WO2012006145A2 - Com positions and methods for retargeting virus constructs - Google Patents
Com positions and methods for retargeting virus constructs Download PDFInfo
- Publication number
- WO2012006145A2 WO2012006145A2 PCT/US2011/042331 US2011042331W WO2012006145A2 WO 2012006145 A2 WO2012006145 A2 WO 2012006145A2 US 2011042331 W US2011042331 W US 2011042331W WO 2012006145 A2 WO2012006145 A2 WO 2012006145A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- peptide
- adenovirus
- nucleic acid
- virus
- adenoviral construct
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1037—Screening libraries presented on the surface of microorganisms, e.g. phage display, E. coli display
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/10011—Adenoviridae
- C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
- C12N2710/10322—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/10011—Adenoviridae
- C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
- C12N2710/10341—Use of virus, viral particle or viral elements as a vector
- C12N2710/10343—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/10011—Adenoviridae
- C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
- C12N2710/10341—Use of virus, viral particle or viral elements as a vector
- C12N2710/10345—Special targeting system for viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2810/00—Vectors comprising a targeting moiety
- C12N2810/40—Vectors comprising a peptide as targeting moiety, e.g. a synthetic peptide, from undefined source
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2820/00—Vectors comprising a special origin of replication system
- C12N2820/007—Vectors comprising a special origin of replication system tissue or cell-specific
Definitions
- the present invention relates to the field of viral gene therapy. More specifically, the present invention provides compositions and methods for retargeting virus constructs.
- This application contains a sequence listing. It has been submitted electronically via EFS-Web as an ASCI I text file entitled "P I 1 155-02_Sequence_Listing_ST25.txt.” The sequence listing is 13. 1 ki lobytes in size, and was created on June 27, 201 1 . It is hereby incorporated by re ference in its ent irety.
- the first tissue-speci fic lytic adenovirus was developed for the treatment of prostate cancer (PCa) by limiting viral replication to cells containing activated androgen receptor.
- PCa prostate cancer
- These prostate-selective lytic vectors have been evaluated in clinical trials both as direct tumor injected agents and as systemically administered virus for castration- resistant metastatic PCa.
- the therapeutic effect was lim ited to prostatic cells, the efficacy as a systemic therapy was hampered by viral sequestration and clearance. This reflects the loss of more than 90% of intravenously administered adenovirus through liver sequestration.
- Next generation cancer gene therapy vectors seek to enhance efficacy through capsid modifications designed to limit viral clearance and/or improve tumor infection through alternative receptors.
- the present invention is based, in part, on the discovery that adenovirus-displayed, semi-random peptide libraries, in the form of Hanking cassettes, can be applied to rescue the targeting ability of phage-derived peptides that were previously ineffective in such a complex environment.
- the result is a genetically modified adenovirus that successfully infects prostatic cells and tumors through PSMA.
- This approach can be applied to develop targeted agents for prostate cancer, or other cancers, not only in adenovirus but also in other experimental therapeutic platforms.
- the present invention relates to the field of viral gene therapy. More specifically, the present invention provides compositions and methods for retargeting virus constructs.
- the present invention provides an adenoviral construct comprising a nucleic acid encoding the peptide sequence MAE-X-PDP, wherein X is an antigen targeting peptide.
- the antigen targeting peptide is a tumor antigen targeting peptide.
- the tumor antigen can be selected from the group consisting of PSMA, VEGFR, PSCA, EPCam, CD227, EGFR, Alpha- V-beta-3 Integrin, AFP, CD 140b, CD30, CD33, CD52, CD56, CD66e, CA 125, GD3 ganglioside, CD4, CD20, CD22, CD80, and CD 152.
- the antigen targeting peptide specifically binds an antigen expressed on the surface of cancer cells.
- the antigen can be selected from the group consisting of PSMA, VEGFR.
- PSCA EPCam, CD227, EGFR, and Alpha- V-beta-3 Integrin.
- the antigen targeting peptide specifically binds prostate specific membrane antigen (PSMA).
- PSMA prostate specific membrane antigen
- X comprises SEQ ID NO:9.
- the present invention also provides an adenoviral construct comprising a nucleic acid sequence encoding the peptide sequence MAE-X-PDP, wherein X is a peptide that specifically binds PSMA.
- X comprises SEQ ID NO:9.
- an adenoviral construct comprises a nucleic acid sequence encoding the peptide sequence of SEQ ID NO: 10.
- the peptide sequence is inserted into the amino acid sequence encoding adenovirus fiber protein.
- the peptide sequence is inserted into the Hl-loop of adenovirus fiber protein.
- the peptide sequence is inserted into the EG-loop of adenovirus fiber protein.
- the peptide sequence is inserted into the IJ-loop of adenovirus fiber protein.
- the peptide sequence can be inserted into the C-terminus of capsid protein IX, the C-terminus of Fiber protein, and the L l -loop of hexon protein. Furthermore, the peptide sequence can be inserted at two or more appropriate sites, e.g., both the H I -loop and C-terminus of Fiber protein.
- the adenoviral constructs of the present invention can be modified to ablate interaction with the natural receptor coxsackie and adenovirus receptor (CAR).
- the mod ification comprises one or more deletions in the nucleic acid sequence encoding adenovirus fiber protein.
- the present invention provides an adenoviral construct comprising a nucleic acid encoding a tumor antigen targeting peptide inserted into the nucleic acid sequence encoding the capsid fiber protein, wherein a nucleic acid sequence encoding the trimer peptide M AE is located upstream of the nucleic acid encoding a tumor antigen targeting peptide and a nucleic acid sequence encoding the trimer peptide PDP is located downstream of the nucleic acid encoding a tumor antigen targeting peptide.
- an adenoviral construct comprises a nucleic acid sequence encoding the peptide sequence MAEWQPDTAHHWALTLPDP inserted into the H l-loop of adenovirus fiber protein.
- the present invention further provides pharmaceutical
- compositions comprises any of the adenoviral constructs described herein.
- the present invention relates to the treatment of cancer.
- a method for treating cancer comprises administering a therapeutical ly effective amount of the adenoviral construct of the present invention.
- the present invention also provides methods for optimizing adenoviral infection of target cells comprising the steps of (a) generating a peptide-d isplay adenovirus library, wherein the displayed peptide is a peptide that specifical ly binds an antigen expressed on the surface of a target cell, and wherein the displayed peptide is flanked by random peptide sequences; and (b) screening the peptide-display adenovirus library against the target cells.
- a method comprises (a) generating a peptide-display virus library, wherein the displayed peptide is a peptide that specifically binds an antigen expressed on the surface of a target cell, and wherein the displayed peptide is flanked by random peptide sequences; and (b) screening the peptide-display virus library against the target cells.
- the target cell is a cancer cell.
- the virus can be selected from the group consisting of adenovirus, herpes simplex virus, in fluenza virus, Newcastle disease virus, poliovi us, reovirus, vaccinia virus and vesicular virus. I n a specific embodiment, the virus is a retrovirus.
- flanking random peptide sequences are selected from the group consisting of monomer dimer, trimer, tetramer, pentamer, hexamer, septamer, octamer, and a nonamer.
- the flanking random peptide sequences are multimers.
- the flanking random peptide sequences are trimers.
- a single peptide sequence at either end of the antigen targeting peptide can be used.
- FIG. 1 is a schemat ic illustration of a semi-random Fiber-peptide library.
- the Fiber library a preselected PSMA-targeting peptide, WQPDTAH H WATL, was c loned into the H I-loop of fiber knob and flanked by 2 random trimer peptide cassettes providing a potential d iversity o f 64 million different peptide orientations.
- the Fiber gene was further modified by and Y477A to ablate interact ion with the natural receptor, CAR.
- the entire Fiber gene region is flanked by noncompatible unidirect ional lox sites (green rectangle) for site-directed cassette exchange.
- FIG. 1 B shows the generation of the adenoviral library.
- a pseudotyped acceptor virus lacking any fiber-coding region, was used to infect 293cre57 cells transfected with fiber-shuttle library cassettes. Cre-recombinase site specifically transferred the modified Fiber gene into the infected viral genome, resulting in amplification and packaging of the retargeted virus.
- FIG. 2 lists the library peptide sequences of randomly selected clones from each round.
- FIG. 3 presents the results of PSMA-mediated adenoviral infection in cell and tumor models.
- infect ion is mediated by PSM A-binding peptide.
- LNCaP cells were preincubated with serial ly diluted PSMA-binding peptide or an unrelated control peptide for 30 minutes. followed by infection with Ad5Track-Luc-Saupw- 1 or Ad5Track-Luc-WtFiber. Infection was quantified by luciferase activity, relative to non-inhibited infection. Bars represent mean ⁇ SE infection of 3 replicates.
- FIG. 2C shows the results of adenoviral infection following systemic injection. Mice bearing LNCaP tumors were intravenously injected with Ad5Track- Luc-Saupw- 1 or Ad5Track-Luc-WtFiber ( I * 10 9 IU).
- FIG. 3D shows relative infection results, specifically, tumor to tissue luciferase ratios for each virus 4 days after virus administration.
- FIG. 4 shows luminescent imaging of viral infection and biodistribution.
- Subcutaneous LNCaP tumors were prepared in nude mice. When the tumors reached approximately 0.8 cm 3 in dimension, 10 9 IU per mouse of (A) Ad5Track-Luc-WtFiber, (B) Ad5Track-Luc-Saupw- l, or (C) PBS was administered by tail-vein injection into mice. Three days after virus injection, mice were anesthetized and imaged.
- FIG. 5 shows PSMA expression models and wild type viral infection.
- Protein extracts were analyzed by western blotting with anti-PSM A antibody, 7E I I , ( 1 : 10000 dilution), and anti ⁇ -actin antibody (loading control). Immunoreactivity was determined by using ECL western blotting detection system.
- adenovirus refers to the virus itself or derival ives thereof. The term covers all serotypes and subtypes and both naturally occurring and recombinant forms, except where otherwise indicated.
- adenovirus or "adenoviral particle” is used to include any and all viruses that can be categorized as an adenovirus, including any adenovirus that infects a human or an animal, including all groups, subgroups, and serotypes.
- subgroup A includes adenovirus serotypes 12, 18, and 3 1 .
- Subgroup C includes adenovirus serotypes 1 , 2, 5, and 6.
- Subgroup D includes adenovirus serotype 8, 9, 10, 1 3, 1 5, 17, 19, 20, 22-30, 32, 33, 36-39, and 42-49.
- Subgroup E includes adenovirus serotype 4.
- Subgroup F includes adenovirus serotypes 40 and 41 . These latter two serotypes have a long and a short Fiber protein.
- an "adenovirus” or “adenovirus particle” may include a packaged vector or genome. Depending upon the context, the term “adenovirus” can also include adenoviral vectors.
- an "adenovirus vector,” “adenoviral vector,” or “adenovirus construct” is a term well understood in the art and generally comprises a polynucleotide comprising all or a portion of an adenovirus genome.
- an "adenovirus vector,” “adenoviral vector,” or “adenovirus construct” refers to any of several forms including, but not limited to, DNA, DNA encapsulated in an adenovirus coat, DNA packaged in another viral or viral-like form (such as herpes simplex, and AAV), DNA encapsulated in liposomes, DNA complexed with polylysine, complexed with synthetic polycationic molecules, conjugated with transferrin, and complexed with compounds such as PEG to immunological ly "mask” the molecule and/or increase half-life, and conjugated to a nonviral protein.
- the adenoviral vector typically contains most of the adenoviral genome.
- the adenoviral vector may also contain a bacterial origin of replication.
- portions of the wild-type adenoviral genome may be deleted to permit insertion of desired products and the packaging of recombinant adenoviral vectors containing the desired genes.
- adenovirus vectors are replication-competent in a target cell.
- adenovirus constructs are conditional ly replicative in a target cell. Indeed, conditionally replicating adenoviruses (CRAds) represent a promising modality for the treatment of neoplastic diseases, including prostate cancer.
- CRAds conditionally replicating adenoviruses
- adenoviruses are currently used for a variety of purposes, including gene transfer in vitro, vaccination in vivo, and gene therapy.
- Several features of adenovirus biology have made such viruses the vectors of choice for certain of these applications.
- adenoviruses transfer genes to a broad spectrum of cel l types, and gene transfer is not dependent on active cell division. Additionally, high titers of virus and high levels of transgene expression can generally be obtained.
- the high density and complexity o f the viral transcription units poses problems for recombinant manipulation, which is therefore usually restricted to specific regions, particularly El, E2A, E3, and E4.
- transgenes are introduced in place of El or E3, the former supplied exogenously.
- the El deletion renders the viruses defective for replication and incapable of producing infectious viral particles in target cells; the E3 region encodes proteins involved in evading host immunity, and is dispensable tor viral production per se.
- Homologous recombination results in a defective adenovirus which can replicate in the packaging line (e.g., 293 or 91 1 cells) which supplies the missing gene products (e.g., El).
- the desired recombinants are identified by screening individual plaques generated in a lawn of packaging cells. The low efficiency of homologous recombination, the need for repeated rounds of plaque purification, and the long times required for completion of the viral production process have hampered more widespread use of adenoviral vector technology.
- the term "administration" refers to the act of giving a drug, prodrug, or other agent, or therapeutic treatment (e.g., compositions of the present invention) to a subject (e.g., a subject or in vivo, in vitro, or ex vivo cells, tissues, and organs).
- a subject e.g., a subject or in vivo, in vitro, or ex vivo cells, tissues, and organs.
- exemplary routes of administration to the human body can be through the eyes (ophthalmic), mouth (oral), skin (transdermal), nose (nasal), lungs (inhalant), oral mucosa (buccal), ear, by injection (e.g., intravenously, subcutaneously, intratumorally, intraperitoneally, etc.) and the like.
- co-administration refers to the administration of at least two agent(s) or therapies to a subject. In some embodiments, the co-administration of two or more agents or therapies is concurrent. In other embodiments, a first agent/therapy is administered prior to a second agent/therapy.
- a first agent/therapy is administered prior to a second agent/therapy.
- the appropriate dosage for co-administration can be readily determined by one sk illed in the art. I n some embodiments, when agents or therapies are co-administered, the respect ive agents or therapies are administered at lower dosages than appropriate for their administration alone. Thus, co-administration is especially desirable in embodiments where the co- administration of the agents or therapies lowers the requisite dosage of a potentially harmful (e.g., toxic) agent(s).
- cancer and “cancerous” refer to or describe the physiological condition in mammals that is typical ly characterized by unregulated cell growth.
- a “tumor” comprises one or more cancerous cells. Examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia or lymphoid malignancies. More particular examples of such cancers include prostate, breast, colon, lung, brain, kidney, and bladder cancer.
- cancer cells refers to individual cells of a cancer. Such cells may include, for example, cells that express prostate specific membrane ant igen (PSMA).
- PSMA prostate specific membrane ant igen
- polynucleot ide or “nucleic acid” refers to a polymeric form of nucleotides of any length, either ribonucleotides and/or deoxyribonuc leotides. These terms include a single-, double- or triple-stranded DNA, genomic DNA, cDNA, RNA, DNA-RNA hybrid, or a polymer comprising purine and pyrimidine bases, or other natural, chemically,
- the backbone of the polynucleotide can comprise sugars and phosphate groups (as may typically be found in RNA or DNA), or modified or substituted sugar or phosphate groups.
- the backbone of the polynucleotide can comprise a polymer of synthetic subunits such as phosphoramidates and thus can be an oligodeoxynucleoside phosphoramidate (P- I-I2) or a mixed phosphoramidaie-phosphod iester oligomer.
- a double-stranded polynucleotide can be obtained from the single stranded polynucleotide product of chemical synthesis either by synthesizing the complementary strand and annealing the strands under appropriate conditions, or by synthesizing the complementary strand de novo using a D A polymerase with an appropriate primer.
- polynucleotides a gene or gene fragment, exons, introns, mRNA, tRNA, rRNA, ribozymes, cDNA, recombinant polynuc leotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers.
- a polynucleotide may comprise mod ified nucleotides, such as methylated nucleotides and nucleotide analogs, uracyl, other sugars and linking groups such as fluororibose and thioate, and nucleotide branches.
- sequence of nucleotides may be interrupted by non-nucleotide components.
- a polynucleotide may be further modified after polymerizat ion, such as by conjugation with a labeling component.
- Other types of modifications included in this defin ition are caps, substitution of one or more of the naturally occurring nucleotides with an analog, and introduction of means for attaching the polynucleotide to proteins, metal ions, labeling components, other polynucleotides, or a solid support.
- plasmid refers to an extrachromosomal circular DNA capable of autonomous replication in a given cell.
- the range of suitable plasmids is very large.
- the plasmid is designed for amplification in bacteria and for expression in a eukaryotic target cell.
- plasmids can be purchased from a variety of manufacturers.
- Exemplary plasmids include but are not limited to those derived from pBR322 (Gibco BRL), pUC (Gibco BRL).
- pBluescript Stratagene
- pREP4 pCEP4
- pCI Promega
- p Poly Longthe et a!.. Gene 57 ( 1987), 193-201 ).
- Plasmids can also be engineered by standard molecular biology techniques (Sambrook et al., Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor ( 1989), N.Y.). It may also comprise a selection gene in order to select or to identify the iransfected cells (e.g., by complementation of a cell auxotrophy or by ant ibiotic resistance), stabilizing elements (e.g., cer sequence) or integrative elements (e.g., LTR viral sequences and transposons).
- stabilizing elements e.g., cer sequence
- integrative elements e.g., LTR viral sequences and transposons
- the term "shuttle plasmid 7'1 refers to a plasmid comprising a unique restriction site between certain homologous recombination sites and used to insert a desired nucleic acid molecule, i.e., a. nucleic acid molecule encoding a desired product, into a recombinant adenoviral vector.
- the homologous recombination sites can be, for example, Ad5 right and Ad5 left.
- the shuttle plasmid may have a tissue specific promoter which controls the expression of the desired nucleic acid molecule.
- the shuttle plasmid also contains a majority of the viral genes necessary to form viral particles. However, the shuttle plasmid does not contain al l necessary genes to form viral particles.
- promoter refers to the D A region, usually upstream of the coding sequence of a gene or operon. which binds RNA polymerase and directs the enzyme to the correct transcriptional start site.
- replication means duplication of a vector. This duplication, in the case of viruses, can occur at the level of nucleic acid, or at the level of infectious viral particle.
- replication at the nucleic acid level comprises DNA replication.
- nucleic acid replication comprises replication into plus or minus strand (or both).
- replication at the nucleic acid level includes the production of cDNA as well as the further production of RNA viral genomes.
- the essent ial feature is the generation of nucleic acid copies of the original viral vector.
- replication also includes the formation of infectious DNA or RNA viral particles. Such particles may successively infect cells in a given target tissue, thus distributing the vector through all or a significant portion of the target .tissue.
- sample refers to a biological sample obtained for the purpose of evaluation in vitro.
- the sample or patient sample may comprise any body fluid including, but not limited to, blood, serum, plasma, urine, saliva, and synovial fluid.
- a sample may also comprise any cells, tissue samples or cell components (such as cel lular membranes or cellular components) obtained from a patient including a tissue biopsy.
- the term “subject” refers to any animal (e.g., a mammal), includ ing, but not limited to, humans, non-human primates, rodents, and the like (e.g., which is to be the recipient of a particular treatment).
- the terms “subject” and “patient” are used interchangeably, unless indicated otherwise herein.
- treatment refers to obtaining a desired pharmacologic and/or physiologic effect.
- the terms are also used in the context of the administration of a "therapeutically effective amount" of an agent, e.g., a viral construct of the present invention.
- the effect may be prophylactic in terms of completely or partially preventing a particu lar outcome, disease or symptom thereof and/or may be therapeutic in terms of a partia l or complete cure for a disease and/or adverse a ffect attributable to the disease.
- any treatment of a disease or condit ion in a subject covers any treatment of a disease or condit ion in a subject, particularly in a human, and includes: (a) preventing the disease or condition from occurring in a subject which may be predisposed to the disease or condition but has not yet been diagnosed as having it; (b) inhibiting the disease or condition, i.e., arresting its development; and (c) relieving the disease or condition, e.g., causing regression of the disease or condition, e.g., to completely or partially remove symptoms of the disease or condition.
- the term is used in the context of treating a subject with cancer.
- vector refers to a polynuc leotide construct designed for transduction/transfection of one or more cell types.
- Vectors may be, for example, "cloning vectors” which are designed for isolation, propagation and replication of inserted nucleotides, "expression vectors” which are designed for expression of a nucleotide sequence in a host cell, or a “viral vector” which is designed to result in the production of a recombinant virus or virus-like particle, or "shuttle vectors,” which comprise the attributes of more than one type of vector.
- the present invention provides compositions and methods related to the generation or production of virus-displayed, semi-random peptide libraries.
- the viruses are replication competent.
- the viruses are conditionally replicative, e.g., the viruses replicate in target cells.
- libraries can be used to optimize infection of the viruses to target cells.
- adenoviruses can be used.
- Existing adenoviral vectors and systems have been described in U. S. Patent No. 7.662,795, U .S. Patent Applicat ion Publicat ion No. 2005/0245472, U.S. Patent Application Publ ication No. US 2009/0042257, and U .S. Patent Applicat ion
- the capsid shell comprises three major coat proteins— hexon, penton and fiber— and several small proteins that aid in assembly and maintenance of capsid structure.
- the nucleic acids encoding targeting peptide and random peptide sequence can be inserted into a part of the nucleic acid sequence that encodes the capsid shel l.
- the nucleic acids can be inserted into one or more of the late genes (L 1 -L5). I n particular embodiments, the nucleic acids are inserted into the sequence that encodes the fiber protein. More particularly, the nucleic acid sequences are inserted into the sequence that encodes the fiber shaft. Alternatively, insertion can take place in the region that encodes the knob domain.
- nucleic acid sequence encoding the flanking peptide sequence and the antigen targeting peptide can be inserted in the H I loop of the fiber protein. In a further embodiment, the nucleic acid sequence encoding the flanking peptide sequence and the antigen targeting peptide can be inserted in the EG loop of the fiber protein. In yet another embodiment, the nucleic acid sequence encoding the flanking peptide sequence and the antigen targeting peptide can be inserted in the IJ loop of the fiber protein.
- flanking peptide sequence and the antigen targeting peptide can also be inserted into the C- terminus of capsid protein I X, the C-terminus of Fiber protein, and the L l -loop o f hexon protein.
- a suitable insert ion point in the viral genome can be determined based on the size and sequence of the peptide cassette and antigen targeting peptide.
- the peptide cassette and antigen targeting peptide can be inserted at the same time in two or perhaps more sites, e.g., both the H I-loop and C-terminus of Fiber protein.
- the present invention is not limited to adenoviruses, as any viruses capable of being used to generate a library (e.g., replicat ion competent or condit ionally replicative) as described herein can be used including, but not limited to, herpes simplex virus (Keil et al., 143( 1 ) VET. MICROBIOL.29-36 (2010); Spear at el., 107( 1 ) J. VIROL. M ETHODS7 1 -9 (2003)), retroviruses (Nikles et al., 79(7) J. VIROL 4033-42 (2005); Buckholz et al., 16( 1 ) NAT.
- herpes simplex virus Karlpes simplex virus
- retroviruses Nekles et al., 79(7) J. VIROL 4033-42 (2005)
- Buckholz et al., 16( 1 ) NAT any viruses capable of being used to generate a library (e.g., replica
- BiOTCCHNOL 95 1 -54 ( 1998)),influenza virus, baculovirus (Grabherr et al., 10(3) CURR. GEN II Tl lER. 1 95-200 (2010); itidee et al., 10 BMC BIOTECH. 80- 1 0 1 (2010); Oker-Blom et al., 2(3) BR IEFINGS IN FUNCTIONAL G ENOMICS AND PROTEOMICS 244-53 (2003)), Newcastle disease virus, poliovirus, reovirus, vaccinia virus and vesicular virus.
- compositions and methods of the present invention relate to the use of peptide cassettes to flank an antigen targeting pept ide that is displayed on the virus.
- a library of virus-displayed antigen targeting peptides with random, flanking peptide sequences can be generated and screened for those peptide sequences that improve and/or optimize the targeting infection of the virus.
- the random peptide sequences provide an optimal environment for peptide display and encourage native folding of the viral capsid proteins.
- peptide sequences that Hank the antigen targeting peptides are used.
- a single peptide sequence at either end of the antigen targeting peptide can be used. Indeed, although the description discusses the use of
- binding it is understood that the present invention applies to the use of peptide sequences on one or both ends of the antigen targeting peptide.
- peptide cassette(s) In the generation of the virus-displayed library, randomly generated peptide cassette(s) are used. Based on the results of initial screening, particular substitutional variants can be generated and tested. For example, amino acids may be substituted based on side-chain properties. Naturally occurring residues are divided into groups based on common side-chain properties:
- Non-conservative substitutions will entail exchanging a member of one of these classes for another class.
- Conservative substitutions involve exchanging of amino acids within the same class.
- the random peptide cassettes are monomers.
- the monomer peptides can be the same or different.
- the random peptide sequences that flank the antigen targeting peptide are multimers.
- the flanking multimers can be the same or different sequences, and/or the same or different length of amino acids.
- the flanking monomers can be any one of a combination of a monomer, a dimer, a trimer, a tetramer, a pentamer, a hexamer, a septamer, an octamer, a nonamer, and the like.
- PSMA Prostate Specific Membrane Antigen
- the antigen targeting peptide is PSMA.
- PSMA is a type I I transmembrane protein found predominantly in the prostate, with minor expression of isoforms in the small intestine, brain, and tumor neovascularity. (Heston. 35 UROI.OGI-: A. 400-07 ( 1996)). Though the precise function of PSMA is not known, it is known to be a membrane bound carboxypeptidase and folate hydrolase. Id. This protein can exist in two forms, PSMA and PSM '. PSMA is the membrane bound form and PSM ' is an intracellular form which lacks the transmembrane domain at the amino terminus.
- PSMA is the predominant form in the benign prostatic cell, while PSMA expression increases and predominates with the more aggressive prostate cancer tumor grades. From a clinical point of view, PSMA has all the features necessary for consideration as a systemic target for metastatic prostate cancer. Namely, its expression increases in aggressive cancers, androgen suppression results in up regulat ion, and background expression in other tissues does not appear to be a clinically significant source of aberrant targeting. See, e.g. Gong, et al., 4 MOL. UROL. 21 7-23 (2000)).
- compositions of the present invention can be used in conjunction with peptides targeting PSMA.
- peptides that specifically target PSMA include, but are not limited to, U.S. Patent No. 7,749,968, U.S. Patent Mo. 7,666,425, U.S. Patent No. 7,476,5 13, U.S. Patent No. 7,381 ,407, U.S. Patent No. 7, 163,680, and U.S. Patent No.
- the present invent ion also relates to the use of other antigens implicated in cancer.
- the compositions and methods of the present invention can be used to generate viruses that display other tumor antigens flanked by peptide sequences that improve infection of target cancer cells.
- the type of cancer can include, but is not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia or lymphoid malignancies. More particular examples of such cancers include small intestine cancer, bladder cancer, lung cancer, thyroid cancer, uterine cancer, liver cancer, kidney cancer, breast cancer, stomach cancer, testicu lar cancer, cervical cancer, esophageal cancer, ovarian cancer, colon cancer, melanoma, prostate cancer, and the like.
- the antigen can be, but is not limited to, MAGE, MART- I /Melan-A, gp l OO, Dipeptidyl peptidase I V (DPPIV), adenosine deaminase-binding protein (ADAbp), cyclophilin b,
- Colorectal associated antigen (CRQ-001 7- 1 A/GA733, Carcinoembryonic Antigen (CEA) and its antigenic epitopes CAP- 1 and CAP-2, etv6, am i I , Prostate Specific Antigen (PSA) and its antigenic epitopes PSA- 1 , PSA-2. and PSA-3, T-cell receptor/CD3-Z chain, MAG E- fami ly of tumor antigens (e.g., MAGE-A 1 , MAG E-A2. MAGE-A3. MAG EA4. MAG E-A5.
- GAGE-family of tumor antigens e.g., GAGE-l, GAGE-2, GAGE-3, GAGE-4, GAGE-5, GAGE-6, G
- RCAS I a- fetoprotein, E-cadherin, a-catenin, 13-catenin, . ⁇ -catenin, pl20ctn, gplOOPmel I 17.
- PRAME NY-ESO-I, cdc27, adenomatous polyposis coli protein (APC), fodrin, Connexin 37, Ig-idiotype, pi 5, gp75, GM2 and GD2 gangliosides, viral products such as human papilloma virus proteins, Smad family of tumor antigens.
- Imp- 1 HA, EBV-encoded nuclear antigen (EBNA)-l, brain glycogen phosphorylase, SSX-1, SSX-2
- HOM-MEL40 acute lymphoblastic leukemia (etv6, amll, cyclophilin b), B cell lymphoma (I -idiotype), glioma (E-cadherin, a- catenin, 13-catenin, 7-catenin, pl20ctn), bladder cancer (p2lras), biliary cancer (p2lras), breast cancer (MUC family, HER2/neu, c-erbB-2), cervical carcinoma (p53, p21ras), colon carcinoma (p2lras, HER2/neu, c-erbB-2, MUC family), colorectal cancer (Colorectal associated antigen'(CRC)-0017-l A/GA733, APC), choriocarcinoma (CEA), epithelial cell cancer (cyclophilin b), gastric cancer
- p2lras myeloma
- MUC family myeloma
- HER2/neu, c-erbB-2 non-small cell lung carcinoma
- nasopharyngeal cancer Imp- 1, EB A-I
- ovarian cancer MUC family, WER2/neu, c-erbB-2
- prostate cancer Prostate Specific Antigen (PSA) and its antigenic epitopes PSA-1, PSA-2, and PSA-3, HER2/neu, c-erbB-2, ga733 glycoprotein
- renal cancer HER2/neu, c-erbB-2
- squamous cell cancers of the cervix and esophagus viral products such as human papilloma virus proteins
- testicular cancer NY-ESO-I
- T cell leukemia HTLV-1 epitopes
- the tumor antigen can be selected from the group consisting of PSMA, VEGFR, PSCA, EPCam, CD227, EGFR, Alpha-V-beta-3 Integrin, AFP, CDHOb, CD30, CD33, CD52, CD56, CD66e, CA 125, GD3 ganglioside, CD4, CD20, CD22, CD80, and CD 152.
- the antigen targeting peptide specifically binds an antigen expressed on the surface of cancer cells.
- the antigen can be selected from the group consisting of PSMA, VEGFR, PSCA, EPCam, CD227, EGFR, and Alpha-V-beta-3 Integrin.
- the present invention can also be used with other antigen targeting peptides to optimize targeting infection of target cells.
- Target cells can include, but are not limited to, bacterial cells, fungal cells, diseased cells, or generally any foreign cells. Indeed, the present invention can be used to target viral infection using an antigen targeting peptide specific for the target cell of choice.
- a pharmaceut ical composition of the present invention may comprise an effective amount of at least one viral construct.
- an effective amount of a recombinant adenoviral vector comprising a nucleic acid sequence encoding the peptide sequence MAEWQPDTAH H WALTLPDP inserted into the Hl-loop of adenovirus fiber protein can be administered to a subject or patient suffering from prostate cancer.
- the term "effective” means adequate to accomplish a desired, expected, or intended result. More particularly, the terms "effective amount" and
- therapeutically effective amount are used interchangeably and refer to an amount of at least one viral construct, perhaps in further combination with another therapeutic agent, necessary to provide the desired treatment or therapeutic effect, e.g., an amount that is effective to prevent, alleviate, treat or ameliorate symptoms of a disease or prolong the survival of the subject being treated.
- the pharmaceutical compositions of the present invention are administered in a therapeutically effective amount to treat a subject suffering from cancer.
- the exact amount required will vary from subject to subject, depending on age, general condit ion of the subject, the severity o f the condition being treated, the particu lar compound and/or composit ion administered, and the like.
- An appropriate "therapeutically effective amount” in any individual case can be determined by one of ordinary skill in the art by reference to the pertinent texts and literature and/or by using routine experimentation.
- compositions of the present invention are in biologically compatible forms suitable for administration in vivo to subjects.
- the pharmaceutical compositions can further comprise a pharmaceutically acceptable carrier.
- “pharmaceutically acceptable” means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly, in humans.
- carrier refers to a diluent, adjuvant, excipient, or vehicle with which the at least one viral construct is administered.
- Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, including but not limited to peanut oil, soybean oil, mineral oil, sesame oil and the like. Water may be a carrier when the pharmaceutical composition is administered orally. Saline and aqueous dextrose may be carriers when the pharmaceutical composition is administered intravenously.
- Saline solutions and aqueous dextrose and glycerol solutions may be employed as liquid carriers for injectable solut ions.
- suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried slim milk, glycerol, propylene, glycol, water, ethanol and the like.
- the pharmaceut ical composition may also contain minor amounts of wetting or emulsifying agents, or pH buffering agents.
- the pharmaceut ical compositions of the present invent ion can take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained-release formulat ions and the like.
- the composit ion can be formulated as a suppository, with traditional binders and carriers such as triglycerides.
- Oral formu lation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc.
- a pharmaceutical composition comprises an effective amount of at least one viral construct together with a suitable amount of a pharmaceutically acceptable carrier so as to provide the form for proper administration to the patient.
- the therapies can be separately formulated and administered according to the present invention. The formulation should suit the mode of administration.
- adenoviral Delivery o f the viral constructs of the present invention (e.g., adenoviral) can be accomplished by either site-speci fic injection (local administration) or intravenously (systemic administration).
- Site-specific injections of adenoviral vectors may include, for example, inject ions into the portal vein of the liver as well as intraperitoneal, intrapleural, intrathecal, intra-arterial, intra-tumor inject ions or topical application. These methods are easily accommodated in treatments using adenoviral vectors.
- compositions of the present invention may be administered by any other particular route of administration including, but not limited to oral, parenteral, subcutaneous, intramuscular, intravenous, intrarticular, intrabronchial, intraabdominal, intracapsular, intracartilaginous, intracavitary, intracelial, intracelebellar, intracerebroventricular, intracolic, intracervical, intragastric, intrahepat ic, intramyocardial, intraosteal. intraosseous, intrapelvic, intrapericardiac, intraperitoneal, intrapleural, intraprostatic, intrapulmonary.
- adenoviral vectors may be delivered to the target cell in a variety of ways, including, but not limited to, liposomes, general transfection methods that are well known in the art (such as calcium phosphate precipitation or electroporation), direct injection, and intravenous infusion.
- the means of delivery will depend in large part on the particular adenoviral vector (including its form) as well as the type and location of the target cells (i.e., whether the cells are to be transfected or transformed in vitro or in vivo).
- adenovirus vectors may be administered in an appropriate
- an adenoviral vector can be administered.
- the adenoviral vector/construct may be administered one or more limes, depending upon the intended use and the immune response potential of the host, and may also be administered as mult iple, simultaneous injections.
- I f an immune response is undesirable, the immune response may be diminished by employing a variety of immunosuppressants, so as to permit repetitive administration, without a strong immune response.
- an amount to be administered is based on standard knowledge about that particular virus (which is readily obtainable from, for example, published literature) and can be determined empirically.
- the adenoviral vector/construct, the polynuc leotide and expression vector or the viral particle of the present invention may be delivered in vivo to the human or animal organism by specific del ivery means adapted to the pathology to be treated.
- a balloon catheter or a stent coated with the adenoviral vector/construct, the expression vector carrying the polynucleotide or the viral particle may be employed to efficient ly reach the cardiovascular system. It is also possible to deliver the therapeutic agents by direct administration, e.g., intravenously, in an accessible tumor, in the lungs by aerosolization, and the like.
- eukaryotic host cells that have been engineered ex vivo to contain the adenoviral vector, the expression vector carrying the polynucleotide or the viral particle according to the invention.
- Methods for introducing such elements into a eukaryotic cell are well known to those skilled in the art and include microinjection of minute amounts of DNA into the nucleus of a cell, transfection with calcium phosphate,
- Administration of the above-described methods may also include repeat doses or courses of target-cell specific adenovirus depending, inter alia, upon the individual's response and the characteristics of the individual's disease. Repeat doses may be undertaken immediately following the first course of treatment (i.e., within one day), or after an interval of days, weeks or months to achieve and/or maintain suppression of tumor growth.
- an effective amount of an adenovirus vector is administered, i.e., amounts sufficient to achieve the desired result, based on general empirical knowledge of a population's response to such amounts.
- Some individuals are refractory to these treatments, and it is understood that the methods encompass administration to these individuals.
- the amount to be given depends, inter alia, on the stage of the cancer, the condition of the individual, the extent of disease, the route of administration, how many doses will be administered, and the desired objective.
- the methods of the present invention can be applied to the treatment of prostate cancer in male subjects at any stage of the cancer, although certain treatment methods are more preferred for particular cancer stages.
- Prostate cancer is commonly evaluated according to a scale divided into four lettered stages: A, B, C and D. Tumors in stage A are
- stage Al designates tumors confined to a relatively small area and composed of well-differentiated tissue, while stage A2 tumors are more diffuse and less well differentiated.
- Stage B tumors are large enough to be felt during a rectal examination, while stage C prostate cancers have spread throughout the gland and typically have pushed past the borders of the prostate into surrounding structures.
- Stage D tumors have metastasized, e.g., to lymph nodes, bone, or other organs.
- tumors can be staged by the TNM staging system, in which tumors are ranked on a scale of progressively worsening disease from T l a to T4b (e.g., Tic tumors are non-palpable and non-visible that were detected by elevated blood levels of prostate specific antigen).
- the methods of the present invention are useful in the treatment of any stage of prostate cancer.
- methods involving procedures for removal or destruction of prostatic tumor tissue preferably are employed with non-metastasized cancers.
- radical prostatectomy can be used with stage A, B and some stage C tumors (i.e., where the tumor growth has not extended considerably beyond the borders of the prostate gland) as well as stage T i c tumors.
- Radiation therapy e.g., external or interstitial
- stage A, B or C tumors as well as T ic tumors.
- the size of the prostate can be determined by methods known in the art, for example, rectal examination, transrectal ultrasonography or magnetic resonance imaging ( M RI).
- the size or extent of the prostate tumor (and metastatic tumors, if any) can be assessed by known methods including a prostate-specific antigen blood test, bone scanning, X-rays, skeletal survey, intravenous pyelography, CAT-scan, M RI, physical examination, biopsy, and the like.
- the tumor can also be staged during surgery (e.g., the prostate gland can be examined during surgery and/or a biopsy can be taken and examined).
- clinical staging and/or surgical staging may be used to evaluate the extent of disease.
- PSA prostate-specific antigen
- the PSA blood test is a reasonably specific, sensitive, rapid, and inexpensive tool for screening for prostate cancer.
- a blood PSA level above 4 ng ml is considered to be suggestive of the presence of prostate cancer, with levels above 10 ng/ml being particularly indicative of cancer.
- a pretreatment level of PSA can be established and the efficacy of the treatment assessed by monitoring periodically the PSA level in the subject's blood, wherein decreased PSA levels are used as an indicator of the efficacy of the treatment.
- the PSA nadir i.e., the point at which PSA levels do not decrease further even upon further treatment with a viral construct
- the PSA nadir can be used as the indicator point for init iation of a second therapy, for example for perlormance of a procedure that removes or destroys prostatic tumor tissue (including rad ical prostatectomy, cryosurgery and or radiation therapy). It is expected that the PSA nad ir will be reached sooner using a viral construct, as compared to treatments which do not include using a viral construct of the present invention.
- plasma concentrations of sex hormones can be monitored to assess the efficacy of the drug therapy.
- Concentrations of hormones such as testosterone, dihydrotestosterone, dehydroepiandrosterone (DH EA), DH EA-sulfate, androst- 5- ⁇ -3 ⁇ , 1 7-diol, and the estrogen l 7 -estradiol can all be measured by methods known to the skilled artisan.
- DH EA dehydroepiandrosterone
- DH EA-sulfate DH EA-sulfate
- rost- 5- ⁇ -3 ⁇ 1 7-diol
- the estrogen l 7 -estradiol can all be measured by methods known to the skilled artisan.
- decreased levels of testosterone and dihydrotestosterone can be used as indicators of treatment efficacy.
- compositions and methods of the invention can be administered in conjunct ion with other known treatments for cancer includ ing, but not limited to, mechan ical removal of cancerous cells (e.g., surgical removal of a tumor), and administration of chemotherapeutic agents.
- mechan ical removal of cancerous cells e.g., surgical removal of a tumor
- chemotherapeutic agents used to treat cancer which act to kill cancer cells and/or slow their growth through other mechanisms.
- the administrations of such additional treatments and/or agents are intended to be included in the methods of the present invention.
- antimetabolites such as folate analogs (e.g., methotrexate), pur
- daunomycin DaunoXome ( liposomal daunorubic in), doxorubicin, Doxil (liposomal- doxorubicin), epirubicin, idarubicin. mitoxantione. and mitomycin C), epipodophylbloxins (e.g., etoposide and teniposide), microtuble agents (e.g., docetaxel, paclitaxel, vinblastine, vincristine, and vinorelbine), camptothecin analogs (e.g., irinotecan and topotecan), enzymes (e.g., asparaginase), and monoclonal antibodies (e.g., alemtuzamab, gemtuzumab ozogamicin, ibritumomab tiuxetan, nofetumomab, rituximab, tositumomab, and trastuzumab
- One aspect of the invention relates to a method for treating prostate cancer in a subject in need of such treatment, comprising administering to the subject a viral construct/particle (e.g., adenoviral) of the present invention, and performing on the subject at least one procedure that removes or destroys prostatic tumor tissue, such as a radical prostatectomy, cryosurgery, external radiation therapy (e.g., X-ray therapy) or interstitial radiation therapy (e.g., implantation of a radioactive seed).
- a viral construct/particle e.g., adenoviral
- the adenoviral construct may be administered to the subject prior to or subsequent to performing the procedure that removes or destroys pro static tumor tissue.
- administration of an viral construct is preferably for a period sufficient to cause the prostate or prostatic tumor tissue to shrink in size prior to performing the procedure that removes or destroys prostatic tumor tissue.
- suitable period for preadministration of a viral construct typically is between about one day and about one year, more preferably between about three days and about six months.
- this treatment method can further invo lve administering an antiandrogen to the subject in combination with the viral construct.
- this treatment method can further involve administering one or more inhibitors of sex steroid biosynthesis to the subject in combination with the viral construct (optional ly in further combinat ion with an antiandrogen) prior to or subsequent to performing the procedure that removes or destroys prostatic tumor tissue.
- the viral construct of the present invention may be administered in conjunction with an LH RH agonist, as described in U.S. Patent No.
- the viral constructs and therapeutic agents of the present inventnion may be combined with other agents including, but not limited to, immunomodulatory agents, anti-inflammatory agents (e.g., adrenocorticoids. corticosteroids (e.g., beclomethasone.
- immunomodulatory agents e.g., adrenocorticoids.
- corticosteroids e.g., beclomethasone.
- budesonide flunisolide, flut icasone, triamcinolone, methlyprednisolone, prednisolone, prednisone, hydrocortisone), glucocorticoids, steroids, non-sterioda l ant i-inflammatory drugs (e.g., aspirin, ibuprofen, diclofenac, and COX-2 inhibitors), and leukotreine antagonists (e.g., montelukast, methyl xanthines, zafirlukast, and zileuton), beta2-agonists (e.g., albuterol, biterol, fenoterol, isoetharie, metaproterenol, pirbuterol, salbutamol, terbutalin formoterol, salmeterol, and salbutamol lerbutaline), anticholinergic agents (e.g., ipratropium bromide and oxitropium bromide), s
- Cre-recombinase activity was authenticated by Cre Stop light assay.
- PC-3- PSMA cells were provided by Warren Heston (Cleveland Clinic) and authenticated for PSMA expression by Western blot and ELI SA.
- DPL-S 1 1 cells are generated as described. See Hoti et al., 17 CANCER GENE THER. 1 - 13 (2010).
- PC-3, 293, and LNCaP cells were obtained from ATCC and were not further authenticated.
- Fiber-Shuttle Vector Generat ion of fiber-shuttle plasmid for the Coxsackie and Adenovirus Receptor (CAR) binding ablation by deletion of amino acids T ⁇ AYT ⁇ in the FG loop has been described previously. See Lupoid et al., 35 NUCLEIC ACIDS RES. e l 38 (2007); and Roelvink el al., 286 SCIENCE 1568-7 1 ( 1999). An add itional site mutation
- the oligonucleotide library template 5'-Biotin-TGGAGTTGTGTCTCCGGAMNNMNN MNNC AGTGTTGCCCAGTGGTGTGCGGTATCAGGCTGCCA NN MNNMNNGAATTCGGA TTCCTGTGTACCGCT (SEQ I D NO:7) is the reverse complement of the coding region, where N refers to all possible nucleotides ( A,G,C, & T) and M refers to only C or A.
- the extension primer LibOO l (5 '-Biotin-AGCGGTACAGGAATCC) (SEQ I D NO:8) was applied to create double-stranded DNA product.
- the template was annealed with the extension primer and extended with klenow fragment DNA polymerase (New England Biolabs, Beverly, MA).
- the products were then restriction digested with BspEI and EcoRI .
- the unwanted digested ends were purified away by streptavidin magnetic beads (New England Biolabs).
- Double-stranded DNA insert was ligated into the Hl-loop of CAR-binding ablated fiber-shuttle plasmid in large scale to maintain library diversity.
- the floxed Fiber-coding region was PGR rescued into the RPuc-Rescue shuttle vector (Lupoid et al., 35 NUCLKIC ACIDS RKS. E 1 38 (2007)), and 10 to 30 individual clones for each round were sequenced. The remaining library was amplified on a large scale and applied as the shuttle vector for the next round.
- Subcutaneous LNCaP tumors in male athymic nu/nu mice were grown to ⁇ 0.5 cm 3 in dimension, and 10" in fect ious units (I U) of Ad5-PSE-PBN-PS
- a library was injected via tail vein.
- a lter 3 weeks, the lumor, kidney, lung, spleen, and liver were collected, total DNA were extracted, and the Fiber region was PCR amplified and subcloned as described earlier. Thirty clones were randomly sequenced.
- Bioluminescence images were observed with an in vivo imaging system (I VI S; Xenogen) and analyzed using Live I mage software (Xenogen).
- Virus Purification Recombinant adenovirus was purified by commercial adenovirus purification kit (Adenopure; Puresyn) or iodixanol discontinuous density gradient ultracen- trifugation and size exclusion column chromatography. Peng et al., 354 ANAL. BlOCl ll-M. 140-47 (2006). Virus titer was determined by Adeno-XTM Rapid Titer Kit ( BD Biosciences) or GFP using DPL-S I I cells expressing an artificial ant i-Fiber single-chain antibody receptor. See Hoti et al., 1 7 CANCI :R G I-IN I- TI II:K. I - 1 3 (2010). Example 1 : Generating an Adenovirus-Displayed, Semi-Random Peptide Library.
- a phage-derived PSMA-targeting peptide VVQPDTAHHWATL (SEQ ID NO: 9) (Aggarwal et al., 66 CANCER Ri-s. 91 7 1 -77 (2006)), flanked by 3 random amino acid cassettes, was first subcloned into the I l l-loop of an Ad5 Fiber-shuttle vector (FIG. 1 A).
- the host Fiber gene was detargeted from CA -mediated infection through FG-loop T 489 AYT 4l) : deletion and DE-loop Y 47 7A mutation.
- the resulting adenovirus library was biopanned against PSMA-positive cell lines and tumors to isolate those adenoviruses that preferentially utilize PSMA as an alternative receptor (Table I ).
- the initial adenovirus library was incubated with PSMA- expressing cells for 1 hour at a density of 1 IU per cell; the cells were then washed and incubated for 3 days.
- Fiber gene cassettes from successfully infectious round I virus were rescued by PCR ampli ficat ion and subcloning, via Cre-recombinase-mediated cassette exchange, to generate a second-round Fiber-shuttle library and finally a second-round adenovirus-displayed peptide library.
- the fourth-round library was generated as a conditionally replicating virus library (Ad5-PSE-PBN-E l A-PSMA-Lib), which utilizes an androgen receptor-responsive cassette to drive EI A gene expression and viral replication.
- This replication-competent library was applied to a fina l and stringent in vivo select ion, by intravenous injection, and allowed 3 weeks for viral infection, amplification, and spread within the LNCaP tumor.
- the tumor was harvested, and peptide cassettes from the infectious viruses were rescued by PCR amplification and Cre-recombinase subcloning.
- Reporter adenovirus displaying the in vivo selected peptide Saupw- 1 or the original nonflanked peptide WQPDTAH H WATL (SEQ I D NO:9) were evaluated for PSMA- mediated infection on 3 cell lines expressing varying levels of PSMA (FIG. 5).
- Infection rate of the selected virus Ad5Track-Luc-Saupw- l directly correlated with PSMA expression levels in these cells, whereas the virus-displayed parental peptide Ad5Track-Luc-Saurabh showed poor infection efficiency in al l 3 cell lines (FIG . 3A).
- the abi l ity o f the selected virus to infect tumors in vivo after intravenous inject ion was then evaluated.
- Adenovirus biodistribution is complex and a ffected by many factors. I n murine tissues, adenoviral biodistribution is independent of CAR binding.
- a series of pioneering articles recent ly revealed that hepatic infection is mediated by interactions between the viral hexon protein and blood factor X. See Kalyuzhniy et al., 105 PROC. NATL. ACAD. SCI. U. S.A. 5483-88 (2008); VIGANT ET AL., 16 Mol. Ther.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Virology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Crystallography & Structural Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The present invention relates to the field of viral gene therapy. More specifically, the present invention provides compositions and methods for retargeting virus constructs. In one embodiment, the present invention provides an adenoviral construct comprising a nucleic acid encoding the peptide sequence MAE-X-PDP, wherein X is an antigen targeting peptide. In a more specific embodiment, an adenoviral construct comprises a nucleic acid sequence encoding the peptide sequence MAEWQPDTAHHWALTLPDP inserted into the HI-loop of adenovirus fiber protein. In yet another embodiment, the present invention provides a method for optimizing adenoviral infection of target cells comprising the steps of (a) generating a peptide-display adenovirus library, wherein the displayed peptide is a peptide that specifically binds an antigen expressed on the surface of a target cell, and wherein the displayed peptide is flanked by random peptide sequences; and (b) screening the peptide-display adenovirus library against the target cells.
Description
COM POSITIONS AND iMETHODS FOR RETARGETING VIRUS CONSTRUCTS
CROSS-REFERENCE TO RELATED APPLICATIONS This app lication claims the benefit of U.S. Provisional Application No. 61 /359,449, filed June 29, 2010, which is incorporated herein by reference in its entirety.
STATEMENT OF GOVERNM ENTAL INTEREST
This invention was made with U.S. government support under grant no.
I 01 CA 121 1 53-01 A2. The U.S. government has certain rights in the invention.
FI ELD OF THE INVENTION
The present invention relates to the field of viral gene therapy. More specifically, the present invention provides compositions and methods for retargeting virus constructs.
INCORPORATION-BY-REFERENCE OF MATERIAL SUBM ITTED
ELECTRONICALLY
This application contains a sequence listing. It has been submitted electronically via EFS-Web as an ASCI I text file entitled "P I 1 155-02_Sequence_Listing_ST25.txt." The sequence listing is 13. 1 ki lobytes in size, and was created on June 27, 201 1 . It is hereby incorporated by re ference in its ent irety.
BACKGROUN D OF TH E I N VENTION
Cancer- fighting adenoviral vectors are now clinically available for intratumoral injection. However, the translation of this approach to the systemic treatment of metastatic tumors requires solutions to multiple obstacles including broad viral tropism, liver sequestration, hepatic toxicity, low-level coxsackie and adenovirus receptor (CAR) expression in some tumor types, and host immunity. See Barry et al., I I CURR. OWN. MOL. Ti ii-R . 41 1 -20 (2009); and Waehler et al., 8 NAT. REV. GENET. 573-87 (2007). Some of these problems have been overcome by genetically targeting the therapeutic effect through tissue- specific promoters or oncolytic mechanisms. For example, the first tissue-speci fic lytic adenovirus was developed for the treatment of prostate cancer (PCa) by limiting viral replication to cells containing activated androgen receptor. Rodriguez et al., 57 CANCER RES. 2559-63 ( 1 97). These prostate-selective lytic vectors have been evaluated in clinical trials both as direct tumor injected agents and as systemically administered virus for castration- resistant metastatic PCa. Lupoid et al., 3 CANCER THER. 267-84 (2005). Although the therapeutic effect was lim ited to prostatic cells, the efficacy as a systemic therapy was hampered by viral sequestration and clearance. This reflects the loss of more than 90% of intravenously administered adenovirus through liver sequestration. Shashkova et al., 1 7
I
OL. THER. 2121-30 (2009). Next generation cancer gene therapy vectors seek to enhance efficacy through capsid modifications designed to limit viral clearance and/or improve tumor infection through alternative receptors.
SUMMARY OF THE INVENTION
The present invention is based, in part, on the discovery that adenovirus-displayed, semi-random peptide libraries, in the form of Hanking cassettes, can be applied to rescue the targeting ability of phage-derived peptides that were previously ineffective in such a complex environment. The result is a genetically modified adenovirus that successfully infects prostatic cells and tumors through PSMA. This approach can be applied to develop targeted agents for prostate cancer, or other cancers, not only in adenovirus but also in other experimental therapeutic platforms.
Accordingly, in one aspect, the present invention relates to the field of viral gene therapy. More specifically, the present invention provides compositions and methods for retargeting virus constructs. In one embodiment, the present invention provides an adenoviral construct comprising a nucleic acid encoding the peptide sequence MAE-X-PDP, wherein X is an antigen targeting peptide. In a specific embodiment, the antigen targeting peptide is a tumor antigen targeting peptide. The tumor antigen can be selected from the group consisting of PSMA, VEGFR, PSCA, EPCam, CD227, EGFR, Alpha- V-beta-3 Integrin, AFP, CD 140b, CD30, CD33, CD52, CD56, CD66e, CA 125, GD3 ganglioside, CD4, CD20, CD22, CD80, and CD 152. In a specific embodiment, the antigen targeting peptide specifically binds an antigen expressed on the surface of cancer cells. In another
embodiment, the antigen can be selected from the group consisting of PSMA, VEGFR.
PSCA. EPCam, CD227, EGFR, and Alpha- V-beta-3 Integrin.
In yel another embodiment, the antigen targeting peptide specifically binds prostate specific membrane antigen (PSMA). In a further embodiment, X comprises SEQ ID NO:9. The present invention also provides an adenoviral construct comprising a nucleic acid sequence encoding the peptide sequence MAE-X-PDP, wherein X is a peptide that specifically binds PSMA. In one embodiment, X comprises SEQ ID NO:9. In another embodiment, an adenoviral construct comprises a nucleic acid sequence encoding the peptide sequence of SEQ ID NO: 10.
In the adenoviral constructs of the present invention, the peptide sequence is inserted into the amino acid sequence encoding adenovirus fiber protein. In a specific embodiment, the peptide sequence is inserted into the Hl-loop of adenovirus fiber protein. In an alternative embodiment, the peptide sequence is inserted into the EG-loop of adenovirus fiber protein.
In another embodiment, the peptide sequence is inserted into the IJ-loop of adenovirus fiber protein.
In additional embodiments, the peptide sequence can be inserted into the C-terminus of capsid protein IX, the C-terminus of Fiber protein, and the L l -loop of hexon protein. Furthermore, the peptide sequence can be inserted at two or more appropriate sites, e.g., both the H I -loop and C-terminus of Fiber protein.
Furthermore, the adenoviral constructs of the present invention can be modified to ablate interaction with the natural receptor coxsackie and adenovirus receptor (CAR). In specific embodiments, the mod ification comprises one or more deletions in the nucleic acid sequence encoding adenovirus fiber protein.
In another embodiment, the present invention provides an adenoviral construct comprising a nucleic acid encoding a tumor antigen targeting peptide inserted into the nucleic acid sequence encoding the capsid fiber protein, wherein a nucleic acid sequence encoding the trimer peptide M AE is located upstream of the nucleic acid encoding a tumor antigen targeting peptide and a nucleic acid sequence encoding the trimer peptide PDP is located downstream of the nucleic acid encoding a tumor antigen targeting peptide.
In yet another embodiment, an adenoviral construct comprises a nucleic acid sequence encoding the peptide sequence MAEWQPDTAHHWALTLPDP inserted into the H l-loop of adenovirus fiber protein. The present invention further provides pharmaceutical
compositions comprises any of the adenoviral constructs described herein. In another aspect, the present invention relates to the treatment of cancer. In one embodiment, a method for treating cancer comprises administering a therapeutical ly effective amount of the adenoviral construct of the present invention.
The present invention also provides methods for optimizing adenoviral infection of target cells comprising the steps of (a) generating a peptide-d isplay adenovirus library, wherein the displayed peptide is a peptide that specifical ly binds an antigen expressed on the surface of a target cell, and wherein the displayed peptide is flanked by random peptide sequences; and (b) screening the peptide-display adenovirus library against the target cells.
In another embodiment, a method comprises (a) generating a peptide-display virus library, wherein the displayed peptide is a peptide that specifically binds an antigen expressed on the surface of a target cell, and wherein the displayed peptide is flanked by random peptide sequences; and (b) screening the peptide-display virus library against the target cells.
In yet another embodiment, the target cell is a cancer cell. In particular embodiments, the virus can be selected from the group consisting of adenovirus, herpes simplex virus,
in fluenza virus, Newcastle disease virus, poliovi us, reovirus, vaccinia virus and vesicular virus. I n a specific embodiment, the virus is a retrovirus.
In certain embodiments, one or both of the flanking random peptide sequences are selected from the group consisting of monomer dimer, trimer, tetramer, pentamer, hexamer, septamer, octamer, and a nonamer. In a specific embodiment, the flanking random peptide sequences are multimers. In another embodiment, the flanking random peptide sequences are trimers. In other embodiments, a single peptide sequence at either end of the antigen targeting peptide can be used.
BRI EF DESCRI PTION OF THE FIGURES .
FIG. 1 is a schemat ic illustration ofa semi-random Fiber-peptide library. I n FIG. I A, the Fiber library, a preselected PSMA-targeting peptide, WQPDTAH H WATL, was c loned into the H I-loop of fiber knob and flanked by 2 random trimer peptide cassettes providing a potential d iversity o f 64 million different peptide orientations. The Fiber gene was further modified by
and Y477A to ablate interact ion with the natural receptor, CAR. The entire Fiber gene region is flanked by noncompatible unidirect ional lox sites (green rectangle) for site-directed cassette exchange. FIG. 1 B shows the generation of the adenoviral library. A pseudotyped acceptor virus, lacking any fiber-coding region, was used to infect 293cre57 cells transfected with fiber-shuttle library cassettes. Cre-recombinase site specifically transferred the modified Fiber gene into the infected viral genome, resulting in amplification and packaging of the retargeted virus.
FIG. 2 lists the library peptide sequences of randomly selected clones from each round.
FIG. 3 presents the results of PSMA-mediated adenoviral infection in cell and tumor models. I n FIG. 2A, PS A-targeted infection, LNCaP, PC-3-PS A (+), and PC-3-PS A (-) cells were infected with Ad5Track-Luc-Saupw- l (selected virus) or Ad5Track-Luc- Saurabh (parental virus), OI = 1 . Virus infect ion was quantified by firefly luciferase activity (relative light units, R LU, per mg protein). Columns, averages (n = 3). Bars, SE. In FIG. 2B, infect ion is mediated by PSM A-binding peptide. LNCaP cells were preincubated with serial ly diluted PSMA-binding peptide or an unrelated control peptide for 30 minutes. followed by infection with Ad5Track-Luc-Saupw- 1 or Ad5Track-Luc-WtFiber. Infection was quantified by luciferase activity, relative to non-inhibited infection. Bars represent mean ± SE infection of 3 replicates. FIG. 2C shows the results of adenoviral infection following systemic injection. Mice bearing LNCaP tumors were intravenously injected with Ad5Track- Luc-Saupw- 1 or Ad5Track-Luc-WtFiber ( I * 109 IU). After 4 days, viral infection was
quant ified by c.x vivo luciferase activity of tissue lysates. Columns, averages (n = 3). Bars, SE. FIG. 3D shows relative infection results, specifically, tumor to tissue luciferase ratios for each virus 4 days after virus administration. Statistical evaluation: *. P < 0.05. **, P < 0.01 , ***, P < 0.001 (Student's / test).
FIG. 4 shows luminescent imaging of viral infection and biodistribution.
Subcutaneous LNCaP tumors were prepared in nude mice. When the tumors reached approximately 0.8 cm3 in dimension, 109 IU per mouse of (A) Ad5Track-Luc-WtFiber, (B) Ad5Track-Luc-Saupw- l, or (C) PBS was administered by tail-vein injection into mice. Three days after virus injection, mice were anesthetized and imaged.
FIG. 5 shows PSMA expression models and wild type viral infection. LNCaP, PC-3-
PSMA (+) and PC-3-PSMA(-) monolayers (96 well plate) were infected with Ad5Track-Luc- WtFiber (MOI = I ). After about one hour, infectious media was replaced with complete medium. Luciferase activity was quantified 48 h post-infection. For western blotting, LNCaP, PC-3-PSMA (+) and PC-3-PSMA(-) cells were collected and washed twice with PBS and incubated on ice for 10 min in lysis buffer. The cell lysates were clarified by centrifugation and the supernatant protein concentrations were measured. Protein extracts were analyzed by western blotting with anti-PSM A antibody, 7E I I , ( 1 : 10000 dilution), and anti^-actin antibody (loading control). Immunoreactivity was determined by using ECL western blotting detection system.
DETAILED DESCRIPTION OF THE INVENTION
It is understood that the present invention is not limited to the particular methods and components, etc.. described herein, as these may vary. It is also to be understood that the terminology used herein is used tor the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention. It must be noted that as used herein and in the appended claims, the singular forms "a," "an," and "the" include the plural reference unless the context clearly dictates otherwise. Thus, for example, a reference to a "protein" is a reference to one or more proteins, and includes equivalents thereof known to those skilled in the art and so forth.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Specific methods, devices, and materials are described, although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention.
All publications cited herein are hereby incorporated by reference including all journal articles, books, manuals, published patent applications, and issued patents. I n addition, the meaning of certain terms and phrases employed in the specification, examples, and appended claims are provided. The definitions are not meant to be limiting in nature and serve to provide a clearer understanding of certain aspects of the present invention.
I. Definitions
The term "adenovirus" refers to the virus itself or derival ives thereof. The term covers all serotypes and subtypes and both naturally occurring and recombinant forms, except where otherwise indicated. Thus, the term "adenovirus" or "adenoviral particle" is used to include any and all viruses that can be categorized as an adenovirus, including any adenovirus that infects a human or an animal, including all groups, subgroups, and serotypes. There are at least 5 1 serotypes of adenovirus that classi fied into several subgroups. For example, subgroup A includes adenovirus serotypes 12, 18, and 3 1 . Subgroup C includes adenovirus serotypes 1 , 2, 5, and 6. Subgroup D includes adenovirus serotype 8, 9, 10, 1 3, 1 5, 17, 19, 20, 22-30, 32, 33, 36-39, and 42-49. Subgroup E includes adenovirus serotype 4.
Subgroup F includes adenovirus serotypes 40 and 41 . These latter two serotypes have a long and a short Fiber protein. Thus, as used herein an "adenovirus" or "adenovirus particle" may include a packaged vector or genome. Depending upon the context, the term "adenovirus" can also include adenoviral vectors.
An "adenovirus vector," "adenoviral vector," or "adenovirus construct" is a term well understood in the art and generally comprises a polynucleotide comprising all or a portion of an adenovirus genome. Thus, an "adenovirus vector," "adenoviral vector," or "adenovirus construct" refers to any of several forms including, but not limited to, DNA, DNA encapsulated in an adenovirus coat, DNA packaged in another viral or viral-like form (such as herpes simplex, and AAV), DNA encapsulated in liposomes, DNA complexed with polylysine, complexed with synthetic polycationic molecules, conjugated with transferrin, and complexed with compounds such as PEG to immunological ly "mask" the molecule and/or increase half-life, and conjugated to a nonviral protein.
In particular embodiments, the adenoviral vector typically contains most of the adenoviral genome. The adenoviral vector may also contain a bacterial origin of replication. In other embodiments, portions of the wild-type adenoviral genome may be deleted to permit insertion of desired products and the packaging of recombinant adenoviral vectors containing the desired genes. In certain embodiments, adenovirus vectors are replication-competent in a target cell. I n other embodiments, adenovirus constructs are conditional ly replicative in a
target cell. Indeed, conditionally replicating adenoviruses (CRAds) represent a promising modality for the treatment of neoplastic diseases, including prostate cancer.
Recombinant adenoviruses are currently used for a variety of purposes, including gene transfer in vitro, vaccination in vivo, and gene therapy. Several features of adenovirus biology have made such viruses the vectors of choice for certain of these applications. For example, adenoviruses transfer genes to a broad spectrum of cel l types, and gene transfer is not dependent on active cell division. Additionally, high titers of virus and high levels of transgene expression can generally be obtained.
Decades of study of adenovirus biology have resu lted in a detailed picture of the viral life cycle and the functions o f the majority of viral proteins. The genome of the most commonly used human adenovirus (serotype 5) consists of a linear, 36 kb, double-stranded DNA molecule. Both strands are transcribed and nearly all transcripts are heavily spliced. Viral transcript ion units are conventionally referred to as early (El, E2, E3 and E4) and late, depending on their temporal expression relative to the onset of viral DNA replication. The high density and complexity o f the viral transcription units poses problems for recombinant manipulation, which is therefore usually restricted to specific regions, particularly El, E2A, E3, and E4. In most recombinant vectors, transgenes are introduced in place of El or E3, the former supplied exogenously. The El deletion renders the viruses defective for replication and incapable of producing infectious viral particles in target cells; the E3 region encodes proteins involved in evading host immunity, and is dispensable tor viral production per se.
Two approaches have traditionally been used to generate recombinant adenoviruses. The first involves d irect ligat ion of DN A fragments of the adenoviral genome to restriction endonuclease fragments containing a transgene. The low efficiency of large fragment ligations and the scarcity o f unique restrict ion sites have made this approach technical ly challenging. The second and more widely used method involves homologous recombination in mammalian cells capable of complementing defective adenoviruses ("packaging lines"). Homologous recombination results in a defective adenovirus which can replicate in the packaging line (e.g., 293 or 91 1 cells) which supplies the missing gene products (e.g., El). The desired recombinants are identified by screening individual plaques generated in a lawn of packaging cells. The low efficiency of homologous recombination, the need for repeated rounds of plaque purification, and the long times required for completion of the viral production process have hampered more widespread use of adenoviral vector technology.
As used herein, the term "administration" refers to the act of giving a drug, prodrug, or other agent, or therapeutic treatment (e.g., compositions of the present invention) to a
subject (e.g., a subject or in vivo, in vitro, or ex vivo cells, tissues, and organs). Exemplary routes of administration to the human body can be through the eyes (ophthalmic), mouth (oral), skin (transdermal), nose (nasal), lungs (inhalant), oral mucosa (buccal), ear, by injection (e.g., intravenously, subcutaneously, intratumorally, intraperitoneally, etc.) and the like.
As used herein, the term "co-administration" refers to the administration of at least two agent(s) or therapies to a subject. In some embodiments, the co-administration of two or more agents or therapies is concurrent. In other embodiments, a first agent/therapy is administered prior to a second agent/therapy. Those of skill in the art understand that the formulat ions and/or routes of administration of the various agents or therapies used may vary. The appropriate dosage for co-administration can be readily determined by one sk illed in the art. I n some embodiments, when agents or therapies are co-administered, the respect ive agents or therapies are administered at lower dosages than appropriate for their administration alone. Thus, co-administration is especially desirable in embodiments where the co- administration of the agents or therapies lowers the requisite dosage of a potentially harmful (e.g., toxic) agent(s).
The terms "cancer" and "cancerous" refer to or describe the physiological condition in mammals that is typical ly characterized by unregulated cell growth. A "tumor" comprises one or more cancerous cells. Examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia or lymphoid malignancies. More particular examples of such cancers include prostate, breast, colon, lung, brain, kidney, and bladder cancer.
As used herein, the term "cancer cells" refers to individual cells of a cancer. Such cells may include, for example, cells that express prostate specific membrane ant igen (PSMA).
The term "polynucleot ide" or "nucleic acid" refers to a polymeric form of nucleotides of any length, either ribonucleotides and/or deoxyribonuc leotides. These terms include a single-, double- or triple-stranded DNA, genomic DNA, cDNA, RNA, DNA-RNA hybrid, or a polymer comprising purine and pyrimidine bases, or other natural, chemically,
biochemically modified, non-natural or derivatized nucleotide bases. The backbone of the polynucleotide can comprise sugars and phosphate groups (as may typically be found in RNA or DNA), or modified or substituted sugar or phosphate groups. Alternatively, the backbone of the polynucleotide can comprise a polymer of synthetic subunits such as phosphoramidates and thus can be an oligodeoxynucleoside phosphoramidate (P- I-I2) or a mixed
phosphoramidaie-phosphod iester oligomer. I n addition, a double-stranded polynucleotide can be obtained from the single stranded polynucleotide product of chemical synthesis either by synthesizing the complementary strand and annealing the strands under appropriate conditions, or by synthesizing the complementary strand de novo using a D A polymerase with an appropriate primer.
The following are non-limiting examples of polynucleotides: a gene or gene fragment, exons, introns, mRNA, tRNA, rRNA, ribozymes, cDNA, recombinant polynuc leotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A polynucleotide may comprise mod ified nucleotides, such as methylated nucleotides and nucleotide analogs, uracyl, other sugars and linking groups such as fluororibose and thioate, and nucleotide branches. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after polymerizat ion, such as by conjugation with a labeling component. Other types of modifications included in this defin ition are caps, substitution of one or more of the naturally occurring nucleotides with an analog, and introduction of means for attaching the polynucleotide to proteins, metal ions, labeling components, other polynucleotides, or a solid support.
The term "plasmid" refers to an extrachromosomal circular DNA capable of autonomous replication in a given cell. The range of suitable plasmids is very large. In certain embodiments, the plasmid is designed for amplification in bacteria and for expression in a eukaryotic target cell. Such plasmids can be purchased from a variety of manufacturers. Exemplary plasmids include but are not limited to those derived from pBR322 (Gibco BRL), pUC (Gibco BRL). pBluescript (Stratagene), pREP4, pCEP4 (Invitrogen), pCI (Promega) and p Poly (Lathe et a!.. Gene 57 ( 1987), 193-201 ). Plasmids can also be engineered by standard molecular biology techniques (Sambrook et al., Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor ( 1989), N.Y.). It may also comprise a selection gene in order to select or to identify the iransfected cells (e.g., by complementation of a cell auxotrophy or by ant ibiotic resistance), stabilizing elements (e.g., cer sequence) or integrative elements (e.g., LTR viral sequences and transposons).
The term "shuttle plasmid7'1 refers to a plasmid comprising a unique restriction site between certain homologous recombination sites and used to insert a desired nucleic acid molecule, i.e., a. nucleic acid molecule encoding a desired product, into a recombinant adenoviral vector. The homologous recombination sites can be, for example, Ad5 right and Ad5 left. In further embodiments, the shuttle plasmid may have a tissue specific promoter
which controls the expression of the desired nucleic acid molecule. The shuttle plasmid also contains a majority of the viral genes necessary to form viral particles. However, the shuttle plasmid does not contain al l necessary genes to form viral particles.
The term "promoter" refers to the D A region, usually upstream of the coding sequence of a gene or operon. which binds RNA polymerase and directs the enzyme to the correct transcriptional start site.
The term "replication" means duplication of a vector. This duplication, in the case of viruses, can occur at the level of nucleic acid, or at the level of infectious viral particle. I n the case of DNA viruses, replication at the nucleic acid level comprises DNA replication. In the case of RNA viruses, nucleic acid replication comprises replication into plus or minus strand (or both). In the case of retroviruses, replication at the nucleic acid level includes the production of cDNA as well as the further production of RNA viral genomes. The essent ial feature is the generation of nucleic acid copies of the original viral vector. However, replication also includes the formation of infectious DNA or RNA viral particles. Such particles may successively infect cells in a given target tissue, thus distributing the vector through all or a significant portion of the target .tissue.
The term "sample," as used herein, refers to a biological sample obtained for the purpose of evaluation in vitro. I n the methods of the present invention, the sample or patient sample may comprise any body fluid including, but not limited to, blood, serum, plasma, urine, saliva, and synovial fluid. A sample may also comprise any cells, tissue samples or cell components (such as cel lular membranes or cellular components) obtained from a patient including a tissue biopsy.
As used herein, the term "subject" refers to any animal (e.g., a mammal), includ ing, but not limited to, humans, non-human primates, rodents, and the like (e.g., which is to be the recipient of a particular treatment). Typically, the terms "subject" and "patient" are used interchangeably, unless indicated otherwise herein.
As used herein, the terms "treatment," "treating," "treat" and the like, refer to obtaining a desired pharmacologic and/or physiologic effect. The terms are also used in the context of the administration of a "therapeutically effective amount" of an agent, e.g., a viral construct of the present invention. The effect may be prophylactic in terms of completely or partially preventing a particu lar outcome, disease or symptom thereof and/or may be therapeutic in terms of a partia l or complete cure for a disease and/or adverse a ffect attributable to the disease. " Treatment." as used herein, covers any treatment of a disease or condit ion in a subject, particularly in a human, and includes: (a) preventing the disease or
condition from occurring in a subject which may be predisposed to the disease or condition but has not yet been diagnosed as having it; (b) inhibiting the disease or condition, i.e., arresting its development; and (c) relieving the disease or condition, e.g., causing regression of the disease or condition, e.g., to completely or partially remove symptoms of the disease or condition. In particular embodiments, the term is used in the context of treating a subject with cancer.
As used herein, the term "vector" refers to a polynuc leotide construct designed for transduction/transfection of one or more cell types. Vectors may be, for example, "cloning vectors" which are designed for isolation, propagation and replication of inserted nucleotides, "expression vectors" which are designed for expression of a nucleotide sequence in a host cell, or a "viral vector" which is designed to result in the production of a recombinant virus or virus-like particle, or "shuttle vectors," which comprise the attributes of more than one type of vector.
I I. Generation of Virus-Displayed Libraries
In one aspect, the present invention provides compositions and methods related to the generation or production of virus-displayed, semi-random peptide libraries. I n particular embodiments, the viruses are replication competent. In other embod iments, the viruses are conditionally replicative, e.g., the viruses replicate in target cells. Thus, such libraries can be used to optimize infection of the viruses to target cells. In specific embodiments, adenoviruses can be used. Existing adenoviral vectors and systems have been described in U. S. Patent No. 7.662,795, U .S. Patent Applicat ion Publicat ion No. 2005/0245472, U.S. Patent Application Publ ication No. US 2009/0042257, and U .S. Patent Applicat ion
Publication No. 2009/0074658, the contents of which are incorporated herein by reference in their entiret ies. See also, Hogg et al., 1 8 CANCER GENE THI;R. 275-87 (201 1 ); Hesse el al.,81 (6) J . VIROL. 2688-99 (2007); Majhen et al., 1 19 VIRUS RES. 121 -33 (2006);
;Waterkemp et al., 8( 1 1 ) J. GENE M ED. 1307- 19 (2006); cVey et al., 84 J . GEN. VlROl .. 341 7-22 (2003). See generally, Young et al., 208 J. PATHOL. 299-318 (2006); Lupoid and Rodriguez, 3 CANCER Tl iER, 267-84 (2005); and Lin et al., 1 1 CANCER GENE Tl lER. 643-64 (2004).
In the context of adenovirus, the capsid shell comprises three major coat proteins— hexon, penton and fiber— and several small proteins that aid in assembly and maintenance of capsid structure. The nucleic acids encoding targeting peptide and random peptide sequence (single or flanking) can be inserted into a part of the nucleic acid sequence that encodes the capsid shel l. The nucleic acids can be inserted into one or more of the late genes (L 1 -L5). I n
particular embodiments, the nucleic acids are inserted into the sequence that encodes the fiber protein. More particularly, the nucleic acid sequences are inserted into the sequence that encodes the fiber shaft. Alternatively, insertion can take place in the region that encodes the knob domain. In other embodiments, the nucleic acid sequence encoding the flanking peptide sequence and the antigen targeting peptide can be inserted in the H I loop of the fiber protein. In a further embodiment, the nucleic acid sequence encoding the flanking peptide sequence and the antigen targeting peptide can be inserted in the EG loop of the fiber protein. In yet another embodiment, the nucleic acid sequence encoding the flanking peptide sequence and the antigen targeting peptide can be inserted in the IJ loop of the fiber protein. The flanking peptide sequence and the antigen targeting peptide can also be inserted into the C- terminus of capsid protein I X, the C-terminus of Fiber protein, and the L l -loop o f hexon protein. Through routine experimentation, a suitable insert ion point in the viral genome can be determined based on the size and sequence of the peptide cassette and antigen targeting peptide. Furthermore, the peptide cassette and antigen targeting peptide can be inserted at the same time in two or perhaps more sites, e.g., both the H I-loop and C-terminus of Fiber protein.
The present invention, however, is not limited to adenoviruses, as any viruses capable of being used to generate a library (e.g., replicat ion competent or condit ionally replicative) as described herein can be used including, but not limited to, herpes simplex virus (Keil et al., 143( 1 ) VET. MICROBIOL.29-36 (2010); Spear at el., 107( 1 ) J. VIROL. M ETHODS7 1 -9 (2003)), retroviruses (Nikles et al., 79(7) J. VIROL 4033-42 (2005); Buckholz et al., 16( 1 ) NAT.
BiOTCCHNOL 95 1 -54 ( 1998)),influenza virus, baculovirus (Grabherr et al., 10(3) CURR. GEN II Tl lER. 1 95-200 (2010); itidee et al., 10 BMC BIOTECH. 80- 1 0 1 (2010); Oker-Blom et al., 2(3) BR IEFINGS IN FUNCTIONAL G ENOMICS AND PROTEOMICS 244-53 (2003)), Newcastle disease virus, poliovirus, reovirus, vaccinia virus and vesicular virus.
I I I. Random Amino Acid Cassettes
As described herein, the compositions and methods of the present invention relate to the use of peptide cassettes to flank an antigen targeting pept ide that is displayed on the virus. Using the disclosure provided herein and the knowledge of one of ordinary skill in the art, a library of virus-displayed antigen targeting peptides with random, flanking peptide sequences can be generated and screened for those peptide sequences that improve and/or optimize the targeting infection of the virus. The random peptide sequences provide an optimal environment for peptide display and encourage native folding of the viral capsid proteins.
In particular embodiments, peptide sequences that Hank the antigen targeting peptides are used. In other embodiments, a single peptide sequence at either end of the antigen targeting peptide can be used. Indeed, although the description discusses the use of
"flanking" peptide sequences, it is understood that the present invention applies to the use of peptide sequences on one or both ends of the antigen targeting peptide.
In the generation of the virus-displayed library, randomly generated peptide cassette(s) are used. Based on the results of initial screening, particular substitutional variants can be generated and tested. For example, amino acids may be substituted based on side-chain properties. Naturally occurring residues are divided into groups based on common side-chain properties:
(1 ) hydrophobic: norleucine, met, ala, val, leu, ile;
(2) neutral hydrophilic: cys, ser, thr;
(3) acidic: asp, glu;
(4) basic: asn, gin, his, lys, arg;
(5) residues that influence chain orientation: gly, pro; and
(6) aromatic: tip, tyr, phe.
Non-conservative substitutions will entail exchanging a member of one of these classes for another class. Conservative substitutions involve exchanging of amino acids within the same class.
In one embodiment, the random peptide cassettes are monomers. The monomer peptides can be the same or different. In another embodiment, the random peptide sequences that flank the antigen targeting peptide are multimers. Similarly, the flanking multimers can be the same or different sequences, and/or the same or different length of amino acids. In particular embodiments, the flanking monomers can be any one of a combination of a monomer, a dimer, a trimer, a tetramer, a pentamer, a hexamer, a septamer, an octamer, a nonamer, and the like.
IV. Peptides for Targeting the Prostate Specific Membrane Antigen (PSMA)
In particular embodiments, the antigen targeting peptide is PSMA. PSMA is a type I I transmembrane protein found predominantly in the prostate, with minor expression of isoforms in the small intestine, brain, and tumor neovascularity. (Heston. 35 UROI.OGI-: A. 400-07 ( 1996)). Though the precise function of PSMA is not known, it is known to be a membrane bound carboxypeptidase and folate hydrolase. Id. This protein can exist in two forms, PSMA and PSM '. PSMA is the membrane bound form and PSM ' is an intracellular form which lacks the transmembrane domain at the amino terminus. PSM' is the
predominant form in the benign prostatic cell, while PSMA expression increases and predominates with the more aggressive prostate cancer tumor grades. From a clinical point of view, PSMA has all the features necessary for consideration as a systemic target for metastatic prostate cancer. Namely, its expression increases in aggressive cancers, androgen suppression results in up regulat ion, and background expression in other tissues does not appear to be a clinically significant source of aberrant targeting. See, e.g.. Gong, et al., 4 MOL. UROL. 21 7-23 (2000)).
The methods and compositions of the present invention can be used in conjunction with peptides targeting PSMA. Examples of peptides that specifically target PSMA include, but are not limited to, U.S. Patent No. 7,749,968, U.S. Patent Mo. 7,666,425, U.S. Patent No. 7,476,5 13, U.S. Patent No. 7,381 ,407, U.S. Patent No. 7, 163,680, and U.S. Patent No.
7, 1 12,412. See also, U.S. Patent Application Publication No. 2009/0274625, U.S. Patent Application Publication No. 2009/0238755, U.S. Patent Application Publication No.
2009/0041789, U.S. Patent Application Publication No. 2007/02543 16, U.S. Patent Applicat ion Publication No. 2007/01 2867 1 , U.S. Patent Application Publication No.
200602752 12, U.S. Patent Application Publication No. 2004/00241 88, and U.S. Patent Applicat ion Publication No. 2003/003 1673.
V. Other Ant igens/Target Cells
The present invent ion also relates to the use of other antigens implicated in cancer. The compositions and methods of the present invention can be used to generate viruses that display other tumor antigens flanked by peptide sequences that improve infection of target cancer cells. The type of cancer can include, but is not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia or lymphoid malignancies. More particular examples of such cancers include small intestine cancer, bladder cancer, lung cancer, thyroid cancer, uterine cancer, liver cancer, kidney cancer, breast cancer, stomach cancer, testicu lar cancer, cervical cancer, esophageal cancer, ovarian cancer, colon cancer, melanoma, prostate cancer, and the like.
Any known cancer/tumor antigen can be used in the context of the present invent ion. The antigen can be, but is not limited to, MAGE, MART- I /Melan-A, gp l OO, Dipeptidyl peptidase I V (DPPIV), adenosine deaminase-binding protein (ADAbp), cyclophilin b,
Colorectal associated antigen (CRQ-001 7- 1 A/GA733, Carcinoembryonic Antigen (CEA) and its antigenic epitopes CAP- 1 and CAP-2, etv6, am i I , Prostate Specific Antigen (PSA) and its antigenic epitopes PSA- 1 , PSA-2. and PSA-3, T-cell receptor/CD3-Z chain, MAG E- fami ly of tumor antigens (e.g., MAGE-A 1 , MAG E-A2. MAGE-A3. MAG EA4. MAG E-A5.
AGE-A6, AGE-A7, AGE-A8, MAGE-A9, MAGE-AIO, MAGE-AI I, AGE-A12, MAGE-Xp2 (MAGE-B2), MAGE-Xp3 (MAGE-B3), MAGE-Xp4 (MAGE-B4), AGE-CI, MAGE-C2, MAGE-C3, AGE-C4, MAGEC5), GAGE-family of tumor antigens (e.g., GAGE-l, GAGE-2, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7, GAGE-8, GAGE-9), BAGE, RAGE, LAGE-I, NAG, GnT-V, MUM- 1, CDK4, tyrosinase, p53, MUC family, HER2/neu, p21ras. RCAS I, a- fetoprotein, E-cadherin, a-catenin, 13-catenin, .γ-catenin, pl20ctn, gplOOPmel I 17. PRAME, NY-ESO-I, cdc27, adenomatous polyposis coli protein (APC), fodrin, Connexin 37, Ig-idiotype, pi 5, gp75, GM2 and GD2 gangliosides, viral products such as human papilloma virus proteins, Smad family of tumor antigens. Imp- 1, HA, EBV-encoded nuclear antigen (EBNA)-l, brain glycogen phosphorylase, SSX-1, SSX-2
(HOM-MEL40), SSX-3, SSX-4, SSX-5, SCP-1 and CT-7, and c-erbB-2, acute lymphoblastic leukemia (etv6, amll, cyclophilin b), B cell lymphoma (I -idiotype), glioma (E-cadherin, a- catenin, 13-catenin, 7-catenin, pl20ctn), bladder cancer (p2lras), biliary cancer (p2lras), breast cancer (MUC family, HER2/neu, c-erbB-2), cervical carcinoma (p53, p21ras), colon carcinoma (p2lras, HER2/neu, c-erbB-2, MUC family), colorectal cancer (Colorectal associated antigen'(CRC)-0017-l A/GA733, APC), choriocarcinoma (CEA), epithelial cell cancer (cyclophilin b), gastric cancer (HER2/neu, c-erbB-2, ga733 glycoprotein), hepatocellular cancer, Hodgkins lymphoma (lmp-1, EBNA-1), lung cancer (CEA, MAGE-3, NY-ESO-1), lymphoid cell-derived leukemia (cyclophilin b), melanoma (pi 5 protein, gp75, oncofetal antigen, GM2 and GD2 gangliosides, MelanA/ ART-l, cdc27, MAGE-3. p2lras, gplOO.sup.Pmel 117), myeloma (MUC family, p21 ras), non-small cell lung carcinoma (HER2/neu, c-erbB-2), nasopharyngeal cancer (Imp- 1, EB A-I ), ovarian cancer (MUC family, WER2/neu, c-erbB-2), prostate cancer (Prostate Specific Antigen (PSA) and its antigenic epitopes PSA-1, PSA-2, and PSA-3, HER2/neu, c-erbB-2, ga733 glycoprotein), renal cancer (HER2/neu, c-erbB-2), squamous cell cancers of the cervix and esophagus (viral products such as human papilloma virus proteins), testicular cancer (NY-ESO-I), and T cell leukemia (HTLV-1 epitopes).
In particular embodiment, the tumor antigen can be selected from the group consisting of PSMA, VEGFR, PSCA, EPCam, CD227, EGFR, Alpha-V-beta-3 Integrin, AFP, CDHOb, CD30, CD33, CD52, CD56, CD66e, CA 125, GD3 ganglioside, CD4, CD20, CD22, CD80, and CD 152. In a specific embodiment, the antigen targeting peptide specifically binds an antigen expressed on the surface of cancer cells. In another embodiment, the antigen can be selected from the group consisting of PSMA, VEGFR, PSCA, EPCam, CD227, EGFR, and Alpha-V-beta-3 Integrin.
The present invention can also be used with other antigen targeting peptides to optimize targeting infection of target cells. Target cells can include, but are not limited to, bacterial cells, fungal cells, diseased cells, or generally any foreign cells. Indeed, the present invention can be used to target viral infection using an antigen targeting peptide specific for the target cell of choice.
VI. Pharmaceutical Compositions/Delivery of Viral Constructs
Accordingly, a pharmaceut ical composition of the present invention may comprise an effective amount of at least one viral construct. In a specific embodiment, an effective amount of a recombinant adenoviral vector comprising a nucleic acid sequence encoding the peptide sequence MAEWQPDTAH H WALTLPDP inserted into the Hl-loop of adenovirus fiber protein can be administered to a subject or patient suffering from prostate cancer.
Although the following description of pharmaceutical composit ions and disease assessment is described in the context of prostate cancer, it is understood that the disclosure is not so limiting and that the present invention is applicable to other types of cancer as well as other disease platforms depending on the antigen targeting peptide used.
As used herein, the term "effective" means adequate to accomplish a desired, expected, or intended result. More particularly, the terms "effective amount" and
"therapeutically effective amount" are used interchangeably and refer to an amount of at least one viral construct, perhaps in further combination with another therapeutic agent, necessary to provide the desired treatment or therapeutic effect, e.g., an amount that is effective to prevent, alleviate, treat or ameliorate symptoms of a disease or prolong the survival of the subject being treated. In particular embodiments, the pharmaceutical compositions of the present invention are administered in a therapeutically effective amount to treat a subject suffering from cancer. As would be appreciated by one of ordinary skil l in the art, the exact amount required will vary from subject to subject, depending on age, general condit ion of the subject, the severity o f the condition being treated, the particu lar compound and/or composit ion administered, and the like. An appropriate "therapeutically effective amount" in any individual case can be determined by one of ordinary skill in the art by reference to the pertinent texts and literature and/or by using routine experimentation.
The pharmaceutical compositions of the present invention are in biologically compatible forms suitable for administration in vivo to subjects. The pharmaceutical compositions can further comprise a pharmaceutically acceptable carrier. The term
"pharmaceutically acceptable" means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized
pharmacopeia for use in animals, and more particularly, in humans. The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the at least one viral construct is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, including but not limited to peanut oil, soybean oil, mineral oil, sesame oil and the like. Water may be a carrier when the pharmaceutical composition is administered orally. Saline and aqueous dextrose may be carriers when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions may be employed as liquid carriers for injectable solut ions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried slim milk, glycerol, propylene, glycol, water, ethanol and the like. The pharmaceut ical composition may also contain minor amounts of wetting or emulsifying agents, or pH buffering agents.
The pharmaceut ical compositions of the present invent ion can take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained-release formulat ions and the like. The composit ion can be formulated as a suppository, with traditional binders and carriers such as triglycerides. Oral formu lation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. In a specific embodiment, a pharmaceutical composition comprises an effective amount of at least one viral construct together with a suitable amount of a pharmaceutically acceptable carrier so as to provide the form for proper administration to the patient. In particular embodiments that comprise the administration of a viral construct and another therapeutic agent, the therapies can be separately formulated and administered according to the present invention. The formulation should suit the mode of administration.
Delivery o f the viral constructs of the present invention (e.g., adenoviral) can be accomplished by either site-speci fic injection (local administration) or intravenously (systemic administration). Site-specific injections of adenoviral vectors may include, for example, inject ions into the portal vein of the liver as well as intraperitoneal, intrapleural, intrathecal, intra-arterial, intra-tumor inject ions or topical application. These methods are easily accommodated in treatments using adenoviral vectors.
Furthermore, the pharmaceutical compositions of the present invention may be administered by any other particular route of administration including, but not limited to oral, parenteral, subcutaneous, intramuscular, intravenous, intrarticular, intrabronchial,
intraabdominal, intracapsular, intracartilaginous, intracavitary, intracelial, intracelebellar, intracerebroventricular, intracolic, intracervical, intragastric, intrahepat ic, intramyocardial, intraosteal. intraosseous, intrapelvic, intrapericardiac, intraperitoneal, intrapleural, intraprostatic, intrapulmonary. intrarectal, intrarenal, intraretinal, intraspinal, intrasynovial, intrathoracic, intrauterine, intravesical, bolus, vaginal, rectal, buccal, subl ingual, intranasal, iontophoretic means, or transdermal means.
The adenoviral vectors may be delivered to the target cell in a variety of ways, including, but not limited to, liposomes, general transfection methods that are well known in the art (such as calcium phosphate precipitation or electroporation), direct injection, and intravenous infusion. The means of delivery will depend in large part on the particular adenoviral vector (including its form) as well as the type and location of the target cells (i.e., whether the cells are to be transfected or transformed in vitro or in vivo). I f used as a packaged adenovirus, adenovirus vectors may be administered in an appropriate
physiologically acceptable carrier at a dose of about I to about 10 pg. The mu ltiplicity of infection will generally be in the range of about 0.001 to 100. I f administered as a polynucleotide construct (i.e.. not packaged as a virus) about 0.01 pg to about 1000 pg of an adenoviral vector can be administered. The adenoviral vector/construct may be administered one or more limes, depending upon the intended use and the immune response potential of the host, and may also be administered as mult iple, simultaneous injections. I f an immune response is undesirable, the immune response may be diminished by employing a variety of immunosuppressants, so as to permit repetitive administration, without a strong immune response. If packaged as another viral form, such as HSV, an amount to be administered is based on standard knowledge about that particular virus (which is readily obtainable from, for example, published literature) and can be determined empirically.
Thus, the adenoviral vector/construct, the polynuc leotide and expression vector or the viral particle of the present invention may be delivered in vivo to the human or animal organism by specific del ivery means adapted to the pathology to be treated. For example, a balloon catheter or a stent coated with the adenoviral vector/construct, the expression vector carrying the polynucleotide or the viral particle may be employed to efficient ly reach the cardiovascular system. It is also possible to deliver the therapeutic agents by direct administration, e.g., intravenously, in an accessible tumor, in the lungs by aerosolization, and the like.
Alternat ively, one may employ eukaryotic host cells that have been engineered ex vivo to contain the adenoviral vector, the expression vector carrying the polynucleotide or the
viral particle according to the invention. Methods for introducing such elements into a eukaryotic cell are well known to those skilled in the art and include microinjection of minute amounts of DNA into the nucleus of a cell, transfection with calcium phosphate,
electroporation, lipofection/liposome fusion, and particle bombardment.
Administration of the above-described methods may also include repeat doses or courses of target-cell specific adenovirus depending, inter alia, upon the individual's response and the characteristics of the individual's disease. Repeat doses may be undertaken immediately following the first course of treatment (i.e., within one day), or after an interval of days, weeks or months to achieve and/or maintain suppression of tumor growth.
Generally, an effective amount of an adenovirus vector is administered, i.e., amounts sufficient to achieve the desired result, based on general empirical knowledge of a population's response to such amounts. Some individuals are refractory to these treatments, and it is understood that the methods encompass administration to these individuals. The amount to be given depends, inter alia, on the stage of the cancer, the condition of the individual, the extent of disease, the route of administration, how many doses will be administered, and the desired objective.
The methods of the present invention can be applied to the treatment of prostate cancer in male subjects at any stage of the cancer, although certain treatment methods are more preferred for particular cancer stages. Prostate cancer is commonly evaluated according to a scale divided into four lettered stages: A, B, C and D. Tumors in stage A are
microscopic; stage Al designates tumors confined to a relatively small area and composed of well-differentiated tissue, while stage A2 tumors are more diffuse and less well differentiated. Stage B tumors are large enough to be felt during a rectal examination, while stage C prostate cancers have spread throughout the gland and typically have pushed past the borders of the prostate into surrounding structures. Stage D tumors have metastasized, e.g., to lymph nodes, bone, or other organs. Alternatively, tumors can be staged by the TNM staging system, in which tumors are ranked on a scale of progressively worsening disease from T l a to T4b (e.g., Tic tumors are non-palpable and non-visible that were detected by elevated blood levels of prostate specific antigen). The methods of the present invention are useful in the treatment of any stage of prostate cancer. However, it will be appreciated by the skilled artisan that methods involving procedures for removal or destruction of prostatic tumor tissue preferably are employed with non-metastasized cancers. For example, radical prostatectomy can be used with stage A, B and some stage C tumors (i.e., where the tumor growth has not extended considerably beyond the borders of the prostate gland) as well as stage T i c tumors.
Radiation therapy (e.g., external or interstitial) preferably is used with stage A, B or C tumors as well as T ic tumors.
To assess the efficacy of a treatment method of the invention, the size of the prostate can be determined by methods known in the art, for example, rectal examination, transrectal ultrasonography or magnetic resonance imaging ( M RI). Moreover, the size or extent of the prostate tumor (and metastatic tumors, if any) can be assessed by known methods including a prostate-specific antigen blood test, bone scanning, X-rays, skeletal survey, intravenous pyelography, CAT-scan, M RI, physical examination, biopsy, and the like. For treatment methods that involve surgery (e.g., in neoadjuvant therapy wherein a peptide compound is administered prior to a radical prostatectomy), the tumor can also be staged during surgery (e.g., the prostate gland can be examined during surgery and/or a biopsy can be taken and examined). Thus, clinical staging and/or surgical staging may be used to evaluate the extent of disease.
One method of evaluating the extent of prostate cancer is to assay the level of prostate-specific antigen (PSA) in a subject's blood. The PSA blood test is a reasonably specific, sensitive, rapid, and inexpensive tool for screening for prostate cancer. In general, a blood PSA level above 4 ng ml is considered to be suggestive of the presence of prostate cancer, with levels above 10 ng/ml being particularly indicative of cancer. For a subject undergoing treatment with a viral construct according to the methods of the invention, a pretreatment level of PSA can be established and the efficacy of the treatment assessed by monitoring periodically the PSA level in the subject's blood, wherein decreased PSA levels are used as an indicator of the efficacy of the treatment. The PSA nadir (i.e., the point at which PSA levels do not decrease further even upon further treatment with a viral construct) can be used as the indicator point for init iation of a second therapy, for example for perlormance of a procedure that removes or destroys prostatic tumor tissue (including rad ical prostatectomy, cryosurgery and or radiation therapy). It is expected that the PSA nad ir will be reached sooner using a viral construct, as compared to treatments which do not include using a viral construct of the present invention.
Additionally or alternatively, plasma concentrations of sex hormones can be monitored to assess the efficacy of the drug therapy. Concentrations of hormones such as testosterone, dihydrotestosterone, dehydroepiandrosterone (DH EA), DH EA-sulfate, androst- 5-εηε-3β, 1 7-diol, and the estrogen l 7 -estradiol can all be measured by methods known to the skilled artisan. Preferably, decreased levels of testosterone and dihydrotestosterone can be used as indicators of treatment efficacy.
I n another embodiment, the compositions and methods of the invention can be administered in conjunct ion with other known treatments for cancer includ ing, but not limited to, mechan ical removal of cancerous cells (e.g., surgical removal of a tumor), and administration of chemotherapeutic agents. There are many known. chemotherapeutic agents used to treat cancer which act to kill cancer cells and/or slow their growth through other mechanisms. The administrations of such additional treatments and/or agents are intended to be included in the methods of the present invention.
For example, examples of chemotherapeutic agents that may be used in conjunction with the compositions and methods of the present invention include, but are not limited to, antimetabolites such as folate analogs (e.g., methotrexate), purine analogs (e.g., fludarabine, mercaptopurine, and thioguanine (e.g., 6-TG)), adenosine analogs (e.g., cladribine, and pentostatin), pyrimidine analogs (e.g., capecitabine, cytarabine, depocyt, floxuridine, fluorouracil (e.g., 5- FU); and gemcitabine), and substituted ureas (e.g., hydroxyurea); natural products such as antitumor antibiotics (e.g., bleomycin, dactinomycin, actinomycin D, daunorubicin. daunomycin, DaunoXome ( liposomal daunorubic in), doxorubicin, Doxil (liposomal- doxorubicin), epirubicin, idarubicin. mitoxantione. and mitomycin C), epipodophylbloxins (e.g., etoposide and teniposide), microtuble agents (e.g., docetaxel, paclitaxel, vinblastine, vincristine, and vinorelbine), camptothecin analogs (e.g., irinotecan and topotecan), enzymes (e.g., asparaginase), and monoclonal antibodies (e.g., alemtuzamab, gemtuzumab ozogamicin, ibritumomab tiuxetan, nofetumomab, rituximab, tositumomab, and trastuzumab). Those skilled in the art will recognize that any of these chemotherapeutic agents and others can be used in combination with the viral constructs of the present invention.
One aspect of the invention relates to a method for treating prostate cancer in a subject in need of such treatment, comprising administering to the subject a viral construct/particle (e.g., adenoviral) of the present invention, and performing on the subject at least one procedure that removes or destroys prostatic tumor tissue, such as a radical prostatectomy, cryosurgery, external radiation therapy (e.g., X-ray therapy) or interstitial radiation therapy (e.g., implantation of a radioactive seed). The adenoviral construct may be administered to the subject prior to or subsequent to performing the procedure that removes or destroys pro static tumor tissue. I n one such embodiment, administration of an viral construct is preferably for a period sufficient to cause the prostate or prostatic tumor tissue to shrink in size prior to performing the procedure that removes or destroys prostatic tumor
tissue. Λ suitable period for preadministration of a viral construct typically is between about one day and about one year, more preferably between about three days and about six months.
In certain situations, it may be desirable to use an antiandrogen, and thus in another embodiment, this treatment method can further invo lve administering an antiandrogen to the subject in combination with the viral construct. I n yet another embodiment, this treatment method can further involve administering one or more inhibitors of sex steroid biosynthesis to the subject in combination with the viral construct (optional ly in further combinat ion with an antiandrogen) prior to or subsequent to performing the procedure that removes or destroys prostatic tumor tissue.
In another embodiment, the viral construct of the present invention may be administered in conjunction with an LH RH agonist, as described in U.S. Patent No.
5,843,902, U.S. Patent No. 5,780,435, and U.S. Patent No. 6, 153,586, the contents of which are incorporated herein by reference in their entireties, or an LH receptor antagonist.
Those of skil l in the art will recognize that while it may not be necessary to combine viral construct therapy with add itiona l drugs or treatments, in certain situation it may be desirable to further combine the viral construct with other drugs or treatments to achieve the greatest therapeutic effect.
In another aspect, the viral constructs and therapeutic agents of the present inventnion may be combined with other agents including, but not limited to, immunomodulatory agents, anti-inflammatory agents (e.g., adrenocorticoids. corticosteroids (e.g., beclomethasone. budesonide, flunisolide, flut icasone, triamcinolone, methlyprednisolone, prednisolone, prednisone, hydrocortisone), glucocorticoids, steroids, non-sterioda l ant i-inflammatory drugs (e.g., aspirin, ibuprofen, diclofenac, and COX-2 inhibitors), and leukotreine antagonists (e.g., montelukast, methyl xanthines, zafirlukast, and zileuton), beta2-agonists (e.g., albuterol, biterol, fenoterol, isoetharie, metaproterenol, pirbuterol, salbutamol, terbutalin formoterol, salmeterol, and salbutamol lerbutaline), anticholinergic agents (e.g., ipratropium bromide and oxitropium bromide), sulphasalazine, penicillamine, dapsone, antihistamines, ant i-malarial agents (e.g., hydroxychloroquine), anti-viral agents, and antibiotics (e.g. , dactinomycin (formerly actinomycin), bleomycin, erythomycin, penicillin, mithramycin, and anthramycin (A C)).
Without further elaboration, it is believed that one skilled in the art, using the preceding description, can util ize the present invention to the fullest extent. The following examples are illustrative only, and not limiting of the remainder of the disclosure in any way whatsoever.
EXAMPLES
The following examples are put forth so as to provide those of ordinary sk ill in the art with a complete disclosure and description of how the compounds, compositions, articles, devices, and/or methods described and claimed herein are made and evaluated, and are intended to be purely illustrative and are not intended to limit the scope of what the inventors regard as their invention. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.) but some errors and deviations should be accounted for herein. U nless indicated otherwise, parts are parts by weight, temperature is in degrees Celsius or is at ambient temperature, and pressure is at or near atmospheric. There are numerous variations and combinat ions of reaction condit ions, e.g., component
concentrations, desired solvents, solvent mixtures, temperatures, pressures and other reaction ranges and conditions that can be used to optimize the product purity and yield obtained from the described processes. Only reasonable and routine experimentation will be required to optimize such process conditions.
Materials and Methods
Cell Lines. 293cre57 cells were provided by Stephen Langer (University of
Colorado). Cre-recombinase activity was authenticated by Cre Stop light assay. PC-3- PSMA cells were provided by Warren Heston (Cleveland Clinic) and authenticated for PSMA expression by Western blot and ELI SA. DPL-S 1 1 cells are generated as described. See Hoti et al., 17 CANCER GENE THER. 1 - 13 (2010). PC-3, 293, and LNCaP cells were obtained from ATCC and were not further authenticated.
Fiber-Shuttle Vector. Generat ion of fiber-shuttle plasmid for the Coxsackie and Adenovirus Receptor (CAR) binding ablation by deletion of amino acids T^AYT^ in the FG loop has been described previously. See Lupoid et al., 35 NUCLEIC ACIDS RES. e l 38 (2007); and Roelvink el al., 286 SCIENCE 1568-7 1 ( 1999). An add itional site mutation
(Y477A) was performed using site directed mutagenesis kit (Invitrogen, Carlsbad, CA) with primers BFB- I : CTTCCTGG ACCC AG A AGCTTGG A ACTTT AG A A ATG (SEQ I D NO: I ) and BFB-2 CATTTCTAAAGTTCCAAGC^TTCTGGGTCCAGGAAG (SEQ I D O:2), where the underlined sequences represent the desired mutation. See Shayakhmetov et al., 79 J. VIROL. 7478-91 (2005); and Alemany et al., 8 GENE THER. 1 347-53 (2001 ). An Sspl restriction enzyme recognition site was ablated by this mutation and thus serves as a means to identify the new desired vector prior to sequencing. The entire Fiber coding region of the resulting shuttle plasmid was sequenced with primers 13 forward (5 '- GTAAAACGACGGCCAGT) (SEQ I D NO:3), l 3 reverse (5'-
GGAAACAGCTATGACCATG) (SEQ I D O:4), Fiber-S2 (5'- CTCACCCCCTCTAACTACTG) (SEQ I D NO:5) and Fiber-S3 (5'- CAGGAGATGGGCTTGAATTT) (SEQ I D N0:6), and the integrity was confirmed. The resulting fiber-shuttle plasmid, RPuc-FBR-8, received the insertion of retargeting peptide cassettes through EcoRI/BspEI subcloning.
Library Insert. Oligonucleotides encoding PSMA-binding peptide
(WQPDTAHH WATL) (Aggarwal et al., 66 CANCER RliS. 91 71 -77 (2006)), flanked by three random amino acid coding cassettes were generated at library scale and quality. The oligonucleotide library template, 5'-Biotin-TGGAGTTGTGTCTCCGGAMNNMNN MNNC AGTGTTGCCCAGTGGTGTGCGGTATCAGGCTGCCA NN MNNMNNGAATTCGGA TTCCTGTGTACCGCT (SEQ I D NO:7) is the reverse complement of the coding region, where N refers to all possible nucleotides ( A,G,C, & T) and M refers to only C or A. The extension primer LibOO l (5 '-Biotin-AGCGGTACAGGAATCC) (SEQ I D NO:8) was applied to create double-stranded DNA product. The template was annealed with the extension primer and extended with klenow fragment DNA polymerase (New England Biolabs, Beverly, MA). The products were then restriction digested with BspEI and EcoRI . The unwanted digested ends were purified away by streptavidin magnetic beads (New England Biolabs). Double-stranded DNA insert was ligated into the Hl-loop of CAR-binding ablated fiber-shuttle plasmid in large scale to maintain library diversity. Completed ligation was electroporated into electrocompetent DM5a and grown in SOC broth at 37°C for 30 minutes. Prior to amplification, serial dilutions were plated on LB agar with selective antibiotic, and the diversity of this shuttle plasmid library was estimated at 2x l 06 clones. Sequencing of random clones demonstrated library integrity and diversity. The combined cultures were grown in large scale for purification of the fiber-peptide-shuttle library.
Construction of the Adenovirus-Displaved Peptide Library. Oligonucleotides encod ing PSM A-binding peptide (Aggarwal el al., 66 CA NCER RES. 91 7 1 -77 (2006) ). flanked by 3 random amino acid cassettes, were synthesized and subcloned into the H l-loop of CA R- ablated Fiber in RPuc-FBR8 ΔΤ^ΑΥΤ^. YwA; FIG. I A) at library scale. The resulting Fiber-peptide shuttle library was recombined into the Fiber region of pseudotyped adenovirus serotype 5 (Ad5). Ad5Track-Luc-Fex or Ad5-PSE-PBN-E 1 A-Fex [multiplicity of infection (MOI) = I ], by Cre-recombinase-mediated cassette exchange in 6 106 293cre57 cells and purified at 72 hours as previously described. See FIG. I B and Lupoid et al., 35 NUCLEIC ACIDS RES. E l 38 (2007).
/// Viiro L ibrary Screening, Target cells were infected ( OI = I ) for 2 hours (round I ) or I hour (subsequent rounds), washed, and incubated for 3 to 4 days. Counterselections were conducted for I hour in rounds 2 to 3 prior to positive select ion (Table I below). The floxed Fiber-coding region was PGR rescued into the RPuc-Rescue shuttle vector (Lupoid et al., 35 NUCLKIC ACIDS RKS. E 1 38 (2007)), and 10 to 30 individual clones for each round were sequenced. The remaining library was amplified on a large scale and applied as the shuttle vector for the next round.
TABLE 1 .Screening of Adenovirus-Displayed Peptide Library in a PSMA-Expressing Cancer Cell and Tumor Model
In Vivo Selection. Subcutaneous LNCaP tumors in male athymic nu/nu mice (Charles River Laboratories) were grown to ~0.5 cm3 in dimension, and 10" in fect ious units (I U) of Ad5-PSE-PBN-PS A library was injected via tail vein. A lter 3 weeks, the lumor, kidney, lung, spleen, and liver were collected, total DNA were extracted, and the Fiber region was PCR amplified and subcloned as described earlier. Thirty clones were randomly sequenced.
Lucifera.se Assays. Cells were infected (MOI = 1) in 96-multiwell plates for I hour, washed, fed complete media, and assayed for luciferase activity at 48 hours (Promega). Competition studies applied serially diluted peptide 30 minutes prior to infection.
Bioluminescence Imaging. LNCaP tumor-bearing mice were anesthetized with isoflurane 3 days after viral infection and D-luciferin was injected intraperitoneally.
Bioluminescence images were observed with an in vivo imaging system (I VI S; Xenogen) and analyzed using Live I mage software (Xenogen).
Virus Purification. Recombinant adenovirus was purified by commercial adenovirus purification kit (Adenopure; Puresyn) or iodixanol discontinuous density gradient ultracen- trifugation and size exclusion column chromatography. Peng et al., 354 ANAL. BlOCl ll-M. 140-47 (2006). Virus titer was determined by Adeno-XTM Rapid Titer Kit ( BD Biosciences) or GFP using DPL-S I I cells expressing an artificial ant i-Fiber single-chain antibody receptor. See Hoti et al., 1 7 CANCI :R G I-IN I- TI II:K. I - 1 3 (2010).
Example 1 : Generating an Adenovirus-Displayed, Semi-Random Peptide Library.
To generate an adenovirus-displayed, semirandom peptide library, a phage-derived PSMA-targeting peptide, VVQPDTAHHWATL (SEQ ID NO: 9) (Aggarwal et al., 66 CANCER Ri-s. 91 7 1 -77 (2006)), flanked by 3 random amino acid cassettes, was first subcloned into the I l l-loop of an Ad5 Fiber-shuttle vector (FIG. 1 A). The host Fiber gene was detargeted from CA -mediated infection through FG-loop T489AYT4l): deletion and DE-loop Y477A mutation. Roelvink et al., 286 SCIENCE 1568-7 1 ( 1999). The Fiber region of the shuttle library was unidirectionally transferred into the native Ad5 Fiber region by Cre-recombinase-mediated cassette exchange in 6 * 106 packaging cel ls ( FIG. I B). Previous studies indicate that a library diversity of at least I 05 can be achieved by this method. See Lupoid et al. , 35
Nuci.l- lC ACIDS RES. e ! 38 (2007). The result ing adenovirus library was harvested within a single life cycle to prevent the generation of hybrid capsids, which could occur after virus spread and coinfection. This adenovirus library approach can produce a high complexity o f potential conformations for Fiber protein folding, peptide folding, and orientation for peptide-target interaction.
The resulting adenovirus library was biopanned against PSMA-positive cell lines and tumors to isolate those adenoviruses that preferentially utilize PSMA as an alternative receptor (Table I ). Specifically, the initial adenovirus library was incubated with PSMA- expressing cells for 1 hour at a density of 1 IU per cell; the cells were then washed and incubated for 3 days. Fiber gene cassettes from successfully infectious round I virus were rescued by PCR ampli ficat ion and subcloning, via Cre-recombinase-mediated cassette exchange, to generate a second-round Fiber-shuttle library and finally a second-round adenovirus-displayed peptide library. Various cell lines were used for counter- and positive- selections to minimize ampl i ficat ion of virus that infected via PSMA-independent mechanisms. Ten to 20 Fiber-shuttle clones from each selection round were sequenced both to ensure diversity and to identify potential candidates. By the third round, 6 unrelated candidate peptides were represented by multiple clones, indicating library maturation (FIG. 2).
To identify the most successful targeted virus, the fourth-round library was generated as a conditionally replicating virus library (Ad5-PSE-PBN-E l A-PSMA-Lib), which utilizes an androgen receptor-responsive cassette to drive EI A gene expression and viral replication. This replication-competent library was applied to a fina l and stringent in vivo select ion, by intravenous injection, and allowed 3 weeks for viral infection, amplification, and spread within the LNCaP tumor. The tumor was harvested, and peptide cassettes from the infectious
viruses were rescued by PCR amplification and Cre-recombinase subcloning. Thirty randomly picked clones were sequenced and, surprisingly, a single peptide sequence (MetAEWQPDTAHH WATLPDP, named Saupw- 1 ) (SEQ I D NO: 10) was identified in all 30 clones. Diversity of the input fourth-round library was reconfirmed by sequencing, suggesting that the in vivo selection was extremely stringent and resulted in a single, successful targeting peptide.
Example 2: Evaluation of Adenovirus Constructs
Reporter adenovirus displaying the in vivo selected peptide Saupw- 1 or the original nonflanked peptide WQPDTAH H WATL (SEQ I D NO:9) were evaluated for PSMA- mediated infection on 3 cell lines expressing varying levels of PSMA (FIG. 5). Infection rate of the selected virus Ad5Track-Luc-Saupw- l directly correlated with PSMA expression levels in these cells, whereas the virus-displayed parental peptide Ad5Track-Luc-Saurabh showed poor infection efficiency in al l 3 cell lines (FIG . 3A). I n fect ion of adenovirus with wild-type fiber, Ad5Track-Luc-WtFiber, correlated with CA R expression and fai led to show any PSMA selectivity (FIG. 5). These results ind icate that the infection of Ad5Track-Luc- Saupw- I is CAR independent and mediated by the peptide. To confirm this, competition experiments were conducted with PS A-targeting or control peptides. AdTrack-Luc- Saupw- 1 was dose-dependently inhibited by the PSM A-targeting peptide. (FIG. 3 B) but not the control peptide. On the other hand, PSMA-targeting and control peptides had no effect on infection by wild-type fiber. These results support PSMA-targeted infection mediated through the Fiber-displayed peptide. Similar inhibition studies with a pept ide, containing the flanking regions, did not show an increased abi lity to inhibit viral infection (data not shown), indicating that the selected flanking peptides enhanced folding and display rather than peptide binding affinity. Interestingly, more than 75% of the flanking sequences identified in each round contained at least 1 proline residue, which suggests that peptides in the H l-loop may be constrained or interfere with proper fiber folding and assembly. This was not only unique to the PSMA-targeting pept ide but was also seen in other library select ions.
The abi l ity o f the selected virus to infect tumors in vivo after intravenous inject ion was then evaluated. Adenovirus biodistribution is complex and a ffected by many factors. I n murine tissues, adenoviral biodistribution is independent of CAR binding. A series of pioneering articles recent ly revealed that hepatic infection is mediated by interactions between the viral hexon protein and blood factor X. See Kalyuzhniy et al., 105 PROC. NATL. ACAD. SCI. U. S.A. 5483-88 (2008); VIGANT ET AL., 16 Mol. Ther. 1474-80 (2008); and Waddington et al., 132 CELL 397-409 (2008). Indeed, hexon gene modification or blockade
can reduce hepatic infection and viral induced hepatic toxicity. Shashkova et al., 1 7 MOL. TM I- K. 2 1 2 1 -30 (2009); and Waddington et al., 1 32 CELL 397-409 (2008). However, the majority of injected adenovirus still remains in the liver through noninfectious sequestration. Di Paolo et al., 17 oi... Tl lER. 675-84 (2009). Interestingly, although CAR is not the dominant receptor for hepatic infection, it remains important in tumor models. Tumor models that express low levels of CAR are poorly infected by Ad5 vectors after systemic injection; however, infection can be rescued by the use of alternate serotype Fiber genes. The present inventors discovered that the selected PS A-targeting peptide was capable of rescuing CAR-independent infection of LNCaP tumors (FIG. 3C). Following intravenous administration of Ad5Track-Luc-Saupw- l ( I 0g III), LNCaP tumors were infected with similar efficiency when compared with adenovirus with wild-type fiber (FIG. 3C). These results reflect efficient retargeting by the PS A-binding peptide. As expected, both virus presented significant liver transduction (FIG. 3C), as confirmed by in vivo luciferase imaging (FIG. 4). Transgene expression in tumor xenografts could not be observed from
bioluminescence imaging with either wild-type or PS A-targeted Fiber genes, which is general ly expected following systemic admin istration of replication-incompetent adenovirus reporters. On the other hand, Ad5T rack-Luc-Saupw- 1 infected kidney and lung with signi ficantly lower efficiency. These results are consistent with previous studies utilizing Y477A detargeting mutations. See Bayo-Puxan et al., 87 J. GEN. VIROL. 2487-95 (2006). Therefore, the combination of CAR detargeting and PS A retargeting has affected the systemic infection pattern of the virus in some tissues while still retaining efficient tumor cell infection (FIG. 2D).
References
I . Wae ler et al., 8 NAT. REV. G ENET. 573-87 (2007).
2. Barry et al., 1 1 CURR. OPIN. MOL THER. 41 1 -20 (2009).
3. Rodriguez et al., 57 CANCER RES. 2559-63 ( 1 97).
4. Lupoid et al., 3 CANCER TI IER. 267-84 (2005).
5. Shashkova et al., 1 7 MOL. TI IER. 2 12 1 -30 (2009).
6. Ghosh et al., 79 J. VIROL. 1 3667-72 (2005).
7. Lupoid et al., 35 NUCLEIC ACIDS RES. e 1 38 (2007).
8. M iura et al.. 14 GEN E TI IER. 1448-60 (2007).
9. Elgamal et al., 18 SEM IN. SURG. ONCOL. 10- 16 (2000).
10. Chen et al., 5 1 J. ED. Cl-lEM . 7933-43 (2008).
I I . Aggarwal et al., 66 CANCER RES. 91 7 1077 (2006).
12. Rege et al., 67 CANCER ES.6368-75 (2007).
13. Hoti et al., 17 CANCER GENE THER. I - 13 (2010).
14. Penget al., 354 ANAL. BlOCllEM.140-47 (2006).
1 . Roelvink et al., 286 SCIENCE 1568-71 ( 1999).
16. Waddington et al., 132 CELL 397-409 (2008).
17. Kalyuzhniy et al., 105 PROC. NAIL. ACAD. SCI. U.S.A.5483-88 (2008).
18. Vigant et al., 16 Moi.. THER.1474-80 (2008).
19. Di Paolo et al..17 Oi.. THER.675-84 (2009).
20. Bayo-Puxan et al., 87 J. GEN. VIROL.2487-95 (2006).
21. Alemanyetal., 8 GENE THER.1347-53 (2001)
22. Shayakhmelov et al., 79 J. VIROL.7478-91 (2005).
Claims
We claim:
I . An adenoviral construct comprising a nucleic acid encod ing the peptide sequence AE-X-PDP. wherein X is an ant igen targeting pept ide.
2. The adenoviral construct of claim I , wherein the antigen targeting peptide is a tumor antigen targeting peptide.
3. The adenoviral construct of claim 2, wherein the tumor antigen is selected from the group consisting of PS A, VEGFR, PSCA, EPCam, CD227, EGFR, Alpha-V-beta-3 Integrin, AFP, CD 140b, CD30, CD33, CD52, CD56, CD66e, CA 125, GD3 ganglioside, CD4, CD20, CD22, CD80, and CD 152.
4. The adenoviral construct of claim 1 , wherein the antigen targeting peptide specifically binds an antigen expressed on the surface of cancer cells.
5. The adenoviral construct of claim 4, wherein X is selected from the group consisting of PSMA, VEGFR. PSCA, EPCam, CD227, EG FR, and Alpha-V-beta-3 I ntegrin.
6. The adenoviral construct of claim 1 , wherein the antigen targeting peptide specifically binds prostate specific membrane antigen (PSMA).
7. The adenoviral construct of claim I , wherein X comprises SEQ I D NO:9.
8. An adenoviral construct comprising a nucleic acid sequence encoding the peptide sequence MAE-X-PDP, wherein X is a peptide that specifically binds PSMA.
9. The adenoviral construct of claim 8, wherein X comprises SEQ I D NO:9.
10. An adenoviral construct comprising a nucleic acid sequence encoding the peptide sequence of SEQ I D NO: 10.
1 1 . The adenoviral construct of any o f claims I - 10, wherein the pept ide sequence is inserted into the amino acid sequence encoding adenovirus fiber protein.
12. The adenoviral construct of claim 1 1 , wherein the peptide sequence is inserted into the I l l-loop of adenovirus fiber protein.
13. The adenoviral construct of claim 1 1 , wherein the peptide sequence is inserted into the EG-loop of adenovirus fiber protein.
14. The adenovira l construct of claim I 1 , wherein the peptide sequence is inserted into the IJ-loop of adenovirus fiber protein.
15. The adenoviral construct of any ofclaims 1 - 14, wherein the adenoviral construct is modified to ablate interaction with the natural receptor coxsackie and adenovirus receptor (CAR).
16. The adenoviral construct of claim 1 5, wherein the modification comprises one or more deletions in the nucleic acid sequence encoding adenovirus fiber protein.
17. An adenoviral construct comprising a nucleic acid encoding a tumor antigen targeting peptide inserted into the nucleic acid sequence encoding the capsid fiber protein, wherein a nucleic acid sequence encoding the irimer peptide MAE is located upstream of the nucleic acid encoding a tumor antigen targeting peptide and a nucleic acid sequence encoding the trimer peptide PDP is located downstream of the nucleic acid encoding a tumor ant igen targeting peptide.
18. An adenoviral construct comprising a nucleic acid sequence encoding the peptide sequence M AEWQPDTAHH WALTLPDP inserted into the H l-loop of adenovirus fiber protein.
1 . A pharmaceutical composition comprising the adenoviral construct of any of claims 1 - 18.
20. A method for treating cancer comprising administering a therapeutically effect ive amount of the adenoviral construct of any of claims 1 - 19.
2 1 . A method for optimizing adenoviral infection of target cells comprising the steps of:
a. generating a peptide-display adenovirus library, wherein the displayed peptide is a peptide that specifically binds an antigen expressed on the surface of a target cell, and wherein the displayed peptide is flanked by random peptide sequences; and
b. screening the peptide-display adenovirus library against the target cells.
22. A method comprising:
a. generating a peptide-display virus library, wherein the displayed peptide is a peptide that specifically binds an antigen expressed on the surface of a target cell, and wherein the displayed peptide is flanked by random peptide sequences; and
b. screening the peptide-display virus library against the target cells.
23. The method of claim 22, wherein the virus is selected from the group consisting of adenovirus, herpes simplex virus, influenza virus, Newcastle disease virus, poliovirus, reovirus, vaccinia virus and vesicular virus.
24. The method of claim 22, wherein the virus is a retrovirus.
25. The method of any of claims 21 -24, wherein one or both of the flanking random peptide sequences are selected from the group consisting of monomer dimer, trimer, tetramer, pentamer, hexamer, septamer, octamer, and a nonamer.
26. The method of any of claims 21 -24, wherein the flanking random peptide sequences are multimers.
27. The method of any of claims 21-24, wherein the flanking random peptide sequences are t rimers.
28. The method of any of claims 21-27, wherein the target cell is a cancer cell.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US13/807,359 US9458473B2 (en) | 2010-06-29 | 2011-06-29 | Compositions and methods for retargeting virus constructs |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US35944910P | 2010-06-29 | 2010-06-29 | |
| US61/359,449 | 2010-06-29 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2012006145A2 true WO2012006145A2 (en) | 2012-01-12 |
| WO2012006145A3 WO2012006145A3 (en) | 2012-08-02 |
Family
ID=45441746
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2011/042331 Ceased WO2012006145A2 (en) | 2010-06-29 | 2011-06-29 | Com positions and methods for retargeting virus constructs |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US9458473B2 (en) |
| WO (1) | WO2012006145A2 (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB201804468D0 (en) * | 2018-03-21 | 2018-05-02 | Valo Therapeutics Oy | PeptiCRAd Cancer Therapy |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| IL137681A0 (en) * | 1998-02-06 | 2001-10-31 | Uab Research Foundation | Adenovirus vector containing a heterologous peptide epitope in the hi loop of the fiber knob |
| US7094398B1 (en) * | 1999-06-01 | 2006-08-22 | University Of Washington | Recombinant adenoviral vectors expressing chimeric fiber proteins for cell specific infection and genome integration |
| US6692736B2 (en) * | 2000-03-24 | 2004-02-17 | Cell Genesys, Inc. | Cell-specific adenovirus vectors comprising an internal ribosome entry site |
| US6579522B1 (en) * | 2000-06-27 | 2003-06-17 | Genvec, Inc. | Replication deficient adenoviral TNF vector |
| EP1556082A1 (en) * | 2002-10-22 | 2005-07-27 | Aventis Pasteur Limited | Anti-cancer vaccines and high-dose cytokines as adjuvants |
-
2011
- 2011-06-29 WO PCT/US2011/042331 patent/WO2012006145A2/en not_active Ceased
- 2011-06-29 US US13/807,359 patent/US9458473B2/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| US9458473B2 (en) | 2016-10-04 |
| US20130315870A1 (en) | 2013-11-28 |
| WO2012006145A3 (en) | 2012-08-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8916378B2 (en) | Polynucleotide constructs, pharmaceutical compositions and methods for targeted downregulations of angiogenesis and anticancer therapy | |
| US8642028B2 (en) | Recombinant adenoviruses encoding the specific iodine transporter (NIS) | |
| Rojas et al. | Albumin-binding adenoviruses circumvent pre-existing neutralizing antibodies upon systemic delivery | |
| JP7592493B2 (en) | Fusogenic lipid nanoparticles and methods of making and using the same for target cell specific production of therapeutic proteins and for treatment of target cell associated diseases, illnesses or disorders - Patents.com | |
| Mabjeesh et al. | Gene therapy of prostate cancer: current and future directions. | |
| JP2018533949A (en) | Phagemid vector | |
| JP7794421B2 (en) | Tumor-targeting synthetic adenoviruses and uses thereof | |
| JP2020503390A (en) | Fusogenic lipid nanoparticles, and methods for making and using the same, for target cell-specific production of therapeutic proteins and for treating diseases, conditions, or disorders associated with target cells | |
| US20110071214A1 (en) | Methods and compositions for the treatment of cancer | |
| Wolf et al. | Gene therapy for ovarian cancer | |
| US9458473B2 (en) | Compositions and methods for retargeting virus constructs | |
| Gordon et al. | Lesion-targeted injectable vectors for vascular restenosis | |
| US20060223756A1 (en) | Endothelial cell specifically binding peptides | |
| CN120958136A (en) | Phage vector | |
| Carver et al. | Vectors in gene therapy: Benefit for glioblastoma patients | |
| WO2001070175A2 (en) | Osteocalcin promoter directed adenovirus replicaton for therapy | |
| WO2007127882A2 (en) | An isolated dna fragment of the human a33 promoter and its use to control the expression of a heterologous gene in tumor cells | |
| Qie et al. | An adeno-associated virus vector-based intracellular peptide delivery system for treating hepatocellular carcinoma with wild-type p53 | |
| Jiang | Transcription-Based Molecular Imaging and Gene Therapy for Castration-resistant and Metastatic Prostate Cancer in Translational Models | |
| Jiang | Transcription-Based Molecular Imaging and Gene Therapy for Castration-resistant and | |
| Somiari | Gene Therapy: Methods and Application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 11804172 Country of ref document: EP Kind code of ref document: A2 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 11804172 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13807359 Country of ref document: US |
