WO2012098517A1 - Plants having enhanced yield-related traits and method for making the same - Google Patents

Plants having enhanced yield-related traits and method for making the same Download PDF

Info

Publication number
WO2012098517A1
WO2012098517A1 PCT/IB2012/050259 IB2012050259W WO2012098517A1 WO 2012098517 A1 WO2012098517 A1 WO 2012098517A1 IB 2012050259 W IB2012050259 W IB 2012050259W WO 2012098517 A1 WO2012098517 A1 WO 2012098517A1
Authority
WO
WIPO (PCT)
Prior art keywords
plant
nucleic acid
polypeptide
seq
plants
Prior art date
Application number
PCT/IB2012/050259
Other languages
French (fr)
Inventor
Christophe Reuzeau
Valerie Frankard
Cécile VRIET
Original Assignee
Basf Plant Science Company Gmbh
Basf (China) Company Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Basf Plant Science Company Gmbh, Basf (China) Company Limited filed Critical Basf Plant Science Company Gmbh
Priority to CN2012800141583A priority Critical patent/CN103429745A/en
Priority to US13/980,740 priority patent/US20130298289A1/en
Priority to CA2823287A priority patent/CA2823287A1/en
Priority to DE112012000525T priority patent/DE112012000525T5/en
Priority to BR112013018545A priority patent/BR112013018545A2/en
Priority to AU2012208257A priority patent/AU2012208257A1/en
Priority to MX2013008086A priority patent/MX2013008086A/en
Priority to EP12736407.3A priority patent/EP2665819A4/en
Publication of WO2012098517A1 publication Critical patent/WO2012098517A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants

Definitions

  • the present invention relates generally to the field of molecular biology and concerns a method for enhancing yield-related traits in plants by modulating expression in a plant of a nucleic acid encoding a CYP704-like (Cytochrome P450 family 704) polypeptide.
  • the present invention also concerns plants having modulated expression of a nucleic acid encoding a CYP704-like polypeptide, which plants have enhanced yield-related traits relative to corresponding wild type plants or other control plants.
  • the invention also provides constructs useful in the methods of the invention.
  • the present invention also relates generally to the field of molecular biology and concerns a method for enhancing various economically important yield-related traits in plants. More specifically, the present invention concerns a method for enhancing yield-related traits in plants by mod ulating expression i n a plant of a nucleic acid encod ing a D U F1218 polypeptide. The present invention also concerns plants having modulated expression of a nucleic acid encoding a DUF1218 polypeptide, which plants have enhanced yield-related traits relative to control plants. The invention also provides hitherto unknown DUF1218- encoding nucleic acids, and constructs comprising the same, useful in performing the methods of the invention.
  • the present invention also relates generally to the field of molecular biology and concerns a method for enhancing yield-related traits in plants by modulating expression in a plant of a nucleic acid encoding a translin-like polypeptide.
  • the present invention also concerns plants having modulated expression of a nucleic acid encoding a translin-like polypeptide, which plants have enhanced yield-related traits relative to corresponding wild type plants or other control plants.
  • the invention also provides constructs useful in the methods of the invention.
  • the present invention also relates generally to the field of molecular biology and concerns a method for enhancing yield-related traits in plants by modulating expression in a plant of a nucleic acid encoding an ERG28-like polypeptide.
  • the present invention also concerns plants having modulated expression of a nucleic acid encoding an ERG28-like polypeptide, which plants have enhanced yield-related traits relative to corresponding wild type plants or other control plants.
  • the invention also provides constructs useful in the methods of the invention.
  • Yield is normally defined as the measurable produce of economic value from a crop. This may be defined in terms of quantity and/or quality. Yield is directly dependent on several factors, for example, the number and size of the organs, plant architecture (for example, the number of branches), seed production, leaf senescence and more. Root development, nutrient uptake, stress tolerance and early vigour may also be important factors in determining yield. Optimizing the abovementioned factors may therefore contribute to increasing crop yield.
  • Seed yield is a particularly important trait, since the seeds of many plants are important for human and animal nutrition.
  • Crops such as corn, rice, wheat, canola and soybean account for over half the total human caloric intake, whether through direct consumption of the seeds themselves or through consumption of meat products raised on processed seeds. They are also a source of sugars, oils and many kinds of metabolites used in industrial processes. Seeds contain an embryo (the source of new shoots and roots) and an endosperm (the source of nutrients for embryo growth during germination and during early growth of seedlings).
  • the development of a seed involves many genes, and requires the transfer of metabolites from the roots, leaves and stems into the growing seed.
  • the endosperm in particular, assimilates the metabolic precursors of carbohydrates, oils and proteins and synthesizes them into storage macromolecules to fill out the grain.
  • a fu rther important trait is that of improved abiotic stress tolerance.
  • Abiotic stress is a primary cause of crop loss worldwide, reducing average yields for most major crop plants by more than 50% (Wang et al., Planta 218, 1 -14, 2003).
  • Abiotic stresses may be caused by drought, salinity, extremes of temperature, chemical toxicity and oxidative stress.
  • the ability to improve plant tolerance to abiotic stress would be of great economic advantage to farmers worldwide and would allow for the cultivation of crops during adverse conditions and in territories where cultivation of crops may not otherwise be possible. Crop yield may therefore be increased by optimising one of the above-mentioned factors.
  • Cytochrome P450s are heme-thiolate proteins involved in many basic metabolic pathways ranging from synthesis and degradation of endogenous steroid hormones, vitamins and fatty acid derivatives ('endobiotics') to the metabolism of foreign compounds such as drugs, environmental chemicals, and carcinogens ('xenobiotics'). In plants they are involved in plant hormone synthesis, phytoalexin synthesis, flower petal pigment biosynthesis, and herbicide degradation. P450s usually work as monooxygenases by activating molecular oxygen with inserting one of its atoms into the substrate and reducing the other to form water:
  • Plant P450s are generally classified into two main clades: A-type and non-A type.
  • the A- type clade is specific to plants, some P450s involved in the biosynthesis of secondary metabolites or natural products are found in this group.
  • the non-A type clade is a much more divergent group of sequences consisting of several individual clades, which often show more similarity to non-plant P450s than to the other plant P450s. It is now generally accepted that the A-type P450s originate from a single common ancestral gene.
  • the CYP704A proteins form a small gene family (2 members in Arabidopsis, 3 in rice), and are are postulated to be involved in fatty acid hydroxylation, cutin formation, drought stress tolerance.
  • CYP704B1 is a long-chain fatty acid ⁇ -Hydroxylase essential for sporopollenin synthesis in pollen of Arabidopsis thaliana.
  • CYP704B2 catalyzes the v-hydroxylation of fatty acids (C16 and C18) and is required for anther cutin biosynthesis and pollen exine formation in rice.
  • translin is a member of the Translin Superfamily. Translin interacts with DNA and forms a ring around DNA, see e.g. Aoki et al., FEBS Lett. 1997 Jan 20; 401 (2-3):109-1 12.
  • Translin Superfamily is Translin- associated factor X (TRAX), which was found to interact with translin in yeast two-hybrid screen.
  • sterols also appear to be involved in resistance of the plants to pathogens.
  • exogenous application of ergosterol the main sterol of most fungi, promotes the expression of a number of defence genes and leads to enhanced tolerance toward fungal pathogen in plants (Laquitaine et al , Molecular Plant-Microbe Interactions 19: 1 03-11 12, 2006; Lochman et al, Plant Molecular Biology 62: 43-51 , 2006).
  • experimental data suggest that alterations in sterol composition in plants may lead to modified nutritional qualities of plants.
  • ERG28 is a key protein in the yeast sterol biosynthetic enzyme complex. ERG28 was found to be highly co-regulated with other ergosterol biosynthesis enzymes (Mo et al, Proceedings of the National Academy of Sciences of the United States of America 99: 9739-9744 2002). This endoplasmic reticulum transmembrane-located protein was also shown to interact with many of the ergosterol biosynthetic enzymes in yeast (Saccharomyces cerevisiae). ScERG28 seems to function has a scaffold to tether these enzymes as a large complex (Mo et al, 2002; Mo et al.
  • an increase in the vegetative parts of a plant may be desirable, and for applications such as flour, starch or oil production, an increase in seed parameters may be particularly desirable. Even amongst the seed parameters, some may be favoured over others, depending on the application.
  • Various mechanisms may contribute to increasing seed yield, whether that is in the form of increased seed size or increased seed number.
  • ERG28-like polypeptides it has now been found that various yield-related traits may be improved in plants or yeasts by modulating expression in a plant of a nucleic acid encoding an ERG28-like polypeptide.
  • modulated expression of ERG28-like proteins results in improved yeast growth and/or reproduction, compared to wild type yeast.
  • the present invention shows that modulating expression in a plant of a nucleic acid encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, gives plants having enhanced yield-related traits relative to control plants.
  • the present invention shows that modu lating expression in a plant of a nucleic acid encoding an ERG28-like polypeptide gives plants having altered steroid composition and/or enhanced yield-related traits relative to control plants. It was also found that modulated expression of a nucleic acid encoding an ERG28- like polypeptide in yeast results in improved yeast growth and/or reproduction.
  • the present invention provides a method for enhancing yield-related traits in plants relative to control plants, comprising modulating expression in a plant of a nucleic acid encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, and optionally selecting for plants having enhanced yield-related traits.
  • the present invention provides a method for producing plants having enhanced yield-related traits relative to control plants, wherein said method comprises the steps of modulating expression in said plant of a nucleic acid encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, as described herein and optionally selecting for plants having enhanced yield- related traits.
  • the present invention provides a method for regu lati ng steroid synthesis in plants, comprising modulating expression in a plant of a nucleic acid encoding an ERG28-like polypeptide and optionally selecting for plants having altered steroid composition.
  • the present invention provides a method for enhancing yield-related traits in plants relative to control plants, comprising modulating expression in a plant of a nucleic acid encoding an ERG28-like polypeptide and optionally selecting for plants having enhanced yield-related traits.
  • the present invention provides a method for producing plants having altered steroid composition and/or for enhancing yield-related traits relative to control plants, wherein said method comprises the steps of modulating expression in said plant of a nucleic acid encoding an ERG28-like polypeptide as described herein and optionally selecting for plants having altered steroid composition and/or enhanced yield-related traits.
  • the present invention provides a method for improving yeast growth and/or reproduction, such as for example increasing the volume of yeast cells, increasing the growth rate or improving the mating capacity.
  • a preferred method for modulating (increasing or decreasing) expression of a nucleic acid encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide is by introducing and expressing in a plant a nucleic acid encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin- like polypeptide, or an ERG28-like polypeptide.
  • any reference hereinafter to a "protein useful in the methods of the invention” is taken to mean a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide, as defined herein.
  • Any reference hereinafter to a "nucleic acid useful in the methods of the invention” is taken to mean a nucleic acid capable of encoding such a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide.
  • the nucleic acid to be introduced into a plant is any nucleic acid encoding the type of protein which will now be described, hereafter also named "CYP704- like nucleic acid”, or “DUF1218 nucleic acid”, or “translin-like nucleic acid”, or “ERG28-like nucleic acid”, or “CYP704-like gene", o r "DUF1218 gene”, or “translin-like gene”, or "ERG28-like gene”.
  • a "CYP704-like polypeptide” as defined herein refers to any polypeptide comprising a P450 domain (Pfam PF00067) and the MGRMXXXWGXXXXXXPERW signature sequence (SEQ ID NO: 72), wherein X can be any amino acid.
  • the CYP704-like polypeptide comprises one or more of the following motifs:
  • Motif 2 (SEQ ID NO: 74): D[VTI]LP[DN]G[HYFT][KNRS]V[KVS][KA]G[DG][MG][VI][TNAY]Y[QMV][PIA]Y[AS]MGRM[E
  • x can be any amino acid.
  • the CYP704-like polypeptide comprises one or more of the following motifs:
  • x can be any amino acid, preferably x is one of K, T, N, R, H, Q;
  • CYP704-like or "CYP704-like polypeptide” as used herein also intends to include homologues as defined hereunder of "CYP704-like polypeptide”.
  • Motifs 1 to 6 were derived using the MEME algorithm (Bailey and Elkan, Proceedings of the Second International Conference on Intelligent Systems for Molecular Biology, pp. 28-36, AAA I Press, Menlo Park, California, 1994). At each position within a M EME motif, the residues are shown that are present in the query set of sequences with a frequency higher than 0.2. Residues within square brackets represent alternatives.
  • the CYP704-like polypeptide comprises in increasing order of preference, at least one, at least 2, at least 3, at least 4, at least 5, or all 6 motifs. Additionally or alternatively, the CYP704-like polypeptide comprises one, two or all three of motifs 7, 8 and 9.
  • the homologue of a CYP704-like protein has in increasing order of preference at least 20%, 21 %, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31 %, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41 %, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%
  • the overall sequence identity is determined using a global alignment algorithm, such as the Needleman Wunsch algorithm in the program GAP (GCG Wisconsin Package, Accelrys), preferably with default parameters and preferably with sequences of mature proteins (i.e. without taking into account secretion signals or transit peptides).
  • GAP GCG Wisconsin Package, Accelrys
  • the sequence identity level is determined by comparison of the polypeptide sequences over the entire length of the sequence of SEQ ID NO: 2 or SEQ I D NO: 4. Compared to overall sequence identity, the sequence identity will generally be higher when only conserved domains or motifs are considered.
  • the motifs in a CYP704-like polypeptide have, in increasing order of preference, at least 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90% , 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one or more of the motifs represented by SEQ ID NO: 73 to SEQ ID NO: 78 (Motifs 1 to 6), SEQ ID NO: 79 to SEQ ID NO: 81 (Motif 7 to 9)
  • a method wherein said CYP704-like polypeptide comprises a conserved domain (or motif) with at least 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 % , 92% , 93%, 94%, 95% , 96% , 97%, 98%, or 99% sequence identity to the conserved domain starting with amino acid Q51 up to amino acid F501 in SEQ ID NO: 2 or with amino acid V94 up to amino acid L517 in SEQ ID NO: 4.
  • DUF1218 proteins are plant proteins. Family members contain a number of conserved cysteine residues.
  • a "DUF1218 polypeptide" as defined herein refers to any polypeptide comprising a DUF1218 domain.
  • said DU F1218 domain comprises or consists of an amino acid sequence having at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96% , 97%, 98%, or 99% overall sequence identity to the amino acid represented by SEQ ID NO: 179, and for instance consists of the amino acid sequence as represented by SEQ ID NO: 179.
  • said DUF1218 domain consists of an amino acid sequence having at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% overall sequence identity to a conserved domain from amino acid 60 to 152 in SEQ ID NO: 88.
  • said DUF1218 polypeptide comprises at least one signal peptide.
  • said DUF1218 polypeptide comprises at least one transmembrane domain, and for instance at least two or at least three transmembrane domains.
  • said DUF1218 polypeptide comprises one or more of the following motifs:
  • said DUF1218 polypeptide further comprises one or more of the following motifs:
  • Motif 13 CCKRHPVPSDTNWSVALISFIVSW[VAC]TFIIAFLLLLTGAALNDQRG[E Q] ENMY (SEQ ID NO: 183),
  • DPF1218 or "DUF1218 polypeptide” as used herein also intends to include homologues as defined hereunder of such "DUF1218 polypeptide”.
  • Motifs 10 to 15 were derived using the MEME algorithm (Bailey and Elkan, Proceedings of the Second International Conference on Intelligent Systems for Molecular Biology, pp. 28- 36, AAA I Press, Menlo Park, California, 1994). At each position within a MEME motif, the residues are shown that are present in the query set of sequences with a frequency higher than 0.2. Residues within square brackets represent alternatives.
  • the DUF1218 polypeptide comprises in increasing order of preference, at least 2, at least 3, at least 4, at least 5, or all 6 motifs.
  • the homologue of a DUF1218 protein has in increasing order of preference at least 25%, 26%, 27%, 28%, 29%, 30%, 31 %, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41 %, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% overall sequence
  • the overall sequence identity is determined using a global alignment algorithm, such as the Needleman Wunsch algorithm in the program GAP (GCG Wisconsin Package, Accelrys), preferably with default parameters and preferably with sequences of mature proteins (i.e. without taking into account secretion signals or transit peptides). Compared to overall sequence identity, the sequence identity will generally be higher when only conserved domains or motifs are considered .
  • the motifs in a DUF1218 polypeptide have, in increasing order of preference, at least 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one or more of the motifs represented by SEQ ID NO: 180 to SEQ ID NO: 185 (Motifs 10 to 15).
  • translin-like polypeptide refers to any polypeptide comprising the signature sequence GTDFWKLRR (S EQ I D NO: 245) .
  • the transl in-like polypeptde comprises an InterPro accession IPR002848 corresponding to PFAM accession number PF01997 translin domain.
  • the translin domain is present starting with amino acid 72 up to amino acid 272.
  • translin-like or translin-like polypeptide as used herein also intends to include homologues as defined hereunder of "translin-like polypeptide".
  • the translin-like polypeptide comprises one or more of the following motifs:
  • the translin-like polypeptide comprises in increasing order of preference, at least 2, or all 3 motifs.
  • the homologue of a translin-like protein has in increasing order of preference at least 25%, 26%, 27%, 28%, 29%, 30%, 31 %, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41 %, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%,
  • the overall sequence identity is determined using a global alignment algorithm, such as the Needleman Wunsch algorithm in the program GAP (GCG Wisconsin Package, Accelrys), preferably with default parameters and preferably with sequences of mature proteins (i.e. without taking into account secretion signals or transit peptides).
  • GAP GAP
  • sequence identity level is determined by comparison of the polypeptide sequences of the entire length of the sequence of SEQ ID NO: 191 .
  • the sequence identity will generally be higher when only conserved domains or motifs are considered.
  • the motifs in a translin-like polypeptide have, in increasing order of preference, at least 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one or more of the motifs represented by SEQ ID NO: 238 to SEQ ID NO: 240 (Motifs 16 to 18).
  • translin-like polypeptide comprises a conserved domain or motif, with at least 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to one or more of conserved domain(s) starting with amino acid 1 14 up to amino acid 163, amino acid 55 up to amino acid 104 and/or amino acid 222 up to amino acid 271 in SEQ ID NO: 191.
  • ERG28-like polypeptide refers to any polypeptide comprising a Pfam PF03694 domai n (E RG28-like protein, InterPro IPR005352). Typically ERG28-like polypeptide proteins comprise 4 transmembrane domains. Preferably the ERG28-like polypeptide also comprises the signature sequence WTLL[TS]CTL (SEQ ID NO: 296).
  • the ERG28-like polypeptide comprises one or more of the following motifs:
  • CTLC[FY]LCA[FL]NL[HE][DN][KR]PLYLAT[IF]LSF[IV]YA[FL]GHFLTE[FY]L[FI]Y[HQ]TM Motif 20 SEQ ID NO: 298):
  • ERP28-like or "ERG28-like polypeptide” as used herein also intends to include homologues as defined hereunder of "ERG28-like polypeptide”.
  • the ERG28-like polypeptide comprises the signature sequence and in increasing order of preference, at least 1 , at least 2, at least 3, or all 4 motifs as defined herein.
  • the homologue of an ERG28-like protein has in increasing order of preference at least 25%, 26%, 27%, 28%, 29%, 30%, 31 %, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41 %, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% overall sequence
  • the overall sequence identity is determined using a global alignment algorithm, such as the Needleman Wunsch algorithm in the program GAP (GCG Wisconsi n Package, Accelrys), preferably with default parameters and preferably with sequences of mature proteins (i.e. without taking into account secretion signals or transit peptides). Compared to overall sequence identity, the sequence identity will generally be higher when only conserved domains or motifs are considered.
  • GAP GCG Wisconsi n Package, Accelrys
  • the motifs in an ERG28-like polypeptide have, in increasing order of preference, at least 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87% , 88% , 89% , 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one or more of the motifs represented by SEQ ID NO: 297 to SEQ ID NO: 300 (Motifs 19 to 22).
  • said ERG28-like polypeptide comprises a conserved domain (or motif) with at least 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 % , 92%, 93%, 94% , 95% , 96%, 97% , 98% , or 99% sequence identity to the conserved domain starting with amino acid 1 up to amino acid 106 in SEQ ID NO: 247.
  • domain the polypeptide sequence which when used in the construction of a phylogenetic tree, such as the one published in Li et al., Plant Cell, 22:173-190, 2010, preferably clusters with the group of CYP704-like polypeptides comprising the amino acid sequence represented by AT2G45510 (SEQ ID NO: 8) rather than with any other group.
  • CYP704-li ke polypeptides typically ly have monooxygenase activity.
  • Tools and techniques for measuring monooxygenase activity are well known in the art, for example the v-hydroxylation of fatty acids (C16 and C18) is catalysed by CYP704B2 (Dobritsa et al., Plant Physiology 151 , 574-589, 2009).
  • the function of the nucleic acid sequences of the invention is to confer information for a protein that increases yield or yield related traits, when a nucleic acid sequence of the invention is transcribed and translated in a living plant cell.
  • CYP704-like polypeptides when expressed in rice according to the methods of the present invention as outlined in Examples 8 and 9, give plants having increased yield related traits, in particular increased seed yield.
  • DUF121 8 polypeptides the polypeptide sequence which when used in the construction of a phylogenetic tree, preferably clusters with the group of DUF1218 polypeptides comprising the amino acid sequence represented by SEQ ID NO: 88 rather than with any other group.
  • a phylogenetic tree of DUF1218 polypeptides can be constructed by aligning DUF1218 sequences using MAFFT (Katoh and Toh (2008) - Briefings in Bioinformatics 9:286-298).
  • a neighbour-joining tree can be calculated using Quick-Tree (Howe et al. (2002), Bioinformatics 18(1 1 ): 1546-7), 100 bootstrap repetitions.
  • a dendrogram can be drawn using Dendroscope (Huson et al. (2007), BMC Bioinformatics 8(1 ):460). Confidence levels for 100 bootstrap repetitions are generally indicated for major branchings.
  • Figure 10 illustrates a phylogentic tree of a number of DUF1218 polypeptides
  • DUF1218 polypeptides when expressed in rice according to the methods of the present invention as outlined in Examples 8 and 9, give plants having increased yield related traits, in particular increased seed yield , and more particu larly one or more parameters selected from the group comprising increased total seed weight, increased fill rate and increased thousand kernel weight.
  • translin-like polypeptides the polypeptide sequence which when used in the construction of a phylogenetic tree, such as the one depicted in Figure 13, clusters with the group of translin-like polypeptides comprising the amino acid sequence represented by SEQ ID NO: 191 rather than with any other group.
  • translin-like polypeptides at least in their native form, typically have DNA binding activity. Tools and techniques for measuring DNA binding activity are well known in the art.
  • the function of the nucleic acid sequences of the invention is to confer information for a protein that increases yield or yield related traits, when a nucleic acid sequence of the invention is transcribed and translated in a living plant cell.
  • translin-like polypeptides when expressed in rice according to the methods of the present invention as outlined in Examples 8 and 9, give plants having increased yield related traits, in particular increased seed yield , more in particular total seed yield (Totalwgseeds), seed fill rate (fillrate), harvest index and number of seeds (nrfilledseed).
  • ERG28-like polypeptides the polypeptide sequence which when used in the construction of a phylogenetic tree, such as the one depicted in Figure 19, preferably clusters with the group of ERG28-like polypeptides comprising the amino acid sequence represented by S EQ I D NO: 247 rather than with any other group of sequences not comprising the PF03694 domain.
  • ERG28-like polypeptides typically may be involved in tethering sterols and/or steroid enzymes to membranes of the secretory system (such as for example the endoplasmatic reticulum, the Golgi apparatus, transport vesicles, secretory vesicles), and/or to mediate interactions between these enzymes.
  • membranes of the secretory system such as for example the endoplasmatic reticulum, the Golgi apparatus, transport vesicles, secretory vesicles
  • Tools and techniques for measuring demethylating activity are well known in the art, see for example Gachotte et al. (Journal of Lipid Research 42: 150-154, 2001 ).
  • ERG28-like polypeptides when expressed in rice according to the methods of the present invention as outlined in Examples 8 and 9, give plants having increased yield related traits.
  • Concerning CYP704-like polypeptides the present invention is illustrated by transforming plants with the nucleic acid sequence represented by SEQ I D NO: 1 , encoding the polypeptide sequence of SEQ ID NO: 2.
  • performance of the invention is not restricted to these sequences; the methods of the invention may advantageously be performed using any CYP704-like-encoding nucleic acid or CYP704-like polypeptide as defined herein, as was shown for SEQ ID NO: 4, encoded by SEQ ID NO: 3.
  • nucleic acids encoding CYP704-like polypeptides are given in Table A1 of the Examples section herein. Such nucleic acids are useful in performing the methods of the invention.
  • the amino acid sequences given in Table A1 of the Examples section are example sequences of orthologues and paralogues of the CYP704-like polypeptide represented by SEQ ID NO: 2, the terms "orthologues” and "paralogues” being as defined herein.
  • orthologues and paralogues may readily be identified by performing a so-called reciprocal blast search as described in the definitions section; where the query sequence is SEQ ID NO: 1 or SEQ ID NO: 2, the second BLAST (back-BLAST) would be against Populus trichocarpa sequences, where the query sequence is SEQ ID NO: 3 or SEQ ID NO: 4, the second BLAST (back-BLAST) would be against rice sequences.
  • the invention also provides hitherto unknown CYP704-like-encoding nucleic acids and CYP704-like polypeptides useful for conferring enhanced yield-related traits in plants relative to control plants.
  • DUF1218 polypeptides the present invention is illustrated by transforming plants with the nucleic acid sequence represented by S EQ I D NO: 87, encoding the polypeptide sequence of SEQ ID NO: 88.
  • performance of the invention is not restricted to these sequences; the methods of the invention may advantageously be performed using any DUF1218-encoding nucleic acid or DUF1218 polypeptide as defined herein.
  • nucleic acids encoding DUF1218 polypeptides are given in Table A2 of the Examples section herein. Such nucleic acids are useful in performing the methods of the invention.
  • the amino acid sequences given in Table A2 of the Examples section are example sequences of orthologues and paralogues of the DUF1218 polypeptide represented by SEQ ID NO: 88, the terms "orthologues” and “paralogues” being as defined herein. Further orthologues and paralogues may readily be identified by performing a so- called reciprocal blast search as described in the definitions section; where the query sequence is SEQ ID NO: 87 or SEQ ID NO: 88, the second BLAST (back-BLAST) would be against rice sequences.
  • the invention also provides hitherto unknown DUF1218-encoding nucleic acids and DUF1218 polypeptides useful for conferring enhanced yield-related traits in plants relative to control plants.
  • nucleic acid molecule selected from:
  • nucleic acid molecule which hybridizes with a nucleic acid molecule of (i) to (iii) under high stringency hybridization conditions and preferably confers enhanced yield-related traits relative to control plants.
  • an amino acid sequence having, in increasing order of preference, at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the amino acid sequence represented by SEQ ID NO: 88 or 98, and additionally or alternatively comprising one or more motifs having in increasing order of preference at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity to
  • translin-like polypeptides the present invention is illustrated by transforming plants with the nucleic acid sequence represented by SEQ I D NO: 1 90, encoding the polypeptide sequence of SEQ ID NO: 191 .
  • performance of the invention is not restricted to these sequences; the methods of the invention may advantageously be performed using any translin-like -encoding nucleic acid or translin-like polypeptide as defined herein.
  • nucleic acids encoding translin-like polypeptides are given in Table A3 of the Examples section herein. Such nucleic acids are useful in performing the methods of the invention.
  • the amino acid sequences given in Table A3 of the Examples section are example sequences of orthologues and paralogues of the transl i n-like polypeptide represented by SEQ ID NO: 191 , the terms "orthologues" and “paralogues” being as defined herein.
  • Further orthologues and paralogues may readily be identified by performing a so-called reciprocal blast search as described in the definitions section; where the query sequence is SEQ ID NO: 190 or SEQ ID NO: 191 , the second BLAST (back-BLAST) would be against poplar sequences.
  • the invention also provides hitherto unknown translin-like polypeptide-encoding nucleic acids and translin-like polypeptides useful for conferring enhanced yield-related traits in plants relative to control plants.
  • nucleic acid molecule selected from:
  • nucleic acid encoding a translin-like polypeptide having in increasing order of preference at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88% , 89% , 90% , 91 % , 92% , 93% , 94% , 95% , 96% , 97% , 98% , or 99% sequence identity to the amino acid sequence represented by any one of SEQ I D NO: 225 or 233, and additionally or alternatively comprising one or more motifs having in increasing order of preference at least 50%, 55%, 60%, 65%, 70%, 7
  • nucleic acid molecule which hybridizes with a nucleic acid molecule of (i) to (iii) under high stringency hybridization conditions and preferably confers enhanced yield-related traits relative to control plants.
  • polypeptide selected from:
  • ERG28-like polypeptides the present invention is illustrated by transforming plants with the nucleic acid sequence represented by SEQ I D NO: 246, encoding the polypeptide sequence of SEQ ID NO: 247.
  • performance of the invention is not restricted to these sequences; the methods of the invention may advantageously be performed using any ERG28-like-encoding nucleic acid or ERG28-like polypeptide as defined herein.
  • the invention is practiced with the nucleic acid sequence represented by SEQ ID NO: 248, encoding the polypeptide sequence of SEQ ID NO: 249. Examples of nucleic acids encoding ERG28-like polypeptides are given in Table A4 of the Examples section herein.
  • nucleic acids are useful in performing the methods of the invention.
  • the amino acid sequences given in Table A4 of the Examples section are example sequences of orthologues and paralogues of the ERG28-like polypeptide represented by SEQ I D NO: 247, the terms "orthologues” and “paralogues” being as defined herein.
  • Further orthologues and paralogues may readily be identified by performing a so-called reciprocal blast search as described in the definitions section; where the query sequence is SEQ ID NO: 246 or SEQ ID NO: 247, the second BLAST (back-BLAST) would be against Arabidopsis thaliana sequences.
  • the query sequence is SEQ ID NO: 248 or S EQ I D NO: 249
  • th e second BLAST back-BLAST
  • Nucleic acid variants may also be useful in practising the methods of the invention.
  • Examples of such variants include nucleic acids encoding homologues and derivatives of any one of the amino acid sequences given in Table A1 to A4 of the Examples section, the terms "homologue” and “derivative” being as defined herein.
  • Also useful in the methods of the invention are nucleic acids encoding homologues and derivatives of orthologues or paralogues of any one of the amino acid seq uences given in Table A1 to A4 of the Examples section.
  • Homologues and derivatives useful in the methods of the present invention have substantially the same biological and functional activity as the unmodified protein from which they are derived.
  • Further variants useful in practising the methods of the invention are variants in which codon usage is optimised or in which miRNA target sites are removed.
  • nucleic acid variants useful in practising the methods of the invention include portions of nucleic acids encoding CYP704-like polypeptides, or DUF1218 polypeptides, or translin-like polypeptides, or ERG28-like polypeptides, nucleic acids hybridising to nucleic acids encoding encoding CYP704-like polypeptides, or DUF1218 polypeptides, or translin- like polypeptides, or ERG28-like polypeptides, splice variants of nucleic acids encoding encoding CYP704-like polypeptides, or DUF1218 polypeptides, or translin-like polypeptides, or ERG28-like polypeptides, allelic variants of nucleic acids encoding encoding CYP704-like polypeptides, or DUF1218 polypeptides, or translin-like polypeptides, or ERG28-like polypeptides, and variants
  • nucleic acids encoding CYP704-like polypeptides, or DUF1218 polypeptides, or translin-like polypeptides, or ERG28-like polypeptides need not be full-length nucleic acids, since performance of the methods of the invention does not rely on the use of full-length nucleic acid sequences.
  • a method for enhancing yield-related traits in plants comprising introducing and expressing in a plant a portion of any one of the nucleic acid sequences given in Table A1 to A4 of the Examples section, or a portion of a nucleic acid encoding an orthologue, paralogue or homologue of any of the amino acid sequences given in Table A1 to A4 of the Examples section.
  • a portion of a nucleic acid may be prepared, for example, by making one or more deletions to the nucleic acid.
  • the portions may be used in isolated form or they may be fused to other coding (or non-coding) sequences in order to, for example, produce a protein that combines several activities. When fused to other coding sequences, the resultant polypeptide produced upon translation may be bigger than that predicted for the protein portion.
  • coding or non-coding sequences
  • portions useful in the methods of the invention encode a CYP704-like polypeptide as defined herein, and have substantially the same biological activity as the amino acid sequences given in Table A1 of the Examples section.
  • the portion is a portion of any one of the nucleic acids given in Table A of the Examples section, or is a portion of a nucleic acid encoding an orthologue or paralogue of any one of the amino acid sequences given i n Table A1 of the Examples section .
  • the portion is at least 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1 100, 1 150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850, 1900 consecutive nucleotides in length, the consecutive nucleotides being of any one of the nucleic acid sequences given in Table A1 of the Examples section, or of a nucleic acid encoding an orthologue or paralogue of any one of the amino acid sequences given in Table A1 of the Examples section.
  • the portion is a portion of the nucleic acid of SEQ ID NO: 1 or SEQ ID NO: 3.
  • the portion encodes a fragment of an amino acid sequence which, when used in the construction of a phylogenetic tree, such as the one published in Li et al., Plant Cell, 22:173-190, 2010, clusters with the group of CYP704-like polypeptides comprising the amino acid sequence represented by AT2G45510 (SEQ I D NO: 8) rather than with any ot h e r g ro u p , a n d /o r co m p r i se s a P 450 d o m a i n ( Pfa m P F 00067 ) a n d th e MGRMXXXWGXXXXXXPERW signature sequence (SEQ ID NO: 72), and/or has monooxygenase activity, and/or has at least
  • portions useful in the methods of the invention encode a DU F1218 polypeptide as defined herein, and have substantially the same biological activity as the am ino acid sequ ences given in Ta ble A2 of the Examples section.
  • the portion is a portion of any one of the nucleic acids given in Table A2 of the Examples section, or is a portion of a nucleic acid encoding an orthologue or paralogue of any one of the amino acid sequences given in Table A2 of the Examples section.
  • the portion is at least 500, 550, 600, 650, 700, 750, 800 consecutive nucleotides in length, the consecutive nucleotides being of any one of the nucleic acid sequences given in Table A2 of the Examples section, or of a nucleic acid encoding an orthologue or paralogue of any one of the amino acid sequences given in Table A2 of the Examples section.
  • the portion is a portion of the nucleic acid of SEQ ID NO: 87.
  • the portion encodes a fragment of an amino acid sequence which has one or more of the following characteristics:
  • - comprises any one or more of the motifs 10 to 15 as provided herein, and
  • portions useful in the methods of the invention encode a translin-like polypeptide as defined herein, and have substantially the same biological activity as the amino acid sequences given in Table A3 of the Examples section.
  • the portion is a portion of any one of the nucleic acids given in Table A3 of the Examples section, or is a portion of a nucleic acid encoding an orthologue or paralogue of any one of the amino acid sequences given i n Table A3 of the Examples section .
  • the portion is at least 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950 consecutive nucleotides in length, the consecutive nucleotides being of any one of the nucleic acid sequences given in Table A3 of the Examples section, or of a nucleic acid encoding an orthologue or paralogue of any one of the amino acid sequences given in Table A3 of the Examples section. Most preferably the portion is a portion of the nucleic acid of SEQ ID NO: 190.
  • the portion encodes a fragment of an amino acid sequence which, when used in the construction of a phylogenetic tree, such as the one depicted in Figure 13, clusters with the group of translin-like polypeptides comprising the amino acid sequence represented by SEQ ID NO: 191 rather than with any other group, and/or comprises at least one of the motifs 16 to 18 (SEQ ID NO 238 to 240), and/or has DNA binding biological activity, and/or has at least 30.1 % sequence identity to SEQ ID NO: 191 .
  • portions useful in the methods of the invention encode an ERG28-like polypeptide as defined herein, and have substantially the same biological activity as the amino acid sequences given in Table A4 of the Examples section.
  • the portion is a portion of any one of the nucleic acids given in Table A4 of the Examples section, or is a portion of a nucleic acid encoding an orthologue or paralogue of any one of the amino acid sequences given i n Table A4 of the Examples section .
  • the portion is at least 100, 150, 200, 250, 300, 350, 400 consecutive nucleotides in length, the consecutive nucleotides being of any one of the nucleic acid sequences given in Table A4 of the Examples section, or of a nucleic acid encoding an orthologue or paralogue of any one of the amino acid sequences given in Table A4 of the Examples section.
  • the portion is a portion of the nucleic acid of SEQ ID NO: 246.
  • the portion encodes a fragment of an amino acid sequence which, when used in the construction of a phylogenetic tree, such as the one depicted in Figure 19, clusters with the group of ERG28-like polypeptides comprising the amino acid sequence represented by S EQ I D NO: 247 rather than with any other group of sequences not comprising the PF03694 domain, and/or comprises one or more of motifs 19 to 22, and/or has at least 40% sequence identity to SEQ ID NO: 247 or SEQ ID NO: 249.
  • nucleic acid variant useful in the methods of the invention is a nucleic acid capable of hybridising, under reduced stringency conditions, preferably under stringent conditions, with a nucleic acid encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or a ERG28-like polypeptide, as defined herein, or with a portion as defined herein.
  • a method for enhancing yield-related traits in plants comprising introducing and expressing in a plant a nucleic acid capable of hybridizing to any one of the nucleic acids given in Table A1 to A4 of the Examples section, or comprising introducing and expressing in a plant a nucleic acid capable of hybridising to a nucleic acid encoding an orthologue, paralogue or homologue of any of the nucleic acid sequences given in Table A1 to A4 of the Examples section.
  • Hybridising sequences useful in the methods of the invention encode a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or a ERG28-like polypeptide, as defined herein, having substantially the same biological activity as the amino acid sequences given in Table A1 to A4 of the Examples section.
  • the hybridising sequence is capable of hybridising to the complement of any one of the nucleic acids given in Table A1 to A4 of the Examples section, or to a portion of any of these sequences, a portion being as defined herein, or the hybridising sequence is capable of hybridising to the complement of a nucleic acid encoding an orthologue or paralogue of any one of the amino acid sequences given in Table A1 to A4 of the Examples section.
  • the hybridising sequence is most preferably capable of hybridising to the complement of a nucleic acid as represented by SEQ ID NO: 1 or to a portion thereof.
  • the hybridising sequence is capable of hybridising to the complement of a nucleic acid as represented by SEQ ID NO: 1 or to a portion thereof under conditions of medium or high stringency, preferably high stringency as defined herein.
  • the hybridising sequence is capable of hybridising to the complement of a nucleic acid as represented by SEQ ID NO: 1 under stringent conditions.
  • the hybridising sequence encodes a polypeptide with an amino acid sequence which, when full-length and used in the construction of a phylogenetic tree, such as the one published in Li et al., Plant Cell, 22: 173-190, 2010, clusters with the group of CYP704-like polypeptides comprising the amino acid sequence represented by AT2G45510 (SEQ I D NO: 8) rather than with any other group, and/or comprises a P450 domain (Pfam PF00067) and the MGRMXXXWGXXXXXXPERW signature sequence (SEQ ID NO: 72), and/or has monooxygenase activity, and/or has at least 20% sequence identity to SEQ ID NO: 2 or SEQ ID NO: 4.
  • the hybridising sequence is most preferably capable of hybridising to the complement of a nucleic acid as represented by SEQ ID NO: 87 or to a portion thereof.
  • the hybridising sequence encodes a polypeptide with an amino acid sequence which has one or more of the following characteristics,
  • - comprises any one or more of the motifs 10 to 15 as provided herein, and
  • the hybridising sequence is most preferably capable of hybridising to the complement of a nucleic acid as represented by SEQ ID NO: 190 or to a portion thereof.
  • the hybridising sequence is capable of hybridising to the complement of a nucleic acid as represented by SEQ ID NO: 190 or to a portion thereof under conditions of medium or high stringency, preferably high stringency as defined herein.
  • the hybridising sequence is capable of hybridising to the complement of a nucleic acid as represented by SEQ ID NO: 190 under stringent conditions.
  • the hybridising sequence encodes a polypeptide with an amino acid sequence which, when full-length and used in the construction of a phylogenetic tree, such as the one depicted in Figure 13, clusters with the group of translin-like polypeptides comprising the amino acid sequence represented by SEQ ID NO: 191 rather than with any other group group, and/or comprises at least one of the motifs 16 to 18 (SEQ ID NO 238 to 240), and/or has DNA binding biological activity, and/or has at least 30.1 % sequence identity to SEQ ID NO: 191 .
  • the hybridising sequence is most preferably capable of hybridising to the complement of a nucleic acid as represented by SEQ ID NO: 246 or to a portion thereof.
  • the hybridising sequence encodes a polypeptide with an amino acid sequence which, when full-length and used in the construction of a phylogenetic tree, such as the one depicted in Figure 19, clusters with the group of ERG28-like polypeptides comprising the amino acid sequence represented by SEQ ID NO: 247 rather than with any other group of sequences not comprising the PF03694 domain, and/or comprises one or more of motifs 19 to 22, and/or has at least 40% sequence identity to SEQ ID NO: 247 or SEQ ID NO: 249.
  • nucleic acid variant useful in the methods of the invention is a splice variant encodi ng a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or a ERG28-like polypeptide, as defined herein, a splice variant being as defined herein.
  • a method for enhancing yield-related traits and/or altering steroid level/composition in plants comprising introducing and expressing in a plant a splice variant of any one of the nucleic acid sequences given in Table A1 to A4 of the Examples section, or a splice variant of a nucleic acid encoding an orthologue, paralogue or homologue of any of the amino acid sequences given in Table A1 to A4 of the Examples section.
  • preferred splice variants are splice variants of a nucleic acid represented by SEQ ID NO: 1 , or a splice variant of a nucleic acid encoding an orthologue or paralogue of SEQ ID NO: 2.
  • the amino acid sequence encoded by the splice variant when used in the construction of a phylogenetic tree, such as the one published in Li et al., Plant Cell, 22:173-190, 2010, clusters with the group of CYP704-like polypeptides comprising the amino acid sequence represented by AT2G45510 (SEQ I D NO: 8) rather than with any other group, and/or comprises a P450 domain (Pfam PF00067) and the MGRMXXXWGXXXXXXPERW signature sequence (SEQ ID NO: 72), and/or has monooxygenase activity, and/or has at least 20% sequence identity to SEQ ID NO: 2 or SEQ ID NO: 4.
  • a phylogenetic tree such as the one published in Li et al., Plant Cell, 22:173-190, 2010, clusters with the group of CYP704-like polypeptides comprising the amino acid sequence represented by AT2G45510 (SEQ I D NO: 8) rather than with
  • preferred splice variants are splice variants of a nucleic acid represented by SEQ ID NO: 87, or a splice variant of a nucleic acid encoding an orthologue or paralogue of SEQ ID NO: 88.
  • the amino acid sequence encoded by the splice variant has one or more of the following characteristics,
  • - comprises any one or more of the motifs 10 to 15 as provided herein, and
  • referred splice variants are splice variants of a nucleic acid represented by SEQ ID NO: 190, or a splice variant of a nucleic acid encoding an orthologue or paralogue of SEQ ID NO: 191.
  • the amino acid sequence encoded by the splice variant when used in the construction of a phylogenetic tree, such as the one depicted i n Figure 1 3, clusters with the group of translin-like polypeptides comprising the amino acid sequence represented by SEQ ID NO: 191 rather than with any other group, and/or comprises at least one of the motifs 16 to 18 (SEQ ID NO 238 to 240), and/or has DNA binding biological activity, and/or has at least 30.1 % sequence identity to SEQ ID NO: 191 .
  • preferred splice variants are splice variants of a nucleic acid represented by SEQ ID NO: 246, or a splice variant of a nucleic acid encoding an orthologue or paralogue of SEQ ID NO: 247.
  • the amino acid sequence encoded by the splice variant when used in the construction of a phylogenetic tree, such as the one depicted i n Figu re 1 9, cl usters with the grou p of E RG28-like polypeptides comprising the amino acid sequence represented by SEQ ID NO: 247 rather than with any other group of sequences not comprising the PF03694 domain, and/or comprises one or more of motifs 19 to 22, and/or has at least 40% sequence identity to SEQ ID NO: 247 or SEQ ID NO: 249.
  • nucleic acid variant useful in performing the methods of the invention is an allelic variant of a nucleic acid encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or a ERG28-like polypeptide, as defined herein, an allelic variant being as defined herein.
  • a method for enhancing yield-related traits and/or altering steroid level/composition in plants comprising introducing and expressing in a plant an allelic variant of any one of the nucleic acids given in Table A1 to A4 of the Examples section, or comprising introducing and expressing in a plant an allelic variant of a nucleic acid encoding an orthologue, paralogue or homologue of any of the amino acid sequences given in Table A1 to A4 of the Examples section.
  • allelic variants useful in the methods of the present invention have substantially the same biological activity as the CYP704-like polypeptide of SEQ ID NO: 2 and any of the amino acid sequences depicted in Table A1 of the Examples section.
  • Allelic variants exist in nature, and encompassed within the methods of the present invention is the use of these natural alleles.
  • the allelic variant is an allelic variant of SEQ I D NO: 1 or an allelic variant of a nucleic acid encoding an orthologue or paralogue of SEQ ID NO: 2.
  • the amino acid sequence encoded by the allelic variant when used in the construction of a phylogenetic tree, such as the one published in Li et al., Plant Cell, 22: 173-190, 2010, clusters with the group of CYP704-like polypeptides comprising the amino acid sequence represented by AT2G45510 (SEQ ID NO: 8) rather than with any other group, and/or comprises a P450 domain (Pfam PF00067) and the MGRMXXXWGXXXXXXPERW signature sequence (SEQ ID NO: 72), and/or has monooxygenase activity, and/or has at least 20% sequence identity to SEQ ID NO: 2 or SEQ ID NO: 4.
  • a phylogenetic tree such as the one published in Li et al., Plant Cell, 22: 173-190, 2010, clusters with the group of CYP704-like polypeptides comprising the amino acid sequence represented by AT2G45510 (SEQ ID NO: 8) rather than with any other group,
  • the polypeptides encoded by allelic variants useful in the methods of the present invention have substantially the same biological activity as the DUF1218 polypeptide of SEQ ID NO: 88 and any of the amino acid sequences depicted in Table A1 of the Examples section.
  • Allelic variants exist in nature, and encompassed within the methods of the present invention is the use of these natural alleles.
  • the allelic variant is an allelic variant of SEQ ID NO: 87 or an allelic variant of a nucleic acid encoding an orthologue or paralogue of SEQ I D NO: 88.
  • the amino acid sequence encoded by the allelic variant has one or more of the following characteristics,
  • - comprises any one or more of the motifs 10 to 15 as provided herein, and
  • translin-lile polypeptides the polypeptides encoded by allelic variants useful in the methods of the present invention have substantially the same biological activity as the translin-like polypeptide of SEQ ID NO: 191 and any of the amino acid sequences depicted in Table A3 of the Examples section.
  • Allelic variants exist in nature, and encompassed within the methods of the present invention is the use of these natural alleles.
  • the allelic variant is an allelic variant of SEQ ID NO: 190 or an allelic variant of a nucleic acid encoding an orthologue or paralogue of SEQ ID NO: 191 .
  • the amino acid sequence encoded by the allelic variant when used in the construction of a phylogenetic tree, such as the one depicted in Figure 7, clusters with the translin-like polypeptides comprising the amino acid sequence represented by SEQ ID NO: 191 rather than with any other group, and/or comprises at least one of the motifs 16 to 18 (SEQ ID NO 238 to 240), and/or has DNA binding biological activity, and/or has at least 30.1 % sequence identity to SEQ ID NO: 191 .
  • allelic variants useful in the methods of the present invention have substantially the same biological activity as the ERG28-like polypeptide of SEQ ID NO: 247 and any of the amino acid sequences depicted in Table A4 of the Examples section.
  • Allelic variants exist in nature, and encompassed within the methods of the present invention is the use of these natural alleles.
  • the allelic variant is an allelic variant of SEQ ID NO: 246 or an allelic variant of a nucleic acid encoding an orthologue or paralogue of SEQ ID NO: 247.
  • the amino acid sequence encoded by the allelic variant when used in the construction of a phylogenetic tree, such as the one depicted in Figure 19, clusters with the group of ERG28-like polypeptides comprising the amino acid sequence represented by SEQ ID NO: 247 rather than with any other group of sequences not comprising the PF03694 domain, and/or comprises one or more of motifs 19 to 22, and/or has at least 40% sequence identity to SEQ ID NO: 247 or SEQ ID NO: 249.
  • Gene shuffling or directed evolution may also be used to generate variants of nucleic acids encoding CYP704-like polypeptides, or DUF1218 polypeptides, or translin-like polypeptides, or ERG28-like polypeptides, as defined above; the term "gene shuffling" being as defined herein.
  • a method for enhancing yield-related traits in plants comprising introducing and expressing in a plant a variant of any one of the nucleic acid sequences given in Table A1 to A4 of the Examples section, or comprising introducing and expressing in a plant a variant of a nucleic acid encoding an orthologue, paralogue or homologue of any of the amino acid sequences given in Table A1 to A4 of the Examples section, which variant nucleic acid is obtained by gene shuffling.
  • CYP704-like polypeptides the amino acid sequence encoded by the variant nucleic acid obtained by gene shuffling, when used in the construction of a phylogenetic tree, such as the one published in Li et al., Plant Cell, 22:173-190, 2010, preferably clusters with the grou p of CYP704-like polypeptides comprising the amino acid sequence represented by AT2G45510 (SEQ I D NO: 8) rather than with any other group, and/or comprises a P450 domain (Pfam PF00067) and the MGRMXXXWGXXXXXXPERW signature sequence (SEQ ID NO: 72), and/or has monooxygenase activity, and/or has at least 20% sequence identity to SEQ ID NO: 2 or SEQ ID NO: 4.
  • DUF1218 polypeptides the amino acid sequence encoded by the variant nucleic acid obtained by gene shuffling, preferably has one or more of the following characteristics,
  • - comprises any one or more of the motifs 10 to 15 as provided herein, and
  • translin-like polypeptides the amino acid sequence encoded by the variant nucleic acid obtained by gene shuffling, when used in the construction of a phylogenetic tree such as the one depicted in Figure 13, preferably clusters with the group of translin-like polypeptides comprising the amino acid sequence represented by SEQ ID NO: 191 rather than with any other group, and/or comprises at least one of the motifs 16 to 18 (SEQ ID NO 238 to 240), and/or has DNA binding biological activity, and/or has at least 30.1 % sequence identity to SEQ ID NO: 191.
  • ERG28-like polypeptides the amino acid sequence encoded by the variant nucleic acid obtained by gene shuffling, when used in the construction of a phylogenetic tree, such as the one depicted in Figure 19, preferably clusters with the group of ERG28- like polypeptides comprising the amino acid sequence represented by SEQ I D NO: 247 rather than with any other group of sequences not comprising the PF03694 domain, and/or comprises one or more of motifs 19 to 22, and/or has at least 40% sequence identity to SEQ ID NO: 247 or SEQ ID NO: 249.
  • nucleic acid variants may also be obtained by site-directed mutagenesis.
  • site-directed mutagenesis Several methods are available to achieve site-directed mutagenesis, the most common being PCR based methods (Current Protocols in Molecular Biology. Wiley Eds.).
  • CYP704-like polypeptides differing from the sequence of SEQ ID NO: 2 or SEQ ID NO: 4 by one or several amino acids may be used to increase the yield of plants in the methods and constructs and plants of the invention. Substituting one or more amino acids in a protein can be done using standard techniques known to the person skilled in the art.
  • Nucleic acids encoding CYP704-like polypeptides may be derived from any natural or artificial source.
  • the nucleic acid may be modified from its native form in composition and/or genomic environment through deliberate human manipulation .
  • the CYP704-like polypeptide-encoding nucleic acid is from a plant, further preferably from a monocotyledonous plant, more preferably from the family Poaceae, most preferably the nucleic acid is from Oryza sativa.
  • the CYP704-like polypeptide- encoding nucleic acid is from a dicotyledonous plant, preferably from the family Salicaceae, more preferably from Populus trichocarpa.
  • Nucleic acids encoding DUF1218 polypeptides may be derived from any natural or artificial source.
  • the nucleic acid may be modified from its native form in composition and/or genomic environment through deliberate human manipulation.
  • the DUF1218 polypeptide-e n cod i n g n u cl e i c aci d i s fro m a pl a nt , fu rth er p refe ra b l y from a monocotyledonous plant, more preferably from the family Poaceae, more preferably from the genus Oryza, most preferably the nucleic acid is from Oryza sativa.
  • Nucleic acids encoding translin-like polypeptides may be derived from any natural or artificial source.
  • the nucleic acid may be modified from its native form in composition and/or genomic environment through deliberate human manipulation.
  • the translin-like polypeptide-encoding nucleic acid is from a plant, further preferably from a dicotyledonous plant, more preferably from the family Salicaceae, most preferably the nucleic acid is from Populus trichocarpa.
  • Nucleic acids encoding ERG28-like polypeptides may be derived from any natural or artificial source.
  • the nucleic acid may be modified from its native form in composition and/or genomic environment through deliberate human manipulation, including but not limited to hybrid ERG28-like proteins comprising parts of two or more other ERG28-like proteins, or synthetic fusion proteins of an ERG28-like protein with domains of other proteins.
  • the ERG28-like polypeptide-encoding nucleic acid is from (or is derived from) yeast or a plant, further preferably from a dicotyledonous plant, more preferably from the family Brassicaceae, most preferably the nucleic acid is from Arabidopsis thaliana.
  • the ERG28-like polypeptide-encoding nucleic acid is from the family Solanaceae, most preferably the nucleic acid is from Solarium lycopersicum.
  • Steroid encompasses “sterols” and is used herein interchangeably.
  • Steroids form a group of compounds based on the saturated tetracyclic hydrocarbon: 1 ,2-cyclopentanoperhydrophenanthrene which may have substitutions at C10 and C13 by methyl groups and may have ketone, hydroxyl, alkyl or other side-chains at C17.
  • Steroid molecules may be divided into several groups such as for example sterols, brassinosteroids, bufadienolides, cardenolides, cucurbitaci ns, ecdysteroids, sapogenins, steroid alkaloids, withasteroids, bile acids, hormonal steroids.
  • Phytosterols are synthesized via the mevalonate pathway of terpenoid formation.
  • Plant steroids are derived from sterols and comprise the plant steroid hormones brassinosteroids.
  • Plant steroids and sterols have been shown to play an essential role in the regulation of many plant growth and developmental processes. Alterations in sterol levels are known to affect embryogenesis, cell elongation and vascular differentiation (Clouse, Plant Cell 14: 1995-2000, 2002 and references therein). Interestingly in terms of agronomical applications, sterols also appear to be involved in resistance of the plants to pathogens.
  • modulating the expression of ERG28- like proteins in a plant results in altered sterol and/or steroid composition and/or modified sterol and/or steroid levels in a plant.
  • modulating the expression of ERG28-like proteins in yeast results in improved yeast growth and/or reproduction, compared to wild type yeast.
  • the invention also provides use of ERG28-like proteins to improve yeast growth and/or reproduction under normal and/or stressed growth conditions.
  • modulating expression (increased or decreased expression) of ERG28-like protei ns i n a plant resu lts i n en hanced yield-related traits.
  • decreased expression of ERG28-like protein results in increased seed yield and shorter, swollen root with increased root hair density in comparison with wildtype plants as described and exemplified herein in Example 14.
  • the present invention extends to recombinant chromosomal DNA comprising a nucleic acid sequence useful in the methods of the invention, wherein said nucleic acid is present in the chromosomal DNA as a result of recombinant methods, i.e. said nucleic acid is not in the chromosomal DNA in its native surrounding.
  • Said recombinant chromosomal DNA may be a chromosome of native origin, with said nucleic acid inserted by recombinant means, or it may be a mini-chromosome or a non-native chromosomal structure, e.g. or an artificial chromosome.
  • chromosomal DNA may vary, as long it allows for stable passing on to successive generations of the recombinant nucleic acid useful in the methods of the invention, and allows for expression of said nucleic acid in a living plant cell resulting in increased yield or increased yield related traits of the plant cell or a plant comprising the plant cell.
  • the recombinant chromosomal DNA of the invention is comprised in a plant cell.
  • Performance of the methods of the invention gives plants having enhanced yield-related traits.
  • performance of the methods of the invention gives plants having increased yield, especially increased seed yield relative to control plants.
  • Reference herein to enhanced yield-related traits is taken to mean an increase early vigour and/or in biomass (weight) of one or more parts of a plant, which may include (i) aboveground parts and preferably aboveground harvestable parts and/or (ii) parts below ground and preferably harvestable below ground.
  • harvestable parts are seeds, and performance of the methods of the invention results in plants having increased seed yield relative to the seed yield of control plants.
  • the present invention provides a method for increasing plant yield, especially seed yield of plants, relative to control plants, which method comprises modulating expression in a plant of a nucleic acid encoding a CYP704-like polypeptide as defined herein.
  • the present invention also provides a method for increasing yield-related traits, in particular yield, especially seed yield of plants, relative to control plants, which method comprises modulating expression in a plant of a nucleic acid encoding a DUF121 8 polypeptide as defined herein.
  • the present invention also provides a method for increasing yield, especially harvest index and/or seed yield of plants, relative to control plants, which method comprises modulating expression in a plant of a nucleic acid encoding a translin-like polypeptide as defined herein.
  • the present invention also provides a method for increasing yield-related traits and/or altering (increasing or decreasing) steroid level/composition, especially yield of plants, relative to control plants, which method comprises modulating expression (increased or decreased expression) in a plant of a nucleic acid encoding an ERG28-like polypeptide as defined herein.
  • performance of the methods of the invention gives plants having an increased growth rate relative to control plants. Therefore, according to the present invention, there is provided a method for increasing the growth rate of plants, which method comprises modulating expression in a plant of a nucleic acid encodi ng a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide, as defined herein.
  • Performance of the methods of the invention gives plants grown under non-stress conditions or under mild drought conditions increased yield and/or altered (increased or decreased) steroid level/composition relative to control plants grown under comparable conditions. Therefore, according to the present invention, there is provided a method for increasing yield and/or altered (increased or decreased) steroid level/composition in plants grown under non-stress conditions or under mild drought conditions, which method comprises modulating expression in a plant of a nucleic acid a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide.
  • Performance of the methods of the invention gives plants grown under conditions of drought, increased yield and/or altered (increased or decreased) steroid level/composition relative to control plants grown under comparable conditions. Therefore, according to the present invention, there is provided a method for increasing yield and/or altered steroid (increased or decreased) level/composition in plants grown under conditions of drought which method comprises modulating expression in a plant of a nucleic acid encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide.
  • Performance of the methods of the invention gives plants grown under conditions of nutrient deficiency, particularly under conditions of nitrogen deficiency, increased yield and/or altered (increased or decreased) steroid level/composition relative to control plants grown under comparable conditions. Therefore, according to the present invention, there is provided a method for increasing yield and/or altered (increased or decreased) steroid level/composition in plants grown under conditions of nutrient deficiency, which method comprises modulating expression in a plant of a nucleic acid encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide.
  • Performance of the methods of the invention gives plants grown under conditions of salt stress, increased yield and/or altered (increased or decreased) steroid level/composition relative to control plants grown under comparable conditions. Therefore, according to the present invention, there is provided a method for increasing yield and/or altered (increased or decreased) steroid level/composition in plants grown under conditions of salt stress, which method comprises modulating expression in a plant of a nucleic acid encoding a CYP704-like polypeptide, or a DUF12 8 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide.
  • the invention also provides genetic constructs and vectors to facilitate introduction and/or expression in plants of nucleic acids encoding CYP704-like polypeptides, or DUF1218 polypeptides, or translin-like polypeptides, or ERG28-like polypeptides.
  • the gene constructs may be inserted into vectors, which may be commercially available, suitable for transforming into plants and suitable for expression of the gene of interest in the transformed cells.
  • the invention also provides use of a gene construct as defined herein in the methods of the invention.
  • the present invention provides a construct comprising:
  • nucleic acid sequence of (a) a nucleic acid encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide as defined above; one or more control sequences capable of driving expression of the nucleic acid sequence of (a); and optionally
  • the nucleic acid encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide is as defined above.
  • control sequence and terminal sequence are as defined herein.
  • the genetic construct of the invention may be comprised in a host cell, plant cell, seed, agricultural product or plant.
  • Plants or host cells are transformed with a genetic construct such as a vector or an expression cassette comprising any of the nucleic acids described above.
  • the invention furthermore provides plants or host cells transformed with a construct as described above.
  • the invention provides plants transformed with a construct as described above, which plants have increased yield-related traits and/or altered (increased or decreased) steroid level/composition as described herein.
  • Plants are transformed with a vector comprising any of the nucleic acids described above.
  • the skilled artisan is well aware of the genetic elements that must be present on the vector in order to successfully transform, select and propagate host cells containing the sequence of interest.
  • the sequence of interest is operably linked to one or more control sequences, at least to a promoter, in the vectors of the invention.
  • the promoter in such an expression cassette may be a non-native promoter to the nucleic acid described above, i.e. a promoter not regulating the expression of said nucleic acid in its native surrounding.
  • the expression cassettes of the invention confer increased yield or yield related traits(s) to a living plant cell when they have been introduced into said plant cell and result in expression of the nucleic acid as defined above, comprised in the expression cassette(s).
  • any type of promoter may be used to drive expression of the nucleic acid sequence, but preferably the promoter is of plant origin.
  • a constitutive promoter is particularly useful in the methods.
  • the constitutive promoter is a ubiquitous constitutive promoter of medium strength. See the "Definitions" section herein for definitions of the various promoter types.
  • the constitutive promoter is preferably a medium strength promoter. More preferably it is a plant derived promoter, e.g. a promoter of plant chromosomal origin, such as a GOS2 promoter or a promoter of substantially the same strength and having substantially the same expression pattern (a functionally equivalent promoter), more preferably the promoter is the promoter GOS2 promoter from rice.
  • a plant derived promoter e.g. a promoter of plant chromosomal origin, such as a GOS2 promoter or a promoter of substantially the same strength and having substantially the same expression pattern (a functionally equivalent promoter)
  • the promoter is the promoter GOS2 promoter from rice.
  • the constitutive promoter is represented by a nucleic acid sequence substantially similar to SEQ ID NO: 83, or SEQ ID NO: 186, or SEQ ID NO: 242, or SEQ ID NO: 301 , most preferably the constitutive promoter is as represented by SEQ ID NO: 83, or SEQ ID NO: 186, or SEQ ID NO: 242, or SEQ ID NO: 301 . See the "Definitions" section herein for further examples of constitutive promoters. Concerning ERG28-like polypeptides, in a particular embodiment with Arabidopsis thaliana as host plant, the CaMV35S promoter may be used as constitutive promoter.
  • CYP704-like polypeptides it should be clear that the applicability of the present invention is not restricted to the CYP704-like polypeptide-encoding nucleic acid represented by SEQ ID NO: 1 , nor is the applicability of the invention restricted to expression of a CYP704-like polypeptide-encoding nucleic acid when driven by a constitutive promoter, or when driven by a root-specific promoter.
  • DUF1218 polypeptides it should be clear that the applicability of the present invention is not restricted to the DUF1218 polypeptide-encoding nucleic acid represented by S EQ I D NO : 87, nor is the applicability of the invention restricted to expression of a DUF1218 polypeptide-encoding nucleic acid when driven by a constitutive promoter.
  • translin-like polypeptides it should be clear that the applicability of the present invention is not restricted to the translin-like polypeptide-encoding nucleic acid represented by SEQ ID NO: 190 nor is the applicability of the invention restricted to expression of a translin-like polypeptide-encoding nucleic acid when driven by a constitutive promoter.
  • ERG28-like polypeptides it should be clear that the applicability of the present invention is not restricted to the ERG28-like polypeptide-encoding nucleic acid represented by SEQ ID NO: 246 or SEQ ID NO: 247, nor is the applicability of the invention restricted to expression of an E RG28-like polypeptide-encoding nucleic acid when driven by a constitutive promoter.
  • Concerning CYP704-like polypeptides, optionally, one or more terminator sequences may be used in the construct introduced into a plant.
  • the construct comprises an expression cassette comprising a GOS2 promoter, substantially similar to SEQ ID NO: 83, operably linked to the nucleic acid encoding the CYP704-like polypeptide. More preferably, the construct comprises a zein terminator (t-zein) linked to the 3' end of the CYP704-like coding sequence. Furthermore, one or more sequences encoding selectable markers may be present on the construct introduced into a plant.
  • t-zein zein terminator
  • one or more terminator sequences may be used in the construct introduced into a plant.
  • the construct comprises an expression cassette comprising a GOS2 promoter, substantially similar to SEQ ID NO: 186, operably linked to the nucleic acid encoding the DUF1218 polypeptide.
  • the construct comprises a zein terminator (t-zein) linked to the 3' end of the DUF1218 sequence.
  • the expression cassette comprises a sequence having in increasing order of preference at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity to the sequence represented by SEQ ID NO: 187 (pGOS2::DUF1218::t- zein sequence).
  • sequences encoding selectable markers may be present on the construct introduced into a plant.
  • one or more terminator sequences may be used in the construct introduced into a plant.
  • the construct comprises an expression cassette comprising a GOS2 promoter, substantially similar to SEQ ID NO: 242, operably linked to the nucleic acid encoding the translin-like polypeptide.
  • the construct comprises a zein terminator (t-zein) linked to the 3' end of the translin-like coding sequence.
  • the expression cassette comprises a sequence having in increasing order of preference at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity to the sequence represented by SEQ ID NO: 241 (pPRO::translin-like gene::t-zein sequence).
  • sequences encoding selectable markers may be present on the construct introduced into a plant.
  • one or more terminator sequences may be used in the construct introduced into a plant.
  • the construct comprises an expression cassette comprising a GOS2 promoter, substantially similar to SEQ ID NO: 301 , operably linked to the nucleic acid encoding the ERG28-like polypeptide.
  • the construct comprises a zein terminator (t-zein) linked to the 3' end of the ERG28-like coding sequence.
  • sequences encoding selectable markers may be present on the construct introduced into a plant.
  • the modulated expression is increased expression.
  • Methods for increasing expression (or overexpression) of nucleic acids or genes, or gene products, are well documented in the art and examples are provided in the definitions section.
  • the modulated expression is decreased expression.
  • Methods for decreasing expression of nucleic acids or genes, or gene products are known to the skilled person and well documented in the art.
  • T-DNA insertion is used for decreasing expression of an ERG28-like gene/nucleic acid.
  • Alternative methods for decreasing expression are described herein within the definitions section.
  • a preferred method for modulating expression of a nucleic acid encodi ng a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide is by introducing and expressing in a plant a nucleic acid encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin- like polypeptide, or an ERG28-like polypeptide; however the effects of performing the method, i.e. enhancing yield-related traits may also be achieved using other well known techniques, including but not limited to T-DNA activation tagging, TILLING, homologous recombination. A description of these techniques is provided in the definitions section.
  • the invention also provides a method for the production of transgenic plants having enhanced yield-related traits and/or altered steroid level/composition relative to control plants, comprising introduction and expression in a plant of any nucleic acid encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide, as defined hereinabove. More specifically, the present invention provides a method for the production of transgenic plants having enhanced yield-related traits, particularly increased (seed) yield, which method comprises:
  • Cultivating the plant cell under conditions promoting plant growth and development may or may not include regeneration and or growth to maturity.
  • the present invention provides a method for the production of transgenic plants having enhanced yield-related traits, particularly increased yield, and more particularly increased seed yield, which method comprises:
  • Cultivating the plant cell under conditions promoting plant growth and development may or may not include regeneration and or growth to maturity.
  • the present invention provides a method for the production of transgenic plants having enhanced yield-related traits, particularly increased seed yield and/or increased harvest index, which method comprises:
  • cultivating the plant cell under conditions promoting plant growth and development may or may not include regeneration and or growth to maturity.
  • the present invention provides a method for the production of transgenic plants having enhanced yield-related traits and/or altered steroid level/composition, particularly increased (seed) yield, which method comprises:
  • Cultivating the plant cell under conditions promoting plant growth and development may or may not include regeneration and or growth to maturity.
  • the plant cell transformed by the method according to the invention is regenerable into a transformed plant.
  • the plant cell transformed by the method according to the invention is not regenerable into a transformed plant, i.e. cells that are not capable to regenerate into a plant using cell culture tech niques known in the art.
  • Wh ile plants cells generally have the characteristic of totipotency, some plant cells can not be used to regenerate or propagate intact plants from said cells.
  • the plant cells of the invention are such cells.
  • the plant cells of the invention are plant cells that do not sustain themselves in an autotrophic way.
  • the nucleic acid may be introduced directly into a plant cell or into the plant itself (including introduction into a tissue, organ or any other part of a plant). According to a preferred feature of the present invention, the nucleic acid is preferably introduced into a plant or plant cell by transformation.
  • transformation is described in more detail in the "definitions” section herein.
  • the present invention extends to any plant cell or plant produced by any of the methods described herein, and to all plant parts and propagules thereof.
  • the present invention encompasses plants or parts thereof (including seeds) obtainable by the methods according to the present invention.
  • the plants or parts thereof comprise a nucleic acid transgene encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide, as defined above.
  • the present invention extends further to encompass the progeny of a primary transformed or transfected cell, tissue, organ or whole plant that has been produced by any of the aforementioned methods, the only requirement being that progeny exhibit the same genotypic and/or phenotypic characteristic(s) as those produced by the parent in the methods according to the invention.
  • yeast or yeast cell refers to un icel l ula r microorgani sms that bel ong to one of three classes: Ascomycetes, Basidiomycetes and Fungi Imperfecti.
  • the yeast is a nonpathogenic strain selected from Saccharomyces, Candida, Cryptococcus, Hansenula, Kluyveromyces, Pichia, Rhodotorula, Schizosaccharomyces and Yarrowia, more preferably the yeast is se lected from Sacch aromyces , Can d id a , H a nsen u la , Pichia and Schizosaccharomyces, most preferably the yeast is Saccharomyces.
  • yeast strains include Saccharomyces cerevisiae, Saccharomyces carlsbergensis, Candida kejyr, Candida tropicalis, Cryptococcus laurentii, Cryptococcus neoformans, Hansenula anomala, Hansenula polymorpha, Kluyveromyces frag His, Kluyveromyces lactis, Kluyveromyces marxianus var. lactis, Pichia pastoris, Rhodotorula rubra, Schizosaccharomyces pombe, and Yarrowia lipolytica. It is to be appreciated that a number of these species include a variety of subspecies, types, subtypes, etc.
  • yeast species used in the methods of the present invention is a yeast species that is "Generally Recognized As Safe” or "GRAS" for use as food additives (GRAS, FDA proposed Rule 62FR18938, April 17, 1997).
  • the present invention also extends in another embodiment to transgenic plant cells and seed comprising the nucleic acid molecule of the invention in a plant expression cassette or a plant expression construct.
  • the seed of the invention recombinantly comprises the expression cassette of the invention, the (expression) construct of the invention, the nucleic acids described above and/or the proteins encoded by the nucleic acids as described above.
  • a further embodiment of the present invention extends to plant cells comprising the nucleic acid as described above in a recombinant plant expression cassette.
  • the plant cells of the invention are non-propagative cells, e.g. the cells can not be used to regenerate a whole plant from this cell as a whole using standard cell culture techniques, this meaning cell culture methods but excluding in-vitro nuclear, organelle or chromosome transfer methods. While plant cells generally have the characteristic of totipotency, some plant cells can not be used to regenerate or propagate intact plants from said cells. In one embodiment of the invention the plant cells of the invention are such cells. In another embodiment the plant cells of the invention are plant cells that do not sustain themselves through photosynthesis by synthesizing carbohydrate and protein from such inorganic substances as water, carbon dioxide and mineral salt, i.e. they may be deemed non-plant variety. In a further embodiment the plant cells of the invention are non-plant vari- ety and non-propagative.
  • the invention also includes host cells containing an isolated nucleic acid encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide, as defined hereinabove.
  • Host cells of the invention may be any cell selected from the group consisting of bacterial cells, such as E. coli or Agrobacterium species cells, yeast cells, fungal , algal or cyanobacterial cells or plant cells.
  • host cells according to the invention are plant cells, yeasts, bacteria or fungi.
  • Host plants for the nucleic acids or the vector used in the method according to the invention, the expression cassette or construct or vector are, in principle, advantageously all plants, which are capable of synthesizing the polypeptides used in the inventive method.
  • Plants that are particularly useful in the methods of the invention include all plants which belong to the superfamily Viridiplantae, in particular monocotyledonous and dicotyledonous plants including fodder or forage leg umes , ornamental plants, food crops, trees or shrubs.
  • the plant is a crop plant. Examples of crop plants include but are not limited to chicory, carrot, cassava, trefoil, soybean, beet, sugar beet, sunflower, canola, alfalfa, rapeseed, linseed, cotton, tomato, potato and tobacco.
  • th e p resen t i n ven ti on th e pl a nt i s a m o n ocotyl ed o n o us p l a nt.
  • Exam pl es of monocotyledonous plants include sugarcane.
  • the plant is a cereal. Examples of cereals include rice, maize, wheat, barley, millet, rye, triticale, sorghum, emmer, spelt, einkorn , teff, milo and oats.
  • the plants used in the methods of the invention are selected from the group consisting of maize, wheat, rice, soybean, cotton, oilseed rape including canola, sugarcane, sugar beet and alfalfa.
  • the methods of the invention are more efficient than the known methods, because the plants of the invention have increased yield and/or tolerance to an environmental stress compared to control plants used in comparable methods.
  • the plant is a non-seed plant, such as algae and mosses.
  • algae refers to unicellular or multicellular eukaryotic organisms, formerly classified as plants, that are photosynthetic but lack true stems, roots, and leaves.
  • Algae that are particularly useful in the methods of the invention include all species and subspecies of the genus Selaginella, in particular the species Selaginella moellendorffii.
  • moss refers to nonvascular plants of the class Musci of the division Bryophyta.
  • Moss that are particularly useful in the methods of the invention include all species and subspecies of the genus Physcomitrella, in particular the species Physcomitrella patens.
  • the invention also includes host cells containing an isolated nucleic acid encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide, as defined herein.
  • host cells according to the invention are plant cells, yeasts, bacteria or fungi .
  • Host plants for the nucleic acids, construct, expression cassette or the vector used in the method according to the invention are, in pri nciple, advantageously all plants which are capable of synthesizi ng the polypeptides used in the inventive method.
  • the plant cells of the invention overexpress the nucleic acid molecule of the invention.
  • the invention also extends to harvestable parts of a plant such as, but not limited to seeds, leaves, fruits, flowers, stems, roots, rhizomes, tubers and bulbs, which harvestable parts comprise a recombinant nucleic acid encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide.
  • the invention furthermore relates to products derived or produced, preferably directly derived or produced, from a harvestable part of such a plant, such as dry pellets, meal or powders, oil, fat and fatty acids, starch or proteins.
  • the invention also includes methods for manufacturing a product comprising a) growing the plants of the invention and b) producing said product from or by the plants of the invention or parts thereof, including seeds.
  • the methods comprise the steps of a) growing the plants of the invention, b) removing the harvestable parts as described herein from the plants and c) producing said product from, or with the harvestable parts of plants according to the invention. Examples of such methods would be growing corn plants of the invention, harvesting the corn cobs and remove the kernels. These may be used as feedstuff or processed to starch and oil as agricultural products.
  • the product may be produced at the site where the plant has been grown, or the plants or parts thereof may be removed from the site where the plants have been grown to produce the product.
  • the plant is grown, the desired harvestable parts are removed from the plant, if feasible in repeated cycles, and the product made from the harvestable parts of the plant.
  • the step of growing the plant may be performed only once each time the methods of the invention is performed, while allowing repeated times the steps of product production e.g. by repeated removal of harvestable parts of the plants of the invention and if necessary further processing of these parts to arrive at the product. It is also possible that the step of growing the plants of the invention is repeated and plants or harvestable parts are stored until the production of the product is then performed once for the accumulated plants or plant parts. Also, the steps of growing the plants and producing the product may be performed with an overlap in time, even simultaneously to a large extend, or sequentially.
  • the plants are grown for some time before the product is produced.
  • the products produced by the methods of the invention are plant products such as, but not limited to, a foodstuff, feedstuff, a food supplement, feed supplement, fiber, cosmetic or pharmaceutical.
  • Foodstuffs are regarded as compositions used for nutrition or for supplementing nutrition.
  • Animal feedstuffs and animal feed supplements, in particular, are regarded as foodstuffs.
  • the methods for production are used to make agricultural products such as, but not limited to, plant extracts, proteins, amino acids, carbohydrates, fats, oils, polymers, vitamins, and the like. It is possible that a plant product consists of one ore more agricultural products to a large extent.
  • the polynucleotides or the polypeptides of the invention are comprised in an agricultural product.
  • the nucleic acid sequences and protein sequences of the invention may be used as product markers, for example where an agricultural product was produced by the methods of the invention.
  • Such a marker can be used to identify a product to have been produced by an advantageous process resulting not only in a greater efficiency of the process but also improved quality of the product due to increased quality of the plant material and harvestable parts used in the process.
  • markers can be detected by a variety of methods known in the art, for example but not limited to PCR based methods for nucleic acid detection or antibody based methods for protein detection.
  • the present invention also encompasses use of nucleic acids encoding POI polypeptides as described herein and use of these CYP704-like polypeptides, or DUF1218 polypeptides, or translin-like polypeptides, or ERG28-like polypeptides, in enhancing any of the aforementioned yield-related traits in plants.
  • nucleic acids encoding CYP704- like polypeptide, or DUF1218 polypeptide, or translin-like polypeptide, or ERG28-like polypeptide, described herein, or the CYP704-like polypeptides, or DUF1218 polypeptides, or translin-like polypeptides, or ERG28-like polypeptides, themselves, may find use in breeding programmes in which a DNA marker is identified which may be genetically linked to a gene encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide.
  • nucleic acids/genes or the CYP704-like polypeptides, or DUF 121 8 polypeptides, or translin-like polypeptides, or ERG28-like polypeptides, themselves may be used to define a molecular marker.
  • This DNA or protein marker may then be used in breeding programmes to select plants having enhanced yield- related traits as defined herein in the methods of the invention.
  • allelic variants of anucleic acid/gene encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide may find use in marker-assisted breeding programmes.
  • Nucleic acids encoding CYP704-like polypeptides, or DUF121 8 polypeptides, or translin-like polypeptides, or ERG28-like polypeptides may also be used as probes for genetically and physically mapping the genes that they are a part of, and as markers for traits linked to those genes. Such information may be useful in plant breeding in order to develop lines with desired phenotypes.
  • any comparison to determine sequence identity percentages is performed
  • a sequence identity of 50% sequence identity in this embodiment means that over the entire coding region of SEQ ID NO: 190, 50 percent of all bases are identical between the sequence of SEQ ID NO: 190 and the related sequence.
  • a polypeptide sequence is 50 % identical to the polypeptide sequence of SEQ ID NO: 191 , when 50 percent of the amino acids residues of the sequence as represented in SEQ ID NO: 191 , are found in the polypeptide tested when comparing from the starting methionine to the end of the sequence of SEQ ID NO: 2.
  • the present invention relates to the following specific items:
  • a method for enhancing yield-related traits in plants relative to control plants comprising modulating expression in a plant of a nucleic acid encoding a CYP704-like polypeptide, wherein said CYP704-like polypeptide comprises a PF450 domain and the MGRMXXXWGXXXXXXXPERW (SEQ ID NO: 72) signature sequence.
  • CYP704-like polypeptide comprises one or more of the following motifs:
  • nucleic acid encoding a CYP704-like polypeptide is of plant origin, preferably from a dicotyledonous or a monocotyledonous plant.
  • nucleic acid encoding a CYP704-like encodes any one of the polypeptides listed in Table A1 or is a portion of such a nucleic acid, or a nucleic acid capable of hybridising with such a nucleic acid.
  • nucleic acid sequence encodes an orthologue or paralogue of any of the polypeptides given in Table A1 .
  • nucleic acid is operably linked to a constitutive promoter, preferably to a medium strength constitutive promoter, preferably to a plant promoter, more preferably to a GOS2 promoter, most preferably to a GOS2 promoter from rice.
  • Plant, plant part thereof, including seeds, or plant cell obtainable by a method according to any one of items 1 to 10, wherein said plant, plant part or plant cell comprises a recombinant nucleic acid encoding a CYP704-like polypeptide as defined in any of items 1 and 5 to 9.
  • one of said control sequences is a constitutive promoter, preferably a medium strength constitutive promoter, preferably to a plant promoter, more preferably a GOS2 promoter, most preferably a GOS2 promoter from rice.
  • Transgenic plant having enhanced yield-related traits relative to control plants, preferably increased yield relative to control plants, and more preferably increased seed yield, resulting from modulated expression of a nucleic acid encoding a CYP704- like polypeptide as defined in any of items 1 and 5 to 9 or a transgenic plant cell derived from said transgenic plant.
  • Transgenic plant according to item 1 1 , 15 or 17, or a transgenic plant cell derived therefrom wherein said plant is a crop plant, such as beet, sugarbeet or alfalfa; or a monocotyledonous plant such as sugarcane; or a cereal, such as rice, maize, wheat, barley, millet, rye, triticale, sorghum, emmer, spelt, einkorn, teff, milo or oats.
  • a crop plant such as beet, sugarbeet or alfalfa
  • a monocotyledonous plant such as sugarcane
  • a cereal such as rice, maize, wheat, barley, millet, rye, triticale, sorghum, emmer, spelt, einkorn, teff, milo or oats.
  • nucleic acid encoding a CYP704-like polypeptide as defined in any of items 1 and 5 to 9 for enhancing yield-related traits in plants relative to control plants, preferably for increasing yield, and more preferably for increasing seed yield in plants relative to control plants.
  • the present invention relates to the following specific embodiments:
  • a method for the production of a transgenic plant having enhanced seed yield relative to a control plant comprising the steps of:
  • a nucleic acid encoding a CYP704-like polypeptide, wherein said nucleic acid is operably linked to a constitutive plant promoter, a nd wherei n said CYP704-like polypeptide comprises the polypeptide represented by one of: SEQ ID NO: 2, SEQ ID NO: 4 or a homologue thereof which has at least 90% overall sequence identity to SEQ ID NO: 2, SEQ ID NO: 4 or a homologue thereof which has at least 90% overall sequence identity to SEQ ID NO: 2, SEQ ID NO: 4 or a homologue thereof which has at least 90% overall sequence identity to SEQ
  • said increased seed yield comprises at least one parameter selected from the group comprising increased total seed weight, increased harvest index, and increased fill rate.
  • Method according to embodiment 1 or 2 wherein said i ncrease in seed yield comprises an in-crease of at least 5 % in said plant when compared to control plants for each of said parameters.
  • nucleic acid sequence of (i) (i) nucleic acid encoding a CYP704-like polypeptide as defined in embodiment 1 ; (ii) one or more control sequences capable of driving expression of the nucleic acid sequence of (i); and optionally
  • Transgenic plant having enhanced seed yield as defined in embodiment 2 or 3 relative to control plants, resulting from introduction and expression of a nucleic acid encoding a CYP704-like polypeptide as defined in embodiment 1 in said plant, or a transgenic plant cell derived from said transgenic plant.
  • nucleic acid encoding a CYP704-like polypeptide as defined in embodiment 1 for enhancing seed yield as defined in embodiment 2 or 3 in a transgenic plant relative to a control plant.
  • the present invention relates to the following specific embodiments:
  • a method for enhancing yield-related traits in plants relative to control plants comprising modulating expression in a plant of a nucleic acid encoding a DUF1218 polypeptide, wherein said DUF1218 polypeptide comprises a DUF1218 domain.
  • Method according to embodiment 1 or 2 wherein said enhanced yield-related traits comprises increased yield relative to control plants, and preferably comprises increased seed yield and/increase biomass relative to control plants.
  • DUF1218 polypeptide further comprises one or more of the following motifs:
  • Motif 13 CCKRHPVPSDTNWSVALISFIVSW[VC]TFIIAFLLLLTGAALNDQRG[E Q]ENMY (SEQ ID NO: 183),
  • nucleic acid en cod i n g a D U F 1 21 8 po ly pepti d e i s of pl a n t o ri g i n , prefera b ly fro m a monocotyledonous plant, further preferably from the family Poaceae, more preferably from the genus Oryza, most preferably the nucleic acid is from Oryza sativa.
  • nucleic acid encoding a DUF1218 polypeptide encodes any one of the polypeptides listed in Table A2 or is a portion of such a nucleic acid, or a nucleic acid capable of hybridising with such a nucleic acid.
  • nucleic acid encodes the polypeptide represented by SEQ ID NO: 2 or a homologue thereof.
  • nucleic acid is operably linked to a constitutive promoter, preferably to a medium strength constitutive promoter, preferably to a plant promoter, more preferably to a GOS2 promoter, most preferably to a GOS2 promoter from rice.
  • Plant, plant part thereof, including seeds, or plant cell obtainable by a method according to any one of embodiments 1 to 15, wherein said plant, plant part or plant cell comprises a recombinant nucleic acid encoding a DUF1218 polypeptide as defined in any of embodiments 1 and 7 to 14.
  • Construct comprising: (i) nucleic acid encoding a DUF1218 polypeptide as defined in any of embodiments 1 and 7 to 14;
  • one of said control sequences is a constitutive promoter, preferably a medium strength constitutive promoter, preferably to a plant promoter, more preferably a GOS2 promoter, most preferably a GOS2 promoter from rice.
  • Transgenic plant having enhanced yield-related traits relative to control plants, preferably increased yield relative to control plants, and more preferably increased seed yield, resu lting from modulated expression of a nucleic acid encoding a
  • DUF1218 polypeptide as defined in any of embodiments 1 and 7 to 14 or a transgenic plant cell derived from said transgenic plant.
  • Transgenic plant according to embodiment 16, 20 or 22, or a transgenic plant cell derived therefrom, wherein said plant is a crop plant, such as beet, sugarbeet or alfalfa; or a monocotyledonous plant such as sugarcane; or a cereal, such as rice, maize, wheat, barley, millet, rye, triticale, sorghum, emmer, spelt, secale, einkorn, teff, milo or oats.
  • a crop plant such as beet, sugarbeet or alfalfa
  • a monocotyledonous plant such as sugarcane
  • a cereal such as rice, maize, wheat, barley, millet, rye, triticale, sorghum, emmer, spelt, secale, einkorn, teff, milo or oats.
  • Isolated nucleic acid molecule selected from:
  • nucleic acid encoding a DUF1218 polypeptide having in increasing order of preference at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88% , 89% , 90% , 91 % , 92% , 93% , 94% , 95% , 96% , 97% , 98% , or 99% sequence identity to the amino acid sequence represented by any one of SEQ ID NO: 2 or 12, and additionally or alternatively comprising one or more motifs having in increasing order of preference at least 50%, 55%, 60%, 65%, 70%, 75%, 80%,
  • nucleic acid molecule which hybridizes with a nucleic acid molecule of (i) to (iii) under high stringency hybridization conditions and preferably confers enhanced yield-related traits relative to control plants.
  • Isolated polypeptide selected from:
  • an amino acid sequence having, in increasing order of preference, at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the amino acid sequence represented by SEQ ID NO: 2 or 12, and additionally or alternatively comprising one or more motifs having in increasing order of preference at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any one or
  • nucleic acid encoding a DUF1218 polypeptide as defined in any of embodiments 1 and 7 to 14 and 27 for enhancing yield-related traits in plants relative to control plants, preferably for increasing yield, and more preferably for increasing seed yield in plants relative to control plants.
  • nucleic acid as defi ned in embodi ment 26 and encoding a DU F 1 21 8 polypeptide for enhancing yield-related traits in plants relative to control plants, preferably for increasing yield, and more preferably for increasing seed yield in plants relative to control plants.
  • nucleic acid encoding a DU F 1218 polypeptide as defi ned i n any of embodiments 1 and 7 to 14 and 27 as molecular marker.
  • nucleic acid s defi ned i n embodiment 26 and encod ing a DU F 1218 polypeptide as defined in any of embodiments 1 and 7 to 14 and 27 as molecular marker.
  • the present invention relates to the following specific embodiments:
  • a method for enhancing yield-related traits in plants relative to control plants comprising modulating expression in a plant of a nucleic acid encoding a translin-like polypeptide, wherein said translin-like polypeptide comprises the signature sequence
  • GTDFWKLRR (SEQ I D NO: 56) and preferably comprises an InterPro accession IPR002848 corresponding to PFAM accession number PF01997 translin domain.
  • translin-like polypeptide comprises one or more of the following motifs:
  • nucleic acid encoding a translin-like polypeptide is of plant origin, preferably from a dicotyledonous plant, further preferably from the family Salicaceae, more preferably from the genus Populus, most preferably from Populus trichocarpa.
  • nucleic acid encoding a translin-like polypeptide encodes any one of the polypeptides listed in Table A3 or is a portion of such a nucleic acid, or a nucleic acid capable of hybridising with such a nucleic acid.
  • nucleic acid sequence encodes an orthologue or paralogue of any of the polypeptides given in Table A3.
  • nucleic acid is operably linked to a constitutive promoter, preferably to a medium strength constitutive promoter, preferably to a plant promoter, more preferably to a GOS2 promoter, most preferably to a GOS2 promoter from rice.
  • Plant, plant part thereof, including seeds, or plant cell obtainable by a method according to any one of embodiments 1 to 10, wherein said plant, plant part or plant cell comprises a recombinant nucleic acid encoding a translin-like polypeptide as defined in any of embodiments 1 and 5 to 9.
  • nucl eic acid encod ing a translin-like polypeptide as defined in any of embodiments 1 and 5 to 9;
  • one of said control sequences is a constitutive promoter, preferably a medium strength constitutive promoter, preferably to a plant promoter, more preferably a GOS2 promoter, most preferably a GOS2 promoter from rice.
  • a construct according to embodiment 12 or 13 in a method for making plants having enhanced yield-related traits, preferably increased yield relative to control plants, and more preferably increased seed yield and/or increased biomass relative to control plants.
  • Transgenic plant having enhanced yield-related traits relative to control plants, preferably increased yield relative to control plants, and more preferably increased seed yield and/or increased biomass, resulting from modulated expression of a nucleic acid encoding a translin-like polypeptide as defined in any of embodiments 1 and 5 to 9 or a transgenic plant cell derived from said transgenic plant.
  • Transgenic plant according to embodiment 1 1 , 15 or 17, or a transgenic plant cell derived therefrom, wherein said plant is a crop plant, such as beet, sugarbeet or alfalfa; or a monocotyledonous plant such as sugarcane; or a cereal, such as rice, maize, wheat, barley, millet, rye, triticale, sorghum, emmer, spelt, secale, einkorn, teff, milo or oats.
  • a crop plant such as beet, sugarbeet or alfalfa
  • a monocotyledonous plant such as sugarcane
  • a cereal such as rice, maize, wheat, barley, millet, rye, triticale, sorghum, emmer, spelt, secale, einkorn, teff, milo or oats.
  • nucleic acid encod ing a translin-like polypeptide as defined in any of embodiments 1 and 5 to 9 for enhancing yield-related traits in plants relative to control plants, preferably for increasing yield, and more preferably for increasing seed yield and/or for increasing biomass in plants relative to control plants.
  • a method for the production of a product comprising the steps of growing the plants of the invention and producing said product from or by
  • a dicot such as sugar beet, alfalfa, trefoil, chicory, carrot, cassava, cotton, soybean, canola
  • a monocot such as sugarcane
  • a cereal such as rice, maize, wheat, barley, millet, rye, triticale, sorghum emmer, spelt,
  • Construct according to embodiment 12 or 13 comprised in a plant cell.
  • Recombinant chromosomal DNA comprising the construct according to embodiment 12 or 13.
  • the present invention relates to the following specific embodiments:
  • a method for enhancing yield-related traits, and/or for modifying sterol and/or steroid composition, and/or for increasing or decreasing sterol and/or steroid levels in plants relative to control plants comprising modulating expression in a plant of a nucleic acid encoding an ERG28-like polypeptide, wherein said ERG28-like polypeptide comprises a Pfam PF03694 domain and preferably also the signature sequence WTLL[TS]CTL.
  • nucleic acid encoding an ERG28-like is from yeast or of plant origin, preferably from a dicotyledonous plant, further preferably from the family Brassicaceae or Solonaceae, more preferably from the genus Arabidopsis or Solanum , most preferably from Arabidopsis thaliana or from Solanum lycopersicum.
  • nucleic acid encoding an ERG28-like encodes any one of the polypeptides listed in Table A4 or is a portion of such a nucleic acid, or a nucleic acid capable of hybridising with such a nucleic acid.
  • nucleic acid is operably linked to a constitutive promoter such as the CaMV35S promoter, preferably to a medium strength constitutive promoter, preferably to a plant promoter, more preferably to a GOS2 promoter, most preferably to a GOS2 promoter from rice.
  • a constitutive promoter such as the CaMV35S promoter, preferably to a medium strength constitutive promoter, preferably to a plant promoter, more preferably to a GOS2 promoter, most preferably to a GOS2 promoter from rice.
  • Plant, plant part thereof, including seeds, or plant cell obtainable by a method according to any one of embodiments 1 to 1 1 , wherein said plant, plant part or plant cell comprises a recombinant nucleic acid encoding an ERG28-like polypeptide as defined in any of embodiments 1 and 6 to 10.
  • nucleic acid encoding an ERG28-like as defined in any of embodiments 1 and 6 to 10;
  • one of said control sequences is a constitutive promoter, preferably a medium strength constitutive promoter, preferably to a plant promoter, more preferably a GOS2 promoter, most preferably a GOS2 promoter from rice. 16.
  • a construct according to embodiment 13 or 14 in a method for making plants having enhanced yield-related traits, and/or modified steroid composition, and/or increased steroid levels, relative to control plants.
  • Method for the production of a transgenic plant having enhanced yield-related traits, and/or modified steroid composition, and/or increased or decreased steroid levels, relative to control plants comprising:
  • Transgenic plant having enhanced yield-related traits, and/or modified steroid composition, and/or increased or decreased steroid levels, relative to control plants, resulting from modulated expression of a nucleic acid encoding an ERG28-like polypeptide as defined in any of embodiments 1 and 6 to 10 or a transgenic plant cell derived from said transgenic plant.
  • Transgenic plant according to embodiment 12, 16 or 18, or a transgenic plant cell derived therefrom wherein said plant is a crop plant, such as soybean, canola, cotton, beet, sugarbeet or alfalfa; or a monocotyledonous plant such as sugarcane; or a cereal, such as rice, maize, wheat, barley, millet, rye, triticale, sorghum, emmer, spelt, einkorn, teff, milo or oats.
  • a crop plant such as soybean, canola, cotton, beet, sugarbeet or alfalfa
  • a monocotyledonous plant such as sugarcane
  • a cereal such as rice, maize, wheat, barley, millet, rye, triticale, sorghum, emmer, spelt, einkorn, teff, milo or oats.
  • nucleic acid encoding an ERG28-like polypeptide as defined in any of embodiments 1 and 6 to 10 for enhancing yield-related traits, and/or modifying steroid composition, and/or increasing steroid levels in plants relative to control plants.
  • peptides amino acids in a polymeric form of any length, linked together by peptide bonds, unless mentioned herein otherwise.
  • nucleic acid sequence(s) refers to nucleotides, either ribonucleotides or deoxyribonucleotides or a combination of both, in a polymeric unbranched form of any length.
  • Homologue(s) refers to nucleotides, either ribonucleotides or deoxyribonucleotides or a combination of both, in a polymeric unbranched form of any length.
  • Homologues of a protein encompass peptides, oligopeptides, polypeptides, proteins and enzymes having amino acid substitutions, deletions and/or insertions relative to the unmodified protein in question and having similar biological and functional activity as the unmodified protein from which they are derived.
  • Orthologues and paralogues are two different forms of homologues and encompass evolutionary concepts used to describe the ancestral relationships of genes.
  • Paralogues are genes within the same species that have originated through duplication of an ancestral gene; orthologues are genes from different organisms that have originated th rough speciation, and are also derived from a common ancestral gene.
  • a “deletion” refers to removal of one or more amino acids from a protein.
  • Insertions refers to one or more amino acid residues being i ntrod uced into a predetermined site in a protein. Insertions may comprise N-terminal and/or C-terminal fusions as well as intra-sequence insertions of single or multiple amino acids. Generally, insertions within the amino acid sequence will be smaller than N- or C-terminal fusions, of the order of about 1 to 1 0 residues.
  • N- or C-terminal fusion proteins or peptides include the binding domain or activation domain of a transcriptional activator as used in the yeast two-hybrid system, phage coat proteins, (histidine)-6-tag, glutathione S- transferase-tag, protein A, maltose-binding protein, dihydrofolate reductase, Tag*100 epitope, c-myc epitope, FLAG ® -epitope, lacZ, CMP (calmodulin-binding peptide), HA epitope, protein C epitope and VSV epitope.
  • a transcriptional activator as used in the yeast two-hybrid system
  • phage coat proteins phage coat proteins
  • glutathione S- transferase-tag glutathione S- transferase-tag
  • protein A maltose-binding protein
  • dihydrofolate reductase Tag*100 epitope
  • c-myc epitope FL
  • substitution refers to replacement of amino acids of the protein with other amino acids having similar properties (such as similar hydrophobicity, hydrophilicity, antigenicity, propensity to form or break a-helical structures or ⁇ -sheet structures).
  • Amino acid substitutions are typically of single residues, but may be clustered depending upon functional constraints placed upon the polypeptide and may range from 1 to 10 amino acids.
  • the amino acid substitutions are preferably conservative amino acid substitutions. Conservative substitution tables are well known in the art (see for example Creighton (1984) Proteins. W.H. Freeman and Company (Eds) and Table 1 below).
  • Amino acid substitutions, deletions and/or insertions may readily be made using peptide synthetic techniques known in the art, such as solid phase peptide synthesis and the like, or by recombinant DNA manipulation. Methods for the manipulation of DNA sequences to produce substitution, insertion or deletion variants of a protein are well known in the art.
  • “Derivatives” include peptides, oligopeptides, polypeptides which may, compared to the amino acid sequence of the naturally-occurring form of the protein, such as the protein of interest, comprise substitutions of amino acids with non-naturally occurring amino acid residues, or additions of non-naturally occurring amino acid residues.
  • “Derivatives” of a protein also encompass peptides, oligopeptides, polypeptides which comprise naturally occurring altered (glycosylated, acylated , prenylated, phosphorylated , myristoylated , sulphated etc.) or non-naturally altered amino acid residues compared to the amino acid sequence of a naturally-occurring form of the polypeptide.
  • a derivative may also comprise on e or more non-amino acid substituents or additions compared to the amino acid sequence from which it is derived, for example a reporter molecule or other ligand, covalently or non-covalently bound to the amino acid sequence, such as a reporter molecule which is bound to facilitate its detection, and non-naturally occurring amino acid residues relative to the amino acid sequence of a naturally-occurring protein.
  • reporter molecule or other ligand covalently or non-covalently bound to the amino acid sequence, such as a reporter molecule which is bound to facilitate its detection, and non-naturally occurring amino acid residues relative to the amino acid sequence of a naturally-occurring protein.
  • derivatives also include fusions of the naturally-occurring form of the protein with tagging peptides such as FLAG, HIS6 or thioredoxin (for a review of tagging peptides, see Terpe, Appl. Microbiol. Biotechnol. 60, 523-533, 2003
  • domain refers to a set of amino acids conserved at specific positions along an alignment of sequences of evolutionarily related proteins. While amino acids at other positions can vary between homologues, amino acids that are highly conserved at specific positions indicate amino acids that are likely essential in the structure, stability or function of a protein. Identified by their high degree of conservation in aligned sequences of a family of protein homologues, they can be used as identifiers to determine if any polypeptide in question belongs to a previously identified polypeptide family.
  • motif or "consensus sequence” or “signature” refers to a short conserved region in the sequence of evolutionarily related proteins. Motifs are frequently highly conserved parts of domains, but may also include only part of the domain, or be located outside of conserved domain (if all of the amino acids of the motif fall outside of a defined domain).
  • Domains or motifs may also be identified using routine techniques, such as by sequence alignment. Methods for the alignment of sequences for comparison are well known in the art, such methods include GAP, BESTFIT, BLAST, FASTA and TFASTA. GAP uses the algorithm of Needleman and Wunsch ((1970) J Mol Biol 48: 443-453) to find the global (i.e. spanning the complete sequences) alignment of two sequences that maximizes the number of matches and minimizes the number of gaps. The BLAST algorithm (Altschul et al. (1990) J Mol Biol 215: 403-10 calculates percent sequence identity and performs a statistical analysis of the similarity between the two sequences.
  • the software for performing BLAST analysis is publicly available through the National Centre for Biotechnology Information (NCBI). Homologues may readily be identified using, for example, the ClustalW multiple sequence alignment algorithm (version 1 .83), with the default pairwise alignment parameters, and a scoring method in percentage. Global percentages of similarity and identity may also be determined using one of the methods available in the MatGAT software package (Campanella et al. , BMC Bioinformatics. 2003 Jul 10;4:29. MatGAT: an application that generates similarity/identity matrices using protein or DNA sequences.). Minor manual editing may be performed to optimise alignment between conserved motifs, as would be apparent to a person skilled in the art.
  • sequence identity values may be determined over the entire nucleic acid or amino acid sequence or over selected domains or conserved motif(s), using the programs mentioned above using the default parameters. For local alignments, the Smith-Waterman algorithm is particularly useful (Smith TF, Waterman MS (1981 ) J. Mol. Biol 147(1 );195-7). Reciprocal BLAST
  • BLASTN or TBLASTX (using standard default values) are general ly used when starting from a nucleotide sequence, and BLASTP or TBLASTN (using standard default values) when starting from a protein sequence.
  • the BLAST results may optionally be filtered.
  • the full-length sequences of either the filtered results or non-filtered results are then BLASTed back (second BLAST) against sequences from the organism from which the query sequence is derived.
  • the results of the first and second BLASTs are then compared.
  • a paralogue is identified if a high-ranking hit from the first blast is from the same species as from which the query sequence is derived, a BLAST back then ideally results in the query sequence amongst the highest hits; an orthologue is identified if a high-ranking hit in the first BLAST is not from the same species as from which the query sequence is derived, and preferably results upon BLAST back in the query sequence being among the highest hits.
  • High-ran ki ng hits are those havi ng a low E-value. The lower the E-value, the more significant the score (or in other words the lower the chance that the hit was found by chance). Computation of the E-value is well known in the art. In addition to E-values, comparisons are also scored by percentage identity. Percentage identity refers to the number of identical nucleotides (or amino acids) between the two compared nucleic acid (or polypeptide) sequences over a particular length. In the case of large families, ClustalW may be used, followed by a neighbour joining tree, to help visualize clustering of related genes and to identify orthologues and paralogues. Hybridisation
  • hybridisation is a process wherein substantially homologous complementary nucleotide sequences anneal to each other.
  • the hybridisation process can occur entirely in solution, i.e. both complementary nucleic acids are in solution.
  • the hybridisation process can also occur with one of the complementary nucleic acids immobilised to a matrix such as magnetic beads, Sepharose beads or any other resin.
  • the hybridisation process can furthermore occur with one of the complementary nucleic acids immobilised to a solid support such as a nitro-cellulose or nylon membrane or immobilised by e.g. photolithography to, for example, a siliceous glass support (the latter known as nucleic acid arrays or microarrays or as nucleic acid chips).
  • the nucleic acid molecules are generally thermally or chemically denatured to melt a double strand into two single strands and/or to remove hairpi ns or other secondary structures from single stranded nucleic acids.
  • stringency refers to the conditions under which a hybridisation takes place.
  • the stri ngency of hybridisation is i nfl uenced by cond itions such as temperatu re, salt concentration, ionic strength and hybridisation buffer composition.
  • low stringency conditions are selected to be about 30°C lower than the thermal melting point (T m ) for the specific sequence at a defined ionic strength and pH.
  • Medium stringency conditions are when the temperature is 20°C below T m
  • high stringency conditions are when the temperature is 10°C below T m .
  • High stringency hybridisation conditions are typically used for isolating hybridising sequences that have high sequence similarity to the target nucleic acid seq uence.
  • Tm is the temperature under defined ionic strength and pH, at which 50% of the target sequence hybridises to a perfectly matched probe.
  • the T m is dependent upon the solution conditions and the base composition and length of the probe. For example, longer sequences hybridise specifically at higher temperatures.
  • the maximum rate of hybridisation is obtained from about 16°C up to 32°C below T m .
  • Formamide reduces the melting temperature of DNA-DNA and DNA-RNA duplexes with 0.6 to 0.7°C for each percent formamide, and addition of 50% formamide allows hybridisation to be performed at 30 to 45°C, though the rate of hybridisation will be lowered.
  • Base pair mismatches reduce the hybridisation rate and the thermal stability of the duplexes.
  • the Tm decreases about 1 °C per % base mismatch. The T m may be calculated using the following equations, depending on the types of hybrids:
  • T m 81 .5°C + 16.6xlogio[Na + ] a + 0.41x%[G/C b ] - 500x[L c ]- 1 - 0.61 x% formamide
  • T m 22 + 1 .46 (l n )
  • c L length of duplex in base pairs.
  • Non-specific binding may be controlled using any one of a number of known techniques such as, for example, blocking the membrane with protein containing solutions, additions of heterologous RNA, DNA, and SDS to the hybridisation buffer, and treatment with Rnase.
  • a series of hybridizations may be performed by varying one of (i) progressively lowering the annealing temperature (for example from 68°C to 42°C) or (ii) progressively lowering the formamide concentration (for example from 50% to 0%) .
  • annealing temperature for example from 68°C to 42°C
  • formamide concentration for example from 50% to 0%
  • hybridisation typically also depends on the fu nction of post-hybridisation washes.
  • samples are washed with dilute salt solutions.
  • Critical factors of such washes include the ionic strength and temperature of the final wash solution: the lower the salt concentration and the higher the wash temperature, the higher the stringency of the wash .
  • Wash conditions are typical ly performed at or below hybridisation stringency. A positive hybridi sation gives a signal that is at least twice of that of the backgrou nd .
  • suitable stringent conditions for nucleic acid hybridisation assays or gene amplification detection procedures are as set forth above. More or less stringent conditions may also be selected . The skilled artisan is aware of various parameters which may be altered during washing and which will either maintain or change the stringency conditions.
  • typical high stringency hybridisation conditions for DNA hybrids longer than 50 nucleotides encompass hybridisation at 65°C in 1 x SSC or at 42°C in 1 x SSC and 50% formamide, followed by washing at 65°C in 0.3x SSC.
  • Examples of medium stringency hybridisation conditions for DNA hybrids longer than 50 nucleotides encompass hybridisation at 50°C in 4x SSC or at 40°C in 6x SSC and 50% formamide, followed by wash i ng at 50°C i n 2x SSC.
  • the length of the hybrid is the anticipated length for the hybridising nucleic acid. When nucleic acids of known sequence are hybridised, the hybrid length may be determined by aligning the sequences and identifying the conserved regions described herei n.
  • 1 xSSC is 0.15M NaCI and 1 5mM sodiu m citrate; the hybrid isation solution and wash solutions may additionally include 5x Denhardt's reagent, 0.5-1 .0% SDS, 100 ⁇ g/ml denatured, fragmented salmon sperm DNA, 0.5% sodium pyrophosphate.
  • 5x Denhardt's reagent 0.5-1 .0% SDS
  • 100 ⁇ g/ml denatured, fragmented salmon sperm DNA 0.5% sodium pyrophosphate.
  • splice variant encompasses variants of a nucleic acid sequence in which selected introns and/or exons have been excised, replaced, displaced or added, or in which introns have been shortened or lengthened. Such variants will be ones in which the biological activity of the protein is substantially retained; this may be achieved by selectively retaining functional segments of the protein. Such splice variants may be found in nature or may be manmade. Methods for predicting and isolating such splice variants are well known in the art (see for example Foissac and Schiex (2005) BMC Bioinformatics 6: 25). Allelic variant
  • Allelic variants are alternative forms of a given gene, located at the same chromosomal position. Allelic variants encompass Single Nucleotide Polymorphisms (SNPs), as well as Small Insertion/Deletion Polymorphisms (INDELs). The size of INDELs is usually less than 100 bp. SNPs and INDELs form the largest set of sequence variants in naturally occurring polymorphic strains of most organisms.
  • an "endogenous" gene not only refers to the gene in question as found in a plant in its natural form (i.e., without there being any human intervention), but also refers to that same gene (or a substantially homologous nucleic acid/gene) in an isolated form subsequently (re)introduced into a plant (a transgene).
  • a transgenic plant containing such a transgene may encounter a substantial reduction of the transgene expression and/or substantial reduction of expression of the endogenous gene.
  • the isolated gene may be isolated from an organism or may be manmade, for example by chemical synthesis.
  • Gene shuffling or “directed evolution” consists of iterations of DNA shuffling followed by appropriate screening and/or selection to generate variants of nucleic acids or portions thereof encoding proteins having a modified biological activity (Castle et al., (2004) Science 304(5674): 1 151 -4; US patents 5,81 1 ,238 and 6,395,547).
  • Artificial DNA (such as but, not limited to plasmids or viral DNA) capable of replication in a host cell and used for introduction of a DNA sequence of interest into a host cell or host organism.
  • Host cells of the invention may be any cell selected from bacterial cells, such as Escherichia coli or Agrobacterium species cells, yeast cells, fungal, algal or cyanobacterial cells or plant cells.
  • the skilled artisan is well aware of the genetic elements that must be present on the genetic construct in order to successfully transform, select and propagate host cells containing the sequence of interest.
  • the sequence of interest is operably linked to one or more control sequences (at least to a promoter) as described herein. Additional regulatory elements may include transcriptional as well as translational enhancers.
  • an intron sequence may also be added to the 5' untranslated region (UTR) or in the coding sequence to increase the amount of the mature message that accumulates in the cytosol, as described in the definitions section.
  • Other control sequences (besides promoter, enhancer, silencer, intron sequences, 3'UTR and/or 5'UTR regions) may be protein and/or RNA stabilizing elements. Such sequences would be known or may readily be obtained by a person skilled in the art.
  • the genetic constructs of the invention may further include an origin of replication sequence that is required for maintenance and/or replication in a specific cell type.
  • an origin of replication sequence that is required for maintenance and/or replication in a specific cell type.
  • Preferred origins of replication include, but are not limited to, the f 1 -ori and colEl
  • marker genes or reporter genes. Therefore, the genetic construct may optionally comprise a selectable marker gene. Selectable markers are described in more detail in the "definitions" section herein.
  • the marker genes may be removed or excised from the transgenic cell once they are no longer needed. Techniques for marker removal are known in the art, useful techniques are described above in the definitions section.
  • regulatory element control sequence
  • promoter typically refers to a nucleic acid control sequence located upstream from the transcriptional start of a gene and which is involved in recognising and binding of RNA polymerase and other proteins, thereby directing transcription of an operably linked nucleic acid.
  • transcriptional regulatory sequences derived from a classical eukaryotic genomic gene (including the TATA box which is required for accurate transcription i nitiation, with or without a CCAAT box sequence) and additional regulatory elements (i.e. upstream activating sequences, enhancers and silencers) which alter gene expression in response to developmental and/or external stimuli , or in a tissue-specific manner.
  • additional regulatory elements i.e. upstream activating sequences, enhancers and silencers
  • a transcriptional regulatory sequence of a classical prokaryotic gene in which case it may include a -35 box sequence and/or -10 box transcriptional regulatory sequences.
  • regulatory element also encompasses a synthetic fusion molecule or derivative that confers, activates or enhances expression of a nucleic acid molecule in a cell, tissue or organ.
  • a “plant promoter” comprises regulatory elements, which mediate the expression of a coding sequence segment in plant cells. Accordingly, a plant promoter need not be of plant origin, but may originate from viruses or micro-organisms, for example from viruses which attack plant cells. The "plant promoter” can also originate from a plant cell, e.g. from the plant which is transformed with the nucleic acid sequence to be expressed in the inventive process and described herein. This also applies to other “plant” regulatory signals, such as "plant” terminators.
  • the promoters upstream of the nucleotide sequences useful in the methods of the present invention can be modified by one or more nucleotide substitution(s), insertion(s) and/or deletion(s) without interfering with the functionality or activity of either the promoters, the open reading frame (ORF) or the 3'-regulatory region such as terminators or other 3' regulatory regions which are located away from the ORF. It is furthermore possible that the activity of the promoters is increased by modification of their sequence, or that they are replaced completely by more active promoters, even promoters from heterologous organisms.
  • the nucleic acid molecule must, as described above, be linked operably to or comprise a suitable promoter which expresses the gene at the right point in time and with the required spatial expression pattern.
  • the promoter strength and/or expression pattern of a candidate promoter may be analysed for example by operably linking the promoter to a reporter gene and assaying the expression level and pattern of the reporter gene in various tissues of the plant.
  • Suitable well-known reporter genes include for example beta-glucuronidase or beta-galactosidase.
  • the promoter activity is assayed by measuring the enzymatic activity of the beta-glucuronidase or beta-galactosidase.
  • the promoter strength and/or expression pattern may then be compared to that of a reference promoter (such as the one used in the methods of the present invention).
  • promoter strength may be assayed by quantifying mRNA levels or by comparing mRNA levels of the nucleic acid used in the methods of the present invention, with mRNA levels of housekeeping genes such as 18S rRNA, using methods known in the art, such as Northern blotting with densitometric analysis of autoradiograms, quantitative real-time PCR or RT- PCR (Heid et al., 1996 Genome Methods 6: 986-994).
  • weak promoter is intended a promoter that drives expression of a coding sequence at a low level.
  • low level is intended at levels of about 1/10,000 transcripts to about 1/100,000 transcripts, to about 1/500,0000 transcripts per cell.
  • a “strong promoter” drives expression of a coding sequence at high level, or at about 1/10 transcripts to about 1/100 transcripts to about 1/1000 transcripts per cell.
  • “medium strength promoter” is intended a promoter that drives expression of a coding sequence at a lower level than a strong promoter, in particular at a level that is in all instances below that obtained when under the control of a 35S CaMV promoter.
  • operably linked refers to a functional linkage between the promoter sequence and the gene of interest, such that the promoter sequence is able to initiate transcription of the gene of interest.
  • a "constitutive promoter” refers to a promoter that is transcriptionally active during most, but not necessarily all , phases of growth and development and under most environmental conditions, in at least one cel l , tissue or organ .
  • Table 2a gives examples of constitutive promoters.
  • Table 2a Examples of constitutive promoters
  • a "ubiquitous promoter” is active in substantially all tissues or cells of an organism. Developmentally-regulated promoter
  • a "developmentally-regulated promoter” is active during certain developmental stages or in parts of the plant that undergo developmental changes. Inducible promoter
  • inducible promoter has induced or increased transcription initiation in response to a chemical (for a review see Gatz 1997, Annu. Rev. Plant Physiol. Plant Mol. Biol. , 48:89- 108), environmental or physical stimulus, or may be "stress-inducible", i.e. activated when a plant is exposed to various stress conditions, or a “pathogen-inducible” i.e. activated when a plant is exposed to exposure to various pathogens.
  • organ-specific or tissue-specific promoter is one that is capable of preferentially initiating transcription in certain organs or tissues, such as the leaves, roots, seed tissue etc.
  • a "root-specific promoter” is a promoter that is transcriptionally active predominantly in plant roots, substantially to the exclusion of any other parts of a plant, whilst still allowing for any leaky expression in these other plant parts. Promoters able to initiate transcription in certain cells only are referred to herein as "cell-specific”.
  • root-specific promoters examples are listed in Table 2b below:
  • ALF5 (Arabidopsis) Diener et al. (2001 , Plant Cell 13:1625) NRT2;1 Np (N. plumbaginifolia) Quesada et al. (1997, Plant Mol. Biol. 34:265)
  • seed-specific promoter is transcriptionally active predominantly in seed tissue, but not necessarily exclusively in seed tissue (in cases of leaky expression).
  • the seed-specific promoter may be active during seed development and/or during germination.
  • the seed specific promoter may be endosperm/aleurone/embryo specific. Examples of seed-specific promoters (endosperm/aleurone/embryo specific) are shown in Table 2c to Table 2f below. Further examples of seed-specific promoters are given in Qing Qu and Takaiwa (Plant Biotechnol. J. 2, 1 13-125, 2004), which disclosure is incorporated by reference herein as if fully set forth.
  • a-amylase (Amy32b) Lanahan et al, Plant Cell 4:203-21 1 , 1992; Skriver et al,
  • green tissue-specific promoter as defined herein is a promoter that is transcriptionally active predominantly in green tissue, substantially to the exclusion of any other parts of a plant, whilst still allowing for any leaky expression in these other plant parts. Examples of green tissue-specific promoters which may be used to perform the methods of the invention are shown in Table 2g below.
  • tissue-specific promoter is a meristem-specific promoter, which is transcriptionally active predominantly in meristematic tissue, substantially to the exclusion of any other parts of a plant, whilst still allowing for any leaky expression in these other plant parts.
  • Examples of green meristem-specific promoters which may be used to perform the methods of the invention are shown in Table 2h below.
  • terminal encompasses a control sequence which is a DNA sequence at the end of a transcriptional unit which signals 3' processing and polyadenylation of a primary transcript and termination of transcription.
  • the terminator can be derived from the natural gene, from a variety of other plant genes, or from T-DNA.
  • the terminator to be added may be derived from, for example, the nopaline synthase or octopine synthase genes, or alternatively from another plant gene, or less preferably from any other eukaryotic gene.
  • “Selectable marker”, “selectable marker gene” or “reporter gene” includes any gene that confers a phenotype on a cell in which it is expressed to facilitate the identification and/or selection of cells that are transfected or transformed with a nucleic acid construct of the invention. These marker genes enable the identification of a successful transfer of the nucleic acid molecules via a series of different principles. Suitable markers may be selected from markers that confer antibiotic or herbicide resistance, that introduce a new metabolic trait or that allow visual selection.
  • selectable marker genes include genes conferring resistance to antibiotics (such as nptl l that phosphorylates neomycin and kanamycin, or hpt, phosphorylating hygromycin , or genes conferring resistance to, for example, bleomycin, streptomycin, tetracyclin, chloramphenicol, ampicillin, gentamycin, geneticin (G418), spectinomycin or blasticidin), to herbicides (for example bar which provides resistance to Basta ® ; aroA or gox providing resistance against glyphosate, or the genes conferri ng resistance to, for exampl e, i midazolinone, phosph inoth rici n or sulfonylurea), or genes that provide a metabolic trait (such as manA that allows plants to use mannose as sole carbon source or xylose isomerase for the utilisation of xylose, or antinutritive markers such as the resistance to 2-deoxygluco
  • Visual marker genes results in the formation of colour (for example ⁇ -glucuronidase, GUS or ⁇ - galactosidase with its coloured substrates, for example X-Gal), luminescence (such as the luciferin/luceferase system) or fluorescence (Green Fluorescent Protein, GFP, and derivatives thereof).
  • colour for example ⁇ -glucuronidase, GUS or ⁇ - galactosidase with its coloured substrates, for example X-Gal
  • luminescence such as the luciferin/luceferase system
  • fluorescence Green Fluorescent Protein
  • nucleic acid molecules encoding a selectable marker can be introduced into a host cell on the same vector that comprises the sequence encoding the polypeptides of the invention or used in the methods of the invention, or else in a separate vector. Cells which have been stably transfected with the introduced nucleic acid can be identified for example by selection (for example, cells which have integrated the selectable marker survive whereas the other cells die).
  • the process according to the invention for introducing the nucleic acids advantageously employs techniques which enable the removal or excision of these marker genes.
  • One such a method is what is known as co-transformation.
  • the co- transformation method employs two vectors simultaneously for the transformation, one vector bearing the nucleic acid according to the invention and a second bearing the marker gene(s).
  • a large proportion of transformants receives or, in the case of plants, comprises (up to 40% or more of the transformants), both vectors.
  • the transformants usually receive only a part of the vector, i.e.
  • the marker genes can subsequently be removed from the transformed plant by performing crosses.
  • marker genes integrated into a transposon are used for the transformation together with desired nucleic acid (known as the Ac/Ds technology).
  • the transformants can be crossed with a transposase source or the transformants are transformed with a nucleic acid construct conferring expression of a transposase, transiently or stable.
  • the transposon jumps out of the genome of the host cell once transformation has taken place successfully and is lost.
  • the transposon jumps to a different location. In these cases the marker gene must be eliminated by performing crosses.
  • Cre/lox system Cre1 is a recombinase that removes the sequences located between the loxP sequences. If the marker gene is integrated between the loxP sequences, it is removed once transformation has taken place successfully, by expression of the recombinase.
  • Cre1 is a recombinase that removes the sequences located between the loxP sequences. If the marker gene is integrated between the loxP sequences, it is removed once transformation has taken place successfully, by expression of the recombinase.
  • Further recombination systems are the HIN/HIX, FLP/FRT and REP/STB system (Tribble et al. , J. Biol.
  • transgenic means with regard to, for example, a nucleic acid sequence, an expression cassette, gene construct or a vector comprising the nucleic acid sequence or an organism transformed with the nucleic acid sequences, expression cassettes or vectors according to the invention, all those constructions brought about by recombinant methods in which either
  • genetic control sequence(s) which is operably linked with the nucleic acid sequence according to the invention, for example a promoter, or
  • the natural genetic environment is understood as meaning the natural genomic or chromosomal locus in the original plant or the presence in a genomic library.
  • the natural genetic environment of the nucleic acid sequence is preferably retained, at least in part.
  • the environment flanks the nucleic acid sequence at least on one side and has a sequence length of at least 50 bp, preferably at least 500 bp, especially preferably at least 1000 bp, most preferably at least 5000 bp.
  • transgenic plant for the purposes of the invention is thus understood as meaning, as above, that the nucleic acids used in the method of the invention are not present in, or originating from, the genome of said plant, or are present in the genome of said plant but not at their natural locus in the genome of said plant, it being possible for the nucleic acids to be expressed homologously or heterologously.
  • transgenic also means that, while the nucleic acids according to the invention or used in the inventive method are at their natural position in the genome of a plant, the sequence has been modified with regard to the natural sequence, and/or that the regulatory sequences of the natural sequences have been modified.
  • Transgenic is preferably understood as meaning the expression of the nucleic acids according to the invention at an unnatural locus in the genome, i.e. homologous or, preferably, heterologous expression of the nucleic acids takes place.
  • Preferred transgenic plants are mentioned herein.
  • the term "isolated nucleic acid” or “isolated polypeptide” may in some instances be considered as a synonym for a "recombinant nucleic acid” or a “recombinant polypeptide”, respectively and refers to a nucleic acid or polypeptide that is not located in its natural genetic environment and/or that has been modified by recombinant methods.
  • modulation means in relation to expression or gene expression, a process in which the expression level is changed by said gene expression in comparison to the control plant, the expression level may be increased or decreased.
  • the original, unmodulated expression may be of any kind of expression of a structural RNA (rRNA, tRNA) or mRNA with subsequent translation.
  • the original unmodulated expression may also be absence of any expression.
  • modulating the activity shall mean any change of the expression of the inventive nucleic acid sequences or encoded proteins, which leads to increased yield and/or increased growth of the plants.
  • the expression can increase from zero (absence of, or immeasurable expression) to a certain amount, or can decrease from a certain amount to immeasurable small amounts or zero.
  • expression means the transcription of a specific gene or specific genes or specific genetic construct.
  • expression in particular means the transcription of a gene or genes or genetic construct into structural RNA (rRNA, tRNA) or mRNA with or without subsequent translation of the latter into a protein. The process includes transcription of DNA and processing of the resulting mRNA product.
  • the term "increased expression” or "overexpression” as used herein means any form of expression that is additional to the original wild-type expression level.
  • the original wild-type expression level might also be zero, i.e. absence of expression or immeasurable expression.
  • Methods for increasing expression of genes or gene products are well documented in the art and include, for example, overexpression driven by appropriate promoters, the use of transcription enhancers or translation enhancers. Isolated nucleic acids which serve as promoter or enhancer elements may be introduced in an appropriate position (typically upstream) of a non-heterologous form of a polynucleotide so as to upregulate expression of a nucleic acid encoding the polypeptide of interest.
  • endogenous promoters may be altered in vivo by mutation, deletion, and/or substitution (see, Kmiec, US 5,565,350; Zarling et al., W09322443), or isolated promoters may be introduced into a plant cell in the proper orientation and distance from a gene of the present invention so as to control the expression of the gene.
  • polypeptide expression it is generally desirable to include a polyadenylation region at the 3'-end of a polynucleotide coding region.
  • the polyadenylation region can be derived from the natural gene, from a variety of other plant genes, or from T-DNA.
  • the 3' end sequence to be added may be derived from, for example, the nopaline synthase or octopine synthase genes, or alternatively from another plant gene, or less preferably from any other eukaryotic gene.
  • An intron sequence may also be added to the 5' untranslated region (UTR) or the coding sequence of the partial coding sequence to increase the amount of the mature message that accumulates in the cytosol.
  • UTR 5' untranslated region
  • coding sequence of the partial coding sequence to increase the amount of the mature message that accumulates in the cytosol.
  • Inclusion of a spliceable intron in the transcription unit in both plant and animal expression constructs has been shown to increase gene expression at both the mRNA and protein levels up to 1000-fold (Buchman and Berg (1988) Mol. Cell biol. 8: 4395-4405; Callis et al. (1987) Genes Dev 1 :1 183-1200).
  • Such intron enhancement of gene expression is typically greatest when placed near the 5' end of the transcription unit.
  • Reference herein to "decreased expression” or “reduction or substantial elimination” of expression is taken to mean a decrease in endogenous gene expression and/or polypeptide levels and/or polypeptide activity relative to control plants.
  • the reduction or substantial elimination is in increasing order of preference at least 10%, 20%, 30%, 40% or 50%, 60%, 70%, 80%, 85%, 90%, or 95%, 96%, 97%, 98%, 99% or more reduced compared to that of control plants.
  • substantially contiguous nucleotides of a nucleic acid sequence is required. In order to perform gene silencing, this may be as little as 20, 19, 18, 17, 16, 15, 14, 13, 12, 1 1 , 10 or fewer nucleotides, alternatively this may be as much as the entire gene (including the 5' and/or 3' UTR, either in part or in whole).
  • the stretch of substantially contiguous nucleotides may be derived from the nucleic acid encoding the protein of interest (target gene), or from any nucleic acid capable of encoding an orthologue, paralogue or homologue of the protein of interest.
  • the stretch of substantially contiguous nucleotides is capable of forming hydrogen bonds with the target gene (either sense or antisense strand), more preferably, the stretch of substantially contiguous nucleotides has, in increasing order of preference, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97% , 98% , 99% , 100% seq uence identity to the target gene (either sense or antisense strand).
  • a nucleic acid sequence encoding a (functional) polypeptide is not a requirement for the various methods discussed herein for the reduction or substantial elimination of expression of an endogenous gene.
  • a preferred method for the reduction or substantial elimination of endogenous gene expression is by introducing and expressing in a plant a genetic construct into which the nucleic acid (in this case a stretch of substantially contiguous nucleotides derived from the gene of interest, or from any nucleic acid capable of encoding an orthologue, paralogue or homologue of any one of the protein of interest) is cloned as an inverted repeat (in part or completely), separated by a spacer (non-coding DNA).
  • the nucleic acid in this case a stretch of substantially contiguous nucleotides derived from the gene of interest, or from any nucleic acid capable of encoding an orthologue, paralogue or homologue of any one of the protein of interest
  • expression of the endogenous gene is reduced or substantially eliminated through RNA-mediated silencing using an inverted repeat of a nucleic acid or a part thereof (in this case a stretch of substantially contiguous nucleotides derived from the gene of interest, or from any nucleic acid capable of encoding an orthologue, paralogue or homologue of the protein of interest), preferably capable of forming a hairpin structure.
  • the inverted repeat is cloned in an expression vector comprising control sequences.
  • a non- coding DNA nucleic acid sequence (a spacer, for example a matrix attachment region fragment (MAR), an intron, a polylinker, etc.) is located between the two inverted nucleic acids forming the inverted repeat.
  • MAR matrix attachment region fragment
  • a chimeric RNA with a self-complementary structure is formed (partial or complete).
  • This double-stranded RNA structure is referred to as the hairpin RNA (hpRNA).
  • the hpRNA is processed by the plant into siRNAs that are incorporated into an RNA-induced silencing complex (RISC).
  • RISC RNA-induced silencing complex
  • the RISC further cleaves the mRNA transcripts, thereby substantially reducing the number of mRNA transcripts to be translated into polypeptides.
  • RISC RNA-induced silencing complex
  • Performance of the methods of the invention does not rely on introducing and expressing in a plant a genetic construct into which the nucleic acid is cloned as an inverted repeat, but any one or more of several well-known "gene silencing" methods may be used to achieve the same effects.
  • RNA-mediated silencing of gene expression is triggered in a plant by a double stranded RNA sequence (dsRNA) that is substantially similar to the target endogenous gene.
  • dsRNA double stranded RNA sequence
  • This dsRNA is further processed by the plant into about 20 to about 26 nucleotides called short interfering RNAs (siRNAs).
  • the siRNAs are incorporated into an RNA-induced silencing complex (RISC) that cleaves the mRNA transcript of the endogenous target gene, thereby substantially reducing the number of mRNA transcripts to be tran slated i nto a polypeptide.
  • RISC RNA-induced silencing complex
  • the double stranded RNA sequence corresponds to a target gene.
  • RNA silencing method involves the introduction of nucleic acid sequences or parts thereof (in this case a stretch of substantially contiguous nucleotides derived from the gene of interest, or from any nucleic acid capable of encoding an orthologue, paralogue or homologue of the protein of interest) in a sense orientation into a plant.
  • Sense orientation refers to a DNA sequence that is homologous to an mRNA transcript thereof. Introduced into a plant would therefore be at least one copy of the nucleic acid sequence.
  • the additional nucleic acid sequence wi ll reduce expression of the endogenous gene, giving rise to a phenomenon known as co-suppression. The reduction of gene expression will be more pronounced if several additional copies of a nucleic acid sequence are introduced into the plant, as there is a positive correlation between high transcript levels and the triggering of co-suppression.
  • RNA silencing method involves the use of antisense nucleic acid sequences.
  • An "antisense" nucleic acid sequence comprises a nucleotide sequence that is complementary to a "sense" nucleic acid sequence encoding a protein, i.e. complementary to the coding strand of a double-stranded cDNA molecule or complementary to an mRNA transcript sequence.
  • the antisense nucleic acid sequence is preferably complementary to the endogenous gene to be silenced.
  • the complementarity may be located in the "coding region” and/or in the "non-coding region" of a gene.
  • the term “coding region” refers to a region of the nucleotide sequence comprising codons that are translated into amino acid residues.
  • non-coding region refers to 5' and 3' sequences that flank the coding region that are transcribed but not translated into amino acids (also referred to as 5' and 3' untranslated regions).
  • Antisense nucleic acid sequences can be designed according to the rules of Watson and Crick base pairing.
  • the antisense nucleic acid sequence may be complementary to the entire nucleic acid sequence (in this case a stretch of substantially contiguous nucleotides derived from the gene of interest, or from any nucleic acid capable of encoding an orthologue, paralogue or homologue of the protein of interest), but may also be an oligonucleotide that is antisense to only a part of the nucleic acid sequence (including the mRNA 5' and 3' UTR).
  • the antisense oligonucleotide sequence may be complementary to the region surrounding the translation start site of an mRNA transcript encoding a polypeptide.
  • an antisense nucleic acid sequence according to the invention may be constructed using chemical synthesis and enzymatic ligation reactions using methods known in the art.
  • an antisense nucleic acid sequence e.g., an antisense oligonucleotide sequence
  • an antisense nucleic acid sequence may be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acid sequences, e.g.
  • nucleotide modifications include methylation, cyclization and 'caps' and substitution of one or more of the naturally occurring nucleotides with an analogue such as inosine. Other modifications of nucleotides are well known in the art.
  • the antisense nucleic acid sequence can be produced biologically using an expression vector into which a nucleic acid sequence has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest).
  • an expression vector into which a nucleic acid sequence has been subcloned in an antisense orientation i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest.
  • production of antisense nucleic acid sequences in plants occurs by means of a stably integrated nucleic acid construct comprising a promoter, an operably linked antisense oligonucleotide, and a terminator.
  • the nucleic acid molecules used for silencing in the methods of the invention hybridize with or bind to mRNA transcripts and/or genomic DNA encoding a polypeptide to thereby inhibit expression of the protein, e.g., by inhibiting transcription and/or translation.
  • the hybridization can be by conventional nucleotide complementarity to form a stable duplex, or, for example, in the case of an antisense nucleic acid sequence which binds to DNA duplexes, through specific interactions in the major groove of the double hel ix.
  • Antisense nucleic acid sequences may be introduced into a plant by transformation or direct injection at a specific tissue site.
  • antisense nucleic acid sequences can be modified to target selected cells and then administered systemically.
  • antisense nucleic acid sequences can be modified such that they specifically bind to receptors or antigens expressed on a selected cell surface, e.g., by linking the antisense nucleic acid sequence to peptides or antibodies which bind to cell surface receptors or antigens.
  • the antisense nucleic acid sequences can also be delivered to cells using the vectors described herein.
  • the antisense nucleic acid sequence is an a-anomeric nucleic acid seq uence.
  • An a-anomeric nucleic acid sequence forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual b-units, the strands run parallel to each other (Gaultier et al. (1987) Nucl Ac Res 15: 6625-6641 ).
  • the antisense nucleic acid sequence may also comprise a 2'-o-methylribonucleotide (Inoue et al. (1987) Nucl Ac Res 15, 6131 -6148) or a chimeric RNA-DNA analogue (Inoue et al. (1987) FEBS Lett.
  • Ribozymes are catalytic RNA molecules with ribonuclease activity that are capable of cleaving a single-stranded nucleic acid sequence, such as an mRNA, to which they have a complementary region.
  • ribozymes e.g., hammerhead ribozymes (described in Haselhoff and Gerlach (1988) Nature 334, 585-591) can be used to catalytically cleave mRNA transcripts encoding a polypeptide, thereby substantially reducing the number of mRNA transcripts to be translated into a polypeptide.
  • a ribozyme having specificity for a nucleic acid sequence can be designed (see for example: Cech et al. U.S. Patent No. 4,987,071 ; and Cech et al. U.S. Patent No. 5, 1 1 6,742).
  • mRNA transcripts corresponding to a nucleic acid sequence can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules (Bartel and Szostak (1993) Science 261 , 141 1 -1418).
  • the use of ribozymes for gene silencing in plants is known in the art (e.g., Atkins et al.
  • Gene silencing may also be achieved by insertion mutagenesis (for example, T-DNA insertion or transposon insertion) or by strategies as described by, among others, Angell and Bau lcombe ((1999) Plant J 20(3): 357-62), (Amplicon VIGS WO 98/36083), or Baulcombe (WO 99/15682).
  • insertion mutagenesis for example, T-DNA insertion or transposon insertion
  • strategies as described by, among others, Angell and Bau lcombe ((1999) Plant J 20(3): 357-62), (Amplicon VIGS WO 98/36083), or Baulcombe (WO 99/15682).
  • Gene silencing may also occur if there is a mutation on an endogenous gene and/or a mutation on an isolated gene/nucleic acid subsequently introduced into a plant.
  • the reduction or substantial elimination may be caused by a non-functional polypeptide.
  • the polypeptide may bind to various interacting proteins; one or more mutation(s) and/or truncation(s) may therefore provide for a polypeptide that is still able to bind interacting proteins (such as receptor proteins) but that cannot exhibit its normal function (such as signalling ligand).
  • a further approach to gene silencing is by targeting nucleic acid sequences complementary to the regulatory region of the gene (e.g., the promoter and/or enhancers) to form triple helical structures that prevent transcription of the gene in target cells.
  • nucleic acid sequences complementary to the regulatory region of the gene e.g., the promoter and/or enhancers
  • the regulatory region of the gene e.g., the promoter and/or enhancers
  • miRNAs Artificial and/or natural microRNAs
  • Endogenous miRNAs are single stranded small RNAs of typically 19-24 nucleotides long. They function primarily to regulate gene expression and/ or mRNA translation.
  • Most plant microRNAs miRNAs
  • Most plant microRNAs have perfect or near-perfect complementarity with their target sequences. However, there are natural targets with up to five mismatches. They are processed from longer non-coding RNAs with characteristic fold-back structures by double-strand specific RNases of the Dicer family. Upon processing, they are incorporated in the RNA-induced silencing complex (RISC) by binding to its main component, an Argonaute protein.
  • RISC RNA-induced silencing complex
  • MiRNAs serve as the specificity components of RISC, since they base-pair to target nucleic acids, mostly mRNAs, in the cytoplasm. Subsequent regulatory events include target mRNA cleavage and destruction and/or translational inhibition. Effects of miRNA overexpression are thus often reflected in decreased mRNA levels of target genes.
  • Artificial microRNAs ami RNAs
  • ami RNAs which are typically 21 nucleotides in length, can be genetically engineered specifically to negatively regulate gene expression of single or multiple genes of interest. Determinants of plant microRNA target selection are well known in the art. Empirical parameters for target recognition have been defined and can be used to aid in the design of specific amiRNAs, (Schwab et al., Dev. Cell 8, 517-527, 2005). Convenient tools for design and generation of amiRNAs and their precursors are also available to the public (Schwab et al., Plant Cell 18, 1 121 -1 133, 2006).
  • the gene silencing techniques used for reducing expression in a plant of an endogenous gene requires the use of nucleic acid sequences from monocotyledonous plants for transformation of monocotyledonous plants, and from dicotyledonous plants for transformation of dicotyledonous plants.
  • a nucleic acid sequence from any given plant species is introduced into that same species.
  • a nucleic acid sequence from rice is transformed into a rice plant.
  • Described above are examples of various methods for the reduction or substantial elimination of expression in a plant of an endogenous gene.
  • a person skilled in the art would readily be able to adapt the aforementioned methods for silencing so as to achieve reduction of expression of an endogenous gene in a whole plant or in parts thereof through the use of an appropriate promoter, for example.
  • introduction or “transformation” as referred to herein encompasses the transfer of an exogenous polynucleotide into a host cell, irrespective of the method used for transfer.
  • Plant tissue capable of subsequent clonal propagation may be transformed with a genetic construct of the present invention and a whole plant regenerated there from.
  • the particular tissue chosen will vary depending on the clonal propagation systems available for, and best suited to, the particular species being transformed.
  • tissue targets include leaf disks, pollen, embryos, cotyledons, hypocotyls, megagametophytes, callus tissue, existing meristematic tissue (e.g., apical meristem, axillary buds, and root meristems), and induced meristem tissue (e.g., cotyledon meristem and hypocotyl meristem).
  • the polynucleotide may be transiently or stably introduced into a host cell and may be maintained non-integrated, for example, as a plasmid. Alternatively, it may be integrated into the host genome.
  • the resulting transformed plant cell may then be used to regenerate a transformed plant in a manner known to persons skilled in the art.
  • a plant cell that cannot be regenerated into a plant may be chosen as host cell, i.e. the resulting transformed plant cell does not have the capacity to regenerate into a (whole) plant.
  • Transformation of plant species is now a fairly routine technique.
  • any of several transformation methods may be used to introduce the gene of interest into a suitable ancestor cell.
  • the methods described for the transformation and regeneration of plants from plant tissues or plant cel ls may be util ized for transient or for stable transformation. Transformation methods include the use of liposomes, electroporation, chemicals that increase free DNA uptake, injection of the DNA directly into the plant, particle gun bombardment, transformation using viruses or pollen and microprojection. Methods may be selected from the calcium/polyethylene glycol method for protoplasts (Krens, F.A.
  • Transgenic plants including transgenic crop plants , a re prefera bly prod u ced vi a Agrobacterium-medlaied transformation.
  • An advantageous transformation method is the transformation in planta.
  • Methods for Agrobacterium-medlaied transformation of rice include well known methods for rice transformation, such as those described in any of the following: European patent application EP 1 198985 A1 , Aldemita and Hodges (Planta 199: 612-617, 1996); Chan et al. (Plant Mol Biol 22 (3): 491 -506, 1993), Hiei et al. (Plant J 6 (2): 271 -282, 1994), which disclosures are incorporated by reference herein as if fully set forth.
  • the preferred method is as described in either Ishida et al. (Nat. Biotechnol 14(6): 745-50, 1996) or Frame et al.
  • the nucleic acids or the construct to be expressed is preferably cloned into a vector, wh ich is suitable for transforming Agrobacterium tumefaciens, for example pBin19 (Bevan et al., Nucl. Acids Res. 12 (1984) 871 1 ).
  • Agrobacteria transformed by such a vector can then be used in known manner for the transformation of plants, such as plants used as a model, like Arabidopsis (Arabidopsis thaliana is within th e scope of the present inventi on not considered as a crop plant), or crop plants such as, by way of example, tobacco plants, for example by immersing bruised leaves or chopped leaves in an agrobacterial solution and then cu lturi ng them in suitable media.
  • the tra nsformation of plants by means of Agrobacterium tumefaciens is described, for example, by Hofgen and Willmitzer in Nucl. Acid Res. (1988) 16, 9877 or is known inter alia from F.F.
  • the stable transformation of plastids is of advantages because plastids are inherited maternally is most crops reducing or eliminating the risk of transgene flow through pollen.
  • the transformation of the chloroplast genome is generally achieved by a process which has been schematically displayed i n Klaus et al . , 2004 [Nature Biotechnology 22 (2), 225-229]. Briefly the sequences to be transformed are cloned together with a selectable marker gene between flanking sequences homologous to the chloroplast genome. These homologous flanking sequences direct site specific integration into the plastome. Plastidal transformation has been described for many different plant species and an overview is given in Bock (2001 ) Transgenic plastids in basic research and plant biotechnology. J Mol Biol.
  • the genetically modified plant cells can be regenerated via all methods with which the skilled worker is fami liar. Suitable methods can be fou nd in the abovementioned publications by S.D. Kung and R. Wu, Potrykus or Hofgen and Willmitzer. Alternatively, the genetically modified plant cells are non-regenerable into a whole plant.
  • plant cells or cell groupings are selected for the presence of one or more markers which are encoded by plant-expressible genes co-transferred with the gene of interest, following which the transformed material is regenerated into a whole plant.
  • the plant material obtained in the transformation is, as a rule, subjected to selective conditions so that transformed plants can be distinguished from untransformed plants.
  • the seeds obtained in the above-described manner can be planted and, after an initial growing period, subjected to a suitable selection by spraying.
  • a further possibility consists in growing the seeds, if appropriate after sterilization, on agar plates using a suitable selection agent so that only the transformed seeds can grow into plants.
  • the transformed plants are screened for the presence of a selectable marker such as the ones described above.
  • putatively transformed plants may also be evaluated, for instance using Southern analysis, for the presence of the gene of interest, copy number and/or genomic organisation.
  • expression levels of the newly introduced DNA may be monitored using Northern and/or Western analysis, both techniques being well known to persons having ordinary skill in the art.
  • the generated transformed plants may be propagated by a variety of means, such as by clonal propagation or classical breeding techniques.
  • a first generation (or T1 ) transformed plant may be selfed and homozygous second-generation (or T2) transformants selected, and the T2 plants may then further be propagated through classical breeding techniques.
  • the generated transformed organisms may take a variety of forms. For example, they may be chimeras of transformed cells and non-transformed cells; clonal transformants (e.g. , all cells transformed to contain the expression cassette); grafts of transformed and untransformed tissues (e.g., in plants, a transformed rootstock grafted to an untransformed scion).
  • T-DNA activation tagging involves insertion of T-DNA, usually containing a promoter (may also be a translation enhancer or an intron), in the genomic region of the gene of interest or 10 kb up- or downstream of the coding region of a gene in a configuration such that the promoter directs expression of the targeted gene.
  • a promoter may also be a translation enhancer or an intron
  • regulation of expression of the targeted gene by its natural promoter is disrupted and the gene falls under the control of the newly introduced promoter.
  • the promoter is typically embedded in a T-DNA. This T-DNA is randomly inserted into the plant genome, for example, through Agrobacterium infection and leads to modified expression of genes near the inserted T-DNA.
  • the resulting transgenic plants show dominant phenotypes due to modified expression of genes close to the introduced promoter.
  • TILLING is an abbreviation of "Targeted Induced Local Lesions In Genomes” and refers to a mutagenesis technology useful to generate and/or identify nucleic acids encoding proteins with modified expression and/or activity. TILLING also allows selection of plants carrying such mutant variants. These mutant variants may exhibit modified expression, either in strength or in location or in timing (if the mutations affect the promoter for example). These mutant variants may exhibit higher activity than that exhibited by the gene in its natural form. TILLING combines high-density mutagenesis with high-throughput screening methods.
  • Homologous recombination allows introduction in a genome of a selected nucleic acid at a defined selected position. Homologous recombination is a standard technology used routi nely in biologi ca l sci en ces for lower organ isms such as yeast or the moss Physcomitrella. Methods for performing homologous recombination in plants have been described not only for model plants (Offringa et al. (1990) EMBO J 9(10): 3077-84) but also for crop plants, for example rice (Terada et al.
  • a "Yield related trait” is a trait or feature which is related to plant yield. Yield-related traits may comprise one or more of the following non-limitative list of features: early flowering time, yield, biomass, seed yield, early vigour, greenness index, growth rate, agronomic traits, such as e.g. tolerance to submergence (which leads to yield in rice), Water Use Efficiency (WUE), Nitrogen Use Efficiency (NUE), etc.
  • WUE Water Use Efficiency
  • NUE Nitrogen Use Efficiency
  • Reference herein to enhanced yield-related traits, relative to of control plants is taken to mean one or more of an increase in early vigour and/or in biomass (weight) of one or more parts of a plant, which may include (i) aboveground parts and preferably aboveground harvestable parts and/or (ii) parts below ground and preferably harvestable below ground. In particular, such harvestable parts are seeds.
  • yield in general means a measurable produce of economic value, typically related to a specified crop, to an area, and to a period of time. Individual plant parts directly contribute to yield based on their number, size and/or weight, or the actual yield is the yield per square meter for a crop and year, which is determined by dividing total production (includes both harvested and appraised production) by planted square meters.
  • yield of a plant and “plant yield” are used interchangeably herein and are meant to refer to vegetative biomass such as root and/or shoot biomass, to reproductive organs, and/or to propagules such as seeds of that plant.
  • a yield increase in maize may be manifested as one or more of the following: increase in the number of plants established per square meter, an increase in the number of ears per plant, an increase in the number of rows, number of kernels per row, kernel weight, thousand kernel weight, ear length/diameter, increase in the seed filling rate, which is the number of filled florets (i.e. florets containing seed) divided by the total number of florets and multiplied by 100), among others.
  • Inflorescences in rice plants are named panicles.
  • the panicle bears spikelets, which are the basic units of the panicles, and which consist of a pedicel and a floret.
  • a yield increase may manifest itself as an increase in one or more of the following: number of plants per square meter, number of panicles per plant, panicle length, number of spikelets per panicle, number of flowers (or florets) per panicle; an increase in the seed filling rate which is the number of filled florets (i .e. florets containing seeds) divided by the total number of florets and multiplied by 100; an increase in thousand kernel weight, among others.
  • Plants having an "early flowering time” as used herein are plants which start to flower earlier than control plants. Hence this term refers to plants that show an earlier start of flowering.
  • Flowering time of plants can be assessed by counting the number of days ("time to flower") between sowing and the emergence of a first inflorescence.
  • the "flowering time" of a plant can for instance be determined using the method as described in WO 2007/093444.
  • Early vigour refers to active healthy well-balanced growth especially during early stages of plant growth, and may result from increased plant fitness due to, for example, the plants being better adapted to their environment (i.e. optimizing the use of energy resources and partitioning between shoot and root). Plants having early vigour also show increased seedling survival and a better establishment of the crop, which often results in highly uniform fields (with the crop growing in uniform manner, i .e. with the majority of plants reaching the various stages of development at substantially the same time), and often better and higher yield. Therefore, early vigour may be determined by measuring various factors, such as thousand kernel weight, percentage germination, percentage emergence, seedling growth, seedling height, root length, root and shoot biomass and many more. Increased growth rate
  • the increased growth rate may be specific to one or more parts of a plant (including seeds), or may be throughout substantially the whole plant. Plants having an increased growth rate may have a shorter life cycle.
  • the life cycle of a plant may be taken to mean the time needed to grow from a mature seed up to the stage where the plant has produced mature seeds, similar to the starting material. This life cycle may be influenced by factors such as speed of germination, early vigour, growth rate, greenness index, flowering time and speed of seed maturation.
  • the increase in growth rate may take place at one or more stages in the life cycle of a plant or during substantially the whole plant life cycle. Increased growth rate during the early stages in the life cycle of a plant may reflect enhanced vigour.
  • the increase in growth rate may alter the harvest cycle of a plant allowing plants to be sown later and/or harvested sooner than would otherwise be possible (a similar effect may be obtained with earlier flowering time). If the growth rate is sufficiently increased, it may allow for the further sowing of seeds of the same plant species (for example sowing and harvesting of rice plants followed by sowing and harvesting of further rice plants all within one conventional growing period). Similarly, if the growth rate is sufficiently increased, it may allow for the further sowing of seeds of different plants species (for example the sowing and harvesting of corn plants followed by, for example, the sowing and optional harvesting of soybean, potato or any other suitable plant). Harvesting additional times from the same rootstock in the case of some crop plants may also be possible.
  • Altering the harvest cycle of a plant may lead to an increase in annual biomass production per square meter (due to an increase in the number of times (say in a year) that any particular plant may be grown and harvested).
  • An increase in growth rate may also allow for the cultivation of transgenic plants in a wider geographical area than their wild-type counterparts, since the territorial limitations for growing a crop are often determined by adverse environmental conditions either at the time of planting (early season) or at the time of harvesting (late season). Such adverse conditions may be avoided if the harvest cycle is shortened.
  • the growth rate may be determined by deriving various parameters from growth curves, such parameters may be: T-Mid (the time taken for plants to reach 50% of their maximal size) and T-90 (time taken for plants to reach 90% of their maximal size), amongst others.
  • Mild stress in the sense of the invention leads to a reduction in the growth of the stressed plants of less than 40%, 35% , 30% or 25%, more preferably less than 20% or 15% in comparison to the control plant under non-stress conditions. Due to advances in agricultural practices (irrigation, fertilization, pesticide treatments) severe stresses are not often encountered in cultivated crop plants.
  • Abiotic stresses may be due to drought or excess water, anaerobic stress, salt stress, chemical toxicity, oxidative stress and hot, cold or freezing temperatures.
  • Biotic stresses are typically those stresses caused by pathogens, such as bacteria, viruses, fungi, nematodes and insects.
  • the "abiotic stress” may be an osmotic stress caused by a water stress, e.g. due to drought, salt stress, or freezing stress.
  • Abiotic stress may also be an oxidative stress or a cold stress.
  • Freezing stress is intended to refer to stress due to freezing temperatures, i.e. temperatures at which available water molecules freeze and turn into ice.
  • Cold stress also called “chilling stress” is intended to refer to cold temperatures, e.g. temperatures below 10°, or preferably below 5°C, but at which water molecules do not freeze.
  • abiotic stress leads to a series of morphological, physiological, biochemical and molecular changes that adversely affect plant growth and productivity. Drought, salinity, extreme temperatures and oxidative stress are known to be interconnected and may induce growth and cellular damage through similar mechanisms. Rabbani et al. (Plant Physiol (2003) 133: 1755-1767) describes a particularly high degree of "cross talk" between drought stress and high-salinity stress.
  • non-stress conditions are those environmental conditions that allow optimal growth of plants. Persons skilled in the art are aware of normal soil conditions and climatic conditions for a given location.
  • Plants with optimal growth conditions typically yield in increasing order of preference at least 97%, 95%, 92%, 90%, 87%, 85%, 83%, 80%, 77% or 75% of the average production of such plant in a given environment.
  • Average production may be calculated on harvest and/or season basis. Persons skilled in the art are aware of average yield productions of a crop.
  • the methods of the present invention may be performed under non-stress conditions.
  • the methods of the present invention may be performed under non-stress conditions such as mild drought to give plants having increased yield relative to control plants.
  • the methods of the present invention may be performed under stress conditions.
  • the methods of the present invention may be performed under stress conditions such as drought to give plants having increased yield relative to control plants.
  • the methods of the present invention may be performed under stress conditions such as nutrient deficiency to give plants having increased yield relative to control plants.
  • Nutrient deficiency may result from a lack of nutrients such as nitrogen, phosphates and other phosphorous-containing compounds, potassium, calcium, magnesium, manganese, iron and boron, amongst others.
  • the methods of the present invention may be performed under stress conditions such as salt stress to give plants having increased yield relative to control plants.
  • salt stress is not restricted to common salt (NaCI), but may be any one or more of: NaCI, KCI, LiCI, MgC , CaC , amongst others.
  • the methods of the present invention may be performed under stress conditions such as cold stress or freezing stress to give plants having increased yield relative to control plants.
  • Increased seed yield may manifest itself as one or more of the following:
  • TKW thousand kernel weight
  • filled florets and “filled seeds” may be considered synonyms.
  • An increase in seed yield may also be manifested as an increase in seed size and/or seed volume. Furthermore, an increase in seed yield may also manifest itself as an increase in seed area and/or seed length and/or seed width and/or seed perimeter.
  • the "greenness index” as used herein is calculated from digital images of plants. For each pixel belonging to the plant object on the image, the ratio of the green value versus the red value (i n the RGB model for encoding color) is calculated. The green ness index is expressed as the percentage of pixels for which the green-to-red ratio exceeds a given threshold. Under normal growth conditions, under salt stress growth conditions, and under reduced nutrient availability growth conditions, the greenness index of plants is measured in the last imaging before flowering. In contrast, under drought stress growth conditions, the greenness index of plants is measured in the first imaging after drought.
  • biomass as used herein is intended to refer to the total weight of a plant. Within the definition of biomass, a distinction may be made between the biomass of one or more parts of a plant, which may include any one or more of the following:
  • - aboveground parts such as but not limited to shoot biomass, seed biomass, leaf biomass, etc.
  • - aboveground harvestable parts such as but not limited to shoot biomass, seed biomass, leaf biomass, etc.
  • parts below ground such as but not limited to root biomass, tubers, bulbs, etc.;
  • harvestable parts below ground such as but not limited to root biomass, tubers, bulbs, etc.;
  • - vegetative biomass such as root biomass, shoot biomass, etc.
  • Such breeding programmes sometimes require introduction of allelic variation by mutagenic treatment of the plants, using for example EMS mutagenesis; alternatively, the programme may start with a collection of allelic variants of so called "natural" origin caused unintentionally. Identification of allelic variants then takes place, for example, by PCR. This is followed by a step for selection of superior allelic variants of the sequence in question and which give increased yield . Selection is typically carried out by monitoring growth performance of plants containing different allelic variants of the sequence in question. Growth performance may be monitored in a greenhouse or in the field. Further optional steps include crossing plants in which the superior allelic variant was identified with another plant. This could be used, for example, to make a combination of interesting phenotypic features.
  • nucleic acids encoding the protein of interest for genetically and physically mapping the genes requires only a nucleic acid sequence of at least 15 nucleotides in length. These nucleic acids may be used as restriction fragment length polymorphism (RFLP) markers.
  • RFLP restriction fragment length polymorphism
  • restriction-digested plant genomic DNA may be probed with the nucleic acids encoding the protein of interest.
  • the resulting banding patterns may then be subjected to genetic analyses using computer programs such as MapMaker (Lander et al.
  • nucleic acids may be used to probe Southern blots containing restriction endonuclease-treated genomic DNAs of a set of individuals representing parent and progeny of a defined genetic cross. Segregation of the DNA polymorphisms is noted and used to calculate the position of the nucleic acid encoding the protein of interest in the genetic map previously obtained using this population (Botstein et al. (1980) Am. J. Hum. Genet. 32:314-331 ).
  • the nucleic acid probes may also be used for physical mapping (i .e. , placement of sequences on physical maps; see Hoheisel et al. In: Non-mammalian Genomic Analysis: A Practical Guide, Academic press 1996, pp. 319-346, and references cited therein).
  • the nucleic acid probes may be used in direct fluorescence in situ hybridisation (FISH) mapping (Trask (1991 ) Trends Genet. 7: 149-154).
  • FISH direct fluorescence in situ hybridisation
  • nucleic acid amplification-based methods for genetic and physical mapping may be carried out using the nucleic acids. Examples include allele-specific amplification (Kazazian (1989) J. Lab. Clin. Med 1 1 :95-96), polymorphism of PCR-amplified fragments (CAPS; Sheffield et al. (1993) Genomics 16:325-332), allele-specific ligation (Landegren et al. (1988) Science 241 :1077-1080), nucleotide extension reactions (Sokolov (1990) Nucleic Acid Res. 8:3671 ), Radiation Hybrid Mapping (Walter et al. (1997) Nat. Genet.
  • plant as used herein encompasses whole plants, ancestors and progeny of the plants and plant parts, including seeds, shoots, stems, leaves, roots (including tubers), flowers, and tissues and organs, wherein each of the aforementioned comprise the gene/nucleic acid of interest.
  • plant also encompasses plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen and microspores, again wherein each of the aforementioned comprises the gene/nucleic acid of interest.
  • Plants that are particularly useful in the methods of the invention include all plants which belong to the superfamily Viridiplantae, in particular monocotyledonous and dicotyledonous plants including fodder or forage legumes, ornamental plants, food crops, trees or shrubs selected from the list comprising Acer spp., Actinidia spp., Abelmoschus spp., Agave sisalana, Agropyron spp., Agrostis stolonifera, Allium spp., Amaranthus spp., Ammophila arenaria, Ananas comosus, Annona spp., Apium graveolens, Arachis spp, Artocarpus spp., Asparagus officinalis, Avena spp.
  • Avena sativa e.g. Avena sativa, Avena fatua, Avena byzantina, Avena fatua var. sativa, Avena hybrida
  • Averrhoa carambola e.g. Bambusa sp.
  • Benincasa hispida Bertholletia excelsea
  • Beta vulgaris Brassica spp.
  • Brassica napus e.g. Brassica napus, Brassica rapa ssp.
  • control plants are routine part of an experimental setup and may include corresponding wild type plants or corresponding plants without the gene of interest.
  • the control plant is typically of the same plant species or even of the same variety as the plant to be assessed.
  • the control plant may also be a nullizygote of the plant to be assessed. Nullizygotes (or null control plants) are individuals missing the transgene by segregation.
  • control plants are grown under equal growing conditions to the growing conditions of the plants of the invention, i.e. in the vicinity of, and simultaneously with, the plants of the invention.
  • a "control plant” as used herein refers not only to whole plants, but also to plant parts, including seeds and seed parts.
  • Figure 1 represents the domain structure of SEQ ID NO: 2 and SEQ I D NO: 4 with the signature sequence in bold, the P450 domain in italics and domains 1 to 6 underlined;
  • Figure 2 represents a multiple alignment of various CYP704-like polypeptides. These alignments can be used for defining further motifs or signature sequences, when using conserved amino acids.
  • Figure 3 shows the MATGAT table of Example 3.
  • Figure 4 represents the binary vector used for increased expression in Oryza sativa of a CYP704-like-encoding nucleic acid under the control of a rice GOS2 promoter (pGOS2).
  • the structure of the plasmid is the same for both the rice and the poplar sequences, only the ORFs are different.
  • Figure 5 represents the domain structure of SEQ ID NO: 2 with indication of the conserved DUF1218 domain (indicated as bold and underlined) and motifs 1 to 6.
  • Figure 6 represents a multiple alignment of various DU F1218 polypeptides. These alignments can be used for defining further motifs or signature sequences, when using conserved amino acids.
  • the Os_UNK DUF1218 (SEQ ID NO: 87) in indicated with a box.
  • the signal peptide is indicated with a box.
  • the DUF1218 domain is located between the amino acids at position 60 and 152 in SEQ ID NO: 88 protein and is also indicated with a box. These alignments can be used for defining further motifs, when using conserved amino acids.
  • the illustrated polypeptides have the following SEQ ID NOs:
  • Figure 7 represents a multiple alignment of DUF1218 polypeptides when used in the construction of a phylogenetic tree, such as the one depicted in Figure 6 , clusters with the group of polypeptides comprising the amino acid sequence represented by SEQ ID NO: 88 rather than with any other group.
  • the Os_UNK DUF1218 (SEQ ID NO:87), the signal peptide, and the DUF1218 domain are indicated with a box, similarly as was done in Figure 6.
  • Figure 8 shows the MATGAT table of Example 3 for a number of DUF1218 polypeptides.
  • DUF1218 polypeptides are indicated by the following numbering:
  • G.max_Glyma1 1 g09860.1 ; 26. M.domestica_TC35146; 27. P.persica_TC10133; 28.
  • Figure 9 represents the binary vector used for increased expression in Oryza sativa of a DUF1218 encoding nucleic acid under the control of a rice GOS2 promoter (pGOS2).
  • Figure 10 shows phylogenetic tree of number of DUF1218 polypeptides (see also Example 2 and Example 3 for a MATGAT table on the illustrated DUF1218 polypeptides).
  • Figure 1 1 represents the domain structure of SEQ ID NO: 191 with signature sequence and conserved motifs.
  • Figure 12 represents a multiple alignment of various translin-like polypeptides.
  • the asterisks indicate identical amino acids among the various protein sequences, colons represent highly conserved amino acid substitutions, and the dots represent less conserved amino acid su bstitution; on other positions there is no sequence conservation.
  • These alignments can be used for defining further motifs or signature sequences, when using conserved amino acids .
  • the corresponding SEQ ID NOs for the aligned polypeptide sequences shown in Figure 12 are:
  • SEQ ID NO: 237 for Z. mays_GRMZM2G128080_T03
  • SEQ ID NO: 235 for Z. mays_GRMZM2G128080_T02
  • SEQ ID NO: 233 for Z. mays_ZM07MC31062_BFb0264M 7
  • Figure 13 shows a phylogenetic tree of translin-like polypeptides, as described in Example 2.
  • Figure 14 shows the MATGAT table of Example 3.
  • Figure 15 shows a further MATGAT table of Example 3.
  • Figure 16 represents the binary vector used for increased expression in Oryza sativa of a translin-like-encoding nucleic acid under the control of a rice GOS2 promoter (pGOS2).
  • Figure 17 represents the domain structure of SEQ I D NO: 247 with the ERG28 domain (Pfam PF03694) in bold and motifs 19 to 22 underlined);
  • Figure 18 represents a multiple alignment of various ERG28-like polypeptides. This alignment can be used for defining further motifs or signature sequences, when using conserved amino acids, using standard techniques known in the art.
  • Figure 19 shows phylogenetic tree of ERG28-like polypeptides.
  • Figure 20 shows the MatGAT table of Example 3.
  • Figure 21 represents the binary vector useful for increased expression in Oryza sativa of an ERG28-like-encoding nucleic acid under the control of a rice GOS2 promoter (pGOS2).
  • Figure 22 shows AtERG28 transcript level analysis (qRT-PCR) of GABI-Kat_205F01 (GK205F01 ). Almost no AtERG28 gene expression was observed in the GABI-Kat_205F01 (GK205F01 ) homozygous mutants (AtERG28 loss-of-function mutants). Wt: 1 , 2, 8, 1 1 ; homozygous mutant: 3, 5, 6, 9; heterozygous: 4, 7, 10, 12.
  • Figure 23 shows seed yield ERG28 T-DNA mutant versus wildtype (wt) under stress and non-stress conditions.
  • DS drought stress (mild, progressive drought stress without any watering for 2 weeks) followed by a recovery phase (plants left to recover and set seeds under well watered conditions).
  • C control, no drought stress treatment applied, plants were kept well watered.
  • Example 1 Identification of sequences related to the nucleic acid sequence used in the methods of intervention
  • Sequences (full length cDNA, ESTs or genomic) related to SEQ ID NO: 1 and SEQ ID NO: 2 were identified amongst those maintained in the Entrez Nucleotides database at the National Center for Biotechnology Information (NCBI) using database sequence search tools, such as the Basic Local Alignment Tool (BLAST) (Altschul et al. (1990) J. Mol. Biol. 215:403-410; and Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402). The program is used to find regions of local similarity between sequences by comparing nucleic acid or polypeptide sequences to sequence databases and by calculating the statistical significance of matches.
  • BLAST Basic Local Alignment Tool
  • the polypeptide encoded by the nucleic acid of SEQ ID NO: 1 was used for the TBLASTN algorithm, with default settings and the filter to ignore low complexity sequences set off.
  • the output of the analysis was viewed by pairwise comparison, and ranked according to the probability score (E-value), where the score reflect the probability that a particular alignment occurs by chance (the lower the E-value, the more significant the hit).
  • E-value probability score
  • comparisons were also scored by percentage identity. Percentage identity refers to the number of identical nucleotides (or amino acids) between the two compared nucleic acid (or polypeptide) sequences over a particular length.
  • the default parameters may be adjusted to modify the stringency of the search. For example the E-value may be increased to show less stringent matches. This way, short nearly exact matches may be identified.
  • Table A1 provides a list of nucleic acid and protein sequences related to SEQ ID NO: 1/2 and SEQ ID NO: 3/4.
  • Z. mays_TA13407_4577999 45 46 Z. mays_TA16211 _4577999 47 48
  • Sequences (full length cDNA, ESTs or genomic) related to SEQ ID NO: 87 and SEQ ID NO: 88 were identified amongst those maintained in the Entrez Nucleotides database at the National Center for Biotechnology Information (NCBI) using database sequence search tools, such as the Basic Local Alignment Tool (BLAST) (Altschul et al. (1990) J. Mol. Biol. 215:403-410; and Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402). The program is used to find regions of local similarity between sequences by comparing nucleic acid or polypeptide sequences to sequence databases and by calculating the statistical significance of matches.
  • BLAST Basic Local Alignment Tool
  • the program is used to find regions of local similarity between sequences by comparing nucleic acid or polypeptide sequences to sequence databases and by calculating the statistical significance of matches.
  • the polypeptide encoded by the nucleic acid of SEQ ID NO: 87 was used for the TBLASTN algorithm, with default settings and the filter to ignore low complexity sequences set off.
  • the output of the analysis was viewed by pairwise comparison, and ranked according to the probability score (E-value), where the score reflect the probability that a particular alignment occurs by chance (the lower the E-value, the more significant the hit).
  • E-value probability score
  • comparisons were also scored by percentage identity. Percentage identity refers to the number of identical nucleotides (or amino acids) between the two compared nucleic acid (or polypeptide) sequences over a particular length.
  • the default parameters may be adjusted to modify the stringency of the search. For example the E-value may be increased to show less stringent matches. This way, short nearly exact matches may be identified.
  • Table A2 provides SEQ ID NO: 87 and SEQ ID NO: 88 and a list of nucleic acid sequences related to SEQ ID NO: 87 and SEQ ID NO: 88.
  • Table A2 Examples of DUF1218 nucleic acids and polypeptides:
  • Sequences (full length cDNA, ESTs or genomic) related to SEQ ID NO: 190 and SEQ ID NO: 191 were identified amongst those maintained in the Entrez Nucleotides database at the National Center for Biotechnology Information (NCBI) using database sequence search tools, such as the Basic Local Alignment Tool (BLAST) (Altschul et al. (1990) J. Mol. Biol. 215:403-410; and Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402). The program is used to find regions of local similarity between sequences by comparing nucleic acid or polypeptide sequences to sequence databases and by calculating the statistical significance of matches.
  • BLAST Basic Local Alignment Tool
  • the program is used to find regions of local similarity between sequences by comparing nucleic acid or polypeptide sequences to sequence databases and by calculating the statistical significance of matches.
  • the polypeptide encoded by the nucleic acid of SEQ I D NO: 190 was used for the TBLASTN algorithm, with default settings and the filter to ignore low complexity sequences set off.
  • the output of the analysis was viewed by pairwise comparison, and ranked according to the probability score (E-value), where the score reflect the probability that a particular alignment occurs by chance (the lower the E- value, the more significant the hit).
  • E-value probability score
  • comparisons were also scored by percentage identity. Percentage identity refers to the number of identical nucleotides (or amino acids) between the two compared nucleic acid (or polypeptide) sequences over a particular length.
  • the default parameters may be adjusted to modify the stringency of the search. For example the E-value may be increased to show less stringent matches. This way, short nearly exact matches may be identified.
  • Table A3 provides a list of nucleic acid sequences related to SEQ ID NO: 190 and SEQ ID NO: 191 .
  • Table A3 Examples of translin-like nucleic acids and polypeptides:

Abstract

The present invention relates generally to the field of molecular biology and discloses a method for enhancing various economically important yield-related traits in plants. More specifically, the present invention discloses a method for enhancing yield-related traits in plants by modulating expression in a plant of a nucleic acid encoding a CYP704-like (Cytochrome P450 family 704) polypeptide, a DUF1218 polypeptide, a translin-like polypeptide, or an ERG28-like polypeptide. The present invention also discloses plants having modulated expression of a nucleic acid encoding a CYP704-like (Cytochrome P450 family 704) polypeptide, a DUF1218 polypeptide, a translin-like polypeptide, or an ERG28-like polypeptide, which plants have enhanced yield-related traits relative to control plants. The invention also provides hitherto unknown DUF1218 polypeptide-encoding nucleic acids, and constructs comprising the same, useful in performing the methods of the invention.

Description

PLANTS HAVING ENHANCED YIELD-RELATED TRAITS AND METHOD FOR MAKING THE SAME
Background
The present invention relates generally to the field of molecular biology and concerns a method for enhancing yield-related traits in plants by modulating expression in a plant of a nucleic acid encoding a CYP704-like (Cytochrome P450 family 704) polypeptide. The present invention also concerns plants having modulated expression of a nucleic acid encoding a CYP704-like polypeptide, which plants have enhanced yield-related traits relative to corresponding wild type plants or other control plants. The invention also provides constructs useful in the methods of the invention.
The present invention also relates generally to the field of molecular biology and concerns a method for enhancing various economically important yield-related traits in plants. More specifically, the present invention concerns a method for enhancing yield-related traits in plants by mod ulating expression i n a plant of a nucleic acid encod ing a D U F1218 polypeptide. The present invention also concerns plants having modulated expression of a nucleic acid encoding a DUF1218 polypeptide, which plants have enhanced yield-related traits relative to control plants. The invention also provides hitherto unknown DUF1218- encoding nucleic acids, and constructs comprising the same, useful in performing the methods of the invention.
The present invention also relates generally to the field of molecular biology and concerns a method for enhancing yield-related traits in plants by modulating expression in a plant of a nucleic acid encoding a translin-like polypeptide. The present invention also concerns plants having modulated expression of a nucleic acid encoding a translin-like polypeptide, which plants have enhanced yield-related traits relative to corresponding wild type plants or other control plants. The invention also provides constructs useful in the methods of the invention. The present invention also relates generally to the field of molecular biology and concerns a method for enhancing yield-related traits in plants by modulating expression in a plant of a nucleic acid encoding an ERG28-like polypeptide. The present invention also concerns plants having modulated expression of a nucleic acid encoding an ERG28-like polypeptide, which plants have enhanced yield-related traits relative to corresponding wild type plants or other control plants. The invention also provides constructs useful in the methods of the invention.
The ever-increasing world population and the dwindling supply of arable land available for agriculture fuels research towards increasing the efficiency of agriculture. Conventional means for crop and horticultural improvements utilise selective breeding techniques to identify plants having desirable characteristics. However, such selective breeding techniques have several drawbacks, namely that these techniques are typically labour intensive and result in plants that often contain heterogeneous genetic components that may not always result in the desirable trait being passed on from parent plants. Advances in molecular biology have allowed mankind to modify the germplasm of animals and plants. Genetic engineering of plants entails the isolation and manipulation of genetic material (typically in the form of DNA or RNA) and the subsequent introduction of that genetic material into a plant. Such technology has the capacity to deliver crops or plants having various improved economic, agronomic or horticultural traits.
A trait of particular economic interest is increased yield. Yield is normally defined as the measurable produce of economic value from a crop. This may be defined in terms of quantity and/or quality. Yield is directly dependent on several factors, for example, the number and size of the organs, plant architecture (for example, the number of branches), seed production, leaf senescence and more. Root development, nutrient uptake, stress tolerance and early vigour may also be important factors in determining yield. Optimizing the abovementioned factors may therefore contribute to increasing crop yield.
Seed yield is a particularly important trait, since the seeds of many plants are important for human and animal nutrition. Crops such as corn, rice, wheat, canola and soybean account for over half the total human caloric intake, whether through direct consumption of the seeds themselves or through consumption of meat products raised on processed seeds. They are also a source of sugars, oils and many kinds of metabolites used in industrial processes. Seeds contain an embryo (the source of new shoots and roots) and an endosperm (the source of nutrients for embryo growth during germination and during early growth of seedlings). The development of a seed involves many genes, and requires the transfer of metabolites from the roots, leaves and stems into the growing seed. The endosperm, in particular, assimilates the metabolic precursors of carbohydrates, oils and proteins and synthesizes them into storage macromolecules to fill out the grain.
Another important trait for many crops is early vigour. Improving early vigour is an important objective of modern rice breeding programs in both temperate and tropical rice cultivars. Long roots are important for proper soil anchorage in water-seeded rice. Where rice is sown directly into flooded fields, and where plants must emerge rapidly through water, longer shoots are associated with vigour. Where drill-seeding is practiced, longer mesocotyls and coleoptiles are important for good seedling emergence. The ability to engineer early vigour into plants would be of great importance in agriculture. For example, poor early vigour has been a limitation to the introduction of maize (Zea mays L.) hybrids based on Corn Belt germplasm in the European Atlantic.
A fu rther important trait is that of improved abiotic stress tolerance. Abiotic stress is a primary cause of crop loss worldwide, reducing average yields for most major crop plants by more than 50% (Wang et al., Planta 218, 1 -14, 2003). Abiotic stresses may be caused by drought, salinity, extremes of temperature, chemical toxicity and oxidative stress. The ability to improve plant tolerance to abiotic stress would be of great economic advantage to farmers worldwide and would allow for the cultivation of crops during adverse conditions and in territories where cultivation of crops may not otherwise be possible. Crop yield may therefore be increased by optimising one of the above-mentioned factors.
Concerning CYP704-like polypeptides, the term 'cytochrome P450' (P450s) referred to a pigmented substance when reduced and bound with carbon monoxide, produced an unusual absorption peak at a wavelength of 450 nm. Cytochrome P450s are heme-thiolate proteins involved in many basic metabolic pathways ranging from synthesis and degradation of endogenous steroid hormones, vitamins and fatty acid derivatives ('endobiotics') to the metabolism of foreign compounds such as drugs, environmental chemicals, and carcinogens ('xenobiotics'). In plants they are involved in plant hormone synthesis, phytoalexin synthesis, flower petal pigment biosynthesis, and herbicide degradation. P450s usually work as monooxygenases by activating molecular oxygen with inserting one of its atoms into the substrate and reducing the other to form water:
R-H + 02 + NADPH + H+ = R-OH + H20 + NADP+
Plant P450s are generally classified into two main clades: A-type and non-A type. The A- type clade is specific to plants, some P450s involved in the biosynthesis of secondary metabolites or natural products are found in this group. In contrast, the non-A type clade is a much more divergent group of sequences consisting of several individual clades, which often show more similarity to non-plant P450s than to the other plant P450s. It is now generally accepted that the A-type P450s originate from a single common ancestral gene. The CYP704A proteins form a small gene family (2 members in Arabidopsis, 3 in rice), and are are postulated to be involved in fatty acid hydroxylation, cutin formation, drought stress tolerance. CYP704B1 is a long-chain fatty acid ω-Hydroxylase essential for sporopollenin synthesis in pollen of Arabidopsis thaliana. CYP704B2 catalyzes the v-hydroxylation of fatty acids (C16 and C18) and is required for anther cutin biosynthesis and pollen exine formation in rice.
Concerning translin-like polypeptides, translin is a member of the Translin Superfamily. Translin interacts with DNA and forms a ring around DNA, see e.g. Aoki et al., FEBS Lett. 1997 Jan 20; 401 (2-3):109-1 12. Another member of the Translin Superfamily is Translin- associated factor X (TRAX), which was found to interact with translin in yeast two-hybrid screen.
Jaendling et al.(Biochem. J. (2010) 429, 225-234) reported that both Translin and TRAX are implicated in a broad spectrum of biological activities, although the precise role has not been elucidated for all of these processes. Concerning ERG28-like polypeptides, phytosterols are synthesized via the mevalonate pathway of terpenoid formation. Plant steroids are derived from sterols and comprise the plant steroid horomones brassinosteroids. Plant steroids and sterols have been shown to play an essential role in the regulation of many plant growth and developmental processes. Alterations in sterol levels are known to affect embryogenesis, cell elongation and vascular differentiation (Clouse, Plant Cell 14: 1995-2000, 2002 and references therein). Interestingly in terms of agronomical applications, sterols also appear to be involved in resistance of the plants to pathogens. For instance, exogenous application of ergosterol, the main sterol of most fungi, promotes the expression of a number of defence genes and leads to enhanced tolerance toward fungal pathogen in plants (Laquitaine et al , Molecular Plant-Microbe Interactions 19: 1 03-11 12, 2006; Lochman et al, Plant Molecular Biology 62: 43-51 , 2006). However, it remains to be elucidated if changes in plant sterol composition and/or levels also confer increased tolerance to abiotic stresses in plants. Lastly, experimental data suggest that alterations in sterol composition in plants may lead to modified nutritional qualities of plants. For instance, overexpression of the gene GmSMTI in potato plants lead to a reduction in cholesterol and glycoalkaloid (TGA) levels (Arnqvist et al, Plant Physiology 131 : 1792-1799, 2003). Further, plant sterols are also thought to have beneficial effects on human health (a relatively high consumption of phytosterol tends to enhance the immune function and reduce the cholesterol level in humans; Piironen et al, Journal of the Science of Food and Agriculture 80: 939-966, 2000).
The pathways of plant sterols and brassinosteroid synthesis and signalling are well characterised. Yet, virtually nothing is known to date regarding the topology of the enzymes responsible for the synthesis of plant sterols and brassinosteroids. Little is known also about the mechanisms of regulation involved in the synthesis of plant sterols and steroids and their transport within the cell.
ERG28 is a key protein in the yeast sterol biosynthetic enzyme complex. ERG28 was found to be highly co-regulated with other ergosterol biosynthesis enzymes (Mo et al, Proceedings of the National Academy of Sciences of the United States of America 99: 9739-9744 2002). This endoplasmic reticulum transmembrane-located protein was also shown to interact with many of the ergosterol biosynthetic enzymes in yeast (Saccharomyces cerevisiae). ScERG28 seems to function has a scaffold to tether these enzymes as a large complex (Mo et al, 2002; Mo et al. , Biochimica Et Biophysica Acta-Molecular and Cell Biology of Lipids 1686: 30-36, 2004; and Mo et al., Journal of Lipid Research 46: 1991 -1998, 2005). Loss of ScERG28 results in reduced ergosterol level, accumulation of sterol intermediates, and slow growth in yeast (Smith et al, Science 274:2069-2074, 1996; Gachotte et al., Journal of Lipid Research 42: 50-154, 2001 ). Homologues of ScERG28 were identified in other eukaryotes, including human and diverse plant species. The function ERG28-like proteins in plants remains to be characterised. Depending on the end use, the modification of certain yield traits may be favoured over others. For example for applications such as forage or wood production, or bio-fuel resource, an increase in the vegetative parts of a plant may be desirable, and for applications such as flour, starch or oil production, an increase in seed parameters may be particularly desirable. Even amongst the seed parameters, some may be favoured over others, depending on the application. Various mechanisms may contribute to increasing seed yield, whether that is in the form of increased seed size or increased seed number.
It has now been found that various yield-related traits may be improved in plants by modulating expression in a plant of a nucleic acid encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, in a plant.
Concerning ERG28-like polypeptides, it has now been found that various yield-related traits may be improved in plants or yeasts by modulating expression in a plant of a nucleic acid encoding an ERG28-like polypeptide. In yeast, modulated expression of ERG28-like proteins results in improved yeast growth and/or reproduction, compared to wild type yeast.
Detailed description of the invention
The present invention shows that modulating expression in a plant of a nucleic acid encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, gives plants having enhanced yield-related traits relative to control plants.
Concerning ERG28-like polypeptides, the present invention shows that modu lating expression in a plant of a nucleic acid encoding an ERG28-like polypeptide gives plants having altered steroid composition and/or enhanced yield-related traits relative to control plants. It was also found that modulated expression of a nucleic acid encoding an ERG28- like polypeptide in yeast results in improved yeast growth and/or reproduction.
According to a first embodiment, the present invention provides a method for enhancing yield-related traits in plants relative to control plants, comprising modulating expression in a plant of a nucleic acid encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, and optionally selecting for plants having enhanced yield-related traits. According to another embodiment, the present invention provides a method for producing plants having enhanced yield-related traits relative to control plants, wherein said method comprises the steps of modulating expression in said plant of a nucleic acid encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, as described herein and optionally selecting for plants having enhanced yield- related traits. Concerning ERG28-like polypeptides, according to a first embodiment, the present invention provides a method for regu lati ng steroid synthesis in plants, comprising modulating expression in a plant of a nucleic acid encoding an ERG28-like polypeptide and optionally selecting for plants having altered steroid composition. According to a second embodiment, the present invention provides a method for enhancing yield-related traits in plants relative to control plants, comprising modulating expression in a plant of a nucleic acid encoding an ERG28-like polypeptide and optionally selecting for plants having enhanced yield-related traits. According to another embodiment, the present invention provides a method for producing plants having altered steroid composition and/or for enhancing yield-related traits relative to control plants, wherein said method comprises the steps of modulating expression in said plant of a nucleic acid encoding an ERG28-like polypeptide as described herein and optionally selecting for plants having altered steroid composition and/or enhanced yield-related traits. According to yet another embodiment, the present invention provides a method for improving yeast growth and/or reproduction, such as for example increasing the volume of yeast cells, increasing the growth rate or improving the mating capacity. A preferred method for modulating (increasing or decreasing) expression of a nucleic acid encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide, is by introducing and expressing in a plant a nucleic acid encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin- like polypeptide, or an ERG28-like polypeptide.
Any reference hereinafter to a "protein useful in the methods of the invention" is taken to mean a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide, as defined herein. Any reference hereinafter to a "nucleic acid useful in the methods of the invention" is taken to mean a nucleic acid capable of encoding such a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide. The nucleic acid to be introduced into a plant (and therefore useful in performing the methods of the invention) is any nucleic acid encoding the type of protein which will now be described, hereafter also named "CYP704- like nucleic acid", or "DUF1218 nucleic acid", or "translin-like nucleic acid", or "ERG28-like nucleic acid", or "CYP704-like gene", o r "DUF1218 gene", or "translin-like gene", or "ERG28-like gene".
A "CYP704-like polypeptide" as defined herein refers to any polypeptide comprising a P450 domain (Pfam PF00067) and the MGRMXXXWGXXXXXXXPERW signature sequence (SEQ ID NO: 72), wherein X can be any amino acid.
Additionally and/or alternatively, the CYP704-like polypeptide comprises one or more of the following motifs:
Motif 1 (SEQ ID NO: 73):
[GD]L[LF]GDGIF[ATN][TV]DG[EHD][MK]W[RK][HQ]QRK[VLIT][SA]S[FY]EF[SA][TS][RK][V A]LRDFS[STC][DSV][TIV]F[RK][RKE]
Motif 2 (SEQ ID NO: 74): D[VTI]LP[DN]G[HYFT][KNRS]V[KVS][KA]G[DG][MG][VI][TNAY]Y[QMV][PIA]Y[AS]MGRM[E
TK][YF][ILN]WG[DE]DA[EQA][ES][YF][RK]PERW
Motif 3 (SEQ ID NO: 75):
[DT][PYD][RTK]YLRD[IV][IV]LN[FI][VLM]IAG[KR]DTT[GA][GNAT][AST]L[TAS]WF[LFI]Y[LM ]LCK[HN]P[LHAIE][VI][QA][DEN]K[VIL][AV][LQ]E[VIL][RM][ED][AFV][TVE]
Motif 4 (SEQ ID NO: 76):
[LD][VEDK][DN]G[VI][YF][QK][PQ]ESPFKF[TV][SA]F[QNH]AGPRICLGK[DE][FS]A[HY][RL] QMK[IM][VMF][AS][AM][ATV]L
Motif 5 (SEQ ID NO: 77):
R[YF][VI]D[PIV][FML]WK[LI]K[RK][YF][LF]N[IV]GSEAxLK[RK][NS][VI][QK][VI][IV][DN][DES] FV[MY][KS][LV]I[HNR][KQT][RK][KIR][EA]
wherein x can be any amino acid.
Motif 6 (SEQ ID NO: 78):
[SE]F[ASTV][KA][RS][IL][DTN][DEY][DEG]A[IL][SENG]K[ML][HNQ]YL[QH]A[TA][LI][TS]ETL RLYP[AS]VP[VLQ]D[PGNA]K[MIG][CAI][FLD][SE]D
Additionally and/or alternatively, the CYP704-like polypeptide comprises one or more of the following motifs:
Motif 7 (SEQ ID NO: 79):
G[DEHK]GIF;
Motif 8 (SEQ ID NO: 80):
[TS][ML][DE][SG][IVFT][FC]x[VIG][GAVI][FL]G;
Wherein x can be any amino acid, preferably x is one of K, T, N, R, H, Q;
Motif 9 (SEQ ID NO: 81 ):
[YFST]L[RK]D[IV][VIT]L[NS][FIV].
The term "CYP704-like" or "CYP704-like polypeptide" as used herein also intends to include homologues as defined hereunder of "CYP704-like polypeptide". Motifs 1 to 6 were derived using the MEME algorithm (Bailey and Elkan, Proceedings of the Second International Conference on Intelligent Systems for Molecular Biology, pp. 28-36, AAA I Press, Menlo Park, California, 1994). At each position within a M EME motif, the residues are shown that are present in the query set of sequences with a frequency higher than 0.2. Residues within square brackets represent alternatives.
More preferably, the CYP704-like polypeptide comprises in increasing order of preference, at least one, at least 2, at least 3, at least 4, at least 5, or all 6 motifs. Additionally or alternatively, the CYP704-like polypeptide comprises one, two or all three of motifs 7, 8 and 9.
Additionally or alternatively, the homologue of a CYP704-like protein has in increasing order of preference at least 20%, 21 %, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31 %, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41 %, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% overall sequence identity to the amino acid sequence represented by SEQ ID NO: 2, provided that the homologous protein comprises any one or more of the conserved motifs as outlined above. The overall sequence identity is determined using a global alignment algorithm, such as the Needleman Wunsch algorithm in the program GAP (GCG Wisconsin Package, Accelrys), preferably with default parameters and preferably with sequences of mature proteins (i.e. without taking into account secretion signals or transit peptides). I n one embodi ment the sequence identity level is determined by comparison of the polypeptide sequences over the entire length of the sequence of SEQ ID NO: 2 or SEQ I D NO: 4. Compared to overall sequence identity, the sequence identity will generally be higher when only conserved domains or motifs are considered. Preferably the motifs in a CYP704-like polypeptide have, in increasing order of preference, at least 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90% , 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one or more of the motifs represented by SEQ ID NO: 73 to SEQ ID NO: 78 (Motifs 1 to 6), SEQ ID NO: 79 to SEQ ID NO: 81 (Motif 7 to 9)
In other words, in another embodiment a method is provided wherein said CYP704-like polypeptide comprises a conserved domain (or motif) with at least 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 % , 92% , 93%, 94%, 95% , 96% , 97%, 98%, or 99% sequence identity to the conserved domain starting with amino acid Q51 up to amino acid F501 in SEQ ID NO: 2 or with amino acid V94 up to amino acid L517 in SEQ ID NO: 4.
DUF1218 proteins are plant proteins. Family members contain a number of conserved cysteine residues. In particular, A "DUF1218 polypeptide" as defined herein refers to any polypeptide comprising a DUF1218 domain.
I n one embodiment, said DU F1218 domain comprises or consists of an amino acid sequence having at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96% , 97%, 98%, or 99% overall sequence identity to the amino acid represented by SEQ ID NO: 179, and for instance consists of the amino acid sequence as represented by SEQ ID NO: 179.
In an example, said DUF1218 domain consists of an amino acid sequence having at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% overall sequence identity to a conserved domain from amino acid 60 to 152 in SEQ ID NO: 88.
In another embodiment, said DUF1218 polypeptide comprises at least one signal peptide. Alternatively, or in combination therewith, said DUF1218 polypeptide comprises at least one transmembrane domain, and for instance at least two or at least three transmembrane domains. In yet another embodiment, said DUF1218 polypeptide comprises one or more of the following motifs:
(i) Motif 10: NW[TS][LV]AL[VI][CS]F[VI]VSW[FA]TF[VI]IAFLLLLTGAALNDQ[HR]G [EQ]E (SEQ ID NO: 180),
(ii) Motif 11 : SP[STG][EQ]C[VI]YPRSPAL[AG]LGL[IT][AS]A[DV][AS]LM[IV]A[QH] [ISV]IIN[TV][AV][TA]GCICC[KR][RK] (SEQ ID NO: 181 ),
(iii) Motif 12: [YS][YF]CYVVKPGVF[AS]G[GA]AVLSLASV[AI]L[GA]IVYY (SEQ I D NO: 182)
In another embodiment, said DUF1218 polypeptide further comprises one or more of the following motifs:
(i) Motif 13: CCKRHPVPSDTNWSVALISFIVSW[VAC]TFIIAFLLLLTGAALNDQRG[E Q] ENMY (SEQ ID NO: 183),
(ii) Motif 14: MERK[AV]VVVCA[LV]VGFLGVLSAALGFAAE[GA]TRVKVSDVQT[DS] (SEQ ID NO: 184),
(iii) Motif 15: IP[QP]QSSEPVFVHEDTYNR[QR]Q[FQ] (SEQ ID NO: 185)
The term "DUF1218" or "DUF1218 polypeptide" as used herein also intends to include homologues as defined hereunder of such "DUF1218 polypeptide". Motifs 10 to 15 were derived using the MEME algorithm (Bailey and Elkan, Proceedings of the Second International Conference on Intelligent Systems for Molecular Biology, pp. 28- 36, AAA I Press, Menlo Park, California, 1994). At each position within a MEME motif, the residues are shown that are present in the query set of sequences with a frequency higher than 0.2. Residues within square brackets represent alternatives.
More preferably, the DUF1218 polypeptide comprises in increasing order of preference, at least 2, at least 3, at least 4, at least 5, or all 6 motifs.
Additionally or alternatively, the homologue of a DUF1218 protein has in increasing order of preference at least 25%, 26%, 27%, 28%, 29%, 30%, 31 %, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41 %, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% overall sequence identity to the amino acid sequence represented by SEQ ID NO: 88, provided that the homologous protein comprises any one or more of the conserved motifs as outlined above. The overall sequence identity is determined using a global alignment algorithm, such as the Needleman Wunsch algorithm in the program GAP (GCG Wisconsin Package, Accelrys), preferably with default parameters and preferably with sequences of mature proteins (i.e. without taking into account secretion signals or transit peptides). Compared to overall sequence identity, the sequence identity will generally be higher when only conserved domains or motifs are considered . Preferably the motifs in a DUF1218 polypeptide have, in increasing order of preference, at least 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one or more of the motifs represented by SEQ ID NO: 180 to SEQ ID NO: 185 (Motifs 10 to 15).
A "translin-like polypeptide" as defined herein refers to any polypeptide comprising the signature sequence GTDFWKLRR (S EQ I D NO: 245) . Preferably, the transl in-like polypeptde comprises an InterPro accession IPR002848 corresponding to PFAM accession number PF01997 translin domain. In SEQ ID NO: 191 , the translin domain is present starting with amino acid 72 up to amino acid 272.
The term "translin-like" or "translin-like polypeptide" as used herein also intends to include homologues as defined hereunder of "translin-like polypeptide". Preferably, the translin-like polypeptide comprises one or more of the following motifs:
(i) Motif 16: DLAAV[TV][NED]QY[IM][LAGS][KR]LVKELQGTDFWKLRRAY[ST][PF] GVQEYVEAAT[FL][CY][KR]FC[RK][TS]GT (SEQ ID NO: 238),
(ii) Motif 17: [SP][SA][FM]K[DA][AE]F[GSA][NK][YH]A[NE]YLN[KNT]LN[ED]KRER [VL]VKASRD[IV]TMNSKKVIFQVHR[IM]SK[DN]N[RK] (SEQ ID NO: 239), (iii) Motif 18: IC[QA]FVRDIYRELTL[LVI]VP[YL]MDD[SN][SN][DE]MK[TK]KM[DE][TV]
MLQSV[VM]KIENAC[YF][GS]VHVRG (SEQ ID NO: 240).
Motifs 16 to 18 were derived using the MEME algorithm (Bailey and Elkan, Proceedings of the Second International Conference on Intelligent Systems for Molecular Biology, pp. 28- 36, AAAI Press, Menlo Park, California, 1994). At each position within a MEME motif, the residues are shown that are present in the query set of sequences with a frequency higher than 0.2. Residues within square brackets represent alternatives.
More preferably, the translin-like polypeptide comprises in increasing order of preference, at least 2, or all 3 motifs. Additionally or alternatively, the homologue of a translin-like protein has in increasing order of preference at least 25%, 26%, 27%, 28%, 29%, 30%, 31 %, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41 %, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% overall sequence identity to the amino acid sequence represented by SEQ ID NO: 191 , provided that the homologous protein comprises any one or more of the conserved motifs as outlined above. The overall sequence identity is determined using a global alignment algorithm, such as the Needleman Wunsch algorithm in the program GAP (GCG Wisconsin Package, Accelrys), preferably with default parameters and preferably with sequences of mature proteins (i.e. without taking into account secretion signals or transit peptides).
In one embodiment, the sequence identity level is determined by comparison of the polypeptide sequences of the entire length of the sequence of SEQ ID NO: 191 .
Compared to overall sequence identity, the sequence identity will generally be higher when only conserved domains or motifs are considered. Preferably the motifs in a translin-like polypeptide have, in increasing order of preference, at least 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one or more of the motifs represented by SEQ ID NO: 238 to SEQ ID NO: 240 (Motifs 16 to 18).
In other words, in another embodiment a method is provided wherein said translin-like polypeptide comprises a conserved domain or motif, with at least 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to one or more of conserved domain(s) starting with amino acid 1 14 up to amino acid 163, amino acid 55 up to amino acid 104 and/or amino acid 222 up to amino acid 271 in SEQ ID NO: 191.
An "ERG28-like polypeptide" as defined herein refers to any polypeptide comprising a Pfam PF03694 domai n (E RG28-like protein, InterPro IPR005352). Typically ERG28-like polypeptide proteins comprise 4 transmembrane domains. Preferably the ERG28-like polypeptide also comprises the signature sequence WTLL[TS]CTL (SEQ ID NO: 296).
In one embodiment, the ERG28-like polypeptide comprises one or more of the following motifs:
Motif 19 (SEQ ID NO: 297):
CTLC[FY]LCA[FL]NL[HE][DN][KR]PLYLAT[IF]LSF[IV]YA[FL]GHFLTE[FY]L[FI]Y[HQ]TM Motif 20 (SEQ ID NO: 298):
VG[ST]LRLASVWFGF[VF][DN]IWALR[LV]AVFS[QK]T[TE]M[TS][ED][VI]HGRTFG[VT]WT Motif 21 (SEQ ID NO: 299):
[IA][KA]NL[SVT]TVG[FI]FAGTSI[VI]WMLL[EQ]WN[SA][LH][EQG][QK][PV][RKH] Motif 22 (SEQ ID NO: 300):
[PEK][LA]LG[YW]WL[MI]
The term "ERG28-like" or "ERG28-like polypeptide" as used herein also intends to include homologues as defined hereunder of "ERG28-like polypeptide".
Motifs 19 to 22 were derived using the MEME algorithm (Bailey and Elkan, Proceedings of the Second International Conference on Intelligent Systems for Molecular Biology, pp. 28- 36, AAAI Press, Menlo Park, California, 1994). At each position within a MEME motif, the residues are shown that are present in the query set of sequences with a frequency higher than 0.2. Residues within square brackets represent alternatives.
More preferably, the ERG28-like polypeptide comprises the signature sequence and in increasing order of preference, at least 1 , at least 2, at least 3, or all 4 motifs as defined herein.
Additionally or alternatively, the homologue of an ERG28-like protein has in increasing order of preference at least 25%, 26%, 27%, 28%, 29%, 30%, 31 %, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41 %, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% overall sequence identity to the amino acid sequence represented by SEQ ID NO: 247 or SEQ I D NO: 249, provided that the homologous protein comprises any one or more of the conserved motifs as outlined above. The overall sequence identity is determined using a global alignment algorithm, such as the Needleman Wunsch algorithm in the program GAP (GCG Wisconsi n Package, Accelrys), preferably with default parameters and preferably with sequences of mature proteins (i.e. without taking into account secretion signals or transit peptides). Compared to overall sequence identity, the sequence identity will generally be higher when only conserved domains or motifs are considered. Preferably the motifs in an ERG28-like polypeptide have, in increasing order of preference, at least 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87% , 88% , 89% , 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one or more of the motifs represented by SEQ ID NO: 297 to SEQ ID NO: 300 (Motifs 19 to 22).
In other words, in another embodiment a method is provided wherein said ERG28-like polypeptide comprises a conserved domain (or motif) with at least 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 % , 92%, 93%, 94% , 95% , 96%, 97% , 98% , or 99% sequence identity to the conserved domain starting with amino acid 1 up to amino acid 106 in SEQ ID NO: 247.
The terms "domain", "signature" and "motif are defined in the "definitions" section herein. Concerning CYP704-like polypeptides, the polypeptide sequence which when used in the construction of a phylogenetic tree, such as the one published in Li et al., Plant Cell, 22:173-190, 2010, preferably clusters with the group of CYP704-like polypeptides comprising the amino acid sequence represented by AT2G45510 (SEQ ID NO: 8) rather than with any other group.
Furthermore, CYP704-li ke polypeptides (at least in their native form) typical ly have monooxygenase activity. Tools and techniques for measuring monooxygenase activity are well known in the art, for example the v-hydroxylation of fatty acids (C16 and C18) is catalysed by CYP704B2 (Dobritsa et al., Plant Physiology 151 , 574-589, 2009).
In one embodiment of the present invention the function of the nucleic acid sequences of the invention is to confer information for a protein that increases yield or yield related traits, when a nucleic acid sequence of the invention is transcribed and translated in a living plant cell.
In addition, CYP704-like polypeptides, when expressed in rice according to the methods of the present invention as outlined in Examples 8 and 9, give plants having increased yield related traits, in particular increased seed yield.
Concerning DUF121 8 polypeptides, the polypeptide sequence which when used in the construction of a phylogenetic tree, preferably clusters with the group of DUF1218 polypeptides comprising the amino acid sequence represented by SEQ ID NO: 88 rather than with any other group. As is well-known in the art, a phylogenetic tree of DUF1218 polypeptides can be constructed by aligning DUF1218 sequences using MAFFT (Katoh and Toh (2008) - Briefings in Bioinformatics 9:286-298). A neighbour-joining tree can be calculated using Quick-Tree (Howe et al. (2002), Bioinformatics 18(1 1 ): 1546-7), 100 bootstrap repetitions. A dendrogram can be drawn using Dendroscope (Huson et al. (2007), BMC Bioinformatics 8(1 ):460). Confidence levels for 100 bootstrap repetitions are generally indicated for major branchings. Figure 10 illustrates a phylogentic tree of a number of DUF1218 polypeptides
In addition, DUF1218 polypeptides, when expressed in rice according to the methods of the present invention as outlined in Examples 8 and 9, give plants having increased yield related traits, in particular increased seed yield , and more particu larly one or more parameters selected from the group comprising increased total seed weight, increased fill rate and increased thousand kernel weight.
Concerning translin-like polypeptides, the polypeptide sequence which when used in the construction of a phylogenetic tree, such as the one depicted in Figure 13, clusters with the group of translin-like polypeptides comprising the amino acid sequence represented by SEQ ID NO: 191 rather than with any other group.
Furthermore, translin-like polypeptides, at least in their native form, typically have DNA binding activity. Tools and techniques for measuring DNA binding activity are well known in the art.
In one embodiment of the present invention the function of the nucleic acid sequences of the invention is to confer information for a protein that increases yield or yield related traits, when a nucleic acid sequence of the invention is transcribed and translated in a living plant cell.
In addition, translin-like polypeptides, when expressed in rice according to the methods of the present invention as outlined in Examples 8 and 9, give plants having increased yield related traits, in particular increased seed yield , more in particular total seed yield (Totalwgseeds), seed fill rate (fillrate), harvest index and number of seeds (nrfilledseed).
Concerning ERG28-like polypeptides, the polypeptide sequence which when used in the construction of a phylogenetic tree, such as the one depicted in Figure 19, preferably clusters with the group of ERG28-like polypeptides comprising the amino acid sequence represented by S EQ I D NO: 247 rather than with any other group of sequences not comprising the PF03694 domain.
Furthermore, ERG28-like polypeptides (at least in their native form) typically may be involved in tethering sterols and/or steroid enzymes to membranes of the secretory system (such as for example the endoplasmatic reticulum, the Golgi apparatus, transport vesicles, secretory vesicles), and/or to mediate interactions between these enzymes. Tools and techniques for measuring demethylating activity are well known in the art, see for example Gachotte et al. (Journal of Lipid Research 42: 150-154, 2001 ).
In addition, ERG28-like polypeptides, when expressed in rice according to the methods of the present invention as outlined in Examples 8 and 9, give plants having increased yield related traits. Concerning CYP704-like polypeptides, the present invention is illustrated by transforming plants with the nucleic acid sequence represented by SEQ I D NO: 1 , encoding the polypeptide sequence of SEQ ID NO: 2. However, performance of the invention is not restricted to these sequences; the methods of the invention may advantageously be performed using any CYP704-like-encoding nucleic acid or CYP704-like polypeptide as defined herein, as was shown for SEQ ID NO: 4, encoded by SEQ ID NO: 3. Examples of nucleic acids encoding CYP704-like polypeptides are given in Table A1 of the Examples section herein. Such nucleic acids are useful in performing the methods of the invention. The amino acid sequences given in Table A1 of the Examples section are example sequences of orthologues and paralogues of the CYP704-like polypeptide represented by SEQ ID NO: 2, the terms "orthologues" and "paralogues" being as defined herein. Further orthologues and paralogues may readily be identified by performing a so- called reciprocal blast search as described in the definitions section; where the query sequence is SEQ ID NO: 1 or SEQ ID NO: 2, the second BLAST (back-BLAST) would be against Populus trichocarpa sequences, where the query sequence is SEQ ID NO: 3 or SEQ ID NO: 4, the second BLAST (back-BLAST) would be against rice sequences.
The invention also provides hitherto unknown CYP704-like-encoding nucleic acids and CYP704-like polypeptides useful for conferring enhanced yield-related traits in plants relative to control plants.
Concerning DUF1218 polypeptides, the present invention is illustrated by transforming plants with the nucleic acid sequence represented by S EQ I D NO: 87, encoding the polypeptide sequence of SEQ ID NO: 88. However, performance of the invention is not restricted to these sequences; the methods of the invention may advantageously be performed using any DUF1218-encoding nucleic acid or DUF1218 polypeptide as defined herein.
Examples of nucleic acids encoding DUF1218 polypeptides are given in Table A2 of the Examples section herein. Such nucleic acids are useful in performing the methods of the invention. The amino acid sequences given in Table A2 of the Examples section are example sequences of orthologues and paralogues of the DUF1218 polypeptide represented by SEQ ID NO: 88, the terms "orthologues" and "paralogues" being as defined herein. Further orthologues and paralogues may readily be identified by performing a so- called reciprocal blast search as described in the definitions section; where the query sequence is SEQ ID NO: 87 or SEQ ID NO: 88, the second BLAST (back-BLAST) would be against rice sequences.
The invention also provides hitherto unknown DUF1218-encoding nucleic acids and DUF1218 polypeptides useful for conferring enhanced yield-related traits in plants relative to control plants.
According to a further embodiment of the present invention, there is therefore provided an isolated nucleic acid molecule selected from:
(i) a nucleic acid represented by any one of SEQ ID NO: 87 or 97;
(ii) the complement of a nucleic acid represented by any one of SEQ ID NO: 87 or
97; (iii) a nucleic acid encoding a DUF1218 polypeptide having in increasing order of preference at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the amino acid sequence represented by any one of SEQ ID NO: 88 or 98, and additionally or alternatively comprising one or more motifs having in increasing order of preference at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any one or more of the motifs given in SEQ ID NO: 179 to SEQ ID NO: 185, and further preferably conferring enhanced yield-related traits relative to control plants.
(iv) a nucleic acid molecule which hybridizes with a nucleic acid molecule of (i) to (iii) under high stringency hybridization conditions and preferably confers enhanced yield-related traits relative to control plants.
According to another embodiment of the present invention, there is also provided an isolated polypeptide selected from:
(i) an amino acid sequence represented by any one of SEQ ID NO: 88 or 98;
(ii) an amino acid sequence having, in increasing order of preference, at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the amino acid sequence represented by SEQ ID NO: 88 or 98, and additionally or alternatively comprising one or more motifs having in increasing order of preference at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any one or more of the motifs given in SEQ ID NO: 179 to SEQ ID NO: 185, and further preferably conferring enhanced yield-related traits relative to control plants;
(iii) derivatives of any of the amino acid sequences given in (i) or (ii) above.
Concerning translin-like polypeptides, the present invention is illustrated by transforming plants with the nucleic acid sequence represented by SEQ I D NO: 1 90, encoding the polypeptide sequence of SEQ ID NO: 191 . However, performance of the invention is not restricted to these sequences; the methods of the invention may advantageously be performed using any translin-like -encoding nucleic acid or translin-like polypeptide as defined herein.
Examples of nucleic acids encoding translin-like polypeptides are given in Table A3 of the Examples section herein. Such nucleic acids are useful in performing the methods of the invention. The amino acid sequences given in Table A3 of the Examples section are example sequences of orthologues and paralogues of the transl i n-like polypeptide represented by SEQ ID NO: 191 , the terms "orthologues" and "paralogues" being as defined herein. Further orthologues and paralogues may readily be identified by performing a so-called reciprocal blast search as described in the definitions section; where the query sequence is SEQ ID NO: 190 or SEQ ID NO: 191 , the second BLAST (back-BLAST) would be against poplar sequences.
The invention also provides hitherto unknown translin-like polypeptide-encoding nucleic acids and translin-like polypeptides useful for conferring enhanced yield-related traits in plants relative to control plants.
According to a further embodiment of the present invention, there is therefore provided an isolated nucleic acid molecule selected from:
(i) a nucleic acid represented by any one of SEQ ID NO: 224 or 232;
(ii) the complement of a nucleic acid represented by any one of SEQ ID NO: 224 or 232;
(iii) a nucleic acid encoding a translin-like polypeptide having in increasing order of preference at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88% , 89% , 90% , 91 % , 92% , 93% , 94% , 95% , 96% , 97% , 98% , or 99% sequence identity to the amino acid sequence represented by any one of SEQ I D NO: 225 or 233, and additionally or alternatively comprising one or more motifs having in increasing order of preference at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% , 90%, 95%, 96%, 97% , 98%, 99% or more sequence identity to any one or more of the motifs given in SEQ ID NO: 238 to SEQ I D NO: 240, and further preferably conferring enhanced yield-related traits relative to control plants;
(iv) a nucleic acid molecule which hybridizes with a nucleic acid molecule of (i) to (iii) under high stringency hybridization conditions and preferably confers enhanced yield-related traits relative to control plants.
According to a further embodiment of the present invention, there is also provided an isolated polypeptide selected from:
(i) an amino acid sequence represented by any one of SEQ ID NO: 225 or 233; (ii) an amino acid sequence having, in increasing order of preference, at least 37%,
38%, 39%, 40%, 41 %, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94% , 95% , 96% , 97%, 98% , or 99% sequence identity to the ami no acid sequence represented by any one of SEQ ID NO: 225 or 233, and additionally or alternatively comprising one or more motifs havi ng in increasing order of preference at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any one or more of the motifs given in SEQ ID NO: 238 to SEQ ID NO: 240, and further preferably conferring enhanced yield-related traits relative to control plants;
(iii) derivatives of any of the amino acid sequences given in (i) or (ii) above.
Concerning ERG28-like polypeptides, the present invention is illustrated by transforming plants with the nucleic acid sequence represented by SEQ I D NO: 246, encoding the polypeptide sequence of SEQ ID NO: 247. However, performance of the invention is not restricted to these sequences; the methods of the invention may advantageously be performed using any ERG28-like-encoding nucleic acid or ERG28-like polypeptide as defined herein. In another embodiment, the invention is practiced with the nucleic acid sequence represented by SEQ ID NO: 248, encoding the polypeptide sequence of SEQ ID NO: 249. Examples of nucleic acids encoding ERG28-like polypeptides are given in Table A4 of the Examples section herein. Such nucleic acids are useful in performing the methods of the invention. The amino acid sequences given in Table A4 of the Examples section are example sequences of orthologues and paralogues of the ERG28-like polypeptide represented by SEQ I D NO: 247, the terms "orthologues" and "paralogues" being as defined herein. Further orthologues and paralogues may readily be identified by performing a so-called reciprocal blast search as described in the definitions section; where the query sequence is SEQ ID NO: 246 or SEQ ID NO: 247, the second BLAST (back-BLAST) would be against Arabidopsis thaliana sequences. Where the query sequence is SEQ ID NO: 248 or S EQ I D NO: 249, th e second BLAST (back-BLAST) would be against Solanum lycopersicum sequences.
Nucleic acid variants may also be useful in practising the methods of the invention. Examples of such variants include nucleic acids encoding homologues and derivatives of any one of the amino acid sequences given in Table A1 to A4 of the Examples section, the terms "homologue" and "derivative" being as defined herein. Also useful in the methods of the invention are nucleic acids encoding homologues and derivatives of orthologues or paralogues of any one of the amino acid seq uences given in Table A1 to A4 of the Examples section. Homologues and derivatives useful in the methods of the present invention have substantially the same biological and functional activity as the unmodified protein from which they are derived. Further variants useful in practising the methods of the invention are variants in which codon usage is optimised or in which miRNA target sites are removed.
Further nucleic acid variants useful in practising the methods of the invention include portions of nucleic acids encoding CYP704-like polypeptides, or DUF1218 polypeptides, or translin-like polypeptides, or ERG28-like polypeptides, nucleic acids hybridising to nucleic acids encoding encoding CYP704-like polypeptides, or DUF1218 polypeptides, or translin- like polypeptides, or ERG28-like polypeptides, splice variants of nucleic acids encoding encoding CYP704-like polypeptides, or DUF1218 polypeptides, or translin-like polypeptides, or ERG28-like polypeptides, allelic variants of nucleic acids encoding encoding CYP704-like polypeptides, or DUF1218 polypeptides, or translin-like polypeptides, or ERG28-like polypeptides, and variants of nucleic acids encoding encoding encoding CYP704-like polypeptides, or DUF 121 8 polypeptides, or translin-like polypeptides, or ERG28-like polypeptides, obtained by gene shuffling. The terms hybridising sequence, splice variant, allelic variant and gene shuffling are as described herein. Nucleic acids encoding CYP704-like polypeptides, or DUF1218 polypeptides, or translin-like polypeptides, or ERG28-like polypeptides, need not be full-length nucleic acids, since performance of the methods of the invention does not rely on the use of full-length nucleic acid sequences. According to the present invention, there is provided a method for enhancing yield-related traits in plants, comprising introducing and expressing in a plant a portion of any one of the nucleic acid sequences given in Table A1 to A4 of the Examples section, or a portion of a nucleic acid encoding an orthologue, paralogue or homologue of any of the amino acid sequences given in Table A1 to A4 of the Examples section.
A portion of a nucleic acid may be prepared, for example, by making one or more deletions to the nucleic acid. The portions may be used in isolated form or they may be fused to other coding (or non-coding) sequences in order to, for example, produce a protein that combines several activities. When fused to other coding sequences, the resultant polypeptide produced upon translation may be bigger than that predicted for the protein portion. Concerning CYP704-like polypeptides, portions useful in the methods of the invention, encode a CYP704-like polypeptide as defined herein, and have substantially the same biological activity as the amino acid sequences given in Table A1 of the Examples section. Preferably, the portion is a portion of any one of the nucleic acids given in Table A of the Examples section, or is a portion of a nucleic acid encoding an orthologue or paralogue of any one of the amino acid sequences given i n Table A1 of the Examples section . Preferably the portion is at least 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1 100, 1 150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850, 1900 consecutive nucleotides in length, the consecutive nucleotides being of any one of the nucleic acid sequences given in Table A1 of the Examples section, or of a nucleic acid encoding an orthologue or paralogue of any one of the amino acid sequences given in Table A1 of the Examples section. Most preferably the portion is a portion of the nucleic acid of SEQ ID NO: 1 or SEQ ID NO: 3. Preferably, the portion encodes a fragment of an amino acid sequence which, when used in the construction of a phylogenetic tree, such as the one published in Li et al., Plant Cell, 22:173-190, 2010, clusters with the group of CYP704-like polypeptides comprising the amino acid sequence represented by AT2G45510 (SEQ I D NO: 8) rather than with any ot h e r g ro u p , a n d /o r co m p r i se s a P 450 d o m a i n ( Pfa m P F 00067 ) a n d th e MGRMXXXWGXXXXXXXPERW signature sequence (SEQ ID NO: 72), and/or has monooxygenase activity, and/or has at least 20% sequence identity to SEQ ID NO: 2 or SEQ ID NO: 4. Concerning DUF1218 polypeptides, portions useful in the methods of the invention, encode a DU F1218 polypeptide as defined herein, and have substantially the same biological activity as the am ino acid sequ ences given in Ta ble A2 of the Examples section. Preferably, the portion is a portion of any one of the nucleic acids given in Table A2 of the Examples section, or is a portion of a nucleic acid encoding an orthologue or paralogue of any one of the amino acid sequences given in Table A2 of the Examples section. Preferably the portion is at least 500, 550, 600, 650, 700, 750, 800 consecutive nucleotides in length, the consecutive nucleotides being of any one of the nucleic acid sequences given in Table A2 of the Examples section, or of a nucleic acid encoding an orthologue or paralogue of any one of the amino acid sequences given in Table A2 of the Examples section. Most preferably the portion is a portion of the nucleic acid of SEQ ID NO: 87.
Preferably, the portion encodes a fragment of an amino acid sequence which has one or more of the following characteristics:
- when used in the construction of a phylogenetic tree, such as the one depicted in Figure 10, clusters with the group of polypeptides comprising the amino acid sequence represented by SEQ ID NO: 88 rather than with any other group;
comprises a DUF1218 domain as defined herein,
- comprises any one or more of the motifs 10 to 15 as provided herein, and
- has at least 30% sequence identity to SEQ ID NO: 88.
Concerning translin-like polypeptides, portions useful in the methods of the invention , encode a translin-like polypeptide as defined herein, and have substantially the same biological activity as the amino acid sequences given in Table A3 of the Examples section. Preferably, the portion is a portion of any one of the nucleic acids given in Table A3 of the Examples section, or is a portion of a nucleic acid encoding an orthologue or paralogue of any one of the amino acid sequences given i n Table A3 of the Examples section . Preferably the portion is at least 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950 consecutive nucleotides in length, the consecutive nucleotides being of any one of the nucleic acid sequences given in Table A3 of the Examples section, or of a nucleic acid encoding an orthologue or paralogue of any one of the amino acid sequences given in Table A3 of the Examples section. Most preferably the portion is a portion of the nucleic acid of SEQ ID NO: 190. Preferably, the portion encodes a fragment of an amino acid sequence which, when used in the construction of a phylogenetic tree, such as the one depicted in Figure 13, clusters with the group of translin-like polypeptides comprising the amino acid sequence represented by SEQ ID NO: 191 rather than with any other group, and/or comprises at least one of the motifs 16 to 18 (SEQ ID NO 238 to 240), and/or has DNA binding biological activity, and/or has at least 30.1 % sequence identity to SEQ ID NO: 191 .
Concerning translin-like polypeptides, portions useful in the methods of the invention, encode an ERG28-like polypeptide as defined herein, and have substantially the same biological activity as the amino acid sequences given in Table A4 of the Examples section. Preferably, the portion is a portion of any one of the nucleic acids given in Table A4 of the Examples section, or is a portion of a nucleic acid encoding an orthologue or paralogue of any one of the amino acid sequences given i n Table A4 of the Examples section . Preferably the portion is at least 100, 150, 200, 250, 300, 350, 400 consecutive nucleotides in length, the consecutive nucleotides being of any one of the nucleic acid sequences given in Table A4 of the Examples section, or of a nucleic acid encoding an orthologue or paralogue of any one of the amino acid sequences given in Table A4 of the Examples section. Most preferably the portion is a portion of the nucleic acid of SEQ ID NO: 246. Preferably, the portion encodes a fragment of an amino acid sequence which, when used in the construction of a phylogenetic tree, such as the one depicted in Figure 19, clusters with the group of ERG28-like polypeptides comprising the amino acid sequence represented by S EQ I D NO: 247 rather than with any other group of sequences not comprising the PF03694 domain, and/or comprises one or more of motifs 19 to 22, and/or has at least 40% sequence identity to SEQ ID NO: 247 or SEQ ID NO: 249.
Another nucleic acid variant useful in the methods of the invention is a nucleic acid capable of hybridising, under reduced stringency conditions, preferably under stringent conditions, with a nucleic acid encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or a ERG28-like polypeptide, as defined herein, or with a portion as defined herein.
According to the present invention, there is provided a method for enhancing yield-related traits in plants, comprising introducing and expressing in a plant a nucleic acid capable of hybridizing to any one of the nucleic acids given in Table A1 to A4 of the Examples section, or comprising introducing and expressing in a plant a nucleic acid capable of hybridising to a nucleic acid encoding an orthologue, paralogue or homologue of any of the nucleic acid sequences given in Table A1 to A4 of the Examples section. Hybridising sequences useful in the methods of the invention encode a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or a ERG28-like polypeptide, as defined herein, having substantially the same biological activity as the amino acid sequences given in Table A1 to A4 of the Examples section. Preferably, the hybridising sequence is capable of hybridising to the complement of any one of the nucleic acids given in Table A1 to A4 of the Examples section, or to a portion of any of these sequences, a portion being as defined herein, or the hybridising sequence is capable of hybridising to the complement of a nucleic acid encoding an orthologue or paralogue of any one of the amino acid sequences given in Table A1 to A4 of the Examples section.
Concerning CYP704-like polypeptides, the hybridising sequence is most preferably capable of hybridising to the complement of a nucleic acid as represented by SEQ ID NO: 1 or to a portion thereof. In one embodiment the hybridising sequence is capable of hybridising to the complement of a nucleic acid as represented by SEQ ID NO: 1 or to a portion thereof under conditions of medium or high stringency, preferably high stringency as defined herein. In another embodiment the hybridising sequence is capable of hybridising to the complement of a nucleic acid as represented by SEQ ID NO: 1 under stringent conditions.
Preferably, the hybridising sequence encodes a polypeptide with an amino acid sequence which, when full-length and used in the construction of a phylogenetic tree, such as the one published in Li et al., Plant Cell, 22: 173-190, 2010, clusters with the group of CYP704-like polypeptides comprising the amino acid sequence represented by AT2G45510 (SEQ I D NO: 8) rather than with any other group, and/or comprises a P450 domain (Pfam PF00067) and the MGRMXXXWGXXXXXXXPERW signature sequence (SEQ ID NO: 72), and/or has monooxygenase activity, and/or has at least 20% sequence identity to SEQ ID NO: 2 or SEQ ID NO: 4.
Cancerning DUF1218 polypeptides, the hybridising sequence is most preferably capable of hybridising to the complement of a nucleic acid as represented by SEQ ID NO: 87 or to a portion thereof. Preferably, the hybridising sequence encodes a polypeptide with an amino acid sequence which has one or more of the following characteristics,
- when full-length and used when used in the construction of a phylogenetic tree, such as the one depicted in Figure 10, clusters with the group of polypeptides comprising the amino acid sequence represented by SEQ ID NO: 88 rather than with any other group;
- comprises a DUF1218 domain as defined herein,
- comprises any one or more of the motifs 10 to 15 as provided herein, and
- has at least 30% sequence identity to SEQ ID NO: 88. Concerning translin-like polypeptides, the hybridising sequence is most preferably capable of hybridising to the complement of a nucleic acid as represented by SEQ ID NO: 190 or to a portion thereof. In one embodiment the hybridising sequence is capable of hybridising to the complement of a nucleic acid as represented by SEQ ID NO: 190 or to a portion thereof under conditions of medium or high stringency, preferably high stringency as defined herein. In another embodiment the hybridising sequence is capable of hybridising to the complement of a nucleic acid as represented by SEQ ID NO: 190 under stringent conditions. Preferably, the hybridising sequence encodes a polypeptide with an amino acid sequence which, when full-length and used in the construction of a phylogenetic tree, such as the one depicted in Figure 13, clusters with the group of translin-like polypeptides comprising the amino acid sequence represented by SEQ ID NO: 191 rather than with any other group group, and/or comprises at least one of the motifs 16 to 18 (SEQ ID NO 238 to 240), and/or has DNA binding biological activity, and/or has at least 30.1 % sequence identity to SEQ ID NO: 191 . Concerning ERG28-like polypeptides, the hybridising sequence is most preferably capable of hybridising to the complement of a nucleic acid as represented by SEQ ID NO: 246 or to a portion thereof.
Preferably, the hybridising sequence encodes a polypeptide with an amino acid sequence which, when full-length and used in the construction of a phylogenetic tree, such as the one depicted in Figure 19, clusters with the group of ERG28-like polypeptides comprising the amino acid sequence represented by SEQ ID NO: 247 rather than with any other group of sequences not comprising the PF03694 domain, and/or comprises one or more of motifs 19 to 22, and/or has at least 40% sequence identity to SEQ ID NO: 247 or SEQ ID NO: 249.
Another nucleic acid variant useful in the methods of the invention is a splice variant encodi ng a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or a ERG28-like polypeptide, as defined herein, a splice variant being as defined herein.
According to the present invention, there is provided a method for enhancing yield-related traits and/or altering steroid level/composition in plants, comprising introducing and expressing in a plant a splice variant of any one of the nucleic acid sequences given in Table A1 to A4 of the Examples section, or a splice variant of a nucleic acid encoding an orthologue, paralogue or homologue of any of the amino acid sequences given in Table A1 to A4 of the Examples section.
Concerning CYP704-like polypeptides, preferred splice variants are splice variants of a nucleic acid represented by SEQ ID NO: 1 , or a splice variant of a nucleic acid encoding an orthologue or paralogue of SEQ ID NO: 2. Preferably, the amino acid sequence encoded by the splice variant, when used in the construction of a phylogenetic tree, such as the one published in Li et al., Plant Cell, 22:173-190, 2010, clusters with the group of CYP704-like polypeptides comprising the amino acid sequence represented by AT2G45510 (SEQ I D NO: 8) rather than with any other group, and/or comprises a P450 domain (Pfam PF00067) and the MGRMXXXWGXXXXXXXPERW signature sequence (SEQ ID NO: 72), and/or has monooxygenase activity, and/or has at least 20% sequence identity to SEQ ID NO: 2 or SEQ ID NO: 4. Concerning DUF1218 polypeptides, preferred splice variants are splice variants of a nucleic acid represented by SEQ ID NO: 87, or a splice variant of a nucleic acid encoding an orthologue or paralogue of SEQ ID NO: 88. Preferably, the amino acid sequence encoded by the splice variant has one or more of the following characteristics,
- when used in the construction of a phylogenetic tree, such as the one depicted in Figure 10, clusters with the group of polypeptides comprising the amino acid sequence represented by SEQ ID NO: 88 rather than with any other group;
- comprises a DUF1218 domain as defined herein,
- comprises any one or more of the motifs 10 to 15 as provided herein, and
- has at least 30% sequence identity to SEQ ID NO: 88.
Concerning translin-like polypeptides, referred splice variants are splice variants of a nucleic acid represented by SEQ ID NO: 190, or a splice variant of a nucleic acid encoding an orthologue or paralogue of SEQ ID NO: 191. Preferably, the amino acid sequence encoded by the splice variant, when used in the construction of a phylogenetic tree, such as the one depicted i n Figure 1 3, clusters with the group of translin-like polypeptides comprising the amino acid sequence represented by SEQ ID NO: 191 rather than with any other group, and/or comprises at least one of the motifs 16 to 18 (SEQ ID NO 238 to 240), and/or has DNA binding biological activity, and/or has at least 30.1 % sequence identity to SEQ ID NO: 191 .
Concerning ERG28-like polypeptides, preferred splice variants are splice variants of a nucleic acid represented by SEQ ID NO: 246, or a splice variant of a nucleic acid encoding an orthologue or paralogue of SEQ ID NO: 247. Preferably, the amino acid sequence encoded by the splice variant, when used in the construction of a phylogenetic tree, such as the one depicted i n Figu re 1 9, cl usters with the grou p of E RG28-like polypeptides comprising the amino acid sequence represented by SEQ ID NO: 247 rather than with any other group of sequences not comprising the PF03694 domain, and/or comprises one or more of motifs 19 to 22, and/or has at least 40% sequence identity to SEQ ID NO: 247 or SEQ ID NO: 249.
Another nucleic acid variant useful in performing the methods of the invention is an allelic variant of a nucleic acid encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or a ERG28-like polypeptide, as defined herein, an allelic variant being as defined herein.
According to the present invention, there is provided a method for enhancing yield-related traits and/or altering steroid level/composition in plants, comprising introducing and expressing in a plant an allelic variant of any one of the nucleic acids given in Table A1 to A4 of the Examples section, or comprising introducing and expressing in a plant an allelic variant of a nucleic acid encoding an orthologue, paralogue or homologue of any of the amino acid sequences given in Table A1 to A4 of the Examples section.
Concerning CYP704-like polypeptides, the polypeptides encoded by allelic variants useful in the methods of the present invention have substantially the same biological activity as the CYP704-like polypeptide of SEQ ID NO: 2 and any of the amino acid sequences depicted in Table A1 of the Examples section. Allelic variants exist in nature, and encompassed within the methods of the present invention is the use of these natural alleles. Preferably, the allelic variant is an allelic variant of SEQ I D NO: 1 or an allelic variant of a nucleic acid encoding an orthologue or paralogue of SEQ ID NO: 2. Preferably, the amino acid sequence encoded by the allelic variant, when used in the construction of a phylogenetic tree, such as the one published in Li et al., Plant Cell, 22: 173-190, 2010, clusters with the group of CYP704-like polypeptides comprising the amino acid sequence represented by AT2G45510 (SEQ ID NO: 8) rather than with any other group, and/or comprises a P450 domain (Pfam PF00067) and the MGRMXXXWGXXXXXXXPERW signature sequence (SEQ ID NO: 72), and/or has monooxygenase activity, and/or has at least 20% sequence identity to SEQ ID NO: 2 or SEQ ID NO: 4.
Concerning DUF1218 polypeptides, the polypeptides encoded by allelic variants useful in the methods of the present invention have substantially the same biological activity as the DUF1218 polypeptide of SEQ ID NO: 88 and any of the amino acid sequences depicted in Table A1 of the Examples section. Allelic variants exist in nature, and encompassed within the methods of the present invention is the use of these natural alleles. Preferably, the allelic variant is an allelic variant of SEQ ID NO: 87 or an allelic variant of a nucleic acid encoding an orthologue or paralogue of SEQ I D NO: 88. Preferably, the amino acid sequence encoded by the allelic variant, has one or more of the following characteristics,
- when used in the construction of a phylogenetic tree, such as the one depicted in Figure 10, clusters with the group of polypeptides comprising the amino acid sequence represented by SEQ ID NO: 88 rather than with any other group;
- comprises a DUF1218 domain as defined herein,
- comprises any one or more of the motifs 10 to 15 as provided herein, and
- has at least 30% sequence identity to SEQ ID NO: 88.
Concerning translin-lile polypeptides, the polypeptides encoded by allelic variants useful in the methods of the present invention have substantially the same biological activity as the translin-like polypeptide of SEQ ID NO: 191 and any of the amino acid sequences depicted in Table A3 of the Examples section. Allelic variants exist in nature, and encompassed within the methods of the present invention is the use of these natural alleles. Preferably, the allelic variant is an allelic variant of SEQ ID NO: 190 or an allelic variant of a nucleic acid encoding an orthologue or paralogue of SEQ ID NO: 191 . Preferably, the amino acid sequence encoded by the allelic variant, when used in the construction of a phylogenetic tree, such as the one depicted in Figure 7, clusters with the translin-like polypeptides comprising the amino acid sequence represented by SEQ ID NO: 191 rather than with any other group, and/or comprises at least one of the motifs 16 to 18 (SEQ ID NO 238 to 240), and/or has DNA binding biological activity, and/or has at least 30.1 % sequence identity to SEQ ID NO: 191 .
Concerning ERG28-lile polypeptides, the polypeptides encoded by allelic variants useful in the methods of the present invention have substantially the same biological activity as the ERG28-like polypeptide of SEQ ID NO: 247 and any of the amino acid sequences depicted in Table A4 of the Examples section. Allelic variants exist in nature, and encompassed within the methods of the present invention is the use of these natural alleles. Preferably, the allelic variant is an allelic variant of SEQ ID NO: 246 or an allelic variant of a nucleic acid encoding an orthologue or paralogue of SEQ ID NO: 247. Preferably, the amino acid sequence encoded by the allelic variant, when used in the construction of a phylogenetic tree, such as the one depicted in Figure 19, clusters with the group of ERG28-like polypeptides comprising the amino acid sequence represented by SEQ ID NO: 247 rather than with any other group of sequences not comprising the PF03694 domain, and/or comprises one or more of motifs 19 to 22, and/or has at least 40% sequence identity to SEQ ID NO: 247 or SEQ ID NO: 249. Gene shuffling or directed evolution may also be used to generate variants of nucleic acids encoding CYP704-like polypeptides, or DUF1218 polypeptides, or translin-like polypeptides, or ERG28-like polypeptides, as defined above; the term "gene shuffling" being as defined herein. According to the present invention, there is provided a method for enhancing yield-related traits in plants, comprising introducing and expressing in a plant a variant of any one of the nucleic acid sequences given in Table A1 to A4 of the Examples section, or comprising introducing and expressing in a plant a variant of a nucleic acid encoding an orthologue, paralogue or homologue of any of the amino acid sequences given in Table A1 to A4 of the Examples section, which variant nucleic acid is obtained by gene shuffling.
Concerning CYP704-like polypeptides, the amino acid sequence encoded by the variant nucleic acid obtained by gene shuffling, when used in the construction of a phylogenetic tree, such as the one published in Li et al., Plant Cell, 22:173-190, 2010, preferably clusters with the grou p of CYP704-like polypeptides comprising the amino acid sequence represented by AT2G45510 (SEQ I D NO: 8) rather than with any other group, and/or comprises a P450 domain (Pfam PF00067) and the MGRMXXXWGXXXXXXXPERW signature sequence (SEQ ID NO: 72), and/or has monooxygenase activity, and/or has at least 20% sequence identity to SEQ ID NO: 2 or SEQ ID NO: 4. Concerning DUF1218 polypeptides, the amino acid sequence encoded by the variant nucleic acid obtained by gene shuffling, preferably has one or more of the following characteristics,
when used in the construction of a phylogenetic tree, such as the one depicted in Figure 10, clusters with the group of polypeptides comprising the amino acid sequence represented by SEQ ID NO: 88 rather than with any other group;
- comprises a DUF1218 domain as defined herein,
- comprises any one or more of the motifs 10 to 15 as provided herein, and
- has at least 30% sequence identity to SEQ ID NO: 88.
Concerning translin-like polypeptides, the amino acid sequence encoded by the variant nucleic acid obtained by gene shuffling, when used in the construction of a phylogenetic tree such as the one depicted in Figure 13, preferably clusters with the group of translin-like polypeptides comprising the amino acid sequence represented by SEQ ID NO: 191 rather than with any other group, and/or comprises at least one of the motifs 16 to 18 (SEQ ID NO 238 to 240), and/or has DNA binding biological activity, and/or has at least 30.1 % sequence identity to SEQ ID NO: 191.
Concerning ERG28-like polypeptides, the amino acid sequence encoded by the variant nucleic acid obtained by gene shuffling, when used in the construction of a phylogenetic tree, such as the one depicted in Figure 19, preferably clusters with the group of ERG28- like polypeptides comprising the amino acid sequence represented by SEQ I D NO: 247 rather than with any other group of sequences not comprising the PF03694 domain, and/or comprises one or more of motifs 19 to 22, and/or has at least 40% sequence identity to SEQ ID NO: 247 or SEQ ID NO: 249.
Furthermore, nucleic acid variants may also be obtained by site-directed mutagenesis. Several methods are available to achieve site-directed mutagenesis, the most common being PCR based methods (Current Protocols in Molecular Biology. Wiley Eds.).
CYP704-like polypeptides differing from the sequence of SEQ ID NO: 2 or SEQ ID NO: 4 by one or several amino acids may be used to increase the yield of plants in the methods and constructs and plants of the invention. Substituting one or more amino acids in a protein can be done using standard techniques known to the person skilled in the art.
Nucleic acids encoding CYP704-like polypeptides may be derived from any natural or artificial source. The nucleic acid may be modified from its native form in composition and/or genomic environment through deliberate human manipulation . Preferably the CYP704-like polypeptide-encoding nucleic acid is from a plant, further preferably from a monocotyledonous plant, more preferably from the family Poaceae, most preferably the nucleic acid is from Oryza sativa. In another embodiment, the CYP704-like polypeptide- encoding nucleic acid is from a dicotyledonous plant, preferably from the family Salicaceae, more preferably from Populus trichocarpa.
Nucleic acids encoding DUF1218 polypeptides may be derived from any natural or artificial source. The nucleic acid may be modified from its native form in composition and/or genomic environment through deliberate human manipulation. Preferably the DUF1218 polypeptide-e n cod i n g n u cl e i c aci d i s fro m a pl a nt , fu rth er p refe ra b l y from a monocotyledonous plant, more preferably from the family Poaceae, more preferably from the genus Oryza, most preferably the nucleic acid is from Oryza sativa.
Nucleic acids encoding translin-like polypeptides may be derived from any natural or artificial source. The nucleic acid may be modified from its native form in composition and/or genomic environment through deliberate human manipulation. Preferably the translin-like polypeptide-encoding nucleic acid is from a plant, further preferably from a dicotyledonous plant, more preferably from the family Salicaceae, most preferably the nucleic acid is from Populus trichocarpa.
Nucleic acids encoding ERG28-like polypeptides may be derived from any natural or artificial source. The nucleic acid may be modified from its native form in composition and/or genomic environment through deliberate human manipulation, including but not limited to hybrid ERG28-like proteins comprising parts of two or more other ERG28-like proteins, or synthetic fusion proteins of an ERG28-like protein with domains of other proteins. Preferably the ERG28-like polypeptide-encoding nucleic acid is from (or is derived from) yeast or a plant, further preferably from a dicotyledonous plant, more preferably from the family Brassicaceae, most preferably the nucleic acid is from Arabidopsis thaliana. In another embodiment, the ERG28-like polypeptide-encoding nucleic acid is from the family Solanaceae, most preferably the nucleic acid is from Solarium lycopersicum.
Concerning ERG28-like polypeptides, the term "steroid", as used herein, encompasses "sterols" and is used herein interchangeably. Steroids form a group of compounds based on the saturated tetracyclic hydrocarbon: 1 ,2-cyclopentanoperhydrophenanthrene which may have substitutions at C10 and C13 by methyl groups and may have ketone, hydroxyl, alkyl or other side-chains at C17. Steroid molecules may be divided into several groups such as for example sterols, brassinosteroids, bufadienolides, cardenolides, cucurbitaci ns, ecdysteroids, sapogenins, steroid alkaloids, withasteroids, bile acids, hormonal steroids.
Phytosterols are synthesized via the mevalonate pathway of terpenoid formation. Plant steroids are derived from sterols and comprise the plant steroid hormones brassinosteroids. Plant steroids and sterols have been shown to play an essential role in the regulation of many plant growth and developmental processes. Alterations in sterol levels are known to affect embryogenesis, cell elongation and vascular differentiation (Clouse, Plant Cell 14: 1995-2000, 2002 and references therein). Interestingly in terms of agronomical applications, sterols also appear to be involved in resistance of the plants to pathogens. For instance, exogenous application of ergosterol, the main sterol of most fungi, promotes the expression of a number of defence genes and leads to enhanced tolerance toward fungal pathogen in plants (Laquitaine et al, Molecular Plant-Microbe Interactions 19: 1 103-11 12, 2006; Lochman et al, Plant Molecular Biology 62: 43-51 , 2006). However, it remains to be elucidated if change in plant sterol composition and/or levels also confer increased tolerance to abiotic stresses in plants. Lastly, evidences suggest that alterations in sterol composition in plants may lead to modified nutritional qualities of plants. For instance, overexpression of the gene GmSMTI in potato plants lead to a reduction in cholesterol and glycoalkaloid (TGA) levels (Arnqvist et al, Plant Physiology 131 : 1792-1799, 2003). Further, plant sterols are also thought to have beneficial effects on human health (a relatively high consumption of phytosterol tends to enhance the immune function and red uce the cholesterol level in humans; Piironen et al, Journal of the Science of Food and Agriculture 80: 939-966, 2000). Therefore it would be beneficial to be able to manipulate the steroid composition of a plant and/or to increase or decrease the levels of steroids in a plant. It has now surprisingly been found that in one embodiment, modulating the expression of ERG28- like proteins in a plant results in altered sterol and/or steroid composition and/or modified sterol and/or steroid levels in a plant. In a second embodiment, it has now surprisingly been found that modulating the expression of ERG28-like proteins in yeast results in improved yeast growth and/or reproduction, compared to wild type yeast. The invention also provides use of ERG28-like proteins to improve yeast growth and/or reproduction under normal and/or stressed growth conditions.
In a third embodiment, modulating expression (increased or decreased expression) of ERG28-like protei ns i n a plant resu lts i n en hanced yield-related traits. Particularly, decreased expression of ERG28-like protein results in increased seed yield and shorter, swollen root with increased root hair density in comparison with wildtype plants as described and exemplified herein in Example 14.
In one embodiment the present invention extends to recombinant chromosomal DNA comprising a nucleic acid sequence useful in the methods of the invention, wherein said nucleic acid is present in the chromosomal DNA as a result of recombinant methods, i.e. said nucleic acid is not in the chromosomal DNA in its native surrounding. Said recombinant chromosomal DNA may be a chromosome of native origin, with said nucleic acid inserted by recombinant means, or it may be a mini-chromosome or a non-native chromosomal structure, e.g. or an artificial chromosome. The nature of the chromosomal DNA may vary, as long it allows for stable passing on to successive generations of the recombinant nucleic acid useful in the methods of the invention, and allows for expression of said nucleic acid in a living plant cell resulting in increased yield or increased yield related traits of the plant cell or a plant comprising the plant cell. In a further embodiment the recombinant chromosomal DNA of the invention is comprised in a plant cell.
Performance of the methods of the invention gives plants having enhanced yield-related traits. In particular performance of the methods of the invention gives plants having increased yield, especially increased seed yield relative to control plants. The terms "yield" and "seed yield" are described in more detail in the "definitions" section herein.
Reference herein to enhanced yield-related traits is taken to mean an increase early vigour and/or in biomass (weight) of one or more parts of a plant, which may include (i) aboveground parts and preferably aboveground harvestable parts and/or (ii) parts below ground and preferably harvestable below ground. In particular, such harvestable parts are seeds, and performance of the methods of the invention results in plants having increased seed yield relative to the seed yield of control plants.
The present invention provides a method for increasing plant yield, especially seed yield of plants, relative to control plants, which method comprises modulating expression in a plant of a nucleic acid encoding a CYP704-like polypeptide as defined herein. The present invention also provides a method for increasing yield-related traits, in particular yield, especially seed yield of plants, relative to control plants, which method comprises modulating expression in a plant of a nucleic acid encoding a DUF121 8 polypeptide as defined herein. The present invention also provides a method for increasing yield, especially harvest index and/or seed yield of plants, relative to control plants, which method comprises modulating expression in a plant of a nucleic acid encoding a translin-like polypeptide as defined herein. The present invention also provides a method for increasing yield-related traits and/or altering (increasing or decreasing) steroid level/composition, especially yield of plants, relative to control plants, which method comprises modulating expression (increased or decreased expression) in a plant of a nucleic acid encoding an ERG28-like polypeptide as defined herein.
According to a preferred feature of the present invention, performance of the methods of the invention gives plants having an increased growth rate relative to control plants. Therefore, according to the present invention, there is provided a method for increasing the growth rate of plants, which method comprises modulating expression in a plant of a nucleic acid encodi ng a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide, as defined herein.
Performance of the methods of the invention gives plants grown under non-stress conditions or under mild drought conditions increased yield and/or altered (increased or decreased) steroid level/composition relative to control plants grown under comparable conditions. Therefore, according to the present invention, there is provided a method for increasing yield and/or altered (increased or decreased) steroid level/composition in plants grown under non-stress conditions or under mild drought conditions, which method comprises modulating expression in a plant of a nucleic acid a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide. Performance of the methods of the invention gives plants grown under conditions of drought, increased yield and/or altered (increased or decreased) steroid level/composition relative to control plants grown under comparable conditions. Therefore, according to the present invention, there is provided a method for increasing yield and/or altered steroid (increased or decreased) level/composition in plants grown under conditions of drought which method comprises modulating expression in a plant of a nucleic acid encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide.
Performance of the methods of the invention gives plants grown under conditions of nutrient deficiency, particularly under conditions of nitrogen deficiency, increased yield and/or altered (increased or decreased) steroid level/composition relative to control plants grown under comparable conditions. Therefore, according to the present invention, there is provided a method for increasing yield and/or altered (increased or decreased) steroid level/composition in plants grown under conditions of nutrient deficiency, which method comprises modulating expression in a plant of a nucleic acid encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide.
Performance of the methods of the invention gives plants grown under conditions of salt stress, increased yield and/or altered (increased or decreased) steroid level/composition relative to control plants grown under comparable conditions. Therefore, according to the present invention, there is provided a method for increasing yield and/or altered (increased or decreased) steroid level/composition in plants grown under conditions of salt stress, which method comprises modulating expression in a plant of a nucleic acid encoding a CYP704-like polypeptide, or a DUF12 8 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide.
The invention also provides genetic constructs and vectors to facilitate introduction and/or expression in plants of nucleic acids encoding CYP704-like polypeptides, or DUF1218 polypeptides, or translin-like polypeptides, or ERG28-like polypeptides. The gene constructs may be inserted into vectors, which may be commercially available, suitable for transforming into plants and suitable for expression of the gene of interest in the transformed cells. The invention also provides use of a gene construct as defined herein in the methods of the invention.
More specifically, the present invention provides a construct comprising:
(a) a nucleic acid encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide as defined above; one or more control sequences capable of driving expression of the nucleic acid sequence of (a); and optionally
a transcription termination sequence. Preferably, the nucleic acid encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide, is as defined above. The term "control sequence" and "termination sequence" are as defined herein.
The genetic construct of the invention may be comprised in a host cell, plant cell, seed, agricultural product or plant. Plants or host cells are transformed with a genetic construct such as a vector or an expression cassette comprising any of the nucleic acids described above. Thus the invention furthermore provides plants or host cells transformed with a construct as described above. In particular, the invention provides plants transformed with a construct as described above, which plants have increased yield-related traits and/or altered (increased or decreased) steroid level/composition as described herein.
Plants are transformed with a vector comprising any of the nucleic acids described above. The skilled artisan is well aware of the genetic elements that must be present on the vector in order to successfully transform, select and propagate host cells containing the sequence of interest. The sequence of interest is operably linked to one or more control sequences, at least to a promoter, in the vectors of the invention.
The promoter in such an expression cassette may be a non-native promoter to the nucleic acid described above, i.e. a promoter not regulating the expression of said nucleic acid in its native surrounding. In a further embodiment the expression cassettes of the invention confer increased yield or yield related traits(s) to a living plant cell when they have been introduced into said plant cell and result in expression of the nucleic acid as defined above, comprised in the expression cassette(s). Advantageously, any type of promoter, whether natural or synthetic, may be used to drive expression of the nucleic acid sequence, but preferably the promoter is of plant origin. A constitutive promoter is particularly useful in the methods. Preferably the constitutive promoter is a ubiquitous constitutive promoter of medium strength. See the "Definitions" section herein for definitions of the various promoter types.
The constitutive promoter is preferably a medium strength promoter. More preferably it is a plant derived promoter, e.g. a promoter of plant chromosomal origin, such as a GOS2 promoter or a promoter of substantially the same strength and having substantially the same expression pattern (a functionally equivalent promoter), more preferably the promoter is the promoter GOS2 promoter from rice. Further preferably the constitutive promoter is represented by a nucleic acid sequence substantially similar to SEQ ID NO: 83, or SEQ ID NO: 186, or SEQ ID NO: 242, or SEQ ID NO: 301 , most preferably the constitutive promoter is as represented by SEQ ID NO: 83, or SEQ ID NO: 186, or SEQ ID NO: 242, or SEQ ID NO: 301 . See the "Definitions" section herein for further examples of constitutive promoters. Concerning ERG28-like polypeptides, in a particular embodiment with Arabidopsis thaliana as host plant, the CaMV35S promoter may be used as constitutive promoter.
Concerning CYP704-like polypeptides it should be clear that the applicability of the present invention is not restricted to the CYP704-like polypeptide-encoding nucleic acid represented by SEQ ID NO: 1 , nor is the applicability of the invention restricted to expression of a CYP704-like polypeptide-encoding nucleic acid when driven by a constitutive promoter, or when driven by a root-specific promoter.
Concerning DUF1218 polypeptides it should be clear that the applicability of the present invention is not restricted to the DUF1218 polypeptide-encoding nucleic acid represented by S EQ I D NO : 87, nor is the applicability of the invention restricted to expression of a DUF1218 polypeptide-encoding nucleic acid when driven by a constitutive promoter.
Concerning translin-like polypeptides it should be clear that the applicability of the present invention is not restricted to the translin-like polypeptide-encoding nucleic acid represented by SEQ ID NO: 190 nor is the applicability of the invention restricted to expression of a translin-like polypeptide-encoding nucleic acid when driven by a constitutive promoter.
Concerning ERG28-like polypeptides it should be clear that the applicability of the present invention is not restricted to the ERG28-like polypeptide-encoding nucleic acid represented by SEQ ID NO: 246 or SEQ ID NO: 247, nor is the applicability of the invention restricted to expression of an E RG28-like polypeptide-encoding nucleic acid when driven by a constitutive promoter. Concerning CYP704-like polypeptides, optionally, one or more terminator sequences may be used in the construct introduced into a plant. Preferably, the construct comprises an expression cassette comprising a GOS2 promoter, substantially similar to SEQ ID NO: 83, operably linked to the nucleic acid encoding the CYP704-like polypeptide. More preferably, the construct comprises a zein terminator (t-zein) linked to the 3' end of the CYP704-like coding sequence. Furthermore, one or more sequences encoding selectable markers may be present on the construct introduced into a plant.
Concerning DUF1218 polypeptides, optionally, one or more terminator sequences may be used in the construct introduced into a plant. Preferably, the construct comprises an expression cassette comprising a GOS2 promoter, substantially similar to SEQ ID NO: 186, operably linked to the nucleic acid encoding the DUF1218 polypeptide. More preferably, the construct comprises a zein terminator (t-zein) linked to the 3' end of the DUF1218 sequence. Most preferably, the expression cassette comprises a sequence having in increasing order of preference at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity to the sequence represented by SEQ ID NO: 187 (pGOS2::DUF1218::t- zein sequence). Furthermore, one or more sequences encoding selectable markers may be present on the construct introduced into a plant.
Concerning translin-like polypeptides, optionally, one or more terminator sequences may be used in the construct introduced into a plant. Preferably, the construct comprises an expression cassette comprising a GOS2 promoter, substantially similar to SEQ ID NO: 242, operably linked to the nucleic acid encoding the translin-like polypeptide. More preferably, the construct comprises a zein terminator (t-zein) linked to the 3' end of the translin-like coding sequence. Most preferably, the expression cassette comprises a sequence having in increasing order of preference at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity to the sequence represented by SEQ ID NO: 241 (pPRO::translin-like gene::t-zein sequence). Furthermore, one or more sequences encoding selectable markers may be present on the construct introduced into a plant.
Concerning ERG28-like polypeptides, optionally, one or more terminator sequences may be used in the construct introduced into a plant. Preferably, the construct comprises an expression cassette comprising a GOS2 promoter, substantially similar to SEQ ID NO: 301 , operably linked to the nucleic acid encoding the ERG28-like polypeptide. More preferably, the construct comprises a zein terminator (t-zein) linked to the 3' end of the ERG28-like coding sequence. Furthermore, one or more sequences encoding selectable markers may be present on the construct introduced into a plant.
According to a preferred feature of the invention, the modulated expression is increased expression. Methods for increasing expression (or overexpression) of nucleic acids or genes, or gene products, are well documented in the art and examples are provided in the definitions section.
According to another preferred feature of the invention, the modulated expression is decreased expression. Methods for decreasing expression of nucleic acids or genes, or gene products, are known to the skilled person and well documented in the art. In a particular embodiment, T-DNA insertion is used for decreasing expression of an ERG28-like gene/nucleic acid. Alternative methods for decreasing expression are described herein within the definitions section.
As mentioned above, a preferred method for modulating expression of a nucleic acid encodi ng a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide, is by introducing and expressing in a plant a nucleic acid encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin- like polypeptide, or an ERG28-like polypeptide; however the effects of performing the method, i.e. enhancing yield-related traits may also be achieved using other well known techniques, including but not limited to T-DNA activation tagging, TILLING, homologous recombination. A description of these techniques is provided in the definitions section.
The invention also provides a method for the production of transgenic plants having enhanced yield-related traits and/or altered steroid level/composition relative to control plants, comprising introduction and expression in a plant of any nucleic acid encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide, as defined hereinabove. More specifically, the present invention provides a method for the production of transgenic plants having enhanced yield-related traits, particularly increased (seed) yield, which method comprises:
(i) introducing and expressing in a plant or plant cell a CYP704-like polypeptide- encoding nucleic acid or a genetic construct comprising a CYP704-like polypep- tide-encoding nucleic acid; and
(ii) cultivating the plant cell under conditions promoting plant growth and development.
Cultivating the plant cell under conditions promoting plant growth and development, may or may not include regeneration and or growth to maturity.
More specifically, the present invention provides a method for the production of transgenic plants having enhanced yield-related traits, particularly increased yield, and more particularly increased seed yield, which method comprises:
(i) introducing and expressing in a plant or plant cell a DUF121 8 polypeptide- encoding nucleic acid or a genetic construct comprising a DUF1218 polypeptide- encoding nucleic acid; and
(ii) cultivating the plant cell under conditions promoting plant growth and development.
Cultivating the plant cell under conditions promoting plant growth and development, may or may not include regeneration and or growth to maturity.
More specifically, the present invention provides a method for the production of transgenic plants having enhanced yield-related traits, particularly increased seed yield and/or increased harvest index, which method comprises:
(i) introducing and expressing in a plant or plant cell a translin-like polypeptide- encoding nucleic acid or a genetic construct comprising a translin-like polypep- tide-encoding nucleic acid; and
(ii) cultivating the plant cell under conditions promoting plant growth and development. Cultivating the plant cell under conditions promoting plant growth and development, may or may not include regeneration and or growth to maturity.
More specifically, the present invention provides a method for the production of transgenic plants having enhanced yield-related traits and/or altered steroid level/composition, particularly increased (seed) yield, which method comprises:
(i) introducing and expressing in a plant or plant cell an ERG28-like polypeptide- encoding nucleic acid or a genetic construct comprising an ERG28-like polypep- tide-encoding nucleic acid; and
(ii) cultivating the plant cell under conditions promoting plant growth and development.
Cultivating the plant cell under conditions promoting plant growth and development, may or may not include regeneration and or growth to maturity.
Cultivating the plant cell under conditions promoting plant growth and development, may or may not include regeneration and/or growth to maturity. Accordingly, in a particular embodiment of the invention, the plant cell transformed by the method according to the invention is regenerable into a transformed plant. In another particular embodiment, the plant cell transformed by the method according to the invention is not regenerable into a transformed plant, i.e. cells that are not capable to regenerate into a plant using cell culture tech niques known in the art. Wh ile plants cells generally have the characteristic of totipotency, some plant cells can not be used to regenerate or propagate intact plants from said cells. In one embodiment of the invention the plant cells of the invention are such cells. In another embodiment the plant cells of the invention are plant cells that do not sustain themselves in an autotrophic way.
The nucleic acid may be introduced directly into a plant cell or into the plant itself (including introduction into a tissue, organ or any other part of a plant). According to a preferred feature of the present invention, the nucleic acid is preferably introduced into a plant or plant cell by transformation. The term "transformation" is described in more detail in the "definitions" section herein.
In one embodiment the present invention extends to any plant cell or plant produced by any of the methods described herein, and to all plant parts and propagules thereof.
The present invention encompasses plants or parts thereof (including seeds) obtainable by the methods according to the present invention. The plants or parts thereof comprise a nucleic acid transgene encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide, as defined above. The present invention extends further to encompass the progeny of a primary transformed or transfected cell, tissue, organ or whole plant that has been produced by any of the aforementioned methods, the only requirement being that progeny exhibit the same genotypic and/or phenotypic characteristic(s) as those produced by the parent in the methods according to the invention. Concerning ERG28-like polypeptides, the present invention also extends to yeast cells produced by any of the methods described herein. The term yeast or yeast cell as used herein refers to un icel l ula r microorgani sms that bel ong to one of three classes: Ascomycetes, Basidiomycetes and Fungi Imperfecti. Preferably, the yeast is a nonpathogenic strain selected from Saccharomyces, Candida, Cryptococcus, Hansenula, Kluyveromyces, Pichia, Rhodotorula, Schizosaccharomyces and Yarrowia, more preferably the yeast is se lected from Sacch aromyces , Can d id a , H a nsen u la , Pichia and Schizosaccharomyces, most preferably the yeast is Saccharomyces. Preferred species of yeast strains include Saccharomyces cerevisiae, Saccharomyces carlsbergensis, Candida kejyr, Candida tropicalis, Cryptococcus laurentii, Cryptococcus neoformans, Hansenula anomala, Hansenula polymorpha, Kluyveromyces frag His, Kluyveromyces lactis, Kluyveromyces marxianus var. lactis, Pichia pastoris, Rhodotorula rubra, Schizosaccharomyces pombe, and Yarrowia lipolytica. It is to be appreciated that a number of these species include a variety of subspecies, types, subtypes, etc. that are meant to be included within the aforementioned species. Most preferably the yeast species used in the methods of the present invention is a yeast species that is "Generally Recognized As Safe" or "GRAS" for use as food additives (GRAS, FDA proposed Rule 62FR18938, April 17, 1997).
The present invention also extends in another embodiment to transgenic plant cells and seed comprising the nucleic acid molecule of the invention in a plant expression cassette or a plant expression construct.
In a further embodiment the seed of the invention recombinantly comprises the expression cassette of the invention, the (expression) construct of the invention, the nucleic acids described above and/or the proteins encoded by the nucleic acids as described above. A further embodiment of the present invention extends to plant cells comprising the nucleic acid as described above in a recombinant plant expression cassette.
In yet another embodiment the plant cells of the invention are non-propagative cells, e.g. the cells can not be used to regenerate a whole plant from this cell as a whole using standard cell culture techniques, this meaning cell culture methods but excluding in-vitro nuclear, organelle or chromosome transfer methods. While plant cells generally have the characteristic of totipotency, some plant cells can not be used to regenerate or propagate intact plants from said cells. In one embodiment of the invention the plant cells of the invention are such cells. In another embodiment the plant cells of the invention are plant cells that do not sustain themselves through photosynthesis by synthesizing carbohydrate and protein from such inorganic substances as water, carbon dioxide and mineral salt, i.e. they may be deemed non-plant variety. In a further embodiment the plant cells of the invention are non-plant vari- ety and non-propagative.
The invention also includes host cells containing an isolated nucleic acid encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide, as defined hereinabove. Host cells of the invention may be any cell selected from the group consisting of bacterial cells, such as E. coli or Agrobacterium species cells, yeast cells, fungal , algal or cyanobacterial cells or plant cells. I n one embodiment host cells according to the invention are plant cells, yeasts, bacteria or fungi. Host plants for the nucleic acids or the vector used in the method according to the invention, the expression cassette or construct or vector are, in principle, advantageously all plants, which are capable of synthesizing the polypeptides used in the inventive method.
The methods of the invention are advantageously applicable to any plant, in particular to any plant as defined herein . Plants that are particularly useful in the methods of the invention include all plants which belong to the superfamily Viridiplantae, in particular monocotyledonous and dicotyledonous plants including fodder or forage leg umes , ornamental plants, food crops, trees or shrubs. According to an embodiment of the present invention, the plant is a crop plant. Examples of crop plants include but are not limited to chicory, carrot, cassava, trefoil, soybean, beet, sugar beet, sunflower, canola, alfalfa, rapeseed, linseed, cotton, tomato, potato and tobacco. According to another embodiment of th e p resen t i n ven ti on , th e pl a nt i s a m o n ocotyl ed o n o us p l a nt. Exam pl es of monocotyledonous plants include sugarcane. According to another embodiment of the present invention, the plant is a cereal. Examples of cereals include rice, maize, wheat, barley, millet, rye, triticale, sorghum, emmer, spelt, einkorn , teff, milo and oats. In a particular embodiment the plants used in the methods of the invention are selected from the group consisting of maize, wheat, rice, soybean, cotton, oilseed rape including canola, sugarcane, sugar beet and alfalfa. Advantageously the methods of the invention are more efficient than the known methods, because the plants of the invention have increased yield and/or tolerance to an environmental stress compared to control plants used in comparable methods.
According to another embodiment, the plant is a non-seed plant, such as algae and mosses. The term "algae" as used in the present application refers to unicellular or multicellular eukaryotic organisms, formerly classified as plants, that are photosynthetic but lack true stems, roots, and leaves. Algae that are particularly useful in the methods of the invention include all species and subspecies of the genus Selaginella, in particular the species Selaginella moellendorffii. The term "moss" refers to nonvascular plants of the class Musci of the division Bryophyta. Moss that are particularly useful in the methods of the invention include all species and subspecies of the genus Physcomitrella, in particular the species Physcomitrella patens.
The invention also includes host cells containing an isolated nucleic acid encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide, as defined herein. In one embodiment host cells according to the invention are plant cells, yeasts, bacteria or fungi . Host plants for the nucleic acids, construct, expression cassette or the vector used in the method according to the invention are, in pri nciple, advantageously all plants which are capable of synthesizi ng the polypeptides used in the inventive method. In a particular embodiment the plant cells of the invention overexpress the nucleic acid molecule of the invention.
The invention also extends to harvestable parts of a plant such as, but not limited to seeds, leaves, fruits, flowers, stems, roots, rhizomes, tubers and bulbs, which harvestable parts comprise a recombinant nucleic acid encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide. The invention furthermore relates to products derived or produced, preferably directly derived or produced, from a harvestable part of such a plant, such as dry pellets, meal or powders, oil, fat and fatty acids, starch or proteins.
The invention also includes methods for manufacturing a product comprising a) growing the plants of the invention and b) producing said product from or by the plants of the invention or parts thereof, including seeds. In a further embodiment the methods comprise the steps of a) growing the plants of the invention, b) removing the harvestable parts as described herein from the plants and c) producing said product from, or with the harvestable parts of plants according to the invention. Examples of such methods would be growing corn plants of the invention, harvesting the corn cobs and remove the kernels. These may be used as feedstuff or processed to starch and oil as agricultural products. The product may be produced at the site where the plant has been grown, or the plants or parts thereof may be removed from the site where the plants have been grown to produce the product. Typically, the plant is grown, the desired harvestable parts are removed from the plant, if feasible in repeated cycles, and the product made from the harvestable parts of the plant. The step of growing the plant may be performed only once each time the methods of the invention is performed, while allowing repeated times the steps of product production e.g. by repeated removal of harvestable parts of the plants of the invention and if necessary further processing of these parts to arrive at the product. It is also possible that the step of growing the plants of the invention is repeated and plants or harvestable parts are stored until the production of the product is then performed once for the accumulated plants or plant parts. Also, the steps of growing the plants and producing the product may be performed with an overlap in time, even simultaneously to a large extend, or sequentially. Generally the plants are grown for some time before the product is produced. In one embodiment the products produced by the methods of the invention are plant products such as, but not limited to, a foodstuff, feedstuff, a food supplement, feed supplement, fiber, cosmetic or pharmaceutical. Foodstuffs are regarded as compositions used for nutrition or for supplementing nutrition. Animal feedstuffs and animal feed supplements, in particular, are regarded as foodstuffs. In another embodiment the methods for production are used to make agricultural products such as, but not limited to, plant extracts, proteins, amino acids, carbohydrates, fats, oils, polymers, vitamins, and the like. It is possible that a plant product consists of one ore more agricultural products to a large extent.
In yet another embodiment the polynucleotides or the polypeptides of the invention are comprised in an agricultural product. In a particular embodiment the nucleic acid sequences and protein sequences of the invention may be used as product markers, for example where an agricultural product was produced by the methods of the invention. Such a marker can be used to identify a product to have been produced by an advantageous process resulting not only in a greater efficiency of the process but also improved quality of the product due to increased quality of the plant material and harvestable parts used in the process. Such markers can be detected by a variety of methods known in the art, for example but not limited to PCR based methods for nucleic acid detection or antibody based methods for protein detection.
The present invention also encompasses use of nucleic acids encoding POI polypeptides as described herein and use of these CYP704-like polypeptides, or DUF1218 polypeptides, or translin-like polypeptides, or ERG28-like polypeptides, in enhancing any of the aforementioned yield-related traits in plants. For example, nucleic acids encoding CYP704- like polypeptide, or DUF1218 polypeptide, or translin-like polypeptide, or ERG28-like polypeptide, described herein, or the CYP704-like polypeptides, or DUF1218 polypeptides, or translin-like polypeptides, or ERG28-like polypeptides, themselves, may find use in breeding programmes in which a DNA marker is identified which may be genetically linked to a gene encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide. The nucleic acids/genes, or the CYP704-like polypeptides, or DUF 121 8 polypeptides, or translin-like polypeptides, or ERG28-like polypeptides, themselves may be used to define a molecular marker. This DNA or protein marker may then be used in breeding programmes to select plants having enhanced yield- related traits as defined herein in the methods of the invention. Furthermore, allelic variants of anucleic acid/gene encoding a CYP704-like polypeptide, or a DUF1218 polypeptide, or a translin-like polypeptide, or an ERG28-like polypeptide, may find use in marker-assisted breeding programmes. Nucleic acids encoding CYP704-like polypeptides, or DUF121 8 polypeptides, or translin-like polypeptides, or ERG28-like polypeptides, may also be used as probes for genetically and physically mapping the genes that they are a part of, and as markers for traits linked to those genes. Such information may be useful in plant breeding in order to develop lines with desired phenotypes.
Concerning translin polypeptides, in one embodiment any comparison to determine sequence identity percentages is performed
in the case of a comparison of nucleic acids over the entire coding region of SEQ ID NO: 190, or
in the case of a comparison of polypeptide sequences over the entire length of SEQ ID NO: 191.
For example, a sequence identity of 50% sequence identity in this embodiment means that over the entire coding region of SEQ ID NO: 190, 50 percent of all bases are identical between the sequence of SEQ ID NO: 190 and the related sequence. Similarly, in this embodiment a polypeptide sequence is 50 % identical to the polypeptide sequence of SEQ ID NO: 191 , when 50 percent of the amino acids residues of the sequence as represented in SEQ ID NO: 191 , are found in the polypeptide tested when comparing from the starting methionine to the end of the sequence of SEQ ID NO: 2.
Moreover concerning the CYP704-like polypeptides, the present invention relates to the following specific items:
1. A method for enhancing yield-related traits in plants relative to control plants, comprising modulating expression in a plant of a nucleic acid encoding a CYP704-like polypeptide, wherein said CYP704-like polypeptide comprises a PF450 domain and the MGRMXXXWGXXXXXXXPERW (SEQ ID NO: 72) signature sequence.
2. Method according to item 1 , wherein said modulated expression is effected by introducing and expressing in a plant said nucleic acid encoding said CYP704-like polypeptide.
3. Method according to item 1 or 2, wherein said enhanced yield-related traits comprise increased yield and/or early vigour relative to control plants, and preferably comprise increased seed yield relative to control plants.
4. Method according to any one of items 1 to 3, wherein said enhanced yield-related traits are obtained under non-stress conditions.
5. Method according to any of items 1 to 4, wherein said CYP704-like polypeptide comprises one or more of the following motifs:
(i) Motif 1 : GD]L[LF]GDGIF[ATN][TV]DG[EHD][MK]W[RK][HQ]QRK[VLIT][SA]S[FY] EF[SA][TS][RK][VA]LRDFS[STC][DSV][TIV]F[RK][RKE] (SEQ ID NO: 73),
(ii) Motif 2: D[VTI]LP[DN]G[HYFT][KNRS]V[KVS][KA]G[DG][MG][VI][TNAY]Y[QMV] [PIA]Y[AS]MGRM[ETK][YF][ILN]WG[DE]DA[EQA][ES][YF][RK]PERW (SEQ ID NO: 74),
(iii) Motif 3: [DT][PYD][RTK]YLRD[IV][IV]LN[FI][VLM]IAG[KR]DTT[GA][GNAT][AST] L[TAS]WF[LFI]Y[LM]LCK[HN]P[LHAIE][VI][QA][DEN]K[VIL][AV][LQ]E[VIL][RM][E
D][AFV][TVE] (SEQ ID NO: 75) (iv) Motif 4: [LD][VEDK][DN]G[VI][YF][QK][PQ]ESPFKF[TV][SA]F[QNH]AGPRICLGK [DE][FS]A[HY][RL]QMK[IM][VMF][AS][AM][ATV]L (SEQ ID NO: 76)
(v) Motif 5: R[YF][VI]D[PIV][FML]WK[LI]K[RK][YF][LF]N[IV]GSEAxLK[RK][NS][VI] [QK][VI][IV][DN][DES]FV[MY][KS][LV]I[HNR][KQT][RK][KIR][EA] (SEQ ID NO: 77)
(vi) Motif 6: [SE]F[ASTV][KA][RS][IL][DTN][DEY][DEG]A[IL][SENG]K[ML][HNQ]YL [QH]A[TA][LI][TS]ETLRLYP[AS]VP[VLQ]D[PGNA]K[MIG][CAI][FLD][SE] D (S EQ ID NO: 78)
6. Method according to any one of items 1 to 5, wherein said nucleic acid encoding a CYP704-like polypeptide is of plant origin, preferably from a dicotyledonous or a monocotyledonous plant.
7. Method according to any one of items 1 to 6, wherein said nucleic acid encoding a CYP704-like encodes any one of the polypeptides listed in Table A1 or is a portion of such a nucleic acid, or a nucleic acid capable of hybridising with such a nucleic acid. 8. Method according to any one of items 1 to 7, wherein said nucleic acid sequence encodes an orthologue or paralogue of any of the polypeptides given in Table A1 .
9. Method according to any one of items 1 to 8, wherein said nucleic acid encodes the polypeptide represented by SEQ ID NO: 2 or SEQ ID NO: 4.
10. Method according to any one of items 1 to 9, wherein said nucleic acid is operably linked to a constitutive promoter, preferably to a medium strength constitutive promoter, preferably to a plant promoter, more preferably to a GOS2 promoter, most preferably to a GOS2 promoter from rice.
1 1. Plant, plant part thereof, including seeds, or plant cell , obtainable by a method according to any one of items 1 to 10, wherein said plant, plant part or plant cell comprises a recombinant nucleic acid encoding a CYP704-like polypeptide as defined in any of items 1 and 5 to 9.
12. Construct comprising:
(i) nucleic acid encoding a CYP704-like polyeptide as defined in any of items 1 and 5 to 9;
(ii) one or more control sequences capable of driving expression of the nucleic acid sequence of (i); and optionally
(iii) a transcription termination sequence.
13. Construct accord ing to item 1 2, wherein one of said control sequences is a constitutive promoter, preferably a medium strength constitutive promoter, preferably to a plant promoter, more preferably a GOS2 promoter, most preferably a GOS2 promoter from rice.
14. Use of a construct according to item 12 or 13 in a method for making plants having enhanced yield-related traits, preferably increased yield relative to control plants, and more preferably increased seed yield relative to control plants.
15. Plant, plant part or plant cell transformed with a construct according to item 12 or 13. 16. Method for the production of a transgenic plant having enhanced yield-related traits relative to control plants, preferably increased yield relative to control plants, and more preferably increased seed yield relative to control plants, comprising:
(i) introducing and expressing in a plant cell or plant a nucleic acid encoding a CYP704-like polypeptide as defined in any of items 1 and 5 to 9; and
(ii) cultivating said plant cell or plant under conditions promoting plant growth and development.
17. Transgenic plant having enhanced yield-related traits relative to control plants, preferably increased yield relative to control plants, and more preferably increased seed yield, resulting from modulated expression of a nucleic acid encoding a CYP704- like polypeptide as defined in any of items 1 and 5 to 9 or a transgenic plant cell derived from said transgenic plant.
18. Transgenic plant according to item 1 1 , 15 or 17, or a transgenic plant cell derived therefrom, wherein said plant is a crop plant, such as beet, sugarbeet or alfalfa; or a monocotyledonous plant such as sugarcane; or a cereal, such as rice, maize, wheat, barley, millet, rye, triticale, sorghum, emmer, spelt, einkorn, teff, milo or oats.
19. Use of a nucleic acid encoding a CYP704-like polypeptide as defined in any of items 1 and 5 to 9 for enhancing yield-related traits in plants relative to control plants, preferably for increasing yield, and more preferably for increasing seed yield in plants relative to control plants.
Moreover concerning the CYP704-like polypeptides, the present invention relates to the following specific embodiments:
1. A method for the production of a transgenic plant having enhanced seed yield relative to a control plant, comprising the steps of:
introducing and expressing in a plant cell or plant a nucleic acid encoding a CYP704-like polypeptide, wherein said nucleic acid is operably linked to a constitutive plant promoter, a nd wherei n said CYP704-like polypeptide comprises the polypeptide represented by one of: SEQ ID NO: 2, SEQ ID NO: 4 or a homologue thereof which has at least 90% overall sequence identity to SEQ
ID NO : 2 or SEQ ID NO: 4, and
cultivating said plant cell or plant under conditions promoting plant growth and development.
2. Method according to embodiment 1 , wherein said increased seed yield comprises at least one parameter selected from the group comprising increased total seed weight, increased harvest index, and increased fill rate.
3. Method according to embodiment 1 or 2, wherein said i ncrease in seed yield comprises an in-crease of at least 5 % in said plant when compared to control plants for each of said parameters.
4. Method according to any of embodiments 1 to 3, wherein said increased yield is obtained under non-stress conditions. 5. Method according to any one of embodiments 1 to 4, wherein said nucleic acid is operably linked to a GOS2 promoter.
6. Method according to embodiment 5, wherein said GOS2 promoter is the GOS2 promoter from rice.
7. Method according to any one for embodi ments 1 to 6, wherein said plant is a monocotyledonous plant.
8. Method according to embodiment 7, wherein said plant is a cereal.
9. Construct comprising:
(i) nucleic acid encoding a CYP704-like polypeptide as defined in embodiment 1 ; (ii) one or more control sequences capable of driving expression of the nucleic acid sequence of (i); and optionally
(iii) a transcription termination sequence.
10. Construct of embodiment 9, wherein said one or more control sequences is a GOS2 promoter.
1 1. Transgenic plant having enhanced seed yield as defined in embodiment 2 or 3 relative to control plants, resulting from introduction and expression of a nucleic acid encoding a CYP704-like polypeptide as defined in embodiment 1 in said plant, or a transgenic plant cell derived from said transgenic plant.
12. Use of a nucleic acid encoding a CYP704-like polypeptide as defined in embodiment 1 for enhancing seed yield as defined in embodiment 2 or 3 in a transgenic plant relative to a control plant.
Moreover concerning the DUF 1218 polypeptides, the present invention relates to the following specific embodiments:
1. A method for enhancing yield-related traits in plants relative to control plants, comprising modulating expression in a plant of a nucleic acid encoding a DUF1218 polypeptide, wherein said DUF1218 polypeptide comprises a DUF1218 domain.
2. Method according to embodiment 1 , wherein said modulated expression is effected by introducing and expressing in a plant said nucleic acid encoding said DUF1218 polypeptide.
3. Method according to embodiment 1 or 2, wherein said enhanced yield-related traits comprises increased yield relative to control plants, and preferably comprises increased seed yield and/increase biomass relative to control plants.
4. Method according to any one of embodiments 1 to 3, wherein said increased seed yield comprises increased total seed weight.
5. Method according to any one of embodiments 1 to 4, wherein said enhanced yield- related traits are obtained under non-stress conditions.
6. Method according to any one of embodiments 1 to 4, wherein said enhanced yield- related traits are obtained under conditions of drought stress, salt stress or nitrogen deficiency. 7. Method according to any one of embodiments 1 to 6, wherein said DUF1218 domain comprises an amino acid sequence having at least 50% overall sequence identity to the amino acid represented by SEQ ID NO: 179
8. Method according to any one of embodiments 1 to 7, wherei n said D U F 121 8 polypeptide has at least one signal peptide and at least one transmembrane domain.
9. Method according to any of embodiments 1 to 8, wherein said DUF1218 polypeptide comprises one or more of the following motifs:
(i) Motif 10: NW[TS][LV]AL[VI][CS]F[VI]VSW[FA]TF[VI]IAFLLLLTGAALNDQ[HR]G
[EQ]E (SEQ ID NO: 180),
(ii) Motif 1 1 : SP[STG][EQ]C[VI]YPRSPAL[AG]LGL[IT][AS]A[DV][AS]LM[IV]A[QH]
[ISV]IIN [TV][AV][TA]GCICC[KR][RK] (SEQ ID NO: 181 ),
(iii) Motif 12: [YS][YF]CYVVKPGVF[AS]G[GA]AVLSLASV[AI]L[GA]IVYY (SEQ I D
NO: 182)
10. Method according to any of embodiments 1 to 9, wherein said DUF1218 polypeptide further comprises one or more of the following motifs:
(i) Motif 13: CCKRHPVPSDTNWSVALISFIVSW[VC]TFIIAFLLLLTGAALNDQRG[E Q]ENMY (SEQ ID NO: 183),
(ii) Motif 14: MERK[AV]VVVCA[LV]VGFLGVLSAALGFAAE[GA]TRVKVSDVQT[DS] (SEQ ID NO: 184),
(iii) Motif 15: IP[QP]QSSEPVFVHEDTYNR[QR]Q[FQ] (SEQ ID NO: 185)
1 1 . Method according to any one of embodiments 1 to 10, wherein said nucleic acid en cod i n g a D U F 1 21 8 po ly pepti d e i s of pl a n t o ri g i n , prefera b ly fro m a monocotyledonous plant, further preferably from the family Poaceae, more preferably from the genus Oryza, most preferably the nucleic acid is from Oryza sativa.
12. Method according to any one of embodiments 1 to 1 1 , wherein said nucleic acid encoding a DUF1218 polypeptide encodes any one of the polypeptides listed in Table A2 or is a portion of such a nucleic acid, or a nucleic acid capable of hybridising with such a nucleic acid.
13. Method according to any one of embodiments 1 to 12, wherein said nucleic acid sequence encodes an orthologue or paralogue of any of the polypeptides given in
Table A2.
14. Method according to any one of embodiments 1 to 13, wherein said nucleic acid encodes the polypeptide represented by SEQ ID NO: 2 or a homologue thereof.
15. Method according to any one of embodiments 1 to 14, wherein said nucleic acid is operably linked to a constitutive promoter, preferably to a medium strength constitutive promoter, preferably to a plant promoter, more preferably to a GOS2 promoter, most preferably to a GOS2 promoter from rice.
16. Plant, plant part thereof, including seeds, or plant cell , obtainable by a method according to any one of embodiments 1 to 15, wherein said plant, plant part or plant cell comprises a recombinant nucleic acid encoding a DUF1218 polypeptide as defined in any of embodiments 1 and 7 to 14.
17. Construct comprising: (i) nucleic acid encoding a DUF1218 polypeptide as defined in any of embodiments 1 and 7 to 14;
(ii) one or more control sequences capable of driving expression of the nucleic acid sequence of (i); and optionally
(iii) a transcription termination sequence.
18. Construct according to embodiment 17, wherein one of said control sequences is a constitutive promoter, preferably a medium strength constitutive promoter, preferably to a plant promoter, more preferably a GOS2 promoter, most preferably a GOS2 promoter from rice.
19. Use of a construct according to embodiment 16 or 17 in a method for making plants having enhanced yield-related traits, preferably increased yield relative to control plants, and more preferably increased seed yield relative to control plants.
20. Plant, plant part or plant cell transformed with a construct according to embodiment 16 or 17.
21 . Method for the production of a transgenic plant having enhanced yield-related traits relative to control plants, preferably increased yield relative to control plants, and more preferably increased seed yield and/or increased biomass relative to control plants, comprising:
(i) introducing and expressing in a plant cell or plant a nucleic acid encoding a DUF1218 polypeptide as defined in any of embodiments 1 and 7 to 14; and
(ii) cultivating said plant cell or plant under conditions promoting plant growth and development.
22. Transgenic plant having enhanced yield-related traits relative to control plants, preferably increased yield relative to control plants, and more preferably increased seed yield, resu lting from modulated expression of a nucleic acid encoding a
DUF1218 polypeptide as defined in any of embodiments 1 and 7 to 14 or a transgenic plant cell derived from said transgenic plant.
23. Transgenic plant according to embodiment 16, 20 or 22, or a transgenic plant cell derived therefrom, wherein said plant is a crop plant, such as beet, sugarbeet or alfalfa; or a monocotyledonous plant such as sugarcane; or a cereal, such as rice, maize, wheat, barley, millet, rye, triticale, sorghum, emmer, spelt, secale, einkorn, teff, milo or oats.
24. Harvestable parts of a plant according to any of embodiments 16, 20, 22-23, wherein said harvestable parts are preferably shoot biomass and/or seeds.
25. Products derived from a plant according to any of embodiments 16, 20, 22-23 and/or from harvestable parts of a plant according to embodiment 24.
26. Isolated nucleic acid molecule selected from:
(i) a nucleic acid represented by any one of SEQ ID NO: 87 or 97;
(ii) the complement of a nucleic acid represented by any one of SEQ ID NO: 87 or 97;
(iii) a nucleic acid encoding a DUF1218 polypeptide having in increasing order of preference at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88% , 89% , 90% , 91 % , 92% , 93% , 94% , 95% , 96% , 97% , 98% , or 99% sequence identity to the amino acid sequence represented by any one of SEQ ID NO: 2 or 12, and additionally or alternatively comprising one or more motifs having in increasing order of preference at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any one or more of the motifs given in SEQ ID NO: 93 to SEQ ID NO: 99, and further preferably conferring enhanced yield-related traits relative to control plants.
(iv) a nucleic acid molecule which hybridizes with a nucleic acid molecule of (i) to (iii) under high stringency hybridization conditions and preferably confers enhanced yield-related traits relative to control plants.
Isolated polypeptide selected from:
(i) an amino acid sequence represented by any one of SEQ ID NO: 2 or 12;
(ii) an amino acid sequence having, in increasing order of preference, at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the amino acid sequence represented by SEQ ID NO: 2 or 12, and additionally or alternatively comprising one or more motifs having in increasing order of preference at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any one or more of the motifs given in SEQ ID NO: 93 to SEQ ID NO: 99, and further preferably conferring enhanced yield-related traits relative to control plants;
(iii) derivatives of any of the amino acid sequences given in (i) or (ii) above.
Use of a nucleic acid encoding a DUF1218 polypeptide as defined in any of embodiments 1 and 7 to 14 and 27 for enhancing yield-related traits in plants relative to control plants, preferably for increasing yield, and more preferably for increasing seed yield in plants relative to control plants.
Use of a nucleic acid as defi ned in embodi ment 26 and encoding a DU F 1 21 8 polypeptide for enhancing yield-related traits in plants relative to control plants, preferably for increasing yield, and more preferably for increasing seed yield in plants relative to control plants.
Use of a nucleic acid encoding a DU F 1218 polypeptide as defi ned i n any of embodiments 1 and 7 to 14 and 27 as molecular marker.
Use of a nucleic acid s defi ned i n embodiment 26 and encod ing a DU F 1218 polypeptide as defined in any of embodiments 1 and 7 to 14 and 27 as molecular marker. Moreover concerning the translin-like polypeptides, the present invention relates to the following specific embodiments:
1. A method for enhancing yield-related traits in plants relative to control plants, comprising modulating expression in a plant of a nucleic acid encoding a translin-like polypeptide, wherein said translin-like polypeptide comprises the signature sequence
GTDFWKLRR (SEQ I D NO: 56) and preferably comprises an InterPro accession IPR002848 corresponding to PFAM accession number PF01997 translin domain.
2. Method according to embodiment 1 , wherein said modulated expression is effected by introducing and expressing in a plant said nucleic acid encoding said translin-like polypeptide.
3. Method according to embodiment 1 or 2, wherein said enhanced yield-related traits comprise increased yield relative to control plants, and preferably comprise increased harvest index and/or increased seed yield relative to control plants.
4. Method according to any one of embodiments 1 to 3, wherein said enhanced yield- related traits are obtained under non-stress conditions.
5. Method according to any of embodiments 1 to 4, wherein said translin-like polypeptide comprises one or more of the following motifs:
(i) Motif 16: DLAAV[TV][NED]QY[IM][LAGS][KR]LVKELQGTDFWKLRRAY[ST][PF] GVQEYVEAAT[FL][CY][KR]FC[RK][TS]GT (SEQ ID NO: 238),
(ii) Motif 17: [SP][SA][FM]K[DA][AE]F[GSA][NK][YH]A[NE]YLN[KNT]LN[ED]KRER
[VL]VKASRD[IV]TMNSKKVIFQVHR[IM]SK[DN]N[RK] (SEQ ID NO: 239),
(iii) Motif 18: IC[QA]FVRDIYRELTL[LVI]VP[YL]MDD[SN][SN][DE]MK[TK]KM[DE][T V]MLQSV[VM]KIENAC[YF][GS]VHVRG (SEQ ID NO: 240).
6. Method according to any one of embodiments 1 to 5, wherein said nucleic acid encoding a translin-like polypeptide is of plant origin, preferably from a dicotyledonous plant, further preferably from the family Salicaceae, more preferably from the genus Populus, most preferably from Populus trichocarpa.
7. Method according to any one of embodiments 1 to 6, wherein said nucleic acid encoding a translin-like polypeptide encodes any one of the polypeptides listed in Table A3 or is a portion of such a nucleic acid, or a nucleic acid capable of hybridising with such a nucleic acid.
8. Method according to any one of embodiments 1 to 7, wherein said nucleic acid sequence encodes an orthologue or paralogue of any of the polypeptides given in Table A3.
9. Method according to any one of embodiments 1 to 8, wherein said nucleic acid encodes the polypeptide represented by SEQ ID NO: 191 .
10. Method according to any one of embodiments 1 to 9, wherein said nucleic acid is operably linked to a constitutive promoter, preferably to a medium strength constitutive promoter, preferably to a plant promoter, more preferably to a GOS2 promoter, most preferably to a GOS2 promoter from rice.
1 1 . Plant, plant part thereof, including seeds, or plant cell , obtainable by a method according to any one of embodiments 1 to 10, wherein said plant, plant part or plant cell comprises a recombinant nucleic acid encoding a translin-like polypeptide as defined in any of embodiments 1 and 5 to 9.
Construct comprising:
(i) nucl eic acid encod ing a translin-like polypeptide as defined in any of embodiments 1 and 5 to 9;
(ii) one or more control sequences capable of driving expression of the nucleic acid sequence of (i); and optionally
(i) a transcription termination sequence.
Construct according to embodiment 12, wherein one of said control sequences is a constitutive promoter, preferably a medium strength constitutive promoter, preferably to a plant promoter, more preferably a GOS2 promoter, most preferably a GOS2 promoter from rice.
Use of a construct according to embodiment 12 or 13 in a method for making plants having enhanced yield-related traits, preferably increased yield relative to control plants, and more preferably increased seed yield and/or increased biomass relative to control plants.
Plant, plant part or plant cell transformed with a construct according to embodiment 12 or 13.
Method for the production of a transgenic plant having enhanced yield-related traits relative to control plants, preferably increased yield relative to control plants, and more preferably increased seed yield and/or increased harvest index relative to control plants, comprising:
(i) introducing and expressing in a plant cell or plant a nucleic acid encoding a translin-like polypeptide as defined in any of embodiments 1 and 5 to 9; and (ii) cultivating said plant cell or plant under conditions promoting plant growth and development.
Transgenic plant having enhanced yield-related traits relative to control plants, preferably increased yield relative to control plants, and more preferably increased seed yield and/or increased biomass, resulting from modulated expression of a nucleic acid encoding a translin-like polypeptide as defined in any of embodiments 1 and 5 to 9 or a transgenic plant cell derived from said transgenic plant.
Transgenic plant according to embodiment 1 1 , 15 or 17, or a transgenic plant cell derived therefrom, wherein said plant is a crop plant, such as beet, sugarbeet or alfalfa; or a monocotyledonous plant such as sugarcane; or a cereal, such as rice, maize, wheat, barley, millet, rye, triticale, sorghum, emmer, spelt, secale, einkorn, teff, milo or oats.
Harvestable parts of a plant according to embodiment 18, wherein said harvestable parts are preferably seeds.
Products derived from a plant according to embodiment 18 and/or from harvestable parts of a plant according to embodiment 19.
Use of a nucleic acid encod ing a translin-like polypeptide as defined in any of embodiments 1 and 5 to 9 for enhancing yield-related traits in plants relative to control plants, preferably for increasing yield, and more preferably for increasing seed yield and/or for increasing biomass in plants relative to control plants.
22. Plant having increased yield, particularly increased biomass and/or increased seed yield, relative to control plants, resulting from modulated expression of a nucleic acid encoding a translin-like polypeptide, or a transgenic plant cell originating from or being part of said transgenic plant.
23. A method for the production of a product comprising the steps of growing the plants of the invention and producing said product from or by
(a) the plants of the invention; or
(b) parts, including seeds, of these plants.
24. Plant according to embodiment 1 1 , 15, or 21 , or a transgenic plant cell originating thereof, or a method according to embodiment 22, wherein said plant is a crop plant, preferably a dicot such as sugar beet, alfalfa, trefoil, chicory, carrot, cassava, cotton, soybean, canola or a monocot, such as sugarcane, or a cereal, such as rice, maize, wheat, barley, millet, rye, triticale, sorghum emmer, spelt, secale, einkorn, teff, milo and oats.
25. Construct according to embodiment 12 or 13 comprised in a plant cell.
26. Recombinant chromosomal DNA comprising the construct according to embodiment 12 or 13.
Moreover concerning the ERG28-like polypeptides, the present invention relates to the following specific embodiments:
1. A method for enhancing yield-related traits, and/or for modifying sterol and/or steroid composition, and/or for increasing or decreasing sterol and/or steroid levels in plants relative to control plants, comprising modulating expression in a plant of a nucleic acid encoding an ERG28-like polypeptide, wherein said ERG28-like polypeptide comprises a Pfam PF03694 domain and preferably also the signature sequence WTLL[TS]CTL.
2. Method according to embodiment 1 , wherein said modulated expression is effected by introducing and expressing in a plant said nucleic acid encoding said ERG28-like polypeptide.
3. Method according to embodiment 1 or 2, wherein said modulated expression is increased or decreased expression.
4. Method according to embodiment 1 or 3, wherein said enhanced yield-related traits comprise increased yield and/or early vigour relative to control plants, and preferably comprise increased biomass and/or increased seed yield relative to control plants.
5. Method according to any one of embodiments 1 to 4, wherein said enhanced yield- related traits, and/or modified steroid composition, and/or increased steroid levels are obtained under non-stress conditions.
6. Method according to any one of embodiments 1 to 4, wherein said enhanced yield- related traits, and/or modified steroid composition, and/or increased steroid levels are obtained under conditions of drought stress, salt stress or nitrogen deficiency. 7. Method according to any of embodiments 1 to 5, wherein said ERG28-like polypeptide comprises one or more of the following motifs:
(i) Motif 19: CTLC[FY]LCA[FL]NL[HE][DN][KR]PLYLAT[IF]LSF[IV]YA[FL]GHFLTE [FY]L[FI]Y[HQ]TM (SEQ ID NO: 297),
(ii) Motif 20: VG[ST]LRLASVWFGF[VF][DN]IWALR[LV]AVFS[QK]T[TE]M[TS][ED]
[VI]HGRTFG[VT]WT (SEQ ID NO: 298),
(iii) Motif 21 : [IA][KA]NL[SVT]TVG[FI]FAGTSI[VI]WMLL[EQ]WN[SA][LH][EQG][QK] [PV][RKH] (SEQ ID NO: 299),
(iv) Motif 22: [PEK][LA]LG[YW]WL[MI ] (SEQ ID NO: 300).
8. Method according to any one of embodiments 1 to 6, wherein said nucleic acid encoding an ERG28-like is from yeast or of plant origin, preferably from a dicotyledonous plant, further preferably from the family Brassicaceae or Solonaceae, more preferably from the genus Arabidopsis or Solanum , most preferably from Arabidopsis thaliana or from Solanum lycopersicum.
9. Method according to any one of embodiments 1 to 7, wherein said nucleic acid encoding an ERG28-like encodes any one of the polypeptides listed in Table A4 or is a portion of such a nucleic acid, or a nucleic acid capable of hybridising with such a nucleic acid.
10. Method according to any one of embodiments 1 to 8, wherein said nucleic acid sequence encodes an orthologue or paralogue of any of the polypeptides given in
Table A4.
1 1. Method according to any one of embodiments 1 to 9, wherein said nucleic acid encodes the polypeptide represented by SEQ ID NO: 247.
12. Method according to any one of embodiments 1 to 10, wherein said nucleic acid is operably linked to a constitutive promoter such as the CaMV35S promoter, preferably to a medium strength constitutive promoter, preferably to a plant promoter, more preferably to a GOS2 promoter, most preferably to a GOS2 promoter from rice.
13. Plant, plant part thereof, including seeds, or plant cell , obtainable by a method according to any one of embodiments 1 to 1 1 , wherein said plant, plant part or plant cell comprises a recombinant nucleic acid encoding an ERG28-like polypeptide as defined in any of embodiments 1 and 6 to 10.
14. Construct comprising:
(i) nucleic acid encoding an ERG28-like as defined in any of embodiments 1 and 6 to 10;
(ii) one or more control sequences capable of driving expression of the nucleic acid sequence of (i); and optionally
(iii) a transcription termination sequence.
15. Construct according to embodiment 13, wherein one of said control sequences is a constitutive promoter, preferably a medium strength constitutive promoter, preferably to a plant promoter, more preferably a GOS2 promoter, most preferably a GOS2 promoter from rice. 16. Use of a construct according to embodiment 13 or 14 in a method for making plants having enhanced yield-related traits, and/or modified steroid composition, and/or increased steroid levels, relative to control plants.
17. Plant, plant part or plant cell transformed with a construct according to embodiment 13 or 14.
18. Method for the production of a transgenic plant having enhanced yield-related traits, and/or modified steroid composition, and/or increased or decreased steroid levels, relative to control plants, comprising:
(i) introducing and expressing in a plant cell or plant a nucleic acid encoding an ERG28-like polypeptide as defined in any of embodiments 1 and 6 to 10; and
(ii) cultivating said plant cell or plant under conditions promoting plant growth and development.
18. Transgenic plant having enhanced yield-related traits, and/or modified steroid composition, and/or increased or decreased steroid levels, relative to control plants, resulting from modulated expression of a nucleic acid encoding an ERG28-like polypeptide as defined in any of embodiments 1 and 6 to 10 or a transgenic plant cell derived from said transgenic plant.
19. Transgenic plant according to embodiment 12, 16 or 18, or a transgenic plant cell derived therefrom, wherein said plant is a crop plant, such as soybean, canola, cotton, beet, sugarbeet or alfalfa; or a monocotyledonous plant such as sugarcane; or a cereal, such as rice, maize, wheat, barley, millet, rye, triticale, sorghum, emmer, spelt, einkorn, teff, milo or oats.
20. Harvestable parts of a plant according to embodiment 19, wherein said harvestable parts are preferably shoot biomass and/or seeds.
21. Products derived from a plant according to embodiment 19 and/or from harvestable parts of a plant according to embodiment 20.
22. Use of a nucleic acid encoding an ERG28-like polypeptide as defined in any of embodiments 1 and 6 to 10 for enhancing yield-related traits, and/or modifying steroid composition, and/or increasing steroid levels in plants relative to control plants.
Definitions
The following definitions will be used throughout the present application. The section captions and headings in this application are for convenience and reference purpose only and should not affect in any way the meaning or interpretation of this application. The technical terms and expressions used within the scope of this application are generally to be given the meaning commonly applied to them in the pertinent art of plant biology, molecular biology, bioinformatics and plant breeding. All of the following term definitions apply to the complete content of this application . The term "essentially", "about", "approximately" and the like in connection with an attribute or a value, particularly also define exactly the attribute or exactly the value, respectively. The term "about" in the context of a given numeric value or range relates in particular to a value or range that is within 20%, within 10%, or within 5% of the value or range given. As used herein, the term "comprising" also encompasses the term "consisting of.
Peptide(s)/Protein(s)
The terms "peptides", "oligopeptides", "polypeptide" and "protein" are used interchangeably herein and refer to amino acids in a polymeric form of any length, linked together by peptide bonds, unless mentioned herein otherwise.
Polynucleotide(s)/Nucleic acid(s)/Nucleic acid sequence(s)/nucleotide sequence(s)
The terms "polynucleotide(s)", "nucleic acid sequence(s)", "nucleotide sequence(s)", "nucleic acid(s)", "nucleic acid molecule" are used interchangeably herein and refer to nucleotides, either ribonucleotides or deoxyribonucleotides or a combination of both, in a polymeric unbranched form of any length. Homologue(s)
"Homologues" of a protein encompass peptides, oligopeptides, polypeptides, proteins and enzymes having amino acid substitutions, deletions and/or insertions relative to the unmodified protein in question and having similar biological and functional activity as the unmodified protein from which they are derived.
Orthologues and paralogues are two different forms of homologues and encompass evolutionary concepts used to describe the ancestral relationships of genes. Paralogues are genes within the same species that have originated through duplication of an ancestral gene; orthologues are genes from different organisms that have originated th rough speciation, and are also derived from a common ancestral gene.
A "deletion" refers to removal of one or more amino acids from a protein.
An "i nsertion" refers to one or more amino acid residues being i ntrod uced into a predetermined site in a protein. Insertions may comprise N-terminal and/or C-terminal fusions as well as intra-sequence insertions of single or multiple amino acids. Generally, insertions within the amino acid sequence will be smaller than N- or C-terminal fusions, of the order of about 1 to 1 0 residues. Examples of N- or C-terminal fusion proteins or peptides include the binding domain or activation domain of a transcriptional activator as used in the yeast two-hybrid system, phage coat proteins, (histidine)-6-tag, glutathione S- transferase-tag, protein A, maltose-binding protein, dihydrofolate reductase, Tag*100 epitope, c-myc epitope, FLAG®-epitope, lacZ, CMP (calmodulin-binding peptide), HA epitope, protein C epitope and VSV epitope. A "substitution" refers to replacement of amino acids of the protein with other amino acids having similar properties (such as similar hydrophobicity, hydrophilicity, antigenicity, propensity to form or break a-helical structures or β-sheet structures). Amino acid substitutions are typically of single residues, but may be clustered depending upon functional constraints placed upon the polypeptide and may range from 1 to 10 amino acids. The amino acid substitutions are preferably conservative amino acid substitutions. Conservative substitution tables are well known in the art (see for example Creighton (1984) Proteins. W.H. Freeman and Company (Eds) and Table 1 below).
Table 1 : Examples of conserved amino acid substitutions
Figure imgf000055_0001
Amino acid substitutions, deletions and/or insertions may readily be made using peptide synthetic techniques known in the art, such as solid phase peptide synthesis and the like, or by recombinant DNA manipulation. Methods for the manipulation of DNA sequences to produce substitution, insertion or deletion variants of a protein are well known in the art. For example, techniques for making substitution mutations at predetermined sites in DNA are well known to those skilled in the art and include M 13 mutagenesis, T7-Gen in vitro mutagenesis (USB, Cleveland, OH), QuickChange Site Directed mutagenesis (Stratagene, S a n D i eg o , CA) , PC R-mediated site-directed mutagenesis or other site-directed mutagenesis protocols (see Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989 and yearly updates)). Derivatives
"Derivatives" include peptides, oligopeptides, polypeptides which may, compared to the amino acid sequence of the naturally-occurring form of the protein, such as the protein of interest, comprise substitutions of amino acids with non-naturally occurring amino acid residues, or additions of non-naturally occurring amino acid residues. "Derivatives" of a protein also encompass peptides, oligopeptides, polypeptides which comprise naturally occurring altered (glycosylated, acylated , prenylated, phosphorylated , myristoylated , sulphated etc.) or non-naturally altered amino acid residues compared to the amino acid sequence of a naturally-occurring form of the polypeptide. A derivative may also comprise on e or more non-amino acid substituents or additions compared to the amino acid sequence from which it is derived, for example a reporter molecule or other ligand, covalently or non-covalently bound to the amino acid sequence, such as a reporter molecule which is bound to facilitate its detection, and non-naturally occurring amino acid residues relative to the amino acid sequence of a naturally-occurring protein. Furthermore, "derivatives" also include fusions of the naturally-occurring form of the protein with tagging peptides such as FLAG, HIS6 or thioredoxin (for a review of tagging peptides, see Terpe, Appl. Microbiol. Biotechnol. 60, 523-533, 2003).
Domain, Motif/Consensus sequence/Signature
The term "domain" refers to a set of amino acids conserved at specific positions along an alignment of sequences of evolutionarily related proteins. While amino acids at other positions can vary between homologues, amino acids that are highly conserved at specific positions indicate amino acids that are likely essential in the structure, stability or function of a protein. Identified by their high degree of conservation in aligned sequences of a family of protein homologues, they can be used as identifiers to determine if any polypeptide in question belongs to a previously identified polypeptide family.
The term "motif or "consensus sequence" or "signature" refers to a short conserved region in the sequence of evolutionarily related proteins. Motifs are frequently highly conserved parts of domains, but may also include only part of the domain, or be located outside of conserved domain (if all of the amino acids of the motif fall outside of a defined domain).
Specialist databases exist for the identification of domains, for example, SMART (Schultz et al. (1998) Proc. Natl. Acad. Sci. USA 95, 5857-5864; Letunic et al. (2002) Nucleic Acids Res 30, 242-244), InterPro (Mulder et al., (2003) Nucl. Acids. Res. 31 , 315-318), Prosite (Bucher and Bairoch (1994), A generalized profile syntax for biomolecular sequences motifs and its function in automatic sequence interpretation . (I n) ISMB-94; Proceedings 2nd International Conference on Intelligent Systems for Molecular Biology. Altman R., Brutlag D., Karp P. , Lathrop R. , Searls D., Eds., pp53-61 , AAA I Press, Menlo Park; Hulo et al. , Nucl. Acids. Res. 32:D134-D137, (2004)), or Pfam (Bateman et al., Nucleic Acids Research 30(1 ): 276-280 (2002)). A set of tools for in silico analysis of protein sequences is available on the ExPASy proteomics server (Swiss Institute of Bioinformatics (Gasteiger et al . , ExPASy: the proteomics server for in-depth protein knowledge and analysis, Nucleic Acids Res. 31 :3784-3788(2003)) . Domains or motifs may also be identified using routine techniques, such as by sequence alignment. Methods for the alignment of sequences for comparison are well known in the art, such methods include GAP, BESTFIT, BLAST, FASTA and TFASTA. GAP uses the algorithm of Needleman and Wunsch ((1970) J Mol Biol 48: 443-453) to find the global (i.e. spanning the complete sequences) alignment of two sequences that maximizes the number of matches and minimizes the number of gaps. The BLAST algorithm (Altschul et al. (1990) J Mol Biol 215: 403-10) calculates percent sequence identity and performs a statistical analysis of the similarity between the two sequences. The software for performing BLAST analysis is publicly available through the National Centre for Biotechnology Information (NCBI). Homologues may readily be identified using, for example, the ClustalW multiple sequence alignment algorithm (version 1 .83), with the default pairwise alignment parameters, and a scoring method in percentage. Global percentages of similarity and identity may also be determined using one of the methods available in the MatGAT software package (Campanella et al. , BMC Bioinformatics. 2003 Jul 10;4:29. MatGAT: an application that generates similarity/identity matrices using protein or DNA sequences.). Minor manual editing may be performed to optimise alignment between conserved motifs, as would be apparent to a person skilled in the art. Furthermore, instead of using full-length sequences for the identification of homologues, specific domains may also be used. The sequence identity values may be determined over the entire nucleic acid or amino acid sequence or over selected domains or conserved motif(s), using the programs mentioned above using the default parameters. For local alignments, the Smith-Waterman algorithm is particularly useful (Smith TF, Waterman MS (1981 ) J. Mol. Biol 147(1 );195-7). Reciprocal BLAST
Typically, this involves a first BLAST involving BLASTing a query sequence (for example using any of the sequences listed in Table A of the Examples section) against any sequence database, such as the publicly available NCBI database. BLASTN or TBLASTX (using standard default values) are general ly used when starting from a nucleotide sequence, and BLASTP or TBLASTN (using standard default values) when starting from a protein sequence. The BLAST results may optionally be filtered. The full-length sequences of either the filtered results or non-filtered results are then BLASTed back (second BLAST) against sequences from the organism from which the query sequence is derived. The results of the first and second BLASTs are then compared. A paralogue is identified if a high-ranking hit from the first blast is from the same species as from which the query sequence is derived, a BLAST back then ideally results in the query sequence amongst the highest hits; an orthologue is identified if a high-ranking hit in the first BLAST is not from the same species as from which the query sequence is derived, and preferably results upon BLAST back in the query sequence being among the highest hits.
High-ran ki ng hits are those havi ng a low E-value. The lower the E-value, the more significant the score (or in other words the lower the chance that the hit was found by chance). Computation of the E-value is well known in the art. In addition to E-values, comparisons are also scored by percentage identity. Percentage identity refers to the number of identical nucleotides (or amino acids) between the two compared nucleic acid (or polypeptide) sequences over a particular length. In the case of large families, ClustalW may be used, followed by a neighbour joining tree, to help visualize clustering of related genes and to identify orthologues and paralogues. Hybridisation
The term "hybridisation" as defined herein is a process wherein substantially homologous complementary nucleotide sequences anneal to each other. The hybridisation process can occur entirely in solution, i.e. both complementary nucleic acids are in solution. The hybridisation process can also occur with one of the complementary nucleic acids immobilised to a matrix such as magnetic beads, Sepharose beads or any other resin. The hybridisation process can furthermore occur with one of the complementary nucleic acids immobilised to a solid support such as a nitro-cellulose or nylon membrane or immobilised by e.g. photolithography to, for example, a siliceous glass support (the latter known as nucleic acid arrays or microarrays or as nucleic acid chips). In order to allow hybridisation to occur, the nucleic acid molecules are generally thermally or chemically denatured to melt a double strand into two single strands and/or to remove hairpi ns or other secondary structures from single stranded nucleic acids.
The term "stringency" refers to the conditions under which a hybridisation takes place. The stri ngency of hybridisation is i nfl uenced by cond itions such as temperatu re, salt concentration, ionic strength and hybridisation buffer composition. Generally, low stringency conditions are selected to be about 30°C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. Medium stringency conditions are when the temperature is 20°C below Tm, and high stringency conditions are when the temperature is 10°C below Tm. High stringency hybridisation conditions are typically used for isolating hybridising sequences that have high sequence similarity to the target nucleic acid seq uence. However, nucleic acids may deviate in sequence and still encode a substantially identical polypeptide, due to the degeneracy of the genetic code. Therefore medium stringency hybridisation conditions may sometimes be needed to identify such nucleic acid molecules. The Tm is the temperature under defined ionic strength and pH, at which 50% of the target sequence hybridises to a perfectly matched probe. The Tm is dependent upon the solution conditions and the base composition and length of the probe. For example, longer sequences hybridise specifically at higher temperatures. The maximum rate of hybridisation is obtained from about 16°C up to 32°C below Tm. The presence of monovalent cations in the hybridisation solution reduce the electrostatic repulsion between the two nucleic acid strands thereby promoting hybrid formation; this effect is visible for sodium concentrations of up to 0.4M (for higher concentrations, this effect may be ignored). Formamide reduces the melting temperature of DNA-DNA and DNA-RNA duplexes with 0.6 to 0.7°C for each percent formamide, and addition of 50% formamide allows hybridisation to be performed at 30 to 45°C, though the rate of hybridisation will be lowered. Base pair mismatches reduce the hybridisation rate and the thermal stability of the duplexes. On average and for large probes, the Tm decreases about 1 °C per % base mismatch. The Tm may be calculated using the following equations, depending on the types of hybrids:
1 ) DNA-DNA hybrids (Meinkoth and Wahl, Anal. Biochem., 138: 267-284, 1984):
Tm= 81 .5°C + 16.6xlogio[Na+]a + 0.41x%[G/Cb] - 500x[Lc]-1 - 0.61 x% formamide
2) DNA-RNA or RNA-RNA hybrids: Tm= 79.8°C+ 18.5 (logio[Na+]a) + 0.58 (%G/Cb) + 1 1 .8 (%G/Cb)2 - 820/Lc
3) oligo-DNA or oligo-RNAd hybrids:
For <20 nucleotides: Tm= 2 (l„)
For 20-35 nucleotides: Tm= 22 + 1 .46 (ln)
a or for other monovalent cation, but only accurate in the 0.01 -0.4 M range.
b only accurate for %GC in the 30% to 75% range.
c L = length of duplex in base pairs.
d oligo, oligonucleotide; ln, = effective length of primer = 2χ(ηο. of G/C)+(no. of A/T). Non-specific binding may be controlled using any one of a number of known techniques such as, for example, blocking the membrane with protein containing solutions, additions of heterologous RNA, DNA, and SDS to the hybridisation buffer, and treatment with Rnase. For non-homologous probes, a series of hybridizations may be performed by varying one of (i) progressively lowering the annealing temperature (for example from 68°C to 42°C) or (ii) progressively lowering the formamide concentration (for example from 50% to 0%) . The skilled artisan is aware of various parameters which may be altered during hybridisation and which will either maintain or change the stringency conditions.
Besides the hybridisation conditions, specificity of hybridisation typically also depends on the fu nction of post-hybridisation washes. To remove background resulting from nonspecific hybridisation, samples are washed with dilute salt solutions. Critical factors of such washes include the ionic strength and temperature of the final wash solution: the lower the salt concentration and the higher the wash temperature, the higher the stringency of the wash . Wash conditions are typical ly performed at or below hybridisation stringency. A positive hybridi sation gives a signal that is at least twice of that of the backgrou nd . Generally, suitable stringent conditions for nucleic acid hybridisation assays or gene amplification detection procedures are as set forth above. More or less stringent conditions may also be selected . The skilled artisan is aware of various parameters which may be altered during washing and which will either maintain or change the stringency conditions.
For example, typical high stringency hybridisation conditions for DNA hybrids longer than 50 nucleotides encompass hybridisation at 65°C in 1 x SSC or at 42°C in 1 x SSC and 50% formamide, followed by washing at 65°C in 0.3x SSC. Examples of medium stringency hybridisation conditions for DNA hybrids longer than 50 nucleotides encompass hybridisation at 50°C in 4x SSC or at 40°C in 6x SSC and 50% formamide, followed by wash i ng at 50°C i n 2x SSC. The length of the hybrid is the anticipated length for the hybridising nucleic acid. When nucleic acids of known sequence are hybridised, the hybrid length may be determined by aligning the sequences and identifying the conserved regions described herei n. 1 xSSC is 0.15M NaCI and 1 5mM sodiu m citrate; the hybrid isation solution and wash solutions may additionally include 5x Denhardt's reagent, 0.5-1 .0% SDS, 100 μg/ml denatured, fragmented salmon sperm DNA, 0.5% sodium pyrophosphate. For the purposes of defining the level of stringency, reference can be made to Sambrook et al. (2001 ) Molecular Cloning: a laboratory manual, 3rd Edition, Cold Spring Harbor Laboratory Press, CSH, New York or to Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989 and yearly updates).
Splice variant
The term "splice variant" as used herein encompasses variants of a nucleic acid sequence in which selected introns and/or exons have been excised, replaced, displaced or added, or in which introns have been shortened or lengthened. Such variants will be ones in which the biological activity of the protein is substantially retained; this may be achieved by selectively retaining functional segments of the protein. Such splice variants may be found in nature or may be manmade. Methods for predicting and isolating such splice variants are well known in the art (see for example Foissac and Schiex (2005) BMC Bioinformatics 6: 25). Allelic variant
"Alleles" or "allelic variants" are alternative forms of a given gene, located at the same chromosomal position. Allelic variants encompass Single Nucleotide Polymorphisms (SNPs), as well as Small Insertion/Deletion Polymorphisms (INDELs). The size of INDELs is usually less than 100 bp. SNPs and INDELs form the largest set of sequence variants in naturally occurring polymorphic strains of most organisms.
Endogenous gene
Reference herein to an "endogenous" gene not only refers to the gene in question as found in a plant in its natural form (i.e., without there being any human intervention), but also refers to that same gene (or a substantially homologous nucleic acid/gene) in an isolated form subsequently (re)introduced into a plant (a transgene). For example, a transgenic plant containing such a transgene may encounter a substantial reduction of the transgene expression and/or substantial reduction of expression of the endogenous gene. The isolated gene may be isolated from an organism or may be manmade, for example by chemical synthesis.
Gene shuffling/Directed evolution
"Gene shuffling" or "directed evolution" consists of iterations of DNA shuffling followed by appropriate screening and/or selection to generate variants of nucleic acids or portions thereof encoding proteins having a modified biological activity (Castle et al., (2004) Science 304(5674): 1 151 -4; US patents 5,81 1 ,238 and 6,395,547).
Construct
Artificial DNA (such as but, not limited to plasmids or viral DNA) capable of replication in a host cell and used for introduction of a DNA sequence of interest into a host cell or host organism. Host cells of the invention may be any cell selected from bacterial cells, such as Escherichia coli or Agrobacterium species cells, yeast cells, fungal, algal or cyanobacterial cells or plant cells. The skilled artisan is well aware of the genetic elements that must be present on the genetic construct in order to successfully transform, select and propagate host cells containing the sequence of interest. The sequence of interest is operably linked to one or more control sequences (at least to a promoter) as described herein. Additional regulatory elements may include transcriptional as well as translational enhancers. Those skilled in the art will be aware of terminator and enhancer sequences that may be suitable for use in performing the invention. An intron sequence may also be added to the 5' untranslated region (UTR) or in the coding sequence to increase the amount of the mature message that accumulates in the cytosol, as described in the definitions section. Other control sequences (besides promoter, enhancer, silencer, intron sequences, 3'UTR and/or 5'UTR regions) may be protein and/or RNA stabilizing elements. Such sequences would be known or may readily be obtained by a person skilled in the art.
The genetic constructs of the invention may further include an origin of replication sequence that is required for maintenance and/or replication in a specific cell type. One example is when a genetic construct is required to be maintained in a bacterial cell as an episomal genetic element (e.g. plasmid or cosmid molecule). Preferred origins of replication include, but are not limited to, the f 1 -ori and colEl For the detection of the successful transfer of the nucleic acid sequences as used in the methods of the invention and/or selection of transgenic plants comprising these nucleic acids, it is advantageous to use marker genes (or reporter genes). Therefore, the genetic construct may optionally comprise a selectable marker gene. Selectable markers are described in more detail in the "definitions" section herein. The marker genes may be removed or excised from the transgenic cell once they are no longer needed. Techniques for marker removal are known in the art, useful techniques are described above in the definitions section.
Regulatory element/Control sequence/Promoter
The terms "regulatory element", "control sequence" and "promoter" are all used interchangeably herein and are to be taken in a broad context to refer to regulatory nucleic acid sequences capable of effecting expression of the sequences to which they are ligated. The term "promoter" typically refers to a nucleic acid control sequence located upstream from the transcriptional start of a gene and which is involved in recognising and binding of RNA polymerase and other proteins, thereby directing transcription of an operably linked nucleic acid. Encompassed by the aforementioned terms are transcriptional regulatory sequences derived from a classical eukaryotic genomic gene (including the TATA box which is required for accurate transcription i nitiation, with or without a CCAAT box sequence) and additional regulatory elements (i.e. upstream activating sequences, enhancers and silencers) which alter gene expression in response to developmental and/or external stimuli , or in a tissue-specific manner. Also included within the term is a transcriptional regulatory sequence of a classical prokaryotic gene, in which case it may include a -35 box sequence and/or -10 box transcriptional regulatory sequences. The term "regulatory element" also encompasses a synthetic fusion molecule or derivative that confers, activates or enhances expression of a nucleic acid molecule in a cell, tissue or organ.
A "plant promoter" comprises regulatory elements, which mediate the expression of a coding sequence segment in plant cells. Accordingly, a plant promoter need not be of plant origin, but may originate from viruses or micro-organisms, for example from viruses which attack plant cells. The "plant promoter" can also originate from a plant cell, e.g. from the plant which is transformed with the nucleic acid sequence to be expressed in the inventive process and described herein. This also applies to other "plant" regulatory signals, such as "plant" terminators. The promoters upstream of the nucleotide sequences useful in the methods of the present invention can be modified by one or more nucleotide substitution(s), insertion(s) and/or deletion(s) without interfering with the functionality or activity of either the promoters, the open reading frame (ORF) or the 3'-regulatory region such as terminators or other 3' regulatory regions which are located away from the ORF. It is furthermore possible that the activity of the promoters is increased by modification of their sequence, or that they are replaced completely by more active promoters, even promoters from heterologous organisms. For expression in plants, the nucleic acid molecule must, as described above, be linked operably to or comprise a suitable promoter which expresses the gene at the right point in time and with the required spatial expression pattern.
For the identification of functionally equivalent promoters, the promoter strength and/or expression pattern of a candidate promoter may be analysed for example by operably linking the promoter to a reporter gene and assaying the expression level and pattern of the reporter gene in various tissues of the plant. Suitable well-known reporter genes include for example beta-glucuronidase or beta-galactosidase. The promoter activity is assayed by measuring the enzymatic activity of the beta-glucuronidase or beta-galactosidase. The promoter strength and/or expression pattern may then be compared to that of a reference promoter (such as the one used in the methods of the present invention). Alternatively, promoter strength may be assayed by quantifying mRNA levels or by comparing mRNA levels of the nucleic acid used in the methods of the present invention, with mRNA levels of housekeeping genes such as 18S rRNA, using methods known in the art, such as Northern blotting with densitometric analysis of autoradiograms, quantitative real-time PCR or RT- PCR (Heid et al., 1996 Genome Methods 6: 986-994). Generally by "weak promoter" is intended a promoter that drives expression of a coding sequence at a low level. By "low level" is intended at levels of about 1/10,000 transcripts to about 1/100,000 transcripts, to about 1/500,0000 transcripts per cell. Conversely, a "strong promoter" drives expression of a coding sequence at high level, or at about 1/10 transcripts to about 1/100 transcripts to about 1/1000 transcripts per cell. Generally, by "medium strength promoter" is intended a promoter that drives expression of a coding sequence at a lower level than a strong promoter, in particular at a level that is in all instances below that obtained when under the control of a 35S CaMV promoter.
Operably linked
The term "operably linked" as used herein refers to a functional linkage between the promoter sequence and the gene of interest, such that the promoter sequence is able to initiate transcription of the gene of interest.
Constitutive promoter
A "constitutive promoter" refers to a promoter that is transcriptionally active during most, but not necessarily all , phases of growth and development and under most environmental conditions, in at least one cel l , tissue or organ . Table 2a below gives examples of constitutive promoters. Table 2a: Examples of constitutive promoters
Figure imgf000063_0001
Ubiquitous promoter
A "ubiquitous promoter" is active in substantially all tissues or cells of an organism. Developmentally-regulated promoter
A "developmentally-regulated promoter" is active during certain developmental stages or in parts of the plant that undergo developmental changes. Inducible promoter
An "inducible promoter" has induced or increased transcription initiation in response to a chemical (for a review see Gatz 1997, Annu. Rev. Plant Physiol. Plant Mol. Biol. , 48:89- 108), environmental or physical stimulus, or may be "stress-inducible", i.e. activated when a plant is exposed to various stress conditions, or a "pathogen-inducible" i.e. activated when a plant is exposed to exposure to various pathogens.
Organ-specific/Tissue-specific promoter
An "organ-specific" or "tissue-specific promoter" is one that is capable of preferentially initiating transcription in certain organs or tissues, such as the leaves, roots, seed tissue etc. For example, a "root-specific promoter" is a promoter that is transcriptionally active predominantly in plant roots, substantially to the exclusion of any other parts of a plant, whilst still allowing for any leaky expression in these other plant parts. Promoters able to initiate transcription in certain cells only are referred to herein as "cell-specific".
Examples of root-specific promoters are listed in Table 2b below:
Table 2b: Examples of root-specific promoters
Gene Source Reference
RCc3 Plant Mol Biol. 1995 Jan;27(2):237-48
Arabidopsis PHT1 Koyama et al. J Biosci Bioeng. 2005 Jan;99(1 ):38-42.;
Mudge et al. (2002, Plant J. 31 :341 )
Medicago phosphate Xiao et al., 2006, Plant Biol (Stuttg). 2006 Jul;8(4):439- transporter 49
Arabidopsis Pyk10 Nitz et al. (2001) Plant Sci 161 (2): 337-346
root-expressible genes Tingey et al., EMBO J. 6: 1 , 1987.
tobacco auxin-inducible gene Van der Zaal et al., Plant Mol. Biol. 16, 983, 1991 .
β-tubulin Oppenheimer, et al., Gene 63: 87, 1988.
tobacco root-specific genes Conkling, et al., Plant Physiol. 93: 1203, 1990.
B. napus G1 -3b gene United States Patent No. 5, 401 , 836
SbPRPI Suzuki et al., Plant Mol. Biol. 21 : 109-1 19, 1993.
LRX1 Baumberger et al. 2001 , Genes & Dev. 15:1 128
BTG-26 Brassica napus US 20050044585
LeAMTI (tomato) Lauter et al. (1996, PNAS 3:8139)
The LeNRT1 -1 (tomato) Lauter et al. (1996, PNAS 3:8139)
class I patatin gene (potato) Liu et al., Plant Mol. Biol. 17 (6): 1 139-1 154
KDC1 (Daucus carota) Downey et al. (2000, J. Biol. Chem. 275:39420)
TobRB7 gene W Song (1997) PhD Thesis, North Carolina State
University, Raleigh, NC USA
OsRAB5a (rice) Wang et al. 2002, Plant Sci. 163:273
ALF5 (Arabidopsis) Diener et al. (2001 , Plant Cell 13:1625) NRT2;1 Np (N. plumbaginifolia) Quesada et al. (1997, Plant Mol. Biol. 34:265)
A "seed-specific promoter" is transcriptionally active predominantly in seed tissue, but not necessarily exclusively in seed tissue (in cases of leaky expression). The seed-specific promoter may be active during seed development and/or during germination. The seed specific promoter may be endosperm/aleurone/embryo specific. Examples of seed-specific promoters (endosperm/aleurone/embryo specific) are shown in Table 2c to Table 2f below. Further examples of seed-specific promoters are given in Qing Qu and Takaiwa (Plant Biotechnol. J. 2, 1 13-125, 2004), which disclosure is incorporated by reference herein as if fully set forth.
Table 2c: Examples of seed-specific promoters
Gene source Reference
seed-specific genes Simon et al., Plant Mol. Biol. 5: 191 , 1985;
Scofield et al., J. Biol. Chem. 262: 12202, 1987.;
Baszczynski et al., Plant Mol. Biol. 14: 633, 1990.
Brazil Nut albumin Pearson et al., Plant Mol. Biol. 18: 235-245, 1992.
legumin Ellis et al., Plant Mol. Biol. 10: 203-214, 1988.
glutelin (rice) Takaiwa et al., Mol. Gen. Genet. 208: 15-22, 1986;
Takaiwa et al., FEBS Letts. 221 : 43-47, 1987.
zein Matzke et al Plant Mol Biol, 14(3):323-32 1990
napA Stalberg et al, Planta 199: 515-519, 1996.
wheat LMW and HMW Mol Gen Genet 216:81 -90, 1989; NAR 17:461 -2, 1989 glutenin-1
wheat SPA Albani et al, Plant Cell, 9: 171-184, 1997
wheat α, β, γ-gliadins EMBO J. 3:1409-15, 1984
barley Itr1 promoter Diaz et al. (1995) Mol Gen Genet 248(5):592-8
barley B1 , C, D, hordein Theor Appl Gen 98:1253-62, 1999; Plant J 4:343-55,
1993; Mol Gen Genet 250:750-60, 1996
barley DOF Mena et al, The Plant Journal, 1 16(1 ): 53-62, 1998 blz2 EP99106056.7
synthetic promoter Vicente-Carbajosa et al., Plant J. 13: 629-640, 1998. rice prolamin NRP33 Wu et al, Plant Cell Physiology 39(8) 885-889, 1998 rice a-globulin Glb-1 Wu et al, Plant Cell Physiology 39(8) 885-889, 1998 rice OSH1 Sato et al, Proc. Natl. Acad. Sci. USA, 93: 81 17-8122,
1996
rice a-globulin REB/OHP-1 Nakase et al. Plant Mol. Biol. 33: 513-522, 1997 rice ADP-glucose pyrophos- Trans Res 6:157-68, 1997
phorylase
maize ESR gene family Plant J 12:235-46, 1997
sorghum a-kafirin DeRose et al., Plant Mol. Biol 32:1029-35, 1996 KNOX Postma-Haarsma et al, Plant Mol. Biol. 39:257-71 , 1999 rice oleosin Wu et al, J. Biochem. 123:386, 1998
sunflower oleosin Cummins et al., Plant Mol. Biol. 19: 873-876, 1992
PRO01 17, putative rice 40S WO 2004/070039
ribosomal protein
PRO0136, rice alanine unpublished
aminotransferase
PRO0147, trypsin inhibitor unpublished
ITR1 (barley)
PRO0151 , rice WSI18 WO 2004/070039
PRO0175, rice RAB21 WO 2004/070039
PRO005 WO 2004/070039
PRO0095 WO 2004/070039
a-amylase (Amy32b) Lanahan et al, Plant Cell 4:203-21 1 , 1992; Skriver et al,
Proc Natl Acad Sci USA 88:7266-7270, 1991 cathepsin β-like gene Cejudo et al, Plant Mol Biol 20:849-856, 1992
Barley Ltp2 Kalla et al., Plant J. 6:849-60, 1994
Chi26 Leah et al., Plant J. 4:579-89, 1994
Maize B-Peru Selinger et al., Genetics 149;1125-38,1998
Table 2d: Examples of endosperm-specific promoters
Gene source Reference
glutelin (rice) Takaiwa et al. (1986) Mol Gen Genet 208:15-22;
Takaiwa et al. (1987) FEBS Letts. 221 :43-47 zein Matzke et al., (1990) Plant Mol Biol 14(3): 323-32 wheat LMW and HMW glutenin-1 Colot et al. (1989) Mol Gen Genet 216:81 -90,
Anderson et al. (1989) NAR 17:461 -2
wheat SPA Albani et al. (1997) Plant Cell 9:171 -184 wheat gliadins Rafalski et al. (1984) EMBO 3:1409-15
barley Itr1 promoter Diaz et al. (1995) Mol Gen Genet 248(5):592-8 barley B1 , C, D, hordein Cho et al. (1999) Theor Appl Genet 98:1253-62;
Muller et al. (1993) Plant J 4:343-55;
Sorenson et al. (1996) Mol Gen Genet 250:750-60 barley DOF Mena et al, (1998) Plant J 1 16(1 ): 53-62 blz2 Onate et al. ( 999) J Biol Chem 274(14):9175-82 synthetic promoter Vicente-Carbajosa et al. (1998) Plant J 13:629-640 rice prolamin NRP33 Wu et al, (1998) Plant Cell Physiol 39(8) 885-889 rice globulin Glb-1 Wu et al. (1998) Plant Cell Physiol 39(8) 885-889 rice globulin REB/OHP-1 Nakase et al. (1997) Plant Molec Biol 33: 513-522 rice ADP-glucose pyrophosphorylase Russell et al. (1997) Trans Res 6:157-68 maize ESR gene family Opsahl-Ferstad et al. (1997) Plant J 12:235-46 sorghum kafirin DeRose et al. (1996) Plant Mol Biol 32:1029-35
Table 2e: Examples of embryo specific promoters:
Figure imgf000067_0001
Table 2f: Examples of aleurone-specific promoters:
Figure imgf000067_0002
A "green tissue-specific promoter" as defined herein is a promoter that is transcriptionally active predominantly in green tissue, substantially to the exclusion of any other parts of a plant, whilst still allowing for any leaky expression in these other plant parts. Examples of green tissue-specific promoters which may be used to perform the methods of the invention are shown in Table 2g below.
Table 2g: Examples of green tissue-specific promoters
Gene Expression Reference
Maize Orthophosphate dikinase Leaf specific Fukavama et al., Plant Physiol.
2001 Nov;127(3):1 136-46
Maize Phosphoenolpyruvate carboxylase Leaf specific Kausch et al., Plant Mol Biol.
2001 Jan;45(1 ):1 -15
Rice Phosphoenolpyruvate carboxylase Leaf specific Lin et al., 2004 DNA Seq. 2004
Aug;15(4):269-76
Rice small subunit Rubisco Leaf specific Nomura et al., Plant Mol Biol.
2000 Sep;44(1 ):99-106 rice beta expansin EXBP9 Shoot specific WO 2004/070039
Pigeonpea small subunit Rubisco Leaf specific Panguluri et al., Indian J Exp
Biol. 2005 Apr;43(4):369-72
Pea RBCS3A Leaf specific Another example of a tissue-specific promoter is a meristem-specific promoter, which is transcriptionally active predominantly in meristematic tissue, substantially to the exclusion of any other parts of a plant, whilst still allowing for any leaky expression in these other plant parts. Examples of green meristem-specific promoters which may be used to perform the methods of the invention are shown in Table 2h below.
Table 2h: Examples of meristem-specific promoters
Figure imgf000068_0001
Terminator
The term "terminator" encompasses a control sequence which is a DNA sequence at the end of a transcriptional unit which signals 3' processing and polyadenylation of a primary transcript and termination of transcription. The terminator can be derived from the natural gene, from a variety of other plant genes, or from T-DNA. The terminator to be added may be derived from, for example, the nopaline synthase or octopine synthase genes, or alternatively from another plant gene, or less preferably from any other eukaryotic gene.
Selectable marker (gene)/Reporter gene
"Selectable marker", "selectable marker gene" or "reporter gene" includes any gene that confers a phenotype on a cell in which it is expressed to facilitate the identification and/or selection of cells that are transfected or transformed with a nucleic acid construct of the invention. These marker genes enable the identification of a successful transfer of the nucleic acid molecules via a series of different principles. Suitable markers may be selected from markers that confer antibiotic or herbicide resistance, that introduce a new metabolic trait or that allow visual selection. Examples of selectable marker genes include genes conferring resistance to antibiotics (such as nptl l that phosphorylates neomycin and kanamycin, or hpt, phosphorylating hygromycin , or genes conferring resistance to, for example, bleomycin, streptomycin, tetracyclin, chloramphenicol, ampicillin, gentamycin, geneticin (G418), spectinomycin or blasticidin), to herbicides (for example bar which provides resistance to Basta®; aroA or gox providing resistance against glyphosate, or the genes conferri ng resistance to, for exampl e, i midazolinone, phosph inoth rici n or sulfonylurea), or genes that provide a metabolic trait (such as manA that allows plants to use mannose as sole carbon source or xylose isomerase for the utilisation of xylose, or antinutritive markers such as the resistance to 2-deoxyglucose). Expression of visual marker genes results in the formation of colour (for example β-glucuronidase, GUS or β- galactosidase with its coloured substrates, for example X-Gal), luminescence (such as the luciferin/luceferase system) or fluorescence (Green Fluorescent Protein, GFP, and derivatives thereof). This list represents only a small number of possible markers. The skilled worker is familiar with such markers. Different markers are preferred, depending on the organism and the selection method.
It is known that upon stable or transient integration of nucleic acids into plant cells, only a minority of the cells takes up the foreign DNA and, if desired, integrates it into its genome, depending on the expression vector used and the transfection technique used. To identify and select these integrants, a gene coding for a selectable marker (such as the ones described above) is usually introduced into the host cells together with the gene of interest. These markers can for example be used in mutants in which these genes are not functional by, for example, deletion by conventional methods. Furthermore, nucleic acid molecules encoding a selectable marker can be introduced into a host cell on the same vector that comprises the sequence encoding the polypeptides of the invention or used in the methods of the invention, or else in a separate vector. Cells which have been stably transfected with the introduced nucleic acid can be identified for example by selection (for example, cells which have integrated the selectable marker survive whereas the other cells die).
Since the marker genes, particularly genes for resistance to antibiotics and herbicides, are no longer required or are undesired in the transgenic host cell once the nucleic acids have been introduced successfully, the process according to the invention for introducing the nucleic acids advantageously employs techniques which enable the removal or excision of these marker genes. One such a method is what is known as co-transformation. The co- transformation method employs two vectors simultaneously for the transformation, one vector bearing the nucleic acid according to the invention and a second bearing the marker gene(s). A large proportion of transformants receives or, in the case of plants, comprises (up to 40% or more of the transformants), both vectors. In case of transformation with Agrobacteria, the transformants usually receive only a part of the vector, i.e. the sequence flanked by the T-DNA, which usually represents the expression cassette. The marker genes can subsequently be removed from the transformed plant by performing crosses. In another method, marker genes integrated into a transposon are used for the transformation together with desired nucleic acid (known as the Ac/Ds technology). The transformants can be crossed with a transposase source or the transformants are transformed with a nucleic acid construct conferring expression of a transposase, transiently or stable. In some cases (approx. 0%), the transposon jumps out of the genome of the host cell once transformation has taken place successfully and is lost. In a further number of cases, the transposon jumps to a different location. In these cases the marker gene must be eliminated by performing crosses. In microbiology, techniques were developed which make possible, or facilitate, the detection of such events. A further advantageous method relies on what is known as recombination systems; whose advantage is that elimination by crossing can be dispensed with. The best-known system of this type is what is known as the Cre/lox system. Cre1 is a recombinase that removes the sequences located between the loxP sequences. If the marker gene is integrated between the loxP sequences, it is removed once transformation has taken place successfully, by expression of the recombinase. Further recombination systems are the HIN/HIX, FLP/FRT and REP/STB system (Tribble et al. , J. Biol. Chem., 275, 2000: 22255-22267; Velmurugan et al., J. Cell Biol. , 149, 2000: 553-566). A site- specific integration into the plant genome of the nucleic acid sequences according to the invention is possible. Naturally, these methods can also be applied to microorganisms such as yeast, fungi or bacteria.
Transgenic/Transgene/Recombinant
For the purposes of the invention, "transgenic", "transgene" or "recombinant" means with regard to, for example, a nucleic acid sequence, an expression cassette, gene construct or a vector comprising the nucleic acid sequence or an organism transformed with the nucleic acid sequences, expression cassettes or vectors according to the invention, all those constructions brought about by recombinant methods in which either
(a) the nucleic acid sequences encoding proteins useful in the methods of the invention, or
(b) genetic control sequence(s) which is operably linked with the nucleic acid sequence according to the invention, for example a promoter, or
(c) a) and b)
are not located in their natural genetic environment or have been modified by recombinant methods, it bei ng possi ble for the modification to take the form of, for example, a substitution, addition, deletion, inversion or insertion of one or more nucleotide residues. The natural genetic environ ment is understood as meaning the natural genomic or chromosomal locus in the original plant or the presence in a genomic library. In the case of a genomic library, the natural genetic environment of the nucleic acid sequence is preferably retained, at least in part. The environment flanks the nucleic acid sequence at least on one side and has a sequence length of at least 50 bp, preferably at least 500 bp, especially preferably at least 1000 bp, most preferably at least 5000 bp. A naturally occurring expression cassette - for example the naturally occurring combination of the natural promoter of the nucleic acid sequences with the corresponding nucleic acid sequence encoding a polypeptide useful in the methods of the present invention, as defined herein - becomes a transgenic expression cassette when this expression cassette is modified by non-natural, synthetic ("artificial") methods such as, for example, mutagenic treatment. Suitable methods are described, for example, in US 5,565,350 or WO 00/15815.
A transgenic plant for the purposes of the invention is thus understood as meaning, as above, that the nucleic acids used in the method of the invention are not present in, or originating from, the genome of said plant, or are present in the genome of said plant but not at their natural locus in the genome of said plant, it being possible for the nucleic acids to be expressed homologously or heterologously. However, as mentioned, transgenic also means that, while the nucleic acids according to the invention or used in the inventive method are at their natural position in the genome of a plant, the sequence has been modified with regard to the natural sequence, and/or that the regulatory sequences of the natural sequences have been modified. Transgenic is preferably understood as meaning the expression of the nucleic acids according to the invention at an unnatural locus in the genome, i.e. homologous or, preferably, heterologous expression of the nucleic acids takes place. Preferred transgenic plants are mentioned herein. It shall further be noted that in the context of the present invention, the term "isolated nucleic acid" or "isolated polypeptide" may in some instances be considered as a synonym for a "recombinant nucleic acid" or a "recombinant polypeptide", respectively and refers to a nucleic acid or polypeptide that is not located in its natural genetic environment and/or that has been modified by recombinant methods.
Modulation
The term "modulation" means in relation to expression or gene expression, a process in which the expression level is changed by said gene expression in comparison to the control plant, the expression level may be increased or decreased. The original, unmodulated expression may be of any kind of expression of a structural RNA (rRNA, tRNA) or mRNA with subsequent translation. For the purposes of this invention, the original unmodulated expression may also be absence of any expression. The term "modulating the activity" shall mean any change of the expression of the inventive nucleic acid sequences or encoded proteins, which leads to increased yield and/or increased growth of the plants. The expression can increase from zero (absence of, or immeasurable expression) to a certain amount, or can decrease from a certain amount to immeasurable small amounts or zero.
Expression
The term "expression" or "gene expression" means the transcription of a specific gene or specific genes or specific genetic construct. The term "expression" or "gene expression" in particular means the transcription of a gene or genes or genetic construct into structural RNA (rRNA, tRNA) or mRNA with or without subsequent translation of the latter into a protein. The process includes transcription of DNA and processing of the resulting mRNA product.
Increased expression/overexpression
The term "increased expression" or "overexpression" as used herein means any form of expression that is additional to the original wild-type expression level. For the purposes of this invention, the original wild-type expression level might also be zero, i.e. absence of expression or immeasurable expression. Methods for increasing expression of genes or gene products are well documented in the art and include, for example, overexpression driven by appropriate promoters, the use of transcription enhancers or translation enhancers. Isolated nucleic acids which serve as promoter or enhancer elements may be introduced in an appropriate position (typically upstream) of a non-heterologous form of a polynucleotide so as to upregulate expression of a nucleic acid encoding the polypeptide of interest. For example, endogenous promoters may be altered in vivo by mutation, deletion, and/or substitution (see, Kmiec, US 5,565,350; Zarling et al., W09322443), or isolated promoters may be introduced into a plant cell in the proper orientation and distance from a gene of the present invention so as to control the expression of the gene.
If polypeptide expression is desired, it is generally desirable to include a polyadenylation region at the 3'-end of a polynucleotide coding region. The polyadenylation region can be derived from the natural gene, from a variety of other plant genes, or from T-DNA. The 3' end sequence to be added may be derived from, for example, the nopaline synthase or octopine synthase genes, or alternatively from another plant gene, or less preferably from any other eukaryotic gene.
An intron sequence may also be added to the 5' untranslated region (UTR) or the coding sequence of the partial coding sequence to increase the amount of the mature message that accumulates in the cytosol. Inclusion of a spliceable intron in the transcription unit in both plant and animal expression constructs has been shown to increase gene expression at both the mRNA and protein levels up to 1000-fold (Buchman and Berg (1988) Mol. Cell biol. 8: 4395-4405; Callis et al. (1987) Genes Dev 1 :1 183-1200). Such intron enhancement of gene expression is typically greatest when placed near the 5' end of the transcription unit. Use of the maize introns Adh1 -S intron 1 , 2, and 6, the Bronze-1 intron are known in the art. For general information see: The Maize Handbook, Chapter 1 16, Freeling and Walbot, Eds., Springer, N.Y. (1994). Decreased expression
Reference herein to "decreased expression" or "reduction or substantial elimination" of expression is taken to mean a decrease in endogenous gene expression and/or polypeptide levels and/or polypeptide activity relative to control plants. The reduction or substantial elimination is in increasing order of preference at least 10%, 20%, 30%, 40% or 50%, 60%, 70%, 80%, 85%, 90%, or 95%, 96%, 97%, 98%, 99% or more reduced compared to that of control plants.
For the reduction or substantial elimination of expression an endogenous gene in a plant, a sufficient length of substantially contiguous nucleotides of a nucleic acid sequence is required. In order to perform gene silencing, this may be as little as 20, 19, 18, 17, 16, 15, 14, 13, 12, 1 1 , 10 or fewer nucleotides, alternatively this may be as much as the entire gene (including the 5' and/or 3' UTR, either in part or in whole). The stretch of substantially contiguous nucleotides may be derived from the nucleic acid encoding the protein of interest (target gene), or from any nucleic acid capable of encoding an orthologue, paralogue or homologue of the protein of interest. Preferably, the stretch of substantially contiguous nucleotides is capable of forming hydrogen bonds with the target gene (either sense or antisense strand), more preferably, the stretch of substantially contiguous nucleotides has, in increasing order of preference, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97% , 98% , 99% , 100% seq uence identity to the target gene (either sense or antisense strand). A nucleic acid sequence encoding a (functional) polypeptide is not a requirement for the various methods discussed herein for the reduction or substantial elimination of expression of an endogenous gene.
This reduction or substantial elimination of expression may be achieved using routine tools and techn iques. A preferred method for the reduction or substantial elimination of endogenous gene expression is by introducing and expressing in a plant a genetic construct into which the nucleic acid (in this case a stretch of substantially contiguous nucleotides derived from the gene of interest, or from any nucleic acid capable of encoding an orthologue, paralogue or homologue of any one of the protein of interest) is cloned as an inverted repeat (in part or completely), separated by a spacer (non-coding DNA). In such a preferred method, expression of the endogenous gene is reduced or substantially eliminated through RNA-mediated silencing using an inverted repeat of a nucleic acid or a part thereof (in this case a stretch of substantially contiguous nucleotides derived from the gene of interest, or from any nucleic acid capable of encoding an orthologue, paralogue or homologue of the protein of interest), preferably capable of forming a hairpin structure. The inverted repeat is cloned in an expression vector comprising control sequences. A non- coding DNA nucleic acid sequence (a spacer, for example a matrix attachment region fragment (MAR), an intron, a polylinker, etc.) is located between the two inverted nucleic acids forming the inverted repeat. After transcription of the inverted repeat, a chimeric RNA with a self-complementary structure is formed (partial or complete). This double-stranded RNA structure is referred to as the hairpin RNA (hpRNA). The hpRNA is processed by the plant into siRNAs that are incorporated into an RNA-induced silencing complex (RISC). The RISC further cleaves the mRNA transcripts, thereby substantially reducing the number of mRNA transcripts to be translated into polypeptides. For further general details see for example, Grierson et al. (1998) WO 98/53083; Waterhouse et al. (1999) WO 99/53050).
Performance of the methods of the invention does not rely on introducing and expressing in a plant a genetic construct into which the nucleic acid is cloned as an inverted repeat, but any one or more of several well-known "gene silencing" methods may be used to achieve the same effects.
One such method for the reduction of endogenous gene expression is RNA-mediated silencing of gene expression (downregulation). Silencing in this case is triggered in a plant by a double stranded RNA sequence (dsRNA) that is substantially similar to the target endogenous gene. This dsRNA is further processed by the plant into about 20 to about 26 nucleotides called short interfering RNAs (siRNAs). The siRNAs are incorporated into an RNA-induced silencing complex (RISC) that cleaves the mRNA transcript of the endogenous target gene, thereby substantially reducing the number of mRNA transcripts to be tran slated i nto a polypeptide. Preferably, the double stranded RNA sequence corresponds to a target gene.
Another example of an RNA silencing method involves the introduction of nucleic acid sequences or parts thereof (in this case a stretch of substantially contiguous nucleotides derived from the gene of interest, or from any nucleic acid capable of encoding an orthologue, paralogue or homologue of the protein of interest) in a sense orientation into a plant. "Sense orientation" refers to a DNA sequence that is homologous to an mRNA transcript thereof. Introduced into a plant would therefore be at least one copy of the nucleic acid sequence. The additional nucleic acid sequence wi ll reduce expression of the endogenous gene, giving rise to a phenomenon known as co-suppression. The reduction of gene expression will be more pronounced if several additional copies of a nucleic acid sequence are introduced into the plant, as there is a positive correlation between high transcript levels and the triggering of co-suppression.
Another example of an RNA silencing method involves the use of antisense nucleic acid sequences. An "antisense" nucleic acid sequence comprises a nucleotide sequence that is complementary to a "sense" nucleic acid sequence encoding a protein, i.e. complementary to the coding strand of a double-stranded cDNA molecule or complementary to an mRNA transcript sequence. The antisense nucleic acid sequence is preferably complementary to the endogenous gene to be silenced. The complementarity may be located in the "coding region" and/or in the "non-coding region" of a gene. The term "coding region" refers to a region of the nucleotide sequence comprising codons that are translated into amino acid residues. The term "non-coding region" refers to 5' and 3' sequences that flank the coding region that are transcribed but not translated into amino acids (also referred to as 5' and 3' untranslated regions).
Antisense nucleic acid sequences can be designed according to the rules of Watson and Crick base pairing. The antisense nucleic acid sequence may be complementary to the entire nucleic acid sequence (in this case a stretch of substantially contiguous nucleotides derived from the gene of interest, or from any nucleic acid capable of encoding an orthologue, paralogue or homologue of the protein of interest), but may also be an oligonucleotide that is antisense to only a part of the nucleic acid sequence (including the mRNA 5' and 3' UTR). For example, the antisense oligonucleotide sequence may be complementary to the region surrounding the translation start site of an mRNA transcript encoding a polypeptide. The length of a suitable antisense oligonucleotide sequence is known in the art and may start from about 50, 45, 40, 35, 30, 25, 20, 15 or 10 nucleotides in length or less. An antisense nucleic acid sequence according to the invention may be constructed using chemical synthesis and enzymatic ligation reactions using methods known in the art. For example, an antisense nucleic acid sequence (e.g., an antisense oligonucleotide sequence) may be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acid sequences, e.g. , phosphorothioate derivatives and acridine substituted nucleotides may be used. Examples of modified nucleotides that may be used to generate the antisense nucleic acid sequences are well known in the art. Known nucleotide modifications include methylation, cyclization and 'caps' and substitution of one or more of the naturally occurring nucleotides with an analogue such as inosine. Other modifications of nucleotides are well known in the art.
The antisense nucleic acid sequence can be produced biologically using an expression vector into which a nucleic acid sequence has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest). Preferably, production of antisense nucleic acid sequences in plants occurs by means of a stably integrated nucleic acid construct comprising a promoter, an operably linked antisense oligonucleotide, and a terminator.
The nucleic acid molecules used for silencing in the methods of the invention (whether introduced into a plant or generated in situ) hybridize with or bind to mRNA transcripts and/or genomic DNA encoding a polypeptide to thereby inhibit expression of the protein, e.g., by inhibiting transcription and/or translation. The hybridization can be by conventional nucleotide complementarity to form a stable duplex, or, for example, in the case of an antisense nucleic acid sequence which binds to DNA duplexes, through specific interactions in the major groove of the double hel ix. Antisense nucleic acid sequences may be introduced into a plant by transformation or direct injection at a specific tissue site. Alternatively, antisense nucleic acid sequences can be modified to target selected cells and then administered systemically. For example, for systemic administration, antisense nucleic acid sequences can be modified such that they specifically bind to receptors or antigens expressed on a selected cell surface, e.g., by linking the antisense nucleic acid sequence to peptides or antibodies which bind to cell surface receptors or antigens. The antisense nucleic acid sequences can also be delivered to cells using the vectors described herein.
According to a further aspect, the antisense nucleic acid sequence is an a-anomeric nucleic acid seq uence. An a-anomeric nucleic acid sequence forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual b-units, the strands run parallel to each other (Gaultier et al. (1987) Nucl Ac Res 15: 6625-6641 ). The antisense nucleic acid sequence may also comprise a 2'-o-methylribonucleotide (Inoue et al. (1987) Nucl Ac Res 15, 6131 -6148) or a chimeric RNA-DNA analogue (Inoue et al. (1987) FEBS Lett. 215, 327-330). The reduction or substantial elimination of endogenous gene expression may also be performed using ribozymes. Ribozymes are catalytic RNA molecules with ribonuclease activity that are capable of cleaving a single-stranded nucleic acid sequence, such as an mRNA, to which they have a complementary region. Thus, ribozymes (e.g., hammerhead ribozymes (described in Haselhoff and Gerlach (1988) Nature 334, 585-591) can be used to catalytically cleave mRNA transcripts encoding a polypeptide, thereby substantially reducing the number of mRNA transcripts to be translated into a polypeptide. A ribozyme having specificity for a nucleic acid sequence can be designed (see for example: Cech et al. U.S. Patent No. 4,987,071 ; and Cech et al. U.S. Patent No. 5, 1 1 6,742). Alternatively, mRNA transcripts corresponding to a nucleic acid sequence can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules (Bartel and Szostak (1993) Science 261 , 141 1 -1418). The use of ribozymes for gene silencing in plants is known in the art (e.g., Atkins et al. (1994) WO 94/00012; Lenne et al. (1995) WO 95/03404; Lutziger et al. (2000) WO 00/00619; Prinsen et al. (1997) WO 97/13865 and Scott et al. (1997) WO 97/381 16).
Gene silencing may also be achieved by insertion mutagenesis (for example, T-DNA insertion or transposon insertion) or by strategies as described by, among others, Angell and Bau lcombe ((1999) Plant J 20(3): 357-62), (Amplicon VIGS WO 98/36083), or Baulcombe (WO 99/15682).
Gene silencing may also occur if there is a mutation on an endogenous gene and/or a mutation on an isolated gene/nucleic acid subsequently introduced into a plant. The reduction or substantial elimination may be caused by a non-functional polypeptide. For example, the polypeptide may bind to various interacting proteins; one or more mutation(s) and/or truncation(s) may therefore provide for a polypeptide that is still able to bind interacting proteins (such as receptor proteins) but that cannot exhibit its normal function (such as signalling ligand).
A further approach to gene silencing is by targeting nucleic acid sequences complementary to the regulatory region of the gene (e.g., the promoter and/or enhancers) to form triple helical structures that prevent transcription of the gene in target cells. See Helene, C , Anticancer Drug Res. 6, 569-84, 1991 ; Helene et al., Ann. N.Y. Acad. Sci. 660, 27-36 1992; and Maher, L.J. Bioassays 14, 807-15, 1992.
Other methods, such as the use of antibodies directed to an endogenous polypeptide for inh ibiting its function i n planta, or interference in the signalling pathway in which a polypeptide is involved, will be well known to the skilled man. In particular, it can be envisaged that manmade molecules may be useful for inhibiting the biological function of a target polypeptide, or for interfering with the signalling pathway in which the target polypeptide is involved. Alternatively, a screening program may be set up to identify in a plant population natural variants of a gene, which variants encode polypeptides with reduced activity. Such natural variants may also be used for example, to perform homologous recombination.
Artificial and/or natural microRNAs (miRNAs) may be used to knock out gene expression and/or mRNA translation. Endogenous miRNAs are single stranded small RNAs of typically 19-24 nucleotides long. They function primarily to regulate gene expression and/ or mRNA translation. Most plant microRNAs (miRNAs) have perfect or near-perfect complementarity with their target sequences. However, there are natural targets with up to five mismatches. They are processed from longer non-coding RNAs with characteristic fold-back structures by double-strand specific RNases of the Dicer family. Upon processing, they are incorporated in the RNA-induced silencing complex (RISC) by binding to its main component, an Argonaute protein. MiRNAs serve as the specificity components of RISC, since they base-pair to target nucleic acids, mostly mRNAs, in the cytoplasm. Subsequent regulatory events include target mRNA cleavage and destruction and/or translational inhibition. Effects of miRNA overexpression are thus often reflected in decreased mRNA levels of target genes. Artificial microRNAs (ami RNAs), which are typically 21 nucleotides in length, can be genetically engineered specifically to negatively regulate gene expression of single or multiple genes of interest. Determinants of plant microRNA target selection are well known in the art. Empirical parameters for target recognition have been defined and can be used to aid in the design of specific amiRNAs, (Schwab et al., Dev. Cell 8, 517-527, 2005). Convenient tools for design and generation of amiRNAs and their precursors are also available to the public (Schwab et al., Plant Cell 18, 1 121 -1 133, 2006).
For optimal performance, the gene silencing techniques used for reducing expression in a plant of an endogenous gene requires the use of nucleic acid sequences from monocotyledonous plants for transformation of monocotyledonous plants, and from dicotyledonous plants for transformation of dicotyledonous plants. Preferably, a nucleic acid sequence from any given plant species is introduced into that same species. For example, a nucleic acid sequence from rice is transformed into a rice plant. However, it is not an absolute requirement that the nucleic acid sequence to be introduced originates from the same plant species as the plant in which it will be introduced. It is sufficient that there is substantial homology between the endogenous target gene and the nucleic acid to be introduced.
Described above are examples of various methods for the reduction or substantial elimination of expression in a plant of an endogenous gene. A person skilled in the art would readily be able to adapt the aforementioned methods for silencing so as to achieve reduction of expression of an endogenous gene in a whole plant or in parts thereof through the use of an appropriate promoter, for example.
Transformation
The term "introduction" or "transformation" as referred to herein encompasses the transfer of an exogenous polynucleotide into a host cell, irrespective of the method used for transfer. Plant tissue capable of subsequent clonal propagation, whether by organogenesis or embryogenesis, may be transformed with a genetic construct of the present invention and a whole plant regenerated there from. The particular tissue chosen will vary depending on the clonal propagation systems available for, and best suited to, the particular species being transformed. Exemplary tissue targets include leaf disks, pollen, embryos, cotyledons, hypocotyls, megagametophytes, callus tissue, existing meristematic tissue (e.g., apical meristem, axillary buds, and root meristems), and induced meristem tissue (e.g., cotyledon meristem and hypocotyl meristem). The polynucleotide may be transiently or stably introduced into a host cell and may be maintained non-integrated, for example, as a plasmid. Alternatively, it may be integrated into the host genome. The resulting transformed plant cell may then be used to regenerate a transformed plant in a manner known to persons skilled in the art. Alternatively, a plant cell that cannot be regenerated into a plant may be chosen as host cell, i.e. the resulting transformed plant cell does not have the capacity to regenerate into a (whole) plant.
The transfer of foreign genes i nto the genome of a plant is cal led transformation . Transformation of plant species is now a fairly routine technique. Advantageously, any of several transformation methods may be used to introduce the gene of interest into a suitable ancestor cell. The methods described for the transformation and regeneration of plants from plant tissues or plant cel ls may be util ized for transient or for stable transformation. Transformation methods include the use of liposomes, electroporation, chemicals that increase free DNA uptake, injection of the DNA directly into the plant, particle gun bombardment, transformation using viruses or pollen and microprojection. Methods may be selected from the calcium/polyethylene glycol method for protoplasts (Krens, F.A. et al., (1982) Nature 296, 72-74; Negrutiu I et al. (1987) Plant Mol Biol 8: 363- 373); electroporation of protoplasts (Shillito R.D. et al. (1985) Bio/Technol 3, 1099-1 102); microinjection into plant material (Crossway A et al., (1986) Mol. Gen Genet 202: 179-185); DNA or RNA-coated particle bombardment (Klein TM et al., (1987) Nature 327: 70) infection with (non-integrative) viruses and the like. Transgenic plants, including transgenic crop plants , a re prefera bly prod u ced vi a Agrobacterium-medlaied transformation. An advantageous transformation method is the transformation in planta. To this end , it is possible, for example, to allow the agrobacteria to act on plant seeds or to inoculate the plant meristem with agrobacteria. It has proved particularly expedient in accordance with the invention to allow a suspension of transformed agrobacteria to act on the intact plant or at least on the flower primordia. The plant is subsequently grown on until the seeds of the treated plant are obtained (Clough and Bent, Plant J. (1998) 16, 735-743). Methods for Agrobacterium-medlaied transformation of rice include well known methods for rice transformation, such as those described in any of the following: European patent application EP 1 198985 A1 , Aldemita and Hodges (Planta 199: 612-617, 1996); Chan et al. (Plant Mol Biol 22 (3): 491 -506, 1993), Hiei et al. (Plant J 6 (2): 271 -282, 1994), which disclosures are incorporated by reference herein as if fully set forth. In the case of corn transformation, the preferred method is as described in either Ishida et al. (Nat. Biotechnol 14(6): 745-50, 1996) or Frame et al. (Plant Physiol 129(1 ): 13-22, 2002), which disclosures are incorporated by reference herein as if fully set forth. Said methods are further described by way of example in B. Jenes et al., Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1 , Engineering and Utilization, eds. S.D. Kung and R. Wu, Academic Press (1993) 128-143 and in Potrykus Annu. Rev. Plant Physiol. Plant Molec. Biol. 42 (1991 ) 205-225). The nucleic acids or the construct to be expressed is preferably cloned into a vector, wh ich is suitable for transforming Agrobacterium tumefaciens, for example pBin19 (Bevan et al., Nucl. Acids Res. 12 (1984) 871 1 ). Agrobacteria transformed by such a vector can then be used in known manner for the transformation of plants, such as plants used as a model, like Arabidopsis (Arabidopsis thaliana is within th e scope of the present inventi on not considered as a crop plant), or crop plants such as, by way of example, tobacco plants, for example by immersing bruised leaves or chopped leaves in an agrobacterial solution and then cu lturi ng them in suitable media. The tra nsformation of plants by means of Agrobacterium tumefaciens is described, for example, by Hofgen and Willmitzer in Nucl. Acid Res. (1988) 16, 9877 or is known inter alia from F.F. White, Vectors for Gene Transfer in Higher Plants; in Transgenic Plants, Vol. 1 , Engineering and Utilization, eds. S.D. Kung and R. Wu, Academic Press, 1993, pp. 15-38. In addition to the transformation of somatic cells, which then have to be regenerated into intact plants, it is also possible to transform the cells of plant meristems and in particular those cells which develop into gametes. In this case, the transformed gametes follow the natural plant development, giving rise to transgenic plants. Thus, for example, seeds of Arabidopsis are treated with agrobacteria and seeds are obtained from the developing plants of which a certain proportion is transformed and thus transgenic [Feldman, KA and Marks MD (1987). Mol Gen Genet 208:1 -9; Feldmann K (1992). In: C Koncz, N-H Chua and J Shell, eds, Methods in Arabidopsis Research. Word Scientific, Singapore, pp. 274-289]. Alternative methods are based on the repeated removal of the i nflorescences and incubation of the excision site in the center of the rosette with transformed agrobacteria, whereby transformed seeds can likewise be obtained at a later point in time (Chang (1994). Plant J. 5: 551 -558; Katavic (1994). Mol Gen Genet, 245: 363-370). However, an especially effective method is the vacuum infiltration method with its modifications such as the "floral dip" method. In the case of vacuum infiltration of Arabidopsis, intact plants under reduced pressure are treated with an agrobacterial suspension [Bechthold, N (1993). C R Acad Sci Paris Life Sci, 316: 1 194-1 199], while in the case of the "floral dip" method the developing floral tissue is incubated briefly with a surfactant-treated agrobacterial suspension [Clough, SJ and Bent AF (1998) The Plant J. 16, 735-743]. A certain proportion of transgenic seeds are harvested in both cases, and these seeds can be distinguished from non-transgenic seeds by growing under the above-described selective conditions. In addition the stable transformation of plastids is of advantages because plastids are inherited maternally is most crops reducing or eliminating the risk of transgene flow through pollen. The transformation of the chloroplast genome is generally achieved by a process which has been schematically displayed i n Klaus et al . , 2004 [Nature Biotechnology 22 (2), 225-229]. Briefly the sequences to be transformed are cloned together with a selectable marker gene between flanking sequences homologous to the chloroplast genome. These homologous flanking sequences direct site specific integration into the plastome. Plastidal transformation has been described for many different plant species and an overview is given in Bock (2001 ) Transgenic plastids in basic research and plant biotechnology. J Mol Biol. 2001 Sep 21 ; 312 (3):425-38 o r M a l iga , P (2003) Progress towa rd s com merci al izatio n of pl asti d transformation technology. Trends Biotechnol. 21 , 20-28. Further biotechnological progress has recently been reported in form of marker free plastid transformants, which can be produced by a transient co-integrated maker gene (Klaus et al., 2004, Nature Biotechnology 22(2), 225-229).
The genetically modified plant cells can be regenerated via all methods with which the skilled worker is fami liar. Suitable methods can be fou nd in the abovementioned publications by S.D. Kung and R. Wu, Potrykus or Hofgen and Willmitzer. Alternatively, the genetically modified plant cells are non-regenerable into a whole plant.
Generally after transformation, plant cells or cell groupings are selected for the presence of one or more markers which are encoded by plant-expressible genes co-transferred with the gene of interest, following which the transformed material is regenerated into a whole plant. To select transformed plants, the plant material obtained in the transformation is, as a rule, subjected to selective conditions so that transformed plants can be distinguished from untransformed plants. For example, the seeds obtained in the above-described manner can be planted and, after an initial growing period, subjected to a suitable selection by spraying. A further possibility consists in growing the seeds, if appropriate after sterilization, on agar plates using a suitable selection agent so that only the transformed seeds can grow into plants. Alternatively, the transformed plants are screened for the presence of a selectable marker such as the ones described above. Following DNA transfer and regeneration, putatively transformed plants may also be evaluated, for instance using Southern analysis, for the presence of the gene of interest, copy number and/or genomic organisation. Alternatively or additionally, expression levels of the newly introduced DNA may be monitored using Northern and/or Western analysis, both techniques being well known to persons having ordinary skill in the art.
The generated transformed plants may be propagated by a variety of means, such as by clonal propagation or classical breeding techniques. For example, a first generation (or T1 ) transformed plant may be selfed and homozygous second-generation (or T2) transformants selected, and the T2 plants may then further be propagated through classical breeding techniques. The generated transformed organisms may take a variety of forms. For example, they may be chimeras of transformed cells and non-transformed cells; clonal transformants (e.g. , all cells transformed to contain the expression cassette); grafts of transformed and untransformed tissues (e.g., in plants, a transformed rootstock grafted to an untransformed scion).
T-DNA activation tagging
"T-DNA activation" tagging (Hayashi et al. Science (1992) 1350-1353), involves insertion of T-DNA, usually containing a promoter (may also be a translation enhancer or an intron), in the genomic region of the gene of interest or 10 kb up- or downstream of the coding region of a gene in a configuration such that the promoter directs expression of the targeted gene. Typically, regulation of expression of the targeted gene by its natural promoter is disrupted and the gene falls under the control of the newly introduced promoter. The promoter is typically embedded in a T-DNA. This T-DNA is randomly inserted into the plant genome, for example, through Agrobacterium infection and leads to modified expression of genes near the inserted T-DNA. The resulting transgenic plants show dominant phenotypes due to modified expression of genes close to the introduced promoter.
TILLING
The term "TILLING" is an abbreviation of "Targeted Induced Local Lesions In Genomes" and refers to a mutagenesis technology useful to generate and/or identify nucleic acids encoding proteins with modified expression and/or activity. TILLING also allows selection of plants carrying such mutant variants. These mutant variants may exhibit modified expression, either in strength or in location or in timing (if the mutations affect the promoter for example). These mutant variants may exhibit higher activity than that exhibited by the gene in its natural form. TILLING combines high-density mutagenesis with high-throughput screening methods. The steps typically followed in TILLING are: (a) EMS mutagenesis (Redei GP and Koncz C (1992) In Methods in Arabidopsis Research, Koncz C, Chua NH, Schell J, eds. Singapore, World Scientific Publishing Co, pp. 16-82; Feldmann et al., (1994) In Meyerowitz EM, Somerville CR, eds, Arabidopsis. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp 137-172; Lightner J and Caspar T (1998) In J Martinez-Zapater, J Salinas, eds, Methods on Molecular Biology, Vol. 82. Humana Press, Totowa, NJ, pp 91 - 104); (b) DNA preparation and pooling of individuals; (c) PCR amplification of a region of interest; (d) denaturation and annealing to allow formation of heteroduplexes; (e) DHPLC, where the presence of a heterodu plex in a pool is detected as an extra peak in the chromatogram; (f) identification of the mutant individual; and (g) sequencing of the mutant PCR product. Methods for TILLING are well known in the art (McCallum et al., (2000) Nat Biotechnol 18: 455-457; reviewed by Stemple (2004) Nat Rev Genet 5(2): 145-50). Homologous recombination
"Homologous recombination" allows introduction in a genome of a selected nucleic acid at a defined selected position. Homologous recombination is a standard technology used routi nely in biologi ca l sci en ces for lower organ isms such as yeast or the moss Physcomitrella. Methods for performing homologous recombination in plants have been described not only for model plants (Offringa et al. (1990) EMBO J 9(10): 3077-84) but also for crop plants, for example rice (Terada et al. (2002) Nat Biotech 20(10): 1030-4; lida and Terada (2004) Curr Opin Biotech 15(2): 132-8), and approaches exist that are generally applicable regardless of the target organism (Miller et al, Nature Biotechnol. 25, 778-785, 2007).
Yield related Trait(s)
A "Yield related trait" is a trait or feature which is related to plant yield. Yield-related traits may comprise one or more of the following non-limitative list of features: early flowering time, yield, biomass, seed yield, early vigour, greenness index, growth rate, agronomic traits, such as e.g. tolerance to submergence (which leads to yield in rice), Water Use Efficiency (WUE), Nitrogen Use Efficiency (NUE), etc.
Reference herein to enhanced yield-related traits, relative to of control plants is taken to mean one or more of an increase in early vigour and/or in biomass (weight) of one or more parts of a plant, which may include (i) aboveground parts and preferably aboveground harvestable parts and/or (ii) parts below ground and preferably harvestable below ground. In particular, such harvestable parts are seeds. Yield
The term "yield" in general means a measurable produce of economic value, typically related to a specified crop, to an area, and to a period of time. Individual plant parts directly contribute to yield based on their number, size and/or weight, or the actual yield is the yield per square meter for a crop and year, which is determined by dividing total production (includes both harvested and appraised production) by planted square meters.
The terms "yield" of a plant and "plant yield" are used interchangeably herein and are meant to refer to vegetative biomass such as root and/or shoot biomass, to reproductive organs, and/or to propagules such as seeds of that plant.
Flowers in maize are unisexual; male inflorescences (tassels) originate from the apical stem and female inflorescences (ears) arise from axillary bud apices. The female inflorescence produces pairs of spikelets on the surface of a central axis (cob). Each of the female spikelets encloses two fertile florets, one of them will usually mature into a maize kernel once fertilized. Hence a yield increase in maize may be manifested as one or more of the following: increase in the number of plants established per square meter, an increase in the number of ears per plant, an increase in the number of rows, number of kernels per row, kernel weight, thousand kernel weight, ear length/diameter, increase in the seed filling rate, which is the number of filled florets (i.e. florets containing seed) divided by the total number of florets and multiplied by 100), among others. Inflorescences in rice plants are named panicles. The panicle bears spikelets, which are the basic units of the panicles, and which consist of a pedicel and a floret. The floret is borne on the pedicel and includes a flower that is covered by two protective glumes: a larger glume (the lemma) and a shorter glume (the palea). Hence, taking rice as an example, a yield increase may manifest itself as an increase in one or more of the following: number of plants per square meter, number of panicles per plant, panicle length, number of spikelets per panicle, number of flowers (or florets) per panicle; an increase in the seed filling rate which is the number of filled florets (i .e. florets containing seeds) divided by the total number of florets and multiplied by 100; an increase in thousand kernel weight, among others.
Early flowering time
Plants having an "early flowering time" as used herein are plants which start to flower earlier than control plants. Hence this term refers to plants that show an earlier start of flowering. Flowering time of plants can be assessed by counting the number of days ("time to flower") between sowing and the emergence of a first inflorescence. The "flowering time" of a plant can for instance be determined using the method as described in WO 2007/093444.
Early vigour
"Early vigour" refers to active healthy well-balanced growth especially during early stages of plant growth, and may result from increased plant fitness due to, for example, the plants being better adapted to their environment (i.e. optimizing the use of energy resources and partitioning between shoot and root). Plants having early vigour also show increased seedling survival and a better establishment of the crop, which often results in highly uniform fields (with the crop growing in uniform manner, i .e. with the majority of plants reaching the various stages of development at substantially the same time), and often better and higher yield. Therefore, early vigour may be determined by measuring various factors, such as thousand kernel weight, percentage germination, percentage emergence, seedling growth, seedling height, root length, root and shoot biomass and many more. Increased growth rate
The increased growth rate may be specific to one or more parts of a plant (including seeds), or may be throughout substantially the whole plant. Plants having an increased growth rate may have a shorter life cycle. The life cycle of a plant may be taken to mean the time needed to grow from a mature seed up to the stage where the plant has produced mature seeds, similar to the starting material. This life cycle may be influenced by factors such as speed of germination, early vigour, growth rate, greenness index, flowering time and speed of seed maturation. The increase in growth rate may take place at one or more stages in the life cycle of a plant or during substantially the whole plant life cycle. Increased growth rate during the early stages in the life cycle of a plant may reflect enhanced vigour. The increase in growth rate may alter the harvest cycle of a plant allowing plants to be sown later and/or harvested sooner than would otherwise be possible (a similar effect may be obtained with earlier flowering time). If the growth rate is sufficiently increased, it may allow for the further sowing of seeds of the same plant species (for example sowing and harvesting of rice plants followed by sowing and harvesting of further rice plants all within one conventional growing period). Similarly, if the growth rate is sufficiently increased, it may allow for the further sowing of seeds of different plants species (for example the sowing and harvesting of corn plants followed by, for example, the sowing and optional harvesting of soybean, potato or any other suitable plant). Harvesting additional times from the same rootstock in the case of some crop plants may also be possible. Altering the harvest cycle of a plant may lead to an increase in annual biomass production per square meter (due to an increase in the number of times (say in a year) that any particular plant may be grown and harvested). An increase in growth rate may also allow for the cultivation of transgenic plants in a wider geographical area than their wild-type counterparts, since the territorial limitations for growing a crop are often determined by adverse environmental conditions either at the time of planting (early season) or at the time of harvesting (late season). Such adverse conditions may be avoided if the harvest cycle is shortened. The growth rate may be determined by deriving various parameters from growth curves, such parameters may be: T-Mid (the time taken for plants to reach 50% of their maximal size) and T-90 (time taken for plants to reach 90% of their maximal size), amongst others.
Stress resistance
An increase in yield and/or growth rate occurs whether the plant is under non-stress conditions or whether the plant is exposed to various stresses compared to control plants. Plants typically respond to exposure to stress by growing more slowly. In conditions of severe stress, the plant may even stop growing altogether. Mild stress on the other hand is defined herein as being any stress to which a plant is exposed which does not result in the plant ceasing to grow altogether without the capacity to resume growth. Mild stress in the sense of the invention leads to a reduction in the growth of the stressed plants of less than 40%, 35% , 30% or 25%, more preferably less than 20% or 15% in comparison to the control plant under non-stress conditions. Due to advances in agricultural practices (irrigation, fertilization, pesticide treatments) severe stresses are not often encountered in cultivated crop plants. As a consequence, the compromised growth induced by mild stress is often an undesirable feature for agriculture. Abiotic stresses may be due to drought or excess water, anaerobic stress, salt stress, chemical toxicity, oxidative stress and hot, cold or freezing temperatures. "Biotic stresses" are typically those stresses caused by pathogens, such as bacteria, viruses, fungi, nematodes and insects. The "abiotic stress" may be an osmotic stress caused by a water stress, e.g. due to drought, salt stress, or freezing stress. Abiotic stress may also be an oxidative stress or a cold stress. "Freezing stress" is intended to refer to stress due to freezing temperatures, i.e. temperatures at which available water molecules freeze and turn into ice. "Cold stress", also called "chilling stress", is intended to refer to cold temperatures, e.g. temperatures below 10°, or preferably below 5°C, but at which water molecules do not freeze. As reported in Wang et al. (Planta (2003) 218: 1 -14), abiotic stress leads to a series of morphological, physiological, biochemical and molecular changes that adversely affect plant growth and productivity. Drought, salinity, extreme temperatures and oxidative stress are known to be interconnected and may induce growth and cellular damage through similar mechanisms. Rabbani et al. (Plant Physiol (2003) 133: 1755-1767) describes a particularly high degree of "cross talk" between drought stress and high-salinity stress. For example, drought and/or salinisation are manifested primarily as osmotic stress, resulting in the disruption of homeostasis and ion distribution in the cell. Oxidative stress, which frequently accompanies high or low temperature, salinity or drought stress, may cause denaturing of functional and structural proteins. As a consequence, these diverse environmental stresses often activate similar cell signalling pathways and cellular responses, such as the production of stress proteins, up-regulation of anti-oxidants, accumulation of compatible solutes and growth arrest. The term "non-stress" conditions as used herein are those environmental conditions that allow optimal growth of plants. Persons skilled in the art are aware of normal soil conditions and climatic conditions for a given location. Plants with optimal growth conditions, (grown under non-stress conditions) typically yield in increasing order of preference at least 97%, 95%, 92%, 90%, 87%, 85%, 83%, 80%, 77% or 75% of the average production of such plant in a given environment. Average production may be calculated on harvest and/or season basis. Persons skilled in the art are aware of average yield productions of a crop.
In particular, the methods of the present invention may be performed under non-stress conditions. In an example, the methods of the present invention may be performed under non-stress conditions such as mild drought to give plants having increased yield relative to control plants.
In another embodiment, the methods of the present invention may be performed under stress conditions.
In an example, the methods of the present invention may be performed under stress conditions such as drought to give plants having increased yield relative to control plants. In another example, the methods of the present invention may be performed under stress conditions such as nutrient deficiency to give plants having increased yield relative to control plants.
Nutrient deficiency may result from a lack of nutrients such as nitrogen, phosphates and other phosphorous-containing compounds, potassium, calcium, magnesium, manganese, iron and boron, amongst others. In yet another example, the methods of the present invention may be performed under stress conditions such as salt stress to give plants having increased yield relative to control plants. The term salt stress is not restricted to common salt (NaCI), but may be any one or more of: NaCI, KCI, LiCI, MgC , CaC , amongst others.
In yet another example, the methods of the present invention may be performed under stress conditions such as cold stress or freezing stress to give plants having increased yield relative to control plants.
Increase/Improve/Enhance
The terms "increase", "improve" or "enhance" are interchangeable and shall mean in the sense of the application at least a 3%, 4%, 5%, 6%, 7%, 8%, 9% or 10%, preferably at least 15% or 20%, more preferably 25% , 30% , 35% or 40% more yield and/or growth i n comparison to control plants as defined herein. Seed yield
Increased seed yield may manifest itself as one or more of the following:
(a) an increase in seed biomass (total seed weight) which may be on an individual seed basis and/or per plant and/or per square meter;
(b) increased number of flowers per plant;
(c) increased number of seeds;
(d) increased seed filling rate (which is expressed as the ratio between the number of filled florets divided by the total number of florets);
(e) increased harvest index, which is expressed as a ratio of the yield of harvestable parts, such as seeds, divided by the biomass of aboveground plant parts; and (f) increased thousand kernel weight (TKW), which is extrapolated from the number of seeds counted and their total weight. An increased TKW may result from an increased seed size and/or seed weight, and may also result from an increase in embryo and/or endosperm size.
The terms "filled florets" and "filled seeds" may be considered synonyms.
An increase in seed yield may also be manifested as an increase in seed size and/or seed volume. Furthermore, an increase in seed yield may also manifest itself as an increase in seed area and/or seed length and/or seed width and/or seed perimeter. Greenness Index
The "greenness index" as used herein is calculated from digital images of plants. For each pixel belonging to the plant object on the image, the ratio of the green value versus the red value (i n the RGB model for encoding color) is calculated. The green ness index is expressed as the percentage of pixels for which the green-to-red ratio exceeds a given threshold. Under normal growth conditions, under salt stress growth conditions, and under reduced nutrient availability growth conditions, the greenness index of plants is measured in the last imaging before flowering. In contrast, under drought stress growth conditions, the greenness index of plants is measured in the first imaging after drought.
Biomass
The term "biomass" as used herein is intended to refer to the total weight of a plant. Within the definition of biomass, a distinction may be made between the biomass of one or more parts of a plant, which may include any one or more of the following:
- aboveground parts such as but not limited to shoot biomass, seed biomass, leaf biomass, etc.;
- aboveground harvestable parts such as but not limited to shoot biomass, seed biomass, leaf biomass, etc.;
parts below ground, such as but not limited to root biomass, tubers, bulbs, etc.;
harvestable parts below ground, such as but not limited to root biomass, tubers, bulbs, etc.;
- harvestable parts partially below ground such as but not limited to beets and other hypocotyl areas of a plant, rhizomes, stolons or creeping rootstalks;
- vegetative biomass such as root biomass, shoot biomass, etc.;
reproductive organs; and
- propagules such as seed.
Marker assisted breeding
Such breeding programmes sometimes require introduction of allelic variation by mutagenic treatment of the plants, using for example EMS mutagenesis; alternatively, the programme may start with a collection of allelic variants of so called "natural" origin caused unintentionally. Identification of allelic variants then takes place, for example, by PCR. This is followed by a step for selection of superior allelic variants of the sequence in question and which give increased yield . Selection is typically carried out by monitoring growth performance of plants containing different allelic variants of the sequence in question. Growth performance may be monitored in a greenhouse or in the field. Further optional steps include crossing plants in which the superior allelic variant was identified with another plant. This could be used, for example, to make a combination of interesting phenotypic features.
Use as probes in (gene mapping)
Use of nucleic acids encoding the protein of interest for genetically and physically mapping the genes requires only a nucleic acid sequence of at least 15 nucleotides in length. These nucleic acids may be used as restriction fragment length polymorphism (RFLP) markers.
Southern blots (Sambrook J , Fritsch EF and Maniatis T ( 1989) Molecular Cloning, A
Laboratory Manual) of restriction-digested plant genomic DNA may be probed with the nucleic acids encoding the protein of interest. The resulting banding patterns may then be subjected to genetic analyses using computer programs such as MapMaker (Lander et al.
(1987) Genomics 1 : 174-181 ) in order to construct a genetic map. In addition, the nucleic acids may be used to probe Southern blots containing restriction endonuclease-treated genomic DNAs of a set of individuals representing parent and progeny of a defined genetic cross. Segregation of the DNA polymorphisms is noted and used to calculate the position of the nucleic acid encoding the protein of interest in the genetic map previously obtained using this population (Botstein et al. (1980) Am. J. Hum. Genet. 32:314-331 ).
The production and use of plant gene-derived probes for use in genetic mapping is described in Bernatzky and Tanksley (1986) Plant Mol. Biol. Reporter 4: 37-41 . Numerous publications describe genetic mapping of specific cDNA clones using the methodology outlined above or variations thereof. For example, F2 intercross populations, backcross populations, randomly mated populations, near isogenic lines, and other sets of individuals may be used for mapping. Such methodologies are well known to those skilled in the art.
The nucleic acid probes may also be used for physical mapping (i .e. , placement of sequences on physical maps; see Hoheisel et al. In: Non-mammalian Genomic Analysis: A Practical Guide, Academic press 1996, pp. 319-346, and references cited therein).
In another embodiment, the nucleic acid probes may be used in direct fluorescence in situ hybridisation (FISH) mapping (Trask (1991 ) Trends Genet. 7: 149-154). Although current methods of FISH mapping favour use of large clones (several kb to several hundred kb; see Laa n et al . (1 995) Genome Res. 5: 1 3-20), improvements in sensitivity may allow performance of FISH mapping using shorter probes.
A variety of nucleic acid amplification-based methods for genetic and physical mapping may be carried out using the nucleic acids. Examples include allele-specific amplification (Kazazian (1989) J. Lab. Clin. Med 1 1 :95-96), polymorphism of PCR-amplified fragments (CAPS; Sheffield et al. (1993) Genomics 16:325-332), allele-specific ligation (Landegren et al. (1988) Science 241 :1077-1080), nucleotide extension reactions (Sokolov (1990) Nucleic Acid Res. 8:3671 ), Radiation Hybrid Mapping (Walter et al. (1997) Nat. Genet. 7:22-28) and Happy Mapping (Dear and Cook (1989) Nucleic Acid Res. 17:6795-6807). For these methods, the sequence of a nucleic acid is used to design and produce primer pairs for use in the amplification reaction or in primer extension reactions. The design of such primers is well known to those skilled in the art. In methods employing PCR-based genetic mapping, it may be necessary to identify DNA sequence differences between the parents of the mapping cross in the region corresponding to the instant nucleic acid sequence. This, however, is generally not necessary for mapping methods.
Plant
The term "plant" as used herein encompasses whole plants, ancestors and progeny of the plants and plant parts, including seeds, shoots, stems, leaves, roots (including tubers), flowers, and tissues and organs, wherein each of the aforementioned comprise the gene/nucleic acid of interest. The term "plant" also encompasses plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen and microspores, again wherein each of the aforementioned comprises the gene/nucleic acid of interest. Plants that are particularly useful in the methods of the invention include all plants which belong to the superfamily Viridiplantae, in particular monocotyledonous and dicotyledonous plants including fodder or forage legumes, ornamental plants, food crops, trees or shrubs selected from the list comprising Acer spp., Actinidia spp., Abelmoschus spp., Agave sisalana, Agropyron spp., Agrostis stolonifera, Allium spp., Amaranthus spp., Ammophila arenaria, Ananas comosus, Annona spp., Apium graveolens, Arachis spp, Artocarpus spp., Asparagus officinalis, Avena spp. (e.g. Avena sativa, Avena fatua, Avena byzantina, Avena fatua var. sativa, Avena hybrida), Averrhoa carambola, Bambusa sp., Benincasa hispida, Bertholletia excelsea, Beta vulgaris, Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]), Cadaba farinosa, Camellia sinensis, Canna indica, Cannabis sativa, Capsicum spp., Carex elata, Carica papaya, Carissa macrocarpa, Carya spp., Carthamus tinctorius, Castanea spp., Ceiba pentandra, Cichorium endivia, Cinnamomum spp., Citrullus lanatus, Citrus spp., Cocos spp., Coffea spp., Colocasia esculenta, Cola spp., Corchorus sp., Coriandrum sativum, Corylus spp., Crataegus spp., Crocus sativus, Cucurbita spp., Cucumis spp., Cynara spp., Daucus carota, Desmodium spp., Dimocarpus longan, Dioscorea spp., Diospyros spp., Echinochloa spp., Elaeis (e.g. Elaeis guineensis, Elaeis oleifera), Eleusine coracana, Eragrostis tef, Erianthus sp., Eriobotrya japonica, Eucalyptus sp., Eugenia uniflora, Fagopyrum spp., Fagus spp., Festuca arundinacea, Ficus carica, Fortunella spp., Fragaria spp., Ginkgo biloba, Glycine spp. (e.g. Glycine max, Soja hispida or Soja max), Gossypium hirsutum, Helianthus spp. (e.g. Helianthus annuus), Hemerocallis fulva, Hibiscus spp., Hordeum spp. (e.g. Hordeum vulgare), Ipomoea batatas, Juglans spp., Lactuca sativa, Lathyrus spp., Lens culinaris, Linum usitatissimum, Litchi chinensis, Lotus spp., Luffa acutangula, Lupinus spp., Luzula sylvatica, Lycopersicon spp. (e.g. Lycopersicon esculentum, Lycopersicon lycopersicum, Lycopersicon pyriforme), Macrotyloma spp., Malus spp., Malpighia emarginata, Mammea americana, Mangifera indica, Manihot spp., Manilkara zapota, Medicago sativa, Melilotus spp., Mentha spp., Miscanthus sinensis, Momordica spp., Morus nigra, Musa spp., Nicotiana spp., Olea spp., Opuntia spp., Ornithopus spp., Oryza spp. (e.g. Oryza sativa, Oryza latifolia), Panicum miliaceum, Panicum virgatum, Passiflora edulis, Pastinaca sativa, Pennisetum sp., Persea spp., Petroselinum crispum, Phalaris arundinacea, Phaseolus spp., Phleum pratense, Phoenix spp., Phragmites australis, Physalis spp., Pinus spp., Pistacia vera, Pisum spp., Poa spp., Populus spp., Prosopis spp., Prunus spp., Psidium spp., Punica granatum, Pyrus communis, Quercus spp., Raphanus sativus, Rheum rhabarbarum, Ribes spp., Ricinus communis, Rubus spp., Saccharum spp., Salix sp., Sambucus spp., Secale cereale, Sesamum spp., Sinapis sp., Solanum spp. (e.g. Solanum tuberosum, Solanum integrifolium or Solanum lycopersicum), Sorghum bicolor, Spinacia spp., Syzygium spp., Tagetes spp., Tamarindus indica, Theobroma cacao, Trifolium spp., Tripsacum dactyioides, Triticosecale rimpaui, Triticum spp. (e.g. Triticum aestivum, Triticum durum, Triticum turgidum, Triticum hybernum, Triticum macha, Triticum sativum, Triticum monococcum or Triticum vulgare), Tropaeolum minus, Tropaeolum majus, Vaccinium spp., Vicia spp., Vigna spp., Viola odorata, Vitis spp., Zea mays, Zizania palustris, Ziziphus spp., amongst others.
Control plant(s)
The choice of suitable control plants is a routine part of an experimental setup and may include corresponding wild type plants or corresponding plants without the gene of interest. The control plant is typically of the same plant species or even of the same variety as the plant to be assessed. The control plant may also be a nullizygote of the plant to be assessed. Nullizygotes (or null control plants) are individuals missing the transgene by segregation. Further, control plants are grown under equal growing conditions to the growing conditions of the plants of the invention, i.e. in the vicinity of, and simultaneously with, the plants of the invention. A "control plant" as used herein refers not only to whole plants, but also to plant parts, including seeds and seed parts.
Description of figures
The present invention will now be described with reference to the following figures in which: Figure 1 represents the domain structure of SEQ ID NO: 2 and SEQ I D NO: 4 with the signature sequence in bold, the P450 domain in italics and domains 1 to 6 underlined;
Figure 2 represents a multiple alignment of various CYP704-like polypeptides. These alignments can be used for defining further motifs or signature sequences, when using conserved amino acids.
Figure 3 shows the MATGAT table of Example 3.
Figure 4 represents the binary vector used for increased expression in Oryza sativa of a CYP704-like-encoding nucleic acid under the control of a rice GOS2 promoter (pGOS2). The structure of the plasmid is the same for both the rice and the poplar sequences, only the ORFs are different.
Figure 5 represents the domain structure of SEQ ID NO: 2 with indication of the conserved DUF1218 domain (indicated as bold and underlined) and motifs 1 to 6.
Figure 6 represents a multiple alignment of various DU F1218 polypeptides. These alignments can be used for defining further motifs or signature sequences, when using conserved amino acids. The Os_UNK DUF1218 (SEQ ID NO: 87) in indicated with a box.
The signal peptide is indicated with a box. The DUF1218 domain is located between the amino acids at position 60 and 152 in SEQ ID NO: 88 protein and is also indicated with a box. These alignments can be used for defining further motifs, when using conserved amino acids. The illustrated polypeptides have the following SEQ ID NOs:
Annotation SEQ ID NO:
A.lyrata_488583 1 10
A.thaliana_AT5G17210.1 1 14
A. off i ci n a I i s_TA2043_4686 90 H.vulgare_TC164154 92
T.aestivum_c54830581 @5965 98
T.aestivum_TC281335 100
T.aestivum_TC286470 102
T.aestivum_TC293972 104
O.sativa_LOC_Os06g02440.1 94
Os_UNK_DUF1218 88
S.bicolor_Sb10g001220.1 96
Z.mays_TC513290 106
Zea_mays_G RMZM2G041994_T01 108
G.max_Glyma1 1g09860.1 140
G.max_Glyma12g02170.1 142
L.japonicus_TC36104 154
A.majus_TA5960_4151 1 12
Triphysaria_sp_TC12092 176
N.tabacum_EB451790 160
S.lycopersicum TC198292 168
S.tuberosum_TC172344 172
S.tuberosum_TC168299 170
C.intybus_TA2743_13427 1 18
T. kok-saghyz_D R398994 174
L.perennis_TA3000_43195 156
C.maculosa_EH745515 120
C.maculosa_EH748870 122
C.maculosa_TA751_215693 124
C.maculosa_TA752_215693 126
C.solstitialis_TA2955_347529 128
C.tinctorius_EL401 1 12 130
C.tinctorius_EL412247 132
H.ciliaris_EL431974 144
H.exilis_EE650298 146
H.tuberosus_TA3647_4233 150
H.paradoxus_EL492156 148
F.vesca_EX683932 136
M.domestica_TC35146 158 P.persica_TC10133 162
C.clementina_CX293339 1 16
V.vinifera_GSVIVT00014076001 178
E.esula_DV124989 134
P.trichocarpa_826108 164
R.communis_TA5054_3988 166
G.hirsutum_TC133069 138
J.hindsii_x_regia_EL901497 152
Figure 7 represents a multiple alignment of DUF1218 polypeptides when used in the construction of a phylogenetic tree, such as the one depicted in Figure 6 , clusters with the group of polypeptides comprising the amino acid sequence represented by SEQ ID NO: 88 rather than with any other group. The Os_UNK DUF1218 (SEQ ID NO:87), the signal peptide, and the DUF1218 domain are indicated with a box, similarly as was done in Figure 6.
Figure 8 shows the MATGAT table of Example 3 for a number of DUF1218 polypeptides.
The represented DUF1218 polypeptides are indicated by the following numbering:
1. Os_UNKDUF1218; 2. T.aestivum_c54830581 @5965; 3. H.paradoxus_EL492156; 4.
H.tuberosus_TA3647_4233; 5. H.exilis_EE650298; 6. H.ciliaris_EL431974; 7. C.intybus.
TA2743_13427; 8. G.max_Glyma12g02170.1 ; 9. L.japonicus_TC36104; 10. E.esula_
DV124989; 1 1 . P.trichocarpa_8261 08; 12. H.vulgare_TC164154; 13. T.aestivum_
TC293972; 14. T.aestivum_TC281335; 15. Zea_mays_GRMZM2G041994_T01 ; 16. Z.mays_TC513290; 17. F.vesca_EX683932; 18. G.hirsutum_TC133069; 19.
S.lycopersicum_TC198292; 20. S.tuberosum_TC172344; 21 . S.tuberosum_TC168299;
22. A.majus_TA5960_4151 ; 23. Triphysaria_sp_TC12092; 24. C.clementina_CX293339;
25. G.max_Glyma1 1 g09860.1 ; 26. M.domestica_TC35146; 27. P.persica_TC10133; 28.
N.tabacum_EB451790; 29. S.bicolor_Sb10g001220.1 ; 30. J.hindsii_x_regia_EL901497; 31 . O.sativa_LOC_Os06g02440.1 ; 32. R.communis_TA5054_3988; 33. A.thaliana_
AT5G 1 721 0. 1 ; 34. A. lyrata 488583; 35. V.vinifera GSVIVT00014076001 ; 36.
A.officinalis_TA2043_4686 ; 37. C.solstitialis_TA2955_347529 ; 38. C.maculosa_
EH745515; 39. C.maculosa_EH748870; 40. C.maculosa_TA751_215693; 41. C. maculosa
_TA752_215693; 42. C.tinctorius_EL401 1 12; 43. C.tinctorius_EL412247; 44. L.perennis_ TA3000_43195 ; 45. T.aestivum_TC286470 ; 46. T.kok-saghyz_DR398994
Figure 9 represents the binary vector used for increased expression in Oryza sativa of a DUF1218 encoding nucleic acid under the control of a rice GOS2 promoter (pGOS2).
Figure 10 shows phylogenetic tree of number of DUF1218 polypeptides (see also Example 2 and Example 3 for a MATGAT table on the illustrated DUF1218 polypeptides). Figure 1 1 represents the domain structure of SEQ ID NO: 191 with signature sequence and conserved motifs.
Figure 12 represents a multiple alignment of various translin-like polypeptides. The asterisks indicate identical amino acids among the various protein sequences, colons represent highly conserved amino acid substitutions, and the dots represent less conserved amino acid su bstitution; on other positions there is no sequence conservation. These alignments can be used for defining further motifs or signature sequences, when using conserved amino acids . The corresponding SEQ ID NOs for the aligned polypeptide sequences shown in Figure 12 are:
SEQ ID NO: 199 for B.napus_TC64968
SEQ ID NO: 195 for A.thaliana_AT2G03780.1
SEQ ID NO: 197 for B.napus_TC100628
SEQ ID NO: 207 for S. lycopersicum_PUT-155a
SEQ ID NO: 203 for G.max TC289758
SEQ ID NO: 201 for G.max_Glyma1 1 g01340.1
SEQ ID NO: 209 for M.truncatula_AC144726_60.5
SEQ ID NO: 221 for P.trichocarpa_TC97700
SEQ ID NO: 219 for P.trichocarpa_TC1 16999
SEQ ID NO: 217 for P.trichocarpa_scaff_X.1315
SEQ ID NO: 215 for P.trichocarpa_659024
SEQ ID NO: 191 for P.trichocarpajranslin
SEQ ID NO: 193 for A.cepa_CF442302
SEQ ID NO: 225 for T.aestivum c54625664@13479
SEQ ID NO: 229 for T.aestivum_TC284985
SEQ ID NO: 205 for H.vulgare_TC189986
SEQ ID NO: 227 for T.aestivum_TC278465
SEQ ID NO: 21 1 for O.sativa_LOC_Os01 g16100.1
SEQ ID NO: 213 for 0.sativa_TC_314197
SEQ ID NO: 237 for Z. mays_GRMZM2G128080_T03
SEQ ID NO: 235 for Z. mays_GRMZM2G128080_T02
SEQ ID NO: 233 for Z. mays_ZM07MC31062_BFb0264M 7
SEQ ID NO: 223 for S. lycopersicum_PUT-171 a
SEQ ID NO: 231 for Z.mays_TC476725
Figure 13 shows a phylogenetic tree of translin-like polypeptides, as described in Example 2.
Figure 14 shows the MATGAT table of Example 3.
Figure 15 shows a further MATGAT table of Example 3.
Figure 16 represents the binary vector used for increased expression in Oryza sativa of a translin-like-encoding nucleic acid under the control of a rice GOS2 promoter (pGOS2). Figure 17 represents the domain structure of SEQ I D NO: 247 with the ERG28 domain (Pfam PF03694) in bold and motifs 19 to 22 underlined); Figure 18 represents a multiple alignment of various ERG28-like polypeptides. This alignment can be used for defining further motifs or signature sequences, when using conserved amino acids, using standard techniques known in the art.
Figure 19 shows phylogenetic tree of ERG28-like polypeptides.
Figure 20 shows the MatGAT table of Example 3.
Figure 21 represents the binary vector useful for increased expression in Oryza sativa of an ERG28-like-encoding nucleic acid under the control of a rice GOS2 promoter (pGOS2). Figure 22 shows AtERG28 transcript level analysis (qRT-PCR) of GABI-Kat_205F01 (GK205F01 ). Almost no AtERG28 gene expression was observed in the GABI-Kat_205F01 (GK205F01 ) homozygous mutants (AtERG28 loss-of-function mutants). Wt: 1 , 2, 8, 1 1 ; homozygous mutant: 3, 5, 6, 9; heterozygous: 4, 7, 10, 12.
Figure 23 shows seed yield ERG28 T-DNA mutant versus wildtype (wt) under stress and non-stress conditions. DS: drought stress (mild, progressive drought stress without any watering for 2 weeks) followed by a recovery phase (plants left to recover and set seeds under well watered conditions). C: control, no drought stress treatment applied, plants were kept well watered.
Examples
The present invention will now be described with reference to the following examples, which are by way of illustration only. The following examples are not intended to limit the scope of the invention. Unless otherwise indicated, the present invention employs conventional techniques and methods of plant biology, molecular biology, bioinformatics and plant breedings. DNA manipulation: unless otherwise stated, recombinant DNA techniques are performed according to standard protocols described in (Sambrook (2001 ) Molecular Cloning: a laboratory manual, 3rd Edition Cold Spring Harbor Laboratory Press, CSH, New York) or in Volumes 1 and 2 of Ausubel et al. (1994), Current Protocols in Molecular Biology, Current Protocols. Standard materials and methods for plant molecular work are described in Plant Molecular Biology Labfax (1993) by R.D.D. Croy, published by BIOS Scientific Publications Ltd (UK) and Blackwell Scientific Publications (UK).
Example 1: Identification of sequences related to the nucleic acid sequence used in the methods of intervention
1. CYP704-like polypeptides
Sequences (full length cDNA, ESTs or genomic) related to SEQ ID NO: 1 and SEQ ID NO: 2 were identified amongst those maintained in the Entrez Nucleotides database at the National Center for Biotechnology Information (NCBI) using database sequence search tools, such as the Basic Local Alignment Tool (BLAST) (Altschul et al. (1990) J. Mol. Biol. 215:403-410; and Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402). The program is used to find regions of local similarity between sequences by comparing nucleic acid or polypeptide sequences to sequence databases and by calculating the statistical significance of matches. For example, the polypeptide encoded by the nucleic acid of SEQ ID NO: 1 was used for the TBLASTN algorithm, with default settings and the filter to ignore low complexity sequences set off. The output of the analysis was viewed by pairwise comparison, and ranked according to the probability score (E-value), where the score reflect the probability that a particular alignment occurs by chance (the lower the E-value, the more significant the hit). In addition to E-values, comparisons were also scored by percentage identity. Percentage identity refers to the number of identical nucleotides (or amino acids) between the two compared nucleic acid (or polypeptide) sequences over a particular length. In some instances, the default parameters may be adjusted to modify the stringency of the search. For example the E-value may be increased to show less stringent matches. This way, short nearly exact matches may be identified.
Table A1 provides a list of nucleic acid and protein sequences related to SEQ ID NO: 1/2 and SEQ ID NO: 3/4.
Table A1 : Examples of CYP704-like nucleic acids and polypeptides:
Plant source Nucleic acid Protein
SEQ ID NO: SEQ ID NO:
P.trichocarpa_scaff_XI V.182 1 2
O.sativa_Os06g0129900 3 4
A.thaliana_AT1 G69500.1 5 6
A.thaliana AT2G45510.1 7 8
A.thaliana_AT2G44890.1 9 10
G.max_Glyma03g02320.1 1 1 12
G.max Glyma07g09160.1 13 14
G.max_Glyma07g04840.1 15 16
G.max_Glyma03g02470.1 17 18
G.max Glyma07g09150.1 19 20
H.annuus_TC52057 21 22
H.annuus_GE493538 23 24
H.vulgare_TC186100 25 26
O.sativa_Os04g0573900 27 28
0.sativa_Os10g0524700 29 30
O.sativa_Os10g0525000 31 32
0.sativa_Os10g0525200 33 34
P . tri ch oca rpa_scaff_V 111.822 35 36
P.trichocarpa_scaff_XII.1206 37 38
P.trichocarpa_scaff_XI V.177 39 40
T.aestivum_TC301 179 41 42
T.aestivum_DR733503 43 44
Z.mays_TA13407_4577999 45 46 Z. mays_TA16211 _4577999 47 48
Z.mays_TA32265_4577999 49 50
M.truncatula_ABC59095 51 52
P.taeda_AAX07434 53 54
O.sativa_Os10g38120 55 56
O.sativa_Os10g381 10 57 58
O.sativa_Os10g38090 59 60
O.sativa_Os03g07250 61 62
O.sativa_Os03g0168600 63 64
Z.mays_ACG35470 65 66
M.truncatula_ABC59094 67 68
P.patens_TC39323 69 70
P.patens_183927 71 72
2. DUF1218 polypeptides
Sequences (full length cDNA, ESTs or genomic) related to SEQ ID NO: 87 and SEQ ID NO: 88 were identified amongst those maintained in the Entrez Nucleotides database at the National Center for Biotechnology Information (NCBI) using database sequence search tools, such as the Basic Local Alignment Tool (BLAST) (Altschul et al. (1990) J. Mol. Biol. 215:403-410; and Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402). The program is used to find regions of local similarity between sequences by comparing nucleic acid or polypeptide sequences to sequence databases and by calculating the statistical significance of matches. For example, the polypeptide encoded by the nucleic acid of SEQ ID NO: 87 was used for the TBLASTN algorithm, with default settings and the filter to ignore low complexity sequences set off. The output of the analysis was viewed by pairwise comparison, and ranked according to the probability score (E-value), where the score reflect the probability that a particular alignment occurs by chance (the lower the E-value, the more significant the hit). In addition to E-values, comparisons were also scored by percentage identity. Percentage identity refers to the number of identical nucleotides (or amino acids) between the two compared nucleic acid (or polypeptide) sequences over a particular length. In some instances, the default parameters may be adjusted to modify the stringency of the search. For example the E-value may be increased to show less stringent matches. This way, short nearly exact matches may be identified.
Table A2 provides SEQ ID NO: 87 and SEQ ID NO: 88 and a list of nucleic acid sequences related to SEQ ID NO: 87 and SEQ ID NO: 88. Table A2: Examples of DUF1218 nucleic acids and polypeptides:
Plant Source Nucleic acid Protein
SEQ ID NO: SEQ ID NO:
Os_UNK DUF1218 87 88 A.officinalis_TA2043_4686#1 89 90
H.vulgare_TC164154#1 91 92
O.sativa_LOC_Os06g02440.1#1 93 94
S.bicolor_Sb10g001220.1 #1 95 96
T.aestivum_c54830581 @5965#1 97 98
T.aestivum_TC281335#1 99 100
T.aestivum TC286470#1 101 102
T.aestivum_TC293972#1 103 104
Z.mays_TC513290#1 105 106
Zea_mays_GRMZM2G041994_T01#1 107 108
A.lyrata_488583#1 109 1 10
A.majus_TA5960_4151#1 1 1 1 1 12
A.thaliana_AT5G17210.1#1 1 13 1 14
C.clementina CX293339#1 1 15 1 16
C.intybus_TA2743_13427#1 1 17 1 18
C.maculosa_EH745515#1 1 19 120
C.maculosa_EH748870#1 121 122
C.maculosa_TA751_215693#1 123 124
C.maculosa_TA752_215693#1 125 126
C.solstitialis_TA2955_347529#1 127 128
C.tinctorius_EL401 112#1 129 130
C.tinctorius_EL412247#1 131 132
E.esula_DV124989#1 133 134
F.vesca_EX683932#1 135 136
G.hirsutum_TC133069#1 137 138
G.max_Glyma1 1g09860.1#1 139 140
G.max_Glyma12g02170.1#1 141 142
H.ciliaris_EL431974#1 143 144
H.exilis_EE650298#1 145 146
H.paradoxus_EL492156#1 147 148
H.tuberosus_TA3647_4233#1 149 150
J.hindsii_x_regia_EL901497#1 151 152
L.japonicus_TC36104#1 153 154
L.perennis_TA3000_43195#1 155 156
M.domestica_TC35146#1 157 158 N.tabacum_EB451790#1 159 160
P.persica_TC10133#1 161 162
P.trichocarpa_826108#1 163 164
R.communis_TA5054_3988#1 165 166
S.lycopersicum_TC198292#1 167 168
S.tuberosum_TC168299#1 169 170
S. tuberosum TC172344#1 171 172
T.kok-saghyz_DR398994#1 173 174
Triphysaria_sp_TC12092#1 175 176
V.vinifera_GSVIVT00014076001#1 177 178
3. translin-like polypeptides
Sequences (full length cDNA, ESTs or genomic) related to SEQ ID NO: 190 and SEQ ID NO: 191 were identified amongst those maintained in the Entrez Nucleotides database at the National Center for Biotechnology Information (NCBI) using database sequence search tools, such as the Basic Local Alignment Tool (BLAST) (Altschul et al. (1990) J. Mol. Biol. 215:403-410; and Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402). The program is used to find regions of local similarity between sequences by comparing nucleic acid or polypeptide sequences to sequence databases and by calculating the statistical significance of matches. For example, the polypeptide encoded by the nucleic acid of SEQ I D NO: 190 was used for the TBLASTN algorithm, with default settings and the filter to ignore low complexity sequences set off. The output of the analysis was viewed by pairwise comparison, and ranked according to the probability score (E-value), where the score reflect the probability that a particular alignment occurs by chance (the lower the E- value, the more significant the hit). In addition to E-values, comparisons were also scored by percentage identity. Percentage identity refers to the number of identical nucleotides (or amino acids) between the two compared nucleic acid (or polypeptide) sequences over a particular length. In some instances, the default parameters may be adjusted to modify the stringency of the search. For example the E-value may be increased to show less stringent matches. This way, short nearly exact matches may be identified.
Table A3 provides a list of nucleic acid sequences related to SEQ ID NO: 190 and SEQ ID NO: 191 . Table A3: Examples of translin-like nucleic acids and polypeptides:
Plant Source Nucleic acid Protein
SEQ ID NO: SEQ ID NO:
P. trichocarpa_translin-like 190 191
A.cepa_CF442302 192 193 A.thaliana_AT2G03780.1 194 195
B.napus_TC100628 196 197
B.napus_TC64968 198 199
G.max_Glyma1 1 g01340.1 200 201
G.max_TC289758 202 203
H.vulgare_TC189986 204 205
S.lycopersicum_PUT-155a- 206 207
Lycopersicon_esculentum-70144897
M.truncatula_AC144726_60.5 208 209
O.sati va_LOC_Os01 g 16100.1 210 21 1
0.sativa_TC314197 212 213
P.trichocarpa_659024 214 215
P.trichocarpa_scaff_X.1315 216 217
P.trichocarpa TC116999 218 219
P.trichocarpa_TC97700 220 221
S. lycopersicum_PUT-171 a- 222 223
SolanumJycopersicum-42451
T.aestivum_c54625664@13479 224 225
T.aestivum_TC278465 226 227
T.aestivum_TC284985 228 229
Z.mays_TC476725 230 231
Z.mays_ZM07MC31062_ 232 233
BFb0264l 17@30969
Z.mays_GRMZM2G128080_T02 234 235
Z.mays GRMZM2G 128080 T03 236 237
4. ERG28-like polypeptides
Sequences (full length cDNA, ESTs or genomic) related to SEQ ID NO: 246 and SEQ ID NO: 247 were identified amongst those maintained in the Entrez Nucleotides database at the National Center for Biotechnology Information (NCBI) using database sequence search tools, such as the Basic Local Alignment Tool (BLAST) (Altschul et al. (1990) J. Mol. Biol. 215:403-410; and Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402). The program is used to find regions of local similarity between sequences by comparing nucleic acid or polypeptide seq uences to seq uence databases and by cal cu lati ng th e stati sti cal significance of matches. For example, the polypeptide encoded by the nucleic acid of SEQ I D NO: 246 was used for the TBLASTN algorithm, with default settings and the filter to ignore low complexity sequences set off. The output of the analysis was viewed by pairwise comparison, and ranked according to the probability score (E-value), where the score reflect the probability that a particular alignment occurs by chance (the lower the E- value, the more significant the hit). In addition to E-values, comparisons were also scored by percentage identity. Percentage identity refers to the number of identical nucleotides (or amino acids) between the two compared nucleic acid (or polypeptide) sequences over a particular length. In some instances, the default parameters may be adjusted to modify the stringency of the search. For example the E-value may be increased to show less stringent matches. This way, short nearly exact matches may be identified. Table A4 provides a list of nucleic acid sequences related to SEQ ID NO: 246 and SEQ ID NO: 247.
Table A4: Examples of ERG28-like nucleic acids and polypeptides:
Plant Source Nucleic acid Protein
SEQ ID NO: SEQ ID NO:
A.thaliana_AT1 G10030.1 246 247
S.lycopersicum_TC199397 248 249
A.lyrata_471 1 14 250 251
B.napus_TC79290 252 253
C.reinhardtiM 87890 254 255
G.max_TC281697 256 257
G.max_TC280775 258 259
H.vulgare_TC169934 260 261
L.japonicus_TC37915 262 263
M.domestica_TC37761 264 265
M.domestica G0518631 266 267
M. tru ncatu I a_TC 125707 268 269
O.sati va_LOC_Os 12g43670.1 270 271
P.patens_TC471 10 272 273
P . tri ch oca rpa_scaff_l 1.1045 274 275
S.moellendorffii_94581 276 277
S.bicolor_Sb09g004860.1 278 279
S.bicolor_Sb08g022820.1 280 281
T.aestivum_TC333473 282 283
T.aestivum_TC318205 284 285
Z.mays_TC51 1056 286 287
Z.mays_TC527163 288 289 Z.mays_TC492655 290 291
Z.mays_TC480305 292 293
S.cerevisiae_YER044C 294 295
Sequences have been tentatively assembled and publicly disclosed by research institutions, such as The Institute for Genomic Research (TIGR; beginning with TA). For instance, the Eukaryotic Gene Orthologs (EGO) database may be used to identify such related sequences, either by keyword search or by using the BLAST algorithm with the nucleic acid sequence or polypeptide sequence of interest. Special nucleic acid sequence databases have been created for particular organisms, e.g. for certain prokaryotic organisms, such as by the Joint Genome Institute. Furthermore, access to proprietary databases, has allowed the identification of novel nucleic acid and polypeptide sequences.
Example 2: Alignment of sequences to the plypeptide sequences used in the methods of the invention
1. CYP704-like polypeptides
Alignment of polypeptide sequences was performed using the ClustalW 1.81 algorithm of progressive alignment (Thompson et al. (1997) Nucleic Acids Res 25:4876-4882; Chenna et al. (2003). Nucleic Acids Res 31 :3497-3500) with standard setting (slow alignment, similarity matrix: Gonnet, gap opening penalty 10, gap extension penalty: 0.2). Minor manual editing was done to further optimise the alignment. The CYP704-like polypeptides are aligned in Figure 2.
2. DUF1218 polypeptides
Alignment of polypeptide sequences was performed using MAFFT (version 6.624, L-INS-I method - Katoh and Toh (2008) - Briefings in Bioinformatics 9:286-298). Minor manual editing was done to further optimize the alignment. A representative number of DUF1218 polypeptides are aligned in Figure 6. Figure 7 represents a multiple alignment of DUF1218 polypeptides which, when used in the construction of a phylogenetic tree, such as the one depicted in Figure 10, clusters with the group of polypeptides comprising the amino acid sequence represented by SEQ ID NO: 88 rather than with any other group. A phylogenetic tree of a number of DUF1218 polypeptides (Figure 10) can be constructed by aligning DU F1218 sequences using MAFFT (Katoh and Toh (2008) - Briefings in Bioinformatics 9:286-298). A neighbour-joining tree was calculated using Quick-Tree (Howe et al. (2002), Bioinformatics 18(1 1 ): 1546-7), 100 bootstrap repetitions. The dendrogram was drawn using Dendroscope (Huson et al. (2007), BMC Bioinformatics 8(1 ) :460) . Confidence levels for 100 bootstrap repetitions are indicated for major branchings.
3. translin-like polypeptides
Alignment of polypeptide sequences was performed using the ClustalW 2.0.1 1 algorithm of progressive alignment (Thompson et al. (1997) Nucleic Acids Res 25:4876-4882; Chenna et al. (2003). Nucleic Acids Res 31 :3497-3500) with standard setting (slow alignment, similarity matrix: Gonnet, gap opening penalty 10, gap extension penalty: 0.2). Minor manual editing was done to further optimise the alignment. The translin-like polypeptides are aligned in Figure 12.
A phylogenetic tree of translin-like polypeptides (Figure 13) was constructed by aligning translin-like sequences using MAFFT (Katoh and Toh (2008) - Briefings in Bioinformatics 9:286-298). A neighbour-joining tree was calculated using Quick-Tree (Howe et al. (2002), Bioinformatics 18(1 1 ): 1546-7), 100 bootstrap repetitions. The dendrogram was drawn using Dendroscope (Huson et al. (2007), BMC Bioinformatics 8(1 ):460). Confidence levels for 100 bootstrap repetitions are indicated for major branchings.
4. ERG28-like polypeptides
Alignment of polypeptide sequences was performed using MAFFT (Katoh and Toh (2008) - Briefings in Bioinformatics 9:286-298), with standard setting, see Figure 18.
A phylogenetic tree of ERG28-like polypeptides (Figure 19) was constructed by aligning ERG28-like sequences using MAFFT (Katoh and Toh, 2008. A neighbour-joining tree was calculated using Quick-Tree (Howe et al . (2002), Bioinformatics 1 8(1 1 ): 1546-7), 100 bootstrap repetitions. The cladogram was drawn using Dendroscope (Huson et al. (2007), BMC Bioinformatics 8(1 ):460). Confidence levels for 100 bootstrap repetitions are indicated for major branchings.
Example 3: Calculation of global percentage identity between polypeptide sequences
Global percentages of similarity and identity between full length polypeptide sequences useful in performing the methods of the invention were determined using MatGAT (Matrix Global Alignment Tool) software (BMC Bioinformatics. 2003 4:29. MatGAT: an application that generates similarity/identity matrices using protein or DNA sequences. Campanella JJ, Biti ncka L, S mal ley J ; software h osted by Led ion Biti ncka) . MatGAT generates similarity/identity matrices for DNA or protein sequences without needing pre-alignment of the data. The program performs a series of pair-wise alignments using the Myers and Miller global alignment algorithm, calculates similarity and identity, and then places the results in a distance matrix. 1. CYP704-like polypeptides
Results of the analysis are shown in Figure 3 for the global similarity and identity over the full length of the polypeptide sequences. Sequence similarity is shown in the bottom half of the dividing line and sequence identity is shown in the top half of the diagonal dividing line. Parameters used in the comparison were: Scoring matrix: Blosum62, First Gap: 12, Extending Gap: 2. The sequence identity (in %) between the CYP704-like polypeptide sequences useful in performing the methods of the invention can be lower than 30 %, but is generally higher than 30% compared to SEQ ID NO: 2 or SEQ ID NO: 4. 2. DUF1218 polypeptides
Results of the analysis are shown in Figure 8 for the global similarity and identity over the full length of the polypeptide sequences. Sequence similarity is shown in the bottom half of the dividing line and sequence identity is shown in the top half of the diagonal dividing line. Parameters used in the comparison were: Scoring matrix: Blosum62, First Gap: 12, Extending Gap: 2. The sequence identity (in %) between the DUF1218 polypeptide sequences useful in performing the methods of the invention is generally higher than 30%, and preferably higher than 50% compared to SEQ ID NO: 88.
Results of the analysis for the global similarity and identity over the full length of a number of polypeptide sequences, which, when used in the construction of a phylogenetic tree, such as the one depicted in Figure 10, clusters with the group of polypeptides comprising the amino acid sequence represented by SEQ ID NO: 88 rather than with any other group, are shown in Table B1 . In this table, the following legend is used:
1. Os_UNKDUF1218; 2. A.officinalis_TA2043_4686; 3. H.vulgare_TC164154; 4. O.sativa. LOC_Os06g02440.1 ; 5. S.bicolor_Sb10g001220.1 ; 6. T.aestivum_c54830581 @5965; 7. T.aestivum_TC281335; 8. T.aestivum_TC286470; 9. T.aestivum_TC293972; 10. Z.mays_ TC513290; 1 1. Zea_mays_GRMZM2G041994_T01
Table B1
Figure imgf000103_0001
3. translin-like polypeptides
Results of the analysis are shown in Figure 14 for the global similarity and identity over the full length of the polypeptide sequences. Sequence similarity is shown in the bottom half of the dividing line and sequence identity is shown in the top half of the diagonal dividing line. Parameters used in the comparison were: Scoring matrix: Blosum62, First Gap: 12, Extending Gap: 2. The sequence identity (in %) between the translin-like polypeptide sequences useful in performing the methods of the invention can be as low as 26,4 % (is generally higher than 26,4%) compared to SEQ ID NO: 191 .
Table B2: Description of proteins in Figure 14:
1. B.napus_TC100628
2. B.napus_TC64968
3. T.aestivum_c54625664@13479
4. Z.mays_ZM07MC31062_BFb0264l17@30969
5. Z. mays_GRMZM2G128080_T02
6. Z. mays_TC476725
7. Z. mays_GRMZM2G128080_T03
8. P.trichocarpa_TC1 16999
9. M.truncatula_AC144726_60.5
10. A.thaliana AT2G03780.1
1 1 . O.sativa_LOC_Os01g16100.1
12. S. lycopersicum_PUT-171 a-Solanum_lycopersicum-42451
13. P.trichocarpa_TC97700
14. P.trichocarpa_scaff_X.1315
15. P. Trichocarpa translin-like
16. P.trichocarpa_659024
17. G.max_TC289758
18. G.max_Glyma1 1g01340.1
19. T.aestivum TC284985
20. 0.sativa_TC314197
21 . A.cepa_CF442302
22. S. lycopersicum_PUT-155a-Lycopersicon_esculentum-70 44897
23. T.aestivum_TC278465
24. H.vulgare_TC189986
Results of a further analysis are shown in Figure 15 for the similarity and identity of the polypeptide sequences, over the translin-like domain according to PFAM01997. Sequence similarity is shown in the bottom half of the dividing line and sequence identity is shown in the top half of the diagonal dividing line. Parameters used in the comparison were: Scoring matrix: Blosum62, First Gap: 12, Extending Gap: 2. The sequence identity (in %) of the translin-like domain between the translin-like polypeptide sequences useful in performing the methods of the invention can be as low as 30, 1 % (is generally higher than 30, 1 %) compared to SEQ ID NO: 191 . Table B3: Description of proteins in Figure 15:
1. B.napus_TC100628
2. B.napus_TC64968
3. A.thaliana_AT2G03780.1 4. P.trichocarpa_TC97700
5. P.trichocarpa_scaff_X.1315
6. P.trichocarpa_659024
7. P.trichocarpa_translin-like
8. P.trichocarpa_TC1 16999
9. G.max_TC289758
10. G.max_Glyma1 1g01340.1
1 1 . M.truncatula_AC144726_60.5
12. S. lycopersicum_PUT-171 a-Solanum_lycopersicum-42451
13. S. lycopersicum_PUT-155a-Lycopersicon_esculentum-70144897
14. A.cepa_CF442302
15. T.aestivum_c54625664@13479
16. T.aestivum_TC278465
17. H.vulgare TC189986
18. T.aestivum_TC284985
19. O.sativa_LOC_Os01g16100.1
20. 0.sativa_TC314197
21 . Z.mays_TC476725
22. Z. mays_GRMZM2G128080_T03
23. Z. mays_GRMZM2G128080_T02
24. Z. mays_ZM07MC31062_BFb0264H7@30969
4. ERG28-like polypeptides
Results of the analysis are shown in Figure 20 for the global similarity and identity over the full length of the polypeptide sequences. Sequence similarity is shown in the bottom half of the dividing line and sequence identity is shown in the top half of the diagonal dividing line. Parameters used in the comparison were: Scoring matrix: Blosum62, First Gap: 12, Extending Gap: 2. The sequence identity (in %) between the ERG28-like polypeptide sequences useful in performing the methods of the invention can be as low as 24 %, when SEQ ID NO: 247 is compared to the yeast ERG28-like orthologue, but is generally higher than 45% compared to SEQ ID NO: 247.
Example 4: Identification of domains comprised in polypeptide sequences useful in performing the methods of the invention
The Integrated Resource of Protein Families, Domains and Sites (InterPro) database is an integrated interface for the commonly used signature databases for text- and sequence- based searches. The InterPro database combines these databases, which use different methodologies and varying degrees of biological information about well-characterized proteins to derive protein signatures. Collaborating databases include SWISS-PROT, PROSITE, TrEMBL, PRINTS, ProDom and Pfam, Smart and TIGRFAMs. Pfam is a large collection of multiple sequence alignments and hidden Markov models covering many common protein domains and families. Pfam is hosted at the Sanger Institute server in the United Kingdom. Interpro is hosted at the European Bioinformatics Institute in the United Kingdom.
1. CYP704-like polypeptides
The results of the InterPro scan (InterPro database, release 28.0) of the polypeptide sequence as represented by SEQ ID NO: 2 are presented in Table C1 , those for SEQ ID NO: 4 in Table C2.
Table C1 : InterPro scan results (major accession numbers) of the polypeptide sequence as represented by SEQ ID NO: 2.
InterPro IPR001 128 Cytochrome P450
Molecular Function: monooxygenase activity (GO:0004497),
Molecular Function: iron ion binding (GO:0005506),
Biological Process: electron transport (GO:00061 18),
Molecular Function: heme binding (GO:0020037)
Method AccNumber shortName location
FprintScan PR00385 P450 T[303-320] 4.2e-13 T[365-376] 4.2e-13
T[443-452] 4.2e-13 T[452-463] 4.2e-13
Gene3D G3DSA: 1.10.630.10 no description T[20-505] 1.4e-92
HMMPanther PTHR19383 CYTOCHROME P450 T[11 -473] 3.3e-166
HMMPfam PF00067 p450 T[51 -501] 6.5e-54
Superfamily SSF48264 Cytochrome P450 T[36-505] 1.2e-99
InterPro IPR002401 Cytochrome P450, E-class, group I
Molecular Function: monooxygenase activity (GO:0004497),
Molecular Function: iron ion binding (GO:0005506),
Biological Process: electron transport (GO:00061 18),
Molecular Function: heme binding (GO:0020037)
Method AccNumber shortName location
FPrintScan PR00463 EP450I T[292-309] 6.3e-16 T[312-338] 6.3e-16 T[364-382] 6.3e-16
T[442-452] 6.3e-16 T[452-475] 6.3e-16
Table C2: InterPro scan results (major accession numbers) of the polypeptide sequence as represented by SEQ ID NO: 4.
InterPro IPR001 128 Cytochrome P450
Molecular Function: monooxygenase activity (GO:0004497),
Molecular Function: iron ion binding (GO:0005506),
Biological Process: electron transport (GO:00061 18),
Molecular Function: heme binding (GO:0020037)
Method AccNumber shortName location
FprintScan PR00385 P450 T[318-335] 3.5e-13 T[381 -392] 3.5e-13
T[459-468] 3.5e-13 T[468-479] 3.5e-13
Gene3D G3DSA: 1.10.630.10 no description T[55-521 ] 5.1 e-93
HMMPanther PTHR19383 CYTOCHROME P450 T[22-489] 1.7e-152
HMMPfam PF00067 p450 T[94-517] 1.8Θ-59
Superfamily SSF48264 Cytochrome P450 T[54-522] 6.3e-102
InterPro IPR002401 Cytochrome P450, E-class, group I
Molecular Function: monooxygenase activity (GO:0004497),
Molecular Function: iron ion binding (GO:0005506),
Biological Process: electron transport (GO:00061 18),
Molecular Function: heme binding (GO:0020037)
Method AccNumber shortName location
FPrintScan PR00463 EP450I T[307-324] 2e-16 T[327-353] 2e-16 T[380-398] 2e-16
T[458-468] 2e-16 T[468-491] 2e-16
In an embodiment a CYP704-like polypeptide comprises a conserved domain (or motif) with at least 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to a conserved domain starting with amino acid Q51 up to amino acid F501 in SEQ ID NO: 2 or with amino acid V94 up to amino acid L517 in SEQ ID NO: 4.
2. DUF1218 polypeptides
The results of the InterPro scan (InterPro database, release 29.0) of the polypeptide sequence as represented by SEQ ID NO: 88 are presented in Table C3.
Table C3: InterPro scan results (major accession numbers) of the polypeptide sequence as represented by SEQ ID NO: 88.
Figure imgf000109_0001
3. translin-like polypeptides
The results of the InterPro scan (InterPro database, release 30.0) of the polypeptide sequence as represented by SEQ ID NO: 191 are presented in Table C4.
Table C4: InterPro scan results (major accession numbers) of the polypeptide sequence as represented by SEQ ID NO: 191.
Figure imgf000109_0002
In an embodiment a translin-like polypeptide comprises a conserved domain (or motif) with at least 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to a conserved domain from amino acid 72 to 272 in SEQ ID NO: 191 . 4. ERG28-like polypeptides
The results of the InterPro scan (InterPro database, release 30.0) of the polypeptide sequence as represented by SEQ ID NO: 247 are presented in Table C5. Table C5: InterPro scan results (major accession numbers) of the polypeptide sequence as represented by SEQ ID NO: 247.
Figure imgf000110_0001
In an embodiment an ERG28-like polypeptide comprises a conserved domain (or motif) with at least 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to a conserved domain from amino acid 1 to 106 in SEQ ID NO: 247).
Example 5: Topology prediction of the polypeptide sequences useful in performing the methods of invention
TargetP 1.1 predicts the subcellular location of eukaryotic proteins. The location assignment is based on the predicted presence of any of the N-terminal pre-sequences: chloroplast transit peptide (cTP), mitochondrial targeting peptide (mTP) or secretory pathway signal peptide (SP). Scores on which the final prediction is based are not really probabilities, and they do not necessarily add to one. However, the location with the highest score is the most likely according to TargetP, and the relationship between the scores (the reliability class) may be an indication of how certain the prediction is. The reliability class (RC) ranges from 1 to 5, where 1 indicates the strongest prediction. TargetP is maintained at the server of the Technical University of Denmark.
For the sequences predicted to contain an N-terminal presequence a potential cleavage site can also be predicted.
A number of parameters were selected, such as organism group (non-plant or plant), cutoff sets (none, predefined set of cutoffs, or user-specified set of cutoffs), and the calculation of prediction of cleavage sites (yes or no).
Many other algorithms can be used to perform such analyses, including:
• ChloroP 1.1 hosted on the server of the Technical University of Denmark;
· Protein Prowler Subcellular Localisation Predictor version 1.2 hosted on the server of the I nstitute for Molecular Bioscience, University of Queensland , Brisbane, Australia; • PENCE Proteome Analyst PA-GOSUB 2.5 hosted on the server of the University of Alberta, Edmonton, Alberta, Canada;
• PSORT (URL: psort.org)
• PLOC (Park and Kanehisa, Bioinformatics, 19, 1656-1663, 2003).
· TMHMM, hosted on the server of the Technical University of Denmark:
1. CYP704-like polypeptides
The results of TargetP 1.1 analysis of the polypeptide sequence as represented by SEQ ID NO: 2 and 4 are presented in respectively Table D1 and Table D2. The "plant" organism group has been selected, no cutoffs defined, and the predicted length of the transit peptide requested. The polypeptide sequences as represented by SEQ ID NO: 2 or SEQ ID NO: 4 are predicted to be secreted or attached to a membrane of the secretory pathway.
Table D1 : TargetP 1.1 analysis of the polypeptide sequence as represented by SEQ ID NO:
2. Abbreviations: Len, Length; cTP, Chloroplastic transit peptide; imTP, Mitochondrial transit peptide, SP, Secretory pathway signal peptide, other, Other subcellular targeting,
Loc, Predicted Location; RC, Reliability class; TPIen, Predicted transit peptide length.
Name Len cTP mTP SP other Loc RC TPIen P.trichocarpa_scaff_ 508 0.018 0.013 0.949 0.156 S 2 27 cutoff 0.000 0.000 0.000 0.000
Table D2: TargetP 1.1 analysis of the polypeptide sequence as represented by SEQ ID NO: 4. Abbreviations: Len , Length; cTP, Chloroplastic transit peptide; mTP, Mitochondrial transit peptide, SP, Secretory pathway signal peptide, other, Other subcellular targeting, Loc, Predicted Location; RC, Reliability class; TPIen, Predicted transit peptide length.
Name Len cTP mTP SP other Loc RC TPIen
0. sativa_Os06g012990 525 0.005 0.093 0.987 0.035 S 1 36 cutoff 0.000 0.000 0.000 0.000 Results of the TMHMM analysis on SEQ ID NO: 4 are given hereunder:
# O.SATIVA_OS06G0129900 Length: 525
# O.SATIVA_OS06G0129900 Number of predicted TMHs : 1
# O.SATIVA_OS06G0129900 Exp number of AAs in TMHs: 26.40637
# O.SATIVA_OS06G0129900 Exp number, first 60 AAs: 25.87569
# O.SATIVA_OS06G0129900 Total prob of N-in: 0.96764
# O . SATIVA_OS06G0129900 POSSIBLE N-term signal sequence
0. SATIVA_OS06G0129900 TMHMM2.0 inside 1 11
0. SATIVA_OS06G0129900 TMHMM2.0 TMhelix 12 34
0. SATIVA_OS06G0129900 TMHMM2.0 outside 35 525 2. ERG28-like polypeptides
The results of TargetP 1.1 analysis of the polypeptide sequence as represented by SEQ ID NO: 2 are presented in Table D3. The "plant" organism group has been selected, no cutoffs defined, and the predicted length of the transit peptide requested. The subcellular localization of the polypeptide sequence as represented by SEQ ID NO: 247 may be the secretory pathway, a transit peptide is predicted with a cleavage site between S40 and E41.
Table D3: TargetP 1.1 analysis of the polypeptide sequence as represented by SEQ ID NO: 191. Abbreviations: Len, Length; cTP, Chloroplastic transit peptide; mTP, Mitochondrial transit peptide, SP, Secretory pathway signal peptide, other, Other subcellular targeting, Loc, Predicted Location; RC, Reliability class; TPIen, Predicted transit peptide length.
Name Len cTP mTP SP other Loc RC SEQ ID NO: 247 129 0.000 0.630 0.685 0.015 S cutoff 0.000 0.000 0.000 0.000
When analysed using Predotar (Small et al, Proteomics 4(6): 1581 -90, 2004), SEQ ID NO 247 is predicted to be located in the endoplasmatic reticulum (ER):
Figure imgf000112_0001
Analysis with the TMHMM algorithm (Technical University of Denmark, Sonnhammer et al, Proc Int Conf Intell Syst Mol Biol. 6:175-82, 1998) revealed the presence of four putative transmembrane domains:
# A.thaliana AT1G10030. 1 Length: 129
# A.thaliana AT1G10030. 1 Number of ;predicted TMHs : 4
# A.thaliana AT1G10030. 1 Exp number of AAs in TMHs : 83.8 9595
# A.thaliana AT1G10030. 1 Exp number , first 60 AAs : 36.83596
# A.thaliana AT1G10030. 1 Total prob of N-in: 0.25'
# A.thaliana AT1G10030. 1 POSSIBLE N -term signal sequence
A. •thaliana AT1G10030.1 TMHMM2. 0 outside 1 4
A. •thaliana AT1G10030.1 TMHMM2. 0 TMhelix 5 27
A. .thaliana AT1G10030.1 TMHMM2. 0 inside 28 46
A. .thaliana AT1G10030.1 TMHMM2. 0 TMhelix 47 66
A. •thaliana AT1G10030.1 TMHMM2. 0 outside 67 69
A. .thaliana AT1G10030.1 TMHMM2. 0 TMhelix 70 92
A. .thaliana AT1G10030.1 TMHMM2. 0 inside 93 96
A. .thaliana AT1G10030.1 TMHMM2. 0 TMhelix 97 116
A. •thaliana AT1G10030.1 TMHMM2. 0 outside 117 129 Example 6: Functional assay related to the polypeptide sequences useful in performing the methods of the invention
1. CYP704-like polypeptides
Guidance for functional characterization of CYP704-like polypeptides are provided in Dobritsa et al. (2009) and Li et al. (2010).
Example 7: Measurement of plant sterol and steroid composition and levels
Extraction, purification, analysis of the composition, and quantification of endogenous levels of sterols and brassinosteroids in plants are carried out by GS-MS, for example as described in He et al, Plant Physiology 131 : 1258-1269, 2003. Yeast sterol composition and levels are also measured using Gas-Chromatography-Mass Spectrometry (GS-MS), for example as described in Gachotte et al., Journal of Lipid Research 42: 150-154, 2001 .
Example 8: Cloning of the nucleic acid sequence used in methods of the invention
1. CYP704-like polypeptides
The nucleic acid sequence was amplified by PCR using as template a custom-made Populus trichocarpa cDNA library for SEQ ID NO: 2, or a custom-made Oryza sativa seedlings cDNA library for SEQ I D NO: 4. PCR was performed using a commercially available proofreading Taq DNA polymerase in standard conditions, using 200 ng of template in a 50 μΙ PCR mix. The primers used for SEQ ID NO: 1 were prm15749 (SEQ ID NO : 85; sense, start codon in bold): 5'-ggggacaagtttgtacaaaaaagcaggcttaaacaatggcctc cattgatgttct-3' and prm15750 (SEQ ID NO: 86; reverse, complementary): 5'-ggggaccact ttgtacaagaaagctgggtga ggcatccatcaatatgaaga-3'. Primers used for the cloning of the rice sequence were prm15747 (SEQ ID NO: 83; sense, start codon in bold): 5'-ggggacaagtttgtacaaaaaagcaggcttaaacaatggttacccagctcacctac-3' and prm15748 (SEQ ID NO: 84; reverse, complementary): 5'-ggggaccactttgtacaagaaagctggg tagtagcttgtttggggttcat-3'. These primers include the AttB sites for Gateway recombination. The amplified PCR fragment was purified also using standard methods. The first step of the Gateway procedure, the BP reaction, was then performed, during which the PCR fragment recombined in vivo with the pDONR201 plasmid to produce, according to the Gateway terminology, an "entry clone", pCYP704-like (either with SEQ ID NO: 1 or SEQ ID NO: 3). Plasmid pDONR201 was purchased from Invitrogen, as part of the Gateway® technology.
The entry clone comprising SEQ I D NO: 1 or SEQ I D NO: 3 was then used in an LR reaction with a destination vector used for Oryza sativa transformation. This vector contained as functional elements within the T-DNA borders: a plant selectable marker; a screenable marker expression cassette; and a Gateway cassette intended for LR in vivo recombination with the nucleic acid sequence of interest already cloned in the entry clone. A rice GOS2 promoter (SEQ ID NO: 82) for constitutive expression was located upstream of this Gateway cassette.
After the LR recombination step, the resulting expression vector pGOS2: :CYP704-like (Figure 4) was transformed into Agrobacterium strain LBA4044 according to methods well known in the art.
2. DUF1218 polypeptides
The nucleic acid sequence was amplified by PCR using as template a custom-made Oryza sativa cDNA library. PCR was performed using a commercially available proofreading Taq DNA polymerase in standard conditions, using 200 ng of template in a 50 μΙ PCR mix. The primers used were prm13120 (SEQ ID NO: 188; sense, start codon in bold): 5'-gggga caagtttgtacaaaaaagcaggcttaaacaatggagaggaaggtggtgg-3' and prm13121 (SEQ ID NO: 189; reverse, complementary): 5'-ggggaccactttgtacaagaaagctgggtcatgatttatgggaattgctg-3', which include the AttB sites for Gateway recombination. The amplified PCR fragment was purified also using standard methods. The first step of the Gateway procedure, the BP reaction, was then performed , du ring which the PCR fragment recombined i n vivo with the pDONR201 plasmid to produce, according to the Gateway terminology, an "entry clone", pDUF1218. Plasmid pDONR201 was purchased from Invitrogen, as part of the Gateway® technology.
The entry clone comprising SEQ ID NO: 87 was then used in an LR reaction with a destination vector used for Oryza sativa transformation. This vector contained as functional elements within the T-DNA borders: a plant selectable marker; a screenable marker expression cassette; and a Gateway cassette intended for LR in vivo recombination with the nucleic acid sequence of interest already cloned in the entry clone. A rice GOS2 promoter (SEQ I D NO : 186) for constitutive expression was located upstream of this Gateway cassette. After the LR recombination step, the resulting expression vector pGOS2:: DUF1218 (Figure 9) was transformed into Agrobacterium strain LBA4044 according to methods well known in the art.
3. translin-like polypeptides
The nucleic acid sequence was amplified by PCR using as template a custom-made Populus trichocarpa seedlings cDNA library. PCR was performed using a commercially available proofreading Taq DNA polymerase in standard conditions, using 200 ng of template in a 50 μΙ PCR mix. The primers used were prm14862 (SEQ ID NO: 243; sense): 5'-ggggacaagtttgtacaaaaaagcaggcttaaacaatgttattgacaagactcgcc-3' and prm 1 5985 (SEQ I D NO: 244; reverse, complementary): 5'-ggggaccactttgtacaagaaagctgggtttataattcgacatcagatacc c-3', which include the AttB sites for Gateway recombination. The amplified PCR fragment was purified also using standard methods. The first step of the Gateway procedure, the BP reaction, was then performed, during which the PCR fragment recombined in vivo with the pDONR201 plasmid to produce, according to the Gateway terminology, an "entry clone", p- translin-like. Plasmid pDONR201 was purchased from Invitrogen, as part of the Gateway® technology.
The entry clone comprising SEQ ID NO: 190 was then used in an LR reaction with a destination vector used for Oryza sativa transformation. This vector contained as functional elements within the T-DNA borders: a plant selectable marker; a screenable marker expression cassette; and a Gateway cassette intended for LR in vivo recombination with the nucleic acid sequence of interest already cloned in the entry clone. A rice GOS2 promoter (S EQ I D NO: 242) for constitutive expression was located upstream of this Gateway cassette.
After the LR recombination step, the resulting expression vector pGOS2:: translin-like gene (Figure 16) was transformed into Agrobacterium strain LBA4044 according to methods well known in the art.
4. ERG28-like polypeptides
The nucleic acid sequence encoding the Arabidopsis thaliana ERG28-like protein and the tomato ERG28-like protein are cloned using standard techniques, for example by PCR from a custom-made seedlings cDNA library using suitable primers which include the AttB sites for Gateway recombination. The amplified PCR fragment is purified also using standard methods. The first step of the Gateway procedure, the BP reaction, is then performed, during which the PCR fragment recombines in vivo with the pDONR201 plasmid (part of the Gateway® technology) to produce, according to the Gateway terminology, an "entry clone", pERG28-like.
The entry clone comprising SEQ ID NO: 246 or SEQ ID NO: 248 is then used in an LR reaction with a destination vector used for Oryza sativa transformation. This vector contains as functional elements within the T-DNA borders: a plant selectable marker; a screenable marker expression cassette; and a Gateway cassette intended for LR in vivo recombination with the nucleic acid sequence of interest already cloned in the entry clone. A rice GOS2 promoter (SEQ ID NO: 301 ) for constitutive expression is located upstream of this Gateway cassette.
After the LR recombination step, the resulting expression vector pGOS2: : ERG28-like (Figure 21 ) is transformed into Agrobacterium strain LBA4044 according to methods well known in the art. Example 9: Plant transformation
Rice transformation
The Agrobacterium containing the expression vector was used to transform Oryza sativa plants. Mature dry seeds of the rice japonica cultivar Nipponbare were dehusked. Sterilization was carried out by incubating for one minute in 70% ethanol, followed by 30 to 60 minutes, preferably 30 minutes in sodium hypochlorite solution (depending on the grade of contamination), followed by a 3 to 6 times, preferably 4 time wash with sterile distilled water. The sterile seeds were then germinated on a medium containing 2,4-D (callus induction medium). After incubation in light for 6 days scutellum-derived calli is transformed with Agrobacterium as described herein below.
Agrobacterium strain LBA4404 containing the expression vector was used for co-cultivation. Agrobacterium was inoculated on AB medium with the appropriate antibiotics and cultured for 3 days at 28°C. The bacteria were then collected and suspended in liquid co-cultivation medium to a density (Οϋβοο) of about 1 . The calli were immersed in the suspension for 1 to 15 minutes. The callus tissues were then blotted dry on a filter paper and transferred to solidified, co-cultivation medium and incubated for 3 days in the dark at 25°C. After washing away the Agrobacterium, the calli were grown on 2,4-D-containing medium for 10 to 14 days (growth time for indica: 3 weeks) under light at 28°C - 32°C in the presence of a selection agent. During this period, rapidly growing resistant callus developed. After transfer of this material to regeneration media, the embryogenic potential was released and shoots developed in the next four to six weeks. Shoots were excised from the calli and incubated for 2 to 3 weeks on an auxin-containing medium from which they were transferred to soil. Hardened shoots were grown under high humidity and short days in a greenhouse.
Transformation of rice cultivar indica can also be done in a similar way as give above according to techniques well known to a skilled person.
35 to 90 independent TO rice transformants were generated for one construct. The primary transformants were transferred from a tissue culture chamber to a greenhouse. After a quantitative PCR analysis to verify copy number of the T-DNA insert, only single copy transgenic plants that exhibit tolerance to the selection agent were kept for harvest of T1 seed. Seeds were then harvested three to five months after transplanting. The method yielded single locus transformants at a rate of over 50 % (Aldemita and Hodges1996, Chan et al. 1993, Hiei et al. 1994).
Example 10: Transformation of other crops
Corn transformation
Transformation of maize (Zea mays) is performed with a modification of the method described by Ishida et al. (1996) Nature Biotech 14(6): 745-50. Transformation is genotype- dependent in corn and only specific genotypes are amenable to transformation and regeneration. The inbred line A188 (University of Minnesota) or hybrids with A188 as a parent are good sources of donor material for transformation, but other genotypes can be used successfully as well. Ears are harvested from corn plant approximately 1 1 days after pollination (DAP) when the length of the immature embryo is about 1 to 1 .2 mm. Immature embryos are cocultivated with Agrobacterium tumefaciens containing the expression vector, and transgenic plants are recovered through organogenesis. Excised embryos are grown on callus induction medium, then maize regeneration medium, containing the selection agent (for example imidazolinone but various selection markers can be used). The Petri plates are incubated in the light at 25 °C for 2-3 weeks, or until shoots develop. The green shoots are transferred from each embryo to maize rooting medium and incubated at 25 °C for 2-3 weeks, until roots develop. The rooted shoots are transplanted to soil in the greenhouse. T1 seeds are produced from plants that exhibit tolerance to the selection agent and that contain a single copy of the T-DNA insert.
Wheat transformation
Transformation of wheat is performed with the method described by Ishida et al. (1996) Nature Biotech 14(6): 745-50. The cultivar Bobwhite (available from CIMMYT, Mexico) is commonly used in transformation. Immature embryos are co-cultivated with Agrobacterium tumefaciens containing the expression vector, and transgenic plants are recovered through organogenesis. After incubation with Agrobacterium, the embryos are grown in vitro on callus induction medium, then regeneration medium, containing the selection agent (for example imidazolinone but various selection markers can be used). The Petri plates are incubated in the light at 25 °C for 2-3 weeks, or until shoots develop. The green shoots are transferred from each embryo to rooting medium and incubated at 25 °C for 2-3 weeks, until roots develop. The rooted shoots are transplanted to soil in the greenhouse. T1 seeds are produced from plants that exhibit tolerance to the selection agent and that contain a single copy of the T-DNA insert.
Soybean transformation
Soybean is transformed according to a modification of the method described in the Texas A&M patent US 5,164,310. Several commercial soybean varieties are amenable to transformation by this method. The cultivar Jack (available from the I llinois Seed foundation) is commonly used for transformation. Soybean seeds are sterilised for in vitro sowing. The hypocotyl , the radicle and one cotyledon are excised from seven-day old young seedlings. The epicotyl and the remaining cotyledon are further grown to develop axillary nodes. These axillary nodes are excised and incubated with Agrobacterium tumefaciens containing the expression vector. After the cocultivation treatment, the explants are washed and transferred to selection media. Regenerated shoots are excised and placed on a shoot elongation medium. Shoots no longer than 1 cm are placed on rooting medium until roots develop. The rooted shoots are transplanted to soil in the greenhouse. T1 seeds are produced from plants that exhibit tolerance to the selection agent and that contain a single copy of the T-DNA insert. Rapeseed/canola transformation
Cotyledonary petioles and hypocotyls of 5-6 day old young seedling are used as explants for tissue culture and transformed according to Babic et al. (1998, Plant Cell Rep 17: 183- 188). The commercial cultivar Westar (Agriculture Canada) is the standard variety used for transformation, but other varieties can also be used. Canola seeds are surface-sterilized for in vitro sowing. The cotyledon petiole explants with the cotyledon attached are excised from the in vitro seedlings, and inoculated with Agrobacterium (containing the expression vector) by dipping the cut end of the petiole explant into the bacterial suspension. The explants are then cultured for 2 days on MSBAP-3 medium containing 3 mg/l BAP, 3 % sucrose, 0.7 % Phytagar at 23 °C, 16 hr light. After two days of co-cultivation with Agrobacterium, the petiole explants are transferred to MSBAP-3 medium containing 3 mg/l BAP, cefotaxime, carbenicillin, or timentin (300 mg/l) for 7 days, and then cultured on MSBAP-3 medium with cefotaxime, carbenicillin, or timentin and selection agent until shoot regeneration. When the shoots are 5 - 10 mm in length, they are cut and transferred to shoot elongation medium (MSBAP-0.5, containing 0.5 mg/l BAP). Shoots of about 2 cm in length are transferred to the rooting medium (MS0) for root induction. The rooted shoots are transplanted to soil in the greenhouse. T1 seeds are produced from plants that exhibit tolerance to the selection agent and that contain a single copy of the T-DNA insert. Alfalfa transformation
A regenerating clone of alfalfa {Medicago sativa) is transformed using the method of (McKersie et al., 1999 Plant Physiol 119: 839-847). Regeneration and transformation of alfalfa is genotype dependent and therefore a regenerating plant is required. Methods to obtain regenerating plants have been described. For example, these can be selected from the cultivar Rangelander (Agriculture Canada) or any other commercial alfalfa variety as described by Brown DCW and A Atanassov (1985. Plant Cell Tissue Organ Culture 4: 1 1 1 - 1 12). Alternatively, the RA3 variety (University of Wisconsin) has been selected for use in tissue culture (Walker et al., 1978 Am J Bot 65:654-659). Petiole explants are cocultivated with an overnight culture of Agrobacterium tumefaciens C58C1 pMP90 (McKersie et al., 1999 Plant Physiol 1 19: 839-847) or LBA4404 containing the expression vector. The explants are cocultivated for 3 d in the dark on SH induction medium containing 288 mg/ L Pro, 53 mg/ L thioproline, 4.35 g/ L K2S04, and 100 μιη acetosyringinone. The explants are washed in half-strength Murashige-Skoog medium (Murashige and Skoog, 1962) and plated on the same SH induction medium without acetosyringinone but with a suitable selection agent and suitable antibiotic to inhibit Agrobacterium growth. After several weeks, somatic embryos are transferred to BOi2Y development medium containing no growth regulators, no antibiotics, and 50 g/ L sucrose. Somatic embryos are subsequently germinated on half-strength Murashige-Skoog medium. Rooted seedlings were transplanted into pots and grown in a greenhouse. T1 seeds are produced from plants that exhibit tolerance to the selection agent and that contain a single copy of the T-DNA insert. Cotton transformation
Cotton is transformed using Agrobacterium tumefaciens according to the method described in US 5,159,135. Cotton seeds are surface sterilised in 3% sodium hypochlorite solution during 20 minutes and washed in distilled water with 500 pg/ml cefotaxime. The seeds are then transferred to SH-medium with 50μg/ml benomyl for germination. Hypocotyls of 4 to 6 days old seedlings are removed, cut into 0.5 cm pieces and are placed on 0.8% agar. An Agrobacterium suspension (approx. 108 cells per ml, diluted from an overnight culture transformed with the gene of interest and suitable selection markers) is used for inoculation of the hypocotyl explants. After 3 days at room temperature and lighting, the tissues are transferred to a solid medium (1.6 g/l Gelrite) with Murashige and Skoog salts with B5 vitamins (Gamborg et al., Exp. Cell Res. 50:151 -158 (1968)), 0.1 mg/l 2,4-D, 0.1 mg/l 6- furfurylaminopurine and 750 pg/ml MgCL2, and with 50 to 100 μg/ml cefotaxime and 400- 500 pg/ml carbenicillin to kill residual bacteria. Individual cell lines are isolated after two to three months (with subcultures every four to six weeks) and are further cultivated on selective medium for tissue amplification (30°C, 16 hr photoperiod). Transformed tissues are subsequently further cultivated on non-selective medium during 2 to 3 months to give rise to somatic embryos. Healthy looking embryos of at least 4 mm length are transferred to tubes with SH medium in fine vermiculite, supplemented with 0.1 mg/l indole acetic acid, 6 furfurylaminopurine and gibberellic acid. The embryos are cultivated at 30°C with a photoperiod of 16 firs, and plantlets at the 2 to 3 leaf stage are transferred to pots with vermiculite and nutrients. The plants are hardened and subsequently moved to the greenhouse for further cultivation.
Sugarbeet transformation
Seeds of sugarbeet (Beta vulgaris L.) are sterilized in 70% ethanol for one minute followed by 20 min. shaking in 20% Hypochlorite bleach e.g. Clorox® regular bleach (commercially available from Clorox, 1221 Broadway, Oakland, CA 94612, USA). Seeds are rinsed with sterile water and air dried followed by plating onto germinating medium (Murashige and Skoog (MS) based medium (Murashige, T., and Skoog, ., 1962. Physiol. Plant, vol. 15, 473- 497) including B5 vitamins (Gamborg et al.; Exp. Cell Res., vol. 50, 151 -8.) supplemented with 10 g/l sucrose and 0,8% agar). Hypocotyl tissue is used essentially for the initiation of shoot cultures according to Hussey and Hepher (Hussey, G., and Hepher, A., 1978. Annals of Botany, 42, 477-9) and are maintained on MS based medium supplemented with 30g/l sucrose plus 0,25mg/l benzylamino purine and 0,75% agar, pH 5,8 at 23-25°C with a 16- hour photoperiod. Agrobacterium tumefaciens strain carrying a binary plasmid harbouring a selectable marker gene, for example nptll, is used in transformation experiments. One day before transformation, a liquid LB culture including antibiotics is grown on a shaker (28°C, 150rpm) until an optical density (O. D.) at 600 nm of ~1 is reached . Overnight-grown bacterial cultures are centrifuged and resuspended in inoculation medium (O.D. ~1 ) including Acetosyringone, pH 5,5. Shoot base tissue is cut into slices (1 .0 cm x 1.0 cm x 2.0 mm approximately). Tissue is immersed for 30s in liquid bacterial inoculation medium. Excess liquid is removed by filter paper blotting. Co-cultivation occurred for 24-72 hours on MS based medium incl. 30g/l sucrose followed by a non-selective period including MS based medium, 30g/l sucrose with 1 mg/l BAP to induce shoot development and cefotaxim for eliminating the Agrobacterium. After 3-10 days explants are transferred to similar selective medium harbouring for example kanamycin or G418 (50-100 mg/l genotype dependent). Tissues are transferred to fresh medium every 2-3 weeks to maintain selection pressure. The very rapid initiation of shoots (after 3-4 days) indicates regeneration of existing meristems rather than organogenesis of newly developed transgenic meristems. Small shoots are transferred after several rounds of subculture to root induction medium containing 5 mg/l NAA and kanamycin or G418. Additional steps are taken to reduce the potential of generating transformed plants that are chimeric (partially transgenic). Tissue samples from regenerated shoots are used for DNA analysis. Other transformation methods for sugarbeet are known in the art, for example those by Linsey & Gallois (Linsey, K., and Gallois, P., 1990. Journal of Experimental Botany; vol. 41 , No. 226; 529-36) or the methods published in the international application published as W09623891A.
Sugarcane transformation
Spindles are isolated from 6-month-old field grown sugarcane plants (Arencibia et al., 1998. Transgenic Research, vol. 7, 213-22; Enriquez-Obregon et al., 1998. Planta, vol. 206, 20- 27). Material is sterilized by immersion in a 20% Hypochlorite bleach e.g. Clorox® regular bleach (commercially available from Clorox, 1221 Broadway, Oakland, CA 94612, USA) for 20 minutes. Transverse sections around 0,5cm are placed on the medium in the top-up direction. Plant material is cultivated for 4 weeks on MS (Murashige, T., and Skoog, ., 1962. Physiol. Plant, vol. 15, 473-497) based medium incl. B5 vitamins (Gamborg, O., et al., 1968. Exp. Cell Res., vol. 50, 151 -8) supplemented with 20g/l sucrose, 500 mg/l casein hydrolysate, 0,8% agar and 5mg/l 2,4-D at 23°C in the dark. Cultures are transferred after 4 weeks onto identical fresh medium. Agrobacterium tumefaciens strain carrying a binary plasmid harbouring a selectable marker gene, for example hpt, is used in transformation experiments. One day before transformation, a liquid LB culture including antibiotics is grown on a shaker (28°C, 150rpm) until an optical density (O.D.) at 600 nm of ~0,6 is reached. Overnight-grown bacterial cultures are centrifuged and resuspended in MS based inoculation medium (O.D. ~0,4) including acetosyringone, pH 5,5. Sugarcane embryogenic callus pieces (2-4 mm) are isolated based on morphological characteristics as compact structure and yellow colour and dried for 20 min. in the flow hood followed by immersion in a liquid bacterial inoculation medium for 10-20 minutes. Excess liquid is removed by filter paper blotting. Co-cultivation occurred for 3-5 days in the dark on filter paper which is placed on top of MS based medium incl. B5 vitamins containing 1 mg/l 2,4-D. After co- cultivation calli are washed with sterile water followed by a non-selective cultivation period on similar medium containing 500 mg/l cefotaxime for eliminating remaining Agrobacterium cells. After 3-10 days explants are transferred to MS based selective medium incl. B5 vitamins containing 1 mg/l 2,4-D for another 3 weeks harbouring 25 mg/l of hygromycin (genotype dependent). All treatments are made at 23°C under dark conditions. Resistant calli are further cultivated on medium lacking 2,4-D including 1 mg/l BA and 25 mg/l hygromycin under 16 h light photoperiod resulting in the development of shoot structures. Shoots are isolated and cultivated on selective rooting medium (MS based including, 20g/l sucrose, 20 mg/l hygromycin and 500 mg/l cefotaxime). Tissue samples from regenerated shoots are used for DNA analysis. Other transformation methods for sugarcane are known in the art, for example from the in-ternational application published as WO2010/151634A and the granted European patent EP1831378.
Example 1 1 : Phenotypic evaluation procedure
1 1 .1 Evaluation setup
35 to 90 independent TO rice transformants were generated. The primary transformants were transferred from a tissue culture chamber to a greenhouse for growing and harvest of T1 seed. Six events, of which the T1 progeny segregated 3: 1 for presence/absence of the transgene, were retained. For each of these events, approximately 10 T1 seedlings containing the transgene (hetero- and homo-zygotes) and approximately 10 T1 seedlings lacking the transgene (nullizygotes) were selected by monitoring visual marker expression. The transgenic plants and the corresponding nullizygotes were grown side-by-side at random positions. Greenhouse conditions were of shorts days (12 hours light), 28°C in the light and 22°C in the dark, and a relative humidity of 70%. Plants grown under non-stress conditions were watered at regular intervals to ensure that water and nutrients were not limiting and to satisfy plant needs to complete growth and development, unless they were used in a stress screen.
From the stage of sowing until the stage of maturity the plants were passed several times through a digital imaging cabinet. At each time point digital images (2048x1536 pixels, 16 million colours) were taken of each plant from at least 6 different angles.
T1 events were further evaluated in the T2 generation following the same evaluation procedure as for the T1 generation, e.g. with less events and/or with more individuals per event. In the present example, four events were further evaluated in the T2 generation.
Drought screen
T1 or T2 plants are grown in potting soil under normal conditions until they approached the heading stage. They are then transferred to a "dry" section where irrigation is withheld. Soil moisture probes are inserted in randomly chosen pots to monitor the soil water content (SWC). When SWC goes below certain thresholds, the plants are automatically re-watered continuously until a normal level is reached again. The plants are then re-transferred again to normal conditions. The rest of the cultivation (plant maturation, seed harvest) is the same as for plants not grown under abiotic stress conditions. Growth and yield parameters are recorded as detailed for growth under normal conditions. Nitrogen use efficiency screen
T1 or T2 plants are grown in potting soil under normal conditions except for the nutrient solution. The pots are watered from transplantation to maturation with a specific nutrient solution containing reduced N nitrogen (N) content, usually between 7 to 8 times less. The rest of the cultivation (plant maturation, seed harvest) is the same as for plants not grown under abiotic stress. Growth and yield parameters are recorded as detailed for growth under normal conditions.
Salt stress screen
T1 or T2 plants are grown on a substrate made of coco fibers and particles of baked clay (Argex) (3 to 1 ratio). A normal nutrient solution is used during the first two weeks after transplanting the plantlets in the greenhouse. After the first two weeks, 25 mM of salt (NaCI) is added to the nutrient solution , until the plants are harvested . Growth and yield parameters are recorded as detailed for growth under normal conditions.
1 1 .2 Statistical analysis: F test
A two factor ANOVA (analysis of variants) was used as a statistical model for the overall evaluation of plant phenotypic characteristics. An F test was carried out on all the parameters measured of all the plants of all the events transformed with the gene of the present invention. The F test was carried out to check for an effect of the gene over all the transformation events and to verify for an overall effect of the gene, also known as a global gene effect. The threshold for significance for a true global gene effect was set at a 5% probability level for the F test. A significant F test value points to a gene effect, meaning that it is not only the mere presence or position of the gene that is causing the differences in phenotype.
Where two experiments with overlapping events were carried out, a combined analysis was performed. This is useful to check consistency of the effects over the two experiments, and if this is the case, to accumulate evidence from both experiments in order to increase confidence in the conclusion. The method used was a mixed-model approach that takes into account the multilevel structure of the data (i.e. experiment - event - segregants). P values were obtained by comparing likelihood ratio test to chi square distributions.
9.3 Parameters measured
From the stage of sowing until the stage of maturity the plants were passed several times through a digital imaging cabinet. At each time point digital images (2048x1536 pixels, 16 million colours) were taken of each plant from at least 6 different angles as described in WO2010/031780. These measurements were used to determine different parameters. Biomass-related parameter measurement
The plant aboveground area (or leafy biomass) was determined by counting the total number of pixels on the digital images from aboveground plant parts discriminated from the background. This value was averaged for the pictures taken on the same time point from the different angles and was converted to a physical surface value expressed in square mm by calibration. Experiments show that the aboveground plant area measured this way correlates with the biomass of plant parts above ground. The above ground area is the area measured at the time point at which the plant had reached its maximal leafy biomass.
Increase in root biomass is expressed as an increase in total root biomass (measured as maximum biomass of roots observed during the lifespan of a plant); or as an increase in the root/shoot index, measured as the ratio between root mass and shoot mass in the period of active growth of root and shoot. In other words, the root/shoot index is defined as the ratio of the rapidity of root growth to the rapidity of shoot growth in the period of active growth of root and shoot. Root biomass can be determined using a method as described in WO 2006/029987. Parameters related to development time
The early vigour is the plant aboveground area three weeks post-germination. Early vigour was determined by counting the total number of pixels from aboveground plant parts discriminated from the background. This value was averaged for the pictures taken on the same time point from different angles and was converted to a physical surface value expressed in square mm by calibration.
AreaEmer is an indication of quick early development when this value is decreased compared to control plants. It is the ratio (expressed in %) between the time a plant needs to make 30 % of the final biomass and the time needs to make 90 % of its final biomass.
The "time to flower" or "flowering time" of the plant can be determined using the method as described in WO 2007/093444.
Seed-related parameter measurements
The mature primary panicles were harvested, counted, bagged, barcode-labelled and then dried for three days in an oven at 37°C. The panicles were then threshed and all the seeds were collected and counted. The seeds are usually covered by a dry outer covering, the husk. The filled husks (herein also named filled florets) were separated from the empty ones using an air-blowing device. The empty husks were discarded and the remaining fraction was counted again. The filled husks were weighed on an analytical balance.
The total number of seeds was determined by counting the number of filled husks that remained after the separation step. The total seed weight was measured by weighing all filled husks harvested from a plant.
The total number of seeds (or florets) per plant was determined by counting the number of husks (whether filled or not) harvested from a plant.
Thousand Kernel Weight (TKW) is extrapolated from the number of seeds counted and their total weight. The Harvest Index (HI) in the present invention is defined as the ratio between the total seed weight and the above ground area (mm2), multiplied by a factor 106.
The number of flowers per panicle as defined in the present invention is the ratio between the total number of seeds over the number of mature primary panicles.
The "seed fill rate" or "seed filling rate" as defined in the present invention is the proportion (expressed as a %) of the number of filled seeds (i.e. florets containing seeds) over the total number of seeds (i.e. total number of florets). In other words, the seed filling rate is the percentage of florets that are filled with seed. Example 10: Results of the phenotypic evaluation of the transgenic plants
1. CYP704-like polypeptides
The results of the evaluation of transgenic T1 rice plants expressing a nucleic acid encoding the CYP704-like polypeptide of SEQ ID NO: 4 under non-stress conditions are presented below in Table E1 . When grown under non-stress conditions, an increase of at least 5 % was observed for seed yield (including total weight of seeds, fill rate, harvest index). In addition, plants expressing the CYP704-like nucleic acid of SEQ ID NO: 1 showed for one or more of the tested lines an increase in Thousand Kernel Weight, height, and AreaEmer.
Table E1 : Data summary for transgenic rice plants; for each parameter, the overall percent increase is shown for the T1 generation, for each parameter the p-value is <0.05.
Figure imgf000124_0001
Transgenic T1 rice plants expressing a nucleic acid encoding the CYP704-like polypeptide of SEQ ID NO: 4 under non-stress conditions showed an increase in fill rate (overall increase 16.0 %, p-value <0.05). In addition, two of the tested lines scored positive for Emervigour (early vigour) and for height, one of the tested lines had increased Thousand Kernel Weight.
2. DUF1218 polypeptides
The results of the evaluation of transgenic rice plants of the T1 generation expressing the nucleic acid encoding of the DUF1218 polypeptide of SEQ ID NO: 88 under non-stress conditions indicated an increase in total seed weight of at least 5 % (at p-value is <0.05), and in particular of 10.4% as compared to control plants.
This effect was confirmed in the T2 generation. The results of the evaluation of transgenic rice plants of the T2 generation expressing the nucleic acid encoding the DUF 121 8 polypeptide of SEQ ID NO: 88 under non-stress conditions indicated an increase of at least 5% (at p-value is <0.05), and in particular of 8,1 % as compared to control plants, for total seed weight. Results of combined analysis are shown in Table E2. As shown in Table E2 below, the p value from the F test for the T1 and T2 evaluation combined was significant (with a p value of 0.0001 ) indicating that the presence of the construct in the plants has a significant effect on the total seed weight in transgenic plants.
Table E2: Total Seed Weight; overall increase as compared to control plants
Figure imgf000125_0001
In addition, it was noted that plants of at least two events showed an increase in emer vigor, fill rate, harvest index, number of seeds and thousand kernel weight as compared to control plants. One event also showed an increase in biomass (increased area and height max) as compared to control plants.
3. translin-like polypeptides
The results of the evaluation of transgenic rice plants under non-stress conditions are presented below. An increase of at least 5% was observed for total seed yield (Totalwgseeds), seed fill rate (fillrate), harvest index and number of seeds (nrfilledseed) (Table E3).
The results of the evaluation of transgenic rice plants in the T1 generation and expressing a nucleic acid encoding the translin-like polypeptide of SEQ ID NO: 191 under non-stress conditions are presented below in Table E3. When grown under non-stress conditions, an increase of at least 5 % was observed for total seed yield (Totalwgseeds), seed fill rate (fillrate), harvest index and number of seeds (nrfilledseed). Table E3: Data summary for transgenic rice plants; for each parameter, the overall percent increase is shown for the T1 generation, for each parameter the p-value is <0.05.
Figure imgf000125_0002
4. ERG28-like polypeptides
Transgenic rice plants expressing the ERG28-like protein represented by SEQ ID NO: 247 or SEQ ID NO: 249, or a modified version thereof show at least one increased yield related trait as defined herein, in particular increased yield such as increased biomass and/or increased seed yield, and/or have an elevated steroid content and/or modified steroid composition.
Example 13: expression of ERG-28 like protein in yeast results in improved yeast growth and mating
ERG28-like is cloned and expressed i n Saccharomyces cerevisiae using standard techniques. Yeast clones having modulated expression (preferably increased expression) of ERG28-like have improved growth compared to wild type yeast. Yeast growth rate and mating proficiency are determined as described in Smith et al, Science 274:2069-2074, 1996.
Example 14: Decreased expression of ERG-28 like protein in ERG28 T-DNA mutants results in increased yield-related traits under non-stress and drought stress conditions
Several T-DNA mutant lines of ERG-28 like gene has been characterized identifying loss- of-function ERG28 mutants of Arabidopsis (AtERG28) that displayed sterol-deficient like root phenotype (i.e. swollen roots with increased root hair density and length) as well as increased seed yield under both non-stress conditions and upon recovery following drought stress.
1. Materials and Methods
Plant material and growth conditions
Seeds (T2 generation) of SALK, SAIL, and GABI-Kat T-DNA insertion lines were obtained from European Arabidopsis Stock Centre (NASC). FLAG T-DNA insertion lines, and RIKEN Arabidopsis transposon-tagged mutant (RATM) lines were obtained from INRA Versailles and RIKEN, respectively. Arabidopsis wild type controls used were the Columbia (Col-0) ecotype in the case of the SALK, SAIL and Gabi-Kat lines, and Wassilewskija (Ws) ecotype in the case of FLAG lines. Seeds were surface sterilized, chilled at 4°C for 3 d, germinated and grown on Murashige and Skoog (MS) medium (Murashige and Skoog, 1962) supplemented with 1 % sucrose at 21 °C u nd er a 16-h-light/8-h-dark photoperiod. One to two weeks after germination, seedlings were transferred to soil and grown to maturity in the same temperature and light conditions. For the phenotypic analysis of GABI-Kat 205F01 T-DNA line mutant seedlings, the antibiotic plate assays were performed by supplementing the MS medium with 5,25 mg.L-1 Sulfadiazine. The abiotic stress assays were performed by supplementing the MS medium with either 50mM Mannitol, l OOmM Mannitol, or 150mM NaCI.
Genomic DNA extraction for genotyping was performed using the CTAB method. To identify homozygous knockout mutants with a T-DNA insertion, T-DNA border primers and gene- specific primers derived from the genomic DNA flanking the T-DNA insertion were used. Individuals homozygous for the T-DNA insertion were evidenced by the absence of gene- specific products and the presence of a T-DNA-specific product. Primers used for genotyping and sequencing are given below:
Figure imgf000127_0001
Total RNA extraction for EG28 transcript level analysis by Real-Time Quantitative Reverse Transcription PCR (qRT-PCR) was performed followi ng a T RI-reagent (TRIZOL)- Choroform-isopropanol method following by a purification of the RNA isolated using RNAeasy™ col umns. cDNA synthesis was performed by using the iScript™ cDNA synthesis Kit. CDKA, UBQ10, EEF1 a, and 18sRNA were tested as reference gene primers. CDKA and EEF1 a were selected as reference gene for further analysis of the ERG28 transcript levels. For the detection of ERG28 and reference gene transcripts, the primers used are listed below:
Ref. gene name SEQ ID NO: Primer sequence
ERG28 Fw 324 TGGGCTCTTCGTCTCGCTGT
Rev 325 GGTTTGTTTTCGAGGTTGAATGC
CDKA Fw 326 ATTGCGTATTGCCACTCTCATAGG
Rev 327 TCCTGACAGGGATACCGAATGC
EEF1A Fw 328 CTG G AG GTTTTG AG G CTG GTAT
Rev 329 CC AAG G CTG AAAG C AAG AAG A UBQ10 Fw 330 GGACCAGCAGGTCTCATCTTCGCT
Rev 331 CTTATTC ATC AG G G ATTATACAAG
18SRNA Fw 332 G CATTTG CC AAG CATG TTTC
Rev 333 GCGCAGTCCTATAAGCAAC
2. Characterisation of AtERG28 T-DNA lines
T-DNA lines available and for which seeds (T2 generation) were received for AtERG28 T- DNA mutant characterization are listed below. In bold are the lines that have been analyzed. Predicted positions of the insertions of these T-DNA lines relative to the ERG28 gene coding sequence are also given in the following:
Figure imgf000128_0001
Genotyping, phenotyping, and ERG28 transcript level analyses were performed for the different T-DNA lines as described in material and methods. Among the T-DNA lines for which some homozygous mutants could be identified and the T-DNA insertion confirmed by sequencing, homozygous mutants of two of them displayed altered AtERG28 transcript levels. In one of them (SAIL_CS839574) transcript levels were up-regulated in comparison to the WT and heterozygous segregants, whereas in the other (GABI-Kat_205F01 ), transcripts levels of AtERG28 were strongly reduced. No significant changes in AtERG28 transcript levels were observed in the homozygous mutants of any of the other T-DNA mutant lines. None of the homozygous mutants of any of the T-DNA lines mentioned above displayed any visible phenotypic difference with their wildtype (WT) segregants when grown in soil under non-stress/optimal growth conditions. Results of the ERG28 T-DNA line characterization are summarized below for each of the lines and the results of AtERG28 transcript expression level are displayed in Figure 22.
· FLAG_520D04: segregating population of heterozygous, homozygous mutants and
WTs; no change in AtERG28 transcript expression level (qRT-PCR) in the mutants in comparison to the WTs; no visible phenotype.
• SALK_139449: all homozygous mutants; no sign ificant difference in AtE RG28 transcript expression level in comparison to WTcolO; no visible phenotype.
· SAIL_CS839574: segregating population of heterozygous, homozygous mutants and WTs; significant increase in AtERG28 transcript expression level in the mutants (and to a lower extent in the heterozygous too) in comparison to the WTs; No visible phenotypic differences observed between the SAIL_CS839574 homozygous mutant and WT plants grown on soil under optimal growth conditions.
· SALK_000240: segregating population of heterozygous, homozygous mutants, and
WTs; no visible phenotype.
• GABI-Kat_205F01 : segregating population of heterozygous, homozygous mutants and
WTs; significant decrease in AtERG28 transcript expression level in the mutant in comparison to the heterozygous and WTs; No visible phenotypic differences observed between the GABI-Kat_205F01 homozygous mutant and WT plants grown on soil under optimal growth conditions.
• FLAG_328E06, SALK_027826, SALK_025834, SALK_000240, and SALK_023293: no homozygous mutants identified; T-DNA insertion not confirmed. 3. Phenotypic analysis of GK205F01 T-DNA mutants (T3) under non-stress and stress conditions
T3 seeds produced by T2 plants of the T-DNA mutant lines for which the insertion could be confirmed (FLAG_520D04, SALK_139449, SAIL_CS839574, SALK_000240, GABI- Kat_205F01 ) were collected (for each T-DNA line, several individuals/biological replicates of each genotypes: homozygous mutants, heterozygous, and WT segregants were harvested).
Phenotyping analyses under both stress and non-stress conditions were carried out on the progeny (F1 ) of homozygous mutants, heterozygous, and WTs of the GABI-Kat_205F01 T- DNA line. Seeds were germinated and seedlings grown on MS medium with and without antibiotic selection (5,25 mg.L-1 Sulfadiazine) or osmotic/salt stress treatment (50mM Mannitol, 100mM Mannitol, or 150mM NaCI). Only GABI-Kat_205F01 homozygous mutant seeds and seedlings, and not those of WT, were able to grow on MS medium supplemented with antibiotic, thus confirming the presence of the T-DNA insert in the homozygous mutants (data not shown). 1 1 day old GABI-Kat_205F01 homozygous mutant and WT seedlings (8 to 9 biological replicate of each genotype) grown on MS medium were transferred to soil. When 18 day old, plants were stopped being watered for about 2 weeks. At that time, plants which had started dying were re-watered and recorded for their recovering capacity. Plants were left to mature under well-watered conditions, and the seeds were harvested and weighted. Seeds were also harvested and weighted from homozygous mutant and WT control plants that were always kept well watered (4 biological replicates from each genotype). Homozygous mutant plants presented slight increased seed yield (12-19%; not statistically significant difference) in comparison with the WTs, both under non-stress and stress conditions. Results of these seed yield measurement are presented in Figure 23.
A slight seed yield increased was observed in the AtERG28 loss-of-function mutant in comparison to the WTs, both under both non-stress conditions and upon recovery following drought stress. Downregulation of ERG28 in these species leads to increased root hair density, and therefore to increased nodulation and symbiotic nitrogen fixation capacity.

Claims

Claims
1. A method for the production of a transgenic plant having enhanced seed yield relative to a control plant, comprising the steps of:
introducing and expressing in a plant cell or plant a nucleic acid encoding a CYP704-like polypeptide, wherein said n ucleic acid is operably linked to a constitutive plant promoter, and wherei n said CYP704-like polypeptide comprises the polypeptide represented by one of: SEQ ID NO: 2, SEQ ID NO: 4 or a homologue thereof which has at least 90% overall sequence identity to SEQ ID NO : 2 or SEQ ID NO: 4, and
- cultivating said plant cell or plant under conditions promoting plant growth and development.
2. Method according to claim 1 , wherein said increased seed yield comprises at least one parameter selected from the group comprising increased total seed weight, increased harvest index, and increased fill rate.
3. Method according to claim 1 or 2, wherein said increase in seed yield comprises an increase of at least 5 % in said plant when compared to control plants for each of said parameters.
4. Method according to any of claims 1 to 3, wherein said increased yield is obtained under non-stress conditions.
5. Method according to any one of claims 1 to 4, wherein said nucleic acid is operably linked to a GOS2 promoter.
6. Method according to claim 5, wherein said GOS2 promoter is the GOS2 promoter from rice.
7. M eth od a ccord i n g to a ny on e for cl a i m s 1 to 6 , wh e re i n sa i d p l a n t i s a monocotyledonous plant.
8. Method according to claim 7, wherein said plant is a cereal.
9. Construct comprising:
(i) nucleic acid encoding a CYP704-like polypeptide as defined in claim 1 ;
(ii) one or more control sequences capable of driving expression of the nucleic acid sequence of (i); and optionally
(iii) a transcription termination sequence.
10. Construct of claim 9, wherein said one or more control sequences is a GOS2 promoter.
1 1. Transgenic plant having enhanced seed yield as defined in claim 2 or 3 relative to control plants, resulting from introduction and expression of a nucleic acid encoding a
CYP704-like polypeptide as defined in claim 1 in said plant, or a transgenic plant cell derived from said transgenic plant.
12. Use of a nucleic acid encoding a CYP704-like polypeptide as defined in claim 1 for enhancing seed yield as defined in claim 2 or 3 in a transgenic plant relative to a control plant.
13. A method for en hancing yield-related traits in plants relative to control plants, comprising modulating expression in a plant of a nucleic acid encoding a DUF1218 polypeptide, wherein said DUF1218 polypeptide comprises a DUF1218 domain.
14. Method according to claim 13, wherein said modulated expression is effected by introducing and expressing in a plant said nucleic acid encoding said DUF 121 8 polypeptide.
15. Method accordi ng to claim 13 or 14 , wherei n said en hanced yield-related traits comprises increased yield relative to control plants, and preferably comprises increased seed yield and/increase biomass relative to control plants.
16. Method according to any one of claims 13 to 15, wherein said increased seed yield comprises increased total seed weight.
17. Method according to any one of claims 13 to 16, wherein said enhanced yield-related traits are obtained under non-stress conditions.
18. Method according to any one of claims 13 to 16, wherein said enhanced yield-related traits are obtained under conditions of drought stress, salt stress or nitrogen deficiency.
19. Method according to any one of claims 13 to 1 8, wherein said DU F1218 domain comprises an amino acid sequence having at least 50% overall sequence identity to the amino acid represented by SEQ ID NO: 179.
20. Method according to any one of claims 13 to 19, wherein said DUF1218 polypeptide has at least one signal peptide and at least one transmembrane domain.
21. Method according to any of claims 13 to 20, wherein said DUF121 8 polypeptide comprises one or more of the following motifs:
(i) Motif 10: NW[TS][LV]AL[VI][CS]F[VI]VSW[FA]TF[VI]IAFLLLLTGAALNDQ[HR]G [EQ]E (SEQ ID NO: 180),
(ii) Motif 11 : SP[STG][EQ]C[VI]YPRSPAL[AG]LGL[IT][AS]A[DV][AS]LM[IV]A[QH][IS V]IIN[TV][AV][TA]GCICC[KR][RK] (SEQ ID NO: 181 ),
(iii) Motif 12: [YS][YF]CYVVKPGVF[AS]G[GA]AVLSLASV[AI]L[GA]IVYY (SEQ ID NO: 182).
22. Method according to any of claims 13 to 21 , wherein said DUF121 8 polypeptide further comprises one or more of the following motifs:
(i) Motif 13: CCKRHPVPSDTNWSVALISFIVSW[VAC]TFIIAFLLLLTGAALNDQRG [EQ]ENMY (SEQ ID NO: 183),
(ii) Motif 14: M E RK[AV] VV VCA[L V] VG F LGVLS AALG F AAE [G A]T RVKVS D VQT[DS] (SEQ ID NO: 184),
(iii) Motif 15: IP[QP]QSSEPVFVHEDTYNR[QR]Q[FQ] (SEQ ID NO: 185)
23. Method according to any one of claims 13 to 22, wherein said nucleic acid encoding a DUF12 8 polypeptide is of plant origin, preferably from a monocotyledonous plant, further preferably from the family Poaceae, more preferably from the genus Oryza, most preferably the nucleic acid is from Oryza sativa.
24. Method according to any one of claims 13 to 23, wherein said nucleic acid encoding a DUF1218 polypeptide encodes any one of the polypeptides listed in Table A2 or is a portion of such a nucleic acid, or a nucleic acid capable of hybridising with such a nucleic acid.
25. Method according to any one of claims 13 to 24, wherein said nucleic acid sequence encodes an orthologue or paralogue of any of the polypeptides given in Table A2.
26. Method according to any one of claims 13 to 25, wherein said nucleic acid encodes the polypeptide represented by SEQ ID NO: 88 or a homologue thereof.
27. Method according to any one of claims 13 to 26, wherein said nucleic acid is operably linked to a constitutive promoter, preferably to a medium strength constitutive promoter, preferably to a plant promoter, more preferably to a GOS2 promoter, most preferably to a GOS2 promoter from rice.
28. Plant, plant part thereof, including seeds, or plant cell , obtainable by a method according to any one of claims 13 to 27, wherein said plant, plant part or plant cell comprises a recombinant nucleic acid encoding a DUF1218 polypeptide as defined in any of claims 13 and 19 to 26.
29. Construct comprising:
(i) nucleic acid encoding a DUF1218 polypeptide as defined in any of claims 13 and 19 to 26;
(ii) one or more control sequences capable of driving expression of the nucleic acid sequence of (i); and optionally
(iii) a transcription termination sequence.
30. Construct according to claim 29, wherein one of said control seq uences is a constitutive promoter, preferably a medium strength constitutive promoter, preferably to a plant promoter, more preferably a GOS2 promoter, most preferably a GOS2 promoter from rice.
31. Use of a construct according to claim 28 or 29 in a method for making plants having enhanced yield-related traits, preferably increased yield relative to control plants, and more preferably increased seed yield relative to control plants.
32. Plant, plant part or plant cell transformed with a construct according to claim 28 or 29.
33. Method for the production of a transgenic plant having enhanced yield-related traits relative to control plants, preferably increased yield relative to control plants, and more preferably increased seed yield and/or increased biomass relative to control plants, comprising:
(i) introducing and expressing in a plant cell or plant a nucleic acid encoding a DUF1218 polypeptide as defined in any of claims 13 and 19 to 26; and (ii) cultivating said plant cell or plant under conditions promoting plant growth and development.
34. Transgenic plant having enhanced yield-related traits relative to control plants, preferably increased yield relative to control plants, and more preferably increased seed yield, resu lting from modulated expression of a nucleic acid encoding a DUF1218 polypeptide as defined in any of claims 13 and 19 to 26 or a transgenic plant cell derived from said transgenic plant.
35. Transgenic plant according to claim 28, 32 or 34, or a transgenic plant cell derived therefrom, wherein said plant is a crop plant, such as beet, sugarbeet or alfalfa; or a monocotyledonous plant such as sugarcane; or a cereal, such as rice, maize, wheat, barley, millet, rye, triticale, sorghum, emmer, spelt, secale, einkorn, teff, milo or oats.
36. Harvestable parts of a plant according to any of claims 28, 32, 34-35, wherein said harvestable parts are preferably shoot biomass and/or seeds.
37. Products derived from a plant according to any of claims 28, 32, 34-35 and/or from harvestable parts of a plant according to claim 36.
38. Isolated nucleic acid molecule selected from:
(i) a nucleic acid represented by any one of SEQ ID NO: 87 or 97;
(ii) the complement of a nucleic acid represented by any one of SEQ ID NO: 87 or 97;
(iii) a nucleic acid encoding a DUF1218 polypeptide having in increasing order of preference at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%,
74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88% , 89% , 90% , 91 % , 92% , 93% , 94% , 95% , 96% , 97% , 98% , or 99% sequence identity to the amino acid sequence represented by any one of SEQ ID NO: 88 or 98, and additionally or alternatively comprising one or more motifs having in increasing order of preference at least 50%, 55%, 60%, 65%, 70%,
75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any one or more of the motifs given in SEQ ID NO: 179 to SEQ ID NO: 185, and further preferably conferring enhanced yield-related traits relative to control plants.
(iv) a nucleic acid molecule which hybridizes with a nucleic acid molecule of (i) to (iii) under high stringency hybridization conditions and preferably confers enhanced yield-related traits relative to control plants.
39. Isolated polypeptide selected from:
(i) an amino acid sequence represented by any one of SEQ ID NO: 88 or 98;
(ii) an amino acid sequence having, in increasing order of preference, at least 50%,
51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the amino acid sequence represented by SEQ ID NO: 88 or 98, and additionally or alternatively comprising one or more motifs having in increasing order of preference at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any one or more of the motifs given in SEQ ID NO: 179 to SEQ ID NO: 185, and further preferably conferring enhanced yield-related traits relative to control plants;
(iii) derivatives of any of the amino acid sequences given in (i) or (ii) above.
40. Use of a nucleic acid encoding a DUF1218 polypeptide as defined in any of claims 13 and 19 to 26 and 39 for enhancing yield-related traits in plants relative to control plants, preferably for increasing yield, and more preferably for increasing seed yield in plants relative to control plants.
41. Use of a nucleic acid as defined in claim 38 and encoding a DUF1218 polypeptide for enhancing yield-related traits i n plants relative to control plants, preferably for increasing yield, and more preferably for increasing seed yield in plants relative to control plants.
42. Use of a nucleic acid encoding a DUF1218 polypeptide as defined in any of claims 13 and 19 to 26 and 39 as molecular marker.
43. Use of a nucleic acid s defined in claim 38 and encoding a DUF1218 polypeptide as defined in any of claims 13 and 19 to 26 and 39 as molecular marker.
44. A method for en hancing yield-related traits in plants relative to control plants, comprising introducing and expressing in a plant a nucleic acid encoding a translin- like polypeptide, wherein said translin-like polypeptide comprises the signature sequence GTDFWKLRR (SEQ I D NO: 245) and preferably comprises an InterPro accession IPR002848 corresponding to PFAM accession number PF01997 translin domain.
45. Method according to claim 44, wherein said nucleic acid encodes the polypeptide represented by SEQ ID NO: 191.
46. Method accordi ng to claim 44 or 45, wherei n said en hanced yield-related traits comprise increased yield relative to control plants, and preferably comprise increased harvest index and/or increased seed yield relative to control plants.
47. Method according to any one of claims 44 to 46, wherein said enhanced yield-related traits are obtained under non-stress conditions.
48. Method according to any of claims 44 to 47, wherein said translin-like polypeptide comprises one or more of the following motifs:
(i) Motif 16: DLAAV[TV][NED]QY[IM][LAGS][KR]LVKELQGTDFWKLRRAY[ST][PF] GVQEYVEAAT[FL][CY][KR]FC[RK][TS]GT (SEQ ID NO: 238),
(ii) Motif 17: [SP][SA][FM]K[DA][AE]F[GSA][NK][YH]A[NE]YLN[KNT]LN[ED]KRE R
[VL]VKASRD[IV]TMNSKKVIFQVHR[IM]SK[DN]N[RK] (SEQ ID NO: 239),
(iii) Motif 18: IC[QA]FVRDIYRELTL[LVI]VP[YL]MDD[SN][SN][DE]MK[TK]KM[DE][T V]MLQSV[VM]KIENAC[YF][GS]VHVRG (SEQ ID NO: 240).
49. Method according to any one of claims 44 to 48, wherein said nucleic acid encoding a translin-like polypeptide is of plant origin, preferably from a dicotyledonous plant, further preferably from the family Salicaceae, more preferably from the gen us Populus, most preferably from Populus trichocarpa.
50. Method according to any one of claims 44 to 49, wherein said nucleic acid is operably linked to a constitutive promoter, preferably to a medium strength constitutive promoter, preferably to a plant promoter, more preferably to a GOS2 promoter, most preferably to a GOS2 promoter from rice.
51. Plant, plant part thereof, including seeds, or plant cell , obtainable by a method according to any one of claims 44 to 50, wherein said plant, plant part or plant cell comprises a recombinant nucleic acid encoding a translin-like polypeptide as defined in any of claims 44, 45 and 48 to 50.
52. Construct comprising:
(i) nucleic acid encoding a translin-like polypeptide as defined in any of claims 44, 45 and 48 to 50;
(ii) one or more control sequences capable of driving expression of the nucleic acid sequence of (i), preferably a medium strength constitutive promoter, preferably to a plant promoter, more preferably a GOS2 promoter, most preferably a GOS2 promoter from rice; and optionally
(iii) a transcription termination sequence.
53. Use of a construct according to claim 52 in a method for making plants having enhanced yield-related traits, preferably increased yield relative to control plants, and more preferably increased seed yield and/or increased biomass relative to control plants.
54. Plant, plant part or plant cell transformed with a construct according to claim 52.
55. Method for the production of a transgenic plant having enhanced yield-related traits relative to control plants, preferably increased yield relative to control plants, and more preferably increased seed yield and/or increased harvest index relative to control plants, comprising:
(i) introducing and expressing in a plant cell or plant a nucleic acid encoding a translin-like polypeptide as defined in any of claims 44, 45 and 48 to 50; and
(ii) cultivating said plant cell or plant under conditions promoting plant growth and development.
56. Transgenic plant having enhanced yield-related traits relative to control plants, preferably increased yield relative to control plants, and more preferably increased seed yield and/or increased biomass, resulting from modulated expression of a nucleic acid encoding a translin-like polypeptide as defined in any of claims 44, 45 and 48 to 50 or a transgenic plant cell derived from said transgenic plant.
57. Harvestable parts of a plant according to claim 56, wherein said harvestable parts are preferably seeds.
58. Products derived from a plant according to claim 56 and/or from harvestable parts of a plant according to claim 57.
59. A method for enhancing yield-related traits, and/or for modifying steroid composition, and/or for increasing or decreasing steroid levels in plants relative to control plants, comprising modulating expression in a plant of a nucleic acid encoding an ERG28-like polypeptide, wherein said ERG28-like polypeptide comprises a Pfam PF03694 domain and preferably also the signature sequence WTLL[TS]CTL.
60. Method according to claim 59, wherein said modulated expression is effected by introducing and expressing in a plant said nucleic acid encoding said ERG28-like polypeptide.
61. Method accordi ng to claim 59 or 60 , wherei n said en hanced yield-related traits comprise increased yield and/or early vigour relative to control plants, and preferably comprise increased biomass and/or increased seed yield relative to control plants.
62. Method according to any one of claims 59 to 61 , wherein said enhanced yield-related traits, and/or modified steroid composition, and/or increased or decreased steroid levels are obtained under non-stress conditions.
63. Method according to any one of claims 59 to 61 , wherein said enhanced yield-related traits, and/or modified steroid composition, and/or increased or decreased steroid levels are obtained under conditions of drought stress, salt stress or nitrogen deficiency.
64. Method according to any of claims 59 to 63, wherein said ERG28-like polypeptide comprises one or more of the following motifs:
(i) Motif 19: CTLC[FY]LCA[FL]NL[HE][DN][KR]PLYLAT[IF]LSF[IV]YA[FL]GHFLTE[F Y]L[FI]Y[HQ]TM,
(N) Motif 20: VG[ST]LRLASVWFGF[VF][DN]IWALR[LV]AVFS[QK]T[TE]M[TS][ED]
[VI]HGRTFG[VT]WT,
(iii) Motif 21 : [IA][KA]NL[SVT]TVG[FI]FAGTSI[VI]WMLL[EQ]WN[SA][LH][EQG][QK] [PV][RKH]
(iv) Motif 22: [PEK][LA]LG[YW]WL[MI]
65. Method according to any one of claims 59 to 64, wherein said nucleic acid encoding an ERG28-like is of plant origin, preferably from a dicotyledonous plant, further preferably from the family Brassicaceae, more preferably from the genus Arabidopsis, most preferably from Arabidopsis thaliana.
66. Method according to any one of claims 59 to 65, wherein said nucleic acid encoding an ERG28-like encodes any one of the polypeptides listed in Table A4 or is a portion of such a nucleic acid, or a nucleic acid capable of hybridising with such a nucleic acid.
67. Method according to any one of claims 59 to 66, wherein said nucleic acid sequence encodes an orthologue or paralogue of any of the polypeptides given in Table A4.
68. Method according to any one of claims 59 to 67, wherein said nucleic acid encodes the polypeptide represented by SEQ ID NO: 247.
69. Method according to any one of claims 59 to 68, wherein said nucleic acid is operably linked to a constitutive promoter, preferably to a medium strength constitutive promoter, preferably to a plant promoter, more preferably to a GOS2 promoter, most preferably to a GOS2 promoter from rice.
70. Plant, plant part thereof, including seeds, or plant cell , obtainable by a method according to any one of claims 59 to 69, wherein said plant, plant part or plant cell comprises a recombinant nucleic acid encoding an ERG28-like polypeptide as defined in any of claims 59 and 63 to 68.
71. Construct comprising:
(i) nucleic acid encoding an ERG28-like as defined in any of claims 59 and 63 to 68; (ii) one or more control sequences capable of driving expression of the nucleic acid sequence of (i); and optionally
(iii) a transcription termination sequence.
72. Construct according to claim 71 , wherein one of said control seq uences is a constitutive promoter, preferably a medium strength constitutive promoter, preferably to a plant promoter, more preferably a GOS2 promoter, most preferably a GOS2 promoter from rice.
73. Use of a construct according to claim 71 or 72 in a method for making plants having enhanced yield-related traits, and/or modified steroid composition, and/or increased or decreased steroid levels, relative to control plants.
74. Plant, plant part or plant cell transformed with a construct according to claim 71 or 72.
75. Method for the production of a transgenic plant having enhanced yield-related traits, and/or modified steroid composition, and/or increased or decreased steroid levels, relative to control plants, comprising:
(i) introducing and expressing in a plant cell or plant a nucleic acid encoding an
ERG28-like polypeptide as defined in any of claims 59 and 63 to 68; and (ii) cultivating said plant cell or plant under conditions promoting plant growth and development.
76. Transgenic plant having enhanced yield-related traits, and/or modified steroid composition, and/or increased steroid levels, relative to control plants, resulting from modulated expression of a nucleic acid encoding an ERG28-like polypeptide as defined in any of claims 59 and 63 to 68 or a transgenic plant cell derived from said transgenic plant.
77. Transgenic plant according to claim 70, 74 or 76, or a transgenic plant cell derived therefrom, wherein said plant is a crop plant, such as beet, sugarbeet or alfalfa; or a monocotyledonous plant such as sugarcane; or a cereal, such as rice, maize, wheat, barley, millet, rye, triticale, sorghum, emmer, spelt, einkorn, teff, milo or oats.
78. Harvestable parts of a plant according to claim 77, wherein said harvestable parts are preferably shoot biomass and/or seeds.
79. Products derived from a plant according to claim 77 and/or from harvestable parts of a plant according to claim 78.
80. Use of a nucleic acid encoding an ERG28-like polypeptide as defined in any of claims 59 a n d 63 to 68 for en ha nci n g yi e ld-related traits, and/or modifying steroid composition, and/or increasing or decreased steroid levels in plants relative to control plants.
PCT/IB2012/050259 2011-01-20 2012-01-19 Plants having enhanced yield-related traits and method for making the same WO2012098517A1 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
CN2012800141583A CN103429745A (en) 2011-01-20 2012-01-19 Plants having enhanced yield-related traits and method for making same
US13/980,740 US20130298289A1 (en) 2011-01-20 2012-01-19 Plants Having Enhanced Yield-Related Traits and a Method for Making the Same
CA2823287A CA2823287A1 (en) 2011-01-20 2012-01-19 Plants having enhanced yield-related traits and method for making the same
DE112012000525T DE112012000525T5 (en) 2011-01-20 2012-01-19 Plants with enhanced yield-related traits and methods for their production
BR112013018545A BR112013018545A2 (en) 2011-01-20 2012-01-19 plants with improved production-related characteristics and a method for producing them
AU2012208257A AU2012208257A1 (en) 2011-01-20 2012-01-19 Plants having enhanced yield-related traits and method for making the same
MX2013008086A MX2013008086A (en) 2011-01-20 2012-01-19 Plants having enhanced yield-related traits and method for making the same.
EP12736407.3A EP2665819A4 (en) 2011-01-20 2012-01-19 Plants having enhanced yield-related traits and method for making the same

Applications Claiming Priority (16)

Application Number Priority Date Filing Date Title
US201161434445P 2011-01-20 2011-01-20
US61/434,445 2011-01-20
EP11151485 2011-01-20
EP11151485.7 2011-01-20
US201161438673P 2011-02-02 2011-02-02
US61/438,673 2011-02-02
EP11153065 2011-02-02
EP11153065.5 2011-02-02
US201161444152P 2011-02-18 2011-02-18
EP11154998 2011-02-18
US61/444,152 2011-02-18
EP11154998.6 2011-02-18
US201161445104P 2011-02-22 2011-02-22
EP11155421.8 2011-02-22
US61/445,104 2011-02-22
EP11155421 2011-02-22

Publications (1)

Publication Number Publication Date
WO2012098517A1 true WO2012098517A1 (en) 2012-07-26

Family

ID=46515216

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2012/050259 WO2012098517A1 (en) 2011-01-20 2012-01-19 Plants having enhanced yield-related traits and method for making the same

Country Status (10)

Country Link
US (1) US20130298289A1 (en)
EP (1) EP2665819A4 (en)
CN (1) CN103429745A (en)
AR (1) AR085309A1 (en)
AU (1) AU2012208257A1 (en)
BR (1) BR112013018545A2 (en)
CA (1) CA2823287A1 (en)
DE (1) DE112012000525T5 (en)
MX (1) MX2013008086A (en)
WO (1) WO2012098517A1 (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106636180B (en) * 2016-09-18 2020-04-07 山东农业大学 Plasmid vector and method for obtaining plant highly sensitive to salt stress
CN106854652B (en) * 2017-01-21 2020-06-19 鲁东大学 Poplar PtCYP85A3 gene and application thereof
CN115873865B (en) * 2022-07-26 2024-04-12 东北农业大学 Application of soybean GmFAH1 gene in improving drought resistance of soybean

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050235382A1 (en) * 2003-04-18 2005-10-20 Jeffrey Ahrens Plant regulatory sequences for selective control of gene expression

Family Cites Families (37)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4962028A (en) 1986-07-09 1990-10-09 Dna Plant Technology Corporation Plant promotors
US4987071A (en) 1986-12-03 1991-01-22 University Patents, Inc. RNA ribozyme polymerases, dephosphorylases, restriction endoribonucleases and methods
US5004863B2 (en) 1986-12-03 2000-10-17 Agracetus Genetic engineering of cotton plants and lines
US5116742A (en) 1986-12-03 1992-05-26 University Patents, Inc. RNA ribozyme restriction endoribonucleases and methods
EP0419533A1 (en) 1988-06-01 1991-04-03 THE TEXAS A&amp;M UNIVERSITY SYSTEM Method for transforming plants via the shoot apex
AU4115693A (en) 1992-04-24 1993-11-29 Sri International In vivo homologous sequence targeting in eukaryotic cells
HUT71929A (en) 1992-06-29 1996-02-28 Gene Shears Pty Ltd Nucleic acids and methods of use thereof for controlling viral pathogens
US5401836A (en) 1992-07-16 1995-03-28 Pioneer Hi-Bre International, Inc. Brassica regulatory sequence for root-specific or root-abundant gene expression
JPH08503853A (en) 1992-11-30 1996-04-30 チューア，ナム−ハイ Expression motifs that confer tissue- and development-specific expression in plants
JPH09505461A (en) 1993-07-22 1997-06-03 ジーン シェアーズ プロプライアタリー リミティド DNA virus ribozyme
DE69434624T2 (en) 1993-11-19 2006-12-14 Biotechnology Research And Development Corp., Peoria CHIMERIC REGULATORY REGIONS AND GENE CASSETTES FOR GENE EXPRESSION IN PLANTS
NZ278490A (en) 1993-12-09 1998-03-25 Univ Jefferson Chimeric polynucleotide with both ribo- and deoxyribonucleotides in one strand and deoxyribonucleotides in a second strand
US6395547B1 (en) 1994-02-17 2002-05-28 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US5605793A (en) 1994-02-17 1997-02-25 Affymax Technologies N.V. Methods for in vitro recombination
DE19503359C1 (en) 1995-02-02 1996-02-22 Kws Kleinwanzlebener Saatzucht Plants with increased tolerance towards stress
ATE331034T1 (en) 1995-10-06 2006-07-15 Bayer Bioscience Nv SEMEN SEMINATION RESISTANCE
US7390937B2 (en) 1996-02-14 2008-06-24 The Governors Of The University Of Alberta Plants with enhanced levels of nitrogen utilization proteins in their root epidermis and uses thereof
GB9607517D0 (en) 1996-04-11 1996-06-12 Gene Shears Pty Ltd The use of DNA Sequences
GB9703146D0 (en) 1997-02-14 1997-04-02 Innes John Centre Innov Ltd Methods and means for gene silencing in transgenic plants
GB9710475D0 (en) 1997-05-21 1997-07-16 Zeneca Ltd Gene silencing
GB9720148D0 (en) 1997-09-22 1997-11-26 Innes John Centre Innov Ltd Gene silencing materials and methods
CN1202246C (en) 1998-04-08 2005-05-18 联邦科学和工业研究组织 Methods for means for obtaining modified phenotypes
US6764851B2 (en) 1998-06-26 2004-07-20 Iowa State University Research Foundation, Inc. Materials and methods for the alteration of enzyme and acetyl CoA levels in plants
US6555732B1 (en) 1998-09-14 2003-04-29 Pioneer Hi-Bred International, Inc. Rac-like genes and methods of use
AU775233B2 (en) 1999-07-22 2004-07-22 National Institute Of Agrobiological Sciences Method for superrapid transformation of monocotyledon
IL147950A0 (en) 1999-08-26 2002-08-14 Basf Plant Science Gmbh PLANT GENE EXPRESSION, CONTROLLED BY CONSTITUTIVE PLANT V-ATPase PROMOTERS
US20110131679A2 (en) * 2000-04-19 2011-06-02 Thomas La Rosa Rice Nucleic Acid Molecules and Other Molecules Associated with Plants and Uses Thereof for Plant Improvement
JP2005185101A (en) * 2002-05-30 2005-07-14 National Institute Of Agrobiological Sciences VEGETABLE FULL-LENGTH cDNA AND UTILIZATION THEREOF
EP1585820B1 (en) 2003-01-21 2007-01-03 CropDesign N.V. Use of the regulatory sequence of the rice gos2 gene for the gene expression in dicotyledonous plants or plant cells
WO2004070039A2 (en) 2003-02-04 2004-08-19 Cropdesign N.V. Rice promoters
EP2302062A1 (en) * 2003-10-20 2011-03-30 CropDesign N.V. Identification of E2F target genes and uses thereof
CN101022719B (en) 2004-09-16 2010-06-09 克罗普迪塞恩股份有限公司 Root evaluation method and device
AR052059A1 (en) 2004-12-21 2007-02-28 Bayer Cropscience Gmbh CANE SUGAR PLANTS WITH INCREASED CONTENT OF STORAGE CARBOHYDRATES
EP1820391A1 (en) 2006-02-17 2007-08-22 CropDesign N.V. Method and apparatus to determine the start of flowering in plants
US20130333068A1 (en) * 2008-04-29 2013-12-12 Marie Coffin Genes and uses for plant enhancement
EP2337441B1 (en) 2008-09-16 2016-08-10 BASF Plant Science GmbH Method for improved plant breeding
BRPI1015564B1 (en) 2009-06-25 2021-02-09 Syngenta Participations Ag production method of processed sugarcane tissue or cell derived from it

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050235382A1 (en) * 2003-04-18 2005-10-20 Jeffrey Ahrens Plant regulatory sequences for selective control of gene expression

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
AOKI K. ET AL.: "Isolation and characterization of a cDNA encoding a translin-like protein, TRAX.", FEBS LETTERS, vol. 401, 1997, pages 109 - 112, XP055096051 *
CLOUSE S.D. ET AL.: "Arabidopsis mutants reveal multiple roles for sterols in plant development.", THE PLANT CELL, vol. 14, September 2002 (2002-09-01), pages 1995 - 2000, XP055096045 *
DATABASE GENBANK [online] 21 August 2009 (2009-08-21), "Ergosterol biosynthetic protein 28 [Arabidopsis thaliana]", XP003033109, accession no. NCBI Database accession no. NP_563858.1 *
DATABASE GENBANK [online] 25 February 2009 (2009-02-25), "predicted protein [Populus trichocarpa]", XP003033108, accession no. NCBI Database accession no. XP_002314915.1 *
DATABASE GENBANK [online] 4 December 2009 (2009-12-04), "cytochrome P450 [Populus trichocarpa]", XP003033105, accession no. NCBI Database accession no. XP_002320074.1 *
DATABASE GENBANK [online] 8 June 2010 (2010-06-08), "Os06g0114700 [Oryza sativa Japonica Group]", XP003033107, accession no. NCBI Database accession no. NP_001056606.1 *
DATABASE GENBANK [online] 8 June 2010 (2010-06-08), "Os06g0129900 [Oryza sativa Japonica Group]", XP003033106, accession no. ncbi Database accession no. NP_001056685.1 *
MO C. ET AL.: "Protein-protein interactions among C-4 demethylation enzymes involved in yeast sterol biosynthesis.", PNAS, vol. 99, no. 15, 23 July 2002 (2002-07-23), pages 9739 - 9744, XP055096044 *

Also Published As

Publication number Publication date
MX2013008086A (en) 2013-10-03
US20130298289A1 (en) 2013-11-07
DE112012000525T5 (en) 2013-10-24
CA2823287A1 (en) 2012-07-26
BR112013018545A2 (en) 2019-02-05
AR085309A1 (en) 2013-09-25
EP2665819A4 (en) 2014-09-10
CN103429745A (en) 2013-12-04
AU2012208257A1 (en) 2013-08-01
EP2665819A1 (en) 2013-11-27

Similar Documents

Publication Publication Date Title
AU2011306439A1 (en) Plants having enhanced yield-related traits and method for making the same
EP2585597A1 (en) Plants with enhanced yield-related traits and producing method thereof
US20130036516A1 (en) Plants having enhanced yield-related traits and method for making the same
EP2593555A2 (en) Plants having enhanced yield-related traits and a method for making the same
US20140123344A1 (en) Plants Having Enhanced Yield-Related Traits and Method for Making the Same
EP2755465A1 (en) Plants having enhanced yield-related traits and methods for making the same
EP2547775A1 (en) Plants having enhanced yield-related traits and method for making the same
CA2852388A1 (en) Plants having enhanced yield-related traits and method for making the same
US20130298289A1 (en) Plants Having Enhanced Yield-Related Traits and a Method for Making the Same
US20140090110A1 (en) Plants having enhanced yield-related traits and method for making the same
WO2012143865A1 (en) Plants having enhanced yield-related traits and method for making the same
EP2783003A1 (en) Plants having enhanced yield-related traits and method for making the same
AU2012324507A1 (en) Plants having enhanced yield-related traits and producing methods thereof
EP2553104A1 (en) Plants having enhanced yield-related traits and method for making the same
US20140250548A1 (en) Plants Having Enhanced Yield-Related Traits and a Method for Making the Same
WO2012176115A2 (en) Plants having enhanced yield-related traits and a method for making the same

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12736407

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2823287

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: MX/A/2013/008086

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 13980740

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 1120120005252

Country of ref document: DE

Ref document number: 112012000525

Country of ref document: DE

ENP Entry into the national phase

Ref document number: 2012208257

Country of ref document: AU

Date of ref document: 20120119

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2012736407

Country of ref document: EP

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112013018545

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112013018545

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20130719