WO2012104851A1 - Methods of diagnosing disease using overlap extension pcr - Google Patents

Methods of diagnosing disease using overlap extension pcr Download PDF

Info

Publication number
WO2012104851A1
WO2012104851A1 PCT/IL2012/050033 IL2012050033W WO2012104851A1 WO 2012104851 A1 WO2012104851 A1 WO 2012104851A1 IL 2012050033 W IL2012050033 W IL 2012050033W WO 2012104851 A1 WO2012104851 A1 WO 2012104851A1
Authority
WO
WIPO (PCT)
Prior art keywords
dna
fragments
primer
primers
linker
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IL2012/050033
Other languages
French (fr)
Other versions
WO2012104851A9 (en
Inventor
Ami Navon
Lior ZELCBUCH
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Yeda Research and Development Co Ltd
Original Assignee
Yeda Research and Development Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yeda Research and Development Co Ltd filed Critical Yeda Research and Development Co Ltd
Priority to US13/982,809 priority Critical patent/US20130316358A1/en
Publication of WO2012104851A1 publication Critical patent/WO2012104851A1/en
Publication of WO2012104851A9 publication Critical patent/WO2012104851A9/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6853Nucleic acid amplification reactions using modified primers or templates

Definitions

  • the present invention in some embodiments thereof, relates to methods of diagnosing a disease or susceptibility thereto based on DNA sequencing.
  • Mutations/variations in the human genome are involved in most diseases, going from monogenetic to multifactorial diseases, and acquired diseases such as cancer. Even the susceptibility to infectious diseases, and the response to pharmaceutical drugs, is affected by the composition of an individual's genome. Most genetic tests, which screen for such mutations/variations, require amplification of the DNA region under investigation. However, the size of the genomic DNA that can be amplified is rather limited. For example, the upper size limit of an amplified DNA fragment in a standard PCR reaction is about 2 kb. This contrasts sharply with the total size of 3 billion nucleotides of which the human genome is build up. As more and more mutations/variations are found to be involved in disease, there is a need for robust assays in which different DNA regions, that harbor the different mutations/variations, are analyzed together.
  • the cystic fibrosis or CFTR gene (approximately 5 kb long), contains approximately 1,300 rare mutations and polymorphisms and it may be desirable to determine the nucleotide sequence at many if not all of the potential mutation and/or SNP sites in a particular individual's gDNA.
  • 7,749,697 teaches multiplex overlap-extension RT-PCR to link two or more nucleotide sequences encoding for domains or subunits of a heteromeric protein in a single reaction.
  • the method especially relates to the linkage of variable regions encoding sequences from, for example, immunoglobulins, T cell receptors, or B cell receptors.
  • Additional background art includes: Heckman, K. L. & Pease, L. R. Nat Protoc 2, 924-932; Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K. & Pease, L. R. Gene 77, 51-59; Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K. & Pease, L. R. Gene 77, 61- 68.
  • a method of diagnosing a disease in a subject in need thereof comprising:
  • a method of linking a plurality of non-contiguous fragments of DNA to generate a single polynucleotide product comprising contacting the fragments with a multiplex overlap-extension primer mix, the mix comprising two flanking primers and a number of linker primers being one less than a number of the fragments, under conditions which allow simultaneous linking of the fragments and amplification of the single polynucleotide product, thereby generating the single polynucleotide product.
  • a method of linking a plurality of non-contiguous fragments of non-transcribed DNA to generate a single polynucleotide product comprising contacting the fragments with a multiplex overlap-extension primer mix under conditions which allow simultaneous linking of the fragments and amplification of the single polynucleotide product, wherein the primer mix comprises two flanking primers and at least one linker primer, thereby generating the single polynucleotide product.
  • kits for linking a plurality of non-contiguous fragments of DNA to generate a polynucleotide product comprising at least two flanking primers and at least one linker primer wherein at least two of the non-contiguous fragments of DNA comprise a nucleic acid sequence which is indicative of a disease.
  • At least two of the noncontiguous fragments of DNA comprise a nucleic acid sequence which is indicative of a disease.
  • the method further comprises fragmenting DNA of the sample prior to step (a) so as to generate the plurality of noncontiguous DNA fragments.
  • the fragmenting is effected using a restriction enzyme.
  • the polynucleotide product is no longer than 1000 base pairs.
  • the plurality of noncontiguous fragments comprises two fragments.
  • the plurality of noncontiguous fragments comprises three fragments.
  • the multiplex overlap- extension primer mix comprises two flanking primers and at least two linker primers.
  • a concentration of the at least one linker primer is lower than a concentration of the two flanking primers.
  • the determining a sequence is effected using a chain termination method.
  • the method further comprises informing the subject of the results of the diagnosing.
  • the method further comprises performing additional diagnostic tests so as to corroborate the results of the diagnosing.
  • the DNA comprises non- transcribed DNA.
  • the subject is a fetus.
  • the sample comprises amniotic fluid.
  • the DNA comprises non- transcribed DNA.
  • a concentration of the linker primers is lower than a concentration of the flanking primers.
  • the kit further comprises a DNA polymerase enzyme.
  • FIGs. 1 A-C illustrate the generation of a chimeric DNA fragment by single step PCR reaction.
  • A A Schematic diagram illustrating the logic underlining the design of a single step PCR ligation reaction of two DNA fragments.
  • B A practical example for PCR ligation of two DNA fragments: the ubiquitin binding proteasomal subunit RPN10 (I - SEQ ID NO: 21) and ubiquitin (II - SEQ ID NO: 20).
  • C PCR recombination of RPN10 and ubiquitin was preformed as described above while inserting one, two or three nucleotides between the two genes.
  • FIG. ID is a cartoon illustrating the alignment of the linker primer with the two PCR templates.
  • FIGs. 2A-B illustrate three piece ligation by single step PCR recombination
  • A A Schematic diagram describing the recombination of three segments of the yeast proteasomal subunits RPN10 (IV - SEQ ID NO: 23), RPT5 (V - SEQ ID NO: 24) and RPT2 (VI - SEQ ID NO: 25).
  • B Analysis of the PCR recombination reaction on 1% agarose gel complimented with Ethidium Bromide demonstrating the formation of the full length three piece recombination products.
  • FIGs. 3A-B illustrate the calibration of the optimal concentration of linker- primer.
  • A Reaction products separated on 1% agarose gel.
  • B Intensity of the desired PCR product visualized by Ethidium bromide plotted as a function of the linker-primer concentrations. Note that the concentrations are given in logarithmic scale. The optimal primer-linker concentration was found to be about 2nM.
  • FIG. 4 is a cartoon illustrating the alignment of the linker primer with the three PCR templates.
  • FIGs. 5A-B illustrate direct ligation of internal gene fragments by linker induced overlap recombination.
  • Four linker-primers and two flanking primers were used to allow single step PCR ligation of fragments in which the desired recombination site resides in the internal sequence of the templates.
  • A A carton representing the rational and the progression of the PCR recombination reaction.
  • B agarose gel stained by Ethidium-bromide staining to visualized the reaction products.
  • FIG. 5C is a cartoon illustrating the alignment of the four linker primers with the three PCR templates.
  • FIGs. 6A-B illustrate ligation of the three fragments as described in Figures 5A- B using the classical two step overhang PCR recombination.
  • Figure 5A Initially, the three fragment to be recombined were amplified by PCR (PCR reaction I). These PCR products were then used in a second PCR reaction (PCR reaction II) to generate the recombination product.
  • Figure 5B agarose gel stained by Ethidium-bromide staining to visualized the reaction products— accusly figure 5A-B is a single PCR reaction in which the first part is what happened in the first few cycles and the second is what happened later in this reaction.
  • FIGs. 6C-D illustrate ligation of the three fragments described in Figures 6A-B using 2 flanking primers and 2 linker primers.
  • FIGs. 7A-B illustrate direct cloning of a desired gene into a plasmid by single step PCR.
  • A pET 22-E2-S (IX - SEQ ID NO: 28) and the Active Site Loop (ASL) of E2-25K (VIII - SEQ ID NO: 27) served as temples for the amplification of a linear recombination products in which the native ASL of E2-S was swapped by the ASL of E2-25K (X - SEQ ID NO: 29).
  • B The PCR products were separated on agarose gel, side by side with the initial templates. The gel was visualized by Ethidium bromide.
  • FIG. 7C is a cartoon illustrating the alignment of the linker primer with the two templates (E2-25K active loop, E2-S in pET22 plasmid).
  • FIGs. 8A-B illustrate direct cloning of a desired gene into a plasmid by single step PCR.
  • A Ks (XI - SEQ ID NO: 30) and RPN10 (I - SEQ ID NO: 21) DNA fragment served as templates for the amplification of linear recombination products.
  • B the PCR products of the reaction were separated on agarose gel, side by side with the initial templates. The gel was visualized by Ethidium bromide.
  • FIG. 8C is a cartoon illustrating the alignment of the linker primer with the two templates (KS+ Plasmid, RpnlO PCR).
  • FIGs. 9A-B illustrates recombining DNA fragment from genomic source.
  • Two linker-primers (f & g) and two flanking primers (a & s) were used to fused RPNIO (Chr. VII) and RPT5 (Chr. XV) utilizing yeast genomic DNA as template.
  • Figure 9A visualization of the PCR reaction product separated on 1% agarose stained by Ethidium bromide.
  • Figure 9B schematic presentation of the reaction. DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION
  • the present invention in some embodiments thereof, relates to methods of diagnosing a disease or susceptibility thereto based on DNA sequencing.
  • the present inventors have now conceived of a different approach - namely the Linker-Induced Overlapping Recombination PCR method - enabling the promotion of an endonuclease-independent, single-step, PCR procedure to aid in disease diagnosis.
  • the method allows for amplification of a DNA product which comprises a multitude of linked fragments, each fragment being indicative of a disease.
  • the amount of sequencing may be significantly reduced.
  • the method may be particularly applicable to prenatal genetic testing whereby a multitude of diseases can be detected and diagnosed by a single reaction.
  • the underlying rational is based on a hierarchical PCR reaction in which by using an additional primer in a limited concentration an intermediate product is generated to a limited amount.
  • the intermediate product then serves both as template and primer for the consecutive reaction that produces the desired end-product which is then amplified by flanking primers.
  • a method of diagnosing a disease in a subject in need thereof comprising:
  • diagnosing a disease refers to determining a presence of a disease, determining if the subject is a carrier for a particular disease, determining a predisposition to a disease, classifying a disease, determining a severity of disease (grade or stage), monitoring disease progression, forecasting an outcome of the disease and/or prospects of recovery.
  • the present invention contemplates diagnosing any disease which is associated with a change (i.e. mutation) in a nucleic acid sequence of a DNA of a subject as compared to the wild-type DNA.
  • wild-type refers to the most common polynucleotide sequence or allele for a certain gene or non-coding sequence in a population. Generally, the wild-type DNA will be obtained from normal (non-diseased) cells.
  • mutant refers to a nucleotide change (i.e., a single or multiple nucleotide substitution, deletion, or insertion) in a nucleic acid sequence.
  • a nucleic acid which bears a mutation has a nucleic acid sequence (mutant allele) that is different in sequence from that of the corresponding wild-type polynucleotide sequence.
  • a mutation in DNA of a subject will contain between 1 and 10 nucleotide sequence changes.
  • the mutant DNA may have 50%, 60%. 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to the wild-type DNA.
  • Changes in the nucleic acid sequence of a DNA of a subject may be the result of natural or artificial (e.g., chemical carcinogens) deletions, additions, or substitutions of nucleotides.
  • An exemplary change in the nucleic acid sequence of DNA is one that takes the form of short tandem repeats (STRs) that include tandem di-, tri- and tetra-nucleotide repeated motifs. These tandem repeats are also referred to as variable number tandem repeat (VNTR) polymorphisms. VNTRs have been used in identity and paternity analysis (U.S. Pat. No. 5,075,217; Armour et al, FEBS Lett. 307: 113-115 (1992); Horn et al, WO 91/14003; Jeffreys, EP 370,719), and in a large number of genetic mapping studies.
  • nucleic acid sequence of DNA is one which takes the form of single nucleotide variations between individuals of the same species.
  • Such polymorphisms are far more frequent than RFLPs, STRs (short tandem repeats) and VNTRs (variable number tandem repeats).
  • Some single nucleotide polymorphisms occur in protein-coding sequences, in which case, one of the polymorphic forms may give rise to the expression of a defective or other variant protein and, potentially, a genetic disease.
  • Other single nucleotide polymorphisms occur in noncoding regions. Some of these polymorphisms may also result in defective protein expression (e.g., as a result of defective splicing).
  • somatic mutations are alterations in
  • Somatic mutations can occur in any of the cells of the body except the germ cells (sperm and egg) and therefore are not passed on to children. These alterations can (but do not always) lead to cancer or other diseases.
  • Exemplary diseases which may be diagnosed include, but are not limited to heart disease, cancer, endocrine disorders, immune disorders, neurological disorders, musculoskeletal disorders, ophthalmologic disorders, genetic abnormalities, trisomies, monosomies, transversions, translocations, skin disorders and familial diseases.
  • the method of the invention is especially useful in prenatal genetic testing of parents and child.
  • the method may be used for simultaneous diagnosis of a multitude of diseases. Examples of some of such diseases include, but are not limited to those listed herein below.
  • DNA fragments from a sample of the subject to generate a polynucleotide product.
  • DNA may be obtained from any biological sample including but not limited to blood sample, serum sample, amniotic fluid sample, plasma sample, urine sample, spinal fluid, lymphatic fluid, semen, vaginal secretion, ascitic fluid, saliva, mucosa secretion, peritoneal fluid, fecal sample, body exudates, breast fluid, lung aspirates, cells, tissues, individual cells or extracts of the such sources that contain the nucleic acid of the same, and subcellular structures such as mitochondria.
  • biological sample including but not limited to blood sample, serum sample, amniotic fluid sample, plasma sample, urine sample, spinal fluid, lymphatic fluid, semen, vaginal secretion, ascitic fluid, saliva, mucosa secretion, peritoneal fluid, fecal sample, body exudates, breast fluid, lung aspirates, cells, tissues, individual cells or extracts of the such sources that contain the nucleic acid of the same, and subcellular structures such as mitochondria.
  • the DNA may be genomic DNA (e.g. non-transcribed DNA, coding DNA or non-coding DNA) or cDNA (reverse transcribed DNA).
  • a reverse transcription (RT) reaction may be performed with an enzyme containing reverse transcriptase activity resulting in the generation of cDNA from total RNA, mRNA or target specific RNA from an isolated single cell.
  • Primers which can be utilized for the reverse transcription are for example oligo-dT primers, random hexamers, random decamers, other random primers, or primers that are specific for the nucleotide sequences of interest.
  • the non-contiguous DNA fragments of this aspect of the present invention may comprise sequences of the same gene or different genes. Further, the non-contiguous DNA fragments of this aspect of the present invention may comprise sequences of the same chromosome or different chromosomes. It will be appreciated that the distance between the DNA fragments of interest in their natural location (e.g. on a particular gene or chromosome) need not be considered when selecting the particular DNA fragments to be located. Typically, the DNA fragments are not closer than 500 base pairs away from each other in their natural environment.
  • the DNA fragments comprise sequences of genes involved in a given pathway or disease. According to another embodiment, the DNA fragments comprise sequences of genes belonging to a certain class of proteins. According to yet another embodiment, each DNA fragment comprises a putative site for a single nucleotide polymorphisms (SNP).
  • SNP single nucleotide polymorphisms
  • Each DNA fragment is typically less than about 5000 base pair (e.g. less than about 1000 base pairs, 500 base pairs, less than 400 base pairs, less than 300 base pairs, less than 200 base pairs or less than 100 base pairs).
  • the DNA fragments are selected such that at least two comprise a nucleic acid sequence which is indicative of a disease. It will be appreciated that the nucleic acid sequences may be indicative of one particular disease or different diseases.
  • the number of DNA fragments that may be linked according to this aspect of the present invention is typically between 2 and 10 and more typically between 2 and 5 - for example, 2, 3 or 4.
  • the sample may be processed before the method is carried out, for example
  • DNA purification may be carried out following the extraction procedure.
  • the DNA in the sample may be cleaved either physically or chemically (e.g. using a suitable enzyme). Processing of the sample may involve one or more of: filtration, distillation, centrifugation, extraction, concentration, dilution, purification, inactivation of interfering components, addition of reagents, and the like.
  • DNA fragments may be prepared using any number of methods well known in the art including but not limited to enzymatic digestion, manual shearing, and sonication.
  • the DNA can be digested with one or more restriction enzymes that have a recognition site, and especially an eight base or six base pair recognition site, which is not present in the loci of interest.
  • linkage refers to the joining of DNA fragments into a single product.
  • the linkage is preferably a nucleotide phosphodiester linkage. However, linkage can also be obtained by different chemical cross linking procedures.
  • the linking is effected by contacting the plurality of noncontiguous DNA fragments with a multiplex overlap-extension primer mix under conditions that allow simultaneous linkage of the DNA fragments and amplification of the polynucleotide product.
  • the method of this aspect of the present invention is effected by performing a multiplex molecular amplification reaction, using a primer mix which comprises two flanking primers and at least one linker primer.
  • PCR polymerase chain reaction
  • LCR ligase chain reaction
  • SDA strand displacement amplification
  • NASBA nucleic acid based sequence amplification
  • One feature of the present invention reduces the number of tubes necessary to amplify the nucleotide sequences of interest, utilizing a variant of PCR in which two or more target sequences are amplified and linked simultaneously in the same tube, by including more than one set of primers.
  • PCR polymerase chain reaction
  • K. B. Mullis and F. A. Faloona Methods Enzymol., 1987, 155: 350-355 and U.S. Pat. Nos. 4,683,202; 4,683,195; and 4,800,159 (each of which is incorporated herein by reference in its entirety).
  • PCR is an in vitro method for the enzymatic synthesis of specific DNA sequences, using two oligonucleotide primers that hybridize to opposite strands and flank the region of interest in the target DNA.
  • a plurality of reaction cycles results in the exponential accumulation of a specific DNA fragment
  • PCR Protocols A Guide to Methods and Applications
  • PCR Strategies M. A. Innis (Ed.), 1995, Academic Press: New York
  • Polymerase chain reaction basic principles and automation in PCR: A Practical Approach
  • the termini of the amplified fragments are defined as the 5' ends of the primers.
  • DNA polymerases capable of producing amplification products in PCR reactions include, but are not limited to: E. coli DNA polymerase I, Klenow fragment of DNA polymerase I, T4 DNA polymerase, thermostable DNA polymerases isolated from Thermus aquaticus (Taq), available from a variety of sources (for example, Perkin Elmer), Thermus thermophilus (United States Biochemicals), Bacillus stereothermophilus (Bio-Rad), or Thermococcus litoralis ("Vent" polymerase, New England Biolabs).
  • RNA target sequences may be amplified by reverse transcribing the mRNA into cDNA, and then performing PCR (RT-PCR), as described above.
  • RT-PCR PCR
  • a single enzyme may be used for both steps as described in U.S. Pat. No. 5,322,770.
  • the duration and temperature of each step of a PCR cycle, as well as the number of cycles, are generally adjusted according to the stringency requirements in effect. Annealing temperature and timing are determined both by the efficiency with which a primer is expected to anneal to a template and the degree of mismatch that is to be tolerated. The ability to optimize the reaction cycle conditions is well within the knowledge of one of ordinary skill in the art.
  • the number of reaction cycles may vary depending on the detection analysis being performed, it usually is at least 15, more usually at least 20, and may be as high as 60 or higher. However, in many situations, the number of reaction cycles typically ranges from about 20 to about 40.
  • the denaturation step of a PCR cycle generally comprises heating the reaction mixture to an elevated temperature and maintaining the mixture at the elevated temperature for a period of time sufficient for any double-stranded or hybridized nucleic acid present in the reaction mixture to dissociate.
  • the temperature of the reaction mixture is usually raised to, and maintained at, a temperature ranging from about 85 °C. to about 100 °C, usually from about 90 °C to about 98 °C, and more usually from about 93 °C. to about 96 °C. for a period of time ranging from about 3 to about 120 seconds, usually from about 5 to about 30 seconds.
  • the reaction mixture is subjected to conditions sufficient for primer annealing to template DNA present in the mixture.
  • the temperature to which the reaction mixture is lowered to achieve these conditions is usually chosen to provide optimal efficiency and specificity, and generally ranges from about 50 °C to about °C, usually from about 55 °C. to about 70 °C, and more usually from about 60 °C to about 68 °C.
  • Annealing conditions are generally maintained for a period of time ranging from about 15 seconds to about 30 minutes, usually from about 30 seconds to about 5 minutes.
  • the reaction mixture is subjected to conditions sufficient to provide for polymerization of nucleotides to the primer's end in a such manner that the primer is extended in a 5' to 3' direction using the DNA to which it is hybridized as a template, (i.e., conditions sufficient for enzymatic production of primer extension product).
  • conditions sufficient for enzymatic production of primer extension product i.e., conditions sufficient for enzymatic production of primer extension product.
  • the temperature of the reaction mixture is typically raised to a temperature ranging from about 65°C to about 75 °C, usually from about 67 °C. to about 73 °C, and maintained at that temperature for a period of time ranging from about 15 seconds to about 20 minutes, usually from about 30 seconds to about 5 minutes.
  • thermal cyclers that may be employed are described in U.S. Pat. Nos. 5,612,473; 5,602,756; 5,538,871; and 5,475,610 (each of which is incorporated herein by reference in its entirety). Thermal cyclers are commercially available, for example, from Perkin Elmer-Applied Biosystems (Norwalk, Conn.), BioRad (Hercules, Calif), Roche Applied Science (Indianapolis, Ind.), and Stratagene (La Jolla, Calif).
  • Amplification products obtained using primers of the present invention may be detected using agarose gel electrophoresis and visualization by ethidium bromide staining and exposure to ultraviolet (UV) light or by sequence analysis of the amplification product.
  • Primers of the invention may be prepared by any of a variety of methods (see, for example, J. Sambrook et al., "Molecular Cloning: A Laboratory Manual", 1989, 2.sup.nd Ed., Cold Spring Harbour Laboratory Press: New York, N.Y.; “PCR Protocols: A Guide to Methods and Applications", 1990, M. A. Innis (Ed.), Academic Press: New York, N.Y.; P.
  • oligonucleotides may be prepared using any of a variety of chemical techniques well-known in the art, including, for example, chemical synthesis and polymerization based on a template as described, for example, in S. A.
  • primers may be prepared using an automated, solid-phase procedure based on the phosphoramidite approach.
  • each nucleotide is individually added to the 5 '-end of the growing oligonucleotide chain, which is attached at the 3 '-end to a solid support.
  • the added nucleotides are in the form of trivalent 3'- phosphoramidites that are protected from polymerization by a dimethoxytriyl (or DMT) group at the 5 '-position.
  • DMT dimethoxytriyl
  • oligonucleotides are then cleaved off the solid support, and the phosphodiester and exocyclic amino groups are deprotected with ammonium hydroxide.
  • These syntheses may be performed on oligo synthesizers such as those commercially available from Perkin Elmer/ Applied Biosystems, Inc. (Foster City, Calif), DuPont (Wilmington, Del.) or Milligen (Bedford, Mass.).
  • oligonucleotides can be custom made and ordered from a variety of commercial sources well-known in the art, including, for example, the Midland Certified Reagent Company (Midland, Tex.), ExpressGen, Inc. (Chicago, 111.), Operon Technologies, Inc.
  • Purification of the primers of the invention may be carried out by any of a variety of methods well-known in the art. Purification of oligonucleotides is typically performed either by native acrylamide gel electrophoresis, by anion-exchange HPLC as described, for example, by J. D. Pearson and F. E. Regnier (J. Chrom., 1983, 255: 137-149) or by reverse phase HPLC (G. D. McFarland and P. N. Borer, Nucleic Acids Res., 1979, 7: 1067-1080).
  • the sequence of the primers can be verified using any suitable sequencing method including, but not limited to, chemical degradation (A. M. Maxam and W. Gilbert, Methods of Enzymology, 1980, 65: 499-560), matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectrometry (U. Pieles et al., Nucleic Acids Res., 1993, 21 : 3191-3196), mass spectrometry following a combination of alkaline phosphatase and exonuclease digestions (H. Wu and H. Aboleneen, Anal. Biochem., 2001, 290: 347-352), and the like.
  • chemical degradation A. M. Maxam and W. Gilbert, Methods of Enzymology, 1980, 65: 499-560
  • MALDI-TOF matrix-assisted laser desorption ionization time-of-flight
  • mass spectrometry U. Pieles et al., Nucleic Acids Res.
  • the components needed for the single-step multiplex overlap- extension reaction comprises the DNA fragments, an enzyme with DNA polymerase activity, deoxynucleoside triphosphate mix (dNTP mix comprising dATP, dCTP, dGTP and dTTP) and a multiplex overlap extension primer mix.
  • dNTP mix deoxynucleoside triphosphate mix
  • a multiplex primer mix where at least one primer is equipped with an overlap-extension tail (i.e. linking primer).
  • the overlap-extension tails enable the linkage of the products.
  • Such a primer mix is called a multiplex overlap-extension primer mix.
  • the multiplex overlap-extension PCR differ from conventional overlap- extension PCR in that the sequences to be linked are generated simultaneously in the same tube, thereby providing immediate linkage of the target sequences during amplification, without any intermediate purification. Further, conventional overlap- extension PCR requires a separate linking PCR reaction either with an outer primer set or a nested primer set in order to generate the linked product (Horton, R. M. et al. 1989. Gene 77, 61-68). Such an additional amplification step is optional in the multiplex overlap-extension PCR of the present invention.
  • the linkage of two DNA fragments is effected using 1 linking primer and 2 flanking primers (as illustrated in Figures 1 A-B).
  • the first flanking primer hybridizes to the 5' region of the sense strand of the first fragment, whereas the second flanking primer hybridizes to the 3' end of the antisense strand of the second fragment.
  • the linker primer is selected such that its nucleotide sequence reflects the desired junction between the two DNA fragments. Specifically, the initial nucleotides of the linker primer are identical to the 3 ' region of the sense strand of the first fragment, while the remaining nucleotides are derived from the 5 ' of the sense strand of the second fragment.
  • the linkage of three DNA fragments is effected using 2 linking primer and 2 flanking primers (as illustrated in Figures 2A-B).
  • the design of the flanking primers generally should observe known primer design rules such as minimizing primer dimerization, hairpin formation and non-specific annealing. Further, multiple G or C nucleotides as the 3' bases are to be avoided when possible.
  • the melting temperature (Tm) of the gene-specific regions in a primer set should preferably be equal to each other plus/minus 5 °C. For example Tm values between 45 °C and 75 °C may be desirable and Tm values of about 60 °C are optimal for most applications.
  • the initial primer design can be aided by computer programs developed for this task.
  • Design of the linking primer is dependent on sequence features such as length, relative GC content (GC %), presence of restriction sites, palindromes, melting temperature, the gene-specific part to which they are coupled etc.
  • the length of the overlap -extension tails should be between 8 and 75 nucleotides long, preferably they are from 15 to 40 nucleotides long. Even more preferred they are from 22 to 28 nucleotides long.
  • the use of very long overlap-extension tails (50 to 75 nucleotides) could favor the linkage of the products produced by each primer set. However, the proportion between the length of the overlap-extension tail and the gene-specific region probably will need to be adjusted when using very long overlap-extension tails.
  • the GC % preference is dependent on the length of the overlap-extension tail. Since shorter tails have a shorter area where they are complementary they need a higher GC % to strengthen the interaction than longer tails. Other principles of primer design should likewise be observed, e.g. primer dimerization and hairpin formation should be minimized. Neither shall they engage in false priming. Further, it is known that Taq DNA polymerase often adds an adenosine (A) at the 3' end of the newly synthesized DNA strand, and this can be accommodated for in overlap-extension tail design by enabling overlap-extension tails to accommodate 3' non-template A addition.
  • A adenosine
  • the primers of this aspect of the present invention need not reflect the exact sequence of the target nucleic acid sequences (i.e. need not be fully complementary), but must be sufficiently complementary to hybridize with their target sequences under the particular experimental conditions. Accordingly, the sequence of the primer typically has at least 70 % homology, preferably at least 80 %, 90 %, 95 %, 97 %, 99 % or 100 % homology, for example over a region of at least 13 or more contiguous nucleotides with the target DNA fragments.
  • the concentration of the linking primers is preferably lower than the concentration of the flanking primers.
  • Suitable ratios of linking primer: flanking primer include 1 : 10, 1 :20, 1 : 50, 1 : 100, 1 : 150, 1 : 200, 1 : 250, 1 : 300, 1 : 400 and 1 : 500.
  • one of the target sequences amplifies with a lower efficiency than the others, for example, as a result of a higher GC %, it may be possible to equalize the amplification efficacy. This may be done by using a higher concentration of the primer set which mediates amplification with low efficiency, or lowering the concentration of the other primer set.
  • the total primer concentration might be an issue.
  • the upper limit is determined experimentally by titration experiments. Such an upper limit of total oligonucleotide concentration influences the maximal concentration of individual primers. If the individual primer concentration is too low it is likely to cause a poor PCR sensitivity.
  • oligonucleotide primers have also been found to be important for the multiplex overlap-extension PCR. HPLC-purified oligonucleotides, have produced the best results. b. PCR Cycling Conditions:
  • a high number of thermal circles constitute between 35 and 80 cycles, preferably around 40 cycles. Further, longer extension times can improve the multiplex overlap-extension PCR process.
  • Multiplex PCR reactions can be significantly improved by using a PCR additive, such as DMSO, glycerol, formamide, or betaine, which relax DNA, thus making template denaturation easier.
  • a PCR additive such as DMSO, glycerol, formamide, or betaine, which relax DNA, thus making template denaturation easier.
  • dNTP Deoxynucleoside triphosphate
  • concentration is important for the multiplex overlap-extension PCR.
  • Optimal dNTP concentration is between 200 and 600 ⁇ (e.g. 400 ⁇ ) of each dNTP (dATP, dCTP, dGTP and dTTP), above which the amplification is rapidly inhibited.
  • dNTP stocks are sensitive to thawing/freezing cycles. After three to five such cycles, multiplex PCR often do not work well. To avoid such problems, small aliquots of dNTP can be made and kept frozen at -20 °C.
  • Mg 2+ concentration is importnat since most DNA polymerases are magnesium-dependent enzymes.
  • the template DNA primers and dNTP's bind Mg 2+ . Therefore, the optimal Mg 2+ concentration will depend on the dNTP concentration, template DNA, and sample buffer composition. If primers and/or template DNA buffers contain chelators such as EDTA or EGTA, the apparent Mg 2+ optimum may be altered. Excessive Mg 2+ concentration stabilizes the DNA double strand and prevents complete denaturation of DNA, which reduces yield. Excessive Mg 2+ can also stabilize spurious annealing of primer to incorrect template sites, thereby decreasing specificity. On the other hand, an inadequate Mg.sup.2+ concentration reduces the amount of product.
  • a good balance between dNTP and MgCl 2+ is approximately 200 to 400 ⁇ dNTP (of each) to 1.5 to 3 mM MgCl 2 or MgSo 4 .
  • dNTP and MgCl 2+ is approximately 200 to 400 ⁇ dNTP (of each) to 1.5 to 3 mM MgCl 2 or MgSo 4 .
  • KCl based buffers may be used for multiplex overlap-extension PCR; however, buffers based on other components such as (NH 4 ).2S0 4 , MgS0 4 , Tris-HCl, or combinations thereof may also be optimized to function with the multiplex overlap- extension PCR.
  • the PFU buffer composition is (10X Pfu Buffer:
  • Phusion DNA polymerse 200 mM Tris-HCl (pH 8.8 at 25 °C), 100 mM (NH 4 ) 2 S0 4 , 100 mM KCl, 1% (v/v) Triton X-100, 1 mg/ml BSA and 20 mM MgS0 4 ).
  • Phusion DNA polymerse may be as follows: 10X Phusion DNA Buffer: 200 mM Tris-HCl (pH 8.8 at 25°C), 100 mM (NH 4 ) 2 S0 4 , 600 mM KCl, 1% (v/v) Triton X-100, 1 mg/ml BSA and 20 mM MgS0 4 .
  • Primer pairs involved in the amplification of longer products may work better at lower salt concentrations (e.g. 20 to 50 mM KCl), whereas primer pairs involved in the amplification of short products work better at higher salt concentrations (e.g. 80 to 100 mM KCl). Raising the buffer concentration to 2 X instead of 1 X may improve the efficiency of the multiplex reaction.
  • the present invention is exemplified with Pfu polymerase.
  • other types of heat-resistant DNA polymerases including, for example, taq, Phusion, Pwo, Tgo, Tth, Vent, Deep-vent may be used.
  • Polymerases without or with 3' to 5'exonuclease activity may either be used alone or in combination with each other.
  • sequencing refers to any technique known in the art that allows the order of at least some consecutive deoxyribonucleotides in at least part of an amplification product.
  • Some non-limiting examples of sequencing techniques include Sanger's dideoxy termination method and the chemical cleavage method of Maxam and Gilbert, including variations of those methods; sequencing by hybridization; sequencing by synthesis; and restriction mapping.
  • sequencing comprises electrophoresis, including gel electrophoresis and capillary electrophoresis, including miniaturized capillary electrophoresis, and often comprising laser-induced fluorescence; sequencing by hybridization including bead array microarray hybridization; microfluidics (see, e.g., Paegel et al, Analyt. Chem. 74:5092-98, 2002); mass spectrometry (see, e.g., Koster et al, Nat. Biotechnol. 14: 1123-28, 1996); single molecule detection, including fluorescence microscopy or a nanometer-scale pore or nanopore; or combinations thereof.
  • electrophoresis including gel electrophoresis and capillary electrophoresis, including miniaturized capillary electrophoresis, and often comprising laser-induced fluorescence
  • sequencing by hybridization including bead array microarray hybridization
  • microfluidics see, e.g., Paegel et
  • sequencing comprises direct sequencing, duplex sequencing, cycle sequencing, single base extension (SBE) sequencing, solid-phase sequencing, Simultaneous Bi-directional Sequencing (SBS), double ended sequencing (see, e.g., Published PCT Application No. WO 2004/070005 A2), or combinations thereof.
  • sequencing comprises asymmetric PCR or A-PCR.
  • sequencing comprises an extending enzyme comprising a first fluorescent reporter group, such as a FRET donor, and a NTP comprising a second fluorescent reporter group, such as a quencher (see, e.g., U.S. Published Patent Application No. US 2003/0064366 Al).
  • sequencing comprises detecting at least some amplification products using an instrument, for example but not limited to an ABI PRISM.RTM. 377 DNA Sequencer, an ABI PRISM.RTM. 310, 3100, 3100-Avant, 3730, or 3730x1 Genetic Analyzer, an ABI PRISM.RTM. 3700 DNA Analyzer (all from Applied Biosystems), a microarray or bead array, a fluorimeter, or a mass spectrometer.
  • an instrument for example but not limited to an ABI PRISM.RTM. 377 DNA Sequencer, an ABI PRISM.RTM. 310, 3100, 3100-Avant, 3730, or 3730x1 Genetic Analyzer, an ABI PRISM.RTM. 3700 DNA Analyzer (all from Applied Biosystems), a microarray or bead array, a fluorimeter, or a mass spectrometer.
  • sequencing comprises incorporating a dNTP, including a dATP, a dCTP, a dGTP, a dTTP, a dUTP, a dITP, or combinations thereof and including dideoxyribonucleotide versions of dNTPs (e.g., ddATP, ddCTP, ddGTP, ddlTP, ddTTP, and ddUTP), into an amplification product.
  • dNTP including a dATP, a dCTP, a dGTP, a dTTP, a dUTP, a dITP, or combinations thereof and including dideoxyribonucleotide versions of dNTPs (e.g., ddATP, ddCTP, ddGTP, ddlTP, ddTTP, and ddUTP)
  • sequencing comprises a sequencing grade DNA-dependent DNA polymerase, for example but not limited to, AmpliTaq DNA polymerase CS or FS (Applied Biosystems); Sequenase or Thermo Sequenase (USB Corp.); and Sequencing Grade Taq DNA Polymerase (Promega).
  • sequencing comprises: a DNA-dependent DNA polymerase, for example but not limited to the Klenow fragment of E. coli DNA Pol I; an ATP sulfurylase, for example but not limited to a recombinant S.
  • a sequencing reaction comprises dATP.alpha.S, typically in place of dATP.
  • sequencing further comprises detecting light or fluorescence using, for example but not limited to a photodiode, a photomultiplier tube, a charge-coupled camera (CCD), a fluorimeter, a laser-scanner coupled with a detector, or combinations thereof.
  • a photodiode for example but not limited to a photodiode, a photomultiplier tube, a charge-coupled camera (CCD), a fluorimeter, a laser-scanner coupled with a detector, or combinations thereof.
  • CCD charge-coupled camera
  • kits preferably contains one or more of the following components: written instructions for the use of the kit, appropriate buffers, salts, DNA extraction detergents, primers, nucleotides, labeled nucleotides, 5' end modification materials, and if desired, water of the appropriate purity, confined in separate containers or packages, such components allowing the user of the kit to extract the appropriate nucleic acid sample, and analyze the same according to the methods of the invention.
  • the primers that are provided with the kit will vary, depending upon the purpose of the kit and the DNA that is desired to be tested using the kit.
  • the kits contain primers that allows for the linkage of two fragments, both of the fragments providing valuable information for single or multiple disease diagnosis.
  • a kit can also be designed to detect a desired or variety of single nucleotide polymorphisms, especially those associated with an undesired condition or disease.
  • one kit can comprise, among other components, a set or sets of primers to amplify and link at least two fragments of interest both of which are associated with breast cancer.
  • Another kit can comprise, among other components, a set or sets of primers for genes associated with a predisposition to develop type I or type II diabetes.
  • another kit can comprise, among other components, a set or sets of primers for genes associated with a predisposition to develop heart disease.
  • the method of the invention can be used to genotype microorganisms so as to rapidly identify the presence of a specific microorganism in a substance, for example, a food substance.
  • the method of the invention provides a rapid way to analyze food, liquids or air samples for the presence of an undesired biological contamination, for example, microbiological, fungal or animal waste material.
  • the invention is useful for detecting a variety of organisms, including but not limited to bacteria, viruses, fungi, protozoa, molds, yeasts, plants, animals, and archaebacteria.
  • the invention is useful for detecting organisms collected from a variety of sources including but not limited to water, air, hotels, conference rooms, swimming pools, bathrooms, aircraft, spacecraft, trains, buses, cars, offices, homes, businesses, churches, parks, beaches, athletic facilities, amusement parks, theaters, and any other facility that is a meeting place for the public.
  • the method of the invention can be used to test for the presence of many types of bacteria or viruses in blood cultures from human or animal blood samples.
  • the method of the invention can also be used to confirm or identify the presence of a desired or undesired yeast strain, or certain traits thereof, in fermentation products, e.g. wine, beer, and other alcohols or to identify the absence thereof.
  • the method of the invention can also be used to confirm or identify the relationship of a DNA of unknown sequence to a DNA of known origin or sequence, for example, for use in criminology, forensic science, maternity or paternity testing, archeological analysis, and the like.
  • the method the invention can also be used to determine the genotypes of plants, trees and bushes, and hybrid plants, trees and bushes, including plants, trees and bushes that produce fruits and vegetables and other crops, including but not limited to wheat, barley, corn, tobacco, alfalfa, apples, apricots, bananas, oranges, pears, nectarines, figs, dates, raisins, plums, peaches, apricots, blueberries, strawberries, cranberries, berries, cherries, kiwis, limes, lemons, melons, pineapples, plantains, guavas, prunes, passion fruit, tangerines, grapefruit, grapes, watermelon, cantaloupe, honeydew melons, pomegranates, persimmons, nuts, artichokes, bean sprouts, beets, cardoon, chayote, endive, leeks, okra, green onions, scallions, shallots, parsnips, sweet potatoes, yams
  • the method of the invention may also be useful for analyzing genetic variations of an individual that have an effect on drug metabolism, drug interactions, and the responsiveness to a drug or to multiple drugs.
  • the method of the invention is especially useful in pharmacogenomics.
  • compositions, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.
  • a compound or “at least one compound” may include a plurality of compounds, including mixtures thereof.
  • range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
  • method refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
  • primers designated “a” and “b”
  • linker-primer designated “c”
  • Primer "a” contains 20 nucleotides derived from the 5' region of the sense strand of the nlO gene (I - SEQ ID NO: 21)
  • primer "b” is similar to the 3' end of the antisense strand of the Ub gene (II - SEQ ID NO: 20).
  • both primers were diluted to a final (standard) concentration of 500 nM.
  • Primer "c” (the linker primer), was used at a concentration of about 2 nM, and its nucleotide sequence reflects the desired junction between the two genes ( Figure ID). Specifically, the initial 22 nucleotides of primer “c” are identical to the 3' region of the sense nlO strand, while the remaining 20 nucleotides are derived from the 5' of the sense strand encoding the Ub gene.
  • a PCR reaction requires a template and two primers complementary to both ends of the fragment to be amplified. Accordingly, the Ub fragment will be the only fragment amplified at the initial phase of the reaction as it is the only DNA fragment with two complementary primers "b" and "c". This amplification results in a ubiquitin gene with a 5' overhang complementary to the 3' end of the nlO gene.
  • This intermediate product ( Figure 1, fragment B*) may hybridize with the nlO gene ( Figure 1, fragment A).
  • the annealed strands serve both as templates and primers leading to the production of the full-length desired product (III - SEQ ID NO: 22) ( Figure 1, fragment C), which is then amplified by the flanking primers "a" and "b” ( Figures 1 A-B).
  • this method can be utilized to fuse genes while shifting the reading frame or introducing mutations at the junction, depending on the linker primer used, as detailed in Figure 1C.
  • the present inventors set out to fuse three arbitrarily-selected gene fragments of yeast (S. cerevisiae) proteosomal subunits, namely RPN10QV) (200 bp; SEQ ID NO: 23), RPT5(V; SEQ ID NO: 24) (200 bp) and RPT2) (765 bp).
  • a PCR reaction was set up as detailed in Table 11 , herein below.
  • the products were digested for 1 hour by Dpnl endonuclease (Fermentas) and subsequently separated on 1% agarose gel. A fragment of the correct size was excised from the gel and purified using a gel clean kit (Promega). The cleaned PCR product was complemented with nucleotide and its termini were Phosphorylated by T4 Poly Nucleotide Kinase (PNK) for 30 minutes. The PNK was then heat inactivated, cooled and used directly for self-ligation (overnight). ⁇ of the ligation mixture were then used to transform E.coli competent cells (Top 10). The transformed bacteria were spread on LB plate complemented with 200 ⁇ g/ml Amp. Several colonies were inoculated and the plasmids were sequenced.
  • the pET22 plasmid carrying the E2S gene(IX - SEQ ID NO: 28) and a PCR fragment of E2-25K ASL (VIII - SEQ ID NO: 27) were used as templates.
  • Two flanking primers "m” and “L” and a linker-primer “n” were also included in the reaction mixture ( Figure 7C). Flanking primer “m” is designed to hybridize with the sense strand of pET22-E2S at the 5' edge of E2S-ASL and promote the generation of the complementary strand.
  • Linker primer “n” associates with the non-sense strand at the 3' edge of E2S-ASL (outside of the ASL), and allows the generation of the coding strand.
  • flanking primers "m” and “L” were phosphorylated prior to the PCR reaction by T4 PNK, as the 5' phosphates are necessary for the ligation reaction.
  • primer linkers of about 40 bp were used. Given, the annealing temperature of the insertion point in the KS plasmid is predicted to be low and so as to avoid the synthesis of long primers, a combination of two linker primers were used. Accordingly, two overlapping primer-linkers to the same recombination junction were synthesized.
  • the first primer (designated primer "q") in conjunction with the flanking primer "p" are expected to generate an intermediate of RPNIO with 5' overhang of 20 bp complementary to the KS recombination site ( Figure 8A).
  • a second primer linker (designated primer "r") was employed in conjunction with flanking primer "o" to generate a second intermediate; a KS with 3 ' overhang of 20 bp complementary to the 5' of RPNIO ( Figure 8A).
  • primer "r” a second primer linker
  • Figure 8A Upon hybridization of these two intermediate products a complementary stretch of 40 nucleotides is generated (in contrast to about 20 bp when a single linker primer is used), thus stabilizing the hybrid.
  • the linker-primers are consumed.
  • the limited amounts of the intermediates formed hybridize and serve as primers and templates for the construction of the full length desired product RPNIO in KS plasmid (XII - SEQ ID NO: 31).
  • the template used by researchers for cloning originates from a complex mixture, e.g. - genomic DNA or cDNA. Accordingly, the present inventors tested if this technique could be applied directly on genomic DNA.
  • the present inventors selected to fuse two yeast gene products that are located on different chromosomes (RPNlO-chrS, RPT5-chrl5). As shown in Figures 9A-B, using two linker-primers and two flanking primers the present inventors successfully produced a fusion product of the two desired gene fragments (RPN10-RPT5, (XIII - SEQ ID NO: 32)).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

A method of diagnosing a disease in a subject in need thereof is disclosed. The method comprises: (a) linking a plurality of non-contiguous DNA fragments from a sample of the subject to generate a polynucleotide product, the linking being effected by contacting the plurality of non-contiguous DNA fragments with a multiplex overlap-extension primer mix under conditions that allow simultaneous linkage of the DNA fragments and amplification of the polynucleotide product, wherein the primer mix comprises two flanking primers and at least one linker primer; and (b) determining a sequence of the polynucleotide product, wherein the sequence is indicative of the disease.

Description

METHODS OF DIAGNOSING DISEASE USING OVERLAP EXTENSION PCR
FIELD AND BACKGROUND OF THE INVENTION
The present invention, in some embodiments thereof, relates to methods of diagnosing a disease or susceptibility thereto based on DNA sequencing.
Mutations/variations in the human genome are involved in most diseases, going from monogenetic to multifactorial diseases, and acquired diseases such as cancer. Even the susceptibility to infectious diseases, and the response to pharmaceutical drugs, is affected by the composition of an individual's genome. Most genetic tests, which screen for such mutations/variations, require amplification of the DNA region under investigation. However, the size of the genomic DNA that can be amplified is rather limited. For example, the upper size limit of an amplified DNA fragment in a standard PCR reaction is about 2 kb. This contrasts sharply with the total size of 3 billion nucleotides of which the human genome is build up. As more and more mutations/variations are found to be involved in disease, there is a need for robust assays in which different DNA regions, that harbor the different mutations/variations, are analyzed together.
Thus, in some cases it is necessary or at least desirable to perform a number of tests, for example, evaluating the sequence of a large number of mutations or single nucleotide polymorphisms (SNPs) in an individual's gDNA. For example, the cystic fibrosis or CFTR gene (approximately 5 kb long), contains approximately 1,300 rare mutations and polymorphisms and it may be desirable to determine the nucleotide sequence at many if not all of the potential mutation and/or SNP sites in a particular individual's gDNA.
In a classical multiplex PCR reaction, different fragments are amplified in a single tube, simply by adding all pairs of amplicon-specific primers to a reaction mixture. The higher the number of primers that are combined in a single PCR reaction, the higher the chance that particular primer interactions (such as primer-dimerization), and a specific primer/template interactions occur, so that particular amplicons fail to amplify. There is thus a limitation in the number of amplicons that can be co-amplified when primers are simply mixed with long stretches of DNA template. U.S. Patent No. 7,749,697 teaches multiplex overlap-extension RT-PCR to link two or more nucleotide sequences encoding for domains or subunits of a heteromeric protein in a single reaction. The method especially relates to the linkage of variable regions encoding sequences from, for example, immunoglobulins, T cell receptors, or B cell receptors.
Additional background art includes: Heckman, K. L. & Pease, L. R. Nat Protoc 2, 924-932; Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K. & Pease, L. R. Gene 77, 51-59; Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K. & Pease, L. R. Gene 77, 61- 68.
SUMMARY OF THE INVENTION
According to an aspect of some embodiments of the present invention there is provided a method of diagnosing a disease in a subject in need thereof, the method comprising:
(a) linking a plurality of non-contiguous DNA fragments from a sample of the subject to generate a polynucleotide product, the linking being effected by contacting the plurality of non-contiguous DNA fragments with a multiplex overlap-extension primer mix under conditions that allow simultaneous linkage of the DNA fragments and amplification of the polynucleotide product, wherein the primer mix comprises two flanking primers and at least one linker primer; and
(b) determining a sequence of the polynucleotide product, wherein the sequence is indicative of the disease.
According to an aspect of some embodiments of the present invention there is provided a method of linking a plurality of non-contiguous fragments of DNA to generate a single polynucleotide product, the method comprising contacting the fragments with a multiplex overlap-extension primer mix, the mix comprising two flanking primers and a number of linker primers being one less than a number of the fragments, under conditions which allow simultaneous linking of the fragments and amplification of the single polynucleotide product, thereby generating the single polynucleotide product.
According to an aspect of some embodiments of the present invention there is provided a method of linking a plurality of non-contiguous fragments of non-transcribed DNA to generate a single polynucleotide product, the method comprising contacting the fragments with a multiplex overlap-extension primer mix under conditions which allow simultaneous linking of the fragments and amplification of the single polynucleotide product, wherein the primer mix comprises two flanking primers and at least one linker primer, thereby generating the single polynucleotide product.
According to an aspect of some embodiments of the present invention there is provided a kit for linking a plurality of non-contiguous fragments of DNA to generate a polynucleotide product, the kit comprising at least two flanking primers and at least one linker primer wherein at least two of the non-contiguous fragments of DNA comprise a nucleic acid sequence which is indicative of a disease.
According to some embodiments of the invention, at least two of the noncontiguous fragments of DNA comprise a nucleic acid sequence which is indicative of a disease.
According to some embodiments of the invention, the method further comprises fragmenting DNA of the sample prior to step (a) so as to generate the plurality of noncontiguous DNA fragments.
According to some embodiments of the invention, the fragmenting is effected using a restriction enzyme.
According to some embodiments of the invention, the polynucleotide product is no longer than 1000 base pairs.
According to some embodiments of the invention, the plurality of noncontiguous fragments comprises two fragments.
According to some embodiments of the invention, the plurality of noncontiguous fragments comprises three fragments.
According to some embodiments of the invention, the multiplex overlap- extension primer mix comprises two flanking primers and at least two linker primers.
According to some embodiments of the invention, a concentration of the at least one linker primer is lower than a concentration of the two flanking primers.
According to some embodiments of the invention, the determining a sequence is effected using a chain termination method. According to some embodiments of the invention, the method further comprises informing the subject of the results of the diagnosing.
According to some embodiments of the invention, the method further comprises performing additional diagnostic tests so as to corroborate the results of the diagnosing.
According to some embodiments of the invention, the DNA comprises non- transcribed DNA.
According to some embodiments of the invention, the subject is a fetus.
According to some embodiments of the invention, the sample comprises amniotic fluid.
According to some embodiments of the invention, the DNA comprises non- transcribed DNA.
According to some embodiments of the invention, a concentration of the linker primers is lower than a concentration of the flanking primers.
According to some embodiments of the invention, the kit further comprises a DNA polymerase enzyme.
Unless otherwise defined, all technical and/or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and/or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting. BRIEF DESCRIPTION OF THE DRAWINGS
Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings and images. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced. In the drawings:
FIGs. 1 A-C illustrate the generation of a chimeric DNA fragment by single step PCR reaction. (A) A Schematic diagram illustrating the logic underlining the design of a single step PCR ligation reaction of two DNA fragments. (B) A practical example for PCR ligation of two DNA fragments: the ubiquitin binding proteasomal subunit RPN10 (I - SEQ ID NO: 21) and ubiquitin (II - SEQ ID NO: 20). (C) PCR recombination of RPN10 and ubiquitin was preformed as described above while inserting one, two or three nucleotides between the two genes.
FIG. ID is a cartoon illustrating the alignment of the linker primer with the two PCR templates.
FIGs. 2A-B illustrate three piece ligation by single step PCR recombination (A) A Schematic diagram describing the recombination of three segments of the yeast proteasomal subunits RPN10 (IV - SEQ ID NO: 23), RPT5 (V - SEQ ID NO: 24) and RPT2 (VI - SEQ ID NO: 25). (B) Analysis of the PCR recombination reaction on 1% agarose gel complimented with Ethidium Bromide demonstrating the formation of the full length three piece recombination products.
FIGs. 3A-B illustrate the calibration of the optimal concentration of linker- primer. Linker induced PCR recombination of RPN10-UBII (SEQ ID NO: 33) gene fragments in the presence of increasing concentrations of linker primer. (A) Reaction products separated on 1% agarose gel. (B) Intensity of the desired PCR product visualized by Ethidium bromide plotted as a function of the linker-primer concentrations. Note that the concentrations are given in logarithmic scale. The optimal primer-linker concentration was found to be about 2nM.
FIG. 4 is a cartoon illustrating the alignment of the linker primer with the three PCR templates.
FIGs. 5A-B illustrate direct ligation of internal gene fragments by linker induced overlap recombination. Four linker-primers and two flanking primers were used to allow single step PCR ligation of fragments in which the desired recombination site resides in the internal sequence of the templates. (A) A carton representing the rational and the progression of the PCR recombination reaction. (B) agarose gel stained by Ethidium-bromide staining to visualized the reaction products. FIG. 5C is a cartoon illustrating the alignment of the four linker primers with the three PCR templates.
FIGs. 6A-B illustrate ligation of the three fragments as described in Figures 5A- B using the classical two step overhang PCR recombination. Figure 5A: Initially, the three fragment to be recombined were amplified by PCR (PCR reaction I). These PCR products were then used in a second PCR reaction (PCR reaction II) to generate the recombination product. Figure 5B: agarose gel stained by Ethidium-bromide staining to visualized the reaction products— accusly figure 5A-B is a single PCR reaction in which the first part is what happened in the first few cycles and the second is what happened later in this reaction.
FIGs. 6C-D illustrate ligation of the three fragments described in Figures 6A-B using 2 flanking primers and 2 linker primers.
FIGs. 7A-B illustrate direct cloning of a desired gene into a plasmid by single step PCR. (A): pET 22-E2-S (IX - SEQ ID NO: 28) and the Active Site Loop (ASL) of E2-25K (VIII - SEQ ID NO: 27) served as temples for the amplification of a linear recombination products in which the native ASL of E2-S was swapped by the ASL of E2-25K (X - SEQ ID NO: 29). (B): The PCR products were separated on agarose gel, side by side with the initial templates. The gel was visualized by Ethidium bromide.
FIG. 7C is a cartoon illustrating the alignment of the linker primer with the two templates (E2-25K active loop, E2-S in pET22 plasmid).
FIGs. 8A-B illustrate direct cloning of a desired gene into a plasmid by single step PCR. (A): Ks (XI - SEQ ID NO: 30) and RPN10 (I - SEQ ID NO: 21) DNA fragment served as templates for the amplification of linear recombination products. (B): the PCR products of the reaction were separated on agarose gel, side by side with the initial templates. The gel was visualized by Ethidium bromide.
FIG. 8C is a cartoon illustrating the alignment of the linker primer with the two templates (KS+ Plasmid, RpnlO PCR).
FIGs. 9A-B illustrates recombining DNA fragment from genomic source. Two linker-primers (f & g) and two flanking primers (a & s) were used to fused RPNIO (Chr. VII) and RPT5 (Chr. XV) utilizing yeast genomic DNA as template. Figure 9A, visualization of the PCR reaction product separated on 1% agarose stained by Ethidium bromide. Figure 9B, schematic presentation of the reaction. DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION
The present invention, in some embodiments thereof, relates to methods of diagnosing a disease or susceptibility thereto based on DNA sequencing.
Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.
Analysis of multiple DNA sequences has become necessary for the diagnosis of a particular disease as more and more mutations/variations are found to be disease associated.
In a classical multiplex PCR reaction, different fragments are amplified in a single tube, simply by adding all pairs of amplicon-specific primers to a reaction mixture.
The present inventors have now conceived of a different approach - namely the Linker-Induced Overlapping Recombination PCR method - enabling the promotion of an endonuclease-independent, single-step, PCR procedure to aid in disease diagnosis. The method allows for amplification of a DNA product which comprises a multitude of linked fragments, each fragment being indicative of a disease. By combining just diagnostically relevant fragments into one polynucleotide fragment, the amount of sequencing may be significantly reduced. The method may be particularly applicable to prenatal genetic testing whereby a multitude of diseases can be detected and diagnosed by a single reaction.
The underlying rational is based on a hierarchical PCR reaction in which by using an additional primer in a limited concentration an intermediate product is generated to a limited amount. The intermediate product then serves both as template and primer for the consecutive reaction that produces the desired end-product which is then amplified by flanking primers. Although all the ingredients are present in the PCR tube at onset of the reaction, the process proceeds through predefined steps guided by the concentration and complimentarity of the different primers included.
The method was successfully performed for the linkage of two (Figures 1A-C) and three (Figures 2A-B, Figures 5A-B and Figures 6A-B) fragments. In addition, the present inventors showed that the method can be used to simultaneously amplify and insert a DNA fragment into a plasmid, thereby significantly simplifying the cloning procedure (Figures 7A-B, 8A-C and 9A-B).
Thus, according to an aspect of the present invention, there is provided a method of diagnosing a disease in a subject in need thereof, the method comprising:
(a) linking a plurality of non-contiguous DNA fragments from a sample of the subject to generate a polynucleotide product, the linking being effected by contacting the plurality of non-contiguous DNA fragments with a multiplex overlap-extension primer mix under conditions that allow simultaneous linkage of the DNA fragments and amplification of the polynucleotide product, wherein the primer mix comprises two flanking primers and at least one linker primer; and
(b) determining a sequence of the polynucleotide product, wherein the sequence is indicative of the disease.
As used herein, the phrase "diagnosing a disease" refers to determining a presence of a disease, determining if the subject is a carrier for a particular disease, determining a predisposition to a disease, classifying a disease, determining a severity of disease (grade or stage), monitoring disease progression, forecasting an outcome of the disease and/or prospects of recovery.
The present invention contemplates diagnosing any disease which is associated with a change (i.e. mutation) in a nucleic acid sequence of a DNA of a subject as compared to the wild-type DNA.
As used herein, the term "wild-type" refers to the most common polynucleotide sequence or allele for a certain gene or non-coding sequence in a population. Generally, the wild-type DNA will be obtained from normal (non-diseased) cells.
As used herein, the term "mutant" refers to a nucleotide change (i.e., a single or multiple nucleotide substitution, deletion, or insertion) in a nucleic acid sequence. A nucleic acid which bears a mutation has a nucleic acid sequence (mutant allele) that is different in sequence from that of the corresponding wild-type polynucleotide sequence. Preferably, a mutation in DNA of a subject will contain between 1 and 10 nucleotide sequence changes. The mutant DNA may have 50%, 60%. 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to the wild-type DNA. Changes in the nucleic acid sequence of a DNA of a subject may be the result of natural or artificial (e.g., chemical carcinogens) deletions, additions, or substitutions of nucleotides.
An exemplary change in the nucleic acid sequence of DNA is one that takes the form of short tandem repeats (STRs) that include tandem di-, tri- and tetra-nucleotide repeated motifs. These tandem repeats are also referred to as variable number tandem repeat (VNTR) polymorphisms. VNTRs have been used in identity and paternity analysis (U.S. Pat. No. 5,075,217; Armour et al, FEBS Lett. 307: 113-115 (1992); Horn et al, WO 91/14003; Jeffreys, EP 370,719), and in a large number of genetic mapping studies.
Another exemplary change in the nucleic acid sequence of DNA is one which takes the form of single nucleotide variations between individuals of the same species. Such polymorphisms are far more frequent than RFLPs, STRs (short tandem repeats) and VNTRs (variable number tandem repeats). Some single nucleotide polymorphisms occur in protein-coding sequences, in which case, one of the polymorphic forms may give rise to the expression of a defective or other variant protein and, potentially, a genetic disease. Other single nucleotide polymorphisms occur in noncoding regions. Some of these polymorphisms may also result in defective protein expression (e.g., as a result of defective splicing).
Other mutations include somatic mutations. Somatic mutations are alterations in
DNA that occurs after conception. Somatic mutations can occur in any of the cells of the body except the germ cells (sperm and egg) and therefore are not passed on to children. These alterations can (but do not always) lead to cancer or other diseases.
Exemplary diseases which may be diagnosed include, but are not limited to heart disease, cancer, endocrine disorders, immune disorders, neurological disorders, musculoskeletal disorders, ophthalmologic disorders, genetic abnormalities, trisomies, monosomies, transversions, translocations, skin disorders and familial diseases.
The method of the invention is especially useful in prenatal genetic testing of parents and child. The method may be used for simultaneous diagnosis of a multitude of diseases. Examples of some of such diseases include, but are not limited to those listed herein below. Achondroplasia Adrenoleukodystrophy, X-Linked Agammaglobulinemia, X- Linked Alagille Syndrome Alpha-Thalassemia X-Linked Mental Retardation Syndrome Alzheimer Disease Alzheimer Disease, Early-Onset Familial Amyotrophic Lateral Sclerosis Overview Androgen Insensitivity Syndrome Angelman Syndrome Ataxia Overview, Hereditary Ataxia-Telangiectasia Becker Muscular Dystrophy (also The Dystrophinopathies) Beckwith- Wiedemann Syndrome Beta-Thalassemia Biotinidase Deficiency Branchiootorenal Syndrome BRCA1 and BRCA2 Hereditary Breast/Ovarian Cancer Breast Cancer CADASIL Canavan Disease Cancer Charcot-Marie-Tooth Hereditary Neuropathy Charcot-Marie-Tooth Neuropathy Type 1 Charcot-Marie-Tooth Neuropathy Type 2 Charcot-Marie-Tooth Neuropathy Type 4 Charcot-Marie-Tooth Neuropathy Type X Cockayne Syndrome Colon Cancer Contractural Arachnodactyly, Congenital Craniosynostosis Syndromes (FGFR-Related) Cystic Fibrosis Cystinosis Deafness and Hereditary Hearing Loss DRPLA (Dentatorubral-Pallidoluysian Atrophy) DiGeorge Syndrome (also 22ql l Deletion Syndrome) Dilated Cardiomyopathy, X- Linked Down Syndrome (Trisomy 21) Duchenne Muscular Dystrophy (also The Dystrophinopathies) Dystonia, Early-Onset Primary (DYT1) Dystrophinopathies, The Ehlers-Danlos Syndrome, Kyphoscoliotic Form Ehlers-Danlos Syndrome, Vascular Type Epidermolysis Bullosa Simplex Exostoses, Hereditary Multiple Facioscapulohumeral Muscular Dystrophy Factor V Leiden Thrombophilia Familial Adenomatous Polyposis (FAP) Familial Mediterranean Fever Fragile X Syndrome Friedreich Ataxia Frontotemporal Dementia with Parkinsonism- 17 Galactosemia Gaucher Disease Hemochromatosis, Hereditary Hemophilia A Hemophilia B Hemorrhagic Telangiectasia, Hereditary Hearing Loss and Deafness, Nonsyndromic, DFNA3 (Connexin 26) Hearing Loss and Deafness, Nonsyndromic, DFNB1 (Connexin 26) Hereditary Spastic Paraplegia Hermansky-Pudlak Syndrome Hexosaminidase A Deficiency (also Tay-Sachs) Huntington Disease Hypochondroplasia Ichthyosis, Congenital, Autosomal Recessive Incontinentia Pigmenti Kennedy Disease (also Spinal and Bulbar Muscular Atrophy) Krabbe Disease Leber Hereditary Optic Neuropathy Lesch-Nyhan Syndrome Leukemias Li-Fraumeni Syndrome Limb-Girdle Muscular Dystrophy Lipoprotein Lipase Deficiency, Familial Lissencephaly Marfan Syndrome MELAS (Mitochondrial Encephalomyopathy, Lactic Acidosis, and Stroke -Like Episodes) Monosomies Multiple Endocrine Neoplasia Type 2 Multiple Exostoses, Hereditary Muscular Dystrophy, Congenital Myotonic Dystrophy Nephrogenic Diabetes Insipidus Neurofibromatosis 1 Neurofibromatosis 2 Neuropathy with Liability to Pressure Palsies, Hereditary Niemann-Pick Disease Type C Nijmegen Breakage Syndrome Norrie Disease Oculocutaneous Albinism Type 1 Oculopharyngeal Muscular Dystrophy Ovarian Cancer Pallister-Hall Syndrome Parkin Type of Juvenile Parkinson Disease Pelizaeus-Merzbacher Disease Pendred Syndrome Peutz-Jeghers Syndrome Phenylalanine Hydroxylase Deficiency Prader-Willi Syndrome PROP 1 -Related Combined Pituitary Hormone Deficiency (CPHD) Prostate Cancer Retinitis Pigmentosa Retinoblastoma Rothmund-Thomson Syndrome Smith-Lemli-Opitz Syndrome Spastic Paraplegia, Hereditary Spinal and Bulbar Muscular Atrophy (also Kennedy Disease) Spinal Muscular Atrophy Spinocerebellar Ataxia Type 1 Spinocerebellar Ataxia Type 2 Spinocerebellar Ataxia Type 3 Spinocerebellar Ataxia Type 6 Spinocerebellar Ataxia Type 7 Stickler Syndrome (Hereditary Arthroophthalmopathy) Tay-Sachs (also GM2 Gangliosidoses) Trisomies Tuberous Sclerosis Complex Usher Syndrome Type I Usher Syndrome Type II Velocardio facial Syndrome (also 22ql l Deletion Syndrome) Von Hippel-Lindau Syndrome Williams Syndrome Wilson Disease X-Linked Adrenoleukodystrophy X-Linked Agammaglobulinemia X-Linked Dilated Cardiomyopathy (also The Dystrophinopathies) X-Linked Hypotonic Facies Mental Retardation Syndrome As mentioned, the method is effected by linking a plurality of non-contiguous
DNA fragments from a sample of the subject to generate a polynucleotide product.
DNA may be obtained from any biological sample including but not limited to blood sample, serum sample, amniotic fluid sample, plasma sample, urine sample, spinal fluid, lymphatic fluid, semen, vaginal secretion, ascitic fluid, saliva, mucosa secretion, peritoneal fluid, fecal sample, body exudates, breast fluid, lung aspirates, cells, tissues, individual cells or extracts of the such sources that contain the nucleic acid of the same, and subcellular structures such as mitochondria.
The DNA may be genomic DNA (e.g. non-transcribed DNA, coding DNA or non-coding DNA) or cDNA (reverse transcribed DNA). A reverse transcription (RT) reaction may be performed with an enzyme containing reverse transcriptase activity resulting in the generation of cDNA from total RNA, mRNA or target specific RNA from an isolated single cell. Primers which can be utilized for the reverse transcription are for example oligo-dT primers, random hexamers, random decamers, other random primers, or primers that are specific for the nucleotide sequences of interest.
The non-contiguous DNA fragments of this aspect of the present invention may comprise sequences of the same gene or different genes. Further, the non-contiguous DNA fragments of this aspect of the present invention may comprise sequences of the same chromosome or different chromosomes. It will be appreciated that the distance between the DNA fragments of interest in their natural location (e.g. on a particular gene or chromosome) need not be considered when selecting the particular DNA fragments to be located. Typically, the DNA fragments are not closer than 500 base pairs away from each other in their natural environment.
According to one embodiment, the DNA fragments comprise sequences of genes involved in a given pathway or disease. According to another embodiment, the DNA fragments comprise sequences of genes belonging to a certain class of proteins. According to yet another embodiment, each DNA fragment comprises a putative site for a single nucleotide polymorphisms (SNP).
Each DNA fragment is typically less than about 5000 base pair (e.g. less than about 1000 base pairs, 500 base pairs, less than 400 base pairs, less than 300 base pairs, less than 200 base pairs or less than 100 base pairs).
Typically, the DNA fragments are selected such that at least two comprise a nucleic acid sequence which is indicative of a disease. It will be appreciated that the nucleic acid sequences may be indicative of one particular disease or different diseases.
The number of DNA fragments that may be linked according to this aspect of the present invention is typically between 2 and 10 and more typically between 2 and 5 - for example, 2, 3 or 4.
The sample may be processed before the method is carried out, for example
DNA purification may be carried out following the extraction procedure. The DNA in the sample may be cleaved either physically or chemically (e.g. using a suitable enzyme). Processing of the sample may involve one or more of: filtration, distillation, centrifugation, extraction, concentration, dilution, purification, inactivation of interfering components, addition of reagents, and the like.
DNA fragments may be prepared using any number of methods well known in the art including but not limited to enzymatic digestion, manual shearing, and sonication. For example, the DNA can be digested with one or more restriction enzymes that have a recognition site, and especially an eight base or six base pair recognition site, which is not present in the loci of interest.
The term "linking" refers to the joining of DNA fragments into a single product. The linkage is preferably a nucleotide phosphodiester linkage. However, linkage can also be obtained by different chemical cross linking procedures.
As mentioned, the linking is effected by contacting the plurality of noncontiguous DNA fragments with a multiplex overlap-extension primer mix under conditions that allow simultaneous linkage of the DNA fragments and amplification of the polynucleotide product.
The method of this aspect of the present invention is effected by performing a multiplex molecular amplification reaction, using a primer mix which comprises two flanking primers and at least one linker primer.
The term "multiplex molecular amplification" describes the simultaneous amplification of two or more target sequences in the same reaction. Suitable amplification methods include the polymerase chain reaction (PCR) (U.S. Pat. No. 4,683,202), ligase chain reaction (LCR), (Wu and Wallace, 1989, Genomics 4, 560-9), strand displacement amplification (SDA) technique (Walker et al., 1992, Nucl. Acids Res. 20, 1691-6), self-sustained sequence replication (Guatelli et al, 1990, Proc. Nat. Acad. Sci. U.S.A., 87, 1874-8) and nucleic acid based sequence amplification (NASBA) (Compton J., 1991, Nature 350, 91-2). The latter two amplification methods involve isothermal reactions based on isothermal transcription, which produce both single stranded RNA (ssRNA) and double stranded DNA (dsDNA).
One feature of the present invention reduces the number of tubes necessary to amplify the nucleotide sequences of interest, utilizing a variant of PCR in which two or more target sequences are amplified and linked simultaneously in the same tube, by including more than one set of primers.
The PCR (or polymerase chain reaction) technique is well-known in the art and has been disclosed, for example, in K. B. Mullis and F. A. Faloona, Methods Enzymol., 1987, 155: 350-355 and U.S. Pat. Nos. 4,683,202; 4,683,195; and 4,800,159 (each of which is incorporated herein by reference in its entirety). In its simplest form, PCR is an in vitro method for the enzymatic synthesis of specific DNA sequences, using two oligonucleotide primers that hybridize to opposite strands and flank the region of interest in the target DNA. A plurality of reaction cycles, each cycle comprising: a denaturation step, an annealing step, and a polymerization step, results in the exponential accumulation of a specific DNA fragment ("PCR Protocols: A Guide to Methods and Applications", M. A. Innis (Ed.), 1990, Academic Press: New York; "PCR Strategies", M. A. Innis (Ed.), 1995, Academic Press: New York; "Polymerase chain reaction: basic principles and automation in PCR: A Practical Approach", McPherson et al. (Eds.), 1991, IRL Press: Oxford; R. K. Saiki et al, Nature, 1986, 324: 163-166). The termini of the amplified fragments are defined as the 5' ends of the primers. Examples of DNA polymerases capable of producing amplification products in PCR reactions include, but are not limited to: E. coli DNA polymerase I, Klenow fragment of DNA polymerase I, T4 DNA polymerase, thermostable DNA polymerases isolated from Thermus aquaticus (Taq), available from a variety of sources (for example, Perkin Elmer), Thermus thermophilus (United States Biochemicals), Bacillus stereothermophilus (Bio-Rad), or Thermococcus litoralis ("Vent" polymerase, New England Biolabs). RNA target sequences may be amplified by reverse transcribing the mRNA into cDNA, and then performing PCR (RT-PCR), as described above. Alternatively, a single enzyme may be used for both steps as described in U.S. Pat. No. 5,322,770.
The duration and temperature of each step of a PCR cycle, as well as the number of cycles, are generally adjusted according to the stringency requirements in effect. Annealing temperature and timing are determined both by the efficiency with which a primer is expected to anneal to a template and the degree of mismatch that is to be tolerated. The ability to optimize the reaction cycle conditions is well within the knowledge of one of ordinary skill in the art. Although the number of reaction cycles may vary depending on the detection analysis being performed, it usually is at least 15, more usually at least 20, and may be as high as 60 or higher. However, in many situations, the number of reaction cycles typically ranges from about 20 to about 40.
The denaturation step of a PCR cycle generally comprises heating the reaction mixture to an elevated temperature and maintaining the mixture at the elevated temperature for a period of time sufficient for any double-stranded or hybridized nucleic acid present in the reaction mixture to dissociate. For denaturation, the temperature of the reaction mixture is usually raised to, and maintained at, a temperature ranging from about 85 °C. to about 100 °C, usually from about 90 °C to about 98 °C, and more usually from about 93 °C. to about 96 °C. for a period of time ranging from about 3 to about 120 seconds, usually from about 5 to about 30 seconds.
Following denaturation, the reaction mixture is subjected to conditions sufficient for primer annealing to template DNA present in the mixture. The temperature to which the reaction mixture is lowered to achieve these conditions is usually chosen to provide optimal efficiency and specificity, and generally ranges from about 50 °C to about °C, usually from about 55 °C. to about 70 °C, and more usually from about 60 °C to about 68 °C. Annealing conditions are generally maintained for a period of time ranging from about 15 seconds to about 30 minutes, usually from about 30 seconds to about 5 minutes.
Following annealing of primer to template DNA or during annealing of primer to template DNA, the reaction mixture is subjected to conditions sufficient to provide for polymerization of nucleotides to the primer's end in a such manner that the primer is extended in a 5' to 3' direction using the DNA to which it is hybridized as a template, (i.e., conditions sufficient for enzymatic production of primer extension product). To achieve primer extension conditions, the temperature of the reaction mixture is typically raised to a temperature ranging from about 65°C to about 75 °C, usually from about 67 °C. to about 73 °C, and maintained at that temperature for a period of time ranging from about 15 seconds to about 20 minutes, usually from about 30 seconds to about 5 minutes.
The above cycles of denaturation, annealing, and polymerization may be performed using an automated device typically known as a thermal cycler or thermocycler. Thermal cyclers that may be employed are described in U.S. Pat. Nos. 5,612,473; 5,602,756; 5,538,871; and 5,475,610 (each of which is incorporated herein by reference in its entirety). Thermal cyclers are commercially available, for example, from Perkin Elmer-Applied Biosystems (Norwalk, Conn.), BioRad (Hercules, Calif), Roche Applied Science (Indianapolis, Ind.), and Stratagene (La Jolla, Calif).
Amplification products obtained using primers of the present invention may be detected using agarose gel electrophoresis and visualization by ethidium bromide staining and exposure to ultraviolet (UV) light or by sequence analysis of the amplification product. Primers of the invention may be prepared by any of a variety of methods (see, for example, J. Sambrook et al., "Molecular Cloning: A Laboratory Manual", 1989, 2.sup.nd Ed., Cold Spring Harbour Laboratory Press: New York, N.Y.; "PCR Protocols: A Guide to Methods and Applications", 1990, M. A. Innis (Ed.), Academic Press: New York, N.Y.; P. Tijssen "Hybridization with Nucleic Acid Probes—Laboratory Techniques in Biochemistry and Molecular Biology (Parts I and II)", 1993, Elsevier Science; "PCR Strategies", 1995, M. A. Innis (Ed.), Academic Press: New York, N.Y.; and "Short Protocols in Molecular Biology", 2002, F. M. Ausubel (Ed.), 5.sup.th Ed., John Wiley & Sons: Secaucus, N.J.). For example, oligonucleotides may be prepared using any of a variety of chemical techniques well-known in the art, including, for example, chemical synthesis and polymerization based on a template as described, for example, in S. A. Narang et al, Meth. Enzymol. 1979, 68: 90-98; E. L. Brown et al, Meth. Enzymol. 1979, 68: 109-151; E. S. Belousov et al, Nucleic Acids Res. 1997, 25: 3440-3444; D. Guschin et al, Anal. Biochem. 1997, 250: 203-211; M. J. Blommers et al, Biochemistry, 1994, 33: 7886-7896; and K. Frenkel et al., Free Radic. Biol. Med. 1995, 19: 373-380; and U.S. Pat. No. 4,458,066.
For example, primers may be prepared using an automated, solid-phase procedure based on the phosphoramidite approach. In such a method, each nucleotide is individually added to the 5 '-end of the growing oligonucleotide chain, which is attached at the 3 '-end to a solid support. The added nucleotides are in the form of trivalent 3'- phosphoramidites that are protected from polymerization by a dimethoxytriyl (or DMT) group at the 5 '-position. After base-induced phosphoramidite coupling, mild oxidation to give a pentavalent phosphotriester intermediate and DMT removal provides a new site for oligonucleotide elongation. The oligonucleotides are then cleaved off the solid support, and the phosphodiester and exocyclic amino groups are deprotected with ammonium hydroxide. These syntheses may be performed on oligo synthesizers such as those commercially available from Perkin Elmer/ Applied Biosystems, Inc. (Foster City, Calif), DuPont (Wilmington, Del.) or Milligen (Bedford, Mass.). Alternatively, oligonucleotides can be custom made and ordered from a variety of commercial sources well-known in the art, including, for example, the Midland Certified Reagent Company (Midland, Tex.), ExpressGen, Inc. (Chicago, 111.), Operon Technologies, Inc. (Huntsville, Ala.), and many others. Purification of the primers of the invention, where necessary or desirable, may be carried out by any of a variety of methods well-known in the art. Purification of oligonucleotides is typically performed either by native acrylamide gel electrophoresis, by anion-exchange HPLC as described, for example, by J. D. Pearson and F. E. Regnier (J. Chrom., 1983, 255: 137-149) or by reverse phase HPLC (G. D. McFarland and P. N. Borer, Nucleic Acids Res., 1979, 7: 1067-1080).
The sequence of the primers can be verified using any suitable sequencing method including, but not limited to, chemical degradation (A. M. Maxam and W. Gilbert, Methods of Enzymology, 1980, 65: 499-560), matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectrometry (U. Pieles et al., Nucleic Acids Res., 1993, 21 : 3191-3196), mass spectrometry following a combination of alkaline phosphatase and exonuclease digestions (H. Wu and H. Aboleneen, Anal. Biochem., 2001, 290: 347-352), and the like.
Generally, the components needed for the single-step multiplex overlap- extension reaction comprises the DNA fragments, an enzyme with DNA polymerase activity, deoxynucleoside triphosphate mix (dNTP mix comprising dATP, dCTP, dGTP and dTTP) and a multiplex overlap extension primer mix. In order to perform multiplex overlap-extension PCR on two fragments, the presence of at least three primers are required (a multiplex primer mix), where at least one primer is equipped with an overlap-extension tail (i.e. linking primer). The overlap-extension tails enable the linkage of the products. Such a primer mix is called a multiplex overlap-extension primer mix. The multiplex overlap-extension PCR, differ from conventional overlap- extension PCR in that the sequences to be linked are generated simultaneously in the same tube, thereby providing immediate linkage of the target sequences during amplification, without any intermediate purification. Further, conventional overlap- extension PCR requires a separate linking PCR reaction either with an outer primer set or a nested primer set in order to generate the linked product (Horton, R. M. et al. 1989. Gene 77, 61-68). Such an additional amplification step is optional in the multiplex overlap-extension PCR of the present invention.
According to one embodiment, the linkage of two DNA fragments is effected using 1 linking primer and 2 flanking primers (as illustrated in Figures 1 A-B). The first flanking primer hybridizes to the 5' region of the sense strand of the first fragment, whereas the second flanking primer hybridizes to the 3' end of the antisense strand of the second fragment. The linker primer is selected such that its nucleotide sequence reflects the desired junction between the two DNA fragments. Specifically, the initial nucleotides of the linker primer are identical to the 3 ' region of the sense strand of the first fragment, while the remaining nucleotides are derived from the 5 ' of the sense strand of the second fragment.
According to one embodiment, the linkage of three DNA fragments is effected using 2 linking primer and 2 flanking primers (as illustrated in Figures 2A-B).
Other contemplated configurations of linking primers and flanking primers are described in the Examples section below.
The design of the flanking primers generally should observe known primer design rules such as minimizing primer dimerization, hairpin formation and non-specific annealing. Further, multiple G or C nucleotides as the 3' bases are to be avoided when possible. The melting temperature (Tm) of the gene-specific regions in a primer set should preferably be equal to each other plus/minus 5 °C. For example Tm values between 45 °C and 75 °C may be desirable and Tm values of about 60 °C are optimal for most applications. Advantageously, the initial primer design can be aided by computer programs developed for this task.
Design of the linking primer is dependent on sequence features such as length, relative GC content (GC %), presence of restriction sites, palindromes, melting temperature, the gene-specific part to which they are coupled etc. The length of the overlap -extension tails should be between 8 and 75 nucleotides long, preferably they are from 15 to 40 nucleotides long. Even more preferred they are from 22 to 28 nucleotides long. The use of very long overlap-extension tails (50 to 75 nucleotides) could favor the linkage of the products produced by each primer set. However, the proportion between the length of the overlap-extension tail and the gene-specific region probably will need to be adjusted when using very long overlap-extension tails. The GC % preference is dependent on the length of the overlap-extension tail. Since shorter tails have a shorter area where they are complementary they need a higher GC % to strengthen the interaction than longer tails. Other principles of primer design should likewise be observed, e.g. primer dimerization and hairpin formation should be minimized. Neither shall they engage in false priming. Further, it is known that Taq DNA polymerase often adds an adenosine (A) at the 3' end of the newly synthesized DNA strand, and this can be accommodated for in overlap-extension tail design by enabling overlap-extension tails to accommodate 3' non-template A addition.
It will be appreciated that the primers of this aspect of the present invention need not reflect the exact sequence of the target nucleic acid sequences (i.e. need not be fully complementary), but must be sufficiently complementary to hybridize with their target sequences under the particular experimental conditions. Accordingly, the sequence of the primer typically has at least 70 % homology, preferably at least 80 %, 90 %, 95 %, 97 %, 99 % or 100 % homology, for example over a region of at least 13 or more contiguous nucleotides with the target DNA fragments.
The parameters of the procedure of this aspect of the present invention can be optimized on several parameters as detailed herein below:
a. Primer Concentration:
The concentration of the linking primers is preferably lower than the concentration of the flanking primers. Suitable ratios of linking primer: flanking primer include 1 : 10, 1 :20, 1 : 50, 1 : 100, 1 : 150, 1 : 200, 1 : 250, 1 : 300, 1 : 400 and 1 : 500.
If one of the target sequences amplifies with a lower efficiency than the others, for example, as a result of a higher GC %, it may be possible to equalize the amplification efficacy. This may be done by using a higher concentration of the primer set which mediates amplification with low efficiency, or lowering the concentration of the other primer set.
Further, when using a large number of primers the total primer concentration might be an issue. The upper limit is determined experimentally by titration experiments. Such an upper limit of total oligonucleotide concentration influences the maximal concentration of individual primers. If the individual primer concentration is too low it is likely to cause a poor PCR sensitivity.
The quality of the oligonucleotide primers have also been found to be important for the multiplex overlap-extension PCR. HPLC-purified oligonucleotides, have produced the best results. b. PCR Cycling Conditions:
Exemplary cycling conditions are provided in the Exammples section herein below.
Problems with poor PCR sensitivity, for example due to low primer concentration or template concentration can be overcome by using a high number of thermal cycles. A high number of thermal circles constitute between 35 and 80 cycles, preferably around 40 cycles. Further, longer extension times can improve the multiplex overlap-extension PCR process.
c. Use of Adjuvants
Multiplex PCR reactions can be significantly improved by using a PCR additive, such as DMSO, glycerol, formamide, or betaine, which relax DNA, thus making template denaturation easier.
d. dNTP and MgCl2
Deoxynucleoside triphosphate (dNTP) quality and concentration is important for the multiplex overlap-extension PCR. Optimal dNTP concentration is between 200 and 600 μΜ (e.g. 400 μΜ) of each dNTP (dATP, dCTP, dGTP and dTTP), above which the amplification is rapidly inhibited. dNTP stocks are sensitive to thawing/freezing cycles. After three to five such cycles, multiplex PCR often do not work well. To avoid such problems, small aliquots of dNTP can be made and kept frozen at -20 °C.
Optimization of Mg2+ concentration is importnat since most DNA polymerases are magnesium-dependent enzymes. In addition to the DNA polymerase, the template DNA primers and dNTP's bind Mg2+. Therefore, the optimal Mg2+ concentration will depend on the dNTP concentration, template DNA, and sample buffer composition. If primers and/or template DNA buffers contain chelators such as EDTA or EGTA, the apparent Mg2+ optimum may be altered. Excessive Mg2+ concentration stabilizes the DNA double strand and prevents complete denaturation of DNA, which reduces yield. Excessive Mg2+ can also stabilize spurious annealing of primer to incorrect template sites, thereby decreasing specificity. On the other hand, an inadequate Mg.sup.2+ concentration reduces the amount of product.
A good balance between dNTP and MgCl2+ is approximately 200 to 400 μΜ dNTP (of each) to 1.5 to 3 mM MgCl2 or MgSo4. e. PCR Buffer Concentration
Generally KCl based buffers may be used for multiplex overlap-extension PCR; however, buffers based on other components such as (NH4).2S04, MgS04, Tris-HCl, or combinations thereof may also be optimized to function with the multiplex overlap- extension PCR.
Selection of the buffer is also dependent on the particular enzyme which is used in the reaction. Thus, for example when the enzyme is PFU, the PFU buffer composition is (10X Pfu Buffer:
200 mM Tris-HCl (pH 8.8 at 25 °C), 100 mM (NH4)2S04, 100 mM KCl, 1% (v/v) Triton X-100, 1 mg/ml BSA and 20 mM MgS04). When Phusion DNA polymerse is used may be as follows: 10X Phusion DNA Buffer: 200 mM Tris-HCl (pH 8.8 at 25°C), 100 mM (NH4)2S04, 600 mM KCl, 1% (v/v) Triton X-100, 1 mg/ml BSA and 20 mM MgS04.
Primer pairs involved in the amplification of longer products may work better at lower salt concentrations (e.g. 20 to 50 mM KCl), whereas primer pairs involved in the amplification of short products work better at higher salt concentrations (e.g. 80 to 100 mM KCl). Raising the buffer concentration to 2 X instead of 1 X may improve the efficiency of the multiplex reaction.
/. DNA Polymerase
The present invention is exemplified with Pfu polymerase. Alternatively, other types of heat-resistant DNA polymerases including, for example, taq, Phusion, Pwo, Tgo, Tth, Vent, Deep-vent may be used. Polymerases without or with 3' to 5'exonuclease activity may either be used alone or in combination with each other.
Following production of the polynucleotide product according to the method of this aspect of the present invention, its sequence is determined.
The term "sequencing" refers to any technique known in the art that allows the order of at least some consecutive deoxyribonucleotides in at least part of an amplification product. Some non-limiting examples of sequencing techniques include Sanger's dideoxy termination method and the chemical cleavage method of Maxam and Gilbert, including variations of those methods; sequencing by hybridization; sequencing by synthesis; and restriction mapping. In certain embodiments, sequencing comprises electrophoresis, including gel electrophoresis and capillary electrophoresis, including miniaturized capillary electrophoresis, and often comprising laser-induced fluorescence; sequencing by hybridization including bead array microarray hybridization; microfluidics (see, e.g., Paegel et al, Analyt. Chem. 74:5092-98, 2002); mass spectrometry (see, e.g., Koster et al, Nat. Biotechnol. 14: 1123-28, 1996); single molecule detection, including fluorescence microscopy or a nanometer-scale pore or nanopore; or combinations thereof. In some embodiments, sequencing comprises direct sequencing, duplex sequencing, cycle sequencing, single base extension (SBE) sequencing, solid-phase sequencing, Simultaneous Bi-directional Sequencing (SBS), double ended sequencing (see, e.g., Published PCT Application No. WO 2004/070005 A2), or combinations thereof. In some embodiments, sequencing comprises asymmetric PCR or A-PCR. In some embodiments, sequencing comprises an extending enzyme comprising a first fluorescent reporter group, such as a FRET donor, and a NTP comprising a second fluorescent reporter group, such as a quencher (see, e.g., U.S. Published Patent Application No. US 2003/0064366 Al). In some embodiments, sequencing comprises detecting at least some amplification products using an instrument, for example but not limited to an ABI PRISM.RTM. 377 DNA Sequencer, an ABI PRISM.RTM. 310, 3100, 3100-Avant, 3730, or 3730x1 Genetic Analyzer, an ABI PRISM.RTM. 3700 DNA Analyzer (all from Applied Biosystems), a microarray or bead array, a fluorimeter, or a mass spectrometer. In some embodiments, sequencing comprises incorporating a dNTP, including a dATP, a dCTP, a dGTP, a dTTP, a dUTP, a dITP, or combinations thereof and including dideoxyribonucleotide versions of dNTPs (e.g., ddATP, ddCTP, ddGTP, ddlTP, ddTTP, and ddUTP), into an amplification product. In some embodiments, sequencing comprises a sequencing grade DNA- dependent DNA polymerase, for example but not limited to, AmpliTaq DNA polymerase CS or FS (Applied Biosystems); Sequenase or Thermo Sequenase (USB Corp.); and Sequencing Grade Taq DNA Polymerase (Promega). In some embodiments, sequencing comprises: a DNA-dependent DNA polymerase, for example but not limited to the Klenow fragment of E. coli DNA Pol I; an ATP sulfurylase, for example but not limited to a recombinant S. cerevisiae ATP sulfurylase, a luciferase, including firefly luciferase, or a sulfurylase-luciferase fusion protein (a non- limiting example of an enzymatically active mutant or variant of an ATP sulfurylase and of a luciferase; see, e.g., U.S. Patent Publication Nos. US 2003/0113747 Al and US 2003/0119012 Al); and optionally, an apyrase. In some embodiments, a sequencing reaction comprises dATP.alpha.S, typically in place of dATP. In some embodiments, sequencing further comprises detecting light or fluorescence using, for example but not limited to a photodiode, a photomultiplier tube, a charge-coupled camera (CCD), a fluorimeter, a laser-scanner coupled with a detector, or combinations thereof.
Descriptions of exemplary sequencing techniques can be found in, among other places, McPherson, particularly in Chapter 5; Sambrook and Russell; Ausubel et al; Siuzdak, The Expanding Role of Mass Spectrometry in Biotechnology, MCC Press, 2003, particularly in Chapter 7; Di Giusto and King, Nucl. Acids Res. 31 :e7; Schena, Microarray Analysis, John Wiley & Sons, 2003, particularly in Chapter 13; BigDye.RTM. Terminator v 1.1 or v3.1 Cycle Sequencing Kit Protocols (Applied Biosystems P/N 4337036 or 4337035, respectively); Ronaghi, Genome Res. 11 :3-11, 2001; Agah et al, Nucl. Acids Res. 32:el66, 2004; Kartalov and Quake, Nucl. Acids Res. 32:2873-79, 2004; Cheuk-Wai Kan et al, Electrophoresis 25:3564-88, 2004; and Rapley.
Comparing the sequences comprised in the polynucleotide product to known human sequences (e.g. a consensus sequence such as that published as part of the human genome) allows for the diagnosis of particular diseases.
On obtaining a result of the sequence the subject is typically informed. Additional diagnostic tests may also be performed so as to corroborate the results of the diagnosing.
The methods of this aspect of the present invention may be practiced by providing the reagents used in the methods in the form of kits. A kit preferably contains one or more of the following components: written instructions for the use of the kit, appropriate buffers, salts, DNA extraction detergents, primers, nucleotides, labeled nucleotides, 5' end modification materials, and if desired, water of the appropriate purity, confined in separate containers or packages, such components allowing the user of the kit to extract the appropriate nucleic acid sample, and analyze the same according to the methods of the invention. The primers that are provided with the kit will vary, depending upon the purpose of the kit and the DNA that is desired to be tested using the kit. In preferred embodiments the kits contain primers that allows for the linkage of two fragments, both of the fragments providing valuable information for single or multiple disease diagnosis.
A kit can also be designed to detect a desired or variety of single nucleotide polymorphisms, especially those associated with an undesired condition or disease. For example, one kit can comprise, among other components, a set or sets of primers to amplify and link at least two fragments of interest both of which are associated with breast cancer. Another kit can comprise, among other components, a set or sets of primers for genes associated with a predisposition to develop type I or type II diabetes. Still, another kit can comprise, among other components, a set or sets of primers for genes associated with a predisposition to develop heart disease.
It will be appreciated that the presently described method for simultaneous linking and amplification of DNA fragments may be useful for other purposes besides disease diagnosis.
Thus for example, the method of the invention can be used to genotype microorganisms so as to rapidly identify the presence of a specific microorganism in a substance, for example, a food substance. In that regard, the method of the invention provides a rapid way to analyze food, liquids or air samples for the presence of an undesired biological contamination, for example, microbiological, fungal or animal waste material. The invention is useful for detecting a variety of organisms, including but not limited to bacteria, viruses, fungi, protozoa, molds, yeasts, plants, animals, and archaebacteria. The invention is useful for detecting organisms collected from a variety of sources including but not limited to water, air, hotels, conference rooms, swimming pools, bathrooms, aircraft, spacecraft, trains, buses, cars, offices, homes, businesses, churches, parks, beaches, athletic facilities, amusement parks, theaters, and any other facility that is a meeting place for the public.
The method of the invention can be used to test for the presence of many types of bacteria or viruses in blood cultures from human or animal blood samples.
The method of the invention can also be used to confirm or identify the presence of a desired or undesired yeast strain, or certain traits thereof, in fermentation products, e.g. wine, beer, and other alcohols or to identify the absence thereof.
The method of the invention can also be used to confirm or identify the relationship of a DNA of unknown sequence to a DNA of known origin or sequence, for example, for use in criminology, forensic science, maternity or paternity testing, archeological analysis, and the like.
The method the invention can also be used to determine the genotypes of plants, trees and bushes, and hybrid plants, trees and bushes, including plants, trees and bushes that produce fruits and vegetables and other crops, including but not limited to wheat, barley, corn, tobacco, alfalfa, apples, apricots, bananas, oranges, pears, nectarines, figs, dates, raisins, plums, peaches, apricots, blueberries, strawberries, cranberries, berries, cherries, kiwis, limes, lemons, melons, pineapples, plantains, guavas, prunes, passion fruit, tangerines, grapefruit, grapes, watermelon, cantaloupe, honeydew melons, pomegranates, persimmons, nuts, artichokes, bean sprouts, beets, cardoon, chayote, endive, leeks, okra, green onions, scallions, shallots, parsnips, sweet potatoes, yams, asparagus, avocados, kohlrabi, rutabaga, eggplant, squash, turnips, pumpkins, tomatoes, potatoes, cucumbers, carrots, cabbage, celery, broccoli, cauliflower, radishes, peppers, spinach, mushrooms, zucchini, onions, peas, beans, and other legumes.
The method of the invention may also be useful for analyzing genetic variations of an individual that have an effect on drug metabolism, drug interactions, and the responsiveness to a drug or to multiple drugs. The method of the invention is especially useful in pharmacogenomics.
As used herein the term "about" refers to ± 10 %.
The terms "comprises", "comprising", "includes", "including", "having" and their conjugates mean "including but not limited to".
The term "consisting of means "including and limited to".
The term "consisting essentially of means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.
As used herein, the singular form "a", "an" and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" may include a plurality of compounds, including mixtures thereof.
Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases "ranging/ranges between" a first indicate number and a second indicate number and "ranging/ranges from" a first indicate number "to" a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween
As used herein the term "method" refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.
Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples. EXAMPLES
Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non limiting fashion.
Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, "Molecular Cloning: A laboratory Manual" Sambrook et al, (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al, "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al, "Recombinant DNA", Scientific American Books, New York; Birren et al. (eds) "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E., ed. (1994); "Culture of Animal Cells - A Manual of Basic Technique" by Freshney, Wiley- Liss, N. Y. (1994), Third Edition; "Current Protocols in Immunology" Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), "Selected Methods in Cellular Immunology", W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; "Oligonucleotide Synthesis" Gait, M. J., ed. (1984); "Nucleic Acid Hybridization" Hames, B. D., and Higgins S. J., eds. (1985); "Transcription and Translation" Hames, B. D., and Higgins S. J., eds. (1984); "Animal Cell Culture" Freshney, R. I., ed. (1986); "Immobilized Cells and Enzymes" IRL Press, (1986); "A Practical Guide to Molecular Cloning" Perbal, B., (1984) and "Methods in Enzymology" Vol. 1-317, Academic Press; "PCR Protocols: A Guide To Methods And Applications", Academic Press, San Diego, CA (1990); Marshak et al., "Strategies for Protein Purification and Characterization - A Laboratory Course Manual" CSHL Press (1996); all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incorporated herein by reference.
EXAMPLE 1
Fusion of the Yeast (S. cerevisiae) proteasomal subunit RPN10 (nlO) to a ubiquitin
(Ub) gene
MATERIALS AND METHODS
A PCR reaction was set up as detailed in Table 1 , herein below.
Table 1
Figure imgf000029_0001
The sequences of the reaction primers are provided in Table 2, herein below.
Table 2
symbol Name Sequence SEQ ID
NO
a RpnlO Forward ATGGTATTGGAAGCTACAGT 1
primer
b Ubiquitin Reverse TTGTCGACTCAACCTCTCAAT 2
primer CTCAAGA
c RpnlO ubiquitin GGAAAGGTTAAGACAGCAGC 3
linker AAGGTGGAGGCAAGACTTTGAC The PCR cycling parameters are set forth in Table 3, herein below.
Table 3
Figure imgf000030_0001
The PCR reaction relies on two flanking primers (designated "a" and "b"), and one linker-primer (designated "c"). Primer "a" contains 20 nucleotides derived from the 5' region of the sense strand of the nlO gene (I - SEQ ID NO: 21), whereas primer "b" is similar to the 3' end of the antisense strand of the Ub gene (II - SEQ ID NO: 20). Importantly, as pfu or Phusion was used as the DNA polymerase, both primers were diluted to a final (standard) concentration of 500 nM. Primer "c" (the linker primer), was used at a concentration of about 2 nM, and its nucleotide sequence reflects the desired junction between the two genes (Figure ID). Specifically, the initial 22 nucleotides of primer "c" are identical to the 3' region of the sense nlO strand, while the remaining 20 nucleotides are derived from the 5' of the sense strand encoding the Ub gene.
A PCR reaction requires a template and two primers complementary to both ends of the fragment to be amplified. Accordingly, the Ub fragment will be the only fragment amplified at the initial phase of the reaction as it is the only DNA fragment with two complementary primers "b" and "c". This amplification results in a ubiquitin gene with a 5' overhang complementary to the 3' end of the nlO gene. This intermediate product (Figure 1, fragment B*) may hybridize with the nlO gene (Figure 1, fragment A). The annealed strands serve both as templates and primers leading to the production of the full-length desired product (III - SEQ ID NO: 22) (Figure 1, fragment C), which is then amplified by the flanking primers "a" and "b" (Figures 1 A-B).
Through extensive calibration assays with various DNA fragments it was found that the linker-induced PCR recombination works best when the linker primer concentration is 2 nM that is about 1 :250 of the flanking primers "a" and "b". A representative assay demonstrating the efficiency of the PCR recombination reaction as a function of the linker primer concentration is given in Figures 3A-B. Using the reaction conditions set forth in Tables 4 and 5 and the modified primers (specifically RpnlO-ubiquitin linker with IT -
GGAAAGGTTAAGACAGCAGCAATGGTGGAGGCAAGACTTTGAC - SEQ ID NO: 8; RpnlO-ubiquitin linker with 2T
GGAAAGGTTAAGACAGCAGCAATTGGTGGAGGCAAGACTTTGAC - SEQ ID NO: 9; and RpnlO-ubiquitin linker with 3T -
GGAAAGGTTAAGACAGCAGCAATTTGGTGGAGGCAAGACTTTGAC - SEQ ID NO: 10) this method can be utilized to fuse genes while shifting the reading frame or introducing mutations at the junction, depending on the linker primer used, as detailed in Figure 1C.
Table 4
Figure imgf000031_0001
Table 5
segment Number of temperature duration
cycles
1 1 95°-C 2 min
2 35 98QC 10 sec
52QC 30 sec
12°-C 2 min
3 1 12°-C 10 min EXAMPLE 2
Linkage of three fragments according to embodiments of the present invention
To test if relying on the same PCR principles it is possible to link more than two fragments in a single PCR reaction, the present inventors set out to fuse three arbitrarily-selected gene fragments of yeast (S. cerevisiae) proteosomal subunits, namely RPN10QV) (200 bp; SEQ ID NO: 23), RPT5(V; SEQ ID NO: 24) (200 bp) and RPT2) (765 bp).
MATERIALS AND METHODS
A PCR reaction was set up as detailed in Table 6, herein below.
Table 6
Figure imgf000032_0001
The sequences of the reaction primers are provided in Table 7, herein below.
Table 7
symbol Name Sequence SEQ ID
NO
a RpnlO Forward ATGGTATTGGAAGCTACAGT 1
primer
d Rpt2 Reverse TCACAAGTATAAACCTTCTA 4
e Rpnl0-Rpt5 GTGTTATCTACGTTTACCGCAT 11
Forward linker CGGTGGGTTGGATAAACA
f Rpnl0-rpt5 TGTTTATCCAACCCACCGATG 5
Reverse linker C GGT AAAC GT AG AT AAC AC
g Rp5-rpt2 TTTTTGAAGCTGGCAGCACCAT 6
Forward linker CGGTGGCTTAGAATCTCA
h Rp5-rpt2 TGAGATTCTAAGCCACCGATGGTG 7
Reverse linker CTGCCAGCTTCAAAAA The PCR cycling parameters are set forth in Table 8, herein below.
Table 8
Figure imgf000033_0002
Four primers were used, two flanking primers "a" and "d" and two linker primers "f ' and "g" (Figure 2A). Initially, linker-primers " ' and "g" direct the synthesis of two intermediate products (Fragment A* and fragment C*). As these intermediates are formed, the linker-primers are depleted due to their low initial concentration (1 :250). In the next step these products anneal with RPT5 (V - SEQ ID NO: 24) (Figure 2A, fragment 2) and serve both as templates and primers resulting in generation of two alternative chimeric products (fragments AB*, fragment BC*), which may hybridize with each other or with the first intermediates (Figure 4). The resulting intermediates converge to form the desired final product Rpnl0-Rpt5-Rpt2 (VII - SEQ ID NO: 26), which is amplified via the flanking primers "a" and "d" (Figure 2A). It is noteworthy that by definition the recombination site of the fragments in the scenarios described above must reside at the end of the templates, otherwise the termini would not be able to serve as primers upon annealing of the intermediate products. To circumvent such a limitation the present inventors use a variation of this method in which primer-linkers suitable for amplification of the desired segments of the three genes are used (Figures
5A-B) using the parameters provided in Tables 9 and 10 herein below.
Table 9
Figure imgf000033_0001
Rpt2 Reverse primer 50nmol/ml 0.5μ1
Rpnl0-Rpt5 Forward linker primer 500pmol/ml 0.2μ1
Rtp5-Rpt2 Forward linker primer 500pmol/ml 0.2μ1
Rpnl0-Rpt5 Reverse linker primer 5 OOpmol/ml 0.2μ1
Rtp5-Rpt2 Reverse linker primer 5 OOpmol/ml 0.2μ1
Pfu DNA polymerase (2.5 U/μΙ) Ιμΐ (2.5U)
Total reaction volume 50μ1
Table 10
Figure imgf000034_0001
Once the overhang containing intermediates are formed, amplification of the final product will proceed relying on primers "a" and "d" (Figures 6A-B). The efficiency of this reaction is comparable to a similar reaction where the, two step, 'PCR- driven overlap extension' method was used to produce the same product by two consecutive PCR reactions.
EXAMPLE 3
Domain swapping according to embodiments of the present invention
To evaluate if the present method can be applied to the construction of plasmids, the present inventors sought to use it to perform both cloning and domain swapping. An outstanding question in the UPS field is how different ubiquitin-conjugating enzymes (E2's) propagate the assembly of polyubiquitin conjugates through a different lysine residue. For example, the E2-25K conjugates ubiquitin molecules through lysine 48 of ubiquitin, while E2-S promotes ubiquitin polymerization through lysine 11 of ubiquitin. A possible explanation would be that the specific structure of the E2's catalytic site (Active Site Loop, ASL) determines which lysine is conjugated to the adjacent ubiquitin molecule. To examine this possibility, the present inventors set to generate an E2S derivative in which the ASL was swapped with the ASL of E2-25K (Figures 7A-B). MATERIALS AND METHODS
A PCR reaction was set up as detailed in Table 11 , herein below.
Table 11
Figure imgf000035_0001
Following the PCR reaction, the products were digested for 1 hour by Dpnl endonuclease (Fermentas) and subsequently separated on 1% agarose gel. A fragment of the correct size was excised from the gel and purified using a gel clean kit (Promega). The cleaned PCR product was complemented with nucleotide and its termini were Phosphorylated by T4 Poly Nucleotide Kinase (PNK) for 30 minutes. The PNK was then heat inactivated, cooled and used directly for self-ligation (overnight). ΙΟμΙ of the ligation mixture were then used to transform E.coli competent cells (Top 10). The transformed bacteria were spread on LB plate complemented with 200 μg/ml Amp. Several colonies were inoculated and the plasmids were sequenced.
The sequences of the reaction primers are provided in Table 12, herein below.
Table 12
symbol Name Sequence SEQ ID
NO
L E2-25K active ATTAGTTCCGTCACAGGGGC 12
site loop
Forward
m E2S-Pet22 GTTCGGGTGGAAGATCTTGG 13
Reverse
11 25K-E2S loop GAAAGATCAATGGGCAGCT 14
linker GAGCTGGGCATCCGACACGTA The PCR cycling parameters are set forth in Table 13, herein below.
Table 13
Figure imgf000036_0001
The pET22 plasmid carrying the E2S gene(IX - SEQ ID NO: 28) and a PCR fragment of E2-25K ASL (VIII - SEQ ID NO: 27) were used as templates. Two flanking primers "m" and "L" and a linker-primer "n" were also included in the reaction mixture (Figure 7C). Flanking primer "m" is designed to hybridize with the sense strand of pET22-E2S at the 5' edge of E2S-ASL and promote the generation of the complementary strand. Linker primer "n" associates with the non-sense strand at the 3' edge of E2S-ASL (outside of the ASL), and allows the generation of the coding strand. Thus, in the initial PCR cycles a linear form of the pET22 E2S plasmid lacking its ASL with a 5' 20 bp overhang, complementary to the 3' of the 25K-ASL, is exclusively generated in limited amounts due to the low concentration of linker primer "n". The intermediate product anneals to the 25K-ASL to product pet22 E2-S with 25K-ASL (X - SEQ ID NO: 29), which is then further amplified utilizing primers "m" and "L" as shown in Figures 7A-B. Following treatment with Dpnl the PCR products were then ligated by T4 DNA ligase (to ligate both ends of the chimeric product) and transformed into an E. Coli DH5a strain. Selected clones were sequenced to ascertain the production of the appropriate hybrid. It should be noted that both the flanking primers "m" and "L" were phosphorylated prior to the PCR reaction by T4 PNK, as the 5' phosphates are necessary for the ligation reaction.
EXAMPLE 4
Cloning according to embodiments of the present invention To exemplify that the present method can be utilized for DNA cloning the present inventors aimed to insert the RPN10 gene (I - SEQ ID NO: 21) into the Bluescript-KS (XI - SEQ ID NO: 30) plasmid (Figures 8A-B). MATERIALS AND METHODS
A PCR reaction was set up as detailed in Table 14, herein below.
Table 14
Figure imgf000037_0001
Following the PCR reaction the products were digested for 1 hour by Dpnl endonuclease (Fermentas) and subsequently separated on 1 % agarose gel. A fragment of the correct size was excised from the gel and purified using a gel clean kit (Promega). The cleaned PCR product was complemented with nucleotide and its termini were Phosphorylated by T4 Poly Nucleotide Kinase (PNK) for 30 minutes. The PNK was then heat inactivated, cooled and used directly for self ligation (overnight). ΙΟμΙ of the ligation mixture were then used to transformed E.coli competent cells (Top 10). The transformed bacteria were spread on LB plate complimented with 200μg/ml Amp, X- gal and IPTG. White colonies were inoculated and the plasmids they carry were sequenced.
The sequences of the reaction primers are provided in Table 15, herein below.
Table 15
symbol Name Sequence SEQ ID
NO
0 KS Forward TACGAGCCGGAAGCATAA 15
P RpnlO Reverse TTGCTGCTGTCTTAACCTTTC 16
primer
q KS-rpnlO linker GCTGCAAGGCGATTAAGT 17
Forward ATGGTATTGGAAGCTACAG
r KS-rpnlO linker CTGTAGCTTCCAATACCAT 18
Reverse ACTTAATCGCCTTGCAGC The PCR cycling parameters are set forth in Table 16, herein below.
Table 16
Figure imgf000038_0001
In the experiments presented in Examples 1-3, primer linkers of about 40 bp were used. Given, the annealing temperature of the insertion point in the KS plasmid is predicted to be low and so as to avoid the synthesis of long primers, a combination of two linker primers were used. Accordingly, two overlapping primer-linkers to the same recombination junction were synthesized. The first primer (designated primer "q") in conjunction with the flanking primer "p" are expected to generate an intermediate of RPNIO with 5' overhang of 20 bp complementary to the KS recombination site (Figure 8A). Simultaneously, a second primer linker (designated primer "r") was employed in conjunction with flanking primer "o" to generate a second intermediate; a KS with 3 ' overhang of 20 bp complementary to the 5' of RPNIO (Figure 8A). Upon hybridization of these two intermediate products a complementary stretch of 40 nucleotides is generated (in contrast to about 20 bp when a single linker primer is used), thus stabilizing the hybrid. As the intermediate product is being produced, the linker-primers are consumed. The limited amounts of the intermediates formed hybridize and serve as primers and templates for the construction of the full length desired product RPNIO in KS plasmid (XII - SEQ ID NO: 31). The flanking primers "o" and "p" then serve to amplify this linear full length product (Figures 8A-C). The PCR product was purified, ligated, and transformed into an E. Coli (DH5a strain) as describe above. Several colonies were sequenced to ensure the correct sequence and orientation. EXAMPLE 4
Linking of genomic DNA
In many cases the template used by researchers for cloning originates from a complex mixture, e.g. - genomic DNA or cDNA. Accordingly, the present inventors tested if this technique could be applied directly on genomic DNA.
A PCR reaction was set up as detailed in Table 17, herein below.
Table 17
Figure imgf000039_0001
The sequences of the reaction primers are provided in Table 18, herein below.
Table 18
symbol Name Sequence SEQ ID
NO
a RpnlO Forward ATGGTATTGGAAGCTACAGT 1
primer
f Rpnl0-rpt5 TGTTTATCCAACCCACCGATG 5
Reverse linker C GGT AAAC GT AG AT AAC AC
g Rp5-rpt2 TTTTTGAAGCTGGCAGCACCAT 6
Forward linker CGGTGGCTTAGAATCTCA
s Rpt 5 Reverse GGTGCTGCCAGCTTCAAAAA 19 The PCR cycling parameters are set forth in Table 19, herein below.
Table 19
Figure imgf000040_0001
For proof of concept the present inventors selected to fuse two yeast gene products that are located on different chromosomes (RPNlO-chrS, RPT5-chrl5). As shown in Figures 9A-B, using two linker-primers and two flanking primers the present inventors successfully produced a fusion product of the two desired gene fragments (RPN10-RPT5, (XIII - SEQ ID NO: 32)).
Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.
All publications, patents and patent applications mentioned in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting.

Claims

WHAT IS CLAIMED IS:
1. A method of diagnosing a disease in a subject in need thereof, the method comprising:
(a) linking a plurality of non-contiguous DNA fragments from a sample of the subject to generate a polynucleotide product, said linking being effected by contacting said plurality of non-contiguous DNA fragments with a multiplex overlap- extension primer mix under conditions that allow simultaneous linkage of said DNA fragments and amplification of said polynucleotide product, wherein said primer mix comprises two flanking primers and at least one linker primer; and
(b) determining a sequence of said polynucleotide product, wherein said sequence is indicative of the disease.
2. The method of claim 1, wherein at least two of said non-contiguous fragments of DNA comprise a nucleic acid sequence which is indicative of a disease.
3. The method of claim 1, further comprising fragmenting DNA of said sample prior to step (a) so as to generate said plurality of non-contiguous DNA fragments.
4. The method of claim 3, wherein said fragmenting is effected using a restriction enzyme.
5. The method of claim 1, wherein said polynucleotide product is no longer than 1000 base pairs.
6. The method of claim 1, wherein said plurality of non-contiguous fragments comprises two fragments.
7. The method of claim 1, wherein said plurality of non-contiguous fragments comprises three fragments.
8. The method of claim 7, wherein said multiplex overlap-extension primer mix comprises two flanking primers and at least two linker primers.
9. The method of claim 1, wherein a concentration of said at least one linker primer is lower than a concentration of said two flanking primers.
10. The method of claim 1, wherein said determining a sequence is effected using a chain termination method.
11. The method of claim 1, further comprising informing the subject of the results of the diagnosing.
12. The method of claim 1, further comprising performing additional diagnostic tests so as to corroborate the results of the diagnosing.
13. The method of claim 1, wherein said DNA comprises non-transcribed
DNA.
The method of claim 1, wherein the subject is a fetus.
The method of claim 1 , wherein the sample comprises amniotic fluid.
16. A method of linking a plurality of non-contiguous fragments of DNA to generate a single polynucleotide product, the method comprising contacting the fragments with a multiplex overlap-extension primer mix, said mix comprising two flanking primers and a number of linker primers being one less than a number of said fragments, under conditions which allow simultaneous linking of said fragments and amplification of said single polynucleotide product, thereby generating the single polynucleotide product.
17. The method of claim 16, wherein said DNA comprises non-transcribed
DNA.
18. The method of claim 16, wherein a concentration of said linker primers is lower than a concentration of said flanking primers.
19. A method of linking a plurality of non-contiguous fragments of non- transcribed DNA to generate a single polynucleotide product, the method comprising contacting the fragments with a multiplex overlap-extension primer mix under conditions which allow simultaneous linking of said fragments and amplification of said single polynucleotide product, wherein said primer mix comprises two flanking primers and at least one linker primer, thereby generating the single polynucleotide product.
20. A kit for linking a plurality of non-contiguous fragments of DNA to generate a polynucleotide product, the kit comprising at least two flanking primers and at least one linker primer wherein at least two of said non-contiguous fragments of DNA comprise a nucleic acid sequence which is indicative of a disease.
21. The kit of claim 20, further comprising a DNA polymerase enzyme.
PCT/IL2012/050033 2011-01-31 2012-01-31 Methods of diagnosing disease using overlap extension pcr Ceased WO2012104851A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US13/982,809 US20130316358A1 (en) 2011-01-31 2012-01-31 Methods of diagnosing disease using overlap extension pcr

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201161437706P 2011-01-31 2011-01-31
US61/437,706 2011-01-31

Publications (2)

Publication Number Publication Date
WO2012104851A1 true WO2012104851A1 (en) 2012-08-09
WO2012104851A9 WO2012104851A9 (en) 2012-09-13

Family

ID=45815931

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IL2012/050033 Ceased WO2012104851A1 (en) 2011-01-31 2012-01-31 Methods of diagnosing disease using overlap extension pcr

Country Status (2)

Country Link
US (1) US20130316358A1 (en)
WO (1) WO2012104851A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2652155A4 (en) * 2010-12-16 2014-05-14 Gigagen Inc SYSTEM AND METHODS FOR MASSIVE PARALLEL ANALYSIS OF NUCLEIC ACIDS CONTAINED IN INDIVIDUAL CELLS
US9422547B1 (en) 2015-06-09 2016-08-23 Gigagen, Inc. Recombinant fusion proteins and libraries from immune cell repertoires
US11421220B2 (en) 2019-03-21 2022-08-23 Gigamune, Inc. Engineered cells expressing anti-viral T cell receptors and methods of use thereof

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2014525921A (en) 2011-08-05 2014-10-02 プレジデント アンド フェローズ オブ ハーバード カレッジ Compositions and methods for nucleic acid nanotechnology and microtechnology
WO2014018675A1 (en) 2012-07-24 2014-01-30 President And Fellows Of Harvard College Self-assembly of nucleic acid nanostructures
WO2014074597A1 (en) 2012-11-06 2014-05-15 President And Fellows Of Harvard College Compositions and methods relating to complex nucleic acid nanostructures
JP2017523594A (en) 2014-05-22 2017-08-17 プレジデント アンド フェローズ オブ ハーバード カレッジ Nanofabrication based on scalable nucleic acids
WO2016144755A1 (en) * 2015-03-07 2016-09-15 President And Fellows Of Harvard College Single-stranded dna nanostructures
EP3929291A1 (en) * 2015-03-17 2021-12-29 Bio-Rad Laboratories, Inc. Detection of genome editing

Citations (38)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3791932A (en) 1971-02-10 1974-02-12 Akzona Inc Process for the demonstration and determination of reaction components having specific binding affinity for each other
US3839153A (en) 1970-12-28 1974-10-01 Akzona Inc Process for the detection and determination of specific binding proteins and their corresponding bindable substances
US3850578A (en) 1973-03-12 1974-11-26 H Mcconnell Process for assaying for biologically active molecules
US3850752A (en) 1970-11-10 1974-11-26 Akzona Inc Process for the demonstration and determination of low molecular compounds and of proteins capable of binding these compounds specifically
US3853987A (en) 1971-09-01 1974-12-10 W Dreyer Immunological reagent and radioimmuno assay
US3867517A (en) 1971-12-21 1975-02-18 Abbott Lab Direct radioimmunoassay for antigens and their antibodies
US3879262A (en) 1972-05-11 1975-04-22 Akzona Inc Detection and determination of haptens
US3901654A (en) 1971-06-21 1975-08-26 Biological Developments Receptor assays of biologically active compounds employing biologically specific receptors
US3935074A (en) 1973-12-17 1976-01-27 Syva Company Antibody steric hindrance immunoassay with two antibodies
US3984533A (en) 1975-11-13 1976-10-05 General Electric Company Electrophoretic method of detecting antigen-antibody reaction
US3996345A (en) 1974-08-12 1976-12-07 Syva Company Fluorescence quenching with immunological pairs in immunoassays
US4034074A (en) 1974-09-19 1977-07-05 The Board Of Trustees Of Leland Stanford Junior University Universal reagent 2-site immunoradiometric assay using labelled anti (IgG)
US4098876A (en) 1976-10-26 1978-07-04 Corning Glass Works Reverse sandwich immunoassay
US4458066A (en) 1980-02-29 1984-07-03 University Patents, Inc. Process for preparing polynucleotides
US4666828A (en) 1984-08-15 1987-05-19 The General Hospital Corporation Test for Huntington's disease
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4800159A (en) 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
US4801531A (en) 1985-04-17 1989-01-31 Biotechnology Research Partners, Ltd. Apo AI/CIII genomic polymorphisms predictive of atherosclerosis
US4879219A (en) 1980-09-19 1989-11-07 General Hospital Corporation Immunoassay utilizing monoclonal high affinity IgM antibodies
EP0370719A2 (en) 1988-11-25 1990-05-30 Imperial Chemical Industries Plc Extended nucleotide sequences
US5011771A (en) 1984-04-12 1991-04-30 The General Hospital Corporation Multiepitopic immunometric assay
WO1991014003A2 (en) 1990-03-09 1991-09-19 Ig Laboratories, Inc. Characterization and analysis of polymorphic vntr loci
US5075217A (en) 1989-04-21 1991-12-24 Marshfield Clinic Length polymorphisms in (dC-dA)n ·(dG-dT)n sequences
US5192659A (en) 1989-08-25 1993-03-09 Genetype Ag Intron sequence analysis method for detection of adjacent and remote locus alleles as haplotypes
US5272057A (en) 1988-10-14 1993-12-21 Georgetown University Method of detecting a predisposition to cancer by the use of restriction fragment length polymorphism of the gene for human poly (ADP-ribose) polymerase
US5281521A (en) 1992-07-20 1994-01-25 The Trustees Of The University Of Pennsylvania Modified avidin-biotin technique
US5322770A (en) 1989-12-22 1994-06-21 Hoffman-Laroche Inc. Reverse transcription with thermostable DNA polymerases - high temperature reverse transcription
US5475610A (en) 1990-11-29 1995-12-12 The Perkin-Elmer Corporation Thermal cycler for automatic performance of the polymerase chain reaction with close temperature control
US5538871A (en) 1991-07-23 1996-07-23 Hoffmann-La Roche Inc. In situ polymerase chain reaction
US5612473A (en) 1996-01-16 1997-03-18 Gull Laboratories Methods, kits and solutions for preparing sample material for nucleic acid amplification
WO2001079561A2 (en) * 2000-04-17 2001-10-25 Liggett Stephen B Alpha-2 adrenergic receptor polymorphisms
US20030064366A1 (en) 2000-07-07 2003-04-03 Susan Hardin Real-time sequence determination
US20030113747A1 (en) 2001-10-30 2003-06-19 Maithreyan Srinivasan Novel sulfurylase-luciferase fusion proteins and thermostable sulfurylase
US20030119012A1 (en) 2001-10-30 2003-06-26 Maithreyan Srinivasan Novel sulfurylase-luciferase fusion proteins and thermostable sulfurylase
WO2004070005A2 (en) 2003-01-29 2004-08-19 454 Corporation Double ended sequencing
EP1516929A2 (en) * 2003-09-18 2005-03-23 Symphogen A/S Method for linking sequences of interest
WO2008104184A2 (en) * 2007-03-01 2008-09-04 Symphogen A/S Method for cloning cognate antibodies

Patent Citations (42)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3850752A (en) 1970-11-10 1974-11-26 Akzona Inc Process for the demonstration and determination of low molecular compounds and of proteins capable of binding these compounds specifically
US3839153A (en) 1970-12-28 1974-10-01 Akzona Inc Process for the detection and determination of specific binding proteins and their corresponding bindable substances
US3791932A (en) 1971-02-10 1974-02-12 Akzona Inc Process for the demonstration and determination of reaction components having specific binding affinity for each other
US3901654A (en) 1971-06-21 1975-08-26 Biological Developments Receptor assays of biologically active compounds employing biologically specific receptors
US3853987A (en) 1971-09-01 1974-12-10 W Dreyer Immunological reagent and radioimmuno assay
US3867517A (en) 1971-12-21 1975-02-18 Abbott Lab Direct radioimmunoassay for antigens and their antibodies
US3879262A (en) 1972-05-11 1975-04-22 Akzona Inc Detection and determination of haptens
US3850578A (en) 1973-03-12 1974-11-26 H Mcconnell Process for assaying for biologically active molecules
US3935074A (en) 1973-12-17 1976-01-27 Syva Company Antibody steric hindrance immunoassay with two antibodies
US3996345A (en) 1974-08-12 1976-12-07 Syva Company Fluorescence quenching with immunological pairs in immunoassays
US4034074A (en) 1974-09-19 1977-07-05 The Board Of Trustees Of Leland Stanford Junior University Universal reagent 2-site immunoradiometric assay using labelled anti (IgG)
US3984533A (en) 1975-11-13 1976-10-05 General Electric Company Electrophoretic method of detecting antigen-antibody reaction
US4098876A (en) 1976-10-26 1978-07-04 Corning Glass Works Reverse sandwich immunoassay
US4458066A (en) 1980-02-29 1984-07-03 University Patents, Inc. Process for preparing polynucleotides
US4879219A (en) 1980-09-19 1989-11-07 General Hospital Corporation Immunoassay utilizing monoclonal high affinity IgM antibodies
US5011771A (en) 1984-04-12 1991-04-30 The General Hospital Corporation Multiepitopic immunometric assay
US4666828A (en) 1984-08-15 1987-05-19 The General Hospital Corporation Test for Huntington's disease
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683202B1 (en) 1985-03-28 1990-11-27 Cetus Corp
US4801531A (en) 1985-04-17 1989-01-31 Biotechnology Research Partners, Ltd. Apo AI/CIII genomic polymorphisms predictive of atherosclerosis
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683195B1 (en) 1986-01-30 1990-11-27 Cetus Corp
US4800159A (en) 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
US5272057A (en) 1988-10-14 1993-12-21 Georgetown University Method of detecting a predisposition to cancer by the use of restriction fragment length polymorphism of the gene for human poly (ADP-ribose) polymerase
EP0370719A2 (en) 1988-11-25 1990-05-30 Imperial Chemical Industries Plc Extended nucleotide sequences
US5075217A (en) 1989-04-21 1991-12-24 Marshfield Clinic Length polymorphisms in (dC-dA)n ·(dG-dT)n sequences
US5192659A (en) 1989-08-25 1993-03-09 Genetype Ag Intron sequence analysis method for detection of adjacent and remote locus alleles as haplotypes
US5322770A (en) 1989-12-22 1994-06-21 Hoffman-Laroche Inc. Reverse transcription with thermostable DNA polymerases - high temperature reverse transcription
WO1991014003A2 (en) 1990-03-09 1991-09-19 Ig Laboratories, Inc. Characterization and analysis of polymorphic vntr loci
US5475610A (en) 1990-11-29 1995-12-12 The Perkin-Elmer Corporation Thermal cycler for automatic performance of the polymerase chain reaction with close temperature control
US5602756A (en) 1990-11-29 1997-02-11 The Perkin-Elmer Corporation Thermal cycler for automatic performance of the polymerase chain reaction with close temperature control
US5538871A (en) 1991-07-23 1996-07-23 Hoffmann-La Roche Inc. In situ polymerase chain reaction
US5281521A (en) 1992-07-20 1994-01-25 The Trustees Of The University Of Pennsylvania Modified avidin-biotin technique
US5612473A (en) 1996-01-16 1997-03-18 Gull Laboratories Methods, kits and solutions for preparing sample material for nucleic acid amplification
WO2001079561A2 (en) * 2000-04-17 2001-10-25 Liggett Stephen B Alpha-2 adrenergic receptor polymorphisms
US20030064366A1 (en) 2000-07-07 2003-04-03 Susan Hardin Real-time sequence determination
US20030113747A1 (en) 2001-10-30 2003-06-19 Maithreyan Srinivasan Novel sulfurylase-luciferase fusion proteins and thermostable sulfurylase
US20030119012A1 (en) 2001-10-30 2003-06-26 Maithreyan Srinivasan Novel sulfurylase-luciferase fusion proteins and thermostable sulfurylase
WO2004070005A2 (en) 2003-01-29 2004-08-19 454 Corporation Double ended sequencing
EP1516929A2 (en) * 2003-09-18 2005-03-23 Symphogen A/S Method for linking sequences of interest
US7749697B2 (en) 2003-09-18 2010-07-06 Symphogen A/S Method for linking sequences of interest
WO2008104184A2 (en) * 2007-03-01 2008-09-04 Symphogen A/S Method for cloning cognate antibodies

Non-Patent Citations (59)

* Cited by examiner, † Cited by third party
Title
"A Practical Guide to Molecular Cloning", 1984, PERBAL, B
"Animal Cell Culture", 1986
"Basic and Clinical Immunology", 1994, APPLETON & LANGE
"Cell Biology: A Laboratory Handbook", vol. I-III, 1994
"Current Protocols in Immunology", vol. I-III, 1994
"Current Protocols in Molecular Biology", vol. I-III, 1994
"Genome Analysis: A Laboratory Manual Series", vol. 1-4, 1998, COLD SPRING HARBOR LABORATORY PRESS
"Immobilized Cells and Enzymes", 1986, IRL PRESS
"Methods in Enzymology", vol. 1-317, ACADEMIC PRESS
"Nucleic Acid Hybridization", 1985
"Oligonucleotide Synthesis", 1984
"PCR Protocols: A Guide To Methods And Applications", 1990, ACADEMIC PRESS
"PCR Strategies", 1995, ACADEMIC PRESS
"Polymerase chain reaction: basic principles and automation in PCR: A Practical Approach", 1991, IRL PRESS
"Selected Methods in Cellular Immunology", 1980, W. H. FREEMAN AND CO.
"Short Protocols in Molecular Biology", JOHN WILEY & SONS
"Transcription and Translation", 1984
A. M. MAXAM; W. GILBERT, METHODS OF ENZYMOLOGY, vol. 65, 1980, pages 499 - 560
AGAH ET AL., NUCL. ACIDS RES., vol. 32, 2004, pages E166
ARMOUR ET AL., FEBS LETT., vol. 307, 1992, pages 113 - 115
AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1989, JOHN WILEY AND SONS
CHEUK-WAI KAN ET AL., ELECTROPHORESIS, vol. 25, 2004, pages 3564 - 88
COMPTON J., NATURE, vol. 350, 1991, pages 91 - 2
D. GUSCHIN ET AL., ANAL. BIOCHEM., vol. 250, 1997, pages 203 - 211
DI GIUSTO; KING, NUCL. ACIDS RES., vol. 31, pages E7
E. L. BROWN ET AL., METH. ENZYMOL., vol. 68, 1979, pages 109 - 151
E. S. BELOUSOV ET AL., NUCLEIC ACIDS RES., vol. 25, 1997, pages 3440 - 3444
FRESHNEY: "Culture of Animal Cells - A Manual of Basic Technique", 1994, WILEY-LISS
G. D. MCFARLAND; P. N. BORER, NUCLEIC ACIDS RES., vol. 7, 1979, pages 1067 - 1080
GUATELLI ET AL., PROC. NAT. ACAD. SCI. U.S.A., vol. 87, 1990, pages 1874 - 8
H. WU; H. ABOLENEEN, ANAL. BIOCHEM., vol. 290, 2001, pages 347 - 352
HECKMAN, K. L.; PEASE, L. R., NAT PROTOC, vol. 2, pages 924 - 932
HO, S. N.; HUNT, H. D.; HORTON, R. M.; PULLEN, J. K.; PEASE, L. R., GENE, vol. 77, pages 51 - 59
HORTON, R. M. ET AL., GENE, vol. 77, 1989, pages 61 - 68
HORTON, R. M.; HUNT, H. D.; HO, S. N.; PULLEN, J. K.; PEASE, L. R., GENE, vol. 77, pages 61 - 68
J. D. PEARSON; F. E. REGNIER, J. CHROM., vol. 255, 1983, pages 137 - 149
J. SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOUR LABORATORY PRESS
K. B. MULLIS; F. A. FALOONA, METHODS ENZYMOL., vol. 155, 1987, pages 350 - 355
K. FRENKEL ET AL., FREE RADIC. BIOL. MED., vol. 19, 1995, pages 373 - 380
KANANGAT ET AL.: "Use of quantitative polymerase chain reaction to quantitate cytokine messenger RNA molecules", 11 November 2002 (2002-11-11), XP055024205, Retrieved from the Internet <URL:http://ac.els-cdn.com/0161589092900597/1-s2.0-0161589092900597-main.pdf?_tid=7120e6377ec0b4be87bb3d629fb87556&acdnat=1334134362_db33af55ec7e20a586669dccd063da24> [retrieved on 20120411] *
KARTALOV; QUAKE, NUCL. ACIDS RES., vol. 32, 2004, pages 2873 - 79
KOSTER ET AL., NAT. BIOTECHNOL., vol. 14, 1996, pages 1123 - 28
M. J. BLOMMERS ET AL., BIOCHEMISTRY, vol. 33, 1994, pages 7886 - 7896
MARSHAK ET AL.: "Strategies for Protein Purification and Characterization - A Laboratory Course Manual", 1996, CSHL PRESS
P. TIJSSEN: "Hybridization with Nucleic Acid Probes--Laboratory Techniques in Biochemistry and Molecular Biology (Parts I and II", 1993, ELSEVIER SCIENCE
PAEGEL ET AL., ANALYT. CHEM., vol. 74, 2002, pages 5092 - 98
PERBAL: "A Practical Guide to Molecular Cloning", 1988, JOHN WILEY & SONS
R. K. SAIKI ET AL., NATURE, vol. 324, 1986, pages 163 - 166
RONAGHI, GENOME RES., vol. 11, 2001, pages 3 - 11
S. A. NARANG ET AL., METH. ENZYMOL., vol. 68, 1979, pages 90 - 98
S. E. SUTER: "In vitro Canine Distemper Virus Infection of Canine Lymphoid Cells: A Prelude to Oncolytic Therapy for Lymphoma", CLINICAL CANCER RESEARCH, vol. 11, no. 4, 15 February 2005 (2005-02-15), pages 1579 - 1587, XP055024187, ISSN: 1078-0432, DOI: 10.1158/1078-0432.CCR-04-1944 *
SAMBROOK ET AL.: "Molecular Cloning: A laboratory Manual", 1989
SCHENA: "Microarray Analysis", 2003, JOHN WILEY & SONS
SIUZDAK: "The Expanding Role of Mass Spectrometry in Biotechnology", 2003, MCC PRESS
U. PIELES ET AL., NUCLEIC ACIDS RES., vol. 21, 1993, pages 3191 - 3196
WALKER ET AL., NUCL. ACIDS RES., vol. 20, 1992, pages 1691 - 6
WARRENS A N ET AL: "Splicing by overlap extension by PCR using asymmetric amplification: an improved technique for the generation of hybrid proteins of immunological interest", GENE, ELSEVIER, AMSTERDAM, NL, vol. 186, no. 1, 20 February 1997 (1997-02-20), pages 29 - 35, XP004054876, ISSN: 0378-1119, DOI: 10.1016/S0378-1119(96)00674-9 *
WATSON ET AL.: "Recombinant DNA", SCIENTIFIC AMERICAN BOOKS
WU; WALLACE, GENOMICS, vol. 4, 1989, pages 560 - 9

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10465243B2 (en) 2010-12-16 2019-11-05 Gigagen, Inc. System and methods for massively parallel analysis of nucleic acids in single cells
US11591652B2 (en) 2010-12-16 2023-02-28 Gigagen, Inc. System and methods for massively parallel analysis of nucleic acids in single cells
US9695474B2 (en) 2010-12-16 2017-07-04 Gigagen, Inc. System and methods for massively parallel analysis of nucleic acids in single cells
US11053543B2 (en) 2010-12-16 2021-07-06 Gigagen, Inc. System and methods for massively parallel analysis of nucleic acids in single cells
EP2652155A4 (en) * 2010-12-16 2014-05-14 Gigagen Inc SYSTEM AND METHODS FOR MASSIVE PARALLEL ANALYSIS OF NUCLEIC ACIDS CONTAINED IN INDIVIDUAL CELLS
US10787706B2 (en) 2010-12-16 2020-09-29 Gigagen, Inc. System and methods for massively parallel analysis of nucleic acids in single cells
US10106789B2 (en) 2010-12-16 2018-10-23 Gigagen, Inc. System and methods for massively parallel analysis of nucleic acids in single cells
US9926554B2 (en) 2015-06-09 2018-03-27 Gigamune, Inc. Recombinant fusion proteins and libraries from immune cell repertoires
US10214740B2 (en) 2015-06-09 2019-02-26 Gigagen, Inc. Recombinant fusion proteins and libraries from immune cell repertoires
US10689641B2 (en) 2015-06-09 2020-06-23 Gigagen, Inc. Recombinant fusion proteins and libraries from immune cell repertoires
US9926555B2 (en) 2015-06-09 2018-03-27 Gigamune, Inc. Recombinant fusion proteins and libraries from immune cell repertoires
US9738699B2 (en) 2015-06-09 2017-08-22 Gigagen, Inc. Recombinant fusion proteins and libraries from immune cell repertoires
US9422547B1 (en) 2015-06-09 2016-08-23 Gigagen, Inc. Recombinant fusion proteins and libraries from immune cell repertoires
US11702765B2 (en) 2015-06-09 2023-07-18 Gigagen, Inc. Recombinant fusion proteins and libraries from immune cell repertoires
US12241178B2 (en) 2015-06-09 2025-03-04 Gigagen, Inc. Recombinant fusion proteins and libraries from immune cell repertoires
US11421220B2 (en) 2019-03-21 2022-08-23 Gigamune, Inc. Engineered cells expressing anti-viral T cell receptors and methods of use thereof
US12497711B2 (en) 2019-03-21 2025-12-16 Gigamune, Inc. Engineered cells expressing anti-viral T cell receptors and methods of use thereof

Also Published As

Publication number Publication date
WO2012104851A9 (en) 2012-09-13
US20130316358A1 (en) 2013-11-28

Similar Documents

Publication Publication Date Title
US20130316358A1 (en) Methods of diagnosing disease using overlap extension pcr
US6977162B2 (en) Rapid analysis of variations in a genome
US7208274B2 (en) Rapid analysis of variations in a genome
Old et al. Fetal DNA analysis
Wang et al. High-throughput SNP genotyping by single-tube PCR with Tm-shift primers
CN101374963B (en) Method for AFLP-based high-throughput polymorphism detection
DK2002017T3 (en) High-capacity detection of molecular markers based on restriction fragments
EP3568493B1 (en) Methods and compositions for reducing redundant molecular barcodes created in primer extension reactions
DK2982762T3 (en) METHOD OF NUCLEIC ACID AMPLIFICATION USING ALLEL-SPECIFIC REACTIVE PRIMER
Wu et al. Targeted capture and sequencing of 1245 SNPs for forensic applications
Xu et al. Population data of mitochondrial DNA HVS-I and HVS-II sequences for 208 Henan Han Chinese
WO2005093101A1 (en) Nucleic acid sequencing
JP4491276B2 (en) Method and kit for detecting the presence of a single nucleotide polymorphism in a target DNA sequence
JP7688417B2 (en) Methods for generating a population of polynucleotide molecules
US20080305470A1 (en) Nucleic Acid Sequencing
Vernesi et al. Recent developments in molecular tools for conservation
US8008002B2 (en) Nucleic acid sequencing
Dierig et al. Development of a multiplex assay for detection of autosomal and Y-chromosomal STRs, assessment of the degradation state of mitochondrial DNA and presence of mitochondrial length heteroplasmies
US20110257018A1 (en) Nucleic acid sequencing
Vallandingham et al. Evaluation of whole transcriptome amplification methods by RNA-Seq
Nakamura et al. Analysis of mtDNA control region using mitoSEQr™ resequencing system and its forensic application
GarimaAgrawal et al. Extent of heterogeneity in the poly-nucleotide stretches of mtDNA hypervariable regions in the Indian population
HK40009932B (en) Methods and compositions for reducing redundant molecular barcodes created in primer extension reactions
Lian et al. Human mitochondrial DNA (mtDNA) types in Malaysia
HK1200497B (en) Method for high-throughput aflp-based polymorphism detection

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12708406

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 13982809

Country of ref document: US

122 Ep: pct application non-entry in european phase

Ref document number: 12708406

Country of ref document: EP

Kind code of ref document: A1