WO2012004559A1 - Methods for screening for compounds expected to be useful in the modulating, for example inhibiting, the activity of kiaa1018/mtmr15/fan1. - Google Patents

Methods for screening for compounds expected to be useful in the modulating, for example inhibiting, the activity of kiaa1018/mtmr15/fan1. Download PDF

Info

Publication number
WO2012004559A1
WO2012004559A1 PCT/GB2011/001017 GB2011001017W WO2012004559A1 WO 2012004559 A1 WO2012004559 A1 WO 2012004559A1 GB 2011001017 W GB2011001017 W GB 2011001017W WO 2012004559 A1 WO2012004559 A1 WO 2012004559A1
Authority
WO
WIPO (PCT)
Prior art keywords
fan1
polypeptide
icl
compound
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/GB2011/001017
Other languages
French (fr)
Inventor
John Rouse
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Medical Research Council
Original Assignee
Medical Research Council
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Medical Research Council filed Critical Medical Research Council
Publication of WO2012004559A1 publication Critical patent/WO2012004559A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
    • C12Q1/44—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving esterase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5011—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90—Enzymes; Proenzymes
    • G01N2333/914—Hydrolases (3)
    • G01N2333/916—Hydrolases (3) acting on ester bonds (3.1), e.g. phosphatases (3.1.3), phospholipases C or phospholipases D (3.1.4)
    • G01N2333/922—Ribonucleases (RNAses); Deoxyribonucleases (DNAses)

Definitions

  • the present invention relates to methods for screening for compounds expected to be useful in modulating, for example inhibiting, the activity of a polypeptide considered to be involved in repairing DNA inter-strand crosslinks.
  • DNA inter-strand crosslinks are formed when bifunctional agents covalently link the two strands in a double helix.
  • ICLs are toxic lesions that prevent strand separation necessary for transcription and DNA replication.
  • ICLs can be induced by drugs and also by endogenous metabolites.
  • Cross-linking agents such as mitomycin-C (MMC) and cisplatin generate a mixture of mono-adducts and ICLs in cells but cellular toxicity correlates with the number of ICLs.
  • MMC mitomycin-C
  • cisplatin generate a mixture of mono-adducts and ICLs in cells but cellular toxicity correlates with the number of ICLs.
  • Fanconi Anaemia is an inherited recessive condition characterized by developmental defects, skeletal abnormalities, bone marrow failure and cancer predisposition (Wang, 2007). FA falls into thirteen complementation groups and the relevant FA genes have been cloned (Patel and Joeje, 2007; Wang, 2007). Nevertheless FA patients exist where mutations in known FA genes could not be found.
  • the central components of the FA pathway are FANCD2 and its paralogue FANCI that together form the "ID" complex (Garcia-Higuera et al., 2001; Smogorzewska et al., 2007). These two proteins are mono-ubiquitinated at Lys561 and Lys523, respectively, in S-phase and in response to ICLs (Fig. 8) (Garcia- Higuera et al., 2001 ; Taniguchi et al., 2002).
  • This reaction is catalysed by the E3 ubiquitin ligase FANCL subunit of the FA core complex, that comprises FANCA, B, C, E, F, G, L, and M, and also requires the FA-associated proteins FAAP100 and FAAP24 (Ciccia et al., 2007; Collis et al., 2008; Ling et al., 2007). Furthermore, loss of FANCD2 mono-ubiquitination is observed in many FA patients (Moldovan and D'andrea, 2009).
  • MUS81-EME1 creates a one-ended double-strand break (DSB) that can be used later to initiate homologous recombination (HR).
  • DSB double-strand break
  • HR homologous recombination
  • FAN1 FA-associated nuclease 1
  • REND1 a novel nuclease recruited to sites of DNA damage by mono-ubiquitinated FANCD2 that is important for repair of ICLs.
  • a first aspect of the invention provides a method for identifying a compound expected to be useful in modulating, for example inhibiting, KIAA1018/MTMR15/FAN1 (FAN1 ) endonuclease activity, the method comprising the steps of (1) determining whether a test compound modulates, for example inhibits, the endonuclease activity of a FA 1 polypeptide on a branched polynucleotide substrate and (2) selecting a compound which modulates, for example inhibits, the said FAN1 endonuclease activity.
  • the branched polynucleotide substrate may be, for example, a substrate 5' flap-containing nucleic acid or a replication fork nucleic acid.
  • a second aspect of the invention provides a method for identifying a compound expected to be useful in modulating, for example inhibiting, FAN1 5'-exonuclease activity, the method comprising the steps of (1) determining whether a test compound modulates, for example inhibits, the 5'-exonuclease activity of a FAN1 polypeptide on a substrate polynucleotide and (2) selecting a compound which modulates, for example inhibits, the said FAN1 5 -exonuclease activity.
  • a further aspect of the invention provides a method for identifying a compound expected to be useful in modulating, for example inhibiting, the repair of a DNA inter-strand crosslink (ICL), resolution of an ICL-induced double strand break, or homologous recombination in a cell, the method comprising the steps of (1) determining whether a test compound modulates, for example inhibits, the endonuclease or 5'-exonuclease activity of a FAN1 polypeptide on a substrate polynucleotide and (2) selecting a compound which modulates, for example inhibits, the said FAN1 polypeptide endonuclease or 5 -exonuclease activity.
  • ICL DNA inter-strand crosslink
  • a further aspect of the invention provides a method for identifying a compound expected to be useful in modulating, for example inhibiting, the repair of a DNA inter-strand crosslink, resolution of an ICL-induced double strand break, or homologous recombination in a cell, the method comprising the steps of (1) determining whether a test compound modulates, for example inhibits, the interaction between a FAN1 polypeptide and an ubiquitinylated FANCD2 or FANCI polypeptide and (2) selecting a compound which modulates, for example inhibits, the said interaction between the FAN1 polypeptide and the ubiquitinylated FANCD2 or FANCI polypeptide.
  • a further aspect of the invention provides a method for identifying a compound expected to be useful in increasing cancer cells' sensitivity to ICLs or enhancing the effect of platinum based chemotherapy or other ICL-inducing therapy (for example mitomycin C, nitrogen mustards, nitrosoureas, alkylalkanesulphonate, and Cyclophosphamide, part of the FEC (fluorouracil/etoposide/cyclophosphamide) chemotherapy regimen) on cancer cells, the method comprising the steps of (1) determining whether a test compound modulates, for example inhibits, the endonuclease or 5'-exonuclease activity of a FA 1 polypeptide on a substrate polynucleotide; or the interaction between a FAN1 polypeptide and an ubiquitinylated FANCD2 or FANCI polypeptide, and (2) selecting a compound which modulates, for example inhibits, the endonuclease or 5'-exonuclease activity of
  • the method of the immediately preceding aspect may be particularly useful in increasing cancer cells' sensitivity to ICLs or enhancing the effect of platinum based chemotherapy or other ICL-inducing therapy on cancer cells when the cancer cells are those that have intrinsic or acquired resistance to platinum compounds, as would be understood by a person skilled in the art.
  • cancer cells that may be considered to exhibit intrinsic resistance to platinum compounds include colorectal cancer cells, prostate cancer cells, lung cancer cells and breast cancer cells.
  • An example of cancer cells that may be considered to exhibit acquired resistance to platinum compounds includes ovarian cancer cells.
  • a compound that may be identified by the methods of the invention may be useful in inhibiting lymphocyte, for example T-cell, activity. Such activity may be inhibited, for example, via inhibition of somatic recombination in T-cells. Thus such compound may be useful as an immunosuppressant.
  • a further aspect of the invention provides a method for identifying a compound expected to be useful in modulating, for example inhibiting, the repair of a DNA inter-strand crosslink, resolution of an ICL-induced double strand break, or homologous recombination in a cell, or in increasing cancer cells' sensitivity to ICLs or enhancing the effect of platinum based chemotherapy or other ICL-inducing therapy on cancer cells, the method comprising the steps of (1) determining whether a test compound modulates, for example inhibits, said repair of a DNA inter-strand crosslink, resolution of an ICL-induced double strand break, or homologous recombination in the cell, or the cell's resistance to ICLs or the effect of platinum based chemotherapy or other ICL-inducing therapy on the cell, wherein said determining is done on at least two cells, wherein said cells differ in the amount or activity of FAN1 , and (2) selecting a compound which modulates, for example inhibits, the said repair of a DNA inter-strand crosslink, resolution of an I
  • the methods of the preceding aspect may be useful in screening compounds for their specificity for, for example, FAN1 , and investigating their mode of action. For example, altering the expression levels of FAN1 then testing the compound activity in test cells displaying differing levels of FAN1 expression, may provide information on potential off-target effects of test compounds, i.e. identify whether the test compound interacts with targets in the cell other than FAN1.
  • the endonuclease or 5'-exonuclease activity of the FAN1 polypeptide that is modulated/assessed in the screening method is endonucleolytic or 5'-exonuclease cleavage of a substrate polynucleotide as defined above.
  • Cleavage of the substrate polynucleotide may be assessed by techniques including those discussed further below and in the Examples. For example, fluorescent or radioisotopic labelling of the polynucleotide may be used in assessing cleavage of the nucleic acid, as well known to those skilled in the art. Further methods will be apparent to the skilled person on the basis of this teaching and the many known methods of assessing nucleic acid cleavage.
  • the substrate polynucleotide may be a branched polynucleotide. It is particularly preferred that the branched polynucleotide is a 5' flap-containing nucleic acid or a replication fork nucleic acid. It will be appreciated that the terms “polynucletide” and “nucleic acid” may be used interchangeably herein.
  • a typical substrate 5' flap-containing nucleic acid is shown in Figure 2 A and below.
  • the 5' flap-containing nucleic acid typically has a single-stranded portion of typically 5 or more nucleotides but may be, for example, between 1 and 100 nucleotides.
  • the single-stranded portion may be between 3 and 50 nucleotides, more preferably between 5 and 10 nucleotides.
  • the double stranded portions of the molecule independently typically have at least 5 base pairs, for example between 5 and 100 base pairs.
  • the double stranded portion may be between 10 and 50 base pairs, more preferably 20 base pairs.
  • Each of the three double stranded portions of the molecule independently typically has at least 5 base pairs, for example between 10 and 50 base pairs, such as 20 base pairs.
  • nucleic acid will be deoxyribose nucleic acid.
  • the nucleic acids may include naturally occurring or wholly or partially synthetic DNA, e.g., cDNA and genomic DNA.
  • the nucleic acids may be labelled, for example, with radioactive isotopes, such as 32 P, 3 H, and 14 C.
  • the nucleic acids may be labelled with non-radioactive probes, for example chemiluminescent or fluourescent probes, as would be understood in the art.
  • the substrate nucleic acids may be labelled with a tag to enable purification, fixing to a solid support and/or other manipulation to be carried out, as would be understood in the art.
  • the nucleic acid may be labelled with biotin to allow binding to an appropriate support labelled with an avidin compound, such as streptavidin.
  • the substrate nucleotides are produced by annealing oligonucleotides using standard techniques known in the art.
  • the endonuclease or exonuclease activity may be increased or reduced by an alteration in the V max or the K m (or both) of the FAN1 polypeptide for a particular substrate.
  • activity may be increased by an increased V ma x or decreased K m . It will be appreciated that it may not be necessary to determine the value of either V ma x or K m in order to determine whether the FA 1 polypeptide has been activated or deactivated.
  • Activity may be measured as the amount of a substrate cleaved in a given time; a change of activity may therefore be detected as a change in the amount of substrate (for example, at a single concentration) that is cleaved in a given time. It is preferred that the activity is increased or decreased, as appropriate, by at least 2, preferably 5, 10, 15, 20, 25, 30 or 50-fold.
  • the FAN1 polypeptide is wild type human FAN1 polypeptide or a fragment thereof, or a fusion either thereof.
  • the fragment comprises at least the VPR- nuc domain. Nevertheless, the VPR-nuc domain is not considered to be required for interaction with FANCD2 or FANCI.
  • the VRR-nuc domain is located at amino acid 871- 1009 of human FAN1 (the sequence of which is provided below) or residues equivalent thereto.
  • the UBZ domain may be included in the fragment, but this is not required for activity of FAN .
  • the UBZ domain is located at amino acids 41-69 of human FAN1 or residues equivalent thereto.
  • the fragment may also comprise the SAP domain, which is located at amino acid numbers 461-504 of human FAN1 or residues equivalent thereto.
  • the fragment of FAN1 will comprise at least the VRR-nuc and generally the SAP domain.
  • the fragment may thus correspond to at least residues 460-1017 of human FAN1 , or residues equivalent thereto.
  • the fragment may comprise at least residues 41-69 of human FAN1.
  • Full length human FAN1 may be used in all aspects of the invention, or fragments thereof containing the relevant domains according to the requirements of the assay.
  • FAN1 Plasmid constructs that may be used to express FAN1 are well known to those skilled in the art.
  • FAN1 may be expressed using a bacterial expression plasmid with a NUS (N-utilization substance) and a hexahistidine tag.
  • FAN1 may be expressed using the pET43.1A bacterial expression plasmid.
  • FAN1 may be cloned into, for example, pFASTBAC.
  • the human FAN1 polypeptide and polynucleotide sequence is shown below and is shown at GenBank N _014967 for nucleic acid sequence and Uni-Prot Q9Y2M0 for amino acid sequence.
  • GenBank N _014967 for nucleic acid sequence
  • Uni-Prot Q9Y2M0 for amino acid sequence.
  • the skilled person will readily be able to identify other FAN1 polypeptide sequences from databases.
  • the Homologene feature of the NCBI database may be used.
  • the nucleotide sequence of human FAN1 (GenBank ref: NM_014967) (SEQ ID NO: 1) may be found below:
  • amino acid sequence of human FAN1 (Uni-prot ref: Q9Y2M0) (SEQ ID NO: 2) (SEQ ID NO: 2) (SEQ ID NO: 2) (SEQ ID NO: 2) (SEQ ID NO: 2) (SEQ ID NO: 2) (SEQ ID NO: 2) (SEQ ID NO: 2) (SEQ ID NO: 2) (SEQ ID NO: 2) (SEQ ID NO: 2) (SEQ ID NO: 2) (SEQ ID NO: 2)
  • the human FANCD2 polypeptide and polynucleotide sequences are shown below and are shown at GenBank ref: NM 033084.3 and Uni-Prot ref: Q9BXW9.
  • GenBank ref NM 033084.3
  • Uni-Prot ref Q9BXW9.
  • the skilled person will readily be able to identify other FANCD2 polypeptide sequences from databases.
  • the Homologene feature of the NCBI database may be used.
  • the nucleotide sequence of human FANCD2 (GenBank ref: NM_033084.3) (SEQ ID NO: 3) may be found below:
  • the human FANCI polypeptide and polynucleotide sequences are shown below and are shown at GenBank ref: NM_001113378.1 and Uni-Prot ref: Q9NVI1.
  • GenBank ref NM_001113378.1
  • Uni-Prot ref Q9NVI1.
  • the skilled person will readily be able to identify other FANCI polypeptide sequences from databases.
  • the Homologene feature of the NCBI database may be used.
  • the nucleotide sequence of human FANCI (GenBank ref: NM_001113378.1) (SEQ ID NO: 5) may be found below:
  • the amino acid sequence of human FANCI (Uni-prot ref: Q9NVI1) (SEQ ID NO: 6) may be found below:
  • the FAN1 or FANCD2 or FANCI polypeptide may comprise a tag sequence, as will be well known to those skilled in the art.
  • a tag useful in a FRET system may be used.
  • a fluorescent protein tag for example a Cherry tag may be used.
  • a GST moiety or Green Fluorescent Protein (GFP) moiety or a FLAG moiety may alternatively be used.
  • the FAN1 or FANCD2 or FANCI is a full length FAN1 or FANCD2 or FANCI polypeptide.
  • the FAN1 polypeptide may be a NUS-His 6 fusion polypeptide.
  • the FAN1 polypeptide may be recombinant.
  • the FAN1 polypeptide is typically human FAN1 , but may alternatively be another mammalian FA 1 , for example FAN1 of a laboratory animal or of a tissue or organ assay system considered useful in assessing a potential inhibitor of FAN1.
  • the FAN1 may be a laboratory rodent FAN (for example mouse, rabbit or rat) or may be a laboratory primate FAN1 , for example a monkey FAN1.
  • An assay of the present invention may, for example, be useful in assessing the effect of a test compound on FAN1 in tissue of a laboratory animal, for example a mouse or a monkey.
  • a mouse human tumor xenograft model may be used to assess the effect of a test compound on FAN1.
  • FAN1 polypeptide has at least 30% of the enzyme activity of full-length human FAN1 on a polynucleotide substrate as defined herein.
  • a particularly preferred substrate is the 5' flap shown in Figure 2A. It is more preferred if the FAN1 polypeptide has at least 50%, preferably at least 70% and more preferably at least 90% of the enzyme activity of full-length human FAN1 on a polynucleotide substrate as defined herein.
  • variants of a polypeptide we include insertions, deletions and substitutions, either conservative or non-conservative.
  • variants of the polypeptide where such changes do not substantially alter the endonuclease or 5'-exonuclease activity, or the interaction between FAN1 and FANCD2 or FANCI polypeptide, as appropriate.
  • the skilled person will readily be able to design and test appropriate variants, based on, for example, comparison of sequences of examples of each polypeptide, for example from different species.
  • the skilled person will readily be able to determine where insertions or deletions can be made; or which residues can appropriately be left unchanged; replaced by a conservative substitution; or replaced by a non-conservative substitution.
  • the variant polypeptides can readily be tested, for example as described in the Examples.
  • the FAN1 polypeptide retains a functional UBZ domain, for example retains Cys44 and Cys47, as discussed in the Examples.
  • substitutions are intended combinations such as Gly, Ala; Val, lie, Leu; Asp, Glu; Asn, Gin; Ser, Thr; Lys, Arg; and Phe, Tyr.
  • Xaa represents any amino acid. It is preferred that at least the amino acids corresponding to the consensus sequences defined herein are L-amino acids.
  • the polypeptide variant has an amino acid sequence which has at least 65% identity with the amino acid sequence of the relevant human polypeptide, more preferably at least 70%, 71%, 72%, 73% or 74%, still more preferably at least 75%, yet still more preferably at least 80%, in further preference at least 85%, in still further preference at least 90% and most preferably at least 95% or 97% identity with the amino acid sequence of the relevant human polypeptide.
  • the FAN1 variant has an amino acid sequence which has at least 65% identity with the amino acid sequence of the catalytic domain of the human polypeptide, more preferably at least 70%, 71%, 72%, 73% or 74%, still more preferably at least 75%, yet still more preferably at least 80%, in further preference at least 83 or 85%, in still further preference at least 90% and most preferably at least 95% or 97% identity with the relevant human amino acid sequence.
  • the location of the catalytic domain is discussed above and in the Examples.
  • the percent sequence identity between two polypeptides may be determined using suitable computer programs, for example the GAP program of the University of Wisconsin Genetic Computing Group and it will be appreciated that percent identity is calculated in relation to polypeptides whose sequence has been aligned optimally.
  • the alignment may alternatively be carried out using the Clustal W program (Thompson et a/., 1994). The parameters used may be as follows:
  • Fast pairwise alignment parameters K-tuple(word) size; 1 , window size; 5, gap penalty; 3, number of top diagonals; 5. Scoring method: x percent.
  • the alignment may alternatively be carried out using the program T-Coffee, or EMBOSS.
  • the residue corresponding (equivalent) to, for example, Cys44 of full-length human FAN1 may be identified by alignment of the sequence of the polypeptide with that of full- length human FAN1 in such a way as to maximise the match between the sequences.
  • the alignment may be carried out by visual inspection and/or by the use of suitable computer programs, for example the GAP program of the University of Wisconsin Genetic Computing Group, which will also allow the percent identity of the polypeptides to be calculated.
  • the Align program Pierson (1994) in: Methods in Molecular Biology, Computer Analysis of Sequence Data, Part II (Griffin, AM and Griffin, HG eds) pp 365- 389, Humana Press, Clifton).
  • residues identified in this manner are also "corresponding residues". It will be appreciated that in the case of truncated forms of (for example) FAN1 or in forms where simple replacements of amino acids have occurred it is facile to identify the "corresponding residue”.
  • polypeptides used in the screen are mammalian, preferably human (or a species useful in agriculture or as a domesticated or companion animal, for example dog, cat, horse, cow), including naturally occurring allelic variants (including splice variants).
  • the polypeptides used in the screen may comprise a GST portion or may be biotinylated or otherwise tagged, for example with a 6His, HA, myc or other epitope tag, as known to those skilled in the art, or as mentioned above or as described in the Examples. This may be useful in purifying and/or detecting the polypeptide(s).
  • the substrate polynucleotide may consist of or comprise the structure of the 5' flap polynucleotide identified in Figure 2A, which is efficiently cleaved in vitro. Modifications to the length and structure such that the utility of the substrate in the methods of the invention may be improved are standard in the art as would be understood by a person of skill in the art.
  • Binding of the FAN1 polypeptide to an ubiquitinylated FANCD2 or FANCI polypeptide may be assessed by any suitable technique for assessing protein: protein interaction.
  • the interaction between polypeptides may be detected using fluorescence resonance energy transfer; immunoprecipitation; subcellular fractionation or imaging; surface plasmon resonance (SPR); or isothermal titration calorimetry.
  • immunoprecipitation may be with an antibody that binds specifically to FAN1 ; or may be with an antibody that binds specifically to an ubiquitinylated FANCD2 or FANCI polypeptide, as will be apparent to the skilled person.
  • immunoprecipitation may be with an antibody that binds specifically to a tag present on recombinant FAN1 ; or with an antibody that binds specifically to a tag present on a recombinant FANCD2 or FANCI polypeptide, as will also be apparent to the skilled person.
  • FAN1 coupled with either ubiquitinylated FANCD2 or FANCI co- pull down or an anti- ubiquitinylated FANCD2 or FANCI antibody can be carried out using Invitrogen's Alpha-Elisa technologies, which would be useful in achieving a high throughput screening system.
  • Multiplex assays using Luminex beads or plate based electrochemiluminescence (MSD; meso scale discovery) detection could also be used.
  • Quantitative Stable Isotope Labelling with Amino acids in Cell culture may be used to identify and quantitate proteins associated with immunoprecipitates of FAN1 or ubiquitinylated FANCD2 or FANCI.
  • Other immunoprecipitate methods may be used, as will be well known to those skilled in the art.
  • labeled ubiquitinylated FANCD2 or FANCI may be used. Some examples of such methods are described in the Examples.
  • other techniques for assessing protein protein interactions in cells or cell extracts may also be used.
  • a fluorescence resonance energy transfer (FRET) based system may be used if the interaction of a recombinant FAN1 and recombinant ubiquitinylated FANCD2 or FANCI is being assessed, for example if both FAN1 and ubiquitinylated FANCD2 or FANCI polypeptide are both tagged with a fluorescent polypeptide.
  • FRET fluorescence resonance energy transfer
  • FRET-based method such as FLI -FRET on a microscope such as a multiphoton microscope.
  • a construct for expressing Cherry-tagged wild type ubiquitinylated FANCD2 or FANCI or (as a control) an inactive mutant of FANCD2 or FANC1 that does not bind FAN1 may be transfected into a cell line stably expressing wild type GFP-FAN1 or control polypeptide.
  • FRET fluorescence resonance energy transfer
  • FLIM fluorescence lifetime imaging microscopy
  • FRET pairs include CFP (donor) and YFP (acceptor) as well as GFP (donor) and Cherry (acceptor).
  • CFP donor
  • YFP acceptor
  • GFP conjugated FRET
  • Cherry acceptor
  • FRET enhanced acceptor fluorescence
  • Examples of further references concerning FRET techniques include Wallrabe & Periasamy (2005) Current Opinion in Biotechnology Volume 16, Issue 1 , February 2005, Pages 19-27; Imaging protein molecules using FRET and FLIM microscopy; Ai et al (2008) Nature Methods 5, 401-403 Fluorescent protein FRET pairs for ratiometric imaging of dual biosensors; Shaner et al. (2004) Nat Biotechnol 22: 1567-1572 Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein.
  • the compounds identified in the methods may themselves be useful as a drug or they may represent lead compounds for the design and synthesis of more efficacious compounds.
  • the compound may be a drug-like compound or lead compound for the development of a drug-like compound for each of the above methods of identifying a compound. It will be appreciated that the said methods may be useful as screening assays in the development of pharmaceutical compounds or drugs, as well known to those skilled in the art.
  • drug-like compound is well known to those skilled in the art, and may include the meaning of a compound that has characteristics that may make it suitable for use in medicine, for example as the active ingredient in a medicament.
  • a drug-like compound may be a molecule that may be synthesised by the techniques of organic chemistry, less preferably by techniques of molecular biology or biochemistry, and is preferably a small molecule, which may be of less than 5000 daltons.
  • a drug-like compound may additionally exhibit features of selective interaction with a particular protein or proteins and be bioavailable and/or able to penetrate cellular membranes, but it will be appreciated that these features are not essential.
  • lead compound is similarly well known to those skilled in the art, and may include the meaning that the compound, whilst not itself suitable for use as a drug (for example because it is only weakly potent against its intended target, non-selective in its action, unstable, difficult to synthesise or has poor bioavailability) may provide a starting- point for the design of other compounds that may have more desirable characteristics. It will be understood that it will be desirable to identify compounds that may modulate the endonuclease activity or 5'exonuclease activity of a FAN1 polypeptide in vivo.
  • reagents and conditions used in the method may be chosen such that the interactions between, for example, the FAN1 polypeptide and a substrate nucleic acid, are substantially the same as between the human FAN1 and an endogenous human substrate nucleic acid.
  • a method of the invention may be performed in a human cell-based system, optionally expressing human recombinant polypeptides.
  • the compounds that are tested in the screening methods of the invention or in other assays in which the ability of a compound to modulate the endonuclease activity or 5'exonuclease activity of a FAN1 polypeptide, may be measured may be (but do not have to be) compounds that have been selected and/or designed (including modified) using molecular modelling techniques, for example using computer techniques.
  • the selected or designed compound may be synthesised (if not already synthesised) and tested for its effect on the FAN1 polypeptide, for example its effect on the endonuclease activity or 5'exonuclease activity.
  • the compound may be tested in a screening method of the invention.
  • the compounds that are tested may be compounds that are already considered likely to be able to modulate the activity of an endonuclease or 5'exonuclease; or may be compounds that have not been selected on the basis of being likely to modulate the activity of an endonuclease or 5'exonuclease.
  • the compounds tested may be compounds forming at least part of a general, unselected compound bank; or may alternatively be compounds forming at least part of a pre-selected compound bank, for example a bank of compounds pre-selected on the basis of being considered likely to modulate the activity of an endonuclease or 5'exonuclease.
  • screening assays which are capable of high throughput operation will be particularly preferred. Examples may include cell based assays and protein-protein binding assays. As will be apparent to those skilled in the art, it may be desirable to assess what effect the compound has on other endonucleases or 5'exonucleases.
  • the screening methods of the invention may comprise the step of synthesising, purifying and/or formulating the selected compound.
  • the compound may be formulated for pharmaceutical use, for example for use in in vivo trials in animals or humans.
  • a further aspect of the invention provides a purified preparation or kit of parts comprising a FA 1 polypeptide or polynucleotide; and a substrate polynucleotide as defined above and/or a FANCD2 or FAN CI polypeptide.
  • kits for performing in vitro assays may comprise a FA 1 polypeptide or polynucleotide, a fluorescently labelled DNA flap substrate, and a suitable buffer comprising divalent cations, such as g 2+ , Mn 2+ , Zn 2+ , Co 2+ , Cu 2+ and/or Ca 2+ .
  • DNA flap substrates may be assembled by annealing oligonucletides, for example where one oligonucletode comprises label, such as a chromophore or dye.
  • the preparation or kit may comprise a recombinant FAN1 polynucleotide.
  • the kit of parts may further comprising ubiquitin or dithiobis (succinimidyl propionate) (DSP) or a de-ubiquitinase inhibitor, for example N-ethyl maleimide (NEM).
  • DSP ubiquitin or dithiobis
  • NEM de-ubiquitinase inhibitor
  • purified is meant that the preparation has been at least partially separated from other components in the presence of which it has been formed, for example other components of a recombinant cell. Examples of methods of purification that may be used are described in the Examples.
  • the preparation may be substantially pure.
  • substantially pure we mean that the said polypeptide(s) are substantially free of other proteins.
  • any composition that includes at least 2, 3, 4, 5, 10, 15, 20 or 30% of the protein content by weight as the said polypeptides, preferably at least 50%, more preferably at least 70%, still more preferably at least 90% and most preferably at least 95% of the protein content is the said polypeptides.
  • the invention also includes compositions comprising the said polypeptides and a contaminant wherein the contaminant comprises less than 96, 95, 94, 90, 85, 80 or 70% of the composition by weight, preferably less than 50% of the composition, more preferably less than 30% of the composition, still more preferably less than 10% of the composition and most preferably less than 5% of the composition by weight.
  • the invention also includes the substantially pure said polypeptides when combined with other components ex vivo, said other components not being all of the components found in the cell in which said polypeptides are found.
  • a further aspect of the invention provides a mutant FAN1 polypeptide or polynucleotide wherein Asp 981 and/or Arg982 are mutated, optionally to alanine; and/or wherein Cys44 and/or Cys47 are mutated, optionally to alanine.
  • a further aspect of the invention provides the use of a FAN1 polypeptide in an in vitro method of resolving a DNA ICL.
  • a further aspect of the invention provides an in vitro method of resolving a DNA ICL, the method comprising the step of using a FAN1 polypeptide.
  • the screening method of the invention may comprise the step of assessing whether the compound modulates the repair of a DNA inter-strand crosslink, resolution of an ICL- induced double strand break, or homologous recombination in a cell, or in increasing cancer cells' sensitivity to ICLs or enhancing the effect of platinum based chemotherapy or other ICL-inducing therapy on cancer cells, in a whole cell, tissue or organism; and a compound that modulates the activity or therapeutic response is selected.
  • the method may further comprise the step of assessing whether the compound modulates the activity of a FAN1 polypeptide in the whole cell, tissue or organism, and a compound that modulates the activity is selected.
  • the method may further comprise the step of synthesising, purifying and/or formulating the selected compound.
  • a further aspect of the invention provides a method for preparing a compound which modulates the activity of a FAN1 polypeptide, the method comprising 1) performing a method according to the invention and 2) synthesising, purifying and/or formulating the selected compound.
  • a further aspect of the invention provides a method of characterising a patient with cancer and/or suspected Fanconi Anaemia, the method comprising the step of assessing the patient's genotype or phenotype for FAN1.
  • the method may include the step of assessing the expression level of FAN1 polynucleotide or polypeptide in the patient.
  • the method of characterising a patient with cancer or suspected Fanconi Anaemia may further comprise the step of assessing the patient's genotype or phenotype for SLX4 and/or SLX1. It is envisaged that such methods may aid in the diagnosis of cancer or Fanconi Anaemia. It is further envisaged that an appropriate treatment regime may be chosen based on the genotype or phenotype identified above.
  • FIG. 1 The KIAA1018/MTMR15/FAN1 family of proteins.
  • A Schematic representation of the domain architecture of KIAA1018/MTMR15/FAN1 orthologues from different species. The relevant protein identification codes are: Homo sapiens Q9Y2 0; Danio rerio Q1 LWH4; Caenorhabditis elegans P90740; Schizosaccharomyces pombe Q9Y804; Arabidopsis thaliana Q9SX69; Oryza sativa B9FRR6; Pseudomonas aeruginosa Q9I2N0.
  • B Alignment of the VRR_nuc domain of FAN1.
  • Recombinant human FAN1 was incubated with synthetic DNA structures: splayed duplex (SD; oligos a3, b), 3' flap (3'F; oligonucleotides a3, b, d3), 5' flap (5'F; oligos a3, b, c) or a replication fork (RF)-Nke structure (oligos a3, b, c, d3), each radioactively 5'- 32 P- labelled on the strands indicated.
  • WT refers to wild-type FAN1 and DR refers to the Asp981Ala-Arg982Ala FAN1 mutant.
  • A Schematic diagram of the DNA substrates used in A.
  • Recombinant human FAN1 was incubated for the time indicated (s, seconds) with dsDNA (oligonucleotide a3, a3-cp), ssDNA (oligonucleotide a3) or with a 5' flap (5'F; oligonucleotides a3, b, c) radioactively 5'- or 3'- 32 P-labelled on the a3 strand as shown (asterisks).
  • WT refers to wild-type FAN1 and DR refers to the Asp981Ala-Arg982Ala FAN1 mutant. Reaction products were subjected to denaturing PAGE.
  • A. Cleavage of linear DNA substrates.
  • B The cleavage products were quantitated.
  • Fraction DNA cut is the ratio of the relevant cleavage product to total DNA (cleaved plus uncleaved DNA). The data are plotted as a function of time, and fitted to single or double exponential functions.
  • HEK293 Flp-ln cells that stably express GFP-FAN1 were lysed in the presence of dithiobis (succinimidyl propionate) (DSP) or N-ethyl maleimide (NEM). These extracts together with extracts of cells that express GFP only were subjected to immunoprecipitation with GFP-Trap beads and after extensive washing precipitates were subjected to SDS-PAGE. The gel was fixed and stained with Colloidal Blue. The gel lane containing FAN1 -associated proteins was cut into slices, as indicated, and the proteins were digested with trypsin before mass spectrometric fingerprinting. B.
  • DSP dithiobis
  • NEM N-ethyl maleimide
  • HEK293 Flp-ln cells that stably express GFP-FAN1 were lysed in the presence or absence of DSP and extracts were subjected to immunoprecipitation with control anti-HA (IgG) or GFP-Trap beads. Precipitates were analysed by western blotting with the antibodies indicated. Input represents 4% of the extract used for immunoprecipitation.
  • D represents 4% of the extract used for immunoprecipitation.
  • Extracts of HEK293 cells were analysed by size exclusion chromatography on a HiLoad 26/60 Superdex 200 column in buffer containing 0.2 M NaCI, and every third fraction was denatured and analysed by western blotting with the indicated antibodies.
  • the elution positions of Dextran blue (2 MDa), thyroglobulin (670 kDa) and bovine ⁇ -globulin (158 kDa) are shown.
  • HEK293 cells were transiently transfected with pcDNA5.1-GFP-FAN1 wild type (WT) or pcDNA5.1-GFP-FAN1-UBZ * (Cys44A/Cys47A). After 48 h, cells were lysed in the presence or absence of DSP and anti-GFP precipitates were analysed by western blotting with the antibodies indicated. "Input" represents cell extracts.
  • HEK293 cells stably expressing GFP-FAN1 were transiently transfected with pDEST40-lacZ ("-"), pDEST40-V5-FANCD2 wild -type (WT) or pDEST40-V5-FANCD2 K561 R. After 48 h, cells were lysed in the presence of DSP and anti-GFP precipitates were analysed by western blotting with the antibodies indicated.
  • F. FANCD2 -/- (PD20) cells stably transfected with empty vector (-), FANCD2 wild-type (WT) or FANCD2 K561 R were transiently transfected with GFP-FAN1.
  • FIG. 6 FAN1 is required for DNA repair
  • A.HEK293 cells were transfected with the siRNAs indicated. Clonogenic survival assays were carried out with cisplatin or mitomycin-C (see Experimental Procedures). For each siRNA, cell viability of untreated cells is defined as 100%.
  • HEK293 cells transfected with control siRNA or FAN1 siRNA (FAN1-1) were treated with cisplatin (1 mg/ml) for 2 h and then allowed to recover for the times indicated.
  • the proportion of cells in each population with more than two ⁇ - ⁇ 2 ⁇ foci at each timepoint (" ⁇ - ⁇ 2 ⁇ positive") was determined. The experiment was done three times and a representative experiment is shown.
  • D The frequency of chromosome breaks and radial chromosomes in metaphase spreads of HEK293 cells transfected with control siRNA or FAN1-1 siRNA was measured before and after exposure to MMC (10 ng/ml; 2 h) or to IR (3 Gy; 18h) was measured as described previously (Deans and West, 2009). Data in A, C are represented as mean ⁇ SEM.
  • U20S cells in which an 18 bp sequence recognized by l-Scel was placed between tandem mutant copies of the gene encoding GFP, were transfected with control siRNA (luciferase) and/or siRNAs specifically targeting FAN1 (FAN-1 or FAN-2) or RAD51. After 48 h, cells were transfected with a plasmid expressing l-Scel or with an empty vector, and 24 h later, cells were tested for GFP expression by FACS analysis. The frequency of HR in cells transfected with the various siRNAs was calculated relative to cells transfected with control siRNA.
  • siRNA luciferase
  • ICL repair is initiated by the convergence of two replication forks on the ICL.
  • Various signaling proteins including the Fanconi Anemia (FA) complex are recruited to the vicinity of the blocked replisome. This triggers the mono-ubiquitination of FANCD2 and its paralogue FANCI at Lys561 and Lys523 respectively, that in turn directs subsequent steps of ICL repair by unknown mechanisms.
  • Cleavage of the leading strand template of one of the forks by MUS81 in concert with cleavage of the same strand on the opposite side of the ICL by a second nuclease would unhook the ICL.
  • WT refers to wild-type FAN1 and DR refers to the Asp981Ala-Arg982Ala FAN1 mutant. Reaction products were subjected to denaturing PAGE (12% polyacrylamide, 8 M urea).
  • C Schematic diagram of the DNA substrates used in B. (SEQ ID NOS: 51 and 52). Fig. 10 Exonuclease activity of FAN1 on recessed DNA ends, Related to Figure 3
  • Recombinant human FAN1 was incubated with dsDNA (oligos a3-cp and a3-l25) with a recessed end in which the shorter strand (a3-l25) on the 5' end (A) or 3' end (B).
  • WT refers to wild-type FAN1
  • DR refers to the Asp981Ala-Arg982Ala FAN1 mutant.
  • Reaction products were subjected to denaturing PAGE (12% polyacrylamide, 8 M urea). Asterisks denotes the DNA end that was labelled.
  • U20S cells were exposed to MMC (10 ng/ml) for 18h, or left untreated. Cells were fixed, permeabilised, washed and blocked before incubation with sheep anti-FAN1 antibodies generated as part of this study, or with anti-FANCD2 antibodies. After washing, coverslips were incubated with secondary antibodies, stained with DAPI, mounted on glass slides and visualised.
  • B U20S cells, grown on glass coverslips, were transiently transfected with pcDNA5.1-GFP-FAN1. Cells were treated, or not, with MMC and after 18h cells were fixed, permeabilised, washed and blocked before incubation with anti-GFP or anti-FANCD2 antibodies.
  • Fig. 12 Effect of FAN1 depletion on cell sensitivity to genotoxins and on ubiquitination of FANCD2 and FANCI, Related to Figure 6
  • HEK293 cells were transfected with control siRNA (CON) or siRNA specifically targeting FAN1 (REND-1 or REND-2) or FANCA. After 48 h, cell extracts were subjected to western blotting with the indicated antibodies.
  • B. HEK293 cells were seeded in 10 cm 2 dishes at 25% confluence and allowed to adhere overnight. Cells were transfected with the relevant siRNA for 48 h and cells were split and seeded in 10 cm 2 dishes (5000 cells/dish). Cells were allowed to adhere for 8 h and exposed to the indicated doses of IR or UV before being incubated at 37°C for 10-14 days.
  • genotoxins were added at the concentrations indicated for 24 h: camptothecin, 6- thioguanine or hydroxyurea. Cells were then washed free of genotoxin and incubated in fresh medium for 0-14 days before the number of colonies of >50 cells in each dish were counted. For each siRNA, cell viability of untreated cells is defined as 100%. Data represented as mean ⁇ SEM.
  • C. HEK293 cells were transfected with the control (CON) siRNA or siRNAs targeting FAN1 or FANCA. After 48 h, cells were treated with cisplatin for the indicated times and lysed. Cell extracts were subjected to western blotting with antibodies against FANCD2 (left panels) or FANCI (right panels).
  • SCEs were scored for 60 mitotic spreads for HEK293 cells transfected with the relevant siRNA (D2, FANCD2; F1 , FAN1-1) in the presence the indicated dose of MMC. Each point represents the total number of SCEs in a single mitotic spread.
  • repair may be initiated by collision of a single replisome with an ICL followed by MUS81- catalysed generation of a one-ended DSB. It is possible that the 5' endonuclease activity of FAN1 makes an incision in the D-loop created by strand invasion, allowing the resulting 5' end to be ligated to the invading strand that was extended. This would regenerate an intact replication fork from which DNA replication can continue.
  • Fig. 15 GFP-FAN1 -associated proteins identified by mass spectrometry, Related to Figure 4
  • Gel slices 9-16 came from the gel lane containing GFP-FAN1 precipitates from cells lysed in the presence of DSP (Fig. 4A).
  • Gel slices 17- 24 came from the gel lane containing GFP-FAN1 precipitates from cells lysed in the presence of NEM (Fig. 4A). Only proteins that were also present in FLAG-FAN 1 precipitates (data not shown), and that were not present in GFP-only precipitates, are listed.
  • Example 1 KIAA1018/FAN1 (FAN1) is a flap endonuclease involved in DNA repair that is recruited to DNA damage by mono-ubiquitinated FANCD2
  • DNA inter-strand crosslinks are highly toxic because they block the progression of replisomes.
  • the Fanconi Anemia (FA) proteins encoded by genes that are mutated in FA, are important for repair of ICLs.
  • the FA core complex catalyses the mono- ubiquitination of FANCD2 and this event is essential for several steps of ICL repair.
  • mono-ubiquitination of FANCD2 promotes ICL repair at the molecular level is unknown.
  • KIAA1018/MT R15/FAN1 a novel and highly conserved protein, KIAA1018/MT R15/FAN1 , that interacts with, and is recruited to sites of DNA damage by, the mono-ubiquitinated form of FANCD2.
  • FAN1 exhibits endonuclease activity towards 5' flaps and has 5'-exonuclease activity and these activities are mediated by an ancient VRR-nuc domain. Depletion of FAN1 from human cells causes hypersensitivity to ICLs, defects in ICL repair and genome instability. These data at least partly explain how ubiquitination of FANCD2 promotes DNA repair.
  • DSP dithiobis (succinimidyl propionate; Pierce) is a homobifunctional and thiol-cleavable crosslinker that was used according to the manufacturers instructions. DSP was included in lysis buffer at 2.5 mg/ml and lysates were incubated for 30 min on ice. Excess DSP was quenched by adding 75 ⁇ 1 M Tris- HCI (pH 7.4) followed by an additional 30 min incubation. Crosslinks were reversed by the inclusion of dithiothreitol in SDS-PAGE sample buffer added to cell extracts or immunoprecipitates before electrophoresis. Details of immunofluorescence are given in Supplementary Information.
  • the primary antibodies used in this study were the following: FAN1 (this study; sheep S420C, 4 th bleed), MLH1 (BD Pharminigen, 554073), PMS2 (Santa Cruz, sc-617), PCNA (Santa Cruz, PC10), FANCI (Bethyl, A301-354), FANCD2 (Abeam, ab2187-50), FANCD2 (Novus, NB100-182; immunofluorescence), FANCA (Cascade Biosciences, abm6202), FANCC (Cascade Biosciences, abp6305), FANCE (a kind gift from KJ Patel), FANCF, FANCG (kind gifts from Johan De Winter), FLAG (Sigma, M2), Ku80 (Cell Signaling, 2753), RAD51 (Santa Cruz, H-92), RPA70 (Cell Signaling, 2267) and anti-y-H2AX (Bethyl, A300-081A).
  • FAN1 this study;
  • the FAN1 antibody raised in sheep against full-length FAN1 fused to GST, at the Scottish Antibody Production Unit (SAPU; Carluke, Lanarkshire) was affinity purified using immobilised antigen.
  • GFP-Trap beads were from Chromotek. Protein G Sepharose was from GE Healthcare. Cells were lysed in ice-cold buffer: [40 mM HEPES (pH 7.4), 120 mM NaCI, 1% (v/v) Triton X-100, 1 mM EDTA] with protease inhibitors (Roche).
  • Benzonase Sigma was included in the lysis buffer and lysates were incubated on ice for 30 min. All immunoprecipitations were carried out in lysis buffer for 1 h at 4°C. Endogenous immunoprecipitations were carried out using 2 ⁇ g of FAN1 antibody coupled to 10 ⁇ protein G sepharose per 4 mg of whole cell extract.
  • Flpln T-Rex cells (Invitrogen) cells stably expressing GFP-FAN1 in a tetracycline- inducible manner were made according to the manufacturers instructions with FAN1 in plasmid pcDNA5-FRT-TO-GFP-FAN1. FAN1 was induced and purified according to a previously-described protocol (Munoz et al., 2009).
  • RNAs were transfected with the relevant siRNA duplex (100 nM) using the calcium phosphate precipitation method.
  • Fig. 7 U20S cells were transfected in 96-well plates using siRNAs at a concentration of 20 nM and DharmaFECT 1 (Dharmacon) at a 1 :1000 concentration. Cells were incubated at 37°C for 48 h.
  • the mRNA target sequences used for siRNAs were:
  • FANCA (GGGUCAAGAGGGAAAAAUA) (SEQ ID NO: 7), FAN1-1 (GUAAGGCUCUUUCAACGUA; exon 3) (SEQ ID NO: 8), FAN1-2 (GCAGGAAGGCAGAGUGGCU; exon 12) (SEQ ID NO: 9), MLH1 (GCAUGUGGCUCAUGUUAC) (SEQ ID NO: 10), ATR (GGGAGCCUGUUGAGACAAGAU) (SEQ ID NO: 11), FANCD2 (siGenome SMARTPool from Dharmacon).
  • a3-cp 5'-CGACTTCCGGTAGCACGTAGCAGCGCGTCAACTGGTTGGT
  • HEK293 cells were seeded in 10 cm 2 dishes at 25% confluence and allowed to adhere overnight. Cells were transfected with the relevant siRNA for 48 h and cells were split and seeded in 10 cm 2 dishes (5000 cells/dish). Cells were allowed to adhere for a minimum of 8 h before cisplatin or mitomycin-C were added at the indicated concentrations for 24 h. Cells were then washed free of drugs and incubated in fresh medium for 10-14 days before the number of colonies of >50 cells in each dish were counted. C. elegans genotoxin sensitivity assays
  • synchronized L1 larval stage animals of the relevant genotype were incubated at 20°C for 16 h in 1 ml S-basal buffer (0.1m NaCI, 0.05M KH 2 P0 4 , pH 6.0, 5 mg/ml cholesterol) containing E. coli OP50 and the indicated concentration of nitrogen mustard (HN 2 ) or cisplatin. After incubation worms were transferred to OP50-seeded NGM plates. After 48 h, the extent of developmental progression was scored. In each experiment, a minimum of 60 worms was scored and the results shown are the average of three independent experiments.
  • pET43.1a(+) expressing NUS-His 6 -FAN1 or NUS-His 6 -FAN1 D981A R982A was transformed into BL21 bacterial cells.
  • FAN1 expression was induced by the addition of IPTG (50 ⁇ ) to 0.5 L of bacteria in early exponential phase in liquid culture followed by overnight incubation at 18°C. Cells were then heat shocked at 42°C for five minutes before centrifugation (4000 g, 20 mins, 4°C) and the pellet was snap frozen and thawed.
  • Bacterial pellets were lysed in lysis buffer (25 mM HEPES pH 7.6, 10% glycerol (v/v), 0.1 mM EDTA, 150 mM KCI, 1 mM DTT, 1 mM PMSF, protease inhibitors (Roche)). Lysates were incubated on ice at 4 °C for 30 min before centrifugation (18,000 rpm, 20 mins, 4°C).
  • lysis buffer 25 mM HEPES pH 7.6, 10% glycerol (v/v), 0.1 mM EDTA, 150 mM KCI, 1 mM DTT, 1 mM PMSF, protease inhibitors (Roche)
  • the supernatant was then subjected to ultracentrifugation (37,500 rpm, 1 h, 4°C) before being loaded onto a DEAE column (Amersham) that was developed with a linear gradient of KCI in buffer A (25 mM HEPES pH 7.6, 10% glycerol (v/v), 0.1 mM EDTA, 1 mM DTT, ddH20) using an FPLC LCC-50 (Pharmacia biotech). The flow rate was 2 ml/min and 3 ml fractions were collected. Samples from every fourth fraction were denatured and subjected to SDS-PAGE followed by Coomassie blue staining.
  • Fractions containing FAN1 were combined and diluted 1:1 in buffer A and loaded onto an SP column (Amersham) that was developed with a linear gradient of KCI in buffer A. The flow rate was 0.5 ml/min and 0.25 ml fractions were collected. Samples from every third fraction were denatured and subjected to SDS-PAGE followed by Coomassie blue staining. Fractions containing FAN1 were diluted 1 :1 in buffer A and loaded onto a Heparin column (Amersham) that was developed with a linear gradient of KCI in buffer A. The flow rate was 0.5 ml/min and 0.25 ml fractions were collected. Samples from every second fraction were subjected to SDS-PAGE and FAN1 containing fractions were combined. Protein concentration was estimated by subjecting FAN1 to SDS-PAGE and Coomassie blue staining in parallel with known amounts of BSA.
  • Oligonucleotides use in Figs. 9 and 10 f7: 5'-ATTGACTAGGTTACATGACTGAATGATAGT (SEQ ID NO: 17)
  • a3-cp 5'-CGACTTCCGGTAGCACGTAGCAGCGCGTCAACTGGTTGGTAGG
  • a3-l25 5'- CGCTGCTACGTGCTACCGGAAGTCG (SEQ ID NO: 22)
  • DNA substrates were prepared with the following oligos.
  • Fig. 9 - splayed duplex (SD), f9, f10; 3' flap (3'F) f7, f9, f10; 5' flap (5'F) f8, f9, f10; replication fork analogue (RF), f7, f8, f9, f10.
  • Fig. 10 - a3-l25 and a3-cp (recessed 5' ends).
  • U20S cells transfected with the relevant siRNA were treated with cisplatin (1 mg/ml) for 2 h or irradiated with 3 Gy and then allowed to recover for times indicated before fixation with 4% paraformaldehyde in PBS-Triton-X 00 (0.1%). After three PBS washes and blocking in 3% BSA in PBS, cells were incubated with primary antibody overnight. Another three PBS washes were followed by a 1 h incubation with secondary antibody at room temperature. DNA was stained with DAPI at 1 pg/ml and images acquired using an IN Cell Analyzer 1000 (GE Healthcare). Images were analyzed with IN Cell Analyzer 1000 Workstation software using the Multi Target Analysis module (GE Healthcare).
  • HEK293 or U20S cells transfected with the relevant siRNA were mock-treated, treated with 80 ng/ml MMC or 0.5 mM HU and fixed 18 h later or treated with 5 Gy IR and fixed 1 h later with 2% PFA for 10 min at room temperature. Cells were then permeabilised with 0.2% Triton X- 00 in PBS for 10 min at room temperature.
  • g-H2AX or endogenous FAN1 cells were washed several times in PBS and incubated in blocking solution (PBS containing 3% IgG -free BSA (Jackson Immunoresearch) and 0.2% Tween 20) for 1 h.
  • Coverslips were then incubated with primary antibodies (1 mg/ml) in blocking solution for 1 h. After extensive washing in PBS-T (PBS containing 0.2% Tween20), coverslips were incubated with secondary antibodies (2 mg/ml) conjugated to Texas Red for 45 min. Coverslips were washed thoroughly in PBS -T and mounted on glass slides. Before covering with a cover slip cells were stained with DAPI-Hydromount for 5 min. Slides were viewed using a Deltavision DV3 widefield deconvolution microscope mounted on a Nikon Diaphot inverted microscope and images were deconvolved after acquisition. For GFP tagged proteins, the protocol is the same except that no blocking or antibody incubation takes place.
  • KIAA1018/MTMR15 an uncharacterised human protein, KIAA1018/MTMR15, in the human sequence databases, that has a UBZ-type ubiquitin— binding domain domain, a SAP- type DNA binding domain and a putative nuclease domain termed "VRR_nuc" domain (Fig. 1A), initially referred to as "domain of unknown function 994" (DUF994) (Iyer et al., 2006).
  • Orthologues of KIAA1018 are found in prokaryotes and most eukaryotes with the notable exception of budding yeast (Fig. 1A).
  • KIAA1018 is the only VRR-nuc domain-containing protein in eukaryotes but many bacteria and bacteriophages have genes that encode solely VRR_nuc domains. Although the functions of these genes are unknown, most of them are located in operons that include known DNA repair enzymes, hence the name VRRjiuc (virus-type replication-repair nuclease) (Iyer et al., 2006).
  • the VRR_nuc domains contain a PD- (D/E)XK motif found in the active site of many restriction nucleases (Kosinski et al., 2005) (Fig. 1B).
  • KIAA1018 might act as a repair endonuclease.
  • a putative role for KIAA1018 in DNA repair is also implied by the presence of a UBZ4- type ubiquitin-binding domain that belongs to the RAD18 family of zinc fingers, a domain commonly found in DNA damage response proteins such as DNA polymerase k, RAD18 and WRNIP (Fig. 1C) (Hofmann, 2009).
  • KIAA1018 was also found to interact with the MLH1 DNA mismatch repair protein in a genome wide screen (Cannavo et al., 2007).
  • FAN1 has nuclease activity and if it is involved in DNA repair.
  • FAN1 has endonuclease activity that is specific for branch points
  • FAN1 displayed strong endonuclease activity towards the 5' flap structure and weaker activity towards the replication fork model. Cleavage affected only one strand of these structures and occurred in the double-stranded (ds) region on the same strand as the flap, 4 nucleotides (nt) 3' to the branchpoint (Fig. 2A). Selectivity of FAN1 for these DNA structures, as opposed to specificity for DNA sequence, was confirmed by analysing the cleavage of an analagous set of branched DNA structures composed of strands with alternative sequence (Fig. 2B,C). The endonuclease activity of the FAN1 DR mutant was severely reduced compared with wild-type protein (Fig. 2B; Fig. 9B) resulting in cleavage rates approximately 1000-fold lower than for wild-type protein (Fig. 2C.D). FAN1 did not exhibit endonuclease activity towards four-way junctions (data not shown).
  • FAN1 has 5' exonuclease activity
  • FAN1 has a 5' to 3' exonuclease activity which initiates 4 nt from the 5' end on single- and double-stranded DNA, and 4 nt from the branchpoint on 5' flaps and nicked three-way junctions. Rate measurements suggest that FAN1 has a structural selectivity for helical branchpoints.
  • FAN1 interacts with FANCD2 and FANCI
  • DSP reversible protein crosslinker dithiobis
  • NEM de-ubiquitinase inhibitor N-ethyl maleimide
  • Extracts were subjected to immunoprecipitation with GFP-Trap beads and protein-protein crosslinking was reversed with dithiothreitol. After SDS-PAGE, strong bands at the expected molecular weights of GFP-FAN1 and GFP were observed in the respective lanes (Fig. 4A). In addition, a range of other proteins was found in GFP-FAN1 but not GFP precipitates. Mass fingerprinting revealed that most of these proteins are involved in DNA repair. Both components of the MLH1-PMS2 complex involved in mismatch repair were found in GFP-FAN1 precipitates when cells were lysed in NEM or DSP (Fig. 15) (Cannavo et al., 2007).
  • FANCD2 and FANCI were only found in GFP-FAN1 precipitates when DSP was present in the lysis buffer.
  • antibodies were raised in sheep against human FAN1. These antibodies recognised a protein of the expected molecular mass (114 kDa) in extracts of HEK293 cells that was not detected when cells were transfected with FAN1-specific small interfering (si) RNA duplexes (Fig. 12A). These antibodies were used to immunoprecipitate FAN1 from HEK293 cell extracts. Endogenous MLH1 , FANCD2 and FANCI were detected in anti-FAN1 immunoprecipitates (Fig. 4C) but not in precipitates using an antibody against an unrelated epitope (HA).
  • HA unrelated epitope
  • FANCD2 and FANCI were only found in GFP-FAN1 precipitates when DSP was present in the lysis buffer. These interactions were not affected by ethidium bromide or by treatment of immunoprecipitates with DNase I or benzonase (data not shown), excluding the possibility that these interactions are DNA- dependent. Abundant DNA repair proteins such as ERCC1 or PCNA, and other FA proteins such as FANCA were not detected in anti-FAN1 immunoprecipitates (Figs. 4B.C).
  • FAN1 Size exclusion chromatography of HEK293 cell extracts showed that FAN1 elutes in two sub-complexes; one of these overlaps with MLH1 and elutes slower than the 670 kDa marker, while the other sub-complex elutes faster than the 670 kDa marker and overlaps with FANCD2 and FANCI (Fig. 4D). It is interesting that FAN1 in the latter sub-complex migrates more slowly on SDS-PAGE than the form of FAN1 that co-elutes with MLH1 , and this may represent a post-translationally-modified form of FAN1. Taken together these data show that FAN1 binds to MLH1 , FANCD2 and FANCI.
  • FAN1 stands for "FANCD2/FANCI-associated nuclease 1 ".
  • the UBZ domain of FAN1 interacts with FANCD2
  • FAN1 has a UBZ domain of the RAD18 type that is found in DNA repair proteins such as WRNIP, POL k and RAD18 (Fig. 1C).
  • the POL k UBZ domain binds to mono- ubiquitinated PCNA (Bienko et al., 2005), but we could not detect PCNA in FAN1 precipitates (Fig. 4C).
  • the UBZ domain of FAN1 binds to the mono-ubiquitinated form of FANCD2 since we detected FANCD2 in FAN1 precipitates.
  • FANCD2 forms subnuclear "foci" at sites of DNA damage in cells after DNA damage.
  • Endogenous FAN1 formed foci that colocalised with FANCD2 in response to MMC (Fig. 11A).
  • GFP-FAN1 transiently transfected into HEK293 cells also formed subnuclear foci in MMC-treated cells, and these colocalised with FANCD2 (Fig. 5B).
  • UBZ * mutant did not form subnuclear foci in MMC-treated cells (Figs. 5B, C).
  • FAN1 is recruited to DNA damage by mono-ubiquitinated FANCD2 :
  • FANCD2 mono-ubiquitinated form of FANCD2 interacts with FAN1.
  • wild-type FANCD2 transiently transfected into cells stably expressing GFP-FAN1 was detected in GFP-FAN1 precipitates, the FANCD2 K561 R mutant that cannot be ubiquitinated was not (Fig. 5E). These data indicate that FAN1 interacts with the mono-ubiquitinated form of FANCD2.
  • FANCD2 -/- (PD20) human cells stably transfected with wild-type FANCD2 or with a FANCD2 K561 R mutant (Garcia-Higuera et al., 2001).
  • GFP-FAN1 did not form MMC-induced foci in FANCD2 -/- cells, but formation of foci was restored when these cells stably express wild-type FANCD2 (Fig. 5F,G).
  • Fig. 5F,G Only background levels of GFP- FAN1 foci occurred when the FANCD2 K561 R mutant was expressed in these cells, at all timepoints examined (Fig. 5F,G).
  • FAN1 is required for cellular resistance to agents that induce ICLs
  • Fig. 12B Cells depleted of FAN1 did not show hypersensitivity to DNA damaging agents such as campthothecin, hydroxyurea, UV light, or ionizing radiation (Fig. 12B). In contrast, depletion of the ATR kinase caused hypersensitivity to all of these agents (Fig. 12B). Cells defective in mismatch repair are resistant to killing by 6-thioguanine (6-TG) (Swann et al., 1996), and consistent with this, depletion of MLH1 from HEK293 cells caused cells to become more resistant to 6-TG (Fig. 12B). However, depletion of FAN1 did not, so it is unlikely that FAN1 is involved in mismatch repair.
  • 6-TG 6-thioguanine
  • ICLs cause mono- ubiquitination of FANCD2 and FANCI that promotes ICL repair.
  • Mono-ubiquitination of FANCD2 and FANCI causes reduced electrophoretic mobility (Garcia-Higuera et al., 2001).
  • Exposure of HEK293 cells transfected with control siRNA to cisplatin or MMC resulted in damage-induced mono-ubiquitination of FANCD2 and FANCI (Fig. 12C).
  • depletion of FANCA abolished FANCD2 and FANCI mono-ubiquitination.
  • depletion of FAN1 has no detectable effect (Fig. 12C).
  • FAN1 is not required for mono-ubiquitination of FANCD2 or FANCI.
  • Exposure of cells to ICL-inducing agents causes DSBs, judged by g-H2AX foci or pulsed field gels. These DSBs, formed as a result of replication fork cleavage by MUS81 during ICL unhooking (Hanada et al., 2007; Hanada et al., 2006) (Fig. 8), initiate the HR step of ICL repair.
  • HEK293 cells were transfected with control siRNA or FAN1 siRNA and were either left untreated or exposed to cisplatin for 2 h. Cells were washed free of cisplatin and incubated in fresh medium, and g-H2AX foci were counted at various times during recovery. Around 80% of cells transfected with control siRNA had between 2 and 40 foci 24 h after transient exposure to cisplatin; cells with more than two ⁇ - ⁇ 2 ⁇ foci were scored as " ⁇ - ⁇ 2 ⁇ positive". Although the percentage of control siRNA-transfected cells that were ⁇ - ⁇ 2 ⁇ positive declined to almost basal levels by 48 h (Fig.
  • FAN1-depleted cells showed a substantial increase in the frequency of cells with more than one chromosome break or radial chromosome, similar to cells depleted of FANCD2 (Fig. 6D). These data i are consistent with FAN1 acting in the FA pathway.
  • FAN1 is required for efficient HR but not for DSB resection or RAD51 loading
  • Resection of DSBs leads to the generation of ssDNA, and the coating of ssDNA by RPA leads to RPA foci.
  • RPA foci after exposure of cells to a pulse of cisplatin to assess DSB resection and found that depletion of FAN1 did not prevent cisplatin-induced RPA focus formation. In fact, depletion of FAN1 caused a slight increase in the average number of RPA foci per cell and in the average number of cells with >9 RPA foci (Fig. 7B). This suggests that FAN1 is not required for resection of DSBs. RPA foci gradually disappeared during the recovery of cells treated with control siRNA or FAN1 siRNA from cisplatin (Fig. 7B).
  • DSB resection is followed by formation of the RAD51 nucleoprotein filament on the resected DSB so we examined formation of RAD51 foci at various times during recovery of cells from cisplatin.
  • cells depleted of FAN1 showed an approximately 2.5-fold increase in the number of cells with RAD51 foci, and a similar increase in the number of RAD51 foci per cell, compared with control siRNA (Fig. 7C).
  • FAN1-depleted cells continued to have around twice as many RAD51 foci as control cells and these data are consistent with a defect in HR.
  • FAN1 and FANCD2 proteins co-precipitate in a manner that depends on FANCD2 K561 and on the FAN1 UBZ domain. Both ubiquitinated and non-ubiquitinated FANCD2 were detected in FAN1 immunoprecipitates even though when FANCD2 K561 is mutated, no FANCD2 is detected in FAN1 immunoprecipitates. This discrepancy may be explained by de-ubiquitination of a proportion of FANCD2 after cell lysis or by the association of modified FANCD2 with the unmodified form of the protein. Even though DNA damage stimulates FANCD2 ubiquitination, FAN1 interacts with FANCD2 even without exposure of cells to genotoxins. This is probably a reflection of basal FANCD2 mono-ubiquitination that occurs in the absence of DNA damage in S-phase cells (Taniguchi et al., 2002).
  • SLX4-XPF-SLX1-MUS81 can cleave three-way DNA junctions, 3' flaps and 5' flaps in vitro, and so FAN1 specificity overlaps with the SLX4 complex in 5' flap cleavage.
  • FAN1 FAN1
  • FAN1 is the only VRR_nuc domain-containing protein in eukaryotic cells. These domains are found in all kingdoms of life, but the functions of most of them are unknown (Iyer et al., 2006). Many bacteria and phages have VRR_nuc domain proteins and so it appears that the FA repair pathway which appeared relatively late during evolution was built on a more ancient VRR_nuc domain nuclease. It will be interesting to follow up on this hypothesis. Many cytotoxic anti-cancer agents act by inducing ICLs and it is possible that nucleases such as FAN1 are good targets for sensitizing cancer cells to killing by ICLs. Finally, although the majority of FA patients have mutations in the known FA genes, FA patients exist where mutations in known FA genes could not be found. In this light, it is likely that FAN1 mutations will be found in some of these patients. References
  • Fanconi anemia core complex protein that interacts with FANCM. Mol Cell 25, 331-343.
  • FANCM Connects the Genome Instability Disorders Bloom's Syndrome and Fanconi Anemia. Molecular Cell 36, 943-953.
  • Human SLX4 is a Holliday junction resolvase subunit that binds multiple DNA repair/recombination endonucleases. Cell 138, 78-89.
  • Fanconi anemia is characterized by delayed repair kinetics of DNA double- strand breaks. Tohoku J Exp Med 227, 69-76.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • Pathology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Toxicology (AREA)
  • Biophysics (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

A method for identifying a compound expected to be useful in modulating, for example inhibiting, the repair of a DNA inter-strand crosslink (ICL), resolution of an iCL-induced double strand break, or homologous recombination in a cell, the method comprising the steps of (1) determining whether a test compound modulates, for example inhibits, the endonuclease or 5'-exonuclease activity of a FAN1 polypeptide on a substrate polynucleotide and (2) selecting a compound which modulates, for example inhibits, the said FAN1 polypeptide endonuclease or 5'-exonuclease activity. Such a compound may be useful in enhancing the effect of platinum based chemotherapy or other ICL-inducing therapy on cancer cells.

Description

METHODS FOR SCREENING FOR COMPOUNDS EXPECTED TO BE USEFUL IN THE
MODULATING, FOR EXAMPLE INHIBITING, THE ACTIVITY OF
KIAA1018/MTMR15/FAN1
The present invention relates to methods for screening for compounds expected to be useful in modulating, for example inhibiting, the activity of a polypeptide considered to be involved in repairing DNA inter-strand crosslinks.
DNA inter-strand crosslinks (ICLs) are formed when bifunctional agents covalently link the two strands in a double helix. ICLs are toxic lesions that prevent strand separation necessary for transcription and DNA replication. ICLs can be induced by drugs and also by endogenous metabolites. Cross-linking agents such as mitomycin-C (MMC) and cisplatin generate a mixture of mono-adducts and ICLs in cells but cellular toxicity correlates with the number of ICLs. Although ICLs can be repaired in G , the major route for ICL repair appears to occur in S-phase (Akkari et al., 2000; Rothfuss and Grompe, 2004; Taniguchi et al., 2002). Various models for the repair of ICLs have been suggested (Mccabe et al., 2009; Moldovan and D'andrea, 2009), and recent studies proposed that ICL repair requires two forks to converge on the ICL (Raschle et al., 2008) (Fig. 8)
Forks that stall at ICLs recruit signaling complexes including the Fanconi Anaemia (FA) · proteins and FA-associated proteins (Moldovan and D'andrea, 2009) (Fig. 8). Fanconi Anaemia is an inherited recessive condition characterized by developmental defects, skeletal abnormalities, bone marrow failure and cancer predisposition (Wang, 2007). FA falls into thirteen complementation groups and the relevant FA genes have been cloned (Patel and Joeje, 2007; Wang, 2007). Nevertheless FA patients exist where mutations in known FA genes could not be found. The central components of the FA pathway are FANCD2 and its paralogue FANCI that together form the "ID" complex (Garcia-Higuera et al., 2001; Smogorzewska et al., 2007). These two proteins are mono-ubiquitinated at Lys561 and Lys523, respectively, in S-phase and in response to ICLs (Fig. 8) (Garcia- Higuera et al., 2001 ; Taniguchi et al., 2002). This reaction is catalysed by the E3 ubiquitin ligase FANCL subunit of the FA core complex, that comprises FANCA, B, C, E, F, G, L, and M, and also requires the FA-associated proteins FAAP100 and FAAP24 (Ciccia et al., 2007; Collis et al., 2008; Ling et al., 2007). Furthermore, loss of FANCD2 mono-ubiquitination is observed in many FA patients (Moldovan and D'andrea, 2009).
Mono-ubiquitination of FANCD2 is necessary for ICL repair but the underlying molecular mechanisms are unclear. The mono-ubiquitinated form of the ID complex may recruit ICL repair proteins but, as yet, no ligands for ubiquitinated FANCD2 or FANCI have been reported. It was reported that mono-ubiquitination of FANCD2 is required for the "unhooking" of the ICL in a cell-free repair system (Knipscheer et al., 2009) (Fig. 8). Unhooking involves incisions on either side of the ICL, one of which is catalysed by the structure-specific nuclease MUS81-EME1 (Fig. 8) (Hanada et al., 2007; Hanada et al., 2006). MUS81-EME1 creates a one-ended double-strand break (DSB) that can be used later to initiate homologous recombination (HR). The identity of the nuclease that catalyses the second incision to enable unhooking of the ICL is unclear. XPF-ERCC1 has been implicated but this is controversial (Bergstralh and Sekelsky, 2008; Bhagwat et al., 2009). After unhooking the resulting gap is filled in by translesion synthesis, that also appears to require FANCD2 ubiquitination (Knipscheer et al., 2009), and the unhooked lesion is removed by excision repair. The DSBs generated by unhooking are resected and one of them initiates HR to complete ICL repair (Fig. 8). Successful HR-mediated repair of the US81 -generated DSB depends on processing of DNA repair intermediates by the SLX4 complex. SLX4 acts as a scaffold for XPF-ERCC1 , MUS81- EME1 and SLX1. Cells lacking, or depleted of, SLX4 (Fekairi et al., 2009; Munoz et al., 2009; Svendsen et al., 2009) or XPF-ERCC1 (Niedernhofer et al., 2004) cannot repair the DSBs created by MUS81 after ICL induction, and exhibit defects in HR-mediated repair of DSBs. In this study we report the identification of FAN1 (FA-associated nuclease 1), also referred to herein as REND1 , a novel nuclease recruited to sites of DNA damage by mono-ubiquitinated FANCD2 that is important for repair of ICLs.
The listing or discussion of a prior-published document in this specification should not necessarily be taken as an acknowledgement that the document is part of the state of the art or is common general knowledge. A first aspect of the invention provides a method for identifying a compound expected to be useful in modulating, for example inhibiting, KIAA1018/MTMR15/FAN1 (FAN1 ) endonuclease activity, the method comprising the steps of (1) determining whether a test compound modulates, for example inhibits, the endonuclease activity of a FA 1 polypeptide on a branched polynucleotide substrate and (2) selecting a compound which modulates, for example inhibits, the said FAN1 endonuclease activity.
In an embodiment of the preceding aspect, the branched polynucleotide substrate may be, for example, a substrate 5' flap-containing nucleic acid or a replication fork nucleic acid.
A second aspect of the invention provides a method for identifying a compound expected to be useful in modulating, for example inhibiting, FAN1 5'-exonuclease activity, the method comprising the steps of (1) determining whether a test compound modulates, for example inhibits, the 5'-exonuclease activity of a FAN1 polypeptide on a substrate polynucleotide and (2) selecting a compound which modulates, for example inhibits, the said FAN1 5 -exonuclease activity.
A further aspect of the invention provides a method for identifying a compound expected to be useful in modulating, for example inhibiting, the repair of a DNA inter-strand crosslink (ICL), resolution of an ICL-induced double strand break, or homologous recombination in a cell, the method comprising the steps of (1) determining whether a test compound modulates, for example inhibits, the endonuclease or 5'-exonuclease activity of a FAN1 polypeptide on a substrate polynucleotide and (2) selecting a compound which modulates, for example inhibits, the said FAN1 polypeptide endonuclease or 5 -exonuclease activity. A further aspect of the invention provides a method for identifying a compound expected to be useful in modulating, for example inhibiting, the repair of a DNA inter-strand crosslink, resolution of an ICL-induced double strand break, or homologous recombination in a cell, the method comprising the steps of (1) determining whether a test compound modulates, for example inhibits, the interaction between a FAN1 polypeptide and an ubiquitinylated FANCD2 or FANCI polypeptide and (2) selecting a compound which modulates, for example inhibits, the said interaction between the FAN1 polypeptide and the ubiquitinylated FANCD2 or FANCI polypeptide.
A further aspect of the invention provides a method for identifying a compound expected to be useful in increasing cancer cells' sensitivity to ICLs or enhancing the effect of platinum based chemotherapy or other ICL-inducing therapy (for example mitomycin C, nitrogen mustards, nitrosoureas, alkylalkanesulphonate, and Cyclophosphamide, part of the FEC (fluorouracil/etoposide/cyclophosphamide) chemotherapy regimen) on cancer cells, the method comprising the steps of (1) determining whether a test compound modulates, for example inhibits, the endonuclease or 5'-exonuclease activity of a FA 1 polypeptide on a substrate polynucleotide; or the interaction between a FAN1 polypeptide and an ubiquitinylated FANCD2 or FANCI polypeptide, and (2) selecting a compound which modulates, for example inhibits, the endonuclease or 5'-exonuclease activity of the FAN1 polypeptide on the substrate polynucleotide; or the interaction between the FAN1 polypeptide and the ubiquitinylated FANCD2 or FANCI polypeptide. The method of the immediately preceding aspect may be particularly useful in increasing cancer cells' sensitivity to ICLs or enhancing the effect of platinum based chemotherapy or other ICL-inducing therapy on cancer cells when the cancer cells are those that have intrinsic or acquired resistance to platinum compounds, as would be understood by a person skilled in the art. Examples of cancer cells that may be considered to exhibit intrinsic resistance to platinum compounds include colorectal cancer cells, prostate cancer cells, lung cancer cells and breast cancer cells. An example of cancer cells that may be considered to exhibit acquired resistance to platinum compounds includes ovarian cancer cells.
It is envisaged that a compound that may be identified by the methods of the invention may be useful in inhibiting lymphocyte, for example T-cell, activity. Such activity may be inhibited, for example, via inhibition of somatic recombination in T-cells. Thus such compound may be useful as an immunosuppressant.
A further aspect of the invention provides a method for identifying a compound expected to be useful in modulating, for example inhibiting, the repair of a DNA inter-strand crosslink, resolution of an ICL-induced double strand break, or homologous recombination in a cell, or in increasing cancer cells' sensitivity to ICLs or enhancing the effect of platinum based chemotherapy or other ICL-inducing therapy on cancer cells, the method comprising the steps of (1) determining whether a test compound modulates, for example inhibits, said repair of a DNA inter-strand crosslink, resolution of an ICL-induced double strand break, or homologous recombination in the cell, or the cell's resistance to ICLs or the effect of platinum based chemotherapy or other ICL-inducing therapy on the cell, wherein said determining is done on at least two cells, wherein said cells differ in the amount or activity of FAN1 , and (2) selecting a compound which modulates, for example inhibits, the said repair of a DNA inter-strand crosslink, resolution of an ICL- induced double strand break, or homologous recombination in the cell, or the cell's resistance to ICLs or the effect of platinum based chemotherapy or other ICL-inducing therapy to a greater extent in the cell having more FAN1 than in the cell having less FAN1.
It is envisaged that the methods of the preceding aspect may be useful in screening compounds for their specificity for, for example, FAN1 , and investigating their mode of action. For example, altering the expression levels of FAN1 then testing the compound activity in test cells displaying differing levels of FAN1 expression, may provide information on potential off-target effects of test compounds, i.e. identify whether the test compound interacts with targets in the cell other than FAN1.
The endonuclease or 5'-exonuclease activity of the FAN1 polypeptide that is modulated/assessed in the screening method is endonucleolytic or 5'-exonuclease cleavage of a substrate polynucleotide as defined above. Cleavage of the substrate polynucleotide may be assessed by techniques including those discussed further below and in the Examples. For example, fluorescent or radioisotopic labelling of the polynucleotide may be used in assessing cleavage of the nucleic acid, as well known to those skilled in the art. Further methods will be apparent to the skilled person on the basis of this teaching and the many known methods of assessing nucleic acid cleavage.
In an embodiment of any aspect of the invention, the substrate polynucleotide may be a branched polynucleotide. It is particularly preferred that the branched polynucleotide is a 5' flap-containing nucleic acid or a replication fork nucleic acid. It will be appreciated that the terms "polynucletide" and "nucleic acid" may be used interchangeably herein.
A typical substrate 5' flap-containing nucleic acid is shown in Figure 2 A and below. The 5' flap-containing nucleic acid typically has a single-stranded portion of typically 5 or more nucleotides but may be, for example, between 1 and 100 nucleotides. Preferably the single-stranded portion may be between 3 and 50 nucleotides, more preferably between 5 and 10 nucleotides. The double stranded portions of the molecule independently typically have at least 5 base pairs, for example between 5 and 100 base pairs. Preferably, the double stranded portion may be between 10 and 50 base pairs, more preferably 20 base pairs.
5'
Figure imgf000007_0001
A typical replication fork nucleic acid is shown in Figure 2A and below. Each of the three double stranded portions of the molecule independently typically has at least 5 base pairs, for example between 10 and 50 base pairs, such as 20 base pairs.
Figure imgf000007_0002
It is considered that the sequence of the 5' flap-containing nucleic acid or the replication fork nucleic acid is not critical. It is envisaged that the nucleic acid will be deoxyribose nucleic acid. The nucleic acids may include naturally occurring or wholly or partially synthetic DNA, e.g., cDNA and genomic DNA. The nucleic acids may be labelled, for example, with radioactive isotopes, such as 32P, 3H, and 14C. Alternatively, the nucleic acids may be labelled with non-radioactive probes, for example chemiluminescent or fluourescent probes, as would be understood in the art. The substrate nucleic acids may be labelled with a tag to enable purification, fixing to a solid support and/or other manipulation to be carried out, as would be understood in the art. For example, the nucleic acid may be labelled with biotin to allow binding to an appropriate support labelled with an avidin compound, such as streptavidin.
The substrate nucleotides are produced by annealing oligonucleotides using standard techniques known in the art.
The endonuclease or exonuclease activity may be increased or reduced by an alteration in the Vmax or the Km (or both) of the FAN1 polypeptide for a particular substrate. For example, activity may be increased by an increased Vmax or decreased Km. It will be appreciated that it may not be necessary to determine the value of either Vmax or Km in order to determine whether the FA 1 polypeptide has been activated or deactivated.
Activity may be measured as the amount of a substrate cleaved in a given time; a change of activity may therefore be detected as a change in the amount of substrate (for example, at a single concentration) that is cleaved in a given time. It is preferred that the activity is increased or decreased, as appropriate, by at least 2, preferably 5, 10, 15, 20, 25, 30 or 50-fold.
Typically the FAN1 polypeptide is wild type human FAN1 polypeptide or a fragment thereof, or a fusion either thereof. Typically the fragment comprises at least the VPR- nuc domain. Nevertheless, the VPR-nuc domain is not considered to be required for interaction with FANCD2 or FANCI. The VRR-nuc domain is located at amino acid 871- 1009 of human FAN1 (the sequence of which is provided below) or residues equivalent thereto. In some embodiments, the UBZ domain may be included in the fragment, but this is not required for activity of FAN . The UBZ domain is located at amino acids 41-69 of human FAN1 or residues equivalent thereto. For methods assaying FA 1 binding to FANCD2 or FANCI, the UBZ domain is considered to be required. In some embodiments, the fragment may also comprise the SAP domain, which is located at amino acid numbers 461-504 of human FAN1 or residues equivalent thereto. Thus, for nuclease activity assays, it is envisaged that the fragment of FAN1 will comprise at least the VRR-nuc and generally the SAP domain. The fragment may thus correspond to at least residues 460-1017 of human FAN1 , or residues equivalent thereto. For FANCD2 or FANCI binding assays the fragment may comprise at least residues 41-69 of human FAN1. Full length human FAN1 may be used in all aspects of the invention, or fragments thereof containing the relevant domains according to the requirements of the assay.
Plasmid constructs that may be used to express FAN1 are well known to those skilled in the art. For example, FAN1 may be expressed using a bacterial expression plasmid with a NUS (N-utilization substance) and a hexahistidine tag. For example, FAN1 may be expressed using the pET43.1A bacterial expression plasmid. For expression in Sf21 insect cells, FAN1 may be cloned into, for example, pFASTBAC.
It is envisaged that co-expression of FAN1 with LH1 (MutL homo!og 1), a mismatch repair protein FAN1 interacts with, may improve stability of the recombinant FAN1 and is therefore also included in the methods of the invention.
The human FAN1 polypeptide and polynucleotide sequence is shown below and is shown at GenBank N _014967 for nucleic acid sequence and Uni-Prot Q9Y2M0 for amino acid sequence. The skilled person will readily be able to identify other FAN1 polypeptide sequences from databases. For example, the Homologene feature of the NCBI database may be used.
The nucleotide sequence of human FAN1 (GenBank ref: NM_014967) (SEQ ID NO: 1) may be found below:
1 ggcgcgcgga gccaggtggg aggtgcgagg tggccgcgcg gggatcttgg gtgacagggc 61 accgagggaa ggaggacgcg agggcagcca ggccctaggg agcagggaga gtggctcggg
121 ctcagtcgcg tggccccagg aagaagaaat tgtcgagacg aataacatga ggtcatatag
181 aatcccactt ttggtgattt caagtcaaga aagtaaaagt aaaccattgc tatctttcac
241 cttaaatatc ctgtgtttta ttgctcagaa catccagttt ttctaatact catgatgtca
301 gaagggaaac ctcctgacaa aaaaaggcct cgtagaagct tatcaatcag caagaataag 361 aaaaaagcat ctaattctat tatttcgtgt tttaacaatg caccacctgc taaacttgcc
421 tgccccgttt gcagtaaaat ggtgcctaga tatgacttaa accggcacct tgatgaaatg
481 tgtgctaaca atgacttcgt tcaagtggat ccagggcagg ttggcttaat aaattcaaat
541 gtgtctatgg tagatttaac cagtgttacc ttagaagatg taacacctaa gaagtcacca
601 ccaccaaaga caaatttaac ccctggccaa agtgattcag caaaaaggga agtaaagcag 661 aagatcagtc cctactttaa aagtaatgat gtggtgtgca aaaatcaaga tgagctgaga
721 aatcgtagtg tgaaagtcat ttgtttggga agcctagcat ctaaattgtc cagaaaatac
781 gtaaaggcta aaaaatcaat agataaggat gaagaatttg ccggttctag tccacagagt
841 tccaaatcca cagttgttaa gagcctgatt gataactctt cagaaattga ggacgaggat
901 caaattttgg agaacagttc tcaaaaagaa aacgtgttta aatgtgattc tctaaaggaa 961 gagtgcattc ctgaacatat ggtaagagga agtaaaataa tggaagccga aagccaaaag 1021 gctacccggg aatgtgagaa atcagccctc acccctggat tctcagataa tgcgatcatg 1081 ttattctcac cagatttcac tcttaggaat acattaaagt ctacttcaga agacagtctt 1141 gtaaagcaag agtgtatcaa agaagtggtt gaaaaacgtg aggcatgtca ttgtgaagaa 1201 gtaaaaatga ctgttgcttc agaagctaaa atacagctgt cagattcaga ggcaaaatct 1261 catagttctg cagatgatgc ttctgcatgg agtaacatcc aagaggctcc tctgcaggat
1321 gacagttgct taaacaatga tatccctcac agcattcctt tggagcaggg gtcaagctgc 1381 aatggtcctg gtcaaacaac cggtcatcct tactaccttc ggagtttcct tgtggtgctg 1441 aaaaccgtac ttgagaatga agatgatatg ttgctctttg atgagcagga gaagggaatt 1501 gtaactaaat tttatcagtt atcagctact ggtcagaagt tatatgtaag gctctttcaa 1561 cgtaaattaa gctggattaa gatgaccaaa ttagagtatg aagagattgc cttagactta
1621 acacctgtga ttgaagaatt gacgaatgca ggctttctac agacagaatc tgagttgcaa 1681 gaactctctg aagtgcttga actcctttct gctcctgaac taaaatccct agccaagacc 1741 ttccacttgg tgaatcccaa tggacagaaa cagcagctgg tggacgcctt tctcaaattg 1801 gccaaacagc gttcagtctg cacttggggc aagaataagc ctggaattgg tgcagtgatt 1861 ttaaaaagag ccaaagcctt ggctggacag tcagtacgaa tctgtaaagg ccccagggct
1921 gtgttttccc gcatcttgct actgttttcg ttgaccgact caatggaaga tgaagacgcc 1981 gcttgtggag gtcagggaca gctttcaaca gtcctgttgg tcaacctcgg ccgaatggag 2041 tttcctagtt acaccatcaa tcggaaaacc cacatcttcc aagacagaga tgatcttatc 2101 agatatgcag cagccacgca catgctgagt gacatttctt ccgcaatggc caatgggaac 2161 tgggaagaag ctaaggagct cgctcagtgt gcaaaaaggg attggaacag actgaaaaac
2221 cacccttctc tgagatgcca cgaagattta ccactcttcc tgcggtgttt cactgttggg 2281 tggatttata caaggatttt gtctcggttt gtggaaatac tgcagagact tcacatgtat 2341 gaggaagccg tcagagaact tgaaagcctt ttgtctcaga gaatttattg tcctgacagc 2401 agaggccgat ggtgggatcg actggccctt aatttacacc agcacttgaa gcgcctggaa 2461 ccgactatca agtgcatcac agaggggctg gcggatccgg aagtcagaac gggacaccgc
2521 ctttcactgt atcagcgagc cgtgcgcctg cgagagtctc cgagctgtaa aaagttcaag 2581 cacctcttcc agcagctccc agaaatggct gtgcaagatg tgaaacacgt gaccatcaca 2641 ggcaggctgt gcccacagcg tgggatgtgc aagtctgtgt ttgtgatgga ggccggggag 2701 gccgctgacc ccaccacggt cctgtgctct gtggaggagc tggcactggc ccattacaga 2761 cgcagcggtt ttgaccaggg gattcatggc gaagggtcca ccttcagcac cctgtatggc
2821 ctcctcctgt gggacatcat cttcatggat gggattccgg atgtcttcag aaacgcctgt 2881 caggcattcc ccctggactt gtgcacagac agcttcttca caagcagacg cccagccctt 2941 gaggccaggc tgcagctgat tcatgatgcc cccgaggaga gcctgcgggc ctgggtggca 3001 gccacgtggc atgagcagga aggcagagtg gcttcccttg tcagctggga tcgcttcacg 3061 tctcttcagc aagctcagga tcttgtctcc tgcctggggg gccctgtgct cagtggtgtg
3121 tgcaggcacc tggctgctga ctttcgacac tgtcgagggg gcctccccga cctggtggtg 3181 tggaactccc agagccgtca ctttaagctg gtggaagtta aaggccccaa tgatcgtctt 3241 tcacataagc agatgatctg gctggctgaa ctgcagaagc tgggggctga agtagaagtc 3301 tgccatgtgg ttgcagttgg agctaagagc caaagcctta gctaaaagat tccctacagg 3361 agaaaatgga aatgaggagg agagaaactc cggtgtcccc gaggtgtcgg tgtggtgagg
3421 gccgctggcg ttgaagtaca tcctgctctg gcccagctcc ccatagcagg cctccagggg 3481 gccactgcgc tgttgccgca gcatcctgct cagtacgtcg acttcatcag ccaggaggga 3541 gagcttgtga aaggctgtga tggagccacc caggctgatc tgggcctcgg gaacccagcg 3601 gaagtagcac agtttccaca gttttatgtg tgttccagag acacgtggca gaataacacc 3661 gtgcaggttg gcgggtttgg aaaaccattc tctaaaatac tgctccgtat cactgttctg
3721 gctgtcggtt tgctgagctg gatctggctt tggttttaat atcaatgaat ttctccttgg 3781 aagtaattct tggtcactga tgattccatt ctttaaggca gacggcattc ctcttagtgt 3841 ggagctgtag cttttctata cagaagagat tttattatgt tccggggatt ccctttttag 3901 aaagattgaa ggatgcaatg gcaaatataa actcaatact atgaaaaatt aatggaattt 3961 cagcctcaaa gaacattttc ctcccttcct ttgtgtcctt attctaatcc tcctcccctg 4021 gaattacact tttttatgtg ttgactctac ctaggctgtt actatcagcc tgaatggggg
4081 cgggatgaga gtacctccta tccactaatt tgcttaagga taagttctaa gacgggctag 4141 aaaaaacact agacctggcc gattctatca agaacaatgg caaactgaac agaggcagtc 4201 aggaggccaa atgtctgatt ctttgttctg tacctttcag tagtctgcaa attttctacc 4261 aaaaaaaatc ccaagaattt atttgggaat tattaaaaag gcaaacaatg aatgttatta 4321 ggacaagaat atagcagtca ggaggccatg actacatcac agccaggcgg cattccctgc
4381 cacagtggcg gcttgaatca tcaagaaatg gataaatggg gctttagtaa atcaggcttg 4441 caggctcaaa gctgcaatct gcccactctc aggtactgag actttgtggg cctcagacac 4501 caggaagaaa gctgggatac agtcatttga gttaaaaagg gaatgacccc tcagaaaccc 4561 gcattagcag tgttactctt ggaagtgcct ttacttttaa cgctctctgt tctgaaaaag 4621 aggtgtttgg ttacgtgtga gccaacatca cgttttgtta gctgtgattt acctttgtcc
4681 gtttaaaaga cttcacggag ccattctgta tacaaggtgt gctctttcca atgtagaagg 4741 ggttatggaa aagggtgcga tcctttgctg taaactggag agaccagtcc caaacagagg 4801 ggaattttaa gcccttctca tcacccaatt ggatgttttt gcttatagca aattcctgca 4861 aaataaataa ataaatattt gcaaaactaa aaaaaaaaaa a
The amino acid sequence of human FAN1 (Uni-prot ref: Q9Y2M0) (SEQ ID NO: 2) may be found below:
1 MMSEGKPPD KRPRRSLSIS KNKK ASNSI ISCF NAPPA LACPVCSKM VPRYDLNRHL
61 DEMCANNDFV QVDPGQVGLI NSNVSMVDLT SVTLEDVTPK KSPPPKTNLT PGQSDSAKRE
121 VKQKISPYFK SNDWCKNQD ELRNRSVKVI CLGSLASKLS R YVKA KSI DKDEEFAGSS
181 PQSSKSTWK SLIDNSSEIE DEDQILENSS Q ENVFKCDS LKEECIPEHM VRGSKIMEAE
241 SQKATRECEK SALTPGFSDN AIMLFSPDFT LRNTLKSTSE DSLVKQECIK EWEKREACH
301 CEEVKMTVAS EAKIQLSDSE AKSHSSADDA SA SNIQEAP LQDDSCLNND IPHSIPLEQG
361 SSCNGPGQTT GHPYYLRSFL WLKTVLENE DDMLLFDEQE KGIVTKFYQL SATGQ LYVR
421 LFQRKLSWI MT LEYEEIA LDLTPVIEEL TNAGFLQTES ELQELSEVLE LLSAPELKSL
481 AKTFHLVNPN GQKQQLVDAF LKLAKQRSVC T G KPGIG AVILKRA AL AGQSVRICKG
541 PRAVFSRILL LFSLTDSMED EDAACGGQGQ LSTVLLV LG RMEFPSYTIN RKTHIFQDRD
601 DLIRYAAATH MLSDISSAMA NGNWEEAKEL AQCAKRDWNR L NHPSLRCH EDLPLFLRCF
661 TVGWIYTRIL SRFVEILQRL HMYEEAVREL ESLLSQRIYC PDSRGRWWDR LALNLHQHL
721 RLEPTIKCIT EGLADPEVRT GHRLSLYQRA VRLRESPSCK KFKHLFQQLP EMAVQDVKHV
781 TITGRLCPQR GMC SVFVME AGEAADPTTV LCSVEELALA HYRRSGFDQG IHGEGSTFST
841 LYGLLLWDII FMDGIPDVFR NACQAFPLDL CTDSFFTSRR PALEARLQLI HDAPEESLRA
901 WVAATWHEQE GRVASLVSWD RFTSLQQAQD LVSCLGGPVL SGVCRHLAAD FRHCRGGLPD
961 LW NSQSRH FKLVEVKGPN DRLSH QMIW LAELQKLGAE VEVCHVVAVG AKSQSLS
The human FANCD2 polypeptide and polynucleotide sequences are shown below and are shown at GenBank ref: NM 033084.3 and Uni-Prot ref: Q9BXW9. The skilled person will readily be able to identify other FANCD2 polypeptide sequences from databases. For example, the Homologene feature of the NCBI database may be used.
The nucleotide sequence of human FANCD2 (GenBank ref: NM_033084.3) (SEQ ID NO: 3) may be found below:
1 ggcctggcgg gaaagtcgaa aactacgggc ggcgacggct tctcggaagt aatttaagtg 61 cacaagacat tggtcaaaat ggtttccaaa agaagactgt caaaatctga ggataaagag 121 agcctgacag aagatgcctc caaaaccagg aagcaaccac tttccaaaaa gacaaagaaa 181 tctcatattg ctaatgaagt tgaagaaaat gacagcatct ttgtaaagct tcttaagata 241 tcaggaatta ttcttaaaac gggagagagt cagaatcaac tagctgtgga tcaaatagct
301 ttccaaaaga agctctttca gaccctgagg agacaccctt cctatcccaa aataatagaa 361 gaatttgtta gtggcctgga gtcttacatt gaggatgaag acagtttcag gaactgcctt 421 ttgtcttgtg agcgtctgca ggatgaggaa gccagtatgg gtgcatctta ttctaagagt 481 ctcatcaaac tgcttctggg gattgacata ctgcagcctg ccattatcaa aaccttattt 541 gagaagttgc cagaatattt ttttgaaaac aagaacagtg atgaaatcaa catacctcga
601 ctcattgtca gtcaactaaa atggcttgac agagttgtgg atggcaagga cctcaccacc 661 aagatcatgc agctgatcag tattgctcca gagaacctgc agcatgacat catcaccagc 721 ctacctgaga tcctagggga ttcccagcac gctgatgtgg ggaaagaact cagtgaccta 781 ctgatagaga atacttcact cactgtccca atcctggatg tcctttcaag cctccgactt 841 gacccaaact tcctattgaa ggttcgccag ttggtgatgg ataagttgtc gtctattaga
901 ttggaggatt tacctgtgat aataaagttc attcttcatt ccgtaacagc catggataca 961 cttgaggtaa tttctgagct tcgggagaag ttggatctgc agcattgtgt tttgccatca 1021 cggttacagg cttcccaagt aaagttgaaa agtaaaggac gagcaagttc ctcaggaaat 1081 caagaaagca gcggtcagag ctgtattatt ctcctctttg atgtaataaa gtcagctatt 1141 agatatgaga aaaccatttc agaagcctgg attaaggcaa ttgaaaacac tgcctcagta
1201 tctgaacaca aggtgtttga cctggtgatg cttttcatca tctatagcac caatactcag 1261 acaaagaagt acattgacag ggtgctaaga aataagattc gatcaggctg cattcaagaa 1321 cagctgctcc agagtacatt ctctgttcat tacttagttc ttaaggatat gtgttcatcc 1381 attctgtcgc tggctcagag tttgcttcac tctctagacc agagtataat ttcatttggc 1441 agtctcctat acaaatatgc atttaagttt tttgacacgt actgccagca ggaagtggtt
1501 ggtgccttag tgacccatat ctgcagtggg aatgaagctg aagttgatac tgccttagat 1561 gtccttctag agttggtagt gttaaaccca tctgctatga tgatgaatgc tgtctttgta 1621 aagggcattt tagattatct ggataacata tcccctcagc aaatacgaaa actcttctat 1681 gttctcagca cactggcatt tagcaaacag aatgaagcca gcagccacat ccaggatgac 1741 atgcacttgg tgataagaaa gcagctctct agcaccgtat tcaagtacaa gctcattggg
1801 attattggtg ctgtgaccat ggctggcatc atggcggcag acagaagtga atcacctagt 1861 ttgacccaag agagagccaa cctgagcgat gagcagtgca cacaggtgac ctccttgttg 1921 cagttggttc attcctgcag tgagcagtct cctcaggcct ctgcacttta ctatgatgaa 1981 tttgccaacc tgatccaaca tgaaaagctg gatccaaaag ccctggaatg ggttgggcat 2041 accatctgta atgatttcca ggatgccttc gtagtggact cctgtgttgt tccggaaggt
2101 gactttccat ttcctgtgaa agcactgtac ggactggaag aatacgacac tcaggatggg 2161 attgccataa acctcctgcc gctgctgttt tctcaggact ttgcaaaaga tgggggtccg 2221 gtgacctcac aggaatcagg ccaaaaattg gtgtctccgc tgtgcctggc tccgtatttc 2281 cggttactga gactttgtgt ggagagacag cataacggaa acttggagga gattgatggt 2341 ctactagatt gtcctatatt cctaactgac ctggagcctg gagagaagtt ggagtccatg 2401 tctgctaaag agcgttcatt catgtgttct ctcatatttc ttactctcaa ctggttccga 2461 gagattgtaa atgccttctg ccaggaaaca tcacctgaga tgaaggggaa ggtgctcact 2521 cggttaaagc acattgtaga attgcaaata atcctggaaa agtacttggc agtcacccca 2581 gactatgtcc ctcctcttgg aaactttgat gtggaaactt tagatataac acctcatact
2641 gttactgcta tttcagcaaa aatcagaaag aaaggaaaaa tagaaaggaa acaaaaaaca 2701 gatggcagca agacatcctc ctctgacaca ctttcagaag agaaaaattc agaatgtgac 2761 cctacgccat ctcatagagg ccagctaaac aaggagttca cagggaagga agaaaagaca 2821 tcattgttac tacataattc ccatgctttt ttccgagagc tggacattga ggtcttctct 2881 attctacatt gtggacttgt gacgaagttc atcttagata ctgaaatgca cactgaagct
2941 acagaagttg tgcaacttgg gccccctgag ctgcttttct tgctggaaga tctctcccag 3001 aagctggaga gtatgctgac acctcctatt gccaggagag tcccctttct caagaacaaa 3061 ggaagccgga atattggatt ctcacatctc caacagagat ctgcccaaga aattgttcat 3121 tgtgtttttc aactgctgac cccaatgtgt aaccacctgg agaacattca caactatttt 3181 cagtgtttag ctgctgagaa tcacggtgta gttgatggac caggagtgaa agttcaggag
3241 taccacataa tgtcttcctg ctatcagagg ctgctgcaga tttttcatgg gctttttgct 3301 tggagtggat tttctcaacc tgaaaatcag aatttactgt attcagccct ccatgtcctt 3361 agtagccgac tgaaacaggg agaacacagc cagcctttgg aggaactact cagccagagc 3421 gtccattact tgcagaattt ccatcaaagc attcccagtt tccagtgtgc tctttatctc 3481 atcagacttt tgatggttat tttggagaaa tcaacagctt ctgctcagaa caaagaaaaa
3541 attgcttccc ttgccagaca attcctctgt cgggtgtggc caagtgggga taaagagaag 3601 agcaacatct ctaatgacca gctccatgct ctgctctgta tctacctgga gcacacagag 3661 agcattctga aggccataga ggagattgct ggtgttggtg tcccagaact gatcaactct 3721 cctaaagatg catcttcctc cacattccct acactgacca ggcatacttt tgttgttttc 3781 ttccgtgtga tgatggctga actagagaag acggtgaaaa aaattgagcc tggcacagca
3841 gcagactcgc agcagattca tgaagagaaa ctcctctact ggaacatggc tgttcgagac 3901 ttcagtatcc tcatcaactt gataaaggta tttgatagtc atcctgttct gcatgtatgt 3961 ttgaagtatg ggcgtctctt tgtggaagca tttctgaagc aatgtatgcc gctcctagac 4021 ttcagtttta gaaaacaccg ggaagatgtt ctgagcttac tggaaacctt ccagttggac 4081 acaaggctgc ttcatcacct gtgtgggcat tccaagattc accaggacac gagactcacc
4141 caacatgtgc ctctgctcaa aaagaccctg gaacttttag tttgcagagt caaagctatg 4201 ctcactctca acaattgtag agaggctttc tggctgggca atctaaaaaa ccgggacttg 4261 cagggtgaag agattaagtc ccaaaattcc caggagagca cagcagatga gagtgaggat 4321 gacatgtcat cccaggcctc caagagcaaa gccactgagg tatctctaca aaacccacca 4381 gagtctggca ctgatggttg cattttgtta attgttctaa gttggtggag cagaactttg
4441 cctacttatg tttattgtca aatgcttcta tgcccatttc cattccctcc ataacagctt 4501 ctgtgcttat ataatttttg ggacccagaa gaaacaacga cacaatctta gaatcactcc 4561 tgagtatctc gagttgtggc atttgttata gagttgacaa ttttctgcat tatagcctct 4621 cattttccat gaattcatat ctgaaaccat tttagaaggg agaagtcatc gaagtatttt 4681 ctgagtgttg agaagaatga gttaaaccat ttaaacacat ttgaaacata caaaaataga
4741 aatgtgaaag catttggtga aagccaaagc acagagtcag aagctgccac cttagagaac 4801 tgaaataaaa atagaagttc ttacgctttt ttgtggtaca gatgctttcg acaatttaaa 4861 gaaagctaaa taaaaatgta gacatggctg gcgcagtggc tcatgcttgt aatcctagca 4921 ctttttgagg ccaaggtagg aggattgctt gagtccggga gctcaaggca aagctgcaca 4981 acataacaag accctatctc cacaaaaaaa atgaaaaata aacctgggtg cggtggctca
5041 cacctgtaat cccagcactt tgggaggccg atgtgggcag atcacaaggt caggagttca 5101 agaccagcct ggccaacata gtgaaacccc atctctactg aaaatacaaa aattagctgg 5161 gtgtggtggc acgtgcctgt tatctcagct acttgggagg ctga The amino acid sequence of human FANCD2 (Uni-prot ref: Q9BXW9) (SEQ ID NO: 4) may be found below:
1 MVSKRRLSKS EDKESLTEDA SKTRKQPLS KTKKSHIANE VEENDSIFVK LLKISGIILK
61 TGESQNQLAV DQIAFQ KLF QTLRRHPSYP KIIEEFVSGL ESYIEDEDSF RNCLLSCERL
121 QDEEASMGAS YSKSLI LLL GIDILQPAII KTLFEKLPEY FFENK SDEI NIPRLIVSQL
181 KWLDRWDGK DLTTKIMQLI SIAPENLQHD IITSLPEILG DSQHADVGKE LSDLLIENTS
241 LTVPILDVLS SLRLDPNFLL KVRQLVMDKL SSIRLEDLPV II FILHSVT AMDTLEVISE
301 LREKLDLQHC VLPSRLQASQ VKLKSKGRAS SSGNQESSGQ SCI1LLFDVI KSAIRYEKTI
361 SEAWIKAIEN TASVSEH VF DLVMLFIIYS TNTQTKKYID RVLRNKIRSG CIQEQLLQST
421 FSVHYLVLKD MCSSILSLAQ SLLHSLDQSI ISFGSLLYKY AF FFDTYCQ QEWGALVTH
481 ICSGNEAEVD TALDVLLELV VLNPSAMMM AVFVKGILDY LDNISPQQIR KLFYVLSTLA
541 FSKQNEASSH IQDDMHLVIR KQLSSTVFKY KLIGIIGAVT MAGI AADRS ESPSLTQERA
601 NLSDEQCTQV TSLLQLVHSC SEQSPQASAL YYDEFANLIQ HE LDPKALE WVGHTICNDF
661 QDAFWDSCV VPEGDFPFPV KALYGLEEYD TQDGIAINLL PLLFSQDFAK DGGPVTSQES
721 GQ LVSPLCL APYFRLLRLC VERQHNGNLE EIDGLLDCPI FLTDLEPGE LESMSAKERS
Ί81 FMCSLIFLTL NWFREIVNAF CQETSPEMKG KVLTRLKHIV ELQIILEKYL AVTPDYVPPL
841 GNFDVETLDI TPHTVTAISA IR KG IER KQKTDGSKTS SSDTLSEEKN SECDPTPSHR
901 GQLNKEFTGK EE TSLLLHN SHAFFRELDI EVFSILHCGL VT FILDTEM HTEATEWQL
961 GPPELLFLLE DLSQKLESML TPPIARRVPF LKNKGSRNIG FSHLQQRSAQ EIVHCVFQLL
1021 TPMCNHLENI HNYFQCLAAE NHGWDGPGV KVQEYHIMSS CYQRLLQIFH GLFAWSGFSQ
1081 PENQNLLYSA LHVLSSRLKQ GEHSQPLEEL LSQSVHYLQN FHQSIPSFQC ALYLIRLLMV
1141 ILEKSTASAQ N EKIASLAR QFLCRVWPSG DKEKSNISND QLHALLCIYL EHTESILKAI
1201 EEIAGVGVPE LI SPKDASS STFPTLTRHT FVVFFRVMMA ELEKTV KIE PGTAADSQQI
1261 HEE LLYWNM AVRDFSILIN LIKVFDSHPV LHVCLKYGRL FVEAFLKQCM PLLDFSFRKH
1321 REDVLSLLET FQLDTRLLHH LCGHSKIHQD TRLTQHVPLL KTLELLVCR VKAMLTLNNC
1381 REAFWLGNLK NRDLQGEEIK SQNSQESTAD ESEDDMSSQA SKSKATEVSL QNPPESGTDG
1441 CILLIVLSWW SRTLPTYVYC QMLLCPFPFP P
The human FANCI polypeptide and polynucleotide sequences are shown below and are shown at GenBank ref: NM_001113378.1 and Uni-Prot ref: Q9NVI1. The skilled person will readily be able to identify other FANCI polypeptide sequences from databases. For example, the Homologene feature of the NCBI database may be used.
The nucleotide sequence of human FANCI (GenBank ref: NM_001113378.1) (SEQ ID NO: 5) may be found below:
1 tcttgttgtt acgggtaacg gaagtgtggc ggcgttgggt tgagcgggct ttttggaagt 61 ttgtggcgga gttctgtgat atgagcaaca atggaccaga agattttatc tctagcagca 121 gaaaaaacag cagacaaact gcaagaattt cttcaaaccc tgagagaagg tgatttgact 181 aatctccttc agaatcaagc agtgaaagga aaagttgctg gagcactcct gagagccatc
241 ttcaaaggtt ccccctgctc tgaggaagct ggaacactta ggagacgtaa gatatacact
301 tgttgtatcc agttggtgga atcgggggat ttgcagaaag aaatagcgtc tgagatcata
361 ggattactga tgctggaggc tcaccatttt ccaggaccat tattggttga attagccaat 421 gagtttatta gtgctgtcag agaaggcagc ctagtgaatg gaaaatcttt ggagttacta
481 cctatcattc ' tcactgccct ggctacgaaa aaggaaaatc tggcttatgg aaaaggtgta
541 ctgagtgggg aagaatgtaa gaaacagttg attaacaccc tgtgttctgg caggtgggat
601 cagcaatatg taatccaact cacctccatg ttcaaggatg tccctctgac tgcagaagag
661 gtggaatttg tggtggaaaa agcattgagc atgttctcca agatgaatct tcaagaaata 721 ccacctttgg tctatcagct tctggttctc tcctccaagg gaagcagaaa gagtgttttg
781 gaaggaatca tagccttctt cagtgcacta gataagcagc acaatgagga acagagtggt
841 gacgagctat tggatgttgt cactgtgcca tcaggtgaac ttcgtcatgt ggaaggcacc
901 attattctac acattgtgtt tgccatcaaa ttggactatg aactaggcag agaactcgtg
961 aaacacttaa aggtaggaca gcaaggagat tccaataata acttaagtcc cttcagcatt 1021 gctcttcttc tgtctgtaac aagaatacaa agatttcagg accaggtgct tgatctttta
1081 aagacttcgg ttgtaaagag ctttaaggat cttcaactcc tccaaggctc aaaatttctt
1141 cagaatctag ttcctcatag atcttatgtt tcaaccatga tcttggaagt agtgaagaat
1201 agcgttcata gctgggacca tgttactcag ggcctcgtag aacttggttt cattttgatg
1261 gattcatatg ggccaaagaa ggttcttgat ggaaaaacta ttgaaaccag cccaagtctt 1321 tctagaatgc caaaccagca tgcatgtaag ctcggagcta atatcctgtt ggaaactttt
1381 aagatccatg agatgatcag acaagaaatt ttggagcagg tcctcaacag ggttgttacc
1441 agagcatctt ctcccatcag tcatttctta gacctgcttt caaatatcgt catgtatgca
1501 cccttagttc ttcaaagttg ttcttctaaa gtcacagaag cttttgacta tttgtccttt
1561 ctgccccttc agactgtaca aaggctgctt aaggcagtgc agccccttct caaagtcagc 1621 atgtcaatga gagactgctt gatacttgtc cttcggaaag ctatgtttgc caaccagctt
1681 gatgcccgaa aatctgcagt tgctgggttt ttgctgctcc tgaagaactt taaagtttta
1741 ggcagcctgt catcctctca gtgcagtcag tctctcagtg tcagtcaggt tcatgtggat
1801 gttcacagcc attacaattc tgtcgccaat gaaacttttt gccttgagat catggatagt
1861 ttgaggagat gcttaagcca gcaagctgat gttcgactca tgctttatga ggggttttat 1921 gatgttcttc gaaggaactc tcagctggct aattcagtca tgcaaactct gctctcacag
1981 ttaaaacagt tctatgagcc aaaacctgat ctgctgcctc ctctgaaatt agaagcttgt
2041 attctgaccc aaggagataa gatctctcta caagaaccac tggattatct gctgtgttgt
2101 attcagcatt gtttggcctg gtataagaat acagtcatac ccttacagca gggagaggag
2161 gaagaggagg aggaagaggc attctacgaa gacctagatg atatattgga gtccattact 2221 aatagaatga ttaagagtga gctggaagac tttgaactgg ataaatcagc agatttttct
2281 cagagcacca gtattggcat aaaaaataat atctgtgctt ttcttgtgat gggagtttgt
2341 gaggttttaa tagaatacaa tttctccata agtagtttca gtaagaatag gtttgaggac
2401 attctgagct tatttatgtg ttacaaaaaa ctctctgaca ttcttaatga aaaagcgggt
2461 aaagccaaaa ctaaaatggc caacaagaca agtgatagtc ttttgtccat gaaatttgtg 2521 tccagtcttc tcactgctct tttcagggat agtatccaaa gccaccaaga aagcctttct
2581 gttctcaggt ccagcaatga gtttatgcgc tatgcagtga atgtagctct gcagaaagta
2641 cagcagctaa aggaaacagg gcatgtgagt ggccctgatg gccaaaaccc agaaaagatc
2701 tttcagaacc tctgtgacat aactcgagtc ttgctatgga gatacacttc aattcctact
2761 tcagtggaag agtcgggaaa gaaagagaaa ggaaagagca tctcactgct gtgcttggag 2821 ggtttacaga aaatattcag tgctgtgcaa cagttctatc agcccaagat tcagcagttt
2881 ctcagagctc tggatgtcac agataaggaa ggagaagaga gagaagatgc agatgtcagt 2941 gtcactcaga gaacagcatt ccagatccgg caatttcaga ggtccttgtt gaatttactt 3001 agcagtcaag aggaagattt taatagcaaa gaagccctcc tgctagtcac ggttcttacc 3061 agtttgtcca agttactgga gccctcctct cctcagtttg tgcagatgtt atcctggaca 3121 tcaaagattt gcaaggaaaa cagccgggag' gatgccttgt tttgcaagag cttgatgaac 3181 ttgctcttca gcctgcatgt ttcgtataag agtcctgtca ttctgctgcg tgacttgtcc
3241 caggatatcc acgggcatct gggagatata gaccaggatg tagaggtgga gaaaacaaac 3301 cactttgcaa tagtgaattt gagaacggct gcccccactg tctgtttact tgttctgagt 3361 caggccgaga aggttctaga agaagtggac tggctaatca ccaagcttaa gggacaagtg 3421 agccaagaaa ccttatcaga agaggcctct tctcaggcaa ccctaccaaa tcagcctgtt 3481 gagaaagcta tcatcatgca actgggaact ctgcttacat ttttccacga gctggtgcag
3541 acagctctgc catcaggcag ctgtgtggac accttgttaa aggacttgtg caaaatgtac 3601 accacactta cagcccttgt cagatattat ctccaggtgt gtcagagctc cggaggaatt 3661 ccaaaaaata tggaaaagct ggtgaagctg tctggttctc atctgacccc cctgtgttat 3721 tctttcattt cttacgtaca gaataagagt aagagcctga actatacggg agagaaaaag 3781 gagaaacctg ctgccgttgc cacagccatg gccagagttc ttcgggaaac caagccaatc
3841 cctaacctca tctttgccat agaacagtat gaaaaatttc tcatccacct ttctaagaag 3901 tccaaggtga acctgatgca gcacatgaag ctcagcacct cacgagactt caagatcaaa 3961 ggaaacatcc tagacatggt tcttcgagag gatggtgaag atgaaaatga agagggcact 4021 gcatcagagc atgggggaca gaacaaagaa ccagccaaga agaaaaggaa aaaataaatg 4081 aaatgcctga gttaatgtga actttggggc ttctgcttca tttttaccca acaagcaaca
4141 atgccccttg tcctgtagtc cacaccgatg ttggcatctt ggttctgaac ccactgaatt 4201 caactgcacc ttcagttaga aggaatcttc ttggcaggtc ctgctactga aaaatggctg 4261 gccttaggca agcccttttg caaaaagcac agctgaaagc ctgagtttgg gagcctgcac 4321 caccccgatg aagctccacg ggagcaaata cagagcctcc aggcagtgct atggtccagg 4381 ctggcttcgt ttttccaagg agcctttggt gagttcaatt atctggtaaa tatccagcgc
4441 ttcacctgaa agatagtgca aattggttag gatgccacct caagaactgt aactgagagc 4501 tcagaagtga gcaaaggagc ttaatgctaa ggtcaaaagg agagtgaaag gttgagaaca 4561 attgccacga acggtaatgt tacatgttag gagggtctgt tttcttttta tataagtgtg 4621 tcttagatat attttaaata gaaaataagc tttctgattt acttgtttgg tatttaaagc 4681 acagtttgtt tttctgtcac ctatagagtg caagaatgca ctctatagaa taaattatct
4741 ttaaacatt
The amino acid sequence of human FANCI (Uni-prot ref: Q9NVI1) (SEQ ID NO: 6) may be found below:
1 MDQ ILSLAA EKTADKLQEF LQTLREGDLT NLLQNQAVKG KVAGALLRAI F GSPCSEEA 61 GTLRRRKIYT CCIQLVESGD LQKEIASEII GLLMLEAHHF PGPLLVELAN EFISAVREGS 121 LV GKSLELL PIILTALATK KENLAYGKGV LSGEECK QL INTLCSGRWD QQYVIQLTS 181 FKDVPLTAEE VEFVVEKALS MFSKMNLQEI PPLVYQLLVL SS GSR SVL EGIIAFFSAL 241 D QHNEEQSG DELLDWTVP SGELRHVEGT IILHIVFAI LDYELGRELV KHLKVGQQGD 301 SNNNLSPFSI ALLLSVTRIQ RFQDQVLDLL KTSWKSF D LQLLQGSKFL QNLVPHRSYV 361 STMILEWKN SVHSWDHVTQ GLVELGFILM DSYGPKKVLD GKTIETSPSL SRMPNQHACK 421 LGANILLETF KIHEMIRQEI LEQVLNRWT RASSPISHFL DLLSNIVMYA PLVLQSCSSK 481 VTEAFDYLSF LPLQTVQRLL KAVQPLLKVS MSMRDCLILV LRKAMFANQL DARKSAVAGF 541 L.LLLKNFKVL GSLSSSQCSQ SLSVSQVHVD VHSHYNSVAN ETFCLEIMDS LRRCLSQQAD 601 VRLMLYEGFY DVLRRNSQLA NSVMQTLLSQ LKQFYEPKPD LLPPLKLEAC ILTQGDKISL 661 QEPLDYLLCC IQHCLAWYKN TVIPLQQGEE EEEEEEAFYE DLDDILESIT NRMIKSELED 721 FELD SADFS QSTSIGIKNN ICAFLVMGVC EVLIEYNFSI SSFSKNRFED ILSLFMCYKK 781 LSDILNEKAG KAKTK ANKT SDSLLSMKFV SSLLTALFRD SIQSHQESLS VLRSSNEFMR 841 YAVNVALQKV QQLKETGHVS GPDGQNPEKI FQNLCDITRV LL RYTSIPT SVEESGKKEK
901 GKSISLLCLE GLQKIFSAVQ QFYQPKIQQF LRALDVTDKE GEEREDADVS VTQRTAFQIR 961 QFQRSLLNLL SSQEEDF S EALLLVTVLT SLSKLLEPSS PQFVQMLSWT SKIC ENSRE 1021 DALFC SLMN LLFSLHVSYK SPVILLRDLS QDIHGHLGDI DQDVEVE TN HFAIVNLRTA 1081 APTVCLLVLS QAEKVLEEVD WLITKLKGQV SQETLSEEAS SQATLPNQPV EKAII QLGT 1141 LLTFFHELVQ TALPSGSCVD TLL DLCKMY TTLTALVRYY LQVCQSSGGI PKNMEKLVKL
1201 SGSHLTPLCY SFISYVQNKS KSLNYTGEKK EKPAAVATAM ARVLRETKPI PNLIFAIEQY 1261 EKFLIHLSKK SKVNLMQHMK LSTSRDFKIK GNILDMVLRE DGEDENEEGT ASEHGGQNKE 1321 PA KRKK The FAN1 or FANCD2 or FANCI polypeptide may comprise a tag sequence, as will be well known to those skilled in the art. For example, a tag useful in a FRET system may be used. For example a fluorescent protein tag, for example a Cherry tag may be used. A GST moiety or Green Fluorescent Protein (GFP) moiety or a FLAG moiety may alternatively be used. Typically the FAN1 or FANCD2 or FANCI is a full length FAN1 or FANCD2 or FANCI polypeptide.
The FAN1 polypeptide may be a NUS-His6 fusion polypeptide. The FAN1 polypeptide may be recombinant. The FAN1 polypeptide is typically human FAN1 , but may alternatively be another mammalian FA 1 , for example FAN1 of a laboratory animal or of a tissue or organ assay system considered useful in assessing a potential inhibitor of FAN1. Thus, the FAN1 may be a laboratory rodent FAN (for example mouse, rabbit or rat) or may be a laboratory primate FAN1 , for example a monkey FAN1. An assay of the present invention may, for example, be useful in assessing the effect of a test compound on FAN1 in tissue of a laboratory animal, for example a mouse or a monkey. For example, a mouse human tumor xenograft model may be used to assess the effect of a test compound on FAN1. It is particularly preferred, although not essential, that the FAN1 polypeptide has at least 30% of the enzyme activity of full-length human FAN1 on a polynucleotide substrate as defined herein. A particularly preferred substrate is the 5' flap shown in Figure 2A. It is more preferred if the FAN1 polypeptide has at least 50%, preferably at least 70% and more preferably at least 90% of the enzyme activity of full-length human FAN1 on a polynucleotide substrate as defined herein.
By "variants" of a polypeptide we include insertions, deletions and substitutions, either conservative or non-conservative. In particular we include variants of the polypeptide where such changes do not substantially alter the endonuclease or 5'-exonuclease activity, or the interaction between FAN1 and FANCD2 or FANCI polypeptide, as appropriate. The skilled person will readily be able to design and test appropriate variants, based on, for example, comparison of sequences of examples of each polypeptide, for example from different species. The skilled person will readily be able to determine where insertions or deletions can be made; or which residues can appropriately be left unchanged; replaced by a conservative substitution; or replaced by a non-conservative substitution. The variant polypeptides can readily be tested, for example as described in the Examples. Optionally, the FAN1 polypeptide retains a functional UBZ domain, for example retains Cys44 and Cys47, as discussed in the Examples.
By "conservative substitutions" is intended combinations such as Gly, Ala; Val, lie, Leu; Asp, Glu; Asn, Gin; Ser, Thr; Lys, Arg; and Phe, Tyr.
The three-letter or one letter amino acid code of the lUPAC-IUB Biochemical Nomenclature Commission is used herein, with the exception of the symbol Zaa, defined above. In particular, Xaa represents any amino acid. It is preferred that at least the amino acids corresponding to the consensus sequences defined herein are L-amino acids.
It is particularly preferred if the polypeptide variant has an amino acid sequence which has at least 65% identity with the amino acid sequence of the relevant human polypeptide, more preferably at least 70%, 71%, 72%, 73% or 74%, still more preferably at least 75%, yet still more preferably at least 80%, in further preference at least 85%, in still further preference at least 90% and most preferably at least 95% or 97% identity with the amino acid sequence of the relevant human polypeptide.
It is still further preferred if the FAN1 variant has an amino acid sequence which has at least 65% identity with the amino acid sequence of the catalytic domain of the human polypeptide, more preferably at least 70%, 71%, 72%, 73% or 74%, still more preferably at least 75%, yet still more preferably at least 80%, in further preference at least 83 or 85%, in still further preference at least 90% and most preferably at least 95% or 97% identity with the relevant human amino acid sequence. The location of the catalytic domain is discussed above and in the Examples. The percent sequence identity between two polypeptides may be determined using suitable computer programs, for example the GAP program of the University of Wisconsin Genetic Computing Group and it will be appreciated that percent identity is calculated in relation to polypeptides whose sequence has been aligned optimally. The alignment may alternatively be carried out using the Clustal W program (Thompson et a/., 1994). The parameters used may be as follows:
Fast pairwise alignment parameters: K-tuple(word) size; 1 , window size; 5, gap penalty; 3, number of top diagonals; 5. Scoring method: x percent.
Multiple alignment parameters: gap open penalty; 10, gap extension penalty; 0.05.
Scoring matrix: BLOSUM.
The alignment may alternatively be carried out using the program T-Coffee, or EMBOSS.
The residue corresponding (equivalent) to, for example, Cys44 of full-length human FAN1 may be identified by alignment of the sequence of the polypeptide with that of full- length human FAN1 in such a way as to maximise the match between the sequences. The alignment may be carried out by visual inspection and/or by the use of suitable computer programs, for example the GAP program of the University of Wisconsin Genetic Computing Group, which will also allow the percent identity of the polypeptides to be calculated. The Align program (Pearson (1994) in: Methods in Molecular Biology, Computer Analysis of Sequence Data, Part II (Griffin, AM and Griffin, HG eds) pp 365- 389, Humana Press, Clifton). Thus, residues identified in this manner are also "corresponding residues". It will be appreciated that in the case of truncated forms of (for example) FAN1 or in forms where simple replacements of amino acids have occurred it is facile to identify the "corresponding residue".
It is preferred that the polypeptides used in the screen are mammalian, preferably human (or a species useful in agriculture or as a domesticated or companion animal, for example dog, cat, horse, cow), including naturally occurring allelic variants (including splice variants). The polypeptides used in the screen may comprise a GST portion or may be biotinylated or otherwise tagged, for example with a 6His, HA, myc or other epitope tag, as known to those skilled in the art, or as mentioned above or as described in the Examples. This may be useful in purifying and/or detecting the polypeptide(s). The substrate polynucleotide may consist of or comprise the structure of the 5' flap polynucleotide identified in Figure 2A, which is efficiently cleaved in vitro. Modifications to the length and structure such that the utility of the substrate in the methods of the invention may be improved are standard in the art as would be understood by a person of skill in the art.
Binding of the FAN1 polypeptide to an ubiquitinylated FANCD2 or FANCI polypeptide may be assessed by any suitable technique for assessing protein: protein interaction. For example, the interaction between polypeptides may be detected using fluorescence resonance energy transfer; immunoprecipitation; subcellular fractionation or imaging; surface plasmon resonance (SPR); or isothermal titration calorimetry.
Typically a FRET (fluorescence resonance energy transfer) technique may be used, as discussed further below. Other techniques that may be useful may make use of immunoprecipitation techniques. For example, immunoprecipitation may be with an antibody that binds specifically to FAN1 ; or may be with an antibody that binds specifically to an ubiquitinylated FANCD2 or FANCI polypeptide, as will be apparent to the skilled person. Alternatively, immunoprecipitation may be with an antibody that binds specifically to a tag present on recombinant FAN1 ; or with an antibody that binds specifically to a tag present on a recombinant FANCD2 or FANCI polypeptide, as will also be apparent to the skilled person.
As an example, it is considered that detection of FAN1 coupled with either ubiquitinylated FANCD2 or FANCI co- pull down or an anti- ubiquitinylated FANCD2 or FANCI antibody can be carried out using Invitrogen's Alpha-Elisa technologies, which would be useful in achieving a high throughput screening system. Multiplex assays using Luminex beads or plate based electrochemiluminescence (MSD; meso scale discovery) detection could also be used.
Details of Alpha screen technology (Perkin Elmer) applicable to both protein.protein and phosphoprotein detection (Sure fire kits developed and sold for MAPK, JAK/STAT and AKT pathways) can be found at, for example, http://las.perkinelmer.co.uk/Catalog/CategoryPage. htm?CategorylD=AlphaTech&M=BIO Details of Luminex technology applicable to phospho protein detection and protein:protein and total protein quantitiation can be found at, for example,
http://www.luminexcorp.com/applications/cellular_signaling.html
An example of the use of such technology is described in reference Khan IH, Zhao J., Ghosh, P. Ziman, M., Sweeney C, Kung HJ and Luciw PA (2010) Assay Drug Dev technology 8, 27-36. In MSD technology the principles of capture onto surface of plate and antibody detection are the same as any ELISA but the mode of detection uses electrochemiluminescence via Ruthenium tagged probes, and the technology allows multiplexing in the well through an array format.
http://www.mesoscale.com/CatalogSystemWeb/WebRoot literature/brochures/pdf/techBr ochure.pdf
Quantitative Stable Isotope Labelling with Amino acids in Cell culture (SILAC)-based mass spectrometry may be used to identify and quantitate proteins associated with immunoprecipitates of FAN1 or ubiquitinylated FANCD2 or FANCI. Other immunoprecipitate methods may be used, as will be well known to those skilled in the art. For example labeled ubiquitinylated FANCD2 or FANCI may be used. Some examples of such methods are described in the Examples. As noted above, other techniques for assessing protein: protein interactions in cells or cell extracts may also be used. For example, a fluorescence resonance energy transfer (FRET) based system may be used if the interaction of a recombinant FAN1 and recombinant ubiquitinylated FANCD2 or FANCI is being assessed, for example if both FAN1 and ubiquitinylated FANCD2 or FANCI polypeptide are both tagged with a fluorescent polypeptide.
Thus, the molecular interaction between FAN1 and ubiquitinylated FANCD2 or FANCI proteins (and the effects of test compounds) could be investigated using a FRET-based method such as FLI -FRET on a microscope such as a multiphoton microscope. As an example, a construct for expressing Cherry-tagged wild type ubiquitinylated FANCD2 or FANCI or (as a control) an inactive mutant of FANCD2 or FANC1 that does not bind FAN1 may be transfected into a cell line stably expressing wild type GFP-FAN1 or control polypeptide. FRET (fluorescence resonance energy transfer) can occur when the GFP and mCherry fluorophores are brought together by virtue of the binding of FAN1 to ubiquitinylated FANCD2 or FANCI which will in turn affects their fluorescence lifetime, which can be detected. Using FLIM (fluorescence lifetime imaging microscopy) it is possible to generate a spatial distribution of the cell where sites of strong protein-protein interaction (and therefore FRET) and weak interaction or no interaction can be recognised (by colour coding: see, for example, Lieres et al. 2009 Quantitative analysis of chromatin compaction in living cells using FLIM-FRET. J Cell Biol. 2009 Nov 16;187(4):481-96.).
Commonly used FRET pairs include CFP (donor) and YFP (acceptor) as well as GFP (donor) and Cherry (acceptor). In cases where the donor and acceptor fluorophores are both excited with the same excitation light wavelength, e.g. in case of the FRET pair GFP-YFP, a special kind of FRET termed enhanced acceptor fluorescence (EAF) can be detected. Examples of further references concerning FRET techniques include Wallrabe & Periasamy (2005) Current Opinion in Biotechnology Volume 16, Issue 1 , February 2005, Pages 19-27; Imaging protein molecules using FRET and FLIM microscopy; Ai et al (2008) Nature Methods 5, 401-403 Fluorescent protein FRET pairs for ratiometric imaging of dual biosensors; Shaner et al. (2004) Nat Biotechnol 22: 1567-1572 Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein.
The compounds identified in the methods may themselves be useful as a drug or they may represent lead compounds for the design and synthesis of more efficacious compounds.
The compound may be a drug-like compound or lead compound for the development of a drug-like compound for each of the above methods of identifying a compound. It will be appreciated that the said methods may be useful as screening assays in the development of pharmaceutical compounds or drugs, as well known to those skilled in the art.
The term "drug-like compound" is well known to those skilled in the art, and may include the meaning of a compound that has characteristics that may make it suitable for use in medicine, for example as the active ingredient in a medicament. Thus, for example, a drug-like compound may be a molecule that may be synthesised by the techniques of organic chemistry, less preferably by techniques of molecular biology or biochemistry, and is preferably a small molecule, which may be of less than 5000 daltons. A drug-like compound may additionally exhibit features of selective interaction with a particular protein or proteins and be bioavailable and/or able to penetrate cellular membranes, but it will be appreciated that these features are not essential.
The term "lead compound" is similarly well known to those skilled in the art, and may include the meaning that the compound, whilst not itself suitable for use as a drug (for example because it is only weakly potent against its intended target, non-selective in its action, unstable, difficult to synthesise or has poor bioavailability) may provide a starting- point for the design of other compounds that may have more desirable characteristics. It will be understood that it will be desirable to identify compounds that may modulate the endonuclease activity or 5'exonuclease activity of a FAN1 polypeptide in vivo. Thus it will be understood that reagents and conditions used in the method may be chosen such that the interactions between, for example, the FAN1 polypeptide and a substrate nucleic acid, are substantially the same as between the human FAN1 and an endogenous human substrate nucleic acid. Typically a method of the invention may be performed in a human cell-based system, optionally expressing human recombinant polypeptides.
The compounds that are tested in the screening methods of the invention or in other assays in which the ability of a compound to modulate the endonuclease activity or 5'exonuclease activity of a FAN1 polypeptide, may be measured, may be (but do not have to be) compounds that have been selected and/or designed (including modified) using molecular modelling techniques, for example using computer techniques. The selected or designed compound may be synthesised (if not already synthesised) and tested for its effect on the FAN1 polypeptide, for example its effect on the endonuclease activity or 5'exonuclease activity. The compound may be tested in a screening method of the invention.
The compounds that are tested may be compounds that are already considered likely to be able to modulate the activity of an endonuclease or 5'exonuclease; or may be compounds that have not been selected on the basis of being likely to modulate the activity of an endonuclease or 5'exonuclease. Thus, the compounds tested may be compounds forming at least part of a general, unselected compound bank; or may alternatively be compounds forming at least part of a pre-selected compound bank, for example a bank of compounds pre-selected on the basis of being considered likely to modulate the activity of an endonuclease or 5'exonuclease. It will be appreciated that screening assays which are capable of high throughput operation will be particularly preferred. Examples may include cell based assays and protein-protein binding assays. As will be apparent to those skilled in the art, it may be desirable to assess what effect the compound has on other endonucleases or 5'exonucleases.
The screening methods of the invention may comprise the step of synthesising, purifying and/or formulating the selected compound. The compound may be formulated for pharmaceutical use, for example for use in in vivo trials in animals or humans.
A further aspect of the invention provides a purified preparation or kit of parts comprising a FA 1 polypeptide or polynucleotide; and a substrate polynucleotide as defined above and/or a FANCD2 or FAN CI polypeptide.
It is envisaged that suitable kits for performing in vitro assays may comprise a FA 1 polypeptide or polynucleotide, a fluorescently labelled DNA flap substrate, and a suitable buffer comprising divalent cations, such as g2+, Mn2+, Zn2+, Co2+, Cu2+ and/or Ca2+. Such DNA flap substrates may be assembled by annealing oligonucletides, for example where one oligonucletode comprises label, such as a chromophore or dye.
The preparation or kit may comprise a recombinant FAN1 polynucleotide. The kit of parts may further comprising ubiquitin or dithiobis (succinimidyl propionate) (DSP) or a de-ubiquitinase inhibitor, for example N-ethyl maleimide (NEM).
By "purified" is meant that the preparation has been at least partially separated from other components in the presence of which it has been formed, for example other components of a recombinant cell. Examples of methods of purification that may be used are described in the Examples.
The preparation may be substantially pure. By "substantially pure" we mean that the said polypeptide(s) are substantially free of other proteins. Thus, we include any composition that includes at least 2, 3, 4, 5, 10, 15, 20 or 30% of the protein content by weight as the said polypeptides, preferably at least 50%, more preferably at least 70%, still more preferably at least 90% and most preferably at least 95% of the protein content is the said polypeptides.
Thus, the invention also includes compositions comprising the said polypeptides and a contaminant wherein the contaminant comprises less than 96, 95, 94, 90, 85, 80 or 70% of the composition by weight, preferably less than 50% of the composition, more preferably less than 30% of the composition, still more preferably less than 10% of the composition and most preferably less than 5% of the composition by weight. The invention also includes the substantially pure said polypeptides when combined with other components ex vivo, said other components not being all of the components found in the cell in which said polypeptides are found.
A further aspect of the invention provides a mutant FAN1 polypeptide or polynucleotide wherein Asp 981 and/or Arg982 are mutated, optionally to alanine; and/or wherein Cys44 and/or Cys47 are mutated, optionally to alanine.
A further aspect of the invention provides the use of a FAN1 polypeptide in an in vitro method of resolving a DNA ICL.
A further aspect of the invention provides an in vitro method of resolving a DNA ICL, the method comprising the step of using a FAN1 polypeptide.
The screening method of the invention may comprise the step of assessing whether the compound modulates the repair of a DNA inter-strand crosslink, resolution of an ICL- induced double strand break, or homologous recombination in a cell, or in increasing cancer cells' sensitivity to ICLs or enhancing the effect of platinum based chemotherapy or other ICL-inducing therapy on cancer cells, in a whole cell, tissue or organism; and a compound that modulates the activity or therapeutic response is selected.
The method may further comprise the step of assessing whether the compound modulates the activity of a FAN1 polypeptide in the whole cell, tissue or organism, and a compound that modulates the activity is selected. The method may further comprise the step of synthesising, purifying and/or formulating the selected compound. A further aspect of the invention provides a method for preparing a compound which modulates the activity of a FAN1 polypeptide, the method comprising 1) performing a method according to the invention and 2) synthesising, purifying and/or formulating the selected compound.
A further aspect of the invention provides a method of characterising a patient with cancer and/or suspected Fanconi Anaemia, the method comprising the step of assessing the patient's genotype or phenotype for FAN1. The method may include the step of assessing the expression level of FAN1 polynucleotide or polypeptide in the patient. The method of characterising a patient with cancer or suspected Fanconi Anaemia may further comprise the step of assessing the patient's genotype or phenotype for SLX4 and/or SLX1. It is envisaged that such methods may aid in the diagnosis of cancer or Fanconi Anaemia. It is further envisaged that an appropriate treatment regime may be chosen based on the genotype or phenotype identified above.
The invention will now be described in more detail by reference to the following, non- limiting, figures and examples.
Any references referred to herein are hereby incorporated by reference.
Figure legends
Figure 1. The KIAA1018/MTMR15/FAN1 family of proteins. A. Schematic representation of the domain architecture of KIAA1018/MTMR15/FAN1 orthologues from different species. The relevant protein identification codes are: Homo sapiens Q9Y2 0; Danio rerio Q1 LWH4; Caenorhabditis elegans P90740; Schizosaccharomyces pombe Q9Y804; Arabidopsis thaliana Q9SX69; Oryza sativa B9FRR6; Pseudomonas aeruginosa Q9I2N0. B. Alignment of the VRR_nuc domain of FAN1. Identical residues are shaded in black, similar residues are shaded in grey. The asterisks denote conserved residues Asp981 and Arg982 mutated in the FAN1-DR mutant. (SEQ ID NOS: 23-29) C. Alignment of the UBZ domain of FAN1. Identical residues are shaded in black, similar residues are shaded in grey. The conserved Cys and His residues that define the two dyads of the UBZ domain are shaded in red. The asterisk denotes the conserved Cys44 and Cys47 residues in the first dyad. (SEQ ID NOS: 30-48) Figure 2 FAN1 has structure-specific endonuclease activity
Recombinant human FAN1 was incubated with synthetic DNA structures: splayed duplex (SD; oligos a3, b), 3' flap (3'F; oligonucleotides a3, b, d3), 5' flap (5'F; oligos a3, b, c) or a replication fork (RF)-Nke structure (oligos a3, b, c, d3), each radioactively 5'-32P- labelled on the strands indicated. WT refers to wild-type FAN1 and DR refers to the Asp981Ala-Arg982Ala FAN1 mutant. A. Schematic diagram of the DNA substrates used in A. Sites of DNA cleavage are indicated by arrows. (SEQ ID NOS: 49 and 50). B. Reaction products (10 min incubation) were subjected to denaturing PAGE. Purine- specific chemical sequencing ladders (R) were derived from oligonucleotides a3 or b. C. FA 1 was incubated with the 5' flap shown in A. for the time indicated (s, seconds) and reaction products were subjected to denaturing PAGE. D, Progress curves of cleavage of the 5' flap construct incubated with wild type (black squares) and DR (red triangles) mutant FAN1. The data have been fitted to a single (DR) or double (wild type) exponential functions (lines). From these data we have calculated observed rates of cleavage of > 0.2 s"1 and 0.0003 s"1 for wild type and DR enzymes respectively.
See also Figure 9. Figure 3 FAN1 has 5' exonuclease activity
Recombinant human FAN1 was incubated for the time indicated (s, seconds) with dsDNA (oligonucleotide a3, a3-cp), ssDNA (oligonucleotide a3) or with a 5' flap (5'F; oligonucleotides a3, b, c) radioactively 5'- or 3'-32P-labelled on the a3 strand as shown (asterisks). WT refers to wild-type FAN1 and DR refers to the Asp981Ala-Arg982Ala FAN1 mutant. Reaction products were subjected to denaturing PAGE. A. Cleavage of linear DNA substrates. B. The cleavage products were quantitated. "Fraction DNA cut" is the ratio of the relevant cleavage product to total DNA (cleaved plus uncleaved DNA). The data are plotted as a function of time, and fitted to single or double exponential functions. C. Activity of WT FA 1 on radioactively 3'-32P-labelled 5' flap. R refers to a purine-specific chemical sequencing ladder derived from the labelled strand.
See also Figure 10.
Figure 4 FAN1 interacts with DNA repair proteins
A. HEK293 Flp-ln cells that stably express GFP-FAN1 were lysed in the presence of dithiobis (succinimidyl propionate) (DSP) or N-ethyl maleimide (NEM). These extracts together with extracts of cells that express GFP only were subjected to immunoprecipitation with GFP-Trap beads and after extensive washing precipitates were subjected to SDS-PAGE. The gel was fixed and stained with Colloidal Blue. The gel lane containing FAN1 -associated proteins was cut into slices, as indicated, and the proteins were digested with trypsin before mass spectrometric fingerprinting. B. HEK293 Flp-ln cells that stably express GFP-FAN1 were lysed in the presence or absence of DSP and extracts were subjected to immunoprecipitation with control anti-HA (IgG) or GFP-Trap beads. Precipitates were analysed by western blotting with the antibodies indicated. Input represents 4% of the extract used for immunoprecipitation. C. HEK293 cells were lysed in the presence or absence of DSP and extracts were subjected to immunoprecipitation with anti-HA (IgG) or with anti-FAN1 antibodies. Precipitates were analysed by western blotting with the antibodies indicated. Input represents 4% of the extract used for immunoprecipitation. D. Extracts of HEK293 cells were analysed by size exclusion chromatography on a HiLoad 26/60 Superdex 200 column in buffer containing 0.2 M NaCI, and every third fraction was denatured and analysed by western blotting with the indicated antibodies. The elution positions of Dextran blue (2 MDa), thyroglobulin (670 kDa) and bovine γ-globulin (158 kDa) are shown.
See also Fig. 15.
Figure 5 The UBZ domain of FAN1 binds mono-ubiquitinated FANCD2
A. HEK293 cells were transiently transfected with pcDNA5.1-GFP-FAN1 wild type (WT) or pcDNA5.1-GFP-FAN1-UBZ* (Cys44A/Cys47A). After 48 h, cells were lysed in the presence or absence of DSP and anti-GFP precipitates were analysed by western blotting with the antibodies indicated. "Input" represents cell extracts. B. U20S cells, grown on glass coverslips, were transiently transfected with pcDNA5.1-GFP, pcDNA5.1- GFP-FAN1 wild type (WT) or pcDNA5.1-GFP-FAN1-UBZ* (Cys44A/Cys47A). Cells were treated, or not, with MMC and after 16 h GFP-FAN1 foci and FANCD2 foci were detected. C. Quantitation of data from B. The number of cells with >5 GFP-FAN1 foci in a sample of 500 cells were counted. D. U20S cells were transfected with control siRNA, or siRNA targeting FAN1 and the number of cells with >5 FANCD2 foci were quantitated after exposure of cells to MMC. E. HEK293 cells stably expressing GFP-FAN1 were transiently transfected with pDEST40-lacZ ("-"), pDEST40-V5-FANCD2 wild -type (WT) or pDEST40-V5-FANCD2 K561 R. After 48 h, cells were lysed in the presence of DSP and anti-GFP precipitates were analysed by western blotting with the antibodies indicated. F. FANCD2 -/- (PD20) cells stably transfected with empty vector (-), FANCD2 wild-type (WT) or FANCD2 K561 R were transiently transfected with GFP-FAN1. Cells were treated with MMC for 18 h and then fixed and GFP-FAN1 foci were visualised. G. Same as F. except that cells were treated with MMC for the times indicated and the number of cells with >5 FA 1 foci were quantitated after exposure of cells to MMC. Data in C, D, G are represented as mean ± SEM.
See also Figure 11.
Figure 6 FAN1 is required for DNA repair A.HEK293 cells were transfected with the siRNAs indicated. Clonogenic survival assays were carried out with cisplatin or mitomycin-C (see Experimental Procedures). For each siRNA, cell viability of untreated cells is defined as 100%. B. Synchronized L1 larva stage animals of the relevant genotype were incubated with the indicated concentrations of nitrogen mustard (HN2) or cisplatin. After 48 h, the extent of developmental progression of the worms was scored, by counting the number of worms in the adult and various larval stages (L1-L2, L3-L4). Adult worms were scored as fertile if they contained fertilized eggs and as sterile if they did not. C. HEK293 cells transfected with control siRNA or FAN1 siRNA (FAN1-1) were treated with cisplatin (1 mg/ml) for 2 h and then allowed to recover for the times indicated. The proportion of cells in each population with more than two γ-Η2ΑΧ foci at each timepoint ("γ-Η2ΑΧ positive") was determined. The experiment was done three times and a representative experiment is shown. D. The frequency of chromosome breaks and radial chromosomes in metaphase spreads of HEK293 cells transfected with control siRNA or FAN1-1 siRNA was measured before and after exposure to MMC (10 ng/ml; 2 h) or to IR (3 Gy; 18h) was measured as described previously (Deans and West, 2009). Data in A, C are represented as mean ± SEM.
See also Figure 12. Figure 7 Effect of FAN1 depletion on focus formation by RAD51 and RPA
A. U20S cells, in which an 18 bp sequence recognized by l-Scel was placed between tandem mutant copies of the gene encoding GFP, were transfected with control siRNA (luciferase) and/or siRNAs specifically targeting FAN1 (FAN-1 or FAN-2) or RAD51. After 48 h, cells were transfected with a plasmid expressing l-Scel or with an empty vector, and 24 h later, cells were tested for GFP expression by FACS analysis. The frequency of HR in cells transfected with the various siRNAs was calculated relative to cells transfected with control siRNA. B. U20S cells transfected with control siRNA or FAN1 siRNA (FAN1-1) were treated with cisplatin (1 mg/ml) for 2 h and then allowed to recover for the times indicated. Cells were then fixed, permeabilised, washed and blocked before incubation with anti-RPA antibodies. Coverslips were incubated with secondary antibodies, mounted on glass slides and visualised. The average number of RPA foci per cell was analysed. The experiment was done three times and a representative experiment is shown. C. Same as B. except that cells were stained with anti-RAD51 antibodies. D. Same as C. except that cells were exposed to IR (3 Gy) and then allowed to recover for the times indicated. Data represented as mean ± SEM.
See also Figure 13. Fig. 8 Model for repair of inter-strand crosslinks (ICLs), Related to Introduction
It was proposed that ICL repair is initiated by the convergence of two replication forks on the ICL. Various signaling proteins including the Fanconi Anemia (FA) complex are recruited to the vicinity of the blocked replisome. This triggers the mono-ubiquitination of FANCD2 and its paralogue FANCI at Lys561 and Lys523 respectively, that in turn directs subsequent steps of ICL repair by unknown mechanisms. Cleavage of the leading strand template of one of the forks by MUS81 in concert with cleavage of the same strand on the opposite side of the ICL by a second nuclease would unhook the ICL. This results in two one-ended DSBs and a gapped duplex with the ICL adduct on one strand that is filled in by translesion synthesis. The ICL adduct is excised and resection of one of the DSBs generated by unhooking initiates homologous recombination that completes repair.
Fig. 9 Purification and assay of FAN1, Related to Figure 2
A. Coomassie gel of the different stages of the purification of recombinant human NUS- Hiss-FAN1 from bacterial cell extracts, as described in Supplemental Material. Samples from the indicated stages in NUS-HiSe-FANI purification were denatured and subjected to SDS-PAGE and Coomassie staining. B. Recombinant human FAN1 was incubated with synthetic DNA structures: splayed duplex (SD), 3' flap DNA (3'F), 5' flap (5'F) or a replication fork (RF)-like structure, each radiolabeled on the strands indicated. Note that f9 was 5' end-labelled while f10 was 3' end-labelled. WT refers to wild-type FAN1 and DR refers to the Asp981Ala-Arg982Ala FAN1 mutant. Reaction products were subjected to denaturing PAGE (12% polyacrylamide, 8 M urea). C. Schematic diagram of the DNA substrates used in B. (SEQ ID NOS: 51 and 52). Fig. 10 Exonuclease activity of FAN1 on recessed DNA ends, Related to Figure 3
Recombinant human FAN1 was incubated with dsDNA (oligos a3-cp and a3-l25) with a recessed end in which the shorter strand (a3-l25) on the 5' end (A) or 3' end (B). WT refers to wild-type FAN1 and DR refers to the Asp981Ala-Arg982Ala FAN1 mutant. Reaction products were subjected to denaturing PAGE (12% polyacrylamide, 8 M urea). Asterisks denotes the DNA end that was labelled.
Fig. 11 FAN1 forms subnuclear foci in response to genotoxins, Related to Figure 5
A. U20S cells were exposed to MMC (10 ng/ml) for 18h, or left untreated. Cells were fixed, permeabilised, washed and blocked before incubation with sheep anti-FAN1 antibodies generated as part of this study, or with anti-FANCD2 antibodies. After washing, coverslips were incubated with secondary antibodies, stained with DAPI, mounted on glass slides and visualised. B. U20S cells, grown on glass coverslips, were transiently transfected with pcDNA5.1-GFP-FAN1. Cells were treated, or not, with MMC and after 18h cells were fixed, permeabilised, washed and blocked before incubation with anti-GFP or anti-FANCD2 antibodies. Fig. 12 Effect of FAN1 depletion on cell sensitivity to genotoxins and on ubiquitination of FANCD2 and FANCI, Related to Figure 6
A. HEK293 cells were transfected with control siRNA (CON) or siRNA specifically targeting FAN1 (REND-1 or REND-2) or FANCA. After 48 h, cell extracts were subjected to western blotting with the indicated antibodies. B. HEK293 cells were seeded in 10 cm2 dishes at 25% confluence and allowed to adhere overnight. Cells were transfected with the relevant siRNA for 48 h and cells were split and seeded in 10 cm2 dishes (5000 cells/dish). Cells were allowed to adhere for 8 h and exposed to the indicated doses of IR or UV before being incubated at 37°C for 10-14 days. Alternatively, genotoxins were added at the concentrations indicated for 24 h: camptothecin, 6- thioguanine or hydroxyurea. Cells were then washed free of genotoxin and incubated in fresh medium for 0-14 days before the number of colonies of >50 cells in each dish were counted. For each siRNA, cell viability of untreated cells is defined as 100%. Data represented as mean ± SEM. C. HEK293 cells were transfected with the control (CON) siRNA or siRNAs targeting FAN1 or FANCA. After 48 h, cells were treated with cisplatin for the indicated times and lysed. Cell extracts were subjected to western blotting with antibodies against FANCD2 (left panels) or FANCI (right panels).
Fig. 13. Effect of FAN1 depletion on SCE, Related to Figure 7
SCEs were scored for 60 mitotic spreads for HEK293 cells transfected with the relevant siRNA (D2, FANCD2; F1 , FAN1-1) in the presence the indicated dose of MMC. Each point represents the total number of SCEs in a single mitotic spread.
Fig. 14 Models for action of FAN1 during ICL repair, Related to Discussion
A. It has been proposed that initiation of ICL repair requires the convergence of two replication forks at an ICL In this scenario, cleavage of the leading strand at one of the stalled forks (corresponding to a 3' flap-like structure) by MUS81-EME1 and cleavage of the same strand on the opposite side of the ICL (corresponding to a 5' flap-like structure) by an unknown nuclease would unhook the ICL. The unknown nuclease could be FAN1 but, as discussed in the text, the available data question this possibility. Unhooking results in two one-ended DSBs. Excision repair removes the crosslink adduct and translesion synthesis fills in the gap. The ends generated by unhooking are resected by a 5' exonuclease, generating 3' overhangs and one of these overhangs invades the complementary duplex. It is unlikely that FAN1 is involved in DSB resection because RPA and RAD51 foci form normally in cells depleted of FAN1. After strand extension, the invading strand re-anneals to the complementary strand in the duplex it came from originally. It is possible that continued DNA synthesis on the parent strand displaces the DNA in front of it. This would generate a 5' flap that could be cleaved by FAN1. B. It may be that MUS81 cleaves the leading strand template on both of the forks that converge on the ICL. This would generate two one-ended DSBs, and a gapped duplex containing the ICL that could be filled in by translesion synthesis. Unhooking and excision of the ICL from the linear duplex would generate a template for strand invasion. Repair is then completed by HR. In this context it is unlikely that FAN1 would be involved in unhooking since it would have to cleave a linear duplex containing an ICL, that does not resemble the 5' flap that FAN1 prefers. C. It is possible that it is not always necessary for two forks to converge on an ICL for ICL repair and fork regeneration to occur. In some cases repair may be initiated by collision of a single replisome with an ICL followed by MUS81- catalysed generation of a one-ended DSB. It is possible that the 5' endonuclease activity of FAN1 makes an incision in the D-loop created by strand invasion, allowing the resulting 5' end to be ligated to the invading strand that was extended. This would regenerate an intact replication fork from which DNA replication can continue. Fig. 15. GFP-FAN1 -associated proteins identified by mass spectrometry, Related to Figure 4
Gels slices in Fig. 4A were excised and proteins were identified by
mass spectrometric fingerprinting. Gel slices 9-16 came from the gel lane containing GFP-FAN1 precipitates from cells lysed in the presence of DSP (Fig. 4A). Gel slices 17- 24 came from the gel lane containing GFP-FAN1 precipitates from cells lysed in the presence of NEM (Fig. 4A). Only proteins that were also present in FLAG-FAN 1 precipitates (data not shown), and that were not present in GFP-only precipitates, are listed. Example 1 : KIAA1018/FAN1 (FAN1) is a flap endonuclease involved in DNA repair that is recruited to DNA damage by mono-ubiquitinated FANCD2
DNA inter-strand crosslinks (ICLs) are highly toxic because they block the progression of replisomes. The Fanconi Anemia (FA) proteins, encoded by genes that are mutated in FA, are important for repair of ICLs. The FA core complex catalyses the mono- ubiquitination of FANCD2 and this event is essential for several steps of ICL repair. However, how mono-ubiquitination of FANCD2 promotes ICL repair at the molecular level is unknown. Here we describe a novel and highly conserved protein, KIAA1018/MT R15/FAN1 , that interacts with, and is recruited to sites of DNA damage by, the mono-ubiquitinated form of FANCD2. FAN1 exhibits endonuclease activity towards 5' flaps and has 5'-exonuclease activity and these activities are mediated by an ancient VRR-nuc domain. Depletion of FAN1 from human cells causes hypersensitivity to ICLs, defects in ICL repair and genome instability. These data at least partly explain how ubiquitination of FANCD2 promotes DNA repair.
EXPERIMENTAL PROCEDURES
General Methods
Gel filtration and analysis of the resolution of cisplatin-induced DSBs were carried out as described previously (Munoz et al., 2009). DSP (dithiobis (succinimidyl propionate; Pierce) is a homobifunctional and thiol-cleavable crosslinker that was used according to the manufacturers instructions. DSP was included in lysis buffer at 2.5 mg/ml and lysates were incubated for 30 min on ice. Excess DSP was quenched by adding 75 μΙ 1 M Tris- HCI (pH 7.4) followed by an additional 30 min incubation. Crosslinks were reversed by the inclusion of dithiothreitol in SDS-PAGE sample buffer added to cell extracts or immunoprecipitates before electrophoresis. Details of immunofluorescence are given in Supplementary Information.
Antibodies, cell lysis and immunoprecipiation
The primary antibodies used in this study were the following: FAN1 (this study; sheep S420C, 4th bleed), MLH1 (BD Pharminigen, 554073), PMS2 (Santa Cruz, sc-617), PCNA (Santa Cruz, PC10), FANCI (Bethyl, A301-354), FANCD2 (Abeam, ab2187-50), FANCD2 (Novus, NB100-182; immunofluorescence), FANCA (Cascade Biosciences, abm6202), FANCC (Cascade Biosciences, abp6305), FANCE (a kind gift from KJ Patel), FANCF, FANCG (kind gifts from Johan De Winter), FLAG (Sigma, M2), Ku80 (Cell Signaling, 2753), RAD51 (Santa Cruz, H-92), RPA70 (Cell Signaling, 2267) and anti-y-H2AX (Bethyl, A300-081A). The FAN1 antibody, raised in sheep against full-length FAN1 fused to GST, at the Scottish Antibody Production Unit (SAPU; Carluke, Lanarkshire) was affinity purified using immobilised antigen. GFP-Trap beads were from Chromotek. Protein G Sepharose was from GE Healthcare. Cells were lysed in ice-cold buffer: [40 mM HEPES (pH 7.4), 120 mM NaCI, 1% (v/v) Triton X-100, 1 mM EDTA] with protease inhibitors (Roche). To visualize mono-ubiquitinated forms of FANCI and FANCD2, 0.5 U/ml of benzonase (Sigma) was included in the lysis buffer and lysates were incubated on ice for 30 min. All immunoprecipitations were carried out in lysis buffer for 1 h at 4°C. Endogenous immunoprecipitations were carried out using 2 μg of FAN1 antibody coupled to 10 μΙ protein G sepharose per 4 mg of whole cell extract.
Purification of GFP-FAN1 from HEK293 cells
Flpln T-Rex cells (Invitrogen) cells stably expressing GFP-FAN1 in a tetracycline- inducible manner were made according to the manufacturers instructions with FAN1 in plasmid pcDNA5-FRT-TO-GFP-FAN1. FAN1 was induced and purified according to a previously-described protocol (Munoz et al., 2009). siRNA
Cells were transfected with the relevant siRNA duplex (100 nM) using the calcium phosphate precipitation method. In Fig. 7 U20S cells were transfected in 96-well plates using siRNAs at a concentration of 20 nM and DharmaFECT 1 (Dharmacon) at a 1 :1000 concentration. Cells were incubated at 37°C for 48 h. The mRNA target sequences used for siRNAs were:
FANCA (GGGUCAAGAGGGAAAAAUA) (SEQ ID NO: 7), FAN1-1 (GUAAGGCUCUUUCAACGUA; exon 3) (SEQ ID NO: 8), FAN1-2 (GCAGGAAGGCAGAGUGGCU; exon 12) (SEQ ID NO: 9), MLH1 (GCAUGUGGCUCAUGUUAC) (SEQ ID NO: 10), ATR (GGGAGCCUGUUGAGACAAGAU) (SEQ ID NO: 11), FANCD2 (siGenome SMARTPool from Dharmacon).
Oligonucleotides
a3: 5'-CCTCGATCCTACCAACCAGATGACGCGCTGCTACGTGCTACCGGAA
GTCG (SEQ ID NO: 12)
b: 5'-CGACTTCCGGTAGCACGTAGCAGCGGCTCGCCACGAACTGCACTCTA
GGC (SEQ ID NO: 13)
c: 5 -GCCTAGAGTGCAGTTCGTGGCGAGC (SEQ ID NO: 14)
d3: 5'-CGTCATCTGGTTGGTAGGATCGAGG (SEQ ID NO: 15)
a3-cp: 5'-CGACTTCCGGTAGCACGTAGCAGCGCGTCAACTGGTTGGT
AGGATCGAGG (SEQ ID NO: 16)
Preparation of DNA substrates
All substrates and standards were annealed by slow cooling of one radioactively 5'-32P- labelled oligonucleotide with the relevant unlabelled one(s). In Fig. 2 these were: splayed duplex (SD), a3, b; 3' flap (3'F) a3, b, d3; 5' flap (5'F) a3, b, c; replication fork analogue (RF), a3, b, c and d3. In Fig. 3 these were a3 and a3-cp (dsDNA), §3 (ssDNA). Synthetic structures were then purified by electrophoresis on a native 8% polyacrylamide gel and recovered by the crush and soak method followed by ethanol precipitation.
Nuclease assays
Purified recombinant FAN1 (35nM) was pre-incubated for at least 10m'in with radiolabeled DNA substrates (5nM) at 37°C in 25 mM Tris-HCI pH 7.5, 10 mM NaCI,15 mM KCI and 0.1 mg/ml BSA to allow binding to occur. The reaction was started by the addition of 1 mM MnCI2 and stopped by the addition of 2 mM EDTA. The samples were then boiled at 95°C for 10 min and analysed by denaturing PAGE (15% polyacrylamide and 8M urea). Gels were dried, exposed to storage Phosphor screens and analysed with the ImageGauge software (Fujifilm). For kinetics experiments, the data were plotted as the fraction of DNA in the relevant product bands as a function of time, and fitted to either one or two exponential functions. When two exponential functions were used, the rate given is the faster of the two.
Clonogenic survival assays
HEK293 cells were seeded in 10 cm2 dishes at 25% confluence and allowed to adhere overnight. Cells were transfected with the relevant siRNA for 48 h and cells were split and seeded in 10 cm2 dishes (5000 cells/dish). Cells were allowed to adhere for a minimum of 8 h before cisplatin or mitomycin-C were added at the indicated concentrations for 24 h. Cells were then washed free of drugs and incubated in fresh medium for 10-14 days before the number of colonies of >50 cells in each dish were counted. C. elegans genotoxin sensitivity assays
Worms were maintained at 20°C on NGM (Nematode Growth Media) agar plates according to standard protocols (Brenner, 1974). Alleles used were: fcd-2 (tm1298) and C01G5.8 (tm423). The C01G5.8 mutant was generated and kindly provided by Shoehi Mitani of the National Bioresource Project for the Nematode, Japan. This strain, which has a 411 bp deletion in C01G5.8 that removes exons 6-8, was outcrossed five times with N2 Bristol strain (wild-type) to eliminate secondary mutations. To access ICL sensitivity, synchronized L1 larval stage animals of the relevant genotype were incubated at 20°C for 16 h in 1 ml S-basal buffer (0.1m NaCI, 0.05M KH2P04, pH 6.0, 5 mg/ml cholesterol) containing E. coli OP50 and the indicated concentration of nitrogen mustard (HN2) or cisplatin. After incubation worms were transferred to OP50-seeded NGM plates. After 48 h, the extent of developmental progression was scored. In each experiment, a minimum of 60 worms was scored and the results shown are the average of three independent experiments.
GFP HR assay
Cells were transfected with siRNA in 96-well dishes and after 48 h cells, were transfected with 0.25 mg l-Sce-l vector and 0.2 mg PEI in 150 ml OptiMEM/well. GFP-positive cells were analyzed using FACS 48 h after l-Sce-l transfection as previously described (Pierce et al. 1999). Expression and purification of recombinant FAN1
pET43.1a(+) expressing NUS-His6-FAN1 or NUS-His6-FAN1 D981A R982A was transformed into BL21 bacterial cells. FAN1 expression was induced by the addition of IPTG (50 μΜ) to 0.5 L of bacteria in early exponential phase in liquid culture followed by overnight incubation at 18°C. Cells were then heat shocked at 42°C for five minutes before centrifugation (4000 g, 20 mins, 4°C) and the pellet was snap frozen and thawed. Bacterial pellets were lysed in lysis buffer (25 mM HEPES pH 7.6, 10% glycerol (v/v), 0.1 mM EDTA, 150 mM KCI, 1 mM DTT, 1 mM PMSF, protease inhibitors (Roche)). Lysates were incubated on ice at 4 °C for 30 min before centrifugation (18,000 rpm, 20 mins, 4°C). The supernatant was then subjected to ultracentrifugation (37,500 rpm, 1 h, 4°C) before being loaded onto a DEAE column (Amersham) that was developed with a linear gradient of KCI in buffer A (25 mM HEPES pH 7.6, 10% glycerol (v/v), 0.1 mM EDTA, 1 mM DTT, ddH20) using an FPLC LCC-50 (Pharmacia biotech). The flow rate was 2 ml/min and 3 ml fractions were collected. Samples from every fourth fraction were denatured and subjected to SDS-PAGE followed by Coomassie blue staining. Fractions containing FAN1 were combined and diluted 1:1 in buffer A and loaded onto an SP column (Amersham) that was developed with a linear gradient of KCI in buffer A. The flow rate was 0.5 ml/min and 0.25 ml fractions were collected. Samples from every third fraction were denatured and subjected to SDS-PAGE followed by Coomassie blue staining. Fractions containing FAN1 were diluted 1 :1 in buffer A and loaded onto a Heparin column (Amersham) that was developed with a linear gradient of KCI in buffer A. The flow rate was 0.5 ml/min and 0.25 ml fractions were collected. Samples from every second fraction were subjected to SDS-PAGE and FAN1 containing fractions were combined. Protein concentration was estimated by subjecting FAN1 to SDS-PAGE and Coomassie blue staining in parallel with known amounts of BSA.
Oligonucleotides use in Figs. 9 and 10 f7: 5'-ATTGACTAGGTTACATGACTGAATGATAGT (SEQ ID NO: 17)
f8: 5'-GGAGTAAAGTACTAGGTATGTCGACATTGA (SEQ ID NO: 18)
f9: 5'-ACTATCATTCAGTCATGTAACCTAGTCAATCTGCGAGCTCGAATTCAC TGGAGTGACCT (SEQ ID NO: 19)
f10: 5'-GAGGTCACTCCAGTGAATTCGAGCTCGCAGTCAATGTCGACATAC CTAGTACTTTACTCC (SEQ ID NO: 20)
a3-cp: 5'-CGACTTCCGGTAGCACGTAGCAGCGCGTCAACTGGTTGGTAGG
ATCGAGG (SEQ ID NO: 21)
a3-l25: 5'- CGCTGCTACGTGCTACCGGAAGTCG (SEQ ID NO: 22)
DNA substrates were prepared with the following oligos. Fig. 9:- splayed duplex (SD), f9, f10; 3' flap (3'F) f7, f9, f10; 5' flap (5'F) f8, f9, f10; replication fork analogue (RF), f7, f8, f9, f10. Fig. 10:- a3-l25 and a3-cp (recessed 5' ends). Sister chromatid exchange assay
Cells were cultured in 5 pg/ml BrdU for 40 h followed by 1 h in 0.1 pg/ml colcemid. MMC was added 20 h prior to cell harvest where indicated. Exchanges that were obviously due to "flipping" at the centrosome were omitted from quantitation. SCEs were scoring on 60 metaphases for each genotype/treatment. All quantification was carried out blind.
Immunofluorescence - RAD51 and RPA
U20S cells transfected with the relevant siRNA were treated with cisplatin (1 mg/ml) for 2 h or irradiated with 3 Gy and then allowed to recover for times indicated before fixation with 4% paraformaldehyde in PBS-Triton-X 00 (0.1%). After three PBS washes and blocking in 3% BSA in PBS, cells were incubated with primary antibody overnight. Another three PBS washes were followed by a 1 h incubation with secondary antibody at room temperature. DNA was stained with DAPI at 1 pg/ml and images acquired using an IN Cell Analyzer 1000 (GE Healthcare). Images were analyzed with IN Cell Analyzer 1000 Workstation software using the Multi Target Analysis module (GE Healthcare).
Immunofluorescence - GFP-FAN1, FANCD2 and g-H2AX
HEK293 or U20S cells transfected with the relevant siRNA were mock-treated, treated with 80 ng/ml MMC or 0.5 mM HU and fixed 18 h later or treated with 5 Gy IR and fixed 1 h later with 2% PFA for 10 min at room temperature. Cells were then permeabilised with 0.2% Triton X- 00 in PBS for 10 min at room temperature. For indirect immunofiouresence analysis of FANCD2, g-H2AX or endogenous FAN1 cells were washed several times in PBS and incubated in blocking solution (PBS containing 3% IgG -free BSA (Jackson Immunoresearch) and 0.2% Tween 20) for 1 h. Coverslips were then incubated with primary antibodies (1 mg/ml) in blocking solution for 1 h. After extensive washing in PBS-T (PBS containing 0.2% Tween20), coverslips were incubated with secondary antibodies (2 mg/ml) conjugated to Texas Red for 45 min. Coverslips were washed thoroughly in PBS -T and mounted on glass slides. Before covering with a cover slip cells were stained with DAPI-Hydromount for 5 min. Slides were viewed using a Deltavision DV3 widefield deconvolution microscope mounted on a Nikon Diaphot inverted microscope and images were deconvolved after acquisition. For GFP tagged proteins, the protocol is the same except that no blocking or antibody incubation takes place.
Results
Domain organisation of KIAA1018/MTMR15/FAN1
We noticed an uncharacterised human protein, KIAA1018/MTMR15, in the human sequence databases, that has a UBZ-type ubiquitin— binding domain domain, a SAP- type DNA binding domain and a putative nuclease domain termed "VRR_nuc" domain (Fig. 1A), initially referred to as "domain of unknown function 994" (DUF994) (Iyer et al., 2006). Orthologues of KIAA1018 are found in prokaryotes and most eukaryotes with the notable exception of budding yeast (Fig. 1A).
We suspected that KIAA1018 is involved in DNA damage responses for a number of reasons. KIAA1018 is the only VRR-nuc domain-containing protein in eukaryotes but many bacteria and bacteriophages have genes that encode solely VRR_nuc domains. Although the functions of these genes are unknown, most of them are located in operons that include known DNA repair enzymes, hence the name VRRjiuc (virus-type replication-repair nuclease) (Iyer et al., 2006). The VRR_nuc domains contain a PD- (D/E)XK motif found in the active site of many restriction nucleases (Kosinski et al., 2005) (Fig. 1B). We thus suspected that KIAA1018 might act as a repair endonuclease. A putative role for KIAA1018 in DNA repair is also implied by the presence of a UBZ4- type ubiquitin-binding domain that belongs to the RAD18 family of zinc fingers, a domain commonly found in DNA damage response proteins such as DNA polymerase k, RAD18 and WRNIP (Fig. 1C) (Hofmann, 2009). Furthermore, KIAA1018 was also found to interact with the MLH1 DNA mismatch repair protein in a genome wide screen (Cannavo et al., 2007). We therefore decided to test if KIAA1018, which we refer to hereafter as FAN1 for reasons that will become clear later, has nuclease activity and if it is involved in DNA repair. FAN1 has endonuclease activity that is specific for branch points
To test for nuclease activity, we purified recombinant FAN1 , fused to an N-terminal NUS-His6 tag, in bacteria and purified it through three steps of ion exchange chromatography (Fig. 9A). In parallel we purified a mutant version of FAN1 where the conserved Asp981 and Arg982 residues (indicated by asterixes in Fig. 1B) found in the VRR_nuc domain were mutated to alanine ("DR" mutant). We next tested the ability of FAN1 to cleave a range of branched DNA substrates that resemble DNA repair and replication intermediates. These included a splayed duplex, a 3' flap, a 5' flap and a nicked three-way junction that mimics a DNA replication fork (Fig. 2A). All substrates were 32P-labelled at the 5' end of the a3 strand or the b strand as indicated in Fig. 2A. After incubation with wild-type or mutant FAN1 , reaction products were separated by gel electrophoresis under denaturing conditions.
As shown in Fig. 2B, FAN1 displayed strong endonuclease activity towards the 5' flap structure and weaker activity towards the replication fork model. Cleavage affected only one strand of these structures and occurred in the double-stranded (ds) region on the same strand as the flap, 4 nucleotides (nt) 3' to the branchpoint (Fig. 2A). Selectivity of FAN1 for these DNA structures, as opposed to specificity for DNA sequence, was confirmed by analysing the cleavage of an analagous set of branched DNA structures composed of strands with alternative sequence (Fig. 2B,C). The endonuclease activity of the FAN1 DR mutant was severely reduced compared with wild-type protein (Fig. 2B; Fig. 9B) resulting in cleavage rates approximately 1000-fold lower than for wild-type protein (Fig. 2C.D). FAN1 did not exhibit endonuclease activity towards four-way junctions (data not shown).
FAN1 has 5' exonuclease activity
Incubation of wild-type FAN1 with 5'-32P-labelled branched substrates also produced a short 4 nt radioactive fragment (Fig. 2B,C), suggesting that FAN1 might possess an additional endo- or exonuclease activity. To further investigate this, FAN1 was incubated with linear double-stranded (ds) or single-stranded (ss) DNA in which one of the oligonucleotides was radioactively 5'- or 3'-32P-labelled. We observed a clear 5' to 3' exonuclease activity which initiates 4 nt from the 5' end and cleaves every phosphate bond thereafter but with varying intensity (Fig. 3A). The exonuclease activity of FAN1 towards ssDNA required that the 5' end be phosphorylated (Fig. 3A). FA 1 exhibited potent 5' exonuclease activity towards DNA substrates with a recessed 5' end indicating that a blunt dsDNA end is not required for exonuclease activity (Fig. 10). The exonuclease activity of FA 1 was severely reduced by mutation of Asp981 and Arg982 in the VRR_nuc domain (Fig. 3A,B). Quantitation of these data showed that the rate of initiation of the exonuclease activity of FAN1 towards dsDNA (0.09 s'1; Fig. 3B) was approximately half that of the endonuclease towards a 5' flap (>0.2 s'1; Fig. 2D). The calculated rates of initiation using wild type enzyme (Fig. 3B) were 0.09 s'1 for ds DNA (5'-32P), 0.002 s'1 for ds DNA (3'-32P), 0.0005 s"1 for ss DNA (5'-32P) and too low to measure for ss DNA (3'-32P). The rate of cleavage of dsDNA (5'-32P) using the DR mutant was 0.0003 s"1, around 300-fold lower than wild-type FAN1 (Fig. 3B).
These results raised the possibility that the endonuclease activity of FA 1 on branched substrates might be coupled with a 5 -3' exonuclease activity. We therefore examined FAN1-mediated cleavage of a 5' flap in which the a3 strand containing the flap was radioactively labelled at the 3' end (Fig. 3C). This experiment clearly revealed that the endonucleolytic incision described above (Fig. 2B,C) was followed by a 5'-3' exonuclease activity that with time generated ever-shorter products (Fig. 3C). Cleavage was observed at each phosphate bond but with varying intensity. Taken together these data show that FAN1 has a 5' to 3' exonuclease activity which initiates 4 nt from the 5' end on single- and double-stranded DNA, and 4 nt from the branchpoint on 5' flaps and nicked three-way junctions. Rate measurements suggest that FAN1 has a structural selectivity for helical branchpoints.
FAN1 interacts with FANCD2 and FANCI
In an attempt to link the nuclease activity of FAN1 towards branched DNA structures with known DNA repair pathways, we aimed to find FAN1-interacting proteins. Plasmids expressing GFP-FAN1 or GFP alone, both under the control of a tetracycline-inducible promoter, were stably integrated in HEK293 cells. Cells were lysed after induction either in the presence of the reversible protein crosslinker dithiobis (succinimidyl propionate) (DSP) or the de-ubiquitinase inhibitor N-ethyl maleimide (NEM). Extracts were subjected to immunoprecipitation with GFP-Trap beads and protein-protein crosslinking was reversed with dithiothreitol. After SDS-PAGE, strong bands at the expected molecular weights of GFP-FAN1 and GFP were observed in the respective lanes (Fig. 4A). In addition, a range of other proteins was found in GFP-FAN1 but not GFP precipitates. Mass fingerprinting revealed that most of these proteins are involved in DNA repair. Both components of the MLH1-PMS2 complex involved in mismatch repair were found in GFP-FAN1 precipitates when cells were lysed in NEM or DSP (Fig. 15) (Cannavo et al., 2007). We also found FANCD2 and FANCI, but only when DSP was included in the lysis buffer. The presence of ubiquitin in the FANCD2-containing band indicated that the ubiquitinated form of FANCD2 might co-precipitate with FAN1 (Fig. 15). The specificity of the FAN1 protein interactions was independently confirmed by analysing the immunoprecipitates of FLAG-FAN 1 under similar conditions (data not shown) and only the proteins identified in both experiments are shown in Fig. 15. FAN1 interactors were confirmed by a number of experiments. Firstly, western blotting detected MLH1 , FANCD2 and FANCI in GFP-FAN1 but not GFP precipitates (Fig. 4B). FANCD2 and FANCI were only found in GFP-FAN1 precipitates when DSP was present in the lysis buffer. To examine endogenous complexes, antibodies were raised in sheep against human FAN1. These antibodies recognised a protein of the expected molecular mass (114 kDa) in extracts of HEK293 cells that was not detected when cells were transfected with FAN1-specific small interfering (si) RNA duplexes (Fig. 12A). These antibodies were used to immunoprecipitate FAN1 from HEK293 cell extracts. Endogenous MLH1 , FANCD2 and FANCI were detected in anti-FAN1 immunoprecipitates (Fig. 4C) but not in precipitates using an antibody against an unrelated epitope (HA). Again, FANCD2 and FANCI were only found in GFP-FAN1 precipitates when DSP was present in the lysis buffer. These interactions were not affected by ethidium bromide or by treatment of immunoprecipitates with DNase I or benzonase (data not shown), excluding the possibility that these interactions are DNA- dependent. Abundant DNA repair proteins such as ERCC1 or PCNA, and other FA proteins such as FANCA were not detected in anti-FAN1 immunoprecipitates (Figs. 4B.C).
Size exclusion chromatography of HEK293 cell extracts showed that FAN1 elutes in two sub-complexes; one of these overlaps with MLH1 and elutes slower than the 670 kDa marker, while the other sub-complex elutes faster than the 670 kDa marker and overlaps with FANCD2 and FANCI (Fig. 4D). It is interesting that FAN1 in the latter sub-complex migrates more slowly on SDS-PAGE than the form of FAN1 that co-elutes with MLH1 , and this may represent a post-translationally-modified form of FAN1. Taken together these data show that FAN1 binds to MLH1 , FANCD2 and FANCI. The acronym FAN1 stands for "FANCD2/FANCI-associated nuclease 1 ".
The UBZ domain of FAN1 interacts with FANCD2
FAN1 has a UBZ domain of the RAD18 type that is found in DNA repair proteins such as WRNIP, POL k and RAD18 (Fig. 1C). The POL k UBZ domain binds to mono- ubiquitinated PCNA (Bienko et al., 2005), but we could not detect PCNA in FAN1 precipitates (Fig. 4C). We hypothesised that instead, the UBZ domain of FAN1 binds to the mono-ubiquitinated form of FANCD2 since we detected FANCD2 in FAN1 precipitates. To test this, the two conserved cysteine residues in the first dyad of the FAN1 UBZ domain (Cys44 and Cys47, indicated by asterixes in Fig. 1C) were both mutated to alanine residues (UBZ* mutant). Whereas wild-type GFP-FAN1 transiently expressed in cells co-immunoprecipitated with endogenous FANCD2 and FANCI, the FAN1 UBZ* mutant did not, even though this mutant retained the ability to bind MLH1 (Fig. 5A).
FANCD2 forms subnuclear "foci" at sites of DNA damage in cells after DNA damage.
Endogenous FAN1 formed foci that colocalised with FANCD2 in response to MMC (Fig. 11A). GFP-FAN1 transiently transfected into HEK293 cells also formed subnuclear foci in MMC-treated cells, and these colocalised with FANCD2 (Fig. 5B). The GFP-FAN1
UBZ* mutant, however, did not form subnuclear foci in MMC-treated cells (Figs. 5B, C).
Depletion of FAN1 from cells had no detectable effect on MMC-induced FANCD2 focus formation (Fig. 5D). GFP-FAN1 formed foci not just in response to MMC but also in response to HU or IR (Fig. 11 B). These data show that co-localization of FAN1 at sites of DNA damage with FANCD2 requires the FAN1 UBZ domain.
FAN1 is recruited to DNA damage by mono-ubiquitinated FANCD2 :
We next tested the possibility that the mono-ubiquitinated form of FANCD2 interacts with FAN1. Although wild-type FANCD2 transiently transfected into cells stably expressing GFP-FAN1 was detected in GFP-FAN1 precipitates, the FANCD2 K561 R mutant that cannot be ubiquitinated was not (Fig. 5E). These data indicate that FAN1 interacts with the mono-ubiquitinated form of FANCD2. To test the possibility that the mono- ubiquitination of FANCD2 might be required to recruit FAN1 to foci, we studied FANCD2 -/- (PD20) human cells stably transfected with wild-type FANCD2 or with a FANCD2 K561 R mutant (Garcia-Higuera et al., 2001). We found that GFP-FAN1 did not form MMC-induced foci in FANCD2 -/- cells, but formation of foci was restored when these cells stably express wild-type FANCD2 (Fig. 5F,G). Only background levels of GFP- FAN1 foci occurred when the FANCD2 K561 R mutant was expressed in these cells, at all timepoints examined (Fig. 5F,G).
FAN1 is required for cellular resistance to agents that induce ICLs
Mono-ubiquitination of FANCD2 is required for ICL repair but the underlying mechanism is unclear. We hypothesized that the association of FAN1 , a nuclease with specificity for branched structures, with the mono-ubiquitinated form of FANCD2 may provide an explanation. Defective ICL repair causes hypersensitivity to agents that induce ICLs. Depletion of FAN1 with two siRNAs targeting different FAN1 exons (Fig. 12A) caused cells to become hypersensitive to cisplatin and MMC compared with control siRNA (Fig. 6A). The hypersensitivity to ICL-inducing agents associated with depletion of FAN1 was similar to that observed when FANCA was depleted (Fig. 6A). Cells depleted of FAN1 did not show hypersensitivity to DNA damaging agents such as campthothecin, hydroxyurea, UV light, or ionizing radiation (Fig. 12B). In contrast, depletion of the ATR kinase caused hypersensitivity to all of these agents (Fig. 12B). Cells defective in mismatch repair are resistant to killing by 6-thioguanine (6-TG) (Swann et al., 1996), and consistent with this, depletion of MLH1 from HEK293 cells caused cells to become more resistant to 6-TG (Fig. 12B). However, depletion of FAN1 did not, so it is unlikely that FAN1 is involved in mismatch repair.
We also tested a Caenorhabditis elegans strain harbouring a deletion in the C. elegans orthologue of FAN1 (Figs. 1A, B), encoded by the C01G5.8 locus, for sensitivity to ICL- inducing agents. This deletion does not lead to any overt developmental defects (data not shown). L1-stage worm larvae were exposed to ICL-inducing agents and the effects on the progression to subsequent larval stages L2, L3, L4 and to adult stages were observed. As shown in Fig. 6B worms defective in Ce-fan-1 were hypersensitive to nitrogen mustard (HN2) and cisplatin, even more so than a deletion of the C. elegans fcd-2 Fancd-2 orthologue. These data were confirmed by depleting Ce-fan-1 by RNA interference (data not shown). Furthermore, the Ce-rend-1 {tm423) deletion resulted in reduced progeny survival when L4 stage animals were exposed to nitrogen mustard (data not shown). Thus the ICL hypersensitivity associated with defects in FAN1 is evolutionarily conserved. FAN1 is required for efficient repair of ICL-induced DNA breaks
We next sought to determine at what stage of ICL repair FAN1 acts. ICLs cause mono- ubiquitination of FANCD2 and FANCI that promotes ICL repair. Mono-ubiquitination of FANCD2 and FANCI causes reduced electrophoretic mobility (Garcia-Higuera et al., 2001). Exposure of HEK293 cells transfected with control siRNA to cisplatin or MMC resulted in damage-induced mono-ubiquitination of FANCD2 and FANCI (Fig. 12C). Consistent with previous reports, depletion of FANCA abolished FANCD2 and FANCI mono-ubiquitination. However, depletion of FAN1 has no detectable effect (Fig. 12C). Therefore FAN1 is not required for mono-ubiquitination of FANCD2 or FANCI. Exposure of cells to ICL-inducing agents causes DSBs, judged by g-H2AX foci or pulsed field gels. These DSBs, formed as a result of replication fork cleavage by MUS81 during ICL unhooking (Hanada et al., 2007; Hanada et al., 2006) (Fig. 8), initiate the HR step of ICL repair. We next tested whether depletion of FAN1 from cells affected the induction of, or disappearance of g-H2AX foci induced by ICLs. HEK293 cells were transfected with control siRNA or FAN1 siRNA and were either left untreated or exposed to cisplatin for 2 h. Cells were washed free of cisplatin and incubated in fresh medium, and g-H2AX foci were counted at various times during recovery. Around 80% of cells transfected with control siRNA had between 2 and 40 foci 24 h after transient exposure to cisplatin; cells with more than two γ-Η2ΑΧ foci were scored as "γ-Η2ΑΧ positive". Although the percentage of control siRNA-transfected cells that were γ-Η2ΑΧ positive declined to almost basal levels by 48 h (Fig. 6C), almost no decrease in the percentage of y-H2AX-positive cells depleted of FAN1 was observed at this time (Fig. 6C). By 96 h, over 50% of cells depleted of FAN1 were still γ-Η2ΑΧ positive although γ-Η2ΑΧ foci had returned to basal levels in cells treated with control siRNA (Fig. 6C). These data show that depletion of FAN1 does not affect DSB induction at replisomes blocked by ICLs but instead causes a defect in DNA repair. Consistent with the persistence of cisplatin— induced g-H2AX foci, we observed an increase in chromosomal abnormalities in metaphase spreads of FAN1-depleted cells exposed to MMC. FAN1-depleted cells showed a substantial increase in the frequency of cells with more than one chromosome break or radial chromosome, similar to cells depleted of FANCD2 (Fig. 6D). These data i are consistent with FAN1 acting in the FA pathway.
FAN1 is required for efficient HR but not for DSB resection or RAD51 loading
Human cells solely expressing FANCD2 K561 R show reduced HR efficiency (Nakanishi et al., 2005). It is possible that defect in the resolution of ICL-induced DSBs in FAN1- depleted cells could reflect a defect in HR. We used a reporter system in U20S cells to measure HR frequency. In this system, an 18 bp sequence recognized by the l-Scel meganuclease is placed between tandem mutant copies of GFP (Nakanishi et al., 2005). HR between these two copies generates a wild-type GFP open reading frame, and functional GFP expression can be detected by FACS analysis. As shown in Fig. 7A, depletion of FAN1 with two separate siRNAs reduced the efficiency of l-Scel-induced HR by 50-60%, similar to the reduction reported for depletion of FA proteins (Nakanishi et al., 2005; Smogorzewska et al., 2007). These data indicate that FAN1 promotes HR in response to DSBs. Depletion of FAN1 - or FANCD2 - from HE 293 cells did not appear to affect the frequency of MMC-induced sister chromatid exchanges (Fig. 13). We postulated that the exonuclease activity of FAN1 could affect HR by controlling the resection of DSBs generated during ICL repair. Resection of DSBs leads to the generation of ssDNA, and the coating of ssDNA by RPA leads to RPA foci. We analysed RPA foci after exposure of cells to a pulse of cisplatin to assess DSB resection and found that depletion of FAN1 did not prevent cisplatin-induced RPA focus formation. In fact, depletion of FAN1 caused a slight increase in the average number of RPA foci per cell and in the average number of cells with >9 RPA foci (Fig. 7B). This suggests that FAN1 is not required for resection of DSBs. RPA foci gradually disappeared during the recovery of cells treated with control siRNA or FAN1 siRNA from cisplatin (Fig. 7B).
DSB resection is followed by formation of the RAD51 nucleoprotein filament on the resected DSB so we examined formation of RAD51 foci at various times during recovery of cells from cisplatin. After 24 h recovery, cells depleted of FAN1 showed an approximately 2.5-fold increase in the number of cells with RAD51 foci, and a similar increase in the number of RAD51 foci per cell, compared with control siRNA (Fig. 7C). At subsequent times during recovery, FAN1-depleted cells continued to have around twice as many RAD51 foci as control cells and these data are consistent with a defect in HR. We also tested the effects of depleting FAN1 on RAD51 loading after IR. Four hours after exposure to IR, the number of cells with greater than nine RAD51 foci, and the average number of RAD51 foci per cell, was similar in FAN 1 -depleted and cells treated with control siRNA (Fig. 7D). However, whereas RAD51 foci declined to basal levels by 12- 24 h post-IR in control cells, FAN1-depleted cells showed a delay in the disappearance of RAD51 foci. These data suggest that FAN1 depletion leads to failure of a late stage of HR.
Discussion
It has been known for almost a decade that mono-ubiquitination of FANCD2 is required for ICL repair (Garcia-Higuera et al., 2001). However, the molecular role of this ubiquitination event has remained elusive. Here we report that the FAN1 nuclease is recruited to sites of DNA damage by mono-ubiquitinated FANCD2 and thus might act as an effector molecule carrying out one or more nucleolytic steps required for ICL repair. The phenotypic consequences of depleting FAN1 from human cells - sensitivity to ICL- inducing agents, chromosome instability in MMC-treated cells and defects in HR - are consistent with a role in ICL repair and are similar to those seen in cells solely expressing FANCD2 K561 R (Moldovan and D'andrea, 2009). These findings might at least in part explain how ubiquitination of FANCD2 promotes ICL repair. According to our data, FAN1 is recruited to sites of ICLs by mono-ubiquitinated FANCD2. This is supported by the requirement of the FAN1 UBZ domain (Fig. 5B) and the mono- ubiquitinated form of FANCD2 (Fig. 5F) for FAN1 localization. Furthermore, FAN1 and FANCD2 proteins co-precipitate in a manner that depends on FANCD2 K561 and on the FAN1 UBZ domain. Both ubiquitinated and non-ubiquitinated FANCD2 were detected in FAN1 immunoprecipitates even though when FANCD2 K561 is mutated, no FANCD2 is detected in FAN1 immunoprecipitates. This discrepancy may be explained by de-ubiquitination of a proportion of FANCD2 after cell lysis or by the association of modified FANCD2 with the unmodified form of the protein. Even though DNA damage stimulates FANCD2 ubiquitination, FAN1 interacts with FANCD2 even without exposure of cells to genotoxins. This is probably a reflection of basal FANCD2 mono-ubiquitination that occurs in the absence of DNA damage in S-phase cells (Taniguchi et al., 2002).
Building upon existing models for ICL repair, and what is already known about the role of FANCD2 mono-ubiquitination in this pathway, it is possible to speculate on where on the ICL repair pathway FAN1 might act. Experiments on the replication of plasmids bearing single ICLs in Xenopus egg extracts showed that FANCD2 mono-ubiquitination is required for ICL unhooking (Knipscheer et al., 2009) which suggests that FAN1 might act at this point. In this system it was proposed that initiation of ICL repair requires the convergence of two replication forks at an ICL (Knipscheer et al., 2009). Consequently an ICL would be located at the intersection of an X-structure shown in Fig. 14A. In this scenario cleavage of the leading strand template of one of the forks by MUS81 in concert with cleavage of the same strand on the opposite side of the ICL (which resembles a 5' flap) by a second nuclease would unhook the ICL (Fig. 14A). This nuclease could be FAN1 based on our in vitro data showing that this nuclease preferentially cleaves the double-stranded portion of a synthetic 5' flap structure (Fig. 2A). However, there are conceptual problems with FAN1 acting at this point of the ICL repair pathway. Firstly, this hypothesis predicts that MUS81 and FAN1 are each responsible for 50% of the one- ended DSBs in cells treated with ICL-inducing agents. Assuming that g-H2AX foci are representative of DSBs, this is not what we observe - depletion of FAN1 does not affect formation of cisplatin-induced DSBs (Fig. 6C) whereas deletion of MUS81 abolished all ICL-induced DSB (Hanada et al., 2006). Secondly, this hypothesis requires that MUS81 acts on the leading strand template of one of the two stalled replication forks (Fig. 14A) but it is difficult to see why MUS81 would not cleave the leading strand template of both forks (Fig. 14B). Cleavage of both forks by MUS81 would result in two one-ended DSBs and a linear duplex containing the ICL, and it is unlikely that unhooking of the ICL from this linear duplex would require FAN1. Thirdly, it is not yet clear if the two-fork model for ICL repair is relevant in vivo, and it is possible that the collision of a single replication fork with an ICL is sufficient to initiate ICL repair (Fig. 14C). In this scenario, it is difficult to see how FAN1 could be involved in unhooking since it would have to cleave linear duplex DNA on the 5' side of the ICL, a structure that is not flap-like in nature. More experiments are required to test if the one-fork or two-fork models for ICL repair, or both, operate in vivo and to test if the defect in ICL unhooking in the context of the FANCD2 K561 R mutant is due to a defect specifically in recruitment of FAN1.
After unhooking, excision repair removes the crosslink adduct and translesion synthesis fills in the gap (Fig. 14A). Although FANCD2 ubiquitination appears to be involved in translesion synthesis in the Xenopus cell free system, it is difficult to see how FAN1 could be involved at this stage and it is likely that other FANCD2-binding proteins are required. We found that FAN1 interacts with MLH1 that is involved in mismatch repair, consistent with a previous report (Cannavo et al., 2007). At present the significance of this interaction is not clear but it may be that the interaction of FA 1 with MLH1 promotes the correction of translesion synthesis-induced mismatches during ICL repair. Regardless of how exactly MUS81 - alone or in conjunction with FAN1 or an as yet unidentified nuclease - unhooks the ICL, at least one and possibly two (one-ended) DSBs are generated (Fig. 14A). These DSBs are resected and this is a function that could be fulfilled by FAN1 based on our finding that FAN1 has 5'-3' exonuclease activity that is capable of generating 3' overhangs (Fig. 3A). However, cytological data showing that RPA loading is normal in FAN1-depleted cells (Fig. 7B) argues against this role although potential redundancy between FAN1 and other 5'-3' exonucleases would need to be investigated.
One of the overhangs generated by DSB resection invades the complementary duplex to initiate D-loop formation and HR (Fig. 7A,B). After extension by DNA synthesis, the invading strand re-anneals to the complementary strand in the duplex it came from originally. It is possible that continued DNA synthesis on the parent strand displaces the DNA in front of it. This would generate a 5' flap that could be cleaved by FAN1. In this scenario, FAN1 is required at a late step in HR and several observations are consistent with this hypothesis. Firstly, there is a delay in the disappearance of g-H2AX foci induced by cisplatin or IR in cells treated with FAN1 siRNA compared with control cells. Similar results were reported recently in FA cells (Leskovac et al., 2010). At all timepoints during recovery from cisplatin and IR, there are more RAD51 foci in FAN 1 -depleted cells than in control cells (Fig. 7C). It is possible that disappearance of foci in FAN1-depleted cells reflects inappropriate repair perhaps by non-homologous end joining, and this may account for the increase in radial chromosomes seen in MMC-treated cells depleted of FAN1 (Fig. 6D). Secondly, depletion of FAN1 from human cells results in reduced efficiency in l-Scel-induced HR (Fig. 7A) and similar results were reported in human cells expressing FANCD2 K561 R (Nakanishi et al., 2005). Depletion of FAN1 does not affect RAD51 loading in cisplatin-treated cells (Fig. 7C) suggesting that if FAN1 functions at the HR step of ICL repair then it acts independently of RAD51 or after RAD51 focus formation. Similar to FANCD2 null cells, depletion of FAN1 does not affect the frequency of MMC-induced SCEs (Fig. 13). Therefore if FAN1 does act at the HR step of ICL repair, then its role may be restricted to a sub-pathway of HR such as synthesis-dependent strand annealing that avoids crossing over. The SLX4 complex of structure-specific nucleases is also required for ICL repair but it is not yet clear at what stage this complex acts (Fekairi et al., 2009; Munoz et al., 2009; Svendsen et al., 2009). SLX4-XPF-SLX1-MUS81 can cleave three-way DNA junctions, 3' flaps and 5' flaps in vitro, and so FAN1 specificity overlaps with the SLX4 complex in 5' flap cleavage. We could find no evidence for an interaction of FAN1 with the SLX4 scaffold (unpublished data). It is not yet clear why two 5' endonucleases are required during ICL repair and it will be important to test redundancy between FAN1 and the SLX4 complex.
FAN1 is the only VRR_nuc domain-containing protein in eukaryotic cells. These domains are found in all kingdoms of life, but the functions of most of them are unknown (Iyer et al., 2006). Many bacteria and phages have VRR_nuc domain proteins and so it appears that the FA repair pathway which appeared relatively late during evolution was built on a more ancient VRR_nuc domain nuclease. It will be interesting to follow up on this hypothesis. Many cytotoxic anti-cancer agents act by inducing ICLs and it is possible that nucleases such as FAN1 are good targets for sensitizing cancer cells to killing by ICLs. Finally, although the majority of FA patients have mutations in the known FA genes, FA patients exist where mutations in known FA genes could not be found. In this light, it is likely that FAN1 mutations will be found in some of these patients. References
Akkari, Y.M.N. , Bateman, R.L., Reifsteck, C.A., Olson, S.B., and Grompe, M. (2000). DNA replication is required to elicit cellular responses to psoralen-induced DNA interstrand cross-links. Molecular and Cellular Biology 20, 8283-8289.
Bergstralh, D.T., and Sekelsky, J. (2008). Interstrand crosslink repair: can XPF-ERCC1 be let off the hook? Trends in Genetics 24, 70-76. Bhagwat, N., Olsen, A.L., Wang, AT., Hanada, K., Stuckert, P., Kanaar, R., D'Andrea,
A., Niedernhofer, L.J., and cHugh, P.J. (2009). XPF-ERCC1 Participates in the Fanconi
Anemia Pathway of Cross-Link Repair. Molecular and Cellular Biology 29, 6427-6437.
Bienko, M., Green, CM., Crosetto, N., Rudolf, F., Zapart, G., Coull, B., Kannouche, P., Wider, G., Peter, M., Lehmann, A.R., et a/. (2005). Ubiquitin-binding domains in Y-family polymerases regulate translesion synthesis. Science 310, 1821-1824.
Brenner, S. (1974). Genetics of Caenorhabditis-Elegans. Genetics 77, 71-94.
Cannavo, E., Gerrits, B., Marra, G., Schlapbach, R., and Jiricny, J. (2007).
Characterization of the interactome of the human MutL homologues MLH1 , PMS1 , and PMS2. J Biol Chem 282, 2976-2986.
Ciccia, A., Ling, C, Coulthard, R., Yan, Z., Xue, Y., Meetei, A.R., Laghmani el, H.,
Joenje, H., McDonald, N., de Winter, J. P., er a/. (2007). Identification of FAAP24, a
Fanconi anemia core complex protein that interacts with FANCM. Mol Cell 25, 331-343.
Collis, S.J., Ciccia, A., Deans, A.J., Horejsi, Z., Martin, J.S., Maslen, S.L., Skehel, J.M., Elledge, S.J., West, S.C., and Boulton, S.J. (2008). FANCM and FAAP24 Function in
ATR-Mediated Checkpoint Signaling Independently of the Fanconi Anemia Core
Complex. Molecular Cell 32, 313-324.
Deans, A.J., and West, S.C. (2009). FANCM Connects the Genome Instability Disorders Bloom's Syndrome and Fanconi Anemia. Molecular Cell 36, 943-953.
Fekairi, S., Scaglione, S., Chahwan, C, Taylor, E.R., Tissier, A., Coulon, S., Dong, M.Q., Ruse, C, Yates, J.R., 3rd, Russell, P., et al. (2009). Human SLX4 is a Holliday junction resolvase subunit that binds multiple DNA repair/recombination endonucleases. Cell 138, 78-89.
Garcia-Higuera, I., Taniguchi, T., Ganesan, S., Meyn, M.S., Timmers, C, Hejna, J., Grompe, M., and D'Andrea, A.D. (2001). Interaction of the Fanconi anemia proteins and BRCA1 in a common pathway. Mol Cell 7, 249-262.
Hanada, K., Budzowska, M., Davies, S.L., van Drunen, E., Onizawa, H., Beverloo, H.B., Maas, A., Essers, J., Hickson, I.D., and Kanaar, R. (2007). The structure-specific endonuclease Mus81 contributes to replication restart by generating double-strand DNA breaks. Nature Structural & Molecular Biology 14, 1096-1104.
Hanada, K., Budzowska, M., Modesti, M., Maas, A., Wyman, C, Essers, J., and Kanaar, R. (2006). The structure-specific endonuclease Mus81-Eme1 promotes conversion of interstrand DNA crosslinks into double-strands breaks. Embo Journal 25, 4921-4932. Hofmann, K. (2009). Ubiquitin-binding domains and their role in the DNA damage response. DNA Repair (Amst) 8, 544-556.
Iyer, L.M., Babu, M.M., and Aravind, L. (2006). The HIRAN domain and recruitment of chromatin remodeling and repair activities to damaged DNA. Cell Cycle 5, 775-782. Knipscheer, P., Raschle, M., Smogorzewska, A., Enoiu, M., Ho, T.V., Scharer, O.D., Elledge, S.J., and Walter, J.C. (2009). The Fanconi Anemia Pathway Promotes Replication-Dependent DNA Interstrand Cross-Link Repair. Science 326, 1698-1701. Kosinski, J., Feder, M., and Bujnicki, J.M. (2005). The PD-(D/E)XK superfamily revisited: identification of new members among proteins involved in DNA metabolism and functional predictions for domains of (hitherto) unknown function. Bmc Bioinformatics 6, -
Leskovac, D., Vujic, D., Guc-Scekic, M., Petrov, S., Joksic, I., Slijepcevic, P., and Joksic, G. (2010). Fanconi anemia is characterized by delayed repair kinetics of DNA double- strand breaks. Tohoku J Exp Med 227, 69-76.
Ling, C, Ishiai, M., Ali, A.M., Medhurst, A.L., Neveling, K., alb, R., Yan, Z., Xue, Y., Oostra, A.B., Auerbach, A.D., et al. (2007). FAAP100 is essential for activation of the Fanconi anemia-associated DNA damage response pathway. Embo J 26, 2104-2114. Mccabe, K.M., Olson, S.B., and Moses, R.E. (2009). DNA Interstrand Crosslink Repair in Mammalian Cells. Journal of Cellular Physiology 220, 569-573.
Moldovan, G.L., and D'andrea, A.D. (2009). How the Fanconi Anemia Pathway Guards the Genome. Annual Review of Genetics 43, 223-249.
Munoz, I.M., Hain, K., Declais, A.C., Gardiner, M., Toh, G.W., Sanchez-Pulido, L., Heuckmann, J.M., Toth, R., Macartney, T., Eppink, B., et al. (2009). Coordination of structure-specific nucleases by human SLX4/BTBD12 is required for DNA repair. Mol Cell 35, 116-127.
Nakanishi, K., Yang, Y.G., Pierce, A.J., Taniguchi, T., Digweed, M., D'Andrea, A.D., Wang, Z.Q., and Jasin, M. (2005). Human fanconi anemia monoubiquitination pathway promotes homologous DNA repair. Proceedings of the National Academy of Sciences of the United States of America 102, 1 10-1115.
Niedernhofer, L.J., Odijk, H., Budzowska, M., van Drunen, E., Maas, A., Theil, A.F., de Wit, J., Jaspers, N.G., Beverloo, H.B., Hoeijmakers, J.H., ef al. (2004). The structure- specific endonuclease Ercc1-Xpf is required to resolve DNA interstrand cross-link- induced double-strand breaks. Mol Cell Biol 24, 5776-5787.
Patel, K.J., and Joeje, H. (2007). Fanconi anemia and DNA replication repair. DNA Repair 6, 885-890.
Raschle, M., Knipscheer, P., Enoiu, M., Angelov, T., Sun, J., Griffith, J.D., Ellenberger, T.E., Scharer, O.D., and Walter, J.C. (2008). Mechanism of replication-coupled DNA interstrand crosslink repair. Cell 134, 969-980.
Rothfuss, A., and Grompe, M. (2004). Repair kinetics of genomic interstrand DNA crosslinks: Evidence for DNA double-strand break-dependent activation of the Fanconi anemia/BRCA pathway. Molecular and Cellular Biology 24, 23-134. Smogorzewska, A., Matsuoka, S., Vinciguerra, P., McDonald, E.R., Hurov, K.E., Luo, J., Ballif, B.A., Gygi, S.P., Hofmann, K., D'Andrea, A.D., et al. (2007). Identification of the FANCI protein, a monoubiquitinated FANCD2 paralog required for DNA repair. Cell 129, 289-301.
Svendsen, J.M., Smogorzewska, A., Sowa, M.E., O'Connell, B.C., Gygi, S.P., Elledge, S.J., and Harper, J.W. (2009). Mammalian BTBD12/SLX4 Assembles A Holliday Junction Resolvase and Is Required for DNA Repair. Cell 38, 63-77.
Swann, P.F., Waters, T.R., Moulton, D.C., Xu, Y.Z., Zheng, Q.G., Edwards, M., and Mace, R. (1996). Role of postreplicative DNA mismatch repair in the cytotoxic action of thioguanine. Science 273, 1109-11 11.
Taniguchi, T., Garcia-Higuera, I., Andreassen, P.R., Gregory, R.C., Grompe, M., and D'Andrea, A.D. (2002). S-phase-specific interaction of the Fanconi anemia protein, FANCD2, with BRCA1 and RAD51. Blood 100, 2414-2420.
Wang, W. (2007). Emergence of a DNA-damage response network consisting of Fanconi anaemia and BRCA proteins. Nat Rev Genet 8, 735-748.

Claims

1. A method for identifying a compound expected to be useful in modulating, for example inhibiting, KIAA1018/MTMR15/FAN1 (FAN1) endonuclease activity, the method comprising the steps of (1 ) determining whether a test compound modulates, for example inhibits, the endonuclease activity of a FAN1 polypeptide on a branched polynucleotide substrate and (2) selecting a compound which modulates, for example inhibits, the said FA 1 endonuclease activity.
2. The method of claim 1, wherein the branched polynucleotide substrate is a substrate 5' flap-containing nucleic acid or replication fork nucleic acid.
3. A method for identifying a compound expected to be useful in modulating, for example inhibiting, FA 1 5'-exonuclease activity, the method comprising the steps of (1) determining whether a test compound modulates, for example inhibits, the 5'- exonuclease activity of a FAN1 polypeptide on a substrate polynucleotide and (2) selecting a compound which modulates, for example inhibits, the said FAN1 5'- exonuclease activity.
4. A method for identifying a compound expected to be useful in modulating, for example inhibiting, the repair of a DNA inter-strand crosslink (ICL), resolution of an ICL- induced double strand break, or homologous recombination in a cell, the method comprising the steps of (1) determining whether a test compound modulates, for example inhibits, the endonuclease or 5'-exonuclease activity of a FA 1 polypeptide on a substrate polynucleotide and (2) selecting a compound which modulates, for example inhibits, the said FAN1 polypeptide endonuclease or 5'-exonuclease activity.
5. A method for identifying a compound expected to be useful in modulating, for example inhibiting, the repair of a DNA inter-strand crosslink, resolution of an ICL- induced double strand break, or homologous recombination in a cell, the method comprising the steps of (1) determining whether a test compound modulates, for example inhibits, the interaction between a FAN1 polypeptide and an ubiquttinylated FANCD2 or FANCl polypeptide and (2) selecting a compound which modulates, for example inhibits, the said interaction between the FAN1 polypeptide and the ubiquitinylated FANCD2 or FANCl polypeptide.
6. A method for identifying a compound expected to be useful in increasing cancer cells' sensitivity to ICLs or enhancing the effect of platinum based chemotherapy or other ICL-inducing therapy (for example mitomycin C, nitrogen mustards, nitrosoureas, alkylalkanesulphonate, and Cyclophosphamide) on cancer cells, the method comprising the steps of (1 ) determining whether a test compound modulates, for example inhibits, the endonuclease or 5-exonuclease activity of a FAN1 polypeptide on a substrate polynucleotide; or the interaction between a FAN1 polypeptide and an ubiquitinylated FANCD2 or FANCI polypeptide, and (2) selecting a compound which modulates, for example inhibits, the endonuclease or 5'-exonuclease activity of the FA 1 polypeptide on the substrate po}ynucleoti'de or the interaction between the FA 1 polypeptide and the ubiquitinylated FANCD2 or FANCI polypeptide.
7. A method for identifying a compound expected to be useful in modulating, for example inhibiting, the repair of a DNA inter-strand crosslink, resolution of an ICL- induced double strand break, or homologous recombination in a cell, or in increasing cancer cells' sensitivity to ICLs or enhancing the effect of platinum based chemotherapy or other ICL-inducing therapy on cancer cells, the method comprising the steps of (1) determining whether a test compound modulates, for example inhibits, said repair of a DNA inter-strand crosslink, resolution of an ICL-induced double strand break, or homologous recombination in the cell, or the cell's resistance to ICLs or the effect of platinum based chemotherapy or other ICL-inducing therapy on the cell, wherein said determining is done on at least two cells, wherein said cells differ in the amount or activity of FAN1 , and (2) selecting a compound which modulates, for example inhibits, the said repair of a DNA inter-strand crosslink, resolution of an ICL-induced double strand break, or homologous recombination in the cell, or the cell's resistance to ICLs or the effect of platinum based chemotherapy or other ICL-inducing therapy to a greater extent in the cell having more FAN1 than in the cell having less FAN1.
8. The method of any one of claims 1 to 7 wherein the FAN1 polypeptide is wild type human FA 1 polypeptide or a fragment thereof, or a fusion either thereof.
9. The method of claim 8 wherein the fragment comprises the VRR-nuc domain and, optionally, further comprises the SAP domain, and/or optionally, further comprises the UBZ domain.
10. The method of claim 8, when dependent on claims 5 or 6, wherein the fragment comprises the UBZ domain and, optionally, further comprises the SAP domain, and/or optionally, further comprises the VRR-nuc domain.
11. The method of any one of claims 8 to 9 wherein the fragment corresponds to at least residues 460-1017 of human FAN1.
12. The method of any one of the preceding claims wherein the FAN1 polypeptide is a NUS-His6 fusion polypeptide.
13. The method of any one of the preceding claims wherein the FAN1 polypeptide is recombinant.
14. The method of any one of claims 3, 4, 6 or 8 to 13, wherein the substrate polynucletide is a branched polynucleotide.
15. The method of claim 14, wherein the substrate polynucleotide consists of or comprises a 5' flap-containing polynucleotide or a replication fork polynucleotide.
16. The method of claim 2 or 15, wherein the substrate polynucleotide consists of or comprises the structure of the 5' flap polynucleotide identified in Figure 2A.
17. A purified preparation or kit of parts comprising a FA 1 polypeptide or polynucleotide; and a substrate polynucleotide as defined in claims 14 to 16 and/or a FANCD2 or FANCI polypeptide.
18. The purified preparation or kit of parts of Claim 17, wherein the substrate polynucleotide is fluorescently labelled.
19. The preparation or kit of parts of claim 17 comprising a recombinant FAN1 polynucleotide.
20. The preparation or kit of parts of claims 17 to 19 further comprising ubiquitin or dithiobis (succinimidyl propionate) (DSP) or a de-ubiquitinase inhibitor, for example N- ethyl maleimide (NEM).
21. A mutant FAN1 polypeptide or polynucleotide wherein Asp 981 and/or Arg982 are mutated, optionally to alanine; and/or wherein Cys44 and/or Cys47 are mutated, optionally to alanine.
22. Use of a FAN1 polypeptide in an in vitro method of resolving a DNA ICL.
23. An in vitro method of resolving a DNA ICL, the method comprising the step of using a FAN1 polypeptide.
24. The method of any one of claims 1 to 16 comprising the step of assessing whether the compound modulates the repair of a DNA inter-strand crosslink, resolution of an ICL-induced double strand break, or homologous recombination in a cell, or in increasing cancer cells' sensitivity to ICLs or enhancing the effect of platinum based chemotherapy or other ICL-inducing therapy on cancer cells, in a whole cell, tissue or organism; and a compound that modulates the activity or therapeutic response is selected.
25. The method of claim 24 further comprising the step of assessing whether the compound modulates the activity of a FAN1 polypeptide in the whole cell, tissue or organism, and a compound that modulates the activity is selected.
26. The method of any one of claims 1 to 16, 24 or 25 further comprising the step of synthesising, purifying and/or formulating the selected compound.
27. A method for preparing a compound which modulates the activity of a FA 1 polypeptide, the method comprising:
1 ) performing a method according to any one of claims 1 to 16, 24 or 25; and
2) synthesising, purifying and/or formulating the selected compound.
28. A method of characterising a patient with cancer and/or suspected Fanconi Anaemia, the method comprising the step of assessing the patient's genotype or phenotype for FAN1.
29. The method of Claim 28, wherein the method further comprises the step of assessing the patient's genotype or phenotype for SLX4 and/or SLX1.
30. The method of claim 5 wherein the interaction is detected using fluorescence resonance energy transfer; immunoprecipitation; subcellular fractionation or imaging; surface plasmon resonance (SPR); or isothermal titration calorimetry.
PCT/GB2011/001017 2010-07-06 2011-07-06 Methods for screening for compounds expected to be useful in the modulating, for example inhibiting, the activity of kiaa1018/mtmr15/fan1. Ceased WO2012004559A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB1011367.8A GB201011367D0 (en) 2010-07-06 2010-07-06 Methods
GB1011367.8 2010-07-06

Publications (1)

Publication Number Publication Date
WO2012004559A1 true WO2012004559A1 (en) 2012-01-12

Family

ID=42669260

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2011/001017 Ceased WO2012004559A1 (en) 2010-07-06 2011-07-06 Methods for screening for compounds expected to be useful in the modulating, for example inhibiting, the activity of kiaa1018/mtmr15/fan1.

Country Status (2)

Country Link
GB (1) GB201011367D0 (en)
WO (1) WO2012004559A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3581101A3 (en) * 2018-06-11 2020-01-22 Contemporary Han Cloud Co., Ltd Device and method for pulse diagnosis measurement
US20220033913A1 (en) * 2018-12-13 2022-02-03 The Henry M. Jackson Foundation For The Advancement Of Military Medicine, Inc. Genomic rearrangements associated with prostate cancer and methods of using the same

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090062196A1 (en) * 2006-10-20 2009-03-05 D Andrea Alan Compositions and methods of treating cancer
US20090305266A1 (en) * 2006-05-03 2009-12-10 Bagby Grover C Test for ovarian cancer by detecting abnormality in fancd2 pathway

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090305266A1 (en) * 2006-05-03 2009-12-10 Bagby Grover C Test for ovarian cancer by detecting abnormality in fancd2 pathway
US20090062196A1 (en) * 2006-10-20 2009-03-05 D Andrea Alan Compositions and methods of treating cancer

Non-Patent Citations (45)

* Cited by examiner, † Cited by third party
Title
AGATA SMOGORZEWSKA ET AL: "A Genetic Screen Identifies FAN1, a Fanconi Anemia-Associated Nuclease Necessary for DNA Interstrand Crosslink Repair", MOLECULAR CELL, vol. 39, no. 1, 8 July 2010 (2010-07-08), pages 36 - 47, XP055009530, ISSN: 1097-2765, DOI: 10.1016/j.molcel.2010.06.023 *
AI ET AL., NATURE METHODS, vol. 5, 2008, pages 401 - 403
AKKARI, Y.M.N., BATEMAN, R.L., REIFSTECK, C.A., OLSON, S.B., GROMPE, M.: "DNA replication is required to elicit cellular responses to psoralen-induced DNA interstrand cross-links", MOLECULAR AND CELLULAR BIOLOGY, vol. 20, 2000, pages 8283 - 8289
BERGSTRALH, D.T., SEKELSKY, J.: "Interstrand crosslink repair: can XPF-ERCC1 be let off the hook?", TRENDS IN GENETICS, vol. 24, 2008, pages 70 - 76, XP022441749, DOI: doi:10.1016/j.tig.2007.11.003
BHAGWAT, N., OLSEN, A.L., WANG, A.T., HANADA, K., STUCKERT, P., KANAAR, R., D'ANDREA, A., NIEDERNHOFER, L.J., MCHUGH, P.J.: "XPF-ERCC1 Participates in the Fanconi Anemia Pathway of Cross-Link Repair", MOLECULAR AND CELLULAR BIOLOGY, vol. 29, 2009, pages 6427 - 6437
BIENKO, M., GREEN, C.M., CROSETTO, N., RUDOLF, F., ZAPART, G., COULL, B., KANNOUCHE, P., WIDER, G., PETER, M., LEHMANN, A.R. ET AL: "Ubiquitin-binding domains in Y-family polymerases regulate translesion synthesis", SCIENCE, vol. 310, 2005, pages 1821 - 1824
BRENNER, S.: "Genetics of Caenorhabditis-Elegans", GENETICS, vol. 77, 1974, pages 71 - 94
CANNAVO, E., GERRITS, B., MARRA, G., SCHLAPBACH, R., JIRICNY, J.: "Characterization of the interactome of the human MutL homologues MLH1, PMS1, and PMS2", J BIOL CHEM, vol. 282, 2007, pages 2976 - 2986, XP055010435, DOI: doi:10.1074/jbc.M609989200
CICCIA, A., LING, C., COULTHARD, R., YAN, Z., XUE, Y., MEETEI, A.R., LAGHMANI EL, H., JOENJE, H., MCDONALD, N., DE WINTER, J.P.: "Identification of FAAP24, a Fanconi anemia core complex protein that interacts with FANCM", MOL CELL, vol. 25, 2007, pages 331 - 343
COLLIS, S.J., CICCIA, A., DEANS, A.J., HOREJSI, Z., MARTIN, J.S., MASLEN, S.L., SKEHEL, J.M., ELLEDGE, S.J., WEST, S.C., BOULTON,: "FANCM and FAAP24 Function in ATR-Mediated Checkpoint Signaling Independently of the Fanconi Anemia Core Complex", MOLECULAR CELL, vol. 32, 2008, pages 313 - 324
CRAIG MACKAY ET AL: "Identification of KIAA1018/FAN1, a DNA Repair Nuclease Recruited to DNA Damage by Monoubiquitinated FANCD2", CELL, vol. 142, no. 1, 8 July 2010 (2010-07-08), pages 65 - 76, XP055009427, ISSN: 0092-8674, DOI: 10.1016/j.cell.2010.06.021 *
DEANS, A.J., WEST, S.C.: "FANCM Connects the Genome Instability Disorders Bloom's Syndrome and Fanconi Anemia", MOLECULAR CELL, vol. 36, 2009, pages 943 - 953
E. CANNAVO ET AL: "Characterization of the Interactome of the Human MutL Homologues MLH1, PMS1, and PMS2", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 282, no. 5, 1 February 2007 (2007-02-01), pages 2976 - 2986, XP055010435, ISSN: 0021-9258, DOI: 10.1074/jbc.M609989200 *
FEKAIRI, S., SCAGLIONE, S., CHAHWAN, C., TAYLOR, E.R., TISSIER, A., COULON, S., DONG, M.Q., RUSE, C., YATES, J.R., 3RD, RUSSELL, P: "Human SLX4 is a Holliday junction resolvase subunit that binds multiple DNA repair/recombination endonucleases", CELL, vol. 138, 2009, pages 78 - 89
GARCIA-HIGUERA, I., TANIGUCHI, T., GANESAN, S., MEYN, M.S., TIMMERS, C., HEJNA, J., GROMPE, M., D'ANDREA, A.D.: "Interaction of the Fanconi anemia proteins and BRCA1 in a common pathway", MOL CELL, vol. 7, 2001, pages 249 - 262, XP003005795, DOI: doi:10.1016/S1097-2765(01)00173-3
HANADA, K., BUDZOWSKA, M., DAVIES, S.L., VAN DRUNEN, E., ONIZAWA, H., BEVERLOO, H.B., MAAS, A., ESSERS, J., HICKSON, I.D., KANAAR,: "The structure-specific endonuclease Mus81 contributes to replication restart by generating double-strand DNA breaks", NATURE STRUCTURAL & MOLECULAR BIOLOGY, vol. 14, 2007, pages 1096 - 1104
HANADA, K., BUDZOWSKA, M., MODESTI, M., MAAS, A., WYMAN, C., ESSERS, J., KANAAR, R.: "The structure-specific endonuclease Mus81-Eme1 promotes conversion of interstrand DNA crosslinks into double-strands breaks", EMBO JOURNAL, vol. 25, 2006, pages 4921 - 4932
HOFMANN, K.: "Ubiquitin-binding domains and their role in the DNA damage response", DNA REPAIR (AMST, vol. 8, 2009, pages 544 - 556, XP026079796, DOI: doi:10.1016/j.dnarep.2009.01.003
K. YOSHIKIYO ET AL: "KIAA1018/FAN1 nuclease protects cells against genomic instability induced by interstrand cross-linking agents", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 107, no. 50, 14 December 2010 (2010-12-14), pages 21553 - 21557, XP055009531, ISSN: 0027-8424, DOI: 10.1073/pnas.1011081107 *
KATJA KRATZ ET AL: "Deficiency of FANCD2-Associated Nuclease KIAA1018/FAN1 Sensitizes Cells to Interstrand Crosslinking Agents", CELL, vol. 142, no. 1, 8 July 2010 (2010-07-08), pages 77 - 88, XP055009534, ISSN: 0092-8674, DOI: 10.1016/j.cell.2010.06.022 *
KHAN IH, ZHAO J., GHOSH, P., ZIMAN, M., SWEENEY C, KUNG HJ, LUCIW PA, ASSAY DRUG DEV TECHNOLOGY, vol. 8, 2010, pages 27 - 36
KNIPSCHEER, P., RASCHLE, M., SMOGORZEWSKA, A., ENOIU, M., HO, T.V., SCHARER, O.D., ELLEDGE, S.J., WALTER, J.C.: "The Fanconi Anemia Pathway Promotes Replication-Dependent DNA Interstrand Cross-Link Repair", SCIENCE, vol. 326, 2009, pages 1698 - 1701, XP055009468, DOI: doi:10.1126/science.1182372
KOSINSKI, J., FEDER, M., BUJNICKI, J.M.: "The PD-(D/E)XK superfamily revisited: identification of new members among proteins involved in DNA metabolism and functional predictions for domains of (hitherto) unknown function", BMC BIOINFORMATICS, vol. 6, 2005, XP021000768, DOI: doi:10.1186/1471-2105-6-172
LESKOVAC, D., VUJIC, D., GUC-SCEKIC, M., PETROV, S., JOKSIC, I., SLIJEPCEVIC, P., JOKSIC, G.: "Fanconi anemia is characterized by delayed repair kinetics of DNA double-strand breaks", TOHOKU J EXP MED, vol. 221, 2010, pages 69 - 76
LIERES ET AL.: "Quantitative analysis of chromatin compaction in living cells using FLIM-FRET", J CELL BIOL., vol. 187, no. 4, 16 November 2009 (2009-11-16), pages 481 - 96
LING, C., ISHIAI, M., ALI, A.M., MEDHURST, A.L., NEVELING, K., KALB, R., YAN, Z., XUE, Y., OOSTRA, A.B., AUERBACH, A.D. ET AL.: "FAAP100 is essential for activation of the Fanconi anemia-associated DNA damage response pathway", EMBO J, vol. 26, 2007, pages 2104 - 2114
LYER, L.M., BABU, M.M., ARAVIND, L.: "The HIRAN domain and recruitment of chromatin remodeling and repair activities to damaged DNA", CELL CYCLE, vol. 5, 2006, pages 775 - 782
MCCABE, K.M., OLSON, S.B., MOSES, R.E.: "DNA Interstrand Crosslink Repair in Mammalian Cells", JOURNAL OF CELLULAR PHYSIOLOGY, vol. 220, 2009, pages 569 - 573
MOLDOVAN, G.L., D'ANDREA, A.D.: "How the Fanconi Anemia Pathway Guards the Genome", ANNUAL REVIEW OF GENETICS, vol. 43, 2009, pages 223 - 249
MUNOZ, I.M., HAIN, K., DECLAIS, A.C., GARDINER, M., TOH, G.W., SANCHEZ-PULIDO, L., HEUCKMANN, J.M., TOTH, R., MACARTNEY, T., EPPIN: "Coordination of structure-specific nucleases by human SLX4/BTBD12 is required for DNA repair", MOL CELL, vol. 35, 2009, pages 116 - 127, XP029011282, DOI: doi:10.1016/j.molcel.2009.06.020
NAKANISHI, K., YANG, Y.G., PIERCE, A.J., TANIGUCHI, T., DIGWEED, M., D'ANDREA, A.D., WANG, Z.Q., JASIN, M.: "Human fanconi anemia monoubiquitination pathway promotes homologous DNA repair", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 102, 2005, pages 1110 - 1115
NIEDERNHOFER, L.J., ODIJK, H., BUDZOWSKA, M., VAN DRUNEN, E., MAAS, A., THEIL, A.F., DE WIT, J., JASPERS, N.G., BEVERLOO, H.B., HO: "The structure-specific endonuclease Ercc1-Xpf is required to resolve DNA interstrand cross-link- induced double-strand breaks", MOL CELL BIOL, vol. 24, 2004, pages 5776 - 5787
P. KNIPSCHEER ET AL: "The Fanconi Anemia Pathway Promotes Replication-Dependent DNA Interstrand Cross-Link Repair", SCIENCE, vol. 326, no. 5960, 12 November 2009 (2009-11-12), pages 1698 - 1701, XP055009468, ISSN: 0036-8075, DOI: 10.1126/science.1182372 *
PATEL, K.J., JOEJE, H.: "Fanconi anemia and DNA replication repair", DNA REPAIR, vol. 6, 2007, pages 885 - 890
PEARSON: "Methods in Molecular Biology, Computer Analysis of Sequence Data, Part 11", 1994, HUMANA PRESS, pages: 365 - 389
RASCHLE, M., KNIPSCHEER, P., ENOIU, M., ANGELOV, T., SUN, J., GRIFFITH, J.D., ELLENBERGER, T.E., SCHARER, O.D., WALTER, J.C.: "Mechanism of replication-coupled DNA interstrand crosslink repair", CELL, vol. 134, 2008, pages 969 - 980
ROTHFUSS, A., GROMPE, M.: "Repair kinetics of genomic interstrand DNA cross- links: Evidence for DNA double-strand break-dependent activation of the Fanconi anemia/BRCA pathway", MOLECULAR AND CELLULAR BIOLOGY, vol. 24, 2004, pages 123 - 134
SHANER ET AL., NAT BIOTECHNOL, vol. 22, 2004, pages 1567 - 1572
SMOGORZEWSKA, A., MATSUOKA, S., VINCIGUERRA, P., MCDONALD, E.R., HUROV, K.E., LUO, J., BALLIF, B.A., GYGI, S.P., HOFMANN, K., D'AN: "Identification of the FANCI protein, a monoubiquitinated FANCD2 paralog required for DNA repair", CELL, vol. 129, 2007, pages 289 - 301, XP008080785, DOI: doi:10.1016/j.cell.2007.03.009
SVENDSEN, J.M., SMOGORZEWSKA, A., SOWA, M.E., O'CONNELL, B.C., GYGI, S.P., ELLEDGE, S.J., HARPER, J.W.: "Mammalian BTBD12/SLX4 Assembles A Holliday Junction Resolvase and Is Required for DNA Repair", CELL, vol. 138, 2009, pages 63 - 77
SWANN, P.F., WATERS, T.R., MOULTON, D.C., XU, Y.Z., ZHENG, Q.G., EDWARDS, M., MACE, R.: "Role of postreplicative DNA mismatch repair in the cytotoxic action of thioguanine", SCIENCE, vol. 273, 1996, pages 1109 - 1111
T. LIU ET AL: "FAN1 Acts with FANCI-FANCD2 to Promote DNA Interstrand Cross-Link Repair", SCIENCE, vol. 329, no. 5992, 29 July 2010 (2010-07-29), pages 693 - 696, XP055009430, ISSN: 0036-8075, DOI: 10.1126/science.1192656 *
TANIGUCHI, T., GARCIA-HIGUERA, I., ANDREASSEN, P.R., GREGORY, R.C., GROMPE, M., D'ANDREA, A.D.: "S-phase-specific interaction of the Fanconi anemia protein, FANCD2, with BRCA1 and RAD51", BLOOD, vol. 100, 2002, pages 2414 - 2420, XP003005797, DOI: doi:10.1182/blood-2002-01-0278
WALLRABE, PERIASAMY, CURRENT OPINION IN BIOTECHNOLOGY, vol. 16, no. 1, February 2005 (2005-02-01), pages 19 - 27
WANG, W.: "Emergence of a DNA-damage response network consisting of Fanconi anaemia and BRCA proteins", NAT REV GENET, vol. 8, 2007, pages 735 - 748

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3581101A3 (en) * 2018-06-11 2020-01-22 Contemporary Han Cloud Co., Ltd Device and method for pulse diagnosis measurement
TWI731339B (en) * 2018-06-11 2021-06-21 當代漢雲企業有限公司 Device and method for pulse diagnosis measurement
US12097013B2 (en) 2018-06-11 2024-09-24 Contemporary Han Cloud Co., Ltd Device and method for pulse diagnosis measurement
US20220033913A1 (en) * 2018-12-13 2022-02-03 The Henry M. Jackson Foundation For The Advancement Of Military Medicine, Inc. Genomic rearrangements associated with prostate cancer and methods of using the same

Also Published As

Publication number Publication date
GB201011367D0 (en) 2010-08-18

Similar Documents

Publication Publication Date Title
Wu et al. TRAIP is a master regulator of DNA interstrand crosslink repair
MacKay et al. Identification of KIAA1018/FAN1, a DNA repair nuclease recruited to DNA damage by monoubiquitinated FANCD2
Nishiyama et al. Two distinct modes of DNMT1 recruitment ensure stable maintenance DNA methylation
Valsecchi et al. RNA nucleation by MSL2 induces selective X chromosome compartmentalization
Wang Emergence of a DNA-damage response network consisting of Fanconi anaemia and BRCA proteins
Bailly et al. The Caenorhabditis elegans homolog of Gen1/Yen1 resolvases links DNA damage signaling to DNA double-strand break repair
Perez‐Oliva et al. USP45 deubiquitylase controls ERCC1–XPF endonuclease‐mediated DNA damage responses
Shi et al. Physical and functional interactions between MutY glycosylase homologue (MYH) and checkpoint proteins Rad9–Rad1–Hus1
Muñoz et al. Coordination of structure-specific nucleases by human SLX4/BTBD12 is required for DNA repair
Sato et al. A DNA-damage selective role for BRCA1 E3 ligase in claspin ubiquitylation, CHK1 activation, and DNA repair
Alpi et al. UBE2T, the Fanconi anemia core complex, and FANCD2 are recruited independently to chromatin: a basis for the regulation of FANCD2 monoubiquitination
Wu et al. Crosstalk between Lys63-and Lys11-polyubiquitin signaling at DNA damage sites is driven by Cezanne
Sen et al. DAF-16/FOXO requires Protein Phosphatase 4 to initiate transcription of stress resistance and longevity promoting genes
Sánchez et al. Monitoring histone methylation (H3K9me3) changes in live cells
Niraj et al. The identification of FANCD2 DNA binding domains reveals nuclear localization sequences
Chen et al. KNO1‐mediated autophagic degradation of the Bloom syndrome complex component RMI1 promotes homologous recombination
Križaj Ammodytoxin: a window into understanding presynaptic toxicity of secreted phospholipases A2 and more
WO2012004559A1 (en) Methods for screening for compounds expected to be useful in the modulating, for example inhibiting, the activity of kiaa1018/mtmr15/fan1.
Serpe et al. The DNA alkylguanine DNA alkyltransferase-2 (AGT-2) Of Caenorhabditis elegans is involved in meiosis and early development under physiological conditions
Stepanik et al. FGF pyramus has a transmembrane domain and cell-autonomous function in Polarity
Song et al. Functional dissection of the conserved C. elegans LEM-3/ANKLE1 nuclease reveals a crucial requirement for the LEM-like and GIY-YIG domains for DNA bridge processing
WO2019024081A1 (en) Tale rvd specifically recognizing dna base modified by methylation and application thereof
De Souza et al. A point mutation in the Aspergillus nidulans sonB Nup98 nuclear pore complex gene causes conditional DNA damage sensitivity
Bugga et al. The cell surface receptor Tartan is a potential in vivo substrate for the receptor tyrosine phosphatase Ptp52F
Sato et al. Defective FANCI binding by a fanconi anemia-related FANCD2 mutant

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11741676

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11741676

Country of ref document: EP

Kind code of ref document: A1