WO2012009475A1 - Methods of treating cancer with inhibition of lysine-specific demethylase 1 - Google Patents

Methods of treating cancer with inhibition of lysine-specific demethylase 1 Download PDF

Info

Publication number
WO2012009475A1
WO2012009475A1 PCT/US2011/043911 US2011043911W WO2012009475A1 WO 2012009475 A1 WO2012009475 A1 WO 2012009475A1 US 2011043911 W US2011043911 W US 2011043911W WO 2012009475 A1 WO2012009475 A1 WO 2012009475A1
Authority
WO
WIPO (PCT)
Prior art keywords
inhibitor
lsdl
subject
cancer
parp
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2011/043911
Other languages
French (fr)
Inventor
Joshi Alumkal
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Oregon Health and Science University
Original Assignee
Oregon Health and Science University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Oregon Health and Science University filed Critical Oregon Health and Science University
Publication of WO2012009475A1 publication Critical patent/WO2012009475A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/13Amines
    • A61K31/132Amines having two or more amino groups, e.g. spermidine, putrescine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/13Amines
    • A61K31/155Amidines (), e.g. guanidine (H2N—C(=NH)—NH2), isourea (N=C(OH)—NH2), isothiourea (—N=C(SH)—NH2)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/50Pyridazines; Hydrogenated pyridazines
    • A61K31/502Pyridazines; Hydrogenated pyridazines ortho- or peri-condensed with carbocyclic ring systems, e.g. cinnoline, phthalazine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/08Drugs for disorders of the urinary system of the prostate
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents

Definitions

  • This disclosure concerns inhibitors of lysine-specific demethylase 1 (LSD1), inhibitors of HDAC, and DNA damaging agents or inhibitors of PARP, and methods of their use for treating human diseases, such as cancer.
  • LSD1 lysine-specific demethylase 1
  • HDAC lysine-specific demethylase 1
  • PARP DNA damaging agents or inhibitors of PARP
  • Cancer of the prostate is the most commonly diagnosed cancer in men and is the second most common cause of cancer death (Carter and Coffey, Prostate 16:39- 48, 1990; Armbruster et al, Clinical Chemistry 39: 181, 1993). If detected at an early stage, prostate cancer is potentially curable. However, a majority of cases are diagnosed at later stages when metastasis of the primary tumor has already occurred (Wang et al, Meth. Cancer Res. 19: 179, 1982). Even early diagnosis is problematic because not all individuals who test positive in these screens develop cancer.
  • ADT androgen deprivation therapy
  • ADT works by lowering levels of androgens or interfering with androgen binding to and activation of the androgen receptor (AR).
  • AR androgen receptor
  • ADT is not curative, and "castration-resistance" is common (Scher and Sawyers, /. Clin. Oncol. 23:8253-8261, 2005).
  • Chemotherapy agents, such as docetaxel, and combination chemotherapy regimens are used to treat castration-resistant prostate cancer (CRPC; also referred to as hormone-refractory prostate cancer).
  • CRPC castration-resistant prostate cancer
  • the prognosis remains poor for individuals with CRPC.
  • LSDl lysine-specific demethylase 1
  • PARP poly (ADP-ribose) polymerase
  • HDAC histone deacetylase
  • the methods include administering a therapeutically effective amount of an LSDl inhibitor to a subject with cancer.
  • the cancer is prostate cancer (such as CRPC or small cell prostate carcinoma).
  • the methods include administering a
  • the LSDl inhibitor includes any inhibitor of LSDl, such as a small organic molecule, an RNA interference molecule, a peptide, or an antibody.
  • the LSDl inhibitor is a polyamine analog, such as XB154, PG11144, PG11047.
  • the LSDl inhibitor decreases the expression of one or more BRCA or Fanconi anemia (FA) gene(s), such as BRCA1, BRCA2, FANCA, FANCB, FANCC, FANCD2, FANCG, or, FANCM.
  • the PARP inhibitor includes any inhibitor of PARP, such as a small organic molecule (for example, olaparib).
  • the disclosed methods include administering a therapeutically effective amount of an HDAC inhibitor and a therapeutically effective amount of a PARP inhibitor to a subject with cancer (such as prostate cancer, breast cancer, or ovarian cancer).
  • the HDAC inhibitor includes any inhibitor of HDAC, such as a small organic molecule, an RNA interference molecule, a peptide, or an antibody.
  • the HDAC inhibitor is vorinostat (SAHA), trichostatin A, or valproic acid.
  • SAHA vorinostat
  • the HDAC inhibitor decreases the expression of one or more androgen-independent androgen receptor-regulated genes, such as UBE2C and CDC20.
  • the PARP inhibitor includes any inhibitor of PARP, such as a small organic molecule (for example, olaparib).
  • FIG. 1 is a pair of digital images showing immunob lotting of LNCaP cells treated with XB154 (left) or LSDl siRNA (right).
  • GAPDH glyceraldehyde-3- phosphate dehydrogenase
  • 2MK4 di-methyl lysine 4
  • 2MK9 di-methyl lysine 9
  • NTC non-targeted control.
  • FIG. 2 is a heatmap of Fanconi anemia (FANC) and BRCA gene expression in LNCaP cells treated with LSDl siRNA, XB154, PGl 1144, or PGl 1047. Darker shading indicates >1.5-fold increase in expression compared to untreated cells; medium shading indicates >1.5-fold decrease in expression compared to untreated cells; and lighter shading indicates ⁇ 1.5-fold change in expression compared to control.
  • FANC Fanconi anemia
  • FIG. 3 is a graph showing relative FANCD2 mRNA expression in LNCaP cells transfected with vector alone (pcDNA3.1) or LSDl.
  • FIG. 4A is a graph showing FANCD2 mRNA expression in LNCaP cells treated with the indicated amount of XB154 for 48 hours.
  • FIG. 4B is a pair of digital images showing FANCD2 and ubiquitinated FANCD2 (ub-FANCD2) protein (upper) and ⁇ -actin (control, lower) in LNCaP cells treated with the indicated amount of XB154 for 24 or 48 hours.
  • ub-FANCD2 ubiquitinated FANCD2
  • ⁇ -actin control, lower
  • FIG. 4C is a series of digital images of immunoblots of LSDl, FANCD2 and GAPDH in LNCaP cells with stable knockdown of LSDl by shRNA. Relative amounts of FANCD2 and ub-FANCD2 are shown below the blot. NTC, non- targeted control shRNA.
  • FIG. 4D is a pair of digital images of immunoblots of FANCD2 and ⁇ -actin in LNCaP cells treated with pargyline. Relative amounts of FANCD2 and ub- FANCD2 are shown below the blot.
  • FIG. 5 is a graph showing relative expression of BRCA1 mRNA in LNCaP cells treated with the indicated amount of XB 154 for 24 or 48 hours.
  • FIG. 6 is a heatmap of Fanconi anemia (FANC) and BRCA gene expression in LNCaP cells treated with histone deacetylase (HDAC) inhibitors sulforaphane (SFN), trichostatin A (TSA), or vorinostat (SAHA) or LSD1 siRNA or XB154. Dark shading indicates > 1.5-fold decrease in expression compared to untreated cells; light shading indicates no change in expression compared to control.
  • HDAC histone deacetylase
  • FIG. 7 is a graph showing effect of LSD1 knockdown (shLSDl) on proliferation of LNCaP cells.
  • FIG. 8 is a graph showing the total cell counts of LNCaP cells pre-treated with the indicated amount of XB154 for 24 hours, followed by 48 hour co-treatment with mitomycin C (MMC).
  • MMC mitomycin C
  • FIG. 9 is a graph showing percent viability of LNCaP cells with LSD1 knockdown (shLSDl) or mock transfected (shNTC) treated with the indicated amount of olaparib.
  • FIG. 10 is a heatmap indicating up or down (1.5 fold) regulation for probe sets from a 16 hour treatment with dihydrotestosterone (DHT) or siRNA to androgen receptor (siAR) in both LNCaP and Abl cells, as well as data with siRNA to LSD1 (siLSDl) in LNCaP cells.
  • Probe sets were selected based on having 1.5 fold change versus control for one of the experiments and having a significant (q-value ⁇ 0.05) AR binding site within 50 kb of the annotated transcriptional start site for the gene associated with the probe set. Dark shading represents at least a 1.5 fold decrease or increase and light shading indicates that there was not a difference meeting the 1.5 fold threshold.
  • FIG. 11 is a series of digital images of immunoblots probed with the indicated antibodies after treatment with siRNA against a non-targeted control (NTC) or LSD1 for 96 hours (left) or increasing amounts of PG11144 (right).
  • NTC non-targeted control
  • FIG. 12 A is a graph showing UBE2C RNA expression in LNCaP cells with RNAi mediated suppression of AR, LSDl, or both AR and LSDl, relative to control.
  • FIG. 12B is a graph showing CCNA2 RNA expression in LNCaP cells with RNAi mediated suppression of AR, LSDl, or both AR and LSDl, relative to control
  • FIG. 12C is a graph showing chromatin immunoprecipitation (ChIP) PCR results for the UBE2C enhancer I (left) and CCNA2 (right) in LNCaP cells with antibodies to AR, LSDl, acetylated histone H3 (AcH3), and IgG. QPCR was performed in triplicate and enrichment was compared with the input sample.
  • ChIP chromatin immunoprecipitation
  • FIG. 13 is a graph showing relative expression of CDC20 (left) and UBE2C (right) mRNA in LNCaP cells treated with LSDl siRNA, XB154, or PGl 1144 at the indicated concentrations.
  • FIG. 14 is a pair of graphs showing proliferation gene expression in PC3 cells treated with siLSDl (top) or XB154 (bottom).
  • FIG. 15 is a graph showing Nkx3.1 mRNA levels in LNCaP cells treated with the indicated amounts of PGl 1144 (top) or siLSDl (bottom).
  • FIG. 16 is a graph showing cell number quantified after trypan blue exclusion in abl (left) and C4-2B (right) cells transfected with control RNAi (RNAiNTC) or siLSDl.
  • FIG. 17A is a graph showing proliferation of LNCaP cells treated with siRNA to LSDl or control and grown in the absence of androgens.
  • FIG. 17B is a digital image of a Western blot showing LSDl expression in the cells.
  • FIG. 18 is a graph showing the change in percentage of cells in the indicated cell cycle phase relative to control in LNCaP LSDl knockdown cells.
  • FIG. 20A is a digital image showing FANCD2 protein expression and ubiquitination and histone methylation (2MK4 and 2MK9) in LNCaP cells treated with PGl 1047 for 96 hours.
  • FIG. 20B is a digital image showing histone methylation (2MK4 and 2MK9) in LNCaP cells treated with vehicle or 1 ⁇ PGl 1047 for 96 hours.
  • FIG. 20C is a digital image showing the effect of LSD 1 suppression on histone methylation (2MK4) in LNCaP cells transfected with the indicated RNAi and then 24 hours later treated with vehicle or 2 ⁇ PGl 1047 for 96 hours.
  • FIG. 20D is a pair of graphs showing relative UBE2C mRNA levels (top) and relative CDC20 mRNA levels (bottom) in LNCaP cells treated with the indicated amounts of PGl 1047 for 96 hours.
  • FIG. 21 is a digital image showing FANCD2 protein expression and ubiquitination, LSD1 protein expression, and histone methylation (2MK4 and 2MK9) in LNCaP cells treated with the indicated amounts of PGl 1044 for 72 hours.
  • FIG. 22 is a series of graphs showing the effect of PGl 1144 treatment for
  • nucleic and amino acid sequences referenced herein are shown using standard letter abbreviations for nucleotide bases, as defined in 37 C.F.R. 1.822. In at least some cases, only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand.
  • Sequence_Listing.txt which was created on July 13, 2011, and is 4715 bytes, which is incorporated by reference herein.
  • SEQ ID NO: 1 is an LSD1 siRNA.
  • SEQ ID NO: 2 is a control luciferase siRNA.
  • SEQ ID NO: 3 is an LSD1 shRNA.
  • SEQ ID NO: 4 is an AR siRNA.
  • SEQ ID NOs: 5-20 are RT-PCR primers.
  • Fanconi anemia is a rare genetic disorder characterized by progressive bone marrow failure, cancer susceptibility, and cellular hypersensitivity to DNA cross-linking agents, such as mitomycin C and cisplatin. Loss of function experiments of FA pathway members point to their role in enhancing chemotherapy sensitivity when depleted in cancer cells (Taniguchi et al, Nature Med. 9:568-574, 2003). Of the 11 pathway members, FANCA, FANCB, FANCC, FANCE, FANCF, FANCG, FANCL, and FANCM form a nuclear core complex (Meetei et al, Nature Genet. 36: 1219-1224, 2004; Levitus et al, Nature Genet.
  • FANCA, FANCB, FANCC, FANCE, FANCF, FANCG, FANCL, and FANCM form a nuclear core complex (Meetei et al, Nature Genet. 36: 1219-1224, 2004; Levitus et al, Nature Gene
  • Inhibition of FA genes provides a synthetic lethal approach to treating cancer by enhancing chemosensitivity of cancer cells to DNA damage-inducing agents. It is also disclosed herein that inhibition of LSD1 (for example, by knockdown of LSD1 expression) increases sensitivity of prostate cancer cells to the PARP inhibitor olaparib. Thus, disclosed herein are methods of treating cancer by administering a therapeutically effective amount of an LSD1 inhibitor or an HDAC inhibitor in combination with a PARP inhibitor.
  • the central protein in prostate cancer is the androgen receptor (AR) which is a nuclear hormone receptor that is activatable by androgens.
  • AR androgen receptor
  • Most therapeutic approaches in this disease rest upon depleting androgens or interfering with androgen binding to AR protein.
  • ADT androgen deprivation therapy
  • CRPC castration resistant prostate cancers
  • LSD1 is an AR binding partner which binds to androgen response elements (AREs) along with AR. It is disclosed herein that following inhibition of LSD1 by RNA interference, the top pathways whose expression decline are androgen- independent "AR" signaling pathways that are enriched in CRPC cells and patient samples. This indicates that LSD1 inhibition is a target to prevent or overcome castration-resistance in prostate cancer.
  • methods of treating CRPC by administering a therapeutically effective amount of an LSD1 inhibitor.
  • DNA damaging agent A compound or treatment that causes damage to DNA, such as produces DNA strand breaks (such as single-strand or double-strand breaks) or DNA cross -linking.
  • a DNA damaging agent includes a DNA cross-linking agent, such as mitomycin C (MMC), diepoxybutane (DEB), platinum compounds (such as carboplatin, cisplatin, oxaliplatin, and bbr3464), cyclophosphamide, psoralen, adriamycin, 5-fluorouracil (5FU), etoposide (VP- 16), camptothecin, actinomycin-D, or radiation (such as UVA radiation).
  • MMC mitomycin C
  • DEB diepoxybutane
  • platinum compounds such as carboplatin, cisplatin, oxaliplatin, and bbr3464
  • cyclophosphamide such as carboplatin, cisplatin, oxaliplatin, and b
  • Histone deacetylase A family of proteins that catalyze deacetylation of histone lysine residues. HDACs are classified into at least three families based on structural homology and co-factor dependence. Class I and II HDACs require zinc as a cofactor, while Class III HDACs require nicotinamide adenine dinucleotide (NAD) for enzyme activity. In cancer, HDACs are recruited to the promoter regions of tumor suppressor genes and result in inappropriate transcriptional repression (such as gene silencing), contributing to tumorigenesis.
  • HDAC Histone deacetylase
  • HDAC inhibitors include diverse compounds, such as short-chain fatty acids (for example, sodium butyrate and valproic acid), epoxides (for example, depudecin and trapoxin), cyclic peptides (for example, apicidin and depsipeptide), hydroxamic acids (for example, trichostatin A, suberoylanilide hydroxamic acid (SAHA), oxamflatin, scriptaid, and pyroxamide), benzamides (for example, MS-275 and CI-994), and other hybrid compounds (for example, SK-7068).
  • short-chain fatty acids for example, sodium butyrate and valproic acid
  • epoxides for example, depudecin and trapoxin
  • cyclic peptides for example, apicidin and depsipeptide
  • hydroxamic acids for example, trichostatin A, suberoylanilide hydroxamic acid (SAHA), oxamflatin,
  • HDAC nucleic acid and amino acid sequences are publicly available.
  • GenBank Accession Nos.: NM_004964, NM_001527, NM_003883, NM_006037, and NM_006044 disclose exemplary human HDAC nucleic acid sequences
  • GenBank Accession Nos.: NP_004955, NP_001518, NP_003874, NP_006028, and NP_006035 disclose exemplary human HDAC amino acid sequences, all of which are incorporated by reference as present in GenBank on July 14, 2010.
  • Other HDAC nucleic acid and amino acid sequences can be identified by one of skill in the art.
  • an HDAC has at least 80% sequence identity, for example at least 85%, 90%, 95%, or 98% sequence identity to a publicly available HDAC sequence, such as those provided herein.
  • Inhibitor Any chemical compound, nucleic acid molecule, or peptide, such as a small organic molecule, a nucleic acid (such as an RNAi nucleic acid), or an antibody, specific for a gene product that can reduce activity of a gene product or directly interfere with expression of a gene, such as genes that encode LSD1, HDAC, or PARP, such as in a cancer or a treatment resistant cancer (e.g., a prostate cancer, such as castration-resistant prostate cancer).
  • An inhibitor of the disclosure for example, can inhibit the activity of a protein that is encoded by a gene either directly or indirectly.
  • Direct inhibition can be accomplished, for example, by binding to a protein and thereby preventing the protein from binding a target (such as a receptor or binding partner) or preventing protein activity (such as enzymatic activity). Indirect inhibition can be accomplished, for example, by binding to a protein's intended target, such as a receptor or binding partner, thereby blocking or reducing activity of the protein.
  • an inhibitor of the disclosure can inhibit a gene by reducing or inhibiting expression of the gene, inter alia by interfering with gene expression (transcription, processing, translation, post- translational modification), for example, by interfering with the gene's mRNA and blocking translation of the gene product or by post-translational modification of a gene product, or by causing changes in intracellular localization.
  • Lysine-specific demethylase 1 (LSD1): A histone lysine demethylase that specifically demethylates monomethylated and dimethylated histone H3 at K4 (Shi et al, Cell 119:941-953, 2004) and also demethylates dimethylated histone H3 at K9.
  • LSD1 includes a monoamine oxidase-like domain, which has homology to FAD-dependent oxidases. LSD1 also includes an N-terminal SWRIM domain. There are two transcript variants of LSD 1 produced by alternative splicing.
  • LSD1 Nucleic acid and amino acid sequences for LSD1 are publicly available.
  • GenBank Accession Nos.: NM_015013 and NM_001009999 disclose exemplary human LSD1 nucleic acid sequences
  • GenBank Accession Nos.: NP_055828 and NP_001009999 disclose exemplary human LSD1 amino acid sequences, all of which are incorporated by reference as present in GenBank on July 14, 2010.
  • Other LSDl nucleic acid and amino acid sequences can be identified by one of skill in the art.
  • LSDl includes a full-length wild-type (or native) sequence, as well as LSDl allelic variants that retain lysine-specific demethylase activity.
  • LSDl has at least 80% sequence identity, for example at least 85%, 90%, 95%, or 98% sequence identity to a publicly available LSDl sequence, such as those provided herein.
  • compositions and formulations suitable for pharmaceutical delivery of one or more therapeutic compounds, molecules or agents are conventional. Remington: The Science and Practice of Pharmacy, The University of the Sciences in Philadelphia, Editor, Lippincott, Williams, & Wilkins, Philadelphia, PA, 21 st Edition (2005), describes compositions and formulations suitable for pharmaceutical delivery of one or more therapeutic compounds, molecules or agents.
  • parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle.
  • pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle.
  • physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like
  • solid compositions for example, powder, pill, tablet, or capsule forms
  • conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate.
  • compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
  • non-toxic auxiliary substances such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
  • PARP Poly (ADP ribose) polymerase
  • PARP1 is the founding member of a large family of poly(ADP-ribose) polymerases with 17 members identified (Ame et ah, Bioessays 26:882-893, 2004). It is the primary enzyme catalyzing the transfer of ADP-ribose units from NAD + to target proteins including PARP1 itself. Under normal physiologic conditions, PARP1 facilitates the repair of DNA base lesions by helping recruit base excision repair proteins XRCC1 and ⁇ (Dantzer et ah,
  • PARP2 contains a catalytic domain and is capable of catalyzing a poly(ADP-ribosyl)ation reaction.
  • This protein has a catalytic domain that is homologous to that of PARPl, but lacks an N-terminal DNA binding domain which activates the C-terminal catalytic domain of PARP.
  • the basic residues within the N-terminal region of this protein may bear potential DNA-binding properties, and may be involved in the nuclear and/or nucleolar targeting of the protein.
  • PARP nucleic acid and amino acid sequences are publicly available.
  • NM_001042618, NM_005485, NM_001003931, and NM_006437 disclose exemplary human PARP nucleic acid sequences
  • GenBank Accession Nos.: NP_001609, NP_005475, NP_001036083, NP_005476, NP_001003931, and NP_006428 disclose exemplary human PARP amino acid sequences, all of which are incorporated by reference as present in GenBank on July 14, 2010. Additional PARP nucleic acid and amino acid sequences can be identified by one of skill in the art.
  • a PARP has at least 80% sequence identity, for example at least 85%, 90%, 95%, or 98% sequence identity to a publicly available PARP sequence, such as those provided herein.
  • Prostate cancer A malignant tumor, generally of glandular origin, of the prostate. Prostate cancers include adenocarcinomas and small cell carcinomas. Many prostate cancers express prostate specific antigen (PSA).
  • PSA prostate specific antigen
  • Prostate cancer initially grows in an androgen-dependent manner, and androgen deprivation therapy (ADT) is an effective treatment in many cases of prostate cancer.
  • ADT androgen deprivation therapy
  • prostate cancer can eventually become refractory to ADT.
  • CRPC Basation-resistant prostate cancer
  • hormone- refractory prostate cancer is prostate cancer that has become androgen-independent and progresses despite low levels of androgens (for example, in a subject undergoing ADT).
  • RNA interference refers to a cellular process that inhibits expression of genes, including cellular and viral genes. RNAi is a form of antisense- mediated gene silencing involving the introduction of double stranded RNA-like oligonucleotides leading to the sequence- specific reduction of RNA transcripts. Double-stranded RNA molecules that inhibit gene expression through the RNAi pathway include small (or short) interfering RNA (siRNA), micro-RNA (miRNA), and short (or small) hairpin RNA (shRNA).
  • siRNA small interfering RNA
  • miRNA micro-RNA
  • shRNA short hairpin RNA
  • Short hairpin RNA An RNA that makes a tight hairpin turn and can be used to silence gene expression via the RNAi pathway.
  • the shRNA hairpin structure is cleaved by the cellular machinery into siRNA.
  • a shRNA molecule is one that reduces or interferes with the biological activity of one or more molecules that encode LSD1, HDAC, or PARP.
  • siRNA Short (or small) interfering RNA: A double stranded nucleic acid molecule capable of RNA interference or "RNAi.”
  • RNAi RNA interference
  • siRNA molecules need not be limited to those molecules containing only RNA, but further encompasses chemically modified nucleotides and non-nucleotides having RNAi capacity or activity.
  • a siRNA molecule is one that reduces or interferes with the biological activity of one or more molecules that encode LSD1, HDAC, or PARP.
  • Subject Living multi-cellular vertebrate organisms, a category that includes both human and non-human mammals.
  • Subjects include veterinary subjects, including livestock such as cows and sheep, rodents (such as mice and rats), and non-human primates.
  • Therapeutically effective amount An amount of a pharmaceutical preparation that alone, or together with a pharmaceutically acceptable carrier or one or more additional therapeutic agents, induces the desired response.
  • a therapeutic agent such as a chemotherapeutic agent, is administered in therapeutically effective amounts.
  • Effective amounts a therapeutic agent can be determined in many different ways, such as assaying for a reduction in tumor size or improvement of
  • physiological condition of a subject having cancer such as prostate cancer.
  • transfected A transfected cell is a cell into which has been introduced a nucleic acid molecule by molecular biology techniques.
  • transfection encompasses all techniques by which a nucleic acid molecule (such as a DNA or siRNA) might be introduced into such a cell, including transfection with viral vectors, transformation with plasmid vectors, and introduction of naked nucleic acid by electroporation, lipofection, and particle gun acceleration.
  • Treating a disease refers to a therapeutic intervention that ameliorates a sign or symptom of a disease or pathological condition, such as a sign or symptom of prostate cancer. Treatment can also induce remission or cure of a condition, such as prostate cancer. In particular examples, treatment includes preventing a disease, for example by inhibiting the full development of a disease. Prevention of a disease does not require a total absence of disease. For example, a decrease of at least 50% can be sufficient.
  • cancer such as prostate cancer (for example, castration-resistant prostate cancer), breast cancer, or ovarian cancer) including administering a therapeutically effective amount of an inhibitor of lysine-specific demethylase 1 (LSDl) to a subject with cancer.
  • the methods include administering a therapeutically effective amount of an inhibitor of LSDl and a DNA damaging agent or an inhibitor of poly (ADP ribose) polymerase (PARP) to the subject.
  • PARP poly (ADP ribose) polymerase
  • the methods include administering a therapeutically effective amount of an inhibitor of histone deacetylase (HDAC) and a DNA damaging agent or an inhibitor of PARP to the subject.
  • HDAC histone deacetylase
  • the disclosed methods include treating a subject with cancer, such as prostate cancer (for example, CRPC) including administering a therapeutically effective amount of an LSDl inhibitor to the subject.
  • the LSDl inhibitor is any inhibitor of LSDl activity or expression, such as those described in Section V, below.
  • the method includes administering a therapeutically effective amount of a polyamine analog (such as XB154, PG 11047 or PG11144).
  • a polyamine analog such as XB154, PG 11047 or PG11144.
  • the structures of XB 154, PG11047, and PG11144 are provided in FIGS. 19A to 19C. .
  • the LSDl inhibitor inhibits LSDl activity (for example, decreases LSDl histone demethylation activity).
  • an LSDl inhibitor may decrease demethylation (increase methylation) of dimethyl lysine 4 of histones or dimethyl lysine 9 of histones in a cell or a subject, for example, as compared to a cell or subject that has not been treated with the LSDl inhibitor.
  • an LSDl inhibitor includes a small organic molecule, including, but not limited to polyamine analogs, such as XB154 (also known as 2d), PG11047, or PG11144.
  • the LSDl inhibitor inhibits LSDl expression (for example, decreases LSDl mRNA and/or LSDl protein levels).
  • an LSDl inhibitor may decrease amounts of LSDl mRNA, LSDl protein, or both, in a cell or subject, as compared to a cell or subject that has not been treated with the LSDl inhibitor.
  • an LSDl inhibitor includes an RNA interference (RNAi) molecule, such as a small interfering RNA (siRNA) or short hairpin RNA (shRNA).
  • RNAi RNA interference
  • the RNAi molecule includes, but is not limited to, SEQ ID NO: 1 or 3.
  • an LSDl inhibitor decreases expression of one or more andro gen-independent androgen receptor-regulated genes.
  • the expression of the one or more andro gen-independent androgen receptor-regulated genes is decreased by at least about 1.5-fold (such as at least about 2-fold, 2.5-fold, 3-fold, 4-fold, 5-fold, or more) as compared to a cell that has not been treated with the LSDl inhibitor.
  • the genes exhibiting decreased expression following treatment of cells with an LSDl inhibitor include at least one of ACYP1, ARL6IP6, BUB3, CDK1, DEPDC1, HMGB2, HMMR, NCAPG, and PRC1.
  • the genes exhibiting decreased expression following treatment of cells with an LSDl inhibitor include UBE2C and/or CDC20
  • the disclosed methods include treating a subject with cancer (such as prostate cancer, breast cancer, or ovarian cancer) with a
  • the method includes administering a therapeutically effective amount of a polyamine analog such as XB154, PG11047, or PG11144 and a therapeutically effective amount of olaparib to a subject.
  • a polyamine analog such as XB154, PG11047, or PG11144
  • the LSDl inhibitor inhibits LSDl activity (for example, decreases LSDl histone demethylation activity).
  • an LSDl inhibitor may decrease demethylation (increase methylation) of dimethyl lysine 4 of histones or dimethyl lysine 9 of histones in a cell or a subject, for example, as compared to a cell or subject that has not been treated with the LSDl inhibitor.
  • an LSDl inhibitor includes a small organic molecule, including, but not limited to polyamine analogs such as XB154 (also known as 2d), PG11047, or PG11144.
  • the LSDl inhibitor inhibits LSDl expression (for example, decreases LSDl mRNA and/or LSDl protein levels).
  • an LSDl inhibitor may decrease amount of LSDl mRNA, LSDl protein, or both, in a cell or subject, as compared to a cell or subject that has not been treated with the
  • an LSDl inhibitor includes an RNA interference (RNAi) molecule, such as a small interfering RNA (siRNA) or short hairpin RNA (shRNA).
  • RNAi RNA interference
  • siRNA small interfering RNA
  • shRNA short hairpin RNA
  • the RNAi molecule includes, but is not limited to, SEQ ID NO: 1 or 3.
  • an LSD1 inhibitor decreases expression of one or more Fanconi anemia (FA) or BRCA genes.
  • the FA genes include FANCA, FANCB, FANCC, FANCD1 (BRACA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ, FANCL, FANCM, and FANCN.
  • the BRCA genes include BRCAl and BRCA2 (FANCD1).
  • an LSD1 inhibitor decreases expression (such as mRNA expression and/or protein expression) of at least one of BRCAl, BRCA2, FANCA, FANCB, FANCC, FANCD2, FANCG, and FANCM, as compared to a control.
  • the expression of at least one of BRCAl, BRCA2, FANCA, FANCB, FANCC, FANCD2, FANCG, and FANCM is decreased by at least about 1.5-fold (such as at least about 2-fold, 2.5-fold, 3-fold, 4-fold, 5-fold, or more) as compared to a cell that has not been treated with the LSD1 inhibitor.
  • an LSD1 inhibitor decreases expression of FANCD2 protein and/or amount of ubiquitinated FANCD2 (ub-FNACD2) protein as compared to a control.
  • the amount of FANCD2 protein and/or ubFANCD2 is decreased by at least about 1.5-fold (such as at least about 2-fold, 2.5-fold, 3-fold, 4- fold, 5-fold, or more) as compared to a cell that has not been treated with the LSD1 inhibitor.
  • the disclosed methods include treating a subject with cancer (such as prostate cancer, breast cancer, or ovarian cancer) with a cancer (such as prostate cancer, breast cancer, or ovarian cancer) with a cancer (such as prostate cancer, breast cancer, or ovarian cancer) with a subject with cancer (such as prostate cancer, breast cancer, or ovarian cancer) with a subject with cancer (such as prostate cancer, breast cancer, or ovarian cancer) with a subject with cancer (such as prostate cancer, breast cancer, or ovarian cancer) with a subject with cancer (such as prostate cancer, breast cancer, or ovarian cancer) with a cancer (such as prostate cancer, breast cancer, or ovarian cancer) with a cancer (such as prostate cancer, breast cancer, or ovarian cancer) with a subject with cancer (such as prostate cancer, breast cancer, or ovarian cancer) with a subject with cancer (such as prostate cancer, breast cancer, or ovarian cancer) with a subject with cancer (such as prostate cancer, breast cancer, or ovarian cancer) with a subject with cancer
  • the method includes administering a therapeutically effective amount of vorinostat and a therapeutically effective amount of olaparib to a subject.
  • the structure of olaparib is provided in FIG. 19C.
  • the HDAC inhibitor inhibits HDAC activity (for example, decreases HDAC histone deacetylase activity).
  • HDAC inhibitor may decrease deacetylation of N-acetyl lysine on a histone protein in a cell or a subject, for example, as compared to a cell or subject that has not been treated with the HDAC inhibitor.
  • an HDAC inhibitor includes a small organic molecule, including, but not limited to vorinostat, trichostatin A (TSA), or sulforaphane.
  • the HDAC inhibitor inhibits HDAC expression (for example, decreases HDAC mRNA and/or HDAC protein levels).
  • an HDAC inhibitor may decrease amount of HDAC mRNA, HDAC protein, or both, in a cell or subject, as compared to a cell or subject that has not been treated with the HDAC inhibitor.
  • an HDAC inhibitor includes an RNA interference (RNAi) molecule, such as a small interfering RNA (siRNA) or short hairpin RNA (shRNA).
  • RNAi RNA interference
  • siRNA small interfering RNA
  • shRNA short hairpin RNA
  • an HDAC inhibitor decreases expression of one or more Fanconi anemia (FA) or BRCA genes.
  • the FA genes include FANCA, FANCB, FANCC, FANCD1 (BRACA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ, FANCL, FANCM, and FANCN.
  • the BRCA genes include BRCA1 and BRCA2 (FANCD1).
  • an HDAC inhibitor decreases expression (such as mRNA expression and/or protein expression) of at least one of BRCA1, BRCA2, FANCA, FANCB, FANCC, FANCD2, FANCG, and FANCM, as compared to a control.
  • the expression of at least one of BRCA1, BRCA2, FANCA, FANCB, FANCC, FANCD2, FANCG, and FANCM is decreased by at least about 1.5-fold (such as at least about 2-fold, 2.5-fold, 3-fold, 4-fold, 5- fold, or more) as compared to a cell that has not been treated with the HDAC inhibitor.
  • an HDAC inhibitor decreases expression of FANCD2 protein and/or amount of ubiquitinated FANCD2 (ub-FNACD2) protein as compared to a control.
  • the amount of FANCD2 protein and/or ubFANCD2 is decreased by at least about 1.5-fold (such as at least about 2-fold, 2.5- fold, 3-fold, 4-fold, 5-fold, or more) as compared to a cell that has not been treated with the HDAC inhibitor.
  • the methods disclosed herein are utilized to treat a subject with a solid cancer.
  • solid cancers such as sarcomas and carcinomas
  • solid cancers include fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, and other sarcomas, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, lymphoid malignancy, pancreatic cancer, breast cancer, lung cancers, ovarian cancer, prostate cancer, hepatocellular carcinoma, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, Wilm
  • the disclosed methods are used to treat a subject with a hematological malignancy.
  • hematological malignancies include leukemias, including acute leukemias (such as acute lymphocytic leukemia, acute myelocytic leukemia, acute myelogenous leukemia and myeloblastic,
  • chronic leukemias such as chronic myelocytic (granulocytic) leukemia
  • myelogenous leukemia and chronic lymphocytic leukemia
  • polycythemia vera lymphoma
  • lymphoma lymphoma
  • Hodgkin' s disease non-Hodgkin' s lymphoma (indolent and high grade forms)
  • multiple myeloma Waldenstrom's macroglobulinemia, heavy chain disease, myelodysplasia syndrome, hairy cell leukemia and myelodysplasia.
  • the cancer is prostate cancer, breast cancer, or ovarian cancer.
  • the cancer is castration- resistant prostate cancer.
  • the cancer is small cell prostate carcinoma.
  • the disclosed methods include treating a subject with cancer with a therapeutically effective amount of an LSDl inhibitor, a combination of an LSDl inhibitor and a DNA damaging agent or a PARP inhibitor, or an HDAC inhibitor and a DNA damaging agent or a PARP inhibitor.
  • Inhibitors of LSDl, HDAC, and PARP are known to one of skill in the art including, but are not limited to the inhibitors described below.
  • the disclosed methods include treating a subject with cancer (such as prostate cancer, breast cancer, or ovarian cancer) with an inhibitor of LSDl.
  • Inhibitors of LSDl are known to, or can be identified by, one of skill in the art.
  • an LSDl inhibitor specifically inhibits LSDl activity (such as LSDl histone demethylase activity).
  • an LSDl inhibitor specifically inhibits LSDl expression (such as LSDl mRNA expression or longevity and/or LSDl protein expression or longevity).
  • the LSDl inhibitor is a previously identified small molecule LSDl inhibitor.
  • the inhibitor is a polyamine analog.
  • the polyamine analog is a bisguanidine polyamine analog or a biguanide polyamine analog.
  • the LSDl inhibitor is a biguanide analog, such as XB154 (also known as 2d; Huang et al., Proc. Natl. Acad. Sci. 104:8023-8028, 2007).
  • the polyamine analog is an oligoamine analog, such as a pentamine (for example, PGl 1122, PGl 1128, or PGl 1141), hexamine (for example, PGl 1231, PGl 1287, or PGl 1288), octamine (for example, PGl 1157, PGl 1158, or PGl 1160), or decamine (such as PGl 1144, PGl 1150, or PGl 1159).
  • a pentamine for example, PGl 1122, PGl 1128, or PGl 1141
  • hexamine for example, PGl 1231, PGl 1287, or PGl 1288
  • octamine for example, PGl 1157, PGl 1158, or PGl 1160
  • decamine such as PGl 1144, PGl 1150, or PGl 1159. See, e.g., Huang et al, Clin. Cancer Res.
  • the LSDl inhibitor is a decamine oligoamine analog, such as PGl 1144 or PGl 1150.
  • the LSDl inhibitor is a conformationally restricted polyamine analog, such as PGl 1047 (see, e.g., Casero and Marton, Nature Rev. Drug Discovery 6:373- 390, 2007; U.S. Pat. No. 5,889,061).
  • the LSDl inhibitor is a monoamine oxidase inhibitor, such as pargyline, trans-2-phenylcyclorpropylamine (tranylcypromine), phenelzine, nialamide, clorgyline, or deprenyl. See, e.g., Lee et al., Chem. Biol. 13:563-567, 2006.
  • the LSDl inhibitor is pargyline.
  • the LSDl inhibitor is an antisense compound. Any type of antisense compound that specifically targets and regulates expression of LSDl is contemplated for use.
  • An antisense compound is one which specifically hybridizes with and modulates expression of a target nucleic acid molecule (such as LSDl).
  • the agent is an antisense compound selected from an antisense oligonucleotide, a siRNA, a miRNA, a shRNA or a ribozyme.
  • these compounds can be introduced as single- stranded, double-stranded, circular, branched or hairpin compounds and can contain structural elements such as internal or terminal bulges or loops.
  • Double- stranded antisense compounds can be two strands hybridized to form double- stranded compounds or a single strand with sufficient self complementarity to allow for hybridization and formation of a fully or partially double-stranded compound.
  • an antisense oligonucleotide is a single stranded antisense compound, such that when the antisense oligonucleotide hybridizes to a target mRNA, the duplex is recognized by RNaseH, resulting in cleavage of the mRNA.
  • a miRNA is a single- stranded RNA molecule of about 21-23 nucleotides that is at least partially complementary to an mRNA molecule that regulates gene expression through an RNAi pathway.
  • a shRNA is an RNA oligonucleotide that forms a tight hairpin, which is cleaved into siRNA.
  • siRNA molecules are generally about 20-25 nucleotides in length and may have a two nucleotide overhang on the 3' ends, or may be blunt ended. Generally, one strand of a siRNA is at least partially complementary to a target nucleic acid.
  • Antisense compounds specifically targeting LSDl can be prepared by designing compounds that are complementary to an LSDl nucleotide sequence, such as an LSDl mRNA sequence. Antisense compounds need not be 100%
  • the antisense compound, or antisense strand of the compound if a double- stranded compound can be at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% complementary to the selected LSDl nucleic acid sequence, such as about 20-25 contiguous nucleotides of an LSDl nucleic acid.
  • LSDl nucleic acid sequences are provided above.
  • Exemplary LSDl antisense compounds are commercially available (for example, catalog numbers sc-60970, sc-60970-SH, and sc-60970- V, Santa Cruz Biotechnologies (Santa Cruz, CA); or catalog numbers L-0092223-00, M-009223-01, E-009223-00, SH-009223-01, Thermo Scientific Dharmacon (Lafayette, CO)).
  • the RNAi molecule includes, but is not limited to, SEQ ID NO: 1 or 3. Methods of screening antisense compounds for specificity are well known in the art.
  • LSD1 inhibitors for use in the present disclosure also include novel LSD1 inhibitors developed in the future.
  • the disclosed methods include treating a subject with cancer (such as prostate cancer, breast cancer, or ovarian cancer) with an inhibitor of HDAC.
  • Inhibitors of HDAC are known to, or can be identified by, one of skill in the art.
  • an HDAC inhibitor specifically inhibits HDAC activity (such as histone deacetylase activity).
  • an HDAC inhibitor specifically inhibits HDAC expression (such as HDAC mRNA expression or longevity and/or HDAC protein expression or longevity).
  • the HDAC inhibitor is a previously identified small molecule HDAC inhibitor.
  • the HDAC inhibitor includes short-chain fatty acids (for example, sodium butyrate and valproic acid), epoxides (for example, depudecin and trapoxin), cyclic peptides (for example, apicidin and depsipeptide), hydroxamic acids (for example, trichostatin A, suberoylanilide hydroxamic acid (SAHA, also known as vorinostat), oxamflatin, scriptaid, and pyroxamide), benzamides (for example, MS-275 and CI-994), and other hybrid compounds (for example, SK-7068).
  • short-chain fatty acids for example, sodium butyrate and valproic acid
  • epoxides for example, depudecin and trapoxin
  • cyclic peptides for example, apicidin and depsipeptide
  • hydroxamic acids for example, trichostatin A, sub
  • HDAC inhibitors include BML-210, M344, NVP-LAQ-824, CHR-3996, CHR-2845, SB939, AR-42, ITF2357, panobinostat (LBH589), mocetinostat (MGCD0103), romidepsin (FR901228), resminostat (4SC-201), and belinostat (PXD101).
  • the HDAC inhibitor is vorinostat, LBH589, TSA, or sulforaphane.
  • the HDAC inhibitor is an antisense compound.
  • Any type of antisense compound that specifically targets and regulates expression of HDAC is contemplated for use. Methods of designing, preparing and using HDAC antisense compounds are within the abilities of one of skill in the art, for example, utilizing publicly available HDAC sequences.
  • Antisense compounds specifically targeting HDAC can be prepared by designing compounds that are complementary to an HDAC nucleotide sequence, such as an HDAC mRNA sequence. Antisense compounds need not be 100% complementary to the target nucleic acid molecule to specifically hybridize and regulate expression the target gene.
  • the antisense compound, or antisense strand of the compound if a double-stranded compound can be at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% complementary to the selected HDAC nucleic acid sequence, such as about 20-25 contiguous nucleotides of an HDAC nucleic acid.
  • HDAC nucleic acid sequences are provided above.
  • HDAC antisense compounds are commercially available (for example, from Santa Cruz Biotechnologies (Santa Cruz, CA); or Thermo Scientific
  • HDAC inhibitors for use in the present disclosure also include novel HDAC inhibitors developed in the future.
  • the disclosed methods include treating a subject with cancer (such as prostate cancer, breast cancer, or ovarian cancer) with an inhibitor of LSD1 or HDAC and a DNA damaging agent or an inhibitor of PARP.
  • DNA damaging agents are known to one of skill in the art, and include mitomycin C (MMC), diepoxybutane (DEB), platinum compounds (such as carboplatin, cisplatin, oxaliplatin, and bbr3464), cyclophosphamide, psoralen, adriamycin, 5-fluorouracil (5FU), etoposide (VP- 16), camptothecin, actinomycin-D, doxorubicin, bleomycin, or radiation (such as UVA radiation or gamma radiation).
  • PARP inhibitors are also known to one of skill in the art and are discussed in detail below.
  • the subject is treated with an inhibitor of LSD1 or HDAC and a PARP inhibitor.
  • Inhibitors of PARP are known to, or can be identified by, one of skill in the art.
  • a PARP inhibitor specifically inhibits PARP activity (such as poly(ADP ribosyl)ation activity).
  • a PARP inhibitor specifically inhibits PARP expression (such as PARP mRNA expression or longevity and/or PARP protein expression or longevity).
  • the PARP inhibitor is a previously identified small molecule PARP inhibitor.
  • a PARP inhibitor includes a benzamide analog, which binds competitively with the natural substrate NAD in the catalytic site of PARP.
  • a PARP inhibitor includes a quinolone, isoquinolone, benzopyrone, methyl 3,5-diiodo-4-(4'-methoxyphenoxy)benzoate, methyl-3,5-diiodo-4-(4'-methoxy-3',5'-diiodo-phenoxy)benzoate, benzimidazole, or indole.
  • the PARP inhibitor includes olaparib (AZD- 2281), BSI 201, veliparib (ABT-888), AG014699, CEP 9722, MK4827, LT-673, E7016, PF-01367338, and 3-aminobenzamide.
  • olaparib AZD- 2281
  • BSI 201 BSI 201
  • ABT-888 veliparib
  • CEP 9722 MK4827
  • LT-673 LT-673
  • E7016 PF-01367338
  • 3-aminobenzamide 3-aminobenzamide.
  • the PARP inhibitor is olaparib. In another particular example, the PARP inhibitor is ABT-888.
  • the PARP inhibitor is an antisense compound. Any type of antisense compound that specifically targets and regulates expression of PARP is contemplated for use. Methods of designing, preparing and using PARP antisense compounds are within the abilities of one of skill in the art, for example, utilizing publicly available PARP sequences. Antisense compounds specifically targeting PARP can be prepared by designing compounds that are complementary to a PARP nucleotide sequence, such as a PARP mRNA sequence. Antisense compounds need not be 100% complementary to the target nucleic acid molecule to specifically hybridize and regulate expression the target gene.
  • the antisense compound, or antisense strand of the compound if a double-stranded compound can be at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% complementary to the selected PARP nucleic acid sequence, such as about 20-25 contiguous nucleotides of a PARP nucleic acid.
  • PARP antisense compounds are commercially available (for example, from Santa Cruz Biotechnologies (Santa Cruz, CA); or Thermo Scientific
  • PARP inhibitors for use in the present disclosure also include novel PARP inhibitors developed in the future.
  • the disclosed methods include administering a therapeutically effective amount of an LSD1 inhibitor to a subject with cancer (such as prostate cancer, breast cancer, or ovarian cancer). In other embodiments, the disclosed methods include administering a therapeutically effective amount of an LSD1 inhibitor and a PARP inhibitor to a subject with cancer. In further embodiments, the disclosed methods include administering a therapeutically effective amount of an LSD1 inhibitor and a PARP inhibitor to a subject with cancer.
  • the disclosed methods include administering a therapeutically effective amount of an HDAC inhibitor and a PARP inhibitor to a subject with cancer.
  • Inhibitors of LSD1, HDAC, and PARP are known to one of skill in the art, such as those discussed above (Section V).
  • the method includes selecting a subject with CRPC and administering a therapeutically effective amount of an LSD1 inhibitor (such as a polyamine analog) to the subject.
  • the method includes selecting a subject with small cell prostate carcinoma and administering a therapeutically effective amount of an LSD1 inhibitor (such as a polyamine analog) to the subject.
  • CRPC is generally defined as prostate cancer with disease progression despite androgen deprivation therapy and castrate serum levels of testosterone.
  • CRPC may present as a rise in serum levels of pro state- specific antigen (with or without symptoms), progression of pre-existing disease, appearance of new metastases, or a combination thereof (see, e.g., Hotte and Saad, Curr. Oncol. 17:S72-S79, 2010). Prognosis of CRPC is generally poor.
  • small cell prostate carcinoma can be diagnosed by histological examination of a prostate tumor biopsy (such as a fine-needle aspirate or core biopsy).
  • small cell prostate carcinoma can include histological features such as sheets of small round blue cells with a high nuclear-to-cytoplasmic ratio, necrosis, coarse (slat and pepper_ chromatin, and nuclear molding.
  • Small cell prostate carcinoma can also stain positive for neuron- specific enolase,
  • the subject may have a prostate tumor including both small cell carcinoma cells and adenocarcinoma cells.
  • Therapeutic agents can be administered to a subject in need of treatment using any suitable means known in the art.
  • Methods of administration include, but are not limited to, intradermal, transdermal, intramuscular, intraperitoneal, parenteral, intravenous, subcutaneous, intratumoral, vaginal, rectal, intranasal, inhalation, oral, or by gene gun.
  • the therapeutic agent is administered
  • the therapeutic agent is administered orally. If two or more agents are administered to a subject (such as an LSD1 inhibitor and a PARP inhibitor or an HDAC inhibitor and a PARP inhibitor), the agents may be administered by the same route or by different routes.
  • Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution of suspension in liquid prior to injection, or as emulsions. Injection solutions and suspensions can be prepared from sterile powders, granules, and tablets. Administration can be systemic or local.
  • Therapeutic agents can be administered in any suitable manner, preferably with pharmaceutically acceptable carriers.
  • Pharmaceutically acceptable carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions of the present disclosure.
  • the pharmaceutically acceptable carriers (vehicles) useful in this disclosure are conventional. Remington: The Science and Practice of Pharmacy, The University of the Sciences in Philadelphia, Editor, Lippincott, Williams, & Wilkins, Philadelphia, PA, 21 st Edition (2005) describes compositions and formulations suitable for pharmaceutical delivery of one or more therapeutic agents Preparations for parenteral administration include sterile aqueous or nonaqueous solutions, suspensions, and emulsions.
  • non-aqueous solvents examples include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
  • Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
  • Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils.
  • Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti- oxidants, chelating agents, and inert gases and the like.
  • compositions for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets, or tablets. Thickeners, flavorings, diluents, emulsifiers, dispersing aids or binders may be desirable.
  • Appropriate dosages for treatment with one or more of LSD1 inhibitors, HDAC inhibitors, and PARP inhibitors can be determined by one of skill in the art.
  • an effective amount of a therapeutic agent that includes one or more of LSD1 inhibitors, HDAC inhibitors, and PARP inhibitors administered to a subject will vary depending upon a number of factors associated with that subject, for example the overall health of the subject, the condition to be treated, or the severity of the condition.
  • An effective amount of an LSD1 inhibitor, HDAC inhibitor, or PARP inhibitor can be determined by varying the dosage of the compound and measuring the resulting therapeutic response, such as an increase in survival (such as overall survival, progression-free survival, or metastasis-free survival) or a decrease in the size, volume or number of tumors.
  • the LSD1, HDAC, and/or PARP inhibitors can be administered in a single dose, or in several doses, as needed to obtain the desired response.
  • the effective amount can be dependent on the source applied, the subject being treated, the severity and type of the condition being treated, and the manner of
  • the LSD1 inhibitor is administered intravenously, intraperitoneally, or orally.
  • the dose of an LSD1 inhibitor administered to a subject may be about 0.1 mg/kg to about 1000 mg/kg.
  • the dose may be about 0.5 mg/kg to about 100 mg/kg, such as about 1 mg/kg, 5 mg/kg, 10 mg/kg, 20 mg/kg, 40 mg/kg, 50 mg/kg, 75 mg/kg, or 100 mg/kg.
  • the dose may be about 10 to 800 mg, for example, about 50 mg to 800 mg, or about 100 mg to 600 mg of an LSD1 inhibitor (such as PG11047, PG11144, or XB 154).
  • PG11047 is administered to the subject intravenously once per week.
  • PG11047 is administered as one or more courses of treatment, where a course of treatment is one dose (such as 600 mg) weekly for three weeks followed by one week off.
  • the HDAC inhibitor is administered intravenously, orally, or intraperitoneally.
  • the dose of an HDAC inhibitor administered to a subject may be about 0.1 mg/kg to about 1000 mg/kg.
  • the dose may be about 1 mg/kg to about 100 mg/kg, such as about 1 mg/kg, 5 mg/kg, 10 mg/kg, 20 mg/kg, 40 mg/kg, 50 mg/kg, 75 mg/kg, or 100 mg/kg.
  • the dose may be about 10 to 800 mg, for example, about 50 mg to 800 mg, or about 100 mg to 600 mg of an HDAC inhibitor.
  • the PARP inhibitor is administered intravenously, orally, or intravenously. In particular examples, the PARP inhibitor is administered orally.
  • the dose of a PARP inhibitor administered to a subject may be about 0.1 mg/kg to about 1000 mg/kg. In particular examples, the dose may be about 1 mg/kg to about 100 mg/kg, such as about 1 mg/kg, 5 mg/kg, 10 mg/kg, 20 mg/kg, 40 mg/kg, 50 mg/kg, 75 mg/kg, or 100 mg/kg. In other examples, the dose may be about 10 to 800 mg, for example, about 50 mg to 800 mg, or about 100 mg to 600 mg of a PARP inhibitor.
  • the combined administration of an LSD1 inhibitor or HDAC inhibitor and a PARP inhibitor includes administering the LSD1 or HDAC inhibitor either sequentially with the PARP inhibitor (e.g., the treatment with one agent first and then the second agent) or administering both agents at substantially the same time (e.g., an overlap in performing the administration).
  • sequential administration a subject is exposed to the agents at different times so long as some amount of the first agent remains in the subject (or has a therapeutic effect) when the other agent is administered.
  • the treatment with both agents at the same time can be in the same dose, for example, physically mixed, or in separate doses administered at the same time.
  • a therapeutically effective dose of an LSD1 inhibitor or HDAC inhibitor includes daily, weekly, bi-weekly, or monthly use for at least about 2 weeks, such as at least about one month, two months, three months, six months, one year, two years, three years, four years, five years, or more.
  • the disclosed methods include an LSD1 inhibitor or an HDAC inhibitor, which can be administered alone, in the presence of a pharmaceutically acceptable carrier, in the presence of other therapeutic agents (for example other anti-cancer therapeutic agents), or both.
  • other therapeutic agents for example other anti-cancer therapeutic agents
  • chemotherapeutic drugs include, but are not limited to, chemotherapeutic drug treatment, radiation, gene therapy, hormonal manipulation, immunotherapy and antisense oligonucleotide therapy.
  • useful chemotherapeutic drugs include, but are not limited to, microtubule binding agents (such as paclitaxel, docetaxel, vinblastine, vindesine, vinorelbine, epothilones, colchicine, dolastatin 15, nocodazole, podophyllotoxin, rhizoxin, and derivatives or analogs thereof), DNA intercalators or cross-linkers (such as cisplatin, carboplatin, oxaliplatin, mitomycins such as mitomycin C, bleomycin, chlorambucil, cyclophosphamide, and derivatives or analogs thereof), DNA synthesis inhibitors (such as methotrexate, 5-fluoro-5'- deoxyuridine, 5'fluorouracil, gemcitabine, and analogs thereof
  • an LSDl inhibitor is administered in combination with one or more of cisplatin, docetaxel, gemcitabine, 5-fluorouracil, bevacizumab, erlotinib, or sunitinib.
  • the LSDl inhibitor PG11047 is administered in combination with cisplatin.
  • the LSDl inhibitor is administered in combination with a PARP inhibitor.
  • the LSDl inhibitor is administered to the subject for a period of time (such as at least one day) prior to administration of the PARP inhibitor.
  • the LSDl inhibitor and PARP inhibitor are administered to the subject at least once per day (such as at least two, three, four, or more times a day) for at least two weeks (such as at least three weeks, four weeks, two months, three months, or more).
  • the HDAC inhibitor is administered to the subject for a period of time (such as at least one day) prior to administration of the PARP inhibitor.
  • the HDAC inhibitor and PARP inhibitor are administered to the subject at least once per day (such as at least two, three, four, or more times a day) for at least two weeks (such as at least three weeks, four weeks, two months, three months, or more).
  • This example describes the effect of inhibition of LSDl on gene expression profiles in prostate cell lines.
  • RWPE-1 were cultured in RPMI1640 medium with 10% fetal bovine serum.
  • Cells were transfected with 50 nM LSDl siRNA (siLSDl; target sequence C AC A AGG A A AGCU AG A AG AUU ; SEQ ID NO: 1) or control siRNA (siLuc; target sequence CGUACGCGGAAUACUUCGATT; SEQ ID NO: 2) with 50 nM LSDl siRNA (siLSDl; target sequence C AC A AGG A A AGCU AG A AG AUU ; SEQ ID NO: 1) or control siRNA (siLuc; target sequence CGUACGCGGAAUACUUCGATT; SEQ ID NO: 2) with 50 nM LSDl siRNA (siLSDl; target sequence C AC A AGG A A AGCU AG A AG AUU ; SEQ ID NO: 1) or control siRNA (siLuc; target sequence CGUACGCGGAAUACUUCGATT; SEQ ID NO: 2) with 50 nM LSDl siRNA
  • Stable transfectants were selected in the presence of 1 ⁇ g/ml puromycin (In vitro gen, Carlsbad, CA). Cells were treated with polyamine analogs for 48 hours at the indicated concentrations.
  • Microarray hybridization All samples were processed simultaneously with labeling and hybridization to Affymetrix U133 2.0 Plus assays. Each biological replicate was labeled and hybridized to its own array without pooling.
  • Hybridized arrays were evaluated for consistency and quality using the Affy package in the R statistical computing environment (R Development Core Team, R Foundation for Statistical Computing, 2008 (R-project.org); Gautier et al,
  • Immunoblotting Whole cell protein extracts were prepared and separated by SDS-PAGE and transferred to an Immobilon® membrane (Millipore, Billerica, MA). Blots were probed with mouse anti-FANCD2 (Santa Cruz Biotechnologies, Santa Cruz, CA), rabbit anti-LSD 1 (Cell Signaling, Beverly, MA), or mouse anti- actin (Sigma- Aldrich), followed by horseradish peroxidase-conjugated goat anti- mouse or goat anti-rabbit IgG. Detection was performed with ECL Western Reagents (Pierce, Rockford, IL).
  • LNCaP prostate cancer cells were treated with the LSDl inhibitor XB154
  • LSDl siRNA also known as 2d or LSDl siRNA. This resulted in global increases in the active di-methyl lysine 4 (2MK4) and repressive di-methyl lysine 9 (2MK9) marks on histone H3, which are removed by LSDl (FIG. 1A and B). This demonstrated XB154 and LSDl siRNA both inhibited LSDl demethylase activity.
  • Gene expression profiling was performed using LNCaP cells treated with polyamine analogs XB154 (10 ⁇ ) or LSDl siRNA for 96 hours. This treatment resulted in >2-fold increase in expression of over 61 common genes and >2-fold decrease in expression of 293 common genes. Notably, many of these genes were not AR target genes.
  • the Fanconi anemia (FA) DNA damage repair pathway was the top pathway whose gene members changed in expression in both polyamine analog- and LSDl siRNA-treated cells. Many of these genes had >1.5-fold decrease in expression in cells treated with XB154, PG11144, PG11047, or LSDl siRNA (FIG. 2).
  • FANCD2 mRNA levels versus vector-transfected cells FIG. 3
  • XB154 treatment reduced FANCD2 mRNA levels in LNCaP cells treated for 48 hours (FIG. 4A).
  • FANCD2 protein levels and levels of ubiquitinated FANCD2 (ub- FANCD2) were also reduced in LNCaP cells following 24-48 hours of treatment with XB154 or LSDl siRNA (FIG. 4B) and in LSDl stable knockdown cells (FIG. 4C). This result was also obtained in cells treated with the monoamine oxidase LSDl inhibitor pargyline (FIG. 4D).
  • Treatment with XB154 for 24 or 48 hours also reduced levels of BRCA1 mRNA in a concentration-dependent manner (FIG. 5).
  • LNCaP cells were also treated with HDAC inhibitors and analyzed by gene expression profiling. Similar to XB154 and LSDl siRNA treatment, inhibition of HDAC resulted in >1.5-fold decrease in expression of DNA damage repair enzyme expression (FIG. 6).
  • This example describes the effect of inhibition of LSDl on cell proliferation and viability.
  • LNCaP cells were plated in 12- well plates at 75,000 cells/well.
  • XB154 was added at 1 ⁇ or 5 ⁇ final concentration the next day.
  • Mitomycin C (MMC) was added 24 hours after XB154 treatment.
  • Cell counts were performed after 48 hours of MMC treatment with the Countess® Automated Cell Counter (Invitrogen).
  • shLSDl cells and shNTC cells (described in Example 1) were plated in 12 well plates at 50,000 cells/well.
  • Olaparib was added at 1 ⁇ or 5 ⁇ the next day, and again after 3 days. Cell counts were performed after 5 days with the Countess® Automated Cell Counter (Invitrogen).
  • LNCaP cells with a stable knockdown of LSDl expression had greatly reduced proliferation compared to control cells (FIG. 7). Similar results were obtained with cells treated with XB154 or pargyline and all other prostate cancer cell lines tested (DU145, VCaP, and LAPC4).
  • LNCaP cells treated with XB154 for 24 hours and subsequently co-treated with MMC for 48 hours showed greater sensitivity to MMC than cells treated with XB154 or MMC alone (FIG. 8).
  • Treatment of shLSDl cells with olaparib, a PARP inhibitor also resulted in enhanced cell death compared to control shNTC cells (FIG. 9).
  • This example describes analysis of gene expression in androgen-dependent and androgen-independent cells and the effect of inhibition of LSD1.
  • ADT Androgen deprivation therapy
  • Intratumoral androgens and canonical, androgen- dependent signaling persist in CRPC cells from patients (Mostahel et al., Cancer Res. 67:5033-5041, 2007; Mohler ei a/., Clin. Cancer Res. 10:440-448, 2004). This highlights the misnomer of only classifying prostate cancers that have not been treated with ADT or which are responding to ADT as androgen-dependent (non- CRPC may be a more accurate descriptor for these cancers).
  • CRPC cell lines (Abl or C42B), which are LNCaP derivatives grown chronically in the absence of androgens
  • the top upregulated pathways versus LNCaP cells are "cell cycle” or “mitotic cell cycle” (Wang et al., Cell 138:245-256, 2009).
  • This androgen- independent program promotes progression through the mitotic phase of the cell cycle, and RNA interference to AR in CRPC cells leads to reduced expression of these genes (which highlights their AR-dependency) and leads to G2-M cell cycle arrest (Wang et al., Cell 138:245-256, 2009).
  • Prostate cancer cell line LNCaP and PC3 were cultured in RPMI 1640 medium with 10% fetal bovine serum.
  • Cells were transfected with 50 nM AR siRNA (siAR, target sequence GACCUACCGAGGAGCUUUCUU: SEQ ID NO: 4), LSD1 siRNA, or control siRNA (described in Example 1) with 50 nM AR siRNA (siAR, target sequence GACCUACCGAGGAGCUUUCUU: SEQ ID NO: 4), LSD1 siRNA, or control siRNA (described in Example 1) with
  • DharmaFECT 3 siRNA transfection reagent (Thermo Scientific Dharmacon, Lafayette, CO). Cells were harvested 96 hours post-transfection. Stable LSD1 knockdown cells were described in Example 1.
  • XB154 treatment cells were treated with XB154 for 48 hours at the indicated concentrations.
  • PG11144 (Progen) treatment cells were treated with PG11144 for 96 hours at the indicated concentrations.
  • RT-PCR was performed as described in Example 1. Primers used for RT-PCR are provided in Table 1. Immunoblotting: Immunoblots were performed as described in Example 1. Antibodies used were rabbit anti-AR (Millipore), mouse anti-2MK9 (Abeam, Cambridge, MA), and mouse anti-GAPDH (Santa Cruz Biotechnologies).
  • Chromatin Immunoprecipitation Cells were cross-linked with formaldehyde and reactions were stopped with glycine. Cross-linked cells were resuspended in IP buffer with SigmaFastTM protease inhibitor tablets (Sigma- Aldrich) and sonicated on ice by using a Branson Digital Sonifier® model 450. Immunoprecipitations were performed with rabbit anti-LSD 1 (Abeam), rabbit anti- AR (Santa Cruz), rabbit anti-AcH3 (Millipore) and normal rabbit IgG (Millipore) on Dynabeads® (Invitrogen). For real time PCR, 2 ⁇ of 50 ⁇ DNA extract was used.
  • RNA interference This allowed comparison of the effect of RNA interference to LSDl in LNCaP cells versus AR in LNCaP and Abl cells.
  • the gene expression profiles were compared to published gene expression profiles after the addition of dihydrotestosterone (DHT) to LNCaP or Abl cells grown in charcoal- stripped serum, which allowed determination of the effect of RNA interference to LSDl on androgen-dependent genes.
  • DHT dihydrotestosterone
  • RNA interference to LSDl in LNCaP cells or to AR in both LNCaP and Abl cells reduced gene expression of many AR-bound genes. Indeed, RNA interference to LSDl in LNCaP most closely resembled gene expression profiles after RNA interference to AR in Abl cells. None of the AR-bound genes that declined in expression with RNA interference to LSDl in LNCaP cells (RNA interference to LSDl was done in cells grown in the presence of androgens) increased in expression with the addition of androgens, which highlights their andro gen-independence (FIG. 10).
  • PGl 1144 inhibited LSDl function (increased 2MK9 levels) and attenuated androgen-independent (but not canonical androgen-dependent) "AR" signaling without affecting AR protein levels (FIG. 11).
  • This effect of RNA interference to LSDl or PGl 1144 treatment was recapitulated in non-CRPC cells such as VCaP and LAPC4 and CRPC C42B cells, which highlights the generalizability of these findings.
  • Chrin immunoprecipitation (ChIP) assays showed that these androgen-independent "AR" genes are direct targets of both AR and LSDl in
  • LNCaP cells grown in the absence of androgens. RNAi-mediated suppression of AR, LSDl, or both decreased expression of both UBE2C and CCNA2 (FIGS. 12A and B) in LNCaP cells.
  • a representative ChIP PCR for UBE2C and CCNA2 is shown in FIG. 12C.
  • RNA interference to AR or LSDl or treatment with PGl 1144 or XB154 recapitulated the effect of these manipulations in LNCaP cells, resulting in reduced androgen-independent "AR" target gene expression and reduced proliferation (FIG. 13). Furthermore, treatment of PC3 cells (AR negative) with siLDSl or XB154 caused decreases in proliferation gene expression (FIG. 14). Finally, treatment with PG11144 did not lower expression of classic androgen-dependent genes, such as Nkx3.1 in LNCaP cells (FIG. 15).
  • This example describes the effect of inhibition of LSDl on cell growth and proliferation and cell cycle progression.
  • LNCaP, Abl, or C42B cells were transfected with siAR, siLSDl or siLUC (described as in Examples 1 and 3), then plated in 12-well plates at 50,000 cells/well. Cell counts were performed the next day (set as start point) and 5 days after siRNA transfection with the Countess® Automated Cell Counter (Invitrogen). Growth in CSM was examined as above, except cells were cultured in RPMI1640 plus 10% FBS after siRNA transfection. Cell counts were performed the next day (set as start point) and 5 days after siRNA transfection with the Countess® Automated Cell Counter (Invitrogen).
  • Stable shLSDl (or shNTC) cells were plated in 12-well plates at 50,000 cells/well with 5 ⁇ g/ml puromycin. Cell counts were performed at indicated days with the Countess® Automated Cell Counter (Invitrogen).
  • RNA interference to LSDl prostate cancer cell growth was assessed.
  • LSDl knockdown inhibited growth of Abl and C42B cells (FIG. 16).
  • LSDl knockdown with siRNA also inhibited growth of LNCaP cells (non-CRPC cells) in the absence of androgens (FIG. 17).
  • RNA interference to LSD1 led to accumulation of cells in the G2-M phases of the cell cycle (FIG. 18).
  • Prostate cancer cell lines LNCaP, Abl, and PC3 were cultured in RPMI1640 medium with 10% fetal bovine serum. Cells at 30% confluency were treated with PG11144 or PG11047 in water at the indicated concentrations and harvested at the indicated times post-treatment. Cell viability was analyzed by trypan blue exclusion.
  • Immunoblotting Whole cell protein extracts were prepared and separated by SDS-PAGE and transferred to an Immobilon® membrane (Millipore, Billerica, MA). Blots were probed with mouse anti-FANCD2 (Santa Cruz Biotechnologies, Santa Cruz, CA), rabbit anti-Histone H3 di-methyl lysine 4 (Millipore, Billerica, MA), mouse anti-Histone H3 di-methyl lysine 9 (Abeam, Cambridge, MA) or mouse anti-actin (Sigma- Aldrich), followed by infrared dye-labeled goat anti-mouse or goat anti-rabbit IgG. Detection was performed with an Odyssey® imager (LI- COR Biotechnology, Lincoln, Iowa).
  • suppression of LSDl expression with RNAi eliminated the effect of PGl 1047 treatment on histone methylation (FIG. 20C).
  • This example describes assessment of effectiveness and toxicity of treatment of cells in vitro with a combination of LSDl inhibitor and PARP inhibitor.
  • prostate cancer cell lines are treated with an LSDl inhibitor plus or minus a PARP inhibitor.
  • the prostate cancer cell lines include androgen-dependent cell lines (such as LNCaP, PC3, and DU145 cells) and androgen-independent prostate cancer cell lines (such as Abl and C42B cells).
  • the prostate cancer cells are transfected with LSDl siRNA or shRNA to decrease LSDl expression (LSDl knockdown cells).
  • LSDl knockdown cells are treated with varying amounts (such as 0.1 ⁇ to 100 ⁇ ) of a PARP inhibitor (such as olaparib) for 1-7 days.
  • unmodified prostate cancer cells are treated with varying amounts (such as 0.1 ⁇ to 100 ⁇ ) of an LSDl inhibitor (such as XB154, PGl 144, or pargyline) for one day.
  • LSDl inhibitor such as XB154, PGl 144, or pargyline
  • the cells are then co-treated with the LSDl inhibitor and with varying amounts (such as 0.1 ⁇ to 100 ⁇ ) of a PARP inhibitor (such as olaparib) for 1-7 days.
  • the number of cells is counted and compared to cells treated with vehicle alone or cells treated with the LSDl inhibitor alone.
  • a decrease (such as a statistically significant decrease) in the number of cells following treatment with an LSDl inhibitor and a PARP inhibitor indicates that the combination is effective at decreasing proliferation and/or killing prostate cancer cells.
  • the number of cells undergoing apoptosis may also be determined, for example, using a TUNEL assay, annexin V staining, or other methods known to one of skill in the art.
  • An increase (such as a statistically significant increase) in the number of cells undergoing apoptosis following treatment with an LSDl inhibitor and a PARP inhibitor indicates that the combination is effective at decreasing proliferation and/or killing prostate cancer cells.
  • H2AX foci are measured using
  • the effect of LSDl inhibitor plus PARP inhibitor is assessed in non-cancer cells in culture.
  • non-cancer cells in culture For example, primary cultures from normal bone marrow donors can be used. The cells are treated with an LSDl inhibitor (such as XB154, PG11047, PG11144, or pargyline) and a PARP inhibitor (such as olaparib) as described above. Cell number and apoptosis are assessed as discussed above. No change (for example, no statistically significant change) in cell number or the number of cells undergoing apoptosis as compared to cells treated with vehicle alone indicates that the treatment is not toxic to non-cancer cells.
  • LSDl inhibitor such as XB154, PG11047, PG11144, or pargyline
  • PARP inhibitor such as olaparib
  • This example describes methods for assessing the effectiveness of LSDl inhibitors against prostate cancer cells in an in vivo xenograft model.
  • LNCaP cells with a stable knockdown of LSDl (shLSDl cells) or control cells (such as shNTC cells) are inoculated in the dorsal flank of nude mice by subcutaneous injection (such as 3 x 10 6 cells in 100 of 50% RPMI 1640/BD Matrigel).
  • a two- sample t-test is performed to determine statistical differences in mean tumor volume between the two groups.
  • Unmodified LNCaP cells are inoculated by subcutaneous injection into the dorsal flank of nude mice (such as 3 x 10 6 cells in 100 ⁇ . of 50% RPMI 1640/BD Matrigel). After three weeks, mice are injected intraperitoneally once per day with water (control), pargyline (0.53 mg or 1.59 mg; 1 or 3 mM final concentration, assuming 70% bioavailability), or XB154 (4 or 20 ⁇ g; 1 or 5 ⁇ final concentration, assuming 70% bioavailability) or treated with PGl 1144 (5 mg/kg each week) or PGl 1047 (10 mg/kg each week) Treatment continues for three weeks, during which time mouse weight and tumor volume are measured as above.
  • shLSDl LNCaP cells or control cells are injected in nude mice as above. After three weeks, mice are treated with 2.6 ⁇ g mitomycin C (predicted final concentration of 1 ⁇ assuming 40% bioavailability), olaparib (for example, about 0.5 mg/kg to 25 mg/kg), or vehicle intraperitoneally once per day for three weeks. In other examples, unmodified LNCaP cells are injected in nude mice as above.
  • mice are treated with pargyline, XB154, PGl 1047, PGl 1144, or vehicle as above, plus MMC or olaparib. Treatment continues for three weeks, during which time mouse weight and tumor volume are measured as above.
  • a decrease in tumor volume compared to control in mice injected with shLSDl cells indicates that LSDl inhibition decreases tumor growth in vivo.
  • mice injected with LNCaP cells and treated with XB154, PGl 1144, or PGl 1047 indicates that LSDl inhibition decreases tumor growth in vivo.
  • a decrease in tumor volume in mice injected with LNCaP cells and treated with XB154, PGl 1144, or PGl 1047 plus olaparib as compared to mice treated with XB154, PGl 1144, or PGl 1047 alone indicates that inhibition of LSDl plus inhibition of PARP decreases tumor growth in vivo.
  • the harvested xenograft tissue is examined for evidence of LSDl inhibition. This is assessed with Western blots to examine global levels of the 2MK4 and 2MK9 histone marks, expression of FA/BRCA genes, FANCD2 ubiquitination, and LSDl protein levels in the cases of the shRNA cells. A decrease in one or more of these parameters indicates the effective inhibition of LSD 1. Additionally, effects on DNA damage repair are assessed with staining for H2AX foci.
  • This example describes an exemplary prospective clinical trial for treating prostate cancer with polyamine analogs PG11144 or PG11047.
  • methods that deviate from these specific methods can also be used in a clinical trial.
  • Patients identified as having a prostate tumor are selected for treatment. Patients with small cell prostate carcinoma diagnosed by histology on biopsy are selected and followed as a subset of patients. Patients with CRPC are also selected and followed as a subset of patients.
  • Patients are administered PG11047 or PG1144 intravenously (50 mg-750 mg) on days 1, 8, and 15 of a 28 day cycle for at least 2 cycles.
  • PG11047 or PG1144 intravenously (50 mg-750 mg) on days 1, 8, and 15 of a 28 day cycle for at least 2 cycles.
  • PG11047 patients are administered 610 mg PG11047 on days 1, 8, and 15 of a 28 day cycle for at least 2 cycles. Patients are monitored for signs of unacceptable toxicity. Disease progression is monitored periodically (such as weekly, bi-weekly, monthly). Outcome measures include time to progression (for example as measured by Response Evaluation Criteria in Solid Tumors (RECIST) v2.0), overall survival, and quality of life.
  • RECIST Response Evaluation Criteria in Solid Tumors

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Epidemiology (AREA)
  • Organic Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Urology & Nephrology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Disclosed herein are methods of treating cancer utilizing an inhibitor of lysine-specific demethylase 1 (LSDl), an LSDl inhibitor in combination with a DNA damaging agent or an inhibitor of poly (ADP-ribose) polymerase (PARP), or a histone deacetylase (HDAC) inhibitor in combination with a DNA damaging agent or a PARP inhibitor. In one embodiment, the methods include administering a therapeutically effective amount of an LSDl inhibitor to a subject with cancer (such as castration-resistant prostate cancer). In other embodiments, the methods include administering a therapeutically effective amount of an LSDl inhibitor and a therapeutically effective amount of a PARP inhibitor to a subject with cancer (such as prostate cancer, breast cancer, or ovarian cancer). In further embodiments, the disclosed methods include administering a therapeutically effective amount of an HDAC inhibitor and a therapeutically effective amount of a PARP inhibitor to a subject with cancer (such as prostate cancer, breast cancer, or ovarian cancer).

Description

METHODS OF TREATING CANCER WITH INHIBITION OF LYSINE-
SPECIFIC DEMETHYLASE 1
CROSS REFERENCE TO RELATED APPLICATION
This application claims the benefit of U.S. Provisional Application No. 61/364,353, filed July 14, 2010, which is incorporated herein by reference in its entirety.
FIELD
This disclosure concerns inhibitors of lysine- specific demethylase 1 (LSD1), inhibitors of HDAC, and DNA damaging agents or inhibitors of PARP, and methods of their use for treating human diseases, such as cancer.
ACKNOWLEDGMENT OF GOVERNMENT SUPPORT
This invention was made with government support under grant number KL RR024141 awarded by the National Institutes of Health. The government has certain rights in the invention.
BACKGROUND
Cancer of the prostate is the most commonly diagnosed cancer in men and is the second most common cause of cancer death (Carter and Coffey, Prostate 16:39- 48, 1990; Armbruster et al, Clinical Chemistry 39: 181, 1993). If detected at an early stage, prostate cancer is potentially curable. However, a majority of cases are diagnosed at later stages when metastasis of the primary tumor has already occurred (Wang et al, Meth. Cancer Res. 19: 179, 1982). Even early diagnosis is problematic because not all individuals who test positive in these screens develop cancer.
Although androgen deprivation therapy (ADT) is an effective strategy for some prostate cancers, about 27,000 men die of prostate cancer each year, virtually all due to castrate- and chemotherapy-resistant tumors (Jemal et al, CA Cancer J. Clin. 58:71-96, 2008). ADT works by lowering levels of androgens or interfering with androgen binding to and activation of the androgen receptor (AR). ADT is not curative, and "castration-resistance" is common (Scher and Sawyers, /. Clin. Oncol. 23:8253-8261, 2005). Chemotherapy agents, such as docetaxel, and combination chemotherapy regimens are used to treat castration-resistant prostate cancer (CRPC; also referred to as hormone-refractory prostate cancer). However, the prognosis remains poor for individuals with CRPC.
SUMMARY
Disclosed herein are methods of treating cancer utilizing an inhibitor of lysine-specific demethylase 1 (LSDl); an LSDl inhibitor in combination with DNA damaging agent or a poly (ADP-ribose) polymerase (PARP) inhibitor; or a histone deacetylase (HDAC) inhibitor in combination with a DNA damaging agent or a PARP inhibitor.
In one embodiment, the methods include administering a therapeutically effective amount of an LSDl inhibitor to a subject with cancer. In particular examples, the cancer is prostate cancer (such as CRPC or small cell prostate carcinoma). In other embodiments, the methods include administering a
therapeutically effective amount of an LSDl inhibitor and a therapeutically effective amount of a PARP inhibitor to a subject with cancer (such as prostate cancer, breast cancer, or ovarian cancer). The LSDl inhibitor includes any inhibitor of LSDl, such as a small organic molecule, an RNA interference molecule, a peptide, or an antibody. In particular examples, the LSDl inhibitor is a polyamine analog, such as XB154, PG11144, PG11047. In some examples, the LSDl inhibitor decreases the expression of one or more BRCA or Fanconi anemia (FA) gene(s), such as BRCA1, BRCA2, FANCA, FANCB, FANCC, FANCD2, FANCG, or, FANCM. In some examples, the PARP inhibitor includes any inhibitor of PARP, such as a small organic molecule (for example, olaparib).
In further embodiments, the disclosed methods include administering a therapeutically effective amount of an HDAC inhibitor and a therapeutically effective amount of a PARP inhibitor to a subject with cancer (such as prostate cancer, breast cancer, or ovarian cancer). The HDAC inhibitor includes any inhibitor of HDAC, such as a small organic molecule, an RNA interference molecule, a peptide, or an antibody. In particular examples, the HDAC inhibitor is vorinostat (SAHA), trichostatin A, or valproic acid. In some examples, the HDAC inhibitor decreases the expression of one or more androgen-independent androgen receptor-regulated genes, such as UBE2C and CDC20. In some examples, the PARP inhibitor includes any inhibitor of PARP, such as a small organic molecule (for example, olaparib).
The foregoing and other features of the disclosure will become more apparent from the following detailed description, which proceeds with reference to the accompanying figures.
BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a pair of digital images showing immunob lotting of LNCaP cells treated with XB154 (left) or LSDl siRNA (right). GAPDH, glyceraldehyde-3- phosphate dehydrogenase; 2MK4, di-methyl lysine 4; 2MK9, di-methyl lysine 9; NTC, non-targeted control.
FIG. 2 is a heatmap of Fanconi anemia (FANC) and BRCA gene expression in LNCaP cells treated with LSDl siRNA, XB154, PGl 1144, or PGl 1047. Darker shading indicates >1.5-fold increase in expression compared to untreated cells; medium shading indicates >1.5-fold decrease in expression compared to untreated cells; and lighter shading indicates <1.5-fold change in expression compared to control.
FIG. 3 is a graph showing relative FANCD2 mRNA expression in LNCaP cells transfected with vector alone (pcDNA3.1) or LSDl.
FIG. 4A is a graph showing FANCD2 mRNA expression in LNCaP cells treated with the indicated amount of XB154 for 48 hours.
FIG. 4B is a pair of digital images showing FANCD2 and ubiquitinated FANCD2 (ub-FANCD2) protein (upper) and β-actin (control, lower) in LNCaP cells treated with the indicated amount of XB154 for 24 or 48 hours.
FIG. 4C is a series of digital images of immunoblots of LSDl, FANCD2 and GAPDH in LNCaP cells with stable knockdown of LSDl by shRNA. Relative amounts of FANCD2 and ub-FANCD2 are shown below the blot. NTC, non- targeted control shRNA. FIG. 4D is a pair of digital images of immunoblots of FANCD2 and β-actin in LNCaP cells treated with pargyline. Relative amounts of FANCD2 and ub- FANCD2 are shown below the blot.
FIG. 5 is a graph showing relative expression of BRCA1 mRNA in LNCaP cells treated with the indicated amount of XB 154 for 24 or 48 hours.
FIG. 6 is a heatmap of Fanconi anemia (FANC) and BRCA gene expression in LNCaP cells treated with histone deacetylase (HDAC) inhibitors sulforaphane (SFN), trichostatin A (TSA), or vorinostat (SAHA) or LSD1 siRNA or XB154. Dark shading indicates > 1.5-fold decrease in expression compared to untreated cells; light shading indicates no change in expression compared to control.
FIG. 7 is a graph showing effect of LSD1 knockdown (shLSDl) on proliferation of LNCaP cells.
FIG. 8 is a graph showing the total cell counts of LNCaP cells pre-treated with the indicated amount of XB154 for 24 hours, followed by 48 hour co-treatment with mitomycin C (MMC).
FIG. 9 is a graph showing percent viability of LNCaP cells with LSD1 knockdown (shLSDl) or mock transfected (shNTC) treated with the indicated amount of olaparib.
FIG. 10 is a heatmap indicating up or down (1.5 fold) regulation for probe sets from a 16 hour treatment with dihydrotestosterone (DHT) or siRNA to androgen receptor (siAR) in both LNCaP and Abl cells, as well as data with siRNA to LSD1 (siLSDl) in LNCaP cells. Probe sets were selected based on having 1.5 fold change versus control for one of the experiments and having a significant (q-value <0.05) AR binding site within 50 kb of the annotated transcriptional start site for the gene associated with the probe set. Dark shading represents at least a 1.5 fold decrease or increase and light shading indicates that there was not a difference meeting the 1.5 fold threshold.
FIG. 11 is a series of digital images of immunoblots probed with the indicated antibodies after treatment with siRNA against a non-targeted control (NTC) or LSD1 for 96 hours (left) or increasing amounts of PG11144 (right).
2MK9, dimethyl lysine 9; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. FIG. 12 A is a graph showing UBE2C RNA expression in LNCaP cells with RNAi mediated suppression of AR, LSDl, or both AR and LSDl, relative to control.
FIG. 12B is a graph showing CCNA2 RNA expression in LNCaP cells with RNAi mediated suppression of AR, LSDl, or both AR and LSDl, relative to control
FIG. 12C is a graph showing chromatin immunoprecipitation (ChIP) PCR results for the UBE2C enhancer I (left) and CCNA2 (right) in LNCaP cells with antibodies to AR, LSDl, acetylated histone H3 (AcH3), and IgG. QPCR was performed in triplicate and enrichment was compared with the input sample.
FIG. 13 is a graph showing relative expression of CDC20 (left) and UBE2C (right) mRNA in LNCaP cells treated with LSDl siRNA, XB154, or PGl 1144 at the indicated concentrations.
FIG. 14 is a pair of graphs showing proliferation gene expression in PC3 cells treated with siLSDl (top) or XB154 (bottom).
FIG. 15 is a graph showing Nkx3.1 mRNA levels in LNCaP cells treated with the indicated amounts of PGl 1144 (top) or siLSDl (bottom).
FIG. 16 is a graph showing cell number quantified after trypan blue exclusion in abl (left) and C4-2B (right) cells transfected with control RNAi (RNAiNTC) or siLSDl.
FIG. 17A is a graph showing proliferation of LNCaP cells treated with siRNA to LSDl or control and grown in the absence of androgens.
FIG. 17B is a digital image of a Western blot showing LSDl expression in the cells.
FIG. 18 is a graph showing the change in percentage of cells in the indicated cell cycle phase relative to control in LNCaP LSDl knockdown cells.
FIG. 19 shows the structures of (A) XB154 (where n=5 and R is 3,3- diphenylpropyl), (B) PGl 1144, (C) PGl 1047, and (D) olaparib.
FIG. 20A is a digital image showing FANCD2 protein expression and ubiquitination and histone methylation (2MK4 and 2MK9) in LNCaP cells treated with PGl 1047 for 96 hours.
FIG. 20B is a digital image showing histone methylation (2MK4 and 2MK9) in LNCaP cells treated with vehicle or 1 μΜ PGl 1047 for 96 hours. FIG. 20C is a digital image showing the effect of LSD 1 suppression on histone methylation (2MK4) in LNCaP cells transfected with the indicated RNAi and then 24 hours later treated with vehicle or 2 μΜ PGl 1047 for 96 hours.
FIG. 20D is a pair of graphs showing relative UBE2C mRNA levels (top) and relative CDC20 mRNA levels (bottom) in LNCaP cells treated with the indicated amounts of PGl 1047 for 96 hours.
FIG. 21 is a digital image showing FANCD2 protein expression and ubiquitination, LSD1 protein expression, and histone methylation (2MK4 and 2MK9) in LNCaP cells treated with the indicated amounts of PGl 1044 for 72 hours.
FIG. 22 is a series of graphs showing the effect of PGl 1144 treatment for
120 hours at the indicated amounts in LNCaP, Abl, and PC3 cells, as determined by trypan blue exclusion.
SEQUENCES
The disclosed nucleic and amino acid sequences referenced herein are shown using standard letter abbreviations for nucleotide bases, as defined in 37 C.F.R. 1.822. In at least some cases, only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand.
The Sequence Listing is submitted as an ASCII text file in the form of the file named Sequence_Listing.txt, which was created on July 13, 2011, and is 4715 bytes, which is incorporated by reference herein.
SEQ ID NO: 1 is an LSD1 siRNA.
SEQ ID NO: 2 is a control luciferase siRNA.
SEQ ID NO: 3 is an LSD1 shRNA.
SEQ ID NO: 4 is an AR siRNA.
SEQ ID NOs: 5-20 are RT-PCR primers.
DETAILED DESCRIPTION
/. Introduction
Fanconi anemia (FA) is a rare genetic disorder characterized by progressive bone marrow failure, cancer susceptibility, and cellular hypersensitivity to DNA cross-linking agents, such as mitomycin C and cisplatin. Loss of function experiments of FA pathway members point to their role in enhancing chemotherapy sensitivity when depleted in cancer cells (Taniguchi et al, Nature Med. 9:568-574, 2003). Of the 11 pathway members, FANCA, FANCB, FANCC, FANCE, FANCF, FANCG, FANCL, and FANCM form a nuclear core complex (Meetei et al, Nature Genet. 36: 1219-1224, 2004; Levitus et al, Nature Genet. 37:934-935, 2005; Levran et al, Nature Genet. 37:931-933, 2005). This complex must be completely intact in order to facilitate the monoubiquitination of the downstream FANCD2 protein, which, in response to DNA damage by cross-linking agents, is required for
FANCD2's co-localization with BRCA1, BRCA2, and RAD51 to damage-induced nuclear foci (Taniguchi et al., Blood 100:2414-2420, 2002; Hussain et al., Hum. Mol. Genet. 13:1241-1248, 2004; Garci-Higuera et al, Mol. Cell 7:249-262, 2001).
As disclosed herein, it has been discovered that inhibition of LSD1 or HDAC reduces expression of many FA genes and prevents FANCD2 ubiquitination.
Inhibition of FA genes provides a synthetic lethal approach to treating cancer by enhancing chemosensitivity of cancer cells to DNA damage-inducing agents. It is also disclosed herein that inhibition of LSD1 (for example, by knockdown of LSD1 expression) increases sensitivity of prostate cancer cells to the PARP inhibitor olaparib. Thus, disclosed herein are methods of treating cancer by administering a therapeutically effective amount of an LSD1 inhibitor or an HDAC inhibitor in combination with a PARP inhibitor.
The central protein in prostate cancer is the androgen receptor (AR) which is a nuclear hormone receptor that is activatable by androgens. Most therapeutic approaches in this disease rest upon depleting androgens or interfering with androgen binding to AR protein. However, the response to androgen deprivation therapy (ADT) is finite, and so-called castration resistant prostate cancers (CRPC) eventually develop. There are currently no known markers which predict poor response or resistance to ADT prior to the initiation of ADT. Such markers, if identified, would allow for the early identification of androgen-independent tumors that may respond better to therapies targeting pathways upregulated in these cells, which are not dependent upon androgens for their expression. Recently, gene expression profiles from non-CRPC cells and their CRPC derivatives (which were generated after chronic growth in the absence of androgens) demonstrated that androgen-independent signaling pathways are enriched in CRPC cells. LSD1 is an AR binding partner which binds to androgen response elements (AREs) along with AR. It is disclosed herein that following inhibition of LSD1 by RNA interference, the top pathways whose expression decline are androgen- independent "AR" signaling pathways that are enriched in CRPC cells and patient samples. This indicates that LSD1 inhibition is a target to prevent or overcome castration-resistance in prostate cancer. Thus, disclosed herein are methods of treating CRPC by administering a therapeutically effective amount of an LSD1 inhibitor.
//. Abbreviations
ADT androgen deprivation therapy
AR androgen receptor
ARE androgen response element
ChIP chromatin immunoprecipitation
CRPC castration-resistant prostate cancer
DHT dihydrotestosterone
FA Fanconi anemia
HDAC histone deacetylase
LSD1 lysine-specific demethylase 1
MMC mitomycin C
PARP poly (ADP ribose) polymerase
QPCR quantitative PCR
shRNA short hairpin RNA
siRNA small interfering RNA
ub-FANCD2 ubiquitinated FANCD2 Terms
Unless otherwise noted, technical terms are used according to conventional usage. Definitions of common terms in molecular biology may be found in
Benjamin Lewin, Genes V, published by Oxford University Press, 1994 (ISBN 0-19- 854287-9); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology : a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8). In order to facilitate review of the various embodiments, the following explanations of certain terms are provided:
DNA damaging agent: A compound or treatment that causes damage to DNA, such as produces DNA strand breaks (such as single-strand or double-strand breaks) or DNA cross -linking. In some examples, a DNA damaging agent includes a DNA cross-linking agent, such as mitomycin C (MMC), diepoxybutane (DEB), platinum compounds (such as carboplatin, cisplatin, oxaliplatin, and bbr3464), cyclophosphamide, psoralen, adriamycin, 5-fluorouracil (5FU), etoposide (VP- 16), camptothecin, actinomycin-D, or radiation (such as UVA radiation).
Histone deacetylase (HDAC): A family of proteins that catalyze deacetylation of histone lysine residues. HDACs are classified into at least three families based on structural homology and co-factor dependence. Class I and II HDACs require zinc as a cofactor, while Class III HDACs require nicotinamide adenine dinucleotide (NAD) for enzyme activity. In cancer, HDACs are recruited to the promoter regions of tumor suppressor genes and result in inappropriate transcriptional repression (such as gene silencing), contributing to tumorigenesis.
Inhibition of HDAC function can reverse transcriptional gene silencing and inhibitors of HDACs have been shown to have anti-tumor activity. HDAC inhibitors include diverse compounds, such as short-chain fatty acids (for example, sodium butyrate and valproic acid), epoxides (for example, depudecin and trapoxin), cyclic peptides (for example, apicidin and depsipeptide), hydroxamic acids (for example, trichostatin A, suberoylanilide hydroxamic acid (SAHA), oxamflatin, scriptaid, and pyroxamide), benzamides (for example, MS-275 and CI-994), and other hybrid compounds (for example, SK-7068).
HDAC nucleic acid and amino acid sequences are publicly available. For example, GenBank Accession Nos.: NM_004964, NM_001527, NM_003883, NM_006037, and NM_006044 disclose exemplary human HDAC nucleic acid sequences, and GenBank Accession Nos.: NP_004955, NP_001518, NP_003874, NP_006028, and NP_006035 disclose exemplary human HDAC amino acid sequences, all of which are incorporated by reference as present in GenBank on July 14, 2010. Other HDAC nucleic acid and amino acid sequences can be identified by one of skill in the art. In certain examples, an HDAC has at least 80% sequence identity, for example at least 85%, 90%, 95%, or 98% sequence identity to a publicly available HDAC sequence, such as those provided herein.
Inhibitor: Any chemical compound, nucleic acid molecule, or peptide, such as a small organic molecule, a nucleic acid (such as an RNAi nucleic acid), or an antibody, specific for a gene product that can reduce activity of a gene product or directly interfere with expression of a gene, such as genes that encode LSD1, HDAC, or PARP, such as in a cancer or a treatment resistant cancer (e.g., a prostate cancer, such as castration-resistant prostate cancer). An inhibitor of the disclosure, for example, can inhibit the activity of a protein that is encoded by a gene either directly or indirectly. Direct inhibition can be accomplished, for example, by binding to a protein and thereby preventing the protein from binding a target (such as a receptor or binding partner) or preventing protein activity (such as enzymatic activity). Indirect inhibition can be accomplished, for example, by binding to a protein's intended target, such as a receptor or binding partner, thereby blocking or reducing activity of the protein. Furthermore, an inhibitor of the disclosure can inhibit a gene by reducing or inhibiting expression of the gene, inter alia by interfering with gene expression (transcription, processing, translation, post- translational modification), for example, by interfering with the gene's mRNA and blocking translation of the gene product or by post-translational modification of a gene product, or by causing changes in intracellular localization.
Lysine-specific demethylase 1 (LSD1): A histone lysine demethylase that specifically demethylates monomethylated and dimethylated histone H3 at K4 (Shi et al, Cell 119:941-953, 2004) and also demethylates dimethylated histone H3 at K9. LSD1 includes a monoamine oxidase-like domain, which has homology to FAD-dependent oxidases. LSD1 also includes an N-terminal SWRIM domain. There are two transcript variants of LSD 1 produced by alternative splicing.
Nucleic acid and amino acid sequences for LSD1 are publicly available. For example, GenBank Accession Nos.: NM_015013 and NM_001009999 disclose exemplary human LSD1 nucleic acid sequences, and GenBank Accession Nos.: NP_055828 and NP_001009999 disclose exemplary human LSD1 amino acid sequences, all of which are incorporated by reference as present in GenBank on July 14, 2010. Other LSDl nucleic acid and amino acid sequences can be identified by one of skill in the art. In one example, LSDl includes a full-length wild-type (or native) sequence, as well as LSDl allelic variants that retain lysine-specific demethylase activity. In certain examples, LSDl has at least 80% sequence identity, for example at least 85%, 90%, 95%, or 98% sequence identity to a publicly available LSDl sequence, such as those provided herein.
Pharmaceutically acceptable carrier: The pharmaceutically acceptable carriers (vehicles) useful in this disclosure are conventional. Remington: The Science and Practice of Pharmacy, The University of the Sciences in Philadelphia, Editor, Lippincott, Williams, & Wilkins, Philadelphia, PA, 21st Edition (2005), describes compositions and formulations suitable for pharmaceutical delivery of one or more therapeutic compounds, molecules or agents.
In general, the nature of the carrier will depend on the particular mode of administration being employed. For instance, parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle. For solid compositions (for example, powder, pill, tablet, or capsule forms), conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. In addition to biologically-neutral carriers, pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
Poly (ADP ribose) polymerase (PARP): As used herein, the term "PARP" includes at least PARP1 and PARP2. PARP1 is the founding member of a large family of poly(ADP-ribose) polymerases with 17 members identified (Ame et ah, Bioessays 26:882-893, 2004). It is the primary enzyme catalyzing the transfer of ADP-ribose units from NAD+ to target proteins including PARP1 itself. Under normal physiologic conditions, PARP1 facilitates the repair of DNA base lesions by helping recruit base excision repair proteins XRCC1 and Ροΐβ (Dantzer et ah,
Methods Enzymol. 409:493-510, 2006). Inhibition of PARP1 results in decreased repair of DNA base damage and increased sensitivity of cells to alkylating agents (Fisher et al, Mol. Cell Biol. 27:5597-5605, 2007). PARP2 contains a catalytic domain and is capable of catalyzing a poly(ADP-ribosyl)ation reaction. This protein has a catalytic domain that is homologous to that of PARPl, but lacks an N-terminal DNA binding domain which activates the C-terminal catalytic domain of PARP. The basic residues within the N-terminal region of this protein may bear potential DNA-binding properties, and may be involved in the nuclear and/or nucleolar targeting of the protein.
PARP nucleic acid and amino acid sequences are publicly available. For example, GenBank Accession Nos.: NM_001618, NM_005484. NM_001042618, NM_005485, NM_001003931, and NM_006437 disclose exemplary human PARP nucleic acid sequences, and GenBank Accession Nos.: NP_001609, NP_005475, NP_001036083, NP_005476, NP_001003931, and NP_006428 disclose exemplary human PARP amino acid sequences, all of which are incorporated by reference as present in GenBank on July 14, 2010. Additional PARP nucleic acid and amino acid sequences can be identified by one of skill in the art. In certain examples, a PARP has at least 80% sequence identity, for example at least 85%, 90%, 95%, or 98% sequence identity to a publicly available PARP sequence, such as those provided herein.
Prostate cancer: A malignant tumor, generally of glandular origin, of the prostate. Prostate cancers include adenocarcinomas and small cell carcinomas. Many prostate cancers express prostate specific antigen (PSA).
Prostate cancer initially grows in an androgen-dependent manner, and androgen deprivation therapy (ADT) is an effective treatment in many cases of prostate cancer. However, prostate cancer can eventually become refractory to ADT. "Castration-resistant prostate cancer" (CRPC, also known as hormone- refractory prostate cancer) is prostate cancer that has become androgen-independent and progresses despite low levels of androgens (for example, in a subject undergoing ADT).
RNA interference (RNAi): Refers to a cellular process that inhibits expression of genes, including cellular and viral genes. RNAi is a form of antisense- mediated gene silencing involving the introduction of double stranded RNA-like oligonucleotides leading to the sequence- specific reduction of RNA transcripts. Double-stranded RNA molecules that inhibit gene expression through the RNAi pathway include small (or short) interfering RNA (siRNA), micro-RNA (miRNA), and short (or small) hairpin RNA (shRNA).
Short hairpin RNA (shRNA): An RNA that makes a tight hairpin turn and can be used to silence gene expression via the RNAi pathway. The shRNA hairpin structure is cleaved by the cellular machinery into siRNA. In an example, a shRNA molecule is one that reduces or interferes with the biological activity of one or more molecules that encode LSD1, HDAC, or PARP.
Short (or small) interfering RNA (siRNA): A double stranded nucleic acid molecule capable of RNA interference or "RNAi." (See, for example, Bass, Nature 411: 428-429, 2001; Elbashir et al, Nature 411: 494-498, 2001; and International Pat. Publication Nos. WO 00/44895; WO 01/36646; WO 99/32619; WO 00/01846; WO 01/29058; WO 99/07409; and WO 00/44914.) As used herein, siRNA molecules need not be limited to those molecules containing only RNA, but further encompasses chemically modified nucleotides and non-nucleotides having RNAi capacity or activity. In an example, a siRNA molecule is one that reduces or interferes with the biological activity of one or more molecules that encode LSD1, HDAC, or PARP.
Subject: Living multi-cellular vertebrate organisms, a category that includes both human and non-human mammals. Subjects include veterinary subjects, including livestock such as cows and sheep, rodents (such as mice and rats), and non-human primates.
Therapeutically effective amount: An amount of a pharmaceutical preparation that alone, or together with a pharmaceutically acceptable carrier or one or more additional therapeutic agents, induces the desired response. A therapeutic agent, such as a chemotherapeutic agent, is administered in therapeutically effective amounts.
Effective amounts a therapeutic agent can be determined in many different ways, such as assaying for a reduction in tumor size or improvement of
physiological condition of a subject having cancer, such as prostate cancer.
Effective amounts also can be determined through various in vitro, in vivo or in situ assays. Transfected: A transfected cell is a cell into which has been introduced a nucleic acid molecule by molecular biology techniques. As used herein, the term transfection encompasses all techniques by which a nucleic acid molecule (such as a DNA or siRNA) might be introduced into such a cell, including transfection with viral vectors, transformation with plasmid vectors, and introduction of naked nucleic acid by electroporation, lipofection, and particle gun acceleration.
Treating a disease: "Treatment" refers to a therapeutic intervention that ameliorates a sign or symptom of a disease or pathological condition, such as a sign or symptom of prostate cancer. Treatment can also induce remission or cure of a condition, such as prostate cancer. In particular examples, treatment includes preventing a disease, for example by inhibiting the full development of a disease. Prevention of a disease does not require a total absence of disease. For example, a decrease of at least 50% can be sufficient.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter disclosed herein belongs. The singular terms "a", "an", and "the" include plural referents unless context clearly indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. All sequences associated with the GenBank Accession Nos. mentioned herein are incorporated by reference in their entirety as they were present on July 14, 2010. In case of conflict, the present specification, including explanations of terms, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. IV. Overview of Several Embodiments
Disclosed herein are methods of treating cancer (such as prostate cancer (for example, castration-resistant prostate cancer), breast cancer, or ovarian cancer) including administering a therapeutically effective amount of an inhibitor of lysine- specific demethylase 1 (LSDl) to a subject with cancer. In some examples, the methods include administering a therapeutically effective amount of an inhibitor of LSDl and a DNA damaging agent or an inhibitor of poly (ADP ribose) polymerase (PARP) to the subject. In other examples, the methods include administering a therapeutically effective amount of an inhibitor of histone deacetylase (HDAC) and a DNA damaging agent or an inhibitor of PARP to the subject.
In one embodiment, the disclosed methods include treating a subject with cancer, such as prostate cancer (for example, CRPC) including administering a therapeutically effective amount of an LSDl inhibitor to the subject. The LSDl inhibitor is any inhibitor of LSDl activity or expression, such as those described in Section V, below. In one specific example, the method includes administering a therapeutically effective amount of a polyamine analog (such as XB154, PG 11047 or PG11144). The structures of XB 154, PG11047, and PG11144 are provided in FIGS. 19A to 19C. .
In some examples, the LSDl inhibitor inhibits LSDl activity (for example, decreases LSDl histone demethylation activity). For example, an LSDl inhibitor may decrease demethylation (increase methylation) of dimethyl lysine 4 of histones or dimethyl lysine 9 of histones in a cell or a subject, for example, as compared to a cell or subject that has not been treated with the LSDl inhibitor. In some examples, an LSDl inhibitor includes a small organic molecule, including, but not limited to polyamine analogs, such as XB154 (also known as 2d), PG11047, or PG11144.
In other examples, the LSDl inhibitor inhibits LSDl expression (for example, decreases LSDl mRNA and/or LSDl protein levels). For example, an LSDl inhibitor may decrease amounts of LSDl mRNA, LSDl protein, or both, in a cell or subject, as compared to a cell or subject that has not been treated with the LSDl inhibitor. In some examples, an LSDl inhibitor includes an RNA interference (RNAi) molecule, such as a small interfering RNA (siRNA) or short hairpin RNA (shRNA). In particular examples, the RNAi molecule includes, but is not limited to, SEQ ID NO: 1 or 3.
In some examples, an LSDl inhibitor decreases expression of one or more andro gen-independent androgen receptor-regulated genes. In some examples, the expression of the one or more andro gen-independent androgen receptor-regulated genes is decreased by at least about 1.5-fold (such as at least about 2-fold, 2.5-fold, 3-fold, 4-fold, 5-fold, or more) as compared to a cell that has not been treated with the LSDl inhibitor. In some examples the genes exhibiting decreased expression following treatment of cells with an LSDl inhibitor (such as LSDl siRNA) include at least one of ACYP1, ARL6IP6, BUB3, CDK1, DEPDC1, HMGB2, HMMR, NCAPG, and PRC1. In other examples, the genes exhibiting decreased expression following treatment of cells with an LSDl inhibitor include UBE2C and/or CDC20 In another embodiment, the disclosed methods include treating a subject with cancer (such as prostate cancer, breast cancer, or ovarian cancer) with a
therapeutically effective amount of an LSDl inhibitor and a therapeutically effective amount of a DNA damaging agent or a PAR inhibitor. The LSDl inhibitor is any inhibitor of LSDl activity or expression, such as those described in Section V, below. Similarly, the PARP inhibitor is any inhibitor of PARP activity or expression, such as those described in Section V, below. DNA damaging agents are also known to one of skill in the art and are described in Section V, below. In one specific example, the method includes administering a therapeutically effective amount of a polyamine analog such as XB154, PG11047, or PG11144 and a therapeutically effective amount of olaparib to a subject.
In some examples, the LSDl inhibitor inhibits LSDl activity (for example, decreases LSDl histone demethylation activity). For example, an LSDl inhibitor may decrease demethylation (increase methylation) of dimethyl lysine 4 of histones or dimethyl lysine 9 of histones in a cell or a subject, for example, as compared to a cell or subject that has not been treated with the LSDl inhibitor. In some examples, an LSDl inhibitor includes a small organic molecule, including, but not limited to polyamine analogs such as XB154 (also known as 2d), PG11047, or PG11144.
In other examples, the LSDl inhibitor inhibits LSDl expression (for example, decreases LSDl mRNA and/or LSDl protein levels). For example, an LSDl inhibitor may decrease amount of LSDl mRNA, LSDl protein, or both, in a cell or subject, as compared to a cell or subject that has not been treated with the
LSDl inhibitor. In some examples, an LSDl inhibitor includes an RNA interference (RNAi) molecule, such as a small interfering RNA (siRNA) or short hairpin RNA (shRNA). In particular examples, the RNAi molecule includes, but is not limited to, SEQ ID NO: 1 or 3.
In some examples, an LSD1 inhibitor decreases expression of one or more Fanconi anemia (FA) or BRCA genes. The FA genes include FANCA, FANCB, FANCC, FANCD1 (BRACA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ, FANCL, FANCM, and FANCN. The BRCA genes include BRCAl and BRCA2 (FANCD1). In one example, an LSD1 inhibitor decreases expression (such as mRNA expression and/or protein expression) of at least one of BRCAl, BRCA2, FANCA, FANCB, FANCC, FANCD2, FANCG, and FANCM, as compared to a control. In some examples, the expression of at least one of BRCAl, BRCA2, FANCA, FANCB, FANCC, FANCD2, FANCG, and FANCM is decreased by at least about 1.5-fold (such as at least about 2-fold, 2.5-fold, 3-fold, 4-fold, 5-fold, or more) as compared to a cell that has not been treated with the LSD1 inhibitor. In another example, an LSD1 inhibitor decreases expression of FANCD2 protein and/or amount of ubiquitinated FANCD2 (ub-FNACD2) protein as compared to a control. In some examples, the amount of FANCD2 protein and/or ubFANCD2 is decreased by at least about 1.5-fold (such as at least about 2-fold, 2.5-fold, 3-fold, 4- fold, 5-fold, or more) as compared to a cell that has not been treated with the LSD1 inhibitor.
In another embodiment, the disclosed methods include treating a subject with cancer (such as prostate cancer, breast cancer, or ovarian cancer) with a
therapeutically effective amount of an HDAC inhibitor and a therapeutically effective amount of a DNA damaging agent or a PARP inhibitor. The HDAC inhibitor is any inhibitor of HDAC activity or expression, such as those described in Section V, below. Similarly, the PARP inhibitor is any inhibitor of PARP activity or expression, such as those described in Section V, below. DNA damaging agents are also known to one of skill in the art and are described in Section V, below. In one specific example, the method includes administering a therapeutically effective amount of vorinostat and a therapeutically effective amount of olaparib to a subject. The structure of olaparib is provided in FIG. 19C.
In some examples, the HDAC inhibitor inhibits HDAC activity (for example, decreases HDAC histone deacetylase activity). For example, an HDAC inhibitor may decrease deacetylation of N-acetyl lysine on a histone protein in a cell or a subject, for example, as compared to a cell or subject that has not been treated with the HDAC inhibitor. In some examples, an HDAC inhibitor includes a small organic molecule, including, but not limited to vorinostat, trichostatin A (TSA), or sulforaphane.
In other examples, the HDAC inhibitor inhibits HDAC expression (for example, decreases HDAC mRNA and/or HDAC protein levels). For example, an HDAC inhibitor may decrease amount of HDAC mRNA, HDAC protein, or both, in a cell or subject, as compared to a cell or subject that has not been treated with the HDAC inhibitor. In some examples, an HDAC inhibitor includes an RNA interference (RNAi) molecule, such as a small interfering RNA (siRNA) or short hairpin RNA (shRNA).
In some examples, an HDAC inhibitor decreases expression of one or more Fanconi anemia (FA) or BRCA genes. The FA genes include FANCA, FANCB, FANCC, FANCD1 (BRACA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ, FANCL, FANCM, and FANCN. The BRCA genes include BRCA1 and BRCA2 (FANCD1). In one example, an HDAC inhibitor decreases expression (such as mRNA expression and/or protein expression) of at least one of BRCA1, BRCA2, FANCA, FANCB, FANCC, FANCD2, FANCG, and FANCM, as compared to a control. In some examples, the expression of at least one of BRCA1, BRCA2, FANCA, FANCB, FANCC, FANCD2, FANCG, and FANCM is decreased by at least about 1.5-fold (such as at least about 2-fold, 2.5-fold, 3-fold, 4-fold, 5- fold, or more) as compared to a cell that has not been treated with the HDAC inhibitor. In another example, an HDAC inhibitor decreases expression of FANCD2 protein and/or amount of ubiquitinated FANCD2 (ub-FNACD2) protein as compared to a control. In some examples, the amount of FANCD2 protein and/or ubFANCD2 is decreased by at least about 1.5-fold (such as at least about 2-fold, 2.5- fold, 3-fold, 4-fold, 5-fold, or more) as compared to a cell that has not been treated with the HDAC inhibitor.
In some examples, the methods disclosed herein are utilized to treat a subject with a solid cancer. Examples of solid cancers, such as sarcomas and carcinomas, include fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, and other sarcomas, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, lymphoid malignancy, pancreatic cancer, breast cancer, lung cancers, ovarian cancer, prostate cancer, hepatocellular carcinoma, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, Wilms' tumor, cervical cancer, testicular tumor, bladder carcinoma, and CNS tumors (such as a glioma, astrocytoma, medulloblastoma, craniopharyogioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, menangioma, melanoma, neuroblastoma and retinoblastoma).
In other examples, the disclosed methods are used to treat a subject with a hematological malignancy. Examples of hematological malignancies include leukemias, including acute leukemias (such as acute lymphocytic leukemia, acute myelocytic leukemia, acute myelogenous leukemia and myeloblastic,
promyelocytic, myelomonocytic, monocytic and erythroleukemia), chronic leukemias (such as chronic myelocytic (granulocytic) leukemia, chronic
myelogenous leukemia, and chronic lymphocytic leukemia), polycythemia vera, lymphoma, Hodgkin' s disease, non-Hodgkin' s lymphoma (indolent and high grade forms), multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease, myelodysplasia syndrome, hairy cell leukemia and myelodysplasia.
In specific non-limiting examples, the cancer is prostate cancer, breast cancer, or ovarian cancer. In one particular example, the cancer is castration- resistant prostate cancer. In another specific example, the cancer is small cell prostate carcinoma.
V. Inhibitors
The disclosed methods include treating a subject with cancer with a therapeutically effective amount of an LSDl inhibitor, a combination of an LSDl inhibitor and a DNA damaging agent or a PARP inhibitor, or an HDAC inhibitor and a DNA damaging agent or a PARP inhibitor. Inhibitors of LSDl, HDAC, and PARP are known to one of skill in the art including, but are not limited to the inhibitors described below.
A. LSDl Inhibitors
In some embodiments, the disclosed methods include treating a subject with cancer (such as prostate cancer, breast cancer, or ovarian cancer) with an inhibitor of LSDl. Inhibitors of LSDl are known to, or can be identified by, one of skill in the art. In particular examples, an LSDl inhibitor specifically inhibits LSDl activity (such as LSDl histone demethylase activity). In other examples, an LSDl inhibitor specifically inhibits LSDl expression (such as LSDl mRNA expression or longevity and/or LSDl protein expression or longevity).
In some embodiments, the LSDl inhibitor is a previously identified small molecule LSDl inhibitor. In some non-limiting examples, the inhibitor is a polyamine analog. In some examples, the polyamine analog is a bisguanidine polyamine analog or a biguanide polyamine analog. In a particular example, the LSDl inhibitor is a biguanide analog, such as XB154 (also known as 2d; Huang et al., Proc. Natl. Acad. Sci. 104:8023-8028, 2007). In other examples, the polyamine analog is an oligoamine analog, such as a pentamine (for example, PGl 1122, PGl 1128, or PGl 1141), hexamine (for example, PGl 1231, PGl 1287, or PGl 1288), octamine (for example, PGl 1157, PGl 1158, or PGl 1160), or decamine (such as PGl 1144, PGl 1150, or PGl 1159). See, e.g., Huang et al, Clin. Cancer Res.
15:7217-7228, 2009; U.S. Pat. No. 5,889,061. In a particular example, the LSDl inhibitor is a decamine oligoamine analog, such as PGl 1144 or PGl 1150. In further examples, the LSDl inhibitor is a conformationally restricted polyamine analog, such as PGl 1047 (see, e.g., Casero and Marton, Nature Rev. Drug Discovery 6:373- 390, 2007; U.S. Pat. No. 5,889,061). In another example, the LSDl inhibitor is a monoamine oxidase inhibitor, such as pargyline, trans-2-phenylcyclorpropylamine (tranylcypromine), phenelzine, nialamide, clorgyline, or deprenyl. See, e.g., Lee et al., Chem. Biol. 13:563-567, 2006. In a particular example, the LSDl inhibitor is pargyline.
In other embodiments, the LSDl inhibitor is an antisense compound. Any type of antisense compound that specifically targets and regulates expression of LSDl is contemplated for use. An antisense compound is one which specifically hybridizes with and modulates expression of a target nucleic acid molecule (such as LSDl). In some examples, the agent is an antisense compound selected from an antisense oligonucleotide, a siRNA, a miRNA, a shRNA or a ribozyme. As such, these compounds can be introduced as single- stranded, double-stranded, circular, branched or hairpin compounds and can contain structural elements such as internal or terminal bulges or loops. Double- stranded antisense compounds can be two strands hybridized to form double- stranded compounds or a single strand with sufficient self complementarity to allow for hybridization and formation of a fully or partially double-stranded compound.
In some examples, an antisense oligonucleotide is a single stranded antisense compound, such that when the antisense oligonucleotide hybridizes to a target mRNA, the duplex is recognized by RNaseH, resulting in cleavage of the mRNA. In other examples, a miRNA is a single- stranded RNA molecule of about 21-23 nucleotides that is at least partially complementary to an mRNA molecule that regulates gene expression through an RNAi pathway. In further examples, a shRNA is an RNA oligonucleotide that forms a tight hairpin, which is cleaved into siRNA. siRNA molecules are generally about 20-25 nucleotides in length and may have a two nucleotide overhang on the 3' ends, or may be blunt ended. Generally, one strand of a siRNA is at least partially complementary to a target nucleic acid.
Methods of designing, preparing and using LSDl antisense compounds are within the abilities of one of skill in the art, for example, utilizing publicly available LSDl sequences.
Antisense compounds specifically targeting LSDl can be prepared by designing compounds that are complementary to an LSDl nucleotide sequence, such as an LSDl mRNA sequence. Antisense compounds need not be 100%
complementary to the target nucleic acid molecule to specifically hybridize and regulate expression the target gene. For example, the antisense compound, or antisense strand of the compound if a double- stranded compound, can be at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% complementary to the selected LSDl nucleic acid sequence, such as about 20-25 contiguous nucleotides of an LSDl nucleic acid. Particular examples of LSDl nucleic acid sequences are provided above. Exemplary LSDl antisense compounds are commercially available (for example, catalog numbers sc-60970, sc-60970-SH, and sc-60970- V, Santa Cruz Biotechnologies (Santa Cruz, CA); or catalog numbers L-0092223-00, M-009223-01, E-009223-00, SH-009223-01, Thermo Scientific Dharmacon (Lafayette, CO)). In particular examples, the RNAi molecule includes, but is not limited to, SEQ ID NO: 1 or 3. Methods of screening antisense compounds for specificity are well known in the art.
It is to be understood that LSD1 inhibitors for use in the present disclosure also include novel LSD1 inhibitors developed in the future.
B. HDAC Inhibitors
In additional embodiments, the disclosed methods include treating a subject with cancer (such as prostate cancer, breast cancer, or ovarian cancer) with an inhibitor of HDAC. Inhibitors of HDAC are known to, or can be identified by, one of skill in the art. In particular examples, an HDAC inhibitor specifically inhibits HDAC activity (such as histone deacetylase activity). In other examples, an HDAC inhibitor specifically inhibits HDAC expression (such as HDAC mRNA expression or longevity and/or HDAC protein expression or longevity).
In some embodiments, the HDAC inhibitor is a previously identified small molecule HDAC inhibitor. In some non-limiting examples, the HDAC inhibitor includes short-chain fatty acids (for example, sodium butyrate and valproic acid), epoxides (for example, depudecin and trapoxin), cyclic peptides (for example, apicidin and depsipeptide), hydroxamic acids (for example, trichostatin A, suberoylanilide hydroxamic acid (SAHA, also known as vorinostat), oxamflatin, scriptaid, and pyroxamide), benzamides (for example, MS-275 and CI-994), and other hybrid compounds (for example, SK-7068). Other exemplary HDAC inhibitors include BML-210, M344, NVP-LAQ-824, CHR-3996, CHR-2845, SB939, AR-42, ITF2357, panobinostat (LBH589), mocetinostat (MGCD0103), romidepsin (FR901228), resminostat (4SC-201), and belinostat (PXD101). In particular examples, the HDAC inhibitor is vorinostat, LBH589, TSA, or sulforaphane.
In other embodiments, the HDAC inhibitor is an antisense compound. Any type of antisense compound that specifically targets and regulates expression of HDAC is contemplated for use. Methods of designing, preparing and using HDAC antisense compounds are within the abilities of one of skill in the art, for example, utilizing publicly available HDAC sequences. Antisense compounds specifically targeting HDAC can be prepared by designing compounds that are complementary to an HDAC nucleotide sequence, such as an HDAC mRNA sequence. Antisense compounds need not be 100% complementary to the target nucleic acid molecule to specifically hybridize and regulate expression the target gene. For example, the antisense compound, or antisense strand of the compound if a double-stranded compound, can be at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% complementary to the selected HDAC nucleic acid sequence, such as about 20-25 contiguous nucleotides of an HDAC nucleic acid. Particular examples of HDAC nucleic acid sequences are provided above.
Exemplary HDAC antisense compounds are commercially available (for example, from Santa Cruz Biotechnologies (Santa Cruz, CA); or Thermo Scientific
Dharmacon (Lafayette, CO)). Methods of screening antisense compounds for specificity are well known in the art.
It is to be understood that HDAC inhibitors for use in the present disclosure also include novel HDAC inhibitors developed in the future.
C. DNA Damaging Agents and PARP Inhibitors
In additional embodiments, the disclosed methods include treating a subject with cancer (such as prostate cancer, breast cancer, or ovarian cancer) with an inhibitor of LSD1 or HDAC and a DNA damaging agent or an inhibitor of PARP. DNA damaging agents are known to one of skill in the art, and include mitomycin C (MMC), diepoxybutane (DEB), platinum compounds (such as carboplatin, cisplatin, oxaliplatin, and bbr3464), cyclophosphamide, psoralen, adriamycin, 5-fluorouracil (5FU), etoposide (VP- 16), camptothecin, actinomycin-D, doxorubicin, bleomycin, or radiation (such as UVA radiation or gamma radiation). PARP inhibitors are also known to one of skill in the art and are discussed in detail below.
In particular examples, the subject is treated with an inhibitor of LSD1 or HDAC and a PARP inhibitor. Inhibitors of PARP are known to, or can be identified by, one of skill in the art. In particular examples, a PARP inhibitor specifically inhibits PARP activity (such as poly(ADP ribosyl)ation activity). In other examples, a PARP inhibitor specifically inhibits PARP expression (such as PARP mRNA expression or longevity and/or PARP protein expression or longevity).
In some embodiments, the PARP inhibitor is a previously identified small molecule PARP inhibitor. In some examples, a PARP inhibitor includes a benzamide analog, which binds competitively with the natural substrate NAD in the catalytic site of PARP. In other examples, a PARP inhibitor includes a quinolone, isoquinolone, benzopyrone, methyl 3,5-diiodo-4-(4'-methoxyphenoxy)benzoate, methyl-3,5-diiodo-4-(4'-methoxy-3',5'-diiodo-phenoxy)benzoate, benzimidazole, or indole. In some non-limiting examples, the PARP inhibitor includes olaparib (AZD- 2281), BSI 201, veliparib (ABT-888), AG014699, CEP 9722, MK4827, LT-673, E7016, PF-01367338, and 3-aminobenzamide. See, e.g., U.S. Pat. Nos. 5,464,871 ; 6, 100,283; 6, 169,104; 5,922,775; 6,017,958; 5,736,576; 7,732,491 ; and 5,484,951 ; U.S. Pat. Publication Nos. US2002/156050, US2005/054631, US2006/0142231, and US2002/028815; and International Pat. Publication Nos. WO05/012305 and
W099/11628; all incorporated herein in their entirety. In a particular example, the PARP inhibitor is olaparib. In another particular example, the PARP inhibitor is ABT-888.
In other embodiments, the PARP inhibitor is an antisense compound. Any type of antisense compound that specifically targets and regulates expression of PARP is contemplated for use. Methods of designing, preparing and using PARP antisense compounds are within the abilities of one of skill in the art, for example, utilizing publicly available PARP sequences. Antisense compounds specifically targeting PARP can be prepared by designing compounds that are complementary to a PARP nucleotide sequence, such as a PARP mRNA sequence. Antisense compounds need not be 100% complementary to the target nucleic acid molecule to specifically hybridize and regulate expression the target gene. For example, the antisense compound, or antisense strand of the compound if a double-stranded compound, can be at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% complementary to the selected PARP nucleic acid sequence, such as about 20-25 contiguous nucleotides of a PARP nucleic acid.
Particular examples of PARP nucleic acid sequences are provided above.
Exemplary PARP antisense compounds are commercially available (for example, from Santa Cruz Biotechnologies (Santa Cruz, CA); or Thermo Scientific
Dharmacon (Lafayette, CO)). Methods of screening antisense compounds for specificity are well known in the art.
It is to be understood that PARP inhibitors for use in the present disclosure also include novel PARP inhibitors developed in the future.
VI. Administration of Inhibitors
In some embodiments, the disclosed methods include administering a therapeutically effective amount of an LSD1 inhibitor to a subject with cancer (such as prostate cancer, breast cancer, or ovarian cancer). In other embodiments, the disclosed methods include administering a therapeutically effective amount of an LSD1 inhibitor and a PARP inhibitor to a subject with cancer. In further
embodiments, the disclosed methods include administering a therapeutically effective amount of an HDAC inhibitor and a PARP inhibitor to a subject with cancer. Inhibitors of LSD1, HDAC, and PARP are known to one of skill in the art, such as those discussed above (Section V).
In some examples, the method includes selecting a subject with CRPC and administering a therapeutically effective amount of an LSD1 inhibitor (such as a polyamine analog) to the subject. In other examples, the method includes selecting a subject with small cell prostate carcinoma and administering a therapeutically effective amount of an LSD1 inhibitor (such as a polyamine analog) to the subject.
One of skill in the art can identify a subject with CRPC. CRPC is generally defined as prostate cancer with disease progression despite androgen deprivation therapy and castrate serum levels of testosterone. CRPC may present as a rise in serum levels of pro state- specific antigen (with or without symptoms), progression of pre-existing disease, appearance of new metastases, or a combination thereof (see, e.g., Hotte and Saad, Curr. Oncol. 17:S72-S79, 2010). Prognosis of CRPC is generally poor.
One of skill in the art can identify a subject with small cell prostate carcinoma. For example, small cell prostate carcinoma can be diagnosed by histological examination of a prostate tumor biopsy (such as a fine-needle aspirate or core biopsy). For example, small cell prostate carcinoma can include histological features such as sheets of small round blue cells with a high nuclear-to-cytoplasmic ratio, necrosis, coarse (slat and pepper_ chromatin, and nuclear molding. Small cell prostate carcinoma can also stain positive for neuron- specific enolase,
synaptophysin, and chromogranin A, and is negative for androgen receptor and prostate specific antigen. See, e.g., Helpap and Kollermann, Vir chows Arch., 434:385-391, 1999). In some examples, the subject may have a prostate tumor including both small cell carcinoma cells and adenocarcinoma cells.
Therapeutic agents (such as an LSD1 inhibitor, an HDAC inhibitor, and/or a PARP inhibitor) can be administered to a subject in need of treatment using any suitable means known in the art. Methods of administration include, but are not limited to, intradermal, transdermal, intramuscular, intraperitoneal, parenteral, intravenous, subcutaneous, intratumoral, vaginal, rectal, intranasal, inhalation, oral, or by gene gun. In some examples, the therapeutic agent is administered
intravenously. In other examples, the therapeutic agent is administered orally. If two or more agents are administered to a subject (such as an LSD1 inhibitor and a PARP inhibitor or an HDAC inhibitor and a PARP inhibitor), the agents may be administered by the same route or by different routes.
Parenteral administration is generally achieved by injection. Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution of suspension in liquid prior to injection, or as emulsions. Injection solutions and suspensions can be prepared from sterile powders, granules, and tablets. Administration can be systemic or local.
Therapeutic agents can be administered in any suitable manner, preferably with pharmaceutically acceptable carriers. Pharmaceutically acceptable carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions of the present disclosure. The pharmaceutically acceptable carriers (vehicles) useful in this disclosure are conventional. Remington: The Science and Practice of Pharmacy, The University of the Sciences in Philadelphia, Editor, Lippincott, Williams, & Wilkins, Philadelphia, PA, 21st Edition (2005) describes compositions and formulations suitable for pharmaceutical delivery of one or more therapeutic agents Preparations for parenteral administration include sterile aqueous or nonaqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti- oxidants, chelating agents, and inert gases and the like.
Compositions for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets, or tablets. Thickeners, flavorings, diluents, emulsifiers, dispersing aids or binders may be desirable.
Appropriate dosages for treatment with one or more of LSD1 inhibitors, HDAC inhibitors, and PARP inhibitors can be determined by one of skill in the art. In general, an effective amount of a therapeutic agent that includes one or more of LSD1 inhibitors, HDAC inhibitors, and PARP inhibitors administered to a subject will vary depending upon a number of factors associated with that subject, for example the overall health of the subject, the condition to be treated, or the severity of the condition. An effective amount of an LSD1 inhibitor, HDAC inhibitor, or PARP inhibitor (alone or in a combination therapy regimen) can be determined by varying the dosage of the compound and measuring the resulting therapeutic response, such as an increase in survival (such as overall survival, progression-free survival, or metastasis-free survival) or a decrease in the size, volume or number of tumors.
The LSD1, HDAC, and/or PARP inhibitors can be administered in a single dose, or in several doses, as needed to obtain the desired response. However, the effective amount can be dependent on the source applied, the subject being treated, the severity and type of the condition being treated, and the manner of
administration. In particular examples, the LSD1 inhibitor is administered intravenously, intraperitoneally, or orally. In some non-limiting examples, the dose of an LSD1 inhibitor administered to a subject may be about 0.1 mg/kg to about 1000 mg/kg. In particular examples, the dose may be about 0.5 mg/kg to about 100 mg/kg, such as about 1 mg/kg, 5 mg/kg, 10 mg/kg, 20 mg/kg, 40 mg/kg, 50 mg/kg, 75 mg/kg, or 100 mg/kg. In other examples, the dose may be about 10 to 800 mg, for example, about 50 mg to 800 mg, or about 100 mg to 600 mg of an LSD1 inhibitor (such as PG11047, PG11144, or XB 154).
In one non-limiting example, about 600 mg PG11047 is administered to the subject intravenously once per week. In some examples, PG11047 is administered as one or more courses of treatment, where a course of treatment is one dose (such as 600 mg) weekly for three weeks followed by one week off.
In other examples, the HDAC inhibitor is administered intravenously, orally, or intraperitoneally. In some non-limiting examples, the dose of an HDAC inhibitor administered to a subject may be about 0.1 mg/kg to about 1000 mg/kg. In particular examples, the dose may be about 1 mg/kg to about 100 mg/kg, such as about 1 mg/kg, 5 mg/kg, 10 mg/kg, 20 mg/kg, 40 mg/kg, 50 mg/kg, 75 mg/kg, or 100 mg/kg. In other examples, the dose may be about 10 to 800 mg, for example, about 50 mg to 800 mg, or about 100 mg to 600 mg of an HDAC inhibitor.
In other examples, the PARP inhibitor is administered intravenously, orally, or intravenously. In particular examples, the PARP inhibitor is administered orally. In some non-limiting examples, the dose of a PARP inhibitor administered to a subject may be about 0.1 mg/kg to about 1000 mg/kg. In particular examples, the dose may be about 1 mg/kg to about 100 mg/kg, such as about 1 mg/kg, 5 mg/kg, 10 mg/kg, 20 mg/kg, 40 mg/kg, 50 mg/kg, 75 mg/kg, or 100 mg/kg. In other examples, the dose may be about 10 to 800 mg, for example, about 50 mg to 800 mg, or about 100 mg to 600 mg of a PARP inhibitor.
The combined administration of an LSD1 inhibitor or HDAC inhibitor and a PARP inhibitor includes administering the LSD1 or HDAC inhibitor either sequentially with the PARP inhibitor (e.g., the treatment with one agent first and then the second agent) or administering both agents at substantially the same time (e.g., an overlap in performing the administration). With sequential administration a subject is exposed to the agents at different times so long as some amount of the first agent remains in the subject (or has a therapeutic effect) when the other agent is administered. The treatment with both agents at the same time can be in the same dose, for example, physically mixed, or in separate doses administered at the same time.
In some examples, a therapeutically effective dose of an LSD1 inhibitor or HDAC inhibitor (alone or in combination with a PARP inhibitor) includes daily, weekly, bi-weekly, or monthly use for at least about 2 weeks, such as at least about one month, two months, three months, six months, one year, two years, three years, four years, five years, or more. The disclosed methods include an LSD1 inhibitor or an HDAC inhibitor, which can be administered alone, in the presence of a pharmaceutically acceptable carrier, in the presence of other therapeutic agents (for example other anti-cancer therapeutic agents), or both. Such anti-cancer
therapeutics include, but are not limited to, chemotherapeutic drug treatment, radiation, gene therapy, hormonal manipulation, immunotherapy and antisense oligonucleotide therapy. Examples of useful chemotherapeutic drugs include, but are not limited to, microtubule binding agents (such as paclitaxel, docetaxel, vinblastine, vindesine, vinorelbine, epothilones, colchicine, dolastatin 15, nocodazole, podophyllotoxin, rhizoxin, and derivatives or analogs thereof), DNA intercalators or cross-linkers (such as cisplatin, carboplatin, oxaliplatin, mitomycins such as mitomycin C, bleomycin, chlorambucil, cyclophosphamide, and derivatives or analogs thereof), DNA synthesis inhibitors (such as methotrexate, 5-fluoro-5'- deoxyuridine, 5'fluorouracil, gemcitabine, and analogs thereof), DNA and/or RNA transcription inhibitors (such as actinomycin D, daunorubicin, doxorubicin, and derivatives or analogs thereof), enzyme inhibitors, gene regulators, enzymes, antibodies (such as trastuzumab, bevacizumab, cetuximab, and panitumumab), angiogenesis inhibitors, enzyme inhibitors (such as camptothecin, etoposide, formestane, trichostatin and derivatives and analogs thereof), kinase inhibitors (such as imatinib, gefitinib, sunitinib, and erolitinib), and gene regulators (such as raloxifene, 5-azacytidine, 5-aza-2'-deoxycytidine, tamoxifen, 4-hydroxytamoxifen, mifepristone and derivatives and analogs thereof) or combinations of two or more thereof. In some examples, the LSD1 inhibitor or HDAC inhibitor is administered prior to, concurrent with, or subsequent to the one or more additional
chemotherapeutic agents. In some examples, an LSDl inhibitor is administered in combination with one or more of cisplatin, docetaxel, gemcitabine, 5-fluorouracil, bevacizumab, erlotinib, or sunitinib. In one particular example, the LSDl inhibitor PG11047 is administered in combination with cisplatin.
In particular examples, the LSDl inhibitor is administered in combination with a PARP inhibitor. In some examples, the LSDl inhibitor is administered to the subject for a period of time (such as at least one day) prior to administration of the PARP inhibitor. In some examples, the LSDl inhibitor and PARP inhibitor are administered to the subject at least once per day (such as at least two, three, four, or more times a day) for at least two weeks (such as at least three weeks, four weeks, two months, three months, or more). In other examples, the HDAC inhibitor is administered to the subject for a period of time (such as at least one day) prior to administration of the PARP inhibitor. In some examples, the HDAC inhibitor and PARP inhibitor are administered to the subject at least once per day (such as at least two, three, four, or more times a day) for at least two weeks (such as at least three weeks, four weeks, two months, three months, or more).
The following examples are provided to illustrate certain particular features and/or embodiments. These examples should not be construed to limit the invention to the particular features or embodiments described.
EXAMPLES
Example 1
Inhibition of LSDl Modulates Gene Expression in Prostate Cells
This example describes the effect of inhibition of LSDl on gene expression profiles in prostate cell lines.
Methods
Cell culture: Prostate cancer cell line LNCaP and normal prostate cell line
RWPE-1 were cultured in RPMI1640 medium with 10% fetal bovine serum. Cells were transfected with 50 nM LSDl siRNA (siLSDl; target sequence C AC A AGG A A AGCU AG A AG AUU ; SEQ ID NO: 1) or control siRNA (siLuc; target sequence CGUACGCGGAAUACUUCGATT; SEQ ID NO: 2) with
DharmaFECT 3 siRNA transfection reagent (Thermo Scientific Dharmacon, Lafayette, CO). Cells were harvested 96 hours post-transfection. Stable LSD1 knockdown cells were also generated by treating LNCaP cells with MISSION® shLSDl (clone ID #NM_015013.1-775slcl;
CCGGCCAACAATTAGAAGCACCTTACTCGAGTAAGGTGCTTCTAATTGTT GGTTTTTG; SEQ ID NO: 3) or shNTC (control; cat. #SHC002V) lentiviral particles (Sigma- Aldrich, St. Louis, MO), according to the manufacturer's protocol. Stable transfectants were selected in the presence of 1 μg/ml puromycin (In vitro gen, Carlsbad, CA). Cells were treated with polyamine analogs for 48 hours at the indicated concentrations.
Microarray hybridization: All samples were processed simultaneously with labeling and hybridization to Affymetrix U133 2.0 Plus assays. Each biological replicate was labeled and hybridized to its own array without pooling.
Hybridized arrays were evaluated for consistency and quality using the Affy package in the R statistical computing environment (R Development Core Team, R Foundation for Statistical Computing, 2008 (R-project.org); Gautier et al,
Bioinformatics 20:307-315, 2004). Intensity values for acceptable arrays were log- transformed, pre-processed and normalized to correct for probe-level differences across arrays using the model-based algorithm Robust Multi-chip Average (RMA) (Irizarry et al., Nucl. Acids Res. 31:el5, 2003). Differentially expressed transcripts were identified using Analysis of Variance (ANOVA) with the Linear Models for Microarray data analysis package (LIMMA) (Smyth, Stat. Appl. Genet. Mol. Biol. 3:3, 2004). Specific contrasts were set depending on the experimental comparisons: Based on previous experiments, this design has the power to detect an effect of 1.5- fold at a 0.05 level of significance. Given the high dimensional nature of the data, the false positive error rate was controlled using the q- value statistic, a minimum measure of the False Discovery Rate (FDR) (Storey and Tibshirani Pwc. Natl. Acad. Sci. USA 100:9440-9445, 2003). All transcripts on the array were annotated for gene name, function, and chromosome location using NetAffx
(affymetrix.com/analysis/index.affx) and used for subsequent analyses. Real-time PCR: Cells were harvested and mRNA was purified with TRIzol® reagent (Invitrogen). One microgram of RNA was reverse-transcribed using Omniscript® RT kit (Qiagen, Valencia, CA). All samples were run in triplicate in real-time PCR. Target gene expression was normalized to endogenous controls (18S or actin).
Immunoblotting: Whole cell protein extracts were prepared and separated by SDS-PAGE and transferred to an Immobilon® membrane (Millipore, Billerica, MA). Blots were probed with mouse anti-FANCD2 (Santa Cruz Biotechnologies, Santa Cruz, CA), rabbit anti-LSD 1 (Cell Signaling, Beverly, MA), or mouse anti- actin (Sigma- Aldrich), followed by horseradish peroxidase-conjugated goat anti- mouse or goat anti-rabbit IgG. Detection was performed with ECL Western Reagents (Pierce, Rockford, IL).
Results
LNCaP prostate cancer cells were treated with the LSDl inhibitor XB154
(also known as 2d) or LSDl siRNA. This resulted in global increases in the active di-methyl lysine 4 (2MK4) and repressive di-methyl lysine 9 (2MK9) marks on histone H3, which are removed by LSDl (FIG. 1A and B). This demonstrated XB154 and LSDl siRNA both inhibited LSDl demethylase activity.
Gene expression profiling was performed using LNCaP cells treated with polyamine analogs XB154 (10 μΜ) or LSDl siRNA for 96 hours. This treatment resulted in >2-fold increase in expression of over 61 common genes and >2-fold decrease in expression of 293 common genes. Notably, many of these genes were not AR target genes. The Fanconi anemia (FA) DNA damage repair pathway was the top pathway whose gene members changed in expression in both polyamine analog- and LSDl siRNA-treated cells. Many of these genes had >1.5-fold decrease in expression in cells treated with XB154, PG11144, PG11047, or LSDl siRNA (FIG. 2).
Transient transfection of LSDl for 48 hours in RWPE-1 normal prostate cells increased FANCD2 mRNA levels versus vector-transfected cells (FIG. 3). XB154 treatment reduced FANCD2 mRNA levels in LNCaP cells treated for 48 hours (FIG. 4A). FANCD2 protein levels and levels of ubiquitinated FANCD2 (ub- FANCD2) were also reduced in LNCaP cells following 24-48 hours of treatment with XB154 or LSDl siRNA (FIG. 4B) and in LSDl stable knockdown cells (FIG. 4C). This result was also obtained in cells treated with the monoamine oxidase LSDl inhibitor pargyline (FIG. 4D). Treatment with XB154 for 24 or 48 hours also reduced levels of BRCA1 mRNA in a concentration-dependent manner (FIG. 5).
LNCaP cells were also treated with HDAC inhibitors and analyzed by gene expression profiling. Similar to XB154 and LSDl siRNA treatment, inhibition of HDAC resulted in >1.5-fold decrease in expression of DNA damage repair enzyme expression (FIG. 6).
Example 2
Cell Proliferation and Viability in LSDl Knockdown Cells
This example describes the effect of inhibition of LSDl on cell proliferation and viability.
Methods
LNCaP cells were plated in 12- well plates at 75,000 cells/well. XB154 was added at 1 μΜ or 5μΜ final concentration the next day. Mitomycin C (MMC) was added 24 hours after XB154 treatment. Cell counts were performed after 48 hours of MMC treatment with the Countess® Automated Cell Counter (Invitrogen). shLSDl cells and shNTC cells (described in Example 1) were plated in 12 well plates at 50,000 cells/well. Olaparib was added at 1 μΜ or 5 μΜ the next day, and again after 3 days. Cell counts were performed after 5 days with the Countess® Automated Cell Counter (Invitrogen).
Results
LNCaP cells with a stable knockdown of LSDl expression (shLSDl cells) had greatly reduced proliferation compared to control cells (FIG. 7). Similar results were obtained with cells treated with XB154 or pargyline and all other prostate cancer cell lines tested (DU145, VCaP, and LAPC4).
LNCaP cells treated with XB154 for 24 hours and subsequently co-treated with MMC for 48 hours showed greater sensitivity to MMC than cells treated with XB154 or MMC alone (FIG. 8). Treatment of shLSDl cells with olaparib, a PARP inhibitor also resulted in enhanced cell death compared to control shNTC cells (FIG. 9). These results indicate that inhibition of LSD1 expression or activity sensitizes cells to anti-cancer therapies.
Example 3
Role of LSD1 in Androgen Independent Androgen Receptor Signaling
This example describes analysis of gene expression in androgen-dependent and androgen-independent cells and the effect of inhibition of LSD1.
Each year, over 192,000 men each year are diagnosed with prostate cancer, and over 27,000 men die of castration-resistant prostate cancers (CRPC) (Jemal et al, CA Cancer J. Clin. 59:225-249, 2009). Androgen deprivation therapy (ADT), the current most effective treatment for recurrent prostate cancer, works by lowering levels of androgens or interfering with androgen binding to and activation of the androgen receptor (AR), the central protein in this disease. ADT is not curative, and "castration-resistance" is the rule and not the exception (Scher and Sawyers, J. Clin. Oncol. 23:8253-8261, 2005). Intratumoral androgens and canonical, androgen- dependent signaling persist in CRPC cells from patients (Mostahel et al., Cancer Res. 67:5033-5041, 2007; Mohler ei a/., Clin. Cancer Res. 10:440-448, 2004). This highlights the misnomer of only classifying prostate cancers that have not been treated with ADT or which are responding to ADT as androgen-dependent (non- CRPC may be a more accurate descriptor for these cancers). However, it is not certain whether persistent expression of androgen-responsive "AR" signaling pathways (quotation marks indicate that AR alone does not regulate expression of genes to which it is bound) accounts for the biological aggressiveness of CRPC (Scher and Sawyers, J. Clin. Oncol. 23:8253-8261, 2005; Gao et al, Epigenetics 5: 100-104, 2010).
Chronic androgen deprivation experimentally or in patients leads to alterations in the androgen receptor transcriptome (Wang et al., Cell 138:245-256, 2009). In non-CRPC cells such as the LNCaP cell line, gene expression profiles after short-term growth in castrate serum followed by the addition of androgens show that the top androgen-responsive pathways are "metabolism" or "regulation of cellular processes" (Wang et al., Cell 138:245-256, 2009; Nelson et al., Pwc. Natl. Acad. Sci. USA 99: 118990-11895, 2002). However, in CRPC cell lines (Abl or C42B), which are LNCaP derivatives grown chronically in the absence of androgens, the top upregulated pathways versus LNCaP cells are "cell cycle" or "mitotic cell cycle" (Wang et al., Cell 138:245-256, 2009). This androgen- independent program promotes progression through the mitotic phase of the cell cycle, and RNA interference to AR in CRPC cells leads to reduced expression of these genes (which highlights their AR-dependency) and leads to G2-M cell cycle arrest (Wang et al., Cell 138:245-256, 2009).
That castration in non-CRPC cells, conversely, leads to Gl-S cell cycle checkpoint arrest further highlights that AR's growth promoting function in CRPC is not equivalent to its androgen-dependent function in non-CRPC cells (Wang et al., Cell 138:245-256, 2009; Balk and Knudsen Nucl. Recept. Signal. 6:e001, 2008). Additionally, RNA interference to several transcription factors in CRPC cells, including FOXA1, GATA2, MED1, lowers expression of these androgen- independent "AR" target genes (Wang et al., Cell 138:245-256, 2009).
Methods
Cell culture: Prostate cancer cell line LNCaP and PC3 were cultured in RPMI 1640 medium with 10% fetal bovine serum. Cells were transfected with 50 nM AR siRNA (siAR, target sequence GACCUACCGAGGAGCUUUCUU: SEQ ID NO: 4), LSD1 siRNA, or control siRNA (described in Example 1) with
DharmaFECT 3 siRNA transfection reagent (Thermo Scientific Dharmacon, Lafayette, CO). Cells were harvested 96 hours post-transfection. Stable LSD1 knockdown cells were described in Example 1. For XB154 treatment, cells were treated with XB154 for 48 hours at the indicated concentrations. For PG11144 (Progen) treatment, cells were treated with PG11144 for 96 hours at the indicated concentrations.
RT-PCR: RT-PCR was performed as described in Example 1. Primers used for RT-PCR are provided in Table 1. Immunoblotting: Immunoblots were performed as described in Example 1. Antibodies used were rabbit anti-AR (Millipore), mouse anti-2MK9 (Abeam, Cambridge, MA), and mouse anti-GAPDH (Santa Cruz Biotechnologies).
Chromatin Immunoprecipitation (ChIP): Cells were cross-linked with formaldehyde and reactions were stopped with glycine. Cross-linked cells were resuspended in IP buffer with SigmaFast™ protease inhibitor tablets (Sigma- Aldrich) and sonicated on ice by using a Branson Digital Sonifier® model 450. Immunoprecipitations were performed with rabbit anti-LSD 1 (Abeam), rabbit anti- AR (Santa Cruz), rabbit anti-AcH3 (Millipore) and normal rabbit IgG (Millipore) on Dynabeads® (Invitrogen). For real time PCR, 2 μΐ of 50 μΐ DNA extract was used.
Table 1. RT-PCR primer sequences
Figure imgf000037_0001
Results
In order to determine LSDl targets in andro gen-independent signaling, gene expression profiles were performed after RNA interference to LSDl in non-CRPC LNCaP cells that were grown in the presence of androgens. The top pathways whose genes change in expression were control of the cell cycle or proliferation. Many of these genes were enriched in CRPC cells and in 2 independent data sets of CRPC patient samples. Cell cycle and M phase genes that were enriched in CRPC cells that also decreased in expression in LNCaP siLSDl microarray included UBE2C, CDC20, CCNA2, ID1, CDC2, CCNE2, CDC25C, PTTG1, STIL,
NUSAP1, SGOL2, RAD54B, BUB3, PBK, TRAIP, CDKN3, DBF4, DLG7, and CDCA8. Genes that decreased with siAR in Abl and LNCaP and siLSDl in LNCaP included ACYP1, ARL6IP6, BUB3, CDK1, DEPDC1, HMGB2, HMMR, NCAPG, and PRC1.
In order to more globally understand how LSDl affects AR signaling (both androgen-dependent and androgen-independent), the gene expression profiles after RNA interference to LSDl in LNCaP cells were compared to published AR ChlP- Chip data from LNCaP and Abl CRPC derivative cells, which allowed examination of the effect of RNA interference to LSDl on AR-bound genes in LNCaP and Abl cells. Of note, the genomic localization of AR, with rare exception, was conserved across both cell lines. The gene expression profiles were then compared with published gene expression profiles after RNA interference to AR in LNCaP and Abl cells grown in charcoal-stripped, androgen-deprived serum. This allowed comparison of the effect of RNA interference to LSDl in LNCaP cells versus AR in LNCaP and Abl cells. Of note, the gene expression changes after RNA interference to AR, with rare exception, were conserved across both cell lines. Finally, the gene expression profiles were compared to published gene expression profiles after the addition of dihydrotestosterone (DHT) to LNCaP or Abl cells grown in charcoal- stripped serum, which allowed determination of the effect of RNA interference to LSDl on androgen-dependent genes.
As shown in FIG. 10, which depicts the effect of these manipulations on AR- bound genes, RNA interference to LSDl in LNCaP cells or to AR in both LNCaP and Abl cells reduced gene expression of many AR-bound genes. Indeed, RNA interference to LSDl in LNCaP most closely resembled gene expression profiles after RNA interference to AR in Abl cells. None of the AR-bound genes that declined in expression with RNA interference to LSDl in LNCaP cells (RNA interference to LSDl was done in cells grown in the presence of androgens) increased in expression with the addition of androgens, which highlights their andro gen-independence (FIG. 10). Additionally, AR was bound to these androgen- independent genes in the absence of androgens, and adding androgens to LNCaP or Abl cells did not increase AR binding to these genes. This highlights that androgen- independent signaling is operational even in non-CRPC cells and that the role of LSDl in "AR" signaling is confined to andro gen-independent targets.
QRTPCR confirmed that the androgen-independent "AR" target genes declined in expression after RNA interference to AR and LSDl and that these genes did not increase in expression after androgen stimulation in LNCaP or Abl cells. LSDl RNA interference or treatment with polyamine analogues, including
PGl 1144, inhibited LSDl function (increased 2MK9 levels) and attenuated androgen-independent (but not canonical androgen-dependent) "AR" signaling without affecting AR protein levels (FIG. 11). This effect of RNA interference to LSDl or PGl 1144 treatment was recapitulated in non-CRPC cells such as VCaP and LAPC4 and CRPC C42B cells, which highlights the generalizability of these findings. Finally, chromatin immunoprecipitation (ChIP) assays showed that these androgen-independent "AR" genes are direct targets of both AR and LSDl in
LNCaP cells grown in the absence of androgens. RNAi-mediated suppression of AR, LSDl, or both decreased expression of both UBE2C and CCNA2 (FIGS. 12A and B) in LNCaP cells. A representative ChIP PCR for UBE2C and CCNA2 is shown in FIG. 12C. The presence of the active, acetylated histone H3 (AcH3) mark confirmed that these genes are actively transcribed in LNCaP cells.
In Abl cells, the top-enriched pathways versus LNCaP cells were androgen- independent pathways that promote proliferation. AR mutations and gene amplification do not account for androgen-independent activation of these genes in Abl cells. Additionally only full-length AR and not shorter transcript variants were detectable by Western blot in LNCaP and Abl cells. This highlights that genetic alterations in AR are not necessary for (continued) activation of androgen- independent signaling in CRPC cells. Rather, non-CRPC cells in which androgen- independent "AR" signaling is active may be selected for because this allows for continued growth and survival despite castration.
In Abl and C42B cells (another CRPC derivative), RNA interference to AR or LSDl or treatment with PGl 1144 or XB154 recapitulated the effect of these manipulations in LNCaP cells, resulting in reduced androgen-independent "AR" target gene expression and reduced proliferation (FIG. 13). Furthermore, treatment of PC3 cells (AR negative) with siLDSl or XB154 caused decreases in proliferation gene expression (FIG. 14). Finally, treatment with PG11144 did not lower expression of classic androgen-dependent genes, such as Nkx3.1 in LNCaP cells (FIG. 15).
Example 4
Effect of LSDl Inhibition on Cell Cycle Progression
This example describes the effect of inhibition of LSDl on cell growth and proliferation and cell cycle progression.
Methods
Growth chart/curve: LNCaP, Abl, or C42B cells were transfected with siAR, siLSDl or siLUC (described as in Examples 1 and 3), then plated in 12-well plates at 50,000 cells/well. Cell counts were performed the next day (set as start point) and 5 days after siRNA transfection with the Countess® Automated Cell Counter (Invitrogen). Growth in CSM was examined as above, except cells were cultured in RPMI1640 plus 10% FBS after siRNA transfection. Cell counts were performed the next day (set as start point) and 5 days after siRNA transfection with the Countess® Automated Cell Counter (Invitrogen).
Stable shLSDl (or shNTC) cells were plated in 12-well plates at 50,000 cells/well with 5 μg/ml puromycin. Cell counts were performed at indicated days with the Countess® Automated Cell Counter (Invitrogen).
Cell cycle analysis: shLSDl cells and shNTC cells (described in Example 1) were stained with propidium iodide (PI) and processed on FACSCalibur™. Raw data was analyzed with Modfit LT (Verity Software, Topsham, ME).
Results
Having demonstrated that LSDl and AR have effects on androgen- independent "AR" signaling (Example 3), the effect of RNA interference to LSDl prostate cancer cell growth was assessed. LSDl knockdown inhibited growth of Abl and C42B cells (FIG. 16). LSDl knockdown with siRNA also inhibited growth of LNCaP cells (non-CRPC cells) in the absence of androgens (FIG. 17). Additionally, RNA interference to LSD1 led to accumulation of cells in the G2-M phases of the cell cycle (FIG. 18). These experiments recapitulated the effect of RNA interference to AR in CRPC Abl cells. This was not equivalent to the effect of acute castration in LNCaP cells, which was accumulation in the Gl-S phases of the cell cycle.
Example 5
Effect of Polyamine Analogs on Prostate Cancer Cells
Methods
Cell culture: Prostate cancer cell lines LNCaP, Abl, and PC3 were cultured in RPMI1640 medium with 10% fetal bovine serum. Cells at 30% confluency were treated with PG11144 or PG11047 in water at the indicated concentrations and harvested at the indicated times post-treatment. Cell viability was analyzed by trypan blue exclusion.
Real-time PCR: Cells were harvested and mRNA was purified with
TRIzol® reagent (Invitrogen). One microgram of RNA was reverse-transcribed using Omniscript® RT kit (Qiagen, Valencia, CA). All samples were run in triplicate in real-time PCR. Target gene expression was normalized to endogenous controls (18S or actin).
Immunoblotting: Whole cell protein extracts were prepared and separated by SDS-PAGE and transferred to an Immobilon® membrane (Millipore, Billerica, MA). Blots were probed with mouse anti-FANCD2 (Santa Cruz Biotechnologies, Santa Cruz, CA), rabbit anti-Histone H3 di-methyl lysine 4 (Millipore, Billerica, MA), mouse anti-Histone H3 di-methyl lysine 9 (Abeam, Cambridge, MA) or mouse anti-actin (Sigma- Aldrich), followed by infrared dye-labeled goat anti-mouse or goat anti-rabbit IgG. Detection was performed with an Odyssey® imager (LI- COR Biotechnology, Lincoln, Nebraska).
Results
Treatment of LNCaP cells with increasing amounts of PG11047 for 96 hours resulted in decreased amounts of FANCD2 protein and ub-FANCD2 as determined by Western blotting (FIG. 20 A). Treatment with PG11047 increased the amount of histone methylation at 2MK4 and 2MK9 (FIGS. 20A and B), indicating that PGl 1047 inhibits LSDl activity. In addition, suppression of LSDl expression with RNAi eliminated the effect of PGl 1047 treatment on histone methylation (FIG. 20C). PGl 1047 treatment of LNCaP cells for 96 hours also decreased the amount of UBE2C and CDC20 mRNA in the cells (FIG. 20D).
Similarly, treatment of LNCaP cells with PGl 1144 for 72 hours decreased FANCD2 expression and ubiquitination and increased histone methylation at 2MK4 and 2MK9 (FIG. 21). Finally, PGl 1144 reduced viability of LNCaP, Abl, and PC3 cells following 120 hour treatment (FIG. 22). PGl 1144 decreased viability of the small cell prostate carcinoma cell line PC3 to a greater extent than the non-small cell lines LNCaP and Abl (FIG. 22).
Example 6
Treatment of Cultured Cells with Combination LSDl Inhibitor and PARP Inhibitor Therapy
This example describes assessment of effectiveness and toxicity of treatment of cells in vitro with a combination of LSDl inhibitor and PARP inhibitor.
In some examples, prostate cancer cell lines are treated with an LSDl inhibitor plus or minus a PARP inhibitor. The prostate cancer cell lines include androgen-dependent cell lines (such as LNCaP, PC3, and DU145 cells) and androgen-independent prostate cancer cell lines (such as Abl and C42B cells). In some examples, the prostate cancer cells are transfected with LSDl siRNA or shRNA to decrease LSDl expression (LSDl knockdown cells). The LSDl knockdown cells are treated with varying amounts (such as 0.1 μΜ to 100 μΜ) of a PARP inhibitor (such as olaparib) for 1-7 days. Following treatment, the number of cells are counted and compared to similarly treated control cells (cells transfected with a control siRNA or shRNA, or untransfected cells). In other examples, unmodified prostate cancer cells are treated with varying amounts (such as 0.1 μΜ to 100 μΜ) of an LSDl inhibitor (such as XB154, PGl 144, or pargyline) for one day. The cells are then co-treated with the LSDl inhibitor and with varying amounts (such as 0.1 μΜ to 100 μΜ) of a PARP inhibitor (such as olaparib) for 1-7 days. Following treatment, the number of cells is counted and compared to cells treated with vehicle alone or cells treated with the LSDl inhibitor alone. A decrease (such as a statistically significant decrease) in the number of cells following treatment with an LSDl inhibitor and a PARP inhibitor indicates that the combination is effective at decreasing proliferation and/or killing prostate cancer cells. The number of cells undergoing apoptosis may also be determined, for example, using a TUNEL assay, annexin V staining, or other methods known to one of skill in the art. An increase (such as a statistically significant increase) in the number of cells undergoing apoptosis following treatment with an LSDl inhibitor and a PARP inhibitor indicates that the combination is effective at decreasing proliferation and/or killing prostate cancer cells. In other examples, H2AX foci are measured using
immunofluorescence or Western blot. An increase (such as a statistically significant increase) in the number of H2AX foci indicates that treatment with an LSD 1 inhibitor and a PARP inhibitor is effective.
In other examples, the effect of LSDl inhibitor plus PARP inhibitor is assessed in non-cancer cells in culture. For example, primary cultures from normal bone marrow donors can be used. The cells are treated with an LSDl inhibitor (such as XB154, PG11047, PG11144, or pargyline) and a PARP inhibitor (such as olaparib) as described above. Cell number and apoptosis are assessed as discussed above. No change (for example, no statistically significant change) in cell number or the number of cells undergoing apoptosis as compared to cells treated with vehicle alone indicates that the treatment is not toxic to non-cancer cells.
Example 7
Assessing LSDl Inhibitors in an In Vivo Model
This example describes methods for assessing the effectiveness of LSDl inhibitors against prostate cancer cells in an in vivo xenograft model.
LNCaP cells with a stable knockdown of LSDl (shLSDl cells) or control cells (such as shNTC cells) are inoculated in the dorsal flank of nude mice by subcutaneous injection (such as 3 x 106 cells in 100 of 50% RPMI 1640/BD Matrigel). Mouse weight and tumor size are measured once per week and tumor volume is estimated using the formula (7i/6)(LxW ), where L = length of tumor and W = width of tumor. A two- sample t-test is performed to determine statistical differences in mean tumor volume between the two groups.
Unmodified LNCaP cells are inoculated by subcutaneous injection into the dorsal flank of nude mice (such as 3 x 106 cells in 100 μΐ. of 50% RPMI 1640/BD Matrigel). After three weeks, mice are injected intraperitoneally once per day with water (control), pargyline (0.53 mg or 1.59 mg; 1 or 3 mM final concentration, assuming 70% bioavailability), or XB154 (4 or 20 μg; 1 or 5 μΜ final concentration, assuming 70% bioavailability) or treated with PGl 1144 (5 mg/kg each week) or PGl 1047 (10 mg/kg each week) Treatment continues for three weeks, during which time mouse weight and tumor volume are measured as above.
shLSDl LNCaP cells or control cells are injected in nude mice as above. After three weeks, mice are treated with 2.6 μg mitomycin C (predicted final concentration of 1 μΜ assuming 40% bioavailability), olaparib (for example, about 0.5 mg/kg to 25 mg/kg), or vehicle intraperitoneally once per day for three weeks. In other examples, unmodified LNCaP cells are injected in nude mice as above.
After three weeks, mice are treated with pargyline, XB154, PGl 1047, PGl 1144, or vehicle as above, plus MMC or olaparib. Treatment continues for three weeks, during which time mouse weight and tumor volume are measured as above.
A decrease in tumor volume compared to control in mice injected with shLSDl cells indicates that LSDl inhibition decreases tumor growth in vivo.
Similarly, a decrease in tumor volume compared to control in mice injected with LNCaP cells and treated with XB154, PGl 1144, or PGl 1047 indicates that LSDl inhibition decreases tumor growth in vivo. Finally, a decrease in tumor volume in mice injected with LNCaP cells and treated with XB154, PGl 1144, or PGl 1047 plus olaparib as compared to mice treated with XB154, PGl 1144, or PGl 1047 alone indicates that inhibition of LSDl plus inhibition of PARP decreases tumor growth in vivo.
The harvested xenograft tissue is examined for evidence of LSDl inhibition. This is assessed with Western blots to examine global levels of the 2MK4 and 2MK9 histone marks, expression of FA/BRCA genes, FANCD2 ubiquitination, and LSDl protein levels in the cases of the shRNA cells. A decrease in one or more of these parameters indicates the effective inhibition of LSD 1. Additionally, effects on DNA damage repair are assessed with staining for H2AX foci.
Example 8
Clinical Trial with Polyamine Analogs
This example describes an exemplary prospective clinical trial for treating prostate cancer with polyamine analogs PG11144 or PG11047. However, one skilled in the art will appreciate that methods that deviate from these specific methods can also be used in a clinical trial.
Patients identified as having a prostate tumor (for example by prostate biopsy) are selected for treatment. Patients with small cell prostate carcinoma diagnosed by histology on biopsy are selected and followed as a subset of patients. Patients with CRPC are also selected and followed as a subset of patients.
Patients are administered PG11047 or PG1144 intravenously (50 mg-750 mg) on days 1, 8, and 15 of a 28 day cycle for at least 2 cycles. In one trial of
PG11047, patients are administered 610 mg PG11047 on days 1, 8, and 15 of a 28 day cycle for at least 2 cycles. Patients are monitored for signs of unacceptable toxicity. Disease progression is monitored periodically (such as weekly, bi-weekly, monthly). Outcome measures include time to progression (for example as measured by Response Evaluation Criteria in Solid Tumors (RECIST) v2.0), overall survival, and quality of life.
In view of the many possible embodiments to which the principles of the disclosure may be applied, it should be recognized that the illustrated embodiments are only examples and should not be taken as limiting the scope of the disclosure. Rather, the scope of the invention is defined by the following claims. We therefore claim as our invention all that comes within the scope and spirit of these claims.

Claims

We claim:
1. A method of treating castration-resistant prostate cancer in a subject, comprising:
selecting a subject with castration-resistant prostate cancer; and
administering a therapeutically effective amount of a lysine- specific demethylase 1 (LSDl) inhibitor to the subject.
2. A method of treating small cell prostate carcinoma in a subject, comprising: selecting a subject with small cell prostate carcinoma; and
administering a therapeutically effective amount of a lysine- specific demethylase 1 (LSDl) inhibitor to the subject.
3. The method of claim 1 or claim 2, wherein the LSDl inhibitor comprises an inhibitor of LSDl activity or an inhibitor of LSDl expression.
4. The method of claim 3, wherein the inhibitor of LSDl activity comprises a peptide, an antibody, a small organic molecule, or a combination of two or more thereof.
5. The method of claim 4, wherein the small organic molecule comprises a polyamine analog.
6. The method of claim 5, wherein the polyamine analog is a biguanide, bisguanidine, or oligoamine analog.
7. The method of claim 5 or claim 6, wherein the polyamine analog is XB154, PG11047, or PG11144.
8. The method of claim 3, wherein the inhibitor of LSDl expression comprises an RNAi molecule, a peptide, an antibody, a small organic molecule, an antisense molecule, or a combination of two or more thereof.
9. The method of claim 8, wherein the RNAi molecule comprises a LSDl siRNA.
10. The method of claim 9, wherein the LSDl siRNA comprises a nucleic acid sequence according to SEQ ID NO: 1.
11. The method of claim 8, wherein the RNAi molecule comprises a LSDl shRNA.
12. The method of claim 11, wherein the LSDl shRNA comprises a nucleic acid sequence according to SEQ ID NO: 3.
13. The method of any one of claims 1 to 12, wherein the LSDl inhibitor decreases expression of CDC20 or UBE2C as compared to a control.
14. The method of any one of claims 1 to 13, further comprising
administering a therapeutically effective amount of a second anti-cancer agent that does not inhibit LSDl to the subject.
15. The method of claim 14, wherein the second anti-cancer agent comprises a DNA damaging agent or a PARP inhibitor.
16. The method of claim 15, wherein the DNA damaging agent comprises a platinum compound or mitomycin C.
17. A method of treating a subject with cancer, comprising administering a therapeutically effective amount of a lysine- specific demethylase 1 (LSDl) inhibitor and a therapeutically effective amount of poly (ADP ribose) polymerase (PARP) inhibitor to the subject.
18. The method of claim 17, wherein the LSDl inhibitor comprises an inhibitor of LSDl activity or an inhibitor of LSDl expression.
19. The method of claim 18, wherein the inhibitor of LSDl activity comprises a peptide, an antibody, a small organic molecule, or a combination of two or more thereof.
20. The method of claim 19, wherein the small organic molecule comprises a polyamine analog.
21. The method of claim 20, wherein the polyamine analog is a biguanide, bisguanidine, or oligoamine analog.
22. The method of claim 20 or claim 21, wherein the polyamine analog is XB154, PG11047, or PG11144.
23. The method of claim 18, wherein the inhibitor of LSDl expression comprises an RNAi molecule, a peptide, an antibody, a small organic molecule, an antisense molecule, or a combination of two or more thereof.
24. The method of claim 23, wherein the RNAi molecule comprises a LSDl siRNA.
25. The method of claim 24, wherein the LSDl siRNA comprises a nucleic acid sequence according to SEQ ID NO: 1.
26. The method of claim 23, wherein the RNAi molecule comprises a LSDl shRNA.
27. The method of claim 26, wherein the LSDl shRNA comprises a nucleic acid sequence according to SEQ ID NO: 3.
28. The method of any one of claims 17 to 27, wherein the LSD1 inhibitor decreases expression of one or more Fanconi anemia (FA) or BRCA genes.
29. The method of claim 28, wherein the LSD1 inhibitor decreases expression of one or more of BRCA1, BRCA2, FANCA, FANCB, FANCC, FANCD2, FANCG, or FANCM as compared to a control.
30. The method of any one of claims 17 to 29, wherein the PARP inhibitor comprises olaparib (AZD-2281), BSI 201, veliparib (ABT-888), AG014699, CEP 9722, or MK 4827.
31. A method of treating cancer in a subject, comprising administering a therapeutically effective amount of a histone deacetylase (HDAC) inhibitor and a therapeutically effective amount of a poly (ADP ribose) polymerase (PARP) inhibitor to the subject.
32. The method of claim 31, wherein the HDAC inhibitor comprises a hydroxamic acid, a cyclic tetrapeptide, a depsipeptide, a benzamide, an electrophilic ketone, or an aliphatic acid.
33. The method of claim 31 or claim 32, wherein the HDAC inhibitor is vorinostat (SAHA), romidepsin, panobinostat, valproic acid, mocetinostat, trichostatin A, AR-42, or CUDC-101.
34. The method of any one of claims 31 to 33, wherein the HDAC inhibitor decreases expression of one or more of BRCA1, BRCA2, FANCA, FANCB, FANCC, FANCD2, FANCG, or FANCM as compared to a control.
35. The method of any one of claims 31 to 34, wherein the PARP inhibitor comprises olaparib (AZD-2281), BSI 201, veliparib (ABT-888), AG014699, CEP 9722, MK 4827, or KU-0059436 (AZD2281).
36. The method of any one of claims 17 to 35, wherein the cancer is prostate cancer, breast cancer, or ovarian cancer.
37. Use of an inhibitor of lysine- specific demethylase 1 (LSDl) to treat a subject with castration-resistant prostate cancer, comprising administering a therapeutically effective amount of the LSDl inhibitor to the subject.
38. Use of an inhibitor of lysine- specific demethylase 1 (LSDl) to treat a subject with small-cell prostate carcinoma, comprising administering a
therapeutically effective amount of the LSDl inhibitor to the subject.
39. The use of claim 37 or claim 38, wherein the LSDl inhibitor comprises a polyamine analog.
40. The use of claim 39, wherein the polyamine analog is XB154, PG11047, or PG11144.
41. The use of any one of claims 37 to 40, further comprising administering a therapeutically effective amount of a second anti-cancer agent that does not inhibit LSDl to the subject.
42. Use of an inhibitor of lysine- specific demethylase 1 (LSDl) and a poly (ADP ribose) polymerase (PARP) inhibitor to treat a subject with cancer, comprising administering a therapeutically effective amount of an inhibitor of LSDl and a therapeutically amount of a PARP inhibitor to the subject.
43 The use of claim 42, wherein the LSDl inhibitor comprises a polyamine analog.
44, The use of claim 43, wherein the polyamine analog is XB154, PG11047, or PG11144.
45. Use of any one of claims 42 to 44, wherein the PARP inhibitor is olaparib (AZD-2281), BSI 201, veliparib (ABT-888), AG014699, CEP 9722, MK 4827, or KU-0059436 (AZD2281) 46. Use of a histone deacetylase (HDAC) inhibitor and a poly (ADP ribose) polymerase (PARP) inhibitor to treat a subject with cancer, comprising
administering a therapeutically effective amount of an HDAC inhibitor and a therapeutically amount of a PARP inhibitor to the subject.
47. The use of claim 46, wherein the HDAC inhibitor is vorinostat (SAHA), romidepsin, panobinostat, valproic acid, mocetinostat, trichostatin A, AR-42, or CUDC-101.
48. The use of claim 46 or claim 47, wherein the PARP inhibitor is olaparib (AZD-2281), BSI 201, veliparib (ABT-888), AG014699, CEP 9722, MK 4827, or KU-0059436 (AZD2281)
PCT/US2011/043911 2010-07-14 2011-07-13 Methods of treating cancer with inhibition of lysine-specific demethylase 1 Ceased WO2012009475A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US36435310P 2010-07-14 2010-07-14
US61/364,353 2010-07-14

Publications (1)

Publication Number Publication Date
WO2012009475A1 true WO2012009475A1 (en) 2012-01-19

Family

ID=45469795

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2011/043911 Ceased WO2012009475A1 (en) 2010-07-14 2011-07-13 Methods of treating cancer with inhibition of lysine-specific demethylase 1

Country Status (1)

Country Link
WO (1) WO2012009475A1 (en)

Cited By (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150150832A1 (en) * 2013-11-20 2015-06-04 Ohio State Innovation Foundation Methods for suppressing cancer-related cachexia
WO2016003917A1 (en) * 2014-07-03 2016-01-07 Quanticel Pharmaceuticals, Inc. Inhibitors of lysine specific demethylase-1
WO2016029262A1 (en) * 2014-08-25 2016-03-03 University Of Canberra Compositions for modulating cancer stem cells and uses therefor
US20160143938A1 (en) * 2013-06-25 2016-05-26 University Of Canberra Methods and compositions for modulating cancer stem cells
WO2018031658A1 (en) * 2016-08-10 2018-02-15 Celgene Corporation Treatment of relapsed and/or refractory solid tumors and non-hodgkin's lymphomas
WO2018045422A1 (en) * 2016-09-07 2018-03-15 University Of Canberra Lysine specific histone demethylase-1 inhibitors and uses therefor
US20180296574A1 (en) * 2017-04-13 2018-10-18 Janssen Pharmaceutica Nv Combination Therapy for Prostate Cancer
US10300051B2 (en) 2014-02-13 2019-05-28 Incyte Corporation Cyclopropylamines as LSD1 inhibitors
US10329255B2 (en) 2015-08-12 2019-06-25 Incyte Corporation Salts of an LSD1 inhibitor
EP3420079A4 (en) * 2016-02-22 2019-07-10 New York Institute of Technology METHOD FOR TREATING CANCER BY DEACTIVATING BRACA1 / FANCM INTERACTION
US10513493B2 (en) 2014-02-13 2019-12-24 Incyte Corporation Cyclopropylamines as LSD1 inhibitors
US10556908B2 (en) 2014-07-10 2020-02-11 Incyte Corporation Substituted imidazo[1,2-a]pyrazines as LSD1 inhibitors
US10640503B2 (en) 2014-07-10 2020-05-05 Incyte Corporation Imidazopyridines and imidazopyrazines as LSD1 inhibitors
US10676457B2 (en) 2014-02-13 2020-06-09 Incyte Corporation Cyclopropylamines as LSD1 inhibitors
US10717737B2 (en) 2014-02-13 2020-07-21 Incyte Corporation Cyclopropylamines as LSD1 inhibitors
US10800779B2 (en) 2015-04-03 2020-10-13 Incyte Corporation Heterocyclic compounds as LSD1 inhibitors
US10968221B2 (en) 2014-07-10 2021-04-06 Incyte Corporation Substituted [1,2,4]triazolo[1,5-a]pyrazines as LSD1 inhibitors
US10968200B2 (en) 2018-08-31 2021-04-06 Incyte Corporation Salts of an LSD1 inhibitor and processes for preparing the same
WO2021247977A1 (en) * 2020-06-05 2021-12-09 Celgene Quanticel Research, Inc. Methods of treating prostate cancer
US11207311B2 (en) 2016-07-29 2021-12-28 Janssen Pharmaceutica Nv Method of treating prostate cancer
ES2919083R1 (en) * 2020-06-29 2022-07-26 Celgene Quanticel Res Inc Prostate cancer treatment methods
CN115957203A (en) * 2022-12-19 2023-04-14 湖南岳靶生物医药有限公司 A compound, composition and application thereof that can be used to reduce drug resistance of bladder cancer cells
CN117017962A (en) * 2023-08-23 2023-11-10 复旦大学附属肿瘤医院 Application of HDACI inhibitor in preparation of medicines for treating ovarian cancer
WO2023195923A3 (en) * 2022-04-04 2023-11-23 Singapore Health Services Pte Ltd Compound screening and therapeutic uses

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998017624A1 (en) * 1996-10-18 1998-04-30 Wisconsin Alumni Research Foundation Conformationally restricted polyamines and their use as antineoplastic agents
WO2006127978A2 (en) * 2005-05-24 2006-11-30 Dana Farber Cancer Institute, Inc. Compositions and methods for the treatment of cancer
WO2008056187A1 (en) * 2006-11-08 2008-05-15 Istituto Di Ricerche Di Biologia Molecolare P. Angeletti Spa Imidazolopyrimidines and imidazolotriazine derivatives as inhibitors of poly(adp-ribose) polymerase (parp)
WO2008127734A2 (en) * 2007-04-13 2008-10-23 The Johns Hopkins University Lysine-specific demethylase inhibitors
WO2010043721A1 (en) * 2008-10-17 2010-04-22 Oryzon Genomics, S.A. Oxidase inhibitors and their use

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998017624A1 (en) * 1996-10-18 1998-04-30 Wisconsin Alumni Research Foundation Conformationally restricted polyamines and their use as antineoplastic agents
WO2006127978A2 (en) * 2005-05-24 2006-11-30 Dana Farber Cancer Institute, Inc. Compositions and methods for the treatment of cancer
WO2008056187A1 (en) * 2006-11-08 2008-05-15 Istituto Di Ricerche Di Biologia Molecolare P. Angeletti Spa Imidazolopyrimidines and imidazolotriazine derivatives as inhibitors of poly(adp-ribose) polymerase (parp)
WO2008127734A2 (en) * 2007-04-13 2008-10-23 The Johns Hopkins University Lysine-specific demethylase inhibitors
WO2010043721A1 (en) * 2008-10-17 2010-04-22 Oryzon Genomics, S.A. Oxidase inhibitors and their use

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
ADIMOOLAM, S. ET AL.: "HDAC inhibitor PCI-24781 decreases RAD51 expression and inhibits homologous recombination", THE PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 104, no. 49, 2007, pages 19482 - 19487, XP002578134, DOI: doi:10.1073/pnas.0707828104 *
DREDGE, K. ET AL.: "The polyamine analog PG11047 potentiates the antitumor activity of cisplatin and bevacizumab in preclinical models of lung and prostate cancer", CANCER CHEMOTHERAPY AND PHARMACOLOGY, vol. 65, no. 1, 2009, pages 191 - 195, XP002758797, DOI: doi:10.1007/s00280-009-1105-7 *
GAYMES, T.J. ET AL.: "Inhibitors of poly ADP-ribose polymerase (PARP) induce apoptosis of myeloid leukemic cells: potential for therapy of myeloid leukemia and myelodysplastic syndromes", HAEMATOLOGICA, vol. 94, no. 5, 2009, pages 638 - 646, XP008147848, DOI: doi:10.3324/haematol.2008.001933 *
PAPEO, G. ET AL.: "Poly(ADP-ribose) polymerase inhibition in cancer therapy: are we close to maturity?", EXPERT OPINION ON THERAPEUTIC PATENTS, vol. 19, no. 10, 2009, pages 1377 - 1400 *
ZAREMBA, T. ET AL.: "PARP Inhibitor Development for Systemic Cancer Targeting", ANTI-CANCER AGENTS IN MEDICINAL CHEMISTRY, vol. 7, no. 5, 2007, pages 515 - 523, XP009107679 *

Cited By (61)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2014302038B2 (en) * 2013-06-25 2019-11-14 Epiaxis Therapeutics Pty Ltd Methods and compositions for modulating cancer stem cells
US20160143938A1 (en) * 2013-06-25 2016-05-26 University Of Canberra Methods and compositions for modulating cancer stem cells
US10220053B2 (en) * 2013-06-25 2019-03-05 University Of Canberra Methods and compositions for modulating cancer stem cells
AU2014353070B2 (en) * 2013-11-20 2020-04-30 Ohio State Innovation Foundation HDAC inhibitors for suppressing cancer-related cachexia
RU2692785C1 (en) * 2013-11-20 2019-06-27 Огайо Стейт Инновейшн Фаундейшн Methods of reducing cachexia associated with cancer
US20150150832A1 (en) * 2013-11-20 2015-06-04 Ohio State Innovation Foundation Methods for suppressing cancer-related cachexia
US11219607B2 (en) * 2013-11-20 2022-01-11 Ohio State Innovation Foundation Methods for suppressing cancer-related cachexia
US11247992B2 (en) 2014-02-13 2022-02-15 Incyte Corporation Cyclopropylamines as LSD1 inhibitors
US10513493B2 (en) 2014-02-13 2019-12-24 Incyte Corporation Cyclopropylamines as LSD1 inhibitors
US10676457B2 (en) 2014-02-13 2020-06-09 Incyte Corporation Cyclopropylamines as LSD1 inhibitors
US10717737B2 (en) 2014-02-13 2020-07-21 Incyte Corporation Cyclopropylamines as LSD1 inhibitors
US10300051B2 (en) 2014-02-13 2019-05-28 Incyte Corporation Cyclopropylamines as LSD1 inhibitors
US11155532B2 (en) 2014-02-13 2021-10-26 Incyte Corporation Cyclopropylamines as LSD1 inhibitors
CN108530424A (en) * 2014-07-03 2018-09-14 赛尔基因昆蒂赛尔研究公司 The inhibitor of lysine specific demethylase -1
CN106795103A (en) * 2014-07-03 2017-05-31 赛尔基因昆蒂赛尔研究公司 Inhibitor of lysine-specific demethylase-1
CN106795103B (en) * 2014-07-03 2019-07-12 赛尔基因昆蒂赛尔研究公司 Inhibitors of lysine-specific demethylase-1
US9902719B2 (en) 2014-07-03 2018-02-27 Celgene Quanticel Research, Inc. Inhibitors of lysine specific demethylase-1
WO2016003917A1 (en) * 2014-07-03 2016-01-07 Quanticel Pharmaceuticals, Inc. Inhibitors of lysine specific demethylase-1
EA033698B1 (en) * 2014-07-03 2019-11-18 Celgene Quanticel Res Inc Inhibitors of lysine specific demethylase-1
US10100046B2 (en) 2014-07-03 2018-10-16 Celgene Quanticel Research, Inc. Inhibitors of lysine specific demethylase-1
US10968221B2 (en) 2014-07-10 2021-04-06 Incyte Corporation Substituted [1,2,4]triazolo[1,5-a]pyrazines as LSD1 inhibitors
US10556908B2 (en) 2014-07-10 2020-02-11 Incyte Corporation Substituted imidazo[1,2-a]pyrazines as LSD1 inhibitors
US10640503B2 (en) 2014-07-10 2020-05-05 Incyte Corporation Imidazopyridines and imidazopyrazines as LSD1 inhibitors
WO2016029262A1 (en) * 2014-08-25 2016-03-03 University Of Canberra Compositions for modulating cancer stem cells and uses therefor
US10485772B2 (en) 2014-08-25 2019-11-26 EpiAxis Therapeutics Pty Ltd. Compositions for modulating cancer stem cells and uses therefor
AU2015309686B2 (en) * 2014-08-25 2020-05-14 Epiaxis Therapeutics Pty Ltd Compositions for modulating cancer stem cells and uses therefor
US10800779B2 (en) 2015-04-03 2020-10-13 Incyte Corporation Heterocyclic compounds as LSD1 inhibitors
US11401272B2 (en) 2015-04-03 2022-08-02 Incyte Corporation Heterocyclic compounds as LSD1 inhibitors
US10329255B2 (en) 2015-08-12 2019-06-25 Incyte Corporation Salts of an LSD1 inhibitor
US10723700B2 (en) 2015-08-12 2020-07-28 Incyte Corporation Salts of an LSD1 inhibitor
US11498900B2 (en) 2015-08-12 2022-11-15 Incyte Corporation Salts of an LSD1 inhibitor
EP3420079A4 (en) * 2016-02-22 2019-07-10 New York Institute of Technology METHOD FOR TREATING CANCER BY DEACTIVATING BRACA1 / FANCM INTERACTION
US11207311B2 (en) 2016-07-29 2021-12-28 Janssen Pharmaceutica Nv Method of treating prostate cancer
US12383543B2 (en) 2016-07-29 2025-08-12 Janssen Pharmaceutica Nv Methods of treating prostate cancer
US11992486B2 (en) 2016-07-29 2024-05-28 Janssen Pharmaceutica Nv Methods of treating prostate cancer
US11986470B2 (en) 2016-07-29 2024-05-21 Janssen Pharmaceutica Nv Methods of treating prostate cancer
US11986469B2 (en) 2016-07-29 2024-05-21 Janssen Pharmaceutica Nv Methods of treating prostate cancer
US11986468B2 (en) 2016-07-29 2024-05-21 Janssen Pharmaceutica Nv Methods of treating prostate cancer
WO2018031658A1 (en) * 2016-08-10 2018-02-15 Celgene Corporation Treatment of relapsed and/or refractory solid tumors and non-hodgkin's lymphomas
US10543213B2 (en) 2016-08-10 2020-01-28 Celgene Quanticel Research, Inc. Treatment of relapsed and/or refractory solid tumors and non-hodgkin's lymphomas
US10849898B2 (en) 2016-08-10 2020-12-01 Celgene Quanticel Research, Inc. Treatment of relapsed and/or refractory solid tumors and non-Hodgkin's lymphomas
US10960005B2 (en) 2016-08-10 2021-03-30 Celgene Quanticel Research, Inc. Treatment of relapsed and/or refractory solid tumors and non-hodgkin's lymphomas
IL264718B2 (en) * 2016-08-10 2023-11-01 Celgene Corp Treatment of solid tumors and non-Hodgkin's lymphomas that have relapsed and/or are resistant
CN109803660A (en) * 2016-08-10 2019-05-24 细胞基因公司 Treatment of relapsed and/or refractory solid tumors and non-Hodgkin lymphoma
IL264718B1 (en) * 2016-08-10 2023-07-01 Celgene Corp Treatment of relapsed and/or refractory solid tumors and non-hodgkin's lymphomas
US10328077B2 (en) 2016-08-10 2019-06-25 Celgene Corporation Treatment of relapsed and/or refractory solid tumors and non-hodgkin's lymphomas
US10548896B2 (en) 2016-08-10 2020-02-04 Celgene Quanticel Research, Inc. Treatment of relapsed and/or refractory solid tumors and non-Hodgkin's lymphomas
WO2018045422A1 (en) * 2016-09-07 2018-03-15 University Of Canberra Lysine specific histone demethylase-1 inhibitors and uses therefor
CN110312522A (en) * 2016-09-07 2019-10-08 堪培拉大学 - 1 inhibitor of lysine specific histone demethylation enzyme and application thereof
US20180296574A1 (en) * 2017-04-13 2018-10-18 Janssen Pharmaceutica Nv Combination Therapy for Prostate Cancer
CN110753545A (en) * 2017-04-13 2020-02-04 詹森药业有限公司 Combination therapy for prostate cancer
US20240398837A1 (en) * 2017-04-13 2024-12-05 Janssen Pharmaceutica Nv Combination Therapy For Prostate Cancer
US11512064B2 (en) 2018-08-31 2022-11-29 Incyte Corporation Salts of an LSD1 inhibitor and processes for preparing the same
US10968200B2 (en) 2018-08-31 2021-04-06 Incyte Corporation Salts of an LSD1 inhibitor and processes for preparing the same
US20230241063A1 (en) * 2020-06-05 2023-08-03 Celgene Quanticel Research, Inc. Methods of treating prostate cancer
CN116056707A (en) * 2020-06-05 2023-05-02 赛尔基因昆蒂赛尔研究公司 Methods of treating prostate cancer
WO2021247977A1 (en) * 2020-06-05 2021-12-09 Celgene Quanticel Research, Inc. Methods of treating prostate cancer
ES2919083R1 (en) * 2020-06-29 2022-07-26 Celgene Quanticel Res Inc Prostate cancer treatment methods
WO2023195923A3 (en) * 2022-04-04 2023-11-23 Singapore Health Services Pte Ltd Compound screening and therapeutic uses
CN115957203A (en) * 2022-12-19 2023-04-14 湖南岳靶生物医药有限公司 A compound, composition and application thereof that can be used to reduce drug resistance of bladder cancer cells
CN117017962A (en) * 2023-08-23 2023-11-10 复旦大学附属肿瘤医院 Application of HDACI inhibitor in preparation of medicines for treating ovarian cancer

Similar Documents

Publication Publication Date Title
WO2012009475A1 (en) Methods of treating cancer with inhibition of lysine-specific demethylase 1
Huang et al. YTHDF2 promotes intrahepatic cholangiocarcinoma progression and desensitises cisplatin treatment by increasing CDKN1B mRNA degradation
Deng et al. A KLF4/PiHL/EZH2/HMGA2 regulatory axis and its function in promoting oxaliplatin-resistance of colorectal cancer
Triscott et al. Personalizing the treatment of pediatric medulloblastoma: Polo-like kinase 1 as a molecular target in high-risk children
Canesin et al. Scavenging of labile heme by hemopexin is a key checkpoint in cancer growth and metastases
Kelly et al. Targeting Aurora A kinase activity with the investigational agent alisertib increases the efficacy of cytarabine through a FOXO‐dependent mechanism
Lu et al. SIK2 inhibition enhances PARP inhibitor activity synergistically in ovarian and triple-negative breast cancers
Islam et al. Genetic alterations of Keap1 confers chemotherapeutic resistance through functional activation of Nrf2 and Notch pathway in head and neck squamous cell carcinoma
Yang et al. Histone deacetylase 6 acts upstream of DNA damage response activation to support the survival of glioblastoma cells
Cevatemre et al. Exploiting epigenetic targets to overcome taxane resistance in prostate cancer
WO2014074805A1 (en) Selective targeting of cancer stem cells
ES2843829T3 (en) New methods for subtyping and cancer treatment
Sonobe et al. Long noncoding RNA TUG1 promotes cisplatin resistance in ovarian cancer via upregulation of DNA polymerase eta
EP3681515A1 (en) Mafg as a potential therapeutic target to restore chemosensitivity in platinum-resistant cancer cells
Liang et al. Hsa_circ_0097922 promotes tamoxifen resistance and cell malignant behaviour of breast cancer cells by regulating ACTN4 expression via miR‐876‐3p
Peng et al. Jab1 regulates HRR mRNA stability to modulate PARP inhibitor sensitivity in triple-negative breast cancer
Fan et al. Phospholipase C-ε regulates bladder cancer cells via ATM/EXO1
Pihlajoki et al. Biology of childhood hepatoblastoma and the search for novel treatments
US9568483B2 (en) Molecular subtyping, prognosis and treatment of prostate cancer
Li et al. RN7SL1 overexpression promotes cell proliferation in cutaneous T-cell lymphoma via miR-34a-5p/MYCN axis
Deng et al. Knockdown of circLRWD1 weakens DDP resistance via reduction of SIRT5 expression through releasing miR-507 in non-small cell lung cancer
Kindt et al. RET inhibition overcomes resistance to combined CDK4/6 inhibitor and endocrine therapy in ER+ breast cancer
Sears et al. Methylation-induced suppression of YAP/TAZ confers sensitivity to HDAC inhibitors in high-grade IDH mutant gliomas
Raninga et al. Thioredoxin reductase 3 inhibition sensitizes triple-negative breast cancer cells to EGFR inhibitors
Dominika et al. Influence of Hypoxia on Tumor Heterogeneity, DNA Repair, and Cancer Therapy: From Molecular Insights to Therapeutic Strategies

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11807479

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11807479

Country of ref document: EP

Kind code of ref document: A1