WO2012065705A1 - Novel complex mutation in the epidermal growth factor receptor kinase domain - Google Patents
Novel complex mutation in the epidermal growth factor receptor kinase domain Download PDFInfo
- Publication number
- WO2012065705A1 WO2012065705A1 PCT/EP2011/005712 EP2011005712W WO2012065705A1 WO 2012065705 A1 WO2012065705 A1 WO 2012065705A1 EP 2011005712 W EP2011005712 W EP 2011005712W WO 2012065705 A1 WO2012065705 A1 WO 2012065705A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- del
- ins
- seq
- egfr
- nucleic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Definitions
- the invention relates to cancer diagnostics and companion diagnostics for cancer therapies.
- the invention relates to the detection of mutations that are useful for diagnosis and prognosis as well as predicting the effectiveness of treatment of cancer.
- EGFR Epidermal Growth Factor Receptor
- HERl or ErbBl is a member of the type 1 tyrosine kinase family of growth factor receptors. These membrane-bound proteins possess an intracellular tyrosine kinase domain that interacts with various signaling pathways. Upon ligand binding, receptors in this family undergo dimerization and subsequent autophosphorylation of the tyrosine kinase domain.
- autophosphorylation triggers a cascade of events in intracellular signaling pathways, including the Ras/MAPK, PI3K and AKT pathways. Through these pathways, HER family proteins regulate cell proliferation, differentiation, and survival.
- cetuximab ERBITUX TM
- panitumumab VECTIBIX
- Erlotinib TARCEVA TM
- gefitinib IRESSA TM
- quinazolines useful as orally active selective inhibitors of EGFR tyrosine kinase.
- IRESSA IRESSA TM Pan- Asia Study
- NSCLC non-small cell lung cancer
- TKIs tyrosine kinase inhibitors
- TARCEVA TM quinazolines erlotinib
- IRESSA TM gefitinib
- Some mutations in the EGFR kinase domain are common, while others occur less frequently. However, it is essential that a clinical test for EGFR mutations target as many mutations as possible. This will assure that patients with rare mutations do not receive a "false negative" test result. If a rare mutation is not detected, the patient with such a mutation will not receive potentially life-saving treatment. Therefore when a new mutation in the EGFR kinase domain is discovered, detecting this mutation has the potential of affecting the clinical outcome in a patient.
- the invention is an oligonucleotide that specifically hybridizes to a nucleic acid containing a deletion of nucleotides 2237-2248 and insertion of CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1.
- the invention is a method of detecting a mutation in the epidermal growth factor receptor (EGFR) gene in a sample from a human, comprising: contacting the nucleic acid in the sample with an oligonucleotide capable of selectively hybridizing to the target EGFR nucleic acid containing a deletion of nucleotides 2237-2248 and insertion of CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1; and less efficiently to the wild- type sequence at nucleotides 2237-2250 in SEQ ID NO: 1; incubating the sample under conditions allowing hybridization of the oligonucleotide to the target nucleic acid, and detecting the hybridization.
- EGFR epidermal growth factor receptor
- the invention is a method of treating a patient having a tumor possibly harboring cells with a mutation in the epidermal growth factor receptor (EGFR) gene, comprising: obtaining results of testing for the presence of the mutated EGFR gene characterized by a deletion of nucleotides 2237-2248 and insertion of CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1 in the patient's sample; and if the results indicate that said mutated EGFR gene is present, administering to the patient a compound that inhibits signaling of the mutant EGFR protein encoded by the mutated gene.
- EGFR epidermal growth factor receptor
- the invention is a method of determining whether a treatment of a patient with a malignant tumor with tyrosine kinase inhibitors (TKIs) or EGFR inhibitors is likely to be successful, comprising: testing for the presence of the mutated EGFR gene with the deletion of nucleotides 2237-2248 and insertion of CCC together with a substitution A- >G at nucleotide 2250 in SEQ ID NO: 1; and if the mutation is found, determining that the treatment is likely to be successful.
- TKIs tyrosine kinase inhibitors
- the invention is a kit for detecting mutations in the human EGFR gene, including the mutation consisting of a deletion of nucleotides 2237-2248 and insertion of CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1, the kit comprising one or more oligonucleotides selected from SEQ ID NOs: 7-20.
- the invention is a reaction mixture for detecting mutations in the human EGFR gene, including the mutation consisting of a deletion of nucleotides 2237- 2248 and insertion of CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1, the reaction mixture comprising one or more oligonucleotides selected from SEQ ID NOs: 7-20.
- the invention is the use of oligonucleotides selected from SEQ ID NOs: 7-20 in detecting a mutation in the human EGFR gene consisting of a deletion of nucleotides 2237-2248 and insertion of CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1.
- the invention is the use of detection of the mutation in the human EGFR gene consisting of a deletion of nucleotides 2237-2248 and insertion of CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1, in diagnosis or prognosis of cancer.
- the invention is the use of detection of the mutation in the human EGFR gene consisting of a deletion of nucleotides 2237-2248 and insertion of CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1 in designing treatment of a cancer patient or predicting response of the cancer patient to the treatment.
- FIG. 1 (1A-1C) shows SEQ ID NO: 1, the cDNA sequence of wild-type EGFR and the mutant sequence as SEQ ID NO: 29.
- FIG. 2 shows SEQ ID NO: 2, the amino acid sequence of wild-type EGFR.
- FIG. 3A shows SEQ ID NO: 3, the wild- type sequence of nucleotides 2221-2260 of the EGFR gene (SEQ ID NO: 1); and SEQ ID NO: 4, the mutant sequence at the same locus.
- FIG. 3B shows SEQ ID NO: 5, the wild-type sequence of amino acids 741-753 of the EGFR protein (SEQ ID NO: 2); and SEQ ID NO: 6, the mutant sequence at the same locus.
- FIG. 4 shows the detection of the mutation E746-A750 del AP ins in a lung cancer tumor sample by allele-specific PCR.
- X[n]-Y[m] or "X[n]-Y[m] del” refers to a mutation that results in a protein lacking amino acids between positions "n” and “m” including the amino acids X and Y.
- X[n]-Y[m] del ZW ins refers to a complex mutation where the protein is lacking amino acids between positions "n” and “m” including the amino acids X and Y, but amino acids Z and W are inserted in their place.
- the term “dup” refers to a duplication of a stretch of amino acids.
- E746-A750 del refers to a mutation that results in a protein lacking amino acids 746, 747, 748, 749 and 750.
- E746-A750 del AR ins refers to a complex mutation where the protein is lacking amino acids 746, 747, 748, 749 and 750, but amino acids alanine and proline are inserted in their place.
- allele-specific primer or "AS primer” refers to a primer that hybridizes to more than one variant of the target sequence, but is capable of discriminating between the variants of the target sequence in that only with one of the variants, the primer is efficiently extended by the nucleic acid polymerase under suitable conditions. With other variants of the target sequence, the extension is less efficient, inefficient or undetectable.
- the term "common primer” refers to the second primer in the pair of primers that includes an allele-specific primer.
- the common primer is not allele-specific, i.e. does not discriminate between the variants of the target sequence between which the allele-specific primer discriminates.
- complementary or “complementarity” are used in reference to antiparallel strands of polynucleotides related by the Watson-Crick base-pairing rules.
- perfectly complementary or “100% complementary” refer to complementary sequences that have Watson-Crick pairing of all the bases between the antiparallel strands, i.e. there are no mismatches between any two bases in the polynucleotide duplex. However, duplexes are formed between antiparallel strands even in the absence of perfect complementarity.
- partially complementary or “incompletely complementary” refer to any alignment of bases between antiparallel polynucleotide strands that is less than 100% perfect (e.g., there exists at least one mismatch or unmatched base in the polynucleotide duplex).
- the duplexes between partially complementary strands are generally less stable than the duplexes between perfectly complementary strands.
- sample refers to any composition containing or presumed to contain nucleic acid.
- sample includes a sample of tissue or fluid isolated from an individual for example, skin, plasma, serum, spinal fluid, lymph fluid, synovial fluid, urine, tears, blood cells, organs and tumors, and also to samples of in vitro cultures established from cells taken from an individual, including the formalin-fixed paraffin embedded tissues (FFPET) and nucleic acids isolated therefrom.
- FFFPET formalin-fixed paraffin embedded tissues
- polynucleotide and “oligonucleotide” are used interchangeably.
- Oligonucleotide is a term sometimes used to describe a shorter polynucleotide.
- An oligonucleotide may be comprised of at least 6 nucleotides, for example at least about 10-12 nucleotides, or at least about 15-30 nucleotides corresponding to a region of the designated nucleotide sequence.
- the term "primary sequence” refers to the sequence of nucleotides in a polynucleotide or oligonucleotide. Nucleotide modifications such as nitrogenous base modifications, sugar modifications or other backbone modifications, are not a part of the primary sequence. Labels, such as chromophores conjugated to the oligonucleotides are also not a part of the primary sequence. Thus two oligonucleotides can share the same primary sequence but differ with respect to the modifications and labels.
- the term "primer” refers to an oligonucleotide which hybridizes with a sequence in the target nucleic acid and is capable of acting as a point of initiation of synthesis along a complementary strand of nucleic acid under conditions suitable for such synthesis.
- the term “probe” refers to an oligonucleotide which hybridizes with a sequence in the target nucleic acid and is usually detectably labeled.
- the probe can have modifications, such as a 3'-terminus modification that makes the probe non-extendable by nucleic acid polymerases, and one or more chromophores.
- An oligonucleotide with the same sequence may serve as a primer in one assay and a probe in a different assay.
- target sequence refers to a portion of the nucleic acid sequence which is to be either amplified, detected or both.
- hybridized and “hybridization” refer to the base-pairing interaction of between two nucleic acids that results in formation of a duplex. It is not a requirement that two nucleic acids have 100% complementarity over their full length to achieve hybridization.
- selective hybridization and “specific hybridization” refer to the hybridization of a nucleic acid predominantly (50% or more of the hybridizing molecule) or nearly exclusively (90% or more of the hybridizing molecule) to a particular nucleic acid present in a complex mixture where other nucleic acids are also present.
- primers specifically hybridize to the target nucleic acids to the exclusion of non-target nucleic acids also present in the solution.
- the specifically hybridized primers drive amplification of the target nucleic acid to produce an amplification product of the target nucleic acid that is at least the most predominant amplification product and is preferably the nearly exclusive (e.g., representing 90% or more of all amplification products in the sample) amplification product.
- the non-specific amplification product is present in such small amounts that it is either non-detectable or is detected in such small amounts as to be easily distinguishable from the specific amplification product.
- probes specifically hybridize to the target nucleic acids to the exclusion of non-target nucleic acids also present in the reaction mixture. The specifically hybridized probes allow specific detection of the target nucleic acid to generate a detectable signal that is at least the most predominant signal and is preferably the nearly exclusive (e.g., representing 90% or more of all amplification products in the sample) signal.
- the present invention describes a novel mutation in the EGFR kinase domain that is useful for cancer diagnosis and prognosis, designing a therapy regimen and predicting success of the therapy.
- nucleotide numbering used herein is in reference to SEQ ID NO:l, shown on Figure 1.
- SEQ ID NO: 1 the mutation resulting in the deletion of nucleotides A A TTA AGA GAA G (nucleotides 2237-2248 of SEQ ID NO: 1) is underlined and shown in bold.
- the insertion of CCC together with substitution A->G at nucleotide 2250 in SEQ ID NO: 1 are shown in bold italics.
- the placement of the inserted nucleotides CCC is chosen to correspond to the codons within the EGFR open reading frame.
- amino acid numbering used herein is in reference to SEQ ID NO: 2, shown on Figure 2.
- the signal sequence includes amino acids 1-24
- the extracellular domain includes amino acids 24-645
- the transmembrane domain includes amino acids 646-668
- the cytoplasmic domain includes amino acids 669-1210, of which the tyrosine kinase domain is amino acids 718-964
- the threonine phosphorylation site is amino acid 678.
- E746-A750 del AP ins in exon 19 of EGFR.
- the mutation is a combination of deletion of amino acids E746-A750 (E, L, R, E and A) caused by the deletion of nucleotides AA TTA AGA GAA G (nucleotides 2237-2248 of SEQ ID NO: 1), combined with the insertion of two amino acids: alanine and proline (A-P) caused by insertion of CCC and nucleotide change 2250 A->G.
- Figure 3A shows the fragment of the nucleotide sequence of the wild-type EGFR (SEQ ID NO: 3) and the corresponding fragment encoding the mutation E746-A750 del AP ins (SEQ ID NO: 4). The placement of the inserted nucleotides CCC is chosen to correspond to the codons within the EGFR open reading frame.
- Figure 3B shows the fragment of the amino acid sequence of the wild-type EGFR (SEQ ID NO: 5) and the corresponding fragment harboring the mutation E746-A750 del AP ins (SEQ ID NO: 6).
- the present invention comprises oligonucleotides for detecting the EGFR mutation "E746-A750 del AP ins" in a sample.
- the invention comprises oligonucleotides (SEQ ID NOs: 7-20) for use as primers to specifically detect the mutation by allele-specific PCR (Tables 1 and 2), (Allele-specific PCR has been described in U.S. Patent No. 6,627,402). Some of these allele-specific primers contain internal mismatches with both the wild-type and mutant target sequence. Additional mismatches in allele-specific PCR primers have been shown to increase selectivity of the primers, see U.S. Patent Application Publ. No. 2010/0099110.
- the allele-specific primers of the present invention are paired with a "common" i.e. not allele-specific second primer. Table 1
- the present invention comprises oligonucleotides SEQ ID NOs: 21-28 (Table 3) for use as probes to specifically detect the mutation by probe hybridization.
- the probe can hybridize to the products of real-time PCR, wherein the amplification is directed by primers flanking the mutation site.
- the probe may be labeled with a chromophore or a combination of a chromophore and a quencher. Table 3
- Probes for detecting mutation "E746-A750 del AP ins" (sense and anti-sense orientation)
- the primer For successful extension of a primer, the primer needs to have at least partial
- complementarity to the target sequence Generally, complementarity at the 3'-end of the primer is more critical than complementarity at the 5'-end of the primer, (Innis et al. Eds. PCR Protocols (1990), Academic Press, Chapter 1, pp. 9-11). This means that variations of the 5'-end, i.e. additions, substitutions or removal of nucleotides at the 5'-end, do not affect performance of the primer in a PCR assay. Therefore the present invention encompasses the primers disclosed in Tables 1 and 2 as well as the variants of these primers with 5'-end variations.
- the probe needs to have at least partial complementarity to the target sequence.
- complementarity close to the central portion of the probe is more critical than complementarity at the ends of the probe (Innis et al. Eds. (1990), Chapter 32, pp. 262-267). This means that variations of the ends of the probe, i.e. additions, substitutions or removal of a few nucleotides, do not affect
- the present invention encompasses the probes disclosed in Table 3 as well as the variants of these probes with terminal variations.
- the probe has a particular structure, including a protein-nucleic acid (PNA), a locked nucleic acid (LNA), a molecular beacon probe (Tyagi et al. (1996), Nat. Biotechnol. 3:303-308) or SCORPIONS * self-probing primers
- the invention comprises a method of detecting the mutation E746- A750 del AP ins EGFR at the nucleic acid level by detecting the deletion of nucleotides 2237-2248, and insertion of CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1, the method comprising contacting nucleic acid from the sample with a nucleic acid probe that is capable of specifically hybridizing to a nucleic acid incorporating the mutation, and directly or indirectly, detecting the hybridization event.
- the probe can be selected from Table 3.
- the probe is labeled with a radioactive, a fluorescent or a chromophore label.
- the mutation may be detected by real-time polymerase chain reaction, where hybridization of the mutation- specific probe to the mutant target results in enzymatic digestion of the mutation-specific probe and detection of the digestion products (TaqMan TM probe, Holland et al. (1991), P.N.A.S. USA 88:7276-7280).
- Hybridization between the mutation-specific probe to the mutant target may also be detected by detecting the change in fluorescence due to the nucleic acid duplex formation (U.S. App. Publ. No. 2010/0143901) or by detecting the characteristic melting temperature of the hybrid between the probe and the mutant nucleic acid (U.S. Patent No. 5,871,908).
- detection of the mutant nucleic acid is accomplished by allele-specific amplification where only the mutant template is amplified (or is amplified preferentially) due to selective hybridization of the primer to the mutant template.
- the allele-specific primers may be selected from Tables 1 and 2.
- Mutant EGFR gene or gene product can be detected in tumors or other body samples such as urine, sputum or serum.
- body samples such as urine, sputum or serum.
- the same techniques discussed above for detection of mutant EGFR genes or gene products in tumor samples can be applied to other body samples.
- cancer cells are sloughed off from tumors and appear in such body samples.
- nucleic acid detection methods are capable of detecting mutant cells in a background of non-tumor cells in a wide variety of sample types.
- the invention is a method of treating a patient having a tumor possibly harboring cells with an EGFR gene having the E746-A750 del AP ins mutation.
- the method comprises detecting the E746-A750 del AP ins mutation in the patient's sample by detecting deletion of nucleotides AA TTA AGA GAA G (nucleotides 2237-2248 of SEQ ID NO: 1), and insertion of CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1; and if the mutation is found, administering to the patient a tyrosine kinase inhibitor (TKI) or an EGFR inhibitor.
- the tyrosine kinase inhibitors are EGFR kinase inhibitors such as for example, cetuximab, panitumumab, erlotinib or gefitinib.
- the method further comprises detecting one more of the following mutations: G719A, G719C, K745-A750 del K ins, E746V, E746K, L747S, E749Q, A750P, A755V, S768I, L858P, L858R, E746-R748 del, E746-S752 del V ins, L747-E749 del, L747-A750 del P ins, L747-T751 del, L747-T751 del P ins, L747-P753 del S ins, L747-S752 del, R748-P753 del, T751-1759 del T ins, S752-I759 del, P753-K757 del, D770-N771 del NPG ins, D770-N771 del SVD ins, P772-H773 dup,
- nucleotide changes causing the mutations listed above and methods of detecting them are for example described in U.S. App. Publ. No. 2010/0297615 and U.S. Patent No. 7,294,468.
- Multiple mutations can be detected simultaneously or separately by using hybridization to multiple probes, for example in a dot-blot or nucleic acid array format, multiplex PCR, for example multiplex allele-specific PCR and multiplex PCR followed by a probe melting assay with each probe characterized by a mutation-specific melting temperature.
- Multiple mutations may also be detected by high-throughput sequencing for example, using a method involving emulsion PCR amplification of single molecules adhered to a solid support, subsequent sequencing by synthesis and bioinformatic analysis of the sequence data, such as the method developed by 454 Life Sciences, Inc. (Branford, Conn./USA).
- the invention is a method of determining whether a treatment of a patient with a malignant tumor with tyrosine kinase inhibitors (TKIs) or EGFR inhibitors is likely to be successful.
- the method comprises detecting the E746-A750 del AP ins mutation in the patient's sample by detecting deletion of nucleotides AA TTA AGA GAA G (nucleotides 2237-2248 of SEQ ID NO: 1), and insertion of CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1; and if the mutation is found, determining that the treatment is likely to be successful.
- the tyrosine kinase inhibitors are EGFR kinase inhibitors or EGFR inhibitors are, for example, cetuximab, panitumumab, erlotinib or gefitinib.
- the method further comprises detecting one more of the following mutations: G719A, G719C, K745-A750 del K ins, E746V, E746K, L747S, E749Q, A750P, A755V, S7681, L858P, L858R, E746-R748 del, E746-S752 del V ins, L747-E749 del, L747-A750 del P ins, L747-T751 del, L747-T751 del P ins, L747-P753 del S ins, L747-S752 del, R748-P753 del, T751-1759 del T ins, S752-I759 del, P753-K757 del, D770-N771 del NPG ins, D770-N771 del SVD ins, P772-H773 dup, P
- the invention is a kit containing reagents necessary for detecting the mutation E746-A750 del AP ins in the EGFR gene.
- the reagents comprise at least one oligonucleotide that specifically hybridizes to the target sequence containing the mutation E746-A750 del AP ins.
- the oligonucleotide may be a probe or an amplification primer specific for the mutated sequence but not the wildtype sequence.
- one or more allele-specific primers in the kit may be selected from Tables 1 and 2 and a probe, if present, may be selected from Table 3.
- the kit further comprises reagents necessary for the performance of amplification and detection assay, such as the components of PCR, a realtime PCR, or transcription mediated amplification (TMA).
- the mutation-specific oligonucleotide is detectably labeled.
- the kit comprises reagents for labeling and detecting the label.
- the kit may comprise a streptavidin reagent with an enzyme and its chromogenic substrate.
- the kit further includes reagents for detecting at least one more mutation in the EGFR gene, selected from the following: G719A, G719C, K745-A750 del K ins, E746V, E746K, L747S, E749Q, A750P, A755V, S7681, L858P, L858R, E746-R748 del, E746-S752 del V ins, L747-E749 del, L747-A750 del P ins, L747-T751 del, L747-T751 del P ins, L747-P753 del S ins, L747-S752 del, R748-P753 del, T751-I759 del T ins, S752-I759 del, P753-K757 del, D770-N771 del NPG ins, D770-N771 del SV
- the invention is a reaction mixture for detecting mutations in the human EGFR gene, including the mutation consisting of a deletion of nucleotides 2237- 2248 and insertion of CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1, the reaction mixture comprising one or more oligonucleotides selected from SEQ ID NOs: 7-20.
- the invention is the use of oligonucleotides selected from SEQ ID NOs: 7-20 in detecting a mutation in the human EGFR gene consisting of a deletion of nucleotides 2237-2248 and insertion of CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1.
- the invention is the use of detection of the mutation in the human EGFR gene consisting of a deletion of nucleotides 2237-2248 and insertion of CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1, in diagnosis or prognosis of cancer.
- the invention is the use of detection of the mutation in the human EGFR gene consisting of a deletion of nucleotides 2237-2248 and insertion of CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1 in designing treatment of a cancer patient or predicting response of the cancer patient to the treatment.
- a tissue sample was obtained from a lung cancer (NSCLC) patient.
- the sample was preserved as formalin-fixed, paraffin embedded tissue (FFPET).
- Nucleic acid was isolated from the sample and subjected to direct sequencing on the Genome Sequencer FLX instrument (454 Life Sciences, Branford, Conn./USA).
- the E746-A750 del AP ins mutation was detected in 20.82% of forward reads and 22% reverse reads (average 20.99% of total 8849 reads) from the sample, reflecting the fact that the sample is a mixture of tumor and non-tumor cells.
- Each 50 ⁇ 1 reaction contained 50 ng genomic DNA purified from the NSCLC FFPET sample, 50 mM Tris (pH 8.0), 2.5 mM magnesium acetate, 80 mM KCl, 0.1 mM EDTA, 160 ⁇ of each of dATP, dCTP and dGTP, 320 ⁇ dUTP, 0.2 ⁇ / ⁇ .
- UNG 200 nM Aptamer, 40 nM DNA polymerase Z05-AS1, 1.25% DMSO (v/v), 2.11% Glycerol (v/v), 0.02% Tween * 20 (v/v), 0.09% sodium azide (w/v), EGFR exon 19 deletion-specific forward primers at 0.1 - 0.2 ⁇ , a common EGFR exon 19-specific reverse primer and EGFR exon 19-specific FAM-labeled probe at 0.05 ⁇ .
- the reactions were subjected to the following temperature profile: 50°C for 5 minutes, 2 cycles of 95°C for 10 seconds and 62°C for 30 seconds, followed by 55 cycles of 93°C for 10 seconds and 62°C for 30 seconds. Fluorescence data was collected at the end of each 62°C step to generate the growth curves. Finally, the temperature was reduced to 37°C and 25°C to end the reaction.
- the data are shown on Figure 4.
- the growth curve demonstrates detection of the mutation "E746-A750 del AP ins" with allele-specific primers targeting exon 19 deletions.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A new mutation, E746-A750 del AP ins is found in exon 19 of the EGFR gene, that is often mutated in cancer. The invention comprises method of detecting the mutation, a method of prognosis and a method of predicting response to treatment based on the presence of absence of the mutation.
Description
NOVEL COMPLEX MUTATION IN THE EPIDERMAL GROWTH FACTOR
RECEPTOR KINASE DOMAIN
FIELD OF THE INVENTION
The invention relates to cancer diagnostics and companion diagnostics for cancer therapies. In particular, the invention relates to the detection of mutations that are useful for diagnosis and prognosis as well as predicting the effectiveness of treatment of cancer.
BACKGROUND OF THE INVENTION
Epidermal Growth Factor Receptor (EGFR), also known as HERl or ErbBl, is a member of the type 1 tyrosine kinase family of growth factor receptors. These membrane-bound proteins possess an intracellular tyrosine kinase domain that interacts with various signaling pathways. Upon ligand binding, receptors in this family undergo dimerization and subsequent autophosphorylation of the tyrosine kinase domain. The
autophosphorylation triggers a cascade of events in intracellular signaling pathways, including the Ras/MAPK, PI3K and AKT pathways. Through these pathways, HER family proteins regulate cell proliferation, differentiation, and survival.
A number of human malignancies are associated with aberrant expression or function of EGFR (Mendelsohn et al., (2000), "The EGF receptor family as targets for cancer therapy," Oncogene, 19:6550-6565). In particular, it has been demonstrated that some cancers harbor mutations in the EGFR kinase domain (exons 18-21). In non-small cell lung cancer (NSCLC), these mutations were shown to promote anti-apoptotic pathways in malignant cells (Pao et al. (2004), "EGF receptor gene mutations are common in lung cancers from "never smokers" and are associated with sensitivity of tumors to gefitinib and erlotinib",
P.N.A.S. 101 (36): 13306-13311; Sordella et al. (2004), "Gefitinib-sensitizing EGFR mutations in lung cancer activate anti-apoptotic pathways" , Science 305 (5687): 1163-1167).
Therapies targeting EGFR have been developed. For example, cetuximab (ERBITUX™) and panitumumab (VECTIBIX") are anti-EGFR antibodies. Erlotinib (TARCEVA™) and gefitinib (IRESSA™) are quinazolines useful as orally active selective inhibitors of EGFR tyrosine kinase. These drugs are most effective in patients whose cancers are driven by the aberrant EGFR activity. A randomized, large-scale, double-blinded study of IRESSA (IRESSA™ Pan- Asia Study (IP ASS)) compared gefitinib to the traditional chemotherapy as a first line treatment in non-small cell lung cancer (NSCLC) (Mok et al. (2009), "Gefitinib or carboplatin-paclitaxel in pulmonary adenocarcinoma", N Eng J Med 361:947-957). IPASS studied 1,217 patients with confirmed adenocarcinoma histology. The study revealed that progression-free survival (PFS) was significantly longer for IRESSA™ than chemotherapy in patients with EGFR mutation-positive tumors. The opposite was true for tumors where EGFR was not mutated: PFS was significantly longer for chemotherapy than IRESSA™. The study demonstrated that to improve a lung cancer patient's chances of successful treatment, EGFR mutations status must be known.
Analysis of clinical outcome revealed that patients with tumors harboring mutations in the kinase domain of EGFR (exons 18-21) have better response to erlotinib than those with tumors expressing wild-type EGFR (U.S. Application Publ. No. 2010/0297615, U.S. Patent No. 7,294,468). These mutations are predictive of response to tyrosine kinase inhibitors (TKIs) such as the quinazolines erlotinib (TARCEVA™) and gefitinib (IRESSA™). Among the EGFR mutations, deletion of amino acids 746-750 is especially common in lung cancer patients (see U.S. Patent No. 7,294,468 and Kosaka et al. (2004), "Mutations of the epidermal growth factor receptor gene in lung cancer, biological and clinical implications", Cancer Res. 64:8919-23), Kosaka et al. document a study involving 277 Japanese lung caner
patients. The study revealed that EGFR mutations occurred in 40% of adenocarcinomas of the lung. About one-half of the mutations (20% of patients) are deletions around amino acids 746-750. One-half of those deletions (10% of patients) are simple deletions of all five amino acids 746-750 (E-L-R-E-A residues 746-750 of SEQ ID NO: 2) "E746-A750 del". Occasionally, complex mutations, such as deletions with insertions of different amino acids were found, for example, deletion of amino acids 746-750, with the insertion of a valine ("E746-A750 del V ins") or arginine-proline ("E746-A750 del RP ins") also occur (See Kosaka et al.).
Some mutations in the EGFR kinase domain are common, while others occur less frequently. However, it is essential that a clinical test for EGFR mutations target as many mutations as possible. This will assure that patients with rare mutations do not receive a "false negative" test result. If a rare mutation is not detected, the patient with such a mutation will not receive potentially life-saving treatment. Therefore when a new mutation in the EGFR kinase domain is discovered, detecting this mutation has the potential of affecting the clinical outcome in a patient.
SUMMARY OF THE INVENTION
In one embodiment, the invention is an oligonucleotide that specifically hybridizes to a nucleic acid containing a deletion of nucleotides 2237-2248 and insertion of CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1.
In another embodiment, the invention is a method of detecting a mutation in the epidermal growth factor receptor (EGFR) gene in a sample from a human, comprising: contacting the nucleic acid in the sample with an oligonucleotide capable of selectively hybridizing to the target EGFR nucleic acid containing a deletion of nucleotides 2237-2248 and insertion of
CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1; and less efficiently to the wild- type sequence at nucleotides 2237-2250 in SEQ ID NO: 1; incubating the sample under conditions allowing hybridization of the oligonucleotide to the target nucleic acid, and detecting the hybridization.
In another embodiment, the invention is a method of treating a patient having a tumor possibly harboring cells with a mutation in the epidermal growth factor receptor (EGFR) gene, comprising: obtaining results of testing for the presence of the mutated EGFR gene characterized by a deletion of nucleotides 2237-2248 and insertion of CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1 in the patient's sample; and if the results indicate that said mutated EGFR gene is present, administering to the patient a compound that inhibits signaling of the mutant EGFR protein encoded by the mutated gene.
In another embodiment, the invention is a method of determining whether a treatment of a patient with a malignant tumor with tyrosine kinase inhibitors (TKIs) or EGFR inhibitors is likely to be successful, comprising: testing for the presence of the mutated EGFR gene with the deletion of nucleotides 2237-2248 and insertion of CCC together with a substitution A- >G at nucleotide 2250 in SEQ ID NO: 1; and if the mutation is found, determining that the treatment is likely to be successful.
In yet another embodiment, the invention is a kit for detecting mutations in the human EGFR gene, including the mutation consisting of a deletion of nucleotides 2237-2248 and insertion of CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1, the kit comprising one or more oligonucleotides selected from SEQ ID NOs: 7-20.
In yet another embodiment, the invention is a reaction mixture for detecting mutations in the human EGFR gene, including the mutation consisting of a deletion of nucleotides 2237-
2248 and insertion of CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1, the reaction mixture comprising one or more oligonucleotides selected from SEQ ID NOs: 7-20.
In yet another embodiment, the invention is the use of oligonucleotides selected from SEQ ID NOs: 7-20 in detecting a mutation in the human EGFR gene consisting of a deletion of nucleotides 2237-2248 and insertion of CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1. In a variation of this embodiment, the invention is the use of detection of the mutation in the human EGFR gene consisting of a deletion of nucleotides 2237-2248 and insertion of CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1, in diagnosis or prognosis of cancer. In a further variation of this embodiment, the invention is the use of detection of the mutation in the human EGFR gene consisting of a deletion of nucleotides 2237-2248 and insertion of CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1 in designing treatment of a cancer patient or predicting response of the cancer patient to the treatment.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 (1A-1C) shows SEQ ID NO: 1, the cDNA sequence of wild-type EGFR and the mutant sequence as SEQ ID NO: 29.
FIG. 2 shows SEQ ID NO: 2, the amino acid sequence of wild-type EGFR.
FIG. 3A shows SEQ ID NO: 3, the wild- type sequence of nucleotides 2221-2260 of the EGFR gene (SEQ ID NO: 1); and SEQ ID NO: 4, the mutant sequence at the same locus.
FIG. 3B shows SEQ ID NO: 5, the wild-type sequence of amino acids 741-753 of the EGFR protein (SEQ ID NO: 2); and SEQ ID NO: 6, the mutant sequence at the same locus.
FIG. 4 shows the detection of the mutation E746-A750 del AP ins in a lung cancer tumor sample by allele-specific PCR.
DETAILED DESCRIPTION OF THE INVENTION Definitions
To facilitate the understanding of this disclosure, the following definitions of the terms used herein are provided.
The term "X[n]-Y[m]" or "X[n]-Y[m] del" refers to a mutation that results in a protein lacking amino acids between positions "n" and "m" including the amino acids X and Y. The term "X[n]-Y[m] del ZW ins" refers to a complex mutation where the protein is lacking amino acids between positions "n" and "m" including the amino acids X and Y, but amino acids Z and W are inserted in their place. The term "dup" refers to a duplication of a stretch of amino acids. For example, the term "E746-A750 del" refers to a mutation that results in a protein lacking amino acids 746, 747, 748, 749 and 750. The term "E746-A750 del AR ins" refers to a complex mutation where the protein is lacking amino acids 746, 747, 748, 749 and 750, but amino acids alanine and proline are inserted in their place.
The term "allele-specific primer" or "AS primer" refers to a primer that hybridizes to more than one variant of the target sequence, but is capable of discriminating between the variants of the target sequence in that only with one of the variants, the primer is efficiently extended by the nucleic acid polymerase under suitable conditions. With other variants of the target sequence, the extension is less efficient, inefficient or undetectable.
The term "common primer" refers to the second primer in the pair of primers that includes an allele-specific primer. The common primer is not allele-specific, i.e. does not
discriminate between the variants of the target sequence between which the allele-specific primer discriminates.
The terms "complementary" or "complementarity" are used in reference to antiparallel strands of polynucleotides related by the Watson-Crick base-pairing rules. The terms "perfectly complementary" or "100% complementary" refer to complementary sequences that have Watson-Crick pairing of all the bases between the antiparallel strands, i.e. there are no mismatches between any two bases in the polynucleotide duplex. However, duplexes are formed between antiparallel strands even in the absence of perfect complementarity. The terms "partially complementary" or "incompletely complementary" refer to any alignment of bases between antiparallel polynucleotide strands that is less than 100% perfect (e.g., there exists at least one mismatch or unmatched base in the polynucleotide duplex). The duplexes between partially complementary strands are generally less stable than the duplexes between perfectly complementary strands.
The term "sample" refers to any composition containing or presumed to contain nucleic acid. This includes a sample of tissue or fluid isolated from an individual for example, skin, plasma, serum, spinal fluid, lymph fluid, synovial fluid, urine, tears, blood cells, organs and tumors, and also to samples of in vitro cultures established from cells taken from an individual, including the formalin-fixed paraffin embedded tissues (FFPET) and nucleic acids isolated therefrom.
The terms "polynucleotide" and "oligonucleotide" are used interchangeably.
"Oligonucleotide" is a term sometimes used to describe a shorter polynucleotide. An oligonucleotide may be comprised of at least 6 nucleotides, for example at least about 10-12 nucleotides, or at least about 15-30 nucleotides corresponding to a region of the designated nucleotide sequence.
The term "primary sequence" refers to the sequence of nucleotides in a polynucleotide or oligonucleotide. Nucleotide modifications such as nitrogenous base modifications, sugar modifications or other backbone modifications, are not a part of the primary sequence. Labels, such as chromophores conjugated to the oligonucleotides are also not a part of the primary sequence. Thus two oligonucleotides can share the same primary sequence but differ with respect to the modifications and labels.
The term "primer" refers to an oligonucleotide which hybridizes with a sequence in the target nucleic acid and is capable of acting as a point of initiation of synthesis along a complementary strand of nucleic acid under conditions suitable for such synthesis. As used herein, the term "probe" refers to an oligonucleotide which hybridizes with a sequence in the target nucleic acid and is usually detectably labeled. The probe can have modifications, such as a 3'-terminus modification that makes the probe non-extendable by nucleic acid polymerases, and one or more chromophores. An oligonucleotide with the same sequence may serve as a primer in one assay and a probe in a different assay.
As used herein, the term "target sequence", "target nucleic acid" or "target" refers to a portion of the nucleic acid sequence which is to be either amplified, detected or both.
The terms "hybridized" and "hybridization" refer to the base-pairing interaction of between two nucleic acids that results in formation of a duplex. It is not a requirement that two nucleic acids have 100% complementarity over their full length to achieve hybridization.
The terms "selective hybridization" and "specific hybridization" refer to the hybridization of a nucleic acid predominantly (50% or more of the hybridizing molecule) or nearly exclusively (90% or more of the hybridizing molecule) to a particular nucleic acid present in a complex mixture where other nucleic acids are also present. For example, under typical PCR conditions, primers specifically hybridize to the target nucleic acids to the exclusion of
non-target nucleic acids also present in the solution. The specifically hybridized primers drive amplification of the target nucleic acid to produce an amplification product of the target nucleic acid that is at least the most predominant amplification product and is preferably the nearly exclusive (e.g., representing 90% or more of all amplification products in the sample) amplification product. Preferably, the non-specific amplification product is present in such small amounts that it is either non-detectable or is detected in such small amounts as to be easily distinguishable from the specific amplification product. Similarly, probes specifically hybridize to the target nucleic acids to the exclusion of non-target nucleic acids also present in the reaction mixture. The specifically hybridized probes allow specific detection of the target nucleic acid to generate a detectable signal that is at least the most predominant signal and is preferably the nearly exclusive (e.g., representing 90% or more of all amplification products in the sample) signal.
The present invention describes a novel mutation in the EGFR kinase domain that is useful for cancer diagnosis and prognosis, designing a therapy regimen and predicting success of the therapy.
The nucleotide numbering used herein is in reference to SEQ ID NO:l, shown on Figure 1. Within SEQ ID NO: 1, the mutation resulting in the deletion of nucleotides A A TTA AGA GAA G (nucleotides 2237-2248 of SEQ ID NO: 1) is underlined and shown in bold. The insertion of CCC together with substitution A->G at nucleotide 2250 in SEQ ID NO: 1 are shown in bold italics. The placement of the inserted nucleotides CCC is chosen to correspond to the codons within the EGFR open reading frame.
The amino acid numbering used herein is in reference to SEQ ID NO: 2, shown on Figure 2. Within SEQ ID NO: 2, the signal sequence includes amino acids 1-24, the extracellular domain includes amino acids 24-645, the transmembrane domain includes amino acids
646-668, and the cytoplasmic domain includes amino acids 669-1210, of which the tyrosine kinase domain is amino acids 718-964, and the threonine phosphorylation site is amino acid 678.
The present study identified a novel complex mutation "E746-A750 del AP ins" in exon 19 of EGFR. As shown on Figure 3, the mutation is a combination of deletion of amino acids E746-A750 (E, L, R, E and A) caused by the deletion of nucleotides AA TTA AGA GAA G (nucleotides 2237-2248 of SEQ ID NO: 1), combined with the insertion of two amino acids: alanine and proline (A-P) caused by insertion of CCC and nucleotide change 2250 A->G. Figure 3A shows the fragment of the nucleotide sequence of the wild-type EGFR (SEQ ID NO: 3) and the corresponding fragment encoding the mutation E746-A750 del AP ins (SEQ ID NO: 4). The placement of the inserted nucleotides CCC is chosen to correspond to the codons within the EGFR open reading frame. Figure 3B shows the fragment of the amino acid sequence of the wild-type EGFR (SEQ ID NO: 5) and the corresponding fragment harboring the mutation E746-A750 del AP ins (SEQ ID NO: 6).
In one embodiment, the present invention comprises oligonucleotides for detecting the EGFR mutation "E746-A750 del AP ins" in a sample. In one embodiment, the invention comprises oligonucleotides (SEQ ID NOs: 7-20) for use as primers to specifically detect the mutation by allele-specific PCR (Tables 1 and 2), (Allele-specific PCR has been described in U.S. Patent No. 6,627,402). Some of these allele-specific primers contain internal mismatches with both the wild-type and mutant target sequence. Additional mismatches in allele-specific PCR primers have been shown to increase selectivity of the primers, see U.S. Patent Application Publ. No. 2010/0099110. The allele-specific primers of the present invention are paired with a "common" i.e. not allele-specific second primer.
Table 1
Allele-specific primers for detecting mutation "E746-A750 del AP ins" (sense orientation)
SEQ ID NO: 7 GTCGCTATCAAGGCCCCG
SEQ ID NO: 8 CCGTCGCTATCAAGGCCC
SEQ ID NO: 9 CCCGTCGCTATCAAGGCC
SEQ ID NO: 10 ATTCCCGTCGCTATCAAGGC
SEQ ID NO: 11 CCCGTCGCTATCAAGGTCCTGA
SEQ ID NO: 12 CCGTCGCTATCAAGGCCTCG
SEQ ID NO: 13 CCCGTCGCTATCAAGGTCC
SEQ ID NO: 14 AAATTCCCGTCGCTATCAAGGTC
Table 2
Allele-specific primers for detecting mutation "E746-A750 del AP ins" (anti-sense orientation)
In a variation of this embodiment, the present invention comprises oligonucleotides SEQ ID NOs: 21-28 (Table 3) for use as probes to specifically detect the mutation by probe hybridization. In variations of this embodiment, the probe can hybridize to the products of real-time PCR, wherein the amplification is directed by primers flanking the mutation site. For this variation, the probe may be labeled with a chromophore or a combination of a chromophore and a quencher.
Table 3
Probes for detecting mutation "E746-A750 del AP ins" (sense and anti-sense orientation)
For successful extension of a primer, the primer needs to have at least partial
complementarity to the target sequence. Generally, complementarity at the 3'-end of the primer is more critical than complementarity at the 5'-end of the primer, (Innis et al. Eds. PCR Protocols (1990), Academic Press, Chapter 1, pp. 9-11). This means that variations of the 5'-end, i.e. additions, substitutions or removal of nucleotides at the 5'-end, do not affect performance of the primer in a PCR assay. Therefore the present invention encompasses the primers disclosed in Tables 1 and 2 as well as the variants of these primers with 5'-end variations.
Similarly, for successful probe hybridization, the probe needs to have at least partial complementarity to the target sequence. Generally, complementarity close to the central portion of the probe is more critical than complementarity at the ends of the probe (Innis et al. Eds. (1990), Chapter 32, pp. 262-267). This means that variations of the ends of the probe, i.e. additions, substitutions or removal of a few nucleotides, do not affect
performance of the probe in hybridization. Therefore the present invention encompasses
the probes disclosed in Table 3 as well as the variants of these probes with terminal variations.
In other variations of this embodiment, the probe has a particular structure, including a protein-nucleic acid (PNA), a locked nucleic acid (LNA), a molecular beacon probe (Tyagi et al. (1996), Nat. Biotechnol. 3:303-308) or SCORPIONS* self-probing primers
(Whitcombe et al. (1999), Nat. Biotechnol. 8:804-807).
In one embodiment, the invention comprises a method of detecting the mutation E746- A750 del AP ins EGFR at the nucleic acid level by detecting the deletion of nucleotides 2237-2248, and insertion of CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1, the method comprising contacting nucleic acid from the sample with a nucleic acid probe that is capable of specifically hybridizing to a nucleic acid incorporating the mutation, and directly or indirectly, detecting the hybridization event. Optionally, the probe can be selected from Table 3. In a particular embodiment the probe is labeled with a radioactive, a fluorescent or a chromophore label. For example, the mutation may be detected by real-time polymerase chain reaction, where hybridization of the mutation- specific probe to the mutant target results in enzymatic digestion of the mutation-specific probe and detection of the digestion products (TaqMan™ probe, Holland et al. (1991), P.N.A.S. USA 88:7276-7280). Hybridization between the mutation-specific probe to the mutant target may also be detected by detecting the change in fluorescence due to the nucleic acid duplex formation (U.S. App. Publ. No. 2010/0143901) or by detecting the characteristic melting temperature of the hybrid between the probe and the mutant nucleic acid (U.S. Patent No. 5,871,908). In another embodiment, detection of the mutant nucleic acid is accomplished by allele-specific amplification where only the mutant template is amplified (or is amplified preferentially) due to selective hybridization of the primer to the
mutant template. Optionally, the allele-specific primers may be selected from Tables 1 and 2.
Mutant EGFR gene or gene product can be detected in tumors or other body samples such as urine, sputum or serum. The same techniques discussed above for detection of mutant EGFR genes or gene products in tumor samples can be applied to other body samples. For example, cancer cells are sloughed off from tumors and appear in such body samples. State of the art nucleic acid detection methods are capable of detecting mutant cells in a background of non-tumor cells in a wide variety of sample types.
In another embodiment, the invention is a method of treating a patient having a tumor possibly harboring cells with an EGFR gene having the E746-A750 del AP ins mutation. The method comprises detecting the E746-A750 del AP ins mutation in the patient's sample by detecting deletion of nucleotides AA TTA AGA GAA G (nucleotides 2237-2248 of SEQ ID NO: 1), and insertion of CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1; and if the mutation is found, administering to the patient a tyrosine kinase inhibitor (TKI) or an EGFR inhibitor. In variations of this embodiment, the tyrosine kinase inhibitors are EGFR kinase inhibitors such as for example, cetuximab, panitumumab, erlotinib or gefitinib.
In a variation of this embodiment, the method further comprises detecting one more of the following mutations: G719A, G719C, K745-A750 del K ins, E746V, E746K, L747S, E749Q, A750P, A755V, S768I, L858P, L858R, E746-R748 del, E746-S752 del V ins, L747-E749 del, L747-A750 del P ins, L747-T751 del, L747-T751 del P ins, L747-P753 del S ins, L747-S752 del, R748-P753 del, T751-1759 del T ins, S752-I759 del, P753-K757 del, D770-N771 del NPG ins, D770-N771 del SVD ins, P772-H773 dup, P772-H773 del V ins, M766-A767 del AI ins, S768-V769 del SVA ins, G779S, P848L, G857V, L858R, L861Q, L883S, D896Y; and if
one or more of the mutations are present, administering to the patient a compound that inhibits signaling of the mutant EGFR protein encoded by the mutated gene. The nucleotide changes causing the mutations listed above and methods of detecting them are for example described in U.S. App. Publ. No. 2010/0297615 and U.S. Patent No. 7,294,468. Multiple mutations can be detected simultaneously or separately by using hybridization to multiple probes, for example in a dot-blot or nucleic acid array format, multiplex PCR, for example multiplex allele-specific PCR and multiplex PCR followed by a probe melting assay with each probe characterized by a mutation-specific melting temperature. Multiple mutations may also be detected by high-throughput sequencing for example, using a method involving emulsion PCR amplification of single molecules adhered to a solid support, subsequent sequencing by synthesis and bioinformatic analysis of the sequence data, such as the method developed by 454 Life Sciences, Inc. (Branford, Conn./USA).
In another embodiment, the invention is a method of determining whether a treatment of a patient with a malignant tumor with tyrosine kinase inhibitors (TKIs) or EGFR inhibitors is likely to be successful. The method comprises detecting the E746-A750 del AP ins mutation in the patient's sample by detecting deletion of nucleotides AA TTA AGA GAA G (nucleotides 2237-2248 of SEQ ID NO: 1), and insertion of CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1; and if the mutation is found, determining that the treatment is likely to be successful. In variations of this embodiment, the tyrosine kinase inhibitors are EGFR kinase inhibitors or EGFR inhibitors are, for example, cetuximab, panitumumab, erlotinib or gefitinib.
In a variation of this embodiment, the method further comprises detecting one more of the following mutations: G719A, G719C, K745-A750 del K ins, E746V, E746K, L747S, E749Q, A750P, A755V, S7681, L858P, L858R, E746-R748 del, E746-S752 del V ins, L747-E749 del, L747-A750 del P ins, L747-T751 del, L747-T751 del P ins, L747-P753 del S ins, L747-S752
del, R748-P753 del, T751-1759 del T ins, S752-I759 del, P753-K757 del, D770-N771 del NPG ins, D770-N771 del SVD ins, P772-H773 dup, P772-H773 del V ins, M766-A767 del AI ins, S768-V769 del SVA ins, G779S, P848L, G857V, L858R, L861Q, L883S, D896Y; and if one or more of the mutations are present, determining that the treatment with tyrosine kinase inhibitors is likely to be successful.
In yet another embodiment, the invention is a kit containing reagents necessary for detecting the mutation E746-A750 del AP ins in the EGFR gene. The reagents comprise at least one oligonucleotide that specifically hybridizes to the target sequence containing the mutation E746-A750 del AP ins. The oligonucleotide may be a probe or an amplification primer specific for the mutated sequence but not the wildtype sequence. Optionally, one or more allele-specific primers in the kit may be selected from Tables 1 and 2 and a probe, if present, may be selected from Table 3. The kit further comprises reagents necessary for the performance of amplification and detection assay, such as the components of PCR, a realtime PCR, or transcription mediated amplification (TMA). In some embodiments, the mutation-specific oligonucleotide is detectably labeled. In such embodiments, the kit comprises reagents for labeling and detecting the label. For example, if the oligonucleotide is labeled with biotin, the kit may comprise a streptavidin reagent with an enzyme and its chromogenic substrate. In variations of this embodiment, the kit further includes reagents for detecting at least one more mutation in the EGFR gene, selected from the following: G719A, G719C, K745-A750 del K ins, E746V, E746K, L747S, E749Q, A750P, A755V, S7681, L858P, L858R, E746-R748 del, E746-S752 del V ins, L747-E749 del, L747-A750 del P ins, L747-T751 del, L747-T751 del P ins, L747-P753 del S ins, L747-S752 del, R748-P753 del, T751-I759 del T ins, S752-I759 del, P753-K757 del, D770-N771 del NPG ins, D770-N771 del SVD ins, P772-H773 dup, P772-H773 del V ins, M766-A767 del AI ins, S768-V769 del SVA ins, G779S, P848L, G857V, L858R, L861Q, L883S and D896Y.
In yet another embodiment, the invention is a reaction mixture for detecting mutations in the human EGFR gene, including the mutation consisting of a deletion of nucleotides 2237- 2248 and insertion of CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1, the reaction mixture comprising one or more oligonucleotides selected from SEQ ID NOs: 7-20.
In yet another embodiment, the invention is the use of oligonucleotides selected from SEQ ID NOs: 7-20 in detecting a mutation in the human EGFR gene consisting of a deletion of nucleotides 2237-2248 and insertion of CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1. In a variation of this embodiment, the invention is the use of detection of the mutation in the human EGFR gene consisting of a deletion of nucleotides 2237-2248 and insertion of CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1, in diagnosis or prognosis of cancer. In a further variation of this embodiment, the invention is the use of detection of the mutation in the human EGFR gene consisting of a deletion of nucleotides 2237-2248 and insertion of CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1 in designing treatment of a cancer patient or predicting response of the cancer patient to the treatment.
Example 1
Identifying mutation E746-A750 del AP ins in a lung cancer patient sample
A tissue sample was obtained from a lung cancer (NSCLC) patient. The sample was preserved as formalin-fixed, paraffin embedded tissue (FFPET). Nucleic acid was isolated from the sample and subjected to direct sequencing on the Genome Sequencer FLX instrument (454 Life Sciences, Branford, Conn./USA). The E746-A750 del AP ins mutation was detected in 20.82% of forward reads and 22% reverse reads (average 20.99% of total
8849 reads) from the sample, reflecting the fact that the sample is a mixture of tumor and non-tumor cells.
Example 2
Confirming the presence of the mutation E746-A750 del AP ins by PCR targeting EGFR Exon 19
The FFPET lung cancer sample used in the direct sequencing experiment described in Example 1, was subjected to real-time PCR that targets exon 19 deletions. Each 50μ1 reaction contained 50 ng genomic DNA purified from the NSCLC FFPET sample, 50 mM Tris (pH 8.0), 2.5 mM magnesium acetate, 80 mM KCl, 0.1 mM EDTA, 160 μΜ of each of dATP, dCTP and dGTP, 320 μΜ dUTP, 0.2 υ/μΐ. UNG, 200 nM Aptamer, 40 nM DNA polymerase Z05-AS1, 1.25% DMSO (v/v), 2.11% Glycerol (v/v), 0.02% Tween* 20 (v/v), 0.09% sodium azide (w/v), EGFR exon 19 deletion-specific forward primers at 0.1 - 0.2 μΜ, a common EGFR exon 19-specific reverse primer and EGFR exon 19-specific FAM-labeled probe at 0.05 μΜ.
The reactions were subjected to the following temperature profile: 50°C for 5 minutes, 2 cycles of 95°C for 10 seconds and 62°C for 30 seconds, followed by 55 cycles of 93°C for 10 seconds and 62°C for 30 seconds. Fluorescence data was collected at the end of each 62°C step to generate the growth curves. Finally, the temperature was reduced to 37°C and 25°C to end the reaction.
The data are shown on Figure 4. The growth curve demonstrates detection of the mutation "E746-A750 del AP ins" with allele-specific primers targeting exon 19 deletions.
Claims
1. An oligonucleotide that specifically hybridizes to a nucleic acid containing a deletion of nucleotides 2237-2248 and insertion of CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1.
2. The oligonucleotide of claim 1, selected from SEQ ID NOs: 7-28.
3. A method of detecting a mutation in the epidermal growth factor receptor (EGFR) gene in a sample from a human, comprising:
(a) contacting the nucleic acid in the sample with an oligonucleotide capable of selectively hybridizing to the target EGFR nucleic acid containing a deletion of nucleotides 2237-2248 and insertion of CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1; and less efficiendy to the wild-type sequence at nucleotides 2237-2250 in SEQ ID NO: 1;
(b) incubating the sample under conditions allowing hybridization of the
oligonucleotide to the target nucleic acid, and
(c) detecting the hybridization.
4. The method of claim 3, wherein the oligonucleotide is fluorescently labeled.
5. The method of claim 3, wherein the oligonucleotide is an allele-selective amplification primer and the hybridization results in generation of a detectable amplification product.
6. The method of claim 3, further comprising amplification of the target EGFR nucleic acid, wherein the oligonucleotide is a mutation-specific probe capable of being digested by the nucleic acid polymerase during amplification and generating a detectable signal upon digestion.
7. The method of claim 3, wherein the oligonucleotide is selected from SEQ ID NOs:
7-28.
8. A method of treating a patient having a tumor possibly harboring cells with a
mutation in the epidermal growth factor receptor (EGFR) gene, comprising:
(a) obtaining results of testing for the presence of the mutated EGFR gene
characterized by a deletion of nucleotides 2237-2248 and insertion of CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1 in the patient's sample; and if the results indicate that said mutated EGFR gene is present,
(b) administering to the patient a compound that inhibits signaling of the mutant EGFR protein encoded by the mutated gene.
9. The method of claim 8, wherein said compound is cetuximab, panitumumab,
erlotinib or gefitinib.
10. The method of claim 8, further comprising prior to step (b), testing for the presence of the mutated EGFR gene characterized by one or more of the mutations G719A, G719C, K745-A750 del K ins, E746V, E746K, L747S, E749Q, A750P, A755V, S7681, L858P, L858R, E746-R748 del, E746-S752 del V ins, L747-E749 del, L747-A750 del P ins, L747-T751 del, L747-T751 del P ins, L747-P753 del S ins, L747-S752 del, R748- P753 del, T751-1759 del T ins, S752-I759 del, P753-K757 del, D770-N771 del NPG ins, D770-N771 del SVD ins, P772-H773 dup, P772-H773 del V ins, M766-A767 del AI ins, S768-V769 del SVA ins, G779S, P848L, G857V, L858R, L861Q, L883S and D896Y; and (b) administering to the patient a compound that inhibits signaling of the mutant EGFR protein encoded by a gene with any one of the mutations.
11. A method of determining whether a treatment of a patient with a malignant tumor with tyrosine kinase inhibitors (TKIs) or EGFR inhibitors is likely to be successful, comprising:
(a) testing for the presence of the mutated EGFR gene with the deletion of
nucleotides 2237-2248 and insertion of CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1; and if the mutation is found,
(b) determining that the treatment is likely to be successful.
12. The method of claim 11, wherein said tyrosine kinase inhibitor or EGFR inhibitors is cetuximab, panitumumab, erlotinib or gefitinib.
13. The method of claim 11, comprising an additional step of detecting the presence or absence of one or more of the mutations G719A, G719C, K745-A750 del K ins, E746V, E746K, L747S, E749Q, A750P, A755V, S7681, L858P, L858R, E746-R748 del, E746-S752 del V ins, L747-E749 del, L747-A750 del P ins, L747-T751 del, L747-T751 del P ins, L747-P753 del S ins, L747-S752 del, R748-P753 del, T751-1759 del T ins, S752-I759 del, P753-K757 del, D770-N771 del NPG ins, D770-N771 del SVD ins, P772-H773 dup, P772-H773 del V ins, M766-A767 del AI ins, S768-V769 del SVA ins, G779S, P848L, G857V, L858R, L861Q, L883S, D896Y, and if at least one of the mutations is found, determining that the treatment is likely to be successful.
14. A kit for detecting mutations in the human EGFR gene, including the mutation
consisting of a deletion of nucleotides 2237-2248 and insertion of CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1, the kit comprising one or more oligonucleotides selected from SEQ ID NOs: 7-20.
15. The kit of claim 14, further comprising one or more additional oligonucleotides
selected from SEQ ID NOs: 21-28.
16. The kit of claim 14, wherein said additional oligonucleotides are labeled.
17. The kit of claim 14, further comprising nucleic acid precursors, nucleic acid
polymerase and reagents and solutions necessary to support the activity of the nucleic acid polymerase.
18. A reaction mixture for detecting mutations in the human EGFR gene, including the mutation consisting of a deletion of nucleotides 2237-2248 and insertion of CCC together with a substitution A->G at nucleotide 2250 in SEQ ID NO: 1, the reaction mixture comprising one or more oligonucleotides selected from SEQ ID NOs: 7-20.
19. The reaction mixture of claim 18, further comprising one or more additional
oligonucleotides selected from SEQ ID NOs: 21-28. The reaction mixture of claim 18, further comprising nucleic acid precursors, nucleic acid polymerase and reagents and solutions necessary to support the activity of the nucleic acid polymerase.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US41544210P | 2010-11-19 | 2010-11-19 | |
| US61/415,442 | 2010-11-19 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2012065705A1 true WO2012065705A1 (en) | 2012-05-24 |
Family
ID=45002892
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2011/005712 Ceased WO2012065705A1 (en) | 2010-11-19 | 2011-11-12 | Novel complex mutation in the epidermal growth factor receptor kinase domain |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2012065705A1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014086707A1 (en) | 2012-12-04 | 2014-06-12 | Roche Diagnostics Gmbh | Novel mutations in the epidermal growth factor receptor kinase domain |
| WO2014182521A1 (en) * | 2013-05-06 | 2014-11-13 | Medimmune, Llc | Diagnostic methods and treatments for cancer |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5871908A (en) | 1992-02-05 | 1999-02-16 | Evotec Biosystems Gmbh | Process for the determination of in vitro amplified nucleic acids |
| US6627402B2 (en) | 1992-06-17 | 2003-09-30 | City Of Hope | Method of detecting and discriminating between nucleic acid sequences |
| US7294468B2 (en) | 2004-03-31 | 2007-11-13 | The General Hospital Corporation | Method to determine responsiveness of cancer to epidermal growth factor receptor targeting treatments |
| EP2175016A1 (en) * | 2007-06-25 | 2010-04-14 | Forerunner Pharma Research Co., Ltd. | Anti-prominin-1 antibody having adcc activity or cdc activity |
| US20100143901A1 (en) | 2008-12-09 | 2010-06-10 | Roche Molecular Systems, Inc. | Nuclease-Free Real-Time Detection of Nucleic Acids |
| US20100297615A1 (en) | 2004-06-04 | 2010-11-25 | Genentech, Inc. | Egfr mutations |
| WO2011131145A1 (en) * | 2010-04-23 | 2011-10-27 | 广州益善生物技术有限公司 | Liquid chip for detecting egfr gene mutations |
-
2011
- 2011-11-12 WO PCT/EP2011/005712 patent/WO2012065705A1/en not_active Ceased
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5871908A (en) | 1992-02-05 | 1999-02-16 | Evotec Biosystems Gmbh | Process for the determination of in vitro amplified nucleic acids |
| US6627402B2 (en) | 1992-06-17 | 2003-09-30 | City Of Hope | Method of detecting and discriminating between nucleic acid sequences |
| US7294468B2 (en) | 2004-03-31 | 2007-11-13 | The General Hospital Corporation | Method to determine responsiveness of cancer to epidermal growth factor receptor targeting treatments |
| US20100297615A1 (en) | 2004-06-04 | 2010-11-25 | Genentech, Inc. | Egfr mutations |
| EP2175016A1 (en) * | 2007-06-25 | 2010-04-14 | Forerunner Pharma Research Co., Ltd. | Anti-prominin-1 antibody having adcc activity or cdc activity |
| US20100143901A1 (en) | 2008-12-09 | 2010-06-10 | Roche Molecular Systems, Inc. | Nuclease-Free Real-Time Detection of Nucleic Acids |
| WO2011131145A1 (en) * | 2010-04-23 | 2011-10-27 | 广州益善生物技术有限公司 | Liquid chip for detecting egfr gene mutations |
Non-Patent Citations (18)
| Title |
|---|
| A F GAZDAR: "Activating and resistance mutations of EGFR in non-small-cell lung cancer: role in clinical response to EGFR tyrosine kinase inhibitors", ONCOGENE, vol. 28, 1 August 2009 (2009-08-01), pages S24 - S31, XP055018935, ISSN: 0950-9232, DOI: 10.1038/onc.2009.198 * |
| DATABASE Geneseq [Online] 29 October 2009 (2009-10-29), "EGFR siRNA SEQ ID NO:7295.", XP002669147, retrieved from EBI accession no. GSN:AXD46905 Database accession no. AXD46905 * |
| INNIS ET AL.: "PCR Protocols", 1990, ACADEMIC PRESS, pages: 9 - 11 |
| JANNE P A ET AL: "Epidermal growth factor receptor mutations in non-small-cell lung cancer: Implications for treatment and tumor biology", JOURNAL OF CLINICAL ONCOLOGY, AMERICAN SOCIETY OF CLINICAL ONCOLOGY, US, vol. 23, no. 14, 1 January 2005 (2005-01-01), pages 3227 - 3234, XP009104856, ISSN: 0732-183X, DOI: 10.1200/JCO.2005.09.985 * |
| K. HOSHI ET AL: "Rapid Detection of Epidermal Growth Factor Receptor Mutations in Lung Cancer by the SMart-Amplification Process", CLINICAL CANCER RESEARCH, vol. 13, no. 17, 1 September 2007 (2007-09-01), pages 4974 - 4983, XP055018866, ISSN: 1078-0432, DOI: 10.1158/1078-0432.CCR-07-0509 * |
| KOSAKA ET AL., 277 JAPANESE LUNG CANER |
| KOSAKA ET AL.: "Mutations of the epidermal growth factor receptor gene in lung cancer, biological and clinical implications", CANCER RES., vol. 64, 2004, pages 8919 - 23, XP002369912, DOI: doi:10.1158/0008-5472.CAN-04-2818 |
| KOSAKA TAKAYUKI ET AL: "Mutations of the epidermal growth factor receptor gene in lung cancer: biological and clinical implications", CANCER RESEARCH, AMERICAN ASSOCIATION FOR CANCER RESEARCH, US, vol. 64, no. 24, 15 December 2004 (2004-12-15), pages 8919 - 8923, XP002369912, ISSN: 0008-5472, DOI: 10.1158/0008-5472.CAN-04-2818 * |
| L. V. SEQUIST ET AL: "First-Line Gefitinib in Patients With Advanced Non-Small-Cell Lung Cancer Harboring Somatic EGFR Mutations", JOURNAL OF CLINICAL ONCOLOGY, vol. 26, no. 15, 20 May 2008 (2008-05-20), pages 2442 - 2449, XP055018867, ISSN: 0732-183X, DOI: 10.1200/JCO.2007.14.8494 * |
| L. V. SEQUIST ET AL: "First-Line Gefitinib in Patients With Advanced Non-Small-Cell Lung Cancer Harboring Somatic EGFR Mutations: online supplementary material", JOURNAL OF CLINICAL ONCOLOGY, 20 May 2008 (2008-05-20), XP055018873, Retrieved from the Internet <URL:http://jco.ascopubs.org/content/26/15/2442.full.pdf+html> [retrieved on 20120209] * |
| MENDELSOHN ET AL.: "The EGF receptor family as targets for cancer therapy", ONCOGENE, vol. 19, 2000, pages 6550 - 6565, XP001010397, DOI: doi:10.1038/sj.onc.1204082 |
| MOK ET AL.: "Gefitinib or carboplatin-paclitaxel in pulmonary adenocarcinoma", N ENG J MED, vol. 361, 2009, pages 947 - 957, XP055073586, DOI: doi:10.1056/NEJMoa0810699 |
| PAO ET AL.: "EGF receptor gene mutations are common in lung cancers from ''never smokers'' and are associated with sensitivity of tumors to gefitinib and erlotinib", P.N.A.S., vol. 101, no. 36, 2004, pages 13306 - 13311, XP002334314, DOI: doi:10.1073/pnas.0405220101 |
| PETERSON MICHAEL R ET AL: "Terminal respiratory unit type lung adenocarcinoma is associated with distinctive EGFR immunoreactivity and EGFR mutations", APPLIED IMMUNOHISTOCHEMISTRY & MOLECULAR MORPHOLOGY, vol. 15, no. 3, September 2007 (2007-09-01), pages 242 - 247, XP009156443, ISSN: 1062-3345 * |
| SORDELLA ET AL.: "Gefitinib-sensitizing EGFR mutations in lung cancer activate anti-apoptotic pathways", SCIENCE, vol. 305, no. 5687, 2004, pages 1163 - 1167, XP002447438, DOI: doi:10.1126/science.1101637 |
| TAQMAN- PROBE, HOLLAND ET AL., P.N.A.S. USA, vol. 88, 1991, pages 7276 - 7280 |
| TYAGI ET AL., NAT. BIOTECHNOL., vol. 3, 1996, pages 303 - 308 |
| WHITCOMBE ET AL., NAT. BIOTECHNOL., vol. 8, 1999, pages 804 - 807 |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014086707A1 (en) | 2012-12-04 | 2014-06-12 | Roche Diagnostics Gmbh | Novel mutations in the epidermal growth factor receptor kinase domain |
| WO2014182521A1 (en) * | 2013-05-06 | 2014-11-13 | Medimmune, Llc | Diagnostic methods and treatments for cancer |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10968487B2 (en) | Oligonucleotides and methods for detecting KRAS and PIK3CA mutations | |
| US20080286785A1 (en) | Method to predict or monitor the response of a patient to an erbb receptor drug | |
| US20120164641A1 (en) | Methods and Compositions for Detecting Mutation in the Human Epidermal Growth Factor Receptor Gene | |
| CA2854659C (en) | Novel complex mutations in the epidermal growth factor receptor kinase domain | |
| WO2012065705A1 (en) | Novel complex mutation in the epidermal growth factor receptor kinase domain | |
| US20140341884A1 (en) | Novel Complex Mutations in the Epidermal Growth Factor Receptor Kinase Domain | |
| JP6694429B2 (en) | Mutations in the epidermal growth factor receptor kinase domain |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 11785591 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 11785591 Country of ref document: EP Kind code of ref document: A1 |
