WO2011127070A2 - IRE-1α INHIBITORS - Google Patents

IRE-1α INHIBITORS Download PDF

Info

Publication number
WO2011127070A2
WO2011127070A2 PCT/US2011/031274 US2011031274W WO2011127070A2 WO 2011127070 A2 WO2011127070 A2 WO 2011127070A2 US 2011031274 W US2011031274 W US 2011031274W WO 2011127070 A2 WO2011127070 A2 WO 2011127070A2
Authority
WO
WIPO (PCT)
Prior art keywords
compounds
structural formula
specifically
structural
formulae
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2011/031274
Other languages
French (fr)
Other versions
WO2011127070A3 (en
Inventor
Qingping Zeng
Andras Toro
John Bruce Patterson
Warren Stanfield Wade
Zoltan Zubovics
Yun Yang
Zhipeng Wu
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Mannkind Corp
Original Assignee
Mannkind Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to EP18181955.8A priority Critical patent/EP3409276B1/en
Priority to MX2012011504A priority patent/MX2012011504A/en
Priority to CA2795350A priority patent/CA2795350C/en
Priority to MX2015001652A priority patent/MX362442B/en
Priority to EP11715346.0A priority patent/EP2555768B1/en
Priority to US13/639,734 priority patent/US9040714B2/en
Priority to ES11715346T priority patent/ES2698048T3/en
Priority to MX2018000187A priority patent/MX388981B/en
Priority to CN201910119705.8A priority patent/CN110172051B/en
Priority to EP20209114.6A priority patent/EP3799870A1/en
Priority to CN201180027605.4A priority patent/CN103079558B/en
Priority to JP2013503848A priority patent/JP2013525281A/en
Application filed by Mannkind Corp filed Critical Mannkind Corp
Publication of WO2011127070A2 publication Critical patent/WO2011127070A2/en
Publication of WO2011127070A3 publication Critical patent/WO2011127070A3/en
Anticipated expiration legal-status Critical
Priority to US14/594,400 priority patent/US9693992B2/en
Priority to US15/600,473 priority patent/US9867803B2/en
Priority to US15/836,728 priority patent/US10357475B2/en
Priority to US16/429,460 priority patent/US11337956B2/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D311/00Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings
    • C07D311/02Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings ortho- or peri-condensed with carbocyclic rings or ring systems
    • C07D311/04Benzo[b]pyrans, not hydrogenated in the carbocyclic ring
    • C07D311/06Benzo[b]pyrans, not hydrogenated in the carbocyclic ring with oxygen or sulfur atoms directly attached in position 2
    • C07D311/08Benzo[b]pyrans, not hydrogenated in the carbocyclic ring with oxygen or sulfur atoms directly attached in position 2 not hydrogenated in the hetero ring
    • C07D311/16Benzo[b]pyrans, not hydrogenated in the carbocyclic ring with oxygen or sulfur atoms directly attached in position 2 not hydrogenated in the hetero ring substituted in position 7
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/335Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/365Lactones
    • A61K31/366Lactones having six-membered rings, e.g. delta-lactones
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/335Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/34Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having five-membered rings with one oxygen as the only ring hetero atom, e.g. isosorbide
    • A61K31/343Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having five-membered rings with one oxygen as the only ring hetero atom, e.g. isosorbide condensed with a carbocyclic ring, e.g. coumaran, bufuralol, befunolol, clobenfurol, amiodarone
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/335Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/35Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom
    • A61K31/352Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom condensed with carbocyclic rings, e.g. methantheline 
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/335Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/365Lactones
    • A61K31/366Lactones having six-membered rings, e.g. delta-lactones
    • A61K31/37Coumarins, e.g. psoralen
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/38Heterocyclic compounds having sulfur as a ring hetero atom
    • A61K31/381Heterocyclic compounds having sulfur as a ring hetero atom having five-membered rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A61K31/4025Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil not condensed and containing further heterocyclic rings, e.g. cromakalim
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A61K31/403Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with carbocyclic rings, e.g. carbazole
    • A61K31/404Indoles, e.g. pindolol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A61K31/403Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with carbocyclic rings, e.g. carbazole
    • A61K31/404Indoles, e.g. pindolol
    • A61K31/4045Indole-alkylamines; Amides thereof, e.g. serotonin, melatonin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/4151,2-Diazoles
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/4151,2-Diazoles
    • A61K31/41551,2-Diazoles non condensed and containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/41641,3-Diazoles
    • A61K31/4172Imidazole-alkanecarboxylic acids, e.g. histidine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/41641,3-Diazoles
    • A61K31/41841,3-Diazoles condensed with carbocyclic rings, e.g. benzimidazoles
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/42Oxazoles
    • A61K31/423Oxazoles condensed with carbocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/425Thiazoles
    • A61K31/427Thiazoles not condensed and containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4427Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems
    • A61K31/4433Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems containing a six-membered ring with oxygen as a ring hetero atom
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4427Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems
    • A61K31/4439Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. omeprazole
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/445Non condensed piperidines, e.g. piperocaine
    • A61K31/452Piperidinium derivatives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/445Non condensed piperidines, e.g. piperocaine
    • A61K31/4523Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems
    • A61K31/453Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a six-membered ring with oxygen as a ring hetero atom
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/445Non condensed piperidines, e.g. piperocaine
    • A61K31/4523Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems
    • A61K31/454Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. pimozide, domperidone
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/445Non condensed piperidines, e.g. piperocaine
    • A61K31/4523Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems
    • A61K31/4545Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a six-membered ring with nitrogen as a ring hetero atom, e.g. pipamperone, anabasine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/496Non-condensed piperazines containing further heterocyclic rings, e.g. rifampin, thiothixene or sparfloxacin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/535Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
    • A61K31/53751,4-Oxazines, e.g. morpholine
    • A61K31/53771,4-Oxazines, e.g. morpholine not condensed and containing further heterocyclic rings, e.g. timolol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/12Drugs for disorders of the urinary system of the kidneys
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • A61P21/04Drugs for disorders of the muscular or neuromuscular system for myasthenia gravis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/18Antipsychotics, i.e. neuroleptics; Drugs for mania or schizophrenia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/06Immunosuppressants, e.g. drugs for graft rejection
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/06Antianaemics
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07BGENERAL METHODS OF ORGANIC CHEMISTRY; APPARATUS THEREFOR
    • C07B59/00Introduction of isotopes of elements into organic compounds ; Labelled organic compounds per se
    • C07B59/002Heterocyclic compounds
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D209/00Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom
    • C07D209/02Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom condensed with one carbocyclic ring
    • C07D209/04Indoles; Hydrogenated indoles
    • C07D209/30Indoles; Hydrogenated indoles with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, directly attached to carbon atoms of the hetero ring
    • C07D209/42Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D215/00Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems
    • C07D215/02Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom
    • C07D215/16Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D215/20Oxygen atoms
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D217/00Heterocyclic compounds containing isoquinoline or hydrogenated isoquinoline ring systems
    • C07D217/02Heterocyclic compounds containing isoquinoline or hydrogenated isoquinoline ring systems with only hydrogen atoms or radicals containing only carbon and hydrogen atoms, directly attached to carbon atoms of the nitrogen-containing ring; Alkylene-bis-isoquinolines
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D217/00Heterocyclic compounds containing isoquinoline or hydrogenated isoquinoline ring systems
    • C07D217/02Heterocyclic compounds containing isoquinoline or hydrogenated isoquinoline ring systems with only hydrogen atoms or radicals containing only carbon and hydrogen atoms, directly attached to carbon atoms of the nitrogen-containing ring; Alkylene-bis-isoquinolines
    • C07D217/04Heterocyclic compounds containing isoquinoline or hydrogenated isoquinoline ring systems with only hydrogen atoms or radicals containing only carbon and hydrogen atoms, directly attached to carbon atoms of the nitrogen-containing ring; Alkylene-bis-isoquinolines with hydrocarbon or substituted hydrocarbon radicals attached to the ring nitrogen atom
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D217/00Heterocyclic compounds containing isoquinoline or hydrogenated isoquinoline ring systems
    • C07D217/02Heterocyclic compounds containing isoquinoline or hydrogenated isoquinoline ring systems with only hydrogen atoms or radicals containing only carbon and hydrogen atoms, directly attached to carbon atoms of the nitrogen-containing ring; Alkylene-bis-isoquinolines
    • C07D217/06Heterocyclic compounds containing isoquinoline or hydrogenated isoquinoline ring systems with only hydrogen atoms or radicals containing only carbon and hydrogen atoms, directly attached to carbon atoms of the nitrogen-containing ring; Alkylene-bis-isoquinolines with the ring nitrogen atom acylated by carboxylic or carbonic acids, or with sulfur or nitrogen analogues thereof, e.g. carbamates
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D217/00Heterocyclic compounds containing isoquinoline or hydrogenated isoquinoline ring systems
    • C07D217/02Heterocyclic compounds containing isoquinoline or hydrogenated isoquinoline ring systems with only hydrogen atoms or radicals containing only carbon and hydrogen atoms, directly attached to carbon atoms of the nitrogen-containing ring; Alkylene-bis-isoquinolines
    • C07D217/08Heterocyclic compounds containing isoquinoline or hydrogenated isoquinoline ring systems with only hydrogen atoms or radicals containing only carbon and hydrogen atoms, directly attached to carbon atoms of the nitrogen-containing ring; Alkylene-bis-isoquinolines with a hetero atom directly attached to the ring nitrogen atom
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D235/00Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, condensed with other rings
    • C07D235/02Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, condensed with other rings condensed with carbocyclic rings or ring systems
    • C07D235/04Benzimidazoles; Hydrogenated benzimidazoles
    • C07D235/18Benzimidazoles; Hydrogenated benzimidazoles with aryl radicals directly attached in position 2
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D235/00Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, condensed with other rings
    • C07D235/02Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, condensed with other rings condensed with carbocyclic rings or ring systems
    • C07D235/04Benzimidazoles; Hydrogenated benzimidazoles
    • C07D235/24Benzimidazoles; Hydrogenated benzimidazoles with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached in position 2
    • C07D235/28Sulfur atoms
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D263/00Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings
    • C07D263/52Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings condensed with carbocyclic rings or ring systems
    • C07D263/54Benzoxazoles; Hydrogenated benzoxazoles
    • C07D263/56Benzoxazoles; Hydrogenated benzoxazoles with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached in position 2
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D277/00Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings
    • C07D277/60Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings condensed with carbocyclic rings or ring systems
    • C07D277/62Benzothiazoles
    • C07D277/64Benzothiazoles with only hydrocarbon or substituted hydrocarbon radicals attached in position 2
    • C07D277/66Benzothiazoles with only hydrocarbon or substituted hydrocarbon radicals attached in position 2 with aromatic rings or ring systems directly attached in position 2
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D277/00Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings
    • C07D277/60Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings condensed with carbocyclic rings or ring systems
    • C07D277/62Benzothiazoles
    • C07D277/68Benzothiazoles with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached in position 2
    • C07D277/82Nitrogen atoms
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D307/00Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom
    • C07D307/77Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom ortho- or peri-condensed with carbocyclic rings or ring systems
    • C07D307/78Benzo [b] furans; Hydrogenated benzo [b] furans
    • C07D307/82Benzo [b] furans; Hydrogenated benzo [b] furans with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to carbon atoms of the hetero ring
    • C07D307/84Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen
    • C07D307/85Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen attached in position 2
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D311/00Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings
    • C07D311/02Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings ortho- or peri-condensed with carbocyclic rings or ring systems
    • C07D311/04Benzo[b]pyrans, not hydrogenated in the carbocyclic ring
    • C07D311/06Benzo[b]pyrans, not hydrogenated in the carbocyclic ring with oxygen or sulfur atoms directly attached in position 2
    • C07D311/08Benzo[b]pyrans, not hydrogenated in the carbocyclic ring with oxygen or sulfur atoms directly attached in position 2 not hydrogenated in the hetero ring
    • C07D311/12Benzo[b]pyrans, not hydrogenated in the carbocyclic ring with oxygen or sulfur atoms directly attached in position 2 not hydrogenated in the hetero ring substituted in position 3 and unsubstituted in position 7
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D311/00Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings
    • C07D311/02Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings ortho- or peri-condensed with carbocyclic rings or ring systems
    • C07D311/04Benzo[b]pyrans, not hydrogenated in the carbocyclic ring
    • C07D311/06Benzo[b]pyrans, not hydrogenated in the carbocyclic ring with oxygen or sulfur atoms directly attached in position 2
    • C07D311/20Benzo[b]pyrans, not hydrogenated in the carbocyclic ring with oxygen or sulfur atoms directly attached in position 2 hydrogenated in the hetero ring
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D311/00Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings
    • C07D311/02Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings ortho- or peri-condensed with carbocyclic rings or ring systems
    • C07D311/04Benzo[b]pyrans, not hydrogenated in the carbocyclic ring
    • C07D311/22Benzo[b]pyrans, not hydrogenated in the carbocyclic ring with oxygen or sulfur atoms directly attached in position 4
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D311/00Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings
    • C07D311/02Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings ortho- or peri-condensed with carbocyclic rings or ring systems
    • C07D311/78Ring systems having three or more relevant rings
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D311/00Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings
    • C07D311/02Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings ortho- or peri-condensed with carbocyclic rings or ring systems
    • C07D311/94Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings ortho- or peri-condensed with carbocyclic rings or ring systems condensed with rings other than six-membered or with ring systems containing such rings
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D333/00Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom
    • C07D333/50Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom condensed with carbocyclic rings or ring systems
    • C07D333/52Benzo[b]thiophenes; Hydrogenated benzo[b]thiophenes
    • C07D333/54Benzo[b]thiophenes; Hydrogenated benzo[b]thiophenes with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached to carbon atoms of the hetero ring
    • C07D333/60Radicals substituted by carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D333/00Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom
    • C07D333/50Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom condensed with carbocyclic rings or ring systems
    • C07D333/52Benzo[b]thiophenes; Hydrogenated benzo[b]thiophenes
    • C07D333/62Benzo[b]thiophenes; Hydrogenated benzo[b]thiophenes with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to carbon atoms of the hetero ring
    • C07D333/68Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen
    • C07D333/70Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen attached in position 2
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D401/00Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/04Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D401/00Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/10Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings linked by a carbon chain containing aromatic rings
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D401/00Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/12Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings linked by a chain containing hetero atoms as chain links
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D405/00Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
    • C07D405/02Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings
    • C07D405/04Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D405/00Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
    • C07D405/02Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings
    • C07D405/10Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings linked by a carbon chain containing aromatic rings
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D409/00Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms
    • C07D409/02Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing two hetero rings
    • C07D409/04Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D417/00Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
    • C07D417/02Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings
    • C07D417/04Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D417/00Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
    • C07D417/02Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings
    • C07D417/06Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings linked by a carbon chain containing only aliphatic carbon atoms
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D417/00Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
    • C07D417/02Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings
    • C07D417/10Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings linked by a carbon chain containing aromatic rings
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D417/00Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
    • C07D417/14Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing three or more hetero rings
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the field of the invention includes IRE- ⁇ inhibitors and their therapeutic uses.
  • Protein folding stress in the endoplasmic reticulum of a cell initiates a signal transduction cascade termed the unfolded protein response or UPR.
  • a key enzyme, inositol requiring enzyme 1 (IRE- l a), relieves protein folding stress by enhancing molecular ehaperone activity and therefore protects cells from stress induced apoptosis.
  • Inhibitors of IRE- la are useful for treating at least B cell autoimmune diseases, certain cancers, and some viral infections.
  • FIG. 1 shows inhibition of endogenous XBP-1 splicing in RPMI 8226 cells using
  • PCR amplification products were run on a 4% agarose gel and stained with ethidium bromide. The inverse image is shown.
  • Figure 2 shows inhibition of regulated IRE 1 -dependent decay (RIDD) of Blosl ( Figure
  • Figure 3B Results of RT-PCR analysis performed using murine-specific XBP-1 primers from total RNA harvested from specified organs after intraperitoneal treatment with an IRE- la inhibitor (Example 44).
  • FIG. 4A Results of RT-PCR analysis performed using murine-specific XBP-1 primers from total RNA harvested from specified organs after intravenous treatment with an IRE- la inhibitor (Example 44).
  • Figure 4B Results of RT-PCR analysis performed using murine-specific XBP-1 primers from total RNA harvested from specified organs after oral treatment with an IRE- la inhibitor (Example 44).
  • Figure 5B Results of RT-PCR amplification of XBP-1 using human specific primers.
  • Figure 6B Results of RT-PCR amplification of XBP-1 using human specific primers.
  • IRE- la inhibitor compounds, prodrugs, and pharmaceutically acceptable salts thereof therapeutically to treat disorders associated with the unfolded protein response.
  • Patients who can be treated include those with B cell autoimmune diseases, certain cancers, and some viral infections, in other embodiments IRE- ⁇ ⁇ inhibitor compounds, prodrugs, or
  • IRE- la inhibitor compounds can be administered to treat disorders associated with regulated IRE 1 -dependent decay (RIDD).
  • RIDD regulated IRE 1 -dependent decay
  • Other embodiments are intermediates of IRE- la inhibitor compounds and methods of synthesizing IRE- la inhibitor compounds as set forth in the specific Examples, below.
  • Halogen includes fluorine, chlorine, bromine, and iodine.
  • alkyl as used herein means a saturated monovalent hydrocarbon radical having 1, 2, 3, 4, 5, or 6 carbon atoms (“C1--C6 alkyl”) and can be linear, branched, or a combination thereof.
  • C1-C6 alkyl includes C1-C5 alkyl, C1-C4 alkyl, and C.1-C3 alkyl. Examples of C1-C6 alkyls include methyl, ethyl, propyl, isopropyl, sec-butyl, tert-butyl, n-butyl, 2-butyl, pentyl, and hexyl.
  • Alkyl as defined above, and can be linear, branched, or a combination thereof.
  • alkoxys include, for example, methoxy, ethoxy, propoxy, 2-propoxy, butoxy, sec-butoxy, and tert-butoxy.
  • perfluoroalkyl means an alkyl group as defined above in which all of the hydrogen atoms are replaced by fluorine atoms.
  • perfiuoroalkoxy means an aikoxy group in which the alkyl moiety is a perfluoroalkyl group as defined above.
  • hydroxylalkyl as used herein means an alkyl group as defined above which is substituted with a hydroxyl group.
  • alkoxylaikyi means radicals of the formula -O- (03 ⁇ 4)/,- , in which a and b independently are 1, 2, 3, 4, 5, or 6.
  • cycloaikyl is a saturated or partially saturated 3- to 14-membered ⁇ i.e., a 3-, 4-, 5-, 6, 7-, 8-, 9-, 10-, 11-, 12-, 13-, or 14-membered) monocyclic or polycyclic ring, such as a 5- , 6-, or 7-membered monocyclic ring or a 10-membered bicyclic ring, in which all of the ring members are carbon atoms.
  • Examples of cycloalkyls include cyclobutyl,
  • Al when used alone or as part of another term, means a carbocyclic aromatic ring containing 5 to 14 members ⁇ e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 members) and can be monocyclic or polycyclic.
  • aryls include phenyl, naphthyl, anthryl, and phenanthryl.
  • heterocycle is a saturated or a partially saturated 4- to 14-membered (i.e., 4-, 5-, 6-, 7-, 8-, 9-, 10-, 1 1 -, 12-, 13-, or 14- membered) monocyclic or polycyclic (fused) ring, such as a 5-, 6-, or 7-membered monocyclic ring or a 10-membered bicyclic ring which has 1 , 2, 3, or 4 heteroatoms selected from nitrogen (N), oxygen (O), and sulfur (S). Any of the nitrogen and sulfur heteroatoms optionally can be oxidized, and any nitrogen heteroatom optionally can be quateniized.
  • a heterocyclic ring can be attached at any suitable heteroatom or carbon atom.
  • heterocycles include azepinyl, furyl, thienyl, pyrrolyl, pyrazolyl, imidazolvi, pyridyl, pyrazinyl, pyrimidinyi, pyridazinyl, triazolyl, isobenzofuranyl, furazanyl, indolyi, quinolinyi, oxazolyl, imidazolinyl, isoxazolyi, quinolyi,
  • heteroaryf is a saturated 4- to 14 ⁇ membered (i.e., 4-, 5-, 6-, 7 ⁇ , 8-, 9-, 10-, 11-, 12-, 13-, or 14-membered) monocyclic or polycyclic (fused) ring, such as a 5-, 6-, or 7- membered monocyclic ring or a 10-membered bicyclic ring which has 1 , 2, 3, or 4 heteroatoms sel ected from nitrogen (N), oxygen (O), and sulfur (S), Any of the ni trogen and sulfur heteroatoms optionally can be oxidized, and any nitrogen heteroatom optional ly can be quateniized.
  • a heteroarv! can be attached at any suitable heteroatom or carbon atom.
  • heteroaiyls examples include pyridyl, imidazolvi, pyrrolyl, thienyl, furyl, pyranyl, pyrimidinyi, pyridazinyl, indolyi, quinolyi, naphthyridinyl, and isoxazolyi.
  • IRE- la inhibitor compounds directly inhibit IRE- l a.
  • the compounds are understood to act through inhibition of the RNAse activity of the enzyme.
  • IRE- la inhibitor compounds form a complex with IRE- la.
  • this activity is detected as cleavage of a human mini-XBP-1 mRNA stem- loop substrate 5'- CAGUCCGCAGGACUG-3' (SEQ ID NO: l) by IRE-la in vitro by 10 to 100%.
  • Other substrates also can be used to detect cleavage. See US 2007/0105123.
  • IRE-la inhibitor compounds can meet either or both of the following criteria: a. Some compounds inhibit IRE-la in the in vitro assay with an IC50 of
  • Some compounds inhibit IRE-1 a in an in vivo XBP-1 splicing assay (e.g., in myeloma ceils) with an EC50 in the range of approximately 0.05-80 ⁇ . Some of these compounds have an ECO50 in this assay of approximately 10-80 ⁇ , Others have an ECO50 in this assay of approximately 1-10 ⁇ . Still others have an ECO50 in this assay of approximately 0.05-1 ⁇ .
  • Some embodiments specifically include and some embodiments only include compounds which have stractural formula (A):
  • R3 and R4 independently are hydrogen; halogen; hydroxyl; optionally substituted alkyl; or optionally substituted alkoxyl; or optionally substituted alkylammo.
  • Optional substituents for the alkyl or for the uikoxyl and alkylammo are (1) a CI ⁇ C6 hydrocarbon chain containing an N or O atom and optionally substituted with a C1-C3 perfluoroalkyl, and (2) a cycloalkyl which may contain 1 or 2 heteroatoms selected from N, O, and S, and which is optionally substituted with a C1-C3 perfluoroalkyl;
  • Q5, Q6, Q7 and Q8 (used throughout this specification interchangeably with Qs, ⁇ 3 ⁇ 4, Q? and Qg), together with the benzene ring to which they are attached, form a benzofused ring.
  • Q7 is a bond which connects Q6 and Q8.
  • the benzofused ring may or may not be fully aromatic.
  • Q7 is CR7, CR7R7', N, R7, NOOR7, O, S, C O. or a bond;
  • Q5, Q6, Q7 (when not a bond), and Q8 must be a heteroatom selected from N, S, and O and Q5, Q6, Q7, and Q8 do not form O-O, O-N, () S. or () ( ' C () bonds,
  • R5, R5', R6, R6 f , R7, R7', R8, and R8 f are independently hydrogen; R21; 10 ;
  • R10 , R10 and O a 5- or 6-membered heteroaryl that is substituted with 1, 2, or 3 substituents independently selected from the group consisting of halogen,— CN, alkyl, peril uoroaikyi, alkoxy, hydroxylalkyl,
  • R5 and R6 together with the carbon atoms to which they are attached, form a 5-membered eycioalkyl.
  • 5, R5', R6, R6', R7, R7', R8, and R8' are not simultaneously hydrogen; when R5, R5', R6, R6', R7, R7 f , R8, and R8 f are independently
  • RIO is independently hydrogen; alkyl; alkoxvlalkyi; perfluoroaikoxylalkyl; aryl, optionally substituted with 1 , 2, or 3 substituents independently selected from
  • R21 a 5- or 6-membered heteroeycle, optionally substituted with 1, 2, or 3 substituents independently selected from R21; a 5- or 6-membered heteroaryl, optionall substituted with 1, 2, or 3 substituents independently selected from
  • si is 0, 1, 2, or 3: or and RiO, together with the nitrogen atom to which they are attached, form a
  • heteroeycle containing I, 2, 3, or 4 heteroatoms selected from N, O, and S, optionally substituted with 1, 2, or 3 substituents selected independently from
  • Rll is hydrogen; alkyl; aryl; heteroaryl containing 1 or 2 heteroatoms selected from N, (), and S; arylalkyl; heteroarylalkyl in which the heteroaryl contains 1 or 2
  • heteroatoms selected from N, (J. and S;
  • R12 is amino; alkoxy; aryl, optionally substituted with 1, 2, or 3 substituents selected independently from Rll; a 5- or 6-membered heteroeycle having 1, 2, or 3 heteroatoms selected from , O, and 8 and optionally substituted with 1, 2, or 3 substituents selected independently from Rll; or a 5- or 6-membered heteroaryl having 1 , 2, or 3 heteroatoms selected from N, O, and S and optionally substituted with 1, 2, or 3 substituents selected independently from Rll;
  • R13 is alkyl; alkoxvlalkyi; perfluoroalkoxyialkyl; aryl, optionally substituted with 1, 2, or 3 substituents independently selected from R21 ; a 5- or 6-membered heteroeycle, optionally substituted with 1, 2, or 3 substituents independently selected from R21; a 5- or 6-membered heteroaryl, optionally substituted with 1 , 2, or 3 substituents independently selected from R21; or , wherein s is 0, 1, 2, or 3; and R14 is hydrogen or R13; or d R14, together with the nitrogen to which they are attached, form a heterocycle containing 1, 2, or 3 heteroatoms selected independently from N, O, and S, optionally substituted with 1, 2, or 3 substituents selected independently from mino; alkoxy; aryl, optionally substituted with 1, 2, or 3 substituents selected independently from R21; a 5- or 6-membered heterocycle having 1, 2, or 3 heteroatoms selected from N, O, and S and optionally substituted with
  • n 0, 1 , 2, or 3; and R18 is hydrogen or R17; or R17 and R18, together with the nitrogen to which they are attached, form a heterocycle containing 1 , 2, 3, or 4 heteroatoms selected independently from N, O, and 8, optionally substituted with 1, 2, or 3 substituents selected independently from R20;
  • R19 is alkoxy; aryl, optionally substituted with 1, 2, or 3 substituents selected
  • R21 independently from R21 ; a 5- or 6-membered heterocycle, optionally substituted with 1, 2, or 3 substituents independently selected from R21; or a 5- or 6- membered heteroaryl, optionally substituted with 1, 2, or 3 substituents independently selected from R21;
  • R20 is a 5- or 6-membered heterocycle having 1 or 2 heteroatoms selected from N, O, and S and optionally substituted with 1 , 2, or 3 substituents selected
  • R21 independently from R21 ; a 5- or 6-membered heteroaryl, optionally substituted with 1, 2, or 3 substituents selected independently from R21; or R 1; and
  • R21 is halogen, perfiuoroalkyl, perfluoroalkoxy,— CN,— CONH 2 ,— CON(CH 3 ) 2 , alkyl, alkoxy, hydroxy 1 alkyl, or alkoxylalkyl, with the exception of the compounds excluded from structural formulae (A-l), (A- 2), (A-3), (A-4), (A-5), (A-6), and (A-7), below.
  • R ⁇ O includes the following, in which "X" is halogen
  • Some embodiments specifically include and some embodiments only include compounds which have structural formula (A-l):
  • R3, R4, R5, and R6 are as defined in structural formula (A), PROVIDED THAT if R3 and R4 are both hydrogen and R5 is methyl, then R6 cannot be ethyl or unsubstituted phenyl. In other embodiments, such compounds are specifically excluded from structural formula (A).
  • Structural formula (A-l a) Some embodiments specifically include and some embodiments only include compounds of structural formula (A-l) in which R5 is hydrogen; halogen; CN; optionally substituted alkyl; or an optionally substituted alkoxyi.
  • Optional substituents for the alkyl and for the alkoxyl are (1) a C1-C6 hydrocarbon chain containing an N or O atom and optionally substituted with a C1-C3 perfluoroalkyl, and (2) a cycloalkyl which may contain 1 or 2 heteroatoms selected from N, O, and S, and which is optionally substituted with a C1-C3 perfluoroalkyl.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-l).
  • embodiments only include compounds of structural formula (A-l) in which 6 is a side chain selected from the group consisting of alky I, perfluoroalkyl, alkoxyl, hydroxylalkyl, alkoxylaikyi, and perfluoroalkoxyl, each optionally substituted with 1-3 substituents selected from halogen,— CN, alkyl, perfluoroalkyl, alkoxy, hydroxylalkyl, alkoxylaikyi, and perfluoroalkoxyl.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-l ).
  • embodiments only include compounds of structural formula (A-l) in which R6 is alkenyi, alkyne, phenyl, or a 5- or 6-membered heteroaryl, each optionally substituted with 1 2, or 3 substituents independently selected from the group consisting of
  • K io , io , O , 0 , K 10 , wherem n is 0, 1, or 2; 9 and RIO are as defined in connection with structural formula (A). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l).
  • embodiments only include compounds of structural formula (A-l) in which a.
  • R4 is hydrogen, alkoxyl, or hydroxyl
  • R5 is hydrogen, alkyl, alkoxyl, alkylamino, CF3 ⁇ 4, or, together with R6 and the carbon atoms to which they are attached, forms a five-membered cycioalkyl.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-1 ).
  • Structural formula (A-lf) Some embodiments specifically include and some embodiments only include compounds of structural formula (A-1) in which a. 4 is hydrogen, alkoxyl, or hydroxyl and b. R6 is hydrogen; alkenyl, alkyl, or phenyl, each optionally substituted with 1 , 2, or 3 substituents independently selected from the group consisting of halogen,— CN, alkyl, perfluoroalkyl, alkoxy, hydroxylaikyi, alkoxylalkyl, perfluoroalkoxy,
  • R10 , R10 and - O a 5- or 6-membered heteroaryl that is substituted with 1, 2, or 3 substituents independently selected f om the group consisting of halogen,— CN, alkyl, perfluoroalkyl, alkoxy, hydroxylaikyi,
  • alkoxylalkyl perfluoroalkoxyl, ⁇ , and f ® ;
  • R10 wherein si is 0, 1 , or R5 and R6, together with the carbon atoms to which they are attached, form a 5-membered cycioalkyl.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-1).
  • Structural formula (A-lg) Some embodiments specifically include and some embodiments only include compounds of structural formula (A-1) in which R5 is hydrogen, alkyl, alkoxyl, alkylamino, CF 3 , or, together with R6 and the carbon atoms to which they are attached, forms a five-membered cycloalkyl. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l).
  • Structural formula (A-lh) Some embodiments specifically include and some embodiments only include compounds include only compounds of structural formula (A- 1) in which a. 5 is hydrogen, alkyl, alkoxyi, alkylamino, CF 3 , or, together with R6 and the carbon atoms to which they are attached, forms a five-membered cycloalkyl and b.
  • R6 is hydrogen; alkenyl, alkyl, or phenyl, each optionally substituted with 1 , 2, or 3 substituents mdependently selected from the group consisting of halogen,— CN, alkyl, periluoroalkyi, alkoxy, hydroxylalkyl, alkoxylalkyl, perfiuoroalkoxy, and ⁇ O ; a 5- or 6-membered eteroaryl that is substituted with 1 , 2, or 3 substituents independently selected from the group consisting of halogen,— CN, alkyl, periluoroalkyi, alkoxy, hydroxylalkyl,
  • R5 and R6 together with the carbon atoms to which they are attached, form a 5-membered cycloalkyl.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-l).
  • Structural formula (A-li) Some embodiments specifically include and some embodiments only include compounds of structural formula (A-l) in which R6 is independently hydrogen; alkenyl, alkyl, or phenyl, each optionally substituted with 1 , 2, or 3 substituents independently selected from the group consisting of halogen,— CN, alkyl, perfluoroa!ky!, alkoxy, hydroxylalkyl, alkoxylalkyl, perfluoroalkoxv,
  • n 0, 1 , - ; or R5 and 6, together with the carbon atoms to which they are attached, form a 5-merabered cycloalkyl.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-l ).
  • Structural formula (A-lj) Some embodiments specifically include and some embodiments only include compounds of structural formula (A-l) in which a. R4 is hydrogen, alkoxyl, or hydroxyl, b. R5 is hydrogen, alkyl, alkoxyl, alkylamino, CF 3 , or, together with 6 and the carbon atoms to which they are attached, forms a five-membered cycloalkyl, and c. R6 is hydrogen; alkenyl, alkyl, or phenyl, each optional ly substituted with 1 , 2, or
  • R10 5 R10 and O ; a 5- or 6-membered heteroaryl that is substituted with 1 , 2, or 3 substituents independently selected from the group consisting of halogen,— CN, alkyl, perfluoroalkyl, alkoxy, hydroxylalkyl,
  • R' 10 wherein si is 0, 1 , or 2; 10 ; or R5 and R6, together with the carbon atoms to which they are attached, form a 5-membered cycloalkyl.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-l).
  • Structural formula (A-lk) Some embodiments specifically include and some embodiments only include compounds of structural formula (A-l) in which a. R4 is hydrogen, alkoxyl, or hydroxy!, b. R5 is hydrogen, alkyl, alkoxyl, alkylarnino, CF 3 , or, together with R6 and the carbon atoms to which they are attached, forms a five-membered cycloalkyl, and c.
  • R6 is hydrogen; alkenyl, alkyl, or phenyl, each optional ly substituted with 1 , 2, or 3 substituents independently selected from the group consisting of halogen,— CN, alkyl, perfluoroalkyl, al koxy, hydroxylalkyl, alkoxylalkyl, perfj.uoroai.koxy,
  • such compounds are specifically excluded from structural formulae (A) and/or (A-l).
  • Structural formula (A-ll) Some embodiments specifically include and some embodiments only include compounds of structural formula (A-l) in which a. R4 is hydrogen, alkoxyl, or hydroxy!, R5 is hydrogen, alkyl, aikoxyl, alkylamino, CF 3 , or, together with R6 and the carbon atoms to which they are attached, forms a iive-membered cycloalkvl, and
  • R6 is a 5- or 6-membered heteroaryl that is substituted with 1, 2, or 3 substituents independently selected from the group consisting of halogen, CN, alkyl,
  • such compounds are specifically excluded from structural formulae (A) and/or (A-l).
  • Structural formula (A-l m) Some embodiments specifically include and some embodiments only include compounds of structural formula (A-l) in which a. R4 is hydrogen, aikoxyl, or hydroxyl, b. R5 is hydrogen, alkyl, aikoxyl, alkylamino, CF 3 , or, together with R6 and the carbon atoms to which they are attached, forms a five-membered cycloalkvl, and
  • such compounds are specifically excluded from structura formulae (A) and/or (A-l).
  • formula (A- In) Some embodiments specifically include and some embodiments only include compounds of structural formula (A-l ) in which a. R4 is hydrogen, b. R5 is hydrogen, alkyl, aikoxyl, alkylamino, CF 3 , or, together with R6 and the carbon atoms to which they are attached, forms a five-membered cycloalkvl, and c.
  • R6 is hydrogen; aikenyl, alkyl, or phenyl, each optionally substituted with 1, 2, or 3 substituents independently selected from the group consisting of halogen,— CN, alkyl, perfluoroalkyl, alkoxy, hydroxyiaikyi, alkoxylalkyl, perfluoroalkoxy, 0
  • R10 RIO and ⁇ O ; a 5- or 6-membered heteroaryl that is substituted with 1, 2, or 3 substituents independently selected from the group consisting of halogen,— CN, alkyl, perfluoroalkyl, alkoxy, hydroxyiaikyi,
  • alkoxylalkyl perfluoroalkoxyl, O , and O ;
  • R10 wherein n is 0, 1, 5 and R6, together with the carbon atoms to which they are attached, form a 5-membered cvcloaikyi.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-l).
  • R6 is hydrogen; aikenyl, alkyl, or phenyl, each optionally substituted with 1 , 2, or 3 substituents independently selected from the group consisting of halogen,— CN, alkyl, perfluoroalkyl, alkoxy, hydroxyiaikyi, alkoxylalkyl, perfluoroalkoxy, and O ; a 5- or 6-membered heteroaryl that is substituted with 1, 2, or 3 substituents independently selected from the group consisting of halogen,— CN, alkyl, perfluoroalkyl, alkoxy, hydroxylalkyl,
  • R ' l 0 wherein si is 0, 1 , or 2; R10 : or R5 and R6, together with the carbon atoms to which they are attached, form a 5-membered cvcioalkyl.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-l).
  • embodiments only include compounds of structural formula (A-l) in which a. R4 is hydroxyl, b. R5 is hydrogen, alkyl, alkoxy I, alkylarmno, CF 3 , or, together with R6 and the carbon atoms to which they are attached, forms a five-membered cvcioalkyl, and c. R6 is hydrogen; alkenyl, alkyl, or phenyl, each optional ly substituted with 1, 2, or 3 substituents independently selected from the group consisting of halogen,— CN, alkyl, perfluoroalkyl, alkoxy, hydroxylalkyl, alkoxylalkyl, perfj.uoroai.koxy,
  • RI O s R10 and s O a 5- or 6-membered heteroaryl that is substituted with 1, 2, or 3 substituents independently selected from the group consisting of halogen, CN, alkyl, perfluoroalkyl, alkoxy, hydroxylalkyl,
  • such compounds are specifically excluded from structural formulae (A) and/or (A-l).
  • Structural formula (A-lq) Some embodiments specifically include and some embodiments only include compounds of structural formula (A-l) in which a. R4 is hydrogen, alkoxyl, or hydroxy!, b. R5 is hydrogen, alkyl, al koxyl, a!ky!amino, or CF 3 , and c.
  • R6 is hydrogen; alkenyl, alkyl, or phenyl, each optionally substituted with 1 , 2, or 3 substituents independently selected from the group consisting of halogen,— CN, alkyl, perfl.uoroalk.yl, alkoxy, hydroxylalkyl, alkoxylalkyl, periluoroalkoxy, and - f O ; a 5- or 6-membered heteroaryl that is substituted with 1 , 2, or 3 substituents independently selected from the group consisting of halogen,— CN, alkyl, peril uoroalkyl, alkoxy, hydroxylalkyl,
  • such compounds are specifically excluded from structural formulae (A) and/or (A-l).
  • Some embodiments specifically include and some embodiments only include (.1 ) compounds of structural formula (A- la) and (2) compounds of any of structural formulae (A-lb), (A-lc), (A-ld), (A-le), (A-l f), (A-lg), (A-lh), (A-li), (A-lj), (A-! k), (A-l l), (A- lm), (A-ln), (A-lo), (A-lp), and (A-lq). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l ).
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-la) and (2) compounds of up to 16 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, or 16) of structural formulae (A- lb), (A-l c), (A-ld), (A- le), (A-lf), (A-lg), (A-lh), (A-li), (A-lj), (A-lk), (A-ll), (A-lm), (A- In), (A-lo), (A- Ip), and (A-lq).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-l).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-l).
  • Each possible combination is specifical ly contemplated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include (1 ) compounds of stractural formula (A-lc) and (2) compounds of any of structural formulae (A-la), (A- l b), (A-l d), (A-le), (A- I f), (A-l g), (A-lh), (A-li), (A-lj), (A-l k), (A-11), (A- 1m), (A- In), (A-lo), (A-lp), and (A-lq).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-l ).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-l c) and (2) compounds of up to 16 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, or 16) of structural formulae (A-la), (A-l b), (A-ld), (A- le), (A-lf), (A-lg), (A-lh), (A-li), (A-lj), (A-lk), (A-11), (A-lm), (A- In), (A-lo), (A- Ip), and (A-l q).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-l).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-l d) and (2) compounds of any of structural formulae (A-l a), (A-lb), (A-ic), (A-le), (A-li), (A-lg), (A-lh), (A-H), (A-lj), (A-l k), (A-li), (A- lm), (A- In), (A-lo), (A- lp), and (A-l q).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-l).
  • Each possible combination is specifically contemplated as if set forth expli citly herein.
  • stractural formulae A-la
  • A-lb A-ic
  • A- le e.g., A- lh
  • A- li e.g
  • A-lj e.g
  • A-li e.g
  • A-lj e.g
  • A-lj e.g
  • A-lh
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-le) and (2) compounds of any of structural formulae (A-l a), (A-lb), (A-le), (A-ld), ( ⁇ - ⁇ ' ). (A-lg), (A-l h), (A-l i), (A-lj), (A-lk), (A-11), (A- lm), (A-ln), (A-lo), (A-lp), and (A-lq). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or ( ⁇ - ). Each possible combination is specifically contemplated as if set forth explicitly herein,
  • such compounds are specifically excluded from structural formulae (A) and/or (A-l).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-l ).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-l ).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-! ).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-l ).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-l).
  • Each possible combination is specifically contemplated as if set forth expli citly herein.
  • such compounds are specifically excluded from structural formulae (A ) and/or (A-l).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-li) and (2) compounds of up to 16 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, or 16) of structural formulae (A- la), (A-lb), (A-lc), (A- ld), (A-le), (A-lf), (A-lg), (A-lh), (A-lj), (A- lk), (A- 11), (A-lm), (A-ln), (A-lo), (A- Ip), and (A-lq).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-l).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-l ).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-l).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from stmcturai formulae (A) and/or (A-l ).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from stmcturai formulae (A) and/or (A-l).
  • Each possible combination is specifically con templated as if set forth explicitly herein.
  • such compounds are specifically excluded from stmcturai formulae (A) and/or (A-l).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A) and/or ( ⁇ - ⁇ ).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-l ).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • compounds of structural fommla (A-l o) and (2) compounds of any of structural formulae (A- la), (A-lb), (A- lc), (A-ld), (A- le), (A-l f), (A-lg), (A- lh), (A- li), (A - l h. (A-l k), (A- 11), (A-lm), (A-ln), (A-lp), and (A-lq).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-l).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-l).
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-lp) and (2) compounds of any of structural formulae (A-l a), (A-lb), (A-le), (A-ld), (A-le), (A-lf), (A-lg), (A-l h), (A-li), (A-lj), (A- lk), (A-11), (A-lm), (A- In), (A-lo), and (A-lq).
  • compoimds are specifical ly excluded from structural formulae (A) and/or (A-l).
  • Each possible combination is specifically contemplated as if set forth explicitly herein,
  • Some embodiments specifically include and some embodiments only include (1 )
  • Structural formula (A-2a) Some embodiments specifically include and some embodiments only include compounds of structural formula (A-2) in which R3, R4, R5, R5 f , R7, R7', R8, and R8' are hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A.) and/or (A-2).
  • Structural formula (A-2b) Some embodiments specifically include and some embodiments only include compounds of structural formula (A-2) in which R6 is a side chain selected from the group consisting of alkyl, perfluoroalkyl, alkoxyl, hydroxyialkyl, alkoxylalkyl, and perfluoroalkoxyl, each optionally substituted with 1-3 substituents selected from halogen,— CN, alkyl, perfluoroalkyl, alkoxy, hydroxyialkyl, alkoxylalkyl, and perfluoroalkoxyl. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-2).
  • Structural formula (A-2c) Some embodiments specifically include and some embodiments only include compounds of structural formula (A-2) in which R7' is hydrogen and R7 is a side chain selected from the group consisting of alkyl, perfluoroaikyi alkoxyl, hydroxylalkyl, alkoxylalkyl, and perfluoroalkoxyl, each optionally substituted with 1-3 substituents selected from halogen,— CN, alkyl, perfluoroaikyi, aikoxy, hydroxylalkyl, alkoxylalkyl, and perfluoroalkoxyl. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-2).
  • Structural formula (A-2d) Some embodiments specifically include and some embodiments only include compounds of structural formula (A-2) in which R6 is alkenyi, alkyne, phenyl, or a 5- or 6-membered heteroaryl, each optionally substituted with 1 2, or 3 substituents independently selected from the group consisting of
  • n 0, 1, or 2;
  • R9 and R10 are as defined in connection with structural formula (A).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-2).
  • Some embodiments specifically include and some embodiments only include compounds which have structural formula (A-3):
  • R3, R4, R6, and R7 are as defined in structural formula (A), PROVIDED THAT: i. if R3 and R4 are hydrogen and R6 is optionally substituted phenyl, then R7 cannot be optional!)' substituted phenyl, hydrogen, methyl, or
  • R3 and R4 are hydrogen and R6 is methoxy, then R7 is not methyl or unsubstituted phenyl;
  • R6 is not fluorophenyl; iv. if R3 is halogen and R4 and R7 are hydrogen, then R6 is not
  • v. R6 and R7 cannot both be methyl if either:
  • R3 is halogen and R4 is hydrogen
  • R3 and R4 are methyl and the other is hydrogen.
  • Structural formula (A-3a) Some embodiments specifically include and some embodiments only include compounds of structural formula (A-3) in which R6 is a side chain selected from the group consisting of alkyl, perfluoroalkyl, alkoxyi, hydroxylalkyi C1-C6 alkoxylalkyl, and perfluoroalkoxyi, each optionally substituted with 1-3 substituents selected from halogen,— CN, alkyl, perfluoroalkyl, alkoxy, hydroxylalkyi, alkoxylalkyl, and perfluoroalkoxyi. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3).
  • Structural formula (A-3b) Some embodiments specifically include and some embodiments only include compounds of structural formula (A-3) in which R6 is alkenyl, or alkynyl, or phenyl, or a 5- or 6-membered heteroaryl, each optionally substituted with 1 2, or 3 substituents independently selected from the group consisting
  • embodiments only include compounds of structural formula (A-3) in which R7 is hydrogen; halogen;— CN; optionally substituted alkyl; or optionally substituted alkoxyi.
  • Optional substituents for the alky] and for the alkoxyi are (1) a C1-C6 hydrocarbon chain containing an N or O atom and optional!)' substituted with a C1-C3 perfluoroalkyl, and (2) a cycloaikyi which may contain 1 or 2 heteroatoms selected from N, O, and S, and which is optionally substituted with a C1-C3 perfluoroalkyl.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-3).
  • embodiments only include compounds of structural formula (A-3) in which R9 and R10 are independently hydrogen, C2-C6 alkyl, alkoxylalkyl, perfluoroalkoxylalkyl, aryl, optionally substituted with 1, 2, or 3 substituents independently selected from R2i. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3).
  • embodiments only include compounds of structural formuia (A-3) in which R9 and RIO are independently a 5- or 6-membered heterocycle, optionally substituted with 1, 2, or 3 substituents independently selected from R21. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3).
  • embodiments only include compounds of structural formula (A-3) in which R9 and RIO are independently a 5- or 6-membered heteroaryl, optionally substituted with 1 , 2, or 3 substituents independently selected from R21; or ' n K i 2 , wherein n is 0, 1, 2, or 3 and R12 is as defined in structural formula (A). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3).
  • embodiments only include compounds of structural formula (A-3) in which R9 and RIO, together with the nitrogen atom to which they are attached, form a heterocycle containing 1 , 2, 3, or 4 heteroatoms selected from N, O and S, optionally substituted with 1 , 2, or 3 substituents selected independently from Rll, wherein Ril is defined as in structural formula (A).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-3).
  • embodiments only include compounds of structural formula ( A-3) which R6 is alkenyl, or alkynyl, or phenyl, or a 5- or 6-membered heteroaryl, each optionally substituted with
  • embodiments only include compounds of structural formula (A-3) in which R7 is methyl. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3).
  • embodiments only include compounds of structural formula (A-3) in which a. R7 is alkyl. b. R6 is alkenyl, or alkynyi, or phenyl, or a 5- or 6-membered heteroaryl, each
  • such compounds are specifically excluded from stnictural formulae (A) and/or (A-3). ] Structural formula (A-31). Some embodiments specifically include and some
  • embodiments only include compounds of structural formula (A3) in which 3 is alkoxyl. Some embodiments specifically include and some embodiments only include compounds of structural formula (A-3) in which R3 is methoxy. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3).
  • embodiments only include compounds of structural formula (A-3) in which a. R7 is methyl and b. R3 is alkoxyl.
  • such compounds are specifically excluded from stmctural formulae (A) and/or (A-3).
  • embodiments only include compounds of structural formula (A-3) in which a. R7 is methyl; b. R3 is alkoxyl; and c. R6 is alkenyl, or alkynyl, or phenyl, or a 5- or 6-merabered heteroaryl, each
  • si is 0, 1, or hich R9 and Rf 0 are defined as in structural formula (A).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-3).
  • Structural formula (A-3o) Some embodiments specifically include and some embodiments only include compounds of structural formula (A-3) in which a. R7 is methyl and b. R3 is methoxy.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-3).
  • embodiments only include compounds of structural formula (A-3) in which a. 7 is methyl; b. R3 is methoxy; and c. R6 is alkenyl, or alkynyl, or phenyl, or a 5- or 6-membered heteroaiyl, each
  • n 0, 1, or 2; ; ; O ; or O O , in which R9 and RIO are defined as in structural formula (A).
  • such compounds are specifically excluded from structural form lae (A) and/or (A-3).
  • embodiments only include compounds of structural formula (A-3) in which a. R7 is alky I and b. R3 is alkoxyl. In other embodiments, such compounds are specifically excluded from stmctural formulae (A) and/or (A-3).
  • embodiments only include compounds of structural formula (A-3) in which a. R7 is alkyl, b. R3 is alkoxy!, and c. R6 is alkenyl, or alkynyl, or phenyl, or a 5- or 6-membered heteroaryl, each
  • n 0, 1, or 2; ; or O O , in which R9 and RIO are defined as in structural formula (A).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-3).
  • such compounds are specifically excluded from structural form lae (A) and/or (A-3).
  • embodiments only include compounds of stmctural formula (A-3) in which R3 is hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3).
  • embodiments only include compounds of structural formuia (A-3) in which R4 is hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3).
  • embodiments only include compounds of structural formula (A-3) in which R3 and R4 are hydrogen. In other embodiments, such compounds are specifically excluded from stmctural formulae (A) and/or (A-3).
  • embodiments only include compounds of structural formula (A-3) in which a. R3 is methoxy and b. R4 is hydrogen.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-3).
  • embodiments only include compounds of structural formula (A-3) in which a. R3 is methoxy, b. R4 is hydrogen, and c. R7 is methyl.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-3).
  • Structural formula (A-3y) Some embodiments specifically include and some embodiments only include compounds of structural formula (A-3) in which a. R4 is methoxy and b. R7 is methyl
  • such compounds are specifically excluded from structural formulae (A) and/or (A-3).
  • embodiments only include compounds of stmctural formula (A-3) in which a. R3 is hydrogen and b. R6 is alkenyl, or aikynyl, or phenyl, or a 5- or 6-membered heteroaryl, each
  • n 0, 1, or , in which R9 and RIO are defined as in structural formula (A).
  • such compounds are specifically excluded from stmctural form lae (A) and/or (A-3).
  • embodiments only include compounds of structural formula (A-3) in which a.
  • R4 is hydrogen and b.
  • R6 is alkenyl, or aikynyl, or phenyl, or a 5- or 6-membered heteroaryl, each
  • is 0, 1 , or 2; R io ; * S ; O ; or O O , in which R9 and RIO are defined as in structural formula (A).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-3).
  • embodiments only include compounds of stmctural formula (A-3) in which a. R3 and 4 are hydrogen and b. R6 is alkenyl, or alkynyl, or phenyl, or a 5- or 6-membered heteroaryl, each
  • n 0, 1 , or 2; , in which R9 and RiO are defined as in structural formula (A).
  • such compounds are specifically excluded from stmctural form lae (A) and/or (A-3).
  • embodiments only include compounds of structural formula (A-3) in which a. R3 is methoxy, b. R4 is hydrogen, and c. R6 is alkenyl, or alkynyi, or phenyl, or a 5- or 6-membered heteroaiyi, each o tionally substituted with 1 , 2, or 3 substituents independently selected from the
  • n 0, 1 , or 2; R io ; f " S !' ; O ; or O O , in which 9 and RIO are defined as in structural formula (A).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-3).
  • such compounds are specifically excluded from stnictural formulae (A) and/or (A-3).
  • Some embodiments specifically include and some embodiments only include compounds of structural formula (A-3) in which a. R4 is methoxy, b. R7 is methyl, and c. R6 is alkenyl, or alkynyl, or phenyl, or a 5- or 6-membered heteroaryl, each optionally substituted with 1 , 2, or 3 substituents independently selected from the
  • n 0, 1 , or 2; R io ; ; O ; or O O , in which R9 and RIO are defined as in structural formula (A).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-3), Some embodiments specifical ly include and some embodiments only include (1) compounds of structural formula (A-3a) and (2) compounds of any of stmctural formulae (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A- 3m), (A-3n), (A-3o), ( ⁇ ⁇ 3 ⁇ (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A- 3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee).
  • stmctural formulae A-3b
  • A-3c A-3d
  • A-3e A-3f
  • A-3g A
  • such compounds are specifically excluded from stmctural formulae (A) and/or (A-3).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include (! ) compounds of stmctural formula (A-3a) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of stmctural formulae (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A-3x), (
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-3b) and (2) compounds of any of structural formulae (A-3a), (A c ). (A-3d), (A-3e), ( ⁇ -3 ⁇ ). (A-3g), (, ⁇ -3h ). (A - 3i ). (A-3j), ( A - k )..
  • such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A -3b) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae ( A ⁇ 3a), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee).
  • such compounds are specifically excluded from structural formulae (A) and/or
  • structural formulae A-3a), (A-3b), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-31), (A-3j), (A-3k), (A-31), (A- 3m
  • such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein. [135] Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-3c) and (2) compounds of up to 30 (e.g.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-3).
  • Each possibie combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-3).
  • Some embodiments specifically include and some embodiments only include (I)
  • such compounds are specifically excluded from structural formulae (A) and/or (A-3).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include (1)
  • A-3a A-3b
  • A-3c A-3dd
  • A-3ee compounds of structural formulae (A ⁇ 3g) and (2) compounds of any of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3h
  • such compounds are specifical ly excluded from stractural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
  • compounds of structural formula (A-3h) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-3a), (A-3b), (A-3c), (A ⁇ 3d), (A-3e), (A-3f), (A-3g), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A - 3l ).
  • structural formulae A-3a), (A-3b), (A-3c), (A ⁇ 3d), (A-3e), (A-3f), (A-3g), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r),
  • such compounds are specifical ly excluded from structural formulae (A) and/or (A-3).
  • compounds of structural formula (A-3j) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-3 a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3k), (A-3I), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-3).
  • Each possible combination is specifically contemplated as
  • such compounds are specifically excluded from structural formulae (A.) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
  • compounds of structural formula (A-3k) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-3a), (A-3b), (A-3c), (A -3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A- 3u), (A-3v), (A-3w), (A-3x), (A-3y), (A ⁇ 3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A- 3ee).
  • structural formulae (A-3a), (A-3b), (A-3c), (A -3d), (A-3
  • Such compounds are specifically excluded from structural formulae (A) and/or (A-3).
  • Each possible combination is specifical ly contemplated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-31) and (2) compounds of any of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-31), (A-3j), (A - 3k).
  • compounds of structural formula (A-31) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-3 a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-31), (A-3j), (A-3k), ( A-3m), (A-3n), ( A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A ⁇ 3t), (A-3u), (A-3v), (A-3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee).
  • such compounds are specifical ly excluded from structural formulae (A) and/or (A-3).
  • Each possible combination is specifically contemplat
  • such compounds are specifically excluded from structural formulae (A) and/or (A-3).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include (1 )
  • such compounds are specifically excluded from structural formulae (A.) and/or (A-3).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include (1)
  • Some embodiments specifically include and some embodiments only include (1)
  • compounds of structural formula (A-3p) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-3 a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3q), (A-3r), (A-3s), (A-3t), (A- 3u), (A-3v), (A-3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A- 3ee).
  • structural formulae (A-3 a), (A-3b), (A-3c), (A-3d), (A-3e
  • such compounds are specifically excluded from structural formulae (A) and/or (A-3).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-3q) and (2) compounds of any of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A - 3k h (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v),
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-3q) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of stmctural formulae (A-3 a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), ( A - k ; ⁇ .
  • compounds of structural formula (A-3q) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of stmctural formulae (A-3 a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (
  • Some embodiments specifically include and some embodiments only include (1) compounds of stmctural formula (A-3r) and (2) compounds of any of stmctural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3s), (A-3t), (A-3u), (A-3v), (A-3 ), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee).
  • such compounds are specifical ly excluded from structural formulae (A) and/or (A-3).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-3r) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-3a), (A-3b), (A-3c), (A -3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A ⁇ 3ec), (A-3dd), and
  • such compounds are specifically excluded from structural formulae (A) and/or (A-3).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include (1 )
  • suc compounds are specifically excluded from structural formulae (A) and/or (A-3).
  • Each possible combination is specifically contemplated as
  • such compounds are specifically excluded from structural formulae (A) and/or (A-3).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-3v) and (2) compounds of any of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-3).
  • Each possible combination is specifically contemplated as if set forth explicitly herein,
  • compounds of structural formula (A-3v) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-3 a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee).
  • such compounds are specifical ly excluded from structural formulae (A) and/or (A-3).
  • Each possible combination is specifically contemplat
  • such compounds are specifical ly excluded from structural formulae (A) and/or (A-3).
  • compounds of structural formula (A-3w) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A -3s ).
  • structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A
  • such compounds are specifically excluded from structural formulae (A) and/or (A-3).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include (1 ) compounds of structural formula (A-3x) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A-3y), (A-3z), (A-3aa), (A-3b
  • such compounds are specifical ly excluded from structural formulae (A) and/or (A-3).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A ⁇ 3y ) and (2) compounds of any of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A ⁇ 3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A-3x), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee).
  • such compounds are specifically excluded from structural formulae (A) and/or (A) and/
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-3y) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-3a), (A-3b), ( A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3 ), (A-3x), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee).
  • such compounds are specifically excluded from structural formulae (A) and/or (A) and
  • such compounds are specifically excluded from structural formulae (A) and/or (A-3).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-3z) and (2) compounds of up to 30 (e.g., I , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-3 a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), ⁇ ( .' ⁇ -3k ; ⁇ .
  • compounds of structural formula (A-3z) and (2) compounds of up to 30 (e.g., I , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-3 a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i),
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-3aa) and (2) compounds of any of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A-3x), (A-3y), (A-3z), (A-3bb), (A-3cc), (A-3dd), and (A-3ee).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-3).
  • Each possible combination is specifically contemplated as if set forth explicitly herein,
  • compounds of structural formula (A-3aa) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A ⁇ 3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A-3x), (A-3y), (A-3z), (A-3bb), (A-3cc), (A-3dd), and (A-3ee).
  • such compounds are specifical ly excluded from structural formulae (A) and/or (A-3).
  • Each possible combination is specifically contemplat
  • such compounds are specifical ly excluded from structural formulae (A) and/or (A-3).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-3).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include (1 )
  • such compounds are specifically excluded from structural formulae (A) and/or (A-3).
  • Each possible combination is specifical ly contemplated as if set forth explicitly herein.
  • Structural formula (A-4a) Some embodiments specifically include and some embodiments only include compounds of structural formula (A-4) in which R3, R4, R5, R5', R6, R6', R8, and R8 ? are hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-4).
  • Structural formula (A-4b) Some embodiments specifically include and some embodiments only include compounds of stmctural formula (A-4) in which R7 is hydrogen; halogen;— CN; optionally substituted alkyl; or an optionally substituted alkoxyl.
  • R7 is hydrogen; halogen;— CN; optionally substituted alkyl; or an optionally substituted alkoxyl.
  • Optional substituents for the alkyl and for the alkoxyl are (1) a C1-C6 hydrocarbon chain containing a nitrogen or oxygen atom and optionally substituted with a C1-C3 perfluoroalkyl, and (2) a cycloalkyl which may contain 1 or 2 heteroatoms selected from N, O, and S, and which is optionally substituted with a C1-C3
  • Structural formula (A-4c) Some embodiments specifically include and some embodiments only include compound sof structural formula (A-4) in which R7 is alkyl, perfluoroalkyl, alkoxyl, hydroxylalkyl, alkoxylalkyl, or perfluoiOalkoxyi. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-4).
  • embodiments only include compoundsof structural formula (A-4) in which R7 is a side chain selected from the group consisting of alky 1, perfluoroalkyl, alkox i, hydroxylalkyl, alkoxvlalkyl, and perfiuoroaikoxyl, each optionally substituted with 1 -3 substituents selected from halogen,— CN, alkyl, perfluoroalkyl, alkoxy, hydroxylalkyl, alkoxvlalkyl, and perfiuoroaikoxyl. in other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-4).
  • embodiments only include compoundsof structural formula (A-4) in which 7 is alkenyl, alkyne, phenyl, or a 5- or 6-membered heteroaryl, each optionally substituted with 1 , 2,
  • R9 and RIO are as defined in connection with structural formula (A).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-4).
  • Some embodiments specifically include and some embodiments only include (!) compounds of stractural formula (A-4a) and (2) compounds of any of structural formulae (A-4b), (A -4c), (A-4d), and (A-4e). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-4). Each possible combination is specifical ly contemplated as if set forth explicitly herein. [199] Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A ⁇ 4a) and (2) compounds of up to 4 (e.g., 1 , 2, 3, or 4) of structural formulae (A-4b), (A-4c), (A-4d), and (A-4e). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-4). Each possible combination is specifically contemplated as if set forth explicitly herein.
  • Structural formula (A-5a) Some embodiments include only those compounds of stmctural formula (A-5) in which R3 and R4 are hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-5).
  • Structural formula (A-5b) Some embodiments specifically include and some embodiments only include compoundsof stmctural formula (A-5) in which R6 is alkenyl, alkyne, phenyl, or a 5- or 6-membered heteroaryl, each optionally substituted with 1, 2,
  • n 0, 1 , or 2; R io
  • R9 and RIO are as defined in connection with structural formula (A). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-5).
  • Some embodiments specifically include and some embodiments only include (I) compounds of structural formula (A-5 a) and (2) compounds of structural formula ( A-5b). In other embodiments, (1) compounds of structural formula (A-5a) and (2) compounds of structural formula (A-5b) compounds are specifically excluded from structural formulae (A) and/or (A-5). [212] Some embodiments specifically include and some embodiments only include compounds which have structural formula (A-6a):
  • R3, R4, and R6 are as defined in structural formula (A). In other embodiments, such compounds are specifically excluded from structural formula (A).
  • Structural formula (A-6al) Some embodiments include only those compounds of structural formula (A ⁇ 6a) in which R3 is hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6a).
  • Structural formula (A-6a2) Some embodiments include only those compounds of structural formula (A-6a) in which R4 is hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6a).
  • Structural formula (A-6a3) Some embodiments include only those compounds of structural formula (A-6a) in which R3 and R4 are hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6a).
  • embodiments only include compounds of structural formula (A-6a) in which R6 is hydrogen; halogen;— CN; optionally substituted alkyl; or optionally substituted alkoxyl.
  • Optional substituents for the alkyl and for the aikoxyl are (1) a C1 -C6 hydrocarbon chain containing a nitrogen or oxygen atom and optionally substituted with a C1-C3 perfiuoroalkyl, and (2) a cycloalkyl which may contain 1 or 2 heteroatoms selected from N, O, and S, and which is optionally substituted with a C1-C3 perfiuoroalkyl.
  • such compounds are specifically excluded from structural formulae (A) and/or (A ⁇ 6a).
  • Structural formula (A-6a5) Some embodiments specifically include and some embodiments only include compoundsof structural formula (A-6a) in which R6 is C1-C6 alkyl, C1-C6 perfluoroalkyl, C1-C6 alkoxyl, C1-C6 hydroxylalkyl, C1-C6 alkoxylalkyl, or C1-C6 perfluoroalkoxyi. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6a).
  • Structural formula (A-6a6) Some embodiments include only those compounds of structural formula (A ⁇ 6a) in whic a.
  • R3 is hydrogen and b.
  • R.6 is hydrogen; halogen;— CN; optionally substituted alkyl; or optionally
  • Optional substituents for the alkyl and for the alkoxyl are (1) a C1-C6 hydrocarbon chain containing a nitrogen or oxygen atom and optionally substituted with a C1-C3 perfluoroalkyl, and (2) a cycioalkyl which may contain 1 or 2 heteroatoms selected from N, O, and S, and which is optionally substituted with a C1 -C3 perfluoroalkyl.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6a).
  • Structural formula (A-6a7) Some embodiments include only those compounds of structural formula (A-6a) in which a. R4 is hydrogen and b. R6 is hydrogen; halogen;— CN; optionally substituted alkyl; or optionally
  • Optional substituents for the alkyl and for the al koxyl are (1) a CI-C6 hydrocarbon chain containing a nitrogen or oxygen atom and optionally substituted with a C1-C3 perfluoroalkyl, and (2) a cycioalkyl which may contain 1 or 2 heteroatoms selected from N, O, and S, and which is optionally substituted with a C1-C3 perfluoroalkyl.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6a).
  • Structural formula (A-6a8) Some embodiments include only those compounds of structural formula (A-6a) in which a. R3 and R4 are hydrogen and b. 6 is hydrogen; halogen; CN; optionally substituted a!ky!; or optionally
  • Optional substituents for the alkyl and for the alkoxyl are (1) a C.1 -C6 hydrocarbon chain containing a nitrogen or oxygen atom and optionally substituted with a C 1-C3 perfluoroalkyl, and (2) a cycloalkyl which may contain 1 or 2 heteroatoms selected from N, O, and S, and which is optionally substituted with a C1-C3 perfluoroalkyl.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6a).
  • Structural formula (A-6a9) Some embodiments include only those compounds of structural formula (A-6a) in which a. R3 is hydrogen and b. R6 is C1-C6 alkyl, C1-C6 perfluoroalkyl, C1-C6 alkoxyl, C1-C6 hydroxylalkyl, C1-C6 alkoxylaikyi, or C1 -C6 perfluoroalkoxyl.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6a).
  • Structural formula (A-6all) Some embodiments include only those compounds of structural formula (A-6a) in which a. R3 and R4 are hydrogen and b. 6 is CI -C6 a!ky!, CI -C6 perfluoroalkyl, CI -C6 a!koxyl, CI ⁇ C6 hydroxy lalkyl, C1-C6 alkoxyialkyl, or C1-C6 perfluoroalkoxyl.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6a).
  • embodiments only include compoundsof structural formula (A-6a) in which R6 is a side chain selected from the group consisting of alkyl, perfluoroalkyl, alkoxyl, hydroxyialkyl, alkoxyialkyl, and perfluoroalkoxyl, each optionally substituted with 1-3 substituents selected from halogen,— CN, alkyl, perfluoroalkyl, alkoxy, hydroxyialkyl, alkoxyialkyl, and perfluoroalkoxyl.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6a).
  • embodiments only include compoundsof structural formula (A-6a) in which R6 is alkenyl, alkyne, phenyl, or a 5- or 6-membered heteroaryl, each optionally substituted ith 1 2, or 3 substituents independently selected from the group consisting of
  • R9 and RIO are as defined in connection with structural formula (A).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6a).
  • Some embodiments specifically include and some embodiments only include (1 ) compounds of stractural formula (A-6al) and (2) compounds of any of structural formulae (A-6a2), (A-6a3), (A ⁇ 6a4), (A-6a5), (A-6a6), (A-6a7), (A-6a8), (A-6a9), (A- 6al0), (A-6al 1), (A-6al2), and (A-6al3).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6a).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-6al) and (2) compounds of up to 12 ⁇ e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12) of structural formulae (A-6a2), (A-6a3), (A-6a4), (A-6a5), (A- 6a6), (A-6a7), (A-6a8), (A-6a9), (A-6al0), (A-6al l), (A-6al2), and (A-6al3).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6a).
  • Each possible combination is specifically contemplated as if set forth explicitly herein, Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-6a2) and (2) compounds of any of structural formulae (A-6al), (A-6a3), (A-6a4), (A-6a5), (A-6a6), (A-6a7), (A-6a8), (A-6a9), (A- 6al0), (A-6al 1), (A-6al2), and (A-6al3). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6a). Each possible combination is specifically contemplated as if set forth expli citly herein.
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-6a2) and (2) compounds of up to 12 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , or 12) of structural formulae (A-6al), (A-6a3), (A-6a4), (A ⁇ 6a5), (A- 6a6), (A-6a7), (A-6a8), (A-6a9), (A-6al0), (A-6al 1), (A-6al2), and (A-6al3).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6a).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-6a3) and (2) compounds of any of structural formulae (A-6al), (A-6a2), (A-6a4), (A-6a5), (A-6a6), (A-6a7), (A-6a8), (A-6a9), (A- 6al0), (A-6al 1), (A-6al2), and (A-6al3).
  • such compounds are specifical ly excluded from structural formulae (A) and/or (A ⁇ 6a).
  • such compounds are specifically excluded from structural formulae (A) and/or (A ⁇ 6a).
  • Each possible combination is specifically contempl ated as if set fort explicitly herein.
  • Some embodiments specifically include and some embodiments only include (1 )
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6a).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifical ly excluded from structural formulae (A) and/or (A-6a).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6a).
  • Each possible combination is specifically contemplated as if set forth explicitly herein,
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6a).
  • Each possible combination is specifical ly contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6a).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-6a7) and (2) compounds of up to 12 (e.g.
  • stractural formulae (A-6al), (A-6a2), (A-6a3), (A-6a4), (A- 6a5), (A-6a6), (A-6a8), (A-6a9), (A-6al0), (A-6al 1), (A-6al2), and (A-6al 3).
  • stractural formulae (A-6al), (A-6a2), (A-6a3), (A-6a4), (A- 6a5), (A-6a6), (A-6a8), (A-6a9), (A-6al0), (A-6al 1), (A-6al2), and (A-6al 3).
  • stractural formulae (A-6al)
  • A-6a2) (A-6a3), (A-6a4), (A- 6a5), (A-6a6), (A-6a8), (A-6a9), (A-6al0), (A-6al 1), (A-6al2), and (A-6al 3).
  • such compounds are specifically excluded from structural formulae (A) and/
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6a).
  • such compounds are specifically excluded from stractural formulae (A) and/or (A-6a).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6a).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6a).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from stmctural formulae (A) and/or (A-6a).
  • Each possible combination is specifically contemplated as if set forth explicitly herein,
  • such compounds are specifically excluded from stmctural formulae (A) and/or (A-6a).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • m other embodiments, such compounds are specifically excluded from stmctural formulae (A) and/or (A-6a).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include compounds which have structural formula (A-6b):
  • R3, R4, and R6 are as defined in structural formula (A). In other embodiments, such compounds are specifically excluded from structural formula (A).
  • Structural formula (A-6bl) Some embodiments include only those compounds of structural formula (A ⁇ 6b) in which R3 is hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b).
  • Structural formula (A-6fo2) Some embodiments include only those compounds of structural formula (A-6b) in which R4 is hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b).
  • Structural formula (A-6b3) Some embodiments include only those compounds of structural formula (A-6b) in which R3 and R4 are hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b).
  • embodiments only include compounds of structural formula (A -6b ; in which R6 is hydrogen; halogen;— CN; optionally substituted alkyl; or optionally substituted alkoxyl.
  • Optional substituents for the alkyl and for the alkoxyl are (1) a C1-C6 hydrocarbon chain containing a nitrogen or oxygen atom and optionally substituted with a C1-C3 perfluoroalkyl, and (2) a cycloalkyl which may contain 1 or 2 heteroatoms selected from N, O, and S, and which is optionally substituted with a C1-C3 perfluoroalkyl.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6b).
  • embodiments only include compoundsof structural formula (A-6b) in which R6 is C1 -C6 alkyl, C1-C6 perfluoroalkyl, C1-C6 alkoxyl, C1-C6 hydroxylalkyl, C1-C6 alkoxylaikyi, or C1-C6 perfluoroalkoxyl.
  • R6 is C1 -C6 alkyl, C1-C6 perfluoroalkyl, C1-C6 alkoxyl, C1-C6 hydroxylalkyl, C1-C6 alkoxylaikyi, or C1-C6 perfluoroalkoxyl.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6b).
  • Structural formula (A-6b6) Some embodiments include only those compounds of structural formula (A ⁇ 6b) in which a. R3 is hydrogen and b. R.6 is hydrogen; halogen;— CN; optionally substituted alkyl; or optionally
  • Optional substituents for the alkyl and for the alkoxyl are (1) a C1-C6 hydrocarbon chain containing a nitrogen or oxygen atom and optionally substituted with a C1-C3 perfluoroalkyl, and (2) a cycioalkyl which may contain 1 or 2 heteroatoms selected from N, O, and S, and which is optionally substituted with a C1 -C3 perfluoroalkyl.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6b).
  • Structural formula (A-6fo7) Some embodiments include only those compounds of structural formula (A -6b) in which a. 4 is hydrogen and b.
  • R6 is hydrogen; halogen;— CN; optionally substituted alkyl; or optionally
  • Optional substituents for the alkyl and for the al koxyl are (1) a C1-C6 hydrocarbon chain containing a nitrogen or oxygen atom and optionally substituted with a C1-C3 perfluoroalkyl, and (2) a cycioalkyl which may contain
  • Structural formula (A-6b8) Some embodiments mclude only those compounds of structural formula (A-6b) in which a. R3 and R4 are hydrogen and b. 6 is hydrogen; halogen; CN; optionally substituted alkyl; or optionally
  • Optional substituents for the alkyl and for the alkoxyl are (1) a C.1 -C6 hydrocarbon chain containing a nitrogen or oxygen atom and optionally substituted with a C 1-C3 perfluoroalkyl, and (2) a cycloalkyl which may contain 1 or 2 heteroatoms selected from N, O, and S, and which is optionally substituted with a C1-C3 perfluoroalkyl.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6b).
  • Structural formula (A-6b9) Some embodiments include only those compounds of structural formula (A-6b) in which a. R3 is hydrogen and b. R6 is C1-C6 alkyl, C1-C6 perfluoroalkyl, C1-C6 alkoxyl, C1-C6 hydroxylalkyl, C1-C6 alkoxylaikyi, or C1 -C6 perfluoroalkoxyl.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6b).
  • embodiments only include compoundsof structural formula (A-6b) in which R6 is a side chain selected from the group consisting of alkyl, perfluoroalkyl, alkoxvl, hydroxyialkyl, alkoxyialkyl, and perfluoroalkoxyl, each optionally substituted with 1-3 substituents selected from halogen,— CN, alkyl, perfluoroalkyl, alkoxy, hydroxyialkyl, alkoxyialkyl, and perfluoroalkoxyl.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6b).
  • embodiments only include compoundsof structural formula (A-6b) in which R6 is alkenyl, alkyne, phenyl, or a 5- or 6-membered heteroaryl, each optionally substituted ith 1 2, or 3 substituents independently selected from the group consisting of
  • R9 and RIO are as defined in connection with structural formula (A).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6b).
  • Some embodiments specifically include and some embodiments only include (1 ) compounds of structural formula (A-6bl) and (2) compounds of any of structural formulae (A ⁇ 6b2), (A-6b3), (A-6b4), (A-6b5), (A-6b6), (A-6b7), (A-6b8), (A-6b9), (A- 6b 10), (A-6bl 1), (A-6M2), and (A-6M3).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6b).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-6M) and (2) compounds of up to 12 (e.g. , 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , or 12) of structural formulae (A-6b2), (A-6b3), (A-6b4), (A-6b5), (A 6b6), (A-6b7), (A-6b8), (A-6b9), (A-6bl0), (A-6bl l), (A-6M2), and (A-6bl3).
  • such compounds are specifical ly excluded from structural formulae (A) and/or (A-6b).
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-6b2) and (2) compounds of any of structural formulae (A-6M), (A-6b3), (A-6b4), (A-6b5), (A-6b6), (A-6b7), (A-6b8), (A-6b9), (A-
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-6b3) and (2) compounds of any of structural formulae (A-6M), (A-6b2), (A-6b4), (A-6b5), (A-6b6), ( ⁇ 6 ⁇ ? (A-6b8), (A-6b9), (A- 6b 10), (A-6bl l), (A-6M2), and (A-6bl 3). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A ⁇ 6b). Each possible combination is specifically contemplated as if set forth explicitly herein,
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6b).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include (1 )
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6b).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifical ly excluded from structural formulae (A) and/or (A-6b).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6b).
  • Each possible combination is specifically contemplated as if set forth explicitly herein,
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6b).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6b).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6b).
  • Each possible combmation is specifically contemplated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-6b7) and (2) compounds of up to 12 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , or 12) of structural formulae (A-6bl), (A-6b2), (A-6b3), (A-6b4), (A- 6b5), (A-6b6), (A-6b8), (A-6b9), (A-6bl0), (A-6M 1), (A-6M2), and (A-6bl 3).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6b).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A.) and/or (A-6b).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6b).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6b).
  • Each possible combination is specifically contemplated as if set forth explicitly herein,
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6b).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifical ly excluded from structural formulae (A) and/or (A ⁇ 6b).
  • Each possible combination is specifically contemplated as if set forth explicitly herein,
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6b).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6b).
  • Each possible combination is specifically contemplated as if set forth explicitly herein,
  • such compounds are specifically excluded from structural formulae (A) and/or (A-6b).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-6M 3) and (2) compounds of any of structural formulae (A-6M), (A-6b2), (A-6b3), (A-6b4), (A-6b5), ( ⁇ ⁇ 6 ⁇ 6 (A-6b7), (A-6b8), (A- 6b9), (A-6bl0), (A-6bl 1), or (A-6bl2).
  • such compounds are specifical ly excluded from structural formulae (A) and/or (A ⁇ 6b).
  • such compounds are specifical ly excluded from structural formulae (A) and/or (A-6b).
  • Each possible combination is specifically contemplated as if set forth explicitly herein,
  • Some embodiments specifically include and some embodiments only include compounds which have structural formula (A-7a), which can exist as a mixture of two tautomers:
  • R3, R4, and R6 are as defined in structural formula (A). In other embodiments, such compounds are specifical ly excluded from structural formula (A).
  • embodiments only include compounds of structural formula (A-7a) in which R3 is hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7a).
  • embodiments only include compounds of structural formula (A-7a) in which R4 is hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7a).
  • embodiments only include compounds of structural formuia (A-7a) in which R3 and R4 are hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7a).
  • Structural formula (A-7a4) Some embodiments include only those compounds of formula (A-7a) in which R3 and R4 are hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7a).
  • embodiments only include compounds of structural formula (A-7a) in which R6 is hydrogen; halogen;— CN; optionally substituted alkyl; or optionally substituted alkoxyl.
  • Optional substituents for the alkyl and for the aikoxyl are (1) a C1-C6 hydrocarbon chain containing a nitrogen or oxygen atom and optionally substituted with a C1-C3 perfluoroalkyl, and (2) a cycloalkyl which may contain 1 or 2 heteroatoms selected from N, O, and S, and which is optionally substituted with a C1-C3 perfluoroalkyl.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-7a).
  • embodiments only include compoundsof structural formula (A-7a) in which R6 is a side chain selected from the group consisting of alkyl, perfluoroalkyl, al koxyl, hydroxy 1 alkyl, alkoxylalkyl, and perfluoroaikoxyl, each optionally substituted with 1-3 substituents selected from halogen, CN, alkyl, perfluoroalkyl, alkoxy, hydroxylalkyl, alkoxylalkyl, and perfluoroaikoxyl.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-7a).
  • embodiments only include compoundsof structural formula (A-7a) in which R6 is aikenyi, aikyne, phenyl, or a 5 ⁇ or 6-membered heteroaryl, each optionally substituted with 1 2, or 3 substituents independently selected from the group consisting of
  • such compounds are specifically excluded from structural formulae (A) and/or (A-7a).
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-7al) and (2) compounds of any of structural formulae (A-7a2), (A-7a3), (A-7a4), (A-7a5), (A-7a6), and (A-7a7).
  • A-7a2 compounds of structural formula (A-7al) and (2) compounds of any of structural formulae (A-7a2), (A-7a3), (A-7a4), (A-7a5), (A-7a6), and (A-7a7).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-7a). Each possible combination is specifically contemplated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include (1 ) compounds of structural formula (A-7al) and (2) compounds of up to 6 (e.g., 1 , 2, 3, 4, 5 or 6) of structural formulae (A-7a2), (A-7a3), (A-7a4), (A-7a5), (A-7a6), and (A-7a7).
  • such compounds are specifically excluded from structural formulae (A) and/or (A -7a), Each possible combination is specifically contemplated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include (1 ) compounds of structural formula (A-7a2) and (2) compounds of any of structural formulae (A-7al), (A-7a3), ( A ⁇ 7a4), (A ⁇ 7a5), (A ⁇ 7a6), and (A-7a7).
  • A-7a2 compounds of structural formula (A-7a2) and (2) compounds of any of structural formulae (A-7al), (A-7a3), ( A ⁇ 7a4), (A ⁇ 7a5), (A ⁇ 7a6), and (A-7a7).
  • such compounds are specifically excluded from structural formulae (A) and/or (A ⁇ 7a). Each possible combination is specifically contempl ated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-7a2) and (2) compounds of up to 6 (e.g., 1 , 2, 3, 4, 5, or 6) of structural formulae (A-7al), (A-7a3), (A-7a4), (A-7a5), (A-7a6), and (A-7a7). in other embodiments, such compounds are specificaily excluded from structural formulae (A) and/or (A-7a). Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specificaily excluded from structural formulae (A) and/or (A-7a). Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-7a). Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-7a).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-7a). Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A) and/or (A ⁇ 7a). Each possible combination is specifically contemplated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-7a7) and (2) compounds of up to 6 (e.g., 1 , 2, 3, 4, 5, or 6) of structural formulae (A-7aI), (A-7a2), (A-7a3), (A-7a4), (A-7a5), and (A-7a6). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7a). Each possible combination is specifically contemplated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include compounds which have structural formula (A-7b):
  • R3, R4, and R6 are as defined in structural formula (A) and R7 is hydrogen or C1 -C3 alkyl. In other embodiments, such compounds are specifically excluded from structural formula (A).
  • embodiments only include compounds of structural formula (A-7b) in which R3 is hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7b).
  • embodiments only include compounds of structural formula (A-7b) in which R4 is hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 7b).
  • Structural formula (A-7b3) Some embodiments specifically include and some embodiments only include compounds of structural formuia (A-7b) in which R3 and R4 are hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7b).
  • Structural formula (A-7b4) Some embodiments specifically include and some embodiments only include compounds of structural formula (A-7b) in which R7 is C 1-C3 alkyl . In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7b).
  • Structural formula (A-7b5) Some embodiments specifically include and some embodiments only include compounds of structural formula (A- 7b) in which R7 is methyl. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 7b).
  • Structural formula (A-7b6) Some embodiments specifically include and some embodiments only include compounds of structural formula (A ⁇ 7b) in which R is hydrogen; halogen;— CN; optionally substituted alkyl; or optionally substituted alkoxyl.
  • Optional substituents for the alkyl and for the alkoxyl are (1) a C1-C6 hydrocarbon chain containing a nitrogen or oxygen atom and optionally substituted with a C1-C3 perfluoroalkyl, and (2) a cycloalkyl which may contain 1 or 2 heteroatoms selected from N, O, and S, and which is optionally substituted with a C1-C3 perfluoroalkyl.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-7b).
  • Structural formula (A-7b7) Some embodiments specifically include and some embodiments only include compoundsof structural formula (A- 7b) in which R6 is a side chain selected from the group consisting of alkyl, perfluoroalkyl, alkoxyl, hydroxy 1 alkyl, alkoxylalkyl, and perfluoroalkoxyl, each optionally substituted with 1-3 substituents selected from halogen,— CN, alkyl, perfluoroalkyl, alkoxy, hydroxylalkyl, alkoxylalkyl, and perfluoroalkoxyl. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7b).
  • Structural formula (A-7b8) Some embodiments specifically include and some embodiments only include compoundsof structural fonnula (A-7b) in which R6 is alkenyl, alkyne, phenyl, or a 5- or 6-membered heteroaryl, each optionally substituted with 1 2, or 3 substituents independently selected from the group consisting of
  • n 0, 1 , or
  • R9 and RIO are as defined in connection with structural formula (A). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7b). ] Structural formula (A-7b9). Some embodiments specifically include and some embodiments only include compoundsof structural formula (A- 7b) in which 6 is and R9 and RIO are as defined in connection with structural formula (A). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 7b). ] Structural formula (A-7bl0). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-7b) in which a. R3 is hydrogen; and b. 6 is and R9 and RIO defined in connection with structural formula (A).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-7b).
  • Structural formula (A-7bll) Some embodiments specifically include and some embodiments only include compounds of structural formula (A-7b) in which a. R3 is hydrogen; and
  • R6 is O " i U ; and R9 and R10 are as defined in connection with stmctural formula (A); and c.
  • R7 is Cl -C3 alkyl.
  • such compounds are specifically excluded from structural formulae (A) and/or (A- 7b), Structural formula (A-7 2).
  • Some embodiments specifically include and some embodiments only include compounds of structural formula (A-7b) in which a. R3 is hydrogen; and
  • R.6 is R R o , wherein n is 0, 1. or 2; or . -r O' ' 1 ° ; and R9 and R10 are as defined in connection with stmctural formula (A); and c. R7 is methyl. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7b).
  • R6 is , wherein n is 0, 1 , or 2; and R9 and RIO
  • such compounds are specifically excluded from structural formulae (A) and/or (A- 7b).
  • b. 6 is , wherein n is 0, 1, or 2; or , " 1 O and R9 and R10 are as defined in connection with structural formula (A); and c. R7 is Cl-C3 alkyl.
  • such compounds are specifically excluded from structural formulae (A) and/or (A- 7b).
  • Structural formula (A-7bl5) Some embodiments specifically include and some embodiments only mclude compounds of structural formula (A ⁇ 7b) in which a. R4 is hydrogen; and b. 6 is wherein n is 0, 1, or 2; or , and R9 and RIO defined in connection with structural formula (A); and c. R7 is methyl.
  • Structural formula (A-7bl6) Some embodiments specifically include and some embodiments only include compounds of structural formula (A-7b) in which a. R3 and R4 are hydrogen; and
  • R6 is , wherein n is 0, 1, or 2; or , " "1 O ' and R9 and R10 are as defined in connection with stmctural formula (A).
  • such compounds are specifically excluded from structural formulae (A) and/or (A- 7b), Structural formula (A-7 7).
  • Some embodiments specifically include and some embodiments only include compounds of structural formula (A-7b) in which a. R3 and R4 are hydrogen; and
  • R6 is R R o , wherein n is 0, 1, or 2; or , -r O' ' 1 ° ; and R9 and R10 are as defined in connection with stmctural formula (A); and c.
  • R7 is Cl -C3 alk l. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7b).
  • Structural formula (A-7M8) Some embodiments specifically include and some embodiments only include compounds of structural formula (A -7b) in which a. R3 and R4 are hydrogen; and
  • R6 is , wherein n is 0, 1 , or 2; and R9 and R10 are as defined in connection with structural formula (A); and c. R7 is methyl.
  • such compounds are specifically excluded from structural formulae (A) and/or (A- 7b).
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A -7b I) and (2) compounds of any of structural formulae (A-7b2), (A-7b3), (A-7b4), (A-7b5), (A-7b6), (A-7b7), (A-7b8), (A-7b9), (A- 7b 10), (A-7M 1), (A-7bl2), (A-7bl 3), (A-7bl4), (A-7bl5), (A-7M6), (A-7M7), and (A- 7b 18).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-7b).
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-7bl ) and (2) compounds of up to 17 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, I I, 12, 13, 14, 15, 16, or 17) of structural formulae (A-7b2), (A-7b3), (A- 7b4), (A-7b5), (A-7b6), (A-7b7), (A-7b8), (A-7b9), (A- 7b 10), (A-7bl 1 ), (A-7bl2), (A- 7b 13), (A-7M4), (A-7bl5), (A-7bl6), (A-7M7), and (A-7 l8). in other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7b).
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-7b2) and (2) compounds of any of structural formulae (A-7M), (A-7b3), (A-7b4), (A-7b5), (A-7b6), (A-7b7), (A-7b8), (A-7b9), (A- 7b 10), (A-7b l l), (A-7M2), (A-7bl3), ( ⁇ ⁇ 7 ⁇ ! 4 ). (A-7bl 5), (A-7b l6), (A-7M7), and (A- 7b 18).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-7b).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A) and/or (A- 7b).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifical ly excluded from structural formulae (A) and/or (A-7b).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include (1 )
  • such compounds are specifically excluded from structural formulae (A) and/or (A-7b).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A) and/or (A- 7b).
  • Each possible combination is specifical ly contemplated as if set forth explicitly herein,
  • such compounds are specifical ly excluded from structural formulae (A) and/or (A-7b).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include (1 )
  • such compounds are specifically excluded from stnictural formulae (A) and/or (A-7b).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-7b).
  • Each possible combination is specifically contemplated as if set forth explicitly herein,
  • such compounds are specifically excluded from structural formulae (A-7M), (A-7b2), (A-7b3), (A-7b4), (A-7b5), (A-7b6), (A-7b7), (A-7b9), (A- 7b 10), (A-7M 1), (A-7bl 2), (A-7bl 3), (A-7bl4), (A-7bl 5), (A-7M6), (A-7bl7), and (A- 7b 18).
  • such compounds are specifically excluded
  • such compounds are specifical ly excluded from structural formulae (A) and/or (A-7b).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-7b).
  • Each possible combination is specifically contemplated as if set forth explicitly herein,
  • such compounds are specifically excluded from structural formulae (A-7M), (A-7b2), (A-7b3), (A-7b4), (A-7b5), (A-7b6), (A-7b7), (A-7b8), (A- 7b9), (A-7bl l), (A-7bl2), (A-7 l 3), (A-7M4), (A-7M 5), (A-7bl 6), (A-7M7), and (A- 7b 18).
  • such compounds are specifically
  • such compounds are specifical ly excluded from structural formulae (A) and/or (A-7h).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-7b).
  • Each possible combination is specifically contemplated as if set forth explicitly herein,
  • such compounds are specifically excluded from structural formulae (A-7M), (A-7b2), (A-7b3), (A-7b4), (A-7b5), (A-7b6), (A-7b7), (A-7b8), (A- 7b9), (A-7bl0), (A-7bl l), (A-7M 3), (A-7M4), (A-7M 5), (A-7 l 6), (A ⁇ 7bl7), and (A- 7b 18).
  • such compounds are specifically
  • such compounds are specifical ly excluded from structural formulae (A) and/or (A-7b).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A-7M), (A-7b2), (A-7b3), (A-7b4), (A-7b5), (A-7b6), (A-7b7), (A-7b8), (A- 7b9), (A-7bl0), (A-7bl l), (A-7bl 2), (A-7M3), (A-7M 5), (A-7bl 6), (A-7M7), and (A- 7b 18).
  • such compounds are specifically excluded from
  • such compounds are specifical ly excluded from structural formulae (A) and/or (A-7b).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-7b).
  • Each possible combination is specifically contemplated as if set forth explicitly herein,
  • such compounds are specifically excluded from structural formulae (A-7M), (A-7b2), (A-7b3), (A-7b4), (A-7b5), (A-7b6), (A-7b7), (A-7b8), (A- 7b9), (A-7bl0), (A-7bl l), (A-7bl 2), (A-7bl3), (A-7M4), (A-7bl 5), (A-7M7), and (A- 7b 18).
  • such compounds are specifically
  • such compounds are specifical ly excluded from structural formulae (A) and/or (A-7b).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A) and/or (A- 7b).
  • Each possible combination is specifically contemplated as if set forth explicitly herein,
  • such compounds are specifically excluded from structural formulae (A-7M), (A-7b2), (A-7b3), (A-7b4), (A-7b5), (A-7b6), (A-7b7), (A-7b8), (A- 7b9), (A-7bl0), (A-7bl l), (A-7M 2), (A-7bl3), (A-7M4), (A -7b 15), (A-7M6), and (A- 7b 17).
  • such compounds are specifically excluded
  • such compounds are specifical ly excluded from structural formulae (A) and/or (A-7b).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • R3, R4, and R6 are as defined in structural formula (A) and R5 is hydrogen or C 1-C3 aikyi. In other embodiments, such compounds are specifically excluded from structural formula (A).
  • embodiments only include compounds of structural formula (A-7c) in which R3 is hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c).
  • embodiments only include compounds of structural formula (A-7c) in which R4 is
  • embodiments only include compounds of structural formuia (A-7c) in which R3 and R4 are hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c).
  • embodiments only include compounds of structural formula (A-7c) in which R5 is C1-C3 alkyl . In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7e).
  • embodiments only include compounds of structural formula (A ⁇ 7c) in which R6 is hydrogen; halogen;— CN; optionally substituted alkyl; or optionally substituted alkoxyl.
  • Optional substituents for the alkyl and for the alkoxyl are (1) a C1-C6 hydrocarbon chain containing a nitrogen or oxygen atom and optionally substituted with a C1-C3 perfluoroalkyl, and (2) a cycloalkyl which may contain 1 or 2 heteroatoms selected from N, O, and S, and which is optionally substituted with a C1-C3 perfluoroalkyl.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-7c).
  • R6 is a side chain selected from the group consisting of alkyl, perfluoroalkyl, alkoxyl, hydroxy 1 alkyl, alkoxyiaikyi, and perfluoroalkoxyl, each optionally substituted with 1-3 substituents selected from halogen,— CN, alkyl, perfluoroalkyl, alkoxy, hydroxylalkyl, alkoxyiaikyi,
  • n 0, 1 , or
  • R9 and RIO are as defined in connection with structural formula (A). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c). Structural formula (A-7c9). Some embodiments specifically include and some embodiments only include compoundsof structural formula (A-7c) in which R6 is and R9 and RIO are as defined in connection with structural formula (A). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c). Structural formula (A-7cl0). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-7c) in which a. R3 is hydrogen; and
  • such compounds are specifically excluded from structural formulae (A) and/or (A-7c).
  • Structural formula (A-7cll) Some embodiments specifically include and some embodiments only include compounds of structural formula (A-7c) in which a. R3 is hydrogen; and
  • R6 is O " i U ; and R9 and R10 are as defined in connection with structural formula (A); and c.
  • R5 is Cl -C3 alkyl.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-7c).
  • Structural formula (A-7cl2) Some embodiments specifically include and some embodiments only include compounds of structural formula (A-7c) in which a. R3 is hydrogen; and
  • R.6 is R R o , wherein n is 0, 1, or 2; or , -r O' ' 1 ° ; and R9 and R10 are as defined in connection with structural formula (A); and c. R5 is methyl.
  • such compounds are specifically excluded from stmctural formulae (A) and/or (A-7c).
  • R6 is , wherein n is 0, 1 , or 2; and R9 and RIO
  • such compounds are specifically excluded from stmctural formulae (A) and/or (A-7c).
  • b. 6 is , wherein n is 0, 1, or 2; or , " 1 O and R9 and R10 are as defined in connection with structural formula (A); and c. R5 is C1-C3 alkyl.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-7c).
  • Structural formula (A-7cl5) Some embodiments specifically mclude and some embodiments only include compounds of structural formula (A-7c) in which a. R.4 is hydrogen; and
  • such compounds are specifically excluded from structural formulae (A) and/or (A-7c).
  • Structural formula (A-7cl6) Some embodiments specifically include and some embodiments only include compounds of structural formula (A-7c) in which a. R3 and R4 are hydrogen; and
  • R6 is , wherein n is 0, 1 , or 2; or , " "1 O ' and R9 and R10 are as defined in connection with stractural formula (A).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-7c).
  • Structural formula (A-7cl7) Some embodiments specifically include and some embodiments only include compounds of structural formula (A-7c) in which a. R3 and R4 are hydrogen; and
  • R6 is R R o , wherein n is 0, 1 , or 2; or , -r O'' 1 ° ; and R9 and R10 are as defined in connection with stractural formula (A); and c.
  • R5 is Cl -C3 alk l.
  • Structural formula (A-7cl8) Some embodiments specifically include and some embodiments only include compounds of structural formula (A-7c) in which a. R3 and R4 are hydrogen; and
  • R6 is , wherein n is 0, 1 , or 2; and R9 and R10 are as defined in connection with structural formula (A); and c. R5 is methyl.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-7c).
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A ⁇ 7cl) and (2) compounds of any of structural formulae (A-7c2), (A-7c3), (A-7c4), (A-7c5), (A-7c6), (A-7c7), (A-7c8), (A-7c9), (A- 7cl0), (A-7cl l), (A-7cl2), (A-7cl3), (A-7cl4), (A-7cl5), (A-7cl6), (A-7cl7), and (A-
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-7cl) and (2) compounds of up to 17 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17) of structural formulae (A-7c2), (A-7c3), (A- 7c4), (A-7c5), (A-7c6), (A-7c7), (A-7c8), (A-7c9), (A-7cl 0), (A-7cl 1), (A-7cl 2), (A- 7cl3), (A-7cl4), (A-7cl5), (A-7cl6), (A-7cl7), and (A-7cl8).
  • such compounds are speciticaily excluded from structural formulae (A) and/or (A-7c).
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-7c2) and (2) compounds of any of structural formulae (A-7cl), (A-7c3), (A-7c4), (A-7c5), (A-7c6), (A-7c7), (A-7c8), (A-7c9), (A-
  • such compounds are specifically excluded from structural formulae (A) and/or (A-7c).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-7c).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifical ly excluded from structural formulae (A) and/or (A-7c).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-7c).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A) and/or (A ⁇ 7c).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifical ly excluded from structural formulae (A) and/or (A-7c).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include (1 )
  • such compounds are specifically excluded from structural formulae (A) and/or (A-7c).
  • Each possible combination is specifically contemplated as if set forth explicitly herein,
  • such compounds are specifical ly excluded from structural formulae (A) and/or (A-7c).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-7c).
  • Each possible combination is specifically contemplated as if set forth explicitly herein,
  • such compounds are specifical ly excluded from structural formulae (A) and/or (A-7c).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-7c).
  • Each possible combination is specifically contemplated as if set forth explicitly herein,
  • such compounds are specifical ly excluded from structural formulae (A) and/or (A-7c).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifical ly excluded from structural formulae (A) and/or (A-7c).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • such compounds are specifical ly excluded from structural formulae (A) and/or (A-7c).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-7c l 8) and (2) compounds of up to 17 (e.g., I , 2, 3, 4 5, 6, 7, 8, 9, 10, 1 L 12, 13, 14, 15, 16, or 17) of structural formulae (A-7el), (A-7c2), (A- 7c3), (A-7c4), (A-7c5), (A-7c6), (A-7c7), (A ⁇ 7c8), (A-7c9), (A-7cl 0), (A-7cl 1 ), (A- 7cl2), (A-7cl3), (A-7cl4), (A-7cl5), (A-7cl6), and (A-7cl 7).
  • such compounds are specifical ly excluded from structural formulae (A) and/or (A-7c).
  • Each possible combination is specifically contemplated as if set forth explicitly herein.
  • Some embodiments specifically include and some embodiments only include compounds which have stmctural formula (A-8a):
  • R3, R4, and R6 are as defined in stmctural formula (A). In other embodiments, such compounds are specifically excluded from structural formula (A).
  • Structural formula (A-8al) Some embodiments specifically include and some embodiments only include compounds of structural formula (A-8a) in which R3 is hydrogen. In other embodiments, such compounds are specifically excluded from stmctural formulae (A) and/or (A-8a).
  • Structural formula (A-8a2) Some embodiments specifically mclude and some embodiments only include compounds of structural formula (A-8a) in which R4 is hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 8 a).
  • Structural formula (A-8a3) Some embodiments specifically include and some embodiments only include compounds of structural formula (A-8a) in which R3 and 4 are hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-8a).
  • Structural formula (A-8a4) Some embodiments specifically include and some embodiments only include compounds of structural formula (A-8a) in which a. R3 and 4 are hydrogen and
  • R6 is hydrogen, alkyl, .
  • such compounds are specifically excluded from structural formulae (A) and/or (A- 8 a).
  • Structural formula (A-8a5) Some embodiments specifically mclude and some embodiments only include compounds of structural formula (A-8a) in which a. R3 and R4 are hydrogen and b. R6 is alkyl.
  • such compounds are specifically excluded from structural formulae (A) and/or (A-8a).
  • Structural formula (A-8a6) Some embodiments specifically include and some embodiments only mclude compounds of structural formula (A-8a) in which a. R3 and R4 are hydrogen and b. R6 is A O l 0 .
  • such compounds are specifically excluded from structural formulae (A) and/or (A-8a).
  • Structural formula (A-8a7) Some embodiments specifically include and some embodiments only include compounds of structural formuia (A-8a) in which a. R3 and R4 are hydrogen, c. RIO is a!kyl.
  • such compounds are specifically excluded from structural formulae (A) and/or (A- 8 a).
  • such compounds are specifically excluded from structural formulae (A) and/or (A -8a).
  • R6 is R io , and n is 2.
  • such compounds are specifically excluded from structural formulae (A) and/or (A- 8 a).
  • such compounds are specifically excluded from structural formulae (A) and/or (A-8a).
  • Structural formula (A-8all) Some embodiments specifically include and some embodiments only include compounds of structural formula (A-8a) in which a. R3 and R4 are hydrogen and

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Diabetes (AREA)
  • Hematology (AREA)
  • Neurology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Neurosurgery (AREA)
  • Rheumatology (AREA)
  • Oncology (AREA)
  • Biomedical Technology (AREA)
  • Virology (AREA)
  • Endocrinology (AREA)
  • Pain & Pain Management (AREA)
  • Obesity (AREA)
  • Psychiatry (AREA)
  • Urology & Nephrology (AREA)
  • Dermatology (AREA)
  • Communicable Diseases (AREA)
  • Emergency Medicine (AREA)
  • Transplantation (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Plural Heterocyclic Compounds (AREA)
  • Pyrane Compounds (AREA)

Abstract

Compounds which directly inhibit IRE-1α activity in vitro, prodrugs, and pharmaceutically acceptable salts thereof. Such compounds and prodrugs are useful for treating diseases associated with the unfolded protein response or with regulated IRE1-dependent decay (RIDD) and can be used as single agents or in combination therapies.

Description

IRE-Ια INHIBITORS
[01] This application claims the benefit of and incorporates by reference Serial No.
61/320,975 filed on April 5, 2010.
[02] Each patent, patent application, and reference cited in this disclosure is expressly
incorporated herein by reference in its entirety.
FIELD OF THE INVENTION
[03] The field of the invention includes IRE-Ια inhibitors and their therapeutic uses.
BACKGROUND
[04] Protein folding stress in the endoplasmic reticulum of a cell initiates a signal transduction cascade termed the unfolded protein response or UPR. A key enzyme, inositol requiring enzyme 1 (IRE- l a), relieves protein folding stress by enhancing molecular ehaperone activity and therefore protects cells from stress induced apoptosis. Inhibitors of IRE- la are useful for treating at least B cell autoimmune diseases, certain cancers, and some viral infections.
BRIEF DESCRIPTION OF THE DRAWINGS
[OS] Figure 1 shows inhibition of endogenous XBP-1 splicing in RPMI 8226 cells using
lQiiM IRE- la endoribonuclease inhibitor (Cnipd) and Thapsigargin (Tg) induced XBP- ls. PCR amplification products were run on a 4% agarose gel and stained with ethidium bromide. The inverse image is shown.
[06] Figure 2 shows inhibition of regulated IRE 1 -dependent decay (RIDD) of Blosl (Figure
2A) and CD59 (Figure 2B) in human RPMI 8226 cells using a selective IRE- la endoribonuclease inhibitor. GAPDH (Figure 2C) is shown as a control. Cells were left untreated or treated with ! OuM IRE- l a inhibitor or 300n thapsigargin (Tg) or both or for 2, 4, 6, 8, 16 or 24 hours. Total RNA was harvested and RT-qPCR was performed using specific primers for each of the individual mRNAs. The expression levels are shown as Ct values where one PCR cycle correlates to a 2-fold change. [07] Figure 3A. Time course of experiment described in Example 44.
[08] Figure 3B. Results of RT-PCR analysis performed using murine-specific XBP-1 primers from total RNA harvested from specified organs after intraperitoneal treatment with an IRE- la inhibitor (Example 44).
[09] Figure 4A. Results of RT-PCR analysis performed using murine-specific XBP-1 primers from total RNA harvested from specified organs after intravenous treatment with an IRE- la inhibitor (Example 44).
[10] Figure 4B. Results of RT-PCR analysis performed using murine-specific XBP-1 primers from total RNA harvested from specified organs after oral treatment with an IRE- la inhibitor (Example 44).
[11] Figure 5A. Time course of experiment described in Example 45.
[12] Figure 5B. Results of RT-PCR amplification of XBP-1 using human specific primers.
[13] Figure 6A. Time course of experiment described in Example 46.
[14] Figure 6B. Results of RT-PCR amplification of XBP-1 using human specific primers.
DETAILED DESCRIPTION
[15] This specification describes IRE- la inhibitor compounds and prodrugs and
pharmaceutically acceptable salts thereof; purified preparations IRE- la inhibitor compounds and prodrugs and pharmaceutically acceptable salts thereof; pharmaceutical compositions comprising IRE- la inhibitor compounds and prodrugs and
pharmaceutically acceptable salts thereof; and methods of using IRE- la inhibitor compounds, prodrugs, and pharmaceutically acceptable salts thereof therapeutically to treat disorders associated with the unfolded protein response. Patients who can be treated include those with B cell autoimmune diseases, certain cancers, and some viral infections, in other embodiments IRE-Ι α inhibitor compounds, prodrugs, or
pharmaceutically acceptable salts thereof can be administered to treat disorders associated with regulated IRE 1 -dependent decay (RIDD). Other embodiments are intermediates of IRE- la inhibitor compounds and methods of synthesizing IRE- la inhibitor compounds as set forth in the specific Examples, below.
Definitions
[16] "Halogen" includes fluorine, chlorine, bromine, and iodine.
[17] Unless otherwise specified, the term "alkyl" as used herein means a saturated monovalent hydrocarbon radical having 1, 2, 3, 4, 5, or 6 carbon atoms ("C1--C6 alkyl") and can be linear, branched, or a combination thereof. "C1-C6 alkyl" includes C1-C5 alkyl, C1-C4 alkyl, and C.1-C3 alkyl. Examples of C1-C6 alkyls include methyl, ethyl, propyl, isopropyl, sec-butyl, tert-butyl, n-butyl, 2-butyl, pentyl, and hexyl.
[18] "Aikoxy" as used herein means -O-alkyl groups, where "alkyl" is as defined above, and can be linear, branched, or a combination thereof. Examples of C1-C6 alkoxys include, for example, methoxy, ethoxy, propoxy, 2-propoxy, butoxy, sec-butoxy, and tert-butoxy.
[19] The term ''perfluoroalkyl" means an alkyl group as defined above in which all of the hydrogen atoms are replaced by fluorine atoms. The term "perfiuoroalkoxy" means an aikoxy group in which the alkyl moiety is a perfluoroalkyl group as defined above.
[20] The term "hydroxylalkyl" as used herein means an alkyl group as defined above which is substituted with a hydroxyl group.
[21] The term "alkoxylaikyi" means radicals of the formula -O- (0¾)/,- , in which a and b independently are 1, 2, 3, 4, 5, or 6.
[22] A. "cycloaikyl" is a saturated or partially saturated 3- to 14-membered {i.e., a 3-, 4-, 5-, 6, 7-, 8-, 9-, 10-, 11-, 12-, 13-, or 14-membered) monocyclic or polycyclic ring, such as a 5- , 6-, or 7-membered monocyclic ring or a 10-membered bicyclic ring, in which all of the ring members are carbon atoms. Examples of cycloalkyls include cyclobutyl,
cyclopentyl, cyclohexyl, cycioheptyl, and cyclooctyl.
[23] "Aryi," when used alone or as part of another term, means a carbocyclic aromatic ring containing 5 to 14 members {e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 members) and can be monocyclic or polycyclic. Examples of aryls include phenyl, naphthyl, anthryl, and phenanthryl.
[24] A. "heterocycle," "heterocyclic group," and "heterocyclic ring" is a saturated or a partially saturated 4- to 14-membered (i.e., 4-, 5-, 6-, 7-, 8-, 9-, 10-, 1 1 -, 12-, 13-, or 14- membered) monocyclic or polycyclic (fused) ring, such as a 5-, 6-, or 7-membered monocyclic ring or a 10-membered bicyclic ring which has 1 , 2, 3, or 4 heteroatoms selected from nitrogen (N), oxygen (O), and sulfur (S). Any of the nitrogen and sulfur heteroatoms optionally can be oxidized, and any nitrogen heteroatom optionally can be quateniized. A heterocyclic ring can be attached at any suitable heteroatom or carbon atom. Examples of heterocycles include azepinyl, furyl, thienyl, pyrrolyl, pyrazolyl, imidazolvi, pyridyl, pyrazinyl, pyrimidinyi, pyridazinyl, triazolyl, isobenzofuranyl, furazanyl, indolyi, quinolinyi, oxazolyl, imidazolinyl, isoxazolyi, quinolyi,
naphthyridinyl, phenoxazinyl, phenanthridinyl, chromenyl, triazinyl, purinyl,
benzothienyl, benzimidazolyl, benzopyranyl, benzothiazolyl, benzoazolyl,
benzo[b]thienyl, naphtho[2,3-b]-tbienyl, isothiazolyl, thiazolyl, isothiazolyl,
isoquinoiinyl, thiadiazolyl, oxadiazolyl, tetrahydroquinolinyl, indolizinyl, isoindolyl, indazolyl, isoquiriolyl, phthalazinyl, tetrahydroquinolinyl, and cinnolinyl.
[25] A. "heteroaryf is a saturated 4- to 14~membered (i.e., 4-, 5-, 6-, 7~, 8-, 9-, 10-, 11-, 12-, 13-, or 14-membered) monocyclic or polycyclic (fused) ring, such as a 5-, 6-, or 7- membered monocyclic ring or a 10-membered bicyclic ring which has 1 , 2, 3, or 4 heteroatoms sel ected from nitrogen (N), oxygen (O), and sulfur (S), Any of the ni trogen and sulfur heteroatoms optionally can be oxidized, and any nitrogen heteroatom optional ly can be quateniized. A heteroarv! can be attached at any suitable heteroatom or carbon atom. Examples of heteroaiyls include pyridyl, imidazolvi, pyrrolyl, thienyl, furyl, pyranyl, pyrimidinyi, pyridazinyl, indolyi, quinolyi, naphthyridinyl, and isoxazolyi.
IRE- Ja Inhibitor Compounds
[26] IRE- la inhibitor compounds directly inhibit IRE- l a. The compounds are understood to act through inhibition of the RNAse activity of the enzyme. In some embodiments IRE- la inhibitor compounds form a complex with IRE- la. In particular embodiments this activity is detected as cleavage of a human mini-XBP-1 mRNA stem- loop substrate 5'- CAGUCCGCAGGACUG-3' (SEQ ID NO: l) by IRE-la in vitro by 10 to 100%. Other substrates also can be used to detect cleavage. See US 2007/0105123.
IRE-la inhibitor compounds can meet either or both of the following criteria: a. Some compounds inhibit IRE-la in the in vitro assay with an IC50 of
approximately 0.0005-20 μΜ. Some of these compounds have an IC50 in this assay of approximately 1 -20 μΜ. Others have an IC50 in this assay of
approximately 0.1-1 μΜ. Still others have an IC50 of approximately 0.0005-0.1 μ\1. b. Some compounds inhibit IRE-1 a in an in vivo XBP-1 splicing assay (e.g., in myeloma ceils) with an EC50 in the range of approximately 0.05-80 μΜ. Some of these compounds have an ECO50 in this assay of approximately 10-80 μΜ, Others have an ECO50 in this assay of approximately 1-10 μ . Still others have an ECO50 in this assay of approximately 0.05-1 μΜ.
Compounds fail into one or more of the stractural formulae described below. Non- limiting examples of compounds falling within the scope of these structural formulae are provided in Tables 1 and 2 and in the Examples.
Some embodiments specifically include and some embodiments only include compounds which have stractural formula (A):
Figure imgf000006_0001
(A) wherein:
R3 and R4 independently are hydrogen; halogen; hydroxyl; optionally substituted alkyl; or optionally substituted alkoxyl; or optionally substituted alkylammo. Optional substituents for the alkyl or for the uikoxyl and alkylammo are (1) a CI ~C6 hydrocarbon chain containing an N or O atom and optionally substituted with a C1-C3 perfluoroalkyl, and (2) a cycloalkyl which may contain 1 or 2 heteroatoms selected from N, O, and S, and which is optionally substituted with a C1-C3 perfluoroalkyl;
Q5, Q6, Q7 and Q8 (used throughout this specification interchangeably with Qs, <¾, Q? and Qg), together with the benzene ring to which they are attached, form a benzofused ring. In some embodiments, Q7 is a bond which connects Q6 and Q8. The benzofused ring may or may not be fully aromatic.
Q5 is CR5, CR5R5', N, NR5, NC=OR5, O, S, or C ().
Q6 is CR6, CR6R6', N, NR6, NC=OR6, O, S, or C ().
Q7 is CR7, CR7R7', N, R7, NOOR7, O, S, C O. or a bond; and
Q8 is CR8, CR8R8', N, NR8, NC=OR8, O, S, ( ' O.
PROVIDED THAT: at least one of Q5, Q6, Q7 (when not a bond), and Q8 must be a heteroatom selected from N, S, and O and Q5, Q6, Q7, and Q8 do not form O-O, O-N, () S. or () ( ' C () bonds,
R5, R5', R6, R6f, R7, R7', R8, and R8f are independently hydrogen; R21; 10 ;
·* υ ; alkenyl, alkynyl, or phenyl, each optionally substituted with 1, 2, or 3 substituents independently selected from the group consisting of halogen,— CN, alkyl, perfluoroalkyl, alkoxy, hydroxylalkyl, alkoxylalkyl, perfluoroalkoxy, p
I I - RI O
R10 , R10 and O ; a 5- or 6-membered heteroaryl that is substituted with 1, 2, or 3 substituents independently selected from the group consisting of halogen,— CN, alkyl, peril uoroaikyi, alkoxy, hydroxylalkyl,
alkoxylalkyl, perfluoroalkoxyl,
Figure imgf000008_0001
:
Figure imgf000008_0002
R9
O O ; or R5 and R6, together with the carbon atoms to which they are attached, form a 5-membered eycioalkyl. 5, R5', R6, R6', R7, R7', R8, and R8' are not simultaneously hydrogen; when R5, R5', R6, R6', R7, R7f, R8, and R8f are independently
? V ^ „R10
R10 or s Ό , none of Q5, Q6, Q7, and Q8 is N, O, or S; and when R5, R5!, R6, R6', R7, R7', R8, and R8' are independently a 5- or 6-membered heteroaryl substituted with 1, 2, or 3 substituents
Figure imgf000008_0003
-> N
I ,R10 -cS' ,R10
the RIO , ·** O , or S is linked to a carbon atom of the 5- or 6-membered heteroaryl; and RIO are independently hydrogen; alkyl; alkoxvlalkyi; perfluoroaikoxylalkyl; aryl, optionally substituted with 1 , 2, or 3 substituents independently selected from
R21; a 5- or 6-membered heteroeycle, optionally substituted with 1, 2, or 3 substituents independently selected from R21; a 5- or 6-membered heteroaryl, optionall substituted with 1, 2, or 3 substituents independently selected from
or
Figure imgf000009_0001
, wherein si is 0, 1, 2, or 3: or and RiO, together with the nitrogen atom to which they are attached, form a
heteroeycle containing I, 2, 3, or 4 heteroatoms selected from N, O, and S, optionally substituted with 1, 2, or 3 substituents selected independently from
Rll is hydrogen; alkyl; aryl; heteroaryl containing 1 or 2 heteroatoms selected from N, (), and S; arylalkyl; heteroarylalkyl in which the heteroaryl contains 1 or 2
heteroatoms selected from N, (J. and S;
Figure imgf000009_0002
R12 is amino; alkoxy; aryl, optionally substituted with 1, 2, or 3 substituents selected independently from Rll; a 5- or 6-membered heteroeycle having 1, 2, or 3 heteroatoms selected from , O, and 8 and optionally substituted with 1, 2, or 3 substituents selected independently from Rll; or a 5- or 6-membered heteroaryl having 1 , 2, or 3 heteroatoms selected from N, O, and S and optionally substituted with 1, 2, or 3 substituents selected independently from Rll;
R13 is alkyl; alkoxvlalkyi; perfluoroalkoxyialkyl; aryl, optionally substituted with 1, 2, or 3 substituents independently selected from R21 ; a 5- or 6-membered heteroeycle, optionally substituted with 1, 2, or 3 substituents independently selected from R21; a 5- or 6-membered heteroaryl, optionally substituted with 1 , 2, or 3 substituents independently selected from R21; or
Figure imgf000010_0001
, wherein s is 0, 1, 2, or 3; and R14 is hydrogen or R13; or d R14, together with the nitrogen to which they are attached, form a heterocycle containing 1, 2, or 3 heteroatoms selected independently from N, O, and S, optionally substituted with 1, 2, or 3 substituents selected independently from mino; alkoxy; aryl, optionally substituted with 1, 2, or 3 substituents selected independently from R21; a 5- or 6-membered heterocycle having 1, 2, or 3 heteroatoms selected from N, O, and S and optionally substituted with 1, 2, or 3 substituents selected from R21; or a 5- or 6-membered heteroarvl having 1 , 2, or 3 heteroatoms selected from N, O, and S and optionally substituted with 1, 2, or 3 substituents selected from R21; ydrogen; alley); aryl; heteroarvl containing I or 2 heteroatoms selected from N, O, and S; arylalkyi; heteroarylalkyl in which the heteroaryl contains 1 or 2
heteroatoms selected from N, O, and S; "¾ R17 ;
Figure imgf000010_0002
; amino; or R^ 8 alkyl; alkoxylalkyl; perfluoroal.koxylalk.yl; aryl, optionally substituted with 1 , 2, or 3 substituents independentl selected from R21; a 5- or 6-membered heterocycle, optionally substituted with 1 , 2, or 3 substituents independently selected from R21; a 5- or 6-membered heteroaryl, optionall substituted with 1,
2, or 3 substituents independently selected from R21; or
Figure imgf000010_0003
wherein n is 0, 1 , 2, or 3; and R18 is hydrogen or R17; or R17 and R18, together with the nitrogen to which they are attached, form a heterocycle containing 1 , 2, 3, or 4 heteroatoms selected independently from N, O, and 8, optionally substituted with 1, 2, or 3 substituents selected independently from R20;
R19 is alkoxy; aryl, optionally substituted with 1, 2, or 3 substituents selected
independently from R21 ; a 5- or 6-membered heterocycle, optionally substituted with 1, 2, or 3 substituents independently selected from R21; or a 5- or 6- membered heteroaryl, optionally substituted with 1, 2, or 3 substituents independently selected from R21;
R20 is a 5- or 6-membered heterocycle having 1 or 2 heteroatoms selected from N, O, and S and optionally substituted with 1 , 2, or 3 substituents selected
independently from R21 ; a 5- or 6-membered heteroaryl, optionally substituted with 1, 2, or 3 substituents selected independently from R21; or R 1; and
R21 is halogen, perfiuoroalkyl, perfluoroalkoxy,— CN,— CONH2,— CON(CH3)2, alkyl, alkoxy, hydroxy 1 alkyl, or alkoxylalkyl, with the exception of the compounds excluded from structural formulae (A-l), (A- 2), (A-3), (A-4), (A-5), (A-6), and (A-7), below.
J
Non-limiting examples of R^ O include the following, in which "X" is halogen,
CN,— CONH2j— C0N(CH3)2, C1-C4 alkyl, C1-C4 alkoxy, C1-C4 hydroxylalkyl, or C1-C4 alkoxylalkyl :
Figure imgf000011_0001
Figure imgf000012_0001
Figure imgf000013_0001
Some embodiments specifically include and some embodiments only include compounds which have structural formula (A-l):
Figure imgf000013_0002
(A-l) wherem R3, R4, R5, and R6 are as defined in structural formula (A), PROVIDED THAT if R3 and R4 are both hydrogen and R5 is methyl, then R6 cannot be ethyl or unsubstituted phenyl. In other embodiments, such compounds are specifically excluded from structural formula (A).
Structural formula (A-l a). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-l) in which R5 is hydrogen; halogen; CN; optionally substituted alkyl; or an optionally substituted alkoxyi. Optional substituents for the alkyl and for the alkoxyl are (1) a C1-C6 hydrocarbon chain containing an N or O atom and optionally substituted with a C1-C3 perfluoroalkyl, and (2) a cycloalkyl which may contain 1 or 2 heteroatoms selected from N, O, and S, and which is optionally substituted with a C1-C3 perfluoroalkyl. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l).
[33] Structural formula (A- lb). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-l) in which 6 is a side chain selected from the group consisting of alky I, perfluoroalkyl, alkoxyl, hydroxylalkyl, alkoxylaikyi, and perfluoroalkoxyl, each optionally substituted with 1-3 substituents selected from halogen,— CN, alkyl, perfluoroalkyl, alkoxy, hydroxylalkyl, alkoxylaikyi, and perfluoroalkoxyl. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l ).
[34] Structural formula (A-lc), Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-l) in which R6 is alkenyi, alkyne, phenyl, or a 5- or 6-membered heteroaryl, each optionally substituted with 1 2, or 3 substituents independently selected from the group consisting of
Figure imgf000014_0001
Kio , io , O , 0 , K10 , wherem n is 0, 1, or 2;
Figure imgf000014_0002
9 and RIO are as defined in connection with structural formula (A). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l).
[35] Structural formula (A- Id). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-l) in which R4 is hydrogen, alkoxyl, or hydroxy!. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l).
[36] Structural formula (A-le). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-l) in which a. R4 is hydrogen, alkoxyl, or hydroxyl, and b. R5 is hydrogen, alkyl, alkoxyl, alkylamino, CF¾, or, together with R6 and the carbon atoms to which they are attached, forms a five-membered cycioalkyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1 ).
Structural formula (A-lf). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-1) in which a. 4 is hydrogen, alkoxyl, or hydroxyl and b. R6 is hydrogen; alkenyl, alkyl, or phenyl, each optionally substituted with 1 , 2, or 3 substituents independently selected from the group consisting of halogen,— CN, alkyl, perfluoroalkyl, alkoxy, hydroxylaikyi, alkoxylalkyl, perfluoroalkoxy,
0
\X R9
N ^ N
R10 , R10 and - O ; a 5- or 6-membered heteroaryl that is substituted with 1, 2, or 3 substituents independently selected f om the group consisting of halogen,— CN, alkyl, perfluoroalkyl, alkoxy, hydroxylaikyi,
alkoxylalkyl, perfluoroalkoxyl, Ό , and f ® ;
R10 , wherein si is 0, 1 ,
Figure imgf000015_0001
or R5 and R6, together with the carbon atoms to which they are attached, form a 5-membered cycioalkyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1).
Structural formula (A-lg). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-1) in which R5 is hydrogen, alkyl, alkoxyl, alkylamino, CF3, or, together with R6 and the carbon atoms to which they are attached, forms a five-membered cycloalkyl. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l).
Structural formula (A-lh). Some embodiments specifically include and some embodiments only include compounds include only compounds of structural formula (A- 1) in which a. 5 is hydrogen, alkyl, alkoxyi, alkylamino, CF3, or, together with R6 and the carbon atoms to which they are attached, forms a five-membered cycloalkyl and b. R6 is hydrogen; alkenyl, alkyl, or phenyl, each optionally substituted with 1 , 2, or 3 substituents mdependently selected from the group consisting of halogen,— CN, alkyl, periluoroalkyi, alkoxy, hydroxylalkyl, alkoxylalkyl, perfiuoroalkoxy,
Figure imgf000016_0001
and ^ O ; a 5- or 6-membered eteroaryl that is substituted with 1 , 2, or 3 substituents independently selected from the group consisting of halogen,— CN, alkyl, periluoroalkyi, alkoxy, hydroxylalkyl,
, and 0
Figure imgf000016_0002
; or R5 and R6, together with the carbon atoms to which they are attached, form a 5-membered cycloalkyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l).
Structural formula (A-li), Some embodiments specifically include and some embodiments only include compounds of structural formula (A-l) in which R6 is independently hydrogen; alkenyl, alkyl, or phenyl, each optionally substituted with 1 , 2, or 3 substituents independently selected from the group consisting of halogen,— CN, alkyl, perfluoroa!ky!, alkoxy, hydroxylalkyl, alkoxylalkyl, perfluoroalkoxv,
Figure imgf000017_0001
N'R9
R10 and ; a 5- or 6-membered heteroaryl that is substituted with 1 , 2, or 3 substituents independently selected from the group consisting of halogen,— CN, alkyl,
O
N
perfluoroalkvl, alkoxy, hydroxylalkyl, alkoxylalkyl, perfiuoroalkoxyl,
-wherein n is 0, 1 , -
Figure imgf000017_0002
; or R5 and 6, together with the carbon atoms to which they are attached, form a 5-merabered cycloalkyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l ).
Structural formula (A-lj). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-l) in which a. R4 is hydrogen, alkoxyl, or hydroxyl, b. R5 is hydrogen, alkyl, alkoxyl, alkylamino, CF3, or, together with 6 and the carbon atoms to which they are attached, forms a five-membered cycloalkyl, and c. R6 is hydrogen; alkenyl, alkyl, or phenyl, each optional ly substituted with 1 , 2, or
3 substituents independently selected from the group consisting of halogen,
CN, alkyl, perfluoroalkvl, alkoxy, hydroxylalkyl, alkoxylalkyl, perfluoroalkoxy,
O
- ! N J N
R10 5 R10 and O ; a 5- or 6-membered heteroaryl that is substituted with 1 , 2, or 3 substituents independently selected from the group consisting of halogen,— CN, alkyl, perfluoroalkyl, alkoxy, hydroxylalkyl,
O
^ . ,'R9 o
.RIO
alkoxylalkyl, perfluoroalkoxyl, R10 and ^crR1° O o
,R9
n N'
R'10 , wherein si is 0, 1 , or 2; 10 ; or R5 and R6, together with the carbon atoms to which they are attached, form a 5-membered cycloalkyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l).
Structural formula (A-lk). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-l) in which a. R4 is hydrogen, alkoxyl, or hydroxy!, b. R5 is hydrogen, alkyl, alkoxyl, alkylarnino, CF3, or, together with R6 and the carbon atoms to which they are attached, forms a five-membered cycloalkyl, and c. R6 is hydrogen; alkenyl, alkyl, or phenyl, each optional ly substituted with 1 , 2, or 3 substituents independently selected from the group consisting of halogen,— CN, alkyl, perfluoroalkyl, al koxy, hydroxylalkyl, alkoxylalkyl, perfj.uoroai.koxy,
0
\A „R9
R O , R10 and )
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l).
Structural formula (A-ll). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-l) in which a. R4 is hydrogen, alkoxyl, or hydroxy!, R5 is hydrogen, alkyl, aikoxyl, alkylamino, CF3, or, together with R6 and the carbon atoms to which they are attached, forms a iive-membered cycloalkvl, and
R6 is a 5- or 6-membered heteroaryl that is substituted with 1, 2, or 3 substituents independently selected from the group consisting of halogen, CN, alkyl,
Figure imgf000019_0001
R10 K . i o
, and f O
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l).
Structural formula (A-l m). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-l) in which a. R4 is hydrogen, aikoxyl, or hydroxyl, b. R5 is hydrogen, alkyl, aikoxyl, alkylamino, CF3, or, together with R6 and the carbon atoms to which they are attached, forms a five-membered cycloalkvl, and
R6 is
Figure imgf000019_0002
In other embodiments, such compounds are specifically excluded from structura formulae (A) and/or (A-l).
Structura! formula (A- In). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-l ) in which a. R4 is hydrogen, b. R5 is hydrogen, alkyl, aikoxyl, alkylamino, CF3, or, together with R6 and the carbon atoms to which they are attached, forms a five-membered cycloalkvl, and c. R6 is hydrogen; aikenyl, alkyl, or phenyl, each optionally substituted with 1, 2, or 3 substituents independently selected from the group consisting of halogen,— CN, alkyl, perfluoroalkyl, alkoxy, hydroxyiaikyi, alkoxylalkyl, perfluoroalkoxy, 0
' N I N I y · ,R1 Q
R10 , RIO and Λ O ; a 5- or 6-membered heteroaryl that is substituted with 1, 2, or 3 substituents independently selected from the group consisting of halogen,— CN, alkyl, perfluoroalkyl, alkoxy, hydroxyiaikyi,
alkoxylalkyl, perfluoroalkoxyl, O , and O ;
R10 , wherein n is 0, 1,
Figure imgf000020_0001
5 and R6, together with the carbon atoms to which they are attached, form a 5-membered cvcloaikyi.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l).
Structural formula (A-lo). Some embodiments specifically include and some embodiments only include compounds of structural formula (A~l) in which a. R4 is alkoxy 1, b. R5 is hydrogen, alkyl, alkoxyl, aikyiamino, CF3, or, together with R6 and the carbon atoms to which the)' are attached, forms a five-membered cycioalkyl, and c. R6 is hydrogen; aikenyl, alkyl, or phenyl, each optionally substituted with 1 , 2, or 3 substituents independently selected from the group consisting of halogen,— CN, alkyl, perfluoroalkyl, alkoxy, hydroxyiaikyi, alkoxylalkyl, perfluoroalkoxy,
Figure imgf000020_0002
and O ; a 5- or 6-membered heteroaryl that is substituted with 1, 2, or 3 substituents independently selected from the group consisting of halogen,— CN, alkyl, perfluoroalkyl, alkoxy, hydroxylalkyl,
O
^ . ,'R9 o
.RIO
alkoxylalkyl, perfluoroalkoxyl, R10 and ^crR1° O o
,R9
n N'
R'l 0 , wherein si is 0, 1 , or 2; R10 : or R5 and R6, together with the carbon atoms to which they are attached, form a 5-membered cvcioalkyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l).
[47] Structural formula (A-lp). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-l) in which a. R4 is hydroxyl, b. R5 is hydrogen, alkyl, alkoxy I, alkylarmno, CF3, or, together with R6 and the carbon atoms to which they are attached, forms a five-membered cvcioalkyl, and c. R6 is hydrogen; alkenyl, alkyl, or phenyl, each optional ly substituted with 1, 2, or 3 substituents independently selected from the group consisting of halogen,— CN, alkyl, perfluoroalkyl, alkoxy, hydroxylalkyl, alkoxylalkyl, perfj.uoroai.koxy,
0
\A „R9
I I -RI O
RI O s R10 and s O ; a 5- or 6-membered heteroaryl that is substituted with 1, 2, or 3 substituents independently selected from the group consisting of halogen, CN, alkyl, perfluoroalkyl, alkoxy, hydroxylalkyl,
alkoxylalkyl, perfluoroalkoxyl,
Figure imgf000021_0001
Figure imgf000021_0002
or R5 and R6, together with the carbon atoms to which they are attached, form a 5-membered cvcioalkyl. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l).
Structural formula (A-lq). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-l) in which a. R4 is hydrogen, alkoxyl, or hydroxy!, b. R5 is hydrogen, alkyl, al koxyl, a!ky!amino, or CF3, and c. R6 is hydrogen; alkenyl, alkyl, or phenyl, each optionally substituted with 1 , 2, or 3 substituents independently selected from the group consisting of halogen,— CN, alkyl, perfl.uoroalk.yl, alkoxy, hydroxylalkyl, alkoxylalkyl, periluoroalkoxy,
Figure imgf000022_0001
and -f O ; a 5- or 6-membered heteroaryl that is substituted with 1 , 2, or 3 substituents independently selected from the group consisting of halogen,— CN, alkyl, peril uoroalkyl, alkoxy, hydroxylalkyl,
alkoxylalkyl, perfluoroalkoxyl,
Figure imgf000022_0002
;
Figure imgf000022_0003
; or R5 and R6, together with the carbon atoms to which they are attached, form a 5-membered cycloalkyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l).
Some embodiments specifically include and some embodiments only include (.1 ) compounds of structural formula (A- la) and (2) compounds of any of structural formulae (A-lb), (A-lc), (A-ld), (A-le), (A-l f), (A-lg), (A-lh), (A-li), (A-lj), (A-! k), (A-l l), (A- lm), (A-ln), (A-lo), (A-lp), and (A-lq). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l ). [50 j Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-la) and (2) compounds of up to 16 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, or 16) of structural formulae (A- lb), (A-l c), (A-ld), (A- le), (A-lf), (A-lg), (A-lh), (A-li), (A-lj), (A-lk), (A-ll), (A-lm), (A- In), (A-lo), (A- Ip), and (A-lq). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l).
[51] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-la) and (2) compounds of any of structural formulae (A-l b), (A-l c), (A-ld), (A-l e), (A-lf;, (A-lg), (A-l h), (A-l i), (A-lj), (A-lk), (A-l l), (A- Irn), (A- i n ). (A-lo), (A-lp), and (A-lq). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l). Each possible combination is specifical ly contemplated as if set forth explicitly herein.
[52] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-la) and (2) compoimds of up to 16 (e.g. , 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, or 16) of structural formulae (A-lb), (A-lc), (A-ld), (A- le), (A-lf), (A-lg), (A-l h), (A-li), (A-lj), ( Λ- l k ). (A-ll), (A-l m), (A-ln), (A-l o), (A- Ip), and (A-lq). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l). Each possible combination is specifically contemplated as if set forth explicitly herein.
[53] Some embodiments specifically include and some embodiments only include (1)
compounds of stractural formula (A-lb) and (2) compoimds of any of stractural formulae (A-la), (A-l c), (A-l d), (A-l e), (A-l f), (A-l g), (A-l h), (A-li), (A-lj ), (A-lk), (A-l l), (A- 1m), (A-ln), (A-lo), (A-lp), and (A-lq). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l ). Each possible combination is specifically contemplated as if set forth explicitly herein.
[54] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-lb) and (2) compounds of up to 16 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, or 16) of stractural formulae (A- la), (A-lc), (A-l d), (A- le), (A-lf), (A-lg), (A-lh), (A-li), (A-lj), (A-lk), (A-ll), (A-lm), (A-ln), (A-lo), (A- lp), and (A-lq). in other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l ). Each possible combination is specifically contemplated as if set forth explicitly herein.
Some embodiments specifically include and some embodiments only include (1 ) compounds of stractural formula (A-lc) and (2) compounds of any of structural formulae (A-la), (A- l b), (A-l d), (A-le), (A- I f), (A-l g), (A-lh), (A-li), (A-lj), (A-l k), (A-11), (A- 1m), (A- In), (A-lo), (A-lp), and (A-lq). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l ). Each possible combination is specifically contemplated as if set forth explicitly herein.
Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-l c) and (2) compounds of up to 16 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, or 16) of structural formulae (A-la), (A-l b), (A-ld), (A- le), (A-lf), (A-lg), (A-lh), (A-li), (A-lj), (A-lk), (A-11), (A-lm), (A- In), (A-lo), (A- Ip), and (A-l q). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l). Each possible combination is specifically contemplated as if set forth explicitly herein.
Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-l d) and (2) compounds of any of structural formulae (A-l a), (A-lb), (A-ic), (A-le), (A-li), (A-lg), (A-lh), (A-H), (A-lj), (A-l k), (A-li), (A- lm), (A- In), (A-lo), (A- lp), and (A-l q). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l). Each possible combination is specifically contemplated as if set forth expli citly herein.
Some embodiments specifical ly include and some embodiments only include (1) compounds of structural formula (A-ld) and (2) compounds of up to 16 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, or 16) of stractural formulae (A-la), (A-lb), (A-ic), (A- le), (A-l f), (A-lg), (A- lh), (A- li), (A-lj), (A-l k), (A-11), (A-lm), (A- In), (A-lo), (A- lp), and (A-lq). In other embodime ts, such compounds are specifically excluded from structural formulae (A) and/or (Α-Γ). Each possible combination is specifically contemplated as if set forth explicitly herein. [5 j Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-le) and (2) compounds of any of structural formulae (A-l a), (A-lb), (A-le), (A-ld), ( Λ- Π'). (A-lg), (A-l h), (A-l i), (A-lj), (A-lk), (A-11), (A- lm), (A-ln), (A-lo), (A-lp), and (A-lq). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (Α- ). Each possible combination is specifically contemplated as if set forth explicitly herein,
[6Θ] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-le) and (2) compounds of up to 16 (e.g. , 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, or 16) of structural formulae (A-la), (A-lb), (A-le), (A- id), (A-l f), (A-l g), (A-l h), (A-l i), (A-lj), (A-lk), (A-i l), (A-lm), (A-ln), (A-lo), (A- Ip), and (A-lq). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l). Each possible combination is specifically contemplated as if set forth explicitly herein.
[61 ] Some embodiments specifically include and some embodiments only include (! )
compounds of structural formula (A-lf) and (2) compounds of any of structural formulae (A-la), (A-l b), (A-lc), (A-l d), (A-le), (A-l g), (A-l h), (A-li), (A-lj), (A-lk), (A-11), (A- lm), (A-ln), (A-lo), (A-lp), and (A-lq). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l ). Each possible combination is specifically contemplated as if set forth explicitly herein.
[62] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-lf) and (2) compounds of up to 16 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, or 16) of structural formulae (A-la), (A-l b), (A-lc), (A- ld), (A-le), (A-lg), (A-lh), (A-li), (A-lj), (A-lk), (A-11), (A-lm), (A-ln), (A-lo), (A- I p), and (A-l q). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l ). Each possible combination is specifically contemplated as if set forth explicitly herein.
[63] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-l g) and (2) compounds of any of structural formulae (A-la), (A-lb), (A-lc), (A-ld), (A-le), (A-lf), (A-lh), (A-li), (A-lj), (A-lk), (A-11), (A- 1m), (A- In), (A-lo), (A-lp), and (A-lq). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-! ). Each possible combination is specifically contemplated as if set forth explicitly herein.
[64] Some embodiments specifically include and some embodiments only include (! )
compounds of structural formula (A-lg) and (2) compounds of up to 16 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, or 16) of structural formulae (A- la), (A- l b), (A-l c), (A- ld), (A-le), (A-lf), (A-lh), (A-li), (A-lj), (A-lk), (A-ll), (A-lm), (A-in), (A-lo), (A- l p), and (A-l q). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l ). Each possible combination is specifically contemplated as if set forth explicitly herein.
[65] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-l h) and (2) compounds of any of structural formulae (A-la), (A-lb), (A-lc), (A-ld), (A-le), (A-lf), (A-lg), (A-li), (A-lj), (A-lk), (A-ll), (A- 1m), (A-l n), (A-l o), (A-lp), and (A-l q). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l). Each possible combination is specifically contemplated as if set forth expli citly herein.
[66] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-l h) and (2) compounds of up to 16 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, or 16) of structural formulae (A-la), (A-lb), (A-lc), (A- Id), (A- le), (A-lf), (A- lg), (A- li), (A-lj), (A-l k), (A-l l), (A-lm), (A-ln), (A-lo), (A- lp), and (A-lq). In other embodiments, such compounds are specifically excluded from structural formulae (A ) and/or (A-l). Each possible combination is specifically contemplated as if set forth explicitly herein.
[67] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-li) and (2) compounds of any of structural formulae (A-l a), (A-lb), (A-lc), (A-ld), (A-le), (A-lf), (A-lg), (A-lh), (A-lj), (A-lk), (A-l l), (A-lm), (A-ln), ( A- l o). (A-lp), and (A-lq). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l). Each possible combination is specifically contemplated as if set forth explicitly herein. [68 j Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-li) and (2) compounds of up to 16 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, or 16) of structural formulae (A- la), (A-lb), (A-lc), (A- ld), (A-le), (A-lf), (A-lg), (A-lh), (A-lj), (A- lk), (A- 11), (A-lm), (A-ln), (A-lo), (A- Ip), and (A-lq). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l). Each possible combination is specifically contemplated as if set forth explicitly herein.
[69] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-lj) and (2) compounds of any of structural formulae (A-la), (A-l b), (A-lc), (A-l d), (A-le), (A-l f), (A-l g), (A-lh), (A-li), (A-l k), (A-li), (A- lm), (A- In), (A- lo), (A-lp), and (A- lq). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[70] Some embodiments specifically include and some embodiments only include (1 )
compounds of structural formula (A-lj) and (2) compounds of up to 16 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, or 16) of structural formulae (A-la), (A-lb), (A-lc), (A- Id), (A-l e), (A-lf), (A-lg), (A-l h), (A-l i), (A-lk), (A-l l), (A-lm), (A- ln), (A-lo), (A- l p), and (A-l q). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l ). Each possible combination is specifically contemplated as if set forth explicitly herein.
[71] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-l k) and (2) compounds of any of structural formulae (A-la), (A-lb), (A-lc), (A-ld), (A-le), (A-lf), (A-lg), (A-lh), (A-li), (A-lj), (A-ll), (A- I m), (A-l n), (A-l o), (A-lp), and (A-l q). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l). Each possible combination is specifically contemplated as if set forth explicitly herein.
[72] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-l k) and (2) compounds of up to 16 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, or 16) of structural formulae (A-la), (A-lb), (A-lc), (A- Id), (A-l e), (A-lf), (A-lg), (A-l h), (A-l i), (A-lj), (A-11), (A-lm), (A-ln), (A-lo), (A- l p), and (A-l q). In other embodiments, such compounds are specifically excluded from stmcturai formulae (A) and/or (A-l ). Each possible combination is specifically contemplated as if set forth explicitly herein.
[73] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-l i) and (2) compounds of any of structural formulae (A-la), (A-lb), (A-lc), (A-ld), (A-le), (A-lf), (A-lg), (A-lh), (A-li), (A-lj), (A-lk), (A- Ira), (A-ln), (A-lo), (A-lp), and (A-lq). In other embodiments, such compounds are specifically excluded from stmcturai formulae (A) and/or (A-l). Each possible combination is specifically con templated as if set forth explicitly herein.
[74] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-11) and (2) compounds of up to 16 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, or 16) of stmcturai formulae (A-la), (A-lb), (A-lc), (A- Id), (A-le), (A-l f), (A-lg), (A-l h), (A-li), (A-lj), (A-l k), (A-l m), (A-ln), (A-l o), (A- lp), and (A-lq). In other embodiments, such compounds are specifically excluded from stmcturai formulae (A) and/or (A-l). Each possible combination is specifically contemplated as if set forth explicitly herein.
[75] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-lm) and (2) compounds of any of structural formulae (A-l a), (A-l b), (A-l c), (A-ld), (A-le), (A-lf), (A-lg), (A-l h), (A-li), (A-lj), (A- Ik), (A- II), (A-ln), (A-lo), (A-I ), and (A-lq). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l). Each possible combination is specifically contemplated as if set forth explicitly herein,
[76] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-lm) and (2) compounds of up to 16 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, or 16) of structural formulae (A-la), (A-l b), (A-l c), (A-ld), (A-le), (A-lf), (A-lg), (A-lh), (A-li), (A-lj), (A-l k), (A-li), (A-ln), (A-l o), (A- Ip), and (A-lq). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (Α-Γ). Each possible combination is specifically contemplated as if set forth explicitly herein,
[77] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-ln) and (2) compounds of any of structural formulae (A-la), (A-lb), (A-lc), (A-ld), (A-le), (A-lf , (A-lg), (A-lh), (A-li), (A-lj), (A- lk), (A- 11), (A- 1 m), (A-l o), (A-l ), and (A-l q). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[78] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-ln) and (2) compounds of up to 16 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, or 16) of structural formulae (A-la), (A-lb), (A-lc), (A- I d), (A-l e), (A-lf), (A-lg), (A-l h), (A-l i), (A-lj), (A-lk), (A-l i), (A-lm), (A-l o), (A- Ip), and (A-lq). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l ). Each possible combination is specifically contemplated as if set forth explicitly herein.
[79] Some embodiments specifically include and some embodiments only include (1)
compounds of structural fommla (A-l o) and (2) compounds of any of structural formulae (A- la), (A-lb), (A- lc), (A-ld), (A- le), (A-l f), (A-lg), (A- lh), (A- li), (A - l h. (A-l k), (A- 11), (A-lm), (A-ln), (A-lp), and (A-lq). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l). Each possible combination is specifically contemplated as if set forth explicitly herein.
[8Θ] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-l o) and (2) compounds of up to 16 (e.g. , 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, or 16) of structural formulae (A-la), (A-lb), (A-lc), (A- ld), (A-le), (A-l f), (A-lg), (A-lh), (A-li), (A-lj), (A-l k), (A-l l), (A-lm), (A-ln), (A- lp), and (A-l q). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l). Each possible combination is specifically contemplated as if set forth explicitly herein. [81] Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-lp) and (2) compounds of any of structural formulae (A-l a), (A-lb), (A-le), (A-ld), (A-le), (A-lf), (A-lg), (A-l h), (A-li), (A-lj), (A- lk), (A-11), (A-lm), (A- In), (A-lo), and (A-lq). In other embodiments, such compoimds are specifical ly excluded from structural formulae (A) and/or (A-l). Each possible combination is specifically contemplated as if set forth explicitly herein,
[82] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-lp) and (2) compounds of up to 16 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, or 16) of structural formulae (A-la), (A-lb), (A-le), (A- Id), (A-l e), (A-lf), (A-lg), (A-l h), (A-l i), (A-lj), (A-lk), (A-11), (A-lm), (A-l n), (A- lo), and (A-lq). in other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l). Each possible combination is specifically contemplated as if set forth explicitly herein.
[83] Some embodiments specifically include and some embodiments only include (1 )
compounds of stractural formula (A-lq) and (2) compoimds of any of stractural formulae (A-la), (A-l b), (A-lc), (A-l d), (A-le), (A-l f), (A-l g), (A-lh), (A-li), (A-lj), (A-l k), (A- 11), (A-lm), (A-ln), (A-lo), and (A-lp). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l ). Each possible combination is specifically contemplated as if set forth explicitly herein.
[84] Some embodiments specifically include and some embodiments only include (1)
compounds of stractural formula (A-lq) and (2) compoimds of up to 16 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, or 16) of structural formulae (A-la), (A-l b), (A-lc), (A- ld), (A-le), (A-lf), (A-lg), (A-lh), (A-li), (A-lj), (A-lk), (A-11), (A-lm), (A-ln), (A- lo), and (A-l ). In other embodiments, such compounds are specifically excluded from stractural formulae (A) and/or (A-l ). Each possible combination is specifically contemplated as if set forth explicitly herein. Some embodiments specifically include and some embodiments only include compoun which have structural formula (A-2):
Figure imgf000031_0001
(A-2) wherein R3, R4, R5, R5f, R6, R7, R7f, R8, and R8f are as defined in structural formula (A). In other embodiments, such compounds are specifically excluded from structural formula (A).
Structural formula (A-2a). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-2) in which R3, R4, R5, R5f, R7, R7', R8, and R8' are hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A.) and/or (A-2).
Structural formula (A-2b). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-2) in which R6 is a side chain selected from the group consisting of alkyl, perfluoroalkyl, alkoxyl, hydroxyialkyl, alkoxylalkyl, and perfluoroalkoxyl, each optionally substituted with 1-3 substituents selected from halogen,— CN, alkyl, perfluoroalkyl, alkoxy, hydroxyialkyl, alkoxylalkyl, and perfluoroalkoxyl. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-2).
Structural formula (A-2c). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-2) in which R7' is hydrogen and R7 is a side chain selected from the group consisting of alkyl, perfluoroaikyi alkoxyl, hydroxylalkyl, alkoxylalkyl, and perfluoroalkoxyl, each optionally substituted with 1-3 substituents selected from halogen,— CN, alkyl, perfluoroaikyi, aikoxy, hydroxylalkyl, alkoxylalkyl, and perfluoroalkoxyl. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-2).
Structural formula (A-2d). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-2) in which R6 is alkenyi, alkyne, phenyl, or a 5- or 6-membered heteroaryl, each optionally substituted with 1 2, or 3 substituents independently selected from the group consisting of
, wherein n is 0, 1, or 2;
Figure imgf000032_0001
R9 and R10 are as defined in connection with structural formula (A).
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-2).
9Θ] Some embodiments specifically include and some embodiments only include (I)
compounds of structural formula (A-2a) and (2) compounds of any of structural formul ae (A-2b), (A-2c), and (A-2d). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-2). Each possible combination is specifically contemplated as if set forth explicitly herein.
[91] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-2a) and (2) compounds of up to 3 (e.g., 1, 2, or 3) of structural formulae (A-2b), (A-2c), and (A-2d), In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-2), Each possible combination is specifical ly contemplated as if set forth explicitly herein. [92 j Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-2b) and (2) compounds of any of structural formulae (A-2a), (A-2c), and (A-2d). in other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-2). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[93] Some embodiments specifical ly include and some embodiments only include (1)
compounds of structural formula (A-2b) and (2) compounds of up to 3 (e.g., 1 , 2, or 3) of structural formulae (A-2a), (A-2c), and (A-2d). In other embodiments, such compounds are specifically excluded from stractural formulae (A) and/or (A-2). Each possible combination is specifically contemplated as if set forth explicitly herein.
[94] Some embodiments specifically include and some embodiments only include (1)
compounds of stractural formula (A-2c) and (2) compounds of any of structural formul ae (A-2a), (A-2b), and (A-2d). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-2). Each possible combination is specifically contemplated as if set forth explicitly herein,
[95] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-2c) and (2) compounds of up to 3 (e.g., 1 , 2, or 3) of stractural formulae (A-2a), (A-2b), and (A-2d). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-2). Each possible combination is specifically contemplated as if set forth explicitly herein.
[96] Some embodiments specifically include and some embodiments only include (1 )
compounds of stractural formula (A-2d) and (2) compounds of any of stractural formulae (A-2a), (A-2b), and (A-2c). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-2). Each possible combination is specifically contemplated as if set forth explicitly herein.
[97] Some embodiments specifically include and some embodiments only include (1)
compounds of stractural formula (A-2d) and (2) compounds of up to 3 (e.g., 1 , 2, or 3) of stractural formulae (A-2a), (A~2b), and (A-2c). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-2). Each possible combination is specifically contemplated as if set forth explicitly herein.
Some embodiments specifically include and some embodiments only include compounds which have structural formula (A-3):
Figure imgf000034_0001
(A-3)
wherein:
R3, R4, R6, and R7 are as defined in structural formula (A), PROVIDED THAT: i. if R3 and R4 are hydrogen and R6 is optionally substituted phenyl, then R7 cannot be optional!)' substituted phenyl, hydrogen, methyl, or
CH20(CH2)2;
ii. if R3 and R4 are hydrogen and R6 is methoxy, then R7 is not methyl or unsubstituted phenyl;
iii. if R3 is ethyl, R4 is hydrogen, R7 is methyl, then R6 is not fluorophenyl; iv. if R3 is halogen and R4 and R7 are hydrogen, then R6 is not
bromophenyl; and
v. R6 and R7 cannot both be methyl if either:
i, R3 is halogen and R4 is hydrogen; or
ii. one of R3 and R4 is methyl and the other is hydrogen.
In other embodiments, such compounds are specifically excluded from structural formula (A).
Structural formula (A-3a). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-3) in which R6 is a side chain selected from the group consisting of alkyl, perfluoroalkyl, alkoxyi, hydroxylalkyi C1-C6 alkoxylalkyl, and perfluoroalkoxyi, each optionally substituted with 1-3 substituents selected from halogen,— CN, alkyl, perfluoroalkyl, alkoxy, hydroxylalkyi, alkoxylalkyl, and perfluoroalkoxyi. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3).
Structural formula (A-3b). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-3) in which R6 is alkenyl, or alkynyl, or phenyl, or a 5- or 6-membered heteroaryl, each optionally substituted with 1 2, or 3 substituents independently selected from the group consisting
, wherein si is 0, 1, or 2;
Figure imgf000035_0001
; or θ' O , in which R9 and R10 are defined as in structural formula (A), in other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3).
[1Θ1] Structural formula (A-3c). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-3) in which R7 is hydrogen; halogen;— CN; optionally substituted alkyl; or optionally substituted alkoxyi. Optional substituents for the alky] and for the alkoxyi are (1) a C1-C6 hydrocarbon chain containing an N or O atom and optional!)' substituted with a C1-C3 perfluoroalkyl, and (2) a cycloaikyi which may contain 1 or 2 heteroatoms selected from N, O, and S, and which is optionally substituted with a C1-C3 perfluoroalkyl. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3).
[102] Structural formula (A-3d). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-3) in which R9 and R10 are independently hydrogen, C2-C6 alkyl, alkoxylalkyl, perfluoroalkoxylalkyl, aryl, optionally substituted with 1, 2, or 3 substituents independently selected from R2i. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3).
] Structural formula (A-3e). Some embodiments specifically include and some
embodiments only include compounds of structural formuia (A-3) in which R9 and RIO are independently a 5- or 6-membered heterocycle, optionally substituted with 1, 2, or 3 substituents independently selected from R21. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3).
] Structural formula (A-3f). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-3) in which R9 and RIO are independently a 5- or 6-membered heteroaryl, optionally substituted with 1 , 2, or 3 substituents independently selected from R21; or ' n Ki 2 , wherein n is 0, 1, 2, or 3 and R12 is as defined in structural formula (A). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3).
] Structural formula (A-3g). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-3) in which R9 and RIO, together with the nitrogen atom to which they are attached, form a heterocycle containing 1 , 2, 3, or 4 heteroatoms selected from N, O and S, optionally substituted with 1 , 2, or 3 substituents selected independently from Rll, wherein Ril is defined as in structural formula (A). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3).
] Structural formula (A-3h). Some embodiments specifically include and some
embodiments only include compounds of structural formula ( A-3) which R6 is alkenyl, or alkynyl, or phenyl, or a 5- or 6-membered heteroaryl, each optionally substituted with
Figure imgf000036_0001
1, 2, or 3 substituents independently selected from the group consisting of R 10
Figure imgf000036_0002
^s" 0 ; O ; or θ' Ν0 , in which R9 and RIO are defined as in structural formula (A). In other embodiments, such compounds are specifically excluded from stnictural formulae (A) and/or (A-3).
] Structural formula (A-3i). Some embodimen s specifically include and some
embodiments only mclude compounds of structural formula (A-3) in which R7 is alkyl. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3).
] Structural formula (A-3j). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-3) in which R7 is methyl. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3).
] Structural formula (A-3k). Some embodiments specifically mclude and some
embodiments only include compounds of structural formula (A-3) in which a. R7 is alkyl. b. R6 is alkenyl, or alkynyi, or phenyl, or a 5- or 6-membered heteroaryl, each
optionally substituted with 1 2, or 3 substituents independent!)' selected from the
group consisting of ,
wherein s¾ is 0, 1, or
Figure imgf000037_0001
hich R9 and RIO are defined as in structural formula (A).
In other embodiments, such compounds are specifically excluded from stnictural formulae (A) and/or (A-3). ] Structural formula (A-31). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A3) in which 3 is alkoxyl. Some embodiments specifically include and some embodiments only include compounds of structural formula (A-3) in which R3 is methoxy. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3).
] Structural formula (A-3m). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-3) in which a. R7 is methyl and b. R3 is alkoxyl.
In other embodiments, such compounds are specifically excluded from stmctural formulae (A) and/or (A-3).
] Structural formula (A-3n). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-3) in which a. R7 is methyl; b. R3 is alkoxyl; and c. R6 is alkenyl, or alkynyl, or phenyl, or a 5- or 6-merabered heteroaryl, each
optionally substituted with 1, 2, or 3 substituents independently selected from the
group consisting of
wherein si is 0, 1, or
Figure imgf000038_0001
hich R9 and Rf 0 are defined as in structural formula (A).
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). [113] Structural formula (A-3o). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-3) in which a. R7 is methyl and b. R3 is methoxy.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3).
[114] Structural formula (A-3p). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-3) in which a. 7 is methyl; b. R3 is methoxy; and c. R6 is alkenyl, or alkynyl, or phenyl, or a 5- or 6-membered heteroaiyl, each
optionally substituted with 1, 2, or 3 substituents independently selected from the
group c
Figure imgf000039_0001
wherein n is 0, 1, or 2;
Figure imgf000039_0002
; ; O ; or O O , in which R9 and RIO are defined as in structural formula (A).
In other embodiments, such compounds are specifically excluded from structural form lae (A) and/or (A-3).
[115] Structural formula (A-3q). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-3) in which a. R7 is alky I and b. R3 is alkoxyl. In other embodiments, such compounds are specifically excluded from stmctural formulae (A) and/or (A-3).
[116] Structural formula (A~3r), Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-3) in which a. R7 is alkyl, b. R3 is alkoxy!, and c. R6 is alkenyl, or alkynyl, or phenyl, or a 5- or 6-membered heteroaryl, each
optiona endently selected from the
group c O Rio ,
wherein
Figure imgf000040_0001
n is 0, 1, or 2; ; or O O , in which R9 and RIO are defined as in structural formula (A).
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3).
[117] Structural formula (A-3s). Some embodiments specifically include and some
embodiments only mclude compounds of structural formula (A-3) in which R6 is
Figure imgf000040_0002
1 , or 2, and R9 and 10 are defined as in structural formula
(A).
In other embodiments, such compounds are specifically excluded from structural form lae (A) and/or (A-3).
[118] Structural formula (A-3t). Some embodiments specifically include and some
embodiments only include compounds of stmctural formula (A-3) in which R3 is hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3).
[119] Structural formula (A-3 ). Some embodiments specifically include and some
embodiments only include compounds of structural formuia (A-3) in which R4 is hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3).
1120] Structural formula (A-3v). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-3) in which R3 and R4 are hydrogen. In other embodiments, such compounds are specifically excluded from stmctural formulae (A) and/or (A-3).
[121] Structural formula (A-3w). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-3) in which a. R3 is methoxy and b. R4 is hydrogen.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3).
[122] Structural formula (A-3x). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-3) in which a. R3 is methoxy, b. R4 is hydrogen, and c. R7 is methyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). [123] Structural formula (A-3y). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-3) in which a. R4 is methoxy and b. R7 is methyl
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3).
[124] Structural formula (A-3z). Some embodiments specifically include and some
embodiments only include compounds of stmctural formula (A-3) in which a. R3 is hydrogen and b. R6 is alkenyl, or aikynyl, or phenyl, or a 5- or 6-membered heteroaryl, each
optionally substituted with 1, 2, or 3 substituents independently selected from the
group consisting or io ,
wherein n is 0, 1, or
Figure imgf000042_0001
, in which R9 and RIO are defined as in structural formula (A).
In other embodiments, such compounds are specifically excluded from stmctural form lae (A) and/or (A-3).
[125] Structural formula (A-3aa), Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-3) in which a. R4 is hydrogen and b. R6 is alkenyl, or aikynyl, or phenyl, or a 5- or 6-membered heteroaryl, each
optionally substituted with 1, 2, or 3 substituents independently selected from the
Figure imgf000043_0001
group consisting of R io , Rio , O l , O Rio ,
Figure imgf000043_0002
wherein Ώ is 0, 1 , or 2; Rio ; * S ; O ; or O O , in which R9 and RIO are defined as in structural formula (A).
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3).
[126] Structural formula (A-3bb). Some embodiments specifically mclude and some
embodiments only include compounds of stmctural formula (A-3) in which a. R3 and 4 are hydrogen and b. R6 is alkenyl, or alkynyl, or phenyl, or a 5- or 6-membered heteroaryl, each
optionally substituted with 1 2, or 3 substituents independently selected from the
Figure imgf000043_0003
group consisting oi io , Kio , - O , 0 , Kio ,
wherein n is 0, 1 , or 2;
Figure imgf000043_0004
, in which R9 and RiO are defined as in structural formula (A).
In other embodiments, such compounds are specifically excluded from stmctural form lae (A) and/or (A-3).
[127] Structural formula (A-3cc). Some embodiments specifically mclude and some
embodiments only include compounds of structural formula (A-3) in which a. R3 is methoxy, b. R4 is hydrogen, and c. R6 is alkenyl, or alkynyi, or phenyl, or a 5- or 6-membered heteroaiyi, each o tionally substituted with 1 , 2, or 3 substituents independently selected from the
Figure imgf000044_0001
O
X . ^ R-O ! I
wherein n is 0, 1 , or 2; Rio ; f"S !' ; O ; or O O , in which 9 and RIO are defined as in structural formula (A).
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3).
Structural formula (A-3dd). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-3) in which a. R3 is methoxy, b. R4 is hydrogen, c. R7 is methyl, and d. R6 is alkenyl, or alkynyi, or phenyl, or a 5- or 6-membered heteroaryl, each
optionally substituted with 1, 2, or 3 substituents independently selected from the
group c
wherei
Figure imgf000044_0002
ich 9 and RIO are defined as in stnictural formula (A ).
In other embodiments, such compounds are specifically excluded from stnictural formulae (A) and/or (A-3). Structural formula (A-3ee). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-3) in which a. R4 is methoxy, b. R7 is methyl, and c. R6 is alkenyl, or alkynyl, or phenyl, or a 5- or 6-membered heteroaryl, each optionally substituted with 1 , 2, or 3 substituents independently selected from the
group consisting ot ,
Figure imgf000045_0001
wherein n is 0, 1 , or 2; Rio ; ; O ; or O O , in which R9 and RIO are defined as in structural formula (A).
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3), Some embodiments specifical ly include and some embodiments only include (1) compounds of structural formula (A-3a) and (2) compounds of any of stmctural formulae (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A- 3m), (A-3n), (A-3o), (Λ ·3η (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A- 3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other
embodiments, such compounds are specifically excluded from stmctural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein. Some embodiments specifically include and some embodiments only include (! ) compounds of stmctural formula (A-3a) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of stmctural formulae (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A-3x), (Λ ·3ν (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and
(A-3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-3b) and (2) compounds of any of structural formulae (A-3a), (A c ). (A-3d), (A-3e), ( Λ-3 Γ). (A-3g), (,\ -3h ). (A - 3i ). (A-3j), ( A - k ).. (A-31), (A- 3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A- 3x), (Λ · 3ν (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other
embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A -3b) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae ( A~3a), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
Some embodiments specifical ly include and some embodiments only include (1) compounds of structural formula (A-3c) and (2) compounds of any of structural formulae (A-3a), (A-3b), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-31), (A-3j), (A-3k), (A-31), (A- 3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A- 3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other
embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein. [135] Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-3c) and (2) compounds of up to 30 (e.g. , 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-3a), (A-3b), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
[136] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-3d) and (2) compounds of any of structural formulae (A-3a), (A-3b), (A-3c), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A- 3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A- 3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possibie combination is specifically contemplated as if set forth explicitly herein.
[137] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-3d) and (2) compounds of up to 30 (e.g. , 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A~3a), (A-3b), ( A-3c), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A■■},}, (A-3t), (A-3u), (A-3v), (A-3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3), Each possible combination is specifically contemplated as if set forth explicitly herein.
[138] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-3e) and (2) compounds of any of structural formulae (A-3a), (A-3b), (A-3c), (A~3d), (A-3f), (A-3g), (A-3h), (A-31), (A-3j), (A-3k), (A-31), (A- 3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (Λ · 3κ (A-3v), (A-3w), (A- 3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein,
] Some embodiments specifical ly include and some embodiments only include (1)
compounds of structural formula (A-3e) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), ( A - k ). (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
] Some embodiments specifically include and some embodiments only include (I)
compounds of structural formula (A-3f) and (2) compounds of any of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A- 3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A- 3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A~3f) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A~3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
[142] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A~3g) and (2) compounds of any of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A- 3m), (A-3n), (A~3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A- 3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other
embodiments, such compounds are specifical ly excluded from stractural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
[143] Some embodiments specifically include and some embodiments only include (1)
compounds of stractural formula (A-3g) and (2) compounds of up to 30 (e.g. , 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of stractural formulae (A-3a), (A-3b), (A-3c), (A -3d), (A-3e), (A~3f), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
[144] Some embodiments specifically include and some embodiments only include (1)
compounds of stractural formula (A-3h) and (2) compoimds of any of stractural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3i), (A-3j), (A-3k), (A-31), (A- 3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A- 3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other
embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
[145] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-3h) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-3a), (A-3b), (A-3c), (A~3d), (A-3e), (A-3f), (A-3g), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A - 3l ). (A-3u), (A-3v), (A-3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
[146] Some embodiments specifically include and some embodiments only include (1)
compounds of stmctural formula (A-3i) and (2) compounds of any of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (Λ · 3ο (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein,
[147] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-3i) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3j), ( A - k ). (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A~3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifical ly contemplated as if set forth explicitly herein.
[148] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-3j) and (2) compounds of any of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A~3s), (A-3t), (A-3u), (A-3v), (A-3w),
(A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
[149] Some embodiments specifically include and some embodiments only include (1 )
compounds of structural formula (A-3j) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-3 a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3k), (A-3I), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
[150] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A -3k) and (2) compounds of any of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-31), (A- 3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A- 3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other
embodiments, such compounds are specifically excluded from structural formulae (A.) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
[151] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-3k) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-3a), (A-3b), (A-3c), (A -3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A- 3u), (A-3v), (A-3w), (A-3x), (A-3y), (A~3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A- 3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifical ly contemplated as if set forth explicitly herein. [152] Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-31) and (2) compounds of any of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-31), (A-3j), (A - 3k). (A-3ni), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A-3x), (A~3y), (A-3/}. (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or ( A-3). Each possible combination is specifically contemplated as if set forth explicitly herein,
[153] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-31) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-3 a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-31), (A-3j), (A-3k), ( A-3m), (A-3n), ( A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A~3t), (A-3u), (A-3v), (A-3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
[154] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-3m) and (2) compounds of any of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A -3k ;·. (A-31), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v),
(A-3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein,
[155] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-3m) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A- 3u), (A-3v), (A~3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-
3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3), Each possible combination is specifically contemplated as if set forth explicitly herein.
1156] Some embodiments specifical ly include and some embodiments only include (1)
compounds of structural formula (A-3n) and (2) compounds of any of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A-3x), (A~3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
[157] Some embodiments specifically include and some embodiments only include (1 )
compounds of structural formula (A-3n) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (Λ- 3u), (A-3v), (A-3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A- 3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
[158] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-3o) and (2) compounds of any of structural formulae (A-3a), (A-3b), (A-3e), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A - 3k (A-31), (A-3m), (A-3n), (A-3p), (A-3q), (A~3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A 3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A.) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-3o) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A- 3u), (A-3v), (A-3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A- 3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
] Some embodiments specifical ly include and some embodiments only include (1)
compounds of structural formula (A-3p) and (2) compounds of any of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v),
Figure imgf000054_0001
(A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-3p) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-3 a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3q), (A-3r), (A-3s), (A-3t), (A- 3u), (A-3v), (A-3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A- 3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein. Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-3q) and (2) compounds of any of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A - 3k h (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v),
Figure imgf000055_0001
(A-3x), (A-3y), (A-3/}. (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifically excluded from stmctural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-3q) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of stmctural formulae (A-3 a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), ( A - k ;·. (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3r), (A-3s), (A-3t), (A- 3u), (A-3v), (A-3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A- 3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
Some embodiments specifically include and some embodiments only include (1) compounds of stmctural formula (A-3r) and (2) compounds of any of stmctural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3s), (A-3t), (A-3u), (A-3v), (A-3 ), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-3r) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-3a), (A-3b), (A-3c), (A -3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A~3ec), (A-3dd), and
(A-3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3), Each possible combination is specifically contemplated as if set forth explicitly herein.
1166] Some embodiments specifical ly include and some embodiments only include (1)
compounds of structural formula (A-3s) and (2) compounds of any of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3t), (A-3u), (A-3v), (A-3w), (A~3x), (A~3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
[167] Some embodiments specifically include and some embodiments only include (1 )
compounds of structural formula (A-3s) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3t), (A-3u), (A-3v), (A-3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, suc compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
[168] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-3t) and (2) compounds of any of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A~3q), (A-3r), ( - ). (A-3u), (A-3v), (A-3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
[169] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-3t) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A~3a), (A-3b), ( A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A~3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3u), (A-3v), (A-3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
1170] Some embodiments specifical ly include and some embodiments only include (1)
compounds of structural formula (A-3u) and (2) compounds of any of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3v), (A-3w), (A~3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
[171 ] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-3u) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-3 a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), ·( .'\-3k ;·. (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3v), (A-3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A~3ee). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein. [172] Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-3v) and (2) compounds of any of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein,
[173] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-3v) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-3 a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
[174] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-3w) and (2) compounds of any of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A~3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein,
[175] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-3w) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A -3s ). (A-3t), (A-3u), (A-3v), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3), Each possible combination is specifically contemplated as if set forth explicitly herein. Some embodiments specifical ly include and some embodiments only include (1) compounds of structural formula (A-3x) and (2) compounds of any of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein. Some embodiments specifically include and some embodiments only include (1 ) compounds of structural formula (A-3x) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein. Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A~3y ) and (2) compounds of any of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A~3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A-3x), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-3y) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-3a), (A-3b), ( A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3 ), (A-3x), (A-3z), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
Some embodiments specifical ly include and some embodiments only include (1) compounds of structural formula (A-3z) and (2) compounds of any of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A~3w), (A-3x), (A-3y), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A~3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-3z) and (2) compounds of up to 30 (e.g., I , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-3 a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), ·( .'\-3k ;·. (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A-3x), (A-3y), (A-3aa), (A-3bb), (A-3cc), (A-3dd), and (A~3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein. [182] Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-3aa) and (2) compounds of any of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A-3x), (A-3y), (A-3z), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein,
[183] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-3aa) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A~3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A-3x), (A-3y), (A-3z), (A-3bb), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
[184] Some embodiments specifically include and some embodiments only include (! )
compounds of structural formula (A-3bb) and (2) compounds of any of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A~3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A~3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3cc), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein,
[185] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-3bb) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A -3s ). (A-3t), (A-3u), (A-3v), (A-3w), (A~3x), (A~3y), (A-3z), (A-3aa), (A-3cc), (A-3dd), and
(A-3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
1186] Some embodiments specifical ly include and some embodiments only include (1)
compounds of structural formula (A-3cc) and (2) compounds of any of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A~3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A~3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
[187] Some embodiments specifically include and some embodiments only include (1 )
compounds of structural formula (A-3cc) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3dd), and (A-3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
[188] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A~3dd) and (2) compounds of any of structural formulae (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A~3k), (A-31), (A-3m), (A-3n), (A-3o), (A~3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), and (A-3ee). in other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
[189] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-3dd) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 . 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A~3a), (A-3b), ( A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3 ), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A~3cc), and (A-3ee). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein.
1190] Some embodiments specifical ly include and some embodiments only include (1)
compounds of structural formula (A-3ee) and (2) compounds of any of structural (A-3a), (A-3b), (A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A- 3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3w), (A- 3x), (A-3y), (A-3z), (A-3aa), (A~3bb), (A~3cc), and (A-3dd). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifical ly contemplated as if set forth explicitly herein.
[191] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-3ee) and (2) compounds of up to 30 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, I I , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae ( A-3a), (A-3b), ( A-3c), (A-3d), (A-3e), (A-3f), (A-3g), (A-3h), (A-3i), (A-3j), (A-3k), (A-31), (A-3m), (A-3n), (A-3o), (A-3p), (A-3q), (A-3r), (A-3s), (A-3t), (A-3u), (A-3v), (A-3 ), (A-3x), (A-3y), (A-3z), (A-3aa), (A-3bb), (A-3cc), and (A-3dd). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-3). Each possible combination is specifically contemplated as if set forth explicitly herein. Some embodiments specifically include and some embodiments only include compounds which have structural formula (A-4):
Figure imgf000064_0001
(A-4) wherein R3, R4, R5, R5', R6, R6', R7, R8, and R8? are as defined in structural formula (A). In other embodiments, such compounds are specifically excluded from structural formula (A).
Structural formula (A-4a). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-4) in which R3, R4, R5, R5', R6, R6', R8, and R8? are hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-4).
Structural formula (A-4b). Some embodiments specifically include and some embodiments only include compounds of stmctural formula (A-4) in which R7 is hydrogen; halogen;— CN; optionally substituted alkyl; or an optionally substituted alkoxyl. Optional substituents for the alkyl and for the alkoxyl are (1) a C1-C6 hydrocarbon chain containing a nitrogen or oxygen atom and optionally substituted with a C1-C3 perfluoroalkyl, and (2) a cycloalkyl which may contain 1 or 2 heteroatoms selected from N, O, and S, and which is optionally substituted with a C1-C3
perfluoroalkyl. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-4).
Structural formula (A-4c). Some embodiments specifically include and some embodiments only include compound sof structural formula (A-4) in which R7 is alkyl, perfluoroalkyl, alkoxyl, hydroxylalkyl, alkoxylalkyl, or perfluoiOalkoxyi. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-4).
[196] Structural formula (A-4d). Some embodiments specifically include and some
embodiments only include compoundsof structural formula (A-4) in which R7 is a side chain selected from the group consisting of alky 1, perfluoroalkyl, alkox i, hydroxylalkyl, alkoxvlalkyl, and perfiuoroaikoxyl, each optionally substituted with 1 -3 substituents selected from halogen,— CN, alkyl, perfluoroalkyl, alkoxy, hydroxylalkyl, alkoxvlalkyl, and perfiuoroaikoxyl. in other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-4).
[197] Structural formula (A-4e). Some embodiments specifically include and some
embodiments only include compoundsof structural formula (A-4) in which 7 is alkenyl, alkyne, phenyl, or a 5- or 6-membered heteroaryl, each optionally substituted with 1 , 2,
O or 3 substituents independently selected from the group consisting of
Figure imgf000065_0001
Rio
Figure imgf000065_0002
R9 and RIO are as defined in connection with structural formula (A). In other
embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-4).
Some embodiments specifically include and some embodiments only include (!) compounds of stractural formula (A-4a) and (2) compounds of any of structural formulae (A-4b), (A -4c), (A-4d), and (A-4e). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-4). Each possible combination is specifical ly contemplated as if set forth explicitly herein. [199] Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A~4a) and (2) compounds of up to 4 (e.g., 1 , 2, 3, or 4) of structural formulae (A-4b), (A-4c), (A-4d), and (A-4e). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-4). Each possible combination is specifically contemplated as if set forth explicitly herein.
[200] Some embodiments specifical ly include and some embodiments only include (1)
compounds of structural formula (A- b) and (2) compounds of any of structural formulae (A-4a), (A-4c), (A~4d), and (A-4e). In other embodiments, such compounds are specifically excluded from stmctural formulae (A) and/or (A-4). Each possible combination is specifically contemplated as if set forth explicitly herein.
[201] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-4b) and (2) compounds of up to 4 (e.g., 1 , 2, 3, or 4) of structural formulae (A-4a), (A-4c), (A-4d), and (A-4e). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-4). Each possible combination is specifically contemplated as if set forth explicitly herein.
[202] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-4c) and (2) compounds of any of structural formulae (A-4a), (A-4b), (A-4d), and (A-4e). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-4). Each possible combination is specifically contemplated as if set forth explicitly herein.
[203] Some embodiments specifically include and some embodiments only include (! )
compounds of stmctural formula (A-4e) and (2) compounds of up to 4 (e.g., I , 2, 3, or 4) of structural formulae ( A-4a), (A-4b), (A-4d), and (A-4e). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-4). Each possible combination is specifically contemplated as if set forth explicitly herein.
[204] Some embodiments specifically include and some embodiments only include (1)
compounds of stmctural formula (A-4d) and (2) compounds of any of stmctural formulae (A~4a), (A-4b), (A~4c), and (A-4e). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-4). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[205] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A~4d) and (2) compounds of up to 4 (e.g., I , 2, 3, or 4) of structural formulae (A~4a), (A-4b), (A-4c), and (A-4e). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-4). Each possible combination is specifically contemplated as if set forth explicitly herein,
[2Θ6] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-4e) and (2) compounds of any of structural formulae (A-4a), (A-4b), (A-4c), and (A-4d). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-4). Each possible combination is specifically contemplated as if set forth explicitly herein.
[207] Some embodiments specifical ly include and some embodiments only include (1)
compounds of structural formula (A-4e) and (2) compounds of up to 4 (e.g., 1 , 2, 3, or 4) of structural formulae (A-4a), (A-4b), (A-4c), and (A~4d). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-4). Each possible combination is specifically contemplated as if set forth explicitly herein.
[208] Some embodiments specifically include and some embodiments only include compounds which have structural formula (A-5):
Figure imgf000067_0001
(A-5) wherein R3, R4, R6, R7, and R8 are as defined in structural formula (A). In other embodiments, such compounds are specifically excluded from structural formula (A).
Structural formula (A-5a). Some embodiments include only those compounds of stmctural formula (A-5) in which R3 and R4 are hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-5).
Structural formula (A-5b). Some embodiments specifically include and some embodiments only include compoundsof stmctural formula (A-5) in which R6 is alkenyl, alkyne, phenyl, or a 5- or 6-membered heteroaryl, each optionally substituted with 1, 2,
O or 3 substituents independently selected from the group consisting of
Figure imgf000068_0001
Figure imgf000068_0002
, wherein n is 0, 1 , or 2; Rio
¾-R9 ,R9
? S i0 ; O ; or O N0 ; and
R9 and RIO are as defined in connection with structural formula (A). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-5).
Some embodiments specifically include and some embodiments only include (I) compounds of structural formula (A-5 a) and (2) compounds of structural formula ( A-5b). In other embodiments, (1) compounds of structural formula (A-5a) and (2) compounds of structural formula (A-5b) compounds are specifically excluded from structural formulae (A) and/or (A-5). [212] Some embodiments specifically include and some embodiments only include compounds which have structural formula (A-6a):
Figure imgf000069_0001
(A-6a) wherein:
R3, R4, and R6 are as defined in structural formula (A). In other embodiments, such compounds are specifically excluded from structural formula (A).
[213] Structural formula (A-6al). Some embodiments include only those compounds of structural formula (A~6a) in which R3 is hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6a).
[214] Structural formula (A-6a2). Some embodiments include only those compounds of structural formula (A-6a) in which R4 is hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6a).
[215] Structural formula (A-6a3). Some embodiments include only those compounds of structural formula (A-6a) in which R3 and R4 are hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6a).
[216] Structural formula (A-6a4), Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-6a) in which R6 is hydrogen; halogen;— CN; optionally substituted alkyl; or optionally substituted alkoxyl. Optional substituents for the alkyl and for the aikoxyl are (1) a C1 -C6 hydrocarbon chain containing a nitrogen or oxygen atom and optionally substituted with a C1-C3 perfiuoroalkyl, and (2) a cycloalkyl which may contain 1 or 2 heteroatoms selected from N, O, and S, and which is optionally substituted with a C1-C3 perfiuoroalkyl. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A~6a).
Structural formula (A-6a5), Some embodiments specifically include and some embodiments only include compoundsof structural formula (A-6a) in which R6 is C1-C6 alkyl, C1-C6 perfluoroalkyl, C1-C6 alkoxyl, C1-C6 hydroxylalkyl, C1-C6 alkoxylalkyl, or C1-C6 perfluoroalkoxyi. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6a).
Structural formula (A-6a6). Some embodiments include only those compounds of structural formula (A~6a) in whic a. R3 is hydrogen and b. R.6 is hydrogen; halogen;— CN; optionally substituted alkyl; or optionally
substituted alkoxyl. Optional substituents for the alkyl and for the alkoxyl are (1) a C1-C6 hydrocarbon chain containing a nitrogen or oxygen atom and optionally substituted with a C1-C3 perfluoroalkyl, and (2) a cycioalkyl which may contain 1 or 2 heteroatoms selected from N, O, and S, and which is optionally substituted with a C1 -C3 perfluoroalkyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6a).
Structural formula (A-6a7). Some embodiments include only those compounds of structural formula (A-6a) in which a. R4 is hydrogen and b. R6 is hydrogen; halogen;— CN; optionally substituted alkyl; or optionally
substituted alkoxyl. Optional substituents for the alkyl and for the al koxyl are (1) a CI-C6 hydrocarbon chain containing a nitrogen or oxygen atom and optionally substituted with a C1-C3 perfluoroalkyl, and (2) a cycioalkyl which may contain 1 or 2 heteroatoms selected from N, O, and S, and which is optionally substituted with a C1-C3 perfluoroalkyl. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6a).
Structural formula (A-6a8), Some embodiments include only those compounds of structural formula (A-6a) in which a. R3 and R4 are hydrogen and b. 6 is hydrogen; halogen; CN; optionally substituted a!ky!; or optionally
substituted alkoxyl. Optional substituents for the alkyl and for the alkoxyl are (1) a C.1 -C6 hydrocarbon chain containing a nitrogen or oxygen atom and optionally substituted with a C 1-C3 perfluoroalkyl, and (2) a cycloalkyl which may contain 1 or 2 heteroatoms selected from N, O, and S, and which is optionally substituted with a C1-C3 perfluoroalkyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6a).
Structural formula (A-6a9). Some embodiments include only those compounds of structural formula (A-6a) in which a. R3 is hydrogen and b. R6 is C1-C6 alkyl, C1-C6 perfluoroalkyl, C1-C6 alkoxyl, C1-C6 hydroxylalkyl, C1-C6 alkoxylaikyi, or C1 -C6 perfluoroalkoxyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6a).
Structural formula (A-6al0). Some embodiments include only those compounds of structural formula (A-6a) in which a. R4 is hydrogen and b. R6 is CI -C6 alkyl, CI -C6 perfluoroalkyl, CI -C6 alkoxyl, CI ~C6 hydroxylalkyl, C1-C6 alkoxylaikyi, or C1-C6 perfluoroalkoxyl. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6a).
[223] Structural formula (A-6all). Some embodiments include only those compounds of structural formula (A-6a) in which a. R3 and R4 are hydrogen and b. 6 is CI -C6 a!ky!, CI -C6 perfluoroalkyl, CI -C6 a!koxyl, CI ~C6 hydroxy lalkyl, C1-C6 alkoxyialkyl, or C1-C6 perfluoroalkoxyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6a).
[224] Structural formula (A-6al2). Some embodiments specifically include and some
embodiments only include compoundsof structural formula (A-6a) in which R6 is a side chain selected from the group consisting of alkyl, perfluoroalkyl, alkoxyl, hydroxyialkyl, alkoxyialkyl, and perfluoroalkoxyl, each optionally substituted with 1-3 substituents selected from halogen,— CN, alkyl, perfluoroalkyl, alkoxy, hydroxyialkyl, alkoxyialkyl, and perfluoroalkoxyl. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6a).
[225] Structural formula (A-6al3). Some embodiments specifically include and some
embodiments only include compoundsof structural formula (A-6a) in which R6 is alkenyl, alkyne, phenyl, or a 5- or 6-membered heteroaryl, each optionally substituted ith 1 2, or 3 substituents independently selected from the group consisting of
Figure imgf000072_0001
R9 and RIO are as defined in connection with structural formula (A). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6a). Some embodiments specifically include and some embodiments only include (1 ) compounds of stractural formula (A-6al) and (2) compounds of any of structural formulae (A-6a2), (A-6a3), (A~6a4), (A-6a5), (A-6a6), (A-6a7), (A-6a8), (A-6a9), (A- 6al0), (A-6al 1), (A-6al2), and (A-6al3). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6a). Each possible combination is specifically contemplated as if set forth explicitly herein. Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-6al) and (2) compounds of up to 12 {e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12) of structural formulae (A-6a2), (A-6a3), (A-6a4), (A-6a5), (A- 6a6), (A-6a7), (A-6a8), (A-6a9), (A-6al0), (A-6al l), (A-6al2), and (A-6al3). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6a). Each possible combination is specifically contemplated as if set forth explicitly herein, Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-6a2) and (2) compounds of any of structural formulae (A-6al), (A-6a3), (A-6a4), (A-6a5), (A-6a6), (A-6a7), (A-6a8), (A-6a9), (A- 6al0), (A-6al 1), (A-6al2), and (A-6al3). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6a). Each possible combination is specifically contemplated as if set forth expli citly herein. Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-6a2) and (2) compounds of up to 12 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , or 12) of structural formulae (A-6al), (A-6a3), (A-6a4), (A~6a5), (A- 6a6), (A-6a7), (A-6a8), (A-6a9), (A-6al0), (A-6al 1), (A-6al2), and (A-6al3). in other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6a). Each possible combination is specifically contemplated as if set forth explicitly herein. [230] Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-6a3) and (2) compounds of any of structural formulae (A-6al), (A-6a2), (A-6a4), (A-6a5), (A-6a6), (A-6a7), (A-6a8), (A-6a9), (A- 6al0), (A-6al 1), (A-6al2), and (A-6al3). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A~6a). Each possible combination is specifically contemplated as if set forth explicitly herein,
[231] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-6a3) and (2) compounds of up to 12 (e.g. , 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 or 12) of structural formulae (A-6al), (A-6a2), (A-6a4), (A-6a5), (A- 6a6), (A-6a7), (A-6a8), (A-6a9), (A-6al0), (A-6al 1), (A-6al2), and (A-6al 3). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A~6a). Each possible combination is specifically contempl ated as if set fort explicitly herein.
[232] Some embodiments specifically include and some embodiments only include (1 )
compounds of structural formula (A-6a4) and (2) compounds of any of structural formulae (A-6al), (A-6a2), (A-6a3), (A-6a5), (A-6a6), (A-6a7), (A-6a8), (A-6a9), (A- 6al0), (A-6al 1), (A-6al2), and (A-6al3). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[233] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-6a4) and (2) compounds of up to 12 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , or 12) of structural formulae (A-6al ), (A-6a2), (A-6a3), (A-6a5), (A- 6a6), (A-6a7), (A-6a8), (A-6a9), (A-6al0), (A-6al l), (A-6al2), and (A-6al3). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-6a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[234] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-6a5) and (2) compounds of any of structural formulae (A-6al), (A-6a2), (A-6a3), (A-6a4), (A-6a6), (A-6a7). (A-6a8), (A-6a9), (A- 6al0), (A-6al 1), (A-6al2), and (A-6al3). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[235] Some embodiments specifically include and some embodiments only include (1 )
compounds of structural formula (A-6a5) and (2) compounds of up to 12 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 or 12) of structural formulae (A-6al), (A~6a2), (A~6a3), (A~6a4), (A- 6a6), (A-6a7), (A-6a8), (A-6a9), (A-6al0), (A-6al l), (A-6al2), and (A-6al3). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6a). Each possible combination is specifically contemplated as if set forth explicitly herein,
[236] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-6a6) and (2) compounds of any of structural formulae (A-6al), (A-6a2), (A-6a3), (A-6a4), (A-6a5), (.\ -6a7). (A-6a8), (A-6a9), (A- 6al 0), (A-6al 1 ), (A-6al 2), and (A-6al 3). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[237] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-6a6) and (2) compounds of up to 12 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , or 12) of structural formulae (A-6al), (A~6a2), (A-6a3), (A-6a4), (A- 6a5), (A-6a7), (A-6a8), (A-6a9), (A-6al0), (A-6al 1 ), (A-6al 2), and (A-6al3). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6a). Each possible combination is specifical ly contemplated as if set forth explicitly herein.
[238] Some embodiments specifically include and some embodiments only mclude (1)
compounds of structural formula (A-6a7) and (2) compounds of any of structural formulae (A-6al), (A-6a2), (A-6a3), (A-6a4), (A-6a5), (A-6a6), (A-6a8), (A-6a9), (A- 6al0), (A-6al 1), (A-6al2), and (A~6al3). in other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6a). Each possible combination is specifically contemplated as if set forth explicitly herein. [239] Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-6a7) and (2) compounds of up to 12 (e.g. , 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , or 12) of stractural formulae (A-6al), (A-6a2), (A-6a3), (A-6a4), (A- 6a5), (A-6a6), (A-6a8), (A-6a9), (A-6al0), (A-6al 1), (A-6al2), and (A-6al 3). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[240] Some embodiments specifically include and some embodiments only include (1)
compounds of stractural formula (A-6a8) and (2) compounds of any of stractural formulae (A-6al), (A-6a2), (A-6a3), (A-6a4), (A-6a5), (A-6a6), (A-6a7), (A-6a9), (A- 6al0), (A-6al 1), (A-6al2), and (A-6al3). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6a). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[241 ] Some embodiments specifically include and some embodiments only include (1 )
compounds of stractural formula (A-6a8) and (2) compounds of up to 12 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , or 12) of structural formulae (A-6al), (A-6a2), (A-6a3), (A-6a4), (A- 6a5), (A-6a6), (A-6a7), (A-6a9), (A-6al0), (A-6al l), (A-6al2), and (A-6al 3). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6a). Each possible combination is specifically contemplated as if set forth explicitly herein,
[242] Some embodiments specifically include and some embodiments only include (I)
compounds of structural formula (A-6a9) and (2) compounds of any of structural formulae (A-6al), (A-6a2), (A-6a3), (A-6a4), (A-6a5), (A-6a6), (A-6a7), (A-6a8), (A- 6al 0), (A-6al 1 ), (A-6al 2), and (A-6al 3). In other embodiments, such compounds are specifically excluded from stractural formulae (A) and/or (A-6a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[243] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-6a9) and (2) compounds of up to 12 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , or 12) of structural formulae (A-6al), (A-6a2), (A-6a3), (A-6a4), (A- 6a5), (A-6a6), (A-6a7), (A-6a8), (A-6al0), (A-6al 1), (A-6al2), and (A-6al 3). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6a). Each possible combination is specifically contemplated as if set forth explicitly herein,
[244] Some embodiments specifically include and some embodiments only include (I)
compounds of stractural formula (A-6a! 0) and (2) compounds of any of stractural formulae (A-6al), (A-6a2), (A-6a3), (A-6a4), (A-6a5), (.\ -6a6). (A-6a7), (A-6a8), (A- 6a9), (A-6a! 1 ), (A-6al 2), and (A-6al 3). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[245] Some embodiments specifically include and some embodiments only include (1)
compounds of stractural formula (A-6a! 0) and (2) compounds of up to 12 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , or 12) of structural formulae (A-6al), (A-6a2), (A-6a3), (A-6a4), (A- 6a5), (A-6a6), (A-6a7), (A-6a8), (A-6a9), (A-6al l), (A-6al2), and (A-6al3). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[246] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-6al l) and (2) compounds of any of structural formulae (A-6al), (A-6a2), (A-6a3), (A-6a4), (A-6a5), (A-6a6), (A-6a7), (A-6a8), (A- 6a9), (A-6aI0), (A-6al2), and (A-6al3). In other embodiments, such compounds are specifical ly excluded from stractural formulae (A) and/or (A-6a). Each possible combination is specifically contemplated as if set forth explicitly herein,
[247] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-6al l) and (2) compounds of up to 12 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , or 12) of stractural formulae (A-6al), (A-6a2), (A-6a3), (A-6a4), (A- 6a5), (A-6a6), (A-6a7), (A-6a8), (A-6a9), (A-6al 0), (A-6al 2), and (A-6al 3). In other embodiments, such compounds are specifically excluded from stractural formulae (A) and/or (A-6a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[248] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-6al2) and (2) compounds of any of structural formulae i .\-6a l ). (A-6a2), (A-6a3), (A-6a4), (A-6a5), (A-6a6), (A-6a7), (A-6a8), (A- 6a9), (A-6al0), (A-6al 1 ), and (A-6al 3), In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6a). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[249] Some embodiments specifically include and some embodiments only include (1)
compounds of stmctural formula (A-6al2) and (2) compounds of up to 12 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , or 12) of structural formulae (A-6al ), (A-6a2), (A-6a3), (A-6a4), (A- 6a5), (A-6a6), (A-6a7), (A-6a8), (A-6a9), (A-6a10), (A-6al 1), and (A-6al 3). In other embodiments, such compounds are specifically excluded from stmctural formulae (A) and/or (A-6a). Each possible combination is specifically contemplated as if set forth explicitly herein,
[250] Some embodiments specifically include and some embodiments only include (1)
compounds of stmctural formula (A-6a! 3) and (2) compounds of any of stmctural formulae (A-6al), (A-6a2), (A-6a3), (A-6a4), (A-6a5), (A-6a6), (A-6a7), (A-6a8), (A- 6a9), (A-6al 0), (A-6al 1), and (A-6al 2). In other embodiments, such compounds are specifically excluded from stmctural formulae (A) and/or (A-6a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[251] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-6al 3) and (2) compounds of up to 12 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , or 12) of stmctural formulae (A-6al), (A-6a2), (A-6a3), (A-6a4), (A- 6a5), (A-6a6), (A-6a7), (A-6a8), (A-6a9), (A-6al0), (A-6al l), and (A-6al2). m other embodiments, such compounds are specifically excluded from stmctural formulae (A) and/or (A-6a). Each possible combination is specifically contemplated as if set forth explicitly herein. [252] Some embodiments specifically include and some embodiments only include compounds which have structural formula (A-6b):
Figure imgf000079_0001
(A-6b)
wherein:
R3, R4, and R6 are as defined in structural formula (A). In other embodiments, such compounds are specifically excluded from structural formula (A).
[253] Structural formula (A-6bl). Some embodiments include only those compounds of structural formula (A~6b) in which R3 is hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b).
[254] Structural formula (A-6fo2)„ Some embodiments include only those compounds of structural formula (A-6b) in which R4 is hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b).
[255] Structural formula (A-6b3). Some embodiments include only those compounds of structural formula (A-6b) in which R3 and R4 are hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b).
[256] Structural formula (A-6b4). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A -6b ; in which R6 is hydrogen; halogen;— CN; optionally substituted alkyl; or optionally substituted alkoxyl. Optional substituents for the alkyl and for the alkoxyl are (1) a C1-C6 hydrocarbon chain containing a nitrogen or oxygen atom and optionally substituted with a C1-C3 perfluoroalkyl, and (2) a cycloalkyl which may contain 1 or 2 heteroatoms selected from N, O, and S, and which is optionally substituted with a C1-C3 perfluoroalkyl. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b).
[257] Structural formula (A-6b5). Some embodiments specifically include and some
embodiments only include compoundsof structural formula (A-6b) in which R6 is C1 -C6 alkyl, C1-C6 perfluoroalkyl, C1-C6 alkoxyl, C1-C6 hydroxylalkyl, C1-C6 alkoxylaikyi, or C1-C6 perfluoroalkoxyl. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b).
[258] Structural formula (A-6b6). Some embodiments include only those compounds of structural formula (A~6b) in which a. R3 is hydrogen and b. R.6 is hydrogen; halogen;— CN; optionally substituted alkyl; or optionally
substituted alkoxyl. Optional substituents for the alkyl and for the alkoxyl are (1) a C1-C6 hydrocarbon chain containing a nitrogen or oxygen atom and optionally substituted with a C1-C3 perfluoroalkyl, and (2) a cycioalkyl which may contain 1 or 2 heteroatoms selected from N, O, and S, and which is optionally substituted with a C1 -C3 perfluoroalkyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b).
[259] Structural formula (A-6fo7)„ Some embodiments include only those compounds of structural formula (A -6b) in which a. 4 is hydrogen and b. R6 is hydrogen; halogen;— CN; optionally substituted alkyl; or optionally
substituted alkoxyl. Optional substituents for the alkyl and for the al koxyl are (1) a C1-C6 hydrocarbon chain containing a nitrogen or oxygen atom and optionally substituted with a C1-C3 perfluoroalkyl, and (2) a cycioalkyl which may contain
1 or 2 heteroatoms selected from N, O, and S, and which is optionally substituted with a C1-C3 perfluoroalkyl. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b).
Structural formula (A-6b8). Some embodiments mclude only those compounds of structural formula (A-6b) in which a. R3 and R4 are hydrogen and b. 6 is hydrogen; halogen; CN; optionally substituted alkyl; or optionally
substituted aikoxyl. Optional substituents for the alkyl and for the alkoxyl are (1) a C.1 -C6 hydrocarbon chain containing a nitrogen or oxygen atom and optionally substituted with a C 1-C3 perfluoroalkyl, and (2) a cycloalkyl which may contain 1 or 2 heteroatoms selected from N, O, and S, and which is optionally substituted with a C1-C3 perfluoroalkyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b).
Structural formula (A-6b9). Some embodiments include only those compounds of structural formula (A-6b) in which a. R3 is hydrogen and b. R6 is C1-C6 alkyl, C1-C6 perfluoroalkyl, C1-C6 alkoxyl, C1-C6 hydroxylalkyl, C1-C6 alkoxylaikyi, or C1 -C6 perfluoroalkoxyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b).
Structural formula (A-6bl0). Some embodiments include only those compounds of structural formula (A-6b) in which a. R4 is hydrogen and b. R6 is CI -C6 alkyl, CI -C6 perfluoroalkyl, CI -C6 alkoxyl, CI ~C6 hydroxylalkyl, C1-C6 alkoxylaikyi, or C1-C6 perfluoroalkoxyl. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b).
[263] Structural formula (A-6bl 1.). Some embodiments include only those compounds of structural formula (A-6b) in which a. R3 and R4 are hydrogen and b. R6 is CI ~C6 a!ky!, CI -C6 perfluoroalkyl, CI -C6 alkoxyl, CI ~C6 hydroxy] alkyl, C1-C6 alkoxyialkyl, or C1-C6 perfluoroalkoxyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b),
[264] Structural formula (A-6bl2). Some embodiments specifically include and some
embodiments only include compoundsof structural formula (A-6b) in which R6 is a side chain selected from the group consisting of alkyl, perfluoroalkyl, alkoxvl, hydroxyialkyl, alkoxyialkyl, and perfluoroalkoxyl, each optionally substituted with 1-3 substituents selected from halogen,— CN, alkyl, perfluoroalkyl, alkoxy, hydroxyialkyl, alkoxyialkyl, and perfluoroalkoxyl. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b).
[265] Structural formula (A-6bl3). Some embodiments specifically include and some
embodiments only include compoundsof structural formula (A-6b) in which R6 is alkenyl, alkyne, phenyl, or a 5- or 6-membered heteroaryl, each optionally substituted ith 1 2, or 3 substituents independently selected from the group consisting of
Figure imgf000082_0001
R9 and RIO are as defined in connection with structural formula (A). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b). Some embodiments specifically include and some embodiments only include (1 ) compounds of structural formula (A-6bl) and (2) compounds of any of structural formulae (A~6b2), (A-6b3), (A-6b4), (A-6b5), (A-6b6), (A-6b7), (A-6b8), (A-6b9), (A- 6b 10), (A-6bl 1), (A-6M2), and (A-6M3). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b). Each possible combination is specifically contemplated as if set forth explicitly herein. Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-6M) and (2) compounds of up to 12 (e.g. , 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , or 12) of structural formulae (A-6b2), (A-6b3), (A-6b4), (A-6b5), (A 6b6), (A-6b7), (A-6b8), (A-6b9), (A-6bl0), (A-6bl l), (A-6M2), and (A-6bl3). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-6b). Each possible combination is specifically contemplated as if set forth explicitly herein, Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-6b2) and (2) compounds of any of structural formulae (A-6M), (A-6b3), (A-6b4), (A-6b5), (A-6b6), (A-6b7), (A-6b8), (A-6b9), (A-
6b 10 (A-6bl 1 ), (A-6b l2), and (A-6b l3). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b). Each possible combination is specifically contemplated as if set forth expli citly herein. Some embodiments specifical ly include and some embodiments only include (1) compounds of structural formula (A-6b2) and (2) compounds of up to 12 (e.g. , 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , or 12) of structural formulae (A-6bl), (A-6b3), (A-6b4), (A-6b5), (A 6b6), (A-6b7), (A-6b8), (A-6b9), (Λ ·6ο ! 0 ). (A-6bl 1 ), (A-6b l2), and (A-6b l3). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b). Each possible combination is specifically contemplated as if set forth explicitly herein. [270] Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-6b3) and (2) compounds of any of structural formulae (A-6M), (A-6b2), (A-6b4), (A-6b5), (A-6b6), (Λ·6ο? (A-6b8), (A-6b9), (A- 6b 10), (A-6bl l), (A-6M2), and (A-6bl 3). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A~6b). Each possible combination is specifically contemplated as if set forth explicitly herein,
[271] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-6b3) and (2) compounds of up to 12 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 or 12) of structural formulae (A-6M), (A-6b2), (A-6b4), (A-6b5), (A- 6b6), (A-6b7), (A-6b8), (A-6b9), (A-6bl 0), (A-6bl l), (A-6M 2), and (A-6bl 3). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[272] Some embodiments specifically include and some embodiments only include (1 )
compounds of structural formula (A-6b4) and (2) compounds of any of structural formulae (A-6M), (A-6b2), (A-6b3), (A-6b5), (A-6b6), (A-6b7), (A-6b8), (A-6b9), (A- 6b 10), (Α-6Μ Γ), (A-6M2), and (A-6bl3). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[273] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-6b4) and (2) compounds of up to 12 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , or 12) of structural formulae (A-6bl), (A-6b2), (A-6b3), (A-6b5), (A- 6b6), (A-6b7), (A-6b8), (A-6b9), (A-6bl0), (A-6bl l), (A-6M2), and (A-6bl3). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-6b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[274] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-6b5) and (2) compounds of any of structural formulae (A-6bl), (A-6b2), (A-6b3), (A-6b4), (A-6b6), (A-6b7), (A-6b8), (A-6b9), (A- 6b 10), (Α-6Μ Γ), (A-6bl2), and (A-6bl3). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[275] Some embodiments specifically include and some embodiments only include (1 )
compounds of structural formula (A-6b5) and (2) compounds of up to 12 (e.g. , 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 or 12) of structural formulae (A-6bl), (A-6b2), (A-6b3), (A-6b4), (A- 6b6), (A-6b7), (A-6b8), (A-6b9), (A-6bl0), (A-6bl 1), (A-6M2), and (A-6M3). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b). Each possible combination is specifically contemplated as if set forth explicitly herein,
[276] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-6b6) and (2) compounds of any of structural formulae (A-6M), (A-6b2), (A-6b3), (A-6b4), (A-6b5), (A-6b7), (A-6b8), (A-6b9), (A- 6b 10), (A~6b l 1 ), (A-6M2), and (A-6bl3). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[277] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-6b6) and (2) compounds of up to 12 (e.g. , 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , or 12) of structural formulae (A-6bl), (A-6b2), (A-6b3), (A-6b4), (A- 6b5), (A-6b7), (A-6b8), (A-6b9), (A-6M0), (A-6bl 1 ), (A-6b l2), and (A-6M3). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[278] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-6b7) and (2) compounds of any of structural formulae (A-6M), (A-6b2), (A-6b3), (A-6b4), (A-6b5), (Λ ·6ο6 (A-6b8), (A-6b9), (A- 6b .10), (A-6M 1), (A~6bl 2), and (A-6M 3). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b). Each possible combmation is specifically contemplated as if set forth explicitly herein. [279] Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-6b7) and (2) compounds of up to 12 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , or 12) of structural formulae (A-6bl), (A-6b2), (A-6b3), (A-6b4), (A- 6b5), (A-6b6), (A-6b8), (A-6b9), (A-6bl0), (A-6M 1), (A-6M2), and (A-6bl 3). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[280] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-6b8) and (2) compounds of any of structural formulae (A-6M), (A-6b2), (A-6b3), (A-6b4), (A-6b5), (A-6b6), (A-6b7), (A-6b9), (A- 6b 10), (Α-6Μ Γ), (A-6bl2), and (A-6M3). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b), Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[281 ] Some embodiments specifically include and some embodiments only include (1 )
compounds of structural formula (A-6b8) and (2) compounds of up to 12 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , or 12) of structural formulae (A-6bl), (A-6b2), (A-6b3), (A-6b4), (A- 6b5), (A-6b6), (A-6b7), (A-6b9), (A-6bl 0), (A-6M 1), (A-6bl2), and (A-6bl3). In other embodiments, such compounds are specifically excluded from structural formulae (A.) and/or (A-6b). Each possible combination is specifically contemplated as if set forth explicitly herein,
[282] Some embodiments specifically include and some embodiments only include (I)
compounds of structural formula (A-6b9) and (2) compounds of any of structural formulae (A-6M), (A-6b2), (A-6b3), (A-6b4), (A-6b5), (A-6b6), (A-6b7), (A-6b8), (A- 6b 10), (A-6bl 1 ), (A-6M2), and (A-6bl3). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[283] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-6b9) and (2) compounds of up to 12 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , or 12) of structural formulae (A-6M), (A-6b2), (A-6b3), (A-6b4), (A- 6b5), (A-6b6), (A-6b7), (A-6b8), (A-6bl 0), (A-6M 1), (A-6bl2), and (A-6M3). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b). Each possible combination is specifically contemplated as if set forth explicitly herein,
[284] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-6MG) and ( 2) compounds of any of structural formulae (A-6bl), (A-6b2), (A-6b3), (A-6b4), (A-6b5), (A-6b6), (A-6b7), (A-6b8), (A- 6b9), (A~6bl l), (A -6b 12), and (A -6b 13). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[285] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-6b 1 0) and ( 2) com pounds of up to 12 (e.g. , 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , or 12) of structural formulae (A-6M), (A-6b2), (A-6b3), (A-6b4), (A- 6b5), (A~6b6), (A-6b7), (A-6b8), (A-6b9), (A-6bl 1 ), (A-6bl 2), and (A-6bl 3). in other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[286] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-6bl 1) and (2) compounds of any of structural formulae (A-6M), (A-6b2), (A-6b3), (A-6b4), (A-6b5), (A-6b6), (A-6b7), (A-6b8), (A- 6b9), (A-6M0), (A-6bl2), and (A-6bl3). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A~6b). Each possible combination is specifically contemplated as if set forth explicitly herein,
[287] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-6M 1) and (2) compounds of up to 12 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , or 12) of structural formulae (A-6bl), (A-6b2), (A-6b3), (A-6b4), (A- 6b5), (A-6b6), (A-6b7), (A-6b8), (A-6b9), (A-6bl0), (A-6bl2), and (A-6bl3). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[288] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-6 2) and (2) compounds of any of structural formulae (A-6M), (A-6b2), (A-6b3), (A-6b4), (A-6b5), (A-6b6), (A-6b7), (A-6b8), (A- 6b9), (A-6bl0), (A-6bH), and (A-6M3). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b), Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[289] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-6 2) and (2) compounds of up to 12 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , or 12) of structural formulae (A-6bl), (A-6b2), (A-6b3), (A-6b4), (A- 6b5), (A-6b6), (A-6b7), (A-6b8), (A-6b9), (A-6bl0), (A-6bl l), and (A-6bl3). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b). Each possible combination is specifically contemplated as if set forth explicitly herein,
[290] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-6M3) and (2) compounds of any of structural formulae (A-6M), (A-6b2), (A-6b3), (A-6b4), (A-6b5), (A-6b6), (A-6b7), (A-6b8), (A- 6b9), (A-6M0), (A-6bl 1), and (A-6bl 2). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[291] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-6b 1 3) and ( 2) com pounds of up to 12 (e.g. , 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , or 12) of structural formulae (A-6M), (A-6b2), (A-6b3), (A-6b4), (A- 6b5), (A-6b6), (A-6b7), (A-6b8), (A-6b9), (A-6M0), (A-6bl 1), and (A-6bl 2). in other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-6b). Each possible combination is specifically contemplated as if set forth explicitly herein. [292] Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-6M 3) and (2) compounds of any of structural formulae (A-6M), (A-6b2), (A-6b3), (A-6b4), (A-6b5), (Λ ·6ο6 (A-6b7), (A-6b8), (A- 6b9), (A-6bl0), (A-6bl 1), or (A-6bl2). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A~6b). Each possible combination is specifically contemplated as if set forth explicitly herein,
[293] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-6M 3) and (2) compounds of up to 12 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) of structural formulae (A-6bl), (A-6b2), (A-6b3), (A-6b4), (A-6b5), (A-6b6), (A- 6b7), (A-6b8), (A-6b9), (A-6bl0), (A-6bl 1), or (A-6b l2). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-6b). Each possible combination is specifically contemplated as if set forth explicitly herein,
[294] Some embodiments specifically include and some embodiments only include compounds which have structural formula (A-7a), which can exist as a mixture of two tautomers:
Figure imgf000089_0001
(A-7a)
wherein R3, R4, and R6 are as defined in structural formula (A). In other embodiments, such compounds are specifical ly excluded from structural formula (A).
[295] Structural formula (A-7al). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-7a) in which R3 is hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7a).
[296] Structural formula (A-7a2). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-7a) in which R4 is hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7a).
[297] Structural formula (A-7a3), Some embodiments specifically include and some
embodiments only include compounds of structural formuia (A-7a) in which R3 and R4 are hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7a).
[298] Structural formula (A-7a4). Some embodiments include only those compounds of formula (A-7a) in which R3 and R4 are hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7a).
[299] Structural formula (A-7a5), Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-7a) in which R6 is hydrogen; halogen;— CN; optionally substituted alkyl; or optionally substituted alkoxyl. Optional substituents for the alkyl and for the aikoxyl are (1) a C1-C6 hydrocarbon chain containing a nitrogen or oxygen atom and optionally substituted with a C1-C3 perfluoroalkyl, and (2) a cycloalkyl which may contain 1 or 2 heteroatoms selected from N, O, and S, and which is optionally substituted with a C1-C3 perfluoroalkyl. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7a).
[300] Structural formula (A-7a6). Some embodiments specifically include and some
embodiments only include compoundsof structural formula (A-7a) in which R6 is a side chain selected from the group consisting of alkyl, perfluoroalkyl, al koxyl, hydroxy 1 alkyl, alkoxylalkyl, and perfluoroaikoxyl, each optionally substituted with 1-3 substituents selected from halogen, CN, alkyl, perfluoroalkyl, alkoxy, hydroxylalkyl, alkoxylalkyl, and perfluoroaikoxyl. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7a).
[301] Structural formula (A-7a7), Some embodiments specifically include and some
embodiments only include compoundsof structural formula (A-7a) in which R6 is aikenyi, aikyne, phenyl, or a 5~ or 6-membered heteroaryl, each optionally substituted with 1 2, or 3 substituents independently selected from the group consisting of
, wherein n is 0, 1 , or 2;
Figure imgf000091_0001
9 and 10 are as defined in connection with structural formula (A).
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7a). ] Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-7al) and (2) compounds of any of structural formulae (A-7a2), (A-7a3), (A-7a4), (A-7a5), (A-7a6), and (A-7a7). In other
embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7a). Each possible combination is specifically contemplated as if set forth explicitly herein. ] Some embodiments specifically include and some embodiments only include (1 ) compounds of structural formula (A-7al) and (2) compounds of up to 6 (e.g., 1 , 2, 3, 4, 5 or 6) of structural formulae (A-7a2), (A-7a3), (A-7a4), (A-7a5), (A-7a6), and (A-7a7). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A -7a), Each possible combination is specifically contemplated as if set forth explicitly herein. ] Some embodiments specifically include and some embodiments only include (1 ) compounds of structural formula (A-7a2) and (2) compounds of any of structural formulae (A-7al), (A-7a3), ( A~7a4), (A~7a5), (A~7a6), and (A-7a7). In other
embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A~7a). Each possible combination is specifically contempl ated as if set forth explicitly herein. [305] Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-7a2) and (2) compounds of up to 6 (e.g., 1 , 2, 3, 4, 5, or 6) of structural formulae (A-7al), (A-7a3), (A-7a4), (A-7a5), (A-7a6), and (A-7a7). in other embodiments, such compounds are specificaily excluded from structural formulae (A) and/or (A-7a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[3Θ6] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7a3) and (2) compounds of any of structural formulae (A-7al), (A-7a2), (A-7a4), (A-7a5), (A-7a6), and (A-7a7). In other
embodiments, such compounds are specificaily excluded from structural formulae (A) and/or (A-7a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[307] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7a3) and (2) compounds of up to 6 (e.g., 1 , 2, 3, 4, 5, or 6) of structural formulae (A-7al), (A-7a2), (A-7a4), (A-7a5), (A-7a6), and (A-7a7). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[308] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7a4) and (2) compounds of any of structural formulae (A-7al), (A-7a2), (A-7a3), (A-7a5), (A-7a6), and (A-7a7). In other
embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[309] Some embodiments specificaily include and some embodiments only include (1)
compounds of structural formula (A-7a4) and (2) compounds of up to 6 (e.g., 1 , 2, 3, 4, 5, or 6) of structural formulae (A-7al), (A-7a2), (A-7a3), (A-7a5), (A-7a6), and (A-7a7). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[310] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7a5) and (2) compounds of any of structural formulae (A-7al), (A-7a2), (A-7a3), (A-7a4), (A-7a6), and (A-7a7). In other
embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[311] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7a5) and (2) compounds of up to 6 (e.g., 1 , 2, 3, 4, 5, or 6) of structural formulae (A-7al), (A-7a2), (A-7a3), (A~7a4), (A-7a6), and (A-7a7). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[312] Some embodiments specifically include and some embodiments only include (1 )
compounds of structural formula (A-7a6) and (2) compounds of any of structural formulae (A-7al), (A-7a2), (A-7a3), (A-7a4), (A-7a5), and (A-7a7). m other
embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A~7a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[313] Some embodiments specifically include and some embodiments only include (1 )
compounds of structural formula (A-7a6) and (2) compounds of up to 6 (e.g., I , 2, 3, 4, 5, or 6) of structural formulae (A-7a l ), (A-7a2), (A-7a3), (A-7a4), (A-7a5), and (A-7a7). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A -7a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[314] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7a7) and (2) compounds of any of structurai formulae (A-7al), (A-7a2), (A-7a3), (A-7a4), (A-7a5), and (A-7a6). in other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7a). Each possible combination is specifically contemplated as if set forth explicitly herein.
Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-7a7) and (2) compounds of up to 6 (e.g., 1 , 2, 3, 4, 5, or 6) of structural formulae (A-7aI), (A-7a2), (A-7a3), (A-7a4), (A-7a5), and (A-7a6). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7a). Each possible combination is specifically contemplated as if set forth explicitly herein.
Some embodiments specifically include and some embodiments only include compounds which have structural formula (A-7b):
Figure imgf000094_0001
wherein R3, R4, and R6 are as defined in structural formula (A) and R7 is hydrogen or C1 -C3 alkyl. In other embodiments, such compounds are specifically excluded from structural formula (A).
[317] Structural formula (A-7bl). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-7b) in which R3 is hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7b).
[318] Structural formula (A-7fo2). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-7b) in which R4 is hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 7b).
Structural formula (A-7b3). Some embodiments specifically include and some embodiments only include compounds of structural formuia (A-7b) in which R3 and R4 are hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7b).
Structural formula (A-7b4). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-7b) in which R7 is C 1-C3 alkyl . In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7b).
Structural formula (A-7b5). Some embodiments specifically include and some embodiments only include compounds of structural formula (A- 7b) in which R7 is methyl. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 7b).
Structural formula (A-7b6). Some embodiments specifically include and some embodiments only include compounds of structural formula (A~7b) in which R is hydrogen; halogen;— CN; optionally substituted alkyl; or optionally substituted alkoxyl. Optional substituents for the alkyl and for the alkoxyl are (1) a C1-C6 hydrocarbon chain containing a nitrogen or oxygen atom and optionally substituted with a C1-C3 perfluoroalkyl, and (2) a cycloalkyl which may contain 1 or 2 heteroatoms selected from N, O, and S, and which is optionally substituted with a C1-C3 perfluoroalkyl. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7b).
Structural formula (A-7b7). Some embodiments specifically include and some embodiments only include compoundsof structural formula (A- 7b) in which R6 is a side chain selected from the group consisting of alkyl, perfluoroalkyl, alkoxyl, hydroxy 1 alkyl, alkoxylalkyl, and perfluoroalkoxyl, each optionally substituted with 1-3 substituents selected from halogen,— CN, alkyl, perfluoroalkyl, alkoxy, hydroxylalkyl, alkoxylalkyl, and perfluoroalkoxyl. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7b).
Structural formula (A-7b8). Some embodiments specifically include and some embodiments only include compoundsof structural fonnula (A-7b) in which R6 is alkenyl, alkyne, phenyl, or a 5- or 6-membered heteroaryl, each optionally substituted with 1 2, or 3 substituents independently selected from the group consisting of
wherein n is 0, 1 , or
Figure imgf000096_0001
R9 and RIO are as defined in connection with structural formula (A). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7b). ] Structural formula (A-7b9). Some embodiments specifically include and some embodiments only include compoundsof structural formula (A- 7b) in which 6 is
Figure imgf000096_0002
and R9 and RIO are as defined in connection with structural formula (A). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 7b). ] Structural formula (A-7bl0). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-7b) in which a. R3 is hydrogen; and b. 6 is
Figure imgf000097_0001
and R9 and RIO defined in connection with structural formula (A).
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7b).
Structural formula (A-7bll). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-7b) in which a. R3 is hydrogen; and
b. R6 is
Figure imgf000097_0002
O" i U; and R9 and R10 are as defined in connection with stmctural formula (A); and c. R7 is Cl -C3 alkyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 7b), Structural formula (A-7 2). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-7b) in which a. R3 is hydrogen; and
N
b. R.6 is R R o , wherein n is 0, 1. or 2; or . -r O'' 1 ° ; and R9 and R10 are as defined in connection with stmctural formula (A); and c. R7 is methyl. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7b).
Structural formula (A-7M3). Some embodiments specifically include and some embodiments only mclude compounds of structural formula (A -7b) in which a. R4 is hydrogen; and
b. R6 is
Figure imgf000098_0001
, wherein n is 0, 1 , or 2; and R9 and RIO
defined in connection with structural formula (A).
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 7b).
Structural formula (A-7 4). Some embodiments specifically include and some embodiments only include compounds of structural formula (A -7b) in which a. R4 is hydrogen; and
b. 6 is
Figure imgf000098_0002
, wherein n is 0, 1, or 2; or , "1 O and R9 and R10 are as defined in connection with structural formula (A); and c. R7 is Cl-C3 alkyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 7b). Structural formula (A-7bl5). Some embodiments specifically include and some embodiments only mclude compounds of structural formula (A~7b) in which a. R4 is hydrogen; and b. 6 is
Figure imgf000099_0001
wherein n is 0, 1, or 2; or , and R9 and RIO defined in connection with structural formula (A); and c. R7 is methyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 7b),
Structural formula (A-7bl6). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-7b) in which a. R3 and R4 are hydrogen; and
b. R6 is
Figure imgf000099_0002
, wherein n is 0, 1, or 2; or , ""1 O' and R9 and R10 are as defined in connection with stmctural formula (A).
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 7b), Structural formula (A-7 7). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-7b) in which a. R3 and R4 are hydrogen; and
N
b. R6 is R R o , wherein n is 0, 1, or 2; or , -r O'' 1 ° ; and R9 and R10 are as defined in connection with stmctural formula (A); and c. R7 is Cl -C3 alk l. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7b).
Structural formula (A-7M8). Some embodiments specifically include and some embodiments only include compounds of structural formula (A -7b) in which a. R3 and R4 are hydrogen; and
b. R6 is
Figure imgf000100_0001
, wherein n is 0, 1 , or 2; and R9 and R10 are as defined in connection with structural formula (A); and c. R7 is methyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 7b).
Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A -7b I) and (2) compounds of any of structural formulae (A-7b2), (A-7b3), (A-7b4), (A-7b5), (A-7b6), (A-7b7), (A-7b8), (A-7b9), (A- 7b 10), (A-7M 1), (A-7bl2), (A-7bl 3), (A-7bl4), (A-7bl5), (A-7M6), (A-7M7), and (A- 7b 18). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7b).
Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-7bl ) and (2) compounds of up to 17 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, I I, 12, 13, 14, 15, 16, or 17) of structural formulae (A-7b2), (A-7b3), (A- 7b4), (A-7b5), (A-7b6), (A-7b7), (A-7b8), (A-7b9), (A- 7b 10), (A-7bl 1 ), (A-7bl2), (A- 7b 13), (A-7M4), (A-7bl5), (A-7bl6), (A-7M7), and (A-7 l8). in other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7b).
Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-7b2) and (2) compounds of any of structural formulae (A-7M), (A-7b3), (A-7b4), (A-7b5), (A-7b6), (A-7b7), (A-7b8), (A-7b9), (A- 7b 10), (A-7b l l), (A-7M2), (A-7bl3), ( Λ · 7ο ! 4 ). (A-7bl 5), (A-7b l6), (A-7M7), and (A- 7b 18). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[338] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7b2) and (2) compounds of up to 17 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, or 17) of structural formulae (A-7M), (A-7b3), (A- 7b4), (A-7b5), (A-7b6), (A-7b7), (A-7b8), (A-7b9), (A-7bl 0), (A-7M 1), (A-7M 2), (A- 7b 13), (A-7M4), (A-7b l 5), (A-7bl6), (A-7bl 7), and (A-7bl 8). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 7b). Each possible combination is specifically contemplated as if set forth explicitly herein.
1 1 Some embodiments specifical ly include and some embodiments only include (1)
compounds of structural formula (A-7b3) and (2) compounds of any of structural formulae (A-7bl), (A-7b2), (A-7b4), (A-7b5), (A-7b6), (A-7b7), (A-7b8), (A-7b9), (A- 7b 10), (A-7M I), (A-7bl2), (A-7bl3), (A-7bl4), (A-7bl 5), (A-7M6), (A-7bl 7), and (A-
7b 18). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[340] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7b3) and (2) compounds of up to 17 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, I I , 12, 13, 14, 15, 16, or 17) of structural formulae (A-7bl), (A-7b2), (A- 7b4), (A-7b5), (A-7b6), (A~7b7), (A-7b8), (A-7b9), (A- 7b 10), (A-7bl 1 ), (A-7bl2), (A- 7b 13), (A-7M4), (A-7M5), (A-7bl6), (A-7bl7), and (A-7bl 8). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-7b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[341 ] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7b4) and (2) compounds of any of structural formulae (A-7M), (A-7b2), (A-7b3), (A-7b5), (A-7b6), (A-7b7), (A-7b8), (Λ · 7ο9 (A- 7b 10), (A-7bl l), (A-7bl2), (A-7bl3), (A-7bl4), (A-7bl5), (A-7bl6), (A-7M7), and (A-
00 7b 18). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A -7b). Each possible combination is specifical ly contemplated as if set forth explicitly herein.
[342] Some embodiments specifically include and some embodiments only include (1 )
compounds of structural formula (A-7b4) and (2) compounds of up to 17 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, or 17) of structural formulae (A-7M), (A-7b2), (A- 7b3), (A-7b5), (A-7b6), (A-7b7), (A-7b8), (A-7b9), (A-7bl0), (A-7bl l), (A-7bl2), (A- 7b 13), (A-7bl4), (A-7M5), (A-7bl6), (A-7bl 7), and (A-7bl 8). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[343] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7b5) and (2) compounds of any of structural formulae (A-7bl), (A-7b2), (A-7b3), (A-7b4), (A-7b6), (A-7b7), (A-7b8), (A-7b9), (A- 7b 10), (A-7bl I ), (A-7M2), (A-7bl3), (A-7bl 4), (A-7bl5), (A-7bl 6), (A-7bl 7), and (A-
7b 18). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[344] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7b5) and (2) compounds of up to 17 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, or 17) of structural formulae (A-7M), (A-7b2), (A- 7b3), (A-7b4), (A-7b6), (A-7b7), (A-7b8), (A-7b9), (A-7bl0), (A-7bl l), (A-7M2), (A- 7b 13), (A-7bl4), (A-7bl 5), (A-7bl 6), (A-7M7), and (A-7bl 8). in other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 7b). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[345] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7b6) and (2) compounds of any of structural formulae (A-7bl), (A-7b2), (A-7b3), (A-7b4), (A-7b5), (A-7b7), (A-7b8), (A-7b9), (A- 7b 10), (A-7b l l), (A-7bl2), (A-7 3), (A-7M4), (A-7M 5), (A-7b l6), (A-7bl7), and (A-
7b 18). In other embodiments, such compounds are specifically excluded from structural
01 formulae (A) and/or (A-7b). Each possible combination is specificaiiy contemplated as if set forth explicitly herein.
[346] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A~7b6) and (2) compounds of up to 17 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, or 17) of structural formulae (A-7M), (A-7b2), (A- 7b3), (A-7b4), (A-7b5), (A-7b7), (A-7b8), (A-7b9), (A- 7b 10), (A-7bl 1 ), (A-7bl2), (A- 7b 13), (A-7M4), (A-7M5), (A-7bl6), (A-7bl7), and (A-7bl 8). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-7b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[347] Some embodiments specifically include and some embodiments only include (1 )
compounds of structural formula (A-7b7) and (2) compounds of any of structural formulae (A-7bl), (A-7b2), (A-7b3), (A-7b4), (A-7b5), (A-7b6), (A-7b8), (A-7b9), (A- 7b 10), (A-7M 1), (A-7M2), (A-7bl3), (A-7bl4), (A-7bl5), (A-7M6), (A-7M7), and (A- 7b 18). In other embodiments, such compounds are specifically excluded from stnictural formulae (A) and/or (A-7b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[348] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7b7) and (2) compounds of up to 17 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, or 17) of structural formulae (A-7M), (A-7b2), (A- 7b3), (A-7b4), (A-7b5), (A-7b6), (A-7b8), (A-7b9), (A-7bl 0), (A-7M 1), (A-7bl2), (A- 7b 13), (A-7bl4), (A-7M 5), (A-7bl6), (A-7bl7), and (A-7bl 8). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7b). Each possible combination is specifically contemplated as if set forth explicitly herein,
[349] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A~7b8) and (2) compounds of any of structural formulae (A-7M), (A-7b2), (A-7b3), (A-7b4), (A-7b5), (A-7b6), (A-7b7), (A-7b9), (A- 7b 10), (A-7M 1), (A-7bl 2), (A-7bl 3), (A-7bl4), (A-7bl 5), (A-7M6), (A-7bl7), and (A- 7b 18). In other embodiments, such compounds are specifically excluded from structural
02 formulae (A) and/or (A-7b). Each possible combination is specificaiiy contemplated as if set forth explicitly herein.
[350] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A~7b8) and (2) compounds of up to 17 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, or 17) of structural formulae (A-7M), (A-7b2), (A- 7b3), (A-7b4), (A-7b5), (A-7b6), (A-7b7), (A-7b9), (A- 7b 10), (A-7bl 1 ), (A-7bl2), (A- 7b 13), (A-7M4), (A-7M5), (A-7bl6), (A-7bl7), and (A-7bl 8). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-7b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[351 ] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7b9) and (2) compounds of any of structural formulae (A-7bl), (A-7b2), (A-7b3), (A-7b4), (A-7b5), (A-7b6), (A-7b7), (A-7b8), (A- 7b 10), (A-7M 1), (A-7M2), (A-7bl3), (A-7bl4), (A-7bl5), (A-7M6), (A-7M7), and (A-
7b 18). In other embodiments, such compounds are specifically excluded from stnictural formulae (A) and/or (A-7b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[352] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7b9) and (2) compounds of up to 17 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, or 17) of structural formulae ( A-7b i), (A-7b2), (A- 7b3), (A-7b4), (A-7b5), (A-7b6), (A-7b7), (A-7b8), (A-7bl 0), (A-7M 1), (A-7bl2), (A- 7b 13), (A-7bl4), (A-7bl 5), (A-7M6), (A-7bl7), and (A-7bl 8). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7b). Each possible combination is specifically contemplated as if set forth explicitly herein,
[353] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A -7b 10) and (2) compounds of any of structural formulae (A-7M), (A-7b2), (A-7b3), (A-7b4), (A-7b5), (A-7b6), (A-7b7), (A-7b8), (A- 7b9), (A-7bl l), (A-7bl2), (A-7 l 3), (A-7M4), (A-7M 5), (A-7bl 6), (A-7M7), and (A- 7b 18). In other embodiments, such compounds are specifically excluded from structural
03 formulae (A) and/or (A-7b). Each possible combination is specificaiiy contemplated as if set forth explicitly herein.
[354] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A -7b 10) and (2) compounds of up to 17 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, or 17) of structural formulae (A-7M), (A-7b2), (A- 7b3), (A-7b4), (A-7b5), (A-7b6), (A-7b7), (A-7b8), (A-7b9), (A-7bl 1 ), (A-7bl 2), (A- 7b 13), (A-7M4), (A-7M5), (A-7bl6), (A-7bl7), and (A-7bl 8). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-7h). Each possible combination is specifically contemplated as if set forth explicitly herein.
[355] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7M 1) and (2) compounds of any of structural formulae (A-7bl), (A-7b2), (A-7b3), (A-7b4), (A-7b5), (A-7b6), (A-7b7), (A-7b8), (A- 7b9), (A-7bl0), (A-7bl2), (A-7bl3), (A-7bl4), (A-7M5), (A-7bl6), (A-7bl7), and (A-
7b 18). In other embodiments, such compounds are specifically excluded from stnictural formulae (A) and/or (A-7b), Each possible combination is specifically contemplated as if set forth explicitly herein.
[356] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7b l 1) and (2) compounds of up to 17 (e.g., I , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, or 17) of structural formulae (A-7M), (A-7b2), (A- 7b3), (A-7b4), (A-7b5), (A-7b6), (A-7b7), (A-7b8), (A-7b9), (A-7b l0), (A-7M2), (A- 7b 13), (A-7bl4), (A-7bl 5), (A-7bl6), (A-7bl7), and (A-7bl 8). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7b). Each possible combination is specifically contemplated as if set forth explicitly herein,
[357] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7M 2) and (2) compounds of any of structural formulae (A-7M), (A-7b2), (A-7b3), (A-7b4), (A-7b5), (A-7b6), (A-7b7), (A-7b8), (A- 7b9), (A-7bl0), (A-7bl l), (A-7M 3), (A-7M4), (A-7M 5), (A-7 l 6), (A~7bl7), and (A- 7b 18). In other embodiments, such compounds are specifically excluded from structural
04 formulae (A) and/or (A-7b). Each possible combination is specificaiiy contemplated as if set forth explicitly herein.
[358] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7M 2) and (2) compounds of up to 17 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, or 17) of structural formulae (A-7M), (A-7b2), (A- 7b3), (A-7b4), (A-7b5), (A-7b6), (A-7b7), (A-7b8), (A-7b9), (A-7M 0), (A-7bl 1), (A- 7b 13), (A-7M4), (A-7M5), (A-7bl6), (A-7bl7), and (A-7bl 8). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-7b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[359] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7M3) and (2) compounds of any of structural formulae (A-7bl), (A-7b2), (A-7b3), (A-7b4), (A-7b5), (A-7b6), (A-7b7), (A-7b8), (A- 7b9), (A-7bl0), (A-7bl l), (A-7bl2), (A-7bl4), (A-7M5), (A-7M6), (A-7bl7), and (A-
7b 18). In other embodiments, such compounds are specifically excluded from stnictural formulae (A) and/or (A-7b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[360] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7M3) and (2) compounds of up to 17 (e.g., I , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, or 17) of structural formulae (A-7M), (A-7b2), (A- 7b3), (A-7b4), (A-7b5), (A-7b6), (A-7b7), (A-7b8), (A-7b9), (A-7b l0), (Λ · 7b i I ). (A- 7b 12), (A-7bl4), (A-7bl 5), (A-7bl6), (A-7bl7), and (A-7bl 8). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7b). Each possible combination is specifically contemplated as if set forth explicitly herein,
[361] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7M4) and (2) compounds of any of structural formulae (A-7M), (A-7b2), (A-7b3), (A-7b4), (A-7b5), (A-7b6), (A-7b7), (A-7b8), (A- 7b9), (A-7bl0), (A-7bl l), (A-7bl 2), (A-7M3), (A-7M 5), (A-7bl 6), (A-7M7), and (A- 7b 18). In other embodiments, such compounds are specifically excluded from structural
05 formulae (A) and/or (A-7b). Each possible combination is specificaiiy contemplated as if set forth explicitly herein.
[362] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7M4) and (2) compounds of up to 17 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, or 17) of structural formulae (A-7M), (A-7b2), (A- 7b3), (A-7b4), (A-7b5), (A-7b6), (A-7b7), (A-7b8), (A-7b9), (A-7M 0), (A-7bl 1), (A- 7b 12), (A-7M 3), (A-7M5), (A-7bl6), (A-7bl7), and (A-7bl 8). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-7b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[363] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7M5) and (2) compounds of any of structural formulae (A-7bl), (A-7b2), (A-7b3), (A-7b4), (A-7b5), (A-7b6), (A-7b7), (A-7b8), (A- 7b9), (A-7bl0), (A-7bl l), (A-7bl2), (A-7bl 3), (A-7M4), (A-7M6), (A-7bl7), and (A-
7b 18). In other embodiments, such compounds are specifically excluded from stnictural formulae (A) and/or (A-7b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[364] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7M 5) and (2) compounds of up to 17 (e.g., I , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, or 17) of structural formulae (A-7M), (A-7b2), (A- 7b3), (A-7b4), (A-7b5), (A-7b6), (A-7b7), (A-7b8), (A-7b9), (A-7b l0), (Λ · 7b i I ). (A- 7b 12), (A-7bl3), (A-7bl4), (A-7bl6), (A-7bl7), and (A-7bl 8). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7b). Each possible combination is specifically contemplated as if set forth explicitly herein,
[365] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7M6) and (2) compounds of any of structural formulae (A-7M), (A-7b2), (A-7b3), (A-7b4), (A-7b5), (A-7b6), (A-7b7), (A-7b8), (A- 7b9), (A-7bl0), (A-7bl l), (A-7bl 2), (A-7bl3), (A-7M4), (A-7bl 5), (A-7M7), and (A- 7b 18). In other embodiments, such compounds are specifically excluded from structural
06 formulae (A) and/or (A-7b). Each possible combination is specificaiiy contemplated as if set forth explicitly herein.
[366] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7M 6) and (2) compounds of up to 17 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, or 17) of structural formulae (A-7bl), (A-7b2), (A- 7b3), (A-7b4), (A-7b5), (A-7b6), (A-7b7), (A-7b8), (A-7b9), (A-7M 0), (A-7bl 1), (A- 7b 12), (A-7M 3), (A-7M4), (A-7bl 5), (A-7bl7), and (A-7bl 8). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-7b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[367] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7M7) and (2) compounds of any of structural formulae (A-7bl), (A-7b2), (A-7b3), (A-7b4), (A-7b5), (A-7b6), (A-7b7), (A-7b8), (A- 7b9), (A-7bl0), (A-7bl l), (A-7bl2), (A-7bl 3), (A-7M4), (A-7M 5), (A-7bl6), and (A-
7b 18). In other embodiments, such compounds are specifically excluded from stnictural formulae (A) and/or (A-7b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[368] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7M 7) and (2) compounds of up to 17 (e.g., I , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, or 17) of structural formulae (A-7M), (A-7b2), (A- 7b3), (A-7b4), (A-7b5), (A-7b6), (A-7b7), (A-7b8), (A-7b9), (A-7b l0), (A - 7b ; I ). (A- 7b 12), (A-7bl3), (A-7bl4), (A-7bl5), (A-7al6), and (A-7bl 8). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 7b). Each possible combination is specifically contemplated as if set forth explicitly herein,
[369] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7M 8) and (2) compounds of any of structural formulae (A-7M), (A-7b2), (A-7b3), (A-7b4), (A-7b5), (A-7b6), (A-7b7), (A-7b8), (A- 7b9), (A-7bl0), (A-7bl l), (A-7M 2), (A-7bl3), (A-7M4), (A -7b 15), (A-7M6), and (A- 7b 17). In other embodiments, such compounds are specifically excluded from structural
07 formulae (A) and/or (A-7b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[370] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7M 8) and (2) compounds of up to 17 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, or 17) of structural formulae (A-7M), (A-7b2), (A- 7b3), (A-7b4), (A-7b5), (A-7b6), (A-7 7), (A-7b8), (A-7b9), (A-7M 0), (A-7bl 1), (A- 7b 12), (A-7M 3), (A-7M4), (A-7bl 5), (A-7bl6), and (A-7bl7). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-7b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[371 ] Some embodiments specifically include and some embodiments only include compounds which have structural formula (A-7c):
Figure imgf000109_0001
(A-7c) wherein R3, R4, and R6 are as defined in structural formula (A) and R5 is hydrogen or C 1-C3 aikyi. In other embodiments, such compounds are specifically excluded from structural formula (A).
[372] Structural formula (A-7cl). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-7c) in which R3 is hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c).
[373] Structural formula (A-7c2). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-7c) in which R4 is
08 hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c).
[374] Structural formula (A-7c3). Some embodiments specifically include and some
embodiments only include compounds of structural formuia (A-7c) in which R3 and R4 are hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c).
[375] Structural formula (A-7c4). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-7c) in which R5 is C1-C3 alkyl . In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7e).
[376] Structural formula (A-7c5). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-7c) in which R5 is methyl. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c).
[377] Structural formula (A-7c6). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A~7c) in which R6 is hydrogen; halogen;— CN; optionally substituted alkyl; or optionally substituted alkoxyl. Optional substituents for the alkyl and for the alkoxyl are (1) a C1-C6 hydrocarbon chain containing a nitrogen or oxygen atom and optionally substituted with a C1-C3 perfluoroalkyl, and (2) a cycloalkyl which may contain 1 or 2 heteroatoms selected from N, O, and S, and which is optionally substituted with a C1-C3 perfluoroalkyl. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c).
[378] Structural formula (A-7c7). Some embodiments specifically include and some
embodiments only include compoundsof structural formula (A-7c) in which R6 is a side chain selected from the group consisting of alkyl, perfluoroalkyl, alkoxyl, hydroxy 1 alkyl, alkoxyiaikyi, and perfluoroalkoxyl, each optionally substituted with 1-3 substituents selected from halogen,— CN, alkyl, perfluoroalkyl, alkoxy, hydroxylalkyl, alkoxyiaikyi,
09 and perfluoroalkoxyl. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c). Structural formula (A-7c8). Some embodiments specifically include and some embodiments only include compoundsof structural formula (A-7c) in which R6 is alkenyl, alkyne, phenyl, or a 5- or 6-membered heteroaryl, each optionally substituted with 1 2, or 3 substituents independently selected from the group consisting of
wherein n is 0, 1 , or
Figure imgf000111_0001
R9 and RIO are as defined in connection with structural formula (A). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c). Structural formula (A-7c9). Some embodiments specifically include and some embodiments only include compoundsof structural formula (A-7c) in which R6 is
Figure imgf000111_0002
and R9 and RIO are as defined in connection with structural formula (A). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c). Structural formula (A-7cl0). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-7c) in which a. R3 is hydrogen; and
10 b. 6 is
Figure imgf000112_0001
and R9 and RIO defined in connection with structural formula (A).
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c).
Structural formula (A-7cll). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-7c) in which a. R3 is hydrogen; and
b. R6 is
Figure imgf000112_0002
O" i U; and R9 and R10 are as defined in connection with structural formula (A); and c. R5 is Cl -C3 alkyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c). Structural formula (A-7cl2). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-7c) in which a. R3 is hydrogen; and
N
b. R.6 is R R o , wherein n is 0, 1, or 2; or , -r O'' 1 ° ; and R9 and R10 are as defined in connection with structural formula (A); and c. R5 is methyl.
1 1 In other embodiments, such compounds are specifically excluded from stmctural formulae (A) and/or (A-7c).
Structural formula (A-7cl3). Some embodiments specifically mclude and some embodiments only mclude compounds of structural formuia (A-7c) in which a. R4 is hydrogen; and
b. R6 is
Figure imgf000113_0001
, wherein n is 0, 1 , or 2; and R9 and RIO
defined in connection with structural formuia (A).
In other embodiments, such compounds are specifically excluded from stmctural formulae (A) and/or (A-7c).
Structural formula (A-7cl4). Some embodiments specifically include and some embodiments only mclude compounds of structural formuia (A-7c) in which a. R4 is hydrogen; and
b. 6 is
Figure imgf000113_0002
, wherein n is 0, 1, or 2; or , "1 O and R9 and R10 are as defined in connection with structural formula (A); and c. R5 is C1-C3 alkyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c). Structural formula (A-7cl5). Some embodiments specifically mclude and some embodiments only include compounds of structural formula (A-7c) in which a. R.4 is hydrogen; and
12 b. 6 is
Figure imgf000114_0001
and R9 and RI O defined in connection with stractural fomiula (A); and c. R5 is methyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c).
Structural formula (A-7cl6). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-7c) in which a. R3 and R4 are hydrogen; and
b. R6 is
Figure imgf000114_0002
, wherein n is 0, 1 , or 2; or , ""1 O' and R9 and R10 are as defined in connection with stractural formula (A).
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c). Structural formula (A-7cl7). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-7c) in which a. R3 and R4 are hydrogen; and
N
b. R6 is R R o , wherein n is 0, 1 , or 2; or , -r O'' 1 ° ; and R9 and R10 are as defined in connection with stractural formula (A); and c. R5 is Cl -C3 alk l.
13 In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c).
Structural formula (A-7cl8). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-7c) in which a. R3 and R4 are hydrogen; and
b. R6 is
Figure imgf000115_0001
, wherein n is 0, 1 , or 2; and R9 and R10 are as defined in connection with structural formula (A); and c. R5 is methyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c).
Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A~7cl) and (2) compounds of any of structural formulae (A-7c2), (A-7c3), (A-7c4), (A-7c5), (A-7c6), (A-7c7), (A-7c8), (A-7c9), (A- 7cl0), (A-7cl l), (A-7cl2), (A-7cl3), (A-7cl4), (A-7cl5), (A-7cl6), (A-7cl7), and (A-
7c 18). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c).
Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-7cl) and (2) compounds of up to 17 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17) of structural formulae (A-7c2), (A-7c3), (A- 7c4), (A-7c5), (A-7c6), (A-7c7), (A-7c8), (A-7c9), (A-7cl 0), (A-7cl 1), (A-7cl 2), (A- 7cl3), (A-7cl4), (A-7cl5), (A-7cl6), (A-7cl7), and (A-7cl8). In other embodiments, such compounds are speciticaily excluded from structural formulae (A) and/or (A-7c).
Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-7c2) and (2) compounds of any of structural formulae (A-7cl), (A-7c3), (A-7c4), (A-7c5), (A-7c6), (A-7c7), (A-7c8), (A-7c9), (A-
14 7cl0), (A-7cl l), (A-7c l2), (A-7cl3), (A-7cl4), (A-7cl 5), (A-7cl 6), (A-7cl 7), and (A- 7c] 8), In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c). Each possible combination is specifically contemplated as if set forth explicitly herein.
[393] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7c2) and (2) compounds of up to 17 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, or 17) of structural formulae (A-7cI), (A-7c3), (A- 7c4), (A-7c5), (A-7c6), (A-7c7), (A-7c8), (A-7c9), (A-7cl0), (A-7cl l), (A-7cl2), (A- 7cl3), (A-7cl4), (A-7c l 5), (A-7c l6), (A-7c l 7), and (A-7cl 8). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c). Each possible combination is specifically contemplated as if set forth explicitly herein.
[394] Some embodiments specifical ly include and some embodiments only include (1)
compounds of structural formula (A-7c3) and (2) compounds of any of structural formulae (A-7cl ), (A-7c2), (A-7c4), (A-7c5), (A-7c6), (A-7c7), (A-7c8), (A-7c9), (A- 7cl0), (A-7cl l), (A-7cl2), (A-7cl 3), (A-7cl4), (A-7cl 5), (A-7cl6), (A-7el 7), and (A- 7cl 8). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c). Each possible combination is specifically contemplated as if set forth explicitly herein.
[395] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7c3) and (2) compounds of up to 17 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, or 17) of structural formulae (A-7el), (A-7c2), (A- 7c4), (A-7c5), (A-7c6), (A-7c7), (A-7c8), (A-7c9), (A-7cl 0), (A-7cl 1), (A-7cl 2), (A- 7cl3), (A-7cl4), (A-7cl5), (A-7cl6), (A-7cl7), and (A-7cl 8). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-7c). Each possible combination is specifically contemplated as if set forth explicitly herein.
[396] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7c4) and (2) compounds of any of structural formulae (A-7cl), (A-7c2), (A-7c3), (A-7c5), (A-7c6), (A-7c7), (A-7c8), (A-7c9), (A- 7cl0), (A-7cl l), (A~7c l2), (A~7cl3), (A~7cl4), (A~7cI5), (A-7cl6), (A-7cl7), and (A-
15 7cl 8). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c). Each possible combination is specifically contemplated as if set forth explicitly herein.
[397] Some embodiments specifically include and some embodiments only include (1 )
compounds of structural formula (A-7c4) and (2) compounds of up to 17 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, or 17) of structural formulae (A-7ci ), (A-7c2), (A- 7c3), (A-7c5), (A-7c6), (A-7c7), (A-7c8), (A-7c9), (A-7cl0), (A-7cl l), (A-7cl2), (A- 7c 1 3 ), (A-7cl 4), (A-7cl5), (A-7cl6), (A-7cl7), and (A-7cl 8). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c). Each possible combination is specifically contemplated as if set forth explicitly herein.
[398] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7c5) and (2) compounds of any of structural formulae (A-7cl), (A-7c2), (A-7c3), (A-7c4), (A-7c6), (A-7c7), (A-7c8), (A-7c9), (A- 7c 10), (A-7cl 1), (A-7cl2), (A-7cl3), (A-7cl4), (A-7c l5), (A-7c l6), (A-7cl7), and (A- 7cl 8). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A~7c). Each possible combination is specifically contemplated as if set forth explicitly herein.
[399] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7c5) and (2) compounds of up to 17 (e.g. , 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, or 17) of structural formulae (A-7c l), (A-7c2), (A- 7c3), (A-7c4), (A-7c6), (A-7c7), (A-7c8), (A-7c9), (A-7cl0), (A-7cl l), (A-7cl2), (A- 7c 13), (A-7cl4), (A -7c 15), (A-7c l 6), (A-7cl 7), and (A-7cl 8). In other embodiments, such compoimds are specifically excluded from structural formulae (A) and/or (A-7c). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[400] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7c6) and (2) compounds of any of structural formulae (A-7cl), (A-7c2), (A-7c3), (A-7c4), (A-7c5), (A-7c7), (A-7c8), (A-7c9), (A- 7c 10), (A-7cl l), (A-7c l2), (A-7cl3), (A-7cl4), (A-7cl 5), (A-7cl 6), (A-7cl 7), and (A-
7c 18). In other embodiments, such compounds are specifically excluded from structural
16 formulae (A) and/or (A-7c). Each possible combination is specifically contemplated as if set forth explicitly herein.
[401] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7c6) and (2) compounds of up to 17 (e.g. , 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, I I , 12, 13, 14, 15, 16, or 17) of structural formulae (A-7cl), (A-7c2), (A- 7c3), (A-7c4), (A-7c5), (A-7c7), (A-7c8), (A-7c9), (A-7cl 0), (A-7cl 1 ), (A-7cl 2), (A- 7cl3), (A-7cl4), (A-7cl5), (A-7cl6), (A-7cl7), and (A-7cl 8). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-7c). Each possible combination is specifically contemplated as if set forth explicitly herein.
[402] Some embodiments specifically include and some embodiments only include (1 )
compounds of structural formula (A-7c7) and (2) compounds of any of structural formulae (A-7cl), (A-7c2), (A-7c3), (A-7c4), (A-7c5), (A-7c6), (A-7c8), (A-7c9), (A- 7cl0), (A-7cl l), (A-7cl2), (A-7cl3), (A-7cl4), (A-7cl5), (A-7cl6), (A-7cl7), and (A-
7c 1 8). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c). Each possible combination is specifically contemplated as if set forth explicitly herein.
[403] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7c7) and (2) compounds of up to 17 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, or 17) of structural formulae (A-7cl), (A-7c2), (A- 7c3), (A-7c4), (A-7c5), (A-7c6), (A-7c8), (A-7c9), (A-7cl0), (A-7cl l), (A-7cl2), (A- 7cl3), (A-7cl4), (A-7cl 5), (A-7cl6), (A-7cl 7), and (A-7cl 8). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c). Each possible combination is specifically contemplated as if set forth explicitly herein,
[404] Some embodiments specifically include and some embodiments only mclude (1)
compounds of structural formula (A-7c8) and (2) compounds of any of structural formulae (A-7cl), (A-7c2), (A-7c3), (A-7c4), (A-7c5), (A-7c6), (A-7c7), (A-7c9), (A- 7cl0), (A-7cl l), (A-7cl 2), (A-7cl 3), (A-7cl4), (A-7cl 5), (A-7cl 6), (A-7cl 7), and (A-
7c 18). In other embodiments, such compounds are specifically excluded from structural
17 formulae (A) and/or (A-7c). Each possible combination is specifically contemplated as if set forth explicitly herein.
[405] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7c8) and (2) compounds of up to 17 (e.g. , 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, I I , 12, 13, 14, 15, 16, or 17) of structural formulae (A-7cl), (A-7c2), (A- 7c3), (A-7c4), (A-7c5), (A-7c6), (A-7c7), (A-7c9), (A-7cl 0), (A-7cl 1 ), (A-7cl 2), (A- 7cl3), (A-7cl4), (A-7cl5), (A-7cl6), (A-7cl7), and (A-7cl 8). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-7c). Each possible combination is specifically contemplated as if set forth explicitly herein.
[406] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7c9) and (2) compounds of any of structural formulae (A-7cl), (A-7c2), (A-7c3), (A-7c4), (A-7c5), (A-7c6), (A-7c7), (A-7c8), (A- 7cl0), (A-7cl l), (A-7cl2), (A-7cl3), (A-7cl4), (A-7cl5), (A-7cl6), (A-7cl7), and (A-
7c 1 8). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c). Each possible combination is specifically contemplated as if set forth explicitly herein.
[407] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7c9) and (2) compounds of up to 17 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, or 17) of structural formulae (A-7cl), (A-7c2), (A- 7c3), (A-7c4), (A-7c5), (A-7c6), (A-7c7), (A-7c8), (A-7cl0), (A-7cl l), (A-7cl2), (A- 7cl3), (A-7cl4), (A-7cl 5), (A-7cl6), (A-7cl 7), and (A-7cl 8). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c). Each possible combination is specifically contemplated as if set forth explicitly herein,
[408] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7c l0) and (2) compounds of any of structural formulae (A-7cl), (A-7c2), (A-7c3), (A-7c4), (A-7c5), (A-7c6), (A-7c7), (A-7c8), (A- 7c9), (A-7cl l), (A-7cl2), (A-7cl3), (A-7cl4), (A-7cl5), (A-7cl6), (A-7cl 7), and (A-
7c 18). In other embodiments, such compounds are specifically excluded from structural
18 formulae (A) and/or (A-7c). Each possible combination is specifically contemplated as if set forth explicitly herein.
[409] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A -7c 10) and (2) compounds of up to 17 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, or 17) of structural formulae (A-7cl), (A-7c2), (A- 7c3), (A-7c4), (A-7c5), (A-7c6), (A-7c7), (A-7c8), (A-7c9), (A-7cl 1 ), (A-7cl 2), (A- 7cl3), (A-7cl4), (A-7cl 5), (A-7cl6), (A-7cl7), and (A-7cl 8). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-7c). Each possible combination is specifically contemplated as if set forth explicitly herein.
[410] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7cl 1 ) and (2) compounds of any of structural formulae (A-7cl), (A-7c2), (A-7c3), (A-7c4), (A-7c5), (A-7c6), (A-7c7), (A-7c8), (A- 7c9), (A-7cl0), (A-7cl2), (A-7cl3), (A-7cl4), (A-7cl5), (A-7cl6), (A-7cl7), and (A-
7c 1 8). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c). Each possible combination is specifically contemplated as if set forth explicitly herein.
[411] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7cl 1) and (2) compounds of up to 17 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, or 17) of structural formulae (A-7cl), (A-7c2), (A- 7c3), (A-7c4), (A-7c5), (A-7c6), (A-7c7), (A-7c8), (A-7c9), (A-7cl0), (A-7c l2), (A- 7cl3), (A-7cl4), (A-7cl 5), (A-7cl6), (A-7cl 7), and (A-7cl 8). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c). Each possible combination is specifically contemplated as if set forth explicitly herein,
[412] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7c l2) and (2) compounds of any of structural formulae (A-7cl), (A-7c2), (A-7c3), (A-7c4), (A-7c5), (A-7c6), (A-7c7), (A-7c8), (A- 7c9), (A-7cl0), (A-7cl l), (A-7cl3), (A-7cl4), (A-7cl5), (A-7cl6), (A-7cl 7), and (A-
7c 18). In other embodiments, such compounds are specifically excluded from structural
19 formulae (A) and/or (A-7c). Each possible combination is specifically contemplated as if set forth explicitly herein.
[413] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A -7c 12) and (2) compounds of up to 17 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, or 17) of structural formulae (A-7cl), (A-7c2), (A- 7c3), (A-7c4), (A-7c5), (A-7c6), (A-7c7), (A-7c8), (A-7c9), (A-7cl 0), (A-7cl 1 ), (A- 7cl3), (A-7cl4), (A-7cl 5), (A-7cl6), (A-7cl7), and (A-7cl 8). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-7c). Each possible combination is specifically contemplated as if set forth explicitly herein.
[414] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7cl 3) and (2) compounds of any of structural formulae (A-7cl), (A-7c2), (A-7c3), (A-7c4), (A-7c5), (A-7c6), (A-7c7), (A-7c8), (A- 7c9), (A-7cl0), (A-7cl l), (A-7cl2), (A-7cl4), (A-7cl5), (A-7cl6), (A-7cl7), and (A-
7c 1 8). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c). Each possible combination is specifically contemplated as if set forth explicitly herein.
[415] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7c 13) and (2) compounds of up to 17 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, or 17) of structural formulae (A-7cl), (A-7c2), (A- 7c3), (A-7c4), (A-7c5), (A-7c6), (A-7c7), (A-7c8), (A-7c9), (A-7cl0), (A-7c l l), (A- 7c 1 2 ). (A-7cl4), (A-7cl 5), (A-7cl6), (A-7cl 7), and (A-7cl 8). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c). Each possible combination is specifically contemplated as if set forth explicitly herein,
[416] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7c l4) and (2) compounds of any of structural formulae (A-7cl), (A-7c2), (A-7c3), (A-7c4), (A-7c5), (A-7c6), (A-7c7), (A-7c8), (A- 7c9), (A-7cl0), (A-7cl l), (A-7cl2), (A-7cl3), (A-7cl5), (A-7cl6), (A-7cl 7), and (A-
7c 18). In other embodiments, such compounds are specifically excluded from structural
20 formulae (A) and/or (A-7c). Each possible combination is specifically contemplated as if set forth explicitly herein.
[417] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A -7c 14) and (2) compounds of up to 17 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, I I , 12, 13, 14, 15, 16, or 17) of structural formulae (A-7cl), (A-7c2), (A- 7c3), (A-7c4), (A-7c5), (A-7c6), (A-7c7), (A-7c8), (A-7c9), (A-7cl 0), (A-7cl 1 ), (A- 7cl2), (A-7cl3), (A-7cl 5), (A-7cl6), (A-7cl7), and (A-7cl 8). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-7c). Each possible combination is specifically contemplated as if set forth explicitly herein.
[418] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7c.l 5) and (2) compounds of any of structural formulae (A-7cl), (A-7c2), (A-7c3), (A-7c4), (A-7c5), (A-7c6), (A-7c7), (A-7c8), (A- 7c9), (A-7cl0), (A-7cl l), (A-7cl2), (A-7cl3), (A-7cl4), (A-7cl6), (A-7cl7), and (A-
7c 1 8). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c). Each possible combination is specifically contemplated as if set forth explicitly herein.
[419] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7c 15) and (2) compounds of up to 17 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, or 17) of structural formulae (A-7cl), (A-7c2), (A- 7c3), (A-7c4), (A-7c5), (A-7c6), (A-7c7), (A-7c8), (A-7c9), (A-7cl0), (A-7c l l), (A- 7c 1 2 ). (A-7cl3), (A-7cl4), (A-7cl6), (A-7cl 7), and (A-7cl 8). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c). Each possible combination is specifically contemplated as if set forth explicitly herein,
[420] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7c l6) and (2) compounds of any of structural formulae (A-7cl), (A-7c2), (A-7c3), (A-7c4), (A-7c5), (A-7c6), (A-7c7), (A-7c8), (A- 7c9), (A-7cl0), (A-7cl l), (A-7cl2), (A-7cl3), (A-7cl4), (A-7cl5), (A-7cl 7), and (A-
7c 18). In other embodiments, such compounds are specifically excluded from structural
21 formulae (A) and/or (A-7c). Each possible combination is specifically contemplated as if set forth explicitly herein.
[421] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7c l6) and (2) compounds of up to 17 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, I I , 12, 13, 14, 15, 16, or 17) of structural formulae (A-7cl), (A-7c2), (A- 7c3), (A-7c4), (A-7c5), (A-7c6), (A-7c7), (A-7c8), (A-7c9), (A-7cl 0), (A-7cl 1 ), (A- 7cl2), (A-7cl3), (A-7cl4), (A-7cl5), (A-7cl7), and (A-7cl 8). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-7c). Each possible combination is specifically contemplated as if set forth explicitly herein.
[422] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7c.l 7) and (2) compounds of any of structural formulae (A-7cl), (A-7c2), (A-7c3), (A-7c4), (A-7c5), (A-7c6), (A-7c7), (A-7c8), (A- 7c9), (A-7cl0), (A-7cl l), (A-7cl2), (A-7cl3), (A-7cl4), (A-7cl5), (A-7cl6), and (A-
7c 1 8). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c). Each possible combination is specifically contemplated as if set forth explicitly herein.
[423] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7c 17) and (2) compounds of up to 17 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, or 17) of structural formulae (A-7cl), (A-7c2), (A- 7c3), (A-7c4), (A-7c5), (A-7c6), (A-7c7), (A-7c8), (A-7c9), (A-7cl0), (A-7c l l), (A- 7c 1 2 ). (A-7cl3), (A-7cl4), (A-7cl 5), (A-7al6), and (A-7cl 8). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-7c). Each possible combination is specifically contemplated as if set forth explicitly herein,
[424] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-7c l 8) and (2) compounds of any of structural formulae (A-7cl), (A-7c2), (A-7c3), (A-7c4), (A-7c5), (A-7c6), (A-7c7), (A-7c8), (A- 7c9), (A-7cl0), (A-7cl l), (A-7cl2), (A-7cl3), (A-7cl4), (A-7cl5), (A-7cl6), and (A-
7c 17). In other embodiments, such compounds are specifically excluded from structural
1 ?"* formulae (A) and/or (A-7c). Each possible combination is specifically contemplated as if set forth explicitly herein.
Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-7c l 8) and (2) compounds of up to 17 (e.g., I , 2, 3, 4 5, 6, 7, 8, 9, 10, 1 L 12, 13, 14, 15, 16, or 17) of structural formulae (A-7el), (A-7c2), (A- 7c3), (A-7c4), (A-7c5), (A-7c6), (A-7c7), (A~7c8), (A-7c9), (A-7cl 0), (A-7cl 1 ), (A- 7cl2), (A-7cl3), (A-7cl4), (A-7cl5), (A-7cl6), and (A-7cl 7). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-7c). Each possible combination is specifically contemplated as if set forth explicitly herein.
Some embodiments specifically include and some embodiments only include compounds which have stmctural formula (A-8a):
Figure imgf000124_0001
(A-8a) wherein:
R3, R4, and R6 are as defined in stmctural formula (A). In other embodiments, such compounds are specifically excluded from structural formula (A).
Structural formula (A-8al). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-8a) in which R3 is hydrogen. In other embodiments, such compounds are specifically excluded from stmctural formulae (A) and/or (A-8a).
Structural formula (A-8a2). Some embodiments specifically mclude and some embodiments only include compounds of structural formula (A-8a) in which R4 is hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 8 a).
Structural formula (A-8a3), Some embodiments specifically include and some embodiments only include compounds of structural formula (A-8a) in which R3 and 4 are hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-8a).
Structural formula (A-8a4). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-8a) in which a. R3 and 4 are hydrogen and
b. R6 is hydrogen, alkyl,
Figure imgf000125_0001
.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 8 a). Structural formula (A-8a5). Some embodiments specifically mclude and some embodiments only include compounds of structural formula (A-8a) in which a. R3 and R4 are hydrogen and b. R6 is alkyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-8a). Structural formula (A-8a6). Some embodiments specifically include and some embodiments only mclude compounds of structural formula (A-8a) in which a. R3 and R4 are hydrogen and b. R6 is A O l 0.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-8a).
[433] Structural formula (A-8a7). Some embodiments specifically include and some embodiments only include compounds of structural formuia (A-8a) in which a. R3 and R4 are hydrogen,
Figure imgf000126_0001
c. RIO is a!kyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 8 a).
[434] Structural formula (A-8a8). Some embodiments specifically mclude and some embodiments only include compounds of structural formula (A-8a) in which a. R3 and R4 are hydrogen and
b. R6 is
Figure imgf000126_0002
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A -8a).
[435] Structural formula (A-8a9), Some embodiments specifically include and some embodiments only include compounds of structural formuia (A-8a) in which a. R3 and R4 are hydrogen and
25 b. R6 is Rio , and n is 2.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 8 a).
Structural formula (A-8al0). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-8a) in which a. R3 and R4 are hydrogen and
Figure imgf000127_0001
c. 9 and RIO, together with the nitrogen atom to which they are attached, form a heterocycle containing 1, 2, 3, or 4 heteroatoms selected from N, O, and S, optionally substituted with 1, 2, or 3 substituents selected independently from Ril, wherein Rll is as defined in structural formula (A).
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-8a).
Structural formula (A-8all). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-8a) in which a. R3 and R4 are hydrogen and
Figure imgf000127_0002
c. R9 is alkyl or alkoxylaikyi, and d. RIO is hydrogen. In other embodiments, such compounds are specifically excluded from stmctural formulae (A) and/or (A -8a).
[438] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A~8al) and (2) compounds of any of structural formulae (A-8a2), (A-8a3), (A-8a4), (A-8a5), (A-8a6), (A-8a7), (A-8a8), (A-8a9), (A- 8al0), and (A-8al 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 8 a).
[439] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-8al) and (2) compounds of up to 10 (e.g. , 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-8a2), (A-8a3), (A-8a4), (A-8a5), (A-8a6), (A~8a7), (A~8a8), (A-8a9), (A-8al 0), and (A-8al l). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-8a).
[44Θ] Some embodiments specifical ly include and some embodiments only include (1)
compounds of structural formula (A-8a2) and (2) compounds of any of structural formulae (A-8al ), (A-8a3), (A-8a4), (A-8a5), (A-8a6), (A-8a7), (A-8a8), (A-8a9), (A- 8al0), and (A-8al 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-8a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[441] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-8a2) and (2) compounds of up to 10 (e.g. , 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 1 0) of structural formulae (A-8al ), (A-8a3), (A-8a4), (A-8a5), (A-8a6), (A-8a7), (A-8a8), (A-8a9), (A-8al0), and (A-8al l). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-8a). Each possible combination is specifically contemplated as if set forth explicitly herein,
[442] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-8a3) and (2) compounds of any of structural formulae (A-8al), (A-8a2), (A-8a4), (A-8a5), (A-8a6), (A-8a7), (A-8a8), (A-8a9), (A- 8al0), and (A-8al 1). In other embodiments, such compounds are specifically excluded
27 from structural formulae (A) and/or (A-8a). Each possible combination is specifically contemplated as if set forth explicitly herein,
[443] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-8a3) and (2) compounds of up to 10 (e.g. , 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-8al), (A-8a2), (A-8a4), (A-8a5), (A-8a6), (A~8a7), (A-8a8), (A-8a9), (A-8al 0), and (A-8al l ). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 8 a). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[444] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-8a4) and (2) compounds of any of structural formulae (A-8al), (A-8a2), (A-8a3), (A-8a5), (A-8a6), (A-8a7), (A-8a8), (A-8a9), (A- 8al0), and (A-8al 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 8 a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[445] Some embodiments specifically include and some embodiments only include (1 )
compounds of structural formula (A-8a4) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-8al), (A-8a2), (A-8a3), (A-8a5), (A-8a6), (A-8a7), (A-8a8), (A-8a9), (A-8al 0), and (A-8al 1). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-8a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[446] Some embodiments specifically include and some embodiments only include (1 )
compounds of structural formula (A-8a5) and (2) compounds of any of structural formulae (A-8al), (A-8a2), (A~8a3), (A-8a4), (A-8a6), (A-8a7), (A-8a8), (A-8a9), (A- 8al0), and (A-8al 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-8a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[447] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-8a5) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4,
28 5, 6, 7, 8, 9, or 10) of structural formulae (A-8al), (A-8a2), (A-8a3), (A-8a4), (A-8a6), (A-8a7), (A-8a8), (A-8a9), (A-8al0), and (A-8al 1), In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 8 a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[448] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-8a6) and (2) compounds of any of structural formulae (A-8al), (A-8a2), (A-8a3), (A-8a4), (A-8a5), (A-8a7), (A-8a8), (A-8a9), (A- 8al 0), and (A-8ai l). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-8a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[449] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-8a6) and (2) compounds of up to 10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-8al), (A-8a2), (A-8a3), (A-8a4), (A-8a5), (A-8a7), (A-8a8), (A-8a9), (A-8al0), and (A-8al 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 8 a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[450] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-8a7) and (2) compounds of any of structural formulae (A-8al), (A-8a2), (A-8a3), (A-8a4), (A-8a5), (A-8a6), (A-8a8), (A-8a9), (A- 8al0), and (A-8al 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 8 a). Each possible combination is specifically contemplated as if set forth explicit!)' herein.
[451] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-8a7) and (2) compounds of up to 10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-8ai), (A-8a2), (A-8a3), (A-8a4), (A-8a5), (A-8a6), (A-8a8), (A-8a9), (A-8al0), and (A-8al 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 8 a). Each possible combination is specifically contemplated as if set forth explicitly herein.
29 [452] Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-8a8) and (2) compounds of any of structural formulae (A-8al), (A-8a2), (A-8a3), (A-8a4), (A-8a5), (A-8a6), (A-8a7), (A-8a9), (A- 8al0), and (A-8al 1), In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 8 a). Each possible combination is specifically contemplated as if set forth explicitly herein,
[453] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-8a8) and (2) compounds of up to 10 (e.g. , 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-8al), (A-8a2), (A-8a3), (A-8a4), (A-8a5), (A~8a6), (A~8a7), (A-8a9), (A-8al 0), and (A-8al l). In other embodiments, such compounds are specifically excluded from stnictural formulae (A) and/or (A- 8 a). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[454] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A~8a9) and (2) compounds of any of structural formulae (A-8al), (A-8a2), (A-8a3), (A-8a4), (A-8a5), (A-8a6), (A-8a7), (A-8a8), (A- 8al0), and (A-8al 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-8a). Each possible combination is specifically contemplated as if set forth explicitly herein,
[455] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-8a9) and (2) compounds of up to 10 (e.g., I, 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-8al), (A-8a2), (A-8a3), (A-8a4), (A-8a5), (A-8a6), (A~8a7), (A-8a8), (A-8al 0), and (A-8al l). In other embodiments, such compounds are specifically excluded from stnictural formulae (A) and/or (A- 8 a). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[456] Some embodiments specifically include and some embodiments only include (1)
compounds of stnictural formula (A-8al0) and (2) compounds of any of stnictural formulae (A-8al), (A-8a2), (A~8a3), (A-8a4), (A-8a5), (A-8a6), (A-8a7), (A-8a8), (A- 8a9), and (A-8al 1). In other embodiments, such compounds are specifically excluded
30 from structural formulae (A) and/or (A-8a). Each possible combination is specifically contemplated as if set forth explicitly herein,
[457] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-8al0) and (2) compounds of up to 10 (e.g., I , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-8al), (A-8a2), (A-8a3), (A-8a4), (A-8a5), (A~8a6), (A~8a7), (A-8a8), (A-8a9), and (A~8al l). in other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 8 a). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[458] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-8al 1) and (2) compounds of any of structural formulae (A-8al), (A-8a2), (A-8a3), (A-8a4), (A-8a5), (A-8a6), (A-8a7), (A-8a8), (A- 8a9), and (A-8al 0). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 8 a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[459] Some embodiments specifically include and some embodiments only include (1 )
compounds of structural formula (A-8al 1) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-8al), (A-8a2), (A-8a3), (A-8a4), (A-8a5), (A-8a6), (A-8a7), (A-8a8), (A-8a9), and (A-8al0). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-8a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[460] Some embodiments specifically include and some embodiments only include compounds which have structural formula (A-8b):
Figure imgf000132_0001
(A-8b)
31 wherein:
R3, R4, and R6 are as defmed in stmctural formula (A). In other embodiments, such compounds are specifically excluded from structural formula (A).
[461] Structural formula (A-8bl). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-8b) in which R3 is hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 8b).
[462] Structural formula (A-8b2). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-8b) in which R4 is hydrogen, in other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-8b).
[463] Structural formula (A-8b3). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A~8b) in which R3 and 4 are hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-8b).
[464] Structural formula (A-8b4). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-8b) in which a. R3 and R4 are hydrogen and
b. R6 is hydrogen, alkyl,
Figure imgf000133_0001
.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 8b).
465] Structural formula (A-8b5). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-8b) in which
32 a. R3 and 4 are hydrogen and b. R6 is alkyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 8b). Structural formula (A-8b6). Some embodiments specifically include and some embodiments only include compounds of structural formuia (A-8b) in which a. R3 and R4 are hydrogen and
Figure imgf000134_0001
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 8b). Structural formula (A-8fo7)„ Some embodiments specifically include and some embodiments only include compounds of structural formula (A-8b) in which a. R3 and R4 are hydrogen,
Figure imgf000134_0002
c. RIO is alkyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 8b).
Structural formula (A-8b8). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-8b) in which a. R3 and R4 are hydrogen and
33
Figure imgf000135_0001
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 8b),
[469] Structural formula (A-8b9). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-8b) in which a. R3 and R4 are hydrogen and
b. 6 is
Figure imgf000135_0002
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 8b).
[470] Structural formula (A-8bl0). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-8b) in which a. 3 and R4 are hydrogen and
Figure imgf000135_0003
c. R9 and RIO, together with the nitrogen atom to which they are attached, form a heterocycle containing 1, 2, 3, or 4 heteroatoms selected from N, O, and S, optionally substituted with 1 , 2, or 3 substituents selected independently from ii, wherein Rll is as defined in structural formula (A).
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 8b).
34 Structural formula (A-Sbll). Some embodiments specifically include and some embodiments only include compounds of structural formula (A~8b) in which a. R3 and R4 are hydrogen and
Figure imgf000136_0001
c. R9 is alkyl or alkoxyialkyl, and d. RiO is hydrogen.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 8b),
Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-8bl) and (2) compounds of any of structural formulae (A-8b2), (A-8b3), (A-8b4), (A-8b5), (A-8b6), (A-8b7), (A-8b8), (A-8b9), (A- 8b 10), and (A-8bl 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-8b).
Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-8bl) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-8b2), (A-8b3), (A-8b4), (A-8b5), (A-8b6), (A-8b7), (A-8b8), (A-8b9), (A-8bl0), and (A-8bl l). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-8b).
Some embodiments specifically include and some embodiments only include (! ) compounds of structural formula (A-8b2) and (2) compounds of any of structural formulae (A-8M), (A-8b3), (A-8b4), (A-8b5), (A-8b6), (A-8b7), (A-8b8), (A-8b9), (A- 8b 10), and (A-8bl 1 ). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-8b). Each possible combination is specifical ly contemplated as if set forth explicitly herein.
35 [475] Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-8b2) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-8bl), (A-8b3), (A-8b4), (A-8b5), (A-8b6), (A-8b7), (A-8b8), (A-8b9), (A-8bl0), and (A-8bl l). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-8b), Each possible combination is specifically contemplated as if set forth explicitly herein,
[476] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-8b3) and (2) compounds of any of structural formulae (A-8M), (A-8b2), (A-8b4), (A-8b5), (A-8b6), (Λ ·Ηο? (A-8b8), (A-8b9), (A-
8b 10), and (A-8b.l 1 ). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-8b). Each possible combination is specifically contemplated as if set forth explicitly herein,
[477] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-8b3) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-8M), (A-8b2), (A-8b4), (A-8b5), (A-8b6), (A-8b7), (A-8b8), (A-8b9), (A-8M0), and (A-8M 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-8b). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[478] Some embodiments spec fical ly include and some embodiments only include (1)
compounds of structural formula (A-8b4) and (2) compounds of any of structural formulae (A-8M), (A-8b2), (A-8b3), (A-8b5), (A-8b6), (A-8b7), (A-8b8), (A-8b9), (A- 8b 10), and (A-8b! 1 ). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-8b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[479] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-8b4) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-8bl), (A-8b2), (A-8b3), (A-8b5), (A-8b6), (A-8b7), (A-8b8), (A-8b9), (A-8M0), and (A-8bl l). in other embodiments, such compounds are specifically excluded from stnictural formulae (A) and/or (A-8b). Each possible combination is specifically contemplated as if set forth explicitly herein,
[480] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-8b5) and (2) compounds of any of structural formulae (A-8M), (A-8b2), (A-8b3), (A-8b4), (A-8b6), (A-8b7), (A-8b8), (A-8b9), (A- 8b 10), and (A-8b1 1 ). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-8b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[481] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-8b5) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-8bl), (A-8b2), (A-8b3), (A-8b4), (A-8b6), (A-8b7), (A-8b8), (A-8b9), (A-8M0), and (A-8bl 1 ). In other embodiments, such compounds are specifically excluded from stnictural formulae (A) and/or (A-8b). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[482] Some embodiments specifically include and some embodiments only include (1 )
compounds of stnictural formula (A-8b6) and (2) compounds of any of stnictural formulae (A-8bi), (A-8b2), (A-8b3), (A-8b4), (A-8b5), (A-8b7), (A-8b8), (A-8b9), (A- 8b 10), and (A-8bl 1). In other embodiments, such compounds are specifically excluded from structural formulae (A.) and/or (A-8b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[483] Some embodiments specifically include and some embodiments only include (1 )
compounds of stnictural formula (A-8b6) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-8bl), (A~8b2), (A-8b3), (A-8b4), (A-8b5), (A-8b7), (A-8b8), (A-8b9), (A-8bl0), and (A-8M 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-8b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[484] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-8b7) and (2) compounds of any of structural
37 formulae (A-8M), (A-8b2), (A-8b3), (A-8b4), (A-8b5), (A-8b6), (A-8b8), (A-8b9), (A-
8b 10), and (A-8bl 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-8b). Each possible combination is specifically contemplated as if set forth explicitly herein.
Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-8b7) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-8bl), (A-8b2), (A-8b3), (A-8b4), (A-8b5), (A-8b6), (A-8b8), (A-8b9), (A-8bl 0), and (A-8bl ! ). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-8b). Each possible combination is specifically contemplated as if set forth explicitly herein.
Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-8b8) and (2) compounds of any of structural formulae ( A -8b I K (A-8b2), (A-8b3), (A-8b4), (A-8b5), (A-8b6), (A-8b7), (A-8b9), (A- 8b 10), and (A-8bl 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-8b). Each possible combination is specifically contemplated as if set forth explicit!)' herein.
Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-8b8) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-8bl ), (A-8b2), (A-8b3), (A-8b4), (A-8b5), (A-8b6), (A-8b7), (A-8b9), (A-8bl 0), and (A-8bl 1 ). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-8b). Each possible combination is specifically contemplated as if set forth explicitly herein.
Some embodiments specifical ly include and some embodiments only include (1) compounds of structural formula (A-8b9) and (2) compounds of any of structural formulae (A-8M), (A-8b2), (A-8b3), (A-8b4), (A-8b5), (A-8b6), (A-8b7), (A-8b8), (A- 8b 10), and (A-8bl 1). in other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-8b). Each possible combination is specifically contemplated as if set forth explicitly herein. [489] Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A~8b9) and (2) compounds of up to 10 (e.g. , 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-8bl), (A-8b2), (A-8b3), (A-8b4), (A-8b5), (A-8b6), (A-8b7), (A-8b8), (A-8bl0), and (A-8bl l). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-8b), Each possible combination is specifically contemplated as if set forth explicitly herein,
[490] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-8M0) and (2) compounds of any of structural formulae (A-8M), (A-8b2), (A-8b3), (A-8b4), (A-8b5), (A-8b6), (A-8b7), (A-8b8), (A- 8b9), and (A~8bl l). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-8b). Each possible combination is specifically contemplated as if set forth explicitly herein,
[491] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-8M 0) and (2) compounds of up to 10 (e.g. , 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-8M), (A-8b2), (A-8b3), (A-8b4), (A-8b5), (A~8b6), (A-8b7), (A-8b8), (A-8b9), and (A-8bl l), In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-8b). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[492] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-8bl 1) and (2) compounds of any of structural formulae (A-8M), (A-8b2), (A-8b3), (A-8b4), (A-8b5), (A-8b6), (A-8b7), (A-8b8), (A- 8b9), and (A-8bl 0). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-8b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[493] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-8bl 1) and (2) compounds of up to 10 (e.g. , 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-8bl), (A-8b2), (A-8b3), (A-8b4), (A-8b5), (A-8b6), (A-8b7), (A-8b8), (A-8b9), and (A-8MQ). In other embodiments, such
39 compounds are specifically excluded from stmctural formulae (A) and/or (A-8b). Each possible combination is specifical ly contemplated as if set forth explicitly herein.
Some embodiments specifically include and some embodiments only include compounds which have structural formula (A-9a):
Figure imgf000141_0001
(A-9a)
wherein:
R3, R4, and R6 are as defined in structural formula (A). In other embodiments, such compounds are specifically excluded from structural formula (A).
[495] Structural formula (A-9al), Some embodiments specifically include and some
embodiments only include compounds of stmctural formula (A-9a) in which R3 is hydrogen. In other embodiments, such compounds are specifically excluded from stmctural formulae (A) and/or (A-9a).
[496] Structural formula (A-9a2). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-9a) in which R4 is hydrogen, in other embodiments, such compounds are specifically excluded from stmctural formulae (A) and/or (A-9a).
[497] Structural formula (A-9a3). Some embodiments specifically include and some
embodiments only include compounds of stmctural formula (A-9a) in which R3 and R4 are hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9a).
[498] Structural formula (A-9a4). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-9a) in which
40 a. R3 and 4 are hydrogen and
b. 6 is hydrogen, alkyl,
Figure imgf000142_0001
or
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9a).
[499] Structural formula (A-9a5). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-9a) in which a. R3 and R4 are hydrogen and b. R6 is alkyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9a).
[500] Structural formula (A-9a6). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-9a) in which a. R3 and R4 are hydrogen and
O
b. R6 is A O '° .
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9a).
[5Θ1] Structural formula (A-9a7), Some embodiments specifically include and some embodiments only include compounds of structural formula (A-9a) in which a. R3 and R4 are hydrogen,
O
b. R6 is ^O'R l 0 , and
41 c. RIO is alkyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9a).
Structural formula (A-9a8). Some embodiments specifically include and some embodiments only include compounds of structural formuia (A-9a) in which a. R3 and R4 are hydrogen and
Figure imgf000143_0001
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9a). Structural formula (A-9a9). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-9a) in which a. R3 and R4 are hydrogen and
Figure imgf000143_0002
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9a).
Structural formula (A-9al0). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-9a) in which a. R3 and R4 are hydrogen and
Figure imgf000143_0003
42 c. R9 and RIO, together with the nitrogen atom to which they are attached, form a heterocycle containing 1 , 2, 3, or 4 heteroatoms selected from N, O, and S, optionally substituted with 1 , 2, or 3 substituents selected independently from Rll, wherein Rll is as defined in structural formula (A).
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9a). Structural formula (A-9all). Some embodiments include only those compounds of structural formula (A-9a) in which a. R3 and R4 are hydrogen and
Figure imgf000144_0001
c. R9 is alkyl or alkoxylalkyl, and d. RIO is hydrogen.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9a). Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-9a! ) and (2) compounds of any of structural formulae (A-9a2), (A-9a3), (A-9a4), (A-9a5), (A-9a6), (A-9a7), (A-9a8), (A-9a9), (A- 9al0), and (A-9al 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9a). Some embodiments specifically include and some embodiments only include (1 ) compounds of structural formula (A-9al) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-9a2), (A-9a3), (A-9a4), (A-9a5), (A-9a6), (A-9a7), (A-9a8), (A-9a9), (A-9al 0), and (A-9al l). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9a).
43 [508] Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-9a2) and (2) compounds of any of structural formulae (A-9al), (A-9a3), (A-9a4), (A-9a5), (A-9a6), (A-9a7), (A-9a8), (A-9a9), (A-
9al0), and (A-9al 1), In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9a). Each possible combination is specifically contemplated as if set forth explicitly herein,
[5Θ9] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-9a2) and (2) compounds of up to 10 (e.g. , 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-9al), (A-9a3), (A-9a4), (A-9a5), (A-9a6), (A~9a7), (A~9a8), (A-9a9), (A-9al 0), and (A-9al l). In other embodiments, such compounds are specifically excluded from stnictural formulae (A) and/or (A-9a). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[510] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-9a3) and (2) compounds of any of structural formulae (A-9al), (A-9a2), (A-9a4), (A-9a5), (A-9a6), (A-9a7), (A-9a8), (A-9a9), (A- 9al0), and (A-9al 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9a). Each possible combination is specifically contemplated as if set forth explicitly herein,
[511] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-9a3) and (2) compounds of up to 10 (e.g. , I , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-9al), (A-9a2), (A-9a4), (A-9a5), (A-9a6), (A-9a7), (A~9a8), (A-9a9), (A-9al 0), and (A-9al l). In other embodiments, such compounds are specifically excluded from stnictural formulae (A) and/or (A-9a). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[512] Some embodiments specifically include and some embodiments only include (1)
compounds of stnictural formula (A-9a4) and (2) compounds of any of structural formulae (A-9al), (A-9a2), (A~9a3), (A-9a5), (A-9a6), (A-9a7), (A-9a8), (A-9a9), (A- 9al0), and (A-9al 1). In other embodiments, such compounds are specifically excluded
44 from structural formulae (A) and/or (A-9a). Each possible combination is specifically contemplated as if set forth explicitly herein,
[513] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-9a4) and (2) compounds of up to 10 (e.g. , 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-9al), (A-9a2), (A-9a3), (A-9a5), (A-9a6), (A-9a7), (A-9a8), (A-9a9), (A-9al 0), and (A-9al l ). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9a). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[514] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-9a5) and (2) compounds of any of structural formulae (A-9al), (A-9a2), (A-9a3), (A-9a4), (A-9a6), (A-9a7), (A-9a8), (A-9a9), (A-
9al0), and (A-9al 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[515] Some embodiments specifically include and some embodiments only include (1 )
compounds of structural formula (A-9a5) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-9al), (A-9a2), (A-9a3), (A-9a4), (A-9a6), (A-9a7), (A-9a8), (A-9a9), (A-9al 0), and (A-9al 1). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-9a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[516] Some embodiments specifically include and some embodiments only include (1 )
compounds of structural formula (A-9a6) and (2) compounds of any of structural formulae (A-9al), (A-9a2), (A-9a3), (A-9a4), (A-9a5), (A-9a7), (A-9a8), (A-9a9), (A- 9al0), and (A-9al 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[517] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-9a6) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4,
45 5, 6, 7, 8, 9, or 10) of structural formulae (A-9al), (A-9a2), (A-9a3), (A-9a4), (A-9a5), (A-9a7), (A-9a8), (A-9a9), (A-9al0), and (A-9al 1), In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9a). Each possible combination is specifically contemplated as if set forth explicitly herein.
Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-9a7) and (2) compounds of any of structural formulae (A-9al), (A-9a2), (A-9a3), (A-9a4), (A-9a5), (,\ -9a6). (A-9a8), (A-9a9), (A- 9al 0), and (A-9al l). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9a). Each possible combination is specifically contemplated as if set forth explicitly herein.
Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-9a7) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4 5, 6, 7, 8, 9, or 10) of structural formulae (A-9al), (A-9a2), (A-9a3), (A-9a4), (A-9a5), (A-9a6), (A-9a8), (A-9a9), (A-9al0), and (A-9al 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9a). Each possible combination is specifically contemplated as if set forth explicitly herein.
Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-9a8) and (2) compounds of any of structural formulae (A-9al), (A-9a2), (A-9a3), (A-9a4), (A-9a5), (A-9a6), (A-9a7), (A~9a9), (A- 9al0), and (A-9al 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9a). Each possible combination is specifically contemplated as if set forth explicit!)' herein.
Some embodiments specifical ly include and some embodiments only include (1) compounds of structural formula (A-9a8) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4 5, 6, 7, 8, 9, or 10) of structural formulae (A-9ai), (A-9a2), (A-9a3), (A-9a4), (A-9a5), (A-9a6), (A-9a7), (A-9a9), (A-9al0), and ( A -9a i 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9a). Each possible combination is specifically contemplated as if set forth explicitly herein.
46 [522] Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-9a9) and (2) compounds of any of structural formulae (A-9al), (A-9a2), (A-9a3), (A-9a4), (A-9a5), (A-9a6), (A-9a7), (A-9a8), (A-
9al0), and (A-9al 1), In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9a). Each possible combination is specifically contemplated as if set forth explicitly herein,
[523] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-9a9) and (2) compounds of up to 10 (e.g. , 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-9al), (A-9a2), (A-9a3), (A-9a4), (A-9a5), (A-9a6), (A~9a7), (A-9a8), (A-9al 0), and (A-9al l). In other embodiments, such compounds are specifically excluded from stnictural formulae (A) and/or (A-9a). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[524] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-9al0) and (2) compounds of any of structural formulae i .\-9a i ). (A-9a2), (A-9a3), (A-9a4), (A-9a5), (A-9a6), (A-9a7), (A-9a8), (A- 9a9), and (A-9al 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9a). Each possible combination is specifically contemplated as if set forth explicitly herein,
[525] Some embodiments spec fical ly include and some embodiments only include (1)
compounds of structural formula (A-9al0) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-9al), (A-9a2), (A-9a3), (A-9a4), (A-9a5), (A-9a6), (A-9a7), (A-9a8), (A-9a9), and (A~9al l). In other embodiments, such compounds are specifically excluded from stnictural formulae (A) and/or (A-9a). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[526] Some embodiments specifically include and some embodiments only include (1)
compounds of stnictural formula (A-9al 1) and (2) compounds of any of stnictural formulae (A-9al), (A-9a2), (A~9a3), (A-9a4), (A-9a5), (A-9a6), (A-9a7), (A-9a8), (A- 9a9), and (A-9al0). in other embodiments, such compounds are specifically excluded
47 from structural formulae (A) and/or (A-9a). Each possible combination is specifically contemplated as if set forth explicitly herein,
[527] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-9al l) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-9al), (A-9a2), (A-9a3), (A-9a4), (A-9a5), (A~9a6), (A-9a7), (A-9a8), (A-9a9), and (A-9al0). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9a). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[528] Some embodiments specifically include and some embodiments only include compounds which have structural formula (A-9b):
Figure imgf000149_0001
(A-9b) wherein: 3, R4, and R6 are as defined in structural formula (A). In other embodiments, such compounds are specifical ly excluded from structural formula (A).
[529] Structural formula (A-9bl). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-9b) in which R3 is hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9b).
[53Θ] Structural formula (A-9b2). Some embodiments specifical ly include and some
embodiments only include compounds of structural formula (A-9b) in which R4 is
48 hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 9b).
Structural formula (A-9b3). Some embodiments specifically include and some embodiments only include compounds of structural formuia (A-9b) in which R3 and R4 are hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9b).
Structural formula (A-9b4). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-9b) in which a. R3 and R4 are hydrogen and
b. R6 is hydrogen, alkyl,
Figure imgf000150_0001
.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 9b), Structural formula (A-9fo5)„ Some embodiments specifically include and some embodiments only include compounds of structural formula (A-9b) in which a. R3 and R4 are hydrogen and b. R6 is alkyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9b). Structural formula (A-9b6). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-9b) in which a. R3 and R4 are hydrogen and
49
Figure imgf000151_0001
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9b).
[535] Structural formula (A-9b7). Some embodiments specifically include and some embodiments only include compounds of structural formuia (A -9b) in which a. R3 and R4 are hydrogen,
Figure imgf000151_0002
c. RIO is alkyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9b).
[536] Structural formula (A-9fo8)„ Some embodiments specifically include and some embodiments only include compounds of structural formula (A-9b) in which a. R3 and 4 are hydrogen and
Figure imgf000151_0003
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9b).
Structural formula (A-9b9). Some embodiments specifically include and some embodiments only include compounds of structural formuia (A -9b) in which a. R3 and R4 are hydrogen and
50 b. 6 is Rio , and n is 2.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 9b),
Structural formula (A-9 0). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-9b) in which a. R3 and R4 are hydrogen and
Figure imgf000152_0001
c. 9 and RIO, together with the nitrogen atom to which they are attached, form a heterocycle containing 1, 2, 3, or 4 heteroatoms selected from N, O, and S, optionally substituted with 1, 2, or 3 substituents selected independently from Rll, wherein Rll is as defined in structural formula (A).
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9b). Structural formula (A-9bll). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-9b) in which
a. R3 and R4 are hydrogen and R6 is
Figure imgf000152_0002
b. R9 is alkyl or alkoxylalkyl, and c. RIO is hydrogen.
51 In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9b).
[540] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A -9b I) and (2) compounds of any of structural formulae (A-9b2), (A-9b3), (A-9b4), (A-9b5), (A-9b6), (A-9b7), (A-9b8), (A-9b9), (A- 9b 10), and (A-9bl 1 ). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 9b).
[541] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-9bl) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-9b2), (A-9b3), (A-9b4), (A-9b5), (A-9b6), (A-9b7), (A-9b8), (A-9b9), (A-9bl0), and (A-9M 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9b),
[542] Some embodiments specifical ly include and some embodiments only include (1)
compounds of structural formula (A-9b2) and (2) compounds of any of structural formulae (A-9M), (A~9b3), (A-9b4), (A-9b5), (A-9b6), (A-9b7), (A-9b8), (A-9b9), (A- 9b 10), and (A-9bl 1). in other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 9b), Each possible combination is specifically contemplated as if set forth explicitly herein.
[543] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-9b2) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 1 0) of structural formulae (A-9bl ), (A-9b3), (A~9h4), (A-9b5), (A-9b6), (A-9b7), (A-9b8), (A-9b9), (A-9bl0), and (A-9M 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9b), Each possible combination is specifically contemplated as if set forth explicitly herein,
[544] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-9b3) and (2) compounds of any of structural formulae (A-9M), (A-9b2), (A-9b4), (A-9b5), (A-9b6), (Λ·9ο? (A-9b8), (A-9b9), (A-
9b 10), and (A-9bl 1 ). In other embodiments, such compounds are specifically excluded
1 «;? from structural formulae (A) and/or (A-9b). Each possible combination is specifically contemplated as if set forth explicitly herein,
[545] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-9b3) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-9M), (A-9b2), (A-9b4), (A-9b5), (A-9b6), (A-9b7), (A-9b8), (A-9b9), (A-9M0), and (A-9M 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9b). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[546] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-9b4) and (2) compounds of any of stnictural formulae (A-9bl), (A-9b2), (A-9b3), (A-9b5), (A-9b6), (A-9b7), (A-9b8), (A-9b9), (A- 9b 10), and (A-9bl 1 ). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 9b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[547] Some embodiments specifically include and some embodiments only include (! )
compounds of structural formula (A-9b4) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-9bl), (A-9b2), (A-9b3), (A-9b5), (A-9b6), (A-9b7), (A-9b8), (A-9b9), (A-9M0), and (A-9M 1). in other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-9b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[548] Some embodiments specifically include and some embodiments only include (! )
compounds of structural formula (A-9b5) and (2) compounds of any of stnictural formulae (A-9bl), (A-9b2), (A-9b3), (A-9b4), (A-9b6), (A-9b7), (A-9b8), (A-9b9), (A- 9b 10), and (A-9bl 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A~9b). Each possible combination is specifical ly contemplated as if set forth explicitly herein.
[549] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-9b5) and (2) compounds of up to 10 (e.g., I , 2, 3, 4,
53 5, 6, 7, 8, 9, or 10) of structural formulae (A-9bl), (A-9b2), (A-9b3), (A-9b4), (A-9b6), (A-9b7), (A-9b8), (A-9b9), (A -9b 10), and (A-9bl 1 ). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[550] Some embodiments specifically include and some embodiments only include (I)
compounds of structural formula (A-9b6) and (2) compounds of any of structural formulae (A-9bl), (A-9b2), (A-9b3), (A-9b4), (A-9b5), (A-9b7), (A-9b8), (A-9b9), (A- 9b 10), and (A-9bl 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[551] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-9b6) and (2) compounds of up to 10 (e.g. , 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-9bl), (A-9b2), (A-9b3), (A-9b4), (A-9b5), (A-9b7), (A-9b8), (A~9h9), (A -9b 10), and (A-9bl 1 ). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9b), Each possible combination is specifically contemplated as if set forth explicitly herein.
[552] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-9b7) and (2) compounds of any of structural formulae (A-9bl), (A-9b2), (A-9b3), (A-9b4), (A-9b5), (A-9b6), (A-9b8), (A-9b9), (A- 9b 10), and (A-9bl 1). in other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 9b), Each possible combination is specifically contemplated as if set forth explicit!)' herein.
[553] Some embodiments specifical ly include and some embodiments only include (1)
compounds of structural formula (A-9b7) and (2) compounds of up to 10 (e.g. , 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-9bl ), (A-9b2), (A~9b3), (A-9b4), (A-9b5), (A-9b6), (A-9b8), (A-9b9), (A-9M 0), and (A-9bl 1 ). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9b), Each possible combination is specifically contemplated as if set forth explicitly herein.
54 [554] Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-9b8) and (2) compounds of any of structural formulae (A-9M), (A-9b2), (A-9b3), (A-9b4), (A-9b5), (Λ ·9ο6 (A-9b7), (A-9b9), (A- 9b 10), and (A-9bl 1). In other embodiments, such compoimds are specifically excluded from structural formulae (A) and/or (A-9b). Each possible combination is specifically contemplated as if set forth explicitly herein,
[555] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-9b8) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-9bl), (A-9b2), (A-9b3), (A-9b4), (A-9b5), (A-9b6), (A-9b7), (A-9b9), (A-9bl0), and (A-9bl l). In other embodiments, such compounds are specifically excluded from stnictural formulae (A) and/or (A-9b). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[556] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A~9b9) and (2) compounds of any of structural formulae (A-9M), (A-9b2), (A-9b3), (A-9b4), (A-9b5), (A-9b6), (A-9b7), (A-9b8), (A- 9b 10), and (A-9b.l 1 ). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9b). Each possible combination is specifically contemplated as if set forth explicitly herein,
[557] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-9b9) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-9M), (A-9b2), (A-9b3), (A-9b4), (A-9b5), (A-9b6), (A-9b7), (A-9b8), (A-9M0), and (A-9M 1). In other embodiments, such compounds are specifically excluded from stnictural formulae (A) and/or (A-9b). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[558] Some embodiments specifically include and some embodiments only include (1)
compounds of stnictural formula (A -9b 10) and (2) compounds of any of stnictural formulae (A-9M), (A-9b2), (A-9b3), (A-9b4), (A-9b5), (A-9b6), (A-9b7), (A-9b8), (A- 9b9), and (A-9bl 1). In other embodiments, such compounds are specifically excluded
55 from structural formulae (A) and/or (A-9b). Each possible combination is specifically contemplated as if set forth explicitly herein,
[559] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A -9b 10) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-9M), (A-9b2), (A-9b3), (A-9b4), (A-9b5), (A~9h6), (A-9b7), (A-9b8), (A~9b9), and (A-9M 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-9b). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[560] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-9bl 1) and (2) compounds of any of structural formulae (A~9bl), (A-9b2), (A-9b3), (A-9b4), (A-9b5), (A-9b6), (A-9b7), (A-9b8), (A- 9b9), and (A-9M 0). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 9b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[561 ] Some embodiments specifically include and some embodiments only include (! )
compounds of structural formula (A-9bl 1) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-9bl), (A-9b2), (A-9b3), (A-9b4), (A-9b5), (A-9b6), (A-9b7), (A-9b8), (A-9b9), and (A-9b l0). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-9b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[562] Some embodiments specifically include and some embodiments only include compounds which have structural formula (A- 10 a):
Figure imgf000157_0001
(A- 10a)
56 wherein:
R3, R4, and R6 are as defmed in stmctural formula (A). In other embodiments, such compounds are specifically excluded from structural formula (A).
[563] Structural formula (A-10al). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A- 10a) in which R3 is hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10a).
[564] Structural formula (A-10a2). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A- 10a) in which R4 is hydrogen, in other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10a).
[565] Structural formula (A-10a3). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A~lQa) in which 3 and R4 are hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-IOa).
[566] Structural formula (A-10a4). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A- 10a) in which a. R3 and R4 are hydrogen and
b. R.6 is hydrogen, alkyl,
Figure imgf000158_0001
.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10a).
567] Structural formula (A-10a5). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A- 10a) in which
57 a. R3 and 4 are hydrogen and b. R6 is alkyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10a). Structural formula (A-10a6). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-lOa) in which a. R3 and R4 are hydrogen and
Figure imgf000159_0001
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10a). Structural formula (A-10a7). Some embodiments specifically include and some embodiments only include compounds of structural formula (A- 10a) in which a. R3 and R4 are hydrogen,
Figure imgf000159_0002
c. RIO is alkyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10a).
Structural formula (A-10a8). Some embodiments specifically include and some embodiments only include compounds of structural formula (A- 10a) in which a. R3 and R4 are hydrogen and
58
Figure imgf000160_0001
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10a).
[571] Structural formula (A-10a9). Some embodiments specifically include and some embodiments only include compounds of structural formula (A- 10a) in which a. R3 and R4 are hydrogen and
b. 6 is
Figure imgf000160_0002
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10a).
[572] Structural formula (A-lOalO). Some embodiments specifically include and some embodiments only include compounds of structural formula (A- 10a) in which a. 3 and R4 are hydrogen and
Figure imgf000160_0003
c. R9 and R10, together with the nitrogen atom to which they are attached, form a heterocycle containing 1, 2, 3, or 4 heteroatoms selected from N, O, and S, optionally substituted with 1 , 2, or 3 substituents selected independently from ii, wherein Rll is as defined in structural formula (A).
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10a).
59 [573] Structural formula (A-10all). Some embodiments specifically include and some embodiments only include compounds of structural formula (A- 10a) in which a. R3 and R4 are hydrogen and
Figure imgf000161_0001
c. R9 is alkyl or alkoxyialkyl, and d. RIO is hydrogen.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10a).
[574] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-10al ) and (2 ) compounds of any of structural formulae (A-10a2), (A-10a3), (A-10a4), (A-10a5), (A-10a6), (A-10a7), (A-10a8), (A- 10a9), (A-10al0), and (A-10al 1 ). in other embodiments, such compounds are specifically excluded from structural formulae ( A) and/or (A- 10a).
[575] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-! Oa! ) and (2) compounds of up to 10 {e.g., 1, 2, 3, 4 5, 6, 7, 8, 9, or 10) of structural formulae (A-10a2), (A-10a3), (A-10a4), (A-10a5), (A- 10a6), (A-10a7), (A-10a8), (A-10a9), (A-10al0), and (A-10al l). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10a).
[576] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-10a2) and (2) compounds of any of structural formulae (A-10al), (A-10a3), (A-10a4), (A-10a5), (A-10a6), (A-i0a7), (A-iQaS), (A- 10a9), (A-lGalG), and (A-10al l). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10a). Each possible combination is specifically contemplated as if set forth explicitly herein.
60 [577] Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-10a2) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-10al), (A-10a3), (A-10a4), (A-10a5), (A- 10a6), (A-10a7), (A-10a8), (A-10a9), (A-10al0), and (A-10al l). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10a). Each possible combination is specifically contemplated as if set forth explicitly herein,
[578] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-10a3) and (2) compounds of any of structural formulae (A-10al ), (A-10a2), (A-10a4), (A-10a5), (A- 10a6), (A- 10a7), (A- 10a8), (A- lQa9), (A-10al0), and (A-10al l). In other embodiments, such compounds are
specifically excluded from structural formulae (A) and/or (A- 10a). Each possible combination is specifically contemplated as if set forth explicitly herein,
[579] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-10a3) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae ί Λ- i Oa i ). (A-10a2), (A-10a4), (A-10a5), (A- lQa6), (A-10a7), (A-10a8), (A-lQa9), (A-10al 0), and (A-10al l). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10a). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[580] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-10a4) and (2) compounds of any of structural formulae (A-10al), (A-10a2), (A-10a3), (A-10a5), (A-10a6), (A-10a7), (A-10a8), (A-
10a9), (A-10al 0), and (A-10al l). In other embodiments, such compounds are
specifically excluded from structural formulae (A) and/or (A- 10a). Each possible combination is specifically contemplated as if set forth explicitly herein,
[581] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-10a4) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-10al), (A-10a2), (A-10a3), (A-10a5), (A- 10a6), (A-10a7), (A-10a8), (A-10a9), (A-10al 0), and (A-10al l). In other embodiments,
61 such compounds are specifically excluded from structural formulae (A) and/or (A- 10a). Each possible combination is specifically contemplated as if set forth explicitly herein,
[582] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-10a5) and (2) compounds of any of structural formulae (A-10al), (A-10a2), (A-10a3), (A-10a4), (A-10a6), (A-10a7), (A-10a8), (A- 10a9), (A-10al 0), and (A-10al l). in other embodiments, such compounds are
specifically excluded from structural formulae (A) and/or (A- 10a). Each possible combination is specifically contemplated as if set forth explicitly herein,
[583] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-10a5) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-10al), (A-10a2), (A-10a3), (A-10a4), (A- 10a6), (A-10a7), (A-10a8), (A-10a9), (A-10al 0), and (A-10al l). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10a). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[584] Some embodiments specifically include and some embodiments only include (1 )
compounds of structural formula (A-10a6) and (2) compounds of any of structural formulae (A-10al), (A-10a2), (A-10a3), (A-10a4), (A-i0a5), (A-i0a7), (A-iOaS), (A- 10a9), (A-10al0), and (A-10al l). In other embodiments, such compounds are
specifically excluded from structural formulae (A) and/or (A- 10a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[585] Some embodiments specifically include and some embodiments only include (1 )
compounds of structural formula (A-10a6) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-10al), (A-10a2), (A-10a3), (A-l()a4), (A- 10a5), (A-10a7), (A-10a8), (A-10a9), (A-10al0), and (A-10al l). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A- 10a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[586] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-10a7) and (2) compounds of any of structural
62 formulae (A-10al), (A-10a2), (A-10a3), (A-10a4), (A-10a5), (A-10a6), (A-10a8), (A- lQa9), (A-lQalQ), and (A-! Oa! 1 ). In other embodiments, such compounds are
specifically excluded from structural formulae (A) and/or (A- 10a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[587] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-10a7) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-10al), (A-10a2), (A-10a3), (A-10a4), (A- ! 0a.5 ). (A-10a6), (A-10a8), (A-10a9), ( Λ- I Oa l O h and (A-10al 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[588] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-10a8) and (2 ) compounds of any of structural formulae (A-10al), (A-10a2), (A-10a3), (A-10a4), (A-10a5), (A-10a6), (A-10a7), (A- 10a9), (A-10al0), and (A-10al 1 ). in other embodiments, such compounds are
specifically excluded from structural formulae (A) and/or (A- 10a). Each possible combination is specifically contemplated as if set forth expli citly herein.
[589] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-10a8) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-10al), (A-10a2), (A-10a3), (A-10a4), (A- 10a5), (A- 10a6), (A- 10a7), (A- 10a9), (A- 10al0), and (A-10al 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[59Θ] Some embodiments specifical ly include and some embodiments only include (1)
compounds of structural formula (A-I0a9) and (2) compounds of any of structural formulae (A-10al ), (A-10a2), (A-10a3), (A-10a4), (A-lQa5), (A-10a6), (A-10a7), (A- 10a8), (A- 10a 10), and (A-10al 1). In other embodiments, such compounds are
specifically excluded from structural formulae (A.) and/or (A- 10a). Each possible combination is specifically contemplated as if set forth explicitly herein.
63 [591] Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-10a9) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-10al), (A-10a2), (A-10a3), (A-10a4), (A- 10a5), (A-10a6), (A-10a7), (A-10a8), (A-10al0), and (A-10al l). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10a). Each possible combination is specifically contemplated as if set forth explicitly herein,
[592] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A- 10a 10) and (2) compounds of any of structural formulae (A-10al ), (A-10a2), (A-10a3), (A-10a4), (A- 10a5), (A- 10a6), (A- 10a7), (A- 10a8), (A-10a9), and (A-10al l). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[593] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-10al0) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-10al), (A-10a2), (A-10a3), (A-10a4), (A- 10a5), (A-10a6), (A-10a7), (A-lQaS), (A-10a9), and (A-10al l). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10a). Each possible combination is specifical ly contemplated as if set forth explicitly herein.
[594] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-10al 1) and (2) compounds of any of structural formulae (A-10al), (A-10a2), (A-10a3), (A-10a4), (A-10a5), (A-10a6), (A-10a7), (A- l OaS), (A-10a9), and (A-10al0). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10a). Each possible combination is specifically contemplated as if set fort expli citly herein.
[595] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-10al 1) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-10al), (A~10a2), (A-10a3), (A-10a4), (A- 10a5), (A-10a6), (A-10a7), (A-10a8), (A-10a9), and (A-10al0). In other embodiments,
64 such compounds are specifically excluded from structural formulae (A) and/or (A- 10a). Each possible combmation is specifically contemplated as if set forth explicitly herein.
Some embodiments specifically include and some embodiments only include compounds which have structural formula (A-lOb):
Figure imgf000166_0001
(A- 10b) wherein:
R3, R4, and R6 are as defined in structural formula (A). In other embodiments, such compounds are specifically excluded from structural formula (A).
[597] Structural formula (A-lObl). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A- 10b) in which R3 is hydrogen, in other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10b).
[598] Structural formula (A-10b2). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-lOb) in which R4 is hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10b).
[599] Structural formula (A-10b3). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A- 10b) in which R3 and R4 are hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10b).
65 Structural formula (A-10b4). Some embodiments specifically include and some embodiments only mclude compounds of structural formula (A- 10b) in which a. R3 and R4 are hydrogen and
Figure imgf000167_0001
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10b).
Structural formula (A-10b5). Some embodiments specifically include and some embodiments only include compounds of structural formula (A- 10b) in which a. R3 and R4 are hydrogen and b. R6 is alkyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10b).
Structural formula (A-10b6). Some embodiments specifically include and some embodiments only mclude compounds of structural formula (A- 10b) in which a. R3 and R4 are hydrogen and
Figure imgf000167_0002
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10b). Structural formula (A-10b7). Some embodiments specifically include and some embodiments only include compounds of structural formula (A- 10b) in which a. R3 and R4 are hydrogen,
66
Figure imgf000168_0001
c. RIO is alk l.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10b).
[6Θ4] Structural formula (A-10b8). Some embodiments specifically include and some embodiments only include compounds of structural formula (A- 10b) in which a. R3 and R4 are hydrogen and
Figure imgf000168_0002
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-lOb).
605] Structural formula (A-10b9). Some embodiments specifically include and some embodiments only include compounds of structural formula (A- 10b) in which a. R3 and R4 are hydrogen and
Figure imgf000168_0003
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-lOb).
[606] Structural formula (A- 10b 10). Some embodiments specifically include and some embodiments only include compounds of structural formula (A- 10b) in which a. R3 and R4 are hydrogen and b R6 is Rio , and c. R9 and RIO, together with the nitrogen atom to which the)' are attached, form a heterocyeie containing 1 , 2, 3, or 4 heteroatoms selected from N, O, and S, optionally substituted with 1 , 2, or 3 substituents selected independently from Rll, wherein Ril is as defined in structural formula (A).
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A -10b).
Structural formula (A- 1 Ob 11). Some embodiments specifically include and some embodiments only include compounds of structural formula (A- 10b) in which
a. R3 and R4 are hydrogen and R6 is
Figure imgf000169_0001
b. R9 is alkyl or alkoxylalkyl, and c. R10 is hydrogen.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l Oh).
] Some embodiments specifical ly include and some embodiments only include (1)
compounds of structural formula (A- 1 Obi) and (2) compounds of any of structural formulae (A-10b2), (A-10b3), (A-10b4), (A-10b5), (A-10b6), (A-10b7), (A-10b8), (A- 10b9), (A-l 0b 10), and (A-l Obi 1). In other embodiments, such compounds are specifically excluded from structural formulae (A.) and/or (A- 10b).
] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-l Ob i) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural fomiulae (A-10b2), (A-10b3), (A-10b4), (A-10b5), (A-
68 lGb6), (A-10b7), (A-10b8), (A-10b9), (A- 10b 10), and (A- 10b 1 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10b).
[610] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-10b2) and (2) compounds of any of structural formulae (A-10bl), (A-10b3), (A-10b4), (A-10b5), (A-10b6), (A-10b7), (A-10b8), (A-
10b9), (A- 10b 10), and (A- 10b 1 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10b). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[611] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-10b2) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-lObl), (A-10b3), (A-10b4), (A-10b5), (A- 10bC>), (A-10b7), (A-10b8), (A-10b9), (A- 10b 10), and (A-10bl 1 ). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10b). Each possible combination is specifically contemplated as if set forth explicitly herein,
[612] Some embodiments specifically include and some embodiments only include (! )
compounds of structural formula (A-10b3) and (2) compounds of any of structural formulae (A-lObl), (A-10b2), (A-10b4), (A-10b5), (A-! 0b6), (A-10b7), (A-10b8), (A- 10b9), (A- 10b 10), and (A- 10bl 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[613] Some embodiments specifically include and some embodiments only include (! )
compounds of structural formula (A-10b3) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-lObl), (A-10b2), (A-10b4), (A-10b5), (A- 10b6), (A-10b7), (A-lObS), (A-10b9), (A- 10b 10), and (A- 10b 1 1), In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A- 10b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[614] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-! 0b4) and (2) compounds of any of structural
69 formulae (A-l Obi), (A-10b2), (A - ! 0b3 ). (A-10b5), (A-10b6), (A-10b7), (A-10b8), (A- lQb9), (A- 10b .10), and (A-lObl 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10b). Each possible combination is specifically contemplated as if set forth explicitly herein.
Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-l 0b4) and (2) compounds of up to 10 (e.g. , 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-10bl), (A-10b2), (A-10b3), (A-10b5), (A- 10b6), (A-10b7), (A-10b8), (A-10b9), (A- 10b 10), and (A- 10b 1 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10b). Each possible combination is specifically contemplated as if set forth, explicitly herein.
Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-10b5) and (2) compounds of any of structural formulae (A-l Obi), (A-10b2), (A-10b3), (A-10b4), (A-10b6), (A-10b7), (A-10b8), (A- l.Qb9), (A- 10b 10), and (A-l Obi 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10b). Each possible combination is specifically contemplated as if set forth expli citly herein.
Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-10b5) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-l Obi), (A-10b2), (A-10b3), (A-! 0b4), (A- 10b6), (A- 10b7), (A- 10b8), (A- 10b9), (A- 10b 10), and (A- 10b 1 1 ). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10b). Each possible combination is specifically contemplated as if set forth explicitly herein.
Some embodiments specifical ly include and some embodiments only include (1) compounds of structural formula (A-I0b6) and (2) compounds of any of structural formulae (A-! 0bl), (A-10b2), (A-10b3), (A-10b4), (A-10b5), (A-10b7), (A-lObS), (A- lQh9), (A- 10b 10), and (A-l Obi 1). In other embodiments, such compounds are specifically excluded from structural formulae (A.) and/or (A- 10b). Each, possible combination is specifically contemplated as if set forth explicitly herein. [619] Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-10b6) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-l Ob l), (A- 10b2), (A-10b3), (A-10b4), (A- 10b5), (A-10b7), (A-10b8), (A-10b9), (A- 10b 10), and (A- 10b 1 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-lQb). Each possible combination is specifically contemplated as if set forth explicitly herein,
[620] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A- 10b 7) and (2) compounds of any of structural formulae (A-l Ob l), (A- 10b2), (A-10b3), (Λ · 10ο4 (A-10b5), (A-10b6), (Λ - ! ObH ). (A- !Qb9), (A- 10b 10), and (A-lQbl l). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10b). Each possible combination is specifical ly contemplated as if set forth explicitly herein.
[621] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-10b7) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-lObl), (A-10b2), (A-10b3), (A-10b4), (A- 10b5), (A-10b6), (A-10b8), (A-10b9), (A- 10b 10), and (A- 10b 1 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10b). Each possible combination is specifical ly contemplated as if set forth explicitly herein.
[622] Some embodiments spec fical ly include and some embodiments only include (1)
compounds of structural formula (A-10b8) and (2) compounds of any of structural formulae (A- 1 Obi), (A-10b2), (A-10b3), (A-10b4), (A-10b5), (A-10b6), (A-10b7), (A-
10b9), (A- 10b 10), and (A- 10b 1 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10b), Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[623] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-10b8) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-lObl), (A-10b2), (A-10b3), (A-10b4), (A- lGb5), (A-10b6), (A-10b7), (A-10b9), (A- 10b 10), and (A- 10b 1 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[624] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-10b9) and (2) compounds of any of structural formulae (A-lObl), (A-10b2), (A-10b3), (A-10b4), ( A- ! 0b5 ). (A-10b6), (A-10b7), (A- 10b8), (A- 10b 10), and (A- 10b 1 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10b). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[625] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-10b9) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-lObl), (A-10b2), (A-10b3), (A-10b4), (A- 10b5), (A-10b6), (A-10b7), (A-10b8), (A- 10b 10), and (A-10bl 1 ). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10b). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[626] Some embodiments specifically include and some embodiments only include (1 )
compounds of structural formula (A- 10b 10) and (2) compounds of any of structural formulae (A-lObl), (A-10b2), (A-10b3), (A-10b4), (A-10b5), (A-10b6), (A-10b7), (A-
10b8), (A-10b9), and (A-10b l 1). in other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[627] Some embodiments specifically include and some embodiments only include (1 )
compounds of structural formula (A- 10b 10) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-10bl ), (A-10b2), (A-10b3), (A-10b4), (A- 10b5), (A-10b6), (A-10b7), (A-10b8), (A-10b9), and (A- 10b 1 1). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A- 10b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[628] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A- .10b 1. 1) and (2) compounds of any of structural formulae (A-l Obi), (A-10b2), (A - ! 0b3 ). (A-10b4), (A-10b5), (A-10b6), (A-10b7), (A-
10b8), (A-10b9), and (A-10bl 0). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10b). Each possible combination is specifically contemplated as if set forth explicitly herein,
[629] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-10bl l) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-lObl), (A-10b2), (A-10b3), (A-10b4), (A- 10b5), (A-10b6), (A-10b7), (A-10b8), (A-10b9), and (A- 10b 10). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 10b). Each possible combination is specifically contemplated as if set forth explicitly herein.
[630] Some embodiments specifically include and some embodiments only include compounds which have structural formula (A-l 1 a):
Figure imgf000174_0001
(A- 1 1 a)
wherein:
R3, R4, and 6 are as defined in structural formula (A); and R5 is hydrogen or C1-C3 alkyl. In other embodiments, such compounds are specifically excluded from structural formula (A).
Structural formula (A-llal). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-l l a) in which R3 is hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l l a).
73 [632] Structural formula (A-l la2). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-l la) in which 4 is hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l la).
[633] Structural formula (A-lla3). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-l l a) in which R3 and R4 are hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l l a).
[634] Structural formula (A-lla4). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-l la) in which a. R3 and R4 are hydrogen and
b. R6 is hydrogen, alky 1,
Figure imgf000175_0001
.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- l la).
[635] Structural formula (A-l la5). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-l la) in which a. R3 and R4 are hydrogen and b. R6 is alkyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l l a).
[636] Structural formula (A-lla6). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-l la) in which a. R3 and R4 are hydrogen and b. R6 is A O l 0.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l l a).
[637] Structural formula (A-lla7). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-l la) in which a. R3 and R4 are hydrogen,
Figure imgf000176_0001
c. RIO is a!kyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l l a).
[638] Structural formula (A-lla8). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-l l a) in which a. R3 and R4 are hydrogen and
b. R6 is
Figure imgf000176_0002
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l l a).
Structural formula (A-lla9). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-l la) in which a. R3 and R4 are hydrogen and
75 b. R6 is Rio , and n is 2.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1 la).
Structural formula (A-llalO). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-1 l a) in which a. R3 and R4 are hydrogen and
Figure imgf000177_0001
c. R9 and RIO, together with the nitrogen atom to which they are attached, form a heterocycle containing 1, 2, 3, or 4 heteroatoms selected from N, O, and S, optionally substituted with 1, 2, or 3 substituents selected independently from Ril, wherein Rll is as defined in structural formula (A).
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1 la). Structural formula (A-11 all). Some embodiments specifically mciude and some embodiments only mciude compounds of structural formula (A-1 la) in which a. R3 and R4 are hydrogen and
Figure imgf000177_0002
c. R9 is alkyl or alkoxylaikyi, and d. RIO is hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1 l a).
[642] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-1 lal) and (2) compounds of any of structural formulae (A-1 la2), (A-1 la3), (A-1 la4), (A-1 la5), (A-1 la6), (A-1 la7), (A-1 la8), (A- 1 l a9), (A-1 l al O), and (A-1 lal 1 ). In other embodiments, such compounds are
specifically excluded from structural formulae (A) and/or (A-1 la).
[643] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-1 lal) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-1 l a2), (A-1 l a3), (A-1 l a4), (A-1 la5), (A- 1 l a6), (A-1 l a7), (A-1 l a8), (A-1 l a9), (A-1 l al O), and (A-1 lal 1). In other embodiments, such compounds are specifically excluded from structural formulae ( A) and/or (A-1 la).
[644] Some embodiments specifical ly include and some embodiments only include (1)
compounds of structural formula (A-I la2) and (2) compounds of any of structural formulae (A-1 l al ), (A-1 l a3), (A-1 l a4), (A-1 l a5), (A-l la6), (A-l la7), (A-1 la8), (A- 1 la9), (A- 1 lalO), and (A-1 lal 1). In other embodiments, such compounds are
specifically excluded from structural formulae (A) and/or (A-1 la). Each possible combination is specifically contemplated as if set forth explicitly herein.
[645] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-l la2) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-1 l al ), (A-1 l a3), (A-1 l a4), (A-1 l a5), (A- 1 la6), (A-1 la7), (A-1 la8), (A-1 la9), (A-1 lalO), and (A-1 lal 1). In other embodiments, such compounds are specifically excluded from structural formulae ( A) and/or (A-1 la). Each possible combination is specifically contemplated as if set forth explicitly herein,
[646] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-l la3) and (2) compounds of any of structural formulae (A-1 lal ), (A-1 Ia2), (A-1 la4), (A-1 la5), (A- 1 la6), (A- 1 la7), (A- 1 la8), (A- 1 l a9), (A-1 l alO), and (A-1 lal 1). In other embodiments, such compounds are
77 specifically excluded from structural formulae (A) and/or (A-1 la). Each possible combination is speciticai ly contemplated as if set forth explicitly herein,
[647] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A~l la3) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-1 lal), (A-1 la2), (A-1 la4), (A-1 la5), (Λ- 1 l a6), (A-1 l a7), (A-1 l a8), (A-1 l a9), (A-1 l al O), and (A-1 l al 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1 la). Each possible combination is specifically contemplated as if set forth explicitly herein,
[648] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-1 la4) and (2) compounds of any of structural formulae (A-l lal), (A-l la2), (A~l ia3), (A~l ia5), (A-l l a6), (A~i l a7), (A~i l a8), (A- 1 l a9), (A-1 l al O), and (A-1 lal 1). In other embodiments, such compounds are
specifically excluded from structural formulae (A) and/or (A-1 la). Each possible combination is specifically contemplated as if set forth explicitly herein,
[649] Some embodiments specifically include and some embodiments only include (1 )
compounds of structural formula (A-1 la4) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-1 lal), (A-1 la2), (A-1 la3), (A-1 la5), (A- 1 l a6), (A-1 l a7), (A-1 l a8), (A-1 l a9), (A-1 l al O), and (A-1 lal 1). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A- 1 l a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[650] Some embodiments specifically include and some embodiments only include (1 )
compounds of structural formula (A-1 la5) and (2) compounds of any of structural formulae (A-1 lal), (A-1 la2), (A-1 l a3), (A-1 l a4), (A-1 l a6), (A-1 l a7), (A-1 l a8), (A- 1 la9), (A-1 lalO), and (A-1 lal 1). In other embodiments, such compounds are
specifically excluded from structural formulae (A) and/or (A-1 la). Each possible combination is specifically contemplated as if set forth explicitly herein.
[651 ] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-1 l a5) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4,
78 5, 6, 7, 8, 9, or 10) of structural formulae (A- 1 lal), (A-l la2), (A-l la3), (A-l la4), (A- 1 la6), (A-1 la7), (A-1 la8), (A-1 la9), (A-1 lalO), and (A-1 lal 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1 l a). Each possible combination is specifically contemplated as if set forth explicitly herein.
[652] Some embodiments specifically include and some embodiments only include (I)
compounds of structural formula (A-1 l a6) and (2) compounds of any of structural formulae (A-1 lal), (A-1 la2), (A-1 la3), (A-1 la4), (A-1 la5), (A-1 Ia7), (A-1 Ia8), (A- 1 la9), (A-1 lalO), and (A-1 1 al 1 ). In other embodiments, such compounds are
specifically excluded from structural formulae (A) and/or (A-1 la). Each possible combination is specifically contemplated as if set forth explicitly herein.
[653] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-1 l a6) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-1 lal), (A-1 la2), (A-1 la3), (A-1 la4), (A- 1 la5), (A-1 la?) , (A-1 la8), (A-1 la9), (A-1 lalO), and (A-1 lal 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1 la). Each possible combination is specifically contemplated as if set forth explicitly herein.
[654] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-1 la?) and (2) compounds of any of structural formulae (A-1 l al ), (A-1 l a2), (A-1 la3), (A-1 la4), (A-l la5), (A-l la6), (A-l la8), (A- 1 la9), (A- 1 lalO), and (A-1 lal 1). In other embodiments, such compounds are
specifically excluded from structural formulae (A) and/or (A-1 la). Each possible combination is specifically contemplated as if set forth expli citly herein.
[655] Some embodiments specifical ly include and some embodiments only include (1)
compounds of structural formula (A- 1 la?) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-1 l al), (A-1 l a2), (A-1 l a3), (A-1 l a4), (A- 1 la5), (A- 1 la6), (A- 1 la8), (A- 1 la9), (A- 1 lalO), and (A-1 lal 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1 la). Each possible combination is specifically contemplated as if set forth explicitly herein. [656] Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-lla8) and (2) compounds of any of structural formulae (A-1 lal), (A-1 Ia2), (A-1 la3), (A-1 la4), (A-1 la5), (A-1 la6), (A-1 la7), (A- 1 la9), (A-1 lalO), and (A-1 lal 1). In other embodiments, such compounds are
specifically excluded from structural formulae (A) and/or (A-1 la). Each possible combination is specifically contemplated as if set forth explicitly herein,
[657] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-lla8) and (2) compounds of up to 10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-1 lal), (A-1 la2), (A-1 la.3), (A-1 la4), (A- 1 la5), (A-1 la6), (A-1 la7), (A-1 la9), (A-1 lalO), and (A-1 lal 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1 la). Each possible combination is specifical ly contemplated as if set forth explicitly herein.
[658] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-1 la9) and (2) compounds of any of structural formulae (A-1 lal), (A-1 la2), (A-1 la3), (A-1 la4), (A-1 la5), (A-1 la6), (A-1 la7), (A-
1 la8), (A-1 lalO), and (A-1 lal 1). In other embodiments, such compounds are
specifically excluded from structural formulae (A) and/or (A-1 la). Each possible combmation is specifically contemplated as if set forth explicitly herein.
[659] Some embodiments spec fically include and some embodiments only include (1)
compounds of structural formula (A-1 la9) and (2) compounds of up to 10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae ίΛ-Ι ial). ίΛ-Ι ia2). i.V-i la3), (A-1 la4), (Λ- 1 la5), (A-1 la6), (A-1 la7), (A-1 la8), (A-1 lal 0), and (A-1 lal 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1 la). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[660] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-1 lal 0) and (2) compounds of any of structural formulae (A-1 lal), (A-lla2), (A-lla3), (A-lla4), (A-lla5), (A-lla6), (A-lla7), (A- lla8), (A-lla9), and (A-1 lal 1). in other embodiments, such compounds are specifically
80 excluded from structural formulae (A) and/or (A- 1 la). Each possible combination is specifically contemplated as if set forth explicitly herein.
[661] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-1 lalO) and (2) compounds of up to 1 0 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-l lal), (A-l la2), (A-l la3), (A-l la4), (A- 1 1 a5), (A-1 1 a6), (A-1 1 a7), (A-1 1 a8), (A-1 1 a9), and (A-l lal 1). in other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1 la). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[662] Some embodiments spec fical ly include and some embodiments only include (1)
compounds of structural formula (A-l lal 1) and (2) compounds of any of structural formulae (A-l lal), (A-l la2), (A-l la3), (A-l la4), (A~l l a5), (A-l l a6), (A-l l a7), (A- 1 l a8), (A-1 l a9), and (A-l lal0). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1 la). Each possible combination is specifically contemplated as if set forth expli citly herein.
[663] Some embodiments specifically include and some embodiments only include (1 )
compounds of structural formula (A-l lal 1) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-l lal), (A-l la2), (A-l la3), (A~l l a4), (A- 1 l a5), (A-l la6), (A-l la7), (A-l la8), (A-1 l a9), and (A-l lal0). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-1 la). Each possible combination is specifically contemplated as if set forth explicitly herein.
[664] Some embodiments specifically include and some embodiments only include compounds which have structural formula (A-1 lb):
Figure imgf000182_0001
81 (A-1 lb) wherein:
R3, R4, and R6 are as defined in structurai formula (A) and R7 is hydrogen or C1 -C3 alkyl. In other embodiments, such compounds are specifically excluded from structural formula (A).
[665] Structural formula (A-llbl). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-1 lb) in which 3 is hydrogen, in other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1 lb).
[666] Structural formula (A-l lbl). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-1 lb) in which R4 is hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1 lb).
[667] Structural formula (A-llb3). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-1 1 b) in whic R3 and R4 are hydrogen. In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1 l b).
[668] Structural formula (A-llb4). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-1 lb) in which a. R3 and R4 are hydrogen and
b. R6 is hydrogen, alkyl,
Figure imgf000183_0001
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 1 lb).
82 [669] Structural formula (A-l lbS). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-l lb) in which a. R3 and R4 are hydrogen and b. R6 is alkyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l I b).
[670] Structural formula (A-llb6). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-l lb) in which a. R3 and R4 are hydrogen and
O
b. R6 is O
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l lb).
[671] Structural formula (A~llb7). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-l l b) in which a. R3 and R4 are hydrogen,
O
%)l p
b. R6 is A O' l0, and c. RIO is alkyl.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- l lb).
[672] Structural formula (A-l ib8). Some embodiments specifically include and some embodiments only include compounds of structural formula (A- 1 lb) in which a. R3 and 4 are hydrogen and
Figure imgf000185_0001
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-l lb).
Structural formula (A-llb9). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-l lb) in which a. R3 and R4 are hydrogen and
Figure imgf000185_0002
In other embodiments, such compounds are specifically excluded from structural form lae (A) and/or (A-l lb).
Structural formula (A- lib 10). Some embodiments specifically include and some embodiments only include compounds of structural formula (A-l lb) in which a. R3 and R4 are hydrogen and
Figure imgf000185_0003
c. R9 and RIO, together with the nitrogen atom to which they are attached, form heterocycle containing 1, 2, 3, or 4 heteroatoms selected from N, O, and S, optionally substituted with 1 , 2, or 3 substituents selected independently from Rll, wherein Rll is as defined in structural formula (A). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1 lb).
[675] Structural formula (A-1 Ibl 1). Some embodiments specifically include and some
embodiments only include compounds of structural formula (A-1 lb) in which a. R3 and R4 are hydrogen and
Figure imgf000186_0001
c. R9 is alkyl or alkoxylalkyl, and d. RIO is hydrogen.
In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1 lb).
[676] Some embodiments specifical ly include and some embodiments only include (1)
compounds of structural formula (A- 1 Ibl) and (2) compounds of any of structural formulae (A-1 l b2), (A-1 lb3), (A-1 lb4), (A-1 lb5), (A-1 lb6), (A-1 lb7), (A-1 lb8), (A- 1 lb9), (A-1 lb 10), and (A-1 I bl 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1 lb).
[677] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A- 1 1 b 1 ) and ( 2) com pounds of up to 10 (e.g. , 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-1 lb2), (A-1 Ib3), (A-1 lb4), (A-1 ! b5 ). (A- 1 lb6), (A-1 lb7), (A-1 1 b8), (A-1 lb9), (A-1 1 bl 0), and (A-1 I bl 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1 lb).
[678] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-1 l b2) and (2) compounds of any of structural formulae (A-1 Ibl), (A-1 l b3), (A- 1 lb4), (A-1 lb5), (A-1 lb6), (A-1 lb7), (A-1 l b8), (A- 1 lb9), (A-1 Ibl 0), and (A-1 Ibl 1). In other embodiments, such compounds are
85 specifically excluded from structural formulae (A) and/or (A-1 lb). Each possible combination is specifical ly contemplated as if set forth explicitly herein.
[679] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-1 lb2) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-1 ibl), (A-1 lb3), (A-1 lb4), (A-1 lb5), (A- 1 1 b6), (A-1 lb7), (A-1 lb8), (A-1 1 b9), (A-1 lb 10), and (A-1 Ibl 1 ). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1 lb). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[680] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-1 lb3) and (2) compounds of any of structural formulae (A-1 Ibl), (A-1 lb2), (A-1 lb4), (A-1 lb5), (A-1 l b6), (A-1 lb7), (A-1 lb8), (A-
1 1 b9), (A-1 lb 10), and (A-1 lb 1 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1 lb). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[681 ] Some embodiments specifically include and some embodiments only include (! )
compounds of structural formula (A-1 lb3) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-1 Ibl), (A-l lb2), (A-1 lb4), (A-l lb5), (A- 1 l b6), (A-1 lb7), (A-1 lb8), (A-1 l b9), (A- 1 lb 10), and (A- 1 Ibl 1). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-1 lb). Each possible combination is specifically contemplated as if set forth explicitly herein.
[682] Some embodiments specifically include and some embodiments only include (! )
compounds of structural formula (A-1 lb4) and (2) compounds of any of structural formulae (A-1 Ibl ), (A-l l b2), (A-l lb3), (A-l lb5), (A-1 l b6), (A-l lb7), (A-l ! b8), (A- 1 lb9), (A-1 lblO), and (A-1 Ibl 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1 lb). Each possible combination is specifically contemplated as if set forth explicitly herein.
[683] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-1 ! b4) and (2) compounds of up to .10 (e.g. , 1 , 2, 3, 4,
86 5, 6, 7, 8, 9, or 10) of structural formulae (A- l lbl), (A-l l b2), (A-1 lb3), (A-l lb5), (A-
1 lb6), (A-1 lb7), (A-1 l b8), ( A- 1 lb9), (A-1 Ibl 0), and (A-1 Ibl 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1 l b). Each possible combination is specifically contemplated as if set forth explicitly herein.
Some embodiments specifically include and some embodiments only include (I) compounds of structural formula (A-1 1 b5) and ( 2) compounds of any of structural formulae (A-1 Ibl), (A-1 lb2), (A-1 lb3), (A-1 lb<4), (A-1 lb6), (A-1 lb7), (A-1 lb8), (A- 1 lb9), (A-1 Ibl 0), and (A-1 Ibl 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1 lb). Each possible combination is specifically contemplated as if set forth explicitly herein.
Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-1 1 b5) and (2) compounds of up to 10 (e.g. , 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-1 Ibl), (A-1 Ib2), (A-1 lb3), (A-1 lb4), (A- 1 lb6), (A-1 lb7), (A-1 1 b8), (A-1 lb9), (A-1 1 b! 0), and (A-1 I bl 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1 lb). Each possible combination is specifically contemplated as if set forth explicitly herein.
Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-1 l b6) and (2) compounds of any of structural formulae (A-1 I bl), (A-1 lb2), (A-1 lb3), (A-1 lb4), (A-1 lb5), (A-1 lb7), (A-1 lb8), (A- 1 lh9), (A-1 Ibl 0), and (A-l l bl 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1 lb). Each possible combination is specifically contemplated as if set forth expli citly herein.
Some embodiments specifical ly include and some embodiments only include (1) compounds of structural formula (A-I lb6) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-1 Ibl), (A-1 lb2), (A-1 lb3), (A-1 l b4), (A- 1 lb5), (A-1 lb7), (A-1 l b8), (A- 1 lb9), (A-1 l blO), and (A-1 I b l 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1 lb). Each possible combination is specifically contemplated as if set forth explicitly herein. [688] Some embodiments specifically include and some embodiments only include (1) compounds of structural formula (A-1 lb7) and (2) compounds of any of structural formulae (A-1 Ib l), (A- 1 lb2), (A-1 l b3), (A-1 lb4), (A-1 lb5), (A-1 l b6), (A- 1 lb8), (A-
1 lb9), (A-1 IblO), and (A-1 Ibl 1). In other embodiments, such compounds are specifical ly excluded from structural formulae (A) and/or (A-1 lb). Each possible combination is specifically contemplated as if set forth explicitly herein,
[689] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-1 lb7) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-1 I b l), (A- 1 lb2), (A-1 lb3), (A-1 lb4), (A- 1 lb5), (A-1 lb6), (A-1 lb8), (A-1 lb9), (A-1 IblO), and (A-1 Ibl 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A- 1 lb). Each possible combination is specifical ly contemplated as if set forth explicitly herein.
[690] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-1 lb8) and (2) compounds of any of structural formulae (A-1 Ibl), (A-1 lb2), (A-1 lb3), (A-1 lb4), (A-1 ! b5 ). (A-1 lb6), (A-1 lb7), (A-
I lb9), (A-1 IblO), and (A-1 Ibl 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1 lb). Each possible combination is specifically contemplated as if set forth explicitly herein.
[691] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-1 lb8) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-1 Ibl), (A-1 lb2), (A-1 lb3), (A-1 lb4), (A-
I I b5), (A-1 lb6), (A-1 lb7), (A-1 1 b9), (A-1 lb 10), and (A-1 Ibl 1 ). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1 lb). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[692] Some embodiments spec fical ly include and some embodiments only include (1)
compounds of structural formula (A-1 lb9) and (2) compounds of any of structural formulae (A-1 Ibl), (A-1 lb2), (A-1 lb3), (A-1 lb4), (A-1 ! bS k (A-1 lb6), (A-1 lb7), (A-
1 l b8), (A-1 IblO), and (A- 1 Ibl 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1 lb). Each possible combination is specifical ly contemplated as if set forth explicitly herein.
[693] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-1 lb9) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-1 lbl), (A-1 lb2), (A-1 lt>3), (A-1 lb4), (A- 1 1 b5), (A-1 lb6), (A-1 lb7), (A-1 1 b8), (A-1 lb 10), and (A-1 lbl 1 ). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1 lb). Each possible combination is specifical ly contemplated as if set forth explicitly herein,
[694] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-1 l bl 0) and (2) compounds of any of structural formulae (A-1 lbl), (A-1 lb2), (A-1 lb3), (A-1 lb4), (A-1 ! bS k (A-1 lb6), (A-1 lb7), (A- 1 1 b8), (A-1 lb9), and (A-1 1 bl l ). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1 lb). Each possible combination is specifically contemplated as if set forth expli citly herein.
[695] Some embodiments specifically include and some embodiments only include (! )
compounds of structural formula (A-1 Ibl O) and (2) compounds of up to 10 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-l lbl), (A-1 lb2), (A-l lb3), (A~l lb4), (A- 1 l b5), (A-1 lb6), (A-1 lb7), (A-1 l b8), (A- 1 lb9), and (A- 1 lbl 1). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1 lb). Each possible combination is specifically contemplated as if set forth explicitly herein.
[696] Some embodiments specifically include and some embodiments only include (! )
compounds of structural formula (A-1 lbl I) and (2) compounds of any of structural formulae (A-l lbl ), (A-l l b2), (A-l lb3), (A-l lb4), (A-1 l b5), (A-l lb6), (A-l ! b7), (A- 1 lb8), (A-1 lb9), and (A-I IblO). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1 lb). Each possible combination is specifically contemplated as if set forth explicitly herein.
[697] Some embodiments specifically include and some embodiments only include (1)
compounds of structural formula (A-1 ! bl l) and (2) compounds of up to 10 (e.g., 1 , 2, 3,
89 4, 5, 6, 7, 8, 9, or 10) of structural formulae (A-l lbl), (A-1 lb2), (A-l lb3), (A-l lb4), (A 1 lb5), (A-1 lb6), (A-1 lb7), (A-1 lb8), (A-1 lb9), and (A-1 lbl 0). In other embodiments, such compounds are specifically excluded from structural formulae (A) and/or (A-1 lb). Each possible combination is specifically contemplated as if set forth explicitly herein.
Table 1 provides examples of compounds encompassed by one or more of the structural formulae described above. The average ICso a d EC50 were determined as described in the Examples below. These and other compounds within the scope of the formulae described above can be synthesized according to general methods known in the art and as described in the specific Examples, below.
Table 1.
Figure imgf000191_0001
90
Figure imgf000192_0001
Figure imgf000193_0001
Figure imgf000194_0001
Figure imgf000195_0001
94
Figure imgf000196_0001
95
Figure imgf000197_0001
Figure imgf000198_0001
97
Figure imgf000199_0001
Figure imgf000200_0001
99
Figure imgf000201_0001
Figure imgf000202_0001
Figure imgf000203_0001
Figure imgf000204_0001
203
Figure imgf000205_0001
Figure imgf000206_0001
205
Figure imgf000207_0001
Figure imgf000208_0001
Figure imgf000209_0001
208
Figure imgf000210_0001
209
Figure imgf000211_0001
Figure imgf000212_0001
Figure imgf000213_0001
Figure imgf000214_0001
213
Figure imgf000215_0001
Figure imgf000216_0001
Figure imgf000217_0001
Figure imgf000218_0001
Figure imgf000219_0001
Figure imgf000220_0001
Figure imgf000221_0001
Figure imgf000222_0001
Figure imgf000223_0001
Figure imgf000224_0001
Figure imgf000225_0001
Figure imgf000226_0001
Figure imgf000227_0001
Figure imgf000228_0001
Figure imgf000229_0001
Figure imgf000230_0001
Figure imgf000231_0001
Figure imgf000232_0001
Figure imgf000233_0001
Figure imgf000234_0001
IJ33
Figure imgf000235_0001
Figure imgf000236_0001
IRE- la inhibitor compounds include both the free forms and pharmaceutically acceptable salts of pharmaceutically usable stereoisomers, E/Z isomers, enantiomers, racernates, diastereomers, hydrates, and solvates. Some of the specific IRE- l a inhibitor compounds described herein are the protoiiated salts of amine compoimds. The term "free form" refers to the amine compounds in non-salt form. The encompassed pharmaceutically acceptable salts not only include the salts described for the specific compounds disclosed herein, but also all the typical pharmaceutically acceptable salts of the free form of IRE- l inhibitor compounds and prodrugs thereof,
[700] The free form of the specific salt compounds described may be isolated using techniques known in the art. For example, the free form may be regenerated by treating the salt with a suitable dilute aqueous base solution such as dilute aqueous NaOH, potassium carbonate, ammonia and sodium bicarbonate. The free forms may differ from their respective salt forms somewhat in certain physical properties, such as solubility in polar solvents, but the acid and base salts are otherwise pharmaceutically equivalent to their respective free forms.
[701] Pharmaceutically acceptable salts of the disclosed IRE- la inhibitor compounds can be synthesized which contain a basic or acidic moiety by conventional chemical methods. Generally, the salts of the basic compounds are prepared either by ion exchange chromatography or by reacting the free base with stoichiometric amounts or with an excess of the desired salt-forming inorganic or organic acid in a suitable solvent or various combinations of solvents. Similarly, the salts of the acidic compounds are formed by reactions with the appropriate inorganic or organic base.
[702] Pharmaceutically acceptable salts of IRE-1 a inhibitor compounds include the
conventional non-toxic salts of the compounds as formed by reacting a basic compound with an inorganic or organic acid. For example, conventional non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like, as well as salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maieic, hydroxymaleic, phenyiacetic, glutamic, benzoic, salicylic, sulfaniiic, 2-acetoxy- benzoic, fumaric, toluenesulfonic, benzenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, trifluoroacetic and the like.
[703] When an IRE- la inhibitor compound is acidic, suitable pharmaceutically acceptable salts include salts prepared form pharmaceutically acceptable non-toxic bases including inorganic bases and organic bases. Salts derived from inorganic bases include aluminum, ammonium, calcium, copper, ferric, ferrous, lithium, magnesium, manganic salts, manganous, potassium, sodium, zinc and the like. Particular salts are the ammonium, calcium, magnesium, potassium and sodium salts. Salts derived from pharmaceutically acceptable organic non-toxic bases include salts of primary, secondary and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as arginine, betaine, caffeme, choline, N,N1 - dibenzylethylenediamine, diethyiamine, 2-diethyiaminoethanoL 2-dimetliylaminoethanol, ethanolamine, ethylenediamine, N-ethylmorpholine, N-ethylpiperidine, glucamine, glucosamine, histidine, hydrabamine, isopropyiamme, lysine, methylglucamine, morpholine, piperazine, piperidine, polyamine resins, procaine, purines, theobromine, triethylamine, trimethylamine tripropylamine, tromethamine and the like. The preparation of the pharmaceutically acceptable salts described above and other typical
pharmaceutically acceptable salts is more fully described by Berg et al., "Pharmaceutical Salts," J. Pharm. 8ci„ 1977:66: 1-19. Θ4] Some IRE- la compounds or prodrugs are potentially internal salts or zwitterioiis,
because under physiological conditions a deprotonated acidic moiety in the compound, such as a earhoxyl group, may be anionic, and this electronic charge might then be balanced off internally against the cationic charge of a protonated or alkylated basic moiety, such as a quaternary nitrogen atom. 05] IRE- la inhibitor compounds or prodrugs thereof may have asymmetric centers, chiral axes, and chiral planes (as described in: E. L. Eli el and S. . Wilen, Stereochemistry of Carbon Compounds, John Wiley & Sons, New York, 1994, pages 11 19-1 190), and may occur as racemates, racemic mixtures, and as individual diastereomers, with all possible isomers and mixtures thereof, including optical isomers, being included. 06] An IRE-la inhibitor compound or prodrug thereof may be of such a nature that its
constituent atoms are capable of being arranged spatially in two or more ways, despite having identical bonds. As a consequence, this compound exists in the form of stereoisomers. Cis/'trans isomerism is only one type of stereoisomerism. If the
stereoisomers are image and mirror image which cannot be superimposed, they are enantiomers which have chirality or handedness since one or more asymmetric carbon atoms are present in the structure forming them. Enantiomers are optically active and therefore distinguishable since they rotate the plane of polarized light to an equal extent, but in opposite directions.
707] "Solvates" are adductions of inert solvent molecules onto the compounds which form owing to their mutual attractive force. Solvates are, for example, monohydrates, dihydrates or alcoholates.
70S] If two or more asymmetric carbon atoms are present in an IRE- la compound, two
possible configurations exist at each of these carbon atoms. If two asymmetric carbon atoms are present, four possible stereoisomers exist, for example. Furthermore, these four possible stereoisomers can be divided into six possible pairs of stereoisomers that differ from each other. In order for a pair of molecules with more than one asymmetric carbon to be enantiomers, they must have different configurations at each asymmetric carbon. Those pairs that do not behave as enantiomers have a different stereochemical relationship, which is known as a diastereomeric relationship. Stereoisomers that are not enantiomers are known as diastereoisomers, or, more frequently, diastereomers.
709] IRE- la inhibitor compounds thus include stereoisomers, and, if these are enantiomers, the individual enantiomers, racemic mixtures of these enantiomers, and artificial, i.e. synthetic, mixtures comprising proportions of these enantiomers which are different from the proportions of these enantiomers observed in a racemic mixture. If an IRE- 1 a inhibitor compound has stereoisomers that are diastereomers, this compound includes the individual diastereomers as well as mixtures of any two or more of these diastereomers in any desired proportions.
71Θ] The specific biological effects and/or physical and chemical properties of a pair or set of enantiomers of an IRE- la inhibitor compound— if present— may make it desirable to use these enantiomers in certain ratios, for example to form a final therapeutic product. The following is intended to serve for illustration: if a pair of enantiomers exists, the enantiomers can be used in ratios such as 90% (R)-10% (S), 80% (R)-20% (S), 70% (R)- 30% (S), 60% (R)-40% (S), 50% (R)-50% (8), 40% (R)-60% (S), 30% (R)-70% (S), 20% (R)-80% (8), and 10% (R)-90% (8). A fter evaluation of the properties of the various enantiomers of an IRE- la inhibitor compound— if they exist— the corresponding amount of one or more of these enantiomers having certain desired properties which form the final therapeutic product can be determined in a simple manner.
For IRE- la inhibitor compounds disclosed herein which may exist as tautomers, both tautomeric forms are encompassed by a depicted structural formula, even though only one tautomeric structure is depicted. For example, a compound such as that below drawn as the keto tautomer includes the enoi tautomer, and vice versa, as well as mixtures thereof.
Figure imgf000240_0001
Prodrugs
[712] A "prodrug" as used herein is a compound that can be metabolized to active IRE- la inhibitor compound after administration. For example, IRE- la inhibitor compounds disclosed herein can be modified, e.g., with alkyl or acyl groups, sugars, or oligopeptides and which are rapidly cleaved in vivo to release the active IRE-Ια inhibitor compounds.
[713] Derivatives of the corresponding aromatic alcohols can serve as prodrugs for aromatic aldehydes because alcohols and aldehydes are metabolicaily interconvertible, according to the following general scheme:
Figure imgf000240_0002
Scheline, 1972, Xenobiotica, 2, 227-36.
Examples of prodrugs of aldehydes, ketones, alcohols and other functional groups are described in Wermuth et ai., 1996, Designing Prodrugs and Bioprecursors I : Carrier Prodmgs. In The Practice of Medicinal Chemistiy, pp. 672-696; and in Wermuth, 1996, "Preparation of Water-Soluble Compounds by Covalent Attachment of Solubiiizing Moieties," in Wermuth, ed., The Practice of Medicinal. Chemistry, pp. 756-776. Other general aldehyde derivatives and alcohol derivatives that can perform prodrug functions as well as methods for their preparation are described in Cheronis et al., 1965, Semimicro Qualitative Organic Analysis, New York: Interscience, pp. 465-5.18.
Methods of Preparing IRE- la Inhibitor Compounds and Prodrugs
IRE- l a inhibitor compounds and starting materials for their synthesis can be prepared by appropriate modification of methods known in the art as described in the literature, for example in standard works such as Houben-Weyl, Methoden der organi.sch.en Chemie, Georg-Thieme-Verlag, Stuttgart. Methods may also be found by computer search in The MDL® CrossFire Beilsiem database, in which the reaction domain details the preparation of substances. See also the specific Examples, below.
Pharmaceutical Preparations
Any of the IRE-1 a inhibi tor compounds and prodrugs di sclosed herein can be formulated as pharmaceuticals using methods well known in the art. Pharmaceutical formulations typically comprise at least one IRE-1 a inhibitor compound or prodrug thereof mixed with a carrier, diluted with a diluent, and/or enclosed or encapsulated by an ingestible carrier in the form of a. capsule, sachet, cachet, paper, or other container, or by a disposable container such as an ampoule.
A carrier or diluent can be a solid, semi-solid, or liquid material. Some examples of diluents or carriers which can be employed in the pharmaceutical compositions are lactose, dextrose, sucrose, sorbitol, mannitol, propylene glycol, liquid paraffin, white soft paraffin, kaolin, microcrystalline cellulose, calcium silicate, silica polyvinylpyrrolidone, cetostearyl alcohol, starch, gum acacia, calcium phosphate, cocoa butter, oil of theobroma, arachis oil, alginates, tragacanth, gelatin, methyl cellulose, polyoxyethylene sorbitan rnoriolaurate, ethyl lactate, propvlhvdroxybenzoate, sorbitan trioleate, sorbitan sesquioleate, and oleyi alcohol. [718] Pharmaceutical compositions can be manufactured by methods well known in the art, including conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or iyophiiizing processes.
[71 ] For injection, the J RE- la inhibitor compounds can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks' s solution, Ringer's solution, or physiological saline buffer. For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art. if desired, any of the IRE- la inhibitor compounds or prodrugs thereof disclosed herein can be provided in a pyrogen-free pharmaceutically acceptable vehicle.
[720] For oral administration, an IRE-1 a inhibitor compound or prodrug thereof can be
combined with pharmaceutically acceptable carriers or vehicles which enable the IRE- la inhibitor compound or prodrug thereof to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like. Fi llers can be used, such as gelatin, sugars (e.g., lactose, sucrose, mannitol, or sorbitol), cellulose preparations (e.g., maize starch, wheat starch, rice starch, potato starch, gum tragacanth, methyl cellulose, hydroxypropylmethyl-eeilulose, sodium carboxymethylcellulose), and/or polyvinylpyrrolidone (PVP). If desired, disintegrating agents can be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof, such as sodium alginate.
[721] Dragee cores can be provided with suitable coatings. For this purpose, concentrated sugar solutions can be used, which can optionally contain gum arable, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments can be added to the tablets or dragee coatings for identification.
[722] Phamiaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules can contain the active ingredients in admixture with a filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, an IRE- la inhibitor compound or prodrug thereof can be dissol ved or suspended in a suitable liquid, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers can be added. All formulations for oral administration preferably are in dosages suitable for such administration.
[723] For buccal administration, the compositions can take the form of tablets or lozenges formulated in conventional manners.
[724] For administration by inhalation, pharmaceutical preparations can be delivered in the form of an aerosol sprays from a pressurized pack or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofiuoromethane,
dichiorotetrafluoroethane, carbon dioxide, or other suitable gas. If desired, a valve can be used to deliver a metered amount. Capsules and cartridges of, e.g., gelatin for use in an inhaler or msufflator, can be formulated containing a powder mix of an IRE- la inhibitor compound or prodrug thereof and a suitable powder base, such as lactose or starch.
[725] IRE- la inhibitor compounds or prodrugs thereof can be formulated for parenteral
administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection can be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions can take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles, and can contain formulatory agents such as suspending, stabilizing, and/or dispersing agents.
[726] Pharmaceutical formulations for parenteral adm nistration include aqueous solutions of an IRE- 1 a inhibitor compound or prodrug thereof. Additionally, a suspension of an IRE- la inhibitor compound or prodrug thereof can be prepared as an appropriate oily injection suspension. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions can contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, the suspension can also contain suitable stabilizers or agents which increase the solubility of an IRE- la inhibitor compound or prodmg thereof to allow for the preparation of highly concentrated soluti ons .
[727] Alternatively, an IRE- la inhibitor compound or prodrug thereof can be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
[728] IRE- la inhibitor compounds or prodrugs thereof can also be formulated in rectal
compositions such as suppositories or retention enemas, e.g. , containing conventional suppository bases such as cocoa butter or other glycerides.
[729] In addition to the formulations described previously, an IRE- la inhibitor compound or prodrug thereof can also be formulated as a depot preparation. Such long-acting formulations can be administered by implantation (for example, subcutaneously or intramuscularly) or by intramuscular injection. Thus, for example, an IRE- la inhibitor compound or prodrug thereof can be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt,
[730] The pharmaceutical compositions also can comprise suitable solid or gel phase carriers or excipients. Examples of such carriers or excipients include but are not limited to, calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, and polymers such as polyethylene glycols.
[731] In addition to the common dosage forms set out above, an IRE- la inhibitor compound or prodrug thereof can be administered by a controlled release means and/or delivery device, including ALZET® osmotic pumps (Alza Corporation). Suitable delivery devices are described in U.S. Pat. Nos. 3,845,770; 3,916,899; 3,536,809; 3,598,123; 3,944,064; and 4,008,719.
Methods
[732] IRE- la inhibitor compounds or prodrugs thereof can be used to inhibit IRE- la activity (e.g., cleavage of RNA or mRNA., RNA or mRNA splicing). In some embodiments IRE- la activity (e.g., cleavage of RNA or mRNA, RNA or mRNA splicing) is inhibited in vitro. In other embodiments IRE- la activity (e.g., cleavage of RNA or mRNA, RNA or mRNA splicing) is inhibited in vivo,
[733] IRE- la inhibitor compounds or prodrugs thereof can be used to prepare formulations or medicaments for inhibiting tumor cell growth and for treating the disorders disclosed below. IRE- la inhibitor compounds or prodrugs thereof can be administered to a patient, preferably a human patient, in pharmaceutical preparations as disclosed above, preferably with a pyrogen-free pharmaceutically acceptable vehicle, at doses effective to treat or ameliorate a symptom, of a disorder associated with the unfolded protein response, IRE- la inhibitor compounds and prodmgs thereof can be used to treat patient populations which are not entirely coincident with those most commonly receiving treatment for disorders associated with the unfolded protein response (e.g., cancer therapies or therapies for autoimmune disorders). For example, IRE- la inhibitor compounds and prodrugs thereof can be administered to patients at the earliest stages of these conditions, even those to whom traditional therapies are commonly not offered.
Disorders associated with UPR
[734] A fine balance exists between a cell's life and death depending on how protein folding stress is managed by the cell (proteostasis). Imbalances in proteostasis lead to many metabolic, oncological, neurodegenerative, inflammatory, cardiovascular disorders and infectious disease (Balch. et ah, Science 319, 916, 2008). The UPR. relates specifically to the proteostasis of the endoplasmic reticulum where all secreted and membrane proteins are translated, folded and processed for delivery to their individual site of action.
Therefore, activation of the UPR enhances protein folding in the ER allowing the cell to survive. If protein folding stress is not managed in the ER, the cells will initiate apoptosis.
[735] Protein folding stress may be a natural hallmark of the type of cell for example insulin secreting β-is!et cells or antibody secreting plasma cells. In both cases, the ceil has fine tuned the machinery to deal with, the stress by activating the UPR. Depending on the disease type, it may be therapeutically beneficial to induce or inhibit the UPR. For example, in type II diabetes or Alzheimer's disease, it may be therapeutically beneficial to activate the UPR in such a way where β-islet cells survive the stress of over producing insulin or neurons survive the apoptotic effects due to unfolded aggregates of β-arayloid protein. Diseases such as cancer, inflammation, and viral infection may be therapeutically modulated by inhibition of the UPR. In these types of conditions, cellular survival due to corruption of the U PR may be impacted. Protein folding in the ER is negati ve!)' impacted by such conditions in the tumor microenviroiinient as hypoxia, glucose starvation, amino acid deprivation, acidosis and mutant malfolded and oncogenic proteins. Additionally chenio-, bio-, and radiotherapy can lead to protein folding stress. It may be possible to induce apoptosis in these conditions by inhibiting the anti-apoptotic effects of the UPR. Myeloma derived from neoplastic antibody secreting plasma cells provides an example of a condition in which this approach can be applied.
Lastly, enveloped viruses must use and corrupt this system to ensure production of progeny from infected cells. Viruses often produce vast quantities of viral membrane glycoproteins which are folded and modified in the ER. Therefore, activation of the UPR by the virus for this purpose as a survival mechanism is entirely conceivable. It is therefore logical that inhibition of the UPR during viral infection can impact the outcome of the disease in a beneficial way.
Only specialized secretory cells and diseased cells activate the UPR. for their own benefit. Most cells are not under such protein folding stress and therefore would not be impacted by a UPR inhibitor. Thus, "disorders associated with the UPR" as used herein means conditions for which pathogenesis can be advantageously impacted by inhibition of the UPR. In various embodiments such inhibition of the UPR is accomplished through inhibition of IRE- l a.
In some embodiments the IRE- la inhibitor compounds or prodrugs thereof are useful to treat or ameliorate a symptom of a B cell autoimmune disease, certain cancers, and infections of enveloped viruses that use the endoplasmic reticulum as a viral factory for expressing viral surface and spike proteins for budding and infection. IRE- la inhibitors and prodrugs thereof can be used as single agents or in combination therapies, as described below. [739] B cell autoimmune diseases which can be treated include, but are not limited to,
Addison's disease, antiphospholipid syndrome, aplastic anemia, autoimmune hemolytic anemias, autoimmune hepatitis, autoimmune hypophysitis, autoimmune
iymphoproliferative disorders, autoimmune myocarditis, Churg-Strauss syndrome, epidermolysis bullosa acquisita, giant cel l arteritis, Goodpasture's syndrome. Graves' disease, Guiilain-Barre syndrome, Hashimoto's thyroiditis, idiopathic thrombocytopenic purpura, IgA nephropathy, myasthenia gravis, pemphigus foliaceous, pemphigus vulgaris, polyarteritis nodosa, poiymyositis/'dermatomyositis, rheumatoid arthritis, scleroderma, Sjogren's syndrome, systemic lupus erythematosus, Takayasu's arteritis, and Wegener's granulomatosis.
[740] Cancers which can be treated mclude solid tumors, such as tumors of the breast, bone, prostate, lung, adrenal gland (e.g., adrenocortical tumors), bile duct, bladder, bronchus, nervous tissue (including neuronal and glial tumors), gall bladder, stomach, salivary gland, esophagus, small intestine, cervix, colon, rectum, liver, ovary, pancreas, pituitary adenomas, and secretory adenomas. Methods are particularly useful for treating drug- or radiation-resistant solid tumors.
[741] Cancers of the blood (e.g., lymphomas and leukemias) also can be treated including, but not limited to, multiple myeloma, Hodgkin's lymphoma, non-FIodgkirr s lymphomas (e.g., cutaneous T cell lymphomas such as Sezary syndrome and Mycosis fungoides, diffuse large cell lymphoma, HTLV-1 associated T cell lymphoma, nodal peripheral T cell lymphoma, extranodal peripheral T cell lymphoma, central nervous system lymphoma, and AIDS-related lymphoma). Leukemias include acute and chronic types of both lymphocytic and myelogenous leukemia (e.g, acute lymphocytic or lymphoblastic leukemia, acute myelogenous leukemia, acute myeloid leukemia, chronic myelogenous leukemia, chronic lymphocytic leukemia, T cell prolymphocyte leukemia, adult T cel l leukemia, and hairy ceil leukemia). Monoclonal gammopathy of undetermined significance (MGUS), the precursor of myeloma, also can be treated.
[742] Viral infections which can be treated include infections of enveloped viruses whic use the unfolded protein response pathway when they replicate and form infectious progeny (e.g., measles, pox viruses, Ebola, etc.). Infections also include those of Epstein Ban- vims (EBV), cytomegalovirus (CMV), Flavi viruses (e.g., Japanese Encephalitis Virus and West Nile Virus), and Hepatitis C virus (HCV).
Combination therapies
743] Various types of physiological stress induce the unfolded protein response including, but not limited to, hypoxia, nutrient starvation, acidosis, and genetic damage resulting in mutant or over-expressed misfolded proteins (oncogenic stress). One or more of these conditions are manifest in cancer cells, which may in part be mediated by the
microenviroment of the tumor. It is likely the cytoprotective arm of the unfolded protein response (UPR) plays an anti-apoptotic role in tumor survival. In addition, bio- and chemotherapeutic drugs and thermal and radiation treatments may further impact the protein folding and degradation cycle in the ER thereby inducing the UPR as a protective resistance mechanism. Patients succumb to cancer because either the tumor is resistant to conventional therapies, or returns in a resistant form after an initial response to treatment and, therefore, new treatments and treatment combinations are needed.
744] Angiogenesis inhibitors block tumor growth by inhibiting new blood vessel formation, a process that would enhance the stress effects of the tumor microenvironment. A promising approach to further reduce tumor burden would be to administer anti- angiogenesis agents in combination with IRE-la/XBP-1 inhibitors to obtain a similar effect as that demonstrated by RNAi knockdown of GRP78, the major chaperone of the ER and target ofXBP-ls (Dong et al, Cancer Res. 2007 Jul 15;67(2):6700-7). In addition, IRE-Ια itself regulates angiogensis by influencing the expression of VEGF.
745] In some embodiments an IRE-l a inhibitor compound or prodrug thereof is administered in combination with a therapeutic agent that induces or up-regulates IRE- la expression {e.g., Hsp90 and or HDAC inhibitors, both of which induce IRE-Ια activation and XBP-1 splicing) or a therapeutic agent which is less effective when IRE- la is expressed (e.g., 17-AAG (TANESPIMYCIN® and suberoylaniiide hydroxamic acid (SAHA)). [746] In some embodiments an IRE- la inhibitor compound or prodrug thereof is administered in combination with one or more cancer therapies. These therapies include treatments such as radiation therapy or thermal treatment (heat shock) as well as administration of therapeutic agents, such as chemotherapeutic agents and biotherapeutic agents, as described below. Such therapies can be administered separately or together with the IRE- la inhibitor compound or prodrug, e.g., the one or more treatments can independently be administered at essential ly the same time as the IRE- la inhibitor compound or prodrug or can be administered either before or after the IRE- l a inhibitor compound.
[747] Cancer therapeutic agents which can be used according to various embodiments include, but are not limited to, agents in the following categories (which may overlap): a. proteasome inhibitors, such as bortezomib ([(.l R)-3-methyl-.l -[[(2S)-l-oxo-3- phenyl-2-[(pyrazinylcarbonyl) amino]propyl]amino]butyl] boronic acid; MG-341 ; VELCADE®), MG-132 (N-[(phenylmethoxy)carbonyl]-L-leucyl-N-[(l S)-l- formyl-3 -methy lbuty 1 ] -L- leuci namide); b. cytotoxic anticancer therapeutics , such as: i. pyrimidine analogs (e.g. , 5-fluorouracil, floxuridine, capeeitabme,
gemcitabine and cytarabine); and purine analogs, ii. alkylating agents such as nitrogen mustards (e.g., mechlorethamine,
cyclophosphamide and analogs, melphalan, chlorambucil), ethylenimmes and methy Imel amines (e.g., hexamethylmel amine and thiotepa), alkyl sulfonates-busulfan, nitrosoureas (e.g., carmustine (BCNU) and analogs, streptozocin), trazenes - dacarbazinine (DTIC); iii. microtubule disruptors such as taxane (paclitaxel, docetaxel), vmcristin, vinblastin, nocodazole, epothilones and navelbine, and epidipodophyllotoxins (e.g., tenyposide); natural products such as vinca alkaloids (e.g., vinblastine, vincristine, and vinorelbine); iv. DNA damaging agents, such as actinomycin, amsacrme, anthracyclines, bleomycin, busulfan, camptothecin, carboplatin, chlorambucil, cisplatin, cyclophosphamide, Cytoxan, dactinomycin, daunorubicin, docetaxel, doxorubicin, epirubicin, hexametliylmeiamineoxaiiplatin, iphosphamide, meiphalan, merchlorethamine, mitomycin, mitoxantrone, nitrosourea, paclitaxel, plicamycin, procarbazine, teniposide,
triethylenethiophosphorami.de and etoposide (VP 16); and platinum coordination complexes (e.g., cisplatin, carboplatin), procarbazine, hydroxyurea, mi totane , aminogl u tethi m id e; c. antibiotics, such as dactinomycin (actinomycin D), daunorubicin, doxorubicin (adriamycin), idarubicin, anthracyclines, mitoxantrone, bleomycins, plicamycin (mithramycin) and mitomycin; d. folate antagonists and related inhibitors (e.g., mercaptopurine, thioguanine, pentostatin and 2- chlorodeoxyadenosine [cladribine]); folic acid analogs (e.g., methotrexate) e. hormones, hormone analogs (e.g., estrogen, tamoxifen, goserelin, bicalutamide, nilutamide); f. aromatase inhibitors (e.g. , letrozole, anastrozole); g. fibrinolytic agents (such as tissue plasminogen activator, streptokinase and
urokinase), aspirin, COX-2 inhibitors, dipyridamole, ticlopidine, ciopidogrei, abciximab; h. antimigratory agents; i. antisecretory agents (e.g., breve ldin); immunosuppressives (e.g., cyclosporine, tacrolimus (F -506), sirolirnus (rapamyciti), azathioprine, mycophenolate mofetii); j. anti-angiogenic compounds (e.g., TNP -470, genistein, Sutent, Vatalinib) and growth factor inhibitors (e.g., vascular endothelial growth factor (VEGF) inhibitors, fibroblast growth factor (FGF) inhibitors, epidermal growth factor (EGF) inhibitors); and multi -kinase inhibitors (e.g., lestaurtinib); k. antibodies (e.g., trastuzumab (HE RCEPTI ® ) , AVASTIN®, ERBITUX©);
1. cell cycle inhibitors and differentiation inducers (e.g., tretinoin); m. mTOR (mammalian target of rapamyein) inhibitors (e.g., everolimus, sirolimus); n. topoisomerase inhibitors (e.g., doxorubicin (adriamycin), amsacriiie,
camptothecin, daunorubicin, dactinomycin, eniposide, epirubicin, etoposide, idarubicin, irinotecan (CPT-1 1) and mitoxantrone, topotecan, irinotecan); o. corticosteroids (e.g., cortisone, dexamethasone, hydrocortisone,
methyjpednisolone, prednisone, and prenisolone); p. HSP90 inhibitors (e.g., 17-AAG) q. mitochondrial dysfunction inducers (e.g., 2-deoxygiucose, dichloroacetic acid); r. caspase activators; and s, chromatin disrupters.
In some embodiments the cancer therapeutic agent is selected from the group consisting of alemtuzumab, aminoglutethimide, amsacrine, anastrozole, asparaginase, beg, bevacizumab, bicalutamide, bleomycin, bortezomib, buserelin, busulfan, campothecin, capeeitabme, carboplatin, carmustine, CeaVac, cetuximab, chlorambucil, cisplatin, cladribine, clodronate, colchicine, cyclophosphamide, cyproterone, cytarabine, dacarbazine, daclizurnab, dactinomycin, daunorubicin, dienestrol, diethvlstilbestrol, docetaxel, doxorubicin, edrecolomab, epirubicin, epratuzumab, eriotinib, estradiol, estramustine, etoposide, exemestane, filgrastim, fludarabiiie, fludrocortisone,
fluorouracil, fluoxymesterone, flutamide, gemcitabine, gemtuzumab, genistein, goserelin, huJ591 , hydroxyurea, ibritumomab, idarubicin, ifosfamide, IGN-101 , imatinib, interferon, irinotecan, ironotecan, letrozole, leucovorin, leuprolide, levamisole, lintuzumab, lomustine, MDX-210, mechlorethamine, medroxyprogesterone, megestrol, meiphalan, mercaptopurine, mesna, methotrexate, mitomycin, mitotane, mitoxantrone, mitumomab, nilutamide, noeodazoie, octreotide, oxaliplatin, paclitaxel, pamidronate, pentostatin, pertuzumab, plicamycin, porfimer, procarbazine, raltitrexed, rituximab, streptozocin, sunitinib, suramin, tamoxifen, temozolomide, tenyposide, testosterone, thalidomide, thioguanine, thiotepa, titanocene dichloride, topotecan, tositumomab, trastuzumab, tretinoin, vatalanib, vinblastine, vincristine, vindesine, and vinorelbine.
Inhibition of IRE- 1 a dependent decay of membrane associated niRNAs (RIDD) pathway using IRE- la inhibitors
Inositol requiring enzyme- 1 (IRE- la) is the most highly conserved signaling node of the unfolded protein response (UPR) and represents a potential therapeutic target for a number of diseases associated with endoplasmic reticulum (ER) stress. IRE-Ια activates the XBP-1 transcription factor by site specific cleavage of two hairpin loops within its mRNA promoting its nonconventional splicing and alternative translation. In addition, the endonbonuclease of IRE- l a is required for the cleavage and degradation of certain mRNAs coding for primarily secreted and transmembrane proteins targeted to the ER called RE- la dependent mRNA decay (RIDD). However, it had not been known whether this is a direct activity or the subsequent activation of a second
endoribonuclease. Using IRE- la specific endonbonuclease inhibitors, Examples 43-46 below demonstrate that this activity is l kely direct from the I E- l a endoribonuclease and that inhibitors selectivity block down-regulation of known targets of the RIDD pathway including but not limited to CD59 and Blosl . IRE-! inhibitors therefore be useful to treat or ameliorate a symptom of a neurological disorder, or disorders that involve overproduction of insulin or inflammation.
Protein folding perturbations resulting in endoplasmic reticulum (ER) stress are thought to play a role in the pathogenesis of diseases as diverse as neurodegeneration, diabetes and cancer. The unfolded protein response (UPR) coordinates the ability of a cell to respond to ER stress by altering protein translation, folding, and post translational modification of ail secreted and membrane proteins. Terminally unfolded proteins are retro-transported to the cytosol by the ER associated degradation (ERAD) machinery for proteolysis by the proteasome. The ER is also the site of lipid biosynthesis and membrane expansion. These activities are linked physiologically to specialized secretory cells;
however, depending on stress levels, the UPR can control cellular survival or death via autophagy and apoptosis (Ron & Walter, Nat Rev Mo! Ceil Biol, 8(7), 519-29, 2007), Secretion and membrane composition are balanced by the high caloric demand of these activities against the energy homeostasis of the cell (Ron & Walter, 2007).
[751] Inositol requiring enzyme 1 (IRE- la) is the most highly conserved signaling node of the unfolded protein response (Ron & Walter, 2007). A unique ER. resident transmembrane kinase with a novel C-terminal endoribonuclease domain, IRE- la is activated in part by the disassociatkm of BiP/GRP78 in the presence of unfolded protein in the ER lumen (Ron & Walter, 2007). The signal is transduced to the cytosol by the sequential dimerization/multimerization, trans-autophosphorylation and activation of its
endoribonuclease (Tirasophon et ah. Genes Dev. 14 (21) 2725-36, 2000). The specific activity of the endoribonuclease is responsible for the unconventional cytosolic splicing of HAC1 in yeast and excision of the 26 nucleotide intron of the X-box binding protein (XBP-1) transcription factor in metazoan organisms (Ron & Walter, 2007). In
mammalian cells IRE-1 a acts in concert with companion UPR. signaling molecules PKR- iike ER resident kinase (PERK) and ATF6 (Ron & Walter, 2007).
[752] XBP-1 mRNA, a major substrate of the IRE- la endoribonuclease, is cleaved specifically at two conserved stem-loop sites. Each site is located 3' to a mirrored guanosme residue in the 7 base loop (Ron & Walter, 2007), The resulting internal fragment, a 26-nt intron, is removed and the two exon ends are H ated by and unknown mechanism in mammalian cells and by tRNA ligase in yeast (Ron & Walter, 2007). The rejoined mRNA shifts the Open Reading Frame (ORF) and extends the C-terminal domain of XBP-1 from amino acid 164 with, an alternative 212 amino acid reading frame producing the active "spliced" transcription factor, XBP-ls, which regulates a broad range of ER resident chaperones, ER translocon channels, ERAD components and lipid metabolic enzymes (Ron & Walter, 2007). An emerging and important activity of IRE- la is regulated Ire 1 -dependent decay (RIDD) of mRNAs encoding ER targeted membrane and secreted proteins during stress analogous to the less discriminate but targeted activities of IRE- l a's evolutionary
0^7 homologue, RNase L (Hollien & Weissman, Science 313(5783) 104-07, 2006). This activity in combination with XBP-ls expression has the potential to alter the surface composition of stressed cells and the extracellular proteome. In addition, it appears to selectively target different mRNAs in different types of cells. Substrates include but are not limited to insulin (Ban et al, Cell 138(3) 562-75, 2009), CD59 (Oikawa et a!., Biochem Biophys Res Commun. 360(1) 122-127, 2007), Blosl(Hoilien et al., J Cell Biol 186(3) 323-31, 2009), DGAT2 (Thorpe & Schwarze, Cell Stress Chaperones. 15(5) 497-508, 2010) and IRE-la's own mRNA (Tirasophon et al., 2000). IRE- la endoribonuclease inhibitors selectively block mRNA degradation by IRE- l a including Blosl, DGAT2 and CDS 9 and IRE- la itself.
[753] Example 43 below demonstrates that selective and potent IRE- 1 a endoribonuclease inhibitors disclosed herein can block the RIDD of mRNA targets in both unstressed and ER stressed RPMI 8226 myeloma cells. Diseases linked to ER stress include
neurodegenerative diseases, diabetes, inflammation and cancer. This has important implications for disease management.
[754] For example, CD59 is a GPI linked cell surface glycoprotein which as member of the complement regulatory factor family which includes CD46 and CD55. Compliment regulatory factors inhibit complement mediated lysis of cells by preventing membrane attack complex formation. Down modulation of CD59 may play a role in many diseases with an immune component, such as Barraquer-Sirnons Syndrome, asthma, lupus erythematous, glomerulonephritis, various forms of arthritis, autoimmune heart disease, multiple sclerosis, inflammatory bowel disease, and ischemia-reperfusion inj uries, autoimmune hemocytopenias and rejection of transplanted organs (Song, Autoimmunity 39(5) 403-10, 2006; Ruiz-Argiielles & Llorente, Autoimmun Rev. 6(3): 155-61 , 2007; Arumugam et al, Shock 21(5) 401-06, 2004; Asgari et al, Curr Opin Organ Transplant 15(4):486-91, 2010).
[755] Blosl is a component of endosome-localized Biogenesis of Lysosome-related Organelles Complex-1 (BLOC-1). Alteration of components of this complex are associated with schizophrenia, it is conceivable that down modulation of Blosl (BLOCISI ) due to IRE- l activation by ER stress may impact normal synaptic transmission (Ryder & Faundez, Sci Signal. 2(93): 66, 2009).
756] IRE- la inhibitors disclosed herein (or prodrugs or pharmaceutically acceptable salts of IRE-la inhibitors) can be used to block degradation of Bios 1 mRNA, DGAT2 mRNA, CDS 9 mRNA, and IRE-la mRNA. In some embodiments, a cell comprising an mRNA selected from the group consisting of Blosl mRNA, DGAT2 mRNA, CD59 mRNA, and IRE-l mRNA is contacted with an IRE-la inhibitor or a prodrug or pharmaceutically acceptable salt of an I E-l inhibitor. In some embodiments, the cell is in vitro. In other embodiments, the cell is in vivo.
757] In some embodiments, an IRE-la inhibitor or a prodrug or pharmaceutically acceptable salt of an IRE-la inhibitor is administered to treat Barraquer-Simons Syndrome, asthma, lupus erythematous, glomerulonephritis, various forms of arthritis, autoimmune heart disease, multiple sclerosis, inflammatory bowel disease, and ischemia-reperfusion injuri es, autoimmune hemocytopenias and rejection of transplanted organs.
758] In some embodiments, an IRE-1 a inhibitor or a prodrug or pharmaceutically acceptable salt of an IRE-l inhibitor is administered to treat schizophrenia.
Routes of administration
759] Pharmaceutical preparations constituting embodiments can be administered locally or systemically. Suitable routes of administration include oral, pulmonary, rectal, transmucosal, intestinal, parenteral (including intramuscular, subcutaneous,
intramedullary routes), intranodal, intrathecal, direct intraventricular, intravenous, intraperitoneal, intranasal, intraocular, transdermal, topical, and vaginal routes. As described in more detail above, dosage forms include, but are not limited to, tablets, troches, dispersions, suspensions, suppositories, solutions, capsules, creams, patches, mimpumps and the like. Targeted delivery systems also can be used (for example, a liposome coated with target-specific antibody). Dosage
760] A pharmaceutical composition embodiment comprises at least one active ingredient (an IRE- la inhibitor compound or prodrug thereof) in a therapeutically effective dose. A "therapeutically effective dose" is the amount of an IRE-Ια inhibitor compound or prodrug thereof which, when administered to a patient over a treatment period, results in a measurable improvement in survival time and/or quality of life. Such improvements include, for example, a delay or halt in the progression of a cancer, partial or complete regression, reduced severity of one or more existing symptoms, delay or prevention of the development of one or more symptoms, and one or more improved laboratory values (including, but not limited to, a biological marker e.g., XBP-1 splicing and down stream targets such as EDEM, VEGF-A, ERdj4). Various methods and assays can be used to assess whether and to what extent an improvement occurs.
761] Determination of therapeutically effective doses is well within the capability of those skilled in the art. A therapeutically effective dose initially can be estimated from in vitro enzyme assays, cell culture assays, and/or animal models. For example, a dose can be formulated in an animal model to achieve a circulating concentration range at least as concentrated as the IC50 as determined in an in vitro enzyme assay or in a cell culture (i.e. , the concentration of the test compound which achieves a half-maximal inhibition of IRE- la activity). Such information can be used to more accurately determine useful doses in humans. See the FD A guidance document "Guidance for Industry and
Reviewers Estimating the Safe Starting Dose in Clinical Trials for Therapeutics in Adult Healthy Volunteers" (HFA-305), which provides an equation for use in calculating a human equivalent dose (HED) based on in vivo animal studies.
62] Appropriate animal models for the relevant diseases are known in the art. See, e.g.,
Lupus. 1996 Oct;5(5b):451-5 (antiphospholipid syndrome); Blood. 1974 Jul;44(l):49-56 (aplastic anemia); Autoimmunity. 2001 ;33(5):265-74 (autoimmune hypophysitis);
Methods. 2007 Jan;41(l):l 18-22 (autoimmune myocarditis); Clin Exp Rheumatol. 2003 Nov-Dec;2! (6 Suppl 32):S55-63 (Churg-Strauss syndrome, Wegener's granulomatosis); J Clin invest. 2005 Apr;l 15(5):870-8 (epidermolysis bullosa acquisita); Circulation. 2005 Jun 14;1 1 1(23):3135-40. Epnb 2005 Jun 6 (giant cell arteritis; Takayusu's arteritis); Int J Immunopathol Pharmacol 2005 Oct-Dec;18(5):701-8 (IgA nephropathy); Vet Rec. 1984 May 12; 114(19):479 (pemphigus foliaceous); J. Neuroimmunol. 98, 130-35, 1999 (polymyositis); Am. J. Pathol. 120, 323-25, 1985 (dermatomyositis); Cell. Mol. Immunol. 2, 461-65, 2005 (myasthenia gravis); Arthritis Rheum. 50, 3250-59, 2004 (lupus eiythymatosus); Clin. Exp. Immunol. 99, 294-302, 1995 (Grave's disease); J. Clin. Invest. 116, 961 -973, 2006 (rheumatoid arthritis); Exp Mol Pathol. 77, 161 -67, 2004
(Hashimoto's thyroiditis); Rheumatol. 32, 1071-75, 2005 (Sjogren's syndrome); Brain Pathol. 12, 420-29, 2002 (Guillain-Barre syndrome); Vet. Pathol. 32, 337-45, 1995 (polyarteritis nodosa); Immunol. Invest. 5,47-61, 2006 (pemphigus vulgaris); Arch.
Dermatol. Res. 297, 333-44, 2006 (scleroderma); J. Exp. Med. 191, 899-906, 2000 (Goodpasture's syndrome); Clin. Exp. Immunol. 99, 294-302, 1995 (Grave's disease); ./. Clin. Invest. 91, 1507-15, 1993 (membranous nephropathy); J. Immunol. 169, 4889-96, 2002 (autoimmune hepatitis); Surgery 128, 999-1006, 2000 (Addison's disease); Eur. J. Immunol. 32, 1147-56, 2002 (autoimmune hemolytic anemia); and Haematologica 88, 679-87, 2003 (autoimmune thrombocytopenic purpura).
I.D50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population) can be determined by standard pharmaceutical procedures in cell cultures and/or experimental animals. Data obtained from cel l culture assays or animal studies can be used to determine initial human doses. As is known in the art, the dosage may vary depending upon the dosage form and route of administration used.
Usual dosages for systemic administration to a human patient range from 1 ,u.g/kg to 100 mg/kg (e.g., 1-10 lig/kg, 20-80 fig/kg, 5-50 fig/kg, 75-150 fig/kg, 100-500 μ& ¾, 250- 750 fig/kg, 500-1000 μ , 1 -10 mg/kg, 5-50 mg/kg, 25-75 mg/kg, 50-100 mg/kg, 5 mg/kg, 20 mg/kg, or 50 mg/kg). In some embodiments, the treatment schedule can require that a plasma concentration of an IRE- l a inhibitor compound be maintained for a period of time (e.g., several days or a week) and then allowed to decay by ceasing administration for a period of time (e.g., 1, 2, 3, or 4 weeks). The amount of composition administered wi ll, of course, be dependent on the subject being treated, on the subject's weight, the severity of the disorder, the manner of administration and the judgment of the prescribing physician.
[765 The following specific exampl es are provided for purposes of illustration only and are not intended to limi t the scope of the subject matter described above.
EXAMPLES
[76 The analytical LC/MS method used in Examples 1-20 employed an A gilent 1200 with Variable Wavelength detector extracted at 220 nm and Agilent 6140 Single quadrupole mass spectrometer. The HPLC column was a Zorbax 8B-C18, 3.5 μτη, 2.1 mm x 30 mm, maintained at 40 °C. The HPLC Gradient was 0.4 niL/min, 95:5:0.1
water: acetomtrile: formic acid for 0.1 min then to 5:95:0.1 water: acetoiiitrile: formic acid in 3.9 min, maintaining for 0.5 min.
EXAMPLE 1
7~Hydrox -l, 2, 3, 4~tetrahydro-isoquinoline-6-carbaldehyde hydrobromide
Figure imgf000258_0001
To a stirred suspension of 7-methoxy-l 52,354-tetrahydroisoqumoline-6-carbaldehyde hydrochloride (91 mg, 0.40 mmol) in anhydrous CH2C12 (5 mL) boron tribromide (0.42 g, 1.68 mmol) was added under argon at -78 °C. The reaction was stirred for 1 h, allowed to warm to room temperature and stirred for 2 h. After addition of isopropanol and diethyl ether the precipitated product was collected and washed with ether. In this manner the title compound (79 mg, 0.31 mmol, 77.5%) was obtained as a pink powder. LCMS /BB LCMS0 !(+)/: M+I= 178, Rt: L331 min.
[768] !H NMR (400 MHz, DMSO-< 6) δ ppm 10.65 (s, 1H), 10.23 (s, 1H), 9.07 (br. s., 2H), 7.52 (s, H i ). 6.84 (s, H i ). 4.30 (s, 2H), 3.34 - 3.40 (m, 21 Π. 2.95 (t, ./ = 6.3 Hz, 2H). [769] The following compounds (includes title compound) were made by the above procedure:
Figure imgf000259_0001
EXAMPLE 2
6-Hydroxy-2-(pyndine-3-carbonyl)-l,2 A-tetrahydro soquim
Figure imgf000259_0002
To a solution of 6-methoxy-2-(pyridine-3-carbonyl)-l,2 ,4-tetrahydro-isoquinoline-5- carbaldehyde (62 mg, 0.21 mmol) in dichloromethane (5 mL) stirred under argon at -78 °C was added boron tri.bromi.de (0, 12 mL, 0.31 g, 1 ,25 mmol). The reaction was stirred for 1 h, allowed to warm to room temperature and stirred for 2 h. The reaction was quenched by addition of methanol (2 ml.) at -78 °C and the mixture was stirred for 1 h. After warming to room temperature, ethyl acetate (3 mL) and diethyl ether (30 mL) wrere added, upon scratching the product started to precipitate. The mixture was allowed to stand refrigerated overnight, the product was collected, washed with ethyl acetate and dried over P205 to give the title compound (48 mg, 0.13 mmol, 61.9%) as a beige powder.
LCMS /BB LCMS0K+)/: M+l= 283, Rt: 2.668 min. [772] !H NMR (400 MHz, DMSO-i e) δ ppm 11.16 (br. s., I I f 10.42 (s, IH), 8.97 (s, IH), 8.91 (dd, J ------ 5.4, 1.1 Hz, IH), 8.42 (br. s., I H), 7.94 (dd, J ------ 7.9, 5.6 Hz, I H), 7.33 (br. s., IH), 6.87 (br. s., IH), 4.63 (br. s., 2H), 3.55 (br. s., 2H), 3.21 (br. s., 2H).
773] The following compounds (includes title compound) were made by the above procedure:
Figure imgf000260_0001
Figure imgf000261_0001
Figure imgf000262_0001
* During O-demethylation. the N-Boc protecting group of the precursor was also removed. EXAMPLE 3
6-Hydroxy-2-(pyridine-3-carbonyl)-l,2 -teirahydro so
Figure imgf000263_0001
[774] To a stirred suspension of 6-hydroxy- 1 ,2,3 ,4-tetrahydro-isoquinoline-7-carbaldehyde hydrobromide ( 129 mg, 0.5 mmol ) and nicotinoyl chloride hydrochloride (107 mg, 0.6 mmol) in 1 ,2-dichloroethane (6 niL), ethyldiisopropyl amine (259 μΕ, 194 mg, 1.5 mmol) was added and the mixture was stirred at room temperature for 3 h. After dilution with 1 ,2-dichloroethane (30 niL) the mixture was washed with water (3 x 5 mL). After drying over MgS04 and concentration the title compound (99 mg, 0.35 mmol, 70 %) was obtained.
[775] LCMS /BBJXMSOl(-)/: M+l = 281, Rt: 2.592 min.
[776] 5 H NMR (400 MHz, DMSO-</6) δ salt, 2 sets of signals A and B in ratio of 55 :45 ppm
10.58 (br. s., 1H, A+B), 10.20 (br. s., 0.55H, A), 10.12 (br. s., 0.45H, B), 8.67 (br. s., 2H, A+B), 7.88 (br. s., 1H, A-t-B), 7.57 (br. s., Q.55H, A), 7.49 (dd, J=7.8, 4.8 Hz, 1 H, A+B), 7.36 (br. s., 0.45H, B), 6.81 (s, 1H, A+B), 4.73 (br. s., 1.1H, A), 4.54 (br. s., 0.9H, B), 3.82 (br. s., 0.9! i. B), 3.53 (br. s., 1.1H, A), 2.89 (br. s., 21 L A+B).
Figure imgf000263_0002
EXAMPLE 4
6-Hydroxy-2-[3-(4-mel yl-piperazin-l-yi)
carhaidehyde
Figure imgf000264_0001
[777] To a stirred mixture of 6-iiydroxy-l,2,3,4-tetrahydro-isoquiiioliiie-7-carbaidehyde
hydrobromide (82 mg, 0.46 mmol ) and triethylamine (322 μΕ, 234 mg, 2.3 mmoi) in anhydrous tetrahydrofuran (2 mL), 3-(4-methyl-piperazin-l-yl)-pro ionie acid (80 mg, 0.46 mmol), (3-dimethylamino-propyl)-ethyl-carbodiimide hydrochloride (98 mg, 0.51 mmol) and 1 -hydroxybenzotnazole (69 mg, 0.51 mmol) were added in the above order and the mixture was stirred at room temperature for 7 h. A fter evaporation, the residue was taken up in chloroform (10 mL) and washed with sat NaHC03 (2 x 5 mL) and brine (5 mL). The organic phase was dried over MgS04 and evaporated. The obtained crude product (94 mg) was purified by column chromatography on silica gel, eluting with CHC MeGH 94/6 mixture. In this manner the title compound (33 mg, 0.10 mmol, 21 %) was obtained.
[778] LCMS /BB_LCMS02(+)/: M+l- 332, Rt: 1.86 min.
[779] Ί-Ϊ MR (400 MHz, DMSO-< 6) δ ppm 10.47 (br. s., 1 H), 10.18 (s, 1 I I ). 7.51 (s, 1 H), 6.85 (s, 1 H), 4.59 (s, 2 H), 3.67 (t, J=6.0 Hz, 2 H), 3.49 (s, 2 H), 2.87 (br. s., 10 H), 2.71 (s, 3 H).
[780] The following compounds (includes title compound) were made by the above procedure: LCMS LCMS NMR
Made LCMS
EXAMPLE Structure LC S method Rt purity purity
From ion
(min) (%) " (%)
4-1 1-2 BB_LCMS02(+) 332 1.860 97 98
4-2* 1-2 BB_LCMS01(+) 318 1.912 100 98
Figure imgf000265_0001
isolated from EtOAc with HCl/EtOAc EXAMPLE 5
6-Methoxy-l,2,3,4-tetrahydro-isoquinoline-5- and 7-carbaldehydes
Figure imgf000265_0002
Step A
5-Formyl-6-methoxy-3,4-dihydro-lH-isoqumoline-2-carboxylic acid tert-butyl ester and 7formyl-6-methoxy-3,4-dihydro-IH-isoquinoUne-2-carboxylic acid tert-butyl ester (HI-227d and HI-227i)
To dichloromethane (80 mL) at 0 °C, titanium tetrachloride (8.8 mL, 15.2 g, 80 mmol) and then dichlororaethyl methyl ether (7.2 mL, 9.2 g, 80 mmol) were added dropwise followed by the addition of 6-methoxy- 1 ,2,3, 4-tetrahydro-isoquinoline hydrochloride (4.0 g, 20 mmol) in small portions and the mixture was stirred at 0 °C for 3 h. The reaction was quenched by slow addition of 2 N HCl (50 mL) and the layers were separated. The organic layer was extracted with 1 N HCl (2 x 10 mL) and the combined acidic aqueous layers were washed with dichloromethane (1 x 20 mL). Dichloromethane (100 mL) was added to the aqueous layers and the pH of the two-phase mixture was adjusted to 10 with 10 N NaOH (70 rnL) under ice cooling. After addition of di-tert-butyl dicarbonate (4.8 g, 22 mmol) the mixture was stirred overnight. The reaction was diluted with
dichloromethane (120 mL) and water (200 mL), the aqueous layer was separated and extracted with dichloromethane (2 x 100 mL), The combined organic layers were washed with water (3 x 150 rnL), dried over MgS04 and concentrated. The residual oil was chromatographed on silica (200 g), eluting first with a 8: 1 mixture of n-hexane and ethyl acetate, followed by a 4: 1 mixture and finally with a 2: 1 mixture of the same solvents. By combining the appropriate fractions, concentration and trituration of the residues with n- hexane first 5-formyl-6-methoxy-3,4-dihydro-lH-isoquinoline-2-carboxylic acid tert- butyl ester (1.72 g, 5.9 mmol, 29.5%) and then 7-formyl-6-raet'hox.y-3,4-dihydro-lH- isoqumolme-2-carboxylic acid tert-butyl ester (2.88 g, 9.9 mmol, 49.5%) were obtained as colorless solids.
[782] 5a-l : LCMS , BB LCMSO !(+)/: VI · 1 = 236, Rt: 3.955 min,
[783] 5a-2: LCMS /BB _LC S01(+)/:M+l = 236, Rt: 3.811 min,
[784] The following compounds (includes title compound) were made by the above procedure:
Figure imgf000266_0001
Figure imgf000267_0001
insepara e m xture Ste B
6-Hydroxy-l, 2, 3, 4-tetrahydro-isoquinoline-5-carbaldehyde hydrochloride
[785] To 5-formyl-6-methoxy-3,4-dihydro-lH-isoqumoline-2-carboxylic acid tert-butyl ester (1.41 g, 4.84 mmol) in ethyl acetate (10 mL), a 3.3 M solution of anhydrous HCI in ethyl acetate was added and the mixture was stirred at room temperature for 2 h. The precipitated product was collected, washed with ethyl acetate and dried in air. In this manner the title compound (1.03 g, 4.52 mmol, 93.4%) was obtamed as a white powder.
[786] LCMS BB i.C.'viSO K · } : M+l = 192, Rt: 0.654 min,
[787] The following compounds (includes title compound) were made by the above procedure:
Figure imgf000267_0002
EXAMPLE 6
6-Methoxy-2-(p)mdine-3-CMrbo
Figure imgf000268_0001
To a stirred suspension of 6-methoxy-l ,2,3,4-tetrahydro-isoqurnoline-5-carbaidehyde hydrochloride (91 mg, 0.4 mmol) and nicotinoyl chloride hydrochloride (89 mg, 0.5 mmol) in 1 ,2-dichloroethane (6 mL) diisopropyleth ί amine (261 ,uL, 194 rng, 1 .5 mmol) was added and the mixture was stirred at room temperature for 3 h. After dilution with 1 ,2-dichloroethane (30 mL) the mixture was washed sequentially with water (5 mL), 1 N aqueous NaOH (5 mL) and again with water (3 x 5 mL). After drying over MgSO,¾ and concentration, the title compound (1 10 mg, 0.38 mmol, 95%) was obtained as a beige solid.
[789] LCMS /BBJLCMSOl (+)/: M+l = 297, lit: 2.792 min.
[790] The following compounds (includes title compound) were made by the above procedure:
Figure imgf000268_0002
-4 5-3 BB_LCMS01(+) 297 2.738 93 n/a o
-5 5-3 BB_LCMS01(+) 332 3.667 98.5 n/a
Figure imgf000269_0001
-6 5-4 BB LCMSOi (-f ) 297 2.807 98,2 n/a
EXAMPLE 7
6-Methoxy~2-[ 3-(4-methyl-piperazin-l-yl)-propionyl J- 1, 2, 3, 4-tetrahydro~isoquinoline~5- carhaldehyde
Figure imgf000269_0002
To a stirred mixture of 6-methoxy-l ,2,3,4-tetrahydro-isoquvnoline-5-carbaidehyde hydrochloride (153 mg, 0.67 mmol) and triethylamine (447 LIL, 324 mg, 3.2 mmol) in anhydrous tetrahydrofuran (8 mL) 3-(4-m.ethyl-piperazin-l-yl)-propionic acid (172 mg, 1.0 mmol), (3-dimethylaminopropyl)-ethyl-carbodiimide hydrochloride (192 mg, 1.0 mmol) and 1-hydroxy-benzoiriazoie (135 mg, 1.0 mmol) were added in the above order and the mixture was stirred at room temperature for 3 h. After dilution with ethyl acetate (20 mL) the mixture was washed with 1 N aqueous NaOH (3 x 5 mL) and water (3 x 5 mL) and then the product was extracted into 1 HC1 (3 x 5 mL). The aqueous acidic layer was rendered alkaline (pH = 10) with 10% aqueous NaOH and extracted with ch oroform (3 x 10 mL). The combined chloroform layers were washed with water (3 x 5 mL), dried over MgS04 and concentrated. In this manner the title compound (206 mg, 0.60 mmol, 89.6%) was obtained as a yellow oil.
LCMS /BB_LCMS01 (+)/: M+l = 346, Rt: 2.085 min. [793] The following compounds (includes title compound) were made by the above procedure:
Figure imgf000270_0002
EXAMPLE 8
5-Formyl-6-methoxy-3,4-dihydro-lH-isoquinoline-2-carboxylic acid (2-morpholin-4-yl- ethyl -amide
Figure imgf000270_0001
Step A
2-(Imidazole- 1 -carbonyl)-6~methoxy~l, 2, 3, 4-tetrahydro~isoquinoline-5~carbaldehyde
[794] To a solution of freshly dried di-imidazol-l-yl-methanone (276 mg, 1.7 ramoi) in
anhydrous tetrahydrofuran (20 mL) the solution of 6-methoxy- 1 ,2,3, 4-tetrahydro- isoquinoline-5-Garbaldehyde (325 mg, 1 .7 mmol) in anhydrous tetrahydrofuran (10 mL) was added and the mixture was stirred at 80 °C oil bat for 14 h. The solution was concentrated and the residue was dissolved in dichloromethane, washed with water (2 x 10 mL), dried over MgSC>4 and concentrated. In this manner the title compound (426 mg, 1.50 mmol 88.2%) was obtained as a brownish yel low foam.
|795] LCMS P> E .CViSO H · } : M+l= 286, Rt: 2.524 min.
[796] The following compounds (includes title compound) were made by the above procedure:
Figure imgf000271_0001
Ste B
3-(5-Fomiyl-6-methoxy-3,4-dihydro-lH-isoqumoUne-2-carbonyl)-l-m
1-iuni iodide
797] A mixture of 2-(imidazole-l-carbonyl)-6-methoxy-l ,2,3,4-tetrahydro-isoquinoline-5- carbaldehyde (426 mg, 1.50 mmol) and methyl iodide (475 uL, 1.05 g, 7.6 mmol) in anhydrous acetonitrile ( 10 mL) was stirred at room temperature for 24 h. After evaporation of the solvent the title compoimd (640 mg, 1 ,50 mmol, 100%) was obtained as a brownish foam.
798] LCMS /BBJLCMSOl (+)/: M+l = 300, lit: 2.251 min.
799] The following compounds (includes title compoimd) were made by the above procedure: LCMS LCMS NMR
Made LCMS
EXAMPLE Structure LCMS method Ri purity purity
From Ion
(min) (%) ' (%)
8b- 1 8a- 1 BB__ LCMS01(-i-) 300 2.251 92.2 n/a
Figure imgf000272_0001
8b-2 8a-2 BB_LCMS0I(÷) 300 2.103 82.4 n/a o 1
Step C
5-Formyl-6-methoxy-3,4-dihydro-lH-isoquinoline-2-carbo^lic acid (2-morpholin-4-yl- ethyl -amide
80Θ] A mixture of 3-(5-formyl-6-methoxy-3,4-dihydro-l H-isoqumoline-2-carbonyi)-l-rnethyl- 3 H-imidazol-l-ium iodide (321 mg, 0.75 mmol), 2-(moi-pholin-4-yl)-ethylamine (99.5 μΤ, 99.5 mg, 0,75 mmol) and triethylamine (106 .uL, 76 mg, 0.75 mmol) in anhydrous dichloromethane (10 mL) was stirred at room temperature for 24 h. After dilution with dichloromethane (10 mL), the solution was washed with brine (2 x 5 mL), dried over MgS04 and concentrated. The residue was purified by column chromatography over silica, eluting with a 9: 1 mixture of chloroform and methanol. In this manner the title compound (154 mg, 0.44 mmol, 58.7%) was obtained.
801] LCMS /BBJLCMS01(+)/: M+l= 348, Ri: 2.343 min.
802] The following compounds (includes title compound) were made by the above procedure:
LCMS LCMS NMR
Made LCMS
EXAMPLE Structure LCMS method Rt purity purity
From Ion
(min) (%) (%)
8-1 8b- 1 BB_LCMS01(÷) 348 2.343 98.7 n/a o l^o 8-2 8b- ί BB_LCMS01(÷) 318 2.403 100 n/a
Figure imgf000273_0001
8-3 8b-2 BB_LCMS0I(÷) 348 2.336 96 t n/a
8-4 8b-2 BB_LCMS01(+) 318 2.258 96 n/'a
EXAMPLE 9
2-Benzyl-6-methoxy- 1, 2, 3, 4-tetrahydro~isoquinoline~ 7-carbaldehyde
Figure imgf000273_0002
To a mixture of 6-methoxy- 1 ,2,3 ,4-tetrahydro~isoqumol.me~7-carbaldehyde h.y drochl.ori.de (1 14 mg, 0.5 mmol ) and freshly dried 2C03 (173 mg, 1.25 mmol) in anhydrous dimemylformamide (5 mL), benzyl chloride (69 fiL, 76 mg, 0.6 mmol) was added and the mixture was stirred at room temperature for 24 h. The mixture was poured into water (25 mL) and extracted with diethyl ether (3 x 10 mL). The combined organic layers were washed with brine (3 5 mL), dried over MgS04 and concentrated. The title compound (1 12 mg, 0.40 mmol, 80%) was obtained as a yellow oil.
LCMS BB i .C.VISO H · } : M+l= 282, Rt: 2.415 min.
[805] The following compounds (includes title compound) were made by the above procedure:
LCMS LCMS NMR
Made LCMS
EXAMPLE Structure LCMS method Rt purity purily
Frorn Ion
(min) (%) '(%) "
9-Ϊ 5-2 BB_ LCMS01 + ) 282 2.430 95 n/a -2 5-! BB_LCMS01(÷) 282 2.538 67.3 jv'a
Figure imgf000274_0001
-3 5-3 BB_LCMS01(÷) 282 2.436 82.9 jv'a
EXAMPLE 10
6-MethOxy-2-[4-methyl-5-(morphOline-4-carbonyl)-thiazol-2-yl]- isoquinoline-5-carbaldehyde
Figure imgf000274_0002
Step A
(2-Chloro-4-methyl-thiazol-5-yl)-morpholm-4-yl-methanone
A mixture of 2-bromo-4-methyl-thiazole-5-carboxylic acid (1.11 g, 5.0 mmol) and thionyl chloride (11 mL, 18.2 g, 0.153 mol) was heated under reflux for 30 min. After cooling, the volatiles were evaporated, followed by addition and evaporation of three 10 mL portions of toluene. A sample of the residue was treated with methanol and the obtained methyl ester was shown to be the 2-chlorothiazoie compound [LCMS
/BB LCMSO !(+)/: M+l= 192, Rt: 3.424 min] indicating that the product (0.91 g, 4.7 mmol, 95 %) was 2-chloro-4-methyl-thiazole-5-carbony]. chloride.
To a solution of the above acid chloride (200 mg, 1.02 rnmol) in dichloromethane (5 mL) at 0 °C, a mixture of morphoiine (88 μΐ., 89 mg, 1.02 mmol) and diisopropylethylamine (148 μΐ., 124 mg, 1.03 mmol) in dichloromethane (3 mL) was added drop wise and the reaction mixture was stirred at room temperature for 1 h. After dilution with dichloromeihane (20 mL) the solution was washed with water (2 x 5 mL), dried over MgS04 and evaporated to yield the title compound (208 mg, 0.84 mmoi, yield: 82% calculated from the starting acid chloride) as a yellow oil.
LCMS /BB_LCMS0 !(+)/: M+l= 247, Rt: 2,534 min. 8Θ9] The following compounds (includes title compound) were made by the above procedure:
Figure imgf000275_0001
Step Af
2-Bromo-4-methyl-thiazole-5-carboxylic acid (l-methyl-piperidin-4-yl)-amide
[810] To a stirred mixture of l-methyl-4-ammopiperidme (125 iL, 1 14 mg, 1 mmoi) and
triethylamine (570 μΐ., 414 mg, 4.1 mmoi) in anhydrous tetrahydrofuran (10 mL), 2- bromo-4-methyl-thiazole-5-carboxylic acid (266 mg, 1.2 mmoi), (3- dimethylammopropyl)-ethyl-carbodiimide hydrochloride (232 mg, 1 ,2 mmoi) and 1- hydroxy-benzotriazole (164 mg, 1.2 mmoi) were sequential!)' and the mixture was stirred at room temperature for 22 h. After dilution with dichloromeihane (20 mL), the mixture was washed with water (3 x 10 mL), dried over MgS04 and concentrated. In this manner the title compound (277 mg, 0.87 mmoi, 87%) was obtained as a yellow solid.
[811] LCMS BB i.C.VISO H · } : M+l= 318, Rt: 1.102 min.
[812] The following compounds (includes title compound) were made by the above procedure: LCMS LCMS NMR
Made LCMS
EXAMPLE Structure LCMS method Rt purity purity
From Ion
(mill) (%) (%)
10a -3 - K"VCr BB_LCMS01(+) 318 1.102 96.8 a/a
Ϊ Oa-4 - BB LC SOi(-r) 348 3,620 93.8 n/a
10a -5 - BB_LCMS01(+) 304 0.555 99.1 a/a
10a-6 - BB_LCMS01(÷) 290 0.492 100 n/a
Figure imgf000276_0001
Ste B
6-Methoxy-2-[ 4-methyl-5-(morpholine-4-carbonyl)-thiazol-2-yl]-l, 2, 3, 4-tetrahydro- isoquinoline-S-carbaldehyde
A. mixture of 6-meth.oxy-l,2,3,4-tetrah.ydro-isoquinoime-5-carba3.deh.yde hydrochloride (82 mg, 0.36 mjmol), anhydrous dimethylformami.de (5 mL), (2-chloro-4-methyl-thiazol- 5-yl)-morpholin-4-yl-methanone (89 mg, 0.36 mmol) and freshly dried potassium carbonate ( 149 mg, 1.08 mmol) was stirred under argon at 120 °C for 3.5 h and then at 150 °C for 1 h. Water (20 mL) was added and the separated solid product was filtered off. The filtrate was extracted with diethyl ether (5 10 mL) and the combined extracts were washed with water (2 x 10 mL), dried and concentrated. The residue and the above solid product were combined and triturated repeatedly with diisopropyl ether. In this manner the title compound (37 mg, 0.092 mmol, 26%) was obtained as a beige powder.
LCMS P> E.CViSO H · } : M+l= 402, Rt: 3.129 min.
The following compounds (includes title compound) were made by the above procedure:
Figure imgf000277_0001
Figure imgf000278_0001
EXAMPLE 11
4~(7~Formyl~6~methoxy~3 ~dihydro~lH soquinolin~2-yl)~benzamide
Figure imgf000278_0002
Step A
4-(7-FormyU6-methOxy-3 'dihydro-lH soquimlin-2-yl)-benz
[816] A mixture of 6-methoxy-l,2,3,4-tetrahydro-isoqumoline-7-carbaldehyde hydrochloride (1.0 g, 4.39 mmol), l-fl.uoro-4-methyl -benzene (2.42 g, 20.0 mmol) and freshly dried ·.( '()< (3.0 g, 21.7 mmol) in anhydrous dimethylformamide (11 mL) was stirred under nitrogen at 130 °C for 6 h. The mixture was poured into water (50 mL) and extracted with ethyl acetate (3 x 50 mL). The organic extracts were dried over MgS04 and evaporated. The residue was purified by column chromatography over silica by eluting with a 2: 1 mixture of n-hexane and ethyl acetate. In this manner the title compound (0.45 g, 1.54 mmol, 35.1%) was obtained.
LCMS LCMS NMR
Made LCMS
EXAMPLE Structure LCMS method Rt purity purity
From Ion
(min) (%) (%) '
1 1a - BB_LCMS01(÷) 293 3.828 100 n/a Step B
4~(5-Fo}myl~6~methoxy~3,4~dihydro-lH~isoquinolin-2-yl)-benzamid^
817] A mixture of 4-(7-formyl-6-methoxy-3,4-dihydro-lH-isoquinolin-2-yl)-benzonitri.ie (200 mg, 0.68 mmol) and 96% (w/w) sulfuric acid (3 mL) was stirred at room temperature overnight. The next day poured onto ice-water (10 mL), the pH was adjusted with K2C03 to 9 and the mixture was extracted with ethyl acetate. The residue was purified by column chromatography over silica, elating with a 95:5 mixture of chloroform and methanol. In this manner the title compound (85 mg, 0.27 mmol, 39.7%) was obtained as a solid.
Figure imgf000279_0002
EXAMPLE 12
6-Methoxy-2-[2-(4-methyl^ipera∑in-l-yl)-thiazole-5-carbon^
isoquinoline-5-carbaldehyde
Figure imgf000279_0001
Step A
2~(2-Bromo-thiazole-5-carbonyl)-6~methoxy-l, 2, 3, 4~tetrahydro-isoquinoline-5- carbaldehyde
To a mixture of dry tetrahydrofuran (20 mL) 6-Methoxy- 1 ,2,3,4-tetrahydro-isoquinoline- 5-carbaldehyde hydrochloride (683 mg, 3.00 mmol), and triethyi amine (2.1 mL, 1.52 g, 15 mmol), 2-bromothiazole-5-carboxylic acid (655 mg, 3.15 mmoi), 1- hydroxybenzotriazole (446 mg, 3.30 mmoi) and l-etbyi-(3-dimethylaminopropyl)- carbodiimide hydrochloride (634 mg, 3.30 mmoi) were added sequentially. The mixture was stirred at room temperature for 2 h and the resulted yellow suspension was evaporated and partitioned between chloroform (30 mL) and 0.1N HQ ( 15 mL). The organic layer was separated and washed with saturated sodium bicarbonate (15 mL) and brine ( 15 mL). The organic phase was dried, evaporated and purified by column chromatography (Kieselgel 60), with chloroform as the eluent. The title compound (600 mg, 1.57 mmol, 53%) was isolated as a solid.
Figure imgf000280_0001
Step B
6-Methoxy-2-[ 2-(4-methyl-piperazin- 1 -yl)-thiazole-5-carbonyl]-l , 2, 3, 4-tetrahydro- isoquinoline-5-carbaldehyde
[819] To a solution of 2~(2-Bromo-thiazole-5-carbonyl)-6~methoxy-l,2,3,4-tetrahydro~
isoqumoiine-5-earhaldehyde (229 mg, 0.60 mg) in abs. N,N-dimethylformamide (4 mL), N-methyl piperazine (133 tuL, 120 mg, 1.20 mmol) and dry potassium carbonate (248 mg, 1 ,80 mmoi) was added. The resultant mixture was stirred under nitrogen at 100 °C for 2 h iri a closed vial. The reaction was cooled, water (10 mL) was added, and the resultant solution was extracted with ethyl acetate (3 x 15 mL) The combined organic layers were dried (MgS04) and evaporated to afford title compound (92 mg, 0.23 mmol, 38%) as a pale yellow crystalline solid.
Figure imgf000281_0002
EXAMPLE 13
7-Hydroxy-3-[4-methyl-5-(4-methyl^iperazine-l-carbonyl)-tM
chromene-8-carbaldehyde
Figure imgf000281_0001
[820] A mixture of 7-hydroxy-3-[4-methy!-5-(4-methy 1-piperazine- 1 -carbonyl .)-thiazol-2-yl]- chrometi-2-one (156 mg, 0.40 mmol) and hexamethy lenetetramine (224 mg, 1.6 mmol) in trifluoroacetic acid (4 mL) was stirred in a closed vial under argon at 1 10°C for 40 min. After cooling water (15 mL) was added and the mixture was extracted with
dichloromethane (3 x 5 mL). The combmed organic extracts were washed with water (3 x 5 mL), dried over MgS04 and concentrated. The obtained crude product (83 mg) was purified by column chromatography over silica, e luting with a 9:1 mixture of chloroform and methanol. In this manner the title compound (30.5 mg, 0,074 mmol, 18.5%) was obtained as a yellow solid. [821] LCMS /BB_LCMS01(+)/: M+l= 414, Rt: 3.085 min.
[822] !H NMR (400 MHz, DMSO- ) δ ppm 10.41 (s, IH), 8.86 (s, IH), 7.97 (d, ,/ 9.0 Hz, 1H), 6.83 {d, J ------ 9.0 Hz, I H), 3.59 (br. s., 4H), 2.55 - 2.64 (m, 4H), 2.41 (s, 3H), 2.38 (s,
Mi).
[823] The following compounds (includes title compound) were made by the above procedure:
Figure imgf000282_0001
Figure imgf000283_0001
-16 55977-10-1 BB_LCMS01(-) 281 3.453 95 n/a -17 19a-l BB_LCMS01(-) 344 3.844 90 95 -18 19a-2 BB_LCMS01(-) 358 3.948 97 96 -1 9 20-2 BB LCMSOl(-r) 444 3.124 100 98 -20 20-3 BB_LCMS01 (+) 428 3.033 100 94
Figure imgf000284_0001
-21 20-5 BB_LCMS07(+) 400 99 98
Y_N -22 21 -1 BB_ LCMS01 (+) 401 3.359 96 95
Figure imgf000284_0002
-23 22-1 BB_LCMS01(-) 311 3.290 100 98 ί3-24 22-2 BB_LCMS0J (-) 299 3.4 ί9 99 98
13-25 22-3 BB_LCMS01(-) 3 [5 3.229 79 n/a
Figure imgf000285_0001
EXAMPLE 14
[4-(6-Hydroxy-benzothiazol-2-yl)-phenyl]-(4-methyl^^
Figure imgf000285_0002
[824] 3-Bromo-7-hydroxy-4-met yl-2-oxo-2H-chromene-8-carbaldehyde (142 mg, 0.50
mmol), 4-(4-morp oline-4-carbonyi)phenylboronic acid inacol ester (175 mg, 0.55 mmol), potassium phosphate (424 mg, 2.00 mmol) and
tetrakis(tripheny]phosphine)palladium (17 mg, 0.015 mmol) were dissolved in a degassed mixture of 4.5 mL 2-ethoxyethanol and 0.5 mL water. The mixture was stirred at 115 °C under argon for 2 h. The reaction mixture was allowed to reach room temperature, then activated-carbon (40 mg) was added and was stirred for 20 min. The solid was filtered off, washed with ethanol and the combined filtrates were evaporated. The residue was suspended in saturated sodium bicarbonate (20 mL) and extracted with dichloromethane (3x20 mL). The combined organic layers were dried (Na2S04) and evaporated. The solid residue was purified by column chromatography (Kieselgel 60) with chloroform - methanol 98:2 as the eluent. The crude product was triturated with Et?0, filtered off and air dried, affording the title compound (31 mg, 0.08 mmol, 16%) as a white powder. 5] The following compounds (includes title compound) were made by the above procedure:
Figure imgf000286_0001
Figure imgf000287_0001
EXAMPLE 15
7-hydroxy-4-methyi-3-(3-morphoUn-4-yl-3-oxo^ropyl)-2-oxo-2H-chrom
carbaldehyde
Figure imgf000288_0001
Step A
3-(8-Fomiyl-7-hydroxy-4-methyl-2-oxo-2H-chromen-3-yl)-propionic acid
A mixture of 3-(7-hydroxy-4-methyl-2-oxo-2H-chromen-3-yl)-propiomc acid ethyl ester (100 mg, 0,36 mmoi) and hexamethylenetetramine (203 mg, 1.44 mmoi) in
trifluoroaeetie acid (3.6 mL) was stirred in a closed vial under argon at 1 10°C for 2 h. The reaction was poured onto crushed ice (15 mL), warmed to room temperature, and the solid precipitate was filtered off. This mixture of tormylated ester and corresponding carboxylic acid was dissolved in dioxane - I N NaOH (1 : 1) and was stirred at room temperature. After 2 h, 15 mL of dichloromethane was added. The aqueous layer was separated and acidified by portionwise addition of IN HCL The precipitate was collected, washed with water, and dried to afford title compound (1 5 mg, 0.043 mmoi, 13%) as a light brown powder. LCMS LCMS NMR
Made LCMS
Structure LCMS method Rt purity purity From Ion
(rain) (%) (%) a-l 5969-19-7 BB_LCMS01(+) 277 3.268 90 n/a
a-2 6100-60-3 BB_LCMS07(+) 307 1.386 79 n/a
Figure imgf000289_0001
Step B
7-Hydroxy-4-meihyl-3-(3-moψholm-4-yl-3-oxo ropyl)-2-oxo-2H-chromene-8- carhaldehyde
[827] To a mixture of dry tetrahydrofuran (8.5 mL) and N,N-dimethylformamide (2 mL),
morpholine (93 μΐ,, 94 mg, 1.08 mmol), triethylamine (340 μί, 247 mg, 2.45 mmoi) 3-(8- formyl-7-hydroxy-4-methyl-2-oxo-2H-chromen-3-yi)-propiomc acid (148 mg, 0.49 mmol), l-hydroxybenzotriazoie (146 mg, 1.08 mmol) and l-ethyl-(3- dimethylaminopropyl)-carbodiimide hydrochloride (205 mg, 1.08 mmoi) were added in order. The mixture was stirred at room temperature overnight, then 5 mL of 2N HCl was added and the stirring was continued for 2 h. The resultant solution was extracted with dichloromethane (2x10 mL ), the combined organic layers were washed with saturated sodium bicarbonate (10 mL) and brine (10 mL), the organic phase was dried (Na2S04) and evaporated. The title compound (399 mg, 1.070 mmol, 57%) was isolated by column chromatography (Kieselgel 60), with chloroform - methanol 20: 1 as eluent, as a white powder.
[828] lB NMR (400 M Hz, D\1S< )-</<.) δ ppm 11.74 (br. s., H i ). 10.45 (s, 1H), 7.98 (d, J= 9.0 Hz, 1H), 6.96 (d, J= 9.0 Hz, 1H), 3.49 - 3.60 (m, 4H), 3.39 - 3.45 (m, 4H), 2.75 - 2.81 (m, 2H), 2.47 - 2.53 (m, 2H), 2.41 (s, M l ). following compounds (includes title compound) were made by the above proeedur
Figure imgf000290_0001
EXAMPLE 16
7-Hydroxy-4-mei yl-3-[3-(4-m.ei yl-p^
chromene-8-carbaldehyde
Figure imgf000291_0001
3-Bromo-7-hydroxy-4-methyl-2-oxo-2H-chromene-8-carbaldehyde (142 mg, 0.50 mmol), l -(4-methyl-piperazm-l.-yl)-propenone (93 mg, 0.60 mmol), palladium acetate (4 mg, 15 μηιοΐ), tri-o-tolyl-phosphane (9 mg, 30 μπιοΐ) and silver acetate (167 mg, 1.0 mmol) were dissolved in abs. N,N~dimethylformamide (4mL), The mixture was irradiated in a microwave reactor for 1 h at 120 °C under inert atmosphere. The reaction mixture was poured into water (lOml.) and extracted with chloroform (3x15 mL). The combined organic layers were dried (Na2S04) and evaporated. The title compound (15 mg, 0.042 mmol, 8%) was isolated by column chromatography (Kieselgel 60), with chloroform as e!uent, as a yellow powder. 1] Ί-Ϊ MR (400 MHz, DMSO-< 6) δ ppm 10.43 (s, i l l ). 8.05 (d, J= 9.0 Hz, ! M h 7.59 (d, J = 15.1 Hz, 1H), 7.50 (d, J= 15.1 Hz, 1H), 6.92 (d, J= 9.0 Hz, 1H), 3.56 - 3.66 (m, 4H), 2.55 (s, 3H), 2.38 (br. s., 4H), 2.27 (s, 3H).
Figure imgf000291_0002
EXAMPLE 17
7-Hydroxy-4-methyl-2-oxo-2H-chromene-3-carhothioic acid amide
Figure imgf000292_0001
To a solution of 7-Hydroxy-4-methyl-2-oxo-2H-chromene-3-carbonitrile (7.50 g, 37.31 mmol) in N,N-dimethylformamide (150 ml.), ammonium sulfide (40-48 wt% solution in water; 38 mL, 560 mmol) was added, and the resulted mixture was stirred at room temperature for a week. An additional portion of ammonium sulfide (38 mL) was added on every second day. The solution was evaporated and the solid residue was triturated with water, filtered and dried. The obtained cnide product was purified by column chromatography (Kieselgel 60), with chloroform - methanol (1 : 1) as eluent. The title compound (3.20 g, 13.6 mmol, 36%) was isolated as a yellow powder.
Figure imgf000292_0003
EXAMPLE 18
7-methOxy-3-[4-methyl-5-(4-methyl^iperadne-l-carbonyl^
Figure imgf000292_0002
Step A
2~(7-Hydroxy~2-oxo-2H~chromen~3-yl)~4~methyl~thiazole-5~carboxylic acid tert-butyl ester
To a suspension of 7-hydroxy-2-oxo-2H-chromene-3-carbothioic acid amide (221 mg, 1.0 mmol) in anhydrous N,N-dim.ethylformamide (5 mL) stirred at 0 °C, sodium hydride (60% in oil, 44 mg, 1.1 mmol) was added portionwise. During addition a clear solution was formed with moderate effervescence. After 10 min, a solution of 2-bromo-3-oxo- butyric acid tert-butyl ester (474 mg, 2.0 mmol) in anhydrous N,N-dimethylformamide (2 mL) was added dropwise and the mixture was stirred at room temperature for 16 h. The reaction was poured into water (20 mL) and extracted with chloroform (3 x 10 mL). The combined organic extracts were washed with water (3 x 5 mL), dried over MgS04 and concentrated. The residue was triturated with diethyl ether, the solid product was collected and washed with diethyl ether. The title compound (224 mg, 0.623 mmol, 62.3%) was obtained as a yellow solid.
[834] The following compounds (includes title compound) were made by the above procedure:
Figure imgf000293_0001
Step B
2-(7-Hydroxy-2-oxo-2H-chromen-3-yl)-4-methyl-thiazole-5-carboxyl acid
835] To a suspension of 2-(7-hydroxy-2-oxo-2H-chromen-3-yl)-4-methyl-thiazole-5- carboxylic acid tert-butyl ester (387 mg, ! .08 mmol) and anisole (117 μΐ,, 1 17 mg, 1 .08 mmol) in anhydrous dichloromethane (5 mL)was added trifluoroacetic acid (5 mL) and the obtained solution was stirred at room temperature for 6 h. Diethyl ether (30 mL) was added, the precipitate was collected, washed with diethyl ether and dried in air. in this manner the title compound (285 mg, 0.94 mmol, 87%) was obtained as a light brown solid.
836] Li MS /BBJLCMSOl (+)/: M+l = 304, l t: 3.297 min.
837] The following compounds (includes title compound) were made by the above procedure:
Figure imgf000294_0002
EXAMPLE 19
Figure imgf000294_0001
Step A
2-(7~Hydroxy-2-oxo~2H-chromen-3-yl)-4-methyl-ihiazole-5-carboxyUc acid ethyl ester
838] To a solution of 7-hydroxy-2-oxo-2H-chromene-3-carbothioic acid amide (66 mg, 0.3 mmol) in anhydrous N,N-dimethylformamide (5 mL), freshly dried 2CO3 (263 mg, 1 ,9 mmol) was added followed by 2-chloro-3-oxo-butyric acid ethyl ester (79 μΕ, 94 mg, 0.54 mmol) and the mixture was stirred at room temperature for 19 h. The mixture was poured into water (25 mL) and extracted first with chloroform (3 x 10 mL) and, after saturation with NaCl, with tetrahydrofuran (3 10 mL). The combined organic extracts were dried over MgSO/j and concentrated. The residue was dissolved in chloroform (8 mL), pyridinium p-toluenesulfonate (7.5 mg, 0.03 mmol) was added and the mixture was stirred at 60 °C for 4.5 h. After cooling, the solution was washed with brine (3 x 5 mL), dried over MgS04 and concentrated. The residue was purified by column
chromatography on silica, eluting with a 9:1 :0.1 mixture of chloroform, methanol and cc. NI-LjOH. The title compound (14.5 mg, 0.044 mmol, 14.7%) was obtained as a yellow solid.
LCMS /BBJLCMS0 ] (+)/: M+l= 332, Rt: 3.748 min.
The following compounds (includes title compound) were made by the above procedur
Figure imgf000295_0001
Step B
2-(7-Hydroxy-2-oxo-2H-chromen-3-yl)-thiazole-5-carhoxylic acid)
A suspension of 2-(7-hydroxy-2-oxo-2H-chromen-3-yl)-thiazole-5-carboxylic acid ethyl ester (50 mg, 0.16 mmol) in 70% (w/w) sulfuric acid (3 mL) was stirred at 100°C for 1 h. During heating the solids dissolved and a solid precipitated after 1 h. The precipitate was collected, washed with water and dried in air. In this manner the title compound (30.5 mg, 0,10 mmol, 62.5%) was obtained as a pale brown solid. LCMS LCMS NMR
Made LCMS
Ex Structure LCMS method Rt puritv purity
From Ion
(mill) (%) ' (%) "
19-1 19a- 3 BB_LCMS07(÷) 290 3.181 98 n/a
Figure imgf000296_0001
EXAMPLE 20
7~Hydrox -4-methyl-3-[4-methyl~5-(4-methyl^iperazine- chromen-2-one
Figure imgf000296_0002
[842] To dry tetrahydrofiiran (12 mL) at 0 °C, l-methylpiperazine (61 ,LIL, 55 mg, 0.55 mmol), triethylamine (210 LIL, 152 mg, 1.5 mmol), 2-(7-hydroxy-2-oxo-2H-chromen-3-yl)-4- methyl-thiazo!e-5-carboxy!ic acid ( 156 mg, 0.49 mmol), (3-dimethylamino-propyl)- ethyl-carbodiimid hydrochloride (105 mg, 0.55 mmol) and 1-hydroxybenzotriazole monohydrate (84 mg, 0.55 mmol) were added sequentially, and the mixture was stirred at room temperature for 16 h. After addition of water (30 mL) the pH was adjusted to 8 by addition of a 5% aqueous solution of NaHC03 and the mixture was extracted with tetrahydrofiiran (3 x 15 mL). After drying (MgS04) and evaporation, the residue was purified by column chromatography over silica (Kieselgel 60) using chloroform - methanol 9: 1 as eiuent. The title compound ( 156 mg, 0.41 mmol, 81 %) was obtained as a yellow solid. following compounds (includes title compound) were made by the above procedur
Figure imgf000297_0002
EXAMPLE 21
7-Hydroxy-3-[4-methyl-5-(morpholine-4-carbonyl)-thi^
Figure imgf000297_0001
To a solution of l -morpholin-4-y [-butane- 1,3-dione (0.53 g, 3.1 mmol) in 1,2- dichloroethane (30 mL) stirred at 0 °C, N-bromosuccinimide (0.55 mg, 3.1 mmol) was added in small portions and the mixture was stirred for 1 h. The solution was washed with brine (3 5 mL), dried over MgS04 and concentrated below 30 °C. 2-Bromo-l- morpholin-4-yl-butane- l,3-dione 0.76 g, 3.04 mmol, 98.1%, LCMS /BB_LCMS01(+)/: M+l=250, 252, Rt: 1.831 min] was obtained as a yellowish oil.
To a stirred suspension of 7-hydroxy-2-oxo-2H-chromene-3-carbothioic acid amide (354 mg, 1.6 mmol) in anhydrous Ν,Ν-dimethylformamide (7 mL), 1 ,8-diazabicyclo- [5.4.0]undec-7-ene (480 μΤ, 490 mg, 3.2 mmol) was added followed by a solution of 2- bromo-l-morpholin-4-yl-butane-l,3-dione (750 mg, 3.0 mmol) in anhydrous N,N~ dimethylformamide (15 mL) and the mixture was stirred at room temperature for 15 h. The reaction mixture was poured into water (100 ml.) and extracted first with chloroform (3 x 30 mL) then after saturation with NaCl, with tetrahydrofuran (3 x 50 mL). The combined organic extracts were dried over MgS04 and concentrated. The residue was dissolved in chloroform (16 mL), pyridinium p-toluenesulfonate (40.2 mg, 0.16 mmol) was added and the mixture was stirred at 60°C for 4.5 h. The reaction mixture was washed with a mixture of brine (10 mL) and 5% NaHC03 solution (5 mL) and then with brine (2 x 15 mL), dried over MgS04 and concentrated. The residue was purified by column chromatography on silica, eluting with a 9: 1 :0.1 mixture of chloroform, methanol and cc. NH4OH. The title compound (34.6 mg, 0.093 mmol, 5.8%) was obtained as a yellow solid.
LCMS LCMS NMR
Made LCMS
Structure LCMS method Rt puriiv purity From Ion
(tnin) (%) ' (%) -1 69015-66-3 BB_LCMS01(+) 373 3.040 100 n/a
\— 0 EXAMPLE 22
3-Bromo-7-hydroxy-6-methoxy-4-methyl-chromen-2-one
Figure imgf000299_0001
A. bromine (2.55 g, 15.96 mmol) solution in acetic acid (8 ml.) was added dropwise to a stirred suspension of 7-hydroxy-6-methoxy-4-methyl-chromen-2-one (3.20 g, 15.5 mmol) in glacial acetic acid (31 mL) at room temperature. The mixture was stirred for 10 min, then poured onto crushed ice (400 mL). To the resultant light yellow suspension, 1 mL of saturated sodium bisulphite solution was added and the mixture was allowed to reach room temperature. The precipitated solids were filtered off, washed with wrater, dried and recrystallized from glacial acetic acid. The obtained white powder (3.39 g, 11.88 mmol, 76%) was used without further purification.
The following compounds (includes title compound) were made by the above procedure:
LCMS LCMS NMR
Made LCMS
Structure LCMS method Rt rjurit purity From Ion
(min) (%) (%) " - 1 3374-03-6 BB_LCMS03 ÷) 286 3.316 78 jv'a
Figure imgf000299_0002
-2 2Ϊ 9965-92-1 BB_ LCMS01 (+) 274 3.390 92 n/a -3 19492-02-5 BB LCMSOl(r) 289 3.589 92 n/a
Figure imgf000299_0003
EXAMPLE 23
Figure imgf000300_0001
Step A
7-hy^oxy-4-methyl-3-(4-(4-methy piperadne-l-carbony )pheny (3)
A mixture of 3-bromo-7-hydroxy-4-methyl-2fi-chrom.en-2-one (i) (7.66 g, 30 mmol), 4- (4-methylpiperazine-l-carbonyl)phenylboronic acid hydrochloride (2) (10.24 g, 36 mmol), Na¾PQ4 (22.14 g, 135 rnmol), ethoxyethanol (140 g) and water (14 g) was purged with Argon for five minutes in a 250 mL pressure vessel, Ligand Sphos (obtained from Aldrich, Cat No. 638072) (739 mg, 1.8 mmol) and Pd(OAc)2 (202 mg, 0.90 mmol) were added under an Argon atmosphere then the vessel was sealed and heated for 60 min in a 150 °C oil bath with strong stirring. This process was repeated once. Upon cooling, the reaction mixtures were filtered through a silica plug using CH2CI2 and MeOH wash. The unified solutions were evaporated to 100 mL slowly diluted with water (100 mL) and crystallized at 0 °C. The product was filtered, washed with 50% MeOH (2x30 mL) and dried to afford 18.52 g (81%) of the title compound. MS (ESI): 379 (M+H)+. 1H NMR (δ, DMSO (2.5 ppm)): 10.57 (s, br, 1H), 7.69 (d, 1H), 7.44 (d, 2H), 7.36 (d, 2H), 6.84 (dd, I H), 6.76 (d. H i }. 3.65-3.30 (m, 8H), 2.23 (s, 3H), 2.20 (s, 3H). Step B
7~hydroxy~4-met yl~3-(4-(4~methylpiperazine
carb ldehyde hydrochloride (4)
A mixture of 7-hydroxy-4-methyl-3-(4-(4-methylpiperazine-l -carbonyl)phenyl)-2H- chrornen-2-one (3) (9, 1 1 g, 24.0 mmol) and bexameth lenetetramine (13.46 g, 96.0 mmol) in TFA (283 g) was heated in a pressure flask in a 120 "C oil bath for 40 minutes. This process was repeated once. Upon cooling, the unified solutions were evaporated to 1 82 g weight and, after addition of CH2C12 (500 mL) and water (100 mL) it was cooled to 0 °C. The mixture was neutralized with NaOH (2N, 400 mL) and then close to the end point with NaHC03 (10%) with cooling and stirring. The product was extracted with CH2C12 (5x100 mL), washed with water (backextracted), dried on MgS04 and evaporated to afford 23.5 g crude product. The crude product was loaded on 33 g silica and purified by medium pressure chromatography (4 1 OOg columns + 4x1 OOg reruns) using 2-3% MeOH in CH2C3.2 by collecting the front fractions to afford 7.00 g of free base This product was dissolved in EtOH (130 mL) and HQ (8 mL, 6N) with heating. Upon cooling to 20 °C the salt crystallized. It was filtered and washed with abs EtOH (2x20 mL), dried on air then at 50 °C under 5 Hgmm vacuum to afford 6.65 g (34%) of the title compound.
MS (ESI): 407 (M+H)'\
1H NMR (8, DMSO (2.5 ppm)): 11.93 (s, br, 1H), 10.90 (s, br, IH), 10.50 (s, IH), 8.04 (d, I i f ). 7.55 (d, 21 1 ), 7.43 (d, 2H), 7.04 (d, I H), 4.4-3.3 (m, br, 8H), 2.79 (s, 3H), 2.28 (s, 3H).
Elemental analysis of a previous air dried sample corresponds well to 2 crystal water:
Figure imgf000301_0001
"Air dried: equilibrated at 22 °C.
"Deep dried: equilibrated at 50 "C under 1 Hgmm for 24 hours.
EXAMPLE 24
Figure imgf000302_0001
Step A
4-(7~Hydroxy-4-methyl-2-oxo-2H-chromen-3-yl)-N-(2- jrpholinoethy (6) A mixture of 3-bromo-7-hydroxy-4-methy3-2fi-chrom.en-2-one (1) (7.66 g, 30 mmol), 4- (2-morpholmoethylcarbamoyl)phenylboronic acid (2) (10.02 g, 36 mmol), Na3P04 (17.21 g, 105 mmol) in a mixture of ethoxyethanol (140 g) and water (14 g) was purged with Argon for five minutes in a 250 mL pressure vessel. Ligand Sphos (738 mg, 1.8 mmol) and Pd(OAc)2 (206 mg, 0.90 mmol) were added under an Argon atmosphere then the vessel was sealed and heated for 60 min in a 150 oC oil bath with strong stirring. This process was repeated once. Upon cooling, the reaction mixtures were filtered through a silica plug using CH2Ci2 and MeOH wash. The unified solutions were evaporated to 100 mL slowly diluted with water (100 mL) and crystallized at 0 °C. The product was filtered, washed with 50% MeOH (2x50 mL) and dried to afford 22.33 g (91%) of the title compound. MS (ESI): 409 (M+H)+. IH NMR (δ, DMSO (2.5 ppm)): 10.57 (s, br, IH), 8.46 (t, IH), 7.88 (d, 2H), 7.69 (d, I H), 7.39 (d, 21 ! ). 6.84 (dd, IH), 6.76 (d, I H), 3.57 (m, 4! I ). 3.40 and 2,48 (2q, 2x2! i s. 2.43 (m, 41 ! }. 2.22 (s, 3H). Step B
4~(8-Formyl~7~hydroxy-4-methyl-2^xo-2H-chromen-3-yl)~N-(^^
henzamide (4)
[854] A mixture of 4-(7-hydroxy-4-methyl-2-oxo-2H-eliromen-3-yl)-N-(2-iiiorpholinoethyl^ benzamide (3) (8.17 g, 20.0 mmol) and hexamethyienetetramine (11.22 g, 80.0 mmol) in TFA (200 mL) was heated in a pressure flask in a 1 15 °C oil bath for 40 minutes. This process was repeated once. Upon cooling, the unified solutions were evaporated to 158 g weight and, after addition of CH?Ci? (500 mL) and water (100 mL) it was cooled to 0 °C. The mixture was neutralized with NaOH (2N, 350 mL) and then close to the end point with NaHC03 (10%) with cooling and stirring. The product was extracted with CH2CI2 (5x100 mL), washed with water (backextracted), dried on MgS04 and evaporated to afford 17.2 g crude product. The crude product was loaded on 40 g silica and purified by medium pressure chromatography (4x1 OOg columns) using 1-3% MeOH in CH?C1? by collecting the front fractions to afford 6.2 g (31%) of the title compound. This product can be turned into its HQ salt by dissolving it in EtOH ( 100 mL) and adding 6N HC1 (10 mL). The salt was filtered and washed with 70% EtOH (2x20 mL), dried on air then at 50 °C under 5 Hgmm vacuum to afford 6.0 g HC1 salt of the title compound.
[855] MS (ESI): 437 (M+H)+.
[856] lB NMR (δ, DMSO (2.5 ppm)): 10.50 (s, 1 1 1 ). 8.48 (t, 1H), 8.02 (d, 1 H), 7.89 (d, 2H), 7.42 (d, 2H), 7.00 (d, 1H), 3.58 (t, 4H), 3.41 and 2.50 (2q, 2x2H), 2.48 (m, 4H), 2.25 (s, 31 ! ) HCl-salt: 1 1 .93 (s, br, 1H),10.62 (s, br, 1H), 10.50 (s, 1H), 8.96 (t, 1 H), 8.04 (d, 1H), 8.00 (d, 2H), 7.45 (d, 2H), 7.04 (d, 1H), 3.98, 3.79, 3.71, 3.55, 3.34, 3.14 (6m, 6x21 ! ). 2.26 (s, 3H).
[857] Elemental analysis of a previous air dried sample corresponds well to one crystal water which is lost on further drying:
Figure imgf000303_0001
CI 7.46 7.28 7.50 7.22 6.97
Pd <10ppm <10ppm
"Air dried: equilibrated at 22 °C.
"Deep dried: equilibrated at 50 "C under 1 Hgmm for 24 hours.
EXAMPLE 25
Figure imgf000304_0001
3-(2-(Diethylamino)ethyl)-7-hydroxy-4-methyl-2-oxo-2H-chrom
hydroch loride (2)
858] A mixture of 3-(2-(diethylamino)ethyl)-7-hydroxy-4-methyl-2H-chromen-2-one (1 (312 mg, 1.0 mmol) and hexarnethylenetetramine (280 rag, 2.0 mmol) in tri.fi uoroacetic acid (5 mL) was microwave irradiated for 20 rain at 110 °C. Upon cooling, the reaction mixture was evaporated. The residue was diluted with water (10 mL) and CH2C12 (30 mL), cooled to 0 °C, neutralized with NaHC03 solution and extracted with CH2C12. The organic phase was dried and HC1 (1 mL, 2M in ether) was added to it. Evaporation and crystallization from a CH2Cl2/hexane mixture afforded the title product. MS (ESI): 304 (MrH)+. lll NMR (δ, DMSO (2.5 ppm)): 10.45 (s, 1H), 8.02 (d, I I I ). 7.00 (cL I I f ). 3.22 (q, 4H), 3.1 1 (m, 2H), 2.94 (m, 2H), 2.46 (s, 3H), 1.24 (†, 6H).
EXAMPLE 26
Figure imgf000305_0001
PdOAc2(Sphos)4 tablets
Step A
6-Hydroxy-2-oxo-l,2-dihydroquinoline-5-carbaldehyde (2)
A mixture of 6-hydroxyqumolin-2(lH)-one (1) (TCI: 2,6-dihydroxyquinoline) (806 mg, 5.0 mmol) and hexameth.yienetetrami.ne (1.40 g, 10.0 mmol) in tri.fl.uoroacetic acid (6 mL) was microwave irradiated for 20 min at 100 °C. The reaction was run twice with two parallels on a 5 mmol scale. Upon cooling, the two reaction mixtures were washed into a 100 mL flask with MeQH (40 mL). The mixture was evaporated to -10 mL and diiuted with water (70 mL) with vigorous stirring. The precipitated product was filtered, washed with water and dried on air to afford 1.85 g (97%) title compound, MS (ESI): 190 (M+H)÷. lH NMR (8, DMSO (2.5 ppm)): 11.84 (s, 1H, OH), 11.07 (s, 1H, M i ). 10.61 (s, I B, CHO), 8.86, 7.51 , 7.24 and 6.63 (4d, 4x1 H).
Step B
2-Chloro-6-hydroxyquinoline-5-carbaldehyde (3)
POCI3 (973 μΐ,, 10.4 mmol) was added dropwise to a DMF (5 mL) solution of 6- hydroxy-2-oxo-l ,2-dibydroqumolme-5-carbaldehyde (658 mg, 3.48 mmol) at 0 °C. The mixture was stirred for 20 hours at 20 °C then cooled to 0 °C. Upon addition of ice water the product precipitated. It was filtered, washed with water and dried on air to afford 580 mg (88%) of the title compound. MS (ESI): 208 (M+H)+. ! H NMR (δ, DMSO (2.5 ppm)): 1.1.95 (s, i i f . OH), .10.70 (s, 1H, CHO), 9.38, 8.10, 7.67 and 7.55 (4d, 4x.l H). Step C
6~Hydrox -2~(4-(4-methylpiperazine-l~carbonyl)phenyl)quino^ (§)
861] A mixture of 2-chloro-6-hydroxyquinolin-5-carbaldehyde (3) (104 mg, 0.5 mmol), 4-(4- methylpiperazine-l ~carbonyi)phenylboronic acid (4) (198 mg, 0.7 mmol) and K.2CQ3 (174 mg, 1.25 mmol) in a mixture of i-PrOH and water (6 niL 10:1) was purged with Argon for five minutes in a microwave vessel A tablet of PdOAc2(Sphos)4 (Aldrich, Cat. No. 694088) was added under an Argon atmosphere then the vessel was sealed and irradiated for 45 min at 165 °C. Upon cooling, the reaction mixture was filtered through a silica plug using MeOH. The solution was evaporated and purified by Flash
chromatography using 0-5% MeOH in C¾C12. The product was recrystaliized from CH2Cl2/hexanes to afford the title compound. MS (ESI): 376 (M+H) . lll NMR (6, DM80 (2.5 ppm)): 10.74 (s, lH), 9.44 8.25, 7.21 and 7.49 (4d, 4x1 H), 8.29 and 7.54 (2d, 2x2H), 3.64, 3.38, 2.41 and 2.33 (4 broad s, 4x2! ! }. 2.23 (s, M l ).
EXAMPLE 27
Figure imgf000306_0001
6~hydroxy~2-(3-(4~methylpiperazine~l-carbonyl)phenyl)quinoli (7)
862] A mixture of 2-chloro-6-hydroxyquinolin-5-carbaIdehyde (3) (104 mg, 0.5 mmol), 3-(4- methylpiperazine-l-carboiiyl)phenylboronic acid (6) (198 mg, 0.7 mmol) and 2C0 ( 174 mg, 1.25 mmol) in a mi xture of i-PrOH and water (6 mL 10: 1 ) was purged with Argon for five minutes in a microwave vessel. A tablet of PdOAc2(Sphos)4 (Aldrich, Cat, No. 694088) was added under an Argon atmosphere then the vessel was sealed and irradiated for 45 min at 165 °C. Upon cooling, the reaction mixture was filtered through a silica plug using MeOH. The solution was evaporated and purified by Flash chromatography using 0-5% MeOH in€H?C1?. The product was recrystallized from CH2Cl.2/hexanes to afford the title compound, MS (ESI): 376 (M+H) . ιΉ NMR (6, DM80 (2.5 ppm)): 10.74 (s, i l l ). 9.44 (d, 1 1 1 ). 8.30 (dd, 1H), 8.27 (d, I I I ). 8.24 (s, H I ). 8.23 (d,lH), 7.61 (t, 1H), 7.49 (d, 1H), 7.47 (dd. 1H), 3.60, 3.40, 2.40 and 2.30 (4 broad s, 4x2H), 2.23 (s, M i ).
EXAMPLE 28
6- ydroxy~2-[4~(4-methyl~pipeHdine ~carhonyl)-p enyl]
Figure imgf000307_0001
Step A
[4-( 6-Hydroxy-benzothiazol-2-yl)-phenyl]- (4-methyl-piperidin-l-yl)-methanone
2-Bromo-6-hydroxybenzothiazole (400 mg, 1.74 mmol), 4-(4-methyl.piperidine-l~ carbonyl)phenylboronic acid (472 mg, 1.91 mmol), potassium phosphate (848 mg, 6.96 mmol) and tetrakis(triphenylphosphine)pailadium (60 mg, 0.05 mmol) were dissolved in a mixture of 13.5 mL 2-ethoxyethano! and 1.5 mL water. The mixture was stirred at 1 15 °C under argon for 2 h. The reaction mixture was let to reach room temperature then activated-carbon was added and stirred for 20 min. The mixture was filtered, the solid was washed with ethanol and the combined filtrates were evaporated. The residue was purified by column chromatography (Kieselgel 60) with chloroform as the eluent. The crude product was triturated with Et20, collected and air dried, affording the title compound (122 mg, 0.35 mmol, 20%). 4] The following compounds (includes title compound) were made by the above procedur
Figure imgf000308_0001
Step B
6-Hydroxy-2-[4-(4-methyl-piperidine-l-carbonyl)-pfa
[865] A mixture of [4-(6-Hydroxy-benzothiazol-2-yl)-phenylj-(4-methyi-piperidin-l.-yl)- methanone (120 mg, 0.34 mmol), hexamethylenetetramme (190 mg, 1.36 mmol) and trifiuoroacetic acid (2 mL) was stirred in a closed vessel under argon atmosphere at 120 °C for 1 h. The reaction was cooled to room temperature and 10 mL of water was added. The pH of the mixture was adjusted to 8 by dropwise addition of saturated NaHC03 solution, and extracted with dichloromethane (3 x 15 mL). The combined organic layers were dried (MgS04), filtered and evaporated. The residue was purified by column chromatography on silica ( ieselgel 60), eluting with chloroform. ~ methanol 99: 1. The title compound (34 mg, 0.089 mmol, 26%) was obtained as pale yellow crystals.
[866] !H NMR (400 MHz, CDCl3) δ ppm 11.20 (s, 1H), 10.35 (s, 1H), 8.13 (d, J= 9.3 Hz, 1H), 8.08 (d, J ------ 8.3 Hz, 21 1 ), 7.52 (d, J= 8.3 Hz, 2H), 7.13 (d, J ------ 9.3 Hz, 1H), 4.66 (br. s.,
1 1 1 ). 3.76 (br. s., i l l ). 3.03 (br. s., 1H), 2.80 (br. s., 1H), 1 .81 (br. s., 1 1 1 ). 1 .57 - 1 .72 (m, 2H), 1.07 - 1.35 (m, 2H), 1.00 (d, J= 6.5 Hz, 3H). [867] The following compounds (includes title compound) were made by the above procedure:
Figure imgf000309_0002
EXAMPLE 29
6-Hydroxy-2-[5-(4-methyl^iperazine-l-carbonyl)-thiophen-2-yl]-be
carbaldehyde
Figure imgf000309_0001
Step A
5-(6-Methoxy-benzothiazol-2-yl)-thiophene-2-carboxylic acid
[868] 2-Bromo-6-methoxy-benzothiazoIe (1.22 g, 5.00 mmol), 2-carboxythiophene-5-boromc acid (860 mg, 5.00 mmol), sodium carbonate (2.65 g, 25.00 mmol) and
tetrakis(triphenylphosphine)palladium (300 mg, 0.25 mmol) were dissolved in a mixture of 80 mL ,N-dimethylformamide and 80 mL water. The mixture was stirred at 120 °C under argon for 2 h. The reaction mixture was evaporated and the residue was partitioned between 100 mL of wrater and 100 mL of diehforomethane. A considerable amount of white solid precipitated between the layers and was filtered off and triturated with diethyl ether, affording the title compound (550 mg, 1.89 mmol, 38%) as a white powder.
Figure imgf000310_0001
Step B
5-(6-Hydroxy-benzothiazol-2-yl)-thiophene-2-carboxylic acid
869] To dry tetrahydrofuran (30 ml . ;-, l-methylpiperazine (834 _uL, 756 mg, 7.56 mmol), triethylamine (1.05 mL, 762 mg, 7.56 mmol) 5-(6-Methoxy-benzotbiaz.ol-2-yi)- thiophene-2-carboxylic acid (550 mg, 1.89 mmol), 1 -hydroxybenzotriazole (510 mg, 3.78 mmol) and l-ethyl-3-(dimethylaminopropyl)-carbodiimid hydrochloride (726 mg, 3.78) were added sequentially. The mixture was stirred at room temperature overnight then was evaporated. The residue was suspended in saturated sodium bicarbonate (20 mL) and extracted with dichloromethane (3 x 20mL). The combined organic layers were dried (Na2S04), evaporated and reerystallized from toluene. The title compound (399 mg, 1.070 mmol, 57%) was isolated as a white powder.
Figure imgf000310_0002
[5-(6-Hydrox -benzothiazol-2-yl)-thiophen^
To a solution of 5-(6-Hydroxy-benzothiazol-2-yi)-thiophene-2-carboxylic acid (375 mg, 1.00 mmol) in abs. dichloromethane (3 mL) stirred under argon at -78 °C, boron tribromide (769 μί, 2.00 g, 8.00 mmol) was added via syringe and the mixture was stirred for 1 h and then allowed to warm to room temperature and stirred for 12 h. The reaction was quenched at -78 °C by addition of methanol (0.50 mL) and the mixture was for 1 h and allowed to warm to room temperature and stirred for 1 h. The volatiles were removed and the solid residue was recrystailized with ethanol, filtered, washed with diethyl-ether and dried to give the title compound (295 mg, 0.82 mmol, 82%) as a gray solid.
Figure imgf000311_0001
Step D
6-Hydroxy-2-[5-(4-methyl^ipemzine-l-carbonyl)-thiophe
carbaldehyde
A mixture of [5-(6-L]ydroxy~benzothiazol~2~yl)^m - y!)-methanone (290 mg, 0.81 mmol), hexamethylenetetramine (453 mg, 3.23 mmol) and tiifluoroacetic acid (3 mL) was stirred in a closed vessel under argon atmosphere at 120 °C for 1 h. The mixture was cooled to room temperature and 10 mL of water was added. The pH of the mixture was adjusted to 8 by slow addition of a saturated NaHCO¾ solution, then extracted with dichloromethane (3 x 20 mL). After drying (MgS04), filtration and evaporation of the solvent, the residue was purified by column
chromatography by I SCO on silica (Kieselgel 60) using a chloroform. - methanol gradient followed by trituration with diethyl ether. The title compound (23 mg, 0.059 mmol, 10%) was obtained as an orange solid.
1H NMR (400 MHz, DMSO-cfe) δ ppm 10.50 (s, 1H), 8.16 (d, J= 9.0 Hz, 1H), 7.81 (d, J = 3.8 Hz, i l l ). 7.46 (d, J= 3.8 Hz, i l l ). 7.21 (d, J = 9.0 Hz, 1H), 3.63 - 3.70 (m, 4H), 2.34 - 2.43 (m, 4H), 2.23 (s, 3H).
Figure imgf000312_0001
EXAMPLE 30
0-Hy iroxy-2-(4-isopropyi^iperazin-
Figure imgf000312_0002
Step A
2-(4-Isopropyl-piperazm-l-yl)-henzothiazol-6-ol
2-Bromo-6-bydroxybenzothi.azole (345 mg, 1.5 mmo ), .1 -isopropyl-piperazine hydrochloride (271 mg, 1.65 mmol) and dr potassium carbonate (828 mg, 6.00 mmol), were dissolved in 6 mL. of dry N,N-dimethylformamide. The resulted pale brown solution was stirred at 100 °C for 18 h in a closed vial. The reaction mixture was evaporated, suspended in 20 mL of water and extracted with dichlorometliane (3 x 15 mL). The combined organic layers were washed with saturated sodium bicarbonate and brine, then dried over MgS04. After evaporation the residue was purified by column
chromatography (Kieselgel 60) using chloroform - methanol 49: 1 as the eluent. The title compound (76 mg, 0.27 mmol, 18%) was obtained as a white solid.
874] The following compounds (includes title compound) were made by the above procedure:
Figure imgf000312_0003
30a-3 HO. .3 BB LCMSOi(-r) 318 0.452 93 n/a
Step B
6-Eydroxy-2-(44sopropyl-pipemzinA-yl)-benzothiazoh^
[875] A mixture of 2-(4-Isopropyl-piperazin~l-yi)-benzoihiazol-6-ol (76 mg, 0.027 mmoi), hexamethylenetetramine ( 153 mg, 1.10 mmoi) and trifiuoroacetic acid (2 mL) was stirred in a closed vessel under argon atmosphere at 120 °C for 1 li. The mixture was cooled to room temperature then 10 mL of water was added. The pH of the mixture was adjusted to 8 by portionwise addition of saturated NaHC03 solution, and extracted with
dichloromethane (3 x 15 ml.). After drying (MgS04), filtration and evaporation of the solvent, the residue was purified by column chromatography (Kieselgel 60) using chloroform - methanol 49:1 as eluent followed by trituration with diethyl ether and n- hexane. The title compound (14 mg, 0.040 mmoi, 14%) was obtained as a yellow solid.
[876] 1 NMR (400 MHz, D\1S< )-</<.) δ ppm 10.66 (br. s., H i ). 10.44 (s, 1H), 7.62 (d, J= 8.5 Hz, 1H), 6.97 (d, J= 8.5 Hz, 1H), 3.48 - 3.55 (m, 4H), 2.66 - 2.79 (m, 1H), 2.53 - 2.59 im. 4H), 0.99 (d, J 6.5 Hz, 61 ! }.
[877] The following compounds (includes title compound) were made by the above procedure:
Figure imgf000313_0001
EXAMPLE 31
4-(7-Fonnyl-6-hydroxy-lH-benzoimidazol-2-yl)-benzoic acid methyl ester
Figure imgf000314_0001
Step A
4-( 6-Methoxy-lH-benzoimidazol-2-yl)-benzoic acid methyl ester
[878] 4-Methoxybenzene-l ,2-diamine (1.96 g, 14.2 mmol), 4-fonnylbenzoie acid methyl ester (2.33 g, 14.2 mmol) and sodium bisulphite (1.55 g, 14.9 mmol) were refluxed in methanol (50mL) for 3 h, then evaporated to dryness. The solid residue was partitioned between dichloromethane and water. The organic layer was dried, evaporated and purified by column chromatography, elutmg with. The title compound (2.65 g, 9.40 mmol, 66%) was obtained as a dark solid.
[879] The following compounds (includes title compound) were made by the above procedure:
Figure imgf000314_0002
Step B
4~(7-Formyl-6~methoxy-lH-benzoimidazol-2~yl)-benzoic acid methyl ester
880] A mixture of 4-(6-Methoxy-lH-benzoimidazo]-2-yl)-benzoic acid methyl ester (1.50 g, 5.3 ttimol), hexamethylenetetramme (1.50 mg, 10.60 mmol) and trifluoroacetic acid (12 rnL) was stirred in a closed vessel under an argon atmosphere at 130 °C for 3 h. The resultant brown solution was poured onto 250 mL of crushed ice. The mixture was extracted with chloroform - ethanol 95:5 (2 x 100 mL), The combined organic layers were dried (Na2S04), and evaporated. The solid residue was purified by column chromatography over silica (Kieselgel 60) using chloroform as the eluent to give title compound (350 mg, 1.13 mmol, 21 %) yellow crystals.
881] The following compounds (includes title compound) were made by the above procedure:
Figure imgf000315_0001
Step C
4-(7-Fonnyl-6-hydroxy-lH-benzoimidazol-2-yl)-benzoic acid methyl ester
To a solution of 4-(7-Formyl-6-methoxy-lH-benzoimidazol-2-yl)-benzoic acid methyl ester (650 mg, 2.1 mmol) in abs. dichlorom ethane (30 mL) at -78 °C, boron tribromide (1.20 mL, 3.20 g, 12.60 mmol) was added dropwise and the mixture was stirred for 1 h, then overnight at room temperature. The yellow suspension was cooled to -78 °C and quenched with methanol (30 mL) followed by evaporation. The residue was partitioned between saturated sodium bicarbonate (30 mL) and chloroform (30 mL). The organic phase was dried (Na?S04) and evaporated. The title compound (360 mg, 1.22 mmol, 58%) was isolated as a light green solid.
T-i: NMR (400 MHz, DMSO-<¾) 6 ppm 12.69 (br. s., H i ). 10.54 (s, 1H), 8.38 (d, J ------ 8.5
Hz, 21 ! }. 8.09 (d, J = 8.5 Hz, 2H), 7.84 (d, J = 8.8 Hz, H i ). 6.87 id. J = 8.8 Hz, H I ). 3.89 (s, 3H).
The following compounds (includes title compound) were made by the above procedure:
Figure imgf000316_0002
EXAMPLE 32
4-(7-Formyl-6-hydroxy-lH-benzoimidazol-2-yl)-benzoic acid
Figure imgf000316_0001
[885] 4-(7-Formyl-6-hydroxy-lH-benzoimidazol-2-yl)-benzoic acid methyl ester (360mg, 1.22 mmol) was dissolved in a mixture of dioxane (6 mL) and IN NaOH (6 mL) and was stirred at 50 °C for 1 h. The mixture was evaporated to half volume and acidified with glacial acetic acid. The precipitate was collected, washed with acetone and dried. The title compound (305 mg, 1.08 mmol, 89%) was isolated as a brown solid.
[886] lll NMR (400 MHz, DMSO-^) 6 ppm 12.75 (br. s., H i ). 10.57 (s, H i ). 8.33 (d, J ------ 8.5
Hz, 2H), 8.07 (d, J= 8.5 Hz, 2H), 7.85 (d. ./ 8.8 Hz, 1H), 6.90 id. ./ 8.8 Hz, I I I ). ] The following compounds (includes title compound) were made by the above procedure:
Figure imgf000317_0002
EXAMPLE 33
5-Hydrox -2-[4-(4-methyl-piperazineA-carbonyl)-ph^
carha!dehyde
Figure imgf000317_0001
To dry tetrahydrofuran (5 mL), 1-methylpiperazine (69 μΐ,, 63 mg, 0.62 mmol), triethylamine (196 μΐ-, 142 mg, 1.40 mmol), 4-(7-Formyl-6-hydroxy-lH-benzoimidazol- 2-yl)-benzoie acid (80 mg, 0.28 mmol), 1 -hydroxvbenzotriazole (84 mg, 0.62 mmol) and l-ethyl-3-(dimethylaminopropyl)-carbodiimide hydrochloride (120 mg, 0.62) were added in the above order. The mixture was stirred at room temperature overnight. The resulted brown solution was suspended in saturated sodium bicarbonate (60 mL) and extracted with dichloromet ane (3 x 20 mL). The combined organic layers were dried (Na2S04), evaporated and purified by column chromatography (Kieselgel 60), eluting with chloroform - methanol 9: 1. The title compound (35 mg, 0.096 mmol, 34%) was isolated as a white powder. Ή NMR (400 MHz, DMSO- ) δ ppm 12.71 (br. s., I If 10.51 (br. s., IH), 8.28 (br. s. 2H), 7.83 (br. s., IH), 7.53 (br. s., 2H), 6.87 id,./ 8.8 Hz, IH), 3.50 (br. s., 411), 2.33 (br. s.,4H),2.21 (s, 3H).
890] The following compounds (includes title compound) were made by the above procedure:
Figure imgf000318_0002
EXAMPLE 34
(7-Formyl-6-hydroxy-lH-benzoimidazol-2-ylsidfanyl)-acetic acid
Figure imgf000318_0001
Step A
(6-Methoxy-lH~benzoimidazol-2-ylsulfanyl)~acetic acid ethyl ester
6-Methoxy-l H-benzoimidazole-2-thiol (10.00 g, 55.56 mmol) was dissolved in D F (300 mL). NaH (2.44 g, 60 w/w% in mineral oil, 61.1 1 mmol) was added in small portions at room temperature. The resulted mixture was stirred for one h then bromo- acetic acid ethyl ester (10.2 lg, 61.11 mmol) was added. After 12 h the mixture was evaporated and the resulted slurry was diluted with HCI (340 mL, 2N) and was stirred for a 0.5 h at room temperature then was filtered, washed with water and n-hexane respectively. The title compound (14.70 g, 99%) was isolated as a pale yellow powder.
[892] LCMS /BB_ LCMS0 !(+)/: M+l= 267, Rt: 2.586 min, pur: 99%
Figure imgf000319_0001
Step B
(7-Formyl-6-methoxy-lH-benzoimi( zol-2-ylsulfariyl)-acetic acid ethyl ester
A mixture of (6-methoxy- 1 H-benzoimidazol-2-ylsulfanyl)-acetic acid ethyl ester (14.70 g, 55.26 mmol), hexamethylenetetramine (15.47 g, 100.53 mmol) and trifiitoroacetic acid (61 mL) was stirred under argon atmosphere at 120 °C for 1 h. The solution was cooled to room temperature and water (950 mL) was added. This aqueous mixture was extracted with EtOAc (3 x 200 mL). The combined organic layers were dried over Na2S04 and evaporated. The title compound (1.432 g, 4.87 mmol, 9%) was obtained by column chromatography in 2 consecutive steps followed by trituration with diethyl ether.
LCMS /BBJLCMSO ! (+)/: M+l= 295, Rt: 3.084 min, pur: 97% LCMS LCMS NMR
Made LCMS
EXAMPLE Structure LCMS method Rt purity purity
From Ion
(min) (%) " (%) '
34b 34a BB_LCMS01(+) 295 3.084 97 n/a
Figure imgf000320_0001
Step C
(7-Formyl-6-methoxy-lH-benzoimidazol-2-ylsulfanyl)-acetic acid
[895] (7-FormyI-6-methoxy- 1 H-benzoimidazol-2-ylsuifanyI)-acetic acid ethyl ester (1 .432 g, 4.87 mmol) was dissolved in a mixture of 19.5 mL of IN sodium hydroxide and 15 mL of dioxane. The solution was stirred at 50 °C for 2 h, cooled to 0 °C, and the pH was adjusted to 3.5 by dropwise addition of 6N HCl, keeping the temperature at 0°C. The precipitated yellow solid was filtered, washed with ice cold water and dried. The title compound (l .lOg, 4.15 mmol, 85%) was isolated as a yellow powder.
LCMS /BB_LCMS01 (-)/: M · i 265, Rt:2.390 min, pur: 100%
Figure imgf000320_0002
Ste D
(7-Formyl-6~hydroxy~lH~benzoimid zol~2-ylsulfanyl)-acetic acid
896] To a solution of (7-Formy]-6-methoxy-l H-benzoimidazol-2-ylsulfany].)-acetic acid ethyl ester (500 mg, 1.88 mmol) in abs. dichloromethane (40 mL) stirred under argon at -78 °C, boron tribromide (723 μΐ, 1.88 g, 7,52 mmol) was added dropwise and the mixture was warmed to room temperature and stirred for 2 h. An additional portion of boron tribromide (723 μΐ, 1 .88 g, 7.52 mmol) was added at -78°C and stirred for 2 h at room temperature. The mixture was quenched by slow addition of 120 mL. of water. The mixture was evaporated to dryness, suspended in boiling ethyl acetate, and the solid was filtered off. The filtrate was evaporated and triturated with diethyl ether. The title compound (220 mg, 0.87 mmol, 46%) was obtained as a ligh orange powder.
1H NMR (400 MHz, DMSO-<¾) 6 ppm 10.64 (br. s., H i ). 10.41 (s, 1H), 7.64 (d, J Hz, 1 H), 6.78 (d. ./ 8.5 Hz, 1H), 4.10 (s, 2H).
Figure imgf000321_0001
EXAMPLE 35
IRE- la assay
A fusion protein comprising glutathione S transferase (GST) and human IRE- l a (GST- IRE- la) obtained from a 500 ml baculovirus-infected insect cell culture can be used to measure IRE- la activity in vitro.
Five μΐ of a reaction mixture comprising IX reaction buffer (5X reaction buffer is 100 fflM Hepes pH 7.5, 250 niM OAc, 2.5 mM MgCl2), 3mM DTT, and 0.4% polyethylene glycol water is added to each well of 384 well plates. Twenty- five nanoliters of a 1 mM test compound solution are added to test wells. Three μΐ of a 128 ng/ml IRE- la preparation are added to each test well and to positive control wells (final concentration 5.82 ng weli). Negative control wells contain only reaction mixture and test compound.
After spinning the plates at 1200 rpm for 30 seconds, 3 μΐ of an IRE- la human mini- XBP-1 mRNA stem-loop substrate 5'-CAGUCCGCAGCACUG-3' (SEQ ID NO: l), labeled with the fluorescent dye Cy5 at the 5' end and Black Hole Quencher 2 (BH2) at the 3' end, are added to each well of a control plate. The plates are again spun at 1200 rpm for 30 seconds. Final concentrations for the assay are: 63 nM IRE- la substrate, 5,82 ng IRE-Ι α protein, and 2.5 uM test compound. 901] The plates are covered with lids and i cubated for one hour at 30 °C. The plates are then transferred to an ACQUEST™1 microplate reader. Data is analyzed using data analysis software, and the percent activity of IRE-la is calculated.
EXAMPLE 36
Determination of IC so for inhibition of IRE-la
902} IC-50 for inhibition of IRE-la of compounds identified in Table 1 was measured as
described in EXAMPLE 35.
EXAMPLE 37
Kinase selectivity assays
903] Compounds are assayed for their ability to inhibit 86 different kinases at a concentration of 10 μ,Μ, The results of the assays demonstrate that these compounds are selective for IRE-l a.
EXAMPLE 38
Cell-based assays
904] Human myeloma MM.1 s cells are incubated with a compound for 1 .25 hours before stressing the cells with 2mM dithiothreitol (DTT). After an additional 45 minutes (2 hours total) with compound and DTT, the cells are harvested with TRIZOL'* (a mono- phasic solution of phenol and guanidine isothiocyanate), and total RNA is prepared as directed by the manufacturer (Invitrogen). Human XBP-1 is amplified by RT-PCR with the following primers, which flank the 26 base unconventional ititroti excised by IRE-l :
CCTGGTTGCTGAAGAGGAGG (SEQ ID NO:2) (forward) and
CCATGGGGAGATGTTCTGGAG (SEQ ID NO:3) (reverse).
905] In unstressed cells, IRE-la is inactive and hence, the 26 base intron is left in the XBP-1 mRNA. RT-PCR of unstressed (U) cel ls then generates the upper band. When cell s are stressed (S) with the endoplasmic reticulum (ER) stressing agent DTT, IRE- la is activated due to accum.uiati.ng unfolded protein and the resulting RT-PCR. product is 26 base pairs shorter. Increasing amounts of the compound block IRE-la-mediated XBP-1 splicing as demonstrated by a shift from a lower band to an upper band. Compound potency reflects SAR in the in vitro enzyme assay.
Determination of cellular EC 50 for IRE- la inhibitors
906] Compounds whic pass specificity assays are assayed for cellular EC50 using endogenous XBP-1 splicing in myeloma ceils. XBP-1 is regulated through the excision of a 26 nucleotide intron from the XBP-1 mR A by the highly specific endoribonuclease activity of IRE- la. This splicing event induces a frame shift in the ORE of the C- terminus of XBP-1 leading to the translation of the larger 54kD active transcription factor rather than the inactive 33kD form. This splicing event is used to measure IRE- la activity on XBP-1 mRNA in cells and tissues.
9Θ7] Briefly, compounds are incubated in the presence or absence of an ER stress agent (e.g., DTT), and the ratio ofXBP-lu (unspliced) to XBP-1 s (spliced) is quantified by RT-PCR. The ED50 is determined as the 50% XBP-ls to total XPB-1 levels. Compounds which have EC50S equal to or below 10 μΜ are used in standard apoptosis assays, including Annexin V staining and CA8PASE-GLQ*.
908] Proliferation assays using myeloma cell lines (U266, RPMI8226 and MM. Is) are used to determine ED50. Compounds are used as single agents and in combination with other chernotherapeutic drugs. IRE- la inhibitor compounds inhibit the proliferation of
RPMI8226 myeloma cells, which have endogenous activation of the pathway and are further induced by the addition of bortezomib. When an IRE-Ια inhibitor compound is used in combination with MG-132, increased apoptosis is observed with U266 myeloma ceils. EXAMPLE 39
Animal Model/ 'Preclinical Validation Studies
909] The preclinical validation strategy employs a set of animal models representing norma! tissues under chemical stress and multiple myeloma xenographs. The normal animal model is employed as a surrogate model where dose-related on-target activity of compounds can be confirmed in tissues sensitive to standard UPR inducing agents such as tunicamycin (Wu et al., Dev Cell. 2007 Sep;13(ld):351-64). Normal mouse tissues are not under ER stress, and therefore the XBP-1 mRNA remains as the inactive, unspliced form. Upon induction with tunicamycin, tissues induce active XBP-1 mRNA. splicing, and this activity is suppressed by IRE- la inhibitors. This on-target ER stress animal model is a useful screening and early pharmacokinetic tool.
91Θ] Antibody production is evaluated in a second surrogate model. However, in cell-based models, IRE- la inhibitors have been shown to potently inhibit antibody production.
911 ] Final efficacy studies are performed in myeloma xenograft models, as described below, EXAMPLE 40
RPMI8226 xenograft efficacy model
912] SCID mice are evaluated for their ability to support implantation of desired tumor cells in support of model development and characterization. Mice are injected intravenously (5) or implanted either subcutaneous ly (SC) or intraperitoneaily (IP). To generate a relevant animal model mimicking human disease, it is desirable that all three approaches are evaluated for improved implantation rates and relevant disease progression, as is well known in the art. SC injections provide an easy way to measure tumor growth and efficacy, and IV and IP injections represent a more physiologically relevant model of human tumor spread. SC injections are given primarily in the flank, while IV injections are administered in the tail vein. Mice are manually restrained for SC and IP injections, and a Broome mouse restrainer is used for IV injections. EXAMPLE 41
Evaluation of IRE- la inhibitor compounds in a xenograft efficacy model ] SCID mice are implanted with tumor ceils (human RPMI8226 myeloma cells) via IP, IV or SC routes based on the results from the xenograft model development studies (above). Mice are treated with compound or mock treated (vehicle) for a period of up to 4-5 weeks. Compound administration can be via IV, IP, PO or SC routes. In some cases, tumcamycin is administered via IP injection in order to stimulate stress in the animal. This stress mimics the stress an animal may undergo during times of tumor growth. The tunicaymycin injection mimics tumor growth during times of stress and permits evaluation of biomarkers which indicate the effectiveness of a compound (such as XBP-1 splicing) by RT-PCR, irnmunohistochemistiy, or Western blots. ] Mice are monitored for tumor growth, regression and general health. Tumors are collected and characterized by immunohistochemistry and/or FACS analysis. Tumor growth is measured by calipers, ultrasound, or by abdominal lavage. Biomarkers in the blood or tumor can evaluated (primarily XBP-1 splicing). ] In some experiments, blood samples are collected at various time points during the dosing (i.e., day 1 or week 4 etc.) to evaluate the pharmacokinetic profile. The time points of blood collection vary depending on the pharmacokinetic properties of the drug being tested. The volume of blood sample is 100 micro liters/per time point, and mice are bled twice after drug administration within a 24 hour period via retro-orbital sinus. If the same mouse is used, blood samples are collected once from each eye during 24 hours, ] Tumor cells are cultured and injected IP, IV (tail vein) or SC (flank) in the mouse using a 21G needle in a volume of approx 100 μΕ. Mice are treated with compounds or vehicle alone as a control by IV, IP, SC or PO routes 5 days per week for up to 4-5 weeks. Blood is collected via retroorbital bleed (100 id) at 2 time points (different eyes). The endpoint of the study depends on the overall health of the mice: while mice are euthanized at the end of 4-5 weeks in most studies, mice are maintained until day 40 in a few studies if their general health will allow. The reason for maintaining studies for 40 days is to determine if the tested compounds have a long term effect on inhibiting tumor growth. Euthanization of mice in which tumor regression is observed will depend on the experimental design, in screening mode, the experiment will end with tumors in the control/untreated group reach 1.5 cm, are ulcerated or when loss of motility is observed in that group. In follow up experiments, mice in which tumor regression is observed may be maintained longer, until they show signs of tumor growth of ill health.
917] Therapeutic dosing with bortezomib 0.75mg/ kg IV twice weekly of SCID mice bearing human myeloma RPMI8226 tumor xenografts resulted in suppression of tumor growth. However, after cessation of bortezomib therapy, tumors often recurred and grew into large masses. Therefore, mice will be treated in combination as with both bortezomib (as indicated) and twice daily with 10-60mg/kg IRE-la/XBP-1 inhibitors such as compound 17-1 by oral, IP or IV administration. Compounds which reduce the incidence of tumor recurrence are identified.
EXAMPLE 42
Combination therapies
918] The spliced form of X.BP-1, as a homodimer and heterodimer with ATF-6,
transcriptionally regulates genes involved in adapting to ER stress (Wu et a!., Dev Ceil. 2007 Sep;13(ld):351-64). Many of these downstream targets are major chaperones, co- chaperones and ERAD components of the ER. Chaperones such as GRP78 and GRP94 are stable and long lived proteins with half lives on the order of days (Wu et a!., Dev Cell. 2007 Sep;13(ld):351-64). Therefore, treatment of cancer with an IRE-l a/XBP-1 inhibitor may require up to 5 to 6 days of treatment in each cycle.
919] In some embodiments, combination therapy given in cycles such as with proteasome inhibitors involves giving the patient 2 days of pretreatment with IRE-la/XBP-1 inhibitor and then simultaneously with the chemotherapeutic agent until a pharmacodynamic effect is achieved (typically 24 hours post bortezomib infusion). Bortezomib is typically administered on three week cycles, every 1 , 4, 8 and 11 days (of 21). Dosing is 1 .3mg/m2 by IV administration. IRE-la/XBP-1 inhibitors can be administered 2 day prior and 24 hours post infusion of boriezomib at 10 to 100 mg/kg by the I V or oral route once, twice or three times daily depending on the PK/PD relationship,
A. similar protocol can be employed with Hsp90 and or HDAC inhibitors. Alternatively, both agents are administered simultaneously for the duration of each cycle depending on the PK/PD relation of the inhibitor. IRE-la/XBP-l inhibitors can be given to breast cancer patients in combination with Tamoxifen (Gomez et a!., FASEB J. 2007
Dec;21(2):4G 13-27) or in combination with Sorafinib to various other cancers including kidney carcinoma and hepatocellular carcinoma (Rahmani et ah, Mol Cell Biol. 2007 Aug;27(15):5499-513).
In general, because many kinase inhibitors often are not selective on their targeted kinase and often affect many additional kinases; they may cause non-specific cellular stress which may activate the UPR. Therefore, combination approaches may be useful using IRE-la/XBP-l inhibitors as sensitizing agents.
EXAMPLE 43
Inhibition of RlDD-targeted degradation a. Experimental procedures
Cell culture. RPMI 8226 cells were grown in monolayer culture using Dulbecco's Modified Eagle Medium (DM EM) supplemented with 10% fetal calf serum (PCS) at 37°C and 5% C02. Compounds were kept as lOmM stock in DMSO at -20°C and diluted in medium to 1 ΟμΜ, Tbapsigargin (Tg) was resuspended in DMSO and diluted in medium,
RT-qPCR. Procedures for measuring XBP-ls and XBP-lu mRNAs have been described previously (Volkmann et ah , J. Biol. Chem. 286, 12743-55, 201 1 ). Briefly, total RNA was harvested from ceils or tissue using TRIZOL® (Invitrogen) according to the manufacture's procedures. After ethanol precipitation and resuspension of the RNA, RIBOGREEN® (invitrogen) was used to quantify the yield-and normalize the RNA concentration in the source tube containing isolated RNA , RT-PCR was performed by oligo dT priming, SUPERSCRIPT® II (Invitrogen) and reverse transcription using the AMPL1TAQ GOLD® Kit (Applied Biosystems) according to the manufacturer's protocols. Primers for human XBP- 1 were
5 '-CCTGGTTGCTGAAG AGGAGG-3 ' (forward, SEQ ID NO:2 ) and
5'-CCATGGGGAGATGTTCTGGAG-3' (reverse, SEQ ID N():3). ] All DNA oligos were purchased from IDT DNA Technologies. PCR reactions were run on a Bio-Rad PTC- 100® 96-weli thermocycler; heating at 94°C for 30 seconds, annealing at 58°C for 30 seconds polymerizing at 72°C for 30 seconds for 35 cycles. ] The same RNA preparations were used to evaluate levels of CD59 and Blosl by RT- qPCR. CDS 9 primers were and the probe and primer sequences were
CD59 224s: CCAGTTGGTGTAGGAGTTGAGACC (SEQ ID NO:4);
CD59 354a: AGGCTATGACCTGAATGGCAGA (SEQ ID NO:5); and
CD59ap: CAGCCAGGACGAGCAGCAGCCCG (SEQ ID NO:6). ] Blosl probes were commercially available from Applied Biosciences (Hs00155241_ml). b. Results ] Low levels of IRE- la activation where observed in unstressed human RPMI 8226 plasmacytoma cells as demonstrated small amounts of XBP-ls relative to XBP-lu (Fig, 1). Treatment of RPMI cells for 2 hours with 300nM Thapsigargin (Tg) induced near complete conversion of XBP-lu to XBP-ls and lOuM compound inhibited this completely (Fig. 1 ). When compound B was added in combination with Tg for the 2 ,4, 6, 8, 16 and 24 hours, complete inhibition of XBP-l s with repopulation of XBP-lu was observed. RNA samples from this experiment were subjected RT-qPCR using specific primers for CDS 9 and Blosl . Inhibition of RID D targeted degradation of Blosl (Hoilien, 2009) and CD59 (Oikawa, 2007) was observed by RT-qPCR. (Fig. 2). EXAMPLE 44
Measurement ofXBP-1 slicing inhibition in the livers and kidneys of CBI 7 SCID mice in response to tunicamycm and subsequent treatment with an IRE- la inhibitor
[928] CBI 7 SCID mice were treated with lmg/kg tunicamycm by intraperitoneal (IP) injection at time 0 (T::::0). Two hours later, compound A formulated in 10% hydroxy beta propyl cyclo dextran HBPCD was administered by IP injection. Doses were 50mg/'kg, 25mg/kg and IQmg/kg (4 mice in each group). Mice were sacrificed two hours later (4 hours from T=0), and the designated organs were harvested (Figure 3 A).
1929] RT-PCR analysis was performed using murine-specific XBP-1 primers from total RNA harvested from specified organs. The results are shown in Figure 4B. Tunicamycm alone induces XBP-1 spliced (XBP-ls) relative to PBS treated mice. Dose response for target inhibition (XBP-ls) can be observed with increasing doses of compound A administered IP in both the liver and kidney. Each lane represents an individual mouse where RNA was harvested and RT-PCR was performed. Method of RNA extraction and RT-PCR analysis is described in Volkmann et al, J. Biol. Chem. 286, 12743-55, 201 1.
[930] The experiment was repeated using intravenous (IV) administration of compound A
(50mg/kg, 25mg/kg and ! Omg/kg) and oral administration of compound A (IGOmg/kg, 50mg/'kg or 25mg/kg), The results are shown in Figures 4A and 4B, respectively.
EXAMPLE 45
Inhibition of XBP-1 splicing in the tumors ofRPMI 8226 human myeloma cells in tumor bearing SCID mice by intraperitoneal administration of an IRE- la inhibitor
[931] Mice were implanted subcutaneously with 10' RPMI8226 cells on day 0. After 32 days of tumor growth, mice were treated with lOOmg/kg compound B by IP administration. After 3, 6 and 24 hours of exposure, tumors were harvested and RNA was prepared (Figure 5 A). RT-PCR amplification of XBP-1 was performed using human specific primers (Volkmann et al, J. Biol. Chem. 286, 12743-55, 201 1 ) and splicing was analyzed by agarose gel electrophoresis. Three tumors for each of the time points were analyzed against untreated, 3 tumors, and 2 vehicle treated tumors (Figure 5B). Target inhibition was observed for ail 3 time points up to 24 hours when compared to endogenous splicing levels in control groups.
EXAMPLE 46
Inhibition ofXBP-1 splicing in the tumors of RPMI 8226 human myeloma cells in tumor- hearing SCID mice by oral dosing with an IRE- la inhibitor
932] Mice were implanted with 10 ' RPMI8226 cells subcutaneously on day 0. After 28 days of tumor growth, mice were treated with 2Q0mg/kg, ] OOmg/kg, 50mg/kg and 25mg/kg compound Y by oral dosing. After 4 hours of exposure, tumors were harvested and RNA was prepared (Figure 6A). RT-PCR amplification of XBP-1 was performed using human specific primers (Volkmann et ai, J. Biol, Chem. 286, 12743-55, 2011) and splicing was analyzed by agarose gel electrophoresis. Four tumors for each dose group were analyzed against 4 untreated control tumors (Figure 6B). Target inhibition was observed for the 3 higher dose groups: 200, 100 and 50mg/kg while the lowest dose group, 25mg/kg was comparable to endogenous splicing levels in the control group.
EXAMPLE 47
Figure imgf000330_0001
Figure imgf000330_0002
)33] Synthesis of ethyl 4-bromo-2-methyl-3-oxobutanoate 1 ) 3r2 / CHCI3, 0 °C lo RT, 16 h
Figure imgf000331_0001
) air bubble, RT, 2 h ] The solution of Br2 (58,0 g, 364,5 mmol) in CHCI3 (50 mL) was added dropwise to the solution of compound 1 (50.0 g, 347.2 mmol) in CHCI3 (320 mL) at 0 °C, Then the reaction mixture was allowed to warm slowly to RT and stirred for 16 h. Air was bubbled to the reaction mixture at RT for 2 h. The reaction mixture was diluted with DCM (300 mL), washed with sat. Na2S03 (150 mL) and brine (100 mL x 2). The organic layer was dried over Na2S04, filtered, concentrated, afforded crude compound 2 (50 g ) as light yellow oil without further purification. The crude product was stored in frige below 0 °C. ] Synthesis of 4-(bromomethyl)-7-hydroxy-6-methoxy-3-methyl-2H-chromen-2-one
Figure imgf000331_0002
2 4 ] Compound 2 (19.0 g, 85.71 mmol) and compound 3 (10.0 g, 71.42 mmol) were added to CH3SO3H (80 mL) at RT. The reaction mixture was stirred at RT for 16 h, then poured into ice-water (300 mL), extracted with EA (100 mL x 3). The combined EA was washed with brine, dried over Na2S04, filtered, concentrated, purified by silica gel column (PE: EA =;: 2: 1 ), afforded 5.6 g of the crude compound 4. Then the crude product was triturated with EA, afforded compound 4 (2.5 g, 9.7%) as white solid. 3 Synthesis of Compound 5
Figure imgf000331_0003
4 5 [938] Compound 4 (1 eq) was added to MeCN. The solution of amine (2.5 eq) in MeCN was added dropwise at RT and stirred for 16 h. The reaction mixture was concentrated. The residue was diluted with H20, extracted with DCM. The combined DCM was dried over Na?S04, filtered, concentrated, afforded crude compound 5 without further purification.
[939] Synthesis of Compound 6
Figure imgf000332_0001
Compound 5 (1 eq) and HMTA (4 eq) were added to TFA. The mixture was heated to 90 °C for 2.5 h. After cooled to RT, the reaction mixture was concentrated, purified by prep- HPLC afforded compound 6.
Figure imgf000332_0002
7-Hydroxy-6-methoxy-3-methyl-4-(morphoiinomethyl)-2-oxo-2H-chromene-8- carbaldehyde was obtained by the above procedure at 45.7% yield. 1HNMR (CDCI3, 400 MHz): δ 12.43 (s, I I I. OH), 10.59 (s, H i. CHO), 7.75 (s, i l l ArH), 3.93 (s, 3H, ArOCH3), 3.68-3.66 (m, 6H), 2.56-2.53 (m, 4H), 2.26 (s, 3H, CH3). MS [ESI, MH+] : 334.1
Figure imgf000332_0003
3 1 4-((DimethyIamino)methyl)-7-hydroxy-6-met^
carbaldehyde hydrochloride was obtained by the above procedure at 22% yield.
IX MR (DMSO-d6, 400 MHz): δ 10.45 (s, i l l. CHO), 7.58 (s, 1H, ArH), 4.68 (s, 2H, NCH2), 4.00 (s, 3H, OCH,), 2.86 (s. 6H, 2(1 1,0. 2.25 (s, 3H, CH3). MS [ESI,
292.1
EXAMPLE 48
Figure imgf000333_0001
Figure imgf000333_0002
10 Synthesis of 4-(¾romomethyi)-7-hydroxy-5-methoxy-3-methyi-2H-chrornen-2-one
Figure imgf000333_0003
Compound 2 (38.0 g, 171.1 mmol) was added dropwise to the solution of compound 7 (20.0 g, 142,8 mmol) in H3PO4 (200 mL) at 0 °C. The reaction mixture was warmed slowly to RT and stirred for 16 h, then poured into ice-water (500 mL), extracted with EA (200 mL x 3). The combined EA was washed with sat, NaHCCh, dried over Na2S04, filtered, concentrated. The crude product was purified by silica gel column (PE: EA =;: 3:
35+ 1), then washed with DCM, afforded crude 4-(bromomethyl)-7-hydroxy-5-methoxy-3- methyi-2H-chromen-2-one (8 g, 55% purity) without further purification.
Synthesis of Compound 9
Figure imgf000334_0001
Compound 8 (1 eq) was added to MeCN. The solution of amine (2.5 eq) in MeCN was added dropwise at RT and stirred for 16 h. The reaction mixture was concentrated. IN HQ was added to the residue, stirred for 15 rain. The undissolved material was removed by filtration. The filter was washed with DCM, then basified by saturated NaHC0 , extracted with DCM. The combined DCM was dried over Na2S04, filtered, concentrated, afforded compound 9 as light green solid.
Synthesis of Compound 10:
Figure imgf000334_0002
Compound 9 (1 eq) and HMTA (4 eq) were added to AcOH. The mixture was heated to 120 °C for 2 h. After cooled to RT, the reaction mixture was concentrated, purified by prep-HPLC and prep-TLC, afforded compound 10 as yellow solid.
Figure imgf000334_0003
7-Hydroxy-5-methoxy-3-methyI-4-(morpholi!iometliyI}-2-oxo-2H-cliroaie!ie-8- carbaldehyde was obtained by the above procedure at 19,6 % yield. 1HNMR. (CDCI3, 400 MHz): δ 12.57 (s, i l l. OH), 10.41 (s, 1H, CHO), 6.30 (s, 1H, ArH), 3.94 (s, 3H, Λ Κ '! ! ). 3.83 (s, 2H, CH2), 3.61 (br, 4H, 2CH2), 2.48 (br, 4H, 2CH2), 2.24 (s, 3H, CH3). MS [ESI, ΜΪ-Γ]: 334.1.
Figure imgf000335_0001
4~((DimethyIamino)methyl)~7-hydroxy-5-meth^
carbaldehyde was obtained by the above procedure at 20 % yield. 'HNMR (CDCI3, 400
MHz): δ 12.54 (br, 1H, OH), 10.40 (s, 1 H, CHO), 6.30 (s, I I I ArH), 3.99 (s, 3H,
ArOCH3), 3.78 (s, 2H, CH2), 2.29 (s, 6H, 2CH3), 2.24 (s, 3H, CH3). MS [ESI, MH+]: 292.1 .
EXAMPLE 49
Figure imgf000335_0002
2 4
Figure imgf000335_0003
5 Synthesis of ethyl 4-methoxy-3-oxobutanoate o o MeOH, NaH, D F o o
MeO
OEi . .:),-, ... _- ^ ^ OEi
0 JC to RT, 16 h
2
NaH (7.71 g, 192,7 mmol) was suspended in DMF (110 mL). The solution of MeOH (2.64 g, 82.5 mmol) in DMF (55 mL) was added drop wise at 0 °C. After that, the mixture was stirred at 0 °C for 30 min. The solution of compound 1 (9.54 g, 57.9 mrnoi) in DMF (55 mL) was added dropwise at 0 °C, then the reaction mixture was allowed to warm slowly to RT and stirred for 16 h. The reaction mixture was diluted with IN HCI (400 mL), extracted with MTBE (250 mL x 3). The combmed organic layer was washed with ¾0 (200 m . x 5), dried over Na2S04, filtered, concentrated, purified by silica gel column (PE: EA. = 10: 1) afforded ethyl 4-methoxy-3-oxobutanoate (1.4 g, 15.1%) as light yellow oil- Synthesis of 7-hydroxy-6-methoxy-4-(methoxymethyl)-2H-chromen-2-one
Figure imgf000336_0001
4
Compound 2 (1.50 g, 3.61 mmol) and compound 3 (1.24 g, 8.85 mmol) were added to CH3SO3H (15 mL) at RT. The reaction mixture was stirred at RT for 16 h, then poured into ice-water (100 mL), extracted with EA (30 mL x 3). The combined EA was washed with sat. NaHC03, dried over Na2S04, filtered, concentrated, purified by silica gel column (PE: EA = 3: 1) 7-hydroxy-6-methoxy-4-(methoxymethyl)-2H-chromen-2-one (620 mg, 27.9%) as white solid.
Synthesis of 7-hydroxy-6-methoxy-4-(methoxymethyl)-2-oxo-2H-chromene-8- carbaidehyde
Figure imgf000337_0001
Compound 4 (520 mg, 2.21 mmol) and HMTA (1230 mg, 8,78 mmoi) were added to TFA (30 mL). The mixture was heated to reflux for 3 h. After cooled to RT, the reaction mixture was concentrated, purified by pre-HPLC, afforded 7-hydroxy-6-methoxy-4- (methoxymethyl)-2-oxo-2H-chromene-8-carbaldehyde (200 mg, 34.2%) as yellow solid. TTNMR (CDCI3, 400 MHz): 6 12.55 (s, 1 H, OH), 10.61 (s, I I I. CHO), 7.20 (s, H i. ArH), 6.43 (s, 1H, =CH), 4.57 (s, 2H, OCH2), 3.95 (s, 3H, ArOCH3), 3.50 (s, 3H, OCH3). MS [ESI, Ml ! j: 265.2.
EXAMPLE 50
Figure imgf000337_0002
Figure imgf000337_0003
Synthesis of Compound 6:
Figure imgf000337_0004
EtONa (1.48 g, 21.87 mmol) was suspended in EtOH (35 mL). The solution of compound 2 (3.50 g, 21.87 mmol) in EtOH (15 mL) was added dropwi.se at RT and stirred for 30 min. The solution of Br(CH2)2COOEt (3.93 g, 21.87 mmol) in EtOH (15 mL) was added dropwise and stirred at RT for 16 h. The reaction was quenched with 2 N HCi (10 mL). concentrated. The residue was diluted with H20 (50 mL), extracted with DCM (25 mL x 3). The combined DCM was dried over Na2S04, filtered, concentrated, afforded crude compound 6. (5.4 g) as yellow oil, without further purification.
Synthesis of Compound 7:
Figure imgf000338_0001
6 7
Compound 6 (5.4 g, 20.76 mmol) and compound 3 (2.32 g, 8.85 mmol) were added to CH3SO3H (55 mL) at RT. The reaction mixture was stirred at RT for 16 h, then poured into ice-water (300 mL), extracted with EA (100 mL x 3). The combined EA was washed with sat. NaHC03, dried over Na2S04, filtered, concentrated, purified by silica gel column (PE: EA = 3: 1), afforded compound 7 (3.0 g, 42.9%) as white solid.
Synthesis of Compound 8:
Figure imgf000338_0002
7 8
Compound 7 was added to amine and the reaction mixture was stirred at 120 °C for 16 h. LC-MS showed that the starting material was almost consumed completely. The solvent was removed under vacuum. The residue was purified by silica gel column, afforded compound 8. Synthesis of Compound 9:
Figure imgf000339_0001
Compound 8 (1 eq) and HMTA (4 eq) were added to TFA . The mixture was heated to reflux for 2 h. After cooled to RT, the reaction mixture was concentrated, purified by prep-HPLC, afforded compound 9 as yellow solid.
Figure imgf000339_0002
3-(8-formyI-7-hydroxy-6-methoxy-4-(methoxymethyl)-2-oxo-2H-chromen-3-yI)-N- (2-methoxyethyl)propanamide was obtained by the above procedure from amine Ai. 26.7% yield. 1HNMR (CDC13, 400 MHz): 612.47 (s, 1H, OH), 10.58 (s, 1H, CHO), 7.44 (s, 1H, ArH), 5.84(br, 1H, M i ). 4.72 (s, 2H, OCH2), 3.94 (s, 3H, ArOCH3), 3.46 (s, 3H, {)('] ! :. }. 3.40-3.39 (m, 4H, 2CH2), 3.29 (s, 31 1. ()CH3), 3.03 (t, J =7.2 Hz, 2H), 2.51 (t, J =7.2 Hz, 2H). MS [ESI, MET] : 394.2.
Figure imgf000339_0003
7-Hydroxy-6-methoxy-4-(methoxymethyl)-3-(3-morphoIino-3-oxopropyl)-2-oxo-2H- chromesie-8~citrbaldehyde was obtained by the above procedure from amine A2. 12.7% yield. 1H MR (CDCi3, 400 MHz): δ 12.44 (s, 1H, OH), 10.58 (s, 1 1 1. CHO), 7.44 (s, 1 H, ArH), 4.76 (s, 2H, OCH2), 3.94 (s, 3H, ArOCH3), 3.66-3.63 (m, 4H, 2CH2), 3.59-3.58 (m, 2H, Of I ·■}.3.50-3.49 (m, 2H, ( I f > 3.49 (s, 3H, OCH3), 3.02 (t, 2H, J= 7.2 Hz, CH2), 2.65 (t, 2H, J= 7.2 Hz, CM-). MS [ESI, Mi! h 406.2
Figure imgf000340_0001
)67] 3-(8-Formyl-7-hydroxy-6-methoxy-4-(methoxymethyl)-2-oxo-2H-chromen-3-yl)-N- (2~morphoiinoethyl)propa»amide as obtained by the above procedure from amine A5. 37.9% yield.1HNMR (CDC13, 400 MHz): 510.58 (s, ill. CHO), 7.44 (s, IH, ArH), 4.72 (s, 2H, CH2), 3.94 (s, Ml. ArOCH3), 3.73 (br, 4Π.2CH2), 3.46 (s, 3H, OCH3), 3.35 (br, 2H, CH2), 3.04 (t, J =7.2 Hz, 2H, CH2), 2.53-2.50 (m, 8H); MS [ESI, Ml!']: 449.2
EXAMPLE 51
Figure imgf000340_0002
Figure imgf000340_0003
Synthesis of 5-(7-hydroxy-6-methoxy-4-methyl-2-oxo-2H-chromen-3-yl) thiophene-2- carboxylic acid
Figure imgf000341_0001
Compound 1 (15 g, 46 mmol), the boric acid (8.7 g, 50.6 mmoi), Pd(PPh3)4 ( 1.88 g, 2.3 mmol), Na2C03 ( 12.1 g, 1 15 mmoi) were added to DMF (250 mL). The reaction mixture was degassed with N2 for three times, and then heated to 90 °C for 16 h. A fter cool ed to RT, the solvent was concentrated, the residue was dissoloved in sat Na2C03 (150 mL). The aqueous was washed with DCM (100 ml. x 4), and then acidified by con.HCl to pli to - 4. The result precipitate was collected by filtration, triturated with hot EA (50 mL), afforded compound 2 ( 6.5 g, 42%) as yellow solid. ]HNMR (DMSO-d6, 400 MHz): δ 10.55 is. ! i ! 7.71(d, J = 4.0 Hz, 1 1 1 ). 7.24(s, 1 1 1 ). 7.19 (d. J 4.0 Hz, I H), 6.86 (s, I H), 3.88 (s, 3H), 2.45 (s, 3H).
Synthesis of Compound 3 :
Figure imgf000341_0002
Compound 2 (1 eq), HATU (1 .5 eq) and Et3N (2.5 eq) were added to dry DMF. The mixture was stirred at RT for 30 min, then amine (1.5 eq) was added. The reaction mixture was stirred at RT overnight. 2N HO was added, later extracted with DCM. The combined DCM was washed with satturated NaHC<¾, dried over Na2S04, filtered, concentrated, purified by silica gel column, afforded compound 3. Synthesis of Compound 4
Figure imgf000342_0001
Compound 3 (1 eq) and HMTA (4 eq) were added to TFA. The mixture was heated to reflux for 30 min. After cooled to RT, the reaction mixture was concentrated, purified by prep-HPLC, afforded compound 4.
Figure imgf000342_0002
7~Hydroxy-0~methoxy~4~meihy!-3-(5~(morphoM
2H-chron¾ene-8-carbaldehyde was obtained by the above procedure from amine A2. 31% yield. 1HNMR (DMSO-d6, 400 MHz): δ 10.46 (s, 1H), 10.38 (s, H i ). 7.53 (s, H i ). 7.44 id. J 3.6 Hz, 1 1 1 ). 7.17 (cL ./ 3.6 Hz, IH), 3.94 (s, M l ). 3.67-3.64 (m, 8H), 2.48 (s, 3H). lHNMR (CDCh, 400 MHz): 512.57 (s, IH), 10.63 (s, 1H),7.31 (d, J =3.6 Hz, I H), 7.23 (s, H i ). 7.06 (d, J -3.6 Hz, IH), 3.98 (s, 3H), 3.81-3.74 (m, 8H), 2.48 (s,3H). MS [ESI, MH ]: 430.1.
Figure imgf000342_0003
7~Hydroxy-6-methoxy-4~methyl-3-(5~(4-m
yl)-2-oxo-2H-chromene-8-carbaldehyde hydrochloride was obtained by the above procedure from amine A3.34% yield. HNMR (MeOD, 400 MHz): δ 7.48 (d, J= 4.0 Hz, 1H),7.23 (s, IH), 7.13 (d../ 4.0 Hz, IH), 6.02 (s, IH), 4.66-4.62 (m, 2H), 3.94 (s, M l). 3.61-3.52 (m, 4H), 3.25-3.19 (m, 2H), 2.97(s, 3H), 2.50 (s, 3H).
Figure imgf000343_0001
5-(8-Formyl-7-hydroxy-6-methoxy-4-methyl-2-oxo-2H-chromen-3-yl)-N-(2- morpholinoethyl)thiophene-2-carboxamide hydrochloride was obtained by the above procedure from amine A5.22% yield. ' ΙΧΥΙΗ (MeOD, 400 MHz): 67.73 (d, J ------ 4Hz,
1H),7.27 (s, IH), 7.14 (d, 4Hz, IH), 6.03 (s, 1H),4.11-4.07 (m, 2H),3.95 (s, 3H),3.82- 3.76 (m, 4H),3.70-3.67 (m, 211).3.43-3.40 (m, 2H),3.25-3.21 (m, 2H), 2.50 (s, 3H). 1HNMR (DM80, 400 MHz, T = 273 + 80 ): 610.49 (s, IH), 8.88 (t, ,/ 6.0SIz.1H),7.90 (d,J= 4Hz, iH),7.55(s, lH),7.18(d, J= 4Hz, 1H),3.95 (s, 3H), 3.94-3.92 (m, 4H),3.74- 3.69 (m, 2H),3.34-3.31(m, 4H), 3.31-3.10( m, 2H),2.48 (s, M i). MS [ESI, MH+]: 473.2.
EXAMPLE 52
Figure imgf000343_0002
Figure imgf000343_0003
>77] Synthesis of N-(2, 4-dimethoxyphenyl)-2,2,2-trifluoroacetamide
Figure imgf000344_0001
[978] Compound 1 (38 g, 249.6 mmol) and pyridine (21.7 g, 275.0 mmol) were dissolved in
DCM (750 ffiL). (CF3CO)20 (57.7 g, 275.0 mmol) was added dropwise at 0 °C. After that the reaction mixture was stirred at RT for 16 h. The reaction mixture was diluted with DCM (500 mL), washed with IN HC1, concentrated. The residue was purified by silica gef column (PE: EA = 10: 1), afforded compound 2 (45 g , 72%) as white solid.
[979] Synthesis ofN-(2,4-dimethoxyphenyI)-2,2,2-trifluoro-N-methylacetaraide
Figure imgf000344_0002
[980] NaH (2.2 g, 90.3 mmol) was suspended in DMF (25 mL), cooled to -20 °C. The solution of compound 2 (15 g, 60.2 mmol) in DMF (50 mL) was added dropwise and stirred 0 dC for 1 h. Mel (17.1 g, 120.4 mmol) was added dropwise at -20 JC, then stirred at RT for another 1 h. The reaction mixture was quenched with H?0, extracted with EA, dried over Na?S04, filtered, concentrated. The residue was purified by silica gel column (PE: EA = 3: 1 ), afforded compound 3 (14 g , 88%) as white solid.
[981] Synthesis of -(2,4-dihydroxyphenyl)-2,2,2-trif!uoro- -methylacetaniide
Figure imgf000344_0003
] Compound 3 (8 g, 30.4 mmol) was dissolved in DCM (80 mL), cooled to -60 UC. The solution of BBr3 (30.4 g, 121.6 mmol) in DCM (40 mL) was added at -60 °C. After that, the reaction mixture was stirred at RT for 1 h. Then the reaction was quenched with H2Q, extracted with DCM. The combined DCM was dried over Na2S04, filtered, concentrated. The residue was purified by silica gel column (PE: EA = 1 : 1), afforded compound 4 (6.1 g , 85.9%) as white solid.
] Synthesis of ethyl 3-(7-hydroxy-4-methyl-6- (methylamino) -2-oxo-2H-chromeii-3- yl)propanoate
Figure imgf000345_0001
] Compound 4 (5 g, 21.2 mmol) and compound 5 (5.6 g, 24.3 mmol) were stirred at 0 °C. CH3SO3H (50 mL) was added dropwi.se. Then the mixture was stirred at RT for 16 h. The reaction mixture was poured into crush ice, extracted by DCM. The DCM layer was washed with sat.Na2HP04, dried over Na2S(>4, filtered, concentrated. The residue was purified by silica gel column (DCM: EtOH = 50: 1), afforded compound 6 (1.2 g , 18%) as light yellow solid.
] Synthesis of ethyl 3-(7-hydroxy-4-methyl-6-(N-methylacetamido) -2~oxo-2H-chromen-3- yl) propanoate
Compound 6 (0.7 g, 2.2 mmol) and pyridine (0.18 g, 2.3 mmol) were dissolved in DCM ( 10 mL). CH3CQCI (0.2 g, 2.5 mmol) was added dropwise at 0 °C. After that the reaction mixture was stirred at RT for 2 h. The reaction mixture was diluted with DCM (10 mL), washed with I N HCI, concentrated. The residue was purified by silica gel column (DCM : EtOH = 100: 1), afforded compound 7 (0.56 g, 70%) as light yellow solid. 1HNMR (CDC13, 400 MHz): 8 7.38 (s, 1H, ArH), 7.00 (s, 1H, ArH), 4, 13 (q, J = 7.2 Hz, 2H, (Ί ! , }. 3.46 (s, 3H, \{ Π ·. ). 2.96 (t, 7.2 Hz, 2H, ( Ί !■}. 2.61 (t, J = 7.2 Hz, 211 CH2), 2.43 (s, 3H, ( ! ! .· ). 1.90 (s, 3H, CH3), 1.24 (t, 7.2 Hz, 3H, CH3).
[987] Synthesis of ethyl 3-(8-fonnyl-7-hydroxy-4-methyl-6-(N-methylacetaiiiido) -2-oxo-2H- chromen-3~yi)propanoate
Figure imgf000346_0001
7
[988] Compound 7 (516 mg, 1.48 mmol) and HMTA (832.8 mg, 5.94 mmoi) were added to
AcOH (13 mL). The reaction mixture was heated to 120 °C for 5 h. The reaction mixture was concentrated. The residue was purified by prep-HPLC and prep-TLC successively, afforded Synthesis of ethyl 3-(8-formyl-7-hydroxy-4-methyl-6-(N-methylacetamido)-2- oxo-2H-chromen-3-yl)propanoate (65 mg, 1 1 .7%) as yellow solid. M S [ESI, V! i l l : 376.1. 1HNMR (CDCI3, 400 MHz): 8 12.42 (s, 1H, OH), 10.63 (s, 1H, CHO),7.67 (s, 1H, ArH), 4.13 (q, ./ 7.2 Hz, 2H, CH2), 3.21 (s, 3H, NCH3), 2.98 (t, J == 7.2 Hz, 2H, CH2), 2.63 (t, J = 7.2 Hz, 2H, ( ! ! . ). 2.46 (s, 3H, CH3), 1.86 (s, 3H, CH3), 1.24 (t, J= 7.2 Hz, 31 1 CH ).
EXAMPLE 53
Figure imgf000347_0001
Synthesis of 7-hydroxy-5~methoxy~3~(2-(2-methoxyethoxy)ethyl)-4- methyl -2H- chromen-2-one
Figure imgf000347_0002
1 2 3
Compound 1 (0,67 g, 4.8 mmol) and compound 2 (1.13 g, 4.8 mmoi) were stirred at 0 °C. H3PO4 (15 mL) was added dropwise. Then the mixture was stirred at RT for 16 h. The reaction mixture was poured into crush ice, extracted by EA. The EA layer was concentrated; DCM ( 15 mL) was added, stirred for 15 min. The undissolved material was removed by filtration. The filter was concentrated. The residue was purified by prep- TLC, afforded crude compound 3 (687 mg, 60% purity) without further purification.
Synthesis of 7-hydroxy-5-methoxy-3-(2-(2-methoxyethoxy)ethyl) -4-methyl-2-oxo-2H- chromene-8-carbaldehyde
Figure imgf000348_0001
7-hydroxy-5-methoxy-3-(2-(2- methoxyethoxy)ethyl)-4-methyi-2-oxo- 2H-chromene-8-carba!dehyde
Compound 3 (0,58 g, 1.88 mmol) and HMTA (1 ,05 g, 7.5 mmol) were added to AcOH (25 mL). The reaction mixture was heated to 100 °C under N2 for 3 h. The solvent was removed under vacuum, diluted with H20, extracted by EA, concentrated. The residue was purified by prep~TLC, afforded 7-hydroxy-5-meth.oxy-3-(2-(2- methoxyethoxy)ethyl)-4-methyl-2-oxo-2H-chromene-8-carbaldehyde (60 mg, 15.8%) as yellow solid. iHNMR (CDC! :. 400 MHz): 6 12.58 (s, I I I OH), 10.38 (s, 1H, CHG), 6.2 (s, 1 H, ArH), 3.93 (s, 3R ArOCL ) 3.63-3.60 (m, 4H), 3.53-3.50 (m, 2H), 3.36 (s, 3H, CH3), 2.95 (t, J= 7.2 Hz, 2 H), 2.56 (s, 3H, C¾), MS [ESI, Ml ! j: 337.0
EXAMPLE 54
Figure imgf000348_0002
Synthesis of compound 2:
NaOH, TsCI
HO'"' "^·'^-·"Ο'"' *" TsO'" " 0"
THF/H20
The solution of NaOH (2.38 g, 0.0595 mol) in H20 (125 mL) was mixed together with the solution of compound 1 (5 g, 0.042 mol) in THF (200 mL), Then the mixture was cooled to 0°C, a solution of TsCI (7.38 g, 0.0388 mol) in THF (200 mL) was added dropwise while keeping the inner temperature below 5l'C. After that, the reaction mixture was stirred at 0°C - 5°C while monitoring the reaction progress with TLC. After the reaction was completed (~2 h), the mixture was poured into ice-water (500 mL), extracted with DCM (150 mL x 3). The combined DCM was washed with water and brine, dried over Na2S04, concentrated to afford compound 2 (9.50 g, yield: 89%) as light yellow needle solid without further purification. 1H MR (400 MHz, CDC13): 8 7.79 (d, ./ 8.4 Hz, 2H, Arl-l), 7.33(d, J = 8.4 Hz, 2H, ArH), 4.16 (t, 4.8 Hz, 2H, CH2), 3.68 (t, J = 4.8 Hz, 2H, CH2), 3.58-3.56 (m, 2H, C 'f I ·■)- 3.48-3.47 (m, 2H, CH2), 3.34 (s, 3H, OCH3), 2.44 (s, 3H, ArCH3).
[995] Synthesis of compound 3 :
Figure imgf000349_0001
96] To the suspension of NaH (0.992 g, 0.0248 mol) in DME (25 mL) was added dropwise the solution of CH3COCH2COOEt (3.07 g, 0.0236 mol) in DME (550 mL) at 0°C. After that, the mixture was stirred at RT for 30 min. The solution of compound 2 (6.79 g, 0.0247 mmol) in DME (100 mL) and Nal (3.72 g, 0.0248 mol) were added to the reaction mixture successively at RT. The result mixture was stirred at RT for 2h unti l some precipitate was formed. Then the mixture was heated to 80°C overnight under N2.
Progress of this reaction was monitored by LCMS. After the reaction was completed (-16 h), the undisclosed material was removed by filtration. The filtrate was concentrated, diluted by I !,(). acidified by 2N HCi to pB ------ ~3, extracted by DCM (100 mL x3). The combined DCM was concentrated, purified by silica gel column (PE: EA = 6: 1) to afford compound 3 as light yellow oil (1.8 g, 32% yield). HNMR indicated few EA entrained that didn't make influence on the next step,
)97] ! i i NMR (400 MHz, CDCI3): δ 4.19-4.16 (m, 2H, CH2), 4. 12-4. 1 0 (m, 1 H, CH), 3.66 (m, 1H, CH), 3.52-3.48 (m, 6H, 3CH2), 3.36 (s, 3H, OCH3), 2.25 (s, 3H, COCH3), 2.17-2.1 1 (m, 2H, CH2), 1 .49 ( !. ,/ 7.2 Hz, 31 1. CH3). ] Synthesis of compound 5
Figure imgf000350_0001
] Compound 3 (2.25 g, 0.0097 mol) and 2~hydroxyi-3~methoxyi -phenol (1.30 g, 0.0093 mol) were added to H3PO4 (200 mL). The reaction mixture was stirred at 45°C for 2 days. Progress of this reaction was monitored by LCMS. After the reaction was completed (~ 48 h), the mixture was di luted with EA (100 mL), poured into ice-water (1 L) and stirred for 15 min. Then the solid was collected by filtration, washed with cold sat NaHCO,?, brine and I¾0 successively. The solid was dried by azeotropy with toluene to afford compound 4 as light yellow solid (1.25 g, 41% yield). 1H NMR ( 400 MHz, DMSO-d6): 6 7.14 (s, 1 1 1, ArH), 6.74 (s, 1 1 1. Ari l ). 3.85 (s, M l . CH3), 3.49-3.47 (m, 4H, 2CH2), 3.41- 3.33 (m, 2H, CH2), 3.20 (s, 3H, CH3), 2.78 (t, J = 7.2 Hz, 2H, CH2), 2.40 (s, 3H, C¾).
Figure imgf000350_0002
0] 7-Hydroxy-6-methoxy-3-(2-(2-methoxyethoxy)ethyl)-4-methyl-2-oxo-2H-chromene-
8-carba!dehyde: Compound 5 (2.0 g, 0.0064 mol) and HMTA (3.65 g, 0.026 mol) were added to TFA (85 mL). The reaction mixture was heated to 95°C for 2h . Progress of this reaction was monitored by LCMS. After the reaction was completed, the reaction mixture was concentrated. The residue was di luted with H20, extracted by DCM ( 100 mL x 3), the combined DCM was washed with cold sat.NaHCOs, brine, dried over Na2S04, concentrated. The cnide product was purified by si lica gel column (DCM: MeOH = 100: 1) to afforded 1.3 g of desired product (94.7% purity on 220 ran). The product was further purification by recrystallization from EA to afford 7-hydroxy-6~methoxy~3~(2-(2- methoxyethoxy)ethyl)-4-methyl-2-oxo-2H-chromene-8-carbaldehyde (0.8 g, 37% yield) as yellow solid. ! I ! N R (400 MHz, CDC! . }: δ 12.46 (s, 1 H, OH), 10.66 (s, H i. CHO), 7.30 (s, 1H, ArH), 4.01 (s, 3H, ArOCH3), 3.72 (t, J = 6.8 Hz, 2H, CH2), 3.65-3.64 (m, 2H, - ). 3.56-3.55 (m, 2H, ( '! !, ). 3.40 (s, 3H, OCH3), 3.02 (t, J= 6.8 Hz, 2H, CH2), 2.49 (s. M l CH3); I .CV1S j V] · I i | = 337.2.
EXAMPLE 55
Figure imgf000351_0001
7-Hydroxy-4-methyI-3-[3-(4-methyl-piperazin-l-yl)-3-oxo-propenyl]-2-oxo-2H- chromene~8~carbaldehyde: 3-Bromo-7-hydroxy-4-methyl-2-oxo-2H-chromene-8- carbaldehyde ( 142 mg, 0.50 mmol), l-(4-methyl-piperazm-l-yl)-propenone (93 mg, 0.60 mmol), palladium acetate (4 mg, 15 μηιοΐ), tri-o-tolyl-phosphane (9 mg, 30 .umol) and silver acetate (167 mg, 1.0 mmol) were dissolved in abs. N,N-dimethylformamide (4mL). The mixture was irradiated in a microwave reactor for 1 h at 120 °C under inert atmosphere. The reaction mixture was poured into water (1 OmL) and extracted with chloroform (3x15 mL). The combined organic layers were dried (Na2S04) and evaporated. The title compound (15 mg, 0.042 mmol, 8%) was isolated by column chromatography (Kieselgel 60), with chloroform as eluent, as a yellow powder. 1H NMR (400 MHz, DMSO-d6) δ ppm 10.43 (s, 1H), 8.05 (d, J - 9.0 Hz, i l l ). 7.59 (d, J = 15.1 Hz, i l l ). 7.50 (d, J - 15.1 Hz, H I ). 6.92 (d, J = 9.0 Hz, I N ). 3.56 - 3.66 ( rn. 4H), 2.55 (s, 3H), 2.38 (br. s., 4H), 2.27 (s, 3H).
EXAMPLE 56
Figure imgf000352_0001
Synthesis of Compound 2:
Figure imgf000352_0002
[1003] To the mixture of compound 1 (3.0 g, 21.0 mmol) and compound 2 (4.0 g, 25.0 mmol), H2SO4 (9 mL) was added slowly at 0 °C. The mixture was stirred at RT overnight. The reaction mixture was poured into H?0 (10 mL) and stirred for 30 mins, the formed precipitate was filtered and washed with water, dried to give compound 3 (2.0 g, 41% yield) as light yel low solid.
[1004] Synthesis of Compound 7-hydrox.y-4-isopropyl-6-met'hox.y-2-oxo-2H~ chromene-8- carbaldehyde:
Figure imgf000352_0003
A mixture of compound 3 (500 mg, 2.1 mmol) and HMTA (1.1 g, 9.4 mmol) in TFA (50 mL) was heated to 90 °C under N2 for 2 h. LC-MS indicated that the reaction was completed. After cooling to RT, the solvent was removed under vacuum. The residue was purified by prep-HPLC, afforded 7-hydroxy~4-isopropyl-6-methoxy~2-oxo-2H- chromene-8-carbaldehyde (150 mg, 26%). 1 HNMR (DMSO, 400 MHz): 6 1 1.91 (s, i ! L OH), 10.42 (s, 1H, CHO), 7.50 (s, 1H, ArH), 6.23 (s, 1H, ArH), 3.90 (s, 3H, CH3), 3.29 (s, i ! i. CH), 1 .24 (cL M l. J 6.8 Hz, 2CH3). MS [ESI, VI M ' j : 263.1 .
EXAMPLE 57
Figure imgf000353_0001
Figure imgf000353_0002
[1006] Synthesis of Compound 3 :
Figure imgf000353_0003
A suspension of compound 2 (1 1 g, 105 mmol) and compound 1 (2 g, 6.8 mmol) was heated to 120 °C for 16 h. The reaction mixture was diluted with DCM (300 mL), washed with 1 N aq.HCi (20 mLx3), sat. NaHC03 (50 mL), brine (50 mL), dried over MgS04 and concentrated to give the residue, then recrstallized in MeOH to give compound 6 (1 .5 g, 63.0%) as white solid.
Figure imgf000353_0004
[1008] 2-(8-Formyl-7~hydroxy-6-methoxy-4-methyl-2~oxo-2H-chromen-3-yl)-N~(2-
A solution of compound 3 (750 mg, 1 .98 mmol) and HMTA (1.1 1 g, 7.92 mmol) in AcOH (50 mL) was heated to 100 °C for 2 h. After cooling to RT, the reaction mixture was concentrated to give the residue, and then diluted with DCM (200 mL), washed with water (20 mL), brine (20 mL), dried over Na2S04 concentrated to give 2-(8-Fomyl-7-hydroxy-6-methoxy-4-methyl-2-oxo-2H-chromen-3- y!)-N-(2-(methoxymethoxy)ethyl)acetamide (200 mg, 26.7 %). Ί ! NMR: (DMSO, 400 MHz) 8 11.78 (s, 1H, OH), 10.41 (s,lH, CHO), 7.88 (s, 1H, ArH), 7.45 (br, 1H, NH), 3.90 (s, 3H, OC! ! u. 3.46 (s, 2H, CH2), 3.37-3.33 (m, 2H, CH2), 3.08 (d, 6.0, 2H, CH2), 2.36 (s, 3H, CH3); MS [ESI, M l ! 1:336.2.
Figure imgf000354_0001
2-(8~Formyl-7-hydroxy-6~methoxy~4-methyl-2-oxo-2H~chromen~3-yl)-N-(2- hydroxyethyl)acetamide: A solution of 2-(8-Formyl-7-hydroxy-6-methoxy-4-methyl-2- oxo-2H-chromen-3-yl)-N-(2-(methoxymethoxy)ethyl)acetamide (400 mg, 1 ,06 mmol) in CHCI3 (40 mL) and conc.HCI (20 mL) was heated to reflux for 1 h, and then
concentrated to give the residue and purified by prep.HPLC to give 2-(8-Formyl-7- hydroxy-6-methoxy-4~methyW
(40 mg, 1 1.3 %)as yellow solid. 1H NMR: (CDC13, 400 MHz) δ 12.47 (d, J= 0.4 Hz, 1H, OH), 10.02 (s,lH, CHO), 7.22 (s, 1 H, ArH), 6.60 (br, 1 H, NH), 4.63 (s, 2H, CH2), 3.97(s, 3H, OCH3), 3.60 (t, J= 5.4 Hz, 4H, CH2), 3.45 (m, 2 H, CH2), 3.36 (d, J= 0.4 Hz, 2H, CH2), 2.57 (s, 3H, CH3); MS [ESI, MH ;J: 380.2.
EXAMPLE 58
Figure imgf000355_0001
[1010J Synthesis of Compound 3 :
Figure imgf000355_0002
1011] To a suspension of compound 1 (30 g, 0.209 mol) and compound 2 (41 g, 0.313 mol) was added CH3SO3H (200 mL) while keeping inner temperature below 25 °C. The reaction mixture was stirred at RT for 16 h and then poured in to ice water, filtered and the filter cake was washed with water (50 mL><3), dried in vacuum to give compoimd 3 (30 g, 68 %) as white solid.
1012] Synthesis of Compound 4:
Figure imgf000355_0003
[1013] To a suspension of compoimd 3 (30 g, 0.143 mol) in AcOH (300 mL) was added Br2 (22.7 g, 0.143 mol) dropwise at 60 °C for 30 min. After cooling to RT, the reaction mixture was filtered and the filter cake was washed with water (50 mLx4), dried in vacuum to give compound 4 (30 g, 73 %) as white solid.
[1014] Synthesis of Compound 5:
Figure imgf000356_0001
1 A. suspension of compound 4 (30 g, 0.104 mol) in Ac20 (200 mL) was heated to 130 °C for 2 h. After cooling to room temperature, the reaction mixture was filtered and the filter cake was washed with water (50 mL*3), dried in vacuum to give compound 5 as white solid (28 g, 81.1 %).
[1016] Synthesis of Compound 7:
A
Figure imgf000356_0002
A suspension of compound 5 (1 g, 3.0 mmol), compound 6 (1.41 g, 6.0 mmol), Pd (dppf) 2 CI 2 ( 1 10 mg, 0.15 mmol) and Na2C03 (0.636 g, 6.0 mmol) in DMF (50mL) and water (5 mL) was heated to 100 °C for 10 h. The solvent was removed under reduced pressure and then purified by column chromatography on silica gel to give compound 7 (600 mg, 50 %) as yellow solid.
Synthesis of Compound 9:
Figure imgf000356_0003
[1019] A solution of compound 7 (1 eq) and HMTA (4 eq) in TFA was heated to 70 "C for 16 h. A fter cooling to room temperature, the reaction mixture was concentrated to give the residue, and then purified by prep.HPLC to give compound 9.
Figure imgf000357_0001
[1020] 4-(6-Chloro-8-formyI-7-hydroxy-4-methyl-2-oxo-2H-chromen-3-yl)-N-(2- methoxyethyl)benzamide was obtained by the above procedure from amine Al 7.0 % yield 1 H NMR (CDC13400 MHz): δ 12.74 (s, 1H, OH), 10.65 (s, 1H, CHO), 7.89 (d, J = 8 Hz, 3H, ArH), 7.38 (d, J= 8.8 Hz, 2H, ArH), 6.55 (br, 1H, NH), 3.68 (t, J= 7.2 Hz, 2H, CH2), 3.58 (t, J = 7.2 Hz, 2H, CH2), 3.40 (s, 3H, OCH3), 2.30 (s, 3H, CH3); MS [ESI, V1 H |: 416.2.
Figure imgf000357_0002
1021] 6-Chloro-7-hydroxy-4-methyl-3-(4-(morphoIine-4-carbonyl)phenyI)-2-oxo-2H- chromeiie~8~carbaldehyde was obtained by the above procedure from amine A2. 9.4 % yield 5 H NMR: (CDC13 400 MHz) δ 12.7 (s, 1 H, OH), 10.66 (s, 1 H, CHO), 7.90 (s, i ! i. ArH), 7.53 (t, J= 8 Hz, 2H, ArH), 7.37 (t, J= 12 Hz, 2H, ArH) 3.77-3.55 (m, 8H), 2.30 (s, 3H, CH3); MS [ESI, Vj ! S 428.2
Figure imgf000358_0001
Θ22] 4-(6-Chloro-8-formyl~7-hydroxy-4-methyl-2-oxo-2H~chromen-3-yl)-N-(2- morpholinoethyl)benzamide was obtained by the above procedure from amine A5 9.5 % yield 1H NMR (DMSO 400 MHz) δ 10.46 (s, IH, CHO), 8.78 (br, IH. NH), 8.23 (s, IH, Ari l ). 7.94 i d. J = 8.4 Hz, 2H, ArH), 7.45 (d, ./ 8.4 Hz 2H, ArH) 3.82 (s, 4H, 2CH2), 3.65 (d, J = 4.0 Hz, 2H, CH2), 2.53 (d, J= 4.0 Hz 2H, CH2), 2.26 (s, 3H, CH3). MS [ESI, MH+] : 471.3.
Figure imgf000358_0002
8 6 023] To a suspension of compound 8 1 .0 eq) and D F (5 mL) in DCM (1 L) was added (COCI)? (2 eq) dropwise at 0 °C in 1 h. The reaction mixture was stirred at room temperature overnight and then removed the solvent to give the chloride acid. To a solution of the chloride acid in DCM (1 L) was added morpholine (1.0 eq) and TEA (2.0 eq) dropwise at 0 °ϋ . After 2 h, the solvent was removed to give compound 6.
EXAMPLE 59
Figure imgf000359_0001
Figure imgf000359_0002
[1024] Synthesis of Compound 2:
Figure imgf000359_0003
11025] To a solution of compound 1 (50 g, 0.4 mol) and 2-Methoxy-ethanol (200 mL) in dioxane (800 mL.) and MeOH (200 mL) was bubbled HCl gas at 0 °C over 20 min, and then heated to 90 °C for 16 h. The reaction mixture was concentrated under reduced pressure to removed dioxane, and then the residue was purified by column chromatography on silica gel to give compound 2 (30 g, 40.8 %) as waxy solid.
[1026] MS [EST MH "]: 185.2
[1027] Synthesis of Compound 4:
Figure imgf000359_0004
28] To a mixtrue of compound 2 (15.5 g, 0.084 mol) and compound 2 (23.5 g, 0.101 mol) was added H3P04 (100 mL) dropwise at 0 °C over 30 min, and then wanned to RT for h. The reaction mixture was poured into ice water and the precipitate was filtered and recrystallized from EtOAc to give compound 4 as (9.5 g, 32.3 %) white solid. Θ29] Synthesis of Compound 5:
Figure imgf000360_0001
Θ30] A mixtrue of compound 4 1 eq) and amine was heated to 120 °C for 16 h. The reaction mixture was concentrated to give the residue, and then purified by column
chromatography on silica gel to give the crude product, and then recrystallized from MeOH to give compound 5 031 J Synthesis of Compound 6:
Figure imgf000360_0002
Θ32] A solution of compound 5 (1 eq) and HMTA (4.0 eq) in TFA was heated to 100 °C for 3 h. After cooling to room temperature, the reaction mixture was concentrated to give the residue, and then purified by Prep-HPLC to give compound 6
Figure imgf000360_0003
[1033] 3-(8-Formyl-7-hydroxy-5-(2-methoxyethoxy)-4-methyl-2-oxo-2H-chromen-3-yl)-N-
(2~methoxyethyl)propai8am e was obtained by the above procedure from, amine .41 , 15
% yield. ¾ NMR. ( CIX k 400 ΜΗζ):δ 12.58 (s, 1H, OH), 10.40 (d, J = 2.8 Hz, CHO), 6.25 (d, J = 2.4, 1H, ArH), 6.04 (br, 1H, NH), 4.21 (d, J= 2.4 Hz, ArOCH2), 3.79 (d, J = 2.8 Hz, OCH2), 3.44 (s, 7! 1 >. 3.33 (s, 3H, OCH3), 2.97 (s, 2H, CH2), 2.64 is, 3H, CH3), 2.44 (s, 2H, CH2); MS [ESI, MH;]: 408.3.
Figure imgf000361_0001
1034] 7-Hydroxy-5-(2-methoxyethoxy)-4-methyI-3-(3-morpholino-3-oxopropyi)-2-oxo-2H- chromeiie~8~carbaldehyde was obtained by the above procedure from amine A2. 52,2 % yield 5 H NMR (CDCi3 400 ΜΗζ):δ 12.55 (d, 3.2 Hz, OH), 10.37 (d, J = 3.2 Hz, 1 ! L CHO), 6.23 (d, J= 3,2 Hz, 1H, ArH), 4.20 (t, J= 3.0 Hz, 2 H, ArOCH2), 3.81-3.79 (m, 2 H, ( ΚΊ ί, Κ 3.66 (s, 4Π. 2CH2), 3.62 (s, 2H, CH2), 3.54 (s, 2! L CH2), 3.43 (d, J = 3.6 Hz, 3H, OC¾), 2.96-2.92 (m, 2H, CH2), 2.63 (d, J = 3.2 Hz, 3H, C¾), 2.56-2.51 (m, 2H, CH2). MS [ESI, VI I i } : 420,2.
Figure imgf000361_0002
[1035] 7-Hydroxy-5-(2-methoxyethoxy)-4-methyl-3-(3-(4-methylpiperazin-l-yI)-3- oxopropyI)-2- xo-2H-chron¾ene-8-carbaldehyde was obtained by the above procedure from amine A3. 28 % yield. 1H NMR (D20, 400 ΜΗζ):δ 9.69 (s, 1 H, CHO), 6.01 (s, 1 H, ArH), 4.42 (s, i l l. CH2), 4.12 (s, I I I CH2), 3.98 (s, 1 H, ArOCH2), 3.72 (s, 2H, OCH2), 3.50-3.32 (m, 3H, CH2), 3.31 (s, 3H, OCH3), 3.07-2.93 (m, 3H, CH2), 2.81 (s, 3H, NCH3), 2.57 (d, J = 7.6 Hz, 21 L CH2), 2,45 (!. ./ 7,4 Hz, 21 1. CH2), 2.23 (s, 3H, CH3); MS [ESI, MH1] : 433.2.
Figure imgf000362_0001
1036] N-Ethyl-3-(8-formyI-7-hydroxy-5-(2-methoxyethoxy)-4-methyl-2-oxo-2H-chromen-
3~yi)propsmamide was obtained by the above procedure from amine A4. 9.3 % yield. ¾
NMR (CDC!3 400 ΜΗζ):δ 12.59 (s, 1H, OH), 10.40 (s, I B, CHO), 6.26 (s, 1 H, ArH), 5.71 (s, 1H, CONH), 4.23-4.21 (m, 2H, ArOCH2), 3.82-3.79 (m, 2H, 0( Ί Ι · ). 3.45 (d, J = 2.4 Hz, 3H, ()( 'I ! :: }. 3.29 (t, J ------ 5.6 Hz, 2H, CH2),2.98 (t, J ------ 7.4 Hz, 2H, CH2), 2.65 (s,
3H, Q¾), 2.41 (t, J= 7.6 Hz, 2H, CH2), 1.15-1.12 (m, 3H, CH3). MS [ESI, MH+] : 378.1
Figure imgf000362_0002
[1037] 3-(8-Formyl-7-hydroxy-5-(2-methoxyethoxy)-4-methyl-2-oxo-2H-chromen-3-yl)-N-
(2~morpholisioeihy!)prop5mamide was obtained by the above procedure from amine A5. 23 % yield. 1H MR (D20, 400 MHz): 6 9.74 (s, 1 H, CHO), 6.06 (s, 1 H, ArH), 4.01 (s, 2H, A1OCH2), 3.97 (s, 2H, OCH2), 3.75-3.69 (m, 4H, CH2), 3.49 (s, 4H, CH2), 3.32 (s, 31 1 OCH3), 3.19 (t, J --- 6.0 Hz, CH2), 3.12-3.08 (m, 2H, CH2), 2.63(d, J ------ 8.4 Hz, 2H,
CI ! , ). 2.26 (s, 3H, CH3); MS [ESI, V1 H i: 463.2.
Figure imgf000362_0003
[1038] N-(2-(Dimethylamino)ethyI)-3-(8-formyl-7-hydroxy-5-(2-methoxyethoxy)-4-methyl- 2-oxo-2H-chromen-3-yI)propanamide was obtained by the above procedure from amine .46. 9.5 % yield lll NMR (D2O 400 ΜΗζ):δ 9.95 (s, 1H, CHO), 6.25 (s, 1H, ArH) , 4.20 (s, 2H, ArOCH2), 3.91 (s, 2H, OCI¾), 3.59 (t, J == 6.0 Hz, 2H, CH2), 3.48 (s, 311 OCH3), 3.32 (t, J= 6.0 Hz, 2H, Q¾), 2.95 (s, 6H, 2NCH3), 2.81 (t, J= 7.8 Hz, 2H), 2.45 (s, 5H); MS [ESI, M! i |: 421 .2
EXAMPLE 60
Figure imgf000363_0001
1 3 4
Figure imgf000363_0002
11039] Synthesis of Compound 3:
Figure imgf000363_0003
To a mixtrue of compound .1 (15.5 g, 0.084 mol) and compound 2 (21.8 g, 0.101 mol) was added H3P04 (100 mL) dropwi.se at 0 °C OVQX 30 min, and then warmed to RT for 16 h. The reaction mixture was poured into ice water and the precipitate was filtered and recrystallized from EtOAc to give compound 3 (5.5 g, 19.5 %) as white solid.
MS [ESI, MB1]: 337. 2] Synthesis of Compound 4:
Figure imgf000364_0001
A mix true of compound 4 (2.0 g, 6.0 mmol) and amine (20 raL) was heated to 120 °C for 16 h. The reaction mixture was concentrated to give the residue, and then purified by column chromatography on silica gel to give the crude product, and then reerystaliized in MeCN to give compound 5 (0.4 g, 18.4%) as white solid. 044] Synthesis of Compound 5 :
Figure imgf000364_0002
A solution of compound 4 (1 eq) and HMTA (4.0 eq) in AcOH was heated to 100 °C for 3 h. After cooling to room temperature, the reaction mixture was concentrated to give the residue, and then purified by Prep-HPLC to give compound 5
Figure imgf000364_0003
Θ46] 2-(8-Formyl-7~hydroxy-5-(2-methoxyethoxy)-4-methyl-2-oxo-2H-chromen-3-yl)-N- (2-methoxyethyl)acetamide was obtained by the above procedure from amine Al. 3.5 % yield. 1HNMR (CDC13, 400 ΜΗζ):δ 12.61 (s, I I I . OH), 10.40 (s, 1 1 1. CHO), 6.43 (br, 1H, NH), 6.27 (s, 1 H, ArH), 4.22 (t, J = 4.4 Hz, 2H, ArOCH2), 3.79 (t, ./' 4.4 Hz, 2H, OCH2), 3.58 (s, 3H, CH2), 3.43 (m, 7Ή), 3.35 (d, J = 4.0 Hz, 3H, OC! h 2.72 (s, 3H, CH3) .MS [ESI, MH+J : 394.1
Figure imgf000365_0001
[1047] 7-Hydroxy-5-(2-methoxyethoxy)-4-methyl-3-(2-morpholino-2-oxoethyI)-2-oxo-2H- chromene~8~carbaldehyde was obtained by the above procedure from amine A2. 14 % yield.1H NMR (CDCI3, 400 ΜΗζ):δ 12.62 (s, 1H, OH), 10.41 (s, 1H, CHO), 6.27 (s, 1H, ArH), 4.22 ( L ./ 4.4 Hz, 21 L ArOC¾), 3.81-3.76 (m, 4H, OCH2 and CH2), 3.70 (d, ./ = 3.6 Hz, 6H, CH2), 3.65 i d. J = 4.8 Hz, 2H, CH2), 3.43 (s, 3H, OCH3), 2.61 (s, M l. CH3) MS [ESI, MH ] : 406.1
Figure imgf000365_0002
7-Hydroxy-5-(2-methoxyethoxy)-4-methyI-3-(2-(4-niethylpiperazin-l-yI)-2- oxoethyl)-2-oxo~2H-chromene-8-carbaldehyde was obtained by the above procedure from amine A3. 3.9 % yield.5 H NMR (D20, 400 MHz): δ 9.89 (s, i ! L CHO), 6.1 8 (s, i ! i. ArH), 4.60 (d, J = 12.4 Hz, IH), 4.41 (d, J = 14.8 Hz, IH), 4.14 (s, 2H, ArOCH2), 3.88- 3.62 (m, 8H), 3.45 (s, 31 1. OCI¾), 3.33 (d, ./ 2.8 Hz, I H), 3.19 (d, J = 12.8 Hz, 2H, CH2), 3.01 (s, 3H, NC¾), 2.37 (s, 3H, \ ): MS [ESI, MH4]: 419.3.
Figure imgf000365_0003
[1049] N-Ethyl-2-(8~formyl~7-hydroxy-5-(2~m
3~yl)acetamide was obtained by the above procedure from amine A4, 9.6 % yield. HNMR (MeOD, 400 ΜΗζ):δ 10.35 (s, i l l. CHO), 6.46 (s, i ! L ArH), 4.30-4.28 (m, 2H, ArOCH2), 3.82-3.80 (m, 2H, OCH2), 3.59 (s, 2H, CH2), 3.41 (s, 3H, OCH3), 3.22- 3.20 (m, 2H, CH2), 2.59 (s, 3H, CH3), 1.12 (t, J = 4.0 Hz, 3H, CH3). MS [ESI, MH÷] : 364.1
Figure imgf000366_0001
1050] 2-(8-FormyI-7-hydroxy-5-(2-methoxyethoxy)-4-methyl-2-oxo-2H-chromen-3-yI)-N- (2-morpholinoethy])acetamide was obtained by the above procedure from amine A.5. 5.0 % yield.' H NMR (CDCI3, 400 ΜΗζ):δ 10.40 (s, I H, CHO), 6.83 (br, I H, NH), 6.27 (s, IH, ArH), 4.22 (t, J= 4.4 Hz, 2H, ArOCH2), 3.79 (t, J= 4.4 Hz, 2H, OCH2), 3.74 (s, 4H, CH2), 3.63 (s, 2H, CH2), 3.43 (s, 3H, OCH3), 3.38 (d, J = 5.2 Hz, 2H, CH2), 2.71 (s, 3H, CH3), 2.56 (s, 6H, CH2) .MS [ESI, MH;]:449.1
Figure imgf000366_0002
1051 ] N-(2-(Dimethy].amino)ethyl)-2-(8-formyl-7-hydroxy-5-(2-rnethoxyethoxy)-4-rnethyl-2- oxo-2H-chromen-3-yl)acetamide was obtamed by the above procedure from amine A6. 10 % yield. ' HNMR (D2(), 400 ΜΗζ):δ 10.12 is. I H, CHO), 6.40 (s, IH, ArH), 4.29 (d, J = 4.0 Hz, 2H, ArOQ¾), 3.96 (t, J = 2.0 Hz, 2H, OCH2), 3.70-3.65 (m, 4H, 2( 1 f/ 3.50 (s, 3H, OCH3), 3.36 (L ./ 6.2 Hz, 21 1 CH2) 2.97 (s, 6H, 2NCH ), 2.54 (s, 3H, CH3). MS [ESI, MH ]: 407.1
Figure imgf000366_0003
[1052] Ethyl 2-(8-formyl-7-hydroxy-5-(2-methoxyethoxy) -4-methyl-2-oxo-2H-cfaromen-3- yl) acetate: 'ilNMR (CDC13, 400 ΜΉζ):δ 12.62 (s, ! I L OH), 10.41 (s, i i !. CHO), 6.27 (s, 1H, ArH), 4.23-4.18 (m, 4H), 3.80 (t, J= 4.6 Hz, 2H, OCH2), 3.72 (s, 2H, CH2), 3.44 (s, 3H, OCH. , 2.56 (s, 3H, CH3), 1.27 (t, J= 4.0 Hz, 3H, CH3); MS [ESI, MH ]:365.2.
EXAMPLE 61
Figure imgf000367_0001
Figure imgf000367_0002
Synthesis of Compound 3
Figure imgf000367_0003
1054] To a mixtrue of compound 1 (1.0 g, 5.43 mraol.) and compound 2 (0.94 g, 6.52 mmoi) was added MeS0 H (20 mL) dropwise at 0 °C over 30 min, and then warmed to RT for 16 h. The reaction mixture was poured into ice water and the precipitate was filtered and recrystallized from EtOAc to give compound 3 (830 mg, 55.8 %) as white solid.
Figure imgf000368_0001
3
1055] 7~Mydroxy-S~(2~methoxyethoxy)~3,4~dime^
A solution of compound 3 (800 mg, 3.14 mmol) and HMTA (1 ,76 g, 12.6 mmol) in AcOH (50 mL) was heated to 100 °C for 2 h. After cooling to room temperature, the reaction mixture was concentrated to give the residue, and then purified by Prep-HPLC to give the target compound (32 mg, 3.5%). iH NMR (CDCI3, 400 ΜΗζ):δ 12.57 (s, i f I OH), 10.41 (s, I H, CHO), 6.24 (s, I H, ArH), 4.23-4.21 (m, 2H, Ar OCH2), 3.82-3.80 (m, 2H, OCH2), 3.44 (s, 3H, OCH3), 2.57 (d, J ------ 0.8 Hz, 3H, CH3j, 2.17 (d, J ------- 0.8 Hz 3H,
< ! ! :. } .LC-MS MS [ESI, M i l i : 293.0.
EXAMPLE 62
Figure imgf000368_0002
6ta [1056] Synthesis of Compound 1 :
Figure imgf000369_0001
a b
[1057] To a solution of compound a (300 g, 1.98 mo! ) and Se02 (17.4 g, 0.156 mol) in DCM (4 L) was added H202 (512 rnL) dropwise at ice-bath. The mixture solution was stirred at RT for 16 h. The reaction mixture turned to dark-brown in the period. The reaction was monitored by TLC (PE:EA=1 : 1 ). After the material was consumed completely (- 12 h), the organic phase was separated and washed with 10% NaHS03 (1 L), followed by Na2C03 (1 L) and brine (1 L), then dried on NaS04, the solvent was removed to get the crude compound 2 and use at the next step directly. 1Θ58] The crude compound b was hydrolyzed in a mixture of MeOH (3 L) and 10%KOH (2 L) at RT over night. After MeOH was removed, the mixture was acidified by 6M HC1 to PH=3 and extracted with DCM (2 L x 8). The combined organic phase was washed with brine and dried on NaS04. After the solvent was removed, the residue was purified by chromatography (EA:PE=6: 1 to EA:PE=4: 1) to give compound 3 (140 g, 50.5%) as light- yellow solid HNMR (MeOD, 400MHz): δ 6.70 i d. ./ 8.8 Hz, I I I. ArH), 6.29 (d, J ------ 3.2
Hz, i l l. ArH), 6.18 (dd, J= 8.8, 2.8 Hz, 1H, ArH), 3.73 (s, 3H, CH3).
[1059] Synthesis of Compound 3 :
Figure imgf000369_0002
2 3
] To a suspension of compound 1 (120 g, 0.86 mol) in diethyl aeetylsuccmate (220 g, 1 .03 mol), CH3S03H (1200 mL) was added in one portion. The mixture was stirred at RT overnight. LC-MS showed that starting material was consumed completely. The reaction mixture was poured into ice-water (1000 ml) and stirred for 30 min. The formed precipitate was filtered and washed with water and EA, dried to afford the crude product (150 g, 60 %) as white solid.1HNMR. (MeOD, 400 VI Hz ): δ 7.15 (s, 1 H, ArH), 6.75 (s, 1H, ArH), 4.18-4.12 (q, 21 1. CH2), 3.93 (s, M l . (Ί i. }. 2.41 (s, 3! L CH3), 1.25 (t, M l . CH3).
10 1 ] Synthesis of Compound 4 :
Figure imgf000370_0001
[1062] Compound 3 (180 g, 0.6 mol) was added into 4M NaOH (500 mL) in one portion and stirred at RT overnight. TLC (EA/MeOH- 10/1) indicated that the reaction was complete.The reaction mixture was acidified with 5M HCl to PH=3. The formed precipitate was filtered, which was washed with EA and dried in vacuo to give compound 4 as white solid (140 g, 67 %)
[1063] Synthesis of Compound 5a:
Figure imgf000370_0002
5s
[1064] To a suspension of compound 4(1 eq) in DMF, amine and PyBOP (1.2 eq) was added sequentially. The mixture was cooled to 0 °C, DIPEA (1.2 eq) was then added dropwise while controlling the temperature below 10 °C. The reaction mixture was stirred at RT overnight. LCMS showed that starting material was consumed completed, the precipitate was filtered and washed with water and EA, dried in vacuo to give compound 5a as a white solid. 5A2,5A3 used the method
[1Θ65] Synthesis of Compound 5b:
Figure imgf000370_0003
[1066] Compound 3 (1.0 eq) was added to amine. The reaction mixture was stirred at 120 °C for 48 h. LC-MS showed that the starting material was almost consumed completely. The solvent was removed under vacuum. The residue was washed with DCM (3 x 5 mL) and concentrated under vacuum, afforded compound 5b, 5A1 ,5A4,5A5 used the method 1Θ67] Synthesis of Compound 6:
Figure imgf000371_0001
5a-5b 6a-6b
1068] A mixture of compound 5 ( 1 eq) and HMTA (4 eq) in HO Ac was heated at 120°C under nitrogen for 1.5 h. The reaction mixture turned to dark-yellow in the period. LCMS indicated that the reaction was completed. After cooled to RT, the solvent was removed under reduced pressure, the product was purified by Prep-HPLC to give compound 6.
Figure imgf000371_0002
1Θ69] 2-(8-Formyl-7-hydroxy-6-methoxy-4-methyl-2-oxo-2H-chromen-3-yl)-N-(2- methoxyethyl)acetamidewas obtained by the above procedure from amine A 1.18 % yield
[1070] 1HNMR (CDCI3, 400 MHz): δ 12.48 (s. I ! !. OH), 10.61 (s, i ! L CHO),7.22 (s, 1 H, ArH),
6.61(br, lH,NH),3.97 (s, 3H, OCH3), 3.61 (s, 2H, CH2), 3.46-341 (m, 4H, 2CH2), 3 36Cs.3i i.cn .2.55 (s, 3H, Cl h }, MS [EST MH+] : 350.1
Figure imgf000371_0003
[1871] 7-Hydroxy-6-methoxy-4-methyl-3-(2-morpholino-2-oxoethyl)-2-oxo-2H-chromene-8' carbaidehyde was obtained by the above procedure from amine A2.46 % yield [1072] Ή NMR (CDCI3, 400 MHz): δ 12.45 (s, 1H, OH), 10.59 (s, 1 1 1. CHO), 7.24 (s, 1H,
ArH), 3.95 (s, 3H, Ο(Ί Ϊ, ). 3.78-3.62 (m, 10H) 2.46 (s, M l CI ! :}. MS [ESI, Mi l j: 362.2.
Figure imgf000372_0001
[1073] 7-Hydroxy-6-methoxy-4-methyl-3-(2-(4-methylpiperazin-l-yl)-2-oxoethyl)-2-oxo-2H- chromene-8-carbaldehyde was obtained by the above procedure from amine A3.7.7 % yield. 5 HNMR (D2(), 400MHz) δ 10.10 (s, 1 H,CH0), 7.1 1 (s, 1H, ArH),
4.44(d,lH,J=12.0 HZ,CH), 4.29 (d, 1H, J=14.4 HZ,CH), 3.74-2.98(m,l lH),
2.85(s,3 H,OCH ), 2.19(s,3H,CH3); MS [ESI, M i l |: 375.1.
Figure imgf000372_0002
[1874] N-Ethyl-2-(8-formyl-7-hydroxy-6-methoxy-4-methyl-2-oxo-2H-chronien-3- yl)ace amide was obtained by the above procedure from amine A4.18 % yield. 'HNMR (CDCi3, 400MHz) δ 12,49 (s, ΙΗ,ΟΗ), 10.61 (s, 1 H,CH0),
7.22(s,lH,ArH);6.48(bi%lH;NH),3.97(s,3H,OC¾),3.60(s,2H,CH2),3.28-3.23(m, 2H,CH2),2.57(s, 3H,CH3), 1.13 (t, 31 L ,/ 7.2 HZ,CH3); MS [ESI, VIM ' j: 320.2,
Figure imgf000372_0003
[1875] N-(2-(dimethyIamino)ethyI)-2-(8-formyl-7-hydroxy-6-methoxy-4-methyl-2-oxo-2H- chromen-3-yl)acetamlde was obtained by the above procedure from amine A6.9.2 % yield. rH MR (D20, 400 MHz): 10.61 (s, 1 H, CHO), 7.26 (s, 1H, ArH), 3.90 (s, 3H, OCH3), 3.69-3.64 (m, 4H, 2CI !.·). 3.56 (t, 2H, J=6.0 HZ, CH2), 2.95(s,6H,2NCH3),2.39 (s, 3H, CH3); MS [ESI, MH÷]: 363.3. EXAMPLE 63
Figure imgf000373_0001
Figure imgf000373_0002
[1076] Synthesis of Compound 3:
Figure imgf000373_0003
1077] To a suspension of compound 1 (8.8 g, 0.063 moi) in compound 2 (18 g,0.078 mol), CH3SO3H (144 mL) was added in one portion. The mixture was stirred at RT for 12 h. LC-MS showed that starting material was consumed completely. The reaction mixture was poured into ice-water (300 mL) and stirred for 30 min. The formed precipitate was filtered and washed with water and EA, dried to afford the crude Compound 3 (11.2 g, 59 %) as white solid; MS [ESI, i l j: 306.9.
1078] Synthesis of Compound 4:
Figure imgf000373_0004
[1079] Compound 3 (1.0 eq) was added to amine, The reaction mixture was stirred at 120 °C for 48 h.LC-MS showed that the starting material was almost consumed completely. The solvent was removed under vacuum. The residue was washed with DCM and concentrated under vacuum to afforded compound 4. [1080] Synthesis of Compound 5:
Figure imgf000374_0001
[1081] A mixture of compound 4 (1.0 eq) and HMT A (4.0 eq) in TFA was heated to 90 °C under nitrogen for 2 h. LC-MS indicated that the reaction was completed. After cooled to RT, the solvent was removed under vacuum. The residue was purified by Prep-HPLC, afforded compound 5.
Figure imgf000374_0002
1082] 3-(8-FormyI-7-hydroxy-6-methoxy-4-methyl-2-oxo-2H-chromen-3-yI)-N-(2- methoxyetfayI)propanamMe was obtained by the above procedure from amine Al.23.5 % yield. 1HN R (CDCI3, 400 MHz): δ 12,42 (s, ΙΗ,ΟΗ), 10.61 (s, 1 H, CHO),7.20 (s, 1 H,
ArH), 3.41 (m, 4H, 2CH2), 3.30 (s, 3H, CH3), 2.99 (t, 2H, J= 7.2 Hz, CH2), 2.52-2.48 (m, 51 1 ); MS [ESI, VIM ' j: 364.2.
Figure imgf000374_0003
1083] 7-Hydroxy-6-methoxy-4-methy[-3-(3-morpholino-3-oxopropyl)-2-oxo-2H-chromene-8- carbaldehyde was obtained by the above procedure from amine A2.39.6 % yield
1HNMR (MeOD, 400 MHz): δ 7.20 (s, 1H, CHO), 6.01 (s, 1H, ArH), 3.93 (s, 3H, OCH3), 3.63-3.60 (m, 4H, 2CH2), 3.58-3.55 (m, 4H, 2CH2), 2.92 (t, 2H, J ------ 7.6 Hz
.{ '! ! .). 2.61 (t, 21 L J= 7.6 Hz, (Ί I ·}. 2.48 (s, 3H, Q¾); MS [ESI, VII ! j: 376.2.
Figure imgf000375_0001
[1 Θ85] 7-Hy droxy-6-methoxy-4-methyl-3 -(3 -(4-methy Ipiperazin- 1 -yl)-3 -oxopropyl)-2-oxo-2H- chromene-8-carbaidehyde was obtained by the above procedure from amine A3.4.6 % yield. !HNMR(CDC13, 400 MHz): δ 10.61 (s, IH, < 1 !<)).?.2 i (s. ill. ArH), 3.96 (s, 3IL CIli), 3.60-3.59 (m, 3H, OCH), 2.97 (t, 2W.J 7.6. Hz, CH2), 2.64 (t, 2!!,./ 7.6 Hz, 2H, Of I ·■}.2.50-2.34 (m, 1 IH); MS [ESI, MH+]:389.2.
Figure imgf000375_0002
N-Ethyl-3-(8-formyl-7-hydroxy-6-methoxy-4-methyl-2-oxo-2H-chromen-3- yl)propan amide was obtained by the above procedure from amine A4.1.2 % yield.
*HNMR (CDCI3, 400 MHz): δ 12.39 (s, ill. OH), 10.58 (s, IH, CHO),7.20 (s, ill.
ArH), 5.71 (s, IH, Mi).3.95 (s, 3H, OCH), 3.25 (t, 2W.J 5.6 Hz, CH2), 2.98 (t, 2H, = 6.8 Hz, Q¾), 2.47 (s, 5H,), 1.11-1.07 (m, 3H, CH3); MS [ESI, MH+]:334.1
Figure imgf000375_0003
[1Θ87] N-(2-(Dimethylamino)ethyl)-3-(8-formyl-7-hydroxy-6-methoxy-4-met ^
chromen-3-yl)propanamide was obtained by the above procedure from amine A6.16 % yield. !HNMR (DMSO-d6, 400 MHz): 10.44 (s, IH, CHO), 8.24 (s, IH, OH),7.46 (s, IH, ArH), 3.92 (s, 3H, CH3), 3.41-3.36 (m, 2H, CH2),2.83-2.79 (m, 2H, CH2), 2.76-2.74 (m, 6H),2.49 (s, 3H, CH3), 2.45-2.30 (m, 2H, CH2): 1HNMR (MeOD, 400 MHz):7.20 (d, IH, J ------ 12.8 Hz ,ArH), 5.99 (s, IH, CHO),3.93 (s, 31 L CH3), 3.53-3.50 (m, 2H, CI!,}.326-
3.23 im.2B, CH2), 2.99-2.96 (m, 8H),2.47 (s, 3H, CH3), 2.45-2.43 (m, 2H, CW ).
Figure imgf000376_0001
Figure imgf000376_0002
Figure imgf000376_0003
1088] Synthesis of Compound 3:
Figure imgf000376_0004
To a solution of compound i (1000 g, 7.93 mol) in 1 ,4- Dixon e (2 L) was added
HCl/MeOH (8 L, saturated with dry HC1 at 0°C) in one portion with stirring at RT. The result solution was stirred at 80°C overnight. The reaction was monitored by TLC (PE:EA :::: 1 : 1) and HPLC. After -16 h (Note 1), the solvent was removed and the residue was purified by chromatography on silica gel (PE:EA = 12:1-8: 1) to give compound 2 (514 g,46 %) as white solid.
Note 1 : HPLC indicated that the material was not consumed. However, the disubstituted by-product woul d increase if the reaction was prolonged. [1Θ91] Synthesis of Compound 3:
Figure imgf000377_0001
2
11092] To a suspension of compound 2 (1 12 g, 0.8 mol) in diethyl acetylsuccinate (208 g, 0.96 mol) was added ZnCl2 (1 2 g, 0.82 mol) in one portion with stirring at RT, The mixture solution stirred at 100°C overnight. LC-MS showed that starting material was consumed completely. Then ice-water (400 ml) was added followed by MeOB (1000 ml) and the result mixture was stirred for 3 Grains. The precipitate was filtered and washed with EA and MeOH (1 :1 , 800 mL) to afford the desired product (35 g, 15 %, containing ~10% isomer) as white solid. MS [ESI, MH+]: 293
[1093] Synthesis of Compound 4:
Figure imgf000377_0002
The compound 3 (100 g, 0.34 mol) was added into 4 N NaOH (256 mL, 1.03 mol) in portions with stirring at RT overnight. TLC showed that starting material was consumed completely 5N HQ was added until PH = 2. The precipitate was filtered and washed with EA, dried in vacuo to give compound 4 as white solid (60 g, 67 %)
[1Θ95] Synthesis of Compound 5:
Figure imgf000377_0003
[1Θ96] To a solution of compound 4 (1 eq) in DMF was added GDI (1.4 eq) in one portion. The solution was stirred at RT for 3 h, TLC showed that starting material was consumed /6 completely, amine (1.4 eq) was added into the solution in one portion. The mixture solution was stirred at RT overnight. The solvent was removed under reduced pressure and the residue was treated with EA and DCM to give a suspension. The precipitate was filtered to give the product as solid. Θ97] Synthesis of Compound 6:
Figure imgf000378_0001
Θ98] A mixture of compound 5 (1 eq) and HMTA (4 eq) in TFA was heated at 90°C under nitrogen for 1 .5h. The reaction mixture turned to dark-yellow in the period. LCMS indicated that the reaction was completed. After cooled to RT, the solvent was removed under reduced pressure, the product was purified by Prep-HPLC to give compound 6.
Figure imgf000378_0002
2-(8-Formyl-7-hydroxy-5-methoxy-4-methyl-2-oxo-2H-chromen-3-yl)-N-(2- methoxyethyI)acetamide was obtained by the above procedure from amine Al. 12 % yield. iHNM (CDCI3, 400 MHz): δ 12.56 (s, 1H, OH), 10.34 (s, 1H, CHO), 6.23 (s, 1H, ArH), 3.88 (s, 31 i. C i i s ). 3.51 (s, 2H, CH2), 3.37-3.33(m,4H,CH2),3.28 (s, 31 1. CH3),2.61(s, 31 1. CH3); MS [ESI, Ml ! j: 350.1
Figure imgf000378_0003
1001 7-Hydroxy-5-raethoxy-4-methyl-3-(2-raorpholmo-2-oxoethyl)-2-oxo-2H-chrora
carbaldehyde was obtained by the above procedure from amine A2. 46 % yield. , ,uw δ 12.60 (s, 1H, OH), 10.38 (s, 1H, CHO), 6.27 (s, 1H,
ArH), 3.92 (s, 3H, CH ), 3.75-3.62 (m, 10H), 2.53 (s, 3H, CH3). MS [ESI, MH+]: 362.2
Figure imgf000379_0001
7~Hydroxy-5-methoxy-4-methyi~3-^
chromene-8-carbaIdehyde was obtained by the above procedure from amine A3. 9.2 % yield. 1HNMR (D20, 400 MHz): δ 9.65 (s, 1H, CHO), 5.99 (s, 1H, ArH), 4.41 (d, 1H, J 12.4 Hz CH2), 4.22(d, I H, J = 14.4 Hz, CH2), 3.65(s, 3H, CH3), 3.59-3.15 (m, 8H), 2,83 (s, 3H, CH ),2.15 (s, 3H, CH3); MS [ESI, MH ]: 375.1.
Figure imgf000379_0002
2-(8-Formyl-7~hydroxy-5-methoxy-4-methyl-2~oxo-2H-chromen-3-yl)-N~(2- morpholinoethyl)acetamide was obtained by the above procedure from amine A6. 9.3 % yield. 1HNMR (D20, 400 MHz): δ 9.89 (s, IH, CHO), 6.23 (s, IH, ArH), 4.16-3.23 (m, 17H) ,2.41 (s, 3H, CH3); MS [ESI, M H j: 405.3
Figure imgf000379_0003
N-(2-(Dimethylamino)ethyI)-2-(8-formyl-7-hydroxy-5-methoxy-4-methyl-2-oxo-2H- chromen~3-yl)acetamide was obtained by the above procedure from amine A5. I I % yield. !HNMR (CDCI3, 400 Hz): δ 10.42 (s, I H, CHO), 6.75 (br, I H, NH), 6.31 (s, IH, ArH), 3.97 (s, 3H, CH3), 3.61 (s, 2H, CH2), 3.37(t,2H, J= 3.2 HZ,CH2),3.28 (s, 3H, CI ! .}, 2.52 (t,2H, J= 3.2 HZ,CH2)2.33(s, 6H, 2NCH3); MS [ESI, MH ]: 363.2.
Figure imgf000380_0001
Figure imgf000380_0002
1105] Synthesis of" Compound 1 :
Figure imgf000380_0003
D
A mixture of compound A (200 gj .44 mol),BnBr (345 mL,2.88 mol) and K.2C03 (3i g,2.16 mol) in acetone was refluxed over night .The reaction mixture was filtered and the filtrate was concentrated to give compound B (421 g,91.5%).85% meta-perchlorobenzoic acid (348 g,l .72 mol) was added ,with stirring ,at ambient temperature to a solution of compound B (421 g, 1 .32 mol) in 4000 ml. anhydrous methylene chloride.After stirring for 30 minutes ,the mixture was filtered and the filtrate was washed with a solution of sodium bicarbonate ,then with a solution of NaHS03 and finally with water. After drying on sodium sulphate ,the solvent was evaporated ,the residue were taken up in methanol (2000 mL)and water (2000 mL), NaOH (263.8 g,6.60 mol) was added and stirring was carried out for 30 minutes after which the mixture was acidified with concentrated FIG. One extracts with methylene chloride and then washed with water until neutral. After drying on sodium sulphate, the solvent was evaporated , compound C (300 g,74%) was obtained. A mixture of compound C(22 g,71.89 mmol),l-bromo-2-methoxyethane(13.4 mL,14.38 mmol) and 2CO3(30 g,21.57 mmol) in DMF was stirred at 80 U over night. The reaction mixture was filtered and filtrate was concentrated to give compound D(20 g, 84%). A slum' of compoimd D (20 g,54.94 mmol) and Pd/C (4.0 g) in methanol (500 mL) was stirred at ambient temperature for 4 hours under 2 arm ¾ (30 PSI).The mixture was filtered and filtrate was concentrated ,the residue was purified by column chromatogram to give compound 1(9.7 g,95%).
1107] Synthesis of Compound 3:
"^ k ooEt RT. 12 h '·' °
8] Compound 1 (9.7 g, 52.7 mmol) and compound 2 (12.1 g, 52.7 mmol) were added to CH3SO3H (500 mL) at RT. The mixture was stirred at RT for 12 h. LC-MS showed that starting material was consumed complete!)'. The reaction mixture was poured into ice- water (300 mL) and stirred for 30 min. The formed precipitate was filtered and washed with water and EA, dried, afforded the crude compound 3 (19.5 g, 100 %) as white solid.
[1109] Synthesis of Compound 4:
Figure imgf000381_0001
[1110] Compound 3 (1.0 eq) was added to amine The reaction mixture was stirred at 120 °C for 48 h. LC-MS showed that the starting material was almost consumed completely. The solvent was removed under vacuum. The residue was washed with DCM and
concentrated under vacuum, afforded compound 4.
11111] Synthesis of Compound 5:
Figure imgf000381_0002
] A mixture of compound 4 ( 1.0 eq) and HMTA (4.0 eq) in TFA (100 mL) was heated to 90°C under nitrogen for 2 h. LC-MS indicated that the reaction was completed. After cooled to RT, the solvent was removed under vacuum. The residue was purified by Prep- HPLC, afforded compound 5.
Figure imgf000382_0001
7-Hydroxy-6-(2-methoxyethoxy)-4-methyl-3-(3-morpholino-3-oxopropyI)-2-oxo-2H- c romesie-8-carbaMeliyde was obtamed by the above procedure from amine A2, 40 % yield. iHNM (CDCl3,400MHz) δ 10.56 (s, ! I L CHO), 7.36 (s, I N. ArH), 4.24-4.21 (m, 2H, CH2), 3.83 (t, 5.4 Hz, 21 !. CH2), 3.76-3.66 (m, 8H), 3.47 (s, M l. CH3), 2.95-2.91 (m, 2H„ CH2), 2.69-2.65(m, 2H, Π i.< ). 2.43 (s, 3H, CH3); MS [ESI, MH; ]:
7-Hydroxy-6-(2-methoxyethoxy)-4-methyl-3 -(3 -(4-methylpiperazin- 1 -yl)-3 -oxopropyl)- 2-oxo-2H-chromene-8-carbaldehyde was obtained by the above procedure from amine A3. 20 % yield. iHNMR (D2O,400MHz) δ 10.06 (s, 1H, CHO), 7.12 (s, 1H, ArH), 4.57 (d ./ 10.4 Hz, 1H), 4.26 (d, J= 14.0 Hz, 1 H), 4.14 (d, J= 0.8 Hz, 2H, CH2), 3.85 (s, 2H, CH2), 3.67-3.54 (m, 3H), 3.45 (s, 3H, OCH,), 3.24-3.18 (m, 1H), 3.14-3.07 (m, 2.97-2.94 (m, 2H), 2.76-2.74 (m, 2H), 2.28 (s, 3H, CH ); MS [ESI, M i I | · 433.2.
Figure imgf000382_0003
N-Ethy[-3-(8-formyl-7-hydroxy-6-(2-methoxyethoxy)-4-methyl-2-oxo-2H-chromen-3- yl)propanamide was obtamed by the above procedure from amine A4. 12 % yield. [1116] HNMR (CDC¾,40OMHz) δ 12.36 (s, 1H, OH),10.58 (s, 1H, CHO) 7.38 (s, 1H, ArH), 4 25-4 22 (m, 2H, CH2), 3.79-3.77 (m, 2H, (Ί ί, Κ 3.44 (s, 3H, OCH3), 3.26-3.23 (m, 2H„ CH2), 2.96(t, J = 7.6 Hz, 2H, CH2), 2.48-2.42 (m, 5H), 1.08 (t, J = 7.2 Hz, 3H, CH3); MS [ESL MH1]: 378.1.
Figure imgf000383_0001
[1117] 3-(8~Formyl-7-hydroxy-6~(2-methoxyethoxy)~4-methyl-2~oxo~2H~chromen-3~yl)~N~
(2-aieihoxyethyI)propasiaiiiide was obtained by the above procedure from amine Al. 12 % yield. 1HNMR (CDC OOMHz) δ 12.41 (d, J = 16.8 Hz, 1H, OH), 10.59 (s, 1H, CHO) 7.38 (s, 1 H, ArH), 4.24 (t, ./ 4.6 Hz 2H, CH2), 3.79 (t, J = 4.6 Hz, 2H, CH2), 3.45 (s, 3H, OCH3), 3.41 (d, J= 2.4 Hz, 4H, 2C¾), 3.30 (s, 3H, OCH3), 2.97 (t, J= 7.6 Hz, 2H, CH2), 2.43 (t, ./ 7.6 Hz, 21 !. CH2), 2.26 (s, 3H, CH3); MS [ESI, Vi i i I : 408.1 .
Figure imgf000383_0002
[1118] N-(2-(Dimethylamino)ethyl)-3-(8-formyl-7 iydroxy-6-(2-metho
oxo-2H-criromen-3-yl)propanamide was obtained by the above procedure from amine A6. 9 % yield. f HNMR (D2O,400MHz) δ 9.66 (s, 1 H, CHO), 6.76 (s, 1 H, ArH), 3.89 (s, 2H, CH2), 3.70 (s, 2H, CH2), 3.50 (d, J = 5.6 Hz, 2H, CH2), 3.35 (s, 3H, OCH3), 3.24 (d, J= 5.6 Hz, 2H, CH2), 2.86 (s, 6H, 2NCH3), 2.58 (d, J= 7.2 Hz, 1 H), 2.32 (d, J = 7.2 Hz, 1 H), 2.05 (s, M l. CI S : ): MS [ESI, MH+] : 421.2.
Figure imgf000383_0003
[1119] 3-(8-Formyl-7-hydroxy-6-(2-methoxyethoxy)-4-methyl-2-oxo-2H-chrornen-3-yl)-N-(2- moipholinoethyljpropan amide was obtained by the above procedure from, amine A2. 13 % yield. 1HNMR (D2O,400MHz) δ 9.64 (s, IH, CHO), 6.75 (s, IH, ArH), 4.09 (d, 12.8 Hz, 2H, CH2), 3.88 (s, 2H, ( '! !, ). 3.83 (d, J = 13.6 Hz, 2H, CM, ). 3.77 (s, 4H, CH2), 3.70 (s, 2H, CH2), 3.36 (cL ./ 2.0 Hz, 311 OCH3), 3.30 (d, ./ 5.6 Hz, 2H, CH2), 3.15 (t, 1 1.6 Hz, 2H, CH2), 2.58 (s, 2H, CM, ). 2.32 (s, 2H, CH2), 2.05 (s, 3H, CH3); MS [ESI, MH ] : 463.2.
EXAMPLE 66
Figure imgf000384_0001
[1120] Synthesis of Compound 1 :
HO ¾¾ ,OH HCX _, ¾ OH
]: " \ MeOH.HCl ίί 1
r
OH OMe
1
[1121] The solution of compound (50 g, 396.82 mmol) in solvent (methanol: l ,2-dioxane=
4: 1 ,1000 ml.) was stirred at 0"C under HC1 (gas) for 1 hour ,then the mixture was refluxed for 24 hours. The mixture was concentrated and purified by column
chromatogram to give Compound 1 (33 g, 58.9%). [1122] Synthesis of Compound 3 :
Figure imgf000385_0001
1
[1123] Compound 1 (25 g, 0.178 mol) and compound 2 (40.7 g, 0.178 mol) were added to
CH3SO3H (500 mL) at RT. The mixture was stirred at RT for 12 h. LC-MS showed that startmg material was consumed completely. The reaction mixture was poured into ice- water (300 mL) and stirred for 30 min. The formed precipitate was filtered and washed with water and EA, dried, afforded the crude compound 3 (10.2 g, 18.6 %) as white solid.
[1124] Synthesis of Compound 4:
Figure imgf000385_0002
[1125] Compound 3 (1 eq) was added to amine (20 mL). The reaction mixture was stirred at 120 "C for 48 h. LC-MS showed that the startmg material was almost consumed completely. The solvent was removed under vacuum. The residue was washed wit DCM and concentrated under vacuum, afforded compound 4.
[1126] Synthesis of Compound 5 :
Figure imgf000385_0003
1127] A mixture of compound 4 ( 1.0 eq) and HMTA (4,0 eq) in TFA (100 mL) was heated to 90°C under nitrogen for 2 h. LC-MS indicated that the reaction was completed. After cooled to RT, the solvent was removed under vacuum. The residue was purified by Prep- HPLC, afforded compound 5.
Figure imgf000386_0001
[1128] 7-Hydroxy-5-methoxy-4-methyl-3-(3-morpholino-3-oxopropyl)-2-oxo-2H-cliromene-8- carbaldehyde was obtained by the above procedure from amine A2. 15 % yield.
[1129] 1HNMR (CDC13, 400 MHz): δ 10.38 (s, 1H, CHO), 6.27 (s, i f !. Ari l ), 3.93 (s, 31 1
ArOCH3), 3.70-3.56 (m, 8H, CH2), 2.94-2.90 (m, 2H, ( Ί I ·■}. 2.58 (s, 3H, CH3), 2.58-2.53 (m, 2H, CH2); MS [ESI, VII ! | : 376.2.
Figure imgf000386_0002
7-Hydroxy-5-methoxy-4-methyl-3~(3-(4~methylpiperazin-l~yl)~3-oxopropyl)-2-oxo-
2H-chr mene-8-carbaIdehyde was obtained by the above procedure from amine A3. 9.2 % yield. 1HNMR (MeOD, 400 MHz): 8 10.30 (s, 1H, CHO), 6.44(s, 1H, ArH), 3.97 (s, 3H, ArOCH. . 3.29-3.27 (m, 5! L C 'l i■). 2.93 (s, M l. CH3), 2.92-2.87 (m, 4H, CH2), 2.596-2.593 (m, 6H, CH2); MS [ESI, MH+] : 389.2.
Figure imgf000386_0003
[1131] 3-(8-Formyl-7-hydroxy-5-methoxy-4-methyl-2-oxo-2H-chromen-3-yl)-N-(2- methoxyethyI)propanamide was obtained by the above procedure from amine Al. 13 % yield. 'HNMR (CDC13, 400 MHz) : 610.36 (s, 1 H, CHO), 6.30(s, 1 H, -NH),6.26 (s, 1H, ArH), 3.93 (s, 3H, ArOCH3), 3.44-3.43 (m, 4H, 2Π !.·· ). 3.31 (s, 3H, OCH3), 2.95 (t, 2H, J = 8 Hz, CH2), 2.56(s, 3H, CH3),2.47(t,2 H, J = 8.0 Hz, Cf I ·■}. MS [ESI, MW . 364.1.
Figure imgf000387_0001
N-(2-(Dimethylamino)ethyI)-3-(8-formy
chromefi~3~y1)propaiiamide was obtained by the above procedure from amine Al. 10% yield. 1HNMR (D20, 400 MHz) : 69.72 (s, 1H, CHO), 6.10(s, 1 H, ArH),6.26 (s, 1H, ArH), 3.81 (s, 3H, ArGCH ), 3,59(t, 2H, ./ = 6.0 Hz CH2), 3.32(t, 2H, J = 6.0 Hz CH2), 2.95 (s, 6H, 2CH3), 2.72(t,2 H, J = 7.6 Hz, CH2). 2.39(t,2 H, 7.6 Hz,
CH2),2.37(s,3H,CH3); MS [ESI, MH+] : 377.1.
Figure imgf000387_0002
3-(8-FormyI-7-hydroxy-5-methoxy-4-methyl-2-oxo-2H-chromen-3-yI)-N-(2- morpholinoethyl)propanamide was obtained by the above procedure from amine AS. 7.8 % yield. lH MR (MeOD, 400 MHz) : δ 10.26 (s, I H, CHO), 6.42 (s, IH, Al l ). 5.89 (s, IH, ArH), 4.05(8, 2H, CH2), 3.96 (s, 3H, ArOCH3), 3.87-3.51 (m, 8H, CH2), 3.14 (s, 2H, CH2), 2.93(1. 2H, ./' 7.6 Hz,CH2), 2.56 (s, 3H, CH3), 2.43-2.36 (m, 21 !. CH2). MS SI, Ml I j: 419.2.
EXAMPLE 67
Figure imgf000387_0003
A1 A2 [1134] Synthesis of Compound 3:
Figure imgf000388_0001
35] To a suspension of compound 1 (1 eq), compound 2 (1.2 eq ),CH3S03H was added in one portion. The mixture was stirred at RT 12 h. LC-MS showed that starting material was consumed completely. The reaction mixture was poured into ice-water (100 mL) and stirred for 30 min. The formed precipitate was filtered and washed with water and EA, dried to afford the crude compound 3 and use at the next step directly.
.36] Synthesis of Compound 4:
Figure imgf000388_0002
4
[1137] A mixture of compound 3 (1 eq) and HMTA (4 eq) in TFA was heated at 100°C under nitrogen for 1 .5 . The reaction mixture turned to dark-yellow in the period. LCMS indicated that the reaction was completed. After cooled to RT, the solvent was removed under reduced pressure, the product was purified by Prep-HPLC to give compound 4.
Figure imgf000388_0003
[1138] 7-Hydroxy-6-methoxy-2-oxo-4-(trifluoromethyl)-2H-chromene-8-carbaldehyde was obtained by the above procedure from media Al. 39.6 % yield. 1H MR (CDClj, 400 MHz): 8 12.69 (s, 1H, OH), 10.59 (s, 1H, CHO),7.23(s, 1H, ArH),6.72 (s, 1H, CH), 3.96 (s, 3H, OCI¾); MS [ESI, MET]: 289.0.
Figure imgf000389_0001
7-Hydroxy-8-methoxy-4-oxo-l,2,3,4-tetrahydrocydopenta[cjchromene-6- carbaldehyde was obtained by the above procedure from media A3, 8.9 % yield, 1H MR (CDCI3, 400 MHz): δ 12.47 (s, I B, OH), 10.63 (s, 1 H,
CHO),7.01(s,lH,ArH),3.95(s,3H,OCH3),3.08-3.04(m52H.CH2),2.96-2.92(m.2H,CH2),
1140] 2.25-2.22 (m,2H,CH2); MS [ESI, MH+] : 261.1.
Figure imgf000389_0002
7-Hydroxy-6-methoxy-3,4-dimethyl-2-oxo-2H-chromene-8-carbaIdehyde was obtained by the above procedure from media A3.1.2 % yield. 1HNMR (CDCI3, 400 MHz): 8 12.38 (s, 1H, OH), 10.61 (s, 1H, CHO),7.18(s, 1H, ArH),3.95 (s, 3H,
OCH3),2.38(d,3H, J==8.0 HZ CI¾),2.20(d, M l ./ Κ.ίί HZ CH2); MS [ESI, M i ! i: 249.1.
Figure imgf000389_0003
1142] 7-Hydroxy-3-isopropyl-6-methoxy-4-methyl-2-oxo-2H-chromene-8-carbaldehyde was obtained by the above procedure from media A4.5 % yield. iH MR (CDCI3, 400 MHz): δ 12.38 (s, 1H, OH), 10.61 (s, 1H, CHO),7.24 (d, 1H, J=14.8 HZ,ArH),3.96 (s, M l. OCH3),2.38(m,lH,CH),2.41(s, 3H, CH3),1.37-1.35(m,6H). EXAMPLE 68
Figure imgf000390_0001
A 3 1 To a solution of compound .4(55 g, 179.74 mmol),2-morpholinoethanol(23.5 g, 179.74 mmol) and triphenyiphosphine (56.5 g,215.69 mmol) in THE, DIAD (43.5 g,215.69 mmol ) was added in portions .The solution was stirred at ambient temperature over night. The reaction mixture was concentrated and purified by column chromatogram to give compound B (52.6 g, 69,8 %). A slurry of compound B (52.6g, 125.54 mmoi),
CH3COOH (100 niL) and Pd/C (14.0 g) in methanol (800 mL) was stirred at ambient temperature for 4 hours under 2 atm H2 (30 PSI).The mixture was filtered and filtrate was concentrated, the residue was purified by column chromatogram y to give compound 1(30 g, 98 %). [1145] Synthesis of Compound 3:
Figure imgf000391_0001
A mixture of compound 1(6.7 g, 28.0 mmol) and compound 2(7.06 g, 28.0 mrnol) in methane sulfonic acid was stirred at ambient temperature over night. The reaction mixture was poured into ice-water and stirred for 30 minutes .The formed precipitate was filtered and washed with water and EA, dried to afford the compound 3(5. Og, 44%),
[1147] Synthesis of Compound 4 :
Figure imgf000391_0002
Compound 3 (1.0 eq) was added to Amine (20 niL). The reaction mixture was stirred at 120 °C for 48 h. LC-MS showed that the starting material was almost consumed completely. The solvent was removed under vacuum. The residue was washed with DCM (3 x 5 mL) and concentrated under vacuum, afforded compound 4.
[1149] Synthesis of Compound 5:
Figure imgf000391_0003
A mixture of compound 4 (1.0 eq) and HMTA (4.0 eq) in TFA (100 mL) was heated to 90°C under nitrogen for 2 h. LC-MS indicated that the reaction was completed. After cooled to RT, the solvent was removed under vacuum. The residue was purified by Prep- HPLC, afforded Compound 5.
Figure imgf000392_0001
1151] 3-(8-Formyl-7-hydroxy-4-methyI-6-(2-morphoMnoethoxy)-2-oxo-2H-chromen-3-yl)- N-(2-methoxyethyi)propanamide was obtained by the above procedure from amine Al. 10% yield. ΉΝΜΚ (!)>().400 MHz): 610.11 (s, IH, CHO), 7.31 (s, ML ArH), 4.39 (t, J = 4.4 Hz, 2H, Ce2),4.06 (d, J = 12 A Hz, 2H, CH2j, 3.79 (t, J= 12.4 Hz, 2H, CH2), 3.64- 3.58 (m, 4H, CH2), 3.32-3.25 (m, 4H, CH2), 3.16 (t, J= 5.6 Hz, 2H, CH2), 3.07 (s, 3H, OCH3), 2.73 (t, J :::: 7.6 Hz, 2H, CH2), 2.32 (t, J ------ 6.8 Hz, 2H, CH2), 2.24 (s, 3H, CH3);
MS [ESI, Μϊ- ]: 462.23.
Figure imgf000392_0002
1152] N-Ethyl-3-(8-formyl-7-hydroxy-4-methyI-6-(2-morphoiinoethoxy)-2-oxo-2 H- chromen~3~y])propanamide was obtained by the above procedure from amine A4.7.4 % yield. fHNMR (D20, 400 MHz): 59.97 is. IH, CHO), 7.25 (s, IH, ArH), 4.35 (t, J ------- 4.4
Hz, 2H, CH2),4.03 (d, J= 12.8 Hz, 2H, CH2), 3.79 (t, J= 12.8 Hz, 2H, CH2), 3.61-3.55 (m, 4H, CH2), 3.26-3.23 (m, 2H, CIS,!.2.95-2.64(m, 4H),2,21-2,18(m, 5\\). 0.82 (t, J = 7.2Hz, CH3; MS [ESI, Mil j: 433.2.
EXAMPLE 69
Figure imgf000393_0001
Figure imgf000393_0002
Figure imgf000393_0003
A6
[1153] Synthesis of 4-methoxybenzene-l ,3-diol
Figure imgf000393_0004
3
[1154] To a solution of compound 1 (300 g, 1.98 mol) and Se02 (17.4 g, 0.15 mol) in DCM (4
L) was added H2Q2 (512 mL) dropwise at 0 °C. The reaction mixture was stirred at RT for 16 h. The reaction was monitored by TLC. After the STM was consumed completely, the reaction mixture washed with aq.10% NaHS03 (1 L), followed by Na2C03 (1 L) and brine (1 L) successively, dried over Na2S04, concentrated to get the crude compound 2 without further purification. The crude compound 2 was dissolved in a mixture of MeOH (3 L) and aq.10% KOH (2 L) and stirred at RT overnight. After MeOH was removed, the mixture was acidified by 6M HC1 to pH=3 and extracted with DCM (2 L X 8). The combined DCM phase was washed with brine and dried over NaS04, concentrated. The residue was purified by silica gel column (EA:PE = 6:1 to EA:PE = 4: 1) to give 4- methoxybenzene~l,3~diol (140 g, 50.5% yield) as light-yellow solid. T!NMR (MeOD, 400MHz): δ 6.70 (d, ./ 8.8 Hz, i ! L ArH), 6.29 (d, J = 3.2 Hz, 1H, ArH), 6.18 (dd, J = 8.8, 2.8 Hz, H i. ArH), 3.73 (s, 3H, CH3).
1155] Synthesis of ethyl 4-(2,4-dihydroxy-5-methoxyphenyl)-4~oxobutanoate:
Figure imgf000394_0001
[1156] To a suspension of compound 3 (15 g, 0.11 mol) and compound 4 (21 g, 0.13 mol) in Dichloroethane (300 mL) was added BF3 C2H60 (15 g, 0.11 mol) in one portion. The mixture was stirred at RT for 4 h. After standing overnight, the reaction mixture was heated to reflux for 4 h, then cooled to RT. The formed precipitate was filtered and washed with water and EA, dried to afford the crude ethyl 4-(2,4-dihydroxy-5- metboxyphenyl)-4-oxobutanoate (20 g, 69% yield) as yellow oil. MS [ESI, MH4]: 268.
1157] Synthesis of ethyl 2-(7-acetoxy-6-methoxy-2-methyl-4-oxo-4H-chromen-3-yl) acetate:
Figure imgf000394_0002
[1158] The mixture of compound 5 (20 g, 0.07 mol ), Ac20 (31 g, 0.29 mol) and DBU (9 g, 0.55 mol) was heated to reflux for 6 h. After cooling to RT, the reaction mixture was dissolved in DCM (400 mL), then the solution was washed with water, dried over Na2S04 and concentrated to give the ethyl 2-(7-acetoxy-6-methoxy-2-methyl-4-oxo-4H-chromen-3- yl)acetate (12 g, 48%, yield). MS [ESI, MNa+]: 356.9. [1159] Synthesis of 2-(7-hydroxy-6-methoxy-2-methyl-4-oxo-4H-chromen-3-yl) acetic acid
Figure imgf000395_0001
The suspension of compound 6 (12.0 g, 0.036 mol) in 20% H2S04 (80 rnL) was heated to reflux for 4 h. After cooling to RT, the formed precipitate was filtered, washed with wafer and EA, dried to give 2-(7-hydroxy-6-methoxy-2-methyl-4 )xo-4H-chromen-3-yl)acetic acid ( 8 g, 85%). MS [ESI, MNa+]: 286.8.
1161] Synthesis of Compound 8:
Figure imgf000395_0002
11 2] To the suspention of compound 7 (1 eq) and HATU (1 eq) in DMF was added Et3N (2 eq) dropwise at RT. The mixture was stirred at RT for Ih. Then amine (1 .5 eq) was added. The reaction mixture was stirred at RT for another 10 h. DMF was removed un vacuum, the residue was diluted with MeOH, the formed precipitate was filtered and washed with EA, dried to give compound 8.
11 3] Synthesis of Compound 9:
Figure imgf000395_0003
[1164] A mixture of compound 8 (1 eq) and HMTA (4 eq) in HOAc was heated to 90 'C under N2 for 1.5 h. The reaction was monitored by LCMS. After cooled to RT, the solvent was removed under vacuum; the residue was purified by prep-HPLC to give compound 9.
Figure imgf000396_0001
[1165] 7-Hydroxy-6-me†hoxy-2-methyl-3-(2-morpholino-2-oxoethyl.)-4-oxo-4H-chromene-8- carbaldehyde was obtained by the above procedure from amine A2. 12% yield.
[1166] 1 HNMR (CDC13, 400 MHz): δ 12.80 (s, IH, OH), 10.53 (cL IH, J=1.2 Hz, CHO), 7.68 (s, IH, ArH), 3.97 (s, 3H, ArOCH3), 3.77-3.61 (m, 10H), 2.53 (s, 3H, C i h). MS [ESI, VI I ί ] . 362.0.
Figure imgf000396_0002
1167] 7-Hydroxy-6-methoxy-2-methyI-3-(2-(4-niethyipiperazin-l-yl)-2-oxoethyl)-4-oxo- 4H-chromene-8-carbaldehyde hydrochloride was obtained by the above procedure from amine A3. 8% yield. f HNMR (MeOD, 400 MHz): δ 7.47 (s, I H, ArH), 6.02 (s, I H CHO), 3.93(s, 3H, CH3), 3.58-3.54 (m, 10H), 2.95 (s, 3H, CH3), 2.45 (s, 3H, CH3), MS [ESI, MET]: 375.1 .
Figure imgf000396_0003
[1168] N-Ethyl-2-(8-formyl-7-hydroxy-6-methoxy-2-methyl-4-oxo-4H-chromen-3- yl)acetamide was obtained by the above procedure from amine A4. 9% yield. 'HNMR (CDC13, 400 MHz); δ 10.53 (d, IH, J ------- 0.8 Hz, CHO), 7.69 (s, I H, ArH), 6.50 (br, I H,
NH), 3.99 (s, 3H, ArOCH3), 3.42 (s, 2H, CH2), 3.22-3.18 (m, 2H, CH2), 2.62(s, 3H, CH3), 1 .09 (t, S ~ \ I. J 0 8 Hz, Ci¾). MS [ESI, V!f ! j: 320.1.
Figure imgf000397_0001
2-(8-Formyl-7-hydroxy-6-methoxy-2-methyl-4-oxo-4H-chromen-3-yl)-N-(2- morpholmoetfwI)acetamide was obtained by the above procedure from amine A5, 9% yield. 1 I f N M R (D20, 400 MHz): δ 10.21 (s, 1H, CHO), 7.26 (s, 1 H, ArH), 4.14(d, 2H, J ------ 12.4 Hz, CH2), 3.88-3.82 (m, 61 L 3CH2), 3.67 (t, 4! i. J 6.0 Hz, 2CH2), 3.53 (s, 2H,
CH2), 3.40 ( i, 2R J = 6.0 Hz, CH2), 3.29-3.22 (m, 1H), 2.47 (s, M l. CH3). MS [ESI, MH+] I 405.1.
Figure imgf000397_0002
N~(2-(t?imethylami o)eihyl)~2-(8~formy!~7~hydroxy-6-meihoxy-2~met^
chron¾en-3-yl)acetamide was obtained by the above procedure from amine A6. 8% yield. !HNMR (D20, 400 MHz): 6 10.26 (s, 1H, CHO), 7.32 (s, 1H, ArH), 3.88 (s, 3H, (Ί ! :: }. 3.66 (t, 2H, J zzz 5.6 Hz, CH2), 3.56 (s, 2H, CH2), 3.37 (t, 2H, J == 5.6 Hz, CH2), 2.97 (s, 6H, 2CH3), 2.50 (s, 3H, O h ). MS [ESI, VII ! j : 363.1 .
EXAMPLE 70
Figure imgf000398_0001
HAT U . Et-N
Figure imgf000398_0002
Figure imgf000398_0003
A1 A2 A3 A4 A5
[1171 ] Synthesis of Compound 3:
Figure imgf000398_0004
To a suspension of compound 1 (15 g, 0.1 1 mol) and compound 2 (21 g, 0.13 mol) in Dichloroethane (300 ml), BF3 C2H60 (15 g, 0.11 mol) was added in one portion. The mixture was first stirred at RT for 4 h, then heated to reflux for 4 h. After cooling to RT. the formed precipitate was filtered and washed with water and EA, dried to afford the crude compound 3 (20 g, 69% yield) as yellow oil. [1173] Synthesis of Compound 4:
Figure imgf000399_0001
[ 174] To a suspension of compound 3 (38 g, 0.15 mol) in EtOH (300 mL) was added H2S04 (1 mL), The mixture was heated to reflux for 4 h. After cooling to RT, the reaction mixture was concentrated and purified by silica gel column to give compound 4 (30 g, 75% yieid) as vellow oil .
[1175] Synthesis of Compound 5 :
Figure imgf000399_0002
[ 176] The mixture of compound 4 (30 g, 0.1 !mo!, Ac20 (43,4 g, 0.42mo!) and DBU ( 15 g, 0.10 mol) was heated to reflux for 6 h. After cooled to RT, the reaction mixture was dissolved in DCM (400 mL), then the solution was washed with water, dried over Na2S04 and concentrated to give the compound 5 (19 g, 50% yield), 1HNMR. (ΠΧΊ .·. 400 M Hz): δ 7.62 (s, ! i !. ArH), 7. 14 (s, 1H, Ari l ). 4.10 (q, 2! L ./ 7.2 Hz, CH2), 3.91 (s, 3H, CH3), 2,84 (t, 2H, J = 7.6 Hz, CH2), 2.60 (t, 2H, J = 7,6 Hz, CH2), 2.46 (s, 3H, CH3), 1.57 (s, M l CI¾), 1.22 (t, 3H, J = 7.2 Hz, (¾).
1177] Synthesis of Compound 6:
Figure imgf000399_0003
[ 178] The suspension of compound 5 (19 g, 0.054 mol) in 20% H2S04 (160 mL) was heated to reflux for 4 h, after cooling to RT, the formed precipitate was filtered, washed water and EA, dried to give compound 6 (12 g, 80%), 1HNMR. (MeOD, 400 MHz): δ 7,43 (s, i l l. ArH), 6.84 (s, i l l. ArH), 3.93 (s, 3H, ArOCH3), 2.81 (t, 2H, J= 7.6 Hz, CH2), 2.53 (q, 2H, J ------- 7.6 Hz, CH2), 2.47 (s, M l CH3).
[1179] Synthesis of Compound 7:
Figure imgf000400_0001
[1180] To the suspension of compound 6 (1 eq) and HATU (1.05 eq) in DMF was added Et3N (1.1 eq) dropwise at RT. Then the mixture was stirred at RT for 1 h. Amine (1.1 eq) was added. The reaction mixture was stirred at RT for another 10 h. DMF was removed under vacuum. The residue was diluted writh MeOH, the formed precipitate wras filtered and washed with EA, dried to give compound 7.
[1181] Synthesis of Compound 8:
Figure imgf000400_0002
A mixture of compound 7 (1 eq) and HMTA (4 eq) in HO Ac was heated at 120 °C under N2 for 1.5 h. The reaction mixture was monitored by LCMS. After cooled to RT, the solvent was removed under vacuum; the residue was purified by prep-HPLC to give compound 8,
Figure imgf000400_0003
1183] 3-(8-FormyI-7-hydroxy-6-methoxy-2-methyl-4-oxo-4H-chromen-3-yI)-N-(2- methoxyetfayI)propanamMe was obtained by the above procedure from amine Al. 9% yield. 1H MR (CDCl3, 400 MHz): δ 12.78 (s, l i s. OH), 10.54 (s, 1 1 1. CHO), 7.72 (s, 1 H, ArH), 6.03 (br, I I f. NH), 4.00 (s, 3H, ArQCH3), 3.42 (s, 4S L 2CS I.- 3.31 (s, M l OCH3), 2.89 ίί, ./ 6.8 Hz, 2H, CH2), 2.55-2.51 (m, 5H). MS [ESI, Vlf ! |: 364.0.
Figure imgf000401_0001
] 7 3ydroxy~0~methoxy~2-methyl~3~(3-i4~m
4H=ehromerie-8-carhaMehyde hydrochloride was obtained by the above procedure from amine A3. 13% yield. 1HNMR (D20, 400 MHz): δ 10.12 (s, 1H, CHO), 7.15 (s, 1H, ArH), 4.62 (m, IH), 4.28 (m, 1H), 3.82 (s, 3H, ArOCH3), 3.63 (m, 3H), 3.24 (m, 1H), 3.12 (m, 2H, CH2), 2.98 (s, 3H, NCH3), 2.66 (m, 4H), 2.43 (s, 3H, C¾). MS [ESI, Ml ! j: 389.3
Figure imgf000401_0002
] -Ethyl-3-(8-formy!-7-hydroxy-6-methoxy-2-methyl-4- xo-4H-chromesi-3- yf)propanamide was obtained by the above procedure from amine A4. 9 % yield .
1HNMR (CDCls, 400 MHz): δ 12.78 (s, 1H, OH), 10.51 (s, i l l. CHO), 7.67 (s, 1H, ArH), 6.21 (br, I I I. NH), 3.97 (s, 3H, ArOCH3), 3.25 (q, J = 7.2 Hz, 21 1. CH2), 2.86 (t, 2H, J ------
12 Hz, CH2), 2.53 (m, 5H), 1.08 (t, 3H, ./' 7.2 Hz, CH3). S [ESI, ! i j: 334.1.
Figure imgf000401_0003
3-(8-Formyl-7-hydroxy-6-methoxy-2-methyl-4-oxo-4H-chromen-3-yl)-N-(2- morphoIinoethyl)propanamide hydrochloride was obtained by the above procedure from amine A5. 12% yield. 1HNMR (D20, 400 MHz): δ 10.07 (s, 1H, CHO), 7.10 (s, 1 ArH), 4.13 (d, 2H, J= 12.0 Hz, CH2), 3.86 (d, 2H, J= 12.0 Hz, CH2), 3.78(s, 3H, ArCX i .3.62 (m, 4H, 2Ce2), 3.34 (t, 2H, J ------- 6.0 Hz, CH2), 3.23 (q, 2.W. 12.0 Hz,
CH2), 2.68 (t, 2H, J= 8.0 Hz, CH2), 2.43(m, 5H). MS [ESI, MH÷] : 419.2
Figure imgf000402_0001
N~C2~(Dimett5ylammo)eifiyl)~3~^^
ehromeri-3-yI)propsmamide hydrochloride was obtained by the above procedure from amine .46.11% yield. 'i!VvlR (D20, 400 MHz); δ 10.10 (s, if!. CHO), 7.15 (s, IH, ArH), 3.80 (s, 3H, Ar()CH3), 3.58 (t, ./ 6.0 Hz, 2H, CH2), 3.30 (t, 2H, J == 6.0 Hz, CH2), 2.94 (s, 6H, 2CH3), 2.70 (t, 2H, J= 6.8 Hz, CH2), 2.41(m, 5H). MS [ESI, MH+]: 377.1.
EXAMPLE 71
Figure imgf000402_0002
[1188] Synthesis of Compound 3:
Figure imgf000403_0001
[1189] Glutarie anhydride dissolved in 3000 ml 1.2-DCE,the reaction mixture cooled to 0
"('.A id.: (138.3 g, 1.04 mol) added dropwise with stirring at 0 °C, the above suspension added a solution of compound 1 ( 110.4 g ,0.8 mol) in 600 ml of 1 ,2-DCE from the dropping funnel over a period of 30min.the mixture solution stirred at RT for 30 min,TLC(PE:EA::::l : l ) showed the starting material was consumed completely. The above solution poured into 1000 ml ice- water ,the organic layers separated,the aqueous layer was extracted with DCM (500*3) ,the combined organic layers were washed with sat NaCl(500 mi*2) , dried over Na2S04, the solvent was removed to get the cmde compound 2 and use at the next step directly,
[1190] The solution of the cmde compound 2 in EtOH (1000 mi) and H2SO4(I0 ml) was heated to reflux ed for 2 h , LC-MS showed the starting material was consumed completely, after cooled ,the solvent was removed ,the solids was filtrated, washed with PE (300 mi) to give (160 g ,65 %) compound 3 as white solid.
[1191] MS [ESI, Mi ! 1: 280.
[1192] Synthesis of Compound 4:
Figure imgf000403_0002
3 4
1193] To a solution of compound 3(160 g, 0.57 mol) in dry DCM (1900 ml) was added BBr¾ (1142 g ,3.42 mol) in portions with stirring at -70 °C, the reaction solution stirred at RT for 3 h, The reaction was quenched by addition of 1000 ml of ethanol at -70 UC, the solvent was removed .the residue was eiiromatographed on silica gel (PE:EA=5: 1) to give compound 4(80 g ,56 %) as white solid. MS [ESI, MH+] : 253.0. [1194] Synthesis of Compound 5:
Figure imgf000404_0001
1195] To a suspension of compound 4 (42.8 g, 0.17 mol) in AC20(69 g,0.68 mol) was added DBU(20.7 g,0.14 mol) in one portion .The solution stirred at 120 °C for 16h,
TLC(PE:E.A:::5: 1) showed the starting material was consumed completely. After cooled, the residue poured into 500 ml ice-water ,the reaction mixture was extracted with DCM(! 50*3),The combined organic layers dried, concentrated and chromatographed on silica gel (PE:EA=5: 1) to give compound 5(40 g, 76 %) as white solid.
1196] Synthesis of Compound 6 :
Figure imgf000404_0002
The compound 5 (33 g , 0.103 mol) in 20 % 1¾SQ4(5Q0 ml) were heated to 100 °C overnight, after cooled, the solids was filtrated, washed with DCM three times to give(20 g , 78 %) compound 6 as white solid
[1198] Synthesis of Compound 7:
Figure imgf000404_0003
To the suspention of Compound 6 (1 eq) and H.ATUf l .05 eq) in DMF was added Et3N(I .l eq) dropwise at RT, after the mixture was stirred at this temperature for 1 h, amine (1 .1 eq) was added, the reaction mixture was stirred at RT for another 10 h, after DMF was eliminated, diluted with MeOH, the formed solid was filtered and washed with EA, dried to give Compound 7,
[1200] Synthesis of Compound 8:
Figure imgf000405_0001
1201 ] A mixture of compound 7 ( 1 eq) and HMTA (4 eq) in HO Ac was heated at 120 °C under nitrogen for 1.5 h. The reaction mixture turned to dark-yellow in the period. LCMS indicated that the reaction was completed. After cooled to RT, the solvent was removed under reduced pressure, the product was purified by Prep-HPLC to gi ve compound 8.
Figure imgf000405_0002
3-(8-FormyI-7-hydroxy-2-methyi-4-oxo-4H-chromen-3-yI)-N-(2- methoxyetfayI)propanamMe was obtained by the above procedure from amine Al. 4, 1 % yield. 1HNM (C DC ,400 M E z) δ 12.40 (s, 1 H, OH ), 10.51 (s, l H,CHO),8.26(d, 1H, J = 9.2 HZ, ArH), 6.93 (d, 1H, J = 9.2 HZ, ArH), 5.95 (s, 1H, OH),3.38.3.37 (m, 4H), 3.26 (s, 3H, CH3),2.83 (t, 2H, J ------ 7.2 HZ, CH2),2.51(s, 3H, CH3),2.47 (t, 21 1. ./ 7.2 HZ, CH2)
MS [ US!. M i l j : 334.0
Figure imgf000405_0003
[1203]
7-Hydroxy-2-methyI-3-(3-morphoIino-3-oxopropyl)-4-oxo-4H-chromene-8- pde was obtained by the above procedure from amine A2. 3.6 % yield.
δ 12.35 (s, 1 H, OH), 10.46 (s, lH,CHO),8.20(d, i l l. ,/ 8. HZ, ArH), 6.89 (d, 1H, J= 9.2 HZ, ArH), 3.60-3.47 (m, 8H), 2.76 (t, 2H, J= 7.2
HZ,CH2),2.58 (t, 2W. J 7.2 HZ, CH2), 2.50 (s, 3H, CH3). MS [ESI, MH+]: 346.0
Figure imgf000406_0001
[1204J 7-Hydroxy-2-niethyi-3-(3-(4-methylpiperazin-l-yI)-3-oxopropyl)-4-oxo-4H- chromene-8~carbaidehyde was obtained by the above procedure from amine .43. 9.2 yield. 3"HNMR (MeOD,400MHz): δ 7.95 (d, I N. J 8.8 HZ, ArH),6.89 (d, 1 ί !. ./ 8.8
HZ, ArH), 6.06 (s, 1H,CH0),3.61 (br, 6H), 3.01 (s,3H ,CH3),2.8i (t, 2H, J= 7.6 HZ, (Ί ! , }. 2.56 (t, 2H, J zzz 3.2 HZ, ( ! ].- ). 2.51 (s, 3H, CH3). MS [ESI, M i l i. 359.2
Figure imgf000406_0002
[1205]
N-Ethyl-3-(8-formyl-7-hydroxy-2-methyI-4-oxo-4H-chromen-3-yi)propanamide was obtained by the above procedure from amine A4. 4.5 % yield. XHNMR
(CDC!;,,400MHz) δ 12.36 (s, U f . OH), 10.46 (s, lH,CHO),8.21 (d, 1H, J ------ 9.2 HZ, ArH),
6.88 (d, 1H, ./ 9.2 HZ, ArH), 5.67 (d,lH, J--- 10 HZ, OH),3.17 (t, 2H, J ------ 5.6 HZ ,CH2),
2.78 (t, 2H, J= 5.6 HZ, CH2),2.47-2.39 (m, 5H), i .03-0.99 (m, 3H, CH3). MS [ESI, ΜΠ ]. 304.0
Figure imgf000406_0003
[1206]
-(2-(Dimethylamino)ethyI)-3-(8-formyl-7-hydroxy-2-methyl-4-oxo-4H-chromen-3- was obtained by the above procedure from amine .45. 5.4 % yield. R (D2O,400MHz) δ 10.06 (s, 1H,CH0),7.78 (d, 1H, J= 8.8 HZ, ArH), 6.74 (d, 1H, J =8.8 HZ, ArH), 3.56 (t, 2H, J= 6.0 HZ ,CH2), 3.29 (t, 2H, J= 6.0 HZ ,CH2), 2.91 (s, 6H).2.64 (t, 7.2 HZ, CH2), 2.40 (t, 2H, J= 7.2 HZ, CH2),2.37 (s, 3H, CH3,).
MS [US!. Mil j: 347.0
Figure imgf000407_0001
[1207] 3-(8-Formyl-7-hydroxy-2-methyi-4-oxo-4H-chromen-3-yI)-N-(2- morpholinoethyl)propanamide was obtamed by the above procedure from amine .46. 9.2 % yield. 'lI .VI (D2O,400MHz) 69.78 (s, 1H,CHO),7.50 (d, 2W. 8.8 HZ, ArH), 6.78 (d, iii../ 9.2 HZ, ArH), 3.91 id. I!LJ 13.2 HZ ,CH2), 3.62 ft, 211.7 13.2 HZ ,CH2),3.38 (t, 2H, J = 14.4 HZ, CH2), 3.12 (t, 4H, J= 6.0 HZ, CH2),3.04-2.97 (m, 4H),2.41-2.13(m, 7H) MS [ESI, MH+]: 389.1.
EXAM PLE 72
Figure imgf000407_0002
[1208] Synthesis of Compound 2:
Figure imgf000407_0003
Ethyl succinyl chloride(18 g,0.11 mol) dissolved in 1.2-DCE (1000 ml) , the reaction mixture cooled to Q °C,AlCi3 (17,3 g, 0.13 mol) added dropwise with stirring at 0 °C, the above suspension added a solution of compound 1 ( 13,8 g ,0.1 mol) in 200 ml of 1,2- DCE from the dropping funnel over a period of 30min, the mixture solution stirred at RT for 30min ,TLC(PE:EA=1 : 1) showed the starting material was consumed completely. The above solution poured into 1000 ml ice-water ,the organic layers separated ,the aqueous layer was extracted with DCM (500*3) ,the combined organic layers were washed with sat NaCl(500 ml*2) , dried over Na2S04.the solvent was removed to get the crude compound 2( 16 g, 60 %) and use at the next step directly. MS [ESI, MH+]: 267.
1210] Synthesis of Compound 3:
Figure imgf000408_0001
112111 To a solution of compound 3(23 g, 0.086 mol) in dry DCM (1345 ml) was added BBr3 (173 g ,0.692 mol) in portions with stirring at -70 °C, the reaction solution stirred at RT for 3h, The reaction was quenched by addition of 1000 ml of ethanol, the solvent was removed ,the residue was chromatographed on silica gel (PE:EA=5:1) to give compound 4(12.2 g ,60 %)) as white solid.
[1212] Synthesis of Compound 4:
Figure imgf000408_0002
1213] To a suspension of compound 3 (7.5 g, 0.032 mol) in Ac?0(13 g,0.13 mol) was added DBU(3.8 g,0.025 mol) in one portion .The solution stirred at 120 °C for 16h,
TLC(PE:EA=1 : 1) showed the starting material was consumed completely. After cooled, the residue poured into 300 ml ice-water .the reaction mixture was extracted with DCM(! 50*3),The combined organic layers dried, concentrated and chromatographed on silica gel (PE:EA=5: 1) to give compound 4(9 g, 92 %) as white solid. MS [ESI, MET]: 305,2
[1214] Synthesis of Compound 5:
Figure imgf000409_0001
1215] The compound 4 (9 g , 0.030 mol) in 20% H2SO4(200 ml) were heated to 100 °C
overnight, after cooled, the solids was filtrated, washed with DCM three times to grve(5 g , 70 %) compound 5 and use at the next step directly. MS [ESI, MH+]: 234.8
121 ] Synthesis of Compound 6:
Figure imgf000409_0002
[1217] To the suspention of Compound 5 (1 eq) and HATU(1.05 eq) in DMF was added
Et3N(l .1 eq) dropwise at RT, after the mixture was stirred at this temperature for 1 h, amine (LI eq) was added, the reaction mixture was stirred at RT for another 10 h, after DMF was eliminated, diluted with MeOH, the formed solid was filtered and washed wit EA, dried to give Compound 6,
[1218] Synthesis of Compound 7:
Figure imgf000409_0003
[1219] A mixture of compound 6 (1 eq) and HMTA (4 eq) in HO Ac was heated at 120°C under nitrogen for ! .5h. The reaction mixture turned to dark-yellow in the period. LCMS indicated that the reaction was completed. After cooled to RT, the solvent was removed under reduced pressure; the product was purified by Prep-HPLC to give compound 7.
Figure imgf000410_0001
2-(8-Formyl-7-hydroxy-2-methyI-4-oxo-4H-chromeni-3-yi)-N-(2- methoxyethyl)acetamide was obtained by the above procedure from amine Ai. 9.12 % yield. 1H MR (CDC¾, 400M Hz): 6 12.38 (s, I H, OH), 10.47 (s, 1H,CH0),8.23 (d, I H, J= 9.2 Hz, ArH), 6.91(d, I H, J = 9.2 Hz ArH), 3.38-3.29 (m, 6H), 3.26 (s, 3H, CH3),2.54 (s, 3H, CH3) MS [ESI, MH ] : 320.0
Figure imgf000410_0002
[1221]
7~Hydroxy-2~meihyl~3-(2~morpholiiio~2~oxoeihyl)~4~oxo-4H~chromeiie~8- carbaldehyde was obtained by the above procedure from amine .42, 10 % yield. 1HNM f (CDC13, 400MHz): δ 12.42 (br, IH, OH), 10.54 (s, lH,CHO),8.28-8.25(m, IH, ArH), 6.97-6.94 (m, IH, ArH), 3.74-3.58 (m, 10H), 2.54 (s, M l. CH3). MS [ESI, MI ] ; 332.1
Figure imgf000410_0003
[12221
7- Hydroxy-2-methyI-3-(2-(4-methylpiperazin-l-yl)-2-oxoethyl)-4-oxo-4H-chrom
8- carbaldefayde was obtained by the above procedure from amine A3. 7.3 % yield. 1HNMR (MeOD,400MHz): δ 7.96 (d, IH, ./ = 8.8 Hz, ArH),6.92 (d, I H, J - 8.8 Hz, ArH), 6.08 (s, 1H,CHO),4.70-4.40 (m, 2H, CH2), 3.79-3.30 (m,8H), 2.96 (s, 3H, Ce3),2.47 (s, 3H, CH3). MS [ESI, V! i ! | : 345.1
Figure imgf000411_0001
N-Eihyl~2~(8-formyl-7~hydroxy~2-metliyl~4~oxo-4H-c romeii~3-yI)acetamide was obtained by the above procedure from amine A4. 9.05 % yield. 1HNMR
(CDC OOMHz): δ 12.40 (br, 1 H, OH), 10.48 (s, 1 H,CH0),8.22 (d, i i f . J 9.2 Hz,
ArH), 6.92(d, 1H, J = 9.2 HZ, ArH), 6.43-6.36 (br, 1H, NH), 3.35 (s, 2H, CH3),3.16-313 (q, 2H, J= 7.2 HZ, CH2), 2.56(s, 3H, CH3),1.03(t, 3H, J = 12 HZ C¾), MS [ESI, MH]: 290.0.
Figure imgf000411_0002
N~(2-(Dimethylamino)ethyl)-2-(8-formyl-7-hydroxy-2~methyl-4-oxo-4H-chromen-3' yl)acetamide hydrochloride was obtained by the above procedure from amine A5. 9,2 % yield. 1HNMR (D2O,400MHz): δ 10.02 (s, 1H, CHO), 7.72 (d, 1H, J= 8.8 Hz ArH), 6.66 (d, l i i. J 8.8 Hz, ArH), 3.47 (m, 2H,CH2), 3.26(m, 2H,CH2),3.18(m,
2H,CH2),2.79(s, 6H),2.28(s, 3H, CH3) MS [ESI, MH÷] : 333.1
Figure imgf000411_0003
2-(8-Formyl-7-hydroxy-2-methyI-4-oxo-4H-chromeni-3-yi)-N-(2- morpholinoethyl)acetamide was obtained by the above procedure from amine A6. 18.6 % yield iHNMR (D2O,400M Hz): δ 10.32 (s, 1 H, CHO), 8.00 (d, I i f . J 9.2 HZ ,ArH), 6.90 (d, 1H, J= 9.2 HZ, ArH), 4.10 (m, 2H,CH2), 3.72(m, 2H,CH2)3.55-3.09(m,8H),2.40 (s, 3H, ( ! ! : ). MS [ESI, MH+]:375. EXAMPLE 73
Figure imgf000412_0001
Figure imgf000412_0002
Figure imgf000412_0003
[1226] Synthesis of Compound 2:
Figure imgf000412_0004
1227] Ethyl succinyl chloride( 13.2 g,0.()8 mol) dissolved in 1.2~DCE(270 mi),the reaction
mixture cooled to 0 °C,A1C13 (10.7 g, 0.08 mol) was added dropwise with stirring at 0 °C, the above suspension added to a solution of compound 1 ( 9 g ,0.054 mol) in 1,2-DCE (30 mljfrom the dropping funnel over a period of 30min, the mixture solution stirred at RT for 30mm, TLC(PE:EA:::.l : 1) showed the starting material was consumed completely. The above solution poured into ice-water (200 ml), the organic layers separated, the aqueous layer was extracted with DCM (500*3) ,the combined organic layers were washed with sat NaCl (500 ml*2), dried over Na2S04 the solvent was removed to get the crude compound 2 and use at the next step directly, MS [ESI, MET]: 297.2.
1228] Synthesis of Compound 3:
Figure imgf000412_0005
[1229] The compound 2 (46 g, 0.145 mol), A!C!3 (43 g, 0.324 mol) in dry DCM (240 mi) was was heated to 60 °C for 15 min and additional AlCh (43 g ,0.324 mol) was added followed by an additional 15 min. The reaction mixture heating at 60 °C for 2 h, LC-MS detected the starting material was consumed completely. The above suspension poured into ice-water(1000 ml), the organic layers separated, the aqueous layer was extracted with DCM (500mLX3), The combined organic layers dried, concentrated and
chromatographed on silica gel (PE:EA=5: 1 ) to give compound 3(8 g, 21 %) as white solid. MS [ESI, MH4]: 269.2
[1230] Synthesis of Compound 4:
Figure imgf000413_0001
[1231] To a suspension of compound 3 (17 g, 0.063 mol) in Ac20 (25.5 g, 0.25 mol) was added DBU(8,5 g, 0.056 mol) in one portion. The solution stirred at 120 °C for 16h, TLC (PE:EA= 1 : 1) showed the starting material was consumed completely. After cooled to RT, the residue poured into 300 ml ice-water, the reaction mixture was extracted
withDCM(150*3), The combined organic layers dried, concentrated and
chromatographed on silica gel (PE:EA=5: 1) to give compound 4 (10 g, 47.5 %) as white solid. MS [ESI, ΜΙ-Ϊ ]: 334.8.
[1232] Synthesis of Compound 5:
4 5
The compound 4 (10 g , 0.030 mol) in 20 % H2SO4(200 ml) were heated to 100 °C overnight, after cooled, the solid was filtered, washed with DCM three times to give(5 g , 63 %) compound 5 and use at the next step directly. MS [ESI, MET]: 265.2, 1234] Synthesis of Compound 6:
Figure imgf000414_0001
[1235] To the suspention of Compound 5 (1 eq) and HATU (1 ,05 eq) in DMF was added
Et3N(Ll eq) dropwise at RT, after the mixture was stirred at this temperature for 1 h, amine (1 .1 eq) was added, the reaction mixture was stirred at RT for another 10 h, after DMF was eliminated, diluted with MeOH, the formed solid was filtered and washed wit EA, dried to give Compound 6,
[1236] Synthesis of Compound 7:
Figure imgf000414_0002
A mixture of compound 5 (1 eq) and HMTA (4 eq) in HO Ac was heated at 120 °C under nitrogen for 1.5 h. The reaction mixture turned to dark-yellow in the period. LCMS indicated that the reaction was completed. After cooled to RT, the solvent was removed under reduced pressure; the product was purified by Prep-HPLC to give compound 6.
Figure imgf000414_0003
1238] 2-(8-FormyI-7-hydroxy-5-methoxy-2-methyl-4-oxo-4H-chromen-3-yI)-N-(2- methoxyethyI)acetamide was obtained by the above procedure from amine Al. 1.55 % yield. 1HNM (CDQ3, 40Θ MHz): δ 12.80 (s, 1 R OH), 10.29 (s, 1H, CHO), 6.68(br, 1H, M i ). 6.29 (s, 1H, ArH), 4.00 (s, 3H, OCH3), 3.40-3.30 (m, 9H), 2.53 (s, 3H, ( ! ! .· ). MS [ESI, VI M ' j: 350.2.
Figure imgf000415_0001
7-Hydroxy-5~methoxy~2-methyl-3-(2-morpholino-2-oxoethyl)~4-oxo-4H-chromene-8- carbaldehyde was obtained by the above procedure from amine A2, 3.95 % yield, *HNM (CDC13, 400 MHz): δ 12.85 (br, IH, OH), 10.29 (s, IH, CHO), 6.29 (s, IH, ArH), 3.94 (s, 3H, OCH3), 3.75-3.63 (m, 8H), 3.53 (s, 2H, CH2) , 2.47 (s, 3H, CH3). MS [ESI, Ml ! j : 362.2.
Figure imgf000415_0002
N~Ethyl-2-(8-formyl-7-hydroxy-5~methoxy~2-methyl-4-oxo~4H~chromen-3- yl)acetamide was obtamed by the above procedure from amine A4. 9.2 % yield.
1HNMR (CDCI3, 400 MHz): δ 12.83 (br, IH, OH), 10.29 (s, IH, CHO), 6.88(br,
N ! 0.6.3 i (s, I H, ArH), 4.00 (s, 31 1. OCH,), 3.37 (s, 21 !. CH2),3.18 (q, 21 !. J 12
Hz,CH2), 2.55 (s, 3H, CH3), 1.07 (t, 3H, J=7.2 Hz,CH3), MS [ESI, MH ] : 320.2.
EXAMPLE 74
Figure imgf000416_0001
Figure imgf000416_0002
N H
A2 A4
Synthesis of Compound 2
Figure imgf000416_0003
[1242] A mixture of compound i (1 eq) and amine was heated to 90 °C for 16 h. After cooling to room temperature, the reaction mixture was concentrated to give compound 2
11243] Synthesis of Compound 3: eC MeO.
R^ Mel, NaOH, H- 0 NR, R2
N H DMF, RT, 3 h
O O
[1244} To a solution of compound 1(1.0 eq) in DMF / water (4 : 1) was added NaOH (2.0 eq) and Mel (1 ,2 eq) in turn. The reaction mixture was stirred at RT for 3 h, and then diluted with EtOAc (200 mL) and water (500 mL), extracted with EtOAc (200 mL X 2), washed with brine (200 niL), dried over Na2S04, concentrated to give the residue, and then purified by chromatography on silica gel to give compound 3
[1245] Synthesis of Compound 4:
Figure imgf000417_0001
1246] To a solution of compound 3 (1.0 eq) in DCM was added BBr3 (2.0 eq) in DCM
dropwise at -78 °C in 10 min and then warmed to RT and stirred for 1 h. The reaction mixture was quenched with MeOH at -78 °C, concentrated to give the residue, and diluted with water (100 mL), washed with DCM. The aqueous layer was neutralized by 10 % NaOH solution to p === 8-9, then extracted with EtOAc (200 ml, X 3), dried over Na?S04, concentrated to give compound 4.
1247] Synthesis of Compound 5:
Figure imgf000417_0002
[1248] A solution of Compound 4 (1.0 eq) and HMTA (4.0 eq) in AcOH was heated to 90 °C for 16 h. After cooling to room temperature, the reaction mixture was concentrated to give the residue, and then purified by Prep-HPLC to give compound 5
Figure imgf000417_0003
6~Hydroxy-l~methyl~2-(3~morpholiiio~3-oxopropy!)-iH-beiizo[d]imk?azole-7~ carbaldehyde was obtained by the above procedure from amine .42, 7.4 % yield. iH NMR (D20, 400 MHz): δ 10.70 (s, IH, CHO), 7.94 (d, J= 9.2 Hz, IH, ArH), 7.22 (d, J = 8.8 Hz, I H, ArH), 4.24 (s, 3H, NCH,), 3.78 (t, ./ 4.8 Hz, 21 1. CH2), 3.73 (t, ,/ 5.0 Hz, 2H, CH2), 3.63 (i, J= 4.8 Hz, 2H, CH2), 3.57 (t, J= 4.8 Hz, 2H, CH2), 3.50 (t, J = 6.8 Hz, 2H, CH2), 3.18 (t, 6.8 Hz, 2H, CH2). MS [ESI, W W V. 318.2
Figure imgf000418_0001
N-Ethyl-3-(4-formyl-5-hydroxy-l-methyl-lH-benzo[d]imidazoI-2-yi)propanamide was obtamed by the above procedure from amine A4. 2.0 % yield/H NMR (MeOD, 400 MHz): δ 10.63 (s, I H, CHO), 7.75(d, ./ = 9.2 Hz, IH, ArH), 6.91 (d, J ------ 9.2 Hz, IH,
ArH), 3.87 (s, 3H, NCH3) 3.25 (i, J= 7.2 Hz, 2H, CH2), 3.19-3.14 (m ,2H, CH2), 2.76 (t, J ------ 4.8 Hz, 2H, CH2), 1 .06 ίί, ./ 6.8 Hz, 3H, C¾). MS [ESI, MH ] : 276.2.
EXAMPLE 75
Figure imgf000419_0001
Figure imgf000419_0002
Figure imgf000419_0003
A3 AS A6
[1251] Synthesis of Compound 2:
!Vle l
Figure imgf000419_0004
2] To a mixtrue of compound 1 (33.6 g, 0.020 mol) and Pd /' C (6.72 g) in MeOH (400 mL) was hydrogenated under 50 psi of H2 at 50 °C for 3 h. The catalyst was filtered off and the filtrate was concentrated to give the residue then purified by column chromatography on silica gel to give compound 2 (20 g, 72.5 %) as reddish solid.
[1253] Synthesis of Compound 3:
Figure imgf000420_0001
[1254] A mixtrue of compound 2 (11 g, 79.7 mmol) and succinic anhydride (9.57 g, 95.7 mmol) in dioxane (250 mL) was heated to 80 °C for 16 h. The reaction mixture was concentrated to give the residue, and then diluted with EtOH (300 mL) and added cone. H2S04 (5 mL). The suspension was heated to 80 °C for 16 h. After cooling to RT, the reaction mixture was concentrated to give the residue, diluted with water(200 mL), neutralized by 1 M NaOH solution to pi I 7-8. extracted with (X V! (500 X 3), washed with water (100 mL), brine (100 mL), dried over Na?S04 concentrated to give the residue, and then purified by chromatography on silica gel to give compound 3 as yellow solid (13 g, 65.7 %). ¾ NMR (th02877-062-lD2O, 400 MHz): δ 7.43 (d, J = 8.4 Hz, 1H, ArH), 7.01 (d, J= 2.4 Hz, I I I. ArH), 6.87-6.84 (m, I I I, ArH), 4.20-4.15 (m, 2H, CH2), 3.83 (s, 3H, ArOCH3), 3.19-3.16 (m, 2H, CH2) 2.86-2.83 (m, 2H, CH2) 1.26 (t, J= 7.2 Hz, 4H, CH2).
[1255] Synthesis of Compound 4:
Figure imgf000420_0002
[1256] A. mixture of compound 3 (1 eq) and amine was heated to 90 °C for 16 h. After cooling to RT, the reaction mixture was concentrated to give compound 4 (1.9 g, 95.4 %).
1257] Synthesis of Compound 5:
Figure imgf000420_0003
[1258] To a solution of Compound 4 (1 eq) in DCM was added BBr3 (2.0 eq) dropwise at -78 °C over 10 min and then wanned to RT and stirred for 1 .The reaction mixture was quenched with MeOH at -78 UC, concentrated to give the residue, and diluted with water (100 ml . ) washed with DCM (50 ml_ X 3). The aqueous layer was neutralized by 10 % NaOH solution to pH= 8-9, then extracted with EtOAc (200 mL X 3), dried over Na2S04, concentrated to give compound 5.
1259] Synthesis of Compound 6:
Figure imgf000421_0001
A solution of compound 5 (1 eq) and HMTA (4.0 eq) in TFA was heated to 90 °C for 1 h. After cooling to RT, the reaction mixture was concentrated to give the residue, and then purified by prep-HPLC to give compound 6.
Figure imgf000421_0002
[1261] 3-(4~Formyl-5-hydroxy-lH-benzo[d]imidazol~2-yl)-N-(2-methoxyethyl)propanamide was obtained by the above procedure from amine Al. 15.4 % yield.1H NMR (D20, 400 MHz):6 10.33 (s, 1H, CHO), 7.82 (d, J= 9.2 Hz, 1H, ArH), 7.11 (d, J= 8.8 Hz, 1H, Aril), 3.50-3.44 (m, 41 !. 2CH2), 3.38 (cL ./ 5.2, Hz, CH2), 3.27 (s, 3H, OCH3), 2.92 (t, J = 7.0 Hz, 2H, CH2) MS [ESI, MH ; ] : 292.2
Figure imgf000421_0003
j2] 5 3ydroxy~2~(3-morphoImo~3~oxGpropy
was obtained by the above procedure from amine A2. 10.1 % yield.3 H NMR (DMSO, 400 MHz): δ 10.47 (s, 1H, CHO), 7.77 (d, J= 8.8 Hz, 1H, ArH), 7.05 (d, J= 8.8 Hz, 1H, ArH), 5.06 (br, Hi. NH), 3.54 (d, J ------ 4.4, 4H, 2CH2), 3.44 (t, J ------- 4.6 Hz, 4H, 2CH2), 3.24
(t, J= 7.2 Hz, 2H, CH2), 2.96 (t, J= 12 Hz, 4H, CH2) MS [ESI, MET1"]: 304.2.
Figure imgf000422_0001
[1263] 5-Hydroxy-2-(3-(4-methylpiperazin-l-yl)-3-oxopropyI)-lH-benzo[d]imidazoIe-4- carbaldehyde was obtained by the above procedure from amine A3.16 % yield. H NMR
(D20, 400 MHz): δ 10.40 (s, III CHO), 7.86 id../ 8.8 Hz, ill. ArH), 7.17 (d, J ------ 9.2
Hz, 1H, ArH), 4.57 (d, J= 7.0 Hz, 1H), 4.21 (d, J= 15.6 Hz, 1H), 3.63-3.58 (m 3H,
CH2), 3.47 (t, J= 6.6 Hz, 2H, CH2), 3.21 (m, 3H, CH2),3.11-3.09 (m, 2H, CH2), 2.95 (s, 3H, NCH3); MS [ESI, MH4]: 317.2.
Figure imgf000422_0002
[1264] N-Ethyl-3-(4-formyl-5-hydroxy-lH-benzo[d3imidazoI-2-yl)propanamide was
obtained by the above procedure ixom amine A4.7.2 % yield. ^INMR (M D20, 400 ΜΗζ):δ 10.38 (s, 1H, CHO), 7.85(d,J= 8.8 Hz, 1H, ArH), 7.16 (d,J= 9.2 Hz, 1H, ArH), 3.45 (t, J= 2.8 Hz, 2H, CH2), 3.15 (t, J = 7.2 Hz, 2H, CH2), 2.86 (t, J= 12 Hz, 2H, CH2), 1.03-1.01 (t,J= 7.2 Hz, 3H, CD;.): MS [ESI, MH']: 262.0.
Figure imgf000422_0003
3-(7-Formyl-6-hydroxy-lH-benzo[d]imidazoI-2-yl)-N-(2- morpholinoethy!)propanamide was obtained by the above procedure from, amine .45, 14.0 % yield.lHNMR (D20, 400 ΜΗζ):δ 10.36 (s, 1H, CHO), 7.84 (d, J= 9.2 Hz, 1H, ArH), 7.15 (d, J= 9.2 Hz, 1H, ArH), 4.10 (d, J= 13.6 Hz, 2H, CH2), 3.81 (d, J= 12.0 Hz, 2H, CH2), 3.64-3.57 (m, 4i !. CH2), 3.46 (t, ./ 7.2 Hz, 2H, CH2), 3.33 it, 6.2 Hz, 2H, CH2), 3.22 (d, J =5.2 Hz, 2H, CH2), 2.96 (t, J= 7.0 Hz, 2H, CH2); MS [ESI, MH ]:
347.3.
Figure imgf000423_0001
] N-(2-(Dimethylamino)ethyl)-3-(4-formyl-5-hydroxy-lH-benzo[d3imidazoI-2- yl)propanamide was obtained by the above procedure from amine .46. 5.5 % yield. Ή NMR (MeOD, 400 MHz): δ 7.54 (d, J= 8.8 Hz, 1H, ArH), 7.07 (d, J= 8.8 Hz, 1H, ArH), 5.89 (s, 1H, CONH), 3.58 ( L ./ 5.8 Hz, 2H, CH2), 3.44 (!. ./ 7.0 Hz, 2H, CH2), 3.29- 3.27 (m, 2H, CH2), 2.94 (t, J = 4.8 Hz, 2H, CH2), 2.92 (s, 6H, 2NCH3); MS [ESI, MH"]: 305.2.
EXAMPLE 76
Figure imgf000424_0001
Figure imgf000424_0002
1267] Synthesis of Compound 2:
Figure imgf000424_0003
1 2
1268] To a suspension of NaH (1.93 g, 48 mmol) in THF (100 mL) was added compound 1 (10 g, 40 mmol) in THF (100 mL) dropwise at 0 °C over 30 min. The reaction mixture was stirred at RT for 1 h, and Mel (6.81 g, 48 mmol) was added dropwise at 0 °C over 10 min. The mixture was stirred at RT for 16 h, then poured into ice water and extracted with EtOAc ( 1 L X 3),washed with brine (1 OOmL X 3),dried over Na2S04, concentrated to give (9.8 g, 86 %) compound 2 as yellow solid. MS [ESI, Μ Π 1:263.1 1269] Synthesis of Compound 3:
Figure imgf000425_0001
2 3
1270] To a solution of compound 2 (10 g, 38 mmol) in DCM (150 mL) was added BBr3 (19 g, 76 mmol) in DCM (50 mL) dropwise at -78 °C over 20 min. The reaction mixture was warmed to RT and stirred at RT for 2 h, then quenched with EtOH at -78 °C. The mixture was diluted with water (50 mL), then neutralized by adding sat.NaHCO-j to pH=7- 8 extracted with DCM (300ml, X 4), washed with brine (100 mL), dried over
Na?S04, concentrated to give the residue, and then purified by column chromatography on silica gel to give compound 3 (4.8 g, 51 %) as yellow solid. 271] Synthesis of Compound 4:
Figure imgf000425_0002
272] A mixture of compound 3 (2.47 g, 10 mmol) and HMTA (5.58 g, 40 mmol) in TFA (120 mL) was heated to 90 °C for 18 h. After cooling to RT, the reaction mixture was concentrated to give the residue, and then diluted with water (100 mL), extracted with
EtOAc (500 mL*2), washed with brine (100 mL*2), dried over Na2S04, concentrated to give the crude product, then purified by column chromatography on silica gei to give yellow solid and further purified by SFC to give compound 4 (0.5 g, 18 %) as yellow solid. [1273] Synthesis of Compound 5 :
Figure imgf000426_0001
74] A mixture of compound 4 (0.9 g, 3.26 mmoi) and 6 M HCl (30 mL) solution was heated to 100 °C for 2 h. The solvent was removed under vacuum to give compound 5 (0.8 g, 86.5 %) as reddish solid.
1275] Synthesis of Compound 6:
Figure imgf000426_0002
76] To a suspension of of compound 5 (1.0 eq) in DCM was added PyBop (1.2 eq) and DIEA (2.5 eq). The mixture was stirred at RT for 30 min, and then added amine (1.2 eq). The reaction mixture was stirred at RT for 1 h. The solvent was removed to give the residue, purified by Prep-HPLC to give compound 6
Figure imgf000426_0003
[1277] 3-(7-FormyI-6-hydroxy-l-methyi-l H-benzo[djimidazol-2-yl)-N-(2- methoxyetfayI)propaiiamMe was obtained by the above procedure from amine Al 25 % yield. ' i iVv! R (MeOD, 400 ΜΗζ):δ 10.68 (s, U L CHO), 7.73 id. J 8.8 Hz, I N. ArH), 6.81 (d, J = 8.4 Hz, I H, ArH), 4.02 (s, 3H, NCH3), 3.43-3.40 (m, 2H, CH2), 3.36-3.33 (m, 2H, CH2), 3.31-3.29 (m, 3H, OCH3), 3.19 (t, J ------ 7.4 Hz, 2H, CH2), 2.76 (i, ./ 7.6 Hz,
2H, CH2) MS [ESI, M i l |: 306.2
Figure imgf000427_0001
1278] 3-(7-Formyl-6-hydroxy-l-methyI-lH-benzo[d]imidazol-2-yl)-N-(2- morphoIinoethyl)propanamide was obtained by the above procedure from amine A3. 28.6 % yield'HNMR (D20, 400 MHz): δ 10.70 (s, 1H, CHO), 7.95 (d, J= 9.2 Hz, 1H, ArH), 7.23 (d, J= 8.8 Hz, 1H, ArH), 4.23 (s, 3H, NCH3), 4.12 (d, J = 6.4 Hz, 2H, CM.. ). 3.81 ft, J ==12.6 Hz, 2H, CH2), 3.64 (m, 4H, 2CH2), 3.58-3.51 (m, 2H, CH2), 3.34 (t, ./ 6.2 Hz, 2H, CH2), 3.26-3.20 (m, 2H, CH2), 2.97 (t, ./ 7.4 Hz, 21 1 ) MS [ESI, MH+]: 361 .1.
Figure imgf000427_0002
1279] 6-Hydroxy-l-methyI-2-(3-(4-methylpiperazin-l-yl)-3-oxopropyl)-lH- benzo[d]imidazole-7-carbaldehyde was obtained by the above procedure from amine A5. 14.1 % yield.1 HNMR (M D20, 400 MHz): δ 10.69 (s, 1H, CHO), 7.93 (d, J= 9.2 Hz, 1 1 1. ArH), 7.20 (d, ./ = 9.2 Hz, H i, ArH), 4.53 (!. ./ 5.4 Hz, 1 H), 4.22 (s, 4H), 3.69 (d, J =8.0 Hz, 3H, CH2), 3.51 (t, J= 6.2 Hz, 2H, Q¾), 3.21 (t, J= 7.0 Hz, 3H, CH2), 3.10 (t, J = 5.2 Hz, 2H, CH2), 2.95 (s, 3H, NCH3); MS [ESI, MH+]: 331 .3.
Figure imgf000427_0003
[1280] 3-(7~Formyl-6-hydroxy-l~methyl-lH-benzo[d]imidazol-2-yl)propanoic acid:
IX MR ([.) .(). 400 MHz): δ 10.60 (s, 1H, CHO), 7.86 (d, ,/ 9.2 Hz, 1H, ArH), 7.11 fd, J= 9.2 Hz, 1H, ArH), 4.17 (s, 3H, NCH3), 3.48 (t, J= 7.0 Hz, 2H, ί '! !,). 3.03 (t, J= 7.0 Hz, 2H, CH2); MS [ESI, Mi l j. 249.1 . EXAMPLE 77
Figure imgf000428_0001
Figure imgf000428_0002
Figure imgf000428_0003
[1281] Synthesis of Compound 2:
MeO. N°2 Mel, NaH MeO- . NOo
!"HF, RT. 16 h
H2 N"
H
To a suspension of NaH (14.9 g, 0.373 mol) in DMF (1 L) was added compound 1 (50 g, 0.298 mol) in DMF (200 mL) dropwise at °C over 1 h. The reaction mixture was stirred at RT for 1 h, and then Mel (46.5 g, 0.328 mol) was added. The reaction mixture was stirred at RT for 16 , and then poured into ice water. The mixture was concentrated to give the residue, diluted with DCM (3 L), washed with water (200 mL,x2), brine (200 mLx2), dried over Na -SO s. concentrated to give compound 2 (50 g, 92.6 %) as reddish solid. 1283] Synthesis of Compound 3:
Figure imgf000429_0001
4] To a mixtrue of compound 2 (40 g, 0.22 mol) and Pd / C (9.0 g) in MeOH (1.0 L) was hydrogenated under 40 psi H2 at 30 °C for 16 h. The catalyst was filtered off and the filtrate was concentrated to give the residue then purified by column chromatography on silica gel to give compound 3 (30 g, 91 %) as brown solid.
5] Synthesis of Compound 4:
Figure imgf000429_0002
3 4
6] A mixtrue of compound 3 (30 g, 0.197 mo! ) and succinic anhydride (23.7 g, 0.237 mol) in dioxane (500 mL) was heated to 80 °C for 16 h. The reaction mixture was concentrated to give the residue. The residue was diluted with EtOH (500 mL) and added cone. H2S04 (10 mL). The suspension was heated to 90 °C for 16 h. After cooling to RT, the reaction mixture was concentrated to give the residue, diluted wit water (400 mL), neutralized by adding 1 M NaOH solution to pH:;=7-8, extracted with DC (500 mL X 3), washed with water (100 mL), brine (100 mL), dried over Na2S04 concentrated to give the residue, and then purified by chromatography on silica gel to give compound 4 as yellow solid (23 g, 44 %). MS [ESI, MET]: 263.2.
7J Synthesis of Compound 5 :
Figure imgf000429_0003
To a solution of compound 4 (22 g, 0.084 mol) in DCM (250 mL) was added BBr3 (42 g, 0.168 rnol) dropwise at -78 °C over 20 rain and then warmed to RT and stirred for 1 h .The reaction mixture was quenched with MeOH at -78 °C, concentrated to give the residue, neutralized by 10 % NaOH solution to pH= 8-9, then extracted with EtOAc (200 mL X 3), dried over Na2S04, concentrated to give compound 5 (5.0 g, 24 %) as yel low solid. ' l IN R (MeOD, 400 MHz): 6 1 7.21 (d, ./ = 8.4 Hz, 1H, ArH), 6.94 (d, J ------ 2.0 Hz,
I B, ArH ), 6.78-6.75{m, 1 1 1. ArH), 3.72 (s, 3H, NCH3), 3.09 (t, ./ 7.2 Hz, 2H, \ \ ). 2.88 it. ./ 7.2 Hz, 2H, CH2), 1.18 (t, J = 7.0 Hz, 3H, CH3).
Synthesis of Compound 6:
Figure imgf000430_0001
A solution of compound 5 (5.0 g, 0.020 mol) and HMTA (i 1.3 g, 0.080 mol) in TFA (1 50 mL) was heated to 90 °C for 16 h. After cooling to RT the reaction mixture was concentrated to give the residue, diluted with water (100 mL), and then extracted with
EtOAc (500 mL), washed with water (50 mL><3), brine (100 mL), dried over Na2S04 to give the crude product and then purified by column chromatography on silica gel to give compound 6 (1.3 g, 23.6 %) as yel low solid.
[1291] Synthesis of Compound 7:
CHO CHO
6 M HC HO tsi HC!
OEt
90 °C, 1 h
" N
O O
[1292] A mixture of compound 6 (1.3 g, 4,71 mmoi) in 6 M HC1 solution (40 mL) was heated to 90 °C for 1 h. The reaction mixture was concentrated to give the product (1 .05 g, 68 %) as red solid. [1293] Synthesis of Compound 8:
Figure imgf000431_0001
8
7
1294] A suspension of compound 7 (1.0 eq), PyBop (1.2 eq) and DiEA (2.5 eq) in DCM (3 mL) was stirred at RT for 30 min, then added amine (1.0 eq). The mixture was stirred at RT for 16 h, diluted with DCM (200 ml.), washed with water (20 ml X 3), dried over Na?S04, concentrated to give the residue, then purified by prep.TLC to give compound 8
Figure imgf000431_0002
[1295] 3-(4~Formyl-5-hydroxy-l~methyl-lH-benzo[d]imidazol-2-yl)~N-(2- methoxyetbyI)propanamide was obtained by the above procedure from amine Al. 18.5 % yield. 1H NMR (CDC13, 400 MHz): δ 11.45 (s, 1H, OH), 10.74 (s, 1H, CHO), 7.43 (d, J = 8.8 Hz, I B, ArH), 6.84 (d, 8.4 Hz, 1 1 1. A; i n. 6.65 (br, 1 1 1. H), 3.76 (s, 3H, NCH3), 3.41 (t, J = 3.8 Hz, 2H, CH2), 3.29 (s, 3H, OCH3), 3.19 (t, J = 6.8 Hz, 2H, CH2), 2.88 i t. ./' 6.6 Hz, 2H, CI¾); MS [ESI, Mi l j : 306.2.
Figure imgf000431_0003
5-Hydroxy-l-methyI-2-(3-morphoiino-3-oxopropyl)-l H-benzo[d]imidazole-4- carbaldehyde was obtained by the above procedure from amine A2. 24.7 % yield.1H NMR (DMSO, 400 MHz): ό ) 1 .69 (s, 1H, OH), 10.46 (s, 1H, CHO), 8.09 (d, J= 8.8 ! 1H, ArH), 7.28 (d, J= 8.8 Hz, 1H, ArH), 3.98 (s, 3H, NCH3), 3.56 (t, J= 4.6 Hz, 2H, CH- , 3.51 (t, J= 5.0 Hz, 2H, CH2), 3.39 (s, 4H, 2CH2), 3.31 (t, 2H,J= 5.2 Hz, CH2), 2.98 (t, 2H, J = 5.2 Hz, CH2); MS [ESI, MH+] : 318.2.
Figure imgf000432_0001
1297] 3-(4-FormyI-5-hydroxy-l-methyi-l H-benzo[djimidazol-2-yl)-N-(2- morpholinoethyl)propanamide was obtained by the above procedure from amine AS. 12.6 % yield.1H NMR (CDCls 400 ΜΗζ):δ 1 1.42 (s, 1 H, OH), 10.73 (s, I H, CHO), 7.42 (d, J= 8.8 Hz, 1H, ArH), 6.84 (d, J= 8.8 Hz, IH, ArH), 6.54-6.51 (br, IH, NH), 3.77 (s, 3H, NC¾), 3.68 (!. ./ 3.8 Hz, 4H, 2CH2), 3.36 {d, J ------ 5.6 Hz, 2R CH2), 3.20 (t, J ------ 7.0
Hz, 2H, CH2), 2.89 (d, J= 7.2 Hz, 2H, CH2), 2.45 (s, 6H); MS [ESI, MH÷]:361.3
Figure imgf000432_0002
[1298] 5-Hydroxy-l -methyi-2-(3-(4-methylpiperazin-l-yl)-3-oxopropyl)-lH- benzo[d]imidazoIe-4-carbaldehyde was obtained by the above procedure from amine A3. 6.9 % yield.1!-! NMR (CDCI3, 400 ΜΗζ):δ \ 1.45 (s, IH, OH), 10.73 (s, IH, CHO), 7.43 (d, 8.8 Hz, I H, ArH ), 6.83 id. ./' 9.2 Hz, I H, ArH), 3.80 (s, 311 NCH3), 3.63- 3.58 (m, 4H, 2CH2), 3.21 (t, J= 6.8 Hz, 2H, CH2), 3.03 (d, J= 7.0 Hz, 2H, CH2), 2.44- 2.38 in-!. 4H, 2CH2), 2.31 (s, M l. NCH3); MS [ESI, MH ] :331 .3.
Figure imgf000432_0003
] 1299] Ethyl 3-(4-formyI-5-hydroxy-l-methyi-l H-bes¾zo[d]imldazol-2-yI)propas¾ ate: lH
NMR (CDCI3, 400 MHz): 8 i 1.45 (s, I H.. OH), 10.72 i d . J 0.4 Hz IH, CHO), 7.43 (d, J - 8.8 Hz, I H, ArH), 6.83 id. ./ 8.8 Hz, IH, ArH), 4.1 8-4.13 (m, 2H, CI¾), 3.77 (s, 3H, NCH3), 3.16 (t,J= 4.8 Hz, 2H, CH2), 2.99 (t,J= 4.8 Hz, 2H, CH2), 1.24 (t,J= 7.2 Hz, 3H, CH3); MS [ESI, Mil ]. = 277.2
Figure imgf000433_0001
1300] 3-(4-Formyl-5-hydroxy-l-methyI-1 H~ber8zo[d]imids2ol-2-yl)propai8ok acid: H
NMR ([.) .().400 MHz): o 10.35 (s, IH, CHO), 7.91 (d, ./ 8.8 Hz, IH, ArH), 7.19 (d../ 9.2 Hz, IH, ArH), 4.03 (s, 3H, NCH3), 3.49 (t, J= 7.2 Hz, 2H, CH2), 3.02 (t, J= 7.0 Hz, 2H, CH2); MS [ESI, Ml! |.249.2. iXA PLE 78
Figure imgf000433_0002
Figure imgf000433_0003
Figure imgf000433_0004
Figure imgf000433_0005
1301] Synthesis of Compound 2:
Figure imgf000434_0001
1302] Compound 1 (60.0 g, 355.0 mmol) and Pd / C (8 g) were added to EA / MeOH (320 mL / 480 mL). The reaction mixture was stirred at RT under H2 (30 Psi) for 4 h and filtered through Celite pad. The filter was concentrated, afforded the crude product. The crude product was washed with MTBE (100 mL), dried, afforded compound 2 (45.0 g, 91.1%) as brown solid.
1303] Synthesis of Compound 3:
Figure imgf000434_0002
2 3
[1304] Compound 2 (32.5 g, 233.8 mmol) and Et3N (23.6 g, 233.8 mmol) were added to
DCM (650 mL). The solution of acyichloride (38.5 g, 234.7 mmol) in DCM (200 mL) was added dropwise. Then the mixture was warmed slowly to RT and stirred for 3 h. The reaction mixture was diluted with DCM (500 mL), washed with IN HCI (100 mL) and brine ((200 mL x 2). The DCM layer was dried over Na2S04, filtered, concentrated, afforded crude compound 3 (52.0 g, ~ 40% purity) as brown oil.
[1305] Synthesis of Compound 4:
Figure imgf000434_0003
3 [1306] Compound 3 (40.0 g, 149.8 mmol) and PPTS (12.5 g, 49.8 mmol) were added to xylene (600 mL). The mixture was heated to 140 °C for 16 h. After cooled to RT, the reaction mixture was concentrated, purified by silica gel column (PE: EA = 5: 1), afforded compound 4 (10.0 g, 66.9%) as light red solid.
[1307] Synthesis of Compound 5:
Figure imgf000435_0001
[1308] Compound 4 (12.6 g, 50.60 mmol) was dissolved in dry DCM (225 mL), cooled to - 60 °C. The solution of ΒΓ¾ (75.6 g, 302.4 mmol) in DCM (225 mL) was added dropwise. Then the reaction mixture was warmed slowly to RT and stirred for another 2 h. The reaction was quenched with EtOH (17 mL) at - 60 'JC. The reaction mixture was concentrated. The residue was diluted with H20 (200 mL), extracted with EA (100 mL x 3). The combined EA was washed with sat.NaHCCh (100 mL x 2), dried over Na2S04, filtered, concentrated, purified by silica gel column (PE: EA = 3: 1 ), afforded compound 5 (9.2 g, 77.3%) as light yellow solid.
[1309] Synthesis of Compound 6:
Figure imgf000435_0002
1310] Compound 5 (4.0 g, 17.02 mmol) and HMTA (9.53 g, 68.07 mmol) were added to TFA (225 mL). The reaction mixture was heated to 90- 95 °C for 2 h. The reaction mixture was concentrated. The residue was diluted with H?0 (100 mL), extracted with EA (80 mL x 2). The combined EA was washed with sat. NaHC03, dried over Na2S04, filtered, concentrated, purified by silica gel column (PE: EA = 10: 1), afforded compound 6 (2.0 g, 44.6%) as white solid. ¾HNMR (CDC13, 400 MHz): δ 11.26 (s, 1H, OH), 10.57 (s, 1H, CHO), 7.61 (d, J = 9.2 Ηζ,ΙΗ, ArH), 6.89 (d, J= 9.2 Hz, 1H, ArH), 4.17 (q, J 2H, CH2), 3.27 (t, J= 1.2 Hz, 2H, CH2), 2.94 it. J 7.2 Hz, 2H, CH2), 1.26 (t,
3H, C¾). MS [ESI, MH"]: 264.2
1311 ] Synthesis of Compound 7 :
Figure imgf000436_0001
1312] Compound 6 (2,0 g, 7.6 mmol) was added to THF / H20 (25 mL /12 mL), LiOH.H2Q (1.16 g, 27.6 mmol) was added. The reaction mixture was stirred at RT for 30 min and quenched with IN FICl (30 mL). Then the mixture was extracted with EA (15 mL x 2). The combined EA was washed with brine, dried over Na2S04, filtered, concentrated, afforded compound 7 (1.6 g, 89.4%) as white solid. 1H MR (DMSO, 400 MHz): δ 12.39 (br, 1 H, C X}()i ! ). 10.92 (br, 1H, OH), 10.48 (s,! R -CHO), 7.90 i t!. ./ 8.8 Hz, i i !. ArH), 6.94 (d, J= 8.8 Hz, 1H, ArH), 3.17 (t, J= 7.2 Hz, 2H, CH2), 2.83 (t, J= 7.2 Hz, 2H, ('] ! · }. MS [ESI, MH |: 236.1
1313] Synthesis of Compound 8:
Figure imgf000436_0002
[1314] Compound 7 (1 eq) and GDI (1.1 eq) were added to dry DCM.The reaction mixture was stirred at RT for 0.5 h.The solution of amine (leq) in DCM was added dropwise at RT. Then the reaction mixture was stirred at RT for 16 h. LC-MS indicated that the reaction was completed. The mixture was diluted with DCM, washed with H20, dried over Na?S04, concentrated. The crude product was purified by by silica gel column, afforded compound 8.
Figure imgf000437_0001
[1315] 3-(4-Formyl-5~hydroxybenzo[d]oxazol-2-yl)- -(2-methoxyethyl)propanamide was obtained by the above procedure from amine Al.26.8% yield.1HNM (CDCl3, 400 MHz) :δ 11.25 (s, 1H, OH), 10.57 (s, 1H, CHO), 7.60 (d, J= 9.2 Hz, 1H, ArH), 6.88 (d, J= 9.2 Hz, 1H, ArH), 6.14 (br, 1H, NH), 3.45-3.43 (m, 4H, 2CH2), 3.33 (s, 3H, OCH3),3.30 (t,J = 7.2 Hz, 2H, CH2), 2.81 (t, J= 7.2 Hz, 2H, CH2). MS [ESI, Mil j: 293.2.
Figure imgf000437_0002
[1316] 5~Hydroxy-2~(3~morphoH8io-3-oxopropyl)ber8zo[d]oxazole~4~carbaIdehyde was
obtained by the above procedure from amine A2.42.6% yield.5HNMR (CDC13, 400 MHz) :δ 11.26 (s, 1H, OH), 10.57 (s, 1H, CHO), 7.61 (d.J 9.2 Hz, III. ArH), 3.73-3.63 (m, 4H, 2CI¾), 3.57-3.54 (m, 2H, CH2),3.34-3.30 (m, 2H, CH2), 3.32 (t, J == 7.2 Hz, 2H, C¾), 2.96 (L J 7.2 Hz, 2H, CH2). MS [ESI, MH+]i 305.2.
Figure imgf000437_0003
[1317] 5-Hydroxy-2~(3-(4-methylpiperazin~l-yl)-3-oxopropyl)benzo[d]oxazole-4~
carbaldehyde was obtained by the above procedure from amine A3, 20% yield.1HNMR (CDCI3, 400 MHz) :610.56 (s, 1H, CHO), 7.59 (d, J= 8.8 Hz, 1H, ArH), 6.86 (d, J= 8.8 Hz, l!L ArH), 3.66-3.63 (m, 2H, CH2), 3.57-3.55 (m, 211 CH2), 3.30 i\. J 7.2 Hz, 2H, CH2), 2.95 (t, J= 7.2 Hz, 2H, O f; ). 2.45-2.44 (m, 2H, CH2), 2.43-2.39 (m, 2H, CH2), 231 (s, 3H, CH3). MS [ESI, VI I i ] . 318.2.
Figure imgf000438_0001
1318] N-Ethyl-3-(4-formyl-5-hydroxybenzo[d.|oxazoi-2-yl)propanamide was obtained by the above procedure from amine A4. 38.9% yield. 3HNMR (CDC13, 400 MHz) :δ 10.56 (s, 1H, CHO), 7.77 (d, ./ 8.8 Hz, i l l. ArH), 6.93 (d, J = 8.8 Hz, 1H, ArH), 3.32 (!. ./ 7.2 Hz, 2H, Of I ·■}. 3.21 (q, J= 7.2 Hz, 2H, CH2), 2.81 (t, J= 7.2 Hz, 2H, CH2), 1.1 1 (t, J = 7.2 Hz, 3H, CH3). MS [ESI, MH+]: 263.2.
Figure imgf000438_0002
[1319] 3-(4-Formyl-5-hydroxybenzo[d]oxazoi-2-yl)- -(2-morpholinoethyl)propanamide was obtained by the above procedure from amine AS. 10.2% yield. lHNMR (CDC13, 400 MHz) :δ 11.24 (s, IH, OH), 10.57 (s, I H, CHO), 7.61 id. J 8.8 Hz, I H, ArH), 6.89 (d, J = 8.8 Hz, IH, ArH), 6.15 (br, IH, NH), 3.70-3.67 (m, 4H, 2CH2), 3.40-3.35 (m, 2H, CI !..}, 3.31 (t, ./ = 7.2 Hz, 2H, CH2), 2.83 ( L ./ 7.2 Hz, 21 1 CH2), 2.48-2.43 (m, 6H, 3CH2). MS [ESI, MH+]: 348.2.
EXAMPLE 79
Figure imgf000439_0001
Figure imgf000439_0002
Figure imgf000439_0003
[1320] Synthesis of Compound 2:
Figure imgf000439_0004
[1321 J Compound 1 (25 g, 294.1 mmol) and DMF (0.5 ml.) were suspended in DCM (250 mL).
(COCl)2 (41 g, 323.5 mmo!) was added dropwi.se at 0 °C. After that the reaction mixture was stirred at RT for 4 h. The reaction mixture was concentrate. The residue was dissolved in dry DCM (250 mL). The solution of acyl chloride was added dropwise to the solution morpholine (28.1 g, 323.5 mmol) and Et3N (32.7 g, 323.5 mmol) in DCM (100 mL) at 0 °C. Then the mixture was stirred at RT for 16 h and concentrated . The residue was purified by silica gel column (DCM: MeOH = 20: 1), afforded compound 2 (18.7 g , 41%) as white solid.
[1322] Synthesis of Compound 3:
Figure imgf000439_0005
[1323] Compound 2 (18.5 g, 120.1 mmol) and EtOH (8.3 mmol) were added to CHC13 (120 ml.,), cooled to -20 IJC. HCi (gas) was bubble into the mixture for 1 h. Then the reaction mixture was stirred at RT for another 1.5 h. The solvent was removed under vacuum. The residue was washed with MTBE, afforded compound 3 (14.5 g, 51%) as white solid.
[1324] Synthesis of Compound 5:
Figure imgf000440_0001
1325] Compound 3 (12.2 g, 51.5 mmol) was dissolved in MeOH (105 rnL), cooled to 0 ' C. The solution of compound 4 (6 g, 43.1 mmol) in MeOB (60 rnL) was added dropwise. The reaction mixture was stirred at RT for 16 h. The reaction mixture was concentrated, purified by silica gel column (PE: EA = 2: 1), afforded compound 5 (8.7 g , 73.1%) as white solid.
1326] Synthesis of Compound 6:
Figure imgf000440_0002
[1327] t- BuO (4.2 g, 38.7 mmol) was suspended in THF (100 ml,), cooled to 0 ' C. The
solution of compound 5 (8.7 g, 32.2 mmol) in THF (75 mL) was added dropwise and stirred for I h. The solution of Mel (4.7 g, 33.8 mmol) in THF (25 mL) was added dropwise at 0 °C, then stirred at RT for another 4 h. The reaction mixture was quenched with H20, acidified by 2 N HCI to p H = 4, extracted with EA, concentrated. The residue was purified by silica gel column (PE: EA = 2: 1), afforded compound 6 (7.3 g , 80.2%) as white solid. Synthesis of Compound 7:
Figure imgf000441_0001
Compound 6 (5,8 g, 20 mmol) was dissolved in DCM (120 mL), cooled to -60 C. The solution of BB13 (30 g, 120 mmol) in DCM (40 mL) was added at -60 °C. After that, the reaction mixture was stirred at RT for 1 h. Then the reaction was quenched with H20, extracted with EA. The combined EA was dried over Na?80 , filtered, concentrated. The residue was purified by silica gel column (PE: EA = 1 : 2), afforded compound 7 (3.3 g , 47.8%) as white solid. lH MR (CDCI3, 400 MHz): δ 7.28 (dd, J= 8.8 Hz, 2.4 Hz, i ! i. ArH), 7.16 (d, J= 2.4 Hz , 1H, ArH), 6.82 (dd, J= 8.8 Hz, 2.4 Hz, 1H, ArH), 4.30 (q, J = 6.8 Hz, 1H, { H i. 3.75-3.55 (m, 8H, 4CI¾), 1.70 Id. J 6.8 Hz ,3H,CH3).
Synthesis of 5-hydroxy-2-( 1 ~morph.olin.o- 1 -oxopropan-2-yl)benzo[d]oxazole-4- carbaidehyde:
Figure imgf000441_0002
Compound 7 (1 g, 3.62 mmol) and HMTA (2.1 g, 14.5 mmol) were added to TFA (45 mL), The reaction mixture was heated to 95 °C for 1 h. The reaction mixture was concentrated. The residue was purified by prep-HPLC and prep-TLC successively, afforded 5-hydroxy-2-(l-morpholino-l -oxopropan-2-yl) benzo[d] oxazole-4- carbaidehyde (200 mg, 12.1 %) as yellow solid. MS [ESI, VI M j : 305.2. EXAMPLE 80
Figure imgf000442_0001
Synthesis of Compound 2
Figure imgf000442_0002
reflux, 16 h OH
1 2
[1333] Compound 1 (100 g, 657 mmol) and NH2OH.HCl (137 g, 1973 mmol) were added to EtOH (1.5 L). The reaction mixture was refiuxed for 16 h. The reaction mixture was concentrated. The residue was recrystailized from DCM / PE (4: 1), afforded compound 2 (95 g, 86.4% yield). ' UNMR (MeQD, 400 MHz): δ 6.88 (q, J= 1 .2 Hz, 1 H, ArH), 6.688- 6.682 (m, 2H), 2.25 (s, 3H).
[1334] Synthesis of Compound 3:
Figure imgf000442_0003
2 3
[1335] Compound 2 (20.0 g, 119.7 mmol) was dissolved in DMF (300 mL), cooled to 0 °C.
POCI3 (20 g, 131 .6 mmol) was added dropwise keeping the inner temperature below 10 °C .Then the reaction mixuture was stirred for another 1 h. H?0 (1 L) was added to the reaction mixture, extracted with EA (300 mL x 3). The combined EA was concentrated. The residue was dissolved in MTBE (800 mL), washed with H20 (200 mL x 3). The organic layer was dried over Na2S04, concentrated. The residue was washed with DCM / PE (4:1) (250 nil.}, afforded compound 3 (13.5 g, 75.6%). 'UNMR (MeOD, 400 MHz): δ 7.32 (d, J= 8.8 Hz, 1H, ArH), 6.95 (s, 1H, ArH), 6.79 (d, J= 8.8 Hz, 1H, ArH), 2.56 (s, 3H).
Figure imgf000443_0001
5-hydroxy-2-metfaylbenzo[d]oxazole-4-carbaldehyde2: Compounds (1.5 g, 10.06 mmol) and HMTA (5.6 g, 40.0 mmol) were added to TFA (100 mL), The mixture was heated to 90 °C for 1 h. After cooled to RT, the reaction mixture was concentrated, purified by prep-HPLC and prep-TLC successively, afforded 5-hydroxy-2- methylhenzo[d]oxazole-4-carbaldehyde (20.0 mg, 1.1%) as yellow solid.1H MR (CDC13, 400 MHz): δ 11.27 (s, 1H, OH), 10.58 (s, 1H, CHO), 7.60 (d,J= 8.8 Hz, 1H, ArH), 6.88 (cL ./ 8.8 Hz, 1H, ArH), 2.67 (s, 3H, CH3). MS [ESI, Mil j.178.0.
EXAMPLE 81 ΗΟ... ,.Q
Figure imgf000443_0002
1337] Synthesis of Compound 5:
Figure imgf000443_0003
1338] Compound 4 (33 g, 217 mmol) and 10! 1.1 ICi (45.2 g, 650.3 mmol) were added to EtOH (500 mL). The reaction mixture was refiuxed for 16 h. The reaction mixture was concentrated, purified by silica gel column (PE: EA = 4: 1), afforded compound 5 (5.2 g, 14.3%).
[1339] Synthesis of Compound 6:
Figure imgf000444_0001
5 6
[1340] Compound 5 (5.2 g, 31 .1 mmol) was dissolved in DMA / MeCN (6 ml. / 18 mL), cooled to 0 dC. FOCI? (5.2 g, 34.2 mmol) was added dropwise to keep the inner temperature below 10 °C, then stirred at RT for 1 h. The reaction was monitored by TLC. The reaction mixture was poured into crush-ice (200 mL) containing NaOAc (7.5 g, 91.4 mmol), stirred for 5 min, then stand for 30 min. The precipitate was collected by filtration, dried, afforded compound 6 (2.9 g, 63%).
Figure imgf000444_0002
6
[1341] 6-Hydroxy~2~methylbeiizo[d]oxazo!e~7~carba!dehyde: Compound 6 (0.5 g, 3.3 mmol) and HMTA (1 ,88 g, 13.4 mmol) were added to TFA (40 mL). The mixture was heated to 70 °C for 16 h. After cooled to RT, the reaction mixture was concentrated, purified by prep-TLC, afforded 6-Hydroxy-2-methylbenzo[d]oxazole-7-carbafdehyde (40.0 mg, 6.7%) as yellow solid. lHNMR (CDC13, 400 MHz): δ 11.14 (s, 1H, OH), 10.41 (s, 1H, CHO), 7.77 (d, J ------- 8.8 Hz, 1 1 1. ArH), 6.91 (d, ./ = 8.8 Hz, 1H, ArH), 2.66 (s, 3H, CH3).
MS [ESI, MH+] : 178.0. EXAMPLE 82
Figure imgf000445_0001
reflux, 5 h
Figure imgf000445_0002
Synthesis of Compound 2
Figure imgf000445_0003
reflux,
A mixture of compound 1 (3.0 g, 23.0 mmol) and triethyl orthoformate (50 mL) was refluxed for 5 h. After cooled to RT, triethyl orthoformate was removed under high vacuum. The residue was purified by silica gel column to give compound 2 (1 .3 g, 38% yield) as white solid.
Synthesis of Compound 3
MeO.
1 BBr¾. DCM HCX
> >
-60 °C to 0 °C, 2 h
The solution of compound 2 (1.2 g, 8.0 mmol) in DCM (50 mL) was cooled to -60 C. The solution of BBr3 (10.0 g, 40.0 mmol) in DCM (30 mL) was added dropwise keep temperature below -50 °C. After stirred for another 2 h at RT, the reaction mixture was quenched with MeOH at -60 tJC. The reaction mixture was diluted with DCM (200 mL) and the solution was washed with sat.NaHCO-3, brine, dried over Na2S04, concentrated to give compound 3 (0.6 g, 60% yield) as white solid. MS [ESI, MH ]: 136.2.
Figure imgf000446_0001
5-Hydr xybeiizo[d]oxazoIe-4-carbaMehyde: A mixture of compound 3 (350 mg, 1.05 mmol) and HMTA (560 mg, 4 mmol) in AcOH (35 mL) was heated to 90 °C under N2 for 1.5 h. The reaction was monitored by LCMS. After cooled to RT, the solvent was removed under vacuum. The residue was purified by prep-HPLC to give 5- hydroxybenzo[d]oxazole-4-carbaidehyde (152 mg, 25% yield). 1HNMR (DM80, 400 MHz): δ 10.99 (s, 1H, OH), 10.53 (s, 1H, CHO), 8.86 (s, 1H, ArH), 8.00 (d, 1H, J= 9.2 Hz, ArH), 7.05 (d, 1H, J= 8.8 Hz, ArH). MS [ESI, MH+] : 164, 1.
EXAMPLE 83
refiu ed. 26 h
Figure imgf000446_0002
Figure imgf000446_0003
Figure imgf000446_0004
A1 A3 A5 1347] Synthesis of Compound 2:
Figure imgf000447_0001
11348] A stirred mixture of rhodanine (31 g, 232 mmol), sodium acetate (1 ,76 g, 21 mmol), compound 1 (28.2 g, 232 mmol), glacial acetic acid (5.3 mL) and toluene (300 mL) were heated to reflux for 4 hours in a round-bottomed flask equipped with a Dean and Stark water separator. During this time a total of 45 mL of water was collected and a yellow precipitate was resulted. After concentrating this mixture to approximately half of its volume, it was cooled to 5 °C .The separated yellow solid was filtered and collected, afforded compound 2 (54.8 g, 100%), without further purification, go to next step directly.
[1349] Synthesis of Compound 3:
Figure imgf000447_0002
Compound 2 (54.8 g, 231 mmol) was dissolved in a solution of sodium hydroxide (46.2 g, 1155 mmol) in water (750 mL) and kept at 60-70 °C for 30 minutes. During the last 15 minutes, it was treated with charcoal and filtered. The filtrate was cooled to 5-10 °Cand acidified under stirring by dropwise addition of concentrated HCl. The precipitated solid was collected, washed with water and dried in vacuum to give compound 3 (38.6 g, 85.7% yield) as yellow solid. [1351] Synthesis of Compound 4:
Figure imgf000448_0001
[1352] A stirred solution of compound 3 (38.6 g, 195.94 mmol) and iodine (62.5 g, 244.92
mmol) in dry THF was heated to reflux for 26 h. After removing almost of THF, the residue was poured into water. The pH was adjusted to 12 by progressively adding solid NaOH and the water phase was washed with EA for 3 times, then the water phase was acidified by conc.HCl to pH 2. The result precipitate was collected by filtration, washed by water, dried to give compound 4 (13.5 g, 35%) as light yellow solid.
[1353] Synthesis of Compound 5:
Figure imgf000448_0002
1354] The mixture of compound 4 (1.0 eq), PyBOP (1.0 eq), amine (1.0 eq)and DIPEA (2.0 eq) were added to dry THF, The reaction mixture was stirred at RT for 16 h. The mixture was concentrated and purified by column chromatogram to give compound 5.
[1355] Synthesis of Compound 6:
Figure imgf000448_0003
1356] A mixture of compound 5 ( 1.0 eq) and HMTA (4.0 eq) in TFA was heated to 80°C under nitrogen for 16 h. LC-MS indicated that the reaction was completed. After cooled to RT, the solvent was removed under vacuum. The residue was purified by prep-HPLC, afforded compound 6.
Figure imgf000449_0001
4-FormyI-5-hydroxy-N-(2-methoxyethyi)benzo{bjthiophene-2-carboxamide was obtained by the above procedure from amine Ai.10% yield.1HNMR (DMSO, 400 MHz) : δ 11.02 (s, 1H, OH), 10.56 (s, !IL CHO), 9.00 (t, Hi../ = 5.6 Hz, Nil).8.80 (d, IB, J ------
0.4Hz, ArH), 8.13(dd,lH, J= 8.8, 0.4 Hz, ArH), 7.14 (d, ill. J= 8.8 Hz, ArH), 3.48-3.40 (m, 4H, CH2), 3.28 (s, 3H, CH3); MS [ESI, Mil |: 280.1.
Figure imgf000449_0002
5-Hydroxy-2-(morpholine-4-carbonyI)benzo[bjthiophene-4-carbaIdehyde was obtained by the above procedure from amine A2.10% yield. !HNMR (DMSO, 400 MHz δ 11.15 (s, 1H, -Oil).10.56 (s, !IL CHO), 8.34 (s, III. ArH),8.16 (dd, if I J 9.2 , 0.8 Hz)7.14 (d, 1H, J= 8.8Hz, ArH),3.64 (d, 8H, J= 4.4 Hz,CH2). MS [ESI, Mil j: 292.1.
Figure imgf000449_0003
5-Hydroxy-2-(4-methylpiperazine~l-carbonyl)benzo[b]thiophene~4-carbaldehyde was obtained by the above procedure from amine A3.10% yield. 'HNMR (DMSO, 400 MHz) : 610.53 (s, 1H, CHO), 8.30 (s, 1H, ArH), 8.10 (d, 1H,J= 8.8Hz, ArH), 7.10 (d, 1H, J= 8.8Hz, ArH), 3.61 (t, 4H, J= 4.4 Hz, CH2), 2.32 (s, 4H, CH2), 2.17 (s, 3H, CH3). MS [ HS!. VII ! j: 305.2.
Figure imgf000450_0001
1360] N-Ethyl-4-fori-nyI-5-hydroxybeezo[b]ihiophes¾e-2-carboxamide was obtained by the above procedure from amine A4. 10% yield. ' l lVYIR (DMSO, 400 MHz) : δ 11.00 (s, 1H, OH), 10.58 (s, i l l CHO), 8.92 (t, 1H, ./ = 5.6 Hz, Ni l ). 8.77 (s, 1H, ArH), 8.12 (d, I I I. J = 8.8Hz, ArH), 7.14 (d, 1H, J= 8.8 Hz, ArH), 3.29-3.24 (m, 2H, CH2), 1.12 (t, 3H, J = 7.2! iz. CH3). MS [ESI, MH ]: 250.1.
Figure imgf000450_0002
[1361] 4-Formyi-5-hydroxy-N-(2-morpholiitoethyI)benzo[b]thiophenie-2-carboxamide was obtamed by the above procedure from amine AS. 10% yield. !HNMR (DMSO, 400 MHz) : 610.40 (s, 1H, CHO),8.73-8.72 (m, 3H, ArH), 7.88 (d, 1H, J= 9.2Hz, ArH), 6.90 (d, 1H, ./ 9.2 Hz, ArH), 3.53 (t, 6Π. ./ 4.4 Hz, C ! !.-}. 2.38 (s, 6H, CH2). MS [ESI, MH']:
335.2.
Figure imgf000450_0003
[1362] N~(2-(Dimethylamino)ethyl)-4~formyl-5-hydroxybenzo[b]thiophene-2-carboxamide was obtained by the above procedure from amine A6. 10% yield. 'HNMR (DMSO, 400 MHz) : 610.54 (s, 1H, CHO), 8.84 (t, 1H, J= 5.6 Hz, NH), 8.75 (s, 3H, ArH), 8.09 (d, I H, J ------- 8.8Hz, ArH), 7.12 (d, 1 H, ,/ 9.2 Hz, ArH), 3.35-3.30 (m, 21 !. CH2), 2.44-2.41
(m, 2H, CH2), 2.18 (s, 6H, CH3); MS [ESI, MH+] : 293.2. EXAMPLE 84 . 2 r
Figure imgf000451_0001
Figure imgf000451_0002
A1 A2 A4 A6
1363] Synthesis of Compound 2:
Figure imgf000451_0003
1364] To the solution of compound ί (5 g, 0.028 mol) in EtOH (250 mL) was added H2S04 (0.5 mL). The mixture was heated to reflux for 12 h. After cooled to RT, the reaction mixture was concentrated and dissolved in DCM (100 mL).The DCM layer was washed with sat.NaHCOs, dried over Na2S04, concentrated to give compound 2 (5.0 g, 86% yield) as white solid. [1365] Synthesis of Compound 4:
Figure imgf000452_0001
2 4
[1366] The mixture of compound 2 (5 g, 0,024 mol) and compound 3 (3.7 g, 0.024 moi) was heated to 160 -1 80 °C under N2 for 2 h. After cooled to RT, the reaction mixture was dissolved in MeOH (5 mL) at 70 °C. Then the mixture was cooled to RT, the formed precipitate was filtered and washed with MeOH, dried to give compound 4 (3.0 g, 40% yield) as yellow solid.
[1367] Synthesis of Compound 5 :
Figure imgf000452_0002
4 5
[1368] The suspension of compoimd 4 (3.0 g, 9.7 mmol) in 5M HCl (100 mL) was heated at 70 C for 2 h. After cooled to RT, the reaction mixture was diluted with water (50 mL), the formed precipitate was filtered and washed with water, dried to give compound 5 (2.0 g, 90.5% yield). : ! I NMR (CDCI3, 400 MHz): 6 1 1.72 (s, 1 H, OH), δ 10.40 (s, i f !. CHO), 9.08 (br, 1H, NH), 7.58 (d, 1H, J = 9.2 Hz, ArH), 7.44 (s, 1 H, ArH), 6.97 (d, 1 H, J = 9.2 Hz, ArH), 4.41 (q, 21 1 ./ 7.2 Hz, CI !, }. 1.41 (t, M i. . I 7.2 Hz, O ! .· ). 1369] Synthesis of Compound 6:
Figure imgf000453_0001
[1370] To the solution of compound 5 (2.0 g, 8.0 mmol) in MeOH (30 mL), the solution of
LiOH-H20 (0.5 g, 12.0 mmol) in H?0 ( 15 mL) was added. The mixture was heated to 60 °C for 2 h. After cooled to RT, the reaction mixture was concentrated, then acidified with 3 M HCI to pH =;: 2. The formed precipitate was filtered and washed with water, dried to give compound 6 (1.6 g, 91.4% yield). MS [ESI, MET]: 206.1.
[1371] Synthesis of Compound 7:
Figure imgf000453_0002
[1372] To the solution of compound 6 (1 eq), amine (1 eq) and PyBOP (1 eq) in DMF was added DIPEA (2 eq) dropwise at 0 °C. Then the reaction mixture was stirred at RT overnight. LCMS showed that starting materia] was consumed completed, the reaction mixture was concentrated and purified by prep-HPLC to give compound 7,
Figure imgf000453_0003
1373] 4-Formyl-5-hydroxy-N-(2-methoxyethyl)-lH-indole-2-carboxamide was obtained by the above procedure from amine AL 18 % yield. Hi NMR (MeOD, 400 MHz): 6 10.45 (s, 1H, CHO), 7.60 (dd, 1H, J= 0.8 Hz, J= 8.8 Hz, ArH), 7.47 (d, IH, ,1 = 12 Hz, ArH), 6.81 (d, U f . J 9.2 Hz, ArH), 3.53 (m, 4H, 2CH2), 3.34 (s, 3H, OCH3);
[1374] MS [ESI, Mil']: 263.2.
Figure imgf000454_0001
11375 J 5-Hydroxy~2-(morpholme-4-carboiiyI)-i H-indo]e~4~carba ehyde was obtained by the above procedure from amine A2. 25% yield. JH NMR (DMSO, 400 MHz): δ 11.80 (s, 1H, OH), 10.53 (s, 1H, CHO), 10.51 (s, I H, NH), 7.59 (dd, ! I L J= 0.8 Hz, J- 8.8 Hz, ArH), 7.26 (dd, IH, J= 0.8 Hz, ArH), 6.87 (d, 1 H, ./ 8.8 Hz, ArH),3.73 (s, 4H, 2CH2), 3.63 (m, 4H, 2CH2). MS [ESI, ME1]: 275.2.
Figure imgf000454_0002
[1376] 5-Hydroxy~2-(4-methyJpiperazMe~l-carboiiy1)~l H~mdole-4~carbaMehyd^ was
obtained by the above procedure from amine A3. 23.6 % yield. 1H NMR (D?0, 400 MHz): δ 9.97 (s, I I I. CHO), 7.42 i d. I I I. j 9.2 Hz, ArH), 6.91 (s, I H, ArH), 6.63 (d, I H, J= 9.2 Hz, ArH), 4.53 (d, 2H, J= 14.8 Hz, CH2), 3.55-3.41 (m, 4H), 3.09 (m, 2H, CI S .). 2.85 (s, 3H, NCH3),. MS [ESI, MH+] : 288.2.
Figure imgf000454_0003
[1377] N-Ethyl-4-formyl-5-hydroxy-lH-indole-2-carboxamide was obtained by the above procedure from amine .44. 30% yield. Ή NMR (DMSO, 400 MHz): δ 11.68 (s, t ! L OH), 8 10.50 (s, IH, CHO), δ 10.32 (s, IH, NH), 8.56 (br, IH, NH), 7.62 (d, 1H, J= 1.6 Hz, ArH), 7.54 (d, 1H, J =4.8 Hz, ArH), 6.83 (d, 1H, J= 4.8 Hz, ArH), 3.24 (m, 2H, CH2), L09 (t, 3H, J - 7.2 Hz, CH3). MS [ESI, MH |; 233.2.
Figure imgf000455_0001
[1378] 4-FormyI-5-hydroxy-N-(2-morpholinoethyI)-l H~indo]e~2~carhoxamide was obtained by the above procedure from amine AS. 22% yield. !H NMR (D20, 400 MHz): δ 9.93 (s, 1H, CHO), 7.37 (d, 1H, 1=8.8 Hz, ArH), 6.96 (s, 1H, ArH), 6.63 (d, 1H, j=8.8 Hz, ArH), 4.03 id. 2H, (Ί ί .Κ 3.78-3.67 (rn. 4H, 2CH2), 3.56 (d, 2H, J --- 12.4 Hz, CH2), 3.35 (t, 21 !.
6.0 Hz, CH2), 3.17 (t, 2H, J = 11.2 Hz, CH2). MS [ESI, MH ; ] : 318.3.
Figure imgf000455_0002
[1379] N-(2-(Dimethylamino)ethyl)-4-formyl-5-hydroxy-lH-indole-2-carboxamide was obtained by the above procedure from amine A6. 25% yield. ] H NMR (MeOD, 400 MHz): 8 10.49 (s, 1H, CHO), 7.64 (d, IH, J= 8.8 Hz, ArH), 7.52 (s, 1H, ArH), 6.85 (d, 1H, J = 8.8 Hz, ArH), 3.55 (t, 2H, J == 6.4 Hz, CH2), 2.64 ft, 21 !. ./ 6.4 Hz, CH2), 2.36 (s, 61 1. 2NCH3).MS [ESI, MH"]: 276.2.
EXAMPLE 85
Figure imgf000456_0001
4
Figure imgf000456_0002
A1 A3 A4 AS A8
Synthesis of Compound 3
Figure imgf000456_0003
381] The mixture of compound 1 (15.2 g, O. lmol), compound 2 (16.6 g, 0.1 moi ) and 2CO3 (27.6 g, 0.2 mo!) in DMF (150 rnL) was heated to reflux under N2 for 2 h. After cooled to RT, the reaction mixture was concentrated and dissolved in DCM (100 mL), the solution washed with sat.NaHCC , brine, dried over Na2S04, concentrated. The residue was purified by silica gel column to give compound 3 (1 1.8 g , 62% yield) as white solid. 382] Synthesis of Compound 4:
Figure imgf000456_0004
The solution of BBr3 (40 g, 160.0 mmol) in DCM (100 mL) was added dropwise to the solution of compound 3 (9g, 40.9 mmol ) in PC VI (300 mL) at -60 IJC. After that the reaction mixture was warmed slowly to 0 °C and stirred for another 1 h. The reaction mixture was quenched with EtOH (10 ml) slowly at -60 °C. The reaction mixture was washed with water, brine, dried over Na2S04, concentrated to give compound 4 (8.8 g, 100% yield). MS [ESI, VII 1 ]: 206.1.
Figure imgf000457_0001
?84] Ethyl 4-formyl-5-hydroxybenzofuran-2-carbox late: The mixture of compound 4 (5.0 g, 24.3 mmol), and HMTA (13.5 g, 97.0 mmol) in TFA (500 mL) was heated to 100 °C under N2 for 2 h. The reaction was monitored by LCMS. The reaction mixture was concentrated, diluted with H20 (20 mL) and stirred for 30 min. The formed precipitate was filtered, washed with water, dried to give MNKD-227(3.0 g, 53.5% yield). lHNMR (CDCI3, 400 MHz): δ 11.45 (s, IH, OH), 10.26 (d, IH, J= 0.4 Hz, CHO), 7.72 (s, 1H, ArH), 7.68 (d, 1 H, 9.2 Hz, ArH), 7.02 (d, I H, J 9.2 Hz, ArH), 4.40 (q, 2H, J ------- 7.2
Hz, CH2), 1.37 (t, 3H, J= 7.2 Hz, CH3). MS [ESI, MH+] : 235.1.
Figure imgf000457_0002
4-Formyl-5-hydroxybenzofuran-2~carboxylic acid: The solution of LiOH-H20 (1.26 g, 60 mmol ) in H20 (15 mL) was added dropwise to the solution of ethyl 4-formyl-5- hydroxybenzofuran-2-carboxylate (4.6 g, 20 mmol) in THF (40 mL). The reaction mixture was heated to 50 °C for 2 h. After cooled to RT, the reaction mixture was concentrated, then acidified with 3 M HC1 to pH = 2. The formed precipitate was filtered and washed with water, dried to give 4-formyl-5-hydroxybenzofuran-2-carboxyiic acid (4.1 g. 87.8% yield). ' i iX V! R (DMSO, 400 MHz): δ 10.91 (s, I H, OH), 10.47 (s, I H, CHO), 7.92 (d, M L J= 0.8 Hz, ArH), 7.87 (dd, 1H, J = 9.2 Hz, 0.8 Hz, ArH), 1H, J= 9.2 Hz, ArH); MS [ESI, V!f ! j: 207.1.
[1386] Synthesis of Compound 5:
Figure imgf000458_0001
1387] To the solution of 4-formy!-5-hydroxybenzofuran-2-carboxylic acid (1 eq), amine (1 eq) and PyBOP (1 eq) in DMF was added DIPEA (2 eq) dropwise keeping the inner temperature below 10 "C. The reaction mixture was stirred at RT for 2 h. The reaction was monitored by LCMS. The reaction mixture was concentrated and purified by prep- HPLC to give compound 5.
Figure imgf000458_0002
1388] 4-Formyi-5-hydroxy-N-(2-methoxyethyI)benzofuran-2-carboxamide was obtained by the above procedure from amine Al. 17.6% yield. 3 HNMR (DMSO, 400 MHz): δ 10.80 (s, 1H, OH), 10.47 (s, 1H, CHO), 8.77 (t, l ! L J 5.2 Hz, NH), 7.96 (d, l ! L J 0.8 Hz, ArH), 7.81 (dd, 1H, J= 8.8 Hz, 0.8 Hz, ArH), 7.06 (d, 1H, J= 8.8 Hz, ArH), 3.41 (m, 41 1 2CH2), 3.24 (s, 3H, OCH3). MS [ESi, MH ]; 264.1.
Figure imgf000458_0003
[1389] 5-Hydroxy-2-{morpholtae-4-carbosiyl)benzof srari-4-carbaIdehyde was obtamed by the above procedure from amine A2. 21.7 % yield. 1HNMR (CDC13, 400 MHz): 6 11.48 (s, 1H, OH), 10.31 (s, i l l. CHO), 7.65 (d, i l l. ./ 1.2 Hz, AxH), 7.03 (d, 1H, J = 9.2 Hz, ArH), 3.87- 3.78 (m, 8H); MS [ESI, MH+] : 276.2.
Figure imgf000459_0001
1390] 5-Hydroxy-2-(4-methylpiperazine-l-carbonyl)benzofuran-4-carbaldehyde was
obtained by the above procedure from amine A3. 30% yield. !HNMR (MeOD, 400 MHz): δ 7.63 (s, H i. ArH), 7.41 (d, 1H, J 9.2! !/. ArH), 6.97 (dd, 1H, J =8.8 Hz, 0.8 Hz, ArH), 5.87 (d, 1H, J =0.8 Hz, NH), 4.79 (d. 2H, J= 14.8 Hz, CH2), 3.63-3.48 (m, 4H, 2CH2), 3.25-3.22 (m. 2H, CH2), 2.96 (s, 3H, CH3); MS [ESI, MH+]: 289.2.
Figure imgf000459_0002
1391] N-Ethyl-4-formyI-5-hydroxybenzofuran-2-carboxamide was obtained by the above procedure from amine A4. 18.7% yield. iHNMR (DMSO, 400 MHz): δ 10.80 (s, IH, OH), 10.47 (s, IH, CHO), 8.77 (t, l ! L J 5.2 Hz, NH), 7.94 (s, IH, ArH), 7.80 (dd, IH, J ------
8.8 Hz, 0.8 Hz, ArH), 7.08 (d, IH, J= 8.8 Hz, ArH), 3.26 (m, 2H, CH2), 1.10 (t, 3H, J = 7.2 Hz, C¾); MS [ESI, MH ]: 234.2.
Figure imgf000459_0003
[1392] 4-FormyI-5-hydroxy-N-(2-morpholinoethyl)benzofuran-2-carboxamide was obtained by the above procedure from amine A5. 21.7% yield. *HNMR (MeOD, 400 MHz): 6 7.72 (d, IH, J =1.2 Hz, Ari i ). 7.40 (dd, IH, J = 8.8 Hz, 1.2 Hz, ArH), 6.97 (d, IH, J = 8.8 Hz, ArH), 5.87 (s, IH, NH), 4.08 (m. 2H, CH2), 3.80 (t, 4H, J= 5.6 Hz, 2CH2), 3.68 (d. 2H, J -12.0 Hz, { ! ].· ). 3.25-3.17 (m, 21 !. ( '[ !■}: MS [ESI, MH+] : 319.2.
Figure imgf000460_0001
[1393] N~(2-(dimethylamino)ethyl)-4-formyl~5-hydroxybenzofuran-2-carboxamide was obtained by the above procedure from amine A6. 2.5% yield. Ί iXVIR (DMSO, 400 MHz): δ 10.89 (s, IH, OH), 10.48 (s, IH, CHO), 9.41 (br, IH, NH), 8.97 (br, IH, NH), 7.98 (s, IH, ArH), 7.84 (d, I H, J - 8.8 Hz, ArH), 7.12 (d, IH, J ------ 9.2 Hz, ArH), 3.59 (d, 2H, ./ =
6.4 Hz, CH2), 3.24 (s, 2H, CH2), 2.81 (s, 6H, 2CH3); MS [ESI, MH+]: 277.2.

Claims

1. A compound or pharmaceutically acceptable salt thereof, where the compound directly inhibits IRE- let activity in vitro and is represented by a structural formula selected from the group cons sting of:
a. structural formula (A):
Figure imgf000461_0001
where n:
R3 and R4 independently are hydrogen; halogen; hydroxy I; optional!)' substituted alkyl; or optionally substituted alkoxyl; or optionally substituted alkylamino. Optional substituents for the alkyl or for the aikoxyl and alkylamino are (1) a CI ~C6 hydrocarbon chain containing an N or O atom and optionally substituted with a C1-C3 peril uoroalkyl, and (2) a cycloalkyl which may contain 1 or 2 heteroatoms selected from N, O, and S, and which is optionally substituted with a C 1-C3 perfluoroalkyl;
Q5, Q6, Q7 and Q8 (used throughout this specification interchangeably with Qs, Q6, Q7 and Qg), together with the benzene ring to which they are attached, form a benzofused ring. In some embodiments, Q7 is a bond which connects Q6 and Q8. The benzofused ring may or may not be fully aromatic.
Q5 is CR5, CR5R5', N, NR5, NC=OR5, O, 8, or C ( ).
Q6 is CR6, CR6R6', N, NR6, NC=OR6, O, 8, or C ( ). CR7, CR7R7', N, NR7, NC=OR7, O, S, C=0, or a bond; and
CR8, CR8R8', N, NR8, NC=OR8, O, S, C=0,
PROVIDED THAT: at least one of Q5, Q6, Q7 (when not a bond), and Q8 must be a heteroatom selected from N, S, and O and Q5, Q6, Q7, and Q8 do not form O-O, O-N, 0-8, or C C bonds.
V, R6, R6f, R7, R7', R8, and R8f are independently hydrogen; R21; R10 ; v °^R1 0 ; alkenyl, alkynyi, or phenyl, each optionally substituted with 1, 2, or 3 substituents independently selected from the group consisting of halogen, CN, alkyl, perfluoroalkyl, alkoxy, hydroxylalkyl, alkoxvlalkyl, perfluoroaikoxy,
Figure imgf000462_0001
; a 5- or 6-membered heteroaryi that is substituted with 1 , 2, or 3 substituents independently selected from the group consisting of halogen,— CN, alkyl, perfluoroalkyl, alkoxy, hydroxylalkyl,
Figure imgf000462_0002
R10 , wherein n is 0, 1, or 2; R10 ; -^S" ; O
O O ; or R5 and R6, together with the carbon atoms to which they are attached, form a 5-membered cycloalkyl,
1. R5, R5', 6, R6', R7, R7', R8, and R8f are not simultaneously hydrogen; when R5, R5', R6, R6', R7, R7f, R8, and R8f are independently y ^ Rio
R10 or -^'Ο" , none of Q5, Q6, Q7, and Q8 is N, O, or S; and
3. when R5, RS', R6, R6', R7, R7', R8, and R8' are independently a 5- or 6-mernbered heteroaryl substituted with 1, 2, or 3 substituents
Figure imgf000463_0001
the is linked to a carbon atom of the 5- or 6-membered heteroarvl; and RIO are independently hydrogen; alkyl; alkoxylalkvl; periiuoroalkoxylaiky]; aryi optionally substituted with 1, 2, or 3 substituents independently selected from R21; a 5- or 6-mernbered heterocycle, optionally substituted with 1, 2, or 3 substituents independently selected from R21; a 5- or 6-membered heteroaryl, optionall substituted with 1, 2, or 3 substituents independently selected from
R21; or
Figure imgf000463_0002
, wherein n is 0, 1, 2, or 3; or and RIO, together with the nitrogen atom to which they are attached, form a
heterocycle containing 1, 2, 3, or 4 heteroatoms selected from N, O, and S, optionally substituted with 1, 2, or 3 substituents selected independently from
Rll is hydrogen; alkyl; aryl; heteroaryl containing 1 or 2 heteroatoms selected from N, O, and S; aryialkyl; heteroarylalkyl in which the heteroaryl contains 1 or 2 heteroatoms selected from N, O, and S;
Figure imgf000464_0001
; or R14
R12 is amino; a!koxy; aryl, optionally substituted with 1, 2, or 3 substitutents selected independently from Rll; a 5- or 6-membered heterocycle having 1, 2, or 3 heteroatonis selected from N, O, and S and optionally substituted with 1, 2, or 3 substitutents selected independently from Rll; or a 5- or 6-membered iieteroaryl having 1, 2, or 3 heteroatoms selected from , O, and S and optional!)' substituted with 1, 2, or 3 substitutents selected mdependently from Rll;
R13 is alkyl; alkoxylalkvl; perfiuoroalkoxyl alkyl; aryl, optionally substituted with 1, 2, or 3 substituents independently selected from R21; a 5- or 6-membered heterocycle, optionally substituted with 1, 2, or 3 substituents independently selected from R21; a 5- or 6-membered iieteroaryl, optionally substituted with 1 2, or 3
Figure imgf000464_0002
5
substituents independently selected from R21; or , wherein n is 0, 1, 2, or 3; and R14 is hydrogen or R13; or
R13 and R14, together with the nitrogen to which they are attached, form a heterocycle containing 1 , 2, or 3 heteroatoms selected independently from N, O, and S, optionally substituted with 1, 2, or 3 substitutents selected independently from R16;
R15 is amino; alkoxy; aryl, optionally substituted with 1, 2, or 3 substitutents selected independently from R21; a 5- or 6-membered heterocycle having 1 , 2, or 3 heteroatoms selected from N, O, and S and optionally substituted with 1, 2, or 3 substitutents selected from R21 ; or a 5~ or 6-membered heteroaryl having 1, 2, or 3 heteroatoms selected from N, O, and S and optionally substituted with 1 , 2, or 3 substitutents selected from R21; R16 is hydrogen; alkyl; aryl; heteroaryl containing 1 or 2 heteroatoms selected from N, O, and S; arylalkyl; heteroarylalkyl in which the heteroaryl contains 1 or 2
O heteroatoms selected from N, O, and S; R17 ; G O ; R18 ;
Figure imgf000465_0001
amino; or *¥1R817 ·
.17 is alkyl; alkoxylalkyl; perfiuoroaikoxylalkyl; aryl, optionally substituted with 1, 2, or 3 substituents independently selected from R21; a 5- or 6-membered heterocycie, optionally substituted with 1 , 2, or 3 substituents independently selected from R21; a 5- or 6-membered heteroaryl, optionall substituted with 1,
2, or 3 substituents independently selected from R21 ; or
Figure imgf000465_0002
, wherein n is 0, 1, 2, or 3; and R18 is hydrogen or R17; or
17 and R18, together with the nitrogen to which they are attached, form a heterocycie containing 1, 2, 3, or 4 heteroatoms selected independently from N, O, and S, optionally substituted with 1, 2, or 3 substituents selected independently fi rxom
R19 is aikoxy; aryl, optionally substituted with 1, 2, or 3 substitutents selected
independently from R21; a 5- or 6-membered heterocycie, optionally substituted with 1, 2, or 3 substituents independently selected from R21; or a 5- or 6- membered heteroaryl, optionally substituted with 1, 2, or 3 substituents independently selected from R21; is a 5- or 6-membered heterocycie having 1 or 2 heteroatoms selected from N, (), and S and optionally substituted with 1, 2, or 3 substituents selected
independently from R21; a 5- or 6-membered heteroaryl, optionally substituted with 1, 2, or 3 substituents selected independently from R21; or R2i; and R21 is halogen, perfluoroalkyl, perfluoroalkoxy,— CN,— CONH2,— CON(CH3)2, alkyl, aikoxy, hvdroxyialkyl, or alkoxylalkyl, with the exception of the com pounds excluded from structure
(A-4), (A-5), (A-6), and (A-7), below; b. structural formula (A-1 ):
Figure imgf000466_0001
(A-1) wherem R3, R4, R5, and R6 are as defined in structural formula (A), PROVIDED THAT if R3 and R4 are both hydrogen and R5 is methyl, then R6 cannot be ethyl or unsubstituted phenyl;
c. structural formula (A-2):
Figure imgf000467_0001
d. structural formula (A-3):
Figure imgf000467_0002
(A-3)
wherein:
R3, R4, R6, and R7 are as defined in structural formula (A), PROVIDED THAT:
i. if R3 and R4 are hydrogen and R6 is optionally substituted phenyl, then R7 cannot be optionally substituted phenyl, hydrogen, methyl, or CH20(CH2)2;
ii. if R3 and R4 are hydrogen and R6 is methoxv, then R7 is not methyl or unsubstituted phenyl; ill. if R3 is ethyl, R4 is hydrogen, R7 is methyl, then R6 is not fluorophenyl;
IV. if R3 is halogen and R4 and R7 are hydrogen, then R6 is not
bromophenyi; and
V. R6 and R7 cannot both be methyl if either:
iii. R3 is halogen and R4 is hydrogen; or
iv. one of R3 and R4 is methyl and the other is hydrogen.
VI . have structural formula (A-4):
Figure imgf000468_0001
(A-4) wherein R3, R4, R5, R5 R6, R6', R.7, R8, and R8' are as defined in structural formula (A).
e. have structural formula (A-5):
Figure imgf000468_0002
wherein R3, R4, R6, R7, and R8 are as defined in structural formula (A);
f. have structural formula (A-6a):
Figure imgf000469_0001
(A-6a) wherein:
R3, R4, and R6 are as defined in structural formula (A);
g. structural formula (A-6b):
Figure imgf000469_0002
(A-6b)
wherein:
R3, R4, and R6 are as defined in structural formula (A); h. structural formula (A-7a), which can exist as a mixture of two tautomers:
Figure imgf000469_0003
wherein R3, R4, and R6 are as defined in structural formula (A);
i , stru ctural formu la (A-7b) :
Figure imgf000470_0001
(A-7b) wherein R3, R4, and R6 are as detmed in structural formula (A) and R7 is hydrogen or C1 -C3 aikyi; j. have structural formula (A-7c):
Figure imgf000470_0002
(A-7c) wherein R3, R4, and R6 are as defined in structural formula (A) and R5 is hydrogen or C1-C3 aikyi; k. structural formula (A- 8 a):
Figure imgf000470_0003
(A-8a) wherein:
R3, R4, and R6 are as defined in structural formula (A); j. structural formula (A-8b):
Figure imgf000471_0001
(A-8b) wherein:
R3, R4, and R6 are as defined in structural formula (A);
k. stmctural formula (A-9a):
Figure imgf000471_0002
(A-9a) wherein:
R3, R4, and R6 are as defmed in stmctural formula (A);
1. stractural formula (A-9b :
Figure imgf000472_0001
(A-9b) m, structural formula (A- 10a):
Figure imgf000472_0002
(A- 10a) wherein:
R3, R4, and R6 are as defined in structural formula (A);
n . stractural formula (A- 10b):
Figure imgf000472_0003
(A- 10b) wherein: I, and R6 are as defined in structural formula (A); o . stru ctural formu la (A- 1 1 a) :
Figure imgf000473_0001
(A- 1 1 a)
wherein:
R3, R4, and R6 are as defined in stmctural formula (A) and R5 is hydrogen or C 1-C3 alkyl; and . structural formula (A - l ib):
Figure imgf000473_0002
(A- l ib) wherein:
R3, R4, and R6 are as defined in structural formula (A) and R7 is hydrogen or C I alkyl.
2. A prodrug of a compound of claim 1.
3. A pharmaceutical composition comprising the compound of claim 1 and a pharmaceutical ly acceptable vehicle.
4. A complex comprising IRE- l a and a compound of claim 1.
5. A method of inhibiting IRE- la activity, comprising contacting IRE- la with a compound of claim 1 or a prodrug or pharmaceutically acceptable salt thereof,
6. The method of claim 5 wherein the IRE- la activity is selected from the group consisting of cleavage of RNA, cleavage of mRNA, RNA splicing, and mRNA splicing.
7. The method of claim 6 wherein the IRE- la activity is cleavage of mRNA and wherein the mRNA is selected from the group consisting of Blosl mRNA, DGAT2 mRNA, CD59 mRNA, and IRE- la mRNA.
8. A method of treating a disorder associated with the unfolded protein response, comprising administering to a patient in need thereof a compound of claim 1 or a prodmg or pharmaceutically acceptable salt thereof,
9. The method of claim 8 further comprising administering a therapeutic agent that induces or up-regulates IRE- l a expression.
10. The method of claim 8 further comprising administering a therapeutic agent which is less effective when IRE- la is expressed.
11. A method of treating a disorder associated with the unfolded protein response, comprising administering to a patient in need thereof:
a compound of claim 1 or a prodrug or pharmaceutically acceptable salt thereof; and
a proteasome inhibitor.
12. A method of treating a disorder associated with a target of regulated IRE1- dependent decay (RIDD), comprising administering to a patient in need thereof a compound of claim 1 or a prodrug or pharmaceutically acceptable salt thereof.
13. A compound of claim 1 for use as a medicament.
14. A compound of claim 1 for treatment of a disorder associated with the unfolded protein response or a disorder associated with a target of regulated IRE 1 -dependent decay (RXDD).
PCT/US2011/031274 2010-04-05 2011-04-05 IRE-1α INHIBITORS Ceased WO2011127070A2 (en)

Priority Applications (16)

Application Number Priority Date Filing Date Title
CN201180027605.4A CN103079558B (en) 2010-04-05 2011-04-05 IRE-1α inhibitors
CA2795350A CA2795350C (en) 2010-04-05 2011-04-05 Ire-1.alpha. inhibitors
MX2015001652A MX362442B (en) 2010-04-05 2011-04-05 INHIBITORS OF ENZYME 1 DEPENDENT OF INOSITOL (IRE-1ALFA).
EP11715346.0A EP2555768B1 (en) 2010-04-05 2011-04-05 Ire-1 inhibitors
US13/639,734 US9040714B2 (en) 2010-04-05 2011-04-05 IRE-1α inhibitors
ES11715346T ES2698048T3 (en) 2010-04-05 2011-04-05 IRE-1 inhibitors
MX2018000187A MX388981B (en) 2010-04-05 2011-04-05 INOSITOL-DEPENDENT ENZYME 1 INHIBITORS (IRE-1ALPHA).
CN201910119705.8A CN110172051B (en) 2010-04-05 2011-04-05 IRE-1 alpha inhibitors
EP20209114.6A EP3799870A1 (en) 2010-04-05 2011-04-05 Ire-1a inhibitors
EP18181955.8A EP3409276B1 (en) 2010-04-05 2011-04-05 Ire-1a inhibitors
MX2012011504A MX2012011504A (en) 2010-04-05 2011-04-05 INHIBITORS OF ENZYME 1 DEPENDENT OF INOSITOL (IRE-1 ALFA).
JP2013503848A JP2013525281A (en) 2010-04-05 2011-04-05 IRE-1α inhibitor
US14/594,400 US9693992B2 (en) 2010-04-05 2015-01-12 IRE-1α inhibitors
US15/600,473 US9867803B2 (en) 2010-04-05 2017-05-19 IRE-1α inhibitors
US15/836,728 US10357475B2 (en) 2010-04-05 2017-12-08 IRE-1α inhibitors
US16/429,460 US11337956B2 (en) 2010-04-05 2019-06-03 IRE-1α inhibitors

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US32097510P 2010-04-05 2010-04-05
US61/320,975 2010-04-05

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US13/639,734 A-371-Of-International US9040714B2 (en) 2010-04-05 2011-04-05 IRE-1α inhibitors
US14/594,400 Division US9693992B2 (en) 2010-04-05 2015-01-12 IRE-1α inhibitors

Publications (2)

Publication Number Publication Date
WO2011127070A2 true WO2011127070A2 (en) 2011-10-13
WO2011127070A3 WO2011127070A3 (en) 2012-04-19

Family

ID=44317675

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2011/031274 Ceased WO2011127070A2 (en) 2010-04-05 2011-04-05 IRE-1α INHIBITORS

Country Status (8)

Country Link
US (5) US9040714B2 (en)
EP (3) EP3799870A1 (en)
JP (5) JP2013525281A (en)
CN (3) CN103079558B (en)
CA (2) CA2914966A1 (en)
ES (2) ES2858328T3 (en)
MX (3) MX388981B (en)
WO (1) WO2011127070A2 (en)

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9126999B2 (en) 2012-05-31 2015-09-08 Eisai R&D Management Co., Ltd. Tetrahydropyrazolopyrimidine compounds
US20170247340A1 (en) * 2014-10-14 2017-08-31 La Jolla Institute Of Allergy & Immunology Inhibitors of Low Molecular Weight Protein Tyrosine Phosphatase and Uses Thereof
US9867803B2 (en) 2010-04-05 2018-01-16 Shanghai Fosun Pharmaceutical Industrial Development Co. Ltd. IRE-1α inhibitors
US10131668B2 (en) 2012-09-26 2018-11-20 The Regents Of The University Of California Substituted imidazo[1,5-a]pYRAZINES for modulation of IRE1
CN111566089A (en) * 2017-11-10 2020-08-21 康奈尔大学 IRE1 small molecule inhibitor
EP3630748A4 (en) * 2017-06-01 2021-01-27 Quentis Therapeutics, Inc. SMALL IRE1 INHIBITOR MOLECULES
US11066420B2 (en) 2017-05-01 2021-07-20 Sanford Burnham Prebys Medical Discovery Institute Inhibitors of low molecular weight protein tyrosine phosphatase (LMPTP) and uses thereof
WO2022023353A1 (en) * 2020-07-28 2022-02-03 Illumina Cambridge Limited Substituted coumarin dyes and uses as fluorescent labels
US11767320B2 (en) 2020-10-02 2023-09-26 Incyte Corporation Bicyclic dione compounds as inhibitors of KRAS
WO2024072110A1 (en) 2022-09-30 2024-04-04 한미약품 주식회사 NOVEL TRICYCLIC HETEROCYCLIC CARBALDEHYDE COMPOUND AND PHARMACEUTICAL COMPOSITION, CONTAINING SAME, FOR IRE1α INHIBITION
EP4089090A4 (en) * 2019-12-31 2024-04-10 Fosun Orinove Pharmatech, Inc. PROCESS FOR PREPARING A COUMARIN COMPOUND WHOSE 3-POSITION IS SUBSTITUTED WITH AMIDOALKYL, AND PRODUCTS AND RELATED INTERMEDIATES THEREOF
US12123048B2 (en) 2018-12-06 2024-10-22 Solventum Intellectual Property Company Fluorinated 4′-alkylumbelliferyl a-D-glucopyranosides, biological sterilization indicators including the same and methods of using the same

Families Citing this family (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2996064C (en) * 2015-08-18 2024-02-13 Novation Pharmaceuticals Inc. Benzopyran derivatives and uses thereof
CN107311861B (en) * 2015-12-04 2020-04-21 高邮市华宝颜料有限公司 4-methoxy ethyl acetoacetate and synthetic method thereof
BR112020004226A2 (en) * 2017-09-01 2020-11-17 Optikira Llc compounds and compositions for ire1 inhibition
EP3752135A1 (en) * 2018-02-16 2020-12-23 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating liver diseases
WO2020019107A1 (en) * 2018-07-23 2020-01-30 Fosun Orinove Pharmatech, Inc. IRE1α INHIBITOR IN COMBINATION WITH CANCER THERAPEUTIC AGENT FOR CANCER TREATMENT
US20210260069A1 (en) * 2018-07-23 2021-08-26 Fosun Orinove Pharmatech, Inc. IRE1a INHIBITOR IN COMBINATION WITH CANCER THERAPEUTIC AGENT FOR CANCER TREATMENT
AU2018447495A1 (en) * 2018-11-02 2021-06-17 Fosun Orinove Pharmatech, Inc. IRE1α inhibitor in combination with cancer therapeutic agent for cancer treatment
CN110724098A (en) * 2019-11-13 2020-01-24 成都福柯斯医药技术有限公司 Synthetic method of 5, 7-dichloro-1, 2,3, 4-tetrahydroisoquinoline-6-carboxylic acid hydrochloride
CN111808083B (en) * 2020-07-18 2023-03-31 贵州大学 3-pyrazoline isoflavone compound and preparation method and application thereof
CN114213249B (en) * 2021-12-31 2023-09-01 瑞孚信江苏药业股份有限公司 Synthesis method of dolutegravir intermediate
CN114349635B (en) * 2021-12-31 2023-09-01 瑞孚信江苏药业股份有限公司 Synthesis method of dolutegravir core intermediate
CN114890879A (en) * 2022-03-02 2022-08-12 北京中医药大学 Monobromo method of beta-dicarbonyl compound
CN118576600A (en) * 2024-05-31 2024-09-03 中山大学附属第三医院 Application of IRE1α inhibitor KIRA8 in the preparation of drugs for treating relapsed and refractory multiple myeloma
CN119751432B (en) * 2024-12-29 2025-10-10 浙江工业大学 Polysubstituted coumarin compound and application thereof

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3536809A (en) 1969-02-17 1970-10-27 Alza Corp Medication method
US3598123A (en) 1969-04-01 1971-08-10 Alza Corp Bandage for administering drugs
US3845770A (en) 1972-06-05 1974-11-05 Alza Corp Osmatic dispensing device for releasing beneficial agent
US3916899A (en) 1973-04-25 1975-11-04 Alza Corp Osmotic dispensing device with maximum and minimum sizes for the passageway
US3944064A (en) 1973-10-26 1976-03-16 Alza Corporation Self-monitored device for releasing agent at functional rate
US4008719A (en) 1976-02-02 1977-02-22 Alza Corporation Osmotic system having laminar arrangement for programming delivery of active agent
US20070105123A1 (en) 2005-11-04 2007-05-10 Mannkind Corporation IRE-1alpha substrates

Family Cites Families (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5608085A (en) * 1995-02-27 1997-03-04 The University Of Tennessee Research Corporation Synthesis of optically active calanolides A and B and enantiomers and related compounds
AU722883B2 (en) * 1995-10-18 2000-08-10 Merck & Co., Inc. Cyclopentyl tachykinin receptor antagonists
KR20020009383A (en) 1998-04-01 2002-02-01 우에노 도시오 Fused thiophene derivatives and drugs containing the same as the active ingredient
FR2777562B1 (en) * 1998-04-16 2002-07-19 Rhone Poulenc Fibres PROCESS FOR THE PURIFICATION OF ALIPHATIC AMINONITRILES
ATE269295T1 (en) * 1998-04-17 2004-07-15 Parker Hughes Inst BTK INHIBITORS AND METHODS OF IDENTIFICATION AND USE
US6303652B1 (en) * 1998-08-21 2001-10-16 Hughes Institute BTK inhibitors and methods for their identification and use
AU7593001A (en) 2000-07-14 2002-01-30 Zycos Inc Alpha-msh related compounds and methods of use
US6774248B2 (en) * 2001-12-18 2004-08-10 Wyeth Substituted 2-phenyl benzofurans as estrogenic agents
GB0412768D0 (en) * 2004-06-08 2004-07-07 Novartis Ag Organic compounds
JP5223162B2 (en) 2006-02-28 2013-06-26 公立大学法人名古屋市立大学 Fluorescent dye for labeling peptide or protein, and labeling method using the fluorescent dye
EP1930396B1 (en) * 2006-12-04 2011-07-06 Merck Patent GmbH Furochroman derivatives
MX2009013332A (en) * 2007-06-08 2010-01-25 Mannkind Corp INHIBITORS OF IRE-1 ALFA.
JP2010180191A (en) * 2009-02-09 2010-08-19 Univ Of Electro-Communications Photogenesis substrate of luciferase
CN103079558B (en) * 2010-04-05 2025-09-12 上海复星医药产业发展有限公司 IRE-1α inhibitors

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3536809A (en) 1969-02-17 1970-10-27 Alza Corp Medication method
US3598123A (en) 1969-04-01 1971-08-10 Alza Corp Bandage for administering drugs
US3845770A (en) 1972-06-05 1974-11-05 Alza Corp Osmatic dispensing device for releasing beneficial agent
US3916899A (en) 1973-04-25 1975-11-04 Alza Corp Osmotic dispensing device with maximum and minimum sizes for the passageway
US3944064A (en) 1973-10-26 1976-03-16 Alza Corporation Self-monitored device for releasing agent at functional rate
US4008719A (en) 1976-02-02 1977-02-22 Alza Corporation Osmotic system having laminar arrangement for programming delivery of active agent
US20070105123A1 (en) 2005-11-04 2007-05-10 Mannkind Corporation IRE-1alpha substrates

Non-Patent Citations (47)

* Cited by examiner, † Cited by third party
Title
"Addison's disease", SURGERY, vol. 128, 2000, pages 999 - 1006
"aplastic anemia", BLOOD, vol. 44, no. 1, July 1974 (1974-07-01), pages 49 - 56
"autoimmune hemolytic anemia", EUR.J. IMMUNOL., vol. 32, 2002, pages 1147 - 56
"autoimmune hepatitis", J. IMMUNOL., vol. 169, 2002, pages 4889 - 96
"autoimmune hypophysitis", AUTOIMMUNITY, vol. 33, no. 5, 2001, pages 265 - 74
"autoimmune myocarditis", METHODS, vol. 41, no. 1, January 2007 (2007-01-01), pages 118 - 22
"autoimmune thrornbocytopcnic purpura", HAEMATOLOGICA, vol. 88, 2003, pages 679 - 87
"Churg-Strauss syndrome, Wegener's granulomatosis", CLIN EXP RHEUMATOL., vol. 21, no. 6, November 2003 (2003-11-01), pages S55 - 63
"dermatomyositis", AM. J. PATHOL., vol. 120, 1985, pages 323 - 25
"epidermolysis bullosa acquisita", J CLIN INVEST., vol. 115, no. 5, April 2005 (2005-04-01), pages 870 - 8
"giant cell arteritis; Takayusu's arteritis", CIRCULATION, vol. 111, no. 23, 6 June 2005 (2005-06-06), pages 3135 - 40
"Goodpasture's syndrome", J. EXP. MED., vol. 191, 2000, pages 899 - 906
"Grave's disease", CLIN. EXP. IMMUNOL., vol. 99, 1995, pages 294 - 302
"Guillain-Barré syndrome", BRAIN PATHOL., vol. 12, 2002, pages 420 - 29
"Hashimoto's thyroiditis", EXP MOL PATHOL., vol. 77, 2004, pages 161 - 67
"IgA nephropathy", INT J IMMUNOPATHOL PHARRNACOL., vol. 18, no. 5, October 2005 (2005-10-01), pages 701 - 8
"lupus erythymatosus", ARTHRITIS RHEUM., vol. 50, 2004, pages 3250 - 59
"membranous nephropathy", J.6, CLIN. INVEST., vol. 91, 1993, pages 1507 - 15
"myasthenia gravis", CELL. MOL. IMMUNOL., vol. 2, 2005, pages 461 - 65
"pemphigus foliaceous", VETREC, vol. 114, no. 19, 12 May 1984 (1984-05-12), pages 479
"pemphigus vulgaris", IMMUNOL. INVEST., vol. 3, 2006, pages 47 - 61
"polyarteritis nodosa", VET. PATHOL., vol. 32, 1995, pages 337 - 45
"polymyositis", J. NEUROIMMUNOL., vol. 98, 1999, pages 130 - 35
"rheumatoid arthritis", J. CLIN. INVEST., vol. 116, 2006, pages 961 - 973
"Sjögren's syndrome", RHEUMATOL., vol. 32, 2005, pages 1071 - 75
ARCH. DERMATOL. RES., vol. 297, 2006, pages 333 - 44
ARUMUGAM ET AL., SHOCK, vol. 21, no. 5, 2004, pages 401 - 06
ASGARI ET AL., CURR OPIN ORGAN, TRANSPLANT, vol. 15, no. 4, 2010, pages 486 - 91
BALCH ET AL., SCIENCE, vol. 319, 2008, pages 916
BCRG ET AL.: "Pharmaceutical Salts", J. PHARM. SCI., vol. 66, 1977, pages 1 - 19
CHERONIS ET AL.: "Semimicro Qualitative Organic Analysis", 1965, INTERSCIENCE, pages: 465 - 518
DONG ET AL., CANCER RES., vol. 67, no. 2, 15 July 2007 (2007-07-15), pages 6700 - 7
E. L. EL.IEL, S. H. WILEN: "Stereochemistry of Carbon Compounds", 1994, JOHN WILEY & SONS, pages: 11 19 - 1190
HAN ET AL., CELL, vol. 138, no. 3, 2009, pages 562 - 75
HOLLIEN ET AL., J CELL BIOL., vol. 186, no. 3, 2009, pages 323 - 31
HOLLIEN, WEISSMAN, SCIENCE, vol. 313, no. 5783, 2006, pages 104 - 07
LUPUS, ANTI.PHOSPHOLIPID SYNDROME, vol. 5, no. 5B, October 1996 (1996-10-01), pages 451 - 5
OIKAWA ET AL., BIOCHEM BIOPHYS RES COMMUN., vol. 360, no. 1, 2007, pages 122 - 127
RON, WALTER, NAT. REV MOL CELL BIOL., vol. 8, no. 7, 2007, pages 519 - 29
RUIZ-ARGÜELLES, LLORENTE, AUTOIMMUN REV., vol. 6, no. 3, 2007, pages 155 - 61
RYDER, FAUNDEZ, SCI SIGNAL., vol. 2, no. 93, 2009, pages 66
SCHELINC, XENOBIOTICA, vol. 2, 1972, pages 227 - 36
SONG, AUTOIMMUNITY, vol. 39, no. 5, 2006, pages 403 - 10
THORPE, SCHWARZE, CELL STRESS CHAPERONES, vol. 15, no. 5, 2010, pages 497 - 508
TIRASOPHON ET AL., GENES DEV., vol. 14, no. 21, 2000, pages 2725 - 36
WERMUTH ET AL.: "Designing Prodrugs -and Bioprecursors 1: Carrier Prodrugs", THE PRACTICE OF MEDICINAL CHEMISTRY, 1996, pages 672 - 696
WERMUTH.: "The Practice of Medicinal Chemistry", 1996, article "Preparation of Water-Soluble Compounds by Covalent Attachment of Solubilizimg Moieties", pages: 756 - 776

Cited By (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9867803B2 (en) 2010-04-05 2018-01-16 Shanghai Fosun Pharmaceutical Industrial Development Co. Ltd. IRE-1α inhibitors
US10357475B2 (en) 2010-04-05 2019-07-23 Fosun Orinove Pharmatech, Inc. IRE-1α inhibitors
US11337956B2 (en) 2010-04-05 2022-05-24 Fosun Orinove Pharmatech, Inc. IRE-1α inhibitors
US11130758B2 (en) 2012-05-31 2021-09-28 Eisai R&D Management Co., Ltd. Tetrahydropyrazolopyrimidine compounds
US9446046B2 (en) 2012-05-31 2016-09-20 Eisai R&D Management Co., Ltd. Tetrahydropyrazolopyrimidine compounds
US9850242B2 (en) 2012-05-31 2017-12-26 Eisai R&D Management Co., Ltd Tetrahydropyrazolopyrimidine compounds
US9126999B2 (en) 2012-05-31 2015-09-08 Eisai R&D Management Co., Ltd. Tetrahydropyrazolopyrimidine compounds
US10640500B2 (en) 2012-05-31 2020-05-05 Eisai R&D Management Co., Ltd. Tetrahydropyrazolopyrimidine compounds
US11613544B2 (en) 2012-09-26 2023-03-28 The Regents Of The University Of California Substituted imidazo[1,5-a]pyrazines for modulation of IRE1
US10131668B2 (en) 2012-09-26 2018-11-20 The Regents Of The University Of California Substituted imidazo[1,5-a]pYRAZINES for modulation of IRE1
US10822340B2 (en) 2012-09-26 2020-11-03 The Regents Of The University Of California Substituted imidazolopyrazine compounds and methods of using same
US10626094B2 (en) * 2014-10-14 2020-04-21 Sanford Burnham Prebys Medical Discovery Institute Inhibitors of low molecular weight protein tyrosine phosphatase and uses thereof
US20170247340A1 (en) * 2014-10-14 2017-08-31 La Jolla Institute Of Allergy & Immunology Inhibitors of Low Molecular Weight Protein Tyrosine Phosphatase and Uses Thereof
US11220486B2 (en) 2014-10-14 2022-01-11 La Jolla Institute Of Allergy & Immunology Inhibitors of low molecular weight protein tyrosine phosphatase and uses thereof
US11066420B2 (en) 2017-05-01 2021-07-20 Sanford Burnham Prebys Medical Discovery Institute Inhibitors of low molecular weight protein tyrosine phosphatase (LMPTP) and uses thereof
US11731986B2 (en) 2017-05-01 2023-08-22 Sanford Burnham Prebys Medical Discovery Institute Inhibitors of low molecular weight protein tyrosine phosphatase (LMPTP) and uses thereof
EP3630748A4 (en) * 2017-06-01 2021-01-27 Quentis Therapeutics, Inc. SMALL IRE1 INHIBITOR MOLECULES
US11021466B2 (en) 2017-06-01 2021-06-01 Cornell University IRE1 small molecule inhibitors
US11649224B2 (en) 2017-06-01 2023-05-16 Cornell University IRE1 small molecule inhibitors
CN111566089A (en) * 2017-11-10 2020-08-21 康奈尔大学 IRE1 small molecule inhibitor
US11634403B2 (en) 2017-11-10 2023-04-25 Cornell University IRE1 small molecule inhibitors
CN111566089B (en) * 2017-11-10 2023-11-17 康奈尔大学 IRE1 small molecule inhibitors
US12071424B2 (en) 2017-11-10 2024-08-27 Cornell University IRE1 small molecule inhibitors
US12123048B2 (en) 2018-12-06 2024-10-22 Solventum Intellectual Property Company Fluorinated 4′-alkylumbelliferyl a-D-glucopyranosides, biological sterilization indicators including the same and methods of using the same
EP4089090A4 (en) * 2019-12-31 2024-04-10 Fosun Orinove Pharmatech, Inc. PROCESS FOR PREPARING A COUMARIN COMPOUND WHOSE 3-POSITION IS SUBSTITUTED WITH AMIDOALKYL, AND PRODUCTS AND RELATED INTERMEDIATES THEREOF
WO2022023353A1 (en) * 2020-07-28 2022-02-03 Illumina Cambridge Limited Substituted coumarin dyes and uses as fluorescent labels
US12351871B2 (en) 2020-07-28 2025-07-08 Illumina Cambridge Limited Substituted coumarin dyes and uses as fluorescent labels
US11767320B2 (en) 2020-10-02 2023-09-26 Incyte Corporation Bicyclic dione compounds as inhibitors of KRAS
KR20240046082A (en) 2022-09-30 2024-04-08 한미약품 주식회사 Novel tricyclic heterocyclic carbaldehyde compound and pharmaceutical composition for inhibiting IRE1α including the same
WO2024072110A1 (en) 2022-09-30 2024-04-04 한미약품 주식회사 NOVEL TRICYCLIC HETEROCYCLIC CARBALDEHYDE COMPOUND AND PHARMACEUTICAL COMPOSITION, CONTAINING SAME, FOR IRE1α INHIBITION

Also Published As

Publication number Publication date
MX362442B (en) 2019-01-18
JP6799624B2 (en) 2020-12-16
MX388981B (en) 2025-03-20
US20180228765A1 (en) 2018-08-16
CN110172051B (en) 2023-03-07
JP6219882B2 (en) 2017-10-25
WO2011127070A3 (en) 2012-04-19
JP2021014475A (en) 2021-02-12
EP3409276B1 (en) 2020-12-30
CN107082770B (en) 2019-04-23
CN107082770A (en) 2017-08-22
ES2858328T3 (en) 2021-09-30
CN103079558B (en) 2025-09-12
MX2012011504A (en) 2013-01-18
JP2015214548A (en) 2015-12-03
EP2555768B1 (en) 2018-08-29
CN103079558A (en) 2013-05-01
JP6479913B2 (en) 2019-03-06
EP2555768A2 (en) 2013-02-13
US20170326104A1 (en) 2017-11-16
JP2019070046A (en) 2019-05-09
CN110172051A (en) 2019-08-27
EP3799870A1 (en) 2021-04-07
US20150141424A1 (en) 2015-05-21
JP2017206555A (en) 2017-11-24
EP3409276A1 (en) 2018-12-05
US10357475B2 (en) 2019-07-23
CA2914966A1 (en) 2011-10-13
US11337956B2 (en) 2022-05-24
US20190314330A1 (en) 2019-10-17
US20130116247A1 (en) 2013-05-09
ES2698048T3 (en) 2019-01-30
CA2795350A1 (en) 2011-10-13
JP2013525281A (en) 2013-06-20
CA2795350C (en) 2016-02-09
US9693992B2 (en) 2017-07-04
US9040714B2 (en) 2015-05-26
US9867803B2 (en) 2018-01-16

Similar Documents

Publication Publication Date Title
WO2011127070A2 (en) IRE-1α INHIBITORS
JP6916795B2 (en) LSD1 inhibitor
EP3164130B1 (en) Heteroaryl compounds useful as inhibitors of sumo activating enzyme
CN103450077B (en) IRE-1 alpha inhibitor
JP2021121599A (en) Histone demethylase inhibitors
ES2782357T3 (en) IRE 1 alpha inhibitors
CN108456165B (en) Sulfonylurea compound and its preparation method and application
TW202214574A (en) Substituted (phthalazin-1-ylmethyl)ureas, substituted n-(phthalazin-1-ylmethyl)amides, and analogues thereof
HK1179171A (en) Ire-1 inhibitors
HK1179171B (en) Ire-1 inhibitors
HK1237266B (en) Heteroaryl compounds useful as inhibitors of sumo activating enzyme
HK1237266A1 (en) Heteroaryl compounds useful as inhibitors of sumo activating enzyme
HK1192249A (en) Ire-1a inhibitors
HK1192249B (en) Ire-1a inhibitors

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201180027605.4

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11715346

Country of ref document: EP

Kind code of ref document: A2

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
ENP Entry into the national phase

Ref document number: 2795350

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: MX/A/2012/011504

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 2013503848

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 13639734

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 2011715346

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 3389/KOLNP/2012

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 201180027605.4

Country of ref document: CN

WWG Wipo information: grant in national office

Ref document number: 201180027605.4

Country of ref document: CN