WO2012009703A2 - Targeted nanoparticles for cancer and other disorders - Google Patents
Targeted nanoparticles for cancer and other disorders Download PDFInfo
- Publication number
- WO2012009703A2 WO2012009703A2 PCT/US2011/044288 US2011044288W WO2012009703A2 WO 2012009703 A2 WO2012009703 A2 WO 2012009703A2 US 2011044288 W US2011044288 W US 2011044288W WO 2012009703 A2 WO2012009703 A2 WO 2012009703A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- therapeutic
- tumor
- cancer
- plasmid
- rexin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/19—Cytokines; Lymphokines; Interferons
- A61K38/193—Colony stimulating factors [CSF]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/19—Cytokines; Lymphokines; Interferons
- A61K38/20—Interleukins [IL]
- A61K38/2013—IL-2
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/45—Transferases (2)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/33—Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/13011—Gammaretrovirus, e.g. murine leukeamia virus
- C12N2740/13022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/13011—Gammaretrovirus, e.g. murine leukeamia virus
- C12N2740/13041—Use of virus, viral particle or viral elements as a vector
- C12N2740/13043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/13011—Gammaretrovirus, e.g. murine leukeamia virus
- C12N2740/13071—Demonstrated in vivo effect
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2810/00—Vectors comprising a targeting moiety
- C12N2810/50—Vectors comprising as targeting moiety peptide derived from defined protein
- C12N2810/80—Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates
- C12N2810/85—Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates mammalian
- C12N2810/857—Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates mammalian from blood coagulation or fibrinolysis factors
Definitions
- the present disclosure relates generally to methods and compositions for treating cancer. Further, the disclosure relates to methods and systems for administering therapeutically effective vectors.
- Cancerous growths including malignant cancerous growths, possess unique characteristics such as uncontrollable cell proliferation resulting in, for example, unregulated growth of malignant tissue, an ability to invade local and even remote tissues, lack of differentiation, lack of detectable symptoms and most significantly, the lack of effective therapy and prevention.
- Cancer can develop in any tissue of any organ at any age.
- the etiology of cancer is not clearly defined but mechanisms such as genetic susceptibility, chromosome breakage disorders, viruses, environmental factors and immunologic disorders have all been linked to a malignant cell growth and transformation.
- Cancer encompasses a large category of medical conditions, affecting millions of individuals worldwide. Cancer cells can arise in almost any organ and/or tissue of the body. Worldwide, more than 10 million people are diagnosed with cancer every year and it is estimated that this number will grow to 15 million new cases every year by 2020. Cancer causes six million deaths every year or 12% of the deaths worldwide.
- This disclosure relates to the administration of targeted viral-based and non- viral particles, including retroviral-based vector particles, adenoviral vector particles, adeno-associated virus vector particles, Herpes Virus vector particles, and pseudotyped viruses such as with the vesicular stomatitis virus G-protein (VSV-G), and to non-viral vectors that contain a viral protein as part of a virosome or other proteo liposomal gene transfer vector.
- retroviral-based expression systems for the generation of targeted therapeutic retroviral particles, the use of transiently transfected human producer cells to produce the particles, a manufacturing process for large scale production of the viral particles, and methods for collecting and storing targeted delivery vectors.
- the targeted therapeutic retroviral particles for the treatment of cancer and other disorders, including to halt tumor progression and control tumor growth, to induce remission, to enable surgical resection or to prevent recurrence of the cancer or other disorder.
- the methods described herein are especially useful in cancers or other disorders that are resistant to traditional therapies, e.g. resistant to chemotherapy, antibody-based therapies or other standard therapies.
- a method for treating cancer in a subject in need thereof with a targeted therapeutic retroviral particle comprising
- a first therapeutic course of at least 1 x 10 11 cfu of a targeted therapeutic retroviral particle administering via hepatic arterial infusion a second therapeutic course of at least 1 x 10 11 cfu of a targeted therapeutic retroviral particle to the subject; and monitoring the subject for improvement of cancer symptoms.
- the method further comprises a third therapeutic course of at least 1 x 10 12 cfu of targeted therapeutic retroviral particles following administration via hepatic arterial infusion of a second therapeutic course of at least 1 x 10 11 cfu of a targeted therapeutic retroviral particle to the subject.
- the first and/or second therapeutic course comprises treatment with the targeted therapeutic retroviral particles for at least three days. In other embodiments, the first and/or second therapeutic course comprises treatment with the targeted therapeutic retroviral particle for at least five days. In yet other embodiments, the first and/or second therapeutic course comprises treatment with the targeted therapeutic retroviral particles for at least one week. In still other embodiments, the first and/or second therapeutic course comprises treatment with the targeted therapeutic retroviral particles for at least two weeks. In yet another embodiment, the first and/or second therapeutic course comprises treatment with the targeted therapeutic retroviral particles for at least three weeks.
- the first therapeutic course comprises treatment with the targeted therapeutic retroviral particles for at least one week, followed by the second therapeutic course with the targeted therapeutic retroviral particle for at least three days.
- the first therapeutic course comprises treatment with the targeted therapeutic retroviral particles for at least one week, followed by the second therapeutic course with the targeted therapeutic retroviral particle for at least one week.
- the first therapeutic course comprises treatment with the targeted therapeutic retroviral particles for at least two weeks, followed by the second therapeutic course with the targeted therapeutic retroviral particle for at least one week.
- the first and/or second therapeutic course is administered intravenously.
- the first and/or second therapeutic course is administered via intra-arterial infusion, including but not limited to infusion through the hepatic artery, cerebral artery, coronary artery, pulmonary artery, iliac artery, celiac trunk, gastric artery, splenic artery, renal artery, gonadal artery, subclavian artery, vertebral artery, axilary artery, brachial artery, radial artery, ulnar artery, carotid artery, femoral artery, inferior mesenteric artery and/or superior mesenteric artery.
- Intra-arterial infusion may be accomplished using endovascular procedures, percutaneous procedures or open surgical approaches.
- the first and second therapeutic course may be administered sequentially.
- the first and second therapeutic course may be administered simultaneously.
- the optional third therapeutic course may be administered sequentially or simultaneously with the first and second therapeutic courses.
- the subject is allowed to rest 1 to 2 days between the first therapeutic course and second therapeutic course. In some embodiments, the subject is allowed to rest 2 to 4 days between the first therapeutic course and second therapeutic course. In other embodiments, the subject is allowed to rest at least 2 days between the first and second therapeutic course. In yet other embodiments, the subject is allowed to rest at least 4 days between the first and second therapeutic course. In still other embodiments, the subject is allowed to rest at least 6 days between the first and second therapeutic course. In some embodiments, the subject is allowed to rest at least 1 week between the first and second therapeutic course. In yet other embodiments, the subject is allowed to rest at least 2 weeks between the first and second therapeutic course.
- the subject is allowed to rest at least one month between the first and second therapeutic course. In some embodiments, the subject is allowed to rest at least 1-7 days between the second therapeutic course and the optional third therapeutic course. In yet other embodiments, the subject is allowed to rest at least 1-2 weeks between the second therapeutic course and the optional third therapeutic course.
- the first and/or second therapeutic course comprises administration of the targeted therapeutic retroviral particles topically, intravenously, intra- arterially, intracolonically, intratracheally, intraperitoneally, intranasally, intravascularly, intrathecally, intracranially, intramarrowly, intrapleurally, intradermally, subcutaneously, intramuscularly, intraocular ly, intraosseously and/or intrasynovially.
- the first and/or second therapeutic course comprises administration of the targeted therapeutic retroviral particles intravenously.
- the first and/or second therapeutic course comprises administration via intra-arterial infusion.
- the optional third therapeutic course may be administered topically, intravenously, intra-arterially, intracolonically, intratracheally, intraperitoneally, intranasally, intravascularly, intrathecally, intracranially, intramarrowly, intrapleurally, intradermally, subcutaneously, intramuscularly, intraocular ly, intraosseously and/or intrasynovially.
- the cancer being treated is selected from the group consisting of breast cancer, skin cancer, bone cancer, prostate cancer, liver cancer, lung cancer, brain cancer, cancer of the larynx, gall bladder, pancreas, rectum, parathyroid, thyroid, adrenal, neural tissue, head and neck, colon, stomach, bronchi, kidneys, basal cell carcinoma, squamous cell carcinoma of both ulcerating and papillary type, metastatic skin carcinoma, melanoma, osteosarcoma, Ewing's sarcoma, veticulum cell sarcoma, myeloma, giant cell tumor, small-cell lung tumor, gallstones, islet cell tumor, primary brain tumor, acute and chronic lymphocytic and granulocytic tumors, hairy-cell tumor, adenoma, hyperplasia, medullary carcinoma, pheochromocytoma, mucosal neuromas, intestinal ganglioneuromas, hyperplastic corneal nerve tumor, marfanoid
- the cancer being treated is pancreatic cancer, liver cancer, breast cancer, osteosarcoma, lung cancer, soft tissue sarcoma, cancer of the larynx, melanoma, ovarian cancer, brain cancer, Ewing's sarcoma or colon cancer.
- the targeted therapeutic retroviral particle accumulates in the subject in areas of exposed collagen.
- the areas of exposed collagen include neoplastic lesions, areas of active angiogenesis, neoplastic lesions, areas of vascular injury, surgical sites, inflammatory sites and areas of tissue destruction.
- the targeted therapeutic retroviral particle is a retroviral vector having an envelope protein modified to contain a collagen binding domain, and encodes a therapeutic agent against the cancer.
- the retroviral vector is amphotropic.
- the therapeutic agent is a cyclin Gl mutant.
- the therapeutic agent is an N-terminal deletion mutant of cyclin Gl .
- the N-terminal deletion mutant of cyclin Gl comprises from about amino acid 41 to 249 of human cyclin Gl .
- the therapeutic agent is interleukin-2 (IL-2).
- the therapeutic agent is granulocyte macrophage-colony stimulating factor (GM-CSF).
- the therapeutic agent is thymidine kinase.
- a method for producing a targeted therapeutic retroviral particle includes transiently transfecting a producer cell with 1) a first plasmid comprising a nucleic acid sequence encoding the 4070A amphotropic envelope protein modified to contain a collagen binding domain; 2) a second plasmid comprising i) a nucleic acid sequence operably linked to a promoter, wherein the sequence encodes a viral gag-pol polypeptide; ii) a nucleic acid sequence operably linked to a promoter, wherein the sequence encodes a polypeptide that confers drug resistance on the producer cell; and iii) an SV40 origin of replication; 3) a third plasmid comprising i) a heterologous nucleic acid sequence operably linked to a promoter, wherein the sequence encodes a diagnostic or therapeutic polypeptide; ii) 5 ' and 3' long terminal repeat sequences; iii) a ⁇ retroviral packaging sequence;
- the collected particles generally exhibit a viral titer of about 1 x 10 7 to 1 x 10 12 , 1 x 10 8 to 1 x 10 11 , 1 x 10 9 to 1 x 10 11 , 5 x 10 8 to 5x 10 10 , or 1 x 10 9 to 5x 10 11 , at least 5 xlO 8 , 1 xlO 9 , 5xl0 9 , 1 xlO 10 , 5xl0 10 , lxlO 11 , lxlO 12 , lxl0 13 or lxlO 14 colony forming units per milliliter.
- the viral particles are generally about 10 nm to 1000 nm, 20 nm to 500 nm, 50 nm to 300 nm, 50 nm to 200 nm, or 50 nm to 150 nm in diameter.
- the first plasmid is the Bvl/pCAEP plasmid. In another embodiment, the first plasmid is an pB-RVE plasmid. In some embodiments, the second plasmid is the pCgpn plasmid. In one embodiment, the third plasmid is derived from the GlXSvNa plasmid. In yet another embodiment, the third plasmid is the pdnGl/C-REX plasmid. In still another embodiment, the third plasmid is the pdnGl/C-REX II plasmid. In yet another embodiment, the third plasmid is the pdnGl/UBER-REX plasmid.
- the targeted therapeutic retroviral particle comprises a collagen binding domain comprising a peptide derived from the D2 domain of von
- the von WiUebrand factor is bovine von WiUebrand factor.
- the peptide comprises the amino acid sequence Gly-His- Val-Gly-Trp-Arg-Glu-Pro-Ser-Phe Met- Ala-Leu- Ser- Ala- Ala (SEQ ID NO: l).
- the peptide comprises the amino acid sequence Gly-His-Val-Gly-Trp- Arg-Glu-Pro-Ser-Phe-Met-Ala-Lys-Ser-Ala-Ala (SEQ ID NO:2).
- the peptide is contained in the gp70 portion of the 4070A amphotropic envelope protein.
- the methods above further comprise administering to the subject a chemotherapeutic agent, a biologic agent, or radiotherapy prior to,
- At least one of an abdominal CT scan, MRI, abdominal ultrasound, CBC, platelet count, Chem panel (BUN, Creatinine, AST, ALT, Alk Phos, Bilirubin), electrolytes, PT or PTT measurements is monitored in the subject for
- tumor lesion(s) is monitored for improvement of cancer symptoms.
- the tumor lesion(s) is measured by calipers or by radiologic imaging.
- the radiologic imaging is MRI, CT, PET, or SPECT scan.
- the methods provided further comprise a third therapeutic course of at least 1 x 10 11 cfu of targeted therapeutic retroviral particles following step b).
- Targeted therapeutic retroviral particles disclosed herein generally contain nucleic acid sequences encoding diagnostic or therapeutic polypeptides.
- exemplary therapeutic proteins and polypeptides of the invention include, but are in no way limited to, those of the classes of suicidal proteins, apoptosis-inducing proteins, cytokines, interleukins, and TNF family proteins.
- exemplary diagnostic proteins or peptides include for example, a green fluorescent protein and luciferase.
- a plasmid including a multiple cloning site including a multiple cloning site
- plasmids include pC-REX II, pC-REX and pUBER-REX.
- Additional derivatives of the exemplary include those that contain a heterologous nucleic acid sequence encoding a therapeutic or diagnostic polypeptide.
- kits for treating cancer includes a container containing a viral particle produced by a method described herein in a
- the administration can be according to the exemplary treatment protocol provided herein.
- a method for conducting a gene therapy business includes generating targeted therapeutic retroviral particles and establishing a bank of the same by harvesting and suspending the therapeutic retroviral particles in a solution of suitable medium and storing the suspension.
- the method further includes providing the particles, and instructions for use of the particles, to a physician or health care provider for administration to a subject (patient) in need thereof.
- Such instructions for use of the particles can include the exemplary treatment regimen provided in Table 1.
- the method optionally includes billing the patient or the patient's insurance provider.
- kits disclosed herein to a physician or health care provider.
- the subject is a mammal, preferably a human.
- the therapeutic retroviral particles are inventive viral vectors disclosed here, such as viral vectors which are retroviral (preferably amphotropic) vectors having an envelope protein modified to contain a collagen binding domain, and encodes a therapeutic agent (such a cytocidal mutant of cyclin Gl) against the cancer.
- viral vectors which are retroviral (preferably amphotropic) vectors having an envelope protein modified to contain a collagen binding domain, and encodes a therapeutic agent (such a cytocidal mutant of cyclin Gl) against the cancer.
- the method may further include the following step: administering to the subject a chemotherapeutic agent, a biologic agent, or radiotherapy prior to, contemporaneously with, or subsequent to the administration of the therapeutic retroviral particles.
- Figure 1 A depicts a representative MRI from Patient #1 one day after completion of treatment cycle #1 showing a large round recurrent tumor (T; bracketed area) in the region of the pancreas within the area of the surgical bed and an enlarged para-aortic lymph node (N) indicating metastasis.
- T round recurrent tumor
- N para-aortic lymph node
- Figure IB depicts a follow-up MRI from Patient #1 four days after completion of treatment cycle #2 showing an irregularity in the shape of the recurrent tumor (T; bracketed area) with a large area of central necrosis (nec) involving 40-50% of the tumor mass, and a significant decrease in the size of the para-aortic lymph node metastasis (N).
- Figure 1C is a graph showing that REXIN-G induces a reduction in CA19-9 serum level in Patient #1. Serum CA19-9 levels (U/ml), plotted on the vertical axis, are expressed as a function of time (date), plotted on the horizontal axis. The start of each treatment cycle is indicated by arrows.
- Figure 2A provides a representative abdominal CT scan from Patient #2 obtained at the beginning of treatment cycle #1 revealing a 6.0 cm3 mass in the region of the pancreatic head (T) encroaching on the superior mesenteric vein (SMV) and the superior mesenteric artery (SMA).
- T pancreatic head
- SMV superior mesenteric vein
- SMA superior mesenteric artery
- Figure 2B provides a follow-up abdominal CT scan from Patient #2 two days after completion of treatment cycle #2, revealing that the pancreatic tumor mass (T) has decreased in size and regressed away from the superior mesenteric vessels (SMV and SMA). The start of each treatment cycle is indicated by arrows.
- Figure 2C is a graph showing that REXIN-G arrests primary tumor growth in
- Tumor volume (cm 3 ) derived by using the formula: width 2 x length x 0.52 (O'Reilly et al. Cell 88, 277, 1997), and plotted on the vertical axis, is expressed as a function of time, plotted on the horizontal axis. The start of each treatment cycle is indicated by arrows.
- Figure 3A depicts data indicating REXIN-G plus gemcitabine induces tumor regression in Patient #3 with metastatic pancreatic cancer.
- Tumor volumes (cm 3 ) of primary tumor is plotted on the Y axis and are expressed as a function of time, date.
- the start of REXIN-G infusions is indicated by arrows.
- Figure 3B depicts data indicating REXIN-G plus gemcitabine induces tumor regression in Patient #3 with metastatic pancreatic cancer.
- Tumor volume of portal node is plotted on the Y axis and are expressed as a function of time, date.
- the start of REXIN-G infusions is indicated by arrows.
- Figure 3C depicts data indicating REXIN-G plus gemcitabine induces tumor regression in Patient #3 with metastatic pancreatic cancer.
- the number of liver nodules is plotted on the Y axis, are expressed as a function of time, date.
- the start of REXIN-G infusions is indicated by arrows.
- Figure 4A the systolic blood pressure, expressed as mm Hg, plotted on the vertical axis, while time of REXIN-G infusion is plotted on the horizontal axis, for patient #1.
- REXIN-G infusion is plotted on the horizontal axis, for patient #1.
- Figure 4C respiratory rate per minute are plotted on the vertical axis, while time of REXIN-G infusion is plotted on the horizontal axis, for patient #1.
- Figure 5A depicts data indicating the hemoglobin (gms%), white blood count and platelet count for patient #1 plotted on the Y axis and expressed as a function of treatment days, plotted on the X axis.
- Figure 5B depicts data indicating that REXIN-G has no adverse effects on for patient #1 liver function.
- AST U/L
- ALT U/L
- bilirubin mg %
- Figure 5C depicts patient #1 Blood urea nitrogen (mg %), creatinine (mg %) and potassium (mmol/L) levels, plotted on the Y axis, expressed as a function of treatment days, plotted on the X axis.
- Dose Level I (4.5 x 10 9 cfu/dose) was given for 6 consecutive days, rest period for two days, followed by Dose Level II (9 x 10 9 cfu/dose) for 2 days, and then Dose Level III (1.4 x 10 10 cfu/dose) for 2 days.
- Figure 6 provides data indicating that dose escalation of REXIN-G has no adverse effects on Patient #2's hemodynamic functions.
- the systolic blood pressure (mm Hg), pulse rate/min, and respiratory rate/per minute are plotted on the vertical axis as a function of time of infusion, plotted on the horizontal axis.
- Figure 7A depicts hemoglobin (gms%), white blood count and platelet count for patient #2 plotted on the Y axis and expressed as a function of treatment days, plotted on the X axis.
- Figure 7B depicts data indicating that REXIN-G has no adverse effects on for patient #2 liver function.
- AST U/L
- ALT U/L
- bilirubin mg %
- Figure 7C depicts blood urea nitrogen (mg %), creatinine (mg %) and potassium (mmol/L) levels for patient #2, plotted on the Y axis expressed as a function of treatment days, plotted on the X axis.
- Dose Level I (4.5 x 10 9 cfu/dose) was given for 5 consecutive days, followed by Dose Level II (9 x 10 9 cfu/dose) for 3 days, and then Dose Level III (1.4 x 10 9 cfu/dose) for 2 days.
- Figure 8A depicts hemoglobin (gms%), white blood count and platelet count for patient #3 plotted on the Y axis and expressed as a function of treatment days, plotted on the X axis.
- Figure 8B depicts data indicating that REXIN-G has no adverse effects on for patient #3 liver function.
- AST U/L
- ALT U/L
- bilirubin mg %
- Figure 8C depicts data indicating that REXIN-G has no adverse effects on for patient #3 kidney function.
- Blood urea nitrogen (mg %), creatinine (mg %) and potassium (mmol/L) levels plotted on the Y axis, are expressed as a function of treatment days, plotted on the X axis.
- Dose Level I (4.5 x 10 9 cfu/dose) was given for 6 consecutive days.
- Figure 9 depicts size measurements of REXIN-G nanoparticles. Using a
- Precision Detector Instrument (Franklin, MA 02038 U.S.A.), the vector samples were analyzed using Dynamic Light Scattering (DLS) in Batch Mode for determining molecular size as the hydrodynamic radius (rh). Precision Deconvolve software was used to mathematically determine the various size populations from the DLS data.
- the average particle size of 3 REXIN-G clinical lots are 95, 105 and 95 nm respectively with no detectable viral aggregation.
- Figure 10 depicts the High Infectious Titer (HIT) version of the GTI expression vector GlnXSvNa.
- the pRV109 plasmid provides the strong CMV promoter.
- the resulting pREX expression vector has an SV40 ori for episomal replication and plasmid rescue in producer cell lines expressing the SV40 large T antigen (293T), an ampicillin resistance gene for selection and maintenance in E. coli, and a neomycin resistance gene driven by the SV40 e.p. to determine vector titer.
- the gene of interest is initially cloned as a PCR product with Not I and Sal I overhangs.
- the amplified fragments are verified by DNA sequence analysis and inserted into the retroviral expression vector pREX by cloning the respective fragment into pGlXsvNa (Gene Therapy Inc.), then excising the Kpn I fragment of this plasmid followed by ligation with a linearized (Kpn I-digested) pRV109 plasmid to yield the respective HIT / pREX vector.
- Figure 11 depicts a map of pC-REX II (i.e., EPEIUS-REX) plasmid.
- Figure 12 depicts a map of the novel pC-REX II (i.e., EPEIUS-REX) plasmid with the therapeutic cytokine gene IL-2 inserted.
- EPEIUS-REX novel pC-REX II
- Figure 13 depicts a map of the novel pC-REX II (i.e., EPEIUS-REX) plasmid with the therapeutic cytokine gene GM-CSF inserted.
- EPEIUS-REX novel pC-REX II
- Figure 14A depicts a map of the novel pB-RVE plasmid, an enhanced CMV expression plasmid bearing a targeted retroviral vector envelope construct (Epeius-BVl): a minimal amphotropic env (4070A) modified by the addition of a unique restriction site near the N-terminus of the mature protein (CAE-P); engineered to exhibit a collagen-binding motif (GHVGWREPSFMALS AA) (SEQ ID NO: l); and re-generated by PCR to eliminate all upstream (5') and downstream (3') viral sequences.
- Epeius-BVl a minimal amphotropic env (4070A) modified by the addition of a unique restriction site near the N-terminus of the mature protein (CAE-P); engineered to exhibit a collagen-binding motif (GHVGWREPSFMALS AA) (SEQ ID NO: l); and re-generated by PCR to eliminate all upstream (5') and downstream (3') viral sequences.
- the plasmid backbone (phCMVl) provides an optimized CMV prompter/enhancer/intron to drive the expression of env, in addition to an SV40 promoter/enhancer, which enables episomal replication in vector producer cells expressing the SV40 large T antigen (293T). Positive selection is provided by the kanamycin resistance gene.
- Figure 14B depicts a restriction digest of pB-RVE.
- Figure 15A depicts a map of the novel pdnGl/UBER-REX plasmid.
- This plasmid encodes the 209 aa (630 bp) dominant-negative mutant dnGl (472-1098 nt; 41-249 aa; Accession # U47413).
- the plasmid is derived from GlXSvNa (GTI), into which the CMV i.e. promoter enhancer was cloned at the unique Sac II site upstream of the 5' LTR. 487bp of residual gag sequences were removed (D) to reduce the possibility of RCR, and a 97bp splice acceptor site (ESA) was added upstream of dnGl .
- GTI GlXSvNa
- ESA 97bp splice acceptor site
- the neo gene is driven by the SV40 e.p. with its nested ori.
- the pdnGl/UBER- REX plasmid was designed for high-titer vector production in 293T cells
- Figure 15B depicts the restriction digest of pdnGl/UBER-REX.
- Figure 16A illustrates a schematic representation of the C-REX plasmid.
- Figure 16B illustrates a schematic representation of the UBER-REX plasmid.
- Figure 17 depicts intravenous REXIN-G induced necrosis and fibrosis in metastatic tumor nodules, as observed in surgically excised liver sections from a patient with Stage IV pancreatic cancer (Patient A3).
- B Trichrome stain of a tissue section of same tumor nodule. Blue-staining material indicates presence of collagenous proteins in fibrotic areas.
- Figure 18 depicts intravenous REXIN-G induced overt apoptosis in metastatic tumor nodules, seen of a patient with pancreatic cancer (Patient A3).
- A-D Representative immunostained tissue sections of tumor nodules from biopsied liver indicating an appreciable incidence of Tunel-positive apoptotic nuclei (brown-staining material).
- FIG 19 depicts immunohistochemical characterization of tumor infiltrating lymphocytes (TILs) in metastatic tumor nodules excised from a REXIN-G-treated patient with pancreatic cancer (Patient A3).
- Representative tissue sections of residual tumor nodules within the biopsied liver show significant TIL infiltration with a functional complement of immunoreactive T and B cells.
- Helper T cells cd4+
- Killer T cells cd8+
- B cells cd20+
- Monocyte/Macrophages cd45+
- Dendritic cells cd35+
- Natural Killer cells cd56+.
- Figure 20 depicts intravenous REXIN-G induced necrosis, apoptosis and fibrosis in a cancerous lymph node of a patient with malignant melanoma (Patient B4).
- B Higher magnification (100X) of sections of A showing numerous cells undergoing apoptosis indicated by small cells with pyknotic or fragmented nuclei;
- C Higher magnification (100X) of A revealing golden-yellow hemosiderin- laden macrophages;
- Figure 21 depicts evidence of tumor regression in a patient with squamous cell carcinoma of the larynx (Patient B6).
- Figure 22 depicts the effects of REXIN-G infusions on the number and quality of hepatic metastatic lesions observed in a pancreatic cancer patient exhibiting a massive tumor burden (Patient CI).
- Abdominal MRI obtained (A) before treatment and (B) after treatment with calculated (Calculus of Parity) dose-dense infusions of REXIN-G.
- Subsequent aspiration of the enlarged liver cyst (white arrow) followed by cytological analysis confirmed the complete absence of cancer cells in the aspirates following the treatment.
- Figure 23 depicts the effects of treatment with REXIN-G on intractable osteosarcoma, metastatic to heart, lungs, and adrenal gland.
- Radiologic imaging identifies the major metastatic sites (A), focusing on three pulmonary target lesions (arrows) which change dramatically from baseline (B), to one month (C) to three months (D) of REXIN-G treatment.
- A major metastatic sites
- B focusing on three pulmonary target lesions
- C three months
- D three months
- the densities of these tumors change significantly, indicating reactive calcification and necrosis
- the PET scan adds mechanistic details, confirming the cessation of tumor metabolic activity.
- Figure 24 depicts the effects of treatment with REXIN-G on intractable metastatic osteosarcoma wherein halting progression and stabilization of disease by REXIN-G, acting here as neoadjuvant and adjuvant therapy, enabled a surgical remission gained by the excision of two residual tumor nodules. Histological examination of the excised tumors demonstrated clear objective responses, confirming calcification (A, and C at higher magnification) in one lesion, and cystic conversion and necrosis (B, and D at higher magnification) of the second lesion following REXIN-G treatment.
- Figure 25 depicts the effects of treatment with REXIN-G on intractable
- Ewing's sarcoma metastatic to the lungs and spine.
- a comparison of the PET scans with the CT scans of three large target lesions in the chest region (A) reveals a problematic disparity in evaluating objective clinical responses in tumor size versus tumor metabolism following REXIN-G treatment.
- the diffuse metastatic tumor infiltration in the lumbar region (B) which was detected by PET scan but not CT scan, further suggests that clinical understanding based on tumor size alone is of a very meager kind.
- Figure 26 depicts the effects of treatment with REXIN-G on intractable metastatic breast cancer, revealing histological aspects of tumor destruction, reparative fibrosis, and reactive immune cell infiltration, now-classical hallmarks of REXIN-G action.
- a scant number of tumor cells can be seen in the context of extensive fibrosis (fib) accompanied by a significant immune response (im) following REXIN-G treatment (A, H&E stain; B, Trichrome stain for extracellular matrix proteins).
- A, H&E stain; B Trichrome stain for extracellular matrix proteins.
- the remaining nests of degenerative tumor cells appear to be infiltrated and 'recognized' by the patient's immune cells (C, H&E; D, LCA immuno staining), including killer T-cells (E).
- Figure 27 depicts the effects of treatment with REXIN-G on intractable metastatic pancreatic cancer, wherein the patient received REXIN-G as second-line therapy treatment shortly after failing standard first line therapy; thus demonstrating the clinical benefit of gaining effective tumor control at a relatively early stage of disease progression.
- Complete regression of the primary pancreatic tumor (A versus B) is demonstrated along with both size (RECIST) and density (CHOI) changes in a metastatic liver lesion (C versus D); resulting in the stabilization of disease, prevention of new lesions, and enhancement of treatment options.
- Figure 28 depicts the effects of treatment with REXIN-G on recurrent chemotherapy-resistant pancreas cancer with metastasis to the liver and abdominal lymph nodes, documenting a complete clinical remission gained by continued treatment with REXIN-G as stand alone therapy.
- Figure 29 depicts the effects of treatment with REXIN-G on intractable metastatic pancreas cancer, wherein the surgical excision of a residual tumor from the liver provides important insights into the molecular mechanisms-of-action of REXIN-G, as well as a sustained clinical remission.
- Histological examination of the excised liver nodule (A) demonstrates the limitations of simple RECIST measurements, revealing epithelioid tumor cells (tu) in various stages of degeneration (insert) that are surrounded by a significant amount of reparative fibrosis (B, ECM stains blue) and immune cell infiltration (C, Leukocytes), including both helper T-cells (F) and killer T-cells (G).
- Figure 30 depicts a Kaplan Meier analysis of progression-free survival in
- Figure 31 A depicts the overall survival data on evaluable osteosarcoma patients.
- Kaplan-Meier analysis shows Overall Survival curve of 17 evaluable patients with recurrent or metastatic osteosarcoma refractory to known therapies who completed at least one treatment cycle and had a tumor response evaluation.
- Figure 3 IB depicts the progression- free survival rates of patients with pancreatic cancer.
- Figure 32 depicts a flow diagram of therapeutic embodiment using targeted vector therapy in combination with radiation or chemotherapeutic therapy.
- the therapeutic systems disclosed herein targets retroviral vectors or any other viral or non-viral vector, protein or drug selectively to areas of pathology (i.e., pathotropic targeting), enabling preferential gene delivery to vascular (Hall et al, Hum Gene Ther, 8:2183-92, 1997; Hall et al, Hum Gene Ther, 11 :983-93, 2000) or cancerous lesions (Gordon et al, Hum Gene Ther 12: 193-204, 2001; Gordon et al, Curiel DT, Douglas JT, eds. Vector Targeting Strategies for Therapeutic Gene Delivery, New York, NY: Wiley-Liss, Inc.
- pathotropic targeting enabling preferential gene delivery to vascular (Hall et al, Hum Gene Ther, 8:2183-92, 1997; Hall et al, Hum Gene Ther, 11 :983-93, 2000) or cancerous lesions (Gordon et al, Hum Gene Ther 12: 193-204, 2001; Gordon et al
- nucleic acid refers to a polynucleotide containing at least two covalently linked nucleotide or nucleotide analog subunits.
- a nucleic acid can be a deoxyribonucleic acid (DNA), a ribonucleic acid (RNA), or an analog of DNA or RNA.
- Nucleotide analogs are commercially available and methods of preparing polynucleotides containing such nucleotide analogs are known (Lin et al. (1994) Nucl. Acids Res. 22:5220- 5234; Jellinek et al. (1995) Biochemistry 34: 11363-11372; Pagratis et al.
- the nucleic acid can be single-stranded, double-stranded, or a mixture thereof.
- the nucleic acid is double- stranded, or it is apparent from the context.
- DNA is meant to include all types and sizes of DNA molecules including cDNA, plasmids and DNA including modified nucleotides and nucleotide analogs.
- nucleotides include nucleoside mono-, di-, and triphosphates.
- Nucleotides also include modified nucleotides, such as, but are not limited to,
- the term "subject” refers to animals, plants, insects, and birds into which the large DNA molecules can be introduced. Included are higher organisms, such as mammals and birds, including humans, primates, rodents, cattle, pigs, rabbits, goats, sheep, mice, rats, guinea pigs, cats, dogs, horses, chicken and others.
- administering to a subject is a procedure by which one or more delivery agents and/or large nucleic acid molecules, together or separately, are introduced into or applied onto a subject such that target cells which are present in the subject are eventually contacted with the agent and/or the large nucleic acid molecules.
- targeted delivery vector or “targeted delivery vehicle” or
- targeted therapeutic vector or “targeted therapeutic system” refers to both viral and non- viral particles that harbor and transport exogenous nucleic acid molecules to a target cell or tissue.
- Viral vehicles include, but are not limited to, retroviruses, adenoviruses and adeno- associated viruses.
- Non-viral vehicles include, but are not limited to, microparticles, nanoparticles, virosomes and liposomes.
- “Targeted,” as used herein, refers to the use of ligands that are associated with the delivery vehicle and target the vehicle to a cell or tissue.
- Ligands include, but are not limited to, antibodies, receptors and collagen binding domains.
- transduction refers to the process by which exogenous nucleic acid molecules are transferred into a cell such that they are located inside the cell. Delivery of nucleic acids is a distinct process from expression of nucleic acids.
- a “multiple cloning site (MCS)” is a nucleic acid region in a plasmid that contains multiple restriction enzyme sites, any of which can be used in conjunction with standard recombinant technology to digest the vector.
- “Restriction enzyme digestion” refers to catalytic cleavage of a nucleic acid molecule with an enzyme that functions only at specific locations in a nucleic acid molecule. Many of these restriction enzymes are commercially available. Use of such enzymes is widely understood by those of skill in the art.
- a vector is linearized or fragmented using a restriction enzyme that cuts within the MCS to enable exogenous sequences to be ligated to the vector.
- "origin of replication” is a specific nucleic acid sequence at which replication is initiated.
- an autonomously replicating sequence (ARS) can be employed if the host cell is yeast.
- selectable or screenable markers confer an identifiable change to a cell permitting easy identification of cells containing an expression vector.
- a selectable marker is one that confers a property that allows for selection.
- a positive selectable marker is one in which the presence of the marker allows for its selection, while a negative selectable marker is one in which its presence prevents its selection.
- An example of a positive selectable marker is a drug resistance marker.
- a drug selection marker aids in the cloning and identification of transformants
- genes that confer resistance to neomycin, puromycin, hygromycin, DHFR, GPT, zeocin and histidinol are useful selectable markers.
- markers conferring a phenotype that allows for the discrimination of transformants based on the implementation of conditions other types of markers including screenable markers such as GFP, whose basis is calorimetric analysis, are also
- screenable enzymes such as herpes simplex virus thymidine kinase (tk) or chloramphenicol acetyltransferase (CAT) may be utilized.
- tk herpes simplex virus thymidine kinase
- CAT chloramphenicol acetyltransferase
- immunologic markers possibly in conjunction with FACS analysis. The marker used is not believed to be important, so long as it is capable of being expressed simultaneously with the nucleic acid encoding a gene product. Further examples of selectable and screenable markers are well known to one of skill in the art.
- transfection is used to refer to the uptake of foreign DNA by a cell.
- a cell has been "transfected” when exogenous DNA has been introduced inside the cell membrane.
- transfection techniques are generally known in the art. See, e.g., Graham et al, Virology 52:456 (1973); Sambrook et al, Molecular Cloning: A Laboratory Manual (1989); Davis et al, Basic Methods in Molecular Biology (1986); Chu et al, Gene 13: 197 (1981).
- exogenous DNA moieties such as a nucleotide integration vector and other nucleic acid molecules, into suitable host cells.
- the term captures chemical, electrical, and viral- mediated transfection procedures.
- expression refers to the process by which nucleic acid is translated into peptides or is transcribed into RNA, which, for example, can be translated into peptides, polypeptides or proteins. If the nucleic acid is derived from genomic DNA, expression may, if an appropriate eukaryotic host cell or organism is selected, include splicing of the mR A. For heterologous nucleic acid to be expressed in a host cell, it must initially be delivered into the cell and then, once in the cell, ultimately reside in the nucleus.
- applying to a subject is a procedure by which target cells present in the subject are eventually contacted with energy such as ultrasound or electrical energy. Application is by any process by which energy can be applied.
- a "therapeutic course” refers to the periodic or timed administration of the targeted vectors disclosed herein within a defined period of time. Such a period of time is at least one day, at least two days, at least three days, at least five days, at least one week, at least two weeks, at least three weeks, at least one month, at least two months, or at least six months. Administration could also take place in a chronic manner, i.e. for an undefined period of time.
- the periodic or timed administration includes once a day, twice a day, three times a day or other set timed administration.
- co-administration means to encompass administration of the selected therapeutic agents to a single patient, and are intended to include treatment regimens in which the agents are administered by the same or different route of
- a therapeutic agent as disclosed in the present application will be co-administered with other agents.
- These terms encompass administration of two or more agents to an animal so that both agents and/or their metabolites are present in the animal at the same time. They include
- a thereapeutic agent and the other agent(s) are administered in a single composition.
- a therapeutic agent and the other agent(s) are admixed in the composition.
- a therapeutic agent and the other agent(s) are administered at separate times in separate doses.
- the term "host cell” denotes, for example, microorganisms, yeast cells, insect cells, and mammalian cells, that can be, or have been, used as recipients for multiple constructs for producing a targeted delivery vector.
- the term includes the progeny of the original cell which has been transfected.
- a "host cell” as used herein generally refers to a cell which has been transfected with an exogenous DNA sequence. It is understood that the progeny of a single parental cell may not necessarily be completely identical in morphology or in genomic or total DNA complement as the original parent, due to natural, accidental, or deliberate mutation.
- heterologous DNA involves the transfer of heterologous DNA to the certain cells, target cells, of a mammal, particularly a human, with a disorder or conditions for which therapy or diagnosis is sought.
- the DNA is introduced into the selected target cells in a manner such that the heterologous DNA is expressed and a therapeutic product encoded thereby is produced.
- the heterologous DNA may in some manner mediate expression of DNA that encodes the therapeutic product, it may encode a product, such as a peptide or RNA that in some manner mediates, directly or indirectly, expression of a therapeutic product.
- Genetic therapy may also be used to deliver nucleic acid encoding a gene product to replace a defective gene or supplement a gene product produced by the mammal or the cell in which it is introduced.
- the introduced nucleic acid may encode a therapeutic compound, such as a growth factor inhibitor thereof, or a tumor necrosis factor or inhibitor thereof, such as a receptor therefor, that is not normally produced in the mammalian host or that is not produced in therapeutically effective amounts or at a therapeutically useful time.
- the heterologous DNA encoding the therapeutic product may be modified prior to introduction into the cells of the afflicted host in order to enhance or otherwise alter the product or expression thereof.
- heterologous nucleic acid sequence is typically DNA that encodes RNA and proteins that are not normally produced in vivo by the cell in which it is expressed or that mediates or encodes mediators that alter expression of endogenous DNA by affecting transcription, translation, or other regulatable biochemical processes.
- a heterologous nucleic acid sequence may also be referred to as foreign DNA. Any DNA that one of skill in the art would recognize or consider as heterologous or foreign to the cell in which it is expressed is herein encompassed by heterologous DNA.
- heterologous DNA examples include, but are not limited to, DNA that encodes traceable marker proteins, such as a protein that confers drug resistance, DNA that encodes therapeutically effective substances, such as anti-cancer agents, enzymes and hormones, and DNA that encodes other types of proteins, such as antibodies.
- Antibodies that are encoded by heterologous DNA may be secreted or expressed on the surface of the cell in which the heterologous DNA has been introduced.
- Plasmids disclosed herein are used to transfect and produce targeted delivery vectors or targeted therapeutic vectors for use in therapeutic and diagnostic procedures.
- such plasmids provide nucleic acid sequences that encode components, viral or non-viral, of targeted vectors disclosed herein.
- Such plasmids include nucleic acid sequences that encode, for example the 4070A amphotropic envelope protein modified to contain a collagen binding domain.
- Additional plasmids can include a nucleic acid sequence operably linked to a promoter. The sequence generally encodes a viral gag-pol polypeptide.
- the plasmid further includes a nucleic acid sequence operably linked to a promoter, and the sequence encodes a polypeptide that confers drug resistance on the producer cell.
- Additional plasmids can include a heterologous nucleic acid sequence encoding a diagnostic or therapeutic polypeptide, 5' and 3' long terminal repeat sequences; a ⁇ retroviral packaging sequence, a CMV promoter upstream of the 5' LTR, a nucleic acid sequence operably linked to a promoter, and an SV40 origin of replication.
- the heterologous nucleic acid sequence generally encodes a diagnostic or therapeutic polypeptide.
- the therapeutic polypeptide or protein is a "suicide protein" that causes cell death by itself or in the presence of other compounds.
- suicide protein is thymidine kinase of the herpes simplex virus.
- Additional examples include thymidine kinase of varicella zoster virus, the bacterial gene cytosine deaminase (which converts 5-fluorocytosine to the highly toxic compound 5- fluorouracil), p450 oxidoreductase, carboxypeptidase G2, beta-glucuronidase, penicillin- V- amidase, penicillin-G-amidase, beta-lactamase, nitroreductase, carboxypeptidase A, linamarase (also referred to as .beta.-glucosidase), the E. coli gpt gene, and the E. coli Deo gene, although others are known in the art.
- cytosine deaminase which converts 5-fluorocytosine to the highly toxic compound 5- fluorouracil
- p450 oxidoreductase carboxypeptidase G2
- beta-glucuronidase penicillin- V- amid
- the suicide protein converts a prodrug into a toxic compound.
- prodrug means any compound useful in the methods of the present invention that can be converted to a toxic product, i.e. toxic to tumor cells. The prodrug is converted to a toxic product by the suicide protein.
- prodrugs include: ganciclovir, acyclovir, and FIAU (l-(2- deoxy-2-fluoro-.beta.-D-arabinofuranosyl)-5-iod-ouracil) for thymidine kinase; ifosfamide for oxidoreductase; 6-methoxypurine arabinoside for VZV-TK; 5-fluorocytosine for cytosine deaminase; doxorubicin for beta-glucuronidase; CB1954 and nitrofurazone for nitroreductase; and N-(Cyanoacetyl)-L-phenylalanine or N-(3-chloropropionyl)-L- phenylalanine for carboxypeptidase A.
- the prodrug may be administered readily by a person having ordinary skill in this art. A person with ordinary skill would readily be able to determine the most appropriate dose and route for the administration
- a therapeutic protein or polypeptide is a cancer suppressor, for example p53 or Rb, or a nucleic acid encoding such a protein or polypeptide.
- a cancer suppressor for example p53 or Rb
- a nucleic acid encoding such a protein or polypeptide is known.
- those of skill know of a wide variety of such cancer suppressors and how to obtain them and/or the nucleic acids encoding them.
- therapeutic proteins or polypeptides include pro-apoptotic therapeutic proteins and polypeptides, for example, pi 5, pi 6, or p21/WAF-l .
- Cytokines, and nucleic acid encoding them may also be used as therapeutic proteins and polypeptides.
- GM-CSF granulocyte macrophage colony stimulating factor
- TNF-alpha Tumor necrosis factor alpha
- Interferons including, but not limited to, IFN-alpha and IFN-gamma
- Interleukins including, but not limited to, Interleukin-1 (IL1), Interleukin-Beta (IL-beta), Interleukin-2 (IL2), Interleukin-4 (IL4), Interleukin-5 (IL5), Interleukin-6 (IL6), Interleukin-8 (IL8), Interleukin-10 (IL10),
- Interleukin-12 (IL12), Interleukin-13 (IL13), Interleukin-14 (IL14), Interleukin-15 (IL15), Interleukin-16 (IL16), Interleukin-18 (IL18), Interleukin-23 (IL23), Interleukin-24 (IL24), although other embodiments are known in the art.
- cytocidal genes include, but are not limited to, mutated cyclin Gl genes.
- the cytocidal gene may be a dominant negative mutation of the cyclin Gl protein (e.g., WO/01/64870).
- retroviral vector (RV) constructs were generally produced by the cloning and fusion of two separate retroviral (RV) plasmids: one containing the retroviral LTRs, packaging sequences, and the respective gene(s) of interest; and another retroviral vector containing a strong promoter (e.g., CMV) as well as a host of extraneous functional sequences.
- the pC-REX II (e-REX) vector disclosed herein refers to an improved plasmid containing an insertion of a unique set of cloning sites in the primary plasmid to facilitate directional cloning of the experimental gene(s).
- the strong promoter (ex, CMV) is employed in the plasmid backbone to increase the amount of RNA message generated within the recipient producer cells but is not itself packaged into the retroviral particle, as it lies outside of the gene-flanking retroviral LTR's.
- CMV promoter obtained by PCR
- This streamlined construct was designated pC-REX.
- PC-REX was further modified to incorporate a series of unique cloning sites (see MCS in pC-REX II, Figure 11), enabling directional cloning and/or the insertion of multiple genes as well as auxiliary functional domains.
- the new plasmids are designated pC-REX and pC-REX II (EPEIUS-REX or eREX).
- the pC-REX plasmid design outperformed that of pHIT-112/pREX in direct side-by-side comparisons.
- the new plasmid design was further modified to include the coding sequence of various
- REXIN-G represents the targeted delivery vector dnGl/C-REX that is packaged, encapsidated, and enveloped in a targeted, injectable viral particle.
- human producer cells are used to generate virions. Human cells do not have endogenous murine sequences that would be capable of recombining with a murine-based retroviral vector used in REXIN-G Recent improvements were made to the production of REXIN-G in order to further reduce the potential for generation of replication-competent retrovirus.
- the plasmid dnGl/C-REX contains residual gag-pol sequences that potentially overlap with 5' DNA sequences contained in the respective gag-pol construct. Therefore, 487 base pairs were removed from the parent dnGl/C-REX plasmid followed by an insertion of 97 base pair splice acceptor site to yield pdnGl/UBER-REX ( Figure 15A).
- a targeting ligand is included in a plasmid disclosed herein. Generally, it is inserted between two consecutively numbered amino acid residues of the native (i.e., unmodified) receptor binding region of the retroviral envelope encoded by a nucleic acid sequence of a plasmid, such as in the modified amphotropic CAE envelope polypeptide, wherein the targeting polypeptide is inserted between amino acid residues 6 and 7.
- the polypeptide is a portion of a protein known as gp70, which is included in the amphotropic envelope of Moloney Murine Leukemia Virus.
- the targeting polypeptide includes a binding region which binds to an extracellular matrix component, including, but not limited to, collagen (including collagen Type I and collagen Type IV), laminin, fibronectin, elastin, glycosaminoglycans, proteoglycans, and sequences which bind to fibronectin, such as arginine-glycine-aspartic acid, or RGD, sequences.
- Binding regions which may be included in the targeting polypeptide include, but are not limited to, polypeptide domains which are functional domains within von Willebrand Factor or derivatives thereof, wherein such polypeptide domains bind to collagen.
- the binding region is a polypeptide having the following structural formula: Trp-Arg-Glu-Pro-Ser-Phe-Met-Ala-Leu-Ser (SEQ ID NO: 3).
- This disclosure relates to the production of viral and non- viral vector particles, including retroviral vector particles, adenoviral vector particles, adeno-associated virus vector particles, Herpes Virus vector particles, pseudotyped viruses, and non- viral vectors having a modified, or targeted viral surface protein, such as, for example, a targeted viral envelope polypeptide, wherein such modified viral surface protein, such as a modified viral envelope polypeptide, includes a targeting polypeptide including a binding region which binds to an extracellular matrix component such as collagen.
- the targeting polypeptide may be placed between two consecutive amino acid residues of the viral surface protein, or may replace amino acid residues which have been removed from the viral surface protein.
- viral vectors most commonly adenoviral and retroviral vectors.
- exemplary viral- based vehicles include, but are not limited to, recombinant retroviruses (see, e.g., WO 90/07936; WO 94/03622; WO 93/25698; WO 93/25234; U.S. Pat. No. 5,219,740; WO 93/11230; WO 93/10218; U.S. Pat. No. 4,777,127; GB Patent No.
- alphavirus-based vectors e.g., Sindbis virus vectors, Semliki forest virus (ATCC VR-67; ATCC VR-1247), Ross River virus (ATCC VR-373; ATCC VR- 1246) and Venezuelan equine encephalitis virus (ATCC VR-923; ATCC VR-1250; ATCC VR 1249; ATCC VR-532)
- AAV adeno-associated virus
- a viral particle can be developed from a virus that is native to a target cell or from a virus that is non-native to a target cell. In general, it is desirable to use a non-native virus vector rather than a native virus vector. While native virus vectors may possess a natural affinity for target cells, such viruses pose a greater hazard since they possess a greater potential for propagation in target cells. In this regard, animal virus vectors, wherein they are not naturally designed for propagation in human cells, can be useful for gene delivery to human cells.
- Virus vectors produced in this way normally lack any components either as part of the envelope or as part of the capsid that can provide tropism for human cells.
- non- human virus vectors such as ecotropic mouse (murine) retroviruses like MMLV, are produced in a mouse packaging cell line.
- Another component required for human cell tropism must be provided.
- the propagation of a viral vector proceeds in a packaging cell in which a nucleic acid sequence for packaging components were stably integrated into the cellular genome and nucleic acid coding for viral nucleic acid is introduced in such a cell line.
- Packaging lines currently available yield producer clones of sufficient titer to transduce human cells for gene therapy applications and have led to the initiation of human clinical trials. However, there are two areas in which these lines are deficient.
- a packaging system that would enable rapid, high-titer virus production without the need to generate stable producer lines would be highly advantageous in that it would save approximately two months required for the identification of high titer producer clones derived from several constructs.
- TILs Primary human tumor-infiltrating lymphocytes
- CD4+ and CD8+ T cells isolated from peripheral blood lymphocytes
- primate long-term reconstituting hematopoietic stem cells represent an extreme example of low transduction efficiency compared to NIH 3T3 cells.
- Improvements in the retroviral vector design enables the following: (1) the replacement of cumbersome plasmid cloning and fusion procedures which represent the prior art, (2) the provision of a single straightforward plasmid construct which avoids undue fusions and mutations in the parent constructs, which would compromise the reagent in terms of gaining regulatory (i.e.
- TDS includes a high performance retroviral expression vector, designated the C-REX vector.
- Transient transfection has numerous advantages over the packaging cell method.
- transient transfection avoids the longer time required to generate stable vector-producing cell lines and is used if the vector genome or retroviral packaging components are toxic to cells.
- the vector genome encodes toxic genes or genes that interfere with the replication of the host cell, such as inhibitors of the cell cycle or genes that induce apoptosis, it may be difficult to generate stable vector-producing cell lines, but transient transfection can be used to produce the vector before the cells die.
- cell lines have been developed using transient infection that produce vector titer levels that are comparable to the levels obtained from stable vector-producing cell lines (Pear et al 1993, PNAS 90:8392-8396).
- a high efficiency manufacturing process for large scale production of retroviral vector stock bearing cytocidal gene constructs with high bulk titer and biologic activity is provided.
- the manufacturing process describes the use of transiently transfected 293T producer cells; an engineered method of producer cell scale up; and a transient transfection procedure that generates retroviral vectors that retains cytocidal gene expression with high fidelity.
- a fully validated 293T human embryonic kidney cells transformed with SV40 large T
- the manufacturing process incorporates a method of DNA degradation in the preparation of the therapeutic retroviral product, including during the collection of the retroviral particles, the subsequent processing of the retroviral particles, the final steps of vector harvest and collection, the concentration of the retroviral particles, prior to storage of the therapeutic retroviral particles and/or just prior to administration of the retroviral particles that does not result in any loss of vector potency.
- DNA degradation steps may include treatment with DNase I (e.g. Pulmozyme (Genentech), TURBOTM Dnase (Ambion), Plasmid-Safe (Epicentre Technologies)).
- DNase I e.g. Pulmozyme (Genentech), TURBOTM Dnase (Ambion), Plasmid-Safe (Epicentre Technologies)
- from 0.1 - 10 Units/ml; 0.5 - 5 Units/ml; 1-4 Units/ml or 1 Unit/ml of DNase I is added to remove intact oncogenes from the therapeutic retroviral vector preparation.
- a method for concentrating retroviral vector stocks for therapeutic use and consistent generation of clinical vector products approaching 1 x 10 9 cfu/ml is provided.
- the concentration of the clinical vector products is at least 1 x 10 7 cfu/ml.
- the concentration of the clinical vector is at least 1 x 10 8 cfu/ml.
- the concentration of the clinical vector is at least 1 x 10 9 cfu/ml.
- the final formulation of the clinical product consists of a chemically defined serum-free solution for harvest, collection and storage of high titer clinical vector stocks.
- a method of collection of the clinical vector or therapeutic retroviral vector particles using a system for maintenance of sterility, sampling of quality control specimens and facilitation of final fill is provided.
- a closed-loop manifold assembly designed to meet the specifications required for collection of clinical product, i.e., maintenance of sterility during sampling, and is not available as a product for sale.
- the closed loop manifold assembly for harvest of viral particles disclosed herein comprises a flexboy bag and manifold system made of Stedim 71 film; a 3 layer co extruded film consisting of a fluid contact layer of Ethyl Vinyl Acetate (EVA), a gas barrier of Ethyl Vinyl Alcohol (EVOH) and an outer layer of EVA.
- EVA Ethyl Vinyl Acetate
- EVOH Ethyl Vinyl Alcohol
- EVA is an inert non-PVC-based film, which does not require the addition of plasticizers, thereby keeping extractables to a minimum.
- Stedim has conducted extensive biocompatibility trials and has established a Drug Master File with the FDA for this product.
- the film and port tubes meet USP Class VI requirements. All bag customization takes place in Stedim' s class 10,000-controlled manufacturing environment.
- the film, tubing and all components used are gamma compatible to 45 kGy. Gamma irradiation is performed at a minimum exposure of 25 kGy to a maximum of 45 kGy.
- Product certificates of conformance are provided from both Stedim and their contract sterilizers.
- the closed- loop manifold system may also be used for the concentration, final fill and/or storage of the therapeutic retroviral vector particles.
- the retroviral particles are collected and filter-sterilized using, for example, Amicon Ultrafree-MC centrifugal filters with 0.22 ⁇ pore diameter (Millipore), or any other filter-sterilization system available.
- the retroviral vector particles are concentrated using centrifugation, flocculation, reagent binding, column purification and other means used to concentrate retroviral vector particles for clinical use.
- the clinical retroviral vector may be stored at low temperatures, e.g. -80 °C, for an extended period of time.
- the clinical retroviral vector may also be stored in volumes of 1 ml, 5 ml, 10 ml, 20 ml, 30 ml, 40 ml, 50 ml, 60 ml, 70 ml, 80 ml, 90 ml, 100 ml, 110 ml, 120 ml, 130 ml, 140 ml or 150 ml at -80 °C.
- the clinical retroviral vector product may be stored in any suitable container that protects the product during long term, low- temperature storage conditions, including glass vials, cryobags and the like.
- the fully validated product exhibits a viral titer of at least 1 x 10 7 cfu/ml, at least 3 x 10 7 cfu/ml, at least 5 x 10 7 cfu/ml, at least 8 x 10 7 cfu/ml, at least 1 x 10 8 cfu/ml, at least 5 x 10 8 cfu/ml, at least 1 x 10 9 cfu/ml, at least 5 x 10 9 cfu/ml, at least 1 x 10 10 cfu/ml, or at least 5 x 10 10 cfu/ml.
- the fully validated product may also have a biologic potency of at least 65-70% , at least 50-75%, at least 45-70%, at least 35-50%, at least 30%, at least 25%, at least 20% or at least 10% growth inhibitory activity in human breast, colon and pancreatic cancer cells.
- the fully validated product may also have a uniform particle size of -10 nm, -20 nm, -50 nm, -100 nm, -200 nm, -300 nm, -400 nm, -500 nm, -600 nm, -700 nm, -800 nm or -1000 nm with no viral aggregation.
- the fully validated product may also have less than 550 bp residual DNA, less than 500 bp residual DNA, less than 400 bp residual DNA, less than 300 bp residual DNA, less than 200 bp residual DNA or less than 100 bp residual DNA indicating absence of intact oncogenes.
- the fully validated may also have no detectable El A or SV40 large T antigen, and no detectable replication competent retrovirus (RCR) in 5 passages on mus Dunni and human 293 cells.
- the fully validated product is sterile with an endotoxin level of ⁇ 0.3 EU/ml, ⁇ 0.2 EU/ml, ⁇ 0.1 EU/ml, and the end of production cells are free of mycoplasma and other adventitious viruses.
- REXIN-G produced using the new pB-RVE and pdnG 1 /UBER-REX plasmids was stored in volumes of 20-40 ml in 150 ml plastic cryobag at -70 + 10 °C.
- the titers of the clinical lots ranged from 0.5 to 5.0 x 10e9 Units (U)/ml, and each lot was validated to be free of replication competent retrovirus (RCR), and of requisite purity, biological potency, sterility, and general safety for systemic use in humans.
- RCR replication competent retrovirus
- the viral envelope includes a targeting ligand which includes, but are not limited to, the arginine-glycine-aspartic acid, or RGD, sequence, which binds fibronectin, and a polypeptide having the sequence Gly-Gly-Trp-Ser-His-Trp (SEQ ID NO:4), which also binds to fibronectin.
- the targeting polypeptide may further include linker sequences of one or more amino acid residues, placed at the N- terminal and/or C-terminal of the binding region, whereby such linkers increase rotational flexibility and/or minimize steric hindrance of the modified envelope polypeptide.
- the polynucleotides may be constructed by genetic engineering techniques known to those skilled in the art.
- a targeted delivery vector made in accordance with this invention contains associated therewith a ligand that facilitates the vector accumulation at a target site , i.e. a target-specific ligand.
- the ligand is a chemical moiety, such as a molecule, a functional group, or fragment thereof, which is specifically reactive with the target of choice while being less reactive with other targets thus giving the targeted delivery vector an advantage of transferring nucleic acids encoding therapeutic or diagnostic polypeptides, selectively into the cells in proximity to the target of choice.
- binding affinity By being “reactive” it is meant having binding affinity to a cell or tissue, or being capable of internalizing into a cell wherein binding affinity is detectable by any means known in the art, for example, by any standard in vitro assay such as ELISA, flow cytometry, immuno cytochemistry, surface plasmon resonance, etc.
- a ligand binds to a particular molecular moiety ⁇ an epitope, such as a molecule, a functional group, or a molecular complex associated with a cell or tissue, forming a binding pair of two members. It is recognized that in a binding pair, any member may be a ligand, while the other being an epitope.
- binding pairs are known in the art.
- Exemplary binding pairs are antibody-antigen, hormone-receptor, enzyme- substrate, nutrient (e.g. vitamin)-transport protein, growth factor-growth factor receptor, carbohydrate-lectin, and two polynucleotides having complementary sequences. Fragments of the ligands are to be considered a ligand and may be used for the present invention so long as the fragment retains the ability to bind to the appropriate cell surface epitope.
- the ligands are proteins and peptides comprising antigen-binding sequences of an immunoglobulin. More preferably, the ligands are antigen-binding antibody fragments lacking Fc sequences. Such preferred ligands are Fab fragments of an immunoglobulin, F(ab)2 fragments of immunoglobulin, Fv antibody fragments, or single-chain Fv antibody fragments. These fragments can be enzymatically derived or produced recombinantly. In their functional aspect, the ligands are preferably internalizable ligands, i.e. the ligands that are internalized by the cell of choice for example, by the process of endocytosis.
- ligands with substitutions or other alterations, but which retain the epitope binding ability may be used.
- the ligands are advantageously selected to recognize pathological cells, for example, malignant cells or infectious agents.
- Ligands that bind to exposed collagen can target the vector to an area of a subject that comprises malignant tissue. In general, cells that have metastasized to another area of a body do so by invading and disrupting healthy tissue. This invasion results in exposed collagen which can be targeted by the vectors provided herein.
- An additional group of ligands that can be used to target a vector are those that form a binding pair with the tyrosine kinase growth factor receptors which are overexpressed on the cell surfaces in many tumors.
- Exemplary tyrosine kinase growth factors are VEGF receptor, FGF receptor, PDGF receptor, IGF receptor, EGF receptor, TGF-alpha receptor, TGF-beta receptor, HB-EGF receptor, ErbB2 receptor, ErbB3 receptor, and ErbB4 receptor.
- EGF receptor vIII and ErbB2 (HEr2) receptors are especially preferred in the context of cancer treatment using INSERTS as these receptors are more specific to malignant cells, while scarce on normal ones.
- the ligands are selected to recognize the cells in need of genetic correction, or genetic alteration by introduction of a beneficial gene, such as: liver cells, epithelial cells, endocrine cells in genetically deficient organisms, in vitro embryonic cells, germ cells, stem cells, reproductive cells, hybrid cells, plant cells, or any cells used in an industrial process.
- a beneficial gene such as: liver cells, epithelial cells, endocrine cells in genetically deficient organisms, in vitro embryonic cells, germ cells, stem cells, reproductive cells, hybrid cells, plant cells, or any cells used in an industrial process.
- the ligand may be expressed on the surface of a viral particle or attached to a non- viral particle by any suitable method available in the art.
- the attachment may be covalent or non-covalent, such as by adsorption or complex formation.
- the attachment preferably involves a lipophilic molecular moiety capable of conjugating to the ligand by forming a covalent or non-covalent bond, and referred to as an "anchor".
- An anchor has affinity to lipophilic environments such as lipid micelles, bilayers, and other condensed phases, and thereby attaches the ligand to a lipid-nucleic acid microparticle. Methods of the ligand attachment via a lipophilic anchor are known in the art. (see, for example, F.
- Non-viral particles include encapsulated nucleoproteins, including wholly or partially assembled viral particles, in lipid bilayers.
- Methods for encapsulating viruses into lipid bilayers are known in the art. They include passive entrapment into lipid bilayer-enclosed vesicles (liposomes), and incubation of virions with liposomes (U.S. Pat. No. 5,962,429; Fasbender, et al, J. Biol. Chem.
- acidic proteins exposed on the surface of a virion provide an interface for complexation with the cationic lipid/cationic polymer component of the targeted delivery vector or targeted therapeutic vector and serve as a "scaffold" for the bilayer formation by the neutral lipid component.
- exemplary types of viruses are adenoviruses, retroviruses, herpesviruses, lentiviruses, and bacteriophages.
- Non-viral delivery systems such as microparticles or nanoparticles including, for example, cationic liposomes and polycations, provide alternative methods for delivery systems and are encompassed by the present disclosure.
- non-viral delivery systems include, for example, Wheeler et al,
- Bally et al. U.S. Pat. No. 5,705,385, and Zhang et al. U.S. Pat. No. 6,110,745 disclose a method for preparing a lipid-nucleic acid particle by contacting a nucleic acid with a solution containing a non-cationic lipid and a cationic lipid to form a lipid-nucleic acid mixture.
- a Particle-Forming Component typically comprises a lipid, such as a cationic lipid, optionally in combination with a PFC other than a cationic lipid.
- a cationic lipid is a lipid whose molecule is capable of electrolytic dissociation producing net positive ionic charge in the range of pH from about 3 to about 10, preferably in the physiological pH range from about 4 to about 9.
- Such cationic lipids encompass, for example, cationic detergents such as cationic amphiphiles having a single hydrocarbon chain.
- Patent and scientific literature describes numerous cationic lipids having nucleic acid transfection- enhancing properties. These transfection-enhancing cationic lipids include, for example: l,2-dioleyloxy-3-(N,N,N-trimethylammonio)propane chloride-, DOTMA (U.S. Pat. No.
- DOSPA see Hawley-Nelson, et al, Focus 15(3):73 (1993)
- N,N-distearyl- ⁇ , ⁇ -dimethyl-ammonium bromide, or DDAB U.S. Pat. No. 5,279,833
- l,2-dioleoyloxy-3- ( ⁇ , ⁇ , ⁇ -trimethylammonio) propane chloride-DOTAP (Stamatatos, et al, Biochemistry 27: 3917-3925 (1988)
- glycerol based lipids see Leventis, et al, Biochem. Biophys. Acta 1023: 124 (1990); arginyl-PE (U.S. Pat. No. 5,980,935); lysinyl-PE (Puyal, et al. J.
- lipids for transfection are reviewed, for example, in: Behr, Bioconjugate Chemistry, 5:382-389 (1994).
- Preferable cationic lipids are DDAB, CHIM, or combinations thereof.
- cationic lipids that are cationic detergents include (C12-C18)-alkyl- and (C 12-C18)-alkenyl-trimethylammonium salts, N- (C12-C18)-alkyl- and N ⁇ (C12-C18)-alkenyl-pyridinium salts, and the like.
- the size of a targeted delivery vector or targeted therapeutic vector formed in accordance with this invention is within the range of about 40 to about 1500 nm, preferably in the range of about 50-500 nm, and most preferably, in the range of about 20- 150 nm. This size selection advantageously aids the targeted delivery vector, when it is administered to the body, to penetrate from the blood vessels into the diseased tissues such as malignant tumors, and transfer a therapeutic nucleic acid therein. It is also a
- characteristic and advantageous property of the targeted delivery vector that its size, as measured for example, by dynamic light scattering method, does not substantially increase in the presence of extracellular biological fluids such as in vitro cell culture media or blood plasma.
- cells which produce retroviruses can be injected into a tumor.
- the retro virus-producing cells so introduced are engineered to actively produce a targeted delivery vector, such as a viral vector particle, so that continuous productions of the vector occurred within the tumor mass in situ.
- a targeted delivery vector such as a viral vector particle
- the targeted vectors of the present invention can also be used as a part of a gene therapy protocol to deliver nucleic acids encoding a therapeutic agent, such a mutant cyclin-G polypeptide.
- a therapeutic agent such as a mutant cyclin-G polypeptide.
- another aspect of the invention features expression vectors for in vivo or in vitro transfection of a therapeutic agent to areas of a subject comprising cell types associated with metastasized neoplastic disorders.
- the targeted vectors provided herein are intended for use as vectors for gene therapy.
- the mutant cyclin-G polypeptide and nucleic acid molecules can be used to replace the corresponding gene in other targeted vectors.
- a targeted vector disclosed herein e.g., one comprising a collagen binding domain
- any therapeutically agent e.g., thymidine kinase.
- therapeutically agent e.g., thymidine kinase.
- those therapeutic agents useful for treating neoplastic disorders are those therapeutic agents useful for treating neoplastic disorders.
- a targeted vectors disclosed herein can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LDS 50 (the dose lethal to 50% of the population) and the ED 50 (the dose therapeutically effective in 50% of the population).
- the dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD 50 /ED 50 .
- Doses that exhibit large therapeutic indices are preferred. In the present invention, doses that would normally exhibit toxic side effects may be used because the therapeutic system is designed to target the site of treatment in order to minimize damage to untreated cells and reduce side effects.
- the data obtained from human clinical trials prove that the targeted vector of the invention functions in vivo to inhibit the progression of a neoplastic disorder.
- the data in Table 1 provides a treatment regimen for administration of such a vector to a patient.
- data obtained from cell culture assays and animal studies using alternative forms of the targeted vector e.g., alternative targeting mechanism or alternative therapeutic agent
- the dosage lies preferably within a range of circulating concentrations that include the ED 50 with little or no toxicity.
- the dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.
- a therapeutically effective dose can be estimated initially from cell culture assays.
- a dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC 50 (i.e., the concentration of the test compound which achieves a half- maximal infection or a half-maximal inhibition) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography.
- compositions containing a targeted delivery vector can be formulated in any conventional manner by mixing a selected amount of the vector with one or more physiologically acceptable carriers or excipients.
- the targeted delivery vector may be suspended in a carrier such as PBS (phosphate buffered saline).
- PBS phosphate buffered saline
- the active compounds can be administered by any appropriate route, for example, orally, parenterally, intravenously, intradermally, subcutaneously, or topically, in liquid, semi- liquid or solid form and are formulated in a manner suitable for each route of
- the targeted delivery vector may also be administered to increase local concentration of the vectors.
- the targeted delivery vector may be administered via intra-arterial infusion, which increases local concentration of the targeted delivery vector to a specific organ system.
- catheterization of the hepatic artery followed by infusion into the pancreaticoduodenal, right hepatic, and middle hepatic artery, respectively may take place that could locally target hepatic lesions.
- Localized distribution of the targeted delivery vector may be directed to other organ systems, including the lung, gastrointestinal, brain, reproductive, splenic or other defined organ system via catheterization or other localized delivery system.
- Intraarterial infusions may also take place via any other available arterial source, including but not limited to infusion through the hepatic artery, cerebral artery, coronary artery, pulmonary artery, iliac artery, celiac trunk, gastric artery, splenic artery, renal artery, gonadal artery, subclavian artery, vertebral artery, axilary artery, brachial artery, radial artery, ulnar artery, carotid artery, femoral artery, inferior mesenteric artery and/or superior mesenteric artery.
- Intra-arterial infusion may be accomplished using endovascular procedures, percutaneous procedures or open surgical approaches.
- the targeted delivery vector and physiologically acceptable salts and solvates may be formulated for administration by inhalation or insufflation (either through the mouth or the nose) or for oral, buccal, parenteral or rectal administration.
- the targeted delivery vector can be delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g. dichlorodifluoromethane, trichlorofluoromethane, dichlorotetra-fluoroetha- ne, carbon dioxide or other suitable gas.
- a suitable propellant e.g. dichlorodifluoromethane, trichlorofluoromethane, dichlorotetra-fluoroetha- ne, carbon dioxide or other suitable gas.
- the dosage unit may be determined by providing a valve to deliver a metered amount.
- the pharmaceutical compositions may take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., pregelatinized maize starch,
- polyvinylpyrrolidone or hydroxypropyl methylcellulose e.g., polyvinylpyrrolidone or hydroxypropyl methylcellulose
- fillers e.g., lactose,
- Liquid preparations for oral administration may take the form of, for example, solutions, syrups or suspensions, or they may be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g. sorbitol syrup, cellulose derivatives or hydrogenated edible fats); emulsifying agents (e.g.
- lecithin or acacia lecithin or acacia
- non-aqueous vehicles e.g. almond oil, oily esters, ethyl alcohol or fractionated vegetable oils
- preservatives e.g. methyl or propyl- p-hydroxybenzoates or sorbic acid
- the preparations may also contain buffer salts, flavoring, coloring and sweetening agents as appropriate.
- compositions for oral administration may be suitably formulated to give controlled release of the active compound.
- compositions for buccal administration may take the form of tablets or lozenges formulated in conventional manner.
- the targeted delivery vector may be formulated for parenteral administration by injection e.g. by bolus injection or continuous infusion.
- Formulations for injection may be presented in unit dosage form e.g. in ampoules or in multi-dose containers, with an added preservative.
- the compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
- the active ingredient may be in powder lyophilized form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
- the targeted delivery vector may also be formulated as a depot preparation.
- Such long acting formulations may be administered by implantation (for example, subcutaneously or intramuscularly) or by intramuscular injection.
- the therapeutic compounds may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
- the active agents may be formulated for local or topical application, such as for topical application to the skin and mucous membranes, such as in the eye, in the form of gels, creams, and lotions and for application to the eye or for intracisternal or intraspinal application.
- solutions particularly those intended for ophthalmic use, may be formulated as 0.01%- 10% isotonic solutions, pH about 5-7, with appropriate salts.
- the compounds may be formulated as aerosols for topical application, such as by inhalation.
- the concentration of active compound in the drug composition will depend on absorption, inactivation and excretion rates of the active compound, the dosage schedule, and amount administered as well as other factors known to those of skill in the art. For example, the amount that is delivered is sufficient to treat the symptoms of hypertension.
- compositions may, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the active ingredient.
- the pack may for example, comprise metal or plastic foil, such as a blister pack.
- the pack or dispenser device may be accompanied by instructions for administration.
- the active agents may be packaged as articles of manufacture containing packaging material, an agent provided herein, and a label that indicates the disorder for which the agent is provided.
- the targeted retroviral particle comprising the cytokine gene may be administered alone or in conjunction with other therapeutic treatments or active agents.
- the targeted retroviral particle comprising a cytokine gene may be administered with the targeted retroviral particle comprising a cytocidal gene.
- the quantity of the targeted retroviral particle comprising a cytocidal gene to be administered is based on the titer of the virus particles as described herein above.
- the targeted retroviral particle comprising a cytokine gene is administered in conjunction with a targeted retroviral particle comprising a cytocidal gene the titer of the retroviral particle for each vector may be lower than if each vector is used alone.
- the targeted retroviral particle comprising the cytokine gene may be administered concurrently or separately from the targeted retroviral particle comprising the cytocidal gene.
- the methods of the subject invention also relate to methods of treating cancer by administering a targeted retroviral particle (e.g., the targeted retroviral vector expressing a cytokine either alone or in conjunction with the targeted retroviral vector expressing a cytocidal gene) with one or more other active agents.
- a targeted retroviral particle e.g., the targeted retroviral vector expressing a cytokine either alone or in conjunction with the targeted retroviral vector expressing a cytocidal gene
- active agents include, but are not limited to, chemo therapeutic agents, antiinflammatory agents, protease inhibitors, such as HIV protease inhibitors, nucleoside analogs, such as AZT.
- the one or more active agents may be administered concurrently or separately (e.g., before administration of the targeted retroviral particle or after
- the targeted retroviral particle may be administered either by the same route as the one or more agents (e.g., the targeted retroviral vector and the agent are both administered intravenously) or by different routes (e.g., the targeted retroviral vector is administered intravenously and the one or more agents are administered orally).
- An effective amount or therapeutically effective of the targeted retroviral particles to be administered to a subject in need of treatment may be determined in a variety of ways.
- the amount may be based on viral titer or efficacy in an animal model.
- the dosing regimes used in clinical trials may be used as general guidelines.
- the daily dose may be administered in a single dose or in portions at various hours of the day. Initially, a higher dosage may be required and may be reduced over time when the optimal initial response is obtained.
- treatment may be continuous for days, weeks, or years, or may be at intervals with intervening rest periods.
- the dosage may be modified in accordance with other treatments the individual may be receiving.
- the method of treatment is in no way limited to a particular
- concentration or range of the targeted retroviral particle may be varied for each individual being treated and for each derivative used.
- dosage administered to an individual being treated may vary depending on the individuals age, severity or stage of the disease and response to the course of treatment.
- Clinical parameters that may be assessed for determining dosage include, but are not limited to, tumor size, alteration in the level of tumor markers used in clinical testing for particular malignancies. Based on such parameters the treating physician will determine the therapeutically effective amount to be used for a given individual.
- Such therapies may be administered as often as necessary and for the period of time judged necessary by the treating physician.
- the targeted therapeutic vectors may be systemically or regionally (locally) delivered to a subject in need of treatment.
- the targeted therapeutic vectors may be systemically administered intravenously.
- the targeted therapeutic vectors may also be administered intra-arterially.
- the targeted therapeutic vectors may also be administered topically, intravenously, intra-arterially, intracolonically, intratracheally, intraperitoneally, intranasally, intravascularly, intrathecally, intracranially, intramarrowly, intrapleurally, intradermally, subcutaneously, intramuscularly, intraocular ly, intraosseously and/or intrasynovially.
- a combination of delivery modes may also be used, for example, a patient may receive the targeted therapeutic vectors both systemically and regionally (locally) to improve tumor responses with treatment of the targeted therapeutic vectors.
- multiple therapeutic courses may be administered to a subject in need of treatment.
- the first and/or second therapeutic course is administered intravenously.
- the first and/or second therapeutic course is administered via intraarterial infusion, including but not limited to infusion through the hepatic artery, cerebral artery, coronary artery, pulmonary artery, iliac artery, celiac trunk, gastric artery, splenic artery, renal artery, gonadal artery, subclavian artery, vertebral artery, axilary artery, brachial artery, radial artery, ulnar artery, carotid artery, femoral artery, inferior mesenteric artery and/or superior mesenteric artery.
- Intra-arterial infusion may be accomplished using endovascular procedures, percutaneous procedures or open surgical approaches.
- the first and second therapeutic course may be administered sequentially.
- the first and second therapeutic course may be administered simultaneously.
- the optional third therapeutic course may be administered sequentially or simultaneously with the first and second therapeutic courses.
- the targeted delivery vectors disclosed herein may be administered in conjunction with a sequential or concurrently administered therapeutic course(s) in high doses on a cumulative basis.
- a patient in need thereof may be systemically administered, e.g. intravenously administered, with a first therapeutic course of at least 1 x 10 9 cfu, at least 1 x 10 10 cfu, at least 1 x 10 11 cfu, at least 1 x 10 12 cfu, at least 1 x 10 13 cfu, at least 1 x 10 14 cfu or at least 1 x 10 15 cfu targeted delivery vector on a cumulative basis.
- the first therapeutic course may be systemically administered.
- the first therapeutic course may be administered in a localized manner, e.g. intra-arterially, for example a patient in need thereof may be administered via intra-arterial infusion with at least 1 x 10 9 cfu, at least 1 x 10 10 cfu, at least 1 x 10 11 cfu, at least 1 x 10 12 cfu, at least 1 x 10 13 cfu, at least 1 x 10 14 cfu or at least 1 x 10 15 cfu targeted delivery vector on a cumulative basis.
- intra-arterially for example a patient in need thereof may be administered via intra-arterial infusion with at least 1 x 10 9 cfu, at least 1 x 10 10 cfu, at least 1 x 10 11 cfu, at least 1 x 10 12 cfu, at least 1 x 10 13 cfu, at least 1 x 10 14 cfu or at least 1 x 10 15 cfu targeted delivery vector on
- a patient in need thereof may receive a
- a patient in need thereof may be first systemically administered with at least 1 x 10 9 cfu, at least 1 x 10 10 cfu, at least 1 x 10 11 cfu, at least 1 x 10 12 cfu, at least 1 x 10 13 cfu, at least 1 x 10 14 cfu or at least 1 x 10 15 cfu targeted delivery vector on a cumulative basis, followed by an additional therapeutic course of intra-arterial infusion, e.g.
- a patient in need thereof may receive a combination of intra-arterial infusion and systemic administration of targeted delivery vector in high doses.
- a patient in need thereof may be first be administered via intra-arterial infusion with at least 1 x 10 9 cfu, at least 1 x 10 10 cfu, at least 1 x 10 11 cfu, at least 1 x 10 12 cfu, at least 1 x 10 13 cfu, at least 1 x 10 14 cfu or at least 1 x 10 15 cfu targeted delivery vector on a cumulative basis, followed by an additional therapeutic course of systemically administered targeted delivery vector of at least 1 x 10 9 cfu, at least 1 x 10 10 cfu, at least 1 x 10 11 cfu, at least 1 x 10 12 cfu, at least 1 x 10 13 cfu, at least 1 x 10 14 cfu or at least 1 x 10 15 cfu on a cumulative basis.
- the therapeutic courses may also be administered simultaneously, i.e. a therapeutic course of high doses of targeted delivery vector, for example, at least 1 x 10 9 cfu, at least 1 x 10 10 cfu, at least 1 x 10 1 1 cfu, at least 1 x 10 12 cfu, at least 1 x 10 13 cfu, at least 1 x 10 14 cfu or at least 1 x 10 15 cfu targeted delivery vector on a cumulative basis, together with a therapeutic course of intra-arterial infusion, e.g.
- hepatic arterial infusion administered targeted delivery vector of at least 1 x 10 9 cfu, at least 1 x 10 10 cfu, at least 1 x 10 1 1 cfu, at least 1 x 10 12 cfu, at least 1 x 10 13 cfu, at least 1 x 10 14 cfu or at least 1 x 10 15 cfu on a cumulative basis.
- a patient in need thereof may additionally receive, either sequentially or concurrently with the first and second therapeutic courses, additional therapeutic courses (e.g. third therapeutic course, fourth therapeutic course, fifth therapeutic course) of cumulative dose of targeted delivery vector, for example, at least 1 x 10 9 cfu, at least 1 x 10 10 cfu, at least 1 x 10 1 1 cfu, at least 1 x 10 12 cfu, at least 1 x 10 13 cfu, at least 1 x 10 14 cfu or at least 1 x 10 15 cfu targeted delivery vector on a cumulative basis.
- additional therapeutic courses e.g. third therapeutic course, fourth therapeutic course, fifth therapeutic course
- cumulative dose of targeted delivery vector for example, at least 1 x 10 9 cfu, at least 1 x 10 10 cfu, at least 1 x 10 1 1 cfu, at least 1 x 10 12 cfu, at least 1 x 10 13 cfu, at least 1 x 10 14 cfu or at
- the patient in need of treatment may be administered systemically (e.g. intravenously) a cumulative dose of at least 1 x 10 1 1 cfu, followed by the administration via intra-arterial infusion (e.g. hepatic-arterial infusion) of a cumulative dose of at least 1 x 10 1 1 cfu.
- the patient in need of treatment may be administered systemically (e.g. intravenously) a cumulative dose of at least 1 x 10 12 cfu, followed by the administration via intra-arterial infusion (e.g. hepatic-arterial infusion) of a cumulative dose of at least 1 x 10 12 cfu.
- the patient in need of treatment may be administered systemically (e.g. intravenously) a cumulative dose of at least 1 x 10 13 cfu, followed by the administration via intra-arterial infusion (e.g. hepatic- arterial infusion) of a cumulative dose of at least 1 x 10 13 cfu.
- the patient in need of treatment may be administered systemically (e.g. intravenously) a cumulative dose of at least 1 x 10 1 1 cfu, concurrently with the administration via intraarterial infusion (e.g. hepatic-arterial infusion) of a cumulative dose of at least 1 x 10 11 cfu.
- the patient in need of treatment may be administered systemically (e.g. intravenously) a cumulative dose of at least 1 x 10 13 cfu, followed by the administration via intra-arterial infusion (e.g. hepatic- arterial infusion) of a cumulative dose of at least 1 x 10 13 cfu.
- the patient in need of treatment may be administered systemically (e.g. intravenously) a cumulative dose of at least 1 x 10 13 cfu, together with the administration via intra-arterial infusion (e.g. hepatic- arterial infusion) of a cumulative dose of at least 1 x 10 13 cfu.
- a patient in need of treatment may also be administered, either systemically or localized (for example intra-arterial infusion, such as hepatic arterial infusion) a therapeutic course of targeted delivery vector for a defined period of time.
- the period of time may be at least one day, at least two days, at least three days, at least four days, at least five days, at least six days, at least seven days, at least one week, at least two weeks, at least three weeks, at least four weeks, at least five weeks, at least six weeks, at least seven weeks, at least eight weeks, at least 2 months, at least three months, at least four months, at least five months, at least six months, at least seven months, at least eight months, at least nine months, at least ten months, at least eleven months, at least one year, at least two years, at least three years, at least four years, or at least five years.
- Administration could also take place in a chronic manner, i.e. for an undefined or indefinite period of time.
- Administration of the targeted delivery vector may also occur in a periodic manner, e.g., at least once a day, at least twice a day, at least three times a day, at least four times a day, at least five times a day.
- Periodic administration of the targeted delivery vector may be dependent upon the time of targeted delivery vector as well as the mode of administration. For example, parenteral administration may take place only once a day over an extended period of time, whereas oral administration of the targeted delivery vector may take place more than once a day wherein administration of the targeted delivery vector takes place over a shorter period of time.
- the subject is allowed to rest 1 to 2 days between the first therapeutic course and second therapeutic course. In some embodiments, the subject is allowed to rest 2 to 4 days between the first therapeutic course and second therapeutic course. In other embodiments, the subject is allowed to rest at least 2 days between the first and second therapeutic course. In yet other embodiments, the subject is allowed to rest at least 4 days between the first and second therapeutic course. In still other embodiments, the subject is allowed to rest at least 6 days between the first and second therapeutic course. In some embodiments, the subject is allowed to rest at least 1 week between the first and second therapeutic course. In yet other embodiments, the subject is allowed to rest at least 2 weeks between the first and second therapeutic course.
- the subject is allowed to rest at least one month between the first and second therapeutic course. In some embodiments, the subject is allowed to rest at least 1-7 days between the second therapeutic course and the optional third therapeutic course. In yet other embodiments, the subject is allowed to rest at least 1-2 weeks between the second therapeutic course and the optional third therapeutic course.
- an intra- patient dose escalation regimen by intravenous infusion of REXIN-G was given daily for 8- 10 days. Completion of this regimen was followed by a one-week rest period for assessment of toxicity; after which, the maximum tolerated dose of REXIN-G was administered IV for another 8-10 days. If the patient did not develop a grade 3 or 4 adverse event related to REXIN-G during the treatment periods, the dose of REXIN-G was escalated as follows:
- Stage IVB pancreatic cancer with numerous liver metastases was given a frontline treatment with intravenous REXIN-G for six days, followed by 8 weekly doses of gemcitabine at 1000 mg/m 2 in a second clinical protocol approved by the Philippine BFAD.
- the Calculus of Parity assumes from the outset, (i) that the therapeutic agent (in this case REXIN-GTM) is adequately targeted such that physiological barriers including dilution, turbulence, flow, diffusion barriers, filtration, inactivation, and clearance are sufficiently counteracted such that a physiological performance coefficient ( ⁇ ) or physiological multiplicity of infection (P-MOI) can be calculated, (ii) that the agent is effective at levels that do not confer restrictive dose-limiting toxicities, and (iii) that the agent is available in sufficiently high concentrations to allow for intravenous administration of the personalized doses without inducing volume overload.
- the therapeutic agent in this case REXIN-GTM
- P-MOI physiological multiplicity of infection
- the physiological performance coefficient for cytocidal cyclin Gl constructs varies from 4 to 250, and depends in part on the titer of the drug (Gordon et al. (2000) Cancer Res. 60:3343-3347).
- the optimal dosage of the therapeutic targeted vectors, including REXIN-G to be given each day, the following factors were taken into consideration: (1) the total tumor burden based on radiologic imaging studies, (2) the physiological performance coefficient ( ⁇ ) of the system, which specifies the multiplicity of inducible gene transfer units needed per target cancer cell, and (3) the precise potency of the drug defined in terms of vector titer, which is expressed in colony forming units (U) per ml.
- One gene transfer unit is the equivalent of one colony forming unit.
- the Calculus of Parity predicts that tumor control can be achieved if the dose of the targeted vector administered is equivalent to the emergent tumor burden; yet the total dosage should be administered in as short a period of time as considered safely possible, in order to prevent catch- up tumor growth while allowing time for the reticuloendothelial system to eliminate the resulting tumor debris (Gordon et al. (2000) Cancer Res. 60:3343-3347).
- Tumor Burden is derived from the equation [the sum of the longest diameters (cm) of target lesions] x [1 x 10e9 cancer cells/cm]
- Potency is the number of colony forming units (U) per ml of drug solution.
- patient has a locally advanced tumor of dimensions of 2 cm x 2 cm and 4 liver lesions, three of which measure 1 cm x 1 cm, and the fourth measures 2 cm x 2 cm
- Tumor Burden pancreas, liver
- x lxl 0e9 cells/cm 14 x 10e9 cancer cells
- REXIN-G storage units e.g. glass vials, cryobags
- the total volume of the REXIN-G dose is divided by the standard volume of REXIN-G contained in a storage unit from the lot used.
- REXIN-G may be supplied in, for example, cryobags or glass vials in either 20 ml or 40 ml aliquots.
- the advent of targeted therapies, including targeted gene therapy, is changing the way tumor responses to a cancer drug are being evaluated.
- the methods disclosed herein are especially useful in treating cancers or other disorders resistant to traditional therapies, e.g. resistant to chemotherapy, antibody-based therapies or other standard therapies. Induction of remission, enabling of surgical resection of the tumor, or prevention of recurrence of the cancer or other disorder are among the objective responses gained from use of the targeted delivery vectors.
- the methods described herein are especially useful in cancers or other disorders that are resistant to traditional therapies, e.g. resistant to chemotherapy, antibody-based therapies or other standard therapies.
- administration of the targeted delivery vectors may occur even after all standard therapies have failed or been less than successful.
- combination of the targeted delivery vectors with standard therapies e.g. chemotherapeutic agent, a biologic agent, or radiotherapy prior to, contemporaneously with, or subsequent to the administration of the therapeutic viral particles
- standard therapies e.g. chemotherapeutic agent, a biologic agent, or radiotherapy prior to, contemporaneously with, or subsequent to the administration of the therapeutic viral particles
- combination of the targeted delivery vectors with primary, adjuvant or neoadjuvant anti-cancer therapies are contemplated as an embodiment of the present disclosure.
- the terms "cancer treatment,” “cancer therapy,” “anti-cancer therapy” and the like encompasses treatments such as surgery, radiation therapy, administration of chemotherapeutic agents and combinations of any two or all of these methods. Combination treatments may occur sequentially or concurrently.
- Treatments, such as radiation therapy and/or chemotherapy, that is administered prior to surgery are referred to as neoadjuvant therapy.
- adjuvant therapy chemotherapy, administered after surgery is referred to herein as adjuvant therapy.
- surgeries that may be used for cancer treatment include, but are not limited to radical prostatectomy, cryotherapy, mastectomy, lumpectomy, transurethral resection of the prostate, and the like.
- Anti-cancer therapies include, but are not limited to, DNA damaging agents, topoisomerase inhibitors and mitotic inhibitors.
- Many chemotherapeutics are presently known in the art and can be used in combination with the targeted delivery vectors described herein.
- the chemotherapeutic is selected from the group consisting of mitotic inhibitors, alkylating agents, anti-metabolites, intercalating antibiotics, growth factor inhibitors, cell cycle inhibitors, enzymes, topoisomerase inhibitors, biological response modifiers, anti-hormones, angiogenesis inhibitors, and anti-androgens.
- a principle in cancer therapy has been that the therapeutic benefit gained from a prospective chemotherapeutic agent must outweigh the risk of serious or fatal systemic toxicity induced by the drug candidate.
- the Response Evaluation Criteria in Solid Tumors was developed by the National Cancer Institute (NCI), Bethesda Maryland, USA, and has been employed by most, if not all, academic institutions as the universal standard for tumor response evaluations (Therasse et al, (2000) J. Nat'l. Cancer Inst. 92:205-216).
- NTR objective tumor response
- OTR objective tumor response
- An OTR consists of at least a 30% reduction in the size of target lesions and/or complete disappearance of metastatic foci or non-target lesions.
- many biologic response modifiers of cancer are, in fact, not associated with tumor shrinkage, but have been shown to prolong progression- free survival (PFS), and overall survival (OS) (Abeloff, (2006) Oncol. News Int'l. 15:2-16).
- PFS progression- free survival
- OS overall survival
- the response to effective biologic agents is often physiologic and RECIST may no longer be the appropriate standard for evaluation of tumor response to biologic therapies.
- alternative surrogate endpoints such as measurements of tumor density (an index of necrosis), blood flow and glucose utilization in tumors, and other refinements of imaging methods used to evaluate the mechanisms of tumor response are called for.
- necrosis is a prominent feature
- the size of the tumors may actually become larger after REXIN-G treatment, due to the inflammatory reaction evoked by the necrotic tumor and cystic conversion of the tumor.
- an increase in the size of tumor nodules on CT scan, PET scan or MRI does not necessarily indicate disease progression. Therefore, additional concomitant evaluations that reflect the histological quality of the treated tumors may be used to more accurately determine the extent of necrosis or cystic changes induced by treatment, and accordingly monitor progress of the therapeutic retroviral vector particle therapy.
- tumor density measurement in Hounsfield Units (HU) is an accurate and reproducible index of the extent of tumor necrosis.
- a progressive reduction in the density of target lesions indicates a positive treatment effect.
- a progressive reduction in standard uptake value (SUV) in target lesions indicates decreased tumor activity and positive treatment effect.
- SUV standard uptake value
- TILs tumor infiltrating lymphocytes
- PET criteria metabolic activity
- CHOI criteria tumor density
- RECIST size only
- retroviral vectors may elicit the production of vector neutralizing antibodies in the recipient, thereby hampering further treatment.
- immunosuppressive treatments include drugs (cyclophosphamide, FK506), cytokines (interferon-gamma, interleukin-12) and monoclonal antibodies (anti-CD4, anti-pgp39, CTLA4-Ig) (Potter and Chang, (1999) Ann. N.Y. Acad. Sci. 875: 159-174).
- neutralizing antibodies may be removed by extracorporeal immuno adsorption (Nilsson et al. (1990) Clin. Exp. Immunol. 82(3)440- 444). Neutralizing antibodies can also be depleted in vivo by the administration of larger doses of vector.
- the REXIN-G vector has low immuno genicity and to date, vector neutralizing antibodies have not been detected in the serum of patients over a 6 month follow-up period.
- kits or drug delivery systems comprising the compositions for use in the methods described herein. All the essential materials and reagents required for administration of the targeted retroviral particle may be assembled in a kit (e.g., packaging cell construct or cell line, cytokine expression vector). The components of the kit may be provided in a variety of formulations as described above. The one or more targeted retroviral particle may be formulated with one or more agents (e.g., a
- chemotherapeutic agent into a single pharmaceutically acceptable composition or separate pharmaceutically acceptable compositions.
- kits or drug delivery systems may also be provided in dried or lyophilized forms.
- reconstitution generally is by the addition of a suitable solvent, which may also be provided in another container means.
- the kits of the invention may also comprise instructions regarding the dosage and or administration information for the targeted retroviral particle.
- the kits or drug delivery systems of the present invention also will typically include a means for containing the vials in close confinement for commercial sale such as, e.g., injection or blow-molded plastic containers into which the desired vials are retained.
- kits may also comprise, or be packaged with, an instrument for assisting with the injection/administration or placement of the ultimate complex composition within the body of a subject.
- an instrument may be an applicator, inhalant, syringe, pipette, forceps, measured spoon, eye dropper or any such medically approved delivery vehicle.
- a method for conducting a gene therapy business includes generating targeted delivery vectors and establishing a bank of vectors by harvesting and suspending the vector particles in a solution of suitable medium and storing the suspension.
- the method further includes providing the particles, and instructions for use of the particles, to a physician or health care provider for administration to a subject (patient) in need thereof.
- Such instructions for use of the vector can include the exemplary treatment regimen provided in Table 1.
- the method optionally includes billing the patient or the patient's insurance provider.
- kits disclosed herein to a physician or health care provider.
- the plasmid pBvl/CAEP contains coding sequences of the 4070A amphotropic envelope protein (GenBank accession number: M33469), that have been modified to incorporate an integral gain of collagen-binding function (Hall et al, Human Gene Therapy, 8:2183-2192, 1997).
- the parent expression plasmid, pCAE (Morgan et al, Journal of Virology, 67:4712-4721, 1967) was provided by the USC Gene Therapy
- This pCAE plasmid was modified by insertion of a Pst I site (get gca gga, encoding the amino acids AAG) near the N-terminus of the mature protein between the coding sequences of amino acids 6 and 7 (pCAEP).
- a synthetic oligonucleotide duplex (gga cat gta gga tgg aga gaa cca tea ttc atg get ctg tea get gca) (SEQ ID NO:5), encoding the amino acids GHVGWREPSFMALSAA (SEQ ID NO: l), a minimal collagen-binding decapeptide (in bold) derived from the D2 domain of bovine von Willebrand Factor (Hall et al, Human Gene Therapy, 11 :983-993, 2000) and flanked by strategic linkers (underlined), was cloned into this unique Pst I site to produce pBvl/CAEP.
- the expression of the chimeric envelope protein in 293T producer cells is driven by the strong CMV i.e. promoter.
- the chimeric envelope is processed correctly and incorporated stably into retroviral particles, which exhibit the gain-of- function phenotype without appreciable loss of infectious titer. Correct orientation of the collagen-binding domain was confirmed by DNA sequence analysis, and plasmid quality control was confirmed by restriction digestion Pst I, which linearizes the plasmid and releases the collagen-binding domain.
- NewEnvRI 5' CCTCTAGATTATCATGGCTCGTACTCTATGGGTTTTAGCTGG 3'
- pBVl/CAEP was used as the template for the PCR reaction to insure that the unique von Willebrand collagen binding site (GHVGWREPSFMALSAA) (SEQ ID NO: l) would be properly copied into the new open reading frame only Envelope PCR product.
- the proper 2037 bp pair PCR product was produced and ligated into a pCR2 cloning vector and sequenced to insure 100 % sequence conformity to expected sequence.
- This sequenced Moloney Envelope open reading frame only gene was excised from the pCR2 plasmid backbone and subcloned into the ultra high expression plasmid pHCMV form Genelantis to produce the new plasmid, pB-RVE.
- This plasmid was tested in a number of different titer assays and found to its strength had increased such that it was now optimal to use 3-5 times less of it by quantity in a transfection in to 293T cells along with pCgpn and pE-REX to achieve similar titers. This implies that the pB-RVE plasmid is 3-5 times stronger than the corresponding pBVl/CAEP plasmid in producing functional envelope protein. However, if the same amount of pB- RVE plasmid is used as the normal amount pBVl/CAEP, far less titer would be produced.
- the plasmid pCgpn contains the MoMuLV gag-pol coding sequences
- the following describes the construction of the plasmid bearing the pdnGl/C-REX retroviral expression vector which contains the dominant negative cyclin Gl construct (dnGl).
- the plasmid is enhanced for production of vectors of high infectious titer by transient transfection protocols.
- the cDNA sequences (472-1098 plus stop codon) encoding aa 41 to 249 of human cyclin Gl (CYCG1, Wu et al, Oncology Reports, 1 :705- 11, 1994; accession number U47413) were generated from a full length cyclin Gl template by PCR, incorporating Not I / Sal I overhangs.
- the N-terminal deletion mutant construct was cloned initially into a TA cloning vector (Invitrogen), followed by Not I /Sal I digestion and ligation of the purified insert into a Not I / Sal I digested pGlXSvNa retroviral expression vector (Genetic Therapy, Inc.) to produce the pdnGlSvNa vector complete with 5' and 3' long terminal repeat (LTR) sequences and a ⁇ retroviral packaging sequence.
- TA cloning vector Invitrogen
- Not I /Sal I digestion and ligation of the purified insert into a Not I / Sal I digested pGlXSvNa retroviral expression vector (Genetic Therapy, Inc.) to produce the pdnGlSvNa vector complete with 5' and 3' long terminal repeat (LTR) sequences and a ⁇ retroviral packaging sequence.
- LTR long terminal repeat
- a CMV i.e. promoter-enhancer was prepared by PCR from a CMV-driven pIRES template (Clontech), incorporating Sac II overhangs, and cloned into the unique Sac II site of pdnGlSvNa upstream of the 5' LTR.
- the neomycin resistance gene which facilitates determination of vector titer, is driven by the Sv40 e.p. with its nested ori.
- the inclusion of the strong CMV promoter in addition to the Sv40 ori, facilitate high titer retroviral vector production in 293T cells expressing the large T antigen (Soneoka et al, Nucleic Acid Research, 23:628-633, 1995).
- gag-pol plasmid constructs contain a significant number of residual gag-pol sequences that potentially overlap with 5' DNA sequences contained in the respective gag-pol plasmid construct (Yu et al, 2000); and that these significant areas of overlap could become problematic when vector production is eventually scaled-up to commercial volumes with larger cell numbers and corresponding plasmid concentrations.
- Mx-dnGl (REXIN-GTM)
- the final product, Mx-dnGl is a matrix (collagen)-targeted retroviral vector encoding a N-terminal deletion mutant human cyclin Gl construct under the control of a hybrid LTR/CMV promoter.
- the vector also contains the neomycin resistance gene which is driven by the SV40 early promoter.
- the Mx-dnGl vector is produced by transient co-transfection with 3 plasmids of 293T (human embryonic kidney 293 cells transformed with SV40 large T antigen) cells obtained from a fully validated master cell bank.
- the components of the transfection system includes the pdnGl/C-REX therapeutic plasmid construct which contains the deletion mutant of the human cyclin Gl gene encoding a.a. 41 to 249 driven by the CMV immediate early promoter, packaging sequences, and the bacterial neomycin resistance gene under the control of an internal SV40 early promoter.
- the truncated cyclin Gl gene was initially cloned into a TA cloning vector (Invitrogen), followed by Not I/Sal I digestion and ligation of the purified insert into a Not I/Sal I digested pGlXSvNa retroviral expression vector (provided by Genetic Therapy, Inc., Gaithersburg, MD) to produce the pdnGlSvNa vector complete with 5' and 3 ' LTR sequences and a ⁇ sequence.
- the CMV i.e.
- promoter-enhancer was prepared by PCR from a CMV-driven pIRES template (Clontech), incorporating Sac II overhangs, and cloned into the unique SacII site of pdnGlSvNa upstream of the 5 'LTR.
- REX a next generation plasmid that encodes and expresses exactly the same transgenes (dnGl and neo) without 487 base pairs of GAG found in the original pdnGl/C-REX.
- the system further includes the Mx (Bvl/pCAEP) envelope plasmid containing a CMV-driven modified amphotropic 4070A envelope protein wherein a collagen-binding peptide was inserted into an engineered Pst I site between a.a. 6 and 7 of the N terminal region of the 4070A envelope.
- Mx Bvl/pCAEP
- RVE an improved plasmid that eliminates 114 bp of extraneous retroviral sequences that potentially overlap with native untranslated (UTR) sequences.
- the system also includes the pCgpn plasmid which contains the MLV gag- pol elements driven by the CMV immediate early promoter. It is derived from clone 3PO as pGag-pol-gpt.
- the vector backbone is a pcDNA3.1+ from Invitrogen. Polyadnylation signal and transcription termination sequences from bovine growth hormone enhance RNA stability.
- An SV40 ori is featured along with the e.p. for episomal replication and vector rescue in cell lines expressing SV40 target T antigen.
- the plasmids have been analyzed by restriction endonuclease digestion and the cell line consists of a DMEM base supplemented with 4 grams per liter glucose, 3 grams per liter sodium bicarbonate, and 10% gamma irradiated fetal bovine serum (Biowhittaker).
- the serum was obtained from USA sources, and has been tested free of bovine viruses in compliance with USDA regulations.
- the budding of the retroviral particles is enhanced by induction with sodium butyrate.
- the resulting retroviral particles are processed solely by passing the supernatant through a 0.45 micron filter or concentrated using a tangential flow/diafiltration method.
- the retroviral particles are Type C retrovirus in appearance.
- Retroviral particles will be harvested and suspended in a solution of 95% DMEM medium and 1.2% human serum albumin. This formulation is stored in aliquots of 150 ml in a 500 ml cryobag and kept frozen at -70 to -86°C until used.
- REX plasmids the production, suspension, and collection of therapeutic nanoparticles are performed in the absence of bovine serum in a final formulation of proprietary medium, which is processed by sequential clarification, filtration and final fill into cryobags using a sterile closed loop system.
- the resulting C-type retroviral particles with an average diameter of 100 nanometers, are devoid of all viral genes, and are fully replication defective.
- the titers of the clinical lots range from 3 x 10e7 to 5 x 10e9 colony forming units (U)/ml, and each lot is validated for requisite purity and biological potency.
- Preparation of the Mx-dnGl vector for patient administration consists of thawing the vector in the vector bag in a 37°C 80% ethanol bath. Each vector bag will be thawed one hour prior to infusion into the patient, treated with Pulmozyme (10 U/ml),and immediately infused within 1-3 hours.
- Mx-dnGl The efficacy of Mx-dnGl in inhibiting cancer cell proliferation in vitro, and in arresting tumor growth in vivo in a nude mouse model of liver metastasis, was tested.
- a human undifferentiated cancer cell line of pancreatic origin was selected as the prototype of metastatic cancer. Retroviral transduction efficiency in these cancer cells was excellent, ranging from 26% to 85%, depending on the multiplicity of infection (4 and 250
- Mx-dnGl vector For selection of a therapeutic gene, cell proliferation studies were conducted in transduced cells using vectors bearing various cyclin Gl constructs. Under standard conditions, the Mx-dnGl vector consistently exhibited the greatest anti-pro liferative effect, concomitant with the appearance of immunoreactive cyclin Gl at the region of 20 kDa, representing the dnGl protein. Based on these results, the Mx-dnGl vector was selected for subsequent in vivo efficacy studies.
- Mx-dnGl To assess the performance of Mx-dnGl in vivo, a nude mouse model of liver metastasis was established by infusion of 7 x 10 5 human pancreatic cancer cells into the portal vein via an indwelling catheter that was kept in place for 14 days. Vector infusions were started three days later, consisting of 200 ml/day of either Mx-dnGl (REXIN-G; titer: 9.5 x 10 8 cfu/ml) or PBS saline control for a total of 9 days. The mice were sacrificed one day after completion of the vector infusions.
- Mx-dnGl REXIN-G; titer: 9.5 x 10 8 cfu/ml
- PBS saline control PBS saline control
- Mx-dnGl deployed by peripheral vein injection (i) accumulated in angiogenic tumor vasculature within one hour, (ii) transduced tumor cells with high level efficiency, and (iii) enhanced therapeutic gene delivery and long term efficacy without eliciting appreciable toxicity.
- Matrix-targeted injectable retroviral vectors incorporating peptides that target extracellular matrix components have been demonstrated to enhance therapeutic gene delivery in vivo. Additional data are presented using two mouse models of cancer and two matrix-targeted MLV-based retroviral vectors bearing a cytocidal/cyto static dominant negative cyclin Gl construct (designated Mx-dnGl and MxV-dnGl). Both Mx- dnGl and MxV-dnGl are amphotropic 4070 A MLV- based retroviral vectors displaying a matrix (collagen) -targeting motif for targeting areas of pathology. The only difference between the two vectors is that MxV-dnGl is pseudotyped with a vesicular stomatitis virus G protein.
- MiaPaca2 pancreatic cancer cells prototype for metastatic gastrointestinal cancer
- 7 X 10 5 MiaPaca2 cells were injected through the portal vein via an indwelling catheter which was kept in place for 10-14 days.
- a TaqManTM based assay was developed to detect the GlXSvNa- based vector containing SV40 and Neomycin (Neo) gene sequences into mouse genomic DNA background (Althea Technologies, San Diego, CA, USA). The assay detects a 95 nt amplicon (nts.
- Mx-dnGl or MxV-dnGl vector Low level positive signals were detected in the liver, lung and spleen of both low dose and high dose vector-treated animals. No PCR signal was detected in the testes, brain or heart of vector-treated animals. Histopathologic examination revealed portal vein phlebitis, pyelonephritis with focal myocarditis in two animals with indwelling catheters and no antibiotic prophylaxis. No other pathology was noted in non- target organs of Mx-dnG 1 - or MxV-dnG 1 -treated mice. Serum chemistry profiles revealed mild elevations in ALT and AST in the Mx-dnGl -treated animals compared to PBS controls. However, the levels were within normal limits for mice. No vector neutralizing antibodies were detected in the sera of vector-treated animals in a 7-week follow-up period.
- Mx-dnGl in two nude mouse models of human pancreatic cancer showed no appreciable damage to neighboring normal tissues nor systemic side effects.
- the method of targeted gene delivery via intravenous infusion offers several clinically relevant advantages.
- the objectives of the study were (1) to determine the dose-limiting toxicity and maximum tolerated dose (safety) of successive intravenous infusions of REXIN-G, and (2) to assess potential anti-tumor responses.
- the protocol was designed for end-stage cancer patients with an estimated survival time of at least 3 months.
- Three patients with Stage IV pancreatic cancer who were considered refractory to standard chemotherapy by their medical oncologists were invited to participate in the compassionate use protocol using REXIN-G as approved by the Philippine Bureau of Food and Drugs.
- An intrapatient dose escalation regimen by intravenous infusion of REXIN-G was given daily for 8-10 days.
- Tumor response was evaluated by serial determinations of the tumor volume using the formula: width 2 x length x 0.52 as measured by calipers, or by radiologic imaging (MRI or CT scan).
- Patient #1 a 47 year-old Filipino female was diagnosed, by histologic examination of biopsied tumor tissue and staging studies, to have localized adenocarcinoma of the pancreatic head. She underwent a Whipples surgical procedure which included complete resection of the primary tumor. This was followed by single agent gemcitabine weekly for 7 doses, but chemotherapy was discontinued due to unacceptable toxicity.
- the patient received two 10-day treatment cycles of REXIN-G for a cumulative dose of 2.1 x lOel 1 Units over 28 days, with an interim rest period of one week. In the absence of systemic toxicity, the patient received an additional 10-day treatment cycle for a total cumulative dose of 3 x lOel 1 Units.
- Patient # 2 a 56 year-old Filipino female was diagnosed to have Stage IVA locally advanced and non-resectable carcinoma of the pancreatic head, by cytologic examination of biliary brushings. Exploratory laparotomy revealed that the tumor was wrapped around the portal vein and encroached in close proximity to the superior mesenteric artery and vein. She had received external beam radiation therapy with 5- fluorouracil, and further received single agent gemcitabine weekly for 8 doses, followed by monthly maintenance doses. However, a progressive rise in CA19-9 serum levels was noted and a follow-up CT scan revealed that the tumor had increased in size (Figure 2A).
- IVB adenocarcinoma of the body and tail of the pancreas with numerous metastases to the liver and portal lymph node, confirmed by CT guided liver biopsy.
- the patient was invited to participate in a second clinical protocol using REXIN-G frontline followed by gemcitabine weekly.
- a priming dose of REXIN-G was administered to sensitize the tumor to chemotherapy with gemcitabine for better cytocidal efficacy.
- Table 3 illustrates the comparative evaluation of over-all tumor responses in the three patients. Using the RECIST criteria, REXIN-G induced tumor growth
- Clinical Study A includes Phase I/II or single-use protocols investigating intravenous infusions of REXIN-GTM for locally advanced or metastatic pancreatic cancer following approval by the Philippine Bureau of Food and Drugs (BFAD) or by the United States Food Drug Administration (FDA), and the Institutional Review Board or Hospital Ethics Committee (Gordon et al. (2004) Int'l. J. Oncol. 24: 177-185).
- the objectives of the study were (1) to determine the safety/toxicity of daily intravenous infusions of REXIN- GTM, and (2) to assess potential anti-tumor responses to intravenous infusions of REXIN- GTM
- the protocol was designed for patients with an estimated survival time of at least 3 months.
- the REXIN-G preparation had a potency of 3 x 10e7 Units/ml.
- the vector Since the vector will accumulate more readily in certain cancerous lesions - depending on the degree of tumor invasiveness and angiogenesis - it is not expected to be distributed evenly to the rest of the tumor nodules, particularly in patients with large tumor burdens. This would predictably induce a mixed tumor response wherein some tumors may decrease in size while other tumor nodules may become bigger and/or new lesions may appear. Thereafter, with the normalization or decline of the overall tumor burden, the pathotropic surveillance function would distribute the circulating nanoparticles somewhat more uniformly. Additionally, the treated lesions may initially become larger in size due to the inflammatory reactions or cystic changes induced by the necrotic tumor.
- This initial Phase I/II study examines the safety and potential efficacy of an intra-patient dose escalation protocol. As shown in Table 4, partial responses (PR) of varying degrees were noted in 5 out of 6 patients treated with REXIN-G while stable disease was observed in the remaining patient. Three of 6 (50%) patients had a 30% or greater decrease in tumor size by RECIST or by tumor volume measurement, and 2 of 6 (33%) patients had necrosis of either the primary tumor or metastatic nodules by biopsy and/or by follow-up MRI/CAT scan.
- Table 4 Objective Tumor Response, Progression- free Survival, and Overall Survival of Participants in Clinical Study A
- Example 7 Clinical Study B. Phase I/II REXIN-G in Various Advanced or Metastatic Solid Tumors
- Clinical Study B represents an expansion of Clinical Study A. Based on the encouraging results of the initial clinical experiences with REXIN-G, the Phase I/II study was expanded to further determine the safety and potential efficacy of a higher dose of
- REXIN-G to extend the clinical indication to all advanced or metastatic solid tumors that are refractory to standard chemotherapy, and to adjust the treatment schedule and protocol to enable outpatient treatment.
- the objectives of this study were (1) to determine the
- the protocol was designed for patients with an estimated survival time of at least 3 months.
- the vector Since the vector will accumulate more readily in certain cancerous lesions - depending on the degree of tumor invasiveness and angiogenesis - it is not expected to be distributed evenly to the rest of the tumor nodules, particularly in patients with large tumor burdens. This would predictably induce a mixed tumor response wherein some tumors may decrease in size while other tumor nodules may become bigger and/or new lesions may appear. Thereafter, with the normalization or decline of the overall tumor burden, the pathotropic surveillance function would distribute the circulating nanoparticles somewhat more uniformly. Additionally, the treated lesions may initially become larger in size due to the inflammatory reactions or cystic changes induced by the necrotic tumor.
- Table 5 Objective Tumor Response, Progression- free Survival, and Overall Survival of Participants in Clinical Study B
- Example 8 Clinical Study C, Expanded Access of REXIN-G in Metastatic Pancreatic and Colon Cancer and "The Calculus of Parity"
- Clinical Study C involves a small group of patients who participated in an
- Tumor burden was measured as the sum of the longest diameters of the tumor nodules, in centimeters, multiplied by 1 x 10e9 and expressed as the total number of cancer cells.
- the vector Since the vector will accumulate more readily in certain cancerous lesions - depending on the degree of tumor invasiveness and angiogenesis - it is not expected to be distributed evenly to the rest of the tumor nodules, particularly in patients with large tumor burdens. This would predictably induce a mixed tumor response wherein some tumors may decrease in size while other tumor nodules may become bigger and/or new lesions may appear. Thereafter, with the normalization or decline of the overall tumor burden, the pathotropic surveillance function would distribute the circulating nanoparticles somewhat more uniformly. Additionally, the treated lesions may initially become larger in size due to the inflammatory reactions or cystic changes induced by the necrotic tumor.
- a 17-year-old white male, shown by radiography in Figure 23 A was diagnosed with osteosarcoma of the right tibia in December, 2003. He had received preoperative chemotherapy with cisplatin and adriamycin and high dose methotrexate followed by a limb salvage procedure. Post-operatively, he received courses of cisplatin and adriamycin (x 2), and adriamycin and ifosfamide (x 2), bringing the cumulative dose of adriamycin to 400 mg/m2. Chemotherapy was completed on February 2005. In March, 2006, a follow-up CT-scan showed two left-sided pulmonary metastases which were removed by VATS thorascopic surgery.
- a PET-CT scan obtained 2 weeks after completion of the 2 nd therapeutic course showed no new lesions, a 48% reduction in the sum SUV max of the 4 major target lesions, and a 539% increase in sum tumor density, indicating general calcification of the target lesions.
- the FDA approved a Phase II efficacy study of REXIN-G for metastatic osteosarcoma that is refractory to known therapies.
- tumor response criteria including PET criteria (metabolic activity), and CHOI criteria (tumor density), as well as RECIST (size only)— due to the tendency for osteosarcoma lesions to calcify rather than shrink with the cessation of tumor cell proliferation.
- Treatment with REXIN-G had a significant impact on the histology of the tumor, which upon surgical resection, was shown to have undergone cystic conversion of the one metastatic target lesion and ossification of an occult lesion, i.e., not seen by PET-CT scan (see Figure 24).
- the patient received three treatment cycles followed by surgical resection of the residual lung tumors, and then 5 more cycles of REXIN-G post-operatively.
- Ewing's sarcoma is a relatively rare malignancy of the bone and soft tissues, which is generally treated aggressively with multidrug chemotherapy, in addition to local disease control with surgery and/or radiation. In cases where progression to metastatic disease is apparent and the patient becomes refractory to standard therapies, the prognosis is exceedingly poor. In this case, a 36 year-old male was diagnosed with Ewing's sarcoma which was metastatic to lung and liver in July, 2004. His multidrug chemotherapy regimens consisted of doxorubicin, dacarbazine, and ifosfamide, in addition to radiotherapy and surgical resection.
- the patient by responding favorably to REXIN-G monotherapy—qualified for enrollment in the GeneVieve protocol, consisting of REXIN-G plus Reximmune-C (i.e., tumor-targeted GM-CSF vaccine (3) in an effort to prompt localized immune responses within the residual tumors, which might, in principle, lead to additional anti-tumor activity and long lasting anti-tumor immunity.
- REXIN-G in an Intractable Metastatic Breast Cancer Patient
- This case is a 74 year-old white female with recurrent ductal carcinoma of the breast, metastatic to axillary lymph nodes and tissues of the chest wall. She was diagnosed in September 2001 to have infiltrating ductal carcinoma of breast, T3N2 stage, for which she underwent a right mastectomy in September 2001, received doxorubicin and cyclophosphamide, radiation to the chest wall, followed by docetaxel, and then Tamoxifen which was initiated in October 2002. The breast cancer was determined to be ER positive, and questionable for HER-2/neu positivity.
- the patient remained on Tamoxifen until November, 2006, when she recurred in the chest wall, supraclavicular, axillary, and mediastinal lymph nodes, and possibly bone. She was entered in a clinical trial using Faslodex from November 30, 2006 to January 25, 2007. The patient responded initially, but there was residual therapy-resistant disease that was confirmed by repeat CT scans on February 8, 2006.
- the patient received REXIN-G i.v., 2 x lOel 1 cfu per dose given three times a week for 8 weeks.
- first distressing symptoms to abate was the severity of the bone pain followed by progressive relief from the sequelae of hydronephrosis.
- follow-up abdominal sonogram, CT scans, and bone scans showed a normal prostate gland and kidneys, with non-progression of the bone metastases; in addition to subjective relief from pain, there was a significant reduction in serum PSA levels.
- the elderly patient was eventually able to walk again with the aid of a walker, to participate in daily activities, and to resume his employment.
- Objective responses included resolution of primary tumor and regression of liver metastasis by CT scan. Resolution of primary tumor after only 4 weeks of REXIN-G treatment
- REXIN-G was used as a stand-alone therapy; 3x lOel lcfu, given 3x a week. Objective responses included complete clinical remission gained by maintaining treatment for 9 months. First demonstration of REXIN-G-induced clinical remission in a patient presenting with metastatic chemotherapy-resistant pancreatic cancer.
- adenocarcinoma of the pancreas The patient underwent a Whipple's procedure followed by a course of adjuvant chemotherapy consisting of gemcitabine and capecitabine from
- REXIN-G appears to have induced massive amounts of apoptosis of the remaining cancer cells (see TUNEL Stain in Figure 29D), as well as visible karyorrhexis—which is evident all along the borders of the pseudo-glandular structures. While the patient's local immune response is far from robust, with sporadic infiltration of CD45+ leukocytes observed within the lesion (29C), the cellular infiltrate consisted majorly of CD4+ helper T-cells (29F) and CD8+ killer T-cells (29G).
- Stage IV pancreatic cancer using REXIN-G as stand-alone therapy is particularly noteworthy: for REXIN-G, by acting as an effective adjuvant therapy, enabled a definitive surgical remission from this deadly form of cancer—which is important for both clinical and surgical oncologists to consider. Post-operatively, the patient resumed REXIN-G treatment, after healing from the procedure, and continues to enjoy sustained clinical remission for >11 months after treatment initiation.
- the gemcitabine was discontinued for a period of two weeks, due to a progressive elevation in liver enzyme levels (i.e., LFT elevation)— attributable to known gemcitabine toxicity— in accordance with standard dose/treatment modification protocols; while the REXIN-G infusions were continued during this extended rest period. Notably, the liver function tests promptly normalized while the CA19.0 continued to fall to 40% of the initial values. With the relative safety of the combined therapy established, the dose of REXIN-G was raised to 3 x lOel lcfu per dose administered three times per week during the next course of combined therapy.
- Each cohort of three could be expanded to six patients depending on toxicity or biologic activity.
- Maximum tolerated dose was defined as the highest safely tolerated dose, where ⁇ 1 patient experienced dose-limiting toxicity (DLT), with the next higher dose level having at least two patients who experienced DLTs.
- DLT was defined as any grade 3, 4, or 5 adverse events considered possibly, probably, or definitely related to the study drug, excluding anticipated events such as grade 3 ANC lasting ⁇ 72 hours, grade 3 alopecia, or any grade 3 or worse nausea, vomiting, or diarrhea (NCI Common Terminology Criteria for Adverse Events; CTCAE version. 3).
- Phase II efficacy component was incorporated in the on-going Phase I/II clinical trials by allowing additional treatment cycles to be given if the patient had ⁇ Grade I toxicity. Further, across the board dose escalations were allowed up to Dose Level II for patients with ⁇ Grade I toxicity when safety at the specified dose level was documented. The principal investigator was also allowed to recommend surgical resection/debulking and REXIN-G was continued if residual disease was found by histological examination or PET- CT scan.
- Phase I/II Sarcoma (Bone and Soft Tissue Sarcoma): 33 patients evaluable
- Table 8 shows the patient demographics for the Phase I/II sarcoma study (Chawla et al. 2009).
- the Sarcoma Study encompasses 14 types of sarcoma: osteosarcoma, Ewing's sarcoma, chondrosarcoma, liposarcoma, malignant fibrous histiocytoma, leiomyosarcoma, synovial cell sarcoma, fibrosarcoma, mixed malignant Mullerian tumor of ovary, malignant spindle cell sarcoma, angiosarcoma of heart, alveolar soft part sarcoma,
- FIG. 30 shows a direct relationship between progression- free survival and REXIN-G dose. A significant dose-response relationship between progression- free survival and REXIN-G dosage was demonstrated at the 5% statistical level by the log rank test. The proportion of patients surviving is plotted on the vertical axis as a function of time from beginning of treatment, plotted on the horizontal axis. Evaluable patients are those patients who completed at least one treatment cycle and had a tumor response evaluation.
- REXIN-G may exhibit significant anti-tumor activity, and may help control tumor growth, improve progression- free survival and overall survival in chemotherapy-resistant bone and soft tissue sarcoma.
- Phase II Efficacy Studies of REXIN-G for Osteosarcoma The goal of this study is to gain accelerated approval of REXIN-G as salvage therapy for osteosarcoma based upon the completion of a confirmatory single arm study in 20-30 patients with recurrent or metastatic osteosarcoma who are refractory to known therapies.
- the primary endpoint is clinical efficacy as measured by over-all response rates (either CR, PR or SD) by International PET criteria.
- the secondary endpoints are as follows: (1) clinical efficacy as measured by progression- free survival greater than one month and over-all survival of 6 months or longer, and (2) clinical toxicity as defined by patient performance status, toxicity assessment score, hematologic, and metabolic profiles, immune responses, vector integration in PBLs and recombination events.
- Each treatment cycle will be six weeks: four weeks of treatment and two weeks of rest. Patients with ⁇ Grade I toxicity may have repeat cycles after the safety data and objective tumor responses are recorded. Initially, patients received REXIN-G i.v. at a designated dose level which was based on the estimated tumor burden as measured by PET- CT imaging studies. Subsequently, the protocol was amended to include an intra-patient dose escalation option if there was disease progression or a disease-related adverse event.
- REXIN-G treatment enables confirmation of the beneficial anti-tumor effects of cumulative doses of REXIN-G in terms of disease stabilization and extension of over-all survival, as well as confirmation of the absence of cumulative toxicity, both of which were clearly demonstrated in a Phase I/II study of REXIN-G in metastatic bone and soft tissue sarcoma that had failed standard chemotherapy.
- the principal investigator may recommend surgical debulking or resection after one or more treatment cycle/s, enabling the histologic characterization of treated tumors and comparison with known features of REXIN-G-treated tumors, which have been demonstrated in previous preclinical and clinical studies. These features include the presence of apoptotic tumor cells and endothelial cells (the primary mechanism of action of REXIN-G), and varying degrees of central necrosis with reactive inflammatory reaction, focal micro hemorrhages (anti-angiogenic effects of REXIN-G resulting from the selective destruction of proliferative tumor endothelial cells), reparative fibrosis, and a characteristic complement of tumor infiltrating lymphocytes.
- Eligibility (Phase II study) - Patients were required to have recurrent or metastatic osteosarcoma that failed standard chemotherapy. Histologic or cytologic confirmation at diagnosis or recurrence was required. Patients were required to have an ECOG performance score of 0-1 and adequate hematologic, hepatic, and kidney function.
- Exclusion criteria included HIV, HBV or HCV positivity, clinically significant ascites, medical, or psychiatric conditions that could compromise successful adherence to the protocol, and unwillingness to employ effective contraception during treatment with REXIN-G and for four weeks following treatment completion.
- the Western Institutional Review Board approved the protocol and informed consent was obtained from all study participants.
- Pre-treatment Evaluation and Follow-up Studies included history, physical exam, hematology group, chemistry group, assessment of coagulation including prothrombin time (PT), INR, and activated partial thromboplastin time (APTT), testing for HIV, HBV and HCV, imaging evaluation to include FDG/PET-CT scan, EKG and chest x-ray. All patients had a complete blood count and serum chemistry panel performed weekly. In addition, toxicity was assessed before each vector infusion, and before beginning an additional treatment cycle. Efficacy assessment with imaging studies was also performed at the end of 6 weeks or before starting an additional treatment cycle. Patient serum was tested for presence of vector antibodies at 6 weeks and before each treatment cycle.
- PT prothrombin time
- APTT activated partial thromboplastin time
- Diphenhydramine was given as pre-medication at a dose of 12 - 50 mg, either intravenously or orally.
- Tylenol 500 mg p.o., hydrocortisone 50 - 100 mg IV, and meperidine 25 - 50 mg IV were prescribed if a hypersensitivity reaction occurred. All patients received clinical lots with a potency of 5 x 10 9 cfu/mL.
- the principal investigator may recommend surgical debulking or complete surgical removal. If residual disease is present either by histopathological examination or by PET-CT scan, repeat treatment cycles may be given 4 weeks after surgery, if the surgical incision has healed, and if the patient has ⁇ grade I toxicity.
- Terminology Criteria Version 3.0 Response was evaluated by FDG/PET/CT scan performed at baseline and following each treatment cycle. Tumor response was evaluated using the NCI RECIST criteria (Therasse et al. 2000) and the International PET criteria. Over-all evaluation of response/toxicity criteria was conducted by the principal investigator.
- CR Complete response
- PR Partial response
- SD Stable disease
- PD Progressive disease
- ND Not determined; lesion too small to be determined by CHOI
- BIW Two times a week
- TIW Three times a week
- FIG. 31A shows the efficacy data on 17 evaluable patients.
- 10/17 59%>
- evaluable patients had a complete surgical response or stable disease
- International PET criteria 4/17 patients had complete response or partial responses
- 8/17 patients had stable disease, totaling 71%> of patients having partial responses or stable disease.
- CHOI criteria 4/17 had complete or partial responses and 1 1/17 had stable disease totaling 88%> of patients having complete or partial responses or stable disease.
- tumor responses were significantly higher in the REXIN-G-treated group compared to those expected of historical controls (with ⁇ 5%> having a positive response if untreated; p ⁇ 0.025).
- Median progression- free survival was 4 months, and overall survival was 8 months (6.5 months for all 22 enrolled patients).
- Phase I/II Pancreatic CA Analysis of efficacy includes evaluable patients up to Dose Level III as shown in Table 1 1.
- CR Complete response
- PR Partial response
- SD Stable disease
- PD Progressive disease
- ND Not determined; lesion too small to be determined by CHOI
- BIW Two times a week
- TIW Three times a week
- REXIN-G may help control tumor growth and possibly help prolong overall survival in chemotherapy-resistant breast cancer.
- REXIN-G vector particles seek out and accumulate in cancerous lesions, and are expected to quickly bind to exposed collagen in the vicinity of target cancer cells. Vectors binding to non-dividing normal cells will most likely be lost, since a built-in safety feature of retroviral vectors is that they integrate only in actively dividing cells. And since collagen is not normally exposed in the circulation, there would only be a small risk of injury to proliferating cells in non-target organs.
- tumor targeting including the Epeius "pathotropic" envelope, the choice of a growth-associated cell cycle control knock-out gene, and the basic requirement of cell proliferation for MLV vectors integration, act in concert to improve the safety profile of the gene delivery system to minimize the risk of insertional mutagenesis.
- vector neutralizing antibodies The stealth nature and low immunogenicity of the REXIN-G retrovector enables repeated intravenous infusions with less concern for the development of vector-directed antibodies.
- Example 20 Phase I/II Evaluation of Safety and Efficacy of Pathotropic Nanoparticles Bearing a Dominant Negative Cvclin Gl Construct (REXIN-G) as Intervention for Recurrent or Metastatic Sarcoma
- the primary objective of this study was to determine the dose-limiting toxicity (DLT) and maximum tolerated dose (MTD) of REXIN-G administered as intravenous infusions.
- the secondary objectives of this study were to evaluate the potential of REXIN-G for evoking an immune response, recombination events, and unwanted vector integration in nontarget organs, and to identify an objective tumor response to intravenous REXIN-G.
- the MTD was defined as the highest dose in which 0 of 3 or ⁇ 1 of 6 patients experienced a DLT, with the next higher dose level having at least 2 patients who experienced a DLT.
- a DLT was defined as any National Cancer Institute Common Toxicity
- CCAE Criteria for Adverse Events
- AE adverse event
- the Intent-to -Treat (ITT) Safety Population was defined as all patients who received at least one infusion of REXIN-G and included 36 patients (used for safety and overall survival).
- the Modified Intent-to -Treat (mITT) Efficacy Population was defined as all patients who received at least one cycle (4 weeks) of REXIN-G and had a follow-up PET CT scan and included 33 patients (used for response, progression- free survival (PFS) and overall survival (OS)).
- PFS progression- free survival
- OS overall survival
- the tumor control rates (CR + PR + SD) were 67% (22/33 patients) by RECIST; 91% (30/33) by PET criteria and 94% (31/33) by Choi-modified RECIST. There were more PRs using PET and Choi-modified RECIST indicating that these tools are more sensitive indicators of tumor response to REXIN-G treatment.
- hypocalcaemia were reported in 3 patients each. Hyperbilirubinaemia, musculoskeletal chest pain, respiratory acidosis, and respiratory failure were reported in 2 patients each. All other Grade 3 AEs were reported in only 1 patient each, and all were due to disease progression.
- intravascular coagulation and post-operative complication (arrhythmia and dehydration).
- G three patients tested weakly positive for antibodies to gp70 - in each case, the response was transient and this was not associated with detection of vector neutralizing antibodies; no patient tested positive for any of the following: vector neutralizing antibodies, replication- competent retrovirus in peripheral blood lymphocytes (PBLs); or vector integration into genomic DNA of PBLs.
- vector neutralizing antibodies replication- competent retrovirus in peripheral blood lymphocytes (PBLs); or vector integration into genomic DNA of PBLs.
- Example 21 Phase I/II Evaluation of Safety and Efficacy of Pathotropic Nanoparticles Bearing a Dominant Negative Cvclin Gl Construct (REXIN-G) as Intervention for Recurrent or Metastatic Breast Cancer
- the primary objective of this study was to determine the dose-limiting toxicity (DLT) and maximum tolerated dose (MTD) of REXIN-G administered as intravenous infusions.
- the secondary objectives of this study were to evaluate the potential of REXIN-G for evoking an immune response, recombination events, and unwanted vector integration in nontarget organs, and to identify an objective tumor response to intravenous REXIN-G.
- the MTD was defined as the highest dose in which 0 of 3 or ⁇ 1 of 6 patients experienced a DLT, with the next higher dose level having at least 2 patients who experienced a DLT.
- a DLT was defined as any National Cancer Institute Common Toxicity
- CCAE Criteria for Adverse Events
- AE adverse event
- the Intent-to -Treat (ITT) Safety Population was defined as all patients who received at least one dose of REXIN-G and included 20 patients (used for safety and overall survival).
- the Modified Intent-to-Treat (mITT) Efficacy Population was defined as all patients who received at least one cycle and had a follow-up PET-CT scan and included 18 patients (used for response, progression- free survival (PFS) and overall survival (OS)). Gender and race of enrolled subjects are shown in Table 20.
- PFS by RECIST ranged from 3.5 months at Dose Level 0-1, 1.25 months at
- Dose Level II and 3 months at Dose Level III thus no dose-response relationship was apparent.
- a higher tumor burden was observed for patients in Dose Level III, which may explain the shorter PFS.
- two patients with extensive bone metastases only and no visceral involvement one patient at Dose Level III and one at Dose Level IV had a PFS of greater than one year, and remain alive more than one year after treatment initiation.
- OS was examined in the ITT and mITT population. OS estimates at 1 year was 60% at all dose levels (66% in the mITT population), and 83% at Dose Level IV in the ITT and mITT populations. Eight of 20 patients remained alive for 19 to 43 months from treatment initiation as of the last follow-up on Jun. 24, 2011. Of those remaining alive, 1 was treated at Dose Level 0-II, 2 were treated at Dose Level III, and 5 were treated at Dose Level IV. Responses are summarized in Table 21.
- G no patient tested positive for any of the following: vector neutralizing antibodies, antibodies to gp70, replication-competent retrovirus in peripheral blood lymphocytes (PBLs); vector integration into genomic DNA of PBLs.
- the tumor control rate of 76% indicates that REXIN-G may have anti-tumor activity in patients with recurrent or metastatic breast cancer who have failed prior chemotherapy.
- the 83% OS rate at 1 year for Dose Level IV is promising and suggests a survival benefit over 70% OS in historical controls receiving first-line therapy with paclitaxel (Leo et al, 2009).
- two patients with extensive bone metastases only and no visceral involvement had the longest PFS and are alive greater than one year from REXIN-G treatment initiation. No safety issues with REXIN-G were apparent.
- Example 22 Phase I/II Evaluation of Safety and Efficacy of Pathotropic Nanoparticles Bearing a Dominant Negative Cvclin Gl Construct (REXIN-G) as Intervention for Recurrent or Metastatic Pancreatic Cancer
- the primary objective of this study was to determine the dose-limiting toxicity (DLT) and maximum tolerated dose (MTD) of REXIN-G administered as intravenous infusions.
- the secondary objectives of this study were to evaluate the potential of REXIN-G for evoking an immune response, recombination events, and unwanted vector integration in nontarget organs, and to identify an objective tumor response to intravenous REXIN-G.
- the MTD was defined as the highest dose in which 0 of 3 or ⁇ 1 of 6 patients experienced a DLT, with the next higher dose level having at least 2 patients who experienced a DLT.
- a DLT was defined as any National Cancer Institute Common Toxicity
- CCAE Criteria for Adverse Events
- AE adverse event
- the Intent-to -Treat (ITT) Safety Population was defined as all patients who received at least one dose of REXIN-G and included 20 patients (used for safety and overall survival).
- the Modified Intent-to-Treat (mITT) Efficacy Population was defined as all patients who received at least one cycle and had a follow-up PET-CT scan and included 15 patients (used for response, progression- free survival (PFS) and overall survival (OS)). Gender and race of enrolled subjects are shown in Table 22.
- OS estimates in the efficacy evaluable mITT population among the combined group of Dose Levels 0-1 was 0% at one year.
- OS estimates in the combined groups Dose Levels II-III were 33.3% at one year and 25% at 2 years.
- OS estimates in the Intent-to -Treat or ITT population (defined as all patients who received at least one dose of REXIN-G) among the combined group of Dose Levels 0-1 was 0%) at one year.
- OS estimates among the combined group of Dose Levels II-III were 28.5% 1 year and 21.4% at 2 years.
- G no patient tested positive for any of the following: vector neutralizing antibodies, antibodies to gp70, replication-competent retrovirus in peripheral blood lymphocytes (PBLs); vector integration into genomic DNA of PBLs.
- the tumor control rate of 100% indicates that REXIN-G has substantial antitumor activity in patients with recurrent or metastatic pancreatic cancer who have failed gemcitabine or gemcitabine-containing chemotherapy.
- the longer PFS and OS at Dose Levels II and III compared to Dose 0-II are significant for this population.
- the better responses observed using PET and Choi-modified RECIST suggest that these alternative evaluation methods may be more sensitive indicators of tumor response than RECIST in patients with advanced pancreatic cancer.
- Example 23 Phase II Evaluation of Safety and Efficacy of Pathotropic Nanoparticles Bearing a Dominant Negative Cvclin Gl Construct (REXIN-G) as Intervention for Recurrent or Metastatic Osteosarcoma
- the primary objective of this study was to assess the clinical efficacy of intravenous (IV) REXIN-G in terms of tumor response rates, progression- free survival and over-all survival.
- the secondary objectives were to evaluate the over-all safety of intravenously administered REXIN-G as evaluated by performance status, toxicity assessment score, hematologic, metabolic profiles, immune responses, vector integration in PBLs and recombination events.
- Patients with recurrent or metastatic osteosarcoma considered refractory to known therapies were eligible for this study.
- Patients received intravenous infusions of REXIN-G two or three times per week for 4 weeks followed by a two-week rest period.
- Patients were assigned to a dose of 1 x 10 11 cfu BIW if the tumor burden was ⁇ 10 x 10 9 cells or to a dose of 1 x 10 11 cfu TIW if the tumor burden was >10 x 10 9 cells.
- Patients with no toxicity or in whom toxicity had resolved to ⁇ Grade I could receive additional cycles.
- Protocol Amendments I and II permitted intra-patient dose escalation up to 2 x 10 9 cfu TIW for patients who had no toxicity or in whom toxicity had resolved to ⁇ Grade I, once safety had been established at the higher dose level.
- the principal investigator was allowed to recommend surgical resection/debulking after at least one treatment cycle has been completed. Response was evaluated first using RECIST (Therasse et al, 2000).
- the Modified Intent-to-Treat (mITT) Efficacy Population was defined as all patients who received at least one cycle and had a follow-up PET-CT scan and included 17 patients (used for response, progression- free survival (PFS) and overall survival (OS)). Gender and race of enrolled subjects are shown in Table 24.
- hypophosphatemia and chest pain were reported for 3 patients each. Asthenia, fatigue, dehydration, and hypokalemia were reported for 2 patients each.
- G no patient tested positive for any of the following: vector neutralizing antibodies, antibodies to gp70, replication-competent retrovirus in peripheral blood lymphocytes (PBLs); vector integration into genomic DNA of PBLs.
- the tumor control rate of 59% indicates that REXIN-G has substantial antitumor activity in patients with recurrent or metastatic osteosarcoma who have failed all known therapies.
- the better responses observed using PET and Choi-modified RECIST suggest that these alternative evaluation methods may be more sensitive early tumor response indicators in patients with chemotherapy-resistant osteosarcoma.
- Example 24 Compassionate Use of REXIN-G for Pancreatic Cancer, Breast Cancer, Sarcoma, Osteosarcoma and other Solid Malignancies Refractory to Standard
- the patient will receive REXIN-G intravenously at a dose of 2 x 10 11 cfu per dose, five days a week, for 4 weeks. If there is ⁇ Grade I toxicity, may continue REXIN-G at a dose of 2 x 10 11 cfu 3 days a week for 8 more weeks. If the patient develops a Grade 3 or greater adverse event (CTCAE Vs 3.0) which appears to be related or possibly related to REXIN-G, the infusion will be held and the patient will be monitored until the toxicity resolves or the patient is stable. The infusion may be considered to be resumed if the toxicity is grade 3 and resolved to grade 1 or less within 24 hours. If the adverse event does not resolve within 72 hours, the study will be held until the data are discussed with the Food and Drug Administration (FDA) and a decision is made whether to continue or terminate the study.
- FDA Food and Drug Administration
- Patients may have additional treatment cycles if they have clinical benefit and have ⁇ Grade 1 toxicity.
- the principal investigator may recommend surgical resection/debulking/biopsy after completion of the 12-week treatment. Patient may resume treatment with REXIN-G for an additional 6 months after surgery. Principal investigator may recommend radiation therapy, resumption of palliative chemotherapy or enrollment in another clinical study upon completion of 12 week treatment (see Fig. 32).
- the vector is stored in -80 ⁇ 10°C freezer until used. Fifteen minutes before infusion, the product is thawed at 32-36°C waterbath and immediately infused upon thawing.
- Patient will receive injections of the REXIN-G vector via a peripheral vein or a central IV line by slow IV injection at 4 ml per minute.
- Acute reaction prophylactic therapy consists of Benadryl (12.5-25 mg) IV push or p.o. and dexamethasone 2 mg p.o.; ranitidine 300 b.i.d. (to prevent stress ulcers from steroid therapy); if allergic reactions develop, hydrocortisone 50-100 mg IV push, and acetaminophen 500 mg p.o. for fever.
- non-steroidal anti-inflammatory drugs such as ibuprofen, may be used prn for pain and/or fever.
- the patient will be closely monitored for adverse events or changes in clinical status.
- the patient will be closely followed as an inpatient or outpatient during the entire study period and at regular intervals.
- CT-CAE NCI Common Toxicity Criteria
- the patient will receive REXIN-G intravenously at a dose of 2 x 10 11 cfu per dose, five days a week, for 4 weeks. If there is ⁇ Grade I toxicity, may continue REXIN-G at a dose of 2 x 10 11 cfu 3 days a week for 8 more weeks. If the patient develops a Grade 3 or greater adverse event (CTCAE Vs 3.0) which appears to be related or possibly related to REXIN-G, the infusion will be held and the patient will be monitored until the toxicity resolves or the patient is stable. The infusion may be considered to be resumed if the toxicity is Grade 3 and resolved to Grade 1 or less within 24 hours. If the adverse event does not resolve within 72 hours, the study will be held until the data are discussed with the Food and Drug Administration (FDA) and a decision is made whether to continue or terminate the study.
- FDA Food and Drug Administration
- retroviral vector infusion The risks associated with retroviral vector infusion include development of replication competent retrovirus, vector neutralizing antibodies, vector integration in non- target organs. Acute toxicity may occur as outlined in the common toxicity criteria, from destruction of the tumor by the cytocidal REXIN-G vector or from unknown vector toxicity. All Grade III or IV toxicities, whether or not they are attributable to the study drugs, will be reported. In the event of death, an autopsy report will be submitted if a post-mortem examination was conducted.
- Patient is a 67 year-old Asian male, with adenocarcinoma of the tail of the pancreas, S/P distal pancreatectomy, pancreatico-jejunal anastomosis, jejuno-jejunal downstream Rou-Y anastomosis, and splenectomy (October 30, 2008).
- Adjuvant chemotherapy consisted of 6 cycles of gemcitabine and capecitabine.
- REXIN-G Monotherapy On February 24, 2010, a follow-up CT scan showed recurrence of malignant tumor at the surgical site with metastases to the liver. The patient was then referred for consideration of REXIN-G monotherapy. Having failed standard therapy for pancreas cancer, the patient began REXIN-G therapy on March 10, 2010, at 2 x lOel 1 cfu/dose, i.v., 5 days a week for 12 weeks. A follow-up PET-CT scan on April 7, 2010 confirmed a previously small suspicious liver lesion to be a definite hypermetabolic lesion.
- the PET scan showed a mixed tumor response with (i) a dramatic decrease in size and metabolic activity at the left subphrenic area (primary site recurrence), (ii) increased sizes and metabolic activities in two liver lesions, and (iii) a complete absence of new lesions during the REXIN-G treatment.
- gastro duodenal, right hepatic, middle hepatic, and pancreaticoduodenal circulations gastro duodenal, right hepatic, middle hepatic, and pancreaticoduodenal circulations.
- Radiological Findings Brisk hepatopetal visualization of the portal venous segments indicated no traces of collateral vessel formation. Hypovascular tumor nodules were seen in the medial segment of the right hepatic lobe with mild neovascularities and patchy tumor staining, revealing blood supplies from the right hepatic, middle hepatic, and pancreaticoduodenal arteries.
- Dose-Dense Treatment with REXIN-G by HAI Skillful and selective catheterization facilitated the infusion of 40 ml of REXIN-G (5 x 10e9 cfu/ml) sequentially at a rate of 4 ml/min into the pancreaticoduodenal (10 ml), right hepatic (10 ml), and middle hepatic (20 ml) artery supplies of the target lesions, respectively, in proportion to visual estimates of contribution of each vessel. The same infusions were repeated for 2 additional days with re-accessing of the same vessels.
- Example 26 Intensification of REXIN-G Treatment by Hepatic Arterial Infusion plus Intravenous Infusion for Primary or Secondary (Metastatic) Liver Malignancies
- REXIN-G is a replication-incompetent, pathotropic (disease-seeking), tumor matrix (collagen)-targeted retrovector encoding an N-terminal deletion mutant of the cyclin Gl gene with potential antineoplastic activity (NCI Thesaurus C49082).
- REXIN-G nanoparticles exhibit a physiological surveillance function with an intrinsic affinity to bind to newly exposed extracellular matrix proteins found in cancerous lesions— based on the molecular engineering of a collagen-binding motif derived from von Willebrand
- vWF coagulation factor
- the pathotropic nanoparticles carry a cytocidal 'dominant negative' cyclin GI construct as the genetic payload, which has the ability to destroy or retard growth of tumor cells by disruption of tumor cell cyclin Gl activity, thus inducing apoptosis of tumor cells and the proliferative tumor-associated vasculature.
- REXIN-G In preclinical proof-of-concept studies, REXIN-G, given intravenously, has been shown to concentrate selectively in cancerous lesions and to attenuate tumor growth in human xenograft models of metastatic cancer. In clinical studies, REXIN-G has been demonstrated to have significant anti-tumor activity in a number of solid tumor tissues, including breast, colon, lung, skin, muscle and bone, as well as pancreas cancer. Following on from initial Phase I safety studies and Phase I/II adaptive studies, REXIN-G was granted Orphan Drug Status by the U.S. FDA in 2008 for soft tissue sarcoma and osteosarcoma, in addition to pancreas cancer in 2003.
- REXIN-G Advanced Phase I/II clinical studies of REXIN-G for pancreatic cancer have shown that REXIN-G is well-tolerated with an excellent safety/toxicity profile and is associated with significant tumor regression and prolonged progression- free survival (by RECIST criteria), with a tentative indication that REXIN-G monotherapy may improves overall survival as well (Chawla et al. 2009).
- the Phase 4 study is designed to improve objective tumor responses without compromising safety of REXIN- G by combining regional delivery (via hepatic artery infusions for local control) and intravenous infusions (for systemic control) of REXIN-G for primary and secondary (metastatic) liver malignancies.
- Study Design The proposed Phase 4 study is designed as an open-label, single-arm, multicenter study of combination hepatic arterial infusion (for local control) and intravenous infusion (for systemic control) of REXIN-G treatment for primary or secondary (metastatic) liver malignancies.
- Dosing and Conduct of Study 20 to 40 patients will receive the REXIN-G via hepatic arterial infusion on Days 1-3 and Days 11-13 and REXIN-G intravenously, on Days 4-10, and Days 14-20. Stopping rules will be met if at any time, after 10 or more patients have had a full cycle of exposure to study drug, more than one third of patients in the course of a cycle have had grade 3-5 drug-related (possibly, probably or definitely related) toxicities (using CTCAEvs3). Epeius Biotechnologies Corporation, in consultation with the FDA, will make all final decisions regarding termination or continuation of the study.
- Primary Endpoint Favorable objective tumor response in terms of complete or partial response or stabilization of disease by CT scan, MRI or Ultrasound.
- Inclusion Criteria Patient is >18 years of age, either male or female; Patient has histology-proven primary or secondary (metastatic) liver malignancy; Patient is not part of any other experimental drug program; ECOG status 0-1 with life expectancy of 3 months; Patient has no evidence of active infection; Patient has no existing chronic condition (i.e., severe atherosclerosis, collagen-vascular disease, multiple sclerosis, recent MI or coagulopathy, cardiomyopathy, etc.) that would compromise successful adherence to the protocol; Patient has adequate hematologic and organ function, as determined by laboratory testing of blood and serum (as described further in the detailed protocol); Patient has NO ascites, pleural effusion, or pericardial effusion; Patient has the ability to understand and willingness to sign a written informed consent; Patients with measureable disease, i.e., at least 1 cm in diameter by spiral CT scan, MRI or ultrasound; Patients agree to use barrier contraception during vector infusion period and for 6 weeks after infusion.
- measureable disease i.e., at least 1 cm
- Exclusion Criteria Patient has any medical condition which would interfere with the conduct of the study; Patient is unable or unwilling to provide formal informed consent; Pregnant, or nursing women or individuals of either sex unwilling to use adequate contraception measures; Concomitant use of other chemotherapeutic or immunotherapeutic agents during the study period.
- CCAE v.3.0 reported/collected at each weekly visit and graded using common toxicity criteria
- the responsible Investigators will report all SAEs to the sponsor or the sponsor's designated representative within 24 hours of becoming aware of the SAE occurrence. SAEs will be reported in a timely manner to the FDA and IRB, consistent with existing regulations for expedited or special reporting. Information on relevant AEs will be disseminated between sites in a timely manner.
- Tumors will be evaluated radio logically by CT scan, MRI or ultrasound at baseline, on Day 7 and Day 21. The patient's best response on therapy (based on RECIST criteria or Tumor Volume) will be captured. The number (proportion) of responders (CR+PR+SD) versus non-responders (PD) will be determined. The same statistical methods will be conducted for both the Intent-to-Treat (ITT) and the Modified Intention-to-Treat (mITT) populations. The ITT population will consist of all subjects, regardless of the treatment or amount of treatment actually received.
- the mITT population will be composed of all patients who have completed at least the 20-day treatment with of REXIN-G and had a tumor response evaluation by CT scan, MRI or ultrasound on Day 21. Tumor response evaluation will be done by site investigators and may be verified by an independent central site using blinded reviewer(s) at specified time points.
- Endpoints The Primary Endpoint will be a favorable objective tumor response (complete response, partial response or stable disease) in the majority of treated patients.
- the Secondary Endpoint will be acceptable clinical toxicity, with one-third or less of patients experiencing a Grade 3 or greater drug-related toxicity.
- Study Visits Visits will be scheduled at screening and weekly for up to 21 days from start of REXIN-G treatment. Infusion visits will be considered unscheduled visits during which only vital signs will be routinely recorded. Tumor response evaluation will be obtained at Days 7 and 21. The end-of-study visit will be at 21 days. All patients who at end-of- study visit have at least one Grade 2 or higher AE or SAE will be followed for 30 days longer. Patients who complete the study period of 21 days will be placed in a follow- up group and contacted every 3 months to capture unexpected safety events and history of cancer disease progression and to ascertain survival for up to 15 years after study initiation.
- Efficacy information will be summarized for each dose as the number and percentage in each of the categories PD, SD, PR, and CR. In addition, information will be reported for the following events: death from any cause, disease progression or death from any cause, and disease progression or death due to the underlying cancer. Patients will be followed for survival for 15 years. Response rates will be reported both as the percentage of eligible patients enrolled in the study (“intent-to-treat” or ITT analysis) and as the percentage of evaluable patients (i.e., eligible patients who finish the treatment course) ("as modified intent-to-treat” or mITT analysis); 95% confidence intervals for the response rates will be estimated. Survival and time to failure will be summarized with Kaplan-Meier plots.
- Antibiotic prophylaxis Imipenim (500 mg) IV over 15-30 min before procedure (and q 6 firs x 72 firs). Note: Patients with a history of penicillin sensitivity will receive ceftazidime (2 grams) IV q 8 fir and metronidazole (500 mg) IV q 6 firs.
- Hepatic Artery Catheterization Hepatic artery catheter placement per procedure by interventional radiologist
- Pre-medications 30 min before infusion: Benadryl 25-50 mg p.o or i.v.;
- Hydrocortisone 50-100 mg IV Discontinue heparin through hepatic artery catheter during REXIN-G infusion. Infuse 40 ml (2 x lOel 1 cfu) of REXIN-G at a rate of 4 ml/min once a day through hepatic artery catheter for three days. Remove hepatic artery catheter.
- Hepatic Artery Catheter is kept in place for three days: Strict bed rest x 72 hours while hepatic artery catheter is in place; May elevate head 45° ' Insert Foley catheter, I & O x 72 firs while hepatic artery catheter is in place. [00446] Heparinization through Hepatic Artery Catheter: Infuse Heparin 2,000
- Day 3 Discontinue heparinization after REXIN-G infusion is completed.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Epidemiology (AREA)
- Zoology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Marine Sciences & Fisheries (AREA)
- Hematology (AREA)
- Oncology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Medicinal Preparation (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
Description
Claims
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2013519868A JP2013541497A (en) | 2010-07-16 | 2011-07-15 | Targeted nanoparticles for cancer and other disorders |
| AU2011278931A AU2011278931A1 (en) | 2010-07-16 | 2011-07-15 | Targeted nanoparticles for cancer and other disorders |
| PH1/2013/500080A PH12013500080A1 (en) | 2010-07-16 | 2011-07-15 | Targeted nanoparticles for cancer and other disorders |
| CA2805643A CA2805643A1 (en) | 2010-07-16 | 2011-07-15 | Targeted nanoparticles for cancer and other disorders |
| EP11807610.8A EP2593118A2 (en) | 2010-07-16 | 2011-07-15 | Targeted nanoparticles for cancer and other disorders |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US36524010P | 2010-07-16 | 2010-07-16 | |
| US61/365,240 | 2010-07-16 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2012009703A2 true WO2012009703A2 (en) | 2012-01-19 |
| WO2012009703A3 WO2012009703A3 (en) | 2013-08-08 |
Family
ID=45470113
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2011/044288 Ceased WO2012009703A2 (en) | 2010-07-16 | 2011-07-15 | Targeted nanoparticles for cancer and other disorders |
Country Status (7)
| Country | Link |
|---|---|
| US (1) | US20120027727A1 (en) |
| EP (1) | EP2593118A2 (en) |
| JP (1) | JP2013541497A (en) |
| AU (1) | AU2011278931A1 (en) |
| CA (1) | CA2805643A1 (en) |
| PH (1) | PH12013500080A1 (en) |
| WO (1) | WO2012009703A2 (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017079746A2 (en) | 2015-11-07 | 2017-05-11 | Multivir Inc. | Methods and compositions comprising tumor suppressor gene therapy and immune checkpoint blockade for the treatment of cancer |
| US9861726B2 (en) | 2014-09-15 | 2018-01-09 | Covidien Lp | Coupling a body conduit to tissue |
| WO2018111902A1 (en) | 2016-12-12 | 2018-06-21 | Multivir Inc. | Methods and compositions comprising viral gene therapy and an immune checkpoint inhibitor for treatment and prevention of cancer and infectious diseases |
| US10035009B2 (en) | 2013-04-15 | 2018-07-31 | The Board Of Trustees Of The Leland Stanford Junior University | Systems and methods for treating pancreatic cancer |
| WO2020036635A2 (en) | 2018-03-19 | 2020-02-20 | Multivir Inc. | Methods and compositions comprising tumor suppressor gene therapy and cd122/cd132 agonists for the treatment of cancer |
| EP3576766A4 (en) * | 2017-02-04 | 2020-11-18 | Delta Next-Gene, LLC | CYCLIN-G1 INHIBITORS AND RELATED METHODS FOR TREATING CANCER |
| WO2021113644A1 (en) | 2019-12-05 | 2021-06-10 | Multivir Inc. | Combinations comprising a cd8+ t cell enhancer, an immune checkpoint inhibitor and radiotherapy for targeted and abscopal effects for the treatment of cancer |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| PL2892524T3 (en) * | 2012-09-04 | 2021-10-25 | Eleison Pharmaceuticals, Llc | PREVENTION OF PULMONAL RETURN WITH THE USE OF CISPLATIN IN THE LIPID COMPLEX |
| EP2958993B1 (en) * | 2013-02-22 | 2020-04-08 | Case Western Reserve University | Non-covalent loading of plant picornavirus particles |
| KR101943989B1 (en) | 2015-06-05 | 2019-01-30 | 삼성전자주식회사 | Method, server and terminal for transmitting and receiving data |
| AU2019242912B2 (en) | 2018-03-28 | 2025-07-17 | Board Of Regents, The University Of Texas System | Identification of epigenetic alterations in DNA isolated from exosomes |
| US20210024936A1 (en) * | 2018-04-09 | 2021-01-28 | Board Of Regents, The University Of Texas System | Therapeutic targeting of oncogenes using exosomes |
| WO2020131951A1 (en) * | 2018-12-17 | 2020-06-25 | Gordon Erlinda M | Methods of using rexin-g: a tumor-targeted retrovector encoding a dominant-negative cyclin g1 inhibitor for advanced pancreatic cancer |
| WO2021222818A2 (en) * | 2020-04-30 | 2021-11-04 | Gordon Erlinda M | Damage-targeted treatments of disease |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6825033B2 (en) * | 2000-03-02 | 2004-11-30 | University Of Southern California | Mutated cyclin G1 protein |
| US20070178066A1 (en) * | 2003-04-21 | 2007-08-02 | Hall Frederick L | Pathotropic targeted gene delivery system for cancer and other disorders |
| ES2366617T3 (en) * | 2003-04-21 | 2011-10-21 | Epeius Biotechnologies Corporation | METHODS AND COMPOSITIONS FOR THE TREATMENT OF DISORDERS. |
-
2011
- 2011-07-15 CA CA2805643A patent/CA2805643A1/en not_active Abandoned
- 2011-07-15 JP JP2013519868A patent/JP2013541497A/en not_active Withdrawn
- 2011-07-15 EP EP11807610.8A patent/EP2593118A2/en not_active Withdrawn
- 2011-07-15 PH PH1/2013/500080A patent/PH12013500080A1/en unknown
- 2011-07-15 AU AU2011278931A patent/AU2011278931A1/en not_active Abandoned
- 2011-07-15 US US13/184,458 patent/US20120027727A1/en not_active Abandoned
- 2011-07-15 WO PCT/US2011/044288 patent/WO2012009703A2/en not_active Ceased
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10035009B2 (en) | 2013-04-15 | 2018-07-31 | The Board Of Trustees Of The Leland Stanford Junior University | Systems and methods for treating pancreatic cancer |
| US9861726B2 (en) | 2014-09-15 | 2018-01-09 | Covidien Lp | Coupling a body conduit to tissue |
| US10639400B2 (en) | 2014-09-15 | 2020-05-05 | Covidien Lp | Coupling a body conduit to tissue |
| WO2017079746A2 (en) | 2015-11-07 | 2017-05-11 | Multivir Inc. | Methods and compositions comprising tumor suppressor gene therapy and immune checkpoint blockade for the treatment of cancer |
| WO2018111902A1 (en) | 2016-12-12 | 2018-06-21 | Multivir Inc. | Methods and compositions comprising viral gene therapy and an immune checkpoint inhibitor for treatment and prevention of cancer and infectious diseases |
| EP3576766A4 (en) * | 2017-02-04 | 2020-11-18 | Delta Next-Gene, LLC | CYCLIN-G1 INHIBITORS AND RELATED METHODS FOR TREATING CANCER |
| WO2020036635A2 (en) | 2018-03-19 | 2020-02-20 | Multivir Inc. | Methods and compositions comprising tumor suppressor gene therapy and cd122/cd132 agonists for the treatment of cancer |
| US12454561B2 (en) | 2018-03-19 | 2025-10-28 | Multivir Inc. | Methods and compositions comprising tumor suppressor gene therapy and CD122/CD132 agonists for the treatment of cancer |
| WO2021113644A1 (en) | 2019-12-05 | 2021-06-10 | Multivir Inc. | Combinations comprising a cd8+ t cell enhancer, an immune checkpoint inhibitor and radiotherapy for targeted and abscopal effects for the treatment of cancer |
Also Published As
| Publication number | Publication date |
|---|---|
| PH12013500080A1 (en) | 2013-03-11 |
| JP2013541497A (en) | 2013-11-14 |
| US20120027727A1 (en) | 2012-02-02 |
| WO2012009703A3 (en) | 2013-08-08 |
| EP2593118A2 (en) | 2013-05-22 |
| AU2011278931A1 (en) | 2013-03-07 |
| CA2805643A1 (en) | 2012-01-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20120027727A1 (en) | Targeted nanoparticles for cancer and other disorders | |
| EP2077862B1 (en) | Dosage method for cancer therapy | |
| JP7246343B2 (en) | improved thymidine kinase gene | |
| JP5992548B2 (en) | Recombinant vector | |
| DK3159415T3 (en) | Production cells for replicative retroviral vectors | |
| US20090123428A1 (en) | Pathotropic targeted gene delivery system for cancer and other disorders | |
| JP2009112314A (en) | Methods and compositions for treating diseases | |
| WO2015021077A1 (en) | Recombinant vector with optimized a-bulge | |
| AU2008221564A1 (en) | Methods and Compositions for Treating Disorders | |
| Maier et al. | MDR1 gene transfer using a lentiviral SIN vector confers radioprotection to human CD34+ hematopoietic progenitor cells | |
| AU2004232328C1 (en) | Methods and compositions for treating disorders | |
| AU2004232328B2 (en) | Methods and compositions for treating disorders | |
| AU2013251291A1 (en) | Pathotropic targeted gene delivery system for cancer and other disorders | |
| US20160222412A1 (en) | Recombinant vector with stabilizing a-loop |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 11807610 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12013500080 Country of ref document: PH |
|
| ENP | Entry into the national phase |
Ref document number: 2013519868 Country of ref document: JP Kind code of ref document: A Ref document number: 2805643 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2011807610 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2011278931 Country of ref document: AU Date of ref document: 20110715 Kind code of ref document: A |




















