WO2011106389A1 - Method for increasing n-glycosylation site occupancy on therapeutic glycoproteins produced in pichia pastoris - Google Patents
Method for increasing n-glycosylation site occupancy on therapeutic glycoproteins produced in pichia pastoris Download PDFInfo
- Publication number
- WO2011106389A1 WO2011106389A1 PCT/US2011/025878 US2011025878W WO2011106389A1 WO 2011106389 A1 WO2011106389 A1 WO 2011106389A1 US 2011025878 W US2011025878 W US 2011025878W WO 2011106389 A1 WO2011106389 A1 WO 2011106389A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- antibody
- protein
- host cell
- pichia
- nucleic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/44—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from protozoa
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/08—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from viruses
- C07K16/10—RNA viruses
- C07K16/11—Paramyxoviridae (F); Pneumoviridae (F), e.g. respiratory syncytial virus [RSV]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2863—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for growth factors, growth regulators
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/32—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against translation products of oncogenes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P21/00—Preparation of peptides or proteins
- C12P21/005—Glycopeptides, glycoproteins
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/10—Immunoglobulins specific features characterized by their source of isolation or production
- C07K2317/14—Specific host cells or culture conditions, e.g. components, pH or temperature
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/21—Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/40—Immunoglobulins specific features characterized by post-translational modification
- C07K2317/41—Glycosylation, sialylation, or fucosylation
Definitions
- the present invention relates to methods for increasing the N-glycosylation site occupancy of a heterologous glycoprotein produced in a recombinant host cell modified according to the present invention and genetically engineered to express the glycoprotein compared to the N-glycosylation site occupancy of the therapeutic glycoprotein produced in a recombinant host cell not modified according to the present invention.
- the present invention provides recombinant host cells that overexpress a heterologous single-subunit oligosaccharyltransferase, which in particular' embodiments is capable of functionally
- OTase yeast oligosaccharyltransferase
- Mammalian cell lines e.g., Chinese hamster ovary (CHO) cells, human retinal cells
- CHO Chinese hamster ovary
- human retinal cells e.g., human retinal cells
- Fungal hosts such as Saccharomyces cerevisiae or methylotrophic yeast such as
- glycosylated proteins expressed in yeast generally contain additional mannose sugars resulting in "high mannose" glycans. Because these high mannose N-glycans can result in adverse responses when administered to certain individuals, yeast have not generally been used to produce therapeutic glycoproteins intended for human use.
- iV-glycosylation site occupancy can vary for particular sites for particular glycoproteins produced in CHO cells and that modifications in growth conditions can be made to control occupancy at these sites.
- International Published Application No. WO 2006107990 discloses a method for improving protein N-glycosylation of eukaryotic cells using the dolichol-linked oligosaccharide synthesis pathway. Control of N-glycosylation site occupancy has been reviewed by Jones et al., Biochim. Biophys. Acta. 1726: 121-137 (2005). However, there still remains a need for methods for increasing N-glycosylation site occupancy of therapeutic proteins produced in recombinant host cells.
- the present invention provides a method for producing therapeutic glycoproteins in recombinant host cells modified as disclosed herein wherein the N-glycosylation site occupancy of the glycoproteins produced in the host cells modified as disclosed herein is increased over the N-glycosylation site occupancy of the same glycoproteins produced in host cells not modified as disclosed herein.
- the N-glycosylation site occupancy of glycoproteins produced therein will be the same as or more similar to the N-glycosylation site occupancy of the same glycoproteins produced in recombinant mammalian or human cells.
- heterologous single-subunit oligosaccharyltransferase oligosaccharyltransferase
- at least one of the heterologous single-subunit oligosaccharyltransferase is capable of functionally complementing a lethal mutation of one or more essential subunits comprising the endogenous host cell hetero- oligomeric oligosaccharyltransferase (OTase) complex.
- the Leishmania major STT3D protein is an example of a heterologous single-subunit oligosaccharyltransferase that has been shown to suppress a lethal mutation in the STT3 locus and at least one locus selected from WBPI, OST1, SWP1, and OST2 in Saccharomyces cerevisiae (Naseb et al, Molec. Biol. Cell 19: 3758-3768 (2008)).
- the one or more heterologous single-subunit oligosaccharyitransferases is/are overexpressed constitutively or inducibly in the presence of the proteins comprising the host cell's endogenous OTase complex, including the host cell's endogenous STT3 protein.
- Expression cassettes encoding the heterologous single-subunit oligosaccharyltransferase gene can either be integrated into any site within the host cell genome or located in the extrachromosomal space of the host cell, i.e., autonomously replicating genetic elements such as plasmids, viruses, 2 ⁇ plasmid, minichromosomes, and the like.
- one or more of the single-subunit is selected from the single-subunit
- oligosaccharyitransferases is/are the Leishmania sp. STT3A protein, STT3B protein, STT3C protein, STT3D protein, or combinations thereof.
- the one or more single-subunit oligosaccharyitransferases is/are the Leishmania major STT3A protein, STT3B protein, STT3C protein, STT3D protein, or combinations thereof.
- the nucleic acid molecules encoding the single-subunit oligosaccharyitransferases are not overexpressed in lieu of the expression of the endogenous genes encoding the proteins comprising the host cell's OTase complex, including the host cell STT3 protein.
- nucleic acid molecules encoding the single-subunit oligosaccharyitransferases are overexpressed constitutively or inducibly in the presence of the expression of the genes encoding the proteins comprising the host cell's endogenous oligosaccharyltransferase (OTase) complex, which includes expression of the endogenous gene encoding the host cell's STT3.
- OTase endogenous oligosaccharyltransferase
- Each expression cassette encoding a single- subunit OTase can either be integrated into any site within the host cell genome or located in the extrachromosomal space of the host cell, i.e., autonomously replicating genetic elements such as plasmids, viruses, 2 ⁇ plasmid, minichromosomes, and the like.
- the present invention has been exemplified herein using Pichia pastoris host cells genetically engineered to produce mammalian- or human-like complex iV-glycans; however, the present invention can be applied to other yeast or filamentous fungal host cells, in particular, yeast or filamentous fungi genetically engineered to produce mammalian- or human-like complex or hybrid N-glycans, to improve the overall N-glycosylation site occupancy of glycoproteins produced in the yeast or filamentous fungus host cell.
- the host cells are yeast or filamentous fungi that produce recombinant heterologous proteins that have wild-type or endogenous host cell N-glycosylation patterns, e.g., hypermannosylated or high mannose N-glycans.
- the host cells are yeast or filamentous fungi that lack alpha- 1 ,6-mannosy transferase activity (e.g., ochl activity in the case of various yeast strains such as but not limited to Saccharomyces cerevisiae or Pichia pastoris) and thus produce recombinant heterologous proteins that have high mannose JV-glycans.
- the present invention can also be applied to plant and mammalian expression system to improve the overall N-glycosylation site occupancy of glycoproteins produced in these plant or mammalian expression systems, particularly glycoproteins that have more than two N-linked glycosylation sites.
- a method for producing a heterologous glycoprotein in a recombinant host cell comprising providing a recombinant host cell that includes one or more nucleic acid molecules encoding one or more heterologous single- subunit oligosaccharyltransferases and a nucleic acid molecule encoding the heterologous glycoprotein; and culturing the host cell under conditions for expressing the heterologous glycoprotein to produce the heterologous glycoprotein.
- a method for producing a heterologous glycoprotein with mammalian- or human-like complex or hybrid N-glycans in a host cell comprising providing a host cell that includes one or more nucleic acid molecules encoding one or more heterologous single-subunit oligosaccharyltransferases and a nucleic acid molecule encoding the heterologous glycoprotein; and culturing the host cell under conditions for expressing the heterologous glycoprotein to produce the heterologous glycoprotein.
- the endogenous host cell genes encoding the proteins comprising the endogenous oligosaccharyltransferase (OTase) complex are expressed.
- the host cell is selected from the group consisting of Pichia pastoris, Pichia finlandica, Pichia trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia opuntiae, Pichia thermotolerans, Pichia salictaria, Pichia guercuum, Pichia pijperi, Pichia stiptis, Pichia methanolica, Pichia minuta ⁇ Ogataea minuta, Pichia lindneri), Pichia sp., Saccharomyces cerevisiae, Saccharomyces sp., Hansenula polymorpha, Kluyveromyces sp., Kluyveromyces lactis, Candida albicans, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Trichoderma reesei, Chryso
- a method for producing a heterologous glycoprotein in a lower eukaryote host cell comprising providing a recombinant lower eukaryote host cell that includes at least one nucleic acid molecule encoding a heterologous single-subunit oligosaccharyltransferase and a nucleic acid molecule encoding the heterologous glycoprotein and wherein the endogenous host cell genes encoding the proteins comprising the endogenous oligosaccharyltransferase (OTase) complex are expressed; and culturing the host cell under conditions for expressing the heterologous glycoprotein to produce the heterologous glycoprotein.
- OTase endogenous oligosaccharyltransferase
- the lower eukaryote host cell is selected from the group consisting of Pichia pastoris, Pichia finlandica, Pichia trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia opunliae, Pichia thermotolerans, Pichia salictaria, Pichia guercuum, Pichia pijperi, Pichia stiptis, Pichia methanolica, Pichia minuta (Ogataea minuta, Pichia lindneri), Pichia sp., Saccharomyces cerevisiae, Saccharomyces sp., Hansenula polymorphs, Kluyveromyces sp., Kluyveromyces lactis, Candida albicans, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Trichoderma rees
- a method for producing a heterologous glycoprotein in a recombinant yeast host cell comprising providing a recombinant yeast host cell that includes at least one nucleic acid molecule encoding a heterologous single- subunit oligosaccharyltransferase and a nucleic acid molecule encoding the heterologous glycoprotein and wherein the endogenous host cell genes encoding the proteins comprising the endogenous oligosaccharyltransferase (OTase) complex are expressed; and culturing the host cell under conditions for expressing the heterologous glycoprotein to produce the heterologous glycoprotein.
- OTase endogenous oligosaccharyltransferase
- the recombinant yeast host cell either produces the glycoprotein with a yeast N-glycan pattern or the yeast has been genetically engineered to produce glycoproteins with a yeast pattern but which lack hypermannosylation but which produce high mannose N-glycans.
- the yeast can be genetically engineered to lack al,6-mannosyltransferase activity, e.g., Ochlp activity.
- the yeast is genetically engineered to produce glycoproteins that have mammalian or human-like N-glycans.
- the single-subunit oligosaccharyltransferase is the Leishmania sp. STT3A protein, STT3B protein, STT3C protein, STT3D protein, or
- the single-subunit oligosaccharyltransferase is the Leishmania major STT3A protein, STT3B protein, STT3C protein, STT3D protein, or combinations thereof.
- the single-subunit oligosaccharyltransferase is capable of functionally suppressing the lethal phenotype of a mutation of at least one essential protein of an OTase complex, for example, a yeast OTase complex.
- the essential protein of the OTase complex is encoded by the Saccharomyces cerevisiae and/or
- Pichia pastoris STT3 locus Pichia pastoris STT3 locus, WBPl locus, OSTl locus, SWPI locus, or OST2 locus, or homologue thereof.
- the for example single-subunit oligosaccharyltransferase is the Leishmania major STT3D protein, which is capable of functionally suppressing (or rescuing or complementing) the lethal phenotype of at least one essential protein of the
- Saccharomyces cerevisae OTase complex Saccharomyces cerevisae OTase complex.
- the yeast host cell is selected from the group consisting of Pichia pastoris, Pichia finlandica, Pichia trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia opuntiae, Pichia thermotolerans, Pichia salictaria, Pichia guercuum, Pichia pijperi, Pichia stiptis, Pichia methanolica, Pichia minuta (Ogataea minuta, Pichia lindneri), Pichia sp., Saccharomyces cerevisiae, Saccharomyces sp., Hansermla polymorpha, Kluyveromyces sp., Kluyveromyces lactis, and Candida albicans.
- a method for producing a heterologous glycoprotein in a recombinant yeast host cell comprising providing a recombinant yeast host cell that includes at least one nucleic acid molecule encoding a heterologous single- subunit oligosaccharyltransferase capable of functionally suppressing the lethal phenotype of a mutation of at least one essential protein of a yeast oligosaccharyltransferase (OTase) complex, and a nucleic acid molecule encoding the heterologous glycoprotein and wherein the endogenous host cell genes encoding the proteins comprising the endogenous oligosaccharyltransferase (OTase) complex are expressed; and culturing the host cell under conditions for expressing the heterologous glycoprotein to produce the heterologous glycoprotein.
- a recombinant yeast host cell that includes at least one nucleic acid molecule encoding a heterologous single- subunit oligosaccharyltransferase
- the recombinant yeast host cell either produces the glycoprotein with a yeast N-glycan pattern or the yeast has been genetically engineered to produce glycoproteins with a yeast pattern that includes high mannose N-glycans but which lack hypermannosylation.
- the yeast can be genetically engineered to lack a 1,6- mannosyltransferase activity, e.g., Ochlp activity.
- the yeast is genetically engineered to produce glycoproteins that have mammalian or human-like N-glycans.
- the host cell further includes one or more nucleic acid molecules encoding the Leishmania sp. STT3A protein, STT3B protein, STT3C protein, STT3D protein, or combinations thereof.
- the host cell further includes one or more nucleic acids encoding the Leishmania major STT3A protein, STT3B protein, STT3C protein, or combinations thereof,
- the yeast host cell is selected from the group consisting of Pichia pastoris, Pichia finlandica, Pichia trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia opuntiae, Pichia thermotolerans, Pichia salictaria, Pichia guercuum, Pichia pijperi, Pichia stiptis, Pichia methanolica, Pichia minuta (Ogataea minuta, Pichia lindneri), Pichia sp., Saccharomyces cerevisiae, Saccharomyces sp., Hansenula polymorpha, Kluyveromyces sp., Kluyveromyces lactis, and Candida albicans.
- a method for producing a heterologous glycoprotein in a filamentous fungus host cell comprising providing a filamentous fungus host cell that includes at least one nucleic acid molecule encoding a single-subunit heterologous oligosaccharyl transferase and a nucleic acid molecule encoding the heterologous glycoprotein and wherein the endogenous host cell genes encoding the proteins comprising the endogenous oligosaccharyltransferase (OTase) complex are expressed; and culturing the host cell under conditions for expressing the heterologous glycoprotein to produce the heterologous glycoprotein.
- the filamentous fungus host cell produces the glycoprotein in which the N-glycans have a filamentous fungus pattern or it is genetically engineered to produce glycoproteins that have mammalian or human-like N-glycans,
- the single-subunit oligosaccharyltransferase is the Leishmania sp. STT3A protein, STT3B protein, STT3C protein, STT3D protein, or
- the single-subunit oligosaccharyltransferase is the Leishmania major STT3A protein, STT3B protein, STT3C protein, STT3D protein or combinations thereof.
- the single-subunit oligosaccharyltransferase is capable of functionally suppressing the lethal phenotype of a mutation of at least one essential protein of an OTase complex, for example, a yeast OTase complex.
- the essential protein of the OTase complex is encoded by the Saccharomyces cerevisiae and/or Pichia pastoris STT3 locus, WBPI locus, OSTJ locus, SWPI locus, or OST2 locus, or homologue thereof.
- the single-subunit oligosaccharyltransferase is the Leishmania major STT3D protein, which is capable of functionally suppressing (or rescuing or complementing) the lethal phenotype of at least one essential protein of the Saccharomyces cerevisiae OTase complex.
- the filamentous fungus host cell is selected from the group consisting of Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Trichoderma reesei, Chrysosporium lucknowense, Fusarium sp., Fusarium gramineum, Fusarium venenatum, and Neurospora crassa.
- the host cell is genetically engineered to produce glycoproteins comprising one or more mammalian- or humanlike complex N-glycans selected from GO, Gl, G2, Al, or A2.
- the host cell is genetically engineered to produce glycoproteins comprising one or more mammalian- or human-like complex N-glycans that have bisected N-glycans or have multiantennary N-glycans.
- the host cell is genetically engineered to produce glycoproteins comprising one or more mammalian- or human-like hybrid N-glycans selected from
- GlcNAcMan 3 GlcNAc 2 GalGlcNAcMan 3 GlcNAc 2 ; NANAGalGlcNAcMan 3 GlcNAc 2 ;
- the N-glycan structure consists of the G-2 structure Man3GlcNAc2-
- the heterologous glycoprotein can be for example, erythropoietin (EPO); cytokines such as interferon a, interferon ⁇ , interferon ⁇ , and interferon ⁇ ; and granulocyte-colony stimulating factor (GCSF); granulocyte macrophage-colony stimulating factor (GM-CSF); coagulation factors such as factor VIII, factor IX, and human protein C; antithrombin III; thrombin; soluble IgE receptor a-chain;
- EPO erythropoietin
- cytokines such as interferon a, interferon ⁇ , interferon ⁇ , and interferon ⁇
- GCSF granulocyte-colony stimulating factor
- GM-CSF granulocyte macrophage-colony stimulating factor
- coagulation factors such as factor VIII, factor IX, and human protein C
- immunoglobulins such as IgG, IgG fragments, IgG fusions, and IgM; immunoadhesions and other Fc fusion proteins such as soluble TNF receptor-Fc fusion proteins; RAGE-Fc fusion proteins; interleukins; urokinase; chymase; urea trypsin inhibitor; IGF-binding protein; epidermal growth factor; growth hormone-releasing factor; annexin V fusion protein; angiostatin; vascular endothelial growth factor-2; myeloid progenitor inhibitory factor- 1 ; osteoprotegerin; a-1- antitrypsin; a-feto proteins; DNase II; kringle 3 of human plasminogen; giucocerebrosidase; TNF binding protein 1 ; follicle stimulating hormone; cytotoxic T lymphocyte associated antigen 4 - Ig; transmembrane activator and calcium modulator and cyclophilin ligand; glucagon
- the heterologous protein is an antibody, examples of which, include but are not limited to, an anti-Her2 antibody, anti- RSV (respiratory syncytial virus) antibody, anti-TNFa antibody, anti-VEGF antibody, anti ⁇ CD3 receptor antibody, anti-CD41 7E3 antibody, anti-CD25 antibody, anti-CD52 antibody, anti-CD33 antibody, anti-IgE antibody, anti-CD 1 la antibody, anti-EGF receptor antibody, or anti-CD20 antibody.
- an anti-Her2 antibody anti- RSV (respiratory syncytial virus) antibody
- anti-TNFa antibody anti-VEGF antibody
- anti ⁇ CD3 receptor antibody anti-CD41 7E3 antibody
- anti-CD25 antibody anti-CD52 antibody
- anti-CD33 antibody anti-IgE antibody
- anti-CD 1 la antibody anti-EGF receptor antibody
- anti-EGF receptor antibody or anti-CD20 antibody.
- the host cell includes one or more nucleic acid molecules encoding one or more catalytic domains of a glycosidase, marrnosidase, or glycosyltransferase activity derived from a member of the group consisting of UDP-GlcNAc transferase (GnT) I, GnT II, GnT III, GnT IV, GnT V, GnT VI, UDP- galactosyltransferase (GalT), fucosyltransferase, and sialyltransferase.
- GnT UDP-GlcNAc transferase
- the mannosidase is selected from the group consisting of C. elegans marrnosidase IA, C, elegans mannosidase IB, D. melanogaster mannosidase IA, K sapiens mannosidase IB, P. citrinum mannosidase I, mouse mannosidase IA, mouse mannosidase IB, A, nidulans
- mannosidase I A A. nidulans mannosidase IB, A. nidulans mannosidase IC, mouse mannosidase II, C. elegans mannosidase II, H. sapiens mannosidase II, and mannosidase III.
- At least one catalytic domain is localized by forming a fusion protein comprising the catalytic domain and a cellular targeting signal peptide.
- the fusion protein can be encoded by at least one genetic construct formed by the in-frame ligation of a DNA fragment encoding a cellular targeting signal peptide with a DNA fragment encoding a catalytic domain having enzymatic activity.
- targeting signal peptides include, but are not limited to, membrane-bound proteins of the ER or Golgi, retrieval signals, Type II membrane proteins, Type I membrane proteins, membrane spanning nucleotide sugar transporters, mannosidases, sialyltransferases, glucosidases, mannosyltransferases, and phospho-mannosyltransferases.
- the host cell further includes one or more nucleic acid molecules encode one or more enzymes selected from the group consisting of UDP-GlcNAc transporter, UDP-galactose transporter, GDP-fucose transporter, CMP-sialic acid transporter, and nucleotide diphosphatases.
- the host cell includes one or more nucleic acid molecules encoding an l ,2-mannosidase activity, a UDP-GlcNAc transferase (GnT) I activity, a mannosidase II activity, and a GnT II activity.
- GnT UDP-GlcNAc transferase
- the host cell includes one or more nucleic acid molecules encoding an l,2-mannosidase activity, a UDP-GlcNAc transferase (GnT) I activity, a mannosidase II activity, a GnT II activity, and a UDP- galactosyltransferase (GalT) activity.
- GnT UDP-GlcNAc transferase
- GalT UDP-galactosyltransferase
- the host cell is deficient in the activity of one or more enzymes selected from the group consisting of mannosyltransferases and phosphomannosyltransferases. In further still aspects, the host cell does not express an enzyme selected from the group consisting of 1,6 mannosy transferase , 1 ,3 mannosyltransferase, and 1,2 mannosyltransferase.
- the host cell is an ochl mutant of Pichia pastoris.
- a host cell comprising (a) a first nucleic acid molecule encoding a heterologous single-subunit oligosaccharyltransferase; and (b) a second nucleic acid molecule encoding a heterologous glycoprotein; and the endogenous host cell genes encoding the proteins comprising the endogenous oligosaccharyltransferase (OTase) complex are expressed, which includes expression of the endogenous host cell STT3 gene.
- a lower eukaryotic host cell comprising (a) a first nucleic acid molecule encoding a heterologous single-subunit oligosaccharyltransferase; and (b) a second nucleic acid molecule encoding a heterologous glycoprotein; and the endogenous host cell genes encoding the proteins comprising the endogenous oligosaccharyltransferase (OTase) complex are expressed.
- yeast host cell comprising (a) a first nucleic acid molecule encoding a heterologous single-subunit oligosaccharyltransferase; and (b) a second nucleic acid molecule encoding a heterologous glycoprotein; and the endogenous host cell genes encoding the proteins comprising the endogenous oligosaccharyltransferase (OTase) complex are expressed.
- yeast host cell comprising (a) a first nucleic acid molecule encoding a heterologous single-subunit oligosaccharyltransferase capable of functionally suppressing the lethal phenotype of a mutation of at least one essential protein of a yeast oligosaccharyltransferase (OTase) complex; and (b) a second nucleic acid molecule encoding a heterologous glycoprotein; and the endogenous host cell genes encoding the proteins comprising the endogenous oligosaccharyltransferase (OTase) complex are expressed.
- filamentous fungus host cell comprising (a) a first nucleic acid molecule encoding a heterologous smgle-subunit oligosaccharyltransferase; and (b) a second nucleic acid molecule encoding a heterologous glycoprotein; and the endogenous host cell genes encoding the proteins comprising the endogenous oligosaccharyltransferase (OTase) complex are expressed.
- a filamentous fungus host cell comprising (a) a first nucleic acid molecule encoding a heterologous single-subunit oligosaccharyltransferase capable of functionally suppressing the lethal phenotype of a mutation of at least one essential protein of a yeast or filamentous fungus oligosaccharyltransferase (OTase) complex; and (b) a second nucleic acid molecule encoding a heterologous glycoprotein; and the endogenous host cell genes encoding the proteins comprising the endogenous oligosaccharyltransferase (OTase) complex are expressed
- the single-subunit oligosaccharyltransferase is the Leishmania sp. STT3A protein, STT3B protein, STT3C protein, STT3D protein, or
- the single-subunit oligosaccharyltransferase is the Leishmania major STT3A protein, STT3B protein, STT3C protein, STT3D protein, or combinations thereof.
- the single-subunit oligosaccharyltransferase is capable of functionally suppressing the lethal phenotype of a mutation of at least one essential protein of an OTase complex, for example, a yeast OTase complex.
- the essential protein of the OTase complex is encoded by the Saccharomyces cerevisiae and/or Pichia pastoris STT3 locus, WBPJ locus, OSTl locus, SWPJ locus, or OST2 locus, or homologue thereof.
- the for example single-subunit oligosaccharyltransferase is the Leishmania major STT3D protein, which is capable of functionally suppressing (or rescuing or complementing) the lethal phenotype of at least one essential protein of the
- Saccharomyces cerevisiae OTase complex Saccharomyces cerevisiae OTase complex.
- the above host cells further include one or more nucleic acid molecules encoding a Leishmania sp. STT3A protein, STT3B protein, STT3C protein, or combinations thereof.
- the host cell is genetically engineered to produce glycoproteins comprising one or more mammalian- or humanlike complex N-glycans selected from GO, Gl, G2, Al, or A2.
- the host cell is genetically engineered to produce glycoproteins comprising one or more human-like complex N-glycans that bisected N-glycans or have multiantennary N-glycans.
- the host cell is genetically engineered to produce glycoproteins comprising one or more mammalian- or human-like hybrid N-glycans selected from GlcNAcMan 3 GlcNAc 2 ;
- the V-glycan structure consists of the G-2 structure Ma 3GlcNAc2.
- the heterologous glycoprotein can be for example, selected from the group consisting of erythropoietin (EPO); cytokines such as interferon a, interferon ⁇ , interferon ⁇ , and interferon ⁇ ; and granulocyte- colony stimulating factor (GCSF); granulocyte macrophage-colony stimulating factor (GM-CSF); coagulation factors such as factor VIII, factor IX, and human protein C; antithrombin III;
- EPO erythropoietin
- cytokines such as interferon a, interferon ⁇ , interferon ⁇ , and interferon ⁇
- GCSF granulocyte- colony stimulating factor
- GM-CSF granulocyte macrophage-colony stimulating factor
- coagulation factors such as factor VIII, factor IX, and human protein C
- antithrombin III antithrombin III
- thrombin soluble IgE receptor a-chain
- immunoglobulins such as IgG, IgG fragments, IgG fusions, and IgM
- immunoadhesions and other Fc fusion proteins such as soluble TNF receptor- Fc fusion proteins; RAGE-Fc fusion proteins; interleukins; urokinase; chymase; urea trypsin inhibitor; IGF-binding protein; epidermal growth factor; growth hormone-releasing factor;
- annexin V fusion protein angiostatin; vascular endothelial growth factor-2; myeloid progenitor inhibitory factor- 1; osteoprotegerin; a- 1 -antitrypsin; a-feto proteins; DNase II; kringle 3 of human plasminogen; glucocerebrosidase; TNF binding protein 1 ; follicle stimulating hormone; cytotoxic T lymphocyte associated antigen 4 - Ig; transmembrane activator and calcium modulator and cyclophilin ligand; glucagon like protein 1; and IL-2 receptor agonist.
- the heterologous protein is an antibody, examples of which, include but are not limited to, an anti-Her2 antibody, anti-RSV (respiratory syncytial virus) antibody, anti-TNFa antibody, anti-VEGF antibody, anti- CD3 receptor antibody, anti-CD41 7E3 antibody, anti-CD25 antibody, anti-CD52 antibody, anti- CD33 antibody, anti-IgE antibody, anti-CD 1 la antibody, anti-EGF receptor antibody, or anti- CD20 antibody.
- an anti-Her2 antibody anti-RSV (respiratory syncytial virus) antibody
- anti-TNFa antibody anti-VEGF antibody
- anti- CD3 receptor antibody anti-CD41 7E3 antibody
- anti-CD25 antibody anti-CD52 antibody
- anti- CD33 antibody anti-IgE antibody
- anti-CD 1 la antibody anti-EGF receptor antibody
- anti-EGF receptor antibody anti- CD20 antibody
- the host cell includes one or more nucleic acid molecules encoding one or more catalytic domains of a glycosidase, mannosidase, or glycosyltransferase activity derived from a member of the group consisting of UDP-GlcNAc transferase (GnT) I, GnT II, GnT III, GnT IV, GnT V, GnT VI, UDP-galactosyltransferase (GalT), fucosyltransferase, and sialyltransferase.
- the mannosidase is selected from the group consisting of C. elegans mannosidase I A, C.
- elegans mannosidase IB D. melanogaster mannosidase IA, H. sapiens mannosidase IB, P. citrinum mannosidase I, mouse mannosidase IA, mouse mannosidase IB, A. nidulans mannosidase IA, A. nidulans mannosidase IB, A. nidulans mannosidase IC > mouse mannosidase II, C. elegans mannosidase II, H. sapiens mannosidase II, and mannosidase III.
- glucosidases mannosyltransferases, and phospho-mannosyltransferases.
- the host cell further includes one or more nucleic acid molecules encoding one or more enzymes selected from the group consisting of UDP-GlcNAc transporter, UDP-galactose transporter, GDP-fucose transporter, CMP-sialic acid transporter, and nucleotide diphosphatases.
- the host cell includes one or more nucleic acid molecules encoding an al,2-mannosidase activity, a UDP-GlcNAc transferase (GnT) I activity, a mannosidase II activity, and a GnT II activity.
- GnT UDP-GlcNAc transferase
- the host cell includes one or more nucleic acid molecules encoding an l ,2-mannosidase activity, a UDP-GlcNAc transferase (GnT) I activity, a mannosidase II activity, a GnT II activity, and a UDP- galactosyltransferase (GalT) activity.
- GnT UDP-GlcNAc transferase
- GalT UDP- galactosyltransferase
- the host cell is selected from the group consisting of Pichia pastoris, Pichia finlandica, Pichia trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia opuntiae, Pichia thermotolerans, Pichia salictaria, Pichia guercuum, Pichia pijperi, Pichia stiptis, Pichia methanolica, Pichia sp., Saccharomyces cerevisiae, Saccharomyces sp., Hansenula polymorpha, Kluyveromyces sp., Kluyveromyces lactis, Candida albicans, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae,
- Trichoderma reesei Chrysosporium lucknowense, Fusarium sp., Fusarium gramineum
- the host cell is deficient in the activity of one or more enzymes selected from the group consisting of
- the host cell does not express an enzyme selected from the group consisting of 1,6 mannosyltransferase, 1,3 mannosyltransferase, and 1,2 mannosyltransferase.
- the host cell is Pichia pastoris. In a further aspect, the host cell is an ochl mutant of Pichia pastoris.
- the methods and host cells herein can be used to produce glycoprotein
- compositions in which at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% of the N- glycosylation sites of the glycoproteins in the composition are occupied.
- the methods and host cells herein can be used to produce glycoprotein compositions in which at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% of the N- glycosylation sites of the glycoproteins in the composition are occupied and which in further aspects have mammalian- or human-likeN-glycans that lack fucose.
- the methods and yeast or filamentous fungus host cells are genetically engineered to produce mammalian-like or human-like N-glycans can be used to produce glycoprotein compositions in which at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% of the N-glycosylation sites of the glycoproteins in the composition are occupied and which in further aspects have mammalian- or human-like N-glycans that lack fucose.
- the yeast or filamentous host cells genetically engineered to produce fucosylated mammalian- or human-likeN-glycans can be used to produce glycoprotein compositions in which at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% of theN- glycosylation sites of the glycoproteins in the composition are occupied and which in further aspects have mammalian- or human-like N-glycans that have fucose.
- the methods and host cells herein can be used to produce antibody compositions in which at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% antibody molecules in the compositions have bothN-glycosylation sites occupied.
- the methods and host cells herein can be used to produce antibody compositions in which at least 70%, 75%, 80%, 85%, 90%, 95%», 98%, or 99% antibody molecules in the compositions have bothN-glycosylation sites occupied and the N-glycans lack fucose.
- the methods and yeast or filamentous fungus host cells herein can be used to produce antibody compositions in which at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% antibody molecules in the compositions have bothN-glycosylation sites occupied and the N- glycans lack fucose.
- the methods and yeast or filamentous fungus host cells genetically engineered to produce mammalian-like or human-like N-glycans can be used to produce antibody compositions in which at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% antibody molecules in the compositions have bothN-glycosylation sites occupied and the antibodies have mamraalian- or human-likeN-glycans that lack fucose.
- the yeast or filamentous host cells genetically engineered to produce fucosylated mammalian- or human-likeN-glycans can be used to produce antibody compositions in which at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% antibody molecules in the compositions have bothN-glycosylation sites occupied and the antibodies have mammalian- or human-likeN-glycans with fucose.
- glycoprotein composition comprising a plurality of antibodies wherein about 70% to about 99% of the intact antibody molecules in the composition have bothN-glycosylation sites occupied and about 50-70 mole% of theN-glycans have a GO structure, 15-25 mole% of theN-glycans have a Gl structure, 4-12 mole% of the N-glycans have a G2 structure, 5-17 mole% of the N-glycans have a Man5 structure, and 3-15 mole% of the N- glycans have a hybrid structure, and a pharmaceutically acceptable carrier.
- a glycoprotein composition comprising a plurality of antibodies wherein about 70% to 99% of the intact antibody molecules in the composition have both N-glycosylation sites occupied and about 53 to 58 mole% of the N-glycans have a GO structure, 20-22 mole% of the N-glycans have a Gl structure, and about 1 to 18 mole% of the N-glycans comprise a Man 5 GlcNAc 2 core structure, and a pharmaceutically acceptable carrier.
- the antibodies comprise an antibody selected from the group consisting of anti-Her2 antibody, anti- SV (respiratory syncytial virus) antibody, anti- TNFcc antibody, anti-VEGF antibody, anti-CD3 receptor antibody, anti-CD41 7E3 antibody, anti- CD25 antibody, anti-CD52 antibody, anti-CD33 antibody, anti-IgE antibody, anti-CD 1 la antibody, anti-EGF receptor antibody, and anti-CD20 antibody.
- anti-Her2 antibody anti-SV (respiratory syncytial virus) antibody
- anti- TNFcc antibody anti-VEGF antibody
- anti-CD3 receptor antibody anti-CD41 7E3 antibody
- anti-CD25 antibody anti-CD52 antibody
- anti-CD33 antibody anti-IgE antibody
- anti-CD 1 la antibody anti-EGF receptor antibody
- anti-CD20 antibody anti-CD20 antibody
- compositions comprising one ore more glycoproteins produced by the host cells and methods described herein.
- the glycoprotein compositions provided herein comprise glycoproteins having fucosylated and non-fucosylated hybrid and complex N-glycans, including bisected and multiantennary species, including but not limited to N-glycans such as GlcNAC(i i - 4 ) Man 3 GlcNAc 2 ; G l(i ) GlcNAc (I-4) Man 3 Glc Ac 2 ; NANA(i -4) Gal (1-4) GlcNAc(i, 4)Man 3 GlcNAc2.
- N-glycans such as GlcNAC(i i - 4 ) Man 3 GlcNAc 2 ; G l(i ) GlcNAc (I-4) Man 3 Glc Ac 2 ; NANA(i -4) Gal (1-4) GlcNAc(i, 4)Man 3 GlcNAc2.
- glycoprotein compositions provided herein comprise glycoproteins having at least one hybrid N-glycan selected from the group consisting of GlcNAcMan 3 GlcNAc 2 ; GalGlcNAcMan 3 GlcNAc 2 ; NANAGalGlcNAcMan 3 GlcNAc 2 ;
- the hybrid N-glycan is the predominant N-glycan species in the composition.
- the hybrid N-glycan is a particular N-glycan species that comprises about 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97%, 98%, 99%, or 100% of the hybrid N-glycans in the composition.
- glycoprotein compositions provided herein comprise glycoproteins having at least one complex N-glycan selected from the group consisting of GlcNAc 2 Man 3 GlcNAc 2 ; GalGlcNAc 2 Man 3 GlcNAc 2 ; Gal 2 GlcNAc 2 Man 3 GlcNAc 2 ;
- the complex N-glycan is the predominant N-glycan species in the composition.
- the complex N-glycan is a particular N-glycan species that comprises about 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97%, 98%, 99%, or 100% of the complex N-glycans in the composition.
- the N-glycan is fusosylated.
- the fucose is in an al,3-linkage with the GlcNAc at the reducing end of the N-glycan, an al,6-linkage with the GlcNAc at the reducing end of the N-glycan, an al,2-linkage with the Gal at the non-reducing end of the N-glycan, an a 1,3 -linkage with the GlcNac at the non-reducing end of the N-glycan, or an a 1,4 -linkage with a GlcNAc at the non-reducing end of the N-glycan.
- the glycoform is in an a 1 ,3 -linkage or l ,6-linkage fucose to produce a glycoform selected from the group consisting of GlcNAcMan 5 GlcNAc 2 (Fuc) f GlcNAcMan 3 GlcNAc 2 (Fuc),
- the complex N-glycans further include fucosylated and non-fucosylated bisected and multiantennary species.
- the glycoproteins comprise high mannose N-glycans, including but not limited to, Man 5 GlcNAc 2 , or N-glycans that consist of the Man3GlcNAc2 N-glycan structure. Definitions
- N-glycan and “glycoform” are used interchangeably and refer to an N-linked oligosaccharide, for example, one that is attached by an asparagine-N- acetylglucosamine linkage to an asparagine residue of a polypeptide.
- N-linked glycoproteins contain an N-acetylglucosamine residue linked to the amide nitrogen of an asparagine residue in the protein.
- glycoproteins The predominant sugars found on glycoproteins are glucose, galactose, mannose, fucose, N-acetylgalactosamine (GalNAc), N-acetylglucosamine (GlcNAc) and sialic acid (e.g., N- acetyl-neuraminic acid (NANA)).
- GalNAc N-acetylgalactosamine
- GlcNAc N-acetylglucosamine
- sialic acid e.g., N- acetyl-neuraminic acid (NANA)
- N-glycans have a common pentasaccharide core of Man 3 GlcNAc 2 ("Man” refers to mannose; “Glc” refers to glucose; and “NAc” refers to N-acetyl; GlcNAc refers to N- acetylglucosamine).
- Man refers to mannose
- Glc refers to glucose
- NAc refers to N-acetyl
- GlcNAc refers to N- acetylglucosamine
- N-glycan structures are presented with the non-reducing end to the left and the reducing end to the right.
- the reducing end of the N-glycan is the end that is attached to the Asn residue comprising the glycosylation site on the protein.
- N-glycans differ with respect to the number of branches (antennae) comprising peripheral sugars (e.g., GlcNAc, galactose, fucose and sialic acid) that are added to the Man 3 GlcNAc 2 ("Man3") core structure which is also referred to as the "triammnose core", the "pentasaccharide core" or the
- N-glycans are classified according to their branched constituents (e.g., high mannose, complex or hybrid).
- a "high mannose” type N-glycan has five or more mannose residues.
- a "complex” type N ⁇ glycan typically has at least one GlcNAc attached to the 1,3 mannose arm and at least one GlcNAc attached to the 1,6 mannose arm of a "trimannose" core.
- Complex N-glycans may also have galactose (“Gal”) or N-acetylgalactosamine (“GalNAc”) residues that are optionally modified with sialic acid or derivatives (e.g., "NANA” or “NeuAc”, where “Neu” refers to neuraminic acid and “Ac” refers to acetyl).
- Gal galactose
- GalNAc N-acetylgalactosamine residues
- sialic acid or derivatives e.g., "NANA” or “NeuAc”, where “Neu” refers to neuraminic acid and “Ac” refers to acetyl
- Complex N-glycans may also have intrachain substitutions comprising "bisecting" GlcNAc and core fucose ("Fuc").
- Complex N-glycans may also have multiple antennae on the "trimannose core,” often referred to as “multiple antennary glycans.”
- a “hybrid” N-glycan has at least one GlcNAc on the terminal of the 1,3 mannose arm of the trimannose core and zero or more mannoses on the 1,6 mannose arm of the trimannose core.
- the various N-glycans are also referred to as "glycoforms.”
- G-2 refers to an N-glycan structure that can be characterized as Man3GlcNAc2
- G-l refers to an N-glycan structure that can be characterized as GlcNAcMan3GlcNAc2
- GO refers to an N-glycan structure that can be characterized as GlcNAc2M rt3GlcNAc2
- Gl refers to an N-glycan structure that can be characterized as GalGlc Ac2Man3Glc Ac2
- G2 refers to an N-glycan structure that can be characterized as G l2GIc Ac2Man3GlcNAc2
- Al refers to an N- glycan structure that can be characterized as ANAGal2GlcNAc2 an3GlcNAc2;
- A2 refers to an N-glycan structure that can be characterized as
- Gl ", "G2", “Al”, and “A2” refer to N-glycan species that lack fucose attached to the GlcNAc residue at the reducing end of the N-glycan.
- the term includes an "F”
- the "F” indicates that the N-glcyan species contains a fucose residue on the GlcNAc residue at the reducing end of the N-glycan,
- GOF, GIF, G2F, A1F, and A2F all indicate that the N-glycan further includes a fucose residue attached to the GlcNAc residue at the reducing end of the N-glycan.
- Lower eulcaryotes such as yeast and filamentous fungi do not normally produce N-glycans that produce fucose.
- multiantennary N-glycan refers to N-glycans that further comprise a GlcNAc residue on the mannose residue comprising the non-reducing end of the 1 ,6 arm or the 1 ,3 arm of the N-glycan or a GlcNAc residue on each of the mannose residues comprising the non-reducing end of the 1,6 arm and the 1 ,3 arm of the N-glycan.
- multiantennary N-glycans can be characterized by the formulas GlcNAc ⁇ - 4)Man3GlcNAc2 ?
- the term "1-4" refers to 1, 2, 3, or 4 residues.
- bisected N-glycan refers to N- glycans in which a GlcNAc residue is linked to the mannose residue at the reducing end of the N- glycan.
- a bisected N-glycan can be characterized by the formula Glc Ac Man3Glc Ac2 wherein each mannose residue is linked at its non-reducing end to a GlcNAc residue.
- a multiantermary N-glycan is characterized as GlcNAc3Man3GlcNAc2
- the formula indicates that two GlcNAc residues are linked to the mannose residue at the non-reducing end of one of the two arms of the N-glycans and one GlcNAc residue is linked to the mannose residue at the non-reducing end of the other arm of the N-glycan.
- glucose N-glycosidase F which all refer to peptide N-glycosidase F (EC 3.2.2.18).
- glycoprotein refers to any protein having one or more N-glycans attached thereto.
- glycoprotein refers both to proteins that are generally recognized in the art as a glycoprotein and to proteins which have been genetically engineered to contain one or more N-linked glycosylation sites.
- a "humanized glycoprotein” or a “human-like glycoprotein” refers alternatively to a protein having attached thereto N-glycans having fewer than four mannose residues, and synthetic glycoprotein intermediates (which are also useful and can be manipulated further in vitro or in vivo) having at least five mannose residues.
- glycoproteins produced according to the invention contain at least 30 mole %, preferably at least 40 mole % and more preferably 50, 60, 70, 80, 90, or even 100 mole % of the Man 5 GlcNAc2 intermediate, at least transiently.
- a host cell of the invention may express a "better", i.e., a more efficient glycosylation enzyme.
- a mannosidase is selected such that it will have optimal activity under the conditions present at the site in the host cell where proteins are glycosylated and is introduced into the host cell preferably by targeting the enzyme to a host cell organelle where activity is desired.
- recombinant host cell ("expression host cell”, “expression host system”, “expression system” or simply “host cell”), as used herein, is intended to refer to a cell into which a recombinant vector has been introduced. It should be understood that such terms are intended to refer not only to the particular subject cell but to the progeny of such a cell.
- a recombinant host cell may be an isolated cell or cell line grown in culture or may be a cell which resides in a living tissue or organism.
- Preferred host cells are yeasts and fungi.
- mole percent of a glycan present in a preparation of a glycoprotein means the molar percent of a particular glycan present in the pool of N- linked oligosaccharides released when the protein preparation is treated with PNGase and then quantified by a method that is not affected by glycoform composition, (for instance, labeling a PNGase released glycan pool with a fluorescent tag such as 2-aminobenzamide and then separating by high performance liquid chromatography or capillary electrophoresis and then quantifying glycans by fluorescence intensity). For example, 50 mole percent
- GlcNAc2Man3GlcNAc2Gal2NANA2 means that 50 percent of the released glycans are
- GlcNAc2Man3GlcNAc2Gal2NA A2 and the remaining 50 percent are comprised of other N- linked oligosaccharides.
- the mole percent of a particular glycan in a preparation of glycoprotein will be between 20% and 100%, preferably above 25%, 30%, 35%, 40% or 45%, more preferably above 50%, 55%, 60%, 65% or 70% and most preferably above 75%, 80% 85%, 90% or 95%.
- operably linked expression control sequences refers to a linkage in which the expression control sequence is contiguous with the gene of interest to control the gene of interest, as well as expression control sequences that act in trans or at a distance to control the gene of interest.
- expression control sequence or “regulatory sequences” are used interchangeably and as used herein refer to polynucleotide sequences which are necessary to affect the expression of coding sequences to which they are operably linked.
- Expression control sequences are sequences which control the transcription, post-transcriptional events and translation of nucleic acid sequences.
- Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation signals; sequences that stabilize cytoplasmic mRMA; sequences that enhance translation efficiency (e.g., ribosome binding sites); sequences that enhance protein stability; and when desired, sequences that enhance protein secretion.
- control sequences differs depending upon the host organism; in prokaryotes, such control sequences generally include promoter, ribosomal binding site, and transcription termination sequence.
- control sequences is intended to include, at a minimum, all components whose presence is essential for expression, and can also include additional components whose presence is advantageous, for example, leader sequences and fusion partner sequences.
- transfect refers to the introduction of a heterologous nucleic acid into eukaryote cells, both higher and lower eukaryote cells.
- transformation has been used to describe the introduction of a nucleic acid into a yeast or fungal cell; however, herein the term “transfection” is used to refer to the introduction of a nucleic acid into any eukaryote cell, including yeast and fungal cells.
- eukaryotic refers to a nucleated cell or organism, and includes insect cells, plant cells, mammalian cells, animal cells and lower eukaryotic cells.
- lower eukaryotic cells includes yeast and filamentous fungi.
- yeast and filamentous fungi include, but are not limited to Pichia pastoris, Pichia finlandica, Pichia trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia minuta (Ogataea minuta,
- Pichia lindneri Pichia opunliae
- Pichia thermotolerans Pichia salictaria
- Pichia guercuum Pichia lindneri
- Pichia pijperi Pichia stiptis
- Pichia methanolica Pichia sp.
- Saccharomyces cerevisiae Pichia pijperi, Pichia stiptis, Pichia methanolica, Pichia sp., Saccharomyces cerevisiae
- Saccharomyces sp. Hansenula polymorpha, Kluyveromyces sp,, Kluyveromyces lactis, Candida albicans, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Trichoderma reesei, Chrysosporium lucknowense, Fusarium sp., Fusarium gramineum, Fusarium venenatum,
- Pichia sp. any Saccharomyces sp., Hansenula polymorpha, y Kluyveromyces sp., Candida albicans, my Aspergillus sp., Trichoderma reesei,
- each immunoglobulin molecule has a unique structure that allows it to bind its specific antigen, but all immunoglobulins have the same overall structure as described herein.
- the basic immunoglobulin structural unit is known to comprise a tetramer of subunits. Each tetramer has two identical pairs of polypeptide chains, each pair having one "light” chain (about 25 kDa) and one "heavy” chain (about 50-70 kDa).
- the amino-terminal portion of each chain includes a variable region of about 100 to 1 10 or more amino acids primarily responsible for antigen recognition.
- each chain defines a constant region primarily responsible for effector function.
- Light chains are classified as either kappa or lambda.
- Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, and define the antibody's isotype as IgG, IgM, IgA, IgD, and IgE, respectively.
- variable regions and constant regions See generally, Fundamental Immunology (Paul, W., ed., 2nd ed. Raven Press, N.Y., 1989), Ch. 7.
- the variable regions of each light/heavy chain pair form the antibody binding site.
- an intact antibody has two binding sites. Except in bifunctional or bispecific antibodies, the two binding sites are the same.
- the chains all exhibit the same general structure of relatively conserved framework regions (FR) joined by three hypervariable regions, also called FR
- CDRs complementarity determining regions or CDRs.
- the CDRs from the two chains of each pair are aligned by the framework regions, enabling binding to a specific epitope.
- the terms include naturally occurring forms, as well as fragments and derivatives. Included within the scope of the term are classes of immunoglobulins (Igs), namely, IgG, IgA, IgE, IgM, and IgD. Also included within the scope of the terms are the subtypes of IgGs, namely, IgGl, IgG2, IgG3, and IgG4. The term is used in the broadest sense and includes single monoclonal antibodies (including agonist and antagonist antibodies) as well as antibody compositions which will bind to multiple epitopes or antigens.
- the terms specifically cover monoclonal antibodies (including full length monoclonal antibodies), polyclonal antibodies, multispecific antibodies (for example, bispecific antibodies), and antibody fragments so long as they contain or are modified to contain at least the portion of the CH2 domain of the heavy chain immunoglobulin constant region which comprises an N-linked glycosylation site of the CH2 domain, or a variant thereof. Included within the terms are molecules comprising only the Fc region, such as immunoadhesions (U.S. Published Patent Application No. 2004/0136986; the disclosure of which is incorporated herein by reference), Fc fusions, and antibody-like molecules.
- Fc fragment refers to the 'fragment crystallized' C-terminal region of the antibody containing the CH2 and CH3 domains.
- Fab fragment refers to the 'fragment antigen binding' region of the antibody containing the VH, CHI, VL and CL domains.
- mAb monoclonal antibody
- polyclonal antibody preparations which typically include different antibodies directed against different determinants (epitopes), each mAb is directed against a single determinant on the antigen.
- monoclonal antibodies are advantageous in that they can be produced, for example, by hybridoma culture, uncontaminated by other immunoglobulins.
- the term "monoclonal” indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method.
- the monoclonal antibodies to be used in accordance with the present invention may be made by the hybridoma method first described by Kohler et al, (1975) Nature, 256:495, or may be made by recombinant DNA methods (See, for example, U.S. Pat. No. 4,816,567; the disclosure of which is incorporated herein by reference).
- fragments within the scope of the terms “antibody” or “immunoglobulin” include those produced by digestion with various proteases, those produced by chemical cleavage and/or chemical dissociation and those produced recombinantly, so long as the fragment remains capable of specific binding to a target molecule.
- fragments include Fc, Fab, Fab', Fv, F(ab')2, and single chain Fv (scFv) fragments.
- fragments also includes the term “fragments” as well.
- Immunoglobulins further include immunoglobulins or fragments that have been modified in sequence but remain capable of specific binding to a target molecule, including: interspecies chimeric and humanized antibodies; antibody fusions; heteromeric antibody complexes and antibody fusions, such as diabodies (bispecific antibodies), single-chain diabodies, and intrabodies (See, for example, Intracellular Antibodies: Research and Disease Applications, (Marasco, ed., Springer-Verlag New York, Inc., 1998).
- catalytic antibody refers to immunoglobulin molecules that are capable of catalyzing a biochemical reaction. Catalytic antibodies are well known in the art and have been described in U.S. Patent Application Nos. 7,205,136; 4,888,281; 5,037,750 to
- ADCC antibody-dependent cell-mediated cytotoxicity
- CDC complement-dependent cytotoxicity
- the term “consisting essentially of” will be understood to imply the inclusion of a stated integer or group of integers; while excluding modifications or other integers which would materially affect or alter the stated integer.
- the term “consisting essentially of a stated N-glycan” will be understood to include the N-glycan whether or not that N-glycan is fucosylated at the N-acetylglucosamine (GlcNAc) which is directly linked to the asparagine residue of the glycoprotein.
- the term “predominantly” or variations such as “the predominant” or “which is predominant” will be understood to mean the glycan species that has the highest mole percent (%) of total neutral N-glycans after the glycoprotein has been treated with PNGase and released glycans analyzed by mass spectroscopy, for example, MALDI-TOF MS or HPLC.
- the phrase “predominantly” is defined as an individual entity, such as a specific glycoform, is present in greater mole percent than any other individual entity.
- compositions consists of species A at 40 mole percent, species B at 35 mole percent and species C at 25 mole percent, the composition comprises predominantly species A, and species B would be the next most predominant species.
- Some host cells may produce compositions comprising neutral N-glycans and charged N-glycans such as mannosylphosphate. Therefore, a composition of glycoproteins can include a plurality of charged and uncharged or neutral N-glycans. In the present invention, it is within the context of the total plurality of neutral N-glycans in the composition in which the predominant N-glycan determined.
- predominant N-glycan means that of the total plurality of neutral N-glycans in the composition, the predominant N-glycan is of a particular structure.
- the term "essentially free of a particular sugar residue, such as fucose, or galactose and the like, is used to indicate that the glycoprotein composition is substantially devoid of N-glycans which contain such residues. Expressed in terms of purity, essentially free means that the amount of N-glycan structures containing such sugar residues does not exceed 10%, and preferably is below 5%, more preferably below 1%, most preferably below 0.5%, wherein the percentages are by weight or by mole percent.
- substantially all of the N- glycan structures in a glycoprotein composition according to the present invention are free of, for example, fucose, or galactose, or both.
- a glycoprotein composition "lacks" or “is lacking" a particular sugar residue, such as fucose or galactose, when no detectable amount of such sugar residue is present on the N-glycan structures at any time.
- the glycoprotein compositions are produced by lower eukaryotic organisms, as defined above, including yeast (for example, Pichia sp.; Saccharomyces sp.; Kluyveromyces sp.; Aspergillus sp.), and will "lack fucose," because the cells of these organisms do not have the enzymes needed to produce fucosylated N-glycan structures.
- a composition may be "essentially free of fucose” even if the composition at one time contained fucosylated N-glycan structures or contains limited, but detectable amounts of fucosylated N-glycan structures as described above.
- Figure 1 A-H shows the genealogy of P. pastoris strain YGLY13992 (Figure IF) and strain YGLY14401 (Figure 1G) beginning from wild-type strain NRRL-Y11430 ( Figure 1A).
- Figure 2 shows a map of plasmid pGLY6301 encoding the ZwSTT3D ORF under the control of the Pichia pastoris alcohol oxidase I (AOX1) promoter and S. cerevisiae CYC transcription termination sequence.
- the plasmid is a roll-in vector that targets the URA6 locus.
- the selection of transformants uses arsenic resistance encoded by the S. cerevisiae ARR3 ORF under the control of the P. pastoris RPL10 promoter and S. cerevisiae CYC transcription termination sequence.
- Figure 3 shows a map of plasmid pGLY6294 encoding the ImSTT3D ORF under the control of the P. pastoris GAPDH promoter and S. cerevisiae CYC transcription termination sequence.
- the plasmid is a IN O vector that targets the TRP1 locus: the 3' end of the TRP1 ORF is adjacent to the P. pastoris ALG3 transcription termination sequence.
- FIG. 4 shows a map of plasmid pGLY6, Plasmid pGLY6 is an integration vector that targets the URA5 locus and contains a nucleic acid molecule comprising the S.
- ScSUC2 cerevisiae invertase gene or transcription unit flanked on one side by a nucleic acid molecule comprising a nucleotide sequence from the 5 ! region of the P. pastoris URA5 gene (PpURA5-5') and on the other side by a nucleic acid molecule comprising the a nucleotide sequence from the 3' region of the P. pastoris URA5 gene (PpU A5-3').
- Figure 5 shows a map of plasmid pGLY40.
- Plasmid pGLY40 is an integration vector that targets the OCH1 locus and contains a nucleic acid molecule comprising the P.
- PpURAS protein kinase
- lacZ repeat lacZ repeat
- PpOCHl-5 1 nucleic acid molecule comprising a nucleotide sequence from the 5' region of the OCH1 gene
- PpOCHl-3' nucleic acid molecule comprising a nucleotide sequence from the 3' region of the OCH1 gene
- Plasmid pGLY43a is an integration vector that targets the BMT2 locus and contains a nucleic acid molecule comprising the K. lactis UDP-N-acetylglucosamine (UDP-GlcNAc) transporter gene or transcription unit (KIGlcNAc Transp.) adjacent to a nucleic acid molecule comprising the P. pastoris URA5 gene or transcription unit (PpURA5) flanked by nucleic acid molecules comprising lacZ repeats (lacZ repeat).
- UDP-N-acetylglucosamine UDP-N-acetylglucosamine
- KIGlcNAc Transp. transcription unit flanked by nucleic acid molecules comprising lacZ repeats (lacZ repeat).
- the adjacent genes are flanked on one side by a nucleic acid molecule comprising a nucleotide sequence from the 5' region of the BMT2 gene (PpPBS2-5') and on the other side by a nucleic acid molecule comprising a nucleotide sequence from the 3' region of the BMT2 gene (PpPBS2-3 r ).
- FIG. 7 shows a map of plasmid pGLY48.
- Plasmid pGLY48 is an integration vector that targets the MNN4L1 locus and contains an expression cassette comprising a nucleic acid molecule encoding the mouse homologue of the UDP-GlcNAc transporter (MmGlcNAc Transp.) open reading frame (ORP) operably linked at the 5' end to a nucleic acid molecule comprising the P. pastoris GAPDH promoter (PpGAPDH Prom) and at the 3' end to a nucleic acid molecule comprising the S.
- MmGlcNAc Transp. mouse homologue of the UDP-GlcNAc transporter
- ORP open reading frame
- ScCYC TT cerevisiae CYC termination sequence adjacent to a nucleic acid molecule comprising the P, pastoris URA5 gene or transcription unit (PpURAS) flanked by lacZ repeats (lacZ repeat) and in which the expression cassettes together are flanked on one side by a nucleic acid molecule comprising a nucleotide sequence from the 5' region of the P. pastoris MNN4L1 gene (PpMNN4Ll-5') and on the other side by a nucleic acid molecule comprising a nucleotide sequence from the 3' region of the MNN4L1 gene (PpMNN4Ll-3').
- Plasmid pGLY45 is an integration vector that targets the PN01/MNN4 loci contains a nucleic acid molecule comprising the P. pastoris URA5 gene or transcription unit (PpURA5) flanked by nucleic acid molecules comprising lacZ repeats (lacZ repeat) which in turn is flanked on one side by a nucleic acid molecule comprising a nucleotide sequence from the 5' region of the PNOl gene (PpPNOl-5') and on the other side by a nucleic acid molecule comprising a nucleotide sequence from the 3' region of the MNN4 gene ( ⁇ 4-3'),
- PpURA5 P. pastoris URA5 gene or transcription unit
- lacZ repeat lacZ repeat
- FIG. 9 shows a map of plasmid pGLY1430.
- Plasmid pGLY1430 is a ION O integration vector that targets the ADEl locus without disrupting expression of the locus and contains in tandem four expression cassettes encoding (1) the human GlcNAc transferase I catalytic domain (codon optimized) fused at the N-terminus to P. pastoris SEC 12 leader peptide (CO-NA10), (2) mouse homologue of the UDP-GlcNAc transporter (MmTr), (3) the mouse mannosidase I A catalytic domain (FB) fused at the N-terminus to S. cerevisiae SEC 12 leader peptide (FB8), and (4) the P.
- MmTr mouse homologue of the UDP-GlcNAc transporter
- FB mouse mannosidase I A catalytic domain
- PpPMAl prom is the P. pastoris PMAl promoter
- PpPMAl TT is the P. pastoris PMAl termination sequence
- SEC4 is the P. pastoris SEC4 promoter
- OCH1 TT is the P. pastoris OCH1 termination sequence
- ScCYC TT is the S. cerevisiae CYC termination sequence
- PpOCHl Prom is the P. pastoris OCH1 promoter;
- PpALG3 TT is the P. pastoris ALG3 termination sequence
- PpGAPDH is the P. pastoris GADPH promoter.
- FIG 10 shows a map of plasmid pGLY582
- Plasmid pGLY582 is an integration vector that targets the HIS1 locus and contains in tandem four expression cassettes encoding (1) the S. cerevisiae UDP-glucose epimerase (ScGALlO), (2) the human
- GAPDH is the P. pastoris GADPH promoter and ScCYC TT is the S. cerevisiae CYC termination sequence; PpOCHl Prom is the P. pastoris OCH1 promoter and PpALG12 TT is the P. pastoris ALG12 termination sequence.
- FIG. 11 shows a map of plasmid pGLY167b.
- Plasmid pGLY167b is an integration vector that targets the ARGI locus and contains in tandem three expression cassettes encoding (1) the D. melanogaster mannosidase II catalytic domain (codon optimized) fused at the N-terminus to S. cerevisiae MNN2 leader peptide (CO-KD53), (2) the P. pastoris HIS1 gene or transcription unit, and (3) the rat N-acetylglucosamine (GlcNAc) transferase II catalytic domain (codon optimized) fused at the N-terminus to S. cerevisiae MNN2 leader peptide (CO- TC54). All flanked by the 5' region of the ARGI gene (PpARGl -5') and the 3' region of the
- PpPMAl prom is the P. pastoris PMAl promoter
- PpPMAl TT is the P. pastoris PMAl termination sequence
- PpGAPDH is the P. pastoris GADPH promoter
- ScCYC TT is the S. cerevisiae CYC termination sequence
- PpOCHl Prom is the P. pastoris
- OCH1 promoter OCH1 promoter
- PpALG12 TT is the P. pastoris ALG12 termination sequence.
- Figure 12 shows a map of plasmid pGLY3411 (pSH1092). Plasmid pGLY3411
- pSH1092 is an integration vector that contains the expression cassette comprising the P.
- PpURAS lacZ repeat flanked on one side with the 5' nucleotide sequence of the P. pastoris BMT4 gene (PpPBS4 5') and on the other side with the 3' nucleotide sequence of the P. pastoris BMT4 gene (PpPBS4 3').
- FIG. 13 shows a map of plasmid pGLY3419 (pSHl 110). Plasmid pGLY3430
- (pSHl 115) is an integration vector that contains an expression cassette comprising the P.
- P. pastoris URA5 gene or transcription unit flanked by lacZ repeats (lacZ repeat) flanked on one side with the 5' nucleotide sequence of the P. pastoris BMT1 gene (PBS1 5') and on the other side with the 3' nucleotide sequence of the P. pastoris BMP I gene (PBS1 3')
- Figure 14 shows a map of plasmid pGLY3421 (pSHl 106). Plasmid pGLY4472
- pSHl 186 contains an expression cassette comprising the P. pastoris URA5 gene or
- PpURAS flanked by lacZ repeats (lacZ repeat) flanked on one side with the 5' nucleotide sequence of the P. pastoris BMT3 gene (PpPBS3 5') and on the other side with the 3' nucleotide sequence of the P. pastoris BMT3 gene (PpPBS3 3').
- FIG. 15 shows a map of plasmid pGLY3673.
- Plasmid pGLY3673 is a KINKO integration vector that targets the PROl locus without disrupting expression of the locus and contains expression cassettes encoding the T. reesei a-l,2-mannosidase catalytic domain fused at the jV-terminus to S. cerevisiae aMATpre signal peptide (aMATTrMan) to target the chimeric protein to the secretory pathway and secretion from the cell.
- aMATTrMan aMATpre signal peptide
- Figure 16 shows a map of pGLY6833 encoding the light and heavy chains of an anti-Her2 antibody.
- the plasmid is a roll-in vector that targets the TRP2 locus.
- the ORFs encoding the light and heavy chains are under the control of a P. pastoris AOX1 promoter and the P. pastoris CITl 3UTR transcription termination sequence. Selection of transformants uses zeocin resistance encoded by the zeocin resistance protein (Zeocin ⁇ ) ORF under the control of the P. pastoris TEF1 promoter and S. cerevisiae CYC termination sequence.
- Zeocin ⁇ zeocin resistance protein
- Figure 17 shows a map of pGLY6564 encoding the light and heavy chains of an anti-RSV antibody.
- the plasmid is a roll-in vector that targets the TRP2 locus.
- the ORF encoding the heavy chain is under the control of a P. pastoris AOX1 promoter and the S.
- the ORF encoding the light chain is under the control of a P. pastoris AO 1 promoter and the P. pastoris AOX1 transcription termination sequence.
- Selection of transformants uses zeocin resistance encoded by the zeocin resistance protein (ZeocinR) ORF under the control of the P. pastoris TEF1 promoter and S. cerevisiae
- Figure 18 shows the percent N-glycosylation site occupancy of anti-Her2 and anti-RSV antibodies produced in control strains verses strains in which the ZmSTT3D is constitutively expressed (GAPDH promoter) or inducibly expressed (AOX1 promoter).
- Figure 19 shows a comparison of iV-glycosylation site occupancy of the anti-Her2 antibody produced in strain YGLY13992 and strain YGLY17351 compared to N-glycosylation site occupancy of a commercially available anti-Her2 antibody produced in CHO cells
- Strain YGLY13992 does not include an expression cassette encoding the ZmSTT3D whereas strain YGLY17351 includes an expression cassette encoding the LmSTT3 under the control of the inducible PpAOXl promoter.
- Figure 20 shows the shows the percent N-glycosylation site occupancy of anti-
- Figure 21 shows the results of a CE and Q-TOF analysis of a commercial lot of anti-Her2 antibody (HERCEPTIN).
- Figure 22 shows the results of a CE and Q-TOF analysis for the same commercial lot as used for Figure 21 but after treatment with PNGase F for a period of time.
- Figure 23 A-D shows the genealogy of P. pastoris strain YGLY12900 beginning from YGLY7961.
- FIG. 24 shows a map of plasmid pGLY2456.
- Plasmid pGLY2456 is a TNI O integration vector that targets the TRP2 locus without disrupting expression of the locus and contains six expression cassettes encoding (1) the mouse CMP-sialic acid transporter codon optimized (CO mCMP-Sia Transp), (2) the human UDP-GlcNAc 2-epimerase/N- acetylmannosamine kinase codon optimized (CO hGNE), (3) the Pichia pastoris ARG1 gene or transcription unit, (4) the human CMP-sialic acid synthase codon optimized (CO hCMP-NANA S), (5) the human N-acetylneuraminate-9-phosphate synthase codon optimized (CO hSIAP S), and, (6) the mouse a-2,6-sialyltransferase catalytic domain codon optimized fused at the N- terminus to S.
- PpPMAl prom is the P. pastoris PMA1 promoter
- PpPMAl TT is the P. pastoris PMA1 termination sequence
- CYC TT is the S. cerevisiae CYC termination sequence
- PpTEF Prom is the P.
- PpTEF TT is the P. pastoris TEFl termination sequence
- PpALG3 TT is the P. pastoris ALG3 termination sequence
- pGAP is the P. pastoris GAPDH promoter.
- FIG 25 shows a map of plasmid pGLY5048.
- Plasmid pGLY5048 is an integration vector that targets the STE13 locus and contains expression cassettes encoding (1) the T. reesei a-1 ,2-mannosidase catalytic domain fused at the N-terminus to S. cerevisiae MATpre signal peptide (aM ATTrMan) to target the chimeric protein to the secretory pathway and secretion from the cell and (2) the P. pastoris URA5 gene or transcription unit.
- Figure 26 shows a map of plasmid pGLY5019.
- Plasmid pGLY5019 is an integration vector that targets the DAP 2 locus and contains an expression cassette comprising a nucleic acid molecule encoding the Nourseothricin resistance (NAT R ) ORF operably linked to the Ashby gossypii TEFl promoter and A. gossypii TEFl termination sequences flanked one side with the 5' nucleotide sequence of the P. pastoris DAP 2 gene and on the other side with the 3' nucleotide sequence of the P. pastoris DAP 2 gene.
- NAT R Nourseothricin resistance
- FIG. 27 shows a plasmid map of pGLY5085.
- Plasmid pGLY5085 is a INKO plasmid for introducing a second set of the genes involved in producing sialylated N-glycans into P. pastoris.
- the plasmid is similar to plasmid YGLY2456 except that the P. pastoris ARG1 gene has been replaced with an expression cassette encoding hygromycin resistance (HygR) and the plasmid targets the P. pastoris TRP5 locus.
- the six tandem cassettes are flanked on one side by a nucleic acid molecule comprising a nucleotide sequence from the 5' region and ORF of the TRP5 gene ending at the stop codon followed by a P. pastoris ALG3 termination sequence and on the other side by a nucleic acid molecule comprising a nucleotide sequence from the 3' region of the TRP5 gene.
- Figure 28 shows a plasmid map of pGLY7240.
- the plasmid is an integration vector that targets the TRP2 locus and contains an ORF encoding the zeocin resistance protein (ZeocinR) under the control of the P. pastoris TEFl promoter and S. cerevisiae CYC termination sequence.
- the plasmid encodes the GM-CSF/CWP1 fusion protein operably linked at the 5' end to the Pichia pastoris AOX1 promoter and at the 3' end to the S. cerevisiae CYC transcription termination sequence.
- Figure 29 shows a Western blot of GM-CSF produced in strain YGLY16349, which co- expresses LmSTT3D, that the majority of GM-CSF (Lanes 2-8) is glycosylated with 2N-linked sites in contrast to the control strain (YGLY15560, lane 9) where GM-CSF is predominantly N-glycosylated with 1 site along with the minor portions of 2 N sites and non-glycosylated.
- Figure 30 shows a Q-TOP analysis of GM-CSF expressed from YGLY15560 (A) and YGLY16349 (B), respectively. Non-glycosylated GM-CSF was not detected.
- the present invention provides a method for producing a therapeutic glycoprotein in a host cell in which the N-glycosylation site occupancy of the glycoprotein is increased over the N-glycosylation site occupancy of the same glycoprotein produced in a host cell not modified as disclosed herein.
- a host cell e.g., yeast host cells or filamentous fungal host cells
- the iV-glycosylation site occupancy of recombinant glycoproteins produced in the host cell is the same as or more similar to the JV- glycosylation site occupancy of the same recombinant glycoproteins produced in mammalian or human host cells.
- At least one nucleic acid molecule encoding at least one heterologous single-subunit oligosaccharyltransferase which in particular embodiments at least one is capable of functionally suppressing a lethal mutation of one or more essential subunits comprising the endogenous host cell hetero-oligomeric oligosaccharyltransferase (OTase) complex, is overexpressed in the recombinant host cell either before or simultaneously with the expression of the glycoprotein in the host cell.
- the Leishmania major STT3A protein, Leishmania major STT3B protein, and Leishmania major STT3D protein are single-subunit oligosaccharyltransferases that have been shown to suppress the lethal phenotype of a deletion of the STT3 locus in Saccharomyces cerevisiae (Naseb et al, Molec. Biol. Cell 19: 3758-3768 (2008)). Naseb et al. (ibid.) further showed that the Leishmania major STT3D protein could suppress the lethal phenotype of a deletion of the WBP1, OST1, SWP1, or OST2 loci. Hese et al.
- the Leishmania major STT3A (STT3-1), STT3B (STT3-2), and STT3D (STT3-4) proteins can functionally complement deletions of the OST2, SWP1, and WBP1 loci.
- the Leishmania major STT3D (£wSTT3D) protein is a heterologous single-subunit
- oligosaccharyltransferases that is capable of suppressing a lethal phenotype of &Astt3 mutation and at least one lethal phenotype of a wbpl, Aost J, Aswpl, and Aost2 mutation that is shown in the examples herein to be capable of enhancing the N-glycosylation site occupancy of heterologous glycoproteins, for example antibodies, produced by the host cell.
- the one or more heterologous single-subunit oligosaccharyltransferases is/are overexpressed constitutively or inducibly in the presence of the proteins comprising the host cell's endogenous OTase complex, including the host cell's STT3 protein.
- An expression cassette encoding each heterologous single-subunit oligosaccharyltransferase gene can either be integrated into any site within the host cell genome or located in the extrachromosomal space of the host cell, i.e., autonomously replicating genetic elements such as plasmids, viruses, 2 ⁇ plasmid, mini chromosomes, and the like.
- oligosaccharyltransferases are provided to the host cell in expression cassettes, each comprising a nucleic acid molecule encoding a single-subunit oligosaccharyltransferase open reading frame (ORF) operably linked to a heterologous constitutive or inducible promoter and other heterologous transcriptional or translational regulatory elements suitable for expressing heterologous proteins in a particular host cell.
- ORF open reading frame
- One or more copies of each expression cassette is/are integrated into one or more locations in the host cell's genome either by site-specific targeting of a particular locus for integration or randomly integrating the expression cassette into the genome.
- the locus for targeted integration can be selected based upon the suitability of the locus for ectopic constitutive or inducible expression of the single-subunit
- oligosaccharyltransferase in the expression cassette.
- Methods for integrating heterologous nucleic acid molecules into a host cell genome by techniques such as single- and double- crossover homologous recombination and the like are well known in the art (See for example, U.S. Published Application No. 20090124000 and International Published Application No.
- one or more copies of the expression cassette are located in the extrachromosomal space of the host cell using a 2 ⁇ plasmid, viral vector, mini-chromosome, or other genetic vector that replicates autonomously.
- While the present invention has been exemplified herein with Pichia pastor is host cells genetically engineered to produce mammalian or human-like glycosylation patterns comprising complex N-glycans, the present invention to increase the overall amount of N- glycosylation site occupancy of the glycoproteins produced in the host cell compared to that of glycoproteins produced in the host not modified as disclosed herein to express the single-subunit oligosaccharyltransferase gene can also be applied to Pichia pastoris host cells that are not genetically engineered to produce glycoproteins that have mammalian or human glycosylation patterns but instead express glycoproteins that have endogenous or wild-type glycosylation patterns, for example hypermannosylated 7V-glycosylation or when the host cell lacks alpha- 1,6- mannosylatransferase (ochlp) activity, high mannose N-glycosylation .
- ochlp alpha- 1,6- mannosylatransferase
- the present invention can also be applied to other yeast or filamentous fungi or to plant or algal host cells, which express glycoproteins that have endogenous or wild-type glycosylation patterns, for example hypermannosylated N-glycosylation or when the host cell lacks alpha- 1 ,6-mannosylatransferase (ochlp) activity, high mannose iV-glycosylation, or which have been genetically engineered to produce mammalian or human-like complex or hybrid N-glycans to increase the overall amount of N-glycosylation site occupancy of the glycoproteins produced in the host cell compared to that of glycoproteins produced in the host not modified as disclosed herein to express the single- subunit oligosaccharyltransferase gene.
- endogenous or wild-type glycosylation patterns for example hypermannosylated N-glycosylation or when the host cell lacks alpha- 1 ,6-mannosylatransferase (ochlp) activity, high mannose
- the present invention can also be applied to mammalian expression systems to increase the overall iV-glycosylation site occupancy of glycoproteins that have more than two JV-linked sites compared to that of glycoproteins produced in the host cell not modified as disclosed herein to express the single-subunit oligosaccharyltransferase gene.
- the OTase complex of animals, plants, and fungi is a hetero-oligomeric protein complex.
- Saccharomyces cerevisiae the OTase complex currently appears to consist of at least eight different subunits: Ostlp, Ost2p, Wbpl, Stt3p, Swplp, Ost4p, Ost5p, and Ost3p/Ost6p (Silberstein & Gilmore, FASEB J. 10: 849-858 (1996); Knauer & Lehle, Biochim. Biophys. Acta. 1426: 259-273 (1999); Dempski & Imperiali, Curr. Opin. Chem.
- the OTase complex appears to include at least Ostlp, Ost2p, Ost3p, Ost4p, Ost6p, Wbpl, Swplp, and Stt3p (See Shutter et aL, Nat. Biotechnol. 27: 561-566 (2009)).
- the STT3 protein is the catalytic subunit in the OTase complex (Yan & Lennarz, J. Biol. Chem. 277: 47692- ⁇ 7700 (2002); Kelleher et aL, Mol. Cell. 12: 101-111 (2003); Nilsson et aL, J. Cell Biol. 161 : 715-725 (2003)).
- Support for this hypothesis is from experiments showing that the prokaryotic homologue of yeast Stt3p is an active oligosaccharyltransferase in the absence of any other accessory proteins (Wacker et aL, Science.
- Single-subunit oligosaccharyltransferases are present in Giardia and kinetoplastids, whereas four subunit oligosaccharyltransferases consisting of the STT3, OST1, OST2, and WBP1 homologues are found in diplomonads, entamoebas, and apicomplexan species. Additionally, multiple forms of the putative STT3 proteins can be encoded in trypanosomatid genomes: three STT3 homologues are found in Trypanosoma brucei and four in Leishmania major (McConville et aL, Microbiol. Mol. Biol. Rev. 66: 122-154 (2002); Berriman et aL, Science.
- N-linked glycosylation principally follows the pathway described for fungal or animal cells, but with different oligosaccharide structures transferred to protein (Parodi, Glycobiology 3: 193-199 (1993); McConville et aL, Microbiol. Mol. Biol. Rev. 66: 122-154 (2002)). It has been shown that, depending on the species, either Man Glc Ac2 or Man7GlcNAc2 is the largest glycan transferred to protein in the genus
- oligosaccharyltransferase is not selective and transfers different lipid-linked oligosaccharides at the same rate (Bosch et aL, J. Biol. Chem. 263:17360-17365 (1988)). Therefore, the simplest eukaryotic oligossaccharyltransferase is a single subunit STT3 protein, similar to the
- oligosaccharyltransferase found in bacterial TV-glycosylation systems.
- Nasab et aL Molecular Biology of the Cell 19: 3758-3768 (2008) expressed each of the four Leishmania major STT3 proteins individually in Saccharomyces cerevisiae and found that three of them, mSTT3 A protein, XwSTT3B protein, and LmSTTSO protein, were able to complement a deletion of the yeast STT3 locus.
- LwSTT3D expression suppressed the lethal phenotype of single and double deletions in genes encoding various essential OTase subunits.
- the ZwSTT3 proteins did not incorporate into the yeast OTase complex but instead formed a homodimeric enzyme, capable of replacing the endogenous, multimeric enzyme of the yeast cell.
- the results indicate that while these single-subunit oligosaccharyltransferases may resemble the prokaryotic enzymes, they use substrates typical for eukaryote glycosylation: that is, the N-X-S/T N-glycosylation recognition site and dolicholpyrophosphate-linked high mannose oligosaccharides.
- N-glycosylation site occupancy in yeast has also been discussed in reports by, for example, Schultz and Aebi, Molec. Cell. Proteomics 8: 357-364 (2009); Hese et al, op. cit.) and Nasab et al., (op. cit.).
- Expression of the Toxoplasma gondii or Trypanosoma cruzi STT3 protein in Saccharomyces cerevisiae has been shown to complement the lethal phenotype of an stt3 deletion (Shams-Eldin et al, Mol. Biochem. Parasitol. 143: 6-11 (2005); Castro et al, Proc. Natl. Acad. Sci.
- the open reading frame encoding a heterologous single-subunit oligosaccharyltransferase (as exemplified herein with the open reading frame encoding the ImSTT3D) protein is overexpressed constitutively or inducibly in the recombinant host cell in which the host cell further expresses the endogenous genes encoding the proteins comprising the host cell oligosaccharyltransferase (OTase) complex, which includes the expression of the endogenous host cell STT3 gene.
- the host cell expresses both the heterologous single-subunit oligosaccharyltransferase and the endogenous host cell
- OTase complex including the endogenous host cell SST3 protein.
- the host cells can further be genetically engineered to produce glycoproteins that comprise a mammalian or human-like glycosylation pattern comprising complex and/or hybrid N-glycans and not glycoproteins that have the host cells' endogenous glycosylation pattern.
- the present invention has been exemplified herein using Pichia pastoris host cells genetically engineered to produce mammalian- or human-like complex N-glycans; however, the present invention can be applied to other yeast ost cells (including but not limited to
- yeast or fungal N-glycans either hypermannosylated N-glycans or high mannose N- glycans
- the present invention can also be applied to plant and mammalian expression system to improve the overall N- glycosylation site occupancy of glycoproteins produced in these plant or mammalian expression systems, particularly glycoproteins that have more than two N-linked glycosylation sites.
- a method for producing a heterologous glycoprotein in a host cell comprising providing a host cell that includes a nucleic acid molecule encoding at least one heterologous single-subunit oligosaccharyltransferase and a nucleic acid molecule encoding the heterologous glycoprotein and wherein the endogenous host cell genes encoding the proteins comprising the endogenous oligosaccharyltransferase (OTase) complex are expressed; and culturing the host cell under conditions for expressing the heterologous glycoprotein to produce the heterologous glycoprotein.
- OTase endogenous oligosaccharyltransferase
- a method for producing a heterologous glycoprotein with mammalian- or human-like complex or hybrid N-glycans in a host cell comprising providing a host cell that is genetically engineered to produce glycoproteins that have human-like N-glycans and includes a nucleic acid molecule encoding at least one heterologous single-subunit oligosaccharyltransferase and a nucleic acid molecule encoding the heterologous glycoprotein and wherein the endogenous host cell genes encoding the proteins comprising the endogenous oligosaccharyltransferase (OTase) complex are expressed; and culturing the host cell under conditions for expressing the heterologous glycoprotein to produce the heterologous glycoprotein.
- OTase endogenous oligosaccharyltransferase
- Expression of the endogenous host cell genes encoding the proteins comprising the oligosaccharyltransferase (OTase) complex includes expression of the endogenous host cell gene encoding the endogenous STT3 protein or homologue.
- the endogenous host cell genes encoding the proteins comprising the OTase complex are expressed, which includes the expression of the endogenous STT3 gene.
- the genes encoding proteins comprising the Saccharomyces cerevisi e OTase complex are known to include OST1, OST2, OST3, OST4, OST5, OST6, WBP1, SWP1, and STT3 (See for example, Spirig et al, Molec. Gen. Genet.
- the OTase complex appears to include at least Ostlp, Ost2p, Ost3p, Ost4p, Ost6p, Wbpl , Swplp, and Stt3p (See Shutter et al, op. cit).
- the heterologous single-subunit oligosaccharyltransferase is capable of functionally suppressing the lethal phenotype of a mutation of at least one essential protein of an OTase complex, for example, a yeast OTase complex.
- the heterologous single-subunit oligosaccharyltransferase is capable of functionally complementing or rescuing a lethal mutation of at least one essential protein of an OTase complex.
- the essential protein of the OTase complex is encoded by the Saccharomyces cerevisiae and/or Pichia pastor is STT3 locus, WBP1 locus, OST1 locus, SWP1 locus, or OST2 locus, or homologue thereof.
- heterologous single-subunit oligosaccharyltransferases that can be used in the methods herein for increasing N-glycosylation site occupancy is a heterologous single-subunit
- oligosaccharyltransferase that in particular embodiments is capable of functionally suppressing (or rescuing or complementing) the lethal phenotype of at least one essential protein of the Saccharomyces cerevisiae and/or Pichia pastoris OTase complex.
- the heterologous single-subunit oligosaccharyltransferase is the Leishmania major STT3D protein, which is capable of functionally suppressing (or rescuing or complementing) the lethal phenotype of at least one essential protein of the Saccharomyces cerevisiae or Pichia pastoris OTase complex.
- a particular heterologous single- subunit oligosaccharyltransferase is suitable for expression in the particular host cell provided the single-subunit heterologous oligosaccharyltransferase is capable of suppressing the lethal phenotype of at least one essential protein of the yeast OTase complex.
- a heterologous single-subunit heterologous oligosaccharyltransferase is selected for expression in a particular host cell provided the single-subunit heterologous oligosaccharyltransferase is capable of suppressing the lethal phenotype of at least one essential protein of the Saccharomyces cerevisiae and/or Pichia pastoris OTase complex.
- the essential proteins include OST1, OST2, WBPl, SWPl, d STT3.
- a lethal mutation includes a deletion or disruption of the gene encoding the essential protein of the OTase complex or a mutation in the coding sequence that renders the essential protein non-functional.
- the term can further include knock-down mutations wherein production of a functional essential protein is abrogated using shRNA or R Ai.
- a host cell comprising a first nucleic acid molecule encoding at least one heterologous single-subunit oligosaccharyltransferase; and a second nucleic acid molecule encoding a heterologous glycoprotein; and the host cell expresses its endogenous genes encoding the proteins comprising the endogenous oligosaccharyltransferase (OTase) complex, which includes expressing the endogenous host cell gene encoding the host cell STT3 protein, which in yeast is the STT3 gene.
- the host cell expresses the endogenous genes encoding the proteins comprising the OTase complex.
- the host cell further comprises one or more a nucleic acid molecules encoding additional heterologous oligosaccharyltransferases, which can include single-subunit or multimeric oligosaccharyltransferases.
- the host cell can comprise one or more nucleic acid molecules encoding one or more single-subunit oligosaccharyltransferases selected from the group consisting of the £mSTT3A protein, imSTT3B protein, and WJSTT3D protein.
- the host cell can further include a nucleic acid molecule encoding £mSTT3C protein.
- the host cell can include one or more nucleic acid molecules encoding one or more oligosaccharyltransferases selected from the group consisting of the Toxoplasma gondii STT3 protein, Trypanosoma cruzi STT3 protein, Trypanosoma brucei STT3 protein, and C. elegans STT3 protein.
- the host cell can further include a nucleic acid molecule encoding the Pichia pastoris STT3 protein.
- Lower eukaryotes such as yeast or filamentous fungi are often used for expression of recombinant glycoproteins because they can be economically cultured, give high yields, and when appropriately modified are capable of suitable glycosylation.
- Yeast in particular offers established genetics allowing for rapid transfections, tested protein localization strategies and facile gene knock-out techniques.
- Suitable vectors have expression control sequences, such as promoters, including 3-phosphoglycerate kinase or other glycolytic enzymes, and an origin of replication, termination sequences, and the like as desired.
- Useful lower eukaryote host cells include but are not limited to Pichia pastoris, Pichia finlandica, Pichia trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia minuta (Ogataea minuta, Pichia lindneri), Pichia opuntiae, Pichia thermotolerans, Pichia salictaria, Pichia guercuum, Pichia pijperi, Pichia stiptis, Pichia methanolica, Pichia sp., Saccharomyces cerevisiae, Saccharomyces sp., Hansenula olymorpha, Kl yveromyces sp., Kluyveromyces lactis, Candida albicans, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Trichoderma reesei, Chr
- yeasts such as K. lactis, Pichia pastoris, Pichia methanolica, and Hansenula polymorpha are particularly suitable for cell culture because they are able to grow to high cell densities and secrete large quantities of recombinant protein.
- filamentous fungi such as Aspergillus niger, Fusarium sp, Neurospora crassa and others can be used to produce glycoproteins of the invention at an industrial scale. In the case of lower eukaryotes, cells are routinely grown from between about one and a half to three days.
- a method for producing a heterologous glycoprotein in a lower eukaryote host cell comprising providing a lower eukaryote host cell that includes a nucleic acid molecule encoding a heterologous single-subunit ohgosaccharyitransferase and a nucleic acid molecule encoding the heterologous glycoprotein; and culturing the host cell under conditions for expressing the heterologous glycoprotein to produce the heterologous
- glycoprotein glycoprotein
- a lower eukaryote host cell comprising a first nucleic acid molecule encoding a heterologous single- subunit oligosaccharyltransferase; and a second nucleic acid molecule encoding a heterologous glycoprotein; and wherein the endogenous host cell genes encoding the proteins comprising the oligosaccharyltransferase (OTase) complex are expressed.
- yeast or filamentous fungus host cell comprising a first nucleic acid molecule encoding a heterologous single-subunit oligosaccharyltransferase; and a second nucleic acid molecule encoding a heterologous glycoprotein; and wherein the endogenous host cell genes encoding the proteins comprising the oligosaccharyltransferase (OTase) complex are expressed.
- the above yeast or filamentous fungus host cell can be a host cell that produces glycoproteins that have a yeast-like or filamentous fungus-like glycosylation pattern.
- the yeast glycosylation pattern can include hypermannosylated N-glycans or the yeast can be genetically engineered to lack l,6-mannosyltransferase activity, that is, the yeast host is genetically engineered to lack oc lp activity, in which case, the yeast produces glycoproteins that have high mannose N-glycans that are not further hypermannosylated.
- the heterologous single-subunit oligosaccharyltransferase is capable of functionally suppressing the lethal phenotype of a mutation of at least one essential protein of the OTase complex.
- the essential protein of the OTase complex is encoded by the STT3 locus, WBPl locus, OST1 locus, SWP1 locus, or OST2 locus, or homologue thereof.
- the for example single-subunit oligosaccharyltransferase is the Leishmania major STT3D protein.
- the methods and host cells herein provide a means for producing heterologous glycoproteins in a host cell wherein the JV-glycosylation site occupancy of a composition of the heterologous glycoproteins is greater than the N-glycosylation site occupancy for the
- heterologous produced in the host cell not modified as described herein to express a heterologous single-subunit oligosaccharyltransferase and the endogenous host cell genes encoding the proteins comprising the oligosaccharyltransferase (OTase) complex.
- oligosaccharyltransferase oligosaccharyltransferase
- the N-glycosylation site occupancy of a heterologous glycoprotein when the N-glycosylation site occupancy of a heterologous glycoprotein is lower than that obtained for the heterologous glycoprotein when produced in mammalian or human cells, the N-glycosylation site occupancy of the glycoprotein produced in the host cell can be made the same as or more similar to the N-glycosylation site occupancy of the glycoprotein in the mammalian or human cell by producing the glycoprotein in a host cell that express a heterologous single-subunit oligosaccharyltransferase and the endogenous host cell genes encoding the proteins comprising the oligosaccharyltransferase (OTase) complex.
- oligosaccharyltransferase and the endogenous host cell genes encoding the proteins comprising the oligosaccharyltransferase (OTase) complex are capable of producing antibodies wherein the N-glycosylation site occupancy of the antibodies is similar to that of the antibodies produced in Chinese hamster ovary (CHO) cells ⁇ See also Figure 19).
- the antibodies in the composition are reduced and the moles of glycosylated and non-glycosylated heavy chains determined.
- Each heavy chain has one N-glycosylation site at Asn-297.
- the percent N-glycosylation site occupancy is determined based upon total moles of N-glycans released and the total moles of antibody heavy chains. For example, an N- glycosylation site occupancy of 94% would indicate that 94% of the heavy chains in the composition have an N-glycan at Asn-297 and 6% of the heavy chains would lack an N-glycan.
- Antibodies consist of two heavy chains and two light chains.
- antibodies in the composition can have both heavy chains linked to an N-glycan, one of the two heavy chains with an N-glycan, or neither chain with an N-glycan. Therefore, a 94% N-glycosylation site occupancy of heavy chains would suggest that about 88% of the antibodies in the composition would have both heavy chains N-glycosylated and 11.4% of the antibodies would have only one of the two heavy chains N-glycosylated.
- whole antibodies are analyzed by a method such as Q-TOF (hybrid quadrupole time of flight mass spectrometer with MS/MS capability).
- a general method for measuring N-glycosylation site occupancy of antibodies can use the following method, which is exemplified in Example 3.
- the antibodies are reduced to heavy chains (HC) and light chains (LC) and the amount of glycosylated heavy chain (GHC) and non-glycosylated heavy chains (NGHC) are determined by a method such as capillary
- N-glycan occupancy of 100% would be equivalent to a ratio of 1 :1 (1 mole of N-glycan per 1 mole of N-glycosylation site, e.g., heavy chain from reduced antibody) or 2:1 (2 moles of N-glycan per 1 mole of protein with two N-glycosylation sites, e.g., non-reduced antibody).
- N-glycan occupancy of 80% would be equivalent to a ratio of 0.8:1 (0.8 mole of N-glycan per 1 mole of N-glycosylation site, e.g., heavy chain from reduced antibody) or 1.6:1 (1.6 moles of N-glycan per mole of protein with two N-glycosylation sites, e.g., non-reduced antibody).
- Example 3 shows that the methods herein enable the production of antibody compositions wherein about 70% to about 98% of the non-reduced whole antibody molecules in the composition have both N-glycosylation sites occupied. Since measurement of N-glycosylation site occupancy was determined using reduced antibody molecules, the results herein show that for compositions comprising glycoprotein molecules containing a single glycosylation site, more than 84% to at least 99% of the glycoprotein molecules were N-glycosylated. Therefore, the methods and host cells herein enable production of glycoprotein compositions in which at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% of the N-glycosylation sites of the glycoproteins in the composition are occupied.
- Another method for measuring N-glycosylation site occupancy of glycoproteins in a glycoprotein composition can be accomplished by releasing the N-glycans from the
- glycoproteins in the composition and measuring the molar amount of the N-glycans released and the molar amount of glycoprotein times the number of glycosylation sites on the glycoprotein.
- Lower eukaryotes, particularly yeast, can be genetically modified so that they express glycoproteins in which the glycosylation pattern is mammalian or human-like or humanized.
- glycoprotein compositions can be produced in which a specific desired glycoform is predominant in the composition.
- Such can be achieved by eliminating selected endogenous glycosylation enzymes and/or genetically engineering the host cells and/or supplying exogenous enzymes to mimic all or part of the mammalian glycosylation pathway as described in U.S. Published Application No. 2004/0018590, the disclosure of which is incorporated herein by reference.
- additional genetic engineering of the glycosylation can be performed, such that the glycoprotein can be produced with or without core fucosylation.
- Lower eukaryotes such as yeast can be genetically modified so that they express glycoproteins in which the glycosylation pattern is mammalian-like or human-like or humanized. Such can be achieved by eliminating selected endogenous glycosylation enzymes and/or supplying exogenous enzymes as described by Gerngross et ah, U.S. Patent No. 7,449,308, the disclosure of which is incorporated herein by reference.
- the host cell is yeast, for example, a methy!otrophic yeast such as Pichia pastoris or Ogataea minuta and mutants thereof and genetically engineered variants thereof.
- glycoprotein compositions can be produced in which a specific desired glycoform is predominant in the composition.
- Such can be achieved by eliminating selected endogenous glycosylation enzymes and/or genetically engineering the host cells and/or supplying exogenous enzymes to mimic all or part of the mammalian glycosylation pathway as described in U.S. Patent No.
- glycosylation can be performed, such that the glycoprotein can be produced with or without core fucosylation.
- Use of lower eukaryotic host cells such as yeast are further advantageous in that these cells are able to produce relatively homogenous compositions of glycoprotein, such that the predominant glycoform of the glycoprotein may be present as greater than thirty mole percent of the glycoprotein in the composition.
- the predominant glycoform may be present in greater than forty mole percent, fifty mole percent, sixty mole percent, seventy mole percent and, most preferably, greater than eighty mole percent of the glycoprotein present in the composition.
- Such can be achieved by eliminating selected endogenous glycosylation enzymes and/or supplying exogenous enzymes as described by Gerngross et al, U.S. Patent No. 7,029,872 and U.S. Patent No. 7,449,308, the disclosures of which are incorporated herein by reference.
- a host cell can be selected or engineered to be depleted in 1,6-mannosyl transferase activities, which would otherwise add mannose residues onto the N-glycan on a glycoprotein.
- the host cell further includes an al,2-mannosidase catalytic domain fused to a cellular targeting signal peptide not normally associated with the catalytic domain and selected to target the al,2-mannosidase activity to the ER or Golgi apparatus of the host cell.
- Passage of a recombinant glycoprotein through the ER or Golgi apparatus of the host cell produces a recombinant glycoprotein comprising a Man5GlcNAc2 glycoform, for example, a recombinant glycoprotein composition comprising predominantly a MansGlc Aca glycoform.
- U.S. Patent No. 7,029,872, U.S. Patent No. 7,449,308, and U.S. Published Patent Application No. 2005/0170452 disclose lower eukaryote host cells capable of producing a glycoprotein comprising a
- the immediately preceding host cell further includes an N-acetylglucosaminyltransferase I (GlcNAc transferase I or GnT I) catalytic domain fused to a cellular targeting signal peptide not normally associated with the catalytic domain and selected to target GlcNAc transferase I activity to the ER or Golgi apparatus of the host cell.
- GlcNAc transferase I or GnT I N-acetylglucosaminyltransferase I
- glycoprotein produced in the above cells can be treated in vitro with a hexaminidase to produce a recombinant glycoprotein comprising a Man5GlcNAc2 glycoform.
- the immediately preceding host cell further includes a mannosidase II catalytic domain fused to a cellular targeting signal peptide not normally associated with the catalytic domain and selected to target mannosidase II activity to the ER or Golgi apparatus of the host cell. Passage of the recombinant glycoprotein through the ER or Golgi apparatus of the host cell produces a recombinant glycoprotein comprising a
- GlcNAcMan3GlcNAc2 glycoform for example a recombinant glycoprotein composition comprising predominantly a GlcNAcMan3GicNAc2 glycoform.
- the glycoprotein produced in the above cells can be treated in vitro with a hexaminidase to produce a recombinant glycoprotein comprising a Man3GlcNAc2 glycoform.
- the immediately preceding host cell further includes N ⁇ acetylglucosaminyltransferase II (GlcNAc transferase II or GnT II) catalytic domain fused to a cellular targeting signal peptide not normally associated with the catalytic domain and selected to target GlcNAc transferase II activity to the ER or Golgi apparatus of the host cell.
- GlcNAc transferase II or GnT II N ⁇ acetylglucosaminyltransferase II
- glycoprotein produced in the above cells can be treated in vitro with a hexaminidase to produce a recombinant glycoprotein comprising a Man3GlcNAc2 glycoform.
- the immediately preceding host cell further includes a galactosyltransferase catalytic domain fused to a cellular targeting signal peptide not normally associated with the catalytic domain and selected to target galactosyltransferase activity to the ER or Golgi apparatus of the host cell. Passage of the recombinant glycoprotein through the ER or Golgi apparatus of the host cell produces a recombinant glycoprotein comprising a
- glycoprotein produced in the above cells can be treated in vitro with a galactosidase to produce a recombinant glycoprotein comprising a GlcNAc2Man3GlcNAc2 glycoform, for example a recombinant glycoprotein composition comprising predominantly a
- the immediately preceding host cell further includes a sialyltransferase catalytic domain fused to a cellular targeting signal peptide not normally associated with the catalytic domain and selected to target sialyltransferase activity to the ER or Golgi apparatus of the host cell. Passage of the recombinant glycoprotein through the ER or Golgi apparatus of the host cell produces a recombinant glycoprotein comprising predominantly a NANA2Gal2GlcNAc 2 an3GlcNAc2 glycoform or NANAGal2GlcNAc2Man3GlcNAc2 glycoform or mixture thereof.
- the host cell further include a means for providing CMP-sialic acid for transfer to the N-glycan.
- U.S. Published Patent Application No. 2005/0260729 discloses a method for genetically engineering lower eukaryotes to have a CMP-sialic acid synthesis pathway
- U.S. Published Patent Application No. 2006/0286637 discloses a method for genetically engineering lower eukaryotes to produce sialylated glycoproteins.
- glycoprotein produced in the above cells can be treated in vitro with a neuraminidase to produce a recombinant glycoprotein comprising predominantly a Gal2GlcNAc2Man3GlcNAc2 glycoform or GalGlcNAc2Man3GlcNAc2 glycoform or mixture thereof.
- Any one of the preceding host cells can further include one or more GlcNAc transferase selected from the group consisting of GnT III, GnT IV, GnT V, GnT VI, and GnT IX to produce glycoproteins having bisected (GnT III) and/or multiantennary (GnT IV, V, VI, and IX) JV-glycan structures such as disclosed in U.S. Patent No. 7,598,055 and U.S. Published Patent Application No. 2007/0037248, the disclosures of which are all incorporated herein by reference.
- the host cell that produces glycoproteins that have predominantly GlcNAcMan5GlcNAc2 N-glycans further includes a galactosyltransferase catalytic domain fused to a cellular targeting signal peptide not normally associated with the catalytic domain and selected to target galactosyltransferase activity to the ER or Golgi apparatus of the host cell. Passage of the recombinant glycoprotein through the ER or Golgi apparatus of the host cell produces a recombinant glycoprotein comprising predominantly the
- the immediately preceding host cell that produced glycoproteins that have predominantly the GalGlcNAcMan5GlcNAc2 N-glycans further includes a sialyltransferase catalytic domain fused to a cellular targeting signal peptide not normally associated with the catalytic domain and selected to target sialytransferase activity to the ER or Golgi apparatus of the host cell. Passage of the recombinant glycoprotein through the BR or Golgi apparatus of the host cell produces a recombinant glycoprotein comprising a
- any one of the aforementioned host cells is further modified to include a fucosyltransferase and a pathway for producing fucose and transporting fucose into the ER or Golgi.
- a fucosyltransferase and a pathway for producing fucose and transporting fucose into the ER or Golgi.
- the Pichia pastoris host cell is further modified to include a fucosylation pathway comprising a GDP-mannose-4,6-dehydratase, GDP-keto-deoxy-mannose-epimerase/GDP-keto-deoxy- galactose-reductase, GDP -fucose transporter, and a fucosyltransferase.
- a fucosylation pathway comprising a GDP-mannose-4,6-dehydratase, GDP-keto-deoxy-mannose-epimerase/GDP-keto-deoxy- galactose-reductase, GDP -fucose transporter, and a fucosyltransferase.
- the fucosyltransferase is selected from the group consisting of al,2-fucosyltransferase, al,3- fucosyltransferase, a 1,4-fucosyl transferase, and al,6-fucosyltransferase.
- Various of the preceding host cells further include one or more sugar transporters such as UDP-GlcNAc transporters (for example, Kluyveromyces lactis and Mus musculus UDP- Glc Ac transporters), UDP-galactose transporters (for example, Drosophila meianogaster UDP- galactose transporter), and CMP-sialic acid transporter (for example, human sialic acid transporter).
- UDP-GlcNAc transporters for example, Kluyveromyces lactis and Mus musculus UDP- Glc Ac transporters
- UDP-galactose transporters for example, Drosophila meianogaster UDP- galactose transporter
- CMP-sialic acid transporter for example, human sialic acid transporter
- Host cells further include Pichia pastoris that are genetically engineered to eliminate glycoproteins having phosphomannose residues by deleting or disrupting one or both of the phosphomannosyltransferase genes PNOl and MNN4B ⁇ See for example, U.S. Patent Nos. 7,198,921 and 7,259,007; the disclosures of which are all incorporated herein by reference), which in further aspects can also include deleting or disrupting the MNN4A gene.
- Disruption includes disrupting the open reading frame encoding the particular enzymes or disrupting expression of the open reading frame or abrogating translation of RNAs encoding one or more of the ⁇ -mannosyl transferases and/or phosphomannosyltransferases using interfering RNA, antisense RNA, or the like.
- the host cells can further include any one of the aforementioned host cells modified to produce particular N-glycan structures.
- Host cells further include lower eukaryote cells (e.g., yeast such as Pichia pastoris) that are genetically modified to control O-glycosylation of the glycoprotein by deleting or disrupting one or more of the protein 0-mannosyltransferase (Dol-P-Man:Protein (Ser/Thr) Mannosyl Transferase genes) (PMTs) ⁇ See U.S. Patent No. 5,714,377; the disclosure of which is incorporated herein by reference) or grown in the presence of Pmtp inhibitors and/or an a 1,2 mannosidase as disclosed in Published International Application No. WO 2007061631 the disclosure of which is incorporated herein by reference), or both.
- yeast eukaryote cells
- Disruption includes disrupting the open reading frame encoding the Pmtp or disrupting expression of the open reading frame or abrogating translation of RNAs encoding one or more of the Pmtps using interfering RNA, antisense RNA, or the like.
- the host cells can further include any one of the aforementioned host cells modified to produce particular N-glycan structures.
- Pmtp inhibitors include but are not limited to a benzylidene thiazolidinediones.
- benzylidene thiazolidinediones that can be used are 5-[[3,4 ⁇ bis(phenylmethoxy) phenyl]methylene]-4-oxo-2-thioxo-3-thiazolidineacetic Acid; 5-[[3-(l-Phenylethoxy)-4-(2- phenylethoxy)]phenyl]methylene]-4-oxo-2 ⁇ thioxo-3-thiazolidineacetic Acid; and 5-[[3-(l- Phenyl-2-hydroxy)ethoxy)-4-(2-phenylethoxy)]phenyl]methylene]-4-oxo-2-thioxo-3- thiazolidineacetic Acid.
- the function or expression of at least one endogenous PMT gene is reduced, disrupted, or deleted.
- the function or expression of at least one endogenous P !Tgene selected from the group consisting of the PMT1, PMT2, PMT3, and PMT4 genes is reduced, disrupted, or deleted; or the host cells are cultivated in the presence of one or more PMT inhibitors.
- the host cells include one or more PMT gene deletions or disruptions and the host cells are cultivated in the presence of one or more Pmtp inhibitors.
- the host cells also express a secreted a-l,2-mannosidase.
- PMT deletions or disruptions and/or Pmtp inhibitors control O-glycosylation by reducing O-glycosylation occupancy; that is by reducing the total number of O-glycosylation sites on the glycoprotein that are glycosylated.
- the further addition of an a-l,2-mannosidase that is secreted by the cell controls O-glycosylation by reducing the mannose chain length of the O- glycans that are on the glycoprotein.
- the particular combination of PMT deletions or disruptions, Pmtp inhibitors, and a-l,2-mannosidase is determined empirically as particular heterologous glycoproteins (antibodies, for example) may be expressed and transported through the Golgi apparatus with different degrees of efficiency and thus may require a particular combination of PMT deletions or disruptions, Pmtp inhibitors, and a-1 ,2-mannosidase.
- genes encoding one or more endogenous mannosyltransferase enzymes are deleted. The deletion(s) can be in combination with providing the secreted a-1 ,2-mannosidase and/or PMT inhibitors or can be in lieu of providing the secreted a-1 ,2-mannosidase and/or PMT inhibitors.
- control of O-glycosylation can be useful for producing particular glycoproteins in the host cells disclosed herein in better total yield or in yield of properly assembled glycoprotein.
- the reduction or elimination of O-glycosylation appears to have a beneficial effect on the assembly and transport of glycoproteins such as whole antibodies as they traverse the secretory pathway and are transported to the cell surface.
- the yield of properly assembled glycoproteins such as antibody fragments is increased over the yield obtained in host cells in which O-glycosylation is not controlled.
- the recombinant glycoengineered Pichia pastoris host cells are genetically engineered to eliminate glycoproteins having a- mannosidase-resi slant JV-glycans by deleting or disrupting one or more of the ⁇ - mannosyltransferase genes (e.g., BMT1, BMT2, BMT3, and BMT4)(See, U.S. Patent No.
- Yield of glycoprotein can in some situations be improved by overexpressing nucleic acid molecules encoding mammalian or human chaperone proteins or replacing the genes encoding one or more endogenous chaperone proteins with nucleic acid molecules encoding one or more mammalian or human chaperone proteins.
- the expression of mammalian or human chaperone proteins in the host cell also appears to control O-glycosylation in the cell.
- the host cells herein wherein the function of at least one endogenous gene encoding a chaperone protein has been reduced or eliminated, and a vector encoding at least one mammalian or human homolog of the chaperone protein is expressed in the host cell.
- the lower eukaryotic host cell is a yeast or filamentous fungi host cell.
- Examples of the use of chaperones of host cells in which human chaperone proteins are introduced to improve the yield and reduce or control O- glycosylation of recombinant proteins has been disclosed in Published International Application No. WO 2009105357 and WO2010019487 (the disclosures of which are incorporated herein by reference).
- lower eukaryotic host cells wherein, in addition to replacing the genes encoding one or more of the endogenous chaperone proteins with nucleic acid molecules encoding one or more mammalian or human chaperone proteins or
- the function or expression of at least one endogenous gene encoding a protein O- mannosyltransferase (PMT) protein is reduced, disrupted, or deleted.
- the function of at least one endogenous PMT gene selected from the group consisting of the PMT1 , PMT2, PUTS, and PMT4 genes is reduced, disrupted, or deleted.
- the methods disclose herein can use any host cell that has been genetically modified to produce glycoproteins wherein the predominant N-glycan is selected from the group consisting of complex iV-glycans, hybrid N-glycans, and high mannose iV-glycans wherein complex N-glycans may be selected from the group consisting of GlcNAc(2- 4)Man 3 GlcNAc2, Gal(i-4)GlcNAc(2-4)Man 3 GlcNAc2, and NANA(i-4)Gal(i-4) GlcNAc(2- 4)Man3GlcNAc2; hybrid N-glycans maybe selected from the group consisting of
- GlcNAcMan 3 GlcNAc 2 GalGlcNAcMan 3 GlcNAc 2 ; NANAGalGlcNAc an 3 GlcNAc 2
- GlcNAcMan5GlcNAc2 GalGlcN AcMan5 GlcN Ac2, and NANAGalGlcNAcMan5GlcNAc2; and high Mannose N-glycans maybe selected from the group consisting of Man5GlcNAc2,
- MangGlcNAc2 ManyGlcNAc2, MangGIcNAc2, and Man9GlcNAc2- Further included are glycoproteins having N-glycans consisting of the N-glycan structure Man 3 GlcNAc2, for example, as shown in U.S. Published Application No. 20050170452.
- a method for producing a heterologous glycoprotein with mammalian- or human-like complex or hybrid N-glycans in a lower eukaryote host cell comprising providing a lower eukaryote host cell that is genetically engineered to produce glycoproteins that have human-like N-glycans and includes a nucleic acid molecule encoding a heterologous single-subunit oligosaccharyltransferase and a nucleic acid molecule encoding the heterologous glycoprotein; and culturing the host cell under conditions for expressing the heterologous glycoprotein to produce the heterologous glycoprotein.
- a method for producing a heterologous glycoprotein with mammalian- or human-like complex or hybrid N-glycans in a yeast or filamentous fungus host cell comprising providing a yeast or filamentous fungus host cell that is genetically engineered to produce glycoproteins that have human-like N-glycans and includes a nucleic acid molecule encoding a heterologous single-subunit
- oligosaccharyltransferase and a nucleic acid molecule encoding the heterologous glycoprotein; and culturing the host cell under conditions for expressing the heterologous glycoprotein to produce the heterologous glycoprotein.
- yeast or filamentous fungus host cell genetically engineered to produce glycoproteins having mammalian- or human-like N-glycans, comprising a first nucleic acid molecule encoding a heterologous single-subunit oligosaccharyltransferase; and a second nucleic acid molecule encoding a heterologous glycoprotein; and wherein the endogenous host cell genes encoding the proteins comprising the oligosaccharyltransferase (OTase) complex are expressed.
- the single-subunit oligosaccharyltransferase is capable of functionally suppressing the lethal phenotype of a mutation of at least one essential protein of the OTase complex.
- the essential protein of the OTase complex is encoded by the STT3 locus, WBP1 locus, OST1 locus, SWP1 locus, or OST2 locus, or homologue thereof.
- the for example single-subunit oligosaccharyltransferase is the Leishmania major STT3D protein.
- Promoters are DNA sequence elements for controlling gene expression.
- promoters specify transcription initiation sites and can include a TATA box and upstream promoter elements.
- the promoters selected are those which would be expected to be operable in the particular host system selected.
- yeast promoters are used when a yeast such as Saccharomyces cerevisiae, Kluyveromyces lactis, Ogataea minuta, or Pichia pastoris is the host ceil whereas fungal promoters would be used in host cells such as Aspergillus niger, Neurospora crassa, or Tricoderma reesei.
- yeast promoters include but are not limited to the GAPDH, AOX1, SEC4, HH1, PMAl, OCH1, GAL1, PGK, GAP, TPI, CYC1, ADH2, PH05, CUPl, MFal, FLDl, PMAl, PDI, TEF, RPL10, and GUTl promoters.
- Romanos et ah, Yeast 8: 423-488 (1992) provide a review of yeast promoters and expression vectors. Hartner et ah, Nucl. Acid Res. 36: e76 (pub on-line 6 June 2008) describes a library of promoters for fine-tuned expression of heterologous proteins in Pichia pastoris,
- the promoters that are operably linked to the nucleic acid molecules disclosed herein can be constitutive promoters or inducible promoters.
- An inducible promoter for example the AOX1 promoter, is a promoter that directs transcription at an increased or decreased rate upon binding of a transcription factor in response to an inducer.
- Transcription factors as used herein include any factor that can bind to a regulatory or control region of a promoter and thereby affect transcription.
- the RNA synthesis or the promoter binding ability of a transcription factor within the host cell can be controlled by exposing the host to an inducer or removing an inducer from the host cell medium. Accordingly, to regulate expression of an inducible promoter, an inducer is added or removed from the growth medium of the host cell.
- Such inducers can include sugars, phosphate, alcohol, metal ions, hormones, heat, cold and the like.
- commonly used inducers in yeast are glucose, galactose, alcohol, and the like.
- Transcription termination sequences that are selected are those that are operable in the particular host cell selected.
- yeast transcription termination sequences are used in expression vectors when a yeast host cell such as Saccharomyces cerevisiae, Kluyveromyces lactis, or Pichia pastoris is the host cell whereas fungal transcription termination sequences would be used in host cells such as Aspergillus niger, Neurospora crassa, or Tricoderma reesei.
- Transcription termination sequences include but are not limited to the Saccharomyces cerevisiae CYC transcription termination sequence (ScCYC TT), the Pichia pastoris ALG3 transcription termination sequence (ALG3 TT), the Pichia pastoris ALG6 transcription termination sequence (ALG6 TT), the Pichia pastoris ALG12 transcription termination sequence (ALG1 TT), the Pichia pastoris AOX1 transcription termination sequence (AOX1 TT), the Pichia pastoris OCH1 transcription termination sequence (OCH1 TT) and Pichia pastoris PMAl transcription termination sequence ⁇ PMAI TT).
- Other transcription termination sequences can be found in the examples and in the art.
- selectable markers can be used to construct the recombinant host cells include drug resistance markers and genetic functions which allow the yeast host cell to synthesize essential cellular nutrients, e.g. amino acids.
- Drug resistance markers which are commonly used in yeast include chloramphenicol, kanamycin, methotrexate, G418 (geneticin), Zeocin, and the like.
- Genetic functions which allow the yeast host cell to synthesize essential cellular nutrients are used with available yeast strains having auxotrophic mutations in the corresponding genomic function.
- Common yeast selectable markers provide genetic functions for synthesizing leucine (LEW), tryptophan (TRP1 and TRP2), proline
- yeast selectable markers include the ARR3 gene from S. cerevisiae, which confers arsenite resistance to yeast cells that are grown in the presence of arsenite (Bobrowicz et al, Yeast, 13:819-828 (1997); Wysocki et al, J. Biol. Chem. 272:30061-30066 (1997)).
- a number of suitable integration sites include those enumerated in U.S. Patent No.
- 7,479,389 (the disclosure of which is incorporated herein by reference) and include homologs to loci known for Saccharomyces cerevisiae and other yeast or fungi. Methods for integrating vectors into yeast are well known (See for example, U.S. Patent No. 7,479,389, U.S. Patent No. 7,514,253, U.S. Published Application No. 2009012400, and WO2009/085135; the disclosures of which are all incorporated herein by reference).
- Examples of insertion sites include, but are not limited to, Pichia ADE genes; Pichia TRP (including TRP1 through TRP2) genes; Pichia MCA genes;
- Pichia CYM genes Pichia PEP genes; Pichia PRB genes; and Pichia LEU genes.
- the Pichia ADEI md ARG4 genes have been described in Lin Cereghino et al, Gene 263:159-169 (2001) and U.S. Patent No. 4,818,700 (the disclosure of which is incorporated herein by reference), the HIS3 and TRP1 genes have been described in Cosano et al, Yeast 14:861-867 (1998), HIS4 has been described in GenBank Accession No. X56180.
- animal cells include, but are not limited to, SC-I cells, LLC-MK cells, CV-I cells, CHO cells, COS cells, murine cells, human cells, HeLa cells, 293 cells, VERO cells, MDBK cells, MDC cells, MDO cells, CRF cells, RAF cells, TCMK cells, LLC-P cells, PK15 cells, WI-38 cells, MRC-5 cells, T-FLY cells, BH cells, SP2/0, NSO cells, and derivatives thereof.
- Insect cells include cells of Drosophila melanogaster origin.
- These cells can be genetically engineered to render the cells capable of making immunoglobulins that have particular or predominantly particular N-glycans.
- U.S. Patent No. 6,949,372 discloses methods for making glycoproteins in insect cells that are sialylated. Yamane-Ohnuki et al. Biotechnol. Bioeng. 87: 614-622 (2004), anda et al, Biotechnol. Bioeng. 94: 680-688 (2006), Kanda et al, Glycobiol. 17: 104-1 18 (2006), and U.S. Pub. Application Nos.
- 2005/0074843 discloses making antibodies in mammalian cells that have bisected iV-glycans.
- the regulatable promoters selected for regulating expression of the expression cassettes in mammalian, insect, or plant cells should be selected for functionality in the cell-type chosen.
- suitable regulatable promoters include but are not limited to the
- tetracycline-regulatable promoters See for example, Berens & Hillen, Eur. J. Biochem. 270: 3109-3121 (2003)), U 486-inducible promoters, ecdysone-inducible promoters, and kanamycin- regulatable systems. These promoters can replace the promoters exemplified in the expression cassettes described in the examples.
- the capture moiety can be fused to a cell surface anchoring protein suitable for use in the cell-type chosen.
- Cell surface anchoring proteins including GPI proteins are well known for mammalian, insect, and plant cells. GPI-anchored fusion proteins has been described by ennard et ah, Methods Biotechnol. Vo.
- the genome targeting sequences for integrating the expression cassettes into the host cell genome for making stable recombinants can replace the genome targeting and integration sequences exemplified in the examples.
- Transfection methods for making stable and transiently transfected mammalian, insect, and plant host cells are well known in the art. Once the transfected host cells have been constructed as disclosed herein, the cells can be screened for expression of the immunoglobulin of interest and selected as disclosed herein.
- a method for producing a heterologous glycoprotein in a mammalian or insect host cell comprising providing a
- mammalian or insect host cell that includes includes a nucleic acid molecule encoding a heterologous single-subunit oligosaccharyltransferase (e.g., Leishmania major STT3 protein) and a nucleic acid molecule encoding the heterologous glycoprotein; and culturmg the host cell under conditions for expressing the heterologous glycoprotein to produce the heterologous
- a heterologous single-subunit oligosaccharyltransferase e.g., Leishmania major STT3 protein
- the host cell is genetically engineered to produce glycoproteins with human-like N-glycans or N-glycans not normally endogenous to the host cell.
- a method for producing a heterologous glycoprotein wherein the N-glycosylation site occupancy of the heterologous glycoprotein is greater than 83% in a mammalian or insect host cell comprising providing a mammalian or insect host cell that includes a nucleic acid molecule encoding a heterologous single-subunit oligosaccharyltransferase (e.g., Leishmania major STT3 protein) and a nucleic acid molecule encoding the heterologous glycoprotein; and culturing the host cell under conditions for expressing the heterologous glycoprotein to produce the heterologous glycoprotein wherein the N-glycosylation site occupancy of the heterologous glycoprotein is greater than 83%.
- the host cell is genetically engineered to produce glycoproteins with humanlike N-glycans or N-glycans not normally endogenous to the host cell.
- the endogenous host cell genes encoding the proteins comprising the oligosaccharyl transferase (OTase) complex are expressed.
- the N-glycosylation site occupancy is at least 94%. In further still embodiments, the N-glycosylation site occupancy is at least 99%.
- a mammalian or insect host cell comprising a first nucleic acid molecule encoding a heterologous single-subunit oligosaccharyltransferase (e.g., the
- Leishmania major STT3D protein Leishmania major STT3D protein
- a second nucleic acid molecule encoding a heterologous glycoprotein
- the endogenous host cell genes encoding the proteins comprising the endogenous host cell oligosaccharyltransferase (OTase) complex are expressed.
- the higher eukaryote cell, tissue, or organism can also be from the plant kingdom, for example, wheat, rice, corn, tobacco, and the like.
- bryophyte cells can be selected, for example from species of the genera Physcomitrella, Funaria, Sphagnum, Ceratodon, Marchantia, and Sphaerocarpos.
- Exemplary of plant cells is the bryophyte cell of Physcomitrella patens, which has been disclosed in WO 2004/057002 and WO2008/006554 (the disclosures of which are all incorporated herein by reference).
- Expression systems using plant cells can further manipulated to have altered glycosylation pathways to enable the cells to produce immunoglobulins that have predominantly particular N-glycans.
- the cells can be genetically engineered to have a dysfunctional or no core
- the galactose, fucose and/or xylose can be removed from the immunoglobulin by treatment with enzymes removing the residues. Any enzyme resulting in the release of galactose, fucose and/or xylose residues from N-glycans which are known in the art can be used, for example a-galactosidase, ⁇ -xylosidase, and a-fucosidase.
- an expression system can be used which synthesizes modified N-glycans which can not be used as substrates by 1,3 -fucosyltransferase and/or 1 f 2-xylosyltransferase, and/or 1,4- galactosyltransferase.
- Methods for modifying glycosylation pathways in plant cells are disclosed in U.S. Patent Nos. 7,449,308, 6,998,267 and 7,388,081 (the disclosures of which are
- WO 2008006554 discloses methods for making glycoproteins such as antibodies in plants genetically engineered to make glycoproteins without xylose or fucose.
- WO 2007006570 discloses methods for genetically engineering bryophytes, ciliates, algae, and yeast to make glycoproteins that have animal or human-like glycosylation patterns.
- a method for producing a heterologous glycoprotein with mammalian- or human-like complex or hybrid N-glycans in a plant host cell comprising providing a plant host cell that is genetically engineered to produce glycoproteins that have mammalian- or human-like N-glycans and includes a nucleic acid molecule encoding a heterologous single-subunit oligosaccharyltransferase (e.g., the Leishmania major STT3D protein) and a nucleic acid molecule encoding the heterologous glycoprotein; and culturing the host cell under conditions for expressing the heterologous glycoprotein to produce the heterologous glycoprotein.
- a heterologous single-subunit oligosaccharyltransferase e.g., the Leishmania major STT3D protein
- a method for producing a heterologous glycoprotein with mammalian- or human-like complex or hybrid N-glycans wherein the N-glycosylation site occupancy of the heterologous glycoprotein is greater than 83% in a plant host cell comprising providing a plant host cell that is genetically engineered to produce glycoproteins that have mammalian- or human-like N-glycans and includes a nucleic acid molecule encoding a heterologous single-subunit oligosaccharyltransferase (e.g., the Leishmania major STT3D protein) and a nucleic acid molecule encoding the heterologous glycoprotein; and culturing the host cell under conditions for expressing the heterologous glycoprotein to produce the heterologous glycoprotein with mammalian- or human-like N-glycans wherein the N- glycosylation site occupancy of the heterologous glycoprotein is greater than 83%.
- a plant host cell that is genetically engineered to produce glycoproteins that have ma
- the endogenous host cell genes encoding the proteins comprising the endogenous host cell oligosaccharyltransferase (OTase) complex are expressed.
- the N-glycosylation site occupancy is at least 94%. In further still embodiments, the N-glycosylation site occupancy is at least 99%.
- a plant host cell comprising a first nucleic acid molecule encoding a heterologous single-subunit oligosaccharyltransferase (e.g., the Leishmania major STT3D protein); and a second nucleic acid molecule encoding a heterologous glycoprotein; and wherein the endogenous host cell genes encoding the proteins comprising the endogenous host cell oligosaccharyltransferase (OTase) complex are expressed.
- a heterologous single-subunit oligosaccharyltransferase e.g., the Leishmania major STT3D protein
- OTase endogenous host cell genes encoding the proteins comprising the endogenous host cell oligosaccharyltransferase
- the host cells and methods herein are useful for producing a wide range of recombinant proteins and glycoproteins.
- recombinant proteins and glycoproteins that can be produced in the host cells disclosed herein include but are not limited to
- EPO erythropoietin
- cytokines such as interferon a, interferon ⁇ , interferon ⁇ , and interferon ⁇
- GCSF granulocyte-colony stimulating factor
- GM-CSF granulocyte macrophage-colony stimulating factor
- coagulation factors such as factor VIII, factor IX, and human protein C
- antithrombin III thrombin
- soluble IgE receptor a-chain immunoglobulins or antibodies such as IgG, IgG fragments, IgG fusions, and IgM
- immunoadhesions and other Fc fusion proteins such as soluble TNF receptor-Fc fusion proteins; RAGE-Fc fusion proteins; interleukins; urokinase; chymase; urea trypsin inhibitor; IGF-binding protein; epidermal growth factor; growth hormone- releasing factor; annexin V fusion protein; angio statin; vascular endot
- the recombinant host cells and methods disclosed herein are particularly useful for producing antibodies, Fc fusion proteins, and the like where it is desirable to provide antibody or Fc fusion protein compositions wherein the percent galactose-containing N-glycans is increased compared to the percent galactose obtainable in the host cells prior to modification as taught herein.
- Examples of antibodies that can be made in the host cells herein include but are not limited to human antibodies, humanized antibodies, chimeric antibodies, heavy chain antibodies (e.g., camel or llama).
- Specific antibodies include but are not limited to the following antibodies recited under their generic name (target): Muromonab-CD3 (anti-CD3 receptor antibody), Abciximab (anti-CD41 7E3 antibody), Rituximab (anti-CD20 antibody), Daclizumab (anti-CD25 antibody), Basiliximab (anti-CD25 antibody), Palivizumab (anti-RSV (respiratoiy syncytial virus) antibody), Infliximab (anti-TNFa antibody), Trastuzumab (anti-Her2 antibody), Gemtuzumab ozogamicin (anti-CD33 antibody), Alemtuzumab (anti-CD52 antibody),
- Ibritumomab tiuxeten (anti-CD20 antibody), Adalimumab (anti-TNFa antibody), Omalizumab (anti-IgE antibody), Tositumomab- 131 I (iodinated derivative of an anti-CD20 antibody),
- Fc- fusion proteins that can be made in the host cells disclosed herein include but are not limited to etanercept (TNFR-Fc fusion protein), FGF-21-Fc fusion proteins, GLP-l-Fc fusion proteins, RAGE-Fc fusion proteins, EPO-Fc fusion proteins, ActRJIA-Fc fusion proteins, ActRIIB-Fc fusion proteins, glucagon-Fc fusions, oxyntomodulin-Fc-fusions, and analogs and variants thereof.
- the methods and host cells herein can be used to produce glycoprotein compositions in which at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% of the N- glycosylation sites of the glycoproteins in the composition are occupied and the glycoproteins have mammalian- or human-like N-glycans.
- the methods and host cells herein can be used to produce glycoprotein compositions in which at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% of the N- glycosylation sites of the glycoproteins in the composition are occupied and the glycoproteins have mammalian- or human-likeN-glycans that lack fucose.
- the methods and yeast or filamentous fungus host cells genetically engineered to produce mammalian-like or human-like N-glycans can be used to produce glycoprotein compositions in which at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% of theN-glycosylation sites of the glycoproteins in the composition are occupied and the glycoproteins have mammalian- or human-like N-glycans that lack fucose.
- the yeast or filamentous host cells genetically engineered to produce fucosylated mammalian- or human-likeN-glycans can be used to produce glycoprotein compositions in which at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% of theN- glycosylation sites of the glycoproteins in the composition are occupied and the glycoproteins have mammalian- or human-like JV-glycans that have fucose.
- the recombinant cells disclosed herein can be used to produce antibodies and Fc fragments suitable for chemically conjugating to a heterologous peptide or drug molecule.
- WO2005047334, WO2005047336, WO2005047337, and WO2006107124 disclose chemically conjugating peptides or drug molecules to Fc fragments.
- EP1180121, EP1105409, and US 6,593,295 disclose chemically conjugating peptides and the like to blood components, which includes whole antibodies.
- the methods and host cells herein can be used to produce antibody compositions in which at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% of the antibody molecules in the composition have both N-glycosylation sites occupied and the antibodies have mammalian- or human-likeN-glycans.
- the methods and host cells herein can be used to produce antibody compositions in which at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% of the antibody molecules in the composition have bothN-glycosylation sites occupied and the antibodies have mammalian- or human-likeN-glycans that lack fucose.
- the methods and yeast or filamentous fungus host cells genetically engineered to produce mammalian-like or human-like N-glycans can be used to produce antibody compositions in which at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% of the antibody molecules in the composition have bothN-glycosylation sites occupied and the antibodies have mammalian- or human-like N-glycans that lack fucose.
- the yeast or filamentous host cells genetically engineered to produce fucosylated mammalian- or human-like N-glycans can be used to produce antibody compositions in which at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% of the antibody molecules in the composition have both N-glycosylation sites occupied and the antibodies have mammalian- or human-likeN-glycans that have fucose.
- the N-glycosylation composition of antibodies produced in Pichia pastor is strains, which have been genetically engineered to make galactose-terminated N-glycans, appear to range from about 50-60 mole%G0, 18-24 mole%Gl, 3-8% mole% G2, 12- 17 mole% Man5, and 3-6 mole% hybrids.
- a glycoprotein composition comprising a plurality of antibodies wherein at least 70% of the antibody molecules in the composition have both N- glycosylation sites occupied and about 50-70 mole% of the N-glycans have a GO structure, 15-25 mole% of the N-glycans have a Gl structure, 4-12 mole% of the N-glycans have a G2 structure, 5-17 mole% of the N-glycans have a Man5 structure, and 5-15 mole% of the N-glycans have a hybrid structure, and a pharmaceutically acceptable carrier.
- a glycoprotein composition comprising a plurality of antibodies wherein at least 70% of the antibody molecules in the composition have both N-glycosylation sites occupied and about 53 to 58 mole% of the N-glycans have a GO structure, 20-22 mole% of the N-glycans have a Gl structure, and about 16 to 18 mole% of the N-glycans comprise a Man 5 GlcNAc 2 core structure, and a pharmaceutically acceptable carrier.
- the N-glycans further include fucose.
- a glycoprotein composition comprising a plurality of antibodies wherein at least 75% of the antibody molecules in the composition have both N- glycosylation sites occupied and about 50-70 mole% of the N-glycans have a GO structure, 15-25 mole% of the N-glycans have a Gl structure, 4-12 mole% of the N-glycans have a G2 structure, 5-17 mole% of the N-glycans have a Man5 structure, and 5-15 mole% of the N-glycans have a hybrid structure, and a pharmaceutically acceptable carrier.
- a glycoprotein composition comprising a plurality of antibodies wherein at least 75% of the antibody molecules in the composition have both N-glycosylation sites occupied and about 53 to 58 mole% of the N-glycans have a GO structure, 20-22 mole% of the N-glycans have a Gl structure, and about 16 to 18 mole% of the N-glycans comprise a Man 5 GlcNAc 2 core structure, and a pharmaceutically acceptable carrier.
- the N-glycans further include fucose.
- a glycoprotein composition comprising a plurality of antibodies wherein at least 80% of the antibody molecules in the composition have both N- glycosylation sites occupied and about 50-70 mole% of the N-glycans have a GO structure, 15-25 mole% of the N-glycans have a Gl structure, 4-12 mole% of the N-glycans have a G2 structure, 5-17 mole% of the N-glycans have a Man5 structure, and 5-15 mole% of the N-glycans have a hybrid structure, and a pharmaceutically acceptable carrier.
- a glycoprotein composition comprising a plurality of antibodies wherein at least 80% of the antibody molecules in the composition have both N-glycosylation sites occupied and about 53 to 58 mole% of the N-glycans have a GO structure, 20-22 mole% of the N-glycans have a Gl structure, and about 16 to 18 mole% of the N-glycans comprise a Ma sGlcNAc 2 core structure, and a pharmaceutically acceptable carrier.
- the N-glycans further include fucose.
- a glycoprotein composition comprising a plurality of antibodies wherein at least 85% of the antibody molecules in the composition have both N- glycosylation sites occupied and : about 50-70 mole% of the N-glycans have a GO structure, 15-25 mole% of the N-glycans have a Gl structure, 4-12 mole% of the N-glycans have a G2 structure, 5-17 mole% of the N-glycans have a Man5 structure, and 5-15 mole% of the N-glycans have a hybrid structure, and a pharmaceutically acceptable carrier.
- a glycoprotein composition comprising a plurality of antibodies wherein at least 85% of the antibody molecules in the composition have both N-glycosylation sites occupied and about 53 to 58 mole% of the N-glycans have a GO structure, 20-22 mole% of the N-glycans have a Gl structure, and about 16 to 18 mole% of the N-glycans comprise a Man 5 GlcNAc 2 core structure, and a pharmaceutically acceptable carrier.
- the N-glycans further include fucose.
- a glycoprotein composition comprising a plurality of antibodies wherein at least 90% of the antibody molecules in the composition have both N- glycosylation sites occupied and about 50-70 mole% of the N-glycans have a GO structure, 15-25 mole% of the N-glycans have a Gl structure, 4-12 mole% of the N-glycans have a G2 structure, 5-17 mole% of the N-glycans have a Man5 structure, and 5-15 mole% of the N-glycans have a hybrid structure, and a pharmaceutically acceptable carrier.
- a glycoprotein composition comprising a plurality of antibodies wherein at least 90% of the antibody molecules in the composition have both N-glycosylation sites occupied and about 53 to 58 mole% of the N-glycans have a GO structure, 20-22 mole% of the N-glycans have a Gl structure, and about 16 to 18 mole% of the N-glycans comprise a MansGlcNAc 2 core structure, and a pharmaceutically acceptable carrier.
- the N-glycans further include fucose.
- a glycoprotein composition comprising a plurality of antibodies wherein at least 95% of the antibody molecules in the composition have both N- giycosylation sites occupied and about 50-70 mole% of the N-glycans have a GO structure, 15-25 mole% of the N-glycans have a Gl structure, 4-12 mole% of the N-glycans have a G2 structure, 5-17 mole% of the N-glycans have a Man5 structure, and 5-15 mole% of the N-glycans have a hybrid structure, and a pharmaceutically acceptable carrier.
- a glycoprotein composition comprising a plurality of antibodies wherein at least 95% of the antibody molecules in the composition have both N-glycosylation sites occupied and about 53 to 58 mole% of the N-glycans have a GO structure, 20-22 mole% of the N-glycans have a Gl structure, and about 1 to 18 mole% of the N-glycans comprise a Man 5 GlcNAc 2 core structure, and a pharmaceutically acceptable carrier.
- the N-glycans further include fucose.
- a glycoprotein composition comprising a plurality of antibodies wherein at least 98% of the antibody molecules in the composition have both N- glycosylation sites occupied and about 50-70 mole% of the N-glycans have a GO structure, 15-25 mole% of the N-glycans have a Gl structure, 4-12 mole% of the N-glycans have a G2 structure, 5-17 mole% of the N-glycans have a Man5 structure, and 5-15 mole% of the N-glycans have a hybrid structure, and a pharmaceutically acceptable carrier.
- a glycoprotein composition comprising a plurality of antibodies wherein at least 98% of the antibody molecules in the composition have both N-glycosylation sites occupied and about 53 to 58 mole% of the N-glycans have a GO structure, 20-22 mole% of the N-glycans have a Gl structure, and about 16 to 18 mole% of the N-glycans comprise a MansGlcNAc 2 core structure, and a pharmaceutically acceptable carrier.
- the N-glycans further include fucose.
- a glycoprotein composition comprising a plurality of antibodies wherein at least 99% of the antibody molecules in the composition have both N- glycosylation sites occupied and about 50-70 mole% of the N-glycans have a GO structure, 15-25 mole% of the N-glycans have a Gl structure, 4-12 mole% of the N-glycans have a G2 structure, 5-17 mole% of the N-glycans have a Man5 structure, and 5-15 mole% of the N-glycans have a hybrid structure, and a pharmaceutically acceptable carrier.
- a glycoprotein composition comprising a plurality of antibodies wherein at least 99% of the antibody molecules in the composition have both N-glycosylation sites occupied and about 53 to 58 mole% of the N-glycans have a GO structure, 20-22 mole% of the N-glycans have a Gl structure, and about 16 to 18 mole% of the N-glycans comprise a MansGlc Aci core structure, and a pharmaceutically acceptable carrier.
- the N-glycans further include fucose.
- the antibodies comprise an antibody selected from the group consisting of anti-Her2 antibody, anti-RSV (respiratory syncytial virus) antibody, anti- TNF antibody, anti-VEGF antibody, anti-CD3 receptor antibody, anti-CD41 7E3 antibody, anti- CD25 antibody, anti-CD 52 antibody, anti-CD 33 antibody, anti-IgE antibody, anti-CD 1 la antibody, anti-EGF receptor antibody, and anti-CD20 antibody.
- anti-Her2 antibody anti-RSV (respiratory syncytial virus) antibody
- anti- TNF antibody anti-VEGF antibody
- anti-CD3 receptor antibody anti-CD41 7E3 antibody
- anti-CD25 antibody anti-CD 52 antibody
- anti-CD 33 antibody anti-IgE antibody
- anti-CD 1 la antibody anti-EGF receptor antibody
- anti-CD20 antibody anti-CD20 antibody
- Plasmids comprising expression cassettes encoding the Leishmania major STT3D (LmSTT3D) open reading frame (ORF) operably linked to an inducible or constitutive promoter were constructed as follows.
- the open reading frame encoding the ZmSTT3D (SEQ ID NO: 12) was codon- optimized for optimal expression in P. pastoris and synthesized by GeneArt AG, Brandenburg, Germany.
- the codon-optimized nucleic acid molecule encoding the LmSTT3O was designated pGLY6287 and has the nucleotide sequence shown in SEQ ID NO: 11.
- Plasmid pGLY6301 ( Figure 2) is a roll-in integration plasraid that targets the
- the expression cassette encoding the Z.mSTT3D comprises a nucleic acid molecule encoding the Lm$TT3D ORF codon-optimized for effective expression in P. pastoris operably linked at the 5' end to a nucleic acid molecule that has the inducible P. pastoris AOX1 promoter sequence (SEQ ID NO:23) and at the 3' end to a nucleic acid molecule that has the S. cerevisiae CYC transcription termination sequence (SEQ ID NO:24).
- the plasmid comprises an expression cassette encoding the S.
- nucleic acid molecule encoding the ORF (SEQ ID NO:32) is operably linked at the 5' end to a nucleic acid molecule having the P. pastoris RPL10 promoter sequence (SEQ ID NO:25) and at the 3' end to a nucleic acid molecule having the S. cerevisiae CYC
- Plasmid pGLY6301 was constructed by cloning the DNA fragment encoding the codon-optimized £mSTT3D ORF (pGLY6287) flanked by an EcoRI site at the 5' end and an Fsel site at the 3' end into plasmid pGFI30t, which had been digested with Eco l and Fsel. .
- Plasmid pGLY6294 ( Figure 3) is a JNKO integration vector that targets the
- the expression cassette encoding the IwSTT3D comprises a nucleic acid molecule encoding the LmSTT3D ORF operably linked at the 5' end to a nucleic acid molecule that has the constitutive P. pastoris GAPDH promoter sequence (SEQ ID NO:26) and at the 3' end to a nucleic acid molecule having the S.
- the plasmid comprises an expression cassette encoding the Nourseothricin resistance (NAT&) ORF (originally from pAG25 from EROSCARF, Scientific Research and Development GmbH, Daimlerstrasse 13a, D- 61352 Bad Homburg, Germany, See Goldstein et al, Yeast 15: 1541 (1999)); wherein the nucleic acid molecule encoding the ORF (SEQ ID NO:34) is operably linked to at the 5' end to a nucleic acid molecule having the Ashbya gossypii TEFI promoter sequence (SEQ ID NO: 86) and at the 3' end to a nucleic acid molecule that has the Ashbya gossypii TEFI termination sequence (SEQ ID NO:87).
- NAT& Nourseothricin resistance
- the two expression cassettes are flanked on one side by a nucleic acid molecule comprising a nucleotide sequence from the 5' region of the ORF encoding Tr lp ending at the stop codon (SEQ ID NO:30) linked to a nucleic acid molecule having the P.
- Plasmid pGLY6294 was constructed by cloning the DNA fragment encoding the codon-optimized LmSTT3D ORF (pGLY6287) flanked by a Noil site at the 5' end and a Pad site at the 3' end into plasmid pGLY597, which had been digested with Noil and Fsel.
- An expression cassette comprising a nucleic acid molecule encoding the Nourseothricin resistance ORF (NAT) operably linked to the Ashbya gossypii TEFI promoter (PTEF) and Ashbya gossypii TEFI termination sequence (TTEF).
- NAT Nourseothricin resistance ORF
- the above plasmids can be used to introduce the LmSTT3O expression cassettes into P. pastoris to increase the N-glycosylation site occupancy on glycoproteins produced therein as shown in the following examples.
- Pichia pastoris strain YGLY13992 is a strain that produces recombinant human anti-Her2 antibodies and Pichia pastoris strain YGLY14401 is a strain that produces recombinant human anti-RSV antibodies. Construction of the strains is illustrated schematically in Figure 1A-1HL Briefly, the strains were constructed as follows.
- the strain YGLY831 was constructed from wild-type Pichia pastoris strain NRRL-Y 11430 using methods described earlier (See for example, U.S. Patent No. 7,449,308; U.S. Patent No. 7,479,389; U.S. Published Application No. 20090124000; Published PCT
- Plasmid pGLY6 ( Figure 4) is an integration vector that targets the UPAS locus. It contains a nucleic acid molecule comprising the S. cerevisiae invertase gene or transcription unit (ScSUC2; SEQ ID NO:38) flanked on one side by a nucleic acid molecule comprising a nucleotide sequence from the 5' region of the P. pastoris URA5 gene (SEQ ID NO:39) and on the other side by a nucleic acid molecule comprising the nucleotide sequence from the 3' region of the P. pastoris UPAS gene (SEQ ID NO:40).
- ScSUC2 S. cerevisiae invertase gene or transcription unit
- Plasmid pGLY6 was linearized and the linearized plasmid transformed into wild-type strain NRRL-Y 11430 to produce a number of strains in which the ScSUC2 gene was inserted into the UPAS locus by double-crossover homologous recombination.
- Strain YGLY1-3 was selected from the strains produced and is auxotrophic for uracil.
- Plasmid pGLY40 ( Figure 5) is an integration vector that targets the OCH1 locus and contains a nucleic acid molecule comprising the P. pastoris UPAS gene or transcription unit (SEQ ID NO:41) flanked by nucleic acid molecules comprising lacZ repeats (SEQ ID NO:42) which in turn is flanked on one side by a nucleic acid molecule comprising a nucleotide sequence from the 5' region of the OCH1 gene (SEQ ID NO:43) and on the other side by a nucleic acid molecule comprising a nucleotide sequence from the 3' region of the OCH1 gene (SEQ ID NO:44).
- Plasmid pGLY40 was linearized with Sfil and the linearized plasmid transformed into strain YGLY1-3 to produce a number of strains in which the URAS gene flanked by the lacZ repeats has been inserted into the OCH1 locus by double-crossover homologous recombination.
- Strain YGLY2-3 was selected from the strains produced and is prototrophic for UPAS.
- Strain YGLY2-3 was counterselected in the presence of 5-fiuoroorotic acid (5-FOA) to produce a number of strains in which the URA5 gene has been lost and only the lacZ repeats remain in the OCH1 locus. This renders the strain auxotrophic for uracil.
- Strain YGLY4-3 was selected.
- Plasmid pGLY43a ( Figure 6) is an integration vector that targets the BMT2 locus and contains a nucleic acid molecule comprising the K. lactis UDP-N-acetylglucosamine (UDP- GlcNAc) transporter gene or transcription unit (KIMNN2-2, SEQ ID NO:45) adjacent to a nucleic acid molecule comprising the P. pastoris URA5 gene or transcription unit flanked by nucleic acid molecules comprising lacZ repeats.
- the adjacent genes are flanked on one side by a nucleic acid molecule comprising a nucleotide sequence from the 5 r region of the BMT2 gene (SEQ ID NO: 46) and on the other side by a nucleic acid molecule comprising a nucleotide sequence from the 3' region of the BMT2 gene (SEQ ID NO:47).
- Plasmid pGLY43a was linearized with Sfil and the linearized plasmid transformed into strain YGLY4-3 to produce to produce a number of strains in which the KIMNN2-2 gene and UPAS gene flanked by the lacZ repeats has been inserted into the BMT2 locus by double-crossover homologous recombination.
- the BMT2 gene has been disclosed in Mille et aL, J. Biol. Chem. 283: 9724-9736 (2008) and U.S. Patent No.7,465,557.
- Strain YGLY6-3 was selected from the strains produced and is prototrophic for uracil. Strain YGLY6-3 was counterselected in the presence of 5-FOA to produce strains in which the UPAS gene has been lost and only the lacZ repeats remain. This renders the strain auxotrophic for uracil. Strain YGLY8-3 was selected.
- Plasmid pGLY48 ( Figure 7) is an integration vector that targets the MNN4L1 locus and contains an expression cassette comprising a nucleic acid molecule encoding the mouse homologue of the UDP-GlcNAc transporter (SEQ ID NO:48) open reading frame (ORP) operably linked at the 5' end to a nucleic acid molecule comprising the P. pastoris GAPDH promoter (SEQ ID NO: 26) and at the 3 ! end to a nucleic acid molecule comprising the S.
- SEQ ID NO:48 mouse homologue of the UDP-GlcNAc transporter
- ORP open reading frame
- CYC termination sequences adjacent to a nucleic acid molecule comprising the P. pastoris URA5 gene flanked by lacZ repeats and in which the expression cassettes together are flanked on one side by a nucleic acid molecule comprising a nucleotide sequence from the 5' region of the P. pastoris MNN4L1 gene (SEQ ID NO:49) and on the other side by a nucleic acid molecule comprising a nucleotide sequence from the 3' region of the MNN4L1 gene (SEQ ID NO:50).
- Plasmid pGLY48 was linearized with Sfil and the linearized plasmid transformed into strain YGLY8-3 to produce a number of strains in which the expression cassette encoding the mouse UDP-GlcNAc transporter and the URA5 gene have been inserted into the MNN4L1 locus by double-crossover homologous recombination.
- the MNN4L1 gene (also referred to as MNN4B) has been disclosed in U.S. Patent No. 7,259,007.
- YGLY1G-3 was selected from the strains produced and then counterselected in the presence of 5- FOA to produce a number of strains in which the URA5 gene has been lost and only the lacZ repeats remain. Strain YGLY12-3 was selected.
- Plasmid pGLY45 ( Figure 8) is an integration vector that targets the PN01/MNN4 loci and contains a nucleic acid molecule comprising the P. pastoris URA5 gene or transcription unit flanked by nucleic acid molecules comprising lacZ repeats which in turn is flanked on one side by a nucleic acid molecule comprising a nucleotide sequence from the 5' region of the PNOl gene (SEQ ID NO: 51) and on the other side by a nucleic acid molecule comprising a nucleotide sequence from the 3' region of the MNN4 gene (SEQ ID NO: 52).
- Plasmid pGLY45 was linearized with Sfil and the linearized plasmid transformed into strain YGLY12-3 to produce a number of strains in which the URA5 gene flanked by the lacZ repeats has been inserted into the PN01IMNN4 loci by double-crossover homologous recombination.
- the PNOl gene has been disclosed in U.S. Patent No. 7,198,921 and the MNN4 gene (also referred to as MNN4B) has been disclosed in U.S. Patent No. 7,259,007.
- Strain YGLY14-3 was selected from the strains produced and then counterselected in the presence of 5-FOA to produce a number of strains in which the URA5 gene has been lost and only the lacZ repeats remain.
- Strain YGLY16-3 was selected.
- Plasmid pGLY1430 ( Figure 9) is a ⁇ ⁇ integration vector that targets the ADE1 locus without disrupting expression of the locus and contains in tandem four expression cassettes encoding (1) the human GlcNAc transferase I catalytic domain (NA) fused at the N- terminus to P. pastoris SEC 12 leader peptide (10) to target the chimeric enzyme to the ER or Golgi, (2) mouse homologue of the UDP-GlcNAc transporter (MmTr), (3) the mouse
- the expression cassette encoding the NA10 comprises a nucleic acid molecule encoding the human GlcNAc transferase I catalytic domain codon-optimized for expression in P.
- the expression cassette encoding MmTr comprises a nucleic acid molecule encoding the mouse homologue of the UDP-GlcNAc transporter ORF operably linked at the 5' end to a nucleic acid molecule comprising the P.
- the expression cassette encoding the FB8 comprises a nucleic acid molecule encoding the mouse mannosidase IA catalytic domain (SEQ ID NO:57) fused at the 5' end to a nucleic acid molecule encoding the SEC12-m leader 8 (SEQ ID NO: 58), which is operably linked at the 5' end to a nucleic acid molecule comprising the P.
- the UPAS expression cassette comprises a nucleic acid molecule comprising the P. pastoris URA5 gene or transcription unit flanked by nucleic acid molecules comprising lad repeats.
- the four tandem cassettes are flanked on one side by a nucleic acid molecule comprising a nucleotide sequence from the 5' region and complete ORF of the ADEl gene (SEQ ID NO:59) followed by a P.
- Plasmid pGLY1430 was linearized with Sfil and the linearized plasmid transformed into strain YGLY16-3 to produce a number of strains in which the four tandem expression cassette have been inserted into the ADEl locus immediately following the ADEl ORF by double-crossover homologous
- the strain YGLY2798 was selected from the strains produced and is
- auxotrophic for arginine and now prototrophic for uridine histidine, and adenine.
- the strain was then counterselected in the presence of 5-FOA to produce a number of strains now auxotrophic for uridine.
- Strain YGLY3794 was selected and is capable of making glycoproteins that have predominantly galactose terminated jV-glycans.
- Plasmid pGLY582 ( Figure 10) is an integration vector that targets the HIS1 locus and contains in tandem four expression cassettes encoding (1) the S. cerevisiae UDP-glucose epimerase (ScGALlff), (2) the human galactosyltransferase I (hGalT) catalytic domain fused at the N-terminus to the S. cerevisiae KRE2-S leader peptide (33) to target the chimeric enzyme to the ER or Golgi, (3) the P. pastoris URA5 gene or transcription unit flanked by lacZ repeats, and (4) the D. meianogaster UDP-galactose transporter (DmUGT).
- ScGALlfff S. cerevisiae UDP-glucose epimerase
- hGalT human galactosyltransferase I
- the expression cassette encoding the ScGALlO comprises a nucleic acid molecule encoding the ScGALlO ORF (SEQ ID NO:61) operably linked at the 5' end to a nucleic acid molecule comprising the P. pastoris PMA1 promoter (SEQ ID NO:88) and operably linked at the 3' end to a nucleic acid molecule comprising the P. pastoris PMA1 transcription termination sequence (SEQ ID NO:62).
- the expression cassette encoding the chimeric galactosyltransferase I comprises a nucleic acid molecule encoding the hGalT catalytic domain codon optimized for expression in P.
- the URA5 expression cassette comprises a nucleic acid molecule comprising the P. pastoris URA5 gene or transcription unit flanked by nucleic acid molecules comprising lacZ repeats.
- the expression cassette encoding the DmUGT comprises a nucleic acid molecule encoding the DmUGT ORF (SEQ ID NO:65) operably linked at the 5' end to a nucleic acid molecule comprising the P. pastoris OCH1 promoter (SEQ ID NO: 66) and operably linked at the 3' end to a nucleic acid molecule comprising the P. pastoris ALG12 transcription termination sequence (SEQ ID NO: 67).
- the four tandem cassettes are flanked on one side by a nucleic acid molecule comprising a nucleotide sequence from the 5' region of the HISl gene (SEQ ID NO:68) and on the other side by a nucleic acid molecule comprising a nucleotide sequence from the 3 ! region of the HISl gene (SEQ ID NO:69).
- Piasmid pGLY582 was linearized and the linearized piasmid transformed into strain YGLY3794 to produce a number of strains in which the four tandem expression cassette have been inserted into the HISl locus by homologous recombination.
- Strain YGLY3853 was selected and is auxotrophic for histidine and prototrophic for uridine.
- Piasmid pGLY167b (Figure 11) is an integration vector that targets the ARG1 locus and contains in tandem three expression cassettes encoding (1) the D. meianogaster mannosidase II catalytic domain (KD) fused at the N-terminus to S. cerevisiae MNN2 leader peptide (53) to target the chimeric enzyme to the ER or Golgi, (2) the P. pastoris HISl gene or transcription unit, and (3) the rat N-acetylglucosamine (GlcNAc) transferase II catalytic domain (TC) fused at the N-terminus to S. cerevisiae MNN2 leader peptide (54) to target the chimeric enzyme to the ER or Golgi.
- KD D. meianogaster mannosidase II catalytic domain
- S. cerevisiae MNN2 leader peptide 523
- the P. pastoris HISl gene or transcription unit the P. pastoris HISl gene or transcription
- the expression cassette encoding the KD53 comprises a nucleic acid molecule encoding the D. meianogaster mannosidase II catalytic domain codon-optimized for expression in P. pastoris (SEQ ID NO:70) fused at the 5' end to a nucleic acid molecule encoding the MNN2 leader 53 (SEQ ID NO:71), which is operably linked at the 5' end to a nucleic acid molecule comprising the P. pastoris GAPDH promoter and at the 3' end to a nucleic acid molecule comprising the S. cerevisiae CYC transcription termination sequence.
- the HISl expression cassette comprises a nucleic acid molecule comprising the P.
- the expression cassette encoding the TC54 comprises a nucleic acid molecule encoding the rat GlcNAc transferase II catalytic domain codon-optimized for expression in P. pastoris (SEQ ID NO:73) fused at the 5' end to a nucleic acid molecule encoding the MNN2 leader 54 (SEQ ID NO:74), which is operably linked at the 5' end to a nucleic acid molecule comprising the P. pastoris PMA1 promoter and at the 3' end to a nucleic acid molecule comprising the P. pastoris PMA1 transcription termination sequence.
- the three tandem cassettes are flanked on one side by a nucleic acid molecule comprising a nucleotide sequence from the 5' region of the ARG1 gene (SEQ ID NO:75) and on the other side by a nucleic acid molecule comprising a nucleotide sequence from the 3' region of the ARG1 gene (SEQ ID NO:76).
- Plasmid pGLYl 67b was linearized with Sfil and the linearized plasmid transformed into strain YGLY3853 to produce a number of strains (in which the three tandem expression cassette have been inserted into the ARG1 locus by double-crossover homologous recombination.
- the strain YGLY4754 was selected from the strains produced and is
- auxotrophic for arginine and prototrophic for uridine and histidine was then counterselected in the presence of 5-FOA to produce a number of strains now auxotrophic for uridine. Strain YGLY4799 was selected.
- Plasmid pGLY341 1 ( Figure 12) is an integration vector that contains the expression cassette comprising the P. pastoris URA5 gene flanked by lacZ repeats flanked on one side with the 5' nucleotide sequence of the P. pastoris BMT4 gene (SEQ ID NO:77) and on the other side with the 3' nucleotide sequence of the P. pastoris BMT4 gene (SEQ ID NO:78).
- Plasmid pGLY3411 was linearized and the linearized plasmid transformed into YGLY4799 to produce a number of strains in which the URA5 expression cassette has been inserted into the BMT4 locus by double-crossover homologous recombination.
- Strain YGLY6903 was selected from the strains produced and is prototrophic for uracil, adenine, histidine, proline, arginine, and tryptophan. The strain was then counterselected in the presence of 5-FOA to produce a number of strains now auxotrophic for uridine. Strains YGLY7432 and YGLY7433 were selected.
- Plasmid pGLY3419 ( Figure 13) is an integration vector that contains an expression cassette comprising the P. pastoris URA5 gene flanked by lacZ repeats flanked on one side with the 5' nucleotide sequence of the P. pastoris BMT1 gene (SEQ ID NO:79) and on the other side with the 3' nucleotide sequence of the P. pastoris BMTl gene (SEQ ID NO: 80).
- Plasmid pGLY341 was linearized and the linearized plasmid transformed into strain
- YGLY7432 and YGLY7433 to produce a number of strains in which the URA5 expression cassette has been inserted into the BMTl locus by double-crossover homologous recombination.
- the strains YGLY7656 and YGLY7651 were selected from the strains produced and are prototrophic for uracil, adenine, histidine, proline, arginine, and tryptophan. The strains were then counterselected in the presence of 5-FOA to produce a number of strains now auxotrophic for uridine. Strains YGLY7930 and YGLY7940 were selected.
- Plasmid pGLY3421 ( Figure 14) is an integration vector that contains an expression cassette comprising the P.
- Plasmid pGLY3419 was linearized and the linearized plasmid transformed into strain
- YGLY7930 and YGLY7940 to produce a number of strains in which the URA5 expression cassette has been inserted into the ⁇ 1 locus by double-crossover homologous recombination.
- the strains YGLY7965 and YGLY7961 were selected from the strains produced and are prototrophic for uracil, adenine, histidine, proline, arginine, and tryptophan.
- Plasmid pGLY3673 ( Figure 15) is a ⁇ ⁇ integration vector that targets the
- PROl locus without disrupting expression of the locus and contains expression cassettes encoding the T, reesei a-l,2-mannosidase catalytic domain fused at the N-terminus to S, cerevisiae c MATpre signal peptide (aMATTrMan) to target the chimeric protein to the secretory pathway and secretion from the cell.
- the expression cassette encoding the aMATTrMan comprises a nucleic acid molecule encoding the T. reesei catalytic domain (SEQ ID NO:83) fused at the 5' end to a nucleic acid molecule encoding the S.
- SEQ ID NO: 13 cerevisiae MATpre signal peptide
- SEQ ID NO:23 P. pastoris AOX1 promoter
- SEQ ID NO:24 SEQ ID NO:24
- the cassette is flanked on one side by a nucleic acid molecule comprising a nucleotide sequence from the 5' region and complete ORF of the PROl gene (SEQ ID NO:89) followed by a P.
- Plasmid pGLY3673 was transformed into strains YGLY7965 and YGLY7961 to produce a number of strains of which strains YGLY78316 and YGLY8323 were selected from the strains produced.
- Plasmid p GLY6833 ( Figure 16) is a roll-in integration plasmid encoding the light and heavy chains of an anti-Her2 antibody that targets the TRP2 locus in P. pastoris.
- the expression cassette encoding the anti-Her2 heavy chain comprises a nucleic acid molecule encoding the heavy chain ORF codon-optimized for effective expression in P. pastoris (SEQ ID NO: 15) operably linked at the 5' end to a nucleic acid molecule encoding the Saccharomyces cerevisiae mating factor pre- signal sequence (SEQ ID NO: 14) which in turn is fused at its N- terminus to a nucleic acid molecule that has the inducible P.
- the expression cassette encoding the anti- Her2 light chain comprises a nucleic acid molecule encoding the light chain ORF codon- optimized for effective expression in P.
- SEQ ID NO: 17 operably Iinlced at the 5' end to a nucleic acid molecule encoding the Saccharomyces cerevisiae mating factor pre-signal sequence (SEQ ID NO: 14) which in turn is fused at its TV-terminus to a nucleic acid molecule that has the inducible P, pastoris AOX1 promoter sequence (SEQ ID NO:23) and at the 3' end to a nucleic acid molecule that has the P. pastoris CITl transcription termination sequence (SEQ ID NO: 85).
- the plasmid comprises an expression cassette encoding the Zeocin ORF in which the nucleic acid molecule encoding the ORF (SEQ ID NO:35) is operably linked at the 5' end to a nucleic acid molecule having the S. cerevisiae TEF promoter sequence (SEQ ID NO: 37) and at the 3' end to a nucleic acid molecule having the S. cerevisiae CYC transcription termination sequence (SEQ ID NO:24).
- the plasmid further includes a nucleic acid molecule for targeting the TRP2 locus (SEQ ID NO:91 ).
- Plasmid p GLY6564 ( Figure 17) is a roll-in integration plasmid encoding the light and heavy chains of an anti-RSV antibody that targets the TRP2 locus in P. pastoris.
- the expression cassette encoding the anti-RSV heavy chain comprises a nucleic acid molecule encoding the heavy chain ORF codon-optimized for effective expression in P. pastoris (SEQ ID NO: 19) operably linked at the 5' end to a nucleic acid molecule encoding the Saccharomyces cerevisiae mating factor pre-signal sequence (SEQ ID NO: 14) which in turn is fused at its N- terminus to a nucleic acid molecule that has the inducible P.
- the expression cassette encoding the anti- RSV light chain comprises a nucleic acid molecule encoding the light chain ORF codon- optimized for effective expression in P. pastoris (SEQ ID NO:21) operably linked at the 5' end to a nucleic acid molecule encoding the Saccharomyces cerevisiae mating factor pre-signal sequence (SEQ ID NO: 14) which in turn is fused at its N-terminus to a nucleic acid molecule that has the inducible P.
- the plasmid comprises an expression cassette encoding the Zeocin ORF in which the nucleic acid molecule encoding the ORF (SEQ ID NO:35) is operably linked at the 5' end to a nucleic acid molecule having the S, cerevisiae TEF promoter sequence (SEQ ID NO:37) and at the 3' end to a nucleic acid molecule having the S. cerevisiae CYC transcription termination sequence (SEQ ID NO:24).
- the plasmid further includes a nucleic acid molecule for targeting the TRP2 locus (SEQ ID NO:91).
- Strain YGLY13992 was generated by transforming pGLY6833, which encodes the anti-Her2 antibody, into YGLY8316.
- the strain YGLY13992 was selected from the strains produced. In this strain, the expression cassettes encoding the anti-Her2 heavy and light chains are targeted to the Pichia pastoris TRP2 locus (PpTRP2), This strain does not include the
- Strain YGLY14401 was generated by transforming pGLY6564, which encodes the anti-RSV antibody, into YGLY8323. The strain YGLY14401 was selected from the strains produced. In this strain, the expression cassettes encoding the anti- SV heavy and light chains are targeted to the Pichia pastor is TRP2 locus (PpTRP2). This strain does not include the IwSTT3D expression cassette.
- Pichia pastoris strains were grown in 50 mL YPD media (yeast extract (1%), peptone (2%), and dextrose (2%)) overnight to an OD of about 0.2 to 6. After incubation on ice for 30 minutes, cells were pelleted by centrifugation at 2500-3000 rpm for five minutes. Media was removed and the cells washed three times with ice cold sterile 1 M sorbitol before resuspension in 0.5 mL ice cold sterile 1 M sorbitol. Ten linearized DNA (5-20 ⁇ g) and 100 ⁇ L cell suspension was combined in an electroporation cuvette and incubated for 5 minutes on ice.
- Electroporation was in a Bio-Rad GenePulser Xcell following the preset Pichia pastoris protocol (2 kV, 25 up, 200 ⁇ ), immediately followed by the addition of 1 mL YPDS recovery media (YPD media plus 1 M sorbitol). The transformed cells were allowed to recover for four hours to overnight at room temperature (24° C) before plating the cells on selective media.
- Strains YGLY13992 and YGLY14401 were each then transformed with pGLY6301, which encodes the ZwSTT3D under the control of the inducible AOXl promoter, or pGLY6294, which encodes the iwSTT3D under the control of the constitutive GAPDH promoter, as described above to produce the strains described in Example 3.
- Integration/expression plasmid pGLY6301 which comprises the expression cassette in which the ORF encoding the ImSTT3D is operably-linked to the inducible PpAOXl promoter, or pGLY6294, which comprises the expression cassette in which the ORF encoding the 2 wSTT3D is operably-linked to the constitutive PpGAPDH romoter, was linearized with Spel or Sfil t respectively, and the linearized plasmids transformed into Pichia pastoris strain YGLY13992 or YGLY14401 to produce strains YGLY17351, YGLY17368, YGLY17319, and YGLY17354 shown in Table 1. Transformations were performed essentially as described in Example 2.
- PpTEFTT UP (5'-GATGCGAAGTTAAGTGCGCAGAAAGTAATATCA-3'; SEQ ID NO: 7) and PpTRPl-3'out/LP (5'-CGTGTGTACCTTGAAACGTCAATGATACTTTGA-3'; SEQ ID NO: 8).
- LmSTT3D/iUP 5 - GCG ACTGGTTCC A ATTG AC A AGCTT- 3 ' (SEQ ID NO: 9) and LmSTT3D/iLP (5'- C A AC AGT AG AAC C AGA AGCCTC GT A AGTAC AG-3 ' (SEQ ID NO: 10).
- the PCR conditions were one cycle of 95 °C for two minutes, 35 cycles of 95° C for 20 seconds, 55° C for 20 seconds, and 72° C for one minute; followed by one cycle of 72° C for 10 minutes.
- the strains were cultivated in a Sixfor fermentor to produce the antibodies for N- glycosylation site occupancy analysis.
- Cell growth conditions of the transformed strains for antibody production were generally as follows.
- Protein expression for the transformed yeast strains was carried out at in shake flasks at 24° C with buffered glycerol-complex medium (BMGY) consisting of 1% yeast extract, 2% peptone, 100 mM potassium phosphate buffer pH 6.0, 1.34% yeast nitrogen base, 4 x 10-5 % biotin, and 1% glycerol.
- BMGY buffered glycerol-complex medium
- the induction medium for protein expression was buffered methanol- complex medium (BMMY) consisting of 1% methanol instead of glycerol in BMGY, Pmt inhibitor Pmti-3 in methanol was added to the growth medium to a final concentration of 18.3 ⁇ at the time the induction medium was added. Cells were harvested and centrifuged at 2,000 rpm for five minutes.
- PTM1 Salts (.See Table 6) 12.5 niL/L
- the occupancy of JV-glycan on anti-Her2 or anti-RSV antibodies was determined using capillary electrophoresis (CE) as follows.
- the antibodies were recovered from the cell culture medium and purified by protein A column chromatography.
- the protein A purified sample (100-200 ⁇ g) was concentrated to about 100 and then buffer was exchanged with 100 mM Tris-HCl pH 9.0 with 1% SDS.
- the sample along with 2 ⁇ of 10 kDa internal standard provided by Beckman was reduced by addition of 5 ⁇ L ⁇ -mercaptoethanol and boiled for five minutes. About 20 L of reduced sample was then resolved over a bare-fused silica capillary (about 70 mm, 50 ⁇ I.D.) according to the method recommended by Beckman Coulter.
- Figure 18 shows the N-glycosylation site occupancy of heavy chains from the CE analysis. The figure shows that for both antibodies, the amount of TV-linked heavy chains species increased from about 80% to about 94% when the ImSTT3D was constitutively expressed to about 99% when expression of the LmSTT O was induced at the same time as expression of the antibodies was induced.
- Table 7 shows TV-glycosylation site occupancy of anti-HER2 and anti-RSV antibodies was increased for compositions in which the antibodies were obtained from host cells in which the £wSTT3D was overexpressed in the presence of the endogenous oligosaccharyltransferase (OST) complex.
- OST endogenous oligosaccharyltransferase
- the expression of the LmSTT3D and the antibodies were under the control of the same inducible promoter.
- overexpression of the LmSTT3D was under the control of a constitutive promoter the increase in N-glycosylation site occupancy was increased to about 94% for both antibodies tested (about a 13% increase over the N- glycosylation site occupancy in the absence of ZmSTT3D overexpression).
- Table 8 shows the N-glycosylation site occupancy for compositions comprising whole antibodies obtained from host cells in which the Z,mSTT3D was overexpressed in the presence of the endogenous oligosaccharyltransferase (OST) complex based upon the determination of N-glycosylation site occupancy of the individual heavy chains from reduced antibody preparations.
- the formula (fraction GHC)2 ⁇ 100 will provide an estimate or approximation of the percent fully occupied antibodies based upon the determination of the fraction of heavy chains that are N-glycosylated.
- HPLC high performance liquid chromatography
- Agilent 1200 equipped with autoinjector, a column-heating compartment and a UV detector detecting at 210 and 280 nm. All LC-MS experiments performed with this system were running at 1 mL/min. The flow rate was not split for MS detection.
- Mass spectrometric analysis was carried out in positive ion mode on Accurate-Mass Q-TOF LC/MS 6520 (Agilent technology).
- the temperature of dual ESI source was set at 350 °C.
- the nitrogen gas flow rates were set at 13 L/h for the cone and 350 1 h and nebulizer was set at 45 psig with 4500 volt applied to the capillary.
- Reference mass of 922.009 was prepared from HP-0921 according to API-TOF reference mass solution kit for mass calibration and the protein mass measurements. The data for ion spectrum range from 300-3000 m/z were acquired and processed using Agilent Masshunter.
- Sample preparation was as follows. An intact antibody sample (50 g) was prepared 50 pL 25 mM NFLsHC0 3 , pH 7.8. For deglycosylated antibody, a 50 pL aliquot of intact antibody sample was treated with PNGase F (10 units) for 18 hours at 37° C. Reduced antibody was prepared by adding 1 M DTT to a final concentration of 10 mM to an aliquot of either intact antibody or deglycosylated antibody and incubated for 30 min at 37° C.
- a three microgram sample was loaded onto a Poroshell 300SB-C3 column (2.1 mm x 75 mm, 5 pm) (Agilent Technologies) maintained at 40 C.
- the protein was first rinsed on the cartridge for three minutes with 90% solvent A, 5% solvent B. Elution was then performed using a gradient of 5-80% of B over 20 minutes followed by a seven- minute regeneration at 80% B and by a final equilibration period of 10 minutes at 5% B.
- Figure 19 shows the results of a Q-TOF analysis in which the N-glycosylation site occupancy of non-reduced anti-Her2 antibody produced in YGLY17351 was compared to N- glycosylation site occupancy of non-reduced commercially available anti-Her2 antibody produced in CHO cells (HERCEPTIN).
- anti-Her2 antibody produced in strain YGLY17351 has an N-glycosylation site occupancy that is like the N-glycosylation site occupancy of an anti-Her2 antibody made in CHO cells.
- the figure shows that the amount of antibodies in which only one N-glycosylation site was occupied decreased and the amount of antibodies in which both N-glycosylation sites was occupied increased when the antibodies were produced by strain YGLY17351.
- Figure 20 demonstrates the scalability of N-glycosylation site occupancy on anti- Her2 antibodies produced in YGLY17351.
- YGLY17351 was tested in bioreactors ranging from 5 mL through 40 L.
- N-glycosylation site occupancy of glycoproteins in glycoengineered P. pastoris has been observed to vary with the process conditions used to produce the glycoproteins.
- the LmSTT3O overexpressing strains showed very consistent N-glycosylation site occupancy (99%) regardless of scale of bioreactors and process conditions.
- the present invention provides a method in which the N-glycosylation site occupancy of glycoproteins in glycoengineered P. pastoris grown under small scale conditions is maintained when grown under large scale conditions.
- Figures 21 and 22 are provided for illustrative purposes.
- Figure 21 shows the results of a CE and Q-TOF analysis for a commercial lot of anti-Her2 antibody produced in CHO cells (HERCEPTIN).
- Figure 22 shows the results of a CE and Q-TOF analysis for the same commercial lot of anti-Her2 antibody following treatment with PNGase F for a time.
- the CE shows an increase in non-glycosylated heavy chain and the Q-TOF shows the presence of non- glycosylated antibody following PNGase F treatment (compare Figure 21 to Figure 22).
- Table 9 shows the N-glycan composition of the anti-Her2 and anti-RSV antibodies produced in strains that overexpress LmSTT3D compared to strains that do not overexpress LmSTT3O.
- the Figure confirms that the quality of N-glycans of antibodies from ZmSTT3D overexpressing strains is comparable to that from strains that do not overexpress ZmSTT3D.
- Antibodies were produced from SixFors (0.5L bioreactor) and N-glycans from protein A-purified antibodies were analyzed with 2AB labeling. Overall, overexpression of Z,mSTT3D did not appear to significantly affect the N-glycan composition of the antibodies.
- glycosylation composition can vary as a function of fermentation conditions, therefore, the glycosylation composition of antibodies produced in Pichia pastoris strains can range from about 50-70 mole%G0, 15-25 mole%Gl, 4-12% mole% G2, 5-17 raole% Man5, and 3-15 mole% hybrids.
- Hybrid - GlcNAcMan5GlcNAc2 and/or GalGlcNAcMan5GlcNAc2 shows a comparison of the glycosylation pattern of the anti-RSV antibody produced in strain YGLY 14401 compared to several commercial lots of an anti-RSV antibody produced in CHO cells and marketed as paiivizumab under the tradename SYNAGIS.
- Mannose single mannose
- Mannobiose two mannose residues
- the Leishmania major STT3A protein, Leishmania major STT3B protein, and Leishmania major STT3D protein are all examples of heterologous single-subunit
- RNA molecules that have been shown to suppress the lethal phenotype of a deletion of the STT3 locus in Saccharomyces cerevisiae (Naseb et al., Molec. Biol. Cell 19: 3758-3768 (2008)). Naseb et al. (ibid.) further showed that the Leishmania major STT3D protein could suppress the lethal phenotype of a mutation of the WBP1, OST1, SWP1, or OST2 loci in Saccharomyces cerevisiae (Naseb et al., Molec. Biol. Cell 19: 3758-3768 (2008)). Naseb et al. (ibid.) further showed that the Leishmania major STT3D protein could suppress the lethal phenotype of a mutation of the WBP1, OST1, SWP1, or OST2 loci in
- single-subunit heterologous oligosaccharyltransferases include but are not limited to single-subunit Giardia or kinetoplastid STT3 proteins, for example, the Caenorhabditis elegans STT3 protein,
- Trypanosoma brucei STT3 protein Trypanosoma cruzi STT3 protein, and Toxoplasma gondii STT3 protein.
- Leishmania major STT3D protein which Naseb et al. (op. cit.) teaches does not incorporate into the Saccharomyces cerevisiae OTase complex
- Laub et al. Proc. Natl. Acad. Sci. USA 103: 14756-14760 (2006)
- the Trypanosoma cruzi STT3 appears to integrate into the Saccharomyces cerevisiae OTase complex.
- host cells constructed similar to the host cells in the previous example were transformed with plasmid vectors containing expression cassettes encoding the STT3 protein from Caenorhabditis elegans, Trypanosoma cruzi, and Leishmania major STT3C operably United to the AOXl promoter.
- a vector containing an expression cassette encoding the Pichia pastoris Stt3p was included in the experiment.
- expression of the various STT3 proteins concurrently with expression of the anti-Her2 antibody did not appear result in an increase in 7V-glycosylation site occupancy.
- various STT3 proteins can display substrate specificity.
- the Leishmania major STT3 A, B, C, and D proteins differ in substrate specificity at the level of glycosylation, which suggests that in addition to the essential N-X-S/T attachment site additional features of the substrate may influence N-linked glycosylation at a particular attachment site (Naseb et al., op cit.).
- the results shown in Table 9 used the anti-Her2 antibody as the substrate.
- the CH2 domain of each heavy chain of an antibody contains a single site for N-linked glycosylation: this is usually at the asparagine residue 297 (Asn-297) (Kabat et aL, Sequences of proteins of immunological interest, Fifth Ed., U.S. Department of Health and Human Services, ⁇ Publication No. 91-3242).
- the results shown in Table 9 suggest that the percent N-glycosylation site occupancy might be influenced by the substrate specificity of the particular single-subunit oligosaccharyltransferase being used.
- a strain capable of producing sialylated iV-glycans was constructed as follows.
- the strain was transfected with a plasmid vector encoding human GM-CSF and a plasmid vector encoding the Leishmania major STT3D. Construction of the strains is illustrated schematically in Figure 23A-23D. Briefly, the strains were constructed as follows.
- Plasmid pGLY2456 ( Figure 24) is a INKO integration vector that targets the TRP2 locus without disrupting expression of the locus and contains six expression cassettes encoding (1) the mouse CMP-sialic acid transporter (mCMP-Sia Transp), (2) the human UDP- GlcNAc 2-epimerase/N-acetylmannosamine kinase (hGNE), (3) the Pichia pastoris ARG1 gene or transcription unit, (4) the human CMP-sialic acid synthase (hCSS), (5) the human N- acetylneuraminate-9-phosphate synthase (hSPS), (6) the mouse o 2,6-sialyltransferase catalytic domain (mST6) fused at the N-terminus to S.
- mCMP-Sia Transp mouse CMP-sialic acid transporter
- hGNE human UDP- GlcNAc 2-epimerase/N-acet
- the expression cassette encoding the mouse CMP-sialic acid transporter comprises a nucleic acid molecule encoding the mCMP Sia Transp ORF codon optimized for expression in P. pastoris (SEQ ID NO:92), which is operably linked at the 5' end to a nucleic acid molecule comprising the P. pastoris PMA1 promoter and at the 3' end to a nucleic acid molecule comprising the P. pastoris PMA1 transcription termination sequence.
- the expression cassette encoding the human UDP-GlcNAc 2-epimerase/N-acetylmannosamine kinase comprises a nucleic acid molecule encoding the hGNE ORF codon optimized for expression in P. pastoris (SEQ ID NO:93), which is operably linked at the 5' end to a nucleic acid molecule comprising the P. pastor is GAPDH promoter and at the 3' end to a nucleic acid molecule comprising the S. cerevisiae CYC transcription termination sequence.
- the expression cassette encoding the P. pastoris ARG1 gene comprises (SEQ ID NO:94).
- the expression cassette encoding the human CMP-sialic acid synthase comprises a nucleic acid molecule encoding the hCSS ORF codon optimized for expression in P. pastoris (SEQ ID NO:95), which is operably linked at the 5' end to a nucleic acid molecule comprising the P. pastoris GAPDH promoter and at the 3' end to a nucleic acid molecule comprising the S, cerevisiae CYC transcription termination sequence.
- the expression cassette encoding the human N-acetylneuraminate-9-phosphate synthase comprises a nucleic acid molecule encoding the hSIAP S ORF codon optimized for expression in P. pastoris (SEQ ID NO: 96), which is operably linked at the 5' end to a nucleic acid molecule comprising the P.
- the expression cassette encoding the chimeric mouse a-2,6-sialyltransferase comprises a nucleic acid molecule encoding the mST6 catalytic domain codon optimized for expression in P. pastoris (SEQ ID NO: 97) fused at the 5' end to a nucleic acid molecule encoding the S. cerevisiae KRE2 signal peptide, which is operably linked at the 5' end to a nucleic acid molecule comprising the P. pastoris TEF promoter and at the 3' end to a nucleic acid molecule comprising the P. pastoris TEF transcription termination sequence.
- the six tandem cassettes are flanked on one side by a nucleic acid molecule comprising a nucleotide sequence from the 5' region and ORE of the TRP2 gene ending at the stop codon (SEQ ID NO: 97) fused at the 5' end to a nucleic acid molecule encoding the S. cerevisiae KRE2 signal
- Plasmid pGLY2456 was linearized with Sfil and the linearized plasmid transformed into strain YGLY7961 to produce a number of strains in which the six expression cassette have been inserted into the TRP2 locus immediately following the TRP2 ORF by double-crossover homologous recombination.
- the strain YGLY8146 was selected from the strains produced. The strain was then counterselected in the presence of 5-FOA to produce a number of strains now auxotrophic for uridine. Strain YGLY9296 was selected.
- Plasmid pGLY5048 ( Figure 25) is an integration vector that targets the STE13 locus and contains expression cassettes encoding (1) the ⁇ . reesei a-l,2-mannosidase catalytic domain fused at the TV-terminus to S. cerevisiae aMATpre signal peptide (aMATTrMan) to target the chimeric protein to the secretory pathway and secretion from the cell and (2) the P. pastoris URA5 gene or transcription unit.
- the expression cassette encoding the aMATTrMan comprises a nucleic acid molecule encoding the T.
- the URA5 expression cassette comprises a nucleic acid molecule comprising the P. pastoris URA5 gene or transcription unit flanked by nucleic acid molecules comprising lacZ repeats.
- the two tandem cassettes are flanked on one side by a nucleic acid molecule comprising a nucleotide sequence from the 5' region of the STE13 gene (SEQ ID NO: 100) and on the other side by a nucleic acid molecule comprising a nucleotide sequence from the 3' region of the STE13 gene (SEQ ID NO:101).
- Plasmid pGLY5048 was linearized with Sfil and the linearized plasmid transformed into strain YGLY9296 to produce a number of strains.
- the strain YGLY9469 was selected from the strains produced. This strain is capable of producing glycoproteins that have single-mannose O-glycosylation (See Published U.S. Application No. 20090170159).
- Plasmid pGLY5019 (Figure 26) is an integration vector that targets the DAP2 locus and contains an expression cassette comprising a nucleic acid molecule encoding the Nourseothricin resistance (NATR) expression cassette (originally from pAG25 from
- the NAT R expression cassette (SEQ ID NO:34) is operably regulated to the Ashbya gossypii TEF1 promoter and A. gossypii TEF1 termination sequences flanked one side with the 5' nucleotide sequence of the P. pastoris DAP 2 gene (SEQ ID NO: 102) and on the other side with the 3' nucleotide sequence of the P. pastoris DAP2 gene (SEQ ID NO: 103).
- Plasmid pGLY5019 was linearized and the linearized plasmid transformed into strain YGLY9469 to produce a number of strains in which the NATR expression cassette has been inserted into the DAP 2 locus by double-crossover homologous recombination.
- the strain YGLY9797 was selected from the strains produced.
- Plasmid pGLY5085 ( Figure 27) is a ⁇ plasmid for introducing a second set of the genes involved in producing sialylated iV-glycans into P. pastoris.
- the plasmid is similar to plasmid YGLY2 56 except that the P. pastoris ARG1 gene has been replaced with an expression cassette encoding hygromycin resistance (HygR) and the plasmid targets the P.
- the HYG R resistance cassette is SEQ ID NO: 104.
- the HYG R expression cassette (SEQ ID NO: 104) is operably regulated to the Ashbya gossypii TEF1 promoter and A. gossypii TEF1 termination sequences (See Goldstein et ah, Yeast 15: 1541 (1999)).
- the six tandem cassettes are flanked on one side by a nucleic acid molecule comprising a nucleotide sequence from the 5' region and ORF of the TRP5 gene ending at the stop codon (SEQ ID NO: 105) followed by a P.
- Plasmid pGLY5085 was transformed into strain YGLY9797 to produce a number of strains of which strain YGLY1200 was selected.
- Plasmid pGLY7240 ( Figure 28), which targets the Pichia pastoris TRP2 locus (PpTRP2), encodes a fusion protein comprising the human GM-CSF fused to the Pichia pastoris CWP1 protein via a linker containing a Kex2 cleavage site.
- the C P1 protein is removed from GM-CSF in the late Golgi by the ex2 endoprotease so that free GM-CSF is secreted into the fermentation supernatant.
- the human GM-CSF has the amino acid sequence shown in SEQ ID NO:108 and is encoded by the nucleotide sequence shown in SEQ ID NO:108.
- the fusion protein (SEQ ID NO: 109) is encoded by the nucleotide sequence shown in SEQ ID NO: 1 10.
- the CWP1 signal sequence is amino acids 1-18
- the CWP1 amino acid sequence is from amino acids 19-289
- the GGGSLVKR Kex2 linker amino acid sequence (SEQ ID NO: 111) is from amino acids 290-297
- the GM-CSF amino acid sequence is from amino acids 298-424.
- the expression of the fusion protein is operably linked to the Pp AOX1 promoter and ScCYC termination sequences.
- Plasmid pGLY7240 was transformed into strain YGLY12900 to produce a number of strains of which strain YGLY15660 was selected.
- StrainYGLY15660 was transformed with plasmid pGLY6301 (encodes Leishmani major STT3D) to produce a number of strains of which YGLY16349 was selected.
- FIG. 29 shows that LmSTT3D also improved iV-glycan occupancy of non- antibody glycoprotein, GM-CSF.
- GM-CSF contains 2 N-linked sites and in wild-type Pichia 1 N-linked site on GM-CSF is predominantly glycosylated.
- methanol-inducible LmSTT3D was overexpressed in GM-CSF producing strain, yGLY15560.
- N-glycan occupancy was evaluated using Micro24 bioreactor (M24). The cell-free supernatants from M24 were analyzed for iV-glycan occupancy using Western blot and 15% SDS-P AGE.
- GM-CSF As shown in Western blot detected with GM-CSF specific antibody, the majority of GM-CSF (Lanes 2-8) is glycosylated with 2N-linked sites in contrast to the control strain (yGLY15560, lane 9) where GM-CSF is predominantly N-glycosylated with 1 site along with the minor portions of 2 N sites and non-glycosylated. Taken together, this indicates that LmSTT3D can improve N-glycan occupancy of glycoproteins carrying multiple N- linked sites.
- Figure 30 shows Q-TOP analysis of GM-CSF expressed from yGLY15560 (A) and yGLY16349 (B), respectively. This analysis confirms that the majority of GM-CSF is glycosylated with 2N-linked sites in the presence of LmSTT3D as shown in Figure 29. Non- glycosylated GM-CSF was not detected.
- HPLC high performance liquid chromatography
- the nitrogen gas flow rates were set at 13 1/h for the cone and 350 1/h and nebulizer was set at 45 psig with 4500 volt applied to the capillary, eference mass of 922.009 was prepared from HP-0921 according to API-TOF reference mass solution kit for mass calibration and the protein mass measurements.
- the data for ion spectrum range from 300-3000 m/z were acquired and processed using Agilent Masshunter.
- An intact antibody sample (50 ug) was prepared 50 ul 25 mM NH 4 HC0 3 , pH 7.8.
- Reduced antibody was prepared by adding 1 M DTT to a final concentration of 10 mM to an aliquot of either intact antibody or deglycosylated antibody and incubated for 30 min at 37C.
- Poroshell 300SB-C3 column (2.1 mm x 75 mm, 5 ⁇ ) (Agilent Technologies) maintained at
- PpTRPl 5' GCGGAAACGGCAGTAAACAATGGAGCTTCATTAGTGGGTG region and ORF TTATTATGGTCCCTGGCCGGGAACGAACGGTGAAACAAGA
- PpTRPl 3' AAGTCAATTAAATACACGCTTGAAAGGACATTACATAGCTT region TCGATTTAAGCAGAACCAGAAATGTAGAACCACTTGTCAA
- ScARR3 ORF ATGTCAGAAGATCAAAAAAGTGAAAATTCCGTACCTTCTA AGGTTAATATGGTGAATCGCACCGATATACTGACTACGATC
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Oncology (AREA)
- Toxicology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Gastroenterology & Hepatology (AREA)
- Communicable Diseases (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Enzymes And Modification Thereof (AREA)
- Pulmonology (AREA)
Abstract
Description
Claims
Priority Applications (11)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA2788992A CA2788992A1 (en) | 2010-02-24 | 2011-02-23 | Method for increasing n-glycosylation site occupancy on therapeutic glycoproteins produced in pichia pastoris |
| JP2012555104A JP5976549B2 (en) | 2010-02-24 | 2011-02-23 | Method for increasing N-glycosylation site occupancy on therapeutic glycoproteins produced in Pichia pastoris |
| KR1020127022052A KR101930961B1 (en) | 2010-02-24 | 2011-02-23 | Method for increasing n-glycosylation site occupancy on therapeutic glycoproteins produced in pichia pastoris |
| MX2012009802A MX2012009802A (en) | 2010-02-24 | 2011-02-23 | Method for increasing n-glycosylation site occupancy on therapeutic glycoproteins produced in pichia pastoris. |
| EP11747972.5A EP2539430B1 (en) | 2010-02-24 | 2011-02-23 | Method for increasing n-glycosylation site occupancy on therapeutic glycoproteins produced in pichia pastoris |
| AU2011220878A AU2011220878A1 (en) | 2010-02-24 | 2011-02-23 | Method for increasing N-glycosylation site occupancy on therapeutic glycoproteins produced in Pichia pastoris |
| BR112012020882A BR112012020882A2 (en) | 2010-02-24 | 2011-02-23 | methods for producing a heterologous glycoprotein and for producing a glycoprotein composition, host cell, glycoprotein composition, and use of recombinant pichia pastoris. |
| US13/579,972 US8715963B2 (en) | 2010-02-24 | 2011-02-23 | Method for increasing N-glycosylation site occupancy on therapeutic glycoproteins produced in Pichia pastoris |
| RU2012140429/10A RU2012140429A (en) | 2010-02-24 | 2011-02-23 | METHOD FOR INCREASING EMPLOYMENT OF N-LICOSYLATION SECTIONS ON THERAPEUTIC Glycoproteins PRODUCED IN P PASTORIS |
| CN201180011130.XA CN102858949B (en) | 2010-02-24 | 2011-02-23 | Methods for increasing N-glycosylation site occupancy on therapeutic glycoproteins produced in Pichia pastoris |
| US14/181,786 US20140227290A1 (en) | 2010-02-24 | 2014-02-17 | Method for increasing n-glycosylation site occupancy on therapeutic glycoproteins produced in pichia pastoris |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US30764210P | 2010-02-24 | 2010-02-24 | |
| US61/307,642 | 2010-02-24 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US13/579,972 A-371-Of-International US8715963B2 (en) | 2010-02-24 | 2011-02-23 | Method for increasing N-glycosylation site occupancy on therapeutic glycoproteins produced in Pichia pastoris |
| US14/181,786 Division US20140227290A1 (en) | 2010-02-24 | 2014-02-17 | Method for increasing n-glycosylation site occupancy on therapeutic glycoproteins produced in pichia pastoris |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2011106389A1 true WO2011106389A1 (en) | 2011-09-01 |
Family
ID=44507177
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2011/025878 Ceased WO2011106389A1 (en) | 2010-02-24 | 2011-02-23 | Method for increasing n-glycosylation site occupancy on therapeutic glycoproteins produced in pichia pastoris |
Country Status (11)
| Country | Link |
|---|---|
| US (2) | US8715963B2 (en) |
| EP (1) | EP2539430B1 (en) |
| JP (1) | JP5976549B2 (en) |
| KR (1) | KR101930961B1 (en) |
| CN (1) | CN102858949B (en) |
| AU (1) | AU2011220878A1 (en) |
| BR (1) | BR112012020882A2 (en) |
| CA (1) | CA2788992A1 (en) |
| MX (1) | MX2012009802A (en) |
| RU (1) | RU2012140429A (en) |
| WO (1) | WO2011106389A1 (en) |
Cited By (18)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013174927A1 (en) * | 2012-05-23 | 2013-11-28 | Novartis International Pharmaceutical Limited | Production of fucosylated glycoproteins |
| WO2014088836A1 (en) | 2012-12-03 | 2014-06-12 | Merck Sharp & Dohme Corp. | O-glycosylated carboxy terminal portion (ctp) peptide-based insulin and insulin analogues |
| WO2014126787A1 (en) * | 2013-02-13 | 2014-08-21 | Merck Sharp & Dohme Corp. | Methods for increasing n-glycan occupancy and reducing production of hybrid n-glycans in pichia pastoris strains lacking alg3 expression |
| WO2015004239A1 (en) | 2013-07-10 | 2015-01-15 | Novartis Ag | Production of glycoproteins having increased n-glycosylation site occupancy |
| JP2015502144A (en) * | 2011-10-28 | 2015-01-22 | メルク・シャープ・アンド・ドーム・コーポレーションMerck Sharp & Dohme Corp. | Method for increasing N-glycan occupancy and reducing hybrid N-glycan production in Pichia pastoris strains deficient in Alg3 expression |
| WO2015001460A3 (en) * | 2013-07-01 | 2015-04-23 | Biocon Limited | Signal sequence for protein expression in pichia pastoris |
| CN105087405A (en) * | 2015-09-17 | 2015-11-25 | 杭州研真生物科技有限公司 | Pichia pastoris underglycosylated mutant strain and application of pichia pastoris underglycosylated mutant strain |
| WO2016012468A1 (en) * | 2014-07-21 | 2016-01-28 | Novartis Ag | Production of glycoproteins with mammalian-like n-glycans in filamentous fungi |
| EP2854851A4 (en) * | 2012-06-01 | 2016-03-30 | Momenta Pharmaceuticals Inc | METHODS ASSOCIATED WITH TRASTUZUMAB |
| JP2016521549A (en) * | 2013-06-04 | 2016-07-25 | アイコン ジェネティクス ゲーエムベーハー | Method for regulating N-glycosylation site occupancy of plant-produced glycoproteins and recombinant glycoproteins |
| EP2931895A4 (en) * | 2012-12-17 | 2016-08-10 | Merck Sharp & Dohme | MUTANT CELLS PMT2, OCH1, PMT5 |
| US11027021B2 (en) | 2016-03-15 | 2021-06-08 | Seagen Inc. | Combinations of PBD-based antibody drug conjugates with Bcl-2 inhibitors |
| US11110179B2 (en) | 2016-06-03 | 2021-09-07 | Seagen Inc. | Combination of CD33 antibody drug conjugates with chemotherapeutic agents |
| CN113549560A (en) * | 2020-04-24 | 2021-10-26 | 中国人民解放军军事科学院军事医学研究院 | A kind of engineering yeast construction method for glycoprotein preparation and its strain |
| US11191771B2 (en) | 2016-06-09 | 2021-12-07 | Seagen Inc. | Combinations of PBD-based antibody drug conjugates with FLT3 inhibitors |
| US20220213451A1 (en) * | 2013-07-04 | 2022-07-07 | Glykos Finland Oy | O-Mannosyltransferase Deficient Filamentous Fungal Cells and Methods of Use Thereof |
| WO2023004172A1 (en) * | 2021-07-23 | 2023-01-26 | Clara Foods Co. | Protein compositions and methods of production |
| US12559731B2 (en) | 2019-08-09 | 2026-02-24 | Glaxosmithkline Biologicals Sa | Mutated PglB oligosaccharyl transferase enzymes |
Families Citing this family (29)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11377485B2 (en) | 2009-12-02 | 2022-07-05 | Academia Sinica | Methods for modifying human antibodies by glycan engineering |
| US10087236B2 (en) | 2009-12-02 | 2018-10-02 | Academia Sinica | Methods for modifying human antibodies by glycan engineering |
| WO2011130332A1 (en) | 2010-04-12 | 2011-10-20 | Academia Sinica | Glycan arrays for high throughput screening of viruses |
| EP2800809B1 (en) | 2012-01-05 | 2018-03-07 | Glykos Finland Oy | Protease deficient filamentous fungal cells and methods of use thereof |
| DK3019602T3 (en) | 2013-07-10 | 2018-11-12 | Glykos Finland Oy | MULTIPLE PROTEASE-DEFECTED FILAMENTARY FUNGAL CELLS AND PROCEDURES FOR USE THEREOF |
| WO2015034920A2 (en) * | 2013-09-03 | 2015-03-12 | Sloan-Kettering Institute For Cancer Research | Granulocyte macrophage colony-stimulating factor compositions |
| JP6486368B2 (en) | 2013-09-06 | 2019-03-20 | アカデミア シニカAcademia Sinica | Activation of human iNKT cells using glycolipids containing modified glycosyl groups |
| AU2015248815B2 (en) * | 2014-04-17 | 2021-07-08 | Boehringer Ingelheim Rcv Gmbh & Co Kg | Recombinant host cell engineered to overexpress helper proteins |
| AU2015267045B2 (en) * | 2014-05-27 | 2021-02-25 | Academia Sinica | Anti-HER2 glycoantibodies and uses thereof |
| DK3149045T3 (en) | 2014-05-27 | 2023-03-06 | Academia Sinica | COMPOSITIONS AND METHODS OF UNIVERSAL GLYCOFORMS FOR ENHANCED ANTIBODIST EFFECT |
| KR20170003720A (en) | 2014-05-27 | 2017-01-09 | 아카데미아 시니카 | Anti-cd20 glycoantibodies and uses thereof |
| JP7063538B2 (en) | 2014-05-28 | 2022-05-09 | アカデミア シニカ | Anti-TNFα sugar-manipulated antibody group and its use |
| CN105779490A (en) * | 2014-12-16 | 2016-07-20 | 北京集智新创科技有限公司 | Construction method of Pichia pastoris expressed by OCH1 defect anti-CD20 tetravalent antibody |
| KR102007930B1 (en) | 2014-12-31 | 2019-08-06 | 주식회사 엘지화학 | A method for controlling glycosylation of recombinant glycoprotein |
| US10495645B2 (en) | 2015-01-16 | 2019-12-03 | Academia Sinica | Cancer markers and methods of use thereof |
| US10342858B2 (en) | 2015-01-24 | 2019-07-09 | Academia Sinica | Glycan conjugates and methods of use thereof |
| CA2977271A1 (en) | 2015-03-02 | 2016-09-09 | Synthetic Genomics, Inc. | Regulatory elements from labyrinthulomycetes microorganisms |
| WO2017025586A1 (en) * | 2015-08-13 | 2017-02-16 | Glykos Finland Oy | Regulatory protein deficient trichoderma cells and methods of use thereof |
| WO2018013551A1 (en) * | 2016-07-11 | 2018-01-18 | Massachusetts Institute Of Technology | Tools for next generation komagataella (pichia) engineering |
| AU2017316663B2 (en) | 2016-08-22 | 2024-02-22 | CHO Pharma Inc. | Antibodies, binding fragments, and methods of use |
| US10633454B2 (en) | 2016-11-01 | 2020-04-28 | Conagen Inc. | Expression of modified glycoproteins and glycopeptides |
| EP3662067A4 (en) * | 2017-08-03 | 2021-04-14 | Plantform Corporation | TRANSITIONAL SILENCE OF ARGONAUTE1 AND ARGONAUTE4 WITH A VIEW TO INCREASING THE EXPRESSION OF RECOMBINANT PROTEIN IN PLANTS |
| CA3086178A1 (en) * | 2017-12-18 | 2019-06-27 | The General Hospital Corporation | Glycoengineering |
| CN112074608A (en) * | 2018-05-01 | 2020-12-11 | 科纳根公司 | Recombinant organisms and methods for producing sugar molecules with high glycan occupancy |
| EP3788163A4 (en) * | 2018-05-01 | 2022-01-26 | Conagen Inc. | RECOMBINANT ORGANISMS AND METHODS OF PRODUCTION OF LOW-SULPHATION GLYCOMOLECULES |
| JP2022502018A (en) * | 2018-09-24 | 2022-01-11 | オルタ ドグ テクニク ユニヴェルシテシ | Modified AOX1 promoter variant |
| US11110132B2 (en) * | 2018-11-09 | 2021-09-07 | Ohio State Innovation Foundation | Live attenuated parasitic vaccine |
| EP4114173A1 (en) * | 2020-03-04 | 2023-01-11 | Regeneron Pharmaceuticals, Inc. | A rodent model of b4galt1-mediated functions |
| CN115851468A (en) * | 2022-07-18 | 2023-03-28 | 江南大学 | Recombinant pichia pastoris for producing human casein macropeptide and application thereof |
Citations (44)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4816567A (en) | 1983-04-08 | 1989-03-28 | Genentech, Inc. | Recombinant immunoglobin preparations |
| US4818700A (en) | 1985-10-25 | 1989-04-04 | Phillips Petroleum Company | Pichia pastoris argininosuccinate lyase gene and uses thereof |
| US4888281A (en) | 1983-11-29 | 1989-12-19 | Igen, Inc. | Method of catalyzing chemical reactions |
| US5037750A (en) | 1984-11-27 | 1991-08-06 | Igen, Inc. | Method for producing antibodies which catalyze chemical reactions |
| US5714377A (en) | 1992-08-14 | 1998-02-03 | Rhone-Poulenc Rorer S.A. | Modified fungal cells and method for producing recombinant products |
| US5733757A (en) | 1995-12-15 | 1998-03-31 | The Scripps Research Institute | Aldolase catalytic antibody |
| EP1105409A2 (en) | 1999-05-17 | 2001-06-13 | Conjuchem, Inc. | Protection of endogenous therapeutic peptides from peptidase activity through conjugation to blood components |
| EP1180121A1 (en) | 1999-05-17 | 2002-02-20 | Conjuchem, Inc. | Long lasting insulinotropic peptides |
| US20040018590A1 (en) | 2000-06-28 | 2004-01-29 | Gerngross Tillman U. | Combinatorial DNA library for producing modified N-glycans in lower eukaryotes |
| WO2004057002A2 (en) | 2002-12-20 | 2004-07-08 | Greenovation Biotech Gmbh | Production of heterologous glycosylated proteins in bryophyte cells |
| US20040136986A1 (en) | 1997-10-31 | 2004-07-15 | Genentech, Inc. | Methods and compositions comprising glycoprotein glycoforms |
| US20040171826A1 (en) | 2003-02-20 | 2004-09-02 | Stephen Hamilton | Endomannosidases in the modification of glycoproteins in eukaryotes |
| US20040230042A1 (en) | 2000-06-28 | 2004-11-18 | Stephen Hamilton | Expression of class 2 mannosidase and class III mannosidase in lower eukaryotic cells |
| US20050074843A1 (en) | 1998-04-20 | 2005-04-07 | Pablo Umana | Glycosylation engineering of antibodies for improving antibody-dependent cellular cytotoxicity |
| WO2005047336A1 (en) | 2003-11-13 | 2005-05-26 | Hanmi Pharmaceutical. Co. Ltd. | Protein complex using immunoglobulin fragment andmethod for the preparation thereof |
| US20050170452A1 (en) | 2001-12-27 | 2005-08-04 | Stefan Wildt | Method to engineer mammanlian-type carbohydrate structures |
| US20050208617A1 (en) | 2000-06-28 | 2005-09-22 | Piotr Bobrowicz | N-acetylglucosamintransferase III expression in lower eukaryotes |
| US6949372B2 (en) | 1999-03-02 | 2005-09-27 | The Johns Hopkins University | Engineering intracellular sialylation pathways |
| US20050216958A1 (en) | 2002-04-09 | 2005-09-29 | Kyowa Hakko Kogyo Co., Ltd | Cells of which genome is modified |
| US20050260729A1 (en) | 2004-03-17 | 2005-11-24 | Hamilton Stephen R | Method of engineering a cytidine monophosphate-sialic acid synthetic pathway in fungi and yeast |
| US6998267B1 (en) | 1998-12-09 | 2006-02-14 | The Dow Chemical Company | Method for manufacturing glycoproteins having human-type glycosylation |
| US20060040353A1 (en) | 2000-06-28 | 2006-02-23 | Davidson Robert C | Production of galactosylated glycoproteins in lower eukaryotes |
| US7029872B2 (en) | 2000-06-28 | 2006-04-18 | Glycofi, Inc | Methods for producing modified glycoproteins |
| WO2006107124A1 (en) | 2005-04-08 | 2006-10-12 | Hanmi Pharmaceutical Co., Ltd. | Immunoglobulin fc fragment modified by non-peptide polymer and pharmaceutical composition comprising the same |
| WO2006107990A2 (en) | 2005-04-05 | 2006-10-12 | The Johns Hopkins University | Improving protein n-glycosylation of eukaryotic cells using dolichol-linked oligosaccharide synthesis pathway, other n-gylosylation-increasing methods, and engineered hosts expressing products with increased n-glycosylation |
| US20060286637A1 (en) | 2000-06-28 | 2006-12-21 | Glycofi, Inc. | Production of sialylated N-glycans in lower eukaryotes |
| WO2007006570A2 (en) | 2005-07-12 | 2007-01-18 | Greenovation Biotech Gmbh | Improvements in or relating to protein production |
| US20070020260A1 (en) | 2001-10-25 | 2007-01-25 | Genentech, Inc. | Glycoprotein compositions |
| US20070037248A1 (en) | 2000-06-28 | 2007-02-15 | Piotr Bobrowicz | Production of modified glycoproteins having multiple antennary structures |
| US7198921B2 (en) | 2000-05-17 | 2007-04-03 | Mitsubishi Pharma Corporation | Process for producing protein with reduction of acidic sugar chain and glycoprotein produced thereby |
| US7205136B1 (en) | 1983-11-29 | 2007-04-17 | Wellstat Biocatalysis, Llc. | Catalytic antibodies |
| WO2007061631A2 (en) | 2005-11-15 | 2007-05-31 | Glycofi, Inc | Production of glycoproteins with reduced o-glycosylation |
| US7259007B2 (en) | 2003-12-24 | 2007-08-21 | Glycofi, Inc. | Methods for eliminating mannosylphosphorylation of glycans in the production of glycoproteins |
| WO2008006554A2 (en) | 2006-07-11 | 2008-01-17 | Greenovation Biotech Gmbh | Glyco-engineered antibodies |
| WO2008112092A2 (en) | 2007-03-07 | 2008-09-18 | Glycofi, Inc. | Production of glycoproteins with modified fucosylation |
| US7465577B2 (en) | 2004-04-29 | 2008-12-16 | Glycofi, Inc. | Methods for reducing or eliminating α-mannosidase resistant glycans for the production of glycoproteins |
| US20090012400A1 (en) | 2004-07-26 | 2009-01-08 | Guracar Ismayil M | Contrast Agent Imaging With Agent Specific Ultrasound Detection |
| US7479389B2 (en) | 2004-03-02 | 2009-01-20 | Glycofi, Inc. | ARG1, ARG2, ARG3, HIS1, HIS2, HIS5, HIS6 genes and methods for stable genetic integration |
| US20090069232A1 (en) * | 2007-04-03 | 2009-03-12 | Nico Luc Marc Callewaert | Glycosylation of molecules |
| US7514253B2 (en) | 2003-05-16 | 2009-04-07 | Glycofi, Inc. | URA5 gene and methods for stable genetic integration in yeast |
| US20090124000A1 (en) | 2006-05-19 | 2009-05-14 | Juergen Nett | Recombinant Vectors |
| WO2009085135A2 (en) | 2007-12-19 | 2009-07-09 | Glycofi, Inc. | Yeast strains for protein production |
| WO2009105357A1 (en) | 2008-02-20 | 2009-08-27 | Glycofi, Inc. | Vectors and yeast strains for protein production |
| WO2010019487A1 (en) | 2008-08-12 | 2010-02-18 | Glycofi, Inc. | Improved vectors and yeast strains for protein production: ca2+ atpase overexpression |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7405198B2 (en) * | 2003-11-24 | 2008-07-29 | Neose Technologies, Inc. | Glycopegylated erythropoietin |
| TW201028431A (en) | 2008-10-31 | 2010-08-01 | Lonza Ag | Novel tools for the production of glycosylated proteins in host cells |
| WO2010099186A1 (en) * | 2009-02-25 | 2010-09-02 | Merck Sharp & Dohme Corp. | Her2 antibody compositions |
-
2011
- 2011-02-23 KR KR1020127022052A patent/KR101930961B1/en active Active
- 2011-02-23 US US13/579,972 patent/US8715963B2/en active Active
- 2011-02-23 BR BR112012020882A patent/BR112012020882A2/en not_active IP Right Cessation
- 2011-02-23 MX MX2012009802A patent/MX2012009802A/en not_active Application Discontinuation
- 2011-02-23 AU AU2011220878A patent/AU2011220878A1/en not_active Abandoned
- 2011-02-23 CN CN201180011130.XA patent/CN102858949B/en active Active
- 2011-02-23 RU RU2012140429/10A patent/RU2012140429A/en not_active Application Discontinuation
- 2011-02-23 CA CA2788992A patent/CA2788992A1/en not_active Abandoned
- 2011-02-23 JP JP2012555104A patent/JP5976549B2/en active Active
- 2011-02-23 EP EP11747972.5A patent/EP2539430B1/en active Active
- 2011-02-23 WO PCT/US2011/025878 patent/WO2011106389A1/en not_active Ceased
-
2014
- 2014-02-17 US US14/181,786 patent/US20140227290A1/en not_active Abandoned
Patent Citations (55)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4816567A (en) | 1983-04-08 | 1989-03-28 | Genentech, Inc. | Recombinant immunoglobin preparations |
| US4888281A (en) | 1983-11-29 | 1989-12-19 | Igen, Inc. | Method of catalyzing chemical reactions |
| US7205136B1 (en) | 1983-11-29 | 2007-04-17 | Wellstat Biocatalysis, Llc. | Catalytic antibodies |
| US5037750A (en) | 1984-11-27 | 1991-08-06 | Igen, Inc. | Method for producing antibodies which catalyze chemical reactions |
| US4818700A (en) | 1985-10-25 | 1989-04-04 | Phillips Petroleum Company | Pichia pastoris argininosuccinate lyase gene and uses thereof |
| US5714377A (en) | 1992-08-14 | 1998-02-03 | Rhone-Poulenc Rorer S.A. | Modified fungal cells and method for producing recombinant products |
| US5985626A (en) | 1994-03-10 | 1999-11-16 | The Scripps Research Institute | Catalytic antibody/substrate intermediates |
| US6368839B1 (en) | 1995-12-15 | 2002-04-09 | The Scripps Research Institute | Aldolase catalytic antibody |
| US5733757A (en) | 1995-12-15 | 1998-03-31 | The Scripps Research Institute | Aldolase catalytic antibody |
| US20040136986A1 (en) | 1997-10-31 | 2004-07-15 | Genentech, Inc. | Methods and compositions comprising glycoprotein glycoforms |
| US20050074843A1 (en) | 1998-04-20 | 2005-04-07 | Pablo Umana | Glycosylation engineering of antibodies for improving antibody-dependent cellular cytotoxicity |
| US6998267B1 (en) | 1998-12-09 | 2006-02-14 | The Dow Chemical Company | Method for manufacturing glycoproteins having human-type glycosylation |
| US7388081B2 (en) | 1998-12-09 | 2008-06-17 | Dfb Biotech, Inc. | Method for manufacturing glycoproteins having human-type glycosylation |
| US6949372B2 (en) | 1999-03-02 | 2005-09-27 | The Johns Hopkins University | Engineering intracellular sialylation pathways |
| EP1105409A2 (en) | 1999-05-17 | 2001-06-13 | Conjuchem, Inc. | Protection of endogenous therapeutic peptides from peptidase activity through conjugation to blood components |
| EP1180121A1 (en) | 1999-05-17 | 2002-02-20 | Conjuchem, Inc. | Long lasting insulinotropic peptides |
| US6593295B2 (en) | 1999-05-17 | 2003-07-15 | Conjuchem, Inc. | Long lasting insulinotropic peptides |
| US7198921B2 (en) | 2000-05-17 | 2007-04-03 | Mitsubishi Pharma Corporation | Process for producing protein with reduction of acidic sugar chain and glycoprotein produced thereby |
| US7625756B2 (en) | 2000-06-28 | 2009-12-01 | GycoFi, Inc. | Expression of class 2 mannosidase and class III mannosidase in lower eukaryotic cells |
| US7449308B2 (en) | 2000-06-28 | 2008-11-11 | Glycofi, Inc. | Combinatorial DNA library for producing modified N-glycans in lower eukaryotes |
| US20050208617A1 (en) | 2000-06-28 | 2005-09-22 | Piotr Bobrowicz | N-acetylglucosamintransferase III expression in lower eukaryotes |
| US7598055B2 (en) | 2000-06-28 | 2009-10-06 | Glycofi, Inc. | N-acetylglucosaminyltransferase III expression in lower eukaryotes |
| US20040230042A1 (en) | 2000-06-28 | 2004-11-18 | Stephen Hamilton | Expression of class 2 mannosidase and class III mannosidase in lower eukaryotic cells |
| US20060286637A1 (en) | 2000-06-28 | 2006-12-21 | Glycofi, Inc. | Production of sialylated N-glycans in lower eukaryotes |
| US20060040353A1 (en) | 2000-06-28 | 2006-02-23 | Davidson Robert C | Production of galactosylated glycoproteins in lower eukaryotes |
| US7029872B2 (en) | 2000-06-28 | 2006-04-18 | Glycofi, Inc | Methods for producing modified glycoproteins |
| US20040018590A1 (en) | 2000-06-28 | 2004-01-29 | Gerngross Tillman U. | Combinatorial DNA library for producing modified N-glycans in lower eukaryotes |
| US20070037248A1 (en) | 2000-06-28 | 2007-02-15 | Piotr Bobrowicz | Production of modified glycoproteins having multiple antennary structures |
| US20070020260A1 (en) | 2001-10-25 | 2007-01-25 | Genentech, Inc. | Glycoprotein compositions |
| US20050170452A1 (en) | 2001-12-27 | 2005-08-04 | Stefan Wildt | Method to engineer mammanlian-type carbohydrate structures |
| US20050216958A1 (en) | 2002-04-09 | 2005-09-29 | Kyowa Hakko Kogyo Co., Ltd | Cells of which genome is modified |
| WO2004057002A2 (en) | 2002-12-20 | 2004-07-08 | Greenovation Biotech Gmbh | Production of heterologous glycosylated proteins in bryophyte cells |
| US20040171826A1 (en) | 2003-02-20 | 2004-09-02 | Stephen Hamilton | Endomannosidases in the modification of glycoproteins in eukaryotes |
| US7514253B2 (en) | 2003-05-16 | 2009-04-07 | Glycofi, Inc. | URA5 gene and methods for stable genetic integration in yeast |
| WO2005047337A1 (en) | 2003-11-13 | 2005-05-26 | Hanmi Pharmaceutical Co., Ltd. | A pharmaceutical composition comprising an immunoglobulin fc region as a carrier |
| WO2005047336A1 (en) | 2003-11-13 | 2005-05-26 | Hanmi Pharmaceutical. Co. Ltd. | Protein complex using immunoglobulin fragment andmethod for the preparation thereof |
| WO2005047334A1 (en) | 2003-11-13 | 2005-05-26 | Hanmi Pharmaceutical. Co., Ltd. | Igg fc fragment for a drug carrier and method for the preparation thereof |
| US7259007B2 (en) | 2003-12-24 | 2007-08-21 | Glycofi, Inc. | Methods for eliminating mannosylphosphorylation of glycans in the production of glycoproteins |
| US7479389B2 (en) | 2004-03-02 | 2009-01-20 | Glycofi, Inc. | ARG1, ARG2, ARG3, HIS1, HIS2, HIS5, HIS6 genes and methods for stable genetic integration |
| US20050260729A1 (en) | 2004-03-17 | 2005-11-24 | Hamilton Stephen R | Method of engineering a cytidine monophosphate-sialic acid synthetic pathway in fungi and yeast |
| US7465577B2 (en) | 2004-04-29 | 2008-12-16 | Glycofi, Inc. | Methods for reducing or eliminating α-mannosidase resistant glycans for the production of glycoproteins |
| US20090012400A1 (en) | 2004-07-26 | 2009-01-08 | Guracar Ismayil M | Contrast Agent Imaging With Agent Specific Ultrasound Detection |
| US7713719B2 (en) | 2004-10-18 | 2010-05-11 | Glycofi, Inc. | Methods for reducing or eliminating α-mannosidase resistant glycans for the production of glycoproteins |
| WO2006107990A2 (en) | 2005-04-05 | 2006-10-12 | The Johns Hopkins University | Improving protein n-glycosylation of eukaryotic cells using dolichol-linked oligosaccharide synthesis pathway, other n-gylosylation-increasing methods, and engineered hosts expressing products with increased n-glycosylation |
| US20060252672A1 (en) * | 2005-04-05 | 2006-11-09 | Betenbaugh Michael J | Protein N-glycosylation of eukaryotic cells using dolichol-linked oligosaccharide synthesis pathway, other N-gylosylation-increasing methods, and engineered hosts expressing products with increased N-glycosylation |
| WO2006107124A1 (en) | 2005-04-08 | 2006-10-12 | Hanmi Pharmaceutical Co., Ltd. | Immunoglobulin fc fragment modified by non-peptide polymer and pharmaceutical composition comprising the same |
| WO2007006570A2 (en) | 2005-07-12 | 2007-01-18 | Greenovation Biotech Gmbh | Improvements in or relating to protein production |
| WO2007061631A2 (en) | 2005-11-15 | 2007-05-31 | Glycofi, Inc | Production of glycoproteins with reduced o-glycosylation |
| US20090124000A1 (en) | 2006-05-19 | 2009-05-14 | Juergen Nett | Recombinant Vectors |
| WO2008006554A2 (en) | 2006-07-11 | 2008-01-17 | Greenovation Biotech Gmbh | Glyco-engineered antibodies |
| WO2008112092A2 (en) | 2007-03-07 | 2008-09-18 | Glycofi, Inc. | Production of glycoproteins with modified fucosylation |
| US20090069232A1 (en) * | 2007-04-03 | 2009-03-12 | Nico Luc Marc Callewaert | Glycosylation of molecules |
| WO2009085135A2 (en) | 2007-12-19 | 2009-07-09 | Glycofi, Inc. | Yeast strains for protein production |
| WO2009105357A1 (en) | 2008-02-20 | 2009-08-27 | Glycofi, Inc. | Vectors and yeast strains for protein production |
| WO2010019487A1 (en) | 2008-08-12 | 2010-02-18 | Glycofi, Inc. | Improved vectors and yeast strains for protein production: ca2+ atpase overexpression |
Non-Patent Citations (54)
| Title |
|---|
| BERENS; HILLEN, EUR. J. BIOCHEM., vol. 270, 2003, pages 3109 - 3121 |
| BERRIMAN ET AL., SCIENCE, vol. 309, 2005, pages 416 - 422 |
| BOBROWICZ ET AL., YEAST, vol. 13, 1997, pages 819 - 828 |
| BOSCH ET AL., J. BIOL. CHEM., vol. 263, 1988, pages 17360 - 17365 |
| CASTRO ET AL., PROC. NATL. ACAD. SCI. USA, vol. 103, 2006, pages 14756 - 14760 |
| COSANO ET AL., YEAST, vol. 14, 1998, pages 861 - 867 |
| COX; GREENBERG, SEMIN. IMMUNOL., vol. 13, 2001, pages 339 - 345 |
| CREGG ET AL., FEMS MICROBIOL. REV., vol. 24, 2000, pages 45 - 66 |
| DAERON ET AL., ANNU. REV. IMMUNOL., vol. 15, 1997, pages 203 - 234 |
| DEMPSKI; IMPERIALI, CURR. OPIN. CHEM. BIOL., vol. 6, 2002, pages 844 - 850 |
| GAWLITZEK ET AL.: "Identification of cell culture conditions to control N-glycosylation site-occupancy of recombinant glycoproteins expressed in CHO cells", BIOTECHNOL. BIOENGIN., vol. 103, 2009, pages 1164 - 1175, XP002688571, DOI: doi:10.1002/BIT.22348 |
| HARTNER ET AL., NUCL. ACID RES., vol. 36, 6 June 2008 (2008-06-06), pages E76 |
| HESE ET AL., GLYCOBIOLOGY, vol. 19, 2009, pages 160 - 171 |
| HESE ET AL.: "The yeast oligosaccharyltransferase complex can be replaced by STT3 from Leishmania major.", GLYCOBIOLOGY, vol. 19, no. 2, 2009, pages 160 - 171, XP055094329 * |
| HEYMAN, IMMUNOL. LETT., vol. 88, 2003, pages 157 - 161 |
| IVENS ET AL., SCIENCE, vol. 309, 2005, pages 436 - 442 |
| IZQUIERDO ET AL.: "Distinct donor and acceptor specificities of Trypanosoma brucei oligosaccharyltransferases.", EMBO J., vol. 28, no. 17, 2009, pages 2650 - 2661, XP055094363 * |
| JONES ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 1726, 2005, pages 121 - 137 |
| KANDA ET AL., BIOTECHNOL. BIOENG., vol. 94, 2006, pages 680 - 688 |
| KANDA ET AL., GLYCOBIOL., vol. 17, 2006, pages 104 - 118 |
| KELLEHE; GILMORE, GLYCOBIOL., vol. 16, 2006, pages 47R - 62R |
| KELLEHER ET AL., MOL. CELL, vol. 12, 2003, pages 101 - 111 |
| KELLEHER; GILMORE, GLYCOBIOL, vol. 16, 2006, pages 47R - 62R |
| KELLEHER; GILMORE, GLYCOBIOL., vol. 16, 2006, pages 47R - 62R |
| KENNARD ET AL.: "Methods Biotechnol. Vo. 8: Animal Cell Biotechnology", vol. 8, 1999, HUMAN PRESS, INC., pages: 187 - 200 |
| KNAUER; LEHLE, BIOCHIM. BIOPHYS. ACTA, vol. 1426, 1999, pages 259 - 273 |
| KOHLER ET AL., NATURE, vol. 256, 1975, pages 495 |
| KOWARIK ET AL., SCIENCE, vol. 314, 2006, pages 1148 - 1150 |
| LIN CEREGHINO ET AL., GENE, vol. 263, 2001, pages 159 - 169 |
| MAITA ET AL.: "Comparative structural biology of eubacterial and archaeal oligosaccharyltransferases.", J. BIOL. CHEM., vol. 285, no. 7, 12 February 2010 (2010-02-12), pages 4941 - 4950, XP055038785 * |
| MARASCO,: "Intracellular Antibodies: Research and Disease Applications", 1998, SPRINGER-VERLAG NEW YORK, INC. |
| MCCONVILLE ET AL., MICROBIOL. MOL. BIOL. REV., vol. 66, 2002, pages 122 - 154 |
| NASAB ET AL., MOLECULAR BIOLOGY OF THE CELL, vol. 19, 2008, pages 3758 - 3768 |
| NASAB ET AL.: "All in one: Leishmania major STT3 proteins substitute for the whole oligosaccharyltransferase complex in Saccharomyces cerevisiae.", MOL. BIOL. CELL, vol. 19, no. 9, 2008, pages 3758 - 3768, XP002518426 * |
| NASEB ET AL., MOLEC. BIOL. CELL, vol. 19, 2008, pages 3758 - 3768 |
| NILSSON ET AL., J. CELL BIOL., vol. 161, 2003, pages 715 - 725 |
| PARODI, GLYCOBIOLOGY, vol. 3, 1993, pages 193 - 199 |
| PAUL, W.: "Fundamental Immunology., 2nd ed.", 1989, RAVEN PRESS |
| RAVETCH, CURR. OPIN. IMMUNOL., vol. 9, 1997, pages 121 - 125 |
| ROMANOS ET AL., YEAST, vol. 8, 1992, pages 423 - 488 |
| SAMUELSON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 102, 2005, pages 1548 - 1553 |
| SCHULTZ; AEBI, MOLEC. CELL. PROTEOMICS, vol. 8, 2009, pages 357 - 364 |
| See also references of EP2539430A4 |
| SHAMS-ELDIN ET AL., MOL. BIOCHEM. PARASITOL., vol. 143, 2005, pages 6 - 11 |
| SHUTTER ET AL., NAT. BIOTECHNOL., vol. 27, 2009, pages 561 - 566 |
| SILBERSTEIN; GILMORE, FASEB J., vol. 10, 1996, pages 849 - 858 |
| SPIRIG ET AL., MOLEC. GEN. GENET., vol. 256, 1997, pages 628 - 637 |
| WACKER ET AL., SCIENCE, vol. 298, 2002, pages 1790 - 1793 |
| WARD; GHETIE, THERAPEUTIC IMMUNOL., vol. 2, 1995, pages 77 - 94 |
| WEERAPANA; IMPERIALI, GLYCOBIOL., vol. 16, 2006, pages 91R - 101R |
| WYSOCKI ET AL., J. BIOL. CHEM., vol. 272, 1997, pages 30061 - 30066 |
| YAMANE-OHNUKI ET AL., BIOTECHNOL. BIOENG., vol. 87, 2004, pages 614 - 622 |
| YAN; LENNARZ, J. BIOL. CHEM., vol. 277, 2002, pages 47692 - 47700 |
| YAN; LENNARZ, J. BIOL. CHEM., vol. 277, 2005, pages 47692 - 47700 |
Cited By (24)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2015502144A (en) * | 2011-10-28 | 2015-01-22 | メルク・シャープ・アンド・ドーム・コーポレーションMerck Sharp & Dohme Corp. | Method for increasing N-glycan occupancy and reducing hybrid N-glycan production in Pichia pastoris strains deficient in Alg3 expression |
| CN104471053A (en) * | 2011-10-28 | 2015-03-25 | 默沙东公司 | Methods for increasing N-glycan occupancy and reducing production of hybrid N-glycans in Pichia pastoris strains lacking ALG3 expression |
| US9695454B2 (en) | 2012-05-23 | 2017-07-04 | Glykos Finland Oy | Production of fucosylated glycoproteins |
| WO2013174927A1 (en) * | 2012-05-23 | 2013-11-28 | Novartis International Pharmaceutical Limited | Production of fucosylated glycoproteins |
| EP2854851A4 (en) * | 2012-06-01 | 2016-03-30 | Momenta Pharmaceuticals Inc | METHODS ASSOCIATED WITH TRASTUZUMAB |
| WO2014088836A1 (en) | 2012-12-03 | 2014-06-12 | Merck Sharp & Dohme Corp. | O-glycosylated carboxy terminal portion (ctp) peptide-based insulin and insulin analogues |
| EP2931895A4 (en) * | 2012-12-17 | 2016-08-10 | Merck Sharp & Dohme | MUTANT CELLS PMT2, OCH1, PMT5 |
| WO2014126787A1 (en) * | 2013-02-13 | 2014-08-21 | Merck Sharp & Dohme Corp. | Methods for increasing n-glycan occupancy and reducing production of hybrid n-glycans in pichia pastoris strains lacking alg3 expression |
| US9518100B2 (en) | 2013-02-13 | 2016-12-13 | Merck Sharp & Dohme Corp. | Methods for increasing N-glycan occupancy and reducing production of hybrid N-glycans in Pichia pastoris strains lacking Alg3 expression |
| JP2016521549A (en) * | 2013-06-04 | 2016-07-25 | アイコン ジェネティクス ゲーエムベーハー | Method for regulating N-glycosylation site occupancy of plant-produced glycoproteins and recombinant glycoproteins |
| WO2015001460A3 (en) * | 2013-07-01 | 2015-04-23 | Biocon Limited | Signal sequence for protein expression in pichia pastoris |
| US20220213451A1 (en) * | 2013-07-04 | 2022-07-07 | Glykos Finland Oy | O-Mannosyltransferase Deficient Filamentous Fungal Cells and Methods of Use Thereof |
| WO2015004239A1 (en) | 2013-07-10 | 2015-01-15 | Novartis Ag | Production of glycoproteins having increased n-glycosylation site occupancy |
| CN105492620A (en) * | 2013-07-10 | 2016-04-13 | 诺华股份有限公司 | Production of glycoproteins having increased n-glycosylation site occupancy |
| US10513724B2 (en) | 2014-07-21 | 2019-12-24 | Glykos Finland Oy | Production of glycoproteins with mammalian-like N-glycans in filamentous fungi |
| WO2016012468A1 (en) * | 2014-07-21 | 2016-01-28 | Novartis Ag | Production of glycoproteins with mammalian-like n-glycans in filamentous fungi |
| CN105087405A (en) * | 2015-09-17 | 2015-11-25 | 杭州研真生物科技有限公司 | Pichia pastoris underglycosylated mutant strain and application of pichia pastoris underglycosylated mutant strain |
| US11027021B2 (en) | 2016-03-15 | 2021-06-08 | Seagen Inc. | Combinations of PBD-based antibody drug conjugates with Bcl-2 inhibitors |
| US11110179B2 (en) | 2016-06-03 | 2021-09-07 | Seagen Inc. | Combination of CD33 antibody drug conjugates with chemotherapeutic agents |
| US11191771B2 (en) | 2016-06-09 | 2021-12-07 | Seagen Inc. | Combinations of PBD-based antibody drug conjugates with FLT3 inhibitors |
| US12559731B2 (en) | 2019-08-09 | 2026-02-24 | Glaxosmithkline Biologicals Sa | Mutated PglB oligosaccharyl transferase enzymes |
| CN113549560A (en) * | 2020-04-24 | 2021-10-26 | 中国人民解放军军事科学院军事医学研究院 | A kind of engineering yeast construction method for glycoprotein preparation and its strain |
| CN113549560B (en) * | 2020-04-24 | 2024-02-13 | 中国人民解放军军事科学院军事医学研究院 | An engineered yeast construction method and strain for glycoprotein preparation |
| WO2023004172A1 (en) * | 2021-07-23 | 2023-01-26 | Clara Foods Co. | Protein compositions and methods of production |
Also Published As
| Publication number | Publication date |
|---|---|
| JP5976549B2 (en) | 2016-08-24 |
| CN102858949B (en) | 2016-07-06 |
| EP2539430B1 (en) | 2016-09-14 |
| JP2013520205A (en) | 2013-06-06 |
| RU2012140429A (en) | 2014-03-27 |
| MX2012009802A (en) | 2012-09-12 |
| KR20120134116A (en) | 2012-12-11 |
| US20120328626A1 (en) | 2012-12-27 |
| KR101930961B1 (en) | 2018-12-19 |
| EP2539430A1 (en) | 2013-01-02 |
| BR112012020882A2 (en) | 2015-11-03 |
| CN102858949A (en) | 2013-01-02 |
| US8715963B2 (en) | 2014-05-06 |
| EP2539430A4 (en) | 2014-02-12 |
| US20140227290A1 (en) | 2014-08-14 |
| AU2011220878A1 (en) | 2012-08-23 |
| CA2788992A1 (en) | 2011-09-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8715963B2 (en) | Method for increasing N-glycosylation site occupancy on therapeutic glycoproteins produced in Pichia pastoris | |
| US12084651B2 (en) | Surface display of whole antibodies in eukaryotes | |
| AU2010218139B2 (en) | Metabolic engineering of a galactose assimilation pathway in the glycoengineered yeast Pichia pastoris | |
| US9428784B2 (en) | Methods for increasing N-glycan occupancy and reducing production of hybrid N-glycans in pichia pastoris strains lacking ALG3 expression | |
| US9518100B2 (en) | Methods for increasing N-glycan occupancy and reducing production of hybrid N-glycans in Pichia pastoris strains lacking Alg3 expression | |
| AU2013363266A1 (en) | pmt2, och1, pmt5 Mutant Cells | |
| AU2012238203A1 (en) | Metabolic engineering of a galactose assimilation pathway in the glycoengineered yeast pichia pastoris |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 201180011130.X Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 11747972 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2011220878 Country of ref document: AU |
|
| ENP | Entry into the national phase |
Ref document number: 2788992 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 6835/CHENP/2012 Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13579972 Country of ref document: US |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2012555104 Country of ref document: JP |
|
| ENP | Entry into the national phase |
Ref document number: 2011220878 Country of ref document: AU Date of ref document: 20110223 Kind code of ref document: A Ref document number: 20127022052 Country of ref document: KR Kind code of ref document: A |
|
| REEP | Request for entry into the european phase |
Ref document number: 2011747972 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2012/009802 Country of ref document: MX Ref document number: 2011747972 Country of ref document: EP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2012140429 Country of ref document: RU |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112012020882 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112012020882 Country of ref document: BR Kind code of ref document: A2 Effective date: 20120820 |








