WO2011127222A1 - Diagnosis and treatment of melanoma through nuak2 assessment and modulation - Google Patents
Diagnosis and treatment of melanoma through nuak2 assessment and modulation Download PDFInfo
- Publication number
- WO2011127222A1 WO2011127222A1 PCT/US2011/031483 US2011031483W WO2011127222A1 WO 2011127222 A1 WO2011127222 A1 WO 2011127222A1 US 2011031483 W US2011031483 W US 2011031483W WO 2011127222 A1 WO2011127222 A1 WO 2011127222A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nuak2
- melanoma
- expression
- patient
- acral
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/5751—Immunoassay; Biospecific binding assay; Materials therefor for cancer of the skin, e.g. melanoma
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/11—Protein-serine/threonine kinases (2.7.11)
- C12Y207/11001—Non-specific serine/threonine protein kinase (2.7.11.1), i.e. casein kinase or checkpoint kinase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2330/00—Production
- C12N2330/50—Biochemical production, i.e. in a transformed host cell
- C12N2330/51—Specially adapted vectors
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/56—Staging of a disease; Further complications associated with the disease
Definitions
- the present disclosure generally relates to methods and compositions for modulating NUAK2 signaling in tumor cells, and in one embodiment, assessing and modulating NUAK2 in melanoma tumor cells.
- the melanoma is acral melanoma.
- Assessment and modulation of NUAK2 signaling in tumor cells is useful for diagnosis and treatment of melanoma, in one embodiment acral melanoma, under a variety of clinical settings.
- Melanoma is a malignancy of melanocytes found predominantly in the skin, but also found in the eyes, ears, gastro-intestinal tract, leptomeninges, and oral and genital mucous membranes.
- Four major histogenetic subtypes of primary cutaneous melanoma have been identified. These include superficial spreading melanoma, nodular melanoma, lentigo maligna melanoma, and acral lentiginous melanoma. Distinction among these subtypes includes histologic growth pattern, anatomic site, and degree of sun damage.
- the present invention relates to diagnosis and novel therapeutic targets aimed to control melanoma, in one embodiment, aggressive acral melanoma, via regulation and recognition of the expression of the NUAK2 gene.
- compositions and kits are provided for determining expression levels of NUAK2, modulating the expression of NUAK2, and predicting the outcome and treatment for a patient with melanoma following determination of expression levels of NUAK2 in acral melanomas.
- modulating indicates some limitation of the targeted activity, e.g. inhibiting the CDK2 signaling pathway.
- the disclosure teaches diagnosis and novel therapeutic targets aimed to control aggressive acral melanoma via regulation of the NUAK2 gene.
- Gain of UA 2 and deletion of PTEN strongly correlates with tumor thickness in acral melanomas.
- p-Akt phosphor- Akt
- acral melanomas over expressing both genes have three distinct clinical features:
- NUAK2 is a suitable target of therapies for acral melanoma with aggressive behavior by knockdown using shRNA constructs.
- shRNA carriers against the NUAK2 gene these vectors act as therapeutic inhibitors to reduce the proliferation of acral melanoma cells.
- the disclosure provides a polynucleotide comprising a region encoding an shRNA against the NUAK2 gene.
- the polynucleotide may be operably inserted into a lentiviral vector or an adenoviral vector.
- the disclosure further provides a method of inhibiting melanoma (in one embodiment acral melanoma) cell proliferation comprising administering a therapeutically effective amount of the polynucleotide to a patient in need thereof. Further, the disclosure provides a method of inhibiting melanoma (in one
- acral melanoma) cell migration comprising administering a therapeutically effective amount of the polynucleotide to a patient in need thereof.
- the disclosure further provides a method for treating melanoma comprising administering to a patient in need thereof a pharmaceutically effective amount of a CDK2 inhibitor, wherein it is determined that the melanoma cells overexpress NUAK2.
- the disclosure provides a method of treatment for a patient with melanoma comprising measuring the expression of NUAK2 in the melanoma, determining the level of expression of NUAK2 compared to control, and treating the patient with a pharmaceutically effective amount of a CDK2 inhibitor, wherein it is determined that the melanoma cells overexpress NUAK2.
- the disclosure further provides a method of predicting a clinical outcome in a patient with melanoma (in one embodiment, acral melanoma) comprising determining whether NUAK2 is overexpressed in melanoma (in one embodiment, acral melanoma); wherein over-expression of NUAK2 is indicative of decreased relapse-free survival in the patient.
- the disclosure provides a method of predicting a clinical outcome in a patient with melanoma, comprising determining whether NUAK2 and p-Akt (Ser473) are overexpressed in a melanoma; and wherein over-expression of both p-A t and NUAK2 is predictive of decreased relapse-free survival and overall survival in the patient.
- the melanoma can be selected from the group consisting of an acral melanoma, a mucosal melanoma, and metastatic melanoma.
- the disclosure provides a method of diagnosis for clinical outcome for melanoma in a subject comprising measuring the expression of NUAK2 in the melanoma, determining the level of expression of NUAK2 compared to control, and correlating the level of expression with decreased relapse-free survival and overall survival in the patient.
- the disclosure provides for a kit for predicting clinical outcome in a patient with melanoma (in one embodiment acral melanoma) comprising instructions comprising the method of correlating NUAK2 overexpression with clinical outcome.
- the kit may comprise an assay to determine NUAK2 expression levels.
- the disclosure further provides a method of predicting a clinical outcome in a patient with cancer comprising determining whether NUAK2 is overexpressed in the cancer cells, or tumor; wherein over-expression of NUAK2 is indicative of decreased relapse-free survival in the patient.
- the disclosure provides a method of predicting a clinical outcome in a patient with cancer, comprising determining whether NUAK2 and p- Akt (Ser473) are overexpressed in cancer cells or tumor; and wherein over-expression of both p-A t and NUAK2 is predictive of decreased relapse-free survival and overall survival in the patient.
- the cancer can be selected from but not limited to the group consisting of melanoma, breast cancer, non- small cell lung carcinoma, and hepatocellular carcinoma.
- the disclosure further provides a method of inhibiting cancer cell or tumor proliferation comprising administering a therapeutically effective amount of the polynucleotide to a patient in need thereof. Further, the disclosure provides a method of inhibiting cancer cell migration comprising administering a therapeutically effective amount of the polynucleotide to a patient in need thereof.
- the disclosure further provides a method for treating cancer comprising administering to a patient in need thereof a pharmaceutically effective amount of a CDK2 inhibitor, wherein it is determined that the cancer cells overexpress NUAK2.
- the disclosure provides a method of treatment for a patient with cancer comprising measuring the expression of NUAK2 in the cancer, determining the level of expression of NUAK2 compared to control, and treating the patient with a pharmaceutically effective amount of a CDK2 inhibitor, wherein it is determined that the cancer cells or tumor overexpress NUAK2.
- the disclosure provides for a kit for predicting clinical outcome in a patient with cancer comprising instructions comprising the method of correlating NUAK2 overexpression with clinical outcome.
- the kit may comprise an assay to determine NUAK2 expression levels.
- Fig. 1 shows the identification of genomic gains associated with tumor thickness
- the Y axis represents the log 2 ratio and the x axis represents each clone on chromosomes lq and 6p; an ideogram of those chromosomes corresponding to each clone is shown below the panel.
- the gray box above the chromosomal ideogram represents the chromosomal gain of lq in this case, (b) Chromosomal gains of lq and 6p in 33 acral melanomas. Chromosomal gains in each case are depicted by the vertical lines to the right of the chromosomal ideogram. The number of each case is shown above the corresponding vertical line. The tumor thickness of each case is shown below the corresponding vertical line.
- Fig. 2 identifies candidate genes within the lq32 locus
- Each circle represents mRNA expression levels and DNA copy numbers for each cell line.
- the filled circle indicates mRNA level and DNA copy number of C32 melanoma cells that have a gain within the lq32 locus; the open circles represent other melanoma cell lines,
- (c) Reduction % and the statistical significance of cell number analyses by knockdown with the siRNA smart pool against 6 candidate genes in C32 and in A375 melanoma cell lines are shown in the data table. Reductions of cell numbers by knockdown with the siRNA smart pool against NUAK2 in both cell lines are shown in the upper panel.
- Fig. 3 is the immunohistochemical analyses of PTEN, p-A t and NUAK2 expression and their significance on clinical outcome, (a) PTEN, p-A t and NUAK2 are over-expressed in the acral melanoma of case No. 23 and that staining was counted as strong (+3) (left upper panel). PTEN, p-Akt and NUAK2 are not expressed in the acral melanoma of case No. 24 and that staining was counted as negative (0) (left lower panel). PTEN, p-Akt and NUAK2 are weakly, over- or not expressed in the non-CSD melanoma of case No.
- Fig. 4 shows the knockdown of NUAK2 in C32 melanoma cells results in reduced proliferation
- FIG. 5 shows the knockdown of NUAK2 in C32 melanoma cells results in reduced migration and mTOR expression
- Fig. 6 shows the distribution of lq32 gain, PTEN hemizygous deletion and RP11- 243M13 gain in each subset of melanomas, and knockdown of NUAK2 by siRNA smart pool against NUAK2.
- Fig. 7 is NUAK2 expression and H&E hematoxylin and eosin staining.
- the image with low magnification at the bottom shows both the radial growth phase (left portion) and the vertical growth phase (right portion).
- the insets above show higher magnification images (X10) of areas indicated by arrows.
- Each upper inset shows NUAK2 staining and each lower inset shows H&E staining.
- Left insets show melanoma cells in the epidermal portion.
- Fig. 8 is analyses of over-expression of PTEN, p-Akt and NUAK2 in mucosal melanomas and in acral nevi.
- Fig. 9 is knockdown of NUAK2 in C32 cells and apoptosis.
- Fig. 10 is a schematic model for regulation of mTOR by both NUAK2 and PI3K pathway.
- Activation of NUAK2 by increased copy number and PI3K pathway by deletion of PTEN induces up-regulation of mTOR.
- Phosphorylation of Akt at Tyr308 can be blocked by NUAK2.
- Thick lines indicate pathways that might be predominantly regulated in melanoma cells with both NUAK2 amplification and PTEN deletion.
- Inactivation mutations of LKB1 gene underlie Peutz-Jeghers syndrome that have lentigines in palmoplantar- subungual- mucosal areas.
- Fig. 11 shows the specificity of PTEN, p-Akt and NUAK2 antibodies and the staining pattern of NUAK2 in normal skin,
- Real time PCR analysis shows the specific knockdown of NUAK2 expression using a Lentivirus carrying an shRNA targeting NUAK2 (shNUAK2) at the mRNA level; an empty vector (shEV) was used as the control (left).
- Immuno- blotting (middle) and immunohisto- chemical analysis shows the knockdown of NUAK2 expression in shNUAK2- infected cells (right); this result was obtained in 2 of 4 experiments,
- Immunoblotting shows that the corresponding bands of PTEN and p-A t are effectively reduced by the blocking peptides; ⁇ -actin was used as a loading control (left). Immunohistochemical analyses show that staining of PTEN and p-Akt are effectively blocked in the presence of blocking peptides (right), (c) Staining pattern of NUAK2 antibody in normal skin. Negative staining of keratinocytes and melanocytes in normal epidermis is shown (arrowheads indicate melanocytes). Strong staining was observed both in dark and in clear cells of eccrine glands and sebaceous cells of sebaceous glands.
- Fig. 12 illustrates CDK2 as an effective therapeutic target of NUAK2 amplified melanoma
- NUAK2 and CDK2 were highly-expressed, (e) Kapan-Meier survival analyses of over-expression of CDK2, NUAK2 and p-A t for relapse-free survival (upper) and overall survival (lower) in 67 cases of melanomas arising from palmoplantar-subungual-mucosal areas. P values are indicated in graphs.
- Fig. 13 shows Cyclin-dependent kinase inhibitor effectively suppresses tumor growth of NUAK2 amplified melanoma
- Fig. 14 shows inhibition of PI3K pathway by LY294002 increases p21CIP expression and reduces S-phase population in cell cycle profile
- Cell numbers expressing p21CIPl dramatically increased by inhibition of PI3K pathway
- (b) S-phase population in cell cycle profile is reduced by inhibition of PI3K pathway.
- Fig. 15 shows NUAK2 and PI3K pathway are independent excluding expression of /?-Akt(T308).
- Fig. 16 shows analysis of p27KIPl expression on clinical specimens. CDK2, p27KIP expression and H&E staining of case No.3. CDK2 and p27KIPl were over- expressed and counted as strong (+3).
- Fig. 17 shows knockdown of CDK2 by siCDK2 in C32 and mell8 melanoma cells
- ⁇ -actin was used as a loading control.
- CDK2 expression is suppressed by siCDK2 at 24 h, 48 h and 72 h in C32 melanoma cells
- ⁇ -actin was used as a loading control.
- CDK2 expression is suppressed by siCDK2 at 24 h, 48 h and 72 h in mell8 melanoma cells.
- Fig. 18 shows expression of NUAK2, PTEN, p-Akt, Akt and CDK2, and cell proliferation treated with Roscovitine in various melanoma cell lines
- ⁇ -actin was used as a loading control
- Fig. 19 shows cell cycle profile of C32 and mell8 melanoma cells treated with Roscovitine at 0, 5 and 25 ⁇ .
- compositions described herein include agents that limit or inhibit the cell cycling machinery by modulating or inhibiting CDK; these agents include inhibitors and/or modifiers of CDK function, including but not limited to Roscovitine. These agents are referred to herein as "CDK inhibitors".
- CDK inhibitors include two or more different signaling inhibitors.
- CDK inhibitors may include broad CDK inhibitors (compounds targeting a broad spectrum of CDKs, specific CDK inhibitors (compounds targeting a specific type of CDK) and multiple target inhibitors (compounds targeting CDKs as well as additional kinases such as VEGFR or PDGFR).
- the CDK inhibitors are known by those with skill in the art.
- compositions of the invention can include combinations of signaling inhibitors with other conventional cancer treatments, for example, compositions can include chemo therapeutic agents or other adjuvant therapies (for example tamoxifen).
- compositions having one or more signaling inhibitor(s) can be administered before, during, or after other conventional cancer therapies, for example, compositions herein can be administered between radiation treatments to a patient in need thereof.
- tumor is used to indicate a cancerous growth and can be considered interchangeable with the term “cancer.”
- treating means reversing, alleviating, inhibiting the progress of, or preventing the disorder or condition to which such term applies, or one or more symptoms of such disorder or condition.
- treatment refers to the act of treating as “treating” as defined immediately above.
- the inventors have determined that over-expression both of p-A t and of NUAK2 has a strong impact on the survival of melanoma patients, especially for those with acral melanomas. Over-expression of both p-A t and NUAK2 predicts poor clinical outcome of melanoma patients, especially for those with acral melanomas.
- NUAK2 has a significant impact on the proliferation and migration of melanoma cells and regulates mTOR expression. Over-expression of both p-A t and NUAK2 correlates with clinical outcome, especially for melanomas arising from palmoplantar-subungual- mucosal areas and, and that over-expression of both genes is suppressed in acral nevi. Over- expression of both p-Akt and NUAK2 reflects a distinct molecular subset of melanomas with poor clinical outcome, which metastasize quickly, and produce ulcerative and thicker tumors.
- NUAK2 which resides at lq32, predicts clinical outcome in patients with acral melanoma.
- To determine whether NUAK2 is a gene at the lq32 locus that predicts clinical outcome we performed immunohistochemistry and analyzed the clinical outcome using both univariate and multivariate analyses. These analyses were performed on 57 acral melanomas and 35 non-CSD melanomas (Fig. 2A, B).
- acral melanomas with over-expression of both p-Akt and NUAK2 have three distinctive clinical features: poor clinical outcome, ulcerative, and thicker tumors.
- Immunohistochemical analyses also revealed a striking difference between mucosal melanomas arising from the nasal cavity, oral cavity, sinus and esophagus or from anorectal or gynecological tissues.
- NUAK2 by shNUAK2 RNAs markedly increased cellular senescence (shown by positive staining with senescence-associated (3-galactosidase (SA-(3-gal)), significantly decreased the S-phase population of the cells and decreased levels of cyclin Dl, cyclin D3 and CDK2.
- SA-(3-gal) senescence-associated (3-galactosidase
- shNUAK2 had only a marginal effect on apoptosis.
- the migration of C32 cells was significantly impaired by knockdown of NUAK2.
- Examination of the effect of NUAK2 on various melanoma cell lines after confirmation of NUAK2 expression was performed showing that NUAK2 has a profound effect on apoptosis in melI8, A375 and SKMel28 melanoma cell lines.
- Tumor specimens We obtained 103 paraffin-embedded specimens of primary melanomas and 22 paraffin-embedded specimens of acral nevi from 3 institutions.
- Melanoma tissue microarrays that contain 21 mucosal melanomas (ME803) and 21 non-acral nevi (ME 1001) were purchased from US Biomax. This study was approved by the Tokyo Medical and Dental University Research Committee, the Osaka University Clinical Research
- Cell lines Normal human melanocytes and melanoma cell lines were cultured and maintained as previously described and know in the art.
- Melanoma cell lines used were C32, A375, A2058, Malme-3M, SKMel5, SKMel28, SKMel23, 586mel, mel2 and mell8.
- C32, A375, A2058, and Malme-3M cells were purchased from the American Type Culture Collection.
- SKMel5, SKMel28, SKMel23 and 586mel cells were kindly provided by the Surgery Branch, NCI/NIH, Bethesda, MD. mel2 and mell8 melanoma cells are as previously described and known in the art.
- CGH array data of primary melanomas were obtained from Series "GSE2631”. Data from 33 cases of acral melanomas, 34 cases of non-chronic sun-induced damage (CSD) melanomas, 28 cases of CSD melanomas and 15 cases of mucosal melanomas were examined. Clones with a log2 ratio value more than 0.25 were classified as "gain”. Chromosomal loci were estimated as "gained” when log2 values of three clones among four consecutive clones were more than 0.25. Genomic clones were estimated as "gained” when log2 value of the corresponding clone was more than 0.25.
- Genomic areas between two adjacent clones were also estimated as "gained” when log2 values of the two adjacent clones were more than 0.25 at the same time. Genomic clones were estimated as “deleted” when log2 value of the corresponding clone was less than -0.4. Correlations between each chromosomal gain, gain of each clone and tumor thickness were analyzed by the Mann- Whitney test. Correlations between gain of clone "RP11-243M13" and genetic aberrations of several melanoma-related genes were analyzed with the Student t test. Regression analysis was used to compare DNA copy number and mRNA expression level of each candidate gene.
- Human genomic DNA was used as a calibrator for DNA copy number analyses and the cDNA of HEMn-DP was used as a calibrator for mRNA expression level analyses.
- Conditions for PCR reactions were as follows: one cycle at 95°C for 10 min, 40 cycles at 95°C for 10 s, at 55°C for 12 s, and at 72°C for 10 s. Melting curve analyses confirmed that single products were amplified and agarose gel electrophoresis was also carried out to confirm that PCR products were of the predicted lengths.
- Primer sequences for each target used in the DNA copy number analyses are as follows: SOX13 forward 5- ATTGGTTGAGGACCATGTGC-3 and reverse 5- GCGAGCTGTCTCTCTCC AAA-3 ; MDM4 forward 5- TGTGTAAAGGCCTGGGTAGG-3 and reverse 5- AACCTCTAACTGCCCAGCAA-3; NUAK2 forward 5- C ACCCTTGC AG AG ATG ATG A- 3 and reverse 5- CCAGGGAATTGGATACATGG-3; ELK4 forward 5- CAGCTGCCCCAGATTTTATT-3 and reverse 5- GAATCTC AAATTGCCTTTGTC A-3 ; IKBKE forward 5-
- GTC A ATCCGG A AGG AC A A A A- 3 and reverse 5- TCACGATCTTGCTGCTGTTC-3; ELK4 forward 5- AGCCG AGCCCTC AG ATACTA- 3 and reverse 5-
- NUAK2 l against NUAK2 were produced in NCI-Frederick and C32, mel2, mell8, A375, Malme-3m, SKMel28 and SKMel23 melanoma cells were infected using protamine sulfate. Infected cells were then selected by puromycin. The knockdown of NUAK2 expression was confirmed at the mRNA level by real-time PCR analyses.
- SMARTpool siRNAs against CDK2 were purchased from Dharmacon.
- Lentiviral vectors carrying shRNA targeting NUAK2 (AAB66-F-6:
- the BD Falcon FluoroBlok 24-Multiwell Insert System was used for the migration assay. Cells were seeded at 5.0 x 10 4 cells/well in 24- well plates in triplicate and were labeled with calcein AM (Invitrogen). O.D. values were counted at 36 h after seeding using 1420 Multilabel Counter Victor3 (Perkin Elmer). Migration of C32 melanoma cells infected with shEV as a control was set at 100%, and cell counts were adjusted by the difference between proliferation of C32 cells infected with shEV and shNUAK2 at 36 h.
- SA- -gal staining was performed using a Senescence ⁇ -Galactosidase Staining Kit according to the manufacturer's protocol (Cell Signaling).
- Formalin-fixed, paraffin-embedded tissues on slides were dewaxed by two washes, 5 min each, with xylene. Tissues were rehydrated by a series of 3 min washes in 100%, 95%, 70%, 50% ethanol and a 5 min wash in distilled water. Antigen retrieval was performed by heating the slides at 95°C for 15 to 30 min in Antigen Unmasking Solution (Vector Laboratories). Endogenous peroxidase activity was blocked by treatment with 3% hydrogen peroxide for 15 min.
- the tissues were incubated with a rabbit monoclonal anti-PTEN antibody (1: 100, Cell Signaling), a rabbit monoclonal anti-phospho(Ser473) of Akt antibody (1:25, Cell Signaling) a rabbit monoclonal anti-p27KIPl antibody (1: 100, Abeam), a rabbit polyclonal anti-CDK2 antibody (1:2000; Santa Cruz Biotechnology) or a rabbit polyclonal anti-NUAK2 antibody (1: 100, Proteintech Group) at 4°C overnight.
- the tissues were then incubated with a biotin-labeled secondary antibody and then with avidin-peroxidase for 30 min each (Vector Laboratories).
- the slides were then developed with a Vector VIP Substrate Kit (Vector Laboratories) and were counterstained with HematoxylinQS (Vector Laboratories). The slides were then dehydrated following a standard procedure, and were sealed with coverslips. Immuno staining of p-Akt and NUAK2 were performed as described. In immuno staining of CDK2 and p27KIPl, staining was developed with a Vector VIP Substrate Kit (Vector Laboratories) in pigmented melanoma or with a Vector DAB Substrate Kit (Vector Laboratories) using counter- staining in non-pigmented melanoma.
- Immunohistochemistry using fluorescence was performed as previously described and known in the art.
- the antibody used was a rabbit anti-p21CIPl monoclonal antibody (1: 100, Cell Signaling). Images were captured using a Leica DMR B/D MLD fluorescence microscope (Leica, Weltzar, Germany) and a Dage-MTI 3CCD 3-chip color video camera (Dage-MTI, Michigan City, IN, USA).
- genomic loci from 193.52 Mb (D1S2794, clone ID: RP11- 154A22) to 208.18 Mb (D1S205, clone ID: RP11- 104A2) within the lq32 locus, since that locus includes most of the genomic gained clones within the lq32 locus.
- those correlations existed in only one subset of melanomas (acral).
- analyses of the public array CGH database suggest that a putative oncogene resides in a genomic locus around clone "RP11-243M13".
- Thickness was coded as 1, ⁇ 1.0mm; 2, 1.01 to 2.00mm; 3, 2.01 to 4.00mm; 4, >4.00mm.
- Over-expression of NUAK2, and both NUAK2 and phospho-Akt (p-Akt) was coded as 1, negative; 2, positive.
- Age was coded as 1, ⁇ 60 years; 2, >60 years. *P ⁇ 0.05; **P ⁇ 0.01.
- TNM classification and clinical stage are according to the melanoma staging system of the American Joint Committee on Cancer.
- Expression of PTEN, p-Akt and NUAK2 are estimated with 4 histopathological scores of 0, +1, +2 and +3. a + after survival indicates that the patient is alive.
- DOD died of disease
- CCR continuous complete remission
- CR-R complete remission followed by relapse
- CR-R-CR complete remission followed by relapse and subsequent complete remission
- RS relapse free survival
- OS overall survival
- Genomic gain or amplification of oncogenes increases DNA copy number, up- regulates transcriptional levels of mRNA and then promotes the proliferation of cancer cells.
- We examined 6 candidate oncogenes SOX13, MDM4, NUAK2, ELK4, IKBKE and
- MAPKAPK2 within the lq32 locus spanning approximately 5.0 Mb (from 200.45 Mb; RP11-246J15 to 205.86 Mb; RP11-57117), where the most strongly correlated clone (RP11- 243M13) resided in the center.
- PCR quantitative polymerase chain reaction
- NUAK2 is the most promising gene within the lq32 locus.
- NUAK2 is the gene at the lq32 locus that predicts clinical outcome.
- over-expression of both p-Akt and NUAK2 is an independent prognostic factor for relapse-free survival of patients with acral melanomas.
- mTOR is regulated differently by AMPK-related kinases in benign and in malignant neoplasms of melanocytic cells.
- AMPK-related kinases in benign and in malignant neoplasms of melanocytic cells.
- Roscovitine to determine what concentration range has efficacy to suppress cell proliferation.
- C32 melanoma cells were quite sensitive to Roscovitine and their proliferation was significantly reduced at doses greater than 5 ⁇ , whereas more than a 10 ⁇ concentration was required to suppress the proliferation of mell8 melanoma cells (Fig. 13a).
- Roscovitine treatment at 5 ⁇ significantly reduced colony growth of C32 melanoma cells compared to mell8 melanoma cells (Fig. 13b and Fig.18).
- Cell cycle profile analyses showed that the S-phase population of C32 melanoma cells treated with Roscovitine at 5 ⁇ was significantly reduced from 6.9% to 1.8% (P ⁇ 0.0001) (Fig. 19).
- CDK2 is an effective molecular target for the treatment of NUAK2 highly-expressed and PI3K pathway activated melanomas.
- a CDK2 inhibitor such as, but not limited to Roscovitine, to reduce cell proliferation and/or delay tumor growth, and/or treat melanoma in a patient in need thereof.
- CDK2 inhibitor such as, but not limited to Roscovitine
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Pharmacology & Pharmacy (AREA)
- Urology & Nephrology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Hematology (AREA)
- Biophysics (AREA)
- Cell Biology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Epidemiology (AREA)
- Virology (AREA)
- Food Science & Technology (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
shRNA expression vectors (lentiviral vectors) are developed which reduce the proliferation of acral melanoma. Gene therapy using NUAK2 shRNAs are used to reduce melanoma cell growth and metastasis. A prediction of clinical outcome in a patient with melanoma based on expression of NUAK2 and p-AKT is disclosed. The use of CDK inhibitors to suppress cell proliferation of melanoma cells with NUAK2 overexpression by targeting signaling pathways downstream of NUAK2 is disclosed.
Description
DIAGNOSIS AND TREATMENT OF MELANOMA THROUGH NUAK2 ASSESSMENT AND MODULATION
RELATED APPLICATIONS
[0001] This application claims priority to US Application No. 61/321,136 filed April 6, 2010, which is incorporated herein by reference in its entirety.
TECHNICAL FIELD
[0002] The present disclosure generally relates to methods and compositions for modulating NUAK2 signaling in tumor cells, and in one embodiment, assessing and modulating NUAK2 in melanoma tumor cells. In an alternate embodiment, the melanoma is acral melanoma. Assessment and modulation of NUAK2 signaling in tumor cells is useful for diagnosis and treatment of melanoma, in one embodiment acral melanoma, under a variety of clinical settings.
BACKGROUND
[0003] Melanoma is a malignancy of melanocytes found predominantly in the skin, but also found in the eyes, ears, gastro-intestinal tract, leptomeninges, and oral and genital mucous membranes. Four major histogenetic subtypes of primary cutaneous melanoma have been identified. These include superficial spreading melanoma, nodular melanoma, lentigo maligna melanoma, and acral lentiginous melanoma. Distinction among these subtypes includes histologic growth pattern, anatomic site, and degree of sun damage. Molecular analysis has demonstrated different patterns of cell death, oncogene expression, gene amplification, and BRAF mutation frequency among the 4 main histogenetic types of melanoma. (Miracco C, Santopietro R, Biagioli M, et al. Different patterns of cell proliferation and death and oncogene expression in cutaneous malignant melanoma. / Cutan Pathol. May 1998;25(5):244-51., Bastian BC, Kashani-Sabet M, Hamm H, et al. Gene amplifications characterize acral melanoma and permit the detection of occult tumor cells in the surrounding skin. Cancer Res. Apr 1 2000;60(7): 1968-73., Sasaki Y, Niu C, Makino R, et al. BRAF point mutations in primary melanoma show different prevalences by subtype. / Invest Dermatol. Jul 2004;123(l): 177-83.) Melanoma accounts for only 4% of all skin
cancers; however, it causes the greatest number of skin cancer-related deaths worldwide. In the last several decades, acral melanomas have become a significant health problem, with the incidence of acral melanomas increasing amongst Hispanic and Asian populations.
[0004] The present invention relates to diagnosis and novel therapeutic targets aimed to control melanoma, in one embodiment, aggressive acral melanoma, via regulation and recognition of the expression of the NUAK2 gene.
SUMMARY
[0005] Methods, compositions and kits are provided for determining expression levels of NUAK2, modulating the expression of NUAK2, and predicting the outcome and treatment for a patient with melanoma following determination of expression levels of NUAK2 in acral melanomas. The term "modulating" indicates some limitation of the targeted activity, e.g. inhibiting the CDK2 signaling pathway.
[0006] The disclosure teaches diagnosis and novel therapeutic targets aimed to control aggressive acral melanoma via regulation of the NUAK2 gene. Gain of UA 2 and deletion of PTEN strongly correlates with tumor thickness in acral melanomas. The over expression of both NUAK2 and phosphor- Akt at Ser473 (p-Akt), which is activated by reduced function of PTEN, strongly correlates with prognosis of patients with acral melanoma. Furthermore, acral melanomas over expressing both genes have three distinct clinical features:
aggressiveness, higher age of onset, and thicker tumors. NUAK2 is a suitable target of therapies for acral melanoma with aggressive behavior by knockdown using shRNA constructs. As shRNA carriers against the NUAK2 gene, these vectors act as therapeutic inhibitors to reduce the proliferation of acral melanoma cells.
[0007] In one embodiment, the disclosure provides a polynucleotide comprising a region encoding an shRNA against the NUAK2 gene. The polynucleotide may be operably inserted into a lentiviral vector or an adenoviral vector. The disclosure further provides a method of inhibiting melanoma (in one embodiment acral melanoma) cell proliferation comprising administering a therapeutically effective amount of the polynucleotide to a patient in need thereof. Further, the disclosure provides a method of inhibiting melanoma (in one
embodiment acral melanoma) cell migration comprising administering a therapeutically effective amount of the polynucleotide to a patient in need thereof. The disclosure further
provides a method for treating melanoma comprising administering to a patient in need thereof a pharmaceutically effective amount of a CDK2 inhibitor, wherein it is determined that the melanoma cells overexpress NUAK2. In one embodiment, the disclosure provides a method of treatment for a patient with melanoma comprising measuring the expression of NUAK2 in the melanoma, determining the level of expression of NUAK2 compared to control, and treating the patient with a pharmaceutically effective amount of a CDK2 inhibitor, wherein it is determined that the melanoma cells overexpress NUAK2.
[0008] The disclosure further provides a method of predicting a clinical outcome in a patient with melanoma (in one embodiment, acral melanoma) comprising determining whether NUAK2 is overexpressed in melanoma (in one embodiment, acral melanoma); wherein over-expression of NUAK2 is indicative of decreased relapse-free survival in the patient. In one embodiment, the disclosure provides a method of predicting a clinical outcome in a patient with melanoma, comprising determining whether NUAK2 and p-Akt (Ser473) are overexpressed in a melanoma; and wherein over-expression of both p-A t and NUAK2 is predictive of decreased relapse-free survival and overall survival in the patient. The melanoma can be selected from the group consisting of an acral melanoma, a mucosal melanoma, and metastatic melanoma. In one embodiment, the disclosure provides a method of diagnosis for clinical outcome for melanoma in a subject comprising measuring the expression of NUAK2 in the melanoma, determining the level of expression of NUAK2 compared to control, and correlating the level of expression with decreased relapse-free survival and overall survival in the patient. Further, the disclosure provides for a kit for predicting clinical outcome in a patient with melanoma (in one embodiment acral melanoma) comprising instructions comprising the method of correlating NUAK2 overexpression with clinical outcome. The kit may comprise an assay to determine NUAK2 expression levels.
[0009] The disclosure further provides a method of predicting a clinical outcome in a patient with cancer comprising determining whether NUAK2 is overexpressed in the cancer cells, or tumor; wherein over-expression of NUAK2 is indicative of decreased relapse-free survival in the patient. In one embodiment, the disclosure provides a method of predicting a clinical outcome in a patient with cancer, comprising determining whether NUAK2 and p- Akt (Ser473) are overexpressed in cancer cells or tumor; and wherein over-expression of both p-A t and NUAK2 is predictive of decreased relapse-free survival and overall survival
in the patient. The cancer can be selected from but not limited to the group consisting of melanoma, breast cancer, non- small cell lung carcinoma, and hepatocellular carcinoma. The disclosure further provides a method of inhibiting cancer cell or tumor proliferation comprising administering a therapeutically effective amount of the polynucleotide to a patient in need thereof. Further, the disclosure provides a method of inhibiting cancer cell migration comprising administering a therapeutically effective amount of the polynucleotide to a patient in need thereof. The disclosure further provides a method for treating cancer comprising administering to a patient in need thereof a pharmaceutically effective amount of a CDK2 inhibitor, wherein it is determined that the cancer cells overexpress NUAK2. In one embodiment, the disclosure provides a method of treatment for a patient with cancer comprising measuring the expression of NUAK2 in the cancer, determining the level of expression of NUAK2 compared to control, and treating the patient with a pharmaceutically effective amount of a CDK2 inhibitor, wherein it is determined that the cancer cells or tumor overexpress NUAK2. Further, the disclosure provides for a kit for predicting clinical outcome in a patient with cancer comprising instructions comprising the method of correlating NUAK2 overexpression with clinical outcome. The kit may comprise an assay to determine NUAK2 expression levels.
BRIEF DESCRIPTION OF THE DRAWINGS
[0010] Fig. 1 shows the identification of genomic gains associated with tumor thickness, (a) Analysis of chromosomal gains of lq and 6p from the array CGH database in acral melanomas (Case No. 20). Each spot represents the log 2 ratio value of each clone from the array CGH database. Thresholds for gain are shown with the horizontal dashed line at log 2 ratios of 0.25. The Y axis represents the log 2 ratio and the x axis represents each clone on chromosomes lq and 6p; an ideogram of those chromosomes corresponding to each clone is shown below the panel. The gray box above the chromosomal ideogram represents the chromosomal gain of lq in this case, (b) Chromosomal gains of lq and 6p in 33 acral melanomas. Chromosomal gains in each case are depicted by the vertical lines to the right of the chromosomal ideogram. The number of each case is shown above the corresponding vertical line. The tumor thickness of each case is shown below the corresponding vertical line. The most frequent 4 regions (lq21-23, lq32, 6p23-25 and 6p21) of chromosomal gains
of lq and 6p are depicted to the left of the chromosome ideogram, (c) Gain of each genomic clone within the lq32 locus in 33 acral melanomas. Each filled circle represents a genomic clone with a log2 ratio value more than 0.25, and each open circle represents a genomic clone that gives no information. Vertical lines represent genomic areas with log2 ratio of both flanking clones being more than 0.25.
[0011] Fig. 2 identifies candidate genes within the lq32 locus, (a) Six candidate genes and correlations between genomic clones and tumor thickness in each subset of melanoma. The locus spanning approximately 5.0 Mb, where the strongest correlated clone with tumor thickness (RP11-243M13) is located in the center, is shown and 6 candidate genes are located in this locus. Filled circles represent genomic clones with P values of less than 0.05 and open circles represent genomic clones with P values of less than 0.01 in each subset of melanoma, (b) Results of regression analyses of mRNA expression levels and DNA copy numbers obtained by real-time PCR analyses of 6 candidate oncogenes within the lq32 locus are shown in the data table. Regression analysis of NUAK2 that has the strongest correlation among the 6 candidate oncogenes is shown in the upper panel. Each circle represents mRNA expression levels and DNA copy numbers for each cell line. The filled circle indicates mRNA level and DNA copy number of C32 melanoma cells that have a gain within the lq32 locus; the open circles represent other melanoma cell lines, (c) Reduction % and the statistical significance of cell number analyses by knockdown with the siRNA smart pool against 6 candidate genes in C32 and in A375 melanoma cell lines are shown in the data table. Reductions of cell numbers by knockdown with the siRNA smart pool against NUAK2 in both cell lines are shown in the upper panel.
[0012] Fig. 3 is the immunohistochemical analyses of PTEN, p-A t and NUAK2 expression and their significance on clinical outcome, (a) PTEN, p-A t and NUAK2 are over-expressed in the acral melanoma of case No. 23 and that staining was counted as strong (+3) (left upper panel). PTEN, p-Akt and NUAK2 are not expressed in the acral melanoma of case No. 24 and that staining was counted as negative (0) (left lower panel). PTEN, p-Akt and NUAK2 are weakly, over- or not expressed in the non-CSD melanoma of case No. 60, respectively, and those stainings were counted as (+1), (+3) and (0), respectively (right panel), (b) Kaplan-Meier survival analyses of over-expression of NUAK2 for relapse-free survival in 57 cases of acral melanoma (left) and in 35 cases of non-CSD melanoma (right).
(c) Kaplan-Meier survival analyses of over-expression of NUAK2 for overall survival in 57 cases of acral melanomas (left) and in 35 cases of non-CSD melanomas (right), (d) Kaplan- Meier survival analyses of over-expression of both p-A t and NUAK2 for relapse-free survival in 57 cases of acral melanoma (left) and in 35 cases of non-CSD melanoma (right), (e) Kaplan-Meier survival analyses of over-expression of both p-A t and NUAK2 for overall survival in 57 cases of acral melanoma (left) and 35 cases of non-CSD melanoma (right), (f) Kaplan-Meier survival analyses of over-expression of both NUAK2 and p-A t for relapse- free survival (left) and overall survival (right) in 68 cases of melanomas arising from palmoplantar-subungual-mucosal areas. P values are indicated in all graphs.
[0013] Fig. 4 shows the knockdown of NUAK2 in C32 melanoma cells results in reduced proliferation, (a) Cell number analysis of C32 melanoma cells with knockdown of NUAK2, which dramatically reduced cell proliferation, (b) Tumor growth of C32 melanoma cells infected with shNUAK2 relative to shEV in nude mice; tumor growth was significantly suppressed by infection of shNUAK2 compared to the control, (c) Senescence-associated β- galactosidase (SA- -gal) staining in C32 melanoma cells. Microscopic images using phase contrast (upper panel) and bright field (lower panel) are shown. Staining indicates senescent cells. Percentages of positive cells and + SE values are depicted below the images, (d) Cell cycle profiles of C32 melanoma cells following knockdown of NUAK2; a significant decrease of the S-phase population in cell cycle profiles are observed, (e) Immunoblotting showing expression of CDK1, CDK2, CDK4, CDK6, cyclinDl, cyclinD3 and cyclinE; β- actin was used as a loading control. Knockdown of NUAK2 decreases cyclinDl, cyclinD3 and CDK2 expression level in C32 melanoma cells.
[0014] Fig. 5 shows the knockdown of NUAK2 in C32 melanoma cells results in reduced migration and mTOR expression, (a) Migration of C32 melanoma cells following
knockdown of NUAK2, which significantly decreased their migration; the P value is indicated, (b) Knockdown of NUAK2 by shNUAK2 significantly decreased expression of mTOR and increased expression of Akt and p-Akt (T308). (c) Inhibition of the PI3K pathway by Ly294002 significantly decreased expression of mTOR; β-actin was used as a loading control.
[0015] Fig. 6 shows the distribution of lq32 gain, PTEN hemizygous deletion and RP11- 243M13 gain in each subset of melanomas, and knockdown of NUAK2 by siRNA smart pool
against NUAK2. (a) Percentages of lq32 gain in the 4 subsets of melanoma are shown in the upper panel. Correlations with tumor thickness in each subset of melanoma are shown in the data table at the bottom. A correlation was not available (NA) for mucosal melanomas due to an insufficient number of cases in the lq32 gain negative group, (b) Percentage of cases with gain of clone "RP11-243M13" and PTEN hemizygous deletion in each subset of melanoma. Cases with only a hemizygous deletion of PTEN and with only a gain of clone "RP11- 243M13" are depicted as yellow and blue rectangles, respectively. Cases with both a hemizygous deletion of PTEN and a gain of clone "RP11-243M13" are depicted as red rectangles, (c) Knockdown of NUAK2 expression by transfection with either a non-targeting siRNA (siNT) or an siRNA smart pool against NUAK2 (siNUAK2) in C32 and in A375 cells. Knockdown of NUAK2 expression by the siRNA smart pool against NUAK2 in both cell lines is shown.
[0016] Fig. 7 is NUAK2 expression and H&E hematoxylin and eosin staining. The image with low magnification at the bottom shows both the radial growth phase (left portion) and the vertical growth phase (right portion). The insets above show higher magnification images (X10) of areas indicated by arrows. Each upper inset shows NUAK2 staining and each lower inset shows H&E staining. Left insets show melanoma cells in the epidermal portion.
Individual melanoma cells, which are cast off to the outer cornified layer, over-express NUAK2. Middle insets show that melanoma cells form nests and invade into the deep dermis, and also express NUAK2 at significant levels. Right insets show that melanoma cells in the upper dermis over-express NUAK2. Bar indicates 1 cm.
[0017] Fig. 8 is analyses of over-expression of PTEN, p-Akt and NUAK2 in mucosal melanomas and in acral nevi. (a) Over-expression of PTEN, p-A t and NUAK2 in mucosal melanomas was analyzed by immunohisto- chemistry. PTEN, p-A t and NUAK2 were over- expressed in the mucosal melanoma of case No. 102 and these three stainings were scored as strong (+3). (b) Over-expression of PTEN, p-Akt and NUAK2 in acral nevi was analyzed by immunohistochemistry. PTEN was over-expressed, and p-Akt and NUAK2 were not expressed in the acral nevus of case No. 145. These three stainings were scored as +3, 0, and 0, respectively.
[0018] Fig. 9 is knockdown of NUAK2 in C32 cells and apoptosis. (a) Knockdown of NUAK2 has a slight effect on pre-Gl phase population in C32 cells, (b) Immunoblotting shows no cleaved caspase-3 or PARP with knockdown of NUAK2 in C32 cells.
[0019] Fig. 10 is a schematic model for regulation of mTOR by both NUAK2 and PI3K pathway. Activation of NUAK2 by increased copy number and PI3K pathway by deletion of PTEN induces up-regulation of mTOR. Phosphorylation of Akt at Tyr308 can be blocked by NUAK2. Thick lines indicate pathways that might be predominantly regulated in melanoma cells with both NUAK2 amplification and PTEN deletion. Inactivation mutations of LKB1 gene underlie Peutz-Jeghers syndrome that have lentigines in palmoplantar- subungual- mucosal areas.
[0020] Fig. 11 shows the specificity of PTEN, p-Akt and NUAK2 antibodies and the staining pattern of NUAK2 in normal skin, (a) Specificity of the NUAK2 antibody. Real time PCR analysis shows the specific knockdown of NUAK2 expression using a Lentivirus carrying an shRNA targeting NUAK2 (shNUAK2) at the mRNA level; an empty vector (shEV) was used as the control (left). Immuno- blotting (middle) and immunohisto- chemical analysis (right) shows the knockdown of NUAK2 expression in shNUAK2- infected cells (right); this result was obtained in 2 of 4 experiments, (b) Specificity of PTEN and p-A t antibodies. Immunoblotting shows that the corresponding bands of PTEN and p-A t are effectively reduced by the blocking peptides; β-actin was used as a loading control (left). Immunohistochemical analyses show that staining of PTEN and p-Akt are effectively blocked in the presence of blocking peptides (right), (c) Staining pattern of NUAK2 antibody in normal skin. Negative staining of keratinocytes and melanocytes in normal epidermis is shown (arrowheads indicate melanocytes). Strong staining was observed both in dark and in clear cells of eccrine glands and sebaceous cells of sebaceous glands.
[0021] Fig. 12 illustrates CDK2 as an effective therapeutic target of NUAK2 amplified melanoma, (a) Immunoblotting showing expression of CDK2, p21 and p27 by knockdown of NUAK2. Knockdown of NUAK2 decreases CDK2 expression level and increase p27 expression level, (b) Inhibition of PI3K pathway by LY294002 decreases CDK2 expression level and increase p21 expression level, (c) Cell number analysis of C32 and mell8 melanoma cells with knockdown of CDK2. Knockdown of CDK2 reduced cell proliferation only in C32 melanoma cells, (d) NUAK2, CDK2 expression and H&E staining of case
No.26. NUAK2 and CDK2 were highly-expressed, (e) Kapan-Meier survival analyses of over-expression of CDK2, NUAK2 and p-A t for relapse-free survival (upper) and overall survival (lower) in 67 cases of melanomas arising from palmoplantar-subungual-mucosal areas. P values are indicated in graphs.
[0022] Fig. 13 shows Cyclin-dependent kinase inhibitor effectively suppresses tumor growth of NUAK2 amplified melanoma, (a) Sensitivity of C32 and mell8 melanoma cells to Roscovitine. Short-term cell number analyses showed growth of C32 cells is suppressed by Roscovitine at the dose range of less than ΙΟμΜ. (b) Cell proliferation assay showed that growth of C32 cells is efficiently suppressed by Roscovitine at 5μΜ compared to a slight suppression of mell8 cells at the same dosage, (c) Suppression of tumor growth in mice by Roscovitine. Tumor growth of C32 melanoma cells was suppressed by oral administration of Roscovitine (left). Tumor growth of mell8 melanoma cells was not suppressed (right).
[0023] Fig. 14 shows inhibition of PI3K pathway by LY294002 increases p21CIP expression and reduces S-phase population in cell cycle profile, (a) Immunohistochemistry showing expression of p21CIPl by inhibition of PI3K pathway by LY294002. Cell numbers expressing p21CIPl dramatically increased by inhibition of PI3K pathway, (b) S-phase population in cell cycle profile is reduced by inhibition of PI3K pathway.
[0024] Fig. 15 shows NUAK2 and PI3K pathway are independent excluding expression of /?-Akt(T308). (a) Immunoblotting showing expression of NUAK2 by knockdown of PTEN. β-actin was used as a loading control. Knockdown of PTEN by siPTEN did not affect on expression of NUAK2. (b) Immunoblotting showing expression of PTEN, Akt and phosphor- Akt by knockdown of NUAK2. β-actin was used as a loading control. Knockdown of NUAK2 by shNUAK2 increased expression of Akt and /?-Akt(T308), and did not affect on expression of /?-Akt(S473).
[0025] Fig. 16 shows analysis of p27KIPl expression on clinical specimens. CDK2, p27KIP expression and H&E staining of case No.3. CDK2 and p27KIPl were over- expressed and counted as strong (+3).
[0026] Fig. 17 shows knockdown of CDK2 by siCDK2 in C32 and mell8 melanoma cells, (a) Immunoblotting showing expression of CDK2. β-actin was used as a loading control. CDK2 expression is suppressed by siCDK2 at 24 h, 48 h and 72 h in C32 melanoma cells, (b) Immunoblotting showing expression of CDK2. β-actin was used as a loading
control. CDK2 expression is suppressed by siCDK2 at 24 h, 48 h and 72 h in mell8 melanoma cells.
[0027] Fig. 18 shows expression of NUAK2, PTEN, p-Akt, Akt and CDK2, and cell proliferation treated with Roscovitine in various melanoma cell lines, (a) Immunoblotting showing expression of NUAK2, PTEN, p-Akt, Akt and CDK2. β-actin was used as a loading control, (b) Cell proliferation assay treated with Roscovitine at 0, 5 and 25 μΜ in mel2, A375, SKMel28 and SKMel23 melanoma cells.
[0028] Fig. 19 shows cell cycle profile of C32 and mell8 melanoma cells treated with Roscovitine at 0, 5 and 25 μΜ. (a) S-phase population is significantly reduced with the treatment of Roscovitine at 5 μΜ in C32 melanoma cells, (b) S-phase population is not changed with the treatment of Roscovitine at 5 μΜ in mell8 melanoma cells.
DETAILED DESCRIPTION
[0029] Unless otherwise indicated, all numbers expressing quantities of ingredients, dimensions reaction conditions and so forth used in the specification and claims are to be understood as being modified in all instances by the term "about".
[0030] In this application and the claims, the use of the singular includes the plural unless specifically stated otherwise. In addition, use of "or" means "and/or" unless stated otherwise. Moreover, the use of the term "including", as well as other forms, such as "includes" and "included", is not limiting. Also, terms such as "element" or "component" encompass both elements and components comprising one unit and elements and
components that comprise more than one unit unless specifically stated otherwise.
[0031] Compositions described herein include agents that limit or inhibit the cell cycling machinery by modulating or inhibiting CDK; these agents include inhibitors and/or modifiers of CDK function, including but not limited to Roscovitine. These agents are referred to herein as "CDK inhibitors". In some cases, compositions herein include two or more different signaling inhibitors. CDK inhibitors may include broad CDK inhibitors (compounds targeting a broad spectrum of CDKs, specific CDK inhibitors (compounds targeting a specific type of CDK) and multiple target inhibitors (compounds targeting CDKs as well as additional kinases such as VEGFR or PDGFR). The CDK inhibitors are known by those with skill in the art.
[0032] Compositions of the invention can include combinations of signaling inhibitors with other conventional cancer treatments, for example, compositions can include chemo therapeutic agents or other adjuvant therapies (for example tamoxifen). In addition, compositions having one or more signaling inhibitor(s) can be administered before, during, or after other conventional cancer therapies, for example, compositions herein can be administered between radiation treatments to a patient in need thereof.
[0033] For purposes of the present disclosure the term "tumor" is used to indicate a cancerous growth and can be considered interchangeable with the term "cancer."
[0034] The term "treating", as used herein, unless otherwise indicated, means reversing, alleviating, inhibiting the progress of, or preventing the disorder or condition to which such term applies, or one or more symptoms of such disorder or condition. The term "treatment", as used herein, unless otherwise indicated, refers to the act of treating as "treating" as defined immediately above.
[0035] The inventors have determined that over-expression both of p-A t and of NUAK2 has a strong impact on the survival of melanoma patients, especially for those with acral melanomas. Over-expression of both p-A t and NUAK2 predicts poor clinical outcome of melanoma patients, especially for those with acral melanomas.
Table 1 Multivariate Cox regression analysis of over-expression of NUAK2 with or without /7-Akt for relapse-free survival of acral melanoma patients
NUAK2 NUAK2 + p-Akt
Variable* Hazard 95% CI P-value Variable* Hazard 95% CI P-value
Ratio Ratio
NUAK2 3.27 1.14 to 9.39 0.027* NUAK2 + p-Akt 3.83 1.37 to 10.66 0.01*
Thickness 1.89 1.13 to 3.14 0.015* Thickness 1.85 1.09 to 3.13 0.022*
Ulceration 1.47 0.55 to 3.93 0.45 Ulceration 1.39 0.52 to 3.70 11111111111
Age 1.12 0.44 to 2.88 0.81 Age 1.05 0.41 to 2.69 0.92
*Coding of variables: Thickness coded as: 1=<1.0 mm; 2=1.01-2.00 mm; 3=2.01-4.00 mm; 4=>4.00 mm. Over-expression of NUAK2 and both NUAK2 and p-Akt coded as: l=negative; 2=positive. Ulceration coded as: l=absent; 2=present. Age coded as: 1=<60 years; 2=>60 years. *=P<0.05.
[0036] NUAK2 has a significant impact on the proliferation and migration of melanoma cells and regulates mTOR expression. Over-expression of both p-A t and NUAK2 correlates with clinical outcome, especially for melanomas arising from palmoplantar-subungual- mucosal areas and, and that over-expression of both genes is suppressed in acral nevi. Over- expression of both p-Akt and NUAK2 reflects a distinct molecular subset of melanomas with poor clinical outcome, which metastasize quickly, and produce ulcerative and thicker tumors. Over-expression of both p-A t and NUAK2 is a stronger prognostic indicator than Breslow's tumor thickness and is thus an independent prognostic factor for melanomas. The disclosure teaches the crucial role of AMPK-related kinases in cancer development and tumor progression, the integration of molecular classification into prognostic prediction and the choice of therapeutic modalities.
[0037] Over-expression of NUAK2, which resides at lq32, predicts clinical outcome in patients with acral melanoma. To determine whether NUAK2 is a gene at the lq32 locus that predicts clinical outcome, we performed immunohistochemistry and analyzed the clinical outcome using both univariate and multivariate analyses. These analyses were performed on 57 acral melanomas and 35 non-CSD melanomas (Fig. 2A, B). Over-expression of NUAK2 decreased relapse-free survival for acral melanomas (p=0.006), and was associated with tumor thickness and ulceration in acral melanomas (P=0.003 and P=0.03, respectively) (Fig. 2C, D and Table 1). Multivariate Cox regression analysis also showed that over-expression
of NUAK2 decreases relapse-free survival in acral melanomas (hazard ratio, 3.27; P = 0.03) (Table 2). Thus, these analyses suggest that NUAK2 is a gene at chromosome lq32 that has an impact on relapse-free survival in patients with acral melanomas.
Table 2 Comparison of tumor thickness and each chromosomal gain.
*P < 0.05; **P < 0.01; *** inverse correlation
[0038] Over-expression of both NUAK2 and p-Akt (Ser473) is an independent prognostic factor for relapse-free survival in patients with acral melanoma. Deletion of the PTEN gene is tightly correlated with the gain of "RP11-243M13" in the public array CGH database. Analysis of expression of PTEN and p-Akt (Phosphorylated at Ser473) by
immunohistochemistry is shown in Fig. 2A. Analyses by immunoblotting and by
immunohistochemistry of C32 and of Malme-3M cells showed that PTEN and p-Akt staining were correlated inversely as expected. Survival analyses by the Kaplan-Meier method showed that only over-expression of p-Akt weakly decreased relapse-free survival in acral melanomas (p=0.07). Over-expression of both p-Akt and, NUAK2 was examined, and a close correlations with thickness (p=0.001) and ulceration (P=0.03) in acral melanomas was found.
[0039] Survival analyses by the Kaplan-Meier method showed a significant decreased relapse-free survival (P<0.001) and overall survival (P=0.03) in acral melanomas. To exclude the possibility of the impact of tumor thickness on relapse-free survival, survival analysis of cases with only thicker acral melanomas was performed (the pT4 stage) and showed that over-expression of both p-Akt and NUAK2 decreased relapse-free survival for acral melanomas in the pT4 stage (P=0.01). Multivariate Cox regression analysis showed that over-expression of both p-Akt and NUAK2 decreases relapse-free survival in acral
melanomas (hazard ratio, 3.83; P=0.01), and that the statistical significance is stronger than that of the tumor thickness (hazard ratio, 1.85; P=0.02). Thus, over-expression of both p-Akt and NUAK2 is an independent prognostic factor for relapse-free survival in acral
melanomas. In other words, acral melanomas with over-expression of both p-Akt and NUAK2 have three distinctive clinical features: poor clinical outcome, ulcerative, and thicker tumors.
[0040] Over-expression of both NUAK2 and p-Akt (Ser473) in mucosal melanomas. Analysis of the impact of over-expression of both p-Akt and NUAK2 on the survival of patients with melanomas arising from these areas using 57 cases of acral melanoma and 11 cases of mucosal melanoma with survival information was performed. Survival analyses by the Kaplan-Meier method showed that over-expression of NUAK2, and both p-Akt and NUAK2, decreased relapse-free survival (P<0.001 and P<0.001 respectively) and overall survival (p=0.007 and P=0.002, respectively). Multivariate Cox regression analysis showed a significant decreased relapse-free survival (hazard ratio, 3.81; P=0.008 and hazard ratio, 4.61; P=0.002, respectively), and a decreased overall survival (hazard ratio, 3.09; P=0.05 and hazard ratio, 3.60; P=0.02, respectively). Immunohistochemical analyses also revealed a striking difference between mucosal melanomas arising from the nasal cavity, oral cavity, sinus and esophagus or from anorectal or gynecological tissues.
[0041] Knockdown of NUAK2 using a Lentivirus containing shRNA targeting NUAK2 (shNUAK2) caused a significant decrease in cell number. In addition, knockdown of
NUAK2 by shNUAK2 RNAs markedly increased cellular senescence (shown by positive staining with senescence-associated (3-galactosidase (SA-(3-gal)), significantly decreased the S-phase population of the cells and decreased levels of cyclin Dl, cyclin D3 and CDK2. However knockdown by shNUAK2 had only a marginal effect on apoptosis. The migration of C32 cells was significantly impaired by knockdown of NUAK2. Examination of the effect of NUAK2 on various melanoma cell lines after confirmation of NUAK2 expression was performed showing that NUAK2 has a profound effect on apoptosis in melI8, A375 and SKMel28 melanoma cell lines. These results demonstrate that NUAK2 has a significant impact on the proliferation and migration of melanoma cells with both NUAK2 amplification and PTEN deletion, but has no effect on their apoptosis, and that NUAK2 has a marked effect on apoptosis in some of melanoma cells other than C32 cells.
[0042] Various embodiments of the disclosure could also include permutations of the various elements recited in the claims as if each dependent claim was a multiple dependent claim incorporating the limitations of each of the preceding dependent claims as well as the independent claims. Such permutations are expressly within the scope of this disclosure.
[0043] While the invention has been particularly shown and described with reference to a number of embodiments, it would be understood by those skilled in the art that changes in the form and details may be made to the various embodiments disclosed herein without departing from the spirit and scope of the invention and that the various embodiments disclosed herein are not intended to act as limitations on the scope of the claims. All references cited herein are incorporated in their entirety by reference.
EXAMPLES
[0044] The following examples are provided for illustrative purposes only and are not intended to limit the scope of the invention.
Example 1:
[0045] Tumor specimens We obtained 103 paraffin-embedded specimens of primary melanomas and 22 paraffin-embedded specimens of acral nevi from 3 institutions. Melanoma tissue microarrays that contain 21 mucosal melanomas (ME803) and 21 non-acral nevi (ME 1001) were purchased from US Biomax. This study was approved by the Tokyo Medical and Dental University Research Committee, the Osaka University Clinical Research
Committee and the Saitama Cancer Center Research Ethics Committee. Fifty-seven tumors were classified as acral melanomas, 35 as non-CSD melanomas and 32 as mucosal melanomas, but none was a CSD melanoma according to the definition by Curtin and colleagues. Survival information of 57 patients with acral melanomas, 35 with non-CSD melanomas and 11 with mucosal melanomas were obtained. The clinical features of these cases are summarized in Tables 8 and 9.
[0046] Expression of PTEN, p-Akt and NUAK2 are estimated with 4 histopathological scores of 0, +1, +2 and +3.
[0047] Cell lines Normal human melanocytes and melanoma cell lines were cultured and maintained as previously described and know in the art. Melanoma cell lines used were C32, A375, A2058, Malme-3M, SKMel5, SKMel28, SKMel23, 586mel, mel2 and mell8. C32, A375, A2058, and Malme-3M cells were purchased from the American Type Culture Collection. SKMel5, SKMel28, SKMel23 and 586mel cells were kindly provided by the Surgery Branch, NCI/NIH, Bethesda, MD. mel2 and mell8 melanoma cells are as previously described and known in the art.
[0048] Statistical analyses of a public database. CGH array data of primary melanomas were obtained from Series "GSE2631". Data from 33 cases of acral melanomas, 34 cases of non-chronic sun-induced damage (CSD) melanomas, 28 cases of CSD melanomas and 15 cases of mucosal melanomas were examined. Clones with a log2 ratio value more than 0.25 were classified as "gain". Chromosomal loci were estimated as "gained" when log2 values of three clones among four consecutive clones were more than 0.25. Genomic clones were estimated as "gained" when log2 value of the corresponding clone was more than 0.25.
Genomic areas between two adjacent clones were also estimated as "gained" when log2 values of the two adjacent clones were more than 0.25 at the same time. Genomic clones were estimated as "deleted" when log2 value of the corresponding clone was less than -0.4. Correlations between each chromosomal gain, gain of each clone and tumor thickness were analyzed by the Mann- Whitney test. Correlations between gain of clone "RP11-243M13" and genetic aberrations of several melanoma-related genes were analyzed with the Student t test. Regression analysis was used to compare DNA copy number and mRNA expression level of each candidate gene.
[0049] Quantitation of DNA copy numbers and mRNA expression levels Analyses of DNA copy numbers and mRNA expression levels by quantitative real time PCR were performed using a LightCycler 480 Real-Time PCR System. Quantitative real-time PCR was performed using a LightCycler 480 SYBR Green I Master kit (Roche Applied Systems). The DNA copy number of each candidate gene was quantified by comparing the target locus to the reference Line-1 element as previously described. The cDNA level (mRNA expression level) of each candidate gene was quantified by comparison with the cDNA level of 18S.
PCRs for each primer set were performed at in least triplicate. Human genomic DNA was used as a calibrator for DNA copy number analyses and the cDNA of HEMn-DP was used as a calibrator for mRNA expression level analyses. Conditions for PCR reactions were as follows: one cycle at 95°C for 10 min, 40 cycles at 95°C for 10 s, at 55°C for 12 s, and at 72°C for 10 s. Melting curve analyses confirmed that single products were amplified and agarose gel electrophoresis was also carried out to confirm that PCR products were of the predicted lengths. Primer sequences for each target used in the DNA copy number analyses are as follows: SOX13 forward 5- ATTGGTTGAGGACCATGTGC-3 and reverse 5- GCGAGCTGTCTCTCTCC AAA-3 ; MDM4 forward 5- TGTGTAAAGGCCTGGGTAGG-3 and reverse 5- AACCTCTAACTGCCCAGCAA-3; NUAK2 forward 5- C ACCCTTGC AG AG ATG ATG A- 3 and reverse 5- CCAGGGAATTGGATACATGG-3; ELK4 forward 5- CAGCTGCCCCAGATTTTATT-3 and reverse 5- GAATCTC AAATTGCCTTTGTC A-3 ; IKBKE forward 5-
TTTGGCCATAAAACCTGACC-3 and reverse 5- AGCAGGGC ATC AACTCCTAA-3 ; MAPKAPK2 forward 5- CC AGTCCCG AG AC ACTCTGT- 3 and reverse 5- GGCAGAAGCACCAGGTTAAA-3. Primer sequences for each target used in the mRNA expression level analyses are as follows: SOX13 forward 5-
AAGGATGAGCGGAGGAAGAT-3 and reverse 5- CTCCTGGTTGGTC ATGGACT-3 ; MDM4 forward 5- GGTGGAGATCTTTTGGGAGAA-3 and reverse 5- AGCAGTGGCTAAAGTGAC AAGA-3 ; NUAK2 forward 5-
GTC A ATCCGG A AGG AC A A A A- 3 and reverse 5- TCACGATCTTGCTGCTGTTC-3; ELK4 forward 5- AGCCG AGCCCTC AG ATACTA- 3 and reverse 5-
CACAGTCACCCTCAATCCTG-3; IKBKE forward 5- GACCAGTTCTTTGCGGAGAC-3 and reverse 5- GCCTCCTGGAAAATGGCTA-3; MAPKAPK2 forward 5- G A AGTGCCTGCTG ATTGTC A- 3 and reverse 5- CGATGCTCTTCATGATTTCG-3. Quantification of DNA copy number and cDNA level was performed by comparison with standard curves generated from dilution series of human genomic DNA and cDNA of HEMn-DP. DNA copy numbers and mRNA expression levels of candidate genes were automatically calculated using the LightCycler480 Relative Quantification software.
[0050] Vectors, siRNA transfection and lentiviral infection. SMARTpool siRNAs against SOX13, MDM4, NUAK2, ELK4, IKBKE and MAPKAPK2 were purchased from
Dharmacon. Lentiviral vectors carrying shRNA targeting NUAK2 (AAB66-F-6:
AAACCCAGGGCTGCCTTGGAAAAG and AAB66-F-7:
AAACCCAGGGCTGCCTTGGAAAAG) and the empty vector were purchased from Open Biosystems in pLKO.lpuro vector. For siRNA experiments, cells were seeded at 2.0 x 105 cells/well in six- well plates and were transfected either with an siNT (non-targeting) or with an siRNA against SOX13, MDM4, NUAK2, ELK4, IKBKE or MAPKAPK2 (SMARTpool siRNAs, Dharmacon) at a concentration of 100 pmol/well using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer's protocol. All siRNA experiments were performed in triplicate. Lentivirus containing shRNA constructs with pLKO. l against NUAK2 were produced in NCI-Frederick and C32, mel2, mell8, A375, Malme-3m, SKMel28 and SKMel23 melanoma cells were infected using protamine sulfate. Infected cells were then selected by puromycin. The knockdown of NUAK2 expression was confirmed at the mRNA level by real-time PCR analyses.
[0051] In an alternate embodiment, SMARTpool siRNAs against CDK2 were purchased from Dharmacon. Lentiviral vectors carrying shRNA targeting NUAK2 (AAB66-F-6:
AAACCCAGGGCTGCCTTGGAAAAG and AAB66-F-7:
AAACCCAGGGCTGCCTTGGAAAAG) and the empty vector were purchased from Open Biosystems in pLKO.lpuro vector. For siRNA experiments, cells were seeded at 1.0 x 105 cells/well in 6-well plates and were transfected either with an siNT (non-targeting) or with an siRNA against CDK2 (SMARTpool siRNAs, Dharmacon) at a concentration of 100 pmol/well using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer's protocol. All siRNA experiments were performed in triplicate. Infection of Lentivirus containing shRNA constructs with pLKO.l against NUAK2 into cells was performed as previously described.
[0052] In vitro assays For cell number analyses using siRNA, cells were seeded at 2.0 x 105 cells/well in six- well plates in triplicate. Cell numbers were counted at 72 h after transfection of siRNA and statistical differences between siNT and the siRNA against each candidate gene were calculated. For cell number analyses using shRNA, cell were seeded at 1.0 x 105 cells/well in six- well plates in triplicate. Counting of cell numbers was started (as day 0) after 72 h selection with puromycin. Cell numbers were counted at days 0, 3, 6 and 9.
[0053] In an alternate embodiment, Cell numbers were counted at 48 h at Day 0, at 96 h at Day 2 and at 144 h as Day 4 after transfection of siRNA. For cell number analyses treated with Roscovitine, cells were seeded at 2 x 105 cells/well in 6-well plates. Cell numbers were counted at 48 h, 96 h and 144 h after treatment with Roscovitine.
[0054] For colony growth assays, cells were seeded at 1 x 105 cells/well (C32, mel2 and mell8) or at 5 x 104 cells/well (A375, SKMel28 and SKMel23) in 6-well plates in triplicate. After treatment with Roscovitine for 14 days, cells were fixed and stained with crystal violet. Measurement was performed of the optical density at 610 nm.
[0055] Cell cycle profile analyses were performed as previously described and as is known in the art.
[0056] For cell cycle profile and apoptosis analysis, cells were stained with a solution containing 0.1% Triton X-100, 0.1% Na citrate and 50 g/ml propidium iodide (PI), and then were analyzed using an FACSCalibur (BD). Percentages of cells in G0/G1, S, G2/M and pre- Gl phases were calculated with CellQuest Pro software (BD).
[0057] For the migration assay, the BD Falcon FluoroBlok 24-Multiwell Insert System was used. Cells were seeded at 5.0 x 104 cells/well in 24- well plates in triplicate and were labeled with calcein AM (Invitrogen). O.D. values were counted at 36 h after seeding using 1420 Multilabel Counter Victor3 (Perkin Elmer). Migration of C32 melanoma cells infected with shEV as a control was set at 100%, and cell counts were adjusted by the difference between proliferation of C32 cells infected with shEV and shNUAK2 at 36 h.
[0058] SA- -gal staining was performed using a Senescence β-Galactosidase Staining Kit according to the manufacturer's protocol (Cell Signaling).
[0059] Animal model. All animal experiments were approved by the NCTBethesda Animal Care and Use Committee of the National Cancer Institute. One week after infection of lentiviruses and selection using puromycin, 2.0 x 106 C32 melanoma cells (infected with shEV or shNUAK2) were injected subcutaneously into nude mice (4 or 5 per group as noted). Mice were then monitored for tumor appearance and tumor sizes were measured until day 40 or until the tumor measured 2 cm in diameter.
[0060] Immunoblotting. Immunoblotting was performed as previously described.
Antibodies used included a rabbit monoclonal anti-PTEN antibody (1: 1000, Cell Signaling), a rabbit monoclonal anti-phospho(Ser473) of Akt antibody (1: 1000, Cell Signaling), a rabbit
polyclonal anti-NUAK2 antibody (1: 1000, Proteintech Group), a mouse monoclonal anti- actin antibody (1: 1000; Abeam), a mouse monoclonal anti-cdc2 antibody (1: 1000; Santa Cruz Biotechnology), a rabbit polyclonal anti-CDK2 antibody (1: 1000; or 1:2000; Santa Cruz Biotechnology), a mouse monoclonal anti-CDK4 antibody (1: 1000; Cell Signaling), a mouse monoclonal anti-CDK6 antibody (1:500; Abeam), a rabbit monoclonal anti-Cyclin Dl antibody (1: 1000; Cell Signaling), a mouse monoclonal anti-Cyclin D3 antibody (1:2000; Cell Signaling), a mouse monoclonal anti-Cyclin E antibody (1:500; Abeam), a rabbit monoclonal anti-Caspase-3 antibody (1:5000; Cell Signaling) a rabbit monoclonal anti- p21CIPl antibody (1: 1000, Cell Signaling), a rabbit monoclonal anti-p27KIPl antibody (1: 1000, Abeam), a rabbit monoclonal anti-phospho(Thr308) of Akt antibody (1: 1000, Cell Signaling), a rabbit monoclonal anti-Akt(pan) antibody (1: 1000, Cell Signaling) and a rabbit polyclonal anti-cleaved PARP antibody (1: 1000; Cell Signaling). Blocking experiments were performed to show specificities of antibodies using a PTEN blocking peptide (1:500, Cell Signaling) or a Phospho-Akt(Ser473) blocking peptide (1:500, Cell Signaling).
Formalin-fixed, paraffin-embedded tissues on slides were dewaxed by two washes, 5 min each, with xylene. Tissues were rehydrated by a series of 3 min washes in 100%, 95%, 70%, 50% ethanol and a 5 min wash in distilled water. Antigen retrieval was performed by heating the slides at 95°C for 15 to 30 min in Antigen Unmasking Solution (Vector Laboratories). Endogenous peroxidase activity was blocked by treatment with 3% hydrogen peroxide for 15 min. After blocking with normal horse serum (Vector Laboratories) for 30 min, the tissues were incubated with a rabbit monoclonal anti-PTEN antibody (1: 100, Cell Signaling), a rabbit monoclonal anti-phospho(Ser473) of Akt antibody (1:25, Cell Signaling) a rabbit monoclonal anti-p27KIPl antibody (1: 100, Abeam), a rabbit polyclonal anti-CDK2 antibody (1:2000; Santa Cruz Biotechnology) or a rabbit polyclonal anti-NUAK2 antibody (1: 100, Proteintech Group) at 4°C overnight. The tissues were then incubated with a biotin-labeled secondary antibody and then with avidin-peroxidase for 30 min each (Vector Laboratories). The slides were then developed with a Vector VIP Substrate Kit (Vector Laboratories) and were counterstained with HematoxylinQS (Vector Laboratories). The slides were then dehydrated following a standard procedure, and were sealed with coverslips. Immuno staining of p-Akt and NUAK2 were performed as described. In immuno staining of CDK2 and p27KIPl, staining was developed with a Vector VIP Substrate Kit (Vector Laboratories) in
pigmented melanoma or with a Vector DAB Substrate Kit (Vector Laboratories) using counter- staining in non-pigmented melanoma. Confirmation of the specificities of antibodies was carried out with or without blocking peptide (for antibodies against PTEN and p-A t) or using a Lentivirus carrying an shRNA targeting NUAK2 (for the antibody against NUAK2). Cells stained in nucleus and/or both nucleus and cytoplasm were counted as positive, and cells stained only in cytoplasm were counted as negative. Immuno staining was scored from 0 to +3 (0 = 0 tol0%, +1 =11% to 25%, +2 = 26% to 50% or +3 = 51% to 100%) depending on percentages of cells in a blind fashion by 3 observers using positive cells in eccrine and in sebaceous glands as internal positive controls. The basal expression group (negative staining group) includes specimens with a 0 score and the over-expression group (positive staining group) includes specimens with +1, +2 or +3 scores.
[0061] Immunohistochemistry using fluorescence was performed as previously described and known in the art. The antibody used was a rabbit anti-p21CIPl monoclonal antibody (1: 100, Cell Signaling). Images were captured using a Leica DMR B/D MLD fluorescence microscope (Leica, Weltzar, Germany) and a Dage-MTI 3CCD 3-chip color video camera (Dage-MTI, Michigan City, IN, USA).
Table 3 Comparison of tumor thickness and each genomic clone.
Clone ID Acral Non-CSD CSD ucosal Total
RP11 -154A22 P = 0.56 NA NA P = 0.46 P = 0.32
RP11 -249C10 P = 0.36 P > 0.99 P = 0.54 P = 0.71 P = 0.15
RP11 -150L7 P = 0.054 P = 0.74 P = 0.91 NA P = 0.0051**
RP11 -246J15 P = 0.024* P = 0.33 P = 0.79 NA P = 0.023
RP11 -65122 P = 0.013* P = 0.80 P = 0.33 NA P = 0.0034**
RP11 -148 15 P = 0.94 P = 0.49 P > 0.99 P > 0.99 P = 0.72
RP11 -243M 13 P = 0.0029** P = 0.43 P = 0.14 NA P = 0.0004**
RP11 -249H15 P = 0.47 P = 0.78 P = 0.37 NA P = 0.94
RP11 -219P13 P = 0.08 P = 0.45 P = 0.36 P = 0.38 P = 0.0098*
RP11 -57117 P = 0.30 P = 0.36 P = 0.85 P = 0.28 P = 0.03*
RP11 -45F21 P = 0.27 P = 0.22 P = 0.67 P = 0.071 P = 0.092
RP11 -167J2 P = 0.72 P = 0.47 P = 0.44 P = 0.64 P = 0.053
RP11 -104A2 P = 0.52 P = 0.97 P = 0.70 P = 0.13 P = 0.42
*P < 0.05; ** P < 0.01
[0062] Statistical analysis. Student's t test was used to compare cell numbers with knockdown by SMARTpool siRNAs, over-expression of PTEN, /?-Akt and/or NUAK2, and sex and ulceration in immunohistochemical analyses. The Mann- Whitney test was used to compare over-expression of those genes, and tumor thickness and age in
immunohistochemical analyses. Additionally, Student's t test was used to compare S-phase populations in cell cycle profiles. The Kaplan-Meier method and log-rank test were used to examine correlations between expression of CDK2, NUAK2, p-Akt and patient survival. The Cox regression model was used to examine multivariate analyses.
[0063] The Kaplan-Meier method and log-rank test were used to evaluate correlations between over-expression of those genes and patient survival. The Cox regression model was used to evaluate multivariate analyses. We used a public array database
(http;//www. ncbi.nlm.nih.gov/geo/; Series GSE2631) to analyze correlations between genomic loci within chromosomes lq and 6p, and tumor thickness. We initially focused on
examining gains at the chromosomal level. The four most frequent loci (lq21-23, lq32, 6p23-25 and 6p21) with gains were identified. Analyses of correlations of these loci showed that lq32 correlated with tumor thickness in acral melanomas (P = 0.017) and in all melanomas (P = 0.003). To further characterize the significantly correlated clone at the lq32 locus, we focused on genomic loci from 193.52 Mb (D1S2794, clone ID: RP11- 154A22) to 208.18 Mb (D1S205, clone ID: RP11- 104A2) within the lq32 locus, since that locus includes most of the genomic gained clones within the lq32 locus. The genomic clones "RP11- 246J15", "RP11-65122" and "RP11-243M13" have statistically significant correlations in acral melanomas (P <0.05), and the genomic clone "RP11-243M13" has the strongest statistical significance (P = 0.0029). Interestingly, those correlations existed in only one subset of melanomas (acral). Thus, analyses of the public array CGH database suggest that a putative oncogene resides in a genomic locus around clone "RP11-243M13".
Table 4 DNA copy number and mRNA expression of candidate genes at lq32 by realtime PCR analyses.
D N A copy n u mber
mRNA expression
C32 A 375 A2058 IVIalme-3M SK el5 SKMel28 S Mel23 568m el mel2 mel18
SOX13 2.75 0.37 0.34 0.33 0.22 1 .35 0.17 1.31 0.83 1.50
MDM4 1.59 1 .19 1.12 0.79 1.41 0.68 0.74 1.60 3.16 1.64
NUAK2 4.55 1 .11 1.14 0.93 1.66 0.78 1.07 2.26 1.70 0.55
ELK4 1.80 0.73 0.66 0.97 1.14 0.83 0.44 1.99 1.33 0.63
IKBKE 0.34 0.75 1.30 0.76 0.61 0.42 0.59 1.48 1.15 0.55
MAPKAPK2 0.S6 0.67 1.34 0.88 0.4S 0.74 0.43 1.55 1.15 0.53
Table 5 Correlations of clinical parameters with over-expression of PTEN and p-Akt and/or NUAK2.
Acral melanoma Non-CSD melanoma
Table 6 Multivariate Cox regression analysis of overexpression of both NUAK2 and p- Akt for relapse free survival and overall survival in melanomas arising from
palmoplantar-subungal-mucosal area.
Relapse free survival Overall survival
*Coding of variables: Thickness was coded as 1, <1.0mm; 2, 1.01 to 2.00mm; 3, 2.01 to 4.00mm; 4, >4.00mm. Over-expression of NUAK2, and both NUAK2 and phospho-Akt (p-Akt) was coded as 1, negative; 2, positive.
Age was coded as 1, < 60 years; 2, >60 years. *P < 0.05; **P < 0.01.
Table 7 Expression of NUAK2,/?-Akt, PTEN and both NUAK2 and p-Akt in acral and non-acral nevi.
Acral and non-acral nevi
Location PTEN p-Akt NUAK2 NUAK2 + p-Akt
Acral nevi (n=22) 18 (81.8%) 7 (31 .8%) 2 (9.0%) 1 (4.5%)
Non-acral nevi (n=21 ) 11 (52.4%) 8 (38.1 %) 12 (57.1 %) 8 (38.1%)
TABLE 8 Clinical parameters, expression of ΡΤΕΝ, /7-AKT and NUAK2, and survival information for 57 acral, 35 non-CSD and 11 mucosal melanomas.
Acral melanoma Non-CSD melanoma
TNM classification and clinical stage are according to the melanoma staging system of the American Joint Committee on Cancer. Expression of PTEN, p-Akt and NUAK2 are estimated with 4 histopathological scores of 0, +1, +2 and +3. a + after survival indicates that the patient is alive.
Abbreviations: DOD, died of disease; CCR, continuous complete remission; CR-R, complete remission followed by relapse; CR-R-CR, complete remission followed by relapse and subsequent complete remission; RS, relapse free survival; OS, overall survival
TABLE 9 Expression of ΡΤΕΝ, /7-Akt and NUAK2 in 21 mucosal melanomas, 22 acral nevi and 21 non-acral nevi.
Mucosal melanoma Acral nevi Non-acral nevi
Expression of PTEN, p-Akt and NUAK2 are estimated with 4 histopathological scores of 0, +1, +2 and +3.
[0064] We also examined potential correlations between the gain of "RP11-243M13" and genetic aberrations of melanoma-related genes: a CDKN2A deletion, a CDK4 gain, an
MDM2 gain, a CCND1 gain and a PTEN deletion (data not shown). Only a deletion of the PTEN gene correlated with the gain of 'RP11-243M13" (P = 0.0004).
[0065] Genomic gain or amplification of oncogenes increases DNA copy number, up- regulates transcriptional levels of mRNA and then promotes the proliferation of cancer cells. We examined 6 candidate oncogenes (SOX13, MDM4, NUAK2, ELK4, IKBKE and
MAPKAPK2) within the lq32 locus spanning approximately 5.0 Mb (from 200.45 Mb; RP11-246J15 to 205.86 Mb; RP11-57117), where the most strongly correlated clone (RP11- 243M13) resided in the center. First, we investigated DNA copy numbers and mRNA expression levels using quantitative polymerase chain reaction (PCR) in 10 melanoma cell lines. Regression analyses revealed that NUAK2 had the strongest correlation (P = 0.0001). Next, we investigated the impact of RNAi-mediated knockdown of gene expression on cell growth. This analysis of C32 melanoma cells showed reduced cell numbers following knockdown of MDM4 or NUAK2 genes (P = 0.02 and P = 0.04, respectively). Only NUAK2 had statistical significance in C32 cells from both analyses, and thus we speculated that
NUAK2 is the most promising gene within the lq32 locus.
[0066] To determine whether NUAK2 is the gene at the lq32 locus that predicts clinical outcome, we performed immunohistochemistry and analyzed the clinical outcome using both univariate and multivariate analyses. Deletion of the PTEN gene is tightly correlated with the gain of "RP11-243M13" in the public array CGH database. We also analyzed the expression of PTEN and p-A t (phosphorylated at Ser473) using immunohistochemistry. Those analyses were performed on 57 acral melanomas and on 35 non-CSD melanomas. We found close correlations between over-expression of NUAK2, and between both p-A t and NUAK2 with thickness (P = 0.0026 and P = 0.0013, respectively) and ulceration (P = 0.017 and P = 0.031, respectively) in acral melanomas. Survival analyses by the Kaplan-Meier method showed a significant decrease in relapse-free survival (P = 0.057 and P = 0.0007, respectively) and in overall survival (P = 0.071 and P = 0.031, respectively) of patients with acral melanomas. Multivariate Cox regression analysis showed that over-expression of both p-Akt and NUAK2 correlated with decreased relapse-free survival in patients with acral melanomas (hazard ratio, 3.83; P = 0.01), and that the statistical significance is stronger than that of the tumor
thickness (hazard ratio, 1.85; P = 0.022). Thus, over-expression of both p-Akt and NUAK2 is an independent prognostic factor for relapse-free survival of patients with acral melanomas.
[0067] Acral and mucosal melanomas, which arise from palmoplantar-subungual- mucosal areas, have aggressive behaviors and share similar histopathologic features. The study was extended to analyze the impact of over-expression of both p-A t and NUAK2 on the survival of patients with melanomas arising from these areas. Survival analyses by the Kaplan-Meier method showed that over-expression of both p-A t and NUAK2, decreased relapse-free survival (P < 0.0001) and overall survival (P = 0.002). Multivariate Cox regression analysis showed a significant decrease in relapse-free survival (hazard ratio, 4.61; P = 0.0022), and a decrease in overall survival (hazard ratio, 3.60; P = 0.024). In nevi, the percentage of over-expression of both genes in acral nevi is significant lower than non-acral nevi, and the differences of over-expression of both two genes between acral nevi and non- acral nevi have a strong statistical significance (P = 0.0093). Thus over-expression of both p- Akt and NUAK2 has profound impact on the survival of patients with melanomas arising from these areas, and is implied to be suppressed during benign transformation in acral skin.
[0068] Examination of the effect of NUAK2 on C32 melanoma cells which harbor both a NUAK2 amplification and a PTEN deletion was performed, and were derived from an acral/mucosal melanoma. Knockdown of NUAK2 using a lentivirus containing an shRNA targeting NUAK2 (shNUAK2) caused a significant decrease in cell number. In mice, tumor growth was significantly suppressed by knockdown of NUAK2. In addition, knockdown of NUAK2 markedly increased cellular senescence (shown by positive staining with
senescence-associated β-galactosidase (SA- -gal)), significantly decreased the population of cells in S-phase and decreased levels of cyclin Dl, cyclin D3 and CDK2. However knockdown by shNUAK2 had only a marginal effect on apoptosis. The migration of C32 melanoma cells was significantly impaired by knockdown of NUAK2. Next, we examined the downstream pathway of NUAK2 and found that knockdown of NUAK2 significantly decreased expression of mTOR. Interestingly, knockdown of NUAK2 affects the expression of phospho-Akt (Tyr308) and inhibition of the PI3K pathway by Ly294002 significantly decreased mTOR expression in C32 melanoma cells. mTOR is regulated differently by AMPK-related kinases in benign and in malignant neoplasms of melanocytic cells.
[0069] These in vitro and in vivo studies disclose that NUAK2 and the PI3K pathway cooperatively regulate mTOR expression and that NUAK2 has a significant impact on the proliferation and migration of melanoma cells with both NUAK2 amplification and PTEN deletion.
Example 2:
[0070] In vitro studies using shRNA and the inhibitor Ly294002 showed that both NUAK2 and the PI3K pathway control CDK2 expression. Further, knockdown of CDK2 using siRNA significantly reduces cell proliferation of only melanoma cells (C32 melanoma cells) that overexpress both NUAK2 and p-Akt. Clinical studies using immunohistochemistry also show that the survival of patients with acral or mucosal melanomas that overexpress both NUAK2 and CDK2 is significantly reduced. Using an in vitro assay, we show that a low dose of a CDK inhibitor is effective on only melanoma cells that overexpress both NUAK2 and p-Akt. In vivo studies using mice confirm these results.
[0071] We demonstrate that NUAK2 and PI3K pathways cooperatively regulate CDK2 to control the proliferation of melanoma cells, and that CDK2 is an effective target to suppress the growth of primary melanomas. The cdk inhibitor, Roscovitine, is highly effective against NUAK2 highly-expressed and PI3K pathway activated melanoma cells both in vitro and in vivo. Cdk inhibitors are effective therapeutic modalities to treat acral melanomas. We examined the expression of genes which participate in the regulation of S- phase (such as CDK2, p21CIPl and p27KIPl) by knockdown of NUAK2 using a Lentiviral vector containing shRNA targeting NUAK2 (shNUAK2) and by inhibition of the PI3K pathway using LY294002. Knockdown of NUAK2 by shNUAK2 down-regulates the expression of CDK2 and up-regulates the expression of p27KIPl (Fig. 12a). Inhibition of the PI3K pathway by LY294002 down-regulates the expression of CDK2 and up-regulates the expression of p21CIPl (Fig. 12b). Immunohistochemical analyses of the expression of p21CIPl also showed that inhibition of the PI3K pathway by LY294002 increased the percentage of p21CIPl-positive cells from 63.7% to 92.3% (Fig. 14a). The S-phase population was reduced from 6.0% to 4.4% (P = 0.0020) upon inhibition of the PI3K pathway by LY294002 (Fig. 14b). NUAK2 and the PI3K pathway are independently
regulated excluding the expression of /?-Akt(T308) by NUAK2 (Fig. 15a,b). However, immunohistochemical analyses of p27KIP expression in clinical specimens showed that 86% (6 of 7 cases) of primary melanomas with high-expression of both NUAK2 and p-A t express p27KIPl (Fig. 6 and Table 10). We disclose that both NUAK2 and the PI3K pathway control expression of CDK2, and increase the S -phase population which results in increased proliferation in C32 melanoma cells. We disclose that CDK2 is an efficient target to suppress the proliferation of melanoma cells that express high levels of NUAK2 and have an activated PI3K pathway.
Table 10. Primary melanomas with or without over-expression of NUAK2 and p-Akt
Primary melanoma without over-expression of UAK2 and p-Akt
[0072] To show the effect of CDK2 on the proliferation of melanoma cells, we used siRNA SMARTpools targeting CDK2 (siCDK2) and a non-targeting (siNT) control, and we
used C32 melanoma cells and mell8 melanoma cells, the latter having no aberration in either of these 2 genes as a control. After confirmation of the efficient knockdown of CDK2 by siCDK2, we evaluated cell numbers at days 2 and 4 (Fig. 17). The knockdown of CDK2 significantly reduced the number of C32 melanoma cells at day 4, whereas knockdown of CDK2 had no effect on the number of mell8 melanoma cells (Fig. 12c). Next, we examined the expression of CDK2 in primary melanomas with over-expression of both NUAK2 and p- Akt in clinical specimens (Fig. 12d and Table 11). In acral and mucosal melanoma, CDK2 is expressed in 34 of 40 (85%) primary melanomas with high-expression of both NUAK2 and p-Akt compared to 17 of 27 (62.9%) without high-expression of NUAK2 and p-Akt, and this difference is statistically significant (P = 0.0463). Both Kaplan-Meier and multivariate Cox regression survival analyses revealed that primary acral and mucosal melanomas with high- expression of CDK2, NUAK2 and p-A t have significantly worse clinical outcome (Fig. 12e and Table 12). These results indicate that the inhibition of CDK2 has an anti-proliferative effect and that CDK2 expression has a significant impact on the survival of primary acral and mucosal melanomas with high-expression of both NUAK2 and p-A t.
CDK2 + NUAK2 + p-Afcl
5i.¾i <a i. :i
[0073] To inhibit CDK2 activity, we evaluated the efficacy of a cyclin-dependent kinase (cdks) inhibitor (Roscovitine) that significantly inhibits CDK1 or CDK2 compared to CDK4 or CDK6. A previous phase I trial of Roscovitine suggested that dose-limiting toxicities are at 800 mg b.i.d. which achieves approximately 3 μg ml"1 (10 μΜ) of the mean maximum plasma concentration. We used cell number analysis of melanoma cells treated with
Roscovitine to determine what concentration range has efficacy to suppress cell proliferation. C32 melanoma cells were quite sensitive to Roscovitine and their proliferation was significantly reduced at doses greater than 5 μΜ, whereas more than a 10 μΜ concentration was required to suppress the proliferation of mell8 melanoma cells (Fig. 13a). Similarly, Roscovitine treatment at 5 μΜ significantly reduced colony growth of C32 melanoma cells compared to mell8 melanoma cells (Fig. 13b and Fig.18). Cell cycle profile analyses showed that the S-phase population of C32 melanoma cells treated with Roscovitine at 5 μΜ was significantly reduced from 6.9% to 1.8% (P < 0.0001) (Fig. 19). We also assessed the effects of Roscovitine on the proliferation of C32 and mell8 melanoma cells in vivo using a mouse model. Tumor growth was significantly suppressed in C32 melanoma cells compared to mell8 melanoma cells (Fig. 13c). These in vitro and in vivo results indicate that treatment with a low dose of Roscovitine (CY202) effectively suppresses tumor growth of NUAK2 highly-expressed and PI3K pathway activated melanoma cells.
[0074] We demonstrate that CDK2 is an effective molecular target for the treatment of NUAK2 highly-expressed and PI3K pathway activated melanomas. We disclose a method utilizing the inhibition of CDK2 by a CDK2 inhibitor such as, but not limited to Roscovitine, to reduce cell proliferation and/or delay tumor growth, and/or treat melanoma in a patient in need thereof.
[0075] The description of the present invention has been presented for purposes of illustration and description, but is not intended to be exhaustive or limiting of the invention to the form disclosed. The scope of the present invention is limited only by the scope of the following claims. Many modifications and variations will be apparent to those of ordinary skill in the art. The embodiment described and shown in the figures was chosen and described in order to best explain the principles of the invention, the practical application, and to enable others of ordinary skill in the art to understand the invention for various embodiments with various modifications as are suited to the particular use contemplated.
Claims
1. A polynucleotide comprising a melanocyte- specific promoter and a region encoding an shRNA against the NUAK2 gene.
2. A polynucleotide as described in claim 1, wherein the polynucleotide is operably inserted into a lentiviral vector.
3. A polynucleotide as described in claim 1, wherein the polynucleotide is operably inserted into an adenoviral vector.
4. A method of inhibiting melanoma cell proliferation comprising administering a therapeutically effective amount of the polynucleotide of claim 2 or 3 to a patient in need thereof.
5. A method of inhibiting melanoma cell migration comprising administering a therapeutically effective amount of the polynucleotide of claim 2 or 3 to a patient in need thereof.
6. A method of predicting a clinical outcome in a patient with melanoma, comprising determining whether NUAK2 is overexpressed in an melanoma; wherein over- expression of NUAK2 is indicative of decreased relapse-free survival in the patient.
7. A method of predicting a clinical outcome in a patient with melanoma, comprising determining whether NUAK2 and p-A t (Ser473) are overexpressed in a melanoma; and wherein over-expression of both p-Akt and NUAK2 is predictive of decreased relapse-free survival and overall survival in the patient.
8. The method of Claims 4, 5, or 6, wherein the melanoma is acral melanoma.
9. The method of Claims 4, 5, or 6, wherein the melanoma is mucosal melanoma.
10. The method of Claims 4, 5, or 6, wherein the melanoma is metastatic melanoma.
11. A method for treating melanoma comprising administering to a patient in need thereof a pharmaceutically effective amount of a CDK2 inhibitor, wherein it is determined that the melanoma cells overexpress NUAK2.
12. A method of diagnosing a clinical outcome for melanoma in a subject comprising:
(a) measuring the expression of NUAK2 in the melanoma,
(b) determining the level of expression of NUAK2 compared to control,
(c) correlating the level of expression with decreased relapse-free survival and overall survival in the patient.
13. A method of treating a patient with melanoma comprising:
(a) measuring the expression of NUAK2 in the melanoma,
(b) determining the level of expression of NUAK2 compared to control,
(c) treating the patient with a pharmaceutically effective amount of a CDK inhibitor, wherein it is determined that the melanoma cells overexpress NUAK2.
14. A Kit for predicting clinical outcome in a patient with melanoma comprising instructions comprising the method of claim 12.
15. The Kit of Claim 14, wherein the predicted clinical outcome is for a patient with acral melanoma.
16. The Kit of Claim 14, wherein the predicted clinical outcome is for a patient with mucosal melanoma.
17. The Kit of Claim 14, wherein the predicted clinical outcome is for a patient with metastatic melanoma.
18. The Kit of claim 14 further comprising an assay to determine NUAK2 expression levels.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US32113610P | 2010-04-06 | 2010-04-06 | |
| US61/321,136 | 2010-04-06 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2011127222A1 true WO2011127222A1 (en) | 2011-10-13 |
Family
ID=44120954
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2011/031483 Ceased WO2011127222A1 (en) | 2010-04-06 | 2011-04-06 | Diagnosis and treatment of melanoma through nuak2 assessment and modulation |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2011127222A1 (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10287580B2 (en) * | 2014-03-14 | 2019-05-14 | The General Hospital Corporation | Molecular re-engineering of excitation-inhibition balance in memory circuits |
| US20220017905A1 (en) * | 2013-11-22 | 2022-01-20 | Fred Huchinson Cancer Research Center | Methods for identifying therapeutic targets and treating and monitoring cancers |
| WO2023283556A3 (en) * | 2021-07-08 | 2023-02-09 | Regeneron Pharmaceuticals, Inc. | Methods of treating skin cancer with carboxypeptidase vitellogenic like (cpvl) inhibitors |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002012456A2 (en) * | 2000-08-03 | 2002-02-14 | 1149336 Ontario Inc. | Ampk-related serine/threonine kinase, designated snark |
| US20080182257A1 (en) * | 2006-11-15 | 2008-07-31 | The Regents Of The University Of California | Detection of chromosomal region copy number changes to diagnose melanoma |
-
2011
- 2011-04-06 WO PCT/US2011/031483 patent/WO2011127222A1/en not_active Ceased
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002012456A2 (en) * | 2000-08-03 | 2002-02-14 | 1149336 Ontario Inc. | Ampk-related serine/threonine kinase, designated snark |
| US20080182257A1 (en) * | 2006-11-15 | 2008-07-31 | The Regents Of The University Of California | Detection of chromosomal region copy number changes to diagnose melanoma |
Non-Patent Citations (15)
| Title |
|---|
| BASTIAN BC, KASHANI-SABET M, HAMM H ET AL.: "Gene amplifications characterize acral melanoma and permit the detection of occult tumor cells in the surrounding skin", CANCER RES., vol. 60, no. 7, 1 April 2000 (2000-04-01), pages 1968 - 73 |
| BOEHM JESSE S ET AL: "Integrative genomic approaches identify IKBKE as a breast cancer oncogene", CELL, CELL PRESS, US, vol. 129, no. 6, 1 June 2007 (2007-06-01), pages 1065 - 1079, XP002498282, ISSN: 0092-8674, DOI: DOI:10.1016/J.CELL.2007.03.052 * |
| DU J ET AL: "CRITICAL ROLE OF CDK2 FOR MELANOMA GROWTH LINKED TO ITS MELANOCYTE-SPECIFIC TRANSCRIPTIONAL REGULATION BY MITF", CANCER CELL, CELL PRESS, US, vol. 6, 1 December 2004 (2004-12-01), pages 565 - 576, XP003010736, ISSN: 1535-6108, DOI: DOI:10.1016/J.CCR.2004.10.014 * |
| J CUTAN PATHOL., vol. 25, no. 5, May 1998 (1998-05-01), pages 244 - 51 |
| KIM JOO HYUN ET AL: "SNARK, a novel downstream molecule of EBV latent membrane protein 1, is associated with resistance to cancer cell death.", LEUKEMIA & LYMPHOMA JUL 2008 LNKD- PUBMED:18452098, vol. 49, no. 7, July 2008 (2008-07-01), pages 1392 - 1398, XP008139713, ISSN: 1029-2403 * |
| KUGA W ET AL: "Nuclear localization of SNARK; its impact on gene expression", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, ACADEMIC PRESS INC. ORLANDO, FL, US, vol. 377, no. 4, 26 December 2008 (2008-12-26), pages 1062 - 1066, XP025691121, ISSN: 0006-291X, [retrieved on 20081106], DOI: DOI:10.1016/J.BBRC.2008.10.143 * |
| KWONG ET AL: "Growth Factors and Oncogenes as Targets in Melanoma: Lost in Translation?", ADVANCES IN DERMATOLOGY, YEAR BOOK MEDICAL PUBLISHERS, CHICAGO, IL, US, vol. 23, 17 November 2007 (2007-11-17), pages 99 - 129, XP022341386, ISSN: 0882-0880, DOI: DOI:10.1016/J.YADR.2007.07.015 * |
| P. LEGEMBRE: "Identification of SNF1/AMP Kinase-related Kinase as an NF- B-regulated Anti-apoptotic Kinase Involved in CD95-induced Motility and Invasiveness", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 279, no. 45, 1 January 2004 (2004-01-01), pages 46742 - 46747, XP055003026, ISSN: 0021-9258, DOI: 10.1074/jbc.M404334200 * |
| RUNE A ET AL: "Regulation of skeletal muscle sucrose, non-fermenting 1/AMP-activated protein kinase-related kinase (SNARK) by metabolic stress and diabetes", DIABETOLOGIA ; CLINICAL AND EXPERIMENTAL DIABETES AND METABOLISM, SPRINGER, BERLIN, DE, vol. 52, no. 10, 4 August 2009 (2009-08-04), pages 2182 - 2189, XP019735389, ISSN: 1432-0428, DOI: DOI:10.1007/S00125-009-1465-X * |
| S. MOHAPATRA ET AL: "Roscovitine Inhibits Differentiation and Invasion in a Three-Dimensional Skin Reconstruction Model of Metastatic Melanoma", MOLECULAR CANCER RESEARCH, vol. 5, no. 2, 1 February 2007 (2007-02-01), pages 145 - 151, XP055003097, ISSN: 1541-7786, DOI: 10.1158/1541-7786.MCR-06-0300 * |
| SASAKI Y, NIU C, MAKINO R ET AL.: "BRAF point mutations in primary melanoma show different prevalences by subtype", J INVEST DERMATOL., vol. 123, no. 1, July 2004 (2004-07-01), pages 177 - 83 |
| SUSAN BURDETTE-RADOUX ET AL: "Phase II trial of flavopiridol, a cyclin dependent kinase inhibitor, in untreated metastatic malignant melanoma", INVESTIGATIONAL NEW DRUGS ; THE JOURNAL OF NEW ANTICANCER AGENTS, KLUWER ACADEMIC PUBLISHERS, BO, vol. 22, no. 3, 1 August 2004 (2004-08-01), pages 315 - 322, XP019206059, ISSN: 1573-0646, DOI: DOI:10.1023/B:DRUG.0000026258.02846.1C * |
| T. NAMIKI ET AL: "AMP kinase-related kinase NUAK2 affects tumor growth, migration, and clinical outcome of human melanoma", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 108, no. 16, 19 April 2011 (2011-04-19), pages 6597 - 6602, XP055002927, ISSN: 0027-8424, DOI: 10.1073/pnas.1007694108 * |
| WAGNER A J ET AL: "Melanocyte signaling pathways and the etiology of melanoma", DRUG DISCOVERY TODAY: DISEASE MECHANISMS, ELSEVIER, vol. 2, no. 2, 1 July 2005 (2005-07-01), pages 179 - 183, XP004983099, ISSN: 1740-6765, DOI: DOI:10.1016/J.DDMEC.2005.05.017 * |
| WINNEPENNINCKX VÉRONIQUE ET AL: "Gene expression profiling of primary cutaneous melanoma and clinical outcome", NATIONAL CANCER INSTITUTE. JOURNAL (ONLINE), OXFORD UNIVERSITY PRESS, GB, vol. 98, no. 7, 5 April 2006 (2006-04-05), pages 472 - 482, XP002611616, ISSN: 1460-2105, DOI: DOI:10.1093/JNCI/DJJ103 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20220017905A1 (en) * | 2013-11-22 | 2022-01-20 | Fred Huchinson Cancer Research Center | Methods for identifying therapeutic targets and treating and monitoring cancers |
| US10287580B2 (en) * | 2014-03-14 | 2019-05-14 | The General Hospital Corporation | Molecular re-engineering of excitation-inhibition balance in memory circuits |
| WO2023283556A3 (en) * | 2021-07-08 | 2023-02-09 | Regeneron Pharmaceuticals, Inc. | Methods of treating skin cancer with carboxypeptidase vitellogenic like (cpvl) inhibitors |
| US12070460B2 (en) | 2021-07-08 | 2024-08-27 | Regeneron Pharmaceuticals, Inc. | Methods of treating skin cancer with Carboxypeptidase Vitellogenic Like (CPVL) inhibitors |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wang et al. | MicroRNA 23b regulates autophagy associated with radioresistance of pancreatic cancer cells | |
| Qie et al. | Stanniocalcin 2 (STC2): a universal tumour biomarker and a potential therapeutical target | |
| Chen et al. | MicroRNA-490-3P targets CDK1 and inhibits ovarian epithelial carcinoma tumorigenesis and progression | |
| Zhang et al. | MiR-22 regulates 5-FU sensitivity by inhibiting autophagy and promoting apoptosis in colorectal cancer cells | |
| Li et al. | Cornulin is induced in psoriasis lesions and promotes keratinocyte proliferation via phosphoinositide 3-kinase/Akt pathways | |
| Kabir et al. | A miR-335/COX-2/PTEN axis regulates the secretory phenotype of senescent cancer-associated fibroblasts | |
| He et al. | miR-4317 suppresses non-small cell lung cancer (NSCLC) by targeting fibroblast growth factor 9 (FGF9) and cyclin D2 (CCND2) | |
| Dai et al. | Nuclear-translocation of ACLY induced by obesity-related factors enhances pyrimidine metabolism through regulating histone acetylation in endometrial cancer | |
| Zhang et al. | Suppression of microRNA-125a-5p upregulates the TAZ-EGFR signaling pathway and promotes retinoblastoma proliferation | |
| Guo et al. | MiR224-3p inhibits hypoxia-induced autophagy by targeting autophagy-related genes in human glioblastoma cells | |
| Meng et al. | miR-183-5p functions as a tumor suppressor in lung cancer through PIK3CA inhibition | |
| Wei et al. | CDK8 regulates the angiogenesis of pancreatic cancer cells in part via the CDK8-β-catenin-KLF2 signal axis | |
| Zhang et al. | CBX3 promotes tumor proliferation by regulating G1/S phase via p21 downregulation and associates with poor prognosis in tongue squamous cell carcinoma | |
| Zhu et al. | FAM83D inhibits autophagy and promotes proliferation and invasion of ovarian cancer cells via PI3K/AKT/mTOR pathway | |
| Chen et al. | Targeting p21-activated kinase 1 inhibits growth and metastasis via Raf1/MEK1/ERK signaling in esophageal squamous cell carcinoma cells | |
| He et al. | TACC3 overexpression in cholangiocarcinoma correlates with poor prognosis and is a potential anti-cancer molecular drug target for HDAC inhibitors | |
| Wang et al. | Long noncoding RNA LINC01426 promotes glioma progression through PI3K/AKT signaling pathway and serves as a prognostic biomarker. | |
| Yao et al. | F-box and leucine-rich repeat protein 5 promotes colon cancer progression by modulating PTEN/PI3K/AKT signaling pathway | |
| Shao et al. | Methylation-dependent MCM6 repression induced by LINC00472 inhibits triple-negative breast cancer metastasis by disturbing the MEK/ERK signaling pathway | |
| Hsieh et al. | TRPM1 promotes tumor progression in acral melanoma by activating the Ca2+/CaMKIIδ/AKT pathway | |
| Ye et al. | TSPAN12 promotes chemoresistance and proliferation of SCLC under the regulation of miR-495 | |
| Yan et al. | Involvement of TMEM16A/ANO1 upregulation in the oncogenesis of colorectal cancer | |
| Chen et al. | miR‑409‑3p suppresses the proliferation, invasion and migration of tongue squamous cell carcinoma via targeting RDX | |
| Fan et al. | Aberrant miR-1246 expression promotes radioresistance in non-small cell lung cancer: a potential prognostic biomarker and radiotherapy sensitization target | |
| Liu et al. | Knockdown of thrombospondin 2 inhibits metastasis through modulation of PI3K signaling pathway in uveal melanoma cell line M23. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 11720212 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 11720212 Country of ref document: EP Kind code of ref document: A1 |










