WO2012123591A1

WO2012123591A1 - Method for targeting nucleic acids to the nucleus

Info

Publication number: WO2012123591A1
Application number: PCT/EP2012/054828
Authority: WO
Inventors: Minoo Rassoulzadegan; Mitsuoki KAWANO
Original assignee: Institut National de la Sante et de la Recherche Medicale INSERM
Current assignee: Institut National de la Sante et de la Recherche Medicale INSERM
Priority date: 2011-03-17
Filing date: 2012-03-19
Publication date: 2012-09-20
Anticipated expiration: 2013-09-17

Abstract

The present invention relates to novel nucleic acid molecules and their use for nuclear targeting.

Description

Method for targeting nucleic acids to the nucleus

FIELD OF THE INVENTION The present invention relates to nucleic acid sequences that target nucleic acid molecules to the nucleus.

BACKGROUND OF THE INVENTION The paternal contribution to the fertilized egg may not be limited to the transfer of a haploid copy of the genome. A greater complexity was first suggested by the finding of significant amounts of RNA in the transcriptionally inert spermatozoon, leading to interesting speculations relative to RNA transfer to the zygote and its subsequent role in development (Kramer & Krawetz, 1997; Krawetz, 2005). Independently, the discovery of RNA-mediated inheritance of epigenetic traits (paramutations) in the mouse led us to the conclusion that gametic RNAs may act as transgenerational epigenetic determinants (Rassoulzadegan et al, 2006; Wagner et al, 2008; Grandjean et al, 2009). Microarray analysis revealed the presence of microRNAs in sperm (Ostermeier et al, 2005; Amanai et al, 2006) and we are now led to consider other small noncoding RNAs as candidates for regulatory functions.

There is still a need in the art for nucleic acid sequences that are able to target nucleic acid molecules to the nuclear compartment.

SUMMARY OF THE INVENTION The inventors report the identification of two novel small noncoding RNAs, exclusively present in the mature sperm and efficiently transferred to the embryo where they are maintained in a tight association with the nucleus during all the preimplantation period.

Hence, the invention relates to a method for targeting nucleic acid molecules to the nucleus. Indeed, the inventors have identified two small noncoding RNAs, comprising the consensus sequence UGGG(G)CGGG which is sufficient for nuclear targeting of unrelated small RNAs. This consensus sequence is identical in humans and can therefore be used in any mammalian species, as a nuclear targeting sequence. The invention therefore relates to an isolated nucleic acid molecule comprising sequence UGGGCGGG and/or sequence UGGGGCGGG.

The invention also relates to the use of a single-stranded ribonucleic acid moiety comprising sequence UGGGCGGG and/or sequence UGGGGCGGG for targeting a nucleic acid molecule to the nucleus of a host cell.

The invention also relates to a method for targeting a nucleic acid molecule to the nucleus of a host cell comprising the step of adding a single- stranded ribonucleic acid moiety comprising UGGGCGGG and/or sequence UGGGGCGGG to said nucleic acid molecule.

In another aspect, the invention also relates to a method for obtaining an epigenetic regulation comprising introducing a nucleic acid as defined above into a fertilized egg or into an unfertilized oocyte.

In another aspect, the invention relates to a method for obtaining DNA recombination and/or mutagenesis comprising the step of introducing into a cell a nucleic acid molecule which is capable of provoking changes in the DNA sequence, such as DNA or RNA molecules involved in recombination and/or mutagenesis, wherein said nucleic acid molecule contains a single- stranded ribonucleic acid moiety comprising sequence UGGGCGGG and/or sequence UGGGGCGGG.

DETAILLED DESCRIPTION OF THE INVENTION The invention therefore relates to an isolated nucleic acid molecule comprising sequence UGGGCGGG and/or sequence UGGGGCGGG.

In a preferred embodiment, said nucleic acid molecule is a ribonucleic acid molecule.

In another embodiment, said nucleic acid molecule is chimeric DNA/RNA molecule, wherein the sequence UGGGCGGG or UGGGGCGGG is a single-stranded ribonucleic acid.

In a preferred embodiment, said nucleic acid molecule has a length comprised between 8 and 500 nucleotides. In a preferred embodiment, said nucleic acid molecule has a length of more than 8, preferably more than 9, even more preferably more than 10,11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 nucleotides.

In a preferred embodiment, said nucleic acid has a length of less than 500 nucleotides, preferably less than 200, less than 100, 50, 45, 40 nucleotides.

The nucleic acid molecule according to the invention may comprise the sequence UGGGCGGG or UGGGGCGGG in different positions. According to one embodiment, the UGGGCGGG or UGGGGCGGG sequence is located at the 5' end of the nucleic acid molecule.

Without wishing to be bound by theory, the invention believe that, when the targeting sequence is located at the 5' end of the nucleic acid molecule, the nucleic acid molecule is not only targeted to the nucleus, but is also stably localized in the nucleus of the cells after mitosis.

Alternatively, in another embodiment, the UGGGCGGG or UGGGGCGGG sequence is located at the 3' end of the nucleic acid molecule.

In yet another embodiment, the UGGGCGGG or UGGGGCGGG sequence is located within the nucleic acid molecule, with other nucleotides or ribonucleotides on either end.

The invention also relates to a method for targeting a nucleic acid molecule to the nucleus of a host cell comprising the step of adding a single- stranded ribonucleic acid moiety comprising UGGGCGGG and/or sequence UGGGGCGGG to said nucleic acid molecule. As used herein, the expression "targeting a nucleic acid molecule to the nucleus" refers to a nucleic acid molecule which is predominantly located in the nucleus of a given cell. Typically, when said nucleic acid molecule is microinjected into the cytoplasm of the cell, it translocates into the nucleus. When said nucleic acid molecule is microinjected/transferred/transfected/infected into the nucleus of the cell, remains in the nucleus.

Nuclear translocation or nuclear localization can be assessed by any method known in the art. Typically, when bound to a fluorescent tag or when a fluorescent nucleic acid is used, the nuclear localization can be assessed by fluorescence microscopy.

The method for targeting a nucleic acid molecule to the nucleus has many potential applications, as described below.

In one embodiment, it can be used to stabilize an exogenous nucleic acid in the nucleus.

Typically, said exogenous nucleic acid may be a regulatory RNA, a therapeutic RNA.

Advantageously, the nucleic acid molecules according to the invention comprising the consensus sequence UGGG(G)CGGG, i.e. comprising UGGGCGGG or UGGGGCGGG, are not only targeted to the nucleus, but are also maintained stably during cell division. In other terms, they are also found in the nucleus.

Hence, the invention also relates to a method for obtaining an epigenetic regulation comprising introducing a nucleic acid as defined above into a fertilized egg.

Alternatively, the method for obtaining an epigenetic regulation can comprise introducing a nucleic acid as defined above into an unfertilized egg, and subsequently fertilizing said oocyte. Indeed, the inventors have observed that the nucleic acid according to the invention translocates into the nucleus following fertilization.

As used herein, the expression "epigenetic regulation" refers to heritable changes in gene function that occur without a change in the DNA sequence.

Alternatively, the method of the invention can also be used in order to target to the nucleus a nucleic acid molecule which is capable of provoking changes in the DNA sequence, such as DNA or RNA molecules involved in recombination and/or mutagenesis

According to one embodiment, the nucleic acids and methods of the invention can be used in order to target a regulatory RNA and/or a therapeutic RNA to the nucleus. Indeed, regulatory RNA and therapeutic RNA are often unstable and their effects are limited in time. Prior art methods used in order to stabilize said RNA molecules rely on chemical modifications. These chemical modifications can lead to undesirable side effects. In contrast, the nucleic acids and methods of the invention rely on natural endogenous signals and therefore advantageously limit these undesirable side effects. The invention will be better understood with reference to the figures and examples below, which are for illustrative purpose only and do not limit the scope of the invention.

LEGENDS TO FIGURES

Fig. 1. Expression analysis of thirteen sperm small RNAs.

Total RNAs isolated from adult testis and sperm were polyadenylated. Reverse transcription was carried out using an RTQ primer with or without reverse transcriptase. The cDNAs were amplified by PCR using a primer specific to each small RNA and an RTQ-UNIr universal primer (Supplemental Table 3). The expected cDNA sizes for the RNAs are ~120-bp. The PCR products were electrophoresed on 3% agarose gels and stained using ethidium bromide. let-7a was used as a positive control.

Fig. 2. Genomic location and expression profiling of two speRNAs and their proximal piRNAs.

(A) Predicted secondary structures of putative precursors of speRNA-12 (SEQ ID No.12) and -13 (SEQ ID No.13). About 60 nt of genomic sequence from each side of the sequenced speRNAs were used to predict the secondary structures using the RNAfold. The sequenced speRNA sequences are blue and their genomic coordinates of the mouse genome assemblies (mm9) are shown above the secondary structures. All predicted secondary structures of speRNA-1 to -13 are shown in Supplemental Fig. 1. Some other predicted secondary structures of speRNA-12 and -13 using longer flanking sequences are shown in Supplemental Fig. 4. (B) The piRNA cluster on which speRNA-12 and -13 are mapped. Obtained small RNA sequences of speRNA- 12 and -13 are shown as a blue arrowhead, and their adjacent piRNAs are indicated as a red arrowhead above the box. The size of the arrowhead is not scaled. The red lines in the box indicate that piRNAs registered in the piRNABank (http://pirnabank.ibab.ac.in/). (C) Oligo primer sequences used in the analysis are shown as black arrows. The sequenced cDNA read of speRNA-12 and -13 are blue. The piRNAs adjacent to speRNA- 12 and -13 are red. Predicted stem-loop structure region as precursor- speRNA is indicated as upper case. The positions of the genome sequences are shown above each of the sequences. A minus strand of the mouse genome is shown for speRNA-12, and a plus strand of the genome is shown for speRNA-13. (D) Expression of speRNA-12 and -13 and their flanking piRNAs was investigated using mouse total RNAs shown above the pictures. The expected cDNA sizes for the RNAs are ~120-bp. The PCR products were electrophoresed on 3% agarose gels and stained using ethidium bromide. let-7a was used as a positive control. A DNA size marker was loaded on each side of the gel. NTC stands for a non-template control. (E) Model of the speRNA-12 and -13 production. Single-stranded precursor transcripts of piRNAs are expressed specifically in testis. Mature piRNAs are preferentially expressed in testis and remain in sperm. During mature sperm formation, the speRNAs (blue arrows) are generated from piRNA precursor transcripts. (F) Alignment of mature speRNA-12 and -13. Identical nucleotide sequences are indicated by dots.

Fig. 3. Mitotic stability of speRNA-12 and -13 in the preimplantation embryo.

FITC(or Cy3)-tagged oligoribonucleotides were microinjected in fertilized eggs, the embryos were cultured for the next 48 hours and examined by fluorescence microscopy (Zeiss ApoTome). Controls were performed with micro RNA miR-124, previously used for this type of experiment (Grandjean et al, 2009). (A) Fertilized egg, miR-124 injection into male pronucleus, 5 min (left panel); after one hour (right panel), miR-124 (left) is excluded from the nucleus whereas speRNA-12 (right) is partitioned between the two pronuclei. (B) One-cell (6 hrs), 2-cell (24 hrs) and 4-cell (48 hrs) embryos microinjected with the indicated fluorescent oligoribonucleotides. Note the maintenance of speRNA-12 and -13, contrasting with the uniform distribution of miR-29b (48 hrs, c) and the disappearance of miR-124 (d). (C) Maintenance at the 2-cell stage of the microinjected miR-124 sequence with the UGGGCGGG motif at the 5'-end. Fig. 4. Predicted secondary structures of speRNA-1 to -13. Sequenced cDNA read sequences are shown by small letters and the positions are indicated as a blue line. The most stable structure predicted by the mfold is shown.

Fig. 5. Map positions of speRNA-12 and -13 and known piRNAs in the piRNABank (http://pirnabank.ibab.ac.in/ .

Fig. 6. Analysis of putative piRNA precursors by strand-specific RT-PCR from speRNA-12 and -13 loci. Total RNA from adult mouse testes and epididymides were reverse-transcribed with a gene-specific antisense primer (used for the detection of sense transcript), with a gene- specific sense primer, with no primer. PCR was carried out using a set of gene-specific primers (Supplemental Table 3). The PCR product size is 301-bp for the speRNA-12 locus, and 351 -bp for the speRNA-13 locus, whose nucleotide sequences are shown in Supplemental Fig. 3. LINE 1 and β-actin were used as a positive and negative control for the existence of antisense transcripts, respectively. Fig. 7. Predicted secondary structures of speRNA-12 and -13 regions using longer flanking sequences. Positions of the mouse genome used for this analysis are chr 17:27455400- 27455700 for speRNA-12 and ch 17:27496250-27496600 for speRNA-13. Position of the cDNA read sequences are shown as a blue line. The most stable structure predicted by the RNAfold is shown.

Fig. 8 Expression profiling analysis for small RNAs mapped to piRNA loci identified in this study. The PCR products were electrophoresed on 3% agarose gels and stained using ethidium bromide. let-7a was used as a positive control. A DNA size marker was loaded on each side of the gel. NTC stands for a non-template control. Primers used in the analyses are shown in Supplemental Table 3.

Fig. 9 Nuclear localization of the speRNA-12 is an exclusive property of the fertilized egg. Fluorescence-tagged oligoribonucleotides were microinjected and examined either one hour or 24 hours later. Unfertilized oocytes retain the FITC-tagged speRNA-12 uniformly distributed in the whole cell volume, similar to Cy3-tagged miR-124 RNA and contrasting with its strict nuclear localization in the fertilized eggs and subsequent stages.

EXAMPLES Example 1

RESULTS AND DISCUSSION

We sequenced the small RNA fraction prepared from mouse sperm with a 454 sequencer (see Supplemental methods), resulting in 359,840 RNA sequences ranging from 13 to 248 nt. It consists of fragments of long RNAs (rRNA and mRNA) as well as small regulatory RNAs such as microRNAs (miRNAs) and Piwi-interacting RNAs (piRNAs) (Supplemental Table 1). We then searched computationally for novel small RNA and predicted 13 putative novel small RNA in mouse sperm (termed speRNA-1 to -13; Supplemental Table 2) based on their lengths and the predicted secondary structure of the proximal genomic regions (Supplemental Fig. 1). We then examined their expression in sperm with a semiquantitative PCR-based small RNA detection method (Ro et al, 2006) and successfully detected nine of them (speRNA-1, - 2, -4, -7, -8, -9, -1 1 , -12, and -13), while the remaining four were not validated (Fig. 1). Two of the nine RNAs, speRNA-12 and -13 (Fig. 2 A), were present exclusively in epididymal sperm and detected neither in the testis, nor in somatic tissues (Fig. 2D).

Unexpectedly, both speRNA-12 and -13 were determined to be encoded within a ~40-kb region in a piRNA cluster region on chromosome 17 and oriented divergently (Fig. 2B). Since piRNAs are generated by repetitive cleavage a long transcript and the sperm small RNAs are oriented in the same way as their proximal piRNAs (Fig. 2B; Fig. 5), one could assume that the speRNA-12 and -13 are left over of the piRNA pathway. We examined the expression of the two small RNAs and the piRNAs from the flanking regions in testis of different ages as well as in a variety of other mouse tissues. The results showed a clear distinction between speRNA-12 and -13 and the piRNAs, the former being only detected in the maturing epididymal sperm, in contrast to the piRNAs accumulated in the testis starting at the time of meiosis (> 1 week) (Figs. 2C,D). Recently, piRNA loci were reported to generate endogenous siRNAs (-21 -nt) from the long double-stranded RNAs (dsRNAs) expressed from retrotransposons and pseudogenes in mouse oocytes (Tarn et al, 2008; Watanabe et al, 2008), and one could assume that sperm- 12 and -13 are also derived from long dsRNAs. However, no transposable elements and pseudogenes have been reported around the locus. We did not detect the antisense transcription using strand-specific RT-PCR (Fig. 6). Prediction of the secondary structures of their proximal (~300-nt) regions did not show long stretches of dsRNA (Fig. 7). The secondary structures are rather similar to miRNA precursor, where the stem ends correspond to the 3' and 5'-end of speRNA-12 and -13, respectively. Three other ~20-nt small RNAs identified by our sequencing, mapped within piRNA loci, and whose flanking sequences are predicted not to fold as a typical pre-miRNA stem-loop structure, were not detected in sperm (Fig. 8). It is indicated that the speRNA-12 and -13 are cleaved out from stem-loop structured RNA rather than a long dsRNA and suggest that they represent a novel class of RNA (Fig. 2E). Their sequences show significant similarities, in particular 1st to 9th sequences are identical (CAGGGUGGG) (Fig. 2F) and do not match any known miRNAs registered in miRBase (http://mirbase.org/).

Since the speRNAs are exclusively present in the sperm cells, which are devoid of transcription and translation activity, a role in the regulation of gene expression is more likely to take place in the embryo, assuming transfer at fertilization. To evidence such a transfer, we analyzed by quantitative-PCR the stages from the oocyte to the preimplantation embryo. As shown for speRNA-12 in Table 1, the RNAs were detected in the fertilized egg, in all likelihood of sperm origin, since they were not present at a detectable level in oocytes. The same low copy numbers were maintained in the dividing blastomeres and the RNAs were not detectable any more starting at the blastocyst stage. These results provide the first experimental evidence for zygotic transfer of paternal RNAs at natural fertilization.

In order to precise their localization, we carried out microinjection of fluorescent Cy3 or FITC-coupled oligoribonucleotides into the male pronucleus at the one-cell stage. As reported for miR-124 (Grandjean et al, 2009), we previously performed this type of experiment with a variety of microRNAs and other RNAs (Supplemental Table 4). In most cases (except for miR-29b, see below), the labelled RNA was excluded from the nucleus and eliminated within the first hour after injection (see miR-124 in Fig. 3A). The speRNA-12 and -13 oligoribonucleotides showed a strikingly different behaviour. The labelled material injected into the male pronucleus was within minutes distributed between the two pronuclei (Figs. 3A,B). Both nuclear and cytoplasmic microinjection at the one or the two cell stages led to the same exclusive nuclear localization (data not shown). In contrast, their microinjection to unfertilized oocytes led to a homogenous distribution in the whole cellular volume (Supplemental Fig. 6).When the injected eggs were subsequently fertilized in vitro, and the female pronucleus regenerated, the fluorescence was progressively concentrated in the nuclear compartment. Interestingly, accumulation was first detected in the extruded second polar body and the incoming paternal nucleus, both endowed with a nuclear membrane. It then extended to the reconstituted female pronucleus. The case of miR-29b was of specific interest. The microRNA, present in our mouse sperm preparations, is reported to be translocated to the nucleus in HeLa cells (Hwang et al, 2007). The nuclear localization signal identified in miR- 29b, AGUGUU, not present in the two sperm RNAs. In fact, a fluorescence-tagged miR-29b oligoribonucleotide showed in the early embryo the behaviour different from that of the sperm small RNAs. After microinjection into the male pronucleus, the label diffused from the nucleus to the cytoplasm, then was uniformly distributed in both compartments from the one- cell to the later stages (see 4-cell stage in Fig. 3B).

The next question we addressed was to identify the sequence element(s) responsible for the nuclear localization of speRNA-12 and -13. It was likely to be found in their common 5' region and in fact, mutating the 5 '-CAGGGUGGG end into CAUUUGGG resulted in a wide distribution of the microinjected labelled RNA in the whole cellular volume and its disappearance at the start of embryonic growth (data not shown). By adding 5' extensions from the speRNA sequence to the miR-1 and miR-124 oligoribonucleotides, by themselves not maintained in the nucleus; however, we finally determined that addition of UGGGCGGG motif at the 5 '-end of the microRNAs was sufficient to transfer them to the nucleus and insure their maintenance during early development (Fig. 3C).

The stable nuclear association of the labelled speRNAs was maintained during preimplantation development. The fluorescent oligoribonucleotides were detected in the nuclei of the blastomeres until the embryos reached the blastocyst stages (Fig. 3B; and data not shown). In the blastocyst, contrary to the previous stages, only a few nuclei of the inner cell mass and the trophectoderm were still labelled. Maintenance of full-length free oligoribonucleotides was independently ascertained by sequence analysis of individual embryos (data not shown). After microinjection in the nucleus of one of the blastomeres at the two-cell stage, speRNA-12 and -13 were maintained in the progeny of the microinjected blastomere without being transferred to the other one (data not shown). Maintenance during development and a strict nuclear localization, suggestive of an active role in early development, therefore appear as a unique property of the speRNA-12 and -13 RNAs.

Altogether our results identify two small, noncoding RNAs exclusively present in mature sperm and transferred to the fertilized egg. They appear to represent a novel class of small RNAs. Their generation at the final stages of spermatogenesis significantly enlarges our view of the role of piRNA genes in reproduction and development. Their strict, sequence dependent nuclear localization at the preimplantation stages (Fig. 3) indicates regulated transport mechanisms that remain entirely to be analyzed. Most importantly, sexual transfer of the two RNAs and their mitotic stability in the embryo are suggestive of paternal determinations in development. Their tight association with nuclear components makes somewhat unlikely that they could be involved in the classical microRNA-mediated posttranscriptional regulations. We have, on the other hand, observed that microRNAs and other small RNA molecules may act in the early embryo as epigenetic determinants of the level of gene expression. Our current way of thinking would then rather consider these paternal RNAs transferred to the embryo as actors in epigenetic developmental controls.

MATERIALS AND METHODS

Isolation of mouse sperm RNA.

Spermatozoa were collected from -70 mouse caudae epididymides of strain C57BL/6. Motile spermatozoa were washed two times in MEM buffer (ImM Na pyruvate, EDTA, Penicillin, Streptomycin, and BSA) by centrifugation. Sperm pellets were resuspended in phosphate- buffered saline (PBS), followed by centrifugation. Then the pellets were washed two times in frozen storage buffer (50mM HEPES buffer at pH 7.5, 10 mM NaCl, 5 mM Mg acetate, and 25% glycerol), then stored at -80°C. Subsequent to storage, the samples were thawed, washed twice in a somatic cell lysis buffer (0.1% sodium dodecyl sulfate (SDS) and 0.5% Triton X- 100 in H20). This produced an essentially pure population of spermatozoa (Perry et al, 1999). Nonsperm cellular contamination was checked by microscopy. Total RNA was extracted from the purified sperm using TRIzol (Invitrogen, Carlsbad, CA, USA) and Acid- Phenol: Chloroform (Ambion, Austin, TX, USA) according to the manufacturer's instructions. The concentration and integrity of the total RNA samples were evaluated using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific Inc., Wilmington, DE, USA) and a 2100-Bioanalyzer with the RNA 6000 Nano Chip (Applied Biosystems, Carlsbad, CA, USA), respectively.

Small RNA library construction and deep sequencing.

Small RNA cDNA library was generated from -0.8 μg of total RNA as previously described (Kawaji et al, 2008) but without cloning the library into a plasmid. Massively parallel pyrosequencing was performed using a 454 genome sequencer (Roche, Basel, Switzerland).

Semiquantitative poly (A) -tailed RT-PCR.

PCR-based detection of speRNAs and piRNAs was carried out with 2 μg of total RNA samples isolated from various adult mouse tissues (8-9 weeks) and testes at various ages (1-8 weeks and 12 months) and embryo (15 days), and 0.7 μg of total RNA for sperm (9 weeks). RNA was polyadenylated using poly(A) Tailing Kit (Ambion) and used to synthesize small RNA cDNA with PrimeScript II RTase (Takara Bio, Ohtsu, Shiga, Japan) and 2.5 μΜ of an RTQ primer (Ro et al, 2006). Individual RNAs were detected by PCR using AccuPrime Taq DNA SuperMix I (Invitrogen) and an RTQ-UNIr primer with gene-specific primers (Supplemental Table 3).

Microinjection of FITC- and Cy3-coupled oligo-RNA.

Oligoribonucleotides purchased from Proligo-Sigma (Sigma-Aldrich, St. Louis, MO, USA) were microinjected into the male pronuclei of embryos recovered at day 0.5pc from B6D2 Fl females, using the established methods of DNA transgenesis (Hogan et al, 1994) except for the exclusive use of naturally ovulated oocytes. The embryos were then cultured in M16 medium (Sigma-Aldrich) at 37°C. The microinjected molecules were observed over four days from the one-cell to the blastocyst stages by fluorescence microscopy (Zeiss, Oberkochen, Germany). Experiments were reproduced at least three times with a total of 10 embryos microinjected each time. For a given oligoribonucleotide, the same pattern was observed in 100% of the microinjected embryos.

Classification of small RNAs. Firstly, we aligned the small RNA sequences to the known RNA sequences retrieved from a public databases, where we accepted only complete matches, by using the nexAlign (suffix array-based alignment program). The mature and star sequences of miRNAs were downloaded from miRbase (version 15.0), RefSeq mRNA sequences were from the UCSC Table Browser, and piRNA, snoRNA, snRNA were from NONCODE (version 2). The tRNA sequences were prepared from the genome sequence with additional CCA at the 3'-end, which was based on RefSeq annotation of NCBI Build 37 (mouse). The remaining small RNA sequences, which did not match to the RNA sequences above, were aligned with the mouse genome sequence (NCBI Build 37 or mm9), and their genomic coordinates were compared with the repeat masker track in the UCSC genome browser database. The small RNA sequences were classified based on the above hits to the known RNA sequences or overlaps on the genomic coordinates.

Computational exploration of novel small RNAs in sperm. We aligned the sequenced 20 to 23 -nucleotide long small RNA sequences, which are not miRNA nor rRNA, to the genome sequence. After screening out the RNAs mapped two or more loci, we identified 39 loci as potential candidates. Putative secondary structures of their proximal regions were predicted by the RNAfold (http://rna.tbi.univie.ac.at/cgi-bin/RNAfold.cgi)¹, and the results were inspected manually to check if they were a hairpin-like structure harboring the small RNA sequence as one strand of its stem. The secondary structures of Fig. 2A and Fig. 4 were created by the mfold (http://mfold.bioinfo^i.edu/)², followed by manual edition.

Strand-specific RT-PCR. DNase-treated total RNA (0.5 μg) from adult testis and epididymis were reverse-transcribed using PrimeScript II RTase (Takara) with gene-specific RT-primers (Supplemental Table 3). piRNA precursors, protein-coding gene (β-actin), and retrotransposon (LINE 1) were amplified using PrimeSTAR GXL DNA polymerase (Takara) with gene-specific primers (Supplemental Table 3) according to the manufacturer's instructions.

Example 2; spR-12 and spR13 are nuclear transfer elements The inventors added either 3' or 5' extensions from the common spR sequence to miR-1 and miR-124 Cy3 -tagged oligoribonucleotides and checked their localization during early development. Results were identical for the two miRNA sequences.

We tested separately and together two nucleotide blocks of this region, CAGGG and UGGGCGGG. We determined that 5' addition of the UGGGCGGG motif was sufficient to promote transfer to the nucleus and insure maintenance during early development (Fig). Oligoribonucleotides including the same sequence but in 3' position were, interestingly, addressed to the nucleus but their localization was not mitotically stable. The CAGGG sequence by itself had not effect in 5' nor in 3' position and did not interfere with that of the UGGGCGG block.

Neither oligoribonucleotides with sequences complementary to spR-12 and -13, nor the double stranded structures, nor deoxyribonucleotides with the same sequences were maintained in the injected nuclei. However, chimeric molecules of oligodeoxyribonucleotides (of 20 bases) with the 5' extension with RNA motif of rUGGGCGGG were efficiently addressed to, and maintained in the nucleus.

Table 1. Zygotic transfer of speRNA-12

RNA sample Estimated copy number per cell*

Sperm 10-13

Oocyte <1

Fertilized egg 5-10

Blastocyst < 1

* TaqMan qPCR assays were performed as previously described (Grandjean et al., 2009).

Supplemental Table 1

Composition of small RNA population identified in the mouse sperm

RNA class No. of reads (%) rRNA 136362 (37.9) tRNA 24320 (6.76) sno/sc/snRNA 3078 (0.86) mRNA 2121 (0.59)

LINE/S INE/LTR 1430 (0.4) miRNA 232 (0.06) piRNA 77 (0.02)

Mapped (with any other annotation) 4882 (1.36)

Mapped (no annotation) 8507 (2.36)

Unmapped 178831 (49.7)

Total 359840 (100)

Supplemental Table 2

Novel small RNAs from the mouse sperm identified by deep-sequencing

Small RNA Sequences (5' to 3') Size (nt) No. of reads Location³ piRNA^b Stem-loop^c RT-PCR^d speRNA-1 (SEQ ID No.l) AGGAAACUGCCUCUCGGGGCAU 22 1 chrl (+) No Yes Yes

5 speRNA-2 (SEQ ID No.2) CUGACAGCAAGGCCUCUCCC 20 2 chr2 (+) No Yes Yes speRNA-3 (SEQ ID No.3) ACUCCGGGCUGCUCGGGAGCC 21 1 chr4 (-) No Yes No speRNA-4 (SEQ ID No.4) UGGGAAAGACUCUGGGUCUCCU 22 2 chr4 (+) No Yes Yes speRNA-5 (SEQ ID No.5) UGGCCUGGGCCUGGCAGUGGGC 22 1 chr6 (-) No Yes No speRNA-6 (SEQ ID No.6) UCUGCCCUUCCCUCUGGAGAGU 22 1 chr7 (+) No Yes No

10 speRNA-7 (SEQ ID No.7) GUGUGUGCGUGUGUGGGCGC 20 1 chr8 (-) No Yes Yes speRNA-8 (SEQ ID No.8) UGCCAGUGUGUGAGUGUGUG 20 1 chr8 (-) No Yes Yes speRNA-9 (SEQ ID No.9) GUGCCCAGUCAUGUCCGGGGGCC 23 1 chrlO (+) No Yes Yes speRNA-10 (SEQ ID No.10) CGUGGGACCUUAGCGUUAUGCCG 23 1 chrl 3 (+) No Yes No speRNA-11 (SEQ ID No.l l) GAACAGCCGAGUCCUUGCUGGU 22 1 chrl 3 (+) No Yes Yes

15 speRNA-12 (SEQ ID No.12) CAGGGUGGGCGGGUCAUGGGC 21 1 chrl 7 (-) Yes Yes Yes speRNA-13 (SEQ ID No.13) CAGGGUGGGGCGGGGCGUGG 20 1 chrl 7 (+) Yes Yes Yes piRNA-locus-sRNA-1 (SEQ ID No.14 UUCUCUGUGGGGUCCUGGCUGU 22 2 chr7 (+) Yes No No piRNA-locus-sRNA-2 (SEQ ID No.15) CUGGGACGGAUGGUGGGAGGGCA 23 1 chrl 7 (-) Yes No No piRNA-locus-sRNA-3 (SEQ ID No.16) ACUGAGCCUUAUCAGGGUUC 20 2 chr5 (-) Yes No No

20 "(+): plus strand, (-): minus strand.

bpiRNA: mapped in piRNA locus

cStem-loop: potential to pre-miRNA like secondary structure

dRT-PCR: validated by poly(A)-tailed RT-PCR

Supplemental Table 3 Oligonucleotides used in this study

Oligo name

(SEQ ID No. X) Sequence (5' to 3') Used for

RTQ primer (17) CGAATTCTAGAGCTCGAGGCAGGCGACATGGCTGGCTAGT polyA-RT-PCR

TAAGCTTGGTACCGAGCTCGGATCCACTAGTCC ( T ) ₂₅VN

RTQ-UNIr (18) CGAATTCTAGAGCTCGAGGCAGG polyA-RT-PCR speRNA-1 (19) AGGAAACTGCCTCTCGGGGC polyA-RT-PCR speRNA-2 (20) CTGACAGCAAGGCCTCTC polyA-RT-PCR speRNA-3 (21) ACTCCGGGCTGCTCGGGAG polyA-RT-PCR speRNA-4 (22) TGGGAAAGACTCTGGGTCTC polyA-RT-PCR speRNA-5 (23) TGGCCTGGGCCTGGCAGTGG polyA-RT-PCR speRNA-6 (24) TCTGCCCTTCCCTCTGGAGA polyA-RT-PCR speRNA-7 (25) GTGTGTGCGTGTGTGGGC polyA-RT-PCR speRNA-8 (26) TGCCAGTGTGTGAGTGTG polyA-RT-PCR speRNA-9 (27) GTGCCCAGTCATGTCCGGGGG polyA-RT-PCR speRNA-10 (28) CGTGGGACCTTAGCGTTATGC polyA-RT-PCR speRNA-11 (29) GAACAGCCGAGTCCTTGCTG polyA-RT-PCR speRNA-12 (30) CAGGGTGGGCGGGTCATGG polyA-RT-PCR speRNA-13 (31) CAGGGTGGGGCGGGGCGT polyA-RT-PCR flanking-speRNA- 12

(32) TGATAGCTGAGCTCTGAG polyA-RT-PCR flanking-speRNA- 13

(33) TGTCATTGATCCAGGCAATG polyA-RT-PCR let-7a (34) TGAGGTAGTAGGTTGTATAG polyA-RT-PCR piRNA-locus-sRNA-1

(35) TTCTCTGTGGGGTCCTGGCT polyA-RT-PCR piRNA-locus-sRNA-2

(36) CTGGGACGGATGGTGGGAGG polyA-RT-PCR piRNA-locus-sRNA-3

(37) TTACTGAGCCTTATCAGGGT polyA-RT-PCR piRNA12-F (38) CCCTCAACAAATAGTCTGTCT strand-specific RT-PCR piRNA12-R (39) TGGAAGCTTCCTTCCCTGTC strand-specific RT-PCR piRNA13-F (40) TCTCCCTTCTGTTTTCCGTG strand-specific RT-PCR piRNA13-R (41) CCCTGAGCAGTCACACTTTG strand-specific RT-PCR

LINE 1 -sense (42) AGTGCAGAGTTCTATCAGACCTTC strand-specific RT-PCR

LINE 1-antisense ( 43) TCCAGCTACTTCACCGAAGCTGT strand-specific RT-PCR beta-actin-sense (44) CCACCACAGCTGAGAGGGAA strand-specific RT-PCR beta-actin-antisense (45) AGC CAC C GAT C CACACAGAG strand-specific RT-PCR

In RTQ primer, V is A, C, or G; N is A, C, G, or T. Supplemental Table 4

Oligonucleotides used in the microinjection study

Oligo name Sequence (5' to 3') SEQ ID No.

speRNA-5R 5 ' (Cy3)-GCCC ACUGCC AGGCCC AGGCC A 46

speRNA-5 5'(FITC)-UGGCCUGGGCCUGGCAGUGGGC 47

speRNA-11 5 '(Cy3) -C AGGGUGGGGCGGGGCGUGG 48

speRNA-13 (FITC) 5 '(FITC)-C AGGGUGGGGCGGGGCGUGG 49

speRNA-13 (Cy3) 5'(Cy3)-CAGGGUGGGGCGGGGCGUGG 50

speRNA-13R 5'(FITC)-CCACGCCCCGCCCCACCCUG 51

speRNA-13DNA 5 ' (FITC)-C AGGGTGGGGCGGGGCGTGG 52

speRNA-12 5 '(Cy3) -C AGGGUGGGCGGGUC AUGGGC 53

speRNA-12R 5'(Cy3)-GCCCAUGACCCGCCCACCCUG 54

speRN A- 12DN A 5 ' (Cy3)-C AGGGTGGGCGGGTCATGGGC 55

miR-29b 5'(Cy3)-UAGCACCAUUUGAAUCAGUGUU 56

miR-29bR 5'(FITC)-AACACUGAUUCAAAUGGUGCUA 57

miR-l (FITC) 5 ' (FITC)-UGGAAUGU AAAGAAGUAUGU AU 58

miR-l (Cy3) 5 '(Cy3) -UGG A AUGU A A AG A AGU AUGU AU 59

miR-l -3'CAG 5 '(Cy3) -UGG A AUGU A A AG A AGU AUGU AUC AGGG 60

miR-l -5'CAG 5 '(Cy3) -C AGGGUGG A AUGU A A AG A AGU AUGU AU 61

miR-l -3'UGG 5'(Cy3)-UGGGCGGGUGGAAUGUAAAGAAGUAUGUAU 62

miR-l -5'UG-CA 5'(Cy3)-UGGGCGGGUGGAAUGUAAAGAAGUAUGUAUCAGGG 63

miR-l 24 (FITC) 5'(FITC)-UAAGGCACGCGGUGAAUGCC 64

miR-124 (Cy3) 5'(Cy3)-UAAGGCACGCGGUGAAUGCC 65

miR-124-3'CAG 5 '(Cy3) -U A AGGC ACGCGGUG A AUGCCC AGGG 66

miR-124-5'CAG 5 '(Cy3) -CAGGGU A AGGC ACGCGGUG A AUGCC 67

miR-124-5'UG 5'(Cy3)-UGGGCGGGUAAGGCACGCGGUGAAUGCC 68

miR-124-5'UG-CA 5'(Cy3)-UGGGCGGGUAAGGCACGCGGUGAAUGCCCAGGG 69

acca2 5'(Cy3)-CGCGGAAUAGCUGAGCUUCGCCAUGGCCCUGCUACG 70

Tsix 5 ' (Cy3)-GAAACGAGC AAAC AUGGCUGG 71

Xist 5'(FITC)-CCAGCCAUGUUUGCUCGUUUC 72

Xist 5'(FITC)-CCAGCCAUGUUUGCUCGUUUCCCGUGGAUGUGCGGU 73

Tsix 5 '(Cy3)-ACCGC AG AUCCACGGGAAACGAGC AAAC AUGGCUGG 74

AIR 5'(FITC)-GCCACCUGGGUGUGGAAGAGGUGGGACACUUUCAGU 75

SINEB25'(Cy3)-GUCCUGAGUUCAAUUCCCAGCAACCACAUGGUGGCUCACAACCAUC76

SINEB2R 5'(Cy3)-GAUGGUUGUGAGCCACCAUGUGGUUGCUGGGAAUUGAACUCAGGAC 77 speRNA-12-mut-u 5'(Cy3)-CAUUUUGGGCGGGUCAUGGGC 78

speRNA-13-mut-u 5'(Cy3)-CAUUUUGGGGCGGGGCGUGG 79

speRNA-12/29b 5 ' (Cy3)-CAGUGUUGGCGGGUC AUGGGC 80

miR-29b/pmi-12/13 5'(Cy3)-UAGCACCAUUUGAAAUCAGGGUG 81 REFERENCES

Amanai M, Brahmajosyula M, Perry AC (2006) A restricted role for sperm-borne microRNAs in mammalian fertilization. Biol Reprod 75: 877-884

Grandjean V, Gounon P, Wagner N, Martin L, Wagner KD, Bernex F, Cuzin F, Rassoulzadegan M (2009) The miR-124-Sox9 paramutation: RNA-mediated epigenetic control of embryonic and adult growth. Development 136: 3647-3655

Hogan B, Costantini F, Lacy L (1994) Manipulating the mouse embryo - a laboratory manual, Cold Spring Harbor, NY: Second edition, Cold Spring Harbor Laboratory.

Hwang HW, Wentzel EA, Mendell JT (2007) A hexanucleotide element directs microRNA nuclear import. Science 315: 97-100

Kawaji H, Nakamura M, Takahashi Y, Sandelin A, Katayama S, Fukuda S, Daub CO, Kai C, Kawai J, Yasuda J, Carninci P, Hayashizaki Y (2008) Hidden layers of human small RNAs. BMC Genomics 9: 157

Kramer JA, Krawetz SA (1997) RNA in spermatozoa: implications for the alternative haploid genome. Mol Hum Reprod 3: 473-478

Krawetz SA (2005) Paternal contribution: new insights and future challenges. Nat Rev Genet 6: 633-642

Ostermeier GC, Goodrich RJ, Moldenhauer JS, Diamond MP, Krawetz SA (2005) A suite of novel human spermatozoal RNAs. J Androl 26: 70-74

Perry AC, Wakayama T, Kishikawa H, Kasai T, Okabe M, Toyoda Y, Yanagimachi R (1999) Mammalian transgenesis by intracytoplasmic sperm injection. Science 284: 1180-1183 Rassoulzadegan M, Grandjean V, Gounon P, Vincent S, Gillot I, Cuzin F (2006) RNA- mediated non-mendelian inheritance of an epigenetic change in the mouse. Nature 441: 469- 474

Ro S, Park C, Jin J, Sanders KM, Yan W (2006) A PCR-based method for detection and quantification of small RNAs. Biochem Biophys Res Commun 351: 756-763

Tarn OH, Aravin A A, Stein P, Girard A, Murchison EP, Cheloufi S, Hodges E, Anger M, Sachidanandam R, Schultz RM, Hannon GJ (2008) Pseudogene-derived small interfering RNAs regulate gene expression in mouse oocytes. Nature 453: 534-538

Wagner KD, Wagner N, Ghanbarian H, Grandjean V, Gounon P, Cuzin F, Rassoulzadegan M (2008) RNA induction and inheritance of epigenetic cardiac hypertrophy in the mouse. Dev Cell 14: 962-969 Watanabe T, Totoki Y, Toyoda A, Kaneda M, Kuramochi-Miyagawa S, Obata Y, Chiba H, Kohara Y, Kono T, Nakano T, Surani MA, Sakaki Y, Sasaki H (2008) Endogenous siRNAs from naturally formed dsRNAs regulate transcripts in mouse oocytes. Nature 453: 539-543 Hofacker, I.L., Vienna RNA secondary structure server. Nucleic Acids Res 31, 3429-3431 (2003).

Zuker, M., Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res 31, 3406-3415 (2003).

Claims

1. An isolated nucleic acid molecule comprising sequence UGGGCGGG and/or sequence UGGGGCGGG

2. An isolated nucleic acid molecule according to claim 1, wherein said nucleic acid molecule is a ribonucleic acid molecule.

3. An isolated nucleic acid molecule according to claim 1, wherein said nucleic acid molecule is chimeric DNA/RNA molecule and wherein the sequence UGGGCGGG or UGGGGCGGG is a single-stranded ribonucleic acid.

4. An isolated nucleic acid molecule according to any one of claims 1 to 3, wherein said nucleic acid molecule has a length comprised between 8 and 500 nucleotides.

5. An isolated nucleic acid molecule according to any one of claims 1 to 4, wherein said nucleic acid molecule has a length of more than 8, preferably more than 9, even more preferably more than 10,11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 nucleotides.

6. An isolated nucleic acid molecule according to any one of claims 1 to 5, wherein said nucleic acid has a length of less than 500 nucleotides, preferably less than 200, less than 100, 50, 45, 40 nucleotides.

7. An isolated nucleic acid molecule according to any one of claims 1 to 6, wherein the sequence UGGGCGGG or UGGGGCGGG is at the 5' end.

8. An isolated nucleic acid molecule according to any one of claims 1 to 6, wherein the sequence UGGGCGGG or UGGGGCGGG is at the 3' end.

9. Use of a single-stranded ribonucleic acid moiety comprising sequence UGGGCGGG and/or sequence UGGGGCGGG for targeting a nucleic acid molecule to the nucleus of a host cell.

10. Method for targeting a nucleic acid molecule to the nucleus of a host cell comprising the step of adding a single- stranded ribonucleic acid moiety comprising UGGGCGGG and/or sequence UGGGGCGGG to said nucleic acid molecule.

11. Method according to claim 10, wherein said nucleic acid molecule is a regulatory RNA and/or a therapeutic RNA and/or a DNA or RNA involved in recombination and/or mutagenesis.

12. Method for obtaining an epigenetic regulation comprising introducing a nucleic acid according to claims 1 to 8 into a fertilized egg.

13. Method for obtaining DNA recombination and/or mutagenesis comprising the step of introducing into a cell a nucleic acid molecule which is capable of provoking changes in the DNA sequence, such as DNA or RNA molecules involved in recombination and/or mutagenesis, wherein said nucleic acid molecule contains a single-stranded ribonucleic acid moiety comprising sequence UGGGCGGG and/or sequence UGGGGCGGG.