WO2011126937A1

WO2011126937A1 - Targeted intracellular delivery of oligonucleotides via conjugation with small molecule ligands

Info

Publication number: WO2011126937A1
Application number: PCT/US2011/030901
Authority: WO
Inventors: Rudolph Juliano; Osamu Nakagawa; Xin Ming; Leaf Huang
Original assignee: University of North Carolina at Chapel Hill
Current assignee: University of North Carolina at Chapel Hill
Priority date: 2010-04-06
Filing date: 2011-04-01
Publication date: 2011-10-13
Anticipated expiration: 2012-10-06

Abstract

An oligonucleotide covalently coupled to at least one ligand for a membrane bound protein is provided. The ligand is preferably so coupled through a linking group. The linking group preferably comprising a phosphate group covalently coupled to a substituted or unsubstituted aliphatic group or a substituted or unsubstituted aliphatic oxide group. The compounds may be provided as salts, including pharmaceutically acceptable salts, thereof. Methods of making and using the same are also provided.

Description

TARGETED INTRACELLULAR DELIVERY OF OLIGONUCLEOTIDES VIA CONJUGATION WITH SMALL MOLECULE LIGANDS

Rudolph Juliano, Osamu Nakagawa, Xin Ming, and Leaf Huang

This invention was made with Government support under grant number POIGM 26599 from the National Institutes of Health. The US Government has certain rights to this invention.

Field of the Invention

This application concerns compounds and compositions for delivering nucleic acids to a cell of interest, and methods of making and using the same.

Background of the Invention

Targeted delivery is a key issue for the pharmacology of antisense and siRNA oligonucleotides.¹ For example, we recently showed that conjugation of a dimeric RGD (arginine-glycine-aspartic acid) peptide, a high-affinity ligand for the integrin ανβ3, to an oligonucleotide (ON) increased cellular uptake via receptor-mediated endocytosis and enhanced the biological effect of the ON. ² Thus, direct mono- or multi-valent ligand conjugation to ONs seems an attractive strategy for enhancing receptor specific delivery of ONs to cells and tissues while using well-defined chemical moieties.

Summary of the Invention

A first aspect of the present invention is an oligonucleotide covalently coupled to at least one ligand for a membrane bound protein. The ligand is preferably so coupled through a linking group. The linking group preferably comprising a phosphate group covalently coupled to a substituted or unsubstituted aliphatic group or a substituted or unsubstituted aliphatic oxide group. The compounds may be provided as salts, including pharmaceutically acceptable salts, thereof.

In some embodiments, the compound is a compound of Formula I: (A)_n-B (I) wherein:

A is L— R— O— P(=O)(X)— O— , where L is a ligand for a membrane bound protein, R is an unsubstituted or substituted aliphatic group or an unsubstituted or substituted aliphatic oxide group, and X is O or S,

B is selected from the group consisting of

a)— R— Oligo, where R is a covalent bond or a cleavable linker,

where R³ is a covalent bond or a cleavable linker, R⁴ and R⁵ are unsubstituted or substituted aliphatic groups or unsubstituted or substituted aliphatic oxide groups, and each R¹⁰, R¹¹, and R¹² are H or— R¹³— , where R¹³ is an unsubstituted or substituted aliphatic group or an unsubstituted or substituted aliphatic oxide group, subject to the proviso that at least 1 or 2 of R¹⁰, R¹¹, and R¹² are not H, and c) (— R¹⁴— C(R¹⁵— L )— O— P(=O)(X)— 0)_ra— R³— Oligo, where R¹⁴ and R¹⁵ are unsubstituted or substituted aliphatic groups or unsubstituted or substituted aliphatic oxide

* 3 · groups, L is a ligand for a membrane bound protein, X is O or S, m is 1 to 15, and R is a covalent bond or a cleavable linker, wherein

Oligo is an oligonucleotide from 3 to 100 nucleotides in length, and

n is 1 to 3.

A further aspect of the invention is a phosphoramidite group covalently coupled to a ligand for a membrane bound protein, preferably through a linking group. The linking group preferably comprising a substituted or unsubstituted aliphatic group, or a substituted or unsubstituted aliphatic oxide group. In some embodiments such compounds have a structure of Formula II:

L— R— O— P(R²⁰)(NR²¹R²²), (II)

wherein:

L is a ligand for a membrane bound protein, R is an unsubstituted or substituted aliphatic group or an unsubstituted or substituted aliphatic oxide group,

R²⁰ is selected from the group consisting of — OCH₂CH₂CN,— SCH₂CH₂CN, a substituted or unsubstituted aliphatic group, — OR²³, — SR²³, — O— CH₂CH₂— Si(CH₃)₂C₆H₅, — O— CH₂CH₂— S(O)₂— CH₂CH₃, — O— CH₂CH₂— C₆H₄— NO₂, — S— CH₂CH₂— Si(CH₃)₂C₆H₅, — S— CH₂CH₂— S(O)₂— CH₂CH₃, and — S— CH₂CH₂— C₆H₄— NO₂, where R is a substituted or unsubstituted aliphatic group, a substituted or unsubstituted aryl group or a substituted or unsubstituted aralkyl group, and

R²¹ and R²² are each independently selected from the group consisting of a substituted or unsubstituted aliphatic group, a substituted or unsubstituted aryl group, and a substituted or unsubstituted aralkyl, or R²¹ and R²² taken together with the nitrogen to which they are bound form a 5 or 6 member heterocyclic ring.

A further aspect of the present invention is a process for making an oligonucleotide conjugate. The process generally comprises:

a) deprotecting the 5'-hydroxyl group of an oligonucleotide,

b) activating the 3' end of a compound having a structure of Formula II:

L— R— O— P(R²⁰)(NR²¹R²²), (II)

wherein:

L is a ligand for a membrane bound protein,

R is an unsubstituted or substituted aliphatic group or an unsubstituted or substituted aliphatic oxide group,

R²⁰ is selected from the group consisting of — OCH₂CH₂CN,— SCH₂CH₂CN, a substituted or unsubstituted aliphatic group, — OR²³, — SR²³, — O— CH₂CH₂— Si(CH₃)₂C₆H₅, — O— CH₂CH₂— S(O)₂— CH₂CH₃, — O— CH₂CH₂— C₆H₄— NO₂, — S— CH₂CH₂— Si(CH₃)₂C₆H₅, — S— CH₂CH₂— S(O)₂— CH₂CH₃, and — S— CH₂CH₂— C₆H₄— NO₂, where R²³ is a substituted or unsubstituted aliphatic group, a substituted or unsubstituted aryl group or a substituted or unsubstituted aralkyl group, and

R²¹ and R²² are each independently selected from the group consisting of a substituted or unsubstituted aliphatic group, a substituted or unsubstituted aryl group, and a substituted or unsubstituted aralkyl, or R²¹ and R²² taken together with the nitrogen to which they are bound form a 5 or 6 member heterocyclic ring, and then

c) coupling the compound of Formula II with the oligonucleotide to produce an oligonucleotide conjugate. A further aspect of the invention is a method of introducing an oligonucleotide of interest into a cell, comprising contacting a compound as described above (that is, an oligonucleotide covalently coupled to at least one ligand for a membrane bound protein) to the cell in an amount effective to introduce said oligonucleotide into said cell.

The present invention is explained in further detail in the drawings herein and the specification set forth below.

Brief Description of the Drawings

Figure 1. Structure of 5' mono- and tri-valent anisamide-conjugated oligonucleotides. ON 623: 5'-GTT ATT CTT TAG AAT GGT GC-TAMRA-3 ' (T-O-Me RNA with phosphorothioate backbone).

Figure 2. A. Initial cellular uptake. Cells were treated with 50 nM Mono-anisamide- 623-Tamra, Tri-anisamide-623-Tamra, or 623-Tamra, for 4 hours in OptiMEM at 37°C. The cells were rinsed in buffered saline solution and then trypsinized. Total cellular uptake of the Tamra-labeled conjugate was measured by flow cytometry. B. Effect of sigma receptor inhibitor on initial uptake. Cells were treated with 50 nM Mono- or Tri-anisamide-623-Tamra in the absence or presence of 50 μΜ haloperidol. After 4 hours, the cellular uptake was measured by flow cytometry. Results are normalized based on cells receiving no inhibitor as 100%. C. Luciferase induction. Cells were treated with Mono-anisamide-623-Tamra, Tri- anisamide-623-Tamra, or 623-Tamra for 24 hours and luciferase activity was determined 48 hours after treatment. Results A-C are the means and standard deviations of triplicate determinations.

Detailed Description of the Preferred Embodiments

The present invention will now be described more fully hereinafter. This invention may, however, be embodied in different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.

The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used in the description of the invention and the appended claims, the singular forms "a", "an" and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety.

1. Definitions.

"Membrane bound protein" as used herein broadly refers to a target protein being present on or in a cell membrane or the membrane of intracellular organelles (for example, endoplasmic reticulum and Golgi apparatus). Such membrane bound proteins include, for example, integral membrane proteins, peripheral membrane proteins, and receptors. Suitable membrane bound proteins include those described in U.S. Patent Nos. 7,329,509; 7,678,539; 6,761,902; 7,682,802; 7,083,958; and which are incorporated herein by reference.

"Receptor" as used herein widely means a protein capable of interacting (binding) with a ligand. In some embodiments, such a protein is capable of transmitting information resulting from interaction with a ligand, into a cell.

"Ligand" as used herein refers to a chemical molecule or biological molecule that can bind readily to a receptor with a specific binding affinity constant. The ligand may be natural or synthetic. Ligands can vary in size from small organic molecules to peptides or large proteins. Exemplary ligands include, but are not limited to, light-sensitive compounds, olfactory compounds, amines, peptides, proteins, pheromones, hormones, nucleotide-like compounds, cannabinoids, phospholipids, phospholipid derivatives, pharmaceuticals, and neurotransmitters. Suitable ligands include those described in U.S. Patent Nos. 7,682,802 and 7,083,958, which are incorporated herein by reference. In preferred embodiments of the invention, the Ligand is a small organic molecule. In preferred embodiments of the invention, the ligand specifically binds to a cell membrane-bound protein, particularly a membrane- bound receptor such as a G-protein coupled receptor, as discussed below, and for which numerous ligands are known by those skilled in the art.

"Small organic molecule" as used herein refers to organic compounds having a molecular weight of more than about 10 Daltons and less than about 5,000 Daltons, of more than about 40 Daltons and less than about 3,000 Daltons, or of more than about 100 Daltons and less than about 2,500 Daltons. The small organic molecule may be natural, modified, or synthetic. Small organic molecules of the present invention can comprise functional groups necessary for structural interaction with proteins, for example hydrogen bonding. Exemplary functional groups include, but are not limited to alkyl, alkenyl, hydroxyl, alkoxy, cycloalkyl, cycloalkenyl, halo, sulfhydryl, thio, thioalkyl, cyano, carbonyl, carboxyl, amino, aminoalkyl, alkylamino, nitro, heteroaryl, phosphoryl, and aryl groups. The small organic molecules can comprise saturated or unsaturated cyclical carbon or heterocyclic structures substituted with one or more functional groups and/or aromatic or polyaromatic structures substituted with one or more functional groups. Exemplary small organic molecules include, but are not limited to, pharmaceuticals, sugars, fatty acids, steroids, saccharides, purines, pyrimidines, derivatives, structural analogs, or combinations thereof.

"Moiety" and "group" are used interchangeably herein to refer to a portion of a molecule, typically having a particular functional or structural feature, e.g. a linking group (a portion of a molecule connecting two other portions of the molecule).

"Substituted" as used herein to describe chemical structures, groups, or moieties, refers to the structure, group, or moiety comprising one or more substituents. As used herein, in cases in which a first group is "substituted with" a second group, the second group is attached to the first group whereby a moiety of the first group (typically a hydrogen) is replaced by the second group. The substituted group may contain one or more substituents that may be the same or different.

"Substituent" as used herein references a group that replaces another group in a chemical structure. Typical substituents include nonhydrogen atoms (e.g. halogens), functional groups (such as, but not limited to amino, sulfhydryl, carbonyl, hydroxyl, alkoxy, carboxyl, silyl, silyloxy, phosphate and the like), hydrocarbyl groups, and hydrocarbyl groups substituted with one or more heteroatoms. Exemplary substituents include but are not limited to alkyl, lower alkyl, aryl, aralkyl, lower alkoxy, thioalkyl, hydroxyl, thio, mercapto, amino, imino, halo, cyano, nitro, nitroso, azido, carboxy, sulfide, sulfone, sulfoxy, phosphoryl, silyl, silyloxy, boronyl, and modified lower alkyl.

"Aliphatic group" as used herein refers to a straight-chain, branched-chain, or cyclic aliphatic hydrocarbon group and includes saturated and unsaturated aliphatic groups, such as an alkyl group, an alkenyl group, and an alkynyl group. The aliphatic group may be unsubstituted or substituted with one or more substituents, which may be the same or different. When substituted at both ends, or utilized as part of a chain or "backbone," such groups may also be known as alkylene, alkenylene, and alkynylene groups. In some embodiments, aliphatic groups may contain 1, 2, or 3 up to 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, or 20 carbon atoms.

"Aliphatic oxide group" as used herein refers to an aliphatic group as defined herein substituted with one or more oxygen atoms. The aliphatic oxide group may be unsubstituted or substituted with one or more substituents, which may be the same or different. In some embodiments, aliphatic oxide groups may contain 2 or 3 up to 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 carbon and oxygen atoms. In some embodiments the aliphatic oxide group may be utilized as part of a chain or "backbone," which may comprise, consist of, or consist essentially of an aliphatic group containing from 1 to 10 carbon atoms, then an oxygen atom, followed by another aliphatic group containing from 1 to 10 carbon atoms, wherein the oxygen atom and aliphatic group may be repeated 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 times and the aliphatic groups may be the same or different.

"Alkyl," as used herein, refers to a straight or branched chain hydrocarbon containing from 1 to 10 carbon atoms. Representative examples of alkyl include, but are not limited to, methyl, ethyl, n-propyl, iso-propyl, n-butyl, sec-butyl, iso-butyl, tert-butyl, n-pentyl, iso- pentyl, neopentyl, n-hexyl, 3-methylhexyl, 2,2-dimethylpentyl, 2,3-dimethylpentyl, n-heptyl, n-octyl, n-nonyl, n-decyl, and the like.

"Loweralkyl," as used herein, is a subset of alkyl and refers to a straight or branched chain hydrocarbon group containing from 1 to 4 carbon atoms. Representative examples of lower alkyl include, but are not limited to, methyl, ethyl, n-propyl, iso-propyl, n-butyl, iso- butyl, tert-butyl, and the like.

"Alkenyl," as used herein, refers to a straight or branched chain hydrocarbon containing from 2 to 10 carbons and containing at least one carbon-carbon double bond formed by the removal of two hydrogens. Representative examples of "alkenyl" include, but are not limited to, ethenyl, 2-propenyl, 2-methyl-2-propenyl, 3-butenyl, 4-pentenyl, 5- hexenyl, 2-heptenyl, 2-methyl-l-heptenyl, 3-decenyl and the like. "Loweralkenyl" as used herein, is a subset of alkenyl and refers to a straight or branched chain hydrocarbon group containing from 1 to 4 carbon atoms.

"Alkoxy," as used herein, refers to an alkyl group, as defined herein, appended to the parent molecular moiety through an oxy group, as defined herein. Representative examples of alkoxy include, but are not limited to, methoxy, ethoxy, propoxy, 2-propoxy, butoxy, tert- butoxy, pentyloxy, hexyloxy and the like. "Lower alkoxy," as used herein, is a subset of alkoxy and refers to a lower alkyl group, as defined herein, appended to the parent molecular moiety through an oxy group, as defined herein. Representative examples of lower alkoxy include, but are not limited to, methoxy, ethoxy, propoxy, 2-propoxy, butoxy, tert-butoxy, and the like.

"Alkylthio," as used herein refers to an alkyl group, as defined herein, appended to the parent molecular moiety through a thio moiety, as defined herein. Representative examples of alkylthio include, but are not limited, methylthio, ethylthio, tert-butylthio, hexylthio, and the like.

"Alkylogen," as used herein means alkyl or loweralkyl in which one, two, three or more (e.g., all) hydrogens thereon have been replaced with halo. Examples of alkylogen include but are not limited to trifluoromethyl, chloromethyl, 2-chloroethyl, 2-bromoethyl, and 2-iodoethyl. Alkylogens may also be referred to as haloalkyl or perhaloalkyl (e.g. fluoroalkyl; perfluoroalkyl).

"Cycloalkyl," as used herein, refers to a saturated cyclic hydrocarbon group containing from 3 or 4 to 6 or 8 carbons. Representative examples of cycloalkyl include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. A cycloalkyl group may be unsubstituted or substituted and when substituted the substituents may be the same or different.

"Cycloalkenyl," as used herein, refers to an unsaturated cyclic hydrocarbon group containing from 3 to 8 carbons and having at least one double bond. Representative examples include cyclobutenyl, cyclopentenyl, cyclohexenyl, and cycloheptenyl. A cycloalkenyl group may be unsubstituted or substituted and when substituted the substituents may be the same or different. Cycloalkenyl groups herein may or may not be aromatic.

"Heterocycle," as used herein, refers to a monocyclic- or a bicyclic-ring system. Monocyclic ring systems are exemplified by any 5 or 6 membered ring containing 1, 2, 3, or 4 heteroatoms independently selected from oxygen, nitrogen and sulfur. The 5 membered ring has from 0-2 double bonds and the 6 membered ring has from 0-3 double bonds. Representative examples of monocyclic ring systems include, but are not limited to, azetidine, azepine, aziridine, diazepine, 1,3-dioxolane, dioxane, dithiane, furan, imidazole, imidazoline, imidazolidine, isothiazole, isothiazoline, isothiazolidine, isoxazole, isoxazoline, isoxazolidine, morpholine, oxadiazole, oxadiazoline, oxadiazolidine, oxazole, oxazoline, oxazolidine, piperazine, piperidine, pyran, pyrazine, pyrazole, pyrazoline, pyrazolidine, pyridine, pyrimidine, pyridazine, pyrrole, pyrroline, pyrrolidine, tetrahydrofuran, tetrahydrothiophene, tetrazine, tetrazole, thiadiazole, thiadiazoline, thiadiazolidine, thiazole, thiazoline, thiazolidine, thiophene, thiomorpholine, thiomorpholine sulfone, thiopyran, triazine, triazole, trithiane, and the like. Bicyclic ring systems are exemplified by any of the above monocyclic ring systems fused to an aryl group as defined herein, a cycloalkyl group as defined herein, or another monocyclic ring system as defined herein. Representative examples of bicyclic ring systems include but are not limited to, for example, benzimidazole, benzothiazole, benzothiadiazole, benzothiophene, benzoxadiazole, benzoxazole, benzofuran, benzopyran, benzothiopyran, benzodioxine, 1,3-benzodioxole, cinnoline, indazole, indole, indoline, indolizne, naphthyridine, isobenzofuran, isobenzothiophene, isoindole, isoindoline, isoquinoline, phthalazine, pyranopyridine, quinoline, quinolizine, quinoxaline, quinazoline, tetrahydroisoquinoline, tetrahydroquinoline, thiopyranopyridine, and the like. Heterocycle groups of this invention can be substituted with 1 , 2, or 3 substituents, such as substituents independently selected from alkenyl, alkenyloxy, alkoxy, alkoxyalkoxy, alkoxycarbonyl, alkyl, alkylcarbonyl, alkylcarbonyloxy, alkylsulfmyl, alkylsulfonyl, alkylthio, alkynyl, aryl, azido, arylalkoxy, arylalkoxycarbonyl, arylalkyl, aryloxy, carboxy, cyano, formyl, oxo, halo, haloalkyl, haloalkoxy, hydroxy, hydroxyalkyl, mercapto, nitro, sulfamyl,sulfo, sulfonate, ~ NR' R" (wherein, R' and R" are independently selected from hydrogen, alkyl, alkylcarbonyl, aryl, arylalkyl and formyl), and -C(O)NRR' (wherein, R and R' are independently selected from hydrogen, alkyl, aryl, and arylalkyl).

"Aryl," as used herein refers to an aromatic species containing 1 to 5 aromatic rings, either fused or linked, and either unsubstituted or substituted with 1 or more groups typically selected from the group consisting of lower alkyl, modified lower alkyl, aryl, aralkyl, lower alkoxy, thioalkyl, hydroxyl, thio, mercapto, amino, imino, halo, cyano, nitro, nitroso, azido, carboxy, sulfide, sulfone, sulfoxy, phosphoryl, silyl, silyloxy, and boronyl; and lower alkyl substituted with one or more groups selected from lower alkyl, alkoxy, thioalkyl, hydroxyl thio, mercapto, amino, imino, halo, cyano, nitro, nitroso, azido, carboxy, sulfide, sulfone, sulfoxy, phosphoryl, silyl, silyloxy, and boronyl. Typical aryl groups contain 1 to 3 fused aromatic rings, and more typical aryl groups contain 1 aromatic ring or 2 fused aromatic rings. Aromatic groups herein may or may not be heterocyclic.

"Aralkyl" as used herein refers to an aryl group, as defined herein, attached to an alkyl group, as defined herein. Exemplary arylalkyl groups include benzyl, phenylethyl, 4- hydroxybenzyl, 3-fluorobenzyl, 2-fluorophenylethyl, and the like.

"Heteroaryl," as used herein refers to an aryl, as defined herein, that is heterocyclic. "Halo," as used herein refers to any halogen group, such as chloro, fluoro, bromo, or iodo.

"Hydroxyl," as used herein refers to the radical -OH.

"Oxo," as used herein refers to a =O moiety.

"Oxy," as used herein refers to a -O- moiety.

"Phosphoryl," as used herein refers to -P(R⁵⁰)(R^5!)(R⁵²), wherein R⁵⁰ is a lone pair of electrons, thial or oxo, and R⁵¹ and R⁵² are each independently a covalent bond, a hydrogen, a lower alkyl, an alkoxy, an alkylamino, a hydroxy, an oxy or an aryl, as defined herein. Exemplary phosphoryl groups include phosphonate and phosphinate.

"Thio," as used herein refers to a -S- moiety.

"Sulfhydryl," as used herein refers to the radical -SH.

"Thioalkyl," as used herein refers to a - S-alkyl group.

"Cyano," as used herein refers to a -CN group.

"Carbonyl," as used herein refers to a divalent group of the formula -C(=O)-.

"Carboxyl," as used herein refers to a -C(=O)OH group.

"Nitro," as used herein is intended to mean the radical -NO₂.

"Amine," or "amino group," is intended to mean the radical -NH₂.

"Substituted amino," or "substituted amine," refers to an amino group, wherein one or two of the hydrogens is replaced by a suitable substituent. Disubstituted amines may have substituents that are bridging, i.e., form a heterocyclic ring structure that includes the amine nitrogen as the linking atom to the parent compound. Examples of substituted amino include but are not limited to alkylamino, dialkylamino, and heterocyclo (where the heterocyclo is linked to the parent compound by a nitrogen atom in the heterocyclic ring or heterocyclic ring system).

"Alkylamino," is intended to mean the radical -NHR', where R' is alkyl.

"Dialkylamino," is intended to mean the radical NR'R", where R' and R" are each independently an alkyl group.

"Aminoalkyl," refers to an alkyl substituent which is further substituted with one or more amino groups.

"Cleavable linker" as used herein refers to a linker that can be degraded or otherwise severed to separate the two substrates connected by the cleavable linker. The cleavable linker may be part of one of the substrates it is linking together, a modification of one of the substrates it is linking together, or an additional moiety. The cleavable linkers of the present invention can be cleaved by enzymes such as peptidases, proteases, nucleases, lipases; sequence specific restriction enzymes; and the like. A cleavable linker may be susceptible to a chemical agent and may dissociate, hydrolyze, or cleave when contacted with the chemical agent. Cleavable linkers may also be cleaved by environmental cues, such as, for example, changes in temperature, H, salt concentration, when there is such a change in environment following endocytosis, or by being exposed to energy. Examples of forms of energy which may be used include light, microwave, ultrasound, and radiofrequency. Suitable linkers include those described in U.S. Patent Nos. 7,678,378; 7,666,991 ; and 7,604,996, which are incorporated herein by reference.

"Oligonucleotide" or "Oligo" herein refers to polymers of deoxyribonucleotides or ribonucleotides in either single- or double-stranded form. The term encompasses nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, which have similar binding properties as the reference nucleic acid. Examples of such analogs include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2-O-methyl ribonucleotides, peptide-nucleic acids (PNAs). The oligonucleotide may be of any suitable length, e.g., from 3, 5, 8 or 10 nucleotides in length, up to 50, 60, 80 or 100 nucleotides in length. Suitable oligonucleotides include, but are not limited to, short hairpin RNA (shRNA), microRNAs, antisense oligonucleotides, small double stranded interference RNA (siRNA)s, and ribozymes.

2. Ligands.

As noted above, the present invention preferably utilizes ligands (preferably small organic molecules) to membrane bound proteins such as G-protein coupled receptors. Numerous ligands for such proteins and receptors are known which can be used to carry out the present invention.

Integral membrane proteins include transmembrane proteins and integral monotopic proteins. Transmembrane proteins can be classified as single-pass membrane proteins, which cross the membrane only once, or multi-pass membrane proteins, which cross the membrane several times. Many transmembrane proteins associate with other transmembrane proteins to form larger complexes. Such complexes may be comprised of two identical subunits (such as homodimers) or two different protein subunits (such as heterodimers). There are examples of even larger complexes of three (sodium ion channel, Na⁺/K⁺ ATPase), four (aquaporin), five (cation channels of nicotinic receptors, anion channels of glycine receptors) or more (photoreaction center, mitochondrial respiratory chain) homologous or heterologous subunits. Transmembrane proteins contribute to a wide variety of cellular functions, including the transport of molecules and ions into or out of cells, cell recognition, cell-to-cell communication, and cell adhesion.

Exemplary single-pass proteins include, but are not limited to, cell surface receptor proteins, such as the EGF receptor which binds epidermal growth factor, and integrins and cadherins, which function in cell-cell communication via binding to extracellular molecules. Additional single-pass proteins include, but are not limited to, receptor guanylyl cyclases, such as the sperm receptor; receptor tyrosine kinases, such as the EGF receptor; protein tyrosine phosphatases, such as CD45; integrins, such as alpha, beta chains; cadherins, such as E-cadherin; and 1 -transmembrane receptors for growth hormone, insulin, TNF-a, glutamic acid and the like.

Exemplary multi-pass proteins include, but are not limited to, chemotaxis receptors; potassium channels, such as the Kcs K channel; connexins; photosynthetic reaction center, such as the L and M subunits; voltage-gated K⁺ channels, such as the Shaker protein; G- coupled receptors, such as transducin, chemokine receptors, and acetylcholine receptors; ion pumps, such as Ca⁺² pump catalytic subunit, and Na⁺/K⁺ pump catalytic subunit; CIC channels, such as CIC-1 of skeletal muscle; ABC transporters, such as MDR ATPase, peptipe pumps, and CFTR, anion transporters, such as Band 3 protein; 7-transmembrane receptor proteins for hormone, odor, taste, light and the like; LDL receptors; scavenger receptors; ion channel receptors, such as GABA, acetylcholine and ryanodine; T cell receptors; Fc receptors; envelope proteins, such as lentiviral proteins from human immunodeficiency virus (HIV), feline immunodeficiency virus (FIC), or visna virus; and porins.

Integral monotopic proteins are proteins that are permanently attached to one side of the membrane. Exemplary integral monotopic proteins include, but are not limited to, prostaglandin H2 synthase- 1 and 2, prostaglandin E synthase, carnitine O- palmitoyltransferase 2, cyclooxygenase-2, squalene-hopene cyclase, lanosterol synthase, monoamine oxidase A, monoamine oxidase B, fatty acid amide hydrolase, sulfide :quinone oxidoreductase, electron transfer flavoprotein-ubiquinone oxidoreductase, peptidoglycan glycosyltransferase, signal peptidase, signal peptide peptidase, glycerol-3 -phosphate dehydrogenase, ADP-ribosylation factor, and RPE65 visual cycle retinoid isomerase. Peripheral membrane proteins are proteins that temporarily adhere to the membrane. Examples of peripheral membrane proteins include, but are not limited to glycolipid transfer proteins, lipocalins, polyisoprenoid-binding protein, ganglioside GM2 activator proteins, sterol carrier proteins, cytochrome c, cupredoxins, adrenodoxin reductase, phospholipase C, phospholipase A2, cholesterol oxidases, and carotenoid oxygenase.

Examples of receptor proteins include, but are not limited to G protein-coupled receptors, ion-channel receptors, tyrosine kinase-linked receptors, receptor tyrosine kinases, cytokine receptors, and receptors with intrinsic enzymatic activity.

G-protein coupled receptors are a large class of cell surface receptors that span the membrane seven times. Exemplary G-protein coupled receptors include, but are not limited to, secretin and secretin-like receptors, glutamate receptors, pheromone receptors, fungal mating pheromone receptors, cyclic AMP receptors, frizzled receptors, smoothened receptors, calcitonin receptors, A2A adenosine receptor, βΐ and p2-adrenergic receptor, STE2 receptor, cholecystokinin A receptor, melanocortin-4 receptor, muscarinic acetylcholine receptor, dopamine 2 receptor, chemokine receptor CCR5, histamine 2 receptor, serotonin 4 receptor, prostaglandin receptor, serotonin 1A/1D and 2A/2C receptor, neurotensin 1 and 2 receptors, opioid receptors (mu, delta, kappa, ORL-1), dopamine 2/3 receptors, opsins, 5- hydroxy tryptamine 1 A receptor, and rhodopsin and rhodopsin-like receptors. Other suitable G-protein coupled receptors include those described in U.S. Patent Nos. 7,682,802; 7,329,509; 7,083,958; and 6,761,902, which are incorporated herein by reference.

Generally, a particular G-protein coupled receptor can couple to one or more trimeric G proteins in a particular cell line. The binding affinities of agonists to a G-protein coupled receptor depend on the coupling state of the receptor with its G proteins. Compounds that bind with a receptor might have different functionalities, such as agonism, antagonism, super- agonism or inverse agonism. The binding sites involved might be different for different compounds binding to the same receptor. Other suitable ligands for G-protein coupled receptors include those described in U.S. Patent Nos. 7,223,533; 7,678,808; 7,682,802; 7,083,958; 7,329,509; and Morris, A. J., and Malbon, C. C, "Physiological Regulation of G- Protein-linked Signaling," Physiol. Rev., 1999, 79, 1373-1430, which are incorporated herein by reference.

Specific examples of G protein-coupled receptor proteins (parenthesized are exemplary ligands) include, but are not limited to, as follows: (1) The rhodopsin/β adrenaline receptor-like G protein-coupled receptor proteins, which include, but are not limited to BLT1 (leucotriene B₄), ET_A and ET_B (encloserine), ATI (angiotensin), EDG (sphingosine phosphate), CCR and CXCR (chemokine), α₁, α₂, β_1; β₂ and β₃ (norepinephrine), M_1; M₂ and M₃ (acetylcholine), 5-HTi_A (serotonin), NK-1 (substance P), Yi (neuro-peptide Y), B₁ and B₂ (bradykinin), VIA (basopressin), CB1 and CB2 (anandamide), Dl, D2 and D3 (dopamine), odor receptors, MT1, MT2, and MT3 (melatonin), and photoreceptors.

(2) The glucagon/VIP (vasoactive intestinal peptide)/calcitonin receptor-like G protein-coupled receptor proteins, which include, but are not limited to calcitonin receptors (calcitonin), VIP1, VIP2 (vasoactive intestinal peptide), CRF1 (corticotropin-releasing factor), and PTH receptors (parathormone).

(3) The metabolic neurotransmitter/calcium receptor-like G protein-coupled receptor proteins, which include, but are not limited to mgluj, mglu₂ (glutamic acid), GABAB (γ- amino butyric acid), and taste receptors. Other metabolic neurotransmitter/calcium receptorlike G protein-coupled receptor proteins and their ligands include those described in Gether, U. Uncovering molecular mechanisms involved in activation of G protein-coupled receptors. Endocrine Reviews (2000) 21, 90-113 and 1998 Receptor and Ion Channel Nomenclature Supplement, Trends in Pharmacological Science, 1998, which are incorporated herein by reference.

Ligands for G-protein coupled receptors are very diverse, and include, but are not limited to proteins; purines and nucleotides, such as adenosine, cAMP, ATP, UTP, ADP, melatonin and the like; biogenic amines (and related natural ligands), such as 5- hydroxytryptamine, acetylcholine, dopamine, adrenaline, histamine, noradrenaline, tyramine/octopamine and other related compounds; peptides such as adrenocorticotrophic hormone (acth), melanocyte stimulating hormone (msh), melanocortins, neurotensin (nt), bombesin and related peptides, endothelins, cholecystokinin, gastrin, neurokinin b (nk3), invertebrate tachykinin-like peptides, substance k (nk2), substance p (nkl), neuropeptide y (npy), thyrotropin releasing-factor (trf), bradykinin, angiotensin ii, beta-endorphin, c5a anaphalatoxin, calcitonin, chemokines (also called intercrines), corticotrophic releasing factor (erf), dynorphin, endorphin, finlp and other formylated peptides, follitropin (fsh), fungal mating pheromones, galanin, gastric inhibitory polypeptide receptor (gip), glucagon-like peptides (glps), glucagon, gonadotropin releasing hormone (gnrh), growth hormone releasing hormone(ghrh), insect diuretic hormone, interleukin-8, leutropin (lh/hcg), met-enkephalm, opioid peptides, oxytocin, parathyroid hormone (pth) and pthrp, pituitary adenylyl cyclase activating peptide (pacap), secretin, somatostatin, thrombin, thyrotropin (tsh), vasoactive intestinal peptide (vip), vasopressin, vasotocin; eicosanoids such as ip-prostacyclin, pg- prostaglandins, a-thromboxanes; retinal based compounds such as vertebrate 11-cis retinal, invertebrate 11-cis retinal and other related compounds; lipids and lipid-based compounds such as cannabinoids, anandamide, lysophosphatidic acid, platelet activating factor, leukotrienes and the like; excitatory amino acids and ions such as calcium ions and glutamate; and small organic molecules, etc.

Exemplary small organic molecules include, but are not limited to anisamide; melatonin; haloperidol; SA4503; opipramol; buspirone hydrochloride; azapirones, such as, but not limited to, tandospirone, eptapirone, gepirone and ipsapirone; flesinoxan; 8-hydroxy- 2-dipropylaminotetralin; flibanserin; repinotan; lesopitron; piclozotan; aripiprazole; vilazodone; sarizotan; roxindole; roxindole methanesulfonate; alnespirone; bromerguride; xaliproden; mazapertine succinate; mazapertine; ziprasidone; sunepitron; umespirone; bifeprunox; zalospirone; substituted benzamides, such as, but not limited to, cisapride, mosapride, and renzapride; benzofuran derivatives, such as prucalopride; indoles, such as, but not limited to tegaserod, or benzimidazolones; zacopride; metoclopramide; metoclopramide dihydrochloride; metoclopramide hydrochloride; 5-methoxytryptamine; 2-[l-(4- piperonyl)piperazinyl] benzothiazole; norcisapride; mosapride citrate; zacopride hydrochloride; mezacopride; aminomethylazaadamantane; metoclopramide; 5- methoxytryptamine; azasetron; ondansetron; ondansetron hydrochloride; cilansetron; aloxi or palonosetron hydrochloride; palenosetron; cisplatin; lotronex or alosetron hydrochloride; anzemet or dolasetron mesylate; zacopride or R-zacopride; ramosetron hydrochloride; marinol or dronabinol; lac hydrin or ammonium lactate; kytril or granisetron hydrochloride; bemesetron; tropisetron; zatosetron; mirisetron; mirisetron maleate; ketanserin; ketanserin tartrate; risperidone; olanzapine; adatanserin; ritanserin; etoperidone; nefazodone; deramciclane; geoden or ziprasidone hydrochloride; zeldox hydrochloride; effexor XR (venlafaxine formulation); zomaril or iloperidone; quetiapine or quetiapine fumarate; seroquel; tonabersat; sertindole; eplivanserin or eplivanserin fumarate; lubazodone hydrochloride; cyproheptadine; pizotyline or pizotifen; mesulergine; irindalone; pruvanserin; m-chlorophenylpiperazine; clozapine or its metabolite N-desmethylclozapine; olanzapine; fluperlapine; clomipramine; amitriptyline; doxepin; nortryptyline; 5-methoxytryptamine; bromocryptine; octoclothepin; chlorpromazine; loxapine; fluphenazine; etc. Other exemplary small organic molecules include those described in U.S. Patent No. 7,678,808, which is incorporated herein by reference.

3. Methods of Making.

Solid phase chemical synthesis of oligonucleotides is routinely performed using protected nucleoside phosphoramidites. "Phosphoramidite" as used herein refers to a trivalent phosphorus group typically used in oligonucleotide synthesis. Detailed descriptions of the chemistry used to form oligonucleotides by the phosphoramidite method are provided in Caruthers et al., U.S. Pat. Nos. 4,458,066 and 4,415,732; Caruthers et al., Genetic Engineering, 4:1-17 (1982); Users Manual Model 392 and 394 Polynucleotide Synthesizers, pages 6-1 through 6-22, Applied Biosystems, Part No. 901237 (1991), each of which are incorporated by reference in their entirety. Labeled oligonucleotides can be synthesized enzymatically, e.g., using a DNA polymerase or ligase, e.g., Stryer, Biochemistry, Chapter 24, W. H. Freeman and Company (1981), or by chemical synthesis, e.g., by a phosphoramidite method, a phosphite-triester method, and the like, e.g., Gait, OLIGONUCLEOTIDE SYNTHESIS, IRL Press (1990). Labels can be introduced during enzymatic synthesis utilizing labeled nucleoside triphosphate monomers, or introduced during chemical synthesis using labeled non-nucleotide or nucleotide phosphoramidites, or may be introduced subsequent to synthesis,

A typical phosphoramidite reagent used in oligonucleotide synthesis is represented by the structure below:

Z— P(R²⁰)(NR²¹R²²), wherein: Z is the nucleotide or conjugated ligand to be added by the synthesis, R²⁰ is selected from the group consisting of— OCH₂CH₂CN,— SCH₂CH₂CN, a substituted or unsubstituted aliphatic group,—OR²³,— SR²³,— O— CH₂C¾— Si(CH₃)₂C₆H₅,— O— CH₂CH₂— S(O)₂— CH₂CH₃, — O— CH₂CH₂— C₆H— NO₂, — S— CH₂C¾— Si(CH₃)₂C₆H₅, — S— CH₂CH₂— S(O)₂— CH2CH₃, or— S— CH₂CH₂— C₆H₄— NO₂, where R²³ is an optionally substituted aliphatic group, an optionally substituted aryl group or an optionally substituted aralkyl group, and R²¹ and R²² are each independently selected from the group consisting of a substituted or unsubstituted aliphatic group, a substituted or unsubstituted aryl group, or a substituted or unsubstituted aralkyl, or R²¹ and R²² taken together with the nitrogen to which they are bound form a 5 or 6 member heterocyclic ring. Exemplary substituents for phosphoramidite include, but are not limited to isopropyl amine, diisopropylamine, 2- cyanoethyloxy, methoxy, and morpholine. Exemplary phosphoramidites include those described in U.S. Patent Nos. 7,671,218; 7,501,505; and 4,415,732, which are incorporated herein by reference.

One exemplary nucleoside protecting groups is dimethoxytrityl (DMTr), which is removable with an acid, such as trichloroacetic acid (TCA) or dichloroacetic acid (DCA), in an inert solvent, such as dichloromethane or toluene, as described in Khorana (1968) Pure Appl. Chem. 17:349; Smith et al. (1962) J. Am. Chem. Soc. 84:430, which is incorporated herein by reference. Other exemplary protecting groups include those described in U.S. Pat. No. 6,222,030; U.S. Pat. Appl'n Publ'n No. 2002/0058802; and Seio et al. (2001) Tetrahedron Lett. 42 (49): 8657-8660, which involve different conditions for performing reactions such as deprotection at the 3' or 5' positions and are incorporated herein by reference.

In solid phase chemical synthesis, the 3'-hydroxyl group of an initial 5'-protected nucleoside is first covalently attached to a support, such as controlled pore glass (CPG) or a polymer support, such as macroporous polystyrene (MPPS), by methods known in the art. Synthesis of the oligonucleotide then proceeds by deprotection of the 5'-hydroxyl group of the attached nucleoside, followed by coupling of an incoming nucleoside-3 '-phosphoramidite to the deprotected hydroxyl group, such as described in Matteucci et al. (1981) J. Am. Chem. Soc. 103 :3185, which is incorporated herein by reference. Deprotection is generally accomplished by treating the 5 '-hydroxyl group with a protic acid in a solvent, and, optionally, an additive. Exemplary protic acids include, but are not limited to formic acid, acetic acid, chloroacetic acid, dichloroacetic acid, trichloroacetic acid, trifluoroacetic acid, benzenesulfonic acid, toluenesulfonic acid, and phenylphosphoric acid. Exemplary solvents include, but are not limited to benzene, toluene, benzonitrile, o-, m- or p-xylene, mesitylene, and diphenyl ether. To allow for coupling, the incoming nucleoside-3 '-phosphoramidite is activated with an activating compound, such as an acidic azole catalyst, tetrazole, 2- ethylthiotetrazole, 2-bezylthiotetrazole, 4,5-dicyanoimidazole, or the like. The coupling reaction can take from about 10 seconds to about 30 minutes, from about 20 seconds to about 20 minutes, from about 30 seconds to about 15 minutes.

The resulting phosphite triester is oxidized to a phosphorotriester to complete one round of the synthesis cycle, such as described in Letsinger et al. (1976) J. Am. Chem. Soc. 98:3655, which is incorporated herein by reference. The oxidation step generally comprises treating the phosphite triester with iodine and water in the presence of a weak base, such as pyridine, lutidine, or collidine. The steps of deprotection, coupling and oxidation are repeated until an oligonucleotide of the desired length and sequence is obtained.

Optionally, after the coupling step, the product may be treated with a capping agent designed to esterify failure sequences and cleave phosphite reaction products on the heterocyclic bases. Capping can generally be accomplished by acetylation of the unreacted 5 '-hydroxy groups using a mixture of acetic anhydride and 1-methylimidazole as a catalyst. Excess reagents can be removed by washing the support.

Once the desired oligonucleotide is synthesized it can then be released from the support. Various methods of releasing the oligonucleotide from the support are known in the art. The release step yields the polynucleotide in solution, which may then be separated from the solid support, e.g. by filtration or other suitable methods. Additional methods for solid- phase synthesis may be found in Caruthers U.S. Pat. Nos. 4,415,732; 4,458,066; 4,500,707; 4,668,777; 4,973,679; and 5,132,418; and Koster U.S. Pat. No. 4,725,677 and Re. 34,069, which are incorporated herein by reference.

As will be recognized by those of skill in the art, oligonucleotides may be synthesized according to the present methods, not only via the batch and/or continuous processes, but also using automated oligonucleotide synthesis techniques, as described, for example, in Applied BioSystems User's Manual for Models 392 and 394 DNA/RNA Synthesizers; Section 6 Chemistry for Automated DNA/RNA Synthesis (March 1994) and M. J. Gait, "Oligonucleotide Synthesis, A Practical Approach", IRL Press at Oxford University Press (1984, ISBN 0-904147-74-6), which are incorporated herein by reference. In such embodiments, a nucleoside and/or oligonucleotide hydroxyl-containing compound is immobilized on a solid support and reacted within an automated DNA Synthesizer with a nucleoside phosphitylating agent in the presence of a phosphitylation activator to form an oligonucleotide. A specified number and sequence of phosphitylation reactions may be conducted to produce oligonucleotides comprising different lengths and sequences of nucleosides according to the present invention.

According to the methods of the present invention, when an oligonucleotide of the desired length and sequence has been obtained a compound of Formula II is coupled with the oligonucleotide using the solid phase synthesis methods discussed above to produce an oligonucleotide conjugate. In some embodiments, the oligonucleotide conjugate is optionally oxidized. In some embodiments, additional compounds of Formula II are coupled to the oligonucleotide conjugate according to the solid phase synthesis methods discussed above. When the desired oligonucleotide conjugate is obtained, in some embodiments, the oligonucleotide conjugate is cleaved from the solid support. In some embodiments, the oligonucleotide conjugate is purified once cleaved using methods of purification that are known in the art.

In some embodiments a phosphorotioate backbone is introduced into the oligonucleotide sequence. Other modifications of the oligonucleotide sequence are known in the art.

Thus the present invention employs a phosphor amidite group covalently coupled to a ligand for a membrane bound protein, preferably through a linking group. The linking group preferably comprising a substituted or unsubstituted aliphatic group, or a substituted or unsubstituted aliphatic oxide group. As noted above, in some embodiments such compounds have a structure of Formula II:

L— R— O— P(R²⁰)(NR²¹R²²), (II)

wherein:

L is a ligand for a membrane bound protein,

R²⁰ is selected from the group consisting of — OCH₂CH₂CN,— SCH₂CH₂CN, a substituted or unsubstituted aliphatic group, — OR²³, — SR²³, — O— CH₂CH₂— Si(CH₃)₂C₆H₅, — O— CH₂CH₂— S(O)₂— CH₂CH₃, — O— C¾CH₂— C₆H₄— NO₂, — S— CH₂CH₂— Si(CH₃)₂C₆H₅, — S—CH₂CH₂— S(O)₂— CH₂CH₃, and — S— CH₂CH₂— C₆H₄— NO₂, where R²³ is a substituted or unsubstituted aliphatic group, a substituted or unsubstituted aryl group or a substituted or unsubstituted aralkyl group, and

R²¹ and R²² are each independently selected from the group consisting of a substituted or unsubstituted aliphatic group, a substituted or unsubstituted aryl group, and a substituted or unsubstituted aralkyl, or R²¹ and R²² taken together with the nitrogen to which they are bound form a 5 or 6 member heterocyclic ring. One example is a compound having the structure:

The present invention thus provides a process for making an oligonucleotide gate. The process generally comprises:

a) deprotecting the 5'-hydroxyl group of an oligonucleotide,

b) activating the 3' end of a compound having a structure of Formula II:

L— R— O— P(R )(NR R ), (II)

wherein:

L is a ligand for a membrane bound protein,

R²⁰ is selected from the group consisting of — OCH₂CH₂CN,— SCH₂CH₂CN, a substituted or unsubstituted aliphatic group, — OR , — SR , — O— CH₂CH₂— Si(CH₃)₂C₆H₅, — 0—CH₂CH₂— S(O)₂— CH₂CH₃, — O— CH₂C¾— C₆H₄— NO₂, — S— CH₂CH₂— Si(CH₃)₂C₆H₅, — S— CH₂CH₂— S(O)₂— CH₂CH₃, and — S— CH₂CH₂— C₆H₄— NO₂, where R²³ is a substituted or unsubstituted aliphatic group, a substituted or unsubstituted aryl group or a substituted or unsubstituted aralkyl group, and

c) coupling the compound of Formula II with the oligonucleotide to produce an oligonucleotide conjugate.

In some embodiments of the foregoing, the oligonucleotide comprises a multi-valent linking group at the 5' end of the oligonucleotide. In some embodiments, the multi-valent linking group is tri-valent and the oligonucleotide attached to the linking group has the structure:

where R³ is a covalent bond or a cleavable linlcer, R⁴ and R⁵ are unsubstituted or substituted aliphatic groups or unsubstituted or substituted aliphatic oxide groups, and each R¹⁰, R¹¹, and R¹² is independently— R¹³— , where R¹³ is an unsubstituted or substituted aliphatic group or an unsubstituted or substituted aliphatic oxide group.

Some embodiments of the foregoing further comprise coupling the oligonucleotide conjugate with at least one compound of Formula II by

d) deprotecting the 5'-hydroxyl group of the oligonucleotide conjugate,

e) activating the 3 ' end of the compound of Formula II,

f) coupling the compound of Formula II with the oligonucleotide conjugate to produce an oligonucleotide conjugate that has the structure:

L— R— O— P(=O)(X)— O— R¹⁴— C(R¹⁵— L )— O— P(=O)(X)— O— R³— Oligo, wherein:

L is a ligand for a membrane bound protein,

X is O or S,

R¹⁴ and R¹⁵ are unsubstituted or substituted aliphatic groups or unsubstituted or substituted aliphatic oxide groups,

R³ is a covalent bond or a cleavable linker, and

Oligo is an oligonucleotide from 3 to 100 nucleotides in length, and then

g) optionally repeating steps d), e), and f) until the desired number of ligands are attached to the oligonucleotide.

In some embodiments, the coupling comprises solid phase synthesis.

In some embodiments, the method further comprises capping unreacted 5'-hydroxyl groups of the oligonucleotide conjugate. In some embodiments, the method further comprises deprotecting the oligonucleotide conjugate.

In some embodiments, the method further comprises cleaving said oligonucleotide conjugate from a support.

In some embodiments, the method further comprises purifying the oligonucleotide conjugate.

4. Oligonucleotide Compounds (Active Compounds).

As noted above, the present invention provides oligonucleotides covalently coupled to at least one ligand for a membrane bound protein. The ligand is preferably so coupled through a linking group. The linking group preferably comprising a phosphate group covalently coupled to a substituted or unsubstituted aliphatic group or a substituted or unsubstituted aliphatic oxide group. The compounds may be provided as salts, including pharmaceutically acceptable salts, thereof. In some embodiments, the compound is a compound of Formula I:

(A)_n-B (I) wherein:

B is selected from the group consisting of

a)— R— Oligo, where R is a covalent bond or a cleavable linker,

where R³ is a covalent bond or a cleavable linker, R⁴ and R⁵ are unsubstituted or substituted aliphatic groups or unsubstituted or substituted aliphatic oxide groups, and each R¹⁰, R¹¹, and R¹² are H or— R¹³— , where R¹³ is an unsubstituted or substituted aliphatic group or an unsubstituted or substituted aliphatic oxide group, subject to the proviso that at least 1 or 2 of R¹⁰, R¹¹, and R¹² are not H, and c) (— R¹⁴— C(R¹⁵— L )— O— P(=O)(X)— 0)_m— R³— Oligo, where R¹⁴ and R¹⁵ are unsubstituted or substituted aliphatic groups or unsubstituted or substituted aliphatic oxide groups, L is a ligand for a membrane bound protein, X is O or S, m is 1 to 15, and R³ is a covalent bond or a cleavable linker,

wherein Oligo is an oligonucleotide from 3 to 100 nucleotides in length, and n is 1 to

3.

In some embodiments, the compound has the structure:

L—R—0—P(=O)(X)—0—R³— Oligo,

wherein:

L is a ligand for a membrane bound protein,

X is O or S,

R³ is a covalent bond or a cleavable linker, and

Oligo is an oligonucleotide from 3 to 100 nucleotides in length.

In some embodiments, the compound has the structure:

L— R— O— P(=O)(X)— O— R¹⁰ L— R— O— P(=O)(X)— O— R¹¹— C— R⁵— R³— R⁴— R³— Oligo, L— R— O— P(=O)(X)— O— R¹² wherein:

L is a ligand for a membrane bound protein,

X is O or S,

R³ is a covalent bond or a cleavable linker,

R⁴ and R⁵ are unsubstituted or substituted aliphatic groups or unsubstituted or substituted aliphatic oxide groups, 10 1 1 19 1 ^*¾ 1 "

R'", R , and R¹ are— R — , where R is an unsubstituted or substituted aliphatic group or an unsubstituted or substituted aliphatic oxide group, and

Oligo is an oligonucleotide from 3 to 100 nucleotides in length.

In some embodiments, the compound has the structure:

L— R— O— P(=O)(X)— O— (R¹⁴— C(R¹⁵— L )— O— P(=O)(X)— 0)_m— R³— Oligo, wherein:

L is a ligand for a membrane bound protein,

X is O or S,

m is 1 to 15,

R is a covalent bond or a cleavable linker, and

Oligo is an oligonucleotide from 3 to 100 nucleotides in length.

The compounds may optionally incorporate a cleavable linker. Cleavable linkers of the present invention include, but are not limited to, cleavable linkers that may be cleaved by reduction of a disulfide bond, by irradiation of a photolabile bond, by hydrolysis of derivatized amino acid side chain, by serum complement-mediated hydrolysis, or by acid- catalyzed hydrolysis.

The cleavable linker may be a disulfide linker. Examples of disulfide linkers include, but are not limited to, those that can be formed using SATA (N-succinimidyl-S- acetylthioacetate), SPDP (N-succinimidyl-3-(2-pyridyldithio)propionate), SPDB (N- succinimidyl-3-(2-pyridyldithio)butyrate) and SMPT (N-succinimidyl-oxycarbonyl-alpha- methyl-alpha-(2-pyridyl-dithio)toluene), SPDB and SMPT. Suitable disulfide linkers include those described in Thorpe et al, 1987, Cancer Res. 47:5924-5931 ; Wawrzynczak et al., In Immunoconjugates: Antibody Conjugates in Radioimagery and Therapy of Cancer C. W. Vogel ed., Oxford U. Press, 1987; and U.S. Pat. No. 4,880,935, which are incorporated herein by reference. In some embodiments of the present invention the cleavable linker comprises a disulfide linker. In some embodiments the conjugated oligonucleotide has a cleavable disulfide linker and has the following structure: L—R—0—P(-0)(X)—0—(CH₂)₆—S—S—(CH₂)₆— Oligo, wherein:

L is a ligand for a membrane bound protein,

X is O or S, and

Oligo is an oligonucleotide from 3 to 100 nucleotides in length.

Particular examples of the foregoing include, but are not limited to:

wherein n is from 1 to 12, X is a covalent bond or a cleavable linker, and Oligo is an oligonucleotide from 3 to 100 nucleotides in length,

or a salt, including pharmaceutically acceptable salts, thereof,

As noted above, in some embodiments the compounds incorporate a cleavable linker. The cleavable linker may be a photolabile linker, Examples of photolabile linkers include those linkers described in U.S. Pat. No. 5,767,288 and U.S. Pat. No. 4,469,774, which are incorporated herein by reference. The linker may also be an acid labile linker. Examples of acid labile linkers include linkers formed by using cis-aconitic acid, cis-carboxylic alkatriene, polymaleic anhydride, and other acid labile linkers, such as those linkers described in U.S. Pat. Nos. 5,563,250; 5,505,931 ; 5,122,368; 5,824,805; 5,622,929; Dubowchik and Walker, 1999, Pharm. Therapeutics 83 :67-123; and Neville et al, 1989, Biol. Chem. 264: 14653- 14661, which are incorporated herein by reference. The cleavable linker may be a peptide linker cleavable by an intracellular protease, such as lysosomal protease or an endosomal protease. The cleavable linker may be a dipeptide linker, such as a valine-citrulline (val-cit) or a phenylalanine-lysine (phe-lys) linker. Other suitable linkers include, but are not limited to, linkers hydrolyzable at a pH of less than 5.5, such as a hydrazone linker. Other hydrolyzable linkers include, but are not limited to, a thioether linker, such as, e.g., a thioether attached to the therapeutic agent via an acylhydrazone bond. Other suitable cleavable linkers include, but are not limited to, those described in U.S. Pat. Nos. 5,622,929 and 7,662,387, which are incorporated herein by reference.

Further examples of cleavable linkers include, but are not limited to, the linkers described in Lin, et al., J. Org. Chem. 56:6850-6856 (1991); Ph.D. Thesis of W.-C. Lin, U. C. Riverside, (1990); Hobart, et al, J. Immunological Methods 153: 93-98 (1992); Jayabaskaran, et al, Preparative Biochemistry 17(2): 121-141 (1987); Mouton, et al., Archives of Biochemistry and Biophysics 218: 101-108 (1982); Funkakoshi, et al, J. of Chromatography 638:21-27 (1993); Gildea, et al., Tetrahedron Letters 31 : 7095-7098 (1990); WO 85/04674; and Dynabeads (Dynal, Inc., 5 Delaware Drive, Lake Success, N.Y. 11042) , which are incorporated herein by reference.

In some embodiments of the present invention the oxygen atom shown can be part of the cleavable linker or part of the oligonucleotide, as one skilled in the art would recognize.

The active compounds disclosed herein can, as noted above, be prepared in the form of their salts, including pharmaceutically acceptable salts. Pharmaceutically acceptable salts are salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects. Examples of such salts are (a) acid addition salts formed with inorganic acids, for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like; and salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p- toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid, and the like; (b) salts formed from elemental anions such as chlorine, bromine, and iodine, and (c) salts derived from bases, such as ammonium salts, alkali metal salts such as those of sodium and potassium, alkaline earth metal salts such as those of calcium and magnesium, and salts with organic bases such as dicyclohexylamine and N-methyl-D-glucamine.

Any suitable oligonucleotide may be employed, including but not limited to those described in US Patent No. 7,674,778, the disclosure of which is incorporated by reference herein in its entirety.

The oligonucleotide may include chemical modifications. Specific oligonucleotide chemical modifications are described below. It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the following modifications may be incorporated in a single siRNA compound or even in a single nucleotide thereof.

Some modified internucleoside linkages or backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalklyphosphotriesters, and boranophosphates having normal 3 -5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3 -5' to 5'-3' or 2'-5' to 5 -2'. Various salts, mixed salts and free-acid forms are also included. Representative United States Patents that teach the preparation of the above phosphorus atom-containing linlcages include, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301 ; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821 ; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361 ; 5,625,050; and 5,697,248, each of which is herein incorporated by reference. Preferred modified internucleoside linkages or backbones that do not include a phosphorus atom therein (i.e., oligonucleosides) have backbones that are formed by short chain alkyl or cycloalkyl intersugar linkages, mixed heteroatom and alkyl or cycloalkyl intersugar linkages, or one or more short chain heteroatomic or heterocyclic intersugar linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH.sub.2 component parts. Representative United States patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, each of which is herein incorporated by reference.

In other oligonucleotide mimetics, both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleoside units are replaced with novel groups. The nucleobase units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligonucleotide, an oligonucleotide mimetic, that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of an oligonucleotide is replaced with an amide-containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to atoms of the amide portion of the backbone. Representative United States patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331 ; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found in Nielsen et al., Science, 1991, 254, 1497.

5. Compositions.

The invention pertains to uses of the above-described active agents for methods and treatments as described below. Accordingly, the modulators of the present invention can be incorporated into pharmaceutical compositions suitable for administration. See, e.g., US Patent No. 7,459,547. Such compositions typically comprise the nucleic acid molecule, protein, antibody, or modulatory compound and a pharmaceutically acceptable carrier. As used herein the language "pharmaceutically acceptable carrier" is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.

A pharmaceutical composition of the invention is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, intraperitoneal, intramuscular, oral (e.g., inhalation), transdermal (topical), and transmucosal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.

Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL.TM. (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absoiption, for example, aluminum monostearate and gelatin.

Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.

For administration by inhalation, the compounds are delivered in the form of an aerosol spray from pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer.

Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.

The compounds can also be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.

In one embodiment, the active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.

It is especially advantageous to formulate oral or parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the invention are dictated by and directly dependent on the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment of individuals.

Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Compounds that exhibit large therapeutic indices are preferred. Although compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.

The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the EC 50 (i.e., the concentration of the test compound which achieves a half-maximal response) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography.

The pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration.

6. Methods of use.

As noted above, a further aspect of the invention is a method of introducing an oligonucleotide of interest into a cell, comprising contacting a compound as described above (that is, an oligonucleotide covalently coupled to at least one ligand for a membrane bound protein) to the cell in an amount effective to introduce said oligonucleotide into said cell. The method may be carried out in vitro or in vivo with any type of cell, including prokaryotic and eukaryotic cells, and plant, animal, or bacterial cells. Animal cells may be mammalian cells, such as human, monkey, cat, dog, rat, mouse, or rabbit cells. The methods may be utilized for any purpose in which it is desired to introduce an oligonucleotide into a cell, including but not limited to those olgioncucleotides (including polynucleotides and RNAi agents) for those purposes described in US Patents Nos. 7,682,626; 7,674,778; 7,473,419; 7,459,547; and 7,015,040, the disclosures of which are incorporated by reference herein in their entirety.

The compounds of the invention may be used to deliver the oligonucleotides for and for silencing (in whole or part) the genes described in US Patent No. 7,674,778, the disclosure of which is incorporated by reference herein in its entirety. Thus, one aspect of the invention relates to a method of treating a subject at risk for or afflicted with unwanted cell proliferation, e.g., malignant or nonmalignant cell proliferation. The method comprises providing a ligand-conjugated oligonucleotide agent, wherein the oligonucleotide is homologous to and can silence, e.g., by cleavage, a gene which promotes unwanted cell proliferation; and administering a therapeutically effective dose of the ligand- conjugated oligonucleotide agent to a subject, preferably a human subject.

In an embodiment the gene is a growth factor or growth factor receptor gene, a kinase, e.g., a protein tyrosine, serine or threonine kinase gene, an adaptor protein gene, a gene encoding a G protein superfamily molecule, or a gene encoding a transcription factor.

In an embodiment the oligonucleotide agent silences the PDGF beta gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted PDGF beta expression, e.g., testicular and lung cancers.

In an embodiment the oligonucleotide agent silences the Erb-B gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted Erb-B expression, e.g., breast cancer.

In an embodiment the oligonucleotide agent silences the Src gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted Src expression, e.g., colon cancers.

In an embodiment the oligonucleotide agent silences the CRK gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted CRK expression, e.g., colon and lung cancers.

In an embodiment the oligonucleotide agent silences the GRB2 gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted GRB2 expression, e.g., squamous cell carcinoma.

In an embodiment the oligonucleotide agent silences the RAS gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted RAS expression, e.g., pancreatic, colon and lung cancers, and chronic leukemia.

In an embodiment the oligonucleotide agent silences the MEKK gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted MEKK expression, e.g., squamous cell carcinoma, melanoma or leukemia.

In an embodiment the oligonucleotide agent silences the JNK gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted JNK expression; e.g., pancreatic or breast cancers. In an embodiment the oligonucleotide agent silences the RAF gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted RAF expression, e.g., lung cancer or leukemia.

In an embodiment the oligonucleotide agent silences the Erkl/2 gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted Erkl/2 expression, e.g., lung cancer.

In an embodiment the oligonucleotide agent silences the PCNA(p21) gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted PCNA expression, e.g., lung cancer.

In an embodiment the oligonucleotide agent silences the MYB gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted MYB expression, e.g., colon cancer or chronic myelogenous leukemia.

In an embodiment the oligonucleotide agent silences the c-MYC gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted c-MYC expression, e.g., Burkitt's lymphoma or neuroblastoma.

In an embodiment the oligonucleotide agent silences the JUN gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted JUN expression, e.g., ovarian, prostate or breast cancers.

In an embodiment the oligonucleotide agent silences the FOS gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted FOS expression, e.g., skin or prostate cancers.

In an embodiment the oligonucleotide agent silences the BCL-2 gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted BCL-2 expression, e.g., lung or prostate cancers or Non-Hodgkin lymphoma.

In an embodiment the oligonucleotide agent silences the Cyclin D gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted Cyclin D expression, e.g., esophageal and colon cancers.

In an embodiment the oligonucleotide agent silences the VEGF gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted VEGF expression, e.g., esophageal and colon cancers.

In an embodiment the oligonucleotide agent silences the EGFR gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted EGFR expression, e.g., breast cancer. In an embodiment the oligonucleotide agent silences the Cyclin A gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted Cyclin A expression, e.g., lung and cervical cancers.

In an embodiment the oligonucleotide agent silences the Cyclin E gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted Cyclin E expression, e.g., lung and breast cancers.

In an embodiment the oligonucleotide agent silences the WNT-1 gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted WNT-1 expression, e.g., basal cell carcinoma.

In an embodiment the oligonucleotide agent silences the beta-catenin gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted beta- catenin expression, e.g., adenocarcinoma or hepatocellular carcinoma.

In an embodiment the oligonucleotide agent silences the c-MET gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted c-MET expression, e.g., hepatocellular carcinoma.

In an embodiment the oligonucleotide agent silences the PKC gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted PKC expression, e.g., breast cancer.

In an embodiment the oligonucleotide agent silences the NFKB gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted NFKB expression, e.g., breast cancer.

In an embodiment the oligonucleotide agent silences the STAT3 gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted STAT3 expression, e.g., prostate cancer.

In an embodiment the oligonucleotide agent silences the survivin gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted survivin expression, e.g., cervical or pancreatic cancers.

In an embodiment the oligonucleotide agent silences the Her2/Neu gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted Her2/Neu expression, e.g., breast cancer.

In an embodiment the oligonucleotide agent silences the topoisomerase I gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted topoisomerase I expression, e.g., ovarian and colon cancers. In an embodiment the oligonucleotide agent silences the topoisomerase II alpha gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted topoisomerase II expression, e.g., breast and colon cancers.

In an embodiment the oligonucleotide agent silences mutations in the p73 gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted p73 expression, e.g., colorectal adenocarcinoma.

In an embodiment the oligonucleotide agent silences mutations in the p21(WAFl/CIPl) gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted p21(WAFl/CIPl) expression, e.g., liver cancer.

In an embodiment the oligonucleotide agent silences mutations in the p27(KIPl) gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted p27(KIPl) expression, e.g., liver cancer.

In an embodiment the oligonucleotide agent silences mutations in the PPM1D gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted PPM1D expression, e.g., breast cancer.

In an embodiment the oligonucleotide agent silences mutations in the RAS gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted RAS expression, e.g., breast cancer.

In an embodiment the oligonucleotide agent silences mutations in the caveolin I gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted caveolin I expression, e.g., esophageal squamous cell carcinoma.

In an embodiment the oligonucleotide agent silences mutations in the MIB I gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted MIB I expression, e.g., male breast carcinoma (MBC).

In an embodiment the oligonucleotide agent silences mutations in the MTAI gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted MTAI expression, e.g., ovarian carcinoma.

In an embodiment the oligonucleotide agent silences mutations in the M68 gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted M68 expression, e.g., human adenocarcinomas of the esophagus, stomach, colon, and rectum.

In preferred embodiments the oligonucleotide agent silences mutations in tumor suppressor genes, and thus can be used as a method to promote apoptotic activity in combination with chemotherapeutics. In an embodiment the oligonucleotide agent silences mutations in the p53 tumor suppressor-gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted p53 expression, e.g., gall bladder, pancreatic and lung cancers.

In an embodiment the oligonucleotide agent silences mutations in the p53 family member DN-p63, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted DN-p63 expression, e.g., squamous cell carcinoma.

In an embodiment the oligonucleotide agent silences mutations in the pRb tumor suppressor gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted pRb expression, e.g., oral squamous cell carcinoma.

In an embodiment the oligonucleotide agent silences mutations in the APC1 tumor suppressor gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted APC1 expression, e.g., colon cancer.

In an embodiment the oligonucleotide agent silences mutations in the BRCA1 tumor suppressor gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted BRCA1 expression, e.g., breast cancer.

In an embodiment the oligonucleotide agent silences mutations in the PTEN tumor suppressor gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted PTEN expression, e.g., hamartomas, gliomas, and prostate and endometrial cancers.

In an embodiment the oligonucleotide agent silences MLL fusion genes, e.g., MLL- AF9, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted MLL fusion gene expression, e.g., acute leukemias.

In an embodiment the oligonucleotide agent silences the BCR/ABL fusion gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted BCR/ABL fusion gene expression, e.g., acute and chronic leukemias.

In an embodiment the oligonucleotide agent silences the TEL/AML1 fusion gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted TEL/AML1 fusion gene expression, e.g., childhood acute leukemia.

In an embodiment the oligonucleotide agent silences the EWS/FLI1 fusion gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted EWS/FLI1 fusion gene expression, e.g., Ewing Sarcoma. In an embodiment the oligonucleotide agent silences the TLS/FUS1 fusion gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted TLS/FUS1 fusion gene expression, e.g., Myxoid liposarcoma.

In an embodiment the oligonucleotide agent silences the PAX3/FKHR fusion gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted PAX3/FKHR fusion gene expression, e.g., Myxoid liposarcoma.

In an embodiment the oligonucleotide agent silences the AML1/ETO fusion gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted AML1/ETO fusion gene expression, e.g., acute leukemia.

Another aspect of the invention relates to a method of treating a subject, e.g., a human, at risk for or afflicted with a disease or disorder that may benefit by angiogenesis inhibition e.g., cancer. The method comprises providing a ligand-conjugated oligonucleotide agent, wherein said oligonucleotide agent is homologous to and can silence, e.g., by cleavage, a gene which mediates angiogenesis; and administering a therapeutically effective dosage of said ligand-conjugated oligonucleotide agent to a subject, preferrably a human.

In an embodiment the oligonucleotide agent silences the alpha v-integrin gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted alpha V integrin, e.g., brain tumors or tumors of epithelial origin.

In an embodiment the oligonucleotide agent silences the Flt-1 receptor gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted Flt-1 receptors, eg. Cancer and rheumatoid arthritis.

In an embodiment the oligonucleotide agent silences the tubulin gene, and thus can be used to treat a subject having or at risk for a disorder characterized by unwanted tubulin, eg. Cancer and retinal neovascularization.

Another aspect of the invention relates to a method of treating a subject infected with a virus or at risk for or afflicted with a disorder or disease associated with a viral infection. The method comprises providing a ligand-conjugated oligonucleotide agent, wherein said oligonucleotide agent is homologous to and can silence, e.g., by cleavage, a viral gene of a cellular gene which mediates viral function, e.g., entry or growth; and administering a therapeutically effective dose of said ligand-conjugated oligonucleotide agent to a subject, preferably a human subject.

Thus, the invention provides for a method of treating patients infected by the Human Papilloma Virus (HPV) or at risk for or afflicted with a disorder mediated by HPV, e.g, cervical cancer. HPV is linked to 95% of cervical carcinomas and thus an antiviral therapy is an attractive method to treat these cancers and other symptoms of viral infection.

In an embodiment, the expression of a HPV gene is reduced. In an embodiment, the HPV gene is one of the group of E2, E6, or E7.

In an embodiment the expression of a human gene that is required for HPV replication is reduced.

The invention also includes a method of treating patients infected by the Human Immunodeficiency Virus (HIV) or at risk for or afflicted with a disorder mediated by HIV, e.g., Acquired Immune Deficiency Syndrome (AIDS). In an embodiment, the expression of a HIV gene is reduced. In an embodiment, the HIV gene is CCR5, Gag, or Rev. In an embodiment the expression of a human gene that is required for HIV replication is reduced. In an embodiment, the gene is CD4 or TsglOl .

The invention also includes a method for treating patients infected by the Hepatitis B Virus (HBV) or at risk for or afflicted with a disorder mediated by HBV, e.g., cirrhosis and heptocellular carcinoma. In an embodiment, the expression of a HBV gene is reduced. In an embodiment, the targeted HBV gene encodes one of the group of the tail region of the HBV core protein, the pre-cregious (pre-c) region, or the cregious (c) region. In an embodiment, a targeted HBV-RNA sequence is comprised of the poly(A) tail.

In preferred embodiment the expression of a human gene that is required for HBV replication is reduced.

The invention also provides for a method of treating patients infected by the Hepatitis A Virus (HAV), or at risk for or afflicted with a disorder mediated by HAV. In an embodiment the expression of a human gene that is required for HAV replication is reduced.

The present invention provides for a method of treating patients infected by the Hepatitis C Virus (HCV), or at risk for or afflicted with a disorder mediated by HCV, e.g., cirrhosis. In an embodiment, the expression of a HCV gene is reduced. In an embodiment the expression of a human gene that is required for HCV replication is reduced.

The present invention also provides for a method of treating patients infected by the any of the group of Hepatitis Viral strains comprising hepatitis D, E, F, G, or H, or patients at risk for or afflicted with a disorder mediated by any of these strains of hepatitis. In an embodiment, the expression of a Hepatitis, D, E, F, G, or H gene is reduced. In an embodiment the expression of a human gene that is required for hepatitis D, E, F, G or H replication is reduced. Methods of the invention also provide for treating patients infected by the Respiratory Syncytial Virus (RSV) or at risk for or afflicted with a disorder mediated by RSV, e.g, lower respiratory tract infection in infants and childhood asthma, pneumonia and other complications, e.g., in the elderly. In an embodiment, the expression of a RSV gene is reduced. In an embodiment, the targeted HBV gene encodes one of the group of genes N, L, or P. In an embodiment the expression of a human gene that is required for RSV replication is reduced.

Methods of the invention provide for treating patients infected by the Herpes Simplex Virus (HSV) or at risk for or afflicted with a disorder mediated by HSV, e.g, genital herpes and cold sores as well as life-threatening or sight-impairing disease mainly in immunocompromised patients. In an embodiment, the expression of a HSV gene is reduced. In an embodiment, the targeted HSV gene encodes DNA polymerase or the helicase-primase. In an embodiment the expression of a human gene that is required for HSV replication is reduced.

The invention also provides a method for treating patients infected by the herpes Cytomegalovirus (CMV) or at risk for or afflicted with a disorder mediated by CMV, e.g., congenital virus infections and morbidity in immunocompromised patients. In an embodiment, the expression of a CMV gene is reduced. In an embodiment the expression of a human gene that is required for CMV replication is reduced.

Methods of the invention also provide for a method of treating patients infected by the herpes Epstein Barr Virus (EBV) or at risk for or afflicted with a disorder mediated by EBV, e.g., NK/T-cell lymphoma, non-Hodgkin lymphoma, and Hodgkin disease. In an embodiment, the expression of a EBV gene is reduced. In an embodiment the expression of a human gene that is required for EBV replication is reduced.

Methods of the invention also provide for treating patients infected by Kaposi's Sarcoma-associated Herpes Virus (KSHV), also called human herpesvirus 8, or patients at risk for or afflicted with a disorder mediated by KSHV, e.g., Kaposi's sarcoma, multicentric Castleman's disease and AIDS-associated primary effusion lymphoma. In an embodiment, the expression of a KSHV gene is reduced. In an embodiment the expression of a human gene that is required for KSHV replication is reduced.

The invention also includes a method for treating patients infected by the JC Virus (JCV) or a disease or disorder associated with this virus, e.g., progressive multifocal leukoencephalopathy (PML). In an embodiment, the expression of a JCV gene is reduced. In preferred embodiment the expression of a human gene that is required for JCV replication is reduced.

Methods of the invention also provide for treating patients infected by the myxovirus or at risk for or afflicted with a disorder mediated by myxovirus, e.g., influenza. In an embodiment, the expression of a myxovirus gene is reduced. In an embodiment the expression of a human gene that is required for myxovirus replication is reduced.

Methods of the invention also provide for treating patients infected by the rhinovirus or at risk for of afflicted with a disorder mediated by rhinovirus, e.g., the common cold. In an embodiment, the expression of a rhinovirus gene is reduced. In preferred embodiment the expression of a human gene that is required for rhinovirus replication is reduced.

Methods of the invention also provide for treating patients infected by the coronavirus or at risk for of afflicted with a disorder mediated by coronavirus, e.g., the common cold. In an embodiment, the expression of a coronavirus gene is reduced. In preferred embodiment the expression of a human gene that is required for coronavirus replication is reduced.

Methods of the invention also provide for treating patients infected by the flavivirus West Nile or at risk for or afflicted with a disorder mediated by West Nile Virus. In an embodiment, the expression of a West Nile Virus gene is reduced. In an embodiment, the West Nile Virus gene is one of the group comprising E, NS3, or NS5. In an embodiment the expression of a human gene that is required for West Nile Virus replication is reduced.

Methods of the invention also provide for treating patients infected by the St. Louis Encephalitis flavivirus, or at risk for or afflicted with a disease or disorder associated with this virus, e.g., viral haemorrhagic fever or neurological disease. In an embodiment, the expression of a St. Louis Encephalitis gene is reduced. In an embodiment the expression of a human gene that is required for St. Louis Encephalitis virus replication is reduced.

Methods of the invention also provide for treating patients infected by the Tick-borne encephalitis flavivirus, or at risk for or afflicted with a disorder mediated by Tick-borne encephalitis virus, e.g., viral haemorrhagic fever and neurological disease. In an embodiment, the expression of a Tick-borne encephalitis virus gene is reduced. In an embodiment the expression of a human gene that is required for Tick-borne encephalitis virus replication is reduced.

Methods of the invention also provide for methods of treating patients infected by the Murray Valley encephalitis flavivirus, which commonly results in viral haemorrhagic fever and neurological disease. In an embodiment, the expression of a Murray Valley encephalitis virus gene is reduced. In an embodiment the expression of a human gene that is required for Murray Valley encephalitis virus replication is reduced.

The invention also includes methods for treating patients infected by the dengue flavivirus, or a disease or disorder associated with this virus, e.g., dengue haemorrhagic fever. In an embodiment, the expression of a dengue virus gene is reduced. In an embodiment the expression of a human gene that is required for dengue virus replication is reduced.

Methods of the invention also provide for treating patients infected by the Simian Virus 40 (SV40) or at risk for or afflicted with a disorder mediated by SV40, e.g., tumori genesis. In an embodiment, the expression of a SV40 gene is reduced. In an embodiment the expression of a human gene that is required for SV40 replication is reduced.

The invention also includes methods for treating patients infected by the Human T Cell Lymphotropic Virus (HTLV), or a disease or disorder associated with this virus, e.g., leukemia and myelopathy. In an embodiment, the expression of a HTLV gene is reduced. In an embodiment the HTLV1 gene is the Tax transcriptional activator. In an embodiment the expression of a human gene that is required for HTLV replication is reduced.

Methods of the invention also provide for treating patients infected by the Moloney- Murine Leukemia Virus (Mo-MuLV) or at risk for or afflicted with a disorder mediated by Mo-MuLV, e.g., T-cell leukemia. In an embodiment, the expression of a Mo-MuLV gene is reduced. In an embodiment the expression of a human gene that is required for Mo-MuLV replication is reduced.

Methods of the invention also provide for treating patients infected by the encephalomyocarditis virus (EMCV) or at risk for or afflicted with a disorder mediated by EMCV, e.g. myocarditis. EMCV leads to myocarditis in mice and pigs and is capable of infecting human myocardial cells. This virus is therefore a concern for patients undergoing xenotransplantation. In an embodiment, the expression of a EMCV gene is reduced. In an embodiment the expression of a human gene that is required for EMCV replication is reduced.

The invention also includes a method for treating patients infected by the measles virus (MV) or at risk for or afflicted with a disorder mediated by MV, e.g., measles. In an embodiment, the expression of a MV gene is reduced. In an embodiment the expression of a human gene that is required for MV replication is reduced.

The invention also includes a method for treating patients infected by the Vericella zoster virus (VZV) or at risk for or afflicted with a disorder mediated by VZV, e.g. chicken pox or shingles (also called zoster). In an embodiment, the expression of a VZV gene is reduced. In an embodiment the expression of a human gene that is required for VZV replication is reduced.

The invention also includes a method for treating patients infected by an adenovirus or at risk for or afflicted with a disorder mediated by an adenovirus, e.g. respiratory tract infection. In an embodiment, the expression of an adenovirus gene is reduced. In an embodiment the expression of a human gene that is required for adenovirus replication is reduced.

The invention includes a method for treating patients infected by a yellow fever virus (YFV) or at risk for or afflicted with a disorder mediated by a YFV, e.g. respiratory tract infection. In an embodiment, the expression of a YFV gene is reduced. In an embodiment, the preferred gene is one of a group that includes the E, NS2A, or NS3 genes. In an embodiment the expression of a human gene that is required for YFV replication is reduced.

Methods of the invention also provide for treating patients infected by the poliovirus or at risk for or afflicted with a disorder mediated by poliovirus, e.g., polio. In an embodiment, the expression of a poliovirus gene is reduced. In an embodiment the expression of a human gene that is required for poliovirus replication is reduced.

Methods of the invention also provide for treating patients infected by a poxvirus or at risk for or afflicted with a disorder mediated by a poxvirus, e.g., smallpox. In an embodiment, the expression of a poxvirus gene is reduced. In an embodiment the expression of a human gene that is required for poxvirus replication is reduced.

In another, aspect the invention features methods of treating a subject infected with a pathogen, e.g., a bacterial, amoebic, parasitic, or fungal pathogen. The method comprises providing a ligand-conjugated oligonucleotide agent, wherein said oligonucleotide is homologous to and can silence, e.g., by cleavage of a pathogen gene; and administering a therapeutically effective dose of said ligand-conjugated oligonucleotide agent to a subject, prefereably a human subject.

The target gene can be one involved in growth, cell wall synthesis, protein synthesis, transcription, energy metabolism, e.g., the Krebs cycle, or toxin production. Thus, the present invention provides for a method of treating patients infected by a Plasmodium that causes malaria. In an embodiment, the expression of a Plasmodium gene is reduced. In an embodiment, the gene is apical membrane antigen 1 (AMA1). In an embodiment the expression of a human gene that is required for Plasmodium replication is reduced. The invention also includes methods for treating patients infected by the Mycobacterium ulcerans, or a disease or disorder associated with this pathogen, e.g. Buruli ulcers. In an embodiment, the expression of a Mycobacterium ulcerans gene is reduced. In an embodiment the expression of a human gene that is required for Mycobacterium ulcerans replication is reduced.

The invention also includes methods for treating patients infected by the Mycobacterium tuberculosis, or a disease or disorder associated with this pathogen, e.g. tuberculosis. In an embodiment, the expression of a Mycobacterium tuberculosis gene is reduced. In an embodiment the expression of a human gene that is required for Mycobacterium tuberculosis replication is reduced.

The invention also includes methods for treating patients infected by the Mycobacterium leprae, or a disease or disorder associated with this pathogen, e.g. leprosy. In an embodiment, the expression of a Mycobacterium leprae gene is reduced. In an embodiment the expression of a human gene that is required for Mycobacterium leprae replication is reduced.

The invention also includes methods for treating patients infected by the bacteria Staphylococcus aureus, or a disease or disorder associated with this pathogen, e.g. infections of the skin and muscous membranes. In an embodiment, the expression of a Staphylococcus aureus gene is reduced. In an embodiment the expression of a human gene that is required for Staphylococcus aureus replication is reduced.

The invention also includes methods for treating patients infected by the bacteria Streptococcus pneumoniae, or a disease or disorder associated with this pathogen, e.g. pneumonia or childhood lower respiratory tract infection. In an embodiment, the expression of a Streptococcus pneumoniae gene is reduced. In an embodiment the expression of a human gene that is required for Streptococcus pneumoniae replication is reduced.

The invention also includes methods for treating patients infected by the bacteria Streptococcus pyogenes, or a disease or disorder associated with this pathogen, e.g. Strep throat or Scarlet fever. In an embodiment, the expression of a Streptococcus pyogenes gene is reduced. In an embodiment the expression of a human gene that is required for Streptococcus pyogenes replication is reduced.

The invention also includes methods for treating patients infected by the bacteria Chlamydia pneumoniae, or a disease or disorder associated with this pathogen, e.g. pneumonia or childhood lower respiratory tract infection. In an embodiment, the expression of a Chlamydia pneumoniae gene is reduced. In an embodiment the expression of a human gene that is required for Chlamydia pneumoniae replication is reduced.

The invention also includes methods for treating patients infected by the bacteria Mycoplasma pneumoniae, or a disease or disorder associated with this pathogen, e.g. pneumonia or childhood lower respiratory tract infection. In an embodiment, the expression of a Mycoplasma pneumoniae gene is reduced. In an embodiment the expression of a human gene that is required for Mycoplasma pneumoniae replication is reduced.

Another aspect of the invention relates to a method of treating a subject, e.g., a human, at risk for or afflicted with a disease or disorder characterized by an unwanted immune response, e.g., an inflammatory disease or disorder, or an autoimmune disease or disorder. The method comprises providing a ligand-conjugated oligonucleotide agent, wherein said oligonucleotide agent is homologous to and can silence, e.g., by cleavage, a gene which mediates an unwanted immune response; and administering said ligand- conjugated oligonucleotide agent to a subject, preferrably a human subject. In an embodiment the disease or disorder is an ischemia or reperfusion injury, e.g., ischemia or reperfusion injury associated with acute myocardial infarction, unstable angina, cardiopulmonary bypass, surgical intervention e.g., angioplasty, e.g., percutaneous transluminal coronary angioplasty, the response to a transplantated organ or tissue, e.g., transplanted cardiac or vascular tissue; or thrombolysis. In an embodiment the disease or disorder is restenosis, e.g., restenosis associated with surgical intervention e.g., angioplasty, e.g., percutaneous transluminal coronary angioplasty. In a prefered embodiment the disease or disorder is Inflammatory Bowel Disease, e.g., Crohn Disease or Ulcerative Colitis. In a prefered embodiment the disease or disorder is inflammation associated with an infection or injury. In a prefered embodiment the disease or disorder is asthma, lupus, multiple sclerosis, diabetes, e.g., type II diabetes, arthritis, e.g., rheumatoid or psoriatic. In particularly preferred embodiments the oligonucleotide agent silences an integrin or co-ligand thereof, e.g., VLA4, VCAM, ICAM. In particularly preferred embodiments the oligonucleotide agent silences a selectin or co- ligand thereof, e.g., P-selectin, E-selectin (ELAM), I-selectin, P-selectin glycoprotein- 1 (PSGL-1). In particularly preferred embodiments the oligonucleotide agent silences a component of the complement system, e.g., C3, C5, C3aR, C5aR, C3 convertase, C5 convertase. In particularly preferred embodiments the oligonucleotide agent silences a chemokine or receptor thereof, e.g., TNFI, TNFJ, IL-1 I, IL-1J, IL-2, IL-2R, IL-4, IL-4R, IL-5, IL-6, IL- 8, TNFRI, TNFRII, IgE, SCYA11, CCR3.

In other embodiments the oligonucleotide agent silences GCSF, Grol , Gro2, Gro3, PF4, MIG, Pro-Platelet Basic Protein (PPBP), MIP-1I, MIP-1J, RANTES, MCP-1, MCP-2, MCP-3, CMBKR1, CMBKR2, CMBKR3, CMBKR5, AIF-1, 1-309.

Another aspect of the invention features, a method of treating a subject, e.g., a human, at risk for or afflicted with acute pain or chronic pain. The method comprises providing a ligand-conjugated oligonucleotide agent, wherein said ligand is an aromatic group and said oligonucleotide is homologous to and can silence, e.g., by cleavage, a gene which mediates the processing of pain; and administering a therapeutically effective dose of said ligand- conjugated oligonucleotide agent to a subject, preferrably a human subject. In particularly preferred embodiments the oligonucleotide agent silences a component of an ion channel. In particularly preferred embodiments the oligonucleotide agent silences a neurotransmitter receptor or ligand.

Another aspect of the invention relates to a method of treating a subject, e.g., a human, at risk for or afflicted with a neurological disease or disorder. The method comprises providing a ligand-conjugated oligonucleotide agent, wherein said ligand is an aromtic group and said oligonucleotide is homologous to and can silence, e.g., by cleavage, a gene which mediates a neurological disease or disorder; and administering a therapeutically effective dose of said ligand-conjugated oligonucleotide agent the to a subject, preferrably a human. In a prefered embodiment the disease or disorder is Alzheimer Disease or Parkinson Disease. In particularly preferred embodiments the oligonucleotide agent silences an amyloid-family gene, e.g., APP; a presenilin gene, e.g., PSEN1 and PSEN2, or I-synuclein. In an embodiment the disease or disorder is a neurodegenerative trinucleotide repeat disorder, e.g., Huntington disease, dentatorubral pallidoluysian atrophy or a spinocerebellar ataxia, e.g., SCA1, SCA2, SCA3 (Machado- Joseph disease), SCA7 or SCA8.

In particularly preferred embodiments the oligonucleotide agent silences HD, DRPLA, SCA1, SCA2, MJD1, CACNL1A4, SCA7, SCA8.

The loss of heterozygosity (LOH) can result in hemizygosity for sequence, e.g., genes, in the area of LOH. This can result in a significant genetic difference between normal and disease-state cells, e.g., cancer cells, and provides a useful difference between normal and disease-state cells, e.g., cancer cells. This difference can arise because a gene or other sequence is heterozygous in euploid cells but is hemizygous in cells having LOH. The regions of LOH will often include a gene, the loss of which promotes unwanted proliferation, e.g., a tumor suppressor gene, and other sequences including, e.g., other genes, in some cases a gene which is essential for normal function, e.g., growth. Methods of the invention rely, in part, on the specific cleavage or silencing of one allele of an essential gene with a ligand- conjugated oligonucleotide agent of the invention. The oligonucleotide agent is selected such that it targets the single allele of the essential gene found in the cells having LOH but does not silence the other allele, which is present in cells which do not show LOH. In essence, it discriminates between the two alleles, preferentially silencing the selected allele. In essence polymorphisms, e.g., SNPs of essential genes that are affected by LOH, are used as a target for a disorder characterized by cells having LOH, e.g., cancer cells having LOH. E.g., one of ordinary skill in the art can identify essential genes which are in proximity to tumor suppressor genes, and which are within a LOH region which includes the tumor suppressor gene. The gene encoding the large subunit of human RNA polymerase II, POLR2A, a gene located in close proximity to the tumor suppressor gene p53, is such a gene. It frequently occurs within a region of LOH in cancer cells. Other genes that occur within LOH regions and are lost in many cancer cell types include the group comprising replication protein A 70- kDa subunit, replication protein A 32-kD, ribonucleotide reductase, thymidilate synthase, TATA associated factor 2H, ribosomal protein S14, eukaryotic initiation factor 5 A, alanyl tRNA synthetase, cysteinyl tRNA synthetase, NaK ATPase, alpha- 1 subunit, and transferrin receptor.

Accordingly, another aspect of the invention relates to a method of treating a disorder characterized by LOH, e.g., cancer. The method comprises optionally, determining the genotype of the allele of a gene in the region of LOH and preferably determining the genotype of both alleles of the gene in a normal cell; providing a ligand-conjugated oligonucleotide agent which preferentially cleaves or silences the allele found in the LOH cells; and administering a therapeutically effective dose of said ligand-conjugated oligonucleotide agent to the subject, preferrably a human.

The invention also includes a ligand-conjugated oligonucleotide agent disclosed herein, e.g, an oligonucleotide agent which can preferentially silence, e.g., cleave, one allele of a polymorphic gene.

In another aspect, the invention provides a method of cleaving or silencing more than one gene with a ligand-conjugated oligonucleotide agent. In these embodiments the oligonucleotide agent is selected so that it has sufficient homology to a sequence found in more than one gene. For example, the sequence AAGCTGGCCCTGGACATGGAGAT (SEQ ID NO: ) is conserved between mouse lamin Bl, lamin B2, keratin complex 2-gene 1 and lamin A/C. Thus an oligonucleotide agent targeted to this sequence would effectively silence the entire collection of genes.

The selected dosage level will depend upon a variety of factors including the activity of the particular compound of the present invention employed, or the ester, salt or amide thereof, the route of administration, the time of administration, the rate of excretion or metabolism of the particular compound being employed, the rate and extent of absorption, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular compound employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts.

A physician or veterinarian having ordinary skill in the art can readily determine and prescribe the effective amount of the pharmaceutical composition required. For example, the physician or veterinarian could start doses of the compounds of the invention employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.

In general, a suitable daily dose of a compound of the invention will be that amount of the compound which is the lowest dose effective to produce a therapeutic effect. Such an effective dose will generally depend upon the factors described above. Generally, oral, intravenous, intracerebroventricular and subcutaneous doses of the compounds of this invention for a patient, when used for the indicated analgesic effects, will range from about 0.0001 to about 100 mg per kilogram of body weight per day.

If desired, the effective daily dose of the active compound may be administered as two, three, four, five, six or more sub-doses administered separately at appropriate intervals throughout the day, optionally, in unit dosage forms. Preferred dosing is one administration per day.

The present invention is explained in greater detail in the following non-limiting Examples. Example 1

In these examples, we describe the synthesis of mono- and multi-valent oligonucleotide conjugates using anisamide, a high affinity ligand for sigma receptors, and evaluation of the function of these conjugates in tumor cells in culture.

Sigma receptors (σ1, σ2) are transmembrane proteins, found on the endoplasmic reticulum and on plasma membranes that seem to play a role in regulating ion channels.³ High level expression of sigma receptors has been observed for a diverse set of human and rodent tumor cell lines. ⁴ Small molecules such as haloperidol, SA4503 and opipramol have been reported as sigma-receptor ligands.³ Several σΐ ligands have been developed as radioimaging agents for tumors and successfully tested in vivo.⁵ These observations suggested that sigma receptor ligands could also be used for targeted drug delivery. Thus Huang and colleagues have reported that the high affinity sigma-receptor ligand anisamide, when conjugated to lipid nanocarriers, could be used to deliver doxorubicin or siRNA to tumors in animals, Mukherjee et al. reported that haloperidol conjugated lipoplexes showed

o

10-fold greater delivery of DNA to breast carcinoma cells than did control lipoplexes.

For liposome-conjugated anisamide both the anisamide moiety itself and a secondary amino group in a linker are important for binding activity to sigma receptor. ^6,9 However, Desimone et al. developed a new anisamide ligand that used a diethylene glycol linker with an oxygen atom, instead of a nitrogen atom. ¹⁰ This allows facile solid phase synthesis of anisamide-ON conjugates, since a protective group is not needed during DNA synthesis. Thus we prepared anisamide with a diethylene glycol linker, which was then introduced into a phosphoroamidite precursor, and incorporated into an ON at the 5 '-terminal under a standard DNA synthesis cycle.

To evaluate biological activity of the conjugates, we utilized sigma-receptor expressing cells (PC3, human prostate carcinoma cells) that contain a luciferase reporter gene interrupted by an abnormal intron that prevents expression of functional luciferase protein. ¹¹ Upon adequate delivery of an appropriate splice-switching antisense oligonucleotide (an SSO, here designated ON 623) to the nucleus, the intron is spliced out and luciferase is expressed.¹¹ The 623 ONs were 2'-0-methyl RNA with a phosphorothioate backbone and a 3' TAMRA fluorophore. Uptake of the fluorescent ONs was monitored in cells by flow cytometry. ² As seen in Figure 2A, there was slightly higher uptake of the mono-anisamide conjugate as compared to the unconjugated ON control, while the trivalent-anisamide conjugate showed significantly greater uptake than control, possibly reflecting greater avidity of the multi-valent version for the sigma receptor, The increased uptake could partially be blocked by co-incubation with excess free haloperidol (2B), a strong sigma-receptor antagonist. Since the overall uptake process likely involves both receptor mediated endocytosis and non-specific fluid phase pinocytosis, it is expected that the blocking effect of an antagonist would be partial. The biological effect (luciferase induction) paralleled the uptake data, but was more pronounced. The tri-valent conjugate displayed a significantly greater effect than the monovalent compound or the unconjugated control (Figure 2C). Consistent with our previous observations ² the biological effects of oligonucleotides entering cells by a receptor mediated process seem to be greater than those of oligonucleotides entering by pinocytosis.

Thus we demonstrate that conjugation of a low molecular weight ligand to an ON can enhance receptor-specific cell uptake and biological effect. While there has been considerable work on peptide-oligonucleotide conjugates ¹², relatively little has been done with oligonucleotides linked to small organic molecules. The novel conjugation approach described here should create opportunities to utilize a variety of highly selective small molecule ligands to target various receptor types, including members of the numerous G- protein Coupled Receptor family ¹³, thus enhancing possibilities for receptor-selective ON delivery to cells and tissues.

Experimental Procedures

iV-2-(2-hydroxyethoxy)ethyl 4-niethoxy-benzamide (1). According to DeSimone et al. (DeSimone, J.M.; Murphy, A.J.; Galloway, A.; Petros, R.A. PCT Int. Appl. WO 2008045486), under an argon atmosphere a solution of 4-methoxybenzoyl chloride (1.000 g, 5.862 mmol) in 10 ml of dichloromethane was slowly added to a solution of 2-(2- aminoethoxy)ethanol (0.588 ml, 5.862 mmol) and triethylamine (2 ml) in 10 ml dichloromethane at 0 °C.

The reaction mixture was stirred for 2 hrs at room temperature. The reaction was diluted with dichloromethane and then washed with 1 M sodium hydroxide. The organic layer was dried with sodium sulfate, and the solvent was concentrated under reduced pressure. The residue was purified by silica gel column chromatography [chloroform/methanol, (95:5, v/v)] to give 1 (1.229 g, 88%) as colourless oil. 1H-NMR (400 MHz, CDC1₃) δ: 2.17 (brs, 1H), 3.56-3.58 (m, 2H), 3.62 (brs, 4H), 3.71-3.73 (m, 2H), 3.79 (s, 3H), 6.64 (brs, 1H), 6.86 (d, 2H, J = 8 Hz), 7,71 (d, 2H, J - 8 Hz). ¹³C-NMR (CDC1₃)D δ: 39.8, 55.4, 61.8, 70.0, 72.2, 113.4, 126.6, 128.8, 162.2, 167.2. ESI-mass: calcd (M+Na)⁺ 262.13, found 262.12.

N -2-[2-(N,N-diisopropylamino-β-cyanoethoxyphosphinoxy)ethoxy] ethyl 4- methoxy-benzamide (2). Under an argon atmosphere, 2-cyanoethyl N,N-diisopropylchloro phosphoramidite (103 ul, 0.464 mmol) and N,N-diisopropylethylamine (147 ul, 0.844 mmol) were added to a solution of anisamide 1 (101 mg, 0.422 mmol) in anhydrous dichloromethane (5 ml) at 0 °C and the mixture was stirred at room temperature for 1 hr. The reaction was quenched by addition of saturated sodium hydrogen carbonate solution. The mixture was extracted with ethyl acetate. The organic phase was washed with brine and dried over sodium sulfate and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [n-hexane/efhyl acetate (1:1, v/v) + 2% triethylamine] to give 2 (80 mg, 43%) as colorless oil. 1H-NMR (400 MHz, CDC1₃) δ: 1.09-1.1 1 (m, 12H), 2.51 (t, 2H, J = 8 Hz), 3.48-3.75 (m, 12H), 3.77 (s, 3H), 6.55 (brs, 1H), 6.85 (dd, 2H, J= 4, 8 Hz), 7.70 (dd, 2H, J= 4, 8 Hz). ³¹P-NMR (CDC1₃) δ: 148.4.

Mono- and tri-anisamide conjugated oligonucleotides (ONs). All oligonucleotide synthesis reagents were purchased from Glen Research. The anisamide conjugated oligos were synthesized with an Applied Biosystems 3400 DNA synthesizer. 3'-TAMRA CPG (500 A, 1 μιηοΐ scale) was used for mono- and tri-anisamide conjugated ONs synthesis. For TAMRA fluorophore labeling of ONs, ultra-mild deprotection 2'-0-Me phosphoramidites were used. Long trebler phosphoramidite was used to prepare tri-anisamide conjugated ON. The coupling times for the phosphoramidites of anisamide (2), 2'-0-Me RNA with ultra-mild protecting bases and long trebler linker were 900, 360 and 900 s, respectively. 5-(Ethylthio)-lH-tetrazole was used as an activator (0.25 M solution in acetonitrile), 5% phenoxyacetic anhydride in tetrahydrofuran/pyridine as a CAP mix A, and Beaucage reagent was used to introduce the internucleotide phosphorothioate backbone into 623 ON sequences. The anisamide moiety was introduced using a phosphorodiester backbone into the 623 ON. Prior to deprotection, the CPG supports were treated with a 10% solution of diethylamine in acetonitrile. ONs were simultaneously cleaved from the CPG support and deprotected using a mixture of tert- butylamine : methanol : water (1 : 1 :2) at 55°C for 4 h. Purification of the oligonucleotides was carried out by reverse-phase HPLC using a ZORBAX 300 SB-C18 column (9.4 mm x 250 mm) and gel filtration with GE Healthcare illustra NAP-25 column. Structures of the ONs were determined by MALDI-TOF mass spectroscopy (Applied Biosystems Voyager-DE Pro). MALDI TOF mass data: mono-anisamide ON: calcd. (M+H)⁺ 8000.7, found 8001.8, tri- anisamide ON: calcd. (M+H)⁺ 9035.6, found 9035.7.

Cell uptake and luciferase assays. PC3 prostate cancer cells were cultured in F12K medium (Gibco/Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS). The plasmid pLuc/705, containing an aberrant intron inserted into the firefly luciferase coding sequence was a kind gift from Dr R. Kole (University of North Carolina). The Luc705 cassette was amplified from the plasmid pLuc/705 using the forward primers 5 ' TGCATGCTCGAGACATTTTACAATTTGG3 ' and reverse primer

5 ' CCTGC AGGCATGCAAGCTTGGCATTCCG3 ' . Amplified PCR product was inserted at the Xhol and Hindlll site of pcDNA3.1/hygro (Invitrogen) resulting in the plasmid pcDNA3.1/hygro Luc705. Stable transfectants were obtained by transfecting PC3 cells with pcDNA3.1/hygro/Luc705 using Lipofectamine 2000® as per manufacturer's instructions. Selection was carried out in F12K medium containing 200 μg/ml hygromycin B (Roche) and 10% FBS for two weeks. Individual clones were picked and screened for luciferase induction by 623 oligonucleotide complexed with Lipofectamine 2000®. The single cell clone with the highest expression induced by 623 oligonucleotide was referred to as P C3/Luc705 and used in further studies.

Total cellular uptake of the Tamra-labeled oligonucleotide was measured by flow cytometry using a LSR II cell analyzer (Becton-Dickenson, San Jose, CA, USA). After treatment with oligonucleotides for 4 hours, the cells were trypsinized and analyzed by flow cytometry.

PC3/Luc705 cells were plated on 24-well plates (at 1.0 ^χ 105 cells per well in various experiments) in F12K supplemented with 10% FBS. The following day, cells were treated with anisamide-623-Tamra conjugates or 623-Tamra prepared in OPTI-MEM I medium (Gibco, Carlsbad, CA, USA). Four hours after treatment, 1% FBS was added to each well. Twenty-four hours after oligonucleotide treatment, medium was replaced with F12K containing 1% FBS, and at various times thereafter cell lysates were collected for luciferase assay. Cells were harvested 48 hours after oligonucleotide treatment, and activity determined using a Luciferase assay kit (Promega, Madison, WI, USA). Measurements were performed on a FLUOstar Omega microplate reader (BMG LABTECH, Cary, NC, USA). Protein content was determined by the BCA protein assay (Pierce, Rockford, IL, USA) with bovine serum albumin as a standard. Background luciferase expression was determined by measuring luciferase activity in the cells without the oligonucleotide treatment, and these values were then subtracted from the results in the treated cells to obtain response values.

Data are expressed as mean ± SD from three measurements unless otherwise noted. Statistical significance was evaluated using t-test or ANOVA followed by Dunnet's test for multiple comparisons. The data were analyzed with GraphPad Prism 5 (GraphPad Software, Inc., La Jolla, CA).

Example 2

N-2-{2-{2-{2-{3-[(4,4'-dimethyoxytrityl)oxy]-2-hydroxypropoxy}ethoxy}ethoxy} ethyl} 4-methoxybenzamide (3). 40% aq. methylamine solution (12 ml) was added to a solution of 1 (Ossipov, D.; Zamaratski, E.; Chattopadhyaya, J. Helv. Chim. Acta 1999, 82, 2186- 2200) (1.679 g, 2.522 mmol) in methanol (6 ml) and the mixture was stirred at 55°C for 4 hrs. The reaction was evaporated and co-evaporated with toluene. The crude compound 2 was conducted to next reaction without purification. Under an argon atmosphere a solution of 4- methoxybenzoyl chloride (0.516 g, 3.024 mmol) in 10 ml of dichloromethane was slowly added to a solution of crude material 2 and triethylamine (1.054 ml, 7.563 mmol) in 10 ml dichloromethane at 0 °C. The reaction mixture was stirred for 1 hr at room temperature. The reaction was quenched by addition of saturated aqueous sodium hydrogen carbonate solution. The mixture was extracted with ethyl acetate. The organic phase was washed with brine and dried over sodium sulfate and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [77-hexane/ethyl acetate (1 :4- 0: 1, v/v) + 1% triethylamine] to give 3 (1.874 g, 74% in 2 steps from 1) as colorless oil. 1H-NMR (400 MHz, CDC1₃) δ: 3.09- 3.19 (m, 2H), 3.37 (brs, 1H), 3.54 (dd, 1H, J= 8, 12 Hz), 3.59-3.67 (m, 13H), 3.77 (s, 6H), 3.79 (s, 3H), 3.91-3.99 (m, 1H), 6.79 (d, 4H, J = 8 Hz), 6.83 (d, 2H, J = 8 Hz), 7.16-7.29 (m, 7H), 7.40 (d, 2H, J = 4 Hz), 7.76 (d, 2H, J = 8 Hz).

N-2-{2-{2-{2-{3-[(4,4'-dimethyoxytrityl)oxy]-2-(/y^V-diisopropylamino-p- cyanoethoxyphosphinoxy)propoxy} ethoxy}ethoxy} ethyl} 4-methoxybenzamide (4). Under an argon atmosphere, 2-cyanoethyl N,N-diisopropyl chloro phosphoramidite (0.240 ml, 1.076 mmol) and N,N-diisopropylethylamine (0.426 ml, 2.446 mmol) were added to a solution of 3 (645 mg, 0.978 mmol) in anhydrous dichloromethane (20 ml) at 0 °C and the mixture was stirred at room temperature for 30 min. The reaction was quenched by addition of saturated aqueous sodium hydrogen carbonate solution. The mixture was extracted with ethyl acetate. The organic phase was washed with brine and dried over sodium sulfate and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [«-hexane/ethyl acetate (1 :3, v/v) + 1% triethylamine] to give 4 (596 mg, 71%) as colorless oil. ³¹P-NMR (CDC1₃) δ: 149.2, 149.6. ESI-mass: calcd (M+Na)⁺ 882.42, found 882.40.

Synthesis of anisamide-conjugated oligonucleotides.

Oligo (623): 5'-GTT ATT CTT TAG AAT GGT GC-TAMRA-3' (2'-O-Me phosphorothioate). X is a covalent bond or a cleavable linker and n is 1, 3, 6, 9, or 12..

Anisamide conjugated oligonucleotides (ONs). All oligonucleotide synthesis reagents were purchased from Glen Research. The anisamide conjugated oligos were synthesized with an Applied Biosystems 3400 DNA synthesizer. 3'-TAMRA CPG (1000 A, 1 μιηοΐ scale) was used for multi-anisamide conjugated ONs synthesis. For TAMRA fluorophore labeling of ONs, ultra- mild deprotection 2'-0-Me phosphoramidites were used. The coupling times for the phosphoramidites of anisamide (4), 2'-0-Me RNA with ultra-mild protecting bases and thiol- modifier C6 S-S were 900, 360 and 300 s, respectively. 5-(Ethylthio)-lH-tetrazole was used as an activator (0.25 M solution in acetonitrile) and 5% phenoxyacetic anhydride in tetrahydrofuran/pyridine as a CAP mix A. Beaucage reagent was used to introduce the internucleotide phosphorothioate backbone into 623 ON sequences. The anisamide moiety was introduced using a phosphorodiester backbone into the 623 ON. Prior to deprotection, the CPG supports were treated with a 10% solution of diethylamine in acetonitrile. ONs were simultaneously cleaved from the CPG support and deprotected using a mixture of tert- butylamine : methanol : water (1 :1 :2) at 55°C for 4 h. Purification of the oligonucleotides was carried out by reverse-phase HPLC using a ZORBAX 300 SB-C18 column (9.4 mm x 250 mm). Finally, 5 '-terminal DMTr protective group was removed with 2% aqueous TFA using Waters Sep-Pak Plus C18 cartridge. Structures of the ONs were determined by MALDI-TOF mass spectroscopy (AB SCIEX, 4800 Plus MALDI TOF/TOF Analyzer).

Oligonucleotide (623) sequence: 5'-GTT ATT CTT TAG AAT GGT GC-TAMRA-3 ' (2'-<9-Me phosphorothioate).

References

1. Whitehead, K.A.; Langer, R.; Anderson, D.G. Nat Rev Drug Discov. 2009, 8, 129-38. Juliano, R.; Bauman, J.; Kang, H.; Ming, X.. Mol Pharm. 2009, 6, 686-95. 2. Alam, M.R.; Dixit, V.; Kang, H.; Li, Z.B.; Chen, X.; Trejo, J.; Fisher, M.; Juliano, R.L. Nucleic Acids Res. 2008, 36, 2764-76. Alam, M.R.; Ming, X.; Dixit, V.; Fisher, M.; Chen, X.; Juliano, R.L. Oligonucleotides. 2009, In Press.

3. Maurice, T.; Su, T.P. Pharmacol Ther. 2009, 124, 195-206. Cobos, E.J.; Entrena, J.M.; Nieto, F.R.; Cendan, CM.; Del Pozo, E. Curr Neuropharmacol. 2008, 6, 344-66.

4. Vilner, B.J.; John, C.S.; Bowen, W.D. Cancer Res. 1995, 55, 408-13.

5. John, C.S.; Vilner, B.J.; Geyer, B.C.; Moody, T.; Bowen, W.D. Cancer Res. 1999, 59, 4578-83.

6. Banerjee, R.; Tyagi, P.; Li, S.; Huang, L. Int J Cancer. 2004, 112, 693-700.

7. Li, S.D.; Chono, S.; Huang, L. Mol Ther. 2008, 16, 942-6. Chono, S.; Li, S.D.; Conwell, C.C.; Huang, L. J Control Release. 2008, 131, 64-9.

8. Mukherjee, A.; Prasad, T.K.; Rao, N.M.; Banerjee, R.. J Biol Chem. 2005, 280, 15619- 27.

9. Ablordeppey, S.Y.; Fischer, J.B.; Glennon, R.A. Bioorg Med Chem. 2000, 8, 2105-11.

10. DeSimone, J.M.; Murphy, A.J.; Galloway, A.; Petros, R.A. Nanoparticle Compositions for Controlled Delivery of Nucleic Acids. WO/2008/045486. 2008.

11. Sazani, P.; Kole, R. J Clin Invest. 2003, 112, 481-6.

12. Juliano, R.L. Curr Opin Mol Ther. 2005, 7, 132-6. Abes, R.; Arzumanov, A.A.; Moulton, H.M.; Abes, S.; Ivanova, G.D.; Iversen, P.L.; Gait, M.J.; Lebleu, B. Biochem Soc Trans. 2007, 35, 775-9. Juliano, R.; Alam, M.R.; Dixit, V.; Kang, H. Nucleic Acids Res. 2008, 36, 4158-71.

13. Armbruster, B.N.; Roth, B.L. J Biol Chem. 2005, 280, 5129-32.

The foregoing is illustrative of the present invention, and is not to be construed as limiting thereof. The invention is defined by the following claims, with equivalents of the claims to be included therein.

Claims

THAT WHICH IS CLAIMED IS:

1. An oligonucleotide covalently coupled to at least one ligand for a membrane bound protein, preferably through a linking group, said linking group preferably comprising a phosphate group covalently coupled to a substituted or unsubstituted aliphatic group or a substituted or unsubstituted aliphatic oxide group, or a salt thereof.

2. A compound of claim 1, said compound having a structure of Formula I:

(A)n-B (I) wherein:

B is selected from the group consisting of

a)— R— Oligo, where R³ is a covalent bond or a cleavable linker,

where R³ is a covalent bond or a cleavable linker, R⁴ and R⁵ are unsubstituted or substituted aliphatic groups or unsubstituted or substituted aliphatic oxide groups, and each R¹⁰, R¹¹, and R¹² are H or— R¹³— , where R¹³ is an unsubstituted or substituted aliphatic group or an unsubstituted or substituted aliphatic oxide group, subject to the proviso that at least 1 or 2 of R¹⁰, R¹¹, and R¹² are not H, and c) (— R¹⁴— C(R¹⁵— L )— O— P(=O)(X)— O)_m— R³— Oligo, where R¹⁴ and R¹⁵ are unsubstituted or substituted aliphatic groups or unsubstituted or substituted aliphatic oxide groups, L is a ligand for a membrane bound protein, X is O or S, m is 1 to 15, and R³ is a covalent bond or a cleavable linker, Oligo is an oligonucleotide from 3 to 100 nucleotides in length, and

n is 1 to 3.

3. A compound of claim 2, wherein said oligonucleotide covalently coupled to at least one ligand has the structure:

L—R—0—P(=O)(X)—O—R³— Oligo,

wherein:

L is a ligand for a membrane bound protein,

X is O or S,

R³ is a covalent bond or a cleavable linker, and

Oligo is an oligonucleotide from 3 to 100 nucleotides in length.

4. A compound of claim 2, wherein said oligonucleotide covalently coupled to at least one ligand has the structure:

wherein:

L is a ligand for a membrane bound protein,

X is O or S,

R³ is a covalent bond or a cleavable linker,

R⁴ and R⁵ are unsubstituted or substituted aliphatic groups or unsubstituted or substituted aliphatic oxide groups,

R¹⁰, R^{1 1}, and R¹² are— R¹³— , where R¹³ is an unsubstituted or substituted aliphatic group or an unsubstituted or substituted aliphatic oxide group, and

Oligo is an oligonucleotide from 3 to 100 nucleotides in length.

5. A compound of claim 2, wherein said oligonucleotide covalently coupled to at least one ligand has the structure:

L— R— O— P(=O)(X)— O— (R¹⁴— C(R¹⁵— L )— O— P(=O)(X)— 0)_m— R³— Oligo,

wherein:

L is a ligand for a membrane bound protein,

X is O or S,

m is 1 to 15,

R³ is a covalent bond or a cleavable linker, and

Oligo is an oligonucleotide from 3 to 100 nucleotides in length.

6. A compound of claim 1-5, wherein said ligand is a small organic molecule.

7. A compound of claim 6, wherein said small organic molecule is selected from the group consisting of anisamide, melatonin, haloperidol, SA4503, opipramol, buspirone, tandospirone, eptapirone, gepirone, ipsapirone, flesinoxan, 8-hydroxy-2-dipropylaminotetralin, flibanserin, repinotan, lesopitron, piclozotan, aripiprazole, vilazodone, sarizotan, roxindole, roxindole methanesulfonate, alnespirone, bromerguride, xaliproden, mazapertine succinate, mazapertine, ziprasidone, sunepitron, umespirone, bifeprunox, zalospirone, cisapride, mosapride, renzapride, prucalopride, tegaserod, zacopride, metoclopramide, 5-methoxytryptamine, 2-[l-(4- piperonyl)piperazinyl]benzothiazole, norcisapride, mosapride citrate, zacopride, mezacopride, aminomethylazaadamantane, metoclopramide, 5-methoxytryptamine, azasetron, ondansetron, ondansetron, cilansetron, palonosetron, cisplatin, lotronex or alosetron, anzemet or dolasetron mesylate, zacopride or R-zacopride, ramosetron, marinol or dronabinol, lac hydrin or ammonium lactate, kytril or granisetron, bemesetron, tropisetron, zatosetron, mirisetron, mirisetron maleate, ketanserin, ketanserin tartrate, risperidone, olanzapine, adatanserin, ritanserin, etoperidone, nefazodone, deramciclane, geoden or ziprasidone, zeldox, effexor XR, zomaril or iloperidone, quetiapine or quetiapine fumarate, seroquel, tonabersat, sertindole, eplivanserin or eplivanserin fumarate, lubazodone, cyproheptadine, pizotyline or pizotifen, mesulergine, irindalone, pruvanserin, m-chlorophenylpiperazine, clozapine, N-desmethylclozapine, olanzapine, fluperlapine, clomipramine, amitriptyline, doxepin, nortryptyline, 5-memoxytryptamine, bromocryptine, octoclothepin, chlorpromazine, loxapine, and fluphenazine.

8. A compound of claim 1, wherein said compound is selected from the group consisting of:

or a salt thereof.

9. The compound of claim 1-8, wherein said oligonucleotide is from 8 to 60 nucleotides in length.

10. The compound of claim 1-9, wherein said oligonucleotide is a short hairpin RNA (shRNA); microRNA, antisense oligonucleotide, small double stranded interference RNA (siRNA), or ribozyme.

11. A phosphoramidite group covalently coupled to a ligand for a membrane bound protein, preferably through a linking group, said linking group preferably comprising a substituted or unsubstituted aliphatic group or a substituted or unsubstituted aliphatic oxide group.

12. A compound of claim 11 having a structure of Formula II:

L— R— O— P(R²⁰)(NR²¹R²²), (II)

wherein:

L is a ligand for a membrane bound protein,

R²⁰ is selected from the group consisting of — OCH₂CH₂CN, — SCH₂CH₂CN, a substituted or unsubstituted aliphatic group,—OR²³,— SR²³,— O— CH₂CH₂—Si(CH₃)₂C₆H₅, — O— CH₂CH₂— S(O)₂— CH₂CH₃, — O— CH₂CH₂— C₆H₄— NO₂, — S— CH₂CH₂— Si(CH₃)₂C₆H₅,— S— CH₂CH₂— S(O)₂— CH₂CH₃, and— S— CH₂CH₂— C₆H₄— NO₂, where R²³ is a substituted or unsubstituted aliphatic group, a substituted or unsubstituted aryl group or a substituted or unsubstituted aralkyl group, and

13. A compound of claim 11, wherein said compound has the structure:

14. A process for making an oligonucleotide conjugate, comprising:

a) deprotecting the 5'-hydroxyl group of an oligonucleotide,

b) activating the 3' end of a compound having a structure of Formula II:

L— R— O— P(R²⁰)(NR²¹ R²²), (II)

wherein:

L is a ligand for a membrane bound protein,

R²⁰ is selected from the group consisting of — OCH₂CH₂CN, — SCH₂CH₂CN, a substituted or unsubstituted aliphatic group,—OR²³,— SR²³,— O— CH₂CH₂— Si(CH₃)₂C₆H₅, — O— CH₂CH₂— S(O)₂— CH₂CH₃, — O— CH₂CH₂— C₆H₄— NO₂, — S— CH₂CH₂— Si(CH₃)₂C₆H₅,— S— CH₂CH₂— S(O)₂—CH₂CH₃, and— S— CH₂CH₂— C₆H₄— NO₂, where R²³ is a substituted or unsubstituted aliphatic group, a substituted or unsubstituted aryl group or a substituted or unsubstituted aralkyl group, and

R^2! and R²² are each independently selected from the group consisting of a substituted or unsubstituted aliphatic group, a substituted or unsubstituted aryl group, and a substituted or unsubstituted aralkyl, or R²¹ and R²² taken together with the nitrogen to which they are bound form a 5 or 6 member heterocyclic ring, and

15. The method of claim 14, wherein the oligonucleotide comprises a multi-valent linking group at the 5' end of the oligonucleotide.

16. The method of claim 15, wherein the multi-valent linking group is tri-valent and the oligonucleotide attached to the linking group has the structure:

where R³ is a covalent bond or a cleavable linker, R⁴ and R⁵ are unsubstituted or substituted aliphatic groups or unsubstituted or substituted aliphatic oxide groups, and each R¹⁰, R¹¹, and R¹² is independently— R¹³— , where R¹³ is an unsubstituted or substituted aliphatic group or an unsubstituted or substituted aliphatic oxide group.

17. The method of claim 14, further comprising coupling said oligonucleotide conjugate with at least one compound of Formula II by

d) deprotecting the 5'-hydroxyl group of the oligonucleotide conjugate,

e) activating the 3' end of the compound of Formula II,

L— R— O— P(=O)(X)— O— R¹⁴— C(R¹⁵— L )— O— P(=O)(X)— O— R³— Oligo,

wherein:

L is a ligand for a membrane bound protein,

X is O or S,

R³ is a covalent bond or a cleavable linker, and

Oligo is an oligonucleotide from 3 to 100 nucleotides in length, and then g) optionally repeating steps d), e), and f) until the desired number of ligands are attached to the oligonucleotide.

18. The method of claim 14, wherein said coupling comprises solid phase synthesis.

19. The method of claim 18, further comprising capping unreacted 5'-hydroxyl groups of the oligonucleotide conjugate.

20. The method of claim 18, further comprising deprotecting the oligonucleotide conjugate.

21. The method of claim 18, further comprising cleaving said oligonucleotide conjugate from a support.

22. The method of claim 21, further comprising purifying the oligonucleotide conjugate.

23. A method of introducing an oligonucleotide of interest into a cell, comprising contacting a compound of claim 1-10 to said cell in an amount effective to introduce said oligonucleotide into said cell.

24. The method of claim 23, wherein said method is carried out in vitro or in vivo.