1 14, 162, 231 , 282, 306, 315, 324, 357, 372, 393, 417, 504, 582, and 771. The sequences of the genes were determined by sequencing cDNA clones, mRNA transcripts, or genomic DNA obtained from Talaromyces thermophilus NRRL 2155. The invention provides polynucleotide sequences comprising the genes encoding the enzymes listed in Table 21 as well as their coding sequences. Accordingly, the invention relates to an isolated polynucleotide comprising the nucleotide sequences according to any one of SEQ ID NOs: 1, 2, 4, 5, 7, 8, 10, 11, 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41, 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61, 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91, 92, 94, 95, 97, 98, 100, 101, 103, 104, 106, 107, 109, 110, 112, 113, 115, 116, 118, 119, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136, 137, 139, 140, 142, AND 143, or preferably a nucleotide sequence according to any one of SEQ ID Nos: 13, 14, 22, 23, 34, 35, 40, 41 , 43, 44, 46, 47, 49, 50, 61, 62, 64, 65, 73, 74, 76, 77, 91 , 92, 121 , 122, 139, AND 140.
In particular, the invention relates to an isolated polynucleotide hybridizable under stringent conditions, preferably under high stringent conditions, to the complement of the polynucleotide listed above. Advantageously, such isolated polynucleotide may be obtained from fungi, in particular from Talaromyces, preferably from Talaromyces thermophilus. More specifically, the invention relates to isolated polynucleotides having nucleotide sequences according to any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 0, 11 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71, 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91, 92, 94, 95, 97, 98, 100, 101, 103, 104, 106, 107, 109, 110, 112, 113, 115, 116, 118, 119, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136, 137, 139, 140, 142, AND 143, or preferably a nucleotide sequence according to any one of SEQ ID Nos: 13, 14, 22, 23, 34, 35, 40, 41 , 43, 44, 46, 47, 49, 50, 61 , 62, 64, 65, 73, 74, 76, 77, 91 , 92, 121 , 122, 139, AND 140.
As used herein, the terms "gene" and "recombinant gene" refer to nucleic acid molecules which may be isolated from chromosomal DNA, which include an open reading frame encoding a protein, e.g. Talaromyces thermophilus enzymes according to the present invention. A gene may include coding sequences, non- coding sequences, introns and regulatory sequences. Moreover, a gene refers to an isolated nucleic acid molecule as defined herein.
A nucleic acid molecule of the present invention, such as a nucleic acid molecule having the nucleotide sequences listed above can be isolated using standard molecular biology techniques and the sequence information provided herein. For example, using all or a portion of these nucleic acid sequences as hybridization probes, nucleic acid molecules according to the invention can be isolated using standard hybridization and cloning techniques (e. g., as described in Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual.2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989).
Moreover, a nucleic acid molecule encompassing all or a portion of any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 11 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 110, 112, 113, 115, 116, 118, 119, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136, 137, 139, 140, 142, AND 143 can be isolated by the polymerase chain reaction (PCR) using synthetic oligonucleotide primers designed based upon the sequence information contained in these sequences.
A nucleic acid of the invention can be amplified using cDNA, mRNA or alternatively, genomic DNA, as a template and appropriate oligonucleotide primers according to standard PCR amplification techniques. The nucleic acid so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis.
Furthermore, oligonucleotides corresponding to or hybridizable to nucleotide sequences according to the invention can be prepared by standard synthetic techniques, e.g., using an automated DNA synthesizer.
In a preferred embodiment, isolated nucleic acid molecules of the invention comprise the nucleotide sequences shown in any one of SEQ ID Nos: 2, 5, 8, 11 , 14, 17, 20, 23, 26, 29, 32, 35, 38, 41 , 44, 47, 50, 53, 56, 59, 62, 65, 68, 71 , 74, 77, 80, 83, 86, 89, 92, 95, 98, 101 , 104, 107, 1 10, 1 13, 116, 1 19, 122, 125, 128, 131 , 134,
137, 140, AND 143,
These sequences correspond to the coding regions of the Talaromyces thermophilus genes shown in Table 21. These DNA sequences encode the Talaromyces thermophilus polypeptides according to any one of SEQ ID Nos: 3, 6,
9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 111 , 1 14, 1 17, 120, 123, 126, 129, 132, 135,
138, 141 , AND 144.
These sequences correspond to the coding regions of the Talaromyces thermophilus genes shown in Table 21 . These DNA sequences encode the Talaromyces thermophilus polypeptides according to any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 111 , 1 14, 1 17, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144.
In another preferred embodiment, an isolated nucleic acid molecule of the invention comprises a nucleic acid molecule which is a reverse complement of the nucleotide sequences shown in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 11 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 1 10, 112, 113, 115, 116, 118, 119, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136, 137, 139, 140, 142, AND 143.
A nucleic acid molecule which is complementary to another nucleotide sequence is one which is sufficiently complementary to the other nucleotide sequence such that it can hybridize to the other nucleotide sequence thereby forming a stable duplex.
One aspect of the invention pertains to isolated nucleic acid molecules that encode a polypeptide of the invention or a functional equivalent thereof such as a biologically active fragment or domain, as well as nucleic acid molecules sufficient for use as hybridization probes to identify nucleic acid molecules encoding a polypeptide of the invention and fragments of such nucleic acid molecules suitable for use as PCR primers for the amplification or mutation of nucleic acid molecules.
An "isolated polynucleotide" or "isolated nucleic acid" is a DNA or RNA that is not immediately contiguous with both of the coding sequences with which it is immediately contiguous (one on the 5' end and one on the 3' end) in the naturally occurring genome of the organism from which it is derived. Thus, in one embodiment, an isolated nucleic acid includes some or all of the 5' non-coding (e.g., promoter) sequences that are immediately contiguous to the coding sequence. The term therefore includes, for example, a recombinant DNA that is incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g., a cDNA or a genomic DNA fragment produced by PCR or restriction endonuclease treatment) independent of other sequences. It also includes a recombinant DNA that is part of a hybrid gene encoding an additional polypeptide that is substantially free of cellular material, viral material, or culture medium (when produced by recombinant DNA techniques), or chemical precursors or other chemicals (when chemically synthesized). Moreover, an "isolated nucleic acid fragment" is a nucleic acid fragment that is not naturally occurring as a fragment and would not be found in the natural state.
As used herein, the terms "polynucleotide" or "nucleic acid molecule" are intended to include DNA molecules (e.g., cDNA or genomic DNA) and RNA molecules (e.g., imRNA) and analogs of the DNA or RNA generated using nucleotide analogs. The nucleic acid molecule can be single-stranded or double- stranded, but preferably is double-stranded DNA. The nucleic acid may be synthesized using oligonucleotide analogs or derivatives (e.g., inosine or phosphorothioate nucleotides). Such oligonucleotides can be used, for example, to prepare nucleic acids that have altered base-pairing abilities or increased resistance to nucleases.
Another embodiment of the invention provides an isolated nucleic acid molecule which is antisense to nucleic acid molecules shown in any one of SEQ
ID NOs: 1 , 2, 4, 5, 7, 8, 10, 11 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 110, 1 12, 113, 115, 116, 118, 119, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136, 137, 139, 140, 142, AND 143, e.g., the coding strand of these nucleic acid molecules. In a further embodiment, it is also provided an antisense molecule which hybridizes with at least 10 contiguous, 20 contiguous, 40 contiguous, more preferably 50 contiguous, 60 contiguous, at least 80 contiguous and more preferably 100 contiguous nucleotides to any sequences shown in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 11 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 110, 112, 113, 115, 116, 118, 119, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136, 137, 139, 140, 142, AND 143, e.g., the coding strands of a these molecules. Also included within the scope of the invention are the complement strands of the nucleic acid molecules described herein. Sequencing errors
The sequence information as provided herein should not be so narrowly construed as to require inclusion of erroneously identified bases. The specific sequences disclosed herein can be readily used to isolate the complete gene from filamentous fungi, in particular from Talaromyces thermophilus which in turn can easily be subjected to further sequence analyses thereby identifying sequencing errors.
Unless otherwise indicated, all nucleotide sequences determined by sequencing a DNA molecule herein were determined using an automated DNA sequencer and all amino acid sequences of polypeptides encoded by DNA molecules determined herein were predicted by translation of a DNA sequence determined as above. Therefore, as is known in the art for any DNA sequence determined by this automated approach, any nucleotide sequence determined herein may contain some errors. Nucleotide sequences determined by automation are typically at least about 90% identical, more typically at least about 95% to at least about 99.9% identical to the actual nucleotide sequence of the sequenced DNA molecule. The actual sequence can be more precisely determined by other approaches including manual DNA sequencing methods well known in the art. As is also known in the art, a single insertion or deletion in a determined nucleotide sequence compared to the actual sequence will cause a frame shift in translation of the nucleotide sequence such that the predicted amino acid sequence encoded by a determined nucleotide sequence will be completely different from the amino acid sequence actually encoded by the sequenced DNA molecule, beginning at the point of such an insertion or deletion.
The person skilled in the art is capable of identifying such erroneously identified bases and knows how to correct for such errors.
Nucleic acid fragments, probes and primers
Nucleic acid molecules according to the invention may comprise only a portion or a fragment of the nucleic acid sequences shown in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 11 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 1 10, 112, 113, 115, 116, 118, 119, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136, 137, 139, 140, 142, AND 143, for example a fragment which can be used as a probe or primer or a fragment encoding a portion of these genes. The nucleotide sequence determined from the cloning of the genes shown in Table 21 allows for the generation of probes and primers designed for use in identifying and/or cloning other family members, as well as homologues from other species. The probe/primer typically comprises substantially purified oligonucleotide which typically comprises a region of nucleotide sequence that hybridizes preferably under highly stringent conditions to at least about 12 or 15, preferably about 18 or 20, preferably about 22 or 25, more preferably about 30, 35, 40, 45, 50, 55, 60, 65, or 75 or more consecutive nucleotides of a nucleotide sequence shown in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 11 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 110, 112, 113, 115, 116, 118, 119, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136, 137, 139, 140, 142, AND 143.
Probes based on these nucleotide sequences can be used to detect transcripts or genomic sequences encoding the same or homologous proteins for instance in other organisms. In preferred embodiments, the probe further comprises a label group attached thereto, e.g., the label group can be a radioisotope, a fluorescent compound, an enzyme, or an enzyme cofactor. Such probes can also be used as part of a diagnostic test kit for identifying cells which express a protein encoded by the genes shown in Table 2 .
Identity & homology
The terms "homology" or "percent identity" are used interchangeably herein. For the purpose of this invention, it is defined here that in order to determine the percent identity of two amino acid sequences or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first amino acid or nucleic acid sequence for optimal alignment with a second amino or nucleic acid sequence). The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity = number of identical positions/total number of positions (i.e. overlapping positions) x 100). Preferably, the two sequences are the same length.
The skilled person will be aware of the fact that several different computer programs are available to determine the homology between two sequences. For instance, a comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. In a preferred embodiment, the percent identity between two amino acid sequences is determined using the Needleman and Wunsch (J. Mol. Biol. (48): 444-453 (1970)) algorithm which has been incorporated into the GAP program in the Accelrys GCG software package (available at http://www. accelrys .com/prod ucts/qcq/) , using either a Blossom 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1 , 2, 3, 4, 5, or 6. The skilled person will appreciate that all these different parameters will yield slightly different results but that the overall percentage identity of two sequences is not significantly altered when using different algorithms.
In yet another embodiment, the percent identity between two nucleotide sequences is determined using the GAP program in the Accelrys GCG software package (available at http://www.accelrys.com/products/qcg/), using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1 , 2, 3, 4, 5, or 6. In another embodiment, the percent identity two amino acid or nucleotide sequence is determined using the algorithm of E. Meyers and W. Miller (CABIOS, 4:11-17 (1989) which has been incorporated into the ALIGN program (version 2.0) (available at the ALIGN Query using sequence data of the Genestream server IGH Montpellier France http://veqa.iqh.cnrs.fr/bin/aliqn- guess.cgi) using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.
The nucleic acid and protein sequences of the present invention can further be used as a "query sequence" to perform a search against public databases to, for example, identify other family members or related sequences. Such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403—10. BLAST nucleotide searches can be performed with the NBLAST program, score = 100, word length = 12 to obtain nucleotide sequences homologous to nucleic acid molecules of the invention. BLAST protein searches can be performed with the XBLAST program, score = 50, word length = 3 to obtain amino acid sequences homologous to protein molecules of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25(17): 3389-3402. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. See the homepage of the National Center for Biotechnology Information at http://www.ncbi.nlm.nih.gov/.
Hybridization
As used herein, the term "hybridizing" is intended to describe conditions for hybridization and washing under which nucleotide sequences at least about 60%, at least about 70%, at least about 80%, more preferably at least about 85%, even more preferably at least about 90%, more preferably at least 95%, more preferably at least 98% or more preferably at least 99% homologous to each other typically remain hybridized to each other.
A preferred, non-limiting example of such hybridization conditions are hybridization in 6X sodium chloride/sodium citrate (SSC) at about 45 °C, followed by one or more washes in 1 X SSC, 0.1% SDS at 50 °C, preferably at 55 °C, preferably at 60 °C and even more preferably at 65 °C.
Highly stringent conditions include, for example, hybridizing at 68 °C in 5x
SSC/5x Denhardt's solution / 1.0% SDS and washing in 0.2x SSC/0.1 % SDS at room temperature. Alternatively, washing may be performed at 42 °C.
The skilled artisan will know which conditions to apply for stringent and highly stringent hybridization conditions. Additional guidance regarding such conditions is readily available in the art, for example, in Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, N.Y.; and Ausubel et al. (eds.), 1995, Current Protocols in Molecular Biology, (John Wiley & Sons, N.Y.).
Of course, a polynucleotide which hybridizes only to a poly A sequence (such as the 3' terminal poly(A) tract of mRNAs), or to a complementary stretch of T (or U) residues, would not be included in a polynucleotide of the invention used to specifically hybridize to a portion of a nucleic acid of the invention, since such a polynucleotide would hybridize to any nucleic acid molecule containing a poly (A) stretch or the complement thereof (e.g., practically any double-stranded cDNA clone). Obtaining full length DNA from other organisms
In a typical approach, cDNA libraries constructed from other organisms, e.g. brown rot fungi, in particular from the micro-organism family Talaromyces can be screened.
For example, Talaromyces strains can be screened for homologous polynucleotides shown in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 11 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 110, 1 12, 113, 115, 116, 118, 119, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136, 137, 139, 140, 142, AND 143, by Northern blot analysis. Upon detection of transcripts homologous to polynucleotides according to the invention, cDNA libraries can be constructed from RNA isolated from the appropriate strain, utilizing standard techniques well known to those of skill in the art. Alternatively, a total genomic DNA library can be screened using a probe hybridizable to a polynucleotide shown above.
Homologous gene sequences can be isolated, for example, by performing PCR using two degenerate oligonucleotide primer pools designed on the basis of nucleotide sequences as taught herein.
The template for the reaction can be cDNA obtained by reverse transcription of mRNA prepared from strains known or suspected to express a polynucleotide according to the invention. The PCR product can be subcloned and sequenced to ensure that the amplified sequences represent the sequences of a new nucleic acid sequence corresponding to those shown in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 1 1 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 1 10, 1 12, 113, 115, 116, 1 18, 119, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136, 137, 139, 140, 142, AND 143.
The PCR fragment can then be used to isolate a full-length cDNA clone by a variety of known methods. For example, the amplified fragment can be labelled and used to screen a bacteriophage or cosmid cDNA library. Alternatively, the labelled fragment can be used to screen a genomic library.
PCR technology also can be used to isolate full-length cDNA sequences from other organisms. For example, RNA can be isolated, following standard procedures, from an appropriate cellular or tissue source. A reverse transcription reaction can be performed on the RNA using an oligonucleotide primer specific for the most 5' end of the amplified fragment for the priming of first strand synthesis.
The resulting RNA/DNA hybrid can then be "tailed" (e.g., with guanines) using a standard terminal transferase reaction, the hybrid can be digested with RNase H, and second strand synthesis can then be primed (e.g., with a poly-C primer). Thus, cDNA sequences upstream of the amplified fragment can easily be isolated. For a review of useful cloning strategies, see e.g. Sambrook et al., supra; and Ausubel et al., supra.
Vectors
Another aspect of the invention pertains to vectors, preferably expression vectors, containing a nucleic acid encoding a protein shown in Table 21 and whose sequence may be found in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 1 11 , 114, 117, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144.
As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid", which refers to a circular double stranded DNA loop into which additional DNA segments can be ligated. Another type of vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as "expression vectors". In general, expression vectors of utility in recombinant DNA techniques are often in the form of plasmids. The terms "plasmid" and "vector" can be used interchangeably herein as the plasmid is the most commonly used form of vector. However, the invention is intended to include such other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses), which serve equivalent functions.
The recombinant expression vectors of the invention comprise a nucleic acid of the invention in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vector includes one or more regulatory sequences, selected on the basis of the host cells to be used for expression, which is operatively linked to the nucleic acid sequence to be expressed. Within a recombinant expression vector, "operatively linked" is intended to mean that the nucleotide sequence of interest is linked to the regulatory sequence(s) in a manner which allows for expression of the nucleotide sequence (e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell). The term "regulatory sequence" is intended to include promoters, enhancers and other expression control elements (e.g., polyadenylation signal). Such regulatory sequences are described, for example, in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990). Regulatory sequences include those which direct constitutive expression of a nucleotide sequence in many types of host cells and those which direct expression of the nucleotide sequence only in a certain host cell (e.g. tissue-specific regulatory sequences). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, etc. The expression vectors of the invention can be introduced into host cells to thereby produce proteins or peptides, encoded by nucleic acids as described herein (e.g. proteins whose sequences are shown in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 111 , 114, 117, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144, mutant forms of these proteins, fragments, variants or functional equivalents thereof, fusion proteins, etc.).
The recombinant expression vectors of the invention can be designed for expression of proteins whose sequences are shown in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 1 1 1 , 1 14, 117, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144, in prokaryotic or eukaryotic cells. For example, these proteins can be expressed in bacterial cells such as £ coli, insect cells (using baculovirus expression vectors) yeast cells or mammalian cells. Suitable host cells are discussed further in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990). Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example using 11 promoter regulatory sequences and T7 polymerase.
Expression vectors useful in the present invention include chromosomal-, episomal- and virus-derived vectors e.g., vectors derived from bacterial plasmids, bacteriophage, yeast episome, yeast chromosomal elements, viruses such as baculoviruses, papova viruses, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors derived from combinations thereof, such as those derived from plasmid and bacteriophage genetic elements, such as cosmids and phagemids.
The DNA insert should be operatively linked to an appropriate promoter, such as the phage lambda PL promoter, the E. coli lac, trp and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs, to name a few. Other suitable promoters will be known to the skilled person. In a specific embodiment, promoters are preferred that are capable of directing a high expression level of lignocellulose active proteins from fungi. Such promoters are known in the art. The expression constructs may contain sites for transcription initiation, termination, and, in the transcribed region, a ribosome binding site for translation. The coding portion of the mature transcripts expressed by the constructs will include a translation initiating AUG at the beginning and a termination codon appropriately positioned at the end of the polypeptide to be translated.
Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. As used herein, the terms "transformation" and "transfection" are intended to refer to a variety of art- recognized techniques for introducing foreign nucleic acid (e.g., DNA) into a host cell, including calcium phosphate or calcium chloride co-precipitation, DEAE- dextran-mediated transfection, transduction, infection, lipofection, cationic lipid- mediated transfection or electroporation. Suitable methods for transforming or transfecting host cells can be found in Sambrook, et al. (Molecular Cloning: A Laboratory Manual, 2"ded. Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989), Davis et al., Basic Methods in Molecular Biology (1986) and other laboratory manuals.
For stable transfection of mammalian cells, it is known that, depending upon the expression vector and transfection technique used, only a small fraction of cells may integrate the foreign DNA into their genome. In order to identify and select these integrants, a gene that encodes a selectable marker (e.g., resistance to antibiotics) is generally introduced into the host cells along with the gene of interest. Preferred selectable markers include those which confer resistance to drugs, such as G418, hygromycin and methatrexate. Nucleic acid encoding a selectable marker can be introduced into a host cell on the same vector as those encoding proteins whose sequences are shown in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 111 , 114, 117, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144 can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g. cells that have incorporated the selectable marker gene will survive, while the other cells die).
Expression of proteins in prokaryotes is often carried out in E. coli with vectors containing constitutive or inducible promoters directing the expression of either fusion or non-fusion proteins. Fusion vectors add a number of amino acids to a protein encoded therein, e.g. to the amino terminus of the recombinant protein. Such fusion vectors typically serve three purposes: 1 ) to increase expression of recombinant protein; 2) to increase the solubility of the recombinant protein; and 3) to aid in the purification of the recombinant protein by acting as a ligand in affinity purification. Often, in fusion expression vectors, a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant protein to enable separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein.
As indicated, the expression vectors will preferably contain selectable markers. Such markers include dihydrofolate reductase or neomycin resistance for eukaryotic cell culture and tetracyline or ampicillin resistance for culturing in E. coli and other bacteria. Representative examples of appropriate host include bacterial cells, such as E. coli, Streptomyces Salmonella typhimurium and certain Bacillus species; fungal cells such as Aspergillus species, for example A. niger, A. oryzae and A. nidulans, yeast cells such as Kluyveromyces, for example K. lactis and/or Pichia, for example P. pastoris; insect cells such as Drosophila S2 and Spodoptera Sf9; animal cells such as CHO, COS and Bowes melanoma; and plant cells. Appropriate culture mediums and conditions for the above-described host cells are known in the art.
Vectors preferred for use in bacteria are for example disclosed in WO-A1 - 2004/074468, which are hereby enclosed by reference. Other suitable vectors will be readily apparent to the skilled artisan.
Known bacterial promoters suitable for use in the present invention include the promoters disclosed in WO-A 1-2004/074468, which are hereby enclosed by reference.
Transcription of the DNA encoding the polypeptides of the present invention by higher eukaryotes may be increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp that act to increase transcriptional activity of a promoter in a given host cell-type. Examples of enhancers include the SV40 enhancer, which is located on the late side of the replication origin at bp 100 to 270, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
For secretion of the translated protein into the lumen of the endoplasmic reticulum, into the periplasmic space or into the extracellular environment, appropriate secretion signal may be incorporated into the expressed polypeptide.
The signals may be endogenous to the polypeptide or they may be heterologous signals.
The polypeptide whose sequences are shown in any one of SEQ ID Nos: 114, 162, 231 , 282, 306, 3 5, 324, 357, 372, 393, 417, 504, 582, and 771 may be expressed in a modified form, such as a fusion protein, and may include not only secretion signals but also additional heterologous functional regions. Thus, for instance, a region of additional amino acids, particularly charged amino acids, may be added to the N-terminus of the polypeptide to improve stability and persistence in the host cell, during purification or during subsequent handling and storage. Also, peptide moieties may be added to the polypeptide to facilitate purification.
Polypeptides according to the invention
The invention provides isolated polypeptides having the amino acid sequences shown in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 111 , 114, 117, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144 alone or in an appropriate host. Also, a peptide or polypeptide comprising a functional equivalent of the above polypeptides is comprised within the present invention. The above polypeptides are collectively comprised in the term "polypeptides according to the invention"
The terms "peptide" and "oligopeptide" are considered synonymous (as is commonly recognized) and each term can be used interchangeably as the context required to indicate a chain of at least two amino acids coupled by peptidyl linkages. The word "polypeptide" is used herein for chains containing more than seven amino acid residues. All oligopeptide and polypeptide formulas or sequences herein are written from left to right and in the direction from amino terminus to carboxyl terminus. The one-letter code of amino acids used herein is commonly known in the art and can be found in Sambrook, et al. (Molecular Cloning: A Laboratory Manual, 2nd, ed. Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989). Sequence Listings programs can convert easily this one-letter code of amino acids sequence into a three-letter code.
By "isolated" polypeptide or protein is intended a polypeptide or protein removed from its native environment. For example, recombinantly produced polypeptides and proteins expressed in host cells are considered isolated for the purpose of the invention as are native or recombinant polypeptides which have been substantially purified by any suitable technique such as, for example, the single-step purification method disclosed in Smith and Johnson, Gene 67:31-40 (1988).
The proteins whose sequences are shown in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 111 , 1 14, 117, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144 according to the invention can be recovered and purified from recombinant cell cultures by methods known in the art. Most preferably, high performance liquid chromatography ("HPLC") is employed for purification.
Polypeptides of the present invention include naturally purified products, products of chemical synthetic procedures, and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher plant, insect and mammalian cells. Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated. In addition, polypeptides of the invention may also include an initial modified methionine residue, in some cases as a result of host-mediated processes. Protein fragments
The invention also features biologically active fragments of the polypeptides according to the invention.
Biologically active fragments of a polypeptide of the invention include polypeptides comprising amino acid sequences sufficiently identical to or derived from the amino acid sequences shown in any one of SEQ ID Nos: 3, 6, 9, 12, 15,
18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 1 1 1 , 114, 117, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144, which include fewer amino acids than the full length protein but which exhibit at least one biological activity of the corresponding full-length protein. Typically, biologically active fragments comprise a domain or motif with at least one activity of the full-length protein. A biologically active fragment of a protein of the invention can be a polypeptide which is, for example, 10, 25, 50, 100 or more amino acids in length. Moreover, other biologically active portions, in which other regions of the protein are deleted, can be prepared by recombinant techniques and evaluated for one or more of the biological activities of the native form of a polypeptide of the invention.
The invention also features nucleic acid fragments which encode the above biologically active fragments of the proteins whose sequences are shown in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 111 , 114, 117, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144.
Fusion proteins
The proteins of the present invention or functional equivalents thereof, e.g., biologically active portions thereof, can be operatively linked to unrelated polypeptides (e.g., heterologous amino acid sequences) to form fusion proteins. "Unrelated polypeptides" refer to polypeptides having amino acid sequences corresponding to proteins which are not substantially homologous to the proteins whose sequences are shown in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 1 11 , 114, 1 17, 120, 123, 126, 129, 132, 135, 138, 141, AND 144. Such "unrelated polypeptides" can be derived from the same or a different organism. Within a fusion protein the polypeptide derived from the sequences shown in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 11 1 , 114, 117, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144 can correspond to all or a biologically active fragment of a these proteins. In a preferred embodiment, a fusion protein comprises at least two biologically active portions of proteins whose sequences are shown above. Within the fusion protein, the term "operatively linked" is intended to indicate that the polypeptide whose sequence is shown above, and the unrelated polypeptide are fused in-frame to each other. The unrelated polypeptide can be fused to the N-terminus or C-terminus of the polypeptide whose sequence is one of those shown above.
For example, in one embodiment, the fusion protein is a fusion protein in which the protein whose sequence as shown above is fused to the C-terminus of the GST sequences. Such fusion proteins can facilitate the purification of recombinant protein from Talaromyces thermophilus. In another embodiment, the fusion protein is a protein whose sequence is one of those shown above, containing a heterologous signal sequence at its N-terminus. In certain host cells (e.g., mammalian and yeast host cells), expression and/or secretion of proteins whose sequences are shown in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 111 , 114, 1 17, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144 can be increased through use of a heterologous signal sequence.
In another example, the gp67 secretory sequence of the baculovirus envelope protein can be used as a heterologous signal sequence {Current Protocols in Molecular Biology, Ausubel et al., eds., John Wiley & Sons, 1992). Other examples of eukaryotic heterologous signal sequences include the secretory sequences of melittin and human placental alkaline phosphatase (Stratagene; La Jolla, California). In yet another example, useful prokaryotic heterologous signal sequences include the phoA secretory signal (Sambrook et al., supra) and the protein A secretory signal (Pharmacia Biotech; Piscataway, New Jersey).
A signal sequence can be used to facilitate secretion and isolation of a protein or polypeptide of the invention. Signal sequences are typically characterized by a core of hydrophobic amino acids, which are generally cleaved from the mature protein during secretion in one or more cleavage events. Such signal peptides contain processing sites that allow cleavage of the signal sequence from the mature proteins as they pass through the secretory pathway. The signal sequence directs secretion of the protein, such as from a eukaryotic host into which the expression vector is transformed, and the signal sequence is subsequently or concurrently cleaved. The protein can then be readily purified from the extracellular medium by known methods. Alternatively, the signal sequence can be linked to the protein of interest using a sequence, which facilitates purification, such as with a GST domain. Thus, for instance, the sequence encoding the polypeptide may be fused to a marker sequence, such as a sequence encoding a peptide, which facilitates purification of the fused polypeptide. In certain preferred embodiments of this aspect of the invention, the marker sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector (Qiagen, Inc.), among others, many of which are commercially available. As described in Geniz ef al, Proc. Natl. Acad. Sci. USA 86:821-824 (1989), for instance, hexa-histidine provides for convenient purification of the fusion protein. The HA tag is another peptide useful for purification which corresponds to an epitope derived of influenza hemaglutinin protein, which has been described by Wilson er a/., Cell 37:767 (1984), for instance.
Preferably, a fusion protein of the invention (corresponding to one of those whose sequences shown above) is produced by standard recombinant DNA techniques. For example, DNA fragments coding for the different polypeptide sequences are ligated together in-frame in accordance with conventional techniques, for example by employing blunt-ended or stagger-ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and enzymatic ligation. In another embodiment, the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR amplification of gene fragments can be carried out using anchor primers, which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed and reamplified to generate a chimeric gene sequence (see, for example, Current Protocols in Molecular Biology, eds. Ausubel ef al. John Wiley & Sons: 1992). Moreover, many expression vectors are commercially available that already encode a fusion moiety (e.g., a GST polypeptide). A nucleic acid encoding one of the proteins shown in Table 21 can be cloned into such an expression vector such that the fusion moiety is linked in-frame to the this protein. Functional equivalents
The terms "functional equivalents" and "functional variants" are used interchangeably herein. Functional equivalents of DNA whose sequences are shown in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 11 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91, 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 110, 112, 113, 115, 116, 118, 119, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136, 137, 139, 140, 142, AND 143, are isolated DNA fragments that encode a polypeptide that exhibits a particular function of the corresponding Talaromyces thermophilus enzyme or protein as shown in any one Of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 111 , 114, 117, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144. A functional equivalent of a polypeptide according to the invention is a polypeptide that exhibits at least one function of a Talaromyces thermophilus enzyme or protein as defined herein. Functional equivalents therefore also encompass biologically active fragments.
Functional protein or polypeptide equivalents may contain only conservative substitutions of one or more amino acids of proteins whose sequences are shown in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 111 , 114, 117, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144 or substitutions, insertions or deletions of non-essential amino acids. Accordingly, a non-essential amino acid is a residue that can be altered in proteins whose sequences are shown above, without substantially altering the biological function. For example, amino acid residues that are conserved among the proteins of the present invention are predicted to be particularly unamenable to alteration. Furthermore, amino acids conserved among the proteins according to the present invention (shown in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 111 , 1 14, 117, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144) and other enzymes are not likely to be amenable to alteration.
The term "conservative substitution" is intended to indicate a substitution in which the amino acid residue is replaced with an amino acid residue having a similar side chain. These families are known in the art and include amino acids with basic side chains (e.g. lysine, arginine and hystidine), acidic side chains (e.g. aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagines, glutamine, serine, threonine, tyrosine, cysteine), non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine tryptophan, histidine).
Functional nucleic acid equivalents may typically contain silent mutations or mutations that do not alter the biological function of encoded polypeptide. Accordingly, the invention provides nucleic acid molecules encoding the proteins whose sequences are shown above, that contain changes in amino acid residues that are not essential for a particular biological activity. Such proteins differ in amino acid sequence from those shown yet retain at least one biological activity thereof. In one embodiment the isolated nucleic acid molecule comprises a nucleotide sequence encoding a protein, wherein the protein comprises a substantially homologous amino acid sequence of at least about 72%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more homologous to the amino acid sequences shown above.
For example, guidance concerning how to make phenotypically silent amino acid substitutions is provided in Bowie, J.U. et al., Science 247:1306-1310 (1990) and the references cited therein. As the authors state, these studies have revealed that proteins are surprisingly tolerant of amino acid substitutions. The authors further indicate which changes are likely to be permissive at a certain position of the protein.
An isolated nucleic acid molecule encoding a protein homologous to a protein whose sequence is shown in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 111 , 114, 117, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144, can be created by introducing one or more nucleotide substitutions, additions or deletions into the coding nucleotide sequences above such that one or more amino acid substitutions, deletions or insertions are introduced into the encoded protein. Such mutations may be introduced by standard techniques, such as site- directed mutagenesis and PCR-mediated mutagenesis.
The term "functional equivalents" also encompasses orthologues of the Talaromyces thermophilus proteins. Orthologues of the Talaromyces thermophilus proteins are proteins that can be isolated from other strains or species and possess a similar or identical biological activity. Such orthologues can readily be identified as comprising an amino acid sequence that is substantially homologous to one of the sequences shown in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 111 , 114, 117, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144.
As defined herein, the term "substantially homologous" refers to a first amino acid or nucleotide sequence which contains a sufficient or minimum number of identical or equivalent (e.g., with similar side chain) amino acids or nucleotides to a second amino acid or nucleotide sequence such that the first and the second amino acid or nucleotide sequences have a common domain. For example, amino acid or nucleotide sequences which contain a common domain having about 72%, preferably 75%, more preferably 80%, even more preferably 85%, 90%, 95%, 96%, 97%, 98% or 99% identity or more are defined herein as sufficiently identical.
Also, nucleic acids encoding other family members related to those proteins whose sequences are shown above, which thus have a nucleotide sequences that differ from sequences shown in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 1 1 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 110, 112, 113, 15, 116, 118, 119, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136,
137, 139, 140, 142, AND 143, are within the scope of the invention. Moreover, nucleic acids encoding proteins corresponding to those whose sequences are shown above from different species which can have a nucleotide sequences which differ from those shown in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 1 1 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 1 10, 112, 113, 1 15, 116, 1 18, 1 19, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136, 137, 139, 140, 142, AND 143, are within the scope of the invention.
Nucleic acid molecules corresponding to variants (e.g. natural allelic variants) and homologues of the DNA of the invention (shown in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 11 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 1 10, 1 12, 113, 115, 116, 118, 119, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136, 137, 139, 140, 142, AND 143) can be isolated based on their homology to the nucleic acids disclosed herein using the cDNAs disclosed herein or a suitable fragment thereof, as a hybridization probe according to standard hybridization techniques preferably under highly stringent hybridization conditions.
In addition to naturally occurring allelic variants of the sequences shown in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 11 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 110, 1 12, 113, 115, 116, 1 18, 119, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136, 137, 139, 140, 142, AND 143, the skilled person will recognise that changes can be introduced by mutation into those nucleotide sequences thereby leading to changes in the amino acid sequences of the corresponding proteins (whose sequences are shown in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 111 , 114, 117, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144, respectively without substantially altering the functions of the corresponding proteins.
In another aspect of the invention, improved proteins derived from the sequences shown above are provided. Improved proteins are proteins wherein at least one biological activity is improved. Such proteins may be obtained by randomly introducing mutations along all or part of the coding sequences of the polypeptides shown in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 111 , 114, 1 17, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144 such as by saturation mutagenesis, and the resulting mutants can be expressed recombinantly and screened for biological activity. For instance, the art provides for standard assays for measuring the enzymatic activity of the resulting protein and thus improved proteins may easily be selected.
In a preferred embodiment the protein has an amino acid sequence according to a sequence shown in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 ,
24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 111 , 114, 117, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144. In another embodiment, the polypeptide is substantially homologous to the amino acid sequence according to a sequence shown above and retains at least one biological activity of a polypeptide according to the sequence shown above, yet differs in amino acid sequence due to natural variation or mutagenesis as described above.
In a further preferred embodiment, the protein has an amino acid sequence encoded by an isolated nucleic acid fragment capable of hybridizing to a nucleic acid according to the sequences shown in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 11 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 110, 1 12, 1 13, 115, 116, 118, 119, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136, 137, 139, 140, 142, AND 143, preferably under highly stringent hybridization conditions.
Accordingly, the protein is preferably a protein which comprises an amino acid sequence at least about 72%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more homologous to an amino acid sequence shown in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 111 , 114, 117, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144 and retains at least one functional activity of the polypeptide according to the sequences shown above.
Functional equivalents of a protein according to the invention can also be identified e.g. by screening combinatorial libraries of mutants, e.g. truncation mutants, of the protein of the invention for activity. In one embodiment, a variegated library of variants is generated by combinatorial mutagenesis at the nucleic acid level. A variegated library of variants can be produced by, for example, enzymatically ligating a mixture of synthetic oligonucleotides into gene sequences such that a degenerate set of potential protein sequences is expressible as individual polypeptides, or alternatively, as a set of larger fusion proteins (e.g. for phage display). There are a variety of methods that can be used to produce libraries of potential variants of the polypeptides of the invention from a degenerate oligonucleotide sequence. Methods for synthesizing degenerate oligonucleotides are known in the art (see, e.g., Narang (1983) Tetrahedron 39:3; Itakura et al. (1984) Annu. Rev. Biochem. 53:323; Itakura et al. (1984) Science 198:1056; Ike et al. (1983) Nucleic Acid Res. 11 :477).
In addition, libraries of fragments of the coding sequence of a polypeptide of the invention can be used to generate a variegated population of polypeptides for screening a subsequent selection of variants. For example, a library of coding sequence fragments can be generated by treating a double stranded PCR fragment of the coding sequence of interest with a nuclease under conditions wherein nicking occurs only about once per molecule, denaturing the double stranded DNA, renaturing the DNA to form double stranded DNA which can include sense/antisense pairs from different nicked products, removing single stranded portions from reformed duplexes by treatment with S1 nuclease, and ligating the resulting fragment library into an expression vector. By this method, an expression library can be derived which encodes N-terminal and internal fragments of various sizes of the protein of interest.
Several techniques are known in the art for screening gene products of combinatorial libraries made by point mutations of truncation, and for screening cDNA libraries for gene products having a selected property. The most widely used techniques, which are amenable to high through-put analysis, for screening large gene libraries typically include cloning the gene library into replicable expression vectors, transforming appropriate cells with the resulting library of vectors, and expressing the combinatorial genes under conditions in which detection of a desired activity facilitates isolation of the vector encoding the gene whose product was detected. Recursive ensemble mutagenesis (REM), a technique which enhances the frequency of functional mutants in the libraries, can be used in combination with the screening assays to identify variants of a protein of the invention (Arkin and Yourvan (1992) Proc. Natl. Acad. Sci. USA 89:781 1 - 7815; Delgrave et al. (1993) Protein Engineering 6(3): 327-331 ).
In addition to the gene sequences shown in any one of SEQ ID NOs: 1 , 2,
4, 5, 7, 8, 10, 11 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 1 10, 112, 1 13, 115, 116, 118, 119, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136, 137, 139, 140, 142, AND 143, it will be apparent for the person skilled in the art that DNA sequence polymorphisms may exist within a given population, which may lead to changes in the amino acid sequence of the protein sequences as shown herein. Such genetic polymorphisms may exist in cells from different populations or within a population due to natural allelic variation. Allelic variants may also include functional equivalents.
Fragments of a polynucleotide according to the invention may also comprise polynucleotides not encoding functional polypeptides. Such polynucleotides may function as probes or primers for a PCR reaction.
Nucleic acids according to the invention irrespective of whether they encode functional or non-functional polypeptides can be used as hybridization probes or polymerase chain reaction (PCR) primers. Uses of the nucleic acid molecules of the present invention that do not encode a polypeptide having an activity shown in Table 21 , inter alias, (1 ) isolating the gene encoding the protein, or allelic variants thereof from a cDNA library e.g. from an organism other than Talaromyces thermophilus; (2) in situ hybridization (e.g. FISH) to metaphase chromosomal spreads to provide precise chromosomal location of the gene as described in Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988); (3) Northern blot analysis for detecting expression of mRNA corresponding to one of those shown in any one of SEQ ID NOs: 1, 2, 4, 5, 7, 8, 10, 1 1, 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31, 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 1 10, 112, 113, 115, 116, 1 18, 1 19, 121 , 122, 124, 125, 127, 128, 130, 131, 133, 134, 136, 137, 139, 140, 142, AND 143, in specific tissues and/or cells and (4) probes and primers that can be used as a diagnostic tool to analyse the presence of a nucleic acid hybridizable to the a sequence shown above, probe in a given biological (e.g. tissue) sample.
Also encompassed by the invention is a method of obtaining a functional equivalent of a gene corresponding to one of those shown in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 1 1 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91, 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 110, 1 12, 1 13, 115, 116, 118, 119, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136, 137, 139, 140, 142, AND 143. Such a method entails obtaining a labelled probe that includes an isolated nucleic acid which encodes all or a portion of the protein sequence according to any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 11 1 , 114, 117, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144 and to Table 21 or a variant thereof; screening a nucleic acid fragment library with the labelled probe under conditions that allow hybridization of the probe to nucleic acid fragments in the library, thereby forming nucleic acid duplexes, and preparing a full-length gene sequence from the nucleic acid fragments in any labelled duplex to obtain a gene related to the gene shown in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 11 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 110, 112, 1 13, 1 15, 1 16, 1 18, 119, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136, 137, 139, 140, 142, AND 143.
In one embodiment, a nucleic acid of the invention is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more homologous to a nucleic acid sequence shown herein or to the reverse complement thereof.
Host cells
In another embodiment, the invention features cells, e.g., transformed host cells or recombinant host cells that contain a nucleic acid or vector encompassed by the invention. A "transformed cell" or "recombinant cell" is a cell into which (or into an ancestor of which) has been introduced, by means of recombinant DNA techniques, a nucleic acid or vector according to the invention. Both prokaryotic and eukaryotic cells are included, e.g., bacteria, fungi, yeast, and the like, especially preferred are cells from filamentous fungi, in particular Talaromyces thermophilus. A cell of the invention is typically not a wild-type Talaromyces thermophilus or a naturally-occurring cell. They include, but are not limited to: fungi such as Aspergillus niger, Trichoderma reesii, Myceliophthora thermophila or Talaromyces emersonii; yeasts such as Saccharomyces cerevisiae, Yarrowia lipolytica and Pichia pastoris; bacteria such as Escherichia coli and Bacillus sp.; and plants such as Nicotiana benthamiana, Nicotiana tabacum and Medicago sativa.
A nucleic acid molecule (or a nucleic acid molecule which is comprised within a vector) may be homologous or heterologous with respect to the cell into which it is introduced. In this context, a nucleic acid molecule is homologous to a cell if the nucleic acid molecule naturally occurs in that cell. A nucleic acid molecule is heterologous to a cell if the nucleic acid molecule does not naturally occur in that cell. Accordingly, the invention provides a cell which comprises a heterologous or a homologous sequence corresponding to one of those shown in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 11 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 110, 112, 113, 115, 116, 118, 119, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136, 137, 139, 140, 142, AND 143.
A host cell can be chosen that modulates the expression of the inserted sequences, or modifies and processes the gene product in a specific, desired fashion. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products may facilitate optimal functioning of the protein.
Various host cells have characteristic and specific mechanisms for post- translational processing and modification of proteins and gene products. Appropriate cell lines or host systems familiar to those of skill in the art of molecular biology and/or microbiology can be chosen to ensure the desired and correct modification and processing of the foreign protein expressed. To this end, eukaryotic host cells that possess the cellular machinery for proper processing of the primary transcript, glycosylation, and phosphorylation of the gene product can be used. Such host cells are well known in the art.
Host cells also include, but are not limited to, mammalian cell lines such as CHO, VERO, BHK, HeLa, COS, MDCK, 293, 3T3, WI38, and choroid plexus cell lines.
If desired, a stably transfected cell line can produce the polypeptides according to the invention. A number of vectors suitable for stable transfection of mammalian cells are available to the public, methods for constructing such cell lines are also publicly known, e.g., in Ausubel et al. (supra).
Use of the Talaromyces thermophilus enzymes in industrial processes
The invention also relates to the use of the enzymes according to the invention in a selected number of industrial processes. Despite the long term experience obtained with these processes, the enzymes according to the invention feature a number of significant advantages over the enzymes currently used. Depending on the specific application, these advantages can include aspects such as lower production costs, higher specificity towards the substrate, greater synergies with existing enzymes, less antigenic effect, less undesirable side activities, higher yields when produced in a suitable microorganism, more suitable pH and temperature ranges, better properties of the final product, and food grade or kosher aspects.
The present invention also relates to methods for preparing a food product comprising incorporating into the food product an effective amount of an enzyme of the present invention. This improves one or more properties of the food product relative to a food product in which the polypeptide is not incorporated.
The phrase "incorporated into the food product" is defined herein as adding the enzyme according to the invention to the food product, any ingredient from which the food product is to be made, and/or any mixture of food ingredients from which the food product is to be made. In other words, the enzyme according to the invention may be added in any step of the food product preparation and may be added in one, two or more steps. The enzyme according to the invention is added to the ingredients of a food product which can then be treated by methods including cooking, boiling, drying, frying, steaming or baking as is known in the art.
The term "effective amount" is defined herein as an amount of the enzyme according to the invention that is sufficient for providing a measurable effect on at least one property of interest of the food product.
The term "improved property" is defined herein as any property of a food product which is improved by the action of an enzyme according to the invention relative to a food product in which the enzyme according to the invention is not incorporated. The improved property may be determined by comparison of a food product prepared with and without addition of a polypeptide of the present invention. Organoleptic qualities may be evaluated using procedures well established in the food industry, and may include, for example, the use of a panel of trained taste-testers.
The enzymes of the present invention may be in any form suitable for the use in question, e.g., in the form of a dry powder, agglomerated powder, or granulate, in particular a non-dusting granulate, liquid, in particular a stabilized liquid, or protected enzyme such as described in WO01/11974 and WO02/26044. Granulates and agglomerated powders may be prepared by conventional methods, e.g., by spraying the enzyme according to the invention onto a carrier in a fluid-bed granulator. The carrier may consist of particulate cores having a suitable particle size. The carrier may be soluble or insoluble, e.g., a salt (such as NaCI or sodium sulphate), sugar (such as sucrose or lactose), sugar alcohol (such as sorbitol), starch, rice, corn grits, or soy. The enzyme according to the invention and/or additional enzymes may be contained in slow-release formulations. Methods for preparing slow-release formulations are well known in the art. Adding nutritionally acceptable stabilizers such as sugar, sugar alcohol, or another polyol, and/or lactic acid or another organic acid according to established methods may for instance, stabilize liquid enzyme preparations.
The enzyme according to the invention may also be incorporated in yeast comprising compositions such as disclosed in EP-A-0619947, EP-A-0659344 and WO02/49441.
One or more additional enzymes may also be incorporated into the food product. The additional enzyme may be of any origin, including mammalian and plant, and preferably of microbial (bacterial, yeast or fungal) origin and may be obtained by techniques conventionally used in the art. Enzymes may conveniently be produced in microorganisms. Microbial enzymes are available from a variety of sources; Bacillus species are a common source of bacterial enzymes, whereas fungal enzymes are commonly produced in Aspergillus species.
Suitable additional enzymes include other starch degrading enzymes, xylanases, oxidizing enzymes, fatty material splitting enzymes, or protein- degrading, modifying or crosslinking enzymes.
Starch degrading enzymes are for instance endo-acting enzymes such as alpha-amylase, mattogenic amylase, puliulanase or other debranching enzymes and exo-acting enzymes that cleave off glucose (amyloglucosidase), maltose (beta- amylase), maltotriose, maltotetraose and higher oligosaccharides.
Suitable xylanases are for instance xylanases, pentosanases, hemicellulase, arabinofuranosidase, glucanase, cellulase, cellobiohydrolase, beta- glucosidase, and others.
Oxidizing enzymes are for instance glucose oxidase, hexose oxidase, pyranose oxidase, sulfhydryl oxidase, lipoxygenase, laccase, polyphenol oxidases and others.
Fatty material splitting enzymes are for instance triacylglycerol lipases, phospholipases (such as At, A2, B, C and D) and galactolipases.
Protein degrading, modifying or crosslinking enzymes are for instance endo-acting proteases (serine proteases, metalloproteases, aspartyl proteases, thiol proteases), exo-acting peptidases that cleave off one amino acid, or dipeptide, tripeptide etceteras from the N-terminal (aminopeptidases) or C- terminal (carboxypeptidases) ends of the polypeptide chain, asparagines or glutamine deamidating enzymes such as deamidase and peptidoglutaminase or crosslinking enzymes such as transglutaminase.
In a preferred embodiment, the additional enzyme may be an amylase, such as an alpha-amylase (can be useful for providing sugars fermentable by yeast) or beta-amylase, cyclodextrin glucanotransferase, peptidase, in particular, an exopeptidase (can be useful in flavour enhancement), transglutaminase, lipase (can be useful for the modification of lipids present in the food or food constituents), phospholipase, cellulase, hemicellulase, protein disulfide isomerase, peroxidase, laccase, or oxidase, e.g., an glucose oxidase, hexose oxidase, aldose oxidase, pyranose oxidase, lipoxygenase or L-amino acid oxidase..
When one or more additional enzyme activities are to be added in accordance with the methods of the present invention, these activities may be added separately or together with the polypeptide according to the invention.
In addition to the use of the enzymes according to the present invention in food applications, the present invention also relates to the use of the enzymes according to the present invention in other industrial applications.
The enzymes of the current invention may be used in new or improved methods for enzymatically degrading or converting plant cell wall polysaccharides from biomass into various useful products. In addition to cellulose and hemicellulose, plant cell walls contain associated pectins and lignins, the removal of which by enzymes of the current invention can improve accessibility to cellulases and hemicellulases, or which can themselves be converted to useful products.
Usually, biomass must be subjected to pre-treatment in order to make the cellulose more accessible and the enzymes of the current invention may also be used in improved methods for the processing of pretreated biomass. Pretreatment technologies may involve chemical, physical, or biological treatments. Examples of pre-treatment technologies include but are not limited to: steam explosion; ammonia; acid hydrolysis; alkaline hydrolysis; solvent extraction; crushing; milling; etc.
One example of a product produced from biomass is bioethanol. Bioethanol is usually produced by the fermentation of glucose to ethanoi by yeasts such as Saccharomyces cerevisiae: in addition to ethanoi, other chemicals may be synthesized starting from glucose. Ethanoi, today, is produced mostly from sugars or starches, obtained from sugar cane, fruits and grains. In contrast, cellulosic ethanol is obtained from cellulose, the main component of wood, straw and much of the plants. Sources of biomass for cellulosic ethanol production comprise agricultural residues (such as leftover crop materials from stalks, leaves, and husks of corn plants), forestry wastes (such as chips and sawdust from lumber mills, dead trees, and tree branches), energy crops (such as dedicated fast-growing trees and grasses such as switch grass), municipal solid waste (such as household garbage and paper products), food processing and other industrial wastes (such as black liquor, paper manufacturing by-product, etc.).
Plant biomass is a mixture of plant polysaccharides, including cellulose, hemicelluloses, and pectin, together with the structural polymer, lignin. Glucose is released from cellulose by the action of mixtures of enzymes, including: endoglucanases, exoglucanases (cellobiohydrolases 1 and 2) and beta- glucosidases. Efficient large-scale conversion of cellulosic materials by such mixtures requires the full complement of enzymes, and can be enhanced by the addition of enzymes that attack the other plant cell wall components (hemicelluloses, pectins, and lignins), as well as chemical linkages between these components. Hence enzymes of the current invention that are highly expressed, or have high specific activity, stability, or resistance to inhibitors would improve the efficiency of the process, and lower enzyme costs. It would be an advantage to the art to improve the degradation and conversion of plant cell wall polysaccharides by composing cellulase mixtures using cellulase enzymes with such properties. Furthermore, enzymes of the current invention that are able to function at extremes of pH and temperature are desirable, both since improved enzyme robustness decreases costs, and because enzymes that function at high temperature will allow high processing temperatures under high substrate consistency conditions that decrease viscosity and thus improve yields.
Glycoside hydrolases from family GH61 are known to stimulate the activity of cellulose cocktails on lignocellulosic substrates and are thus considered to exhibit cellulose-enhancing activity (P. V. Harris et al., Biochemistry 49, 3305 (2010)). They have no known enzymatic activities of their own. Enhancement of cellulase cocktail efficiency by GH61 proteins of the current invention would contribute to lowering the costs of cellulase enzymes used for the production of glucose from plant cell biomass, as described above.
Enzymatic hydrolysis of plant hemicellulose yields 5-carbon sugars that either may be fermented to ethanol by some species of yeast, or converted to 2012/050198
43
other types of chemical products. Enzymatic deconstruction of hemicellulose is also known to improve the accessibility of plant cell wall cellulose to cellulase enzymes for the production of glucose from lignocellulosic materials. Hemicellulase enzymes of the current invention that enhance glucose production from lignocellulose would find utility in the bioethanol industry and in other process that rely on glucose or pentose streams from lignocellulose.
Lignin is composed of methoxylated phenyl-propane units linked by ether linkages and carbon-carbon bonds. The chemical composition of lignin may, depending on species, include guaiacyl, 4-hydroxyphenyl, and syringyl groups. Enzymatic modification of lignin by the enzymes of the current invention can be used for the production of structural materials from plant biomass, or alternatively improve the accessibility of plant cellulose and hemicelluloses to cellulase enzymes for the release of glucose from biomass as described above. Enzymes that degrade the lignin component of lignocellulose include lignin peroxidases, manganese-dependent peroxidases, versatile peroxidases, and laccases (Vicuna, 2000, Molecular Biotechnology 14: 173-176; Broda et al., 1996, Molecular Microbiology 19: 923-932). These enzymes of the current invention may also in certain instances be active in the decolourization of industrial dyes, and thus useful for the treatment and detoxification of chemical wastes.
Pectin degrading enzymes of the current invention can also enhance the action of cellulases on plant biomass by improving the accessibility of cellulase to the cellulose component of lignocellulose.
The enzymes of the present invention may also be used in other applications for hydrolyzing non-starch polysaccharide (NSP).
One application is in the detergent industry for removal from laundry of carbohydrate-based stains. The textile industry uses various enzymes to improve the properties of its products. Such improvement relates to softness, quality of the finish, "stone-wash look" of denim, etc. Enzymes are used in detergents in order to improve its efficacy to remove most types of dirt. Enzymes have been used in textile processing since the early part of this century to remove starch-based sizing, but only in the past decade has serious attention been given to using enzymes for a wide range of textile applications. Enzymes are expected to have an even greater impact on effluent quality as more fibre preparation, pre-treatment and value-added finishing processes convert to biotreatment. In addition, enzymes are very effective catalysts even under mild conditions and do not require the high energy input often associated with chemical processes. The use of enzymes of the present invention finds utility in the detergent industry for removal from laundry of carbohydrate-based stains.
Feed enzymes have an important role to play in current farming systems. They can increase the digestibility of nutrients, leading to greater efficiency in the production of animal products such as meat and eggs. At the same time they can play a role in minimizing the environmental impact of increased animal production. Non-starch polysaccharides (NSP) can increase the viscosity of the digesta which can, in turn, decrease nutrient availability and animal performance.
Endoxylanases and phytases are the best-known feed-enzyme products.
Phytase enzymes hydrolyse phytic acid and release inorganic phosphate, thereby avoiding the need to add inorganic phosphates to the diet and reducing phosphorus excretion. Addition of xylanases to feed has also been shown to have positive effects on animal growth. Adding specific nutrients to feed improves animal digestion and thereby reduces feed costs. A lot of feed additives are being currently used and new concepts are continuously developed. Use of specific enzymes like non-starch carbohydrate degrading enzymes could breakdown the fibre releasing energy as well as increasing the protein digestibility due to better accessibility of the protein when the fibre gets broken down. In this way the feed cost could come down as well as the protein levels in the feed also could be reduced.
Non-starch polysaccharides (NSPs) are also present in virtually all feed ingredients of plant origin. NSPs are poorly utilized and can, when solubilized, exert adverse effects on digestion. Exogenous enzymes can contribute to a better utilization of these NSPs and as a consequence reduce any antinutritional effects. The hemicellulases and other polysaccharide-active enzymes of the present invention can be used for this purpose in cereal-based diets for poultry and, to a lesser extent, for pigs and other species.
The xylanases of the present invention can be used for prebleaching of kraft pulp. Xylanases have been found to be most effective for that purpose.
Xylanases attract increasing scientific and commercial attention due to applications in the pulp and paper industry for removal of hemicellulose from dissolving pulps or for enhancement of the bleachability of pulp and, thus, reduction of the use of environmentally harmful bleaching chemicals. A similar application of xylanases for pulp prebleaching is an already well-established technology and has greatly stimulated research on hemicellulases in the past decade. Although lignin-active peroxidases of the present invention may also be active in modification of lignin and hence have bleaching properties, such enzymes are generally less attractive for bleaching dues to the need to use and recycle expensive redox mediators.
Xylanases of the present invention can be used to pre-bleach pulp to reduce the amount of bleaching chemicals to obtain a given brightness. It is suggested that xylanase depolymerises xylan blocks and increases accessibility or helps liberation of residual lignin by releasing xylan-chromophore fragments. In addition to brownstock prior to bleaching, xylanases of the present invention can save on bleaching chemicals. The enzymes hydrolyze surface xylans and are able to break linkages between hemicellulose and lignin. Other hemicellulase active enzymes of the present invention which can break these linkages can function effectively in bleaching or pre-bleaching of pulp.
In addition, xylanases of the present invention can also be used in antibacterial formulation as well as in pharmaceutical products such as throat lozenges, toothpastes, and mouthwash.
Chitin is a -(1 ,4)-linked polymer of N-acetyl D-glucosamine (GlcNAc), found as a structural polysaccharide in fungal cell walls as well as in the exoskeleton of arthropods and the outer shell of crustaceans. Approximately 75% the total weight of shellfish is considered waste and a large proportion of the material making up the waste is chitin. Chitin degrading enzymes of the current invention are useful in the modification and degradation of chitin, allowing the production of chitin-derived material, such as chitooligosaccharides and N-acetyl D-glucosamine, from chitin waste; another use of chitinase enzymes as antifungal agents.
For the nomenclature of microorganisms generally applied and accepted nomenclature in the art is used herein. Renaming of a species, strain, genus etc. may lead to a new name of the species, strain, genus etc. In case a species, strain, genus etc. is or will be renamed, this will not have an effect on the present invention or the scope of its protection. The name of the species, strain, genus etc. used herein may be the former, the present or the future name of a microorganism. Rasamsonia is a new genus comprising thermotolerant and thermophilic Talaromyces and Geosmithia species (J. Houbraken et al., Antonie van Leeuwenhoek 2012 Feb; 101 (2): 403-21 ). Based on phenotypic, physiological and molecular data, Houbraken et al proposed to transfer the species 7. emersonii, T. byssochlamydoides, T. eburneus, G. argillacea and G. cylindrospora to Rasamsonia gen. nov.
EXAMPLES
Fermentation of the organism
Materials & Methods
In general, for each species, starter mycelium was grown in rich medium (either mycological broth or yeast malt broth (the latter being indicated with YM in the growth conditions table)) and then washed with water. The starter was then used to inoculate different liquid media or solid substrate and the resulting mycelium was used for RNA extraction and library construction.
Following are the medium recipes and the solid substrates with a referenced source (if available) as well as a table listing the media variations, since in some cases the basic recipes of the referenced source have been altered depending on the species grown. This is then followed by a summary of the specific species as grown in the examples.
A. Mycological broth
Per liter: 10g soytone, 40g D-glucose, 1ml Trace Element solution, Double- distilled water;
Adjust pH to 5.0 with hydrochloric acid (HCI) and bring volume to 1 L with double-distilled water.
Trace Element Solution contains 2mM Iron(ll) sulphate heptahydrate (FeS04 7H20), 1 mM Copper (II) sulphate pentahydrate (CuS04 '5H20), 5 mM Zinc sulphate heptahydrate (ZnS0 '7H20), 10 mM Manganese sulphate monohydrate (MnS04 Ή20), 5 mM Cobalt(ll) chloride hexahydrate (CoCI2 '6H20), 0.5 mM Ammonium molybdate tetrahydrate ((NH4)6Mo7024-4H20), and 95 mM Hydrochloric acid (HCI)dissolved in double-distilled water. Yeast-Malt broth (YM)
(Reference: ATCC medium No. 200)
Per liter: 3g yeast extract, 3g malt extract, 5g peptone, 10g D-glucose, Double-distilled water to 1 L.
Talaromyces thermophilus Defined Medium (TDM)
(Reference: I. D. Reid and M. G. Piace. Effect of Residual lignin type and amount on biological bleaching of kraft pulp by Talaromyces thermophilus. Applied Environmental Microbiology 60: 1395-1400, 1994.)
Per liter: 10 g D-glucose, 0.75 g L-Asparagine monohydrate, 0.68 g Potassium phosphate monobasic (KH2P04), 0.25 g Magnesium sulphate heptahydrate (Mg S04'7H20), 15 mg Calcium chloride dihydrate (CaCI2'2H20), 100 pg Thiamine hydrochloride, 1 ml Trace Element solution, 0.5 g Tween 80, Double distilled water;
Adjust pH to 5.5 with 3M potassium hydroxide and bring volume to 1 L with double-distilled water.
Table 1. Variations of TDM media used for library construction
Figure imgf000048_0001
Variation Description
TDM-14 The medium's pH was raised to 7.5.
The strain was incubated at 5°C above its optimum growth
TDM-15
temperature.
The strain was incubated at 10°C below its optimum growth
TDM-16
temperature.
One half of the double-distilled water was replaced with Whitewater
TDM-17
from newsprint manufacture. Glucose was omitted.
Potassium phosphate monobasic was replaced with 5mM phytic acid
TDM- 18
from rice (Sigma Cat. # P3168).
TDM-19 Asparagine monohydrate was increased to 4g per liter.
Asparagine monohydrate was increased to 4g per liter and glucose
TDM-20 was replaced with 2% fructose.
Asparagine monohydrate was increased to 4g per liter; 100ml of
TDM-21 double-distilled water was replaced with 100ml kerosene4. Glucose was omitted.
Asparagine monohydrate was increased to 4g per liter; 100ml of
TDM-22 double-distilled water was replaced with 100ml hexadecane (Sigma cat. # H0255). Glucose was omitted.
Asparagine monohydrate was increased to 4g per liter; one half of the double-distilled water was replaced with 25% Whitewater from
TDM-23
newsprint manufacture plus 25% white water from peroxide bleaching. Glucose was omitted.
Asparagine monohydrate was increased to 4g per liter and the
TDM-24 quantity of manganese sulphate monohydrate was raised to 0.2mM final concentration in the medium.
Asparagine monohydrate was increased to 4g per liter and
TDM-25
manganese sulphate monohydrate was omitted from the medium.
Asparagine monohydrate was increased to 4g per liter; and
TDM-26
potassium phosphate monobasic was replaced with 5mM phytic acid from rice (Sigma Cat. # P3168).
Glucose was replaced with 10g per liter of olive oil (Sigma cat. #
TDM-27
01514)
One half of the double-distilled water was replaced with Whitewater
TDM-28
from peroxide bleaching. Glucose was omitted.
TDM-29 Glucose was replaced with 10g per liter of tallow.
TDM-30 Glucose was replaced with 10g per liter of yellow grease.
Glucose was replaced with 10g per liter of defined lipid (Sigma cat. #
TDM-31
L0288).
TDM-32 Glucose was replaced with 50g per liter of D-xylose.
Glucose was replaced with 20g per liter of glycerol and 20ml per liter
TDM-33
of ethanol.
Glucose was reduced to 1g per liter and 10g per liter of bran was
TDM-34
added.
Glucose was reduced to 1g per liter and 10g per liter of pectin (Sigma
TDM-35
Cat. # P-9135) was added.
TDM-36 Glucose was replaced with 10g per liter of biodiesel. Variation Description
TDM-37 Glucose was replaced with 10g per liter of soy feedstock.
Glucose was replaced with 10g per liter of locust bean gum (Sigma
TDM-38
cat # G0753).
One half of double-distilled water was replaced with a 1 :1 ratio of
TDM-39 Whitewater from newsprint manufacture and white water from peroxide bleaching. Glucose was omitted.
TDM-40 The medium's pH was raised to 8.5.
One half of double-distilled water was replaced with Whitewater from
TDM-41 peroxide bleaching; plus yeast extract was added to 1 g per liter.
Glucose was omitted.
Glucose was replaced with 5g per liter of yellow grease and 5g per
TDM-42
liter of soy feedstock
TDM-43 Glucose was replaced with 20g per liter of fructose.
Glucose was replaced with 10g per liter of cellulose (Solka-Floc,
TD -44
200FCC) plus 1g per liter of sophorose.
TDM-45 The medium's pH was raised to 8.84.
1 Fooc grade wheat bran sourced from the supermarket was used.
2 All Whitewaters were sourced from Quebec paper mills by PAPRICAN on the Applicant's behalf.
3 Hardwood kraft pulp was sourced from Quebec paper mills by PAPRICAN on the Applicant's behalf.
4 Kerosene was sourced from a general hardware store.
D. Asparagine Salts Medium (AS):
(Reference: R. Ikeda, T. Sugita, E. Jacobson, and T. Shinoda. Laccase and Melanization in Clinically Important Cryptococcus Species Other Than Cryptococcus neoformans Journal of Clinical Microbiology 40: 1214-1218, 2002)
Per liter: 3.0 g D-glucose, 1.0 g L-Asparagine monohydrate, 3.0 g KH2P04, 0.5 g Mg S047H20, 1 mg Thiamine.
Table 2. Variations of AS media used for library construction
Figure imgf000050_0001
E. Solid substrates used:
SS-1 5 g Wheat Bran. SS-2 5g Wheat bran plus 5ml defined lipid.
SS-3 5g Oat bran (food grade, sourced from supermarket).
The Talaromyces thermophilus strain was grown according to the methods described above under the following growth conditions: TDM-1 , -2, -3, -4, -5, -6, -7, -8, 9, -10, -13, -14, -15, -39; YM, whereby the following optimal growth temperature was used: 25°C.
The strains carrying the recombinant genes were grown according to the methods described above under the following growth conditions: minimal medium as described in Kafer (1977, Adv Genet. 19:33-131) except that the salt concentrations were raised ten-fold and the glucose concentration was 150 grams per litre, at 30°C
Genome sequencing and assembly
Genomic DNA was isolated from mycelium when the growth culture had reached the mid log phase. Genomic DNA was sequenced using the Roche 454 Titanium technology (http://www.454.com) to a genome coverage of over 20-fold according to the instruction of the manufacturer. The sequences were assembled using the Newbler and Celera assemblers.
(http://sourceforge.net apps/mediawiki/wgs-assembler).
Building the cDNA library
Total RNA was isolated from fungal cells or mycelia when the growth cultures had reached the late log phase. The mycelia were collected by filtration through Miracloth and washed with water by filtration. The mycelia were padded dry using paper towels, and frozen in liquid nitrogen and stored at -80°C. To extract total RNA, the frozen mycelia or cells were ground to a fine powder in liquid nitrogen using pestle and mortar. Approximately 1-1.5 gram of frozen fungal powder was dissolved in 10 ml of TRizol® reagent and RNA was extracted according to the manufacturer's protocol (Invitrogen Life Sciences, Catalog #15596-018). Following extraction, the RNA was dissolved at 1-1.5 mg/ml of DEPC-treated water.
The PolyATtract® mRNA Isolation Systems (Promega, Catalog #Z5300) was used to isolate poly(A)+RNA. In general, equal amounts of total RNA extracted from up to ten culture conditions were pooled. One milligram of total RNA was used for isolation of poly(A)+RNA according to the protocol provided by the manufacturer. The purified poly(A)+RNA was dissolved at 200-500 Mg/ml of DEPC-treated water.
Five micrograms of poly(A)+RNA were used for the construction of cDNA library. Double-stranded cDNA was synthesized using the ZAP-cDNA® Synthesis Kit (Stratagene, Catalog #200400) according to the manufacturer's protocol with the following modifications. An anchored oligo(dT) linker-primer was used in the first-strand synthesis reaction to force the primer to anneal to the beginning of the poly(A) tail of the mRNA. The anchored oligo(dT) linker-primer has the sequence: 5'-GAGAGAGAGAGAGAGAGAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTTVN- 3' (SEQ ID NO: 145) where V is A, C, or G and N is A, C, G, or T. A second modification was made by adding trehalose at a final concentration of 0.6M and betaine at a final concentration of 2M in the buffer of the first-strand synthesis reaction to promote full-length synthesis. Following synthesis and size fractionation, fractions of double-stranded cDNA with sizes longer than 600 bp were pooled. The pooled cDNA was cloned directionally into the plasmid vector BlueScript KS+® (Stratagene) or a modified BlueScript KS+ vector that contained Gateway® (Invitrogen) recombination sites. The cDNA library was transformed into £. coli strain XL10-Gold ultracompetent cells (Stratagene, Catalog #Z00315) for propagation.
Bacterial cells carrying cDNA clones were grown on LB agar containing the antibiotic Ampicillin for selection of plasmid-borne bacteria and X-gal and IPTG to use the blue/white system to screen for the presence cDNA inserts. The white bacterial colonies, those carrying cDNA inserts, were transferred by a colony-picking robot to 384-well MTP for replication and storage. Clones that were to be analyzed by sequencing were transferred to 96-well deep blocks using liquid-handling robots. The bacteria were cultured at 37°C with shaking at 150 rpm. After 24 hours of growth, plasmid DNA from the cDNA clones was prepared by alkaline lysis and sequenced from the 5' end using ABI 3730x1 DNA analyzers (Applied Biosystems). The chromatograms obtained following single-pass sequencing of the cDNA clones were processed using Phred (available at http://www.phrap.org) to assign sequence quality values, Lucy as described in Chou and Holmes (2001 , Bioinformatics, 17(12) 1093-1104) to remove vector and low quality sequences, and Phrap (available at http://www.phrap.org/) to assemble overlapping sequences derived from the same gene into contigs. Annotation
An in-house automated annotation pipeline was used to predict genes in the assembled genome sequence. The analysis pipeline used in part the ab initio tool Genemark (http://exon.biology.qatech.edu/) for prediction. It also used the predictor Augustus (http://auqustus.qobics.de/) trained on de novo assembled sequences and orthologus sequences for gene finding. Sequence similarity searches against the mycoCLAP (http://cubique.funqalqenomics.ca/mycoCLAP/) and NCBI non-redundant databases were performed with BLASTX as described in Altschul ef a/., (1997) (Nucleic Acids Res. 25(17): 3389-3402). Proteins encoding biomass-degrading enzymes possess conserved domains. We used the domains available at the European Bioinformatics Institute (www.ebi.ac.uk/Tools/lnterProScan/) to assist in the identification of target enzymes.
Proteins targeted to the extracellular space by the classical secretory pathway possess an N-terminal signal peptide, composed of a central hydrophobic core surrounded by N- and C- terminal hydrophilic regions. We used Phobius (available at http://phobius.cqb.ki.se) and SignalP version 3 (available at http://www.cbs.dtu.dk/services/SiqnalP) to recognize the presence of signal peptides encoded by the cDNA clones. The tools TargetP (available at http://www.cbs.dtu.dk services/TargetP) and Big-PI Fungal Predictor (available at http://mendel.imp.ac.at/gpi/fungi_server.html) were used to remove sequences that encode proteins which are targeted to the mitochondria or bound to the cell wall. Finally, sequences predicted to encode soluble secreted protein by these automated tools were analyzed manually. Clones that comprise full-length cDNAs which are predicted to encode soluble secreted proteins were sequenced completely. For genes identified from the genome sequence, oligonucleotide primers specific to the target genes were designed and used to PCR amplified the target genes from double-stranded cDNA or genomic DNA. The PCR amplified products were cloned into an appropriate expression vector for protein production in host cells.
General Molecular Biology Procedures:
Standard molecular cloning techniques such as DNA isolation, gel electrophoresis, enzymatic restriction modifications of nucleic acids, E. coli S3
transformation etc. were performed as described by Sambrook et al., 1989, (Molecular cloning: a laboratory manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York and Innes et al. (1990) PCR protocols, a guide to methods and applications, Academic Press, San Diego, edited by Michael A. Innis et al). Primers were prepared by IDT (Integrated DNA Technologies). Sanger DNA sequencing was performed using an Applied Biosystem's 3730x1 DNA Analyzer technology at the Innovation Centre (Genome Quebec), McGill University in Montreal.
TEC-210 was fermented according to the inoculation and fermentation procedures described in WO2011/000949.
The 4E mix (4 enzymes mixture or 4 enzyme mix) containing CBHI, CBHII, GH61 and BG (30%, 25%, 36% and 9%, respectively as described in WO2011/098577) was used. Construction of pGBFIN49 expression plasmids
Genes of interest were cloned into the expression vector pGBFIN-49. This vector is a derivative of pGBFIN-41 that contains the A. niger glaA promoter, A. niger TrpC terminator, A. nidulans gpdA promoter, gene encoding the pheomycin resistance gene, A. niger glaA terminator and an E. coli backbone. Figure 1 represents a schematic map of pGBFIN-49 and the complete nucleotide sequence is presented as SEQ ID NO: 146.
Details of the construction of pGBFIN-49 are as follows:
1. TtrpC terminator PCR amplification (0.7kb):
TtrpC terminator was PCR amplified using purified pGBFIN33 plasmid as a template. The following primers and PCR program were used:
Primer-3: S'-GTCCGTCGCCGTCCJTCAccgccggtccgacg-S' (SEQ ID NO: 147) Primer-4: 5'-GCGGCCGGCGTATTGGGTGttacggagc-3' (SEQ ID NO: 148) Primer-4 is entirely specific to TtrpC 3' end. Primer-3 was designed to suit the LIC cloning strategy but also to keep TtrpC sequence as close as the original sequence. To do so, five adenines were replaced by thymines (underlined).
PCR master mix:
pGBFIN33 l Ml (5-10ng)
Primer-3 (10mM) 1 μΙ Primer-4 (10mM) 1 μΙ
dNTPs (2mM) 5 μΙ
HF Buffer (5x) 10 μΙ
Phusion DNA pol 0.5 μΙ
Nuclease-free water 31.5 ul
Total 50 μΙ
PCR program: 1x98°C - 2 min; 25x ( 98°C - 30 sec, 68°C - 30 sec, 72°C - 1 min); 72°C - 7 min.
Reaction conditions: 5 μΙ of the PCR reaction was ran on 1.0% agarose gel and remaining was purified using QIAEX II gel Extraction kit (QIAGEN) and resuspended in nuclease-free water.
2. PGBFIN41 vector PCR amplification (8.3kb):
Vector backbone was PCR amplified using pGBF!N41 as a template. Primers were designed outside of the ccdA region (not included in pGBFIN49). The following primers and PCR program were used:
Primer-2: 5'-CACCCAATACGCCGGCCGCgcttccagacagctc-3' (SEQ ID NO: 149)
Primer-1 C: S'-GGTGTJTTGTTGCTGGGGAtgaagctcaggctctcagttgcgtc-S' (SEQ ID NO: 150)
Primer-2 contains a pgpdA-specific region and an extra sequence specific to TtrpC 3' end (also included in Primer-4). Primer-1 C was designed to suit the LIC cloning strategy but also to keep PgalA region as close as the original sequence. To do so, three thymines were replaced by adenines (underlined).
PCR master mix:
PGBFIN41 1 μΙ (50 ng)
Primer-2 (10mM) 1 μΙ
Primer-1C (10mM) 1 μΙ
dNTPs (2mM) 5 μΙ
HF Buffer (5x) 10 μΙ Phusion DNA pol 0.5 μΙ
DMSO 1 μΙ
Nuclease-free water 30.5 ul
Total 50 μΙ
PCR program: 1x98°C - 3 min; 10x (98°C - 30 sec, 68°C - 30 sec, 72°C - 5 min); 20 x ( 98°C - 30 sec, 68°C - 30 sec, 72°C - 5 min+10 sec/cycle); 72°C - 10 min. Reaction conditions: 5 μΙ of the PCR reaction was ran on 0.5% agarose gel and remaining was purified using QIAEX II gel Extraction kit (QIAGEN) and resuspended in nuclease-free water.
3- PGBFIN41 + TtrpC overlap-extension PCR:
Overlap-extension / Long range PCR was performed to a) fused the two PCR pieces together; b) add Sfol restriction site to re-circulate the vector. No primers were used in the overlap-extension stage. Primer-11 and Primer-12 were used for the long range PCR reaction.
Primer-11 : 5'-CACCGGCGCCGTCCGTCGCCGTCCTTC -3' (SEQ ID NO: 151 )
Primer-12: 5'-ACGGCGCCGGTGTTTTGTTGCTGGGGATG -3' (SEQ ID NO: 152)
Primers-11 is specific to the LIC tag located on the TtrpC terminator while Primer-12 is specific to the LIC tag located on the PglaA region. Sfol restriction site sequence is underlined.
A standard PCR master mix was prepared to perform overlap-extension PCR using pGBFIN41 and TtrpC purified PCR products as templates. No primers were added.
Overlap-extension master mix:
TtrpC 1 μΙ
pGBFIN41 9 μΙ
Buffer GC (5x) 10 μΙ
dNTPs (2mM) 5 μΙ
Phusion DNA pol 0.5 μΙ Nuclease-free water 24.5 ul
Total 50 μΙ
PCR program - overlap (no primers): 1x 98°C - 2 min; 5x (98°C - 15 sec, 58° - C30 sec, 72°C - 5 min), 5x (98°C - 15 sec, 63°C - 30 sec, 72°C - 5 min), 5x
(98°C - 15 sec, 68°C - 30 sec, 72°C - 5 min); 72°C - 10 min).
The overlap-extension PCR product was then, purified on QIAEX II column and 5 μΙ of the purified reaction was used as template DNA for Long range PCR step with primers-11 and -12.
PCR master mix:
Overlap product 5ul
Primer-11 (10mM) 1 μΙ
Primer-12 (10mM) 1 μΙ
dNTPs (2mM) 5 μΙ
HF Buffer (5x) 10 μΙ
Phusion DNA pol 0.5 μΙ
DMSO 1 μΙ
Nuclease-free water 26.5 ul
Total 50 μΙ
PCR program - Long range: 1χ 98°C - 3 min; 10x (98°C - 30 sec, 68°C - 30 sec, 72°C - 5 min); 20 x (98°C - 30 sec, 68°C - 30 sec, 72°C - 5 min+10 sec/cycle); 72°C - 10 min.
Reaction conditions: 5 μΙ of the PCR reaction was ran on 0.5% agarose gel and remaining was purified using QIAEX II gel Extraction kit and resuspended in nuclease-free water. Then, Sfol digestion was performed and digested product was purified using QIAEX II gel extraction kit follow the procedure as described by the manufacture.
4. Ligation:
100 ng of the purified digested fragment was ligated to itself using 1 μΙ of T4 DNA Ligase (New England Biolabs, M0202), and incubated at 16C overnight. Enzyme inactivation was performed at 65°C for 10 minutes. Then, 10 μΙ of ligation product were transformed in DH5a E. coli competent cells and plated on 2xYT agar containing 100 ug/ml ampicillin. DNA extraction was performed on single colonies the next day. Restriction analysis and sequencing were done to confirm the structure.
Cloning of Talaromvces thermophilus genes in E. coli
Cloning genes of interest in the pGBFIN-49 expression vector was performed using the Ligation-independent cloning (LIC) method according to Aslanidis, C, de Jong, P. (1990) Nucleic Acids Research Vol. 18 No. 20, 6069- 6074.
Coding sequences from genes of interest were amplified by PCR using primers containing LIC tags which are homologous to Pg/a and TrpC sequences in the pGBFIN-49 cloning vector fused to sequences homologous to the coding sequences of the gene of interest, and either genomic DNA or cDNA as template. Primers have following sequences:
Forward primer: 5 -CCCCAGCAACAAAACACCTCAGCAATG ...15-20 nucleotides specific to each gene to be cloned (SEQ ID NO: 153)
Reverse primer: 5'- GAAGGACGGCGACGGACTTCA...15-20 nucleotides specific to each gene to be cloned (SEQ ID NO:154
PCR mix consists of following components:
Figure imgf000058_0001
PCR amplification was carried out with following conditions:
3-step protocol
Cycle step Cycles
Temp. Time
Initial denaturation 98°C 30 s 1
Figure imgf000059_0001
Following PCR, 90 μΙ milliQ water was added to each sample and the mix was purified using a Multiscreen PCR96 Filter Plate (Millipore) according to manufacturer's instructions. The PCR product was eluted from the filter in 25 μ1 10 mM Tris-HCI pH8.0.
Expression vector pGBFIN-49 was PCR amplified using primers with following sequences:
Forward primer: 5'- GTCCGTCGCCGTCCTTCACCG -3' (SEQ ID NO:155) Reverse primer: 5'- GGTGTTTTGTTGCTGGGGATGAAGC -3' (SEQ ID NO: 156) (Primers are located at either site of the Sfol restriction site.)
PCR mix consists of following components:
Figure imgf000059_0002
PCR amplification was carried out with following conditions:
2 -step PCR protocol
Cycle step Cycles
Temp. Time
Figure imgf000060_0001
Following PCR, 1 μΙ Dpnl was added to the PCR mix and digestion was allowed overnight at 37°C. Digested PCR product was purified using the Qiaquick PCR purification kit (Qiagen) according to manufacturer's instructions.
Obtained PCR fragments were treated with T4 DNA polymerase in the presence of dTTP to create single stranded tails at the ends of the PCR fragments. The single stranded tails of the PCR fragment are complementary to those at the vector, thus permitting non-covalent bi-molecular associations e.g. circularization between molecules.
Reaction mix of T4 DNA polymerase treatment pGBFIN-49 PCR fragment consists of following components:
Figure imgf000060_0002
Reaction mix of T4 DNA polymerase treatment of Gene of Interest (GOI) PCR fragment consists of following components:
Purified GO! PCR 5 μΙ
10X NEB Buffer 2 2 μΙ
25 mM dATP 2 μΙ
DTT 100 μΜ 0.8 μΙ
T4 DNA Polymerase 3U/ μΙ 1 μΙ
H20 9.2 μΙ
TOTAL 20 μΙ
Reaction conditions were as follows:
Figure imgf000061_0001
Following T4 DNA polymerase treatment, 2 μΙ pGBFIN-49 vector and 4 μΙ of the GOI were mixed and incubated at room temperature allowing annealing of GOI fragment with pGBFIN-49 vector fragment. The bi-molecular forms are used to transform £ coli. Plasmid DNA of resulting transformants was isolated and verified by sequence analyses for correct amplification and cloning of the gene of interest.
Transformation of Talaromyces thermophilus gene expression cassettes into A. niger.
As host strain for enzyme production, A. niger GBA307 was used. Construction of A. niger GBA307 is described in WO201 1009700.
Transformation of A. niger was performed essentially according to the method described by Tilburn, J. et. al. (1983) Gene 26, 205-221 and Kelly, J & Hynes, M. (1985) EMBO J., 4, 475-479 with the following modifications:
- Spores were grown for 16-24 hours at 30°C in a rotary shaker at 250 rpm in Aspergillus minimal medium. Aspergillus minimal medium contains per liter: 6 g NaN03; 0.52 g KCI; 1 .52 g KH2P04; 1 .12 ml 4 M KOH; 0.52 g MgS04.7H20; 10 g glucose; 1 g casamino acids; 22 mg ZnS04.7H20; 1 1 mg H3B03; 5 mg FeS04.7H20; 1 .7 mg CoCI2.6H20; 1 .6 mg CuS04.5H20; 5 mg MnCI2.2H20; 1 .5 mg Na2Mo04.2 H20; 50 mg EDTA; 2 mg riboflavin; 2 mg thiamine-HCI; 2 mg nicotinamide; 1 mg pyridoxine-HCI; 0.2 mg panthotenic acid; 4 g biotin; 10 ml Penicillin (5000IU/ml/Streptomycin (5000 UG/ml) solution (Invitrogen);
Glucanex 200G (Novozymes) was used for the preparation of protoplasts; After protoplast formation (2-3 hours) 10 ml TB layer (per liter: 109.32 g Sorbitol; 100 ml 1 M Tris-HCI pH 7.5) was pipetted gently on top of the protoplast suspension. After centrifugation for 10 min at 4330 x g at 4°C in a swinging bucket rotor, the protoplasts on the interface were transferred to a fresh tube and washed with STC buffer (1.2 M Sorbitol, 10 mM Tris-HCI pH7.5, 50 mM CaCI2). The protoplast suspension was centrifuged for 10 min at 1560 x g in a swinging bucket rotor and resuspended in STC-buffer at a concentration of 10s protoplasts/ml;
To 200 pi of the protoplast suspension, 20 μΙ ATA (0.4 M Aurintricarboxylic acid), the DNA dissolved in 10 pi in TE buffer (10 mM Tris-HCI pH 7.5, 0.1 mM EDTA), 100 μΙ of a PEG solution (20% PEG 4000 (Merck), 0.8M sorbitol, 10 mM Tris-HCI pH 7.5, 50 mM CaCI2) was added;
After incubation of the DNA-protoplast suspension for 10 min at room temperature, 1.5 ml PEG solution (60% PEG 4000 (Merck), 10 mM Tris-HCI pH7.5, 50 mM CaCI2) was added slowly, with repeated mixing of the tubes. After incubation for 20 min at room temperature, suspensions were diluted with 5 ml 1.2 M sorbitol, mixed by inversion and centrifuged for 10 min at 2770 x g at room temperature.
The protoplasts were resuspended gently in 1 ml 1.2 M sorbitol and plated onto selective regeneration medium consisting of Aspergillus minimal medium without riboflavin, thiamine. HCI, nicotinamide, pyridoxine, panthotenic acid, biotin, casaminoacids and glucose, supplemented with 150 pg/ml Phieomycin (Invitrogen), 0.07 M NaN03, 1 M sucrose, solidified with 2 % bacteriological agar #1 (Oxoid, England). After incubation for 5-10 days at 30°C, single transformants were isolated on PDA (Potato Dextrose Agar (Difco) supplemented with 150 pg/ml Phieomycin in 96 wells MTP. After 5-7 days growth at 30°C single transformants were used for MTP fermentation.
Aspergillus niqer shake MTP fermentation
96 wells microtiter plates (MTP) with sporulated Aspergillus niger strains were used to harvest spores for MTP fermentations. To do this, 200 μΙ of 10% glycerol was added to each well and after resuspending the mixture, 40 μΙ of spore suspension was used to inoculate 2 ml A. niger medium (70 g/l glucose. H20, 10 g/l yeast extract, 10 g/l (NH4)2S04, 2 g/l K2S04, 0.5 g/l MgS04.7H20, 0.5 g/l ZnS04.7H20, 0.2 g/l CaCI2, 0.01 g/l MnS04.7H20, 0.05 g/l FeS04.7H20, 0.002 Na2Mo04.2H20, 0.25g/l Tween-80, 10 g/l citric acid, 30 g/l MES; pH 5.5 adjusted with 4 M NaOH) in a 24 well MTP. The MTP's were incubated in a humidity shaker (Infors) at 34°C at 550 rpm, and 80% humidity for 6 days. Plates were centrifuged 10 minutes 2750 rpm at 4°C and the supernatants were harvested.
TEC-210 was fermented according to the inoculation and fermentation procedures described in WO2011/000949.
The mix containing CBHI, CBHII, GH61 and BG (30%, 25%, 36% and 9%, respectively as described in WO201 /098577) was used. Protein concentration determination with TCA-biuret method
Concentrated protein samples (supernatants) were diluted with water to a concentration between 2 and 8 mg/ml. Bovine serum albumin (BSA) dilutions (0, 1 , 2, 5, 8 and 10 mg/ml) were made and included as samples to generate a calibration curve. 1 ml of each diluted protein sample was transferred into a 10 ml tube containing 1 ml of a 20% (w/v) trichloro acetic acid solution in water and mixed thoroughly. Subsequently, the tubes were incubated on ice water for one hour and centrifuged for 30 minutes, at 4°C and 6000 rpm. The supernatant was discarded and pellets were dried by inverting the tubes on a tissue and letting them stand for 30 minutes at room temperature. Next, 4 ml BioQuant Biuret reagent mix was added to the pellet in the tube and the pellet was solubilised upon mixing. Next, 1 ml water was added to the tube, the tube was mixed thoroughly and incubated at room temperature for 30 minutes. The absorption of the mixture was measured at 546 nm with a water sample used as a blank measurement and the protein concentration was calculated via the BSA calibration line.
Microtiter plate (MTP) sugar-release activity assay
For each (hemi-)cellulase assay, the stored samples were analyzed twice; 100 μΙ_ sample and 100 μΙ of a (hemi-)cellulase base mix [3.5 mg/g DM TEC-210 or a 4 enzyme mix at a total dosage of 3.5 mg/g DM consisting of 0.3 mg/g DM BG 2012/050198
63
(9% of total protein mix), 1 mg/g DM CBHI (30% of total protein 4E mix), 0.9 mg/g DM CBHII (25% of total protein 4E mix) and 1.3 mg/g DM GH61 (36% of total protein 4E mix)] was transferred to two suitable vials: one vial containing 800 pL 2.5 % (w/ w) DM (dry matter) of the acid pre treated corn stover, hot water treated washed wheat straw, or hot water treated washed corn fiber substrate in a 50 mM citrate buffer, buffered at pH 4.5. The other vial consist of a blank, where the 800 pL 2.5 % f7 w) dry matter, acid pre treated corn stover, hot water treated wheat straw, or hot water treated corn fiber substrate suspension was replaced by 800 pl_ 50 mM citrate buffer, buffered at pH 4.5. The assay samples were incubated for 72 hrs at 65 °C. After incubation of the assay samples, a fixed volume of D20 (with 0.5 g/L 4,4-dimethyl-4-silapentane-1 -sulfonic acid (DSS)) containing an internal standard, maleic acid (20 g/L) and EDTA (40 g/L), was added. The amount of sugar released, is based on the signal between 4.65 - 4.61 ppm, relative to DSS, and is determined by means of 1 D 1H NMR operating at a proton frequency of 500 MHz, using a pulseprogram with water suppression, at a temperature of 27°C.
The (hemi)-cellulase enzyme solution may contain residual sugars. Therefore, the results of the assay are corrected for the sugar content measured after incubation of the enzyme solution.
Sugar-release activity assays
A. niger strains expressing Talaromyces clones were fermented in shake flask cultures, as described above, in order to obtain more material for further testing. The fermentation supernatants (volume between 75 and 100 ml) were concentrated using a 10 kDa spin filter to a volume of approximately 5 ml. Subsequently, the protein concentration in the concentrated supernatant was determined via a TCA-biuret method, as described above. The (hemi-)cellulase activity of these protein samples was tested in an assay where the supernatants were spiked on top of an enzyme base mix in the presence of 2% (w/w) acid pretreated corn stover. 'To spike' or 'spiking of a supernatant or an enzyme indicates in this context the addition of a supernatant or an enzyme to a (hemi)- cellulase base mix. For example a 3E mix (3 enzymes mixture or 3 enzyme mix) is spiked with a fourth enzyme to form the 4E mix. The proteins were spiked based on dosage or volume. In case of spiking based on dosage; the concentrated supernatant samples were added in a final concentration of 2.5 mg/gDM to the base enzyme mix (TEC-210 2.5 mg/gDM) in a total volume of 1 ml at a feedstock concentration of 2% aCS (w/w) in a 2 ml tube. In case of spiking based on volume; 50 μΙ supernatant sample was added to the base enzyme mix (TEC-210 2.5 mg/gDM) in a total volume of 1 ml at a feedstock concentration of 2% (w/w) in a 2 ml tube. All experiments were performed in duplicate and were incubated for 72 hours at 65°C and 600rpm in a shaking eppendorf incubator.
A blank sample was included. For this blank sample, 50 μΙ supernatant was added to 1 ml water in the absence of feedstock or base enzyme mix. This allowed a determination of the background sugar present in the concentrated supernatant. Furthermore, base enzyme mix (TEC-210 2.5 mg/gDM) alone was incubated with 2% aCS (w/w) feedstock in a total volume of 1 ml in a 2 ml tube. The blank and base enzyme mix-only samples were also performed in duplicate.
After incubation, the samples were centrifuged and 500μΙ of the supernatant was transferred to a deep-well microtiter plate (MTP). Subsequently, soluble sugars were analysed by proton NMR as described below.
Soluble sugar analysis by proton NMR
Hydrolysis samples were analyzed for the presence of soluble sugars by proton NMR. 500 μΙ of each sample was collected in MTP (as described above) and subsequently to each sample 100 μΙ_ internal standard solution, containing maleic acid (20 g.L"1) as internal standard, EDTA (40 g.L"1) and trace amounts of
DSS (4,4-dimethyl-4-silapentane-1-sulfonic acid), was added.
After lyophilizing, the samples were re-dissolved in D20. Subsequently the samples were transferred to NMR tubes. 1D H NMR spectra were recorded on a Bruker Avance III 700 MHz, equipped with a 5 mm cryoprobe operating at
300K using a pulse program without water suppression and relaxation delay of 30 s.
The amount of sugars present is calculated based on the following signals (δ in ppm relative to DSS): ct-galactose peak at 5.25 ppm (d, 0.29 H, J = 4 Hz)
a-xylose peak at 5.18 ppm (d, 0.37 H, J = 4 Hz)
a-mannose peak at 5.17 ppm (d, 0.665 H, J = 2 Hz)
β-glucose peak at 4.63 ppm (d, 0.62 H, J = 8 Hz)
a-arabinose peak at 4.50 ppm (d, 0.60 H, J = 8 Hz) In some cases cellobiose is present in the samples. The amount present is calculated on the following signal (δ in ppm relative to DSS): β-cellobiose peak at 4.65 ppm (d, 0.62 H, J = 8Hz)
The signal used for the standard;
maleic acid peak at 6.11 ±- 0.2 ppm (s, 2H) Example 1. Identification of TALTH genes that encode a secreted protein
Genes were identified that based on curation (described above) encoded a secreted protein. A list of these genes is shown in Table 21.
Example 2. Improvement of thermophilic cellulase mixture by Talaromyces thermophilus proteins in the MTP activity assay
Talaromyces thermophilus (hemi)cellulosic proteins were cloned and expressed in A. rtiger as described above. Supernatants from MTP fermentations were used in MTP sugar release activity assays as described above, using two different feedstocks.
In one set of experiments, hot-water pretreated wheat straw (hWS) was used as the substrate. Supernatants of protein fermentations were added to two different cellulase enzyme base mixes, TEC-210 and 4E mix, as described above. Several different Talaromyces thermophilus proteins showed increased sugar release as shown below in Table 3 / Figure 2 and Table 4 / Figure 3:
Figure imgf000066_0001
Table 3: Effect of Talaromyces thermophilus proteins spiked on TEC-210 using hWS substrate
Figure imgf000067_0001
Table 4: Effect of a set of Talaromyces thermophilus proteins spiked on 4E mix using hWS substrate In a second set of experiments with hot-water pretreated wheat straw
(hWS) as the substrate, supernatants of a different set of protein fermentations were added to two different cellulase enzyme base mixes, TEC-210 and 4E mix, as described above. A few different proteins from Talaromyces thermophilus showed increased sugar release as shown below in Table 5 / Figure 4 and Table 6 / Figure 5:
Figure imgf000067_0002
Table 5: Effect of a different set of Talaromyces thermophilus proteins spiked TEC-210 using hWS substrate
Figure imgf000067_0003
Table 6: Effect of a different set of Talaromyces thermophilus proteins spiked on 4E mix using hWS substrate
In a third set of experiments with hot-water pretreated wheat straw (hWS) as the substrate, supernatant of another protein fermentation was added to two different celluiase enzyme base mixes, TEC-210 and 4E mix, as described above. Spiking showed increased sugar release as shown below in Table 7 / Figure 6 and Table 8 / Figure 7:
Figure imgf000068_0001
Table 7: Effect of another different Talaromyces thermophilus protein spiked TEC-210 using hWS substrate
Figure imgf000068_0002
Table 8: Effect of another different Talaromyces thermophilus protein spiked on 4E mix using hWS substrate
In another set of experiments, acid pretreated corn stover (aCS) was used as the substrate. Supernatants of Talarmomyces thermophilus protein fermentations were added to two different celluiase enzyme base mixes, TEC-210 and 4E mix, as described above. Different proteins from Talaromyces thermophilus showed increased sugar release as shown below in Table 9 / Figure 8 and Table 10 / Figure 9:
Figure imgf000068_0003
Table 9: Effect of a set of Talaromyces thermophilus proteins spiked on TEC-210 using aCS substrate
Figure imgf000069_0001
Table 10: Effect of a set of Talaromyces thermophilus proteins spiked on 4E mix using aCS substrate In second set of experiments, acid pretreated corn stover (aCS) was again used as the substrate with supernatants of a different set of Talaromyces thermophilus protein fermentations. As before these protein supernatants were added to two different cellulase enzyme base mixes, TEC-210 and 4E mix, as described above. Several different proteins from Talaromyces thermophilus showed increased sugar release as shown below in Table 1 1 / Figure 10 and Table 12 / Figure 1 1 :
Figure imgf000069_0002
Table 1 1 : Effect of a different set of Talaromyces thermophilus proteins spiked TEC-210 using aCS substrate
Figure imgf000070_0001
Table 12: Effect of a different set of Talaromyces thermophilus proteins spiked on 4E mix using aCS substrate. In a third set of experiments with acid pretreated corn stover (aCS) as the substrate, a different set of Talaromyces thermophilus protein fermentations was added to two different cellulase enzyme base mixes, TEC-210 and 4E mix, as described above. Different proteins from Talaromyces thermophilus showed increased sugar release as shown below in Table 13 / Figure 12 and Table 14/ Figure 13:
Figure imgf000070_0002
Table 13: Effect of another different set of Talaromyces thermophilus proteins spiked on TEC-2 0 using aCS substrate
Figure imgf000070_0003
Table 14: Effect of another different Talaromyces thermophilus protein spiked on 4E mix using aCS substrate. Example 3. Improvement of thermophilic cellulase mixture by Talaromyces thermophilus proteins in the lab scale activity assay
Talaromyces thermophilus proteins were cloned and expressed in A. niger as described above. Concentrated supematants from shake flask fermentations were used in sugar release activity assays as described above, using aCS NREL as feedstock. In one set of experiments, supematants of Taiaromyces thermophilus protein fermentations were spiked based on protein dosage op top of a TEC-210 base mix, as described above. Several proteins showed increased sugar release as shown below in Table 15 / Figure 14.
Figure imgf000071_0001
Table 15: Effect of a set of Taiaromyces thermophilus proteins spiked based on protein dosage on TEC-210 using aCS substrate; st dev, standard deviation.
In second set of experiments with aCS NREL as the substrate, supematants of a different set of protein fermentations were added based on volume to the cellulase enzyme base mix TEC-210, as described above. A few different Taiaromyces thermophilus proteins showed increased sugar release as shown below in Table 16 / Figure 15.
Figure imgf000071_0002
Table 16: Effect of a set of Taiaromyces thermophilus proteins spiked based on supernatant volume on TEC-210 using aCS substrate; st dev, standard deviation.
Example 4. Substitution of Rasamsonia emersonii GH61 with Taiaromyces thermophilus TALTH_3_00094 in the 4 enzyme mixture activity assay The cellulase enhancing activity of Taiaromyces thermophilus GH61 protein (TALTH _3_00094) was further analysed. The TALTH_3_00094 gene was cloned and expressed in A. niger as described above. The supernatant of an A. niger expressing TALTH_3_00094 shake flask fermentation was concentrated and spiked in a dosage of 1 ,8 mg/g DM on top of a base activity of a three enzyme base mix (3.2 mg/g DM composed of: BG at 0.45 g/g DM, CBHI at 1.5 mg/g DM and CBHII at 1.25 mg/g DM) at a feedstock concentration of 2% (w/w) aCS. As a control, the 4 enzyme base mix was taken into account, which effectively consisted of the 3 E mix as mentioned here, spiked with 1.8 mg/g DM GH61. in both cases, all four enzymes were added in a combined volume of 0.5 ml (125μΙ of each enzyme) to a 0.5 ml solution of 4% (w/w) aCS solution in 50mM acetate buffer, pH 4.5, in a 2 ml tube. As blank, the 3 enzyme base mix with addition of 125 μΙ 50mM acetate buffer, pH 4.5, was taken into account. Furthermore the background sugars in the supernatant sample of TALTH_3_00094 were determined by adding 125 μΙ TALTH_3_00094 (in the same dosage as in the experiment) into 875μΙ 50mM acetate buffer, pH 4.5. All experiments were performed at least in duplicate and were incubated for 72 hours at 65°C and 600rpm in a shaking eppendorf incubator. After incubation, the samples were centrifuged and 500μΙ of the supernatant was transferred to a deep-well microtiter plate (MTP). Subsequently, soluble sugars were analysed by proton NMR as described above.
Addition of this T. thermophilus GH61 protein showed increased sugar release up to similar levels as the 3E mix spiked with GH61 , which is present in a standard 4E base mix, shown below in Table 17/ Figure 16.
Figure imgf000072_0001
Table 17: Effect of GH61 TALTH_3_00094 protein spiked on top of a 3E mix using aCS substrate; st dev, standard deviation.
Example 5. Substitution of R. emersonii BG with Talaromyces thermophilus TALTH_2__00031 in the 4 enzyme mixture activity assay.
The cellulase enhancing activity of TALTH_2_00031 was further analysed. The Talaromyces thermophilus BG gene (TALTH_2_00031 ) was cloned and expressed in A. niger as described above. Supernatant of an A. niger expressing TALTH_2_00031 shake flask fermentation was concentrated and spiked in a dosage of 0.45 mg/g DM on top of a base activity of a three enzyme base mix (4.55 mg/gDM composed of: CBHI at 1.5 mg/g DM, CBHII at 1 .25 mg/g DM and GH61 at 1.8 mg/gDM) at a feedstock concentration of 2% (w/w) aCS. As a control, the 4 enzyme base mix was taken into account, which effectively consisted of the 3 E mix as mentioned here, spiked with 0.45 mg/g DM BG. All four enzymes were added in a combined volume of 0.5 ml (125μΙ of each enzyme) to a 0.5 ml solution of 4% (w/w) aCS solution in 50mM acetate buffer, pH 4.5, in a 2 ml tube. As blank, the 3 enzyme base mix with addition of 125 μΙ 50mM acetate buffer, pH 4.5, was taken into account. Furthermore the background sugars in the supernatant sample of TALTH_2_00031 were determined by adding 125 μΙ TALTH_2_00031 (in the same dosage as in the experiment) into 875μΙ 50mM acetate buffer, pH 4.5. All experiments were performed at least in duplicate and were incubated for 72 hours at 65°C and 600 rpm in a shaking eppendorf incubator.
After incubation, the samples were centrifuged and 500μΙ of the supernatant was transferred to a deep-well microtiter plate (MTP). Subsequently, soluble sugars were analysed by proton NMR as described above.
Spiking of this T. thermophilus BG protein showed increased sugar release up to similar levels as the 3E mix spiked with BG, which is present in a standard 4E base mix, as shown below in Table 18/ Figure 17. Furthermore, the cellobiose levels were almost zero when the 3 enzyme base mix was spiked with TALTH_2_00031 and BG, suggesting the presence of an active beta-glucosidase in the mixture.
Figure imgf000073_0001
Table 18: Effect of BG TALTH_2_00031 protein spiked on top of a 3E mix using aCS substrate; st dev, standard deviation. Example 6. Substitution of R. emersonii GH61 with Talaromyces thermophilus TALTH_3_00094 in the 4 enzyme mixture activity assay at high DM.
The cellulase enhancing activity of Talaromyces thermophilus GH61 protein (TALTH_3_00094) was further analysed. 100 μΙ of the concentrated supernatant of an A. niger expressing TALTH_3_00094 shake flask fermentation, obtained as described above, was spiked on top of 870 pi 0% (w/w) aCS solution in water, pH 4.5, and 30 μ| of a three enzyme base mix (3.2 mg/g DM composed of: BG at 0.45 g/g DM, CBHI at 1.5 mg/g DM and CBHII at 1.25 mg/g DM) in a 2 ml tube. By adding 100 μΙ supernatant, the dosage of TALTH_3_00094 was 1.8 mg/g DM and the final DM concentration of the mixture was 9% pCS.
As a control, the 4 enzyme base mix was taken into account, which effectively consisted of the 3 E mix as mentioned here, spiked with 1 ,8 mg/gDM GH61in a volume of 100 μΙ on top of 870 μΙ 10% (w/w) aCS solution in water, pH 4.5. As blank, the 3 enzyme base mix with addition of 100 μΙ water was taken into account. All experiments were performed at least in duplicate and were incubated for 72 hours at 65°C and 600rpm. After incubation, the samples were centrifuged and 500 μΙ of the supernatant was transferred to a deep-well microtiter plate (MTP). Subsequently, soluble sugars were analysed by proton NMR as described above.
Addition of this T. thermophilus GH61 protein showed increased sugar release, also at higher DM, up to similar levels as the 3E mix spiked with GH61 , which is present in a standard 4E base mix, shown below in Table 19/ Figure 17.
Figure imgf000074_0001
Table 19: Effect of GH61 TALTH_3_00094 protein spiked on top of a 3E mix using aCS substrate; st dev, standard deviation.
Example 7. Substitution of R. emersonii BG with Talaromyces thermophilus TALTH_2_00031 in the 4 enzyme mixture activity assay at high DM.
The cellulase enhancing activity of Talaromyces thermophilus BG protein
(TALTH_2_00031) was further analysed. 100 μΙ of the concentrated supernatant of an A. niger expressing TALTH_2_00031 shake flask fermentation, obtained as described above, was spiked on top of 870 μΙ 10% (w/w) aCS solution in water, pH 4.5, and 30 pi of a three enzyme base mix (4.5 mg/g DM composed of: CBHI at 1.5 mg/g DM, CBHII at 1.25 mg/g DM and GH61 at 1.8 mg/g DM) in a 2 ml tube. By adding 100 μΙ supernatant, the dosage of TALTH_2_00031 was 0.45 mg/g DM and the final DM concentration of the mixture was 9% pCS.
As a control, the 4 enzyme base mix was taken into account, which effectively consisted of the 3 E mix as mentioned here, spiked with 0.45 mg/gDM BG in a volume of 100 μΙ on top of 870 μΙ 10% (w/w) aCS solution in water, pH 4.5. As blank, the 3 enzyme base mix with addition of 100 μΙ water, pH 4.5, was taken into account. All experiments were performed at least in duplicate and were incubated for 72 hours at 65°C and 600 rpm. After incubation, the samples were centrifuged and 500 μΙ of the supernatant was transferred to a deep-well microliter plate (MTP). Subsequently, soluble sugars were analysed by proton NMR as described above.
Addition of this T. thermophilus BG protein showed increased sugar release, also at higher DM, up to similar levels as the 3E mix spiked with BG, which is present in a standard 4E base mix, shown below in Table 20/ Figure 18.
Figure imgf000075_0001
Table 20: Effect of GH61 TALTH_2_00031 protein spiked on top of a 3E mix using aCS substrate; st dev, standard deviation.
Table 21. List of target genes and reference to gene, transcript and protein sequences
Figure imgf000076_0001
Figure imgf000077_0001
Figure imgf000078_0001

Claims

1. An isolated polynucleotide selected from the group consisting of: a) a polynucleotide comprising nucleic acid sequence as set forth in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 11 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100,
101 , 103, 104, 106, 107, 109, 110, 112, 1 13, 115, 116, 118, 119, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136, 137, 139, 140, 142, AND 143, or a functional equivalent thereof; b) a polynucleotide encoding a polypeptide comprising a polypeptide sequence as set forth in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99,
102, 105, 108, 1 1 1 , 1 14, 117, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144, or a functional equivalent thereof; c) a polynucleotide hybridizing under stringent conditions to the polynucleotide of a) or b); and d) a polynucleotide hybridizing under stringent conditions to the reverse complement of the polynucleotide of a) or b).
2. An isolated polynucleotide selected from the group consisting of. a) a polynucleotide comprising nucleic acid sequence as set forth in any one of SEQ ID NOs: 13, 14, 22, 23, 34, 35, 40, 41 , 43, 44, 46, 47, 49, 50, 61 , 62, 64, 65, 73, 74, 76, 77, 91 , 92, 121 , 122, 139, AND 140, or a functional equivalent thereof; b) a polynucleotide encoding a polypeptide comprising a polypeptide sequence as set forth in any one of SEQ ID Nos: 15, 24, 36, 42, 45, 48, 51 , 63, 66, 75, 78, 93, 123, and 141 , or a functional equivalent thereof; c) a polynucleotide hybridizing under stringent conditions to the polynucleotide of a) or b); and d) a polynucleotide hybridizing under stringent conditions to the reverse plement of the polynucleotide of a) or b).
The isolated polynucleotide of claim 1 or 2, obtainable from a fungus.
An isolated polynucleotide according to claim 1 , 2 or 3, obtainable from Talaromyces thermophilus.
A vector comprising a polynucleotide as defined in any one of claims 1 to 4.
A vector according to claim 5 further comprising a regulatory sequence operatively linked to the polynucleotide for expression of same in a suitable host cell.
A vector according to claim 6, wherein said suitable host cell is a filamentous fungus.
A host cell comprising a polynucleotide as defined in any one of claims 1 to 4 or a vector as defined in any one of claims 5 to 7.
An isolated polypeptide: a) as set forth in any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27,
30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 1 11 , 114, 117, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144, or a functional equivalent thereof b) that is at least 60%, preferably at least 70%, more preferably at least 80%, even more preferably at least 90%, 95%, 96%, 97%, 98% or 99% homologous to the any one of SEQ ID Nos: 3, 6, 9, 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 111 , 114, 117, 120, 123, 126, 129, 132, 135, 138, 141 , AND 144; c) having a sequence encoded by nucleic acid sequence as set forth in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 11 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 110, 112, 113, 115, 116, 1 18, 119, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136, 137, 139, 140, 142, AND 143, or nucleic acids that are at least 60%, preferably at least 70%, more preferably at least 80%, even more preferably at least 90%, 95%, 96%, 97%, 98% or 99% homologous to any one of said nucleic acid sequence; d) having a sequence encoded by a nucleic acid sequence hybridizing under stringent conditions to the polynucleotide as set forth in any one Of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 11 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 110, 112, 113, 115, 116, 118, 119, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136, 137, 139, 140, 142, AND 143; or e) having a sequence encoded by a nucleic acid sequence hybridizing under stringent conditions to the reverse complement of a polynucleotide as set forth in any one of SEQ ID NOs: 1 , 2, 4, 5, 7, 8, 10, 1 1 , 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31 , 32, 34, 35, 37, 38, 40, 41 , 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61 , 62, 64, 65, 67, 68, 70, 71 , 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91 , 92, 94, 95, 97, 98, 100, 101 , 103, 104, 106, 107, 109, 110, 112, 113, 115, 116, 118, 119, 121 , 122, 124, 125, 127, 128, 130, 131 , 133, 134, 136, 137, 139, 140, 142, AND 143.
10. An isolated polypeptide as set forth in any one of SEQ ID Nos: 114, 162, 231 , 282, 306, 315, 324, 357, 372, 393, 417, 504, 582, and 771 , or a functional equivalent thereof.
1 1. An isolated polypeptide according to claim 9 or 10, obtainable from Talaromyces thermophilus.
12. A polypeptide obtainable by expressing a polynucleotide according to any one of claims 1 to 4 or a vector according to any one of claims 5 to 7 in an appropriate host cell.
13. A method for manufacturing a polypeptide according to any one of claims 9 to 12 comprising the steps of transforming a suitable host cell with an isolated polynucleotide according to any one of claims 1 to 4 or a vector according to any one of claims 5 to 7, culturing said cell under conditions allowing expression of said polynucleotide and optionally purifying the encoded polypeptide from said cell or culture medium.
14. Use of a polypeptide according to any one of claims 9 to 12 for prebleaching kraft pulp.
15. Use of a polypeptide according to any one of claims 9 to 12 for processing lignin.
16. Use of a polypeptide according to any one of claims 9 to 12 for producing ethanol.
17. The use of any one of claims 14 to 16 further comprising adding a cellulose or cellulases.
18. Use of a polypeptide according to any one of the claims 9 to 12 treating textiles or dyed textiles.
19. Use of a polypeptide according to any one of the claims 9 to 12 for degrading biomass or pretreated biomass.
20. Use of a polypeptide according to any one of the claims 9 to 12 in the manufacture of a detergent.
PCT/CA2012/050198 2011-04-01 2012-03-29 Novel cell wall deconstruction enzymes of talaromyces thermophilus and uses thereof Ceased WO2012129697A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201161470825P 2011-04-01 2011-04-01
US61/470,825 2011-04-01

Publications (1)

Publication Number Publication Date
WO2012129697A1 true WO2012129697A1 (en) 2012-10-04

Family

ID=45926558

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/CA2012/050198 Ceased WO2012129697A1 (en) 2011-04-01 2012-03-29 Novel cell wall deconstruction enzymes of talaromyces thermophilus and uses thereof
PCT/EP2012/055654 Ceased WO2012130950A1 (en) 2011-04-01 2012-03-29 Novel cell wall deconstruction enzymes of talaromyces thermophilus and uses thereof

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/EP2012/055654 Ceased WO2012130950A1 (en) 2011-04-01 2012-03-29 Novel cell wall deconstruction enzymes of talaromyces thermophilus and uses thereof

Country Status (1)

Country Link
WO (2) WO2012129697A1 (en)

Cited By (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014138672A1 (en) 2013-03-08 2014-09-12 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
WO2015035029A1 (en) 2013-09-04 2015-03-12 Novozymes A/S Processes for increasing enzymatic hydrolysis of cellulosic material
WO2015039962A1 (en) * 2013-09-20 2015-03-26 Novozymes A/S Enzymatic bleaching of paper pulp
WO2015081139A1 (en) 2013-11-26 2015-06-04 Novozymes A/S Enzyme compositions and uses thereof
WO2015187935A1 (en) 2014-06-06 2015-12-10 Novozymes A/S Enzyme compositions and uses thereof
WO2016045569A1 (en) 2014-09-23 2016-03-31 Novozymes A/S Processes for producing ethanol and fermenting organisms
WO2016138167A2 (en) 2015-02-24 2016-09-01 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
WO2016145358A1 (en) 2015-03-12 2016-09-15 Novozymes A/S Enzymatic hydrolysis with hemicellulolytic enzymes
WO2016145363A1 (en) 2015-03-12 2016-09-15 Novozymes A/S Multi-stage enzymatic hydrolysis of lignocellulosic biomass employing an oxidoreductase with an aa9 polypeptide
WO2016145350A1 (en) 2015-03-12 2016-09-15 Novozymes A/S Multi-stage enzymatic hydrolysis of lignocellulosic biomass
WO2016188459A1 (en) 2015-05-27 2016-12-01 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2017019491A1 (en) 2015-07-24 2017-02-02 Novozymes Inc. Polypeptides having beta-xylosidase activity and polynucleotides encoding same
WO2017019490A1 (en) 2015-07-24 2017-02-02 Novozymes Inc. Polypeptides having arabinofuranosidase activity and polynucleotides encoding same
WO2017040907A1 (en) 2015-09-04 2017-03-09 Novozymes A/S Methods of inhibiting aa9 lytic polysaccharide monooxygenase catalyzed inactivation of enzyme compositions
WO2017050242A1 (en) 2015-09-22 2017-03-30 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2017070219A1 (en) 2015-10-20 2017-04-27 Novozymes A/S Lytic polysaccharide monooxygenase (lpmo) variants and polynucleotides encoding same
WO2017076421A1 (en) 2015-11-02 2017-05-11 Renescience A/S Solubilization of msw with blend enzymes
WO2017151957A1 (en) 2016-03-02 2017-09-08 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
WO2017165760A1 (en) 2016-03-24 2017-09-28 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
WO2017205535A1 (en) 2016-05-27 2017-11-30 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2018026868A1 (en) 2016-08-01 2018-02-08 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2018085370A1 (en) 2016-11-02 2018-05-11 Novozymes A/S Processes for reducing production of primeverose during enzymatic saccharification of lignocellulosic material
WO2019083831A1 (en) 2017-10-23 2019-05-02 Novozymes A/S Processes for reducing lactic acid in a biofuel fermentation system
WO2019201765A1 (en) 2018-04-20 2019-10-24 Renescience A/S Method for determining chemical compounds in waste
CN111100889A (en) * 2018-10-26 2020-05-05 中国石油化工股份有限公司 Method for improving lignocellulose enzymolysis efficiency
WO2020123463A1 (en) 2018-12-12 2020-06-18 Novozymes A/S Polypeptides having xylanase activity and polynucleotides encoding same
EP3805382A1 (en) 2014-08-28 2021-04-14 Renescience A/S Solubilization of msw with blend enzymes
WO2022096406A1 (en) 2020-11-04 2022-05-12 Renescience A/S Method for enzymatic and/or microbial processing of waste comprising recirculation of process water
WO2023225459A2 (en) 2022-05-14 2023-11-23 Novozymes A/S Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014140165A1 (en) 2013-03-14 2014-09-18 Dsm Ip Assets B.V. Cell wall deconstruction enzymes of paecilomyces byssochlamydoides and uses thereof
WO2014140167A1 (en) 2013-03-14 2014-09-18 Dsm Ip Assets B.V. Cell wall deconstruction enzymes of malbranchea cinnamomea and uses thereof
CN104342425B (en) * 2013-07-29 2017-11-28 瑞辰星生物技术(广州)有限公司 For improving fiber oxidation enzymatic compositions and papermaking process and the application of Paper White Degree

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010141779A1 (en) * 2009-06-03 2010-12-09 Danisco Us Inc. Cellulase variants with improved expression, activity and/or stability, and use thereof

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ATE151948T1 (en) 1993-03-31 1997-05-15 Gist Brocades Nv YEAST FORMULATION FOR PRODUCING BAKED PRODUCTS
PT659344E (en) 1993-12-24 2001-12-28 Dsm Nv DRY YEAST COMPOSITIONS DRY TRANSLATION
AR025320A1 (en) 1999-08-17 2002-11-20 Dsm Nv LIQUID COMPOSITION TO IMPROVE BREAD
PT1331850E (en) 2000-09-28 2007-03-30 Dsm Ip Assets Bv Liquid bread improving compositions
US20040091601A1 (en) 2000-12-20 2004-05-13 Parnell Marie Diane Liquid yeast compositions
WO2004074468A1 (en) 2002-05-30 2004-09-02 Dsm Ip Assets B.V. Novel pectinases and uses thereof
AU2010267983A1 (en) 2009-07-03 2012-01-19 Dsm Ip Assets B.V. Talaromyces strains and enzyme compositions
EP3293264A1 (en) 2009-07-22 2018-03-14 DSM IP Assets B.V. Improved host cell for the production of a compound of interest
WO2011035027A2 (en) * 2009-09-17 2011-03-24 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EA201201125A1 (en) 2010-02-11 2013-03-29 ДСМ АйПи АССЕТС Б.В. CELL-HOST, THE ABLE TO PRODUCT ENZYMES SUITABLE FOR DEGRADATION OF LIGNOCELLULOSE MATERIAL

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010141779A1 (en) * 2009-06-03 2010-12-09 Danisco Us Inc. Cellulase variants with improved expression, activity and/or stability, and use thereof

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK 13 November 2008 (2008-11-13), FEDOROVA,N.D., ET AL.: "Penicillium marneffei ATCC 18224 mannosidase MsdS, mRNA.", Database accession no. XM_002146884 *
DATABASE GENBANK 2 July 2009 (2009-07-02), FEDOROVA ND ET AL.: "class I alpha-mannosidase (Talaromyces stipitatus ATCC 10500)", Database accession no. XP_002481644 *
DATABASE GENBANK 2 July 2009 (2009-07-02), FEDOROVA ND ET AL.: "mannosidase MsdS (Talaromyces stipitatus ATCC 10500)", Database accession no. XP_002479214 *
DATABASE GENBANK 2 July 2009 (2009-07-02), FEDOROVA,N.D., ET AL.: "Talaromyces stipitatus ATCC 10500 class I alpha-mannosidase 1A, mRNA", Database accession no. XM_002481599 *
DATABASE GENBANK 2 July 2009 (2009-07-02), FEDOROVA,N.D., ET AL.: "Talaromyces stipitatus ATCC 10500 mannosidase MsdS, mRNA.", Database accession no. XM_002479169 *
DATABASE GENBANK 3 October 2007 (2007-10-03), FEDOROVA ND ET AL.: "mannosidase MsdS (Penicillium marneffei ATCC 18224)", Database accession no. XP_002146920 *
MAALEJ I ET AL.: "Highly Thermostable Xylanase of the Thermophilic Fungus Talaromyces thermophilus: Purification and Characterization", APPL BIOCHEM BIOTECHNOL., vol. 158, no. 1, July 2009 (2009-07-01), pages 200 - 212, XP055153925, DOI: doi:10.1007/s12010-008-8317-x *
NAKKHARAT P ET AL.: "Purification and characterisation of an intracellular enzyme with (beta- glucosidase and (beta-galactosidase activity from the thermophilic fungus Talaromyces thermophilus CBS 236.58", J BIOTECHNOL., vol. 123, no. 3, 29 May 2006 (2006-05-29), pages 304 - 313 *
NIERMAN WC ET AL.: "Genomic sequence of the pathogenic and allergenic filamentous fingus Aspergillus fumigatus", NATURE, vol. 438, no. 7071, 22 December 2005 (2005-12-22), pages 1151 - 1156 *

Cited By (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014138672A1 (en) 2013-03-08 2014-09-12 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
WO2015035029A1 (en) 2013-09-04 2015-03-12 Novozymes A/S Processes for increasing enzymatic hydrolysis of cellulosic material
WO2015039962A1 (en) * 2013-09-20 2015-03-26 Novozymes A/S Enzymatic bleaching of paper pulp
WO2015081139A1 (en) 2013-11-26 2015-06-04 Novozymes A/S Enzyme compositions and uses thereof
WO2015187935A1 (en) 2014-06-06 2015-12-10 Novozymes A/S Enzyme compositions and uses thereof
EP3805382A1 (en) 2014-08-28 2021-04-14 Renescience A/S Solubilization of msw with blend enzymes
WO2016045569A1 (en) 2014-09-23 2016-03-31 Novozymes A/S Processes for producing ethanol and fermenting organisms
WO2016138167A2 (en) 2015-02-24 2016-09-01 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
EP3739045A2 (en) 2015-02-24 2020-11-18 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
EP4458964A2 (en) 2015-02-24 2024-11-06 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
WO2016145363A1 (en) 2015-03-12 2016-09-15 Novozymes A/S Multi-stage enzymatic hydrolysis of lignocellulosic biomass employing an oxidoreductase with an aa9 polypeptide
WO2016145350A1 (en) 2015-03-12 2016-09-15 Novozymes A/S Multi-stage enzymatic hydrolysis of lignocellulosic biomass
WO2016145358A1 (en) 2015-03-12 2016-09-15 Novozymes A/S Enzymatic hydrolysis with hemicellulolytic enzymes
WO2016188459A1 (en) 2015-05-27 2016-12-01 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2017019491A1 (en) 2015-07-24 2017-02-02 Novozymes Inc. Polypeptides having beta-xylosidase activity and polynucleotides encoding same
WO2017019490A1 (en) 2015-07-24 2017-02-02 Novozymes Inc. Polypeptides having arabinofuranosidase activity and polynucleotides encoding same
WO2017040907A1 (en) 2015-09-04 2017-03-09 Novozymes A/S Methods of inhibiting aa9 lytic polysaccharide monooxygenase catalyzed inactivation of enzyme compositions
WO2017050242A1 (en) 2015-09-22 2017-03-30 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2017070219A1 (en) 2015-10-20 2017-04-27 Novozymes A/S Lytic polysaccharide monooxygenase (lpmo) variants and polynucleotides encoding same
WO2017076421A1 (en) 2015-11-02 2017-05-11 Renescience A/S Solubilization of msw with blend enzymes
WO2017151957A1 (en) 2016-03-02 2017-09-08 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
EP4410974A2 (en) 2016-03-02 2024-08-07 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
WO2017165760A1 (en) 2016-03-24 2017-09-28 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
WO2017205535A1 (en) 2016-05-27 2017-11-30 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2018026868A1 (en) 2016-08-01 2018-02-08 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2018085370A1 (en) 2016-11-02 2018-05-11 Novozymes A/S Processes for reducing production of primeverose during enzymatic saccharification of lignocellulosic material
WO2019083831A1 (en) 2017-10-23 2019-05-02 Novozymes A/S Processes for reducing lactic acid in a biofuel fermentation system
WO2019201765A1 (en) 2018-04-20 2019-10-24 Renescience A/S Method for determining chemical compounds in waste
CN111100889B (en) * 2018-10-26 2021-08-31 中国石油化工股份有限公司 Method for improving lignocellulose enzymolysis efficiency
CN111100889A (en) * 2018-10-26 2020-05-05 中国石油化工股份有限公司 Method for improving lignocellulose enzymolysis efficiency
WO2020123463A1 (en) 2018-12-12 2020-06-18 Novozymes A/S Polypeptides having xylanase activity and polynucleotides encoding same
WO2022096406A1 (en) 2020-11-04 2022-05-12 Renescience A/S Method for enzymatic and/or microbial processing of waste comprising recirculation of process water
WO2023225459A2 (en) 2022-05-14 2023-11-23 Novozymes A/S Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections

Also Published As

Publication number Publication date
WO2012130950A1 (en) 2012-10-04

Similar Documents

Publication Publication Date Title
WO2012129699A1 (en) Cell wall deconstruction enzymes of thermomyces lanuginosus and uses thereof
WO2012130950A1 (en) Novel cell wall deconstruction enzymes of talaromyces thermophilus and uses thereof
WO2012092676A1 (en) Novel cell wall deconstruction enzymes and uses thereof
US20150175980A1 (en) Novel cell wall deconstruction enzymes of scytalidium thermophilum, myriococcum thermophilum, and aureobasidium pullulans, and uses thereof
WO2014059541A1 (en) Novel cell wall deconstruction enzymes of thermoascus aurantiacus, myceliophthora fergusii (corynascus thermophilus), and pseudocercosporella herpotrichoides, and uses thereof
DK2588603T3 (en) POLYPEPTIDE THAT HAS OR CONTRIBUTES TO CARBOHYDRATE MATERIAL DEGRADING ACTIVITIES AND APPLICATIONS THEREOF
WO2014138983A1 (en) Novel cell wall deconstruction enzymes of malbranchea cinnamomea, thielavia australiensis, and paecilomyces byssochlamydoides, and uses thereof
WO2015109405A1 (en) Novel cell wall deconstruction enzymes of chaetomium thermophilum, thermomyces stellatus, and corynascus sepedonium, and uses thereof
WO2012093149A2 (en) Novel cell wall deconstruction enzymes and uses thereof
WO2014110675A1 (en) Novel cell wall deconstruction enzymes of amorphotheca resinae, rhizomucor pusillus, and calcarisporiella thermophila, and uses thereof
EP2912171B1 (en) Novel esterases in the treatment of cellulosic and lignocellulosic material
WO2016090474A1 (en) Novel cell wall deconstruction enzymes of chaetomium olivicolor, acremonium thermophilum, and myceliophthora hinnulea, and uses thereof
CN102112604A (en) Polypeptides having acetylxylan esterase activity and polynucleotides encoding same
WO2016090472A1 (en) Novel cell wall deconstruction enzymes of remersonia thermophila (stilbella thermophila), melanocarpus albomyces, and lentinula edodes, and uses thereof
WO2016090473A1 (en) Novel cell wall deconstruction enzymes of rhizomucor miehei, thermoascus thermophilus (dactylomyces thermophilus), and humicola hyalo thermophila, and uses thereof
WO2009133036A1 (en) Cellobiohydrolase 1 from penicillium chysogenum and uses thereof
US20210123030A1 (en) Polypeptides having cellulolytic enhancing activity and uses thereof
WO2009133035A1 (en) Cellobiohydrolase 1 from penicillium chysogenum and uses thereof
WO2013182669A2 (en) Novel cell wall deconstruction enzymes of myriococcum thermophilum and uses thereof
WO2009133034A1 (en) Carbohydrate modifying polypeptide and uses thereof
WO2014060379A1 (en) Cell wall deconstruction enzymes of myceliophthora fergusii (corynascus thermophilus) and uses thereof
WO2014140165A1 (en) Cell wall deconstruction enzymes of paecilomyces byssochlamydoides and uses thereof
EP3387139B1 (en) Beta-glucosidase and uses thereof
US20190002860A1 (en) Beta-glucosidase and uses thereof
WO2009133039A1 (en) Carbohydrate modifying polypeptide and uses thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12763964

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12763964

Country of ref document: EP

Kind code of ref document: A1