WO2012129555A2 - Host cells and methods for production of isobutanol - Google Patents
Host cells and methods for production of isobutanol Download PDFInfo
- Publication number
- WO2012129555A2 WO2012129555A2 PCT/US2012/030479 US2012030479W WO2012129555A2 WO 2012129555 A2 WO2012129555 A2 WO 2012129555A2 US 2012030479 W US2012030479 W US 2012030479W WO 2012129555 A2 WO2012129555 A2 WO 2012129555A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- host cell
- activity
- polypeptide
- recombinant host
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/52—Genes encoding for enzymes or proenzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
- C12P7/16—Butanols
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/38—Chemical stimulation of growth or activity by addition of chemical compounds which are not essential growth factors; Stimulation of growth by removal of a chemical compound
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
- C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
- C12P7/42—Hydroxy-carboxylic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
- C12P7/52—Propionic acid; Butyric acids
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
- Y02E50/00—Technologies for the production of fuel of non-fossil origin
- Y02E50/10—Biofuels, e.g. bio-diesel
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/52—Improvements relating to the production of bulk chemicals using catalysts, e.g. selective catalysts
Definitions
- the invention relates to recombinant host cells and methods for fermentative production of isobutanol.
- Butanol is an important industrial chemical, useful as a fuel additive, as a feedstock chemical in the plastics industry, and as a food grade extractant in the food and flavor industry. Each year 10 to 12 billion pounds of butanol are produced by petrochemical means and the need for this commodity chemical will likely increase in the future. Methods for the chemical synthesis of isobutanol are known, such as oxo synthesis, catalytic hydrogenation of carbon monoxide (Ullmann's Encyclopedia of Industrial Chemistry, 6th edition, 2003, Wiley-VCH Verlag GmbH and Co., Weinheim, Germany, Vol. 5, pp. 716-719) and Guerbet condensation of methanol with n-propanol (Carlini et al., J. Molec.
- Isobutanol is produced biologically as a by-product of yeast fermentation. It is a component of "fusel oil” that forms as a result of the incomplete metabolism of amino acids by fungi. Isobutanol is specifically produced from catabolism of L-valine. After the amine group of L-valine is harvested as a nitrogen source, the resulting a-keto acid is
- yeast host cells Provided herein are recombinant yeast host cells and methods for the production of isobutanol.
- a recombinant host cell comprises an engineered isobutanol production pathway and (a) at least one of (i) a heterologous polypeptide with ketol-acid reductoisomerase (KARI) activity selected from the group consisting of (1) a polypeptide having at least about 90% identity to a KARI enzyme derived from Bifidobacterium angulatum, Bifidobacterium dentium, Zymomonas mobilis, Clostridium beijerinckii or Anaerostipes caccae, or an active fragment thereof (2) a polypeptide having at least about 90% identity or at least about 95% identity to SEQ ID NO: 27, 29, 31 , 33, 35, 37, 39, 41 , 43, 45, 47, 49, 51 , 53, 55, 57, 59, 61 , 63, or 65; or (ii) a heterologous polynucleotide encoding the heterologous polypeptide with KARI activity of (a); and
- KARI
- a recombinant host cell comprises an isobutanol biosynthetic pathway and (a) a heterologous polypeptide with ketol-acid reductoisomerase (KARI) activity selected from the group consisting of (i) a polypeptide having at least about 90% identity to a KARI enzyme derived from Bifidobacterium angulatum, Bifidobacterium dentium, Zymomonas mobilis, Clostridium beijerinckii or Anaerostipes caccae, or an active fragment thereof, (ii) a polypeptide having at least about 90% identity or at least about 95% identity to SEQ ID NO: 27, 29, 31 , 33, 35, 37, 39, 41 , 43, 45, 47, 49, 51 , 53, 55, 57, 59, 61 , 63, or 65, (iii) a polypeptide having at least about 90% identity or at least about 95% identity to a KARI enzyme derived from Bifi
- KARI
- Enterococcus gallinarum EG2 Macrococcus caseolyticus JCSC5402, Streptococcus vestibularis, Streptococcus mutans UA 159, Streptococcus gordonii str, cgakkus sybstr. CH1, Streptococcus suis 89/1591,
- Streptococcus infantarius subsp. infantarius ATCC BAA- 102 Lactococcus lactis subsp cremoris MG 1363, Lactococcus lactis, Leuconostoc mesenteroides subsp mesenteroides ATCC8293, Lactobacillus buchneh ATCC 11577, Staphylococcus haemolyticus JCSC1435, Staphylococcus epidermidis ATCC12228, Streptococcus pneumoniae CGSP14,
- Streptococcus pneumoniae TIGR4 Streptococcus sanguinis SK36, Streptococcus salivarius SK126, Streptococcus thermophilus LMD-9, Streptococcus pneumoniae CCRI 1974M2, Lactococcus lactis subsp. lactis 111403, Leuconostoc mesenteroides subsp cremoris ATCC 19254, Leuconostoc mesenteroides subsp cremoris, Lactobacillus brevis subsp.
- heterologous polypeptide has a KM for NADH less than about 50
- a heterologous polypeptide with KARI activity having at least about 90% identity or at least about 95% identity to SEQ ID NO: 67, 69, 71 , 73, 75, 77, 79, 81 , 83, 85, 87, 89, 91 , 93, 95, 97, 99, 101 , 103, 105, 107, 109, 1 1 1 , 1 13, 1 15, 1 17, 1 19, 121 , 123, 125, 127, 129, 131 , 133, or 135 or an active fragment thereof, wherein the heterologous polypeptide has a K for NADH less than about 50; (b) a heterologous polynucleotide encoding the heterologous polypeptide with KARI activity of (a);
- the recombinant host cell comprises reduced or eliminated aldehyde dehydrogenase expression activity and reduced or eliminated acetolactate reductase expression or activity.
- the recombinant host cell comprises (i) reduced or eliminated aldehyde dehydrogenase expression or activity or reduced or eliminated acetolactate reductase expression or activity and (ii) a heterologous polynucleotide encoding a polypeptide having KARI activity and K M for NADH less than 300 ⁇ .
- the recombinant host comprises a heterologous polypeptide with KARI activity that has at least about 90% or at least about 95% identity to SEQ ID NO: 27, 29, 141 , 143, 275, or 277.
- the recombinant host cell comprises a heterologous polypeptide with KARI activity that comprises substitutions in amino acids corresponding to S56 and S58 of SEQ ID NO: 27.
- the polypeptide with KARI activity further comprises a substitution of one or more of the amino acids corresponding to 186, N87, T131 , or T191 of SEQ ID NO: 27.
- the polypeptide with KARI activity having at least 90% identity or at least 95% identity to SEQ ID NO: 31 , 33, 35, 37, 39, 41 , 43, 45, 47, 49, 51 , 53, 55, 57, 59, 61 , 63, or 65.
- the recombinant host cell has an effective isobutanol productivity of at least about 3, at least about 4, or at least about 5 grams per gram of cells after about 48 hours, wherein at least the last about 24 of the 48 hours are under anaerobic conditions.
- the recombinant host cell comprises a heterologous polypeptide with KARI activity that has a K M for NADH less than about 350, less than about 100, less than about 50, or less than about 10 ⁇ at pH 6.8.
- the recombinant host cell comprises a heterologous polypeptide with KARI activity that has at least about 90% identity or at least about 95% identity to SEQ ID NO: 376, 382, 378, or 275.
- the recombinant host cell comprises a heterologous polypeptide with KARI activity comprises an amino acid substitution at one or more of the positions corresponding to amino acids A41 , S56, S58, I87, T131 , T191 , R227, or Q246 of a KARI enzyme derived from Anaerostipes caccae (SEQ ID NO:27).
- the recombinant host cell comprises a heterologous polypeptide with KARI activity that comprises SEQ ID NO: 33 or SEQ ID NO:35 or an active fragment thereof.
- the recombinant host cell comprises a deletion, mutation, and/or substitution in an endogenous polynucleotide encoding a polypeptide having aldehyde dehydrogenase activity.
- the polypeptide having aldehyde dehydrogenase activity catalyzes the conversion of isobutyraldehyde to isobutyric acid.
- the polypeptide having aldehyde dehydrogenase activity corresponds to Enzyme Commission Number EC 1.21.3, EC 1 .2.1.4, and/or EC1.2.1 .5.
- the host cell is S.
- the polypeptide having aldehyde dehydrogenase activity is ALD2, ALD3, ALD4, ALD5, ALD6 or a homolog thereof.
- the host cell is K. lactis and the polypeptide having aldehyde
- dehydrogenase activity is is KLLA0F00440, KLLA0E23057,
- the host cell is P. stipitis and the polypeptide having aldehyde dehydrogenase activity is ALD2, ALD3, ALD4, ALD5, or ALD7.
- the host cell is Lactobacillus plantarum and said polypeptide having aldehyde dehydrogenase activity is AldH.
- the host cell is E. coli and the polypeptide having aldehyde dehydrogenase activity is aldA, aldB, or aldH.
- the host cell comprises a deletion, mutation, and/or substitution in an endogenous polynucleotide encoding a polypeptide having aldehyde oxidase activity.
- the polypeptide having aldehyde oxidase activity catalyzes the conversion of isobutyraldehyde to isobutyric acid.
- the polypeptide having aldehyde oxidase activity catalyzes the conversion of isobutyraldehyde to isobutyric acid.
- polypeptide having aldehyde oxidase activity corresponds to Enzyme Commission Number EC 1.2.3.1.
- the polypeptide having aldehyde oxidase activity is AOX1 and/or AOX2.
- the host cell comprises a deletion, mutation, and/or substitution in an endogenous polynucleotide encoding a polypeptide having acetolactate reductase activity.
- the polypeptide having acetolactate reductase activity comprises a polypeptide encoded by a polynucleotide selected from the group consisting of SEQ ID NO: 676, SEQ ID NO: 678, SEQ ID NO.
- polypeptide having acetolactate reductase activity is Y R226C.
- the recombinant host cell is a yeast host cell.
- the yeast is selected from the group consisting of Saccharomyces, Schizosaccharomyces, Hansenula, Candida, Kluyveromyces, Yarrowia, Issatchenkia, or Pichia.
- the host cell is Saccharomyces cerevisiae.
- the host cell is a bacterial cell.
- the bacterial cell is a Clostridium, Zymomonas, Escherichia, Salmonella, Rhodococcus, Pseudomonas, Bacillus, Lactobacillus, Enterococcus, Pediococcus, Alcaligenes, Klebsiella, Paenibacillus, Arthrobacter, Corynebacterium, Brevibacterium, Lactococcus,
- the bacterial cell is not E. coli.
- the engineered isobutanol production pathway of the recombinant host cell comprises the following substrate to product conversions: (a) pyruvate to acetolactate, (b) acetolactate to 2,3- dihydroxyisovalerate, (c) 2,3-dihydroxyisovalerate to 2-ketoisovalerate, (d) 2-ketoisovalerate to isobutyraldehyde, and (e) isobutyraldehyde to isobutanol and more than one of the substrate to product conversions is catalyzed by an enzyme that is heterologous to the host cell. In some embodiments, all of the substrate to product conversions are catalyzed by enzymes heterologous to the host cell.
- At least one heterologous polynucleotide encoding an enzyme heterologous to the host cell is chromosomally integrated into the host cell.
- the substrate to product conversions are catalyzed by enzymes substantially localized to the cytosol.
- the substrate to product conversion for isobutyraldehyde to isobutanol is catalyzed by an alcohol dehydrogenase enzyme that utilizes NADH as a cofactor.
- the converstion of acetolactate to 2,3- dihydroxyisovalerate is catalyzed by a KARI that can use NADH as a cofactor.
- the host cell comprises the plasmid pLH702 or pLH701 or a plasmid having the same coding regions. In some embodiments, the host cell comprises the plasmid pBP915 or a plasmid having the same coding regions. In some embodiments, the host cell comprises the plasmid pYZ067AkivDAhADH or a plasmid having the same coding regions.
- the host cell comprises reduced, disrupted, or eliminated ability to convert acetolactate to 2,3-dihydroxy-2- methylbutyrate.
- the host cell is yeast and has reduced or eliminated pyruvate decarboxylase expression or activity. In some embodiments, the host cell has reduced or eliminated PDC1 , PDC5, or PDC6 activity or a combination thereof.
- the host cell has reduced or eliminated NAD-dependent glycerol-3-phosphate dehydrogenase expression or activity. In some embodiments, the host cell has reduced GPD2 activity.
- the host cell has reduced or eliminated FRA2 expression or activity.
- the host cell produces isobutanol under anaerobic conditions and the molar ratio of isobutanol to glycerol is greater than l .
- the polypeptide having ketol-acid having ketol-acid
- reductoisomerase activity matches the profile HMM given provided in Table Z with a profile HMM E value of ⁇ 10 "3 .
- the host cell produces isobutanol at a yield greater than about 25%, about 50%, about 75%, or about 90% of theoretical yield.
- isobutanol and ethanol are produced.
- Methods for producing isobutanol include methods comprising providing a recombinant host cell as described above and contacting the host cell with a carbon substrate under conditions whereby isobutanol is produced. In some embodiments, at least a portion of the contacting occurs under anaerobic conditions. In some embodiments, the contacting occurs in the presence of an extractant. In some embodiments, the contacting occurs in the, presence of a sufficient quantity of organic extractant to form a two-phase system comprising an aqueous phase and an organic phase.
- one or more of the effective rate, effective titer, or effective yield of isobutanol is increased as compared to methods using a recombinant host cell that does not comprise a heterologous polypeptide with KARI activity, a heterologous polynucleotide encoding a polypeptide with KARI activity, reduced or eliminated aldehyde dehydrogenase activity, reduced or eliminated aldehyde oxidase activity, reduced or eliminated acetolactate reductase activity, or a combination thereof.
- one or more of the effective rate, effective titer, or effective yield of isobutanol is increased as compared to methods using a recombinant host cell that does not comprise (i) a heterologous polypeptide with KARI activity or a
- heterologous polynucleotide encoding a polypeptide with KARI activity and (ii) at least one modification that enchances performance of the
- DHMB production, isobutyric acid production, or both is reduced as compared to methods using a recombinant host cell that does not comprise a heterologous polypeptide with KARI activity, a heterologous polynucleotide encoding a polypeptide with KARI activity, reduced or eliminated aldehyde dehydrogenase activity, reduced or eliminated aldehyde oxidase activity, reduced or eliminated acetolactate reductase activity, or a combination thereof.
- DHMB production, isobutyric acid production, or both is reduced as compared to methods using a recombinant host cell that does not comprise (i) a heterologous
- polypeptide with KARI activity or a heterologous polynucleotide encoding a polypeptide with KARI activity and (ii) at least one modification that enchances performance of the engineered isobutanol production pathway.
- the molar ratio of isobutanol to glycerol is greater than 1.
- Methods for producing isobutanol also comprise providing a recombinant host cell that produces isobutanol and contacting the host cell with a carbon substrate under conditions whereby isobutanol is produced, wherein at least a portion of the contacting occurs under anaerobic conditions, and wherein the ratio of isobutanol to glycerol produced is greater than 1.
- Methods for producing isobutanol also comprise growing a recombinant yeast comprising a biosynthetic pathway capable of converting pyruvate to acetolactate under conditions whereby butanol is produced and removing DHMB from the culture.
- compositions produced by such methods are also provided herein.
- the composition comprises isobutanol and a recombinant host cell provided above.
- the composition comprises butanol and no more than about 0.5 mM DHMB.
- a fermentative composition comprises the host cell and isobutanol produced according to the methods provided above.
- compositions comprising i) a recombinant yeast capable of producing butanol, ii) butanol, and iii) no more than about 0.5 mM DHMB are also provided.
- Methods for producing a recombinant host cell are also provided. Such methods can comprise (a) providing a recombinant host cell comprising a modification in a polynucleotide encoding a polypeptide having aldehyde dehydrogenase activity or aldehyde oxidase activity; and (b) transforming the host cell with a polynucleotide encoding a polypeptide of an isobutanol biosynthetic pathway.
- isbutyraldehye to isobutyric acid are also provided. Such methods can comprise (a) providing the recombinant host cell of any one of claims 1- 52; and (b) subjecting the host cell to conditions wherein the conversion of isbutyraldehye to isobutyric acid is reduced or eliminated compared to methods using a recombinant host cell that does not comprise reduced or eliminated aldehyde dehydrogenase and/or aldehyde oxidase activity.
- the polypeptides comprise at least about 90% identity or at least about 95% identity or at least about 99% identity to SEQ ID NO: 29, 31 , 33, 35, 37, 39, 41 , 43, 45, 47, 49, 51 , 53, 55, 57, 59, 61 , 63, 65, 417, 419, 421 , 423, 425, 427, 429, 431 , 433, 434, 435, 436, 437, 438, 439, 440, 441 , 442, 443, 444, 445, 446, 447, 448, 449, 450, 451 , 452, 453, 454, 455, 456, 457, 458, 459, 460, 461 , 462, 463, 464, 465, 466, 467, 468, 469, 470, 471 , 472, 473, 474, 475, 476, 477, 478, 479, 480, 481 , 482, 483, 484, 485, 485, 48
- polypeptides comprise at least about 90% identity or at least about 95% identity or at least about 99% identity to SEQ ID NO: 417, 419, 421 , 423, 425, or 427 or an active fragment thereof and have ketol-acid reductoisomerase activity.
- a polypeptide comprises a sequence with at least about 90% identity, at least about 95% identity, or at least about 99% identity to SEQ ID NO: 927, 928, 196, 266, 267, 389, 405, 637, 781 , 782, 783, 835, 853, 854, 855, 856, 857, or 859.
- Polynucleotides encoding such polypeptides and host cells comprising such polynucleotides and polypeptides are also provided.
- Methods of converting acetolactate to 2,3-dihydroxyisovalerate are also provided.
- such methods can comprise (a) providing a polypeptide described above, and (b) contacting the polypeptide with acetolactate under conditions wherein 2,3-dihydroxyisovalerate is produced.
- a recombinant yeast comprises a biosynthetic pathway capable of converting pyruvate to acetolactate, and the yeast produces less than 0.01 moles 2,3-dihydroxy-2-methyl butyrate (DHMB) per mole of sugar consumed.
- a recombinant yeast comprises capable of converting pyruvate to acetolactate, and the yeast produces DHMB at a rate of less than about 1.0 mM/hour.
- a recombinant yeast comprises a biosynthetic pathway capable of converting pyruvate to acetolactate, and the yeast produces an amount of 2,3-dihydroxy-3-isovalerate (DHIV) that is at least about 1.5 times the amount of DHMB produced.
- DHIV 2,3-dihydroxy-3-isovalerate
- Methods of identifying a gene involved in DHMB production comprise (i) providing a collection of yeast strains comprising at least two or more gene deletions; (ii) measuring the amount of DHMB produced by individual yeast strains; (iii) selecting a yeast strain that produces no more than about 1.0 mM DHMB/hour; and (iv) identifying the gene that is deleted in the selected yeast strain.
- the methods comprise (i) providing a collection of yeast strains that over-express at least two or more genes; (ii) measuring the amount of DHMB produced by individual yeast strains; (iii) selecting a yeast strain that produces at least about 1.0 mM DHMB; and (iv) identifying the gene that is over-expressed in the selected yeast strain.
- the methods comprise (a) growing a recombinant yeast comprising a biosynthetic pathway capable of converting pyruvate to acetolactate under conditions whereby butanol is produced; and b) measuring DHIV and/or DHMB concentration.
- the growing and measuring can be performed simultaneously or sequentially and in any order.
- the measuring comprises liquid chromatography-mass spectrometry.
- the methods comprise (a) providing a composition comprising acetolactate, a KARI enzyme, and an acetolactate reductase enzyme and (b) decreasing DHMB levels.
- decreasing DHMB levels is achieved by decreasing acetolactate reductase enzyme activity.
- decreasing DHMB levels is achieved by removing DHMB from the composition.
- increasing KARI enzyme productivity in a host cell can comprises culturing a host cell, wherein the host cell comprises a heterologous KARI enzyme and at least one genetic modification that reduces, disrupts, or eliminates acetolactate reductase expression or activity, and wherein the KARI enzyme activity is decreased in the presence of DHMB.
- the KARI has at least about 90%, at least about 95%, or at least about 99% identity to E. coli or L. lactis KARI.
- the reduced, disrupted, or eliminated acetolactate reductase expression or activity substantially reduces the presence of DHMB.
- the methods comprise (a) providing a composition comprising dihydroxyisovalerate (DHIV) and a DHAD enzyme and (b) decreasing DHMB levels.
- DHIV dihydroxyisovalerate
- FIGURE 1- Shows four different isobutanol biosynthetic pathways.
- the steps labeled “a”, “b”, “c”, “d”, “e”, “f ', “g”, “h”, “i”, “j” and “k” represent the substrate to product conversions described below.
- FIGURE 2 depicts, an alignment of the amino acid sequences of the KARI from Pseudomonas fluorescens ("PF5"; SEQ ID NO: 5) and KARI from Anaerostipes caccae ("K9"; SEQ ID NO: 27). The bolded positions are targeted for mutagenesis as described herein.
- FIGURE 3A, 3B and 3C depict an alignment of the amino acid sequences of KARI enzymes from Bifidobacterium angulatum DSM 20098 ("K1"; SEQ ID NO: 141 ), Bifidobacterium dentium ATCC 27678 ("K2";
- Enterococcus gallinarum EG2 ("K25”SEQ ID NO: 376), Streptococcus thermophilus LMD-9 (“K26” SEQ ID NO: 121 ), Lactococcus lactis subsp. cremoris MG1363 (“K29”; SEQ ID NO: 382), Zymomonas mobilis (“S2”; SEQ ID NO: 277), and Lactococcus lactis (“LTS”; SEQ ID NO: 380).
- the bolded positions are targeted for mutagenesis as described herein.
- FIGURE 4 is a plasmid map of pLH556 (pHR81-Pllv5-Pf5.KARI) vector (SEQ ID NO: 138).
- FIGURE 5 shows the specific rate of isobutanol production, Qp, of the two strains, ⁇ 191 and PNY2242.
- FIGURE 6 shows the accumulation of DHIV + DHMB in the culture supernatant during the fermentation time course with PNY1910 (triangles) and PNY2242 (diamonds). (DHMB and DHIV are not distinguished by the HPLC method used.)
- FIGURE 7 shows the yield of glycerol, pyruvic acid, 2,3-butanediol (BDO), DHIV/DHMB, a-ketoisovalerate (aKIV), and isobutyric acid (iBuAc).
- BDO 2,3-butanediol
- DHIV/DHMB a-ketoisovalerate
- iBuAc isobutyric acid
- FIGURE 8 shows a summary of V ma x/K M values for K9G9 variants as described in Example 16.
- FIGURES 9A, B, and C show isobutanol to glycerol molar yield ratios, isobutanol molar yields, and isobutanol titers for K9 variants as described in Example 19.
- FIGURE 10 shows an isobutanol biosynthetic pathway.
- Step “a” represents the conversion of pyruvate to acetolactate.
- Step “b” represents the conversion of acetolactate to DHIV.
- Step “c” represents the
- Step “d” represents the conversion of KIV to isobutyraldehyde.
- Step “e” represents the conversion of isobutyraldehyde to isobutanol.
- Step “f” represents the conversion of acetolactate to DHMB.
- FIGURE 1 1 shows a phyolgenetic tree of YMR226c homologs from species of ascomycete yeast.
- a filamentous fungi (Neurospora crassa) sequence is included as an outgroup.
- FIGURE 12 shows a multiple sequence alignment (MSF Format) of nucleotide sequences of ORFs with homology to YMR226C.
- the gene names shown correspond to the accession numbers and SEQ ID NOs. given in Table 7.
- the alignment was produced by AlignX (Vector NTI).
- FIGURE 13 shows a graph of the molar yield of DHMB over time.
- FIGURE 14 depicts the production of isobutanol and isobutyric acid in yeast strain NYLA84.
- Table Z- is a table (filed electronically herewith and incorporated by reference) of the Profile HMM of experimentally verified KARI enzymes listed in Table 1 and as described in US App. Pub. Nos. 2010/0197519 and 2009/0163376, which are herein incorporated by reference in their entireties.
- the eleven positions in the profile HMM representing the columns in the alignment which correspond to the eleven cofactor switching positions in Pseudomonas fluoresceins Pf-5 KARI are identified as positions 24, 33, 47, 50, 52, 53, 61 , 80, 1 15, 156, and 170.
- Table Z is submitted herewith electronically and is incorporated herein by reference.
- N to represent nucleotides a or g or c or t.
- K is used to represent g or t.
- M is used to represent a or c.
- the last step in the biosynthesis of isobutanol via a pyruvate- utilizing biosynthetic pathway is the conversion of isobutyraldehyde to isobutanol ( Figure 1).
- a side reaction in this pathway is the conversion of isobutyraldehyde to isobutyric acid which results in reduced amounts of isobutyraldehyde available to convert into isobutanol and reduced isobutanol yield.
- there is a need to prevent the conversion of isobutyraldehyde to isobutyric acid such that increased amounts of isobutyraldehyde are available for conversion to isobutanol and isobutanol yields are increased.
- Aldehyde dehydrogenases are a family of enzymes that catalyze the oxidation (dehydrogenation) of aldehydes (Wang et al., J. Bacteriol. 180:822-30, 1998; Navarro-Avino er a/., Yeast 15:829-42, 1999; and Saint- Prix et al. , Microbiology 150:2209-20, 2004).
- aldehyde dehydrogenases that can be modified to reduce or eliminate aldehyde dehydrogenase activity, and can reduce or eliminate the conversion of isobutyraldehyde to isobutyric acid, such that increased amounts of isobutyraldehyde are available for conversion to isobutanol and isobutanol yields are increased.
- Aldehyde oxidases are a family of enzymes that catalyze the production of carboxylic acids from aldehydes (Nomura et al., Biosci.
- the biosynthesis pathway for the production of butanol in genetically engineered yeast includes the conversion of acetolactate to 2,3-dihydroxy-3-isovalerate (DHIV), which is subsequently converted to butanol. See Figure 10.
- DHIV 2,3-dihydroxy-3-isovalerate
- a side reaction in this pathway which decreases the overall production of butanol, is the conversion of acetolactate to 2,3-dihydroxy-2-methylbutyrate (DHMB).
- DHMB 2,3-dihydroxy-2-methylbutyrate
- DHMB has inhibitory effects on enzymes (dihydroxyacid dehydratase and ketol-acid reductoisomerase) in an isobutanol production pathway.
- enzymes dihydroxyacid dehydratase and ketol-acid reductoisomerase
- Applicants have solved the stated problems by providing recombinant yeast host cells comprising an isobutanol biosynthetic pathway; and at least one of: i) reduced or eliminated aldehyde
- dehydrogenase activity ii) reduced or eliminated aldehyde oxidase activity iii) reduced or eliminated acetolactate reductase activity; iv) a
- heterologous polynucleotide encoding a polypeptide having ketol-acid reductoisomerase activity; and v) a heterologous polypeptide having ketol- acid reductoisomerase activity.
- Applicants provide methods of producing butanol utilizing such host cells. Such recombinant host cells can be used to increase the production of a product of a biosynthetic pathway (e.g., isobutanol, 1 -butanol, or 2-butanol) and/or reduce or eliminate the conversion of pathway intermediates to undesirable byproducts.
- Applicants have also provided a suitable screening strategy for evaluating various candidate enzymes.
- the identified enzymes can be altered to enhance the production of a product of a biosynthetic pathway (e.g., isobutanol, 1 -butanol, or 2-butanol) and/or reduce or eliminate the conversion of pathway intermediates to undesirable byproducts.
- a biosynthetic pathway e.g., isobutanol, 1 -butanol, or 2-butanol
- compositions, a mixture, a process, a method, an article, or an apparatus that comprises a list of elements is not necessarily limited to only those elements but can include other elements not expressly listed or inherent to such composition, mixture, process, method, article, or apparatus.
- “or” refers to an inclusive or and not to an exclusive or. For example, a condition A or B is satisfied by any one of the following: A is true (or present) and B is false (or not present), A is false (or not present) and B is true (or present), and both A and B are true (or present).
- indefinite articles "a” and “an” preceding an element or component of the invention are intended to be nonrestrictive regarding the number of instances, i.e. , occurrences of the element or component.
- invention or "present invention” as used herein is a non- limiting term and is not intended to refer to any single embodiment of the particular invention but encompasses all possible embodiments as described in the claims as presented or as later amended and
- the term "about” modifying the quantity of an ingredient or reactant of the invention employed refers to variation in the numerical quantity that can occur, for example, through typical measuring and liquid handling procedures used for making concentrates or solutions in the real world; through inadvertent error in these procedures; through differences in the manufacture, source, or purity of the ingredients employed to make the compositions or to carry out the methods; and the like.
- the term “about” also encompasses amounts that differ due to different equilibrium conditions for a composition resulting from a particular initial mixture. Whether or not modified by the term “about”, the claims include equivalents to the quantities. In one embodiment, the term “about” means within 10% of the reported numerical value, or within 5% of the reported numerical value.
- “synergistic” refers to a greater-than-additive effect produced by a combination (i.e., an effect that is greater than the sum of individual effects) or an additive effect when the individual effects are not expected to be additive.
- the term also refers to the addition of one compound which results in less of another compound being required.
- butanol biosynthetic pathway refers to the enzymatic pathway to produce 1 -butanol, 2-butanol, or isobutanol.
- isobutanol biosynthetic pathways are disclosed in U.S. Patent Application Publication No. 2007/0092957, which is incorporated by reference herein.
- isobutanol biosynthetic pathway refers to the enzymatic pathway to produce isobutanol. Certain isobutanol biosynthetic pathways are illustrated in Figure 1 and described herein. From time to time
- isobutanol biosynthetic pathway is used synonymously with “isobutanol production pathway”.
- butanol refers to 2-butanol, 1 -butanol, isobutanol or mixtures thereof. Isobutanol is also known as 2-methyl-1- propanol.
- a recombinant host cell comprising an "engineered alcohol production pathway" refers to a host cell containing a modified pathway that produces alcohol in a manner different than that normally present in the host cell. Such differences include production of an alcohol not typically produced by the host cell, or increased or more efficient production.
- heterologous biosynthetic pathway refers to an enzyme pathway to produce a product in which at least one of the enzymes is not endogenous to the host cell containing the biosynthetic pathway.
- extract refers to one or more organic solvents which can be used to extract butanol from a fermentation broth.
- the term "effective titer" as used herein, refers to the total amount of a particular alcohol (e.g. butanol) produced by fermentation per liter of fermentation medium.
- the total amount of butanol includes: (i) the amount of butanol in the fermentation medium; (ii) the amount of butanol recovered from the organic extractant; and (iii) the amount of butanol recovered from the gas phase, if gas stripping is used.
- recovery and refers to removing a chemical compound from an initial mixture to obtain the compound in greater purity or at a higher
- aqueous phase refers to the aqueous phase of a biphasic mixture obtained by contacting a fermentation broth with a water-immiscible organic extractant.
- fermentation broth then specifically refers to the aqueous phase in biphasic fermentative extraction.
- organic phase refers to the non- aqueous phase of a biphasic mixture obtained by contacting a
- PDC- refers to a cell that has a genetic modification to inactivate or reduce expression of a gene encoding pyruvate decarboxylase (PDC) so that the cell substantially or completely lacks pyruvate decarboxylase enzyme activity. If the cell has more than one expressed (active) PDC gene, then each of the active PDC genes can be inactivated or have minimal expression thereby producing a PDC- cell.
- PDC pyruvate decarboxylase
- polynucleotide is intended to encompass a singular nucleic acid as well as plural nucleic acids, and refers to a nucleic acid molecule or construct, e.g., messenger RNA (mRNA) or plasmid DNA (pDNA).
- mRNA messenger RNA
- pDNA plasmid DNA
- a polynucleotide can contain the nucleotide sequence of the full- length cDNA sequence, or a fragment thereof, including the untranslated 5' and 3' sequences and. the coding sequences.
- the polynucleotide can be composed of any polyribonucleotide or polydeoxyribonucleotide, which can be unmodified RNA or DNA or modified RNA or DNA.
- polynucleotides can be composed of single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double- stranded regions, hybrid molecules comprising DNA and RNA that can be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions.
- Polynucleotide embraces chemically, enzymatically, or metabolically modified forms.
- a polynucleotide sequence can be referred to as "isolated,” in which it has been removed from its native environment.
- isolated polynucleotide encoding a polypeptide or polypeptide fragment having dihydroxy-acid dehydratase activity contained in a vector is considered isolated for the purposes of the present invention.
- isolated polynucleotide include recombinant
- Isolated polynucleotides or nucleic acids according to the present invention further include such molecules produced synthetically.
- An isolated polynucleotide fragment in the form of a polymer of DNA can be comprised of one or more segments of cDNA, genomic DNA or synthetic DNA.
- NAD(P)H consumption assay refers to an enzyme assay for the determination of the specific activity of the KARI enzyme, involving measuring the disappearance of the KARI cofactor, NAD(P)H, from the enzyme reaction. Such assays are described in Aulabaugh and Schloss, Biochemistry 29: 2824-2830, 1990, which is herein incorporated by reference in its entirety.
- NAD(P)H refers to either NADH or NADPH.
- KARI is the abbreviation for the enzyme ketol-acid reducto- isomerase.
- close proximity when referring to the position of various amino acid residues of a KARI enzyme with respect to the adenosyl 2'- phosphate of NADPH means amino acids in the three-dimensional model for the structure of the enzyme that are within about 4.5 A of the phosphorus atom of the adenosyl 2'-phosphate of NADPH bound to the enzyme.
- ketol-acid reductoisomerase (abbreviated “KARI"), and "acetohydroxy acid isomeroreductase” will be used interchangeably and refer to enzymes capable of catalyzing the reaction of (S)-acetolactate to 2,3-dihydroxyisovalerate, classified as EC number EC 1.1.1.86 (Enzyme Nomenclature 1992, Academic Press, San Diego).
- Class I ketol-acid reductoisomerase enzyme means the short form that typically has between 330 and 340 amino acid residues, and is distinct from the long form, called class II, that typically has approximately 490 residues. These enzymes are available from a number of sources, including, but not limited to E. coli 1 (amino acid SEQ ID NO: 942; GenBank Accession Number NC_000913 REGION: 3955993.3957468), Vibrio cholerae (GenBank Accession Number NC_002505 REGION:
- Pseudomonas aeruginosa GenBank Accession Number NC_002516, REGION: 5272455.5273471
- Pseudomonas fluorescens amino acid SEQ ID NO: 943; GenBank Accession Number NC_004129 REGION: 6017379.6018395.
- KARI enzymes are described for example, in U.S. Patent Nos. 7,910, 342 and 8,129,162 and U.S. Pub, App, No.2010/0197519, all of which are herein incorporated by reference in their entireties.
- KARI is found in a variety of organisms and amino acid sequence comparisons across species have revealed that there are 2 types of this enzyme: a short form (class I) found in fungi and most bacteria, and a long form (class II) typical of plants. Class I KARIs typically have between 330- 340 amino acid residues. The long form KARI enzymes have about 490 amino acid residues. However, some bacteria such as Escherichia coli possess a long form, where the amino acid sequence differs appreciably from that found in plants. KARI is encoded by the ilvC gene and is an essential enzyme for growth of E. coli and other bacteria in a minimal medium.
- Class II KARIs generally consist of a 225-residue N-terminal domain and a 287-residue C-terminal domain.
- the N-terminal domain which contains the NADPH-binding site, has an a structure and resembles domains found in other pyridine nucleotide-dependent oxidoreductases.
- the C-terminal domain consists almost entirely of a- helices.
- Ketol-acid reductoisomerase (KARI) enzymes are useful in pathways for the production of isobutanol using engineered
- a KARI that can utilize NADH can capitalize on the NADH produced by the existing glycolytic and other metabolic pathways in most commonly used microbial cells and can result in improved isobutanol production.
- ketol-acid reductoisomerase activity and “KARI activity” refer to the ability to catalyze the substrate to product conversion (S)- acetolactate to 2,3-dihydroxyisovalerate.
- acetolactate synthase refers to an enzyme that catalyzes the conversion of pyruvate to acetolactate and C0 2 .
- Acetolactate has two stereoisomers ((R) and (S)); the enzyme prefers the (S)- isomer, which is made by biological systems.
- Certain acetolactate synthases are known by the EC number 2.2.1.6 (Enzyme Nomenclature 1992, Academic Press, San Diego). These enzymes are available from a number of sources, including, but not limited to, Bacillus subtilis (GenBank Nos: CAB15618, Z99122, NCBI (National Center for Biotechnology Information) amino acid sequence, NCBI nucleotide sequence,
- Klebsiella pneumoniae GenBank Nos: AAA25079, M73842 and Lactococcus lactis (GenBank Nos: AAA25161 , L16975).
- acetohydroxy acid dehydratase refers to an enzyme that catalyzes the conversion of 2,3-dihydroxyisovalerate to a-ketoiso- valerate. Certain acetohydroxy acid dehydratases are known by the EC number 4.2.1.9. These enzymes are available from a vast array of microorganisms, including, but not limited to, E. coli (GenBank Nos:
- YP_026248 NC_000913, S. cerevisiae (GenBank Nos: NP_012550, NC_001 142), M. maripaludis (GenBank Nos: CAF29874, BX957219), B. subtilis (GenBank Nos: CAB14105, Z991 15), Lactococcus lactis (SEQ ID NO: 926), and Streptococcus mutans (SEQ ID NO: 939).
- branched-chain ⁇ -keto acid decarboxylase refers to an enzyme that catalyzes the conversion of a-ketoisovalerate to
- decarboxylases are known by the EC number 4.1.1.72 and are available from a number of sources, including, but not limited to, Lactococcus lactis (GenBank Nos: AAS49166, AY548760; CAG34226, AJ746364, Salmonella typhimurium (GenBank Nos: NP-461346, NC-003197), Clostridium acetobutylicum (GenBank Nos: NP-149189, NC-001988), Macrococcus caseolyticus (SEQ ID NO: 940), and Listeria grayi (SEQ ID NO: 941).
- Lactococcus lactis GenBank Nos: AAS49166, AY548760; CAG34226, AJ746364
- Salmonella typhimurium GenBank Nos: NP-461346, NC-003197
- Clostridium acetobutylicum GenBank Nos: NP-149189, NC-001988)
- branched-chain alcohol dehydrogenase refers to an enzyme that catalyzes the conversion of isobutyraldehyde to isobutanol.
- Certain branched-chain alcohol dehydrogenases are known by the EC number 1.1.1.265, but can also be classified under other alcohol dehydrogenases (specifically, EC 1.1.1.1 or 1.1.1.2). These enzymes utilize NADH (reduced nicotinamide adenine dinucleotide) and/or NADPH as electron donor and are available from a number of sources, including, but not limited to, S. cerevisiae (GenBank Nos: NP_010656, NC_001136; NP_014051 , NC_001 145), E. co// (GenBank No: NP_417484), C.
- acetobutylicum GenBank Nos: NP_349892, NC_003030
- B. indica amino acid SEQ ID NO: 945
- A. xylosoxidans amino acid SEQ ID NO: 944
- branched-chain keto acid dehydrogenase refers to an enzyme that catalyzes the conversion of a-ketoisovalerate to isobutyryl- CoA (isobutyryl-cofactor A), using NAD* (nicotinamide adenine dinucleotide) as electron acceptor.
- Certain branched-chain keto acid dehydrogenases are known by the EC number 1.2.4.4. These branched- chain keto acid dehydrogenases comprise four subunits, and sequences from all subunits are available from a vast array of microorganisms, including, but not limited to, B. subtilis (GenBank Nos: CAB 14336, Z991 16; CAB14335, Z991 16; CAB14334, Z99116; and CAB14337,
- aldehyde dehydrogenase activity refers to any polypeptide having a biological function of an aldehyde dehydrogenase, including the examples provided herein.
- polypeptides include a polypeptide that catalyzes the oxidation (dehydrogenation) of aldehydes.
- polypeptides include a polypeptide that catalyzes the conversion of isobutyraldehyde to isobutyric acid.
- Such polypeptides also include a polypeptide that corresponds to Enzyme Commission Numbers EC 1.2.1.3, EC 1.2.1.4 or EC 1.2.1.5.
- Such polypeptides can be determined by methods well known in the art and disclosed herein.
- aldehyde oxidase activity refers to any polypeptide having a biological function of an aldehyde oxidase, including the examples provided herein.
- polypeptides include a polypeptide that catalyzes carboxylic acids from aldehydes.
- polypeptides include a polypeptide that catalyzes the conversion of isobutyraldehyde to isobutyric acid.
- polypeptides also include a polypeptide that corresponds to Enzyme Commission Number EC 1.2.3.1. Such polypeptides can be determined by methods well known in the art and disclosed herein.
- pyruvate decarboxylase activity refers to the activity of any polypeptide having a biological function of a pyruvate decarboxylase enzyme, including the examples provided herein.
- polypeptides include a polypeptide that catalyzes the conversion of pyruvate to acetaldehyde.
- polypeptides also include a polypeptide that corresponds to Enzyme Commission Number 4.1.1.1.
- polypeptides can be determined by methods well known in the art and disclosed herein.
- a polypeptide having pyruvate decarboxylate activity can be, by way of example, PDC1 , PDC5, PDC6, or any combination thereof.
- acetolactate reductase activity refers to the activity of any polypeptide having the ability to catalyze the conversion of acetolactate to DHMB. Such polypeptides can be determined by methods well known in the art and disclosed herein.
- DHMB refers to 2,3-dihydroxy-2-methyl butyrate.
- DHMB includes "fast DHMB,” which has the 2S, 3S configuration, and “slow DHMB,” which has the 2S, 3R configurate.
- fast DHMB which has the 2S, 3S configuration
- slow DHMB which has the 2S, 3R configurate.
- Kaneko et al. Phytochemistry 39: 115-120 (1995), which is herein incorporated by reference in its entirety and refers to fast DHMB as angliceric acid and slow DHMB as tigliceric acid.
- reduced activity refers to any measurable decrease in a known biological activity of a polypeptide when compared to the same biological activity of the polypeptide prior to the change resulting in the reduced activity.
- Such a change can include a modification of a polypeptide or a polynucleotide encoding a polypeptide as described herein.
- a reduced activity of a polypeptide disclosed herein can be determined by methods well known in the art and disclosed herein.
- an eliminated activity refers to the complete abolishment of a known biological activity of a polypeptide when compared to the same biological activity of the polypeptide prior to the change resulting in the eliminated activity.
- a change can include a modification of a polypeptide or a polynucleotide encoding a polypeptide as described herein.
- An eliminated activity includes a biological activity of a polypeptide that is not measurable when compared to the same biological activity of the polypeptide prior to the change resulting in the eliminated activity.
- An eliminated activity of a polypeptide disclosed herein can be determined by methods well known in the art and disclosed herein.
- carbon substrate refers to a carbon source capable of being metabolized by host organisms of the present invention and particularly carbon sources selected from the group consisting of monosaccharides, oligosaccharides, polysaccharides, and one-carbon substrates or mixtures thereof.
- Non-limiting examples of carbon substrates are provided herein and include, but are not limited to, monosaccharides, oligosaccharides, polysaccharides, ethanol, lactate, succinate, glycerol, carbon dioxide, methanol, glucose, fructose, sucrose, xylose, arabinose, dextrose, or mixtures thereof.
- Other carbon substrates can include ethanol, lactate, succinate, or glycerol.
- “Fermentation broth” as used herein means the mixture of water, sugars (fermentable carbon sources), dissolved solids (if present), microorganisms producing alcohol, product alcohol and all other constituents of the material held in the fermentation vessel in which product alcohol is being made by the reaction of sugars to alcohol, water and carbon dioxide (C0 2 ) by the microorganisms present. From time to time, as used herein the term “fermentation medium” and “fermented mixture” can be used synonymously with “fermentation broth”.
- Biomass refers to a natural product containing a hydrolysable starch that provides a fermentable sugar, including any cellulosic or lignocellulosic material and materials comprising cellulose, and optionally further comprising hemicellulose, lignin, starch,
- Biomass can also comprise additional components, such as protein and/or lipids.
- Biomass can be derived from a single source, or biomass can comprise a mixture derived from more than one source.
- biomass can comprise a mixture of corn cobs and corn stover, or a mixture of grass and leaves.
- Biomass includes, but is not limited to, bioenergy crops, agricultural residues, municipal solid waste, industrial solid waste, sludge from paper manufacture, yard waste, wood, and forestry waste.
- biomass examples include, but are not limited to, corn grain, corn cobs, crop residues such as corn husks, corn stover, grasses, wheat, rye, wheat straw, barley, barley straw, hay, rice straw, switchgrass, waste paper, sugar cane bagasse, sorghum, soy, components obtained from milling of grains, trees, branches, roots, leaves, wood chips, sawdust, shrubs and bushes, vegetables, fruits, flowers, animal manure, and mixtures thereof.
- crop residues such as corn husks, corn stover, grasses, wheat, rye, wheat straw, barley, barley straw, hay, rice straw, switchgrass, waste paper, sugar cane bagasse, sorghum, soy, components obtained from milling of grains, trees, branches, roots, leaves, wood chips, sawdust, shrubs and bushes, vegetables, fruits, flowers, animal manure, and mixtures thereof.
- Feestock as used herein means a product containing a fermentable carbon source. Suitable feedstock include, but are not limited to, rye, wheat, com, sugar cane, and mixtures thereof.
- oxygen means growth conditions in the presence of oxygen.
- microaerobic conditions means growth conditions with low levels of oxygen (i.e., below normal atmospheric oxygen levels).
- anaerobic conditions means growth conditions in the absence of oxygen.
- specific activity is defined as the units of activity in a given amount of protein. Thus, the specific activity is not directly measured but is calculated by dividing 1) the activity in units/ml of the enzyme sample by 2) the concentration of protein in that sample, so the specific activity is expressed as units/mg, where an enzyme unit is defined as moles of product formed/minute.
- the specific activity of a sample of pure, fully active enzyme is a characteristic of that enzyme.
- the specific activity of a sample of a mixture of proteins is a measure of the relative fraction of protein in that sample that is composed of the active enzyme of interest.
- K ca t and “K M” are known to those skilled in the art and are described in Enzyme Structure and Mechanism, 2 nc ' ed. (Ferst; W.H. Freeman Press, NY, 1985; pp 98-120).
- K M the Michaelis constant, is the concentration of substrate that leads to half-maximal velocity.
- k ca t V ma /[E], where [E] is the enzyme concentration (Ferst, supra).
- total turnover and “total turnover number” are used herein to refer to the amount of product formed by the reaction of a KARI enzyme with substrate.
- catalytic efficiency is defined as the k ca t/K M of an enzyme. Catalytic efficiency is used to quantify the specificity of an enzyme for a substrate.
- isolated nucleic acid molecule isolated nucleic acid fragment
- geneetic construct will be used interchangeably and will mean a polymer of RNA or DNA that is single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases.
- An isolated nucleic acid fragment in the form of a polymer of DNA can be comprised of one or more segments of cDNA, genomic DNA or synthetic DNA.
- amino acid refers to the basic chemical structural unit of a protein or polypeptide. -The following abbreviations are used herein to identify specific amino acids: Three-Letter One-Letter
- gene refers to a nucleic acid fragment that is capable of being expressed as a specific protein, optionally including regulatory sequences preceding (5' non-coding sequences) and following (3' non- coding sequences) the coding sequence.
- “Native gene” refers to a gene as found in nature with its own regulatory sequences.
- “Chimeric gene” refers to any gene that is not a native gene, comprising regulatory and coding sequences that are not found together in nature. Accordingly, a chimeric gene can comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature.
- Endogenous gene refers to a native gene in its natural location in the genome of a microorganism.
- a “foreign” gene refers to a gene not normally found in the host microorganism, but that is introduced into the host microorganism by gene transfer.
- Foreign genes can comprise native genes inserted into a non- native microorganism, or chimeric genes.
- a “transgene” is a gene that has been introduced into the genome by a transformation procedure.
- “native” refers to the form of a polynucleotide, gene, or polypeptide as found in nature with its own regulatory sequences, if present.
- coding sequence or “coding region” refers to a DNA sequence that encodes for a specific amino acid sequence.
- Suitable regulatory sequences refer to nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences can include promoters, translation leader sequences, introns, polyadenylation recognition sequences, RNA processing sites, effector binding sites and stem-loop structures.
- endogenous refers to the native form of a polynucleotide, gene or polypeptide in its natural location in the organism or in the genome of an organism.
- Endogenous polynucleotide includes a native polynucleotide in its natural location in the genome of an organism.
- Endogenous gene includes a native gene in its natural location in the genome of an organism.
- Endogenous polypeptide includes a native polypeptide in its natural location in the organism transcribed and translated from a native polynucleotide or gene in its natural location in the genome of an organism.
- heterologous when used in reference to a
- polynucleotide, a gene, or a polypeptide refers to a polynucleotide, gene, or polypeptide not normally found in the host organism.
- "Heterologous” also includes a native coding region, or portion thereof, that is
- heterologous polynucleotide or gene can be introduced into the host organism by, e.g., gene transfer.
- a heterologous gene can include a native coding region with non-native regulatory regions that is reintroduced into the native host.
- a heterologous gene can include a native coding region that is a portion of a chimeric gene including non-native regulatory regions that is reintroduced into the native host.
- "Heterologous polypeptide" includes a native polypeptide that is reintroduced into the source organism in a form that is different from the corresponding native polypeptide.
- a “transgene” is a gene that has been introduced into the genome by a transformation procedure.
- modification refers to a change in a polynucleotide disclosed herein that results in reduced or eliminated activity of a polypeptide encoded by the polynucleotide, as well as a change in a polypeptide disclosed herein that results in reduced or eliminated activity of the polypeptide.
- Such changes can be made by methods well known in the art, including, but not limited to, deleting, mutating (e.g., spontaneous mutagenesis, random mutagenesis, mutagenesis caused by mutator genes, or transposon mutagenesis), substituting, inserting, down-regulating, altering the cellular location, altering the state of the polynucleotide or polypeptide (e.g., methylation, phosphorylation or ubiquitination), removing a cofactor, introduction of an antisense RNA/DNA, introduction of an interfering RNA/DNA, chemical modification, covalent modification, irradiation with UV or X-rays, homologous recombination, mitotic recombination, promoter replacement methods, and/or combinations thereof.
- deleting, mutating e.g., spontaneous mutagenesis, random mutagenesis, mutagenesis caused by mutator genes, or transposon mutagenesis
- substituting inserting, down-regulating, alter
- Guidance in determining which nucleotides or amino acid residues can be modified can be found by comparing the sequence of the particular polynucleotide or polypeptide with that of homologous polynucleotides or polypeptides, e.g., yeast or bacterial, and maximizing the number of modifications made in regions of high homology (conserved regions) or consensus sequences.
- recombinant genetic expression element refers to a nucleic acid fragment that expresses one or more specific proteins, including regulatory sequences preceding (5' non-coding sequences) and following (3' termination sequences) coding sequences for the proteins.
- a chimeric gene is a recombinant genetic expression element.
- the coding regions of an operon can form a recombinant genetic expression element, along with an operably linked promoter and termination region.
- Regulatory sequences refers to nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non- coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences can include promoters, enhancers, operators, repressors, transcription termination signals, translation leader sequences, introns, polyadenylation recognition sequences, RNA processing site, effector binding site and stem-loop structure.
- promoter refers to a nucleic acid sequence capable of controlling the expression of a coding sequence or functional RNA.
- a coding sequence is located 3' to a promoter sequence.
- Promoters can be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic nucleic acid segments. It is
- promoters can direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental or physiological conditions. Promoters which cause a gene to be expressed in most cell types at most times are commonly referred to as “constitutive promoters”. "Inducible promoters,” on the other hand, cause a gene to be expressed when the promoter is induced or turned on by a promoter- specific signal or molecule. It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of different lengths can have identical promoter activity.
- FBA1 promoter can be used to refer to a fragment derived from the promoter region of the FBA1 gene.
- terminal refers to DNA sequences located downstream of a coding sequence. This includes polyadenylation recognition sequences and other sequences encoding regulatory signals capable of affecting mRNA processing or gene expression.
- the polyadenylation signal is usually characterized by affecting the addition of polyadenylic acid tracts to the 3' end of the mRNA precursor.
- the 3' region can influence the transcription, RNA processing or stability, or translation of the associated coding sequence. It is recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of different lengths can have identical terminator activity.
- CYC1 terminator can be used to refer to a fragment derived from the terminator region of the CYC1 gene.
- operably linked refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is affected by the other.
- a promoter is operably linked with a coding sequence when it is capable of effecting the expression of that coding sequence (i.e. , that the coding sequence is under the
- Coding sequences can be operably linked to regulatory sequences in sense or antisense orientation.
- expression refers to the transcription and stable accumulation of sense (mRNA) or antisense RNA derived from the nucleic acid fragment of the invention. Expression can also refer to translation of mRNA into a polypeptide.
- overexpression refers to expression that is higher than endogenous expression of the same or related gene.
- a heterologous gene is overexpressed if its expression is higher than that of a comparable endogenous gene.
- the term overexpression refers to an increase in the level of nucleic acid or protein in a host cell.
- overexpression can result from increasing the level of transcription or translation of an endogenous sequence in a host cell or can result from the introduction of a heterologous sequence into a host cell. Overexpression can also result from increasing the stability of a nucleic acid or protein sequence.
- transformation refers to the transfer of a nucleic acid fragment into the genome of a host microorganism, resulting in genetically stable inheritance.
- Host microorganisms containing the transformed nucleic acid fragments are referred to as “transgenic” or “recombinant” or “transformed” microorganisms.
- Plasmid refers to an extra chromosomal element often carrying genes which are not part of the central metabolism of the cell, and usually in the form of circular double- stranded DNA fragments.
- Such elements can be autonomously replicating sequences, genome integrating sequences, phage or nucleotide sequences, linear or circular, of a single- or double-stranded DNA or RNA, derived from any source, in which a number of nucleotide sequences have been joined or recombined into a unique construction which is capable of introducing a promoter fragment and DNA sequence for a selected gene product along with appropriate 3' untranslated sequence into a cell.
- Transformation cassette refers to a specific vector containing a foreign gene and having elements in addition to the foreign gene that facilitates transformation of a particular host cell.
- Expression cassette refers to a specific vector containing a foreign gene and having elements in addition to the foreign gene that allow for enhanced expression of that gene in a foreign host.
- site-saturation library refers to a library which contains random substitutions at a specific amino acid position with up to and including all 20 possible amino acids at once.
- error-prone PCR refers to adding random copying errors by imposing imperfect or 'sloppy' PCR reaction conditions which generate randomized libraries of mutations in a specific nucleotide sequence.
- cognate degeneracy refers to the nature in the genetic code permitting variation of the nucleotide sequence without affecting the amino acid sequence of an encoded polypeptide.
- the skilled artisan is well aware of the "codon-bias" exhibited by a specific host cell in usage of nucleotide codons to specify a given amino acid. Therefore, when synthesizing a gene for improved expression in a host cell, it is desirable to design the gene such that its frequency of codon usage approaches the frequency of preferred codon usage of the host cell.
- codon-optimized refers to genes or coding regions of nucleic acid molecules for transformation of various hosts, refers to the alteration of codons in the gene or coding regions of the nucleic acid molecules to reflect the typical codon usage of the host organism without altering the polypeptide encoded by the DNA. Such optimization includes replacing at least one, or more than one, or a significant number, of codons with one or more codons that are more frequently used in the genes of that organism.
- Deviations in the nucleotide sequence that comprise the codons encoding the amino acids of any polypeptide chain allow for variations in the sequence coding for the gene. Since each codon consists of three nucleotides, and the nucleotides comprising DNA are restricted to four specific bases, there are 64 possible combinations of nucleotides, 61 of which encode amino acids (the remaining three codons encode signals ending translation).
- the "genetic code” which shows which codons encode which amino acids is reproduced herein as Table 2A. As a result, many amino acids are designated by more than one codon.
- amino acids alanine and proline are coded for by four triplets, serine and arginine by six, whereas tryptophan and methionine are coded by just one triplet.
- This degeneracy allows for DNA base composition to vary over a wide range without altering the amino acid sequence of the proteins encoded by the DNA.
- Codon preference or codon bias
- Codon bias often correlates with the efficiency of translation of messenger RNA (mRNA), which is in turn believed to be dependent on, inter alia, the properties of the codons being translated and the availability of particular transfer RNA (tRNA) molecules.
- mRNA messenger RNA
- tRNA transfer RNA
- the predominance of selected tRNAs in a cell is generally a reflection of the codons used most frequently in peptide synthesis. Accordingly, genes can be tailored for optimal gene expression in a given organism based on codon optimization.
- Codon usage tables are readily available, for example, at the "Codon Usage Database” available at www.kazusa.or.jp/codon/ (visited March 20, 2008), and these tables can be adapted in a number of ways. See Nakamura, Y., et al. Nucl. Acids Res. 28:292 (2000). Codon usage tables for yeast, calculated from GenBank Release 128.0 [15 February 2002], are reproduced below as Table 2B.
- This table uses mRNA nomenclature, and so instead of thymine (T) which is found in DNA, the tables use uracil (U) which is found in RNA.
- Table 2B has been adapted so that frequencies are calculated for each amino acid, rather than for all 64 codons.
- Randomly assigning codons at an optimized frequency to encode a given polypeptide sequence can be done manually by calculating codon frequencies for each amino acid, and then assigning the codons to the polypeptide sequence randomly.
- various algorithms and computer software programs are readily available to those of ordinary skill in the art. For example, the "EditSeq” function in the Lasergene Package, available from DNAstar, Inc., Madison, Wl, the backtranslation function in the VectorNTI Suite, available from InforMax, Inc., Bethesda, MD, and the "backtranslate" function in the GCG-Wisconsin Package, available from Accelrys, Inc., San Diego, CA.
- various resources are publicly available to codon-optimize coding region sequences, e.g., the
- Codon-optimized coding regions can be designed by various methods known to those skilled in the art including software packages such as "synthetic gene designer"
- a polynucleotide or nucleic acid fragment is "hybridizable" to another nucleic acid fragment, such as a cDNA, genomic DNA, or RNA molecule, when a single-stranded form of the nucleic acid fragment can anneal to the other nucleic acid fragment under the appropriate conditions of temperature and solution ionic strength.
- Hybridization and washing conditions are well known and exemplified in Sambrook, J., Fritsch, E. F. and Maniatis, T. Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory: Cold Spring Harbor, NY (1989), particularly Chapter 11 and Table 1 1.1 therein (entirely incorporated herein by reference).
- Stringency conditions can be adjusted to screen for moderately similar fragments (such as homologous sequences from distantly related organisms), to highly similar fragments (such as genes that duplicate functional enzymes from closely related organisms).
- Post hybridization washes determine stringency conditions. One set of conditions uses a series of washes starting with 6X SSC, 0.5% SDS at room temperature for 15 min, then repeated with 2X SSC, 0.5% SDS at 45 °C for 30 min, and then repeated twice with 0.2X SSC, 0.5% SDS at 50 °C for 30 min.
- Another set of stringent conditions uses higher temperatures in which the washes are identical to those above except for the temperature of the final two 30 min washes in 0.2X SSC, 0.5% SDS was increased to 60 °C.
- Another set of highly stringent conditions uses two final washes in 0.1X SSC, 0.1 % SDS at 65 °C.
- An additional set of stringent conditions include hybridization at 0.1 X SSC, 0.1 % SDS, 65 °C and washes with 2X SSC, 0.1% SDS followed by 0.1 X SSC, 0.1% SDS, for example.
- RNA:RNA, DNA:RNA, DNA:DNA For hybrids of greater than 100 nucleotides in length, equations for calculating Tm have been derived (see Sambrook et al., supra, 9.50 9.51).
- the length for a hybridizable nucleic acid is at least about 10 nucleotides. In one embodiment, a minimum length for a hybridizable nucleic acid is at least about 15 nucleotides; at least about 20 nucleotides; or the length is at least about 30 nucleotides.
- the temperature and wash solution salt concentration can be adjusted as necessary according to factors such as length of the probe.
- polypeptide is intended to encompass a singular “polypeptide” as well as plural “polypeptides,” and refers to a molecule composed of monomers (amino acids) linearly linked by amide bonds (also known as peptide bonds).
- polypeptide refers to any chain or chains of two or more amino acids, and does not refer to a specific length of the product.
- polypeptides can be derived from a natural biological source or produced by recombinant technology, but is not necessarily translated from a designated nucleic acid sequence. It can be generated in any manner, including by chemical synthesis.
- an “isolated” polypeptide or a fragment, variant, or derivative thereof is intended a polypeptide that is not in its natural milieu. No particular level of purification is required.
- an isolated polypeptide can be removed from its native or natural environment.
- Recombinantly produced polypeptides and proteins expressed in host cells are considered isolated for purposed of the invention, as are native or recombinant polypeptides which have been separated, fractionated, or partially or substantially purified by any suitable technique.
- variants and mutant are synonymous and refer to a polypeptide differing from a specifically recited polypeptide by one or more amino acid insertions, deletions, mutations, and
- polynucleotide variants encoding these same or similar polypeptides can be synthesized or selected by making use of the "redundancy" in the genetic code.
- Various codon substitutions such as silent changes which produce various restriction sites, can be introduced to optimize cloning into a plasmid or viral vector for expression. Mutations in the polynucleotide sequence can be reflected in the polypeptide or domains of other peptides added to the polypeptide to modify the properties of any part of the polypeptide.
- mutations can be used to reduce or eliminate expression of a target protein and include, but are not limited to, deletion of the entire gene or a portion of the gene, inserting a DNA fragment into the gene (in either the promoter or coding region) so that the protein is not expressed or expressed at lower levejs, introducing a mutation into the coding region which adds a stop codon or frame shift such that a functional protein is not expressed, and introducing one or more mutations into the coding region to alter amino acids so that a non-functional or a less enzymatically active protein is expressed.
- substitutions can be the result of replacing one amino acid with another amino acid having similar structural and/or chemical properties, i.e., conservative amino acid replacements, or they can be the result of replacing one amino acid with an amino acid having different structural and/or chemical properties, i.e., non-conservative amino acid replacements.
- Constant amino acid substitutions can be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, or the amphipathic nature of the residues involved.
- nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine; polar neutral amino acids. include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine; positively charged (basic) amino acids include arginine, lysine, and histidine; and negatively charged (acidic) amino acids include aspartic acid and glutamic acid.
- non-conservative amino acid substitutions can be made by selecting the differences in polarity, charge, solubility, hydrophobicity, hydrophilicity, or the amphipathic nature of any of these amino acids.
- “Insertions” or “deletions” can be within the range of variation as structurally or functionally tolerated by the recombinant proteins. The variation allowed can be experimentally determined by systematically making insertions, deletions, or substitutions of amino acids in a polypeptide molecule using recombinant DNA techniques and assaying the resulting recombinant variants for activity.
- a "substantial portion" of an amino acid or nucleotide sequence is that portion comprising enough of the amino acid sequence of a polypeptide or the nucleotide sequence of a gene to putatively identify that polypeptide or gene, either by manual evaluation of the sequence by one skilled in the art, or by computer-automated sequence comparison and identification using algorithms such as BLAST (Altschul, S. F. , et al. , J. Mol. Biol., 215:403-410 (1993)). In general, a sequence of ten or more contiguous amino acids or thirty or more nucleotides is necessary in order to putatively identify a polypeptide or nucleic acid sequence as
- oligonucleotide probes comprising 20-30 contiguous nucleotides can be used in sequence-dependent methods of gene identification (e.g., Southern hybridization) and isolation (e.g. , in situ hybridization of bacterial colonies or bacteriophage plaques).
- short oligonucleotides of 12-15 bases can be used as amplification primers in PCR in order to obtain a particular nucleic acid fragment comprising the primers.
- a "substantial portion" of a nucleotide sequence comprises enough of the sequence to specifically identify and/or isolate a nucleic acid fragment comprising the sequence.
- adenine is complementary to thymine and cytosine is complementary to guanine
- cytosine is complementary to guanine
- percent identity is a relationship between two or more polypeptide sequences or two or more
- identity also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as the case may be, as determined by the match between strings of such sequences.
- identity and similarity can be readily calculated by known methods, including but not limited to those described in: 1.) Computational Molecular Biology (Lesk, A. M., Ed.) Oxford University: NY (1988); 2.) Biocomputinq:
- Methods to determine identity are designed to give the best match between the sequences tested. Methods to determine identity and similarity are codified in publicly available computer programs. Sequence alignments and percent identity calculations can be performed using the MegAlignTM program of the LASERGENE bioinformatics computing suite (DNASTAR Inc., Madison, Wl). Multiple alignments of the sequences are performed using the "Clustal method of alignment” which encompasses several varieties of the algorithm including the "Clustal V method of alignment” corresponding to the alignment method labeled Clustal V (described by Higgins and Sharp, CABIOS. 5:151-153 (1989); Higgins, D.G. et al. , Comput. Appl.
- Clustal W method of alignment is available and corresponds to the alignment method labeled Clustal W (described by Higgins and Sharp, CABIOS. 5:151 -153 (1989); Higgins, D.G. er a/. , Comput. Appl. Biosci. 8:189-191 (1992)) and found in the MegAlignTM v6.1 program of the
- polypeptides such as from other species, wherein such polypeptides have the same or similar function or activity, or in describing the corresponding polynucleotides.
- percent identities include, but are not limited to: 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or any integer percentage from 55% to 100% can be useful in describing the present invention, such as 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 9
- polynucleotide having at least 50 nucleotides, at least 100 nucleotides, at least 150 nucleotides, at least 200 nucleotides, or at least 250 nucleotides encode a polypeptide having at least 50 amino acids, at least 100 amino acids, at least 150 amino acids, at least 200 amino acids, or at least 250 amino acids.
- sequence analysis software refers to any computer algorithm or software program that is useful for the analysis of nucleotide or amino acid sequences.
- Sequence analysis software can be commercially available or independently developed. Typical sequence analysis software will include, but is not limited to: 1 .) the GCG suite of programs (Wisconsin Package Version 9.0, Genetics Computer Group (GCG), Madison, Wl); 2.) BLASTP, BLASTN, BLASTX (Altschul et a/., J. Mol. Biol., 215:403-410 (1990)); 3.) DNASTAR (DNASTAR, Inc.
- Maniatis Maniatis
- Silhavy T. J., Bennan, M. L. and Enquist, L. W., Experiments with Gene Fusions, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1984); and by Ausubel, F. M. er a/., Current Protocols in Molecular Biology, published by Greene Publishing Assoc. and Wiley-lnterscience (1987). Additional methods used here are in Methods in Enzymology, Volume 194, Guide to Yeast Genetics and Molecular and Cell Biology (Part A, 2004, Christine Guthrie and Gerald R. Fink (Eds.), Elsevier Academic Press, San Diego, CA).
- the genetic manipulations of a recombinant host cell disclosed herein can be performed using standard genetic techniques and screening and can be made in any host cell that is suitable to genetic manipulation (Methods in Yeast Genetics, 2005, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 201-202).
- a. recombinant host cell disclosed herein can be any yeast or fungi host useful for genetic modification and recombinant gene expression including those yeast mentioned elsewhere herein, such as in Table 7.
- a recombinant host cell can be a member of the genera Issatchenkia, Zygosaccharomyces,
- the recombinant host cells and methods provided herein address a need that arises in the microbial production of isobutanol where the KARI enzyme performs a vital role.
- the substrate to product conversion of acetolactate to dihydroxyisovalerate (DHIV) is catalyzed by the KARI enzyme.
- polypeptides having ketol-acid reductoisomerase activity that are members of the SLSL Clade of KARIs.
- Polypeptides having KARI activity disclosed therein were found to be effective for isobutanol production.
- the SLSL Clade of KARIs include those KARI enzymes listed in Table 3.
- Staphylococcus epidermidis A TCC 12228 1 10 1 11
- polypeptides having KARI activity that function in an isobutanol production pathway have isobutanol titer and/or effective isobutanol productivity comparable to or better than that with the Lactococcus lactis KARI (SEQ ID NO: 380).
- polypeptides having KARI activity may thus be suitable for isobutanol production. It will be appreciated that using a combination of structural and sequence information available in the art, polypeptides comprising KARI activity and less than 100% identity to the exemplified sequences can be constructed for use in isobutanol biosynthetic pathways. For example, crystal structures of the E. coli KARI enzyme at 2.6 A resolution have been solved (Tyagi, et al. , Protein Sci., 14: 3089- 3100, 2005) as has the structure of the P. aeruginosa KARI (Ahn, et al., J. Mol.
- isobutanol is believed to utilize the glycolysis pathway present in the host microorganism.
- glycolysis pathway present in the host microorganism.
- two molecules of pyruvate from glucose during glycolysis, there is net production of two molecules of NADH from NAD+ by the glyceraldehyde- 3-phosphate dehydrogenase reaction.
- isobutanol from two molecules of pyruvate, there is net consumption of one molecule of NAD(P)H, by the KARI reaction, and one molecule of NAD(P)H by the isobutanol dehydrogenase reaction.
- NADPH NADPH to be consumed is generated by metabolism (for example, by the pentose phosphate pathway) consuming substrate in the process.
- the cell strives to maintain homeostasis in the NAD+/NADH ratio, leading to the excess NADH produced in isobutanol production being consumed in wasteful reduction of other metabolic intermediates; e.g., by the production of glycerol (Bakker, et al., 2001. Stoichiometry and compartmentation of NADH metabolism in
- substitutions to the KARI enzyme sequences provided in Table 3 and in Table 10 to produce variants with varying ability to utilize NADH as a cofactor provide alternatives that may be employed to optimize the efficiency of a biosynthetic pathway utilizing KARI, such as an isobutanol biosynthetic pathway, for particular production conditions. Demonstrated in the Examples is isobutanol production under conditions switched from aerobic to anaerobic for variants of the K9 KARI enzyme derived from
- Anaerostipes caccae with, differing abilities to utilize NADH are produced with, differing abilities to utilize NADH.
- one of skill in the art will be able to produce recombinant host cells comprising a SLSL Clade KARI enzyme, or a an Enterococcus gallinarum, Streptococcus thermophilus Lactococcus lactis subsp. cremoris MG 1363, Bifidobacterium angulatum, Bifidobacterium dentium, or Anaerostipes caccae, Lactococcus lactis KARI enzyme or a variant or active fragment thereof suited for a range of production conditions.
- a polypeptide having KARI activity and having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, or at least about 99% identity to a KARI enzyme of Table 3 or Table 10, or Examples 16, 17, 21 and having a K M for NADH less than about 300 ⁇ , 100 ⁇ , 50 ⁇ , 20 ⁇ , 10 ⁇ , or 5 ⁇ .
- such polypeptides have a KM for NADH less than that of the corresponding native enzyme.
- the ratio of K for NADH to KM for NAPDH is less than 0.1 , in some embodiments less than 1 , in some embodiments less than 2, in some embodiments, less than 4.
- KARI enzymes and variants thereof that are particularly suitable for isobutanol production include, but are not limited to, variants of a ketol- acid reductoisomerase from Anaerostipes caccae DSM 14662 (SEQ ID NO: 643): "K9G9” (SEQ ID NO: 644) and "K9D3" (SEQ ID NO: 645) which have K for NADH lower than that of the native enzyme (SEQ ID NO: 643).
- Host cells provided herein may comprise a polypeptide having ketol-acid reductoisomerase activity.
- such polypeptides have at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, or at least about 99% identity to SEQ ID NO: 643, an active variant thereof; or a KARI derived from Anaerostipes caccae DSM 14662, or an active variant thereof.
- the polypeptides have at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, or at least about 99% identity to SEQ ID NO: 645 or 644.
- the polypeptides comprise SEQ ID NO: 645or 644.
- polypeptides having KARI activity comprise at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, or at least about 99% identity to the amino acid sequence of SEQ ID NO: 419 [JB4P], 427 [SB2], and all those variants listed in Tables 25 and 26.
- Such variants provide alternatives for optimizing the efficiency of the isobutanol biosynthetic pathway for particular production conditions. Demonstrated in the Examples is isobutanol production under conditions.
- Example 1 Described in Example 1 is a biodiversity screen of KARI-encoding genes from various bacterial and fungal species which revealed suitable KARIs for isobutanol production. Equipped with this disclosure, one of skill in the art will be readily able to identify additional suitable polypeptides having KARI activity.
- sequences of other polynucleotides, genes and/or polypeptides can be identified in the literature and in bioinformatics databases well known to the skilled person using sequences disclosed herein and available in the art. For example, such sequences can be identified through BLAST searching of publicly available databases with
- polynucleotide or polypeptide sequences disclosed herein can be used to identify other KARI homologs in nature.
- each of the KARI encoding nucleic acid fragments disclosed herein can be used to isolate genes encoding homologous proteins.
- sequence-dependent protocols include, but are not limited to (1) methods of nucleic acid hybridization; (2) methods of DNA and RNA amplification, as exemplified by various uses of nucleic acid amplification technologies [e.g., polymerase chain reaction (PCR), Mullis et al., U.S. Patent No. 4,683,202; ligase chain reaction (LCR), Tabor et al., Proc. Acad. Sci. USA 82:1074 (1985); or strand displacement amplification (SDA), Walker et al., Proc. Natl. Acad. Sci. U.S.A., 89:392 (1992)]; and (3) methods of library construction and screening by complementation.
- PCR polymerase chain reaction
- LCR ligase chain reaction
- SDA strand displacement amplification
- polypeptides provided herein can generate active fragments of polypeptides provided herein, for example, by truncating polypeptides provided herein based on sequence alignments at the N-terminus and confirming KARI activity.
- Anaerostipes caccae KARIs and variants thereof provided herein are truncated at the N-terminus.
- up to and including the first five amino acids are truncated from a polypeptide provided herein.
- the polypeptide is SEQ ID NO: 27 or a variant thereof.
- a polypeptide having KARI activity comprises SEQ ID NO: 635, 637 (encoded by polynucleotide sequences SEQ ID NO: 636 and 638, respectively), K9_Annabel_SH (SEQ ID NO:862, protein SEQ ID NO:863) and
- K9_Zeke_SH (SEQ ID NO: 860, protein SEQ ID NO: 861), or any variant listed in Table 40.
- mutations in the positions corresponding to 50, 52 and 53, and optionally 47, of the Pseudomonas fluorescens KARI in the KARI enzyme from Anaerostipes caccae result in KARIs with lowered K M for NADH as compared to wild-type, verifying that mutations in these positions produce NADH accepting variants of highly effective KARIs. Further mutations of Anaerostipes caccae KARI, revealed positions which further lower the KM for NADH.
- polypeptides derived from an organism listed herein, for example, in Tables 3 and 10 having KARI activity and comprising substitutions at at least two of the four positions corresponding to positions 47, 50, 52, and 53 of PF5 KARI as compared to the native amino acid sequence are provided herein.
- polypeptides having KARI activity and comprising substitutions in the phosphate binding region are provided herein.
- polypeptides having KARI activity and comprising substitutions at positions corresponding to S56 and S58 of K9 KARI (SEQ ID NO: 27).
- the substitution at the position corresponding to S56 is A.
- the substitution at the position corresponding to S58 is D or E.
- the substitution at the position corresponding to S53 is Q, E, P, or A.
- the substitution at the position corresponding to S56 is V or D.
- the substitution at the position corresponding to S58 is D or Q.
- the polypeptides further comprise a substitution at one or more positions corresponding to I86, N87, N107, T131 , or T191 of K9 KARI (SEQ ID NO: 27). In some embodiments, the polypeptides comprise a substitution at at least 2, at least 3, at least 4, or all of the indicated positions. In some embodiments, the substitution at the position corresponding to I86 is T or V. In some embodiments, the substitution at the position corresponding to N87 is P. In some embodiments, the substitution at the position corresponding to N107 is S. In some embodiments, the substitution at the position corresponding to T131 is C, L, A, M or V. In some embodiments, the substitution at the position corresponding to T191 is A, S, D, C, or G.
- the polypeptides comprise fewer than 10, 15, or 20 substitutions with respect to the wild-type sequence.
- the polypeptides match the Profile HMM based on experimentally verified KARIs and given in Table Z with an E value less than ⁇ 10 ⁇ 3 . Sequences can be compared to the profile HMM given in Table Z using hmmsearch (HMMER software package available from Janelia Farm Research Campus, Ashburn, VA).
- polypeptides having KARI activity and lowered K M for NADH can be obtained using methods described and demonstrated herein.
- a polypeptide having KARI activity can be employed in the construction of a site-saturation gene library as described herein. Kits for construction of such gene libraries are commercially available (for example, from USB Corporation, Cleveland, OH, #78480.)
- Site-directed mutagenesis can also be carried out using commercially available kits (for example, the QuickChange II XL site directed mutagenesis kit, Catalog # 200524, Stratagene, La Jolla, CA).
- Primer design for target sites for mutagenesis is well-known in the art, and multiple sequence alignment to identify the target sites is likewise well-known.
- KARI activity with NADH or NADPH can be readily assessed using methods known in the art and/or disclosed herein.
- KARI activity can be determined by measuring the disappearance of the NADPH or NADH from the reaction at 340 nm or by determination of the Michaelis constant via measurement of formation of 2,3-dihydroxyisovalerate using HPLC/MS.
- isobutanol production from a strain comprising variants can be confirmed.
- V ma x KM ratios can be calculated for each cofactor at saturating acetolactate; those variants with a higher ratio for NADH will react at a higher rate with NADH than NADPH under conditions of equal-molar concentrations of the two cofactors and saturating acetolactate.
- V ma x and K values for NADH and NADPH can be determined using methods known in the art and/or provided herein (see Example 16). For example, to determine V MAX and KM values for NADH and NADPH, the partially purified proteins can be assayed at various concentrations of NADH and NADPH.
- polypeptides comprising substitution at one or more or all of the positions corresponding to K57, Y53, and E74 of K9 KARI (SEQ ID NO: 27). Also provided herein are polypeptides comprising substitutions at one or more or all of the positions corresponding to Y53, K57, E74, N87 and K90, In embodiments, the substitution at the position corresponding to Y53 is F. In embodiments, the substitution at the position corresponding to Y53 is F.
- the substitution at the position corresponding to K57 is E. In embodiments, the substitution at the position corresponding to E74 is G. In embodiments, the substitution at the position corresponding to N87 is P. In embodiments, the substitution at the position corresponding to K90 is M or L. In embodiments, the variants comprise substitutions of at least one position corresponding to S56 or S58 of SEQ ID NO: 27 and further comprise at least one, at least two, at least three, or more than three further substitution(s) corresponding to positions of SEQ ID NO: 27 identified herein.
- the polypeptides comprise fewer than 2, 3, 4, 5, 10, 15, or 20 substitutions with respect to the wild-type sequence.
- the polypeptides match the Profile HMM based on experimentally verified KARIs and given in Table Z with an E value less than ⁇ 10 ⁇ 3 .
- variants of K9SB2 (SEQ ID NO: 427) were generated and screened for variants with reduced NADPH affinity, revealing additional positions for substitution.
- polypeptides further comprise substitutions at one or more positions corresponding to F53, G55, A56, W59, F67, I84, L85, Q91 , M94, and P135 of SEQ ID NO: 427.
- the substitution at position G55 is D or C
- the substitution at position Q91 is L
- the substitution at position G55 is D or C
- the substitution at position Q91 is L
- substitution at position A56 is T or V
- the substitution at P135 is S
- the substitution at position F53 is L
- the substitution at position M94 is I
- the substitution at position F67 is L or I
- the substitution at position W59 is C
- the substitution at position I84 is L
- the substitution at position L85 is M.
- PAO-KARI Pseudomonas aeruginosa
- the structure of PF5-KARI with bound NADPH, acetolactate and magnesium ions was built based on the crystal structure of P. aeruginosa PA01-KARI (PDB ID 1 NP3, Ahn H. J. et al., J. Mol. Biol., 328: 505-515, 2003) which has 92% amino acid sequence homology to PF5 KARI.
- PA01-KARI structure is a homo-dodecamer and each dodecamer consists of six homo-dimers with extensive dimer interface.
- the active site of KARI is located in this dimer interface.
- the biological assembly is formed by six homo-dimers positioned on the edges of a tetrahedron resulting in a highly symmetrical dodecamer of 23 point group symmetry.
- the model of PF5-KARI dimer was built based on the coordinates of monomer A and monomer B of PA01 -KARI and sequence of PF5-KARI using DeepView/Swiss PDB viewer (Guex, N. and Peitsch, M.C.,
- the structure of PA01-KARI has no NADPH, substrate or inhibitor or magnesium in the active site. Therefore, the spinach KARI structure (PDB ID 1yve, Biou V. et al. , The EMBO Journal, 16: 3405-3415, 1997 ), which has magnesium ions, NADPH and inhibitor (N-Hydroxy-N- isopropyloxamate) in the acetolacate binding site, was used to model these molecules in the active site.
- the plant KARI has very little sequence homology to either PF5- or PA01 KARI ( ⁇ 20% amino acid identity), however the structures in the active site region of these two KARI enzymes are very similar.
- commands LSQ_ext, LSQ_improve, LSQ_mol in the program O were used to line up the active site of monomer A of spinach KARI to the monomer A of PF5 KARI model.
- the coordinates of NADPH, two magnesium ions and the inhibitor bound in the active site of spinach KARI were extracted and incorporated to molecule A of PF5 KARI.
- a set of the coordinates of these molecules were generated for monomer B of PF5 KARI by applying the transformation operator from monomer A to monomer B calculated by the program.
- NADPH/Mg/ inhibitor bound dimeric PF5-KARI model went through one round of energy minimization using program CNX (ACCELRYS San Diego CA , Burnger, AT. and Warren, G.L., Acta Crystallogr., D 54: 905-921 , 1998) after which the inhibitor was replaced by the substrate, acetolactate (AL), in the model.
- CNX ACCELRYS San Diego CA , Burnger, AT. and Warren, G.L., Acta Crystallogr., D 54: 905-921 , 1998) after which the inhibitor was replaced by the substrate, acetolactate (AL), in the model.
- Host cells provided herein can comprise a polypeptide having ketol- acid reductoisomerase activity.
- additional KARI enzymes and variants of the additional KARIs that result in isobutanol production comparable to and/or exceeding that observed with the KARI from Lactococcus lactis (see Examples).
- polypeptides having KARI activity that function in an. isobutanol production pathway have effective isobutanol productivity and/or produce isobutanol at a titer comparable to or better than that with the Lactococcus lactis KARI (SEQ ID NO: 380).
- polypeptides are thus considered to be useful for isobutanol production, particularly in cells comprising isobutanol production pathways described herein.
- polypeptides provided herein have effective isobutanol productivity and/or produce isobutanol at a titer greater than or about equal to that observed with the the Lactococcus lactis KARI (SEQ ID NO. 380) under the same conditions.
- polypeptides provided herein have effective isobutanol productivity greater than about 3 grams per gram of cells, greater than about 4, greater than about 5, or greater than about 6 grams per gram of cells after about 48 hours wherein at least the last about 24 hours of the 48 hours are under anaerobic conditions.
- variants of the polypeptides having KARI activity described above provide advantages for isobutanol production under anaerobic conditions. While not wishing to be bound by theory, it is believed that such variants provide improved isobutanol production due to more effective use of NADH as reducing equivalents.
- isobutanol production employing such a variant provides reduced glycerol accumulation.
- the molar ratio of isobutanol to glycerol is increased for a variant of a polypeptide having KARI activity described above with KM for NADH lower than that of the unsubstituted polypeptide.
- the molar ratio of isobutanol to glycerol is greater than 1. In embodiments, the molar ratio of isobutanol to glycerol is greater than 2. In embodiments, the molar ratio is greater than 3. In embodiments, the molar ratio is greater than 4, greater than 5, greater than 6, greater than 7, greater than 8, greater than 9, greater than 10, greater than 12, or greater than 14. In embodiments, the molar ratio is in the range of about 1 to 5, about 1 to 10, about 2 to 8, about 5 to 10, about 5 to 15 about 10 to 15 or about 12 to 15.
- a recombinant host cell can comprise reduced or eliminated aldehyde dehydrogenase activity and an isobutanol biosynthetic pathway wherein the host cell produces butanol.
- the recombinant host cell can comprise an isobutanol or a 1 -butanol biosynthetic pathway as described further herein.
- the isobutanol biosynthetic pathway can comprise a polynucleotide encoding a polypeptide that catalyzes a substrate to product conversion selected from the group consisting of: (a) pyruvate to acetolactate; (b) acetolactate to 2,3-dihydroxyisovalerate; (c) 2,3- dihydroxyisovalerate to 2-ketoisovalerate; (d) 2-ketoisovalerate to isobutyraldehyde; and (e) isobutyraldehyde to isobutanol.
- a substrate to product conversion selected from the group consisting of: (a) pyruvate to acetolactate; (b) acetolactate to 2,3-dihydroxyisovalerate; (c) 2,3- dihydroxyisovalerate to 2-ketoisovalerate; (d) 2-ketoisovalerate to isobutyraldehyde; and (e) isobutyraldeh
- the isobutanol biosynthetic pathway can comprise polynucleotides encoding polypeptides having acetolactate synthase, keto acid reductoisomerase, dihydroxy acid dehydratase, ketoisovalerate decarboxylase, and alcohol dehydrogenase activity.
- the recombinant cell comprises a 1 -butanol biosynthetic pathway.
- the 1 -butanol biosynthetic pathway comprises a polynucleotide encoding a polypeptide that catalyzes a substrate to product conversion selected from the group consisting of: (a) acetyl-CoA to acetoacetyl-CoA; (b) acetoacetyl-CoA to 3-hydroxybutyryl- CoA; (c) 3-hydroxybutyryl-CoA to crotonyl-CoA; (d) crotonyl-CoA to butyryl-CoA; (e) butyryl-CoA to butyraldehyde; (f) butyraldehyde to 1- butanol.
- the 1 -butanol biosynthetic pathway can comprise polynucleotides encoding polypeptides having activity.
- a recombinant host cell can comprise a modification or disruption of a polynucleotide or gene encoding a polypeptide having aldehyde dehydrogenase activity or a modification or disruption of a polypeptide having aldehyde dehydrogenase activity.
- Many methods for genetic modification and disruption of target genes to reduce or eliminate expression are known to one of ordinary skill in the art and can be used to create a recombinant host cell disclosed herein.
- the recombinant host cell can comprise a deletion, mutation, and/or substitution in an endogenous polynucleotide or gene encoding a polypeptide having aldehyde dehydrogenase activity or in an endogenous polypeptide having aldehyde dehydrogenase activity.
- modifications, disruptions, deletions, mutations, and/or substitutions can result in aldehyde dehydrogenase activity that is reduced or eliminated. Modifications that can be used include, but are not limited to, deletion of the entire gene or a portion of the gene encoding an aldehyde
- dehydrogenase protein inserting a DNA fragment into the encoding gene (in either the promoter or coding region) so that the protein is not expressed or expressed at lower levels, introducing a mutation into the coding region which adds a stop codon or frame shift such that a functional protein is not expressed, and introducing one or more mutations into the coding region to alter amino acids so that a non-functional or a less active protein is expressed.
- expression of a target gene can be blocked by expression of an antisense RNA or an interfering RNA, and constructs can be introduced that result in
- the synthesis or stability of the transcript can be lessened by mutation.
- the efficiency by which a protein is translated from mRNA can be modulated by mutation. All of these methods can be readily practiced by one skilled in the art making use of the known or identified sequences encoding target proteins.
- DNA sequences surrounding a target aldehyde dehydrogenase coding sequence are also useful in some modification procedures and are available, for example, for yeasts such as Saccharomyces cerevisiae in the complete genome sequence coordinated by Genome Project ID9518 of Genome Projects coordinated by NCBI (National Center for Biotechnology Information) with identifying GOPID #13838.
- yeast genomic sequences is that of Candida albicans, which is included in GPID #10771 , #10701 and #16373.
- Other yeast genomic sequences can be readily found by one of skill in the art in publicly available databases.
- DNA sequences surrounding a target aldehyde dehydrogenase coding sequence can be useful for modification methods using homologous recombination.
- aldehyde dehydrogenase gene flanking sequences can be placed bounding a selectable marker gene to mediate homologous recombination whereby the marker gene replaces the aldehyde
- partial aldehyde dehydrogenase gene sequences and aldehyde dehydrogenase gene flanking sequences bounding a selectable marker gene can be used to mediate homologous recombination whereby the marker gene replaces a portion of the target aldehyde dehydrogenase gene.
- the selectable marker can be bounded by site-specific recombination sites, so that following expression of the corresponding site-specific recombinase, the resistance gene is excised from the aldehyde dehydrogenase gene without reactivating the latter.
- the site-specific recombination leaves behind a recombination site which disrupts expression of the aldehyde dehydrogenase protein.
- the homologous recombination vector can be constructed to also leave a deletion in the aldehyde dehydrogenase gene following excision of the selectable marker, as is well known to one skilled in the art.
- deletions can be made to an aldehyde dehydrogenase target gene using mitotic recombination as described by Wach et al. (Yeast, 10:1793-1808; 1994).
- a method can involve preparing a DNA fragment that contains a selectable marker between genomic regions that can be as short as 20 bp, and which bound a target DNA sequence.
- this DNA fragment can be prepared by PCR amplification of the selectable marker gene using as primers oligonucleotides that hybridize to the ends of the marker gene and that include the genomic regions that can recombine with the yeast genome.
- the linear DNA fragment can be efficiently transformed into yeast and recombined into the genome resulting in gene replacement including with deletion of the target DNA sequence ((as disclosed, for example, in Methods in Enzymology, Volume 194, Guide to Yeast Genetics and Molecular and Cell Biology (Part A, 2004, Christine Guthrie and Gerald R. Fink (Eds.), Elsevier Academic Press, San Diego, CA)).
- promoter replacement methods can be used to exchange the endogenous transcriptional control elements allowing another means to modulate expression such as described by Mnaimneh et al., ((2004) Cell 118(1) 31-44).
- the aldehyde dehydrogenase target gene encoded activity can be disrupted using random mutagenesis, which can then be followed by screening to identify strains with reduced or substantially eliminated activity.
- the DNA sequence of the target gene encoding region, or any other region of the genome affecting carbon substrate dependency for growth need not be known.
- a screen for cells with reduced aldehyde dehydrogenase activity, or other mutants having reduced aldehyde dehydrogenase activity can be useful for recombinant host cells of the invention.
- Methods for creating genetic mutations are common and well known in the art and can be applied to the exercise of creating mutants.
- Commonly used random genetic modification methods include spontaneous mutagenesis, mutagenesis caused by mutator genes, chemical mutagenesis, irradiation with UV or X- rays, or transposon mutagenesis.
- Chemical mutagenesis of host cells can involve, but is not limited to, treatment with one of the following DNA mutagens: ethyl
- EMS methanesulfonate
- MNNG N-methyl-N'-nitro- N-nitroso-guanidine
- UV light or X-rays can also be used to produce random mutagenesis in yeast cells.
- the primary effect of mutagenesis by UV irradiation is the formation of pyrimidine dimers which disrupt the fidelity of DNA replication.
- mutator phenotypes can also be used to generate random chromosomal mutations in host cells.
- common mutator phenotypes can be obtained through disruption of one or more of the following genes: PMS1 , MAG1 , RAD18 or RAD51.
- restoration of the non-mutator phenotype can be obtained by insertion of the wildtype allele.
- collections of modified cells produced from any of these or other known random mutagenesis processes can be screened for reduced or eliminated aldehyde
- Genomes have been completely sequenced and annotated and are publicly available for the following yeast strains: Ashbya gossypii ATCC 10895, Candida glabrata CBS 138, Kluyveromyces lactis NRRL Y-1 140, Pichia stipitis CBS 6054, Saccharomyces cerevisiae S288c,
- Schizosaccharomyces pombe 972h-, and Yarrowia lipolytica CLIB122 are used to identify aldehyde dehydrogenase-encoding sequences of other host cells, such as yeast cells.
- a polypeptide having aldehyde having aldehyde
- dehydrogenase activity can catalyze the conversion of isobutyraldehyde to isobutyric acid.
- the conversion of isobutyraldehyde to isobutyric acid in a recombinant host cell is reduced or eliminated.
- a polynucleotide, gene or polypeptide having aldehyde dehydrogenase activity can correspond to Enzyme Commission Number EC 1.2.1.3, EC 1.2.1.4, and/or EC 1.2.1.5.
- a recombinant host cell of the invention can be S. cerevisiae, and a polypeptide having aldehyde dehydrogenase activity can be ALD2, ALD3, ALD4, ALD5, ALD6, or combinations thereof.
- a recombinant host cell can be Kluyveromyces lactis, and a polypeptide having aldehyde dehydrogenase activity can be
- a recombinant host cell can be Pichia stipitis, and a polypeptide having aldehyde dehydrogenase activity can ALD2, ALD3, ALD4, ALD5, ALD7, or combinations thereof.
- a recombinant host cell can be Lactobacillus plantarum, and a polypeptide having aldehyde dehydrogenase activity can be AldH.
- a recombinant host cell can be E. coli, and a polypeptide having aldehyde dehydrogenase activity can be aldA, aldB, aldH, or combinations thereof.
- a recombinant host cell can be S. cerevisiae, and an endogenous polynucleotide or gene encoding a polypeptide having aldehyde dehydrogenase activity can be ALD2, ALD3, ALD4, ALD5, ALD6, or combinations thereof.
- a recombinant host cell can be S. cerevisiae, and an
- endogenous polynucleotide or gene encoding a polypeptide having aldehyde dehydrogenase activity can be ALD6.
- a recombinant host cell can be Kluyveromyces lactis, and an endogenous polynucleotide or gene encoding a polypeptide having aldehyde dehydrogenase activity can be KLLA0F00440, KLLA0E23057,
- a recombinant host cell can be Pichia stipitis, and an endogenous polynucleotide or gene encoding a polypeptide having aldehyde dehydrogenase activity can be ALD2, ALD3, ALD4, ALD5,
- polypeptide having aldehyde dehydrogenase activity is a homolog of ALD6 from
- Saccharomyces cerevisiae S. cerevisiae deletion strains containing aldehyde dehydrogenase gene deletions with a kanMX cassette are commercially available from American Type Culture Collection [catalog #4000753].
- a recombinant host cell can be Lactobacillus plantarum, and an endogenous polynucleotide encoding a polypeptide having aldehyde dehydrogenase activity can be AldH.
- a recombinant host cell can be E. coli, and an endogenous polynucleotide encoding a polypeptide having aldehyde dehydrogenase activity can be aldA, aldB, aldH, or combinations thereof.
- aldehyde dehydrogenase polynucleotides, genes and polypeptides that can be targeted for modification or inactivation in a recombinant host cell disclosed herein include, but are not limited to, those of the following Table 4.
- aldehyde dehydrogenase polynucleotides, genes and polypeptides that can be targeted for modification or inactivation in a recombinant host cell disclosed herein include, but are not limited to, aldehyde dehydrogenase polynucleotides, genes and/or polypeptides having at least about 70% to about 75%, about 75% to about 80%, about 80% to about 85%, about 85% to about 90%, about 90% to about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to any one of the sequences of Table 4, wherein such a
- aldehyde dehydrogenase polynucleotide or gene encodes, or such a polypeptide has, aldehyde dehydrogenase activity examples include, but are not limited to an active variant, fragment or derivative of any one of the sequences of Table 4, wherein such a polynucleotide or gene encodes, or such a polypeptide has, aldehyde dehydrogenase activity.
- sequences of other aldehyde dehydrogenase polynucleotides, genes and/or polypeptides can be identified in the literature and in bioinformatics databases well known to the skilled person using sequences disclosed herein and available in the art.
- sequences can be identified through BLAST searching of publicly available databases with known aldehyde dehydrogenase-encoding polynucleotide or polypeptide sequences.
- aldehyde dehydrogenase polynucleotide or polypeptide sequences disclosed herein or known the art can be used to identify other aldehyde dehydrogenase homologs in nature.
- each of the aldehyde dehydrogenase encoding nucleic acid fragments disclosed herein can be used to isolate genes encoding homologous proteins. Isolation of homologous genes using sequence-dependent protocols is well known in the art.
- sequence-dependent protocols include, but are not limited to (1 ) methods of nucleic acid hybridization; (2) methods of DNA and RNA amplification, as exemplified by various uses of nucleic acid amplification technologies [e.g., polymerase chain reaction (PCR), Mullis er a/., U.S. Patent No. 4,683,202; ligase chain reaction (LCR), Tabor et a/., Proc. Acad. Sci. USA 82: 1074 (1985); or strand displacement amplification (SDA), Walker et al., Proc. Natl. Acad. Sci. U. S.A., 89:392 (1992)]; and (3) methods of library construction and screening by complementation.
- PCR polymerase chain reaction
- LCR ligase chain reaction
- SDA strand displacement amplification
- aldehyde dehydrogenase in a recombinant host cell disclosed herein to reduce or eliminate aldehyde dehydrogenase activity can be confirmed using methods known in the art. For example, disruption of a particular aldehyde dehydrogenase could be confirmed with PCR screening using primers internal and external to the aldehyde dehydrogenase gene or by Southern blot using a probe designed to the aldehyde dehydrogenase gene sequence. Alternatively, one could utilize gas chromatography-mass spectroscopy or liquid chromatography to screen strains exposed to isobutyraldehyde for decreased formation of isobutyric acid. Accordingly, provided herein is a method of screening for strains with decreased isobutyric acid formation comprising: a)providing a strain comprising a modification in a polynucleotide encoding a
- polypeptide having aldehyde dehydrogenase activity and/or a modification in a polynucleotide encoding a polypeptide having aldehyde oxidase activity b) contacting the cell with isobutyraldehyde; and c) measuring isobutyric acid formation; wherein isobutyric acid formation is reduced as compared to a control strain without the modification.
- the modification is a deletion, mutation, and/or substitution.
- the measuring is carried out using gas
- isobutyric acid is reduced by at least about 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In some embodiments, isobutyric acid formation is substantially eliminated.
- a recombinant host cell disclosed herein can have a modification or disruption of a polynucleotide, gene or polypeptide encoding aldehyde oxidase.
- the recombinant host cell disclosed herein can have a modification or disruption of a polynucleotide, gene or polypeptide encoding aldehyde oxidase.
- recombinant host cell comprises a deletion, mutation, and/or substitution in an endogenous polynucleotide or gene encoding a polypeptide having aldehyde oxidase activity, or in an endogenous polypeptide having aldehyde oxidase activity.
- modifications, disruptions, deletions, mutations, and/or substitutions can result in aldehyde oxidase activity that is reduced or eliminated.
- a polypeptide having aldehyde oxidase activity can catalyze the conversion of isobutyraldehyde to isobutyric acid. In other embodiments, the conversion of isobutyraldehyde to isobutyric acid in a recombinant host cell is reduced or eliminated.
- a polynucleotide, gene or polypeptide having aldehyde oxidase activity can correspond to Enzyme Commission Number EC 1 .2.3.1.
- a recombinant host cell of the invention can be Pichia stipitis and a polynucleotide, gene or polypeptide having aldehyde oxidase activity can be AOX1 and/or AOX2.
- aldehyde oxidase polynucleotides, genes and polypeptides that can be targeted for modification or inactivation in a recombinant host cell disclosed herein include, but are not limited to, those of the following Table 5.
- Table 5 Aldehyde oxidase target gene coding regions and proteins.
- aldehyde oxidase polynucleotides, genes and polypeptides that can be targeted for modification or inactivation in a recombinant host cell disclosed herein include, but are not limited to, aldehyde oxidase polynucleotides, genes and/or polypeptides having at least about 70% to about 75%, about 75% to about 80%, about 80% to about 85%, about 85% to about 90%, about 90% to about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to any one of the sequences of Table 5, wherein such a polynucleotide or gene encodes a polypeptide having, or such a polypeptide has, aldehyde oxidase activity.
- aldehyde oxidase polynucleotides, genes and polypeptides that can be targeted for modification or inactivation in a recombinant host cell disclosed herein include, but are not limited to an active variant, fragment or derivative of any one of the sequences of Table 5, wherein such a polynucleotide or gene encodes, or such a polypeptide has, aldehyde oxidase activity.
- a polynucleotide, gene and/or polypeptide encoding an aldehyde oxidase sequence disclosed herein or known in the art can be modified, as disclosed above for acetolactate reductase or aldehyde dehydrogenase.
- a polynucleotide, gene and/or polypeptide encoding aldehyde oxidase can be used to identify another aldehyde oxidase polynucleotide, gene and/or polypeptide sequence and/or can be used to identify an aldehyde oxidase homolog in other cells, as disclosed above for aldehyde dehydrogenase.
- aldehyde oxidase encoding sequences can be identified, for example, in the literature and/or in bioinformatics databases well known to the skilled person.
- aldehyde oxidase in a recombinant host cell disclosed herein to reduce or eliminate aldehyde oxidase activity can be confirmed using methods known in the art. For example, disruption of a particular aldehyde oxidase could be confirmed with PCR screening using primers internal and external to the aldehyde oxidase gene or by Southern blot using a probe designed to the aldehyde oxidase gene sequence. Alternatively, one could utilize gas chromatography or other analytical methods to screen strains exposed to isobutyraldehyde for decreased formation of isobutyric acid (as described and demonstrated in the Examples).
- isobutyric acid is reduced by at least about 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In some embodiments, isobutyric acid formation is substantially eliminated.
- a recombinant host cell disclosed herein can further comprise a modification in a polynucleotide encoding a polypeptide having pyruvate decarboxylase activity and/or a modification in a polynucleotide encoding a polypeptide having hexokinase 2 activity.
- a recombinant host cell of the invention can produce a production of a biosynthetic pathway (e.g., isobutanol), and can comprise a polynucleotide encoding a polypeptide that catalyzes a substrate to product conversion selected from the group consisting of: (a) pyruvate to acetolactate; (b) acetolactate to 2,3-dihydroxyisovalerate; (c) 2,3- dihydroxyisovalerate to 2-ketoisovalerate; (d) 2-ketoisovalerate to isobutyraldehyde; and (e) isobutyraldehyde to isobutanol.
- a biosynthetic pathway e.g., isobutanol
- such a recombinant host cell can produce a product of a biosynthetic pathway (e.g., isobutanol) at a yield or amount that is greater than the yield or amount of the same product produced by a recombinant host cell that does not comprise reduced or eliminated aldehyde dehydrogenase activity and/or aldehyde oxidase activity.
- a recombinant host cell of the invention can reduce or eliminate the conversion of isobutyraldehyde to isobutyric acid, and can be used for screening candidate polypeptides having aldehyde
- Applicants have also provided methods of increasing the yield or titer of a product of a biosynthetic pathway (e.g., isobutanol), methods for reducing or eliminating the conversion of isobutyraldehyde to isobutyric acid, and methods for screening candidate polypeptides having aldehyde dehydrogenase and/or aldehyde oxidase activity.
- a biosynthetic pathway e.g., isobutanol
- methods of producing a recombinant host cell comprise (a) providing a recombinant host cell disclosed herein; and (b) transforming said host cell with a polynucleotide encoding a polypeptide of a biosynthetic pathway (e.g., an isobutanol biosynthetic pathway).
- methods of producing a recombinant host cell comprise (a) providing a recombinant host cell comprising a modification in a polynucleotide encoding a polypeptide having aldehyde
- dehydrogenase activity comprising: (b) transforming said host cell with a polynucleotide encoding a polypeptide of a biosynthetic pathway (e.g., an isobutanol biosynthetic pathway).
- a biosynthetic pathway e.g., an isobutanol biosynthetic pathway
- methods of producing a recombinant host cell comprise (a) providing a recombinant host cell comprising a modification in a polynucleotide encoding a polypeptide having aldehyde oxidase activity or in a polypeptide having aldehyde oxidase activity; and (b) transforming said host cell with a polynucleotide encoding a polypeptide of an isobutanol biosynthetic pathway.
- methods for reducing or eliminating the conversion of isobutyraldehyde to isobutyric acid comprise (a) providing a recombinant host cell disclosed herein; and (b) growing said host cell under conditions wherein the conversion of isobutyraldehyde to isobutyric acid is reduced or eliminated compared to a recombinant host cell that does not comprise reduced or eliminated aldehyde dehydrogenase and/or aldehyde oxidase activity.
- the conversion of isobutyraldehyde to isobutyric acid of a recombinant host cell disclosed herein can be measured by methods known in the art (see, e.g., Methods in Yeast Genetics, 2005, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 201-202) and/or described herein. Reduction of DHMB
- DHMB can have inhibitory effects on product production.
- DHMB can decrease the activity of enzymes in the biosynthetic pathway or have other inhibitory effects on yeast growth and/or productivity during fermentation.
- the methods described herein provide ways of reducing DHMB during fermentation. The methods include both methods of decreasing the production of DHMB and methods of removing DHMB from fermenting compositions.
- a recombinant host cell can comprise reduced or eliminated ability to convert acetolactate to DHMB.
- the ability of a host cell to convert acetolactate to DHMB can be reduced or eliminated, for example, by a modification or disruption of a polynucleotide or gene encoding a polypeptide having acetolactate reductase activity or a modification or disruption of a polypeptide having acetolactate reductase activity.
- the recombinant host cell can comprise a deletion, mutation, and/or substitution in an endogenous polynucleotide or gene encoding a polypeptide having acetolactate reductase activity or in an endogenous polypeptide having acetolactate reductase.
- Such modifications, disruptions, deletions, mutations, and/or substitutions can result in acetolactate reductase activity that is reduced, substantially eliminated, or eliminated.
- the product of the biosynthetic pathway is produced at a greater yield or amount compared to the production of the same product in a recombinant host cell that does not comprise reduced or eliminated ability to convert acetolactate to DHMB.
- the product can be a composition comprising butanol that is substantially free of, or free of DHMB.
- the composition comprising butanol contains no more than about 5 mM, about 4 mM, about 3 mM, about 2 mM, about 1 mM, about 0.5 mM, about 0.4 mM, about 0.3 mM DHMB, or about 0.2 mM DHMB.
- the product can also be a composition comprising 2,3-butanediol (BDO) that is substantially free of, or free of DHMB.
- BDO 2,3-butanediol
- the composition comprising BDO contains no more than about 5 mM, about 4 mM, about 3 mM, about 2 mM, about 1 mM, about 0.5 mM, about 0.4 mM, about 0.3 mM DHMB, or about 0.2 mM DHMB.
- Any product of a biosynthetic pathway that involves the conversion of acetolactate to a substrate other than DHMB can be produced with greater effectiveness in a recombinant host cell disclosed herein having the described modification of acetolactate reductase activity.
- Such products include, but are not limited to, butanol, e.g., isobutanol, 2- butanol, and BDO, and branched chain amino acids.
- the host cell comprises at least one deletion, mutation, and/or substitution in at least one endogenous polynucleotide encoding a polypeptide having acetolactate reductase activity. In some embodiments, the host cell comprises at least one deletion, mutation, and/or substitution in each of at least two endogenous polynucleotides encoding polypeptides having acetolactate reductase activity.
- a polypeptide having acetolactate reductase activity can catalyze the conversion of acetolactate to DHMB. In some embodiments, a polypeptide having acetolactate reductase activity is capable of catalyzing the reduction of acetolactate to 2S.3S-DHMB (fast DHMB) and/or 2S.3R-DHMB (slow DHMB).
- the conversion of acetolactate to DHMB in a recombinant host cell is reduced, substantially eliminated, or eliminated.
- the polypeptide having acetolactate reductase activity is selected from the group consising of: YMR226C, YER081 W, YIL074C, YBR006W, YPL275W, YOL059W, YIR036C, YPL061W,
- the polypeptide having acetolactate reductase activity is a polypeptide comprising a sequence listed in Table 6 or a sequence that is at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% identical to a polypeptide sequence listed in Table 6.
- the polypeptide having acetolactate reducatase activity is a polypeptide encoded by a polynucleotide sequence listed in Table 6 or a sequence that is at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% identical to a polynucleotide sequence listed in Table 6.
- Table 7 Example YMR226C Yeast Homologs
- a polypeptide having acetolactate reductase activity is YMR226C or a homolog of YMR226C.
- the polypeptide having acetolactate reducatase activity is a polypeptide comprising a sequence listed in Table 7 or a sequence that is at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% identical to a polypeptide sequence listed in Table 7.
- the polypeptide having acetolactate reducatase activity is a polypeptide encoded by a polynucleotide sequence listed in Table 7 or a sequence that is at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% identical to a polynucleotide sequence listed in Table 7.
- Acetolactate reductases capable of converting acetolactate to DHMB can be identified, for example, by screening genetically altered yeast for changes in acetolactate consumption, changes in DHMB production, changes in DHIV production, or changes in other downstream product (e.g., butanol) production.
- One way of identifying a gene involved in DHMB production comprises measuring the amount of DHMB produced by individual yeast strains in a yeast knock-out library.
- Knock-out libraries are available, for example, from Open Biosystems® (a division of Thermo Fisher Scientific, Waltham, MA). In this method, a decrease in DHMB production indicates that the gene that has been knocked-out functions to increase DHMB production, and an increase in DHMB production indicates that the gene that has been knocked-out functions to decrease DHMB production.
- DHMB and DHIV accumulated in the culture during growth from endogenous substrates can be analyzed in samples from cultures. These samples can be placed in a hot (80-100 °C) water bath for 10-20 min, or diluted into a solution such as 2% formic acid that will kill and permeabilize the cells. After either treatment, small molecules will be found in the supernatant after centrifugation (5 min, 1100 x g).
- the DHMB/DHIV ratio of a control strain (e.g., BY4743) can be compared to that of the different KO derivatives, and the gene(s) missing from any strain(s) with exceptionally low DHMB/DHIV ratios can encode acetolactate reductase (ALR).
- ALR acetolactate reductase
- Another way of identifying a gene involved in DHMB production comprises measuring the amount of DHMB produced by individual yeast strains in a yeast overexpression library.
- Overexpression libraries are available, for example, from Open Biosystems® (a division of Thermo Fisher Scientific, Waltham, MA). In this method, a decrease in DHMB production indicates that the overexpressed gene functions to decrease DHMB production, and an increase in DHMB production indicates that the overexpressed gene functions to increase DHMB production.
- DHMB-producing yeast strain Another way of identifying a gene involved in DHMB production is to biochemically analyze a DHMB-producing yeast strain.
- DHMB-producing cells can be disrupted. This disruption can be performed at low pH and cold temperatures.
- the cell lysates can be separated into fractions, e.g., by adding ammonium sulfate or other techniques known to those of skill in the art, and the resulting fractions can be assayed for enzymatic activity.
- the fractions can be assayed for the ability to convert acetolactate to DHMB.
- Fractions with enzymatic activity can be treated by methods known in the art to purify and concentrate the enzyme (e.g., dialysis and chromatographic separation).
- the enzyme can be sequenced, and the corresponding gene encoding the acetolactate reductase capable of converting acetolactate to DHMB can be identified. Furthermore, since the reduction of acetolactate to DHMB occurs in yeast, but does not occur to the same extent in E. coli, acetolactate reductases that are expressed in yeast, but not expressed in E. coli, can be selected for screening. Selected enzymes can be expressed in yeast or other protein expression systems and screened for the capability to convert acetolactate to DHMB.
- Enzymes capable of catalyzing the conversion of acetolactate to DHMB can be screened by assaying for acetolactate levels, by assaying for DHMB levels, by assaying for DHIV levels, or by assaying for any of the downstream products in the conversion of DHIV to butanol, including isobutanol.
- DHMB can be measured using any technique known to those of skill in the art.
- DHMB can be separated and quantified by methods known to those of skill in the art and techniques described in the Examples provided herein.
- DHMB can be separated and quantified using liquid chromatography-mass spectrometry, liquid chromatography-nuclear magnetic resonance (NMR), thin-layer chromatography, and/or HPLC with UV Vis detection.
- selected acetolactate reductase polynucleotides, genes and/or polypeptides disclosed herein can be modified or disrupted.
- Many suitable methods are known to those of ordinary skill in the art and include those described for aldehyde dehydrogenase (above).
- acetolactate reductase in a recombinant host cell disclosed herein to reduce or eliminate acetolactate reductase activity can be confirmed using methods known in the art. For example, the presence or absence of an acetolactate reductase-encoding
- polynucleotide sequence can be determined using PCR screening.
- a decrease in acetolactate reductase activity can also be determined based on a reduction in conversion of acetolactate to DHMB.
- a decrease in acetolactate reductase activity can also be determined based on a reduction in DHMB production.
- a decrease in acetolactate reductase activity can also be determined based on an increase in butanol production.
- a yeast that is capable of producing butanol produces no more than about 5 mM, about 4 mM, about 3 mM, about 2 mM, about 1 mM, about 0.9 mM, about 0.8 mM., about 0.7 mM, about 0.6 mM, about 0.5 mM, about 0.4 mM or about 0.3 mM DHMB.
- a yeast producing butanol produces no more than about about 5 mM, about 4 mM, about 3 mM, about 2 mM, about 1 mM, about 0.9 mM, about 0.8 mM., about 0.7 mM, about 0.6 mM, about 0.5 mM, about 0.4 mM or about 0.3 mM DHMB. In some embodiments, a yeast producing butanol produces no more than about 0.2 mM or 0.2 mM DHMB.
- a yeast capable of producing butanol produces no more than about 10 mM DHMB when cultured under fermentation conditions for at least about 50 hours.
- a yeast capable of producing butanol produces no more than about about 5 mM DHMB when cultured under fermentation conditions for at least about 20 hours, at least about 25 hours, at least about 30 hours, at least about 35 hours, at least about 40 hours, at least about 45 hours, or at least about 50 hours.
- a yeast capable of producing butanol produced no more than about 3 mM DHMB when cultured under fermentation conditions for at least about 5 hours, at least about 10 hours, at least about 15 hours, at least about 20 hours, at least about 25 hours, at least about 30 hours, at least about 35 hours, at least about 40 hours, at least about 45 hours, or at least about 50 hours.
- a yeast capable of producing butanol produced no more than about 1 mM DHMB when cultured under fermentation conditions for at least about 1 hour, at least about 5 hours, at least about 10 hours, at least about 15 hours, at least about 20 hours, at least about 25 hours, at least about 30 hours, at least about 35 hours, at least about 40 hours, at least about 45 hours, or at least about 50 hours.
- a yeast capable of producing butanol produced no more than about 0.5 mM DHMB when cultured under fermentation conditions for at least about 1 hour, at least about 5 hours, at least about 10 hours, at least about 15 hours, at least about 20 hours, at least about 25 hours, at least about 30 hours, at least about 35 hours, at least about 40 hours, at least about 45 hours, or at least about 50 hours.
- a yeast comprising at least one deletion, mutation, and/or substitution in an endogenous polynucleotide encoding an acetolactate reductase produces no more than about 0.5 times, about 0.4 times, about 0.3 times, about 0.2 times, about 0.1 times, about 0.05 times the amount of DHMB produced by a yeast containing the
- endogenous polynucleotide encoding an acelotacatate reductase when cultured under fermentation conditions for the same amount of time.
- a yeast that is capable of producing butanol produces an amount of DHIV that is at least about 5 mM, at least about 6 mM, at least about 7 mM, at least about 8 mM, at least about 9 mM, or at least about 10 mM.
- a yeast that is capable of producing butanol produces an amount of DHIV that is at least about the amount of DHMB produced. In some embodiments, a yeast that is capable of producing butanol produces an amount of DHIV that is at least about twice, about three times, about five times, about ten times, about 5 times, about 20 times, about 25 times, about 30 times, about 35 times, about 40 times, about 45 times, or about 50 times the amount of DHMB produced.
- a yeast that is capable of producing butanol produces DHIV at a rate that is at least about equal to the rate of DHMB production. In some embodiments, a yeast that is capable of producing butanol produces DHIV at a rate that is at least about twice, about three times, about five times, about ten times, about 15 times, about 20 times, about 25 times, about 30 times, about 35 times, about 40 times, about 45 times, or about 50 times the rate of DHMB production.
- a yeast that is capable of producing butanol produces less than 0.010 moles of DHMB per mole of glucose consumed. In some embodiments, a yeast produces less than about 0.009, less than about 0.008, less than about 0.007, less than about 0.006, or less than about 0.005 moles of DHMB per mole of glucose consumed. In some embodiments, a yeast produces less than about 0.004, less than about 0.003, less than about 0.002, or less than about 0.001 moles of DHMB per mole of glucose consumed.
- acetolactate reductase activity is inhibited by chemical means.
- acetolactate reductase could be inhibited using other known substrates such as those listed in Fujisawa et al. including L-serine, D-serine, 2-methyl-DL-serine, D-threonine, L-allo- threonine, L-3-hydroxyisobutyrate, D-3-hydroxyisobutyrate, 3- hydroxypropionate, L-3-hydroxybutyrate, and D-3-hydroxybutyrate.
- a reduction in DHMB can be achieved by removing DHMB from a fermentation.
- fermentations with reduced DHMB concentrations are also described herein. Removal of DHMB can result, for example, in a product of greater purity, or a product requiring less processing to achieve a desired purity. Therefore, compositions comprising products of biosynthetic pathways such as ethanol or butanol with increased purity are also provided.
- DHMB can be removed during or after a fermentation process and can be removed by any means known in the art. DHMB can be removed, for example, by extraction into an organic phase or reactive extraction.
- the fermentation broth comprises less than about 0.5 mM DHMB. In some embodiments, the fermentation broth comprises less than about 1.0 mM DHMB after about 5 hours, about 10 hours, about 15 hours, about 20 hours, about 25 hours, about 30 hours, about 35 hours, about 40 hours, about 45 hours, or about 50 hours of fermentation. In some embodiments, the fermentation broth comprises less than about 5.0 mM DHMB after about 20 hours, about 25 hours, about 30 hours, about 35 hours, about 40 hours, about 45 hours, or about 50 hours of fermentation.
- acetolactate synthase ALS
- acetohydroxy acid dehydratase also called dihydroxy-acid dehydratase (DHAD)
- DHAD dihydroxy-acid dehydratase
- the isobutanol biosynthetic pathway comprises the following substrate to product conversions:
- acetolactate synthase a catalyzed, for example, by acetolactate synthase
- valine a-ketoisovalerate to valine, which may be catalyzed, for example, by transaminase or valine dehydrogenase;
- valine to isobutylamine which may be catalyzed, for example, by valine decarboxylase;
- - isobutylamine to isobutyraldehyde which may be catalyzed by, for example, omega transaminase
- - isobutyraldehyde to isobutanol which may be catalyzed, for example, by a branched-chain alcohol dehydrogenase.
- the isobutanol biosynthetic pathway comprises the following substrate to product conversions:
- acetolactate synthase a catalyzed, for example, by acetolactate synthase
- the isobutanol biosynthetic pathway comprises the substrate to product conversions shown as steps k, g, and e in Figure 1.
- Ketoisovalerate decarboxylases include those derived from Lactococcus lactis, Macrococcus caseolyticus (SEQ ID NO: 542) and Listeria grayi (SEQ ID NO: 543).
- Alcohol dehydrogenases include SadB from Achromobacter xylosoxidans. Additional alcohol dehydrogenases include horse liver ADH and Beijerinkia indica ADH.
- Alcohol dehydrogenases include those that utilize NADH as a cofactor.
- a butanol biosynthetic pathway comprises a) a ketol-acid reductoisomerase that has a K M for NADH less than about 300 ⁇ , less than about 100 ⁇ , less than about 50 ⁇ , less than about 20 ⁇ or less than about 10 ⁇ ; b) an alcohol dehydrogenase that utilizes NADH as a cofactor; or c) both a) and b).
- 2007/0092957, 2010/0081 154 which are herein incorporated by reference in their entireties, describe suitable dihydroxyacid dehydratases.
- Methods of increasing DHAD activity are described, for example, in U.S. Patent Application Publication No. 2010/0081173 and U.S. Patent Application No. 13/029,558, filed February 17, 201 1 , which are herein incorporated by reference in their entireties.
- ketol-acid reductoisomerase (KARI) enzymes are described in U.S. Patent Appl. Pub. Nos. 2008/0261230 A1 .
- KARIs disclosed therein are those from Vibrio cholerae, Pseudomonas aeruginosa PA01 , and Pseudomonas fluorescens PF5.
- the KARI enzyme has a specific activity of at least about 0.1 micromoles/min/mg, at least about 0.2 micromoles/min/mg, at least about 0.3 micromoles/min/mg, at least about 0.4 micromoles/min/mg, at least about 0.5 micromoles/min/mg, at least about 0.6 micromoles/min/mg, at least about 0.7 micromoles/min/mg, at least about 0.8
- micromoles/min/mg at least about 0.9 micromoles/min/mg, at least about 1.0 micromoles/min/mg, or at least about 1.1 micromoles/min/mg.
- Suitable polypeptides to catalyze the substrate to product conversion acetolactate to 2,3-dihydroxyisovalerate include those that that have a KM for NADH less than about 300 ⁇ , less than about 100 ⁇ , less than about 50 ⁇ , less than about 25 ⁇ or less than about 10 ⁇ .
- the KARI utilizes NADPH.
- Methods of measuring NADPH consumption are known in the art.
- US Published Application No. 2008/0261230 which is herein incorporated by reference in its entirety, provides methods of measuring NADPH consumption.
- an NADPH consumption assay is a method that measures the disappearance of the cofactor, NADPH, during the enzymatic conversion of acetolactate to ⁇ - ⁇ -dihydroxy-isovalerate at 340 nm. The activity is calculated using the molar extinction coefficient of 6220 M "1 cm '1 for NADPH and is reported as pmole of NADPH consumed per min per mg of total protein in cell extracts (see Aulabaugh and
- the KARI is capable of utilizing NADH. In some embodiments, the KARI is capable of utilizing NADH under anaerobic conditions. KARI enzymes using NADH are described, for example, in U.S. Patent Application Publication No. 2009/0163376, which is herein incorporated by reference in its entirety.
- Biosynthetic pathways for the production of 1-butanol that may be used include those described in U.S. Appl. Pub. No. 2008/0182308, which is incorporated herein by reference.
- the 1-butanol biosynthetic pathway comprises the following substrate to product conversions:
- butyraldehyde to 1-butanol which may be catalyzed, for example, by butanol dehydrogenase.
- Biosynthetic pathways for the production of 2-butanol include those described in U.S. Appl. Pub. No. 2007/0259410 and U.S. Appl. Pub. No. 2009/0155870, which are incorporated herein by reference.
- the 2-butanol biosynthetic pathway comprises the following substrate to product conversions:
- alpha-acetolactate which may be catalyzed, for example, by acetolactate synthase;
- alpha-acetolactate to acetoin which may be catalyzed, for example, by acetolactate decarboxylase;
- the 2-butanol biosynthetic pathway comprises the following substrate to product conversions:
- alpha-acetolactate which may be catalyzed, for example, by acetolactate synthase;
- alpha-acetolactate to acetoin which may be catalyzed, for example, by acetolactate decarboxylase;
- a recombinant host cell comprises a biosynthetic pathway.
- the biosynthetic pathway can comprise reduced or eliminated aldehyde dehydrogenase activity and an isobutanol or 1 -butanol biosynthetic pathway wherein the pathway comprises the substrate to product conversion pyruvate to acetolactate.
- a host cell comprising a biosynthetic pathway capable of converting pyurvate to acetolacatate comprises a
- the biosynthetic pathway can be a butanol producing pathway or a butanediol producing pathway.
- the biosynthetic pathway can also be a branched-chain amino acid (e.g., leucine, isoleucine, valine) producing pathway.
- the recombinant host cell can comprise an isobutanol, 1-butanol, or a 2-butanol biosynthetic pathway as described herein.
- the butanol biosynthetic pathway is an isobutanol biosynthetic pathway. Production of isobutanol or 2-butanol in a recombinant host cell disclosed herein may benefit from a reduction, substantial elimination or elimination of an acetolactate reductase activity. Modifications
- a recombinant host cell disclosed herein can comprise a modification in an endogenous polynucleotide encoding a polypeptide having pyruvate decarboxylase (PDC) activity or a modification in an endogenous polypeptide having PDC activity.
- a recombinant host cell disclosed herein can have a modification or disruption of a polynucleotide, gene and/or polypeptide encoding PDC.
- a recombinant host cell comprises a deletion, mutation, and/or substitution in an endogenous polynucleotide or gene encoding a polypeptide having PDC activity, or in an endogenous polypeptides having PDC activity.
- Such modifications, disruptions, deletions, mutations, and/or substitutions can result in PDC activity that is reduced or eliminated, resulting, for example, in a PDC knock-out (PDC- KO) phenotype.
- an endogenous pyruvate decarboxylase activity of a recombinant host cell disclosed herein converts pyruvate to acetaldehyde, which can then be converted to ethanol or to acetyl-CoA via acetate.
- a recombinant host cell is Kluyveromyces lactis containing one gene encoding pyruvate
- a recombinant host cell is Saccharomyces cerevisiae containing three isozymes of pyruvate decarboxylase encoded by the PDC1 , PDC5, and PDC6 genes, as well as a pyruvate
- decarboxylase regulatory gene PDC2.
- the PDC1 and PDC5 genes, or the PDC1 , PDC5, and PDC6 genes are disrupted.
- pyruvate decarboxylase activity can be reduced by disrupting the PDC2 regulatory gene.
- S. cerevisiae pyruvate decarboxylase regulatory gene
- polynucleotides or genes encoding pyruvate decarboxylase proteins such as those having about 70% to about 75%, about 75% to about 80%, about 80% to about 85%, about 85% to about 90%, about 90% to about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to PDC1 , PDC2, PDC5 and/or PDC6 can be disrupted.
- a polypeptide having PDC activity or a
- polynucleotide or gene encoding a polypeptide having PDC activity corresponds to Enzyme Commission Number EC 4.1.1.1 .
- a PDC gene of a recombinant host cell disclosed herein is not active under the fermentation conditions used, and therefore such a gene would not need to be modified or inactivated.
- Saccharomyces strains having no pyruvate decarboxylase activity are available from the ATCC with Accession #200027 and #200028.
- PDC polynucleotides, genes and/or polypeptides that can be targeted for modification or inactivation in the recombinant host cells disclosed herein include, but are not limited to, those of the following Table 8.
- PDC polynucleotides, genes and polypeptides that can be targeted for modification or inactivation in a recombinant host cell disclosed herein include, but are not limited to, PDC polynucleotides, genes and/or polypeptides having at least about 70% to about 75%, about 75% to about 80%, about 80% to about 85%, about 85% to about 90%, about 90% to about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to any one of the sequences of Table 8, wherein such a polynucleotide or gene encodes, or such a polypeptide has, PDC activity.
- PDC polynucleotides, genes and polypeptides that can be targeted for modification or inactivation in a recombinant host cell disclosed herein include, but are not limited to an active variant, fragment or derivative of any one of the sequences of Table 8, wherein such a polynucleotide or gene encodes, or such a polypeptide has, PDC activity.
- a polynucleotide, gene and/or polypeptide encoding a PDC sequence disclosed herein or known in the art can be modified, as disclosed above for aldehyde dehydrogenase.
- a polynucleotide, gene and/or polypeptide encoding PDC can be used to identify another PDC polynucleotide, gene and/or polypeptide sequence or to identify a PDC homolog in other cells, as disclosed above for acetolactate dehydrogenase.
- Such a PDC encoding sequence can be identified, for example, in the literature and/or in bioinformatics databases well known to the skilled person.
- the identification of a PDC encoding sequence in other cell types using bioinformatics can be accomplished through BLAST (as described above) searching of publicly available databases with a known PDC encoding DNA and polypeptide sequence, such as those provided herein.
- the modification of PDC in a recombinant host cell disclosed herein to reduce or eliminate PDC activity can be confirmed using methods known in the art. For example, disruption of a particular pyruvate decarboxylase could be confirmed with PCR screening using primers external to the gene sequence, or by Southern blot using a probe designed to the pyruvate decarboxylase gene sequence. Alternatively, one could utilize analytical methods such as gas chromatography or HPLC to screen strains for decreased or eliminated production of acetaldehyde and/or ethanol.
- hexokinase 2 Functional deletion of the hexokinase 2 gene has been used to reduce glucose repression and to increase the availability of pyruvate for utilization in biosynthetic pathways.
- International Publication No. WO 2000/061722 A1 which is incorporated herein by reference in its entirety discloses the production of yeast biomass by aerobically growing yeast having one or more functionally deleted hexokinase 2 genes or analogs.
- Rossell et al. Yeast Research 8:155-164 (2008) found that Saccharomyces cerevisiae with a deletion of the hexokinase 2 gene showed 75% reduction in fermentative capacity, defined as the specific rate of carbon dioxide production under sugar-excess and anaerobic conditions.
- a recombinant host cell disclosed herein can comprise a modification in an endogenous polynucleotide encoding a polypeptide having hexokinase 2 activity and/or a modification in a polypeptide having hexokinase 2 activity.
- a recombinant host cell disclosed herein can have a modification or disruption of a polynucleotide, gene or polypeptide encoding hexokinase 2.
- a recombinant host cell comprises a deletion, mutation, and/or substitution in an endogenous polynucleotide or gene encoding a polypeptide having hexokinase 2 activity, or an endogenous polypeptide having hexokinase 2 activity.
- Such modifications, disruptions, deletions, mutations, and/or substitutions can result in hexokinase 2 activity that is reduced or eliminated, resulting, for example, in a hexokinase 2 knockout (HXK2-KO) phenotype.
- the host cell comprises a modification as described in U.S. Appn. Serial. Nos. 201 1/0124060 A1 or 2012/0015416 A1 , which are incorporated herein by reference in their entireties.
- a polypeptide having hexokinase 2 activity can catalyze the conversion of hexose to hexose-6-phosphate, and/or can catalyze the conversion of D-glucose to D-glucose 6-phosphate, D- fructose to D-fructose 6-phosphate, and/or D-mannose to D-mannose 6- phosphate.
- a polynucleotide, gene or polypeptide having hexokinase 2 activity can correspond to Enzyme Commission Number EC 2.7.1.1.
- a recombinant host cell can be S. cerevisiae and a polynucleotide, gene or polypeptide having hexokinase 2 activity can be HXK2.
- a recombinant host cell can be K. lactis and a polynucleotide, gene or polypeptide having hexokinase 2 activity can be RAG5.
- a recombinant host cell can be H. polymorpha and a polynucleotide, gene or polypeptide having hexokinase 2 activity can be HPGLK1.
- a recombinant host cell can be S. pombe and a polynucleotide, gene or polypeptide having hexokinase 2 activity can be HXK2.
- hexokinase 2 polynucleotides, genes and polypeptides that can be targeted for modification or inactivation in a recombinant host cell disclosed herein include, but are not limited to, those of the following Table 9.
- HXK2 from Nucleic acid (SEQ ID NO: 668)
- RAG 5 from Nucleic acid (SEQ ID NO: 670):
- Amino acid (SEQ ID NO: 673)
- HXK2 from Nucleic acid (SEQ ID NO: 674):
- hexokinase 2 polynucleotides, genes and polypeptides that can be targeted for modification or inactivation in a recombinant host cell disclosed herein include, but are not limited to, hexokinase 2 polynucleotides, genes and/or polypeptides having at least about 70% to about 75%, about 75% to about 80%, about 80% to about 85%, about 85% to about 90%, about 90% to about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to any one of the sequences of Table 9, wherein such a polynucleotide or gene encodes, or such a polypeptide has, hexokinase 2 activity.
- hexokinase 2 polynucleotides, genes and polypeptides that can be targeted for modification or inactivation in a recombinant host cell disclosed herein include, but are not limited to an active variant, fragment or derivative of any one of the sequences of Table 9, wherein such a polynucleotide or gene encodes, or such a polypeptide has, hexokinase 2 activity.
- a polynucleotide, gene and/or polypeptide encoding a hexokinase 2 sequence disclosed herein or known in the art can be modified or disrupted, as disclosed above for aldehyde
- a polynucleotide, gene and/or polypeptide encoding hexokinase 2 can be used to identify another hexokinase 2 polynucleotide, gene and/or polypeptide sequence or to identify a hexokinase 2 homolog in other cells, as disclosed above for aldehyde dehydrogenase.
- a hexokinase 2 encoding sequence can be identified, for example, in the literature and/or in bioinformatics databases well known to the skilled person. For example, the
- PENALTY 0.1 , and Gonnet 250 series of protein weight matrix.
- hexokinase 2 in a recombinant host cell disclosed herein to reduce or eliminate hexokinase 2 activity can be confirmed using methods known in the art. For example, disruption of hexokinase 2 could be confirmed with PCR screening using primers external to the hexokinase 2 gene, or by Southern blot using a probe designed to the hexokinase 2 gene sequence. Alternatively, one could examine putative hexokinase 2 knockout strains for increased biomass yield on glucose-containing media.
- Examples of additional modifications that can be useful in cells provided herein include modifications to reduce glycerol-3-phosphate dehydrogenase activity and/or disruption in at least one gene encoding a polypeptide having pyruvate decarboxylase activity or a disruption in at least one gene encoding a regulatory element controlling pyruvate decarboxylase gene expression as described in U.S. Patent Appl. Pub. No. 2009/0305363 (incorporated herein by reference), modifications to a host cell that provide for increased carbon flux through an Entner- Doudoroff Pathway or reducing equivalents balance as described in U.S. Patent Appl. Pub. No. 2010/0120105 (incorporated herein by reference).
- modifications include integration of at least one polynucleotide encoding a polypeptide that catalyzes a step in a pyruvate-utilizing biosynthetic pathway described in PCT Appn. Pub. No. WO 2012/033832, which is herein incorporated by reference in its entirety.
- a genetic modification which has the effect of reducing glucose repression wherein the yeast production host cell is pdc- is described in U.S. Appl. Publ No. US 201 1/0124060, which is herein incorporated by reference in its entirety.
- U.S. Appl. Publ. No. 20120064561 A1 discloses recombinant host cells comprising (a) at least one heterologous polynucleotide encoding a polypeptide having dihydroxy-acid dehydratase activity; and (b)(i) at least one deletion, mutation, and/or substitution in an endogenous gene encoding a polypeptide affecting Fe-S cluster biosynthesis; and/or (ii) at least one heterologous polynucleotide encoding a polypeptide affecting Fe-S cluster biosynthesis.
- the polypeptide affecting Fe-S cluster biosynthesis is encoded by AFT1, AFT2, FRA2, GRX3, or CCC1.
- the polypeptide affecting Fe-S cluster biosynthesis is constitutive mutant AFT1 L99A, AFT1 L102A, AFT1 C291 F, ox AFT 1 C293F.
- host cells can comprise heterologous polynucleotides encoding a polypeptides with phosphoketolase activity and/or a heterologous polynucleotide encoding a polypeptide with
- phosphotransacetylase activity such as, for example, those encoded by SEQ ID NOs: 962 and 963, and as described in PCT Appn. Pub. No. WO 201 1/159853, which is herein incorporated by reference in its entirety.
- methods for the production of a product of a biosynthetic pathway comprise (a) providing a recombinant host cell disclosed herein; and (b) growing the host cell under conditions whereby the product of the biosynthetic pathway is produced.
- the product is produced as a co- product along with ethanol.
- the product of the biosynthetic pathway is isobutanol.
- the product of the biosynthetic pathway is produced at a greater yield or amount compared to the production of the same product in a recombinant host cell that does not comprise reduced or eliminated aldehyde dehydrogenase and/or aldehyde oxidase activity and/or acetolactate reductase activity.
- yield is increased by at least about 2%, at least about 5% or at least about 10%.
- this greater yield includes production at a yield of greater than about 10% of theoretical, at a yield of greater than about 20% of theoretical, at a yield of greater than about 25% of theoretical, at a yield of greater than about 30% of theoretical, at a yield of greater than about 40% of theoretical, at a yield of greater than about 50% of theoretical, at a yield of greater than about 60% of theoretical, at a yield of greater than about 70% of theoretical, at a yield of greater than about 75% of theoretical, at a yield of greater than about 80% of theoretical at a yield of greater than about 85% of theoretical, at a yield of greater than about 90% of theoretical, at a yield of greater than about 95% of theoretical, at a yield of greater than about 96% of theoretical, at a yield of greater than about 97% of theoretical, at a yield of greater than about 98% of theoretical, at a yield of greater than about 99% of theoretical, or at a yield of about 100% of theoretical.
- the product is produced as a co-product along with ethanol.
- Any product of a biosynthetic pathway that has the conversion of isobutyraldehyde to isobutyric acid as a pathway by-product can be produced with greater effectiveness in a recombinant host cell disclosed herein having the described modification of aldehyde dehydrogenase and/or aldehyde oxidase activity.
- a list of such products includes, but is not limited to, isobutanol.
- Microbial hosts for isobutanol production can be selected from bacteria, cyanobacteria, filamentous fungi and yeasts.
- the microbial host used for butanol production should be tolerant to isobutanol so that the yield is not limited by butanol toxicity.
- butanol-tolerant mutants have been isolated from solventogenic Clostridia, little information is available concerning the butanol tolerance of other potentially useful bacterial strains.
- Most of the studies on the comparison of alcohol tolerance in bacteria suggest that butanol is more toxic than ethanol (de Cavalho, et al., Microsc. Res. Tech., 64: 215-22, 2004) and (Kabelitz, et al., FEMS Microbiol. Lett., 220: 223-227, 2003, Tomas, et al., J. Bacteriol., 186: 2006-2018, 2004) report that the yield of 1 -butanol during
- the microbial hosts selected for the production of isobutanol should be tolerant to isobutanol and should be able to convert carbohydrates to isobutanol.
- the criteria for selection of suitable microbial hosts include the following: intrinsic tolerance to isobutanol, high rate of glucose utilization, availability of genetic tools for gene manipulation, and the ability to generate stable chromosomal alterations.
- Suitable host strains with a tolerance for isobutanol can be identified by screening based on the intrinsic tolerance of the strain.
- the intrinsic tolerance of microbes to isobutanol can be measured by determining the concentration of isobutanol that is responsible for 50% inhibition of the growth rate (IC50) when grown in a minimal medium.
- IC50 values can be determined using methods known in the art.
- the microbes of interest can be grown in the presence of various amounts of isobutanol and the growth rate monitored by measuring the optical density at 600 nanometers. The doubling time can be calculated from the logarithmic part of the growth curve and used as a measure of the growth rate.
- the concentration of isobutanol that produces 50% inhibition of growth can be determined from a graph of the percent inhibition of growth versus the isobutanol concentration. In one
- the host strain has an IC50 for isobutanol of greater than about 0.5%.
- the microbial host for isobutanol production should also utilize glucose at a high rate. Most microbes are capable of metabolizing carbohydrates. However, certain environmental microbes cannot metabolize carbohydrates to high efficiency, and therefore would not be suitable hosts.
- the ability to genetically modify the host is essential for the production of any recombinant microorganism.
- the mode of gene transfer technology can be by electroporation, conjugation, transduction or natural transformation.
- a broad range of host conjugative plasmids and drug resistance markers are available.
- the cloning vectors are tailored to the host microorganisms based on the nature of antibiotic resistance markers that can function in that host.
- the microbial host also has to be manipulated in order to inactivate competing pathways for carbon flow by deleting various genes. This requires the availability of either transposons to direct inactivation or chromosomal integration vectors. Additionally, the production host should be amenable to chemical mutagenesis so that mutations to improve intrinsic isobutanol tolerance can be obtained.
- suitable microbial hosts for the production of isobutanol include, but are not limited to, members of the genera Clostridium, Zymomonas, Escherichia, Salmonella,
- Rhodococcus Pseudomonas, Bacillus, Vibrio, Lactobacillus,
- Suitable hosts include: Escherichia coli, Alcaligenes eutrophus, Bacillus licheniformis,
- Paenibacillus macerans Rhodococcus erythropolis, Pseudomonas putida, Lactobacillus plantarum, Enterococcus faecium, Enterococcus gallinarium, Enterococcus faecalis, Bacillus subtilis and Saccharomyces cerevisiae.
- the host cell is Saccharomyces cerevisiae. S.
- cerevisiae yeast are known in the art and are available from a variety of sources, including, but not limited to, American Type Culture Collection (Rockville, MD), Centraalbureau voor Schimmelcultures (CBS) Fungal Biodiversity Centre, LeSaffre, Gert Strand AB, Ferm Solutions, North American Bioproducts, Martrex, and Lallemand. S.
- American Type Culture Collection Rockville, MD
- Centraalbureau voor Schimmelcultures CBS
- Fungal Biodiversity Centre LeSaffre, Gert Strand AB
- Ferm Solutions North American Bioproducts, Martrex, and Lallemand. S.
- cerevisiae include, but are not limited to, BY4741 , CEN.PK 113-7D, Ethanol Red® yeast, Ferm ProTM yeast, Bio-Ferm® XR yeast, Gert Strand Prestige Batch Turbo alcohol yeast, Gert Strand Pot Distillers yeast, Gert Strand Distillers Turbo yeast, FerMaxTM Green yeast, FerMaxTM Gold yeast, Thermosacc® yeast, BG-1 , PE-2, CAT-1 , CBS7959, CBS7960, and CBS7961.
- Recombinant microorganisms containing the necessary genes that will encode the enzymatic pathway for the conversion of a fermentable carbon substrate to butanol can be constructed using techniques well known in the art.
- genes encoding the enzymes of one of the isobutanol biosynthetic pathways of the invention for example, acetolactate synthase, acetohydroxy acid isomeroreductase, acetohydroxy acid dehydratase, branched-chain a-keto acid decarboxylase, and branched-chain alcohol'dehydrogenase, can be isolated from various sources, as described above.
- Vectors or cassettes useful for the transformation of a variety of host cells are common and commercially available from companies such as EPICENTRE ® (Madison, Wl), Invitrogen Corp. (Carlsbad, CA),
- the vector or cassette contains sequences directing transcription and translation of the relevant gene, a selectable marker, and sequences allowing autonomous replication or chromosomal integration.
- Suitable vectors comprise a region 5' of the gene which harbors transcriptional initiation controls and a region 3' of the DNA fragment which controls transcriptional termination. Both control regions can be derived from genes homologous to the transformed host cell, although it is to be understood that such control regions can also be derived from genes that are not native to the specific species chosen as a production host.
- Initiation control regions or promoters which are useful to drive expression of the relevant pathway coding regions in the desired host cell are numerous and familiar to those skilled in the art. Virtually any promoter capable of driving these genetic elements, including those used in the Examples, is suitable for the present invention including, but not limited to, CYC1, HIS3, GAL1, GAL 10, ADH1, PGK, PH05, GAPDH, ADC1, TRP1, URA3, LEU2, ENO, TPI (useful for expression in
- Alcaligenes, and Pseudomonas as well as the amy, apr, npr promoters and various phage promoters useful for expression in Bacillus subtilis, Bacillus licheniformis, and Paenibacillus macerans.
- yeast recombinant host cells a number of promoters can be used in
- expression cassettes for genes including, but not limited to, the following constitutive promoters suitable for use in yeast: FBA1 , TDH3 (GPD), ADH1 , ILV5, and GPM1 ; and the following inducible promoters suitable for use in yeast: GAL1 , GAL10, OLE1 , and CUP1.
- yeast promoters include hybrid promoters UAS(PGK1 )-FBA1 p (SEQ ID NO: 406), UAS(PGK1 )-EN02p (SEQ ID NO: 538), UAS(FBA1)-PDC1 p (SEQ ID NO: 539), UAS(PGK1 )-PDC1 p (SEQ ID NO: 540), and UAS(PGK)- OLE1 p (SEQ ID NO: 541 ).
- Promoters, transcriptional terminators, and coding regions can be cloned into a yeast 2 micron plasmid and transformed into yeast cells (Ludwig, et al. Gene, 132. 33-40, 1993, US Appl. Pub. No.
- Adjusting the amount of gene expression in a given host may be achieved by varying the level of transcription, such as through selection of native or artificial promoters.
- techniques such as the use of promoter libraries to achieve desired levels of gene transcription are well known in the art.
- Such libraries can be generated using techniques known in the art, for example, by cloning of random cDNA fragments in front of gene cassettes (Goh ei al. (2002) AEM 99, 17025), by modulating regulatory sequences present within promoters (Ligr ei al. (2006) Genetics 172, 21 13), or by mutagenesis of known promoter sequences (Alper et al. (2005) PNAS, 12678; Nevoigt et al. (2006) AEM 72, 5266).
- Termination control regions can also be derived from various genes native to the hosts.
- a termination site can be unnecessaryor can be included.
- Certain vectors are capable of replicating in a broad range of host bacteria and can be transferred by conjugation.
- the complete and annotated sequence of pRK404 and three related vectors-pRK437, pRK442, and pRK442(H) are available. These derivatives have proven to be valuable tools for genetic manipulation in Gram-negative bacteria (Scott et al., Plasmid, 50: 74-79, 2003).
- Several plasmid derivatives of broad-host-range Inc P4 plasmid RSF1010 are also available with promoters that can function in a range of Gram-negative bacteria.
- Plasmid pAYC36 and pAYC37 have active promoters along with multiple cloning sites to allow for the heterologous gene expression in Gram- negative bacteria.
- Chromosomal gene replacement tools are also widely available.
- a thermosensitive variant of the broad-host-range replicon pWV101 has been modified to construct a plasmid pVE6002 which can be used to effect gene replacement in a range of Gram-positive bacteria (Maguin et al., J. Bacterid., 174: 5633-5638, 1992).
- in vitro transposomes are available to create random mutations in a variety of genomes from commercial sources such as EPICENTRE®. The expression of a butanol biosynthetic pathway in various microbial hosts is described in more detail below.
- Vectors or cassettes useful for the transformation of E. coli are common and commercially available from the companies listed above.
- the genes of an isobutanol biosynthetic pathway can be isolated from various sources, cloned into a modified pUC19 vector and transformed into E. coli NM522.
- Rhodococcus erythropolis A series of E. coli- Rhodococcus shuttle vectors are available for expression in R. erythropolis, including, but not limited to, pRhBR17 and pDA71 (Kostichka et al., Appl. Microbiol. Biotechnol., 62: 61-68, 2003). Additionally, a series of promoters are available for heterologous gene expression in R. erythropolis (Nakashima et al., Appl. Environ. Microbiol., 70: 5557-5568, 2004 and Tao et al., Appl. Microbiol. Biotechnol., 68: 346- 354, 2005). Targeted gene disruption of chromosomal genes in R.
- erythropolis can be created using the method described by Tao et al., supra, and Brans et al. (Appl. Environ. Microbiol. , 66: 2029-2036, 2000).
- heterologous genes required for the production of isobutanol can be cloned initially in pDA71 or pRhBR71 and transformed into E. coli.
- the vectors can then be transformed into R. erythropolis by electroporation, as described by Kostichka et al., supra.
- the recombinants can be grown in synthetic medium containing glucose and the production of isobutanol can be followed using methods known in the art.
- genes of an isobutanol biosynthetic pathway can be isolated from various sources, cloned into a modified pUC19 vector and transformed into Bacillus subtilis BE1010. Additionally, the five genes of an isobutanol biosynthetic pathway can be split into two operons for expression.
- the three genes of the pathway (bubB, ilvD, and kivD) can be integrated into the chromosome of Bacillus subtilis BE1010 (Payne, et al., J. Bacteriol., 173, 2278-2282, 1991).
- the remaining two genes (HvC and bdhB) can be cloned into an expression vector and transformed into the Bacillus strain carrying the integrated isobutanol genes
- the genes required for the production of isobutanol can be cloned in plasmids pBE20 or pBE60 derivatives (Nagarajan et al., Gene, 114: 121-126, 1992). Methods to transform B. Iicheniformis are known in the art (Fleming et al. Appl. Environ. Microbiol., 61 : 3775-3780, 1995). The plasmids constructed for expression in B. subtilis can be transformed into B. Iicheniformis to produce a recombinant microbial host that produces isobutanol.
- Plasmids can be constructed as described above for expression in B. subtilis and used to transform Paenibacillus macerans by protoplast transformation to produce a recombinant microbial host that produces isobutanol.
- Alcaligenes eutrophus are known in the art (Taghavi et al., Appl. Environ. Microbiol., 60: 3585-3591 , 1994).
- the genes for an isobutanol biosynthetic pathway can be cloned in any of the broad host range vectors described above, and electroporated to generate recombinants that produce isobutanol.
- the poly(hydroxybutyrate) pathway in Alcaligenes has been described in detail, a variety of genetic techniques to modify the Alcaligenes eutrophus genome is known, and those tools can be applied for engineering an isobutanol biosynthetic pathway.
- yeast promoters can be used in constructing expression cassettes for genes encoding an isobutanol biosynthetic pathway, including, but not limited to constitutive promoters FBA, GPD, ADH1 , and GPM, and the inducible promoters GAL1 , GAL10, and CUP1.
- Suitable transcriptional terminators include, but are not limited to FBAt, GPDt, GPMt, ERG10t, GAL1t, CYC1 , and ADH1.
- suitable promoters, transcriptional terminators, and the genes of an isobutanol biosynthetic pathway can be cloned into E.
- coli- yeast shuttle vectors and transformed into yeast cells as described in U.S. App. Pub. No. 20100129886. These vectors allow strain propagation in both E. coli and yeast strains. Typically the vector contains a selectable marker and sequences allowing autonomous replication or chromosomal integration in the desired host.
- plasmids in yeast are shuttle vectors pRS423, pRS424, pRS425, and pRS426 (American Type Culture Collection, Rockville, MD), which contain an E. coli replication origin (e.g., pMB1), a yeast 2 ⁇ origin of replication, and a marker for nutritional selection.
- the selection markers for these four vectors are His3 (vector pRS423), Trp1 (vector pRS424), Leu2 (vector pRS425) and Ura3 (vector pRS426).
- Construction of expression vectors with genes encoding polypeptides of interest can be performed by either standard molecular cloning techniques in E. coli or by the gap repair recombination method in yeast.
- the gap repair cloning approach takes advantage of the highly efficient homologous recombination in yeast.
- a yeast vector DNA is digested (e.g., in its multiple cloning site) to create a "gap" in its sequence.
- a number of insert DNAs of interest are generated that contain a > 21 bp sequence at both the 5' and the 3' ends that
- a yeast promoter and a yeast terminator are selected for the expression cassette.
- the promoter and terminator are amplified from the yeast genomic DNA
- Gene X is either PCR amplified from its source organism or obtained from a cloning vector comprising Gene X sequence.
- the "gapped" vector and the insert DNAs are then co-transformed into a yeast strain and plated on the medium
- a cassette containing a coding region plus control elements (promoter and terminator) and auxotrophic marker is PCR- amplified with a high-fidelity DNA polymerase using primers that hybridize to the cassette and contain 40-70 base pairs of sequence homology to the regions 5' and 3' of the genomic area where insertion is desired.
- the PCR product is then transformed into yeast and plated on medium containing the appropriate compound mixtures that allow selection for the integrated auxotrophic marker.
- the promoter-coding regionX-terminator construct is PCR amplified from a plasmid DNA construct and joined to an autotrophic marker (such as URA3) by either SOE PCR or by common restriction digests and cloning.
- the full cassette, containing the promoter-coding regionX-terminator-C f?,43 region, is PCR amplified with primer sequences that contain 40-70 bp of homology to the regions 5' and 3' of location "Y" on the yeast chromosome.
- the PCR product is transformed into yeast and
- Transformants can be selected on growth media lacking uracil.
- the Lactobacillus genus belongs to the Lactobacillales family and many plasmids and vectors used in the transformation of Bacillus subtilis and Streptococcus can be used for Lactobacillus.
- suitable vectors include ⁇ and derivatives thereof (Renault et al., Gene 183: 175-182, 1996); and (O'Sullivan et al., Gene, 137: 227-231 ,
- pMBB1 and pHW800 a derivative of pMBB1 (Wyckoff et al., Appl. Environ. Microbiol., 62: 1481 -1486, 1996);
- pMG1 a conjugative plasmid (Tanimoto et al., J. Bacteriol., 184: 5800-5804, 2002);
- pNZ9520 a conjugative plasmid
- the Enterococcus genus belongs to the Lactobacillales family and many plasmids and vectors used in the transformation of Lactobacilli, Bacilli and Streptococci species can be used for Enterococcus species.
- suitable vectors include ⁇ and derivatives thereof (Renault et al., Gene, 183: 175-182, 1996); and (O'Sullivan et al., Gene, 137: 227-231 , 1993); pMBB1 and pHW800, a derivative of pMBB1 (Wyckoff et al. Appl. Environ.
- faecalis using the nisA gene from Lactococcus can also be used (Eichenbaum et al., Appl. Environ. Microbiol., 64: 2763-2769, 1998). Additionally, vectors for gene replacement in the E. faecium chromosome can be used (Nallaapareddy et al., Appl. Environ. Microbiol., 72: 334-345, 2006).
- Fermentation media in the present invention must contain suitable carbon substrates.
- suitable substrates can include but are not limited to monosaccharides such as glucose and fructose, oligosaccharides such as lactose, maltose, galactose, sucrose, polysaccharides such as starch or cellulose or mixtures thereof and unpurified mixtures from renewable feedstocks such as cheese whey permeate, cornsteep liquor, sugar beet molasses, and barley malt.
- the carbon substrate can also be one-carbon substrates such as carbon dioxide, or methanol for which metabolic conversion into key biochemical intermediates has been demonstrated. In addition to one and two carbon substrates
- methylotrophic microorganisms are also known to utilize a number of other carbon containing compounds such as methy!amine, glucosamine and a variety of amino acids for metabolic activity.
- methylotrophic yeast are known to utilize the carbon from methylamine to form trehalose or glycerol (Bellion et al., Microb. Growth C1 Compd., [Int. Symp ], 7th (1993), 415-32. (eds): Murrell, J. Collin; Kelly, Don P. Publisher:
- Candida will metabolize alanine or oleic acid (Suiter et al., Arch. Microbiol., 153:
- the source of carbon utilized in the present invention can encompass a wide variety of carbon containing substrates and will only be limited by the choice of
- the carbon substrates are glucose, fructose, and sucrose, or mixtures of these with C5 sugars such as xylose and/or arabinose for yeasts cells modified to use C5 sugars.
- Sucrose can be derived from renewable sugar sources such as sugar cane, sugar beets, cassava, sweet sorghum, and mixtures thereof.
- Glucose and dextrose can be derived from renewable grain sources through saccharification of starch based feedstocks including grains such as corn, wheat, rye, barley, oats, and mixtures thereof.
- fermentable sugars can be derived from renewable cellulosic or lignocellulosic biomass through processes of pretreatment and saccharification, as described, for example, in U.S.
- Biomass refers to any cellulosic or lignocellulosic material and includes materials comprising cellulose, and optionally further comprising hemicellulose, lignin, starch, oligosaccharides and/or monosaccharides. Biomass can also comprise additional components, such as protein and/or lipid. Biomass can be derived from a single source, or biomass can comprise a mixture derived from more than one source; for example, biomass can comprise a mixture of corn cobs and corn stover, or a mixture of grass and leaves.
- Biomass includes, but is not limited to, bioenergy crops, agricultural residues, municipal solid waste, industrial solid waste, sludge from paper manufacture, yard waste, wood and forestry waste.
- biomass include, but are not limited to, corn grain, corn cobs, crop residues such as corn husks, corn stover, grasses, wheat, wheat straw, barley, barley straw, hay, rice straw, switchgrass, waste paper, sugar cane bagasse, sorghum, soy,
- fermentation media must contain suitable minerals, salts, cofactors, buffers and other components, known to those skilled in the art, suitable for growth of the cultures and promotion of the enzymatic pathway necessary for butanol production described herein.
- Suitable growth media in the present invention are common commercially prepared media such as Luria Bertani (LB) broth, Sabouraud Dextrose (SD) broth or Yeast Medium (YM) broth or broth that includes yeast nitrogen base, ammonium sulfate, and dextrose (as the carbon/energy source) or YPD Medium, a blend of peptone, yeast extract, and dextrose in optimal proportions for growing most Saccharomyces cerevisiae strains.
- Other defined or synthetic growth media can also be used, and the appropriate medium for growth of the particular microorganism will be known by one skilled in the art of microbiology or fermentation science.
- agents known to modulate catabolite repression directly or indirectly e.g., cyclic adenosine 2',3'-monophosphate (cAMP), can also be incorporated into the cAMP.
- cAMP cyclic adenosine 2',3'-monophosphate
- Suitable pH ranges for the fermentation are between pH 5.0 to pH 9.0, where pH 6.0 to pH 8.0 is preferred for the initial condition.
- Suitable pH ranges for the fermentation of yeast are typically between about pH 3.0 to about pH 9.0. In one embodiment, about pH 5.0 to about pH 8.0 is used for the initial condition. Suitable pH ranges for the fermentation of other microorganisms are between about pH 3.0 to about pH 7.5. In one embodiment, about pH 4.5 to about pH 6.5 is used for the initial condition.
- Fermentations can be performed under aerobic or anaerobic conditions. In one embodiment, anaerobic or microaerobic conditions are used for fermentation.
- the present processes may employ a batch method of
- a classical batch fermentation is a closed system where the composition of the medium is set at the beginning of the fermentation and not subject to artificial alterations during the fermentation. Thus, at the beginning of the fermentation the medium is inoculated with the desired microorganism or microorganisms, and fermentation is permitted to occur without adding anything to the system.
- a "batch" fermentation is batch with respect to the addition of carbon source and attempts are often made at controlling factors such as pH and oxygen concentration.
- the metabolite and biomass compositions of the system change constantly up to the time the fermentation is stopped.
- cells moderate through a static lag phase to a high growth log phase and finally to a stationary phase where growth rate is diminished or halted. If untreated, cells in the stationary phase will eventually die.
- Cells in log phase generally are responsible for the bulk of production of end product or intermediate.
- Fed-Batch fermentation processes are also suitable in the present invention and comprise a typical batch system with the exception that the substrate is added in increments as the fermentation progresses.
- Fed-Batch systems are useful when catabolite repression is apt to inhibit the metabolism of the cells and where it is desirable to have limited amounts of substrate in the medium. Measurement of the actual substrate concentration in Fed-Batch systems is difficult and is therefore estimated on the basis of the changes of measurable factors such as pH, dissolved oxygen and the partial pressure of waste gases such as CO2 Batch and
- Continuous fermentation is an open system where a defined fermentation medium is added continuously to a bioreactor and an equal amount of conditioned medium is removed simultaneously for processing.
- Continuous fermentation generally maintains the cultures at a constant high density where cells are primarily in log phase growth.
- Continuous fermentation allows for modulation of one factor or any number of factors that affect cell growth or end product concentration.
- one method will maintain a limiting nutrient such as the carbon source or nitrogen level at a fixed rate and allow all other parameters to moderate.
- a number of factors affecting growth can be altered continuously while the cell concentration, measured by medium turbidity, is kept constant.
- Continuous systems strive to maintain steady state growth conditions and thus the cell loss due to the medium being drawn off must be balanced against the cell growth rate in the
- the present invention can be practiced using either batch, fed-batch or continuous processes and that any known mode of fermentation would be suitable. Additionally, it is contemplated that cells can be immobilized on a substrate as whole cell catalysts and subjected to fermentation conditions for isobutanol production. Methods for Butanol Isolation from the Fermentation Medium
- Bioproduced butanol can be isolated from the fermentation medium using methods known in the art for ABE fermentations (see, e.g. , Durre, Appl. Microbiol. Biotechnol. 49:639-648 (1998), Groot er a/. , Process. Biochem. 27:61 -75 (1992), and references therein).
- solids can be removed from the fermentation medium by centrifugation, filtration, decantation, or the like.
- the butanol can be isolated from the fermentation medium using methods such as distillation, azeotropic distillation, liquid-liquid extraction, adsorption, gas stripping, membrane evaporation, or pervaporation.
- distillation can be used to separate the mixture up to its azeotropic composition. Distillation can be used in combination with another separation method to obtain separation around the azeotrope. Methods that can be used in combination with distillation to isolate and purify butanol include, but are not limited to, decantation, liquid-liquid extraction, adsorption, and membrane-based techniques. Additionally, butanol can be isolated using azeotropic distillation using an entrainer (see, e.g. , Doherty and Malone, Conceptual Design of Distillation Systems, McGraw Hill, New York, 2001).
- the butanol-water mixture forms a heterogeneous azeotrope so that distillation can be used in combination with decantation to isolate and purify the butanol.
- the butanol containing fermentation broth is distilled to near the azeotropic composition.
- the azeotropic mixture is condensed, and the butanol is separated from the fermentation medium by decantation.
- the decanted aqueous phase can be returned to the first distillation column as reflux.
- the butanol-rich decanted organic phase can be further purified by distillation in a second distillation column.
- the butanol can also be isolated from the fermentation medium using liquid-liquid extraction in combination with distillation.
- the butanol is extracted from the fermentation broth using liquid-liquid extraction with a suitable solvent.
- the butanol-containing organic phase is then distilled to separate the butanol from the solvent.
- Distillation in combination with adsorption can also be used to isolate butanol from the fermentation medium.
- the fermentation broth containing the butanol is distilled to near the azeotropic composition and then the remaining water is removed by use of an adsorbent, such as molecular sieves (Aden et al. , Lignocellulosic Biomass to Ethanol Process Design and Economics Utilizing Co-Current Dilute Acid Prehydrolysis and Enzymatic Hydrolysis for Corn Stover, Report
- distillation in combination with pervaporation can be used to isolate and purify the butanol from the fermentation medium.
- the fermentation broth containing the butanol is distilled to near the azeotropic composition, and then the remaining water is removed by pervaporation through a hydrophilic membrane (Guo et al., J. Membr. Sci. 245, 199-210 (2004)).
- ISPR In situ product removal
- extractive fermentation can be used to remove butanol (or other fermentative alcohol) from the fermentation vessel as it is produced, thereby allowing the microorganism to produce butanol at high yields.
- One method for ISPR for removing fermentative alcohol that has been described in the art is liquid-liquid extraction.
- the fermentation medium which includes the microorganism
- the fermentation medium is contacted with an organic extractant at a time before the butanol concentration reaches a toxic level.
- the organic extractant and the fermentation medium form a biphasic mixture.
- the butanol partitions into the organic extractant phase, decreasing the concentration in the aqueous phase containing the microorganism, thereby limiting the exposure of the microorganism to the inhibitory butanol.
- Liquid-liquid extraction can be performed, for example, according to the processes described in U.S. Patent Appl. Pub. No. 2009/0305370, the disclosure of which is hereby incorporated in its entirety.
- U.S. Patent Appl. Pub. No. 2009/0305370 describes methods for producing and recovering butanol from a fermentation broth using liquid-liquid extraction, the methods comprising the step of contacting the fermentation broth with a water immiscible extractant to form a two-phase mixture comprising an aqueous phase and an organic phase.
- the extractant can be an organic extractant selected from the group consisting of saturated, mono- unsaturated, poly-unsaturated (and mixtures thereof) C12 to C22 fatty alcohols, C12 to C22 fatty acids, esters of C 12 to C22 fatty acids, C12 to C22 fatty aldehydes, and mixtures thereof.
- the extractant(s) for ISPR can be non-alcohol extractants.
- the ISPR extractant can be an exogenous organic extractant such as oleyl alcohol, behenyl alcohol, cetyl alcohol, lauryl alcohol, myristyl alcohol, stearyl alcohol, 1-undecanol, oleic acid, lauric acid, myristic acid, stearic acid, methyl myristate, methyl oleate, undecanal, lauric aldehyde, 20-methy!undecanal, and mixtures thereof.
- an exogenous organic extractant such as oleyl alcohol, behenyl alcohol, cetyl alcohol, lauryl alcohol, myristyl alcohol, stearyl alcohol, 1-undecanol, oleic acid, lauric acid, myristic acid, stearic acid, methyl myristate, methyl oleate, undecanal, lauric aldehyde, 20-methy!undecanal, and mixtures thereof.
- the ester can be formed by contacting the alcohol in a fermentation medium with a carboxylic acid (e.g., fatty acids) and a catalyst capable of esterfiying the alcohol with the carboxylic acid, as described in PCT Appn. Pub. No. WO/201 1/159998, which is herein incorporated by reference in its entirety.
- the carboxylic acid can serve as an ISPR extractant into which the alcohol esters partition.
- the carboxylic acid can be supplied to the fermentation vessel and/or derived from the biomass supplying fermentable carbon fed to the fermentation vessel.
- Lipids present in the feedstock can be catalytically hydrolyzed to carboxylic acid, and the same catalyst (e.g., enzymes) can esterify the carboxylic acid with the alcohol.
- the catalyst can be supplied to the feedstock prior to fermentation, or can be supplied to the fermentation vessel before or contemporaneously with the supplying of the feedstock.
- alcohol esters can be obtained by hydrolysis of the lipids into carboxylic acid and substantially simultaneous esterification of the carboxylic acid with butanol present in the fermentation vessel.
- Carboxylic acid and/or native oil not derived from the feedstock can also be fed to the
- any carboxylic acid not esterified with the alcohol can serve as part of the ISPR extractant.
- the extractant containing alcohol esters can be separated from the fermentation medium, and the alcohol can be recovered from the extractant.
- the extractant can be recycled to the fermentation vessel.
- the conversion of the butanol to an ester may reduce the free butanol concentration in the fermentation medium, shielding the microorganism from the toxic effect of increasing butanol concentration.
- unfractionated grain can be used as feedstock without separation of lipids therein, since the lipids can be catalytically hydrolyzed to carboxylic acid, thereby decreasing the rate of build-up of lipids in the ISPR extractant.
- In situ product removal can be carried out in a batch mode or a continuous mode.
- product is continually removed from the reactor.
- a batchwise mode of in situ product removal a volume of organic extractant is added to the fermentation vessel and the extractant is not removed during the process.
- the organic extractant can contact the fermentation medium at the start of the fermentation forming a biphasic fermentation medium.
- the organic extractant can contact the fermentation medium after the microorganism has achieved a desired amount of growth, which can be determined by measuring the optical density of the culture. Further, the organic extractant can contact the fermentation medium at a time at which the product alcohol level in the fermentation medium reaches a preselected level.
- the carboxylic acid extractant can contact the fermentation medium at a time before the butanol concentration reaches a toxic level, so as to esterify the butanol with the carboxylic acid to produce butanol esters and
- the ester-containing organic phase can then be removed from the fermentation vessel (and separated from the fermentation broth which constitutes the aqueous phase) after a desired effective titer of the butanol esters is achieved.
- the ester-containing organic phase is separated from the aqueous phase after fermentation of the available fermentable sugar in the fermentation vessel is substantially complete.
- Clones from the LB agar plates were selected and inoculated into the 96-well archive plates containing the freezing medium and grown overnight at 37 °C without shaking. The archive plates were then stored at -80°C. E. coli strain Bw251 13 transformed with pBAD-H ⁇ sB (Invitrogen) was always used as the negative control.
- the positive controls for the libraries in Examples 3, 4, and 5 are the wild type K9-KARI, AB1 D3, AB1 D3 respectively.
- Clones from archive plates were inoculated into the 96-deep well plates. Each well contained 3.0 ⁇ of cells from thawed archive plates, 200 ⁇ of the LB medium containing 100 ⁇ g/ml ampicillin and 0.02%(w/v) arabinose as the inducer. Cells were the grown overnight at 37 °C with 80% humidity while shaking (900rpm), harvested by centrifugation (4000 rpm, 5 min at 25 °C). (Eppendorf centrifuge, Brinkmann Instruments, Inc. Westbury, NY) and the cell pellet was stored at -20 °C for later analysis.
- the assay substrate, (R,S)-acetolactate was synthesized as described by Aulabaugh and Schloss (Aulabaugh and Schloss, Biochemistry, 29: 2824- 2830, 1990). All other chemicals used in the assay were purchased from Sigma. '
- the enzymatic conversion of acetolactate to , ⁇ -dihydroxy- isovalerate by KARI was followed by measuring the disappearance of the cofactor, NADPH or NADH, from the reaction at 340 nm using a plate reader (Molecular Device, Sunnyvale, CA). The activity was calculated using the molar extinction coefficient of 6220 M "1 cm '1 for either NADPH or NADH.
- the stock solutions used were: K 2 HP0 4 (0.2 M); KH 2 P0 4 (0.2 M); EDTA (0.5 M); MgCI 2 (1.0 M); NADPH (2.0 mM); NADH (2.0 mM) and acetolactate (45 mM).
- the 100 ml reaction buffer (pH 6.8) containing: 2.0 ml K 2 HP0 4 , 3.0 ml KH 2 P0 4 , 4.0 ml MgCI 2 , 0.1 ml EDTA and 90.9 ml water was prepared.
- Absorbance at 340 nm was recorded as background, 16 ⁇ of acetolactate (4.5 mM, diluted with the reaction buffer) was added to each well and mixed with shaking by the plate reader. Absorbance at 340 nm was recorded at 0, and 10 to 30 minutes depending the expected activity after substrate addition. The difference in absorbance (before and after substrate addition) was used to determine the activity of the mutants. Mutants with higher KARI activity compared to the positive control were selected for re-screening.
- the number of clones screened for the libraries in Examplel , 2 and 3 are about 12,000, 12,000 and 92 respectively.
- the top performers from each library were re-screened described below as secondary assay. Secondary assay of active mutants
- Cells containing selected mutants identified by high throughput screening were grown overnight, at 37°C, in 3.0 ml of the LB medium containing 100 ⁇ g/ml ampicillin and 0.025%(w/v) arabinose as the inducer while shaking at 250 rpm. The cells were then aliquoted into 96 deepwell plates (200 ⁇ per well) and harvested by centrifugation at 4,000 xg for 5 min at room temperature. 75 ⁇ of 50% BugBuster (v/v in water) was added to each well and cells were suspended using plate shaker. The plates were incubated at room temperature for 20 min.
- KARI enzyme activity can be routinely measured by NADH or NADPH oxidation as described above, however to measure the Michaelis constant (KM) for these pyridine nucleotides formation of the 2,3- dihydroxyisovalerate product was measured directly using HPLC/MS.
- Protein concentration of crude cell extract from Bugbuster lysed cells was measured using the BioRad protein assay reagent (BioRad Laboratories, Inc., Hercules, CA 94547).
- reaction buffer consisting of 100 mM MOPS KOH, pH 6.8, 10 mM MgCI 2l 1 mM EDTA, 1 mM glucose-6-phosphate (Sigma-Aldrich), 0.2 Units of
- 2 ⁇ _ of the formic acid quenched reaction mixture was injected into a Waters Acquity HPLC equipped with Waters SQD mass spectrometer (Waters Corporation, Milford , MA).
- the chromatography conditions were: flow rate (0.5 ml/min), on a Waters Acquity HSS T3 column (2.1 mm diameter, 100 mm length).
- Buffer A consisted of 0.1 % (v/v) in water
- Buffer B was 0.1 % formic acid in acetonitrile.
- the sample was analyzed using 1 % buffer B (in buffer A) for 1 min, followed by a linear gradient from 1% buffer B at 1 min to 75% buffer B at 1.5 min.
- reaction product 2,3-dihydroxyisovalerate
- electrospay ionization -30 V cone voltage The amount of product 2,3- dihydroxyisovalerate was calculated by comparison to an authentic standard.
- pl_H702 pY2058 was derived from pYZ090 (pHR81 -P C uprAlsS-Pi L v5-lactis KARI; SEQ ID NO: 195).
- pYZ090 was cut with Pmel and Sfil enzymes, and ligated with a PCR product of yeast KARI.
- the PCR product was amplified from genomic DNA of Saccharomyces cerevisiae BY4741 (Research Genetics Inc.) strain using upper primer 5'- catcatcacagtttaaacagtatgttgaagcaaatcaacttcggtgg-3' (SEQ ID NO: 272) and lower primer 5'- ggacgggccctgcaggccttattggttttctggtctcaactttctgac-3' (SEQ ID NO: 273), and digested with Pmel and Sfil enzymes.
- pYZ058 was confirmed by sequencing.
- pLH550 (pHR81-PCUP1 -AlsS-PIL.V5-Pf5.KARI, SEQ ID NO: 175) was derived from pYZ058 (SEQ ID NO: 176).
- the wild type Pf5.KARI gene was PCR amplified with OT1349 (5'- catcatcacagtttaaacagtatgaaagttttctacgataaagactgcgacc-3'; SEQ ID NO: 177) and OT1318 (5'-gcacttgataggcctgcagggccttagttcttggctttgtcgacgattttg- 3'; SEQ ID NO: 178), digested with Pmel and Sfil enzymes and ligated with pYZ058 vector cut with Pmel and Sfil.
- the vector generated, pl_H550 was confirmed by sequencing.
- pLH556 (SEQ ID NO: 138; FIGURE 4) was derived from pLH550 by digesting the vector with Spel and NotI enzymes, and ligating with a linker annealed from OT1383 (5'-ctagtcaccggtggc-3 ⁇ SEQ ID NO: 179) and OT1384 (5'-ggccgccaccggtga-3 ⁇ SEQ ID NO: 180) which contains overhang sequences for Spel and NotI sites.
- This cloning step eliminates the AlsS gene and a large fragment of the PCUP1 promoter, with 60 bp residual upstream sequence that is not functional.
- pLH556 was confirmed by sequencing.
- pHR81 ::ILV5p-K9D3 (pLH702, SEQ ID NO: 181 ) was derived from pLH556.
- the K9D3 mutant KARI gene was excised from vector pBAD- K9D3 using Pmel and Sfil enzymes, and ligated with pLH556 at Pmel and Sfil sites, replacing the Pf5.KARI gene with the K9D3 gene.
- the constructed vector was confirmed by sequencing.
- KARI genes were codon optimized based on codon preferences of Saccharomyces cerevisiae genes where indicated in Table 10.
- a Pmel restriction site and additional 3 bp was added to the 5' end with the sequence 5'-GTTTAAACAGT-3' (SEQ ID NO: 136) before the ATG start codon, and a Sfil restriction site was added to the 3' end with the sequence 5'-GGCCCTGCAGGCC-3' (SEQ ID NO: 137). All of the KARI genes were synthesized by GenScript USA Inc.
- Each KARI gene was subcloned into pHR81 -P C upi-AlsS-Pii V 5-Pf5.llv5 vector (SEQ ID NO: 175) via the Pmel and Sfil sites (Ilv5 encodes for yeast ketol-acid reductoisomerase).
- This vector contains two expression cassettes: Bacillus subtilis acetolactate synthase (AlsS) gene under the yeast CUP1 promoter, and yeast Ilv5 gene controlled by the Ilv5 promoter. Sequence analysis was performed to confirm the KARI gene sequences.
- pHR81-PCUP1-AlsS-Pl lv5 -KARI vectors carrying the KARI genes were co-transformed with pLH468 (pRS423-P F BAi-DHAD- P T DH3- kivD-P G PMi-hADH1 ; SEQ ID NO: 139) into host strain BP1 135 ( ⁇ 1505; Example 8) (CEN.pk 1 13-7D delta ura3::loxP delta his3 delta pdc6 delta pdd ::ilvD.Sm delta pdc5::sadB delta gpd2::loxP delta fra2).
- yeast transformants were selected on minimum drop-out media plates (SE-Ura- His, 2% ethanol) after 5-7 days at 30°C, and restreaked on SE-Ura-His to obtain cell patches after additional 3 day incubation. The cell patches were used for shake flask inoculation.
- the various KARI genes were evaluated based on their "effective productivities" in yeast.
- the effective productivity was determined after a certain period of growth under progressively oxygen-limited conditions (e.g. 48 h).
- the yeast biomass was calculated with the assumption that 1 OD 6 oo of yeast cells is equivalent to 0.3 g/L.
- the yeast isobutanol pathway strains carrying various KARI genes were inoculated into 10 mL SEG-Ura,His media with 0.2% glucose and 0.2% ethanol, and grown aerobically overnight at 30°C, to about 2 OD.
- the cultures were centrifuged and a portion of the cells were resuspended in SEG-Ura,His (2% glucose, 1 % ethanol) to an initial OD 6 oo of 0.4 in 25 mL total volume in a 125 mL shake flask.
- the shake flasks were closed with a screw-on solid plastid cap, and the cultures were grown under progressively oxygen-limited conditions in the flask under minimal air and oxygen exchange with the outside environment. After 48 h incubation at 30°C, 250 RPM, the cultures were removed for OD 6 oo measurement and HPLC analysis to measure isobutanol production.
- IpOHA N-isopropyl oxalylhydroxamic acid
- KARI enzyme analysis of the yeast isobutanol pathway strains IpOHA (N-isopropyl oxalylhydroxamic acid) is a mimic of a reaction intermediate for the reaction catalyzed by the KARI enzyme. It is a tight binding inhibitor that binds to the active site of the KARI enzyme.
- the synthesis of IpOHA and its tight binding to KARI from E. coli is described in literature (A. Aulabaugh and J. V. Schloss, Biochemistry, 1990, 29, 2824-2830). Its use for active site titration has not been reported before. IpOHA was synthesized from [ 14 C]-oxalate according to literature.
- the yeast cultures from Example 2 were harvested and analyzed for KARI enzyme activities. 25 mL of the cultures was pelleted and resuspended in 10 mL of 50 mM Tris-HCI, pH 7.5. The cells were centrifuged again to remove the buffer and the cell pellets are stored at - 70C. The cell pellets were resuspended in 1 mL of 50 mM Tris-HCI pH 7.5 and sonicated. Soluble crude cell extracts were used to perform the enzyme assays. A portion of enzyme was incubated with a molar excess of [ 14 C]-lpOHA, and saturating concentrations of NAD(P)H and Mg 2+ .
- concentration was determined by the Bradford method, and the expression level of KARI is calculated by dividing KARI enzyme amount by the amount of total soluble cellular proteins.
- KARI the K9 KARI gene (synthesized by Genscript, Piscataway, NJ) was subcloned into pBAD-ps-JEA1 vector (SEQ ID NO: 905) via the Pmel and Sfil sites.
- KARI ketol-acid reductolsomerase
- K9-KARI The ketol-acid reductolsomerase from Anaerostipes caccae (called K9-KARI) was used for the library construction.
- One gene library was constructed using the commercially available kits, T4 polynucleotide kinase (PNK) (USB Corporation, Cleveland, Ohio,
- K9_56_58_060210r GCTCTCTTCCAMNNTTTMNNTCCTTC, SEQ ID NO: 145) were synthesized by Integrated DNA Technologies, Inc.
- T4 PNK T4 PNK
- a 30 ⁇ reaction mixture contained: 3.0 ⁇ of 10x T4 PNK buffer supplied with the kit, 4.0 ⁇ of primer (about 35 ⁇ ) , 0.8 ⁇ of 100 mM ATP mix, 0.6 ⁇ T4 PNk and 22 ⁇ of water.
- the reaction mixture was incubated at 37 °C for 1.0 hr and T4 PNK was then deactivated at 65 °C for 20 min.
- phosphorylated primers were then directly used for the subsequent PCR reaction to introduce the mutations at two sites into K9 KARI wild type using the kit.
- a 30 ⁇ reaction mixture contained: 3.0 ⁇ of 10x reaction buffer supplied with the kit, 3.0 ⁇ of phosphorylated forward primer and reverse primer, 2.0 ⁇ of K9 KARI wild type (50 ng/ ⁇ ), 1.2 ⁇ ChangJT enzyme and 17.8 ⁇ of water.
- This reaction mixture was placed into thin well 200 ⁇ -capacity PCR tubes and the following PCR reaction program were used for the PCR: The starting temperature was 95°C for 2 min followed by 30 heating/cooling cycles. Each cycle consisted of 95°C for 30 sec, 55°C for 30 sec, and 68°C for 20 min.
- the samples were kept at 68° C for 25 min more, and then held at 4°C for later processing.
- the PCR reaction was cleaned up using the Zymo DNA clean-up kit (Zymo Research Corporation, Orange CA, #D4004). DNA was eluted out of membrane using 84 ⁇ of water. The DNA template was removed with Dpn I
- reaction mixture 10 ⁇ of 10x reaction buffer, 1.0 ⁇ BSA, 6.0 ⁇ of Dpn I and 83 ⁇ cleaned PCR DNA.
- the Dpn I digested DNA was cleaned up again with Zymo DNA clean-up kit and digested again with Dpn I to completely remove the DNA template (reaction mixture: 1.5 ⁇ of 10x reaction buffer, 0.15 ⁇ BSA, 0.85 ⁇ of Dpn I and 83 ⁇ cleaned PCR DNA).
- the reaction mixture was directly used to transform an electro-competent strain of E. coli
- MSA of existing KARI enzymes (K1 , K2, K7, K9, K25, K26, L. Lactis and S2), determined to produce isobutanol in a butanologen strain (see other examples) was used to identify more mutagenesis targets. Positions 41 , 87, 131 , 191 , 227, and 246 were selected as mutagenesis targets.
- the oligonucleotides targeting positions 30, 39, 41 , 67, 86, 87, 131 , 162, 176, 191 , 227, and 246 were commercially synthesized by Integrated DNA Technologies, Inc (Coralville IA) (Table 13). Eight pairs of oligonucleotides targeting positions 30, 67, 131 , 162, 176, 191 , 227, and 246 were used to generate Megaprimers using Supermix from Invitrogen (Cat#10572-014, Invitrogen, Carlsbad, CA). For each PCR reaction, a pair of primers, any combination of one forward primer and one reverse primer encoding different positions from those eight pairs of oligonucleotides (e.g.
- a 25 ⁇ reaction mixture contained: 22.5 ⁇ of Supermix solution, 1.0 ⁇ of forward primer and 1.0 ⁇ of reverse primer, 0.5 ⁇ of AB1 D3 DNA template (50 ng/ ⁇ ). The mixture was placed in a thin well 200 ⁇ tube for the PCR reaction in a Mastercycler gradient equipment (Brinkmann Instruments, Inc. Westbury, NY). The following conditions were used for the PCR reaction: The starting temperature was 95°C for 1.0 min followed by 35 heating/cooling cycles. Each cycle consisted of 95°C for 20 sec, 55°C for 20 sec, and 72°C for 1.0 min.
- PCR product was cleaned up using a DNA cleaning kit (Cat#D4003, Zymo Research, Orange, CA) as recommended by the manufacturer.
- a 25 ⁇ reaction mixture contained: 2.5 ⁇ of 10x reaction buffer, 1.0 ⁇ of 50 ng/ ⁇ template, 20.5 ⁇ of Megaprimer, 0.5 ⁇ of 40 mM dNTP mix, 0.5 ⁇ pfu-ultra DNA polymerase. Except for the
- K9_86&87_101110f K9_86&87_101 110r were directly then used to generate gene libraries using the QuickChange II XL site directed mutagenesis kit.
- Two 25 ⁇ reaction mixtures for the two oligonucleotide sets each 25 ⁇ reaction mixture contained: 2.5 ⁇ of 10x reaction buffer, 1.0 ⁇ of 50 ng/ ⁇ template, 1.0 ⁇ of forward primer, 1.0 ⁇ reverse primer, 0.5 ⁇ of 40 mM dNTP mix, 0.5 ⁇ pfu-ultra DNA polymerase and 18.5 ⁇ of 5 water.
- the PCR program and the subsequent Dpn I processing are the same.
- the Dpn I processed DNA mixture was cleaned up using Zymo DNA clean-up kit following the manufacturer's protocol.
- the cleaned-up DNA was used to transform an electro-competent strain of E. coli 10 Bw251 13 (AilvC) using a BioRad Gene Pulser II (Bio-Rad Laboratories Inc., Hercules, CA).
- the transformed clones were streaked on agar plates containing the LB medium and 100 ⁇ g/ml ampicillin (Cat#L1004, Teknova Inc. Hollister, CA) and incubated at 37 °C overnight. Clones were screened for improved activity using NADH. K M for the improved mutants
- K9_37&39_101 1 10f gtlctcaaggtcacgctNNKgccNNKaatgctaaggaatcc SEQ ID NO: 162
- K9_37&39_101 1 10r GGATTCCTTAGCATTMNNGGCMNNAGCGTGACCTTGAGAAC SEQ II NO: 163
- T131 L, T131A, 10 T131V, T131 M, T131 C, T191 D, T191 C, T191 S, and T191 G are
- a 20 ⁇ reaction mixture contained: 2.0 ⁇ of 10x T4 PNK
- a 50 ⁇ reaction mixture contained: 5.0 ⁇ of 10x reaction buffer supplied with the kit, 2.5 ⁇ of phosphorylated forward primer (0.5 ⁇ of each forward primer shown in Table 15), 2.5 ⁇ reverse primer (0.625 ⁇ of each forward primer shown at Table 15), 2.5 ⁇ of A07B5 (50 ng/ ⁇ ), 2.5 ⁇ ChangJT enzyme and 35 ⁇ of water.
- This reaction mixture was placed into thin well 200 ⁇ -capacity PCR tubes and the following PCR reaction program were used for the PCR: The starting temperature was 95°C for 2 min followed by 30 heating/cooling cycles.
- Each cycle consisted of 95°C for 30 sec, 55°C for 30 sec, and 68°C for 20 min. At the completion of the temperature cycling, the samples were kept at 68° C for 25 min more, and then held at 4°C for later processing.
- the PCR reaction was cleaned up using the Zymo DNA clean-up kit (Zymo Research Corporation, Orange CA, #D4004). DNA was eluted out of membrane using 84 ⁇ of water. The DNA template was removed with Dpn I (Promega, Madison Wl, #R6231 ) at 37 °C for 3 hr (reaction mixture: 10 ⁇ of 10x reaction buffer, 1.0 ⁇ BSA, 6.0 ⁇ of Dpn I and 83 ⁇ cleaned PCR DNA).
- the Dpn I digested DNA was cleaned up again with Zymo DNA clean-up kit and digested again with Dpn I to completely remove the DNA template (reaction mixture: 1.5 ⁇ of 10x reaction buffer, 0.15 ⁇ BSA, 0.85 ⁇ of Dpn I and 83 ⁇ cleaned PCR DNA).
- the Dpn I processed DNA mixture was cleaned up using Zymo DNA clean-up kit following the manufacturer's protocol.
- the cleaned-up DNA was used to transform an electro-competent strain of E. coli
- K9_131A_112210f ggacgttgatgtcGCAatgatcgctcc SEQ ID NO: 167
- V_112210f ggacgttgatg tcGTTatgatcgctcc SEQ ID NO: 168
- K9_191 C_1 12210r GGT1 rTCAGTTTCGCATCTGAAGGTAGTTTC SEQ ID NO: 172 K9_191 S_1 12210r: GGTl nrCAGTTTCCGATCTGAAGGTAGTTTC SEQ ID NO: 173 K9_191 G_1 12210r: GGT rTCAGTTTCGCCTCTGAAGGTAGTTTC SEQ ID NO: 174
- yeast expression plasmids were made by subcloning of the variant KARI genes from E.coli vectors (pBAD.KARI) into pHR81-Pllv5- Pf5.KARI vector pLH556 ( Figure 4, SEQ ID NO: 138) at Pmel and Sfil sites.
- Yeast pathway strains were made in PNY2204 host (MATa ura3A::loxP his3A pdc6A pdc1A::P[PDC1]-DHAD
- Transformants were patched to the same medium containing 2% glucose and 0.1% ethanol as carbon sources. Three patches were tested for isobutanol production under microaerobic conditions in serum vials. A clone that was transformed with pBP915 and the pLH702 plasmid which expresses K9D3 was designated PNY1910. Yeast colonies from the transformation on SE-Ura-His plates appeared after 5-7 days. The colonies were patched onto fresh SE-Ura- His plates, incubate at 30°C for 3 days.
- the patched cells were inoculated into 25 m!_ SEG-Ura,His media with 0.2% glucose and 0.2% ethanol and grown aerobically for 1-2 days at 30°C, to 2-3 OD.
- the cells were centrifuged and re-suspended in 1 mL of SEG-Ura.His media (2% glucose, 0.1 % ethanol, 10 mg/L ergosterol, 50 mM MES, pH 5.5, thiamine 30 mg/L, nicotinic acid 30 mg/L).
- This step was done in the regular bio-hood in air.
- the serum vials were incubated at 30C, 200 rpm for 2 days.
- the samples were removed for OD and HPLC analysis of glucose, isobutanol and pathway intermediates.
- 24 h samples were taken in an anaerobic chamber to maintain the anaerobic condition in the serum vials.
- the air present in the head space 15 mL
- the liquid media is consumed by the growing yeast cells.
- the culture becomes anaerobic. Therefore this experiment includes switching condition from aerobic to oxygen limiting and anaerobic conditions.
- AB1 G9 and AB1 D3 produced relatively high isobutanol titers, while 495B5 and AB1 D1 have lower titer.
- Wild type K9 KARI strain produced the lowest titer. While not wishing to be bound by theory, it is believed that the lower titer is due to the shifted balance of NADH and NADPH when cells are switched from aerobic to anaerobic conditions. By this rationale, under anaerobic conditions, NADH concentration and availability increased significantly, favoring the variant KARI enzymes that use NADH.
- AB1G9 (“K9G9”) and AB1 D3 (“K9D3”) mutants have relatively high K for NADPH (23 & 9.2 ⁇ ), in addition to their relative low K M for NADH (47 & 38 ⁇ ).
- K9G9 K9G9
- AB1 D3 K9D3 mutants
- 495B5 and AB1 D1's KM'S are 2.5 and 1.1 ⁇ respectively for NADPH
- wt K9's K M is 0.10 ⁇ .
- the low NADH K of AB1 G9 and AB1 D3, together with the high NADPH K M of AB1 G9 and AB1 D3 may have led to reduced NADPH utilization under anaerobic conditions, and relatively high NADH utilization.
- the isobutanohglycerol ratio is for the wild type K9 is 1 :1 under the same switched aerobic to anaerobic condition.
- BP1 135 and PNY1507 were derived from PNY1503 (BP1064).
- PNY1503 was derived from CEN.PK 1 13-7D (CBS 8340; Centraalbureau voor Schimmelcultures (CBS) Fungal Biodiversiry Centre, Netherlands).
- BP1 135 contains an additional deletion of the FRA2 gene.
- PNY1507 was derived from BP1 135 with additional deletion of the ADH1 gene, with integration of the kivD gene from Lactococcus lactis, codon optimized for expression in Saccharomyces cerevisiae, into the ADH1 locus.
- Deletions/integrations were created by homologous recombination with PCR fragments containing regions of homology upstream and downstream of the target gene and the URA3 gene for selection of transformants.
- the URA3 gene was removed by homologous
- the PCR cassette for each deletion/integration was made by combining four fragments, A-B-U-C, and the gene to be integratied by cloning the individual fragments into a plasmid prior to the entire cassette being amplified by PCR for the deletion/integration procedure.
- the gene to be integrated was included in the cassette between fragments A and B.
- the PCR cassette contained a selectable/counter-selectable marker, URA3 (Fragment U), consisting of the native CEN.PK 1 13-7D URA3 gene, along with the promoter (250 bp upstream of the URA3 gene) and terminator (150 bp downstream of the URA3 gene) regions.
- Fragments A and C (each approximately 100 to 500 bp long) corresponded to the sequence immediately upstream of the target region (Fragment A) and the 3' sequence of the target region (Fragment C). Fragments A and C were used for integration of the cassette into the chromosome by homologous recombination. Fragment B (500 bp long) corresponded to the 500 bp immediately downstream of the target region and was used for excision of the URA3 marker and Fragment C from the chromosome by homologous recombination, as a direct repeat of the sequence corresponding to Fragment B was created upon integration of the cassette into the chromosome.
- the FRA2 deletion was designed to delete 250 nucleotides from the 3' end of the coding sequence, leaving the first 1 13 nucleotides of the FRA2 coding sequence intact.
- An in-frame stop codon was present 7 nucleotides downstream of the deletion.
- the four fragments for the PCR cassette for the scarless FRA2 deletion were amplified using Phusion High Fidelity PCR Master Mix (New England BioLabs; Ipswich, MA) and CEN.PK 1 13-7D genomic DNA as template, prepared with a Gentra
- FRA2 Fragment A was amplified with primer oBP594 (SEQ ID NO. 183) and primer oBP595 (SEQ ID NO: 184), containing a 5' tail with homology to the 5' end of FRA2 Fragment B.
- FRA2 Fragment B was amplified with primer oBP596 (SEQ ID NO: 185), containing a 5' tail with homology to the 3' end of FRA2 Fragment A, and primer oBP597 (SEQ ID NO: 186), containing a 5' tail with homology to the 5' end of FRA2 Fragment U.
- FRA2 Fragment U was amplified with primer oBP598 (SEQ ID NO: 187), containing a 5' tail with homology to the 3' end of FRA2 Fragment B, and primer oBP599 (SEQ ID NO: 18 ' 8), containing a 5' tail with homology to the 5' end of FRA2
- FRA2 Fragment C was amplified with primer 0BP6OO (SEQ ID NO: 189), containing a 5' tail with homology to the 3' end of FRA2 Fragment U, and primer 0BP6OI (SEQ ID NO: 190). PCR products were purified with a PCR Purification kit (Qiagen). FRA2 Fragment AB was created by overlapping PCR by mixing FRA2 Fragment A and FRA2 Fragment B and amplifying with primers oBP594 (SEQ ID NO: 183) and OBP597 (SEQ ID NO: 186).
- FRA2 Fragment UC was created by overlapping PCR by mixing FRA2 Fragment U and FRA2 Fragment C and amplifying with primers oBP598 (SEQ ID NO: 187) and 0BP6OI (SEQ ID NO: 190). The resulting PCR products were purified on an agarose gel followed by a Gel Extraction kit (Qiagen).
- the FRA2 ABUC cassette was created by overlapping PCR by mixing FRA2 Fragment AB and FRA2 Fragment UC and amplifying with primers oBP594 (SEQ ID NO:183 and 0BP6OI (SEQ ID NO:190). The PCR product was purified with a PCR Purification kit (Qiagen).
- Competent cells of PNY1503 were made and transformed with the FRA2 ABUC PCR cassette using a Frozen-EZ Yeast Transformation II kit (Zymo Research; Orange, CA). Transformation mixtures were plated on synthetic complete media lacking uracil supplemented with 1 % ethanol at 30 °C. Transformants with a fra2 knockout were screened for by PCR with primers oBP602 (SEQ ID NO: 191) and oBP603 (SEQ ID NO: 192) using genomic DNA prepared with a Gentra Puregene Yeast/Bact kit (Qiagen).
- a correct transformant was grown in YPE (yeast extract, peptone, 1 % ethanol) and plated on synthetic complete medium containing 5-fluoro- orotic acid (0.1 %) at 30 °C to select for isolates that lost the URA3 marker.
- the deletion and marker removal were confirmed by PCR with primers oBP602 (SEQ ID NO:191) and oBP603 (SEQ ID NO:192) using genomic DNA prepared with a Gentra Puregene Yeast Bact kit (Qiagen).
- the absence of the FRA2 gene from the isolate was demonstrated by a negative PCR result using primers specific for the deleted coding sequence of FRA2, oBP605 (SEQ ID NO: 193) and 0BP6O6 (SEQ ID NO: 194).
- the correct isolate was selected as strain CEN.PK 1 13-7D MATa ura3A::loxP his3A pdc6A pdc1A::P[PDC1]-DHAD
- This strain was transformed with isobutanol pathway plasmids (pYZ090, SEQ ID NO. 195) and pLH468 (SEQ ID NO. 139), and one clone was designated BP1 168 (PNY1506).
- pYZ090 (SEQ ID NO: 195) was constructed to contain a chimeric gene having the coding region of the alsS gene from Bacillus subtilis (nt position 457-2172) expressed from the yeast CUP1 promoter (nt 2-449) and followed by the CYC1 terminator (nt 2181-2430) for expression of ALS, and a chimeric gene having the coding region of the ilvC gene from Lactococcus lactis (nt 3634-4656) expressed from the yeast ILV5 promoter (2433-3626) and followed by the ILV5 terminator (nt 4682-5304) for expression of KARI.
- the ADH1 gene was deleted and replaced with the kivD coding region from Lactococcus lactis codon optimized for expression in
- Saccharomyces cerevisiae The scarless cassette for the ADH1 deletion- kivD_LI(y) integration was first cloned into plasmid pUC19-URA3MCS, as described in U.S. Appln. No. 61/356379, filed June 18, 2010, incorporated herein by reference.
- the vector is pUC19 based and contains the sequence of the URA3 gene from Saccharomyces cerevisiae CEN.PK 1 13-7D situated within a multiple cloning site (MCS).
- pUC19 contains the pMB1 replicon and a gene coding for beta-lactamase for replication and selection in Escherichia coli.
- the sequences from upstream (250 bp) and downstream (150 bp) of this gene are present for expression of the URA3 gene in yeast.
- the vector can be used for cloning purposes and can be used as a yeast integration vector.
- the kivD coding region from Lactococcus lactis codon optimized for expression in Saccharomyces cerevisiae was amplified using pLH468 (SEQ ID NO: 139) as template with primer oBP562 (SEQ ID NO: 197), containing a Pmel restriction site, and primer oBP563 (SEQ ID NO: 198), containing a 5' tail with homology to the 5' end of ADH1 Fragment B.
- ADH1 Fragment B was amplified from genomic DNA prepared as above with primer oBP564 (SEQ ID NO: 199), containing a 5' tail with homology to the 3' end of kivD_LI(y), and primer oBP565 (SEQ ID NO:200), containing a Fsel restriction site. PCR products were purified with a PCR Purification kit (Qiagen). kivD_LI(y)-ADH1 Fragment B was created by overlapping PCR by mixing the kivDJJ(y) and ADH1 Fragment B PCR products and amplifying with primers oBP562 (SEQ ID NO: 197) and OBP565 (SEQ ID NO:200).
- ADH1 Fragment A was amplified from genomic DNA with primer oBP505 (SEQ ID NO:201 ), containing a SacI restriction site, and primer oBP506 (SEQ ID NO:202), containing an Ascl restriction site.
- the ADH1 Fragment A PCR product was digested with SacI and Ascl and ligated with T4 DNA ligase into the corresponding sites of the plasmid containing kivD_LI(y)-ADH1 Fragment B.
- ADH1 Fragment C was amplified from genomic DNA with primer oBP507 (SEQ ID NO:203), containing a Pad restriction site, and primer oBP508 (SEQ ID NO:204), containing a Sail restriction site.
- the ADH1 Fragment C PCR product was digested with Pad and Sail and ligated with T4 DNA ligase into the corresponding sites of the plasmid containing ADH1 Fragment A-kivD_LI(y)-ADH1 Fragment B.
- the hybrid promoter UAS(PGK1 )-P F BAI was amplified from vector pRS316-
- UAS(PGK1)-PFBAI-GUS (SEQ ID NO:209) with primer oBP674 (SEQ ID NO:205), containing an Ascl restriction site, and primer oBP675 (SEQ ID NO:206), containing a Pmel restriction site.
- the UAS(PGK1 )-P F BAI PCR product was digested with Ascl and Pmel and ligated with T4 DNA ligase into the corresponding sites of the plasmid containing kivD_LI(y)-ADH1 Fragments ABC.
- the entire integration cassette was amplified from the resulting plasmid with primers oBP505 (SEQ ID NO:201 ) and oBP508 (SEQ ID NO:204) and purified with a PCR Purification kit (Qiagen).
- Competent cells of PNY1505 were made and transformed with the ADH1 -kivD_LI(y) PCR cassette constructed above using a Frozen-EZ Yeast Transformation II kit (Zymo Research). Transformation mixtures were plated on synthetic complete media lacking uracil supplemented with 1 % ethanol at 30 °C. Transformants were grown in YPE (1 % ethanol) and plated on synthetic complete medium containing 5-fluoro-orotic acid (0.1 %) at 30 °C to select for isolates that lost the URA3 marker.
- kivD_LI(y) The deletion of ADH1 and integration of kivD_LI(y) were confirmed by PCR with external primers oBP495 (SEQ ID NO:207) and oBP496 (SEQ ID NO:208) and with kivD_LI(y) specific primer oBP562 (SEQ ID NO: 197) and external primer oBP496 (SEQ ID NO:208) using genomic DNA prepared with a Gentra Puregene Yeast/Bact kit (Qiagen).
- the correct isolate was selected as strain CEN.PK 1 13-7D MATa ura3A::loxP his3A pdc6A pdc1A::P[PDC1]-DHAD
- PNY1507 was transformed with isobutanol pathway plasmids pYZ090 (SEQ ID NO: 195) and pBP915 (SEQ ID NO: 182) and the resultant strain was named PNY1513.
- the pWS358-PGK1 p-GUS plasmid was generated by inserting a PGK1 p and beta-glucuronidase gene (GUS) DNA fragments into multiple cloning site of pWS358, which was derived from pRS423 vector
- pWS358-FBA1 p-GUS plasmid was digested with Sail and Sacl, a DNA fragment containing a FBA1 p promoter, GUS gene, and FBAt terminator gel-purified, and cloned into Sall/Sacl sites on pRS316 to create pRS316- FBA1 p-GUS.
- the PCR product was digested with Kpnl and Sail and cloned into Kpnl/Sall sites on pRS316-FBA1 p-GUS to create pRS316- UAS(PGK1)-FBA1 p-GUS.
- the purpose of this example is to describe methods to modify a yeast host strain for improved production of isobutanol.
- modifications include integration of genes encoding isobutyraldehyde reductase activity and elimination of the native genes ALD6 and
- Y R226c encoding NADP+-dependent acetaldehyde dehydrogenase and a NADPH-dependent dehydrogenase, respectively.
- S. cerevisiae Strain PNY221 1 was constructed in several steps from S. cerevisiae strain PNY1507 (Example 8) as described in the following paragraphs.
- First PNY1507 was modified to contain a phosophoketolase gene.
- an acetolactate synthase gene (a/sS) was added to the strain, using an integration vector targeted to sequences adjacent to the phosphokeloase gene.
- the resulting genotype of PNY221 1 is MATa ura3A::loxP his3A pdc6A pdd ⁇ : : P[PDC 1 ]-DHAD
- adh1A :UAS(PGK1)P[FBA1]-kivD_LI(y)-ADH1t.
- a phosphoketolase gene cassette was introduced into PNY1507 by homologous recombination.
- the integration construct was generated as follows.
- the plasmid pRS423::CUP1-alsS+FBA-budA (previously described in US2009/0305363, which is herein incorporated by reference in its entirety) was digested with A/oil and Xma ⁇ to remove the 1.8 kb FBA- budA sequence, and the vector was religated after treatment with Klenow fragment.
- the CUP1 promoter was replaced with a TEF1 promoter variant (M4 variant previously described by Nevoigt et al. Appl. Environ. Microbiol.
- pRS423::TEF(M4)-alsS was cut with Stu ⁇ and Mlu ⁇ (removes 1.6 kb portion containing part of the alsS gene and CYC1 terminator), combined with the 4 kb PCR product generated from pRS426::GPD-xpk1 +ADH-eutD ( SEQ ID NO:383) with primers N1176 (SEQ ID NO:282) and N1 177 (SEQ ID NO:283) and an 0.8 kb PCR product DNA (SEQ ID NO: 284) generated from yeast genomic DNA (EN01 promoter region) with primers N822 (SEQ ID NO:285) and N1 178 (SEQ ID NO:286) and transformed into S.
- TEF(M4)-xpk1 The 3.1 kb TEF(M4)-xpk1 gene was isolated by digestion with Sacl and Not ⁇ and cloned into the pUC19-URA3::ilvD-TRX1 vector (Clone A, cut with AflW). Cloning fragments were treated with Klenow fragment to generate blunt ends for ligation. Ligation reactions were transformed into E. coli Stbl3 cells, selecting for ampicillin resistance. Insertion of TEF(M4)-xpk1 was confirmed by PCR (primers N1 1 10 (SEQ ID NO:367) and N1 1 14 (SEQ ID NO:290)). The vector was linearized with AflW and treated with Klenow fragment.
- the 1.8 kb Kpnl-Hincll geneticin resistance cassette (SEQ ID NO: 384) was cloned by ligation after Klenow fragment treatment. Ligation reactions were transformed into E. coli Stbl3 cells, selecting for ampicillin resistance. Insertion of the geneticin cassette was confirmed by PCR (primers N160SeqF5 (SEQ ID NO:210) and BK468 (SEQ ID NO:368)). The plasmid sequence is provided as SEQ ID NO. 291 (pUC19-URA3::pdct::TEF(M4)-xpk1 ::kan).
- the resulting integration cassette (pdc1 ::TEF(M4)- xpk1 ::KanMX::TRX1 ) was isolated ⁇ Asc ⁇ and Nae ⁇ digestion generated a 5.3 kb band that was gel purified) and transformed into PNY1507 using the Zymo Research Frozen-EZ Yeast Transformation Kit (Cat. No. T2001 ). Transformants were selected by plating on YPE plus 50 g/ml G418.
- PNY2218 was treated with Cre recombinase and the resulting clones were screened for loss of the xpkl gene and pUC19 integration vector sequences by PCR (primers N886 (SEQ ID NO: 211) and
- N160SeqR5 (SEQ ID NO: 388)). This left only the alsS gene integrated in the pdc1-TRX1 intergenic region after recombination the DNA upstream of xpkl and the homologous DNA introduced during insertion of the integration vector (a "scarless" insertion since vector, marker gene and loxP sequences are lost). Although this recombination could have occurred at any point, the vector integration appeared to be stable even without geneticin selection and the recombination event was only observed after introduction of the Cre recombinase. One clone was designated PNY221 1.
- PNY2218 An isolate of PNY2218 containing the plasmids pYZ090AalsS and pBP915 was designated PNY2209.
- PNY1528 hADH integrations in PNY2211
- Deletions/integrations were created by homologous recombination with PCR products containing regions of homology upstream and downstream of the target region and the URA3 gene for selection of transformants.
- the URA3 gene was removed by homologous
- the YPRCA15 locus was deleted and replaced with the horse liver adh gene, codon optimized for expression in Saccharomyces cerevisiae, along with the PDC5 promoter region (538 bp) from Saccharomyces cerevisiae and the ADH1 terminator region (316 bp) from Saccharomyces cerevisiae.
- the scarless cassette for the YPRCA15 deletion- P[PDC5]- adh_HL(y)-ADH1t integration was first cloned into plasmid pUC19- URA3MCS (described in Example 8).
- Yeast Bact kit (Qiagen; Valencia, CA).
- YPRCA15 Fragment A was amplified from genomic DNA with primer oBP622 (SEQ ID NO: 212), containing a Kpnl restriction site, and primer oBP623 (SEQ ID NO: 213), containing a 5' tail with homology to the 5' end of YPRCA15 Fragment B.
- YPRCA15 Fragment B was amplified from genomic DNA with primer oBP624 (SEQ ID NO: 214), containing a 5' tail with homology to the 3' end of YPRCA15 Fragment A, and primer oBP625 (SEQ ID NO: 215), containing a Fsel restriction site.
- PCR products were purified with a PCR Purification kit (Qiagen).
- YPRCA15 Fragment A - YPRCA15 Fragment B was created by overlapping PCR by mixing the YPRCA15 Fragment A and YPRCA15 Fragment B PCR products and amplifying with primers oBP622 (SEQ ID NO: 212) and oBP625 (SEQ ID NO: 215).
- the resulting PCR product was digested with Kpnl and Fsel and ligated with T4 DNA ligase into the corresponding sites of pUC19-URA3MCS after digestion with the appropriate enzymes.
- YPRCA15 Fragment C was amplified from genomic DNA with primer oBP626 (SEQ ID NO: 216), containing a Notl restriction site, and primer oBP627 (SEQ ID NO: 217), containing a Pad restriction site.
- the YPRCA15 Fragment C PCR product was digested with Notl and Pad and ligated with T4 DNA ligase into the corresponding sites of the plasmid containing YPRCA15 Fragments AB.
- the PDC5 promoter region was amplified from CEN.PK 113-7D genomic DNA with primer HY21 (SEQ ID NO: 218), containing an AscI restriction site, and primer HY24 (SEQ ID NO: 219), containing a 5' tail with homology to the 5' end of adh_HI(y).
- adh_HI(y)-ADH1t was amplified from pBP915 (SEQ ID NO: 182) with primers HY25 (SEQ ID NO: 220), containing a 5' tail with homology to the 3' end of P[PDC5], and HY4 (SEQ ID NO: 221), containing a Pmel restriction site.
- PCR products were purified with a PCR Purification kit
- P[PDC5]-adh_HL(y)-ADH1t was created by overlapping PCR by mixing the P[PDC5] and adh_HL(y)-ADH1t PCR products and amplifying with primers HY21 (SEQ ID NO: 218) and HY4 (SEQ ID NO: 221). The resulting PCR product was digested with AscI and Pmel and ligated with T4 DNA ligase into the corresponding sites of the plasmid containing
- YPRCA15 Fragments ABC The entire integration cassette was amplified from the resulting plasmid with primers oBP622 (SEQ ID NO: 212) and ⁇ 627 (SEQ ID NO: 217).
- Competent cells of PNY221 1 were made and transformed with the YPRCA 15 deletion- P[PDC5]-adh_HL(y)-ADH1t integration cassette PCR product using a Frozen-EZ Yeast Transformation II kit (Zymo Research; Orange, CA). Transformation mixtures were plated on synthetic complete media lacking uracil supplemented with 1 % ethanol at 30 °C.
- Transformants were screened for by PCR with primers URA3-end F (SEQ ID NO: 222) and oBP637 (SEQ ID NO: 224). Correct transformants were grown in YPE (1 % ethanol) and plated on synthetic complete medium supplemented with 1 % EtOH and containing 5-fluoro-orotic acid (0.1 %) at 30 C to select for isolates that lost the URA3 marker. The deletion of YPRCA 15 and integration of P[PDC5]-adh_HL(y)-ADH1t were confirmed by PCR with external primers oBP636 (SEQ ID NO: 223) and oBP637
- the horse liver adh gene codon optimized for expression in Saccharomyces cerevisiae, along with the PDC1 promoter region (870 bp) from Saccharomyces cerevisiae and the ADH1 terminator region (316 bp) from Saccharomyces cerevisiae, was integrated into the site of the fra2 deletion.
- the scarless cassette for the fra2A- P[PDC1]-adh_HL(y)-ADH1t integration was first cloned into plasmid pUC19-URA3MCS.
- fra2A Fragment C was amplified from genomic DNA with primer oBP695 (SEQ ID NO: 229), containing a Notl restriction site, and primer oBP696 (SEQ ID NO: 230), containing a Pad restriction site.
- the fra2A Fragment C PCR product was digested with Notl and Pad and ligated with T4 DNA ligase into the corresponding sites of pUC19-URA3MCS.
- fra2A Fragment B was amplified from genomic DNA with primer oBP693 (SEQ ID NO: 227), containing a Pmel restriction site, and primer oBP694 (SEQ ID NO: 228), containing a Fsel restriction site.
- the resulting PCR product was digested with Pmel and Fsel and ligated with T4 DNA ligase into the corresponding sites of the plasmid containing fra2A fragment C after digestion with the appropriate enzymes.
- fra2A Fragment A was amplified from genomic DNA with primer oBP691 (SEQ ID NO: 225), containing BamHI and AsiSI restriction sites, and primer oBP692 (SEQ ID NO: 226), containing Ascl and Swal restriction sites.
- the fra2A fragment A PCR product was digested with BamHI and Ascl and ligated with T4 DNA ligase into the corresponding sites of the plasmid containing fra2A fragments BC after digestion with the appropriate enzymes.
- the PDC1 promoter region was amplified from CEN.PK 113-7D genomic DNA with primer HY16 (SEQ ID NO. 231), containing an AscI restriction site, and primer HY19 (SEQ ID NO: 232), containing a 5' tail with homology to the 5' end of adh_HI(y).
- adh_HI(y)-ADH1t was amplified from pBP915 with primers HY20 (SEQ ID NO: 233), containing a 5' tail with homology to the 3" end of P[PDC1], and HY4 (SEQ ID NO: 221), containing a Pmel restriction site. PCR products were purified with a PCR Purification kit (Qiagen). P[PDC1]-adh_HL(y)-ADH1t was created by overlapping PCR by mixing the P[PDC1] and adh_HL(y)-ADH1t PCR products and amplifying with primers HY16 (SEQ ID NO: 231 ) and HY4 (SEQ ID NO: 221 ).
- the resulting PCR product was digested with AscI and Pmel and ligated with T4 DNA ligase into the corresponding sites of the plasmid containing fra2A Fragments ABC.
- the entire integration cassette was amplified from the resulting plasmid with primers oBP691 (SEQ ID NO: 225) and ⁇ 696 (SEQ ID NO: 230).
- Competent cells of the PNY221 1 variant with adh_HI(y) integrated at YPRCA15vjere made and transformed with the fra2A- P[PDC1]- adh_HL(y)-ADH1t integration cassette PCR product using a Frozen-EZ Yeast Transformation II kit (Zymo Research). Transformation mixtures were plated on synthetic complete media lacking uracil supplemented with 1 % ethanol at 30 °C. Transformants were screened for by PCR with primers URA3-end F (SEQ ID NO: 222) and oBP731 (SEQ ID NO: 235).
- the gene YMR226c was deleted from S. cerevisiae strain
- the cassette was constructed from spliced PCR amplified fragments comprised of the URA3 gene, along with its native promoter and terminator as a selectable marker, upstream and downstream homology sequences flanking the YMR226c gene chromosomal locus to promote integration of the deletion cassette and removal of the native intervening sequence and a repeat sequence to promote recombination and removal of the URA3 marker.
- Forward and reverse PCR primers (N1251 and N1252, SEQ ID NOs: 247 and 248, respectively), amplified a 1 ,208 bp URA3 expression cassette originating from pL_A33 (pUC19::loxP-URA3-loxP (SEQ ID NO: 268)).
- Forward and reverse primers (N1253 and N1254, SEQ ID NOs: 249 and 250, respectively), amplified a 250 bp downstream homology sequence with a 3' URA3 overlap sequence tag from a genomic DNA preparation of S. cerevisiae strain PNY221 1 (above).
- Forward and reverse PCR primers (N1255 and N1256, SEQ ID NOs: 251 and 252, respectively) amplified a 250 bp repeat sequence with a 5' URA3 overlap sequence,tag from a genomic DNA preparation of S. cerevisiae strain PNY221 1.
- Forward and reverse PCR primers (N1257 and N1258, SEQ ID NOs: 253 and 254, respectively) amplified a 250 bp upstream homology sequence with a 5' repeat overlap sequence tag from a genomic DNA preparation of S. cerevisiae strain PNY221 1.
- PCR amplified cassette was transformed into strain PNY1528 (above) made competent using the ZYMO Research Frozen Yeast Transformation Kit and the transformation mix plated on SE 1.0% -uracil and incubated at 30°C for selection of cells with an integrated ymr226cA:.URA3 cassette. Transformants appearing after 72 to 96 hours are subsequently short-streaked on the same medium and incubated at 30°C for 24 to 48 hours.
- the short-streaks are screened for ymr226cA::URA3 by PCR, with a 5' outward facing URA3 deletion cassette-specific internal primer (N1249, SEQ ID NO: 245) paired with a flanking inward facing chromosome-specific primer (N1239, SEQ ID NO: 243) and a 3' outward-facing URA3 deletion cassette-specific primer (N1250, SEQ ID NO: 246) paired with a flanking inward-facing
- chromosome-specific primer N1242, SEQ ID NO: 244.
- N1242, SEQ ID NO: 244 A positive PNY1528 ymr226cA::URA3 PCR screen resulted in 5' and 3' PCR products of 598 and 726 bp, respectively.
- PNY1528 ymr226cA::URA3 clones were picked and cultured overnight in a YPE 1 % medium of which 10 ⁇ _ was plated on YPE 1 % + 5-FOA for marker removal. Colonies appearing after 24 to 48 hours were PCR screened for marker loss with 5' and 3' chromosome- specific primers (N1239 and N1242). A positive PNY1528 ymr226cA markerless PCR screen resulted in a PCR product of 801 bp. Multiple clones were obtained and one was designated PNY2237.
- a vector was designed to replace the ALD6 coding sequence with a Cre-lox recyclable URA3 selection marker. Sequences 5' and 3' of ALD6 were amplified by PCR (primer pairs N1 179 and N1 180 and N1 181 and
- the vector described above (pUC19::ald6A::loxP-URA3-loxP) was linearized with Ahd ⁇ and transformed into PNY1528 and PNY2237 using the standard lithium acetate method (except that incubation of cells with DNA was extended to 2.5h). Transformants were obtained by plating on synthetic complete medium minus uracil that provided 1 % ethanol as the carbon source. Patched transformants were screened by PCR to confirm the deletion/integration, using primers N1212 (SEQ ID NO: 241) and N1 180 (5' end) (SEQ ID NO: 238) and N1 181 (SEQ ID NO: 239) and N1213 (SEQ ID NO: 242) (3' end).
- ald6A: :loxP clones were screened by PCR to confirm that a translocation between ura3A::loxP (N1228 and N1229, SEQ ID NOs: 259 and 260) and gpd2A:: ⁇ oxP (N1223 and N1225, SEQ ID NOs: 257 and 258) had not occurred.
- Two positive clones were identified from screening of transformants of PNY1528. Clone B has been designated PNY2243.
- Three positive clones were identified from screening transformants of PNY2237. Clones E and K were both assessed for isobutanol production at small scale (below). Although statistically identical in most parameters, Clone E was selected (PNY2238) for further development.
- the purpose of this example is to describe construction or modification of isobutanol pathway plasmids for production of isobutanol in host strains.
- pYZ067 (SEQ ID NO:374) was constructed to contain the following chimeric genes: 1 ) the coding region of the ilvD gene from S. mutans UA159 with a C-terminal Lumio tag expressed from the yeast FBA1 promoter followed by the FBA1 terminator for expression of dihydroxy acid dehydratase, 2) the coding region for horse liver ADH expressed from the yeast GPM1 promoter followed by the ADH1 terminator for expression of alcohol dehydrogenase, and 3) the coding region of the KivD gene from Lactococcus lactis expressed from the yeast TDH3 promoter followed by the TDH3 terminator for expression of ketoisovalerate decarboxylase.
- pYZ067AkivDAhADH (SEQ ID NO: 385) was constructed from pYZ067 (SEQ ID NO: 374) by deleting the promoter-gene-terminator cassettes for both kivD and adh.
- pYZ067 was digested with BamHI and Sacl (New England BioLabs; Ipswich, MA), and the 7934 bp fragment was purified on an agarose gel followed by a Gel Extraction kit (Qiagen;
- pYZ067AkivDAilvD (SEQ ID NO: 772) was constructed to contain a chimeric gene having the coding region of the adh gene from horse liver (nt position 3148-2021 ), codon optimized for expression in
- pYZ067DkivDDilvD was constructed from pYZ067 by deleting the promoter-gene-terminator cassettes for both kivD and ilvD.
- pYZ067 was digested with Aatll and Sacl (New England BioLabs; Ipswich, MA) and the 10196 bp fragment was purified on an agarose gel followed by a Gel Extraction kit (Qiagen; Valencia, CA).
- the isolated fragment of DNA was treated with DNA Polymerase I, Large (Klenow) Fragment (New England BioLabs; Ipswich, MA) and then self-ligated with T4 DNA ligase.
- the resulting plasmid was then digested with NgoMIV and BamHI (New England BioLabs; Ipswich, MA) and the 7533 bp fragment was purified on an agarose gel followed by a Gel Extraction kit (Qiagen; Valencia, CA).
- the isolated fragment of DNA was treated with DNA Polymerase I, Large (Klenow) Fragment (New England BioLabs; Ipswich, MA) and then self- ligated with T4 DNA ligase. Plasmids were isolated and checked for the proper deletions by sequence analysis. A correct plasmid isolate was designated pYZ067DkivDDilvD.
- pK9G9.OLE1 p.ilvD (SEQ ID NO: 773), derived from pYZ090 (SEQ ID NO: 195), was constructed to contain a chimeric gene having the coding region of the ilvD gene from Streptococcus mutans (nt position 5377-3641) expressed from the yeast OLE1 promoter (nt 5986-5387) and followed by the FBA1 terminator (nt 3632-3320) for expression of DHAD, and a chimeric gene having the coding region of the variant K9G9 of the ilvC gene from Anaerostipes caccae (nucleic acid and amino acid SEQ ID NOs: 774 and 647) (nt 1628-2659) expressed from the yeast ILV5 promoter (nt 427-1620) and followed by the ILV5 terminator (nt 2685-
- Plasmid plasmid pYZ067 having the coding region of the ilvD gene from Streptococcus mutans expressed from the yeast FBA1 promoter and followed by the FBA1 terminator was ligated into pYZ090 after digestion with restriction enzymes NgoMIV and BamHI.
- the alsS coding region and 280 bp from the 3" end of the CUP1 promoter was deleted from the resulting plasmid by digesting with the restriction enzymes Spel and Pad and self-ligating the resulting large DNA fragment.
- the yeast FBA1 promoter upstream of ilvD was removed from the resulting plasmid by digesting with the restriction enzymes NgoMIV and Pmll and was replaced with the yeast OLE1 promoter amplified with primers pOLE1-NgoMI (SEQ ID NO: 775) and pOLE1-Pmll (SEQ ID NO. 776).
- the coding region of the ilvC gene from Lactococcus lactis was deleted from the resulting plasmid by digestion with restriction enzymes Pmel and Sfil followed by gel purification of the large DNA fragment.
- the coding region of the variant K9G9 ilvC gene (SEQ ID NO: 777) from Anaerostipes caccae was digested out of pLH701 (SEQ ID NO: 778) with Pmel and Sfil and gel purified. The two DNA fragments were ligated to generate pK9G9.OLE1 p.ilvD.
- Strain PNY2240 was derived from PNY2211 after transformation with plasmids pLH702 (SEQ ID NO: 181) and pBP915 (SEQ ID NO: 182). Transformants were plated on synthetic complete medium without histidine or uracil (1% ethanol as carbon source). Transformants were patched to the same medium containing, instead, 2% glucose and 0.05% ethanol as carbon sources. Three patches were used to inoculate liquid medium (synthetic complete minus uracil with 0.3% glucose and 0.3% ethanol as carbon sources).
- Strain PNY2242 was derived from PNY2238 after transformation with plasmids pLH702 (SEQ ID NO: 181) and pYZ067AkivDAhADH (described herein above). Transformants were plated on synthetic complete medium without histidine or uracil (1% ethanol as carbon source). Transformants were patched to the same medium containing, instead, 2% glucose and 0.05% ethanol as carbon sources. Three patches were tested for isobutanol production, as described above. All three performed similarly in terms of glucose consumption and isobutanol production. One clone was designated PNY2242 and was further characterized under fermentation conditions, as described herein below. Example 12
- the strain BP1064 was derived from CEN.PK 113-7D (CBS 8340;
- Centraalbureau voor Schimmelcultures (CBS) Fungal Biodiversity Centre, Netherlands) and contains deletions of the following genes: URA3, HIS3, PDC1 , PDC5, PDC6, and GPD2.
- BP1064 was transformed with plasmids pYZ090 (SEQ ID NO: 195) and pLH468 (SEQ ID NO: 139) to create strain NGCI-070 (BP1083; PNY1504).
- Deletions which completely removed the entire coding sequence, were created by homologous recombination with PCR fragments containing regions of homology upstream and downstream of the target gene and either a G418 resistance marker or URA3 gene for selection of transformants.
- the G418 resistance marker flanked by loxP sites, was removed using Cre recombinase (pRS423::PGAL1-cre; SEQ ID NO. 271).
- the URA3 gene was removed by homologous recombination to create a scarless deletion, or if flanked by loxP sites was removed using Cre recombinase.
- a ura3::loxP- kanMX-loxP cassette was PCR-amplified from pl_A54 template DNA (SEQ ID NO:386).
- pLA54 contains the K. lactis TEF1 promoter and kanMX marker, and is flanked by loxP sites to allow recombination with Cre recombinase and removal of the marker.
- PCR was done using Phusion DNA polymerase and primers BK505 and BK506 (SEQ ID NOs:294 and 295).
- each primer was derived from the 5' region upstream of the URA3 promoter and 3' region downstream of the coding region such that integration of the loxP-kanMX-loxP marker resulted in replacement of the URA3 coding region.
- the PCR product was transformed into CEN.PK 113-7D using standard genetic techniques (Methods in Yeast Genetics, 2005, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 201-202) and transformants were selected on YPD containing G418 (100 pg/ml) at 30 °C. Transformants were screened to verify correct integration by PCR using primers LA468 and LA492 (SEQ ID NOs:296 and 297) and designated CEN.PK 113-7D Aura3::kanMX. HIS3 Deletion
- the four fragments for the PCR cassette for the scarless HIS3 deletion were amplified using Phusion High Fidelity PCR Master Mix (New England BioLabs; Ipswich, MA) and CEN.PK 113-7D genomic DNA as template, prepared with a Gentra Puregene Yeast/Bact kit (Qiagen;
- HIS3 Fragment A was amplified with primer oBP452 (SEQ ID NO:298) and primer oBP453 (SEQ ID NO:299), containing a 5' tail with homology to the 5' end of HIS3 Fragment B.
- HIS3 Fragment B was amplified with primer oBP454 (SEQ ID NO:300), containing a 5 * tail with homology to the 3' end of HIS3 Fragment A, and primer oBP455 (SEQ ID NO:301 ), containing a 5' tail with homology to the 5' end of HIS3 Fragment U.
- HIS3 Fragment U was amplified with primer oBP456 (SEQ ID NO:302), containing a 5' tail with homology to the 3' end of HIS3 Fragment B, and primer oBP457 (SEQ ID NO:303), containing a 5' tail with homology to the 5' end of HIS3 Fragment C.
- HIS3 Fragment C was amplified with primer oBP458 (SEQ ID NO:304), containing a 5' tail with homology to the 3' end of HIS3 Fragment U, and primer oBP459 (SEQ ID NO:305).
- PCR products were purified with a PCR Purification kit (Qiagen).
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- General Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Mycology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Virology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
Description
Claims
Priority Applications (10)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA2831130A CA2831130C (en) | 2011-03-24 | 2012-03-23 | Host cells and methods for production of isobutanol |
| MX2013010823A MX347976B (en) | 2011-03-24 | 2012-03-23 | Host cells and methods for production of isobutanol. |
| JP2014501294A JP6099623B2 (en) | 2011-03-24 | 2012-03-23 | Host cells and methods for isobutanol production |
| AU2012230737A AU2012230737B2 (en) | 2011-03-24 | 2012-03-23 | Host cells and methods for production of isobutanol |
| EP12760879.2A EP2689014B1 (en) | 2011-03-24 | 2012-03-23 | Host cells and methods for production of isobutanol |
| CN201280024903.2A CN103827304B (en) | 2011-03-24 | 2012-03-23 | Host cell and method for isobutanol production |
| KR1020137027906A KR20140092759A (en) | 2011-03-24 | 2012-03-23 | Host cells and methods for production of isobutanol |
| BR112013024328-7A BR112013024328A2 (en) | 2011-03-24 | 2012-03-23 | Recombinant host cells, methods for producing isobutanol, composition, methods for producing a recombinant host cell, to reduce the conversion of isobutiraldehyde, polypeptides, polynucleqtide, paraconverter acetolactate method, recombinant yeasts, methods for producing butanol, to increase the activity and KARL ENZYME PRODUCTIVITY |
| ZA2013/06708A ZA201306708B (en) | 2011-03-24 | 2013-09-06 | Host cells and methods for production of isobutanol |
| AU2017200439A AU2017200439A1 (en) | 2011-03-24 | 2017-01-20 | Host cells and methods for production of isobutanol |
Applications Claiming Priority (16)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201161467249P | 2011-03-24 | 2011-03-24 | |
| US201161467271P | 2011-03-24 | 2011-03-24 | |
| US201161467261P | 2011-03-24 | 2011-03-24 | |
| US61/467,271 | 2011-03-24 | ||
| US61/467,261 | 2011-03-24 | ||
| US61/467,249 | 2011-03-24 | ||
| US201161472487P | 2011-04-06 | 2011-04-06 | |
| US201161472474P | 2011-04-06 | 2011-04-06 | |
| US201161472484P | 2011-04-06 | 2011-04-06 | |
| US201161472497P | 2011-04-06 | 2011-04-06 | |
| US61/472,487 | 2011-04-06 | ||
| US61/472,484 | 2011-04-06 | ||
| US61/472,474 | 2011-04-06 | ||
| US61/472,497 | 2011-04-06 | ||
| US201161570513P | 2011-12-14 | 2011-12-14 | |
| US61/570,513 | 2011-12-14 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2012129555A2 true WO2012129555A2 (en) | 2012-09-27 |
| WO2012129555A3 WO2012129555A3 (en) | 2013-02-28 |
Family
ID=46880082
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2012/030479 Ceased WO2012129555A2 (en) | 2011-03-24 | 2012-03-23 | Host cells and methods for production of isobutanol |
Country Status (13)
| Country | Link |
|---|---|
| US (4) | US9790521B2 (en) |
| EP (1) | EP2689014B1 (en) |
| JP (1) | JP6099623B2 (en) |
| KR (1) | KR20140092759A (en) |
| CN (1) | CN103827304B (en) |
| AR (1) | AR088778A1 (en) |
| AU (2) | AU2012230737B2 (en) |
| BR (1) | BR112013024328A2 (en) |
| CA (1) | CA2831130C (en) |
| HU (1) | HUE045191T2 (en) |
| MX (1) | MX347976B (en) |
| WO (1) | WO2012129555A2 (en) |
| ZA (1) | ZA201306708B (en) |
Cited By (19)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013102147A2 (en) | 2011-12-30 | 2013-07-04 | Butamax (Tm) Advanced Biofuels Llc | Genetic switches for butanol production |
| WO2014052670A1 (en) * | 2012-09-26 | 2014-04-03 | Butamax (Tm) Advanced Biofuels Llc | Polypeptides with ketol-acid reductoisomerase activity |
| US20140093931A1 (en) * | 2012-09-28 | 2014-04-03 | Butamax Advanced Biofuels Llc | Production of fermentation products |
| WO2014106107A2 (en) | 2012-12-28 | 2014-07-03 | Butamax (Tm) Advanced Biofuels Llc | Dhad variants for butanol production |
| WO2014144728A1 (en) | 2013-03-15 | 2014-09-18 | Butamax Advanced Biofuels Llc | Method for production of butanol using extractive fermentation |
| WO2014144210A2 (en) | 2013-03-15 | 2014-09-18 | Butamax Advanced Biofuels Llc | Competitive growth and/or production advantage for butanologen microorganism |
| WO2014144643A1 (en) | 2013-03-15 | 2014-09-18 | Butamax Advanced Biofuels Llc | Method for producing butanol using extractive fermentation |
| WO2014151645A1 (en) | 2013-03-15 | 2014-09-25 | Butamax Advanced Biofuels Llc | Process for maximizing biomass growth and butanol yield by feedback control |
| WO2014151190A1 (en) | 2013-03-15 | 2014-09-25 | Butamax Advanced Biofuels Llc | Dhad variants and methods of screening |
| WO2014160050A1 (en) | 2013-03-14 | 2014-10-02 | Butamax Advanced Biofuels Llc | Glycerol 3- phosphate dehydrogenase for butanol production |
| WO2014157185A1 (en) * | 2013-03-28 | 2014-10-02 | 株式会社カネカ | Modified carbonyl reducing enzyme and gene |
| US9663759B2 (en) | 2013-07-03 | 2017-05-30 | Butamax Advanced Biofuels Llc | Partial adaptation for butanol production |
| US9689004B2 (en) | 2012-03-23 | 2017-06-27 | Butamax Advanced Biofuels Llc | Acetate supplemention of medium for butanologens |
| CN110982771A (en) * | 2019-12-26 | 2020-04-10 | 江南大学 | Method for synthesizing p-hydroxymandelic acid |
| US20200165463A1 (en) * | 2017-06-30 | 2020-05-28 | Dow Global Technologies Llc | Coating for aldehyde remediation and method of making |
| US10808262B2 (en) | 2013-12-03 | 2020-10-20 | Genomatica, Inc. | Microorganisms and methods for improving product yields on methanol using acetyl-CoA synthesis |
| EP2737073B1 (en) * | 2011-07-28 | 2021-10-20 | Butamax Advanced Biofuels LLC | Keto-isovalerate decarboxylase enzymes and methods of use thereof |
| EP4114917A4 (en) * | 2020-03-06 | 2024-08-21 | GEVO, Inc. | NEW NKR VARIANTS FOR INCREASED ISOBUTANOL PRODUCTION |
| US12398396B2 (en) | 2013-11-25 | 2025-08-26 | Genomatica, Inc. | Methods for enhancing microbial production of specific length fatty alcohols in the presence of methanol |
Families Citing this family (32)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8945899B2 (en) | 2007-12-20 | 2015-02-03 | Butamax Advanced Biofuels Llc | Ketol-acid reductoisomerase using NADH |
| WO2008130995A2 (en) | 2007-04-18 | 2008-10-30 | E. I. Du Pont De Nemours And Company | Fermentive production of isobutanol using highly active ketol-acid reductoisomerase enzymes |
| US8188250B2 (en) | 2008-04-28 | 2012-05-29 | Butamax(Tm) Advanced Biofuels Llc | Butanol dehydrogenase enzyme from the bacterium Achromobacter xylosoxidans |
| AU2009296224B2 (en) | 2008-09-29 | 2015-02-12 | Butamax(Tm) Advanced Biofuels Llc | Increased heterologous Fe-S enzyme actiivty in yeast |
| EP2519628A2 (en) | 2009-12-29 | 2012-11-07 | Butamax (TM) Advanced Biofuels LLC | Alcohol dehydrogenases (adh) useful for fermentive production of lower alkyl alcohols |
| EP2534240B1 (en) | 2010-02-12 | 2019-06-05 | GEVO, Inc. | Yeast microorganisms with reduced by-product accumulation for improved production of fuels, chemicals, and amino acids |
| KR20130027063A (en) | 2010-02-17 | 2013-03-14 | 부타맥스 어드밴스드 바이오퓨얼스 엘엘씨 | Improving activity of fe-s cluster requiring proteins |
| US8871488B2 (en) | 2010-06-18 | 2014-10-28 | Butamax Advanced Biofuels Llc | Recombinant host cells comprising phosphoketolases |
| CA2810244C (en) | 2010-09-07 | 2020-10-06 | Butamax(Tm) Advanced Biofuels Llc | Integration of a polynucleotide encoding a polypeptide that catalyzes pyruvate to acetolactate conversion |
| US9790521B2 (en) | 2011-03-24 | 2017-10-17 | Butamax Advanced Biofuels Llc | Host cells and methods for production of isobutanol |
| US20120258873A1 (en) * | 2011-04-06 | 2012-10-11 | Butamax(Tm) Advanced Biofuels Llc | Reduction of 2,3-dihydroxy-2-methyl butyrate (dhmb) in butanol production |
| JP2015503350A (en) | 2011-12-30 | 2015-02-02 | ビュータマックス・アドバンスド・バイオフューエルズ・エルエルシー | Alcoholic fermentation production |
| CA2873109A1 (en) | 2012-05-11 | 2013-11-28 | Butamax Advanced Biofuels Llc | Ketol-acid reductoisomerase enzymes and methods of use |
| CA2881407A1 (en) | 2012-08-22 | 2014-02-27 | Butamax Advanced Biofuels Llc | Production of fermentation products |
| US9840724B2 (en) | 2012-09-21 | 2017-12-12 | Butamax Advanced Biofuels Llc | Production of renewable hydrocarbon compositions |
| US9273330B2 (en) | 2012-10-03 | 2016-03-01 | Butamax Advanced Biofuels Llc | Butanol tolerance in microorganisms |
| US20140142352A1 (en) | 2012-11-20 | 2014-05-22 | Butamax Advanced Biofuels Llc | Butanol purification |
| US20160002131A1 (en) | 2013-02-21 | 2016-01-07 | Butamax Advanced Biofuels Llc | Vapor recompression |
| CN105722969A (en) | 2013-10-28 | 2016-06-29 | 丹尼斯科美国公司 | Large scale genetically engineered active dry yeast |
| US10280438B2 (en) | 2014-08-11 | 2019-05-07 | Butamax Advanced Biofuels Llc | Method for the production of yeast |
| KR101632642B1 (en) | 2015-01-29 | 2016-06-22 | 씨제이제일제당 주식회사 | Novel promoter and uses thereof |
| US20190276905A1 (en) | 2016-11-09 | 2019-09-12 | Danisco Us Inc. | Yeast with improved alcohol production |
| US10796788B2 (en) * | 2017-06-19 | 2020-10-06 | Academia Sinica | Structural determination of carbohydrates using special procedure and database of mass spectra |
| TWI760548B (en) * | 2018-08-16 | 2022-04-11 | 葡萄王生技股份有限公司 | Use of a composition comprising lactobacillus plantarum gkm3 for anti-aging |
| TWI718402B (en) * | 2018-08-16 | 2021-02-11 | 葡萄王生技股份有限公司 | An active substance of lactobacillus paracasei gks6, a composition comprising thereof and its use for promoting longevity |
| CN111378681B (en) * | 2018-12-27 | 2023-01-17 | 中国医学科学院药物研究所 | Recombinant bacteria producing dammarenediol-II glycoside and its application |
| CN111826405B (en) * | 2019-04-16 | 2022-09-27 | 中国科学院大连化学物理研究所 | Method for producing D-lactic acid by biologically catalyzing and reducing pyruvic acid |
| CN110951704B (en) * | 2019-12-28 | 2021-07-27 | 南京朗恩生物科技有限公司 | Alcohol dehydrogenase mutant with enhanced thermal stability and sequence thereof |
| CN110904061B (en) * | 2019-12-28 | 2021-05-18 | 南京朗恩生物科技有限公司 | A thermostability-enhanced alcohol dehydrogenase mutant and its application |
| KR102801647B1 (en) * | 2022-08-12 | 2025-04-30 | 씨제이제일제당 주식회사 | Ketol-acid reductoisomerase small subunit variant and a method for producing L-valine using the same |
| WO2025133860A1 (en) | 2023-12-21 | 2025-06-26 | Danstar Ferment Ag | Increased production of acetyl-phosphate and products derived therefrom in yeasts |
| WO2026069249A1 (en) | 2024-09-30 | 2026-04-02 | Danstar Ferment Ag | Increasing fermentation kinetics in a recombinant yeast |
Citations (32)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
| WO2000061722A1 (en) | 1999-04-13 | 2000-10-19 | Universiteit Van Amsterdam | Process for the production of yeast biomass comprising functionally deleted $i(hxk2) genes |
| US6586229B1 (en) | 2000-06-01 | 2003-07-01 | North Carolina State University | Method for the production of ρ-Hydroxybenzoate in species of pseudomonas and agrobacterium |
| US20050059136A1 (en) | 2003-05-02 | 2005-03-17 | A.E. Staley Manufacturing Co. | Pyruvate producing yeast strain |
| US20070031918A1 (en) | 2005-04-12 | 2007-02-08 | Dunson James B Jr | Treatment of biomass to obtain fermentable sugars |
| US20070031950A1 (en) | 1998-09-11 | 2007-02-08 | Winkler Aaron A | Production of D-lactic acid with yeast |
| US20070092957A1 (en) | 2005-10-26 | 2007-04-26 | Donaldson Gail K | Fermentive production of four carbon alcohols |
| US20070259410A1 (en) | 2006-05-02 | 2007-11-08 | Donaldson Gail K | Fermentive production of four carbon alcohols |
| US20080182308A1 (en) | 2005-09-29 | 2008-07-31 | Donaldson Gail K | Fermentive production of four carbon alcohols |
| US20080261230A1 (en) | 2007-04-18 | 2008-10-23 | Der-Ing Liao | Fermentive production of isobutanol using highly active ketol-acid reductoisomerase enzymes |
| US20090155870A1 (en) | 2006-05-02 | 2009-06-18 | Donaldson Gail K | Fermentive production of four carbon alcohols |
| US20090163376A1 (en) | 2007-12-20 | 2009-06-25 | E.I. Du Pont De Nemours And Company | Ketol-acid reductoisomerase using nadh |
| US20090269823A1 (en) | 2008-04-28 | 2009-10-29 | E.I. Du Pont De Nemours And Company | Butanol dehydrogenase enzyme from the bacterium achromobacter xylosoxidans |
| US20090305370A1 (en) | 2008-06-04 | 2009-12-10 | E.I. Du Pont De Nemours And Company | Method for producing butanol using two-phase extractive fermentation |
| US20090305363A1 (en) | 2008-06-05 | 2009-12-10 | E. I. Du Pont De Nemours And Company | Enhanced pyruvate to acetolactate conversion in yeast |
| US20100081173A1 (en) | 2007-01-15 | 2010-04-01 | Cj Cheiljedang Corporation | Microorganism Producing Inosine and Method of Producing Inosine Using the Same |
| US20100081154A1 (en) | 2008-09-29 | 2010-04-01 | Butamax(Tm) Advanced Biofuels Llc | IDENTIFICATION AND USE OF BACTERIAL [2Fe-2S] DIHYDROXY-ACID DEHYDRATASES |
| US20100120105A1 (en) | 2008-10-27 | 2010-05-13 | Butamax (Tm) Advanced Biofuels Llc | Carbon pathway optimized production hosts for the production of isobutanol |
| US20100129886A1 (en) | 2008-11-13 | 2010-05-27 | Butamax (Tm) Advanced Biofuels Llc | Production of isobutanol in yeast mitochondria |
| US20100143997A1 (en) | 2008-10-31 | 2010-06-10 | Thomas Buelter | Engineered microorganisms capable of producing target compounds under anaerobic conditions |
| US20100197519A1 (en) | 2007-12-20 | 2010-08-05 | E. I. Du Pont De Nemours And Company | Ketol-acid reductoisomerase using nadh |
| WO2011008924A2 (en) | 2009-07-15 | 2011-01-20 | Butamax(Tm) Advanced Biofuels Llc | Recovery of butanol from a mixture of butanol, water, and an organic extractant |
| US20110019894A1 (en) | 2009-07-22 | 2011-01-27 | Shunichiro Tanigawa | Ultrasonic diagnostic apparatus and control program thereof |
| WO2011019894A1 (en) | 2009-08-12 | 2011-02-17 | Gevo, Inc. | Cytosolic isobutanol pathway localization for the production of isobutanol |
| US20110124060A1 (en) | 2009-09-29 | 2011-05-26 | Butamax(Tm) Advanced Biofuels Llc | Yeast production host cells |
| US20110244536A1 (en) | 2009-09-29 | 2011-10-06 | Butamax(Tm) Advanced Biofuels Llc | Fermentive production of isobutanol using highly effective ketol-acid reductoisomerase enzymes |
| US20110269199A1 (en) | 2009-12-29 | 2011-11-03 | Butamax(Tm) Advanced Biofuels Llc | Alcohol dehydrogenases (adh) useful for fermentive production of lower alkyl alcohols |
| WO2011159853A1 (en) | 2010-06-18 | 2011-12-22 | Butamax(Tm) Advanced Biofuels Llc | Recombinant host cells comprising phosphoketolases |
| WO2011159998A2 (en) | 2010-06-18 | 2011-12-22 | Butamax(Tm) Advanced Biofuels Llc | Production of alcohol esters and in situ product removal during alcohol fermentation |
| US20120015416A1 (en) | 2009-12-29 | 2012-01-19 | Butamax(Tm) Advanced Biofuels Llc | Expression of hexose kinase in recombinant host cells |
| WO2012033832A2 (en) | 2010-09-07 | 2012-03-15 | Butamax(Tm) Advanced Biofuels Llc | Integration of a polynucleotide encoding a polypeptide that catalyzes pyruvate to acetolactate conversion |
| US20120064561A1 (en) | 2010-02-17 | 2012-03-15 | Butamax(Tm) Advanced Biofuels Llc | Activity of fe-s cluster requiring proteins |
Family Cites Families (57)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4865973A (en) | 1985-09-13 | 1989-09-12 | Queen's University At Kingston | Process for extractive fermentation |
| FR2696190B1 (en) | 1992-09-25 | 1994-12-09 | Agronomique Inst Nat Rech | Nucleic acid coding for an alpha-acetolactate synthase and its applications. |
| EP1204755B1 (en) | 1999-08-18 | 2006-08-09 | E.I. Du Pont De Nemours And Company | Process for the biological production of 1,3-propanediol |
| KR20020097200A (en) | 2000-03-21 | 2002-12-31 | 엘리트라 파마슈티컬즈, 인코포레이티드 | Identification of essential genes in prokaryotes |
| US6960465B1 (en) | 2001-06-27 | 2005-11-01 | Northwestern University | Increased cell resistance to toxic organic substances |
| CA2450867A1 (en) | 2001-07-02 | 2003-01-16 | Kaneka Corporation | Method of modifying enzyme and oxidoreductase variant |
| MXPA05009553A (en) | 2003-03-10 | 2006-03-17 | Broin And Associates Inc | Method for producing ethanol using raw starch. |
| SE526429C2 (en) | 2003-10-24 | 2005-09-13 | Swedish Biofuels Ab | Intensifying fermentation of carbohydrate substrate for, e.g. producing one to five carbon alcohols, involves using amino acid leucine, isoleucine, and/or valine as source of nitrogen |
| GB0329722D0 (en) | 2003-12-23 | 2004-01-28 | Delta Biotechnology Ltd | Modified plasmid and use thereof |
| US9303225B2 (en) | 2005-10-26 | 2016-04-05 | Butamax Advanced Biofuels Llc | Method for the production of isobutanol by recombinant yeast |
| US8273558B2 (en) | 2005-10-26 | 2012-09-25 | Butamax(Tm) Advanced Biofuels Llc | Fermentive production of four carbon alcohols |
| US7659104B2 (en) | 2006-05-05 | 2010-02-09 | E.I. Du Pont De Nemours And Company | Solvent tolerant microorganisms and methods of isolation |
| US7541173B2 (en) | 2006-06-15 | 2009-06-02 | E.I. Du Pont De Nemours And Company | Solvent tolerant microorganisms and methods of isolation |
| US8017364B2 (en) | 2006-12-12 | 2011-09-13 | Butamax(Tm) Advanced Biofuels Llc | Solvent tolerant microorganisms |
| WO2008098227A2 (en) | 2007-02-09 | 2008-08-14 | The Regents Of The University Of California | Biofuel production by recombinant microorganisms |
| EP2060632A1 (en) | 2007-10-29 | 2009-05-20 | Technische Universität Berlin | Method of modifying a yeast cell for the production of ethanol |
| US8431374B2 (en) * | 2007-10-31 | 2013-04-30 | Gevo, Inc. | Methods for the economical production of biofuel from biomass |
| DE602007011966D1 (en) | 2007-12-17 | 2011-02-24 | Suntory Holdings Ltd | MUTANT ILV5 GEN AND USE THEREOF |
| US8372612B2 (en) | 2007-12-21 | 2013-02-12 | Butamax(Tm) Advanced Biofuels Llc | Production of four carbon alcohols using improved strain |
| US8518678B2 (en) | 2007-12-21 | 2013-08-27 | Butamax(Tm) Advanced Biofuels Llc | Strain comprising increased expression of a CFA coding region for butanol production |
| CA2710359C (en) | 2007-12-23 | 2018-02-20 | Gevo, Inc. | Yeast organism producing isobutanol at a high yield |
| US8455239B2 (en) | 2007-12-23 | 2013-06-04 | Gevo, Inc. | Yeast organism producing isobutanol at a high yield |
| CN101959568A (en) | 2007-12-27 | 2011-01-26 | 格沃股份有限公司 | Reclaim higher alcohol from dilute aqueous solution |
| US8389252B2 (en) | 2008-05-12 | 2013-03-05 | Butamax(Tm) Advanced Biofuels Llc | Yeast strain for production of four carbon alcohols |
| US8906666B2 (en) | 2008-05-22 | 2014-12-09 | Butamax Advanced Biofuels Llc | Engineering resistance to aliphatic alcohols |
| AU2009296227A1 (en) | 2008-09-29 | 2010-04-01 | Butamax(Tm) Advanced Biofuels Llc | Enhanced pyruvate to 2,3-butanediol conversion in lactic acid bacteria |
| BRPI0913681A2 (en) | 2008-09-29 | 2019-09-24 | Butamax Advanced Biofuels Llc | "Recombinant lactic acid bacterial cell and isobutanol production method" |
| AU2009296232A1 (en) | 2008-09-29 | 2010-04-01 | Butamax(Tm) Advanced Biofuels Llc | Enhanced iron-sulfur cluster formation for increased dihydroxy-acid dehydratase activity in lactic acid bacteria |
| AU2009296224B2 (en) | 2008-09-29 | 2015-02-12 | Butamax(Tm) Advanced Biofuels Llc | Increased heterologous Fe-S enzyme actiivty in yeast |
| US8465964B2 (en) | 2008-11-13 | 2013-06-18 | Butamax (TM) Advanced Biofules LLC | Increased production of isobutanol in yeast with reduced mitochondrial amino acid biosynthesis |
| US8357519B2 (en) | 2008-11-19 | 2013-01-22 | The Ohio State University | Methods and processes for producing esters |
| US8652823B2 (en) | 2008-12-03 | 2014-02-18 | Butamax(Tm) Advanced Biofuels Llc | Strain for butanol production with increased membrane unsaturated trans fatty acids |
| US8795992B2 (en) | 2008-12-29 | 2014-08-05 | Butamax Advanced Biofuels Llc | Yeast with increased butanol tolerance involving cell wall integrity pathway |
| US8455225B2 (en) | 2008-12-29 | 2013-06-04 | Butamax Advanced Biofuels Llc | Yeast with increased butanol tolerance involving high osmolarity/glycerol response pathway |
| US8557562B2 (en) | 2008-12-29 | 2013-10-15 | Butamax(Tm) Advanced Biofuels Llc | Yeast with increased butanol tolerance involving filamentous growth response |
| US8614085B2 (en) | 2009-02-27 | 2013-12-24 | Butamax(Tm) Advanced Biofuels Llc | Yeast with increased butanol tolerance involving a multidrug efflux pump gene |
| US20120058541A1 (en) | 2009-05-22 | 2012-03-08 | Butamax(Tm) Advanced Biofuels Llc | Engineering resistance to aliphatic alcohols |
| AU2010300722A1 (en) | 2009-09-29 | 2012-04-12 | Butamax(Tm) Advanced Biofuels Llc | Improved flux to acetolactate-derived products in lactic acid bacteria |
| US20110195505A1 (en) | 2009-10-08 | 2011-08-11 | Butamax(Tm) Advanced Biofuels Llc | Bacterial strains for butanol production |
| GB2487889B (en) * | 2009-11-24 | 2012-12-19 | Gevo Inc | Methods of increasing dihydroxy acid dehydratase activity to improve production of fuels, chemicals, and amino acids |
| EP2534240B1 (en) | 2010-02-12 | 2019-06-05 | GEVO, Inc. | Yeast microorganisms with reduced by-product accumulation for improved production of fuels, chemicals, and amino acids |
| MX2012014550A (en) | 2010-06-17 | 2013-01-29 | Butamax Tm Advanced Biofuels | Yeast production culture for the production of butanol. |
| WO2012027642A1 (en) | 2010-08-27 | 2012-03-01 | Gevo, Inc. | Balanced four-step pathways to renewable butanols |
| US9790521B2 (en) | 2011-03-24 | 2017-10-17 | Butamax Advanced Biofuels Llc | Host cells and methods for production of isobutanol |
| US20120258873A1 (en) | 2011-04-06 | 2012-10-11 | Butamax(Tm) Advanced Biofuels Llc | Reduction of 2,3-dihydroxy-2-methyl butyrate (dhmb) in butanol production |
| CN103814135A (en) | 2011-06-17 | 2014-05-21 | 布特马斯先进生物燃料有限责任公司 | Lignocellulosic hydrolysates as feedstocks for isobutanol fermentation |
| CN105473726B (en) | 2011-07-28 | 2021-03-12 | 布特马斯先进生物燃料有限责任公司 | Ketoisovalerate decarboxylase and method of use |
| WO2013102147A2 (en) * | 2011-12-30 | 2013-07-04 | Butamax (Tm) Advanced Biofuels Llc | Genetic switches for butanol production |
| JP2015503350A (en) | 2011-12-30 | 2015-02-02 | ビュータマックス・アドバンスド・バイオフューエルズ・エルエルシー | Alcoholic fermentation production |
| AU2013235391A1 (en) | 2012-03-23 | 2014-09-04 | Butamax Advanced Biofuels Llc | Acetate supplemention of medium for butanologens |
| CA2873109A1 (en) | 2012-05-11 | 2013-11-28 | Butamax Advanced Biofuels Llc | Ketol-acid reductoisomerase enzymes and methods of use |
| BR112015006691A2 (en) | 2012-09-26 | 2017-12-12 | Butamax Advanced Biofuels Llc | recombinant host cell, composition, polypeptide, polynucleotides and recombinant vector |
| US9273330B2 (en) | 2012-10-03 | 2016-03-01 | Butamax Advanced Biofuels Llc | Butanol tolerance in microorganisms |
| WO2014106107A2 (en) | 2012-12-28 | 2014-07-03 | Butamax (Tm) Advanced Biofuels Llc | Dhad variants for butanol production |
| US20140186911A1 (en) | 2012-12-28 | 2014-07-03 | Butamax Advanced Biofuels Llc | Recombinant host cells and methods for producing butanol |
| CN105378057A (en) | 2013-03-14 | 2016-03-02 | 纳幕尔杜邦公司 | Glycerol 3-phosphate dehydrogenase for butanol production |
| WO2014151190A1 (en) | 2013-03-15 | 2014-09-25 | Butamax Advanced Biofuels Llc | Dhad variants and methods of screening |
-
2012
- 2012-03-23 US US13/428,585 patent/US9790521B2/en active Active
- 2012-03-23 AU AU2012230737A patent/AU2012230737B2/en active Active
- 2012-03-23 KR KR1020137027906A patent/KR20140092759A/en not_active Ceased
- 2012-03-23 CA CA2831130A patent/CA2831130C/en active Active
- 2012-03-23 WO PCT/US2012/030479 patent/WO2012129555A2/en not_active Ceased
- 2012-03-23 MX MX2013010823A patent/MX347976B/en active IP Right Grant
- 2012-03-23 JP JP2014501294A patent/JP6099623B2/en active Active
- 2012-03-23 HU HUE12760879A patent/HUE045191T2/en unknown
- 2012-03-23 EP EP12760879.2A patent/EP2689014B1/en active Active
- 2012-03-23 BR BR112013024328-7A patent/BR112013024328A2/en not_active Application Discontinuation
- 2012-03-23 CN CN201280024903.2A patent/CN103827304B/en not_active Expired - Fee Related
- 2012-03-26 AR ARP120101001A patent/AR088778A1/en unknown
-
2013
- 2013-03-15 US US13/840,649 patent/US9422581B2/en active Active
- 2013-03-15 US US13/840,676 patent/US9422582B2/en active Active
- 2013-09-06 ZA ZA2013/06708A patent/ZA201306708B/en unknown
-
2017
- 2017-01-20 AU AU2017200439A patent/AU2017200439A1/en not_active Abandoned
- 2017-04-03 US US15/477,980 patent/US20170275652A1/en not_active Abandoned
Patent Citations (37)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4683202B1 (en) | 1985-03-28 | 1990-11-27 | Cetus Corp | |
| US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
| US20070031950A1 (en) | 1998-09-11 | 2007-02-08 | Winkler Aaron A | Production of D-lactic acid with yeast |
| WO2000061722A1 (en) | 1999-04-13 | 2000-10-19 | Universiteit Van Amsterdam | Process for the production of yeast biomass comprising functionally deleted $i(hxk2) genes |
| US6586229B1 (en) | 2000-06-01 | 2003-07-01 | North Carolina State University | Method for the production of ρ-Hydroxybenzoate in species of pseudomonas and agrobacterium |
| US20050059136A1 (en) | 2003-05-02 | 2005-03-17 | A.E. Staley Manufacturing Co. | Pyruvate producing yeast strain |
| US20070031918A1 (en) | 2005-04-12 | 2007-02-08 | Dunson James B Jr | Treatment of biomass to obtain fermentable sugars |
| US20080182308A1 (en) | 2005-09-29 | 2008-07-31 | Donaldson Gail K | Fermentive production of four carbon alcohols |
| US20070092957A1 (en) | 2005-10-26 | 2007-04-26 | Donaldson Gail K | Fermentive production of four carbon alcohols |
| US7851188B2 (en) | 2005-10-26 | 2010-12-14 | Butamax(Tm) Advanced Biofuels Llc | Fermentive production of four carbon alcohols |
| US7993889B1 (en) | 2005-10-26 | 2011-08-09 | Butamax(Tm) Advanced Biofuels Llc | Fermentive production of four carbon alcohols |
| US20070259410A1 (en) | 2006-05-02 | 2007-11-08 | Donaldson Gail K | Fermentive production of four carbon alcohols |
| US20090155870A1 (en) | 2006-05-02 | 2009-06-18 | Donaldson Gail K | Fermentive production of four carbon alcohols |
| US20100081173A1 (en) | 2007-01-15 | 2010-04-01 | Cj Cheiljedang Corporation | Microorganism Producing Inosine and Method of Producing Inosine Using the Same |
| US20080261230A1 (en) | 2007-04-18 | 2008-10-23 | Der-Ing Liao | Fermentive production of isobutanol using highly active ketol-acid reductoisomerase enzymes |
| US7910342B2 (en) | 2007-04-18 | 2011-03-22 | Butamax(Tm) Advanced Biofuels Llc | Fermentive production of isobutanol using highly active ketol-acid reductoisomerase enzymes |
| US8129162B2 (en) | 2007-12-20 | 2012-03-06 | Butamax(Tm) Advanced Biofuels Llc | Ketol-acid reductoisomerase using NADH |
| US20090163376A1 (en) | 2007-12-20 | 2009-06-25 | E.I. Du Pont De Nemours And Company | Ketol-acid reductoisomerase using nadh |
| US20100197519A1 (en) | 2007-12-20 | 2010-08-05 | E. I. Du Pont De Nemours And Company | Ketol-acid reductoisomerase using nadh |
| US20090269823A1 (en) | 2008-04-28 | 2009-10-29 | E.I. Du Pont De Nemours And Company | Butanol dehydrogenase enzyme from the bacterium achromobacter xylosoxidans |
| US20090305370A1 (en) | 2008-06-04 | 2009-12-10 | E.I. Du Pont De Nemours And Company | Method for producing butanol using two-phase extractive fermentation |
| US20090305363A1 (en) | 2008-06-05 | 2009-12-10 | E. I. Du Pont De Nemours And Company | Enhanced pyruvate to acetolactate conversion in yeast |
| US20100081154A1 (en) | 2008-09-29 | 2010-04-01 | Butamax(Tm) Advanced Biofuels Llc | IDENTIFICATION AND USE OF BACTERIAL [2Fe-2S] DIHYDROXY-ACID DEHYDRATASES |
| US20100120105A1 (en) | 2008-10-27 | 2010-05-13 | Butamax (Tm) Advanced Biofuels Llc | Carbon pathway optimized production hosts for the production of isobutanol |
| US20100143997A1 (en) | 2008-10-31 | 2010-06-10 | Thomas Buelter | Engineered microorganisms capable of producing target compounds under anaerobic conditions |
| US20100129886A1 (en) | 2008-11-13 | 2010-05-27 | Butamax (Tm) Advanced Biofuels Llc | Production of isobutanol in yeast mitochondria |
| WO2011008924A2 (en) | 2009-07-15 | 2011-01-20 | Butamax(Tm) Advanced Biofuels Llc | Recovery of butanol from a mixture of butanol, water, and an organic extractant |
| US20110019894A1 (en) | 2009-07-22 | 2011-01-27 | Shunichiro Tanigawa | Ultrasonic diagnostic apparatus and control program thereof |
| WO2011019894A1 (en) | 2009-08-12 | 2011-02-17 | Gevo, Inc. | Cytosolic isobutanol pathway localization for the production of isobutanol |
| US20110124060A1 (en) | 2009-09-29 | 2011-05-26 | Butamax(Tm) Advanced Biofuels Llc | Yeast production host cells |
| US20110244536A1 (en) | 2009-09-29 | 2011-10-06 | Butamax(Tm) Advanced Biofuels Llc | Fermentive production of isobutanol using highly effective ketol-acid reductoisomerase enzymes |
| US20110269199A1 (en) | 2009-12-29 | 2011-11-03 | Butamax(Tm) Advanced Biofuels Llc | Alcohol dehydrogenases (adh) useful for fermentive production of lower alkyl alcohols |
| US20120015416A1 (en) | 2009-12-29 | 2012-01-19 | Butamax(Tm) Advanced Biofuels Llc | Expression of hexose kinase in recombinant host cells |
| US20120064561A1 (en) | 2010-02-17 | 2012-03-15 | Butamax(Tm) Advanced Biofuels Llc | Activity of fe-s cluster requiring proteins |
| WO2011159998A2 (en) | 2010-06-18 | 2011-12-22 | Butamax(Tm) Advanced Biofuels Llc | Production of alcohol esters and in situ product removal during alcohol fermentation |
| WO2011159853A1 (en) | 2010-06-18 | 2011-12-22 | Butamax(Tm) Advanced Biofuels Llc | Recombinant host cells comprising phosphoketolases |
| WO2012033832A2 (en) | 2010-09-07 | 2012-03-15 | Butamax(Tm) Advanced Biofuels Llc | Integration of a polynucleotide encoding a polypeptide that catalyzes pyruvate to acetolactate conversion |
Non-Patent Citations (53)
| Title |
|---|
| "Enzyme Nomenclature", 1992, ACADEMIC PRESS |
| "Manual of Methods for General Bacteriology", 1994, AMERICAN SOCIETY FOR MICROBIOLOGY |
| "Methods in Enzymology", vol. 194, 2004, ELSEVIER ACADEMIC PRESS, article "Guide to Yeast Genetics and Molecular and Cell Biology" |
| "Methods in Yeast Genetics", 2005, COLD SPRING HARBOR LABORATORY PRESS, pages: 201 - 202 |
| "Ullmann's Encyclopedia of Industrial Chemistry", vol. 5, 2003, WILEY-VCH VERLAG GMBH AND CO., pages: 716 - 719 |
| ADEN ET AL.: "Report NREL/TP-510-32438", June 2002, NATIONAL RENEWABLE ENERGY LABORATORY, article "Lignocellulosic Biomass to Ethanol Process Design and Economics Utilizing Co-Current Dilute Acid Prehydrolysis and Enzymatic Hydrolysis for Corn Stover" |
| AULABAUGH; SCHLOSS, BIOCHEMISTRY, vol. 29, 1990, pages 2824 - 2830 |
| AUSUBEL, F. M. ET AL.: "Current Protocols in Molecular Biology", 1987, GREENE PUBLISHING ASSOC. AND WILEY-INTERSCIENCE |
| BELLION ET AL.: "Microb. Growth C1 Compd., [Int. Symp.", 1993, INTERCEPT, pages: 415 - 32 |
| BIOCHIMICA ET BIOPHYSICA ACTA, vol. 1645, 2003, pages 89 - 94 |
| CARLINI ET AL., J. MOLEC. CATAL. A. CHEM., vol. 220, 2004, pages 215 - 220 |
| DATABASE GenBank [O] retrieved from ncbi Database accession no. 3955993.3957468 |
| DATABASE GenBank [O] retrieved from ncbi Database accession no. AAA25079 |
| DATABASE GenBank [O] retrieved from ncbi Database accession no. AAA25161 |
| DATABASE GenBank [O] retrieved from ncbi Database accession no. AAS49166 |
| DATABASE GenBank [O] retrieved from ncbi Database accession no. AJ746364 |
| DATABASE GenBank [O] retrieved from ncbi Database accession no. AY548760 |
| DATABASE GenBank [O] retrieved from ncbi Database accession no. BX957219 |
| DATABASE GenBank [O] retrieved from ncbi Database accession no. CAB14105 |
| DATABASE GenBank [O] retrieved from ncbi Database accession no. CAB15618 |
| DATABASE GenBank [O] retrieved from ncbi Database accession no. CAF29874 |
| DATABASE GenBank [O] retrieved from ncbi Database accession no. CAG34226 |
| DATABASE GenBank [O] retrieved from ncbi Database accession no. L16975 |
| DATABASE GenBank [O] retrieved from ncbi Database accession no. M73842 |
| DATABASE GenBank [O] retrieved from ncbi Database accession no. NC_000913 |
| DATABASE GenBank [O] retrieved from ncbi Database accession no. NC_000913 REGION |
| DATABASE GenBank [O] retrieved from ncbi Database accession no. NC_001142 |
| DATABASE GenBank [O] retrieved from ncbi Database accession no. NC_002505 |
| DATABASE GenBank [O] retrieved from ncbi Database accession no. NC_002516 |
| DATABASE GenBank [O] retrieved from ncbi Database accession no. NC_004129 |
| DATABASE GenBank [O] retrieved from ncbi Database accession no. NP_012550 |
| DATABASE GenBank [O] retrieved from ncbi Database accession no. YP_026248 |
| DATABASE GenBank [O] retrieved from ncbi Database accession no. Z99115 |
| DATABASE GenBank [O] retrieved from ncbi Database accession no. Z99122 |
| DESHPANDE, MUKUND, APPL. BIOCHEM. BIOTECHNOL., vol. 36, 1992, pages 227 |
| DICKINSON ET AL., J. BIOL. CHEM., vol. 273, 1998, pages 25752 - 25756 |
| DIDERICH ET AL., APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 67, 2001, pages 1587 - 1593 |
| GUO ET AL., J. MEMBR. SCI., vol. 245, 2004, pages 199 - 210 |
| HORTON ET AL., GENE, vol. 77, 1989, pages 61 - 68 |
| KANEKO ET AL., PHYTOCHEMISTRY, vol. 39, 1995, pages 115 - 120 |
| MA ET AL., GENE, vol. 58, 1987, pages 201 - 216 |
| NEVOIGT ET AL., APPL. ENVIRON. MICROBIOL., vol. 72, 2006, pages 5266 - 5273 |
| NEVOIGT; STAHL, YEAST, vol. 12, 1996, pages 1331 - 1337 |
| RANE ET AL., ARCH. BIOCHEM. BIOPHYS., vol. 338, 1997, pages 83 - 89 |
| RODNEY ROTHSTEIN, METHODS IN ENZYMOLOGY, vol. 194, 1991, pages 281 - 301 |
| ROSSELL ET AL., YEAST RESEARCH, vol. 8, 2008, pages 155 - 164 |
| SAMBROOK, J.; FRITSCH, E. F.; MANIATIS, T.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY |
| SAMBROOK, J.; FRITSCH, E. F.; MANIATIS, T.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS |
| SUITER ET AL., ARCH. MICROBIOL., vol. 153, 1990, pages 485 - 489 |
| T. J. SILHAVY; M. L. BENNAN; L. W. ENQUIST: "Experiments with Gene Fusions", 1984, COLD SPRING HARBOR LABORATORY |
| TABOR ET AL., PROC. ACAD. SCI. USA, vol. 82, 1985, pages 1074 |
| THOMAS D. BROCK: "Biotechnology: A Textbook of Industrial Microbiology", 1989, SINAUER ASSOCIATES, INC. |
| WALKER ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 89, 1992, pages 392 |
Cited By (29)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2737073B1 (en) * | 2011-07-28 | 2021-10-20 | Butamax Advanced Biofuels LLC | Keto-isovalerate decarboxylase enzymes and methods of use thereof |
| WO2013102147A2 (en) | 2011-12-30 | 2013-07-04 | Butamax (Tm) Advanced Biofuels Llc | Genetic switches for butanol production |
| US9689004B2 (en) | 2012-03-23 | 2017-06-27 | Butamax Advanced Biofuels Llc | Acetate supplemention of medium for butanologens |
| US9512408B2 (en) | 2012-09-26 | 2016-12-06 | Butamax Advanced Biofuels Llc | Polypeptides with ketol-acid reductoisomerase activity |
| WO2014052670A1 (en) * | 2012-09-26 | 2014-04-03 | Butamax (Tm) Advanced Biofuels Llc | Polypeptides with ketol-acid reductoisomerase activity |
| EP3444339A1 (en) * | 2012-09-26 | 2019-02-20 | Butamax(TM) Advanced Biofuels LLC | Polypeptides with ketol-acid reductoisomerase activity |
| US10174345B2 (en) | 2012-09-26 | 2019-01-08 | Butamax Advanced Biofuels Llc | Polypeptides with ketol-acid reductoisomerase activity |
| US20140093931A1 (en) * | 2012-09-28 | 2014-04-03 | Butamax Advanced Biofuels Llc | Production of fermentation products |
| WO2014106107A2 (en) | 2012-12-28 | 2014-07-03 | Butamax (Tm) Advanced Biofuels Llc | Dhad variants for butanol production |
| WO2014160050A1 (en) | 2013-03-14 | 2014-10-02 | Butamax Advanced Biofuels Llc | Glycerol 3- phosphate dehydrogenase for butanol production |
| WO2014151645A1 (en) | 2013-03-15 | 2014-09-25 | Butamax Advanced Biofuels Llc | Process for maximizing biomass growth and butanol yield by feedback control |
| WO2014144728A1 (en) | 2013-03-15 | 2014-09-18 | Butamax Advanced Biofuels Llc | Method for production of butanol using extractive fermentation |
| WO2014144210A2 (en) | 2013-03-15 | 2014-09-18 | Butamax Advanced Biofuels Llc | Competitive growth and/or production advantage for butanologen microorganism |
| WO2014144643A1 (en) | 2013-03-15 | 2014-09-18 | Butamax Advanced Biofuels Llc | Method for producing butanol using extractive fermentation |
| WO2014151190A1 (en) | 2013-03-15 | 2014-09-25 | Butamax Advanced Biofuels Llc | Dhad variants and methods of screening |
| WO2014157185A1 (en) * | 2013-03-28 | 2014-10-02 | 株式会社カネカ | Modified carbonyl reducing enzyme and gene |
| CN105073991B (en) * | 2013-03-28 | 2019-04-05 | 株式会社钟化 | Altered carbonyl reductase and its gene |
| US10294461B2 (en) | 2013-03-28 | 2019-05-21 | Kaneka Corporation | Modified carbonyl reducing enzyme and gene |
| CN105073991A (en) * | 2013-03-28 | 2015-11-18 | 株式会社钟化 | Modified carbonyl reducing enzyme and gene |
| US10308910B2 (en) | 2013-07-03 | 2019-06-04 | Butamax Advanced Biofuels Llc | Partial adaption for butanol production |
| US9663759B2 (en) | 2013-07-03 | 2017-05-30 | Butamax Advanced Biofuels Llc | Partial adaptation for butanol production |
| US12398396B2 (en) | 2013-11-25 | 2025-08-26 | Genomatica, Inc. | Methods for enhancing microbial production of specific length fatty alcohols in the presence of methanol |
| US12529078B2 (en) | 2013-12-03 | 2026-01-20 | Genomatica, Inc. | Microorganisms and methods for improving product yields on methanol using acetyl-CoA synthesis |
| US10808262B2 (en) | 2013-12-03 | 2020-10-20 | Genomatica, Inc. | Microorganisms and methods for improving product yields on methanol using acetyl-CoA synthesis |
| US20200165463A1 (en) * | 2017-06-30 | 2020-05-28 | Dow Global Technologies Llc | Coating for aldehyde remediation and method of making |
| US11597845B2 (en) * | 2017-06-30 | 2023-03-07 | Dow Global Technologies Llc | Coating for aldehyde remediation and method of making |
| CN110982771A (en) * | 2019-12-26 | 2020-04-10 | 江南大学 | Method for synthesizing p-hydroxymandelic acid |
| EP4114917A4 (en) * | 2020-03-06 | 2024-08-21 | GEVO, Inc. | NEW NKR VARIANTS FOR INCREASED ISOBUTANOL PRODUCTION |
| US12595466B2 (en) | 2020-03-06 | 2026-04-07 | Gevo, Inc. | NKR variants for increased production of isobutanol |
Also Published As
| Publication number | Publication date |
|---|---|
| MX347976B (en) | 2017-05-22 |
| AU2017200439A1 (en) | 2017-02-16 |
| HUE045191T2 (en) | 2019-12-30 |
| US20170275652A1 (en) | 2017-09-28 |
| US9790521B2 (en) | 2017-10-17 |
| CA2831130C (en) | 2021-10-26 |
| EP2689014A4 (en) | 2014-11-05 |
| AR088778A1 (en) | 2014-07-10 |
| US9422582B2 (en) | 2016-08-23 |
| JP2014508541A (en) | 2014-04-10 |
| AU2012230737A1 (en) | 2013-09-19 |
| BR112013024328A2 (en) | 2020-08-25 |
| CN103827304B (en) | 2018-04-17 |
| US20140030783A1 (en) | 2014-01-30 |
| AU2012230737B2 (en) | 2017-02-23 |
| EP2689014A2 (en) | 2014-01-29 |
| CN103827304A (en) | 2014-05-28 |
| MX2013010823A (en) | 2014-02-03 |
| EP2689014B1 (en) | 2019-04-24 |
| US9422581B2 (en) | 2016-08-23 |
| KR20140092759A (en) | 2014-07-24 |
| WO2012129555A3 (en) | 2013-02-28 |
| US20130071898A1 (en) | 2013-03-21 |
| ZA201306708B (en) | 2015-01-28 |
| US20140030782A1 (en) | 2014-01-30 |
| CA2831130A1 (en) | 2012-09-27 |
| JP6099623B2 (en) | 2017-03-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2012230737B2 (en) | Host cells and methods for production of isobutanol | |
| US9388392B2 (en) | Ketol-acid reductoisomerase enzymes and methods of use | |
| US10174345B2 (en) | Polypeptides with ketol-acid reductoisomerase activity | |
| EP2737073B1 (en) | Keto-isovalerate decarboxylase enzymes and methods of use thereof | |
| US20120258873A1 (en) | Reduction of 2,3-dihydroxy-2-methyl butyrate (dhmb) in butanol production | |
| EP2798072A2 (en) | Fermentative production of alcohols | |
| JP2012503992A (en) | Increased heterogeneous Fe-S enzyme activity in yeast | |
| EP2888350A1 (en) | Production of fermentation products |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12760879 Country of ref document: EP Kind code of ref document: A2 |
|
| ENP | Entry into the national phase |
Ref document number: 2012230737 Country of ref document: AU Date of ref document: 20120323 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2014501294 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2013/010823 Country of ref document: MX |
|
| ENP | Entry into the national phase |
Ref document number: 2831130 Country of ref document: CA |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2012760879 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 20137027906 Country of ref document: KR Kind code of ref document: A |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112013024328 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112013024328 Country of ref document: BR Kind code of ref document: A2 Effective date: 20130923 |






























































