WO2012107580A1 - In vitro diagnosis method for predicting a predisposition to cardiomyopathy - Google Patents
In vitro diagnosis method for predicting a predisposition to cardiomyopathy Download PDFInfo
- Publication number
- WO2012107580A1 WO2012107580A1 PCT/EP2012/052352 EP2012052352W WO2012107580A1 WO 2012107580 A1 WO2012107580 A1 WO 2012107580A1 EP 2012052352 W EP2012052352 W EP 2012052352W WO 2012107580 A1 WO2012107580 A1 WO 2012107580A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- bag3
- hspb7
- cardiomyopathy
- dcm
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
- G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/32—Cardiovascular disorders
- G01N2800/325—Heart failure or cardiac arrest, e.g. cardiomyopathy, congestive heart failure
Definitions
- the invention relates to the field of molecular diagnosis.
- the invention provides in vitro diagnosis methods for detecting a genetic predisposition to cardiomyopathy, such as dilated cardiomyopathy. More specifically, the invention relates to an in vitro diagnosis method for detecting a genetic predisposition to cardiomyopathy in a human subject, said method comprising the steps of: a. providing a biological sample from a human subject; and, b. detecting the presence or absence of an HSPB7 disease associated variant and/or BAG3 disease associated variant in said biological sample, wherein the presence of said HSPB7 and/or BAG3 disease associated variant is indicative of a genetic predisposition for cardiomyopathy in said human subject.
- BACKGROUND OF THE INVENTION BACKGROUND OF THE INVENTION:
- HF Heart failure
- Idiopathic dilated cardiomyopathy is a form of HF defined by the presence of left ventricular dilatation and left ventricular systolic dysfunction in the absence of an obvious etiology such as coronary artery disease (CAD), hypertension, valvular disease, or congenital defect 3 ' 4 ' 5 .
- DCM is a major cause of systolic heart failure and the leading indication for heart transplantation 6 , it affects approximately 1/2500 adults and it is more common in men than in women 7 .
- DCM The pathophysiology of DCM is poorly understood 3 .
- the disease is considered to be multifactorial with a possible implication of environmental factors and the existence of a strong genetic component attested by a high rate of familial aggregation 3 ; 20% to 35% of DCM cases having an affected first-degree relative 3 ' 4 .
- Genetic analyses of monogenic DCM have identified mutations in more than 30 genes, most of them encoding proteins of the cytoskeleton or the sarcomere 8 . These genes may carry mutations that are implicated in familial forms of the disease cases as well as common susceptibility alleles that are over- represented in sporadic cases 9 .
- the genetic basis of DCM whether familial or sporadic, is still largely unresolved and results of candidate gene association studies have been inconsistent 10 .
- DCM dilated cardiomyopathy
- discovery and replication cohorts comprising overall 2344 cases and 2410 controls
- the inventors identified DCM biomarkers and in particular two DCM-associated S Ps, rsl0927875 and rs2234962 with respective -values of 9.5 x 10 "10 and 4.0 x 10 "12 in the combined data set.
- the first SNP is located at a locus on lp36.13 which exhibit a yin/yang haplotype structure encompassing several genes including HSPB7.
- the second SNP on 10q26.11 is located within BAG3 and is non-synonymous.
- the inventors identified several damaging mutations which were absent in healthy individuals, suggesting that they are causal for DCM.
- a first object of the invention relates to an in vitro diagnosis method for detecting a genetic predisposition to cardiomyopathy in a subject, said method comprising the steps of: a. providing a biological sample from said subject; and, b. detecting the presence or absence of an HSPB7 disease associated variant
- HSPB7 and/or BAG3 disease associated variant in said biological sample, wherein the presence of said HSPB7 and/or BAG3 disease associated variant is indicative of a predisposition to cardiomyopathy in said subject.
- the method is particularly useful in predicting a predisposition to dilated cardiomyopathy, including familial or idiopathic dilated cardiomyopathy.
- said HSPB7 disease associated variant is a genetic mutation that decreases the expression level of HSPB7 gene without resulting in an alteration of the predicted amino acid sequence encoded by the HSPB7 gene.
- Said genetic mutation may be for example, one or more single nucleotide polymorphism (SNP) mutations in HSPB7 gene locus.
- SNP single nucleotide polymorphism
- said genetic mutation is a SNP rsl0927875 and/or rs945417.
- said BAG3 disease associated variant is a genetic mutation altering the predicted amino acid sequence encoded by the BAG3 gene.
- said genetic mutation includes a non-synonymous single nucleotide polymorphism (SNP) in a BAG3 coding region.
- said genetic mutation is a genetic mutation resulting in a deletion or a dysfunction of the BAG domain of the Bag3 protein.
- said genetic mutation is a non-synonymous single nucleotide polymorphisme in the BAG domain of the Bag3 protein.
- said non-synonymous SNP in BAG3 coding region is rs2234962 or rs3858340.
- the invention naturally further relates to a kit for carrying out the above-described method, said kit comprising: a. means for detecting one or more SNPs in BAG3 and/or HSPB7 gene loci, and b. optionally, instructions for use of the kit.
- the invention also relates to a kit for carrying out the above-described method, said kit comprising: a. means for detecting causal mutations in the full gene sequence of BAG3; and, b. optionally, instructions for use of the kit.
- the invention relates to an in vitro diagnosis method for detecting a genetic predisposition to cardiomyopathy in a subject, said method comprising the steps of: a. providing a biological sample from said subject; and, b. detecting the presence or absence of an HSPB7 disease associated variant and/or BAG3 disease associated variant in said biological sample, wherein the presence of said HSPB7 and/or BAG3 disease associated variant is indicative of a genetic predisposition to cardiomyopathy in said subject.
- a subject has a genetic predisposition to a disease when this subject has a higher risk to develop such disease, compared to the average risk in a population to develop such disease.
- a predisposition does not mean that the subject will develop the disease.
- "Detecting a predisposition to cardiomyopathy” therefore includes detecting a higher risk of developing the disease, or determining the susceptibility of that subject to developing the disease or to having a poor prognosis for the disease.
- cardiomyopathy refers to all myocardial disorder in which the heart muscle is structurally and functionally abnormal, in the absence of coronary artery disease, hypertension, valvular disease and congenital heart disease sufficient to cause the observed myocardial abnormality (Eur Heart J 2008;29:270-276).
- Cardiomyopathy includes without limitation, hypertrophic cardiomyopathy (HCM or HOCM), arrhythmogenic right ventricular cardiomyopathy (ARVC), isolated ventricular non- compaction, mitochondrial myopathy, dilated cardiomyopathy such as familial or idiopathic dilated cardiomyopathy (DCM), restrictive cardiomyopathy (RCM), Takotsubo cardiomyopathy and Loeffler endocarditis.
- HCM hypertrophic cardiomyopathy
- ARVC arrhythmogenic right ventricular cardiomyopathy
- isolated ventricular non- compaction mitochondrial myopathy
- dilated cardiomyopathy such as familial or idiopathic dilated cardiomyopathy (DCM), restrictive cardiomyopathy (RCM), Takotsubo
- the diagnosis methods may also be applied to other cause of heart failure such as systolic or diastolic left ventricular dysfunction due to coronary artery disease, valvular diseases or arterial.
- the invention more specifically relates to a method for detecting a genetic predisposition to dilated cardiomyopathy including familial or idiopathic dilated cardiomyopathy.
- the method of the invention can be carried out on any appropriate biological sample obtained from a subject.
- biological sample refers to a sample that contains either nucleic acid or protein materials reflecting the genomic information of cells, tissue or organs of the subject.
- said sample is obtained from a mammal, for example from rodents, cats, dogs, horses, primates or human.
- said sample is obtained from a human subject.
- said biological sample may be obtained from urine, blood including without limitation peripheral blood or plasma, stool, sputum, bronchoalveolar fluid, endotracheal aspirates, wounds, cerebrospinal fluid, lymph node, exsudate and more generally any human biopsy tissue or body fluids, tissues or materials.
- said biological sample is blood, more preferably human blood sample.
- a "disease associated variant” means any genotypic biomarker, such as a genetic mutation, that is associated with an increased or decreased risk of developing the disease.
- said disease associated variant is a genetic mutation in HPSB7 or BAG3 gene locus.
- a “genetic mutation” refers to a nucleotide change (or nucleotide changes) in the wild type sequence of the corresponding gene.
- Said genetic mutation refers to a germline mutation that can be considered as a causal mutation (present only in patients, usually in a familial form of the disease, with a direct causal link with the disease).
- mutations can occur within a gene or chromosome, including specific changes in non-coding regions of a chromosome, for instance changes in or near regulatory regions of genes.
- Types of mutations include, but are not limited to, base substitution point mutations (which are either transitions or transversions), deletions, and insertions.
- Missense mutations are those that introduce a different amino acid into the sequence of the encoded protein; nonsense mutations are those that introduce a new stop codon; and silent mutations are those that introduce the same amino acid often with a base change in the codon.
- mutations can be in-frame (not changing the frame of the overall sequence) or frame shift mutations, which may result in the misreading of a large number of codons (and often leads to abnormal termination of the encoded product due to the presence of a stop codon in the alternative frame).
- a disease associated variant is a single nucleotide polymorphism (S P) in HSPB7 or BAG3 gene locus.
- a “single nucleotide polymorphism (S P)" is a single base (nucleotide) polymorphism in a DNA sequence among individuals in a population.
- a single nucleotide polymorphism (SNP) may fall within coding sequences of genes, non-coding regions of genes, or in the intergenic regions between genes. SNPs within a coding sequence will not necessarily change the amino acid sequence of the protein that is produced, due to degeneracy of the genetic code.
- a SNP in which both forms lead to the same polypeptide sequence is termed “synonymous” (sometimes called a silent mutation)-if a different polypeptide sequence is produced they are “nonsynonymous”.
- a nonsynonymous change may either be missense or "nonsense", where a missense change results in a different amino acid, while a nonsense change results in a premature stop codon.
- the exact sequence of a SNP can be determined from the database of SNPs available at the NCBI website (Entrez SNP, dbSNP build 128, Jan. 28, 2009).
- the "position" of the nucleotide of interest gives the location in the genome of the SNP, referring to the nucleotide position from the p-terminus of the chromosome in the human genome, see the NCBI SNP website (dbSNP), available on the internet.
- the inventors have identified specific single nucleotide polymorphisms of HSPB7 that are associated to a higher risk of developing dilated cardiomyopathy.
- the inventors have further shown that such SNPs may be associated to a decreased level of expression of HSPB7 gene compared to expression level with a wild type sequence.
- predisposition to cardiomyopathy may be diagnosed by detecting a genetic mutation in HSPB7 gene locus that decreases the expression level of HSPB7 gene in a biological sample obtained from a subject.
- human wild type HSPB7 gene is the gene comprising the nucleotide sequence as shown in Genbank accession number (NM_014424.4 GI: 164519093 :
- said genetic mutation is a single nucleotide polymorphism (SNP) mutation in HSPB7 gene locus, which SNP in HSPB7 gene locus is associated with a decreased expression level of HSPB7 gene.
- SNP single nucleotide polymorphism
- HSPB7 gene locus may comprise in the context of the present invention, the genetic sequence of HSPB7, the region of the promoter, the introns, the exons including 3' and 5' untranscribed regions, and some intergenic regions involved in HSPB7 gene expression.
- the genetically associated region discovered by the inventors is covering 5 genes in the locus and extended from SPEN to CLC KB (on chromosome Ip36.2-p36.1 interval 162670000-163700000; GRCh37/hgl9 assembly) which comprise several other genes: SPEN (spen homolog, transcriptional regulator), HSPB7 (heat shock 27 kDa protein family, member 7), CLCNKA (chloride channel Ka) and CLCNKB (chloride channel kb).
- said genetic mutation is the SNP rs 10927875 or rs945417 as described for example in dbSNP
- rsl0927875 is a SNP located in an intron of ZBTB17 (also referred as MIZ-1) (position 16299312; genomic release GRCh37).
- Rs945417 is a SNP located at position 16344625 (genomic release GRCh37) and located in the proximal promoter region of HSPB7 gene sequence.
- SNPs in HSPB7 gene locus may be detected in addition to rsl0927875 and/or rs945417, in particular, other SNPs which are associated with a decreased expression of HSPB7.
- SNPs in HSPB7 have been described for example in Matkovitch et al. 21 , to be associated to systolic heart failure.
- the inventors have further identified specific SNPs of BAG3 gene that are associated to a higher risk of developing dilated cardiomyopathy.
- SNPs includes non-synonymous mutations in the coding regions and have been shown to be associated to an increased risk of developing cardiomyopathy. In some cases, the increased risk may therefore be linked to an altered Bag3 protein sequence. Sequencing of BAG3 exons in patients with familial dilated cardiomyopathy identified several damaging mutations absent in healthy individuals, suggesting a causal link of the mutations for dilated cardiomyopathy.
- said genetic mutation is one or more single nucleotide polymorphism (SNP) mutations in BAG3 gene locus, for example, non synonymous single nucleotide polymorphism in BAG3 coding regions.
- SNP single nucleotide polymorphism
- genetic predisposition to cardiomyopathy may be diagnosed by detecting a genetic mutation that alters the predicted amino acid sequence encoded by the BAG3 gene in the biological sample.
- BAG3 gene locus may comprise in the context of the present invention, the genetic sequence of BAG3, the region of the promoter, the introns, the exons including 3' and 5' untranscribed regions, and some intergenic regions involved in HSPB7 gene expression.
- the BAG3 gene is located on chromosome lOq (position chrlO: 121400000- 121440000; GRCh37/hgl9 assembly).
- human wild type BAG3 gene is the gene comprising the nucleotide sequence as shown in Genbank accession number (NM_004281.3 GL62530382; with corresponding cDNA of SEQ ID NO:3), and coding for the polypeptide sequence of SEQ ID NO:4 (NP_004272.2 GI: 14043024).
- said genetic mutation is the single nucleotide polymorphism rs2234962 or rs3858340 as described for example in dbSNP
- the SNP rs2234962 is a non-synonymous SNP (c. T757C, p. C151R) located within the coding sequence of BAG3 on chromosome 10q25.2-q26.2 (position 121429633 of GRCh37 Assembly).
- the SNP rs3858340 is a non-synonymous SNP (c. C1526T, p. P407L) located within the coding sequence of BAG3 on chromosome 10q25.2-q26.2 (position 121436286 of GRCh37 Assembly).
- BAG3 gene locus may be detected in addition to rs2234962 or rs3858340.
- said genetic mutation is one or more of the following SNPs set forth in Table 1, which have been identified in familial forms of dilated cardiomyopathy.
- SNPs in BAG3 coding regions set forth in Table 1 may be detected in the diagnosis methods according to the invention, either as disease associated variants or in combination with detecting SNPs rs2234962 or rs3858340: Table 1:
- said BAG3 disease associated variant is a variant that is not associated to muscular dystrophy.
- said BAG3 disease associated variant is a Bag3 mutation resulting in a deletion or a dysfunction in the BAG domain of the Bag3 protein, for example one or more amino acid substitution or deletion in the BAG domain of Bag3 protein.
- BAG domain may be defined by the following amino acid sequence of SEQ ID NO:75, corresponding to residues at amino acid position 421 to 498 of the Bag3 amino acid sequence of SEQ ID NO:4.
- the above-mentioned disease associated variants for HSPB7 or BAG3 may be detected in the biological sample either at the nucleic acid level or at the polypeptide level and includes methods to detect a genetic mutation in the genomic DNA or RNA transcripts and method to detect abnormal expression of the gene product or mutation in the gene product (RNA transcripts or polypeptide).
- the presence of the genetic mutation may be detected on either one or both chromosomes, wherein the identification of the genetic mutation (e.g. one or more specific SNPs as described above) on at least one chromosome indicates that the subject is at risk for developing cardiomyopathy, the subject has a cardiomyopathy, or has an early stage of cardiomyopathy.
- the identification of the genetic mutation e.g. one or more specific SNPs as described above
- a variety of techniques are known in the art for detecting a genetic mutation within a sample, including sequencing genotyping, microarrays, Restriction Fragment Length Polymorphism, Southern Blots, SSCP, dHPLC, single nucleotide primer extension, allele- specific hybridization, allele-specific primer extension, oligonucleotide ligation assay, and invasive signal amplification, MALDI-TOF mass spectrometry and fluorescence polarization (FP).
- sequencing genotyping microarrays, Restriction Fragment Length Polymorphism
- Southern Blots Southern Blots
- SSCP Southern Blots
- dHPLC single nucleotide primer extension
- allele-specific hybridization allele-specific primer extension
- oligonucleotide ligation assay oligonucleotide ligation assay
- invasive signal amplification MALDI-TOF mass spectrometry and fluorescence polarization (FP).
- detecting a genetic mutation may be carried out by sequencing a nucleic acid comprising a fragment of BAG3 or HSPB7 gene locus and analysing the sequence for detecting the presence or the absence of said genetic mutation.
- PCR amplification may be performed on genomic DNA from said biological sample allowing amplification of the fragments to be sequenced.
- primers which span one or more fragments that comprise the putative location of a BAG3 or HSPB7 genetic mutation may be used to detect, by sequencing, said BAG3 or HSPB7 genetic mutations.
- primers which may be used in the diagnosis methods of the invention are short nucleic acid molecules, for instance DNA oligonucleotides of 10 nucleotides or more in length, which can be annealed to the complementary target nucleic acid molecule by nucleic acid hybridization to form a hybrid between the primer and the target nucleic acid strand.
- a primer can be extended along the target nucleic acid molecule by a polymerase enzyme. Therefore, primers can be used to amplify the target nucleic acid molecule, such as fragments of BAG3 coding regions or HSPB7 gene locus. The specificity of a primer increases with its length.
- a primer that includes 30 consecutive nucleotides will anneal to a target sequence with a higher specificity than a corresponding primer of only 15 nucleotides.
- probes and primers can be selected that include at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70 or more consecutive nucleotides.
- a primer is at least 15 nucleotides in length, such as at least 15 contiguous nucleotides complementary to a target nucleic acid molecule.
- primers having at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, or more contiguous nucleotides complementary to the target nucleic acid molecule to be amplified, such as a primer of 15-70 nucleotides, 15-60 nucleotides, 15-50 nucleotides, or 15-30 nucleotides.
- An “upstream” or “forward” primer is a primer 5' to a reference point on a nucleic acid sequence.
- a “downstream” or “reverse” primer is a primer 3' to a reference point on a nucleic acid sequence.
- at least one forward and one reverse primer are included in an amplification reaction.
- Nucleic acid probes and primers can be readily prepared based on the nucleic acid sequence of HSPB7 or BAG3 gene locus, for example SEQ ID NO: l and SEQ ID NO:3.
- PCR primer pairs can be derived from a known sequence by using computer programs intended for that purpose such as Primer 3 (v. 0.4.0 Whitehead Institute for Biomedical Research, Steve Rozen, and Helen Skaletsky).
- primers that may be used for amplifying BAG3 and/or HSPB7 exons prior to sequencing are shown in the following table 2.
- Typical PCR amplification conditions that may be used are: 95°C 5 min followed by 35 cycles :[95°C-15sec / Tm (as shown in Table2) - 30sec / Elongation Temp - 30sec].
- Table 2 Examples of PCR primers and conditions for sequence of BAG3 and HSPB7
- BAG3 exon primers (5'>3') 5' position (ref hgl9) PCR: size;Tm;MgC12;DMSO
- the genetic mutations are detected by specific hybridization of nucleic acid probes, such as oligonucleotide probes to genomic DNA or RNA transcripts or corresponding cDNA, containing the BAG3 or HSPB7 genetic mutations, for example containing the specific BAG3 or HSPB7 SNPs as described in the above paragraphs.
- nucleic acid probes such as oligonucleotide probes to genomic DNA or RNA transcripts or corresponding cDNA
- BAG3 or HSPB7 genetic mutations for example containing the specific BAG3 or HSPB7 SNPs as described in the above paragraphs.
- Taqman 5' nuclease genotyping method is used as described in the Examples.
- oligonucleotide PCR primers are designed that flank the mutation in question and allow PCR amplification of the region.
- a third oligonucleotide probe is then designed to hybridize to the region containing the base subject to change between different alleles of the gene.
- This probe is labelled with fluorescent dyes at both the 5' and 3' ends. These dyes are chosen such that while in this proximity to each other the fluorescence of one of them is quenched by the other and cannot be detected.
- Extension by Taq DNA polymerase from the PCR primer positioned 5' on the template relative to the probe leads to the cleavage of the dye attached to the 5' end of the annealed probe through the 5' nuclease activity of the Taq DNA polymerase. This removes the quenching effect allowing detection of the fluorescence from the dye at the 3' end of the probe.
- the discrimination between different DNA sequences arises through the fact that if the hybridization of the probe to the template molecule is not complete (there is a mismatch of some form) the cleavage of the dye does not take place. Thus only if the nucleotide sequence of the oligonucleotide probe is completely complimentary to the template molecule to which it is bound will quenching be removed.
- a reaction mix can contain two different probe sequences each designed against different alleles that might be present thus allowing the detection of both alleles in one reaction.
- primers and probes useful for detecting the SNPs of BAG and/or HSPB7 gene associated to dilated cardiomyopathy are shown in the following Table 3 : Table 3: Primers (a) and probes (b) and reaction conditions for Taqman genotyping
- the method of detecting a genetic mutation in BAG3 or HSPB7 gene locus comprises use of a restriction enzyme that specifically recognizes sequence corresponding to wild type or genetic mutations of BAG3 or HSPB7 gene sequence.
- said disease associated variant may be detected by detecting abnormal expression of gene product such as mRNA transcripts.
- Methods to quantify mRNA level from total mRNA cell extract are well known in the art and include quantitative PCR such as Real Time PCR amplification with labelled probes.
- Abnormal expression level may be determined by comparing the expression level to a control level. Significant difference in the expression level as determined by statistical analysis is indicative of abnormal expression level.
- a polypeptide disease associated variant is detected using a binding agent that specifically binds to a polypeptide disease associated variant.
- a binding agent that specifically binds to a mutant variant of Bag3 corresponding to said disease associated variant but not to wild type Bag3 may be used.
- Said binding agent may be for example an antibody or antibody fragments comprising antigen-binding regions.
- a mutant variant of Bag3 is a mutant Bag3 polypeptide as encoded by a BAG3 coding sequence including one or more of the SNPs associated to cardiomyopathy as described above, such as rs2234962 and rs3858340 or one of the SNP described in Table 1.
- Specific antibodies, or antibody fragments, reactive against particular disease associated variant, for example, a particular Bag3 mutant polypeptide may be selected by screening expression libraries encoding immunoglobulin genes using phage display technologies.
- antibodies are used to detect mutant Bag3 protein, in particular the mutant Bag3 protein as encoded by a B AG3 coding sequence including one or more of the SNPs associated to cardiomyopathy as described above, such as rs2234962 and rs3858340 or one of the SNP described in Table 1.
- Said antibodies or fragments thereof bind to mutant Bag3 protein but not to wild type Bag3 protein.
- said antibodies or fragments thereof bind to wild type Bag3 protein but not to mutant Bag3 protein.
- Kits may be prepared for carrying out one of the above mentioned detection methods.
- the invention further relates to a kit for carrying out the above-described method, said kit comprising: a. means for detecting a genetic mutation in BAG3 and/or HSPB7 gene locus, and, b. optionally, instructions for use of the kit.
- kits for detecting a genetic mutation in BAG3 and/or HSPB7 gene locus may therefore comprises, specific primers or oligonucleotides probes as described above, or specific binding agents, such antibody or antibody fragments as described above.
- the kits can include one or more isolated primers or primer pairs for amplifying a target nucleic acid in BAG3 or HSPB7 gene locus, such as a region comprising a SNP associated to cardiomyopathy as described above.
- the kit can include primers for amplifying a haplotype including one, two, three, four, five S Ps in HSPB7 and/or BAG3, wherein the amplified sequence includes the SNP associated with cardiomyopathy.
- the kit can further include one or more of a buffer solution, a conjugating solution for developing the signal of interest, or a detection reagent for detecting the signal of interest, each in separate packaging, such as a container.
- the kit includes a plurality of size-associated marker target nucleic acid sequences for hybridization with a detection array.
- the target nucleic acid sequences can include oligonucleotides such as DNA, RNA, and peptide-nucleic acid, or can include PCR fragments.
- the kit includes binding reagent to disease associated polypeptide variant, such antibodies or fragment thereof.
- the kit can also include instructions in a tangible form, such as written instructions or in a computer-readable format.
- said kit comprises a. means for detecting one or more SNPs in BAG3 and/or HSPB7 gene locus selected from the group consisting rs 10927875, rs945417, rs2234962 and rs3858340; and, b. optionally, instructions for use of the kit.
- said kit comprise a. means for detecting causal mutations in the full gene sequence of BAG3; and, b. optionally, instructions for use of the kit.
- Figure 1 displays the association of these 14 S Ps with DCM in both the pooled and individual DNA analyses.
- Figure 2 Ideogram from UCSC Genome Browser (assembly GRCh37/hgl9) presenting the associated region on chromosome 1 and gene structure and 5'->3' orientation. Positions of each of the five SNPs in LD defining DCM associated haplotypes are indicated.
- DCM idiopathic dilated cardiomyopathy
- conventional criteria 14 namely enlarged left ventricle diameter and low ejection fraction ( ⁇ 45%) associated with the absence of causal factors, such as coronary artery disease. Only apparently sporadic cases without affected first degree relatives were included.
- GWAS genome wide association study
- DCM cases were recruited through the CARDIGENE study (424 French patients) 42 , the EUROGENE (EHF) study (463 DCM cases from Germany, Italy and France) and the PHRC-DCM study (292 French DCM cases).
- French controls were selected from the ECTFM Study (Etude Cas-Temoin sur rinfarctus du Myocarde) 43 and the FITENAT Study 44 . Controls were also selected from healthy consultants or hospital professional workers in clinical centres in Italy (72 controls) and Germany (278 controls). Selection of controls was stratified according to age, gender and geographic origin to match the distribution of DCM cases. Replications studies were conducted in two case-control studies, from Germany, 723 cases and 726 controls, and from United Kingdom, 442 cases and 576 controls. Constitution of DNA pools. The DNA pools were stratified on population as well as gender and age when the numbers permitted. We required that at least 25 samples were mixed in a single pool. Each pool was constituted twice and each pool replicate was analysed on two arrays independently.
- the association between DCM and individual genotypes was tested using a logistic regression model (R:GLM) assuming an additive allele effect and adjusted on age, gender and study population.
- R:GLM logistic regression model
- DNAs from other available family members were genotyped for the familial variant by PCR and sequencing. We also sequenced exons 2, 3 and 4 of BAG3 in 364 individuals of European descent without known cardiac disease. Moreover, DNA from 95 controls of North African origin and 45 controls from Turkey were sequenced to check respectively for the presence of variants PI 15S and V468M in non-DCM populations.
- the discovery GWAS was performed on pools of DNA (pools-GWAS). Overall 26 DNA pools were constituted according to study population, disease status, gender and age. To improve the precision of effect estimates when comparing pools of DNA from patients and controls, each pool was duplicated and each duplicate was hybridized to two different genotyping arrays. The allele quantification in pools was performed using the Illumina 610 quad beadchip ⁇ Illumina)). After filtering out copy number variation (CNV) markers and single nucleotide polymorphisms (SNPs) with poor signal intensity, we retained 517,382 SNPs in the analysis. Pools-GWAS, validation by individual DNA genotyping and replication
- rsl0927875 is located in an intron of ZBTB17 (zinc finger and BTB domain containing 17 also frequently referred as MIZ-1) on chromosome Ip36.2-p36.1.
- the gene is located within a region exhibiting strong linkage disequilibrium (LD) and spanning several other genes: SPEN (spen homolog, transcriptional regulator), HSPB7 (heat shock 27 kDa protein family, member 7), CLCNKA (chloride channel Ka) and CLCNKB (chloride channel Kb).
- Yin/yang haplotypes To get better insight into the haplotypic structure of the region and its impact on the association of the locus with DCM, haplotypic relative risks 16 were computed.
- the 5 genotyped SNPs determine 6 common haplotypes.
- the two major haplotypes CTGCT (0.508 and 0.603 in controls and DCM cases, respectively) and TGCTA (0.301 and 0.230) differ at the five sites and are likely to represent ancestral alleles, the four less common haplotypes resulting from recombination between them.
- HSPB7 is the best candidate at the locus but does not exhibit any coding variant.
- HSPB7 that encodes the "cardiovascular heat shock protein” 23 and exhibit cardiac-specific expression
- DCM cardiac-specific gene
- HSPB7 expression is strongly affected by c/s-acting SNPs. Given the lack of coding variant in the HSPB7 sequence, we envisaged that sequence variations in the HSPB7 region might be related to DCM risk through an effect on gene expression. To investigate this hypothesis we looked for eQTLs in the HSPB7 region using two large eQTLs databases built from RNA expression data obtained from circulating monocytes (GHS Express 15 ) and from circulating monocytes and in v/Yro-derived macrophages (Cardiogenics Express 24 ). In both studies, HSPB7 mRNA was not detected in monocytes.
- rs2234962 is a non-synonymous S P (c.T757C, p.C151R) located within the coding sequence of BAG3 on chromosome 10q25.2-q26.2.
- S P c.T757C, p.C151R
- a plot of DCM-association -values of SNPs located around rs2234962 shows that the other associated SNPs in the pools-GWAS exhibit rather modest -values in comparison to rs2234962 (data not shown); 3. as rs2234962 could tag functional SNPs absent from the genotyping array used in our study, we examined the LD of this SNP with other variants in the region and observed that only 2 SNPs in HAPMAP release 22 were in tight LD (r 2 > 0.80) with the lead SNP and both were intronic with no evidence that they could be functional.
- BAG3 may affect DCM risk.
- the HAPMAP database revealed that the BAG3 sequence presents several non-synonymous SNPs.
- rs3858340 c.C1526T, p.P407L
- rs35434411 c.G518A, p.R71Q
- the 9 remaining variants were found once and none of them was present in the control group. All carriers of these mutations were heterozygous.
- the identified variants included three insertions/deletions resulting in a truncation of the encoded protein sequence (Q251RfsX56, R396GfsX48, S385QfsX56), a substitution creating a premature stop codon (p.R309X) and 5 missense mutations leading to single amino acid changes (I94F, PI 15S, P380S, E455K, V468M).
- Table 4 Identified SNPs and mutations in the coding sequences of BAG3 in 168 index cases with familial form of DCM Exo genomic variant name protein effect nature of dbSNP frequency frequency n position variant reference in index in controls, cases, n/694 n/336 alleles (%) alleles (%)
- the six remaining variants affect the BAG3 coding sequence and are likely to be disease causative.
- Two of the BAG3 mutations were observed in relatively large families (6 and 5 proven mutation carriers, respectively) and the 4 others were observed in small families (1 to 2 mutation carriers in each of these families).
- the penetrance was high, with presence of DCM in 13/18 mutation carriers (72%) and possible DCM in 3 (LV dilatation and mild LVEF ⁇ 60% in 3, congestive heart failure in 2).
- Two mutation carriers had a normal cardiac examination (a 7-year- old male and a 33-year-old female).
- pools-GWAS also exhibit a reduced sensitivity, implying that our study may have missed some associations that would have been identified by an individual-based genotyping. Nevertheless, this approach is efficient ' ' and the interest of the Illumina technologies for pools-GWAS has been emphasized 26 .
- the first DCM-associated SNP is located in a region exhibiting a yin/yang haplotype structure and encompassing the HSPB7 gene.
- HSPB7 is also called cardiovascular HSP as a consequence of its selective expression in cardiovascular tissues 30 and it belongs to the small HSP (sHSP) family 31 , whose member's main function is to protect a variety of tissues by binding denatured proteins.
- the physiological response of muscle fibers to stress involves HSPs of high molecular mass, such as HSP70 and sHSPs.
- HSP5 ocB-crystallin
- a dominant mutation in this gene causes a severe form of desmin-related cardiomyopathy characterized by accumulation of misfolded proteins as a consequence of impaired autophagy 32 .
- BAG3 is a member of a conserved family of cyto-protective co-chaperones proteins containing a conserved domain able to interact with HSC70/HSP70 and sHSPs proteins. BAG3 is involved in numerous activities including macro-autophagic protein degradation in aging cells 34 . BAG3 is mainly expressed in striated muscle and colocalizes with Z-disks (a sarcomeric protein assembly essential for actin anchoring in striated muscles).
- Bag-3 deficient mice Following normal muscle development, Bag-3 deficient mice present a progressive myopathy with Z-disk disruption and develop a fulminant myopathy characterized by noninflammatory myofibrillar degeneration with apoptotic features 35 . Autophagic degradation appears essential for maintaining Z-disk integrity and muscle contractility and Bag3 plays an essential role in this process which also involves small Hsps, such as HspB8 36 .
- Bag3 knock-out mice fulminant myopathy and cardiomyopathy are observed only in homozygous -/- animals but not in heterozygous 35 while in drosophilia, the Bag3 ortholog starvin deletion is associated with locomotion decline and myofiber sarcomeric disorganization even in heterozygous animals 36 . Further experiments are clearly needed to better understand if either poison peptide or haplo-insufficiency drives the pathophysiology of DCM related to BAG3 mutations.
- this GWAS identified two loci associated with sporadic DCM.
- the most likely candidate genes at these loci are HSPB7 and BAG3.
- BAG3 the two polymorphic loci in other forms of heart failure and muscle dysfunction, as well as in the age-related changes that affect the heart and muscle physiology.
- drug targeting the "proteasis network" 36 ' 41 may interfere with the progressive increase in muscle weakness seen in DCM patients and elderly people.
- An important aspect of this study is the discovery of BAG3 sequence variants being involved in both sporadic and familial forms of DCM. Table 5: Nucleotide sequences for practicing the method of the invention
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to field of molecular diagnosis, in particular for the in vitro diagnosis method for detecting a genetic predisposition to cardiomyopathy, such as dilated cardiomyopathy in a subject. More specifically, the invention relates to an in vitro diagnosis method for detecting a genetic predisposition for cardiomyopathy in a human subject, said method comprising the steps of: a. providing a biological sample from said human subject; and, b. detecting the presence or absence of an HSPB7 disease associated variant and/or BAG3 disease associated variant in said biological sample, wherein the presence of said HSPB7 or BAG3 disease associated variant is indicative of a genetic predisposition to cardiomyopathy in said human subject.
Description
IN VITRO DIAGNOSIS METHOD FOR PREDICTING A PREDISPOSITION TO
CARDIOMYOPATHY
FIELD OF THE INVENTION: The invention relates to the field of molecular diagnosis. The invention provides in vitro diagnosis methods for detecting a genetic predisposition to cardiomyopathy, such as dilated cardiomyopathy. More specifically, the invention relates to an in vitro diagnosis method for detecting a genetic predisposition to cardiomyopathy in a human subject, said method comprising the steps of: a. providing a biological sample from a human subject; and, b. detecting the presence or absence of an HSPB7 disease associated variant and/or BAG3 disease associated variant in said biological sample, wherein the presence of said HSPB7 and/or BAG3 disease associated variant is indicative of a genetic predisposition for cardiomyopathy in said human subject. BACKGROUND OF THE INVENTION:
Heart failure (HF) is a common chronic condition associated with a poor prognosis and an increasing economic burden1'2. The underlying causes of HF are heterogeneous. Idiopathic dilated cardiomyopathy (DCM) is a form of HF defined by the presence of left ventricular dilatation and left ventricular systolic dysfunction in the absence of an obvious etiology such as coronary artery disease (CAD), hypertension, valvular disease, or congenital defect3'4'5. DCM is a major cause of systolic heart failure and the leading indication for heart transplantation6, it affects approximately 1/2500 adults and it is more common in men than in women7.
The pathophysiology of DCM is poorly understood3. The disease is considered to be multifactorial with a possible implication of environmental factors and the existence of a strong genetic component attested by a high rate of familial aggregation3; 20% to 35% of DCM cases having an affected first-degree relative3'4. Genetic analyses of monogenic DCM have identified mutations in more than 30 genes, most of them encoding proteins of the cytoskeleton or the sarcomere8. These genes may carry mutations that are implicated in familial forms of the disease cases as well as common susceptibility alleles that are over- represented in sporadic cases9. However, the genetic basis of DCM, whether familial or
sporadic, is still largely unresolved and results of candidate gene association studies have been inconsistent10.
Over the last few years, genome-wide association studies (GWASs) using high density genotyping arrays have discovered numerous new loci implicated in cardiovascular diseases11 12 13. Despite these successes no GWAS of DCM has been reported so far, probably as a consequence of the relatively low prevalence of the disease making the assembly of large clinically homogeneous cohorts of patients difficult. Therefore, there is still need for providing simple and sensitive diagnostic method for predicting DCM predisposition.
In a first genome-wide association study of heart failure due to dilated cardiomyopathy (DCM) with discovery and replication cohorts comprising overall 2344 cases and 2410 controls, the inventors identified DCM biomarkers and in particular two DCM-associated S Ps, rsl0927875 and rs2234962 with respective -values of 9.5 x 10"10 and 4.0 x 10"12 in the combined data set. The first SNP is located at a locus on lp36.13 which exhibit a yin/yang haplotype structure encompassing several genes including HSPB7. The second SNP on 10q26.11 is located within BAG3 and is non-synonymous. Surprisingly, by sequencing of BAG3 exons in patients with familial DCM, the inventors identified several damaging mutations which were absent in healthy individuals, suggesting that they are causal for DCM.
SUMMARY OF THE INVENTION: A first object of the invention relates to an in vitro diagnosis method for detecting a genetic predisposition to cardiomyopathy in a subject, said method comprising the steps of: a. providing a biological sample from said subject; and, b. detecting the presence or absence of an HSPB7 disease associated variant
and/or BAG3 disease associated variant in said biological sample, wherein the presence of said HSPB7 and/or BAG3 disease associated variant is indicative of a predisposition to cardiomyopathy in said subject.
The method is particularly useful in predicting a predisposition to dilated cardiomyopathy, including familial or idiopathic dilated cardiomyopathy.
In one specific embodiment, said HSPB7 disease associated variant is a genetic mutation that decreases the expression level of HSPB7 gene without resulting in an alteration of the predicted amino acid sequence encoded by the HSPB7 gene.
Said genetic mutation may be for example, one or more single nucleotide polymorphism (SNP) mutations in HSPB7 gene locus. In a preferred embodiment, said genetic mutation is a SNP rsl0927875 and/or rs945417.
In another specific embodiment, said BAG3 disease associated variant is a genetic mutation altering the predicted amino acid sequence encoded by the BAG3 gene. For example, said genetic mutation includes a non-synonymous single nucleotide polymorphism (SNP) in a BAG3 coding region. In one embodiment, said genetic mutation is a genetic mutation resulting in a deletion or a dysfunction of the BAG domain of the Bag3 protein. For example, in a related specific embodiment, said genetic mutation is a non-synonymous single nucleotide polymorphisme in the BAG domain of the Bag3 protein. In a preferred embodiment, said non-synonymous SNP in BAG3 coding region is rs2234962 or rs3858340.
The invention naturally further relates to a kit for carrying out the above-described method, said kit comprising: a. means for detecting one or more SNPs in BAG3 and/or HSPB7 gene loci, and b. optionally, instructions for use of the kit. The invention also relates to a kit for carrying out the above-described method, said kit comprising: a. means for detecting causal mutations in the full gene sequence of BAG3; and, b. optionally, instructions for use of the kit.
DETAILED DESCRIPTION OF THE INVENTION: The invention relates to an in vitro diagnosis method for detecting a genetic predisposition to cardiomyopathy in a subject, said method comprising the steps of: a. providing a biological sample from said subject; and, b. detecting the presence or absence of an HSPB7 disease associated variant and/or BAG3 disease associated variant in said biological sample,
wherein the presence of said HSPB7 and/or BAG3 disease associated variant is indicative of a genetic predisposition to cardiomyopathy in said subject.
As used herein, a subject has a genetic predisposition to a disease when this subject has a higher risk to develop such disease, compared to the average risk in a population to develop such disease. Of course, a predisposition does not mean that the subject will develop the disease. As used herein, "Detecting a predisposition to cardiomyopathy" therefore includes detecting a higher risk of developing the disease, or determining the susceptibility of that subject to developing the disease or to having a poor prognosis for the disease.
As used herein, the term "cardiomyopathy" refers to all myocardial disorder in which the heart muscle is structurally and functionally abnormal, in the absence of coronary artery disease, hypertension, valvular disease and congenital heart disease sufficient to cause the observed myocardial abnormality (Eur Heart J 2008;29:270-276). Cardiomyopathy includes without limitation, hypertrophic cardiomyopathy (HCM or HOCM), arrhythmogenic right ventricular cardiomyopathy (ARVC), isolated ventricular non- compaction, mitochondrial myopathy, dilated cardiomyopathy such as familial or idiopathic dilated cardiomyopathy (DCM), restrictive cardiomyopathy (RCM), Takotsubo cardiomyopathy and Loeffler endocarditis.
The diagnosis methods may also be applied to other cause of heart failure such as systolic or diastolic left ventricular dysfunction due to coronary artery disease, valvular diseases or arterial. The invention more specifically relates to a method for detecting a genetic predisposition to dilated cardiomyopathy including familial or idiopathic dilated cardiomyopathy.
Providing a biological sample The method of the invention can be carried out on any appropriate biological sample obtained from a subject.
As used herein, the term "biological sample" refers to a sample that contains either nucleic acid or protein materials reflecting the genomic information of cells, tissue or organs of the subject.
In one specific embodiment, said sample is obtained from a mammal, for example from rodents, cats, dogs, horses, primates or human. In one preferred embodiment, said sample is obtained from a human subject. For example, said biological sample may be obtained from urine, blood including without limitation peripheral blood or plasma, stool, sputum, bronchoalveolar fluid, endotracheal aspirates, wounds, cerebrospinal fluid, lymph node, exsudate and more generally any human biopsy tissue or body fluids, tissues or materials.
It is well known that genomic DNA of individuals can easily be purified from individual blood sample. Therefore, in a preferred embodiment, said biological sample is blood, more preferably human blood sample.
As used herein, a "disease associated variant" means any genotypic biomarker, such as a genetic mutation, that is associated with an increased or decreased risk of developing the disease.
In one embodiment, said disease associated variant is a genetic mutation in HPSB7 or BAG3 gene locus.
A "genetic mutation" refers to a nucleotide change (or nucleotide changes) in the wild type sequence of the corresponding gene. Said genetic mutation refers to a germline mutation that can be considered as a causal mutation (present only in patients, usually in a familial form of the disease, with a direct causal link with the disease). For example, mutations can occur within a gene or chromosome, including specific changes in non-coding regions of a chromosome, for instance changes in or near regulatory regions of genes. Types of mutations include, but are not limited to, base substitution point mutations (which are either transitions or transversions), deletions, and insertions. Missense mutations are those that introduce a different amino acid into the sequence of the encoded protein; nonsense mutations are those that introduce a new stop codon; and silent mutations are those that introduce the same amino acid often with a base change in the codon. In the case of insertions or deletions, mutations can be in-frame (not changing the frame of the overall sequence) or frame shift mutations, which may result in the misreading of a large number of codons (and often leads to abnormal termination of the encoded product due to the presence of a stop codon in the alternative frame). In preferred embodiments of the diagnosis methods of the invention, a disease associated variant is a single nucleotide polymorphism (S P) in HSPB7 or BAG3 gene locus.
As used herein, a "single nucleotide polymorphism (S P)" is a single base (nucleotide) polymorphism in a DNA sequence among individuals in a population. Typically in the literature, a single nucleotide polymorphism (SNP) may fall within coding sequences of genes, non-coding regions of genes, or in the intergenic regions between genes. SNPs within a coding sequence will not necessarily change the amino acid sequence of the protein that is produced, due to degeneracy of the genetic code. A SNP in which both forms lead to the same polypeptide sequence is termed "synonymous" (sometimes called a silent mutation)-if a different polypeptide sequence is produced they are "nonsynonymous". A nonsynonymous change may either be missense or "nonsense", where a missense change results in a different amino acid, while a nonsense change results in a premature stop codon. The exact sequence of a SNP can be determined from the database of SNPs available at the NCBI website (Entrez SNP, dbSNP build 128, Jan. 28, 2009). The "position" of the nucleotide of interest gives the location in the genome of the SNP, referring to the nucleotide position from the p-terminus of the chromosome in the human genome, see the NCBI SNP website (dbSNP), available on the internet.
HSPB7 disease associated variant
The inventors have identified specific single nucleotide polymorphisms of HSPB7 that are associated to a higher risk of developing dilated cardiomyopathy. The inventors have further shown that such SNPs may be associated to a decreased level of expression of HSPB7 gene compared to expression level with a wild type sequence.
Therefore, in one embodiment, predisposition to cardiomyopathy may be diagnosed by detecting a genetic mutation in HSPB7 gene locus that decreases the expression level of HSPB7 gene in a biological sample obtained from a subject.
An example of human wild type HSPB7 gene is the gene comprising the nucleotide sequence as shown in Genbank accession number (NM_014424.4 GI: 164519093 :
with corresponding cDNA of SEQ ID NO: l), and coding for the polypeptide sequence of SEQ ID NO:2 (NP_055239.1 GL7657202).
In one specific embodiment, said genetic mutation is a single nucleotide polymorphism (SNP) mutation in HSPB7 gene locus, which SNP in HSPB7 gene locus is associated with a decreased expression level of HSPB7 gene.
As used herein "HSPB7 gene locus" may comprise in the context of the present invention, the genetic sequence of HSPB7, the region of the promoter, the introns, the exons
including 3' and 5' untranscribed regions, and some intergenic regions involved in HSPB7 gene expression. The genetically associated region discovered by the inventors is covering 5 genes in the locus and extended from SPEN to CLC KB (on chromosome Ip36.2-p36.1 interval 162670000-163700000; GRCh37/hgl9 assembly) which comprise several other genes: SPEN (spen homolog, transcriptional regulator), HSPB7 (heat shock 27 kDa protein family, member 7), CLCNKA (chloride channel Ka) and CLCNKB (chloride channel kb).
In one preferred embodiment, said genetic mutation is the SNP rs 10927875 or rs945417 as described for example in dbSNP
(http://www.ncbi.nlm.nih.gov/proiects/SNP/snp summary. cgi).
More specifically, rsl0927875 is a SNP located in an intron of ZBTB17 (also referred as MIZ-1) (position 16299312; genomic release GRCh37). Rs945417 is a SNP located at position 16344625 (genomic release GRCh37) and located in the proximal promoter region of HSPB7 gene sequence.
Other genetic mutation or SNPs in HSPB7 gene locus may be detected in addition to rsl0927875 and/or rs945417, in particular, other SNPs which are associated with a decreased expression of HSPB7. SNPs in HSPB7 have been described for example in Matkovitch et al.21, to be associated to systolic heart failure.
BAG3 disease associated variant
The inventors have further identified specific SNPs of BAG3 gene that are associated to a higher risk of developing dilated cardiomyopathy. Such SNPs includes non-synonymous mutations in the coding regions and have been shown to be associated to an increased risk of developing cardiomyopathy. In some cases, the increased risk may therefore be linked to an altered Bag3 protein sequence. Sequencing of BAG3 exons in patients with familial dilated cardiomyopathy identified several damaging mutations absent in healthy individuals, suggesting a causal link of the mutations for dilated cardiomyopathy.
In one preferred embodiment, said genetic mutation is one or more single nucleotide polymorphism (SNP) mutations in BAG3 gene locus, for example, non synonymous single nucleotide polymorphism in BAG3 coding regions.
In one specific embodiment, genetic predisposition to cardiomyopathy may be diagnosed by detecting a genetic mutation that alters the predicted amino acid sequence encoded by the BAG3 gene in the biological sample.
As used herein "BAG3 gene locus" may comprise in the context of the present invention, the genetic sequence of BAG3, the region of the promoter, the introns, the exons including 3' and 5' untranscribed regions, and some intergenic regions involved in HSPB7 gene expression.. The BAG3 gene is located on chromosome lOq (position chrlO: 121400000- 121440000; GRCh37/hgl9 assembly).
An example of human wild type BAG3 gene is the gene comprising the nucleotide sequence as shown in Genbank accession number (NM_004281.3 GL62530382; with corresponding cDNA of SEQ ID NO:3), and coding for the polypeptide sequence of SEQ ID NO:4 (NP_004272.2 GI: 14043024).
In one specific embodiment, said genetic mutation is the single nucleotide polymorphism rs2234962 or rs3858340 as described for example in dbSNP
(http://www.ncbi.nlm.nih.gov/proiects/SNP/snp summary. cgi).
The SNP rs2234962 is a non-synonymous SNP (c. T757C, p. C151R) located within the coding sequence of BAG3 on chromosome 10q25.2-q26.2 (position 121429633 of GRCh37 Assembly).
The SNP rs3858340 is a non-synonymous SNP (c. C1526T, p. P407L) located within the coding sequence of BAG3 on chromosome 10q25.2-q26.2 (position 121436286 of GRCh37 Assembly).
Both SNPs were unambiguously associated with dilated cardiomyopathy as shown in the experimental part below.
Other genetic mutation or SNPs in BAG3 gene locus may be detected in addition to rs2234962 or rs3858340.
In other specific embodiments, said genetic mutation is one or more of the following SNPs set forth in Table 1, which have been identified in familial forms of dilated cardiomyopathy.
In particular, the following SNPs in BAG3 coding regions set forth in Table 1 may be detected in the diagnosis methods according to the invention, either as disease associated variants or in combination with detecting SNPs rs2234962 or rs3858340:
Table 1:
Exon genomic variant name protein nature of dbSN P reference
position effect variant
2 121429462 586A>T I94F missense
2 121429633 757T>C C151R missense rs2234962
3 121432011 1058delA 251RfsX56 frame shift
4 121435991 12310T R309X nonsense
4 121436219 1459_1466 385QfsX56 frame shift
delTCTTCCC
4 121436246 1486_1487 delGA 395GfsX48 frame shift
4 121436286 15260T P407L missense rs3858340
4 121436429 1669G>A E455K missense
4 121436468 1708G>A V468M missense
In one specific embodiment, said BAG3 disease associated variant is a variant that is not associated to muscular dystrophy.
In another specific embodiment, said BAG3 disease associated variant is a Bag3 mutation resulting in a deletion or a dysfunction in the BAG domain of the Bag3 protein, for example one or more amino acid substitution or deletion in the BAG domain of Bag3 protein. As used herein, the term "BAG domain" may be defined by the following amino acid sequence of SEQ ID NO:75, corresponding to residues at amino acid position 421 to 498 of the Bag3 amino acid sequence of SEQ ID NO:4.
Means for detecting disease associated variants
The above-mentioned disease associated variants for HSPB7 or BAG3 may be detected in the biological sample either at the nucleic acid level or at the polypeptide level and includes methods to detect a genetic mutation in the genomic DNA or RNA transcripts and method to detect abnormal expression of the gene product or mutation in the gene product (RNA transcripts or polypeptide).
The presence of the genetic mutation may be detected on either one or both chromosomes, wherein the identification of the genetic mutation (e.g. one or more specific SNPs as described above) on at least one chromosome indicates that the subject is at risk for
developing cardiomyopathy, the subject has a cardiomyopathy, or has an early stage of cardiomyopathy.
A variety of techniques are known in the art for detecting a genetic mutation within a sample, including sequencing genotyping, microarrays, Restriction Fragment Length Polymorphism, Southern Blots, SSCP, dHPLC, single nucleotide primer extension, allele- specific hybridization, allele-specific primer extension, oligonucleotide ligation assay, and invasive signal amplification, MALDI-TOF mass spectrometry and fluorescence polarization (FP).
For example, specific genetic mutations of BAG3 or HSPB7 gene locus associated to dilated cardiomyopathy as described above may be readily detected on genomic DNA or transcript RNA or cDNA obtained from the biological sample. For example, detecting a genetic mutation may be carried out by sequencing a nucleic acid comprising a fragment of BAG3 or HSPB7 gene locus and analysing the sequence for detecting the presence or the absence of said genetic mutation.
For sequencing the appropriate regions in BAG3 or HSPB7 gene locus, PCR amplification may be performed on genomic DNA from said biological sample allowing amplification of the fragments to be sequenced.
Thus, primers which span one or more fragments that comprise the putative location of a BAG3 or HSPB7 genetic mutation (e.g specific SNPs as described in the above paragraphs) may be used to detect, by sequencing, said BAG3 or HSPB7 genetic mutations.
Such primers which may be used in the diagnosis methods of the invention are short nucleic acid molecules, for instance DNA oligonucleotides of 10 nucleotides or more in length, which can be annealed to the complementary target nucleic acid molecule by nucleic acid hybridization to form a hybrid between the primer and the target nucleic acid strand. A primer can be extended along the target nucleic acid molecule by a polymerase enzyme. Therefore, primers can be used to amplify the target nucleic acid molecule, such as fragments of BAG3 coding regions or HSPB7 gene locus. The specificity of a primer increases with its length. Thus, for example, a primer that includes 30 consecutive nucleotides will anneal to a target sequence with a higher specificity than a corresponding primer of only 15 nucleotides. Thus, to obtain greater specificity, probes and primers can be selected that include at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70 or more
consecutive nucleotides. In particular examples, a primer is at least 15 nucleotides in length, such as at least 15 contiguous nucleotides complementary to a target nucleic acid molecule. Particular lengths of primers that can be used to practice the methods of the present disclosure include primers having at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, or more contiguous nucleotides complementary to the target nucleic acid molecule to be amplified, such as a primer of 15-70 nucleotides, 15-60 nucleotides, 15-50 nucleotides, or 15-30 nucleotides.
An "upstream" or "forward" primer is a primer 5' to a reference point on a nucleic acid sequence. A "downstream" or "reverse" primer is a primer 3' to a reference point on a nucleic acid sequence. In general, at least one forward and one reverse primer are included in an amplification reaction.
Nucleic acid probes and primers can be readily prepared based on the nucleic acid sequence of HSPB7 or BAG3 gene locus, for example SEQ ID NO: l and SEQ ID NO:3. PCR primer pairs can be derived from a known sequence by using computer programs intended for that purpose such as Primer 3 (v. 0.4.0 Whitehead Institute for Biomedical Research, Steve Rozen, and Helen Skaletsky).
Examples of primers that may be used for amplifying BAG3 and/or HSPB7 exons prior to sequencing are shown in the following table 2. Typical PCR amplification conditions that may be used are: 95°C 5 min followed by 35 cycles :[95°C-15sec / Tm (as shown in Table2) - 30sec / Elongation Temp - 30sec].
Table 2: Examples of PCR primers and conditions for sequence of BAG3 and HSPB7
BAG3 exon primers (5'>3') 5' position (ref hgl9) PCR: size;Tm;MgC12;DMSO
1 cgcgattatagccgatgact 121410858 562bp;62°C;2mM;10%
gcctgccgtcgaggt 121411420
2 aggagggttcacttcccagt 121429306 499bp;65°C;2mM;none
atgccctgcatgtgaacag 121429805
3 ggagtcatttgtggggtcat 121431722 497bp;55°C;2mM;none
ccctggagacataccaccat 121432219
4.1 caatttctgtgactttcagtcagtt 121435918 495bp;65°C;2mM;none
tttgtcagtcttcttgccttca 121436413
4.2 gccatcctggagaaggtaca 121436345 582bp;55°C;lmM;10%
tttgcctccacccaagttac 121436927
HSW exon
1 cagggacagtcggccttat 16344582 376bp;TD65-55°C;2mM;10% cagacgtcccctccctgt 16344207
2 atgcaaggcctgctccat 16343748 271bp;TD65-55°C;2mM;10% gtctggggtcccaggatg 16343472
3 ggggttagaatggggagaag 16342343 374bp;60°C;2mM;none
ggctagaacctgggctgag 16341970
In other embodiments, the genetic mutations are detected by specific hybridization of nucleic acid probes, such as oligonucleotide probes to genomic DNA or RNA transcripts or corresponding cDNA, containing the BAG3 or HSPB7 genetic mutations, for example containing the specific BAG3 or HSPB7 SNPs as described in the above paragraphs.
In a specific embodiment, Taqman 5' nuclease genotyping method is used as described in the Examples. In this method, oligonucleotide PCR primers are designed that flank the mutation in question and allow PCR amplification of the region. A third oligonucleotide probe is then designed to hybridize to the region containing the base subject to change between different alleles of the gene. This probe is labelled with fluorescent dyes at both the 5' and 3' ends. These dyes are chosen such that while in this proximity to each other the fluorescence of one of them is quenched by the other and cannot be detected. Extension by Taq DNA polymerase from the PCR primer positioned 5' on the template relative to the probe leads to the cleavage of the dye attached to the 5' end of the annealed probe through the 5' nuclease activity of the Taq DNA polymerase. This removes the quenching effect allowing detection of the fluorescence from the dye at the 3' end of the probe. The discrimination between different DNA sequences arises through the fact that if the hybridization of the probe to the template molecule is not complete (there is a mismatch of some form) the cleavage of the dye does not take place. Thus only if the nucleotide sequence of the oligonucleotide probe is completely complimentary to the template molecule to which it is bound will quenching be removed. A reaction mix can contain two different probe sequences each designed against different alleles that might be present thus allowing the detection of both alleles in one reaction.
Examples of primers and probes useful for detecting the SNPs of BAG and/or HSPB7 gene associated to dilated cardiomyopathy are shown in the following Table 3 :
Table 3: Primers (a) and probes (b) and reaction conditions for Taqman genotyping
(a)
(b)
In another embodiment, the method of detecting a genetic mutation in BAG3 or HSPB7 gene locus comprises use of a restriction enzyme that specifically recognizes sequence corresponding to wild type or genetic mutations of BAG3 or HSPB7 gene sequence.
Alternatively, said disease associated variant may be detected by detecting abnormal expression of gene product such as mRNA transcripts. Methods to quantify mRNA level from total mRNA cell extract are well known in the art and include quantitative PCR such as Real Time PCR amplification with labelled probes. Abnormal expression level may be determined by comparing the expression level to a control level. Significant difference in the expression level as determined by statistical analysis is indicative of abnormal expression level.
In another embodiment, a polypeptide disease associated variant is detected using a binding agent that specifically binds to a polypeptide disease associated variant. For example, an agent that specifically binds to a mutant variant of Bag3 corresponding to said disease associated variant but not to wild type Bag3 may be used. Said binding agent may be for example an antibody or antibody fragments comprising antigen-binding regions. In a preferred embodiment, a mutant variant of Bag3 is a mutant Bag3 polypeptide as encoded by a BAG3 coding sequence including one or more of the SNPs associated to cardiomyopathy as described above, such as rs2234962 and rs3858340 or one of the SNP described in Table 1.
Specific antibodies, or antibody fragments, reactive against particular disease associated variant, for example, a particular Bag3 mutant polypeptide may be selected by screening expression libraries encoding immunoglobulin genes using phage display technologies. In one embodiment, antibodies are used to detect mutant Bag3 protein, in particular the mutant Bag3 protein as encoded by a B AG3 coding sequence including one or more of the SNPs associated to cardiomyopathy as described above, such as rs2234962 and rs3858340 or one of the SNP described in Table 1.
Said antibodies or fragments thereof bind to mutant Bag3 protein but not to wild type Bag3 protein. Alternatively, said antibodies or fragments thereof bind to wild type Bag3 protein but not to mutant Bag3 protein.
A person skilled in the art will understand that a number of methods can be used to detect and/or quantify specific polypeptide, including immunoassays such as Western Blots, ELISA, and immunoprecipitation followed by SDS-PAGE, as well as immunocytochemistry or immunohistochemistry.
Kits may be prepared for carrying out one of the above mentioned detection methods. Thus, the invention further relates to a kit for carrying out the above-described method, said kit comprising: a. means for detecting a genetic mutation in BAG3 and/or HSPB7 gene locus, and, b. optionally, instructions for use of the kit.
Said means for detecting a genetic mutation in BAG3 and/or HSPB7 gene locus may therefore comprises, specific primers or oligonucleotides probes as described above, or specific binding agents, such antibody or antibody fragments as described above. The kits can include one or more isolated primers or primer pairs for amplifying a target nucleic acid in BAG3 or HSPB7 gene locus, such as a region comprising a SNP associated to cardiomyopathy as described above. For example, the kit can include primers for amplifying a haplotype including one, two, three, four, five S Ps in HSPB7 and/or BAG3, wherein the amplified sequence includes the SNP associated with cardiomyopathy. The kit can further include one or more of a buffer solution, a conjugating solution for developing the signal of interest, or a detection reagent for detecting the signal of interest, each in separate packaging, such as a container.
In another example, the kit includes a plurality of size-associated marker target nucleic acid sequences for hybridization with a detection array. The target nucleic acid sequences can include oligonucleotides such as DNA, RNA, and peptide-nucleic acid, or can include PCR fragments.
In another example, the kit includes binding reagent to disease associated polypeptide variant, such antibodies or fragment thereof.
The kit can also include instructions in a tangible form, such as written instructions or in a computer-readable format.
In one preferred embodiment, said kit comprises a. means for detecting one or more SNPs in BAG3 and/or HSPB7 gene locus selected from the group consisting rs 10927875, rs945417, rs2234962 and rs3858340; and, b. optionally, instructions for use of the kit.
In another specific embodiment, said kit comprise a. means for detecting causal mutations in the full gene sequence of BAG3; and, b. optionally, instructions for use of the kit.
The invention will now be further illustrated by the following figures and examples. However, these examples and figures should not be interpreted in any way as limiting the scope of the present invention.
Brief Description of the Figures Figure 1: displays the association of these 14 S Ps with DCM in both the pooled and individual DNA analyses.
Figure 2: Ideogram from UCSC Genome Browser (assembly GRCh37/hgl9) presenting the associated region on chromosome 1 and gene structure and 5'->3' orientation. Positions of each of the five SNPs in LD defining DCM associated haplotypes are indicated.
EXAMPLE: 1. Methods
Subjects. All participants included in the study were of European origin. Ethics committees approved the study protocols, and all participants gave written informed consent. All patients had a diagnosis of idiopathic dilated cardiomyopathy (DCM) according to conventional criteria14, namely enlarged left ventricle diameter and low ejection fraction (<45%) associated with the absence of causal factors, such as coronary artery disease. Only apparently sporadic cases without affected first degree relatives were included. For the genome wide association study (GWAS), DCM cases were recruited through the CARDIGENE study (424 French patients)42, the EUROGENE (EHF) study (463 DCM cases from Germany, Italy and France) and the PHRC-DCM study (292 French DCM cases). French controls were selected from the ECTFM Study (Etude Cas-Temoin sur rinfarctus du Myocarde)43 and the FITENAT Study44. Controls were also selected from healthy consultants or hospital professional workers in clinical centres in Italy (72 controls) and Germany (278 controls). Selection of controls was stratified according to age, gender
and geographic origin to match the distribution of DCM cases. Replications studies were conducted in two case-control studies, from Germany, 723 cases and 726 controls, and from United Kingdom, 442 cases and 576 controls. Constitution of DNA pools. The DNA pools were stratified on population as well as gender and age when the numbers permitted. We required that at least 25 samples were mixed in a single pool. Each pool was constituted twice and each pool replicate was analysed on two arrays independently. Quantification of allelic signals in DNA pools. The Human 610 quad beadchip was used to quantify allelic signals and the beadchips were scanned on an i-scan scanner {Illumina). The data delivered by the scanner were transferred to the BeadStudio software {Illumina). "Genotyping" of pools of DNA followed the same general protocol as individual genotyping, but after normalization in BeadStudio the genotype assignment usually performed by clustering was skipped. Allele frequencies within pools were estimated from the normalized quantitative signals (x and y) corresponding to the two alleles of each SNP: p(x) = x/(x+y) and p(y)=l-p(x). As four measurements (two replicates of pools and two arrays /replicate of pool) were done, four estimates of x and y were available for each SNP in each pool and were used for statistical modelling. Statistical analyses were performed using the R statistical software45. A mixed linear model (R: LME4) was used to analyse the pooled allelic signals of each SNP, in which p(x) was the dependent variable, disease status, age category, gender and study population were fixed effects and the pool identifier was a random effect. In addition, a weight was introduced in the model to account for the number of samples in each pool. To estimate allele frequencies from DNA pools It has been proposed to introduce a correction factor k which is specific of each SNP, to compensate for systematic differences in signal intensities (p(x)=x/(x+Ay))46. The coefficient k may be obtained from the ratio of allelic signals in heterozygotes by genotyping a sample of individuals using the same array as for the pools-GWAS. However, k may be difficult to estimate reliably47. In the present analysis, we were not interested in allele frequencies per se, but in association statistics (odds ratio), which are not affected by k, under the assumption that the difference in signal intensity is not related to disease status. As a consequence, despite some loss of precision due to a larger standard error of the association statistic, we did not include a k correction. The association between DCM and individual genotypes was tested using a logistic regression model (R:GLM) assuming an additive allele effect and adjusted on age, gender and study population.
For in-depth investigation of the genomic context of DCM-associated S Ps, exploration and annotations of loci of interest were carried out using WGAviewer post-association genomic annotation tool48. To plot regional association results LocusZoom49 was used. Individual level validation of SNPs associated in the pools-GWAS. For each S P needing validation at the individual level, 2 primers and 2 dual-labelled probes (5'FAM- 3'TAMRA or 5'TET-3 'TAMRA) were designed with the Primer Express software (Applied Biosystems). Twenty ng of each DNA were amplified on a 96-well GeneAmp PCR System 9700 (Applied Biosystems) in 7μ1 final volume with 900nM of each primer, 200nM of each probe, dNTP, 0.2 unit of BIOTAQ DNA Polymerase (Bioline) and a passive fluorescence reference Rox (Euromedex). Before and after the amplification, the fluorescence of the reaction was checked on an ABI Prism 7000 Real-Time PCR System (Applied Biosystem). BAG3 exonic sequencing in patients with familial DCM. To search for mutations in Bag3 in familial DCM, genomic DNA from 168 index patients was sequenced on an ABI 3100 capillary sequencing instrument (Applera). DNAs from other available family members were genotyped for the familial variant by PCR and sequencing. We also sequenced exons 2, 3 and 4 of BAG3 in 364 individuals of European descent without known cardiac disease. Moreover, DNA from 95 controls of North African origin and 45 controls from Turkey were sequenced to check respectively for the presence of variants PI 15S and V468M in non-DCM populations.
2. Results
The results of a GWAS based on pools of DNA from patients with sporadic DCM and controls from several European populations and the replication of the main findings in two independent populations are reported hereafter. The replicated loci suggest the implication of the genes encoding heat shock protein B7 (HSPB7) and B-cell lymphoma 2-associated athanogene 3 (BAG3) in DCM. The subsequent direct sequencing of all coding regions of the BAG3 gene in patients with familial DCM identified several deleterious mutations. The populations of patients and controls included in this study at the discovery and replication stages were all of European origin. We used strict criteria14 for patient selection to exclude secondary or familial forms of cardiomyopathy. Overall 1179 sporadic DCM patients and 1108 controls were included in the discovery phase of the study while 1165
sporadic DCM patients and 1302 controls contributed to the replication phase. The discovery GWAS was performed on pools of DNA (pools-GWAS). Overall 26 DNA pools were constituted according to study population, disease status, gender and age. To improve the precision of effect estimates when comparing pools of DNA from patients and controls, each pool was duplicated and each duplicate was hybridized to two different genotyping arrays. The allele quantification in pools was performed using the Illumina 610 quad beadchip {Illumina)). After filtering out copy number variation (CNV) markers and single nucleotide polymorphisms (SNPs) with poor signal intensity, we retained 517,382 SNPs in the analysis. Pools-GWAS, validation by individual DNA genotyping and replication
We used a mixed linear model to compare allelic signals between pools of patients and pools of controls. DCM status, age category, gender and study population were considered as fixed effects and pool replicates as random effects. At the discovery stage, a slightly liberal threshold of P < 5 x 10"7 was adopted for declaring a SNP significant, in an attempt to compensate for the random error added by the pooling. At this level of significance, 14 SNPs showed significant case-control differences in the pools-GWAS. To check the validity of these associations, these SNPs were genotyped on individual DNA in the same discovery samples (Figure 1). In the individual -based analysis, two SNPs, rs2234962 on chromosome 10 (OR associated with minor allele: 0.52 (0.44-0.62), P=\ . U x 10"13) and rsl0927875 on chromosome 1 (OR: 0.71 (0.62-0.81), P=3.7 x 10"7), remained significantly associated with DCM. A third SNP, rsl6983785 on chromosome 21 (OR: 1.79 (1.42-2.26), P=7.22 x 10"7) was just above the pre-specified threshold. These three SNPs were tested for replication in 2 independent case-control studies of DCM from Germany and United Kingdom.
The pooled-GWAS associations were replicated for rsl0927875 (OR: 0.82 (0.72-0.93), =0.0021), and rs2234962 (OR: 0.82 (0.70-0.95), =0.0092); while for rsl6983785 replication was not achieved (OR: 1.25 (0.98-1.61), .Ρ=0.076). In the data set combining the discovery and replication samples, rsl0927875 and rs2234962 were associated with respective -values of 9.5 x 10"10 and 4.0 x 10"12. The association of rs2234962 with DCM was replicated in men (P =0.0016) but not in women (P=0.59). This difference may largely be attributed to the low minor allele frequency (MAF) of this SNP in women included in the German replication control sample (0.138 compared to >0.188 in the other groups, data not shown). This low frequency is probably due to chance as the MAF of rs2234962 in German men and women was 0.214 and 0.218 respectively in a population-based sample of 6298 individuals from the Gutenberg Heart Study15.
Further exploration of the rsl0927875 association signal on chromosome 1 rsl0927875 is not the best marker of DCM risk in the region. rsl0927875 is located in an intron of ZBTB17 (zinc finger and BTB domain containing 17 also frequently referred as MIZ-1) on chromosome Ip36.2-p36.1. The gene is located within a region exhibiting strong linkage disequilibrium (LD) and spanning several other genes: SPEN (spen homolog, transcriptional regulator), HSPB7 (heat shock 27 kDa protein family, member 7), CLCNKA (chloride channel Ka) and CLCNKB (chloride channel Kb). Recently, using a custom genotyping array targeting putative cardiovascular candidate genes, Stark et al PLoS Genet, 2010 Oct 21;6(10):el001167, identified and replicated an association between a S P in HSPB7 (rsl739843) and DCM, in a study using the same group of patients as the German replication sample of DCM cases used in the present study. Stark et al. did not genotype rsl0927875, however their result pointed to HSPB7 as being the gene responsible for the association with DCM. LD may explain the presence of several DCM- associated SNPs in the region (data not shown), especially in the sequences of HSPB7 (rs 1763601, pools-GWAS: P<1.0 x 10-4, this SNP being a perfect proxy of rsl739843, the DCM-associated SNP identified by Stark et al. according to HAPMAP release 22) and CLCNKA (rs 1805152, pools-GWAS: P=5.6 x 10-6). Because DNA-pooling introduces some error in the estimation of association statistics that may affect the observed relative effects of linked SNPs, we additionally genotyped rsl763601 and rs945417 (this proxy SNP was used in place of rs 1805152 which we had difficulties to genotype by Taqman assay) on individual DNA in the discovery samples (data not shown). Two other tightly linked potentially functional SNPs were also genotyped, rs945425 which is located in the proximal promoter region of CLCNKA and may generate an alternative splice site, and rsl048261 which is located in the 3'UTR of HSPB7. The 4 additionally genotyped SNP are represented in their genomic context in Figure 2.
Three of the 4 additional SNPs exhibited stronger associations with DCM than the lead SNP identified in the pools-GWAS (rs 1763601 : P=3.4 x 10"9; rs945417: 1.4 x 10"9; rs945425: 4.2 x 10"7 and rsl048261 : 7.9 x 10"9 as compared to =1.35 x 10"7 for rsl0927875) and for all these SNPs, the minor allele was associated with a reduced risk of DCM. In a stepwise logistic regression model including the 5 SNPs, only rs945417 remained significantly associated with DCM as a consequence of the LD in the region.
Yin/yang haplotypes. To get better insight into the haplotypic structure of the region and its impact on the association of the locus with DCM, haplotypic relative risks16 were computed. The 5 genotyped SNPs determine 6 common haplotypes. The two major haplotypes CTGCT (0.508 and 0.603 in controls and DCM cases, respectively) and
TGCTA (0.301 and 0.230) differ at the five sites and are likely to represent ancestral alleles, the four less common haplotypes resulting from recombination between them. In comparison to CTGCT, the yin/yang haplotype TGCTA was associated with a reduced risk of DCM (OR: 0.64 [0.53-0.74], P=3.2 x 10"9]. Yin/yang haplotypes are commonly observed in the human genome17 18 19, and such configuration has already been reported for the CLCNKA and CLCNKB genes nearby HSPB720. Recently, through a systematic sequencing of HSPB7 in patients with sporadic DCM and controls, Matkovich et al.21 identified 12 S Ps associated with systolic heart failure. Some of them are in strong LD with the SNPs investigated here or with tight proxies of them (according to HAPMAP22), suggesting that the variants reported in both studies correspond to the same yin/yang haplotypic structure.
HSPB7 is the best candidate at the locus but does not exhibit any coding variant.
Among the genes located in the region, HSPB7 that encodes the "cardiovascular heat shock protein"23 and exhibit cardiac-specific expression, is an obvious candidate for an association with DCM. However none of the DCM-associated SNPs or tight proxies identified through systematic sequencing by Matkovich et al21 or genotyped in the present study affects the coding sequence of HSPB7. Moreover, we sequenced the HSPB7 exons in 168 independent index cases diagnosed with familial DCM but were unable to identify any coding variant affecting the sequence of the HSPB7 protein (data not shown).
HSPB7 expression is strongly affected by c/s-acting SNPs. Given the lack of coding variant in the HSPB7 sequence, we envisaged that sequence variations in the HSPB7 region might be related to DCM risk through an effect on gene expression. To investigate this hypothesis we looked for eQTLs in the HSPB7 region using two large eQTLs databases built from RNA expression data obtained from circulating monocytes (GHS Express15) and from circulating monocytes and in v/Yro-derived macrophages (Cardiogenics Express24). In both studies, HSPB7 mRNA was not detected in monocytes. However, in the Cardiogenics resource, the gene was expressed in macrophages and several SNPs were associated in cis with its expression. The strongest associations were observed with rs945425 ( =5.8 x 10"57), rsl0927875 ( =5.3 x 10"42), rsl763601 (P=\ .9 x 10"36) and rsl805152 ( =4.8 x 10"31). These SNPs explained 34%, 26%, 23% and 20% of the inter-individual variability (R2) of HSPB7 expression respectively and their minor allele was associated with an increased HSPB7 expression. As the minor alleles of rs945425 and rsl763601 were less common in DCM patients than in controls (see above), it might be hypothesized that an increased expression of HSPB7 is associated with a reduced risk of DCM; however, the SNP most strongly correlating with HSPB7 expression, rs945425, was not the one most differing between DCM patients and controls (rs945417).
This obviously does not preclude a possible involvement of HSPB7 expression in the association, but as a consequence of the extensive LD and the yin/yang haplotypic structure in the region, an unexpected regulatory mechanisms at this locus may affect DCM risk. The other genes in the region were either not expressed in monocytes or macrophages (CLCNKA, CLCNKB) or their expression was not influenced by the DCM- associated S Ps (ZBTB17).
Further exploration of the rs2234962 association signal on chromosome 10 rs2234962 may directly affect DCM risk. rs2234962 is a non-synonymous S P (c.T757C, p.C151R) located within the coding sequence of BAG3 on chromosome 10q25.2-q26.2. Our results show that the minor allele of this variant is associated with a reduced risk of DCM. Although causality cannot be established from such data, several arguments support the possible direct involvement of this SNP in DCM susceptibility: 1. the cysteine at position 151 of the BAG protein is conserved across several species and the Polyphen tool25 predicts that the substitution of an arginine at this position is probably damaging; 2. a plot of DCM-association -values of SNPs located around rs2234962 shows that the other associated SNPs in the pools-GWAS exhibit rather modest -values in comparison to rs2234962 (data not shown); 3. as rs2234962 could tag functional SNPs absent from the genotyping array used in our study, we examined the LD of this SNP with other variants in the region and observed that only 2 SNPs in HAPMAP release 22 were in tight LD (r2 > 0.80) with the lead SNP and both were intronic with no evidence that they could be functional.
Several variants on BAG3 may affect DCM risk. The HAPMAP database revealed that the BAG3 sequence presents several non-synonymous SNPs. To complement our analysis we selected two of them, rs3858340 (c.C1526T, p.P407L) and rs35434411 (c.G518A, p.R71Q) on the basis of a MAF>5% in the HAPMAP CEU population, and individually genotyped them in our discovery cohorts. The rs35434411 was relatively uncommon in our data set and it was not associated with disease status (MAF 0.032 and 0.029 in patients and controls, respectively). Conversely, when tested alone, rs3858340 was significantly associated with DCM (P=3.6 x 10"5, MAF of 0.12 and 0.081 in patients and controls, respectively). A multiple logistic regression analysis suggested that both rs2234962 and rs3858340 independently contributed to DCM susceptibility (P=3A x 10"12 and =3.6 x 10" 3, respectively). In the discovery cohort, these two SNPs were in complete LD (D'=-l) defining 3 haplotypes, C757-C1526 (R-P), T757-C1526 (C-P) and T757-T1526 (C-L). We were therefore able to unambiguously determine the haplotypic pairs (i.e. diplotypes) carried by each individual and assessed their associations with DCM. The results suggest that both at the heterozygous and homozygous states, the combination of an arginine (R) at
position 151 and a proline (P) at position 407 of the BAG3 protein sequence protects against DCM.
Finally, the simultaneous association of the HSPB7 and BAG3 loci with DCM was tested by logistic regression in the discovery samples using individual genotypes. The results showed that their effect was additive (rs945417: P<2.5 x 10"8, rs2234962: P<5.6 x 10"13) with no evidence of interaction (P= .7).
Rare mutations in BAG3 are present in patients with familial forms of DCM
Given the possible implication of non-synonymous variants in BAG3 in sporadic DCM, we investigated whether mutations in BAG3 might be implicated in familial forms of DCM. The four BAG3 exons and intron-exon boundaries were sequenced in 168 independent index cases of mainly European DCM families. A total of 19 molecular variants were detected (see Table 4); among them, six were known SNPs referenced in dbSNP, four were present in a control group of 347 healthy individuals of European descent in which they were tested and three were unlikely to be deleterious. Among identified variants, 6 were known SNPs referenced in dbSNP and 4 were present in the control group of 347 healthy individuals of European descent in which they were tested. The 9 remaining variants were found once and none of them was present in the control group. All carriers of these mutations were heterozygous. The identified variants included three insertions/deletions resulting in a truncation of the encoded protein sequence (Q251RfsX56, R396GfsX48, S385QfsX56), a substitution creating a premature stop codon (p.R309X) and 5 missense mutations leading to single amino acid changes (I94F, PI 15S, P380S, E455K, V468M). Further analyses excluded 3 missense variants as possibly disease causing: I94F, despite perfect interspecies conservation, was not segregating in one affected relative of the family; P115S was not conserved and found in one control subject from North African origin out of 95 genotyped (the index case carrying this variant was of North African origin, explaining why a control group of similar origin was genotyped for this variant); P380S was not conserved. Software prediction of mutation consequences using Polyphen, SIFT and SNAP was in accordance with this conclusion as only E455K and V468M among the 5 missense mutants were predicted to impair the protein function.
Table 4: Identified SNPs and mutations in the coding sequences of BAG3 in 168 index cases with familial form of DCM
Exo genomic variant name protein effect nature of dbSNP frequency frequency n position variant reference in index in controls, cases, n/694 n/336 alleles (%) alleles (%)
2 121429394 212G>A R71Q missense rs35434411 9 (0.026) 14 (0,020)
2 121429412 5360T P77L missense 0 1 (0,001)
2 121429462 586A>T I94F missense 1 (0.003) 0
2 121429525 6490T P115S missense 1 (0.003) 0
2 121429633 757T>C C151R missense rs2234962 30 (0.089) 143 (0,206)
2 121429645 769G>A A155T missense rs61756328 0 4 (0,006)
3 121431946 993 G>A Q229Q synonymous 0 1 (0.001)
3 121432011 1058delA 251RfsX56 frame shift 1 (0.003) 0
3 121432036 1083OG P259P synonymous 0 1 (0.001)
3 121432147 11940T His296His synonymous 0 1 (0.001)
4 121435991 123 lOT R309X nonsense 1 (0.003) 0
4 121436068 1308T>G P334P synonymous rs3858339 43 (0.128) 64 (0.092)
4 121436204 14440T P380S missense 1 (0.003) 0
4 121436219 1459 1466 385QfsX56 frame shift 1 (0.003) 0
delTCTTCCC
4 121436246 1486 1487 395GfsX48 frame shift 1 (0.003) 0
delGA
4 121436286 15260T P407L missense rs3858340 43 (0.128) 66 (0.095)
4 121436362 1602A>G V432V synonymous rs 196295 69 (0.205) 146 (0.210)
4 121436429 1669G>A E455K missense 1 (0.003) 0
4 121436468 1708G>A V468M missense 1 (0.003) 0
The six remaining variants, including four truncating and two missense mutations, affect the BAG3 coding sequence and are likely to be disease causative. Two of the BAG3 mutations were observed in relatively large families (6 and 5 proven mutation carriers, respectively) and the 4 others were observed in small families (1 to 2 mutation carriers in each of these families). The penetrance was high, with presence of DCM in 13/18 mutation carriers (72%) and possible DCM in 3 (LV dilatation and mild LVEF<60% in 3, congestive heart failure in 2). Two mutation carriers had a normal cardiac examination (a 7-year- old male and a 33-year-old female).
Phenotypically, the DCM patients carrying a mutation showed isolated DCM, without associated conduction defect or skeletal myopathy and a normal serum creatine kinase
level in all but one patient. Four patients had heart transplantation and five relatives, whose DNA was not available, died prematurely from cardiac cause with a previous diagnosis of DCM. 3. Discussion
We report the results of the first GWAS conducted in patients with HF due to DCM. For the discovery phase of this study, we used a DNA-pooling approach and identified 14 SNPs at different loci showing some evidence of association with DCM. Three of these associations were confirmed by individual genotyping and two of them were replicated in independent DCM patients and controls.
Even when a very strict methodology is applied, estimates of allelic effects based on DNA pools are affected by variation in the quantity and concentration of individual DNAs composing the pools and by quantification errors26. The reduced specificity of pools- GWAS may be accounted for by individual-based genotyping of the most significant hits in the same samples. We observed that associations observed in the pools-GWAS were more reproducible in individual genotyping when several SNPs in LD at the same locus were associated with the disease. The observation made at the ZBTB17IHSPB7 locus is interesting in this regard, because the strongest hits were not the same in the pools-GWAS and in the individual genotyping. As a consequence of errors inherent to the DNA pooling approach, pools-GWAS also exhibit a reduced sensitivity, implying that our study may have missed some associations that would have been identified by an individual-based genotyping. Nevertheless, this approach is efficient ' ' and the interest of the Illumina technologies for pools-GWAS has been emphasized26.
The first DCM-associated SNP is located in a region exhibiting a yin/yang haplotype structure and encompassing the HSPB7 gene. HSPB7 is also called cardiovascular HSP as a consequence of its selective expression in cardiovascular tissues30 and it belongs to the small HSP (sHSP) family31, whose member's main function is to protect a variety of tissues by binding denatured proteins. The physiological response of muscle fibers to stress involves HSPs of high molecular mass, such as HSP70 and sHSPs. An example is provided by HSPB5 (ocB-crystallin); a dominant mutation in this gene causes a severe form of desmin-related cardiomyopathy characterized by accumulation of misfolded proteins as a consequence of impaired autophagy32. In humans, genetic variants in HSPB7 have recently been reported to be associated with advanced heart failure and systolic dysfunction of unspecific origin21'33.
The second DCM-associated SNP affects the sequence of the protein encoded by BAGS. BAG3 is a member of a conserved family of cyto-protective co-chaperones proteins containing a conserved domain able to interact with HSC70/HSP70 and sHSPs proteins. BAG3 is involved in numerous activities including macro-autophagic protein degradation in aging cells34. BAG3 is mainly expressed in striated muscle and colocalizes with Z-disks (a sarcomeric protein assembly essential for actin anchoring in striated muscles). Following normal muscle development, Bag-3 deficient mice present a progressive myopathy with Z-disk disruption and develop a fulminant myopathy characterized by noninflammatory myofibrillar degeneration with apoptotic features35. Autophagic degradation appears essential for maintaining Z-disk integrity and muscle contractility and Bag3 plays an essential role in this process which also involves small Hsps, such as HspB836.
In humans, a mutation in BAG3 (P209L) that affects a conserved motif of the BAG3 protein (I-P-V) known to play an important role in the interaction of BAG3 with sHSP37 causes severe dominant childhood muscular dystrophy with cardiomyopathy38. In our study, we identified 6 mutations, all of them affecting the BAG domain of BAG3, either by substituting highly conserved amino acids or by deleting the whole domain. Surprisingly, none of the carriers of the mutations presented with myofibrillar disorders as observed for the P209L mutation, suggesting a specific role for the BAG domain deletion/dysfunction in the DCM phenotype. In Bag3 knock-out mice fulminant myopathy and cardiomyopathy are observed only in homozygous -/- animals but not in heterozygous35 while in drosophilia, the Bag3 ortholog starvin deletion is associated with locomotion decline and myofiber sarcomeric disorganization even in heterozygous animals36. Further experiments are clearly needed to better understand if either poison peptide or haplo-insufficiency drives the pathophysiology of DCM related to BAG3 mutations.
In conclusion, this GWAS identified two loci associated with sporadic DCM. The most likely candidate genes at these loci are HSPB7 and BAG3. Beyond DCM, it will be of interest to investigate the implication of the two polymorphic loci in other forms of heart failure and muscle dysfunction, as well as in the age-related changes that affect the heart and muscle physiology. As recently discussed, drug targeting the "proteasis network"36'41 may interfere with the progressive increase in muscle weakness seen in DCM patients and elderly people. An important aspect of this study is the discovery of BAG3 sequence variants being involved in both sporadic and familial forms of DCM.
Table 5: Nucleotide sequences for practicing the method of the invention
NO : Description Seauence
CTTTTACCTC TGACTGAAAT CCCACCTAAG
1 cDNA HSB7 GCGCTCGCAGGCATCACCTCTGACACAGAG ATGGAGCAGA CAGTTGCCGG
GAACACAACC TTCTAGACCTTTAAGGAGAA AGCTGCCAAC TTTGTCCT CT TGGGGCTGCT GAATGTTCTGAGAGTCAGAG GGAGTGCAGG CACAGAAT CC AGGTCCCCAT GGGGGCTGGCAGGGGACAGC TGCACATTTT ACACCCCC TG GCAGGGCTCA ACCTTTCCTTAGAGATGGGC TGTGAAGGTT GTCTGCCT TG AGGGAAGGAG CTCCTGACGTCACAGAGCGG TGGTGCTTCC ACCTACCC TG TCCCCAAGGA GCCTGCACACTGATGGAGGA GGTACAGCCG TGGAGGAGAA CCAGAGTCTG GAGGGGAGGCACAGTCCTCA GGAGCCCCCA GGCTGACGGG GGAAACAAAA CACACAATAAACCCCAAACT TGCAAGGTTC TGGGGCAGGC ACCGAGGTCC GAGTGGCAAGGAGACAGGAT CCAGCCCTGT GCAGTGGT GA GGAGGCCCCT GGGGCTGCTGTGATCAGCCT GGAATGTCAG GCTGTGAGCT CAGCCCTCTC GGCCTGCGTGTCGGGCTGTC AGCAGGGCCG GCGCACGGGA GAAGATTTCCAGCCCCCTCTGGGCCATGGA GAGGCCTAAA TTTAGCTAGT AGACAAGGGG CTGGCCCCAAGCCCAGGGAC AGTCGGCCTT ATAAAGCGGC CGCAGTCGGA GCCTGGCACGCTCGCCCAGA GGCCTGCGCC CACACCCT CT CCTGTCCAGC CCTCGCCCGCCTGGGCAGGG CCCGGCGCCG TCCGTGGATG AGCCACAGAA CCTCTTCCACCTTCCGAGCG GAGAGAAGTT TCCATTCC TC TTCCTCTTCC TCCTCCTCTTCCACCTCCTC CTCGGCCTCC CGTGCTCT CC CGGCCCAGGA CCCGCCCATGGAGAAGGCCC TGAGCATGTT TTCCGATGAC TTTGGCAGCT TCATGCGGCCCCACTCGGAG CCCCTGGCCT TCCCAGCC CG CCCCGGTGGG GCAGGCAACATCAAGACCCT AGGAGACGCC TATGAGTT TG CGGTGGACGT GAGAGACTTCTCACCTGAAG ACATCATTGT CACCACCT CC AACAACCACA TCGAGGTGCGGGCTGAGAAG CTGGCGGCTG ACGGCACT GT CATGAACACC TTCGCTCACAAGTGCCAGCT GCCGGAGGAC GTGGACCC GA CGTCGGTGAC CTCGGCTCTGCGGGAGGACG GCAGCCTCAC TATCCGGGCA CGGCGTCACC CGCATACAGAACACGTCCAG CAGACCTTCC GGACGGAGAT CAAAATCTGA GTGCCTCTCCCTTCCCTTTC CCTGTCCCCC CGCCCCAC GC CTGCCAGCAA AGCCTCGCTAACCCCATTAC AACAGCTCCA GGACATCT CA GCCCAGGTTC TAGCCCCCACGCACCCCAGA CCCCAGGTGG ACCATCCT CC CAAACTAGGG CCCTCCACTCTATCCAGGGC AGGCCAGGGA CTCCCTGGCC TGACACATGA TGCCCAGATTTCAGATTTGG CCTCCGTCAC TTAATCCAGA GTACAGGGGC TGGGGTCAGGGAAGGAAGAT CTAAAGAACC CACTGTGGGT CAGGGGAATG GGACCAGCAGGACATATGGG CAAGCTCTGC AGGACAGACA GACAGACAAA CCCTCTGATCTATGAAGTCT CTGCAGGGCA AGGGGACCAG GGACCTGGAA CCCTCTTGGCCAAGGGGAGT GGGAGGGACA GAGGGAAGGT CACAGGCAAG GGTGCCTATCTAAGTGGAAC TAATTGCCCG AGGGCTCAGC AAGGCCAAGA GGAGACAGCCGTGACGGTAA ACTTCCCCTC TACCAGCC TC CAAGCCCCAC GCCAGCGAGC AGGCTGCCTG CCCACCCCGT GCCCCCAGCC AGCTGGCTGT GCCAGGGCAGAGCCATGCCA CATCTGTATA TAGATGGGGT TTTTCCAATA CAGCTGGTTCGTGATAAACT GCATGAAACT CCTGCCGT CC TGCGCCTGCT GGGGCCTCCAGGCAAGGCCA AGTGGGGTTG GGGGTGGGGC TGGTCCTTCT CCCTCCCACAGGCCTGTGTT CTTGGGGCTG CTCCCATGCA GACAGGATCA CCTAACAGAGATGGAAGCCA GGGCATGGAT GGGGCTTT GG GTCCTCGAGG TTGGACCCCAGCTTCTTGCC ACCTTCCCCT CCGGGCAGTC AGCTCTCCAT CCATCCCCCT CTTTAATCTA TGAATCTATA GGCTCGGTGT GTGTAACACA CACACCCCTA TCGTTGTCCT TCAAATACTC AGCATTACCA TTGGTTGAGG CCAAATTCAG AGCTTTCTCA AATCAGATTT ACAATC TCCA TTTTCATTAA CGGGGAAACA TCCCCGAGCC ACTGAGTGCT GTGCTT TGTC ACTGAAGGTT AGATCTGAAC CCAGGGTGTC AACTGCTGCT CTCAACT CCC CACCTCTGGG CACTGAGGAG TATTTCCCCT CATTCTACCT CTCTAAGGCT ATGCAACCCT CCCCACGTCT TCCAGCTGGG GGATGGGGGG GAGTCATAGG AAAAGCCCCC ATCTCCCATC TGGGATAGGG ACCTTCCATC AGCCTTAACC CTGGGAAATG CCTGCTGCCC CCAATGACTC TTGGTTTCGT CTCCCACATA CAGAAGCAGG GTGGAGGGGA AGGGTGGGTC TCAGTTAGCA GGGGTC CCCA GGGCAAGTCA GCCTCCTCCC TCCATGCCTC TCTGGTCAGT GTGCCTTAGG
GTGGCCTCTC ACTCCCACCA CTCTGGGCCC CTTGGGGGAG GACTGGGGAG GGGGCCGTGG GAGAGCCCTG ACGCTGGAAC CTGTATACAC AATAAAGGAC AGTCTCACAG ACaaaaaaaa aaaaaaaa
mshrtsstfr aersfhssss ssssstsssa sralpaqdpp mekalsmfsd
HspB7 dfgsfmrphs eplafparpg gagniktlgd ayefavdvrd fspediivtt polypeptide snnhievrae klaadgtvmn
tfahkcqlpe dvdptsvtsa Iredgsltir arrhphtehv qqtfrteiki
GCGGAGCTCC GCATCCAACC CCGGGCCGCG GCCAACTTCT CTGGACTGGA
cDNA BAG3 CCAGAAGTTT CTAGCCGGCC AGTTGCTACC TCCCTTTATC TCCTCCTTCC
CCTCTGGCAG CGAGGAGGCT ATTTCCAGAC ACTTCCACCC CTCTCTGGCC ACGTCACCCC CGCCTTTAAT TCATAAAGGT GCCCGGCGCC GGCTTCCCGG ACACGTCGGC GGCGGAGAGG GGCCCACGGC GGCGGCCCGG CCAGAGACTC GGCGCCCGGA GCCAGCGCCC CGCACCCGCG CCCCAGCGGG CAGACCCCAA CCCAGCATGA GCGCCGCCAC CCACTCGCCC ATGATGCAGG TGGCGTCCGG CAACGGTGAC CGCGACCCTT TGCCCCCCGG ATGGGAGATC AAGATCGACC CGCAGACCGG CTGGCCCTTC TTCGTGGACC ACAACAGCCG CACCACTACG TGGAACGACC CGCGCGTGCC CTCTGAGGGC CCCAAGGAGA CTCCATCCTC TGCCAATGGC CCTTCCCGGG AGGGCTCTAG GCTGCCGCCT GCTAGGGAAG GCCACCCTGT GTACCCCCAG CTCCGACCAG GCTACATTCC CATTCCTGTG CTCCATGAAG GCGCTGAGAA CCGGCAGGTG CACCCTTTCC ATGTCTATCC CCAGCCTGGG ATGCAGCGAT TCCGAACTGA GGCGGCAGCA GCGGCTCCTC AGAGGTCCCA GTCACCTCTG CGGGGCATGC CAGAAACCAC TCAGCCAGAT AAACAGTGTG GACAGGTGGC AGCGGCGGCG GCAGCCCAGC CCCCAGCCTC CCACGGACCT GAGCGGTCCC AGTCTCCAGC TGCCTCTGAC TGCTCATCCT CATCCTCCTC GGCCAGCCTG CCTTCCTCCG GCAGGAGCAG CCTGGGCAGT CACCAGCTCC CGCGGGGGTA CATCTCCATT CCGGTGATAC ACGAGCAGAA CGTTACCCGG CCAGCAGCCC AGCCCTCCTT CCACCAAGCC CAGAAGACGC ACTACCCAGC GCAGCAGGGG GAGTACCAGA CCCACCAGCC TGTGTACCAC AAGATCCAGG GGGATGACTG GGAGCCCCGG CCCCTGCGGG CGGCATCCCC GTTCAGGTCA TCTGTCCAGG GTGCATCGAG CCGGGAGGGC TCACCAGCCA GGAGCAGCAC GCCACTCCAC TCCCCCTCGC CCATCCGTGT GCACACCGTG GTCGACAGGC CTCAGCAGCC CATGACCCAT CGAGAAACTG CACCTGTTTC CCAGCCTGAA AACAAACCAG AAAGTAAGCC AGGCCCAGTT GGACCAGAAC TCCCTCCTGG ACACATCCCA ATTCAAGTGA TCCGCAAAGA GGTGGATTCT AAACCTGTTT CCCAGAAGCC CCCACCTCCC TCTGAGAAGG TAGAGGTGAA AGTTCCCCCT GCTCCAGTTC CTTGTCCTCC TCCCAGCCCT GGCCCTTCTG CTGTCCCCTC TTCCCCCAAG AGTGTGGCTA CAGAAGAGAG GGCAGCCCCC AGCACTGCCC CTGCAGAAGC TACACCTCCA AAACCAGGAG AAGCCGAGGC TCCCCCAAAA CATCCAGGAG TGCTGAAAGT GGAAGCCATC CTGGAGAAGG TACAGGGGCT GGAGCAGGCT GTAGACAACT TTGAAGGCAA GAAGACTGAC AAAAAGTACC TGATGATCGA AGAGTATTTG ACCAAAGAGC TGCTGGCCCT GGATTCAGTG GACCCCGAGG GACGAGCCGA TGTGCGTCAG GCCAGGAGAG ACGGTGTCAG GAAGGTTCAG ACCATCTTGG AAAAACTTGA ACAGAAAGCC ATTGATGTCC CAGGTCAAGT CCAGGTCTAT GAACTCCAGC CCAGCAACCT TGAAGCAGAT CAGCCACTGC AGGCAATCAT GGAGATGGGT GCCGTGGCAG CAGACAAGGG CAAGAAAAAT GCTGGAAATG CAGAAGATCC CCACACAGAA ACCCAGCAGC CAGAAGCCAC AGCAGCAGCG ACTTCAAACC CCAGCAGCAT GACAGACACC CCTGGTAACC CAGCAGCACC GTAGCCTCTG CCCTGTAAAA ATCAGACTCG GAACCGATGT GTGCTTTAGG GAATTTTAAG TTGCATGCAT TTCAGAGACT TTAAGTCAGT TGGTTTTTAT TAGCTGCTTG GTATGCAGTA ACTTGGGTGG AGGCAAAACA CTAATAAAAG GGCTAAAAAG GAAAATGATG CTTTTCTTCT ATATTCTTAC TCTGTACAAA TAAAGAAGTT GCTTGTTGTT TGAGAAGTTT AACCCCGTTG CTTGTTGTTC TGCAGCCCTG TCTACTTGGG CACCCCCACC ACCTGTTAGC TGTGGTTGTG CACTGTCTTT TGTAGCTCTG GACTGGAGGG GTAGATGGGG AGTCAATTAC CCATCACATA AATATGAAAC ATTTATCAGA AATGTTGCCA TTTTAATGAG ATGATTTTCT TCATCTCATA ATTAAAATAC CTGACTTTAG AGAGAGTAAA ATGTGCCAGG AGCCATAGGA ATATCTGTAT GTTGGATGAC TTTAATGCTA CATTTTAAAA AAAGAAAATA AAGTAATAAT ATAACTCAAa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaa
rs2234962 CAGAAACCACTCAGCCAGATAAACAGYGTGGACAGGTGGCAGCGGCGGCGGC rsl0927875 cactgtAGATTTCACCTAACTAAAGGYGTGAGCATTGCCCAGTGATCATCCA rs945417 CTTGTCTACTAGCTAAATTTAGGCCTSTCCATGGCCCAGAGGGGGCTGGAAA rs3858340 CAGCACTGCCCCTGCAGAAGCTACACYTCCAAAACCAGGAGAAGCCGAGGCT rsl739843 CTGCCATCACCATCTCACACCTGTCAYCTCCCACCCTCAAGCCCCACCCCCT
GGCAGGGCTGGAAACCCTGAGAGAAAMAGACACACCTTCTTTGAGATTTGGG
rsl763601 rsl805152 GCCTCTTGGGAGAGGCTCTTGCCGTCRCCTTCCCTGAGGGCATTGTGACTGG rs945425 TTTGTCAAGGACGTTTTTAATCTCCAYGGTAAACCCCGGCCGGCGGGGAAGG rsl048261 CCCAGAGGTGGGGAGTTGAGAGCAGCWGTTGACACCCTGGGTTCAGATCTAA rs35434411 TAGCAGGCGGCAGCCTAGAGCCCTCCYGGGAAGGGCCATTGGCAGAGGATGG rs61756328 AGCCAGATAAACAGTGTGGACAGGTGRCAGCGGCGGCGGCAGCCCAGCCCCC rs3858339 GGCCCAGTTGGACCAGAACTCCCTCCKGGACACATCCCAATTCAAGTGATCC rs196295 AAAGTGGAAGCCATCCTGGAGAAGGTRCAGGGGCTGGAGCAGGCTGTAGACA aatatagacccagaaagtagattattKtttgcttacaattgaggttggggga rs7328410
CTTAAAGTGTACAGTCTTCTCAAAGTKTGTGGGTGTAGAATTTTCTATTACA
rsl991914 rsl3176432 CTTAGCAGAGGATAAGAGCAGAGACCKTCAGGCCTGGTCAAAGCATGTGCAG rsl0491858 CACCTGTGCTGGCATAGTGGAAAGGTYCATCTGTTATCTAGGCCGAAGTGTT rs5970164 TAGATACTGGCTTACATGCTACATGAYGCCATTCCATTTCTTGCAAACACAT rs856003 TGGGAAAAAGCTAACAAAATGGTAGAYTTGAATCCAAATATATCAATAACAT
rsl 1543052 GAGCAGTGTGTGGATTACACTATCACYGGAAAAATACGAATTGAGAAGAAGG rsl353456 TTACAACAGAGAAACGTCGCTATAGAMCTGCATTTTGTGAGCACACGGCCTT rs2832070 TGCAAATTATTGGATTTGTCATTGCCYTTTTGAAATACAGGCTACCAAATCA rsl378796 AACTGTTCAAAGCCACTGGCTCATAGMCTGCTATCTCTATGAGGATGTTTAG rs2290906 GAGGCACTGAGTGGCCAGGCACTCGARGAAGGCAGCGTGGCATTCTGAGATG rs2832227 ATTAACGAGATATCTTGATTACTAGGRTCTTTTGATTAGATCTCCTTTTGAT rsl7681175 CACAGGTACTCCTTGAACTATTGGCCRGGACATCGAATACTTGACAGCAGAT rs7860026 ggctgttctcttttatgttcccatcaRtggtatatgaggcactcactttctc rs5970160 GCCCAGATTGGAAAAGTGCTCTGAGCRGTTCCTTTGTGACAATGGATGAACA rsl0886106 GCTTTATGAACACTCATTATTCTTAAMAATTAAACAAAAAGATACATTTATG rsl805152 GCCTCTTGGGAGAGGCTCTTGCCGTCRCCTTCCCTGAGGGCATTGTGACTGG rs5959428 ACATAAGACTGACTCCTCTTGATGCARACATACAGACATGGCAAAATAAGCT rs2832057 TTCATTTTTGACATGGGTAATTTGTGYTTTTGATCAAAGTCCAATCCTGCCA
GGGTAGCCCAGGGTGAGGCTCACGTCYTCATCCTGCCCCTCGCCAGTGGGGA
rsl2325933
GVLKVEAILE KVQGLEQAVD NFEGKKTDKK YLMIEEYLTK ELLALDSVDP
Bag Domain EGRADVRQAR RDGVRKVQTI LEKLEQKA
REFERENCES:
1. Lloyd- Jones, D. et al. Executive summary: heart disease and stroke statistics— 2010 update: a report from the American Heart Association. Circulation 121, 948-954 (2010).
2. Dickstein, K. et al. ESC Guidelines for the diagnosis and treatment of acute and chronic heart failure 2008: the Task Force for the Diagnosis and Treatment of Acute and Chronic Heart Failure 2008 of the European Society of Cardiology. Developed in collaboration with the Heart Failure Association of the ESC (HFA) and endorsed by the European Society of Intensive Care Medicine (ESICM). Eur. Heart J 29, 2388-
2442 (2008).
3. Jefferies, J.L. & Towbin, J. A. Dilated cardiomyopathy. Lancet 375, 752-762 (2010). 4. Hershberger, R., Kushner, J. & Parks, S. Dilated Cardiomyopathy Overview.
GeneReviews (2007).
5. Elliott, P. et al. Classification of the cardiomyopathies: a position statement from the European Society Of Cardiology Working Group on Myocardial and Pericardial Diseases. Eur. Heart J 29, 270-276 (2008).
6. Everly, M.J. Cardiac transplantation in the United States: an analysis of the UNOS registry. Clin Transpl 35-43 (2008). 7. Codd, M.B., Sugrue, D.D., Gersh, B.J. & Melton, L.J. Epidemiology of idiopathic dilated and hypertrophic cardiomyopathy. A population-based study in Olmsted County, Minnesota, 1975-1984. Circulation 80, 564-572 (1989).
8. Hershberger, R.E. et al. Coding sequence rare variants identified in MYBPC3, MYH6, TPM1, TNNC1, and TNNI3 from 312 patients with familial or idiopathic dilated cardiomyopathy. Circ Cardiovasc Genet 3, 155-161 (2010).
9. Rampersaud, E. et al. Common susceptibility variants examined for association with dilated cardiomyopathy. Ann. Hum. Genet 74, 110-116 (2010).
10. Tiret, L. et al. Lack of association between polymorphisms of eight candidate genes and idiopathic dilated cardiomyopathy: the CARDIGENE study. J. Am. Coll. Cardiol 35, 29-35 (2000).
11. Samani, N.J. et al. Genomewide association analysis of coronary artery disease. N. Engl. J. Med 357, 443-453 (2007). 12. Yasuno, K. et al. Genome-wide association study of intracranial aneurysm identifies three new risk loci. Nat. Genet 42, 420-425 (2010).
13. Smith, N.L. et al. Association of genome-wide variation with the risk of incident heart failure in adults of European and African ancestry: a prospective meta-analysis from the cohorts for heart and aging research in genomic epidemiology (CHARGE) consortium. Circ Cardiovasc Genet 3, 256-266 (2010).
14. Mestroni, L. et al. Guidelines for the study of familial dilated cardiomyopathies.
Collaborative Research Group of the European Human and Capital Mobility Project on Familial Dilated Cardiomyopathy. Eur. Heart J 20, 93-102 (1999).
15. Zeller, T. et al. Genetics and beyond—the transcriptome of human monocytes and disease susceptibility. PLoS ONE 5, el 0693 (2010). 16. Tregouet, D A. & Garelle, V. A new JAVA interface implementation of THESIAS: testing haplotype effects in association studies. Bioinformatics 23, 1038-1039 (2007).
17. Zhang, J., Rowe, W.L., Clark, A.G. & Buetow, K.H. Genomewide distribution of high- frequency, completely mismatching SNP haplotype pairs observed to be common across human populations. Am. J. Hum. Genet 73, 1073-1081 (2003).
18. Curtis, D. & Vine, A.E. Yin yang haplotypes revisited - long, disparate haplotypes observed in European populations in regions of increased homozygosity. Hum. Hered 69, 184-192 (2010).
19. Broadbent, H.M. et al. Susceptibility to coronary artery disease and diabetes is encoded by distinct, tightly linked SNPs in the ANRIL locus on chromosome 9p. Hum. Mol. Genet 17, 806-814 (2008). 20. Sile, S. et al. Haplotype diversity in four genes (CLCNKA, CLCNKB, BSND, NEDD4L) involved in renal salt reabsorption. Hum. Hered 65, 33-46 (2008).
21. Matkovich, S.J. et al. Cardiac signaling genes exhibit unexpected sequence diversity in sporadic cardiomyopathy, revealing HSPB7 polymorphisms associated with disease. J. Clin. Invest 120, 280-289 (2010).
22. Thorisson, G.A., Smith, A.V., Krishnan, L. & Stein, L.D. The International HapMap Project Web site. Genome Res 15, 1592-1593 (2005).
23. Krief, S. et al. Identification and characterization of cvHsp. A novel human small stress protein selectively expressed in cardiovascular and insulin-sensitive tissues. J. Biol. Chem 274, 36592-36600 (1999).
24. Heinig, M. et al. A trans-acting locus regulates an anti-viral expression network and type 1 diabetes risk. Nature 467, 460-464 (2010).
25. Ramensky, V., Bork, P. & Sunyaev, S. Human non-synonymous S Ps: server and survey. Nucleic Acids Res 30, 3894-3900 (2002).
26. Macgregor, S. et al. Highly cost-efficient genome-wide association studies using DNA pools and dense S P arrays. Nucleic Acids Res 36, e35 (2008).
27. Huang, Y., Hinds, D.A., Qi, L. & Prentice, R.L. Pooled versus individual genotyping in a breast cancer genome-wide association study. Genet Epidemiol (2010). doi : 10.1002/gepi .20517
28. Bosse, Y. et al. Identification of susceptibility genes for complex diseases using pooling-based genome-wide association scans. Hum. Genet 125, 305-318 (2009).
29. Bostrom, M.A. et al. Candidate genes for non-diabetic ESRD in African Americans: a genome-wide association study using pooled DNA. Hum. Genet 128, 195-204 (2010).
30. Krief, S. et al. Identification and characterization of cvHsp. A novel human small stress protein selectively expressed in cardiovascular and insulin-sensitive tissues. J. Biol. Chem 274, 36592-36600 (1999). 31. Kappe, G. et al. The human genome encodes 10 alpha-crystallin-related small heat shock proteins: HspBl-10. Cell Stress Chaperones 8, 53-61 (2003).
32. Tannous, P. et al. Autophagy is an adaptive response in desmin-related cardiomyopathy. Proc. Natl. Acad. Sci. U.S.A 105, 9745-9750 (2008).
33. Cappola, T.P. et al. Common variants in HSPB7 and FRMD4B associated with advanced heart failure. Circ Cardiovasc Genet 3, 147-154 (2010).
34. Gamerdinger, M. et al. Protein quality control during aging involves recruitment of the macroautophagy pathway by BAG3. EMBO J 28, 889-901 (2009). 35. Homma, S. et al. BAG3 deficiency results in fulminant myopathy and early lethality.
Am. J. Pathol 169, 761-773 (2006).
36. Arndt, V. et al. Chaperone-assisted selective autophagy is essential for muscle maintenance. Curr. Biol 20, 143-148 (2010).
37. Fuchs, M. et al. Identification of the key structural motifs involved in HspB8/HspB6- Bag3 interaction. Biochem. J 425, 245-255 (2010).
38. Selcen, D. et al. Mutation in BAG3 causes severe dominant childhood muscular dystrophy. Ann. Neurol 65, 83-89 (2009).
39. McCollum, A.K., Casagrande, G. & Kohn, E.C. Caught in the middle: the role of Bag3 in disease. Biochem. J425, el-3 (2010). 40. Nishino, I. et al. Primary LAMP -2 deficiency causes X-linked vacuolar cardiomyopathy and myopathy (Danon disease). Nature 406, 906-910 (2000).
41. Balch, W.E., Morimoto, R.I., Dillin, A. & Kelly, J.W. Adapting proteostasis for disease intervention. Science 319, 916-919 (2008).
42. Charron, P. et al. Identification of a genetic risk factor for idiopathic dilated cardiomyopathy. Involvement of a polymorphism in the endothelin receptor type A gene. CARDIGENE group. Eur. Heart J20, 1587-1591 (1999). 43. Parra, H.J. et al. A case-control study of lipoprotein particles in two populations at contrasting risk for coronary heart disease. The ECTFM Study. Arterioscler. Thromb 12, 701-707 (1992).
44. Mazoyer, E. et al. Prevalence of factor V Leiden and prothrombin G20210A mutation in a large French population selected for nonthrombotic history: geographical and age distribution. Blood Coagul. Fibrinolysis 20, 503-510 (2009). 45. R Development Core Team R: A language and environment for statistical computing.
(R Foundation for Statistical Computing: Vienna, Austria, 2008). a <http://www.R- project.org>
46. Sham, P., Bader, J.S., Craig, I, O'Donovan, M. & Owen, M. DNA Pooling: a tool for large-scale association studies. Nat. Rev. Genet 3, 862-871 (2002).
47. Macgregor, S., Visscher, P.M. & Montgomery, G. Analysis of pooled DNA samples on high density arrays without prior knowledge of differential hybridization rates. Nucleic Acids Res 34, e55 (2006).
48. Ge, D. et al. WGA Viewer: software for genomic annotation of whole genome association studies. Genome Res 18, 640-643 (2008).
49. Pruim, R.J. et al. LocusZoom: Regional visualization of genome-wide association scan results. Bioinformatics (2010).doi: 10.1093/bioinformatics/btq419
50. Fuchs, M. et al. Identification of the key structural motifs involved in HspB8/HspB6- Bag3 interaction. Biochem. J 425, 245-255 (2010).
Claims
An in vitro diagnosis method for detecting a genetic predisposition to cardiomyopathy in a subject, said method comprising the steps of: a. providing a biological sample from said subject; and, b. detecting the presence or absence of an HSPB7 disease associated variant and/or BAG3 disease associated variant in said biological sample, wherein the presence of said HSPB7 disease associated variant and/or BAG3 disease associated variant is indicative of a genetic predisposition to cardiomyopathy in said subject.
The diagnosis method according to Claim 1, wherein said cardiomyopathy is dilated cardiomyopathy.
The diagnosis method according to Claim 1 or 2, wherein said HSPB7 disease associated variant is a genetic mutation that decreases the expression level of HSPB7 gene without resulting in an alteration of the predicted amino acid sequence encoded by the HSPB7 gene.
The diagnosis method according to Claim 1 or 2, wherein said genetic mutation is one or more single nucleotide polymorphism (S P) mutations in HSPB7 gene locus.
The diagnosis method according to Claim 4, wherein said SNP in HSPB7 gene locus is rsl0927875 and/or rs945417.
The diagnosis method according to Claim 1 or 2, wherein said disease associated variant is a genetic mutation altering the predicted amino acid sequence encoded by the BAG3 gene.
The diagnosis method according to Claim 6, wherein said genetic mutation includes a non-synonymous single nucleotide polymorphism (SNP) in BAG3 coding regions.
The diagnosis method according to Claim 7, wherein said non-synonymous SNP in BAG3 coding region is rs2234962 or rs3858340.
The diagnosis method according to Claim 6, comprising detecting a variant polypeptide of Bag3 encoded by a genetic mutation as defined in any one of Claims 6-8 in said biological sample.
10. A kit for performing the diagnosis method of any one of Claims 1-9 comprising: a. means for detecting one or more S Ps in BAG3 and/or HSPB7 gene loci or one or more causal mutation in the full gene sequence of BAG3; b. optionally, instructions for use of the kit.
11. A kit for performing the diagnosis method of any Claim 10, comprising: a. means for detecting said variant polypeptide of Bag3, such as antibodies that binds specifically to said variant polypeptide of Bag3 but not to corresponding wild type Bag3 protein; and, b. optionally, instructions for use of the kit.
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201161441325P | 2011-02-10 | 2011-02-10 | |
| EP11154003 | 2011-02-10 | ||
| EP11154003.5 | 2011-02-10 | ||
| US61/441,325 | 2011-02-10 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2012107580A1 true WO2012107580A1 (en) | 2012-08-16 |
Family
ID=44148554
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2012/052352 Ceased WO2012107580A1 (en) | 2011-02-10 | 2012-02-10 | In vitro diagnosis method for predicting a predisposition to cardiomyopathy |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2012107580A1 (en) |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016005589A3 (en) * | 2014-07-10 | 2016-03-10 | Max-Delbrück-Centrum für Molekulare Medizin | Novel gene panel for the diagnosis of dilated cardiomyopathy |
| IT201600069391A1 (en) * | 2016-07-04 | 2016-10-04 | Univ Degli Studi Di Salerno | USE OF BAG3 PROTEIN AND ITS PEPTIDAL FRAGMENTS FOR THE CONTROL OF VASCULAR HOMEOSTASIS |
| EP3337518A4 (en) * | 2015-08-17 | 2019-06-12 | Temple University Of The Commonwealth System Of Higher Education | BAG3-BASED COMPOSITIONS AND ASSOCIATED METHODS |
| CN110438159A (en) * | 2019-07-03 | 2019-11-12 | 广州中医药大学(广州中医药研究院) | A method for constructing a gene mutation mouse model that causes myofibrillar myopathy |
| CN110452979A (en) * | 2019-09-03 | 2019-11-15 | 郑州大学第一附属医院 | A TTN G20137T mutation affecting the diagnosis and treatment of human dilated cardiomyopathy and its application |
| WO2019237002A1 (en) * | 2018-06-08 | 2019-12-12 | Temple University - Of The Commonwealth System Of Higher Education | Optimizing bag3 gene therapy |
| CN110863044A (en) * | 2019-12-11 | 2020-03-06 | 昆明理工大学 | Primer combination for detecting VCL gene mutation and application thereof |
| EP3812473A1 (en) * | 2014-01-31 | 2021-04-28 | Temple University Of The Commonwealth System Of Higher Education | Bag3 as target for therapy of heart failure |
| CN116064780A (en) * | 2023-01-19 | 2023-05-05 | 中山大学附属第三医院 | Application of related biomarker in liver cirrhosis cardiomyopathy |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010001358A2 (en) * | 2008-07-03 | 2010-01-07 | Mor Research Applications Ltd | Diagnostic polymorphisms for cardiac disease |
-
2012
- 2012-02-10 WO PCT/EP2012/052352 patent/WO2012107580A1/en not_active Ceased
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010001358A2 (en) * | 2008-07-03 | 2010-01-07 | Mor Research Applications Ltd | Diagnostic polymorphisms for cardiac disease |
Non-Patent Citations (54)
Cited By (21)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3812473A1 (en) * | 2014-01-31 | 2021-04-28 | Temple University Of The Commonwealth System Of Higher Education | Bag3 as target for therapy of heart failure |
| US11542555B2 (en) | 2014-01-31 | 2023-01-03 | Temple University Of The Commonwealth System Of Higher Education | BAG3 as a target for therapy of heart failure |
| US11236389B2 (en) | 2014-01-31 | 2022-02-01 | Temple University Of The Commonwealth System Of Higher Education | BAG3 as a target for therapy of heart failure |
| WO2016005589A3 (en) * | 2014-07-10 | 2016-03-10 | Max-Delbrück-Centrum für Molekulare Medizin | Novel gene panel for the diagnosis of dilated cardiomyopathy |
| EP3337518A4 (en) * | 2015-08-17 | 2019-06-12 | Temple University Of The Commonwealth System Of Higher Education | BAG3-BASED COMPOSITIONS AND ASSOCIATED METHODS |
| IT201600069391A1 (en) * | 2016-07-04 | 2016-10-04 | Univ Degli Studi Di Salerno | USE OF BAG3 PROTEIN AND ITS PEPTIDAL FRAGMENTS FOR THE CONTROL OF VASCULAR HOMEOSTASIS |
| JP2021526819A (en) * | 2018-06-08 | 2021-10-11 | テンプル ユニバーシティー オブ ザ コモンウェルス システム オブ ハイアー エデュケーション | Optimization of BAG3 gene therapy |
| JP7614844B2 (en) | 2018-06-08 | 2025-01-16 | テンプル ユニバーシティー オブ ザ コモンウェルス システム オブ ハイアー エデュケーション | Optimization of BAG3 gene therapy |
| CN113015742A (en) * | 2018-06-08 | 2021-06-22 | 联邦高等教育系统天普大学 | Optimized BAG3 gene therapy |
| US20210254159A1 (en) * | 2018-06-08 | 2021-08-19 | Temple University - Of The Commonwealth System Of Higher Education | Optimizing bag3 gene therapy |
| WO2019237002A1 (en) * | 2018-06-08 | 2019-12-12 | Temple University - Of The Commonwealth System Of Higher Education | Optimizing bag3 gene therapy |
| IL279281B1 (en) * | 2018-06-08 | 2026-03-01 | Univ Temple | Optimizing bag3 gene therapy |
| EP3802576A4 (en) * | 2018-06-08 | 2022-06-15 | Temple University - Of The Commonwealth System of Higher Education | OPTIMIZATION OF BAG3 GENE THERAPY |
| US12516376B2 (en) | 2018-06-08 | 2026-01-06 | Temple University—Of the Commonwealth System of Higher Education | Optimizing BAG3 gene therapy |
| AU2019281008B2 (en) * | 2018-06-08 | 2025-06-05 | Temple University - Of The Commonwealth System Of Higher Education | Optimizing BAG3 gene therapy |
| CN110438159A (en) * | 2019-07-03 | 2019-11-12 | 广州中医药大学(广州中医药研究院) | A method for constructing a gene mutation mouse model that causes myofibrillar myopathy |
| CN110438159B (en) * | 2019-07-03 | 2023-02-28 | 广州中医药大学(广州中医药研究院) | Construction method of gene mutation mouse model for inducing myofibrillar myopathy |
| CN110452979A (en) * | 2019-09-03 | 2019-11-15 | 郑州大学第一附属医院 | A TTN G20137T mutation affecting the diagnosis and treatment of human dilated cardiomyopathy and its application |
| CN110863044A (en) * | 2019-12-11 | 2020-03-06 | 昆明理工大学 | Primer combination for detecting VCL gene mutation and application thereof |
| CN116064780B (en) * | 2023-01-19 | 2023-09-26 | 中山大学附属第三医院 | Application of related biomarker in liver cirrhosis cardiomyopathy |
| CN116064780A (en) * | 2023-01-19 | 2023-05-05 | 中山大学附属第三医院 | Application of related biomarker in liver cirrhosis cardiomyopathy |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Villard et al. | A genome-wide association study identifies two loci associated with heart failure due to dilated cardiomyopathy | |
| WO2012107580A1 (en) | In vitro diagnosis method for predicting a predisposition to cardiomyopathy | |
| Cetani et al. | A novel mutation of the autoimmune regulator gene in an Italian kindred with autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy, acting in a dominant fashion and strongly cosegregating with hypothyroid autoimmune thyroiditis | |
| Yang et al. | Genetic variations of regulator of G-protein signaling 2 in hypertensive patients and in the general population | |
| Knöll et al. | The cardiac mechanical stretch sensor machinery involves a Z disc complex that is defective in a subset of human dilated cardiomyopathy | |
| Gerull et al. | Identification of a novel frameshift mutation in the giant muscle filament titin in a large Australian family with dilated cardiomyopathy | |
| Eggermann et al. | Cystinuria: an inborn cause of urolithiasis | |
| Burashnikov et al. | Mutations in the cardiac L-type calcium channel associated with inherited J-wave syndromes and sudden cardiac death | |
| JP6628226B2 (en) | Evaluation method for gout predisposition | |
| WO2005018436A2 (en) | Methods for the diagnosis, prognosis and treatment of metabolic syndrome | |
| WO2002098355A2 (en) | Methods and reagents for diagnosis and treatment of insulin resistance and related conditions | |
| Hu et al. | Analysis of the frequent R1141X mutation in the ABCC6 gene in pseudoxanthoma elasticum | |
| US10131957B2 (en) | Breast cancer biomarkers and methods of using same | |
| Popovska-Jankovic et al. | Molecular characterization of cystinuria in south-eastern European countries | |
| US20100267024A1 (en) | Mutations in the macrophage scavenger receptor 1 gene alter risk of prostate cancer, asthma, and cardiovascular disease | |
| JP4688492B2 (en) | Determination method of inflammatory diseases | |
| US20070092900A1 (en) | Methods for diagnosing and characterizing breast cancer and susceptibility to breast cancer | |
| Kamide et al. | Genetic variations of HSD11B2 in hypertensive patients and in the general population, six rare missense/frameshift mutations | |
| EP1576352B1 (en) | Methods of cardiovascular disease assessment in an individual | |
| JP2006526986A (en) | Diagnosis method for inflammatory bowel disease | |
| WO2011116311A1 (en) | Determining susceptibility to a sudden cardiac event | |
| Aoi et al. | Association of the insulin‐like growth factor1 gene with myocardial infarction in Japanese subjects | |
| JP2004524822A (en) | Method for diagnosing an individual at increased risk of developing deficiency based on MDR1 gene polymorphism | |
| WO2010009534A1 (en) | Methods for the treatment, prevention and diagnosis of lipid metabolism associated diseases | |
| WO2014207246A1 (en) | New polymorphisms for the diagnosis of idiopathic scoliosis disease |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12703541 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 12703541 Country of ref document: EP Kind code of ref document: A1 |



