WO2012003545A1 - Acetylenation of fatty acids - Google Patents

Acetylenation of fatty acids Download PDF

Info

Publication number
WO2012003545A1
WO2012003545A1 PCT/AU2011/000859 AU2011000859W WO2012003545A1 WO 2012003545 A1 WO2012003545 A1 WO 2012003545A1 AU 2011000859 W AU2011000859 W AU 2011000859W WO 2012003545 A1 WO2012003545 A1 WO 2012003545A1
Authority
WO
WIPO (PCT)
Prior art keywords
cell
polypeptide
seq
sequence
plant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/AU2011/000859
Other languages
French (fr)
Inventor
Victoria Shirley Haritos
Irene Mary Horne
Katherine Ann Damcevski
Karen Johanna Glover
Nerida Louise Gibb
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Commonwealth Scientific and Industrial Research Organization CSIRO
Grains Research and Development Corp
Original Assignee
Commonwealth Scientific and Industrial Research Organization CSIRO
Grains Research and Development Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from AU2010903057A external-priority patent/AU2010903057A0/en
Application filed by Commonwealth Scientific and Industrial Research Organization CSIRO, Grains Research and Development Corp filed Critical Commonwealth Scientific and Industrial Research Organization CSIRO
Publication of WO2012003545A1 publication Critical patent/WO2012003545A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/185Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19Carboxylic acids, e.g. valproic acid
    • A61K31/20Carboxylic acids, e.g. valproic acid having a carboxyl group bound to a chain of seven or more carbon atoms, e.g. stearic, palmitic, arachidic acids
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C07K14/43563Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8247Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified lipid metabolism, e.g. seed oil composition
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0071Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • C12N9/0083Miscellaneous (1.14.99)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/64Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6409Fatty acids
    • C12P7/6427Polyunsaturated fatty acids [PUFA], i.e. having two or more double bonds in their backbone
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/64Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6409Fatty acids
    • C12P7/6427Polyunsaturated fatty acids [PUFA], i.e. having two or more double bonds in their backbone
    • C12P7/6431Linoleic acids [18:2[n-6]]

Definitions

  • the present invention relates to polypeptides and methods for producing acetylenated fatty acids.
  • Acetylenic fatty acids contain carbon-carbon triple bonds and are related to unsaturated fatty acids (containing double bonds) by the removal of a further two hydrogens from the already unsaturated bond.
  • the first acetylenic fatty acid that was fully characterized was tariric acid (C18: 1A6A) from Picramnia tariri (Arnaud, 1892).
  • tariric acid C18: 1A6A
  • Picramnia tariri Picramnia tariri
  • PAFA polyacetylenic fatty acid
  • the term 'polyacetylene' is also commonly used to describe PAFAs and metabolites derived from them.
  • PAFAs and related compounds More than 2000 PAFAs and related compounds have been identified; they are found in higher plants, liverworts, mosses, fungi, marine sponges and algae, and insects. The common function of these PAFA derived compounds in all producing organisms is their probable involvement in self defence against pathogens and predators.
  • PAFA related secondary metabolites that use crepenynic acid ( €18:2 ⁇ 9 ⁇ , ⁇ 12 ⁇ ) as the precursor fatty acid. Tissue distribution of these PAFA metabolites is different between plant species. For example, in safflower (Carthamus tinctorius, Asteraceae), PAFA metabolites were mainly found in the cotyledon and to a lesser extent in hypocotyl and root of germinating plants, whereas a different PAFA epoxide metabolite was concentrated in the subcellular fraction of mature leaf that was rich in chloroplast (Ichihara and Noda, 1977).
  • Crepis biennis contains trace amounts of PAFA metabolites in leaves (Bohlmann and Zdero, 1973).
  • Food plant species belonging to Apiaceae (carrot, celeriac, celery, parsnip, parsley) and Solanaceae (tomato, potato) accumulate falcarinol-type polyacetylenes (a CI 7 PAFA metabolite) mainly in roots and other edible parts (reviewed in Christensen, 2006).
  • falcarinol-type polyacetylenes a CI 7 PAFA metabolite
  • Basidiomycete fungi also synthesize polyacetylenes that use crepenynate and dehydrocrepenynate as the precursor fatty acids. In comparison to the lack of these precursors seen in higher plant tissues, it is well known that they accumulate, and undergo further metabolism mainly into short chain (C8-C11) allenes, which is characteristic of the basidiomycete species (reviewed in Jones and Thaller, 1978).
  • PAFAs that have stearolic acid (CI 8: 1 ⁇ 9 ⁇ ) or ximenynic acid (or santalbic acid, 018:2 ⁇ 9 ⁇ ,11 ⁇ ) as the precursor have been identified mainly in roots of plant species belonging to the order Santales, including families Santalaceae, Olacaceae, Opiliaceae, Balanophoraceae and Loranthaceae (Hatt et al, 1967). They are all hemiparasitic, each species tapping on their preferred host plants mainly through the root system for nutrients and water. In contrast to plants that produce crepenynate- related polyacetylenes, Santales polyacetylenes are detected in their linear fatty acid form.
  • Ximenynic acid is only found in the seed where again there is no presence of PAFAs in the stored oil body (Bu-Lock and Smith, 1963).
  • PAFAs PAFA with the triple bond starting at the ⁇ 9 position (oropheic acid, 17-octadecene-9,l l ,13- triynoic acid) from leaves of Orophea enneandra and stem bark of Mitrephora celebica, both belonging to the Annonaceae family (order Magnoliales) (Cavin et al, 1998; Zgoda et al., 2001).
  • moss and liverwort species produce acetylenic fatty acids with a triple bond in the ⁇ 6 position (Kohn et al., 1987; Kohn et al., 1988). These ⁇ 6 acetylenic fatty acids are found in the triacylglycerol fraction to varying percentages in the moss species (Kohn et al., 1987), and are also found in the mono- and di- galactodiacyl glycerol fraction of a liverwort species Ricca duplex (Kohn et al., 1988). In R.
  • Marine sponges and their associated microorganisms produce a very wide range of polyacetylene compounds many of which have attracted attention in the past decade for potent anticancer and antibiotic activities (reviewed in Minto and Blacklock. 2008).
  • Polyacetylenes have been detected in bacteria but with less frequency and diversity and with structures unique to their group.
  • Much of the polyacetylenic products formed in bacteria and marine organisms are polyketides, a large grouping of secondary metabolites synthesised in organisms via enzyme complexes know as polyketide synthetases (Minto and Blacklock, 2008).
  • some of the polyacetylene products in sponges for example, are thought to originate in symbionts or taken in through the diet.
  • enediyne A family of antibiotics that contains a core with two triple bonds conjugated to a double bond (termed enediyne) are produced by actmomycetes (reviewed in Smith and Nicolaou, 1996). Such enediyne antibiotics have shown great potential for use as antitumor agents (reviewed in Gredicak and Jeric, 2007). Much of the production of microbial and marine polyacetylenic products is thought to occur via enzyme complexes known as polyketide synthases. The genes within some polyketide megaclusters responsible for the formation of enediyne compounds have been cloned (Minto and Blacklock, 2008).
  • acetylenases are thought to be the main enzymes involved in production of (poly)acetylenes in plants, moss and insects.
  • Acetylenases belong to a large family of non-heme diiron oxidoreducing enzymes termed desaturases.
  • Desaturases remove two hydrogen atoms from adjacent carbons in a fatty acid chain to form a carbon-carbon double bond.
  • There are two mam structural groups of desaturases - the soluble type that have been found only in plant plastids, and the transmembrane type that is further categorized into several different types depending on amino acid sequence similarity and the regiospecificity of the carbon chain (reviewed in Sperling et al., 2003).
  • Acetylenases remove two more hydrogen atoms from an existing carbon-carbon double bond to create a triple bond unsaturation. Since the discovery and functional characterization of the first acetylenase from Crepis alpina in 1998 (Lee et al., 1998; W098/46762) there have been three other acetylenase genes reported; all belong to the transmembrane form of desaturase.
  • a gene coding for an acyl-CoA desaturase-like enzyme was identified from total RNA isolated from the female processducy moth (Thaumetopoea pityocampa) pheromone gland (Serra et al., 2007). Yeast expression confirmed this enzyme to have three activities: as a ⁇ 11 desaturase, ⁇ 11 acetylenase, and ⁇ 13 desaturase. This enzyme is the first and only reported animal acetylenase to date.
  • the present inventors have identified enzymes, and polynucleotides encoding therefor, that can be expressed in cells to conjugate or acetylenate fatty acids.
  • the present invention provides a recombinant cell comprising at least two exogenous polynucleotides selected from;
  • each polynucleotide is operably linked to one or more promoters that are capable of directing expression of said polynucleotides in the cell.
  • the cell comprises;
  • the first polypeptide converts linoleic acid to crepenynic acid.
  • the efficiency of conversion of linoleic acid to crepenynic acid in the cell of the invention is at least 0.1% or at least 0.2% or at least 0.3%.
  • the first polypeptide also has ⁇ 12 desaturase activity.
  • the first polypeptide also converts oleic acid to linoleic acid and/or linoleidic acid.
  • the efficiency of conversion of oleic acid to linoleic acid in the cell of the invention is at least 25% or at least 30% or at least 33%.
  • the first polypeptide comprises;
  • amino acids having a sequence which is at least 50% identical to any one or more of SEQ ID NOs:4 to 7 or 50, and/or
  • the first polypeptide comprises; i) amino acids having a sequence as set forth in SEQ ID NO:4,
  • amino acids having a sequence which is at least 50% identical to SEQ ID NO:4, and/or
  • the cell is a plant cell and the first polypeptide comprises;
  • amino acids having a sequence which is at least 50% identical to any one or more of SEQ ID NOs:5 to 7 or 50, and/or
  • iii a biologically active fragment of i) or ii). More preferably,
  • amino acids having a sequence which is at least 50% identical to SEQ ID NO:6, and/or
  • the second polypeptide converts crepenynic acid to dehydrocrepenynate and/or converts ene-diynoic acid to ene diyne-ene, preferably both.
  • the efficiency of conversion of crepenynic acid to dehydrocrepenynate in the cell of the invention is at least 30% or at least 40% or at least 50%.
  • the efficiency of conversion of ene-diynoic acid to ene diyne-ene in the cell of the invention is at least 10% or at least 20% or at least 28%.
  • the second polypeptide has no detectable ⁇ 12 desaturase activity.
  • the second polypeptide comprises;
  • amino acids having a sequence which is at least 50% identical to SEQ ID NO:3, and/or
  • the second polypeptide comprises;
  • amino acids having a sequence which is at least 50% identical to SEQ ID NO:48, and/or
  • the cell also comprises the third polypeptide.
  • the second polypeptide at least has ⁇ 14 conjugase activity.
  • the ⁇ 14 acetylenase activity of the third polypeptide converts dehydrocrepenynate to ene-diynoic acid.
  • the efficiency of conversion of dehydrocrepenynate to ene-diynoic acid in the cell of the invention is at least 0.8% or at least 1.3% or at least 1.8%.
  • the ⁇ 9 acetylenase activity of the third polypeptide converts crepenynate to the methylene interrupted diacetylenic product C18:2 9A,12A.
  • the efficiency of conversion of crepenynate to the methylene interrupted diacetylenic product CI 8:2 9A,12A in the cell of the invention is at least 1 % or at least 1.5% or at least 2%.
  • the third polypeptide comprises;
  • amino acids having a sequence as set forth in SEQ ID NO: l or SEQ ID NO:2 ii) amino acids having a sequence which is at least 50% identical to one or both of SEQ ID NO: l or SEQ ID NO:2, and/or
  • the third polypeptide at least has ⁇ 14 acetylenase activity.
  • the cell comprises the first, second and third exogenous polynucleotides, and converts oleic acid to ene-diynoic acid and/or ene diyne-ene.
  • the cell also comprises one or more, preferably all of, linoleic acid, crepenynic acid, and dehydrocrepenynate.
  • this cell has an increased level of one or more, preferably all of, linoleic acid, crepenynic acid, dehydrocrepenynate, ene-diynoic acid and ene diyne-ene relative to a corresponding cell lacking the first, second and third exogenous polynucleotides.
  • the cell comprises the first and second exogenous polynucleotides, and converts oleic acid to dehydrocrepenynate.
  • this cell has an increased level of dehydrocrepenynate relative to a corresponding cell lacking the first and second exogenous polynucleotides.
  • the cell comprises the first and third exogenous polynucleotides, and converts oleic acid to methylene interrupted diacetylenic product C18:2 9A,12A.
  • this cell has an increased level of methylene interrupted diacetylenic product C18:2 9A,12A relative to a corresponding cell lacking the first and third exogenous polynucleotides.
  • the cell may comprise further exogenous polynucleotides involved in fatty acid synthesis and/or incorporation of fatty acids into other compounds such as TAGs.
  • further exogenous polynucleotides which can be present in a cell of the invention include, but are not limited to, those encoding diacylglycerol acyltransferase (DGAT), glycerol-3 -phosphate acyltransferase (GPAT), 1-acyl- glycerol-3-phosphate acyltransferase (LPAAT), acyl-CoA:lysophosphatidylcholine acyltransferase (LPCAT), phospholipase A 2 (PLA 2 ), phospholipase C (PLC), phospholipase D (PLD), CDP-choline diacylglycerol choline phosphotransferase (CPT), phoshatidylcholine diacylglycerol acyl
  • the cell may comprise an introduced mutation or an exogenous polynucleotide which down regulates the production and/or activity of an endogenous enzyme.
  • This can be particularly useful to promote the formation of the conjugated and/or acetylenated fatty acids by reducing the activity of the enzymes which may convert the relevant substrate, such as oleic acid, to fatty acids which are not a substrate for a polypeptide of the invention.
  • Examples of endogenous enzymes which can be down regulated in a cell of the invention include, but are not limited to, DGAT, GPAT, LPAAT, LPCAT, PLA 2 , PLC, PLD, CPT, PDAT, a fatty acid reductase, a fatty acid desaturase such as a ⁇ 15 desaturase, a fatty acid elongase such as an FAEI elongase, a wax synthase or a combination of two or more thereof.
  • the exogenous polynucleotide which down regulates the production and/or activity of an endogenous enzyme can be, for example, an antisense polynucleotide, a sense polynucleotide, a catalytic polynucleotide, a microRNA, a polynucleotide which encodes a polypeptide which binds the endogenous enzyme and a double stranded RNA.
  • the exogenous polynucleotide which down regulates the production and/or activity of an endogenous enzyme does not significantly effect the production and/or activity of an enzyme encoded by an exogenous polynucleotide in the cell.
  • the cell is a eukaryotic cell.
  • a eukaryotic cell examples include, but are not limited to, a plant cell, a mammalian cell, an insect cell, or a cell suitable for fermentation.
  • the cell is in a plant or part thereof.
  • the part is a seed, fruit, tuber, root, or a vegetative part of a plant.
  • the vegetative of the plant may be an aerial plant part or a green part such as a leaf or stem.
  • the plant is an oilseed plant or part thereof.
  • the present invention provides a substantially purified and/or recombinant polypeptide which is a ⁇ 9 and/or ⁇ 14 acetylenase.
  • the polypeptide at least has ⁇ 14 acetylenase activity, more preferably both ⁇ 9 and ⁇ 14 acetylenase activity.
  • the polypeptide of the above aspect converts dehydrocrepenynate to ene-diynoic acid, and/or converts crepenynate to the methylene interrupted diacetylenic product C18:2 9A,12A, preferably both. More preferably, the polypeptide comprises;
  • amino acids having a sequence as set forth in SEQ ID NO: l or SEQ ID NO:2 ii) amino acids having a sequence which is at least 50% identical to one or both of SEQ ID NO: l or SEQ ID NO:2, and/or
  • the present invention provides a substantially purified and/or recombinant polypeptide which is a ⁇ 14 conjugase and/or ⁇ 16 conjugase.
  • the polypeptide at least has ⁇ 14 conjugase activity, more preferably both ⁇ 14 and ⁇ 16 conjugase activity.
  • the conjugase has no detectable ⁇ 12 desaturase activity.
  • the polypeptide of the above aspect converts crepenynic acid to dehydrocrepenynate and/or converts ene-diynoic acid to ene diyne- ene, preferably both. More preferably, the polypeptide comprises;
  • amino acids having a sequence which is at least 50% identical to SEQ ID NO:3, and/or
  • the present invention provides a substantially purified and/or recombinant polypeptide which is ⁇ 12 acetylenase, wherein the polypeptide comprises; i) amino acids having a sequence as set forth in SEQ ID NO:4,
  • the polypeptide of the above aspect converts linoleic acid to crepenynic acid.
  • the polypeptide also has ⁇ 12 desaturase activity.
  • a polypeptide of the invention comprises amino acids having a sequence which is at least 90% identical, more preferably at least 95% identical and more preferably at least 99% identical, to any one or more of the sequences set forth in SEQ ID NOs:l to 4.
  • a polypeptide of the invention is able to act on an acyl-CoA substrate.
  • a polypeptide of the invention when produced recombinantly in a cell, particularly a yeast cell, a polypeptide of the invention as the corresponding efficiency of conversion of the relevant substrate(s) and product(s) as defined above for a recombinant cell of the invention.
  • a polypeptide of the invention can be isolated from an insect of the Order Coleoptera. More preferably, a polypeptide of the invention can be isolated from an insect of the Family Cantharidae. Even more preferably, the insect is a species of Chauliognathus such as Chauliognathus lugubris.
  • a polypeptide of the invention may be a fusion protein further comprising at least one other polypeptide.
  • the at least one other polypeptide may be a polypeptide that enhances the stability of a polypeptide of the present invention, or a polypeptide that assists in the purification of the fusion protein.
  • the present invention provides an isolated and/or exogenous polynucleotide comprising;
  • ii) a sequence of nucleotides encoding a polypeptide of the invention, iii) a sequence of nucleotides which is at least 50% identical to ⁇ ) or ii), and/or iv) a sequence of nucleotides which hybridizes to any one of i) to iii) under stringent conditions.
  • the polynucleotide encodes a ⁇ 9 and/or ⁇ 14 acetylenase and comprises;
  • iii a sequence of nucleotides which is at least 50% identical to ⁇ ), and/or iv) a sequence of nucleotides which hybridizes to any one of i) to iii) under stringent conditions.
  • the polynucleotide encodes a A14 and/or ⁇ 16 conjugase and comprises;
  • iii a sequence of nucleotides which is at least 50% identical to ⁇ ), and/or iv) a sequence of nucleotides which hybridizes to any one of i) to iii) under stringent conditions.
  • the polynucleotide encodes a ⁇ 12 acetylenase and comprises;
  • iii a sequence of nucleotides which is at least 50% identical to ⁇ ), and/or iv) a sequence of nucleotides which hybridizes to any one of i) to iii) under stringent conditions.
  • the present invention provides a vector comprising a polynucleotide of the invention.
  • the vector is an expression vector, wherein the polynucleotide is operably linked to a promoter.
  • the present invention provides a recombinant cell comprising a recombinant polypeptide of the invention, an exogenous polynucleotide of the invention and/or a vector of the invention.
  • the cell is a eukaryotic cell. Examples include, but are not limited to, a plant cell, a mammalian cell, an insect cell, or a cell suitable for fermentation.
  • the method further comprises isolating the polypeptide.
  • the present invention provides a transgenic non-human organism, or part thereof, comprising a cell of the invention.
  • the organism is a transgenic plant.
  • the transgenic plant is more resistant to an infection when compared to a corresponding plant lacking the cell.
  • a polynucleotide of the invention is stably integrated into the genome of the cell.
  • a plant seed comprising a cell of the invention.
  • the oil comprises one or both of crepenynic acid and dehydrocrepenynate.
  • the oil also comprises polyacetylenated fatty acid.
  • the polyacetylenated fatty acid comprises one or both of ene-diynoic acid and ene diyne-ene.
  • the oil is seedoil.
  • the present invention provides acetylenated fatty acid produced by, or obtained from, any one or more of a cell of the invention, a transgenic non-human organism, or part thereof, of the invention, a seed of the invention, and an extract or portion of any one thereof.
  • the present invention provides a method of producing oil comprising acetylenated fatty acids, the method comprising extracting oil from any one or more of a cell of the invention, a transgenic non-human organism, or part thereof, of the invention, a seed of the invention, and an extract or portion of any one thereof.
  • the acetylenated fatty acid comprises one or both of crepenynic acid and dehydrocrepenynate.
  • the fatty acid is polyacetylenated.
  • the polyacetylenated fatty acid comprises one or both of ene-diynoic acid and ene diyne-ene.
  • the method further comprises obtaining a transgenic non- human organism, or part thereof, of the invention, or a seed of the invention.
  • the present invention provides a composition comprising any one or more of a cell of the invention, a polypeptide of the invention, a polynucleotide of the invention, oil of the invention, a fatty acid of the invention, and an extract or portion of any one thereof.
  • feedstuffs, cosmetics or chemicals comprising any one or more of a cell of the invention, a transgenic non-human organism, or part thereof, of the invention, a seed of the invention, oil of the invention, a fatty acid of the invention, a composition of the invention, and an extract or portion of any one thereof.
  • the present invention provides a method of producing a feedstuff, the method comprising admixing any one or more of a cell of the invention, a transgenic non-human organism, or part thereof, of the invention, a seed of the invention, oil of the invention, a fatty acid of the invention, a composition of the invention, and an extract or portion of any one thereof, with at least one other food ingredient.
  • the present invention provides a method of producing seed, the method comprising:
  • the present invention provides a fermentation process comprising the steps of:
  • a vessel containing a liquid composition comprising a cell of the invention, or a transgenic non-human organism of the invention, which is suitable for fermentation, and constituents required for fermentation and fatty acid biosynthesis, and
  • a cell of the invention a transgenic non-human organism, or part thereof, of the invention, a seed of the invention, oil of the invention, a fatty acid of the invention, a composition of the invention, and an extract or portion of any one thereof, for the manufacture of an industrial product.
  • the product is a lubricant or a polymer.
  • the present invention provides a method of treating and/or preventing a condition which would benefit from an acetylenated fatty acid, the method comprising administering to a subject any one or more of a cell of the invention, a polypeptide of the invention, a polynucleotide of the invention, a vector of the invention, a transgenic non-human organism, or part thereof, of the invention, a seed of the invention, oil of the invention, a fatty acid of the invention, a composition of the invention, and an extract or portion of any one thereof.
  • conditions which may be treated and/or prevented include, but are not limited to, type 2 diabetes, cancer or an infection.
  • the present invention provides a process for selecting a nucleic acid molecule encoding a polypeptide with ⁇ 9 and/or ⁇ 14 acetylenase activity, the process comprising;
  • nucleic acid molecule operably linked to a promoter which is active in the cell, wherein the nucleic acid molecule encodes a polypeptide comprising amino acids having a sequence that is at least 50% identical to one or both of the sequences set forth in SEQ ID NO: 1 or SEQ ID NO:2,
  • the present invention provides a process for selecting a nucleic acid molecule encoding a polypeptide with ⁇ 14 and/or ⁇ 16 conjugase activity, the process comprising;
  • nucleic acid molecule operably linked to a promoter which is active in the cell, wherein the nucleic acid molecule encodes a polypeptide comprising amino acids having a sequence that is at least 50% identical to the sequences set forth in SEQ ID NO:3,
  • the present invention provides a process for selecting a nucleic acid molecule encoding a polypeptide with ⁇ 12 acetylenase activity, the process comprising;
  • nucleic acid molecule operably linked to a promoter which is active in the cell, wherein the nucleic acid molecule encodes a polypeptide comprising amino acids having a sequence that is at least 50% identical to the sequences set forth in SEQ ID NO:4,
  • the polypeptide is an insect polypeptide or mutant thereof. Also provided is a substantially purified antibody, or fragment thereof, that specifically binds a polypeptide of the invention.
  • Figure 1 Yeast FAME analysis by GC/MS
  • A chromatogram showing the production of CI 8:3 Z9,12A,Z14 (unequivocally identified by the product having an identical retention time and mass spectrum as a purchased standard chemical) in yeast expressing CL4 and fed with exogenous fatty acid
  • B chromatogram showing production of the methylene interrupted diacetylenic fatty acid CI 8:2 9A,12A by CL2 expressed in yeast
  • C the empty vector pYES2. All samples were fed with exogenous crepenynic acid (CI 8:2 Z9,12A).
  • FIG. 1 Yeast FAME analysis by GC/MS
  • A chromatogram showing production of the conjugated diacetylenic fatty acid CI 8:3 Z9,12A,14A by CL2 expressed in yeast
  • B the empty vector pYES2. Both samples were fed with exogenous CI 8:3 Z9,12A,Z14.
  • C The mass spectrum of the conjugated diacetylenic fatty acid methyl ester eluting at 19.9 min. CL2 acts on C18:3 Z9,12A,Z14 to produce a peak, at 19.9 min in the above chromatogram.
  • Figure 3 Conversion pathway from oleic acid to the ene-diynoic acid (CI 8:3 Z9,12A,14A) and ene diyne-ene (C18:4 Z9, 12A, 14A, Z9) catalysed by the soldier beetle ⁇ Chauliognathus lugubris) enzymes CLIO, CL4 and CL2.
  • Figure 4. N. benthamiana FAME analysis by GC/MS (A) chromatogram showing fatty acid profile of leaf expressing C. lugubris CL4 gene and fed with exogenous C18:2 Z9,12A and producing the conjugated fatty acid product C18:3 Z9,12A,Z14. (B) chromatogram of wild type leaf fed exogenous C18:2 Z9.12A.
  • SEQ ID NO:2 Amino acid sequence of variant 2 of Chauliognathus lugubris ⁇ 9/ ⁇ 14 acetylenase.
  • SEQ ID NO:3 Amino acid sequence of Chauliognathus lugubris ⁇ 14/ ⁇ 16 conjugase.
  • SEQ ID NO:4 Amino acid sequence of Chauliognathus lugubris ⁇ 12 acetylenase.
  • SEQ ID NO:5 Amino acid sequence of Helianthus annus ⁇ 12 acetylenase.
  • SEQ ID NO:6 Amino acid sequence of Crepis alpina ⁇ 12 acetylenase.
  • SEQ ID NO:7 Amino acid sequence of Hedera helix All acetylenase.
  • SEQ ID NO: 10 Polynucleotide encoding Chauliognathus lugubris ⁇ 14/ ⁇ 16 conjugase.
  • SEQ ID NO:l 1 Polynucleotide encoding Chauliognathus lugubris ⁇ 12 acetylenase.
  • SEQ ID NO: 12 Polynucleotide encoding Helianthus annus ⁇ 12 acetylenase (Genbank Accession AY166773).
  • SEQ ID NO: 13 Polynucleotide encoding Crepis alpina ⁇ 12 acetylenase (Genbank Accession Yl 6285).
  • SEQ ID NO: 14 Polynucleotide encoding Hedera helix All acetylenase (Genbank Accession AY166772).
  • SEQ ID NO:48 Amino acid sequence of Cantharellus formosus All and ⁇ 14 desaturase.
  • SEQ ID NO:49 Polynucleotide encoding Cantharellus formosus All and ⁇ 14 desaturase (Genbank Accession HM036206).
  • SEQ ID NO:50 Amino acid sequence of Cantharellus formosus All acetylenase.
  • SEQ ID NO:51 Polynucleotide encoding Cantharellus formosus ⁇ 12 acetylenase (Genbank Accession HM036207).
  • fatty acid refers to a carboxylic acid (or organic acid), often with a long aliphatic tail, either saturated or unsaturated.
  • fatty acids typically have a carbon-carbon bonded chain of at least 8 carbon atoms in length, more preferably at least 12 carbons in length.
  • a fatty acid of the invention is, or is at least, 18 carbons in length.
  • Most naturally occurring fatty acids have an even number of carbon atoms because their biosynthesis involves acetate which has two carbon atoms.
  • the fatty acids may be in a free state (non-esterified) or in an esterified form such as part of a triglyceride, diacylglyceride, monoacylglyceride, acyl-CoA (thio-ester) bound or other bound form
  • the fatty acids of the invention may be esterified as a phospholipid such as a phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylglycerol, phosphatidylinositol or diphosphatidylglycerol forms.
  • Polyacetylenated fatty acids comprises two or more triple bonds.
  • a polyacetylenated fatty acid produced by a method or cell of the invention comprises two triple bounds. Examples of polyacetylenated fatty acids are ene-diynoic acid and ene diyne-ene ( Figure 3).
  • acetylenase or "fatty acid acetylenase” refers to an enzyme which introduces a triple bond into a fatty acid substrate, and thus has “acetylenase activity".
  • a ⁇ 12 acetylenase incorporates a triple bond at the 12 th position from the carboxyl end of a fatty acid substrate
  • a ⁇ 9 acetylenase incorporates a triple bond at the 9 th position from the carboxyl end of a fatty acid substrate
  • a ⁇ 14 acetylenase incorporates a triple bond at the 14 th position from the carboxyl end of a fatty acid substrate.
  • conjugase refers to an enzyme capable of forming a conjugated bond in the acyl chain of a fatty acid, and thus has “conjugase activity".
  • a ⁇ 14 conjugase of the invention incorporates a double bond at the 14 th position from the carboxyl end of a fatty acid substrate which comprises a triple bond between the 12 th and 13 th carbons.
  • a ⁇ 16 conjugase of the invention incorporates a double bond at the 16 th position from the carboxyl end of a fatty acid substrate which comprises a triple bond between the 12 th and 13 th carbons and a triple bond between the 14 th and 15 th carbons.
  • the term "desaturase” or "fatty acid desaturase” refers to an enzyme which is capable of introducing a carbon-carbon double bond into the acyl group of a fatty acid substrate which is typically in an esterified form such as, for example, fatty acid CoA esters.
  • the acyl group may be esterified to a phospholipid such as phosphatidylcholine (PC), or to acyl carrier protein (ACP), or in a preferred embodiment to CoA.
  • Desaturases generally may be categorized into three groups accordingly.
  • desaturases include, but are not limited to, ⁇ 12 desaturases, ⁇ 4 desaturases, ⁇ 5 desaturases, ⁇ 6 desaturases, ⁇ 8 desaturases, ⁇ x>3 desaturases and ⁇ 17 desaturases.
  • ⁇ 12 desaturase refers to a protein which performs a desaturase reaction that introduces a carbon-carbon double bond at the 12 th position from the carboxyl end of a fatty acid substrate.
  • oil refers to a composition which comprises at least 60% (w/w) lipid.
  • Oil is typically a liquid at room temperature.
  • the lipid predominantly comprises fatty acids which are, or are at least, 18 carbons in length.
  • the fatty acids are typically in an esterified form, such as for example as triacylglycerols, acyl-CoA or phospholipid.
  • the fatty acids may be free fatty acids and/or be found as monoacylglycerols (MAGs), diacylglycerols (DAGs) and/or triacylglycerols (TAGs).
  • MAGs monoacylglycerols
  • DAGs diacylglycerols
  • TAGs triacylglycerols
  • "Oil” of the invention may be "seedoil” if it is obtained from seed. Oil may be present in or obtained from cells, tissues, organs (such as plant vegetative tissue) or organisms other than seeds, in which case the oil is not
  • the level of production of fatty acid in the recombinant cell may also be expressed as a conversion efficiency, i.e., the amount of the fatty acid formed as a percentage of one or more substrate fatty acids (see, for example, Table 3). Unless otherwise indicated, the stated conversion efficiences are prefereably in relation to expression of the polypeptide(s) in a yeast cell.
  • the term "seedoil” refers to a composition obtained from the seed/grain of a plant which comprises at least 60% (w/w) lipid.
  • Seedoil is typically a liquid at room temperature.
  • the lipid predominantly (>50%) comprises fatty acids that are at least 16 carbons in length. More preferably, at least 50% of the total fatty acids in the seedoil are CI 8 fatty acids.
  • the fatty acids are typically in an esterified form, such as for example as TAGs, acyl-CoA or phospholipid.
  • the fatty acids may be free fatty acids and/or be found as monoacylglycerols (MAGs), diacylglycerols (DAGs) and/or triacylglycerols (TAGs).
  • MAGs monoacylglycerols
  • DAGs diacylglycerols
  • TAGs triacylglycerols
  • Seedoil of the invention can form part of the grain/seed or portion thereof. Alternatively, seedoil of the invention has been extracted from grain/seed.
  • "seedoil” of the invention is “substantially purified” or “purified” oil that has been separated from one or more other lipids, nucleic acids, polypeptides, or other contaminating molecules with which it is associated in its native state.
  • substantially purified oil is at least 60% free, more preferably at least 75% free, and more preferably at least 90% free from other components with which it is naturally associated.
  • Seedoil of the invention may further comprise non-fatty acid molecules such as, but not limited to, sterols.
  • the seedoil is canola oil (Brassica napus, Brassica rapa ssp.), mustard oil ⁇ Brassica juncea), other Brassica oil, sunflower oil (Helianthus annus), linseed oil (Linum usitatissimum), soybean oil ⁇ Glycine max), safflower oil (Carthamus tinctorius), corn oil (Zea mays), tobacco oil (Nicotiana tabacum), peanut oil (Arachis hypogaea), palm oil, cottonseed oil (Gossypium hirsutum), coconut oil (Cocos nucifera), avocado oil (Persea americana), olive oil (Olea europaea), cashew oil (Anacardium occidentale), macadamia oil (Macadamia inter grifolia), almond oil (Primus amygdalus) or Arabidopsis seed oil (Arabidopsis thaliana).
  • canola oil Brassica napus
  • Seedoil may be extracted from seed by any method known in the art. This typically involves extraction with nonpolar solvents such as diethyl ether, petroleum ether, chlorofo rm/methanol or butanol mixtures. Lipids associated with the starch in the gram may be extracted with water-saturated butanol.
  • the seedoil may be "de-gummed” by methods known in the art to remove polysaccharides or treated in other ways to remove contaminants or improve purity, stability or colour.
  • the TAGs and other esters in the oil may be hydrolysed to release free fatty acids, or the oil hydrogenated or treated chemically or enzymatically as known in the art.
  • a “recombinant cell”, “genetically modified cell” or variations thereof refers to a cell that contains a gene construct ("transgene") not found in a wild-type cell of the same species, variety or cultivar.
  • transgenic seed refers to a seed that contains a gene construct ("transgene") not found in a wild-type seed from the same species, variety or cultivar of plant.
  • transgenic plant refers to a plant that contains a gene construct ("transgene") not found in a wild-type plant of the same species, variety or cultivar.
  • transgene as referred to herein has the normal meaning in the art of biotechnology and includes a genetic sequence which has been produced or altered by recombinant DNA or RNA technology and which has been introduced into the organism and/or cell.
  • the transgene may include genetic sequences derived from, for example, a plant cell.
  • the transgene has been introduced into the organism and/or cell by human manipulation such as, for example, by transformation but any method can be used as one of skill in the art recognizes.
  • corresponding refers to a cell, or non-human organism or part thereof that has the same or similar genetic background as a cell, or non-human organism or part thereof of the invention but that has not been modified as described herein (for example, the cell, or non-human organsim or part thereof lacks an exogenous polynucleotide encoding an acetylenase or conjugase).
  • a corresponding cell or, non-human organism or part thereof can be used as a control to compare levels of nucleic acid expression, or the extent and nature of trait modification, for example acetylenated and/or conjugated fatty acid production and/or content, with a cell, or non- human organism or part thereof modified as described herein.
  • the term "can be isolated from” means that the polynucleotide or encoded polypeptide is naturally produced by an organism, particularly Chauliognathus sp., such as Chauliognathus lugubris.
  • extract and/or “part” refer to any portion of the cell or organism such as a plant.
  • An “extract” typically involves the disruption of cells and partial purification of the resulting material, whereas “part” typically refers to the isolated portion of an organism (such as plant seeds or leaves).
  • the "extract” or “part” will comprise at least one acetylenated and/or conjugated fatty acid. Extracts and parts can be prepared using standard techniques of the art.
  • an exogenous polynucleotide which down regulates the production and/or activity of an endogenous enzyme refers to a polynucleotide that encodes an RNA molecules that down regulates the production and/or activity (for example, encoding an siRNA), or the exogenous polynucleotide itself down regulates the production and/or activity (for example, an siRNA is delivered to directly to, for instance, a cell).
  • an siRNA for example, encoding an siRNA
  • the phrase "does not significantly effect the production and/or activity of an enzyme” means that the level of activity of the enzyme is at least 75%, more preferably at least 90%, of the level of an isogenic recombinant cell lacking the exogenous polynucleotide that down regulates the production and/or activity of an endogenous enzyme.
  • antibody includes fragments of whole antibodies which retain their binding activity for a target analyte, as well as compounds comprising said fragments. Such fragments include Fv, F(ab') and F(ab') 2 fragments, as well as single chain antibodies (scFv).
  • Antibodies of the invention may be, for example diabodies, triabodies, tetrabodies, monoclonal or polyclonal, and can be produced using standard procedures in the art.
  • treating include administering a therapeutically effective amount of a compound(s) described herein sufficient to reduce or eliminate at least one symptom of the specified condition.
  • preventing include administering a therapeutically effective amount of a compound(s) described herein sufficient to stop or hinder the development of at least one symptom of the specified condition.
  • the term "subject" refers to any organism which may benefit from having increased levels of a fatty acid as defined herein.
  • the subject is a mammal.
  • the subject is a human.
  • Other preferred embodiments include companion animals such as cats and dogs, as well as livestock animals such as horses, cattle, sheep and goats.
  • the invention provides polypeptides which may be purified or recombinant.
  • substantially purified polypeptide or “purified polypeptide” we mean a polypeptide that has generally been separated from the lipids, nucleic acids, other peptides, and other contaminating molecules with which it is associated in a cell in which it is produced or in its native state.
  • the substantially purified polypeptide is at least 60% free, more preferably at least 75% free, and more preferably at least 90% free from other components in the cell in which it is produced or with which it is naturally associated.
  • recombinant in the context of a polypeptide refers to the polypeptide when produced by a cell, or in a cell-free expression system, in an altered amount or at an altered rate, compared to its native state if it is produced naturally.
  • the cell is a cell that does not naturally produce the polypeptide.
  • the cell may be a cell which comprises a non-endogenous gene that causes an altered amount of the polypeptide to be produced.
  • a recombinant polypeptide of the invention includes polypeptides in the cell, tissue, organ or organism, or cell-free expression system, in which it is produced i.e. a polypeptide which has not been purified or separated from other components of the transgenic (recombinant) cell in which it was produced, and polypeptides produced in such cells or cell-free systems which are subsequently purified away from at least some other components.
  • polypeptide and "protein” are generally used interchangeably.
  • the query sequence is at least 15 amino acids in length, and the GAP analysis aligns the two sequences over a region of at least 15 amino acids. More preferably, the query sequence is at least 50 amino acids in length, and the GAP analysis aligns the two sequences over a region of at least 50 amino acids. More preferably, the query sequence is at least 100 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 100 amino acids.
  • the query sequence is at least 250 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 250 amino acids. Even more preferably, the GAP analysis aligns two sequences over their entire length.
  • the polypeptide has an enzymatic activity of at least 10% of the activity of the reference polypeptide.
  • a "biologically active" fragment is a portion of a polypeptide of the invention which maintains a defined activity of a full-length reference polypeptide, for example possessing acetylenase or conjugase activity.
  • Biologically active fragments as used herein exclude the full-length polypeptide.
  • Biologically active fragments can be any size portion as long as they maintain the defined activity.
  • the biologically active fragment maintains at least 10% of the activity of the full length protein.
  • the polypeptide/enzyme comprises an amino acid sequence which is at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 76%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at
  • Amino acid sequence mutants of the polypeptides of the defined herein can be prepared by introducing appropriate nucleotide changes into a nucleic acid defined herein, or by in vitro synthesis of the desired polypeptide.
  • Such mutants include, for example, deletions, insertions or substitutions of residues within the amino acid sequence.
  • a combination of deletion, insertion and substitution can be made to arrive at the final construct, provided that the final polypeptide product possesses the desired characteristics.
  • Mutant (altered) polypeptides can be prepared using any technique known in the art.
  • a polynucleotide of the invention can be subjected to in vitro mutagenesis.
  • in vitro mutagenesis techniques include sub-cloning the polynucleotide into a suitable vector, transforming the vector into a "mutator" strain such as the E. coli XL-1 red (Stratagene) and propagating the transformed bacteria for a suitable number of generations.
  • the polynucleotides of the invention are subjected to DNA shuffling techniques as broadly described by Harayama (1998). Products derived from mutated/altered DNA can readily be screened using techniques described herein to determine if they possess acetylenase or conjugase activity.
  • the location of the mutation site and the nature of the mutation will depend on characteristic(s) to be modified.
  • the sites for mutation can be modified individually or in series, e.g., by (1) substituting first with conservative amino acid choices and then with more radical selections depending upon the results achieved, (2) deleting the target residue, or (3) inserting other residues adjacent to the located site.
  • Amino acid sequence deletions generally range from about 1 to 15 residues, more preferably about 1 to 10 residues and typically about 1 to 5 contiguous residues.
  • Substitution mutants have at least one amino acid residue in the polypeptide molecule removed and a different residue inserted in its place.
  • the sites of greatest interest for substitutional mutagenesis include sites identified as the active site(s).
  • Other sites of interest are those in which particular residues obtained from various strains or species are identical. These positions may be important for biological activity. These sites, especially those falling within a sequence of at least three other identically conserved sites, are preferably substituted in a relatively conservative manner. Such conservative substitutions are shown in Table 1 under the heading of "exemplary substitutions".
  • a mutant/variant polypeptide has only, or not more than, one or two or three or four conservative amino acid changes when compared to a naturally occurring polypeptide. Details of conservative amino acid changes are provided in Table 1. As the skilled person would be aware, such minor changes can reasonably be predicted not to alter the activity of the polypeptide when expressed in a recombinant cell.
  • a polypeptide of the invention has one, two, three, four, five, six or all of the following motifs; TAGXHRLWXH (incorporating the 1 st 'histidine box') (SEQ ID NO:41), YKARWPL (between 1 st and 2 nd histidine boxes) (SEQ ID NO:42), HRVHH (2 nd 'histidine box') (SEQ ID NO:43), YTETDADPXNAKRG (between 2 nd and 3 rd histidine boxes) (SEQ ID NO:44), WHNYHH (3 rd histidine box) (SEQ ID NO:45), AYDLK (Post 3 rd histidine box) (SEQ ID NO:46) and GDGSH (towards C-terminus) (SEQ ID NO:47).
  • TAGXHRLWXH incorporating the 1 st 'histidine box'
  • YKARWPL between 1 st and 2 nd histidine boxes
  • polypeptides defined herein which are differentially modified during or after synthesis, for example, by biotinylation, benzylation, glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. These modifications may serve to increase the stability and/or bioactivity of the polypeptide of the invention.
  • Polypeptides can be produced in a variety of ways, including production and recovery of natural polypeptides, production and recovery of recombinant polypeptides, and chemical synthesis of the polypeptides.
  • a recombinant polypeptide is produced by culturing a cell capable of expressing the polypeptide under conditions effective to produce the polypeptide.
  • the recombinant polypeptide may subsequently be secreted from the cell and recovered, or extracted from the cell and recovered, and is preferably purified away from contaminating molecules. It may or may not be further modified chemically or enzymatically.
  • a preferred cell to culture is a recombinant cell defined herein.
  • Effective culture conditions include, but are not limited to, effective media, bioreactor, temperature, pH and oxygen conditions that permit polypeptide production.
  • An effective medium refers to any medium in which a cell is cultured to produce a polypeptide defined herein.
  • Such medium typically comprises an aqueous medium having assimilable carbon, nitrogen and phosphate sources, and appropriate salts, minerals, metals and other nutrients, such as vitamins.
  • Cells defined herein can be cultured in conventional fermentation bioreactors, shake flasks, test tubes, microtiter dishes, and petri plates. Culturing can be carried out at a temperature, pH and oxygen content appropriate for a recombinant cell. Such culturing conditions are within the expertise of one of ordinary skill in the art.
  • a more preferred cell to produce the polypeptide is a cell in a plant, especially in a seed in a plant.
  • polynucleotides which may be, for example, a gene, an isolated polynucleotide, or a chimeric DNA. It may be DNA or RNA of genomic or synthetic origin, double-stranded or single-stranded, and combined with carbohydrate, lipids, protein or other materials to perform a particular activity defined herein.
  • polynucleotide is used interchangeably herein with the term “nucleic acid molecule”.
  • isolated polynucleotide we mean a polynucleotide which, if obtained from a natural source, has been separated from the polynucleotide sequences with which it is associated or linked in its native state, or a non-naturally occurring polynucleotide.
  • the isolated polynucleotide is at least 60% free, more preferably at least 75% free, and more preferably at least 90% free from other components with which it is naturally associated.
  • the term "gene” is to be taken in its broadest context and includes the deoxyribonucleotide sequences comprising the transcribed region and, if translated, the protein coding region, of a structural gene and including sequences located adjacent to the coding region on both the 5' and 3' ends for a distance of at least about 2 kb on either end and which are involved in expression of the gene.
  • the gene includes control signals such as promoters, enhancers, termination and/or polyadenylation signals that are naturally associated with a given gene, or heterologous control signals in which case the gene is referred to as a "chimeric gene".
  • sequences which are located 5' of the protein coding region and which are present on the mRNA are referred to as 5' non-translated sequences.
  • sequences which are located 3' or downstream of the protein coding region and which are present on the mRNA are referred to as 3' non-translated sequences.
  • the term "gene” encompasses both cDNA and genomic forms of a gene.
  • a genomic form or clone of a gene contains the coding region which may be interrupted with non-codmg sequences termed "introns" or “intervening regions” or “intervening sequences.
  • Introns are segments of a gene which are transcribed into nuclear RNA (hnRNA). Introns may contain regulatory elements such as enhancers.
  • Introns are removed or "spliced out” from the nuclear or primary transcript; introns therefore are absent in the messenger RNA (mRNA) transcript.
  • the mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide.
  • the term "gene” includes a synthetic or fusion molecule encoding all or part of the proteins of the invention described herein and a complementary nucleotide sequence to any one of the above.
  • endogenous is used herein to refer to a substance that is normally present or produced in an unmodified organism and/or cell at the same developmental stage as the organism and/or cell under investigation.
  • An “endogenous gene” refers to a native gene in its natural location in the genome of an organism.
  • recombinant nucleic acid molecule refers to a nucleic acid molecule which has been constructed or modified by recombinant DNA technology.
  • foreign polynucleotide or “exogenous polynucleotide” or “heterologous polynucleotide” and the like refer to any nucleic acid which is introduced into the genome of a cell by experimental manipulations.
  • Foreign or exogenous genes may be genes that are inserted into a non-native organism, native genes introduced into a new location within the native host, or chimeric genes.
  • a "transgene” is a gene that has been introduced into the genome by a transformation procedure.
  • transgenic and variations thereof include introducing genes into cells by transformation or transduction, mutating genes in cells and altering or modulating the regulation of a gene in a cell or organisms to which these acts have been done or their progeny.
  • a “genomic region” as used herein refers to a position within the genome where a transgene, or group of transgenes (also referred to herein as a cluster), have been inserted into a cell, or an ancestor thereof. Such regions only comprise nucleotides that have been incorporated by the intervention of man such as by methods described herein.
  • exogenous in the context of a polynucleotide refers to the polynucleotide when present in a cell in an altered amount compared to its native state.
  • the cell is a cell that does not naturally comprise the polynucleotide.
  • the cell may be a cell which comprises a non-endogenous polynucleotide resulting in an altered amount of production of the encoded polypeptide.
  • An exogenous polynucleotide of the invention includes polynucleotides which have not been separated from other components of the transgenic (recombinant) cell, or cell-free expression system, in which it is present, and polynucleotides produced in such cells or cell-free systems which are subsequently purified away from at least some other components.
  • the exogenous polynucleotide (nucleic acid) can be a contiguous stretch of nucleotides existing in nature, or comprise two or more contiguous stretches of nucleotides from different sources (naturally occurring and/or synthetic) joined to form a single polynucleotide.
  • chimeric polynucleotides comprise at least an open reading frame encoding a polypeptide of the invention operably linked to a promoter suitable of driving transcription of the open reading frame in a cell of interest.
  • the polynucleotide comprises a polynucleotide sequence which is at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%.
  • a polynucleotide of the present invention may selectively hybridise, under stringent conditions, to a polynucleotide that encodes a polypeptide of the present invention.
  • stringent conditions are those that (1) employ during hybridisation a denaturing agent such as formamide, for example, 50% (v/v) formamide with 0.1% (w/v) bovine serum albumin, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate at 42°C; or (2) employ 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 g/ml), 0.1% SDS and 10% dextran sulfate at 42°C in 0.2 x SSC
  • Polynucleotides of the invention may possess, when compared to naturally occurring molecules, one or more mutations which are deletions, insertions, or substitutions of nucleotide residues.
  • Polynucleotides which have mutations relative to a reference sequence can be either naturally occurring (that is to say, isolated from a natural source) or synthetic (for example, by performing site-directed mutagenesis or DNA shuffling on the nucleic acid as described above). It is thus apparent that polynucleotides of the invention can be either from a naturally occurring source or recombinant.
  • One embodiment of the present invention includes a recombinant vector, which comprises at least one polynucleotide molecule defined herein, inserted into any vector capable of delivering the polynucleotide molecule into a host cell.
  • Recombinant vectors include expression vectors.
  • Recombinant vectors contain heterologous polynucleotide sequences, that is polynucleotide sequences that are not naturally found adjacent to polynucleotide molecules defined herein that preferably are derived from a species other than the species from which the polynucleotide molecule(s) are derived.
  • the vector can be either RNA or DNA, either prokaryotic or eukaryotic, and typically is a viral vector, derived from a virus, or a plasmid.
  • Plasmid vectors typically include additional nucleic acid sequences that provide for easy selection, amplification, and transformation of the expression cassette in prokaryotic cells, e.g., pUC-derived vectors, pSK-derived vectors, pGEM-derived vectors, pSP-derived vectors, pBS- derived vectors, or binary vectors containing one or more T-DNA regions.
  • Additional nucleic acid sequences include origins of replication to provide for autonomous replication of the vector, selectable marker genes, preferably encoding antibiotic or herbicide resistance, unique multiple cloning sites providing for multiple sites to insert nucleic acid sequences or genes encoded in the nucleic acid construct, and sequences that enhance transformation of prokaryotic and eukaryotic (especially plant) cells.
  • the recombinant vector may comprise more than one polynucleotide defined herein, for example two or three polynucleotides of the invention in combination, each operably linked to expression control sequences that are operable in the cell of interest.
  • Such more than one polynucleotide of the invention are preferably covalently joined together in a single recombinant vector, which may then be introduced as a single molecule into a cell to form a recombinant cell according to the invention, and preferably integrated into the genome of the recombinant cell, for example in a transgenic plant.
  • the polynucleotides which are so joined will be inherited together as a single genetic locus in progeny of the recombinant cell or plant.
  • the recombinant vector or plant may comprise two or more such recombinant vectors, each containing multiple polynucleotides, for example wherein each recombinant vector comprises 2 or 3 polynucleotides.
  • operably linked refers to a functional relationship between two or more nucleic acid (e.g., DNA) segments. Typically, it refers to the functional relationship of transcriptional regulatory element (promoter) to a transcribed sequence.
  • a promoter is operably linked to a coding sequence, such as a polynucleotide defined herein, if it stimulates or modulates the transcription of the coding sequence in an appropriate cell.
  • promoter transcriptional regulatory elements that are operably linked to a transcribed sequence are physically contiguous to the transcribed sequence, i.e., they are cw-acting.
  • some transcriptional regulatory elements, such as enhancers need not be physically contiguous or located in close proximity to the coding sequences whose transcription they enhance.
  • each promoter may independently be the same or different.
  • Recombinant molecules such as the chimeric DNAs may also contain (a) one or more secretory signals which encode signal peptide sequences, to enable an expressed polypeptide defined herein to be secreted from the cell that produces the polypeptide or which provide for localisation of the expressed polypeptide, for example for retention of the polypeptide in the endoplasmic reticulum (ER) in the cell or transfer into a plastid, and/or (b) contain fusion sequences which lead to the expression of nucleic acid molecules as fusion proteins.
  • suitable signal segments include any signal segment capable of directing the secretion or localisation of a polypeptide defined herein.
  • Preferred signal segments include, but are not limited to, Nicotiana nectarin signal peptide (US 5,939,288), tobacco extensin signal or the soy oleosin oil body binding protein signal.
  • Recombinant molecules may also include intervening and/or untranslated sequences surrounding and/or within the nucleic acid sequences of nucleic acid molecules defined herein.
  • the nucleic acid construct desirably comprises a selectable or screenable marker gene as, or in addition to, the foreign or exogenous polynucleotide.
  • marker gene is meant a gene that imparts a distinct phenotype to cells expressing the marker gene and thus allows such transformed cells to be distinguished from cells that do not have the marker.
  • a selectable marker gene confers a trait for which one can "select” based on resistance to a selective agent (e.g., a herbicide, antibiotic, radiation, heat, or other treatment damaging to untransformed cells).
  • a screenable marker gene confers a trait that one can identify through observation or testing, i.e., by "screening” (e.g., ⁇ -glucuronidase, luciferase, GFP or other enzyme activity not present in untransformed cells).
  • the marker gene and the nucleotide sequence of interest do not have to be linked.
  • the actual choice of a marker is not crucial as long as it is functional (i.e., selective) in combination with the cells of choice such as a plant cell.
  • the marker gene and the foreign or exogenous polynucleotide of interest do not have to be linked, since co-transformation of unlinked genes as, for example, described in US 4,399,216 is also an efficient process in plant transformation.
  • bacterial selectable markers are markers that confer antibiotic resistance such as ampicillin, erythromycin, chloramphenicol or tetracycline resistance, preferably kanamycin resistance.
  • exemplary selectable markers for selection of plant transformants include, but are not limited to, a hyg gene which encodes hygromycin B resistance; a neomycin phosphotransferase (nptll) gene conferring resistance to kanamycin, paromomycin, G418; a glutathione-S-transferase gene from rat liver conferring resistance to glutathione derived herbicides as, for example, described in EP 256223; a glutamine synthetase gene conferring, upon overexpression, resistance to glutamine synthetase inhibitors such as phosphinothricin as, for example, described in WO 87/05327, an acetyltransferase gene from Streptomyces viridochromogenes conferring resistance to the selective
  • a bar gene conferring resistance against bialaphos as, for example, described in WO91/02071 ; a nitrilase gene such as bxn from Klebsiella ozaenae which confers resistance to bromoxynil (Stalker et al., 1988); a dihydro folate reductase (DHFR) gene conferring resistance to methotrexate (Thillet et al., 1988); a mutant acetolactate synthase gene (ALS), which confers resistance to imidazolinone, sulfonylurea or other ALS -inhibiting chemicals (EP 154,204); a mutated anthranilate synthase gene that confers resistance to 5-methyl tryptophan; or a dalapon dehalogenase gene that confers resistance to the herbicide.
  • a nitrilase gene such as bxn from Klebsiella ozaenae which confers resistance to bromoxynil (
  • Preferred screenable markers include, but are not limited to, a uidA gene encoding a ⁇ -glucuronidase (GUS) enzyme for which various chromogenic substrates are known, a ⁇ -galactosidase gene encoding an enzyme for which chromogenic substrates are known, an aequo rin gene (Prasher et al., 1985), which may be employed in calcium-sensitive bioluminescence detection; a green fluorescent protein gene (Niedz et al., 1995) or derivatives thereof; a luciferase (luc) gene (Ow et al., 1986), which allows for bioluminescence detection, and others known in the art.
  • reporter molecule as used in the present specification is meant a molecule that, by its chemical nature, provides an analytically identifiable signal that facilitates determination of promoter activity by reference to protein product.
  • the nucleic acid construct is stably incorporated into the genome of the cell, such as the plant cell.
  • the nucleic acid may comprise appropriate elements which allow the molecule to be incorporated into the genome, or the construct is placed in an appropriate vector which can be incorporated into a chromosome of the cell.
  • an expression vector is a DNA or RNA vector that is capable of transforming a host cell and of effecting expression of one or more specified polynucleotide molecule(s).
  • the expression vector is also capable of replicating within the host cell.
  • Expression vectors can be either prokaryotic or eukaryotic, and are typically viruses or plasmids.
  • Expression vectors of the present invention include any vectors that function (i.e., direct gene expression) in recombinant cells of the present invention, including in bacterial, fungal, endoparasite, arthropod, animal, and plant cells. Particularly preferred expression vectors of the present invention can direct gene expression in yeast and/or plant cells.
  • Expression vectors of the present invention contain regulator ⁇ ' sequences such as transcription control sequences, translation control sequences, origins of replication, and other regulatory sequences that are compatible with the recombinant cell and that control the expression of polynucleotide molecules of the present invention.
  • polynucleotides or vectors of the present invention include transcription control sequences.
  • Transcription control sequences are sequences which control the initiation, elongation, and termination of transcription.
  • Particularly important transcription control sequences are those which control transcription initiation, such as promoter, enhancer, operator and repressor sequences.
  • Suitable transcription control sequences include any transcription control sequence that can function in at least one of the recombinant cells of the present invention.
  • the choice of the regulator ⁇ ' sequences used depends on the target organism such as a plant and/or target organ or tissue of interest.
  • Such regulatory sequences may be obtained from any eukaryotic organism such as plants or plant viruses, or may be chemically synthesized.
  • a variety of such transcription control sequences are known to those skilled in the art.
  • Particularly preferred transcription control sequences are promoters active in directing transcription in plants, either constitutively or stage and/or tissue specific, depending on the use of the plant or parts thereof.
  • plant expression vectors include, for example, one or more cloned plant genes under the transcriptional control of 5' and 3' regulatory sequences and a dominant selectable marker.
  • Such plant expression vectors also can contain a promoter regulatory region (e.g., a regulatory region controlling inducible or constitutive, environmentally- or developmentally- regulated, or cell- or tissue-specific expression), a transcription initiation start site, a ribosome binding site, an RNA processing signal, a transcription termination site, and/or a polyadenylation signal.
  • a promoter regulatory region e.g., a regulatory region controlling inducible or constitutive, environmentally- or developmentally- regulated, or cell- or tissue-specific expression
  • Suitable promoters for constitutive expression in plants include, but are not limited to, the cauliflower mosaic virus (CaMV) 35 S promoter, the Figwort mosaic virus (FMV) 35S, the sugarcane bacilliform virus promoter, the commelina yellow mottle virus promoter, the light-inducible promoter from the small subunit of the ribulose- 1,5 -bis-phosphate carboxylase, the rice cytosolic triosephosphate isomerase promoter, the adenine phosphoribosyltransferase promoter of Arabidopsis, the rice actin 1 gene promoter, the mannopine synthase and octopine synthase promoters, the Adh promoter, the sucrose synthase promoter, the R gene complex promoter, and the chlorophyll ⁇ / ⁇ binding protein gene promoter. These promoters have been used to create DNA vectors that have been expressed in plants; see,
  • promoters utilized in the present invention have relatively high expression in these specific tissues.
  • promoters for genes with tissue- or cell-specific or -enhanced expression. Examples of such promoters reported in the literature include the chloroplast glutamine synthetase GS2 promoter from pea, the chloroplast fructose-1,6- biphosphatase promoter from wheat, the nuclear photosynthetic ST-LSl promoter from potato, the serine/threonine kinase promoter and the glucoamylase (CHS) promoter from Arabidopsis thaliana.
  • chloroplast glutamine synthetase GS2 promoter from pea
  • the chloroplast fructose-1,6- biphosphatase promoter from wheat
  • the nuclear photosynthetic ST-LSl promoter from potato
  • serine/threonine kinase promoter and the glucoamylase (CHS) promoter from Arabidopsis thaliana.
  • ribulose-l,5-bisphosphate carboxylase promoter from eastern larch (Larix laricina), the promoter for the Cab gene, Cab6, from pine, the promoter for the Cab-1 gene from wheat, the promoter for the Cab-1 gene from spinach, the promoter for the Cab 1R gene from rice, the pyruvate, orthophosphate dikinase (PPDK) promoter from Zea mays, the promoter for the tobacco Lhcbl*2 gene, the Arabidopsis thaliana Suc2 sucrose-Ff 0 symporter promoter, and the promoter for the thylakoid membrane protein genes from spinach (PsaD, PsaF, PsaE, PC, FNR, AtpC, AtpD, Cab, RbcS).
  • promoters for the chlorophyll ⁇ / ⁇ -binding proteins may also be utilized in the present invention, such as the promoters for LhcB gene and PsbP gene from white mustard (Sinapis alba).
  • the promoter is a plant storage organ specific promoter.
  • plant storage organ specific promoter refers to a promoter that preferentially, when compared to other plant tissues, directs gene transcription in a storage organ of a plant.
  • the promoter only directs expression of a gene of interest in the storage organ, and/or expression of the gene of interest in other parts of the plant such as leaves is not detectable by Northern blot analysis and/or RT-PCR.
  • the promoter drives expression of genes during growth and development of the storage organ, in particular during the phase of synthesis and accumulation of storage compounds in the storage organ.
  • Such promoters may drive gene expression in the entire plant storage organ or only part thereof such as the seedcoat, embryo or cotyledon(s) in seeds of dicotyledonous plants or the endosperm or aleurone layer of a seeds of monocotyledonous plants.
  • the plant storage organ specific promoter is a seed specific promoter.
  • the promoter preferentially directs expression in the cotyledons of a dicotyledonous plant or in the endosperm of a monocotyledonous plant, relative to expression in the embryo of the seed or relative to other organs in the plant such as leaves.
  • Preferred promoters for seed-specific expression include i) promoters from genes encoding enzymes involved in fatty acid biosynthesis and accumulation in seeds, such as desaturases and elongases, ii) promoters from genes encoding seed storage proteins, and iii) promoters from genes encoding enzymes involved in carbohydrate biosynthesis and accumulation in seeds.
  • Seed specific promoters which are suitable are the oilseed rape napin gene promoter (US 5,608,152), the Vicia faba USP promoter (Baumlein et al., 1991), the Arabidopsis oleosin promoter (WO 98/45461), the Phaseolus vulgaris phaseolin promoter (US 5,504,200), the Brassica Bce4 promoter (WO 91/13980) or the legumin B4 promoter (Baumlein et al., 1992), and promoters which lead to the seed-specific expression in monocots such as maize, barley, wheat, rye, rice and the like.
  • promoters which are suitable are the barley lpt2 or lptl gene promoter (WO 95/15389 and WO 95/23230) or the promoters described in WO 99/16890 (promoters from the barley hordein gene, the rice glutelin gene, the rice oryzin gene, the rice prolamin gene, the wheat gliadin gene, the wheat glutelin gene, the maize zein gene, the oat glutelin gene, the sorghum kasirin gene, the rye secalin gene).
  • Other promoters include those described by Broun et al. (1998), Potenza et al. (2004), US 20070192902 and US 20030159173.
  • the seed specific promoter is preferentially expressed in defined parts of the seed such as the cotyledon(s) or the endosperm.
  • cotyledon specific promoters include, but are not limited to, the FP1 promoter (Ellerstrom et al, 1996), the pea legumin promoter (Perrin et al, 2000), and the bean phytohemagglutnin promoter (Perrin et al., 2000).
  • endosperm specific promoters include, but are not limited to, the maize zein-1 promoter (Chikwamba et al., 2003), the rice glutelin-1 promoter (Yang et al., 2003), the barley D-hordein promoter (Horvath et al., 2000) and wheat HMW glutemn promoters (Alvarez et al., 2000).
  • the seed specific promoter is not expressed, or is only expressed at a low level, in the embryo and/or after the seed germinates.
  • sink tissues of the plant such as the tuber of the potato plant, the fruit of tomato, or the seed of soybean, canola, cotton, Zea mays, wheat, rice, and barley, it is preferred that the promoters utilized in the present invention have relatively high expression in these specific tissues.
  • a number of promoters for genes with tuber-specific or -enhanced expression are known, including the class I patatin promoter, the promoter for the potato tuber ADPGPP genes, both the large and small subunits, the sucrose synthase promoter, the promoter for the major tuber proteins including the 22 kD protein complexes and proteinase inhibitors, the promoter for the granule bound starch synthase gene (GBSS), and other class I and II patatins promoters.
  • Other promoters can also be used to express a protein in specific tissues, such as seeds or fruits.
  • the promoter for ⁇ -conglycinin or other seed-specific promoters such as the napin, zein, linin and phaseolin promoters, can be used. Root specific promoters may also be used. An example of such a promoter is the promoter for the acid chitinase gene. Expression in root tissue could also be accomplished by utilizing the root specific subdomains of the CaMV 35S promoter that have been identified.
  • the plant storage organ specific promoter is a fruit specific promoter.
  • fruit specific promoter examples include, but are not limited to, the tomato polygalacturonase, E8 and Pds promoters, as well as the apple ACC oxidase promoter (for review see Potenza et al., 2004).
  • the promoter preferentially directs expression in the edible parts of the fruit, for example the pith of the fruit, relative to the skin of the fruit or the seeds within the fruit.
  • the promoter directs expression in tissues and organs in which fatty acid and oil biosynthesis takes place. Such promoters act in seed development at a suitable time for modifying oil composition in seeds.
  • the 5' non-translated leader sequence can be derived from the promoter selected to express the heterologous gene sequence of the polynucleotide of the present invention, or may be heterologous with respect to the coding region of the enzyme to be produced, and can be specifically modified if desired so as to increase translation of mRNA.
  • the 5' non-translated regions can also be obtained from plant viral RNAs (Tobacco mosaic virus, Tobacco etch virus, Maize dwarf mosaic virus, Alfalfa mosaic virus, among others) from suitable eukaryotic genes, plant genes (wheat and maize chlorophyll a/b binding protein gene leader), or from a synthetic gene sequence.
  • the present invention is not limited to constructs wherein the non-translated region is derived from the 5' non-translated sequence that accompanies the promoter sequence.
  • the leader sequence could also be derived from an unrelated promoter or coding sequence.
  • Leader sequences useful in context of the present invention comprise the maize Hsp70 leader (US 5,362,865 and US 5,859,347), and the TMV omega element.
  • the termination of transcription is accomplished by a 3' non-translated DNA sequence operably linked in the chimeric vector to the polynucleotide of interest.
  • the 3' non-translated region of a recombinant DNA molecule contains a polyadenylation signal that functions in plants to cause the addition of adenylate nucleotides to the 3' end of the RNA.
  • the 3' non-translated region can be obtained from various genes that are expressed in plant cells.
  • the nopaline synthase 3' untranslated region, the 3' untranslated region from pea small subunit Rubisco gene, the 3' untranslated region from soybean 7S seed storage protein gene are commonly used in this capacity.
  • the 3' transcribed, non-translated regions containing the polyadenylate signal of Agrobacterium tumor-inducing (Ti) plasmid genes are also suitable.
  • Recombinant DNA technologies can be used to improve expression of a transformed polynucleotide molecule by manipulating, for example, the number of copies of the polynucleotide molecule within a host cell, the efficiency with which those polynucleotide molecules are transcribed, the efficiency with which the resultant transcripts are translated, and the efficiency of post-translational modifications.
  • Recombinant techniques useful for increasing the expression of polynucleotide molecules defined herein include, but are not limited to, operatively linking polynucleotide molecules to high-copy number plasmids, integration of the polynucleotide molecule into one or more host cell chromosomes, addition of vector stability sequences to plasmids, substitutions or modifications of transcription control signals (e.g., promoters, operators, enhancers), substitutions or modifications of translational control signals (e.g., ribosome binding sites, Shine-Dalgarno sequences), modification of polynucleotide molecules to correspond to the codon usage of the host cell, and the deletion of sequences that destabilize transcripts.
  • transcription control signals e.g., promoters, operators, enhancers
  • translational control signals e.g., ribosome binding sites, Shine-Dalgarno sequences
  • the invention also provides a recombinant cell which is a host cell transformed with one or more recombinant molecules, such as the polynucleotides, chimeric DNAs or recombinant vectors etc defined herein.
  • the recombinant cell may comprise any combination thereof, such as two or three recombinant vectors, or a recombinant vector and one or more additional polynucleotides or chimeric DNAs.
  • Suitable cells of the invention include any cell that can be transformed with a polynucleotide, chimeric DNA or recombinant vector of the invention, such as for example, a molecule encoding a polypeptide or enzyme described herein.
  • the cell is preferably a cell which is thereby capable of being used for producing fatty acids.
  • the recombinant cell may be a cell in culture, a cell in vitro, or in an organism such as for example a plant, or in an organ such as for example a seed or a leaf.
  • Host cells into which the polynucleotide(s) are introduced can be either untransformed cells or cells that are already transformed with at least one nucleic acid molecule. Such nucleic acid molecules may be related to fatty acid synthesis, or unrelated.
  • Host cells of the present invention either can be endogenously (i.e., naturally) capable of producing proteins defined herein, in which case the recombinant cell derived therefrom has an enhanced capability of producing the polypeptides, or can be capable of producing such proteins only after being transformed with at least one polynucleotide of the invention.
  • Host cells of the present invention can be any cell capable of producing at least one protein described herein, and include bacterial, fungal (including yeast), parasite, arthropod, animal and plant cells.
  • the cells may be prokaryotic or eukaryotic.
  • Preferred host cells are yeast and plant cells.
  • the plant cell is a seed cell, in particular a cell in a cotyledon or endosperm of a seed.
  • the cell is an animal cell or an algal cell.
  • the animal cell may be of any type of animal such as, for example, a non-human animal cell, a non-human vertebrate cell, a non-human mammalian cell, or cells of aquatic animals such as, fish or Crustacea, invertebrates, insects, etc.
  • arthropod cells include insect cells such as Spodoptera frugiperda (Sf) cells, e.g. Sf9, Sf21, Trichoplusia ni cells, and Drosophila S2 cells.
  • An example of a bacterial cell useful as a host cell of the present invention is Synechococcus spp. (also known as Synechocystis spp.), for example Synechococcus elongatus.
  • the cells may be of an organism suitable for a fermentation process such as fungal organisms, such as yeast.
  • yeast includes Saccharomyces spp., Saccharomyces cerevisiae, Saccharomyces carlbergensis, Candida spp., Kluveromyces spp., Pichia spp., Hansenula spp., Trichoderma spp., Lipomyces starkey, and Yarrowia lipolytica.
  • Preferred yeast include strains of the Saccharomyces spp., and in particular, Saccharomyces cerevisiae.
  • the invention also provides a plant comprising a cell of the invention, such as a transgenic plant comprising one or more polynucleotides of the invention.
  • plant as used herein as a noun refers to whole plants, but as used as an adjective refers to any substance which is present in, obtained from, derived from, or related to a plant, such as for example, plant organs (e.g. leaves, stems, roots, flowers), single cells (e.g. pollen), seeds, plant cells and the like.
  • plant part refers to all plant parts that comprise the plant DNA, including vegetative structures such as, for example, leaves or stems, roots, floral organs or structures, pollen, seed, seed parts such as an embryo, endosperm, scutellum or seed coat, plant tissue such as, for example, vascular tissue, cells and progeny of the same.
  • transgenic plant refers to a plant that contains a gene construct ("transgene") not found in a wild-type plant of the same species, variety or cultivar.
  • Transgenic plants as defined in the context of the present invention include plants and their progeny which have been genetically modified using recombinant techniques to cause production of at least one polypeptide defined herein in the desired plant or plant organ.
  • Transgenic plant cells and transgenic plant parts have corresponding meanings.
  • seed and “grain” are used interchangeably herein.
  • “Grain” refers to mature grain such as harvested grain or grain which is still on a plant but ready for harvesting, but can also refer to grain after imbibition or germination, according to the context. Mature grain commonly has a moisture content of less than about 18-20%.
  • "Developing seed” refers to a seed prior to maturity, typically found in the reproductive structures of the plant after fertilisation or anthesis. but can also refer to such seeds prior to maturity which are isolated from a plant.
  • plant storage organ refers to a part of a plant specialized to storage energy in the form of, for example, proteins, carbohydrates, fatty acids and/or oils.
  • plant storage organs are seed, fruit, tuberous roots, and tubers.
  • a preferred plant storage organ of the invention is seed.
  • Plants provided by or contemplated for use in the practice of the present invention include both monocotyledons and dicotyledons.
  • the plants of the present invention are crop plants (for example, cereals and pulses, maize, wheat, potatoes, tapioca, rice, sorghum, millet, cassava, barley, or pea), or other legumes.
  • the plants may be grown for production of edible roots, tubers, leaves, stems, flowers or fruit.
  • the plants may be vegetables or ornamental plants.
  • the plants of the invention may be: corn (Zea mays), canola ⁇ Brassica napus, Brassica rapa ssp.), flax (Linum usitatissimum), alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cerale), sorghum ⁇ Sorghum bicolour, Sorghum vulgare), sunflower (Helianthus annus), wheat (Tritium aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium hirsutum), sweet potato (Lopmoea batatus), cassava (Manihot esculenta), coffee (Cofea spp.), coconut (Cocos nucifera), pineapple (Anana comosus), citris tree (Citrus spp.), cocoa (Theobro
  • the plant is an angiosperm.
  • the plant is an oilseed plant, preferably an oilseed crop plant.
  • an "oilseed plant” is a plant species used for the commercial production of oils from the seeds of the plant.
  • the oilseed plant may be oil-seed rape (such as canola), maize, sunflower, soybean, sorghum, flax (linseed) or sugar beet.
  • the oilseed plant may be other Brassicas, cotton, peanut, poppy, mustard, castor bean, sesame, safflower, or nut producing plants.
  • the plant may produce high levels of oil in its fruit, such as olive, oil palm or coconut.
  • Horticultural plants to which the present invention may be applied are lettuce, endive, or vegetable brassicas including cabbage, broccoli, or cauliflower.
  • the present invention may be applied in tobacco, cucurbits, carrot, strawberry, tomato, or pepper.
  • the transgenic plant is homozygous for each and every gene that has been introduced (transgene) so that its progeny do not segregate for the desired phenotype.
  • the transgenic plant may also be heterozygous for the introduced transgene(s), preferably uniformly heterozygous for the transgene, such as for example in Fl progeny which have been grown from hybrid seed. Such plants may provide advantages such as hybrid vigour, well known in the art. Transformation of plants
  • Transgenic plants can be produced using techniques known in the art, such as those generally described in A. Slater et al., Plant Biotechnology - The Genetic
  • stably transforming As used herein, the terms “stably transforming”, “stably transformed” and variations thereof refer to the integration of the exogenous nucleic acid molecules into the genome of the cell such that they are transferred to progeny cells during cell division without the need for positively selecting for their presence. Stable transformants, or progeny thereof, can be selected by any means known in the art such as Southern blots on chromosomal DNA or in situ hybridization of genomic DNA.
  • Agrobacterium-mediated transfer is a widely applicable system for introducing genes into plant cells because DNA can be introduced into cells in whole plant tissues or plant organs or explants in tissue culture, for either transient expression or for stable integration of the DNA in the plant cell genome.
  • the use of Agrobacterium-mediated plant integrating vectors to introduce DNA into plant cells is well known in the art (see, for example, US 5177010, US 5104310, US 5004863 or US 5159135).
  • the region of DNA to be transferred is defined by the border sequences, and the intervening DNA (T- DNA) is usually inserted into the plant genome. Further, the integration of the T-DNA is a relatively precise process resulting in few rearrangements.
  • Agrobacterium transformation vectors are capable of replication in E. coli as well as Agrobacterium, allowing for convenient manipulations as described (Klee et al., In: Plant DNA Infectious Agents, Hohn and Schell, eds., Springer- Verlag, New York, pp. 179-203 (1985).
  • Acceleration methods include, for example, microprojectile bombardment and the like.
  • microprojectile bombardment One example of a method for delivering transforming nucleic acid molecules to plant cells is microprojectile bombardment. This method has been reviewed by Yang et al., Particle Bombardment Technology for Gene Transfer, Oxford Press, Oxford, England (1994).
  • Non-biological particles that may be coated with nucleic acids and delivered into cells by a propelling force.
  • Exemplary particles include those comprised of tungsten, gold, platinum, and the like.
  • An illustrative embodiment of a method for delivering DNA into Zea mays cells by acceleration is a biolistics ct-particle delivery system, that can be used to propel particles coated with DNA through a screen, such as a stainless steel or Nytex screen, onto a filter surface covered with corn cells cultured in suspension.
  • a particle delivery system suitable for use with the present invention is the helium acceleration PDS- 1000/He gun available from Bio-Rad Laboratories.
  • PDS- 1000/He gun available from Bio-Rad Laboratories.
  • Filters containing the cells to be bombarded are positioned at an appropriate distance below the micro projectile stopping plate. If desired, one or more screens are also positioned between the gun and the cells to be bombarded.
  • immature embryos or other target cells may be arranged on solid culture medium.
  • the cells to be bombarded are positioned at an appropriate distance below the microprojectile stopping plate.
  • one or more screens are also positioned between the acceleration device and the cells to be bombarded.
  • bombardment transformation one may optimize the pre-bombardment culturing conditions and the bombardment parameters to yield the maximum numbers of stable transformants.
  • Both the physical and biological parameters for bombardment are important in this technology. Physical factors are those that involve manipulating the DNA/micro projectile precipitate or those that affect the flight and velocity of either the macro- or microprojectiles.
  • Biological factors include all steps involved in manipulation of cells before and immediately after bombardment, the osmotic adjustment of target cells to help alleviate the trauma associated with bombardment, and also the nature of the transforming DNA, such as linearized DNA or intact supercoiled plasmids. It is believed that pre-bombardment manipulations are especially important for successful transformation of immature embryos.
  • plastids can be stably transformed.
  • Methods disclosed for plastid transformation in higher plants include particle gun delivery of DNA containing a selectable marker and targeting of the DNA to the plastid genome through homologous recombination (US 5, 451,513, US 5,545,818, US 5,877,402, US 5,932479, and WO 99/05265).
  • the execution of other routine adjustments will be known to those of skill in the art in light of the present disclosure.
  • Transformation of plant protoplasts can be achieved using methods based on calcium phosphate precipitation, polyethylene glycol treatment, electroporation, and combinations of these treatments. Application of these systems to different plant varieties depends upon the ability to regenerate that particular plant strain from protoplasts. Illustrative methods for the regeneration of cereals from protoplasts are described (Fujimura et al., 1985; Toriyama et al., 1986; Abdullah et al., 1986).
  • Other methods of cell transformation can also be used and include but are not limited to introduction of DNA into plants by direct DNA transfer into pollen, by direct injection of DNA into reproductive organs of a plant, or by direct injection of DNA into the cells of immature embryos followed by the rehydration of desiccated embryos.
  • This regeneration and growth process typically includes the steps of selection of transformed cells, culturing those individualized cells through the usual stages of embryonic development through the rooted plantlet stage. Transgenic embryos and seeds are similarly regenerated. The resulting transgenic rooted shoots are thereafter planted in an appropriate plant growth medium such as soil.
  • the development or regeneration of plants containing the foreign, exogenous gene is well known in the art.
  • the regenerated plants are self-pollinated to provide homozygous transgenic plants. Otherwise, pollen obtained from the regenerated plants is crossed to seed-grown plants of agronomically important lines. Conversely, pollen from plants of these important lines is used to pollinate regenerated plants.
  • a transgenic plant of the present invention containing a desired exogenous nucleic acid is cultivated using methods well known to one skilled in the art.
  • transgenic wheat or barley plants are produced by Agrobacterium tumefaciens mediated transformation procedures.
  • Vectors carrying the desired nucleic acid construct may be introduced into regenerable wheat cells of tissue cultured plants or explants, or suitable plant systems such as protoplasts.
  • the regenerable wheat cells are preferably from the scutellum of immature embryos, mature embryos, callus derived from these, or the meristematic tissue.
  • PCR polymerase chain reaction
  • Southern blot analysis can be performed using methods known to those skilled in the art.
  • Expression products of the transgenes can be detected in any of a variety of ways, depending upon the nature of the product, and include Western blot and enzyme assay.
  • One particularly useful way to quantitate protein expression and to detect replication in different plant tissues is to use a reporter gene, such as GUS.
  • a transgenic plant formed using Agrobacterium or other transformation methods typically contains a single genetic locus on one chromosome. Such transgenic plants can be referred to as being hemizygous for the added gene(s). More preferred is a transgenic plant that is homozygous for the added gene(s); i.e., a transgenic plant that contains two added genes, one gene at the same locus on each chromosome of a chromosome pair.
  • a homozygous transgenic plant can be obtained by self-fertilising a hemizygous transgenic plant, germinating some of the seed produced and analyzing the resulting plants for the gene of interest.
  • transgenic plants that contain two independently segregating exogenous genes or loci can also be crossed (mated) to produce offspring that contain both sets of genes or loci.
  • Selfing of appropriate Fl progeny can produce plants that are homozygous for both exogenous genes or loci.
  • Back-crossing to a parental plant and out-crossing with a non-transgenic plant are also contemplated, as is vegetative propagation. Descriptions of other breeding methods that are commonly used for different traits and crops can be found in Fehr, In: Breeding Methods for Cultivar Development, Wilcox J. ed., American Society of Agronomy, Madison Wis. (1987). Trans enic Non-Human Animals
  • transgenic non-human animal refers to an animal, other than a human, that contains an exogenous polynucleotide ("transgene") not found in a wild-type animal of the same species or breed.
  • transgene an exogenous polynucleotide
  • Techniques for producing transgenic animals are well known in the art. A useful general textbook on this subject is Houdebine, Transgenic animals - Generation and Use (Harwood Academic, 1997). Transformation of a polynucleotide molecule into a cell can be accomplished by any method by which a polynucleotide molecule can be inserted into the cell. Transformation techniques include, but are not limited to, transfection, electroporation, microinjection, lipofection, adsorption, and cell fusion.
  • a recombinant cell may remain unicellular or may grow into a tissue, organ or a multicellular organism.
  • Transformed polynucleotide molecules can remain extrachromosomal or can integrate into one or more sites within a chromosome of the transformed (i.e., recombinant) cell in such a manner that their ability to be expressed is retained.
  • Heterologous DNA can be introduced, for example, into fertilized mammalian ova.
  • totipotent or pluripotent stem cells can be transformed by microinjection, calcium phosphate mediated precipitation, liposome fusion, retroviral infection or other means, the transformed cells are then introduced into the embryo, and the embryo then develops into a transgenic animal.
  • developing embryos are infected with a retrovirus containing the desired DNA, and transgenic animals produced from the infected embryo.
  • the appropriate DNAs are coinjected into the pronucleus or cytoplasm of embryos, preferably at the single cell stage, and the embryos allowed to develop into mature transgenic animals.
  • Another method used to produce a transgenic animal involves micro injecting a nucleic acid into pro-nuclear stage eggs by standard methods. Injected eggs are then cultured before transfer into the oviducts of pseudopregnant recipients.
  • Transgenic animals may also be produced by nuclear transfer technology. Using this method, fibroblasts from donor animals are stably transfected with a plasmid incorporating the coding sequences for a binding domain or binding partner of interest under the control of regulatory sequences. Stable transfectants are then fused to enucleated oocytes, cultured and transferred into female recipients.
  • Post-transcriptional gene silencing is a nucleotide sequence-specific defense mechanism that can target both cellular and viral mRNAs for degradation.
  • PTGS occurs in plants or fungi stably or transiently transformed with a recombinant polynucleotide(s) and results in the reduced accumulation of RNA molecules with sequence similarity to the introduced polynucleotide.
  • RNA molecule levels can be increased, and/or RNA molecule levels stabilized over numerous generations, by limiting the expression of the silencing suppressor to a storage organ of a plant or part thereof.
  • a "silencing suppressor” is any polynucleotide or polypeptide that can be expressed in a plant cell that enhances the level of expression product from a different transgene in the plant cell, particularly, over repeated generations from the initially transformed plant.
  • the silencing suppressor is a viral silencing suppressor or mutant thereof.
  • a large number of viral silencing suppressors are known in the art and include, but are not limited to P19, V2, P38, Pe-Po and RPV-PO. Examples of suitable viral silencing suppressors include those described in WO 2010/057246.
  • the term "stably expressed" or variations thereof refers to the level of the RNA molecule being essentially the same or higher in progeny plants over repeated generations, for example, at least three, at least five, or at least ten generations, when compared to corresponding plants lacking the exogenous polynucleotide encoding the silencing suppressor.
  • this term(s) does not exclude the possibility that over repeated generations there is some loss of levels of the RNA molecule when compared to a previous generation, for example, not less than a 10% loss per generation.
  • the suppressor can be selected from any source e.g. plant, viral, mammal, etc.
  • the suppressor may be, for example:
  • tomato yellow leaf curl virus-China C2 tomato yellow leaf curl China virus Y10 isolate PCI, tomato yellow leaf curl Israeli isolate V2, mungbean yellow mosaic virus-Vigna AC2, hibiscus chlorotic ringspot virus CP,
  • peanut clump pecluvirus PI 5 peanut clump pecluvirus PI 5
  • rice stripe virus NS3 crucifer infecting tobacco mosaic virus 126K
  • Grapevine leafroll associated virus-2 homolog of BYV p21 grapevine leafroll associated virus-2 homolog of BYV p21.
  • the list above provides the virus from which the suppressor can be obtained and the protein (e.g., B2, P14, etc.), or coding region designation for the suppressor from each particular virus.
  • Multiple copies of a suppressor may be used. Different suppressors may be used together (e. g., in tandem).
  • RNA molecule which is desirable to be expressed in a plant storage organ can be co-expressed with the silencing suppressor.
  • the RNA molecule may influence an agronomic trait, insect resistance, disease resistance, herbicide resistance, sterility, grain characteristics, and the like.
  • the encoded polypeptides may be involved in metabolism of lipid, starch, carbohydrates, nutrients, etc., or may be responsible for the synthesis of proteins, peptides, lipids, waxes, starches, sugars, carbohydrates, flavors, odors, toxins, carotenoids. hormones, polymers, flavonoids, storage proteins, phenolic acids, alkaloids, lignins, tannins, celluloses, glycoproteins, glycolipids, etc.
  • the plants produced increased levels of enzymes for lipid production in plants such as Brassicas, for example oilseed rape or sunflower, safflower, flax, cotton, soya bean or maize.
  • Plants for example oilseed rape or sunflower, safflower, flax, cotton, soya bean or maize.
  • plant seeds are cooked, pressed, and extracted to produce crude seedoil, which is then degummed, refined, bleached, and deodorized.
  • techniques for crushing seed are known in the art.
  • oilseeds can be tempered by spraying them with water to raise the moisture content to, for example, 8.5%, and flaked using a smooth roller with a gap setting of 0.23 to 0.27 mm.
  • water may not be added prior to crushing.
  • Application of heat deactivates enzymes, facilitates further cell rupturing, coalesces the oil droplets, and agglomerates protein particles, all of which facilitate the extraction process.
  • the majority of the seedoil is released by passage through a screw press. Cakes expelled from the screw press are then solvent extracted for example, with hexane, using a heat traced column.
  • crude seedoil produced by the pressing operation can be passed through a settling tank with a slotted wire drainage top to remove the solids that are expressed with the seedoil during the pressing operation.
  • the clarified seedoil can be passed through a plate and frame filter to remove any remaining fine solid particles. If desired, the seedoil recovered from the extraction process can be combined with the clarified seedoil to produce a blended crude seedoil.
  • Degumming can be performed by addition of concentrated phosphoric acid to the crude seedoil to convert non-hydratable phosphatides to a hvdratable form, and to chelate minor metals that are present. Gum is separated from the seedoil by centrifugation. The seedoil can be refined by addition of a sufficient amount of a sodium hydroxide solution to titrate all of the fatty acids and removing the soaps thus formed.
  • Deodorization can be performed by heating the seedoil to 260°C under vacuum, and slowly introducing steam into the seedoil at a rate of about 0.1 ml/minute/100 ml of seedoil. After about 30 minutes of sparging, the seedoil is allowed to cool under vacuum. The seedoil is typically transferred to a glass container and flushed with argon before being stored under refrigeration. If the amount of seedoil is limited, the seedoil can be placed under vacuum for example, in a Parr reactor and heated to 260°C for the same length of time that it would have been deodorized. This treatment improves the colour of the seedoil and removes a majority of the volatile substances. Plant biomass for the production of oils
  • Parts of plants involved in photosynthesis can also be used to produce oil.
  • oils Independent of the type of plant, there are several methods for extracting oils from green biomass.
  • One way is physical extraction, which often does not use solvent extraction. It is a "traditional" way using several different types of mechanical extraction.
  • Expeller pressed extraction is a common type, as are the screw press and ram press extraction methods. The amount of oil extracted using these methods varies widely, depending upon the plant material and the mechanical process employed. Mechanical extraction is typically less efficient than solvent extraction described below.
  • an organic solvent e.g., hexane
  • the solvent dissolves the oil in the biomass and the like, which solution is then separated from the biomass by mechanical action (e.g., with the pressing processes above).
  • This separation step can also be performed by filtration (e.g., with a filter press or similar device) or centrifugation etc.
  • the organic solvent can then be separated from the oil (e.g., by distillation). This second separation step yields oil from the plant and can yield a re- usable solvent if one employs conventional vapor recovery.
  • the term the "fermentation process” refers to any fermentation process or any process comprising a fermentation step.
  • a fermentation process includes, without limitation, fermentation processes used to produce alcohols (e.g., ethanol, methanol, butanol), organic acids (e.g., citric acid, acetic acid, itaconic acid, lactic acid, gluconic acid), ketones (e.g., acetone), amino acids (e.g., glutamic acid), gases (e.g., H 2 and C0 2 ), antibiotics (e.g., penicillin and tetracycline), enzymes, vitamins (e.g., riboflavin, beta-carotene), and hormones.
  • alcohols e.g., ethanol, methanol, butanol
  • organic acids e.g., citric acid, acetic acid, itaconic acid, lactic acid, gluconic acid
  • ketones e.g., acetone
  • amino acids e.g
  • Fermentation processes also include fermentation processes used in the consumable alcohol industry (e.g., beer and wine), dairy industry (e.g., fermented dairy products), leather industry and tobacco industry.
  • Preferred fermentation processes include alcohol fermentation processes, as are well known in the art.
  • Preferred fermentation processes are anaerobic fermentation processes, as are well known in the art.
  • Suitable fermenting cells typically microorganisms that are able to ferment, that is, convert, sugars such as glucose or maltose, directly or indirectly into the desired fermentation product. Examples of fermenting microorganisms include fungal organisms such as y east.
  • the transgenic microorganism is preferably grown under conditions that optimize activity of fatty acid biosynthetic genes and acyltransferase genes. This leads to production of the greatest and the most economical yield of oil.
  • media conditions that may be optimized include the type and amount of carbon source, the type and amount of nitrogen source, the carbon-to-nitrogen ratio, the oxygen level, growth temperature, pH, length of the biomass production phase, length of the oil accumulation phase and the time of cell harvest.
  • Fermentation media must contain a suitable carbon source.
  • suitable carbon sources may include, but are not limited to: monosaccharides (e.g., glucose, fructose), disaccharides (e.g., lactose, sucrose), oligosaccharides, polysaccharides (e.g., starch, cellulose or mixtures thereof), sugar alcohols (e.g., glycerol) or mixtures from renewable feedstocks (e.g., cheese whey permeate, cornsteep liquor, sugar beet molasses, barley malt).
  • monosaccharides e.g., glucose, fructose
  • disaccharides e.g., lactose, sucrose
  • oligosaccharides e.g., polysaccharides (e.g., starch, cellulose or mixtures thereof)
  • sugar alcohols e.g., glycerol
  • renewable feedstocks e.g., cheese whey
  • carbon sources may include alkanes, fatty acids, esters of fatty acids, monoglycerides, diglycerides, triglycerides, phospholipids and various commercial sources of fatty acids including vegetable oils (e.g., soybean oil) and animal fats.
  • the carbon substrate may include one-carbon substrates (e.g., carbon dioxide, methanol, formaldehyde, formate, carbon-contaming amines) for which metabolic conversion into key biochemical intermediates has been demonstrated.
  • the source of carbon utilized in the present invention may encompass a wide variety of carbon-containing substrates and will only be limited by the choice of the host microorganism.
  • preferred carbon substrates are sugars and/or fatty acids. Most preferred is glucose and/or fatty acids containing between 10-22 carbons.
  • Nitrogen may be supplied from an inorganic (e.g., (NH ⁇ SC ⁇ ) or organic source (e.g., urea, glutamate).
  • organic source e.g., urea, glutamate
  • the fermentation media may also contain suitable minerals, salts, cofactors, buffers, vitamins and other components known to those skilled in the art suitable for the growth of the microorganism and promotion of the enzymatic pathways necessary for oil production.
  • a suitable pH range for the fermentation is typically between about pH 4.0 to pH 8.0, wherein pH 5.5 to pH 7.0 is preferred as the range for the initial growth conditions.
  • the fermentation may be conducted under aerobic or anaerobic conditions, wherein microaerobic conditions are preferred.
  • accumulation of high levels of oil in the cells of oleaginous microorganisms requires a two-stage process, since the metabolic state must be "balanced" between growth and synthesis/storage of fats.
  • a two- stage fermentation process is necessary for the production of oils in microorganisms.
  • the first stage of the fermentation is dedicated to the generation and accumulation of cell mass and is characterized by rapid cell growth and cell division.
  • the second stage of the fermentation it is preferable to establish conditions of nitrogen deprivation in the culture to promote high levels of oil accumulation.
  • the effect of this nitrogen deprivation is to reduce the effective concentration of AMP in the cells, thereby reducing the activity of the NAD-dependent isocitrate dehydrogenase of mitochondria.
  • citric acid will accumulate, thus forming abundant pools of acetyl-CoA in the cytoplasm and priming fatty acid synthesis.
  • this phase is characterized by the cessation of cell division followed by the synthesis of fatty acids and accumulation of TAGs.
  • a batch fermentation process is a closed system wherein the media composition is set at the beginning of the process and not subject to further additions beyond those required for maintenance of pH and oxygen level during the process.
  • the media is inoculated with the desired organism and growth or metabolic activity is permitted to occur without adding additional substrates (i.e., carbon and nitrogen sources) to the medium.
  • substrates i.e., carbon and nitrogen sources
  • the metabolite and biomass compositions of the system change constantly up to the time the culture is terminated.
  • cells moderate through a static lag phase to a high-growth log phase and finally to a stationary phase, wherein the growth rate is diminished or halted. Left untreated, cells in the stationary phase will eventually die.
  • a variation of the standard batch process is the fed-batch process, wherein the substrate is continually added to the fermentor over the course of the fermentation process.
  • a fed-batch process is also suitable in the present invention.
  • Fed-batch processes are useful when catabolite repression is apt to inhibit the metabolism of the cells or where it is desirable to have limited amounts of substrate in the media at any one time. Measurement of the substrate concentration in fed-batch systems is difficult and therefore may be estimated on the basis of the changes of measurable factors such as H, dissolved oxygen and the partial pressure of waste gases (e.g., CO2).
  • Continuous cultures generally maintain the cells in the log phase of growth at a constant cell density.
  • Continuous or semi-continuous culture methods permit the modulation of one factor or any number of factors that affect cell growth or end product concentration. For example, one approach may limit the carbon source and allow all other parameters to moderate metabolism. In other systems, a number of factors affecting growth may be altered continuously while the cell concentration, measured by media turbidity, is kept constant. Continuous systems strive to maintain steady state growth and thus the cell growth rate must be balanced against cell loss due to media being drawn off the culture. Methods of modulating nutrients and growth factors for continuous culture processes, as well as techniques for maximizing the rate of product formation, are well known in the art of industrial microbiology and a variety of methods are detailed by Brock, supra.
  • Fatty acids may be found in the host microorganism as free fatty acids or in estenfied forms such as acylglycerols, phospholipids, sulfolipids or glycolipids, and may be extracted from the host cell through a vanety of means well-known in the art.
  • means for the purification of fatty acids may include extraction with organic solvents, sonication, supercritical fluid extraction (e.g., using carbon dioxide), saponification and physical means such as presses, or combinations thereof.
  • organic solvents e.g., methanol and chloroform in the presence of water (Bligh and Dyer, 1959).
  • the aqueous layer can be acidified to protonate negatively- charged moieties and thereby increase partitioning of desired products into the organic layer.
  • the organic solvents can be removed by evaporation under a stream of nitrogen.
  • the products When isolated in conjugated forms, the products may be enzymatically or chemically cleaved to release the free fatty acid or a less complex conjugate of interest, and can then be subject to further manipulations to produce a desired end product.
  • conjugated forms of fatty acids are cleaved with potassium hydroxide.
  • Standard methods can be employed. Such methods may include extraction, treatment with urea, fractional crystallization, HPLC, fractional distillation, silica gel chromatography, high-speed centrifugation or distillation, or combinations of these techniques. Protection of reactive groups such as the acid or alkenyl groups, may be done at any step through known techniques (e.g., alkylation, iodination). Methods used include methylation of the fatty acids to produce methyl esters. Similarly, protecting groups may be removed at any step.
  • oils and fatty acids produced by the methods and cells described have a variety of uses.
  • the oils are used as food oils.
  • the oils are refined and used as lubricants, coatings (US 4933114), radiation, solvent detectors, temperature indicators, biosensors (Reppy and Pindzola, 2007), insecticides (US 5180838), linear optics, or for other industrial uses such as the synthesis of polymers.
  • Oils and fatty acids produced using the methods and cells of the invention can also be used to treat or prevent diseases such as cancer, an infection (for example, a bacterial, fungal or nematode infection) or type 2 diabetes.
  • diseases such as cancer, an infection (for example, a bacterial, fungal or nematode infection) or type 2 diabetes.
  • the oils and fatty acids can be used to synthesize a compound to treat or prevent disease.
  • the production of the oils or fatty acids defined herein in transgenic plants can assist in the protection of the plants from fungal, nematodal and/or bacterial infections. Feedstuffs
  • feedstuffs include any food or preparation for human or animal consumption (including for enteral and/or parenteral consumption) which when taken into the body: (1) serve to nourish or build up tissues or supply energy, and/or (2) maintain, restore or support adequate nutritional status or metabolic function.
  • Feedstuffs of the invention include nutritional compositions for babies and/or young children.
  • Feedstuffs of the invention comprise for example, a cell of the invention, a plant of the invention, the plant part of the invention, the seed of the invention, fatty acid of the invention, oil of the invention, an extract of the invention, the product of a method of the invention, the product of a fermentation process of the invention, or a composition along with a suitable carrier(s).
  • carrier is used in its broadest sense to encompass any component which may or may not have nutritional value. As the person skilled in the art will appreciate, the carrier must be suitable for use (or used in a sufficiently low concentration) in a feedstuff, such that it does not have deleterious effect on an organism which consumes the feedstuff.
  • the feedstuff of the present invention comprises oil and/or fatty acid produced directly or indirectly by use of the methods, cells or organisms disclosed herein.
  • the composition may either be in a solid or liquid form. Additionally, the composition may include edible macronutrients, vitamins, and/or minerals in amounts desired for a particular use. The amounts of these ingredients will vary depending on whether the composition is intended for use with normal individuals or for use with individuals having specialized needs such as individuals suffering from metabolic disorders and the like.
  • suitable carriers with nutritional value include, but are not limited to, macronutrients such as edible fats, carbohydrates and proteins.
  • edible fats include, but are not limited to, coconut oil, borage oil, fungal oil, black current oil, soy oil, and mono- and di-glycerides.
  • carbohydrates include, but are not limited to, glucose, edible lactose, and hydrolyzed starch.
  • proteins which may be utilized in the nutritional composition of the invention include, but are not limited to, soy proteins, electrodialysed whey, electrodialysed skim milk, milk whey, or the hy drolysates of these proteins.
  • vitamins and minerals the following may be added to the feedstuff compositions of the present invention, calcium, phosphorus, potassium, sodium, chloride, magnesium, manganese, iron, copper, zinc, selenium, iodine, and vitamins A, E, D, C, and the B complex. Other such vitamins and minerals may also be added.
  • the components utilized in the feedstuff compositions of the present invention can be of semi-purified or purified origin.
  • semi-purified or purified is meant a material which has been prepared by purification of a natural material or by de novo synthesis.
  • a feedstuff composition of the present invention may also be added to food even when supplementation of the diet is not required.
  • the composition may be added to food of any type, including, but not limited to, margarine, modified butter, cheeses, milk, yogurt, chocolate, candy, snacks, salad oils, cooking oils, cooking fats, meats, fish and beverages.
  • the genus Saccharomyces spp is used in both brewing of beer and wine making and also as an agent in baking, particularly bread.
  • Yeast is a major constituent of vegetable extracts. Yeast is also used as an additive in animal feed. It will be apparent that genetically modified yeast strains can be provided which are adapted to synthesize oil as described herein. These yeast strains can then be used in food stuffs and in wine and beer making to provide products which have enhanced oil content.
  • oil produced in accordance with the present invention or host cells transformed to contain and express the subject genes may also be used as animal food supplements to alter an animal's tissue or milk fatty acid composition to one more desirable for human or animal consumption.
  • animal food supplements include sheep, cattle, horses and the like.
  • feedstuffs of the invention can be used in aquaculture to increase the levels of fatty acids in fish for human or animal consumption.
  • Preferred feedstuffs of the invention are the plants, seed and other plant parts such as leaves, fruits and stems which may be used directly as food or feed for humans or other animals.
  • animals may graze directly on such plants grown in the field, or be fed more measured amounts in controlled feeding.
  • the invention includes the use of such plants and plant parts as feed for increasing the polyunsaturated fatty acid levels in humans and other animals.
  • compositions particularly pharmaceutical compositions, comprising one or more of the fatty acids and/or resulting oils produced using the methods of the invention.
  • a pharmaceutical composition may comprise one or more of the fatty acids and/or oils, in combination with a standard, well-known, non-toxic pharmaceutically- accep table carrier, adjuvant or vehicle such as phosphate-buffered saline, water, ethanol, polyols, vegetable oils, a wetting agent or an emulsion such as a water/oil emulsion.
  • the composition may be in either a liquid or solid form.
  • the composition may be in the form of a tablet, capsule, ingestible liquid or powder, injectible, or topical ointment or cream. Proper fluidity can be maintained, for example, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants.
  • compositions can also include isotonic agents, for example, sugars, sodium chloride, and the like.
  • the composition can also include adjuvants, such as wetting agents, emulsifying and suspending agents, sweetening agents, flavoring agents and perfuming agents.
  • Suspensions in addition to the active compounds, may comprise suspending agents such as ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar, and tragacanth or mixtures of these substances.
  • Solid dosage forms such as tablets and capsules can be prepared using techniques well known in the art.
  • fatty acids produced in accordance with the present invention can be tableted with conventional tablet bases such as lactose, sucrose, and cornstarch in combination with binders such as acacia, cornstarch or gelatin, disintegrating agents such as potato starch or alginic acid, and a lubricant such as stearic acid or magnesium stearate.
  • Capsules can be prepared by incorporating these excipients into a gelatin capsule along with antioxidants and the relevant fatty acid(s).
  • the fatty' acids produced in accordance with the present invention or derivatives thereof may be incorporated into commercial formulations.
  • a typical dosage of a particular fatty acid is from 0.1 mg to 20 g, taken from one to five times per day (up to 100 g daily) and is preferably in the range of from about 10 mg to about 1 , 2, 5, or 10 g daily (taken in one or multiple doses). As known in the art, a minimum of about 300 mg/day of fatty acid is desirable. However, it will be appreciated that any amount of fatty acid will be beneficial to the subject.
  • Possible routes of administration of the pharmaceutical compositions of the present invention include, for example, enteral (e.g. , oral and rectal) and parenteral.
  • enteral e.g. , oral and rectal
  • parenteral e.g., a liquid preparation may be administered orally or rectally.
  • a homogenous mixture can be completely dispersed in water, admixed under sterile conditions with physiologically acceptable diluents, preservatives, buffers or propellants to form a spray or inhalant.
  • the dosage of the composition to be administered to the patient may be determined by one of ordinary skill in the art and depends upon various factors such as weight of the patient, age of the patient, overall health of the patient, past history of the patient, immune status of the patient, etc.
  • compositions of the present invention may be utilized for cosmetic purposes. It may be added to pre-existing cosmetic compositions such that a mixture is formed or a fatty acid produced according to the subject invention may be used as the sole "active" ingredient in a cosmetic composition.
  • RNA was pelleted by centrifugation at 12,000 g, 10 minutes at 4°C. The RNA pellet was washed once with 75 % ethanol and then air-dried for 10 minutes. The RNA was then dissolved in 30 ⁇ of RNase-free water. There was a distinct yellow colour to the RNA which was further purified using the Lithium chloride cleanup method described in the Ambion ToTALLY RNATM kit.
  • the synthesis of cDNA was performed using the Invitrogen Superscript II and using a polyT primer ( ⁇ _ SE Q ID NOT 5).
  • the polyT primer 100 pmol
  • RNA (2 ⁇ ) and RNase-free water to a final volume of 15.5 ⁇
  • 10XPCR Buffer 2.5 ⁇
  • 25 mM MgCl 2 2.5 ⁇
  • 10 mM dNTP mix 1 ⁇
  • 0.1M DTT 2.5 ⁇
  • This mixture was heated to 42 °C for 1 minute after which Superscript II Reverse Transcriptase (1 ⁇ ) was added and the mixture left for 50 minutes at 42°C.
  • Superscript II Reverse Transcriptase was inactivated at 70 °C for 15 minutes and RNA degraded with ⁇ RNaseH (2 Units, 30 minutes at 37°C).
  • the PCR conditions were as follows: an initial denaturation of 94°C for 3 minutes and then 30 cycles of 94°C/15s, 48°C/30s, 72°C/2 min and then a final extension of 72°C/5 min. An aliquot (5 ⁇ ) was separated on a 1.5 % agarose gel and a band of approximately 550 bp was visualised.
  • the PCR reaction products were purified using the QIAgen QIAquick PCR purification kit according to the manufacturer's instructions and cloned into pGEM®T-Easy (Promega).
  • the ligation mixtures were transformed into E. coll DH10B and transformants selected on LB agar plates containing 100 ⁇ ampicillin, 40 ⁇ X-Gal and 0.2 mM IPTG. A total of 16 transformants were sequenced and an internal sequence for CLIO was obtained.
  • Degenerate PCR was performed with XRF2b (5 TTYTTYTWY CNCAYATGGGNTGG - SEQ ID NO: 18)/Clu_r and each reaction contained dNTPs (each 200 ⁇ ), 10X ThermoPol Buffer (NEB), 5 ⁇ of cDNA, 1.5 ⁇ each primer (100 pmol), 0.1 ⁇ TaqONA polymerase (NEB) and sterile water to 50 ⁇ .
  • the PCR conditions were as follows: an initial denaturation of 94°C for 3 minutes and then 30 cycles of 94 °C/15s, 48 °C/30s, 72 °C/2 min and then a final extension of 72 °C/5 min. An aliquot (5 ⁇ ) of each PCR was separated on a 1.5 % agarose gel. A band of expected size was observed and the PCR products obtained were purified using the QIAgen QIAquick PCR purification kit and cloned into pGEM®T-Easy (Promega). The ligation mixture was transformed into E.
  • Primers were designed to sequence obtained internal to the degenerate primer binding sites such as:
  • RNA (3 ⁇ from either abdomen or defence gland tissue) was added with 1 ⁇ Smart IV oligo
  • the 5 ⁇ RACE reactions consisted of dNTPs (each 200 ⁇ ) : 10X Advantage 2 PCR Buffer (Clontech), CDS V Primer (5 ' AAGCAGTGGTATCAACGCAGAGT -
  • Clones were screened by colony PCR for correct insertions. This PCR used internal primers with only one of the primers used in the RACE reaction. Initially, colonies were boiled for 5 minutes in sterile water, after which dNTPs (each 200 ⁇ ), 10X ThermoPol Buffer (NEB), degXfront (10 pomol), degXend (10 pmol) and 0.1U Taq DNA Polymerase (NEB) were added with a final
  • the PCR cycling conditions were as follows: an initial denaturation of 94 °C for 3 minutes and then 30 cycles of 94 °C/15s, 52 °C/30s, 72 °C/2 min and then a final extension of 72 °C/5 min.
  • a 50ul PCR reaction was prepared using Platinum Taq DNA polymerase High Fidelity according to manufacturer's instructions (Invitrogen). The reaction conditions were as follows: 1 cycle of: 94°C for 2 mm followed by 30 cycles of: 94 °C for 30 sec, 52 °C for 30 sec and 68 °C for 1 min . An aliquot (20 ul) of the reaction was run out on 1 % agarose gel and a single band (approximately 1 kbp) was obtained, excised, gel purified (Qiagen), cloned into TOPO 2.1 (Invitrogen) and transformed into TOPO Top 10 E. coli competent cells (Invitrogen) according to manufactures instructions. Positive clones were analysed by restriction enzyme digest and sequence analysis.
  • Example 2 Construction of yeast expression vector for Ch uliosnathus lusubris desaturase genes
  • C. lugubris desaturase genes Functional analysis of C. lugubris desaturase genes were carried out using a yeast expression system. Full length C. lugubris desaturase genes were amplified by RT-PCR from total RNA isolated as previously described using primers containing restriction sites not found in the desaturase genes (Table 2) for directional cloning into pYES2 (Invitrogen).
  • the amplified RT-PCR or PCR products were ligated into pGEM®T-Easy (Promega) or pTOP02.1 (Invitrogen), transformed into JM109 (Promega) or One Shot TOP10 (Invitrogen) electrocompetent Escherichia coli cells and transformants selected on LB agar plates containing 100 g/ml ampicillin.
  • pGEM®T-Easy or pTOP02.1 clones containing correct inserts were confirmed by sequencing. Correct inserts were restriction digested, gel purified with the QIAquick Gel Extraction kit (QIAGEN), and ligated into pYES2 digested with corresponding restriction enzymes for each desaturase gene. The ligation mix was transformed into JM109 or One Shot TOP10 cells and transformants were selected on LB agar plates containing 100 g/ml ampicillin.
  • pYES2 clones containing correct inserts were confirmed by restriction digest and subsequent sequencing, and the isolated plasmids were transformed into Saccharomyces cerevisiae strains OLEl (his3Al leu2A0 ura3A0 YMR272c::kanMX4) or INVScl (Invitrogen; MATa his3Al leu2 trpl-289 ura3-52) using the Sigma Yeast Transformation Kit. Transformants were selected on agar plates containing yeast minimal medium lacking uracil (SCMM-U) at 30 °C for 2-3 days, and presence of pYES2 vectors with inserts were confirmed by PCR.
  • SCMM-U yeast minimal medium lacking uracil
  • S. cerevisiae host strains Two S. cerevisiae host strains were used as recipients for pYES2 desaturase clones; OLE1 (his3Al, leu2A0, ura3A0, YMR272c::kanMX4) and INVScl (MATa, his3Dl leu2 trpl-289 ura3-52). These strains were treated the same during transformation except that cis-10-heptadecenoic acid (CI 7: 1), 0.5 mM, and tergitol (NP-40; 1 %) were added in all media in which S. cerevisiae OLE1 was to grow in.
  • CI 7: 1 cis-10-heptadecenoic acid
  • NP-40 tergitol
  • S. cerevisiae was streaked onto YPD (20 g/1 peptone, 10 g/1 yeast extract, 2 % D-glucose) and grown for several days at 30°C. Transformations were performed using the Sigma Yeast Transformation kit. A loopful of growth was resuspended in 0.5 ml of transformation buffer and spun for 5 s at 12,000g. 400 ⁇ of the supernatant was discarded. To the remaining solution was added 10 ⁇ salmon testes DNA (10 mg/ml) and 1 ⁇ g of plasmid DNA and mixed by vortex for 10 seconds. To this was added 600 ⁇ of PLATE buffer and the samples incubated for 4 hours at room temperature, after which they were subject to heat shock for 15 minutes at 42°C.
  • the cells were pelleted by centnfugation (12.000 g, 3 seconds) and resuspended in 500 ⁇ of sterile water.
  • Transformants were selected on SCMM-U agar plates (6.7 g/1 yeast nitrogen base without amino acids, 1.92 g/1 yeast synthetic drop-out media supplement without uracil, 2 % glucose and 2 % agar) at 30°C for up to 5 days.
  • a number of transformants were masterplated onto SCMM-U and agar selection and tested for the presence of the desaturase gene by PCR.
  • a positive clone for the desaturase gene was chosen and streaked for single colonies. From a single colony glycerol stocks were prepared (50 % culture and 25 % glycerol) and stored at -80 °C until further use.
  • Yeast transformants derived form strains OLEl and INVScI were inoculated into 25 ml of synthetic minimal defined medium for yeast with uracil (SCMM-U medium) containing 2% glucose and additionally 0.5 mM cw-10-heptadecanoic acid for the OLEl strain.
  • This inoculation culture was grown for 24-48 h at 30°C with shaking (200 rpm).
  • the OD600 of the culture was determined. From this, the amount of culture necessary to obtain an OD600 of 0.4 in 50 ml of induction medium was calculated. This amount of inoculation culture was removed and the cells pelleted at 3000 rpm for 5 min at 4°C.
  • the cells were then suspended in 20 ml SCMM-U supplemented with 10 % D-raffinose as the carbon source and 20 % D-galactose as the inducer for desaturase expression, and 0.5 mM c/ ' s-lO-heptadecanoic acid where OLEl was the yeast strain used. Induced yeast were either incubated without added substrates or one of a wide range of fatty acid substrates were added to a final concentration of 0.2 mM. The cultures were grown at 20°C for 3 days with shaking at 200 rpm. The cultures were transferred to preweighed 25 ml polypropylene tubes and the yeast cells pelleted at 3000 rpm for 5 minutes. The supernatant was removed, and tubes inverted to drain for 5 minutes. Wet pellet weights were recorded and these were stored at - 20°C until analysed for fatty acids.
  • Yeast cells were washed sequentially with 1 % tergitol and MiliQ water with centrifugation at 1500 ⁇ g for 5 minutes at 4 °C and dried in a Savant SpeedVac Plus SCl l OA concentrator/dryer.
  • Cells were directly treated with methanol/hydrochloric acid/chloroform (10: 1 : 1) or with sodium methoxide in methanol in a sealed test tube with heating at 90 °C for 60 minutes to convert lipids to fatty acid methyl esters (FAME).
  • FAME fatty acid methyl esters
  • saline was added when the sample was cool and FAME were extracted from the mixture by vortexing with hexane. This layer was removed for analysis.
  • solvent was removed in a nitrogen stream and single drop of anhydrous acetic acid was added prior to FAME taken up in hexane solvent for analysis.
  • FAME samples were analysed by gas chromatography - mass spectrometry (GCMS) using a Varian 3800 gas chromatograph fitted with a BPX70 capillary column (length 30 m, i.d. 0.32 mm, film thickness 0.25 ⁇ ) coupled to a Varian 1200 Single Quadrupole mass spectrometer. Mass spectra were acquired under positive electron impact in full scan mode between 40 - 400 amu at the rate of 2 scans per second. Injections were made in the split mode using helium as the carrier gas and an initial column temperature of 130 °C. The oven temperature was raised at 5°C/minute until 170°C, then raised at 2.5°C/minute until 250°C.
  • GCMS gas chromatography - mass spectrometry
  • the protein had a predicted size of 349 amino acids and contained the eight conserved histidine residues that form the 'histidine boxes' essential for desaturase activity.
  • the protein has a divergent amino acid sequence, showing less than 44% identity with other characterised membrane acetylenases (Table 4).
  • CLIO was therefore characterised as a dual function acylCoA ⁇ 12 desaturase and ⁇ 12 acetylenase.
  • Table 3 Summary of identified products from yeast expressing C. lugubris desaturases and fed with exogenous fatty acids (and no added substrate) and the conversion (%) oi ' substrates, n.d. not detected.
  • CXX carbon chain length of fatty acid.
  • CXX:Y where Y is the number of unsaturations in the fatty acid.
  • the location and nature of unsaturation is given by - stereo chemistry of double bond unsaturation cis (Z) or trans (E) then position of the bond e.g. Z9 is a cis unsaturated bond in the ⁇ 9 position.
  • 'A' represents an acetylenic bond.
  • CL4 was therefore characterised as an acylCoA ⁇ 14 conjugase. Unlike a fungal enzyme with some ⁇ 14 conjugase activity disclosed by Blacklock et al. (2010), CL4 has no detectable ⁇ 12 desaturase activity.
  • CL2-1 and CL2-2 showed ⁇ 14 acetylenase activity toward one of the tested substrates in yeast feeding trials; dehydrocrepenynate (C18:3 Z9,12A,Z14) was converted to the conjugated diacetylenic product C18:3 Z9,12A,14A (Table 3) and as shown in Figure 2.
  • CL2 showed ⁇ 9 acetylenase activity when fed with crepenynate to give the methylene interrupted diacetylenic product CI 8:2 9A,12A ( Figure 1). No other activity was observed in either no-added-substrate trials or where a wide variety of fatty acid substrates were offered.
  • CL2 The two variants of CL2 (-1 and -2) proteins had the same predicted size of 354 amino acids and contained the eight conserved histidine residues that form the 'histidine boxes' essential for desaturase activity. No gene/protein sequence has previously been identified having this activity therefore CL2-1 and CL2-2 are novel. On the basis of sequence homology with known acylCoA desaturases this enzyme was presumed to be acting on an acylCoA substrate. CL2-1 and CL2-2 were therefore characterised as ⁇ 9 and ⁇ 14 acylCoA (poly)acetylenases.
  • a metabolic pathway from oleic acid to the diacetylenic product CI 8:3 Z9,12A,14A and C18:4 Z9, 12A, 14A, Z9 can be envisaged as catalysed by the three C. lugubris genes (CLIO, CL4 and CL2) and assembled in Figure 3.
  • CLIO, CL4 and CL2 The structure of the the methylene interrupted diacetylenic product CI 8:2 9A,12A is provided below.
  • C. lugubris could utilze CI 8 substrates such as oleic acid to produce acetylenated fatty acids, and hence the inventors were surprised to find this activity.
  • the inventors analysed dissected soldier beetles but could not find acetyl enics as a CI 8 chain length version. The insects seem to immediately shorten the acetyl enic fatt acids to CIO and C12 and store it in that form.
  • the PGR fragment was run on a 1.3 % agarose gel, excised from the gel and purified using the Nucleospin Extract II kit (Macherey-Nagel).
  • the gene was subcloned into pGEMDT-Easy (Promega) and chemically competent JM109 (Promega) were transformed with 3 ul of the ligation mix. Promega's bacterial cell transformation procedure was followed. 100 ⁇ of undiluted competent cells were plated onto LB agar plates containing ampicillin 100 ug/ml. Plasmid DNA was isolated using the QIAprep Spin Miniprep Kit (Qiagen). The presence of insert was confirmed through restriction analysis.
  • CLI O was synthesised by Geneart AG (Germany) and subcloned into the pYES2 yeast expression vector (Invitrogen) using the restriction sites Hindlll and Xhol.
  • a scrape of INVScl cells from a YPD plate were cotransformed with pESC Trp containing CL2 and CL4, and pYES2 containing CLIO, using the short yeast protocol from the Yeast Transformation Kit (Sigma). Transformants were selected on SCMM- Uracil, Tryptophan with 2 % D-glucose agar plates at 30°C for up to 5 days.
  • Colonies were masterplated onto SCMM-Uracil, Tryptophan with 2 % D-glucose agar plates and the inserts were screened for using PCR.
  • the transformant clone containing pESC Trp with CLIO that had 100 % sequence identity to the original CLI O sequence was chosen and streaked for single colonies. From a single yeast colony glycerol stocks were prepared (50 % culture and 25 % glycerol) and stored at -80°C.
  • the PCR fragment was run on a 1.3 % agarose gel in TAE, excised from the gel and purified using the Nucleospin Extract II kit (Macherey-Nagel).
  • the gene is subcloned into pCR2.1-Topo (Invitrogen) and chemically competent JM109 cells (Promega) were transformed with 2 ul of the Topo ligation mix. Promega's bacterial cell transformation procedure was followed. 100 ul of undiluted transformed cells is plated onto LB agar plates containing ampicillin 100 ug/ml. Plasmid DNA is isolated using the QIAprep Spin Miniprep Kit (Qiagen). The presence of insert was confirmed through restriction analysis. The sequence of CL4 is verified through sequencing and a clone with 100 % identity to the original sequence was subcloned into the pFastbac Dual pH MCS using the restriction sites Sail and Notl, using standard cloning methods.
  • Dual was performed to potentially increase the amount of crepenynic acid substrate for CL4.
  • the CLIO gene was amplified using gene specific primers with BamHI and Xbal restriction sites at the 5 ' and 3' ends of the gene respectively (Table 5).
  • the PCR fragment was run on a 1.3 % agarose gel in TAE, excised from the gel and purified using the Nucleospm Extract II kit (Macherey-Nagel).
  • the gene is subcloned into pGEM®T-Easy (Promega) and chemically competent JM109cells (Promega) were transformed with 2 ul of the ligation mix.
  • Promega's bacterial cell transformation procedures was followed. 100 ul of undiluted transformed cells are plated onto LB agar plates containing ampicillin 100 ug/ml. Plates are incubated at 37 °C for sixteen hours. Transformants were masterplated onto LB agar plates containing ampicillin (100 ug/ml) and PCR screened for the presence of the insert. Plasmid DNA was isolated from clones positive for the insert grown in LB and ampicillin (100 ug/ml) broth, that was grown for 16 hours at 37 °C, shaking at 220 rpm, using the QIAprep Spin Miniprep Kit (Qiagen). The presence of the insert was confirmed through restriction analysis.
  • Cloning of CLIO into the plO MCS of pFastbac Dual was performed by amplifying CLIO using gene specific primers with Xhol and Sphl restriction sites at the 5' and 3' ends of the gene respectively (Table 5).
  • the PCR fragment was run on a 1.3 % agarose gel in TAE, excised from the gel and purified using the Nucleospin Extract II kit (Macherey-Nagel).
  • the gene was subcloned into pCRTopo2.1 (Invitrogen) and chemically competent JM109 cells (Promega) were transformed with 2 ul of the Topo ligation mix. Promega's bacterial cell transformation procedure was followed.
  • the pFastBac constructs were diluted to a concentration of 200 pg/ul in TE, pH8.0.
  • the MAX Efficiency DHl OBac competent cells (Invitrogen) were thawed on ice and transferred to a 15 ml polypropylene tube.
  • One ng of pFastBac construct was added to the cells and mixed gently. Cells were incubated on ice for 30 minutes, then heat shocked at 42 °C for 45 seconds. Tubes were then chilled on ice for two minutes.
  • a single colony confirmed to have a white phenotype was inoculated in a liquid culture containing 50 ⁇ g/ml kanamycin, 7 ⁇ g/ml gentamicin and 10 ⁇ g/ml tetracycline and incubated in a shaking water bath at 37°c, 250rpm overnight and purified using the PureLink HiPure Plasmid DNA Miniprep Kit. (Invitrogen). Analysing recombinant bacmid DNA
  • bacmid DNA was amplified by PCR using a combination of pUC/M13Forward, pUC/M13Reverse and gene specific primers and analysed by agarose gel electropheresis.
  • SF9 insect cells were grown in Supplemented Grace's Insect Medium containing 10%FBS to log phase 1.5-2.5 x 10 6 cells/ml with 95% viability and transfected with recombinant baculovirus DNA according to Bac-to-Bac Baculovirus Expression System protocol (Invitrogen).
  • the resultant PI viral stock was used to infect SF9 cells to generate a high-titre P2 viral stock.
  • Supemantant and cell pellets of both PI and P2 were harvested, processed to fatty acid methyl esters and analysed by GCMS.
  • DNA sequences encoding Crepl (Crepis alpina ⁇ 12 acetylenase Y16285), CLIO, CL4 or CL2 were cloned within the canonical CaMV35S promoter::ocs polyadenylation signal expression cassettes residing within TDNA binary vector backbones derived from either Gleave et al. (1992) or Coutu et al. (2007) creating binary TDNA plant expression vectors, pCW53, pCW352, pCW54 and pCW55, respectively.
  • a 'seed-specific' T D NA binary vector containing expression cassettes for the three genes - CLIO, CL4 and CL2 or Crepl, CL4 and CL2 - was constructed in the following manner. Firstly a three promoter binary vector was constructed such that three unique restriction sites allowed the sequential insertion of genes into individual expression cassettes for seed specific expression. CL4 was inserted into a unique site under the control of the FP1 promoter (Ellerstrom et al.. 1996), creating pCW77.
  • 35 S constructs All genes, either as individual 35 S constructs or seed-specific expression constructs were transiently expressed in Nicotiana benthamiana leaves, using published methods (Petrie et al., 2010; Wood et al, 2009). Briefly, a 35S:pl9 construct is used to enhance the expression in leaves of individual constructs or combinations of individual constructs. The addition of 35S:LEC2 allows 'seed-specific' promoters to become active in leaves. Individual AGL1 strains were agromfiltrated into the underside of N.
  • benthamiana leaves using the appropriate cofactor namely 35: l9 for experiments using pCW352, pCW53, pCW54 and pCW55 or 35:pl9 and 35S:LEC2 to activate expression from promoter cassette within pCW354 and pCW364.
  • the AtFAE promoter can be activated in trans by the addition of 35S:AtLEC2 (CW data not shown).
  • the optical density (at wavelength 600 nm) of each culture was adjusted to 0.4 prior to each agroinfiltration.
  • Nicotiana benthamiana leaves transformed with plant expression vectors containing the desaturase of interest were cut into approximately 1 cm 2 pieces and incubated overnight at 25 °C in water with 2 mM fatty acid substrate (added in ethanol/20 % tergitol). The leaves were then washed thoroughly in water to remove any excess substrate and water was removed from the leaves in a Savant SpeedVac Plus SCl l OA concentrator/dryer. Dried leaves were analysed for fatty acid composition as described for yeast cells above. The production of the fatty acid dehydro crepenynic acid (CI 8:3 Z9,12A,Z14) in N. benthamiana transiently expressing soldier beetle CL4 fed with exogenous crepenynic acid (CI 8:2 Z9,12A) is demonstrated by the GC/MS chromogram in Figure 4 and Table 9.
  • Agrobacterial strain harbouring pCW354 and pCW364 was transformed into Arabidopsis mutant MC49 using the floral dip protocol (Clough and Bent, 1998).
  • MC49 is a high linoleic acid content mutant resulting from mutations in FAD3 and FAE1.
  • Transformed seed were selected on hygromycin containing plates and 20 independent plants were grown to maturity and T2 seed collected for lipid analyses. Seeds were analysed for fatty acids using methods described for yeast cells above.
  • the seed fatty acid composition results for an experiment where Cre l, CL4 and CL2 were co-expressed in A. thaliana under seed specific expression are given in Table 10.
  • the seed fatty acid composition where CLI O, CL4 and CL2 were co-expressed in Arabidopsis were similar.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Nutrition Science (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Insects & Arthropods (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to polypeptides and methods for producing acetylenated fatty acids. In particular, the present invention relates to polypeptides, and polynucleotides encoding therefor, with Δ12 acetylenase activity, Δ14 and/or Δ16 conjugase activity, or Δ9 and/or Δ14 acetylenase activity.

Description

ACETYLENATION OF FATTY ACIDS
FIELD OF THE INVENTION
The present invention relates to polypeptides and methods for producing acetylenated fatty acids.
BACKGROUND OF THE INVENTION
Acetylenic fatty acids contain carbon-carbon triple bonds and are related to unsaturated fatty acids (containing double bonds) by the removal of a further two hydrogens from the already unsaturated bond. The first acetylenic fatty acid that was fully characterized was tariric acid (C18: 1A6A) from Picramnia tariri (Arnaud, 1892). When the fatty acid has more than one triple bond it becomes a polyacetylenic fatty acid (PAFA). The term 'polyacetylene' is also commonly used to describe PAFAs and metabolites derived from them. More than 2000 PAFAs and related compounds have been identified; they are found in higher plants, liverworts, mosses, fungi, marine sponges and algae, and insects. The common function of these PAFA derived compounds in all producing organisms is their probable involvement in self defence against pathogens and predators.
Many species from the plant families of Asteraceae/ Apiaceae/Araliaceae/Solanaceae synthesize PAFA related secondary metabolites that use crepenynic acid (€18:2Δ9Ζ,Δ12Α) as the precursor fatty acid. Tissue distribution of these PAFA metabolites is different between plant species. For example, in safflower (Carthamus tinctorius, Asteraceae), PAFA metabolites were mainly found in the cotyledon and to a lesser extent in hypocotyl and root of germinating plants, whereas a different PAFA epoxide metabolite was concentrated in the subcellular fraction of mature leaf that was rich in chloroplast (Ichihara and Noda, 1977). Crepis biennis (Asteraceae) contains trace amounts of PAFA metabolites in leaves (Bohlmann and Zdero, 1973). Food plant species belonging to Apiaceae (carrot, celeriac, celery, parsnip, parsley) and Solanaceae (tomato, potato) accumulate falcarinol-type polyacetylenes (a CI 7 PAFA metabolite) mainly in roots and other edible parts (reviewed in Christensen, 2006). Particularly in tomato, it has been shown that fungal attack induces local production of falcarindiol at the attacked site (De Wit and Kodde, 1981). English ivy (Araliaceae) contains a PAFA metabolite falcarinol in leaves (reviewed in Hansen, 1986), which is known to be the causative allergen of contact dermatitis in humans (Hausen et al., 1987). One common observation in all plants that produce crepenynic acid-related metabolites is the absence of crepenynate and the closely related dehydrocrepenynate (018:3Δ9Ζ,Δ12Α,Δ14Ζ) in tissues producing polyacetylenes. Absence of the precursor PAFAs maybe due to their efficient conversion into the metabolites. The only tissue that accumulates crepenynate and dehydrocrepenynate is seeds of certain plants e.g. Crepis alpina, where they do not show signs of further desaturation and metabolism of the acetylenic fatty acids, and is instead stored, as is, in the triacylglycerol fraction.
Basidiomycete fungi also synthesize polyacetylenes that use crepenynate and dehydrocrepenynate as the precursor fatty acids. In comparison to the lack of these precursors seen in higher plant tissues, it is well known that they accumulate, and undergo further metabolism mainly into short chain (C8-C11) allenes, which is characteristic of the basidiomycete species (reviewed in Jones and Thaller, 1978).
PAFAs that have stearolic acid (CI 8: 1 Δ9Α ) or ximenynic acid (or santalbic acid, 018:2Δ9Α,11Ε) as the precursor have been identified mainly in roots of plant species belonging to the order Santales, including families Santalaceae, Olacaceae, Opiliaceae, Balanophoraceae and Loranthaceae (Hatt et al, 1967). They are all hemiparasitic, each species tapping on their preferred host plants mainly through the root system for nutrients and water. In contrast to plants that produce crepenynate- related polyacetylenes, Santales polyacetylenes are detected in their linear fatty acid form. In the Australian native quandong, Santalum acuminatum, addition of triple bonds to CI 8 chain length fatty acids start soon after germination, and by three months there is a gradual increase in the degree of unsaturation in order of descent from the cotyledon (dieneyne) to the hypocotyl (enediyne), and finally root (enetriyne) (Bu'Lock and Smith, 1963). However, one similarity with higher plants that synthesize crepenynate is that the putative precursor, ximenynic acid, is not detected in the tissues that produce PAFAs and related metabolites of the Santales species. Ximenynic acid is only found in the seed where again there is no presence of PAFAs in the stored oil body (Bu-Lock and Smith, 1963). There have been more recent characterizations of a PAFA with the triple bond starting at the Δ9 position (oropheic acid, 17-octadecene-9,l l ,13- triynoic acid) from leaves of Orophea enneandra and stem bark of Mitrephora celebica, both belonging to the Annonaceae family (order Magnoliales) (Cavin et al, 1998; Zgoda et al., 2001).
Several moss and liverwort species produce acetylenic fatty acids with a triple bond in the Δ6 position (Kohn et al., 1987; Kohn et al., 1988). These Δ6 acetylenic fatty acids are found in the triacylglycerol fraction to varying percentages in the moss species (Kohn et al., 1987), and are also found in the mono- and di- galactodiacyl glycerol fraction of a liverwort species Ricca duplex (Kohn et al., 1988). In R. duplex, the authors identified an unusual fatty acid that had a possible "connection" to one of the Δ6 acetylenic fatty acids in the PC fraction (C18:2ro9). If this unusual fatty acid is indeed the substrate for the Δ6 acetylenase, it suggests that the acetylenation takes place in the endoplasmic reticulum and not in the plastid.
Accumulated PAFAs and related metabolites in the animal kingdom have only been reported from insects and marine sponges. Fatty acids containing a single acetylenic bond have been identified in moth sex pheromones such as from the female processionary moth (Thaumetopoea pityocampa) which synthesizes (Z)-13-hexadecen- 11-ynyl acetate as the sole compound of its sex pheromone. The only terrestrial animals that are known to harbour PAFA metabolites belong to two families in the order Coleoptera: Cantharidae (Meinwald et al, 1968) which contain considerable quantities of the CIO diacetylenic fatty acid, dihydromatricaria acid, and the Lycidae (Moore and Brown, 1981) which have less well-characterised acetylenic fatty acids but they are likely to be CI 8 chain length and contain polyacetylenic moieties. The Australian soldier beetle Chauliognathus lugubris (Cantharidae) has been studied in detail concerning the presence of different forms of dihydromatricaria acid and their tissue distribution (Brown et al., 1988). While both female and male adult soldier beetles had dihydromatricaria as free fatty acid and in triglyceride in the extract from whole insects, wax and glyceride ether forms were restricted to female individuals whose presence may be associated with protection from predation or disease. There have been speculations that this polyacetylene in beetles was obtained from their diet or by otherwise association with plants, instead of via de novo synthesis (Jones and Thaller, 1978).
Marine sponges and their associated microorganisms produce a very wide range of polyacetylene compounds many of which have attracted attention in the past decade for potent anticancer and antibiotic activities (reviewed in Minto and Blacklock. 2008). Polyacetylenes have been detected in bacteria but with less frequency and diversity and with structures unique to their group. Much of the polyacetylenic products formed in bacteria and marine organisms are polyketides, a large grouping of secondary metabolites synthesised in organisms via enzyme complexes know as polyketide synthetases (Minto and Blacklock, 2008). Also, some of the polyacetylene products in sponges, for example, are thought to originate in symbionts or taken in through the diet. A family of antibiotics that contains a core with two triple bonds conjugated to a double bond (termed enediyne) are produced by actmomycetes (reviewed in Smith and Nicolaou, 1996). Such enediyne antibiotics have shown great potential for use as antitumor agents (reviewed in Gredicak and Jeric, 2007). Much of the production of microbial and marine polyacetylenic products is thought to occur via enzyme complexes known as polyketide synthases. The genes within some polyketide megaclusters responsible for the formation of enediyne compounds have been cloned (Minto and Blacklock, 2008). By contrast, acetylenases are thought to be the main enzymes involved in production of (poly)acetylenes in plants, moss and insects. Acetylenases belong to a large family of non-heme diiron oxidoreducing enzymes termed desaturases. Desaturases remove two hydrogen atoms from adjacent carbons in a fatty acid chain to form a carbon-carbon double bond. There are two mam structural groups of desaturases - the soluble type that have been found only in plant plastids, and the transmembrane type that is further categorized into several different types depending on amino acid sequence similarity and the regiospecificity of the carbon chain (reviewed in Sperling et al., 2003). Acetylenases remove two more hydrogen atoms from an existing carbon-carbon double bond to create a triple bond unsaturation. Since the discovery and functional characterization of the first acetylenase from Crepis alpina in 1998 (Lee et al., 1998; W098/46762) there have been three other acetylenase genes reported; all belong to the transmembrane form of desaturase.
Sperling and colleagues (2000) amplified two PCR products from C. purpureus protonemata cDNA using primers designed against the conserved regions of Δ5, Δ6 and Δ8 desaturases and on obtaining the full length sequence they confirmed the Δ6- acetylenase by expression in yeast. This enzyme was found to possess dual desaturase/acetylenase activity (WO00/075341). The strong localized defence response of parsley against plant pathogenic fungal attack has been known to include induction of several enzymes related to the phosphatidylcholine Δ12 desaturase family (Kirsch et al., 1997). The Δ12 acetylenase activity of gene ELI 12 was identified when it was expressed in soybean under control of a seed-specific promoter (Cahoon et al., 2003).
A gene coding for an acyl-CoA desaturase-like enzyme was identified from total RNA isolated from the female processionary moth (Thaumetopoea pityocampa) pheromone gland (Serra et al., 2007). Yeast expression confirmed this enzyme to have three activities: as a Δ11 desaturase, Δ11 acetylenase, and Δ13 desaturase. This enzyme is the first and only reported animal acetylenase to date.
Despite the existence in nature of a wide variety of unusual acetylenic fatty acids there have been no genes/enzymes identified that add a second and subsequent carbon-carbon triple bond into a fatty acid, and further, no acetylenase reported to date introduces a carbon-carbon triple bond in the mid chain position of an 18-carbon fatty acid chain, that is, the Δ9 position. Thus, there is a need for polypeptides which can be used to produce polyacetylenic fatty acids.
SUMMARY OF THE INVENTION
The present inventors have identified enzymes, and polynucleotides encoding therefor, that can be expressed in cells to conjugate or acetylenate fatty acids.
In a first aspect, the present invention provides a recombinant cell comprising at least two exogenous polynucleotides selected from;
i) a first exogenous polynucleotide encoding a first polypeptide with Δ12 acetylenase activity,
ii) a second exogenous polynucleotide encoding a second polypeptide with Δ14 and/or Δ16 conjugase activity, and
iii) a third exogenous polynucleotide encoding a third polypeptide with Δ9 and/or Δ14 acetylenase activity,
wherein each polynucleotide is operably linked to one or more promoters that are capable of directing expression of said polynucleotides in the cell.
In one embodiment, wherein the cell comprises;
i) the first, second and third exogenous polynucleotides,
ii) the first and third exogenous polynucleotides, or
iii) the first and second exogenous polynucleotides.
In a preferred embodiment, the first polypeptide converts linoleic acid to crepenynic acid. In a further preferred embodiment, the efficiency of conversion of linoleic acid to crepenynic acid in the cell of the invention is at least 0.1% or at least 0.2% or at least 0.3%.
In a further embodiment, the first polypeptide also has Δ12 desaturase activity.
Accordingly, in an embodiment the first polypeptide also converts oleic acid to linoleic acid and/or linoleidic acid. In a further preferred embodiment, the efficiency of conversion of oleic acid to linoleic acid in the cell of the invention is at least 25% or at least 30% or at least 33%.
In an embodiment, the first polypeptide comprises;
i) amino acids having a sequence as set forth in any one of SEQ ID NOs:4 to 7 or 50,
ii) amino acids having a sequence which is at least 50% identical to any one or more of SEQ ID NOs:4 to 7 or 50, and/or
iii) a biologically active fragment of i) or ii).
In one preferred embodiment, the first polypeptide comprises; i) amino acids having a sequence as set forth in SEQ ID NO:4,
ii) amino acids having a sequence which is at least 50% identical to SEQ ID NO:4, and/or
iii) a biologically active fragment of i) or ii).
In a further embodiment, the cell is a plant cell and the first polypeptide comprises;
i) amino acids having a sequence as set forth in any one of SEQ ID NOs:5 to 7 or 50,
ii) amino acids having a sequence which is at least 50% identical to any one or more of SEQ ID NOs:5 to 7 or 50, and/or
iii) a biologically active fragment of i) or ii). More preferably,
i) amino acids having a sequence as set forth in SEQ ID NO:6,
ii) amino acids having a sequence which is at least 50% identical to SEQ ID NO:6, and/or
iii) a biologically active fragment of i) or ii).
In a further preferred embodiment, the second polypeptide converts crepenynic acid to dehydrocrepenynate and/or converts ene-diynoic acid to ene diyne-ene, preferably both. In a further preferred embodiment, the efficiency of conversion of crepenynic acid to dehydrocrepenynate in the cell of the invention is at least 30% or at least 40% or at least 50%. In a further preferred embodiment, the efficiency of conversion of ene-diynoic acid to ene diyne-ene in the cell of the invention is at least 10% or at least 20% or at least 28%.
In a further preferred embodiment, the second polypeptide has no detectable Δ12 desaturase activity.
In an embodiment, the second polypeptide comprises;
i) amino acids having a sequence as set forth in SEQ ID NO:3,
ii) amino acids having a sequence which is at least 50% identical to SEQ ID NO:3, and/or
iii) a biologically active fragment of i) or ii).
In an alternate, but less preferred embodiment, the second polypeptide comprises;
i) amino acids having a sequence as set forth in SEQ ID NO:48,
ii) amino acids having a sequence which is at least 50% identical to SEQ ID NO:48, and/or
iii) a biologically active fragment of i) or ii). In this embodiment, it is preferred that the cell also comprises the third polypeptide. Preferably, the second polypeptide at least has Δ14 conjugase activity.
In yet another preferred embodiment, the Δ14 acetylenase activity of the third polypeptide converts dehydrocrepenynate to ene-diynoic acid. In a further preferred embodiment, the efficiency of conversion of dehydrocrepenynate to ene-diynoic acid in the cell of the invention is at least 0.8% or at least 1.3% or at least 1.8%.
In a further preferred embodiment, the Δ9 acetylenase activity of the third polypeptide converts crepenynate to the methylene interrupted diacetylenic product C18:2 9A,12A. In a further preferred embodiment, the efficiency of conversion of crepenynate to the methylene interrupted diacetylenic product CI 8:2 9A,12A in the cell of the invention is at least 1 % or at least 1.5% or at least 2%.
In another embodiment, the third polypeptide comprises;
i) amino acids having a sequence as set forth in SEQ ID NO: l or SEQ ID NO:2, ii) amino acids having a sequence which is at least 50% identical to one or both of SEQ ID NO: l or SEQ ID NO:2, and/or
iii) a biologically active fragment of i) or ii).
Preferably, the third polypeptide at least has Δ14 acetylenase activity.
In a preferred embodiment, the cell comprises the first, second and third exogenous polynucleotides, and converts oleic acid to ene-diynoic acid and/or ene diyne-ene. Preferably, the cell also comprises one or more, preferably all of, linoleic acid, crepenynic acid, and dehydrocrepenynate. Thus, preferably this cell has an increased level of one or more, preferably all of, linoleic acid, crepenynic acid, dehydrocrepenynate, ene-diynoic acid and ene diyne-ene relative to a corresponding cell lacking the first, second and third exogenous polynucleotides.
In another embodiment, the cell comprises the first and second exogenous polynucleotides, and converts oleic acid to dehydrocrepenynate. Thus, preferably this cell has an increased level of dehydrocrepenynate relative to a corresponding cell lacking the first and second exogenous polynucleotides.
In a further embodiment, the cell comprises the first and third exogenous polynucleotides, and converts oleic acid to methylene interrupted diacetylenic product C18:2 9A,12A. Thus, preferably this cell has an increased level of methylene interrupted diacetylenic product C18:2 9A,12A relative to a corresponding cell lacking the first and third exogenous polynucleotides.
The cell may comprise further exogenous polynucleotides involved in fatty acid synthesis and/or incorporation of fatty acids into other compounds such as TAGs. Examples of such further exogenous polynucleotides which can be present in a cell of the invention include, but are not limited to, those encoding diacylglycerol acyltransferase (DGAT), glycerol-3 -phosphate acyltransferase (GPAT), 1-acyl- glycerol-3-phosphate acyltransferase (LPAAT), acyl-CoA:lysophosphatidylcholine acyltransferase (LPCAT), phospholipase A2 (PLA2), phospholipase C (PLC), phospholipase D (PLD), CDP-choline diacylglycerol choline phosphotransferase (CPT), phoshatidylcholine diacylglycerol acyltransferase (PDAT), a fatty acid reductase, a fatty acid desaturase, a fatty acid elongase, a wax synthase, or a combination of two or more thereof. Each of these enzymes are well known in the art.
In addition, the cell may comprise an introduced mutation or an exogenous polynucleotide which down regulates the production and/or activity of an endogenous enzyme. This can be particularly useful to promote the formation of the conjugated and/or acetylenated fatty acids by reducing the activity of the enzymes which may convert the relevant substrate, such as oleic acid, to fatty acids which are not a substrate for a polypeptide of the invention. Examples of endogenous enzymes which can be down regulated in a cell of the invention include, but are not limited to, DGAT, GPAT, LPAAT, LPCAT, PLA2, PLC, PLD, CPT, PDAT, a fatty acid reductase, a fatty acid desaturase such as a Δ15 desaturase, a fatty acid elongase such as an FAEI elongase, a wax synthase or a combination of two or more thereof.
The exogenous polynucleotide which down regulates the production and/or activity of an endogenous enzyme can be, for example, an antisense polynucleotide, a sense polynucleotide, a catalytic polynucleotide, a microRNA, a polynucleotide which encodes a polypeptide which binds the endogenous enzyme and a double stranded RNA.
In an embodiment, the exogenous polynucleotide which down regulates the production and/or activity of an endogenous enzyme does not significantly effect the production and/or activity of an enzyme encoded by an exogenous polynucleotide in the cell.
In a preferred embodiment, the cell is a eukaryotic cell. Examples include, but are not limited to, a plant cell, a mammalian cell, an insect cell, or a cell suitable for fermentation.
In one preferred embodiment, the cell is in a plant or part thereof. In an embodiment, the part is a seed, fruit, tuber, root, or a vegetative part of a plant. The vegetative of the plant may be an aerial plant part or a green part such as a leaf or stem.
In an embodiment, the plant is an oilseed plant or part thereof.
In another aspect, the present invention provides a substantially purified and/or recombinant polypeptide which is a Δ9 and/or Δ14 acetylenase. Preferably, the polypeptide at least has Δ14 acetylenase activity, more preferably both Δ9 and Δ14 acetylenase activity.
In a preferred embodiment, the polypeptide of the above aspect converts dehydrocrepenynate to ene-diynoic acid, and/or converts crepenynate to the methylene interrupted diacetylenic product C18:2 9A,12A, preferably both. More preferably, the polypeptide comprises;
i) amino acids having a sequence as set forth in SEQ ID NO: l or SEQ ID NO:2, ii) amino acids having a sequence which is at least 50% identical to one or both of SEQ ID NO: l or SEQ ID NO:2, and/or
iii) a biologically active fragment of i) or ii).
In another aspect, the present invention provides a substantially purified and/or recombinant polypeptide which is a Δ14 conjugase and/or Δ16 conjugase. Preferably, the polypeptide at least has Δ14 conjugase activity, more preferably both Δ14 and Δ16 conjugase activity. Preferably, the conjugase has no detectable Δ12 desaturase activity.
In a preferred embodiment, the polypeptide of the above aspect converts crepenynic acid to dehydrocrepenynate and/or converts ene-diynoic acid to ene diyne- ene, preferably both. More preferably, the polypeptide comprises;
i) amino acids having a sequence as set forth in SEQ ID NO:3,
ii) amino acids having a sequence which is at least 50% identical to SEQ ID NO:3, and/or
iii) a biologically active fragment of i) or ii).
In a further aspect, the present invention provides a substantially purified and/or recombinant polypeptide which is Δ12 acetylenase, wherein the polypeptide comprises; i) amino acids having a sequence as set forth in SEQ ID NO:4,
ii) amino acids having a sequence which is at least 50% identical to SEQ ID
NO:4, and/or
iii) a biologically active fragment of i) or ii).
In a preferred embodiment, the polypeptide of the above aspect converts linoleic acid to crepenynic acid. In a further embodiment, the polypeptide also has Δ12 desaturase activity.
In a further embodiment, a polypeptide of the invention comprises amino acids having a sequence which is at least 90% identical, more preferably at least 95% identical and more preferably at least 99% identical, to any one or more of the sequences set forth in SEQ ID NOs:l to 4.
In an embodiment, a polypeptide of the invention is able to act on an acyl-CoA substrate. Preferably, when produced recombinantly in a cell, particularly a yeast cell, a polypeptide of the invention as the corresponding efficiency of conversion of the relevant substrate(s) and product(s) as defined above for a recombinant cell of the invention.
In another embodiment, a polypeptide of the invention can be isolated from an insect of the Order Coleoptera. More preferably, a polypeptide of the invention can be isolated from an insect of the Family Cantharidae. Even more preferably, the insect is a species of Chauliognathus such as Chauliognathus lugubris.
A polypeptide of the invention may be a fusion protein further comprising at least one other polypeptide. The at least one other polypeptide may be a polypeptide that enhances the stability of a polypeptide of the present invention, or a polypeptide that assists in the purification of the fusion protein.
In a further aspect, the present invention provides an isolated and/or exogenous polynucleotide comprising;
i) a sequence of nucleotides of any one of SEQ ID NOs:8 to 11,
ii) a sequence of nucleotides encoding a polypeptide of the invention, iii) a sequence of nucleotides which is at least 50% identical to ι) or ii), and/or iv) a sequence of nucleotides which hybridizes to any one of i) to iii) under stringent conditions.
In one embodiment, the polynucleotide encodes a Δ9 and/or Δ14 acetylenase and comprises;
i) a sequence of nucleotides of SEQ ID NO:8 or SEQ ID NO:9,
ii) a sequence of nucleotides encoding a polypeptide comprising amino acids having a sequence that is at least 50% identical to one or both of the sequences set forth in SEQ ID NO:8 or SEQ ID NO:9,
iii) a sequence of nucleotides which is at least 50% identical to ι), and/or iv) a sequence of nucleotides which hybridizes to any one of i) to iii) under stringent conditions.
In another embodiment, the polynucleotide encodes a A14 and/or Δ16 conjugase and comprises;
i) a sequence of nucleotides of SEQ ID NO: 10,
ii) a sequence of nucleotides encoding a polypeptide comprising amino acids having a sequence that is at least 50% identical to the sequences set forth in SEQ ID NO: 10,
iii) a sequence of nucleotides which is at least 50% identical to ι), and/or iv) a sequence of nucleotides which hybridizes to any one of i) to iii) under stringent conditions.
In another embodiment, the polynucleotide encodes a Δ12 acetylenase and comprises;
i) a sequence of nucleotides of SEQ ID NO: 1 1,
ii) a sequence of nucleotides encoding a polypeptide comprising amino acids having a sequence that is at least 50% identical to the sequences set forth in SEQ ID NO: l l,
iii) a sequence of nucleotides which is at least 50% identical to ι), and/or iv) a sequence of nucleotides which hybridizes to any one of i) to iii) under stringent conditions.
In another aspect, the present invention provides a vector comprising a polynucleotide of the invention.
In an embodiment, the vector is an expression vector, wherein the polynucleotide is operably linked to a promoter.
In a further aspect, the present invention provides a recombinant cell comprising a recombinant polypeptide of the invention, an exogenous polynucleotide of the invention and/or a vector of the invention. In a preferred embodiment, the cell is a eukaryotic cell. Examples include, but are not limited to, a plant cell, a mammalian cell, an insect cell, or a cell suitable for fermentation.
Also provided is a method of producing a polypeptide of the invention, the method comprising expressing in a cell or cell free expression system a polynucleotide of the invention.
In an embodiment, the method further comprises isolating the polypeptide. In a further aspect, the present invention provides a transgenic non-human organism, or part thereof, comprising a cell of the invention.
In an embodiment, the organism is a transgenic plant. In an embodiment, the transgenic plant is more resistant to an infection when compared to a corresponding plant lacking the cell.
Preferably, a polynucleotide of the invention is stably integrated into the genome of the cell.
In another aspect, provided is a plant seed comprising a cell of the invention. In yet a further aspect, provided is oil produced by, or obtained from, any one or more of a cell of the invention, a transgenic non-human organism, or part thereof, of the invention, a seed of the invention and an extract or portion of any one thereof. In one embodiment, the oil comprises one or both of crepenynic acid and dehydrocrepenynate.
In another embodiment, the oil also comprises polyacetylenated fatty acid. Preferably, the polyacetylenated fatty acid comprises one or both of ene-diynoic acid and ene diyne-ene.
In an embodiment, the oil is seedoil.
In another aspect, the present invention provides acetylenated fatty acid produced by, or obtained from, any one or more of a cell of the invention, a transgenic non-human organism, or part thereof, of the invention, a seed of the invention, and an extract or portion of any one thereof.
In a further aspect, the present invention provides a method of producing oil comprising acetylenated fatty acids, the method comprising extracting oil from any one or more of a cell of the invention, a transgenic non-human organism, or part thereof, of the invention, a seed of the invention, and an extract or portion of any one thereof.
In one embodiment of the above two aspects, the acetylenated fatty acid comprises one or both of crepenynic acid and dehydrocrepenynate.
In another embodiment of the above two aspects, at least some of the fatty acid is polyacetylenated. Preferably, the polyacetylenated fatty acid comprises one or both of ene-diynoic acid and ene diyne-ene.
In an embodiment, the method further comprises obtaining a transgenic non- human organism, or part thereof, of the invention, or a seed of the invention.
In another aspect, the present invention provides a composition comprising any one or more of a cell of the invention, a polypeptide of the invention, a polynucleotide of the invention, oil of the invention, a fatty acid of the invention, and an extract or portion of any one thereof.
In a further aspect, provided are feedstuffs, cosmetics or chemicals comprising any one or more of a cell of the invention, a transgenic non-human organism, or part thereof, of the invention, a seed of the invention, oil of the invention, a fatty acid of the invention, a composition of the invention, and an extract or portion of any one thereof.
In yet another aspect, the present invention provides a method of producing a feedstuff, the method comprising admixing any one or more of a cell of the invention, a transgenic non-human organism, or part thereof, of the invention, a seed of the invention, oil of the invention, a fatty acid of the invention, a composition of the invention, and an extract or portion of any one thereof, with at least one other food ingredient. In a further aspect, the present invention provides a method of producing seed, the method comprising:
i) growing the transgenic plant of the invention, and
ii) harvesting the seed.
In another aspect, the present invention provides a fermentation process comprising the steps of:
i) providing a vessel containing a liquid composition comprising a cell of the invention, or a transgenic non-human organism of the invention, which is suitable for fermentation, and constituents required for fermentation and fatty acid biosynthesis, and
ii) providing conditions conducive to the fermentation of the liquid composition contained in said vessel.
Also provided is the use of any one or more of a cell of the invention, a transgenic non-human organism, or part thereof, of the invention, a seed of the invention, oil of the invention, a fatty acid of the invention, a composition of the invention, and an extract or portion of any one thereof, for the manufacture of an industrial product.
In an embodiment, the product is a lubricant or a polymer.
In another aspect, the present invention provides a method of treating and/or preventing a condition which would benefit from an acetylenated fatty acid, the method comprising administering to a subject any one or more of a cell of the invention, a polypeptide of the invention, a polynucleotide of the invention, a vector of the invention, a transgenic non-human organism, or part thereof, of the invention, a seed of the invention, oil of the invention, a fatty acid of the invention, a composition of the invention, and an extract or portion of any one thereof.
Examples of conditions which may be treated and/or prevented include, but are not limited to, type 2 diabetes, cancer or an infection.
Also provided is the use of any one or more of a cell of the invention, a polypeptide of the invention, a polynucleotide of the invention, a vector of the invention, a transgenic non-human organism, or part thereof, of the invention, a seed of the invention, oil of the invention, a fatty acid of the invention, a composition of the invention, and an extract or portion of any one thereof, for the manufacture of a medicament for treating and/or preventing a condition which would benefit from an acetylenated fatty acid. In a further aspect, the present invention provides a process for selecting a nucleic acid molecule encoding a polypeptide with Δ9 and/or Δ14 acetylenase activity, the process comprising;
i) obtaining a cell comprising a nucleic acid molecule operably linked to a promoter which is active in the cell, wherein the nucleic acid molecule encodes a polypeptide comprising amino acids having a sequence that is at least 50% identical to one or both of the sequences set forth in SEQ ID NO: 1 or SEQ ID NO:2,
ii) determining if the level of Δ9 and/or Δ14 acetylenated fatty acids is increased in the cell when compared to a corresponding cell lacking the nucleic acid, and
iii) selecting a nucleic acid molecule encoding a polypeptide with Δ9 and/or Δ14 acetylenase activity.
In another aspect, the present invention provides a process for selecting a nucleic acid molecule encoding a polypeptide with Δ14 and/or Δ16 conjugase activity, the process comprising;
i) obtaining a cell comprising a nucleic acid molecule operably linked to a promoter which is active in the cell, wherein the nucleic acid molecule encodes a polypeptide comprising amino acids having a sequence that is at least 50% identical to the sequences set forth in SEQ ID NO:3,
ii) determining if the level of Δ14 and/or Δ16 conjugated fatty acids is increased in the cell when compared to a corresponding cell lacking the nucleic acid, and
iii) selecting a nucleic acid molecule encoding a polypeptide with Δ14 and/or Δ16 conjugase activity.
In yet a further aspect, the present invention provides a process for selecting a nucleic acid molecule encoding a polypeptide with Δ12 acetylenase activity, the process comprising;
i) obtaining a cell comprising a nucleic acid molecule operably linked to a promoter which is active in the cell, wherein the nucleic acid molecule encodes a polypeptide comprising amino acids having a sequence that is at least 50% identical to the sequences set forth in SEQ ID NO:4,
ii) determining if the level of Δ12 acetylenated fatty acids fatty acids is increased in the cell when compared to a corresponding cell lacking the nucleic acid, and
iii) selecting a nucleic acid molecule encoding a polypeptide with Δ12 acetylenase activity.
With regard to the above three aspects, it is preferred that the polypeptide is an insect polypeptide or mutant thereof. Also provided is a substantially purified antibody, or fragment thereof, that specifically binds a polypeptide of the invention.
Any embodiment herein shall be taken to apply mutatis mutandis to any other embodiment unless specifically stated otherwise.
The present invention is not to be limited in scope by the specific embodiments described herein, which are intended for the purpose of exemplification only. Functionally-equivalent products, compositions and methods are clearly within the scope of the invention, as described herein.
The invention is hereinafter described by way of the following non-limiting Examples and with reference to the accompanying figures.
BRIEF DESCRIPTION OF THE ACCOMPANYING DRAWINGS
Figure 1. Yeast FAME analysis by GC/MS (A) chromatogram showing the production of CI 8:3 Z9,12A,Z14 (unequivocally identified by the product having an identical retention time and mass spectrum as a purchased standard chemical) in yeast expressing CL4 and fed with exogenous fatty acid (B) chromatogram showing production of the methylene interrupted diacetylenic fatty acid CI 8:2 9A,12A by CL2 expressed in yeast (C) the empty vector pYES2. All samples were fed with exogenous crepenynic acid (CI 8:2 Z9,12A).
Figure 2. Yeast FAME analysis by GC/MS (A) chromatogram showing production of the conjugated diacetylenic fatty acid CI 8:3 Z9,12A,14A by CL2 expressed in yeast (B) the empty vector pYES2. Both samples were fed with exogenous CI 8:3 Z9,12A,Z14. (C) The mass spectrum of the conjugated diacetylenic fatty acid methyl ester eluting at 19.9 min. CL2 acts on C18:3 Z9,12A,Z14 to produce a peak, at 19.9 min in the above chromatogram. There is no known chemical standard available to confirm the identification of this peak, however the mass spectra of the methyl ester of 13-octadecen-9,l l-diynoic acid (C18:3 Z9,11A,Z13) has the same major ions (Spitzer et al., 1991). Similar positional isomers of FAMEs will give very similar mass spectra. The peak produced by CL2 also occurs at an appropriately distant retention time relative to the substrate, CI 8:3 Z9,12A,Z14 indicating that it contains a conjugated di- yne which would be expected to elute at a retention time much later than the substrate.
Figure 3. Conversion pathway from oleic acid to the ene-diynoic acid (CI 8:3 Z9,12A,14A) and ene diyne-ene (C18:4 Z9, 12A, 14A, Z9) catalysed by the soldier beetle {Chauliognathus lugubris) enzymes CLIO, CL4 and CL2. Figure 4. N. benthamiana FAME analysis by GC/MS (A) chromatogram showing fatty acid profile of leaf expressing C. lugubris CL4 gene and fed with exogenous C18:2 Z9,12A and producing the conjugated fatty acid product C18:3 Z9,12A,Z14. (B) chromatogram of wild type leaf fed exogenous C18:2 Z9.12A.
KEY TO THE SEQUENCE LISTING
SEQ ID NO: l - Amino acid sequence of variant 1 of Chauliognathus lugubris Δ9/Δ14 acetylenase.
SEQ ID NO:2 - Amino acid sequence of variant 2 of Chauliognathus lugubris Δ9/Δ14 acetylenase.
SEQ ID NO:3 - Amino acid sequence of Chauliognathus lugubris Δ14/Δ16 conjugase. SEQ ID NO:4 - Amino acid sequence of Chauliognathus lugubris Δ12 acetylenase. SEQ ID NO:5 - Amino acid sequence of Helianthus annus Δ12 acetylenase.
SEQ ID NO:6 - Amino acid sequence of Crepis alpina Δ12 acetylenase.
SEQ ID NO:7 - Amino acid sequence of Hedera helix All acetylenase.
SEQ ID NO:8 - Polynucleotide encoding variant 1 of Chauliognathus lugubris Δ9/Δ14 acetylenase.
SEQ ID NO:9 - Polynucleotide encoding variant 2 of Chauliognathus lugubris Δ9/Δ14 acetylenase.
SEQ ID NO: 10 - Polynucleotide encoding Chauliognathus lugubris Δ14/Δ16 conjugase.
SEQ ID NO:l 1 - Polynucleotide encoding Chauliognathus lugubris Δ12 acetylenase. SEQ ID NO: 12 - Polynucleotide encoding Helianthus annus Δ12 acetylenase (Genbank Accession AY166773).
SEQ ID NO: 13 - Polynucleotide encoding Crepis alpina Δ12 acetylenase (Genbank Accession Yl 6285).
SEQ ID NO: 14 - Polynucleotide encoding Hedera helix All acetylenase (Genbank Accession AY166772).
SEQ ID NOs : 15 to 40 - Oligonucleotide primers.
SEQ ID NOs: 41 to 47 - Conserved motifs of the enzymes of the invention.
SEQ ID NO:48 - Amino acid sequence of Cantharellus formosus All and Δ14 desaturase.
SEQ ID NO:49 - Polynucleotide encoding Cantharellus formosus All and Δ14 desaturase (Genbank Accession HM036206).
SEQ ID NO:50 - Amino acid sequence of Cantharellus formosus All acetylenase. SEQ ID NO:51 - Polynucleotide encoding Cantharellus formosus Δ12 acetylenase (Genbank Accession HM036207).
DETAILED DESCRIPTION OF THE INVENTION
General Techniques and Definitions
Unless specifically defined otherwise, all technical and scientific terms used herein shall be taken to have the same meaning as commonly understood by one of ordinary skill in the art (e.g.. in cell culture, molecular genetics, lipid and fatty acid chemistry, protein chemistry, and biochemistry).
Unless otherwise indicated, the recombinant protein, cell culture, and immunological techniques utilized in the present invention are standard procedures, well known to those skilled in the art. Such techniques are described and explained throughout the literature in sources such as, J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press (1989), T.A. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), D M. Glover and B.D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1 -4, IRL Press (1995 and 1996), and F.M. Ausubel et al. (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley- Interscience (1988, including all updates until present), Ed Harlow and David Lane (editors) Antibodies: A Laboratory Manual, Cold Spring Harbour Laboratory, (1988), and J.E. Coligan et al. (editors) Current Protocols in Immunology, John Wiley & Sons (including all updates until present).
The term "and/or", e.g., "X and/or Y" shall be understood to mean either "X and Y" or "X or Y" and shall be taken to provide explicit support for both meanings or for either meaning.
Throughout this specification the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.
Selected Definitions
As used herein, the term "fatty acid" refers to a carboxylic acid (or organic acid), often with a long aliphatic tail, either saturated or unsaturated. Typically fatty acids have a carbon-carbon bonded chain of at least 8 carbon atoms in length, more preferably at least 12 carbons in length. Preferably, a fatty acid of the invention is, or is at least, 18 carbons in length. Most naturally occurring fatty acids have an even number of carbon atoms because their biosynthesis involves acetate which has two carbon atoms. The fatty acids may be in a free state (non-esterified) or in an esterified form such as part of a triglyceride, diacylglyceride, monoacylglyceride, acyl-CoA (thio-ester) bound or other bound form The fatty acids of the invention may be esterified as a phospholipid such as a phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylglycerol, phosphatidylinositol or diphosphatidylglycerol forms.
"Acetylenated fatty acids" comprise one or more alkyne functional groups along the chain, with each alkyne substituting a singly-bonded "-CH2-CH2-", and/or doubly- bonded "-CH=CH-", part of the chain with a triple-bonded " C^=C " portion (that is, a carbon triple bonded to another carbon). The two next carbon atoms in the chain that are bound to either side of the triple bond can occur in a cis or trans configuration. "Polyacetylenated fatty acids" comprises two or more triple bonds. In an embodiment, a polyacetylenated fatty acid produced by a method or cell of the invention comprises two triple bounds. Examples of polyacetylenated fatty acids are ene-diynoic acid and ene diyne-ene (Figure 3).
As used herein, the term "acetylenase" or "fatty acid acetylenase" refers to an enzyme which introduces a triple bond into a fatty acid substrate, and thus has "acetylenase activity". For example, a Δ12 acetylenase incorporates a triple bond at the 12th position from the carboxyl end of a fatty acid substrate, a Δ9 acetylenase incorporates a triple bond at the 9th position from the carboxyl end of a fatty acid substrate, and a Δ14 acetylenase incorporates a triple bond at the 14th position from the carboxyl end of a fatty acid substrate.
"Conjugated fatty acids" comprise a system of atoms covalently bonded with alternating single and multiple (for example double or triple) bonds such as -C=C-C=C- C-.
As used herein, the term "conjugase" or "fatty acid conjugase" refers to an enzyme capable of forming a conjugated bond in the acyl chain of a fatty acid, and thus has "conjugase activity". For example, a Δ14 conjugase of the invention incorporates a double bond at the 14th position from the carboxyl end of a fatty acid substrate which comprises a triple bond between the 12th and 13th carbons. Furthermore, a Δ16 conjugase of the invention incorporates a double bond at the 16th position from the carboxyl end of a fatty acid substrate which comprises a triple bond between the 12th and 13th carbons and a triple bond between the 14th and 15th carbons. As used herein, the term "desaturase" or "fatty acid desaturase" refers to an enzyme which is capable of introducing a carbon-carbon double bond into the acyl group of a fatty acid substrate which is typically in an esterified form such as, for example, fatty acid CoA esters. The acyl group may be esterified to a phospholipid such as phosphatidylcholine (PC), or to acyl carrier protein (ACP), or in a preferred embodiment to CoA. Desaturases generally may be categorized into three groups accordingly. Examples of known desaturases include, but are not limited to, Δ12 desaturases, Δ4 desaturases, Δ5 desaturases, Δ6 desaturases, Δ8 desaturases, <x>3 desaturases and Δ17 desaturases.
As used herein, a "Δ12 desaturase" refers to a protein which performs a desaturase reaction that introduces a carbon-carbon double bond at the 12th position from the carboxyl end of a fatty acid substrate.
As used herein, the term "oil" refers to a composition which comprises at least 60% (w/w) lipid. Oil is typically a liquid at room temperature. Preferably, the lipid predominantly comprises fatty acids which are, or are at least, 18 carbons in length. The fatty acids are typically in an esterified form, such as for example as triacylglycerols, acyl-CoA or phospholipid. The fatty acids may be free fatty acids and/or be found as monoacylglycerols (MAGs), diacylglycerols (DAGs) and/or triacylglycerols (TAGs). "Oil" of the invention may be "seedoil" if it is obtained from seed. Oil may be present in or obtained from cells, tissues, organs (such as plant vegetative tissue) or organisms other than seeds, in which case the oil is not seedoil as defined herein.
The level of production of fatty acid in the recombinant cell may also be expressed as a conversion efficiency, i.e., the amount of the fatty acid formed as a percentage of one or more substrate fatty acids (see, for example, Table 3). Unless otherwise indicated, the stated conversion efficiences are prefereably in relation to expression of the polypeptide(s) in a yeast cell.
As used herein, the term "seedoil" refers to a composition obtained from the seed/grain of a plant which comprises at least 60% (w/w) lipid. Seedoil is typically a liquid at room temperature. Preferably, the lipid predominantly (>50%) comprises fatty acids that are at least 16 carbons in length. More preferably, at least 50% of the total fatty acids in the seedoil are CI 8 fatty acids. The fatty acids are typically in an esterified form, such as for example as TAGs, acyl-CoA or phospholipid. The fatty acids may be free fatty acids and/or be found as monoacylglycerols (MAGs), diacylglycerols (DAGs) and/or triacylglycerols (TAGs). Seedoil of the invention can form part of the grain/seed or portion thereof. Alternatively, seedoil of the invention has been extracted from grain/seed. Thus, in an embodiment, "seedoil" of the invention is "substantially purified" or "purified" oil that has been separated from one or more other lipids, nucleic acids, polypeptides, or other contaminating molecules with which it is associated in its native state. It is preferred that the substantially purified oil is at least 60% free, more preferably at least 75% free, and more preferably at least 90% free from other components with which it is naturally associated. Seedoil of the invention may further comprise non-fatty acid molecules such as, but not limited to, sterols. In an embodiment, the seedoil is canola oil (Brassica napus, Brassica rapa ssp.), mustard oil {Brassica juncea), other Brassica oil, sunflower oil (Helianthus annus), linseed oil (Linum usitatissimum), soybean oil {Glycine max), safflower oil (Carthamus tinctorius), corn oil (Zea mays), tobacco oil (Nicotiana tabacum), peanut oil (Arachis hypogaea), palm oil, cottonseed oil (Gossypium hirsutum), coconut oil (Cocos nucifera), avocado oil (Persea americana), olive oil (Olea europaea), cashew oil (Anacardium occidentale), macadamia oil (Macadamia inter grifolia), almond oil (Primus amygdalus) or Arabidopsis seed oil (Arabidopsis thaliana). Seedoil may be extracted from seed by any method known in the art. This typically involves extraction with nonpolar solvents such as diethyl ether, petroleum ether, chlorofo rm/methanol or butanol mixtures. Lipids associated with the starch in the gram may be extracted with water-saturated butanol. The seedoil may be "de-gummed" by methods known in the art to remove polysaccharides or treated in other ways to remove contaminants or improve purity, stability or colour. The TAGs and other esters in the oil may be hydrolysed to release free fatty acids, or the oil hydrogenated or treated chemically or enzymatically as known in the art.
A "recombinant cell", "genetically modified cell" or variations thereof refers to a cell that contains a gene construct ("transgene") not found in a wild-type cell of the same species, variety or cultivar.
A "transgenic seed", "genetically modified seed" or variations thereof refers to a seed that contains a gene construct ("transgene") not found in a wild-type seed from the same species, variety or cultivar of plant.
A "transgenic plant", "genetically modified plant" or variations thereof refers to a plant that contains a gene construct ("transgene") not found in a wild-type plant of the same species, variety or cultivar.
A "transgene" as referred to herein has the normal meaning in the art of biotechnology and includes a genetic sequence which has been produced or altered by recombinant DNA or RNA technology and which has been introduced into the organism and/or cell. The transgene may include genetic sequences derived from, for example, a plant cell. Typically, the transgene has been introduced into the organism and/or cell by human manipulation such as, for example, by transformation but any method can be used as one of skill in the art recognizes.
The term "corresponding" refers to a cell, or non-human organism or part thereof that has the same or similar genetic background as a cell, or non-human organism or part thereof of the invention but that has not been modified as described herein (for example, the cell, or non-human organsim or part thereof lacks an exogenous polynucleotide encoding an acetylenase or conjugase). A corresponding cell or, non-human organism or part thereof can be used as a control to compare levels of nucleic acid expression, or the extent and nature of trait modification, for example acetylenated and/or conjugated fatty acid production and/or content, with a cell, or non- human organism or part thereof modified as described herein.
As used herein, the term "can be isolated from" means that the polynucleotide or encoded polypeptide is naturally produced by an organism, particularly Chauliognathus sp., such as Chauliognathus lugubris.
The terms "extract" and/or "part" refer to any portion of the cell or organism such as a plant. An "extract" typically involves the disruption of cells and partial purification of the resulting material, whereas "part" typically refers to the isolated portion of an organism (such as plant seeds or leaves). Naturally, the "extract" or "part" will comprise at least one acetylenated and/or conjugated fatty acid. Extracts and parts can be prepared using standard techniques of the art.
As used herein, the term "an exogenous polynucleotide which down regulates the production and/or activity of an endogenous enzyme" or variations thereof, refers to a polynucleotide that encodes an RNA molecules that down regulates the production and/or activity (for example, encoding an siRNA), or the exogenous polynucleotide itself down regulates the production and/or activity (for example, an siRNA is delivered to directly to, for instance, a cell). Such techniques are well known in the art.
As used herein, the phrase "does not significantly effect the production and/or activity of an enzyme" means that the level of activity of the enzyme is at least 75%, more preferably at least 90%, of the level of an isogenic recombinant cell lacking the exogenous polynucleotide that down regulates the production and/or activity of an endogenous enzyme.
For the purposes of this invention, the term "antibody", unless specified to the contrary, includes fragments of whole antibodies which retain their binding activity for a target analyte, as well as compounds comprising said fragments. Such fragments include Fv, F(ab') and F(ab')2 fragments, as well as single chain antibodies (scFv). Antibodies of the invention may be, for example diabodies, triabodies, tetrabodies, monoclonal or polyclonal, and can be produced using standard procedures in the art.
As used herein, the terms "treating", "treat" or "treatment" include administering a therapeutically effective amount of a compound(s) described herein sufficient to reduce or eliminate at least one symptom of the specified condition.
As used herein, the terms "preventing", "prevent" or "prevention" include administering a therapeutically effective amount of a compound(s) described herein sufficient to stop or hinder the development of at least one symptom of the specified condition.
As used herein, the term "subject" refers to any organism which may benefit from having increased levels of a fatty acid as defined herein. In a preferred embodiment, the subject is a mammal. In a particularly preferred embodiment, the subject is a human. Other preferred embodiments include companion animals such as cats and dogs, as well as livestock animals such as horses, cattle, sheep and goats.
Polyp eptides/P ep tides
The invention provides polypeptides which may be purified or recombinant. By "substantially purified polypeptide" or "purified polypeptide" we mean a polypeptide that has generally been separated from the lipids, nucleic acids, other peptides, and other contaminating molecules with which it is associated in a cell in which it is produced or in its native state. Preferably, the substantially purified polypeptide is at least 60% free, more preferably at least 75% free, and more preferably at least 90% free from other components in the cell in which it is produced or with which it is naturally associated.
The term "recombinant" in the context of a polypeptide refers to the polypeptide when produced by a cell, or in a cell-free expression system, in an altered amount or at an altered rate, compared to its native state if it is produced naturally. In one embodiment the cell is a cell that does not naturally produce the polypeptide. However, the cell may be a cell which comprises a non-endogenous gene that causes an altered amount of the polypeptide to be produced. A recombinant polypeptide of the invention includes polypeptides in the cell, tissue, organ or organism, or cell-free expression system, in which it is produced i.e. a polypeptide which has not been purified or separated from other components of the transgenic (recombinant) cell in which it was produced, and polypeptides produced in such cells or cell-free systems which are subsequently purified away from at least some other components.
The terms "polypeptide" and "protein" are generally used interchangeably. The % identity of a polypeptide to a reference amino acid sequence is typically determined by GAP analysis (Needleman and Wunsch, 1970; GCG program) with parameters of a gap creation penalty=5, and a gap extension penalty=0.3. The query sequence is at least 15 amino acids in length, and the GAP analysis aligns the two sequences over a region of at least 15 amino acids. More preferably, the query sequence is at least 50 amino acids in length, and the GAP analysis aligns the two sequences over a region of at least 50 amino acids. More preferably, the query sequence is at least 100 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 100 amino acids. Even more preferably, the query sequence is at least 250 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 250 amino acids. Even more preferably, the GAP analysis aligns two sequences over their entire length. Preferably, the polypeptide has an enzymatic activity of at least 10% of the activity of the reference polypeptide.
As used herein a "biologically active" fragment is a portion of a polypeptide of the invention which maintains a defined activity of a full-length reference polypeptide, for example possessing acetylenase or conjugase activity. Biologically active fragments as used herein exclude the full-length polypeptide. Biologically active fragments can be any size portion as long as they maintain the defined activity. Preferably, the biologically active fragment maintains at least 10% of the activity of the full length protein.
With regard to a defined polypeptide or enzyme, it will be appreciated that % identity figures higher than those provided herein will encompass preferred embodiments. Thus, where applicable, in light of the minimum % identity figures, it is preferred that the polypeptide/enzyme comprises an amino acid sequence which is at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 76%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8%, and even more preferably at least 99.9% identical to the relevant nominated SEQ ID NO.
Amino acid sequence mutants of the polypeptides of the defined herein can be prepared by introducing appropriate nucleotide changes into a nucleic acid defined herein, or by in vitro synthesis of the desired polypeptide. Such mutants include, for example, deletions, insertions or substitutions of residues within the amino acid sequence. A combination of deletion, insertion and substitution can be made to arrive at the final construct, provided that the final polypeptide product possesses the desired characteristics.
Mutant (altered) polypeptides can be prepared using any technique known in the art. For example, a polynucleotide of the invention can be subjected to in vitro mutagenesis. Such in vitro mutagenesis techniques include sub-cloning the polynucleotide into a suitable vector, transforming the vector into a "mutator" strain such as the E. coli XL-1 red (Stratagene) and propagating the transformed bacteria for a suitable number of generations. In another example, the polynucleotides of the invention are subjected to DNA shuffling techniques as broadly described by Harayama (1998). Products derived from mutated/altered DNA can readily be screened using techniques described herein to determine if they possess acetylenase or conjugase activity.
In designing amino acid sequence mutants, the location of the mutation site and the nature of the mutation will depend on characteristic(s) to be modified. The sites for mutation can be modified individually or in series, e.g., by (1) substituting first with conservative amino acid choices and then with more radical selections depending upon the results achieved, (2) deleting the target residue, or (3) inserting other residues adjacent to the located site.
Amino acid sequence deletions generally range from about 1 to 15 residues, more preferably about 1 to 10 residues and typically about 1 to 5 contiguous residues.
Substitution mutants have at least one amino acid residue in the polypeptide molecule removed and a different residue inserted in its place. The sites of greatest interest for substitutional mutagenesis include sites identified as the active site(s). Other sites of interest are those in which particular residues obtained from various strains or species are identical. These positions may be important for biological activity. These sites, especially those falling within a sequence of at least three other identically conserved sites, are preferably substituted in a relatively conservative manner. Such conservative substitutions are shown in Table 1 under the heading of "exemplary substitutions".
In a preferred embodiment a mutant/variant polypeptide has only, or not more than, one or two or three or four conservative amino acid changes when compared to a naturally occurring polypeptide. Details of conservative amino acid changes are provided in Table 1. As the skilled person would be aware, such minor changes can reasonably be predicted not to alter the activity of the polypeptide when expressed in a recombinant cell.
In an embodiment, a polypeptide of the invention has one, two, three, four, five, six or all of the following motifs; TAGXHRLWXH (incorporating the 1st 'histidine box') (SEQ ID NO:41), YKARWPL (between 1st and 2nd histidine boxes) (SEQ ID NO:42), HRVHH (2nd 'histidine box') (SEQ ID NO:43), YTETDADPXNAKRG (between 2nd and 3rd histidine boxes) (SEQ ID NO:44), WHNYHH (3rd histidine box) (SEQ ID NO:45), AYDLK (Post 3rd histidine box) (SEQ ID NO:46) and GDGSH (towards C-terminus) (SEQ ID NO:47).
Exemplary substitutions.
Figure imgf000026_0001
Also included within the scope of the invention are polypeptides defined herein which are differentially modified during or after synthesis, for example, by biotinylation, benzylation, glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. These modifications may serve to increase the stability and/or bioactivity of the polypeptide of the invention.
Polypeptides can be produced in a variety of ways, including production and recovery of natural polypeptides, production and recovery of recombinant polypeptides, and chemical synthesis of the polypeptides. In one embodiment, a recombinant polypeptide is produced by culturing a cell capable of expressing the polypeptide under conditions effective to produce the polypeptide. The recombinant polypeptide may subsequently be secreted from the cell and recovered, or extracted from the cell and recovered, and is preferably purified away from contaminating molecules. It may or may not be further modified chemically or enzymatically. A preferred cell to culture is a recombinant cell defined herein. Effective culture conditions include, but are not limited to, effective media, bioreactor, temperature, pH and oxygen conditions that permit polypeptide production. An effective medium refers to any medium in which a cell is cultured to produce a polypeptide defined herein. Such medium typically comprises an aqueous medium having assimilable carbon, nitrogen and phosphate sources, and appropriate salts, minerals, metals and other nutrients, such as vitamins. Cells defined herein can be cultured in conventional fermentation bioreactors, shake flasks, test tubes, microtiter dishes, and petri plates. Culturing can be carried out at a temperature, pH and oxygen content appropriate for a recombinant cell. Such culturing conditions are within the expertise of one of ordinary skill in the art. A more preferred cell to produce the polypeptide is a cell in a plant, especially in a seed in a plant.
Polynucleotides
The invention also provides for polynucleotides which may be, for example, a gene, an isolated polynucleotide, or a chimeric DNA. It may be DNA or RNA of genomic or synthetic origin, double-stranded or single-stranded, and combined with carbohydrate, lipids, protein or other materials to perform a particular activity defined herein. The term "polynucleotide" is used interchangeably herein with the term "nucleic acid molecule". By "isolated polynucleotide" we mean a polynucleotide which, if obtained from a natural source, has been separated from the polynucleotide sequences with which it is associated or linked in its native state, or a non-naturally occurring polynucleotide. Preferably, the isolated polynucleotide is at least 60% free, more preferably at least 75% free, and more preferably at least 90% free from other components with which it is naturally associated.
As used herein, the term "gene" is to be taken in its broadest context and includes the deoxyribonucleotide sequences comprising the transcribed region and, if translated, the protein coding region, of a structural gene and including sequences located adjacent to the coding region on both the 5' and 3' ends for a distance of at least about 2 kb on either end and which are involved in expression of the gene. In this regard, the gene includes control signals such as promoters, enhancers, termination and/or polyadenylation signals that are naturally associated with a given gene, or heterologous control signals in which case the gene is referred to as a "chimeric gene". The sequences which are located 5' of the protein coding region and which are present on the mRNA are referred to as 5' non-translated sequences. The sequences which are located 3' or downstream of the protein coding region and which are present on the mRNA are referred to as 3' non-translated sequences. The term "gene" encompasses both cDNA and genomic forms of a gene. A genomic form or clone of a gene contains the coding region which may be interrupted with non-codmg sequences termed "introns" or "intervening regions" or "intervening sequences. " Introns are segments of a gene which are transcribed into nuclear RNA (hnRNA). Introns may contain regulatory elements such as enhancers. Introns are removed or "spliced out" from the nuclear or primary transcript; introns therefore are absent in the messenger RNA (mRNA) transcript. The mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide. The term "gene" includes a synthetic or fusion molecule encoding all or part of the proteins of the invention described herein and a complementary nucleotide sequence to any one of the above.
The term "endogenous" is used herein to refer to a substance that is normally present or produced in an unmodified organism and/or cell at the same developmental stage as the organism and/or cell under investigation. An "endogenous gene" refers to a native gene in its natural location in the genome of an organism. As used herein, "recombinant nucleic acid molecule", "recombinant polynucleotide" or variations thereof refer to a nucleic acid molecule which has been constructed or modified by recombinant DNA technology. The terms "foreign polynucleotide" or "exogenous polynucleotide" or "heterologous polynucleotide" and the like refer to any nucleic acid which is introduced into the genome of a cell by experimental manipulations. Foreign or exogenous genes may be genes that are inserted into a non-native organism, native genes introduced into a new location within the native host, or chimeric genes. A "transgene" is a gene that has been introduced into the genome by a transformation procedure. The terms "recombinant", "genetically modified", "transgenic" and variations thereof include introducing genes into cells by transformation or transduction, mutating genes in cells and altering or modulating the regulation of a gene in a cell or organisms to which these acts have been done or their progeny. A "genomic region" as used herein refers to a position within the genome where a transgene, or group of transgenes (also referred to herein as a cluster), have been inserted into a cell, or an ancestor thereof. Such regions only comprise nucleotides that have been incorporated by the intervention of man such as by methods described herein.
The term "exogenous" in the context of a polynucleotide refers to the polynucleotide when present in a cell in an altered amount compared to its native state. In one embodiment, the cell is a cell that does not naturally comprise the polynucleotide. However, the cell may be a cell which comprises a non-endogenous polynucleotide resulting in an altered amount of production of the encoded polypeptide. An exogenous polynucleotide of the invention includes polynucleotides which have not been separated from other components of the transgenic (recombinant) cell, or cell-free expression system, in which it is present, and polynucleotides produced in such cells or cell-free systems which are subsequently purified away from at least some other components. The exogenous polynucleotide (nucleic acid) can be a contiguous stretch of nucleotides existing in nature, or comprise two or more contiguous stretches of nucleotides from different sources (naturally occurring and/or synthetic) joined to form a single polynucleotide. Typically such chimeric polynucleotides comprise at least an open reading frame encoding a polypeptide of the invention operably linked to a promoter suitable of driving transcription of the open reading frame in a cell of interest.
With regard to the defined polynucleotides, it will be appreciated that % identity figures higher than those provided above will encompass preferred embodiments. Thus, where applicable, in light of the minimum % identity figures, it is preferred that the polynucleotide comprises a polynucleotide sequence which is at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%. more preferably at least 91 %, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1 %, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8%, and even more preferably at least 99.9% identical to the relevant nominated SEQ ID NO.
A polynucleotide of the present invention may selectively hybridise, under stringent conditions, to a polynucleotide that encodes a polypeptide of the present invention. As used herein, stringent conditions are those that (1) employ during hybridisation a denaturing agent such as formamide, for example, 50% (v/v) formamide with 0.1% (w/v) bovine serum albumin, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate at 42°C; or (2) employ 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 g/ml), 0.1% SDS and 10% dextran sulfate at 42°C in 0.2 x SSC and 0.1% SDS and/or (3) employ low ionic strength and high temperature for washing, for example, 0.015 M NaCl/0.0015 M sodium citrate/0.1% SDS at 50°C.
Polynucleotides of the invention may possess, when compared to naturally occurring molecules, one or more mutations which are deletions, insertions, or substitutions of nucleotide residues. Polynucleotides which have mutations relative to a reference sequence can be either naturally occurring (that is to say, isolated from a natural source) or synthetic (for example, by performing site-directed mutagenesis or DNA shuffling on the nucleic acid as described above). It is thus apparent that polynucleotides of the invention can be either from a naturally occurring source or recombinant.
Recombinant Vectors
One embodiment of the present invention includes a recombinant vector, which comprises at least one polynucleotide molecule defined herein, inserted into any vector capable of delivering the polynucleotide molecule into a host cell. Recombinant vectors include expression vectors. Recombinant vectors contain heterologous polynucleotide sequences, that is polynucleotide sequences that are not naturally found adjacent to polynucleotide molecules defined herein that preferably are derived from a species other than the species from which the polynucleotide molecule(s) are derived. The vector can be either RNA or DNA, either prokaryotic or eukaryotic, and typically is a viral vector, derived from a virus, or a plasmid. Plasmid vectors typically include additional nucleic acid sequences that provide for easy selection, amplification, and transformation of the expression cassette in prokaryotic cells, e.g., pUC-derived vectors, pSK-derived vectors, pGEM-derived vectors, pSP-derived vectors, pBS- derived vectors, or binary vectors containing one or more T-DNA regions. Additional nucleic acid sequences include origins of replication to provide for autonomous replication of the vector, selectable marker genes, preferably encoding antibiotic or herbicide resistance, unique multiple cloning sites providing for multiple sites to insert nucleic acid sequences or genes encoded in the nucleic acid construct, and sequences that enhance transformation of prokaryotic and eukaryotic (especially plant) cells. The recombinant vector may comprise more than one polynucleotide defined herein, for example two or three polynucleotides of the invention in combination, each operably linked to expression control sequences that are operable in the cell of interest. Such more than one polynucleotide of the invention, for example 2 or 3 polynucleotides, are preferably covalently joined together in a single recombinant vector, which may then be introduced as a single molecule into a cell to form a recombinant cell according to the invention, and preferably integrated into the genome of the recombinant cell, for example in a transgenic plant. Thereby, the polynucleotides which are so joined will be inherited together as a single genetic locus in progeny of the recombinant cell or plant. The recombinant vector or plant may comprise two or more such recombinant vectors, each containing multiple polynucleotides, for example wherein each recombinant vector comprises 2 or 3 polynucleotides.
"Operably linked" as used herein refers to a functional relationship between two or more nucleic acid (e.g., DNA) segments. Typically, it refers to the functional relationship of transcriptional regulatory element (promoter) to a transcribed sequence. For example, a promoter is operably linked to a coding sequence, such as a polynucleotide defined herein, if it stimulates or modulates the transcription of the coding sequence in an appropriate cell. Generally, promoter transcriptional regulatory elements that are operably linked to a transcribed sequence are physically contiguous to the transcribed sequence, i.e., they are cw-acting. However, some transcriptional regulatory elements, such as enhancers, need not be physically contiguous or located in close proximity to the coding sequences whose transcription they enhance.
When there are multiple promoters present, each promoter may independently be the same or different.
Recombinant molecules such as the chimeric DNAs may also contain (a) one or more secretory signals which encode signal peptide sequences, to enable an expressed polypeptide defined herein to be secreted from the cell that produces the polypeptide or which provide for localisation of the expressed polypeptide, for example for retention of the polypeptide in the endoplasmic reticulum (ER) in the cell or transfer into a plastid, and/or (b) contain fusion sequences which lead to the expression of nucleic acid molecules as fusion proteins. Examples of suitable signal segments include any signal segment capable of directing the secretion or localisation of a polypeptide defined herein. Preferred signal segments include, but are not limited to, Nicotiana nectarin signal peptide (US 5,939,288), tobacco extensin signal or the soy oleosin oil body binding protein signal. Recombinant molecules may also include intervening and/or untranslated sequences surrounding and/or within the nucleic acid sequences of nucleic acid molecules defined herein.
To facilitate identification of transformants, the nucleic acid construct desirably comprises a selectable or screenable marker gene as, or in addition to, the foreign or exogenous polynucleotide. By "marker gene" is meant a gene that imparts a distinct phenotype to cells expressing the marker gene and thus allows such transformed cells to be distinguished from cells that do not have the marker. A selectable marker gene confers a trait for which one can "select" based on resistance to a selective agent (e.g., a herbicide, antibiotic, radiation, heat, or other treatment damaging to untransformed cells). A screenable marker gene (or reporter gene) confers a trait that one can identify through observation or testing, i.e., by "screening" (e.g., β-glucuronidase, luciferase, GFP or other enzyme activity not present in untransformed cells). The marker gene and the nucleotide sequence of interest do not have to be linked. The actual choice of a marker is not crucial as long as it is functional (i.e., selective) in combination with the cells of choice such as a plant cell. The marker gene and the foreign or exogenous polynucleotide of interest do not have to be linked, since co-transformation of unlinked genes as, for example, described in US 4,399,216 is also an efficient process in plant transformation.
Examples of bacterial selectable markers are markers that confer antibiotic resistance such as ampicillin, erythromycin, chloramphenicol or tetracycline resistance, preferably kanamycin resistance. Exemplary selectable markers for selection of plant transformants include, but are not limited to, a hyg gene which encodes hygromycin B resistance; a neomycin phosphotransferase (nptll) gene conferring resistance to kanamycin, paromomycin, G418; a glutathione-S-transferase gene from rat liver conferring resistance to glutathione derived herbicides as, for example, described in EP 256223; a glutamine synthetase gene conferring, upon overexpression, resistance to glutamine synthetase inhibitors such as phosphinothricin as, for example, described in WO 87/05327, an acetyltransferase gene from Streptomyces viridochromogenes conferring resistance to the selective agent phosphinothricin as, for example, described in EP 275957, a gene encoding a 5-enolshikimate-3-phosphate synthase (EPSPS) conferring tolerance to N-phosphonomethylglycine as, for example, described by Hinchee et al. (1988), a bar gene conferring resistance against bialaphos as, for example, described in WO91/02071 ; a nitrilase gene such as bxn from Klebsiella ozaenae which confers resistance to bromoxynil (Stalker et al., 1988); a dihydro folate reductase (DHFR) gene conferring resistance to methotrexate (Thillet et al., 1988); a mutant acetolactate synthase gene (ALS), which confers resistance to imidazolinone, sulfonylurea or other ALS -inhibiting chemicals (EP 154,204); a mutated anthranilate synthase gene that confers resistance to 5-methyl tryptophan; or a dalapon dehalogenase gene that confers resistance to the herbicide.
Preferred screenable markers include, but are not limited to, a uidA gene encoding a β-glucuronidase (GUS) enzyme for which various chromogenic substrates are known, a β-galactosidase gene encoding an enzyme for which chromogenic substrates are known, an aequo rin gene (Prasher et al., 1985), which may be employed in calcium-sensitive bioluminescence detection; a green fluorescent protein gene (Niedz et al., 1995) or derivatives thereof; a luciferase (luc) gene (Ow et al., 1986), which allows for bioluminescence detection, and others known in the art. By "reporter molecule" as used in the present specification is meant a molecule that, by its chemical nature, provides an analytically identifiable signal that facilitates determination of promoter activity by reference to protein product.
Preferably, the nucleic acid construct is stably incorporated into the genome of the cell, such as the plant cell. Accordingly, the nucleic acid may comprise appropriate elements which allow the molecule to be incorporated into the genome, or the construct is placed in an appropriate vector which can be incorporated into a chromosome of the cell. Expression
As used herein, an expression vector is a DNA or RNA vector that is capable of transforming a host cell and of effecting expression of one or more specified polynucleotide molecule(s). Preferably, the expression vector is also capable of replicating within the host cell. Expression vectors can be either prokaryotic or eukaryotic, and are typically viruses or plasmids. Expression vectors of the present invention include any vectors that function (i.e., direct gene expression) in recombinant cells of the present invention, including in bacterial, fungal, endoparasite, arthropod, animal, and plant cells. Particularly preferred expression vectors of the present invention can direct gene expression in yeast and/or plant cells.
Expression vectors of the present invention contain regulator}' sequences such as transcription control sequences, translation control sequences, origins of replication, and other regulatory sequences that are compatible with the recombinant cell and that control the expression of polynucleotide molecules of the present invention. In particular, polynucleotides or vectors of the present invention include transcription control sequences. Transcription control sequences are sequences which control the initiation, elongation, and termination of transcription. Particularly important transcription control sequences are those which control transcription initiation, such as promoter, enhancer, operator and repressor sequences. Suitable transcription control sequences include any transcription control sequence that can function in at least one of the recombinant cells of the present invention. The choice of the regulator}' sequences used depends on the target organism such as a plant and/or target organ or tissue of interest. Such regulatory sequences may be obtained from any eukaryotic organism such as plants or plant viruses, or may be chemically synthesized. A variety of such transcription control sequences are known to those skilled in the art. Particularly preferred transcription control sequences are promoters active in directing transcription in plants, either constitutively or stage and/or tissue specific, depending on the use of the plant or parts thereof.
A number of vectors suitable for stable transfection of plant cells or for the establishment of transgenic plants have been described in, e.g., Pouwels et al., Cloning Vectors: A Laboratory Manual, 1985. supp. 1987; Weissbach and Weissbach, Methods for Plant Molecular Biology, Academic Press, 1989; and Gelvin et al., Plant Molecular Biology Manual, Kluwer Academic Publishers, 1990. Typically, plant expression vectors include, for example, one or more cloned plant genes under the transcriptional control of 5' and 3' regulatory sequences and a dominant selectable marker. Such plant expression vectors also can contain a promoter regulatory region (e.g., a regulatory region controlling inducible or constitutive, environmentally- or developmentally- regulated, or cell- or tissue-specific expression), a transcription initiation start site, a ribosome binding site, an RNA processing signal, a transcription termination site, and/or a polyadenylation signal.
A number of constitutive promoters that are active in plant cells have been described. Suitable promoters for constitutive expression in plants include, but are not limited to, the cauliflower mosaic virus (CaMV) 35 S promoter, the Figwort mosaic virus (FMV) 35S, the sugarcane bacilliform virus promoter, the commelina yellow mottle virus promoter, the light-inducible promoter from the small subunit of the ribulose- 1,5 -bis-phosphate carboxylase, the rice cytosolic triosephosphate isomerase promoter, the adenine phosphoribosyltransferase promoter of Arabidopsis, the rice actin 1 gene promoter, the mannopine synthase and octopine synthase promoters, the Adh promoter, the sucrose synthase promoter, the R gene complex promoter, and the chlorophyll α/β binding protein gene promoter. These promoters have been used to create DNA vectors that have been expressed in plants; see, e.g., WO 84/02913. All of these promoters have been used to create various types of plant-expressible recombinant DNA vectors.
For the purpose of expression in source tissues of the plant, such as the leaf, seed, root or stem, it is preferred that the promoters utilized in the present invention have relatively high expression in these specific tissues. For this purpose, one may choose from a number of promoters for genes with tissue- or cell-specific or -enhanced expression. Examples of such promoters reported in the literature include the chloroplast glutamine synthetase GS2 promoter from pea, the chloroplast fructose-1,6- biphosphatase promoter from wheat, the nuclear photosynthetic ST-LSl promoter from potato, the serine/threonine kinase promoter and the glucoamylase (CHS) promoter from Arabidopsis thaliana. Also reported to be active in photo synthetically active tissues are the ribulose-l,5-bisphosphate carboxylase promoter from eastern larch (Larix laricina), the promoter for the Cab gene, Cab6, from pine, the promoter for the Cab-1 gene from wheat, the promoter for the Cab-1 gene from spinach, the promoter for the Cab 1R gene from rice, the pyruvate, orthophosphate dikinase (PPDK) promoter from Zea mays, the promoter for the tobacco Lhcbl*2 gene, the Arabidopsis thaliana Suc2 sucrose-Ff0 symporter promoter, and the promoter for the thylakoid membrane protein genes from spinach (PsaD, PsaF, PsaE, PC, FNR, AtpC, AtpD, Cab, RbcS).
Other promoters for the chlorophyll α/β -binding proteins may also be utilized in the present invention, such as the promoters for LhcB gene and PsbP gene from white mustard (Sinapis alba). A variety of plant gene promoters that are regulated in response to environmental, hormonal, chemical, and/or developmental signals, also can be used for expression of RNA-binding protein genes in plant cells, including promoters regulated by (1) heat, (2) light (e.g., pea RbcS-3A promoter, maize RbcS promoter); (3) hormones, such as abscisic acid, (4) wounding (e.g., Wunl); or (5) chemicals, such as methyl jasmonate, salicylic acid, steroid hormones, alcohol, Safeners (WO 97/06269), or it may also be advantageous to employ (6) organ-specific promoters.
In a further preferred embodiment, the promoter is a plant storage organ specific promoter. As used herein, the term "plant storage organ specific promoter" refers to a promoter that preferentially, when compared to other plant tissues, directs gene transcription in a storage organ of a plant. Preferably, the promoter only directs expression of a gene of interest in the storage organ, and/or expression of the gene of interest in other parts of the plant such as leaves is not detectable by Northern blot analysis and/or RT-PCR. Typically, the promoter drives expression of genes during growth and development of the storage organ, in particular during the phase of synthesis and accumulation of storage compounds in the storage organ. Such promoters may drive gene expression in the entire plant storage organ or only part thereof such as the seedcoat, embryo or cotyledon(s) in seeds of dicotyledonous plants or the endosperm or aleurone layer of a seeds of monocotyledonous plants.
In one embodiment, the plant storage organ specific promoter is a seed specific promoter. In a more preferred embodiment, the promoter preferentially directs expression in the cotyledons of a dicotyledonous plant or in the endosperm of a monocotyledonous plant, relative to expression in the embryo of the seed or relative to other organs in the plant such as leaves. Preferred promoters for seed-specific expression include i) promoters from genes encoding enzymes involved in fatty acid biosynthesis and accumulation in seeds, such as desaturases and elongases, ii) promoters from genes encoding seed storage proteins, and iii) promoters from genes encoding enzymes involved in carbohydrate biosynthesis and accumulation in seeds. Seed specific promoters which are suitable are the oilseed rape napin gene promoter (US 5,608,152), the Vicia faba USP promoter (Baumlein et al., 1991), the Arabidopsis oleosin promoter (WO 98/45461), the Phaseolus vulgaris phaseolin promoter (US 5,504,200), the Brassica Bce4 promoter (WO 91/13980) or the legumin B4 promoter (Baumlein et al., 1992), and promoters which lead to the seed-specific expression in monocots such as maize, barley, wheat, rye, rice and the like. Notable promoters which are suitable are the barley lpt2 or lptl gene promoter (WO 95/15389 and WO 95/23230) or the promoters described in WO 99/16890 (promoters from the barley hordein gene, the rice glutelin gene, the rice oryzin gene, the rice prolamin gene, the wheat gliadin gene, the wheat glutelin gene, the maize zein gene, the oat glutelin gene, the sorghum kasirin gene, the rye secalin gene). Other promoters include those described by Broun et al. (1998), Potenza et al. (2004), US 20070192902 and US 20030159173. In an embodiment, the seed specific promoter is preferentially expressed in defined parts of the seed such as the cotyledon(s) or the endosperm. Examples of cotyledon specific promoters include, but are not limited to, the FP1 promoter (Ellerstrom et al, 1996), the pea legumin promoter (Perrin et al, 2000), and the bean phytohemagglutnin promoter (Perrin et al., 2000). Examples of endosperm specific promoters include, but are not limited to, the maize zein-1 promoter (Chikwamba et al., 2003), the rice glutelin-1 promoter (Yang et al., 2003), the barley D-hordein promoter (Horvath et al., 2000) and wheat HMW glutemn promoters (Alvarez et al., 2000). In a further embodiment, the seed specific promoter is not expressed, or is only expressed at a low level, in the embryo and/or after the seed germinates.
For the purpose of expression in sink tissues of the plant, such as the tuber of the potato plant, the fruit of tomato, or the seed of soybean, canola, cotton, Zea mays, wheat, rice, and barley, it is preferred that the promoters utilized in the present invention have relatively high expression in these specific tissues. A number of promoters for genes with tuber-specific or -enhanced expression are known, including the class I patatin promoter, the promoter for the potato tuber ADPGPP genes, both the large and small subunits, the sucrose synthase promoter, the promoter for the major tuber proteins including the 22 kD protein complexes and proteinase inhibitors, the promoter for the granule bound starch synthase gene (GBSS), and other class I and II patatins promoters. Other promoters can also be used to express a protein in specific tissues, such as seeds or fruits. The promoter for β-conglycinin or other seed-specific promoters such as the napin, zein, linin and phaseolin promoters, can be used. Root specific promoters may also be used. An example of such a promoter is the promoter for the acid chitinase gene. Expression in root tissue could also be accomplished by utilizing the root specific subdomains of the CaMV 35S promoter that have been identified.
In another embodiment, the plant storage organ specific promoter is a fruit specific promoter. Examples include, but are not limited to, the tomato polygalacturonase, E8 and Pds promoters, as well as the apple ACC oxidase promoter (for review see Potenza et al., 2004). In a preferred embodiment, the promoter preferentially directs expression in the edible parts of the fruit, for example the pith of the fruit, relative to the skin of the fruit or the seeds within the fruit.
In a particularly preferred embodiment, the promoter directs expression in tissues and organs in which fatty acid and oil biosynthesis takes place. Such promoters act in seed development at a suitable time for modifying oil composition in seeds.
The 5' non-translated leader sequence can be derived from the promoter selected to express the heterologous gene sequence of the polynucleotide of the present invention, or may be heterologous with respect to the coding region of the enzyme to be produced, and can be specifically modified if desired so as to increase translation of mRNA. For a review of optimizing expression of trans genes, see Koziel et al. (1996). The 5' non-translated regions can also be obtained from plant viral RNAs (Tobacco mosaic virus, Tobacco etch virus, Maize dwarf mosaic virus, Alfalfa mosaic virus, among others) from suitable eukaryotic genes, plant genes (wheat and maize chlorophyll a/b binding protein gene leader), or from a synthetic gene sequence. The present invention is not limited to constructs wherein the non-translated region is derived from the 5' non-translated sequence that accompanies the promoter sequence. The leader sequence could also be derived from an unrelated promoter or coding sequence. Leader sequences useful in context of the present invention comprise the maize Hsp70 leader (US 5,362,865 and US 5,859,347), and the TMV omega element.
The termination of transcription is accomplished by a 3' non-translated DNA sequence operably linked in the chimeric vector to the polynucleotide of interest. The 3' non-translated region of a recombinant DNA molecule contains a polyadenylation signal that functions in plants to cause the addition of adenylate nucleotides to the 3' end of the RNA. The 3' non-translated region can be obtained from various genes that are expressed in plant cells. The nopaline synthase 3' untranslated region, the 3' untranslated region from pea small subunit Rubisco gene, the 3' untranslated region from soybean 7S seed storage protein gene are commonly used in this capacity. The 3' transcribed, non-translated regions containing the polyadenylate signal of Agrobacterium tumor-inducing (Ti) plasmid genes are also suitable.
Recombinant DNA technologies can be used to improve expression of a transformed polynucleotide molecule by manipulating, for example, the number of copies of the polynucleotide molecule within a host cell, the efficiency with which those polynucleotide molecules are transcribed, the efficiency with which the resultant transcripts are translated, and the efficiency of post-translational modifications. Recombinant techniques useful for increasing the expression of polynucleotide molecules defined herein include, but are not limited to, operatively linking polynucleotide molecules to high-copy number plasmids, integration of the polynucleotide molecule into one or more host cell chromosomes, addition of vector stability sequences to plasmids, substitutions or modifications of transcription control signals (e.g., promoters, operators, enhancers), substitutions or modifications of translational control signals (e.g., ribosome binding sites, Shine-Dalgarno sequences), modification of polynucleotide molecules to correspond to the codon usage of the host cell, and the deletion of sequences that destabilize transcripts.
Recombinant Cells
The invention also provides a recombinant cell which is a host cell transformed with one or more recombinant molecules, such as the polynucleotides, chimeric DNAs or recombinant vectors etc defined herein. The recombinant cell may comprise any combination thereof, such as two or three recombinant vectors, or a recombinant vector and one or more additional polynucleotides or chimeric DNAs. Suitable cells of the invention include any cell that can be transformed with a polynucleotide, chimeric DNA or recombinant vector of the invention, such as for example, a molecule encoding a polypeptide or enzyme described herein. The cell is preferably a cell which is thereby capable of being used for producing fatty acids. The recombinant cell may be a cell in culture, a cell in vitro, or in an organism such as for example a plant, or in an organ such as for example a seed or a leaf.
Host cells into which the polynucleotide(s) are introduced can be either untransformed cells or cells that are already transformed with at least one nucleic acid molecule. Such nucleic acid molecules may be related to fatty acid synthesis, or unrelated. Host cells of the present invention either can be endogenously (i.e., naturally) capable of producing proteins defined herein, in which case the recombinant cell derived therefrom has an enhanced capability of producing the polypeptides, or can be capable of producing such proteins only after being transformed with at least one polynucleotide of the invention.
Host cells of the present invention can be any cell capable of producing at least one protein described herein, and include bacterial, fungal (including yeast), parasite, arthropod, animal and plant cells. The cells may be prokaryotic or eukaryotic. Preferred host cells are yeast and plant cells. In a preferred embodiment, the plant cell is a seed cell, in particular a cell in a cotyledon or endosperm of a seed. In one embodiment, the cell is an animal cell or an algal cell. The animal cell may be of any type of animal such as, for example, a non-human animal cell, a non-human vertebrate cell, a non-human mammalian cell, or cells of aquatic animals such as, fish or Crustacea, invertebrates, insects, etc. Non limiting examples of arthropod cells include insect cells such as Spodoptera frugiperda (Sf) cells, e.g. Sf9, Sf21, Trichoplusia ni cells, and Drosophila S2 cells. An example of a bacterial cell useful as a host cell of the present invention is Synechococcus spp. (also known as Synechocystis spp.), for example Synechococcus elongatus.
The cells may be of an organism suitable for a fermentation process such as fungal organisms, such as yeast. As used herein, "yeast" includes Saccharomyces spp., Saccharomyces cerevisiae, Saccharomyces carlbergensis, Candida spp., Kluveromyces spp., Pichia spp., Hansenula spp., Trichoderma spp., Lipomyces starkey, and Yarrowia lipolytica. Preferred yeast include strains of the Saccharomyces spp., and in particular, Saccharomyces cerevisiae. Transgenic Plants
The invention also provides a plant comprising a cell of the invention, such as a transgenic plant comprising one or more polynucleotides of the invention. The term "plant" as used herein as a noun refers to whole plants, but as used as an adjective refers to any substance which is present in, obtained from, derived from, or related to a plant, such as for example, plant organs (e.g. leaves, stems, roots, flowers), single cells (e.g. pollen), seeds, plant cells and the like. The term "plant part" refers to all plant parts that comprise the plant DNA, including vegetative structures such as, for example, leaves or stems, roots, floral organs or structures, pollen, seed, seed parts such as an embryo, endosperm, scutellum or seed coat, plant tissue such as, for example, vascular tissue, cells and progeny of the same.
A "transgenic plant", "genetically modified plant" or variations thereof refers to a plant that contains a gene construct ("transgene") not found in a wild-type plant of the same species, variety or cultivar. Transgenic plants as defined in the context of the present invention include plants and their progeny which have been genetically modified using recombinant techniques to cause production of at least one polypeptide defined herein in the desired plant or plant organ. Transgenic plant cells and transgenic plant parts have corresponding meanings.
The terms "seed" and "grain" are used interchangeably herein. "Grain" refers to mature grain such as harvested grain or grain which is still on a plant but ready for harvesting, but can also refer to grain after imbibition or germination, according to the context. Mature grain commonly has a moisture content of less than about 18-20%. "Developing seed" refers to a seed prior to maturity, typically found in the reproductive structures of the plant after fertilisation or anthesis. but can also refer to such seeds prior to maturity which are isolated from a plant.
As used herein, the term "plant storage organ" refers to a part of a plant specialized to storage energy in the form of, for example, proteins, carbohydrates, fatty acids and/or oils. Examples of plant storage organs are seed, fruit, tuberous roots, and tubers. A preferred plant storage organ of the invention is seed.
Plants provided by or contemplated for use in the practice of the present invention include both monocotyledons and dicotyledons. In preferred embodiments, the plants of the present invention are crop plants (for example, cereals and pulses, maize, wheat, potatoes, tapioca, rice, sorghum, millet, cassava, barley, or pea), or other legumes. The plants may be grown for production of edible roots, tubers, leaves, stems, flowers or fruit. The plants may be vegetables or ornamental plants. The plants of the invention may be: corn (Zea mays), canola {Brassica napus, Brassica rapa ssp.), flax (Linum usitatissimum), alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cerale), sorghum {Sorghum bicolour, Sorghum vulgare), sunflower (Helianthus annus), wheat (Tritium aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium hirsutum), sweet potato (Lopmoea batatus), cassava (Manihot esculenta), coffee (Cofea spp.), coconut (Cocos nucifera), pineapple (Anana comosus), citris tree (Citrus spp.), cocoa (Theobroma cacao), tea (Camellia senensis), banana (Musa spp.), avocado (Persea americana), fig (Ficus casica), guava (Psidium guajava), mango (Mangifer indica), olive (Olea europaea), papaya (Carica papaya), cashew (Anacardium occidentale), macadamia (Macadamia intergrifolia), almond (Prunus amygdalus), sugar beets (Beta vulgaris), oats, or barley.
In a preferred embodiment, the plant is an angiosperm.
In an embodiment, the plant is an oilseed plant, preferably an oilseed crop plant. As used herein, an "oilseed plant" is a plant species used for the commercial production of oils from the seeds of the plant. The oilseed plant may be oil-seed rape (such as canola), maize, sunflower, soybean, sorghum, flax (linseed) or sugar beet. Furthermore, the oilseed plant may be other Brassicas, cotton, peanut, poppy, mustard, castor bean, sesame, safflower, or nut producing plants. The plant may produce high levels of oil in its fruit, such as olive, oil palm or coconut. Horticultural plants to which the present invention may be applied are lettuce, endive, or vegetable brassicas including cabbage, broccoli, or cauliflower. The present invention may be applied in tobacco, cucurbits, carrot, strawberry, tomato, or pepper.
In a preferred embodiment, the transgenic plant is homozygous for each and every gene that has been introduced (transgene) so that its progeny do not segregate for the desired phenotype. The transgenic plant may also be heterozygous for the introduced transgene(s), preferably uniformly heterozygous for the transgene, such as for example in Fl progeny which have been grown from hybrid seed. Such plants may provide advantages such as hybrid vigour, well known in the art. Transformation of plants
Transgenic plants can be produced using techniques known in the art, such as those generally described in A. Slater et al., Plant Biotechnology - The Genetic
Manipulation of Plants, Oxford University Press (2003), and P. Christou and H. Klee,
Handbook of Plant Biotechnology, John Wiley and Sons (2004).
As used herein, the terms "stably transforming", "stably transformed" and variations thereof refer to the integration of the exogenous nucleic acid molecules into the genome of the cell such that they are transferred to progeny cells during cell division without the need for positively selecting for their presence. Stable transformants, or progeny thereof, can be selected by any means known in the art such as Southern blots on chromosomal DNA or in situ hybridization of genomic DNA.
Agrobacterium-mediated transfer is a widely applicable system for introducing genes into plant cells because DNA can be introduced into cells in whole plant tissues or plant organs or explants in tissue culture, for either transient expression or for stable integration of the DNA in the plant cell genome. The use of Agrobacterium-mediated plant integrating vectors to introduce DNA into plant cells is well known in the art (see, for example, US 5177010, US 5104310, US 5004863 or US 5159135). The region of DNA to be transferred is defined by the border sequences, and the intervening DNA (T- DNA) is usually inserted into the plant genome. Further, the integration of the T-DNA is a relatively precise process resulting in few rearrangements. In those plant varieties where Agrobacterium-mediated transformation is efficient, it is the method of choice because of the facile and defined nature of the gene transfer. Preferred Agrobacterium transformation vectors are capable of replication in E. coli as well as Agrobacterium, allowing for convenient manipulations as described (Klee et al., In: Plant DNA Infectious Agents, Hohn and Schell, eds., Springer- Verlag, New York, pp. 179-203 (1985).
Acceleration methods that may be used include, for example, microprojectile bombardment and the like. One example of a method for delivering transforming nucleic acid molecules to plant cells is microprojectile bombardment. This method has been reviewed by Yang et al., Particle Bombardment Technology for Gene Transfer, Oxford Press, Oxford, England (1994). Non-biological particles (microprojectiles) that may be coated with nucleic acids and delivered into cells by a propelling force. Exemplary particles include those comprised of tungsten, gold, platinum, and the like. A particular advantage of microprojectile bombardment, in addition to it being an effective means of reproducibly transforming monocots, is that neither the isolation of protoplasts, nor the susceptibility of Agrobacterium infection are required. An illustrative embodiment of a method for delivering DNA into Zea mays cells by acceleration is a biolistics ct-particle delivery system, that can be used to propel particles coated with DNA through a screen, such as a stainless steel or Nytex screen, onto a filter surface covered with corn cells cultured in suspension. A particle delivery system suitable for use with the present invention is the helium acceleration PDS- 1000/He gun available from Bio-Rad Laboratories. For the bombardment, cells in suspension may be concentrated on filters. Filters containing the cells to be bombarded are positioned at an appropriate distance below the micro projectile stopping plate. If desired, one or more screens are also positioned between the gun and the cells to be bombarded.
Alternatively, immature embryos or other target cells may be arranged on solid culture medium. The cells to be bombarded are positioned at an appropriate distance below the microprojectile stopping plate. If desired, one or more screens are also positioned between the acceleration device and the cells to be bombarded. Through the use of techniques set forth herein one may obtain up to 1000 or more foci of cells transiently expressing a marker gene. The number of cells in a focus that express the exogenous gene product 48 hours post-bombardment often range from one to ten and average one to three.
In bombardment transformation, one may optimize the pre-bombardment culturing conditions and the bombardment parameters to yield the maximum numbers of stable transformants. Both the physical and biological parameters for bombardment are important in this technology. Physical factors are those that involve manipulating the DNA/micro projectile precipitate or those that affect the flight and velocity of either the macro- or microprojectiles. Biological factors include all steps involved in manipulation of cells before and immediately after bombardment, the osmotic adjustment of target cells to help alleviate the trauma associated with bombardment, and also the nature of the transforming DNA, such as linearized DNA or intact supercoiled plasmids. It is believed that pre-bombardment manipulations are especially important for successful transformation of immature embryos.
In another alternative embodiment, plastids can be stably transformed. Methods disclosed for plastid transformation in higher plants include particle gun delivery of DNA containing a selectable marker and targeting of the DNA to the plastid genome through homologous recombination (US 5, 451,513, US 5,545,818, US 5,877,402, US 5,932479, and WO 99/05265).
Accordingly, it is contemplated that one may wish to adjust various aspects of the bombardment parameters in small scale studies to fully optimize the conditions. One may particularly wish to adjust physical parameters such as gap distance, flight distance, tissue distance, and helium pressure. One may also minimize the trauma reduction factors by modifying conditions that influence the physiological state of the recipient cells and that may therefore influence transformation and integration efficiencies. For example, the osmotic state, tissue hydration and the subculture stage or cell cycle of the recipient cells may be adjusted for optimum transformation. The execution of other routine adjustments will be known to those of skill in the art in light of the present disclosure.
Transformation of plant protoplasts can be achieved using methods based on calcium phosphate precipitation, polyethylene glycol treatment, electroporation, and combinations of these treatments. Application of these systems to different plant varieties depends upon the ability to regenerate that particular plant strain from protoplasts. Illustrative methods for the regeneration of cereals from protoplasts are described (Fujimura et al., 1985; Toriyama et al., 1986; Abdullah et al., 1986).
Other methods of cell transformation can also be used and include but are not limited to introduction of DNA into plants by direct DNA transfer into pollen, by direct injection of DNA into reproductive organs of a plant, or by direct injection of DNA into the cells of immature embryos followed by the rehydration of desiccated embryos.
The regeneration, development, and cultivation of plants from single plant protoplast transformants or from various transformed explants is well known in the art (Weissbach et al., In: Methods for Plant Molecular Biology, Academic Press, San Diego, Calif, (1988). This regeneration and growth process typically includes the steps of selection of transformed cells, culturing those individualized cells through the usual stages of embryonic development through the rooted plantlet stage. Transgenic embryos and seeds are similarly regenerated. The resulting transgenic rooted shoots are thereafter planted in an appropriate plant growth medium such as soil.
The development or regeneration of plants containing the foreign, exogenous gene is well known in the art. Preferably, the regenerated plants are self-pollinated to provide homozygous transgenic plants. Otherwise, pollen obtained from the regenerated plants is crossed to seed-grown plants of agronomically important lines. Conversely, pollen from plants of these important lines is used to pollinate regenerated plants. A transgenic plant of the present invention containing a desired exogenous nucleic acid is cultivated using methods well known to one skilled in the art.
Methods for transforming dicots, primarily by use of Agrobacterium tumefaciens, and obtaining transgenic plants have been published for cotton (US 5,004,863, US 5,159,135, US 5,518,908); soybean (US 5,569,834, US 5,416,011); Brassica (US 5,463,174); peanut (Cheng et al., 1996); and pea (Grant et al., 1995).
Methods for transformation of cereal plants such as wheat and barley for introducing genetic variation into the plant by introduction of an exogenous nucleic acid and for regeneration of plants from protoplasts or immature plant embryos are well known in the art, see for example, CA 2,092,588, AU 61781/94, AU 667939, US 6,100,447, PCT/US 97/10621, US 5,589,617, US 6,541,257, and other methods are set out in Patent specification W099/14314. Preferably, transgenic wheat or barley plants are produced by Agrobacterium tumefaciens mediated transformation procedures. Vectors carrying the desired nucleic acid construct may be introduced into regenerable wheat cells of tissue cultured plants or explants, or suitable plant systems such as protoplasts.
The regenerable wheat cells are preferably from the scutellum of immature embryos, mature embryos, callus derived from these, or the meristematic tissue.
To confirm the presence of the transgenes in transgenic cells and plants, a polymerase chain reaction (PCR) amplification or Southern blot analysis can be performed using methods known to those skilled in the art. Expression products of the transgenes can be detected in any of a variety of ways, depending upon the nature of the product, and include Western blot and enzyme assay. One particularly useful way to quantitate protein expression and to detect replication in different plant tissues is to use a reporter gene, such as GUS. Once transgenic plants have been obtained, they may be grown to produce plant tissues or parts having the desired phenotype. The plant tissue or plant parts, may be harvested, and/or the seed collected. The seed may serve as a source for growing additional plants with tissues or parts having the desired characteristics.
A transgenic plant formed using Agrobacterium or other transformation methods typically contains a single genetic locus on one chromosome. Such transgenic plants can be referred to as being hemizygous for the added gene(s). More preferred is a transgenic plant that is homozygous for the added gene(s); i.e., a transgenic plant that contains two added genes, one gene at the same locus on each chromosome of a chromosome pair. A homozygous transgenic plant can be obtained by self-fertilising a hemizygous transgenic plant, germinating some of the seed produced and analyzing the resulting plants for the gene of interest.
It is also to be understood that two different transgenic plants that contain two independently segregating exogenous genes or loci can also be crossed (mated) to produce offspring that contain both sets of genes or loci. Selfing of appropriate Fl progeny can produce plants that are homozygous for both exogenous genes or loci. Back-crossing to a parental plant and out-crossing with a non-transgenic plant are also contemplated, as is vegetative propagation. Descriptions of other breeding methods that are commonly used for different traits and crops can be found in Fehr, In: Breeding Methods for Cultivar Development, Wilcox J. ed., American Society of Agronomy, Madison Wis. (1987). Trans enic Non-Human Animals
A "transgenic non-human animal" refers to an animal, other than a human, that contains an exogenous polynucleotide ("transgene") not found in a wild-type animal of the same species or breed. Techniques for producing transgenic animals are well known in the art. A useful general textbook on this subject is Houdebine, Transgenic animals - Generation and Use (Harwood Academic, 1997). Transformation of a polynucleotide molecule into a cell can be accomplished by any method by which a polynucleotide molecule can be inserted into the cell. Transformation techniques include, but are not limited to, transfection, electroporation, microinjection, lipofection, adsorption, and cell fusion. A recombinant cell may remain unicellular or may grow into a tissue, organ or a multicellular organism. Transformed polynucleotide molecules can remain extrachromosomal or can integrate into one or more sites within a chromosome of the transformed (i.e., recombinant) cell in such a manner that their ability to be expressed is retained. Heterologous DNA can be introduced, for example, into fertilized mammalian ova. For instance, totipotent or pluripotent stem cells can be transformed by microinjection, calcium phosphate mediated precipitation, liposome fusion, retroviral infection or other means, the transformed cells are then introduced into the embryo, and the embryo then develops into a transgenic animal. In a highly preferred method, developing embryos are infected with a retrovirus containing the desired DNA, and transgenic animals produced from the infected embryo. In a most preferred method, however, the appropriate DNAs are coinjected into the pronucleus or cytoplasm of embryos, preferably at the single cell stage, and the embryos allowed to develop into mature transgenic animals.
Another method used to produce a transgenic animal involves micro injecting a nucleic acid into pro-nuclear stage eggs by standard methods. Injected eggs are then cultured before transfer into the oviducts of pseudopregnant recipients.
Transgenic animals may also be produced by nuclear transfer technology. Using this method, fibroblasts from donor animals are stably transfected with a plasmid incorporating the coding sequences for a binding domain or binding partner of interest under the control of regulatory sequences. Stable transfectants are then fused to enucleated oocytes, cultured and transferred into female recipients.
Enhancing Exogenous RNA Levels and Stabilized Expression
Post-transcriptional gene silencing (PTGS) is a nucleotide sequence-specific defense mechanism that can target both cellular and viral mRNAs for degradation. PTGS occurs in plants or fungi stably or transiently transformed with a recombinant polynucleotide(s) and results in the reduced accumulation of RNA molecules with sequence similarity to the introduced polynucleotide.
RNA molecule levels can be increased, and/or RNA molecule levels stabilized over numerous generations, by limiting the expression of the silencing suppressor to a storage organ of a plant or part thereof. As used herein, a "silencing suppressor" is any polynucleotide or polypeptide that can be expressed in a plant cell that enhances the level of expression product from a different transgene in the plant cell, particularly, over repeated generations from the initially transformed plant. In an embodiment, the silencing suppressor is a viral silencing suppressor or mutant thereof. A large number of viral silencing suppressors are known in the art and include, but are not limited to P19, V2, P38, Pe-Po and RPV-PO. Examples of suitable viral silencing suppressors include those described in WO 2010/057246.
As used herein, the term "stably expressed" or variations thereof refers to the level of the RNA molecule being essentially the same or higher in progeny plants over repeated generations, for example, at least three, at least five, or at least ten generations, when compared to corresponding plants lacking the exogenous polynucleotide encoding the silencing suppressor. However, this term(s) does not exclude the possibility that over repeated generations there is some loss of levels of the RNA molecule when compared to a previous generation, for example, not less than a 10% loss per generation.
The suppressor can be selected from any source e.g. plant, viral, mammal, etc. The suppressor may be, for example:
flock house virus B2,
pothos latent virus PI 4,
pothos latent virus AC2,
African cassava mosaic virus AC4,
bhendi yellow vein mosaic disease C2,
bhendi yellow vein mosaic disease C4,
bhendi yellow vein mosaic disease PCI,
tomato chlorosis virus p22,
tomato chlorosis virus CP,
tomato chlorosis virus CPm,
tomato golden mosaic virus AL2,
tomato leaf curl Java virus βθΐ,
tomato yellow leaf curl virus V2,
tomato yellow leaf curl virus-China C2, tomato yellow leaf curl China virus Y10 isolate PCI, tomato yellow leaf curl Israeli isolate V2, mungbean yellow mosaic virus-Vigna AC2, hibiscus chlorotic ringspot virus CP,
turnip crinkle virus P38,
turnip crinkle virus CP,
cauliflower mosaic virus P6,
beet yellows virus p21 ,
citrus tristeza virus p20,
citrus tristeza virus p23,
citrus tristeza virus CP,
cowpea mosaic virus SCP,
sweet potato chlorotic stunt virus p22,
cucumber mosaic virus 2b,
tomato aspermy virus HC-Pro,
beet curly top virus L2,
soil borne wheat mosaic virus 19K,
barley stripe mosaic virus Gammab,
poa semilatent virus Gammab,
peanut clump pecluvirus PI 5,
rice dwarf virus PnslO,
curubit aphid borne yellows virus P0,
beet western yellows virus P0,
potato virus X P25,
cucumber vein yellowing virus P 1 b,
plum pox virus HC-Pro,
sugarcane mosaic virus HC-Pro,
potato virus Y strain HC-Pro,
tobacco etch virus PI /HC-Pro,
turnip mosaic virus PI /HC-Pro,
cocksfoot mottle virus PI,
cocksfoot mottle virus-Norwegian isolate PI, rice yellow mottle virus PI,
rice yellow mottle virus-Nigerian isolate PI, rice hoja blanca virus NS3.
rice stripe virus NS3, crucifer infecting tobacco mosaic virus 126K,
crucifer infecting tobacco mosaic virus pl22,
tobacco mosaic virus pi 22,
tobacco mosaic virus 126,
tobacco mosaic virus 13 OK,
tobacco rattle virus 16K,
tomato bushy stunt virus PI 9,
tomato spotted wilt virus NSs,
apple chlorotic leaf spot virus P50,
grap evine virus A p 10,
grapevine leafroll associated virus-2 homolog of BYV p21.
as well as variants/mutants thereof. The list above provides the virus from which the suppressor can be obtained and the protein (e.g., B2, P14, etc.), or coding region designation for the suppressor from each particular virus.
Multiple copies of a suppressor may be used. Different suppressors may be used together (e. g., in tandem).
Essentially any RNA molecule which is desirable to be expressed in a plant storage organ can be co-expressed with the silencing suppressor. The RNA molecule may influence an agronomic trait, insect resistance, disease resistance, herbicide resistance, sterility, grain characteristics, and the like. The encoded polypeptides may be involved in metabolism of lipid, starch, carbohydrates, nutrients, etc., or may be responsible for the synthesis of proteins, peptides, lipids, waxes, starches, sugars, carbohydrates, flavors, odors, toxins, carotenoids. hormones, polymers, flavonoids, storage proteins, phenolic acids, alkaloids, lignins, tannins, celluloses, glycoproteins, glycolipids, etc.
In a particular example, the plants produced increased levels of enzymes for lipid production in plants such as Brassicas, for example oilseed rape or sunflower, safflower, flax, cotton, soya bean or maize. Production of Oil
Techniques that are routinely practiced in the art can be used to extract, process, and analyze the oils produced by cells, plants, seeds, etc of the instant invention. Such techniques are described and explained throughout the literature in sources such as, Fereidoon Shahidi, Current Protocols in Food Analytical Chemistry, John Wiley & Sons, Inc. (2001) Dl. l . l-Dl.1.11, and Perez-Vich et al. (1998). Production of seedoil
Typically, plant seeds are cooked, pressed, and extracted to produce crude seedoil, which is then degummed, refined, bleached, and deodorized. Generally, techniques for crushing seed are known in the art. For example, oilseeds can be tempered by spraying them with water to raise the moisture content to, for example, 8.5%, and flaked using a smooth roller with a gap setting of 0.23 to 0.27 mm. Depending on the type of seed, water may not be added prior to crushing. Application of heat deactivates enzymes, facilitates further cell rupturing, coalesces the oil droplets, and agglomerates protein particles, all of which facilitate the extraction process.
The majority of the seedoil is released by passage through a screw press. Cakes expelled from the screw press are then solvent extracted for example, with hexane, using a heat traced column. Alternatively, crude seedoil produced by the pressing operation can be passed through a settling tank with a slotted wire drainage top to remove the solids that are expressed with the seedoil during the pressing operation. The clarified seedoil can be passed through a plate and frame filter to remove any remaining fine solid particles. If desired, the seedoil recovered from the extraction process can be combined with the clarified seedoil to produce a blended crude seedoil.
Once the solvent is stripped from the crude seedoil, the pressed and extracted portions are combined and subjected to normal oil processing procedures (i.e., degumming, caustic refining, bleaching, and deodorization). Degumming can be performed by addition of concentrated phosphoric acid to the crude seedoil to convert non-hydratable phosphatides to a hvdratable form, and to chelate minor metals that are present. Gum is separated from the seedoil by centrifugation. The seedoil can be refined by addition of a sufficient amount of a sodium hydroxide solution to titrate all of the fatty acids and removing the soaps thus formed.
Deodorization can be performed by heating the seedoil to 260°C under vacuum, and slowly introducing steam into the seedoil at a rate of about 0.1 ml/minute/100 ml of seedoil. After about 30 minutes of sparging, the seedoil is allowed to cool under vacuum. The seedoil is typically transferred to a glass container and flushed with argon before being stored under refrigeration. If the amount of seedoil is limited, the seedoil can be placed under vacuum for example, in a Parr reactor and heated to 260°C for the same length of time that it would have been deodorized. This treatment improves the colour of the seedoil and removes a majority of the volatile substances. Plant biomass for the production of oils
Parts of plants involved in photosynthesis (e.g., and stems and leaves of higher plants and aquatic plants such as algae) can also be used to produce oil. Independent of the type of plant, there are several methods for extracting oils from green biomass. One way is physical extraction, which often does not use solvent extraction. It is a "traditional" way using several different types of mechanical extraction. Expeller pressed extraction is a common type, as are the screw press and ram press extraction methods. The amount of oil extracted using these methods varies widely, depending upon the plant material and the mechanical process employed. Mechanical extraction is typically less efficient than solvent extraction described below.
In solvent extraction, an organic solvent (e.g., hexane) is mixed with at least the genetically modified plant green biomass, preferably after the green biomass is dried and ground. Of course, other parts of the plant besides the green biomass (e.g., oil- containing seeds) can be ground and mixed in as well. The solvent dissolves the oil in the biomass and the like, which solution is then separated from the biomass by mechanical action (e.g., with the pressing processes above). This separation step can also be performed by filtration (e.g., with a filter press or similar device) or centrifugation etc. The organic solvent can then be separated from the oil (e.g., by distillation). This second separation step yields oil from the plant and can yield a re- usable solvent if one employs conventional vapor recovery.
Fermentation processes for oil production
As used herein, the term the "fermentation process" refers to any fermentation process or any process comprising a fermentation step. A fermentation process includes, without limitation, fermentation processes used to produce alcohols (e.g., ethanol, methanol, butanol), organic acids (e.g., citric acid, acetic acid, itaconic acid, lactic acid, gluconic acid), ketones (e.g., acetone), amino acids (e.g., glutamic acid), gases (e.g., H2 and C02), antibiotics (e.g., penicillin and tetracycline), enzymes, vitamins (e.g., riboflavin, beta-carotene), and hormones. Fermentation processes also include fermentation processes used in the consumable alcohol industry (e.g., beer and wine), dairy industry (e.g., fermented dairy products), leather industry and tobacco industry. Preferred fermentation processes include alcohol fermentation processes, as are well known in the art. Preferred fermentation processes are anaerobic fermentation processes, as are well known in the art. Suitable fermenting cells, typically microorganisms that are able to ferment, that is, convert, sugars such as glucose or maltose, directly or indirectly into the desired fermentation product. Examples of fermenting microorganisms include fungal organisms such as y east.
The transgenic microorganism is preferably grown under conditions that optimize activity of fatty acid biosynthetic genes and acyltransferase genes. This leads to production of the greatest and the most economical yield of oil. In general, media conditions that may be optimized include the type and amount of carbon source, the type and amount of nitrogen source, the carbon-to-nitrogen ratio, the oxygen level, growth temperature, pH, length of the biomass production phase, length of the oil accumulation phase and the time of cell harvest.
Fermentation media must contain a suitable carbon source. Suitable carbon sources may include, but are not limited to: monosaccharides (e.g., glucose, fructose), disaccharides (e.g., lactose, sucrose), oligosaccharides, polysaccharides (e.g., starch, cellulose or mixtures thereof), sugar alcohols (e.g., glycerol) or mixtures from renewable feedstocks (e.g., cheese whey permeate, cornsteep liquor, sugar beet molasses, barley malt). Additionally, carbon sources may include alkanes, fatty acids, esters of fatty acids, monoglycerides, diglycerides, triglycerides, phospholipids and various commercial sources of fatty acids including vegetable oils (e.g., soybean oil) and animal fats. Additionally, the carbon substrate may include one-carbon substrates (e.g., carbon dioxide, methanol, formaldehyde, formate, carbon-contaming amines) for which metabolic conversion into key biochemical intermediates has been demonstrated. Hence it is contemplated that the source of carbon utilized in the present invention may encompass a wide variety of carbon-containing substrates and will only be limited by the choice of the host microorganism. Although all of the above mentioned carbon substrates and mixtures thereof are expected to be suitable in the present invention, preferred carbon substrates are sugars and/or fatty acids. Most preferred is glucose and/or fatty acids containing between 10-22 carbons.
Nitrogen may be supplied from an inorganic (e.g., (NH^SC^) or organic source (e.g., urea, glutamate). In addition to appropriate carbon and nitrogen sources, the fermentation media may also contain suitable minerals, salts, cofactors, buffers, vitamins and other components known to those skilled in the art suitable for the growth of the microorganism and promotion of the enzymatic pathways necessary for oil production.
A suitable pH range for the fermentation is typically between about pH 4.0 to pH 8.0, wherein pH 5.5 to pH 7.0 is preferred as the range for the initial growth conditions. The fermentation may be conducted under aerobic or anaerobic conditions, wherein microaerobic conditions are preferred. Typically, accumulation of high levels of oil in the cells of oleaginous microorganisms requires a two-stage process, since the metabolic state must be "balanced" between growth and synthesis/storage of fats. Thus, most preferably, a two- stage fermentation process is necessary for the production of oils in microorganisms. In this approach, the first stage of the fermentation is dedicated to the generation and accumulation of cell mass and is characterized by rapid cell growth and cell division. In the second stage of the fermentation, it is preferable to establish conditions of nitrogen deprivation in the culture to promote high levels of oil accumulation. The effect of this nitrogen deprivation is to reduce the effective concentration of AMP in the cells, thereby reducing the activity of the NAD-dependent isocitrate dehydrogenase of mitochondria. When this occurs, citric acid will accumulate, thus forming abundant pools of acetyl-CoA in the cytoplasm and priming fatty acid synthesis. Thus, this phase is characterized by the cessation of cell division followed by the synthesis of fatty acids and accumulation of TAGs.
Although cells are typically grown at about 30°C, some studies have shown increased synthesis of unsaturated fatty acids at lower temperatures. Based on process economics, this temperature shift should likely occur after the first phase of the two- stage fermentation, when the bulk of the microorganism's growth has occurred.
It is contemplated that a variety of fermentation process designs may be applied, where commercial production of oils using the instant nucleic acids is desired. For example, commercial production of oil from a recombinant microbial host may be produced by a batch, fed-batch or continuous fermentation process.
A batch fermentation process is a closed system wherein the media composition is set at the beginning of the process and not subject to further additions beyond those required for maintenance of pH and oxygen level during the process. Thus, at the beginning of the culturing process the media is inoculated with the desired organism and growth or metabolic activity is permitted to occur without adding additional substrates (i.e., carbon and nitrogen sources) to the medium. In batch processes the metabolite and biomass compositions of the system change constantly up to the time the culture is terminated. In a typical batch process, cells moderate through a static lag phase to a high-growth log phase and finally to a stationary phase, wherein the growth rate is diminished or halted. Left untreated, cells in the stationary phase will eventually die. A variation of the standard batch process is the fed-batch process, wherein the substrate is continually added to the fermentor over the course of the fermentation process. A fed-batch process is also suitable in the present invention. Fed-batch processes are useful when catabolite repression is apt to inhibit the metabolism of the cells or where it is desirable to have limited amounts of substrate in the media at any one time. Measurement of the substrate concentration in fed-batch systems is difficult and therefore may be estimated on the basis of the changes of measurable factors such as H, dissolved oxygen and the partial pressure of waste gases (e.g., CO2). Batch and fed-batch culturing methods are common and well known in the art and examples may be found in Brock, In Biotechnology: A Textbook of Industrial Microbiology, 2.sup.nd ed., Sinauer Associates, Sunderland, Mass., (1989); or Deshpande and Mukund (1992).
Commercial production of oil using the instant genes may also be accomplished by a continuous fermentation process, wherein a defined media is continuously added to a bioreactor while an equal amount of culture volume is removed simultaneously for product recovery. Continuous cultures generally maintain the cells in the log phase of growth at a constant cell density. Continuous or semi-continuous culture methods permit the modulation of one factor or any number of factors that affect cell growth or end product concentration. For example, one approach may limit the carbon source and allow all other parameters to moderate metabolism. In other systems, a number of factors affecting growth may be altered continuously while the cell concentration, measured by media turbidity, is kept constant. Continuous systems strive to maintain steady state growth and thus the cell growth rate must be balanced against cell loss due to media being drawn off the culture. Methods of modulating nutrients and growth factors for continuous culture processes, as well as techniques for maximizing the rate of product formation, are well known in the art of industrial microbiology and a variety of methods are detailed by Brock, supra.
Fatty acids may be found in the host microorganism as free fatty acids or in estenfied forms such as acylglycerols, phospholipids, sulfolipids or glycolipids, and may be extracted from the host cell through a vanety of means well-known in the art.
In general, means for the purification of fatty acids may include extraction with organic solvents, sonication, supercritical fluid extraction (e.g., using carbon dioxide), saponification and physical means such as presses, or combinations thereof. Of particular interest is extraction with methanol and chloroform in the presence of water (Bligh and Dyer, 1959). Where desirable, the aqueous layer can be acidified to protonate negatively- charged moieties and thereby increase partitioning of desired products into the organic layer. After extraction, the organic solvents can be removed by evaporation under a stream of nitrogen. When isolated in conjugated forms, the products may be enzymatically or chemically cleaved to release the free fatty acid or a less complex conjugate of interest, and can then be subject to further manipulations to produce a desired end product. Desirably, conjugated forms of fatty acids are cleaved with potassium hydroxide.
If further purification is necessary, standard methods can be employed. Such methods may include extraction, treatment with urea, fractional crystallization, HPLC, fractional distillation, silica gel chromatography, high-speed centrifugation or distillation, or combinations of these techniques. Protection of reactive groups such as the acid or alkenyl groups, may be done at any step through known techniques (e.g., alkylation, iodination). Methods used include methylation of the fatty acids to produce methyl esters. Similarly, protecting groups may be removed at any step.
Uses of Oils and Fatty Acids
The oils and fatty acids produced by the methods and cells described have a variety of uses. In some embodiments, the oils are used as food oils. In other embodiments, the oils are refined and used as lubricants, coatings (US 4933114), radiation, solvent detectors, temperature indicators, biosensors (Reppy and Pindzola, 2007), insecticides (US 5180838), linear optics, or for other industrial uses such as the synthesis of polymers.
Oils and fatty acids produced using the methods and cells of the invention can also be used to treat or prevent diseases such as cancer, an infection (for example, a bacterial, fungal or nematode infection) or type 2 diabetes. In another embociment, the oils and fatty acids can be used to synthesize a compound to treat or prevent disease. In addition, the production of the oils or fatty acids defined herein in transgenic plants can assist in the protection of the plants from fungal, nematodal and/or bacterial infections. Feedstuffs
The present invention includes compositions which can be used as feedstuffs. For purposes of the present invention, "feedstuffs" include any food or preparation for human or animal consumption (including for enteral and/or parenteral consumption) which when taken into the body: (1) serve to nourish or build up tissues or supply energy, and/or (2) maintain, restore or support adequate nutritional status or metabolic function. Feedstuffs of the invention include nutritional compositions for babies and/or young children.
Feedstuffs of the invention comprise for example, a cell of the invention, a plant of the invention, the plant part of the invention, the seed of the invention, fatty acid of the invention, oil of the invention, an extract of the invention, the product of a method of the invention, the product of a fermentation process of the invention, or a composition along with a suitable carrier(s). The term "carrier" is used in its broadest sense to encompass any component which may or may not have nutritional value. As the person skilled in the art will appreciate, the carrier must be suitable for use (or used in a sufficiently low concentration) in a feedstuff, such that it does not have deleterious effect on an organism which consumes the feedstuff.
The feedstuff of the present invention comprises oil and/or fatty acid produced directly or indirectly by use of the methods, cells or organisms disclosed herein. The composition may either be in a solid or liquid form. Additionally, the composition may include edible macronutrients, vitamins, and/or minerals in amounts desired for a particular use. The amounts of these ingredients will vary depending on whether the composition is intended for use with normal individuals or for use with individuals having specialized needs such as individuals suffering from metabolic disorders and the like.
Examples of suitable carriers with nutritional value include, but are not limited to, macronutrients such as edible fats, carbohydrates and proteins. Examples of such edible fats include, but are not limited to, coconut oil, borage oil, fungal oil, black current oil, soy oil, and mono- and di-glycerides. Examples of such carbohydrates include, but are not limited to, glucose, edible lactose, and hydrolyzed starch. Additionally, examples of proteins which may be utilized in the nutritional composition of the invention include, but are not limited to, soy proteins, electrodialysed whey, electrodialysed skim milk, milk whey, or the hy drolysates of these proteins.
With respect to vitamins and minerals, the following may be added to the feedstuff compositions of the present invention, calcium, phosphorus, potassium, sodium, chloride, magnesium, manganese, iron, copper, zinc, selenium, iodine, and vitamins A, E, D, C, and the B complex. Other such vitamins and minerals may also be added.
The components utilized in the feedstuff compositions of the present invention can be of semi-purified or purified origin. By semi-purified or purified is meant a material which has been prepared by purification of a natural material or by de novo synthesis.
A feedstuff composition of the present invention may also be added to food even when supplementation of the diet is not required. For example, the composition may be added to food of any type, including, but not limited to, margarine, modified butter, cheeses, milk, yogurt, chocolate, candy, snacks, salad oils, cooking oils, cooking fats, meats, fish and beverages. The genus Saccharomyces spp is used in both brewing of beer and wine making and also as an agent in baking, particularly bread. Yeast is a major constituent of vegetable extracts. Yeast is also used as an additive in animal feed. It will be apparent that genetically modified yeast strains can be provided which are adapted to synthesize oil as described herein. These yeast strains can then be used in food stuffs and in wine and beer making to provide products which have enhanced oil content.
Additionally, oil produced in accordance with the present invention or host cells transformed to contain and express the subject genes may also be used as animal food supplements to alter an animal's tissue or milk fatty acid composition to one more desirable for human or animal consumption. Examples of such animals include sheep, cattle, horses and the like.
Furthermore, feedstuffs of the invention can be used in aquaculture to increase the levels of fatty acids in fish for human or animal consumption.
Preferred feedstuffs of the invention are the plants, seed and other plant parts such as leaves, fruits and stems which may be used directly as food or feed for humans or other animals. For example, animals may graze directly on such plants grown in the field, or be fed more measured amounts in controlled feeding. The invention includes the use of such plants and plant parts as feed for increasing the polyunsaturated fatty acid levels in humans and other animals.
Compositions
The present invention also encompasses compositions, particularly pharmaceutical compositions, comprising one or more of the fatty acids and/or resulting oils produced using the methods of the invention.
A pharmaceutical composition may comprise one or more of the fatty acids and/or oils, in combination with a standard, well-known, non-toxic pharmaceutically- accep table carrier, adjuvant or vehicle such as phosphate-buffered saline, water, ethanol, polyols, vegetable oils, a wetting agent or an emulsion such as a water/oil emulsion. The composition may be in either a liquid or solid form. For example, the composition may be in the form of a tablet, capsule, ingestible liquid or powder, injectible, or topical ointment or cream. Proper fluidity can be maintained, for example, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants. It may also be desirable to include isotonic agents, for example, sugars, sodium chloride, and the like. Besides such inert diluents, the composition can also include adjuvants, such as wetting agents, emulsifying and suspending agents, sweetening agents, flavoring agents and perfuming agents. Suspensions, in addition to the active compounds, may comprise suspending agents such as ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar, and tragacanth or mixtures of these substances.
Solid dosage forms such as tablets and capsules can be prepared using techniques well known in the art. For example, fatty acids produced in accordance with the present invention can be tableted with conventional tablet bases such as lactose, sucrose, and cornstarch in combination with binders such as acacia, cornstarch or gelatin, disintegrating agents such as potato starch or alginic acid, and a lubricant such as stearic acid or magnesium stearate. Capsules can be prepared by incorporating these excipients into a gelatin capsule along with antioxidants and the relevant fatty acid(s).
For intravenous administration, the fatty' acids produced in accordance with the present invention or derivatives thereof may be incorporated into commercial formulations.
A typical dosage of a particular fatty acid is from 0.1 mg to 20 g, taken from one to five times per day (up to 100 g daily) and is preferably in the range of from about 10 mg to about 1 , 2, 5, or 10 g daily (taken in one or multiple doses). As known in the art, a minimum of about 300 mg/day of fatty acid is desirable. However, it will be appreciated that any amount of fatty acid will be beneficial to the subject.
Possible routes of administration of the pharmaceutical compositions of the present invention include, for example, enteral (e.g. , oral and rectal) and parenteral. For example, a liquid preparation may be administered orally or rectally. Additionally, a homogenous mixture can be completely dispersed in water, admixed under sterile conditions with physiologically acceptable diluents, preservatives, buffers or propellants to form a spray or inhalant.
The dosage of the composition to be administered to the patient may be determined by one of ordinary skill in the art and depends upon various factors such as weight of the patient, age of the patient, overall health of the patient, past history of the patient, immune status of the patient, etc.
Additionally, the compositions of the present invention may be utilized for cosmetic purposes. It may be added to pre-existing cosmetic compositions such that a mixture is formed or a fatty acid produced according to the subject invention may be used as the sole "active" ingredient in a cosmetic composition. EXAMPLES
Example 1; Isolation of soldier beetle divergent desaturase genes
RNA extraction
RNA was extracted from 100 mg of adult female C. lugubris beetles using the Trizol method (Invitrogen). C. lugubris was homogenized in 1 ml Trizol and incubated for 5 minutes at 25 °C, after which 200 μΐ chloroform was added to the sample. The mixture was shaken by hand for 15 seconds and then allowed to settle for 3 minutes at 25°C. The organic and aqueous layers were separated by centrifugation (12,000 g, 15 minutes, 4°C). The upper aqueous layer was transferred to a fresh tube and the RNA precipitated by the addition of 500 μΐ isopropanol. After 10 minute incubation at 25 °C, the RNA was pelleted by centrifugation at 12,000 g, 10 minutes at 4°C. The RNA pellet was washed once with 75 % ethanol and then air-dried for 10 minutes. The RNA was then dissolved in 30 μΐ of RNase-free water. There was a distinct yellow colour to the RNA which was further purified using the Lithium chloride cleanup method described in the Ambion ToTALLY RNA™ kit. cDNA synthesis
The synthesis of cDNA was performed using the Invitrogen Superscript II and using a polyT primer (ΤΤΤΙΤΙΤΙΤΙΤΙΤΙΤΓΓΤ _ SEQ ID NOT 5). The polyT primer (100 pmol), RNA (2 μΐ) and RNase-free water (to a final volume of 15.5 μΐ) were incubated at 70 °C for 10 minutes and then chilled on ice. To this was added 10XPCR Buffer (2.5 μΐ), 25 mM MgCl2 (2.5 μΐ), 10 mM dNTP mix (1 μΐ) and 0.1M DTT (2.5 μΐ). This mixture was heated to 42 °C for 1 minute after which Superscript II Reverse Transcriptase (1 μΐ) was added and the mixture left for 50 minutes at 42°C. Superscript II Reverse Transcriptase was inactivated at 70 °C for 15 minutes and RNA degraded with Ιμΐ RNaseH (2 Units, 30 minutes at 37°C).
Amplification of internal desaturase fragments from female Soldier Beetles
RNA was extracted and cDNA synthesised as previously described. Degenerate PCR was performed using primers Clu_f (5 GCNCAYMGNYTNTGGGCNCA - SEQ ID NO: 16) and Clu-r (5λ AANRYRTGRTGGTAGTTGIG - SEQ ID NO: 17) and contained dNTPs (each 200 μΜ), 10X ThermoPol Buffer (NEB), 5 μΐ of cDNA, 1.5 μΐ each primer (100 pmol), 0.1 μΐ TaqONA polymerase (NEB) and sterile water to 50 μΐ. The PCR conditions were as follows: an initial denaturation of 94°C for 3 minutes and then 30 cycles of 94°C/15s, 48°C/30s, 72°C/2 min and then a final extension of 72°C/5 min. An aliquot (5 μΐ) was separated on a 1.5 % agarose gel and a band of approximately 550 bp was visualised. The PCR reaction products were purified using the QIAgen QIAquick PCR purification kit according to the manufacturer's instructions and cloned into pGEM®T-Easy (Promega). The ligation mixtures were transformed into E. coll DH10B and transformants selected on LB agar plates containing 100 μ^ητΐ ampicillin, 40 μ^ητΐ X-Gal and 0.2 mM IPTG. A total of 16 transformants were sequenced and an internal sequence for CLIO was obtained.
Amplification of degenerate PCR from defence gland tissue
A mixed population of male and female C. lugubris were dissected to obtain their defence gland tissue which is located on the apex of each abdominal tergite located on the exterior of the beetles. RNA was extracted and cDNA synthesised as previously described. Degenerate PCR was performed with XRF2b (5 TTYTTYTWY CNCAYATGGGNTGG - SEQ ID NO: 18)/Clu_r and each reaction contained dNTPs (each 200 μΜ), 10X ThermoPol Buffer (NEB), 5 μΐ of cDNA, 1.5 μΐ each primer (100 pmol), 0.1 μΐ TaqONA polymerase (NEB) and sterile water to 50 μΐ. The PCR conditions were as follows: an initial denaturation of 94°C for 3 minutes and then 30 cycles of 94 °C/15s, 48 °C/30s, 72 °C/2 min and then a final extension of 72 °C/5 min. An aliquot (5 μΐ) of each PCR was separated on a 1.5 % agarose gel. A band of expected size was observed and the PCR products obtained were purified using the QIAgen QIAquick PCR purification kit and cloned into pGEM®T-Easy (Promega). The ligation mixture was transformed into E. coli DH10B cells and transformants selected on LB agar plates containing 100 μg/ml ampicillin, 40 μg/ml X-Gal and 0.2 mM IPTG. Eleven transformants were examined by sequence analysis and yielded unique internal sequences denoted as CL2 and CL4.
5 ' and 3 * RACE to obtain full length sequence information for CL2 and CL4
Primers were designed to sequence obtained internal to the degenerate primer binding sites such as:
CL4 5 frontAAAGCACGGTCGAAACGA (SEQ ID NO:19) 5' endTTCCTCTTCAAACAAGCTACG (SEQ ID NO:20)
CL2 5 frontGAATGGAAGCCAACATAA (SEQ ID NO:21) 5 endCAGACAGAGGAGTCCCGA (SEQ ID NO:22)
The Clontech Creator™ SMART™ System was used to obtain both 5λ and Y RACE products. RNA (3 μΐ from either abdomen or defence gland tissue) was added with 1 μΐ Smart IV oligo
(5 AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG - SEQ ID NO:23) and 1 μΐ CDS III/3 PCR primer
(5 ATTCTAGAGGCCGAGGCGGCCGACATG-d(T)3oN-iN; N=A,G:C or T; N_i=A,G or C - SEQ ID NO:24). This was incubated at 72 °C for 2 minutes to denature the RNA, after which was added 2 μΐ 5X First Strand buffer (Clontech), 1 μΐ 20 mM DTT, 5 1 μΐ dNTPs (200 μΜ each dNTP) and 1 μΐ PowerScript™ reverse transcriptase. cDNA synthesis was allowed to occur for 1 hour at 42 °C. This was used as a template for both 5 λ and S' RACE.
The 5λ RACE reactions consisted of dNTPs (each 200 μΜ): 10X Advantage 2 PCR Buffer (Clontech), CDS V Primer (5' AAGCAGTGGTATCAACGCAGAGT -
10 SEQ ID NO:25; 10 pmol), front primer (10 pmol), 1 μΐ cDNA, 1 μΐ Advantage 2 Polymerase Mix (Clontech) and sterile water to 50 μΐ. The 3λ RACE mixtures consisted of dNTPs (200 μΜ each), 10X Advantage 2 PCR Buffer (Clontech), 1 μΐ CDS III/3 PCR primer (10 pmol), end primer (10 pmol), 1 μΐ cDNA, 1 μΐ Advantage 2 Polymerase Mix (Clontech) and sterile water to 50 μΐ. The cycling conditions were as
15 follows: an initial denaturation at 95 °C for 1 minute, 30 cycles of 95 °C/30s, 68 °C/1 min and a final extension at 68 °C for 1 minute. The PCR reactions were separated on a 1 % agarose gel using the QIAgen QIAquick gel extraction kit and cloned into pGEM®T-Easy (Promega). The ligation mixtures were transformed into E. coli DH10B and transformants selected on LB agar plates containing 100 μg/ml ampicillin,
20 40 μg/ml X-Gal and 0.2 mM IPTG. Clones were screened by colony PCR for correct insertions. This PCR used internal primers with only one of the primers used in the RACE reaction. Initially, colonies were boiled for 5 minutes in sterile water, after which dNTPs (each 200 μΜ), 10X ThermoPol Buffer (NEB), degXfront (10 pomol), degXend (10 pmol) and 0.1U Taq DNA Polymerase (NEB) were added with a final
25 volume of 50 μΐ. The PCR cycling conditions were as follows: an initial denaturation of 94 °C for 3 minutes and then 30 cycles of 94 °C/15s, 52 °C/30s, 72 °C/2 min and then a final extension of 72 °C/5 min.
An aliquot (5 μΐ) was separated on a 1.5 % agarose gel. Clones having expected size (-350 bp) were examined by DNA sequence analysis and reading frames
30 beginning with an ATG and ending in a stop codon and matched all the motifs of desaturases were considered. This yielded the full length sequences of two variants of CL2 (-1 and -2) and CL4.
Obtaining the full length gene sequence for CLIO
35 Full length sequence for CLI O was not obtained by 5 'and 3' RACE despite numerous attempts therefore a PCR based method was used. Gene specific primers (CLIO GSP1 : CCA AGC GTG GCT TCT TCT AC (SEQ ID NO:26), CLIO GSP2: CCC AGA AGT TTT CGG ATG AA (SEQ ID NO:27)) were designed based on internal sequence data from positively hybridising clones and used in combination with pDONOR 222 (Invitrogen) vector sequencing primers , Ml 3 forward and Ml 3 reverse, to amplify the 5' and 3' ends of the gene. A 50ul PCR reaction was prepared using Platinum Taq DNA polymerase High Fidelity according to manufacturer's instructions (Invitrogen). The reaction conditions were as follows: 1 cycle of: 94°C for 2 mm followed by 30 cycles of: 94 °C for 30 sec, 52 °C for 30 sec and 68 °C for 1 min . An aliquot (20 ul) of the reaction was run out on 1 % agarose gel and a single band (approximately 1 kbp) was obtained, excised, gel purified (Qiagen), cloned into TOPO 2.1 (Invitrogen) and transformed into TOPO Top 10 E. coli competent cells (Invitrogen) according to manufactures instructions. Positive clones were analysed by restriction enzyme digest and sequence analysis. Example 2; Construction of yeast expression vector for Ch uliosnathus lusubris desaturase genes
Functional analysis of C. lugubris desaturase genes were carried out using a yeast expression system. Full length C. lugubris desaturase genes were amplified by RT-PCR from total RNA isolated as previously described using primers containing restriction sites not found in the desaturase genes (Table 2) for directional cloning into pYES2 (Invitrogen). The amplified RT-PCR or PCR products were ligated into pGEM®T-Easy (Promega) or pTOP02.1 (Invitrogen), transformed into JM109 (Promega) or One Shot TOP10 (Invitrogen) electrocompetent Escherichia coli cells and transformants selected on LB agar plates containing 100 g/ml ampicillin. pGEM®T-Easy or pTOP02.1 clones containing correct inserts were confirmed by sequencing. Correct inserts were restriction digested, gel purified with the QIAquick Gel Extraction kit (QIAGEN), and ligated into pYES2 digested with corresponding restriction enzymes for each desaturase gene. The ligation mix was transformed into JM109 or One Shot TOP10 cells and transformants were selected on LB agar plates containing 100 g/ml ampicillin.
pYES2 clones containing correct inserts were confirmed by restriction digest and subsequent sequencing, and the isolated plasmids were transformed into Saccharomyces cerevisiae strains OLEl (his3Al leu2A0 ura3A0 YMR272c::kanMX4) or INVScl (Invitrogen; MATa his3Al leu2 trpl-289 ura3-52) using the Sigma Yeast Transformation Kit. Transformants were selected on agar plates containing yeast minimal medium lacking uracil (SCMM-U) at 30 °C for 2-3 days, and presence of pYES2 vectors with inserts were confirmed by PCR. Single colonies of confirmed transformants were incubated in SCMM-U broth at 30 °C for 2-3 days, and stored in 20 % glycerol at -80 °C until further use. Table 2. Primers used for directional cloning of C. lugubris desaturase genes into pYES2. Restriction sites are indicated in bold.
Gene Primer Oligonucleotide sequence
name
CL2 fw 5^GGATCCATGCCGCCTAACACCGAATGT-3 ' (SEQ ID
NO:28)
CL2 rv 5^ CTCGAGTC AC AAATTGATTC AGTCC AA-3 : (SEQ ID
NO:29)
CL4 fw 5^ GAATTCATGCCTCCTCAAGTGACT-3 ' (SEQ ID
NO:30)
CL4 rv 5^ GCGGCCGCTTATTCGCTTTTTGGTCC-3 ' (SEQ ID
NO:31)
CLIO fw 5'-AAGCTTATGGCACCCAACGCC-3 ' (SEQ ID NO:32)
CLIO rv 5'-CTCGAGTCACGTATCCTTATGAC-3 ' (SEQ ID NO:33)
Example 3; Yeast expression of desaturases
Two S. cerevisiae host strains were used as recipients for pYES2 desaturase clones; OLE1 (his3Al, leu2A0, ura3A0, YMR272c::kanMX4) and INVScl (MATa, his3Dl leu2 trpl-289 ura3-52). These strains were treated the same during transformation except that cis-10-heptadecenoic acid (CI 7: 1), 0.5 mM, and tergitol (NP-40; 1 %) were added in all media in which S. cerevisiae OLE1 was to grow in.
S. cerevisiae was streaked onto YPD (20 g/1 peptone, 10 g/1 yeast extract, 2 % D-glucose) and grown for several days at 30°C. Transformations were performed using the Sigma Yeast Transformation kit. A loopful of growth was resuspended in 0.5 ml of transformation buffer and spun for 5 s at 12,000g. 400 μΐ of the supernatant was discarded. To the remaining solution was added 10 μΐ salmon testes DNA (10 mg/ml) and 1 μg of plasmid DNA and mixed by vortex for 10 seconds. To this was added 600 μΐ of PLATE buffer and the samples incubated for 4 hours at room temperature, after which they were subject to heat shock for 15 minutes at 42°C. The cells were pelleted by centnfugation (12.000 g, 3 seconds) and resuspended in 500 μΐ of sterile water. Transformants were selected on SCMM-U agar plates (6.7 g/1 yeast nitrogen base without amino acids, 1.92 g/1 yeast synthetic drop-out media supplement without uracil, 2 % glucose and 2 % agar) at 30°C for up to 5 days. A number of transformants were masterplated onto SCMM-U and agar selection and tested for the presence of the desaturase gene by PCR. A positive clone for the desaturase gene was chosen and streaked for single colonies. From a single colony glycerol stocks were prepared (50 % culture and 25 % glycerol) and stored at -80 °C until further use.
Example 4; Functional characterisation of insect and plant divergent desaturases in yeast
Growth of transformed S. cerevisiae for substrate feeding experiments
Yeast transformants derived form strains OLEl and INVScI were inoculated into 25 ml of synthetic minimal defined medium for yeast with uracil (SCMM-U medium) containing 2% glucose and additionally 0.5 mM cw-10-heptadecanoic acid for the OLEl strain. This inoculation culture was grown for 24-48 h at 30°C with shaking (200 rpm). The OD600 of the culture was determined. From this, the amount of culture necessary to obtain an OD600 of 0.4 in 50 ml of induction medium was calculated. This amount of inoculation culture was removed and the cells pelleted at 3000 rpm for 5 min at 4°C. The cells were then suspended in 20 ml SCMM-U supplemented with 10 % D-raffinose as the carbon source and 20 % D-galactose as the inducer for desaturase expression, and 0.5 mM c/'s-lO-heptadecanoic acid where OLEl was the yeast strain used. Induced yeast were either incubated without added substrates or one of a wide range of fatty acid substrates were added to a final concentration of 0.2 mM. The cultures were grown at 20°C for 3 days with shaking at 200 rpm. The cultures were transferred to preweighed 25 ml polypropylene tubes and the yeast cells pelleted at 3000 rpm for 5 minutes. The supernatant was removed, and tubes inverted to drain for 5 minutes. Wet pellet weights were recorded and these were stored at - 20°C until analysed for fatty acids.
Analysis of lipids from transformed S. cerevisiae
Yeast cells were washed sequentially with 1 % tergitol and MiliQ water with centrifugation at 1500 χ g for 5 minutes at 4 °C and dried in a Savant SpeedVac Plus SCl l OA concentrator/dryer. Cells were directly treated with methanol/hydrochloric acid/chloroform (10: 1 : 1) or with sodium methoxide in methanol in a sealed test tube with heating at 90 °C for 60 minutes to convert lipids to fatty acid methyl esters (FAME). For the acidic treatment, saline was added when the sample was cool and FAME were extracted from the mixture by vortexing with hexane. This layer was removed for analysis. For the basic treatment, solvent was removed in a nitrogen stream and single drop of anhydrous acetic acid was added prior to FAME taken up in hexane solvent for analysis.
These fatty acid methyl ester (FAME) samples were analysed by gas chromatography - mass spectrometry (GCMS) using a Varian 3800 gas chromatograph fitted with a BPX70 capillary column (length 30 m, i.d. 0.32 mm, film thickness 0.25 μπι) coupled to a Varian 1200 Single Quadrupole mass spectrometer. Mass spectra were acquired under positive electron impact in full scan mode between 40 - 400 amu at the rate of 2 scans per second. Injections were made in the split mode using helium as the carrier gas and an initial column temperature of 130 °C. The oven temperature was raised at 5°C/minute until 170°C, then raised at 2.5°C/minute until 250°C. The mass spectra corresponding to each peak in the chromatogram was automatically compared with spectra in the computerised NIST library. Test spectra that matched library spectra with a high degree of accuracy and eluted at the same time as an authentic standard were positively identified.
Results of the functional analysis of desaturases in yeast
From the experiments carried out as described above and summarised in Table 3 the following was concluded: 1) CLIO showed Δ12 desaturase activity towards oleic acid where it produced both linoleic (9Z,12Z-octadecenoic acid) and linoleidic acids (9Z,12E-octadecenoic acid) as shown in Table 3. However, this gene also showed acetylenase activity; in both cases where no added substrate or when given oleic or linoleic acid substrates, CLIO produced crepenynic acid (Z9-octadecen-12-ynoic acid; C18:2 9Z,12A) and matched exactly the GC retention time and MS spectrum of a purchased chemical standard. The protein had a predicted size of 349 amino acids and contained the eight conserved histidine residues that form the 'histidine boxes' essential for desaturase activity. The protein has a divergent amino acid sequence, showing less than 44% identity with other characterised membrane acetylenases (Table 4). On the basis of sequence homology with known acylCoA desaturases this enzyme was presumed to be acting on an acylCoA substrate. CLIO was therefore characterised as a dual function acylCoA Δ12 desaturase and Δ12 acetylenase. Table 3. Summary of identified products from yeast expressing C. lugubris desaturases and fed with exogenous fatty acids (and no added substrate) and the conversion (%) oi 'substrates, n.d. not detected.
Figure imgf000066_0001
Figure imgf000067_0001
*nomenclature for substrates and products CXX - carbon chain length of fatty acid. CXX:Y where Y is the number of unsaturations in the fatty acid. The location and nature of unsaturation is given by - stereo chemistry of double bond unsaturation cis (Z) or trans (E) then position of the bond e.g. Z9 is a cis unsaturated bond in the Δ9 position. 'A' represents an acetylenic bond.
Table 4. Amino acid sequence identity between C. lugubris Δ12 desaturase/acetylenase (CLIO) and plant and insect acetylenases (BLOSUM62 matrix).
Comparison sequence Activities Percentage Percentage identity similarity
Processionary moth EF 150363 Δ11 acyl-CoA desaturase 43.4 64.4
Δ13 acyl-CoA desaturase
Δ13 acyl-CoA acetylenase
Crepis alpina Δ12 acetylenase Δ12 acyl lipid desaturase 10.3 25.5
ABC00769; 081931 Δ12 acyl lipid acetylenase
Helianthus annuus Δ12 10.0 23.2 acetylenase ABC59684;
AAO38032
Hedera helix Δ12 acetylenase 9.9 26.0
AAO38031 2) CL4 showed Δ14 conjugase activity toward two of the tested substrates in yeast feeding trials; significant conversion of crepenynic acid to dehydrocrepenynate (CI 8:3 Z9,12A,Z14, Table 3) occurred (Figure 1) and the product had the identical GC retention time and MS as the standard of dehydrocrepenynic acid (C18:3 Z9,12A,Z14) extracted and purified from dried chanterelle mushrooms, Cantharellus cibarius. A small amount of linoleidic acid (C18:2 Z9,11E) was also converted by CL4 to the putative product C18:2 Z9,E11,Z14. When CL4 was incubated with C18:3 Z9, 12A, 14A it exhibited Δ16 conjugase activity by producing the product C18:4 Z9, 12A, 14A, Z16 with efficiency of 28% (Table 3). No other activity was observed either in no- added-substrate trials or where a wide variety of substrates were offered. The protein had a predicted size of 327 amino acids and contained the eight conserved histidine residues that form the 'histidine boxes' essential for desaturase activity. No gene/protein sequence has previously been identified having this activity therefore CL4 is novel. On the basis of sequence homology with known acylCoA desaturases this enzyme was presumed to be acting on an acylCoA substrate. CL4 was therefore characterised as an acylCoA Δ14 conjugase. Unlike a fungal enzyme with some Δ14 conjugase activity disclosed by Blacklock et al. (2010), CL4 has no detectable Δ12 desaturase activity.
3) CL2-1 and CL2-2 showed Δ14 acetylenase activity toward one of the tested substrates in yeast feeding trials; dehydrocrepenynate (C18:3 Z9,12A,Z14) was converted to the conjugated diacetylenic product C18:3 Z9,12A,14A (Table 3) and as shown in Figure 2. In addition, CL2 showed Δ9 acetylenase activity when fed with crepenynate to give the methylene interrupted diacetylenic product CI 8:2 9A,12A (Figure 1). No other activity was observed in either no-added-substrate trials or where a wide variety of fatty acid substrates were offered. The two variants of CL2 (-1 and -2) proteins had the same predicted size of 354 amino acids and contained the eight conserved histidine residues that form the 'histidine boxes' essential for desaturase activity. No gene/protein sequence has previously been identified having this activity therefore CL2-1 and CL2-2 are novel. On the basis of sequence homology with known acylCoA desaturases this enzyme was presumed to be acting on an acylCoA substrate. CL2-1 and CL2-2 were therefore characterised as Δ9 and Δ14 acylCoA (poly)acetylenases.
Summary
A metabolic pathway from oleic acid to the diacetylenic product CI 8:3 Z9,12A,14A and C18:4 Z9, 12A, 14A, Z9 can be envisaged as catalysed by the three C. lugubris genes (CLIO, CL4 and CL2) and assembled in Figure 3. The structure of the the methylene interrupted diacetylenic product CI 8:2 9A,12A is provided below.
Figure imgf000068_0001
It had previously not been suggested that C. lugubris could utilze CI 8 substrates such as oleic acid to produce acetylenated fatty acids, and hence the inventors were surprised to find this activity. The inventors analysed dissected soldier beetles but could not find acetyl enics as a CI 8 chain length version. The insects seem to immediately shorten the acetyl enic fatt acids to CIO and C12 and store it in that form.
A phylogenetic tree was assembled (data not shown) which suggests the acetylenases (CL2 and CL4) are likely to have evolved from Δ9 desaturase genes, which is unexpected and supports the contention that these are not related to plant or fungi acetylenases.
Example 5; Co-expression of three C. lugubris desaturase gene pathway in yeast
The three desaturase genes that comprise the polyacetylenic pathway from soldier beetle were coexpressed at the same time in a yeast cell system to assemble the pathway to the diacetylenic product (Figure 3). CL4 and CL2 were cloned into the pESC Trp yeast epitope tagging vector (Stratagene). CL2 was synthesised by Geneart AG (Germany) and subcloned into the GallO multiple cloning site (MCS) using the restriction sites Notl and Sacl. CL4 was amplified using gene specific primers with Sail and Kpnl restriction sites at the 5 ' and 3' ends of the gene respectively (Table 5).
Table 5. Primers used for directional cloning of C. lugubris desaturase genes into pESC Trp, pFastbacI and pFastbac Dual. Restriction sites are indicated in bold.
Primer name Oligonucleotide sequence
CL4SalForward 5'-GTCGACATGCCTCCTCAAGTGACT-3' (SEQ ID
NO:34)
CL4KpnReverse 5'-GGTACCTTATTCGCTTTTTGGTCC-3' (SEQ ID
NO:35)
CL4NotReverse 5 '-GCGGCCGCTTATTCGCTTTTTGGTCC-3 ' (SEQ ID
NO:36)
CLl OBamForward 5'-GGATCCATGGCACCCAACGCC-3 ' (SEQ ID NO:37) CLlOXbaReverse 5 '-TCTAGATCACGTATCCTTATGAC-3 ' (SEQ ID
NO:38)
CLlOXhoForward 5'-CTCGAGATGGCACCCAACGCC-3 ' (SEQ ID NO:39) CLlOSphReverse 5 '-GCATGCTCACGTATCCTTATGAC-3 ' (SEQ ID
NO:40)
The PGR fragment was run on a 1.3 % agarose gel, excised from the gel and purified using the Nucleospin Extract II kit (Macherey-Nagel). The gene was subcloned into pGEMDT-Easy (Promega) and chemically competent JM109 (Promega) were transformed with 3 ul of the ligation mix. Promega's bacterial cell transformation procedure was followed. 100 μΐ of undiluted competent cells were plated onto LB agar plates containing ampicillin 100 ug/ml. Plasmid DNA was isolated using the QIAprep Spin Miniprep Kit (Qiagen). The presence of insert was confirmed through restriction analysis. The sequence of CL4 was verified through sequencing and a clone containing pGEM®T-Easy with CL4 that had 100 % identity to the original sequence was subcloned into the pESC Trp Gall MCS using the restriction sites Sail and Nhel, using standard cloning methods.
CLI O was synthesised by Geneart AG (Germany) and subcloned into the pYES2 yeast expression vector (Invitrogen) using the restriction sites Hindlll and Xhol. A scrape of INVScl cells from a YPD plate were cotransformed with pESC Trp containing CL2 and CL4, and pYES2 containing CLIO, using the short yeast protocol from the Yeast Transformation Kit (Sigma). Transformants were selected on SCMM- Uracil, Tryptophan with 2 % D-glucose agar plates at 30°C for up to 5 days. Colonies were masterplated onto SCMM-Uracil, Tryptophan with 2 % D-glucose agar plates and the inserts were screened for using PCR. The transformant clone containing pESC Trp with CLIO that had 100 % sequence identity to the original CLI O sequence was chosen and streaked for single colonies. From a single yeast colony glycerol stocks were prepared (50 % culture and 25 % glycerol) and stored at -80°C. Results
A summary of the results for the CLIO, CL4, CL2 gene combination in yeast is provided in Table 6.
Table 6. Percentage conversion of fatty acid substrates to products in yeast expressing the triple-desaturase constructs CLIO, CL4 and CL2. No new products were detected in yeast expressing the pYES2 empty vector.
Figure imgf000070_0001
Example 6; Co-expression of three C. lusubris desaturase gene pathway in insect cells
In a similar experiment to that above, the three C. lugubris desaturase genes that comprise the polyacetylenic pathway from soldier beetle (Figure 3) are co-expressed in an insect cell system, CL4 and CL2 are cloned into the pFastbac Dual vector (Invitrogen). CL2 was synthesized by Geneart AG (Regensberg, Germany) and subcloned into the plO MCS using the restriction sites Xhol and Sphl. CL4 was amplified by PCR using gene specific primers with Sail and Notl restriction sites at the 5' and 3' ends of the gene respectively (Table 5). The PCR fragment was run on a 1.3 % agarose gel in TAE, excised from the gel and purified using the Nucleospin Extract II kit (Macherey-Nagel). The gene is subcloned into pCR2.1-Topo (Invitrogen) and chemically competent JM109 cells (Promega) were transformed with 2 ul of the Topo ligation mix. Promega's bacterial cell transformation procedure was followed. 100 ul of undiluted transformed cells is plated onto LB agar plates containing ampicillin 100 ug/ml. Plasmid DNA is isolated using the QIAprep Spin Miniprep Kit (Qiagen). The presence of insert was confirmed through restriction analysis. The sequence of CL4 is verified through sequencing and a clone with 100 % identity to the original sequence was subcloned into the pFastbac Dual pH MCS using the restriction sites Sail and Notl, using standard cloning methods.
CLI O was cloned into both pFastbacI and pFastbac Dual. Cloning into pFastbac
Dual was performed to potentially increase the amount of crepenynic acid substrate for CL4. For cloning into the pH MCS of both pFastbacI and pFastbac Dual, the CLIO gene was amplified using gene specific primers with BamHI and Xbal restriction sites at the 5 ' and 3' ends of the gene respectively (Table 5). The PCR fragment was run on a 1.3 % agarose gel in TAE, excised from the gel and purified using the Nucleospm Extract II kit (Macherey-Nagel). The gene is subcloned into pGEM®T-Easy (Promega) and chemically competent JM109cells (Promega) were transformed with 2 ul of the ligation mix. Promega's bacterial cell transformation procedures was followed. 100 ul of undiluted transformed cells are plated onto LB agar plates containing ampicillin 100 ug/ml. Plates are incubated at 37 °C for sixteen hours. Transformants were masterplated onto LB agar plates containing ampicillin (100 ug/ml) and PCR screened for the presence of the insert. Plasmid DNA was isolated from clones positive for the insert grown in LB and ampicillin (100 ug/ml) broth, that was grown for 16 hours at 37 °C, shaking at 220 rpm, using the QIAprep Spin Miniprep Kit (Qiagen). The presence of the insert was confirmed through restriction analysis. The sequence of CLI O was verified through sequencing and a clone with 100 % identity to the original sequence was then used to transform chemically competent Dam-/Dcm- C2925H cells (New England Biolabs). One ul of a 1/10 dilution of CLIO in pGEM®T-Easy was added to 50 ul of thawed C2925H cells and incubated on ice for 30 minutes. The cells were heat shocked at 42 °C for 30 seconds and incubated on ice for five minutes. 950 μΐ of SOC medium (New England Biolabs) at room temperature is added and cells incubated at 37 °C, shaking for one hour. One hundred ul of undiluted transformed cells was plated onto LB agar plates with 100 ug/ml of ampicillin. Plates were incubated at 37 °C for 16 hours.
Cloning of CLIO into the plO MCS of pFastbac Dual was performed by amplifying CLIO using gene specific primers with Xhol and Sphl restriction sites at the 5' and 3' ends of the gene respectively (Table 5). The PCR fragment was run on a 1.3 % agarose gel in TAE, excised from the gel and purified using the Nucleospin Extract II kit (Macherey-Nagel). The gene was subcloned into pCRTopo2.1 (Invitrogen) and chemically competent JM109 cells (Promega) were transformed with 2 ul of the Topo ligation mix. Promega's bacterial cell transformation procedure was followed. 100 ul of undiluted transformed cells was plated onto LB agar plates containing ampicillin 100 ug/ml. Plates were incubated at 37 C° for sixteen hours. Transformants were masterplated onto LB agar plates containing ampicillin (100 ug/ml) and PCR screened for the presence of the insert. Plasmid DNA was isolated from clones positive for the insert grown in LB and ampicillin (100 ug/ml) broth, that were grown for 16 hours at 37 °C, shaking at 220 rpm, using the QIAprep Spin Miniprep Kit (Qiagen). The presence of the insert was confirmed through restriction analysis. The sequence of CLIO was verified through sequencing and a clone with 100 % identity to the original sequence was subcloned into the pFastbac Dual plO MCS using the restriction sites Xhol and Sphl, using standard cloning methods.
Generating Recombinant Bacmid
The pFastBac constructs were diluted to a concentration of 200 pg/ul in TE, pH8.0. The MAX Efficiency DHl OBac competent cells (Invitrogen) were thawed on ice and transferred to a 15 ml polypropylene tube. One ng of pFastBac construct was added to the cells and mixed gently. Cells were incubated on ice for 30 minutes, then heat shocked at 42 °C for 45 seconds. Tubes were then chilled on ice for two minutes.
900uL of room temperature SOC medium are added. Tubes were shaken at 37 °C at
225 rpm for four hours. Ten-fold serial dilutions of the cells to 10"3 in SOC medium were conducted and 100 ul of each dilution are plated on to LB agar plates containing
50 ug/ml kanamycin, 7 ug/ml gentamicin, 10 ug/ml tetracycline, 100 ug/ml Bluo-gal, and 40 ug/ml IPTG. Plates were incubated for 48 hours at 37 0 C. Ten white colonies were picked for analysis and restreaked onto fresh LB agar plates containing 50 ug/ml kanamycin, 7 ug/ml gentamicin, 10 ug/ml tetracycline. 100 ug/ml Bluo-gal, and 40 ug/ml IPTG.
A single colony confirmed to have a white phenotype was inoculated in a liquid culture containing 50μg/ml kanamycin, 7μg/ml gentamicin and 10μg/ml tetracycline and incubated in a shaking water bath at 37°c, 250rpm overnight and purified using the PureLink HiPure Plasmid DNA Miniprep Kit. (Invitrogen). Analysing recombinant bacmid DNA
To confirm the presence of the gene of interest recombinant bacmid DNA was amplified by PCR using a combination of pUC/M13Forward, pUC/M13Reverse and gene specific primers and analysed by agarose gel electropheresis. Transfecting insect cells
SF9 insect cells were grown in Supplemented Grace's Insect Medium containing 10%FBS to log phase 1.5-2.5 x 106 cells/ml with 95% viability and transfected with recombinant baculovirus DNA according to Bac-to-Bac Baculovirus Expression System protocol (Invitrogen). The resultant PI viral stock was used to infect SF9 cells to generate a high-titre P2 viral stock. Supemantant and cell pellets of both PI and P2 were harvested, processed to fatty acid methyl esters and analysed by GCMS.
Results
A summary of the results for the CLIO, CL4, CL2 gene combination expressed in insect cells is provided in Table 7.
Table 7. Percentage conversion of fatty acid precursors to products in insect cells expressing constructs containing CLIO, CL4 and CL2. One set contained two copies of CLIO to attempt to increase the flux of metabolites through the pathway. No acetylenic roducts were detected in insect cells in the absence of these enes.
Figure imgf000074_0001
Example 7; Expression of desaturases in plants
Vector constructions for expression in plants
DNA sequences encoding Crepl (Crepis alpina Δ12 acetylenase Y16285), CLIO, CL4 or CL2 were cloned within the canonical CaMV35S promoter::ocs polyadenylation signal expression cassettes residing within TDNA binary vector backbones derived from either Gleave et al. (1992) or Coutu et al. (2007) creating binary TDNA plant expression vectors, pCW53, pCW352, pCW54 and pCW55, respectively. A 'seed-specific' TDNA binary vector containing expression cassettes for the three genes - CLIO, CL4 and CL2 or Crepl, CL4 and CL2 - was constructed in the following manner. Firstly a three promoter binary vector was constructed such that three unique restriction sites allowed the sequential insertion of genes into individual expression cassettes for seed specific expression. CL4 was inserted into a unique site under the control of the FP1 promoter (Ellerstrom et al.. 1996), creating pCW77. Secondly, CL2 was inserted into a unique site behind the Arabidopsis FAE promoter (AtFAE) to create pCW78 and finally CLIO or Crepl was inserted into a unique site behind a second FP1 promoter, creating pCW354 and pCW364. All TDNA binary constructs were transformed into Agrobacterium tumefaciens strain AGL1. Developed seeds were harvested and the oils processed to fatty acid methyl esters for analysis by GC/MS. Results
The production of acetyl enic products in A. thaliana seeds are given in Table 8.
Table 8. Percentage conversion of fatty acid precursors to products within Arabidopsis thaliana seeds expressing a construct containing Crepl , CL4 and CL2. No acetylenic roducts were detected in seeds in the absence of these enes.
Figure imgf000075_0001
Transient expression in leaves
All genes, either as individual 35 S constructs or seed-specific expression constructs were transiently expressed in Nicotiana benthamiana leaves, using published methods (Petrie et al., 2010; Wood et al, 2009). Briefly, a 35S:pl9 construct is used to enhance the expression in leaves of individual constructs or combinations of individual constructs. The addition of 35S:LEC2 allows 'seed-specific' promoters to become active in leaves. Individual AGL1 strains were agromfiltrated into the underside of N. benthamiana leaves using the appropriate cofactor, namely 35: l9 for experiments using pCW352, pCW53, pCW54 and pCW55 or 35:pl9 and 35S:LEC2 to activate expression from promoter cassette within pCW354 and pCW364. The AtFAE promoter can be activated in trans by the addition of 35S:AtLEC2 (CW data not shown). The optical density (at wavelength 600 nm) of each culture was adjusted to 0.4 prior to each agroinfiltration.
Incubation of Ν. benthamiana leaves expressing C. lugubris desaturases with exogenous fatty acids
Nicotiana benthamiana leaves transformed with plant expression vectors containing the desaturase of interest were cut into approximately 1 cm2 pieces and incubated overnight at 25 °C in water with 2 mM fatty acid substrate (added in ethanol/20 % tergitol). The leaves were then washed thoroughly in water to remove any excess substrate and water was removed from the leaves in a Savant SpeedVac Plus SCl l OA concentrator/dryer. Dried leaves were analysed for fatty acid composition as described for yeast cells above. The production of the fatty acid dehydro crepenynic acid (CI 8:3 Z9,12A,Z14) in N. benthamiana transiently expressing soldier beetle CL4 fed with exogenous crepenynic acid (CI 8:2 Z9,12A) is demonstrated by the GC/MS chromogram in Figure 4 and Table 9.
Table 9. Fatty acid composition and % content in N. hentamiana leaves expressing Crepl and CL4 compared with wildtype leaves and the effect of supplemental linoleic acid feeding to the leaves.
Figure imgf000076_0001
Stable expression of three C. lugubris gene pathway in Arabidopsis seeds
Agrobacterial strain harbouring pCW354 and pCW364 was transformed into Arabidopsis mutant MC49 using the floral dip protocol (Clough and Bent, 1998). MC49 is a high linoleic acid content mutant resulting from mutations in FAD3 and FAE1. Transformed seed were selected on hygromycin containing plates and 20 independent plants were grown to maturity and T2 seed collected for lipid analyses. Seeds were analysed for fatty acids using methods described for yeast cells above. The seed fatty acid composition results for an experiment where Cre l, CL4 and CL2 were co-expressed in A. thaliana under seed specific expression are given in Table 10. The seed fatty acid composition where CLI O, CL4 and CL2 were co-expressed in Arabidopsis were similar.
Table 10. Fatty acid and percentage (%) of total in Arabidopsis thaliana seeds expressing C. lugubris and plant desaturases Crepl, CL4 and CL2.
Arabidopsis Fatty acid
line 16:0 16:1 18:0 18:1 18:2 18:3 20:0 20:1 18:2 18:3
Z9,12A Z9,12A,Z14
362-1 9.7 0.3 4.0 29.7 54.4 1.0 0.6 0.3 0 0
362-2 9.4 0.3 3.9 33.3 51.2 1.0 0.6 0.2 0 0.2
362-3 9.2 0.3 3.8 33.3 51.3 1.0 0.6 0.3 0.04 0.2
362-4 9.1 0.3 3.7 32.7 51.9 1.1 0.7 0.2 0 0.2
362-5 9.0 0.3 3.5 33.6 51.5 0.9 0.6 0.2 0 0.2
362-6 9.7 0.2 3.7 31.0 53.0 1.1 0.7 0.3 0 0.4
362-7 10.3 0.2 5.7 28.6 47.1 0.8 0.6 0.2 0 0.08
362-8 13.2 0.3 7.7 43.1 55.8 1.2 0.7 0.3 0 0.1
362-9 7.7 0.2 3.5 26.1 40.2 0.8 0.4 0.2 0 0.1
362-10 6.8 0.3 2.7 21.2 39.8 0.9 0.4 0.2 0 0.1
362-11 8.6 0.3 3.8 23.0 41.4 1.0 0.7 0.4 0.05 0.4
362-12 18.1 0.5 10.5 58.4 103.1 1.9 1.2 0.4 0 0.4
362-13 8.2 0.4 5.9 46.5 69.0 1.3 0.8 0.3 0 0
362-14 8.8 0.3 3.6 27.5 54.0 1.1 0.6 0.3 0 0
362-15 7.4 0.2 3.5 22.3 43.0 0.9 0.6 0.2 0 0
362-16 8.9 0.2 4.4 32.7 51.4 1.0 0.6 0.2 0.2 0.3
362-17 7.1 0.2 4.2 22.3 36.0 0.7 0.4 0.2 0.07 0.3
362-18 10.2 0.2 7.0 29.5 52.0 1.1 0.6 0.2 0.07 0.3
362-19 14.1 0.4 7.3 49.3 81.4 1.6 1.0 0.4 0 0 It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.
This application claims priority from AU 2010903057 filed 9 July 2010, the entire contents of which are incorporated herein by reference.
All publications discussed and/or referenced herein are incorporated herein in their entirety.
Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is solely for the purpose of providing a context for the present invention. It is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed before the priority date of each claim of this application.
REFERENCES
Abdullah et al. (1986) Biotech. 4: 1087.
Alvarez et al. (2000) Theor Appl Genet 100:319-327.
Arnaud (1892) Bull. Soc. Chim. France 1892:233-234.
Baumlein et al. (1991) Mol. Gen. Genet. 225 :459-467.
Baumlein et al. (1992) Plant J. 2:233-239.
Blacklock et al. (2010) J. Biol. Chem. 285 :28442-28449.
Bligh and Dyer (1959) Canadian Journal of Biochemistry and Physiology 37:911-7. Bohlmann and Zdero (1973) Chem. Ber. 1328-1336.
Broun et al. (1998) Plant J. 13:201-210.
Brown et al. (1988) Journal of Chemical Ecology 14:411-423.
Bu'Lock and Smith (1963) Phytochemistry 2:289-296.
Cahoon et al. (2003) The Plant Journal 34:671 -683.
Cavin et al. (1998) J. Nat. Prod. 61 : 1497-1501.
Cheng et al. (1996) Plant Cell Rep. 15 :653-657.
Chikwamba et al. (2003) Proc. Natl. Acad. Sci. U.S.A. 100: 11127-1 1 132.
Christensen and Brandt (2006) J. Pharm. Biomed. Anal. 41 :683-693.
Clough and Bent (1998) Plant Journal 16:735-743.
Coutu et al. (2007) Transgenic Research 16:771 -781.
De Wit and Kodde (1981) Physiological Plant Pathology 18: 143-148.
Deshpande and Mukund (1992) Appl. Biochem. BiotechnoL, 36:227.Ellerstrom et al.
(1996) Plant Mol. Biol. 32: 1019-1027.
Fujimura et al. (1985) Plant Tissue Culture Lett. 2:74.
Gleave 1992) Plant Molecular Biology 20: 1203-1207.
Grant et al. (1995) Plant Cell Rep. 15 :254-258.
Gredicak and Jeric (2007) Acta. Pharmacol ogica 57: 133-150.
Hansen et al. (1986) Contact Dermatitis 14:91 -93.
Harayama (1998) Trends Biotechnol. 16:76-82.
Hart et al. (1967) Australian Journal of Chemistry 20:2285-2289.
Hausen et al. (1987) Contact Dermatitis 17: 1 -9.
Hinchee et al. (1988) Biotech. 6:915.
Horvath et al. (2000) Proc. Natl. Acad. Sci. U.S.A. 97: 1914-1919.
Ichihara and Noda (1977) Biochim. Biophys. Acta. 487:249-60.
Jones and Thaller (1978) Natural acetylenes. In Patai S. ed. The chemistry of the carbon-carbon triple bond. Part 2, John Wiley and Sons, p.621 -633. Kirsch et al. (1997) Plant Physiology 1 15 :283-289.
Kohn et al. (1987) Phytochemistry 26:2271-2275.
Kohn et al. (1988) Phyto chemistry 27: 1049-1051.
Koziel et al. (1996) Plant Mol. Biol. 32:393-405.
Lee et al. (1998) Science 280:915-918.
Meinwald et al. (1968) Science 160:890-892.
Minto and Blacklock (2008) Progress in Lipid Research 47:233-306.
Moore and Brown (1981) Insect Biochem 11 :493-499.
Needleman and Wunsch (1970) J. Mol Biol. 45:443-453.
Niedz et al. (1995) Plant Cell Reports 14: 403-406.
Ow et al. (1986) Science 234: 856-859.
Perez- Vich et al. (1998) JAOCS 75:547-555
Perrin et al. (2000) Mol Breed 6:345-352.
Petrie et al. (2010) Plant Methods 6:8.
Potenza et al. (2004) In Vitro Cell Dev Biol - Plant 40: 1 -22.
Prasher et al. (1985) Biochem. Biophys. Res. Comm. 126: 1259-68.
Reppy and Pndzola (2007) Chem Commun 42:4317-38.
Serra et al. (2007) Proceedings of the National Academy of Sciences of the USA 104: 16444-16449.
Smith and Nicolaou (1996) Journal of Medicinal Chemistry 39:2103-2117.
Sperling et al. (2000) European Journal of Biochemistry 267:3801 -3811.
Sperling et al. (2003). Prostaglandins Leukot Essent Fatty Acids 68:73-95
Spitzer et al. (1991) Fat Sci. Tech. 93: 169-174.
Stalker et al. (1988) Science 242:419-423.
Thillet et al. (1988) J. Biol. Chem. 263 : 12500.
Toriyama et al. (1986) Theor. Appl. Genet. 205:34.
Wood et al. (2009) Plant Biotechnology Journal 7:914-924.
Yang et al. (2003) Planta 216:597-603.
Zgoda et al. (2001) J. Nat. Prod. 64:1348-1349.

Claims

1. A recombinant cell comprising at least two exogenous polynucleotides selected from;
i) a first exogenous polynucleotide encoding a first polypeptide with Δ12 acetylenase activity,
ii) a second exogenous polynucleotide encoding a second polypeptide with Δ14 and/or Δ16 conjugase activity, and
iii) a third exogenous polynucleotide encoding a third polypeptide with Δ9 and/or Δ14 acetylenase activity,
wherein each polynucleotide is operably linked to one or more promoters that are capable of directing expression of said polynucleotides in the cell.
2. The recombinant cell of claim 1 , wherein the cell comprises;
i) the first, second and third exogenous polynucleotides,
ii) the first and third exogenous polynucleotides, or
iii) the first and second exogenous polynucleotides.
3. The recombinant cell of claim 1 or claim 2, wherein the first polypeptide converts linoleic acid to crepenymc acid.
4. The recombinant cell according to any one of claims 1 to 3, wherein the first polypeptide also has Δ12 desaturase activity.
5. The recombinant cell of claim 4, wherein the first polypeptide also converts oleic acid to linoleic acid and/or linoleidic acid.
6. The recombinant cell according to any one of claims 1 to 5, wherein the first polypeptide comprises;
i) amino acids having a sequence as set forth in any one of SEQ ID NOs:4 to 7 or 50,
ii) amino acids having a sequence which is at least 50% identical to any one or more of SEQ ID NOs:4 to 7 or 50, and/or
iii) a biologically active fragment of i) or ii).
7. The recombinant cell of claim 6, wherein the first polypeptide comprises; i) amino acids having a sequence as set forth in SEQ ID NO:4,
ii) amino acids having a sequence which is at least 50% identical to SEQ ID NO:4, and/or
iii) a biologically active fragment of i) or ii).
8. The recombinant cell according to an)' one of claims 1 to 7, wherein the second polypeptide converts crepenynic acid to dehydrocrepenynate and/or converts ene- diynoic acid to ene diyne-ene.
9. The recombinant cell according to any one of claims 1 to 8, wherein the second polypeptide comprises;
i) amino acids having a sequence as set forth in SEQ ID NO:3,
ii) amino acids having a sequence which is at least 50% identical to SEQ ID NO:3, and/or
iii) a biologically active fragment of i) or ii).
10. The recombinant cell according to any one of claims 1 to 9, wherein the Δ14 acetylenase activity of the third polypeptide converts dehydrocrepenynate to ene- diynoic acid.
11. The recombinant cell according to any one of claims 1 to 10, wherein the Δ9 acetylenase activity of the third polypeptide converts crepenynate to the methylene interrupted diacetylenic product CI 8:2 9A,12A.
12. The recombinant cell according to any one of claims 1 to 11, wherein the third polypeptide comprises;
i) amino acids having a sequence as set forth in SEQ ID NO: l or SEQ ID NO:2, ii) amino acids having a sequence which is at least 50% identical to one or both of SEQ ID NO: l or SEQ ID NO:2, and/or
iii) a biologically active fragment of i) or ii).
13. The recombinant cell according to any one of claims 1 to 12 which comprises the first, second and third exogenous polynucleotides, and which converts oleic acid to ene-diynoic acid and/or ene diyne-ene.
14. The recombinant cell according to any one of claims 1 to 13 which comprises an increased level of ene-diynoic acid and/or ene diyne-ene relative to a corresponding cell lacking at least one of the exogenous polynucleotides.
15. The recombinant cell according to any one of claims 1 to 14, wherein the cell further comprises an exogenous polynucleotide encoding diacylglycerol acyltransferase (DGAT), glycerol-3-phosphate acyltransferase (GPAT), l-acyl-glycerol-3-phosphate acyltransferase (LPAAT), acyl-CoA:lysophosphatidylcholine acyltransferase (LPCAT), phospholipase A2 (PLA2), phospholipase C (PLC), phospholipase D (PLD), CDP- choline diacylglycerol choline phosphotransferase (CPT), phoshatidylcholine diacylglycerol acyltransferase (PDAT), a fatty acid reductase, a fatty acid desaturase, a fatty acid elongase, a wax synthase, or a combination of two or more thereof.
16. The recombinant cell according to any one of claims 1 to 15, wherein the cell further comprises an introduced mutation or an exogenous polynucleotide which down regulates the production and/or activity of an endogenous enzyme of the cell selected from DGAT, GPAT, LPAAT, LPCAT, PLA2, PLC, PLD, CPT, PDAT, a fatty acid reductase, a fatty acid desaturase, a fatty acid elongase, a wax synthase or a combination of two or more thereof.
17. The recombinant cell of claim 16, wherein the exogenous polynucleotide is selected from: an antisense polynucleotide, a sense polynucleotide, a catalytic polynucleotide, a microRNA, a polynucleotide which encodes a polypeptide which binds the endogenous enzyme and a double stranded RNA.
18. The recombinant cell of claim 16 or claim 17, wherein the exogenous polynucleotide which down regulates the production and/or activity of an endogenous enzyme does not significantly effect the production and/or activity of an enzyme encoded by a exogenous polynucleotide in the cell.
19. The recombinant cell according to any one of claims 1 to 18 which is a eukaryotic cell.
20. The recombinant cell of claim 19 which is a plant cell, a mammalian cell, an insect cell, or a cell suitable for fermentation.
21. The recombinant cell of claim 20 which is in a plant or part thereof.
22. The recombinant cell of claim 21 , wherein the plant is an oilseed plant or part thereof.
23. A substantially purified and/or recombinant polypeptide which is a Δ9 and/or Δ14 acetylenase.
24. The polypeptide of claim 23 which converts dehydrocrepenynate to ene-diynoic acid, and/or converts crepenynate to the methylene interrupted diacetylenic product
C18:2 9A,12A.
25. The polypeptide of claim 23 or claim 24 which comprises;
i) amino acids having a sequence as set forth in SEQ ID NO: l or SEQ ID NO:2, ii) amino acids having a sequence which is at least 50% identical to one or both of SEQ ID NO: l or SEQ ID NO:2, and/or
iii) a biologically active fragment of i) or ii).
26. A substantially purified and/or recombinant polypeptide which is a Δ14 and/or Δ16 conjugase.
27. The polypeptide of claim 26 which converts crepenynic acid to dehydrocrepenynate and/or converts ene-diynoic acid to ene diyne-ene.
28. The polypeptide of claim 26 or claim 27 which comprises;
i) amino acids having a sequence as set forth in SEQ ID NO:3,
ii) amino acids having a sequence which is at least 50% identical to SEQ ID NO:3, and/or
iii) a biologically active fragment of i) or ii).
29. A substantially purified and/or recombinant polypeptide which is Δ12 acetylenase, wherein the polypeptide comprises;
i) amino acids having a sequence as set forth in SEQ ID NO:4,
ii) amino acids having a sequence which is at least 50% identical to SEQ ID NO:4, and/or
iii) a biologically active fragment of i) or ii).
30. The polypeptide of claim 29 which converts linoleic acid to crepenynic acid.
31. The polypeptide of claim 29 or claim 30 which also has Δ12 desaturase activity.
32. The polypeptide according to any one of claims 23 to 31, wherein the polypeptide comprises amino acids having a sequence which is at least 90% identical to any one or more of the sequences set forth in SEQ ID NOs: 1 to 4.
33. The polypeptide according to any one of claims 23 to 32 which can be isolated from an insect of the Order Coleoptera.
34. The polypeptide of claim 33, wherein the Coleoptera is a species of
Chauliognathus .
35. The polypeptide according to any one of claims 23 to 34 which is a fusion protein further comprising at least one other polypeptide.
36. An isolated and/or exogenous polynucleotide comprising;
i) a sequence of nucleotides of any one of SEQ ID NOs:8 to 11,
ii) a sequence of nucleotides encoding a polypeptide according to any one of claims 23 to 35,
iii) a sequence of nucleotides which is at least 50% identical to ι) or ii), and/or iv) a sequence of nucleotides which hybridizes to any one of i) to iii) under stringent conditions.
37. A vector comprising the polynucleotide according to claim 36.
38. The vector of claim 37, wherein the polynucleotide is operably linked to a promoter.
39. A recombinant cell comprising a recombinant polypeptide according to any one of claims 23 to 35, an exogenous polynucleotide of claim 36 and/or a vector of claim 37 or claim 38.
40. The cell of claim 39 which is a plant cell, a mammalian cell, an insect cell, or a cell suitable for fermentation.
41. A method of producing a polypeptide according to any one of claims 23 to 35, the method comprising expressing in a cell or cell free expression system a polynucleotide of claim 36.
42. The method of claim 41, further comprising isolating the polypeptide.
43. A transgenic non-human organism, or part thereof, comprising a cell according to any one of claims 1 to 22. 39 or 40.
44. The organism of claim 43 which is a transgenic plant.
45. The organism of claim 44 which is more resistant to an infection when compared to a corresponding plant lacking the cell.
46. A plant seed comprising a cell according to any one of claims 1 to 22, 39 or 40.
47. Oil produced by, or obtained from, any one or more of a cell according to any one of claims 1 to 22, 39 or 40, a transgenic non-human organism, or part thereof, according to any one of claims 43 to 45, a seed of claim 46, and an extract or portion of any one thereof.
48. The oil of claim 47 which comprises polyacetylenated fatty acid.
49. The oil of claim 47 or claim 48 which is seedoil.
50. Acetylenated fatty acid produced by, or obtained from, any one or more of a cell according to any one of claims 1 to 22, 39 or 40, a transgenic non-human organism, or part thereof, according to any one of claims 43 to 45, a seed of claim 46, and an extract or portion of any one thereof.
51. The fatty acid of claim 50, at least some of which is polyacety lenated.
52. A method of producing oil comprising acetylenated fatty acids, the method comprising extracting oil from any one or more of a cell according to any one of claims 1 to 22, 39 or 40, a transgenic non-human organism, or part thereof, according to any one of claims 43 to 45, a seed of claim 46, and an extract or portion of any one thereof.
53. A composition comprising any one or more of a cell according to any one of claims 1 to 22, 39 or 50, a polypeptide according to any one of claims 23 to 35, a polynucleotide according to claim 36, a vector of claim 37 or claim 38, oil according to any one of claims 47 to 49, a fatty acid of claim 50 or claim 51. and an extract or portion of any one thereof.
54. Feedstuffs, cosmetics or chemicals comprising any one or more of a cell according to any one of claims 1 to 22, 39 or 40, a transgenic non-human organism, or part thereof, according to any one of claims 43 to 45, a seed of claim 46, oil according to any one of claims 47 to 49, a fatty acid of claim 50 or claim 51 , composition of claim 53 and an extract or portion of any one thereof.
55. A method of producing a feedstuff, the method comprising admixing any one or more of a cell according to any one of claims 1 to 22. 39 or 40, a transgenic non-human organism, or part thereof, according to any one of claims 43 to 45, a seed of claim 46, oil according to any one of claims 47 to 49, a fatty acid of claim 50 or claim 51, a composition of claim 53, and an extract or portion of any one thereof, with at least one other food ingredient.
A method of producing seed, the method comprising:
i) growing a transgenic plant of claim 48 or claim 49, and
ii) harvesting the seed.
57. A fermentation process comprising the steps of:
i) providing a vessel containing a liquid composition comprising a cell of claim
20, or a transgenic non-human organism of claim 43, which is suitable for fermentation, and constituents required for fermentation and fatty acid biosynthesis, and
ii) providing conditions conducive to the fermentation of the liquid composition contained in said vessel.
58. Use of any one or more of a cell according to any one of claims 1 to 22, 39 or 40, a transgenic non-human organism, or part thereof, according to any one of claims 43 to 45, a seed of claim 46, oil according to any one of claims 47 to 49, a fatty acid of claim 50 or claim 51, a composition of claim 53, and an extract or portion of any one thereof, for the manufacture of an industrial product.
59. The use of claim 58, wherein the product is a lubricant or a polymer.
60. A method of treating and/or preventing a condition which would benefit from an acetylenated fatty acid, the method comprising administering to a subject any one or more of a cell according to any one of claims 1 to 22, 39 or 40, a polypeptide according to any one of claims 23 to 35, a polynucleotide according to claim 36, a vector of claim 37 or claim 38, a transgenic non-human organism, or part thereof, according to any one of claims 43 to 45, a seed of claim 46, oil according to any one of claims 47 to 49, a fatty acid of claim 50 or claim 51, a composition of claim 53, and an extract or portion of any one thereof.
61. The method of claim 60, wherein the condition is type 2 diabetes, cancer or an infection.
62. Use of any one or more of a cell according to any one of claims 1 to 22, 39 or 40, a polypeptide according to any one of claims 23 to 35, a polynucleotide according to claim 36, a vector of claim 37 or claim 38, a transgenic non-human organism, or part thereof, according to any one of claims 43 to 45, a seed of claim 46, oil according to any one of claims 47 to 49, a fatty acid of claim 50 or claim 51, a composition of claim 53, and an extract or portion of any one thereof, for the manufacture of a medicament for treating and/or preventing a condition which would benefit from an acetylenated fatty acid.
63. A process for selecting a nucleic acid molecule encoding a polypeptide with Δ9 and/or Δ14 acetylenase activity, the process comprising;
i) obtaining a cell comprising a nucleic acid molecule operably linked to a promoter which is active in the cell, wherein the nucleic acid molecule encodes a polypeptide comprising amino acids having a sequence that is at least 50% identical to one or both of the sequences set forth in SEQ ID NO: 1 or SEQ ID NO:2, ii) determining if the level of Δ9 and/or Δ14 acetylenated fatty acids is increased in the cell when compared to a corresponding cell lacking the nucleic acid, and
iii) selecting a nucleic acid molecule encoding a polypeptide with Δ9 and/or Δ14 acetylenase activity.
64. A process for selecting a nucleic acid molecule encoding a polypeptide with Δ14 and/or Δ16 conjugase activity, the process comprising;
i) obtaining a cell comprising a nucleic acid molecule operably linked to a promoter which is active in the cell, wherein the nucleic acid molecule encodes a polypeptide comprising amino acids having a sequence that is at least 50% identical to the sequences set forth in SEQ ID NO:3,
ii) determining if the level of Δ14 and/or Δ16 conjugated fatty acids is increased in the cell when compared to a corresponding cell lacking the nucleic acid, and
iii) selecting a nucleic acid molecule encoding a polypeptide with Δ14 and/or Δ16 conjugase activity.
65. A process for selecting a nucleic acid molecule encoding a polypeptide with Δ12 acetylenase activity, the process comprising;
i) obtaining a cell comprising a nucleic acid molecule operably linked to a promoter which is active in the cell, wherein the nucleic acid molecule encodes a polypeptide comprising amino acids having a sequence that is at least 50% identical to the sequences set forth in SEQ ID NO:4,
ii) determining if the level of Δ12 acetylenated fatty acids fatty acids is increased in the cell when compared to a corresponding cell lacking the nucleic acid, and
iii) selecting a nucleic acid molecule encoding a polypeptide with Δ12 acetylenase activity.
66. The process according to any one of claims 63 to 65, wherein the polypeptide is an insect polypeptide or mutant thereof.
67. A substantially purified antibody, or fragment thereof, that specifically binds a polypeptide of any one of claims 23 to 34.
PCT/AU2011/000859 2010-07-09 2011-07-05 Acetylenation of fatty acids Ceased WO2012003545A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
AU2010903057A AU2010903057A0 (en) 2010-07-09 Acetylenation of fatty acids
AU2010903057 2010-07-09

Publications (1)

Publication Number Publication Date
WO2012003545A1 true WO2012003545A1 (en) 2012-01-12

Family

ID=45440708

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2011/000859 Ceased WO2012003545A1 (en) 2010-07-09 2011-07-05 Acetylenation of fatty acids

Country Status (1)

Country Link
WO (1) WO2012003545A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3398442A1 (en) 2017-05-05 2018-11-07 Takasago International Corporation Use of acetylenic fatty acid compounds as kokumi flavor

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997037033A1 (en) * 1996-03-29 1997-10-09 Maureen Bafor Novel plant enzyme and use thereof
WO2001071042A2 (en) * 2000-03-23 2001-09-27 Pe Corporation (Ny) Detection kits, such as nucleic acid arrays, for detecting the expression of 10,000 or more drosophila genes and uses thereof
WO2005014832A1 (en) * 2003-07-31 2005-02-17 The University Of York Fatty acid biosynthesis 4
WO2005014831A1 (en) * 2003-07-31 2005-02-17 The University Of York Fatty acid biosynthesis 2
WO2008025068A1 (en) * 2006-08-29 2008-03-06 Commonwealth Scientific And Industrial Research Organisation Synthesis of fatty acids
WO2010023202A2 (en) * 2008-08-26 2010-03-04 Basf Plant Science Gmbh Nucleic acids encoding desaturases and modified plant oil

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997037033A1 (en) * 1996-03-29 1997-10-09 Maureen Bafor Novel plant enzyme and use thereof
WO2001071042A2 (en) * 2000-03-23 2001-09-27 Pe Corporation (Ny) Detection kits, such as nucleic acid arrays, for detecting the expression of 10,000 or more drosophila genes and uses thereof
WO2005014832A1 (en) * 2003-07-31 2005-02-17 The University Of York Fatty acid biosynthesis 4
WO2005014831A1 (en) * 2003-07-31 2005-02-17 The University Of York Fatty acid biosynthesis 2
WO2008025068A1 (en) * 2006-08-29 2008-03-06 Commonwealth Scientific And Industrial Research Organisation Synthesis of fatty acids
WO2010023202A2 (en) * 2008-08-26 2010-03-04 Basf Plant Science Gmbh Nucleic acids encoding desaturases and modified plant oil

Non-Patent Citations (10)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK 1 February 2007 (2007-02-01), Database accession no. EH660099 *
DATABASE GENBANK 10 July 2007 (2007-07-10), Database accession no. BAF69118 *
DATABASE GENBANK 31 January 2008 (2008-01-31), Database accession no. DB823803 *
DATABASE GENBANK 31 January 2008 (2008-01-31), Database accession no. DB837839 *
DATABASE GENBANK 31 January 2008 (2008-01-31), Database accession no. DB854354 *
DATABASE GENBANK 4 June 2010 (2010-06-04), Database accession no. GT306480 *
DATABASE GENBANK RICHARDS S. ET AL.: "The genome of the model beetle and pest Tribolium castaneum", Database accession no. DS497689 *
DEMBITSKY, V.M.: "Anticancer Activity of Natural and Synthetic Acetylenic Lipids", LIPIDS, vol. 41, no. 10, 2006, pages 883 - 924 *
MINTO, R.E ET AL.: "Biosynthesis and Function of Polyacetylenes and Allied Natural Products", PROGRESS IN LIPID RESEARCH, vol. 47, no. 4, 2008, pages 233 - 306 *
RICHARDS S. ET AL.: "The genome of the model beetle and pest Tribolium castaneum", NATURE, vol. 452, 2008, pages 949 - 955 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3398442A1 (en) 2017-05-05 2018-11-07 Takasago International Corporation Use of acetylenic fatty acid compounds as kokumi flavor
WO2018202862A1 (en) 2017-05-05 2018-11-08 Takasago International Corporation Use of acetylenic fatty acid compounds as kokumi flavor

Similar Documents

Publication Publication Date Title
US12203087B2 (en) Enzymes and methods for producing omega-3 fatty acids
US10925293B2 (en) Methods of producing lipids
US8816106B2 (en) Synthesis of fatty acids
AU2013204270B8 (en) Enzymes and methods for producing omega-3 fatty acids
WO2012003545A1 (en) Acetylenation of fatty acids
AU2020277266B2 (en) Enzymes and methods for producing omega-3 fatty acids

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11803021

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11803021

Country of ref document: EP

Kind code of ref document: A1