WO2012121429A1 - 암 세포 바이오 마커를 동정하는 방법 및 상기 방법으로 동정한 nmd-무관 암 세포 바이오 마커 - Google Patents
암 세포 바이오 마커를 동정하는 방법 및 상기 방법으로 동정한 nmd-무관 암 세포 바이오 마커 Download PDFInfo
- Publication number
- WO2012121429A1 WO2012121429A1 PCT/KR2011/001558 KR2011001558W WO2012121429A1 WO 2012121429 A1 WO2012121429 A1 WO 2012121429A1 KR 2011001558 W KR2011001558 W KR 2011001558W WO 2012121429 A1 WO2012121429 A1 WO 2012121429A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cancer
- genes
- cancer cell
- cancer cells
- present
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Definitions
- the present invention relates to a method for identifying a cancer cell biomarker and an NMD-independent cancer cell biomarker identified by the method.
- Microserrit is a sequence of DNA that repeats a specific base, and every individual has a different length, but everyone has a microserrit. It is common and normal to repeat a particular sequence several times. However, if a problem occurs in the DNA repair system, the length of the microserite may be abnormally shortened or lengthened, which may cause various problems. For example, such an unstable state of microserite is known as an important factor in cancers such as colorectal cancer, uterine cancer, ovarian cancer and stomach cancer.
- MSI-H microsatellite instability
- MMR DNA nucleotide mismatch repair
- the mechanism of tumorigenesis in MSI-H tumors is thought to be involved in the frameshift mutation of the microseret repeat sequence within the coding region of the affected genes, and inactivation of these genes is directly involved in tumor development and progression. It is thought to be involved [5, 6].
- the frameshift mutation can produce abnormal mRNAs and proteins, and thus tumor specific antigens can be produced.
- the inventors have described a novel biotechnologically simple and accurate method for cancer cells. Efforts have been made to develop a method for identifying markers, and as a result, the present invention has been completed by identifying a large amount of genes present in a frame shift mutation state in cancer cells at one time.
- Another object of the present invention is to provide a biomarker for cancer cells identified by the above method.
- Another object of the present invention to provide a kit for diagnosing cancer comprising the biomarker.
- Another object of the present invention is to provide a method for screening a cancer therapeutic agent.
- Still another object of the present invention is to provide a method for preventing or treating cancer, comprising administering the pharmaceutical composition to a subject in need.
- the present invention provides a biomarker identification method for cancer cells, comprising the following steps:
- the first screening step of the present invention in order to identify biomarkers by selecting genes having a certain number of mononucleotide repeats in a human gene, selecting a gene having 9 or more mononucleotide repeats is selected. desirable. Frame shift mutations can easily occur when there are nine or more mononucleotide repeats.
- a database providing a list of genes of humans may be used for the above range setting.
- An example of such a database is
- SelTarbase (w. Seltarbase.org).
- SelTarbase provides information on all human genes, which allows for simple and accurate selection of genes with more than nine mononucleotide repeats.
- the repetition of the mononucleotide in the primary screened gene is in the coding region, and the immature stop codon is in the last exon or within 55 bp upstream from the last axon binding region. Screening.
- Nonsense mRNAs resulting from frameshift mutations are well degraded by nonsense-mediated mRNA decay (NMD), which avoids the adverse effects associated with the production of truncated proteins.
- NMD nonsense-mediated mRNA decay
- the immature stop codon is at the last exon or is within 55 bp upstream from the last exon binding site, it is not recognized by VIII, so some NMD-functional mRNAs may escape from NMD. If the nonsense mRNA is not destroyed by NMD and the protein is expressed, it causes a disease such as cancer in the human body.
- Range of genes that can be biomarkers for cancer cells by repeating mononucleotides in the coding region and by selecting genes where the immature stop codon is at the last axon or within 55 bp upstream from the last exon junction Can be set narrower.
- the method of determining the location of immature stop codons can be by conventional methods known in molecular biology and related art. For example, an open reading frame, an axon junction site, a start codon and a stop codon may be selected using a VectorNTI software or NCBI database to select only genes that satisfy the criteria.
- the biomarker identification method for the cancer cells is that the gene selected in the second screening step after the second screening step is actually present in the frame shift mutation state in the microserial unstable cancer cells It further comprises the step of checking.
- Cancer cells capable of confirming whether the gene selected in the second screening step is present in a frame shift mutation state can be used without limitation as long as the cancer cells are known to have microserit instability, and preferably colon cancer cells and uterine cancer cells.
- it may be more preferably one selected from the group consisting of colon cancer cells uterine cancer cells, ovarian cancer cells and gastric cancer cells.
- the method for confirming whether the candidate gene selected in the second screening step exists in a frame shift mutation state may be used without limitation as long as it is a method commonly used in molecular biology and related arts, and preferably, isotope PCR It is available.
- the biomarker identification method for cancer cells further comprises the step of identifying mRNA or polypeptide produced from the second screened gene. If a gene is found, Identification of mRNA markers and peptide markers can be readily performed by methods commonly used in the field of molecular biology and the related art.
- the present invention provides a novel nucleotide sequence corresponding to SEQ ID NO: 1 to 49, identified using the biomarker identification method for the cancer cells.
- the nucleotide sequence is the nucleotide sequence of the gene in which the frame shift mutation occurred, and when the sequence is expressed, cancer cell specific mRNA and protein are generated.
- the amino acid sequence of the protein encoded by the nucleotide sequence is an amino acid sequence described in SEQ ID NO: 50 to 95.
- the cancer cell specific protein protein comprising an amino acid sequence selected from the group consisting of the novel nucleotides corresponding to SEQ ID NO: 1 to 49 or the amino acid sequence described in SEQ ID NO: 50 to 95 is a colon cancer cell specific Can be used as an enemy marker.
- the present invention provides a kit for diagnosing cancer comprising an antibody or peptide 3 ⁇ 4 tammer that specifically binds to the cancer cell-specific protein and a primer or probe that specifically binds to the novel nucleotide sequence. It provides a kit for diagnosing cancer.
- the antibody included in the cancer diagnostic kit may be prepared as a polyclonal antibody or a monoclonal antibody, preferably a monoclonal antibody.
- Antibodies that specifically bind to the cancer cell specific protein are methods commonly practiced in the art, such as fusion methods (Kohler and Mil stein, European Journal of Immunology, 6: 511-519 (1976)), Recombinant DNA methods (US Pat. No. 4, 816, 56) or phage antibody library methods (Clackson et al, Nature, 352: 624-628 (1991) and Marks et al, J. Mo I. Biol., 222: 58 1-597 (1991). General procedures for antibody preparation are described in Harlow, E.
- the polyclonal antibody is injected into a suitable animal by injecting a cancer cell specific protein, ie, an antigen, comprising an amino acid sequence selected from the group consisting of the amino acid sequences set forth in SEQ ID NOs 50-82, and collecting antisera from the animals.
- a cancer cell specific protein ie, an antigen
- the antibody can then be obtained by separating the antibody from the antiserum using known affinity techniques.
- the aptamer of the present invention included in the kit for diagnosing cancer specifically binds to a protein including an amino acid sequence selected from the group consisting of amino acid sequences set forth in SEQ ID NOs 50-95, and has a peptide structure.
- peptide refers to a linear or cyclic, preferably linear, molecule formed by binding amino acid residues to each other by peptide bonds.
- Peptides of the invention can be prepared according to chemical synthesis methods known in the art, in particular solid-phase synthesis techniques (Merri field, J. Amer. Che. Soc. 85: 2149-54 (1963). Stewart, et al., Solid Phase Peptide Synthesis, 2nd.ed., Pierce Chem. Co .: Rockford, 111 (1984)).
- the probe or primer used in the cancer diagnostic kit of the present invention has a sequence complementary to a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to 49. Terminology herein
- complementary is meant to have a degree of complementarity that can be selectively hybridized to the nucleotide sequence of the frame shift gene described in SEQ ID NOS: 1-49, under certain specific homogenization or annealing conditions.
- the term “complementary” has a different meaning from the term perfectly complementary, and the primers or probes of the present invention may selectively hybridize to the nucleotide sequence of the genes described in SEQ ID NOS: 1 to 49. Come To the degree it may have one or more mismatch sequences.
- the term “probe” refers to a linear oligomer of natural or modified monomers or linkages, includes deoxyribonucleotides and ribonucleotides, and can specifically hybridize to a target nucleotide sequence, It is either naturally present or artificially synthesized.
- the probe of the present invention is preferably single chain.
- the probe is an oligodioxyribonucleotide.
- Probes of the invention can include naturally occurring dNMPs (ie, dAMP, dGMP, dCMP and dTMP), nucleotide analogues or derivatives.
- the probe of the present invention may also include ribonucleotides.
- the probes of the present invention may be selected from the group consisting of backbone modified nucleotides such as peptide nucleic acids (PNA) (M. Egholm et al., Nature, 365: 566-568 (1993)), phosphorothioate DNA, phosphorodithioate DNA Phosphoroamidate DNA, amide-linked DNA, I-linked DNA, 2'-0-methyl RNA, alpha -DNA and methylphosphonate DNA, sugar modified nucleotides such as 2'-0-methyl RNA, DNA 2'-fluoro RNA, 2'-amino RNA, 2'-0-alkyl DNA, 2'_0-allyl DNA, 2'-alkylyl DNA, nuclear source DNA, pyranosyl RNA and anhydronucleocytosis And nucleotides having base modifications such as C-5 substituted pyrimidines (substituents are fluoro-, bromo-, chloro-, iodo-
- primer refers to a single that can serve as an initiation point for template-directed DNA synthesis under suitable conditions (ie, four different nucleoside triphosphates and polymerases) in a suitable complete solution at a suitable temperature. -Refers to stranded oligonucleotides. Suitable lengths of primers are typically 15-30 nucleotides, although varying with various factors, such as temperature and the use of the primer. Short primer molecules generally require lower temperatures to form a stable complex with the complex.
- the sequence of the primer does not need to have a sequence that is completely complementary to some sequences of the template, and is sufficient if it has sufficient complementarity within a range that can be hybridized with the template to perform a primer-specific function. Therefore, the primer in the present invention does not need to have a sequence that is perfectly complementary to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1 to 49 as a template, and can be hybridized to the gene sequence to act as a primer. If there is a complementary complement within the range it is divided.
- the invention provides a method for screening a cancer therapeutic agent comprising the following steps:
- the present invention is (a) a pharmaceutically effective amount of an antibody or peptide aptamer specifically binding to the cancer cell specific protein; And (b) provides a pharmaceutical composition for preventing or treating cancer comprising a pharmaceutically acceptable carrier.
- the present invention provides a method for preventing or treating cancer, comprising administering the pharmaceutical composition to a subject in need.
- treatment refers to alleviation of symptoms, reduction in the extent of disease, maintenance of disease that does not worsen, delay of disease progression, improvement or alleviation of disease state (pal hat ion), partial or complete remission. Include. Treatment can also mean increased survival compared to the expected survival if untreated. Treatment includes simultaneously prophylactic measures in addition to therapeutic means. Cases in need of treatment include those already with the disease and cases in which the disease should be prevented. Alleviation of a disease is when the clinical manifestations of the undesired disease are delayed or the progress of the disease is delayed or prolonged compared to the untreated situation.
- the pharmaceutical composition of the present invention may further comprise a pharmaceutically acceptable carrier.
- a pharmaceutically acceptable carrier refers to a cell or human exposed to the composition, which is not toxic.
- the carrier may be used without limitation as long as it is known in the art as a buffer, preservative, analgesic, solubilizer, isotonic agent, stabilizer, base, excipient lubricant, preservative.
- compositions of the present invention can be prepared according to techniques commonly used in the form of various formulations.
- injectables can be prepared in the form of unit dose ampoules or multiple dose inclusions.
- the formulations may be in the form of solutions, suspensions, syrups or emulsions of oil or aqueous medium, or may be in the form of axes, powders, granule powders, granules, tablets, or voxels, and may further comprise dispersants or stabilizers.
- dispersants or stabilizers for a general principle of the pharmaceutical formulation of the pharmaceutical composition according to the present invention, reference can be made to several documents (W. Sheridan and G.
- Suitable dosages of the pharmaceutical compositions of the present invention may vary depending on factors such as the formulation method, mode of administration, age, weight, sex, morbidity, food, time of administration, route of administration, rate of excretion and reaction in response to the patient. It may be prescribed. Preferred dosages of the pharmaceutical compositions of the invention may be administered at 0.001 mg / kg body weight to 500 rag / kg body weight on an adult basis.
- the pharmaceutical composition of the present invention is colon cancer, uterine cancer, ovarian cancer, gastric cancer, brain tumor, It can be used as a prophylactic and therapeutic agent for cancer selected from the group consisting of laryngeal cancer, breast cancer, lung cancer, esophageal cancer, liver cancer, pancreatic cancer, gallbladder cancer, prostate cancer, bladder cancer, childhood cancer and skin cancer.
- the present invention is a biomarker identification method for cancer cells, a biomarker for cancer cells identified by the method, a kit for cancer diagnosis comprising the biomarker, a screening method of cancer therapeutic agents and cancer specific proteins It provides a pharmaceutical composition for preventing or treating cancer, comprising a pharmaceutically effective amount of an antibody or peptide 3 ⁇ 4tammer binding to.
- the biomarker identification method for cancer cells of the present invention is a method of screening genes that are well mutated through bioinformatics technology, rather than testing individual genes individually to test their potential as biomarkers. By using, it is possible to identify a plurality of biomarkers very easily and accurately.
- the present invention also provides a novel NMD-independent cancer cell biomarker identified using the above method, thereby providing a kit for cancer diagnosis, a screening method for a cancer therapeutic agent and a medicament for preventing or treating cancer using the novel marker. Provides basic data on pharmaceutical compositions.
- 1 is a 6% polyacrylamide gel electrophoresis result of the amplified DNA product obtained by PCR using a primer prepared based on sequence information of the AIM2 gene.
- FIG. 26 shows Western blotting results for AIM2 protein.
- SelTarbase (www. Seltarbase.org) is a database that provides a list of all human genes with mononucleotide repeats. In this Seltarbase all genes in humans with at least 9 mononucleotide repeats (eg 9 or more repeats regardless of A, C, G and T) were found. 447 genes were found. Among the 447 genes, they included a wide variety of genes, from relatively well-known to little-known genes.
- Only immature stop codons were found in the last exon or within 55 bp in the direction of the start codon at the last exon binding (ie, within 55 bp upstream from the last axon binding).
- all of the 447 genes were selected using the VectorNTI software (Invitrogen) and NCBI database to display only the open reading frame, the axon junction site, the start codon and the end codon. It was a dog. Of the 66 genes, 15 previously reported mononucleotide repeats, but not reported. There were 51 things that were not.
- MSI-H high microsatellite instability
- MSS microsatellite stability
- the primer to be used for PCR is based on the information of the AIM2 gene obtained from SelTarbase, and the Primer 3 program (http: //frodo.wi .mit .edu / primer3 /) or
- ⁇ 3 Made using the Blast program (NCBI). Specifically, the sequence of the prepared primer is as follows:
- Reverse Primer TTGGCTTGMTTGGTCCTTT. 2 genome DNA obtained from each colorectal cancer cell line of Table 1 (50 l ⁇ ), 2 ⁇ 10x Gold Taq complete solution (Applied Biosystem), 1.2 25 mM MgCl 2 (Appl ied Biosystem), 2/10 mM dNTP (Ap lied Biosystem), 2 ⁇ 20 pM primer, 0.2 ⁇ Alpha P-32 (BMS), 0.2 ⁇ 1000 U Gold ⁇ (Applied Biosystem) and 10.6 ⁇ distilled water. PCR cycles were performed. At this time, the length of the PCR product was mostly adjusted to about 100 bp, and the isotope used was a -P 32 (BMS). PCR temperature conditions were set as follows: 30 cycles of 95 ° C. 10 minutes, 95 ° C. 30 seconds, 55 ° C. 30 seconds and 72 ° C. 30 seconds and then 72 ° C. 10 minutes.
- This isotope-PCR can also distinguish 1 bp of difference.
- 6% polyacrylamide gel electrophoresis was performed on the amplified DNA product. Each line (1-12) of the gel was loaded with the PCR amplified DNA product of the colorectal cancer cell line of Table 1, and electrophoresis was performed, and the results are shown in FIG. 1.
- primers prepared based on sequence information of each of TCF7L2, TRIM59, GBP3, GAFA1, KCTD16, IN080E, FBXL3, and KIAA2018 genes were used.
- FIGS. 2-25 Experimental results of Examples 2-25 after the electrophoresis method are shown in FIGS. 2-25.
- Figure 2-25 it can be seen that the frame shift mutation of each gene in the experimental group MSI-H colorectal cancer cells.
- the nucleotide sequence of each specific frame shift mutant gene is listed in SEQ ID NO: 4 to 49.
- the result of Example 1-25 was put together, and it was summarized in Table 3 below.
- Example 2 ASTE1 + 1 / W -1 / W + 1 / + 1 / W + 1 / W 2 ⁇ 2 -2 / -3 W — 2 / -3 W w
- Example 9 RGS22 WWW -1 / WW -1 / WWWWWWww
- Example 10 FLT3LG WWWW + 1 / WW + 1 / W + 1 / WW + 1 / WW w
- Example 11 ASH1L WWWWW -1 / -1 -1 /- 1 -1 / WWW w
- Example 12 MED8 WWW -1 / W -2 / WW -1 / W -1 / WWW w
- Example 13 ⁇ W -1 / WW -1 / WW -2 — 2 / W -2 / W + 1 / -2 W w
- Example 14 SLAMF1 W -1 / WW One 1 / WWWWW -1 / W -1 / WW w
- Example 15 L0C100127950 WWW -1 / W -1 / WW + 1 / W -1 / W -1 / WW w
- Example 16 SFRS12IP1 WWWW -1 / -2 W + 1
- Example 22 CTD16 W -1 / WWW -1 / WW -1 / W -1 / W -1 / WW w
- Example 23 ⁇ 080 ⁇ -1 / WW -1 / W -1 / -1 One 1 / -1 -II --1 / W — 1 / W -1 / -1 / WW w
- Example 24 FBXL3 W W W w w w w w w w w w
- Examples 26-31 Confirmation of the potential of six genes, including CIRl, as a colorectal cancer marker
- Example 2 The same procedure as in Example 1 was performed except that primers prepared based on sequence information of each of CIR1, HOXAll, L0C643677, RXFP2, ERCC5, and L0C100128175 genes were used.
- MSI colorectal cancer cell lines used for isotope PCR when Western blot was performed using the purchased antibodies (anti-AIM2, anti-TTK).
- anti-AIM2, anti-TTK purchased antibodies
- each MSS cell line which was selected as a control line and used as a control, one of four colon cancer cell lines was used.
- SNUC4 wild type was selected as the normal type, DLDl (-1 / w) as the hetero mutation, LoVo (-1 / l) as the homo mutation, and WiDr (wild type) as the control cell line.
- the reason for the treatment with MG132 (proteasome inhibitor) is to prevent the breakdown of the mutant protein by the proteasome.
- the normal type is DLD1 (wild type)
- the heterologous mutation is HCT116 (-lAv)
- homo SNIC4 (+ l / -2) was selected as a mutation
- WiDr wild type
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
본 발명은 암 세포에 대한 바이오 마커 동정 방법, 상기 방법으로 동정된 암 세포에 대한 바이오 마커, 상기 바이오 마커를 포함하는 암 진단용 키트, 암 치료제의 스크리닝 방법 및 암특이적 단백질에 특이적으로 결합하는 항체 또는 펩타이드 앱타머의 약제학적 유효량을 포함하는 암 예방 또는 치료용 약제학적 조성물을 제공한다. 본 발명의 암 세포에 대한 바이오 마커 동정 방법은 유전자 개개를 일일이 검사하여 바이오 마커로서의 가능성을 시험하는 것이 아니라, 생물정보학 기술을 통해 돌연변이가 잘 발생하는 유전자들을 2차에 걸쳐 스크리닝 하는 방법을 사용하므로, 매우 간편하면서도 정확하게 다수의 바이오 마커를 동정할 수 있다.
Description
【명세서】
【발명의 명칭】
암 세포 바이오 마커를 동정하는 방법 및 상기 방법으로 동정한 NMD- 무관 암세포 바이오 마커
【기술분야】
본 발명은 암 세포 바이오 마커를 동정하는 방법 및 상기 방법으로 동정한 NMD-무관 암 세포 바이오 마커에 관한 것이다.
【배경기술】
마이크로세를리트란 특정 염기가 반복된 DNA의 서열을 말하며 개인마다 그 길이는 다르지만 누구나 마이크로세를리트를 가지고 있다. 이와 같이 특정 염기 서열이 여러 번 반복되는 것은 흔하고 정상적인 것이다. 그러나, DNA 리페어 시스템에 문제가 생기는 경우 마이크로세를리트의 길이가 비정상적으로 짧아지거나 길어질 수 있으며, 이로 인해 다양한 문제들이 발생할 수 있다. 예를 들어, 이와 같은 마이크로세를리트의 불안정한 상태는 대장암, 자궁암, 난소암 및 위암 등 암에 있어서 중요한요소로 알려져 있다.
대장암종의 한 세트는 고 -마이크로세틀리트 불안정성 (high microsatellite instability: MSI-H)을 나타낸다 [1]. 구체적으로 MSI 경로는 DNA 뉴클레오타이드 미스매치 리페어 (MMR)에 관여하는 유전자들의 한 유전자가 불활성됨으로써 촉발되며, 이는 반복성 및 비-반복성 DNA 서열에서 과도한 돌연변이를 유발한다 [2-4]. MSI-H종양에서 종양발생의 기전에는, 영향을 받은 유전자들의 코딩 부위 내에서 있는 마이크로세를리트 반복 서열의 프레임쉬프트 변이가 관여하는 것으로 판단되며, 상기 유전자들의 불활성화는 종양 발생 및 진행에 직접적으로 관여하는 것으로 판단된다 [5, 6]. 상기 프레임쉬프트 돌연변이는 비정상적인 mRNAs 및 단백질을 생성시킬 수 있고, 따라서 종양 특이적 항원이 생성될 수 있다. MSI-H 종양에서 높은 암주변 림프구 침윤 및 우수한 예후가 있다는 사실이 발표되었다 [7, 8].
프레임쉬프트 돌연변이의 중요한 결과 중 하나는 미성숙 종결 코돈 (premature termination codons: PTCs)이 형성되는 것이다. 포유동물 세포에서, 넌센스 돌연변이 또는 프레임쉬프트 돌연변이에 의한 PTC를 포함하는 mRNAs는 넌센스 -중재 mRNA 파괴 (nonsense-mediated mRNA decay: NMD)에 의해 잘 분해되며, 이는 절단 단백질의 생성과 관련된 나쁜 영향을 피할 수 있도록 한다 [9, 10]. PTCs가 있는 mRNAs의 MD는 마지막 엑손 -엑손 연결부에 대한 PTC의 위치에 의해 PTC가 인지되는 기전에 의해 중재된다. 일반적으로, 마지막 엑손 -엑손 연결부의 업스트림으로부터 55 뉴클레오타이드 이상 이격된 PTC를 포함하는 포유동물 전사체는 NMD 작용을 받는다 (NMD-민감성 )[11-13].
프레임쉬프트 돌연변이 -유래 mRNA에서의 PTC 형성 및 NMD에 의한 이들의 파쇄는 널리 수용되고 있지만, 마지막 액손ᅳ액손 연결부에서 55 뉴클레오타이드 이내에 위치해 있거나 또는 다운스트림에 위치해 있는 PTCs는 NMD에 의해 인식되지 않으며 (NMD-무관성), 어떠한 NMD-작용성 mRNAs는 NMD로부터 벗어날 수 있다 (NMD-탈출) [14, 15]. MSI-H 종양에서, 몇 개의 NMD-민감성 및 NMD-탈출 PTC-포함 mRNA가 보고된 바 있다. 앞선 연구는, 돌연변이 상태에 따라 다양한 세포주의 영향 받은 유전자들의 총 mRNAs를 비교 하였다 [16]· 그러나, 이 연구는 야생형 및 변이형 mRNAs 사이에서의 차이에 대한 결과는 보고하고 있지 않으며, 영향을 받은 유전자들의 mRNA 양이 세포주에 따라 변화가 있을 수 있다는 것을 언급하고 있지 않다. 또한, NMD-탈출 PTC-포함 mRNAs의 발현 상태 및 생물학적 영향은 아직도 규명되어 있지 않다. 본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
【발명의 상세한 설명】
【기술적 과제】
본 발명자들은 간단하고도 정확하게 암 세포에 대한 신규한 바이오
마커를 동정하는 방법을 개발하기 위하여 예의 연구 노력하였고 그 결과 암세포 내 프레임 쉬프트 돌연변이 상태로 존재하는 유전자를 한 번에 다량으로 동정해 냄으로써, 본 발명을 완성하게 되었다.
따라서 본 발명의 목적은 암 세포에 대한 바이오 마커 동정 방법을 제공하는 데 있다.
본 발명의 다른 목적은 상기 방법으로 동정된 암 세포에 대한 바이오 마커를 제공하는 데 있다.
본 발명의 또 다른 목적은 상기 바이오 마커를 포함하는 암 진단용 키트를 제공하는 데 있다.
본 발명의 또 다른 목적은 암 치료제의 스크리닝 방법을 제공하는 데 있다.
본 발명의 또 다른 목적은 암특이적 단백질에 특이적으로 결합하는 항체 또는 펩타이드 ¾타머의 약제학적 유효량을 포함하는 암 예방 또는 치료용 약제학적 조성물을 제공하는 데 있다.
본 발명의 또 다른 목적은 상기 약제학적 조성물을 필요로 하는 대상 (Subject)에게 투여하는 단계를 포함하는 암의 예방 또는 치료방법을 제공하는데 있다, 본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 보다 명확하게 된다.
【기술적 해결방법】
본 발명의 일 양태에 따르면, 본 발명은 다음 단계를 포함하는 암 세포에 대한 바이오 마커 동정 방법을 제공한다:
(a) 9개 이상의 모노뉴클레오타이드 반복을 갖는 유전자를 선별하는 제 1차스크리닝 단계 ; 및
(b) 상기 제 1차 스크리닝된 유전자 중 모노뉴클레오다이드의 반복이 코딩지역에 있고, 미성숙 종결코돈이 마지막 액손에 있거나 또는 마지막 엑손 결합부에서 업스트림 쪽으로 55 bp 이내에 있는 유전자를 선별하는 제 2차
스크리닝 단겨). 본 발명자들은 간단하고도 정확하게 암 세포에 대한 신규한 바이오 마커를 동정하는 방법을 개발하기 위하여 예의 연구 노력하였고 그 결과 암세포 내 프레임 쉬프트 돌연변이 상태로 존재하는 유전자를 한 번에 다량으로 동정해 냄으로써, 본 발명을 완성하게 되었다.
본 발명의 제 1차 스크리닝 단계에서는, 인간의 유전자에서 일정 개수이상의 모노뉴클레오타이드 반복을 갖는 유전자를 선별하여 바이오 마커를 동정하기 위한 범위를 설정하는데, 9개 이상의 모노뉴클레오타이드 반복을 갖는 유전자를 선별하는 것이 바람직하다. 모노뉴클레오타이드 반복이 9개 이상인 경우 프레임 쉬프트 돌연변이가 용이하게 일어날 수 있다.
상기 범위 설정을 위하여 인간의 유전자 목록을 제공하는 데이터베이스를 이용할 수 있으며, 이러한 데이터베이스의 예로는
SelTarbase(w . seltarbase.org)가 있다. SelTarbase는 인간의 모든 유전자에 대한 정보를 제공하며, 이를 이용하면 9개 이상의 모노뉴클레오타이드 반복을 갖는 유전자를 간편하고도 정확하게 선별할수 있다. 본 발명의 제 2차 스크리닝 단계에서는 제 1차 스크리닝된 유전자 중 모노뉴클레오다이드의 반복이 코딩지역에 있고, 미성숙 종결코돈이 마지막 엑손에 있거나 또는 마지막 액손 결합부에서 업스트림 쪽으로 55 bp 이내에 있는 유전자를 선별한다.
프레임쉬프트 돌연변이의 결과 발생하는 넌센스 mRNAs는 넌센스 -중재 mRNA 파괴 (nonsense-mediated mRNA decay: NMD)에 의해 잘 분해되며, 이는 절단 단백질의 생성과 관련된 나쁜 영향을 피할 수 있도톡 한다. 그러나, 미성숙 종결코돈이 마지막 엑손에 있거나 또는 마지막 엑손 결합부에서 업스트림 쪽으로 55 bp 이내에 있는 경우에는 匪 D에 의해 인식되지 않으며, 따라서 어떠한 NMD- 작용성 mRNAs는 NMD로부터 벗어날 수 있다. 이러한 넌센스 mRNA가 NMD에 의해 파괴되지 않고 단백질이 발현되는 경우 인체에 암과 같은 질병을 일으키게 된다. 따라서, 제 2차 스크리닝 단계에서는 제 1차 스크리닝된 유전자 중
모노뉴클레오다이드의 반복이 코딩지역에 있고, 미성숙 종결코돈이 마지막 액손에 있거나 또는 마지막 엑손 결합부에서 업스트림 쪽으로 55 bp 이내에 있는 유전자를 선별함으로써, 암세포에 대한 바이오 마커가 될 수 있는 유전자의 범위를 더욱 좁게 설정할 수 있다.
미성숙 종결코돈의 위치를 확인하는 방법은 분자생물학 및 관련 분야에서 알려진 통상적인 방법에 의할 수 있다. 예컨대, VectorNTI 소프트웨어 또는 NCBI 데이터베이스를 이용해 오픈리딩프레임과 액손접합부위, 시작코돈 및 종결코돈을 모두 표시하여 기준을 만족하는 유전자만을 선택하는 방법을 사용할 수 있다. 본 발명의 일 구현예에서, 상기 암 세포에 대한 바이오 마커 동정 방법은 상기 제 2차 스크리닝 단계 이후에 제 2차 스크리닝 단계에서 선별된 유전자가 실제로 마이크로세를리트 불안정 암세포 내 프레임 쉬프트 돌연변이 상태로 존재하는지를 확인하는 단계를 추가적으로 포함한다. 상기 제 2차 스크리닝 단계에서 선별된 유전자가 프레임 쉬프트 돌연변이 상태로 존재하는지 확인 할 수 있는 암세포는 마이크로세를리트 불안정성을 지닌 것으로 알려진 암세포라면 아무 제한 없이 사용할 수 있으며, 바람직하게는 대장암세포, 자궁암세포, 난소암세포, 위암세포, 뇌종양세포, 후두암세포, 유방암세포, 폐암세포, 식도암세포, 간암세포, 췌장암세포, 담낭암세포, 전립선암세포, 방광암세포, 소아암세포 및 피부암세포로 이투어진 군으로부터 선택되는 하나일 수 있으며, 더 바람직하게는 대장암세포 자궁암세포, 난소암세포 및 위암세포로 이루어진 군으로부터 선택되는 하나일 수 있다. 상기 제 2차 스크리닝 단계에서 선별된 후보 유전자가 프레임 쉬프트 돌연변이 상태로 존재하는지 확인하는 방법은 분자생물학 및 관련 기술 분야에서 통상적으로 사용되는 방법이라면 제한 없이 사용될 수 있으며, 바람직하게는 동위원소 PCR 방법을 이용할 수 있다. 본 발명의 다른 구현예에서, 상기 암 세포에 대한 바이오 마커 동정 방법은 상기 제 2차 스크리닝된 유전자로부터 생성되는 mRNA또는 폴리펩타이드를 동정하는 단계를 추가적으로 포함한다. 유전자가 밝혀진 경우 이를 기초로
하여 mRNA 마커 및 펩타이드 마커를 동정하는 것은 분자생물학 및 관련 기술 분야에서 통상적으로 쓰이는 방법에 의해 용이하게 수행될 수 있다. 본 발명의 다른 양태에 따르면, 본 발명은 상기 암 세포에 대한 바이오 마커 동정 방법을 사용하여 동정한, 서열목록 제 1서열 내지 제 49서열에 해당하는 신규한뉴클레오타이드 서열을 제공한다.
상기 뉴클레오타이드 서열은 프레임 쉬프트 돌연변이가 발생한 유전자의 뉴클레오타이드 서열이며, 상기 서열이 발현되는 경우 암세포 특이적 mRNA 및 단백질이 생성된다.
일 구현예에서, 상기 뉴클레오타이드 서열이 인코딩하고 있는 단백질의 아미노산 서열은 서열목록 제 50서열 내지 제 95서열에 기재된 아미노산서열이다. 상기 서열목록 제 1서열 내지 제 49서열에 해당하는 신규한 뉴클레오타이드 또는 서열목록 제 50서열 내지 제 95서열에 기재된 아미노산 서열로 구성된 군으로부터 선택되는 아미노산 서열을 포함하는 암세포 특이적 단백질단백질은 대장암세포 특이적 마커로서 사용될 수 있다. 본 발명의 또 다른 양태에 따르면, 본 발명은 상기 암세포 특이적 단백질에 특이적으로 결합하는 항체 또는 펩타이드 ¾타머를 포함하는 암 진단용 키트 및 상기 신규한 뉴클레오타이드 서열에 특이적으로 결합하는 프라이머 또는 프로브를 포함하는 암 진단용 키트를 제공한다.
상기 암 진단용 키트에 포함되는 항체는 폴리클론 항체 또는 단일클론 항체로 제조될 수 있으며, 바람직하게는 단일클론 항체이다. 상기 암세포 특이적 단백질에 특이적으로 결합하는 항체는 당업계에서 통상적으로 실시되는 방법들, 예를 들어, 융합 방법 (Kohler and Mil stein, European Journal of Immunology, 6:511-519(1976)), 재조합 DNA 방법 (미국 특허 제 4, 816, 56호) 또는 파아지 항체 라이브러리 방법 (Clackson et al , Nature, 352:624-628(1991) 및 Marks et al , J. Mo I. Biol. , 222:58, 1-597(1991))에 의해 제조될 수 있다. 항체 제조에 대한 일반적인 과정은 Harlow, E. and Lane, D. , Using Antibodies: A Laboratory Manual, Cold Spring Harbor Press, New York, 1999; Zola, H. ,
Monoclonal Antibodies: A Manual of Techniques, CRC Press, Inc., Boca Raton, Florida, 1984; 및 Coligan , CURRENT PROTOCOLS IN IMMUNOLOGY, Wiley/Greene, NY, 1991에 상세하게 기재되어 있으며, 상기 문헌들은 본 명세서에 참조로서 삽입된다. 예를 들어, 단일클론 항체를 생산하는 하이브리도마 세포의 제조는 불사멸화 세포주를 항체 -생산 림프구와 융합시켜 이루어지며, 이 과정에 필요한 기술은 당업자에게 잘 알려져 있으며 용이하게 실시할 수 있다. 폴리클로날 항체는 서열목록 제 50서열 내지 제 82서열에 기재된 아미노산 서열로 구성된 군으로부터 선택되는 아미노산 서열을 포함하는 암세포 특이적 단백질, 즉 항원을 적합한 동물에게 주사하고, 이 동물로부터 항혈청을 수집한 다음, 공지의 친화성 (affinity) 기술을 이용하여 항혈청으로부터 항체를 분리하여 얻을 수 있다.
상기 암 진단용 키트에 포함되는 본 발명의 앱타머는 서열목록 제 50서열 내지 제 95서열에 기재된 아미노산 서열로 구성된 군으로부터 선택되는 아미노산 서열을 포함하는 단백질에 특이적으로 결합하며, 펩타이드 구조를 갖는다. 본 명세서에서 용어 "펩타이드" 는 펩타이드 결합에 의해 아미노산 잔기들이 서로 결합되어 형성된 선형 또는 환형, 바람직하게는 선형의 분자를 의미한다. 본 발명의 펩타이드는 당업계에 공지된 화학적 합성 방법, 특히 고상 합성 기술 (solid-phase synthesis techniques)에 따라 제조될 수 있다 (Merri field, J . Amer. Che . Soc. 85:2149-54(1963); Stewart, et al. , Solid Phase Peptide Synthesis, 2nd. ed. , Pierce Chem. Co.: Rockford, 111(1984)).
본 발명의 암 진단용 키트에서 이용되는 프로브 또는 프라이머는 서열목록 게 1서열 내지 제 49서열로 구성된 군으로부터 선택되는 뉴클레오타이드 서열에 대하여 상보적인 서열을 갖는다. 본 명세서에서 용어
"상보적 (complementary)" 은 어떤 특정한 흔성화 또는 어닐링 조건 하에서 서열목록 게 1서열 내지 제 49서열 기재된 프레임 쉬프트 유전자의 뉴클레오타이드 서열에 선택적으로 흔성화할 수 있을 정도의 상보성을 갖는 것을 의미한다. 따라서 용어 "상보적" 은 용어 완전 상보적 (perfectly complementary)과는 다른 의미를 가지며, 본 발명의 프라이머 또는 프로브는 서열목록 제 1서열 내지 제 49서열 기재된 유전자의 뉴클레오타이드 서열에 선택적으로 흔성화할 수 있올
정도이면, 하나 또는 그 이상의 미스매치 (mismatch) 염기서열을 가질 수 있다. 본 명세서에서, 용어 "프로브" 는 자연의 또는 변형된 모노머 또는 연쇄 (linkages)의 선형 을리고머를 의미하며, 디옥시리보뉴클레오타이드 및 리보뉴클레오타이드를 포함하고 타깃 뉴클레오타이드 서열에 특이적으로 흔성화할 수 있으며, 자연적으로 존재하거나 또는 인위적으로 합성된 것이다. 본 발명의 프로브는 바람직하게는 단일쇄이다. 바람직하게는, 프로브는 을리고디옥시리보뉴클레오타이드이다. 본 발명의 프로브는 자연 (naturally occurring) dNMP (즉, dAMP, dGMP, dCMP 및 dTMP), 뉴클레오타이드 유사체 또는 유도체를 포함할 수 있다. 또한, 본 발명의 프로브는 리보뉴클레오타이드도 포함할 수 있다. 예컨대, 본 발명의 프로브는 골격 변형된 뉴클레오타이드 예컨대, 펩타이드 핵산 (PNA) (M. Egholm et al., Nature, 365:566—568(1993)), 포스포로티오에이트 DNA, 포스포로디티오에이트 DNA, 포스포로아미데이트 DNA, 아마이드-연결된 DNA, 画 I-연결된 DNA, 2'-0-메틸 RNA, 알파 -DNA 및 메틸포스포네이트 DNA, 당 변형된 뉴클레오타이드 예컨대, 2'-0-메틸 RNA, 2'- 플루오로 RNA, 2'-아미노 RNA, 2'-0-알킬 DNA, 2'_0-알릴 DNA, 2'-으알카이닐 DNA, 핵소스 DNA, 피라노실 RNA 및 안히드로핵시를 DNA, 및 염기 변형을 갖는 뉴클레오타이드 예컨대, C-5 치환된 피리미딘 (치환기는 플루오로-, 브로모-, 클로로-, 아이오도-, 메틸-, 에틸-, 비닐-, 포르밀-, 에티틸-, 프로피닐-, 알카이닐-, 티아조릴-, 이미다조릴-, 피리딜- 포함), C-7 치환기를 갖는 Ί~ 데아자퓨린 (치환기는 플루오로-, 브로모-, 클로로-, 아이오도-, 메틸—, 에틸-, 비닐-, 포르밀-, 알카이닐-, 알켄일-, 티아조릴-, 이미다조릴-, 피리딜 -), 이노신 및 디아미노퓨린을 포함할 수 있다.
본 명세서에서, 용어 "프라이머" 는 적합한 온도에서 적합한 완층액 내에서 적합한 조건 (즉, 4종의 다른 뉴클레오사이드 트리포스페이트 및 중합반응 효소) 하에서 주형 -지시 DNA 합성의 개시점으로 작용할 수 있는 단일 -가닥 올리고뉴클레오타이드를 의미한다. 프라이머의 적합한 길이는 다양한 요소, 예컨대, 온도와 프라이머의 용도에 따라 변화가 있지만 전형적으로 15-30 뉴클레오타이드이다. 짧은 프라이머 분자는 주형과 충분히 안정된 흔성 복합체를 형성하기 위하여 일반적으로 보다 낮은 온도를 요구한다.
프라이머의 서열은 주형의 일부 서열과 완전하게 상보적인 서열을 가질 필요는 없으며, 주형과 흔성화 되어 프라이머 고유의 작용을 할 수 있는 범위 내에서의 층분한 상보성을 가지면 층분하다. 따라서 본 발명에서의 프라이머는 주형인 서열목록 제 1서열 내지 제 49서열로 구성된 군으로부터 선택되는 뉴클레오타이드 서열에 완벽하게 상보적인 서열을 가질 필요는 없으며, 이 유전자 서열에 흔성화되어 프라이머 작용을 할 수 있는 범위 내에서 층분한 상보성을 가지면 층분하다. 이러한 프라이머의 디자인은 서열목록 제 1서열 내지 제 49서열로 구성된 군으로부터 선택되는 뉴클레오타이드 서열을 참조하여 당업자에 의해 용이하게 실시할 수 있으며, 예컨대, 프라이머 디자인용 프로그램인 Primer 3 프로그램 (http://frodo.wi .mi t .edu/primer3/), Blast 프로그램 (NCBI)을 이용하여 할 수 있다. 본 발명의 또 다른 양태에 따르면, 본 발명은 다음 단계를 포함하는 암 치료제의 스크리닝 방법을 제공한다:
(a) 서열목톡 제 50서열 내지 제 95서열에 기재된 아미노산 서열로 구성된 군으로부터 선택되는 아미노산 서열을 포함하는 암세포 특이적 단백질을 발현하는 세포에 시험물질을 접촉시키는 단계; 및
(b) 상기 시험물질이 상기 암세포 특이적 단백질에 결합하는 지 여부를 분석하는 단계로서, 상기 시험물질이 상기 암세포 특이적 단백질에 결합하는 경우에는 암 치료제로 판정된다. 또한, 본 발명의 또 다른 양태에 따르면, 본 발명은 (a) 상기 암세포 특이적 단백질에 특이적으로 결합하는 항체 또는 펩타이드 앱타머의 약제학적 유효량; 및 (b) 약제학적으로 허용되는 담체를 포함하는 암 예방 또는 치료용 약제학적 조성물을 제공한다.
본 발명의 또 다른 양태에 따르면, 본 발명은 상기 약제학적 조성물을 필요로 하는 대상 (Subject)에게 투여하는 단계를 포함하는 암의 예방 또는 치료방법을 제공한다.
상기에서 '치료 (treatment)'는 증상의 완화, 질환 정도의 감소, 악화되지 않는 질환의 유지, 질환진행의 지연, 질환 상태의 개선 또는 완화 (pal Hat ion), 일부 또는 완전한 완화 (remission)를 포함한다. 또한 치료는 치료를 받지 않은 경우 예상되는 생존율과 비교하여 증가된 생존을 의미할 수 있다. 치료는 치료적 수단 이외에 예방적 수단을 동시에 포함한다. 치료가 필요한 경우는 질환을 이미 가지고 있는 경우와 질환이 예방되어야 하는 경우를 포함한다. 질병의 완화는 치료받지 않는 상황과 비교하여 원하지 않는 질병의 임상양상의 호전이나 질병의 추이가 지연되거나 연장되는 경우이다.
본 발명의 약제학적 조성물에는 약제학적으로 허용되는 담체를 추가로 포함할 수 있다. 상기 '약제학적으로 허용되는'이란 상기 조성물에 노출되는 세포나 인간에게 독성이 없는 것을 말한다. 상기 담체는 완충제, 보존제, 무통화제, 가용화제, 등장제, 안정화제, 기제, 부형제 윤활제, 보존제 둥 당업계에 공지된 것이라면 제한없이 사용할 수 있다.
본 발명의 약제학적 조성물은 각종 제형의 형태로 통용되는 기법에 따라 제조될 수 있다. 예컨대, 주사제의 경우에는 단위 투약 앰플 또는 다수회 투약 포함제 형태로 제조할 수 있다. 제형은 오일 또는 수성 매질 증의 용액, 현탁액, 시럽제 또는 유화액 형태이거나, 액스제, 산제, 과립제 분말제 , 과립제, 정제, 또는 갑셀제 형태일 수 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다. 본 발명에 따른 약제학적 조성물의 의약 제형의 일반적인 원리에 대해서는 여러 문헌을 참고할 수 있다 (W. Sheridan 및 G. Morstyn amp, Cell Therapy: Stem Cell Transplantation, Gene Therapy, and Cellular Immunotherapy, Cambridge University Press (1996); E. D. Ball 및 J. Lister amp, Hematopoietic Stem Cell Therapy', P. Law, Churchill Livingstone (2000)) . 본 발명의 약제학적 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성별, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반웅 감웅성과 같은 요인들에 의해 다양하게 처방될 수 있다. 본 발명의 약제학적 조성물의 바람직한 투여량은 성인 기준으로 0.001 mg/kg (체중) 내지 500 rag/kg (체중)으로 투여할 수 있다.
본 발명의 약제학적 조성물은 대장암, 자궁암, 난소암, 위암, 뇌종양,
후두암, 유방암, 폐암, 식도암, 간암, 췌장암, 담낭암, 전립선암, 방광암, 소아암 및 피부암으로 이루어진 군으로부터 선택되는 암의 예방 및 치료제로서 사용될 수 있다.
【유리한 효과】
본 발명의 특징 및 이점을 요약하면 다음과 같다:
( i ) 본 발명은 암 세포에 대한 바이오 마커 동정 방법, 상기 방법으로 동정된 암 세포에 대한 바이오 마커, 상기 바이오 마커를 포함하는 암 진단용 키트, 암 치료제의 스크리닝 방법 및 암특이적 단백질에 특이적으로 결합하는 항체 또는 펩타이드 ¾타머의 약제학적 유효량을 포함하는 암 예방 또는 치료용 약제학적 조성물을 제공한다.
(ii) 본 발명의 암 세포에 대한 바이오 마커 동정 방법은 유전자 개개를 일일이 검사하여 바이오 마커로서의 가능성을 시험하는 것이 아니라, 생물정보학 기술을 통해 돌연변이가 잘 발생하는 유전자들을 2차에 걸쳐 스크리닝 하는 방법을 사용하므로, 매우 간편하면서도 정확하게 다수의 바이오 마커를 동정할 수 있다.
(iii) 또한 본 발명은 상기 방법을 사용하여 동정된 신규한 NMD-무관 암 세포 바이오 마커를 제공하며, 이로써 상기 신규한 마커를 이용한 암 진단용 키트, 암 치료제의 스크리닝 방법 및 암 예방 또는 치료용 약제학적 조성물에 관한 기초적인 자료를 제공한다.
【도면의 간단한 설명】
도 1은 AIM2유전자의 시퀀스 정보를 기본으로 제작한 프라이머를 사용한 PCR 수행 결과 증폭된 DNA 산물에 대한 6% 폴리아크릴아마이드 젤 전기영동 결과이다.
도 2 내지 도 25는 각각 ASTEl, CCDC43-Isol, CCT8L1, CYHRl, FAM111B- Isol, EBPL, L0C100131089, RGS22, FLT3LG, ASH1L, MED8, TTK, SLAMF1, L0C100127950, SFRS12IP1, SYCPl, TCF7L2, TRIM59, GBP3, GAFAl, KCTD16, IN080E FBXL3 및 KIM2018 유전자의 시퀀스 정보를 기본으로 제작한 프라이머를 사용한
PCR 수행 결과 증폭된 DNA 산물에 대한 6% 폴리아크릴아마이드 젤 전기영동 결과이다.
도 26은 AIM2단백질에 대한 웨스턴 블롯팅 결과이다.
【발명의 실시를 위한 형태】
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명 하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자에게 있어서 자명할 것이다. 실시예
실시예 1-31: 유전자 탐색 및 동위원소 PCR을 이용한 변이 유전자 스크리닝
SelTarbase(www. seltarbase.org)는 모노뉴클레오타이드 반복을 갖는 인간의 모든 유전자 목록을 제공해주는 데이터베이스이다. 이러한 Seltarbase에서 모노뉴클레오타이드 반복이 9개 이상 (예컨대 A, C, G 및 T 관계없이 반복이 9개 이상)인 인간의 모든 유전자를 찾았다. 이렇게 찾아낸 유전자는 모두 447개였다. 447개의 유전자 중에는 비교적 많이 알려진 유전자부터 거의 알려지지 않은 유전자까지 광범위하게 다양한 유전자를 포함하고 있었다.
본 발명의 목적은 NMD-무관 (irrelevant) 바이오 마커를 동정하는 것이므로 모노뉴클레오다이드의 반복이 코딩지역 즉, 오픈리딩프레임에 있으며, 프레임 쉬프트 돌연변이가 일어나는 원인인 뉴클레오타이드의 삽입이나 빠짐에 의해 생기는 미성숙 종결코돈이 마지막 엑손에 있거나 마지막 엑손 결합부에서 시작코돈 방향으로 55 bp 이내 (즉, 마지막 액손 결합부에서 업스트림쪽으로 55 bp 이내)에 있는 경우만을 찾아내었다. 구체적으로는 상기 447개의 모든 유전자를 VectorNTI 소프트웨어 (Invitrogen)와 NCBI 데이터베이스를 이용해 오픈리딩프레임과 액손접합부위, 시작코돈 및 종결코돈을 모두 표시하여 기준을 만족하는 유전자만올 선택하였으며 그 개수는 총 66개였다. 66개의 유전자들 중에는 이전에 모노뉴클레오타이드 반복이 있다고 보고된 것이 15개, 보고되지
않았던 것이 51개 있었다.
상기와 같은 방법으로 선택된 66개의 유전자 중에서, 이전에 보고된 유전자 8개 및 보고되지 않은 유전자 23개를 임의로 선택하였다. 이들 31개의 유전자의 명칭은 각각 AIM2, ASTE1, CCDC43-Isol, CCT8L1, CYHR1, FAMlllB-Isol, EBPL, L0C100131089, RGS22, FLT3LG, ASHIL, MED8, TTK, SLAMFl, LOClOO 127950, SFRS12IP1, SYCPl, TCF7L2, TRIM59, GBP3, GAFA1, KCTD16, IN080E, FBXL3, KIAA2018, CIR1, L0C643677, RXFP2, L0C100128175, HOXAll 및 ERCC5이며, 이 중 이전에 보고된 유전자는 AIM2, ASTE1, FLT3LG, TTK, SYCP1 , TCF7L2, HOXAll 및 ERCC5이다. 실시예 1: AIM2유전자의 대장암 마커로서의 가능성 확인
우선 고ᅳ마이크로세를리트 불안정 (high microsatellite instability: MSI- H) 대장암 세포주 10종류 및 마이크로세를리트 안정 (microsatellite stability: MSS) 대장암 세포주 2종류를 취득하였다. MSI-H 대장암 세포주는 실험군으로, MSS 대장암 세포주는 대조군으로 사용하기 위한 것이다. 구체적으로 사용한 대장암 세포주 명칭은 하기 표 1과 같다:
【표 1】
PCR에 사용할 프라이머는 SelTarbase에서 얻은 AIM2 유전자의 시원入 정보를 기본으로, Primer 3 프로그램 (http://frodo.wi .mit .edu/primer3/) 또는
】3
Blast 프로그램 (NCBI)을 사용하여 제작하였다. 구체적으로는 제작한 프라이머의 서열은 다음과 같다:
정방향프라이머: CCACTCATCGACTGCATCTC
역방향프라이머: TTGGCTTGMTTGGTCCTTT . 상기 표 1의 각각의 대장암 세포주로부터 얻은 2 지놈 DNA(50 l ≠), 2 ιΑ 10x Gold Taq 완층액 (Applied Biosystem), 1.2 25 mM MgCl2(Appl ied Biosystem), 2 / 10 mM dNTP( Ap lied Biosystem), 상기 제작한 2 ^의 20 pM 프라이머 , 0.2 μΐ Alpha P-32(BMS) , 0.2 ≠ 1000 U Gold ^(Applied Biosystem) 및 10.6 ^의 증류수 이렇게 총 20 / 의 반웅 부피를 가지고 동위원소 PCR 사이클을 수행하였다. 이때 PCR 생성물의 길이는 대부분 100 bp 내외로 맞추었고, 사용한 동위원소는 a-P32(BMS)이었다. PCR 온도 조건은 아래와 같이 설정하였다: 95°C 10분 이후, 95°C 30초, 55°C 30초 및 72°C 30초의 30 사이클 그런 다음 72 °C 10분.
이러한 동위원소 -PCR은 1 bp의 차이도 구분할 수 있다. 상기 PCR 수행 결과 증폭된 DNA 산물에 대하여 6% 폴리아크릴아마이드 젤 전기영동법을 수행하였다. 젤의 각 라인 (1-12)에 상기 표 1의 대장암 세포주의 PCR 증폭 DNA산물을 로딩하고, 전기영동을 수행하여 그 결과를 도 1에 도시하였다.
대조군 라인 (11-12)과 실험군 라인 (1-10)의 밴드를 비교해본 결과, MSI-H 대장암 세포 (1-2 및 4-8 라인)에 AIM2 유전자의 프레임 쉬프트 돌연변이가 발생하였음을 확인할 수 있었다. 구체적으로 모노뉴클레오타이드 반복 부분에서, 1 뉴클레오타이드가 결여된 프레임 쉬프트 돌연변이, 2 뉴클레오타이드가 결여된 프레임 쉬프트 돌연변이 및 1 뉴클레오타이드가 첨가된 프레임 쉬프트 돌연변이가 실제로 확인되었으며, 각각의 프레임 쉬프트 돌연변이 유전자의 뉴클레오타이드 서열은 서열목톡 제 1서열 내지 제 3서열에 표시하였다. 실시예 2-25: ASTE1등 총 24개 유전자의 대장암 마커로서의 가능성 확인
ASTE1 , CCDC43-Isol, CCT8L1, CYHR1, FAMlllB-Isol, EBPL, L0C100131089, RGS22, FLT3LG, ASH1L, MED8, TTK, SLAMF1, LOC100127950, SFRS12IP1, SYCP1,
TCF7L2, TRIM59, GBP3, GAFA1, KCTD16, IN080E, FBXL3 및 KIAA2018 유전자 각각의 시뭔스 정보를 기본으로 제작한 프라이머를 사용한 것을 제외하고는 상기 실시예 丄과 동일하게 수행하였다.
구체적으로 실시예 2-25에 사용한프라이머는 하기 표 2와 같다.
【표 2]
전기영동법 실시 후 실시예 2-25 각각의 실험결과를 도 2-25에 도시하였다.
도 2-25를 보면 실험군인 MSI-H 대장암 세포에서 각각의 유전자의 프레임 쉬프트 돌연변이가 발생하였음을 알 수 있다 . 구체적 인 각각의 프레임 쉬프트 돌연변이 유전자의 뉴클레오타이드 서 열은 서 열목록 제 4서 열 내지 제 49서 열에 기재하였다 . 상기 실시 예 1-25의 결과를 종합하여, 하기 표 3에 정 리하였다 .
【표 3]
돌연변이 상태표
SI-H SS
2. 5. 10.
¾ " 1. 3. 4. 6. 7. 8. 9. 11. 12.
HCT LS SNU DLD1 HCT8 L0V0 RK0 SNUC2A SNUC2B SNUC4 WiDr Hela 116 174T 407
Η/- 실시 예 1 ΑΙΜ2 — 1/W -1/W W -1/-1 -1/W — 1/ᅳ 2 -1/-2 W W W w
1
-21- 실시 예 2 ASTE1 +1/W -1/W +1/ +1/W +1/W 2卜 2 -2/-3 W — 2/-3 W w
2
실시 예 3 CCDC43-Isol W W W -1/ -1/W W — L/W -1/W W +1/W W w :
-11- -11- 실시 예 4 CCT8L1 W W -1/-2 -1/-2 -2/-2 -21-2 -1/-3 -2/W W .
2 2
실시 예 5 CYHR1 W W W W -1/-1 -1/W -1/W -1/W +1/+2 一 1/W W w
FAM11 -1/—
실시 예 6 — L/W — L/W W -1/-1 -1/W -2/W +1/-2 — 1/-1 一 1/-2 W w
1 실시 예 7 EBPL W +1/W W +1/-1 W -1/W W -1/W W W w
-1/- -\ί- 실시 예 8 L0C100131089 W W W -1/-1 -1/W -1/W W W w
1 1
실시 예 9 RGS22 W W W -1/W W -1/W W W W W W w 실시 예 10 FLT3LG W W W W + 1/W W +1/W +1/W W +1/W W w 실시 예 11 ASH1L W W W W W W -1/-1 -1/-1 -1/W W W w 실시예 12 MED8 W W W -1/W -2/W W -1/W -1/W -1/W W W w 실시 예 13 ΤΤΚ W -1/W W -1/W W -2/W — 2/W -2/W +1/-2 W w 실시 예 14 SLAMF1 W -1/W W 一 1/W W W W W -1/W -1/W W w 실시 예 15 L0C100127950 W W W -1/W -1/W W +1/W -1/W -1/W -1/W W w 실시 예 16 SFRS12IP1 W W W W -1/-2 W +1/+1 Μ W +1/+1 W w 실시예 17 SYCP1 -1/W +1 U W 1 -1/-1 -1/-1 -1/W W w 실시예 18 TCF7L2 W W W -1/W -1/W W -1/W -1/W W w 실시 예 19 TRIM59 W W W -1/W -1/W -1/ -1/W W -1/-2 W
1
— 1/一
실시 예 20 GBP3 -1/W — 1/W W -1/W -1/W W W -1/W W w
1
-21- 실시 예 21 GAFA1 W -2/2 W -2/-2 -2/-2 -2/-3 -2/-3 W -1/-1 W w
2
실시 예 22 CTD16 W -1/W W W -1/W W -1/W -1/W -1/W W w 실시 예 23 ΙΝ080Ε -1/W W -1/W -1/-1 一 1/-1 -II- -1/W — 1/W -1/-1 -1/W W w
1
실시예 24 FBXL3 W W W w w w w w w w 실시예 25 IAA2018 w w w w w w -1/W w 실시예 26-31: CIRl등 총 6개 유전자의 대장암 마커로서의 가능성 확인
CIRl, HOXAll , L0C643677, RXFP2, ERCC5 및 L0C100128175 유전자 각각의 시퀀스 정보를 기본으로 제작한 프라이머를 사용한 것을 제외하고는 상기 실시예 1과 동일하게 수행하였다.
실시예 26 및 31에 사용한 프라이머는 하기 표 4와 같다.
【표 4】
대조군 라인 (11-12)과 실험군 라인 (1-10)의 밴드를 비교해본 결과, 밴드가 완전히 일치하여 MSI-H 대장암 세포 내에 프레임 쉬프트 돌연변이가 발생하지 않았음을 확인할 수 있었다. 실시예 1-31의 결과를 종합하면, 총 31개의 돌연변이 확인을 시도 했던 유전자 중에 총 25개의 유전자에 실제 돌연변이가 있음을 확인하였으며, 그 결과 서열목록 제 1서열 내지 제 49서열에 해당하는 신규한 뉴클레오타이드 서열을 동정하기에 이르렀다. 이들 뉴클레오타이드 서열은 새로운 대장암 마커로서의 용도를 갖는다. 실시예 32-33: 대장암 펩타이드 마커 동정을 위한 웨스턴 블롯팅
앞서 찾은 66개의 유전자 모두에 대해 데이터베이스 (http://www.genecards.org/) 탐색을 통해 상업적으로 유통되고
있는 항체가 있는 유전자를 찾아본 결과, 그 중 토끼 생산 항 -AIM2(Abcam) 및 토끼 생산 항 -TTK(Abcam) 항체 두 개를 찾았고, 상기 두 항체를 구입하여 상기 유전자 AIM2 및 TTK에 대해 웨스턴 블롯을 수행하였다.
상기 구입한 항체 (anti-AIM2, anti-TTK)를 이용해 웨스턴 블롯을 수행할 때 동위원소 PCR에 사용했던 10개의 MSI 대장암 세포주에서 정상 타입, 헤테로접합형 (heterozygous) 돌연변이, 호모접합형 (homozygous) 돌연변이를 갖는 세포주를 각각 선택하고 대조군으로 사용했던 MSS 세포주에서는 하나를 선택해 총 4가지의 대장암 세포주를 사용하였다. 실시예 32: AIM2 단백질에 대한 웨스턴 블롯팅
정상 타입으로는 SNUC4(야생형), 헤테로 돌연변이로는 DLDl(-l/w), 호모 돌연변이로는 LoVo(-l/-l)를 선택하고, 대조군 세포주로는 WiDr (야생형)을 선택하였다. 상기 4가지 세포주를 각각 25 μΜ의 MG132(A.G. scientific INC)로 8시간 처리한 것과 처리안한 것으로부터 수집한 세포 용해물을 각 웰 당 50 //g씩 4-12%의 Bis-Tris 젤 (amresco)에 로딩하였다. MG132(proteasome inhibitor)으로 처리한 이유는 변이 단백질이 프로테아좀에 의해 분해되는 것을 방지하기 위해서이다. 이어, 5¾ 스킴밀크로 한 시간 동안 블록킹하고, 1 g/ml의 농도로 4°C에서 16시간 동안 1차 항체반웅 후, 0.1 ig/ml의 농도로 상온에서 1시간 동안 2차 항체 (anti-rabbit antibody, santa cruz) 반웅하는 방식으로 진행하였다. 상기 실험 결과를 도 27에 도시하였는데, 이를 보면 헤테로 돌연변이 DLDK-1/w) 뿐만 아니라, 호모 돌연변이 LoVo(-l/-l)에서도 밴드가 보이는 것을 확인 할 수 있다.
또한, 호모 돌연변이가 있는 다른 MSI 세포주인 RKO, SNUC2A 및 SNUC2B에서도 동일하게 웨스턴 블롯을 수행한 결과 AIM2가 탐지되었다. 실시예 33: ΊΤΚ단백질에 대한 웨스턴 블롯팅
정상 타입으로는 DLD1 (야생형), 해테로 돌연변이로는 HCT116(-lAv), 호모
돌연변이로는 SNIC4(+l/-2)를 선택하고, 대조군 세포주로는 WiDr (야생형)을 선택하였다. 상기 4가지 세포주를 각각 25uM의 MG132로 8시간 처리한 것과 안한 것으로 모아 얻은 세포 용해물을 각 웰 당 50 «g씩 4~12%의 Bis-Tris 젤에 로딩하였다.
이어, 스킴밀크로 한 시간 동안 블록킹하고, 1 /g/ml의 농도로 4°C에서 16시간 동안 1차 항체반웅 후, 0.1;/g/ml의 농도로 상온에서 1시간 동안 2차 항체 (anti-rabbit antibody, santa cruz) 반웅하는 방식으로 진행하였다. 실험 결과 헤테로 돌연변이 HCT116(-l/w) 뿐만 아니라, 호모 돌연변이 SNUC4(+l/-2)에서도 밴드가 보이는 것을 확인하였다. 이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다. 참조 문헌
1. Lengauer C, Kinzler KW, Vogelstein B (1998) Genetic instabilities in human cancers. Nature 396·' 643一 649.
2. Ionov Y, Peinado MA, Malkhosyan S, Shi bat a D, Perucho M (1993) Ubiquitous somat ic mut at i ons in simple repeated sequences reveal a new mechanism for colonic carcinogenesis. Nature 363: 558-561.
3. Thibodeau SN, Bren G, Schaid D (1993) Microsatellite instability in cancer of the proximal colon. Science 260: 816-819.
4. Kim H, Jen J, Vogelstein B, Hamilton SR (1994) Clinical and pathological characteristics of sporadic colorectal carcinomas with DNA replication errors in microsatel 1 ite sequences . Am J Pathol 145: 148ᅳ 156.
5. Markowitz S, Wang J, Myerof f L, Parsons R, Sun L, et al. (1995) Inactivation of the type II TGFᅳ beta receptor in colon cancer eel Is with
0sws micltro 1re ilwbli:ln:i-
411-414.
15. Lewis BP, Green RE, Brenner SE (2003) Evidence for the widespread coupl ing of alternat ive spl icing and nonsense-mediated mRNA decay in humans . Proceedings of the Nat ional Academy of Sciences of the United States of America 100: 189-192.
16. El-Bchiri J , Buhard 0, Penard-Lacroni que V, Thomas G, Hamel in R, et al . (2005) Di fferent ial nonsense mediated decay of mutated mRNAs in mismatch repair def icient colorectal cancers . Human Molecular Genet ics 14: 2435-2442.
Claims
【청구항 1】
다음 단계를 포함하는 암 세포에 대한 바이오 마커 동정 방법 :
(a) 9개 이상의 모노뉴클레오타이드 반복을 갖는 유전자를 선별하는 제 1차 스크리닝 단계; 및
(b) 상기 제 1차 스크리닝된 유전자 중 모노뉴클레오다이드의 반복이 코딩지역에 있고, 미성숙 종결코돈이 마지막 액손에 있거나 또는 마지막 액손 결합부에서 업스트림 쪽으로 55 bp 이내에 있는 유전자를 선별하는 제 2차 스크리닝 단계.
【청구항 2]
제 1 항에 있어서, 상기 암은 대장암, 자궁암, 난소암, 위암, 뇌종양, 후두암, 유방암, 폐암, 식도암, 간암, 췌장암, 담낭암, 전립선암, 방광암 소아암 및 피부암으로 이루어진 군으로부터 선택되는 것을 특징으로 하는 암 세포에 대한 바이오 마커 동정 방법 .
【청구항 3]
제 1 항에 있어서, 상기 제 1차 스크리닝 단계 (a)는 인간지놈 서열 정보를 제공하는 데이터베이스를 이용하는 것을 특징으로 하는 암 세포에 대한 바이오 마커 동정 방법 .
【청구항 4]
제 1 항에 있어서, 상기 방법은 상기 제 2차 스크리닝된 유전자가 마이크로세를리트 불안정 암세포 내에서 프레임 쉬프트 돌연변이 상태로 존재하는지를 분석하는 단계를 추가적으로 포함하는 것을 특징으로 하는 암 세포에 대한 바이오 마커 동정 방법 .
【청구항 5】
제 4 항에 있어서, 상기 분석하는 단계는 동위원소 PCR 방법을 이용하는 것을 특징으로 하는 암 세포에 대한 바이오 마커 동정 방법.
【청구항 6】
제 1 항에 있어서, 상기 방법은 상기 제 2차 스크리닝된 유전자로부터 생성되는 mRNA 또는 폴리펩타이드를 동정하는 단계를 추가적으로 포함하는 것올 특징으로 하는 암 세포에 대한 바이오 마커 동정 방법 .
【청구항 7]
서열목록 제 50 서열 내지 제 95 서열에 기재된 아미노산 서열로 구성된 군으로부터 선택되는 아미노산서열을 포함하는 암세포 특이적 단백질.
【청구항 8]
제 7 항의 암세포 특이적 단백질을 코딩하는 뉴클레오타이드 서열.
【청구항 9】
제 8 항에 있어서, 상기 뉴클레오타이드 서열은 서열목록 제 1서열 내지 제 49서열로 구성된 군으로부터 선택되는 뉴클레오타이드 서열인 것을 특징으로 하는 서열.
【청구항 10】
제 7 항 내지 제 9 항 증 어느 한 항의 단백질 또는 뉴클레오타이드 서열을 포함하는 암세포 특이적 마커 .
【청구항 111
제 7 항의 단백질에 특이적으로 결합하는 항체 또는 펩타이드 ¾타머를 포함하는 암 진단용 키트.
【청구항 12】
제 8 항 또는 제 9 항의 뉴클레오타이드 서열에 특이적으로 결합하는 프라이머 또는 프로브를 포함하는 암 진단용 키트.
【청구항 13]
다음 단계를 포함하는 암 치료제의 스크리닝 방법:
(a) 상기 계 6항의 암세포 특이적 단백질을 발현하는 세포에 시험물질을 접촉시키는 단계; 및
(b) 상기 시험물질이 상기 암세포 특이적 단백질에 결합하는 지 여부를 분석하는 단계로서, 상기 시험물질이 상기 암세포 특이적 단백질에 결합하는 경우에는 암 치료제로 판정된다.
【청구항 14]
(a) 상기 제 6 항의 단백질에 특이적으로 결합하는 항체 또는 펩타이드 앱타머의 약제학적 유효량; 및 (b) 약제학적으로 허용되는 담체를 포함하는 암 예방또는 치료용 약제학적 조성물.
【청구항 15】
상기 제 14 항의 약제학적 조성물을 필요로 하는 대상 (Subject)에게 투여하는 단계를 포함하는 암의 예방 또는 치료방법 .
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/KR2011/001558 WO2012121429A1 (ko) | 2011-03-07 | 2011-03-07 | 암 세포 바이오 마커를 동정하는 방법 및 상기 방법으로 동정한 nmd-무관 암 세포 바이오 마커 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/KR2011/001558 WO2012121429A1 (ko) | 2011-03-07 | 2011-03-07 | 암 세포 바이오 마커를 동정하는 방법 및 상기 방법으로 동정한 nmd-무관 암 세포 바이오 마커 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2012121429A1 true WO2012121429A1 (ko) | 2012-09-13 |
Family
ID=46798370
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2011/001558 Ceased WO2012121429A1 (ko) | 2011-03-07 | 2011-03-07 | 암 세포 바이오 마커를 동정하는 방법 및 상기 방법으로 동정한 nmd-무관 암 세포 바이오 마커 |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2012121429A1 (ko) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016065038A1 (en) * | 2014-10-23 | 2016-04-28 | Five Prime Therapeutics, Inc. | Slamf1 antagonists and uses thereof |
| JP2024105596A (ja) * | 2016-03-31 | 2024-08-06 | ビオンテック ユーエス インコーポレイテッド | ネオ抗原およびその使用方法 |
-
2011
- 2011-03-07 WO PCT/KR2011/001558 patent/WO2012121429A1/ko not_active Ceased
Non-Patent Citations (5)
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016065038A1 (en) * | 2014-10-23 | 2016-04-28 | Five Prime Therapeutics, Inc. | Slamf1 antagonists and uses thereof |
| JP2024105596A (ja) * | 2016-03-31 | 2024-08-06 | ビオンテック ユーエス インコーポレイテッド | ネオ抗原およびその使用方法 |
| AU2023241320B2 (en) * | 2016-03-31 | 2025-07-17 | Biontech Us Inc. | Neoantigens and methods of their use |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20250115912A1 (en) | Method for the diagnosis, prognosis and treatment of cancer metastasis | |
| US20140274788A1 (en) | Leukemia stem cell markers | |
| EP2341148A2 (en) | Diagnosis and treatment of cancer | |
| KR102097859B1 (ko) | 위암의 항암제 치료 반응성 예측용 바이오마커 및 이의 용도 | |
| JP2018102299A (ja) | 膀胱癌の処置および診断のための方法および組成物 | |
| JP6045563B2 (ja) | ドミナントネガティブhsp110突然変異体、並びにガンの予測及び処置におけるその使用 | |
| US20240410016A1 (en) | Cd274 rearrangements as predictors of response to immune checkpoint inhibitor therapy | |
| CN102325548A (zh) | 用于癌症的诊断和治疗的方法和组合物 | |
| CN107056930A (zh) | 编码突变的人notch受体的多核苷酸 | |
| CN114222825A (zh) | 诊断抗肿瘤治疗有效性的方法 | |
| KR102842664B1 (ko) | 유전자 발현 검정을 이용한 펩티드 수용체 방사선요법의 예측 | |
| AU2019258527B2 (en) | Hla-j and medical/diagnostic uses thereof | |
| US20140295416A1 (en) | Novel Method of Cancer Diagnosis and Prognosis and Prediction of Response to Therapy | |
| EP3464623B1 (en) | Androgen receptor splice variants and androgen deprivation therapy | |
| WO2012121429A1 (ko) | 암 세포 바이오 마커를 동정하는 방법 및 상기 방법으로 동정한 nmd-무관 암 세포 바이오 마커 | |
| US20210108276A1 (en) | Tumor-associated markers for detection of minimal residual disease using digital droplet pcr | |
| US20220363767A1 (en) | Hla-h, hla-j, hla-l, hla-v and hla-y as therapeutic and diagnostic targets | |
| KR101168055B1 (ko) | 암 세포 바이오 마커를 동정하는 방법 및 상기 방법으로 동정한 nmd?무관 암 세포 바이오 마커 | |
| KR101128640B1 (ko) | 간암 진단용 마커로서의 rps 14의 용도 | |
| JP2008072939A (ja) | 多発性骨髄腫の検出方法および抑制方法 | |
| KR102042332B1 (ko) | 간암의 재발 및 예후 예측용 tcirg1 마커 및 이의 용도 | |
| WO2022063957A1 (en) | Biomarker for anti-tumor therapy | |
| HK40058894A (en) | Diagnostic methods and compositions for cancer immunotherapy |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 11860267 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 11860267 Country of ref document: EP Kind code of ref document: A1 |



