WO2012109220A2 - Cell cycle control for improving process performance and recombinant expression in fungal host cells - Google Patents
Cell cycle control for improving process performance and recombinant expression in fungal host cells Download PDFInfo
- Publication number
- WO2012109220A2 WO2012109220A2 PCT/US2012/024116 US2012024116W WO2012109220A2 WO 2012109220 A2 WO2012109220 A2 WO 2012109220A2 US 2012024116 W US2012024116 W US 2012024116W WO 2012109220 A2 WO2012109220 A2 WO 2012109220A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- cerevisiae
- host cell
- pichia
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
- C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P21/00—Preparation of peptides or proteins
- C12P21/02—Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
Definitions
- the field of the invention relates to regulated cell cycle control of fungal cells such as Pichia pastoris and methods of use thereof.
- the methylotrophic yeast Pichia pastoris is one of the most widely used expression hosts for genetic engineering. This ascomycetous single--celled budding yeast has been used for the heterologous expression of hundreds of proteins (Lin-Cereghino, Curr Opin Biotech, 2002; acauley-Patrick, Yeast, 2005) .
- P. pastoris provides the advantages of a microbial system with facile genetics, shorter cycle times and the capability of achieving high cell densities. Secreted protein productivities have routinely been reported in the multi-gram per liter ranges.
- P. pastoris is a eukaryote which provides the further advantage of having basic machinery for protein folding and post-translational modifications.
- pastoris has recently been proposed to be stochastic and variable over time when single- cell secretion is analyzed (Love et al, 2010) . This asymmetry in secretion has been shown to be independent of cell cycle. However, this data still supports a model whereby secretion of heterologous protein is associated with cell growth and that the decision to secrete protein or not is made on the single cell level.
- heterologous protein is secreted.
- HAC1 overexpression Gram et al, 2008
- mAbs are a commercially important class of therapeutic protein and P. pastoris has been shown to be an effective secretor of mAbs (Walsh, 2010, Potgieter, 2009) .
- sequence can have a dramatic impact on overall secretion levels.
- P. pastoris homologs of cyclin genes known to control the cell cycle in S. cerevisiae, are downregulated in a strain
- the present invention provides an isolated fungal host cell (e.g., a Pichia cell such as Pichia pastoris) that overexpresses a homologue of C. albicans CYB2 (e.g., SEQ ID NO: 18), S.cerevisiae
- a Pichia cell such as Pichia pastoris
- a homologue of C. albicans CYB2 e.g., SEQ ID NO: 18
- CLB2 ⁇ e.g., SEQ ID NO: 19
- S.cerevisiae CLE4 e.g., SEQ ID NO: 20
- S.cerevisiae CLN4 e.g., SEQ ID NO: 21
- S.cerevisiae CLN3 e.g., SEQ ID NO: 22
- S.cerevisiae CDC28 e.g., SEQ ID NO: 23
- Pichia pastoris gene Pp05g03580 Pp02gl2160, Pp05g03580, Pp01g00590, Pp01g03460, Pp01g07380 or Pp05g06140 or a variant thereof; e.g., comprising the nucleotide sequence set forth in a member selected from SEQ ID NOs : 1-5 and 17) and which, optionally, comprises a polynucleotide encoding a heterologous polypeptide.
- Such a homologue or variant
- a fungal host cell e.g., a Pichia cell such as Pichia pastoris
- a heterologous polypeptide at an acceptable level comprising
- the method also includes the step of introducing a heterologous polynucleotide encoding the heterologous polypeptide into the identified host cell and culturing the host cell under conditions where the heterologous polypeptide is expressed.
- the present invention provides a method for producing a heterologous polypeptide comprising introducing a polynucleotide that encodes the heterologous polypeptide into an isolated fungal host cell (e.g., a Pichia cell such as Pichia pastoris) of the present invention (discussed herein) and culturing the host cell under conditions where the heterologous polypeptide is expressed.
- an isolated fungal host cell e.g., a Pichia cell such as Pichia pastoris
- Figure 1 Expression profiling of "high” and “low” mAb secreting P. pastorls strains.
- Pp05g03580 homologous to C. albicans B-type cyclin- CYB2; or CLB4 in S, cerevisiae (blastp E-value ⁇ le-100 for both), is down-regulated in "Low" strain following MeOH induction vs.
- S. cerevisiae CLB4 is a B-type cyclin involved in cell cycle progression that activates Cdc28p to promote the transition from G2 to phase and accumulates during G2 and M, which is then targeted via a destruction box motif for ubiquitin-mediated degradation by the proteasome.
- Pp01g03460 f homologous to C.
- S. cerevisiae CLN3 is a Gl cyclin involved in cell cycle progression that activates Cdc28p kinase to promote the Gl
- Figure 4 Restriction map of plasmid pGLY8369.
- the E. coli/P. pastoris shuttle vector is depicted circularly as it is maintained in E. coli.
- the vector is digested with Spel or Prael to linearize the vector, thus promoting integration at the URA6 locus or the AOXl locus, respectively, and selected for in the presence of arsenite via the ScARR3 gene.
- Genes of interest, including the cell cycle control genes described herein can be inserted using the EcoRI, Sphl, Apal,
- the present invention provides, in part, fungal host cells that overexpress cell cycle regulatory genes. This overexpression leads to increased robustness and protein expression and secretion of the fungal host cells.
- the present invention provides, in part, methods for
- the present invention further comprises methods for expressing polypeptides in such fungal cells including the step of increasing expression of host fungal cell genes that are homologous to cell cycle regulatory genes ⁇ e.g., a homologue of C. albicans CYB2 (e.g., SEQ ID NO: 18), S.cerevisiae CLB2 ⁇ e.g., SEQ ID NO: 19), S.cerevisiae CLB4 ⁇ e.g., SEQ ID NO: 20), S.cerevisiae CLN4 ⁇ e.g., SEQ ID NO: 21),
- a homologue of C. albicans CYB2 e.g., SEQ ID NO: 18
- S.cerevisiae CLB2 e.g., SEQ ID NO: 19
- S.cerevisiae CLB4 ⁇ e.g., SEQ ID NO: 20
- S.cerevisiae CLN4 ⁇ e.g., SEQ ID NO
- S.cerevisiae CLN3 ⁇ e.g., SEQ ID NO: 22
- S. cerevisiae CDC28 e.g., SEQ ID NO: 23
- Pichia pastoris gene Pp05g03580 e.g., Pichia pastoris gene Pp05g03580
- Pp05g06140 or a variant thereof; e.g., comprising the nucleotide sequence set forth in a member selected from SEQ ID NOs : 1-5 and 17) .
- overexpress refers to the introduction or modification of a gene such that the expression of the
- introduced/modified gene cassette results in higher overall expression of the gene or expression that is temporally different from the endogenous gene. This can be achieved either by addition of copies of the gene or by modification of the regulatory regions of the endogenous gene.
- an acceptable level of protein expression or secretion means expression that is measurably higher or temporally different from that of the original host cell as judged by standard molecular biology techniques. Acceptable can also be defined by the resultant phenotype wherein the expression of the level of protein is deemed acceptable when a phenotypic change ascribed to said expression is observed.
- an acceptable level of protein expression or secretion refers to a two or more fold statistically significant (e.g., reproducible increase observed in 4 or more fungal host cells) increase in expression or secretion relative to that of a fungal host cell that does not overexpress any regulatory genes .
- a "heterologous polypeptide” in a fungal host cell is a polypeptide that is not naturally occurring in a wild-type host cell [e.g., NRRL ⁇ yll430) and/or which has been introduced into said cell.
- a wild-type host cell e.g., NRRL ⁇ yll430
- heterologous polypeptide is an immunoglobulin heavy or light chain.
- Host cell line "robustness” refers to cellular health, e.g., as measured by cellular viability.
- overexpression of the cell cycle regulatory genes discussed herein leads to enhanced robustness in the host fungal host cell, which, in turn, leads to increased levels of protein expression or secretion.
- polynucleotides of the present invention may, in an embodiment of the invention, be flanked by natural regulatory (expression control) sequences, or may foe associated with heterologous sequences, including promoters, internal ribosome entry sites (IRES) and other ribosome binding site sequences, enhancers, response elements, suppressors, signal sequences, polyadenylation sequences, introns, 5'- and 3'- non-coding regions, and the like.
- a fungal host cell e.g., a Pichia cell such as Pichia pastoris
- albicans CYB2 (e.g., SEQ ID NO: 18), S.cerevisiae CLB2 (e.g., SEQ ID NO: 19), S.cerevisiae CLB4 ⁇ e.g., SEQ ID NO: 20), S.cerevisiae CLN4 (e.g., SEQ ID NO: 21), S.cerevisiae CLN3 (e.g., SEQ ID NO: 22) or S.cerevisiae CDC28 (e.g., SEQ ID NO: 23) (e.g., Pichia pastoris gene Pp05g03580 Pp02gl2160, Pp05g03580, Pp01g00590, Pp01g03460, Pp01g07380 or Pp05g06140 or a variant thereof; e.g., comprising the nucleotide sequence set forth in a member selected from SEQ ID NOs : 1-5 and 17) operably linked to a regulatory sequence
- the homologue of C. albicans CYB2 e.g., SEQ ID NO: 18
- S.cerevisiae CLB2 e.g., SEQ ID NO: 19
- S . cerevisiae CLB4 e.g., SEQ ID NO: 20
- S. cerevisiae CLN4 e.g., SEQ ID NO: 21
- S.cerevisiae CLN3 e.g., SEQ ID NO: 22
- S.cerevisiae CDC28 e.g., SEQ ID NO: 23
- S.cerevisiae CDC28 e.g., SEQ ID NO: 23
- a strong constitutive promoter such as the GAPDH promoter, the TEF promoter (Waterham, Gene 1997, 186: 37-44; Ann, Appl Microb Biotech, 2007, 74:601-608); or a methanol-inducible promoter such as the AOXl which is tightly regulated and highly induced on methanol (Cregg, Biotechnology, 1993, 11:905-910) (e.g., where
- a coding sequence e.g., of a heterologous polypeptide or a homologue of C. albicans CYB2 (e.g., SEQ ID NO: 18), S.cerevisiae CLB2 ⁇ e.g., SEQ ID NO: 19), S.cerevisiae CLB4 [e.g., SEQ ID NO: 20), S. cerevisiae CLN4 ⁇ e.g., SEQ ID NO: 21), S . cerevisiae CLN3
- a yeast host cell e.g., a Pichia cell such as Pichia pastoris
- a fungal host cell e.g., a Pichia cell such as Pichia pastoris
- vector examples include a vehicle (e.g., a plasmid) by which a DNA or RNA sequence can be introduced into a host cell (e.g., a Pichia cell such as Pichia pastoris) , so as to transform the host and, optionally, promote expression and/or replication of the introduced sequence.
- a homologue of C. albicans CYB2 e.g., SEQ ID NO: 18
- S. cerevisiae CLB2 e.g., SEQ I D NO: 19
- S. cerevisiae CLB4 e. g. , SEQ ID NO: 20
- S. cerevisiae CLN4 ⁇ e.g., SEQ ID NO: 21
- a vehicle e.g., a plasmid
- a host cell e.g., a Pichia cell such as Pichia pastoris
- a homologue of C. albicans CYB2 e.g., SEQ ID NO
- S. cerevisiae CLN3 ⁇ e.g., SEQ I D NO: 22
- S. cerevisiae CDC28 e.g., SEQ I D NO: 23
- Pichia pastoris gene Pp05g03580 e.g., Pichia pastoris gene Pp05g03580
- Pp02gl2l60, Pp05g03580, Pp01g00590, Pp01g03460, Pp01g07380 or Pp05g06l40 or a variant thereof; e.g., comprising the nucleotide sequence set forth in a member selected from SEQ ID NOs: 1-5 and 17) may, in an embodiment of the invention, be in a vector when in a fungal host cell.
- fungal host cells are discussed in greater detail below.
- the term "fungal host cell” includes any fungal cell that is selected, modified, transfected, transformed, grown, or used or manipulated in any way, e.g., for the production of a substance by the cell, for example the expression or replication, by the cell, e.g., or a polynucleotide and/or polypeptide.
- a fungal host cell can be S .
- Pichia erevisiae any Pichia cell, Pichia pastoris, Pichia flnlandica, Pichia trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia minuta (Ogataea minuta, Pichia lindneri) , Pichia opuntiae, Pichia thermotolerans, Pichia salictaria, Pichia guercuum, Pichia pijperi, Pichia stiptis, Pichia methanolxca, Pichia, Saccharomyces cerevisiae, Saccharomyces, Hansenula polymorpha, Kluyveromyces, Kluyveromyces lactis, Candida albicans, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Trichoderma reesei,
- R prokaryotic host cell can be, for example, a bacterial cell such as E.coli (e.g., BL21 or BL21 DE3 ⁇ ; see U.S. Patent Nos .
- Prokaryotic ho-st cells can be used, e.g., for routine molecular biological techniques .
- the present invention includes embodiments wherein fungal host cells [e.g., a Pichia cell such as Pichia pastoris) overexpress cell cycle regulatory genes.
- a Pichia cell such as Pichia pastoris
- Such a gene bears sequence similarity to C. albicans CYB2,
- S. cerevisiae CLN3 or S. cerevisiae CDC28 [e.g., as expressed as a percentage of sequence identity or in terms of polynucleotide hybridization) and, when overexpressed (e.g., due to increased gene copy number above 1 and/or increased expression driven by operable linking to a strong promoter) , exhibits cell cycle control activity such as slowing cell cycle progression relative to a fungal host cell that does not overexpress the homologue, for example, in an embodiment of the invention, wherein the cell cycle is slowed by lengthening Gl and/or G2 phase; and/or such as, when overexpressed in a fungal host cell, causing the host cell to express and/or secrete polypeptides (e.g., heterologous polypeptides) at a higher level than such host cells that do not overexpress the homologue.
- polypeptides e.g., heterologous polypeptides
- the homologue is Pichia pastoris gene Pp05g03580 Pp02gl2160, Pp05g03580, Pp01g00590, Pp01g03460, Pp01g07380 or Pp05g06140 (e.g., comprising the
- Pp02gl2160, Pp05g03580, Pp01g00590, Pp01g03460, Pp01g07380 or Pp05g06140 ⁇ e.g., as expressed as a percentage of sequence identity or in terms of polynucleotide hybridization
- overexpressed exhibits cell cycle control activity such as slowing cell cycle progression relative to a fungal host cell that does not overexpress the homologue, for example, in an embodiment of the invention, wherein the cell cycle is slowed by lengthening Gl and/or G2 phase; and/or such as, when overexpressed in a fungal host cell, causing the host cell to express and/or secrete
- polypeptides e.g., heterologous polypeptides
- polypeptides at a higher level than such host cells that do not overexpress the homologue.
- the present invention includes fungal host cells (e.g., a Pichia cell such as Pichia pastoris) overexpressing polynucleotides encoding homologues of C. albicans CYB2 ⁇ e.g., SEQ ID NO: 18),
- S.cerevisiae CLB2 ⁇ e.g., SEQ ID NO: 19
- S.cerevisiae CLB4 (e.g., SEQ ID NO: 20)
- S.cerevisiae CLN4 ⁇ e.g., SEQ ID NO: 21
- S.cerevisiae CLN3 e.g., SEQ ID NO: 22
- S.cerevisiae CDC28 e.g., SEQ ID NO: 23
- Pichia pastoris gene Pp05g03580 e.g., Pichia pastoris gene Pp05g03580
- Pp05g06140 or a variant thereof; e.g., comprising the nucleotide sequence set forth in a member selected from SEQ ID NOs : 1-5 and 17).
- the homologue or variant polynucleotides that are overexpresssed in the fungal host cells of the present invention hybridize to a complementary strand of SEQ ID NO: 1, 2, 3, 4, 5, 17, 18, 19, 20, 21, 22 or 23 under low
- a polynucleotide is "hybridizable" to another polynucleotide, when a single stranded form of the
- polynucleotide can anneal to the other polynucleotide under the appropriate conditions of temperature and solution ionic strength ⁇ see Sambrook, et al., supra).
- the conditions of temperature . and ionic strength determine the "stringency" of the hybridization.
- An example, of a non-stringent wash condition under which a membrane comprising hybridized polynucleotides may be washed of excess, non- hybridizing polynucleotides is 2X SSC at 65°C; whereas a stringent wash would be 0. IX SSC at 65°C.
- a stringent wash can include a series of washes at 65°C in decreasing salt
- a hybridization condition may be 6x SSC; 0.2% SDS; lx Denhardt's blocking solution, or 1% w/v milk; 10-50 ng/ml probe (denatured first); 65°C incubation, with agitation, for 18-24 hours.
- a recipe for 20X SSC per liter is NaCl 175.3 g (3 molar final in 20X) Sodium Citrate 88.2 g (0.3 molar final in 20X) (Adjust pH to 7.0 with a few drops of 10 N NaOH) .
- fungal host cells e.g., a Pichia cell such as Pichia pastoris
- a Pichia cell such as Pichia pastoris
- polynucleotides encoding homologues of C. albicans CYB2 (e.g., SEQ ID NO: 18), S.cerevisiae CLB2 (e.g., SEQ ID NO: 19), S.cerevisiae CLB4 ⁇ e.g. f SEQ ID NO: 20), S.cerevisiae CLN4 (e.g., SEQ ID NO: 21), S .
- a Pichia cell such as Pichia pastoris
- polynucleotides encoding homologues of C. albicans CYB2 (e.g., SEQ ID NO: 18), S.cerevisiae CLB2 (e.g., SEQ ID NO: 19), S.cerevisiae CLB4 ⁇ e.g. f SEQ ID NO:
- Pichia pastoris is Pichia pastoris gene Pp05g03580 Pp02gl2160, Pp05g03580, Pp01g00590, Pp01g03460, Pp01g07380 or Pp05g06140 or a variant thereof; e.g., comprising the nucleotide sequence set forth in a member selected from SEQ ID NOs : 1-5 and 17; or comprising a nucleotide sequence that differs from that set forth in SEQ ID NO: 1, 2, 3, 4, 5 or 17 at about 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides; or comprising a nucleotide sequence that is at least about 70% (e.g., 75%) identical, preferably at least about 80%
- the Pichia pastoris homologue of C. albicans CYB2 exhibits about 75% nucleotide sequence identity to the C. albicans gene, e.g., over about 291 nucleotides.
- the Pichia pastoris homologue of C. albicans CYB2 also exhibits identity to C. albicans CLB4, e.g., about 84% nucleotide sequence identity, e.g., over about 50 nucleotides. In an embodiment of the invention such a homologue or variant exhibits cell cycle control activity (see e.g., above) .
- the fungal host cells e.g., a Pichia cell such as Pichia pastoris
- polynucleotides encoding C. albicans CYB2 e.g., SEQ ID NO: 18
- S . cerevisiae CLB2 e.g., SEQ ID NO: 19
- S . cerevisiae CLB4 e.g. , SEQ ID NO: 20
- S. cerevisiae CLN4 e.g., SEQ ID NO: 21
- S . cerevisiae CLN3 e.g., SEQ ID NO: 22
- S. cerevisiae CDC28 e.g., SEQ ID NO: 23
- a variant thereof e.g., see supra.
- BLAST ALGORITHMS Altschul, S.F., et al., (1990) J. Mol. Biol. 215:403-410; Gish, W., et al., (1993) Nature Genet. 3:266-272; Madden, T.L., et al., (1996) Meth.
- the present invention includes fungal host cells ⁇ e.g., a Pichia cell) such as Pichia pastoris which overexpress homologues of C. albicans CYB2 (e.g., SEQ ID NO: 18), S.cerevisiae CLB2 (e.g., SEQ ID NO: 19), S.cerevisiae CLB4(e.g. f SEQ ID NO: 20),
- a Pichia cell such as Pichia pastoris which overexpress homologues of C. albicans CYB2 (e.g., SEQ ID NO: 18), S.cerevisiae CLB2 (e.g., SEQ ID NO: 19), S.cerevisiae CLB4(e.g. f SEQ ID NO: 20),
- S.cerevisiae CLN4 (e.g., SEQ ID NO: 21), S.cerevisiae CLN3 (e.g., SEQ ID NO: 22) or S.cerevisiae CDC28 (e.g., SEQ ID NO: 23 ⁇ which exhibit superior levels of robustness, expression and/or secretion of heterologous proteins.
- homologues include the Pichia pastoris Pp02gl2160, Pp05g03580, Pp01g00590, Pp01g03460, Pp01g07380 or Pp05g06140 genes (e.g., SEQ ID NO: 1, 2, 3, 4, 5 or 17).
- such a homologue or variant is operably linked to a promoter in said fungal host cell; e.g., wherein the fungal host cell overexpresses such a homologue or variant relative to that of a wild-type fungal host cell ⁇ e.g., NRRL-yll430) lacking such a polynucleotide linked to a promoter.
- C, albicans CYB2 comprises the following nucleotide sequence:
- S.cerevisiae CLB2 comprises the following nucleotide sequence:
- S.cerevisiae CLB4 comprises the following nucleotide sequence:
- S.cerevisiae CLN2 comprises the following nucleotide sequence:
- S.cerevisiae CLN3 comprises the following nucleotide sequence:
- S.cerevisiae CDC28 comprises the following nucleotide sequence:
- the present invention encompasses any isolated fungal host cell (e.g., Pichia pastoris) wherein a homologue of C. albicans CYB2 ⁇ e.g., SEQ ID NO: 18), S.cerevisiae CLB2 (e.g., SEQ ID NO: 19), S.cerevisiae CLB4 ⁇ e.g. , SEQ ID NO: 20), S.cerevisiae CLN4 (e.g., SEQ ID NO: 21), S.cerevisiae CLN3 ⁇ e.g., SEQ ID NO: 22) or
- S.cerevisiae CDC28 ⁇ e.g., SEQ ID NO: 23
- a variant thereof e.g., Pichia pastoris gene Pp05g03580 Pp02gl2160, Pp05g03580, Pp01g00590, Pp01g03460, Pp01g07380 or Pp05g06140 or a variant thereof; e.g., comprising the nucleotide sequence set forth in a member selected from SEQ ID NOs : 1-5 and 17) is overexpressed; as well as methods of use thereof, e.g., methods for expressing a heterologous polypeptide in the host cell.
- Host cells of the present invention comprising a promoter of the present invention, may be genetically engineered so as to express particular glycosylation patterns on heterologous
- polypeptides that are expressed in such cells e.g., immunoglobulin heavy and/or light chains.
- Host cells of the present invention are discussed in detail herein.
- a "fungal host cell” that may be used in a composition or method of the present invention, as is discussed herein, includes a host cell, which, for example, is selected from the group consisting of any Pichia cell, Pichia pastoris, Pichia flnlandica,
- Pichia trehalophila Pichia koclamae, Pichia me branaefaciens, Pichia minuta (Ogataea minuta, Pichia lindneri) , Pichia opuntiae, Pichia thermotolerans, Pichia salictaria, Pichia guercuum, Pichia pijperi, Pichia stiptis, Pichia methanolica, Pichia, Saccharomyces cerevisiae, Saccharomyces, Hansfinula polymorpha, Kluyveromyces, Kluyveromyces lactis, Candida albicans, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Trichoderma reesei,
- N-glycan and “glycoform” are used interchangeably and refer to an N-linked oligosaccharide, e.g., one that is attached by an asparagine-N- acetylglucosamine linkage to an asparagine residue of a polypeptide.
- N-linked glycoproteins contain an N-acetylglucosamine residue linked to the amide nitrogen of an asparagine residue in the protein.
- Predominant sugars found on glycoproteins are glucose, galactose, mannose, fucose, N- acetylgalactosamine (GalNAc) , N-acetylglucosamine (GlcNAc) and sialic acid (e.g., N-acetyl-neuraminic acid (NANA)).
- GalNAc N-acetylgalactosamine
- GlcNAc N-acetylglucosamine
- sialic acid e.g., N-acetyl-neuraminic acid (NANA)
- N-glycans have a common pentasaccharide core of Man 3 GlcNAc 2 ("Man” refers to mannose; “Glc” refers to glucose; and “NAc” refers to N-acetyl; GlcNAc refers to N-acetylglucosamine) .
- N-glycans differ with respect to the number of branches (antennae) comprising peripheral sugars (e.g., GlcNAc, galactose, fucose and sialic acid) that are added to the Man 3 GlcNAc 2 (“Man 3 ") core structure which is also referred to as the "trimannose core", the "pentasaccharide core” or the "paucimannose core”.
- N-glycans are classified according to their branched constituents (e.g., high mannose, complex or hybrid) .
- a "high mannose” type N-glycan has five or more mannose residues.
- a "complex” type N-glycan typically has at least one GlcNAc attached to the 1,3 mannose arm and at least one GlcNAc attached to the 1,6 mannose arm of a "trimannose" core.
- Complex N-glycans may also have galactose (“Gal”) or N- acetylgalactosamine (“GalNAc”) residues that are optionally modified with sialic acid or derivatives (e.g., "NANA” or “NeuAc”, where “Neu” refers to neuraminic acid and “Ac” refers to acetyl) .
- Gal galactose
- GalNAc N- acetylgalactosamine residues
- sialic acid or derivatives e.g., "NANA” or “NeuAc”, where “Neu” refers to neuraminic acid and “Ac” refers to acetyl
- Complex N-glycans may also have intrachain substitutions comprising "bisecting" GlcNAc and core fucose (“Fuc").
- Complex N-glycans may also have multiple antennae on the "trimannose core, " often referred to as “multiple antennary glycans.”
- a “hybrid” N-glycan has at least one GlcNAc on the terminal of the 1,3 mannose arm of the trimannose core and zero or more mannoses on the 1,6 mannose arm of the trimannose core.
- the various N-glycans are also referred to as “glycoforms . " " PNGase”, or “glycanase” or
- glucose N-glycosidase F refers to peptide N-glycosidase F (EC 3.2.2.18).
- glycoproteins in a fungal host cell is controlled.
- the scope of the present invention includes isolated fungal host cells ⁇ e.g., Pichia pastoris) that overexpresses a homologue C. albicans CYB2 (e.g., SEQ ID NO: 18), S.cerevisiae CLB2 (e.g., SEQ ID NO: 19), S.cerevisiae CLB4 (e.g., SEQ ID NO: 20), S.cerevisiae CLN4 (e.g., SEQ ID NO: 21), S.cerevisiae CLN3 (e.g., SEQ ID NO: 22 ⁇ or
- S. cerevisiae CDC28 e.g., SEQ ID NO: 23
- SEQ ID NO: 23 e.g., Pichia pastoris gene Pp05g03580 Pp02gl2160, Pp05g03580, Pp01g00590, Pp01g03460, Pp01g07380 or Pp05g06140 or a variant thereof; e.g., comprising the nucleotide sequence set forth in a member selected from SEQ ID NOs : 1-5 and 17
- O-glycosylation is controlled (as discussed herein) and methods of use thereof.
- fungal host cells are part of the present invention wherein O-glycan occupancy and mannose chain length are reduced.
- O-glycosylation can be controlled by deleting the genes encoding one or more protein O-mannosyltransferases (Dol-PMan: Protein
- the present invention includes isolated fungal host cells
- S.cerevisiae CLB2 r S.cerevisiae CLB4, S.cerevisiae CLN4, S.cerevisiae CLN3 or S.cerevisiae CDC28 e.g., Pichia pastoris gene Pp05g03580 Pp02gl2160, Pp05g03580, Pp01g00590, Pp01g03460, Pp01g07380 or Pp05g06140 or a variant thereof; e.g., comprising the nucleotide sequence set forth in a member selected from SEQ ID NOs: 1-5 and 17), e.g., comprising a deletion of one or more of the genes encoding PMTs, and/or, e.g., wherein the host cell can be cultivated in a medium that includes one or more Pmtp inhibitors.
- Pmtp inhibitors include but are not limited to a benzylidene thi
- a fungal host cell of the invention overexpressing a homologue of C. albicans CYB2 [e.g., SEQ ID NO: 18), S.cerevisiae CLB2 (e.g., SEQ ID NO: 19), S.cerevisiae CLB4 ⁇ e.g. r SEQ ID NO: 20), S.cerevisiae CLN4 (e.g., SEQ ID NO: 21), S.cerevisiae CLN3 ⁇ e.g., SEQ ID NO: 22) or S.cerevisiae CDC28 ⁇ e.g., SEQ ID NO: 23) (e.g., Pichia pastoris gene Pp05g03580
- the fungal host cell is engineered to express an exogenous alpha-1, 2- mannosidase enzyme having an optimal pH between 5.1 and 8.0, preferably between 5.9 and 7.5.
- the exogenous enzyme is targeted to the endoplasmic reticulum or Golgi apparatus of the fungal host cell, where it trims N ⁇ glycans such as Ma 8 GlcN c 2 to yield an s GlcNAc 2 . See U.S. Patent no.
- Fungal Host cells ⁇ e.g., Pichia pastoris
- a homologue of C. albicans CYB2 [e.g., SEQ ID NO: 18), S.cerevisiae CLB2 ⁇ e.g., SEQ ID NO: 19), S.cerevisiae CLB4(e.g., SEQ ID NO: 20), S.cerevisiae CLN4 ⁇ e.g., SEQ ID NO: 21), S.cerevisiae CLN3 ⁇ e.g., SEQ ID NO: 22) or S.cerevisiae CDC28 (e.g., SEQ ID NO: 23) (e.g., Pichia pastoris gene Pp05g03580 Pp02gl2160, Pp05g03580, Pp01g00590, Pp01g03460, Pp01g07380 or Pp05g06140 or a variant thereof; e.g., comprising the nucleot
- glycoproteins having alpha-mannosidase-resistant N-glycans by deleting or disrupting one or more of the beta-mannosyltransferase genes ⁇ e.g., BMTl, BMT2, BMT3, and BMT4) (See, U.S. Published Patent Application No.
- Fungal host cells e.g., Pichia pastoris overexpressing a homologue of C. albicans CYB2 (e.g., SEQ ID NO: 18), S.cerevisiae CLB2 (e.g., SEQ ID NO: 19), S.cerevisiae CLB4(e.g. f SEQ ID NO: 20), S.cerevisiae CLN4 (e.g., SEQ ID NO: 21), S.cerevisiae CLN3 (e.g., SEQ ID NO: 22) or S.cerevisiae CDC28 ⁇ e.g., SEQ ID NO: 23) (e.g.,
- phosphomannose residues e.g., by deleting or disrupting one or both of the phosphomannosyl transferase genes PNOl and MNN4B (See for example, U.S. Patent Nos . 7,198,921 and 7,259,007), which can include deleting or disrupting the MNN4A gene or abrogating translation of RNAs encoding one or more of the phosphomannosyl transferase genes PNOl and MNN4B (See for example, U.S. Patent Nos . 7,198,921 and 7,259,007), which can include deleting or disrupting the MNN4A gene or abrogating translation of RNAs encoding one or more of the
- a fungal host cell that has been genetically modified to produce glycoproteins that have predominantly an N-glycan selected from the group consisting of complex N-glycans, hybrid N-glycans, and high mannose N-glycans wherein complex N-glycans are, in an embodiment of the invention, selected from the group consisting of Man 3 GlcNAc 2 , GlcNAC ( i ⁇
- GlcNAc an 5 GlcNAc 2
- GalGlcNAc an 5 GlcNAc 2
- NANAGalGlcNAcMan 5 GlcNAc 2 ; and high mannose N-glycans are, in an embodiment of the invention, selected from the group consisting of an 6 GlcNAc 2 , Man 7 GlcNAc 2 , Mang 8 lcNAc 2 , and Ma 9 GlcNAc 2 .
- the term "essentially free of” as it relates to lack of a particular sugar residue, such as fucose, or galactose or the like, on a glycoprotein is used to indicate that the glycoprotein composition is substantially devoid of N-glycans which contain such residues.
- essentially free means that the amount of N-glycan structures containing such sugar residues does not exceed 10%, and preferably is below 5%, more preferably below 1%, most preferably below 0.5%, wherein the percentages are by weight or by mole percent.
- glycoprotein composition "lacks” or “is lacking” a particular sugar residue, such as fucose or galactose, when no detectable amount of such sugar residue is present on the N-glycan structures.
- glycoproteins are expressed in an isolated fungal host cell of the present invetion, as discussed herein, and will “lack fucose, " because the cells do not have the enzymes needed to produce fucosylated N-glycan structures.
- the present invention encompasses methods for making a heterologous polypeptide (e.g., an immunoglobulin chain or an antibody or antigen-binding fragment thereof) comprising
- an isolated fungal host cell of the present invention e.g., a Pichia cell such as Pichia pastoris
- C. albicans CYB2 e.g., SEQ ID NO: 18
- S , cerevisiae CLB2 e.g., SEQ ID NO: 19
- S.cerevisiae a homologue of C. albicans CYB2 (e.g., SEQ ID NO: 18), S , cerevisiae CLB2 ⁇ e.g., SEQ ID NO: 19), S.cerevisiae
- CLB4 ⁇ e.g., SEQ ID NO: 20), S. cerevisiae CLN4 (e.g., SEQ ID NO: 21), S.cerevisiae CLN3 (e.g., SEQ ID NO: 22) or S.cerevisiae CDC28 (e.g., SEQ ID NO: 23) (e.g., Pichia pastoris gene Pp05g03580
- An expression system comprising the host cell that overexpresses a homologue of C. albicans CYB2 ⁇ e.g., SEQ ID NO: 18 ⁇ , S.cerevisiae CLB2 ⁇ e.g., SEQ ID NO: 19),
- S.cerevisiae CLB4 ⁇ e.g. r SEQ ID NO: 20
- S. cerevisiae CLN4 ⁇ e.g., SEQ ID NO: 21
- S.cerevisiae CLN3 ⁇ e.g., SEQ ID NO: 22
- S.cerevisiae CDC28 ⁇ e.g., SEQ ID NO: 23
- Pichia pastoris gene Pp05g03580 Pp02gl2160, Pp05g03580, Pp01g00590, Pp01g03460, Pp01g07380 or Pp05g06140 or a variant thereof; e.g., comprising the nucleotide sequence set forth in a member selected from SEQ ID NOs: 1-5 and 17) comprising a polynucleotide encoding the heterologous polypeptide to be expressed forms part of the present invention.
- a heterologous polypeptide expressed in a fungal host cell of the present invention is purified from said host cell and/or from culture medium in which the host cell is grown.
- the polypeptide can be purified by protein-A binding, anion exchange, cation exchange or hydrophobic interaction chromatography.
- the present invention further comprises methods for
- the method comprises the step of determining whether the fungal host cell overexpresses a homologue of C.
- albicans CYB2 ⁇ e.g., SEQ ID NO: 18
- S.cerevisiae CLB2 ⁇ e.g., SEQ ID NO: 19
- S.cerevisiae C B4 ⁇ e.g., SEQ ID NO: 20
- S.cerevisiae CLN4 ⁇ e.g., SEQ ID NO: 21
- S.cerevisiae CLN3 ⁇ e.g., SEQ ID NO: 22) or S.
- CDC28 ⁇ e.g., SEQ ID NO: 23
- an embodiment of the invention comprises a method for identifying a fungal host cell ⁇ e.g., a Pichia cell such as Pichia pastoris) that exhibits acceptable robustness, expression and/or secretion of a heterologous polypeptide comprising:
- S. cerevisiae CLN3 [e.g., SEQ ID NO: 22) or S. cerevisiae CDC28 (e.g., SEQ ID NO: 23)
- SEQ ID NO: 23 e.g., Pichia pastoris gene Pp05g03580 Pp02gl2160, Pp05g03580, Pp01g00590, Pp01g03460, Pp01g07380 or Pp05g06140 or a variant thereof; e.g., comprising the nucleotide sequence set forth in a member selected from SEQ ID NOs : 1-5 and 17) in a candidate fungal host cell;
- the method further comprises the steps of expressing the heterologous polypeptide in said identified candidate host cell.
- the method further comprises the steps
- polypeptide is expressed and secreted.
- a heterologous polypeptide expressed in a fungal host cell of the present invention is purified from said host cell and/or from culture medium in which the host cell is grown.
- the polypeptide can be purified by protein-A binding, anion exchange, cation exchange or hydrophobic interaction chromatography. Examples
- the present invention is intended to exemplify the present invention and not to be a limitation thereof.
- the methods and compositions disclosed below fall within the scope of the present invention.
- Example 1 Identification of the Putative Complete Set of Protein Coding Genes for P. pastoris.
- Biosciences (Beverly, MA) yielding 9,411,042 bases on 4 large contigs and one smaller contig of 34,728 bp (nucleotide base pairs) that could not be resolved, consistent with the previously
- chromosomes The genome sequence was then annotated by Biomax USA (Rockville, MD) using the automated genefinder software FGNESH (Salamov and Solovyev, Genome Res., 2000, 10: 516-522). A total of 5069 protein coding ORFs and 278 non-coding transcripts, were identified. Identified genes were named systematically using the convention Pp (for P. pastoris) , the contig number, the letters g (gene) or e (element) , and a systematic number. For example, the first gene on Contig 1 is PpOlgOOOlO. Each identified gene was compared to 8 databases using BlastP (Altschul, et al., J. Mol .
- the 77 non-P. pastoris genes are derived from various species from fungi to human and code for proteins that include glycan transferases, sugar-nucleotide transporters, and enzymes involved in sugar metabolism. Probes were designed for all 5424 genes for 3' biased hybridization protocol to a density of 2-3 probes per gene (4207 genes with 3 probes/transcript and 1217 genes with 2 probes/transcript) . This custom-designed Agilent P.
- a P. pastoris glycoengineered strain YGLY8316, and four highly related glycoengineered strains expressing the monoclonal antibodies MK-HER2 strain A (YGLY12501), MK-HER2 Strain B
- Example 3 Gene Expression Analysis using Agilent P.pastoris- specific microarrays .
- the labeled cRNA was then hybridized to the Merck (Whitehouse Station, NJ) custom-designed Agilent (Santa Clara, CA) P. pastoris 15k 3.0 microarray (8xl5K) based upon the internal P. pastoris genome sequence for strain NRRL Y-11430 (above) . Subsequent scanning of the microarrays was performed using Agilent Microarray scanners (version B) , and output raw image files in .tif format were processed by Agilent Feature Extractor (FE) software.
- Microarray quality control data were generated from the FE output data and were reviewed for data quality before delivery to Merck.
- intensity and ratio error models were constructed which combined replicate measurements and modeled associated error. These models determined whether a particular gene exhibited differential expression for the ratio comparison specified, although such differential expression calls were typically made via ANOVA and t- test statistical tests that were also performed. In addition to these statistical tests, clustering, PCA, and other operations were also performed upon the data using Resolver software, typically utilizing data ratioed to the pool of all other samples within, a specific study unless otherwise indicated. In order to determine promoters with desired characteristics (e.g., little gene
- the Trend tool was utilized to match the 100 closest matching gene expression profiles by distance as described in the Resolver User's Manual and online help sections (Rosetta Resolver User Guide, 2002, Kirkland, WA) .
- Example 4 Statistical gene expression analysis of P. pastoris "high” vs. "low” niftb-producing strains
- Pp05g03580 SEQ ID NO: 2
- CYB2 C. albicans B-type cyclin
- CLB4 cerevisiae B-type cyclin
- CLB4 is involved in cell cycle progression due to its role in activating CDC28p to promote the transition from G2 to M phase; CLB4 accumulates during G2 and M, then it is targeted via a destruction box motif for ubiquitin-mediated degradation by the proteasome (Fitch et al., 1992; Lew et al., 1997; Mendenhall and Hodge, 1998; Richardson et al., 1992; Surana et al., 1991).
- Pp05g06140 SEQ ID NO: 17; CDC28 homolog
- Pp02gl2160 SEQ ID NO: 1; CLB2 homolog
- Pp05g03580 SEQ ID NO: 2; CLB4 homolog
- Pp01g00590 SEQ ID NO: 3; CLN2 homolog
- Pp01g03460 SEQ ID NO: 4; homolog
- Pp01g07380 SEQ ID NO: 5
- Example 5 Regulated expression of a cell cycle control protein .
- P. pastoris genes encoding homologs of the S. cerevisiae CLN/CLB family members, Pp02gl2160, (SEQ ID NO: 1), Pp05g03580 (SEQ NO: 2), Pp01g00590 (SEQ ID NO: 3), Pp01g03460 (SEQ ID NO: 4), and Pp01g07380 (SEQ ID NO: 5), and CDC28 homolog, Pp05g06140 are each PCR amplified using the primers SEQ ID NO: 6 and SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9, SEQ ID NO: 10 and SEQ ID NO: 11, SEQ ID NO: 12 and SEQ ID NO: 13, respectively.
- the PCR products are cloned into the P. pastoris expression vector pGLY8369 ( Figure 4), via the EcoRI/Fsel restriction sites in the vector and the overlapping vector sequences in the primers using the Clontech
- the vector pGLY8369 contains an AOX1 promoter and terminator flanking the insertion site as well as the P. pastoris URA6 gene as an integration site and the ScARR3 arsenite resistance gene as a selectable marker ( Figure 4) .
- the resulting plasraids are digested with Pmel and transformed into the P. pastoris host strain YGLY13992 (expressing an anti-HER2 mAb under control of the methanol inducible A0X1 promoter) and
- transformants are selected on 0.3, 1 and 3mM arsenite.
- the resulting isolated clones are PCR amplified to confirm integration of the plasmid using a pair of primers, one specific to the AOX1 promoter (SEQ ID NO: 16) and another specific to each of the genes located anywhere within and complementary to the sequence of each (SEQ IDs NO: 1-5 and 17).
- Positive clones are then cultured in glycerol and then induced in methanol to induce the expression of the secreted anti-HER2 antibody as well as the specific expressed CLN/CLB gene either in shake flasks or in fermenters as described by Barnard (J. Ind. Microbiol. Biotechnol. 37:961-971, 2010).
- the strains are monitored for robustness using the techniques described by Barnard, including picogreen fluorescence supernatant DNA measurement and microscopic evaluation of cell health.
- the fermentation culture supernatants are then harvested by centrifugation after 24h, 48h, and 72h of induction and the anti-HER2 antibody is purified by protein A capture and analyzed for titer, mAb quality, N- and O-linked N-glycans as described by Jiang (Protein Expr. Purif. 2010 Nov; 74 ( 1 ) : 9-15) .
- Clones with increased titer, fermentation process robustness, or improved N-glycan uniformity are selected for larger scale
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Mycology (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The present invention provides, in part, isolated host cells that overexpress various cell cycle control genes which exhibit robust levels of protein expression and secretion. Methods for expressing proteins with the cells and for identifying such cells are also provided.
Description
CELL CYCLE CONTROL FOR IMPROVING PROCESS PERFORMANCE AND RECOMBINANT EXPRESSION IN FUNGAL HOST CELLS This application claims the benefit of U.S. provisional patent application no. 61/440,632, filed February 8, 2011; which is herein incorporated by reference in its entirety.
Field of the Invention
The field of the invention relates to regulated cell cycle control of fungal cells such as Pichia pastoris and methods of use thereof.
Background of the Invention
The methylotrophic yeast Pichia pastoris is one of the most widely used expression hosts for genetic engineering. This ascomycetous single--celled budding yeast has been used for the heterologous expression of hundreds of proteins (Lin-Cereghino, Curr Opin Biotech, 2002; acauley-Patrick, Yeast, 2005) . As a protein expression system, P. pastoris provides the advantages of a microbial system with facile genetics, shorter cycle times and the capability of achieving high cell densities. Secreted protein productivities have routinely been reported in the multi-gram per liter ranges. Importantly, P. pastoris is a eukaryote which provides the further advantage of having basic machinery for protein folding and post-translational modifications. Recent progress in the field, including humanization -of the P. pastoris N™ glycosylation pathway and a better understanding of the yeast secretory pathway, has resulted in improvements in the ability to produce mammalian proteins including monoclonal antibodies (mAbs) . However, expression of heterologous proteins has yielded varying results with efficiencies ranging from several mg/L to several g/L of secreted purified product, even for very similar proteins such as mAbs and mAb-f agments of similar sequence (Sreekrishna, 1997; Cereghino, 2000) .
Expression of secreted proteins in P. pastoris has recently been proposed to be stochastic and variable over time when single- cell secretion is analyzed (Love et al, 2010) . This asymmetry in secretion has been shown to be independent of cell cycle. However, this data still supports a model whereby secretion of heterologous protein is associated with cell growth and that the decision to secrete protein or not is made on the single cell level.
High throughput and whole genome methods have been employed previously in order to analyze the underlying factors affecting heterologous protein productivity and secretion stress in P.
pastoris . One important observation included activation of the unfolded protein response (UPR) pathway and other stress induced responses in cells expressing heterologously secreted protein {Gasser et al, 2007; Graf et al, 2008) . Moreover, these studies demonstrate that different subsets of genes are up- and
downregulated depending on whether the UPR is induced by
Dithiothreitol, HAC1 overexpression, or heterologous gene
secretion. However, they do not point to specific differences in growth between strains where the UPR is induced or where
heterologous protein is secreted. In fact the exact opposite finding is demonstrated with HAC1 overexpression (Graf et al, 2008) .
Here we have used similar expression profiling methods to understand the relative impact on the transcriptome of an
effectively secreted protein versus a poorly secreted protein.
mAbs are a commercially important class of therapeutic protein and P. pastoris has been shown to be an effective secretor of mAbs (Walsh, 2010, Potgieter, 2009) . However, sequence can have a dramatic impact on overall secretion levels. Unexpectedly, we find that P. pastoris homologs of cyclin genes, known to control the cell cycle in S. cerevisiae, are downregulated in a strain
expressing a poorly secreted mAb as compared to one expressing a well-secreted mAb. Summary of the Invention
The present invention provides an isolated fungal host cell (e.g., a Pichia cell such as Pichia pastoris) that overexpresses a
homologue of C. albicans CYB2 (e.g., SEQ ID NO: 18), S.cerevisiae
CLB2 {e.g., SEQ ID NO: 19), S.cerevisiae CLE4 (e.g., SEQ ID NO: 20), S.cerevisiae CLN4 {e.g., SEQ ID NO: 21), S.cerevisiae CLN3 (e.g., SEQ ID NO: 22) or S.cerevisiae CDC28 (e.g., SEQ ID NO: 23) {e.g., Pichia pastoris gene Pp05g03580 Pp02gl2160, Pp05g03580, Pp01g00590, Pp01g03460, Pp01g07380 or Pp05g06140 or a variant thereof; e.g., comprising the nucleotide sequence set forth in a member selected from SEQ ID NOs : 1-5 and 17) and which, optionally, comprises a polynucleotide encoding a heterologous polypeptide. Such a homologue or variant may have been introduced into the host cell, e.g., as part of a vector and/or operably linked to a promoter .
Also provided is a method for identifying a fungal host cell (e.g., a Pichia cell such as Pichia pastoris) that expresses a heterologous polypeptide at an acceptable level comprising
determining whether the host cell overexpresses a homologue of C. albicans CYB2 {e.g., SEQ ID NO: 18), S.cerevisiae CLB2 {e.g., SEQ ID NO: 19), S.cerevisiae CLB4{e.g., SEQ ID NO: 20), S.cerevisiae CLN4 {e.g., SEQ ID NO: 21), S.cerevisiae CLN3 {e.g., SEQ ID NO: 22) or S.cerevisiae CDC28 {e.g., SEQ ID NO: 23) {e.g., Pichia pastoris gene Pp05g03580 Pp02gl2160, Pp05g03580, Pp01g00590, Pp01g03460, Pp01g07380 or Pp05g06140 or a variant thereof; e.g., comprising the nucleotide sequence set forth in a member selected from SEQ ID NOs: 1-5 and 17); wherein, if the host cell does overexpress the homologue or variant, then the host cell is identified as
expressing the heterologous polypeptide at an acceptable level. For example, in an embodiment of the invention, the method also includes the step of introducing a heterologous polynucleotide encoding the heterologous polypeptide into the identified host cell and culturing the host cell under conditions where the heterologous polypeptide is expressed.
In addition, the present invention provides a method for producing a heterologous polypeptide comprising introducing a polynucleotide that encodes the heterologous polypeptide into an isolated fungal host cell (e.g., a Pichia cell such as Pichia pastoris) of the present invention (discussed herein) and culturing
the host cell under conditions where the heterologous polypeptide is expressed.
Brief Description of the Figures
Figure 1: Expression profiling of "high" and "low" mAb secreting P. pastorls strains.
Three replicates each of five different strains were
cultivated in Sartorius Q12 1L fermenters and samples were
harvested for expression profiling at timepoints during glycerol {mid-batch and mid-fedbatch) and methanol induction (4h, 24h, 48h, 72h, and 96h post-methanol addition) . Strains used were YGLY8316 (empty), YGLY12501 (MK-HER2 strain A), YGLY13992, (MK-HER2 strain B) , YGLY14401 (MK-RSV) , and YGLY1036Q (MK-VEGF) . Statistical analyses were then performed by fixing the timepoints and
performing a student's t-test of the "high" vs. "low" expressers as indicated for each.
Figure 2: Induced Signature for "High" vs. "Low"-Producing Strains .
Two dimensional cluster diagram of the two cell cycle
regulator genes resulting from unsupervised analysis of the mAb expression experiment data. One gene results from analysis distinguishing high vs. low mAb expressing strains from the intersection of up- and downregulated genes at all timepoints (Pp05g03580) and another cell cycle control gene is among the 38 genes resulting from intersection of 4h, 24h, and 48h samples (Pp01g03460) . Pp05g03580, homologous to C. albicans B-type cyclin- CYB2; or CLB4 in S, cerevisiae (blastp E-value < le-100 for both), is down-regulated in "Low" strain following MeOH induction vs.
"High". S. cerevisiae CLB4 is a B-type cyclin involved in cell cycle progression that activates Cdc28p to promote the transition from G2 to phase and accumulates during G2 and M, which is then targeted via a destruction box motif for ubiquitin-mediated degradation by the proteasome. Pp01g03460f homologous to C.
albicans CLN1 or CLN3 in S. cerevisiae {blastp E-value < le-20 for both) , is down-regulated in "Low" strain following MeOH induction vs. "High". S. cerevisiae CLN3 is a Gl cyclin involved in cell
cycle progression that activates Cdc28p kinase to promote the Gl
S phase transition and plays a role in regulating transcription the other Gl cyclins, CLNl and CLN2 and is regulated by
phosphorylation and proteolysis. Teal is downregulated, Pink is upregulated. Samples are ordered first by strain and then by timepoint .
Figure 3 : Relaxed "High" vs . "Low" Production Comparison Time t-Test Intersections .
Relationships between various gene sets resulting from the intersections of statistically significant (p<0.01) gene sets that in turn result from comparing the "high" and "low"-producing strains via t-tests at the methanol induction time points described in the figure.- The "5 post-induction t-test" set is the
intersection of genes significantly different between "high" and "low"-producing strains at all five 4h, 24h, 48h, 72h, and 96h post-methanol induction time points. Genes therein are set forth in Table 2. The three other sets correspond to the intersections of significant genes between "high" and "low"-producing strains at the time points indicated. Since the glycerol growth time points are excluded here, these gene signatures are relatively "relaxed" meaning that the extra conditions where the genes are not
significant {the glycerol time points) are excluded. It can be seen that the genes that are consistently significant at earlier time points {4h, 24h, and 48h) generally differ from those genes that are consistently significant at later time points (24h, 48h, 72h) except for a small subset of genes. This subset is the most robust or stringently-selected set for differences between "high" and "low"~producing strains.
Figure 4: Restriction map of plasmid pGLY8369.
The E. coli/P. pastoris shuttle vector is depicted circularly as it is maintained in E. coli. For introduction into P. pastoris the vector is digested with Spel or Prael to linearize the vector, thus promoting integration at the URA6 locus or the AOXl locus, respectively, and selected for in the presence of arsenite via the ScARR3 gene. Genes of interest, including the cell cycle control
genes described herein can be inserted using the EcoRI, Sphl, Apal,
Pstl, and Fsel restriction sites located in the polylinker.
Detailed Description
The present invention provides, in part, fungal host cells that overexpress cell cycle regulatory genes. This overexpression leads to increased robustness and protein expression and secretion of the fungal host cells.
The present invention provides, in part, methods for
identifying fungal cells that exhibit acceptable levels of protein robustness, expression and/or secretion. The present invention further comprises methods for expressing polypeptides in such fungal cells including the step of increasing expression of host fungal cell genes that are homologous to cell cycle regulatory genes {e.g., a homologue of C. albicans CYB2 (e.g., SEQ ID NO: 18), S.cerevisiae CLB2 {e.g., SEQ ID NO: 19), S.cerevisiae CLB4 {e.g., SEQ ID NO: 20), S.cerevisiae CLN4 {e.g., SEQ ID NO: 21),
S.cerevisiae CLN3 {e.g., SEQ ID NO: 22) or S. cerevisiae CDC28 (e.g., SEQ ID NO: 23) (e.g., Pichia pastoris gene Pp05g03580
Pp02gl2160, Pp05g03580, Pp01g00590, Pp01g03460, Pp01g07380 or
Pp05g06140 or a variant thereof; e.g., comprising the nucleotide sequence set forth in a member selected from SEQ ID NOs : 1-5 and 17) .
The term "overexpress", as it relate to fungal host cells that overexpress cell cycle regulatory genes, refers to the introduction or modification of a gene such that the expression of the
introduced/modified gene cassette results in higher overall expression of the gene or expression that is temporally different from the endogenous gene. This can be achieved either by addition of copies of the gene or by modification of the regulatory regions of the endogenous gene.
The term "acceptable", as it relate to levels of protein expression or secretion, means expression that is measurably higher or temporally different from that of the original host cell as judged by standard molecular biology techniques. Acceptable can also be defined by the resultant phenotype wherein the expression of the level of protein is deemed acceptable when a phenotypic
change ascribed to said expression is observed. For example, in an embodiment of the invention, an acceptable level of protein expression or secretion refers to a two or more fold statistically significant (e.g., reproducible increase observed in 4 or more fungal host cells) increase in expression or secretion relative to that of a fungal host cell that does not overexpress any regulatory genes .
A "heterologous polypeptide" in a fungal host cell is a polypeptide that is not naturally occurring in a wild-type host cell [e.g., NRRL~yll430) and/or which has been introduced into said cell. For example in an embodiment of the invention, a
heterologous polypeptide is an immunoglobulin heavy or light chain.
Host cell line "robustness" refers to cellular health, e.g., as measured by cellular viability. In an embodiment of the invention, overexpression of the cell cycle regulatory genes discussed herein leads to enhanced robustness in the host fungal host cell, which, in turn, leads to increased levels of protein expression or secretion. Molecular Biology
In accordance with the present invention there may be employed conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Second Edition
(1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (herein "Sambrook, et al.r 1989"); DNA Cloning: A Practical Approach, Volumes I and II (D.N. Glover ed. 1985); Oligonucleotide Synthesis (M.J. Gait ed. 1984); Nucleic Acid Hybridization (B.D. Hames & S.J. Higgins eds . (1985)); Transcription And Translation
(B.D. Hames & S.J. Higgins, eds. (1984)); Animal Cell Culture (R.I. Freshney, ed. (1986)); Immobilized Cells And Enzymes (IRL Press, (1986)); B . Perbal, A Practical Guide To Molecular Cloning (1984); F.M. Ausubel, et al. (eds.), Current Protocols in Molecular
Biology, John Wiley & Sons, Inc. (1994).
The polynucleotides of the present invention may, in an embodiment of the invention, be flanked by natural regulatory
(expression control) sequences, or may foe associated with heterologous sequences, including promoters, internal ribosome entry sites (IRES) and other ribosome binding site sequences, enhancers, response elements, suppressors, signal sequences, polyadenylation sequences, introns, 5'- and 3'- non-coding regions, and the like. For example, a fungal host cell (e.g., a Pichia cell such as Pichia pastoris) may comprise a homologue of C. albicans CYB2 (e.g., SEQ ID NO: 18), S.cerevisiae CLB2 (e.g., SEQ ID NO: 19), S.cerevisiae CLB4{e.g., SEQ ID NO: 20), S.cerevisiae CLN4 (e.g., SEQ ID NO: 21), S.cerevisiae CLN3 (e.g., SEQ ID NO: 22) or S.cerevisiae CDC28 (e.g., SEQ ID NO: 23) (e.g., Pichia pastoris gene Pp05g03580 Pp02gl2160, Pp05g03580, Pp01g00590, Pp01g03460, Pp01g07380 or Pp05g06140 or a variant thereof; e.g., comprising the nucleotide sequence set forth in a member selected from SEQ ID NOs : 1-5 and 17) operably linked to a regulatory sequence. Such cells and their uses form part of the present invention. For example, in an embodiment of the invention, the homologue of C. albicans CYB2 (e.g., SEQ ID NO: 18), S.cerevisiae CLB2 (e.g., SEQ ID NO: 19), S . cerevisiae CLB4 (e.g., SEQ ID NO: 20), S. cerevisiae CLN4 (e.g., SEQ ID NO: 21), S.cerevisiae CLN3 (e.g., SEQ ID NO: 22) or
S.cerevisiae CDC28 (e.g., SEQ ID NO: 23) (e.g., Pichia pastoris gene Pp05g03580 Pp02gl2160, Pp05g03580, Pp01g00590, Pp01g03460, Pp01g07380 or Pp05g06140 or a variant thereof; e.g., comprising the nucleotide sequence set forth in a member selected from SEQ ID NOs: 1-5 and 17) is operably linked to a strong constitutive promoter such as the GAPDH promoter, the TEF promoter (Waterham, Gene 1997, 186: 37-44; Ann, Appl Microb Biotech, 2007, 74:601-608); or a methanol-inducible promoter such as the AOXl which is tightly regulated and highly induced on methanol (Cregg, Biotechnology, 1993, 11:905-910) (e.g., wherein the fungal host cell is Pichia such as Pichia pastoris) . In embodiments wherein the gene is operably linked to a methanol inducible promoter, fungal host cells comprising the promoter and gene may be cultured in the presence of methanol .
A coding sequence (e.g., of a heterologous polypeptide or a homologue of C. albicans CYB2 (e.g., SEQ ID NO: 18), S.cerevisiae CLB2 {e.g., SEQ ID NO: 19), S.cerevisiae CLB4 [e.g., SEQ ID NO:
20), S. cerevisiae CLN4 {e.g., SEQ ID NO: 21), S . cerevisiae CLN3
(e.g., SEQ ID NO: 22) or S. cerevisiae CDC28 (e.g., SEQ ID NO: 23) (e.g., Pichia pastoris gene Pp05g03580 Pp02gl2160, Pp05g03580, Pp01g00590, Pp01g03460, Pp01g07380 or Pp05g06140 or a variant thereof; e.g., comprising the nucleotide sequence set forth in a member selected from SEQ ID NOs: 1-5 and 17) is "operably linked to", "under the control of", "functionally associated with" or "operably associated with" a transcriptional and translational control sequence in a fungal host cell (e.g., a Pichia cell such as Pichia pastoris) when the sequence directs RNA polymerase mediated transcription of the coding sequence into RNA, preferably mRNA, which then may be RNA spliced {if it contains introns) and possibly translated into a protein encoded by the coding sequence.
The terms "vector", "cloning vector" and "expression vector" include a vehicle (e.g., a plasmid) by which a DNA or RNA sequence can be introduced into a host cell (e.g., a Pichia cell such as Pichia pastoris) , so as to transform the host and, optionally, promote expression and/or replication of the introduced sequence. For example, a homologue of C. albicans CYB2 (e.g., SEQ ID NO: 18), S. cerevisiae CLB2 (e.g., SEQ I D NO: 19), S. cerevisiae CLB4 (e. g. , SEQ ID NO: 20), S. cerevisiae CLN4 {e.g., SEQ ID NO: 21),
S. cerevisiae CLN3 {e.g., SEQ I D NO: 22) or S. cerevisiae CDC28 (e.g., SEQ I D NO: 23) (e.g., Pichia pastoris gene Pp05g03580
Pp02gl2l60, Pp05g03580, Pp01g00590, Pp01g03460, Pp01g07380 or Pp05g06l40 or a variant thereof; e.g., comprising the nucleotide sequence set forth in a member selected from SEQ ID NOs: 1-5 and 17) may, in an embodiment of the invention, be in a vector when in a fungal host cell.
Fungal host cells are discussed in greater detail below. The term "fungal host cell" includes any fungal cell that is selected, modified, transfected, transformed, grown, or used or manipulated in any way, e.g., for the production of a substance by the cell, for example the expression or replication, by the cell, e.g., or a polynucleotide and/or polypeptide. A fungal host cell can be S . erevisiae, any Pichia cell, Pichia pastoris, Pichia flnlandica, Pichia trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia minuta (Ogataea minuta, Pichia lindneri) , Pichia opuntiae,
Pichia thermotolerans, Pichia salictaria, Pichia guercuum, Pichia pijperi, Pichia stiptis, Pichia methanolxca, Pichia, Saccharomyces cerevisiae, Saccharomyces, Hansenula polymorpha, Kluyveromyces, Kluyveromyces lactis, Candida albicans, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Trichoderma reesei,
Chrysosporium lucknowense, Fusarium, Fusa um gramineum, Fusarium venenatum, Neuraspora crassa or Yarrowia lipolyitica.
R prokaryotic host cell can be, for example, a bacterial cell such as E.coli (e.g., BL21 or BL21 DE3}; see U.S. Patent Nos .
4,952,496, 5,693,489 and 5,869,320 and in Davanloo, P., et al.,
(1984) Proc. Natl. Acad. Sci. USA 81, 2035-2039; Studier, F. W., et al.r (1986) J. Mol. Biol. 189: 113-130; Rosenberg, A. H., et al., (1987) Gene 56: 125-135; and Dunn, J. J., et al.r (1988) Gene 68: 259 which are herein incorporated by reference. Prokaryotic ho-st cells can be used, e.g., for routine molecular biological techniques .
The present invention includes embodiments wherein fungal host cells [e.g., a Pichia cell such as Pichia pastoris) overexpress cell cycle regulatory genes. Such a gene, in an embodiment of the invention, bears sequence similarity to C. albicans CYB2,
S. cerevisiae CLB2, S. cerevisiae CLB4, S. cerevisiae CLN4,
S. cerevisiae CLN3 or S. cerevisiae CDC28 [e.g., as expressed as a percentage of sequence identity or in terms of polynucleotide hybridization) and, when overexpressed (e.g., due to increased gene copy number above 1 and/or increased expression driven by operable linking to a strong promoter) , exhibits cell cycle control activity such as slowing cell cycle progression relative to a fungal host cell that does not overexpress the homologue, for example, in an embodiment of the invention, wherein the cell cycle is slowed by lengthening Gl and/or G2 phase; and/or such as, when overexpressed in a fungal host cell, causing the host cell to express and/or secrete polypeptides (e.g., heterologous polypeptides) at a higher level than such host cells that do not overexpress the homologue. For example, in an embodiment of the invention, the homologue is Pichia pastoris gene Pp05g03580 Pp02gl2160, Pp05g03580, Pp01g00590, Pp01g03460, Pp01g07380 or Pp05g06140 (e.g., comprising the
nucleotide sequence set forth in SEQ ID NO: 1, 2, 3, 4, 5 or 17) or
a variant thereof bearing sequence similarity to Pp05g03580
Pp02gl2160, Pp05g03580, Pp01g00590, Pp01g03460, Pp01g07380 or Pp05g06140 {e.g., as expressed as a percentage of sequence identity or in terms of polynucleotide hybridization) and, when
overexpressed, exhibits cell cycle control activity such as slowing cell cycle progression relative to a fungal host cell that does not overexpress the homologue, for example, in an embodiment of the invention, wherein the cell cycle is slowed by lengthening Gl and/or G2 phase; and/or such as, when overexpressed in a fungal host cell, causing the host cell to express and/or secrete
polypeptides (e.g., heterologous polypeptides) at a higher level than such host cells that do not overexpress the homologue.
The present invention includes fungal host cells (e.g., a Pichia cell such as Pichia pastoris) overexpressing polynucleotides encoding homologues of C. albicans CYB2 {e.g., SEQ ID NO: 18),
S.cerevisiae CLB2 {e.g., SEQ ID NO: 19), S.cerevisiae CLB4(e.g., SEQ ID NO: 20), S.cerevisiae CLN4 {e.g., SEQ ID NO: 21),
S.cerevisiae CLN3 (e.g., SEQ ID NO: 22) or S.cerevisiae CDC28 (e.g., SEQ ID NO: 23) (e.g., Pichia pastoris gene Pp05g03580
Pp02gl2160, Pp05g03580, Pp01g00590, Pp01g03460, Pp01g07380 and
Pp05g06140 or a variant thereof; e.g., comprising the nucleotide sequence set forth in a member selected from SEQ ID NOs : 1-5 and 17). In an embodiment of the invention, the homologue or variant polynucleotides that are overexpresssed in the fungal host cells of the present invention hybridize to a complementary strand of SEQ ID NO: 1, 2, 3, 4, 5, 17, 18, 19, 20, 21, 22 or 23 under low
stringency conditions, more preferably under moderate stringency conditions and most preferably under high stringency conditions and, in an embodiment of the invention, exhibit cell cycle control activity (see e.g., above). A polynucleotide is "hybridizable" to another polynucleotide, when a single stranded form of the
polynucleotide can anneal to the other polynucleotide under the appropriate conditions of temperature and solution ionic strength {see Sambrook, et al., supra). The conditions of temperature . and ionic strength determine the "stringency" of the hybridization. An example, of a non-stringent wash condition under which a membrane comprising hybridized polynucleotides may be washed of excess, non-
hybridizing polynucleotides is 2X SSC at 65°C; whereas a stringent wash would be 0. IX SSC at 65°C. Alternatively, a stringent wash can include a series of washes at 65°C in decreasing salt
concentrations (e.g., 3xSSC/0.2% SDS, then Ix SSC/0.2% SDS} . A hybridization condition may be 6x SSC; 0.2% SDS; lx Denhardt's blocking solution, or 1% w/v milk; 10-50 ng/ml probe (denatured first); 65°C incubation, with agitation, for 18-24 hours. A recipe for 20X SSC per liter is NaCl 175.3 g (3 molar final in 20X) Sodium Citrate 88.2 g (0.3 molar final in 20X) (Adjust pH to 7.0 with a few drops of 10 N NaOH) .
Also included in the present invention are fungal host cells (e.g., a Pichia cell such as Pichia pastoris) overexpressing polynucleotides encoding homologues of C. albicans CYB2 (e.g., SEQ ID NO: 18), S.cerevisiae CLB2 (e.g., SEQ ID NO: 19), S.cerevisiae CLB4{e.g.f SEQ ID NO: 20), S.cerevisiae CLN4 (e.g., SEQ ID NO: 21), S . cerevisiae CLN3 (e.g., SEQ ID NO: 22) or S.cerevisiae CDC28 (e.g., SEQ ID NO: 23); e.g., wherein the homologue in Pichia pastoris is Pichia pastoris gene Pp05g03580 Pp02gl2160, Pp05g03580, Pp01g00590, Pp01g03460, Pp01g07380 or Pp05g06140 or a variant thereof; e.g., comprising the nucleotide sequence set forth in a member selected from SEQ ID NOs : 1-5 and 17; or comprising a nucleotide sequence that differs from that set forth in SEQ ID NO: 1, 2, 3, 4, 5 or 17 at about 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides; or comprising a nucleotide sequence that is at least about 70% (e.g., 75%) identical, preferably at least about 80%
(e.g., 84% or 85%) identical, more preferably at least about 90% identical and most preferably at least about 95% identical (e.g., 96%, 97%, 98%, 99%) to SEQ ID NO: 1, 2, 3, 4, 5, 17, 18, 19, 20, 21, 22 or 23 when the comparison is performed by a BLAST algorithm wherein the parameters of the algorithm are selected to give the largest match between the respective sequences over the entire length of the respective reference sequences. For example, in an embodiment of the invention, the Pichia pastoris homologue of C. albicans CYB2 exhibits about 75% nucleotide sequence identity to the C. albicans gene, e.g., over about 291 nucleotides. In an embodiment of the invention, the Pichia pastoris homologue of C. albicans CYB2 also exhibits identity to C. albicans CLB4, e.g.,
about 84% nucleotide sequence identity, e.g., over about 50 nucleotides. In an embodiment of the invention such a homologue or variant exhibits cell cycle control activity (see e.g., above) .
In an embodiment of the invention, the fungal host cells (e.g., a Pichia cell such as Pichia pastoris) overexpress
polynucleotides encoding C. albicans CYB2 (e.g., SEQ ID NO: 18), S . cerevisiae CLB2 (e.g., SEQ ID NO: 19), S . cerevisiae CLB4(e.g. , SEQ ID NO: 20), S. cerevisiae CLN4 (e.g., SEQ ID NO: 21),
S . cerevisiae CLN3 (e.g., SEQ ID NO: 22) or S. cerevisiae CDC28 (e.g., SEQ ID NO: 23) or a variant thereof, e.g., see supra.
The following references regarding the BLAST algorithm are herein incorporated by reference: BLAST ALGORITHMS : Altschul, S.F., et al., (1990) J. Mol. Biol. 215:403-410; Gish, W., et al., (1993) Nature Genet. 3:266-272; Madden, T.L., et al., (1996) Meth.
Enzymol. 266:131-141; Altschul, S.F., et al., (1997) Nucleic Acids Res. 25:3389-3402; Zhang, J., et al., (1997) Genome Res. 7:649-656; ootton, J.C., et al., (1993) Comput . Chem. 17:149-163; Hancock, J.M. et al., (1994) Comput. Appl. Biosci . 10:67-70; ALIGNMENT SCORING SYSTEMS : Dayhoff, M.O., et al., "A model of evolutionary change in proteins . " in Atlas of Protein Sequence and Structure, (1978) vol. 5, suppl. 3. M.O. Dayhoff (ed. ) , pp. 345-352, Natl. Biomed. Res. Found., Washington, DC; Schwartz, R.M., et al. ,
"Matrices for detecting distant relationships." in Atlas of Protein Sequence and Structure, (1978) vol. 5, suppl. 3." M.O. Dayhoff (ed.), pp. 353-358, Natl. Biomed. Res. Found., Washington, DC;
Altschul, S.F., (1991) J. Mol. Biol. 219:555-565; States, D.J., et al., (1991) Methods 3:66-70; Henikoff, S., et al., (1992) Proc. Natl. Acad. Sci. USA 89:10915-10919; Altschul, S.F., et al. , (1993) J. Mol. Evol. 36:290-300; ALIGNMENT STATISTICS : Karlin, S., et al., (1990) Proc. Natl. Acad. Sci. USA 87:2264-2268; Karlin, S., et al.,
(1993) Proc. Natl. Acad. Sci. USA 90:5873-5877; Dembo, A., et al.,
(1994) Ann. Prob. 22:2022-2039; and Altschul, S.F. "Evaluating the statistical significance of multiple distinct local alignments." in Theoretical and Computational Methods in Genome Research (S. Suhai, ed.), (1997) pp. 1-14, Plenum, New York.
Sequences
The present invention includes fungal host cells {e.g., a Pichia cell) such as Pichia pastoris which overexpress homologues of C. albicans CYB2 (e.g., SEQ ID NO: 18), S.cerevisiae CLB2 (e.g., SEQ ID NO: 19), S.cerevisiae CLB4(e.g.f SEQ ID NO: 20),
S.cerevisiae CLN4 (e.g., SEQ ID NO: 21), S.cerevisiae CLN3 (e.g., SEQ ID NO: 22) or S.cerevisiae CDC28 (e.g., SEQ ID NO: 23} which exhibit superior levels of robustness, expression and/or secretion of heterologous proteins. Such homologues include the Pichia pastoris Pp02gl2160, Pp05g03580, Pp01g00590, Pp01g03460, Pp01g07380 or Pp05g06140 genes (e.g., SEQ ID NO: 1, 2, 3, 4, 5 or 17).
In an embodiment of the invention, such a homologue or variant is operably linked to a promoter in said fungal host cell; e.g., wherein the fungal host cell overexpresses such a homologue or variant relative to that of a wild-type fungal host cell {e.g., NRRL-yll430) lacking such a polynucleotide linked to a promoter.
In an embodiment of the invention, C, albicans CYB2 comprises the following nucleotide sequence:
ATGCGATCTTATAAATCATCCATAACGGATGAAAATGAGTTGACAAAACAAAGACTTAGA GCCAAAAGTATTGCCAATTTGAGCAGCAATCACACAACAGCTGGGCAACCATCAACAAGC TCTCAACATAGAGAGGCATTGACTGATTTGACCTCACAGGAGAATAAAAATCACCCAAGA GTGAAACTAACACAAACAAACACCAATCATCACAGAAACAGCTCAAG AGTTCGAACAAA AT C AATATATCAAC AA AGAGC AAAGAAAACCGA ATCCATCAGTTCAAAAAACCA AGATTGGAGAAGGTATTACTAAATGACGACGACGATGAAACCGATGACGAATTTGACGAC GAAGAAGATAAAGAAAACAGATATCATGATCTAGAGTTGAATGAAGATGACAGTAAACAT CAACTAATAAGTGAAGCATTTGAAACAATTGATGATCGGGGAATAAGTGAGGGTGAAAAT GATACAGCGCAAGAAGCACGTGAAAGATTAGAGGAAGAAACACAATCACATACACAGGAT ATGAGATCAATATATGGGGTTCATGTGCCCATGCAACCAATGTGGAATAATGCGATAATA AACGAGCTCAAATACGTTATACAAAAGTACTCTCGTAATACGTTGGACGAAAATGACGAA GATACTTATGATACTACCATGGTGGCAGAATATTCACCGGAAATTTTCAATTACTTGCAT GAACTTGAAAATAAGTTTACACCTGATCCAAATTATATGGATTTCCAAGACGATCTAAAG TGGGAGATGCGTGCAGTGCTTATTGATTGGGTCGTCCAAGTGCATGCTCGATTCAACTTG TTTTCAGAAACCTTGTACTTGACTGTAAATTACATTGACAGATTCTTATCCAAGAGAAGG GTGTCATTATCCAGATTTCAGTTAGTTGGAGCAGTAGCATTGTTTATTGCTGCCAAATAC GAAGAAATCAATTGTCCTACAGTCCAAGAAATTGCATACATGGCAGACAATGCCTATTCA ATCGACGAGTTTTTAAAAGCCGAGAGATTTATGATTGATGTATTGGAATTTGATTTGGGA TGGCCAGGGCCAATGTCGTTTTTGAGAAGAATATCAAAAGCTGACGATTATGATTATGAA
ACTAGAACACTTGCCAAATATTTTCTTGAAATAACTATAATGGACTCAAAATTTGTTGCT
TCTCCACCAAGTTGGTTGGCCGCTGGAGCACATTACATATCAAGAATACTATTGGGAAGA GGTGAATGGACAGAATTGCATGTTTTTTATAGTGGCTATACCGAAAAGCAATTGCAGCCA TTGGCAGACGTTTTGTTAGAGAACTGTCGCCATGCTGAAATAAACCATAAAGCCATTTTC GAAAAA ACAAGGAAAGAAGGTATAGAAAAAGTTCACTTTTTGTTC AGAA ATTTTCGT CACATAATGTCCCAGAGTTGA {SEQ ID NO: 18),
In an embodiment of the invention, S.cerevisiae CLB2 comprises the following nucleotide sequence:
ATGTCCAACCCAATAGAAAACACAGAAAACTCACAGAATACTAGTTCATCAAGGTTTTTG AGGAATGTACAAAGGTTGGCCTTAAACAATGTAACAAATACGACATTTCAAAAGAGTAAT GCGAATAATCCAGCCCTAACAAATTTCAAATCTACACTAAACTCAGTAAAGAAGGAGGGA AGTCGGATTCCTCAATTTACTAGAGAAAGCGTATCAAGATCAACAGCCGCACAAGAGGAG AAAAGAACCCTGAAAGAAAATGGTATCCAACTCCCCAAAAACAATCTTTTAGATGATAAA GAAAACCAAGACCCAAGTAGTCAGCAATTTGGTGCGCTAACTTCTATAAAGGAGGGGAGA GCTGAGCTGCCTGCAAATATAAGTTTACAAGAATCCTCCTCAGCGAAGGAGATAATCCAG CATGATCCCCTAAAAGGCGTTGGATCAAGCACTGAGGTAGTCCATAACTCGGTAGAAAAC GAAAAACTTCATCCAGCTAGAAGTCAACTTCAAGTTAGAAATACCGAAAGTGAAACTGAT AGTGGAAAAAAAAGACCAATTTCTACAATTGTTGAACAAGAACTGCCCAAAAAGTTTAAA GTGTGCGATGAAAATGGCAAAGAAGAATATGAATGGGAAGACCTAGATGCAGAAGATGTA AATGATCCATTCATGGTCAGCGAGTACGTCAATGATATATTCGAATATCTCCACCAACTA G GGTCATTACTCTTCCAAAG AGGAAGATCTCTATCAGC TAGAAA ATTCATCAAAAT CGAGATATCCTAGTTAATTGGTTGGTTAAAATCCATAATAAATTCGGCTTATTACCGGAG ACTTTGTATCTTGCCATTAACATAATGGACAGGTTTTTAGGTAAAGAGCTAGTTCAACTG GATAAGTTACAATTGGTTGGCACATCATGCCTTTTCATTGCCTCTAAATATGAAGAGGTC TATTCTCCTAGTATAAAACATTTCGCATCAGAGACAGACGGTGCATGTACGGAAGATGAA ATCAAAGAAGGGGAGAAATTCATTTTAAAGACATTGAAATTTAACCTAAATTATCCCAAT CCGATGAATTTTCTGAGAAGAATTTCGAAAGCAGATGACTACGATATACAGTCTCGAACT CTTGCCAAATTCTTATTAGAGATATCATTGGTAGATTTCAGATTTATTGGGATACTACCC TCATTGTGTGCAGCAGCTGCGATGTTTATGTCGAGAAAAATGTTAGGTAAAGGTAAATGG GATGGAAATCTAATACACTATAGCGGCGGGTATACTAAAGAAGAACTTGCGCCCGTGTGT CACATGATAATGGATTATCTAGTGAGTCCAATTGTTCATGATGAATTTCATAGAAAATAT CAATCTAGAAGATTTATGAAAGCTTCTATAATTTCCGTCCAATGGGCTTTAAAGGTTAGA AAAAACGGCTATGATATAATGACCTTGCATGAATGA
(SEQ ID NO: 19)
In an embodiment of the invention, S.cerevisiae CLB4 comprises the following nucleotide sequence:
ATGATGCTTGAAGGGTATACGGTACAACCTCCACAGTCTACTTTGATAGGTGACATTGAA
ATTCAGGACGAAAATGCAAACCAAGAAGTTAAGAACGTACTTTACCAAGGAGTTCAAAAG
GGTATAAAAAGGCTAGAAAAAAGACAAAGGAGGGTTGCATTAGGTGATGTAACCTCTCAA AAGGCAAACAAAATACACAATGCTATACATAATAAATTCCATCAGACGAAGAACAATTTT GAAATAGAGAACATACGCTCATCGGCCTTGGTAAAAGAACAACAACGAGACGTAAGGCAT GAAGATAGCGACTATTTTTTAATTGATAGTTCTGAAGGCTCTTCTACTGATGACGAACAA GTTAATGAAGA GCTATTGATGATTTGT AGTCGAAGAG AAATGATCAGC GATTCAA GCCGATGAAGTGTATGAAGATTTCGATGGAGAAATGCAAGATGTCATTGAAGAGGATGTT GATAGTCAAATTGAACCACTATCACCAATAAACAACGATGAAATTCAGACTGAGCTGGAC AGGGCGTTTGAAAAATATTTTCGGTCGGTTCCCAATCCGCTGGATGATGATACCCATGAT GTTGTGATGGTTGTGGAGT CGCTTCCGACATATTCTATTACTTGAGAGAACTTGAAGTG AAATATAGGCCTAATCCCTACTATATGCAAAATCAAGTAGAGCTTACATGGCCGTTCAGA CGAACTATGATAGATTGGCTAGTTCAACTGCATTTTAGATTTCAACTTTTACCAGAAACG CTATACCTGACGATTAATATAGTGGATAGATTTCTGTCAAAGAAGACCGTTACTTTGAAC AGGTTTCAATTGGTTGGTGTATCGGCTTTATTTATTGCTGCCAAGTTTGAAGAGATTAAC TGCCCCACTTTGGATGATCTAGTTTACATGCTGGAAAATACATACACTAGAGATGACATT ATTAGAGCGGAACAGTATATGATAGATACTCTGGAATTTGAAATAGGTTGGCCAGGACCC ATGCCATTTTTAAGAAGGATAAGTAAAGCAGATGACTATGACTTCGAACCAAGAACATTA GCAAAGTACTTATTGGAAACTACAATAGTAGAACCCAAACTAGTGGCTGCGGCACCAAGC TGGTTAGCTGCTGGCGCGTATTTTCTGAGCAGAACAATTCTTGGTTCAAATGATTGGTCT TTAAAACATGTATTCTACTCTGGCTATACATCCAGCCAAATAATTCCTTTAGCATCACTG ATATTGGAGAATTGCAAGAACGCATCTCGACGCCATCATTCAATTTGGAAAAAATACTTT GACCAAAAGCATTACCGCTGTTCTCAAATTGTAGAAGAATGGATTGTTTCGACAGAAGCC TAA
(SEQ ID NO: 20)
In an embodiment of the invention, S.cerevisiae CLN2 comprises the following nucleotide sequence:
ATGGCTAGTGCTGAACCAAGACCCCGTATGGGACTCGTCATCAATGCTAAACCGGACTAC TATCCGATTGAGCTATCTAATGCAGAATTACTTTCTCACTTCGAAATGCTGCAAGAATAC CACCAAGAAATCTCCACCAATGTTATTGCTCAATCATGTAAGTTCAAACCTAATCCAAAA C ATAGACCAGCAGCCTGAAATGAACCCCGTGGAAACAAGGTCCAACAT TC CTTTT TTGTTCGAGCTGTCTGTGGTCACTCGAGTGACAAATGGTATTTTTTTTCATTCAGTTAGA TTATATGACCGCTATTGTTCCAAGAGAATCGTGTTACGGGACCAAGCCAAATTGGTTGTC GCTACTTGTCTCTGGTTGGCTGCTAAAACTTGGGGCGGTTGTAATCACATCATCAATAAT GTAGTCATCCCTACTGGCGGAAGATTTTATGGTCCCAACCCAAGGGCACGTATACCTCGA CTCTCTGAACTAGTTCATTACTGTGGTGATGGTCAGGTCTTTGATGAATCAATGTTTTTA CAAATGGAAAGACATATACTAGACACTTTAAATTGGAACATTTATGAACCAATGATCAAT GATTACGTTTTA ATGTTG TG AAATTGTTTGATGCAATACGAACTT ATGAA ATCAA
GTTACTTATGACAAACAATGCTCTGAAAAACGTCAGTCTCAATTATCCCAGGATAGTGAT
GCCACTGTAGACGAGAGGCCCTACCAAAACGAAGAAGAAGAAGAAGAAGACTTAAAACTA AAGATCAAGTTGATTAATTTGAAAAAATTCTTGATTGATGTATCCGCGTGGCAGTACGAC TTACTTAGATATGAACTTTTCGAAGTATCGCACGGCATATTCTCCATTATCAATCAATTC ACCAATCAAGACCACGGTCCTTTTTTAATGACTCCAATGACATCAGAAAGCAAAAATGGT GAAATTTTGAGTACCTTAATGAACGGCATTGTTTCCATTCCTAACTCCTTGATGGAAGTG TATAAAACGGTCAATGGTGTTCTACCCTTCATTAATCAAGTGAAAGAATATCACTTGGAT CTACAAAGAAAACTGCAAATTGCATCCAACTTGAACATTTCGAGAAAGCTTACCATATCA ACCCCATCATGCTCTTTCGAAAATTCAAATAGCACATCCATTCCTTCGCCCGCTTCCTCA TCTCAAAGCCACACTCCAATGAGAAACATGAGCTCACTCTCTGATAACAGCGTTTTCAGC CGGAA ATGGAACAATCATCACCAA CAC CCAAGTATG ACCAATTTGGTCAGCAGCAG TCAAACAGTATATGTGGTAGCACCGTTAGTGTGAATAGTCTGGTGAATACAAATAACAAA CAAAGGATCTACGAACAAATCACGGGTCCTAACAGCAATAACGCAACCAATGATTATATT GATTTGCTAAACCTAAATGAGTCTAACAAGGAAAACCAAAATCCCGCAACGGCGCATTAC CTCAATGGGGGCCCACCCAAGACAAGCTTCATTAACCATGGAATGTTCCCCTCGCCAACT GGGACCATAAATAGCGGTAAATCTAGCAGTGCCTCATCTTTAATTTCTTTTGGTATGGGC AATACCCAAGTAATATAG
(SEQ ID NO: 21)
In an embodiment of the invention, S.cerevisiae CLN3 comprises the following nucleotide sequence:
ATGGCCATATTGAAGGATACCATAATTAGATACGCTAATGCAAGGTATGCTACCGCTAGT GGCACTTCCACCGCCACTGCCGCCTCTGTCAGCGCTGCCTCATGTCCTAATTTGCCCTTG CTCTTGCAAAAGAGGCGGGCCATTGCTAGTGCAAAGTCTAAAAACCCTAATCTCGTTAAA AGAGAATTGCAAGCACATCACTCAGCGATCAGCGAATACAATAATGATCAATTGGACCAC TATTTCCGTCTTTCCCACACAGAAAGGCCGCTGTACAACCTGACTAACTTCAACTCTCAG CCACAAGTTAATCCGAAGATGCGTTTCTTGATCTTTGACTTCATCATGTACTGTCACACA AGACTCAATCTATCGACCTCGACTTTGTTCCTTACTTTCACTATCTTGGACAAGTATTCC TCGCGGTTCATTATCAAGAGTTACAACTACCAGCTCTTGTCCTTGACCGCGCTTTGGATT TCGTCCAAATTTTGGGACTCCAAGAATAGAATGGCCACTTTGAAAGTCTTGCAAAACTTG TGTTGCAATCAATATTCTATAAAGCAATTCACGACTATGGAAATGCATCTTTTCAAATCA CTCGATTGGTCCATCTGTCAGTCGGCAACATTCGACTCCTACATCGACATCTTCTTGTTC CAATCTACGTCCCCGTTATCGCCTGGCGTTGTCCTTTCTGCCCCTTTGGAAGCTTTCATT CAACAGAAACTGGCCTTATTAAATAACGCTGCTGGTACTGCTATTAATAAATCGTCCTCT TCTCAAGGCCCCTCTTTGAACATCAACGAGATCAAATTGGGTGCCATTATGTTGTGCGAG TTAGCTTCCTTCAATCTCGAATTATCATTTAAATATGATCGTTCACTAATTGCGCTGGGT GCAATTAACCTCATCAAATTATCTTTGAACTACTATAATTCAAACCTTTGGGAAAATATC AATCTGGCTTTGGAGGAAAACTGCCAAGACCTAGATATTAAA TGTCAGAAATCTCTAAT
ACTTTATTGGATATAGCAATGGACCAAAATTCTTTCCCCTCCAGTTTCAAATCAAAATAT
TTGAATAGCAATAAGACATCTTTAGCAAAATCTCTCTTAGACGCATTACAAAACTATTGT ATTCAATTGAAACTGGAAGAATTCTACCGTTCACAAGAATTGGAAACCATGTACAATACT ATCTTTGCTCAGTCCTTTGACAGCGATTCATTGACTTGTGTTTACTCAAATGCTACTACT CCAAAGAGCGCTACGGTTTCATCTGCGGCCACAGACTATTTCTCGGATCACACTCATTTA AGAAGGTTGACCAAAGATAGCATTTCTCCACCATTTGCCTTCACTCCAACCTCATCTTCA TCCTCTCCATCTCCATTCAATTCCCCTTACAAGACTTCAAGTTCAATGACGACCCCAGAC TCTGCATCACACCATTCACATTCAGGTTCGTTCTCTTCTACCCAAAATTCTTTTAAAAGG TCACTGAGCATCCCACAAAATTCAAGCATCTTTTGGCCAAGCCCACTAACTCCCACCACC CCATCTCTAATGTCAAATAGAAAATTATTACAAAATTTATCTGTGCGTTCAAAAAGATTA TTTCCTGTTAGACCCATGGCCACTGCTCACCCATGCTCTGCCCCCACCCAACTGAAAAAG AGATCAACTTCCTCTGTGGATTGTGATTTTAATGATAGTAGCAACCTCAAGAAAACTCGC TGA
( SEQ ID NO: 22)
In an embodiment of the invention, S.cerevisiae CDC28 comprises the following nucleotide sequence:
ATGAGCGGTGAATTAGCAAATTACAAAAGACTTGAGAAAGTCGGTGAAGGTACATACGGT GTTGTTTATAAAGCGTTAGACTTAAGACCTGGCCAAGGTCAAAGAGTAGTCGCATTGAAG AAAATAAGACTAGAGAGTGAAGACGAGGGTGTTCCCAGTACAGCCATCAGAGAAATCTCA TTATTGAAGGAATTAAAAGACGATAATATTGTCAGATTATACGATATTGTTCACTCTGAT GCACACAAGCTATATCTTGTTTTTGAGTTCCTCGATTTGGACCTGAAAAGATATATGGAG GGTATTCCAAAGGACCAACCGTTAGGAGCTGATATTGTTAAGAAGTTTATGATGCAACTT TGTAAGGGTATTGCATACTGCCACTCACACCGTATTCTGCATCGTGATTTAAAACCGCAG AACTTATTGATTAACAAAGATGGGAATCTAAAACTAGGTGATTTTGGCTTAGCGCGTGCT TTTGGTGTTCCGTTGAGAGCTTACACACATGAAATTGTTACTCTATGGTATAGAGCTCCG GAGGTATTACTGGGTGGAAAACAATATAGTACAGGTGTCGATACATGGTCCATCGGCTGT ATATTTGCCGAAATGTGTAACAGGAAACCAATCTTCAGTGGCGATAGTGAGATCGATCAG ATTTTCAAGATATTCAGAGTATTGGGAACGCCGAATGAAGC AT TGGCC G TATTGTC TACTTGCCTGATTTCAAGCCAAGCTTTCCTCAATGGCGCAGAAAAGACCTATCACAAGTG GTACCAAGTCTAGATCCACGCGGTATTGATTTGTTGGACAAACTCCTCGCGTATGACCCT ATTAACCGGATTAGCGCCAGAAGAGCAGCCATCCACCCCTACTTCCAAGAATCATAA
(SEQ ID NO: 23)
SEQ ID NO: 1 - Pp02gl2160 ORF sequence; ScCLB2 homolog atggacatcacaatagtggaaactgctagttcagtagcaaatgtttttccagaaaatatt caaaaagagaatatcctctcgggaccagctgatcgcaatagaaacacaaagtcttcgctc aagagatctgctaccattacggacgtgccccaggtaacgaacaaaaaagccaaggtagac
tattcttgggacgacctggatgctgatgattcggatgatcctttgatggtcagcgagtat gttggtgaaatcttcgagtatttgcatcgattagagaaggagacgttaccagaccccaac tacctgcaatggcaaaaatcattcaaacccaaaatgagatccattctggtagattggctg gtcgaagttcagttaaagtttcgtctgttgccggagactctgtatctctcaattaatatc atggatcgctttttgtccaaagaacccgttcaaataaataaacttcaattgctggcaact ggttgcattttcatatcagcaaagtacgaggaggtctattctccgtctataaaatattac gcccaagatagtgggttttccgaggaagagatcttggacgctgagaaattcattttggag atattggatttcaatataaactaccccggagcaatgaattttctgagaagaatctccaag gcagatgactacgacgttcagtcaaggacaataggaaagtatctgttggaaataaccatt ttgatcacaagtttttaggtgtactaccatccctgtgcgcagcagcttcgatgtacgtt gctcgcaaaatgttagggagatatgagtggaacggtaacctaatacattattccggaggc tatactgaagcccatttgaaagaaacttgtgagatgctaattgattatttggtatctccc atcattcatgaagaatttttcaaaaaatatgcatcaaagaagttcatgaaggtgagcatt cttgcaaggcaatgggcaaagaaagtcaccacagaaggaagaagcatcatggatccaatt ttgtag
SEQ ID NO: 2 - Pp05g03580 ORF sequence; ScCLB4 homolog atgt caaacacattgcaccaccgagatccacatacggagaggaaaacaaccatgttatc gacctcagtatcgttctaagaaccaaggggcaacagactcggccaattcccagtcccag ccccgtctggcgctgggccagttgcccactgagcaaaatcgcccaatcctggtggaaaac aataggctgaaaaacaatgaaaacaaaatccccgtatatgtagagcctcatccgaaagag tcacagtcgcaggaccatgacagtgacgataccgaagacagcattgaattcgaagaactc gaggacgactttggcgagttggaccaagatgtcttggactcagaccaacagccccaatct ttgcattccactgactcagaggtcgaagagtctataaggagttttacacagcacaggcat actttgcagtcctccacgactggggataccaccacaacagcaccaacagctaactctggg tctgtggttcccctactcccagtgtgggactcccgtatccaccacgaactaacctacgtg aattccaaattccaaagggatagccccgatgaggatgatgaggacacttatgatgttacc atggttgccgaatacgcgccagacatcttcagatacatgcgacaattggaggctcgtctt tcacccaaccctcgttacatggatagccaaaacgaactcgaatggcacatgagaaggact cttgtcgactggctggttcaggtacactcacgtttcaacttgctgccggaaacacttttc ttgacggtcaattacatagaccgttttttaagtaaacgaactgtttccgcctcaaggttc caactagtcggtcttgtggccctattcattgctgccaaatacgaggagatcaactgccct tcaatccaggaagttgcatctcttatcaacaacgcctattctattgacgatttgttaaga gctgaaaaattcatgattgatattcttgaattcgaaatgggctggccaggaccaatgtca ttcctcagaagaacttcaaaggctgatgattacgattttgatacgcgtactctggctaag tattttttggaaattacaatcatggattcgaaactggtcgcctccccacctagttggtta gccgcgggtgctcatt ccttgcacgtcgattactgaacagaggttcatggactgatgct
catatattttactcgggctacacagaggagcaactgacaccattggccgacatgatggtg caaatgtgtcgacaccctcttagacatcaccgtacaatctttgaaaaatactccgaacgt cggtacaagcgatcagccgaattcgttcaagaatggatgcgtatgcgttta ga SEQ ID NO: 3 - Pp01g00590 ORF sequence; ScCLN2 homolog atgtcttttaatggcaagttccgttacaagcacgatccgaagcagta cccaactcgctg gtgttcaaagaagtcaccactcatagagatgttgtaggggaatacgtcaaggaactttcc atgtcctcttttgaggacgctaacatgttcaaacctgacattaatctgatcagccagcag ccccagcttacattggacctgagatcgcctcttctggactttctgttcaaagttttcatc aaaaccagaatttgcagtcatcttttctataggagtgtacgtttgttggatagatactgt tcaaagagaatcgtcctagtcgaccaggctcagttagttgcctcaacctgtctatggatt gtcgccaaagtggacggtggctgcaaccactgtctttcgtcttcttcatgtccaattgga ggtagattcgaaggacccacaaagagagcccgtatcccaagattgaccgagttgtgccaa ttatgtgggccttcttgcaattacgacgagggcatgttcatccagatggaacgacacatt ttggacactttaagttggagcgtcaccgagcctggcatcgatgaatggattatggacgtg gacagcagccaaaacatgaccaatttccttcctttagacaaagaagcagccatcagcctc aaagagttcatgatcaactgcaccctgtacaaccctgaactt tttctaatcatccggcc caggtggcagcttcaattaatgacatttacgacaaactacaatcacaaggacacagtcaa ggacgcagattaatgtcacagcaaagcaaacaatcaaccctatatacaacaactccatct catcaaatagcatctctaaacccaaacctaccattgttgtctcctcctcatacatcttca catcccaaactggaagagccagccatcaataagaacactactatcacagttttacaatgc atagtcgatgctactgatactctagtatccacttactgtgcacactctccagtcaaagag tttcaaaagatggcccagatgcaattggtgtcattgaaatccagacaatttagtgcacac tctccattctctttaacaggacaagaagaagacatattctccgaagacacctactgggag tctggagacgagtcattcgattctatttttgaacctcccaccatgaaattcaagaaccat tcactcagctctgtgagctcatcacccacagaacaccattcaccaacaatttcgattaca aagccttggatatcacaatctcctcgcaagagccctaccttatcacaagtagcttctcgt taccgcaaggtttcataa SEQ ID NO: 4 - Pp01g03460 ORF sequence; ScCLN3 homolog atgacgacaaggagacttcctcgaccaatctccaaaagagaacaagagatttacaagttg ggaccgcccaggaacaccaaacctggagctacaaatttagagttggacaaatatgaacaa atttgcaacaggaaacttatcgatgagtacttaaacgatgtcttgcattaccatgccgct ttagaggaattagatcctgttaacgcgaggatgattgacttgcaaccagagatcagttgg tatatgcgtccttatctgattagctttctgattgaggttcatttatcctatcgtctgaag gcttccaccttatttttgtgtgtcaatttgattgatagatattgttctaggagaattgtc ttcaaacagcactatcaactggtgggatgcaccgctctgtggattgccgccaaatatgaa
gataagaagtccagggttcctttgttgaaagatttagtactgatgacccagaatagtttt gatgagtct tgtttaaagagatggagttgcatatgttgagcactttggattggcaaatc ggccatgtgtctttggaagagaatttgcaatcaataatgttatgctttgaaatcgactca ctaactgtctcccaccacgttacaggtgatcataaagcgcttcgaagcgcgctagtggcc atttcccgttatctttgcgaactatcgctctatcataggagtttcatatgtgtttctcca aacataatcgctaccactgctacgctaatctcttgtacagtgttggagatatctaacgga acagaatttatagatgaccttgtacaagatatcctaagagataagcaacaacctgaaaat tatgatattgatgatatggatgatatcttcttctcagacaatgaagatgaacttaatgat gaaaatgaaccctcatacaactctcgtgtcatgtgtcctccgtttgttaccaactttgac ggtgaacaaacacttcgagtgatgaagttagtagcacttctatttttgacatgtatgttg gatcccccggatattttggttgacaaatataagcctttgggtgtgatagacgtactttct ggatatctttcaacgaagcaagatcacattcaacatcaaatggatatgctagatccttct aagctggactttgaagcctcagagaaaacatatcaacttctacttgagactaatccacaa ttactacaaacggccgaatggctactgagtatcacagaaatcaaatcatcaatctctttc cagctaccccacactccaaaccaagaagaatcctctgaatctctttatagagatacaatt tactcgcttccaaaatatcccgacacaacaaattacactgccaagagctcaagagatacg ttaatgttatcctcatctccttcgatgcctccactcactccaccatctgtcgcatctacg cacttttcaagttcttctatgagaagcccatcccatgttgtttcctatgaaaacaaccct gccaagaaacaagtga'ttacttatccgtcttcatcaccgatatttaattag
SEQ ID NO: 5 - Pp01g07380 ORF sequence; ScCLN3 homolog atgtcgctttcacctgatgcttaccatggcttacgccaacgtcaagcgtctttgcgagcg caatgtcctcaactcaaaatgatggaacttcgggcacatactaatactgttgctgactac caccacactattttactacaccacttgaaactggagcagactacaagacctcagccacag tctatcgctatgcaacctgaaatcaggttacggatgagaccaatgcttttggatcatctt gtcgacatattcttacaattcaagctcagttatgtcacatttttcttgacagttaactta cttgatcgctacacatccctgcgagtggtcagaaagcaacactaccagctattgggactg acgtgcctgtggatagcagcaaagtactcagagaagaagacacgcgtacctacggttcat gatcttaccaggttgtgtttgaatacatactccaaaaccttgttcttggagatggaatct catattttgaaaagcttagattggaacattgggttcagcactcataacgtttttcttgat cttgtacttcaagaacaacctgatatagtctccaatacaccccacaatttgcacgatctc aaaatgggtgctatctatttatgtgagttagctcaattccatccgagaatctgttttcat tactctgcgagtgccattgctgttgctgctcttgctttagtggtagatgctattggtata gcgccactggttggtggtcctctggtagcacgattagatgctgatcttccccatcatttg ctggctcttgtcgcatgcccgccaccaagtttgcgagtgaagtatgcttccccgggttat gctatcaatgctcttcattgccatcaccaggttcagacattagttccttcacctcgatct tctcctgtttctgttagatccagttttaccccgtatgcgtctccggtttcatctgttgcc
tcctctgcaggcaccatttcaccgtaccactatgacatagcacttgaggaaaagaagagg cagtctgcggattcggaa attttcggtctgaacagaaaaaaatgcgacaattctag
SEQ ID NO: 17 - Pp05g06140 ORF sequence; ScCDC28 homolog
atgggggaattagctgactatcaaagactggagaagatcggagagggtacctacggtgtcgtttata aagcgctcgatataagacacaataaccgggtggtagcgctgaaaaaaatcagattagagtccgagga cgaaggtgtgccttccaccgccatcagagagatctccctgttgaaagaactgaaagatgacaatatc gtccgattgtatgacatagtccattctgactcgcataagctgtatctagtgtttgaatttttggatt tggacttcaaaaaatacatggaatcgattccacagggtgcagggttgggagctgccatggtaaagcg attcatgattcaattgatccgaggaatcttgtactgccactcgcacaggatcttgcatagagacctt aagcctcagaatctacttattgataaagagggtaacttgaagttggcagatttcggtcttgccagag catttggtgtgcccttgcgtgcctacacacatgaagttgttacactttggtacagagccccagagat cttactaggaggcaaacagtattctacaggagtggatatgtggtctattggatgtatctttgcagag atggtcaacagaaagccattgttcgcaggagattcagaaattgaccagatattccgaatcttcaggg tgttgggaactcccaacgaggaaaactggcccgaagtcaattacctccctgacttcaagcccacatt tcccaaatggggtagaaagagcttagcttcggtcgttacttcgttggacgctgacggtattgacctt ttagagcgcttgcttgtctacgacccggccggccgaatctccgccaagcgtgctcttcagcactcct acttctttgatgatgcaatcactgctccgcttaccgatgctgatcacgagctacaccaatccaacat gcaagtggacacttcagcagtgtatacttga
SEQ ID NO: 6 - Pp02gl2160 5' PCR primer (vector seq underlined) 5 ' -TTATTCGAAACGGAATTCGAAACATGTCTAATGTTCAGCCTAACG-3 '
SEQ ID NO: 7 - Pp02gl2160 3" PCR primer (vector seq underlined) 5 ' -GGCCTGTATTTAAATGGCCGGCCCTACAAAATTGGATCCATGATGC-3 '
SEQ ID NO: 8 - Pp05g03580 5' PCR primer (vector seq underlined) 5 * -TTATTCGAAACGGAATTCGAAACATGTCCAAACACATTGCACCACCG-3 ' SEQ ID NO: 9 - Pp05g03580 3' PCR primer (vector seq underlined) 5 ' - GGCCTGTATTTAAATGGCCGGCCTCATAAACGCATACGCATCCATTC-3 '
SEQ ID NO: 10 - Pp01g00590 5' PCR primer (vector seq underlined) 5 ' - TTATTCGAAACGGAATTCGAAACATGTCTTTTAATGGCAAGTTCCG-3 '
SEQ ID NO: 11 - Pp01g00590 3' PCR primer {vector seq underlined) 5 ' - GGCCTGTATTTAAATGGCCGGCCTTATGAAACCTTGCGGTAACGAGAAG-3 '
SEQ ID NO: 12 - Pp01g03460 5' PCR primer {vector seq underlined) 5 ' - T AT CGAAACGGAATTCGAAACA GACGACAAGGAGACTTCCTCG-3 T SEQ ID NO: 13 - Pp01g03460 3' PCR primer (vector seq underlined) 5 · - GGCCTGTATTTAAATGGCCGGCCCTAATTAAATATCGGTGATGAAG-3 '
SEQ ID NO: 14 - Pp01g07380 5T PCR primer (vector seq underlined) 5 ' - TTATTCGAAACGGAATTCGAAACATGTCGCTTTCACCTGATGCTTACC-3 '
SEQ ID NO: 15 - Pp01g07380 5' PCR primer (vector seq underlined) 5 ' - GGCCTGTATTTAAATGGCCGGCCCTAGAATTGTCGCATTTTTTTCTGTTC-3 '
SEQ ID NO: 16 - AOX1 promoter specific PCR check primer
5'- GCTTACTTTCATAATTGCGACTGGTTCC-3 '
Host cells
The present invention encompasses any isolated fungal host cell (e.g., Pichia pastoris) wherein a homologue of C. albicans CYB2 {e.g., SEQ ID NO: 18), S.cerevisiae CLB2 (e.g., SEQ ID NO: 19), S.cerevisiae CLB4{e.g. , SEQ ID NO: 20), S.cerevisiae CLN4 (e.g., SEQ ID NO: 21), S.cerevisiae CLN3 {e.g., SEQ ID NO: 22) or
S.cerevisiae CDC28 {e.g., SEQ ID NO: 23) {e.g., Pichia pastoris gene Pp05g03580 Pp02gl2160, Pp05g03580, Pp01g00590, Pp01g03460, Pp01g07380 or Pp05g06140 or a variant thereof; e.g., comprising the nucleotide sequence set forth in a member selected from SEQ ID NOs : 1-5 and 17) is overexpressed; as well as methods of use thereof, e.g., methods for expressing a heterologous polypeptide in the host cell. Host cells of the present invention, comprising a promoter of the present invention, may be genetically engineered so as to express particular glycosylation patterns on heterologous
polypeptides that are expressed in such cells (e.g., immunoglobulin heavy and/or light chains) . Host cells of the present invention are discussed in detail herein.
A "fungal host cell" that may be used in a composition or method of the present invention, as is discussed herein, includes a host cell, which, for example, is selected from the group
consisting of any Pichia cell, Pichia pastoris, Pichia flnlandica,
Pichia trehalophila, Pichia koclamae, Pichia me branaefaciens, Pichia minuta (Ogataea minuta, Pichia lindneri) , Pichia opuntiae, Pichia thermotolerans, Pichia salictaria, Pichia guercuum, Pichia pijperi, Pichia stiptis, Pichia methanolica, Pichia, Saccharomyces cerevisiae, Saccharomyces, Hansfinula polymorpha, Kluyveromyces, Kluyveromyces lactis, Candida albicans, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Trichoderma reesei,
Chrysosporium lucknowense, Fusarium, Fusa um gramineum, Fusarium venenatum and Neuraspora crassa.
As used herein, the terms "N-glycan" and "glycoform" are used interchangeably and refer to an N-linked oligosaccharide, e.g., one that is attached by an asparagine-N- acetylglucosamine linkage to an asparagine residue of a polypeptide. N-linked glycoproteins contain an N-acetylglucosamine residue linked to the amide nitrogen of an asparagine residue in the protein. Predominant sugars found on glycoproteins are glucose, galactose, mannose, fucose, N- acetylgalactosamine (GalNAc) , N-acetylglucosamine (GlcNAc) and sialic acid (e.g., N-acetyl-neuraminic acid (NANA)).
N-glycans have a common pentasaccharide core of Man3GlcNAc2 ("Man" refers to mannose; "Glc" refers to glucose; and "NAc" refers to N-acetyl; GlcNAc refers to N-acetylglucosamine) . N-glycans differ with respect to the number of branches (antennae) comprising peripheral sugars (e.g., GlcNAc, galactose, fucose and sialic acid) that are added to the Man3GlcNAc2 ("Man3") core structure which is also referred to as the "trimannose core", the "pentasaccharide core" or the "paucimannose core". N-glycans are classified according to their branched constituents (e.g., high mannose, complex or hybrid) . A "high mannose" type N-glycan has five or more mannose residues. A "complex" type N-glycan typically has at least one GlcNAc attached to the 1,3 mannose arm and at least one GlcNAc attached to the 1,6 mannose arm of a "trimannose" core.
Complex N-glycans may also have galactose ("Gal") or N- acetylgalactosamine ("GalNAc") residues that are optionally modified with sialic acid or derivatives (e.g., "NANA" or "NeuAc", where "Neu" refers to neuraminic acid and "Ac" refers to acetyl) . Complex N-glycans may also have intrachain substitutions comprising
"bisecting" GlcNAc and core fucose ("Fuc"). Complex N-glycans may also have multiple antennae on the "trimannose core, " often referred to as "multiple antennary glycans." A "hybrid" N-glycan has at least one GlcNAc on the terminal of the 1,3 mannose arm of the trimannose core and zero or more mannoses on the 1,6 mannose arm of the trimannose core. The various N-glycans are also referred to as "glycoforms . " "PNGase", or "glycanase" or
"glucosidase" refer to peptide N-glycosidase F (EC 3.2.2.18).
In an embodiment of the invention, O-glycosylation of
glycoproteins in a fungal host cell is controlled. The scope of the present invention includes isolated fungal host cells {e.g., Pichia pastoris) that overexpresses a homologue C. albicans CYB2 (e.g., SEQ ID NO: 18), S.cerevisiae CLB2 (e.g., SEQ ID NO: 19), S.cerevisiae CLB4 (e.g., SEQ ID NO: 20), S.cerevisiae CLN4 (e.g., SEQ ID NO: 21), S.cerevisiae CLN3 (e.g., SEQ ID NO: 22} or
S. cerevisiae CDC28 (e.g., SEQ ID NO: 23) (e.g., Pichia pastoris gene Pp05g03580 Pp02gl2160, Pp05g03580, Pp01g00590, Pp01g03460, Pp01g07380 or Pp05g06140 or a variant thereof; e.g., comprising the nucleotide sequence set forth in a member selected from SEQ ID NOs : 1-5 and 17) wherein O-glycosylation is controlled (as discussed herein) and methods of use thereof. For example, fungal host cells are part of the present invention wherein O-glycan occupancy and mannose chain length are reduced. In lower eukaryote host cells, O-glycosylation can be controlled by deleting the genes encoding one or more protein O-mannosyltransferases (Dol-PMan: Protein
(Ser/Thr) Mannosyl Transferase genes) (PMTs) or by growing the host in a medium containing one or more Pmtp inhibitors. Thus, the present invention includes isolated fungal host cells
overexpressing C. albicans CYB2, S.cerevisiae CLB2r S.cerevisiae CLB4, S.cerevisiae CLN4, S.cerevisiae CLN3 or S.cerevisiae CDC28 (e.g., Pichia pastoris gene Pp05g03580 Pp02gl2160, Pp05g03580, Pp01g00590, Pp01g03460, Pp01g07380 or Pp05g06140 or a variant thereof; e.g., comprising the nucleotide sequence set forth in a member selected from SEQ ID NOs: 1-5 and 17), e.g., comprising a deletion of one or more of the genes encoding PMTs, and/or, e.g., wherein the host cell can be cultivated in a medium that includes one or more Pmtp inhibitors. Pmtp inhibitors include but are not
limited to a benzylidene thiazolidinedione . Examples of benzylidene thiazolidinediones are 5-[[3,4bis{ phenylmethoxy)
phenyl ] methylene] -4-oxo-2-thioxo-3-thiazolidineacetic Acid; 5-{ [3- (1-25 Phenylethoxy) -4- (2-phenylethoxy) ] phenyl] methylene ] -4-oxo-2- thioxo-3-thiazolidineacetic Acid; and 5- [ [3- ( 1-Phenyl~2- hydroxy} ethoxy) -4- (2-phenylethoxy) ] phenyl ] methylene] -4-oxo-2~ thioxo3-thiazolidineacetic acid.
In an embodiment of the invention, a fungal host cell of the invention overexpressing a homologue of C. albicans CYB2 [e.g., SEQ ID NO: 18), S.cerevisiae CLB2 (e.g., SEQ ID NO: 19), S.cerevisiae CLB4{e.g.r SEQ ID NO: 20), S.cerevisiae CLN4 (e.g., SEQ ID NO: 21), S.cerevisiae CLN3 {e.g., SEQ ID NO: 22) or S.cerevisiae CDC28 {e.g., SEQ ID NO: 23) (e.g., Pichia pastoris gene Pp05g03580
Pp02gl2160, Pp05g03580, Pp01g00590, Pp01g03460, Pp01g07380 or Pp05g06140 or a variant thereof; e.g., comprising the nucleotide sequence set forth in a member selected from SEQ ID NOs : 1-5 and 17) (e.g., Pichia pastoris) includes a polynucleotide that encodes an alpha-1, 2-mannosidase that has a signal peptide that directs it for secretion. For example, in an embodiment of the invention, the fungal host cell is engineered to express an exogenous alpha-1, 2- mannosidase enzyme having an optimal pH between 5.1 and 8.0, preferably between 5.9 and 7.5. In an embodiment of the invention, the exogenous enzyme is targeted to the endoplasmic reticulum or Golgi apparatus of the fungal host cell, where it trims N~glycans such as Ma 8GlcN c2 to yield ansGlcNAc2. See U.S. Patent no.
7, 029, 872.
Fungal Host cells {e.g., Pichia pastoris) overexpressing a homologue of C. albicans CYB2 [e.g., SEQ ID NO: 18), S.cerevisiae CLB2 {e.g., SEQ ID NO: 19), S.cerevisiae CLB4(e.g., SEQ ID NO: 20), S.cerevisiae CLN4 {e.g., SEQ ID NO: 21), S.cerevisiae CLN3 {e.g., SEQ ID NO: 22) or S.cerevisiae CDC28 (e.g., SEQ ID NO: 23) (e.g., Pichia pastoris gene Pp05g03580 Pp02gl2160, Pp05g03580, Pp01g00590, Pp01g03460, Pp01g07380 or Pp05g06140 or a variant thereof; e.g., comprising the nucleotide sequence set forth in a member selected from SEQ ID NOs: 1-5 and 17) are, in an embodiment of the
invention, genetically engineered to eliminate glycoproteins having alpha-mannosidase-resistant N-glycans by deleting or disrupting one
or more of the beta-mannosyltransferase genes {e.g., BMTl, BMT2, BMT3, and BMT4) (See, U.S. Published Patent Application No.
2006/0211085) or abrogating translation of RNAs encoding one or more of the beta-mannosyltransferases using interfering RNA, antisense RNA, or the like.
Fungal host cells (e.g., Pichia pastoris) overexpressing a homologue of C. albicans CYB2 (e.g., SEQ ID NO: 18), S.cerevisiae CLB2 (e.g., SEQ ID NO: 19), S.cerevisiae CLB4(e.g.f SEQ ID NO: 20), S.cerevisiae CLN4 (e.g., SEQ ID NO: 21), S.cerevisiae CLN3 (e.g., SEQ ID NO: 22) or S.cerevisiae CDC28 {e.g., SEQ ID NO: 23) (e.g.,
Pichia pastoris gene Pp05g03580 Pp02gl2160, Pp05g03580, Pp01g00590, Pp01g03460, Pp01g07380 or Pp05g06140 or a variant thereof; e.g., comprising the nucleotide sequence set forth in a member selected from SEQ ID NOs : 1-5 and 17) also include those that are
genetically engineered to eliminate glycoproteins having
phosphomannose residues, e.g., by deleting or disrupting one or both of the phosphomannosyl transferase genes PNOl and MNN4B (See for example, U.S. Patent Nos . 7,198,921 and 7,259,007), which can include deleting or disrupting the MNN4A gene or abrogating translation of RNAs encoding one or more of the
phosphomannosyltransferases using interfering RNA, antisense RNA, or the like. In an embodiment of the invention, a fungal host cell that has been genetically modified to produce glycoproteins that have predominantly an N-glycan selected from the group consisting of complex N-glycans, hybrid N-glycans, and high mannose N-glycans wherein complex N-glycans are, in an embodiment of the invention, selected from the group consisting of Man3GlcNAc2, GlcNAC(i~
4)Man3GlcNAc2, NANA(1-4)GlcNAc(i-.4) an3GlcNAC2, and NANA(1-q)Gal „
4)Ma 3GlcNAc2; hybrid N-glycans are, in an embodiment of the
invention, selected from the group consisting of Man5GlcNAc2,
GlcNAc an5GlcNAc2, GalGlcNAc an5GlcNAc2, and
NANAGalGlcNAcMan5GlcNAc2; and high mannose N-glycans are, in an embodiment of the invention, selected from the group consisting of an6GlcNAc2, Man7GlcNAc2, Mang8lcNAc2, and Ma 9GlcNAc2.
As used herein, the term "essentially free of" as it relates to lack of a particular sugar residue, such as fucose, or galactose or the like, on a glycoprotein, is used to indicate that the
glycoprotein composition is substantially devoid of N-glycans which contain such residues. Expressed in terms of purity, essentially free means that the amount of N-glycan structures containing such sugar residues does not exceed 10%, and preferably is below 5%, more preferably below 1%, most preferably below 0.5%, wherein the percentages are by weight or by mole percent.
As used herein, a glycoprotein composition "lacks" or "is lacking" a particular sugar residue, such as fucose or galactose, when no detectable amount of such sugar residue is present on the N-glycan structures. For example, in an embodiment of the present invention, glycoproteins are expressed in an isolated fungal host cell of the present invetion, as discussed herein, and will "lack fucose, " because the cells do not have the enzymes needed to produce fucosylated N-glycan structures. Thus, the term
"essentially free of fucose" encompasses the term "lacking fucose." However, a composition may be "essentially free of fucose" even if the composition at one time contained fucosylated N-glycan
structures or contains limited, but detectable amounts of
fucosylated N-glycan structures as described above.
Expression. Methods
The present invention encompasses methods for making a heterologous polypeptide (e.g., an immunoglobulin chain or an antibody or antigen-binding fragment thereof) comprising
introducing, into an isolated fungal host cell of the present invention (e.g., a Pichia cell such as Pichia pastoris)
overexpressing a homologue of C. albicans CYB2 (e.g., SEQ ID NO: 18), S , cerevisiae CLB2 {e.g., SEQ ID NO: 19), S.cerevisiae
CLB4{e.g., SEQ ID NO: 20), S. cerevisiae CLN4 (e.g., SEQ ID NO: 21), S.cerevisiae CLN3 (e.g., SEQ ID NO: 22) or S.cerevisiae CDC28 (e.g., SEQ ID NO: 23) (e.g., Pichia pastoris gene Pp05g03580
Pp02gl2160, Pp05g03580, Pp01g00590, Pp01g03460, Pp01g07380 or Pp05g06140 or a variant thereof; e.g., comprising the nucleotide sequence set forth in a member selected from SEQ ID NOs : 1-5 and 17), a polynucleotide encoding said heterologous polypeptide and culturing the fungal host cell under conditions whereby the polynucleotide encoding the polypeptide is expressed, thereby
producing the polypeptide. An expression system, comprising the host cell that overexpresses a homologue of C. albicans CYB2 {e.g., SEQ ID NO: 18}, S.cerevisiae CLB2 {e.g., SEQ ID NO: 19),
S.cerevisiae CLB4{e.g.r SEQ ID NO: 20), S. cerevisiae CLN4 {e.g., SEQ ID NO: 21), S.cerevisiae CLN3 {e.g., SEQ ID NO: 22) or
S.cerevisiae CDC28 {e.g., SEQ ID NO: 23) {e.g., Pichia pastoris gene Pp05g03580 Pp02gl2160, Pp05g03580, Pp01g00590, Pp01g03460, Pp01g07380 or Pp05g06140 or a variant thereof; e.g., comprising the nucleotide sequence set forth in a member selected from SEQ ID NOs: 1-5 and 17) comprising a polynucleotide encoding the heterologous polypeptide to be expressed forms part of the present invention.
In an embodiment of the invention, a heterologous polypeptide expressed in a fungal host cell of the present invention is purified from said host cell and/or from culture medium in which the host cell is grown. For example, the polypeptide can be purified by protein-A binding, anion exchange, cation exchange or hydrophobic interaction chromatography.
Assay Methods
The present invention further comprises methods for
identifying a fungal host cell (e.g., a Pichia cell such as Pichia pastoris) that exhibits acceptable robustness, expression and/or secretion of heterologous polypeptides. The method comprises the step of determining whether the fungal host cell overexpresses a homologue of C. albicans CYB2 {e.g., SEQ ID NO: 18), S.cerevisiae CLB2 {e.g., SEQ ID NO: 19), S.cerevisiae C B4 {e.g., SEQ ID NO: 20), S.cerevisiae CLN4 {e.g., SEQ ID NO: 21), S.cerevisiae CLN3 {e.g., SEQ ID NO: 22) or S. cerevisiae CDC28 {e.g., SEQ ID NO: 23) {e.g., Pichia pastoris gene Pp05g03580 Pp02gl2160, Pp05g03580, Pp01g00590, Pp01g03460, Pp01g07380 or Pp05g06140 or a variant thereof; e.g., comprising the nucleotide sequence set forth in a member selected from SEQ ID NOs: 1-5 and 17) and, if the host cell does overexpress the homologue or variant, identifying the host cells exhibiting acceptable robustness, expression and/or secretion of heterologous polypeptides.
For example, an embodiment of the invention comprises a method for identifying a fungal host cell {e.g., a Pichia cell such as
Pichia pastoris) that exhibits acceptable robustness, expression and/or secretion of a heterologous polypeptide comprising:
(1) determining the expression level of a homologue of C, albicans CYB2 (e.g., SEQ ID NO: 18), S. cerevisiae CLB2 {e.g., SEQ ID NO: 19), S. cerevisiae CLB4(e.g., SEQ ID NO: 20), S. cerevisiae CLN4
{e.g., SEQ ID NO: 21), S. cerevisiae CLN3 [e.g., SEQ ID NO: 22) or S. cerevisiae CDC28 (e.g., SEQ ID NO: 23) (e.g., Pichia pastoris gene Pp05g03580 Pp02gl2160, Pp05g03580, Pp01g00590, Pp01g03460, Pp01g07380 or Pp05g06140 or a variant thereof; e.g., comprising the nucleotide sequence set forth in a member selected from SEQ ID NOs : 1-5 and 17) in a candidate fungal host cell;
(2) comparing the expression level in said fungal host cell to the expression level of said homologue or variant in a wild-type fungal host cell (e.g., NRRL~yll430) ;
wherein, if the candidate host cell does overexpress said homologue or variant relative to that of the wild-type fungal host cell, the candidate host cell is identified as a fungal host cell that exhibits acceptable robustness, expression and/or secretion of a heterologous polypeptide. In an embodiment of the invention, the method further comprises the steps of expressing the heterologous polypeptide in said identified candidate host cell. For example, in an embodiment of the invention, the method further comprises the steps
(3) introducing a polynucleotide encoding said heterologous polypeptide {e.g., in a vector such as a plasmid) into said identified candidate host cell; and,
(4) culturing the identified candidate host cell comprising said polynucleotide under conditions whereby the heterologous
polypeptide is expressed and secreted.
In an embodiment of the invention, a heterologous polypeptide expressed in a fungal host cell of the present invention is purified from said host cell and/or from culture medium in which the host cell is grown. For example, the polypeptide can be purified by protein-A binding, anion exchange, cation exchange or hydrophobic interaction chromatography.
Examples
The present invention is intended to exemplify the present invention and not to be a limitation thereof. The methods and compositions disclosed below fall within the scope of the present invention.
Example 1: Identification of the Putative Complete Set of Protein Coding Genes for P. pastoris.
The complete genome sequence was determined for the wild P. pastoris strain NRRL-yll430 in collaboration with Agencourt
Biosciences (Beverly, MA) yielding 9,411,042 bases on 4 large contigs and one smaller contig of 34,728 bp (nucleotide base pairs) that could not be resolved, consistent with the previously
published finding that the P. pastoris genome consists of 4
chromosomes. The genome sequence was then annotated by Biomax USA (Rockville, MD) using the automated genefinder software FGNESH (Salamov and Solovyev, Genome Res., 2000, 10: 516-522). A total of 5069 protein coding ORFs and 278 non-coding transcripts, were identified. Identified genes were named systematically using the convention Pp (for P. pastoris) , the contig number, the letters g (gene) or e (element) , and a systematic number. For example, the first gene on Contig 1 is PpOlgOOOlO. Each identified gene was compared to 8 databases using BlastP (Altschul, et al., J. Mol .
Biol., 1990, 215: 403-410). The databases were: Aspergillus niger proteins (Pel et al. , Nat. Biotechnol., 2007, 25: 221-231),
Saccharomyces cerevisiae strain S288C proteins
(www.yeastgenome.org), Schizosaccharomyces pombe proteins, Candida albicans proteins, Candida glabra ta proteins, Homo sapiens
proteins, Pichia stipitis proteins, and the complete UniProtKB protein database {www.uniprot.org}. A gene microarray was designed on the Agilent platform in 8x15 format using Agilent earray
software using these genes as well as an additional 77 genes that were identified from Genbank as being involved in glycosylation processes. The 77 non-P. pastoris genes are derived from various species from fungi to human and code for proteins that include glycan transferases, sugar-nucleotide transporters, and enzymes involved in sugar metabolism. Probes were designed for all 5424
genes for 3' biased hybridization protocol to a density of 2-3 probes per gene (4207 genes with 3 probes/transcript and 1217 genes with 2 probes/transcript) . This custom-designed Agilent P.
pastoris 15k 3.0 array (8xl5K) gene microarray was used for all whole genome gene-chip RNA expression analyses.
Example 2 : Cultivation of P.pastoris Glycoengineered Strains expressing secreted Monoclonal Antibodies Under Bioprocess
Conditions for Gene Expression Analysis .
A P. pastoris glycoengineered strain, YGLY8316, and four highly related glycoengineered strains expressing the monoclonal antibodies MK-HER2 strain A (YGLY12501), MK-HER2 Strain B
(YGLY13992), K-RSV (YGLY14401), and K-VEGF (YGLY10360) were cultivated in triplicate in Sartorius Q12 1L bioreactors
(Sartorius, Goettingen, Germany) using a standard fed-batch
fermentation protocol as described in Barnard et al. , 2010 (J. Ind. Microbiol. Biotechnol. 37:961-971). Samples were taken from each bioreactor at the following timepoints: 1) during the middle of glycerol batch at 50 mg/ml of wet cell weight (batch), 2) during the middle of glycerol fed-batch (4 V- 1 hours into fed-batch), 3) 4 V- 1 hours into methanol induction, 4) 24 V- 1 hours into methanol induction, 5) 48 V- 1 hours into methanol induction, 6) 72 +/~ 1 hours into methanol induction, 7) 96 V- 1 hours into methanol induction (Figure 1). At each timepoint, wet cell weight was measured to determine the amount of cells to harvest and then 1x107 (V~ 2X) cells were harvested into 2ml screwcap microcentrifuge tubes, centrifuged briefly at 5000 X g, supernatant discarded, and the cell pellets flash frozen using dry ice/ethanol. The cell pellets were then used for RNA extraction and microarray
hybridization.
, Example 3: Gene Expression Analysis using Agilent P.pastoris- specific microarrays .
Following sample collection, samples were processed at the
Covance Genomics Laboratory (Seattle, WA) . Briefly, total RNA was extracted and scrutinized for quality and yield; mRNA was amplified using Ambion (Austin, TX) essageAmp II reagents and protocols,
resulting in labeled cRNA representative of the original samples.
The labeled cRNA was then hybridized to the Merck (Whitehouse Station, NJ) custom-designed Agilent (Santa Clara, CA) P. pastoris 15k 3.0 microarray (8xl5K) based upon the internal P. pastoris genome sequence for strain NRRL Y-11430 (above) . Subsequent scanning of the microarrays was performed using Agilent Microarray scanners (version B) , and output raw image files in .tif format were processed by Agilent Feature Extractor (FE) software.
Microarray quality control data were generated from the FE output data and were reviewed for data quality before delivery to Merck.
Standard Resolver pipelines for the Agilent Single Color Error Model (Weng et al., Bioinformatics 22, 2006, 1111-1121) were used for data summarization and calling using the following parameters: FRACTION = 0.12, POISSON = 3, and RANDOM = 0.05. Briefly, the data was median normalized, and then a background gradient was
calculated and subtracted from the normalized data. Next,
intensity and ratio error models were constructed which combined replicate measurements and modeled associated error. These models determined whether a particular gene exhibited differential expression for the ratio comparison specified, although such differential expression calls were typically made via ANOVA and t- test statistical tests that were also performed. In addition to these statistical tests, clustering, PCA, and other operations were also performed upon the data using Resolver software, typically utilizing data ratioed to the pool of all other samples within, a specific study unless otherwise indicated. In order to determine promoters with desired characteristics (e.g., little gene
expression upon glycerol growth but up-regulation upon methanol growth) , the Trend tool was utilized to match the 100 closest matching gene expression profiles by distance as described in the Resolver User's Manual and online help sections (Rosetta Resolver User Guide, 2002, Kirkland, WA) .
Example 4 : Statistical gene expression analysis of P. pastoris "high" vs. "low" niftb-producing strains
In order to determine genes which are di ferentially expressed between "high" and "low" mAb-producing P, pastoris strains, the
strains examined in the study were first grouped into "high" and
"low" production groups within the Rosetta Resolver (Seattle, WA) "13396__Pichia_mAb_Timecourse_Parental_Time-Match" Experimental Definition. The MK-Her2 YGLY12501, MK-Her2 YGLY13992, and the MK- RSV YGLY14401 strains were all grouped into a "high" producer group, whereas the MK-VEGF YLGY10360 strain was the sole member of the "low" producer group. For each gene at each time point (mid- batch glycerol, mid-fed-batch glycerol, 4h methanol induction, 24h induction, 48h induction, 72h induction, and 96h induction) , average expression ratios between the "high" or "low" groups and the empty (no mAb production) parental strain 8316 were calculated. Student's t-tests were then performed between the "high" and "low" group averages for each gene, and gene signatures of p<0.01 were identified at each of the 7 time points. In order to find genes that are differentially expressed during the methanol-induced time points but not significant during the glycerol batch phases, the intersection of p<0.01 gene expression signatures from the 4h, 24h, 48h, 72h, and 96h methanol induction times was calculated under the constraint that the gene was not significant (i.e. p>0.01) at the two glycerol time points. One gene was found to satisfy the most stringent intersection (i.e., 5 significant methanol t-tests and 2 insignificant glycerol t-test) . This gene was down-regulated in the "low"-producing strain following methanol induction but not down-regulated in the "high"-producing group. Additional gene sets, as listed in Table 1, were determined by relaxing some of these conditions as shown in the intersection diagram in figure 3. The genes identified via these relaxed intersections are listed in Tables 3, 4 (4 - 4-3), and 5 (5 - 5-4).
The single gene that was identified in the intersection of all 7 time point t-tests is Pp05g03580 (SEQ ID NO: 2), which has homology to a C. albicans B-type cyclin (CYB2) and a 5. cerevisiae B-type cyclin (CLB4) (blastp E-value < le-100 for both
relationships) . CLB4 is involved in cell cycle progression due to its role in activating CDC28p to promote the transition from G2 to M phase; CLB4 accumulates during G2 and M, then it is targeted via a destruction box motif for ubiquitin-mediated degradation by the proteasome (Fitch et al., 1992; Lew et al., 1997; Mendenhall and
Hodge, 1998; Richardson et al., 1992; Surana et al., 1991).
Interestingly, other growth-associated genes were also identified in the relaxed significant gene set intersections {i.e. less than the total 7 time point t-tests) , including Pp01g03460 (SEQ ID NO: 4), a homolog to CLN1 C. albicans and CLN3 in S. cerevisiae (blastp E-value < le-20 for both relationships) . This gene was identified as significant at 4h, 24h, and 48h of methanol induction (listed in Table 4) and not significant at either glycerol time point. A two dimensional cluster showing the temporal expression changes of these two genes in the various strains tested is shown in Figure 2. Due to identification of these genes in these statistical tests, cyclins, cyclin-dependent kinases, and the cell cycle in general were all suspected as important to the distinction between high and low mAb-producing P. pastoris strains. Experimental work is therefore focused upon deleting, overexpressing, and otherwise modifying the expression of P. pastoris genes including but not limited to the following with the goal of increasing mAb production and fermentation process robustness (also expressed as 5.
cerevisiae homologs) : Pp05g06140 (SEQ ID NO: 17; CDC28 homolog), Pp02gl2160 (SEQ ID NO: 1; CLB2 homolog), Pp05g03580 (SEQ ID NO: 2; CLB4 homolog), Pp01g00590 (SEQ ID NO: 3; CLN2 homolog), Pp01g03460 (SEQ ID NO: 4; homolog), and Pp01g07380 (SEQ ID NO: 5) CLN3 homolog) , and other P. pastoris genes with homology to growth- associated and cell cycle genes including CLB1, CLB3, CLB5, CLB6, and CLN1.
Example 5 : Regulated expression of a cell cycle control protein .
The P. pastoris genes encoding homologs of the S. cerevisiae CLN/CLB family members, Pp02gl2160, (SEQ ID NO: 1), Pp05g03580 (SEQ NO: 2), Pp01g00590 (SEQ ID NO: 3), Pp01g03460 (SEQ ID NO: 4), and Pp01g07380 (SEQ ID NO: 5), and CDC28 homolog, Pp05g06140 are each PCR amplified using the primers SEQ ID NO: 6 and SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9, SEQ ID NO: 10 and SEQ ID NO: 11, SEQ ID NO: 12 and SEQ ID NO: 13, respectively. The PCR products are cloned into the P. pastoris expression vector pGLY8369 (Figure 4), via the EcoRI/Fsel restriction sites in the vector and the
overlapping vector sequences in the primers using the Clontech
InFusion cloning system. The vector pGLY8369 contains an AOX1 promoter and terminator flanking the insertion site as well as the P. pastoris URA6 gene as an integration site and the ScARR3 arsenite resistance gene as a selectable marker (Figure 4) . The resulting plasraids are digested with Pmel and transformed into the P. pastoris host strain YGLY13992 (expressing an anti-HER2 mAb under control of the methanol inducible A0X1 promoter) and
transformants are selected on 0.3, 1 and 3mM arsenite. The resulting isolated clones are PCR amplified to confirm integration of the plasmid using a pair of primers, one specific to the AOX1 promoter (SEQ ID NO: 16) and another specific to each of the genes located anywhere within and complementary to the sequence of each (SEQ IDs NO: 1-5 and 17). Positive clones are then cultured in glycerol and then induced in methanol to induce the expression of the secreted anti-HER2 antibody as well as the specific expressed CLN/CLB gene either in shake flasks or in fermenters as described by Barnard (J. Ind. Microbiol. Biotechnol. 37:961-971, 2010).
During the fermentation the strains are monitored for robustness using the techniques described by Barnard, including picogreen fluorescence supernatant DNA measurement and microscopic evaluation of cell health. The fermentation culture supernatants are then harvested by centrifugation after 24h, 48h, and 72h of induction and the anti-HER2 antibody is purified by protein A capture and analyzed for titer, mAb quality, N- and O-linked N-glycans as described by Jiang (Protein Expr. Purif. 2010 Nov; 74 ( 1 ) : 9-15) .
Clones with increased titer, fermentation process robustness, or improved N-glycan uniformity are selected for larger scale
fermentation to further validate the titer increases.
References :
Love KR, Panagiotou V, Jiang B, Stadheira TA, Love JC. Integrated single-cell analysis shows Pichia pastoris secretes protein stochastically. Biotechnol Bioeng. 2010 Jun 1; 106 (2) : 319-25. PubMed P ID: 20148400.
Graf A, Gasser B, Dragosits M, Sauer M, Leparc GG, Ttichler T, Kreil DP, attanovich D. Novel insights into the unfolded protein response using Pichia pastoris specific DNA microarrays . BMC
Genomics. 2008 Aug 19; 9: 390. PubMed PMID: 18713468.
Gasser B, Sauer M, Maurer M, Stadlmayr G, Mattanovich D.
Transcriptomics-based identification of novel factors enhancing heterologous protein secretion in yeasts. Appl Environ Microbiol. 2007 Oct;73 {20} : 6499-507. Epub 2007 Aug 31. PubMed PMID: 17766460.
Sauer M, Branduardi P, Gasser B, Valli M, Maurer M, Porro D,
Mattanovich D. Differential gene expression in recombinant Pichia pastoris analysed by heterologous DNA microarray hybridisation. Microb Cell Fact. 2004 Dec 20;3(1):17. PubMed PMID: 15610561.
Walsh G. Biopharmaceutical benchmarks 2010. Nat Biotechnol. 2010 Sep 28 (9) : 917-24. PubMed PMID: 20829826. Potgieter TI, Cukan M, Drummond JE, Houston-Cummings NR, Jiang Y, Li F, Lynaugh H, Mallem M, McKelvey TW, Mitchell T, Nylen A,
Rittenhour A, Stadheim TA, Zha D, d'Anjou M. Production of
monoclonal antibodies by glycoengineered Pichia pastoris. J
Biotechnol. 2009 Feb 23; 139 { 4 ): 318-25. Epub 2008 Dec 27. PubMed PMID: 19162096.
Sreekrishna K, Brankamp RG, Kropp KE, Blankenship DT, Tsay JT, Smith PL, Wierschke JD, Subramaniam A, Birkenberger LA. Strategies for optimal synthesis and secretion of heterologous proteins in the methylotrophic yeast Pichia pastoris. Ge e. 1997 Apr 29; 190 (1 ) : 55- 62. PubMed PMID: 9185849.
Cereghino JL, Cregg JM. Heterologous protein expression in the methylotrophic yeast Pichia pastoris. FE S Microbiol Rev- 2000 Jan 2 (1) :45-66. Review. PubMed PMID: 10640598.
***************************
The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, the scope of the present invention includes embodiments specifically set forth herein and other embodiments not specifically set forth herein; the embodiments specifically set forth herein are not necessarily intended to be exhaustive. Various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description. Such
modifications are intended to fall within the scope of the claims.
Patents, patent applications, publications, product
descriptions, and protocols are cited throughout this application, the disclosures of which are incorporated herein by reference in their entireties for all purposes.
Claims
1. An isolated Pichia host cell that overexpresses a polynucleotide encoding a Pichia pastoris homologue of C. albicans CYB2,
S.cerevisiae CLB2, S. cerevisiae CLB4, S. cerevisiae CLN4,
S.cerevisiae CLN3 or S. cerevisiae CDC28 and which comprises a polynucleotide encoding a heterologous polypeptide.
2. The host cell of claim 2 wherein the homologue comprises the nucleotide sequence set forth in SEQ ID NO: 1, 2, 3, 4, 5 or 17.
3. The host cell of claim 1 wherein the homologue is a heterologous polynucleotide operably linked to a promoter.
4. A method for identifying a fungal host cell that expresses a heterologous polypeptide at an acceptable level comprising
determining whether the host cell overexpresses a homologue of C, albicans CYB2, S . cerevisiae CLB2, S. cerevisiae CLB4, S.cerevisiae CLN4, S. cerevisiae CLN3 or S.cerevisiae CDC28; wherein, if the host cell does overexpress the homologue, then the host cell is
identified as expressing the heterologous polypeptide at an acceptable level.
5. The method of claim 4 further comprising introducing a
heterologous polynucleotide encoding the heterologous polypeptide into the identified host cell and culturing the host cell under conditions where the heterologous polypeptide is expressed.
6. A method for producing a heterologous polypeptide comprising . introducing a polynucleotide that encodes the heterologous
polypeptide into an isolated fungal host cell of claim 1 and culturing the host cell under conditions where the heterologous polypeptide is expressed.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201161440632P | 2011-02-08 | 2011-02-08 | |
| US61/440,632 | 2011-02-08 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2012109220A2 true WO2012109220A2 (en) | 2012-08-16 |
| WO2012109220A3 WO2012109220A3 (en) | 2014-04-17 |
Family
ID=46639149
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2012/024116 Ceased WO2012109220A2 (en) | 2011-02-08 | 2012-02-07 | Cell cycle control for improving process performance and recombinant expression in fungal host cells |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2012109220A2 (en) |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101679992A (en) * | 2007-04-20 | 2010-03-24 | 波利门科学生物免疫研究有限公司 | Expression system |
| PL2591121T3 (en) * | 2010-07-05 | 2018-07-31 | Lonza Ltd | Production cell line |
-
2012
- 2012-02-07 WO PCT/US2012/024116 patent/WO2012109220A2/en not_active Ceased
Also Published As
| Publication number | Publication date |
|---|---|
| WO2012109220A3 (en) | 2014-04-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8440456B2 (en) | Nucleic acids of Pichia pastoris and use thereof for recombinant production of proteins | |
| JP4954866B2 (en) | Methods for reducing or eliminating alpha-mannosidase resistant glycans in the production of glycoproteins | |
| Nett et al. | Characterization of the Pichia pastoris protein-O-mannosyltransferase gene family | |
| US20140011236A1 (en) | Promoters for high level recombinant expression in fungal host cells | |
| JP2007534330A5 (en) | ||
| EP2350123A1 (en) | Novel tools for the production of glycosylated proteins in host cells | |
| WO2013066765A1 (en) | Mutation of tup1 in glycoengineered yeast | |
| US9328367B2 (en) | Engineered lower eukaryotic host strains for recombinant protein expression | |
| CN113423836A (en) | Production of carbon source regulated proteins in recombinant host cells | |
| MX2012004994A (en) | Method for producing therapeutic proteins in pichia pastoris lacking dipeptidyl aminopeptidase activity. | |
| KR20160030127A (en) | O-mannosyltransferase deficient filamentous fungal cells and methods of use thereof | |
| EP3265475A1 (en) | Constitutive yeast LLP promoter-based expression system | |
| AU2013335065B2 (en) | CRZ1 mutant fungal cells | |
| WO2012109220A2 (en) | Cell cycle control for improving process performance and recombinant expression in fungal host cells | |
| US20150337274A1 (en) | Pmt2-, och1-, pmt5- mutant cells | |
| WO2012170292A1 (en) | Modulation of metabolic pathways for improving bioprocess performance and secreted protein productivity of yeast | |
| Class et al. | Patent application title: ENGINEERED LOWER EUKARYOTIC HOST STRAINS FOR RECOMBINANT PROTEIN EXPRESSION Inventors: Bo Jiang (Norwich, VT, US) Rebecca D. Argyros (Hartford, VT, US) Stephanie Nelson (White River Junction, VT, US) Robert C. Davidson (Enfield, NH, US) Robert C. Davidson (Enfield, NH, US) Ronghua Chen (Needham Heights, MA, US) Jun Zhuang (Wellesley, MA, US) | |
| KR101419266B1 (en) | A Novel Hansenula polymorpha Gene Coding for Protein O-mannosyltransferase and Hansenula polymorpha Mutant Strain Deficient in The Same Gene | |
| US20150299690A1 (en) | Engineered lower eukaryotic host strains deficient in grr1 activity for recombinant protein | |
| JP5752582B2 (en) | Methods for reducing or eliminating alpha-mannosidase resistant glycans in the production of glycoproteins | |
| CN114026239A (en) | MUT-methanol nutritional yeast | |
| HK40054115A (en) | Carbon-source regulated protein production in a recombinant host cell | |
| Class et al. | Patent application title: PMT2-, OCH1-, PMT5-MUTANT CELLS Inventors: Ming-Tang Chen (Lebanon, NH, US) Ming-Tang Chen (Bedford, NH, US) Byung-Kwon Choi (Norwich, VT, US) Byung-Kwon Choi (Lebanon, NH, US) Robert Davidson (Enfield, NH, US) Robert Davidson |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12744762 Country of ref document: EP Kind code of ref document: A2 |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 12744762 Country of ref document: EP Kind code of ref document: A2 |