WO2011157728A1 - Use of inducible promoters in the production of glycolic acid - Google Patents

Use of inducible promoters in the production of glycolic acid Download PDF

Info

Publication number
WO2011157728A1
WO2011157728A1 PCT/EP2011/059884 EP2011059884W WO2011157728A1 WO 2011157728 A1 WO2011157728 A1 WO 2011157728A1 EP 2011059884 W EP2011059884 W EP 2011059884W WO 2011157728 A1 WO2011157728 A1 WO 2011157728A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
glycolic acid
pseudogene
expression
icd
Prior art date
Application number
PCT/EP2011/059884
Other languages
French (fr)
Other versions
WO2011157728A8 (en
Inventor
Wanda Dischert
Rainer Figge
Philippe Soucaille
Original Assignee
Metabolic Explorer
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Metabolic Explorer filed Critical Metabolic Explorer
Priority to BR112012031965A priority Critical patent/BR112012031965A8/en
Priority to CA2801823A priority patent/CA2801823C/en
Priority to EP11725734.5A priority patent/EP2582828B1/en
Priority to KR1020137000915A priority patent/KR101824282B1/en
Priority to CN201180039363.0A priority patent/CN103221548B/en
Priority to US13/704,578 priority patent/US9121043B2/en
Priority to JP2013514694A priority patent/JP5882310B2/en
Publication of WO2011157728A1 publication Critical patent/WO2011157728A1/en
Publication of WO2011157728A8 publication Critical patent/WO2011157728A8/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/42—Hydroxy-carboxylic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/635—Externally inducible repressor mediated regulation of gene expression, e.g. tetR inducible by tetracyline
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli

Definitions

  • the present invention relates to use of inducible promoters in the production of glycolic acid by fermentation.
  • the use of inducible promoters leads to a more stable glycolic acid producer strain.
  • Glycolic Acid (HOCH 2 COOH), or glycolate, is the simplest member of the alpha- hydroxy acid family of carboxylic acids. Glycolic acid has dual functionality with both alcohol and moderately strong acid functional groups on a very small molecule. Its properties make it ideal for a broad spectrum of consumer and industrial applications, including use in water well rehabilitation, the leather industry, the oil and gas industry, the laundry and textile industry, and as a component in personal care products.
  • Glycolic Acid can also be used to produce a variety of polymeric materials, including thermoplastic resins comprising polygly colic acid. Resins comprising polyglycolic acid have excellent gas barrier properties, and such thermoplastic resins comprising polyglycolic acid may be used to make packaging materials having the same properties (e.g., beverage containers, etc.).
  • the polyester polymers gradually hydrolyze in aqueous environments at controllable rates. This property makes them useful in biomedical applications such as dissolvable sutures and in applications where a controlled release of acid is needed to reduce pH.
  • Glycolic Acid occurs naturally as a trace component in sugarcane, beets, grapes and fruit, it is mainly produced synthetically. Technologies to produce Glycolic Acid are described in the literature or in patent applications. For instance, Mitsui Chemincals, Inc. has described a method for producing the said hydroxycarboxylic acid from an aliphatic polyhydric alcohol having a hydroxyl group at the end by using a microorganism (EP 2 025 759 Al and EP 2 025 760 Al). This method is a bioconversion as the one described by Michihiko Kataoka in its paper on the production of glycolic acid using ethylene gly col-oxidizing microorganisms ⁇ Biosci. Biotechnol. Biochem., 2001).
  • Glycolic acid is also produced by bioconversion from glycolonitrile using mutant nitrilases with improved nitrilase activity as disclosed by Dupont de Nemours and Co in WO2006/069110 and US 7,445,917.
  • These documents teach a process using formaldehyde and hydrogen cyanide as precursors for the synthesis of glycolonitrile, and using an enzyme catalyst having nitrilase activity for the synthesis of glycolic acid from glycolonitrile.
  • the main disadvantage of this process is that glycolonitrile is a chemical substance which may polymerize violently under the influence of traces of acid or base, with fire or explosion hazard. This substance decomposes on heating producing toxic fumes including hydrogen cyanide and nitrogen oxides. Therefore it is listed as an extremely hazardous substance.
  • glycolic acid cycle and glyoxylate bypass reviewed in Neidhardt, F. C. (Ed. in Chief), R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (eds). 1996. Escherichia coli and Salmonella: Cellular and Molecular Biology. American Society for Microbiology).
  • Isocitrate is either (1) cleaved into succinate and glyoxylate, a reaction catalyzed by isocitrate lyase, encoded by the aceA gene or (2) converted into a-ketoglutarate by isocitrate dehydrogenase, encoded by the icd gene.
  • Previous work described in patent application EP 2 027 277 has shown good productions of glycolic acid by strains having an attenuated expression of the icd gene. Reducing the flux in the TCA cycle to force it towards the glyoxylate shunt increased the yield of glycolic acid production significantly but at the same time, it weakened the strain.
  • inducible promoters in biotechno logical processes is in the art of industrial biotechnology. These promoters usually respond to chemical or physical stimuli exemplified by propionate (WO2007005837), zinc (WO2004020640), arabinose (WO1998011231), temperature ('Microbial conversion of glycerol to 1, 3-propanediol by an engineered strain of Escherichia coli.' Tang X, Tan Y, Zhu H, Zhao K, Shen W. Appl Environ Microbiol. 2009 Mar; 75(6): 1628-34.) and light.
  • propionate WO2007005837
  • zinc WO2004020640
  • arabinose WO1998011231
  • temperature 'Microbial conversion of glycerol to 1, 3-propanediol by an engineered strain of Escherichia coli.' Tang X, Tan Y, Zhu H, Zhao K, Shen W. Appl Environ Microbiol. 2009 Mar;
  • Efficient glycolic acid production requires fine tuning of pathways. For maximum glycolic acid production and improved stability of producer strains, it can be beneficial to be able to modulate the expression of certain key enzymes during the process. For instance, the expression of the icd gene is absolutely required for biomass production but not for glycolic acid production and vice versa for aceA. Therefore, use of inducible promoters may be of interest in improving the overall yield of producing glycolic acid at an industrial level. At this point use of inducible promoters to control expression of genes involved in glycolic acid production has never been considered nor reported.
  • heterologous inducible promoters may be beneficial when used to regulate gene expression of genes involved in complex metabolic pathways such as glycolic acid biosynthesis.
  • the present invention concerns a method for the production of glycolic acid in a fermentative process comprising the following steps:
  • the expression of at least one gene involved in glycolic acid production is under the control of a heterologous inducible promoter whose activity is modulated with said external stimulus.
  • the invention also concerns the microorganism modified for glycolic acid production in which expression of at least one gene involved in glycolic acid biosynthesis is under the control of a heterologous inducible promoter.
  • Figure 1 Glycolic acid biosynthesis pathway.
  • the present invention is related to a method for the production of glycolic acid in a fermentative process comprising the following steps:
  • the expression of at least one gene involved in glycolic acid production is under the control of a heterologous inducible promoter whose activity is modulated with said external stimulus.
  • glycosenchymal acid or "gycolate” are used interchangeably and have the same meaning. They designate the molecule of formula HOCH 2 COOH, that is the simplest member of the alpha-hydroxy acid family of carboxylic acids. According to the invention, the terms “fermentative process', 'fermentation” or 'culture' are used interchangeably to denote the growth of bacteria on an appropriate growth medium.
  • the method for the production of glycolic acid in a fermentative process is well known by the man skilled in the art. Different factors of the fermentative process can be modulated for the optimization of the process, such as the choice of the carbon source.
  • An “appropriate culture medium” is a medium appropriate for the culture and growth of the microorganism. Such media are well known in the art of fermentation of microorganisms, depending upon the microorganism to be cultured.
  • the appropriate culture medium comprises a source of carbone.
  • source of carbon refers to any carbon source capable of being metabolized by a microorganism wherein the substrate contains at least one carbon atom.
  • the source of carbon is selected among the group consisting of glucose, sucrose, monosaccharides (such as fructose, mannose, xylose, arabinose), oligosaccharides (such as galactose, cellobiose ...), polysaccharides (such as cellulose), starch or its derivatives, glycerol and single-carbon substrates whereby glyoxylic acid is produced.
  • monosaccharides such as fructose, mannose, xylose, arabinose
  • oligosaccharides such as galactose, cellobiose
  • polysaccharides such as cellulose
  • starch or its derivatives such as glycerol
  • glycerol single-carbon substrates whereby glyoxylic acid is produced.
  • An especially preferred carbon source is glucose.
  • Another preferred carbon source is sucrose.
  • the carbon source is derived from renewable feed-stock.
  • Renewable feed-stock is defined as raw material required for certain industrial processes that can be regenerated within a brief delay and in sufficient amount to permit its transformation into the desired product.
  • the fermentation is generally conducted in fermenters with an appropriate culture medium adapted to the microorganism being used, containing at least one simple carbon source, and if necessary co-substrates for the production of metabolites (as described in patent application EP 09171297.6).
  • the bacteria are fermented at a temperature between 20°C and 55°C, preferentially between 25°C and 40°C, and more specifically about 30°C to 37°C for E. coli.
  • the culture medium can be of identical or similar composition to M9 medium (Anderson, 1946, Proc. Natl. Acad. Sci. USA 32: 120-128), M63 medium (Miller, 1992; A Short Course in Bacterial Genetics: A Laboratory Manual and Handbook for Escherichia coli and Related Bacteria, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York) or a medium such as defined by Schaefer et al. (1999, Anal. Biochem. 270: 88-96).
  • M9 medium Anderson, 1946, Proc. Natl. Acad. Sci. USA 32: 120-128
  • M63 medium Miller, 1992; A Short Course in Bacterial Genetics: A Laboratory Manual and Handbook for Escherichia coli and Related Bacteria, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York
  • Schaefer et al. (1999, Anal. Biochem. 270: 88-96).
  • the term "microorganism” designates a bacterium, yeast or fungus
  • the microorganism is selected among gram negative bacteria such as Enterobacteriaceae, or among gram positive bacteria such as Bacillaceae, Streptomycetaceae and Corynebacteriaceae. More preferentially, the microorganism is a species of Escherichia, Klebsiella, Pantoea, Salmonella or Corynebacterium. Even more preferentially, the microorganism is either the species Escherichia coli or Corynebacterium glutamicum.
  • modified microorganism designates a genetically modified microorganism presenting an improved glycolic acid production.
  • “Improved glycolic acid production” means that the amount of glycolic acid produced by the microorganism, and particularly the glycolic acid yield (ratio of glycolic acid produced per carbon source), is higher in the modified microorganism compared to the corresponding unmodified microorganism.
  • the modified microorganism used in the method of the invention has two characteristics: it is modified for an improved glycolic acid production, and
  • - expression of at least one gene involved in glycolic acid production is under control, direct or indirect, of an inducible promoter.
  • the phrase "recovering glycolic acid from the culture medium” designates the action of recovering glycolic acid.
  • Recovery of the glycolic acid is made by a step of concentration of glycolate in the bacteria or in the medium and isolation of glycolic acid from the fermentation broth and/or the biomass optionally remaining in portions or in the total amount (0-100%) in the end product from the fermentation culture.
  • the process comprises a step of recovery of the glycolic acid produced in step (a) through a step of polymerization to at least glycolic acid dimers and (b) recovery of glycolic acid by depolymerisation from glycolic acid dimers, oligomers and/or polymers.
  • the step of recovery comprises the recovering of derivatives and precursors of glycolic acid present in the culture medium.
  • modulating the expression of a target gene means that the expression of a gene may be either allowed or repressed. This modulation may be achieved with an inducible promoter. Depending on the aim of this modulation, the man skilled in the art knows which kind of inducible system to use.
  • inducible promoter denotes a promoter whose activity can be increased or decreased upon an external stimulus. Stimuli can be physical or chemical in nature, such as temperature, light, chemicals etc.
  • Induction of the target gene can be obtained via direct or indirect transmission of the stimulus.
  • Indirect transmission can be accomplished by using heterologous RNA-polymerases that are under the control of an inducible promoter and that recognize specific promoters driving the expression of target genes involved in glycolic acid biosynthesis.
  • the inducible promoter is not directly linked to the promoter of the target gene, but drives the expression of an R A polymerase transcribing said promoter of the target gene.
  • heterologous RNA polymerases can be e.g. T3 RNA polymerase, T7 RNA polymerase or other polymerase known to the expert in the field.
  • Direct transmission is accomplished when the expression of one target gene is under the control of an inducible promoter.
  • heterologous inducible promoter designates the fact that the inducible promoter is not the native promoter of the gene and was introduced in a way to control, at least partially, the level of expression of the gene that is operably linked to it.
  • the activity of an inducible promoter is induced by the presence or absence of biotic or abiotic factors. Expression of genes can be turned on or off, according to the needs of the man skilled in the art. These promoters might be chemically-regulated (in presence of tetracycline, hormones, etc) or physically-regulated, especially by heat or light.
  • the expression of at least one gene involved in glycolic acid production is under the direct control of an heterologous inducible promoter.
  • This inducible promoter may be induced either by a physical stimulus or by a chemical stimulus.
  • the external stimulus is chosen amon temperature or light, ie. the inducible promoter is a temperature-inducible promoter or a light-inducible promoter.
  • the inducible promoter is advantageously induced by temperature, and is selected among: - promoters regulated by a modified repressor of phage lambda,such as:
  • the modified repressor of phage lambda is a temperature labile allele of the lambda repressor cl.
  • said repressor is the lambda repressor allele cI857 (On a thermosensitive repression system in the Escherichia coli lambda bacteriophage. Sussman R, Jacob F. C. R. Hebd. Seances Acad. Sci. 1962, 254, pl517).
  • Sussman et al. report a new mutant of the bacteriophage, being in the lysogenic state when cultivated at 32°C, but wherein its lyse is induced when the culture is maintained at a temperature of 40°C for one hour.
  • the gene recA encoding the protein RecA has been deleted.
  • the protein RecA is known to act as a protease on cl. Therefore the deletion of the gene encoding RecA excludes proteolysis of the lambda repressor cl.
  • the temperature-inducible promoter might advantageously be chosen between the promoter PR or a derivative, and the promoter PL or a derivative.
  • the temperature-inducible promoter is a modified lac promoter regulated by a temperature sensitive Lac repressor.
  • the external stimulus is a chemical stimulus, ie. the inducible promoter is chemically-regulated.
  • the induction of the promoter's activity is linked to changes in the repression of carbon catabolite.
  • Promoters that are activated by carbon catabolite repression are positively regulated via the activator "cAMP Repressor Protein” (CRP) at low concentrations of glucose or in the absence of glucose.
  • CPP cAMP Repressor Protein
  • the inducible promoter is induced by the presence of specific carbon sources or of sugar alcohols.
  • promoters that are induced by carbon sources or sugar alcohols include the arabinose or raffinose promoter and the mannitol promoter or glucitol promoters, respectively.
  • the principle of induction is based on the protein conformation.
  • a promoter activated by a specific stimulus either physical or chemical stimuli
  • the cognate repressor is active under its native form.
  • the presence of a specific stimulus induces a change of conformation of this repressor, which become unable to bind to the promoter and thus to activate gene transcription.
  • the cognate repressor is inactive under its native form and the presence of specific stimulus induces a change of its conformation which leads to an active form of the repressor which may repress gene transcription.
  • an inducible promoter either activated or repressed by a physical or a chemical stimulus in accordance with the organism used , the culture conditions and the aim of modulation of the expression of a target gene.
  • genes of interest are regulated via "indirect transmission", i.e at least one gene involved in glycolic acid production is transcribed by a heterologous RNA polymerase whose expression is under the control of an inducible promoter.
  • the heterologous RNA polymerase is chosen from T7, T3 polymerase.
  • the 'target gene' is at least one gene involved in gly colic acid production or in the production of its precursors.
  • the target gene is under the control, direct or indirect, of a heterologous inducible promoter; as previously explained, either the gene is under the direct control of an inducible promoter, or the gene is transcribed by an inducible RNA polymerase or both combinations.
  • Genes involved in gly colic acid production in a microorganism are known in the art, and comprise genes involved in the gly colic acid specific biosynthesis pathway as well as genes involved in precursor-providing pathways and genes involved in gly colic acid consuming pathways.
  • Gly colic acid producing strains have been described in patent applications EP 2 027 227 and WO 2010/108909, that are incorporated as reference into this application.
  • glycolic acid producing strains comprise at least one of the following modifications :
  • Said glycolic acid producing strains may comprise furthermore at least one of the following modifications :
  • At least one of the following genes involved in glycolic acid production may be under the control of an inducible promoter whose activity is modulated with an external stimulus: a) Genes encoding the enzymes involved in the crossroad of the TCA cycle and the glyoxylate shunt:
  • NADPH-glyoxylate reductase c Genes encoding enzymes directly or indirectly involved in the production of co factor NADPH and regulation of the redox state of the cell:
  • Phosphoenolpyruvate (PEP) carboxykinase ppc b3956 Phosphoenolpyruvate carboxylase e) Genes encoding enzymes involved in acetate metabolism:
  • At least two genes of the preceding genes mentionned and any combination of these genes are under the control of inducible promoters to increase glycolic acid production.
  • the expression of the gene icd is under the control of a heterologous inducible promoter, directly or indirectly.
  • the enzyme isocitrate dehydrogenase belongs to the TCA cycle and catalyzes the transformation of isocitrate to cc-ketoglutarate. Since isocitrate is at the junction of the TCA cycle which leads to biomass and the glyoxylic shunt which leads to glycolic acid, its distribution in these pathways has a huge impact on the production of glycolic acid.
  • the gene icd is under the control of an inducible promoter, which allowes expression of icd gene at 37°C to 42°C and represses expression of icd gene at 28°C to 32°C.
  • the modified microorganism is grown from 37°C to 42°C to produce biomass (conditions wherein icd is expressed) and from 28°C to 30°C to produce glycolic acid (conditions wherein icd is repressed).
  • the step of recovery of the produced glycolic acid in the culture medium comprises the recovering of derivatives and precursors of glycolic acid present in the culture medium.
  • “Derivatives or precursors” of glycolic acid designates all intermediate compounds in the metabolic pathway of formation and degradation of glycolic acid.
  • Precursors of glycolic acid are in particular: citrate, isocitrate, glyoxylate, and in general all compounds of the glyoxylate cycle.
  • Derivatives of glycolic acid are in particular glycolate esters such as ethyl glycolate ester, methyl glycolate ester and polymers containing glycolate such as polygly colic acid.
  • Genes controlled by the inducible promoter may either be at its native position on the chromosome or integrated at a non-native position. One or several integrations of the gene controlled by the inducible promoter may be required for optimal glycolic acid production. Similarly, one or several copies of the regulator gene may be required for optimal expression. Different ratios of repressor gene copies and promoters may be used to fine- tune expression.
  • loci The gene under the control of the inducible promoter should preferentially be integrated into loci, whose modification does not have a negative impact on glycolic acid production.
  • loci into which the gene may be integrated are: Locus Accession Function
  • aaaD 87081759 Pseudogene, phage terminase protein A homolog, N-terminal fragment aaaE 1787395 Pseudogene, phage terminase protein A homolog, C-terminal fragment afuB 1786458 Pseudogene, ferric ABC family transporter permease;
  • C-terminal fragment afuC 87081709 predicted ferric ABC transporter subunit (ATP -binding component) agaA 48994927 Pseudogene, C-terminal fragment, GalNAc-6-P deacetylase
  • gapC 87081902 Pseudogene reconstruction GAP dehydrogenase gatR 87082039 Pseudogene reconstruction, repressor for gat operon glvC 1790116 Pseudogene reconstruction
  • IS911 transposase ORFAB insO none Pseudogene reconstruction IS911 transposase ORFAB insX 87081710 Pseudogene
  • IS3 family transposase N-terminal fragment insZ 1787491 Pseudogene reconstruction
  • IS4 transposase family in ISZ' intA 1788974 Integrase gene
  • mcrA 1787406 5-methylcytosine-specific DNA binding protein
  • pinH 1789002 Pseudogene, DNA invertase, site-specific recombination
  • yagA 1786462 predicted DNA-binding transcriptional regulator
  • yaiT 1786569 Pseudogene reconstruction
  • autotransporter family yaiX 87082443 Pseudogene reconstruction
  • interrupted by IS2A ybbD 1786709 Pseudogene reconstruction novel conserved family ybcK 1786756 predicted recombinase
  • ybcM 1786758 predicted DNA-binding transcriptional regulator ybcN 1786759 DNA base- flipping protein
  • ybcY 48994878 Pseudogene reconstruction methyltransferase family ybeM 1786843 Pseudogene reconstruction, putative CN hydrolase ybfG 87081771 Pseudogene reconstruction, novel conserved family ybfl none Pseudogene reconstruction, KdpE homolog ybfL 87081775 Pseudogene reconstruction, H repeat-associated protein ybfo 1786921 Pseudogene, copy of Rhs core with unique extension ycgH 87081847 Pseudogene reconstruction
  • the invention is also related to a microorganism modified for an improved production of glycolic acid wherein the expression of at least one gene involved in gly colic acid production is under the control, direct or indirect, of a heterologous inducible promoter as defined above.
  • the microorganism cannot metabolize glyoxylate to other compounds than glycolate, by inactivating the genes coding for the malate synthases (ace and g/cB), the glyoxylate carboligase (gel) and the 2-keto-3-deoxygluconate 6- phosphate aldolase (eda),
  • the microorganism cannot metabolize glycolate, by attenuating genes glcDEF and aldA,
  • the glyoxylate pathway flux is increased by attenuation of icd, acek, pta, ack, poxB, iclR or fadR and/or by overexpression of aceA
  • the conversion of glyoxylate to glycolate is increased by overexpressing endogenous encoding genes like ycdW,
  • genes and proteins are identified using the denominations of the corresponding genes in E. coli. However, and unless specified otherwise, use of these denominations has a more general meaning according to the invention and covers all the corresponding genes and proteins in other organisms, more particularly microorganisms.
  • PFAM protein families database of alignments and hidden Markov models; http://www.sanger.ac.uk/Software/Pfam/) represents a large collection of protein sequence alignments. Each PFAM makes it possible to visualize multiple alignments, see protein domains, evaluate distribution among organisms, gain access to other databases, and visualize known protein structures.
  • COGs clusters of orthologous groups of proteins; http ://www.ncbi.nlm.nih. ov/COG/ are obtained by comparing protein sequences from fully sequenced genomes representing major phylogenic lines. Each COG is defined from at least three lines, which permits the identification of former conserved domains.
  • the means of identifying homologous sequences and their percentage homologies are well known to those skilled in the art, and include in particular the BLAST programs, which can be used from the website http://www.ncbi.nlm.nih.gov/BLAST/ with the default parameters indicated on that website.
  • the sequences obtained can then be exploited (e.g., aligned) using, for example, the programs CLUSTALW (http://www.ebi.ac.uk/clustalw/) or MULTALIN (http://bioinfo.genotoul.fr/multalin/multalin.html), with the default parameters indicated on those websites.
  • the microorganism previously genetically modified to produce glycolic acid contains at least one gene, which expression is under control of a heterologous inducible promoter, selected among icd, ace A, ycdW, pgi, pntAB, udhA,arcA, maeA, maeB, mdh, pck, ppc, ackA, pta, poxB, UdP, glcA, yjcG, IdhA and mgsA. More preferably the gene under control of a heterologous inducible promoter is icd.
  • a heterologous inducible promoter selected among icd, ace A, ycdW, pgi, pntAB, udhA,arcA, maeA, maeB, mdh, pck, ppc, ackA, pta, poxB, UdP, glcA, yjcG, I
  • the use of the inducible promoter allows expression of the icd gene at 37°C to 42°C and represses expression of the icd gene at 28°C to 32°C.
  • the microorganism presents a glycolic acid production of at least 50% of the initial production after 30 generations, preferentially of at least 70% of the initial production after 30 generations, most preferably 90% of the initial production after 30 generations.
  • Said microorganism presents a much more stable production of glycolic acid during a fermentation culture for several generations at an industrial scale.
  • Protocol 1 Introduction of a PCR product for recombination and selection of the recombinants (FRT system)
  • the oligonucleotides chosen and given in Table 1 for replacement of a gene or an intergenic region were used to amplify either the chloramphenicol resistance cassette from the plasmid pKD3 or the kanamycin resistance cassette from the plasmid pKD4 (Datsenko, K.A. & Wanner, B.L. (2000)).
  • the PCR product obtained was then introduced by electroporation into the recipient strain bearing the plasmid pKD46 in which the system ⁇ Red ( ⁇ , ⁇ ,. ⁇ ) expressed greatly favours homologous recombination.
  • the antibiotic- resistant trans formants were then selected and the insertion of the resistance cassette was checked by PCR analysis with the appropriate oligonucleotides given in Table 2. Protocol 2: Transduction with phage PI for deletion of a gene
  • the DNA transfert from one E. coli strain to the another was performed by the technique of transduction with phage PI .
  • the protocol was in two steps, (i) the preparation of the phage lysate on the donor strain with a single gene modified and (ii) the transduction of the recipient strain by this phage lysate.
  • E. coli recipient strain in LB medium E. coli recipient strain in LB medium.
  • Control tubes 100 ⁇ cells
  • Tube test 100 ⁇ of cells + 100 ⁇ phages PI of strain MG1655 with a single gene modified.
  • the antibiotic-resistant transformants were then selected and the insertion of the deletion was checked by a PCR analysis with the appropriate oligonucleotides given in Table 2.
  • Protocol 3 Introduction of a PCR product for recombination and selection of the recombinants (Cre-LOX system)
  • the oligonucleotides chosen and given in Table 1 for replacement of a gene or an intergenic region were used to amplify either the chloramphenicol resistance cassette from the plasmid loxP-cm-loxP (Gene Bridges) or the neomycin resistance cassette from the plasmid loxP-PGK-gb2-neo-loxP (Gene Bridges).
  • the PCR product obtained was then introduced by electroporation into the recipient strain bearing the plasmid pKD46 in which the system ⁇ Red ( ⁇ , ⁇ ,. ⁇ ) expressed greatly favours homologous recombination.
  • the antibiotic-resistant transformants were then selected and the insertion of the resistance cassette was checked by PCR analysis with the appropriate oligonucleotides given in Table 2.
  • thermo inducible strain to produce glycolic acid by fermentation MG1655 Ptrc50/RBSB/TTG-ic ⁇ /:: M AuxaCA::KN/TTadcca-cI857-VR/KBS01*2-icd- TT02::Km AaceB Agcl AglcOEFGB AaldA AiclR Aedd+eda ApoxB AackA+pia (pME101-jCi W-TT07-PflceA-flceA-TT01)
  • strain E.coli MG1655 AaceB Agcl AglcOEFGB AaldA AiclR Aedd+eda ApoxB AackA+pta (pME101-jc W-TT07-PaceA-aceA-TT01) was built according to the description given in patent application WO 2010/108909.
  • the plasmid pUC18-D M xaCA-RN/TTa cca-cI857-PR/RBS01 !i: 2-zc -TT02 was built for this purpose as detailed below.
  • the fragment TTa cca-cI857-PR/RBS01 *2-zc -TT02 was synthesized by PCR and cloned into the vector pUC18-DwxaCA-SMC-Km (SMC for Multiple Cloning Site).
  • the DwxaCA-SMC-Km fragment was obtained by PCR on the MG1655 DwxaCA-SMC-Km genomic DNA as template and cloned into pUC18 (Norrander et al, 1983, Gene 26,101-106).
  • T7Te transcriptional terminator sequence from T7 phage (Harrington K.J., Laughlin R.B. and Liang S. Proc Natl Acad Sci U S A. 2001 Apr 24;98(9):5019-24.),
  • the resulting PCR product was introduced by electroporation into the strain MG1655 (pKD46). Then, the kanamycin-resistant transformants were selected, and the insertion of the antibiotic cassette was checked by PCR analysis with the oligonucleotides Ome 1612- uxaCA_R3 and Ome 1774-DuxaCA_F showed in Table 2 (Seq. N°15 and N°16). The selected clones were validated by DNA sequencing. The final strain was named MG1655 DttxaCA-SMC-Km. - Construction of the plasmid pUC18-D «xaC A-SMC-Km:
  • the DwxaCA-SMC-Km region was amplified by PCR from genomic DNA of the strain MG1655 DwxaCA-SMC-Km as template and oligonucleotides Ome 1515-uxaCA R2 and Ome 1516-uxaCA F2 showed in Table 1 (Seq. N°3 and N°4) :
  • uxaCA a region (italic upper case) homologous to the upstream region of uxaCA (from 3243425 to 3243402)
  • the PCR product obtained with a blunt-end DNA polymerase was cleaved by the restriction enzyme EcoRV and cloned into the Smal site of pUC18.
  • the resulting plasmid was checked by sequencing and named pUC 18-DwxaC A-SMC-Km.
  • the TTa ⁇ icca-c/S57-PR/RBS01 *2 region was amplified by PCR from the pFCl vector as template (Mermet-Bouvier & Chauvat, 1994, Current Microbiology, vol. 28, pp 145-148) and oligonucleotides TTadcca-cI857-icd F and PR/RBS01 *2-ic ⁇ -TT02 R listed in Table 1 (Seq. N°5 and N°6).
  • the fragment z ' c ⁇ i-TT02 was amplified by PCR from the MG1655 genomic DNA using the oligonucleotides PR/RBS01 *2-zcd-TT02 F and TT02-zc R (Seq. N°7 and N°8).
  • the TTa ⁇ icca-c/S57-PR/RBS01 *2-z ' c ⁇ i-TT02 region was synthesized by PCR using a mix of TTadcca-c/S57-PR/RBS01 *2 and z ' c -TT02 PCR products as template and the oligonucleotides T ⁇ adcca-cl857-icd F and TT02-z ' c ⁇ i R (Seq. N°5 and N°8).
  • TTadcca transcriptional terminator sequence transcription terminator of the adc gene from Clostridium acetobutylicum, homologous from 179847 to 179807 of the pSOLl megaplasmid
  • kanamycin-resistant transformants were selected, and the insertion of OuxaCA-KNmadcca-cI857- PR/RBS01 *2-z ' c ⁇ i-TT02::Km into the chromosome was checked by a PCR analysis with the oligonucleotides Ome 1612-uxaCA_R3 and Ome 1774- DuxaCA F (Seq. N°15 and N°16).
  • the strain was named MG1655 OuxaC A-KN/TTadcca-cI857-PR/RBSO l *2-icd- TT02::Km.
  • the antibiotics resistant transformants were selected and the insertion of AuxaCA::RN/TTadcca-cI857- PR/RBS01 *2-z ' c ⁇ i-TT02::Km on the chromosome was checked by PCR analysis with oligonucleotides Ome 1612- uxaCA_R3 (seq. N°15) and Ome 1774- DuxaCA F (seq N°16).
  • the resulting strain was named MG1655 Ptrc50/RBSB/TTG-z ' c ::Cm AuxaCA: :KN/TTadcca-cI857-PR/RBSO 1 *2-z ' c ⁇ i-TT02 : :Km AaceB Agcl Ag/cDEFGB AaldA Az ' c/R Aedd+eda ApoxB AackA+pta.
  • the plasmid pME101-jc ⁇ iW-TT07-PaceA-aceA-TT01 was finally introduced by electroporation to lead to the MG1655 Ptrc50/RBSB/TTG-z ' c ::Cm AuxaCA::RN/TTadcca-cI857-PR/RBS0l *2-icd-TT02::Km AaceB Agcl Ag/cDEFGB AaldA AiclK Aedd+eda ApoxB AackA+pta (pME101-jc W-TT07-PaceA-aceA-TT01) named AG1385.
  • thermo inducible strain to produce glycolic acid by fermentation MG1655 TTfli ccfl/CI857/PR01/RBS01*2-/ci ::Km AaceB Agcl A ⁇ cDEFGB AaldA AiclR Aedd+eda ApoxB AackA+pta AaceKr.Cm (pME101-jci W-TT07-PaceA-aceA- TT01)
  • strain E.coli MG1655 AaceB Agcl Ag/cDEFGB AaldA AiclK Aedd+eda ApoxB AackA+pta (pME101-jc ⁇ iW-TT07-PaceA-aceA-TT01) was built according to the description given in patent applications EP 09155971,6 and US 61162,712.
  • the natural icd promoter was replaced in the strain E.coli MG1655 by the DNA fragment TTa cca-cI857-PR01/RBS01 *2::Km
  • To replaced the natural icd promoter by the TTa ⁇ icca-cI857-PR01/RBS01 *2 DNA fragment we used the homologous recombination strategy described by Datsenko & Wanner (2000).
  • the construction was performed according to the technique described in Protocol 1.
  • T7Te transcriptional terminator sequence from T7 phage (Harrington K.J., Laughlin R.B. and Liang S. 2001, PNAS Apr 24;98(9):5019-24.),
  • the PCR fragment TTadcca-cI857-PR01/RBS01 *2-zcd::Km was first introduced by electroporation into the strain MG1655 (pKD46) to give the strain MG1655 YYadcca- cI857-PR01/RBS01 *2-zc ::Km Kanamycin resistant transformants were selected.
  • TTa ⁇ icca-cI857-PR01/RBS01 *2-z ' c ⁇ i::Km fragment was checked by PCR analysis with oligonucleotides Ome 704 seq Ptrc-icd F and Ome 705 seq Ptrc-z ' c ⁇ i R listed in Table 2 (Seq. N°17 and N°18) and then validated by sequencing.
  • the resulting strain was named MG1655 TTadcca-cI857-PR01/RBS01 *2-zcd::Km.
  • kanamycin-resistant transformants were selected and the insertion of the TTa cca-c/S57-PR01/RBS01 !i: 2-zc -TT02::Km region was checked by PCR analysis with the oligonucleotides Ome 704 seq Ptrc-icd F (seq N°17) and Ome 705 seq Ptrc-icd R (seq N°18).
  • the strain was named MG1655 TTadcca-cI857-PR01/RBS01 *2- z ' c -TT02::Km AaceB Agcl Ag/cDEFGB AaldA AiclK Aedd+eda ApoxB AackA+pta.
  • the gene aceK was deleted in the strain E.coli MG1655 TTadcca-cI857-PR01/RBS01 *2- z ' c -TT02::Km AaceB Agcl Ag/cDEFGB AaldA AiclK Aedd+eda ApoxB AackA+pta (pKD46) by homologous recombination as previously described using the oligonucleotides Ome 0205 -DaceB AKR and Ome 0700-DaceK F (Seq. N°13 and N°14) described in table 1 (See Protocol 3). Oag 0074-DaceK-loxP R (SEQ ID NO 13)
  • chloramphenicol resistance cassette reference sequence Gene Bridges
  • Chloramphenicol and kanamycin resistant transformants were then selected and verified by PCR analysis with the oligonucleotides Ome 0169-BAK F and Ome 0701-aceK F listed in Table 2 (Seq. N°19 and N°20).
  • the plasmid pME101-jc W-TT07-PaceA- aceA-TTOl was introduced into the strain MG1655 TTadcca-c/S57-PR01/RBS01 *2-z ' cd- TT02::Km AaceB Agcl Ag/cDEFGB AaldA AiclK Aedd+eda ApoxB AackA+pta AaceK::Cm.
  • Glycolic acid production was determined in the thermo inducible strains AG1385 and AG1413. Construction of these strains has been described in examples 1 and 2. Genotypes of the strains used below:
  • Strain AG0662 possesses an attenuated expression of icd gene. Whatever the temperature of the culture is, the isocitrate dehydrogenase activity (ICD) of the cells is around 50mUI/mg (table 4).
  • ICD isocitrate dehydrogenase activity
  • strains AG0662, AG1385 and AG1413 were cultivated successively for 30 generations, corresponding to a minimum number for an industrial process, before determining their performance in fermentors.
  • Table 1 Composition of minimal medium MML8AG1 100.
  • Successive cultures were also grown in 700mL working volume vessels assembled on a Multifors Multiple Fermentor System (Infers). Each vessel was filled up with 200 ml of synthetic medium MML11AG1 100 supplemented with 20 g/1 of glucose and 50 mg/1 of spectinomycin and inoculated to an OD between 0,01 and 0,8.
  • Table 2 Composition of minimal medium MML11AG1 100.
  • Cultures were carried out at 37 °C with an aeration of 0,2 1pm and dissolved oxygen was maintained above 30% saturation by controlling agitation (initial : 300 rpm ; max : 1200 rpm) and oxygen supply (0 to 40 ml/min).
  • the pH was adjusted at pH 6.8 ⁇ 0.1 by the addition of base (mix of NH40H 7.5 % w/w and NaOH 2.5% w/w).
  • the fermentation was carried out in discontinuous fed-batch mode, with a feed solution of 700 g/1 of glucose (See table 3). When glucose was used up in the culture medium, a pulse of fed restored a concentration of 20 g/1 of glucose.
  • Table 3 Composition of feed solution. After 30 generations grown at 37°C, populations were sampled and stored in glycerol at - 80°C (dilution in sterile glycerol solution at 40% w/w).
  • thermo inducible strains AG 1385 and AG1413 The fermentation process used for the thermo inducible strains AG 1385 and AG1413 is described in example 4 below.
  • strain AG0662 is highly unstable, since the performances of the strain when cultured for 30 generations before the performance test are much lower than without additional cultivation before the test.
  • thermo inducible icd gene in the glycolic acid producer strains improves the strain stability.
  • Isocitrate dehydrogenase activity was measured for each strain and each population at the same OD according to the protocol described in example 5.
  • activity of ICD must be low; around 50 to lOOmUI/mg.
  • thermo inducible strains The protocol used for thermo inducible strains is based on the "pH increase" protocol described in patent EP 09171297.6 with specific modification due to the thermo regulation of icd gene.
  • Cultures were carried out at 30 °C with an aeration of 0,2 1pm and dissolved oxygen was maintained above 30% saturation by controlling agitation (initial : 300 rpm ; max : 1200 rpm) and oxygen supply (0 to 40 ml/min).
  • pH was adjusted at pH 6.8 ⁇ 0.1 by the addition of base (mix of NH40H 7.5 % w/w and NaOH 2.5% w/w).
  • base mixture of NH40H 7.5 % w/w and NaOH 2.5% w/w.
  • the fermentation was carried out in discontinuous fed-batch mode, with a feed solution of 700 g/1 glucose.
  • pH was adjusted from 6.8 to 7.4 over an interval of 2 h and kept constant until the end of the culture.
  • Isocitrate dehydrogenase activity assay To assay isocitrate dehydrogenase activity, cells (25mg) were lysed by a Precellys (1x30s at 6500rpm, Bertin Technologies) and cell debris were removed by centrifugation at 12000g (4°C) during 30 minutes. Protein concentrations were determined by Bradford. ICD activity was determined in a volume of 300 ⁇ at pH 8,2 and 30°C. The assay mixture contained 50mM Tris-HCl (pH 8,2), 50mM MgCl 2 , 5mM NADP + , 0,5mM Oxalate and 3- 6 ⁇ g of crude cell extract. The reaction mixture was incubated at 30°C for 10 minutes.
  • Table 6 ICD activities measured on precultures and last time points of culture of AG1385 and AG1413 cultivated in Multifors according to conditions described in Example 4. PC were grown at 37°C (biomass production phase) and main cultures at 30°C (glycolic acid production phase).

Abstract

The present invention relates to use of inducible promoters in the production of glycolic acid by fermentation. The present invention concerns a method for the production of glycolic acid in a fermentative process comprising the following steps: -culturing a modified microorganism in an appropriate culture medium comprising a source of carbon, -modulating in said microorganism the expression of a target gene with an external stimulus,and -recovering glycolic acid from the culture medium, wherein in said modified microorganism, the expression of at least one gene involved in glycolic acid production is under the control of a heterologous inducible promoter whose activity is modulated with said external stimulus. The invention also concerned the modified microorganism used in the method of glycolic acid production.

Description

Use of inducible promoters in the production of glycolic acid
FIELD OF THE INVENTION
The present invention relates to use of inducible promoters in the production of glycolic acid by fermentation. The use of inducible promoters leads to a more stable glycolic acid producer strain.
BACKGROUND OF THE INVENTION
Glycolic Acid (HOCH2COOH), or glycolate, is the simplest member of the alpha- hydroxy acid family of carboxylic acids. Glycolic acid has dual functionality with both alcohol and moderately strong acid functional groups on a very small molecule. Its properties make it ideal for a broad spectrum of consumer and industrial applications, including use in water well rehabilitation, the leather industry, the oil and gas industry, the laundry and textile industry, and as a component in personal care products.
Glycolic Acid can also be used to produce a variety of polymeric materials, including thermoplastic resins comprising polygly colic acid. Resins comprising polyglycolic acid have excellent gas barrier properties, and such thermoplastic resins comprising polyglycolic acid may be used to make packaging materials having the same properties (e.g., beverage containers, etc.). The polyester polymers gradually hydrolyze in aqueous environments at controllable rates. This property makes them useful in biomedical applications such as dissolvable sutures and in applications where a controlled release of acid is needed to reduce pH. Currently more than 15,000 tons of glycolic acid are consumed annually in the United states.
Although Glycolic Acid occurs naturally as a trace component in sugarcane, beets, grapes and fruit, it is mainly produced synthetically. Technologies to produce Glycolic Acid are described in the literature or in patent applications. For instance, Mitsui Chemincals, Inc. has described a method for producing the said hydroxycarboxylic acid from an aliphatic polyhydric alcohol having a hydroxyl group at the end by using a microorganism (EP 2 025 759 Al and EP 2 025 760 Al). This method is a bioconversion as the one described by Michihiko Kataoka in its paper on the production of glycolic acid using ethylene gly col-oxidizing microorganisms {Biosci. Biotechnol. Biochem., 2001).
Glycolic acid is also produced by bioconversion from glycolonitrile using mutant nitrilases with improved nitrilase activity as disclosed by Dupont de Nemours and Co in WO2006/069110 and US 7,445,917. These documents teach a process using formaldehyde and hydrogen cyanide as precursors for the synthesis of glycolonitrile, and using an enzyme catalyst having nitrilase activity for the synthesis of glycolic acid from glycolonitrile. The main disadvantage of this process is that glycolonitrile is a chemical substance which may polymerize violently under the influence of traces of acid or base, with fire or explosion hazard. This substance decomposes on heating producing toxic fumes including hydrogen cyanide and nitrogen oxides. Therefore it is listed as an extremely hazardous substance.
Methods for producing Gly colic Acid by fermentation from sugar, and in particular from renewable resources, using bacterial strains are disclosed in patent applications from Metabolic Explorer (WO 2007/141316 and WO 2010/108909).
The biological production of glycolic acid requires the formation of intermediates from the central metabolism of the bacterium (see Fig 1.). Isocitrate situated at the junction of the Krebs cycle and the glyoxylate shunt is one of them (Tricarboxylic acid cycle and glyoxylate bypass, reviewed in Neidhardt, F. C. (Ed. in Chief), R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (eds). 1996. Escherichia coli and Salmonella: Cellular and Molecular Biology. American Society for Microbiology). Isocitrate is either (1) cleaved into succinate and glyoxylate, a reaction catalyzed by isocitrate lyase, encoded by the aceA gene or (2) converted into a-ketoglutarate by isocitrate dehydrogenase, encoded by the icd gene. Previous work described in patent application EP 2 027 277 has shown good productions of glycolic acid by strains having an attenuated expression of the icd gene. Reducing the flux in the TCA cycle to force it towards the glyoxylate shunt increased the yield of glycolic acid production significantly but at the same time, it weakened the strain.
The strains with an attenuated expression of the icd gene were not stable when grown for many generations, which is a strong disadvantage for industrial use. The authors found a solution to the problem by using inducible promoters.
Use of inducible promoters in biotechno logical processes is in the art of industrial biotechnology. These promoters usually respond to chemical or physical stimuli exemplified by propionate (WO2007005837), zinc (WO2004020640), arabinose (WO1998011231), temperature ('Microbial conversion of glycerol to 1, 3-propanediol by an engineered strain of Escherichia coli.' Tang X, Tan Y, Zhu H, Zhao K, Shen W. Appl Environ Microbiol. 2009 Mar; 75(6): 1628-34.) and light.
Efficient glycolic acid production requires fine tuning of pathways. For maximum glycolic acid production and improved stability of producer strains, it can be beneficial to be able to modulate the expression of certain key enzymes during the process. For instance, the expression of the icd gene is absolutly required for biomass production but not for glycolic acid production and vice versa for aceA. Therefore, use of inducible promoters may be of interest in improving the overall yield of producing glycolic acid at an industrial level. At this point use of inducible promoters to control expression of genes involved in glycolic acid production has never been considered nor reported.
The inventors have found that heterologous inducible promoters may be beneficial when used to regulate gene expression of genes involved in complex metabolic pathways such as glycolic acid biosynthesis.
BRIEF DESCRIPTION OF THE INVENTION
The present invention concerns a method for the production of glycolic acid in a fermentative process comprising the following steps:
- culturing a modified microorganism in an appropriate culture medium comprising a source of carbon,
modulating in said microorganism the expression of a target gene with an external stimulus, and
recovering glycolic acid from the culture medium,
wherein in said modified microorganism, the expression of at least one gene involved in glycolic acid production is under the control of a heterologous inducible promoter whose activity is modulated with said external stimulus.
The invention also concerns the microorganism modified for glycolic acid production in which expression of at least one gene involved in glycolic acid biosynthesis is under the control of a heterologous inducible promoter.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 : Glycolic acid biosynthesis pathway.
DETAILED DESCRIPTION OF THE INVENTION
The present invention is related to a method for the production of glycolic acid in a fermentative process comprising the following steps:
• culturing a modified microorganism in an appropriate culture medium comprising a source of carbon,
• modulating in said microorganism the expression of a target gene with an external stimulus, and
• recovering glycolic acid from the culture medium,
wherein in said modified microorganism, the expression of at least one gene involved in glycolic acid production is under the control of a heterologous inducible promoter whose activity is modulated with said external stimulus.
The term "glycolic acid" or "gycolate" are used interchangeably and have the same meaning. They designate the molecule of formula HOCH2COOH, that is the simplest member of the alpha-hydroxy acid family of carboxylic acids. According to the invention, the terms "fermentative process', 'fermentation" or 'culture' are used interchangeably to denote the growth of bacteria on an appropriate growth medium.
The method for the production of glycolic acid in a fermentative process, is well known by the man skilled in the art. Different factors of the fermentative process can be modulated for the optimization of the process, such as the choice of the carbon source.
An "appropriate culture medium" is a medium appropriate for the culture and growth of the microorganism. Such media are well known in the art of fermentation of microorganisms, depending upon the microorganism to be cultured. The appropriate culture medium comprises a source of carbone. The term "source of carbon" refers to any carbon source capable of being metabolized by a microorganism wherein the substrate contains at least one carbon atom. The source of carbon is selected among the group consisting of glucose, sucrose, monosaccharides (such as fructose, mannose, xylose, arabinose), oligosaccharides (such as galactose, cellobiose ...), polysaccharides (such as cellulose), starch or its derivatives, glycerol and single-carbon substrates whereby glyoxylic acid is produced. An especially preferred carbon source is glucose. Another preferred carbon source is sucrose.
In a particular embodiment of the invention, the carbon source is derived from renewable feed-stock. Renewable feed-stock is defined as raw material required for certain industrial processes that can be regenerated within a brief delay and in sufficient amount to permit its transformation into the desired product.
The fermentation is generally conducted in fermenters with an appropriate culture medium adapted to the microorganism being used, containing at least one simple carbon source, and if necessary co-substrates for the production of metabolites (as described in patent application EP 09171297.6).
Those skilled in the art are able to define the culture conditions for the microorganisms according to the invention. In particular the bacteria are fermented at a temperature between 20°C and 55°C, preferentially between 25°C and 40°C, and more specifically about 30°C to 37°C for E. coli.
As an example of a known culture medium for E. coli, the culture medium can be of identical or similar composition to M9 medium (Anderson, 1946, Proc. Natl. Acad. Sci. USA 32: 120-128), M63 medium (Miller, 1992; A Short Course in Bacterial Genetics: A Laboratory Manual and Handbook for Escherichia coli and Related Bacteria, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York) or a medium such as defined by Schaefer et al. (1999, Anal. Biochem. 270: 88-96). The term "microorganism" designates a bacterium, yeast or fungus. The bacterium is selected among gram positive bacteria or gram negative bacteria. Preferentially, the microorganism is selected among gram negative bacteria such as Enterobacteriaceae, or among gram positive bacteria such as Bacillaceae, Streptomycetaceae and Corynebacteriaceae. More preferentially, the microorganism is a species of Escherichia, Klebsiella, Pantoea, Salmonella or Corynebacterium. Even more preferentially, the microorganism is either the species Escherichia coli or Corynebacterium glutamicum. The term "modified microorganism" designates a genetically modified microorganism presenting an improved glycolic acid production. "Improved glycolic acid production" means that the amount of glycolic acid produced by the microorganism, and particularly the glycolic acid yield (ratio of glycolic acid produced per carbon source), is higher in the modified microorganism compared to the corresponding unmodified microorganism.
The modified microorganism used in the method of the invention has two characteristics: it is modified for an improved glycolic acid production, and
- expression of at least one gene involved in glycolic acid production is under control, direct or indirect, of an inducible promoter.
The phrase "recovering glycolic acid from the culture medium" designates the action of recovering glycolic acid. Recovery of the glycolic acid is made by a step of concentration of glycolate in the bacteria or in the medium and isolation of glycolic acid from the fermentation broth and/or the biomass optionally remaining in portions or in the total amount (0-100%) in the end product from the fermentation culture. Optionally the process comprises a step of recovery of the glycolic acid produced in step (a) through a step of polymerization to at least glycolic acid dimers and (b) recovery of glycolic acid by depolymerisation from glycolic acid dimers, oligomers and/or polymers. According to a specific embodiment of the invention, the step of recovery comprises the recovering of derivatives and precursors of glycolic acid present in the culture medium.
The expression "modulating the expression of a target gene" means that the expression of a gene may be either allowed or repressed. This modulation may be achieved with an inducible promoter. Depending on the aim of this modulation, the man skilled in the art knows which kind of inducible system to use.
The term "inducible promoter" denotes a promoter whose activity can be increased or decreased upon an external stimulus. Stimuli can be physical or chemical in nature, such as temperature, light, chemicals etc.
Induction of the target gene can be obtained via direct or indirect transmission of the stimulus.
Indirect transmission can be accomplished by using heterologous RNA-polymerases that are under the control of an inducible promoter and that recognize specific promoters driving the expression of target genes involved in glycolic acid biosynthesis. In this case, the inducible promoter is not directly linked to the promoter of the target gene, but drives the expression of an R A polymerase transcribing said promoter of the target gene.
These heterologous RNA polymerases can be e.g. T3 RNA polymerase, T7 RNA polymerase or other polymerase known to the expert in the field.
Direct transmission is accomplished when the expression of one target gene is under the control of an inducible promoter.
The phrase "under the control of a heterologous inducible promoter" designates the fact that the inducible promoter is not the native promoter of the gene and was introduced in a way to control, at least partially, the level of expression of the gene that is operably linked to it. The activity of an inducible promoter is induced by the presence or absence of biotic or abiotic factors. Expression of genes can be turned on or off, according to the needs of the man skilled in the art. These promoters might be chemically-regulated (in presence of tetracycline, hormones, etc) or physically-regulated, especially by heat or light.
In a specific embodiment of the invention, the expression of at least one gene involved in glycolic acid production is under the direct control of an heterologous inducible promoter. This inducible promoter may be induced either by a physical stimulus or by a chemical stimulus.
In a first aspect of the invention, the external stimulus is chosen amon temperature or light, ie. the inducible promoter is a temperature-inducible promoter or a light-inducible promoter.
The inducible promoter is advantageously induced by temperature, and is selected among: - promoters regulated by a modified repressor of phage lambda,such as:
■ the promoter PR or a derivative of said promoterPR,
■ the promoter PL or a derivative of said promoter PL,
- a modified lac promoter regulated by a temperature sensitive Lac repressor
For these promoters, bibliographic references are the following :
• A genetic switch. Ptashne M. Blackwell Scientific, Cambridge, MA. 1986 ;
• A genetic switch: Phage lambda revisited. Ptashne M. Cold Spring Harbor Lab Press.
Cold Spring Harbor, NY. 2004;
· The bacteriophages, Part II: Life of phages, 8. Gene regulatory circuitry of phage λ.
Little J. 2nd edition 2004. Richard Calendared. Oxford University Press;
• Bukrinsky et al, Gene, 70 (1998) 415-417;
• Mandal & Lieb, 1976,
• Winstanley et al, 1989.
The repressor represses the expression from the cognate promoter by binding to specific binding sites in the promoter region thereby limiting the access of RNA polymerase to the promoter and reducing initiation or elongation of transcription. According to an aspect of the invention, the modified repressor of phage lambda is a temperature labile allele of the lambda repressor cl. Advantageously, said repressor is the lambda repressor allele cI857 (On a thermosensitive repression system in the Escherichia coli lambda bacteriophage. Sussman R, Jacob F. C. R. Hebd. Seances Acad. Sci. 1962, 254, pl517). Sussman et al. report a new mutant of the bacteriophage, being in the lysogenic state when cultivated at 32°C, but wherein its lyse is induced when the culture is maintained at a temperature of 40°C for one hour.
In a specific aspect of the invention, in the modified microorganism for the production of glycolic acid, the gene recA encoding the protein RecAhas been deleted. The protein RecA is known to act as a protease on cl. Therefore the deletion of the gene encoding RecA excludes proteolysis of the lambda repressor cl.
The temperature-inducible promoter might advantageously be chosen between the promoter PR or a derivative, and the promoter PL or a derivative.
In another embodiment, the temperature-inducible promoter is a modified lac promoter regulated by a temperature sensitive Lac repressor.
In a second aspect of the invention, the external stimulus is a chemical stimulus, ie. the inducible promoter is chemically-regulated. In particular, the induction of the promoter's activity is linked to changes in the repression of carbon catabolite. Promoters that are activated by carbon catabolite repression are positively regulated via the activator "cAMP Repressor Protein" (CRP) at low concentrations of glucose or in the absence of glucose.
In another embodiment of the invention, the inducible promoter is induced by the presence of specific carbon sources or of sugar alcohols. Examples of promoters that are induced by carbon sources or sugar alcohols include the arabinose or raffinose promoter and the mannitol promoter or glucitol promoters, respectively.
The principle of induction is based on the protein conformation. For a promoter activated by a specific stimulus (either physical or chemical stimuli), the cognate repressor is active under its native form. The presence of a specific stimulus induces a change of conformation of this repressor, which become unable to bind to the promoter and thus to activate gene transcription. Conversely for a promoter repressed by a specific stimulus, the cognate repressor is inactive under its native form and the presence of specific stimulus induces a change of its conformation which leads to an active form of the repressor which may repress gene transcription.
The man skilled in the art is able to choose an inducible promoter either activated or repressed by a physical or a chemical stimulus in accordance with the organism used , the culture conditions and the aim of modulation of the expression of a target gene.
According to a specific aspect of the invention, the expression of genes of interest ('target gene') is regulated via "indirect transmission", i.e at least one gene involved in glycolic acid production is transcribed by a heterologous RNA polymerase whose expression is under the control of an inducible promoter.
In a specific embodiment of the invention, the heterologous RNA polymerase is chosen from T7, T3 polymerase.
According to the invention, the 'target gene' is at least one gene involved in gly colic acid production or in the production of its precursors. The target gene is under the control, direct or indirect, of a heterologous inducible promoter; as previously explained, either the gene is under the direct control of an inducible promoter, or the gene is transcribed by an inducible RNA polymerase or both combinations.
Genes involved in gly colic acid production in a microorganism are known in the art, and comprise genes involved in the gly colic acid specific biosynthesis pathway as well as genes involved in precursor-providing pathways and genes involved in gly colic acid consuming pathways.
Efficient production of gly colic acid requires the optimization of the gly colic acid specific pathway and several precursor-providing pathways. Gly colic acid producing strains have been described in patent applications EP 2 027 227 and WO 2010/108909, that are incorporated as reference into this application.
In particular, said glycolic acid producing strains comprise at least one of the following modifications :
- Attenuation of the conversion of glyoxylate to products other than glycolate.
(attenuation of aceB, g/cB, gel, eda)
- unability to substantially metabolize glycolate (attenuation of g/cDEFG, aldA)
- increase of the glyoxylate pathway flux (attenuation of icd, aceK, pta, ackA, poxB, z'c/R or fadR, and/or overexpression of aceA)
- increase of the conversion of glyoxylate to glycolate (overexpression of ycdW)
increase of the availability of NADPH (attenuation of pgi, udhA, edd).
Said glycolic acid producing strains may comprise furthermore at least one of the following modifications :
attenuation of the genes IdhA and mgsA
attenuation of the gene arcA
attenuation of at least one of the genes glcA, UdP, and j^'cG. According to the present invention, to increase glycolic acid production in a strain already modified for glycolic acid production, at least one of the following genes involved in glycolic acid production may be under the control of an inducible promoter whose activity is modulated with an external stimulus: a) Genes encoding the enzymes involved in the crossroad of the TCA cycle and the glyoxylate shunt:
gene genelD function
icd bl 136 isocitrate dehydrogenase
aceA b4015 isocitrate lyase b) Genes encoding the enzyme directly involved in the glycolic acid biosynthesis:
ghrA/ycdW b 1033 NADPH-glyoxylate reductase c) Genes encoding enzymes directly or indirectly involved in the production of co factor NADPH and regulation of the redox state of the cell:
pntAB bl602 and b 1603 pyridine nucleotide transhydrogenase
udhA b3962 pyridine nucleotide transhydrogenase, soluble pgi b4025 glucose-6-phosphate isomerase
arcA b4401 aerobic respiration control protein d) Genes involved in anplerotic pathways:
maeA bl479 NAD-dependent malate dehydrogenase
maeB b2463 NADP-dependent malic enzyme
mdh b3236 Malate dehydrogenase
pck b3403 Phosphoenolpyruvate (PEP) carboxykinase ppc b3956 Phosphoenolpyruvate carboxylase e) Genes encoding enzymes involved in acetate metabolism:
ackA b2296 acetate kinase activity
pta b2297 Phosphate acetyltransferase
poxB b0871 Pyruvate oxidase
acs b4069 Acetyl-coenzyme A synthetase f) Genes encoding enzymes involved in the transport of glycolate through the membrane: dP b3603 probable lactate/proton symporter
glcA b2975 glycolate transporter
yjcG/actP b4067 acetate/glycolate permease g) Genes encoding enzymes involved in the production of the lactate as byproduct:
IdhA bl380 Lactate dehydrogenase
mgsA b0963 Methylglyoxal synthase
According to the invention, at least two genes of the preceding genes mentionned and any combination of these genes are under the control of inducible promoters to increase glycolic acid production.
In a preferred embodiment of the invention, the expression of the gene icd is under the control of a heterologous inducible promoter, directly or indirectly.
The enzyme isocitrate dehydrogenase belongs to the TCA cycle and catalyzes the transformation of isocitrate to cc-ketoglutarate. Since isocitrate is at the junction of the TCA cycle which leads to biomass and the glyoxylic shunt which leads to glycolic acid, its distribution in these pathways has a huge impact on the production of glycolic acid.
In a specific embodiment, the gene icd is under the control of an inducible promoter, which allowes expression of icd gene at 37°C to 42°C and represses expression of icd gene at 28°C to 32°C.
In a preferred embodiment of the invention, the modified microorganism is grown from 37°C to 42°C to produce biomass (conditions wherein icd is expressed) and from 28°C to 30°C to produce glycolic acid (conditions wherein icd is repressed).
In a specific embodiment of the invention, the step of recovery of the produced glycolic acid in the culture medium comprises the recovering of derivatives and precursors of glycolic acid present in the culture medium. "Derivatives or precursors" of glycolic acid designates all intermediate compounds in the metabolic pathway of formation and degradation of glycolic acid. Precursors of glycolic acid are in particular: citrate, isocitrate, glyoxylate, and in general all compounds of the glyoxylate cycle. Derivatives of glycolic acid are in particular glycolate esters such as ethyl glycolate ester, methyl glycolate ester and polymers containing glycolate such as polygly colic acid.
Genes controlled by the inducible promoter may either be at its native position on the chromosome or integrated at a non-native position. One or several integrations of the gene controlled by the inducible promoter may be required for optimal glycolic acid production. Similarly, one or several copies of the regulator gene may be required for optimal expression. Different ratios of repressor gene copies and promoters may be used to fine- tune expression.
The gene under the control of the inducible promoter should preferentially be integrated into loci, whose modification does not have a negative impact on glycolic acid production. Examples for loci into which the gene may be integrated are: Locus Accession Function
Number
aaaD 87081759 Pseudogene, phage terminase protein A homolog, N-terminal fragment aaaE 1787395 Pseudogene, phage terminase protein A homolog, C-terminal fragment afuB 1786458 Pseudogene, ferric ABC family transporter permease; C-terminal fragment afuC 87081709 predicted ferric ABC transporter subunit (ATP -binding component) agaA 48994927 Pseudogene, C-terminal fragment, GalNAc-6-P deacetylase
agaW 1789522 Pseudogene, N-terminal fragment, PTS system EIICGalNAc
alpA 1788977 protease
appY 1786776 DNA-binding transcriptional activator
argF 1786469 ornithine carbamoyltransferase
argU none arginine tRNA
argW none Arginine tRNA(CCU) 5
arpB 87081959 Pseudogene reconstruction, ankyrin repeats
arrD 1786768 lysozyme
arrQ 1787836 Phage lambda lysozyme R protein homolog
arsB 87082277 arsenite transporter
arsC 1789918 arsenate reductase
arsR 1789916 DNA-binding transcriptional repressor
beeE 1787397 Pseudogene, N-terminal fragment, portal protein
borD 1786770 bacteriophage lambda Bor protein homolog
cohE 1787391 Cl-like repressor
croE 87081841 Cro-like repressor
cspB 1787839 Cold shock protein
cspF 1787840 Cold shock protein homolog
cspl 1787834 Cold shock protein
cybC 1790684 Pseudogene, N-terminal fragment, cytochrome b562
dicA 1787853 Regulatory for dicB
dicB 1787857 Control of cell division
dicC 1787852 Regulatory for dicB
dicF none DicF antisense sRNA
eaeH 1786488 Pseudogene, intimin homolog
efeU 87081821 Pseudogene reconstruction, ferrous iron permease
emrE 1786755 multidrug resistance pump
essD 1786767 predicted phage lysis protein
essQ 87081934 Phage lambda S lysis protein homolog exoD 1786750 Pseudogene, C-terminal exonuclease fragment eyeA none novel sRNA, unknown function
Flu 48994897 Antigen 43
flxA 1787849 unknown
gapC 87081902 Pseudogene reconstruction, GAP dehydrogenase gatR 87082039 Pseudogene reconstruction, repressor for gat operon glvC 1790116 Pseudogene reconstruction
glvG 1790115 Pseudogene reconstruction, 6-phospho-beta-glucosidase gnsB 87081932 Multicopy suppressor of secG(Cs) and fabA6(Ts) gtrA 1788691 Bactoprenol-linked glucose translocase
gtrB 1788692 Bactoprenol glucosyl transferase
gtrS 1788693 glucosyl transferase
hokD 1787845 Small toxic membrane polypeptide
led 1787381 Isocitrate dehydrogenase
icdC 87081844 pseudogene
ilvG 87082328 Pseudogene reconstruction, acetohydroxy acid synthase II insA 1786204 IS 1 gene, transposition function
insA 1786204 IS 1 gene, transposition function
insB 1786203 IS 1 insertion sequence transposase
insB 1786203 IS 1 insertion sequence transposase
insC 1786557 IS2 gene, transposition function
insD 1786558 IS2 gene, transposition function
insD 1786558 IS2 gene, transposition function
insE 1786489 IS3 gene, transposition function
insF 1786490 IS3 gene, transposition function
insH 1786453 IS5 gene, transposition function
insH 1786453 IS5 gene, transposition function
insH 1786453 IS5 gene, transposition function
insl 1786450 IS30 gene, transposition function
insl(-l) 1786450 IS30 gene, transposition function
insM 87082409 Pseudogene, truncated IS600 transposase
insN 1786449 Pseudogene reconstruction, IS911 transposase ORFAB insO none Pseudogene reconstruction, IS911 transposase ORFAB insX 87081710 Pseudogene, IS3 family transposase, N-terminal fragment insZ 1787491 Pseudogene reconstruction, IS4 transposase family, in ISZ' intA 1788974 Integrase gene
intB 1790722 Pseudogene reconstruction, P4-like integrase intD 1786748 predicted integrase
intE 1787386 el 4 integrase
intF 2367104 predicted phage integrase
intG 1788246 Pseudogene, integrase homolog
intK 1787850 Pseudogene, integrase fragment
intQ 1787861 Pseudogene, integrase fragment
intR 1787607 Integrase gene
intS 1788690 Integrase
intZ 1788783 Putative integrase gene
isrC none Novel sRNA, function unknown
jayE 87081842 Pseudogene, C-terminal fragment, baseplate
kilR 87081884 Killing function of the Rac prophage
lafU none Pseudogene, lateral flagellar motor protein fragment
IjhA 87081703 Pseudogene, lateral flagellar assembly protein fragment
lit 1787385 Cell death peptidase
Pseudogene reconstruction, lom homolog; outer membrane protein lomR 1787632 interrupted by IS5Y, missing N-terminus
malS 1789995 a-amylase
mcrA 1787406 5-methylcytosine-specific DNA binding protein
mdtQ 87082057 Pseudogene reconstruction, lipoprotein drug pump OMF family
melB 1790561 melibiose permease
mmuM 1786456 homocysteine methyltransferase
mmuP 870811708 S-methylglycolic acid permease
mokA none Pseudogene, overlapping regulatory peptide, enables hokB
ninE 1786760 unknown
nmpC 1786765 Pseudogene reconstruction, OM porin, interrupted by IS5B
nohD 1786773 DNA packaging protein
Pseudogene, phage lambda Nul homolog, terminase small subunit family, nohQ 1787830 putative DNA packaging protein
ogrK 1788398 Positive regulator of P2 growth
ompT 1786777 outer membrane protease VII
oweE none Pseudogene, lambda replication protein O homolog
oweS 1788700 Pseudogene, lambda replication protein O homolog
pauD none argU pseudogene, DLP12 prophage attachment site
pawZ none CPS-53 prophage attachment site attR, argW pseudogene
pbl 87082169 Pseudogene reconstruction, pilT homolog
peaD 87081754 Pseudogene, phage lambda replication protein P family; C-terminal fragment perR 1786448 predicted DNA-binding transcriptional regulator outer membrane porin of poly-P-l,6-N-acetyl-D-glucosamine (PGA) pgaA 1787261 biosynthesis pathway
pgaB 1787260 PGA N-deacetylase
pgaC 1787259 UDP-N-acetyl-D-glucosamine β- 1 ,6-N-acetyl-D-glucosaminyl transferase pgaD 1787258 predicted inner membrane protein
phnE 87082370 Pseudogene reconstruction, phosphonate permease
pinE 1787404 DNA invertase
pinH 1789002 Pseudogene, DNA invertase, site-specific recombination
pinQ 1787827 DNA invertase
pinR 1787638 DNA invertase
prfli 1786431 Pseudogene, protein release factor homolog
psaA none ssrA pseudogene, CP4-57 attachment site duplication
ptwF none thrW pseudogene, CP4-6 prophage attachment site
quuD 1786763 predicted antitermination protein
quuQ 87081935 Lambda Q antitermination protein homolog
racC 1787614 unknown
racR 1787619 Rac prophage repressor, cl-like
ralR 1787610 Restriction alleviation gene
rbsA 1790190 D-ribose ABC transporter subunit (ATP -binding component) rbsD 87082327 D-ribose pyranase
recE 1787612 RecET recombinase
red 1787611 RecET recombinase
relB 1787847 Antitoxin for RelE
relE 1787846 Sequence-specific mRNA endoribonuclease
Rem 1787844 unknown
Pseudogene reconstruction, lambda ren homolog, interrupted by IS3C; renD 87081755 putative activator of lit transcription
rhsE 1787728 Pseudogene, rhs family, encoded within RhsE repeat
ml A 1788983 RNase LS, endoribonuclease
Rph 1790074 Pseudogene reconstruction, RNase PH
rusA 1786762 Endonuclease
rzoD 87081757 Probable Rzl-like lipoprotein
rzoQ none Probable Rzl-like lipoprotein
rzoR 87081890 Probable Rzl-like lipoprotein
rzpD 1786769 predicted murein endopeptidase
rzpQ 1787835 Rz-like equivalent
rzpR 87081889 Pseudogene, Rz homolog
sieB 87081885 Superinfection exclusion protein sokA none Pseudogene, antisense sRNA blocking mokA/hokA translation
C-terminal Stf variable cassette, alternate virion-host specificity protein; Tail stfE 87081843 Collar domain, pseudogene
stfP 1787400 Predicted tail fiber protein
stfR 87081892 Side-tail fiber protein
tfaD 87081759 Pseudogene, tail fiber assembly gene, C-terminal fragment
tfaE 1787402 Predicted tail fiber assembly gene
tfaP 1787401 Predicted tail fiber assembly gene
tfaQ 2367120 Phage lambda tail fiber assembly gene homolog
tfaR 1787637 Phage lambda tail fiber assembly gene homolog
tfaS 87082088 Pseudogene, tail fiber assembly gene, C-terminal fragment
tfaX 2367110 Pseudogene reconstruction, tail fiber assembly gene, C-terminal fragment thrW none threonine tRNA (attachment site of the CP4-6 prophage)
tori 87082092 CPS-53/KpLEl exisionase
treB 2367362 subunit of trehalose PTS permease (IIB/IIC domains)
treC 1790687 trehalose-6-phosphate hydrolase
trkG 1787626 Major constitutive K+ uptake permease
ttcA 1787607 Integrase gene
ttcC none Pseudogene, prophage Rac integration site ttcA duplication
uidB 1787902 Glucuronide permease, inactive point mutant
uxaA 1789475 altronate hydrolase
uxaC 2367192 uronate isomerase
wbbL 1788343 Pseudogene reconstruction, rhamnosyl transferase
wcaM 1788356 predicted colanic acid biosynthesis protein
xisD none Pseudogene, exisionase fragment in defective prophage DLP12
xisE 1787387 el 4 excisionase
yabP 1786242 Pseudogene reconstruction
afF 87081701 Pseudogene, C-terminal fragment, H repeat-associated protein
yafu 1786411 Pseudogene, C-terminal fragment
yajW 1786440 antitoxin of the Ykfl-YafW toxin-antitoxin system
y jx 1786442 unknown
yafY 1786445 predicted DNA-binding transcriptional regulator; inner membrane lipoprotein yaft 87081705 unknown
yagA 1786462 predicted DNA-binding transcriptional regulator
yagB 87081711 Pseudogene, antitoxin-related, N-terminal fragment
yagE 1786463 predicted lyase/synthase
yagF 1786464 predicted dehydratase yagG 1786466 putative sugar symporter
yagH 1786467 putative β-xylosidase
yagi 1786468 predicted DNA-binding transcriptional regulator yagJ 1786472 unknown
yagK 1786473 unknown
yagL 1786474 DNA-binding protein
yagM 2367101 unknown
yagN 2367102 unknown
yagP 1786476 Pseudogene, LysR family, fragment
yaiT 1786569 Pseudogene reconstruction, autotransporter family yaiX 87082443 Pseudogene reconstruction, interrupted by IS2A ybbD 1786709 Pseudogene reconstruction, novel conserved family ybcK 1786756 predicted recombinase
ybcL 1786757 predicted kinase inhibitor
ybcM 1786758 predicted DNA-binding transcriptional regulator ybcN 1786759 DNA base- flipping protein
ybcO 1786761 unknown
ybcV 87081758 unknown
ybcW 1786772 unknown
ybcY 48994878 Pseudogene reconstruction, methyltransferase family ybeM 1786843 Pseudogene reconstruction, putative CN hydrolase ybfG 87081771 Pseudogene reconstruction, novel conserved family ybfl none Pseudogene reconstruction, KdpE homolog ybfL 87081775 Pseudogene reconstruction, H repeat-associated protein ybfo 1786921 Pseudogene, copy of Rhs core with unique extension ycgH 87081847 Pseudogene reconstruction
ycgi 1787421 Pseudogene reconstruction, autotransporter homolog ycjv 1787577 Pseudogene reconstruction, malK paralog
ydaC 1787609 unknown
ydaE 87081883 Metallothionein
ydaF 87081886 unknown
ydaG 87081887 unknown
ydaQ 87081882 Putative exisionase
ydaS 1787620 unknown
ydaT 1787621 unknown
ydaU 1787622 unknown
ydaV 1787623 unknown ydaW 87081888 Pseudogene, N-terminal fragment
ydaY 1787629 pseudogene
ydbA 87081898 Pseudogene reconstruction, autotransporter homolog yddK 1787745 Pseudogene, C-terminal fragment, leucine-rich
yddL 1787746 Pseudogene, OmpCFN porin family, N-terminal fragment ydeT 1787782 Pseudogene, FimD family, C-terminal fragment
ydfA 1787854 unknown
ydfB 87081937 unknown
ydfC 1787856 unknown
ydfD 1787858 unknown
ydfi 1787859 Pseudogene, N-terminal fragment
ydfJ 1787824 Pseudogene reconstruction, MFS family
ydfl 1787826 Cold shock gene
ydfO 87081931 unknown
ydfR 1787837 unknown
ydfU 87081936 unknown
ydfv 1787848 unknown
ydjX 1787851 pseudogene
yedN 87082002 Pseudogene reconstruction, IpaH/YopM family
yedS 87082009 Pseudogene reconstruction, outer membrane protein homolog yeeH none Pseudogene, internal fragment
yeeL 87082016 Pseudogene reconstruction, glycosyltransferase family yeeP 87082019 Pseudogene, putative GTP -binding protein
yeeR 87082020 unknown
yeeS 1788312 unknown
yeeT 1788313 unknown
yeeU 1788314 Antitoxin component of toxin-antitoxin protein pair YeeV- YeeU yeeV 1788315 Toxin component of toxin-antitoxin protein pair YeeV- YeeU yeeW 1788316 pseudogene
yegz none Pseudogene, gpD phage P2-like protein D; C-terminal fragment yehH 87082046 Pseudogene reconstruction
yehQ 87082050 Pseudogene reconstruction
yejo 1788516 Pseudogene reconstruction, autotransporter homolog yfaH 1788571 Pseudogene reconstruction, C-terminal fragment, LysR homolog yfaS 87082066 Pseudogene reconstruction
yfcu 1788678 Pseudogene reconstruction, FimD family
yfdK 1788696 unknown yfdL 1788697 Pseudogene, tail fiber protein
yfdM 87082089 Pseudogene, intact gene encodes a predicted DNA adenine methyltransferase yfdN 1788699 unknown
yfdP 1788701 unknown
yfdQ 1788702 unknown
yfdR 87082090 unknown
yfdS 1788704 unknown
yfdT 1788705 unknown
yffL 1788784 unknown
yffM 1788785 unknown
yffN 1788786 unknown
yffo 1788787 unknown
yf/P 1788788 unknown
yffQ 1788790 unknown
yffR 1788791 unknown
ffs 1788792 unknown
yfjH 1788976 unknown
yffl 1788978 unknown
yfjJ 1788979 unknown
yfjK 1788980 unknown
yfjL 1788981 unknown
yfjM 1788982 unknown
yfjo 87082140 unknown
yfjP 48994902 unknown
yJ Q 1788987 unknown
yfjR 1788988 unknown
yfjs 87082142 unknown
yfjT 1788990 unknown
yfju 1788991 pseudogene
yfjv 1788992 Pseudogene reconstruction, arsB-like C-terminal fragment
yjjw 2367146 unknown
yfjx 1788996 unknown
yfjY 1788997 unknown
yfjz 1788998 Antitoxin component of putative toxin-antitoxin YpjF-YfiZ
ygaQ 1789007 Pseudogene reconstruction, has alpha-amylase-related domain
ygaY 1789035 Pseudogene reconstruction, MFS family
ygeF 2367169 Pseudogene reconstruction, part of T3SS PAI ETT2 remnant ygeK 87082170 Pseudogene reconstruction, part of T3SS PAI ETT2 remnant
ygeN 1789221 Pseudogene reconstruction, orgB homolog
ygeO 1789223 Pseudogene, orgA homolog, part of T3SS PAI ETT2 remnant ygeQ 1789226 Pseudogene reconstruction, part of T3SS PAI ETT2 remnant
yghE 1789340 Pseudogene reconstruction, general secretion protein family
yghF 1789341 Pseudogene, general secretion protein
yghO 1789354 Pseudogene, C-terminal fragment
yghx 1789373 Pseudogene reconstruction, S9 peptidase family
yhcE 1789611 Pseudogene reconstruction, interrupted by IS5R
yhdW 1789668 Pseudogene reconstruction
yhiL 87082275 Pseudogene reconstruction, FliA regulated
yhiS 1789920 Pseudogene reconstruction, interrupted by IS5T
y jQ 1789955 Pseudogene reconstruction
yibJ 48994952 Pseudogene reconstruction, Rhs family
yibS none Pseudogene reconstruction, Rhs family, C-terminal fragment
yibU none Pseudogene reconstruction, H repeat-associated protein
yibW none Pseudogene reconstruction, rhsA-linked
yicT none Pseudogene, N-terminal fragment
yifN 2367279 Pseudogene reconstruction
yjbi 1790471 Pseudogene reconstruction
yjdQ none Pseudogene reconstruction, P4-like integrase remnant
yjgx 1790726 Pseudogene reconstruction, EptAB family
yj D 87082406 Pseudogene, C-terminal fragment
yjhE 87082407 Pseudogene, putative transporter remnant
yj R 1790762 Pseudogene reconstruction, helicase family, C-terminal fragment yjhv 1790738 Pseudogene, C-terminal fragment
yj Y none Pseudogene reconstruction, novel zinc finger family
yjhz none Pseudogene reconstruction, rimK paralog, C-terminal fragment yjiP 1790795 Pseudogene reconstruction, transposase family
yjiT 87082428 Pseudogene, N-terminal fragment
yjiv none Pseudogene reconstruction, helicase-like, C-terminal fragment yjjN 87082432 predicted oxidoreductase
y¥* 87081706 putative GTP -binding protein
ykfB 1786444 unknown
yVC 87081707 Pseudogene, retron-type reverse transcriptase family, N-terminal fragment yW 1786443 unknown
yVG 2367100 unknown ym 87081704 unknown
ykfl 1786439 toxin of the Ykfl-YafW toxin-antitoxin system
yVJ 1786430 Pseudogene, N-terminal fragment
ykfK 1786445 Pseudogene, N-terminal fragment
y¥L none Pseudogene, C-terminal fragment
yW none Pseudogene, N-terminal remnant, YdiA family
ykgA 87081714 Pseudogene, N-terminal fragment, AraC family
ykgP none Pseudogene, oxidoreductase fragment
ykgQ none Pseudogene, C-terminal fragment of a putative dehydrogenase ykgS none Pseudogene internal fragment
ykiA 1786591 Pseudogene reconstruction, C-terminal fragment
ylbE 1786730 Pseudogene reconstruction, yahG paralog
ylbG 87081748 Pseudogene reconstruction, discontinuous N-terminal fragment ylbH 1786708 Pseudogene, copy of Rhs core with unique extension ylbl none Pseudogene, internal fragment, Rhs family
ylcG 87081756 unknown
ylcH none unknown
ylcl none unknown
ymdE 87081823 Pseudogene, C-terminal fragment
ymfD 1787383 Putative SAM-dependent methyltransferase
ymfi 1787384 unknown
ymfl 87081839 unknown
ymfJ 87081840 unknown
ymfL 1787393 unknown
ymfM 1787394 unknown
ymfQ 1787399 Putative baseplate or tail fiber proteintt
ymfR 1787396 unknown
ymjC none Pseudogene, N-terminal fragment
ymjD none Expressed deletion pseudogene fusion remnant protein ynaA 1787631 Pseudogene, N-terminal fragment
ynaE 1787639 Cold shock gene
ynaK 1787628 unknown
yncl 1787731 Pseudogene reconstruction, H repeat-associated, RhsE-linked yncK none Pseudogene reconstruction, transposase homolog
yneL 1787784 Pseudogene reconstruction, C-terminal fragment, AraC family yneO 1787788 Pseudogene reconstruction, putative OM autotransporter adhesi ynfN 87081933 Cold shock gene ynfo none unknown
yoeA 87082018 Pseudogene reconstruction, interrupted by IS2F
yoeD none Pseudogene, C-terminal fragment of a putative transposase
yoeF 87082021 Pseudogene, C-terminal fragment
yoeG none pseudogene, N-terminal fragment
yoeH none pseudogene, C-terminal fragment
ypdJ 87082091 Pseudogene, exisonase fragment
ypjc 1789003 Pseudogene reconstruction
ypjF 1788999 Toxin component of putative toxin-antitoxin pair YpjF-YfjZ
ypji none Pseudogene reconstruction
ypjJ 87082144 unknown
ypjK 87082141 unknown
1789281 Pseudogene reconstruction, C-terminal fragment, LysR family
yqiG 48994919 Pseudogene reconstruction, FimD family, interrupted by IS2I
yrdE none Pseudogene reconstruction, C-terminal fragment, yedZ paralog
yrdF none Pseudogene, N-terminal fragment
yrhA 87082266 Pseudogene reconstruction, interrupted by IS IE
yrhC 87082273 Pseudogene reconstruction, N-terminal fragment
ysaC none Pseudogene, C-terminal remnant
ysaD none Pseudogene, internal sequence remnant
ytfA 1790650 Pseudogene, C-terminal fragment
yzgL 87082264 Pseudogene, putative periplasmic solute binding protein
The invention is also related to a microorganism modified for an improved production of glycolic acid wherein the expression of at least one gene involved in gly colic acid production is under the control, direct or indirect, of a heterologous inducible promoter as defined above.
Several modifications were previously introduced into said microorganism, and in particular modifications allowing the following metabolic changes:
i) the microorganism cannot metabolize glyoxylate to other compounds than glycolate, by inactivating the genes coding for the malate synthases (ace and g/cB), the glyoxylate carboligase (gel) and the 2-keto-3-deoxygluconate 6- phosphate aldolase (eda),
ii) the microorganism cannot metabolize glycolate, by attenuating genes glcDEF and aldA,
iii) the glyoxylate pathway flux is increased by attenuation of icd, acek, pta, ack, poxB, iclR or fadR and/or by overexpression of aceA, iv) the conversion of glyoxylate to glycolate is increased by overexpressing endogenous encoding genes like ycdW,
v) the availability of NADPH is increased by attenuating the expression of genes pgiudhA and edd.
Modifications were described in patent applications EP 2 027 227 and WO 2010/108909, hereby incorporated by reference.
In the description of the present invention, genes and proteins are identified using the denominations of the corresponding genes in E. coli. However, and unless specified otherwise, use of these denominations has a more general meaning according to the invention and covers all the corresponding genes and proteins in other organisms, more particularly microorganisms.
Using the references given in GenBank for known genes, those skilled in the art are able to determine the equivalent genes in other organisms, bacterial strains, yeasts, fungi, mammals, plants, etc. This routine work is advantageously done using consensus sequences that can be determined by carrying out sequence alignments with genes derived from other microorganisms, and designing degenerate probes to clone the corresponding gene in another organism. These routine methods of molecular biology are well known to those skilled in the art, and are claimed, for example, in Sambrook et al. (1989 Molecular Cloning: a Laboratory Manual. 2nd ed. Cold Spring Harbor Lab., Cold Spring Harbor, New York.)
PFAM (protein families database of alignments and hidden Markov models; http://www.sanger.ac.uk/Software/Pfam/) represents a large collection of protein sequence alignments. Each PFAM makes it possible to visualize multiple alignments, see protein domains, evaluate distribution among organisms, gain access to other databases, and visualize known protein structures.
COGs (clusters of orthologous groups of proteins; http ://www.ncbi.nlm.nih. ov/COG/ are obtained by comparing protein sequences from fully sequenced genomes representing major phylogenic lines. Each COG is defined from at least three lines, which permits the identification of former conserved domains.
The means of identifying homologous sequences and their percentage homologies are well known to those skilled in the art, and include in particular the BLAST programs, which can be used from the website http://www.ncbi.nlm.nih.gov/BLAST/ with the default parameters indicated on that website. The sequences obtained can then be exploited (e.g., aligned) using, for example, the programs CLUSTALW (http://www.ebi.ac.uk/clustalw/) or MULTALIN (http://bioinfo.genotoul.fr/multalin/multalin.html), with the default parameters indicated on those websites. In a specific aspect of the invention the microorganism previously genetically modified to produce glycolic acid contains at least one gene, which expression is under control of a heterologous inducible promoter, selected among icd, ace A, ycdW, pgi, pntAB, udhA,arcA, maeA, maeB, mdh, pck, ppc, ackA, pta, poxB, UdP, glcA, yjcG, IdhA and mgsA. More preferably the gene under control of a heterologous inducible promoter is icd.
In a preferred aspect of the invention, in the modified microorganism, the use of the inducible promoter allows expression of the icd gene at 37°C to 42°C and represses expression of the icd gene at 28°C to 32°C. In another embodiment of the invention, the microorganism presents a glycolic acid production of at least 50% of the initial production after 30 generations, preferentially of at least 70% of the initial production after 30 generations, most preferably 90% of the initial production after 30 generations.
Said microorganism presents a much more stable production of glycolic acid during a fermentation culture for several generations at an industrial scale.
The man skilled in the art is able to determine the number of generations for a specific microorganism in a fermentation process. A population of bacteria double every generation. To determine the number of cell in a culture, the man skilled in the art uses for E.coli the following formula; 0.4 OD unit = 2.10s cells/mL (OD unit means Optical Density unit or Absorbance).
EXAMPLES
Generic protocols used to build the strains producing glycolic acid described in the following examples.
Protocol 1: Introduction of a PCR product for recombination and selection of the recombinants (FRT system)
The oligonucleotides chosen and given in Table 1 for replacement of a gene or an intergenic region were used to amplify either the chloramphenicol resistance cassette from the plasmid pKD3 or the kanamycin resistance cassette from the plasmid pKD4 (Datsenko, K.A. & Wanner, B.L. (2000)). The PCR product obtained was then introduced by electroporation into the recipient strain bearing the plasmid pKD46 in which the system λ Red (γ, β,.εχο) expressed greatly favours homologous recombination. The antibiotic- resistant trans formants were then selected and the insertion of the resistance cassette was checked by PCR analysis with the appropriate oligonucleotides given in Table 2. Protocol 2: Transduction with phage PI for deletion of a gene
The DNA transfert from one E. coli strain to the another was performed by the technique of transduction with phage PI . The protocol was in two steps, (i) the preparation of the phage lysate on the donor strain with a single gene modified and (ii) the transduction of the recipient strain by this phage lysate.
Preparation of the phage lysate
Seeding with 100 μΐ of an overnight culture of the strain MG1655 with a single gene modified of 10 ml of LB + Cm 30
Figure imgf000025_0001
I Km 50μg/ml + glucose 0.2% + CaCl2 5 mM.
- Incubation for 30 min at 37°C with shaking.
Addition of 100 μΐ of phage lysate PI prepared on the donor strain MG1655 (approx.
1 x 109 phage/ml).
Shaking at 37°C for 3 hours until all cells were lysed.
Addition of 200 μΐ of chloroform, and vortexing.
- Centrifugation for 10 min at 4500 to eliminate cell debris.
Transfer of supernatant in a sterile tube and addition of 200 μΐ of chloroform.
- Storage of the lysate at 4°C
Transduction
Centrifugation for 10 min at 1500 g of 5 ml of an overnight culture of the
E. coli recipient strain in LB medium.
- Suspension of the cell pellet in 2.5 ml of MgS04 10 mM, CaCl2 5 mM.
Control tubes: 100 μΐ cells
100 μΐ phages PI of the strain MG1655 with a single gene modified. Tube test: 100 μΐ of cells + 100 μΐ phages PI of strain MG1655 with a single gene modified.
Incubation for 30 min at 30°C without shaking.
Addition of 100 μΐ sodium citrate 1 M in each tube, and vortexing.
- Addition of 1 ml of LB.
Incubation for 1 hour at 37°C with shaking
- Plating on dishes LB + Cm 30 μg/ml / Km 50μg/ml after centrifugation of tubes for 3 min at 7000 rpm.
Incubation at 37°C overnight.
The antibiotic-resistant transformants were then selected and the insertion of the deletion was checked by a PCR analysis with the appropriate oligonucleotides given in Table 2.
Protocol 3: Introduction of a PCR product for recombination and selection of the recombinants (Cre-LOX system)
The oligonucleotides chosen and given in Table 1 for replacement of a gene or an intergenic region were used to amplify either the chloramphenicol resistance cassette from the plasmid loxP-cm-loxP (Gene Bridges) or the neomycin resistance cassette from the plasmid loxP-PGK-gb2-neo-loxP (Gene Bridges). The PCR product obtained was then introduced by electroporation into the recipient strain bearing the plasmid pKD46 in which the system λ Red (γ, β,.εχο) expressed greatly favours homologous recombination. The antibiotic-resistant transformants were then selected and the insertion of the resistance cassette was checked by PCR analysis with the appropriate oligonucleotides given in Table 2.
Figure imgf000026_0001
Table 1 : Oligonucleotides used for the constructions described in the following examples
Figure imgf000027_0001
Table 2: Oligonucleotides used for checking the insertion of a resistance cassette or the loss of a resistance cassette EXAMPLE 1
Construction of a thermo inducible strain to produce glycolic acid by fermentation: MG1655 Ptrc50/RBSB/TTG-ic</:: M AuxaCA::KN/TTadcca-cI857-VR/KBS01*2-icd- TT02::Km AaceB Agcl AglcOEFGB AaldA AiclR Aedd+eda ApoxB AackA+pia (pME101-jCi W-TT07-PflceA-flceA-TT01)
The strain E.coli MG1655
Figure imgf000027_0002
AaceB Agcl AglcOEFGB AaldA AiclR Aedd+eda ApoxB AackA+pta (pME101-jc W-TT07-PaceA-aceA-TT01) was built according to the description given in patent application WO 2010/108909.
1. Construction of the strain MG1655 AifjceCA::RN/TTe</cce-cI857-PR RBS01*2-ic</- TT02::Km
To replace the uxaCA region by the TTa cca-cI857-PR/RBS01 *2-zc -TT02 fragment, we used the homologous recombination strategy described by Datsenko & Wanner (2000) and detailed in Protocol 1. This strategy allows the insertion of a kanamycin resistance cassette and additional DNA, while deleting most of the region concerned.
The plasmid pUC18-DMxaCA-RN/TTa cca-cI857-PR/RBS01 !i:2-zc -TT02 was built for this purpose as detailed below.
The fragment TTa cca-cI857-PR/RBS01 *2-zc -TT02 was synthesized by PCR and cloned into the vector pUC18-DwxaCA-SMC-Km (SMC for Multiple Cloning Site).
- To build the plasmid pUC18-D«xaCA-SMC-Km, the DwxaCA-SMC-Km fragment was obtained by PCR on the MG1655 DwxaCA-SMC-Km genomic DNA as template and cloned into pUC18 (Norrander et al, 1983, Gene 26,101-106). - Construction of the strain MG1655 DwxaCA-SMC-Km:
To replace the uxaCA region by the SMC-Km one, we used the homologous recombination technique and a PCR product synthesized with oligonucleotides Ome 1506- D uxaCA-SMC F and Ome 1507-D uxaCA-SMC R given in table 1 (Seq. N°l and N°2).
Ome 1506-D uxaCA-SMC F (SEQ ID NO 1)
GCAA GCTA GCTCA CTCGTTGA GA GGAA GA CGAAAA TGA CTCCGTTTA TGA CTGAA GA TTTCCTGTTAGATACCGTCACACTGGCTCACCTTCGGGTGGGCCmCTGCTGTA GGCTGGAGCTGCTTCG
with
- a region (italic upper case) homologous to the sequence (3242797 - 3242724) of the region uxaCA (reference sequence on the website http://ecogene.org/),
- a region (underlined upper case) for T7Te transcriptional terminator sequence from T7 phage (Harrington K.J., Laughlin R.B. and Liang S. Proc Natl Acad Sci U S A. 2001 Apr 24;98(9):5019-24.),
- a region (upper case) for the amplification of the kanamycin resistance cassette (reference sequence in Datsenko, K.A. & Wanner, B.L., 2000, PNAS, 97: 6640-6645),
Ome 1507-D uxaCA-SMC R (SEQ ID NO 2)
TTAA CAA CTCA TTTCGA CTTTA TA GCGTTA CGCCGCTTTTGAA GA TCGCCGAATTCG AGCTCGGTACCCGGGGATCCATCTCGAGATCCGCGGATGTATACATGGGCCCC ATATGAATATCCTCCTTAG
with
- a region (italic upper case) homologous to the sequence (3239830 - 3239879) of the region uxaCA (reference sequence on the website http://ecogene.org/),
- a region (underlined upper case) for the SMC habouring with Apal, BstZl Ά, Sacll, Xhol, Aval, ΒατηΆΙ, Smal, Kpnl, Sacl, EcoRI restriction sites
- a region (upper case) for the amplification of the kanamycin resistance cassette (reference sequence in Datsenko, K.A. & Wanner, B.L., 2000, PNAS, 97: 6640-6645),
The resulting PCR product was introduced by electroporation into the strain MG1655 (pKD46). Then, the kanamycin-resistant transformants were selected, and the insertion of the antibiotic cassette was checked by PCR analysis with the oligonucleotides Ome 1612- uxaCA_R3 and Ome 1774-DuxaCA_F showed in Table 2 (Seq. N°15 and N°16). The selected clones were validated by DNA sequencing. The final strain was named MG1655 DttxaCA-SMC-Km. - Construction of the plasmid pUC18-D«xaC A-SMC-Km:
The DwxaCA-SMC-Km region was amplified by PCR from genomic DNA of the strain MG1655 DwxaCA-SMC-Km as template and oligonucleotides Ome 1515-uxaCA R2 and Ome 1516-uxaCA F2 showed in Table 1 (Seq. N°3 and N°4) :
Ome 1515-uxaCA R2 (SEQ ID NO 3)
CCCACTGGCCTGTAATATGTTCGG
homologous to the downstream region of uxaCA (from 3239021 to 3239044) Ome 1516-uxaCA F2 (SEQ ID NO 4)
ATGCGATATCG^ CCGTA TAA GCA GCA GAA TA GGC
with
- a region (upper case) with extra-bases
- a region (underlined upper case) harbouring the EcoRV restriction site
- a region (italic upper case) homologous to the upstream region of uxaCA (from 3243425 to 3243402)
Then, the PCR product (obtained with a blunt-end DNA polymerase) was cleaved by the restriction enzyme EcoRV and cloned into the Smal site of pUC18. The resulting plasmid was checked by sequencing and named pUC 18-DwxaC A-SMC-Km.
- For the construction of the plasmid pUC18-TTa cca-c/S57-PR/RBS01 !i:2-z'c -TT02, the fragment TTadcca-cI857-PR/RBS01 *2-z'c<i-TT02 was synthetized by PCR and cloned into the plasmid pUC18-DwxaC A-SMC-Km described above.
In a first step, the TTa<icca-c/S57-PR/RBS01 *2 region was amplified by PCR from the pFCl vector as template (Mermet-Bouvier & Chauvat, 1994, Current Microbiology, vol. 28, pp 145-148) and oligonucleotides TTadcca-cI857-icd F and PR/RBS01 *2-ic< -TT02 R listed in Table 1 (Seq. N°5 and N°6). In a second step, the fragment z'c<i-TT02 was amplified by PCR from the MG1655 genomic DNA using the oligonucleotides PR/RBS01 *2-zcd-TT02 F and TT02-zc R (Seq. N°7 and N°8). In a third step, the TTa<icca-c/S57-PR/RBS01 *2-z'c<i-TT02 region was synthesized by PCR using a mix of TTadcca-c/S57-PR/RBS01 *2 and z'c -TT02 PCR products as template and the oligonucleotides T\adcca-cl857-icd F and TT02-z'c<i R (Seq. N°5 and N°8). This final PCR product was cloned into the pSCB vector (Stratagene) and the resulting plasmid was verified by sequencing and named pSCB-TTa<icca-c/S57-PR/RBS01 !i:2-zc(i-TT02.
TTadcca-cI857-icd F (SEQ ID NO 5)
GCCTACAGGGCCCGTATACr^4A 4 TAA GAGTTA CCTTAAA TGGTAACTCTTA TTTT TTTTA TC AGC C AAAC GTC TC TTC AGGC C AC TG AC T AGC G AT AAC TTTCCCCA C with
- a region (upper case) with extra-bases,
- a region (underlined upper case) harbouring the Apal and BstZlll restriction sites,
- a region (italic upper case) for TTadcca transcriptional terminator sequence (transcription terminator of the adc gene from Clostridium acetobutylicum, homologous from 179847 to 179807 of the pSOLl megaplasmid),
- a region (upper bold case) homologous to the 3' extremity of the cI857 gene
PR/RBS01 *2-icd-TT02 R (SEQ ID NO 6)
GCCTTGTGCCGGAACAACTACTTTACTTTCCATr7¾7¾ACCTCCTTAGTACATGC AACCATTATCACCGCCAGAGGTAAAATAGTCAACACGC
with
- a region (upper case) homologous to the 5' extremity of the icd gene (from 1194378 to 1194346)
- a region (underlined upper case) homologous to the lambda bacteriophage PR promoter, except 5 bases (underlined upper italic case) to obtain the RBS01 *2 version of the PvBS to create a Psil restriction site.
PR/RBS01 *2-icd-TT02 F (SEQ ID NO 7)
GCGTGTTGACTATTTTACCTCTGGCGGTGATAATGGTTGCATGTACTAAGGAGG IIHI ATGGAAAGTAAAGTAGTTGTTCCGGCACAAGGC
with
- a region (upper case) homologous to the 5' extremity of the icd gene (from 1194346 to 1194378)
- a region (underlined upper case) homologous to the lambda bacteriophage PR promoter, except 5 bases (underlined upper italic case) to obtain the RBS01 *2 version of the RBS to create a Psil restriction site.
TT02-icd R (SEQ ID NO 8)
CTAG^ TA rCAAC AGATAAAACGAAAGGCCC AGTCTTTCGACTGAGCCTTTCGTT TTATTTGATGTTACATGTTTTCGATGATCGCGTCACC
with
- a region (upper case) with extra-bases,
- a region (italic upper case) harbouring the EcoRV restriction site,
- a region (underlined upper case) homologous to the TT02 transcriptional terminator sequence corresponding to the transcription terminator Ti of the rrnB gene of E. coli (Orosz A, Boros I and Venetianer P. Eur. J. Biochem. 1991 Nov l;201(3):653-9), - a region (upper bold case) homologous to the 3' extremity of the icd gene (from 1195596 to 1195570)
- To transfer the lladcca-cI857-PR/RBSO 1 *2-z'cd-TT02 fragment on the vector pUC 18- DttxaCA-SMC-Km, the plasmid pSCB-ΤΤα dcca-cI857-PR/RBSO 1 *2-ία -ΤΤ02 was restricted by restriction enzymes Apal and EcoRV and the resulting T\adcca-cl857-
PR/RBS01 *2-z'c<i-TT02 fragment cloned into Apal/Smal sites of the vector pUC18- DwxaCA-SMC-Km, leading to the vector pUC18-D«xaCA-RN/TTadcca-c/S57- PR/RBSO 1 *2-ία -ΤΤ02 : :Km. Finally, in order to replace by homologous recombination the uxaCA region by TTadcca- cI857-PR/RBSO l *2-zcd-TT02::Km, the plasmid pUC18-DwxaCA-RN/TTadcca-c/S57- PR/RBS01 *2-z'cd-TT02::Km was restricted by MM and Nrul and the DNA fragment OuxaCA-K ITTadcca-cI857-PR/RBSO l *2-ic< -TT02::Km was introduced by electroporation into the strain MG1655 (pKD46). Then, the kanamycin-resistant transformants were selected, and the insertion of OuxaCA-KNmadcca-cI857- PR/RBS01 *2-z'c<i-TT02::Km into the chromosome was checked by a PCR analysis with the oligonucleotides Ome 1612-uxaCA_R3 and Ome 1774- DuxaCA F (Seq. N°15 and N°16). The strain was named MG1655 OuxaC A-KN/TTadcca-cI857-PR/RBSO l *2-icd- TT02::Km.
2. Construction of the strain MG1655 Ptrc50/RBSB/TTG-icd::Cm AuxaCA::RN/TTadcca-cI857-PR/RBS01*2-icd-TT02::Km AaceB Agcl AglcDEFGB AaldA AiclR Aedd+eda ApoxB AackA+pta (pME101-ycdW-TT07-PaceA-aceA-TT01) To replace the uxaCA region by TTadcca-cI857-PR/RBSO l *2-z'c<i-TT02::Km in the MG1655 Ptrc50/RBSB/TTG-zc ::Cm AaceB Agcl Ag/cDEFGB AaldA AiclR Aedd+eda ApoxB AackA+pta (pME101-jc W-TT07-PaceA-aceA-TT01) strain, the construction AwxaC^.\-i?N/TTa cca-c/S57-PR/RBS01 !i:2-zc(i-TT02::Km was transferred by PI phage transduction (see Protocol 2) from the strain MG1655 AuxaCA::KN/TTadcca- cI857-PR/RBSO l *2-zcd-TT02::Km into the strain MG1655 Ptrc50/RBSB/TTG-zc ::Cm AaceB Agcl Ag/cDEFGB AaldA Az'c/R Aedd+eda ApoxB AackA+pta. The antibiotics resistant transformants were selected and the insertion of AuxaCA::RN/TTadcca-cI857- PR/RBS01 *2-z'c<i-TT02::Km on the chromosome was checked by PCR analysis with oligonucleotides Ome 1612- uxaCA_R3 (seq. N°15) and Ome 1774- DuxaCA F (seq N°16). The resulting strain was named MG1655 Ptrc50/RBSB/TTG-z'c ::Cm AuxaCA: :KN/TTadcca-cI857-PR/RBSO 1 *2-z'c<i-TT02 : :Km AaceB Agcl Ag/cDEFGB AaldA Az'c/R Aedd+eda ApoxB AackA+pta. The plasmid pME101-jc<iW-TT07-PaceA-aceA-TT01 (previously described in patent applications EP 09155971 ,6 and US 61162,712) was finally introduced by electroporation to lead to the MG1655 Ptrc50/RBSB/TTG-z'c ::Cm AuxaCA::RN/TTadcca-cI857-PR/RBS0l *2-icd-TT02::Km AaceB Agcl Ag/cDEFGB AaldA AiclK Aedd+eda ApoxB AackA+pta (pME101-jc W-TT07-PaceA-aceA-TT01) named AG1385.
EXAMPLE 2
Construction of a thermo inducible strain to produce glycolic acid by fermentation: MG1655 TTfli ccfl/CI857/PR01/RBS01*2-/ci ::Km AaceB Agcl A^cDEFGB AaldA AiclR Aedd+eda ApoxB AackA+pta AaceKr.Cm (pME101-jci W-TT07-PaceA-aceA- TT01)
The strain E.coli MG1655 AaceB Agcl Ag/cDEFGB AaldA AiclK Aedd+eda ApoxB AackA+pta (pME101-jc<iW-TT07-PaceA-aceA-TT01) was built according to the description given in patent applications EP 09155971,6 and US 61162,712.
1. Construction of the strain MG1655 TTfli cca-cI857-PR01/RBS01*2-iCi ::Km
The natural icd promoter was replaced in the strain E.coli MG1655 by the DNA fragment TTa cca-cI857-PR01/RBS01 *2::Km To replaced the natural icd promoter by the TTa<icca-cI857-PR01/RBS01 *2 DNA fragment, we used the homologous recombination strategy described by Datsenko & Wanner (2000). The construction was performed according to the technique described in Protocol 1.
To construct the MG1655 TTadcca-cI857-PR01/RBS01 *2-zcd::Km strain, the gene cI857, the promoter PR01 and the kanamycin cassette (Km) were amplified by PCR on the MG1655 AMxaCA::RN/TTa cca-cI857-PR/RBS01 !i:2-zc -TT02::Km genomic DNA with oligonucleotides described in Table 1 (Seq. N°9, N°10, N°l 1 and N°12). ymfC-TT07 F (SEQ ID NO 9)
CTAAAAGAAGTTTTTTGCATGGTATTTTCAGAGATTATGAATTGCCGCATTTCA CACTGGCTCACCTTCGGGTGGGCCTTTCTGCTGTAGGCTGGAGCTGCTTCG
with
- a region (upper case) homologous to the 5' extremity of the ymfC gene (from 1194125 to 1194175)
- a region (underlined upper case) for T7Te transcriptional terminator sequence from T7 phage (Harrington K.J., Laughlin R.B. and Liang S. 2001, PNAS Apr 24;98(9):5019-24.),
- a region (upper bold case) for the amplification of the kanamycin resistance cassette (reference sequence in Datsenko, K.A. & Wanner, B.L., 2000, PNAS, 97: 6640-6645), PR01 - R (SEQ ID NO 10)
CACCGCCAGAGGTAAAATAGTCAACACGCACGGTGTTAGATATTTATCCC
- homologous to the lambda bacteriophage PR promoter, except 1 base (bold upper case) to obtain the PR01 mutant version of the PR promoter
PR01 - F (SEQ ID NO 11)
GGGATAAATATCTAACACCGTGCGTGTTGACAATTTTACCTCTGGCGGTG
- homologous to the lambda bacteriophage PR promoter, except 1 base (bold upper case) to obtain the PR01 mutant version of the PR promoter
icd - R (SEQ ID NO 12)
GGGATAATCGGATTTTCAGGAACGTTGAGTTTGCCG
- homologous to the icd gene (from 1194434 to 1194399)
- The PCR fragment TTadcca-cI857-PR01/RBS01 *2-zcd::Km was first introduced by electroporation into the strain MG1655 (pKD46) to give the strain MG1655 YYadcca- cI857-PR01/RBS01 *2-zc ::Km Kanamycin resistant transformants were selected. The insertion of the TTa<icca-cI857-PR01/RBS01 *2-z'c<i::Km fragment was checked by PCR analysis with oligonucleotides Ome 704 seq Ptrc-icd F and Ome 705 seq Ptrc-z'c<i R listed in Table 2 (Seq. N°17 and N°18) and then validated by sequencing. The resulting strain was named MG1655 TTadcca-cI857-PR01/RBS01 *2-zcd::Km.
2. Construction of the strain MG1655 TTadcca/CI857/PR01/RBS01*2-icd::Km AaceB Agcl AglcDEFGB AaldA AiclR Aedd+eda ApoxB AackA+pta AaceKr. Cm ( MElOl- jCi W-TT07-PflceA-flceA-TT01) The construction TTa cca-cI857-PR01/RBS01
Figure imgf000033_0001
was transferred by transduction (see Protocol 2) from the donor strain MG1655 TTadcca-cI857-PR01/RBS01 *2-z'cd::Km to the receiver strain MG1655 AaceB Agcl Ag/cDEFGB AaldA AiclK Aedd+eda ApoxB AackA+pta strain. Then, kanamycin-resistant transformants were selected and the insertion of the TTa cca-c/S57-PR01/RBS01 !i:2-zc -TT02::Km region was checked by PCR analysis with the oligonucleotides Ome 704 seq Ptrc-icd F (seq N°17) and Ome 705 seq Ptrc-icd R (seq N°18). The strain was named MG1655 TTadcca-cI857-PR01/RBS01 *2- z'c -TT02::Km AaceB Agcl Ag/cDEFGB AaldA AiclK Aedd+eda ApoxB AackA+pta.
The gene aceK was deleted in the strain E.coli MG1655 TTadcca-cI857-PR01/RBS01 *2- z'c -TT02::Km AaceB Agcl Ag/cDEFGB AaldA AiclK Aedd+eda ApoxB AackA+pta (pKD46) by homologous recombination as previously described using the oligonucleotides Ome 0205 -DaceB AKR and Ome 0700-DaceK F (Seq. N°13 and N°14) described in table 1 (See Protocol 3). Oag 0074-DaceK-loxP R (SEQ ID NO 13)
GCCGCGTGGCCTGGAATTATTGATTGCTCAAACCATTTTGCAAGGCTTCGATGC TCAGTATGGTCGATTCCTCGAAGTGACCAATTAACCCTCACTAAAGGG
with
- a region (upper case) homologous to the sequence (4216621-4216702) of the gene aceK (reference sequence on the website http://ecogene.org/),
- a region (underlined upper case) for the amplification of the chloramphenicol resistance cassette (reference sequence Gene Bridges), Oag 0075-DaceK-loxP F (SEQ ID NO 14)
AACATCTTCCACATGCCCTTCACGTATGCGGTTTTGTAGTGCGCGCCAGTAATC AGCGCGGAACAGGTCGGCGTGCATCTAATACGACTCACTATAGGG
with
- a region (upper case) homologous to the sequence (4218298-4218220) of the gene aceK (reference sequence on the website http://ecogene.org/),
- a region (underlined upper case) for the amplification of the chloramphenicol resistance cassette (reference sequence Gene Bridges).
Chloramphenicol and kanamycin resistant transformants were then selected and verified by PCR analysis with the oligonucleotides Ome 0169-BAK F and Ome 0701-aceK F listed in Table 2 (Seq. N°19 and N°20). In the last step, the plasmid pME101-jc W-TT07-PaceA- aceA-TTOl was introduced into the strain MG1655 TTadcca-c/S57-PR01/RBS01 *2-z'cd- TT02::Km AaceB Agcl Ag/cDEFGB AaldA AiclK Aedd+eda ApoxB AackA+pta AaceK::Cm. The final strain MG1655 TTai cca-c/5J7-PR01/RBS01 *2-ici -TT02::Km AaceB Agcl Ag/cDEFGB AaldA AiclK Aedd+eda ApoxB AackA+pta AaceK::Cm (pME101-jc W-TT07-PaceA-aceA-TT01) was named AG1413.
FERMENTATION OF PRODUCER STRAINS
Glycolic acid production was determined in the thermo inducible strains AG1385 and AG1413. Construction of these strains has been described in examples 1 and 2. Genotypes of the strains used below:
AG0662: MG1655
Figure imgf000034_0001
AaceB Agcl Ag/cDEFGB AaldA AiclK Aedd+eda ApoxB AackA+pta ME101-ycdW-TT07-PaceA-aceA-TT01)
Construction of AG0662 was described in patent applications WO 2007/141316A, US 61/162,712 and EP 09155971.6.
AG1385: MG1655 Ptrc50/RBSB/TTG-icd::Cm AuxaCA::RN/TTadcca-cI857- PR/RBS01 *2-icd-TT02::Km AaceB Agcl AglcDEFGB AaldA AiclR Aedd+eda ApoxB AackA+pta (pME 101 -ycdW-TT07-PaceA-ace A-TTO 1 ) AG1413: MG1655 TTadcca/CI857/PR01/RBS01 *2-icd::Km AaceB Agcl AglcDEFGB AaldA AiclR Aedd+eda ΔροχΒ AackA+pta AaceK::Cm (pME101-ycdW-TT07-PaceA- aceA-TTOl)
Strain AG0662 possesses an attenuated expression of icd gene. Whatever the temperature of the culture is, the isocitrate dehydrogenase activity (ICD) of the cells is around 50mUI/mg (table 4).
Strains AG1385 and AG1413 have a thermo inducible copy of icd gene. At 37°C, icd expression is maximal and ICD activity is above lOOOmUI/mg, whereas at 30°C, icd expression is repressed and ICD activity is around 50 to lOOmUI/mg (see exemple 5). EXAMPLE 3
Fermentation cultures of strains AG0662, AG1385 and AG1413 to produce glycolic acid in industrial-like conditions.
To assay the stability of strains AG0662, AG1385 and AG1413, they were cultivated successively for 30 generations, corresponding to a minimum number for an industrial process, before determining their performance in fermentors.
For this purpose between 3 and 5 cultures of each strain were carried out successively in baffled flasks in synthetic medium MML8AG1 100 (See composition in table 1), which was supplemented with 40 g/1 of MOPS and 10 g/1 of glucose. Flasks were agitated at 37°C during 2 days (final OD between 6 and 8) at 200 rpm.
Figure imgf000035_0001
Table 1 : Composition of minimal medium MML8AG1 100.
Successive cultures were also grown in 700mL working volume vessels assembled on a Multifors Multiple Fermentor System (Infers). Each vessel was filled up with 200 ml of synthetic medium MML11AG1 100 supplemented with 20 g/1 of glucose and 50 mg/1 of spectinomycin and inoculated to an OD between 0,01 and 0,8.
Figure imgf000036_0001
Figure imgf000036_0002
Table 2: Composition of minimal medium MML11AG1 100.
Cultures were carried out at 37 °C with an aeration of 0,2 1pm and dissolved oxygen was maintained above 30% saturation by controlling agitation (initial : 300 rpm ; max : 1200 rpm) and oxygen supply (0 to 40 ml/min). The pH was adjusted at pH 6.8 ± 0.1 by the addition of base (mix of NH40H 7.5 % w/w and NaOH 2.5% w/w). The fermentation was carried out in discontinuous fed-batch mode, with a feed solution of 700 g/1 of glucose (See table 3). When glucose was used up in the culture medium, a pulse of fed restored a concentration of 20 g/1 of glucose.
Figure imgf000036_0003
Table 3 : Composition of feed solution. After 30 generations grown at 37°C, populations were sampled and stored in glycerol at - 80°C (dilution in sterile glycerol solution at 40% w/w).
Each population was then tested for production of gly colic acid.
Fermentation conditions used for strain AG0662 and its derived population (30 generations) have already been described in patent applications EP 09155971.6 and EP09171297.6.
The fermentation process used for the thermo inducible strains AG 1385 and AG1413 is described in example 4 below.
Glycolic acid production of strains AG0662, AG1385 and AG1413 and their respective derived populations (± 30 generations) are presented in table 4.
Figure imgf000037_0001
Table 4: Performances of strains AG0662 (with an attenuated expression of icd), AG 1385 and AG1413 (thermo induction on icd) and their respective populations determined at 30°C (production phase). Performances and isocitrate dehydrogenase (ICD) activities of the cells correspond to one time point at the same OD for all conditions.
As can be seen in table 4, strain AG0662 is highly unstable, since the performances of the strain when cultured for 30 generations before the performance test are much lower than without additional cultivation before the test.
Loss of performances is also linked to a higher ICD activity (table 4).
All mutation that can improve icd expression and so ICD activity of the cell will improve growth rate and decrease the yield of production. Population of AG0662 has evolved and recombined to lead to a higher expression of icd. ICD activity in this population is 10 times higher than in the mother strain (1045mUI/mg instead of 50mUI/mg).
In contrast, performances of both strains harbouring a thermo inducible promoter that drives icd expression (AG 1385 and AG1413) do only slightly vary in the performance test when the two conditions (I) without or (II) with growth for 30 generations before the test are compared. Thus the presence of a thermo inducible icd gene in the glycolic acid producer strains improves the strain stability.
Isocitrate dehydrogenase activity (ICD) was measured for each strain and each population at the same OD according to the protocol described in example 5.
For a maximal production of glycolic acid, activity of ICD must be low; around 50 to lOOmUI/mg.
EXAMPLE 4
Fermentation process for thermo inducible strains
The protocol used for thermo inducible strains is based on the "pH increase" protocol described in patent EP 09171297.6 with specific modification due to the thermo regulation of icd gene.
Fermentations were realized with strains AG 1385 and AG1413.
For each strain, an independent preculture was carried out in a 500 ml baffled Erlenmeyer flask filled with 55 ml synthetic medium MML8AG1 100 supplemented with 40 g/1 of MOPS and 10 g/1 of glucose, at 37°C during 2 days (OD between 7 and 10). 20mL of each preculture were used to inoculate fermenters. Cultures were grown in 700mL working volume vessels assembled on a Multifors Multiple Fermentor System (Infors). Each vessel was filled with 200 ml of synthetic medium MML11AG1 100 supplemented with 20 g/1 of glucose and 50 mg/1 of spectinomycin and inoculated at an OD of about 1.
Cultures were carried out at 30 °C with an aeration of 0,2 1pm and dissolved oxygen was maintained above 30% saturation by controlling agitation (initial : 300 rpm ; max : 1200 rpm) and oxygen supply (0 to 40 ml/min).
pH was adjusted at pH 6.8 ± 0.1 by the addition of base (mix of NH40H 7.5 % w/w and NaOH 2.5% w/w). The fermentation was carried out in discontinuous fed-batch mode, with a feed solution of 700 g/1 glucose.
When the glucose was used up in the culture medium, a pulse of fed restored a concentration of 20 g/1 of glucose.
After the 5th pulse of fed (lOOg/L of glucose consumed), pH was adjusted from 6.8 to 7.4 over an interval of 2 h and kept constant until the end of the culture.
Glycolic acid production of strains AG1385 and AG1413 grown under these conditions are given in table 5 below. [GA] titre Yield Productivity
Strain
(g/i) (g GA / g glucose) (g/l/h)
AG1385 51.3 ± 1.0 0.38 ± 0.02 0.99 ± 0.07
AG1413 52.5 ± 1.0 0.36 ± 0.01 1.08 ± 0,07
Table 5 : Glycolic acid production of thermo inducible strains AG1385 and AG1413 at 30°C (glycolic acid production phase) after precultures at 37°C (biomass production phase). Mean values of 3 cultures of each strain are presented.
EXAMPLE 5
Isocitrate dehydrogenase (ICD) activity assay To assay isocitrate dehydrogenase activity, cells (25mg) were lysed by a Precellys (1x30s at 6500rpm, Bertin Technologies) and cell debris were removed by centrifugation at 12000g (4°C) during 30 minutes. Protein concentrations were determined by Bradford. ICD activity was determined in a volume of 300μί at pH 8,2 and 30°C. The assay mixture contained 50mM Tris-HCl (pH 8,2), 50mM MgCl2, 5mM NADP+, 0,5mM Oxalate and 3- 6μg of crude cell extract. The reaction mixture was incubated at 30°C for 10 minutes. Then, lOmM of Isocitrate was added to start the reaction. Changes in absorbance at 340nm (ε = 4,57 μmoΓ1.mL.cm"1) due to NADPH formation were monitored at 30°C during 30 minutes.
Figure imgf000039_0001
Table 6: ICD activities measured on precultures and last time points of culture of AG1385 and AG1413 cultivated in Multifors according to conditions described in Example 4. PC were grown at 37°C (biomass production phase) and main cultures at 30°C (glycolic acid production phase). REFERENCES
Michihiko Kataoka, Biosci. Biotechnol. Biochem., 2001
Neidhardt, F. C. (Ed. in Chief), R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (eds). 1996. Escherichia coli and Salmonella: Cellular and Molecular Biology. (American Society for Microbiology)
Tang X, Tan Y, Zhu H, Zhao K, Shen W. 'Microbial conversion of glycerol to 1, 3- propanediol by an engineered strain of Escherichia coli.' Appl Environ Microbiol. 2009 Mar; 75(6): 1628-34.
Anderson, 1946, Proc. Natl. Acad. Sci. USA 32: 120-128;
Miller, 1992; A Short Course in Bacterial Genetics: A Laboratory Manual and Handbook for Escherichia coli and Related Bacteria, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York;
Schaefer et al. 1999, Anal. Biochem. 270: 88-96;
Ptashne M. Ά genetic switch'. Blackwell Scientific, Cambridge, MA. 1986 ;
Ptashne M. Ά genetic switch: Phage lambda revisited'. Cold Spring Harbor Lab Press. Cold Spring Harbor, NY. 2004;
Little J. 'The bacteriophages, Part II: Life of phages, 8. Gene regulatory circuitry of phage λ.' 2nd edition 2004. Richard Calendared. Oxford University Press;
Bukrinsky et al, Gene, 70 (1998) 415-417;
Mandal & Lieb, 1976,
Winstanley et al. , 1989;
Sussman R, Jacob F. C. R. 'On a thermosensitive repression system in the Escherichia coli lambda bacteriophage'. Hebd. Seances Acad. Sci. 1962, 254, pl517;
Sambrook et al. 'Molecular Cloning: a Laboratory Manual'. 2nd ed. 1989 Cold Spring Harbor Lab., Cold Spring Harbor, New York;
Datsenko, K.A. & Wanner, B.L., 2000, PNAS, 97: 6640-6645;
Norrander et al, 1983, Gene 26,101-106
Harrington K.J., Laughlin R.B. and Liang S. Proc Natl Acad Sci U S A. 2001 Apr 24;98(9):5019-24;
Mermet-Bouvier & Chauvat, 1994, Current Microbiology, vol. 28, pp 145-148 ; Orosz A, Boros I and Venetianer P. Eur. J. Biochem. 1991 Nov l;201(3):653-9.

Claims

1) A method for the production of glycolic acid in a fermentative process comprising the following steps:
- culturing a modified microorganism in an appropriate culture medium comprising a source of carbon,
- modulating in said microorganism the expression of a target gene with an external stimulus, and
- recovering glycolic acid from the culture medium,
wherein in said microorganism, the expression of at least one target gene involved in glycolic acid biosynthesis pathway is under the control of a heterologous inducible promoter whose activity is modulated with said external stimulus.
2) The method of claim 1 wherein the external stimulus is a physical or a chemical stimulus.
3) The method of claim 2 wherein the external stimulus is a physical stimulus chosen among temperature or light.
4) The method according to anyone of claims 1 to 3 wherein the inducible promoter is induced by temperature and is selected among:
- promoters regulated by a modified repressor of phage lambda such as:
■ the promoter PR or a derivative of said promoter PR,
■ the promoter PL or a derivative of said promoter PL,
- a modified lac promoter regulated by a temperature sensitive Lac repressor.
5) The method of claim 4 wherein said modified repressor of phage lambda is a temperature labile allele of the lambda repressor cl, in particular the lambda repressor allele cI857.
6) The method of claims 1 to 5 wherein in the modified microorganism, the gene recA is deleted.
7) The method according to anyone of claims 1 or 2 wherein the external stimulus is a chemical stimulus, said stimulus being chosen among :
changes in the repression of carbon catabolite;
- presence of specific carbon sources, or
- presence of sugar alcohols. 8) The method of anyone of claims 1 to 7, wherein at least one gene whose expression is under control of a inducible promoter is selected among the group consisting of icd, aceA, ycdW, pgi, pntAB, udhA,arcA, maeA, maeB, mdh, pck, ppc, ackA, pta, poxB, dP, glcA, yjcG, IdhA and mgsA.
9) The method of anyone of claims 1 to 8 wherein the icd gene expression is under the control of a heterologous inducible promoter.
10) The method of claim 9 wherein the use of inducible promoter allows expression of the icd gene at 37°C to 42°C and represses expression of the icd gene at 28°C to 32°C.
11) The method of anyone of claims 1 to 10, wherein the recovery of the produced gly co lie acid in the culture medium comprises the recovering of derivatives and precursors of gly colic acid present in the culture medium.
12) A microorganism modified for an improved production of glycolic acid, wherein in said modified microorganism the expression of at least one gene involved in glycolic acid biosynthesis pathway is under the control of a heterologous inducible promoter as defined in anyone of claims 1 to 11.
13) The microorganism of claim 12 wherein at least one target gene whose expression is under the control of an heterologous inducible promoter is selected among the group consisting of icd, aceA, ycdW, pgi, pntAB, udhA,arcA, maeA, maeB, mdh, pck, ppc, ackA, pta, poxB, UdP, glcA, yjcG, IdhA and mgsA.
14) The microorganism of claim 13 wherein the use of said inducible promoter allows expression of the icd gene at 37°C to 42°C and represses expression of the icd gene at 28°C to 32°C.
15) The microorganism according to anyone of claims 12 to 14 wherein the glycolic acid production is at least 50% of the initial production after 30 generations.
PCT/EP2011/059884 2010-06-15 2011-06-15 Use of inducible promoters in the production of glycolic acid WO2011157728A1 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
BR112012031965A BR112012031965A8 (en) 2010-06-15 2011-06-15 use of inducible promoters in the production of glycolic acid
CA2801823A CA2801823C (en) 2010-06-15 2011-06-15 Use of inducible promoters in the production of glycolic acid
EP11725734.5A EP2582828B1 (en) 2010-06-15 2011-06-15 Use of inducible promoters in the production of glycolic acid
KR1020137000915A KR101824282B1 (en) 2010-06-15 2011-06-15 Use of inducible promoters in the production of glycolic acid
CN201180039363.0A CN103221548B (en) 2010-06-15 2011-06-15 Use of inducible promoters in the production of glycolic acid
US13/704,578 US9121043B2 (en) 2010-06-15 2011-06-15 Method for producing glycolic acid using an inducible promoter
JP2013514694A JP5882310B2 (en) 2010-06-15 2011-06-15 Use of inducible promoters in the production of glycolic acid

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US35488710P 2010-06-15 2010-06-15
EP10305635 2010-06-15
US61/354,887 2010-06-15
US61/654,887 2010-06-15
EP10305635.4 2010-06-15

Publications (2)

Publication Number Publication Date
WO2011157728A1 true WO2011157728A1 (en) 2011-12-22
WO2011157728A8 WO2011157728A8 (en) 2013-01-17

Family

ID=42490551

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2011/059884 WO2011157728A1 (en) 2010-06-15 2011-06-15 Use of inducible promoters in the production of glycolic acid

Country Status (8)

Country Link
US (1) US9121043B2 (en)
EP (1) EP2582828B1 (en)
JP (1) JP5882310B2 (en)
KR (1) KR101824282B1 (en)
CN (1) CN103221548B (en)
BR (1) BR112012031965A8 (en)
CA (1) CA2801823C (en)
WO (1) WO2011157728A1 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017068385A1 (en) 2015-10-23 2017-04-27 Metabolic Explorer Microorganism modified for the assimilation of levulinic acid
WO2018007560A1 (en) 2016-07-08 2018-01-11 Metabolic Explorer Method for the fermentative production of molecules of interest by microorganisms comprising genes coding sugar phosphotransferase system (pts)
EP3354742A1 (en) 2017-01-26 2018-08-01 Metabolic Explorer Methods and microorganisms for the production of glycolic acid and/or glyoxylic acid
WO2019068642A1 (en) 2017-10-02 2019-04-11 Metabolic Explorer Method for producing organic acid salts from fermentation broth

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2711870C2 (en) * 2014-05-12 2020-01-22 Метаболик Эксплорер New microorganism and method of producing 1,2-propanediol based on nadph-dependent acetol reductase and improved nadph supply
US10975420B2 (en) * 2015-12-18 2021-04-13 California Institute Of Technology Thermal bioswitches and related genetic circuits, vectors, cells, compositions, methods and systems
US11965001B2 (en) 2019-07-12 2024-04-23 California Institute Of Technology Modular dimerization thermoswitches and related monomers, dimers, constructs, dimeric complexes, vectors, cells, surfaces, devices compositions, methods and systems

Citations (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998011231A1 (en) 1996-09-10 1998-03-19 The Rockefeller University Highly regulable promoter for heterologous gene expression
EP0915597A1 (en) 1997-11-05 1999-05-12 Sony International (Europe) GmbH Synchronisation of digital communication systems
EP0917129A2 (en) 1997-11-17 1999-05-19 International Business Machines Corporation Method and apparatus for adapting a speech recognizer to the pronunciation of an non native speaker
US6162712A (en) 1995-06-30 2000-12-19 Advanced Technology Materials, Inc. Platinum source compositions for chemical vapor deposition of platinum
WO2004020640A2 (en) 2002-08-30 2004-03-11 Institut National De La Recherche Agronomique Zinc-regulated prokaryotic expression cassettes
WO2006069110A2 (en) 2004-12-22 2006-06-29 E.I. Dupont De Nemours And Company Enzymatic production of glycolic acid
US20060160199A1 (en) * 2004-12-22 2006-07-20 Dicosimo Robert Enzymatic production of glycolic acid
WO2007005837A2 (en) 2005-07-01 2007-01-11 The Regents Of The University Of California Inducible expression vectors and methods of use thereof
WO2007141316A2 (en) 2006-06-09 2007-12-13 Metabolic Explorer Glycolic acid production by fermentation from renewable resources
US7445917B2 (en) 2004-12-22 2008-11-04 E.I. Du Pont De Nemours And Company Process for producing glycolic acid from formaldehyde and hydrogen cyanide
EP2025760A1 (en) 2006-05-09 2009-02-18 Mitsui Chemicals, Inc. Method of producing hydroxycarboxylic acid by regenerating coenzyme
EP2025759A1 (en) 2006-05-09 2009-02-18 Mitsui Chemicals, Inc. Method for production of hydroxycarboxylic acid by enhancing the synthesis of coenzyme
EP2027277A2 (en) 2006-06-09 2009-02-25 Metabolic Explorer Glycolic acid production by fermentation from renewable resources
EP2027227A1 (en) 2006-06-09 2009-02-25 M-I Llc Hydrophobically modified fluid loss additives and viscosifier products
WO2010108909A1 (en) 2009-03-24 2010-09-30 Metabolic Explorer Method for producting high amount of glycolic acid by fermentation

Patent Citations (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6162712A (en) 1995-06-30 2000-12-19 Advanced Technology Materials, Inc. Platinum source compositions for chemical vapor deposition of platinum
WO1998011231A1 (en) 1996-09-10 1998-03-19 The Rockefeller University Highly regulable promoter for heterologous gene expression
EP0915597A1 (en) 1997-11-05 1999-05-12 Sony International (Europe) GmbH Synchronisation of digital communication systems
EP0917129A2 (en) 1997-11-17 1999-05-19 International Business Machines Corporation Method and apparatus for adapting a speech recognizer to the pronunciation of an non native speaker
WO2004020640A2 (en) 2002-08-30 2004-03-11 Institut National De La Recherche Agronomique Zinc-regulated prokaryotic expression cassettes
US7445917B2 (en) 2004-12-22 2008-11-04 E.I. Du Pont De Nemours And Company Process for producing glycolic acid from formaldehyde and hydrogen cyanide
WO2006069110A2 (en) 2004-12-22 2006-06-29 E.I. Dupont De Nemours And Company Enzymatic production of glycolic acid
US20060160199A1 (en) * 2004-12-22 2006-07-20 Dicosimo Robert Enzymatic production of glycolic acid
WO2007005837A2 (en) 2005-07-01 2007-01-11 The Regents Of The University Of California Inducible expression vectors and methods of use thereof
EP2025759A1 (en) 2006-05-09 2009-02-18 Mitsui Chemicals, Inc. Method for production of hydroxycarboxylic acid by enhancing the synthesis of coenzyme
EP2025760A1 (en) 2006-05-09 2009-02-18 Mitsui Chemicals, Inc. Method of producing hydroxycarboxylic acid by regenerating coenzyme
WO2007140816A1 (en) * 2006-06-09 2007-12-13 Metabolic Explorer Glycolic acid production by fermentation from renewable resources
WO2007141316A2 (en) 2006-06-09 2007-12-13 Metabolic Explorer Glycolic acid production by fermentation from renewable resources
EP2027277A2 (en) 2006-06-09 2009-02-25 Metabolic Explorer Glycolic acid production by fermentation from renewable resources
EP2027227A1 (en) 2006-06-09 2009-02-25 M-I Llc Hydrophobically modified fluid loss additives and viscosifier products
WO2010108909A1 (en) 2009-03-24 2010-09-30 Metabolic Explorer Method for producting high amount of glycolic acid by fermentation

Non-Patent Citations (23)

* Cited by examiner, † Cited by third party
Title
"Escherichia coli and Salmonella: Cellular and Molecular Biology", 1996, AMERICAN SOCIETY FOR MICROBIOLOGY
ANDERSON, PROC. NATL. ACAD. SCI. USA, vol. 32, 1946, pages 120 - 128
BIOSCI. BIOTECHNOL. BIOCHEM., 2001
BUKRINSKY ET AL., GENE, vol. 70, 1998, pages 415 - 417
DATSENKO, K.A., WANNER, B.L., PNAS, vol. 97, 2000, pages 6640 - 6645
HARRINGTON K.J., LAUGHLIN R.B., LIANG S., PNAS, vol. 98, no. 9, 24 April 2001 (2001-04-24), pages 5019 - 24
HARRINGTON K.J., LAUGHLIN R.B., LIANG S., PROC NATL ACAD SCI U S A., vol. 98, no. 9, 24 April 2001 (2001-04-24), pages 5019 - 24
LITTLE J: "Gene regulatory circuitry of phage À", vol. 8, 2004, OXFORD UNIVERSITY PRESS, article "The bacteriophages, Part II: Life of phages"
LITTLE J: "The bacteriophages, Part II: Life ofphages, 8. Gene regulatory circuitry of phage ?", 2004, OXFORD UNIVERSITY PRESS
MERMET-BOUVIER, CHAUVAT, CURRENT MICROBIOLOGY, vol. 28, 1994, pages 145 - 148
MICHIHIKO KATAOKA, BIOSCI. BIOTECHNOL. BIOCHEM., 2001
MILLER: "A Short Course in Bacterial Genetics: A Laboratory Manual and Handbook for Escherichia coli and Related Bacteria", 1992, COLD SPRING HARBOR LABORATORY PRESS
NORRANDER ET AL., GENE, vol. 26, 1983, pages 101 - 106
OROSZ A, BOROS I, VENETIANER P, EUR. J. BIOCHEM., vol. 201, no. 3, 1 November 1991 (1991-11-01), pages 653 - 9
PTASHNE M.: "A genetic switch", 1986, BLACKWELL SCIENTIFIC
PTASHNE M: "A genetic switch", 1986, BLACKWELL SCIENTIFIC
PTASHNE M: "A genetic switch: Phage lambda revisited", 2004, COLD SPRING HARBOR LAB PRESS
SAMBROOK ET AL.: "Molecular Cloning: a Laboratory Manual", 1989, COLD SPRING HARBOR LAB.
SCHAEFER ET AL., ANAL. BIOCHEM., vol. 270, 1999, pages 88 - 96
SUSSMAN R, JACOB F. C. R.: "On a thermosensitive repression system in the Escherichia coli lambda bacteriophage", HEBD. SEANCES ACAD. SCI., vol. 254, 1962, pages 1517
SUSSMAN R, JACOB F: "On a thermosensitive repression system in the Escherichia coli lambda bacteriophage", C. R. HEBD. SEANCES ACAD. SCI., vol. 254, 1962, pages 1517
TANG X, TAN Y, ZHU H, ZHAO K, SHEN W., APPL ENVIRON MICROBIOL., vol. 75, no. 6, March 2009 (2009-03-01), pages 1628 - 34
TANG X, TAN Y, ZHU H, ZHAO K, SHEN W: "Microbial conversion of glycerol to 1, 3-propanediol by an engineered strain of Escherichia coli.", APPL ENVIRON MICROBIOL., vol. 75, no. 6, March 2009 (2009-03-01), pages 1628 - 34, XP002631310, DOI: doi:10.1128/AEM.02376-08

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017068385A1 (en) 2015-10-23 2017-04-27 Metabolic Explorer Microorganism modified for the assimilation of levulinic acid
US10801050B2 (en) 2015-10-23 2020-10-13 Metabolic Explorer Microorganism modified for the assimilation of levulinic acid
WO2018007560A1 (en) 2016-07-08 2018-01-11 Metabolic Explorer Method for the fermentative production of molecules of interest by microorganisms comprising genes coding sugar phosphotransferase system (pts)
EP3354742A1 (en) 2017-01-26 2018-08-01 Metabolic Explorer Methods and microorganisms for the production of glycolic acid and/or glyoxylic acid
WO2018138240A1 (en) 2017-01-26 2018-08-02 Metabolic Explorer Methods and microorganisms for the production of glycolic acid and/or glyoxylic acid
US10774320B2 (en) 2017-01-26 2020-09-15 Metabolic Explorer Methods and microorganisms for the production of glycolic acid and/or glyoxylic acid
WO2019068642A1 (en) 2017-10-02 2019-04-11 Metabolic Explorer Method for producing organic acid salts from fermentation broth

Also Published As

Publication number Publication date
CN103221548B (en) 2017-04-12
JP2013528390A (en) 2013-07-11
CA2801823C (en) 2019-07-30
KR101824282B1 (en) 2018-01-31
EP2582828B1 (en) 2015-07-15
US9121043B2 (en) 2015-09-01
BR112012031965A8 (en) 2020-05-19
KR20130114079A (en) 2013-10-16
JP5882310B2 (en) 2016-03-09
BR112012031965A2 (en) 2015-11-24
US20130089903A1 (en) 2013-04-11
WO2011157728A8 (en) 2013-01-17
CA2801823A1 (en) 2011-12-22
EP2582828A1 (en) 2013-04-24
CN103221548A (en) 2013-07-24

Similar Documents

Publication Publication Date Title
US11098307B2 (en) Compositions and methods for rapid and dynamic flux control using synthetic metabolic valves
US20150072399A1 (en) Methods, Systems And Compositions Related To Reduction Of Conversions Of Microbially Produced 3-Hydroxypropionic Acid (3-HP) To Aldehyde Metabolites
US9121043B2 (en) Method for producing glycolic acid using an inducible promoter
CA2754949C (en) Method for producing high amount of glycolic acid by fermentation
WO2007140816A1 (en) Glycolic acid production by fermentation from renewable resources
US20140065697A1 (en) Cells and methods for producing isobutyric acid
US20130210097A1 (en) Glycolic acid fermentative production with a modified microorganism
US20070249018A1 (en) Reduced overflow metabolism and methods of use
US20130288320A1 (en) Methods and microorganisms for increasing the biological synthesis of difunctional alkanes
US20080014619A1 (en) Method of production of para-hydroxycinnamic acid
EP2027277A2 (en) Glycolic acid production by fermentation from renewable resources
Wang et al. Elevated production of 3-hydroxypropionic acid in recombinant Escherichia coli by metabolic engineering

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11725734

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2801823

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2011725734

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 10762/DELNP/2012

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 2013514694

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 13704578

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 20137000915

Country of ref document: KR

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112012031965

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112012031965

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20121214