WO2011120099A1 - Diagnostic and prognostic methods for cancer - Google Patents
Diagnostic and prognostic methods for cancer Download PDFInfo
- Publication number
- WO2011120099A1 WO2011120099A1 PCT/AU2011/000378 AU2011000378W WO2011120099A1 WO 2011120099 A1 WO2011120099 A1 WO 2011120099A1 AU 2011000378 W AU2011000378 W AU 2011000378W WO 2011120099 A1 WO2011120099 A1 WO 2011120099A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- senex
- cancer
- expression
- subject
- level
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5011—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57515—Immunoassay; Biospecific binding assay; Materials therefor for cancer of the breast
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57535—Immunoassay; Biospecific binding assay; Materials therefor for cancer of the large intestine, e.g. colon, rectum or anus
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57555—Immunoassay; Biospecific binding assay; Materials therefor for cancer of the prostate
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
- G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
- G01N2333/4701—Details
- G01N2333/4703—Regulators; Modulating activity
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
Definitions
- the present invention relates generally to the diagnosis of cancer disease states and the evaluation of the likelihood of a subject's response to treatment for cancer, based on determination of expression levels of the senescence-inducing polypeptide SENEX or the encoding polynucleotide SENEX.
- cancer remains one of the leading causes of death around the world, with prevalence of many cancers on the increase.
- breast cancer is the leading or second leading cause of cancer death in most populations, and is the most common form of cancer diagnosed in women.
- prostate cancer is the leading or second leading cause of cancer death and is the most prevalent cancer found in men.
- Prognosis for patients suffering from breast cancer and prostate cancer, and indeed many other forms of cancer, can be substantially improved with early and effective diagnosis.
- Early diagnosis allows early intervention with therapeutic treatments.
- knowledge of the stage of the disease in a patient can enable the employment of the most appropriate therapeutic treatment and/or patient management for that disease state,
- senescent cells relies on a number of specific criteria.
- the cells exit the cell cycle although remain viable, they exhibit a large flattened morphology and show accumulation of senescence associated /3-galactosidase (SA-/3-gal) activity. Furthermore, they show altered gene expression profiles which may be cell type specific.
- SA-/3-gal /3-galactosidase
- Replicative senescence is mediated through the shortening of telomeres that occurs after each cell division. This shortening eventually registers as DNA damage and triggers ATM activation and initiates a program of cell cycle arrest.
- Stress induced premature senescence may be induced by oncogenes, by oxidative stress, or by suboptimal culture conditions and occurs independent of a change in telomere length. Senescence is mediated through the p53 pathway which transactivates the cyclin dependent kinase inhibitor p21 , or through the p16 pathway to inhibit the cyclin dependent kinases 2 and 4, preventing the phosphorylation of Rb and thus silencing genes involved in proliferation.
- Oncogene-induced senescence is an 'emergency stop' mechanism that induces an irreversible cell cycle arrest in damaged or pre-malignant cells in response to activated oncogenes, DNA damage or telomere dysfunction, thus preventing tumourigenesis. It has been suggested that senescence may play a role as important as apoptosis in both tumour progression and treatment.
- Described for the first time herein is the expression of the senescence-associated polypeptide SENEX in normal and cancerous mammary epithelial cells and the role of SENEX in inducing senescence in cancerous cells. Accordingly, provided herein are methods for diagnosing cancer disease states, methods for predicting the response of subjects to cancer treatments and methods for monitoring and evaluating the efficacy of cancer treatments.
- a method for determining the efficacy of cancer treatment in a subject comprising:
- the method further comprises repeating step (c) at least once over the period of treatment; and (d) determining whether the level of expression of SENEX changes over the period of treatment, wherein an increase in the level of expression of SENEX in the cancerous cell(s), tissue or fluid over the period of treatment is indicative of the. efficacy of the treatment regime.
- step of determining the level of expression of SENEX in cancerous cell(s), tissue or fluid comprises isolating a sample of cancerous cell(s), tissue or fluid from the subject and determining the level of expression of SENEX ex vivo in the isolated sample. SENEX expression may be determined at the protein or the nucleic acid level.
- Protein expression may be determined by any suitable means, including for example enzyme linked immunosorbent assay (ELISA), immunoblotting, two-dimensional gel electrophoresis, multiplex protein expression assays, flow cytometry and protein expression profiling arrays and microarrays.
- SENEX expression at the nucleic acid level may be determined by any suitable means, including for example reverse transcription PCR, quantitative PCR, microarray expression profiling, northern blotting, and serial analysis of gene expression (SAGE).
- SENEX polypeptide comprises the amino acid sequence as set forth in SEQ ID NO:1 or is a fragment, variant or homologue thereof.
- the polynucleotide encoding SENEX may comprise a nucleotide sequence as set forth in SEQ ID NO:2, or a fragment, variant or homologue thereof.
- the treatment regime may comprise, for example, chemotherapy and/or radiotherapy.
- the treatment regime comprises a chemotherapeutic agent or a combination of chemotherapeulic agents.
- the chemotherapeutic agent is a DNA intercalating agent such as doxorubicin or DNA topoisomerase inhibitor such as camptothecin.
- the cancer is selected from breast cancer, colorectal cancer and prostate cancer.
- the breast cancer may be a benign neoplasm or tumour, ductal carcinoma in situ or invasive ductal carcinoma.
- a method for determining the efficacy of cancer treatment in a subject comprising:
- the method further comprises repeating step (b) at least once over the period of treatment; and (c) determining whether the level of expression of SENEX changes over the period of treatment, wherein an increase in the level of expression of SENEX in the cancerous cell(s), tissue or fluid over the period of treatment is indicative of the efficacy of the treatment regime.
- a method for diagnosing a cancer disease state in a subject known to suffer from, or suspected of having, a cancer comprising determining the level of expression of SENEX in a tissue or bodily fluid associated with the cancer, wherein the level of expression of SENEX is indicative of the cancer disease state.
- the expression of SENEX is determined ex vivo in a sample isolated from the subject.
- the cancer is selected from breast cancer, colorectal cancer and prostate cancer.
- the breast cancer may be a benign neoplasm or tumour, ductal carcinoma in situ or invasive ductal carcinoma.
- the level of expression of SENEX in the subject is compared to the level of expression of SENEX in one or more control samples.
- the subject is suspected of having a cancer and the control samples are derived from one or more individuals known not to suffer from the cancer, wherein increased expression of SENEX in the tissue or fluid from the subject compared to the one or more control samples is indicative that the subject has the cancer.
- the subject suffers from a cancer and the control samples represent different stages of progression of the cancer, wherein the level of expression of SENEX in the sample from the subject compared to the level of expression of SENEX in the control samples is indicative of the disease state of the cancer in the subject.
- the cancer may be breast cancer and the disease state may be benign, hyperplastic, invasive ductal carcinoma grade I, II or III or metastatic invasive ductal carcinoma,
- a method for designing a suitable treatment regime for a subject suffering from cancer comprising monitoring the level of expression of SENEX in cancerous cell(s), tissue or fluid in the subject in the presence or absence of a treatment regime for treating the cancer and adjusting the identity; timing and/or intensity of the treatment regime so as to increase the level of expression of SENEX in the cancerous cell(s), tissue or fluid.
- a method for identifying a compound suitable for treating a cancer in a subject comprising:
- step (d) subsequently determining the level of expression of SENEX in the at least one cell, wherein an increase in the level expression of SENEX between steps (b) and (d) is indicative of the ability of compound to treat the cancer.
- the present disclosure provides methods for predicting or evaluating the response of a subject to a particular cancer treatment regime or therapy.
- a sixth aspect provides a method of treating cancer in a subject, the method comprising administering to the subject a treatment regime designed in accordance with the fourth aspect or a compound identified in accordance with the fifth aspect.
- FIG. 1 SENEX expression is regulated during development and proliferation in the normal murine breast. .SENEX mRNA expression was measured by qPCR in the isolated mammary glands of virgin, pregnant (p12.5, p18.5), and lactating (L4, L7) mice and during involution (i3, ⁇ 7, i10). Expression was decreased in the pregnant, lactating and involuting breast compared to the virgin breast.
- FIG. 1 SENEX expression is increased during ' p16 INK A -mediated senescence in a breast cancer cell line.
- MDAMB231 cells expressing p16 (TET-p16) or p21 (TET-p21) from a tetracycline-inducible promoter were treated with doxycycline for 5 days.
- TBP Tata-binding protein
- FIG. 3 Over-expression of SENEX induces senescence in human mammary epithelial cells.
- Human mammary epithelial cells overexpressing SENEX in combination with GFP show a greater degree of senescence than cells overexpressing GFP alone (left panels).
- Cells overexpressing SENEX show a large flattened morphology indicative of senescence.
- Top phase contrast micrographs.
- Bottom fluorescence micrographs.
- Figure 4 SENEX co-localises with markers of cellular senescence in breast tumours. A.
- FIG. 5 SENEX expression in a breast cancer progression tissue microarray.
- FIG. 6 SENEX expression in a breast cancer progression tissue microarray. Scoring of immunohistochemical staining of tissue microarrays comprising normal breast tissue, Grades 1 , 2 and 3 ductal carcinoma in situ (DCIS), and invasive ductal carcinoma (IDC) showing higher levels of SENEX expression in Grades 1 , 2 and 3 DCIS than in IDC.
- DCIS ductal carcinoma in situ
- IDC invasive ductal carcinoma
- FIG. 7 Chemotherapeutic agents induce SENEX expression and senescence.
- A. Phase- contrast micrographs of human mammary epithelial cells treated with 100nM doxorubicin for 12 days or untreated (control) and stained for senescence-associated ⁇ -galactosidase.
- B. Human mammary epithelial cells treated with doxorubicin (dark bars) for 1-12 days show increased SENEX expression (measured by qPCR) by 3-6 days. Light bars, SENEX expression in human mammary epithelial cells untreated with doxorubicin.
- FIG. 8 SENEX expression in ER/PR+ve tumours.
- IHC immunohistochemical
- FIG. 9 SENEX expression in prostate cancer.
- A Representative immunohistochemical staining of microarrayed normal and cancerous prostate tissue for SENEX illustrating that SENEX is present in epithelial cells of the cancerous tissue but absent in the normal (noncancerous) tissue.
- B Representative immunohistochemical staining of microarrayed benign prostatic hyperplasia tissue and prostate cancer tissue for SENEX illustrating that expression of SENEX is increased in prostate cancer relative to benign prostatic hyperplasia.
- C Representative immunohistochemical staining of microarrayed normal and cancerous prostate tissue for SENEX illustrating that expression of SENEX is increased in prostate cancer relative to benign prostatic hyperplasia.
- Scoring (immunohistochemical (IHC) score) of the tissue microarrays of benign prostatic hyperplasia and prostate cancer shows that 3/13 (13%) benign prostatic hyperplasia samples were positive for SENEX, whereas 20/40 (50%) prostate cancer samples were positive for SENEX.
- FIG. 10 SENEX is not expressed in normal bowel but is expressed in colorectal cancer.
- A Representative immunohistochemical staining of microarrayed normal bowel tissue and colorectal cancerous tissue for SENEX illustrating expression of SENEX in cancerous tissue and absence in normal bowel tissue.
- B Scoring (immunohistochemical (IHC) score) of the tissue microarrays shows that 0/5 normal bowel samples were positive for SENEX, whereas 17/24 (71 %) colorectal cancer tissue samples were positive for SENEX.
- IHC immunohistochemical
- the subject specification contains amino acid and nucleotide sequence information prepared using the programme Patentln Version 3.4, presented herein in a Sequence Listing. Nucleotide and amino acid sequences are referred to by a sequence identifier number (SEQ ID NO:).
- the SEQ ID NOs: correspond numerically to the sequence identifiers ⁇ 400>1 (SEQ ID NO:1), ⁇ 400>2 (SEQ ID NO:2), etc.
- the amino acid sequence of human SENEX is provided in SEQ ID NO:1 and the nucleotide sequence of human SENEX is provided in SEQ ID NO:2.
- SEQ ID NOs:3 to 8 provide the sequences of various oligonucleotide primers used in the Examples.
- cancer is given its broadest meaning as a disease characterized by the abnormal and uncontrolled proliferation of cells, and thus includes benign, potentially malignant and malignant neoplasms, carcinomas, sarcomas, blastomas, lymphomas and leukemias. Accordingly, the cancer may or may not be a solid tumour.
- a specific tissue or bodily fluid in which the cancer resides or which otherwise contains the cancerous cells may be analysed or isolated.
- disease state means the status of a cancer or tumour in a subject.
- diagnosing and monitoring cancer "disease states" in accordance with embodiments of the present invention includes the monitoring of disease progression in a subject.
- the degree of differentiation between stages of cancer capable of being elucidated in accordance with the present disclosure will depend on the particular cancer under investigation, It will be understood that as used herein the term "expression” may refer to expression of a SENEX polypeptide or protein, or to expression of a SENEX polynucleotide or gene, depending on the context.
- Expression may be determined directly or indirectly.
- Expression of a polynucleotide may be determined, for example, by measuring the production of RNA transcript levels.
- Expression of a protein or polypeptide may be determined, for example, by immunoassay using an antibody(ies) that bind with the polypeptide.
- polypeptide means a polymer made up of amino acids linked together by peptide bonds.
- polypeptide and protein are used interchangeably herein, although for the purposes of the present disclosure a “polypeptide” may constitute a portion of a full length protein.
- polynucleotide refers to a single- or double-stranded polymer of deoxyhbonucleotide, or ribonucleotide bases or known analogues of natural nucleotides, or mixtures thereof. In some contexts in the present specification the terms “polynucleotide” and “nucleic acid molecule” are used interchangeably.
- response as used herein in the context of a subject's "response” to a specific treatment or therapy may be used to refer to both or either clinical response or cellular response. That is, in accordance with the invention a subject's response to the administration of a treatment regime or therapy may be characterised by, or assessed in terms of, the clinical response of the subject, for example as determined by changes in any one or more symptoms of the cancer.
- the response of the subject may be assessed or measured at the molecular or cellular level, for example in terms of altered gene expression patterns, changes in cellular morphology, changes in levels of markers of cellular senescence, or changes in the level of production and/or secretion of molecules such as signalling molecules or extracellular matrix constituents.
- SENEX refers to senescence-associated gene described herein and “SENEX” refers to the protein or polypeptide encoded by this gene. Whilst typically referring to the gene and polypeptide as found in humans, or to derivatives, fragments or variants thereof as disclosed herein, those skilled in the art will appreciate that homologues of human SENEX from other species are also contemplated and encompassed by the present disclosure.
- the cDNA encoding human SENEX is located in the National Center for Biotechnology Information (NCBI) database as RefSeq Accession No. NM033515 (GenBank Accession No. AB053293) and is referred to in RefSeq as ARHGAP18 and MacGAP.
- Human SENEX protein or polypeptide may comprise the amino acid sequence as set forth in SEQ ID ⁇ . ⁇
- the polynucleotide encoding human SENEX may comprise the nucleotide sequence as set forth in SEQ ID NO:2.
- subject refers to mammals and includes humans, primates, livestock animals (eg. sheep, pigs, cattle, horses, donkeys), laboratory test animals (eg. mice, rabbits, rats, guinea pigs), companion animals (eg. dogs, cats) and captive wild animals (eg. foxes, kangaroos, deer), Typically, the mammal is human or a laboratory test animal. Even more typically, the mammal is a human.
- treating and “treatment” and variations thereof refer to any and all uses which remedy a cancer or symptoms thereof, prevent the establishment of a cancer, or otherwise prevent, hinder, retard, or reverse the progression of a cancer or other undesirable symptoms in any way whatsoever.
- treating does not necessarily imply that a patient is treated until total recovery.
- the treatment need not necessarily remedy, prevent, hinder, retard, or reverse all of said symptoms, but may prevent, hinder, retard, or reverse one or more of said symptoms.
- Human SENEX is a 663 amino acid comprising a conserved RhoGAP domain, that acts as a regulator of cellular senescence and apoptosis in various cell types.
- SENEX co-localises with ⁇ -galactosidase, a marker of senescence, in breast tissue and over- expression of SENEX in mammary epithelial cells induces senescence.
- SENEX-induced senescent cells exhibit the established senescence criteria of inhibited proliferation, a flattened, large vacuolated cellular morphology, polyploidy, and positive staining with the senescence marker ⁇ -galactosidase.
- the expression .of SENEX is also shown herein to be highly regulated during normal breast - development and expression changes correlate with different stages of breast cancer.
- Breast cancer is a heterogeneous disease typically classified, and tumours graded, according to histological appearance, and expression of specific markers.
- An exemplary progression from normal breast pathology through to malignant, metastatic tumour may originate in epithelial cells of the terminal duct lobular unit, progression to atypical ductal hyperplasia (ADH), non- invasive ductal carcinoma in situ (DCIS) Grade I, DCIS Grade li, DCIS Grade III, invasive ductal carcinoma (IDC) Grade I, IDC Grade II, IDC Grade III and finally metastatic IDC.
- ADH atypical ductal hyperplasia
- DCIS non- invasive ductal carcinoma in situ
- DCIS Grade I DCIS Grade li
- DCIS Grade III invasive ductal carcinoma
- IDC invasive ductal carcinoma
- SENEX As exemplified herein the degree of cellular senescence varies through this progression, as does the expression level of SENEX. Whilst SENEX is essentially absent in normal breast tissue, expression levels increase in benign neoplasms and hyperplasia and further increase significantly in DCIS (Grades I, II and III) and IDC (in particular Grade II and Grade III), but then decrease again in lymph node metastatic IDC. These changes correlate with cellular senescence, and moreover SENEX expression levels are induced by chemotherapeutic agents such as doxorubicin and camptothecin. Moreover, the inventors have also found that SENEX is expressed in both prostate and colorectal cancer while being absent from normal prostate and bowel tissue, and that SENEX expression increases with prostate cancer progression.
- a method for determining the efficacy of cancer treatment in a subject comprising: (a) determining the level of expression of SENEX in a cancerous cell(s), tissue or fluid in the subject; (b) treating the subject with a treatment regime for a period sufficient to evaluate the efficacy of the regime; and (c) subsequently determining the level.
- the method may comprise repeating step (c) at least once over the period of treatment; and (d) determining whether the level of expression of SENEX changes over the period of treatment, wherein an increase in the level of expression of SENEX in the cancerous cell(s), tissue or fluid over the period of treatment is indicative of the efficacy of the treatment regime.
- the method may comprise excluding the determination- of SENEX expression levels prior to administration of the treatment.
- a method for diagnosing or monitoring a cancer disease state in a subject known to suffer from or suspected of having a cancer comprising determining the level of expression of SENEX in a tissue or bodily fluid associated with the cancer, wherein the level of expression of SENEX is indicative of the cancer disease state.
- reference to SENEX should be understood as a reference to all forms of the polypeptide molecule and to functional derivatives and homologues thereof. For example, included therefore are any isoforms which may arise from alternative splicing of the subject SENEX mRNA or functional mutants or polymorphic variants of these proteins. Similarly, reference to SENEX should be understood as a reference to all forms of the polynucleotide molecule encoding SENEX including genomic DNA and mRNA, and fragments and homologues thereof.
- Embodiments of the invention contemplate the determination of expression levels of SENEX polypeptide, or a fragment or variant thereof.
- the SENEX may be derived from a human and may comprise an amino acid sequence as set forth in SEQ ID NO: 1 , or be encoded by a polynucleotide comprising a nucleotide sequence as set forth in SEQ ID NO: 2. Expression may also be determined at the level of the SENEX transcript.
- SENEX polypeptide expression may be determined by any suitable means, including, by way
- SENEX expression at the nucleic acid level may also be determined by any suitable means, including by way of example only, reverse transcription PCR, quantitative PGR, microarray expression profiling, northern blotting, and serial analysis of gene expression (SAGE).
- SAGE serial analysis of gene expression
- variants refers to substantially similar ' sequences.
- polypeptide sequence variants possess qualitative biological activity in common.
- a variant polypeptide sequence may be a derivative of a sequence as disclosed herein, which derivative comprises the addition, deletion, or substitution of one or more amino acids.
- variants of the human SENEX disclosed herein may possess about 70% sequence identity to the amino acid sequence set forth in SEQ ID NO: 1 ,
- the variant may comprise amino acid sequences having at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 1.
- variant encompasses polypeptide sequences modified from those disclosed herein by any suitable means.
- variant as used herein are also applicable to nucleotide sequences with similar scope as defined above.
- Embodiments disclosed herein provide methods determining the efficacy of a cancer treatment regime, and for monitoring the ongoing effectiveness of a treatment regime over time in an individual. Such determination and monitoring can facilitate decision making with respect to the most appropriate intervention or treatment regime for an individual subject.
- the treatment regime can be tailored to an individual subject so as to obtain maximum therapeutic benefit. For example, this may comprise introducing a new treatment regime or modifying an existing regime with a view to improving disease symptoms or other parameters.
- the modification of a regime may be modification with respect to any one or more of a variety of factors, such as the nature of any existing medication, the dosage thereof, the timing of administration and/or any supplementary disease management strategies.
- Such decision making with respect to treatment regimes will vary from case to case and the determination of the most appropriate strategy is well within the expertise and experience of those skilled in the art.
- a treatment regime for the treatment of a cancer in a subject as disclosed herein may involve administration of any medications commonly utilised in the treatment of the particular cancer in question and/or may involve a variety of other physical medical, psychological and/or psychiatric treatments.
- the treatment regime may comprise the administration of a number of drugs simultaneously, sequentially, or in combination with each other.
- the type of drug(s) administered, dosage, and the frequency of administration can be determined by those directing the administration of the drugs in accordance with accepted medical principles, and will typically depend on factors such as the severity of the disease, the age and weight of the subject, the medical history of the subject, other medication being taken by the subject, existing ailments and any other health related factors normally considered when determining treatments.
- control sample may refer to one or more biological samples from individuals or groups of individuals diagnosed as not having the cancer for which a subject is being assessed, or alternatively from individuals or groups of individuals diagnosed as having a specific cancer or grade of cancer.
- a "control sample” may comprise the compilation of data from one or more individuals whose diagnosis as a "control” for the purposes of the present disclosure has been confirmed. That is, for the purposes of practicing embodiments disclosed herein samples to be used as controls need not be specifically or immediately obtained for the purpose of comparison with the sample(s) obtained from the subject under assessment.
- normal endogenous levels of expression of SENEX may be those levels in non-senescent, non- cancerous cells from one individual or a group of individuals.
- this "normal endogenous level” is likely to correspond to a range of levels, as opposed to a singularly uniform discrete level, due to differences between cohorts of individuals.
- cohort is meant a cohort characterised by one or more features which are also characteristic of the subject who is undergoing treatment. These features include, but are not limited to, age, gender or ethnicity, for example.
- reference herein to elevated or reduced SENEX levels relative to normal endogenous levels is a reference to increased or decreased SENEX levels relative to either a discrete level which may have been determined for healthy non-cancerous cells * of the individual, cells of normal individuals who are representative of the same cohort as the individual being treated, or relative to a defined range which corresponds to that expressed by a population of individuals corresponding to those from a range of different cohorts.
- reference to "normal endogenous levels” should be understood as a reference to the level of SENEX in cells of a subject in which senescence or apoptosis (as appropriate) is normally regulated.
- kits suitable for use in accordance with the methods disclosed herein may include for example diagnostic kits for assaying biological samples, comprising an agent for detecting SENEX, or encoding nucleic acid molecules, and reagents useful for facilitating the detection by the agent(s). Further means may also be included, for example, to receive a biological sample.
- the agent(s) may be any suitable detecting molecule.
- Kits according to the present disclosure may also include other components required to conduct the methods disclosed herein, such as buffers and/or diluents.
- the kits typically include containers for housing the various components and instructions for using the kit components in the methods of the present invention.
- Example 1 SENEX and senescence in breast tissue and mammary epithelial cells
- Expression of SENEX was measured by quantitative RT-PCR (qPCR) with SYBR-Green staining using the following primers, generating a 256 bp product:
- SENEX mRNA expression is significantly decreased in breast tissue during pregnancy, lactation and involution compared to the expression ' levels observed in breast tissue from virgin mice. This expression pattern is similar to that seen for classical tumour suppressor genes such as p14 and p16.
- p16 and p21 expression were also investigated.
- Stable cell lines derived from MDAMB231 breast tumour cells expressing human p16 or p21 from a tetracyline-responsive promoter were kindly provided by Dr Alexey Bazarov (University of California). Cells were stimulated for 48 hours with doxycycline to induce p16 or p21 expression and then SENEX mRNA expression, relative to TBP (Tata-binding protein) mRNA, was examined by qPCR. Primers and conditions for PCR analysis of SEA/EX were as described above.
- HMECs human mammary epithelial cells
- Anti-rabbit secondary antibodies conjugated to Horseradish peroxidase (1/1000, one hour at ' room temp) were applied to the arrays and detected using DAKO EnVision peroxidase detection system. Stained sections were counter-stained with haematoxylin. As shown in Figure 4B, SENEX expression co-localises with expression of ⁇ -galactosidase in IDC tissue,
- tissue microarray slides from US BioMax containing formalin-fixed paraffin-embedded samples of breast tissue were analysed.
- the microarray represents a progression of breast cancer from normal breast tissue, hyperplasia, benign tumour, invasive ductal carcinoma (grades I to III) through to invasive ductal carcinoma with lymph node metastasis.
- Slides were boiled in acidic citfate buffer for 20 minutes and then blocked (5 mins Avidin Block, 5 mins Biotin Block, 10 mins protein Block) prior to being immunohistochemically stained for SENEX, using a polyclonal antibody raised in rabbit (1/100, two hours at room temp).
- Anti-rabbit secondary antibodies conjugated to Horseradish peroxidase (1/1000, one hour at room temp) were applied to the arrays and detected using DAKO EnVision peroxidase detection system. Stained sections were counter- stained with haematoxylin.
- the inventors then further investigated the expression levels of SENEX in shops of ductal carcinoma in situ (DCIS).
- DCIS ductal carcinoma in situ
- the tissue microarray containing breast tissue was obtained from the Garvan Institute. Staining and detection were carried out as described above.
- the data shown in Figure 6 is derived from four arrays. It should also be noted that the normal tissue is predominantly "tumour-associated normal tissue".
- SENEX expression was observed in a high proportion of DCIS and IDC samples compared to normal breast tissue, and moreover expression was higher in a greater proportion of DCIS samples than IDC samples.
- Example 3 - SENEX expression is induced in HMECs by chemotherapeutic agents
- Example 2 above illustrates that SENEX expression is significantly increased in invasive ductal carcinomas. As it is likely that patients having invasive ductal carcinoma will have undergone (or are undergoing) some form of therapeutic treatment such as chemotherapy, the inventors investigated the relationship between chemotherapeutic agent administration and SENEX expression.
- Ct cycle threshold
- FIG. 7A cells treated with doxorubicin show positive staining for senescence- associated ⁇ -galactosidase and exhibit classical senescence morphology.
- Figure 7B shows that SENEX expression in doxorubicin treated cells increases significantly, peaking by about 9 days post doxorubicin treatment.
- the human SENEX gene resides on the long arm of chromosome 6 at locus 6q22.33. Loss of the 6q22 region has been implicated in the development of ER/PR ⁇ breast tumours (Hu et al., 2009). The inventors therefore investigated the expression levels of SENEX in breast cancer subtypes that are likely to be ER/PR ⁇ .
- Tissue microarray slides from US BioMax containing formalin-fixed paraffin-embedded samples of normal breast tissue, benign fibroadenosis, invasive ductal carcinoma and mucinoius carcinoma were analysed.
- Mucinous breast cancers are a heterogeneous group.
- "Pure" mucinous tumours may have neuroendocrine differentiation and be ER/PR ⁇ ; these tumours have the best prognosis.
- Some mucinous carcinomas however, have a component of IDC or micropapillary carcinoma, and these may be ER/PR- ve . These tumours have a poorer prognosis.
- a tissue microarray containing normal and tumour prostate tissue (US BioMax) was prepared and immunohistochemically stained for SENEX in the same manner as described above for breast tissue in Example 2. As shown in Figure 9A, SENEX is absent in the normal prostate but can be detected in the epithelial cells of prostate tumour tissue.
- the inventors also investigated the expression of SENEX in normal bowel and colorectal cancer tissue samples. Tissue microarrays were prepared and immunohistochemically stained for SENEX in the same manner as described above for breast tissue in Example 2. As shown in Figure 10, SENEX is expressed in colorectal cancer tissue (71% of tissue samples scored; Figure 10B) but is absent in normal bowel tissue.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Biotechnology (AREA)
- Pathology (AREA)
- Cell Biology (AREA)
- Microbiology (AREA)
- Food Science & Technology (AREA)
- General Physics & Mathematics (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Toxicology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Provided herein are methods for diagnosing cancer disease states and determining the efficacy of cancer treatments in subjects, the methods utilising a determination of expression levels of SENEX polypeptides or SENEX-encoding nucleic acid molecules.
Description
Diagnostic and prognostic methods for cancer
Field of the Invention
The present invention relates generally to the diagnosis of cancer disease states and the evaluation of the likelihood of a subject's response to treatment for cancer, based on determination of expression levels of the senescence-inducing polypeptide SENEX or the encoding polynucleotide SENEX.
Background of the Invention
Despite advances in our understanding and therapeutic treatment of many forms of cancer, cancer remains one of the leading causes of death around the world, with prevalence of many cancers on the increase. In women breast cancer is the leading or second leading cause of cancer death in most populations, and is the most common form of cancer diagnosed in women. Similarly, in men prostate cancer is the leading or second leading cause of cancer death and is the most prevalent cancer found in men.
Prognosis for patients suffering from breast cancer and prostate cancer,, and indeed many other forms of cancer, can be substantially improved with early and effective diagnosis. Early diagnosis allows early intervention with therapeutic treatments. Similarly, knowledge of the stage of the disease in a patient can enable the employment of the most appropriate therapeutic treatment and/or patient management for that disease state, There is also a need for the ability to monitor the effectiveness of treatment over time as a patient's condition can deteriorate if treatment is not effective and, for example, the cancer metastasizes.
Furthermore, the ability to determine the efficacy of a particular treatment, or the likelihood of response of a particular patient to a specific treatment enables the development of personalized approaches to cancer treatment. It is becoming increasingly clear that the responses of different patients to a particular therapeutic agent or combination of agents may differ. Hence there is a growing interest in so-called personalized medicine where treatments are tailored more specifically to the individual to be treated.
Thus, crucial to effective cancer therapy and cancer patient management is the ability to not only effectively diagnose the disease and/or the disease state but also monitor the development of the disease and the effectiveness of treatment. Somatic cells have a finite proliferative capacity. Cellular senescence constitutes a major pathway for the regulation of cell proliferation and plays a role in limiting disease progression, such as in the suppression of tumourigenesis (see, for example, Collado et al., 2005).
The recognition of senescent cells relies on a number of specific criteria. The cells exit the cell cycle although remain viable, they exhibit a large flattened morphology and show accumulation of senescence associated /3-galactosidase (SA-/3-gal) activity. Furthermore, they show altered gene expression profiles which may be cell type specific. There are two broad forms of senescence, replicative and stress induced. Replicative senescence is mediated through the shortening of telomeres that occurs after each cell division. This shortening eventually registers as DNA damage and triggers ATM activation and initiates a program of cell cycle arrest. Stress induced premature senescence (SIPS) may be induced by oncogenes, by oxidative stress, or by suboptimal culture conditions and occurs independent of a change in telomere length. Senescence is mediated through the p53 pathway which transactivates the cyclin dependent kinase inhibitor p21 , or through the p16 pathway to inhibit the cyclin dependent kinases 2 and 4, preventing the phosphorylation of Rb and thus silencing genes involved in proliferation.
Oncogene-induced senescence is an 'emergency stop' mechanism that induces an irreversible cell cycle arrest in damaged or pre-malignant cells in response to activated oncogenes, DNA damage or telomere dysfunction, thus preventing tumourigenesis. It has been suggested that senescence may play a role as important as apoptosis in both tumour progression and treatment.
Summary of the Invention
Described for the first time herein is the expression of the senescence-associated polypeptide SENEX in normal and cancerous mammary epithelial cells and the role of SENEX in inducing senescence in cancerous cells. Accordingly, provided herein are methods for diagnosing cancer disease states, methods for predicting the response of subjects to cancer treatments
and methods for monitoring and evaluating the efficacy of cancer treatments.
In a first aspect there is provided a method for determining the efficacy of cancer treatment in a subject, the method comprising:
(a) determining the level of expression of SENEX in a cancerous cell(s), tissue or fluid in the subject;
(b) treating the subject with a treatment regime for a period sufficient to evaluate the efficacy of the regime; and
(c) subsequently determining the level of expression of SENEX in a cancerous cell(s), tissue or fluid in the subject,
wherein an increase in the level of expression of SENEX in the cancerous cell(s), tissue or fluid following said treatment is indicative of the efficacy of the treatment regime.
Optionally the method further comprises repeating step (c) at least once over the period of treatment; and (d) determining whether the level of expression of SENEX changes over the period of treatment, wherein an increase in the level of expression of SENEX in the cancerous cell(s), tissue or fluid over the period of treatment is indicative of the. efficacy of the treatment regime. Typically the step of determining the level of expression of SENEX in cancerous cell(s), tissue or fluid comprises isolating a sample of cancerous cell(s), tissue or fluid from the subject and determining the level of expression of SENEX ex vivo in the isolated sample. SENEX expression may be determined at the protein or the nucleic acid level. Protein expression may be determined by any suitable means, including for example enzyme linked immunosorbent assay (ELISA), immunoblotting, two-dimensional gel electrophoresis, multiplex protein expression assays, flow cytometry and protein expression profiling arrays and microarrays. SENEX expression at the nucleic acid level may be determined by any suitable means, including for example reverse transcription PCR, quantitative PCR, microarray expression profiling, northern blotting, and serial analysis of gene expression (SAGE). Typically the SENEX polypeptide comprises the amino acid sequence as set forth in SEQ ID NO:1 or is a fragment, variant or homologue thereof. The polynucleotide encoding SENEX may comprise a nucleotide sequence as set forth in SEQ ID NO:2, or a fragment, variant or homologue thereof.
The treatment regime may comprise, for example, chemotherapy and/or radiotherapy. Typically the treatment regime comprises a chemotherapeutic agent or a combination of chemotherapeulic agents. In one embodiment the chemotherapeutic agent is a DNA intercalating agent such as doxorubicin or DNA topoisomerase inhibitor such as camptothecin.
In an exemplary embodiment the cancer is selected from breast cancer, colorectal cancer and prostate cancer. The breast cancer may be a benign neoplasm or tumour, ductal carcinoma in situ or invasive ductal carcinoma. In a second aspect there is provided a method for determining the efficacy of cancer treatment in a subject, the method comprising:
(a) treating the subject with a treatment regime for a period sufficient to evaluate the efficacy of the regime; and
(b) subsequently determining the level of expression of SENEX in a cancerous cell(s), tissue or fluid in the subject,
wherein an increase in the level of expression of SENEX in the cancerous cell(s), tissue or fluid following said treatment is indicative of the efficacy of the treatment regime,
Optionally the method further comprises repeating step (b) at least once over the period of treatment; and (c) determining whether the level of expression of SENEX changes over the period of treatment, wherein an increase in the level of expression of SENEX in the cancerous cell(s), tissue or fluid over the period of treatment is indicative of the efficacy of the treatment regime. ' In a third aspect there is provided a method for diagnosing a cancer disease state in a subject known to suffer from, or suspected of having, a cancer, the method comprising determining the level of expression of SENEX in a tissue or bodily fluid associated with the cancer, wherein the level of expression of SENEX is indicative of the cancer disease state. Typically the expression of SENEX is determined ex vivo in a sample isolated from the subject.
In an exemplary embodiment the cancer is selected from breast cancer, colorectal cancer and prostate cancer. The breast cancer may be a benign neoplasm or tumour, ductal carcinoma in
situ or invasive ductal carcinoma.
Typically the level of expression of SENEX in the subject is compared to the level of expression of SENEX in one or more control samples. In an embodiment, the subject is suspected of having a cancer and the control samples are derived from one or more individuals known not to suffer from the cancer, wherein increased expression of SENEX in the tissue or fluid from the subject compared to the one or more control samples is indicative that the subject has the cancer. In an alternative embodiment, the subject suffers from a cancer and the control samples represent different stages of progression of the cancer, wherein the level of expression of SENEX in the sample from the subject compared to the level of expression of SENEX in the control samples is indicative of the disease state of the cancer in the subject. For example, the cancer may be breast cancer and the disease state may be benign, hyperplastic, invasive ductal carcinoma grade I, II or III or metastatic invasive ductal carcinoma,
In a fourth aspect there is provided a method for designing a suitable treatment regime for a subject suffering from cancer, the method comprising monitoring the level of expression of SENEX in cancerous cell(s), tissue or fluid in the subject in the presence or absence of a treatment regime for treating the cancer and adjusting the identity; timing and/or intensity of the treatment regime so as to increase the level of expression of SENEX in the cancerous cell(s), tissue or fluid.
In a fifth aspect there is provided a method for identifying a compound suitable for treating a cancer in a subject, the. method comprising:
(a) isolating at least one cancerous cell from the subject;
(b) determining the level of expression of SENEX in the at least one cell;
(c) contacting the at least one cell with a candidate compound; and
(d) subsequently determining the level of expression of SENEX in the at least one cell, wherein an increase in the level expression of SENEX between steps (b) and (d) is indicative of the ability of compound to treat the cancer.
Thus, in accordance with the fourth and fifth aspects defined above, the present disclosure
provides methods for predicting or evaluating the response of a subject to a particular cancer treatment regime or therapy.
Accordingly, a sixth aspect provides a method of treating cancer in a subject, the method comprising administering to the subject a treatment regime designed in accordance with the fourth aspect or a compound identified in accordance with the fifth aspect.
Brief Description of the Drawings
Embodiments of the invention are described herein, by way of non-limiting example only, with reference to the following drawings.
Figure 1. SENEX expression is regulated during development and proliferation in the normal murine breast. .SENEX mRNA expression was measured by qPCR in the isolated mammary glands of virgin, pregnant (p12.5, p18.5), and lactating (L4, L7) mice and during involution (i3, Ϊ7, i10). Expression was decreased in the pregnant, lactating and involuting breast compared to the virgin breast.
Figure 2. SENEX expression is increased during' p16INK A-mediated senescence in a breast cancer cell line. MDAMB231 cells expressing p16 (TET-p16) or p21 (TET-p21) from a tetracycline-inducible promoter were treated with doxycycline for 5 days. A. Expression of p16 and p21 induced breast cancer cell senescence in doxycycline treated cells. B. SENEX expression was measured by qPCR. relative to Tata-binding protein (TBP), and found to increase in response to p16 but not p21.
Figure 3. Over-expression of SENEX induces senescence in human mammary epithelial cells. Human mammary epithelial cells overexpressing SENEX in combination with GFP (right panels) show a greater degree of senescence than cells overexpressing GFP alone (left panels). Cells overexpressing SENEX show a large flattened morphology indicative of senescence. Top, phase contrast micrographs. Bottom, fluorescence micrographs. Figure 4, SENEX co-localises with markers of cellular senescence in breast tumours. A. Frozen sections of human breast tissue stained for senescence-associated β-galactosidase illustrating that senescent cells can be detected in the cancerous (invasive ductal carcinoma)
tissue but not normal (cancer-adjacent) tissue. B. Serial sections of invasive ductal carcinoma tissue stained for SENEX and β-galactosidase showing co-localisation of staining.
Figure 5. SENEX expression in a breast cancer progression tissue microarray. A. A tissue microarray containing a cohort of breast cancer progression tissues ranging from normal to grade III invasive ductal carcinoma (IDC) and IDC with lymph node metastasis (LN METS) immunohistochemically stained for SENEX. B. Scoring of a breast cancer tissue microarray stained for SENEX. Tissue samples are from the equivalent progressions as depicted in A. As shown in A and B, SENEX staining was limited in normal breast tissue, but increased in hyperplastic tissue (A, hyperplasia; B, DCIS) and benign neoplasms. IDC showed strong and widespread expression of SENEX, which increased with grade, but decreased significantly in metastatic tissue (LN METS).
Figure 6. SENEX expression in a breast cancer progression tissue microarray. Scoring of immunohistochemical staining of tissue microarrays comprising normal breast tissue, Grades 1 , 2 and 3 ductal carcinoma in situ (DCIS), and invasive ductal carcinoma (IDC) showing higher levels of SENEX expression in Grades 1 , 2 and 3 DCIS than in IDC.
Figure 7. Chemotherapeutic agents induce SENEX expression and senescence. A. Phase- contrast micrographs of human mammary epithelial cells treated with 100nM doxorubicin for 12 days or untreated (control) and stained for senescence-associated β-galactosidase. B. Human mammary epithelial cells treated with doxorubicin (dark bars) for 1-12 days show increased SENEX expression (measured by qPCR) by 3-6 days. Light bars, SENEX expression in human mammary epithelial cells untreated with doxorubicin. C. Phase-contrast micrographs of human mammary epithelial cells treated with 20nM camptothecin for 6 days or untreated (control) and stained for senescence-associated β-galactosidase. D. Camptothecin increased SENEX mRNA expression, as measured by qPCR, compared to control DMSO-treated cells.
Figure 8. SENEX expression in ER/PR+ve tumours. A. Representative immunohistochemical staining of a breast cancer progression tissue microarray shows expression of SENEX in both benign neoplasms of the breast and invasive ductal carcinoma, whilst in mucinous carcinoma tissue staining was low or negative. B. Scoring (immunohistochemical (IHC) score) of the
tissue microarray shows that SENEX expression was high and widespread in benign neoplasms and invasive ductal carcinoma (IDC), but was low or absent in mucinous carcinoma.
Figure 9. SENEX expression in prostate cancer. A, Representative immunohistochemical staining of microarrayed normal and cancerous prostate tissue for SENEX illustrating that SENEX is present in epithelial cells of the cancerous tissue but absent in the normal (noncancerous) tissue. B, Representative immunohistochemical staining of microarrayed benign prostatic hyperplasia tissue and prostate cancer tissue for SENEX illustrating that expression of SENEX is increased in prostate cancer relative to benign prostatic hyperplasia. C. Scoring (immunohistochemical (IHC) score) of the tissue microarrays of benign prostatic hyperplasia and prostate cancer shows that 3/13 (13%) benign prostatic hyperplasia samples were positive for SENEX, whereas 20/40 (50%) prostate cancer samples were positive for SENEX.
Figure 10. SENEX is not expressed in normal bowel but is expressed in colorectal cancer. A. Representative immunohistochemical staining of microarrayed normal bowel tissue and colorectal cancerous tissue for SENEX illustrating expression of SENEX in cancerous tissue and absence in normal bowel tissue. B. Scoring (immunohistochemical (IHC) score) of the tissue microarrays shows that 0/5 normal bowel samples were positive for SENEX, whereas 17/24 (71 %) colorectal cancer tissue samples were positive for SENEX.
The subject specification contains amino acid and nucleotide sequence information prepared using the programme Patentln Version 3.4, presented herein in a Sequence Listing. Nucleotide and amino acid sequences are referred to by a sequence identifier number (SEQ ID NO:). The SEQ ID NOs: correspond numerically to the sequence identifiers <400>1 (SEQ ID NO:1), <400>2 (SEQ ID NO:2), etc. Specifically, the amino acid sequence of human SENEX is provided in SEQ ID NO:1 and the nucleotide sequence of human SENEX is provided in SEQ ID NO:2. SEQ ID NOs:3 to 8 provide the sequences of various oligonucleotide primers used in the Examples.
Detailed Description
The articles "a" arid "an" are used herein to refer to one or to more than one {i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.
, Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.
As used herein, the term "cancer" is given its broadest meaning as a disease characterized by the abnormal and uncontrolled proliferation of cells, and thus includes benign, potentially malignant and malignant neoplasms, carcinomas, sarcomas, blastomas, lymphomas and leukemias. Accordingly, the cancer may or may not be a solid tumour. Thus, in assessing cancerous cells in a subject or isolating cancerous cells from a subject, a specific tissue or bodily fluid in which the cancer resides or which otherwise contains the cancerous cells may be analysed or isolated. As used herein, the term "disease state" means the status of a cancer or tumour in a subject. In the context of the diagnosis of a cancer disease state, the term encompasses not only the diagnosis of the cancer per se in a subject previously not confirmed as having the cancer, but also the diagnosis of the stage of a cancer, for example benign, malignant or metastatic. Thus, diagnosing and monitoring cancer "disease states" in accordance with embodiments of the present invention includes the monitoring of disease progression in a subject. Those skilled in the art will appreciate that the degree of differentiation between stages of cancer capable of being elucidated in accordance with the present disclosure will depend on the particular cancer under investigation, It will be understood that as used herein the term "expression" may refer to expression of a SENEX polypeptide or protein, or to expression of a SENEX polynucleotide or gene, depending on the context. Expression may be determined directly or indirectly. Expression of a polynucleotide may be determined, for example, by measuring the production of RNA transcript levels. Expression of a protein or polypeptide may be determined, for example, by immunoassay using an antibody(ies) that bind with the polypeptide.
As used herein the term "polypeptide" means a polymer made up of amino acids linked together by peptide bonds. The terms "polypeptide" and "protein" are used interchangeably
herein, although for the purposes of the present disclosure a "polypeptide" may constitute a portion of a full length protein. The term "polynucleotide" as used herein refers to a single- or double-stranded polymer of deoxyhbonucleotide, or ribonucleotide bases or known analogues of natural nucleotides, or mixtures thereof. In some contexts in the present specification the terms "polynucleotide" and "nucleic acid molecule" are used interchangeably.
The term "response" as used herein in the context of a subject's "response" to a specific treatment or therapy may be used to refer to both or either clinical response or cellular response. That is, in accordance with the invention a subject's response to the administration of a treatment regime or therapy may be characterised by, or assessed in terms of, the clinical response of the subject, for example as determined by changes in any one or more symptoms of the cancer. Alternatively or in addition, the response of the subject may be assessed or measured at the molecular or cellular level, for example in terms of altered gene expression patterns, changes in cellular morphology, changes in levels of markers of cellular senescence, or changes in the level of production and/or secretion of molecules such as signalling molecules or extracellular matrix constituents.
As used herein "SENEX" refers to senescence-associated gene described herein and "SENEX" refers to the protein or polypeptide encoded by this gene. Whilst typically referring to the gene and polypeptide as found in humans, or to derivatives, fragments or variants thereof as disclosed herein, those skilled in the art will appreciate that homologues of human SENEX from other species are also contemplated and encompassed by the present disclosure. The cDNA encoding human SENEX is located in the National Center for Biotechnology Information (NCBI) database as RefSeq Accession No. NM033515 (GenBank Accession No. AB053293) and is referred to in RefSeq as ARHGAP18 and MacGAP. Human SENEX protein or polypeptide may comprise the amino acid sequence as set forth in SEQ ID ΝΟ.Ί , and the polynucleotide encoding human SENEX may comprise the nucleotide sequence as set forth in SEQ ID NO:2.
The term "subject" as used herein refers to mammals and includes humans, primates, livestock animals (eg. sheep, pigs, cattle, horses, donkeys), laboratory test animals (eg. mice, rabbits, rats, guinea pigs), companion animals (eg. dogs, cats) and captive wild animals (eg. foxes, kangaroos, deer), Typically, the mammal is human or a laboratory test animal. Even more typically, the mammal is a human.
As used herein the terms "treating" and "treatment" and variations thereof refer to any and all uses which remedy a cancer or symptoms thereof, prevent the establishment of a cancer, or otherwise prevent, hinder, retard, or reverse the progression of a cancer or other undesirable symptoms in any way whatsoever. Thus the term "treating" (and the like) is to be considered in its broadest context. For example, treatment does not necessarily imply that a patient is treated until total recovery. In cancers that display or are characterized by multiple symptoms, the treatment need not necessarily remedy, prevent, hinder, retard, or reverse all of said symptoms, but may prevent, hinder, retard, or reverse one or more of said symptoms.
' Human SENEX is a 663 amino acid comprising a conserved RhoGAP domain, that acts as a regulator of cellular senescence and apoptosis in various cell types. As exemplified herein SENEX co-localises with β-galactosidase, a marker of senescence, in breast tissue and over- expression of SENEX in mammary epithelial cells induces senescence. SENEX-induced senescent cells exhibit the established senescence criteria of inhibited proliferation, a flattened, large vacuolated cellular morphology, polyploidy, and positive staining with the senescence marker β-galactosidase.
The expression .of SENEX is also shown herein to be highly regulated during normal breast - development and expression changes correlate with different stages of breast cancer. Breast cancer is a heterogeneous disease typically classified, and tumours graded, according to histological appearance, and expression of specific markers. An exemplary progression from normal breast pathology through to malignant, metastatic tumour may originate in epithelial cells of the terminal duct lobular unit, progression to atypical ductal hyperplasia (ADH), non- invasive ductal carcinoma in situ (DCIS) Grade I, DCIS Grade li, DCIS Grade III, invasive ductal carcinoma (IDC) Grade I, IDC Grade II, IDC Grade III and finally metastatic IDC. As exemplified herein the degree of cellular senescence varies through this progression, as does the expression level of SENEX. Whilst SENEX is essentially absent in normal breast tissue, expression levels increase in benign neoplasms and hyperplasia and further increase significantly in DCIS (Grades I, II and III) and IDC (in particular Grade II and Grade III), but then decrease again in lymph node metastatic IDC. These changes correlate with cellular senescence, and moreover SENEX expression levels are induced by chemotherapeutic agents such as doxorubicin and camptothecin. Moreover, the inventors have also found that SENEX
is expressed in both prostate and colorectal cancer while being absent from normal prostate and bowel tissue, and that SENEX expression increases with prostate cancer progression.
Accordingly, provided herein are, inter alia, methods for diagnosing cancer disease states, methods for monitoring cancer progression, methods for evaluating the efficacy of a cancer treatment and methods for determining or predicting the likely response of a subject to a cancer treatment, premised on the analysis of SENEX expression levels in cancerous, or suspected cancerous, tissue or fluid in a subject. In one aspect there is provided a method for determining the efficacy of cancer treatment in a subject, the method comprising: (a) determining the level of expression of SENEX in a cancerous cell(s), tissue or fluid in the subject; (b) treating the subject with a treatment regime for a period sufficient to evaluate the efficacy of the regime; and (c) subsequently determining the level. of expression of SENEX in a cancerous cell(s), tissue or fluid in the subject, wherein an increase in the level of expression of SENEX in the cancerous cell(s), tissue or fluid following said treatment is indicative of the efficacy of the treatment regime. Optionally, the method may comprise repeating step (c) at least once over the period of treatment; and (d) determining whether the level of expression of SENEX changes over the period of treatment, wherein an increase in the level of expression of SENEX in the cancerous cell(s), tissue or fluid over the period of treatment is indicative of the efficacy of the treatment regime. Also optionally, the method may comprise excluding the determination- of SENEX expression levels prior to administration of the treatment.
In another aspect there is provided a method for diagnosing or monitoring a cancer disease state in a subject known to suffer from or suspected of having a cancer, the method comprising determining the level of expression of SENEX in a tissue or bodily fluid associated with the cancer, wherein the level of expression of SENEX is indicative of the cancer disease state.
It should be understood that the methods disclosed contemplate determination and analysis of SENEX expression levels either ex vivo, in vitro or in vivo, although those skilled in the art will appreciate that in many circumstances the most effective and appropriate means of determining and analysing expression will be by isolating a suitable sample from the individual to be assessed. The nature and extent of the sample can be determined depending on the
circumstances, including the particular cancer in question, the general health of the individual from which the sample is to be taken, the prognosis of the individual and the nature of any treatment currently being administered to the individual or contemplated for the individual. The methods disclosed herein are applicable to any cancer type. Without limiting the scope of the present disclosure, by way of example only the cancer may be selected from breast cancer, colorectal cancer and prostate cancer!
As defined herein, reference to SENEX should be understood as a reference to all forms of the polypeptide molecule and to functional derivatives and homologues thereof. For example, included therefore are any isoforms which may arise from alternative splicing of the subject SENEX mRNA or functional mutants or polymorphic variants of these proteins. Similarly, reference to SENEX should be understood as a reference to all forms of the polynucleotide molecule encoding SENEX including genomic DNA and mRNA, and fragments and homologues thereof.
Embodiments of the invention contemplate the determination of expression levels of SENEX polypeptide, or a fragment or variant thereof. The SENEX may be derived from a human and may comprise an amino acid sequence as set forth in SEQ ID NO: 1 , or be encoded by a polynucleotide comprising a nucleotide sequence as set forth in SEQ ID NO: 2. Expression may also be determined at the level of the SENEX transcript.
SENEX polypeptide expression may be determined by any suitable means, including, by way
• of example only, enzyme Jinked immunosorbent assay (ELISA), immunoblotting, two- dimensional gel electrophoresis, multiplex protein expression assays, flow cytometry and protein expression profiling arrays and microarrays. SENEX expression at the nucleic acid level may also be determined by any suitable means, including by way of example only, reverse transcription PCR, quantitative PGR, microarray expression profiling, northern blotting, and serial analysis of gene expression (SAGE). Those skilled in the art will appreciate that the scope of the present disclosure is not limited in any way by the means of determining SENEX expression, not the nature of the biological sample in which SENEX expression- is determined. Any suitable means for determining, and in particular embodiments for quantifying, SENEX
• expression known to those skilled in the art are contemplated by the present disclosure.
The term "variant" as used herein refers to substantially similar' sequences. Generally, polypeptide sequence variants possess qualitative biological activity in common. A variant polypeptide sequence may be a derivative of a sequence as disclosed herein, which derivative comprises the addition, deletion, or substitution of one or more amino acids. For example, variants of the human SENEX disclosed herein may possess about 70% sequence identity to the amino acid sequence set forth in SEQ ID NO: 1 , The variant may comprise amino acid sequences having at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 1. The term "variant" encompasses polypeptide sequences modified from those disclosed herein by any suitable means. Similarly, the term variant as used herein are also applicable to nucleotide sequences with similar scope as defined above.
Embodiments disclosed herein provide methods determining the efficacy of a cancer treatment regime, and for monitoring the ongoing effectiveness of a treatment regime over time in an individual. Such determination and monitoring can facilitate decision making with respect to the most appropriate intervention or treatment regime for an individual subject. The treatment regime can be tailored to an individual subject so as to obtain maximum therapeutic benefit. For example, this may comprise introducing a new treatment regime or modifying an existing regime with a view to improving disease symptoms or other parameters. The modification of a regime may be modification with respect to any one or more of a variety of factors, such as the nature of any existing medication, the dosage thereof, the timing of administration and/or any supplementary disease management strategies. Such decision making with respect to treatment regimes will vary from case to case and the determination of the most appropriate strategy is well within the expertise and experience of those skilled in the art.
A treatment regime for the treatment of a cancer in a subject as disclosed herein may involve administration of any medications commonly utilised in the treatment of the particular cancer in question and/or may involve a variety of other physical medical, psychological and/or psychiatric treatments. In the case of drug administration, the treatment regime may comprise the administration of a number of drugs simultaneously, sequentially, or in combination with each other. The type of drug(s) administered, dosage, and the frequency of administration can be determined by those directing the administration of the drugs in accordance with accepted
medical principles, and will typically depend on factors such as the severity of the disease, the age and weight of the subject, the medical history of the subject, other medication being taken by the subject, existing ailments and any other health related factors normally considered when determining treatments.
Methods in accordance with embodiments disclosed herein and discussed above are also useful in predicting the response of a. subject to the administration of a cancer treatment regime. The methods described and contemplated herein may therefore play an important role in determining the clinical efficacy of cancer therapies compositions for administration to subjects in need thereof, and those skilled in the art will appreciate that by evaluating the therapeutic potential of a treatment in accordance with embodiments of the present disclosure, clinical response can be improved. A particular application of the present disclosure is in so- called "personalized medicine". The term "personalized medicine" is used herein in its broadest context to refer to the tailoring of pharmaceutical compositions, medicines and other therapies for particular individuals.
In diagnosing and monitoring disease state in accordance with embodiments of the present disclosure, and evaluating the efficacy of a treatment and in monitoring treatment over time, reference may be had to one or more control samples. In this context, the term "control sample" may refer to one or more biological samples from individuals or groups of individuals diagnosed as not having the cancer for which a subject is being assessed, or alternatively from individuals or groups of individuals diagnosed as having a specific cancer or grade of cancer. A "control sample" may comprise the compilation of data from one or more individuals whose diagnosis as a "control" for the purposes of the present disclosure has been confirmed. That is, for the purposes of practicing embodiments disclosed herein samples to be used as controls need not be specifically or immediately obtained for the purpose of comparison with the sample(s) obtained from the subject under assessment. Reference may also be had to normal endogenous levels of expression of SENEX. In one context reference to normal endogenous levels should be understood as a reference to the normal levels of expression of SENEX, either polypeptide or polynucleotide, in normally dividing, non-senescent, non-cancerous cells, typically of a particular cell type and derived from the same tissue or fluid as the tissue or fluid affected by, or associated with, cancer in subjects to which embodiments disclosed herein relate. Normal endogenous levels of SENEX may be those levels in non-senescent, non-
cancerous cells from one individual or a group of individuals. It will be appreciated by those skilled in the art that this "normal endogenous level" is likely to correspond to a range of levels, as opposed to a singularly uniform discrete level, due to differences between cohorts of individuals. By "cohort" is meant a cohort characterised by one or more features which are also characteristic of the subject who is undergoing treatment. These features include, but are not limited to, age, gender or ethnicity, for example. Accordingly, reference herein to elevated or reduced SENEX levels relative to normal endogenous levels is a reference to increased or decreased SENEX levels relative to either a discrete level which may have been determined for healthy non-cancerous cells* of the individual, cells of normal individuals who are representative of the same cohort as the individual being treated, or relative to a defined range which corresponds to that expressed by a population of individuals corresponding to those from a range of different cohorts. It will also be appreciated that in the context of the inducement or inhibition of senescence or apoptosis in a cell, reference to "normal endogenous levels" should be understood as a reference to the level of SENEX in cells of a subject in which senescence or apoptosis (as appropriate) is normally regulated.
The present disclosure also provides kits suitable for use in accordance with the methods disclosed herein. Such kits may include for example diagnostic kits for assaying biological samples, comprising an agent for detecting SENEX, or encoding nucleic acid molecules, and reagents useful for facilitating the detection by the agent(s). Further means may also be included, for example, to receive a biological sample. The agent(s) may be any suitable detecting molecule. Kits according to the present disclosure may also include other components required to conduct the methods disclosed herein, such as buffers and/or diluents. The kits typically include containers for housing the various components and instructions for using the kit components in the methods of the present invention.
Those skilled in the art will appreciate that the aspects and embodiments described herein are susceptible to variations and modifications other than those specifically described. It is to be understood that the disclosure includes all such variations and modifications. The disclosure also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.
The citation of any reference herein should not be construed as an admission that such reference is available as "Prior Art" to the present application. Further, the reference in this specification to any prior publication (or information derived from it), or to any matter which is known, is not, and should not be taken as an acknowledgment or admission or any form of suggestion that that prior publication (or information derived from it) or known matter forms part of the common general knowledge in the field of endeavour to which this specification relates.
The present disclosure is further described by reference to the following non-limiting examples.
Examples
Example 1 - SENEX and senescence in breast tissue and mammary epithelial cells
The expression pattern of SENEX in normal (non-cancerous) breast tissue was first determined. Total RNA was isolated using TriReagen from the mammary gland of C57Black6 mice (virgin, pregnant, lactating and after weaning) by the Breast Cancer Biology Group at King's College London. RNA was DNAse treated and then 1 total RNA was reverse transcribed according to standard procedures. Expression of SENEX was measured by quantitative RT-PCR (qPCR) with SYBR-Green staining using the following primers, generating a 256 bp product:
Forward primer 5' - TACACCATAAACCAAGAAGGCTCCACC - 3' (SEQ ID NO:3) Reverse primer 5' - GCGGGTCATCAATAGACTCTCCAAAAAG - 3' (SEQ ID NO:4) Expression levels were normalised by reference to 18S rRNA levels as a control.
As shown in Figure 1 , SENEX mRNA expression is significantly decreased in breast tissue during pregnancy, lactation and involution compared to the expression ' levels observed in breast tissue from virgin mice. This expression pattern is similar to that seen for classical tumour suppressor genes such as p14 and p16.
The effect of p16 and p21 expression on breast cancer cell senescence and SENEX expression was also investigated. Stable cell lines derived from MDAMB231 breast tumour cells expressing human p16 or p21 from a tetracyline-responsive promoter were kindly provided by Dr Alexey Bazarov (University of California). Cells were stimulated for 48 hours with doxycycline to induce p16 or p21 expression and then SENEX mRNA expression, relative to TBP (Tata-binding protein) mRNA, was examined by qPCR. Primers and conditions for PCR
analysis of SEA/EX were as described above. As shown in Figure 2, expression of both p16 and p21 induced breast cancer cell senescence, however SENEX expression, as measured by qPCR, only increased in response to p16. The inventors then examined the effects of SENEX overexpression in human mammary epithelial cells (HMECs). HMECs were isolated from human mammoplasty tissue by Dr Lily Huschtscha at the Children's Medical Research Institute at Westmead Hospital. Frozen vials of cells were recovered and cultured in HMEC medium in a humidified incubator 37°C 5% CO2. Cells were infected with an adenovirus made using the AdEasy system that expresses human SENEX and GFP from a single CMV promoter. After 4 days culture, cells overexpressing ' SENEX and GFP were compared to cells infected with a control adenoviral vector expressing GFP alone, As shown in Figure 3, overexpression of SENEX induced senescence of HMECs than in the control HMECs in which SENEX expression is unaltered, as evidenced by the greater proportion of cells displaying a classical enlarged, flattened morphology.
This induction of senescence by SENEX overexpression was investigated further in normal and cancerous breast tissue.
First, frozen sections of breast tissue from the NSW Breast Cancer Tissue Bank were fixed in paraformaldehyde, followed by staining with X-gal solution at pH6.0 for senescence-associated β-galactosidase activity. Sections were counter-stained with eosin. The results are shown in Figure 4A. Senescent cells were not observed in normal breast tissue from adjacent to cancerous tissue, however senescence was widespread in invasive ductal carcinoma (IDC) tissue.
To investigate the role of SENEX, sequential Tissue microarray slides from US BioMax containing formalin-fixed paraffin-embedded samples of breast tissue were boiled' in acidic citrate buffer for 20 minutes and then blocked (5 mins Avidin Block, 5 mins Biotin Block, 10 mins protein Block) prior to being immunohistochemically stained for SENEX, using a polyclonal antibody raised in rabbit {1/100, two hours at room temp) and for β-galactosidase using a commercial rabbit polyclonal antibody from Zymed (1/200, two hours at room temp). Anti-rabbit secondary antibodies conjugated to Horseradish peroxidase (1/1000, one hour at ' room temp) were applied to the arrays and detected using DAKO EnVision peroxidase
detection system. Stained sections were counter-stained with haematoxylin. As shown in Figure 4B, SENEX expression co-localises with expression of β-galactosidase in IDC tissue,
Example 2 - SENEX staining in breast cancer progression tissue microarrays
To further investigate SENEX expression patterns in breast tumours, tissue microarray slides from US BioMax containing formalin-fixed paraffin-embedded samples of breast tissue were analysed. The microarray represents a progression of breast cancer from normal breast tissue, hyperplasia, benign tumour, invasive ductal carcinoma (grades I to III) through to invasive ductal carcinoma with lymph node metastasis. Slides were boiled in acidic citfate buffer for 20 minutes and then blocked (5 mins Avidin Block, 5 mins Biotin Block, 10 mins protein Block) prior to being immunohistochemically stained for SENEX, using a polyclonal antibody raised in rabbit (1/100, two hours at room temp). Anti-rabbit secondary antibodies conjugated to Horseradish peroxidase (1/1000, one hour at room temp) were applied to the arrays and detected using DAKO EnVision peroxidase detection system. Stained sections were counter- stained with haematoxylin.
Invasive ductal carcinoma
It is clear from Figure 5A that SENEX staining is limited or negative in normal breast tissue, but is present in benign neoplasms of the breast. SENEX can be detected in invasive ductal carcinoma and increases with grade, however appears to be substantially reduced in invasive ductal carcinoma with lymph node metastasis.
The expression levels of SENEX in the progressive stages of breast cancer described above were then quantified, with expression of SENEX scored by Professor C. Soon Lee (University of Western Sydney, and Royal Prince Alfred Hospital). A tissue microarray containing 66 patient samples of breast tissue ranging from normal or benign to malignant tissue (as per Figure 5A) was immunohistochemically stained for SENEX and SENEX expression scored. As shown in Figure 5B, in normal tissue cells were SENEX negative (0/3). In hyperplastic tissue and benign neoplasms, SENEX staining was positive in epithelial regions (16/17). In grade l-lll invasive ductal carcinoma, SENEX staining was intense and widespread (1 1/12) and increased with grade. Expression then decreased substantially in metastatic tissue.
Ductal carcinoma in situ
The inventors then further investigated the expression levels of SENEX in gardes of ductal carcinoma in situ (DCIS). The tissue microarray containing breast tissue was obtained from the Garvan Institute. Staining and detection were carried out as described above. Figure 6 shows the scoring of SENEX expression in a total of 231 breast tissue samples (scored by Dr Sandra OToole), classified as either normal breast tissue (n=29), Grade I DCIS (n=20), Grade II DCIS (n=43), Grade III DCIS (n=92) or unclassified IDC (n=47). The data shown in Figure 6 is derived from four arrays. It should also be noted that the normal tissue is predominantly "tumour-associated normal tissue". As shown, SENEX expression was observed in a high proportion of DCIS and IDC samples compared to normal breast tissue, and moreover expression was higher in a greater proportion of DCIS samples than IDC samples.
Example 3 - SENEX expression is induced in HMECs by chemotherapeutic agents
Example 2 above illustrates that SENEX expression is significantly increased in invasive ductal carcinomas. As it is likely that patients having invasive ductal carcinoma will have undergone (or are undergoing) some form of therapeutic treatment such as chemotherapy, the inventors investigated the relationship between chemotherapeutic agent administration and SENEX expression.
Human mammary epithelial cells were treated in vitro with 100nM doxorubicin solution for 1-12 . days. Cells were stained for senescence-associated β-galactosidase after 12 days. Total RNA was also isolated from doxorubicin-treated cells (and untreated control cells) using TriReagent according to manufacturer's instructions. 1^ig DNAse-treated total RNA was reverse transcribed using random hexamers and VILO RT enzyme (invitrogen). Primers and their product sizes are shown below.
β-actin (204 bp product):
5' - CCCTCCATCGTCCACCGCAAATGCTTC - 3' (SEQ ID NO:5)
5' - CGACTGCTGTCACCTTCACCGTTCCAG - 3' (SEQ ID NO:6)
SENEX (273 bp product)
5' - CGAGCAAGCACTCAATCAGAAAGAGAG - 3' (SEQ ID NO:7)
5' - GCTGTCAATGGAACGCAAAAAAGACCAG - 3' (SEQ ID NO:8)
Quantitative real-time PCR (qPCR) was performed using a hot-start PCR reaction containing SYBR green and 10 pmol of each primer. After an initial 5 minutes at 95°C, 40 cycles were performed: 15 seconds denaturation at 94°C, 30 seconds annealing at 60°C, 30 seconds extension at 72°C and fluorescence detection at 79°C. A melting curve fluorescence analysis was performed on each sample to verify that a single product had been amplified. Each sample was normalized to β-actin by removing the cycle threshold (Ct) value of β-actin from the Ct value of the gene under investigation (ACt). The fold difference was calculated by subtracting the ACt of the test sample from the control sample to give AACt, and then fold difference = 2-ΔΛει.
As illustrated in Figure 7A, cells treated with doxorubicin show positive staining for senescence- associated β-galactosidase and exhibit classical senescence morphology. Figure 7B shows that SENEX expression in doxorubicin treated cells increases significantly, peaking by about 9 days post doxorubicin treatment.
A similar experiment was carried out investigating the effect of camptothecin exposure on SENEX expression. Human mammary epithelial cells were cultured in MCDB 170 media with MCDB growth supplements. Cells were seeded in 6 well plates at 0.5 x 105 cells/well respectively for 48 h. Cells were treated with D SO (0.1%), or camptothecin (20 n , diluted in DMSO). Media and drug were replenished every 24 h. Cells were stained for SA-p-gal after 6 days. RNA was extracted from replicate wells and analysed as described above. Treatment of human mammary epithelial cells with 20nM camptothecin for six days led to a senescent phenotype (Figure 7C) and concomitant with this camptothecin treatment led to an increase in SENEX mRNA expression (Figure 7D).
Example 4 - SENEX is lost in ER/PR+ve subset of breast tumours
The human SENEX gene resides on the long arm of chromosome 6 at locus 6q22.33. Loss of the 6q22 region has been implicated in the development of ER/PR^ breast tumours (Hu et al., 2009). The inventors therefore investigated the expression levels of SENEX in breast cancer subtypes that are likely to be ER/PR^.
Tissue microarray slides from US BioMax containing formalin-fixed paraffin-embedded samples of normal breast tissue, benign fibroadenosis, invasive ductal carcinoma and mucinoius
carcinoma were analysed. Mucinous breast cancers are a heterogeneous group. "Pure" mucinous tumours may have neuroendocrine differentiation and be ER/PR^; these tumours have the best prognosis. Some mucinous carcinomas, however, have a component of IDC or micropapillary carcinoma, and these may be ER/PR-ve. These tumours have a poorer prognosis.
Slides were boiled in acidic citrate buffer for 20 minutes prior to being immunohistochemically stained for SENEX, using a rabbit polyclonal antibody. Anti-rabbit secondary antibodies were conjugated to horseradish peroxidase and detected using DAKO EnVision peroxidase detection system. Stained sections were counter-stained with haematoxylin. Expression of SENEX in breast tissue was scored by Professor C. Soon Lee (University of Western Sydney, and Royal Prince Alfred Hospital). The majority of mucinous carcinomas (2/3; the positive sample showed weak staining) were negative for SENEX expression (see Figure 8) and for senescence. Staining for p-galactosidase showed a similar staining profile (data not shown). Expression of SENEX in mucinous carcinoma tissue was significantly lower than in both benign fibroadenosis tissue and invasive ductal carcinoma tissue (Figure 8B).
Example 5 - SENEX expression in prostate cancer
To investigate the expression of SENEX in tumours of the prostate, a tissue microarray containing normal and tumour prostate tissue (US BioMax) was prepared and immunohistochemically stained for SENEX in the same manner as described above for breast tissue in Example 2. As shown in Figure 9A, SENEX is absent in the normal prostate but can be detected in the epithelial cells of prostate tumour tissue. As shown in Figure 9B, staining for SENEX in microarrayed benign prostatic hyperplasia tissue and prostate cancer tissue for SENEX demonstrate that expression of SENEX is increased in prostate cancer relative to benign prostatic hyperplasia, Scoring of the tissue microarrays of benign prostatic hyperplasia and prostate cancer shows that 3/13 (13%) benign prostatic hyperplasia samples were positive for SENEX, whereas 20/40 (50%) prostate cancer samples were positive for SENEX. Example 6 - SENEX expression in colorectal cancer
The inventors also investigated the expression of SENEX in normal bowel and colorectal cancer tissue samples. Tissue microarrays were prepared and immunohistochemically stained for SENEX in the same manner as described above for breast tissue in Example 2. As shown
in Figure 10, SENEX is expressed in colorectal cancer tissue (71% of tissue samples scored; Figure 10B) but is absent in normal bowel tissue.
References
Collado, M. et al, 2005, Nature 436:642.
Hu ef a/., 2009, Mol Cancer Res 7:511.
Claims
1. A method for determining the efficacy of cancer treatment in a subject, the method comprising:
(a) determining the level of expression of SENEX in a cancerous cell(s), tissue or fluid in the 5 subject;
(b) treating the subject with a treatment regime for a period sufficient to evaluate the efficacy of the regime; and
(c) subsequently determining the level of expression of SENEX in a cancerous cell(s), tissue or fluid in the subject,
] 0 wherein an increase in the level of expression of SENEX in the cancerous cell(s), tissue or fluid following said treatment is indicative of the efficacy of the treatment regime.
2. The method of claim 1 further comprising repeating step (c) at least once over the period of treatment; and (d) determining whether the level of expression of SENEX changes
15 over the period of treatment, wherein an increase in the level of expression of SENEX in the cancerous cell(s), tissue or fluid over the period of treatment is indicative of the efficacy of the treatment regime.
3. The method of claim 1 or 2, wherein the steps of determining the level of expression of 0 SENEX in cancerous cell(s), tissue or fluid comprise isolating a sample of cancerous cell(s), tissue or fluid from the subject and determining the level of expression of SENEX ex vivo in the isolated sample.
4. The method of any one of claims 1 to 3 wherein expression of the SENEX polypeptide 5 is determined, and wherein the SENEX polypeptide comprises the amino acid sequence as set forth in SEQ1D NO:1 or is a fragment or variant thereof.
5. The method of any one of claims 1 to 3 wherein expression of the SENEX polynucleotide is determined, and wherein the SENEX polynucleotide comprises the nucleotide 0 sequence as set forth in SEQ ID NO:2, or a fragment or variant thereof.
6. The method of any one of claims 1 to 5 wherein the treatment regime comprises chemotherapy and/or radiotherapy.
7. The method of claim 6 wherein the treatment regime comprises a chemotherapeutic agent or a combination of chemotherapeutic agents.
5 8, The method of claim 7 wherein the chemotherapeutic agent is doxorubicin or camptothecin.
9. The method of any one of claims 1 to 8 wherein the cancer is selected from breast cancer, colorectal cancer and prostate cancer.
I 0
10. The method of claim 9 wherein the breast cancer is selected from a benign neoplasm or tumour, ductal carcinoma in situ and invasive ductal carcinoma,
11. A method for determining the efficacy of cancer treatment in a subject, the method 1 5 comprising:
(a) treating the subject with a treatment regime for a period sufficient to evaluate the efficacy of the regime; and
(b) subsequently determining the level of expression of SENEX in a cancerous cell(s), tissue or fluid in the subject,
0 wherein an increase in the level of expression of SENEX in the cancerous cell(s), tissue or fluid following said treatment is indicative of the efficacy of the treatment regime.
12. The method of claim 11 further comprising repeating step (b) at least once over the period of treatment; and (c) determining whether the level of expression of SENEX changes 5 over the period of treatment, wherein an increase in the level of expression of SENEX in the cancerous cell(s), tissue or fluid over the period of treatment is indicative of the efficacy of the treatment regime.
13. A method for diagnosing a cancer disease state in a subject known to suffer from or 0 suspected of having a cancer, the method comprising determining the level of expression of
SENEX in a tissue or bodily fluid associated with the cancer, wherein the level of expression of SENEX is indicative of the cancer disease state.
14. The method of claim 13 wherein the expression of SENEX is determined ex vivo in a sample isolated from the subject.
15. The method of claim 13 or 14 wherein the cancer is selected from breast cancer, colorectal cancer and prostate cancer.
16. The method of claim 15 wherein the breast cancer is selected from a benign neoplasm or tumour, ductal carcinoma in situ and invasive ductal carcinoma.
17. The method of any one of claims 13 to 16 wherein the level of expression of SENEX in subject is compared to the level of expression of SENEX in one or more control samples.
18. The method of claim 17 wherein the subject is suspected of having a cancer and the control samples are derived from one or more individuals known not to suffer from the cancer, wherein increased expression of SENEX in the tissue or fluid from the subject compared to the one or more control samples is indicative that the subject has the cancer.
19. The method of claim 17 wherein the subject suffers from a cancer and the control samples represent different stages of progression of the cancer, wherein the level of expression of SENEX in the sample from the subject compared to the level of expression of SENEX in the control samples is indicative of the disease state of the cancer in the subject.
20. The method of claim 19 wherein the cancer is breast cancer and the disease state is selected from benign, hyperplastic, ductal carcinoma in situ grade I, II or III, invasive ductal carcinoma grade I, II or III, and metastatic invasive ductal carcinoma.
21. The method of claim 20 wherein the cancer is colorectal cancer and the disease state is selected from benign prostatic hyperplasia and prostate cancer.
22. A method for designing a suitable treatment regime for a subject suffering from cancer, the method comprising monitoring the level of expression of SENEX in cancerous cell(s), tissue or fluid in the subject in the presence or absence of a treatment regime for treating the cancer and adjusting the identity, timing and/or intensity of the treatment regime so as to increase the level of expression of SENEX in the cancerous cell(s), tissue or fluid.
23. A^method for identifying a compound suitable for treating a cancer in a subject, the method comprising:
(a) isolating at least one cancerous cell from the subject;
(b) determining the level of expression of SENEX in the at least one cell;
(c) contacting the at least one cell with a candidate compound; and
(d) subsequently determining the level of expression of SENEX in the at least one cell, wherein an increase in the level expression of SENEX between steps (b) and (d) is indicative of the ability of compound to treat the cancer.
24. A method of treating cancer in a subject, the method comprising administering to the subject a treatment regime designed in accordance with the method of claim 22 or a compound identified in accordance with claim 23.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2010901351A AU2010901351A0 (en) | 2010-03-31 | Diagnostic and prognostic methods | |
| AU2010901351 | 2010-03-31 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2011120099A1 true WO2011120099A1 (en) | 2011-10-06 |
Family
ID=44711236
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/AU2011/000378 Ceased WO2011120099A1 (en) | 2010-03-31 | 2011-03-31 | Diagnostic and prognostic methods for cancer |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2011120099A1 (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001025433A2 (en) * | 1999-10-07 | 2001-04-12 | Genentech, Inc. | Novel polypeptides, their nucleic acids, and methods for their use in angiogenesis and vascularization |
| WO2002032962A2 (en) * | 2000-10-20 | 2002-04-25 | Millennium Pharmaceuticals, Inc. | Compositions of human proteins and method of use thereof |
| WO2010148447A1 (en) * | 2009-06-23 | 2010-12-29 | Centenary Institute Of Cancer Medicine And Cell Biology | A novel regulator of cellular senescence |
-
2011
- 2011-03-31 WO PCT/AU2011/000378 patent/WO2011120099A1/en not_active Ceased
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001025433A2 (en) * | 1999-10-07 | 2001-04-12 | Genentech, Inc. | Novel polypeptides, their nucleic acids, and methods for their use in angiogenesis and vascularization |
| WO2002032962A2 (en) * | 2000-10-20 | 2002-04-25 | Millennium Pharmaceuticals, Inc. | Compositions of human proteins and method of use thereof |
| WO2010148447A1 (en) * | 2009-06-23 | 2010-12-29 | Centenary Institute Of Cancer Medicine And Cell Biology | A novel regulator of cellular senescence |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Guo et al. | Down-regulated miR-23a contributes to the metastasis of cutaneous melanoma by promoting autophagy | |
| Cornelius et al. | Endothelial expression of endocan is strongly associated with tumor progression in pituitary adenoma | |
| US20140302042A1 (en) | Methods of predicting prognosis in cancer | |
| JP2020022469A (en) | Methods and assays relating to circulating tumor cells | |
| Lin et al. | Overexpression of AKIP1 promotes angiogenesis and lymphangiogenesis in human esophageal squamous cell carcinoma | |
| JP2013520958A (en) | Method of using AXL as a biomarker for epithelial-mesenchymal transition | |
| MX2010014280A (en) | Signatures and determinants associated with metastasis methods of use thereof. | |
| Balic et al. | Serine-phosphorylated STAT3 promotes tumorigenesis via modulation of RNA polymerase transcriptional activity | |
| Pickard et al. | Inactivation of Rb in stromal fibroblasts promotes epithelial cell invasion | |
| Lin et al. | Serum amyloid A1 in combination with integrin αVβ3 increases glioblastoma cells mobility and progression | |
| Song et al. | USP18 promotes tumor metastasis in esophageal squamous cell carcinomas via deubiquitinating ZEB1 | |
| Rodgers et al. | ETS1 induces transforming growth factor β signaling and promotes epithelial‐to‐mesenchymal transition in prostate cancer cells | |
| Liang et al. | Expression of ribosome‐binding protein 1 correlates with shorter survival in Her‐2 positive breast cancer | |
| Metcalfe et al. | Dvl2 promotes intestinal length and neoplasia in the Apc Min mouse model for colorectal cancer | |
| KR101596166B1 (en) | A Use of microRNA for Ddiagnosing and Treating Brest Cancer | |
| KR102543618B1 (en) | Novel biomarker for predicting of resistance against enzalutamide of prostate cancer and uses thereof | |
| BR112013003506B1 (en) | METHOD TO DETECT THE PRESENCE OF A BARD1 ISOFORM AND METHOD TO DISCRIMINATE CANCER | |
| US20170038384A1 (en) | Treatment of tumors expressing mutant p53 | |
| CN104914242B (en) | For cancer diagnosis and the method and composition for the treatment of | |
| KR20210006945A (en) | Determining the cancer response to treatment | |
| WO2011129427A1 (en) | Diagnostic agent and therapeutic agent for cancer | |
| JP2012170335A (en) | Diagnostic method and therapeutic composition for oral squamous cell carcinoma | |
| CA2908889A1 (en) | Treatment of insulin resistance through inhibitors of transcription factor tsc22d4 | |
| KR102178432B1 (en) | A Composition Using Diagnosis of invasiveness brain cancer | |
| WO2011120099A1 (en) | Diagnostic and prognostic methods for cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 11761841 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 11761841 Country of ref document: EP Kind code of ref document: A1 |