WO2012101032A1 - Tricyclic pyrrolo derivatives, process for their preparation and their use as kinase inhibitors - Google Patents

Tricyclic pyrrolo derivatives, process for their preparation and their use as kinase inhibitors Download PDF

Info

Publication number
WO2012101032A1
WO2012101032A1 PCT/EP2012/050773 EP2012050773W WO2012101032A1 WO 2012101032 A1 WO2012101032 A1 WO 2012101032A1 EP 2012050773 W EP2012050773 W EP 2012050773W WO 2012101032 A1 WO2012101032 A1 WO 2012101032A1
Authority
WO
WIPO (PCT)
Prior art keywords
formula
pyrrolo
methyl
quinazoline
compound
Prior art date
Application number
PCT/EP2012/050773
Other languages
French (fr)
Inventor
Marina Caldarelli
Mauro Angiolini
Italo Beria
Maria Gabriella Brasca
Francesco Casuscelli
Roberto D'alessio
Andrea Lombardi Borgia
Original Assignee
Nerviano Medical Sciences S.R.L.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nerviano Medical Sciences S.R.L. filed Critical Nerviano Medical Sciences S.R.L.
Priority to CN201280006541.4A priority Critical patent/CN103339134B/en
Priority to BR112013018515-5A priority patent/BR112013018515B1/en
Priority to US13/980,168 priority patent/US8975267B2/en
Priority to JP2013550833A priority patent/JP5925809B2/en
Priority to RU2013139353/04A priority patent/RU2591191C2/en
Priority to ES12702207.7T priority patent/ES2602791T3/en
Priority to EP12702207.7A priority patent/EP2668190B1/en
Publication of WO2012101032A1 publication Critical patent/WO2012101032A1/en
Priority to HK14102303.2A priority patent/HK1189229A1/en
Priority to US14/609,534 priority patent/US9309253B2/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D487/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00
    • C07D487/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00 in which the condensed system contains two hetero rings
    • C07D487/04—Ortho-condensed systems
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/55—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/18—Drugs for disorders of the alimentary tract or the digestive system for pancreatic disorders, e.g. pancreatic enzymes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A61P11/06—Antiasthmatics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/12—Drugs for disorders of the urinary system of the kidneys
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/06—Antipsoriatics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • A61P21/04—Drugs for disorders of the muscular or neuromuscular system for myasthenia gravis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/02—Antineoplastic agents specific for leukemia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/04—Antineoplastic agents specific for metastasis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/08—Antiallergic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C67/00—Preparation of carboxylic acid esters
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D207/00—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom
    • C07D207/02—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D207/30—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having two double bonds between ring members or between ring members and non-ring members
    • C07D207/34—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having two double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D209/00—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom
    • C07D209/02—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom condensed with one carbocyclic ring
    • C07D209/04—Indoles; Hydrogenated indoles
    • C07D209/30—Indoles; Hydrogenated indoles with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, directly attached to carbon atoms of the hetero ring
    • C07D209/42—Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/04—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/99—Enzyme inactivation by chemical treatment

Definitions

  • the present invention relates to tricyclic pyrrolo derivatives, to a process for their preparation, to pharmaceutical compositions comprising them, and to their use as therapeutic agents, particularly in the treatment of cancer and cell proliferation disorders.
  • the compounds of this invention are therefore useful in treating diseases caused by dysregulated protein kinase activity.
  • the present invention also provides methods for preparing these compounds, pharmaceutical compositions comprising these compounds, and methods of treating diseases utilizing pharmaceutical compositions comprising these compounds.
  • PKs protein kinases
  • the enhanced activities of PKs are also implicated in many non-malignant diseases, such as benign prostate hyperplasia, familial adenomatosis, polyposis, neuro- fibromatosis, psoriasis, vascular smooth cell proliferation associated with atherosclerosis, pulmonary fibrosis, arthritis glomerulonephritis and post-surgical stenosis and restenosis.
  • PKs are also implicated in inflammatory conditions and in the multiplication of viruses and parasites. PKs may also play a major role in the pathogenesis and development of neurodegenerative disorders.
  • Taxanes Pieris and Docetaxel
  • Vinca Alkaloids Vincristine and Vinblastine
  • Taxanes are first line therapeutics for several tumour types and second line in cisplatin-refractory ovarian, breast, lung, bladder and esophagus cancers (Taxanes).
  • phagocytosis and axonal transport certain toxicities such as peripheral neuropathy are frequently observed with these agents.
  • Progression through mitosis is a requirement of all proliferating cells and hence cancer therapies that have targets in mitosis are generally applicable to a wide range of tumour types.
  • SAC Spindle Assembly Checkpoint
  • MPS1 monopolar spindle 1 kinase
  • TTK tumor necrosis factor-1 kinase
  • MPS1 is a dual Tyrosine and Serine/Threonine kinase highly conserved from yeast to mammals.
  • the human genome encodes for just one MPS1 gene family member, which does not have high sequence similarities with other protein kinases.
  • MPS1 is a cell cycle regulate enzyme that is upregulated and activated in mitosis upon phosphorylation (Stucke VM, et al., Embo J. 21 (7): 1723, 2002).
  • MPS1 controls spindle-pole body duplication (Winey M. et al., J. Cell Biol 114:745, 1991), spindle assembly (Jones, M.H. et al., Curr. Biol. 15: 160, 2005) and the spindle assembly checkpoint (Weiss and Winey, J. Cell. Biol 132: 111 , 1996).
  • the MPS1 kinase activity is mainly involved in SAC regulation and functions (Jelluma, N. et al., Cell 132: 233, 2008).
  • RNA interference experiments indicate that in the absence of MPS1 the SAC functions are compromised: mitotic length is reduced and cells divide rapidly without methaphase plate alignment, which ultimately causes aberrant aneuploidization, mitotic catastrophe and is not anymore compatible with cellular survival (Jelluma N. et al., Cell 132: 233, 2008; Tighe A. et al., J Cell Biol 2008; Jelluma N. et al., Plos ONE 3 (6): e2415, 2008).
  • MPS1 was never found to be mutated in cancer, instead, it has been found upregulated in a number of tumors of different origins like bladder, anaplastic thyroid, breast and prostate cancer (Yuan B. et al, Clin Cancer Res, 12(4): 1121 , 2006). Moreover was found in the signature of the top 25 genes over-expressed in CIN and aneuploid tumors which predict clinical outcome in breast and lung cancer, medulloblastoma, glioma, mesothelioma and lymphoma (Carter SL et al., Nat Genet. 38 (9): 1043, 2006). Finally is highly elevated in metastatic tumors and was found to be over-expressed in p53 mutated breast cancers (Bertheau P. et al., Plos Med 4(3):e90, 2007).
  • PIMs protein-serine/threonine kinases.
  • PIM kinases are poorly expressed in normal tissues, and overexpressed or even mutated in a discrete number of human cancers, including Lymphoma, Leukaemia, Prostate, Pancreas and Gastric cancers [Shah et al. Eur. J. Cancer, 44, 2144-51 , (2008)].
  • PIM kinases are constitutively active and their activity supports in vitro and in vivo tumor cell growth and survival through modification of an increasing number of common as well as isoform-specific substrates including several cell cycle regulators and apoptosis mediators. PIM1 but not PIM2 seems also to mediate homing and migration of normal and malignant hematopoietic cells by regulating chemokine receptor surface expression [Brault et al. Haematologica 95 1004-1015 (2010)].
  • PIM1 and PIM2 kinases may be involved in mediating the oncogenic effects of some acute myelogenous leukemias (AML)-associated oncogenes.
  • AML acute myelogenous leukemias
  • FLT3- mutations ITD and KD mut., present in 30% of AMLs
  • translocations involving the MLL gene occurring in 20% of AMLs
  • PIM1 is more expressed in FLT3-ITD-transformed AML cells than in WT bone marrow cells.
  • CLL chronic lymphocytic leukemia
  • DLBCL diffuse large B-cell lymphoma
  • MCL mantle cell lymphoma
  • myeloma Cohen et al. Leuk. Lymphoma 94 51 2004, Huttmann et al Leukemia 20 1774 (2006).
  • PIM and AKT/PKB seem to play partly redundant roles in mediating growth and survival of hematopoietic cells most probably due to overlapping substrates like BAD, p21 WAF1/clp1 , p27 KIP1 , or Cot/Tpl-2 [Choudhary et al., Mol Cell. 36 326-39 (2009)].
  • PIM kinases have been shown to control mTOR inhibition (rapamycin) resistant, proliferation and survival. Therefore, a combination of small molecule inhibitors targeting several survival kinases might be essential for a powerful cancer therapeutic platform [Amaravadi R., et al. J. Clin. Invest. 2005, 115 (10) 2618-24].
  • Oncogenic protein synthesis through elF4E binding protein 1 (4E-BP1) seems to be mTOR-indipendent and controlled by PIM-2. This observations suggest that the oncogenic elF4F translation-initiating complex could be blocked with small molecules PIM-2 inhibitors [Tamburini J. et al. Blood 2009, 114 (8), 1718-27 and Brault L. et al. Haematologica 2010, 95 (6) 1004-1015].
  • Tetrahydrobenzocycloheptene derivatives known in the art as immunosuppressive agents and for treating and preventing inflammatory conditions, allergic disorders and immune disorders are disclosed in WO2009/089305.
  • Tetrahydrocycloheptapyrimidine derivatives known in the art as protein kinase inhibitors are disclosed in WO2005/037843.
  • Tricyclicindole derivatives possessing kinase inhibitory activity have been disclosed in WO2008/065054, in the name of the applicant itself; some specific compounds of the aforementioned WO2008/065054 are excluded from the present general formula.
  • a first object of the present invention is to provide a substituted tricyclic compound of the formula (I)
  • R1 is hydrogen, halogen or an optionally substituted group selected from amino, straight or branched C1-C6 alkyl, C3-C7 cycloalkyi, cycloalkyl-alkyl, aryl, arylalkyi, heterocyclyl and heterocyclylalkyi;
  • R2 is a group selected from -NR"R"', -N(OR”')R" and OR", wherein R" and R'" are, each independently, hydrogen or an optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyi, cycloalkyl-alkyl, aryl, arylalkyi, heterocyclyl and heterocyclylalkyi or, together with the nitrogen atom to which they are bonded, R" and R'” may form a 5 to 6 membered heteroaryl or heterocyclyl group, optionally containing one additional heteroatom selected among N, 0 and S;
  • R3 is hydrogen or optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyi, cycloalkyl-alkyl, aryl, arylalkyi, heterocyclyl and heterocyclylalkyi;
  • R4 is hydrogen or an optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyi, cycloalkyl-alkyl, aryl, arylalkyi, heterocyclyl and heterocyclylalkyi;
  • X is a single bond or a divalent radical selected from -NR'-, -CONR'-, -NH-CO-NH-, -0-, -S-, -S0 2 - and -OSO2-, wherein R' is hydrogen or an optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyi, cycloalkyl-alkyl, aryl, arylalkyi, heterocyclyl and heterocyclylalkyi or, together with the nitrogen atom to which they are bound, R1 and R' may form a 5 to 6 membered heteroaryl or heterocyclyl group optionally containing one additional heteroatom selected from N, 0 and S;
  • the present invention also provides methods of synthesizing the substituted tricyclic, represented by the formula (I), prepared through a process consisting of standard synthetic transformations and isomers, tautomers, hydrates, solvates, complexes, metabolites, prodrugs, carriers, N- oxides.
  • the present invention also provides a method for treating diseases caused by and/or associated with dysregulated protein kinase activity, particularly ABL, ACK1, AKT1 , ALK, AUR1 , AUR2, BRK, BUB1 , CDC7/DBF4, CDK2/CYCA, CHK1 , CK2, EEF2K, EGFR1 , EphA2, EphB4, ERK2, FAK, FGFR1 , FLT3, GSK3beta, Haspin, IGFR1, IKK2, IR, JAK1, JAK2, JAK3, KIT, LCK, LYN, MAPKAPK2, MELK, MET, MNK2, MPS1 , MST4, NEK6, NIM1 , P38alpha, PAK4, PDGFR, PDK1 , PERK, PIM1 , PIM2, PIM3, PKAalpha, PKCbeta, PLK1, RET, ROS1 , SULU1 , Syk, TLK2, TR
  • a preferred method of the present invention is to treat a disease caused by and/or associated with dysregulated protein kinase activity selected from the group consisting of cancer, cell proliferative disorders, viral infections, autoimmune and neurodegenerative disorders.
  • carcinoma such as bladder, breast, colon, kidney, liver, lung, including small cell lung cancer, esophagus, gallbladder, ovary, pancreas, stomach, cervix, thyroid, prostate, and skin, including squamous cell carcinoma
  • hematopoietic tumors of lymphoid lineage including leukaemia, acute lymphocitic leukaemia, acute lymphoblastic leukaemia, B-cell lymphoma, T-cell-lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, hairy cell lymphoma and Burkett's lymphoma
  • hematopoietic tumors of myeloid lineage including acute and chronic myelogenous leukemias, myelodysplastic syndrome and promyelocytic leukaemia
  • tumors of mesenchymal origin including fibrosarcoma and r
  • Another preferred method of the present invention is to treat specific cellular proliferation disorders such as, for example, benign prostate hyperplasia, familial adenomatosis polyposis, neurofibromatosis, psoriasis, vascular smooth cell proliferation associated with atherosclerosis, pulmonary fibrosis, arthritis, glomerulonephritis and postsurgical stenosis and restenosis.
  • specific cellular proliferation disorders such as, for example, benign prostate hyperplasia, familial adenomatosis polyposis, neurofibromatosis, psoriasis, vascular smooth cell proliferation associated with atherosclerosis, pulmonary fibrosis, arthritis, glomerulonephritis and postsurgical stenosis and restenosis.
  • Another preferred method of the present invention is to treat immune cell-associated diseases and disorders, such as inflammatory and autoimmune diseases, for examples multiple sclerosis, systemic lupus erythematous, inflammatory bowel diseases(IBD), Crohn's disease, irritable bowel syndrome, pancreatitis, ulcerative colitis, diverticulosis, myasthenia gravis, vasculitis, psoriasis, scleroderma, asthma, allergy, systemic sclerosis, vitiligo, arthritis such as osteoarthritis, juvenile rheumatoid arthritis, ankylosing spondylitis.
  • inflammatory and autoimmune diseases for examples multiple sclerosis, systemic lupus erythematous, inflammatory bowel diseases(IBD), Crohn's disease, irritable bowel syndrome, pancreatitis, ulcerative colitis, diverticulosis, myasthenia gravis, vasculitis, psoriasis, scleroderma,
  • Another preferred method of the present invention is to treat viral infections, in particular the prevention of AIDS development in HIV-infected individuals.
  • Another preferred method of the present invention is to treat neurodegenerative disorders, such as Alzheimer's disease, Parkinson's disease and Huntington's disease.
  • the method of the present invention also provides tumor angiogenesis and metastasis inhibition as well as the treatment of organ transplant rejection and host versus graft disease.
  • the present invention also provides a pharmaceutical composition
  • a pharmaceutical composition comprising one or more compounds of the formula (I) or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable excipient, carrier and/or diluent.
  • the present invention further provides a pharmaceutical composition
  • a pharmaceutical composition comprising a compound of the formula (I) in combination with known anticancer treatments such as radiation therapy or chemotherapy regimen in combination with cytostatic or cytotoxic agents, antibiotic-type agents, alkylating agents, antimetabolite agents, hormonal agents, immunological agents, interferon-type agents, cyclooxygenase inhibitors (e.g. COX-2 inhibitors), matrixmetalloprotease inhibitors, telomerase inhibitors, tyrosine kinase inhibitors, anti-growth factor receptor agents, anti-HER agents, anti-EGFR agents, anti-angiogenesis agents (e.g.
  • known anticancer treatments such as radiation therapy or chemotherapy regimen in combination with cytostatic or cytotoxic agents, antibiotic-type agents, alkylating agents, antimetabolite agents, hormonal agents, immunological agents, interferon-type agents, cyclooxygenase inhibitors (e.g. COX-2 inhibitors), matrixmetalloprotease inhibitors, telomerase
  • angiogenesis inhibitors farnesyl transferase inhibitors, ras-raf signal transduction pathway inhibitors, cell cycle inhibitors, other cdks inhibitors, tubulin binding agents, topoisomerase I inhibitors, topoisomerase II inhibitors, and the like.
  • the present invention further provides an in vitro method for inhibiting protein kinase activity which comprises contacting the kinase with an effective amount of a compound of formula (I) as defined above.
  • the invention provides a product or kit comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof, as defined above, or pharmaceutical compositions thereof and one or more chemotherapeutic agents, as a combined preparation for simultaneous, separate or sequential use in anticancer therapy.
  • the invention provides a compound of formula (I) or a pharmaceutically acceptable salt thereof, as defined above, for use as a medicament.
  • the invention provides the use of a compound of formula (I) or a pharmaceutically acceptable salt thereof, as defined above, in the manufacture of a medicament with anticancer activity.
  • the invention provides a compound of formula (I) or a pharmaceutically acceptable salt thereof, as defined above, for use in a method of treating cancer.
  • the present invention includes all of the hydrates, solvates, complexes, metabolites, prodrugs, carriers, N-oxides and pharmaceutically acceptable salts of the compounds of this invention.
  • a metabolite of a compound of the formula (I) is any compound into which this same compound of the formula (I) is converted in vivo, for instance upon administration to a mammal in need thereof.
  • this same derivative may be converted into a variety of compounds, for instance including more soluble derivatives like hydroxylated derivatives, which are easily excreted.
  • any of these hydroxylated derivatives may be regarded as a metabolite of the compounds of the formula (I).
  • Prodrugs are any covalently bonded compounds, which release in vivo the active parent drug according to the formula (I).
  • N-oxides are compounds of the formula (I) wherein nitrogen and oxygen are tethered through a dative bond.
  • stereogenic center or another form of an isomeric center is present in a compound of the present invention, all forms of such isomer or isomers, including enantiomers and diastereomers, are intended to be covered herein.
  • Compounds containing a stereogenic center may be used as a racemic mixture, an enantiomerically enriched mixture, or the racemic mixture may be separated using well-known techniques and an individual enantiomer may be used alone. In cases in which compounds have unsaturated carbon-carbon double bonds, both the cis (Z) and trans (E) isomers are within the scope of this invention.
  • aryl includes carbocyclic or heterocyclic hydrocarbons with from 1 to 2 ring moieties, either fused or linked to each other by single bonds, wherein at least one of the rings is aromatic; if present, any aromatic heterocyclic hydrocarbon also referred to as heteroaryl group, comprises a 5 to 6 membered ring with from 1 to 3 heteroatoms selected from N, 0 and S.
  • aryl groups are, for instance, phenyl, biphenyl, a- or ⁇ -naphthyl, dihydronaphthyl, thienyl, benzothienyl, furyl, benzofuranyl, pyrrolyl, imidazolyl, pyrazolyl, thiazolyl, isothiazolyl, oxazolyl, isoxazolyl, pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl, indolyl, isoindolyl, purinyl, quinolyl, isoquinolyl, dihydroquinolinyl, quinoxalinyl, benzodioxolyl, indanyl, indenyl, triazolyl, and the like.
  • heterocyclyl also known as “heterocycloalkyl”
  • heterocyclyl we intend a 3- to 7-membered, saturated or partially unsaturated carbocyclic ring where one or more carbon atoms are replaced by heteroatoms such as nitrogen, oxygen and sulfur.
  • heterocyclyl groups are, for instance, pyrane, pyrrolidine, pyrroline, imidazoline, imidazolidine, pyrazolidine, pyrazoline, thiazoline, thiazolidine, dihydrofuran, tetrahydrofuran, 1 ,3- dioxolane, piperidine, piperazine, morpholine and the like.
  • C3-C7 cycloalkyl we intend, unless otherwise provided, 3- to 7-membered all-carbon monocyclic ring, which may contain one or more double bonds but does not have a completely conjugated ⁇ -electron system.
  • cycloalkyl groups without limitation, are cyclopropane, cyclobutane, cyclopentane, cyclopentene, cyclohexane, cyclohexene, cyclohexadiene, cycloeptane, cycloeptene, cycloeptadiene.
  • straight or branched C1-C6 alkyl hence comprehensive of C1-C4 alkyl, we intend any of the groups such as, for instance, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, sec-butyl, n-pentyl, n-hexyl, and the like.
  • straight or branched C2-C6 alkenyl we intend any of the groups such as, for instance, vinyl, allyl, 1- propenyl, isopropenyl, 1-butenyl, 2-butenyl, 3-butenyl, 2-pentenyl, 1-hexenyl, and the like.
  • straight or branched C2-C6 alkynyl we intend any of the groups such as, for instance, ethynyl, 2- propynyl, 4-pentynyl, and the like.
  • each of the above substituent may be further substituted by one or more of the aforementioned groups.
  • halogen atom we intend a fluorine, chlorine, bromine or iodine atom.
  • alkenyl or “alkynyl” we intend any of the aforementioned straight or branched C2-C6 alkyl groups further bearing a double or triple bond.
  • alkenyl or alkynyl groups of the invention are, for instance, vinyl, allyl, 1 -propenyl, isopropenyl, 1 -butenyl, 2-butenyl, 3-butenyl, 2-pentenyl, 1 -hexenyl, ethynyl, 2- propynyl, 4-pentynyl, and the like.
  • polyfluorinated alkyl or alkoxy we intend any of the above straight or branched C1-C6 alkyl or alkoxy groups which are substituted by more than one fluorine atom such as, for instance, trifluoromethyl, trifluoroethyl,
  • alkoxy alkoxy
  • aryloxy aryloxy
  • heterocyclyloxy any of the above C1-C6 alkyl, aryl or heterocyclyl groups linked to the rest of the molecule through an oxygen atom (-0-).
  • any group which name is a composite name such as, for instance, arylamino has to be intended as conventionally construed by the parts from which it derives, e.g. by an amino group which is further substituted by aryl, wherein aryl is as above defined.
  • any of the terms such as, for instance, alkylthio, alkylamino, dialkylamino, alkoxycarbonyl,
  • alkoxycarbonylamino, heterocyclylcarbonyl, heterocyclylcarbonylamino, cycloalkyloxycarbonyl and the like include groups wherein the alkyl, alkoxy, aryl, C3-C7 cycloalkyl and heterocyclyl moieties are as above defined.
  • Pharmaceutically acceptable salts of the compounds of the formula (I) include the acid addition salts with inorganic or organic acids, e.g., nitric, hydrochloric, hydrobromic, sulfuric, perchloric, phosphoric, acetic, trifluoroacetic, propionic, glycolic, fumaric, lactic, oxalic, malonic, malic, maleic, tartaric, citric, benzoic, cinnamic, mandelic, methanesulphonic, isethionic and salicylic acid.
  • the acid addition salt of the compounds of the invention is selected between the hydrochloride or mesylate salt.
  • Pharmaceutically acceptable salts of the compounds of the formula (I) also include the salts with inorganic or organic bases, e.g., alkali or alkaline-earth metals, especially sodium, potassium, calcium ammonium or magnesium hydroxides, carbonates or bicarbonates, acyclic or cyclic amines, preferably methylamine, ethylamine, diethylamine, triethylamine, piperidine and the like.
  • inorganic or organic bases e.g., alkali or alkaline-earth metals, especially sodium, potassium, calcium ammonium or magnesium hydroxides, carbonates or bicarbonates, acyclic or cyclic amines, preferably methylamine, ethylamine, diethylamine, triethylamine, piperidine and the like.
  • Preferred compounds of the formula (I) are the compounds wherein X is a group -NR'- and R2 is a group selected from -NHR" and -N(OR"')R", wherein R" is hydrogen or an optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyl, cycloalkyl-alkyl, aryl, arylalkyl, heterocyclyl and heterocyclylalkyl; and R', R'", R1 , R3, R4 and A are as above defined.
  • R2 is a group selected from -NHR" and -N(OR"')R", wherein R" is hydrogen or an optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyl, cycloalkyl-alkyl, aryl, arylalkyl, heterocyclyl and heterocyclylalkyl; and R'", R1 , R3, R4 and A are as above defined.
  • X is a group -S- and R2 is a group selected from -NHR" and -N(OR"')R", wherein R" is hydrogen or an optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyl, cycloalkyl-alkyl, aryl, arylalkyl, heterocyclyl and heterocyclylalkyl; and R'", R1 , R3, R4 and A are as above defined.
  • R2 is a group selected from -NHR" and -N(OR"')R", wherein R" is hydrogen or an optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyl, cycloalkyl-alkyl, aryl, arylalkyl, heterocyclyl and heterocyclylalkyl; and R'", R1 , R3, R4 and A are as above defined.
  • R2 is a group -NHR" or - N(OR"')R", wherein R" is hydrogen or an optionally substituted group selected from straight or branched C1-C4 alkyl group and aryl; and R1 is an optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyl, cycloalkyl-alkyl, aryl, arylalkyl, heterocyclyl and heterocyclylalkyl; and R', R'", R3, R4 and A are as above defined.
  • R2 is a group -NHR" or - N(OR"')R", wherein R" is hydrogen or an optionally substituted group selected from straight or branched C1-C4 alkyl group and aryl; and R1 is an optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyl, cycloalkyl-alkyl, aryl, arylalkyl, heterocyclyl and heterocyclylalkyl; and R'", R3, R4 and A are as above defined.
  • R2 is a group -NHR" or - N(OR"')R", wherein R" is hydrogen or an optionally substituted group selected from straight or branched C1-C4 alkyl group and aryl; and R1 is an optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyl, cycloalkyl-alkyl, aryl, arylalkyl, heterocyclyl and heterocyclylalkyl; and R'", R3, R4 and A are as above defined.
  • R2 is a group -NHR" or - N(OR"')R", wherein R" is hydrogen or an optionally substituted group selected from straight or branched C1-C4 alkyl group and aryl; and R1 is an optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyl, cycloalkyl-alkyl, aryl, arylalkyl, heterocyclyl and heterocyclylalkyl; and R'", R3, R4 and A are as above defined.
  • Preferred specific compounds of the formula (I) or a salt thereof are the compounds listed below:
  • the present invention also provides a process for the preparation of a compound of formula (I) as defined above, by using the reaction routes and synthetic schemes described below, employing the techniques available in the art and starting materials readily available.
  • the preparation of certain embodiments of the present invention is described in the examples that follow, but those of ordinary skill in the art will recognize that the preparations described may be readily adapted to prepare other embodiments of the present invention.
  • the synthesis of non- examplified compounds according to the invention may be performed by modifications apparent to those skilled in the art, for instance by appropriately protecting interfering groups, by changing to other suitable reagents known in the art, or by making routine modifications of reaction conditions.
  • other reactions referred to herein or known in the art will be recognized as having adaptability for preparing other compounds of the invention.
  • a process of the present invention comprises the following steps: st.A) reacting a compound of formula (II)
  • R2 is an optionally substituted alkoxy (for example methoxy, ethoxy or t-butoxy);
  • R2 is an optionally substituted alkoxy
  • R5 is an optionally substituted C1-C6 alkyl
  • R4 ⁇ A R2 (VIII) wherein R2 and R4 are as defined above;
  • R2, R3, R4 and A are as defined above;
  • L is OH or a group that optionally upon activation, may work as a suitable leaving group such as iodo, bromo, chloro or a sulfonate group (e.g. -OS(0)2CF3, -OS(0)2CH3 or -OS(0)2PhMe), and R3 is as defined in formula (I) except hydrogen;
  • R2 is an optionally substituted alkoxy
  • R3 and R4 are as defined in formula (I)
  • R2 is an optionally substituted alkoxy
  • R3 and R4 are as defined in formula (I)
  • X is a single bond or a divalent radical selected from -NR', -0- and -S-; and R1 and R' are as defined in formula (I), so as to obtain a compound of formula (I)
  • Ra and Rb are independently halogen atom, except bromine, hydrogen, nitro, cyano, C1-C6 alkyl, polyfluorinated alkyl, polyfluorinated alkoxy, alkenyl, alkynyl, hydroxyalkyl, aryl, arylalkyl, heterocyclyl, C3-C7 cycloalkyl, hydroxy, alkoxy, aryloxy, heterocyclyloxy, methylenedioxy, alkylcarbonyloxy, arylcarbonyloxy, cycloalkenyloxy, heterocyclylcarbonyloxy, alkylideneaminooxy, carboxy, alkoxycarbonyl, aryloxycarbonyl, cycloalkyloxycarbonyl, heterocyclyloxycarbonyl, amino, ureido, alkylamino, dialkylamino, arylamino, diarylamino, heterocyclyamino, formylamino, alkylcarbonyla
  • Ra, Rb and Rc are independently hydrogen, nitro, cyano, C1-C6 alkyi, polyfluorinated alkyi, polyfluorinated alkoxy, alkenyl, alkynyl, hydroxyalkyl, aryl, arylalkyl, heterocyclyl, C3-C7 cycloalkyl, hydroxy, alkoxy, aryloxy, heterocyclyloxy, methylenedioxy, alkylcarbonyloxy, arylcarbonyloxy, cycloalkenyloxy, heterocyclylcarbonyloxy, alkylideneaminooxy, carboxy, alkoxycarbonyl, aryloxycarbonyl, cycloalkyloxycarbonyl, heterocyclyloxycarbonyl, amino, ureido, alkylamino, dialkylamino, arylamino, diarylamino, heterocyclyamino, formylamino, alkylcarbonylamino, arylcarbon
  • Ra, Rb and Rc are as defined above, in presence of palladium
  • Ra and Rb are independently halogen atom, hydrogen, nitro, cyano, C1-C6 alkyi, polyfluorinated alkyi, polyfluorinated alkoxy, alkenyl, alkynyl, hydroxyalkyl, aryl, arylalkyl, heterocyclyl, C3-C7 cycloalkyl, hydroxy, alkoxy, aryloxy, heterocyclyloxy, methylenedioxy, alkylcarbonyloxy, arylcarbonyloxy, cycloalkenyloxy, heterocyclylcarbonyloxy, alkylideneaminooxy, carboxy, alkoxycarbonyl, aryloxycarbonyl, cycloalkyloxycarbonyl, heterocyclyloxycarbonyl, amino, ureido, alkylamino, dialkylamino, arylamino, diarylamino, heterocyclyamino, formylamino, alkylcarbonylamino, a
  • Ra and Rb are independently halogen atom, hydrogen, nitro, cyano, C1-C6 alkyi, polyfluorinated alkyi, polyfluorinated alkoxy, alkenyl, alkynyl, hydroxyalkyl, aryl, arylalkyl, heterocyclyl, C3-C7 cycloalkyl, hydroxy, alkoxy, aryloxy, heterocyclyloxy, methylenedioxy, alkylcarbonyloxy, arylcarbonyloxy, cycloalkenyloxy, heterocyclylcarbonyloxy, alkylideneaminooxy, carboxy, alkoxycarbonyl, aryloxycarbonyl, cycloalkyloxycarbonyl, heterocyclyloxycarbonyl, amino, ureido, alkylamino, dialkylamino, arylamino, diarylamino, heterocyclyamino, formylamino, alkylcarbonylamino, a
  • R1 is as defined above and Q is a suitable group such as -B(OH)2, -B(OAIk)2 , -Sn(Alk)4, ZnHal, or MgHal, which can undergo palladium mediated carbon bond formation:
  • an aldehyde of formula (II) is reacted with a phosphorane of formula (I II) in a suitable solvent such as, for instance, toluene, xylene, THF or Et20 at a temperature ranging from room temperature to reflux, and for a time ranging from 1 to about 12 hours.
  • a suitable solvent such as, for instance, toluene, xylene, THF or Et20
  • the above reaction is carried out in toluene at reflux so to obtain a compound of formula (IV).
  • a compound of formula (IV) is reacted with TOSMIC, in the presence of a base such as KOH, NaH, LiN(TMS)2 in a suitable solvent such as, for instance, toluene, THF or Et20 at a temperature ranging from -78 °C to room temperature, and for a time ranging from 1 to about 12 hours.
  • a base such as KOH, NaH, LiN(TMS)2
  • a suitable solvent such as, for instance, toluene, THF or Et20
  • the above reaction is carried out in presence of LiN(TMS)2 in THF at -78 °C, so as to obtain a compound of formula (V).
  • a base such as KOH, NaOH, LiOH or Na2C03
  • a suitable solvent such as, for instance, H2O, dioxane or admixtures thereof at a temperature ranging from 0°C to room temperature, and for a time ranging from 1 to about 24 hours.
  • the above reaction is carried out in presence of LiOH in a mixture dioxane/H20 at room
  • a compound of formula (VII) is reacted with a compound of formula (VIII), in the presence of AcONa or sodium ethylate in a suitable solvent such as, for instance, H2O, EtOH or AcOH at a temperature ranging from room temperature to reflux, and for a time ranging from 1 to about 24 hours.
  • a suitable solvent such as, for instance, H2O, EtOH or AcOH
  • the above reaction is carried out in presence of AcONa in H2O at reflux so as to obtain a compound of formula (VI) wherein R3 is hydrogen, R4 is as defined above except hydrogen, and R2 and A are as defined above.
  • a compound of formula (VI) wherein R4 is as defined in formula (I) may be converted into a compound of formula (IX) in presence of an TFAA or PPA in a suitable solvent such asTFA, at a temperature ranging from room temperature to reflux, and for a time ranging from 1 to about 8 hours.
  • a suitable solvent such asTFA
  • the above reaction is carried out in presence of TFAA in TFA at room temperature so as to obtain a compound of formula (IX).
  • step (st.E) of the process a compound of the formula (IX), wherein R3 is hydrogen atom, is reacted with a compound of formula (X), as defined above, wherein L is OH, in which case the Mitsunobu conditions can be employed, or a group that optionally upon activation may work as a leaving group, such as a halogen atom, a tosylate, mesylate or triflate.
  • the reaction can be accomplished using a dialkyl azodicarboxylate, such as diethylazodicarboxylate (DEAD), diisopropyl azodicarboxylate (DIAD) or the like, in the presence of a trialkyl or triaryl phosphine, preferably triphenyl phosphine in a suitable solvent such as tetrahydrofuran, 1 ,4-dioxane, 1 ,2-dimethoxyethane, acetonitrile.
  • a dialkyl azodicarboxylate such as diethylazodicarboxylate (DEAD), diisopropyl azodicarboxylate (DIAD) or the like
  • DEAD diethylazodicarboxylate
  • DIAD diisopropyl azodicarboxylate
  • a trialkyl or triaryl phosphine preferably triphenyl phosphine in a suitable solvent such as tetrahydro
  • L is an halogen or a group such as tosylate, mesylate or triflate or the like
  • the conversion can be accomplished using a suitable base such as, for instance, NaH, K2CO3, CS2CO3, DBU, KO-f-Bu and the like, in a suitable solvent such as tetrahydrofuran, acetonitrile, N,N-dimethylformamide, ⁇ , ⁇ -dimethylacetamide and the like.
  • Said reactions can be carried out at temperatures ranging from 0°C to reflux and for a time ranging from 30 minutes to about 48 hours.
  • step (st.F) of the process the compound of the formula (IX) is reacted with an N,N-dimethylformamide derivative for istance with a A/,A/-dimethylformamidederivative such as A/,A/-dimethylformamide-di-ferf-butylacetale, A/,A/-dimethylformamide-diisopropylacetale, A/,A/-dimethylformamide-dimethylacetale, A/,A/-dimethylformamide- diethylacetale or tris(dimethylamino)methane in a suitable solvent such as, for instance, DMF or toluene, at a temperature ranging from room temperature to reflux, and for a time ranging from about 1 to about 48 hours.
  • a suitable solvent such as, for instance, DMF or toluene
  • the reaction is carried out in presence of tris(dimethylamino)methane neat or in DMF at 90 °C to obtain a
  • step (st.G) of the process the compound of the formula (XI) is reacted with a derivative of formula (XII) wherein X is a single bond or a divalent radical selected from -NR'-, -0- and -S- wherein R' is
  • R1 is as defined in formula (I); so as to obtain a compound of the formula (I) as defined above wherein X and R1 are as defined above through pyrimidine ring formation in presence eventually of a base such as AcOK, K2CO3 or Na2C03 in a suitable solvent such as, for instance, DMF, EtOH or toluene, at a temperature ranging from room temperature to reflux, and for a time ranging from about 1 to about 48 hours.
  • a base such as AcOK, K2CO3 or Na2C03
  • a suitable solvent such as, for instance, DMF, EtOH or toluene
  • the reaction is carried out in presence of DMF at 120 °C.
  • microwave irradiation can be used instead of heating.
  • the compound of formula (I) wherein R3 is a group selected from methoxymethyl or p-methoxybenzyl may be converted into another compound of the formula (I) wherein R3 is hydrogen atom by reaction in acidic conditions, for instance with AcOH, TFA or HCI or in basic conditions, for istance NaOH and in the presence of a suitable solvent such as MeOH, DCM or dioxane, at a temperature ranging from room temperature to reflux and for a time ranging from 1 to about 12 hours.
  • acidic conditions for instance with AcOH, TFA or HCI or in basic conditions, for istance NaOH and in the presence of a suitable solvent such as MeOH, DCM or dioxane
  • a compound of the formula (I), wherein R3 is hydrogen atom may be converted into a compound of formula (I), wherein R2 is as defined above except hydrogen atom, by reaction with a suitable compound of the formula (X) as defined above, when L is OH, in which case the Mitsunobu conditions can be employed, or a group that optionally upon activation may work as a leaving group, such as an halogen atom, a tosylate, mesylate or triflate.
  • the reaction can be accomplished using a dialkyl azodicarboxylate, such as diethylazodicarboxylate (DEAD), diisopropyl azodicarboxylate (DIAD) or the like, in the presence of a trialkyl or triaryl phosphine, preferably triphenyl phosphine in a suitable solvent such as tetrahydrofuran, 1 ,4-dioxane, 1 ,2-dimethoxyethane, acetonitrile.
  • a dialkyl azodicarboxylate such as diethylazodicarboxylate (DEAD), diisopropyl azodicarboxylate (DIAD) or the like
  • DEAD diethylazodicarboxylate
  • DIAD diisopropyl azodicarboxylate
  • a trialkyl or triaryl phosphine preferably triphenyl phosphine in a suitable solvent such as tetrahydro
  • L is an halogen or a group such as tosylate, mesylate or triflate or the like
  • the conversion can be accomplished using a suitable base such as, for instance, NaH, K2CO3, CS2CO3, DBU, KO-f-Bu and the like, in a suitable solvent such as tetrahydrofuran, acetonitrile, N,N-dimethylformamide, ⁇ , ⁇ -dimethylacetamide and the like.
  • Said reactions can be carried out at temperatures ranging from 0°C to reflux and for a time ranging from 30 minutes to about 48 hours.
  • a compound of the formula (I) wherein R2 is OR5 wherein R5 is an optionally substituted alkyl may be converted into the corresponding carboxylic acid derivative of the formula (I) wherein R2 is hydroxyl or their corresponding salts through basic or acidic hydrolysis conditions, widely known in the art.
  • the reaction is carried out in presence of NaOH in dioxane/H20 at reflux.
  • the compound of formula (I) wherein R2 is hydroxy or a corresponding salt may be converted into a derivative of the formula (I) wherein R2 is a group NR"R"' or N(OR"')R" wherein R" and R'" are as defined in formula (I).
  • the reaction is carried out in presence of a compound of formula either (XIII) or (XIV) as defined above in presence of a base for example, with DIPEA or TEA, in a suitable solvent such as DCM, DMF, THF, or dioxane, and in the presence of a suitable condensing agent such as DCC, EDCI or TBTU; catalytic amounts of PyBOP or HOBt may be also required.
  • a suitable solvent such as DCM, DMF, THF, or dioxane
  • a suitable condensing agent such as DCC, EDCI or TBTU
  • catalytic amounts of PyBOP or HOBt may be also required.
  • the reaction is carried out in presence of DIPEA and TBTU in DMF at room temperature.
  • the same conversion may be obtained by first reacting the compound of formula (I) wherein R2 is hydroxy or the corresponding salt with a chlorinating agent for istance oxalyl dichloride or SOC in a suitable solvent, for instance DCM, Toluene, THF, dioxane or DMF, at a temperature ranging from room temperature to 100°C so to obtain the corresponding chloride derivative.
  • a chlorinating agent for istance oxalyl dichloride or SOC in a suitable solvent, for instance DCM, Toluene, THF, dioxane or DMF, at a temperature ranging from room temperature to 100°C so to obtain the corresponding chloride derivative.
  • a suitable solvent for instance DCM, Toluene, THF, dioxane or DMF
  • a compound of the formula (I) wherein R2 is OR5 wherein R5 is an optionally substituted alkyl is reacted with a suitable compound of the formula (XIII) or (XIV) as defined above, in the presence of a base such as NaH, NaN(TMS)2 or LiN(TMS)2 in a suitable solvent, for instance Et20, THF or dioxane, at a temperature ranging from -10 °C to 40°C, and for a time ranging from about 10 minutes to about 12 hours, so to obtain another compound of the formula (I) wherein R2 is an amino group of formula -NR"R"' or -N(OR"')R".
  • the reaction is carried out in presence of LiN(TMS)2 in THF at 0 °C.
  • the compound of formula (I) as defined above is reacted with compounds of the formula (XV) as defined above, according to conventional methods.
  • the reaction can be carried out in a suitable solvent such as DMF, DME, dioxane or CH3CN and in the presence of an optionally- substituted-aryliodine of the formula (XV) as defined above, catalytic amounts of Pd2(dba)3, BINAP or 2- (dicyclohexylphosphino)-2',4',6'-triisopropyl-1 ,1 '-biphenyl (X-phos) and a base such as K2CO3, potassium phosphate or CS2CO3, at a temperature ranging from room temperature to 110 °C and for a time ranging from 2 to about 24 hours.
  • a suitable solvent such as DMF, DME, dioxane or CH3CN
  • an optionally- substituted-aryliodine of the formula (XV) as defined above cata
  • deprotection of the carboxylic residue into the corresponding acid can be achieved using procedure well known in the art in acidic condition for example with HCI or TFA in a suitable solvent, for instance, THF or dioxane, at a temperature ranging from room temperature to 60°C and for a time ranging from about 1 to about 12 hours.
  • a suitable solvent for instance, THF or dioxane
  • transformation of the acid residue into the corresponding amide derivatives -CONR"R"', wherein R" and R'" are as defined above can be obtained by reaction of the acid derivatives with an amine of the formula (XIII) as defined above, under basic conditions, preferably with DIPEA or TEA, in a suitable solvent such as DCM, DMF, THF, or dioxane, and in the presence of a suitable condensing agent such as DCC, EDCI or TBTU; catalytic amounts of PyBOP or HOBt may be also required, at a temperature ranging from room temperature to 60°C and for a time ranging from about 1 to about 24 hours.
  • a suitable solvent such as DCM, DMF, THF, or dioxane
  • a suitable condensing agent such as DCC, EDCI or TBTU
  • catalytic amounts of PyBOP or HOBt may be also required, at a temperature ranging from room temperature to 60°C and for a time ranging from about
  • compounds of formula (I) wherein R1 is iodine and X is a single bond may be prepared by the corresponding compounds of formula (I) wherein R1 is hydrogen and X is -NH-; the reaction carried out using iso-amylnitrite and diiodomethane or cesium iodide, in the presence of iodine and Cul in a suitable solvent such as THF, Et20 or DME, at a temperature ranging from room temperature to about 70°C, and for a time of about 8 hours to about 48 hours.
  • a suitable solvent such as THF, Et20 or DME
  • replacement of the iodine with an arylamine of formula RI-NH2 may be carried out in a suitable solvent such as DMF, DME or CH3CN and in the presence of catalytic amounts of Pd(OAc)2, BINAP or Xantphos and a base such as K2CO3, potassium phosphate or CS2CO3, at a temperature ranging from room temperature to 110°C and for a time ranging from about 2 to about 24 hours.
  • replacement of the iodine with group of formula R1 may be carried out by exploiting any of the cross-coupling reactions suitable for the formation of carbon-carbon bonds.
  • Said reactions which are well known in the art, imply coupling with a suitable organometal reagent such as for instance organoboron (Suzuki reaction), organotin (Stille reaction), organomagnesium (Kumada reaction), or organozinc (Negishi reaction) and the like.
  • Preferred reaction is the Suzuki reaction where the appropriate aryl or heteroharylboronic derivative is used in the presence of a palladium based catalyst such as PdC ⁇ dpp ChbC or Pd2(dba)3 or Pd(PPhi3)4, in a suitable solvent such as DMF, DCM, MeOH, CH3CN, or in a mixture of solvents, such as dimethoxyethane and water, optionally in the presence of a base such as sodium, cesium carbonate or cesium fluoride, at a temperature ranging from room temperature to 100°C.
  • a palladium based catalyst such as PdC ⁇ dpp ChbC or Pd2(dba)3 or Pd(PPhi3)4
  • a suitable solvent such as DMF, DCM, MeOH, CH3CN, or in a mixture of solvents, such as dimethoxyethane and water
  • a base such as sodium, cesium carbonate or cesium fluoride
  • the transformation of thio group into the sulfonyl group can be obtained by reaction with an oxidant agent well-known to those skilled in the art, such as for instance, oxone in a suitable solvent such as tetrahydrofuran, 1 ,4-dioxane, acetone, optionally in the presence of water as co-solvent or m-chloroperbenzoic acid in the presence of a suitable solvent preferably DCM at room temperature.
  • an oxidant agent well-known to those skilled in the art, such as for instance, oxone in a suitable solvent such as tetrahydrofuran, 1 ,4-dioxane, acetone, optionally in the presence of water as co-solvent or m-chloroperbenzoic acid in the presence of a suitable solvent preferably DCM at room temperature.
  • the replacing of the sulfonyl group with a suitable amino derivative is preferably carried out with an amine of formula R1-NHR' (XVIa) in the presence of DMF, DME, dioxane, CH3CN, N-methyl-pyrrolidone or diglyme, at a temperature ranging from room temperature to about 100°C.
  • the replacing of the sulfonyl group may be easily obtained by reaction with an alcohol or phenol derivative of formula (XVIII).
  • the reaction may be carried out in the presence of a base such as K2CO3 or Na2C03, butyl lithium, LiN(TMS)2, NaH or the like, in a suitable solvent such as DMF or THF, and by working at a temperature ranging from room temperature to about 100°C.
  • the removing of the methyl residue may be obtained in presence of trimethylsilylchloride and sodium iodide.
  • the reaction may be carried out in a suitable solvent such as CH3CN, and by working at a temperature ranging from room temperature to about relfux.
  • conversion (conv.17) of the process compounds with a trifluoromethanesulfonyl group may be obtained by reacting the compounds of formula (I) wherein X is -0- and R1 is hydrogen with a triflating agent such as trifluoromethanesulfonic anhydride, trifluoromethanesulfonylchloride or N-phenyl-bis(trifluoromethanesulfonimide), optionally in the presence of a base such as TEA or DIPEA, in a suitable solvent such as DCM, THF or dioxane at a temperature ranging from -78°C to room temperature.
  • a triflating agent such as trifluoromethanesulfonic anhydride, trifluoromethanesulfonylchloride or N-phenyl-bis(trifluoromethanesulfonimide
  • the reaction may be carried out with an alcohol of formula (XVIII), by operating in a suitable solvent such as dioxane, THF, DME, CH3CN, DMF or DMSO, at a temperature ranging from room temperature to about 90°C, optionally in the presence of a base such as K2CO3, potassium tert butoxide or NaH.
  • a suitable solvent such as dioxane, THF, DME, CH3CN, DMF or DMSO
  • reaction may be carried out in a suitable solvent such as toluene, DMF, DME or CH3CN, in the presence of Pd(OAc)2, (+)-BINAP and a base such as potassium phosphate or K2CO3 or CSCO3 at a temperature ranging from 0°C to 100°C.
  • a suitable solvent such as toluene, DMF, DME or CH3CN
  • compounds of formula (I) wherein R1 is as defined in formula (I) except hydrogen and X is -NR'- can be obtained from the corresponding trifluoromethanesulfonyl compounds with an amine of formula R1-NHR' (XVIa).
  • the reaction is typically obtained by operating in a suitable solvent such as dioxane, THF, DME, CH3CN, DMF or DMSO, at a temperature ranging from room temperature to 90°C, optionally in the presence of a base such as K2CO3 or TEA.
  • a compound of formula (I) wherein A is -(CH 2 ) 2 - can undergo dehydrogenation in the presence of an optionally supported palladium or platinum or 2,3-Dichloro-5,6-dicyano-1 ,4- benzoquinone (DDQ), so as to obtain the corresponding aromatic derivative of formula (I), by operating in a suitable solvent such as toluene, 1 ,4-dioxane, chlorobenzene, dichlorobenzene, at a temperature ranging from 90°C to reflux, for a time varying between 2 hours to 8 hours.
  • DDQ 2,3-Dichloro-5,6-dicyano-1 ,4- benzoquinone
  • a compound of formula (I) wherein R4 is hydrogen and A is - (CH 2 )2- can be reacted with an excess of N-iodosuccinimde in DMF at room temperature so to obtain a compound of formula (XX) which is subsequently dehalogenated in presence of a palladium catalyst, for example Tetrakis (triphenylphosphine) Palladium and sodiumformiate so as to obtain the corresponding aromatic derivative of formula (I) by operating in a suitable solvent such as A/,A/-dimethylformamide, at a temperature ranging from 90°C to reflux, for a time varying between 2 hours to 8 hours.
  • a palladium catalyst for example Tetrakis (triphenylphosphine) Palladium and sodiumformiate
  • the deprotection of the nitrogen atom of a compound of formula (I) wherein R' is a protecting group can be accomplished according to conventional methods enabling the selective hydrolysis of ferf-butoxycarbonyl, benzyl, 4-methoxybenzyl, 2,4-dimethoxybenzyl, and triphenylmethyl protective groups.
  • this reaction is run under acidic conditions, for instance in the presence of an inorganic or organic acid such as hydrochloric, trifluoroacetic or methansulfonic acid, in a suitable solvent such as DCM, 1,4-dioxane, a lower alcohol, such as methanol or ethanol, at a temperature ranging from room temperature to reflux and for a period of time ranging from about 1 hour to about 48 hours.
  • an inorganic or organic acid such as hydrochloric, trifluoroacetic or methansulfonic acid
  • a suitable solvent such as DCM, 1,4-dioxane, a lower alcohol, such as methanol or ethanol
  • the starting material and any other reactant is known or easily prepared according to known methods.
  • the compound of the formula (II) wherein A is -CH 2 - and R5 is methyl is commercially available.
  • the compound of the formula (II) wherein A is -(CH2)2- and R5 is methyl can be prepared as described in J. Org. Chem., 1998 ,63(5), 1668.
  • the HPLC equipment consisted of a Waters AcquityTM UPLC system equipped with a Waters 2996 PDA detector, a Waters Acquity ELSDTM detector and Waters mod. SQD single quadrupole mass spectrometer, equipped with an electrospray (ESI) ion source. Instrument control, data acquisition and data processing were provided by Empower 2 and MassLynx 4.1 softwares.
  • HPLC HPLC was carried out at 45°C at a flow rate of 0.7 mL/min using a Waters AcquityTM BEH C 18, 1.7 microm, 50 x 2.1 mm column.
  • Mobile phase A was 0.1 % trifluoro acetic acid in H2O/ CH3CN (95:5), and mobile phase B was H2O/CH3CN (5:95); the gradient was from 5 to 95% B in 2 minutes then hold 95% B 0.1 minutes.
  • the injection volume was 0.8 microL.
  • the mass spectrometer was operated in positive and in negative ion mode, the capillary voltage was set up at 3 KV (ES + and ES ); cone was 30 V (ES + and ES ); the source temperature was 120°C; full scan, mass range from 100 to 800 amu was set up.
  • HPLC HPLC
  • HT 2795 Waters AllianceTM HT 2795 system equipped with a Waters 2996 PDA detector and Waters mod.
  • ZQ 2000 single quadrupole mass spectrometer equipped with an electrospray (ESI) ion source.
  • Instrument control, data acquisition and data processing were provided by Empower 2 and MassLynx 4.1 softwares.
  • HPLC was carried out at 25°C at a flow rate of 1.0 mL/min using a Phenomenex Gemini C18, 3 microm, 50 x 4.6 mm column.
  • the injection volume was 10 microL.
  • the mass spectrometer was operated in positive and in negative ion mode, the capillary voltage was set up at 3.5 kV (ES + ) and 2.8 kV (ES ); cone voltage was 14 V (ES + ) and 28 V (ES ); the source temperature was 120°C; full scan, mass range from 100 to 800 amu was set up.
  • HPLC HPLC
  • a Waters 2790 HPLC system equipped with a 996 Waters PDA detector and Waters mod.
  • ZQ 2000 single quadrupole mass spectrometer equipped with an electrospray (ESI) ion source.
  • Instrument control, data acquisition and data processing were provided by Empower 2 and MassLynx 4.1 software.
  • HPLC was carried out at 25°C at a flow rate of 1 mL/min using a RP18 Waters X Terra 3 microm (3.0 x 20 mm) column.
  • the injection volume was 10 microL.
  • the mass spectrometer was operated in positive and in negative ion mode, the capillary voltage was set up at 2.5 KV; the source temperature was 120°C; cone was 10 V; full scan, mass range from 100 to 800 amu was set up.
  • HPLC HPLC
  • Mobile phase B was CH3CN; the gradient was from 10 to 90% B in 15 minutes then hold 90% B 3 minutes.
  • the injection volume was 200 microL.
  • the mass spectrometer was operated in positive and in negative ion mode, the capillary voltage was set up at 2.5 KV; the source temperature was 120°C; cone was 10 V; full scan, mass range from 100 to 800 amu was set up.
  • the HPLC equipment consisted of a FractionLynxTM System equipped with a 2996 Waters PDA detector and Waters mod. ZQ 2000 single quadrupole mass spectrometer, equipped with an electrospray (ESI) ion source. Instrument control, data acquisition and data processing were provided by Empower 2 and MassLynx 4.1 software.
  • HPLC HPLC was carried out at 25°C at a flow rate of 20 mL/min using a RP18 Waters X Terra 10 microm (19 x 250 mm) column.
  • Mobile phase A was 0.1% TFA in H2O /CH3CN (95:5), and mobile phase B was CH3CN; the gradient was from 10 to 90% B in 15 minutes then hold 90% B 3 minutes.
  • the injection volume was 200 microL.
  • the mass spectrometer was operated in positive and in negative ion mode, the capillary voltage was set up at 2.5 KV; the source temperature was 120°C; cone was 10 V; full scan, mass range from 100 to 800 amu was set up.
  • MS exact Exact mass data ESI(+) were obtained on a Waters Q-Tof Ultima directly connected with micro HPLC 1100 Agilent as previously described (M. Colombo, F. Riccardi-Sirtori, V. Rizzo, Rapid Commun. Mass Spectrom. 2004, 18, 511- 517).
  • 6-amino-5-oxohexanoic acid hydrochloride (9.73 g, 49.8 mmol) was dissolved in H2O (35 mL), and ethyl acetoacetate (5.51 g, 42.34 mmol) and AcONa (20.3 g, 14.95 mmol) were added to the above-mentioned solution.
  • the reaction solution was refluxed for 1 h, cooled to room temperature and 0.5N HCI was added until a pH of about 5 was reached.
  • the combined organic layers were anidrified on Na2S04, filtered and concentred to give 7.15 g (yield: 60 %) of the title compound as brown solid.
  • Methyl 1-methyl-7-oxo-4,5,6,7-tetrahydro-1 H-indole-3-carboxylate (288 mg, 1.39 mmol) was treated with tris(dimethylamino)methane (2.4 mL, 13.9 mmol) and the reaction mixture was stirred at 90 °C for 10 h. Volatiles were removed under reduced pressure and the residue used without further purification.
  • Ethyl 8-methyl-2-(methylsulfanyl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxylate (110 mg, 0.36 mmol) was suspended in dioxane (10 mL) and treated with a 2 N solution of NaOH (4.0 ml, 8 mmol) at 95°C for 18 h. H 2 0 (20 mL) was added and the solution was acidified with HCI 2N. The mixture was portioned between ethyl acetate and water, the organic layer was dried over Na2S04, filtered and concentrated, to provide 95 mg (95%) of the title compound as off-white solid.
  • Methyl 9-methyl-2-(methylsulfanyl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxylate (50 mg, 0.174 mmol) was suspended in dioxane (5 mL) and treated with a 2 N solution of NaOH (2.0 mL, 4 mmol) at 95°C for 2 h. H 2 0 (20 mL) was added and the solution was acidified (pH ⁇ 6) with HCI 2N. The solid was filtrated and washed with water and diethyl ether to provide 40 mg (85%) of the title compound as off-white solid.
  • the compounds of the formula (I) are active as protein kinase inhibitors and are therefore useful, for instance, to restrict the unregulated proliferation of tumour cells.
  • tumours such as those formerly defined, as well as in the treatment of other cell proliferative disorders such as benign prostate hyperplasia, familial adenomatosis polyposis, neurofibromatosis, psoriasis, vascular smooth cell proliferation associated with atherosclerosis, pulmonary fibrosis, arthritis, glomerulonephritis and post-surgical stenosis and restenosis.
  • other cell proliferative disorders such as benign prostate hyperplasia, familial adenomatosis polyposis, neurofibromatosis, psoriasis, vascular smooth cell proliferation associated with atherosclerosis, pulmonary fibrosis, arthritis, glomerulonephritis and post-surgical stenosis and restenosis.
  • MPS1 full length (corresponding to residues 2-857 of the full length sequence, see Swiss-Prot accession number P33981) was PCR amplified from the full-length human MPS1 gene present in house as clone pGEX4t_MPS1. Amplification was performed using the forward oligonucleotide:
  • the oligonucleotides included attB sites in order to obtain an aiffi-flanked PCR product suitable for cloning using the Gateway® technology (Invitrogen). Furthermore, for purification purposes, forward primer included a protease cleavage site. The resulting PCR product was cloned in the pDONR201 plasmid and then transferred in the baculovirus expression vector pVL1393GST (Invitrogen) Gateway®-modified. Cloning was performed according to the protocols described in the Gateway® manual.
  • Baculoviruses were generated by cotransfecting Sf9 insect cells with the expression vector and the viral DNA using the BaculoGold® transfection kit (Pharmingen). Viral supernatant was recovered after 5 days and subjected to 3 rounds of amplification to increase viral titer. Recombinant protein was produced by infecting High5 insect cells. After 72 hours of infection at 21 °C, cells were recovered, pelletted and freezed at -80°C.
  • pellet was thawed, resuspended in lysis buffer (PBS, NaCI 150 mM, Glycerol 10%, CHAPS 0.1 %, DTT 20 mM, protease and phosphatase inhibitors) and lysed by Gaulin. Lysate was cleared by centrifugation and loaded on a GST affinity column. After extensive wash, recombinant protein was cleaved by a specific protease and eluted by incubation.
  • lysis buffer PBS, NaCI 150 mM, Glycerol 10%, CHAPS 0.1 %, DTT 20 mM, protease and phosphatase inhibitors
  • the protein was then subjected to auto-phosphorylation in presence of ATP 1 mM at 25°C for 2 hours in kinase buffer (Hepes pH7.5 50 mM, MgCI 2 2.5 mM, MnCI 2 1 mM, DTT 1 mM, phosphatase inhibitors); ATP was then removed whit a desalting column.
  • kinase buffer Hepes pH7.5 50 mM, MgCI 2 2.5 mM, MnCI 2 1 mM, DTT 1 mM, phosphatase inhibitors
  • the inhibitory activity of putative kinase inhibitors and the potency of selected compounds were determined using a trans-phosphorylation assay.
  • Specific peptide or protein substrates are trans-phosphorylated by their specific ser-thr or tyr kinase in the presence of ATP traced with 33 ⁇ - ⁇ - ⁇ , and in the presence of their own optimal buffer and cofactors.
  • the resin is allowed to settle down (some hours) and then the supernatant is discarded.
  • the resin After three washes as above over a couple of days, the resin is allowed to settle and two volumes (wrt the resin volume) of 150 mM sodium formate buffer are added.
  • the pH is then measured and should be around 3.00
  • the washed resin is stable for more than one week; the stock resin is kept at 4° C before use.
  • the buffer for MPS1 assay was composed of HEPES 50 mM, at pH 7.5, with 2.5 mM MgCI 2 , 1 mM MnCI 2 , 1 mM DTT, 3 microM Na 3 V0 4 , 2 mM ⁇ -glycerophosphate and 0.2 mg/mL BSA.
  • the assay was run with a final concentration MPS1 of 5 nM, in the presence of 15 microM ATP and 1.5 nM 33 ⁇ - ⁇ - ATP; the substrate was ⁇ 38- ⁇ ⁇ , used at 200 microM.
  • the test mix consisted of:
  • HTS percent inhibition studies
  • An automated station for serial dilutions (Biomek FX, Beckman) is used for producing 1 :3 dilutions in 100 % DMSO, from line A1 to A10, and for all the seven compounds in the column. Moreover, 4-5 copies of daughter plates are prepared by reformatting 5 microL of this first set of 100% DMSO dilution plates into 384 deep well-plates: one copy of the daughter plates with the serial dilutions of test compounds will be thaw the day of the experiments, reconstituted at a 3X concentration with water and used in the IC50 determination assays. In a standard experiment, the highest concentration (3X) of all compounds is 30 microM, while the lowest one is 1.5 nM.
  • Each 384 well-plate will contain reference wells (total enzyme activity vs. no enzymatic activity) for the 71 and signal to background evaluation.
  • 384-well plates, V bottom (test plates) are prepared with 5 microL of the compound dilution (3X) and then placed onto a PlateTrak 12 robotized station (Perkin Elmer; the robot has one 384-tips pipetting head for starting the assay plus one 96-tips head for dispensing the resin) together with one reservoir for the Enzyme mix (3X) and one for the ATP mix (3X).
  • the robot Aspirates 5 microL of ATP mix, makes an air gap inside the tips (2 microL) and aspirates 5 microL of MPS1 mix .
  • the following dispensation into the plates allows the kinase reaction to start upon 3 cycles of mixing, done by the robot itself.
  • the robot incubates the plates for 60 minutes at room temperature, and then stops the reaction by pipetting 70 microL of dowex resin suspension into the reaction mix. Three cycles of mixing are done immediately after the addition of the resin.
  • the resin suspension is very dense; in order to avoid tip clogging, wide bore tips are used to dispense it.
  • A2780 human ovarian cancer cells, MCF7 human breast cancer cells and MV-4-11 (biphenotypic B myelomonocytic leukemia) cells (1250 cells/well) were seeded in white 384 well-plates in complete medium (RPMI 1640 or EMEM plus 10% Fetal bovine serum) and treated with compounds dissolved in 0.1 % DMSO, 24h after seeding. The cells were incubated at 37°C and 5 % CO2 and after 72 hours the plates were processed using CellTiter-Glo assay (Promega) following the manufacturer's instruction.
  • CellTiter-Glo is a homogenous method based on the quantification of the ATP present, an indicator of metabolitically active cells. ATP is quantified using a system based on luciferase and D-luciferin resulting into light generation. The luminescent signal is proportional to the number of cells present in culture.
  • Inhibitory activity was evaluated comparing treated versus control data using Assay Explorer (MDL) program.
  • IC50 was calculated using sigmoidal interpolation curve.
  • the compounds of the formula (I) of the invention resulted to possess a good MPS1 inhibitory activity, tipically with an IC50 in the range between 0.001 and 5 microM.
  • the compounds of the formula (I) of the invention show good cellular proliferation inhibitory activity, tipically with an IC50 in the range of from 0.010 to 5 ⁇ in A2780 cells.
  • the inhibitory activity of putative kinase inhibitors and the potency of selected compounds were determined using a trans-phosphorylation assay.
  • Specific peptide or protein substrates are trans-phosphorylated by their specific ser-thr or tyr kinase in the presence of ATP traced with 33 ⁇ - ⁇ - ⁇ , and in the presence of their own optimal buffer and cofactors.
  • the resin is allowed to settle down (some hours) and then the supernatant is discarded.
  • the resin After three washes as above over a couple of days, the resin is allowed to settle and two volumes (wrt the resin volume) of 150 mM sodium formate buffer are added.
  • the pH is then measured and should be around 3.00
  • the washed resin is stable for more than one week; the stock resin is kept at 4° C before use.
  • the buffer for PIM-1 assay was composed of HEPES 50 mM, at pH 7.5, with 10 mM MgCI 2 , 1 mM DTT, 3 microM NaV0 3 , and 0.2 mg/ml BSA
  • the enzyme showed a linear kinetic after a step of pre-activation by auto-phosphorylation in the following conditions: 1.7 microM PIM1 was incubated 1 hour RT at 28° C in the presence of 125 microM ATP
  • Substrate concentration Aktide (Chemical Abstract Service Registry Number 324029-01-8) : 25 microM
  • the test mix consisted of:
  • test compounds are received as a 1 mM solution in 100% DMSO and distributed into 96-well plates: compounds are then plated into the first column of a new 96-well plate (A1 to G1), 100 microL/well.
  • An automated station (Biomek FX, Beckman) is used for serial dilutions, producing 1 :3 dilutions in 100 % DMSO, from line A1 to A10, for all the compounds in the column. Moreover, 4-5 copies of daughter plates are prepared by reformatting 5 microL of this first set of 100% DMSO dilution plates into 384-deep well plates: one copy of these serial dilution plates with the test compounds is thawed on the day of study, reconstituted at the working concentration (3-fold the final concentration) with 162 microL/well of water and used for IC50 determination assays. In a standard experiment, the highest concentration (3X) of compounds is typically 30 microM, while the lowest one is typically 1.5 nM.
  • Each 384-well plate generates at least one curve of the standard inhibitor staurosporine and reference wells (total enzyme activity vs. no enzymatic activity) for evaluation of 71 and signal to background (S/B) ratio.
  • 384-well plates, V bottom (test plates) are prepared with 5 microL of compound diluted as previously described (3X) and then placed onto a PlateTrak 12 robotized station (Perkin Elmer; the robot has one 384-tip pipetting head for assay start, plus one 96-tip head for dispensing resin) together with one reservoir for Enzyme mix (3X) and one for ATP mix (3X).
  • Data are analyzed by an internally customized version of the "Assay Explorer" SW package, which provides sigmoidal fitting of the ten-dilution curves for IC50 determination in secondary assay/hit confirmation routines.
  • the buffer for PIM-2 assay was composed of HEPES 50 mM, at pH 7.5, with 1 mM MgCI 2 , 1 mM DTT, 3 microM Na 3 V0 4 , and 0.2 mg/mL BSA
  • Table A reports the experimental data of some representative compounds of the invention of formula (I) being tested on the MPS1 , PIM-1 and PIM-2 enzymes in the specific in vitro kinase assays above described (IC50 microM) .
  • compound 1 , 2, 3 and 4 corresponds rescpectively to compounds coded M3, N9, N4 and N10 in the patent application WO2008/065054 cited above; these compounds correspond respectively to the third, the fifth, the seventh and the sixth disclaimed compounds of the present invention.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Biomedical Technology (AREA)
  • Neurology (AREA)
  • Pulmonology (AREA)
  • Neurosurgery (AREA)
  • Oncology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Dermatology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Rheumatology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Psychiatry (AREA)
  • Pain & Pain Management (AREA)
  • Virology (AREA)
  • Communicable Diseases (AREA)
  • Transplantation (AREA)
  • Hematology (AREA)

Abstract

The present invention relates to tricyclic pyrrolo derivatives of Formula (I), which modulate the activity of protein kinases and are therefore useful in treating diseases caused by dysregulated protein kinase activity. The present invention also provides methods for preparing these compounds, pharmaceutical compositions comprising these compounds, and methods of treating diseases utilizing such these compounds or the pharmaceutical compositions containing them.

Description

TRICYCLIC PYRROLO DERIVATIVES, PROCESS FOR THEIR PREPARATION AND THEIR USE AS KINASE INHIBITORS
The present invention relates to tricyclic pyrrolo derivatives, to a process for their preparation, to pharmaceutical compositions comprising them, and to their use as therapeutic agents, particularly in the treatment of cancer and cell proliferation disorders.
The compounds of this invention are therefore useful in treating diseases caused by dysregulated protein kinase activity. The present invention also provides methods for preparing these compounds, pharmaceutical compositions comprising these compounds, and methods of treating diseases utilizing pharmaceutical compositions comprising these compounds.
The malfunctioning of protein kinases (PKs) is the hallmark of numerous diseases. A large share of the oncogenes and proto-oncogenes involved in human cancers encode for PKs. The enhanced activities of PKs are also implicated in many non-malignant diseases, such as benign prostate hyperplasia, familial adenomatosis, polyposis, neuro- fibromatosis, psoriasis, vascular smooth cell proliferation associated with atherosclerosis, pulmonary fibrosis, arthritis glomerulonephritis and post-surgical stenosis and restenosis.
PKs are also implicated in inflammatory conditions and in the multiplication of viruses and parasites. PKs may also play a major role in the pathogenesis and development of neurodegenerative disorders.
For a general reference to PKs malfunctioning or deregulation see, for instance, Current Opinion in Chemical Biology 1999, 3, 459 - 465 and Carcinogenesis 2008, 29, 1087-1091.
The use of mitotic inhibitors in cancer therapy is a widely accepted clinical strategy for the treatment of a broad range of human cancers. Taxanes (Paclitaxel and Docetaxel) and Vinca Alkaloids (Vincristine and Vinblastine) work by either stabilizing or destabilizing microtubules with catastrophic consequences in cells progressing through mitosis. They are first line therapeutics for several tumour types and second line in cisplatin-refractory ovarian, breast, lung, bladder and esophagus cancers (Taxanes). However, due to the role of microtubules in processes such as cell movement, phagocytosis and axonal transport certain toxicities such as peripheral neuropathy are frequently observed with these agents. Progression through mitosis is a requirement of all proliferating cells and hence cancer therapies that have targets in mitosis are generally applicable to a wide range of tumour types.
Several protein kinases play key roles in the orchestration of the cell cycle and some of them are already subject to targeted therapies in the oncology setting including Cdk-2 and Aurora-A. The fidelity of mitosis is of paramount importance and several "checkpoints" exist in normal cells to maintain chromosome integrity during the cell cycle. The Spindle Assembly Checkpoint (SAC) is specifically required for proper chromosomal segregation into the two daughter cells upon cellular division. It ensures that sister chromatids aligned at the metaphase plate do not separate prior to the bipolar attachment of all duplicated chromosomes to the mitotic spindle (Reviewed in Musacchio A. and Salmon D. Nat Rev Mol Cell Biol, May;8(5): 379-93, 2007).
Even a single un-aligned chromosome is sufficient to trigger the SAC signal, it is a tightly regulated pathway that ultimately results into the inhibition of the anaphase promoting complex/cyclosome (APC/C)-mediated polyubiquitylation and degradation of two key mitotic components: cyclin B1 and Securin. Securin specifically is required to get sister chromatids separation and anaphase transition, instead cyclin B1 inactivates the master mitotic kinase CDK1 promoting mitotic exit. (Reviewed in Musacchio A. and Salmon D. Nat Rev Mol Cell Biol, May; 8(5): 379-93, 2007).
A large group of proteins has been already identified to play a role in SAC functions: human MPS1 (monopolar spindle 1) kinase, (also known as TTK) has certainly a major role. MPS1 is a dual Tyrosine and Serine/Threonine kinase highly conserved from yeast to mammals. The human genome encodes for just one MPS1 gene family member, which does not have high sequence similarities with other protein kinases.
MPS1 is a cell cycle regulate enzyme that is upregulated and activated in mitosis upon phosphorylation (Stucke VM, et al., Embo J. 21 (7): 1723, 2002).
In Saccharomyces cerevisiae, MPS1 controls spindle-pole body duplication (Winey M. et al., J. Cell Biol 114:745, 1991), spindle assembly (Jones, M.H. et al., Curr. Biol. 15: 160, 2005) and the spindle assembly checkpoint (Weiss and Winey, J. Cell. Biol 132: 111 , 1996). Instead in higher eukaryotes the MPS1 kinase activity is mainly involved in SAC regulation and functions (Jelluma, N. et al., Cell 132: 233, 2008).
RNA interference experiments indicate that in the absence of MPS1 the SAC functions are compromised: mitotic length is reduced and cells divide rapidly without methaphase plate alignment, which ultimately causes aberrant aneuploidization, mitotic catastrophe and is not anymore compatible with cellular survival (Jelluma N. et al., Cell 132: 233, 2008; Tighe A. et al., J Cell Biol 2008; Jelluma N. et al., Plos ONE 3 (6): e2415, 2008). Moreover, to support these results, a small molecule ATP-competitor MPS1 inhibitor was described and despite its not clean selectivity profile, it was shown to be capable to inactivate SAC functions, inactivate nocodazole and taxol mediated mitotic arrest and promote cell death mainly in tumorigenic cell lines (Schmidt et al., EMBO Rep, 6(9): 866, 2005).
Despite that most of the tumors are aneuploid, MPS1 was never found to be mutated in cancer, instead, it has been found upregulated in a number of tumors of different origins like bladder, anaplastic thyroid, breast and prostate cancer (Yuan B. et al, Clin Cancer Res, 12(4): 1121 , 2006). Moreover was found in the signature of the top 25 genes over-expressed in CIN and aneuploid tumors which predict clinical outcome in breast and lung cancer, medulloblastoma, glioma, mesothelioma and lymphoma (Carter SL et al., Nat Genet. 38 (9): 1043, 2006). Finally is highly elevated in metastatic tumors and was found to be over-expressed in p53 mutated breast cancers (Bertheau P. et al., Plos Med 4(3):e90, 2007).
Toghether with the fact that also other SAC components like MAD2, BUBR1 or BUB1 have been found up-regulated in different tumors (deCarcer G. et al., Curr Med Chem 14(9): 969, 2007), it looks that SAC functions could be required and essential to keep tumoral highly aneuploidy cells capable to segregate and tumoral selectivity of SAC inhibitors is foreseen in particular for highly aneuploid tumors like colon, lung and breast carcinomas (Kops G. J. et al., Nat. Rev Cancer, 5:773, 2005).
Finally, massive aneuploidy induction and SAC deregulation have been shown to reduce tumorigenesis in tumour prone mice sustaining the hypothesis that SAC inhibition could confer tumour growth inhibition (Weaver et al., Cancer Cell 11 (1): 25, 2007). Thus, for these reasons, pharmacological attenuation of MPS1 function may have a therapeutic benefit in the treatment of several diverse cancers. Originally identified as activated genes by proviral mutagenesis in a lymphoma mouse model, PIMs (PIM1, PIM2 and/or PIM-3 throughout this application) are protein-serine/threonine kinases. PIM kinases are poorly expressed in normal tissues, and overexpressed or even mutated in a discrete number of human cancers, including Lymphoma, Leukaemia, Prostate, Pancreas and Gastric cancers [Shah et al. Eur. J. Cancer, 44, 2144-51 , (2008)].
PIM kinases are constitutively active and their activity supports in vitro and in vivo tumor cell growth and survival through modification of an increasing number of common as well as isoform-specific substrates including several cell cycle regulators and apoptosis mediators. PIM1 but not PIM2 seems also to mediate homing and migration of normal and malignant hematopoietic cells by regulating chemokine receptor surface expression [Brault et al. Haematologica 95 1004-1015 (2010)].
There is increasing evidence that PIM1 and PIM2 kinases may be involved in mediating the oncogenic effects of some acute myelogenous leukemias (AML)-associated oncogenes. In particular, the oncogenic role of FLT3- mutations (ITD and KD mut., present in 30% of AMLs) and/or translocations involving the MLL gene (occurring in 20% of AMLs), [Kumar, et al. J. Mol. Biol. 348, 183-193, (2005)]. PIM1 is more expressed in FLT3-ITD-transformed AML cells than in WT bone marrow cells. Data suggest that PIM1 as well as PIM2 inhibition may mediate FLT3ITD- dependent death of AML cells. Interestingly, cells transformed by FLT3 mutations that confer resistance to small- molecule tyrosine kinase inhibitors were still sensitive to knockdown of PIM2, or PIM-1 and PIM-2 by RNAi, [Kim et al., Blood 105, 1759-67, (2005)].
Moreover, PIM2 has been reported being over-expressed and associated with progression of several malignancies that originate from the B-cell lineage such as chronic lymphocytic leukemia (CLL), diffuse large B-cell lymphoma (DLBCL), mantle cell lymphoma (MCL) or myeloma [Cohen et al. Leuk. Lymphoma 94 51 2004, Huttmann et al Leukemia 20 1774 (2006)].
Interestingly, PIM and AKT/PKB seem to play partly redundant roles in mediating growth and survival of hematopoietic cells most probably due to overlapping substrates like BAD, p21WAF1/clp1, p27KIP1, or Cot/Tpl-2 [Choudhary et al., Mol Cell. 36 326-39 (2009)].
PIM kinases have been shown to control mTOR inhibition (rapamycin) resistant, proliferation and survival. Therefore, a combination of small molecule inhibitors targeting several survival kinases might be essential for a powerful cancer therapeutic platform [Amaravadi R., et al. J. Clin. Invest. 2005, 115 (10) 2618-24]. Oncogenic protein synthesis through elF4E binding protein 1 (4E-BP1) seems to be mTOR-indipendent and controlled by PIM-2. This observations suggest that the oncogenic elF4F translation-initiating complex could be blocked with small molecules PIM-2 inhibitors [Tamburini J. et al. Blood 2009, 114 (8), 1718-27 and Brault L. et al. Haematologica 2010, 95 (6) 1004-1015].
Tetrahydrobenzocycloheptene derivatives known in the art as immunosuppressive agents and for treating and preventing inflammatory conditions, allergic disorders and immune disorders are disclosed in WO2009/089305. Tetrahydrocycloheptapyrimidine derivatives known in the art as protein kinase inhibitors are disclosed in WO2005/037843. Tricyclicindole derivatives possessing kinase inhibitory activity have been disclosed in WO2008/065054, in the name of the applicant itself; some specific compounds of the aforementioned WO2008/065054 are excluded from the present general formula.
Despite these developments, there is still need for effective agents for said diseases.
The present inventors have now discovered that compounds of the formula (I), described below, are kinase inhibitors and are thus useful in therapy as antitumor agents and lack, in terms of both toxicity and side effects, the aforementioned drawbacks associated with currently available antitumor drugs.
Accordingly, a first object of the present invention is to provide a substituted tricyclic compound of the formula (I)
Figure imgf000005_0001
wherein
R1 is hydrogen, halogen or an optionally substituted group selected from amino, straight or branched C1-C6 alkyl, C3-C7 cycloalkyi, cycloalkyl-alkyl, aryl, arylalkyi, heterocyclyl and heterocyclylalkyi;
R2 is a group selected from -NR"R"', -N(OR"')R" and OR", wherein R" and R'" are, each independently, hydrogen or an optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyi, cycloalkyl-alkyl, aryl, arylalkyi, heterocyclyl and heterocyclylalkyi or, together with the nitrogen atom to which they are bonded, R" and R'" may form a 5 to 6 membered heteroaryl or heterocyclyl group, optionally containing one additional heteroatom selected among N, 0 and S;
R3 is hydrogen or optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyi, cycloalkyl-alkyl, aryl, arylalkyi, heterocyclyl and heterocyclylalkyi;
R4 is hydrogen or an optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyi, cycloalkyl-alkyl, aryl, arylalkyi, heterocyclyl and heterocyclylalkyi;
X is a single bond or a divalent radical selected from -NR'-, -CONR'-, -NH-CO-NH-, -0-, -S-, -S02- and -OSO2-, wherein R' is hydrogen or an optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyi, cycloalkyl-alkyl, aryl, arylalkyi, heterocyclyl and heterocyclylalkyi or, together with the nitrogen atom to which they are bound, R1 and R' may form a 5 to 6 membered heteroaryl or heterocyclyl group optionally containing one additional heteroatom selected from N, 0 and S;
A is a group selected from -CH2-, -(CH2)2-, -(CH2)3-, -CH=CH-, -C(CH3)2-CH2- and -CH2-C(CH3) 2;
or a pharmaceutically acceptable salt thereof,
with the proviso that the following compounds are excluded:
ethyl 2-amino-9-methyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxylate,
2-amino-9-methyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxylic acid,
2-amino-9-methyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamide,
ethyl 2-amino-8-phenyl-9H-pyrrolo[3,2-h]quinazoline-7-carboxylate,
2-amino-8-phenyl-9H-pyrrolo[3,2-h]quinazoline-7-carboxamide, 2-amino-9-methyl-8-phenyl-9H-pyrrolo[3,2-h]quinazoline-7-carboxamide and
2-amino-9-methyl-8-phenyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamide.
The present invention also provides methods of synthesizing the substituted tricyclic, represented by the formula (I), prepared through a process consisting of standard synthetic transformations and isomers, tautomers, hydrates, solvates, complexes, metabolites, prodrugs, carriers, N- oxides.
The present invention also provides a method for treating diseases caused by and/or associated with dysregulated protein kinase activity, particularly ABL, ACK1, AKT1 , ALK, AUR1 , AUR2, BRK, BUB1 , CDC7/DBF4, CDK2/CYCA, CHK1 , CK2, EEF2K, EGFR1 , EphA2, EphB4, ERK2, FAK, FGFR1 , FLT3, GSK3beta, Haspin, IGFR1, IKK2, IR, JAK1, JAK2, JAK3, KIT, LCK, LYN, MAPKAPK2, MELK, MET, MNK2, MPS1 , MST4, NEK6, NIM1 , P38alpha, PAK4, PDGFR, PDK1 , PERK, PIM1 , PIM2, PIM3, PKAalpha, PKCbeta, PLK1, RET, ROS1 , SULU1 , Syk, TLK2, TRKA, TYK, VEGFR2, VEGFR3, ZAP70, more particularly MPS1 , PIM1 , PIM2, PIM3.
A preferred method of the present invention is to treat a disease caused by and/or associated with dysregulated protein kinase activity selected from the group consisting of cancer, cell proliferative disorders, viral infections, autoimmune and neurodegenerative disorders.
Another preferred method of the present invention is to treat specific types of cancer including but not limited to: carcinoma such as bladder, breast, colon, kidney, liver, lung, including small cell lung cancer, esophagus, gallbladder, ovary, pancreas, stomach, cervix, thyroid, prostate, and skin, including squamous cell carcinoma; hematopoietic tumors of lymphoid lineage including leukaemia, acute lymphocitic leukaemia, acute lymphoblastic leukaemia, B-cell lymphoma, T-cell-lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, hairy cell lymphoma and Burkett's lymphoma; hematopoietic tumors of myeloid lineage, including acute and chronic myelogenous leukemias, myelodysplastic syndrome and promyelocytic leukaemia; tumors of mesenchymal origin, including fibrosarcoma and rhabdomyosarcoma; tumors of the central and peripheral nervous system, including astrocytoma neuroblastoma, glioma and schwannomas; other tumors, including melanoma, seminoma, teratocarcinoma, osteosarcoma, xeroderma pigmentosum, keratoxanthoma, thyroid follicular cancer, Kaposi's sarcoma and mesothelioma, highly aneuploid tumors and tumors which do overexpress mitotic checkpoint .
Another preferred method of the present invention is to treat specific cellular proliferation disorders such as, for example, benign prostate hyperplasia, familial adenomatosis polyposis, neurofibromatosis, psoriasis, vascular smooth cell proliferation associated with atherosclerosis, pulmonary fibrosis, arthritis, glomerulonephritis and postsurgical stenosis and restenosis.
Another preferred method of the present invention is to treat immune cell-associated diseases and disorders, such as inflammatory and autoimmune diseases, for examples multiple sclerosis, systemic lupus erythematous, inflammatory bowel diseases(IBD), Crohn's disease, irritable bowel syndrome, pancreatitis, ulcerative colitis, diverticulosis, myasthenia gravis, vasculitis, psoriasis, scleroderma, asthma, allergy, systemic sclerosis, vitiligo, arthritis such as osteoarthritis, juvenile rheumatoid arthritis, ankylosing spondylitis.
Another preferred method of the present invention is to treat viral infections, in particular the prevention of AIDS development in HIV-infected individuals. Another preferred method of the present invention is to treat neurodegenerative disorders, such as Alzheimer's disease, Parkinson's disease and Huntington's disease.
In addition, the method of the present invention also provides tumor angiogenesis and metastasis inhibition as well as the treatment of organ transplant rejection and host versus graft disease.
The present invention also provides a pharmaceutical composition comprising one or more compounds of the formula (I) or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable excipient, carrier and/or diluent.
The present invention further provides a pharmaceutical composition comprising a compound of the formula (I) in combination with known anticancer treatments such as radiation therapy or chemotherapy regimen in combination with cytostatic or cytotoxic agents, antibiotic-type agents, alkylating agents, antimetabolite agents, hormonal agents, immunological agents, interferon-type agents, cyclooxygenase inhibitors (e.g. COX-2 inhibitors), matrixmetalloprotease inhibitors, telomerase inhibitors, tyrosine kinase inhibitors, anti-growth factor receptor agents, anti-HER agents, anti-EGFR agents, anti-angiogenesis agents (e.g. angiogenesis inhibitors), farnesyl transferase inhibitors, ras-raf signal transduction pathway inhibitors, cell cycle inhibitors, other cdks inhibitors, tubulin binding agents, topoisomerase I inhibitors, topoisomerase II inhibitors, and the like.
The present invention further provides an in vitro method for inhibiting protein kinase activity which comprises contacting the kinase with an effective amount of a compound of formula (I) as defined above.
Additionally, the invention provides a product or kit comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof, as defined above, or pharmaceutical compositions thereof and one or more chemotherapeutic agents, as a combined preparation for simultaneous, separate or sequential use in anticancer therapy.
In another aspect the invention provides a compound of formula (I) or a pharmaceutically acceptable salt thereof, as defined above, for use as a medicament.
Moreover the invention provides the use of a compound of formula (I) or a pharmaceutically acceptable salt thereof, as defined above, in the manufacture of a medicament with anticancer activity.
Finally, the invention provides a compound of formula (I) or a pharmaceutically acceptable salt thereof, as defined above, for use in a method of treating cancer.
Unless otherwise specified, when referring to the compounds of the formula (I) per se as well as to any pharmaceutical composition thereof or to any therapeutic treatment comprising them, the present invention includes all of the hydrates, solvates, complexes, metabolites, prodrugs, carriers, N-oxides and pharmaceutically acceptable salts of the compounds of this invention.
In other words, if easily obtainable from the compounds of the formula (I) as defined above, also their isomers, tautomers, hydrates, solvates, complexes, metabolites, prodrugs, carriers and N- oxides are object of the present invention.
A metabolite of a compound of the formula (I) is any compound into which this same compound of the formula (I) is converted in vivo, for instance upon administration to a mammal in need thereof. Typically, without however representing a limiting example, upon administration of a compound of the formula (I), this same derivative may be converted into a variety of compounds, for instance including more soluble derivatives like hydroxylated derivatives, which are easily excreted. Hence, depending upon the metabolic pathway thus occurring, any of these hydroxylated derivatives may be regarded as a metabolite of the compounds of the formula (I).
Prodrugs are any covalently bonded compounds, which release in vivo the active parent drug according to the formula (I).
N-oxides are compounds of the formula (I) wherein nitrogen and oxygen are tethered through a dative bond.
If a stereogenic center or another form of an isomeric center is present in a compound of the present invention, all forms of such isomer or isomers, including enantiomers and diastereomers, are intended to be covered herein. Compounds containing a stereogenic center may be used as a racemic mixture, an enantiomerically enriched mixture, or the racemic mixture may be separated using well-known techniques and an individual enantiomer may be used alone. In cases in which compounds have unsaturated carbon-carbon double bonds, both the cis (Z) and trans (E) isomers are within the scope of this invention.
In cases wherein compounds may exist in tautomeric forms, such as keto-enol tautomers, each tautomeric form is contemplated as being included within this invention whether existing in equilibrium or predominantly in one form. The term "aryl" includes carbocyclic or heterocyclic hydrocarbons with from 1 to 2 ring moieties, either fused or linked to each other by single bonds, wherein at least one of the rings is aromatic; if present, any aromatic heterocyclic hydrocarbon also referred to as heteroaryl group, comprises a 5 to 6 membered ring with from 1 to 3 heteroatoms selected from N, 0 and S.
Examples of aryl groups according to the invention are, for instance, phenyl, biphenyl, a- or β-naphthyl, dihydronaphthyl, thienyl, benzothienyl, furyl, benzofuranyl, pyrrolyl, imidazolyl, pyrazolyl, thiazolyl, isothiazolyl, oxazolyl, isoxazolyl, pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl, indolyl, isoindolyl, purinyl, quinolyl, isoquinolyl, dihydroquinolinyl, quinoxalinyl, benzodioxolyl, indanyl, indenyl, triazolyl, and the like.
With the term "heterocyclyl" (also known as "heterocycloalkyl") we intend a 3- to 7-membered, saturated or partially unsaturated carbocyclic ring where one or more carbon atoms are replaced by heteroatoms such as nitrogen, oxygen and sulfur. Non limiting examples of heterocyclyl groups are, for instance, pyrane, pyrrolidine, pyrroline, imidazoline, imidazolidine, pyrazolidine, pyrazoline, thiazoline, thiazolidine, dihydrofuran, tetrahydrofuran, 1 ,3- dioxolane, piperidine, piperazine, morpholine and the like.
With the term "C3-C7 cycloalkyl", we intend, unless otherwise provided, 3- to 7-membered all-carbon monocyclic ring, which may contain one or more double bonds but does not have a completely conjugated π-electron system. Examples of cycloalkyl groups, without limitation, are cyclopropane, cyclobutane, cyclopentane, cyclopentene, cyclohexane, cyclohexene, cyclohexadiene, cycloeptane, cycloeptene, cycloeptadiene.
With the term "straight or branched C1-C6 alkyl", hence comprehensive of C1-C4 alkyl, we intend any of the groups such as, for instance, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, sec-butyl, n-pentyl, n-hexyl, and the like.
With the term "straight or branched C2-C6 alkenyl" we intend any of the groups such as, for instance, vinyl, allyl, 1- propenyl, isopropenyl, 1-butenyl, 2-butenyl, 3-butenyl, 2-pentenyl, 1-hexenyl, and the like. With the term "straight or branched C2-C6 alkynyl" we intend any of the groups such as, for instance, ethynyl, 2- propynyl, 4-pentynyl, and the like.
According to the present invention and unless otherwise provided, any of the above R1 , R2, R3, R4, R', R" and R'" group may be optionally substituted, in any of their free positions, by one or more groups, for instance 1 to 6 groups, independently selected from: halogen atom, nitro, oxo groups (=0), cyano, C1-C6 alkyl, polyfluorinated alkyl, polyfluorinated alkoxy, alkenyl, alkynyl, hydroxyalkyl, aryl, arylalkyl, heterocyclyl, C3-C7 cycloalkyl, hydroxy, alkoxy, aryloxy, heterocyclyloxy, methylenedioxy, alkylcarbonyloxy, arylcarbonyloxy, cycloalkenyloxy, heterocyclylcarbonyloxy, alkylideneaminooxy, carboxy, alkoxycarbonyl, aryloxycarbonyl, cycloalkyloxycarbonyl, heterocyclyloxycarbonyl, amino, ureido, alkylamino, dialkylamino, arylamino, diarylamino, heterocyclylamino, formylamino, alkylcarbonylamino, arylcarbonylamino, heterocyclylcarbonylamino, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, arylaminocarbonyl, heterocyclylaminocarbonyl, alkoxycarbonylamino, hydroxyaminocarbonyl, alkoxyimino, alkylsulfonylamino, arylsulfonylamino, heterocyclylsulfonylamino, formyl, alkylcarbonyl, arylcarbonyl, cycloalkylcarbonyl, heterocyclylcarbonyl, alkylsulfonyl, arylsulfonyl, aminosulfonyl, alkylaminosulfonyl, dialkylaminosulfonyl, arylaminosulfonyl, heterocyclylaminosulfonyl, arylthio, alkylthio, phosphonate and alkylphosphonate.
In their turn, whenever appropriate, each of the above substituent may be further substituted by one or more of the aforementioned groups.
In this respect, with the term "halogen atom" we intend a fluorine, chlorine, bromine or iodine atom.
With the term "cyano" we intend a -CN residue.
With the term "nitro" we intend a -NO2 group.
With the term "alkenyl" or "alkynyl" we intend any of the aforementioned straight or branched C2-C6 alkyl groups further bearing a double or triple bond. Non limiting examples of alkenyl or alkynyl groups of the invention are, for instance, vinyl, allyl, 1 -propenyl, isopropenyl, 1 -butenyl, 2-butenyl, 3-butenyl, 2-pentenyl, 1 -hexenyl, ethynyl, 2- propynyl, 4-pentynyl, and the like.
With the term "polyfluorinated alkyl or alkoxy" we intend any of the above straight or branched C1-C6 alkyl or alkoxy groups which are substituted by more than one fluorine atom such as, for instance, trifluoromethyl, trifluoroethyl,
1 , 1 , 1 ,3,3,3-hexafluoropropyl, trifluoromethoxy and the like.
With the term "alkoxy", "aryloxy", "heterocyclyloxy" and derivatives thereof we intend any of the above C1-C6 alkyl, aryl or heterocyclyl groups linked to the rest of the molecule through an oxygen atom (-0-).
From all of the above, it is clear to the skilled person that any group which name is a composite name such as, for instance, arylamino has to be intended as conventionally construed by the parts from which it derives, e.g. by an amino group which is further substituted by aryl, wherein aryl is as above defined.
Likewise, any of the terms such as, for instance, alkylthio, alkylamino, dialkylamino, alkoxycarbonyl,
alkoxycarbonylamino, heterocyclylcarbonyl, heterocyclylcarbonylamino, cycloalkyloxycarbonyl and the like, include groups wherein the alkyl, alkoxy, aryl, C3-C7 cycloalkyl and heterocyclyl moieties are as above defined.
Pharmaceutically acceptable salts of the compounds of the formula (I) include the acid addition salts with inorganic or organic acids, e.g., nitric, hydrochloric, hydrobromic, sulfuric, perchloric, phosphoric, acetic, trifluoroacetic, propionic, glycolic, fumaric, lactic, oxalic, malonic, malic, maleic, tartaric, citric, benzoic, cinnamic, mandelic, methanesulphonic, isethionic and salicylic acid. Preferably, the acid addition salt of the compounds of the invention is selected between the hydrochloride or mesylate salt.
Pharmaceutically acceptable salts of the compounds of the formula (I) also include the salts with inorganic or organic bases, e.g., alkali or alkaline-earth metals, especially sodium, potassium, calcium ammonium or magnesium hydroxides, carbonates or bicarbonates, acyclic or cyclic amines, preferably methylamine, ethylamine, diethylamine, triethylamine, piperidine and the like.
Preferred compounds of the formula (I) are the compounds wherein X is a group -NR'- and R2 is a group selected from -NHR" and -N(OR"')R", wherein R" is hydrogen or an optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyl, cycloalkyl-alkyl, aryl, arylalkyl, heterocyclyl and heterocyclylalkyl; and R', R'", R1 , R3, R4 and A are as above defined.
Other preferred compounds are the compounds of formula (I) wherein X is a group -0- and R2 is a group selected from -NHR" and -N(OR"')R", wherein R" is hydrogen or an optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyl, cycloalkyl-alkyl, aryl, arylalkyl, heterocyclyl and heterocyclylalkyl; and R'", R1 , R3, R4 and A are as above defined.
Other preferred compounds are the compounds of formula (I) wherein X is a group -S- and R2 is a group selected from -NHR" and -N(OR"')R", wherein R" is hydrogen or an optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyl, cycloalkyl-alkyl, aryl, arylalkyl, heterocyclyl and heterocyclylalkyl; and R'", R1 , R3, R4 and A are as above defined.
Other preferred compounds are the compounds of formula (I) wherein X is a single bond and R2 is a group selected from -NHR" and -N(OR"')R", wherein R" is hydrogen or an optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyl, cycloalkyl-alkyl, aryl, arylalkyl, heterocyclyl and heterocyclylalkyl; and R'", R1 , R3, R4 and A are as above defined.
Other preferred compounds are the compounds of formula (I) wherein X is a group -NR'-; R2 is a group -NHR" or - N(OR"')R", wherein R" is hydrogen or an optionally substituted group selected from straight or branched C1-C4 alkyl group and aryl; and R1 is an optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyl, cycloalkyl-alkyl, aryl, arylalkyl, heterocyclyl and heterocyclylalkyl; and R', R'", R3, R4 and A are as above defined.
Other preferred compounds are the compounds of formula (I) wherein X is a group -0-; R2 is a group -NHR" or - N(OR"')R", wherein R" is hydrogen or an optionally substituted group selected from straight or branched C1-C4 alkyl group and aryl; and R1 is an optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyl, cycloalkyl-alkyl, aryl, arylalkyl, heterocyclyl and heterocyclylalkyl; and R'", R3, R4 and A are as above defined.
Other preferred compounds are the compounds of formula (I) wherein X is a group -S-; R2 is a group -NHR" or - N(OR"')R", wherein R" is hydrogen or an optionally substituted group selected from straight or branched C1-C4 alkyl group and aryl; and R1 is an optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyl, cycloalkyl-alkyl, aryl, arylalkyl, heterocyclyl and heterocyclylalkyl; and R'", R3, R4 and A are as above defined.
Other preferred compounds are the compounds of formula (I) wherein X is a single bond ; R2 is a group -NHR" or - N(OR"')R", wherein R" is hydrogen or an optionally substituted group selected from straight or branched C1-C4 alkyl group and aryl; and R1 is an optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyl, cycloalkyl-alkyl, aryl, arylalkyl, heterocyclyl and heterocyclylalkyl; and R'", R3, R4 and A are as above defined.
Preferred specific compounds of the formula (I) or a salt thereof are the compounds listed below:
1) N-(2,6-diethylphenyl)-9-(methoxymethyl)-2-{[2-methoxy-4-(4-methylpiperazin-1-yl)phenyl]amino}-8-methyl-6,9- dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamide,
2) 2-[(4-bromo-2-methoxyphenyl)amino]-N-(2,6-diethylphenyl)-8,9-dimethyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoli 7-carboxamide,
3) N-(2,6-diethylphenyl)-2-({2-methoxy-4-[4-(pyrrolidin-1-yl)piperidin-1-yl]phenyl}am
pyrrolo[3,2-h]quinazoline-7-carboxamide,
4) N-(2,6-diethylphenyl)-2-({4-[4-(dimethylamino)piperidin-1-yl]-2-methoxyphenyl}amino)-8,9-dimethyl
5H-pyrrolo[3,2-h]quinazoline-7-carboxamide,
5) N-(2,6-diethylphenyl)-2-{[2-methoxy-4-(4-methylpiperazin-1-yl)phenyl]amino}-8,9-dimethyl-6,9-dihydro-5H- pyrrolo[3,2-h]quinazoline-7-carboxamide,
6) N-(2,6-diethylphenyl)-2-({4-[4-(2-hydroxyethyl)piperazin-1-yl]-2-methoxyphenyl}amino)-8,9-dimethyl-6,9-dihydro- 5H-pyrrolo[3,2-h]quinazoline-7-carboxamide,
7) 2-{[2-methoxy -(4-methylpiperazin-1-yl)phenyl]amino}-8,9-dimethyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7- carboxamide,
8) 2-[(4-bromo-2-methoxyphenyl)amino]-N-(2,6-diethylphenyl)-9-methyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7- carboxamide,
9) N-(2,6-diethylphenyl)-2-{[2-methoxy -(4-methylpiperazin-1-yl)phenyl]amino}-9-methyl-6,9-dihydro-5H-pyrrolo[3,2- h]quinazoline-7-carboxamide,
10) N-(2,6-diethylphenyl)-2-({4-[4-(dimethylamino)piperidin-1-yl]-2-methoxyphenyl}amino)-9-methyl-6,9-di
pyrrolo[3,2-h]quinazoline-7-carboxamide,
11) N-(2,6-diethylphenyl)-2-({2-methoxy-4-[4-(pyrrolidin-1-yl)piperidin-1-yl]phenyl}ami
pyrrolo[3,2-h]quinazoline-7-carboxamide,
12) N-(2,6-diethylphenyl)-2-[(4-{[3-(dimethylamino)propyl](methyl)amino}-2-methoxyphenyl)amino]-9-methyl-6,9- dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamide,
13) N-(2,6-diethylphenyl)-2-({4-[4-(2-hydroxyethyl)piperazin-1-yl]-2-methoxyphenyl}amino)-9-methyl-6,9-dihydro-5H- pyrrolo[3,2-h]quinazoline-7-carboxamide,
14) 2-[(4-bromo-2-methoxyphenyl)amino]-N-[(1 S)-2^
6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamide, 15) 2-[(4-bromo-2-methoxyphenyl)amino]-N-(2,6-diethylphenyl)-10-methyl-5,6,7, 10- tetrahydropyrrolo[3 2':6J]cyclohepta[1,2-d]pyrimidine-8-carboxamide,
16) N-(2,6-diethylphenyl)-2-{[2-methoxy-4-(4-methylpiperazin-1 -yl)phenyl]amino}-10-methyl-5,6J, 10- tetrahydropyrrolo[3 2':6J]cyclohepta[1,2-d]pyrimidine-8-carboxamide,
17) N-(2,6-diethylphenyl)-2-({4-[4-(dimethylamino)piperidin-1-yl]-2-metho
tetrahydropyrrolo[3 2':6J]cyclohepta[1,2-d]pyrimidine-8-carboxamide and
18) N-(2,6-diethylphenyl)-2-({2-methoxy-4-[4-(pyrrolidin-1 -yl)piperidin-1 -yl]phenyl}amino)-1 O-methyl-5,6,7, 10- tetrahydropyrrolo[3',2':6J]cyclohepta[1,2-d]pyrimidine-8-carboxamide.
19) 8-methyl-2-(methylsulfanyl)-9-(propan-2-yl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline -carboxami
20) 8-methyl-2-(methylsulfanyl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamide
21) 2-(methylsulfanyl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamide
22) 2-(methylsulfanyl)-9-(propan-2-yl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamide
23) 2-(dimethylamino)-8-methyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamide
24) 9-(2-hydroxyethyl)-8-methyl-2-(methylsulfanyl)-6,9-dihydro-5H-pyrrolo[3,2-h]
25) 9-(2-hydroxyethyl)-2-(methylsulfanyl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline -carboxamide
26) 2-(dimethylamino)-8-methyl-9H-pyrrolo[3,2-h]quinazoline-7-carboxamide
27) 9-methyl-2-(methylsulfanyl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxamide
28) 8-methyl-2-(methylsulfanyl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxamide
29) 9-(2-hydroxyethyl)-8-methyl-2-(methylsulfanyl)-9H-pyrrolo[3,2-h]quinazoline -carboxamide
30) 8-methyl-2-(methylsulfanyl)-9-(propan-2-yl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxamide
31) 9-ethyl-2-(methylsulfanyl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxamide
32) 2-(methylsulfanyl)-9-(piperidin -yl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline -carboxamide
33) 9-(cis 4-aminocyclohexyl)-2-(methylsulfanyl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline -carboxamide
34) 9-(cis -aminocyclohexyl)-2-(methylsulfanyl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxamide
35) 2-(methylsulfanyl)-9-(piperidin-4-yl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxamide
36) 2-(methylsulfanyl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxamide
37) 2-methyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamide
38) 9-(3-amino-2,2-dimethylpropyl)-2-(methylsulfanyl)-9H-pyrrolo[3,2-h]quinazoline -carboxami hydrochloride
39) 9-(azepan-3-yl)-2-(methylsulfanyl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxamide hydrochloride
For a reference to any specific compound of the formula (I) of the invention, optionally in the form of a pharmaceutically acceptable salt, see the experimental section and claims.
The present invention also provides a process for the preparation of a compound of formula (I) as defined above, by using the reaction routes and synthetic schemes described below, employing the techniques available in the art and starting materials readily available. The preparation of certain embodiments of the present invention is described in the examples that follow, but those of ordinary skill in the art will recognize that the preparations described may be readily adapted to prepare other embodiments of the present invention. For example, the synthesis of non- examplified compounds according to the invention may be performed by modifications apparent to those skilled in the art, for instance by appropriately protecting interfering groups, by changing to other suitable reagents known in the art, or by making routine modifications of reaction conditions. Alternatively other reactions referred to herein or known in the art will be recognized as having adaptability for preparing other compounds of the invention.
The reported Scheme 1 shows the preparation of a compound of formula (I).
Scheme 1
Figure imgf000013_0001
In the above scheme 1 , X is a single bond or a divalent radical selected from -NR', -0- and -S-; R2 is an optionally substituted alkoxy; A is as defined in formula (I) except -CH=CH-; R1 , R3, R4 and R' are as defined in formula (I) and R5 is an optionally substituted C1-C6 alkyl.
All those with ordinary skills in the art will appreciate that any transformation performed according to said methods may require standard modifications such as, for instance, protection of interfering groups, change to other suitable reagents known in the art, or make routine modifications of reaction conditions.
Accordingly, a process of the present invention comprises the following steps: st.A) reacting a compound of formula (II)
Figure imgf000014_0001
wherein A is as defined in formula (I) except -CH=CH- and R5 is an optionally substituted C1-C6 alkyl (for example methyl, ethyl or t-buthyl) with a compound of formula (II I)
Figure imgf000014_0002
wherein R2 is an optionally substituted alkoxy (for example methoxy, ethoxy or t-butoxy);
st.B) reacting the resultant compound of the formula (IV):
Figure imgf000014_0003
wherein R2 is an optionally substituted alkoxy, R5 is an optionally substituted C1-C6 alkyl and A is as defined in formula (I) except -CH=CH- ,with toluenesulfonylmethyl isocyanide in presence of a strong base;
st.C) hydrolyzing selectively in acidic or basic condition the resultant compound of formula (V)
Figure imgf000014_0004
wherein R3 and R4 are hydrogen, A is as defined in formula (I) except -CH=CH-, R2 is an optionally substituted alkoxy and R5 is an optionally substituted -C6 alkyl so to obtain a compound of formula (VI)
Figure imgf000014_0005
wherein R3 and R4 are hydrogen, A is as defined in formula (I) except -CH=CH-, and R2 is an optionally substituted alkoxy;
alternatively,
st.Ca) a compound of formula (VI) wherein R3 is hydrogen, R4 is as defined in formula (I) except hydrogen, A is as defined in formula (I) except -CH=CH-, and R2 is an optionally substituted alkoxy, can be obtained reacting a compound of formula (VII)
o
N^A^I-0H (VI I)
o
wherein A is as defined above with a compound of formula (VIII)
R4^AR2 (VIII) wherein R2 and R4 are as defined above;
st.D) cyclizing the resultant compound of formula (VI) wherein R2 is an optionally substituted alkoxy, R3 is hydrogen, R4 is as defined in formula (I), and A is as defined in formula (I) except -CH=CH-, in acidic condition so as to obtain a compound of formula (IX)
Figure imgf000015_0001
wherein R2, R3, R4 and A are as defined above;
if needed or desired,
st.E) alkylating, a compound of formula (IX) wherein R3 is hydrogen, with a compound of the formula (X):
R3-L (X)
wherein L is OH or a group that optionally upon activation, may work as a suitable leaving group such as iodo, bromo, chloro or a sulfonate group (e.g. -OS(0)2CF3, -OS(0)2CH3 or -OS(0)2PhMe), and R3 is as defined in formula (I) except hydrogen;
st.F) reacting the resultant compound of formula (IX)
Figure imgf000015_0002
wherein R2 is an optionally substituted alkoxy, R3 and R4 are as defined in formula (I), and A is as defined in formula (I) except -CH=CH-, with an Ν,Ν-dimethylformamide derivative;
st.G) reacting the resultant compound of formula (XI)
Figure imgf000015_0003
wherein R2 is an optionally substituted alkoxy, R3 and R4 are as defined in formula (I), and A is as defined in formula (I) except -CH=CH-, with a compound of formula XII)
Figure imgf000015_0004
wherein X is a single bond or a divalent radical selected from -NR', -0- and -S-; and R1 and R' are as defined in formula (I), so as to obtain a compound of formula (I)
Figure imgf000015_0005
wherein X is a single bond or a divalent radical selected from -NR', -0- and -S-; R2 is an optionally substituted alkoxy; A is as defined in formula (I) except -CH=CH-; and R1 , R3, R4 and R' are as defined in formula (I); optionally converting a compound of the formula (I) into another different compound of the formula (I), and, if desired, converting a compound of the formula (I) into a pharmaceutically acceptable salt thereof or converting a salt into the free compound (I).
As said above, the compounds of the formula (I) which are prepared according to the process object of the invention, can be conveniently converted into other compounds of the formula (I) by operating according to well-known synthetic conditions, the following being examples of possible conversions:
conv.1) converting a compound of the formula (I) wherein R3 is a protecting group P such as methoxymethyl or p- methoxybenzyl and into the corresponding compound of the formula (I) wherein R3 is hydrogen atom under acidic or basic conditions:
Figure imgf000016_0001
conv.2) converting a compound of the formula (I) wherein R3 is hydrogen into the corresponding compound of the formula (I) wherein R3 is as defined in formula (I) but not hydrogen, through reaction with compound of the formula R3-L (X) wherein L is OH or a group that optionally upon activation, may work as a suitable leaving group such as iodo, bromo, chloro or a sulfonate group (e.g. -OS(0)2CF3, -OS(0)2CH3 or -OS(0)2PhMe), and R3 is as defined above but not hydrogen atom:
Figure imgf000016_0002
(I) <■>
conv.3) converting a compound of the formula (I) wherein R2 is OR5 wherein R5 is an optionally substituted C1-C6 alkyl into the corresponding compound of the formula (I) wherein R2 is hydroxy or a corresponding salt thereof, through acidic or basic hydrolysis:
Figure imgf000016_0003
conv.4) converting a compound of the formula (I) wherein R2 is hydroxy or a corresponding salt thereof, into the corresponding compound of the formula (I) wherein R2 is a group -NR"R"' or -N(OR"')R" wherein R" and R'" are as defined in formula (I), through reaction with a derivative of formula R"R"'NH (XIII) or R"NHOR"'(XIV) wherein R" and R'" are as defined above under basic conditions and in the presence of a suitable condensing agent; alternatively a compound of the formula (I) wherein R2 is hydroxy, may be first converted into the corresponding chloride derivative using a chlorinating agent, then reacting the resultant compound with a derivative of formula R"R"'NH (XIII) or R"NHOR"'(XIV) wherein R" and R'" are as defined above under basic conditions so as to obtain a compound of the formula I) wherein R2 is a group -NR"R"' or -N(OR"')R":
Figure imgf000017_0001
conv.5) converting a compound of the formula (I) wherein R2 is OR5 wherein R5 is an optionally substituted C1-C6 alkyl into the corresponding compound of the formula (I) wherein R2 is a group -NR"R"' or -N(OR"')R", wherein R" and R'" are as defined in formula (I), through reaction with a derivative of formula R"R"'NH (XIII) or R"NHOR"'(XIV) wherein R" and R'" are as defined above:
Figure imgf000017_0002
Conv.6) converting a compound of formula (I) wherein X is as defined in formula (I) except SC^ and -OSO2-, and R1 is an aryl, i.e. phenyl, substituted by bromine, into the corresponding compound of formula (I) wherein R1 is an aryl, i.e. phenyl, substituted by NR"R"', b treatment with an amine of formula R"R"'-NH (XIII):
Figure imgf000017_0003
wherein Ra and Rb are independently halogen atom, except bromine, hydrogen, nitro, cyano, C1-C6 alkyl, polyfluorinated alkyl, polyfluorinated alkoxy, alkenyl, alkynyl, hydroxyalkyl, aryl, arylalkyl, heterocyclyl, C3-C7 cycloalkyl, hydroxy, alkoxy, aryloxy, heterocyclyloxy, methylenedioxy, alkylcarbonyloxy, arylcarbonyloxy, cycloalkenyloxy, heterocyclylcarbonyloxy, alkylideneaminooxy, carboxy, alkoxycarbonyl, aryloxycarbonyl, cycloalkyloxycarbonyl, heterocyclyloxycarbonyl, amino, ureido, alkylamino, dialkylamino, arylamino, diarylamino, heterocyclyamino, formylamino, alkylcarbonylamino, arylcarbonylamino, heterocyclylcarbonylamino, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, arylaminocarbonyl, heterocyclylaminocarbonyl, alkoxycarbonylamino, hydroxyaminocarbonyl, alkoxyimino, alkylsulfonylamino, arylsulfonylamino, heterocyclylsulfonylamino, formyl, alkylcarbonyl, arylcarbonyl, cycloalkylcarbonyl, heterocyclylcarbonyl, alkylsulfonyl, arylsulfonyl, aminosulfonyl, alkylaminosulfonyl, dialkylaminosulfonyl, arylaminosulfonyl, heterocyclylaminosulfonyl, arylthio, alkylthio, phosphonate or alkylphosphonate;
Conv.7) converting a compound of the formula (I) wherein X is -NH- and R1 is hydrogen, into the corresponding compound of the formula (I) wherein R1 is an ar l, i.e. phenyl, substituted by Ra, Rb, Rc:
Figure imgf000018_0001
wherein Ra, Rb and Rc are independently hydrogen, nitro, cyano, C1-C6 alkyi, polyfluorinated alkyi, polyfluorinated alkoxy, alkenyl, alkynyl, hydroxyalkyl, aryl, arylalkyl, heterocyclyl, C3-C7 cycloalkyl, hydroxy, alkoxy, aryloxy, heterocyclyloxy, methylenedioxy, alkylcarbonyloxy, arylcarbonyloxy, cycloalkenyloxy, heterocyclylcarbonyloxy, alkylideneaminooxy, carboxy, alkoxycarbonyl, aryloxycarbonyl, cycloalkyloxycarbonyl, heterocyclyloxycarbonyl, amino, ureido, alkylamino, dialkylamino, arylamino, diarylamino, heterocyclyamino, formylamino, alkylcarbonylamino, arylcarbonylamino, heterocyclylcarbonylamino, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, arylaminocarbonyl, heterocyclylaminocarbonyl, alkoxycarbonylamino, hydroxyaminocarbonyl, alkoxyimino, alkylsulfonylamino, arylsulfonylamino, heterocyclylsulfonylamino, formyl, alkylcarbonyl, arylcarbonyl, cycloalkylcarbonyl, heterocyclylcarbonyl, alkylsulfonyl, arylsulfonyl, aminosulfonyl, alkylaminosulfonyl, dialkylaminosulfonyl, arylaminosulfonyl, heterocyclylaminosulfonyl, arylthio, alkylthio, phosphonate or alkylphosphonate,
by treatment with an iodo derivative of the formula (XV)
Figure imgf000018_0002
wherein Ra, Rb and Rc are as defined above, in presence of palladium;
Conv.8) converting a compound of the formula (I) wherein X is as defined in formula (I) except SO2 and -OSO2-, and R1 is an aryl, i.e. phenyl, substituted by -COOPg, wherein Pg is a suitable protecting group, into the corresponding compound of formula (I) wherein R1 is an aryl, i.e. phenyl, substituted by -COOH, through conditions well known in the literature (see Teodora W. Green PereG. M.Wuts):
I )
Figure imgf000018_0003
wherein Ra and Rb are independently halogen atom, hydrogen, nitro, cyano, C1-C6 alkyi, polyfluorinated alkyi, polyfluorinated alkoxy, alkenyl, alkynyl, hydroxyalkyl, aryl, arylalkyl, heterocyclyl, C3-C7 cycloalkyl, hydroxy, alkoxy, aryloxy, heterocyclyloxy, methylenedioxy, alkylcarbonyloxy, arylcarbonyloxy, cycloalkenyloxy, heterocyclylcarbonyloxy, alkylideneaminooxy, carboxy, alkoxycarbonyl, aryloxycarbonyl, cycloalkyloxycarbonyl, heterocyclyloxycarbonyl, amino, ureido, alkylamino, dialkylamino, arylamino, diarylamino, heterocyclyamino, formylamino, alkylcarbonylamino, arylcarbonylamino, heterocyclylcarbonylamino, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, arylaminocarbonyl, heterocyclylaminocarbonyl, alkoxycarbonylamino, hydroxyaminocarbonyl, alkoxyimino, alkylsulfonylamino, arylsulfonylamino, heterocyclylsulfonylamino, formyl, alkylcarbonyl, arylcarbonyl, cycloalkylcarbonyl, heterocyclylcarbonyl, alkylsulfonyl, arylsulfonyl, aminosulfonyl, alkylaminosulfonyl, dialkylaminosulfonyl, arylaminosulfonyl, heterocyclylaminosulfonyl, arylthio, alkylthio, phosphonate or alkylphosphonate;
Conv.9) converting a compound of the formula (I) wherein X is as defined in formula (I) except SO2 and -OSO2-, and R1 is an aryl, i.e. phenyl, substituted by -COOH, into the corresponding compound of formula (I) wherein R1 is an aryl, i.e. phenyl, substituted by -CONR"R"', wherein R" and R'" are as defined above, by treatment with an amine of formula R"R"'-NH (XIII), in the resence of the suitable condensing agents:
Figure imgf000019_0001
wherein Ra and Rb are independently halogen atom, hydrogen, nitro, cyano, C1-C6 alkyi, polyfluorinated alkyi, polyfluorinated alkoxy, alkenyl, alkynyl, hydroxyalkyl, aryl, arylalkyl, heterocyclyl, C3-C7 cycloalkyl, hydroxy, alkoxy, aryloxy, heterocyclyloxy, methylenedioxy, alkylcarbonyloxy, arylcarbonyloxy, cycloalkenyloxy, heterocyclylcarbonyloxy, alkylideneaminooxy, carboxy, alkoxycarbonyl, aryloxycarbonyl, cycloalkyloxycarbonyl, heterocyclyloxycarbonyl, amino, ureido, alkylamino, dialkylamino, arylamino, diarylamino, heterocyclyamino, formylamino, alkylcarbonylamino, arylcarbonylamino, heterocyclylcarbonylamino, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, arylaminocarbonyl, heterocyclylaminocarbonyl, alkoxycarbonylamino, hydroxyaminocarbonyl, alkoxyimino, alkylsulfonylamino, arylsulfonylamino, heterocyclylsulfonylamino, formyl, alkylcarbonyl, arylcarbonyl, cycloalkylcarbonyl, heterocyclylcarbonyl, alkylsulfonyl, arylsulfonyl, aminosulfonyl, alkylaminosulfonyl, dialkylaminosulfonyl, arylaminosulfonyl, heterocyclylaminosulfonyl, arylthio, alkylthio, phosphonate or alkylphosphonate;
Conv.10) converting a compound of formula (I) wherein R1 is hydrogen and X is -NH- into the corresponding compound of formula (I) wherein R1 is iodine and X is a single bond, by reaction with iso-amylnitrite and diiodomethane or cesium iodide, in the presence of iodine and Cul:
Figure imgf000020_0001
(I) (I)
Conv.11) converting a compound of formula (I) wherein R1 is iodine and X is a single bond into the corresponding compound of formula (I) wherein X is -NH- and R1 is an optionally substituted aryl, by reaction with an optionally substituted arylamine of formula RI-NH2 (XVI) wherein R1 is as defined above in the presence of Pd(OAc)2 and BINAP:
Figure imgf000020_0002
Conv.12) converting a compound of formula (I) wherein R1 is iodine and X is a single bond into the corresponding compound of formula (I) wherein X is single bond and R1 is as defined in formula (I), by reaction with a compound of formula (XVII):
R1-Q (XVII)
wherein R1 is as defined above and Q is a suitable group such as -B(OH)2, -B(OAIk)2 , -Sn(Alk)4, ZnHal, or MgHal, which can undergo palladium mediated carbon bond formation:
Figure imgf000020_0003
Conv.13) converting a compound of formula (I) wherein R1 is as defined in formula (I) and X is -S- into the corresponding compound of formula (I) wherein X is -SO2- under oxidative conditions:
Figure imgf000020_0004
« (I)
Conv.14) converting a compound of formula (I) wherein R1 is as defined in formula (I) and X is -SO2- into the corresponding compound of formula (I) wherein X is -NR'- by reacting the sulfonyl group with an amine of formula R1-NHR' (XVIa) wherein R1 and R' are as defined in formula (I):
Figure imgf000021_0001
Conv.15) converting a compound of formula (I) wherein R1 is as defined in formula (I) and X is -SO2- into the corresponding compound of formula (I) wherein X is -0- by reacting the sulfonyl group with a compound of formula R1-OH (XVI II) wherein R1 is as defined in formula I) except hydrogen:
Figure imgf000021_0002
Conv.16) converting a compound of formula (I) wherein R1 is methyl and X is -0- into the corresponding compound of formula (I) wherein R1 is hydrogen and X is -0-:.
Figure imgf000021_0003
(I) (')
Conv.17) converting a compound of formula (I) wherein R1 is hydrogen and X is -0- into a compound of formula (I) wherein R1 is trifluoromethyl and X is -OSO2- b reaction with a triflating agent:
Figure imgf000021_0004
Conv.18) converting a compound of formula (I) wherein R1 is trifluoromethyl and X is -OSO2- into the corresponding compound of formula (I) wherein X is -0- and R1 is as defined in formula (I), by reaction with a compound of formula R1-OH (XVIII) wherein R1 is as defined above exce t hydrogen:
Figure imgf000021_0005
Conv.19) converting a compound of formula (I) wherein R1 is trifluoromethyl and X is -OSO2- into the corresponding compound of formula (I) wherein X is -NR'- and R1 is as defined in formula (I) except hydrogen, by reaction with a compound of formula R1-NHR' (XVIa) wherein R1 is as defined above:
Figure imgf000022_0001
Conv.20) converting a compound of formula (I) wherein R1 is trifluoromethyl and X is -OSO2- into the corresponding compound of formula (I) wherein X is -S- and R1 is as defined in formula (I) except hydrogen, by reaction with a thiol of formula R1-SH (XIX) wherein R1 is as defined above exce t hydrogen:
Figure imgf000022_0002
Conv.21) converting a compound of formula (I) wherein R1 is trifluoromethyl and X is -OSO2- into the corresponding compound of formula (I) wherein X is a single bond and R1 is as defined in formula (I) except hydrogen, by reaction with a compound of formula R1-Q (XVII) wherein R1 is as defined above except hydrogen and Q is a suitable group such as -B(OH)2, -B(OAIk)2 , -Sn(Alk)4, ZnHal, or MgHal, which can undergo palladium mediated carbon bond formation:
Figure imgf000022_0003
Conv.22) converting a compound of formula (I) wherein R1 is methyl and X is -S- into the corresponding compounds of formula (I) wherein R1 is an optionally substituted aryl and X is a single bond, by reacting it with an arylboronic acid of formula R1-B(OH)2 (XVI la), wherein R1 is an optionally substituted aryl, in the presence of a palladium derivative:
Figure imgf000022_0004
<" (I)
Conv. 23) converting a compound of formula (I) wherein A is a divalent group such as -CH2-CH2- into the corresponding compound of formula (I) wherein A is a -CH=CH- group, by treatment with an oxidizing agent, or under dehydrogenating operative conditions in the presence of a Pd or Pt catalyst:
Figure imgf000023_0001
wherein X, R1 , R2, R3 and R4 are as defined in formula (I).
Conv. 24) converting a compound of formula (I) wherein R4 is hydrogen and A is a divalent group such as -CH2-CH2- into the corresponding compound of formula (I) wherein R4 is hydrogen and A is a -CH=CH- group, by first converting to the compound of formula (XX) with an excess of N-iodosuccinimide, and by subsequently removing the iodin
Figure imgf000023_0002
wherein X, R1, R2, and R3 are as defined in formula (I) and R4 is hydrogen.
Conv. 25) removing any protecting group or groups and, if desired, forming a salt.
According to steps (st.A) of the process, an aldehyde of formula (II) is reacted with a phosphorane of formula (I II) in a suitable solvent such as, for instance, toluene, xylene, THF or Et20 at a temperature ranging from room temperature to reflux, and for a time ranging from 1 to about 12 hours. Preferably, the above reaction is carried out in toluene at reflux so to obtain a compound of formula (IV).
According to step (st.B), a compound of formula (IV) is reacted with TOSMIC, in the presence of a base such as KOH, NaH, LiN(TMS)2 in a suitable solvent such as, for instance, toluene, THF or Et20 at a temperature ranging from -78 °C to room temperature, and for a time ranging from 1 to about 12 hours. Preferably, the above reaction is carried out in presence of LiN(TMS)2 in THF at -78 °C, so as to obtain a compound of formula (V).
According to step (st.C), a compound of formula (V) wherein R3 is hydrogen, R4 is hydrogen and A is as defined in formula (I) except -CH=CH-, R2 is an optionally substituted alkoxy and R5 is an optionally substituted alkyl is converted into mono-carboxylic acid derivative (VI), in the presence of a base such as KOH, NaOH, LiOH or Na2C03 in a suitable solvent such as, for instance, H2O, dioxane or admixtures thereof at a temperature ranging from 0°C to room temperature, and for a time ranging from 1 to about 24 hours. Preferably, the above reaction is carried out in presence of LiOH in a mixture dioxane/H20 at room temperature so as to obtain a compound of formula (VI).
Alternatively according to step (st.Ca), a compound of formula (VII) is reacted with a compound of formula (VIII), in the presence of AcONa or sodium ethylate in a suitable solvent such as, for instance, H2O, EtOH or AcOH at a temperature ranging from room temperature to reflux, and for a time ranging from 1 to about 24 hours. Preferably, the above reaction is carried out in presence of AcONa in H2O at reflux so as to obtain a compound of formula (VI) wherein R3 is hydrogen, R4 is as defined above except hydrogen, and R2 and A are as defined above. According to step (st.D) of the process, a compound of formula (VI) wherein R4 is as defined in formula (I), may be converted into a compound of formula (IX) in presence of an TFAA or PPA in a suitable solvent such asTFA, at a temperature ranging from room temperature to reflux, and for a time ranging from 1 to about 8 hours. Preferably, the above reaction is carried out in presence of TFAA in TFA at room temperature so as to obtain a compound of formula (IX).
According to step (st.E) of the process, a compound of the formula (IX), wherein R3 is hydrogen atom, is reacted with a compound of formula (X), as defined above, wherein L is OH, in which case the Mitsunobu conditions can be employed, or a group that optionally upon activation may work as a leaving group, such as a halogen atom, a tosylate, mesylate or triflate.
In the former instance, that is, when a Mitsunobu protocol is employed, the reaction can be accomplished using a dialkyl azodicarboxylate, such as diethylazodicarboxylate (DEAD), diisopropyl azodicarboxylate (DIAD) or the like, in the presence of a trialkyl or triaryl phosphine, preferably triphenyl phosphine in a suitable solvent such as tetrahydrofuran, 1 ,4-dioxane, 1 ,2-dimethoxyethane, acetonitrile.
When L is an halogen or a group such as tosylate, mesylate or triflate or the like the conversion can be accomplished using a suitable base such as, for instance, NaH, K2CO3, CS2CO3, DBU, KO-f-Bu and the like, in a suitable solvent such as tetrahydrofuran, acetonitrile, N,N-dimethylformamide, Ν,Ν-dimethylacetamide and the like. Said reactions can be carried out at temperatures ranging from 0°C to reflux and for a time ranging from 30 minutes to about 48 hours.
According to step (st.F) of the process, the compound of the formula (IX) is reacted with an N,N-dimethylformamide derivative for istance with a A/,A/-dimethylformamidederivative such as A/,A/-dimethylformamide-di-ferf-butylacetale, A/,A/-dimethylformamide-diisopropylacetale, A/,A/-dimethylformamide-dimethylacetale, A/,A/-dimethylformamide- diethylacetale or tris(dimethylamino)methane in a suitable solvent such as, for instance, DMF or toluene, at a temperature ranging from room temperature to reflux, and for a time ranging from about 1 to about 48 hours. Preferably, the reaction is carried out in presence of tris(dimethylamino)methane neat or in DMF at 90 °C to obtain a compound of formula (XI).
According to step (st.G) of the process, the compound of the formula (XI) is reacted with a derivative of formula (XII) wherein X is a single bond or a divalent radical selected from -NR'-, -0- and -S- wherein R' is
as defined in formula (I), R1 is as defined in formula (I); so as to obtain a compound of the formula (I) as defined above wherein X and R1 are as defined above through pyrimidine ring formation in presence eventually of a base such as AcOK, K2CO3 or Na2C03 in a suitable solvent such as, for instance, DMF, EtOH or toluene, at a temperature ranging from room temperature to reflux, and for a time ranging from about 1 to about 48 hours. Preferably, the reaction is carried out in presence of DMF at 120 °C. Alternatively microwave irradiation can be used instead of heating.
According to conversion (conv.1) of the process, the compound of formula (I) wherein R3 is a group selected from methoxymethyl or p-methoxybenzyl may be converted into another compound of the formula (I) wherein R3 is hydrogen atom by reaction in acidic conditions, for instance with AcOH, TFA or HCI or in basic conditions, for istance NaOH and in the presence of a suitable solvent such as MeOH, DCM or dioxane, at a temperature ranging from room temperature to reflux and for a time ranging from 1 to about 12 hours.
According to conversion (conv.2) of the process, a compound of the formula (I), wherein R3 is hydrogen atom, may be converted into a compound of formula (I), wherein R2 is as defined above except hydrogen atom, by reaction with a suitable compound of the formula (X) as defined above, when L is OH, in which case the Mitsunobu conditions can be employed, or a group that optionally upon activation may work as a leaving group, such as an halogen atom, a tosylate, mesylate or triflate.
In the former instance, that is, when a Mitsunobu protocol is employed, the reaction can be accomplished using a dialkyl azodicarboxylate, such as diethylazodicarboxylate (DEAD), diisopropyl azodicarboxylate (DIAD) or the like, in the presence of a trialkyl or triaryl phosphine, preferably triphenyl phosphine in a suitable solvent such as tetrahydrofuran, 1 ,4-dioxane, 1 ,2-dimethoxyethane, acetonitrile.
When L is an halogen or a group such as tosylate, mesylate or triflate or the like the conversion can be accomplished using a suitable base such as, for instance, NaH, K2CO3, CS2CO3, DBU, KO-f-Bu and the like, in a suitable solvent such as tetrahydrofuran, acetonitrile, N,N-dimethylformamide, Ν,Ν-dimethylacetamide and the like. Said reactions can be carried out at temperatures ranging from 0°C to reflux and for a time ranging from 30 minutes to about 48 hours.
According to conversion (conv.3) of the process, a compound of the formula (I) wherein R2 is OR5 wherein R5 is an optionally substituted alkyl may be converted into the corresponding carboxylic acid derivative of the formula (I) wherein R2 is hydroxyl or their corresponding salts through basic or acidic hydrolysis conditions, widely known in the art. Preferably, the reaction is carried out in presence of NaOH in dioxane/H20 at reflux.
According to conversion (conv.4) of the process, the compound of formula (I) wherein R2 is hydroxy or a corresponding salt, may be converted into a derivative of the formula (I) wherein R2 is a group NR"R"' or N(OR"')R" wherein R" and R'" are as defined in formula (I). The reaction is carried out in presence of a compound of formula either (XIII) or (XIV) as defined above in presence of a base for example, with DIPEA or TEA, in a suitable solvent such as DCM, DMF, THF, or dioxane, and in the presence of a suitable condensing agent such as DCC, EDCI or TBTU; catalytic amounts of PyBOP or HOBt may be also required. Preferably, the reaction is carried out in presence of DIPEA and TBTU in DMF at room temperature.
Alternatively the same conversion may be obtained by first reacting the compound of formula (I) wherein R2 is hydroxy or the corresponding salt with a chlorinating agent for istance oxalyl dichloride or SOC in a suitable solvent, for instance DCM, Toluene, THF, dioxane or DMF, at a temperature ranging from room temperature to 100°C so to obtain the corresponding chloride derivative. Preferably, the reaction is carried out in presence of SOCI2 in THF at reflux.
According to conversion (conv.5) of the process, a compound of the formula (I) wherein R2 is OR5 wherein R5 is an optionally substituted alkyl, is reacted with a suitable compound of the formula (XIII) or (XIV) as defined above, in the presence of a base such as NaH, NaN(TMS)2 or LiN(TMS)2 in a suitable solvent, for instance Et20, THF or dioxane, at a temperature ranging from -10 °C to 40°C, and for a time ranging from about 10 minutes to about 12 hours, so to obtain another compound of the formula (I) wherein R2 is an amino group of formula -NR"R"' or -N(OR"')R". Preferably, the reaction is carried out in presence of LiN(TMS)2 in THF at 0 °C.
According to conversion (conv.6) of the process, replacement of bromine with -NR"R"' moiety was achieved reacting the starting material with an amine of the formula (XIII) as defined above, in a suitable solvent such as THF or dioxane, and in the presence of catalytic amounts of Pd2(dba)3, 2-dicyclohexylphosphino-2'-(N,N-dimethylamino)- biphenyl and a base such as LiN(TMS)2 at a temperature ranging from room temperature to reflux and for a time ranging from 1 to about 24 hours.
According to conversion (conv.7) of the process, the compound of formula (I) as defined above is reacted with compounds of the formula (XV) as defined above, according to conventional methods. As an example the reaction can be carried out in a suitable solvent such as DMF, DME, dioxane or CH3CN and in the presence of an optionally- substituted-aryliodine of the formula (XV) as defined above, catalytic amounts of Pd2(dba)3, BINAP or 2- (dicyclohexylphosphino)-2',4',6'-triisopropyl-1 ,1 '-biphenyl (X-phos) and a base such as K2CO3, potassium phosphate or CS2CO3, at a temperature ranging from room temperature to 110 °C and for a time ranging from 2 to about 24 hours.
According to conversion (conv.8) of the process, deprotection of the carboxylic residue into the corresponding acid can be achieved using procedure well known in the art in acidic condition for example with HCI or TFA in a suitable solvent, for instance, THF or dioxane, at a temperature ranging from room temperature to 60°C and for a time ranging from about 1 to about 12 hours.
According to conversion (conv.9) of the process, transformation of the acid residue into the corresponding amide derivatives -CONR"R"', wherein R" and R'" are as defined above, can be obtained by reaction of the acid derivatives with an amine of the formula (XIII) as defined above, under basic conditions, preferably with DIPEA or TEA, in a suitable solvent such as DCM, DMF, THF, or dioxane, and in the presence of a suitable condensing agent such as DCC, EDCI or TBTU; catalytic amounts of PyBOP or HOBt may be also required, at a temperature ranging from room temperature to 60°C and for a time ranging from about 1 to about 24 hours.
According to conversion (conv.10) of the process, compounds of formula (I) wherein R1 is iodine and X is a single bond may be prepared by the corresponding compounds of formula (I) wherein R1 is hydrogen and X is -NH-; the reaction carried out using iso-amylnitrite and diiodomethane or cesium iodide, in the presence of iodine and Cul in a suitable solvent such as THF, Et20 or DME, at a temperature ranging from room temperature to about 70°C, and for a time of about 8 hours to about 48 hours.
According to conversion (conv.11) of the process, replacement of the iodine with an arylamine of formula RI-NH2 ( XVI) may be carried out in a suitable solvent such as DMF, DME or CH3CN and in the presence of catalytic amounts of Pd(OAc)2, BINAP or Xantphos and a base such as K2CO3, potassium phosphate or CS2CO3, at a temperature ranging from room temperature to 110°C and for a time ranging from about 2 to about 24 hours.
According to conversion (conv.12) of the process, replacement of the iodine with group of formula R1 may be carried out by exploiting any of the cross-coupling reactions suitable for the formation of carbon-carbon bonds. Said reactions, which are well known in the art, imply coupling with a suitable organometal reagent such as for instance organoboron (Suzuki reaction), organotin (Stille reaction), organomagnesium (Kumada reaction), or organozinc (Negishi reaction) and the like. Preferred reaction is the Suzuki reaction where the appropriate aryl or heteroharylboronic derivative is used in the presence of a palladium based catalyst such as PdC^dpp ChbC or Pd2(dba)3 or Pd(PPhi3)4, in a suitable solvent such as DMF, DCM, MeOH, CH3CN, or in a mixture of solvents, such as dimethoxyethane and water, optionally in the presence of a base such as sodium, cesium carbonate or cesium fluoride, at a temperature ranging from room temperature to 100°C.
According to conversion (conv. 13) of the process, the transformation of thio group into the sulfonyl group can be obtained by reaction with an oxidant agent well-known to those skilled in the art, such as for instance, oxone in a suitable solvent such as tetrahydrofuran, 1 ,4-dioxane, acetone, optionally in the presence of water as co-solvent or m-chloroperbenzoic acid in the presence of a suitable solvent preferably DCM at room temperature.
According to conversion (conv. 14) of the process, the replacing of the sulfonyl group with a suitable amino derivative is preferably carried out with an amine of formula R1-NHR' (XVIa) in the presence of DMF, DME, dioxane, CH3CN, N-methyl-pyrrolidone or diglyme, at a temperature ranging from room temperature to about 100°C.
According to conversion (conv. 15) of the process, the replacing of the sulfonyl group may be easily obtained by reaction with an alcohol or phenol derivative of formula (XVIII). The reaction may be carried out in the presence of a base such as K2CO3 or Na2C03, butyl lithium, LiN(TMS)2, NaH or the like, in a suitable solvent such as DMF or THF, and by working at a temperature ranging from room temperature to about 100°C.
According to conversion (conv. 16) of the process, the removing of the methyl residue may be obtained in presence of trimethylsilylchloride and sodium iodide. The reaction may be carried out in a suitable solvent such as CH3CN, and by working at a temperature ranging from room temperature to about relfux.
According to conversion (conv.17) of the process compounds with a trifluoromethanesulfonyl group may be obtained by reacting the compounds of formula (I) wherein X is -0- and R1 is hydrogen with a triflating agent such as trifluoromethanesulfonic anhydride, trifluoromethanesulfonylchloride or N-phenyl-bis(trifluoromethanesulfonimide), optionally in the presence of a base such as TEA or DIPEA, in a suitable solvent such as DCM, THF or dioxane at a temperature ranging from -78°C to room temperature.
According to conversion (conv.18) of the process, the reaction may be carried out with an alcohol of formula (XVIII), by operating in a suitable solvent such as dioxane, THF, DME, CH3CN, DMF or DMSO, at a temperature ranging from room temperature to about 90°C, optionally in the presence of a base such as K2CO3, potassium tert butoxide or NaH.
Alternatively the reaction may be carried out in a suitable solvent such as toluene, DMF, DME or CH3CN, in the presence of Pd(OAc)2, (+)-BINAP and a base such as potassium phosphate or K2CO3 or CSCO3 at a temperature ranging from 0°C to 100°C.
According to conversion (conv.19) of the process, compounds of formula (I) wherein R1 is as defined in formula (I) except hydrogen and X is -NR'- can be obtained from the corresponding trifluoromethanesulfonyl compounds with an amine of formula R1-NHR' (XVIa). The reaction is typically obtained by operating in a suitable solvent such as dioxane, THF, DME, CH3CN, DMF or DMSO, at a temperature ranging from room temperature to 90°C, optionally in the presence of a base such as K2CO3 or TEA. According to conversion (conv.20) of the process, compounds of formula (I) wherein R1 is as defined in formula (I) except hydrogen and X is -S-, can be obtained from the corresponding trifluoromethanesulfonyl compounds. The conversion is carried out by reaction with a thiol of formula R1-SH (XIX) wherein R1 is as defined above in a suitable solvent such as THF, DMF, DCM, MeOH, DME or CH3CN, at a temperature ranging from room temperature to 100°C.
According to conversion (conv.21) of the process, compounds of formula (I), wherein R1 is as defined above, can be obtained by the corresponding trifluoromethanesulfonyl. The conversion is carried out by reaction with derivatives of formula (XVII) in a suitable solvent such as DMF, DCM, MeOH, DME or CH3CN, in the presence of Pd2(dba)3, PdC (dppf) or Pd(PPh3)4, optionally in the presence of cesium fluoride, at a temperature ranging from room temperature to 100°C.
According to conversion (conv.22) of the process, compounds of formula (I) wherein R1 is an optionally substituted aryl and X is single bond, can be obtained by the corresponding compounds of formula (I) wherein X is -S- and R1 is methyl. The conversion is carried out by reaction with boronic acids of formula (XVI I a) in a suitable solvent such as DMF, THF, DCM, MeOH, DME or CH3CN, in the presence of CuTC and Pd2(dba)3 or Pd(PPh3)4, optionally in the presence of cesium fluoride, at a temperature ranging from room temperature to reflux.
According to conversion (conv. 23) of the process, a compound of formula (I) wherein A is -(CH2)2- can undergo dehydrogenation in the presence of an optionally supported palladium or platinum or 2,3-Dichloro-5,6-dicyano-1 ,4- benzoquinone (DDQ), so as to obtain the corresponding aromatic derivative of formula (I), by operating in a suitable solvent such as toluene, 1 ,4-dioxane, chlorobenzene, dichlorobenzene, at a temperature ranging from 90°C to reflux, for a time varying between 2 hours to 8 hours.
According to conversion (conv.24) of the process, a compound of formula (I) wherein R4 is hydrogen and A is - (CH2)2- can be reacted with an excess of N-iodosuccinimde in DMF at room temperature so to obtain a compound of formula (XX) which is subsequently dehalogenated in presence of a palladium catalyst, for example Tetrakis (triphenylphosphine) Palladium and sodiumformiate so as to obtain the corresponding aromatic derivative of formula (I) by operating in a suitable solvent such as A/,A/-dimethylformamide, at a temperature ranging from 90°C to reflux, for a time varying between 2 hours to 8 hours.
According to conversion (conv. 25) of the process, the deprotection of the nitrogen atom of a compound of formula (I) wherein R' is a protecting group, can be accomplished according to conventional methods enabling the selective hydrolysis of ferf-butoxycarbonyl, benzyl, 4-methoxybenzyl, 2,4-dimethoxybenzyl, and triphenylmethyl protective groups. Preferably this reaction is run under acidic conditions, for instance in the presence of an inorganic or organic acid such as hydrochloric, trifluoroacetic or methansulfonic acid, in a suitable solvent such as DCM, 1,4-dioxane, a lower alcohol, such as methanol or ethanol, at a temperature ranging from room temperature to reflux and for a period of time ranging from about 1 hour to about 48 hours.
According to any variant of the process for preparing the compounds of formula (I), the starting material and any other reactant is known or easily prepared according to known methods.
The compound of the formula (II) wherein A is -CH2- and R5 is methyl is commercially available. The compound of the formula (II) wherein A is -(CH2)2- and R5 is methyl can be prepared as described in J. Org. Chem., 1998 ,63(5), 1668.
The compound of the formula (II) wherein A is -(ΟΗ2)3- and R5 is methyl can be prepared as described in European Journal of Organic Chemistry, 2008 , 23, 3917.
The compound of the formula (II) wherein A is -C(CH3)2-CH2- and R5 is methyl can be prepared as described in US5750769.
The compound of the formula (II) wherein A is -CH2-C(CH3)2- and R5 is methyl can be prepared as described in J. Org. Chem., 1964 , 29, 801.
The compounds of the formula (III) wherein R2 is methyl, ethyl and t-buthyl are commercially available.
The compound of the formula (VII) wherein A IS -CH2CH2- can be prepared as described in US2010/160318.
The compound of the formula (VIII) wherein R2 is ethoxy and R4 is methyl is commercially available.
The compounds of the formula (X), (XII), (XIII), (XIV), (XV), (XVI), (XVIa), (XVII) and (XVI la) are either commercially available or can be prepared with known methods.
EXAMPLES
The synthetic preparation of some compounds of the formula (I) of the invention is described in the following examples.
The compounds of the present invention, as prepared according to the following examples, were also characterized by 1H NMR or by HPLC/MS analytical data; HPLC/MS data were collected following any one of methods 1 , 2, 3 and 4.
HPLC/MS Analytic Method 1
The HPLC equipment consisted of a Waters Acquity™ UPLC system equipped with a Waters 2996 PDA detector, a Waters Acquity ELSD™ detector and Waters mod. SQD single quadrupole mass spectrometer, equipped with an electrospray (ESI) ion source. Instrument control, data acquisition and data processing were provided by Empower 2 and MassLynx 4.1 softwares.
HPLC was carried out at 45°C at a flow rate of 0.7 mL/min using a Waters Acquity™ BEH C 18, 1.7 microm, 50 x 2.1 mm column. Mobile phase A was 0.1 % trifluoro acetic acid in H2O/ CH3CN (95:5), and mobile phase B was H2O/CH3CN (5:95); the gradient was from 5 to 95% B in 2 minutes then hold 95% B 0.1 minutes. The injection volume was 0.8 microL. The mass spectrometer was operated in positive and in negative ion mode, the capillary voltage was set up at 3 KV (ES+ and ES ); cone was 30 V (ES+ and ES ); the source temperature was 120°C; full scan, mass range from 100 to 800 amu was set up.
HPLC/MS Analytic Method 2
The HPLC equipment consisted of a Waters Alliance™ HT 2795 system equipped with a Waters 2996 PDA detector and Waters mod. ZQ 2000 single quadrupole mass spectrometer, equipped with an electrospray (ESI) ion source. Instrument control, data acquisition and data processing were provided by Empower 2 and MassLynx 4.1 softwares. HPLC was carried out at 25°C at a flow rate of 1.0 mL/min using a Phenomenex Gemini C18, 3 microm, 50 x 4.6 mm column. Mobile phase A was ammonium acetate 5mM pH=5.2 buffer with CH3CN (95:5), and mobile phase B was H20/ CH3CN (5:95); the gradient was from 10 to 90% B in 8 minutes then ramp to 100% B in 0.1 minutes. The injection volume was 10 microL. The mass spectrometer was operated in positive and in negative ion mode, the capillary voltage was set up at 3.5 kV (ES+) and 2.8 kV (ES ); cone voltage was 14 V (ES+) and 28 V (ES ); the source temperature was 120°C; full scan, mass range from 100 to 800 amu was set up.
HPLC/MS Analytical Method 3
The HPLC equipment consisted of a Waters 2790 HPLC system equipped with a 996 Waters PDA detector and Waters mod. ZQ 2000 single quadrupole mass spectrometer, equipped with an electrospray (ESI) ion source. Instrument control, data acquisition and data processing were provided by Empower 2 and MassLynx 4.1 software. HPLC was carried out at 25°C at a flow rate of 1 mL/min using a RP18 Waters X Terra 3 microm (3.0 x 20 mm) column. Mobile phase A was ammonium hydroxide 0.05% pH=10 buffer with CH3CN (95:5), and Mobile phase B was H20/ CH3CN (5:95); the gradient was from 10 to 90% B in 4 minutes then hold 90% B 1 minute. The injection volume was 10 microL. The mass spectrometer was operated in positive and in negative ion mode, the capillary voltage was set up at 2.5 KV; the source temperature was 120°C; cone was 10 V; full scan, mass range from 100 to 800 amu was set up.
Several compounds of the invention of the formula (I), as prepared according to the following examples, were purified by preparative HPLC.
The operative conditions are defined below:
HPLC/MS Preparative Method 1
The HPLC equipment consisted of a Waters FractionLynx™ System equipped with a 2996 Waters PDA detector and Waters mod. ZQ 2000 single quadrupole mass spectrometer, equipped with an electrospray (ESI) ion source. Instrument control, data acquisition and data processing were provided by Empower 2 and MassLynx 4.1 software. HPLC was carried out at 25°C at a flow rate of 20 mL/min using a RP18 Waters X Terra 10 microm (19 x 250 mm) column. Mobile phase A was ammonium hydroxide 0.05% pH=10 buffer with CH3CN (95:5), and Mobile phase B was CH3CN; the gradient was from 10 to 90% B in 15 minutes then hold 90% B 3 minutes. The injection volume was 200 microL.
The mass spectrometer was operated in positive and in negative ion mode, the capillary voltage was set up at 2.5 KV; the source temperature was 120°C; cone was 10 V; full scan, mass range from 100 to 800 amu was set up. HPLC/MS Preparative Method 2
The HPLC equipment consisted of a FractionLynx™ System equipped with a 2996 Waters PDA detector and Waters mod. ZQ 2000 single quadrupole mass spectrometer, equipped with an electrospray (ESI) ion source. Instrument control, data acquisition and data processing were provided by Empower 2 and MassLynx 4.1 software.
HPLC was carried out at 25°C at a flow rate of 20 mL/min using a RP18 Waters X Terra 10 microm (19 x 250 mm) column. Mobile phase A was 0.1% TFA in H2O /CH3CN (95:5), and mobile phase B was CH3CN; the gradient was from 10 to 90% B in 15 minutes then hold 90% B 3 minutes. The injection volume was 200 microL.
The mass spectrometer was operated in positive and in negative ion mode, the capillary voltage was set up at 2.5 KV; the source temperature was 120°C; cone was 10 V; full scan, mass range from 100 to 800 amu was set up. MS exact Exact mass data ESI(+) were obtained on a Waters Q-Tof Ultima directly connected with micro HPLC 1100 Agilent as previously described (M. Colombo, F. Riccardi-Sirtori, V. Rizzo, Rapid Commun. Mass Spectrom. 2004, 18, 511- 517).
NMR
1H-NMR spectra were recorded at a constant temperature of 28°C on a Varian INOVA 400 spectrometer operating at 400.50 MHz and equipped with a 5 mm z-axis PFG Indirect Detection Probe (1H{15N-31P}).
Chemical shifts were referenced with respect to the residual solvent signals (DMSO-d6: 2.50 ppm for 1H, where not otherwise specified). Data are reported as follows: chemical shift (δ), multiplicity (s = singlet, d = doublet, t = triplet, q = quartet, br. s = broad singlet, td = triplet of doublets, dd = doublet of doublets, ddd = doublet of doublets of doublets, m = multiplet, spt = septet), coupling constants (J, Hz), and number of protons.
In the examples below as well as troughout the application, the following abbreviations have the following meanings.
If not defined, the terms have their generally accepted meanings.
ABBREVIATIONS
AcOEt Ethyl acetate
AcOH Acetic acid
AcONa Sodium acetate
BINAP (2,2'-Bis(diphenylphosphino)-1 , 1 '-binaphtalene
CH3CN Acetonitrile
Cs2C03 Cesium carbonate
CuTC Copper(l) thiophencarboxylate
Cul Copper(l) iodide
DCC Λ/,Λ/'-dicyclohexylcarbodiimide
DCM Dichloromethane
DIPEA A/,A/-diisopropyethylamine
DME 1 ,2-Dimethoxyethane
DMF A/,A/-dimethylformamide
DMSO Dimethyl sulfoxide
EDCI A/-ethyl-A/',A/'-diisopropyl carbodiimide hydrochloride
Et20 Diethyl ether
EtOH Ethanol
HCI Hydrochloric acid
HOBt 1 /7-benzotriazol-1-ol
K2CO3 Potassium carbonate
KH2PO4 Potassium dihydrogen phosphate
KOH Potassium hydroxide
LiN(TMS)2 Lithium bis(trimethylsilyl)amide
LiOH Litium hydroxide
MeOH Methanol
Na2C03 Sodium carbonate
Na2S203 Sodium thiosulfate
Na2S205 Sodium metabisulphite
Na2S04 Sodium sulfate
NaH Sodium hydride
NaH2P04 Sodium dihydrogen phosphate
NaHC03 Sodium hydrogen carbonate
NaOH Sodium hydroxide
Pd(OAc)2 Palladium(ll) acetate Pd(PPh3)4 Tetrakis (triphenylphosphine) Palladium
Pd2(dba)3 Tris(dibenzylideneacetone)dipalladium(0)
PdCI2(dppf) [1 ,1 '-bis(diphenylphosphino)ferrocene]palladium(ll) chloride
PPA Polyphosphoric acid
PyBOP (Benzotriazol-l-yloxy)tripyrrolidinophosphonium hexafluorophosphate
SOCI2 Thionyl chloride
TBTU 0-(benzotriazol-1-yl)-N,N,N',N'-tetramethyluronium tetrafluoroborate
TEA Triethyl amine
TFA Trifluoro acetic acid
TFAA Trifluoro acetic anhydride
THF Tetrahydrofurane
TOSMIC Tosylmethyl isocyanide
Xantphos 4,5-Bis(diphenylphosphino)-9,9-dimethylxanthene
Preparation A (step A)
Dimethyl (
Figure imgf000032_0001
A solution of methyl 5-oxopentanoate (1.9 g, 14.6 mmol) and (carboethoxymethylene) triphenylphosphorane (5.0 g, 14.9 mmol) in toluene (50 mL) was refluxed for 8 hours. Solvent was removed under vacuo and the crude was purified by flash chromatography on silica gel (eluant: AcOEt/hexane 2/8) to give 1.32 g (48 % yield) as colorless oil of the title compound.
1H NMR (401 MHz, DMSO-d6) δ ppm 1.61 - 1.75 (m, 2 H) 2.16 - 2.27 (m, 2 H) 2.27 - 2.35 (m, 2 H) 3.58 (s, 3 H) 3.64 (s, 3 H) 5.87 (dt, J=15.65, 1.56 Hz, 1 H) 6.87 (dt, J=15.65, 6.94 Hz, 1 H)
According to this same methodology, but employing suitable substituted derivatives, the following compounds were prepared:
dimethyl (2Z)-5,5-dimethylhept-2-enedioate
1H NMR (401 MHz, DMSO-d6) δ ppm 0.98 (s, 6 H) 2.24 (s, 2 H) 2.63 (dt, J=7.75, 1.65 Hz, 2 H)) 3.57 (m, 3 H) 3.62 (s, 3 H) 5.90 (dt, J=11.60, 1.65 Hz, 1 H) 6.38 (dt, J=11.60, 7.75 Hz, 1 H)
dimethyl (2E)-5,5-dimethylhept-2-enedioate
1H NMR (401 MHz, DMSO-d6) δ ppm 0.96 (s, 6 H) 2.21 (s, 2 H) 2.22-2.24 (m, 2 H) 3.58 (s, 3 H) 3.65 (s, 3 H) 5.90 (dt, J=15.50, 5.85 Hz, 1 H) 6.88 (dt, J = 15.50, 7.80 Hz, 1 H)
dimethyl (2E)-hex-2-enedioate
dimethyl (2E)-oct-2-enedioate
1H NMR (401 MHz, DMSO-d6) δ ppm 1.36 - 1.47 (m, 4 H) 1.37 -1.57 (m, 2 H) 2.20 (qd, J=7.05, 1.60 Hz, 2 H) 2.31 (t, J=7.32 Hz, 2 H) 3.58 (s, 3 H) 3.64 (s, 3 H) 5.88 (dt, J=15.65, 1.60 Hz, 1 H) 6.87 (dt, J=15.65, 7.05 Hz, 1 H)
1 -ethyl 8-methyl (2E)-oct-2-enedioate
1H NMR (401 MHz, DMSO-d6) δ ppm 1.20 (t, J=7.16 Hz, 3 H) 1.36 - 1.46 (m, 2 H) 1.47 - 1.57 (m, 2 H) 2.20 (qd, J=7.10, 1.46 Hz, 2 H) 2.31 (t, J=7.14 Hz, 2 H) 3.58 (s, 3 H) 4.10 (q, J=7.16 Hz, 2 H) 5.86 (dt, J=15.56, 1.46 Hz, 1 H) 6.86 (dt, J=15.56, 7.10 Hz, 1 H) 1-ethyl 7-methyl (2E)-5,5-dimethylhept-2-enedioate
1H NMR (401 MHz, DMSO-d6) δ ppm 0.96 (s, 6 H) 1.21 (t, J=7.08 Hz, 3 H) 2.21 (s, 2 H) 2.22 (dd, J=7.87, 1.30 Hz, 2 H) 3.58 (s, 3 H) 4.11 (q, J=7.08 Hz, 2 H) 5.88 (dt, J=15.47, 1.30 Hz, 1 H) 6.86 (dt, J=15.47, 7.87 Hz, 1 H)
1-ethyl 7-methyl (2E)-hept-2-enedioate
1H NMR (401 MHz, DMS0-d6) δ ppm 1.20 (t, J=7.14 Hz, 3 H) 1.68 (quin, J=7.30 Hz, 2 H) 2.15 - 2.27 (m, 2 H) 2.31 (t, J=7.30 Hz, 2 H) 3.58 (s, 3 H) 4.11 (q, J=7.14 Hz, 2 H) 5.85 (dt, J=15.65, 1.59 Hz, 1 H) 6.86 (dt, J=15.65, 6.94 Hz, 1 H)
Preparation B (step B)
Methyl 4-(4-methoxy-4-oxobutyl)-1 H-pyrrole-3-carboxylate
Figure imgf000033_0001
To a 1 M solution of LiN(TMS)2 in THF (5.9 mL, 5.9 mmol) cooled ate -78 °C under argon was added a solution of TOSMIC (1.15 g, 5.9 mmol) in THF (15 mL) dropwise. After 40 min at -78 °C a solution of dimethyl (2E)-hept-2- enedioate (1.1 g, 5.9 mmol) in THF (15 mL) at -78 °C was added slowly. The solution was stirred for 10 min, then the cold bath was removed and the reaction was allowed to warm at room temperature. THF was evaporated and the residue partioned between H2O (200 mL) and DCM (200 mL). Acqueous layer was extracted with DCM and the combined organic layers anidrified on Na2S04, filtered and concentred to give a residue which was chromatographed on silica gel (eluant: AcOEt/hexane 3/7) to afford 633 mg (yield: 40 %) of the title compound as white solid.
1H NMR (401 MHz, DMSO-d6) δ ppm 1.77 (quin, J=7.45 Hz, 2 H) 2.28 (t, J=7.45 Hz, 2 H) 2.62 (t, J=7.45 Hz, 2 H) 3.57 (s, 3 H) 3.66 (s, 3 H) 6.60 (t, J=2.20 Hz, 1 H) 7.32 (dd, J=3.17, 2.20 Hz, 1 H) 11.15 (br. s., 1 H)
According to this same methodology, but employing suitable substituted derivatives, the following compounds were prepared:
methyl 4-(4-methoxy-2,2-dimethyl-4-oxobutyl)-1 H-pyrrole-3-carboxylate
1H NMR (401 MHz, DMSO-d6) δ ppm 0.90 (s, 6 H) 2.06 (s, 2 H) 2.74 (s, 2 H) 3.65 (s, 3 H) 6.60 (s, 1 H) 7.33 (t,
J=2.56 Hz, 1 H) 11.21 (br. s., 1 H) 11.84 (br. s., 1 H)
methyl 4-(3-methoxy-3-oxopropyl)-1 H-pyrrole-3-carboxylate
1H NMR (401 MHz, DMSO-d6) δ ppm 2.52 - 2.58 (m, 2 H) 2.83 - 2.90 (m, 2 H) 3.58 (s, 3 H) 3.67 (s, 3 H) 6.60 (t,
J=2.25 Hz, 1 H) 7.33 (dd, J=3.17, 2.25 Hz, 1 H) 11.16 (br. s., 1 H)
methyl 4-(5-methoxy-5-oxopentyl)-1 H-pyrrole-3-carboxylate
MS calculated: 240.1231 ; MS found: 240.1226
ethyl 4-(4-methoxy-2,2-dimethyl-4-oxobutyl)-1 H-pyrrole-3-carboxylate
1H NMR (401 MHz, DMSO-d6) δ ppm 0.89 (s, 6 H) 1.24 (t, J=7.08 Hz, 3 H) 2.15 (s, 2 H) 2.73 (s, 2 H) 3.56 (s, 3 H)
4.12 (q, J=7.08 Hz, 2 H) 6.59 (t, J=2.30 Hz, 1 H) 7.31 (dd, J=3.11 , 2.30 Hz, 1 H) 11.21 (br. s., 1 H)
ethyl 4-(4-methoxy-4-oxobutyl)-1 H-pyrrole-3-carboxylate 1H NMR (401 MHz, DMSO-d6) δ ppm 1.24 (t, J=7.14 Hz, 3 H) 1.70 - 1.83 (m, 2 H) 2.28 (t, J=7.51 Hz, 2 H) 2.61 (t, J=7.51 Hz, 2 H) 3.57 (s, 3 H) 4.13 (q, J=7.14 Hz, 1 H) 6.59 (t, J=2.20 Hz, 1 H) 7.31 (dd, J=3.17, 2.20 Hz, 1 H) 11.13 (br. s., 1 H)
Preparation C (step C)
4-[4-(methoxycarbonyl)-1 H-pyrrol-3-yl]butanoic acid
Figure imgf000034_0001
Methyl 4-(4-methoxy-4-oxobutyl)-1 H-pyrrole-3-carboxylate (50 mg, 0.220 mmol) was suspended in anhydrous dioxane (2 mL) and H2O (0.5 mL) and LiOH (5.3 mg, 0.220 mmol) was added. The reaction mixture was stirred at room temperature for 4 h. Reaction solution was acidified with 1 N HCI and AcOEt (50 mL) and H2O (20 mL) were added. Acqueous layer was extracted with AcOEt and the combined organic layers anidrified on Na2S04, filtered and concentrated to give 46 mg (quantitative yield) of the title compound as a white solid.
MS calculated: 212.0918; MS found: 212.0917
1H NMR (401 MHz, DMSO-d6) δ ppm 1.74 (quin, J=7.50 Hz, 2 H) 2.19 (t, J=7.50 Hz, 2 H) 2.62 (t, J=7.50 Hz, 2 H) 3.66 (s, 3 H) 6.60 (t, J=2.05 Hz, 1 H) 7.32 (dd, J=3.10, 2.05 Hz, 1 H) 11.14 (br. s., 1 H) 11.93 (br. s., 1 H)
According to this same methodology, but employing suitable substituted derivatives, the following compounds were prepared:
4- [4-(methoxycarbonyl)-1 H-pyrrol-3-yl]-3,3-dimethylbutanoic acid
MS calculated: 240.1230; MS found: 240.1229
1H NMR (401 MHz, DMSO-d6) δ ppm 0.90 (s, 6 H) 2.06 (s, 2 H) 2.74 (s, 2 H) 3.65 (s, 3 H) 6.60 (s, 1 H) 7.33 (t, J=2.56 Hz, 1 H) 11.21 (br. s., 1 H) 11.84 (br. s., 1 H)
3- [4-(methoxycarbonyl)-1 H-pyrrol-3-yl]propanoic acid
1H NMR (401 MHz, DMSO-d6) δ ppm 2.45 (t, J=7.50 Hz, 2 H) 2.84 (t, J=7.50 Hz, 2 H) 3.67 (s, 3 H) 6.60 (t, J=2.20 Hz, 1 H) 7.33 (dd, J=3.17, 2.20 Hz, 1 H) 11.15 (br. s., 1 H) 11.96 (br. s., 1 H)
5- [4-(methoxycarbonyl)-1 H-pyrrol-3-yl]pentanoic acid
MS calculated: 248.0893; MS found: 248.0896
1H NMR (401 MHz, DMSO-d6) δ ppm 1.45 - 1.56 (m, 4 H) 2.20 (t, J=6.90 Hz, 2 H) 2.60 (t, J=6.90 Hz, 2 H) 3.66 (s, 3 H) 6.59 (t, J=2.20 Hz, 1 H) 7.31 (dd, J=3.17, 2.20 Hz, 1 H) 11.11 (br. s., 1 H) 11.92 (br. s., 1 H)
4- [4-(ethoxycarbonyl)-1 H-pyrrol-3-yl]-3,3-dimethylbutanoic acid
4-[4-(ethoxycarbonyl)-1 H-pyrrol-3-yl]butanoic acid
1H NMR (401 MHz, DMSO-d6) δ ppm 1.24 (t, J=7.08 Hz, 3 H) 1.74 (quin, J=7.50 Hz, 2 H) 2.19 (t, J=7.50 Hz, 2 H) 2.61 (t, J=7.50 Hz, 2 H) 4.14 (q, J=7.08 Hz, 2 H) 6.59 (t, J=2.20 Hz, 1 H) 7.31 (dd, J=3.17, 2.20 Hz, 1 H) 11.12 (br. s., 1 H) 11.92 (br. s., 1 H)
Preparation D (step Ca)
4-[4-(ethoxycarbonyl)-5-methyl-1 H-pyrrol-3-yl]butanoic acid
Figure imgf000035_0001
6-amino-5-oxohexanoic acid hydrochloride (9.73 g, 49.8 mmol) was dissolved in H2O (35 mL), and ethyl acetoacetate (5.51 g, 42.34 mmol) and AcONa (20.3 g, 14.95 mmol) were added to the above-mentioned solution. The reaction solution was refluxed for 1 h, cooled to room temperature and 0.5N HCI was added until a pH of about 5 was reached. The combined organic layers were anidrified on Na2S04, filtered and concentred to give 7.15 g (yield: 60 %) of the title compound as brown solid.
MS calculated: 240.1231 ; MS found: 240.1225
1H NMR (401 MHz, DMSO-d6) δ ppm 1.25 (t, J=7.14 Hz, 3 H) 1.71 (quin, J=7.50 Hz, 2 H) 2.18 (t, J=7.50 Hz, 2 H) 2.36 (s, 3 H) 2.56 (t, J=7.50 Hz, 2 H) 4.13 (q, J=7.14 Hz, 2 H) 6.39 (d, J=2.32 Hz, 1 H) 10.91 (br. s., 1 H) 11.90 (br. s., 1 H)
Preparation E (step D)
Methyl 7-oxo-4,5,6,7
Figure imgf000035_0002
4-[4-(methoxycarbonyl)-1 H-pyrrol-3-yl]butanoic acid (500mg, 2.36 mmol) was dissolved in TFA (3 mL). TFAA (0.329 mL, 2.36 mmol) was added and the reaction was stirred at room temperature for 1 h. Organic solvent was evaportated to dryness and the residue suspended in Et20 (15 mL) and filrated to give 320 mg (yield: 64%) of the title compound as a light yellow solid.
1H NMR (401 MHz, DMSO-d6) δ ppm 2.02 (quin, J=6.30 Hz, 2 H) 2.40 (t, J=6.30 Hz, 2 H) 2.91 (t, J=6.30 Hz, 2 H) 3.72 (s, 3 H) 7.58 (d, J=3.42 Hz, 1 H) 12.38 (br. s., 1 H)
According to this same methodology, but employing suitable substituted derivatives, the following compounds were prepared:
methyl 5,5-dimethyl-7-oxo-4,5,6,7-tetrahydro-1 H-indole-3-carboxylate
1H NMR (401 MHz, DMSO-d6) δ ppm 0.97 (s, 6 H) 2.30 (s, 2 H) 2.82 (s, 2 H) 3.72 (s, 3 H) 7.60 (d, J=3.42 Hz, 1 H) 12.38 (br. s., 1 H)
methyl 6-oxo-1 ,4,5,6-tetrahydrocyclopenta[b]pyrrole-3-carboxylate
1H NMR (401 MHz, DMSO-d6) δ ppm 2.71 - 2.80 (m, 2 H) 2.87 - 2.93 (m, 2 H) 3.74 (s, 3 H) 7.85 (s, 1 H) 12.37 (br. s., 1 H)
methyl 8-oxo-1,4,5,6,7,8-hexahydrocyclohepta[b]pyrrole-3-carboxylate
1H NMR (401 MHz, DMSO-d6) δ ppm 1.70 - 1.80 (m, 2 H) 1.81 - 1.89 (m, 2 H) 2.59 - 2.65 (m, 2 H) 3.06 - 3.15 (m, 2 H) 3.70 (s, 3 H) 7.51 (d, J=3.66 Hz, 1 H) 12.01 (br. s., 1 H)
ethyl 5,5-dimethyl-7-oxo-4,5,6,7-tetrahydro-1 H-indole-3-carboxylate 1H NMR (401 MHz, DMSO-d6) δ ppm 1.03 (s, 6 H) 1.26 (t, J=7.08 Hz, 3 H) 2.30 (s, 2 H) 2.83 (s, 2 H) 4.19 (q, J=7.08 Hz, 2 H) 7.57 (d, J=3.42 Hz, 1 H) 12.36 (br. s., 1 H)
ethyl 7-oxo-4,5,6,7-tetrahydro-1 H-indole-3-carboxylate
1H NMR (401 MHz, DMS0-d6) δ ppm 1.24 (t, J=7.08 Hz, 3 H) 1.74 (quin, J=7.50 Hz, 2 H) 2.19 (t, J=7.50 Hz, 2 H) 2.61 (t, J=7.50 Hz, 2 H) 4.14 (q, J=7.08 Hz, 2 H) 6.59 (t, J=2.20 Hz, 1 H) 7.31 (dd, J=3.17, 2.20 Hz, 1 H) 11.12 (br. s., 1 H) 11.92 (br. s., 1 H)
ethyl 2-methyl-7-oxo-4,5,6,7-tetrahydro-1 H-indole-3-carboxylate
MS calculated: 222.1125; MS found: 222.1136
1H NMR (401 MHz, DMSO-d6) δ ppm 1.27 (t, J=7.08 Hz, 3 H) 1.99 (quin, J=6.30 Hz, 2 H) 2.36 (t, J=6.30 Hz, 2 H) 2.43 (s, 3 H) 2.87 (t, J=6.30 Hz, 2 H) 4.18 (q, J=7.08 Hz, 2 H) 12.15 (br. s., 1 H)
Preparation F (step E)
Methyl 1-methyl-7-oxo-4,5, -tetrahydro-1 H-indole-3-carboxylate
Figure imgf000036_0001
To a solution of methyl 7-oxo-4,5,6,7-tetrahydro-1 H-indole-3-carboxylate (300 mg, 1.55 mmol) in dry DMF (5 mL) K2CO3 (429 mg, 3.10 mmol) and methyl iodide (0.193 mL, 3.10 mmol) were added. The reaction was stirred at room temperature for 3 h, then H2O was added (100 mL) and the product extracted with DCM (3x30 mL). The organic fractions were dried over Na2S04, filtered, and concentrated in vacuo to give 305 mg (yield: 95%) as light yellow solid.
1H NMR (401 MHz, DMSO-d6) δ ppm 1.95 - 2.03 (m, 2 H) 2.40 (t, J=6.15 Hz, 2 H) 2.91 (t, J=6.04 Hz, 2 H) 3.72 (s, 3 H) 3.85 (s, 3 H) 7.71 (s, 1 H)
According to this same methodology, but employing suitable substituted derivatives, the following compounds were prepared:
methyl 1-methyl-6-oxo-1,4,5,6-tetrahydrocyclopenta[b]pyrrole-3-carboxylate
MS calculated: 194.0812; MS found: 194.0810
1H NMR (401 MHz, DMSO-d6) δ ppm 2.72 - 2.81 (m, 2 H) 2.83 - 2.92 (m, 2 H) 3.73 (s, 3 H) 3.74 (s, 3 H) 7.81 - 7.91 (m, 1 H)
methyl 1,5,5-trimethyl-7-oxo-4,5,6,7-tetrahydro-1 H-indole-3-carboxylate
MS calculated: 236.1281 ; MS found: 236.1281
1H NMR (401 MHz, DMSO-d6) δ ppm 1.02 (s, 6 H) 2.30 (s, 2 H) 2.83 (s, 2 H) 3.72 (s, 3 H) 3.85 (s, 3 H) 7.72 (s, 1 H) methyl 1-methyl-8-oxo-1,4,5,6,7,8-hexahydrocyclohepta[b]pyrrole-3-carboxylate
1H NMR (401 MHz, DMSO-d6) δ ppm 1.60 - 1.74 (m, 4 H) 2.53 - 2.62 (m, 2 H) 3.13 (t, J=6.04 Hz, 2 H) 3.68 (s, 3 H) 3.78 (s, 3 H) 7.66 (s, 1 H)
ethyl 1,5,5-trimethyl-7-oxo-4,5,6,7-tetrahydro-1 H-indole-3-carboxylate
MS calculated: 250.1438; MS found: 250.1444 1H NMR (401 MHz, DMSO-d6) δ ppm 1.02 (s, 6 H) 1.26 (t, J=7.08 Hz, 3 H) 2.30 (s, 2 H) 2.83 (s, 2 H) 3.85 (s, 3 H) 4.19 (q, J=7.08 Hz, 2 H) 7.70 (s, 1 H)
ethyl 1-methyl-7-oxo-4,5,6,7-tetrahydro-1 H-indole-3-carboxylate
MS calculated: 222.1125; MS found: 222.1134
1H NMR (401 MHz, DMSO-d6) δ ppm 1.26 (t, J=7.16 Hz, 3 H) 1.93 - 2.05 (m, 2 H) 2.40 (t, J=6.10 Hz, 2 H) 2.92 (t,
J=6.10 Hz, 2 H) 3.86 (s, 3 H) 4.19 (q, J=7.16 Hz, 2 H) 7.70 (s, 1 H)
ethyl 1-(methoxymethyl)-2-methyl-7-oxo-4,5,6,7-tetrahydro-1 H-indole-3-carboxylate
MS calculated: 266.1387; MS found: 266.1376
1H NMR (401 MHz, DMSO-d6) δ ppm 1.29 (t, J=7.12 Hz, 3 H) 1.92 - 2.03 (m, 2 H) 2.39 - 2.45 (m, 2 H) 2.53 (s, 3 H) 2.93 (t, J=6.16 Hz, 2 H) 3.19 (s, 3 H) 4.22 (q, J=7.12 Hz, 2 H) 5.75 (s, 2 H)
ethyl 1,2-dimethyl-7-oxo-4,5,6,7-tetrahydro-1 H-indole-3-carboxylate
MS calculated: 236.1281 ; MS found: 236.1283
1H NMR (401 MHz, DMSO-d6) δ ppm 1.28 (t, J=7.08 Hz, 3 H) 1.95 (quin, J=6.25 Hz, 2 H) 2.38 (t, J=6.25 Hz, 2 H) 2.48 (s, 3 H) 2.90 (t, J=6.25 Hz, 2 H) 3.83 (s, 3 H) 4.20 (q, J=7.08 Hz, 2 H)
Preparation G (step F)
Methyl (6E)-6-[(dimethylam indole-3-carboxylate
Figure imgf000037_0001
Methyl 1-methyl-7-oxo-4,5,6,7-tetrahydro-1 H-indole-3-carboxylate (288 mg, 1.39 mmol) was treated with tris(dimethylamino)methane (2.4 mL, 13.9 mmol) and the reaction mixture was stirred at 90 °C for 10 h. Volatiles were removed under reduced pressure and the residue used without further purification.
According to this same methodology, but employing suitable substituted derivatives, the following compounds were prepared:
methyl (6E)-5,5-dimethyl-6-[(methylamino)methylidene]-7-oxo-4,5,6J-tetrahydro-1 H-indole-3-carboxylate
MS calculated: 263.1390; MS found: 263.1384
1H NMR (401 MHz, DMSO-d6) δ ppm 1.15 (s, 6 H) 2.74 (s, 2 H) 2.97 (d, J = 5.05 Hz, 3 H) 3.64 - 3.73 (m, 3 H) 6.91 (d, J=12.30 Hz, 1 H) 7.40 (d, J=3.30 Hz, 1 H) 9.58 (dd, J=12.30, 5.05 Hz, 1 H) 12.00 (br. s., 1 H)
methyl (7E)-7-[(dimethylamino)methylidene]-1-methyl-8-oxo-1,4,5,6,7,8-hexahydrocyclohepta[b]pyrrole-3- carboxylate
MS calculated: 277.1547; MS found: 277.1554
1H NMR (401 MHz, DMSO-d6) δ ppm 1.76 (quin, J=6.80 Hz, 2 H) 2.32 (t, J=6.80 Hz, 2 H) 2.89 (t, J=6.80 Hz, 2 H) 3.07 (s, 6 H) 3.69 (s, 3 H) 3.74 (s, 3 H) 7.36 (s, 1 H) 7.51 (s, 1 H)
ethyl (6E)-6-[(dimethylamino)methylidene]-1-methyl-7-oxo-4,5,6,7-tetrahydro-1 H-indole-3-carboxylate
1H NMR (401 MHz, DMSO-d6) δ ppm 1.25 (t, J=7.14 Hz, 3 H) 2.76 - 2.89 (m, 4 H) 3.05 (s, 6 H) 3.87 (s, 3 H) 4.17 (q, J=7.14 Hz, 2 H) 7.29 (s, 1 H) 7.53 (s, 1 H) ethyl (6E)-6-[(dimethylamino)methylidene]-2-methyl-7-oxo-4,5,6J-tetrahydro-1 H-indole-3-carboxylate
MS calculated: 277.1547; MS found: 277.1544
1H NMR (401 MHz, DMSO-d6) δ ppm 1.26 (t, J=7.08 Hz, 3 H) 2.41 (s, 3 H) 2.77 - 2.83 (m, 2 H) 2.85 - 2.91 (m, 2 H) 3.04 (s, 6 H) 4.16 (q, J=7.08 Hz, 2 H) 7.26 (s, 1 H) 11.86 (br. s., 1 H)
ethyl (6E)-6-[(dimethylamino)methylidene]-1-(methoxymethyl)-2-methyl-7-oxo-4,5,6J-tetrahydro-1 H-indole-3- carboxylate
Methyl (6£)-6-[(dimethylamino)methylidene]-7-oxo-4,5,6,7-tetrahydro-1H-indole-3-carboxylate
LC/MS (254nm) HPLC method 2 Rt 4.5 min.
1H NMR (400 MHz, DMSO-d6) δ 2.80 - 2.84 (m, 2 H) 2.88 - 2.92 (m, 2 H) 3.06 (s, 6 H) 3.70 (s, 3 H) 7.31 (s, 1 H) 7.41 (d, J=2.75 Hz, 1 H) 12.06 (br. s., 1 H).
methyl (6E)-1-[1-(tert-butoxycarbonyl)piperidin-4-yl]-6-[(dimethylamino)methylidene]-7-oxo-4,5,6,7- tetrahydro-1 H-indole-3-carboxylate
Preparation H (step E)
methyl 1-[1-(tert-butoxycarbonyl)piperidin-4-yl]-7-oxo-4,5,6,7-tetrahydro-1 H-indole-3-carboxylate
Figure imgf000038_0001
To a mixture of methyl 7-oxo-4,5,6,7-tetrahydro-1 H-indole-3-carboxylate (100 mg 0.52 mmol), tert-butyl-4- hydroxypiperidine-1-carboxylate (105 mg, 0.52 mmol), and triphenylphosphine (136 mg, 0.52 mmol), in anhydrous THF (5 ml_) at room temperature, was added di tert-butyl-diazadicarboxylate (DTAD) (120 mg, 0.52 mmol). The mixture was stirred at room temperature for 8 h. HPLC/MS suggested 40% conversion and 60% SM remained. Reagents were added, triphenylphosphine (136 mg, 0.52 mmol) and DTAD (120mg, 0.52 mmol), the mixture was stirred for 4 hours. HPLC/MS showed 80 % conversion and 20 % SM remained. Reagents were re-added TPP (136 mg, 0.52 mmol) and DTAD (120 mg, 0.526 mmol) and the solution was stirred for additional 4 hours. The volatiles were removed in vacuo, the crude solid was purified by flash chromatography on silica gel (hexane/EtOAc 7/3) to afford 140 mg (70 % yield) of the title compound as a white solid.
Example 1 (step G)
Methyl 2-[(4-bromo-2-methoxyphenyl)amino]-9-methyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7- carboxylate [(I), R1=4-bromo-2-methoxyphenyl, X-NH-, R2=-0-methyl, R3=methyl, R4=H, A=-CH2CH2-]
Figure imgf000039_0001
To a suspension of methyl (6E)-6-[(dimethylamino)methylidene]-1-methyl-7-oxo-4,5,6J-tetrahydro-1 H-indole-3- carboxylate (365 mg, 1.39 mmol) in DMF (5 mL) A/-(4-bromo-2-methoxy-phenyl)-guanidine (340 mg, 1.39 mmol) was added. The mixture was stirred at 120 °C for 3 hours. The resulting mixture was cooled at room temperature and evaporated to dryness. The crude solid was purified by flash chromatography on silica gel (eluant: AcOEt/hexane 4/6) to afford 306 mg (yield: 50%) of the title compound as a light orange solid.
MS calculated: 443.0714; MS found: 443.0704
1H NMR (401 MHz, DMSO-d6) δ ppm 2.76 (t, J=7.81 Hz, 2 H) 2.93 (t, J=7.81 Hz, 2 H) 3.72 (s, 3 H) 3.88 (s, 3 H) 4.03 (s, 3 H) 7.12 (dd, J=8.60, 2.20 Hz, 1 H) 7.20 (d, J=2.20 Hz, 1 H) 7.65 (d, J=0.49 Hz, 1 H) 7.91 (s, 1 H) 8.07 (d, J=8.60 Hz, 1 H) 8.21 (s, 1 H)
According to this same methodology, but employing suitable substituted derivatives, the following compounds were prepared:
ethyl 2-[(4-bromo-2-methoxyphenyl)amino]-8-methyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-c
[(l),R1=4-bromo-2-methoxyphenyl,X=-NH-, R2=-0-ethyl, R3=H, R4=methyl, A=-CH2CH2-]
Figure imgf000039_0002
MS calculated: 457.087; MS found: 457.0868
1H NMR (401 MHz, DMSO-d6) δ ppm 1.28 (t, J=7.08 Hz, 3 H) 2.51 (br. s., 3 H) 2.75 - 2.83 (m, 2 H) 2.91 - 2.98 (m, 2 H) 3.92 (s, 3 H) 4.19 (q, J=7.08 Hz, 2 H) 7.13 (dd, J=8.65, 2.20 Hz, 1 H) 7.20 (d, J=2.20 Hz, 1 H) 7.60 (s, 1 H) 8.17 (s, 1 H) 8.50 (d, J=8.65 Hz, 1 H) 12.07 (s, 1 H)
ethyl 9-methyl-2-{[4-(4-methylpiperazin-1-yl)phenyl]amino}-6,9-dihydro-5H-pyrrolo[3,2-h] quinazoline-7- carboxylate [(I), R1=4-(4-methyl iperazin-1-yl)phenyl, X=-NH-, R2=-0-ethyl, R3=methyl, R4=H, A=-CH2CH2-]
Figure imgf000039_0003
MS calculated: 447.2503; MS found: 447.2485 1H NMR (401 MHz, DMSO-d6) δ ppm 1.27 (t, J=7.08 Hz, 3 H) 2.22 (s, 3 H) 2.42 - 2.47 (m, 4 H) 2.70 - 2.77 (m, 2 H) 2.89 - 2.95 (m, 2 H) 3.02 - 3.09 (m, 4 H) 4.08 (s, 3 H) 4.19 (q, J=7.08 Hz, 2 H) 6.84 - 6.90 (m, 2 H) 7.45 - 7.53 (m, 2 H) 7.61 (s, 1 H) 8.14 (s, 1 H) 8.97 (s, 1 H)
ethyl 2-[(4-bromo-2-methoxyphenyl)amino]-9-methyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxylate [(l),R1=4-bromo-2-methoxyphenyl,X=-NH- R2=-0-ethyl, R3=methyl, R4=H, A=-CH2CH2-]
Figure imgf000040_0001
MS calculated: 457.0870; MS found: 457.0876
1H NMR (401 MHz, DMSO-d6) δ ppm 1.27 (t, J=7.08 Hz, 3 H) 2.71 - 2.83 (m, 2 H) 2.89 - 2.98 (m, 2 H) 3.88 (s, 3 H) 4.03 (s, 3 H) 4.20 (q, J=7.08 Hz, 2 H) 7.12 (dd, J=8.60, 2.20 Hz, 1 H) 7.20 (d, J=2.20 Hz, 1 H) 7.63 (s, 1 H) 7.92 (s, 1 H) 8.06 (d, J=8.60 Hz, 1 H) 8.20 (s, 1 H)
methyl 2-[(4-bromo-2-methoxyphenyl)amino]-10-methyl-5,6,7,10-tetrahydropyrrolo[3',2,:6,7] cyclohepta[1,2- d]pyrimidine-8-carboxylate [(I), R1=4-bromo-2-methoxyphenyl, X—NH-, R2=-0-methyl, R3=methyl, R4=H, A=- (CH2)3-]
Figure imgf000040_0002
MS calculated: 457.0870; MS found: 457.0851
1H NMR (401 MHz, DMSO-d6) δ ppm 1.92 - 2.07 (m, 2 H) 2.91 (t, J=7.08 Hz, 2 H) 3.71 (s, 3 H) 3.85 (s, 3 H) 3.86 (s, 3 H) 7.13 (dd, J=8.61 , 2.20 Hz, 1 H) 7.20 (d, J=2.20 Hz, 1 H) 7.66 (s, 1 H) 7.93 - 8.08 (m, 2 H) 8.30 (s, 1 H) ethyl 2-amino-8-methyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxylate [(l),R1=H, X—NH-, R2=-0- ethyl, R3=H, R4=methyl, A=-CH2CH2-]
Figure imgf000040_0003
ethyl 9-(methoxymethyl)-2-{[2-methoxy-4-(4-methylpiperazin-1-yl)phenyl]amino}-8-methyl-6,9-dihydro-5H- pyrrolo[3,2-h]quinazoline-7-carboxylate [(I), R1= 2-methoxy-4-(4-methylpiperazin-1-yl)phenyl, X=-NH-, R2=-0- ethyl, R3= methoxymethyl, R4=methyl, A=-CH2CH2-]
Figure imgf000041_0001
Example 2 (conv. 3)
2-[(4-bromo-2-methoxyphenyl)amino]-9-methyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxylic acid [(l),R1=4-bromo-2-methoxyphenyl,X=-NH-, R2=-OH, R3=methyl, R4=H, A=-CH2CH2-]
Figure imgf000041_0002
Methyl 2-[(4-bromo-2-methoxyphenyl)amino]-9-methyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazo (300 mg, 0.68 mmol) was suspended in dioxane (10 mL) and treated with a 2 N solution of NaOH (5.1 mL, 10.2 mmol) at reflux temperature for 3 h. H2O (50 mL) was added and the solution was acidified with HCI 2N. The resulting precipitate was collected by filtration to give 211 mg (yield 72%) of the title compound as a white solid.
MS calculated: 429.0557; MS found: 429.0566
1H NMR (401 MHz, DMSO-d6) δ ppm 2.73 (t, J=7.93 Hz, 2 H) 2.93 (t, J=7.93 Hz, 2 H) 3.88 (s, 3 H) 4.03 (s, 3 H) 7.12 (dd, J=8.67, 2.20 Hz, 1 H) 7.20 (d, J=2.20 Hz, 1 H) 7.57 (s, 1 H) 7.88 (s, 1 H) 8.08 (d, J=8.67 Hz, 1 H) 8.20 (s, 1 H) 12.00 (br. s., 1 H)
According to this same methodology, but employing suitable substituted derivatives, the following compounds were prepared:
2-[(4-bromo-2-methoxyphenyl)amino]-8,9-dimethyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxylic acid [(I), R1=4-bromo-2-methoxyphenyl, X=-NH- R2=-OH, R3=methyl, R4=methyl, A=-CH2CH2-]
Figure imgf000041_0003
MS calculated: 443.0714; MS found: 443.0703
1H NMR (401 MHz, DMSO-d6) δ ppm 2.53 (s, 3 H) 2.67 - 2.74 (m, 2 H) 2.87 - 2.97 (m, 2 H) 3.88 (s, 3 H) 4.00 (s, 3 H) 7.12 (dd, J=8.54, 2.20 Hz, 1 H) 7.20 (d, J=2.20 Hz, 1 H) 7.86 (s, 1 H) 8.09 (d, J=8.54 Hz, 1 H) 8.16 (s, 1 H) 12.02 (br. s., 1 H) 2-amino-9-[1-(tert-butoxycarbonyl)piperidin-4^^ acid [(l),R1=H,X=-NH-, R2=-OH, R3=1-(tert-buto l, R4=H, A=-CH2CH2-]
Figure imgf000042_0001
Example 3 (conv. 4)
2-[(4-bromo-2-methoxyphenyl)amino]-N-(2,6-diethylphenyl)-9-methyl-6,9-dihydro-5H-pyrrolo[3,2-h] quinazoline-7-carboxamide [(I), R1=4-bromo-2-methoxyphenyl, X—NH-, R2=-N-(2,6-diethylphenyl), R3=methyl, R4=H, A=-CH2CH2- (cmpd 8)
Figure imgf000042_0002
2-[(4-bromo-2-methoxyphenyl)amino]-9-methyl-6,9-dihydro-5H-pyrrolo[^ acid (206 mg, 0.48 mmol) was suspended in dry THF (10 mL) and SOC (0.7 mL, 9.6 mmol) was addes under argon. The reaction mixture was refluxed for 2 h then all volatiles were removed under reduced pressure. The crude residue was dissolved in dry DCM (10 mL) then DIPEA (0.43 mL, 2.4 mmol) and 2,6-diethylaniline (143 mg, 0.96 mmol) were added and the reaction mixture was refluxed for 2 h. DCM (100 mL) was added and the organic phase extracted with H2O (3x25 mL). The organic layer was dried over anhydrous Na2S04 and the solvent evaporated to dryness to give 190 mg (yield: 70%) of the title compound as a pale yellow solid.
MS calculated: 560.1656; MS found: 560.1655
1H NMR (401 MHz, DMSO-d6) δ ppm 1.11 (t, J=7.57 Hz, 6 H) 2.55 (q, J=7.57 Hz, 4 H) 2.72 - 2.79 (m, 2 H) 2.95 - 3.02 (m, 2 H) 3.89 (s, 4 H) 4.08 (s, 3 H) 7.08 - 7.16 (m, 3 H) 7.16 - 7.24 (m, 2 H) 7.74 (s, 1 H) 7.88 (s, 1 H) 8.12 (d, J=8.70 Hz, 1 H) 8.20 (s, 1 H) 9.05 (s, 1 H)
According to this same methodology, but employing suitable substituted derivatives, the following compounds were prepared:
2-[(4-bromo-2-methoxyphenyl)amino]-8,9-dimethyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxami [(I), R1=4-bromo-2-methoxyphenyl, X=-NH-, R2=-NH2, R3=methyl, R4=methyl, A=-CH2CH2-]
Figure imgf000043_0001
Example 4 (conv. 5)
2-[(4-bromo-2-methoxyphenyl)amino]-N-(2,6-diethylphenyl)-8,9-dimethyl-6,9-dihydro-5H-pyrrolo [3,2- h]quinazoline-7-carboxamide [(I), R1= 4-bromo-2-methoxyphenyl, X= -NH-, R2= -N-(2,6-diethylphenyl), R3=methyl, R4=meth l, A=-CH2CH2-] (cmpd 2)
Figure imgf000043_0002
To a solution of 2,6-diethylaniline (300 mg, 2.01 mmol) in dry THF (10 mL) under argon, 1 M in THF solution of LiN(TMS)2 (4.02 mL, 4.02 mmmol) at 0°C was added dropwise. The mixture was stirred at 0°C for 10 minutes then ethyl 2-[(4-bromo-2-methoxyphenyl)amino]-8,9-dimethyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxylate (0.315 g, 0.67 mmol) in dry THF (10 mL) at 0°C was added dropwise. Ice bath was removed and the mixture was stirred at room temperature for 1 hour. H2O (20 mL) was added and the mixture was extracted with AcOEt (2x30mL). The organic layer was dried over anhydrous Na2S04 and the solvent evaporated to dryness. The crude solid was purified by flash chromatography on silica gel (eluant: AcOEt/cyclohexane 1/1) to afford 355 mg (92 % yield) of the title compound as a light yellow solid.
MS calculated: 574.1812; MS found: 574.1818
1H NMR (401 MHz, DMSO-d6) δ ppm 1.14 (t, J=7.57 Hz, 6 H) 2.44 (s, 3 H) 2.58 (q, J=7.57 Hz, 4 H) 2.71 - 2.81 (m, 2 H) 2.85 - 2.94 (m, 2 H) 3.89 (s, 3 H) 4.02 (s, 3 H) 7.10 - 7.16 (m, 3 H) 7.18 - 7.23 (m, 2 H) 7.85 (s, 1 H) 8.13 (d, J=8.67 Hz, 1 H) 8.16 (8, 1 H) 8.84 (s, 1 H)
According to this same methodology, but employing suitable substituted derivatives, the following compounds were prepared:
N-(2,6-diethylphenyl)-9-(methoxymethyl)-2-{[2-methoxy-4-(4-methylpiperazin-1-yl)phenyl]amino^^
6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamide [(I), R1= 2-methoxy-4-(4-methylpiperazin-1- yl)phenyl, X= -NH-, R2= -N-(2,6-diethylphenyl), R3=methoxymethyl, R4=methyl, A=-CH2CH2-] (cmpd 1)
Figure imgf000044_0001
MS calculated: 624.3657; MS found: 624.3660
2-[(4-bromo-2-methoxyphenyl)amino]-N-(2,6-diethylphenyl)-10-methyl-5,6J,10-tetrahydropyrrolo[3',
2':6,7]cyclohepta[1,2-d]pyrimidine-8-carboxamide [(I), R1= 4-bromo-2-methoxyphenyl, X= -NH-, R2= -N-(2,6- diethylphenyl), R3=methyl, R4=H, A=-(CH2)3-] (cmpd 15)
MS calculated: 574.1812; MS found: 574.1797
1H NMR (401 MHz, DMSO-d6) δ ppm 1.12 (t, J=7.57 Hz, 6 H) 1.94 - 2.05 (m, 2 H) 2.55 (q, J=7.57 Hz, 4 H) 2.92 (t, J=7.14 Hz, 2 H) 3.88 (s, 3 H) 3.89 (s, 3 H) 7.09 - 7.20 (m, 4 H) 7.21 (d, J=2.32 Hz, 1 H) 7.69 (s, 1 H) 7.98 (s, 1 H) 8.10 (d, J=8.54 Hz, 1 H) 8.30 (s, 1 H) 9.05 (s, 1 H)
Example 5 (conv. 6)
N-(2,6-diethylphenyl)-2-{[2-methoxy-4-(4-methylpiperazin-1-yl)phenyl]amino}-9-methyl-6,9-di
pyrrolo[3,2-h]quinazoline-7-carboxamide [(I), R1= 2-methoxy-4-(4-methylpiperazin-1-yl)phenyl, X= -NH-, R2= - N-(2,6-diethylphenyl), R3=meth l, R4=H, A=-CH2CH2-] (cmpd 9)
Figure imgf000044_0003
Pd2(dba)3, (10 mg, 0.010 mmol), 2-dicyclohexylphosphino-2'-(A/,A/-dimethylamino)-biphenyl (10 mg, 0.025 mmol) and 2-[(4-bromo-2-methoxyphenyl)amino]-N-(2,6-diethylphen
carboxamide (100 mg, 0.178 mmol) in dry THF (5 mL) were charged in a round-bottom flask flushed with argon. The flask was evacuated and backfilled with argon. LiN(TMS)2 solution (1 M in THF, 1.39 mL) and N-methylpiperazine (0.058 mL, 0.522 mmol) were added and the reaction mixture was heated at 85°C for 0.5 h. The reaction mixture was then allowed to cool to room temperature and solvent evaporated to dryness. The crude solid was purified by flash chromatography on silica gel (eluant: DCM/MeOH 95/5) to afford 72 mg (70 % yield) of the title compound as yellow solid.
MS calculated: 580.3395; MS found: 580.3373
1H NMR (401 MHz, DMSO-d6) δ ppm 1.11 (t, J=7.57 Hz, 6 H) 2.25 (br. s., 3 H) 2.54 (q, J=7.57 Hz, 4 H) 2.69 - 2.76 (m, 2 H) 2.91 - 2.99 (m, 2 H) 3.05 - 3.19 (m, 4 H) 3.82 (s, 3 H) 4.04 (s, 3 H) 6.49 (dd, J=8.67, J=2.56 Hz, 1 H) 6.63 (d, J=2.56 Hz, 1 H) 7.08 - 7.14 (m, 2 H) 7.16 - 7.23 (m, 1 H) 7.66 (s, 1 H) 7.69 (s, 1 H) 7.76 (d, J=8.67 Hz, 1 H) 8.10 (s, 1 H) 9.03 (s, 1 H)
According to this same methodology, but employing suitable substituted derivatives, the following compounds were prepared:
N-(2,6-diethylphenyl)-2-({2-methoxy-4-[4-(pyrrolidin-1-yl)piperidin-1-yl]phenyl}amino
dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamide [(I), R1= 2-methoxy-4-[4-(pyrrolidin-1-yl)piperidin-1- yl]phenyl, X= -NH-, R2= -N-(2,6-diethylphen l), R3=methyl, R4=methyl, A=-CH2CH2-] (cmpd 3)
Figure imgf000045_0001
MS calculated: 648.4021 ; MS found: 648.4026
1H NMR (401 MHz, DMSO-d6) δ ppm 1.13 (t, J=7.57 Hz, 6 H) 1.47 - 1.61 (m, 2 H) 1.64 -1.76 (m, 4 H) 1.88 -1.98 (m, 2 H) 2.42 (s, 3 H) 2.52 - 2.63 (m, 8 H) 2.64 - 2.75 (m, 4 H) 2.83 - 2.92 (m, 2 H) 3.26 - 3.29 (m, 1 H) 3.54 - 3.65 (m, 2 H) 3.82 (s, 3 H) 3.98 (s, 3 H) 6.49 (dd, J=8.65, 2.50 Hz, 1 H) 6.63 (d, J=2.40 Hz, 1 H) 7.08 - 7.15 (m, 2 H) 7.17 - 7.24 (m, 1 H) 7.62 (s, 1 H) 7.74 (d, J=8.65 Hz, 1 H) 8.06 (s, 1 H) 8.81 (s, 1 H)
N-(2,6-diethylphenyl)-2-({4-[4-(dimethylamino)piperidin-1-yl]-2-methoxyphenyl}amino)-8,9-di
dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamide [(I), R1=4-[4-(dimethylamino)piperidin-1-yl]-2- methoxyphenyl, X= -NH-, R2= -N-(2,6-diethylphenyl), R3=methyl, R4=methyl, A=-CH2CH2-] (cmpd 4)
Figure imgf000045_0002
MS calculated: 622.3864; MS found: 622.3868
1H NMR (401 MHz, DMSO-d6) δ ppm 1.13 (t, J=7.57 Hz, 6 H) 1.44 - 1.60 (m, 2 H) 1.68 - 1.90 (m, 2 H) 2.23 (br.s., 6 H) 2.42 (s, 3 H) 2.58 (q, J=7.57 Hz, 4 H) 2.60 - 2.69 (m, 2 H) 2.69 - 2.75 (m, 2 H) 2.83 - 2.93 (m, 2 H) 3.61 - 3.70 (m, 2 H) 3.82 (s, 3 H) 3.98 (s, 3 H) 6.49 (dd, J=8.70, 2.50 Hz, 1 H) 6.63 (d, J=2.50 Hz, 1 H) 7.06 - 7.16 (m, 2 H) 7.17 - 7.24 (m, 1 H) 7.62 (s, 1 H) 7.74 (d, J=8.70 Hz, 1 H) 8.06 (s, 1 H) 8.81 (s, 1 H)
N-(2,6-diethylphenyl)-2-{[2-methoxy-4-(4-methylpiperazin-1-yl)phenyl]amino}-8,9-dimethy
pyrrolo[3,2-h]quinazoline-7-carboxamide [(I), R1= 2-methoxy-4-(4-methylpiperazin-1-yl)phenyl, X= -NH-, R2= - N-(2,6-diethylphenyl), R3=methyl, R4=methyl, A=-CH2CH2-] (cmpd 5)
Figure imgf000046_0001
MS calculated: 594.3551 ; MS found: 594.3554
1H NMR (401 MHz, DMSO-d6) δ ppm 1.13 (t, J=7.57 Hz, 6 H) 2.25 (s, 3 H) 2.42 (s, 3 H) 2.58 (q, J=7.57 Hz, 4 H) 2.68 - 2.79 (m, 2 H) 2.84 - 2.91 (m, 2 H) 3.07 - 3.17 (m, 4 H) 3.82 (s, 3 H) 3.99 (s, 3 H) 6.49 (dd, J=8.80, 2.45 Hz, 1 H) 6.63 (d, J=2.45 Hz, 1 H) 7.06 - 7.17 (m, 2 H) 7.17 - 7.24 (m, 1 H) 7.62 (s, 1 H) 7.77 (d, J=8.80 Hz, 1 H) 8.07 (s, 1 H) 8.82 (s, 1 H)
N-(2,6-diethylphenyl)-2-({4-[4-(2-hydroxyethyl)pip^ -6,9- dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamide [(I), R1= 4-[4-(2-hydroxyethyl)piperazin-1-yl]-2- methoxyphenyl, X= -NH-, R2= -N-(2,6-diethylphenyl), R3=methyl, R4=methyl, A=-CH2CH2-] (cmpd 6)
Figure imgf000046_0002
MS calculated: 624.3657; MS found: 624.3643
1H NMR (401 MHz, DMSO-d6) δ ppm 1.13 (t, J=7.57 Hz, 6 H) 2.42 (s, 3 H) 2.44 - 2.49 (m, 6 H) 2.58 (q, J=7.57 Hz, 4 H) 2.73 (m, 2 H) 2.88 (m, 2 H) 3.06 - 3.20 (m, 4 H) 3.49 - 3.61 (m, 2 H) 3.82 (s, 3 H) 3.99 (s, 3 H) 4.41 (br. s., 1 H) 6.48 (dd, J=8.70, 2.35 Hz, 1 H) 6.63 (d, J=2.35 Hz, 1 H) 7.04 - 7.16 (m, 2 H) 7.17 - 7.23 (m, 1 H) 7.63 (s, 1 H) 7.76 (d, J=8.70 Hz, 1 H) 8.06 (s, 1 H) 8.82 (s, 1 H)
2-{[2-methoxy-4-(4-methylpiperazin-1-yl)phenyl]am
quinazoline-7-carboxamide [(I), R1= 2-methoxy-4-(4-methylpiperazin-1-yl)phenyl, X= -NH-, R2= -NH2, R3=methyl, R4=methyl, A=-CH2CH2-] (cmpd 7)
Figure imgf000047_0001
MS calculated: 462.2612; MS found: 462.2595
1H NMR (401 MHz, DMSO-d6) δ ppm 2.22 (s, 3 H) 2.38 (s, 3 H) 2.43 - 2.47 (m, 4 H) 2.61 - 2.69 (m, 2 H) 2.73 - 2.81 (m, 2 H) 3.06 - 3.13 (m, 4 H) 3.80 (s, 3 H) 3.93 (s, 3 H) 6.47 (dd, J=8.70, 2.56 Hz, 1 H) 6.61 (d, J=2.56 Hz, 1 H) 6.89 (br. s., 2 H) 7.58 (s, 1 H) 7.74 (d, J=8.70 Hz, 1 H) 8.04 (s, 1 H)
N-(2,6-diethylphenyl)-2-({4-[4-(dimethylamino)piperidin-1-yl]-2-methoxyphenyl}amino)
5H-pyrrolo[3,2-h]quinazoline-7-carboxamide [(I), R1=4-[4-(dimethylamino)piperidin-1-yl]-2-methoxyphenyl, X= -NH-, R2= -N-(2,6-diethylphen l), R3=methyl, R4=H, A=-CH2CH2-] (cmpd 10)
Figure imgf000047_0002
MS calculated: 608.3708; MS found: 608.3712
1H NMR (401 MHz, DMSO-d6) δ ppm 1.11 (t, J=7.57 Hz, 6 H) 1.41 - 1.61 (m, , 2 H) 1.77 - 1.92 (m, 2 H) 2.17 - 2.32 (m, 7 H) 2.54 (q, J=7.57 Hz, 46 H) 2.60 - 2.68 (m, 2 H) 2.69 - 2.77 (m, 2 H) 2.90 - 3.01 (m, 2 H) 3.59 - 3.64 (m, 2 H) 3.82 (s, 3 H) 4.03 (s, 3 H) 6.49 (dd, J=8.80, 2.56 Hz, 1 H) 6.63 (d, J=2.56 Hz, 1 H) 7.05 - 7.16 (m, 2 H) 7.16 - 7.23 (m, 1 H) 7.66 (s, 1 H) 7.69 (s, 1 H) 7.74 (d, J=8.80 Hz, 1 H) 8.10 (s, 1 H) 9.03 (s, 1 H)
N-(2,6-diethylphenyl)-2-({2-methoxy-4-[4-(pyrrolidin-1-yl)piperidin-1-yl]phenyl}amino)-9-m
5H-pyrrolo[3,2-h]quinazoline-7-carboxamide [(I), R1=2-methoxy-4-[4-(pyrrolidin-1-yl)piperidin-1-yl]phenyl, X= -NH-, R2= -N-(2,6-diethylphenyl), R3=methyl, R4=H, A=-CH2CH2-] (cmpd 11)
Figure imgf000047_0003
MS calculated: 634.3864; MS found: 634.3874
1H NMR (401 MHz, DMSO-d6) δ ppm 1.11 (t, J=7.57 Hz, 6 H) 1.45 - 1.60 (m, 2 H) 1.64 - 1.74 (m, 4 H) 1.87 - 1. (m, 2 H) 2.04 - 2.16 (m, 1 H) 2.54 (q, J=7.57 Hz, 4 H) 2.65 - 2.81 (m, 4 H) 2.90 - 3.03 (m, 2 H) 3.50 - 3.66 (m, 2 3.82 (s, 3 H) 4.04 (s, 3 H) 6.49 (dd, J=8.70, 2.50 Hz, 1 H) 6.63 (d, J=2.50 Hz, 1 H) 7.04 - 7.15 (m, 2 H) 7.15 - 7.29 (m, 1 H) 7.65 (s, 1 H) 7.69 (s, 1 H) 7.74 (d, J=8.70 Hz, 1 H) 8.10 (s, 1 H) 9.03 (s, 1 H)
N-(2,6-diethylphenyl)-2-[(4-{[3-(dimethylamino)propyl](methyl)amino}-2-methoxyphenyl)am
dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamide [(I), R1=4-{[3-(dimethylamino) propyl]methylamino}-2- methoxyphenyl, X= -NH-, R2= -N-(2,6-d A=-CH2CH2-] (cmpd 12)
Figure imgf000048_0001
MS calculated: 596.3708; MS found: 596.3782
1H NMR (401 MHz, DMSO-d6) δ ppm 1.11 (t, J=7.51 Hz, 6 H) 1.64 (quin, J=6.80 Hz, 2 H) 2.15 (s, 6 H) 2.24 (t, J=6.80 Hz, 2 H) 2.54 (q, J=7.51 Hz, 4 H) 2.65 - 2.75 (m, 2 H) 2.87 (s, 3 H) 2.90 - 2.97 (m, 2 H) 3.79 (s, 3 H) 4.01 (s, 3 H) 6.27 (dd, J=8.80, 2.50 Hz, 1 H) 6.39 (d, J=2.50 Hz, 1 H) 7.09 - 7.14 (m, 2 H) 7.16 - 7.23 (m, 1 H) 7.57 (d, J=8.80 Hz, 1 H) 7.62 (s, 1 H) 7.67 (s, 1 H) 8.06 (s, 1 H) 9.02 (s, 1 H)
N-(2,6-diethylphenyl)-2-({4-[4-(2-hydroxyethyl)pip^ -dihydro- 5H-pyrrolo[3,2-h]quinazoline-7-carboxamide [(I), R1=4-[4-(2-hydroxyethyl)piperazin-1-yl]-2-methoxyphenyl, X= -NH-, R2= -N-(2,6-diethylphenyl), R3=methyl, R4=H, A=-CH2CH2-] (cmpd 13)
Figure imgf000048_0002
MS calculated: 610.3500; MS found: 610.3498
1H NMR (401 MHz, DMSO-d6) δ ppm 1.11 (t, J=7.51 Hz, 6 H) 2.45 (t, J=6.10 Hz, 2 H) 2.52 - 2.61 (m, 8 H) 2.68 - 2.76 (m, 2 H) 2.91 - 3.00 (m, 2 H) 3.09 - 3.16 (m, 4 H) 3.54 (q, J=6.10 Hz, 2 H) 3.82 (s, 2 H) 4.04 (s, 2 H) 4.37 - 4.45 (m, 1 H) 6.48 (dd, J=8.79, 2.44 Hz, 1 H) 6.62 (d, J=2.44 Hz, 1 H) 7.09 - 7.13 (m, 2 H) 7.15 - 7.23 (m, 1 H) 7.66 (s, 1 H) 7.69 (s, 1 H) 7.75 (d, J=8.79 Hz, 1 H) 8.10 (s, 1 H) 9.03 (s, 1 H)
N-(2,6-diethylphenyl)-2-{[2-methoxy-4-(4-methylpiperazin-1-yl)phenyl]amino}-10-methyl-5,6,7,10- tetrahydropyrrolo[3',2':6,7]cyclohepta[1,2-d]pyrimidine-8-carboxamide [(I), R1=2-methoxy-4-(4- methylpiperazin-1-yl)phenyl, X= -NH-, R2= -N-(2,6-diethylphenyl), R3=methyl, R4=H, A=-(CH2)3-] (cmpd 16)
Figure imgf000049_0001
MS calculated: 594.3551 ; MS found: 594.3524
1H NMR (401 MHz, DMSO-d6) δ ppm 1.11 (t, J=7.57 Hz, 6 H) 1.89 - 2.03 (m, 2 H) 2.23 (s, 3 H) 2.43 - 2.48 (m, 4 H) 2.55 (q, J=7.57 Hz, 4 H) 2.91 (t, J=7.14 Hz, 2 H) 3.09 - 3.15 (m, 4 H) 3.80 (s, 3 H) 3.81 (s, 3 H) 6.49 (dd, J=8.70, 2.50 Hz, 1 H) 6.63 (d, J=2.50 Hz, 1 H) 7.08 - 7.15 (m, 2 H) 7.15 - 7.23 (m, 1 H) 7.61 - 7.68 (m, 2 H) 7.79 (s, 1 H) 8.19 (s, 1 H) 9.01 (s, 1 H)
N-(2,6-diethylphenyl)-2-({4-[4-(dimethylamino)piperidin-1-yl]-2-methoxyphenyl}amino)
tetrahydropyrrolo[3',2':6,7]cyclohepta[1,2-d]pyrimidine-8-carboxamide [(I), R1=4-[4-(di
methylamino)piperidin-1-yl]-2-methoxyphenyl, X= -NH-, R2= -N-(2,6-diethylphenyl), R3=methyl, R4=H, A=- (CH2)3-] (cmpd 17)
Figure imgf000049_0002
MS calculated: 622.3864; MS found: 622.3876
1H NMR (401 MHz, DMSO-d6) δ ppm 1.11 (t, J=7.57 Hz, 6 H) 1.42 - 1.58 (m, 2 H) 1.76 - 1.89 (m, 2 H) 1.92 - 2.02 (m, 2 H) 2.13 - 2.19 (m, 1 H) 2.18 - 2.23 (m, 6 H) 2.43 - 2.48 (m, 2 H) 2.55 (q, J=7.57 Hz, 4 H) 2.60 - 2.70 (m, 2 H) 2.92 (t, J=7.08 Hz, 2 H) 3.62 - 3.72 (m, 2 H) 3.79 (s, 3 H) 3.80 (s, 3 H)6.50 (dd, J=8.75, 2.44 Hz, 1 H) 6.62 (d, J=2.44 Hz, 1 H) 7.05 - 7.14 (m, 2 H) 7.13 - 7.24 (m, 1 H) 7.58 - 7.68 (m, 2 H) 7.79 (s, 1 H) 8.19 (s, 1 H) 9.01 (s, 1 H)
N-(2,6-diethylphenyl)-2-({2-methoxy-4-[4-(pyrrolidin-1-yl)piperidin-1-yl]phenyl}amino)-10-m
tetrahydropyrrolo[3',2':6,7]cyclohepta[1,2-d]pyrimidine-8-carboxamide [(I), R1=2-methoxy-4-[4-(pyrrolidin-1- yl)piperidin-1-yl]phenyl, X= -NH-, R2= -N-(2,6-diethylphenyl), R3=methyl, R4=H, A=-(CH2)3-] (cmpd 18)
Figure imgf000049_0003
MS calculated: 648.4021 ; MS found: 648.4023 1H NMR (401 MHz, DMSO-d6) δ ppm 1.11 (t, J=7.57 Hz, 6 H) 1.42 - 1.59 (m, 2 H) 1.63 - 1.76 (m, 4 H) 1.83 - 2.04 (m, 4 H) 2.04 - 2.18 (m, 1 H) 2.42 - 2.50 (m, 6 H) 2.54 (q, J=7.57 Hz, 4 H) 2.65 - 2.77 (m, 2 H) 2.92 (t, J=7.14 Hz, 2 H) 3.51 - 3.65 (m, 2 H) 3.79 (s, 3 H) 3.80 (s, 3 H) 6.50 (dd, J=8.85, 2.50 Hz, 1 H) 6.62 (d, J=2.45 Hz, 1 H) 7.03 - 7.15 (m, 2 H) 7.15 - 7.24 (m, 1 H) 7.58 - 7.68 (m, 2 H) 7.78 (s, 1 H) 8.19 (s, 1 H) 9.01 (s, 1 H)
Example 6 (conv. 2)
Ethyl 2-[(4-bromo-2-methoxyphenyl)amino]-8,9-dim^
carboxylate [(I), R1= -bromo-2-methoxyphenyl, X= -NH-, R2= -O-ethyl, R3=methyl, R4=methyl, A=-CH2CH2-]
Figure imgf000050_0001
To a solution of ethyl 2-[(4-bromo-2-methoxyphenyl)amino]-8-methyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7- carboxylate (50 mg, 0.11 mmol) in DMF (1 mL), Cs2C03 (73 mg, 0.22 mmol) and methyl iodide (0.007 mL, 0.11 mmol) were added. The mixture was stirred at room temperature for 8 h, solvent was removed under vacuo, then DCM (10 mL) was added and the organic phase washed with water (2x15 mL). The organic fraction was dried over Na2S04, filtered, and concentrated in vacuo. Purification by flash chromatography on silica gel (eluant: AcOEt/hexane 4/6) provided 40 mg (yield: 80%) of the title compound as a pale yellow solid.
MS calculated: 471.1027; MS found: 471.1031
1H NMR (401 MHz, DMSO-d6) δ ppm 1.28 (t, J=7.08 Hz, 3 H) 2.53 (s, 3 H) 2.72 (t, J=7.63 Hz, 2 H) 2.91 (t, J=7.63 Hz, 2 H) 3.88 (s, 3 H) 4.00 (s, 3 H) 4.20 (q, J=7.08 Hz, 2 H) 7.12 (dd, J=8.55, 2.14 Hz, 1 H) 7.20 (d, J=2.14 Hz, 1 H) 7.89 (s, 1 H) 8.07 (d, J=8.55 Hz, 1 H) 8.17 (s, 1 H)
According to this same methodology, but employing suitable substituted derivatives, the following compound was prepared:
ethyl 2-amino-8,9-dimethyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxylate [(I), R1= -H, X= -NH-, R2= - O-ethyl, R3=methyl, R4=methyl, A=-CH2CH2-
Figure imgf000050_0002
Example 7 (conv. 7)
Ethyl 2-({2-methoxy-4-[(1-methylpiperidin-4-yl)carbamoyl]phenyl}amino)-8,9-dimethyl-6,9-dihydro-5H- pyrrolo[3,2-h]quinazoline-7-carboxylate [(I), R1= 2-methoxy-4-[(1-methylpiperidin-4-yl) carbamoyl]phenyl, X= NH-, R2= -O-ethyl, R3=methyl, R4=methyl, A=-CH2CH2-]
Figure imgf000051_0001
To a solution of ethyl 2-amino-8,9-dimethyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxylate (87 mg, 0.280 mmol) in dioxane (2 ml_), 4-iodo-3-methoxy-N-(1-methylpiperidin-yl)benzamide (112 mg, 0.254 mmol) and CS2CO3 (92 mg, 0.280 mmol) were added and the flask was evacuated and backfilled with argon. Pd2(dba)3 (4.7 mg, 0.005 mmol) and Xantphos (6.5 mg, 0.011 mmol) were then charged and the mixture was heated at 80°C under argon for 8 hours. After cooling to room temperature, the reaction mixture was concentrated, suspended in H2O (10 ml_) and extracted with AcOEt (3x15 ml_). The organic phase was anidrified on Na2S04, filtered and evaporated to dryness, the crude solid was purified by flash chromatography on silica gel (eluant: DCM/MeOH 9/2) to afford 100 mg (yield: 70%) of the title compound as a yellow solid.
1H NMR (500 MHz, DMSO-d6) δ ppm 1.29 (t, J=7.00 Hz, 3 H) 1.54 - 1.67 (m, 2 H) 1.72 - 1.83 (m, 2 H) 1.91 -2.08 (m, 2 H) 2.20 (br. s., 3 H) 2.55 (s, 3 H) 2.70 - 2.76 (m, 2 H) 2.77.2.86 (m, 2 H) 2.89 - 2.98 (m, 2 H) 3.69 - 3.81 (m, 1 H) 3.94 (s, 2 H) 4.05 (s, 2 H) 4.20 (q, J=7.00 Hz, 2 H) 7.40 - 7.54 (m, 2 H) 7.97 (s, 1 H) 8.12 (d, J=7.69 Hz, 1 H) 8.22 (s, 1 H) 8.29 (d, J=8.24 Hz, 1 H)
Example 8 (conv 4)
2-[(4-bromo-2-methoxyphenyl)amino]-N-[(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-phenyl ethyl]-9- methyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamide [(I), R1= 4-bromo-2-methoxyphenyl, X= -NH-, R2= N-[(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-phenyl ethyl], R3=methyl, R4=H, A=-CH2CH2-] (cmpd 14)
Figure imgf000051_0002
2-[(4-bromo-2-methoxyphenyl)amino]-9-methyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxylic acid (50 mg, 0.116 mmol) in dry DMF (5.0 mL) was treated with DIPEA (0.056 mL, 0.033 mmol) and TBTU (65 mg, 0.200 mmol). The mixture was then treated with 2-[(2S)-2-amino-2-phenylethyl]-1 H-isoindole-1 ,3(2H)-dione (3 mg, 0.011 mmol). The reaction was stirred at room for 4 h. The reaction was diluted with water and the resulting precipitate was collected by filtration to afford 35 mg (yield: 45%) of the title compound as yellow solid.
MS calculated: 677.1507; MS found: 677.1521
Example 9 (step G)
Ethyl 8-methyl-2-(methylsulfanyl)-6,9-dihydro-5H-pyrrolo[3,2-/j]quinazoline-7-carboxylate
[(I), R1 = methyl, X= -S-, R2 = -O-ethyl, R3 = H, R4 = methyl, A = -CH2CH2- ] and ethyl 2-(dimethylamino)-8- methyl-6,9-dihydro-5H-pyrrolo[3,2-/j]quinazoline-7-carboxylate [(I), R1 = methyl, X= -N(Me)-, R2 = -O-ethyl, R3 = H, R4 = meth l, A = -CH2CH2- ]
Figure imgf000052_0001
To a solution of ethyl (6£)-6-[(dimethylamino)methylidene]-2-methyl-7-oxo-4,5,6J-tetrahydro-1 /-/-indole-3- carboxylate 2 g (7.22 mmol) in 20 ml_ of anhydrous DMF, 1.41 g (14.4 mmol) of anhydrous potassium acetate and 4.0 g ( 14.4 mmol) of methylisothiourea sulfate were added. The reaction was stirred at 100°C for 3 hours. The mixture was diluted with ethyl acetate, washed with H2O, dried over Na2S04, filtered and evaporated. The crude was purified by silica gel chromagraphy (ethyl acetate: hexane 4:6) to give as major compound 0.8 g of ethyl 8-methyl-2- (methylsulfanyl)-6,9-dihydro-5/-/-pyrrolo[3,2-/5]quinazoline-7-carboxylate (40%)
LC/MS (254nm) HPLC method 2 Rt 5.79 min.
1H NMR (500 MHz, DMSO-d6) δ 1.28 (t, J=7.05 Hz, 3 H) 2.52 (s, 3H) 2.82 (t, J=8.05 Hz, 2 H) 2.95 (t, J=8.05 Hz, 2 H) 3.33 (s, 3H) 4.18 (q, J=7.05 Hz, 2 H) 8.25 (s, 1 H) 12.13 (br. s., 1 H).
HRMS (ESI) calcd for C15H18N3O2S [M + H ]+ 304.1114 found 304.1120;
and as minor product 0.2 g ethyl 2-(dimethylamino)-8-methyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7- carboxylate (10%).
LC/MS (254nm) HPLC method 2 Rt 5.44 min.
1H NMR (600 MHz, DMSO-d6) δ 1.27 (t, J=7.08 Hz, 3 H) 2.50 (s, 3H) 2.70 (t, J=7.88 Hz, 2 H) 2.89 (t, J=7.88 Hz, 2 H) 3.13 (s, 6 H) 4.18 (q, J=7.08 Hz, 2 H) 7.99 (s, 1 H) 11.78 (br. s., 1 H).
HRMS (ESI) calcd for C16H21N4O [M + H ]+ 301.1659 found 301.1655.
Applying the same method, the following compound was prepared:
methyl 2-(methylsulfanyl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxylate [(I), R1 = methyl, X= -S-, R2 = -O-methyl, R3 = R4 = H, A = -CH2CH2-]
LC/MS (254nm) HPLC method 2 Rt 5.02 min.
1H NMR (600 MHz, DMSO-d6) δ 2.53 (s, 3 H) 2.86 (t, J=8.06 Hz, 2 H) 2.99 (t, J=8.06 Hz, 2 H) 3.73 (s, 3 H) 7.57 (s, 1 H) 8.31 (s, 1 H) 12.42 (br. s., 1 H).
HRMS (ESI) calcd for C13H14N3O2S [M + H ]+ 276.0801 found 276.0799.
Example 10 (conv. 2) ethyl 8-methyl-2-(methylsulfanyl)-9-(propan-2-yl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxylate [(I), R1 = methyl, X= -S-, R2 = O-eth l, R3 = H, R4 = methyl, A = -CH2CH2- ]
Figure imgf000053_0001
To a solution of ethyl 8-methyl-2-(methylsulfanyl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxylate (100 mg, 0.33 mmol) in dry DMF (2 mL), Cs2C03 (160 mg, 0.495 mmol) and 2-iodo propane (0.08 ml, 0.825 mmol) were added. The reaction was stirred at 80°C for 8 h. HPLC/MS analysis showed 50% of conversion, therefore an additional amount of reagents were added into the pot and stirred at the same temperature for further 8 h. The mixture was poured into H2O (100 mL) and the product extracted with EtOAc (3x30 mL). The organic fractions were dried over Na2S04, filtrated, and concentered in vacuo. The crude solid was purified by flash chromatography on silica gel (eluant: AcOEt/hexane 1/9) to afford 75 mg (yield: 66%) of the title compound as an off-white solid.
LC/MS (254nm) HPLC method 2 Rt 7.34 min.
1H NMR (600 MHz, DMSO-d6) δ 1.28 (t, J=7.08 Hz, 3 H) 1.55 (d, J=7.14 Hz, 6 H) 2.51 (s, 3H) 2.66 (s, 3 H) 2.70 - 2.74 (m, 2 H) 2.87 - 2.91 (m, 2 H) 4.20 (q, J=7.08 Hz, 2 H) 5.90 (br. s., 1 H) 8.28 (s, 1 H).
HRMS (ESI) calcd for C18H24N3O2S [M + H ]+ 346.1584 found 346.1595.
Example 11 (conv. 2)
methyl 9-[1-(fert-butoxycarbonyl)piperidin-4-yl]-2-(methylsulfanyl)-6,9-dihydro-5H-pyrrolo[3,2-/j]quinazol^ 7-carboxylate [(I), R1 = methyl, X= -S-, R2 = -O-methyl, R3 = 1-(fert-butoxy carbonyl)piperidin-4-yl, R4 = H, A =
Figure imgf000053_0002
To a mixture of methyl 2-(methylsulfanyl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxylate (60 mg 0.218 mmol), tert-butyl-4-hydroxypiperidine-1-carboxylate (88 mg, 0.436 mmol), and triphenylphosphine (120 mg, 0.436 mmol), in anhydrous THF (5 mL) at room temperature, was added di tert-butyl-diazadicarboxylate (DTAD) (100 mg, 0.436 mmol). The mixture was stirred at room temperature for 18 h. HPLC/MS suggested 30% conversion and 70% SM remained, reagents were added, triphenylphosphine (120 mg, 0.436 mmol) and DTAD (100mg, 0.436 mmol) in 5 mL of THF, the mixture was stirred for 6 hours. HPLC/MS showed 70 % conversion and 30 % SM remained. Reagents were re-added TPP (120 mg, 0.436 mmol) and DTAD (100 mg, 0.436 mmol) in 5 mL of THF, the solution was stirred for additional 18 hours. The volatiles were removed in vacuo, the crude solid was purified by flash chromatography on silica gel (hexane/EtOAc 7/3) to afford 69 mg (70 % yield) of the title compound.
LC/MS (254nm) HPLC method 2 Rt 8.10 min. Applying the same method, the following compound was prepared:
methyl 9-[1-(tert-butoxycarbonyl)piperidin-4-yl]-8-iodo-2-(methylsulfanyl)-9H-pyrrolo[3,2-h] quinazoline-7- carboxylate [(I), R1 = methyl, X= -S-, R2 = -O-ethyl, R3 = 1-(fert-butoxy carbonyl)piperidin-4-yl, R4 = I, A = - CH=CH- ]
Figure imgf000054_0001
Example 12 (conv. 2)
methyl 9-{c/s-4-[(fert-butoxycarbonyl)amino]cyclohexyl}-2-(methylsulfanyl)-6,9-dihydro-5H-pyrrolo [3,2- /j]quinazoline-7-carboxylate [(I), R1 = methyl, X= -S-, R2 = O-methyl, R3 = c/'s-4-[(fert- butoxycarbonyl)amino]cyclohex l, R4 = H, A = -CH2CH2-]
Figure imgf000054_0002
To a solution of methyl 2-(methylsulfanyl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxylate (100 mg 0.363 mmol) in THF (5 ml_) frans-ferf-butyl-4-hydroxycyclohexylcarbamate (156 mg 0.727 mmol), Phi3P (190 mg, 0.727 mmol) and DEAD (113 μΙ, 0.727 mmol) were added. The mixture was stirred at room temperature for 16 hours, HPLC/MS suggested unreacted starting material (80%) and desired product (20%), then additional 190 mg of Phi3P and 113 μΙ_ of DEAD were added. After 5 h, the solvent was removed by rotary evaporation to give a viscous orange oil. Mixture of SM (60%) and desired product (40 %) was isolated by flash chromatography on silica gel using 20:80 EtOAc-hexane as eluant. The mixture dissolved in THF (5 ml_) was submitted again with frans-ferf-butyl-4- hydroxycyclohexylcarbamate (156 mg 0.727 mmol), Ph3P (190 mg, 0.727 mmol), DEAD (113 μΙ, 0.727 mmol) and stirred at room temperature for 16 h. HPLC/MS suggested unreacted starting material (40%) and desired product (60%), then added an additional 95 mg of Phi3P and 56 μί of DEAD and stirred for 4 h. The reaction needed five additional refresh of reagents before went to completion. The volatiles were removed under vacuo and the crude purified by silica gel chromatography (hexanes/EtOAc 8/2) to give the title compound as a yellow solid (160 mg 93% yield).
LC/MS (254nm) HPLC method 2 Rt 8.11 min.
Example 13 (conv. 3)
8-methyl-2-(methylsulfanyl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxylic acid [(I), R1 = methyl, X= - S-, R2 = OH, R3 = H, R4 = methyl, A = -CH2CH2-]
Figure imgf000055_0001
Ethyl 8-methyl-2-(methylsulfanyl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxylate (110 mg, 0.36 mmol) was suspended in dioxane (10 mL) and treated with a 2 N solution of NaOH (4.0 ml, 8 mmol) at 95°C for 18 h. H20 (20 mL) was added and the solution was acidified with HCI 2N. The mixture was portioned between ethyl acetate and water, the organic layer was dried over Na2S04, filtered and concentrated, to provide 95 mg (95%) of the title compound as off-white solid.
LC/MS (254nm) HPLC method 2 Rt 4.13 min.
1H NMR (600 MHz, DMSO-d6) δ 2.48 (s, 3 H) 2.52 (s, 3 H) 2.77 - 2.83 (m, 2 H) 2.92 - 2.96 (m, 2 H) 8.24 (s, 1 H) 12.05 (br. s., 1 H).
HRMS (ESI) calcd for C13H14N3O2S [M + H ]+ 276.0801 found 276.0804.
Operating in an analogous way, the following compounds were prepared:
2-(methylsulfanyl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxylic acid [(I), R1 = methyl, X= -S-, R2 = OH, R3 = R4 = H, A = -CH2CH2-]
Figure imgf000055_0002
LC/MS (254nm) HPLC method 2 Rt 3.61 min.
1H NMR (600 MHz, DMSO-d6) δ 2.53 (s, 3 H) 2.85 (t, J = 7.75 Hz, 2H), 2.98 (t, J = 7.75 Hz, 2H) 7.48 - 7.52 (m, 1 H) 8.30 (s, 1 H) 12.32 (br. s., 1 H).
HRMS (ESI) calcd for C12H12N3O2S [M + H ]+ 262.0645 found 262.0649.
8-methyl-2-(methylsulfanyl)-9-(propan-2-yl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxylic acid [(I), R1 = methyl, X= -S-, R2 = OH, R3 = /'s-propyl, R4 = meth l, A = -CH2CH2-]
Figure imgf000055_0003
LC/MS (254nm) HPLC method 2 Rt 5.43 min.
1H NMR (600 MHz, DMSO-d6) δ 1.55 (d, J=6.96 Hz, 6 H) 2.48 (s, 3 H) 2.66 (s, 3 H) 2.71 (t, J = 7.78 Hz, 2H) 2.89 (t, J = 7.75 Hz, 2H) 8.27 (s, 1 H) 12.20 (br. s., 1 H)
HRMS (ESI) calcd for C16H20N3O2S [M + H ]+ 318.1271 found 318.1263.
2-(dimethylamino)-8-methyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxylic acid [(I), R1 = methyl, X= - N(Me)-, R2 = OH, R3 = H, R4 = methyl, A = -CH2CH2-]
Figure imgf000056_0001
LC/MS (254nm) HPLC method 2 Rt 3.17 min.
1H NMR (600 MHz, DMSO-d6) δ 2.54 (s, 3 H) 2.79 (t, J=7.20 Hz, 2 H) 2.98 (t, J=7.20 Hz, 2 H) 3.23 (s, 6 H) 7.49 (s, 1 H) 7.91 (s, 1 H) 12.20 (br. s., 1 H).
HRMS (ESI) calcd for C14H17N4O2 [M + H ]+ 273.1346 found 273.1346.
9-[1-(fert-butoxycarbonyl)piperidin-4-yl]-2-(methylsulfanyl)-6,9-dihydro-5H-pyrrolo[3,2-/j] quinazoline-7- carboxylic acid [(I), R1 = methyl, X= -S-, R2 = OH, R3 = 1-(fert-butoxycarbonyl)piperidin-4-yl, R4 = H, A = -
Figure imgf000056_0002
LC/MS (254nm) HPLC method 2 Rt 6.13 min.
9-{cis 4-[(tert-butoxycarbonyl)amino]cyclohexyl}-2-(methylsulfanyl)-6,9-dihydro-5H-pyrrolo[3,2-h] quinazoline-7-carboxylic acid [(I), R1 = methyl, X= -S-, R2 = OH, R3 = cis 4-[(tert- butoxycarbonyl)amino]cyclohexyl, R4 = H A = -CH2CH2-]
Figure imgf000056_0003
LC/MS (254nm) HPLC method 2 Rt 6.38 min.
1H NMR (600 MHz, DMSO-d6) δ 12.13 (br. s., 1 H), 8.31 (s, 1 H), 8.04 (s, 1 H), 7.23 (d, J = 8.97 Hz, 1 H), 5.45 (ddd, J = 4.03, 8.33, 12.00 Hz, 1 H), 3.81 (br. s., 1 H), 2.91 - 2.96 (m, 2H), 2.72 - 2.80 (m, 2H), 2.00 - 2.12 (m, 2H), 1.77 - 1.86 (m, 2H), 1.67 - 1.75 (m, 2H), 1.59 (m, 2H), 1.42 (s, 9H).
HRMS (ESI) calcd for C23H31N4O4S [M + H ]+ 459.2061 found 459.2066.
2-methyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxylic acid [(I), R1 = methyl, X= single bond, R2 = OH, R3 = H, R4 = H, A = -CH2CH2-]
Figure imgf000057_0001
Example 14 (conv. 4)
8-methyl-2-(methylsulfanyl)-9-(propan-2-yl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamide [(I), R1 = methyl, X= -S-, R2 = NH2, R3 = /'s- ropyl, R4 = methyl, A = -CH2CH2-] (Cmpd 19)
Figure imgf000057_0002
8-methyl-2-(methylsulfanyl)-9-(propan-2-yl)-6,9-dihydro-5H-pyrrolo[3,2-h]quin acid (100 mg,
0.363 mmol) in dry DMA (2.0 mL) was treated with NH4CI ( 0.062 g 0.108 mmol), DIPEA (0.253 mL, 0.14 mmol) and TBTU (175 mg, 0.544 mmol). The reaction was stirred at room for 18 h. The reaction was diluted with sat. NaHC03 and the resulting precipitate was collected by filtration, washed with diethyl ether to afford 90 mg (yield: 90%) of the title compound as yellow solid.
LC/MS (254nm) HPLC method 2 Rt 4.63 min.
HRMS (ESI) calcd for Ci6H2iN4OS [M + H ]+ 317.1431 found 317.1435.
By working according to this method, the following compounds were prepared:
8-methyl-2-(methylsulfanyl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamide [(I), R1 = methyl, X= -S-, R2 = NH2, R3 = H, R4 = methyl, A = -CH2CH2- (cmpd 20)
Figure imgf000057_0003
LC/MS (254nm) HPLC method 3 Rt 4.63 min.
1H NMR (500 MHz, DMSO-d6) δ 2.42 (s, 3 H) 2.52 (s, 3 H) 2.79 (t, J=8.05 Hz, 2 H) 2.87 (t, J=8.05 Hz, 2 H) 6.53 - 7.04 (m, 2 H) 8.21 (s, 1 H) 11.79 (br. s., 1 H)
HRMS (ESI) calcd for Ci3Hi5N4OS [M + H ]+ 275.0961 found 275.0968.
2-(methylsulfanyl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamide [(I), R1 = methyl, X= -S-, R2 = NH2, R3 = R4 = H, A = -CH2CH2-] (cmpd 21)
Figure imgf000057_0004
LC/MS (254nm) HPLC method 3 Rt 5.43 min. 1H NMR (500 MHz, DMSO-d6) δ 2.52 (s, 3 H) 2.81 (t, J=7.78 Hz, 2 H) 3.00 (t, J=7.78 Hz, 2 H) 6.79 (br. s., 1 H) 7.31 (br. s., 1 H) 7.61 (d, J=3.11 Hz, 1 H) 8.27 (s, 1 H) 12.02 (br. s., 1 H)
HRMS (ESI) calcd for C12H13N4OS [M + H ]+ 261.0805 found 261.0814.
2-(methylsulfanyl)-9-(propan-2-yl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamide [(I), R1 = methyl, X= -S-, R2 = NH2, R3 = /s-propyl, R4 = H, A = -CH CH2-] (cmpd 22)
Figure imgf000058_0001
LC/MS (254nm) HPLC method 3 Rt 4.48 min.
1H NMR (600 MHz, DMSO-d6) δ 1.44 (d, J=6.59 Hz, 6 H) 2.75 (t, J=7.78 Hz, 2 H) 2.98 (t, J=7.78 Hz, 2 H) 5.63 - 5.74 (m, 1 H) 6.81 (br. s., 1 H) 7.30 (br. s., 1 H) 7.88 (s, 1 H) 8.28 (s, 1 H)
HRMS (ESI) calcd for C15H19N4OS [M + H ]+ 303.1274 found 303.1277.
2-(dimethylamino)-8-methyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamide [(I), R1 = methyl, X= - N(Me)-, R2 = NH2, R3 = H, R4 = methyl, A = -CH2CH2- (cmpd 23)
Figure imgf000058_0002
LC/MS (254nm) HPLC method 3 Rt 2.65 min.
1H NMR (600 MHz, DMSO-d6) δ 2.43 (s, 3 H) 2.67 (t, J=7.69 Hz, 2 H) 2.81 (t, J=7.69 Hz, 2 H) 3.13 (s, 6 H) 6.50 - 6.95 (m, 2 H) 7.96 (s, 1 H) 11.45 (br. s., 1 H).
HRMS (ESI) calcd for Ci4Hi8N50 [M + H ]+ 272.1506 found 272.1509.
fert-butyl 4-[7-carbamoyl-2-(methylsulfanyl)-5,6-dihydro-9H-pyrrolo[3,2-/j]quinazolin-9-yl]piperidine -1- carboxylate [(I), R1 = methyl, X= -S-, R2 = NH2, R3 = 1-(fert-butoxycarbonyl)piperidin-4-yl, R4 = H, A = - CH2CH2-]
Figure imgf000058_0003
LC/MS (254nm) HPLC method 1 Rt 1.473 min.
fert-butyl {c/s-4-[7-carbamoyl-2-(methylsulfanyl)-5,6-dihydro-9H-pyrrolo[3,2-/j]quinazolin-9-yl]cyclo hexyl}carbamate [(I), R1 = methyl, X= -S-, R2 = NH2, R3 = cis 4-[(tert-butoxycarbonyl)amino]cyclohexyl, R4 = H, A = -CH2CH2-]
Figure imgf000059_0001
LC/MS (254nm) HPLC method 1 Rt 1.501 min.
2-methyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamide [(I), R1 = methyl, X= single bond, R2 = NH2, R3 = H, R4 = H, A = -CH2CH2-] (cmpd 37)
Figure imgf000059_0002
HRMS (ESI) calcd for Ci4Hi8N50 [M + H ]+ 229.1084found 229.1085.
tert-butyl 4-(2-amino-7-carbamoyl-5,6-dihydro-9H-pyrrolo[3,2-h]quinazolin-9-yl)piperidine-1-carboxylate [(I), R1 = H, X= -NH-, R2 = NH2, R3 = 4-[(tert-bu lohexyl, R4 = H, A = -CH2CH2-]
Figure imgf000059_0003
1 H NMR (600 MHz, DMSO-d6) d ppm 1.43 (s, 9 H) 1.56 - 1.67 (m, 2 H) 1.98 - 2.05 (m, 2 H) 2.61 (t, J=7.69 Hz, 2 H) 2.92 (t, J=7.69 Hz, 2 H) 2.95 -3.05 (m, 2 H) 4.01 - 4.16 (m, 2 H) 5.57 - 5.68 (m, 1 H) 6.37 (br. s., 2 H) 6.75 (br. s., 2 H) 7.80 (s, 1 H) 7.95 (s, 1 H)
HRMS (ESI) calcd for C15H18N4O2S [M + H ]+ 413.2296; found 413.2296.
Example 15 (conv. 2)
9-(2-hydroxyethyl)-8-methyl-2-(methylsulfanyl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamide [(I), R1 = methyl, X= -S-, R2 = NH2 R3 = 2-hydroxyethyl, R4 = methyl, A = -CH2CH2-] (cmpd 24)
Figure imgf000059_0004
To a solution of 8-methyl-2-(methylsulfanyl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamide (30 mg, 0.109 mmol) in dry dimethylformamide (2 mL), 2-iodo ethanol (37 μΙ_, 0.437 mmol) and cesium carbonate (106 mg 0.327 mmol) were added. The resulting mixture was heated at 90°C for 8 hours. After cooling to room temperature, the mixture was poured into water and extracted with EtOAc. The organic layer washed with brine, dried over Na2S04 and concentrated. The crude was purified by silica gel chromatography eluting with DCM/MeOH 95/5 to give the title compound 8 mg (25%).
LC/MS (254nm) HPLC method 2 Rt 3.32 min.
1H NMR (400 MHz, DMSO-d6) δ 2.45 (s, 3 H) 2.47 (s, 3 H) 2.74 (t, J=8.05 Hz, 2 H) 2.83 (t, J=8.05 Hz, 2 H) 3.68 (q, J=5.90 Hz, 2 H) 4.54 (t, J=5.90 Hz, 2 H) 4.86 (t, J=5.90 Hz, 1 H) 6.70 - 7.09 (m, 2 H) 8.22 (s, 1 H).
HRMS (ESI) calcd for C15H18N4O2S [M + H ]+ 319.1223 found 319.1215.
By working according to this method, the following compound was prepared:
9-(2-hydroxyethyl)-2-(methylsulfanyl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamide [(I), R1 = methyl, X= -S-, R2 = NH2, R3 = 2-hydroxyeth l, R4 = H, A = -CH2CH2-] (cmpd 25)
Figure imgf000060_0001
LC/MS (254nm) HPLC method 2 Rt 4.21 min.
1H NMR (400 MHz, DMSO-d6) δ 2.47 (s, 3 H) 2.77 (t, J=7.80 Hz, 2 H) 2.99 (t, J=7.80 Hz, 2 H) 3.71 (q, J=5.50 Hz, 2 H) 4.52 (t, J=5.50 Hz, 2 H) 4.90 (t, J=5.50 Hz, 1 H) 6.81 (br. s., 1 H) 7.30 (br. s., 1 H) 7.63 (s, 1 H) 8.27 (s, 1 H). HRMS (ESI) calcd for C14H17N4O2S [M + H ]+ 305.1067 found 305.1062.
Example 16 (conv. 23)
methyl 2-(methylsulfanyl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxylate [(I), R1 = methyl, X= -S-, R2 = -O-methyl, R3 = R4 = H, A = -CH=CH-]
Figure imgf000060_0002
A solution of methyl 2-(methylsulfanyl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxylate 250 mg (0.91 mmol) and 330 mg ( 1.82 mmol) of DDQ in chlorobenzene was heated at 140°C for 2 hours. The volatiles were removed in vacuo, the residue was dissolved with ethyl acetate, and washed with sat. aqueous solution of NaHC03. The organic phase was dried with Na2S04, filtered and concentrated. The crude material was purified by silica gel column chromatography eluting with ethyl acetate and hexane (1 :4) yielding the title compound 180 mg (90%).
LC/MS (254nm) HPLC method 2 Rt 5.72 min.
1H NMR (400 MHz, DMSO-d6) δ 2.73 (s, 3 H) 3.86 (s, 3 H) 7.74 (d, J=8.61 Hz, 1 H) 8.20 (d, J=8.61 Hz, 1 H) 8.26 (d,
J=3.11 Hz, 1 H) 9.37 (s, 1 H) 13.23 (br. s., 1 H).
HRMS (ESI) calcd for C13H12N3O2S [M + H ]+ 274.0645 found 274.065.
Using the same method as described in the above example, the following analogs were also synthesized:
ethyl 8-methyl-2-(methylsulfanyl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxylate [(I), R1 = methyl, X= -S-, R2 = - O-methyl, R3 = H, R4 = methyl, A = -CH=CH-]
Figure imgf000061_0001
LC/MS (254nm) HPLC method 2 Rt 5.95 min.
1H NMR (400 MHz, DMSO-d6) δ 1.38 (t, J=7.14 Hz, 3 H) 2.73 (s, 3 H) 2.77 (s, 3 H) 4.33 (q, J=7.14 Hz, 2 H) 7.68 (d, J=8.61 Hz, 1 H) 8.15 (d, J=8.61 Hz, 1 H) 9.32 (s, 1 H) 12.93 (br. s., 1 H).
HRMS (ESI) calcd for C15H16N3O2S [M + H ]+ 302.0958 found 302.0957.
2-(dimethylamino)-8-methyl-9H-pyrrolo[3,2-h]quinazoline-7-carboxamide [(I), R1 = methyl, X= -S-, R2 = NH2, R3 = H, R4 = methyl, A = -CH=CH-] (cmpd 26
Figure imgf000061_0002
LC/MS (254nm) HPLC method 2 Rt 3.52 min.
1H NMR (400 MHz, DMSO-d6) δ 2.67 (s, 3 H) 3.30 (s, 6 H) 7.01 (s, 2 H) 7.35 (d, J=8.61 Hz, 1 H) 7.67 (d, J=8.61 Hz, 1 H) 9.04 (8, 1 H) 12.08 (br. s., 1 H).
HRMS (ESI) calcd for Ci4Hi6N5OS [M + H ]+ 270.1350 found 270.1352.
Example 17 (conv. 2)
methyl 9-methyl-2-(methylsulfanyl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxylate [(I), R1 = methyl, X= -S-, R2 = - O-methyl, R3 = methyl, R4 = H A = -CH=CH-]
Figure imgf000061_0003
To a solution of methyl 2-(methylsulfanyl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxylate (80 mg 0.29 mmol) in DMF (1.5 mL), CS2CO3 (191 mg, 0.58 mmol) and methyl iodide (18 μί, 0.29 mmol) were added. The mixture was stirred at room temperature for 8 h, solvent was removed under vacuo, then DCM (10 mL) was added and the organic phase washed with water (2x15 mL). The organic fraction was dried over Na2S04, filtrated and concentered in vacuo. Purification by flash chromatography on silica gel (eluant: AcOEt/hexane 4/6) provided 58 mg (yield: 70%) of the title compound as a pale yellow solid.
LC/MS (254nm) HPLC method 2 Rt 6.4 min.
1H NMR (400 MHz, DMSO-d6) δ 2.68 (s, 3 H) 3.86 (s, 3 H) 4.49 (s, 3 H) 7.75 (d, J=8.67 Hz, 1 H) 8.21 (d, J=8.67 Hz, 1 H) 8.35 (s, 1 H) 9.35 (s, 1 H).
HRMS (ESI) calcd for C14H14N3O2S [M + H ]+ 288.0801 found 288.0802.
Example 18 (conv. 3)
9-methyl-2-(methylsulfanyl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxylic acid [(I), R1 = methyl, X= -S-, R2 = -OH, R3 = R4 = H, A = -CH=CH-]
Figure imgf000062_0001
Methyl 9-methyl-2-(methylsulfanyl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxylate (50 mg, 0.174 mmol) was suspended in dioxane (5 mL) and treated with a 2 N solution of NaOH (2.0 mL, 4 mmol) at 95°C for 2 h. H20 (20 mL) was added and the solution was acidified (pH ~6) with HCI 2N. The solid was filtrated and washed with water and diethyl ether to provide 40 mg (85%) of the title compound as off-white solid.
LC/MS (254nm) HPLC method 2 Rt 4.13 min.
1H NMR (600 MHz, DMSO-d6) δ 2.68 (s, 3 H) 4.48 (s, 3 H) 7.71 (d, J=8.61 Hz, 1 H) 8.23 (d, J=8.61 Hz, 1 H) 8.26 (s, 1 H) 9.34 (s, 1 H) 12.35 (br. s., 1 H).
HRMS (ESI) calcd for C13H12N3O2S [M + H ]+ 274.0645 found 274.064.
Working according to the same method the following compounds were prepared:
8-methyl-2-(methylsulfanyl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxylic acid [(I), R1 = methyl, X= -S-, R2 = -OH, R3 = H, R4 = methyl, A = -CH=CH-]
Figure imgf000062_0002
LC/MS (254nm) HPLC method 2 Rt 4.21 min.
1H NMR (600 MHz, DMSO-d6) δ 2.73 (s, 3 H) 2.76 (s, 3 H) 7.65 (d, J=8.61 Hz, 1 H) 8.18 (d, J=8.61 Hz, 1 H) 9.31 (s, 1 H) 12.23 (br. s., 1 H) 12.83 (br. s., 1 H).
HRMS (ESI) calcd for C13H12N3O2S [M + H ]+ 274.0645 found 274.065.
9-[1-(tert-butoxycarbonyl)piperidin-4-yl]-2-(methylsulfanyl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxylic acid [(I), R1 = methyl, X= -S-, R2 = -OH, R3 = 1-(tert-butoxycarbonyl)piperidin-4-yl, R4 = H, A = -CH=CH-]
Figure imgf000062_0003
2-(methylsulfanyl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxylic acid [(I), R1 = methyl, X= -S-, R2 = -OH, R3 = H, R4 = methyl, A = -CH=CH-]
Figure imgf000062_0004
Example 19 (conv. 4) 9-methyl-2-(methylsulfanyl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxamide [(I), R1 = methyl, X= -S-, R2 = NH2, R3 = Methyl, R4 = H, A = -CH=CH- (cmpd 27)
Figure imgf000063_0001
9-methyl-2-(methylsulfanyl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxylic acid (30 mg, 0.109 mmol) in dry DMA (2.0 mL) was treated with NH4CI ( 0.040 g 0.74 mmol), DIPEA (0.120 ml, 0.68 mmol) and TBTU (70 mg, 0.218 mmol). The reaction was stirred at room temperature for 3 h. The reaction was diluted with sat. NaHC03 and the product extracted with EtOAc (3x30 mL). The organic fractions were dried over Na2S04, filtered and evaporated in vacuo to afford 27 mg (yield: 93%) of the title compound as off-white solid.
LC/MS (254nm) HPLC method 2 Rt 3.84 min.
1H NMR (500 MHz, DMSO-d6) δ 2.68 (s, 3 H) 4.46 (s, 3 H) 7.01 (br. s., 1 H) 7.58 (br. s., 1 H) 7.64 (d, J=8.61 Hz, 1 H)
8.19 (s, 1 H) 8.39 (d, J=8.61 Hz, 1 H) 9.31 (s, 1 H).
HRMS (ESI) calcd for Ci3Hi3N4OS [M + H ]+ 273.0805 found 273.0814.
Working according to the same method the following compounds were prepared:
8-methyl-2-(methylsulfanyl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxamide [(I), R1 = methyl, X= -S-, R2 = NH2, R3 = H, R4 = methyl, A = -CH=CH-] (cmpd 28
Figure imgf000063_0002
LC/MS (254nm) HPLC method 2 Rt 3.54 min.
1H NMR (600 MHz, DMSO-d6) δ 2.71 (s, 3 H) 2.72 (s, 3 H) 7.14 (s, 2 H) 7.58 (d, J=8.61 Hz, 1 H) 8.04 (d, J=8.61 Hz, 1 H) 9.29 (s, 1 H) 12.57 (s, 1 H).
HRMS (ESI) calcd for C13H13N3O2S [M + H ]+ 273.0805 found 273.0807.
tert-butyl 4-[7-carbamoyl-2-(methylsulfanyl)-9H-pyrrolo[3,2-h]quinazolin-9-yl]piperidine-1-carboxylate [(I), R1 = methyl, X= -S-, R2 = -NH2, R3 = 1-(tert-butoxycarbonyl)piperidin-4-yl, R4 = H, A = -CH=CH-]
Figure imgf000063_0003
2-(methylsulfanyl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxamide [(I), R1 = methyl, X= -S-, R2 = -NH2, R3 = H, R4 = H, A = -CH=CH-] (cmpd 36)
Figure imgf000064_0001
1H NMR (600 MHz, DMSO-d6) d ppm 2.72 (s, 3 H) 6.98 (br. s., 1 H) 7.62 (d, J=8.61 Hz, 1 H) 7.64 (br. s., 1 H) 8.28 (s, 1 H) 8.37 (d, J=8.61 Hz, 1 H) 9.33 (s, 1 H) 12.80 (br. s., 1 H)
HRMS (ESI) calcd for C13H13N3O2S [M + H ]+ 259.0648; found 259.0646.
Example 20 (conv. 2)
9-(2-hydroxyethyl)-8-methyl-2-(methylsulfanyl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxamide [(I), R1 = methyl, X= -S-, R2 = NH2, R3 = 2-h droxyethyl, R4 = methyl, A = -CH=CH-] (cmpd 29)
Figure imgf000064_0002
To a solution of 8-methyl-2-(methylsulfanyl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxamide (20 mg 0.072 mmol) in DMF (1.5 ml_), 2-iodo ethanol (24 μΙ_, 0.288 mmol) and cesium carbonate (70 mg 0.216 mmol) were added. The resulting mixture was heated at 80°C for 8 hours. After cooling to room temperature, the reaction mixture was poured in water
(10 ml_) and portioned with ethyl acetate. The organic layers were washed with brine, dried over Na2S04 and concentrated. The crude was purified by silica gel chromatography (DCM/MeOH/acetone 85/0.5/1) to give the title compound 10 mg (45%) as a white solid.
LC/MS (254nm) HPLC method 2 Rt 4.31 min.
1H NMR (400 MHz, DMSO-d6) 2.62 (s, 3 H) 2.73 (s, 3 H) 3.85 (q, J=5.50 Hz, 2 H) 4.92 (t, J=5.50 Hz, 1 H) 4.98 (t,
J=5.50 Hz, 2 H) 7.29 (br. s., 2 H) 7.62 (d, J=8.61 Hz, 1 H) 8.01 (d, J=8.61 Hz, 1 H) 9.28 (s, 1 H).
HRMS (ESI) calcd for C15H17N4O2S [M + H ]+ 317.1067 found 317.1064.
Operating in an analogous way, the following compounds were prepared:
8-methyl-2-(methylsulfanyl)-9-(propan-2-yl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxamide [(I), R1 = methyl, X= -
S-, R2 = NH2, R3 = /'s-propyl, R4 = methyl, A = -CH=CH- (cmpd 30)
Figure imgf000064_0003
LC/MS (254nm) HPLC method 2 Rt 6.1 min.
1H NMR (400 MHz, DMSO-d6) δ 1.54 - 1.93 (m, 6 H) 2.63 (s, 3 H) 2.79 (s, 3 H) 4.96 - 5.10 (m, 1 H) 7.35 (br. s., 2 H) 7.57- 7.68 (m, 1 H) 7.90 -8.04 (m, 1 H) 9.28 (s, 1 H).
HRMS (ESI) calcd for Ci6Hi9N4OS [M + H ]+ 315.1274 found 315.1281.
9-ethyl-2-(methylsulfanyl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxamide [(I), R1 = methyl, X= -S-, R2 = NH2, R3 = ethyl, R4 = H, A = -CH=CH-] (cmpd 31)
Figure imgf000065_0001
LC/MS (254nm) HPLC method 2 Rt 4.13 min.
1H NMR (600 MHz, DMSO-d6) δ 1.51 (t, J=7.14 Hz, 3 H) 2.66 (s, 3 H) 4.94 (q, J=7.14 Hz, 2 H) 7.02 (br.
(br. s., 1 H) 7.65 (d, J=8.61 Hz, 1 H) 8.28 (s, 1 H) 8.41 (d, J=8.61 Hz, 1 H) 9.32 (s, 1 H).
HRMS (ESI) calcd for C14H15N4OS [M + H ]+ 287.0961 ; 287.0961.
Example 21 (conv. 23)
fert-butyl {c/s-4-[7-carbamoyl-2-(methylsulfanyl)-9H-pyrrolo[3,2-/j]quinazolin-9-yl]cyclohexyl} carbamate [(I), R1 = methyl, X= -S-, R2 = NH2 R3 = cis 4-[(tert-butoxycarbonyl)amino]cyclohexyl, R4 = H, A = -CH=CH-]
Figure imgf000065_0002
A solution of ferf-butyl {c/s-4-[7-carbamoyl-2-(methylsulfanyl)-5,6-dihydro-9/-/-pyrrolo[3,2-/5]quinazolin-9- yl]cyclohexyl}carbamate 15 mg (0.032 mmol) and 15 mg ( 0.064 mmol) of DDQ in chlorobenzene was heated at 140°C for 2 hours. The volatiles were removed in vacuo, the residue was dissolved with ethyl acetate, and washed with sat. aqueous solution of NaHC03. The organic phase was dried with Na2S04, filtered and concentrated. The crude material was purified by silica gel column chromatography eluting with DCM/MeOH (97:3) yielding the title compound 10 mg (71 %).
LC/MS (254nm) HPLC method 2 Rt 5.72 min.
Example 22 (conv. 24)
methyl 2-(methylsulfanyl)-9-(piperidin-4-yl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxylate hydrochloride [(I), R1 = meth l, X= -S-, R2 = -O-methyl, R3 = piperidin-4-yl, R4 = H, A = -CH2CH2-]
Figure imgf000065_0003
Methyl 9-[1-(ferf-butoxycarbonyl)piperidin-4-yl]-2-(methylsulfanyl)-6,9-dihydro-5/-/-pyrrolo[3,2-/5]quinazoline -7- carboxylate 10 mg (0.021 mmol) was dissolved in 1 ,4 dioxane (2 mL) and 4 M HCI in 1 ,4-dioxane 3 mL (3 mmol) was added. The mixture was stirred at room temperature for 1 h. The volatiles were removed in vacuo and the obtained residue was triturated with diethyl ether, filtered and dried, to afford the title compound 8 mg (97%).
LC/MS (254nm) HPLC method 2 Rt 3.64 min. 1H NMR (600 MHz, DMSO-d6) δ 82.08 - 2.19 (m, 2 H) 2.22 - 2.29 (m, 2 H) 2.54 (s, 3 H) 2.81 (t, J=7.88 Hz, 2 H) 2.97 (t, J=7.88 Hz, 2 H) 2.99 - 3.03 (m, 2 H) 3.44 - 3.51 (m, 2 H) 3.75 (s, 3 H) 5.51 - 5.59 (m, 1 H) 7.71 (s, 1 H) 8.38 (s, 1 H) 8.78 (br. s., 1 H) 8.83 (br. s., 1 H).
HRMS (ESI) calcd for C18H24N4O2S [M + H ]+ 359.1536 found 359.1531.
Operating in an analogous way, the following compounds were prepared:
2-(methylsulfanyl)-9-(piperidin-4-yl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamid hydrochloride [(I), R1 = methyl, X= -S-, R2 = NH2, R3 = piperidin-4- l, R4 = H, A = -CH2CH2-] (cmpd 32)
Figure imgf000066_0001
LC/MS (254nm) HPLC method 2 Rt 3.61 min.
1H NMR (600 MHz, DMSO-d6) δ 1.91 - 2.11 (m, 2 H) 2.23 - 2.32 (m, 2 H) 2.53 (s, 3 H) 2.76 (t, J=7.60 Hz, 2 H) 2.89 - 3.06 (m, 4 H) 3.45 - 3.56 (m, 2 H) 5.40 - 5.50 (m, 1 H) 6.89 (br. s., 1 H) 7.45 (br. s., 1 H) 7.83 (s, 1 H) 8.33 (s, 1 H) 8.85 (br. s., 2 H).
HRMS (ESI) calcd for C17H23N5OS [M + H ]+ 344.154 found 344.1544.
9-(c/s 4-aminocyclohexyl)-2-(methylsulfanyl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxami^ hydrochloride [(I), R1 = methyl, X= -S-, R2 = NH2, R3 = cis 4-aminocyclohexyl, R4 = H, A = -CH2CH2-] (cmpd 33)
Figure imgf000066_0002
LC/MS (254nm) HPLC method 2 Rt 3.91 min.
1H NMR (600 MHz, DMSO-d6) δ 1.72 - 1.86 (m, 2 H) 1.89 - 2.01 (m, 4 H) 2.01 - 2.13 (m, 2 H) 2.76 (t, J=7.70 Hz, 2 H) 2.94 (t, J=7.70 Hz, 2 H) 3.43 - 3.54 (m, 1 H) 5.31 - 5.44 (m, 1 H) 6.93 (br. s., 1 H) 7.16 (br. s., 1 H) 8.00 (s, 1 H) 8.08 (br. s., 3 H) 8.30 (s, 1 H).
HRMS (ESI) calcd for C18H24N5OS [M + H ]+ 358.1696 found 358.1694.
9-(cis-4-aminocyclohexyl)-2-(methylsulfanyl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxamide [(I), R1 = methyl, X= -S-, R2 = NH2, R3 = cis 4-aminocyclohexyl R4 = H, A = -CH=CH-] (cmpd 34)
Figure imgf000066_0003
LC/MS (254nm) HPLC method 2 Rt 3.15 min. 1H NMR (600 MHz, DMSO-d6) δ 1.85 - 1.96 (m, 2 H) 2.00 - 2.07 (m, 2 H) 2.07 - 2.14 (m, 2 H) 2.17 - 2.29 (m, 2 H) 2.68 (s, 3 H) 3.51 - 3.58 (m, 1 H) 6.01 - 6.11 (m, 1 H) 7.11 (br. s., 1 H) 7.54 (br. s., 1 H) 7.67 (d, J=8.61 Hz, 1 H) 8.13 (br. s., 3 H) 8.38 (d, J=8.61 Hz, 1 H) 8.64 (s, 1 H) 9.33 (s, 1 H).
HRMS (ESI) calcd for C18H22N5OS [M + H ]+ 356.1696 found 356.1694.
9-(3-amino-2,2-dimethylpropyl)-2-(methylsulfanyl)-9H-pyrrolo[3,2-/j]quinazoline-7-carboxamide hydrochloride [(I), R1 = methyl, X= -S-, R2 = NH2, R3 = 3-amino-2 2-dimethylpropyl, R4 = H, A = -CH=CH-] (cmpd 38)
Figure imgf000067_0001
LC/MS (254nm) HPLC method 2 Rt 3.89 min.
1H NMR (600 MHz, DMSO-d6) δ 9.35 (s, 1 H), 8.47 (d, J = 8.61 Hz, 1 H), 8.28 (s, 1 H), 7.83 (br. s., 4H), 7.69 (d, J = 8.79 Hz, 1 H), 7.08 (br. s., 1 H), 5.11 (s, 2H), 2.76 (d, J = 5.86 Hz, 2H), 2.71 (s, 3H), 1.02 - 1.07 (m, 6H). HRMS (ESI) calcd for C17H22N5OS [M + H ]+ 344.1540 found 344.1544.
9-(azepan-3-yl)-2-(methylsulfanyl)-9H-pyrrolo[3,2-/j]quinazoline-7-carboxamide hydrochloride [(I), R1 = methyl, X= -S-, R2 = NH2, R3 = azepan-3-yl, R4 = H A = -CH=CH-] (cmpd 39)
Figure imgf000067_0002
LC/MS (254nm) HPLC method 2 Rt 3.82 min.
1H NMR (600 MHz, DMSO-d6) δ 9.34 (s, 1 H), 8.80 - 9.09 (m, 2H), 8.50 (s, 1 H), 8.43 (d, J = 8.61 Hz, 1 H), 7.72 - 7.75 (m, 1 H), 7.67 (d, J = 8.61 Hz, 1 H), 6.90 - 7.17 (m, 1 H), 6.26 (br. s., 1 H), 3.21 (m, 2H), 2.69 (s, 3H), 2.32-2.46 (m, 3H), 2.07-2.11 (m, 2H), 1.91 (m, 1 H).
HRMS (ESI) calcd for C18H22N5OS [M + H ]+ 356.1540 found 356.1538.
2-amino-9-(piperidin-4-yl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamide hydrochloride [(I), R1 = H, X= -NH-, R2 = NH2, R3 = piperidin-4-yl, R4 = H, A = -CH2CH2-]
Figure imgf000067_0003
1 H NMR (600 MHz, DMSO-d6) d ppm 1.95 - 2.11 (m, 2 H) 2.22 - 2.33 (m, 2 H) 2.53 (s, 3 H) 2.76 (t, J=7.60 Hz, 1 H) 2.89 - 3.06 (m, 4 H) 3.45 - 3.55 (m, 2 H) 5.40 - 5.50 (m, 1 H) 6.89 (br. s., 1 H) 7.45 (br. s., 1 H) 7.83 (s, 1 H) 8.33 (s, 1 H) 8.85 (br. s., 2 H)
HRMS (ESI) calcd for C18H22N5O [M + H ]+ 344.1540; found 344.1544. 2-(methylsulfanyl)-9-(piperidin-4-yl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxamide [(I), R1 = methyl, X= -S-, R2 = NH2, R3 = piperidin-4-yl, R4 = H, A = -CH=CH-] (cmpd 35)
Figure imgf000068_0001
1 H NMR (600 MHz, DMS0-d6) d ppm 1.80 - 1.94 (m, 2 H) 2.11 - 2.19 (m, 2 H) 2.71 (s, 3 H) 2.72 - 2-80 (m, 2 H) 3.15 - 3.24 (m, 2 H) 6.07 - 6-17 (m, 1 H) 7.01 (br. s., 1 H) 7.63 (br. s., 1 H) 7.66 (d, J=8.61 Hz, 1 H) 8.45 (d, J=8.61 Hz, 1 H) 8.55 (s, 1 H) 9.32 (s, 1 H)
HRMS (ESI) calcd for C18H22N5O [M + H ]+ 245.1033; found 245.1041.
Example 23 (step G)
methyl 2-methyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxylate [(I), R1 = methyl, X= single bond, R2 = -O-methyl, R3 = H, R4 = H, A = = -CH2CH2-]
Figure imgf000068_0002
To a solution of methyl (6E)-6-[(dimethylamino)methylidene]-7-oxo-4,5,6J-tetrahydro-1 H-indole-3-carboxylate (50 mg, 0.2 mmmol) in DMF (4 ml_) acetamidine hydrochloride (190 mg, 2.0 mmol) and K2CO3 (275 mg, 2.0 mmol) were added and the mixture was heated at 180°C for 1 h under microwave irradiation. Volatiles were removed in vacuo, the residue was dissolved with DCM, and washed with H2O. The organic phase was dried with Na2S04, filtered and concentrated. The crude material was purified by silica gel column chromatography eluting with DCM/MeOH (10:1) yielding the title compound 20 mg (40%) as a dark yellow solid.
1 H NMR (600 MHz, DMSO-d6) d ppm 2.55 (s, 3 H) 2.85 - 2.90 (m, 2 H) 2.96 - 2.99 (m, 2 H) 3.72 (s, 3 H) 7.50 (s, 1 H) 8.35 (s, 1 H) 12.40 (br. s., 1 H)
HRMS (ESI) calcd for C18H22N5O [M + H ]+ 244.1081 ; found 244.1087.
Example 24 (step G)
methyl 2-amino-9-[1-(tert-butoxycarbonyl)piperidin-4-yl]-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7- carboxylate [(I), R1 = H, X= -NH-, R2 = -O-methyl, R3 = 1-(tert-butoxycarbonyl)piperidin-4-yl, R4 = H, A = = - CH2CH2-]
Figure imgf000069_0001
To a solution of methyl (6E)-1-[1-(tert-butoxycarbonyl)piperidin-4-yl]-6-[(dimethylamino)methylidene]-7-oxo-4,5,6J- tetrahydro-1 H-indole-3-carboxylate (10 mg, 0.023 mmol) in DMF (1 ml_) guanidine carbonate (10 mg, 0.055 mmol) was added. The mixture was stirred at 110 °C for 8 hours. The resulting mixture was cooled at room temperature and evaporated to dryness. The crude solid was purified by flash chromatography on silica gel (eluant: AcOEt) to afford 8 mg (yield: 80%) of the title compound as a brown solid.
MS calculated: 428.2293; MS found: 428.2292
1 H NMR (401 MHz, DMSO-d6) d ppm 1.43 (s, 9 H) 1.66 - 1.84 (m, 2 H) 1.92 - 2.04 (m, 2 H) 2.62 - 2.69 (m, 2 H) 2.86 - 2.92 (m, 2 H) 2.92 - 3.10 (m, 2 H) 3.71 (s, 3 H) 3.98 - 4.07 (m, 2 H) 5.59 - 5.72 (m, 1 H) 6.28 (s, 2 H) 7.72 (s, 1 H) 7.99 (s, 1 H)
Operating in an analogous way, the following compound was prepared:
methyl 2-amino-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxylate [(I), R1 = H, X= -NH-, R2 = -O-methyl, R3 = H, R4 = H, A = = -CH2CH2-]
Figure imgf000069_0002
MS calculated: 245.1033; MS found: 245.1041
1 H NMR (600 MHz, DMSO-d6) d ppm 2.71 (t, J=7.78 Hz, 2 H) 2.91 (t, J=7.78 Hz, 2 H) 3.71 (s, 3 H) 6.08 (br.
7.44 (d, J=2.93 Hz, 1 H) 7.98 (s, 1 H) 12.09 (br. s., 1 H)
Preparation I
methyl 2-(methylsulfanyl)-8-iodo-9H-pyrrolo[3,2-h]quinazoline-7-carboxylate [(I), R1 = methyl, X= -S-, R2 = - O-methyl, R3 = H, R4 = I, A = -CH=CH-]
Figure imgf000069_0003
To a solution of methyl 2-(methylsulfanyl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxylate (100 mg, 0.363 mmol) in DMF (5 ml_) N-iodosuccinimide (3.25 mg, 1.44 mmol) was added and the mixture was stirred at room temperature fo 24 h. Volatiles were removed in vacuo, the residue was dissolved with DCM and washed with H2O. The organic phase was dried with Na2S04, filtered and concentrated. The crude material was purified by silica gel column chromatography eluting with Hexane/AcOEt (4:2) yielding the title compound 85 mg (60%) as a yellow solid. 1 H NMR (600 MHz, DMSO-d6) d ppm 2.75 (s, 3 H) 3.89 (s, 3 H) 7.69 (d, J=8.79 Hz, 1 H) 8.15 (d, J=8.79 Hz, 1 H) 9.35 (s, 1 H) 13.75 (s, 1 H)
MS calculated: 399.9611 ; MS found: 399.9610
Example 25 (conv. 23)
methyl 9-[1-(tert-butoxycarbonyl)piperidin-4-yl]-2-(methylsulfanyl)-9H-pyrrolo[3,2-h]quinazoline-7-carb
= methyl, X= -S-, R2 = -O-methyl, R3 = 1-(tert-butoxycarbonyl)piperidin-4-yl, R4 = H, A = -CH=CH-]
Figure imgf000070_0001
To a solution of methyl 9-[1-(tert-butoxycarbonyl)piperidin-4-yl]-8-iodo-2-(methylsulfanyl)-9H-pyrrolo[3,2- h]quinazoline-7-carboxylate (30 mg, 0.05 mmol) in DMF (2 ml_) sodium formiate (7 mg, 10 mmol) and Pd(PPhi3)4 (50mg, 0.004 mmol) were added and the mixture was heated at 120°C for 3 hours. Volatiles were removed in vacuo. The crude material was purified by silica gel column chromatography eluting with DCM/MeOH (95:5) yielding the title compound 15 mg (65%) as a white solid.
Operating in an analogous way, the following compound was prepared:
methyl 2-(methylsulfanyl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxylate [(I), R1 = methyl, X= -S-, R2 = -O-methyl, R3 = H, R4 = H, A = -CH=CH-]
Figure imgf000070_0002
PHARMACOLOGY
The compounds of the formula (I) are active as protein kinase inhibitors and are therefore useful, for instance, to restrict the unregulated proliferation of tumour cells.
In therapy, they may be used in the treatment of various tumours, such as those formerly defined, as well as in the treatment of other cell proliferative disorders such as benign prostate hyperplasia, familial adenomatosis polyposis, neurofibromatosis, psoriasis, vascular smooth cell proliferation associated with atherosclerosis, pulmonary fibrosis, arthritis, glomerulonephritis and post-surgical stenosis and restenosis.
The inhibiting activity of putative MPS1 inhibitors and the potency of selected compounds were determined through the assays below described. The short forms and abbreviations used herein have the following meaning:
Ci Curie
DMSO dimethylsulfoxide
KDa kiloDalton
microCi microCurie
mg milligram
microg microgram
ng nanogram
L liter
mL milliliter
microL microliter
M molar
mM millimolar
microM micromolar
nM nanomolar
Et ethyl
Cloning, expression and purification of recombinant MPS1 full length protein.
MPS1 full length (corresponding to residues 2-857 of the full length sequence, see Swiss-Prot accession number P33981) was PCR amplified from the full-length human MPS1 gene present in house as clone pGEX4t_MPS1. Amplification was performed using the forward oligonucleotide:
5'ggggacaagtttgtacaaaaaagcaggcttactggaagttctgttccaggggcccgaatccgaggatttaagtggcagag3'
and the reverse oligonucleotide: 5'ggggaccactttgtacaagaaagctgggttttatttttttcccctttttttttcaaaagtcttggaggatgaag3'].
Both the oligonucleotides are described in WO2009/156315 published on 30 December 2009.
For cloning purposes, the oligonucleotides included attB sites in order to obtain an aiffi-flanked PCR product suitable for cloning using the Gateway® technology (Invitrogen). Furthermore, for purification purposes, forward primer included a protease cleavage site. The resulting PCR product was cloned in the pDONR201 plasmid and then transferred in the baculovirus expression vector pVL1393GST (Invitrogen) Gateway®-modified. Cloning was performed according to the protocols described in the Gateway® manual.
Baculoviruses were generated by cotransfecting Sf9 insect cells with the expression vector and the viral DNA using the BaculoGold® transfection kit (Pharmingen). Viral supernatant was recovered after 5 days and subjected to 3 rounds of amplification to increase viral titer. Recombinant protein was produced by infecting High5 insect cells. After 72 hours of infection at 21 °C, cells were recovered, pelletted and freezed at -80°C. For purification of recombinant protein, pellet was thawed, resuspended in lysis buffer (PBS, NaCI 150 mM, Glycerol 10%, CHAPS 0.1 %, DTT 20 mM, protease and phosphatase inhibitors) and lysed by Gaulin. Lysate was cleared by centrifugation and loaded on a GST affinity column. After extensive wash, recombinant protein was cleaved by a specific protease and eluted by incubation. To get a fully activated enzyme, the protein was then subjected to auto-phosphorylation in presence of ATP 1 mM at 25°C for 2 hours in kinase buffer (Hepes pH7.5 50 mM, MgCI2 2.5 mM, MnCI2 1 mM, DTT 1 mM, phosphatase inhibitors); ATP was then removed whit a desalting column.
Biochemical assay for inhibitors of MPS1 kinase activity
The inhibitory activity of putative kinase inhibitors and the potency of selected compounds were determined using a trans-phosphorylation assay.
Specific peptide or protein substrates are trans-phosphorylated by their specific ser-thr or tyr kinase in the presence of ATP traced with 33Ρ-γ-ΑΤΡ, and in the presence of their own optimal buffer and cofactors.
At the end of the phosphorylation reaction, more than 98% unlabeled ATP and radioactive ATP is captured by an excess of the ion exchange dowex resin; the resin then settles down to the bottom of the reaction plate by gravity. Supernatant is subsequently withdrawn and transferred into a counting plate, then evaluated by β-counting.
Reagents/assay conditions
/. Dowex resin preparation
500 g of wet resin (SIGMA, custom prepared resin DOWEX 1x8 200-400 mesh, 2.5 Kg) are weighed out and diluted to 2 L in 150 mM sodium formate, pH 3.00.
The resin is allowed to settle down (some hours) and then the supernatant is discarded.
After three washes as above over a couple of days, the resin is allowed to settle and two volumes (wrt the resin volume) of 150 mM sodium formate buffer are added.
The pH is then measured and should be around 3.00
The washed resin is stable for more than one week; the stock resin is kept at 4° C before use.
//. Kinase Buffer (KB)
The buffer for MPS1 assay was composed of HEPES 50 mM, at pH 7.5, with 2.5 mM MgCI2, 1 mM MnCI2, 1 mM DTT, 3 microM Na3V04 , 2 mM β-glycerophosphate and 0.2 mg/mL BSA.
///. Assay conditions
The assay was run with a final concentration MPS1 of 5 nM, in the presence of 15 microM ATP and 1.5 nM 33Ρ-γ- ATP; the substrate was Ρ38-β β, used at 200 microM.
Robotized dowex assay
The test mix consisted of:
1) 3x Enzyme mix (done in Kinase Buffer 3X), 5 microL/well
2) 3x substrate and ATP mix (done in ddH20), together with 33Ρ-γ-ΑΤΡ, 5 microL /well
3) 3x test compounds (diluted into ddH20 - 3% DMSO) - 5 microL /well
See below for compound dilution and assay scheme
Compound dilution and assay scheme is defined below:
/. Dilution of compounds
Test compounds are received as a 1 mM solution in 100% DMSO, distributed into 96 or 384 well plates: a) for percent inhibition studies (HTS), individual dilution plates at 1 mM are diluted at a 3X concentration (30 microM) in ddhbO (3% DMSO = final concentration) using a Beckman NX automated pipetting platform. The same instrument is used for distributing the diluted mother plates into the test plates.
b) for IC50 determination (KSS platform), 100 microL of each compound at 1 mM in 100% DMSO are transferred from the original plate into the first column of another 96 well plate (A1 to G1); well H1 is left empty for the internal standard inhibitor, usually staurosporine.
An automated station for serial dilutions (Biomek FX, Beckman) is used for producing 1 :3 dilutions in 100 % DMSO, from line A1 to A10, and for all the seven compounds in the column. Moreover, 4-5 copies of daughter plates are prepared by reformatting 5 microL of this first set of 100% DMSO dilution plates into 384 deep well-plates: one copy of the daughter plates with the serial dilutions of test compounds will be thaw the day of the experiments, reconstituted at a 3X concentration with water and used in the IC50 determination assays. In a standard experiment, the highest concentration (3X) of all compounds is 30 microM, while the lowest one is 1.5 nM.
Each 384 well-plate will contain reference wells (total enzyme activity vs. no enzymatic activity) for the 71 and signal to background evaluation.
//. Assay scheme
384-well plates, V bottom (test plates) are prepared with 5 microL of the compound dilution (3X) and then placed onto a PlateTrak 12 robotized station (Perkin Elmer; the robot has one 384-tips pipetting head for starting the assay plus one 96-tips head for dispensing the resin) together with one reservoir for the Enzyme mix (3X) and one for the ATP mix (3X).
At the start of the run, the robot aspirates 5 microL of ATP mix, makes an air gap inside the tips (2 microL) and aspirates 5 microL of MPS1 mix . The following dispensation into the plates allows the kinase reaction to start upon 3 cycles of mixing, done by the robot itself.
At this point, the correct concentration is restored for all reagents.
The robot incubates the plates for 60 minutes at room temperature, and then stops the reaction by pipetting 70 microL of dowex resin suspension into the reaction mix. Three cycles of mixing are done immediately after the addition of the resin.
The resin suspension is very dense; in order to avoid tip clogging, wide bore tips are used to dispense it.
Another mixing cycle is performed after all the plates are stopped, this time using normal tips: the plates are then allowed to rest for about one hour in order to maximize ATP capture. At this point, 22 microL of the supernatant are transferred into 384-Opti plates (Perkin-Elmer), with 50 microL of Microscint 40 (Perkin-Elmer); after 5 min of orbital shaking the plates are read on a Perkin-Elmer Top Count radioactivity counter.
///. Data analysis
Data are analysed by an internally customized version of the SW package "Assay Explorer" that provides either % inhibition for primary assays or sigmoidal fittings of the ten-dilutions curves for IC50 determination in the secondary assays/hit confirmation routines. In vitro cell proliferation assay
A2780 human ovarian cancer cells, MCF7 human breast cancer cells and MV-4-11 (biphenotypic B myelomonocytic leukemia) cells (1250 cells/well) were seeded in white 384 well-plates in complete medium (RPMI 1640 or EMEM plus 10% Fetal bovine serum) and treated with compounds dissolved in 0.1 % DMSO, 24h after seeding. The cells were incubated at 37°C and 5 % CO2 and after 72 hours the plates were processed using CellTiter-Glo assay (Promega) following the manufacturer's instruction.
CellTiter-Glo is a homogenous method based on the quantification of the ATP present, an indicator of metabolitically active cells. ATP is quantified using a system based on luciferase and D-luciferin resulting into light generation. The luminescent signal is proportional to the number of cells present in culture.
Briefly 25 microL/well of reagent solution were added to each well and, after 5 minutes shacking, microplates were read by Envision (PerkinElmer) luminometer. The luminescent signal was proportional to the number of cells present in culture.
Inhibitory activity was evaluated comparing treated versus control data using Assay Explorer (MDL) program. IC50 was calculated using sigmoidal interpolation curve.
Given the above inhibition assays, the compounds of the formula (I) of the invention resulted to possess a good MPS1 inhibitory activity, tipically with an IC50 in the range between 0.001 and 5 microM.
Moreover, the compounds of the formula (I) of the invention show good cellular proliferation inhibitory activity, tipically with an IC50 in the range of from 0.010 to 5 μΜ in A2780 cells.
Biochemical assay for inhibitors of PIM-1 kinase activity
The inhibitory activity of putative kinase inhibitors and the potency of selected compounds were determined using a trans-phosphorylation assay.
Specific peptide or protein substrates are trans-phosphorylated by their specific ser-thr or tyr kinase in the presence of ATP traced with 33Ρ-γ-ΑΤΡ, and in the presence of their own optimal buffer and cofactors.
At the end of the phosphorylation reaction, more than 98% unlabeled ATP and radioactive ATP is captured by an excess of the ion exchange dowex resin; the resin then settles down to the bottom of the reaction plate by gravity. Supernatant is subsequently withdrawn and transferred into a counting plate, then evaluated by β-counting.
Reagents/assay conditions
Dowex resin preparation
500 g of wet resin (SIGMA, custom prepared resin DOWEX 1x8 200-400 mesh, 2.5 Kg) are weighed out and diluted to 2 L in 150 mM sodium formate, pH 3.00.
The resin is allowed to settle down (some hours) and then the supernatant is discarded.
After three washes as above over a couple of days, the resin is allowed to settle and two volumes (wrt the resin volume) of 150 mM sodium formate buffer are added.
The pH is then measured and should be around 3.00
The washed resin is stable for more than one week; the stock resin is kept at 4° C before use.
Kinase Buffer (KB) The buffer for PIM-1 assay was composed of HEPES 50 mM, at pH 7.5, with 10 mM MgCI2, 1 mM DTT, 3 microM NaV03, and 0.2 mg/ml BSA
Full-length human PIM-1 was expressed and purified as described in Bullock AN, et al., J. Biol. Chem. 2005, 280, 41675-82.
The enzyme showed a linear kinetic after a step of pre-activation by auto-phosphorylation in the following conditions: 1.7 microM PIM1 was incubated 1 hour RT at 28° C in the presence of 125 microM ATP
Assay conditions
ATP concentration: 200 microM
33P-Y-ATP: 6 nM
Enzyme concentration : 1 nM
Substrate concentration Aktide (Chemical Abstract Service Registry Number 324029-01-8) : 25 microM
Robotized dowex assay
The test mix consisted of:
1) 3x Enzyme mix (done in Kinase Buffer 3X), 5 microL/well
2) 3x substrate and ATP mix (done in ddhbO), together with 33Ρ-γ-ΑΤΡ, 5 microL /well
3) 3x test compounds (diluted into ddH20 - 3% DMSO -) 5 micro /well
See below for compound dilution and assay scheme
Dilution of compounds
For IC50 determination, test compounds are received as a 1 mM solution in 100% DMSO and distributed into 96-well plates: compounds are then plated into the first column of a new 96-well plate (A1 to G1), 100 microL/well.
An automated station (Biomek FX, Beckman) is used for serial dilutions, producing 1 :3 dilutions in 100 % DMSO, from line A1 to A10, for all the compounds in the column. Moreover, 4-5 copies of daughter plates are prepared by reformatting 5 microL of this first set of 100% DMSO dilution plates into 384-deep well plates: one copy of these serial dilution plates with the test compounds is thawed on the day of study, reconstituted at the working concentration (3-fold the final concentration) with 162 microL/well of water and used for IC50 determination assays. In a standard experiment, the highest concentration (3X) of compounds is typically 30 microM, while the lowest one is typically 1.5 nM.
Each 384-well plate generates at least one curve of the standard inhibitor staurosporine and reference wells (total enzyme activity vs. no enzymatic activity) for evaluation of 71 and signal to background (S/B) ratio.
Assay scheme
384-well plates, V bottom (test plates) are prepared with 5 microL of compound diluted as previously described (3X) and then placed onto a PlateTrak 12 robotized station (Perkin Elmer; the robot has one 384-tip pipetting head for assay start, plus one 96-tip head for dispensing resin) together with one reservoir for Enzyme mix (3X) and one for ATP mix (3X).
Data are analyzed by an internally customized version of the "Assay Explorer" SW package, which provides sigmoidal fitting of the ten-dilution curves for IC50 determination in secondary assay/hit confirmation routines.
Method for PIM-2 kinase inhibition assay: Dowex technique Kinase Buffer (KB)
The buffer for PIM-2 assay was composed of HEPES 50 mM, at pH 7.5, with 1 mM MgCI2, 1 mM DTT, 3 microM Na3V04, and 0.2 mg/mL BSA
Full-length human PIM-2 was expressed and purified as described in Fedorov O, et al., PNAS 2007 104, 51 , 20523- 28.
Assay conditions (final concentrations)
Enzyme concentration = 1.5 nM
Aktide substrate (Chemical Abstract Service Registry Number 324029-01-8) = 5 microM
ATP = 4 microM
33P-Y-ATP = 1 nM
Robotized Dowex assay
See above: same procedure as described for PIM-1.
The following Table A reports the experimental data of some representative compounds of the invention of formula (I) being tested on the MPS1 , PIM-1 and PIM-2 enzymes in the specific in vitro kinase assays above described (IC50 microM) .
The following Table A also reports the inhibitory activity of some of the closest compounds of the prior art.
Ref. compound 1 , 2, 3 and 4 corresponds rescpectively to compounds coded M3, N9, N4 and N10 in the patent application WO2008/065054 cited above; these compounds correspond respectively to the third, the fifth, the seventh and the sixth disclaimed compounds of the present invention.
Table A
Figure imgf000077_0001
Figure imgf000078_0001

Claims

1. A compound of formula (I):
Figure imgf000079_0001
wherein
R1 is hydrogen, halogen or an optionally substituted group selected from amino, straight or branched C1-C6 alkyl, C3-C7 cycloalkyi, cycloalkyl-alkyl, aryl, arylalkyi, heterocyclyl and heterocyclylalkyi;
R2 is a group selected from -NR"R"', -N(OR"')R" and OR", wherein R" and R'" are, each independently, hydrogen or an optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyi, cycloalkyl-alkyl, aryl, arylalkyi, heterocyclyl and heterocyclylalkyi or, together with the nitrogen atom to which they are bonded, R" and R'" may form a 5 to 6 membered heteroaryl or heterocyclyl group, optionally containing one additional heteroatom selected among N, 0 and S;
R3 is hydrogen or optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyi, cycloalkyl-alkyl, aryl, arylalkyi, heterocyclyl and heterocyclylalkyi;
R4 is hydrogen or an optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyi, cycloalkyl-alkyl, aryl, arylalkyi, heterocyclyl and heterocyclylalkyi;
X is a single bond or a divalent radical selected from -NR'-, -CONR'-, -NH-CO-NH-, -0-, -S-, -S02- and -OSO2-, wherein R' is hydrogen or an optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyi, cycloalkyl-alkyl, aryl, arylalkyi, heterocyclyl and heterocyclylalkyi or, together with the nitrogen atom to which they are bound, R1 and R' may form a 5 to 6 membered heteroaryl or heterocyclyl group optionally containing one additional heteroatom selected from N, 0 and S;
A is a group selected from -CH2-, -(CH2)2-, -(CH2)3-, -CH=CH-, -C(CH3)2-CH2- and -CH2-C(CH3) 2;
or a pharmaceutically acceptable salt thereof,
with the proviso that the following compounds are excluded:
ethyl 2-amino-9-methyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxylate,
2-amino-9-methyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxylic acid,
2-amino-9-methyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamide,
ethyl 2-amino-8-phenyl-9H-pyrrolo[3,2-h]quinazoline-7-carboxylate,
2-amino-8-phenyl-9H-pyrrolo[3,2-h]quinazoline-7-carboxamide,
2-amino-9-methyl-8-phenyl-9H-pyrrolo[3,2-h]quinazoline-7-carboxamide and
2-amino-9-methyl-8-phenyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamide.
2. A compound of formula (I) as defined in claim 1 wherein: X is a group -NR'- and R2 is a group selected from -NHR" and -N(OR"')R", wherein R" is hydrogen or an optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyl, cycloalkyl-alkyl, aryl, arylalkyl, heterocyclyl and heterocyclylalkyl.
3. A compound of formula (I) as defined in claims 1 or 2 wherein:
X is a group -NR'-; R2 is a group -NHR" or -N(OR"')R", wherein R" is hydrogen or an optionally substituted group selected from straight or branched C1-C4 alkyl group and aryl; and R1 is an optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyl, cycloalkyl-alkyl, aryl, arylalkyl, heterocyclyl and heterocyclylalkyl.
4. A compound of formula (I) as defined in claims 1 wherein:
X is a group -0- and R2 is a group selected from -NHR" and -N(OR"')R", wherein R" is hydrogen or an optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyl, cycloalkyl-alkyl, aryl, arylalkyl, heterocyclyl and heterocyclylalkyl.
5. A compound of formula (I) as defined in claims 1 or 4 wherein:
X is a group -0-; R2 is a group -NHR" or -N(OR"')R", wherein R" is hydrogen or an optionally substituted group selected from straight or branched C1-C4 alkyl and aryl; and R1 is an optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyl, cycloalkyl-alkyl, aryl, arylalkyl, heterocyclyl and heterocyclylalkyl.
6. A compound of formula (I) as defined in claim 1 wherein:
X is a group -S- and R2 is a group selected from -NHR" and -N(OR"')R", wherein R" is hydrogen or an optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyl, cycloalkyl-alkyl, aryl, arylalkyl, heterocyclyl and heterocyclylalkyl.
7. A compound of formula (I) as defined in claims 1 or 6 wherein:
X is a group -S-; R2 is a group -NHR" or -N(OR"')R", wherein R" is hydrogen or an optionally substituted group selected from straight or branched C1-C4 alkyl and aryl; and R1 is an optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyl, cycloalkyl-alkyl, aryl, arylalkyl, heterocyclyl and heterocyclylalkyl.
8. A compound of formula (I) as defined in claim 1 wherein:
X is a single bond and R2 is a group selected from -NHR" and -N(OR"')R", wherein R" is hydrogen or an optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyl, cycloalkyl-alkyl, aryl, arylalkyl, heterocyclyl and heterocyclylalkyl.
9. A compound of formula (I) as defined in claims 1 or 8 wherein:
X is a single bond; R2 is a group -NHR" or -N(OR"')R", wherein R" is hydrogen or an optionally substituted group selected from straight or branched C1-C4 alkyl and aryl; and R1 is an optionally substituted group selected from straight or branched C1-C6 alkyl, C3-C7 cycloalkyl, cycloalkyl-alkyl, aryl, arylalkyl, heterocyclyl and heterocyclylalkyl.
10. A compound of formula (I) or a pharmaceutically acceptable salt thereof as defined in claim 1 which is selected from the group consisting of:
N-(2,6-diethylphenyl)-9-(methoxymethyl)-2-{[2-methoxy-4-(4-methylpiperazin-1 -yl)phenyl]amino}-8-methyl-6,9- dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamide,
2-[(4-bromo-2-methoxyphenyl)amino]-N-(2,6-diethylphenyl)-8,9-dimethyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7- carboxamide, N-(2,6-diethylphenyl)-2-({2-methoxy-4-[4-(pyrrolidin-1-yl)piperidin-1-yl]phenyl}amino)
pyrrolo[3,2-h]quinazoline-7-carboxamide,
N-(2,6-diethylphenyl)-2-({4-[4-(dimethylamino)piperidin-1-yl]-2-methoxyphen
pyrrolo[3,2-h]quinazoline-7-carboxamide,
N-(2,6-diethylphenyl)-2-{[2-methoxy-4-(4-methylpiperazin-1-yl)phenyl]amino}-8,9-d
pyrrolo[3,2-h]quinazoline-7-carboxamide,
N-(2,6-diethylphenyl)-2-({4-[4-(2-hydroxyethyl)piperazin-1-yl]-2-methoxyphenyl}amino)-8,9-di
pyrrolo[3,2-h]quinazoline-7-carboxamide,
2-{[2-methoxy-4-(4-methylpiperazin-1-yl)phenyl]amino}-8)9-dimethyl-6,9-dihydro-5H-pyrrolo[3,2-h
carboxamide,
2-[(4-bromo-2-methoxyphenyl)amino]-N-(2,6-diethylphenyl)-9-methyl-6,9-dihydro-5H-pyrr^
carboxamide,
N-(2,6-diethylphenyl)-2 [2-methoxy-4-(4-methylpiperazin-1-yl)phenyl]amino
h]quinazoline-7-carboxamide,
N-(2,6-diethylphenyl)-2-({4-[4-(dimethylamino)piperidin-1-yl]-2-meth
pyrrolo[3,2-h]quinazoline-7-carboxamide,
N-(2,6-diethylphenyl)-2-({2-methoxy-4-[4-(pyrrolidin-1-yl)piperidin-1-yl]phenyl}am
pyrrolo[3,2-h]quinazoline-7-carboxamide,
N-(2,6-diethylphenyl)-2-[(4-{[3-(dimethylamino)propyl](methyl)amino}-2-m
5H-pyrrolo[3,2-h]quinazoline-7-carboxamide,
N-(2,6-diethylphenyl)-2-({4-[4-(2-hydroxyethyl)piperazin-1-yl]-2-methoxyphenyl}am
pyrrolo[3,2-h]quinazoline-7-carboxamide,
2-[(4-bromo-2-methoxyphenyl)amino]-N-[(1 S)-2-(1 ,3-dioxo-1 ,3-dihydro-2H-isoindol-2-yl)-1-phenylethyl]-9-methyl-6,9- dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamide,
2-[(4-bromo-2-methoxyphenyl)amino]-N-(2,6-diethylphenyl)-10-methyl-5,6J,10- tetrahydropyrrolo[3 2':6J]cyclohepta[1 ,2-d]pyrimidine-8-carboxamide,
N-(2,6-diethylphenyl)-2-{[2-methoxy-4-(4^
tetrahydropyrrolo[3 2':6J]cyclohepta[1,2-d]pyrimidine-8-carboxamide,
N-(2,6-diethylphenyl)-2-({4-[4-(dimethylamino)piperidin-1-yl]-2-meth
tetrahydropyrrolo[3 2':6J]cyclohepta[1,2-d]pyrimidine-8-carboxamide,
N-(2,6-diethylphenyl)-2-({2-methoxy -[4-(pyrrolidin-1-yl)piperidin-1-yl]phen
tetrahydropyrrolo[3 2':6J]cyclohepta[1 ,2-d]pyrimidine-8-carboxamide,
8-methyl-2-(methylsulfanyl)-9-(propan-2-yl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazolin
8-methyl-2-(methylsulfanyl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamide)
2-(methylsulfanyl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamide,
2-(methylsulfanyl)-9-(propan-2-yl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamide)
2-(dimethylamino)-8-methyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamide) 9-(2-hydroxyethyl)-8-methyl-2-(methylsulfanyl)-6,9-dihydro-5H-pyrrolo[3,2-h
9-(2-hydroxyethyl)-2-(methylsulfanyl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxami
2-(dimethylamino)-8-methyl-9H-pyrrolo[3,2-h]quinazoline-7-carboxamide,
9-methyl-2-(methylsulfanyl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxamide)
8- methyl-2-(methylsulfanyl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxamide)
9- (2-hydroxyethyl)-8-methyl-2-(methylsulfanyl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxamide,
8- methyl-2-(methylsulfanyl)-9-(propan-2-yl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxamide,
9- ethyl-2-(methylsulfanyl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxamide,
2-(methylsulfanyl)-9-(piperidin-4-yl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamid
9-(cis 4-aminocyclohexyl)-2-(methylsulfanyl)-6,9-dihydro-5H-pyrrolo[3,2-h]quinazolin
9-(cis-4-aminocyclohexyl)-2-(methylsulfanyl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxamide,
2-(methylsulfanyl)-9-(piperidin-4-yl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxamide,
2-(methylsulfanyl)-9H-pyrrolo[3,2-h]quinazoline-7-carboxamide,
2-methyl-6,9-dihydro-5H-pyrrolo[3,2-h]quinazoline-7-carboxamide,
9-(3-amino-2,2-dimethylpropyl)-2-(methylsulfanyl)-9H-pyrrolo[3,2-/5]quinazolin hydrochloride and
9-(azepan-3-yl)-2-(methylsulfanyl)-9/-/-pyrrolo[3,2-/5]quinazoline-7-carboxamide hydrochloride.
11. A process for preparing a compound of formula (I) as defined in claim 1 or a pharmaceutically acceptable salt thereof wherein the process comprises the following steps:
st.A) reacting a compound of formula (II)
o
R5.
O A .A, ( \ \\
CHO
wherein A is as defined in claim 1 except -CH=CH- and R5 is an optionally substituted C1-C6 alkyl with a compound of formula (III)
Figure imgf000082_0001
wherein R2 is an optionally substituted alkoxy;
st.B) reacting the resultant compound of the formula (IV):
Figure imgf000082_0002
wherein R2 is an optionally substituted alkoxy, R5 is an optionally substituted C1-C6 alkyl and A is as defined in claim 1 except -CH=CH- , with toluenesulfonylmethyl isocyanide in presence of a strong base;
st.C) hydrolyzing selectively in acidic or basic condition the resultant compound of formula (V)
Figure imgf000083_0001
wherein R3 and R4 are hydrogen, A is as defined in claim 1 except -CH=CH-, R2 is an optionally substituted alkoxy and R5 is an optionally substituted C1-C6 alkyl so to obtain a compound of formula (VI)
Figure imgf000083_0002
wherein R3 and R4 are hydrogen, A is as defined in claim 1 except -CH=CH-, and R2 is an optionally substituted alkoxy;
alternatively,
st.Ca) a compound of formula (VI) wherein R3 is hydrogen, R4 is as defined in claim 1 except hydrogen, A is as defined in claim 1 except -CH=CH-, and R2 is an optionally substituted alkoxy, can be obtained reacting a compound of formula (VII)
o
N^A^I-0H (VI I)
o
wherein A is as defined in claim 1 except -CH=CH- with a compound of formula (VIII)
R4^AR2 (VIII)
wherein R2 is an optionally substituted alkoxy and R4 is as defined in claim 1 except hydrogen;
st.D) cyclizing the resultant compound of formula (VI) wherein R2 is an optionally substituted alkoxy, R3 is hydrogen, R4 is as defined in claim 1 , and A is as defined in claim 1 except -CH=CH-, in acidic condition so as to obtain a compound of formula (IX)
Figure imgf000083_0003
wherein R2 is an optionally substituted alkoxy, R3 is hydrogen, R4 is as defined in claim 1 , and A is as defined in claim 1 except -CH=CH-;
if needed or desired,
st.E) alkylating, a compound of formula (IX) wherein R3 is hydrogen, with a compound of the formula (X):
R3-L (X)
wherein L is a suitable leaving group such as mesyl, tosyl, halogen atom, and R3 is as defined in claim 1 except hydrogen;
st.F) reacting the resultant compound of formula (IX)
Figure imgf000084_0001
wherein R2 is an optionally substituted alkoxy, R3 and R4 are as defined in claim 1 , and A is as defined in claim 1 except -CH=CH-, with an Ν,Ν-dimethylformamide derivative;
st.G) reacting the resultant compound of formula (XI)
Figure imgf000084_0002
wherein R2 is an optionally substituted alkoxy, R3 and R4 are as defined in claim 1 , and A is as defined in claim 1 except -CH=CH-, with a compound of formula (XII)
Figure imgf000084_0003
wherein X is a single bond or a divalent radical selected from -NR', -0- and -S-; and R1 and R' are as defined in claim 1 , so as to obtain a compound of formula (I)
Figure imgf000084_0004
wherein X is a single bond or a divalent radical selected from -NR', -0- and -S-; R2 is an optionally substituted alkoxy; A is as defined in claim 1 except -CH=CH-; and R1, R3, R4 and R' are as defined in claim 1 ; optionally converting a compound of the formula (I) into another different compound of the formula (I), and, if desired, converting a compound of the formula (I) into a pharmaceutically acceptable salt thereof or converting a salt into the free compound (I).
12. A method for treating a disease caused by and/or associated with a dysregulated protein kinase activity which comprises administering to a mammal in need thereof an effective amount of a compound of formula (I) as defined in claim 1.
13. The method according to claim 12 for treating a disease caused by and/or associated with a dysregulated MPS1 , PIM -1 , PIM-2, PIM-3 kinase activity.
14. The method according to claim 12 wherein the disease is selected from the group consisting of cancer, cell proliferative disorders, viral infections, autoimmune and neurodegenerative disorders.
15. The method according to claim 14 wherein the cancer is selected from the group consisting of carcinoma such as bladder, breast, colon, kidney, liver, lung, including small cell lung cancer, esophagus, gall-bladder, ovary, pancreas, stomach, cervix, thyroid, prostate, and skin, including squamous cell carcinoma; hematopoietic tumors of lymphoid lineage including leukaemia, acute lymphocitic leukaemia, acute lymphoblastic leukaemia, B-cell lymphoma, T-cell- lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, hairy cell lymphoma and Burkett's lymphoma; hematopoietic tumors of myeloid lineage, including acute and chronic myelogenous leukemias, myelodysplastic syndrome and promyelocytic leukaemia; tumors of mesenchymal origin, including fibrosarcoma and rhabdomyosarcoma; tumors of the central and peripheral nervous system, including astrocytoma neuroblastoma, glioma and schwannomas; other tumors, including melanoma, seminoma, teratocarcinoma, osteosarcoma, xeroderma pigmentosum, keratoxanthoma, thyroid follicular cancer and Kaposi's sarcoma and mesothelioma, highly aneuploid tumors and tumors wich do overexpress mitotic checkpoint.
16. The method according to claim 14 wherein the cell proliferative disorder is selected from the group consisting of benign prostate hyperplasia, familial adenomatosis polyposis, neurofibromatosis, psoriasis, vascular smooth cell proliferation associated with atherosclerosis, pulmonary fibrosis, arthritis, glomerulonephritis and post-surgical stenosis and restenosis.
17. The method according to claim 14 wherein the autoimmune and neurodegenerative disorders are selected from multiple sclerosis, systemic lupus erythematosis, inflammatory bowel diseases(IBD), Crohn's disease, irritable bowel syndrome, pancreatitis, ulcerative colitis, diverticulosis, myasthenia gravis, vasculitis, psoriasis, scleroderma, asthma, allergy, systemic sclerosis, vitiligo, arthritis such as osteoarthritis, juvenile rheumatoid arthritis, ankylosing spondylitis.
18. The method according to claim 12 further comprising subjecting the mammal in need thereof to a radiation therapy or chemotherapy regimen in combination with at least one cytostatic or cytotoxic agent.
19. The method according to claim 12 wherein the mammal in need thereof is a human.
20. An in vitro method for inhibiting kinase protein activity which comprises contacting the said protein with an effective amount of a compound of formula (I) as defined in claim 1.
21. The method according to claim 12 which provides tumor angiogenesis and metastasis inhibition.
22. A pharmaceutical composition comprising one or more compounds of the formula (I) or a pharmaceutically acceptable salt thereof, as defined in claim 1 , and at least one pharmaceutically acceptable excipient, carrier and/or diluent.
23. A pharmaceutical composition according to claim 22 further comprising one or more chemotherapeutic agents.
24. A product or kit comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof, as defined in claim 1 , or pharmaceutical compositions thereof as defined in claim 22 and one or more chemotherapeutic agents, as a combined preparation for simultaneous, separate or sequential use in anticancer therapy.
25. A compound of formula (I) or a pharmaceutically acceptable salt thereof, as defined in claim 1 , for use as a medicament.
26. A compound of formula (I) or a pharmaceutically acceptable salt thereof, as defined in claim 1 , for use in a method of treating cancer.
27. Use of a compound of formula (I) or a pharmaceutically acceptable salt thereof, as defined in claim 1 , in the manufacture of a medicament with anticancer activity.
PCT/EP2012/050773 2011-01-26 2012-01-19 Tricyclic pyrrolo derivatives, process for their preparation and their use as kinase inhibitors WO2012101032A1 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
CN201280006541.4A CN103339134B (en) 2011-01-26 2012-01-19 Tricyclic azole derivative, their preparation method and they are as the application of kinase inhibitor
BR112013018515-5A BR112013018515B1 (en) 2011-01-26 2012-01-19 TRICYCLICAL PYRROL DERIVATIVES, PROCESS FOR THEIR PREPARATION AND USE AS KINASE INHIBITORS
US13/980,168 US8975267B2 (en) 2011-01-26 2012-01-19 Tricyclic pyrrolo derivatives, process for their preparation and their use as kinase inhibitors
JP2013550833A JP5925809B2 (en) 2011-01-26 2012-01-19 Tricyclic pyrrolo derivatives, their preparation and their use as kinase inhibitors
RU2013139353/04A RU2591191C2 (en) 2011-01-26 2012-01-19 Tricyclic pyrrole derivatives, method for production thereof and use thereof as kinase inhibitors
ES12702207.7T ES2602791T3 (en) 2011-01-26 2012-01-19 Tricyclic pyrrolo derivatives, process for its preparation and its use as kinase inhibitors
EP12702207.7A EP2668190B1 (en) 2011-01-26 2012-01-19 Tricyclic pyrrolo derivatives, process for their preparation and their use as kinase inhibitors
HK14102303.2A HK1189229A1 (en) 2011-01-26 2014-03-07 Tricyclic pyrrolo derivatives, process for their preparation and their use as kinase inhibitors
US14/609,534 US9309253B2 (en) 2011-01-26 2015-01-30 Tricyclic pyrrolo derivatives, process for their preparation and their use as kinase inhibitors

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP11152190 2011-01-26
EP11152190.2 2011-01-26

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US13/980,168 A-371-Of-International US8975267B2 (en) 2011-01-26 2012-01-19 Tricyclic pyrrolo derivatives, process for their preparation and their use as kinase inhibitors
US14/609,534 Division US9309253B2 (en) 2011-01-26 2015-01-30 Tricyclic pyrrolo derivatives, process for their preparation and their use as kinase inhibitors

Publications (1)

Publication Number Publication Date
WO2012101032A1 true WO2012101032A1 (en) 2012-08-02

Family

ID=45562287

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2012/050773 WO2012101032A1 (en) 2011-01-26 2012-01-19 Tricyclic pyrrolo derivatives, process for their preparation and their use as kinase inhibitors

Country Status (9)

Country Link
US (2) US8975267B2 (en)
EP (1) EP2668190B1 (en)
JP (2) JP5925809B2 (en)
CN (1) CN103339134B (en)
BR (1) BR112013018515B1 (en)
ES (1) ES2602791T3 (en)
HK (1) HK1189229A1 (en)
RU (1) RU2591191C2 (en)
WO (1) WO2012101032A1 (en)

Cited By (46)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014037751A1 (en) * 2012-09-07 2014-03-13 Cancer Research Technology Limited Pharmacologically active compounds
WO2014037750A1 (en) * 2012-09-07 2014-03-13 Cancer Research Technology Limited Inhibitor compounds
WO2015128676A1 (en) * 2014-02-28 2015-09-03 Cancer Research Technology Limited N2-phenyl-pyrido[3,4-d]pyrimidine-2,8-diamine derivatives and their use as mps1 inhibitors
WO2015155042A1 (en) * 2014-04-07 2015-10-15 Netherlands Translational Research Center B.V. (5,6-dihydro)pyrimido[4,5-e]indolizines
US9200004B2 (en) 2013-01-15 2015-12-01 Incyte Holdings Corporation Thiazolecarboxamides and pyridinecarboxamide compounds useful as Pim kinase inhibitors
US9278950B2 (en) 2013-01-14 2016-03-08 Incyte Corporation Bicyclic aromatic carboxamide compounds useful as Pim kinase inhibitors
WO2016185348A1 (en) * 2015-05-15 2016-11-24 Universita' Degli Studi Di Palermo 4,5,6,9-tetrahydropyrrolo[2',3':3,4]cyclohepta[1,2-d] isoxazole, process for their production and their uses as antitumor agents
US9540347B2 (en) 2015-05-29 2017-01-10 Incyte Corporation Pyridineamine compounds useful as Pim kinase inhibitors
WO2017011776A1 (en) 2015-07-16 2017-01-19 Array Biopharma, Inc. Substituted pyrazolo[1,5-a]pyridine compounds as ret kinase inhibitors
US9556197B2 (en) 2013-08-23 2017-01-31 Incyte Corporation Furo- and thieno-pyridine carboxamide compounds useful as pim kinase inhibitors
US9580418B2 (en) 2014-07-14 2017-02-28 Incyte Corporation Bicyclic aromatic carboxamide compounds useful as Pim kinase inhibitors
WO2017176751A1 (en) 2016-04-04 2017-10-12 Loxo Oncology, Inc. Liquid formulations of (s)-n-(5-((r)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide
WO2017176744A1 (en) 2016-04-04 2017-10-12 Loxo Oncology, Inc. Methods of treating pediatric cancers
US9822124B2 (en) 2014-07-14 2017-11-21 Incyte Corporation Bicyclic heteroaromatic carboxamide compounds useful as Pim kinase inhibitors
US9862705B2 (en) 2015-09-09 2018-01-09 Incyte Corporation Salts of a pim kinase inhibitor
US9920032B2 (en) 2015-10-02 2018-03-20 Incyte Corporation Heterocyclic compounds useful as pim kinase inhibitors
WO2018071447A1 (en) 2016-10-10 2018-04-19 Andrews Steven W Substituted pyrazolo[1,5-a]pyridine compounds as ret kinase inhibitors
WO2018071454A1 (en) 2016-10-10 2018-04-19 Andrews Steven W Substituted pyrazolo[1,5-a]pyridine compounds as ret kinase inhibitors
WO2018136663A1 (en) 2017-01-18 2018-07-26 Array Biopharma, Inc. Ret inhibitors
WO2018136661A1 (en) 2017-01-18 2018-07-26 Andrews Steven W SUBSTITUTED PYRAZOLO[1,5-a]PYRAZINE COMPOUNDS AS RET KINASE INHIBITORS
US10045991B2 (en) 2016-04-04 2018-08-14 Loxo Oncology, Inc. Methods of treating pediatric cancers
WO2018170381A1 (en) 2017-03-16 2018-09-20 Andrews Steven W Macrocyclic compounds as ros1 kinase inhibitors
WO2018177403A1 (en) * 2017-04-01 2018-10-04 成都优赛丽医药科技有限公司 1h-imidazo[4,5-h]quinazoline compound as protein kinase inhibitor
US10251889B2 (en) 2009-07-09 2019-04-09 Array BioPharm Inc. Substituted pyrazolo[1,5-a]pyrimidine compounds as Trk kinase inhibitors
WO2019075108A1 (en) 2017-10-10 2019-04-18 Metcalf Andrew T Crystalline forms
WO2019075114A1 (en) 2017-10-10 2019-04-18 Mark Reynolds Formulations comprising 6-(2-hydroxy-2-methylpropoxy)-4-(6-(6-((6-methoxypyridin-3-yl)methyl)-3,6-diazab icyclo[3.1.1]heptan-3-yl)pyridin-3-yl)pyrazolo[1,5-a]pyridine-3-carbonitrile
WO2019143994A1 (en) 2018-01-18 2019-07-25 Array Biopharma Inc. Substituted pyrazolyl[4,3-c]pyridinecompounds as ret kinase inhibitors
WO2019143977A1 (en) 2018-01-18 2019-07-25 Array Biopharma Inc. Substituted pyrrolo[2,3-d]pyrimidines compounds as ret kinase inhibitors
WO2020028258A1 (en) 2018-07-31 2020-02-06 Loxo Oncology, Inc. Spray-dried dispersions and formulations of (s)-5-amino-3-(4-((5-fluoro-2-methoxybenzamido)methyl)phenyl)-1-(1,1,1-trifluoro propan-2-yl)-1h-pyrazole-4-carboxamide
WO2020055672A1 (en) 2018-09-10 2020-03-19 Array Biopharma Inc. Fused heterocyclic compounds as ret kinase inhibitors
US10596161B2 (en) 2017-12-08 2020-03-24 Incyte Corporation Low dose combination therapy for treatment of myeloproliferative neoplasms
WO2020131674A1 (en) 2018-12-19 2020-06-25 Array Biopharma Inc. 7-((3,5-dimethoxyphenyl)amino)quinoxaline derivatives as fgfr inhibitors for treating cancer
WO2020131627A1 (en) 2018-12-19 2020-06-25 Array Biopharma Inc. Substituted pyrazolo[1,5-a]pyridine compounds as inhibitors of fgfr tyrosine kinases
US10724102B2 (en) 2015-10-26 2020-07-28 Loxo Oncology, Inc. Point mutations in TRK inhibitor-resistant cancer and methods relating to the same
WO2021113492A1 (en) 2019-12-06 2021-06-10 Schrödinger, Inc. Cyclic compounds and methods of using same
WO2021134004A1 (en) 2019-12-27 2021-07-01 Schrodinger, Inc. Cyclic compounds and methods of using same
US11091486B2 (en) 2016-10-26 2021-08-17 Array Biopharma, Inc Process for the preparation of pyrazolo[1,5-a]pyrimidines and salts thereof
US11207321B2 (en) 2017-06-20 2021-12-28 The Institute Of Cancer Research: Royal Cancer Hospital Methods and medical uses
US11208696B2 (en) 2015-04-17 2021-12-28 Netherlands Translational Research Center B.V. Prognostic biomarkers for TTK inhibitor chemotherapy
US11214571B2 (en) 2016-05-18 2022-01-04 Array Biopharma Inc. Process for the preparation of (S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide and salts thereof
WO2022055963A1 (en) 2020-09-10 2022-03-17 Schrödinger, Inc. Heterocyclic pericondensed cdc7 kinase inhibitors for the treatment of cancer
WO2022164789A1 (en) 2021-01-26 2022-08-04 Schrödinger, Inc. Tricyclic compounds useful in the treatment of cancer, autoimmune and inflammatory disoders
WO2022197898A1 (en) 2021-03-18 2022-09-22 Schrödinger, Inc. Cyclic compounds and methods of using same
US11524963B2 (en) 2018-01-18 2022-12-13 Array Biopharma Inc. Substituted pyrazolo[3,4-d]pyrimidines as RET kinase inhibitors
WO2023113478A1 (en) * 2021-12-15 2023-06-22 Sillajen, Inc. Methods of treating neoplastic diseases
WO2023113479A1 (en) * 2021-12-15 2023-06-22 Sillajen, Inc. Pharmaceutical compositions comprising modified beta-cyclodextrins

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2614065B1 (en) * 2010-12-17 2017-04-19 Nerviano Medical Sciences S.r.l. Substituted pyrazolo-quinazoline derivatives as kinase inhibitors
ES2602791T3 (en) 2011-01-26 2017-02-22 Nerviano Medical Sciences S.R.L. Tricyclic pyrrolo derivatives, process for its preparation and its use as kinase inhibitors
CN106659765B (en) 2014-04-04 2021-08-13 德玛医药 Use of dianhydrogalactitol and analogs or derivatives thereof for treating non-small cell lung cancer and ovarian cancer
CN105130980B (en) * 2015-09-09 2018-05-22 沈阳药科大学 N-3- benzimidazole thiazole amines derivatives and preparation method and application
EP3992196B1 (en) * 2019-08-02 2023-12-13 Chengdu Cynogen Bio-Pharmaceutical Technology Co., Ltd. 1h-[1, 2, 3]triazolo[4, 5-h] quinazoline compounds acting as protein kinase inhibitors
CN114685520B (en) * 2020-12-25 2024-08-30 武汉誉祥医药科技有限公司 Tri-fused ring compound and pharmaceutical composition and application thereof

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5750769A (en) 1994-11-25 1998-05-12 Zeneca Limited Halogenated esters useful as intermediates for insecticides
WO2005037843A1 (en) 2003-10-14 2005-04-28 Vertex Pharmaceuticals Incorporated Compositions useful as inhibitors of protein kinases
WO2008065054A1 (en) 2006-11-28 2008-06-05 Nerviano Medical Sciences S.R.L. Tricyclic indoles and (4,5-dihydro) indoles
WO2009089305A1 (en) 2008-01-07 2009-07-16 Synta Pharmaceuticals Corp. Compounds for inflammation and immune-related uses
WO2009156315A1 (en) 2008-06-26 2009-12-30 Nerviano Medical Sciences S.R.L. Pyrazolo-quinazolines
US20100160318A1 (en) 2006-12-04 2010-06-24 Jiangsu Simcere Pharmaceutical R&D Co., Ltd. 3-Pyrrolo[b]Cyclohexylene-2-Dihydroindolinone Derivatives and Uses Thereof

Family Cites Families (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
MY125533A (en) * 1999-12-06 2006-08-30 Bristol Myers Squibb Co Heterocyclic dihydropyrimidine compounds
EP1476431A1 (en) * 2002-02-19 2004-11-17 Pharmacia Corporation Tricyclic pyrazole derivatives for the treatment of inflammation
GEP20094664B (en) * 2003-05-22 2009-04-10 Nerviano Medical Sciences Srl Pyrazolo-quinazoline derivatives, process for their preparation and their use as kinase inhibitors
EP2125822B1 (en) * 2006-12-21 2014-11-19 Nerviano Medical Sciences S.R.L. Substituted pyrazolo-quinazoline derivatives, process for their preparation and their use as kinase inhibitors
BRPI0814426A2 (en) * 2007-07-16 2015-01-06 Novartis Ag Heterocyclic Compounds Useful as MK2 Inhibitors
US8546410B2 (en) * 2008-05-05 2013-10-01 Abbvie Inc. Heteroaryl-fused macrocyclic pyrimidine derivatives
ES2622559T3 (en) * 2008-07-29 2017-07-06 Nerviano Medical Sciences S.R.L. Therapeutic combination comprising a cdk inhibitor and an antineoplastic agent
CN102105151B (en) * 2008-07-29 2013-12-18 内尔维阿诺医学科学有限公司 Use of CDK inhibitor for treatment of glioma
CN102223885B (en) * 2008-11-24 2013-04-03 内尔维阿诺医学科学有限公司 Cdk inhibitor for the treatment of mesothelioma
US8580793B2 (en) * 2009-03-20 2013-11-12 Nerviano Medical Services S.R.L. Use of kinase inhibitor for the treatment of thymoma
CN102428086B (en) * 2009-04-29 2014-08-20 内尔维阿诺医学科学有限公司 Cdk inhibitor salts
AR076784A1 (en) * 2009-05-26 2011-07-06 Nerviano Medical Sciences Srl THERAPEUTIC COMBINATION UNDERSTANDING A PLK1 INHIBITOR AND AN ANTINEOPLASTIC AGENT
CN103626777B (en) * 2009-07-29 2015-10-21 内尔维阿诺医学科学有限公司 The salt of PLK inhibitor
WO2012013557A1 (en) * 2010-07-30 2012-02-02 Nerviano Medical Sciences S.R.L. Isoxazolo-quinazolines as modulators of protein kinase activity
EP2614065B1 (en) * 2010-12-17 2017-04-19 Nerviano Medical Sciences S.r.l. Substituted pyrazolo-quinazoline derivatives as kinase inhibitors
ES2602791T3 (en) 2011-01-26 2017-02-22 Nerviano Medical Sciences S.R.L. Tricyclic pyrrolo derivatives, process for its preparation and its use as kinase inhibitors

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5750769A (en) 1994-11-25 1998-05-12 Zeneca Limited Halogenated esters useful as intermediates for insecticides
WO2005037843A1 (en) 2003-10-14 2005-04-28 Vertex Pharmaceuticals Incorporated Compositions useful as inhibitors of protein kinases
WO2008065054A1 (en) 2006-11-28 2008-06-05 Nerviano Medical Sciences S.R.L. Tricyclic indoles and (4,5-dihydro) indoles
US20100160318A1 (en) 2006-12-04 2010-06-24 Jiangsu Simcere Pharmaceutical R&D Co., Ltd. 3-Pyrrolo[b]Cyclohexylene-2-Dihydroindolinone Derivatives and Uses Thereof
WO2009089305A1 (en) 2008-01-07 2009-07-16 Synta Pharmaceuticals Corp. Compounds for inflammation and immune-related uses
WO2009156315A1 (en) 2008-06-26 2009-12-30 Nerviano Medical Sciences S.R.L. Pyrazolo-quinazolines

Non-Patent Citations (34)

* Cited by examiner, † Cited by third party
Title
AMARAVADI R. ET AL., J. CLIN. INVEST., vol. 115, no. 10, 2005, pages 2618 - 24
BERTHEAU P. ET AL., PLOS MED, vol. 4, no. 3, 2007, pages E90
BRAULT ET AL., HAEMATOLOGICA, vol. 95, 2010, pages 1004 - 1015
BRAULT L. ET AL., HAEMATOLOGICA, vol. 95, no. 6, 2010, pages 1004 - 1015
BULLOCK AN ET AL., J. BIOL. CHEM., vol. 280, 2005, pages 41675 - 82
CARCINOGENESIS, vol. 29, 2008, pages 1087 - 1091
CARTER SL ET AL., NAT GENET., vol. 38, no. 9, 2006, pages 1043
CHOUDHARY ET AL., MOL CELL., vol. 36, 2009, pages 326 - 39
COHEN ET AL., LEUK. LYMPHOMA, vol. 94, 2004, pages 51
CURRENT OPINION IN CHEMICAL BIOLOGY, vol. 3, 1999, pages 459 - 465
DECARCER G. ET AL., CURR MED CHEM, vol. 14, no. 9, 2007, pages 969
EUROPEAN JOURNAL OF ORGANIC CHEMISTRY, vol. 23, 2008, pages 3917
FEDOROV 0 ET AL., PNAS, vol. 104, no. 51, 2007, pages 20523 - 28
HUTTMANN ET AL., LEUKEMIA, vol. 20, 2006, pages 1774
J. ORG. CHEM., vol. 29, 1964, pages 801
J. ORG. CHEM., vol. 63, no. 5, 1998, pages 1668
JELLUMA N. ET AL., CELL, vol. 132, 2008, pages 233
JELLUMA N. ET AL., PLOS ONE, vol. 3, no. 6, 2008, pages E2415
JELLUMA, N. ET AL., CELL, vol. 132, 2008, pages 233
JONES, M.H. ET AL., CURR. BIOL., vol. 15, 2005, pages 160
KIM ET AL., BLOOD, vol. 105, 2005, pages 1759 - 67
KOPS G. J. ET AL., NAT. REV CANCER, vol. 5, 2005, pages 773
KUMAR ET AL., J. MOL. BIOL., vol. 348, 2005, pages 183 - 193
M. COLOMBO; F. RICCARDI-SIRTORI; V. RIZZO, RAPID COMMUN. MASS SPECTROM., vol. 18, 2004, pages 511 - 517
MUSACCHIO A.; SALMON D., NAT REV MOL CELL BIOL, vol. 8, no. 5, May 2007 (2007-05-01), pages 379 - 93
SCHMIDT ET AL., EMBO REP, vol. 6, no. 9, 2005, pages 866
SHAH ET AL., EUR. J. CANCER, vol. 44, 2008, pages 2144 - 51
STUCKE VM ET AL., EMBO J., vol. 21, no. 7, 2002, pages 1723
TAMBURINI J. ET AL., BLOOD, vol. 114, no. 8, 2009, pages 1718 - 27
TIGHE A. ET AL., J CELL BIOL, 2008
WEAVER ET AL., CANCER CELL, vol. 11, no. 1, 2007, pages 25
WEISS; WINEY, J. CELL. BIOL, vol. 132, 1996, pages 111
WINEY M. ET AL., J. CELL BIOL, vol. 114, 1991, pages 745
YUAN B. ET AL., CLIN CANCER RES, vol. 12, no. 4, 2006, pages 1121

Cited By (123)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10251889B2 (en) 2009-07-09 2019-04-09 Array BioPharm Inc. Substituted pyrazolo[1,5-a]pyrimidine compounds as Trk kinase inhibitors
US10758542B2 (en) 2009-07-09 2020-09-01 Array Biopharma Inc. Substituted pyrazolo[l,5-a]pyrimidine compounds as Trk kinase inhibitors
US9409907B2 (en) 2012-09-07 2016-08-09 Cancer Research Technology Limited Inhibitor compounds
EP3293183A1 (en) * 2012-09-07 2018-03-14 Cancer Research Technology Ltd. Inhibitor compounds
US10188642B2 (en) 2012-09-07 2019-01-29 Cancer Research Technology Limited Pharmacologically active compounds
WO2014037751A1 (en) * 2012-09-07 2014-03-13 Cancer Research Technology Limited Pharmacologically active compounds
US9834552B2 (en) 2012-09-07 2017-12-05 Cancer Research Technology Limited Inhibitor compounds
US9334286B2 (en) 2012-09-07 2016-05-10 Cancer Research Technology Limited Pharmacologically active compounds
US11897877B2 (en) 2012-09-07 2024-02-13 Cancer Research Technology Limited Inhibitor compounds
US10479788B2 (en) 2012-09-07 2019-11-19 Cancer Research Technology Limited Compounds that inhibit MPS1 kinase
WO2014037750A1 (en) * 2012-09-07 2014-03-13 Cancer Research Technology Limited Inhibitor compounds
US11046688B2 (en) 2012-09-07 2021-06-29 Cancer Research Technology Limited Inhibitor compounds
CN104837829A (en) * 2012-09-07 2015-08-12 癌症研究科技有限公司 Inhibitor compounds
US9895364B2 (en) 2012-09-07 2018-02-20 Cancer Research Technology Limited Pharmacologically active compounds
US9890157B2 (en) 2012-09-07 2018-02-13 Cancer Research Technology Limited Inhibitor compounds
US9676750B2 (en) 2013-01-14 2017-06-13 Incyte Corporation Bicyclic aromatic carboxamide compounds useful as pim kinase inhibitors
US9278950B2 (en) 2013-01-14 2016-03-08 Incyte Corporation Bicyclic aromatic carboxamide compounds useful as Pim kinase inhibitors
US10517858B2 (en) 2013-01-15 2019-12-31 Incyte Holdings Corporation Thiazolecarboxamides and pyridinecarboxamide compounds useful as PIM kinase inhibitors
US9849120B2 (en) 2013-01-15 2017-12-26 Incyte Holdings Corporation Thiazolecarboxamides and pyridinecarboxamide compounds useful as Pim kinase inhibitors
US9200004B2 (en) 2013-01-15 2015-12-01 Incyte Holdings Corporation Thiazolecarboxamides and pyridinecarboxamide compounds useful as Pim kinase inhibitors
US10265307B2 (en) 2013-01-15 2019-04-23 Incyte Corporation Thiazolecarboxamides and pyridinecarboxamide compounds useful as Pim kinase inhibitors
US10828290B2 (en) 2013-01-15 2020-11-10 Incyte Corporation Thiazolecarboxamides and pyridinecarboxamide compounds useful as pim kinase inhibitors
US11229631B2 (en) 2013-01-15 2022-01-25 Incyte Corporation Thiazolecarboxamides and pyridinecarboxamide compounds useful as Pim kinase inhibitors
US9550765B2 (en) 2013-01-15 2017-01-24 Incyte Holdings Corporation Thiazolecarboxamides and pyridinecarboxamide compounds useful as Pim kinase inhibitors
US10000507B2 (en) 2013-08-23 2018-06-19 Incyte Corporation Furo- and thieno-pyridine carboxamide compounds useful as pim kinase inhibitors
US9556197B2 (en) 2013-08-23 2017-01-31 Incyte Corporation Furo- and thieno-pyridine carboxamide compounds useful as pim kinase inhibitors
CN106459035B (en) * 2014-02-28 2018-04-06 癌症研究科技有限公司 N2 the phenylpyridines simultaneously diamine derivative of [3,4 D] pyrimidine 2,8 and its purposes as MPS1 inhibitor
WO2015128676A1 (en) * 2014-02-28 2015-09-03 Cancer Research Technology Limited N2-phenyl-pyrido[3,4-d]pyrimidine-2,8-diamine derivatives and their use as mps1 inhibitors
RU2693460C2 (en) * 2014-02-28 2019-07-03 Кэнсэр Ресерч Текнолоджи Лимитед N2-(2-phenyl)-pyrido[3,4-d]pyrimidine-2,8-diamine derivatives and use thereof as mps1 inhibitor
CN106459035A (en) * 2014-02-28 2017-02-22 癌症研究科技有限公司 N2-phenyl-pyrido[3,4-d]pyrimidine-2,8-diamine derivatives and their use as mps1 inhibitors
US9902721B2 (en) 2014-02-28 2018-02-27 Cancer Research Technology Limited N2-phenyl-pyrido[3,4-d]pyrimidine-2, 8-diamine derivatives and their use as Mps1 inhibitors
US10399974B2 (en) 2014-02-28 2019-09-03 Cancer Research Technology Limited N2-phenyl-pyrido[3,4-D]pyrimidine-2, 8-diamine derivatives and their use as Mps1 inhibitors
EP3575299A1 (en) * 2014-02-28 2019-12-04 Cancer Research Technology Limited N2-phenyl-pyrido[3,4-d]pyrimidine-2,8-diamine derivatives and their use as mps1 inhibitors
KR102432420B1 (en) 2014-04-07 2022-08-17 네덜런즈 트랜슬레이셔널 리서치 센터 비.브이. (5,6-dihydro)pyrimido[4,5-e]indolizines
KR20170013866A (en) * 2014-04-07 2017-02-07 네덜런즈 트랜슬레이셔널 리서치 센터 비.브이. (5,6-dihydro)pyrimido[4,5-e]indolizines
CN106132963B (en) * 2014-04-07 2019-08-06 荷兰转化研究中心有限责任公司 (5,6- dihydro) pyrimido [4,5-e] indolizine
AU2015243694B2 (en) * 2014-04-07 2019-01-17 Netherlands Translational Research Center B.V. (5,6-dihydro)pyrimido(4,5-e)indolizines
RU2692479C2 (en) * 2014-04-07 2019-06-25 Недерлэндс Транслэшинал Рисерч Сентер Б.В. (5,6-dihydro)pyrimido[4,5-e]indolysines
CN106132963A (en) * 2014-04-07 2016-11-16 荷兰转化研究中心有限责任公司 (5,6 dihydro) pyrimido [4,5 e] indolizine
USRE48974E1 (en) 2014-04-07 2022-03-15 Netherlands Translational Research Center B.V. (5,6-dihydro)pyrimido[4,5-E]indolizines
USRE50082E1 (en) 2014-04-07 2024-08-20 Netherlands Translational Research Center B.V. (5,6-dihydro)pyrimido[4,5-e]indolizines
WO2015155042A1 (en) * 2014-04-07 2015-10-15 Netherlands Translational Research Center B.V. (5,6-dihydro)pyrimido[4,5-e]indolizines
US9856258B2 (en) 2014-04-07 2018-01-02 Netherlands Translational Research Center B.V. (5,6-dihydro)pyrimido[4,5-E]indolizines
US9580418B2 (en) 2014-07-14 2017-02-28 Incyte Corporation Bicyclic aromatic carboxamide compounds useful as Pim kinase inhibitors
US9822124B2 (en) 2014-07-14 2017-11-21 Incyte Corporation Bicyclic heteroaromatic carboxamide compounds useful as Pim kinase inhibitors
US9890162B2 (en) 2014-07-14 2018-02-13 Incyte Corporation Bicyclic aromatic carboxamide compounds useful as pim kinase inhibitors
US12054784B2 (en) 2015-04-17 2024-08-06 Netherlands Translational Research Center B.V. Prognostic biomarkers for TTK inhibitor chemotherapy
US11208696B2 (en) 2015-04-17 2021-12-28 Netherlands Translational Research Center B.V. Prognostic biomarkers for TTK inhibitor chemotherapy
WO2016185348A1 (en) * 2015-05-15 2016-11-24 Universita' Degli Studi Di Palermo 4,5,6,9-tetrahydropyrrolo[2',3':3,4]cyclohepta[1,2-d] isoxazole, process for their production and their uses as antitumor agents
US9540347B2 (en) 2015-05-29 2017-01-10 Incyte Corporation Pyridineamine compounds useful as Pim kinase inhibitors
US9802918B2 (en) 2015-05-29 2017-10-31 Incyte Corporation Pyridineamine compounds useful as Pim kinase inhibitors
US10174028B2 (en) 2015-07-16 2019-01-08 Array Biopharma Inc. Substituted pyrazolo[1,5-A]pyridine compounds as RET kinase inhibitors
US10174027B2 (en) 2015-07-16 2019-01-08 Array Biopharma Inc. Substituted pyrazolo[1,5-a]pyridine compounds as RET kinase inhibitors
WO2017011776A1 (en) 2015-07-16 2017-01-19 Array Biopharma, Inc. Substituted pyrazolo[1,5-a]pyridine compounds as ret kinase inhibitors
US10138243B2 (en) 2015-07-16 2018-11-27 Array Biopharma Inc. Substituted pyrazolo[1,5-a]pyridine compounds as RET kinase inhibitors
US10023570B2 (en) 2015-07-16 2018-07-17 Array Biopharma Inc. Substituted pyrazolo[1,5-A]pyridine compounds as RET kinase inhibitors
US10336728B2 (en) 2015-09-09 2019-07-02 Incyte Corporation Salts of a Pim kinase inhibitor
US11505540B2 (en) 2015-09-09 2022-11-22 Incyte Corporation Salts of a Pim kinase inhibitor
US11066387B2 (en) 2015-09-09 2021-07-20 Incyte Corporation Salts of a Pim kinase inhibitor
US9862705B2 (en) 2015-09-09 2018-01-09 Incyte Corporation Salts of a pim kinase inhibitor
US12043614B2 (en) 2015-09-09 2024-07-23 Incyte Corporation Salts of a Pim kinase inhibitor
US10450296B2 (en) 2015-10-02 2019-10-22 Incyte Corporation Heterocyclic compounds useful as Pim kinase inhibitors
US11053215B2 (en) 2015-10-02 2021-07-06 Incyte Corporation Heterocyclic compounds useful as Pim kinase inhibitors
US9920032B2 (en) 2015-10-02 2018-03-20 Incyte Corporation Heterocyclic compounds useful as pim kinase inhibitors
US10907215B2 (en) 2015-10-26 2021-02-02 Loxo Oncology, Inc. Point mutations in TRK inhibitor-resistant cancer and methods relating to the same
US10724102B2 (en) 2015-10-26 2020-07-28 Loxo Oncology, Inc. Point mutations in TRK inhibitor-resistant cancer and methods relating to the same
WO2017176751A1 (en) 2016-04-04 2017-10-12 Loxo Oncology, Inc. Liquid formulations of (s)-n-(5-((r)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide
US10045991B2 (en) 2016-04-04 2018-08-14 Loxo Oncology, Inc. Methods of treating pediatric cancers
US10137127B2 (en) 2016-04-04 2018-11-27 Loxo Oncology, Inc. Liquid formulations of (S)-N-(5-((R)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-A]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide
WO2017176744A1 (en) 2016-04-04 2017-10-12 Loxo Oncology, Inc. Methods of treating pediatric cancers
US11191766B2 (en) 2016-04-04 2021-12-07 Loxo Oncology, Inc. Methods of treating pediatric cancers
US10588908B2 (en) 2016-04-04 2020-03-17 Loxo Oncology, Inc. Methods of treating pediatric cancers
US10668072B2 (en) 2016-04-04 2020-06-02 Loxo Oncology, Inc. Liquid formulations of (S)-N-(5-((R)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide
US11484535B2 (en) 2016-04-04 2022-11-01 Loxo Oncology, Inc. Liquid formulations of (S)-N-(5-((R)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-a] pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide
US11214571B2 (en) 2016-05-18 2022-01-04 Array Biopharma Inc. Process for the preparation of (S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide and salts thereof
WO2018071447A1 (en) 2016-10-10 2018-04-19 Andrews Steven W Substituted pyrazolo[1,5-a]pyridine compounds as ret kinase inhibitors
US10881652B2 (en) 2016-10-10 2021-01-05 Array Biopharma Inc. Substituted pyrazolo[1,5-A]pyridine compounds as RET kinase inhibitors
WO2018071454A1 (en) 2016-10-10 2018-04-19 Andrews Steven W Substituted pyrazolo[1,5-a]pyridine compounds as ret kinase inhibitors
US10555944B2 (en) 2016-10-10 2020-02-11 Eli Lilly And Company Substituted pyrazolo[1,5-A]pyridine compounds as RET kinase inhibitors
US10172851B2 (en) 2016-10-10 2019-01-08 Array Biopharma Inc. Substituted pyrazolo[1,5-A]pyridine compounds as RET kinase inhibitors
US10112942B2 (en) 2016-10-10 2018-10-30 Array Biopharma Inc. Substituted pyrazolo[1,5-A]pyridine compounds as RET kinase inhibitors
US10137124B2 (en) 2016-10-10 2018-11-27 Array Biopharma Inc. Substituted pyrazolo[1,5-a]pyridine compounds as RET kinase inhibitors
US10441581B2 (en) 2016-10-10 2019-10-15 Array Biopharma Inc. Substituted pyrazolo[1,5-A]pyridine compounds as RET kinase inhibitors
EP3753939A1 (en) 2016-10-10 2020-12-23 Array Biopharma Inc. Substituted pyrazolo[1,5-a]pyridine compounds as ret kinase inhibitors
US11998545B2 (en) 2016-10-10 2024-06-04 Array Biopharma Inc. Substituted pyrazolo[1,5-a]pyridine compounds as RET kinase inhibitors
US10144734B2 (en) 2016-10-10 2018-12-04 Array Biopharma Inc. Substituted pyrazolo[1,5-A]pyridine compounds as RET kinase inhibitors
US10953005B1 (en) 2016-10-10 2021-03-23 Array Biopharma Inc. Substituted pyrazolo[1,5-a]pyridine compounds as RET kinase inhibitors
US10172845B2 (en) 2016-10-10 2019-01-08 Array Biopharma Inc. Substituted pyrazolo[1,5-A]pyridine compounds as RET kinase inhibitors
US11648243B2 (en) 2016-10-10 2023-05-16 Array Biopharma Inc. Substituted pyrazolo[1,5-A]pyridine compounds as RET kinase inhibitors
EP4144735A1 (en) 2016-10-10 2023-03-08 Array Biopharma, Inc. Substituted pyrazolo[1,5-a]pyridine compounds as ret kinase inhibitors
US11091486B2 (en) 2016-10-26 2021-08-17 Array Biopharma, Inc Process for the preparation of pyrazolo[1,5-a]pyrimidines and salts thereof
WO2018136661A1 (en) 2017-01-18 2018-07-26 Andrews Steven W SUBSTITUTED PYRAZOLO[1,5-a]PYRAZINE COMPOUNDS AS RET KINASE INHIBITORS
WO2018136663A1 (en) 2017-01-18 2018-07-26 Array Biopharma, Inc. Ret inhibitors
US11851434B2 (en) 2017-01-18 2023-12-26 Array Biopharma Inc. Substituted pyrazolo[1,5-A]pyrazine compounds as ret kinase inhibitors
US11168090B2 (en) 2017-01-18 2021-11-09 Array Biopharma Inc. Substituted pyrazolo[1,5-a]pyrazines as RET kinase inhibitors
WO2018170381A1 (en) 2017-03-16 2018-09-20 Andrews Steven W Macrocyclic compounds as ros1 kinase inhibitors
US10966985B2 (en) 2017-03-16 2021-04-06 Array Biopharma Inc. Macrocyclic compounds as ROS1 kinase inhibitors
US10688100B2 (en) 2017-03-16 2020-06-23 Array Biopharma Inc. Macrocylic compounds as ROS1 kinase inhibitors
JP2020513034A (en) * 2017-04-01 2020-04-30 晟科薬業（江蘇）有限公司Ｓｈｅｎｇｋｅ Ｐｈａｒｍａｃｅｕｔｉｃａｌｓ （Ｊｉａｎｇｓｕ） Ｌｔｄ． 1H-imidazo [4,5-H] quinazoline compounds as protein kinase inhibitors
JP7175026B2 (en) 2017-04-01 2022-11-18 晟科薬業（江蘇）有限公司 1H-imidazo[4,5-H]quinazoline compounds as protein kinase inhibitors
WO2018177403A1 (en) * 2017-04-01 2018-10-04 成都优赛丽医药科技有限公司 1h-imidazo[4,5-h]quinazoline compound as protein kinase inhibitor
US11207321B2 (en) 2017-06-20 2021-12-28 The Institute Of Cancer Research: Royal Cancer Hospital Methods and medical uses
WO2019075114A1 (en) 2017-10-10 2019-04-18 Mark Reynolds Formulations comprising 6-(2-hydroxy-2-methylpropoxy)-4-(6-(6-((6-methoxypyridin-3-yl)methyl)-3,6-diazab icyclo[3.1.1]heptan-3-yl)pyridin-3-yl)pyrazolo[1,5-a]pyridine-3-carbonitrile
WO2019075108A1 (en) 2017-10-10 2019-04-18 Metcalf Andrew T Crystalline forms
US10596161B2 (en) 2017-12-08 2020-03-24 Incyte Corporation Low dose combination therapy for treatment of myeloproliferative neoplasms
US11278541B2 (en) 2017-12-08 2022-03-22 Incyte Corporation Low dose combination therapy for treatment of myeloproliferative neoplasms
US11472802B2 (en) 2018-01-18 2022-10-18 Array Biopharma Inc. Substituted pyrazolyl[4,3-c]pyridine compounds as RET kinase inhibitors
WO2019143994A1 (en) 2018-01-18 2019-07-25 Array Biopharma Inc. Substituted pyrazolyl[4,3-c]pyridinecompounds as ret kinase inhibitors
WO2019143977A1 (en) 2018-01-18 2019-07-25 Array Biopharma Inc. Substituted pyrrolo[2,3-d]pyrimidines compounds as ret kinase inhibitors
US11524963B2 (en) 2018-01-18 2022-12-13 Array Biopharma Inc. Substituted pyrazolo[3,4-d]pyrimidines as RET kinase inhibitors
US11603374B2 (en) 2018-01-18 2023-03-14 Array Biopharma Inc. Substituted pyrrolo[2,3-d]pyrimidines compounds as ret kinase inhibitors
WO2020028258A1 (en) 2018-07-31 2020-02-06 Loxo Oncology, Inc. Spray-dried dispersions and formulations of (s)-5-amino-3-(4-((5-fluoro-2-methoxybenzamido)methyl)phenyl)-1-(1,1,1-trifluoro propan-2-yl)-1h-pyrazole-4-carboxamide
WO2020055672A1 (en) 2018-09-10 2020-03-19 Array Biopharma Inc. Fused heterocyclic compounds as ret kinase inhibitors
US11964988B2 (en) 2018-09-10 2024-04-23 Array Biopharma Inc. Fused heterocyclic compounds as RET kinase inhibitors
WO2020131674A1 (en) 2018-12-19 2020-06-25 Array Biopharma Inc. 7-((3,5-dimethoxyphenyl)amino)quinoxaline derivatives as fgfr inhibitors for treating cancer
WO2020131627A1 (en) 2018-12-19 2020-06-25 Array Biopharma Inc. Substituted pyrazolo[1,5-a]pyridine compounds as inhibitors of fgfr tyrosine kinases
WO2021113492A1 (en) 2019-12-06 2021-06-10 Schrödinger, Inc. Cyclic compounds and methods of using same
WO2021134004A1 (en) 2019-12-27 2021-07-01 Schrodinger, Inc. Cyclic compounds and methods of using same
WO2022055963A1 (en) 2020-09-10 2022-03-17 Schrödinger, Inc. Heterocyclic pericondensed cdc7 kinase inhibitors for the treatment of cancer
WO2022164789A1 (en) 2021-01-26 2022-08-04 Schrödinger, Inc. Tricyclic compounds useful in the treatment of cancer, autoimmune and inflammatory disoders
WO2022197898A1 (en) 2021-03-18 2022-09-22 Schrödinger, Inc. Cyclic compounds and methods of using same
WO2023113479A1 (en) * 2021-12-15 2023-06-22 Sillajen, Inc. Pharmaceutical compositions comprising modified beta-cyclodextrins
WO2023113478A1 (en) * 2021-12-15 2023-06-22 Sillajen, Inc. Methods of treating neoplastic diseases

Also Published As

Publication number Publication date
CN103339134B (en) 2015-12-23
JP2016053042A (en) 2016-04-14
US20150141408A1 (en) 2015-05-21
RU2591191C2 (en) 2016-07-10
US8975267B2 (en) 2015-03-10
JP2014503567A (en) 2014-02-13
CN103339134A (en) 2013-10-02
RU2013139353A (en) 2015-03-10
HK1189229A1 (en) 2014-05-30
US9309253B2 (en) 2016-04-12
EP2668190A1 (en) 2013-12-04
JP5925809B2 (en) 2016-05-25
ES2602791T3 (en) 2017-02-22
EP2668190B1 (en) 2016-08-17
BR112013018515B1 (en) 2021-06-29
BR112013018515A2 (en) 2016-10-18
US20130296305A1 (en) 2013-11-07
JP6118383B2 (en) 2017-04-19

Similar Documents

Publication Publication Date Title
EP2668190B1 (en) Tricyclic pyrrolo derivatives, process for their preparation and their use as kinase inhibitors
EP2668188B1 (en) Tricyclic derivatives, process for their preparation and their use as kinase inhibitors
US9284298B2 (en) Pyrazolyl-pyrimidine derivatives as kinase inhibitors
US9333205B2 (en) Isoxazolo-quinazolines as modulators of protein kinase activity
EP2788351B1 (en) SUBSTITUTED 3,4-DIHYDROPYRROLO[1,2-a]PYRAZIN-1(2H)-ONE DERIVATIVES AS KINASE INHIBITORS
AU2009264431B2 (en) Pyrazolo-quinazolines
EP2614065B1 (en) Substituted pyrazolo-quinazoline derivatives as kinase inhibitors
EP3668504A1 (en) Macrocyclic mcl-1 inhibitors and methods of use
CA3073112A1 (en) Macrocyclic mcl-1 inhibitors and methods of use

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12702207

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 13980168

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2013550833

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REEP Request for entry into the european phase

Ref document number: 2012702207

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2012702207

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2013139353

Country of ref document: RU

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112013018515

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112013018515

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20130719