WO2011095501A1 - Complexitiy reduction method - Google Patents
Complexitiy reduction method Download PDFInfo
- Publication number
- WO2011095501A1 WO2011095501A1 PCT/EP2011/051442 EP2011051442W WO2011095501A1 WO 2011095501 A1 WO2011095501 A1 WO 2011095501A1 EP 2011051442 W EP2011051442 W EP 2011051442W WO 2011095501 A1 WO2011095501 A1 WO 2011095501A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- fragments
- nucleic acid
- subpools
- sequences
- sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6853—Nucleic acid amplification reactions using modified primers or templates
- C12Q1/6855—Ligating adaptors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Definitions
- the present invention relates to the field of analyzing complex mixtures of nucleic acids through sequencing, especially high throughput sequencing techniques, such as Next generation Se ⁇ quencing (NGS) .
- NGS Next generation Se ⁇ quencing
- NGS is currently the foremost complete analyzing method.
- Next generation sequencing is a generic term for parallelized sequencing through polymerization as high-throughput DNA sequencing method.
- NGS reads sequences of up to many millions fragments which are typically between 10 to several hundred base-pairs long. The complete sequence is obtained by alignment of those reads which is a challenging task due to the sheer number of small reads that have to be assembled to a complete se ⁇ quence.
- Some NGS methods rely on a consensus blue print held in genomic and/or transcriptomic databases. The quality of the re ⁇ sults depends on length and number of reads, reading accuracy, quality of information in the reference database and applied bi- oinformatics algorithms. To date many reads provide just limited information. For instance many of the reads cannot be assigned uniquely and therefore are discarded.
- Emulsion poly ⁇ merase chain reaction isolates individual DNA molecules using primer-coated beads in aqueous bubbles within an oil phase. Singularizing of DNA molecules, e.g. by rigorous dilution is another option.
- Another method for in vitro clonal amplifica ⁇ tion is bridge PCR, where fragments are amplified upon primers attached to a solid surface.
- Another option is to skip this am ⁇ plification step, directly fix DNA molecules to a surface.
- DNA molecules or above mentioned DNA coated beads are immobi ⁇ lized to a surface, and sequenced in parallel.
- Sequencing by synthesis uses a DNA polymerase to determine the base se ⁇ quence.
- Reversible terminator methods use reversible versions of dye-terminators, adding one nucleotide at a time, detecting flu ⁇ orescence at each position by repeated removal of the blocking group to allow polymerization of another nucleotide.
- Pyrose- quencing also uses DNA polymerization, adding one nucleotide species at a time and detecting and quantifying the number of nucleotides added to a given location through the light emitted by the release of attached pyrophosphates.
- the sequencing by li ⁇ gation method uses a DNA ligase to determine the target se- quence .
- oligonucleotides Used in the polony method and in the SOLiD technology, it employs a partition of all possible oligonucleotides of a fixed length, labeled according to the sequenced position. Oli ⁇ gonucleotides are annealed and ligated. The preferential liga ⁇ tion by DNA ligase for matching sequences results in a dinucleo- tide encoded colour space signal at that position.
- NGS technologies are essentially based on random amplifica ⁇ tion of input DNA fragments. This simplifies preparation but the sequencing remains undirected.
- the sheer complexity of the com ⁇ plete sample information simultaneously obtained, is the key hindrance for unambiguous alignment of the reads. Therefore, complexity reduction is essential for increasing the quality of the results.
- BAC bac ⁇ terial artificial chromosome
- Another option to reduce complexity is to first select poly- nucleic acids based on their respective sizes.
- Different ap ⁇ proaches include, but are not limited to, agarose gel electro ⁇ phoresis or size exclusion chromatography for fractionation.
- RNA sequencing approaches employ this method in order to obtain e.g. a fraction of RNA molecules called micro RNA
- RNA sized between 15 and 30 nucleotides.
- a different method for reducing the amount of input nucleic acid to below the amount contained within a single cell some ⁇ times is termed limited dilution.
- a genomic nucleic acid sample is sheared and diluted to an extent where spatial distribution of the nucleic acid fragments within the sample volume becomes significant. Then subpools are created by taking such small vol ⁇ umes from the total sample volume that most subpools contain no nucleic acids, a few subpools contain one nucleic acid each and even less subpools contain two nucleic acids. This leads to a singularization of nucleic acids and therefore to complexity re ⁇ duction compared to the full length genome as each singularized nucleic acid is a fragment of a genome.
- a further option is to sequence-specifically reject RNA, e.g. in a hybridization-based approach that removes ribosomal RNA from the entire RNA sample.
- RNA fractiona ⁇ tion methods that rely either on prior sequence information or are directed towards a certain RNA fraction (e.g. polyA selec ⁇ tion)
- removal of rRNA does not bias the sequencing sample. How ⁇ ever, the mere removal of ribosomal RNA is restricted to RNA samples and cannot be scaled in terms of complexity reduction.
- the duplex-specific nuclease (DSN) method can be used for selectively removing double stranded DNA from the sample solu ⁇ tion. This is achieved by letting the single stranded sample in ⁇ teract with excess driver DNA.
- Driver DNA is made up of se ⁇ quences designed to remove their targets from the original sample.
- sequence-specific selection methods e.g. by targeted sequencing of genomic regions such as particular exons .
- the idea behind such capture arrays is to in ⁇ sert a selection step prior to sequencing. Those arrays are pro ⁇ grammed to capture only the genomic regions of interest and thus enabling users to utilize the full capacity of the NGS machines in the sequencing of the specific genomic regions of interest. Low density, on array capture hybridization is used for sequenc ⁇ ing approaches. Such technology is not hypothesis neutral, as specific sequence information is required for the selection pro ⁇ cess.
- a similar positive selection can be used for targeted re- sequencing.
- biotinylated RNA strands of high specificity for their complementary genomic targets can be used to extract DNA fragments for subsequent amplification and sequence determi ⁇ nation. This form of complexity reduction is necessarily based on available sequence information and therefore not hypothesis neutral .
- Sequencing of 16S rDNA or 16S rRNA sequences from mixed samples of microorganisms is i.a. employed for detection of rare species within these samples.
- sequencing approach By restricting the sequencing approach to a specific signature of microorganisms both complexity and information content are reduced. Frequently only phyloge- netic information is obtained.
- Tag-based identification of transcripts includes SAGE (Se ⁇ rial Analysis of Gene Expression) wherein sequence tags of de ⁇ fined length are extracted and sequenced. Since the initial creation of tag concatemers is a disadvantage for NGS, derived protocols are used omitting this step.
- CAGE Cap Analysis of Gene Expression
- ChlP-seq is one of several approaches to extract sequences based on their respective affinities to specific pro- teins (frequently transcription factors) .
- the associated DNA is immuno-precipitated, purified and sequenced. Only a very limited amount of questions is amenable to this approach.
- Amplification-driven selection methods (like PCR and isothermal amplification) rely on the specific interaction of DNA oligonucleotides with their respective target DNA.
- bioin- formatics-selected hexamers that serve as primers can be used for competitive amplification procedures.
- Such an approach does neither cover the full genome nor is the method scalable in terms of complexity reduction.
- Another possibility is selective amplification of a subset of genomic DNA using a circularization approach.
- a construct including a general primer pair motif which is flanked by two target-specific ends is used.
- liga ⁇ tion to the single stranded target sequence and amplification of the selected polynucleotide using a single primer is possible.
- Molecular Inversion Probe Capture (derived from initially termed "Padlock Probes") is used to select sub-sets of genomic DNA. This approach is not hypothesis neutral and limited in scalabil ⁇ ity.
- WO 2007/073171 A2 relates to a method of sequencing cDNA comprising a complexity reduction step by fragmenting cDNA by controlled endonuclease restriction enzymes.
- this method is dependent on the presence of proper endonuclease restriction sites in the cDNA sequence and always yields the same fragments for a given cDNA.
- WO 2009/073629 A2 describes a shotgun sequencing methods to reduce redundancy in high genome coverage. Nucleic acids are fragmented mechanically or by ultrasound to produce a first shotgun library. The fragments of the first shotgun library are sequenced and the sequence reads are assembled. In a second step, target specific oligonucleotides are synthesized, specific for regions of interest such as locations of single nucleotide polymorphisms, and complexed with the target nucleic acids.
- WO 2008/093098 A2 relates to a method for sequencing nucleic acids of at least two samples comprising randomly fragmenting the nucleic acids, ligating universal adaptors to the fragments and amplifying all nucleic acids for sequencing.
- WO 2009/116863 A2 describes a method for identifying genomic DNA comprising the steps of generating a cDNA, an optional complexity reduction step, fragmenting the cDNA, optional size se ⁇ lection of the fragments, adaptor ligation, a further size and fragments selection steps, and binding to beads, among many further mandatory steps.
- This method is work intensive and simpli ⁇ fication of complexity reduction for specific uses would be ben ⁇ eficial .
- the present invention provides in a first aspect a method for the reduction of the complexity of nucleic acid pool (s) , comprising
- amplified or amplifying means that the one or more fragments, including amplified copies thereof, can be divided into the different subpools after and/or during an amplification reaction.
- the “fraction” refers to the portion or amount of the one or more fragments obtained in the cutting step that are further processed in the amplification and dividing step .
- the inventive method can reduce the complexity of a sequence assembly by reducing the amount of sequence portions that have to be joined.
- rare (and even unknown) nucleic acids can be identified in the presence of highly abundant nucleic ac ⁇ ids, since generally more nucleic acid fragments become detect ⁇ able in the background of other fragments.
- such a method may facilitate the determination of rare genomes, or parts thereof, within a sample of abundant genomes.
- the method can further reduce the complexity of transcriptomic samples to such a degree that rare transcripts can be detected within the main competing signal of all other, possibly highly abundant transcripts. It is possible to measure quantitatively sequences and fragments thereof from the very rare to the highly abundant ones .
- the present invention provides for improved handling and sorting of nucleic acids contained in a pool of nu ⁇ cleic acids, e.g. for sorting or labelling purposes depending on a common nucleic acid feature of individual nucleic acids of the pool.
- the present invention facilitates the sepa ⁇ ration of nucleic acids, each sharing said common nucleic acid feature into different subpools.
- a nucleic acid feature can e.g. be a shared sequence portion as will be elaborated more in detail below.
- each nucleic acid molecule will be cut differently. This means that each nucleic acid molecule having the same sequence (being e.g. of a completely identical sequence or sharing a identical sequence portion) will be cut differently, thus resulting in a pool of different and very di ⁇ verse fragments, sharing the same parent nucleic acid sequence. These fragments may have overlapping portions to fragments of different cutting events. In fact, this is an important crite ⁇ rion for sequence alignment if no prior sequence information is available to facilitate the alignment of sequence portions to a joined sequence. On the other hand, this random fragmenting se- quence diversity greatly increases complexity of the sum of all fragments that have to be handled and eventually be sequenced.
- the present invention now reduces this complexity and helps to assign and sort the fragments into different subpools comprising a common nucleic acid feature. This is done by the amplification step, wherein fragments with the same parent nucleic acid se ⁇ quence are divided into different subpools depending on the com ⁇ mon nucleic acid feature.
- fragments with the same parent nucleic acid se ⁇ quence are divided into different subpools depending on the com ⁇ mon nucleic acid feature.
- not all fragments have to be sorted, e.g. for sequence determination approaches it is possi ⁇ ble and also sufficient to only use a fraction, e.g. sequences or nucleic acid fragments of a defined length.
- the present invention can also be defined as a method for the reduction of the complexity of nucleic acid pool (s) , comprising
- the subpools may comprise many diverse fragments such as at least 2, 3, 4, 5, 6, 7,
- the invention can also be used to improve the alignment of large numbers of individual sequencing reads to determine the sequence of nucleic acids and/or their copy number.
- the inventive method further comprises determining the sequences of the fragments for one or more subpools, further preferably comprising processing the sequences of a first sub-pool by aligning sequences or partial sequences of the fragments of the first sub-pool and join neighboring or overlapping sequences thereby obtaining a joined sequence, and optionally repeating the processing steps for one or more further subpools, wherein the sequences of the fragments of each further subpool are aligned and joined with the sequences of fragments and/or joined sequences of all previously processed subpool sequences, until a continuous sequence of at least one nucleic acid molecule of the sample is obtained.
- the fragments of one or more subpools can be cut sequence dependent or independent by any means known to the art, or partial copies can be generated from such fragments that are sequenced.
- partial sequences are generated during the sequencing run it ⁇ self, e.g. by random priming each of the individual fragments of a subpool to start the sequencing. Therefore partial sequences of fragments of one or more subpools are generated.
- the align ⁇ ment or assembly greatly benefits from first aligning or assem ⁇ bling (joining) such partial sequences within a subpool.
- the present invention also encompasses an embodiment where ⁇ in the fragments of at least one subpool are further cut, op ⁇ tionally sequence dependent or sequence independent, preferably into fragments of from 10 to 5000, more preferred 12 to 1000, further preferred of from 15 to 500 or 17 to 100 nucleotides length .
- the nu ⁇ cleic acid molecules are DNA molecules, in particular genomic DNA. It is further possible that the nucleic acid molecules are RNA, in particular RNA transcripts like mRNA, but also siRNA, snoRNA or microRNA. However, in preferred embodiments the nucleic acid molecules are large enough to yield a fragment size of at least 50, at least 80 or at least 100, at least 1,000 or at least 10,000 nucleotides.
- Nucleic acids are linear polymers of single nucleotides. These molecules carry genetic information (see triplet code) or form structures which fulfill other functions in the cell (e.g. regulation) .
- the nucleic acids which are related to this inven ⁇ tion are deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) .
- the genome is the inheritable information encoded in DNA (or, for some viruses, RNA) .
- the genome includes genes and non-coding sequences. Genomics is the study of the genomes of organisms.
- the transcriptome is the set of all RNA molecules, or "tran ⁇ scripts," produced in cells. Unlike the genome, which is roughly fixed for a given cell line, the transcriptome varies with the kind of cell, tissue, organ and the stage of development. It can alter with external environmental conditions. Because it in ⁇ cludes all RNA transcripts in the cell, the transcriptome re ⁇ flects the genes that are being actively expressed at any given time, and it includes degradation phenomena such as transcrip ⁇ tional attenuation. Transcriptomics is the study of transcripts, also referred to as expression profiling.
- the core principles of the method is similar for the analy ⁇ sis of genomic and transcriptomic data.
- Genomic DNA is characterized through one or a few long mole ⁇ cules (chromosomes) .
- This disclosed method describes how random ⁇ ized sheared DNA can be sorted into a series of different sub- pools e.g. via termini selective amplification. Afterwards, the subpools are processed and sequenced.
- the subpooling of transcript pools can be achieved through subpools with different additional information content.
- the gained benefits depend on the chosen methods.
- nucleic acid molecule shall be understood as a molecule having a certain sequence, shared by other nucleic acid molecules.
- the present invention aims at sorting and analyzing different cutting events of identical sequences comprised in nucleic acid molecules. This means that in the sample with one or more nucleic acid molecules multiple copies of said sequences are present.
- Such samples can e.g. comprise multiple copies of the same nucleic acid, comprise one nucleic acid with multiple copies of said sequence or mix ⁇ tures thereof.
- the nucleic acid molecules of the present inven ⁇ tion, in particular the common sequences thereof, may have an average nucleotide length.
- nucleotide length as well as the copy number directly correlate with the complexity of the nu ⁇ cleic acid pool to be processed by the present invention.
- a sufficient common nucleic acid feature is selected to facilitate a suitable complexity reduc ⁇ tion.
- the number of subpools, each comprising at least one fragment is created and a number of nucleic acid molecules in the sample times the fraction of the amplified fragments (the portion, e.g. percentage, of the fragments that are amplified from the original pool of nucleic acid fragments after the cut ⁇ ting step) .
- a com ⁇ bined length of the fragments of at least one subpool is less than the average nucleotide length of the nucleic acid molecules (e.g. the sequence repeats of the randomly cut nucleic acid of the sample) . It is particular beneficial if the size of the sub- pools is sufficiently small to allow an easier sequence determi ⁇ nation and following sequence alignment procedure, in particular if the copy number of the original sample of the analyzed se ⁇ quence is quite large.
- the original sample can e.g. be a sample of cellular nucleic acid molecules as obtained after isolation, e.g. a sample of 1,000 diploid cells from one organism leads to 2,000 genome cop ⁇ ies, which are all differently cut, or the sample may comprise nucleic acid molecules as obtained after e.g. PCR or any other amplification.
- the inventive segregation step for dividing the fragments of the amplified fraction into different subpools systematically reduces the amounts of the fragments to be ana ⁇ lysed and thus the complexity of the system.
- the numbers of subpools comprising at least one of the fragments is greater than the number of nucleic acid molecules in the sample and /or lower than the total amount of fragments per nucleic acid molecule in the sample.
- nucleic acid properties as distinctive nucleic acid feature which are di ⁇ rectly or indirectly sequence related can be exploited.
- properties are for example the affinity to adsorbing materials like various column materials (e.g. silica gel) or the solubil ⁇ ity in the presence of salts, polymers or other additives.
- the required informa ⁇ tion on the sample nucleic acids is limited, e.g. precipitation depends predominantly on length, the GC-content and secondary structures.
- the distinctive nucleic acid feature can be an ad ⁇ sorption or solubility property. Such properties and/or nucleic or solubility property. Such properties and/or nucleic acid size are preferably used to (optionally) select a fraction to be am ⁇ plified .
- subpools or fractions can be generated through methods which utilize distinctive sequence in ⁇ formation like i) partial internal or terminal sequences or ii) nucleic acid size. Preferably such sequence portions are used to divide fragments into subpools.
- a distictive nucleic acid feature can be a par ⁇ tial sequence of the nucleic acids or their fragments stemming from the template nucleic acid molecules such as RNA or cDNA or (genomic) DNA (portions) .
- the distinctive sequence can be a sin ⁇ gle nucleotide type (e.g. selected from A, T, U, G or C) or more at a specific position within the nucleic acids or fragments to be segregated.
- nucleotides can be segregated for the pres ⁇ ence of one or more nucleotide types or sequences at either the 5' or 3 ' terminus or in a given distance from said terminus.
- an array of hybridization probes which covers one or more sequence possibilities of said distinctive portion of the nucleic acid, can be used to create subpools. Even if subpools contain different nucleic acid fragments and some nucleic acid fragments will be present in several subpools, such a segrega ⁇ tion approach already reduces the complexity of the original pool. After collecting all reads preferably the alignment algo ⁇ rithm ensures, that all nucleic acids display at least one sub- pool specific sequence.
- Segregation by selecting for a distinctive nucleic acid fea ⁇ ture like a distinctive sequence can be performed by either se ⁇ lecting such nucleic acids or fragments with the distinctive se ⁇ quence or by specifically amplifying nucleic acids or fragments with said distinctive sequence and further utilizing these am- plificates in the inventive method.
- a preferred segregation method uses the sequence information of both termini, thus start and end site of the nucleic acid fragments. After termini-specific amplification and if the re ⁇ dundancy in the sequence specificity is zero (no mismatch al ⁇ lowed) , then all subpools contain amplificates , e.g. PCR prod ⁇ ucts, with exactly those termini. Hence, subpools can contain several transcripts but each transcript can only be presented in one subpool. By this means, the complexity of the alignment pro ⁇ cedure is largely reduced.
- nucleic acid size can be exploited to segregate the nu ⁇ cleic acid according to the number of nucleotides per transcript via electrophoresis techniques (gel or capillary electrophore ⁇ sis) , or other methods.
- electrophoresis techniques gel or capillary electrophore ⁇ sis
- the later alignment of the different reads per subpool can benefit from the boundary condition of a certain rather narrow size range.
- nucleic acids are also divided into subpools due to a common nucleic acid feature and then perform the cutting step without or with the preferred further division of the fragments.
- Everything mentioned herein for dividing nu ⁇ cleic acids also applies for dividing the fragments and vice- versa .
- the step of dividing a fragment into different subpools can be performed by any known means.
- This division is generally a qualitative division that leads to a quantitative reduction of the total number of fragments in each subpool. This means that substantially all fragments of a certain kind (sequence) are segregated into one particular subpool. "Substantially” means that a high efficiency of this division is preferred, e.g. about at least 90 %, 95% or 99%, in particular preferred 99.9 % of the fragments of one kind are segregated.
- Dividing as used herein also refers to specifically amplifying the fragments of one kind so that the segregated fragments (in total) constitute at least about 90 %, 95 %, 99 % or at least 99.9 % of the fragments of the subpool.
- this division step also referred to as segregation step, can be in a sequence dependent manner or sequence independently.
- selecting a fraction of the fragments for amplification can be sequence dependent or sequence independent.
- sequence independent means include separation according to physical parameters like absorption or solubility.
- Sequence dependent means include seg ⁇ regation by a size of the fragments or for a specificity for certain sequence portions.
- each subpool comprises fragments with a common nu ⁇ cleic acid feature.
- a subpool may comprise more than one, e.g. two, three, four or more, fragments with differ ⁇ ent nucleic acid features.
- Dividing (or also referred to as seg ⁇ regating) during or after amplification thus means that e.g. the fragments of more than one common nucleic acid feature can be selected or amplified for a given subpool (subpool mixture) .
- the inventive complexity reduction can be achieved by performing the inventive selection for certain nucleic acid features, even if performed simultaneously.
- An example of obtaining subpool mix ⁇ tures in one step according to the present invention is e.g. by multiplex PCR, using primers selecting for more than one nucleic acid features in one reaction.
- a subpool contains the fragments with one common nucleic acid feature used in the dividing or segregation step. Also preferred is when subpooling excludes the complete (undivided) pool of all nucleic acid molecule frag ⁇ ments .
- the step of dividing the fragments comprises selecting one or more frag ⁇ ment (s) with a common nucleic acid feature, preferably the pres ⁇ ence of the same one or more nucleic acid type(s), selected from A, T, U, G or C at the same position for each subpool.
- the nu ⁇ cleic acid feature used for segregation is a given nucleotide type, preferably selected from any one of A, T, U, G, C, at a certain position in the fragment, preferably the position being within 100 nucleotides from either the 5' or 3 ' terminus of the fragments.
- nucleotides e.g. to obtain a full length sequence source, are disclosed in the WO 2007/062445 (incorporated herein by
- segregation may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more, e.g. up to 20 or up to 100 nucleotides.
- a primer which is specific for e.g. one end (either the 3' or 5 ' end) of the nucleic acid and containing one or more further nucleotides specificities which act to segregate the fragments according to the complementary nucleotides after a universal sequence portion on the primer.
- Such universal sequence portions that allow a primer to hybridize specifically at the ends of nucleic acid at the ends of nucleic acid fragments, can be introduced artifi ⁇ cially e.g. by ligating oligonucleotides to the ends of all fragments after the fragmentation step.
- two different universal sequences can be used, one specifying a 5' and one specifying a 3' end.
- Another method to introduce universal se ⁇ quence portions is to copy the pool of fragments by primer ex ⁇ tension using primers, that have on their 5' end the universal sequence portion and on their 3' end random nucleotides, such as random hexamers or nonamers that can randomly hybridize to frag ⁇ ments of the pool.
- the primers have a universal sequence portion, that is complementary to the ends, preferably ether to the 5' or 3' ends, of all fragments, and ad ⁇ ditional nucleotides that are selective for the next 1 to 100, preferably 1 to 10 nucleotides, e.g. the next 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides.
- ad ⁇ ditional nucleotides that are selective for the next 1 to 100, preferably 1 to 10 nucleotides, e.g. the next 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides.
- the specific distinguishing nucleotides are within the first 100 nucleotides from either the 5' or 3 ' terminus of the fragment. It is of course also possible to use primers to select any internal re ⁇ gion used to divide the fragments in the segregation step.
- a universal sequence e.g. of a linker
- the term terminal nucleotides or the word termini or termi ⁇ nal specifies nucleotides or sequence portions (ether 5' and/or 3' ) that are next to, and exclude, these universal sequence por ⁇ tions.
- These universal sequence portions can be added artifi ⁇ cially as linkers or be a common hybridizing region mentioned above.
- Other universal sequences which are not used as nucleic acid feature in the segregation step can be natural repeat re ⁇ gions such as a poly-A tail of mRNA (or the corresponding poly-T stretch in its cDNA) .
- a nucleic acid feature adjacent to the universal sequence is selected for segregation.
- the fragments are selected for common nucleo- tides within the 10 nucleotides next to the 5' and/or 3' termi ⁇ nus, preferably for one or more common 5' and/or 3 ' terminal nu ⁇ cleotide types.
- primers or probes preferably are used in combination with primers or probes which are selected for a different nu ⁇ cleic acid feature.
- Such primers can e.g. be used separately or sequentially to generate subpools specific for nucleic acid fea ⁇ ture.
- primers or oligonucleotides used in a combination can e.g. be primers which have a universal part and a distinguishing part wherein the distinguishing part is e.g. A in the first primer, T in the second primer, G in the third primer and C in the fourth primer.
- more than one nucleotide is used as the nucleic acid feature and the combination can e.g.
- nucleic acid feature contains 3 or more, e.g. 4, 5, 6, 7, 8, or more specific nucleotide types.
- primers are oligonucleotides selecting for distinguishing nucleotides at both the 5' and/or 3' terminus, e.g. using both primers or probes being specific for the two or more 5' nucleotides and the two or more 3' nucleotides.
- the samples used for the inventive method contain potentially diverse nucleic acid molecules of different origins or different sequence in diverse concentration ranges. These factors contribute to the complexity of the sample. Furthermore, fragmentation, usually of all nucleic acids, to provide short molecules suitable for NGS increases diversity and complexity of the sample pool. Modern sequencing approaches however, always contain a random factor which sequences are further processed. In particular next generation sequencing relates to generating sequence portions, called reads of small sequence fractions in the range of about 10 to several 100 nucleotides (nts) or even up to 500 nts, usually in the range of about 30 nts. In complex samples this has always the drawback that the transcript or ge ⁇ nomic fragments of low concentration may be not sequenced in a parallel run in favour of fragments from transcripts or genomes of high copy numbers.
- the invention concerns the preparation of nucleic acids suitable for downstream NGS . It is applicable for high- throughput sequencing of genomic and transcriptomic information. It provides major improvements for the unambiguous alignment of said reads.
- the general principle is to reduce the complexity of a pool of nucleic acid fragments by sequencing smaller segregated por ⁇ tions after the inventive division into smaller portions called subpools.
- all subpools together con ⁇ tain the whole information to be analyzed of the original pool.
- the first factor is determined by the combined length of the individual different sequences. Because the sequence is encoded through 4 bases (T and U are considered to represent the same information) the complexity increases with the variation, equal to the length to the power of four. However, sequences contain redundant information like repeats or any other kind of order. The total value of information is quantifiable using e.g. Shan ⁇ non's information theory. While the raw information can only be deciphered through sequencing, the complexity which is intro ⁇ quizd through repeats can be reduced by segregating the individ ⁇ ual fragments before sequencing.
- the second factor is determined by the number of different sequences within a sample.
- the complexity increases with the number of permutations, therefore with the factorial of differ ⁇ ent sequences.
- Two sequences have two possibilities to arrange, three sequences have six possibilities and so forth.
- the third factor is the difference in copy numbers and to lesser degree the amount of precognition about these differ ⁇ ences, e.g. if it is known that the difference is in the order of 1/1,000.
- Each different sequence belongs to a group which is characterized of having one particular copy number. The level of distribution of these groups determines the complexity which is introduced through concentration differences.
- the inventive segregation can help to distinguish different nucleic acids of the original sample pool or of the fragments.
- This segregation step can also be repeated once or more.
- Repeti ⁇ tion herein shall not be interpreted that additional segregation steps have to be performed after the first segregation step - which is of course one option - but also relates to preforming one or more segregation steps simultaneously.
- one or more subpools are generated and in each subpool specific nucleic ac ⁇ ids are present (or enriched) which share a common feature and all other nucleic acids without that shared distinctive nucleic acid feature can be excluded from each pool (or at least are not enriched, e.g. by amplification).
- the general principle of the present invention is the constituting of subpools where these factors can be controlled, and simultaneously the complex ⁇ ity of the pool reduced, before reads are generated.
- the method simplifies the in-line sequence alignment to provide joined sequences.
- the genome contains one or several long DNA molecules (Chro ⁇ mosomes) .
- the genome is one very long word written with four letters. To be able to sequence this long word smaller portions are necessary.
- the pool of fragments is divided into subpools.
- One way of creating a pool of polynucleotides is using one or more restriction enzymes to cut all copies of a genome (e.g. 1,000). In diploid eukaryotic cells two different genomic molecules for each chromosome pair contribute to the DNA pool.
- the cutting step is random and/or sequence independent, preferably by physi ⁇ cal means, in particular preferred by sonication, shearing or elevated temperatures. This results in different fragments stem ⁇ ming from the same nucleic acid sequence.
- a fragment is consid ⁇ ered a nucleic acid portion of shorter length than the complete nucleic acid molecule from which it is derived.
- the nucleic acid molecules are cut into fragments of from 10 to 200 000 nucleotides length, preferably of from 50 to 100 000 nucleotides length. Any ranges therein are of course al ⁇ so possible.
- the nucleic acid molecules can e.g.
- Subpools can be created through randomly cutting a DNA sample into fragments of approximate length, e.g. lOkb (kilobases) . Such cutting can be for instance a shearing process. For example, each of 1,000 ge ⁇ nomes present in one sample would be cut into 100,000 polynu ⁇ cleotides of lOkb (kilobases) length creating a pool of 10 8 different polynucleotides.
- each subpool would contain only 10,000 of the lOkb polynucleotides thus 1/10 of the 1Gb genomic sequence .
- the number of subpools is preferably higher than the number of nucleic acid molecules in the sample.
- the amount of subpools that are needed for the same level of complexity reduc ⁇ tion is direct proportional to the number of nucleic acid mole ⁇ cules.
- a nucleic acid relates to all molecules with a given sequence, i.e. a nucleic acid of the sample as well a s all its copies obtained during amplification.
- the present invention provides a method for the reduction of the complexity of nucleic acid pool (s) , comprising
- the number of subpools comprising at least one of the fragments is greater than the number of nucleic acid molecules in the sample times said fraction, and wherein the fragments of each subpool comprise a common nucleic acid feature.
- the number of subpools should be greater than the number of different nucleic acid molecules.
- the fraction e.g. a certain percentage
- the fraction (e.g. a certain percentage) of processed nucleic acids thus is a factor in the equation to determine a suitable number of subpools.
- an ordinary probability function describes the chances of reading new sequences compare to reading sequences, or part thereof, which were already read before. To have a probability of close to one (>0.999) of reading once the entire genome, about 800 subpools need to be sequenced, with, 8x fold coverage.
- the complexity reduction is preferably not achieved through cutting the genome with restriction enzymes, but limiting the number of nucleic acid molecules in a subpool of fragments. Creating a number of subpools which is higher than the number of nucleic acid molecules within the starting pool of nucleic acids, the complexity within each subpool will be re ⁇ cuted .
- the core of the invention is dividing or segregating nucleic acids to reduce the complexity of the task in aligning sequenc ⁇ ing reads and foremost the ambiguity of doing so.
- the challenge depends on many different aspects of the real natural system many of which relate to stochastic effects.
- the subpools may hold signatures like chemi ⁇ cal identifier e.g. each fragment starting with a certain nucleotide type or sequence, lateral information in the sequencing machine or others. If the distribution obliges a Poisson- distribution, then the probability to find a certain number k of 12bp read sequences in one subpool calculates to:
- a 12bp read is not in 53% of the subpools, once in 34%, twice in 11% and three times in 2%, and so forth.
- the ratio 34/11/2 determines the probability to align a 12bp read unique ⁇ ly, to two or even 3 positions respectively.
- the genetic information is not random, it contains a high degree of order.
- the bioinformatics survey of the mouse genome revealed that in 25-bp sequence fragments 80% are unique, 6% occur 2-10 times and 14% more than 10 times.
- the benefit of the inventive dividing segregating concerns those 20% which were not unique mapable before, 32-bp long sequence fragments in ⁇ crease the unique mapable window in the genome by just 5 %, to 85 ⁇ o .
- sample comprises at least two, preferably at least 3 even more prefera ⁇ bly at least 4, e.g. 5, 6, 7, 8, 9, 10 or more, at least 20, at least 50, at least 100, at least 1000 or at least 10 000 nucleic acid molecules.
- inven ⁇ tion sample comprises at least 2, 4, 5, 6, 7, 8, 9, 10 or more, at least 20, at least 50, at least 100, at least 1000 or at least 10 000 different nucleic acid molecules of different ori ⁇ gin .
- the fragments are divided into sub- pools wherein at least 10% of all subpools comprise the average amount of fragments of all subpools +/- 50%.
- the complexity reduction method is sufficiently used.
- further subpools may ex ⁇ ist wherein fewer fragments are present, e.g. even empty sub- pools without any fragment of the original pool which can be used as control reference.
- at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40% of all subpools comprise the average amount of frag ⁇ ments of all subpools +/- 50%.
- This error margin of +/- 50% is in preferred embodiment up to +/- 50%, up to +/- 45%, up to +/- 40%, up to +/- 35%, up to +/- 30%, up to +/- 25%, up to +/- 20%.
- the fragments are divided in sub- pools wherein at least 10% of a subpool containing 6, 4, 3 or 2 or less fragments, preferably 1 fragment.
- a high dilution is in particular favorable for fragments that would be hard to assemble if further fragments would be present from the original pool .
- the step of dividing the fragments comprises specifically amplifying the fragments from the original pool of nucleic acid fragments.
- the amplification is performed by nucleotide extension from a primer, preferably by PCR, in particular preferred wherein the am ⁇ plification is performed by using primers which select for at least one, preferably at least two, in particular at least two adjacent, different nucleotides or at least three or more dis ⁇ tinguishing nucleotides as described above after an unspecific primer portion whereby fragments are amplified which comprise the selected nucleotide as the nucleic acid feature specific for a subpool.
- Fragments of different subpools may e.g. be distinguished by spatial separation or by attaching a subpool specific label to each fragment of a given subpool. It is then possible to distin ⁇ guish fragments of different subpools during determining nucleo ⁇ tide sequences of fragments of combined pools. Alternatively nu ⁇ cleotide sequences of separate pools with or without attaching a label can be determined. This allows assigning fragment se ⁇ quences to a subpool depending on a subpool-specific label and overlapping sequences with other fragments, thereby reducing complexity while determining the sequence of the nucleic acids.
- subpool-specific labels or identifier are attached to the fragments.
- molecules that are derived from such subpool fragments can be labeled or iden ⁇ tifiers can be attached.
- the subpool-specific labels can be nu ⁇ cleotides, which are preferably co-determined during sequence determination .
- the fragments, but also the nucleic acids in another step, of the original pool are divided into at least 2, preferably at least 3, at least 4, at least 5, at least 6, at least 7, at least 8 subpools during the segrega ⁇ tion step, which fragments each share a different nucleotide characteristic for each subpool.
- primers or probes used for select ⁇ ing fragments in the segregation step are preferably immobilized on a solid surface, in particular a microarray or chip.
- the same type of segregation as described above for the distinguishing the nucleic acids can also be performed for distinguishing dif ⁇ ferent fragments during the sequencing step.
- the step of dividing the fragments into different subpools does not mean that each subpool has to be occupied, i.e. comprises one of the fragments. It is also possible that some of the subpools may remain empty, e.g. can be reference subpools.
- the dividing step, or segregation step is not neces ⁇ sarily absolute but can be relative. It also relates to dividing fragments through selective enrichment, i.e. amplification while non-selected fragments remain not amplified but still remain in the subpool sample.
- the number of occupied subpools is at least 5 times, preferably at least 10 times even more preferred at least 25 times, i.e. at least 30 times, at least 40 times, at least 50 times, at least 80 times, at least 100 times, at least 200 times, at least 300 times the number of nucleic acid molecules in the sample, in particular if these nucleic acid molecules are of a different sequence.
- the inventive method greatly benefits from increasing the amount of subpools in order to facilitate the alignment step of nucleic acid fragments that would align to multiple site of the original nucleic acid molecule, e.g. the genome.
- the fragmented sample comprises at least one such sequence fragment that cannot be uniquely aligned.
- nu ⁇ cleic acid sequence after sequencing only one subpool and align ⁇ ing, or joining the fragment sequences thereof.
- at least 2 at least 3, at least 4, at least 5, at least 8, at least 10, at least 12, at least 15, at least 20, at least 25, at least 30, at least 40, at least 45, at least 50, at least 60, at least 80, at least 100, at least 120 subpools are determined .
- sequences of the frag ⁇ ments and/or joined sequences are aligned by determining common overlaps or by alignment to a template sequence when joining the sequences of neighbouring fragment sequences. It is both possi ⁇ ble to obtain the joined complete sequence by either using a template, e.g. from a common nucleotide sequence data base and align the sequenced fragments to this template. On the other hand it is possible to join the sequences by determining over ⁇ lapping sequences, e.g. of fragments which are cut in a differ ⁇ ent fashion and provide the connection information of 3 ' and 5 ' ends of different fragments.
- nucleic acid molecule of the sample Preferably at least 2, at least 4, at least 6, at least 8, at least 10, at least 15, at least 20, at least 30, at least 40, at least 100 or at least 150 nucleic acid molecules are sequenced.
- Preferred sequencing methods comprise amplifying the fragments, or ampli ⁇ fying portions of these fragments and detecting each nucleotide type on each position with a label, a florescent nucleotide.
- Am ⁇ plification sequencing approaches can e.g. be automated as on a chip or micro array or on beads.
- the sample comprises at least 2 nu ⁇ cleic acid molecules with the same sequence, which are prefera ⁇ bly cut at different sites thereby providing different frag ⁇ ments.
- overlaps are obtained which can be used to join the sequences.
- Obtaining fragments which are cut at differ ⁇ ent sites can be e.g. by random, sequence independent cutting or by cutting using sequence independent endonucleases .
- a sample comprises at least 2 nu ⁇ cleic acid molecules of different sequences, in particular of different origins or at different concentrations.
- Fig. 1 coverage of a nucleic acid sequence by different fragment sizes.
- Fig. 2 General fragmentation and subpooling workflow, restricting the fragments of a polynucleotide sample to a certain number of subpools.
- Fig. 3 Application of the general principle in a Next gen ⁇ eration sequencing experiment.
- each subpool contains three classes of frag ⁇ ments .
- step 9 can be further advanced by as ⁇ sembling the contigs of step 9 (and the remaining reads) between the different subpools.
- Example 1 Reducing the complexity of a DNA sample
- DNA was extracted from a sample containing 3 x 10 5 human diploid cells.
- the DNA in the sample was fragmented to an average frag ⁇ ment size of lOkb by sonication.
- the fragments were dephosphorylated on their 5' ends by al ⁇ kaline phosphatase (to inhibit selfligation of the fragments in the following first ligation step) .
- the fragments were briefly denatured at 95°C and rapidly cooled on ice to provide single strands. Then a 5' phosphorylated single stranded Linker (L2rc; reverse complement to a L2 sequence) was ligated to the 3' -OH end of the fragments by T4 RNA ligase.
- L2rc linked fragments were phosphorylated on their 5' end by polynu ⁇ cleotide kinase and a second Linker (LI) was ligated to the 5'- phosphate end of the L2rc linked fragments by T4 RNA ligase.
- LI Linker
- the ligated fragments were size separated through electro ⁇ phoresis in an 0,5% agarose gel. Ligated fragments in the size range of 9-llkb are cut out of the gel and purified. This frac ⁇ tion represents a DNA content equivalent to about 1,5 x 10 2 cells .
- the 9-llkb fraction was amplified by long PCR using the LI and L2 sequences as primers to generate about lOOng of PCR prod ⁇ ucts .
- primers that contain the universal LI and L2 sequences and on their 3' end a number of n selective nu ⁇ cleotides can reduce the complexity of the sample by a factor of 4 n , were n was the combined number of selective nucleotides of both primers.
- n To be able to reduce the complexity of 1,5 x 10 2 cells below one haploid genome 4 n must be greater than 3 x 10 2 . Therefore n must be at least 5. When n was 7, the complexity was reduced by a factor of about 54, or in other words each subpool would represent about l/54th of a haploid genome equivalent.
- a segregating PCR was carried out to create the subpools for a set A.
- 70 subpools of a 16.384 subpool matrix (4 7 ) were created by 70 individual PCR reactions containing each one of 70 possible primer combinations of 7 primers with Ll-NNN (Ll- ACA, -TAC, -CTT, -GAT, -CAA, -TTG, -AGT) and 10 primer with L2-NNNN (L2-CACA, -GTAC, -GCTT, -CGAT, -GCAA, -CTTG, -CAGT , -AGCT, -TCTG, -TACG) .
- Set B consisted of a single sample that was amplified in a non- segregating PCR by using LI and L2 primers only. In each PCR reaction 27pg of DNA was amplified to about 500ng.
- each of the PCR samples was fragmented into fragments which are on average 200-600 bp long.
- Linkers (L3, L4rc) were ligated to the ends of the frag ⁇ ments, which are used to bind the samples to the flow cell, al ⁇ low for cluster generation and enable the hybridization of a sequencing primer to start the sequencing run.
- each L3 linker contained a subpool specific se ⁇ quence tag (barcode) to assign each sequencing read.
- Linker ligated fragments in a size range of 200-600 bp were size selected for sequencing.
- the 70 barcoded samples of set A were loaded on ⁇ to 2 channels of the flow cell by pooling 35 samples per chan ⁇ nel.
- the single sample of set B was loaded onto 2 channels of a second flow cell.
- cluster generation on a cBot Instrument (Illumina Inc., USA)
- a 76 bp sequencing run was carried out on a GenomeAnalyzer II (Illumina Inc.) for each flow cell. About 15 millon reads were generated per channel.
- the reads of set A were segregated into the respective sub- pools according to the different channels and according to the different barcodes (sequence tags) .
- a first assembly contigs were built by first aligning reads within each subpool and then assembling contigs and remaining reads within all subpools to ⁇ gether.
- a second assembly of set A contigs were built neglecting the sub-pool information.
- the average con- tig length of the first assembly was longer when contig building was done within each subpool first, compared to the second as ⁇ sembly, where the reads were not separated into subpools.
- a third assembly contigs were built using reads of set B. In com ⁇ parison the third assembly resulted in shorter contings than the second or the first assembly.
- Example 2 Reducing the complexity of an mRNA sample
- mRNA was extracted from a sample containing 12.000 human cells that contain on average about 0,6 pg mRNA. 3,6 ng of mRNA could be recovered and was fragmented to an average fragment size of 100 bases.
- a reverse transcription was carried out using random hexam- ers and reverse transcriptase to copy the cleaved mRNA fragments into cDNA.
- Second strand synthesis was carried out to remove the mRNA strand and synthesize a replacement strand to generate dou ⁇ ble stranded cDNA.
- cDNA ends were blunted by T4 DNA polymerase and Klenow DNA polymerase.
- an "A" base was added to the 3' end of the dsDNA fragments to create a single nucleotide over ⁇ hang.
- Adapters L5-L1-T and L6-L2-T with a 3' "T" base overhang were then ligated to the fragments.
- Ligation products were size separated through gel electrophoresis. Ligates in the size range of 200 ( +/- 25) bases were cut out of the gel and purified. This yields ligates with an cDNA insert content equivalent to an mRNA content of about 50 cells.
- Adapter ligated cDNA was amplified by PCR using L5 and L6 sequences as primers to generate about 500ng of PCR products.
- set A the sample was segregated into n subpools and set B (where a single nonseg- regating PCR was carried out) was analysed as a control.
- n was the combined number of se ⁇ lective nucleotides of both primers.
- 4 n must be greater than 50 x 30. Therefore n must be at least 6.
- each subpool has a 1/43 chance containing a transcript with a copy number below 30.
- Set B consists of a single control sample that was amplified in a non segregating PCR, using primers that contain only the universal LI and L2 sequences.
- the samples are then prepared for next generation sequencing on an Illumina Genome Analyzer II.
- Linkersequences (L3, L4) are added to the ends of the PCR products by 10 cycles of PCR using L3-L1 and L4-L2 primers, which are used to bind the samples to the flow cell, allow for cluster generation and enable the hybridization of a sequencing primer to start the sequencing run.
- the 22 samples of set A were loaded onto one channels of the flow cell by pooling the 22 samples per channel. Into a second channel the single sample of set B was loaded.
- set A When analyzing the sequencing data sets, set A contained reads that are not part of set B. These reads represent low copy number transcripts. Therefore set A encompassed low copy number reads that cannot be detected without segregation.
- Example 3 Reducing the complexity of an mRNA sample
- mRNA was extracted from a sample containing 24.000 human cells that contain on average about lpg mRNA. 12ng of mRNA could be recovered and was fragmented to an average fragment size of 400 bases .
- the fragments were dephosphorylated on their 5' ends by al ⁇ kaline phosphatase (to inhibit selfligation of the fragments in the following first ligation step) .
- the fragments were denatured at 92°C for 30seconds and rapidly cooled on ice to melt any sec ⁇ ondary structure. Then a 5' phosphorylated single stranded Link ⁇ er (L2rc+L6rc; 50nts) was ligated to the 3' -OH end of the frag ⁇ ments by T4 RNA ligase.
- L2rc+L6rc linked frag- ments were phosphorylated on their 5' end by polynucleotide ki ⁇ nase and a second Linker (L5+L1 ; 50nts) was ligated to the 5'- phosphate end of the L2rc+L6rc linked fragments by T4 RNA li- gase.
- L5+L1 and L2rc+L6rc linker representing about 120pg of mRNA that was equivalent to the mRNA content of about 120 cells.
- a reverse transcription was carried out copying 120pg of li ⁇ gated mRNA fragments using a primer that contains L6 (reverse complement to L6rc) to generate cDNA.
- 120pg of cDNA was amplified by PCR using the L5 and L6 as primers to generate about 500ng of PCR products.
- the PCR products are size separated through electrophoresis in an 6 ⁇ 6 polyacrylamid gel. Amplified fragments in the size range of about 475-525 bases were cut out of the gel and puri ⁇ fied .
- primers that contain the universal LI and L2 sequences and on their 3' end a number of n selective nu ⁇ cleotides can reduce the complexity of the sample by a factor of 4 n , were n was the combined number of selective nucleotides of both primers.
- n To be able to reduce the complexity of 120 cells below the mRNA content of one cell 4 n must be greater than 120. Therefore n must be at least 4.
- n was 7, the complexity was reduced by a factor of about 136, or in other words each subpool would represent about l/136th of the mRNA content equivalent of a single cell.
- a segregating PCR was carried out to create the subpools of a set A.
- 70 subpools of a 16.384 subpool matrix (4 7 ) are created by 70 individual PCR reactions containing each one of 70 possi ⁇ ble primer combinations of 7 primers with Ll-NNN (Ll-ACA, -TAC, - CTT, -GAT, -CAA, -TTG, -AGT) and 10 primer with L2-NNNN (L2-CACA, - GTAC, -GCTT, -CGAT, -GCAA, -CTTG, -CAGT, -AGCT, -TCTG, -TACG) .
- Set B consisted of a single sample that was amplified in a nonsegre- gating PCR by using LI and L2 primers only. In each PCR reaction 27pg of DNA was amplified to about 500ng.
- each of the PCR samples was fragmented into fragments which are on average lOObp long.
- Adapters 50bp were ligated to the ends of the fragments, which are used to bind the samples to the flow cell, allow for cluster generation and enable the hybridization of a sequencing primer to start the sequencing run.
- each adapter-pair contained a subpool specific sequence tag (barcode) to assign each sequencing read.
- Adapter ligated fragments in a size range of 175-225 bp were size selected for sequencing.
- the 70 barcoded samples were loaded onto 2 channels of the flow cell by pooling 35 samples per channel. After cluster generation on a cBot Instrument (Illumina Inc., USA), a 36 bp sequencing run is carried out on a GenomeAnalyzer II (Illumina Inc.) . About 15 million reads are generated per channel.
- the reads of set A were segregated into the respective sub- pools according to the different channels and according to the different barcodes (sequence tags) .
- a first assembly contigs were built by first aligning reads within each subpool and then assembling contigs and remaining reads within all subpools to ⁇ gether.
- a second assembly of set A contigs were built neglecting the sub-pool information.
- the average con- tig length of the first assembly was longer when contig building was done within each subpool first, compared to the second as ⁇ sembly, where the reads were not separated into subpools.
- a third assembly contigs were built using reads of set B. In com ⁇ parison the third assembly resulted in shorter contigs than the second or the first.
- the inventive method divides a pool of random fragments into different subpools. This greatly enhances the alignment and as ⁇ sembly of short reads, such as they are returned by next genera ⁇ tion sequencing platforms.
- a simple model pool of fragments (160-305 bases long) is used to show the difference between an alignment of reads (4 bases long) within the whole pool of fragments and when such an alignment is done within each separate subpool.
- Ten random sequences between 160 and 305 were generated using a Random Letter Sequence Generator
- CAGCAGG CGCA A A CAAAAGGGAAAGCCAGC CGCC AGACG CG CAA GG- TAGGTACTTTAATTTTTAGAGGGGCTTCCCCATGCTTTTGGAGATTGGCCTATCGGTAGTGAG- GATACCGGCCTCCACGCTGCGTGATGAGCACAATCATTGTTCTCGGAGACGGAGGACCCG- GAAGGTAACGAGCCCAAAGG CA CA ACCA A AGGGCGTAAC-
- the fragments were ordered into 16 (4x4) different subpools according to their terminal bases (tab. 3) .
- Table 3 Compilation of number of possible 4bp read alignments to fragments segregated into 16 subpools according to the termi ⁇ nal nucleotides of the fragments. When the alignment is done within each subpool 69 of 224 reads align uniquely to a frag ⁇ ment .
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a method for the reduction of the complexity of nucleic acid pool(s), comprising - providing a sample with one or more nucleic acid molecules, - cutting the nucleic acid molecules by a random and/or sequence independent cutting step thereby obtaining a pool of nucleic acid fragments, - amplifying one or more fragments of said nucleic acid molecules, wherein the one or more fragments constitute at least a fraction of all fragments of the nucleic acid molecules, and wherein the amplified or amplifying one or more fragments of said fraction are divided into different subpools, and wherein the fragments of each subpool comprise a common nucleic acid feature.
Description
Complexity reduction method
The present invention relates to the field of analyzing complex mixtures of nucleic acids through sequencing, especially high throughput sequencing techniques, such as Next generation Se¬ quencing (NGS) .
NGS is currently the foremost complete analyzing method. Next generation sequencing is a generic term for parallelized sequencing through polymerization as high-throughput DNA sequencing method. NGS reads sequences of up to many millions fragments which are typically between 10 to several hundred base-pairs long. The complete sequence is obtained by alignment of those reads which is a challenging task due to the sheer number of small reads that have to be assembled to a complete se¬ quence. Some NGS methods rely on a consensus blue print held in genomic and/or transcriptomic databases. The quality of the re¬ sults depends on length and number of reads, reading accuracy, quality of information in the reference database and applied bi- oinformatics algorithms. To date many reads provide just limited information. For instance many of the reads cannot be assigned uniquely and therefore are discarded.
In more detail, for generating detectable signals most NGS approaches must amplify individual DNA molecules. Emulsion poly¬ merase chain reaction (PCR) isolates individual DNA molecules using primer-coated beads in aqueous bubbles within an oil phase. Singularizing of DNA molecules, e.g. by rigorous dilution is another option. Another method for in vitro clonal amplifica¬ tion is bridge PCR, where fragments are amplified upon primers attached to a solid surface. Another option is to skip this am¬ plification step, directly fix DNA molecules to a surface. Such DNA molecules or above mentioned DNA coated beads are immobi¬ lized to a surface, and sequenced in parallel. Sequencing by synthesis, like the "old style" dye-termination electrophoretic sequencing, uses a DNA polymerase to determine the base se¬ quence. Reversible terminator methods use reversible versions of dye-terminators, adding one nucleotide at a time, detecting flu¬ orescence at each position by repeated removal of the blocking group to allow polymerization of another nucleotide. Pyrose- quencing also uses DNA polymerization, adding one nucleotide
species at a time and detecting and quantifying the number of nucleotides added to a given location through the light emitted by the release of attached pyrophosphates. The sequencing by li¬ gation method uses a DNA ligase to determine the target se- quence . Used in the polony method and in the SOLiD technology, it employs a partition of all possible oligonucleotides of a fixed length, labeled according to the sequenced position. Oli¬ gonucleotides are annealed and ligated. The preferential liga¬ tion by DNA ligase for matching sequences results in a dinucleo- tide encoded colour space signal at that position.
NGS technologies are essentially based on random amplifica¬ tion of input DNA fragments. This simplifies preparation but the sequencing remains undirected. The sheer complexity of the com¬ plete sample information simultaneously obtained, is the key hindrance for unambiguous alignment of the reads. Therefore, complexity reduction is essential for increasing the quality of the results.
The classical route for genomic complexity reduction, i.a. employed during the human genome project, is to create BAC (bac¬ terial artificial chromosome) clones prior to sequencing. Dis¬ tinct stretches of genomic DNA are cloned into bacterial host cells, amplified, extracted and used as templates for Sanger se¬ quencing. Production, maintenance and verification of large BAC libraries are laborious processes and associated with apprecia¬ ble costs. Due to these impracticalities and the incompatibility with existing NGS platforms it is generally sought to avoid bac¬ terial cloning.
Another option to reduce complexity is to first select poly- nucleic acids based on their respective sizes. Different ap¬ proaches include, but are not limited to, agarose gel electro¬ phoresis or size exclusion chromatography for fractionation.
Small RNA sequencing approaches employ this method in order to obtain e.g. a fraction of RNA molecules called micro RNA
(miRNA) sized between 15 and 30 nucleotides.
The probably most straightforward approach of complexity re¬ duction is by limiting the amount of input nucleic sample to the genomic DNA of a single cell. Single-cell sequencing approaches rely on amplification reactions from highly dilute solutions, are incapable of actually reducing the complexity inherent to cellular content and are based solely on a selection of the in-
put cells.
A different method for reducing the amount of input nucleic acid to below the amount contained within a single cell some¬ times is termed limited dilution. A genomic nucleic acid sample is sheared and diluted to an extent where spatial distribution of the nucleic acid fragments within the sample volume becomes significant. Then subpools are created by taking such small vol¬ umes from the total sample volume that most subpools contain no nucleic acids, a few subpools contain one nucleic acid each and even less subpools contain two nucleic acids. This leads to a singularization of nucleic acids and therefore to complexity re¬ duction compared to the full length genome as each singularized nucleic acid is a fragment of a genome. Therefore an increased sequence assembly efficiency for the individual nucleic acid fragment containing subpools is gained. Assembly and scaffold building for large genomes thereby is facilitated. In transcrip¬ tion analysis such a limited dilution approach will not reduce complexity introduced through variations in expression of dif¬ ferent genes as each transcript molecule will occupy one subpool and therefore as many subpools are needed as molecules in the sample to display the entire transcriptome of a sample.
A further option is to sequence-specifically reject RNA, e.g. in a hybridization-based approach that removes ribosomal RNA from the entire RNA sample. As opposed to other fractiona¬ tion methods that rely either on prior sequence information or are directed towards a certain RNA fraction (e.g. polyA selec¬ tion), removal of rRNA does not bias the sequencing sample. How¬ ever, the mere removal of ribosomal RNA is restricted to RNA samples and cannot be scaled in terms of complexity reduction.
The duplex-specific nuclease (DSN) method can be used for selectively removing double stranded DNA from the sample solu¬ tion. This is achieved by letting the single stranded sample in¬ teract with excess driver DNA. Driver DNA is made up of se¬ quences designed to remove their targets from the original sample. Upon interaction duplexes are formed, degraded by DSN and the remaining sample may be used for subsequent sequencing. Normalization of sample concentrations may be achieved by amplification using "partial PCR suppression". This method is not "hypothesis neutral" as it requires preparation of PCR fragments as driver DNA, and therefore prior sequence
information .
It is also possible to employ sequence-specific selection methods, e.g. by targeted sequencing of genomic regions such as particular exons . The idea behind such capture arrays is to in¬ sert a selection step prior to sequencing. Those arrays are pro¬ grammed to capture only the genomic regions of interest and thus enabling users to utilize the full capacity of the NGS machines in the sequencing of the specific genomic regions of interest. Low density, on array capture hybridization is used for sequenc¬ ing approaches. Such technology is not hypothesis neutral, as specific sequence information is required for the selection pro¬ cess.
A similar positive selection can be used for targeted re- sequencing. E.g. biotinylated RNA strands of high specificity for their complementary genomic targets can be used to extract DNA fragments for subsequent amplification and sequence determi¬ nation. This form of complexity reduction is necessarily based on available sequence information and therefore not hypothesis neutral .
Sequencing of 16S rDNA or 16S rRNA sequences from mixed samples of microorganisms is i.a. employed for detection of rare species within these samples. By restricting the sequencing approach to a specific signature of microorganisms both complexity and information content are reduced. Frequently only phyloge- netic information is obtained.
Tag-based identification of transcripts includes SAGE (Se¬ rial Analysis of Gene Expression) wherein sequence tags of de¬ fined length are extracted and sequenced. Since the initial creation of tag concatemers is a disadvantage for NGS, derived protocols are used omitting this step.
A related method is CAGE (Cap Analysis of Gene Expression) . CAGE is intended to yield information on the 5' ends of tran¬ scripts and therefore on their respective transcription start sites. 5' cap carrying RNA molecules are selected before end- tags are extracted and sequenced.
Although only defined parts of the transcriptome are ex¬ tracted for analysis SAGE and CAGE have their limitations be¬ cause they do not allow for comprehensive segregation.
Several methods for interaction-specific enrichment of the genome exist. ChlP-seq is one of several approaches to extract sequences based on their respective affinities to specific pro-
teins (frequently transcription factors) . The associated DNA is immuno-precipitated, purified and sequenced. Only a very limited amount of questions is amenable to this approach.
Amplification-driven selection methods (like PCR and isothermal amplification) rely on the specific interaction of DNA oligonucleotides with their respective target DNA. E.g. bioin- formatics-selected hexamers that serve as primers can be used for competitive amplification procedures. Such an approach does neither cover the full genome nor is the method scalable in terms of complexity reduction.
Another possibility is selective amplification of a subset of genomic DNA using a circularization approach. In this case a construct including a general primer pair motif which is flanked by two target-specific ends is used. Upon hybridization, liga¬ tion to the single stranded target sequence and amplification of the selected polynucleotide using a single primer is possible. Molecular Inversion Probe Capture (derived from initially termed "Padlock Probes") is used to select sub-sets of genomic DNA. This approach is not hypothesis neutral and limited in scalabil¬ ity.
Hypothesis neutral preparations of genomes that reduce the complexity of the sample have been disclosed in WO 2006/137734 and are based on AFLP technology (EP 0534858) . For covering the whole genome a multitude of restriction enzymes must be used. This is laborious, introduces redundancy and still covers the genome only statistically as the pool of restriction fragments may or may not be completely sequenced due to the variability in restriction site distribution.
WO 2007/073171 A2 relates to a method of sequencing cDNA comprising a complexity reduction step by fragmenting cDNA by controlled endonuclease restriction enzymes. Thus, this method is dependent on the presence of proper endonuclease restriction sites in the cDNA sequence and always yields the same fragments for a given cDNA.
WO 2009/073629 A2 describes a shotgun sequencing methods to reduce redundancy in high genome coverage. Nucleic acids are fragmented mechanically or by ultrasound to produce a first shotgun library. The fragments of the first shotgun library are sequenced and the sequence reads are assembled. In a second step, target specific oligonucleotides are synthesized, specific
for regions of interest such as locations of single nucleotide polymorphisms, and complexed with the target nucleic acids.
WO 2008/093098 A2 relates to a method for sequencing nucleic acids of at least two samples comprising randomly fragmenting the nucleic acids, ligating universal adaptors to the fragments and amplifying all nucleic acids for sequencing.
WO 2009/116863 A2 describes a method for identifying genomic DNA comprising the steps of generating a cDNA, an optional complexity reduction step, fragmenting the cDNA, optional size se¬ lection of the fragments, adaptor ligation, a further size and fragments selection steps, and binding to beads, among many further mandatory steps. This method is work intensive and simpli¬ fication of complexity reduction for specific uses would be ben¬ eficial .
Therefore there is the need of methods that can provide for defined fractions of a nucleic acid sample and provide for means to improve sequencing processes, in particular for improving the assembly of sequences, and for the detection of rare nucleic ac¬ id samples e.g. in pools stemming from many organisms or genomes of high concentrations which reduce the chance to obtain se¬ quences of rare nucleic acids.
Therefore, the present invention provides in a first aspect a method for the reduction of the complexity of nucleic acid pool (s) , comprising
• providing a sample with one or more nucleic acid molecules,
• cutting the nucleic acid molecules by a random and/or se¬ quence independent cutting step thereby obtaining a pool of nucleic acid fragments,
• amplifying one or more fragments of said nucleic acid mole¬ cules, wherein the one or more fragments constitute at least a fraction of all fragments of the nucleic acid mole¬ cules, and wherein the amplified or amplifying one or more fragments of said fraction are divided into different sub- pools, and wherein the fragments of each subpool comprise a common nucleic acid feature. Thus, for each subpool all fragments share the same nucleic acid feature. This same or common nucleic acid feature of course may differ between the separate subpools.
In this context, "amplified or amplifying" means that the one or more fragments, including amplified copies thereof, can
be divided into the different subpools after and/or during an amplification reaction. The "fraction" refers to the portion or amount of the one or more fragments obtained in the cutting step that are further processed in the amplification and dividing step .
The inventive method can reduce the complexity of a sequence assembly by reducing the amount of sequence portions that have to be joined. In addition, rare (and even unknown) nucleic acids can be identified in the presence of highly abundant nucleic ac¬ ids, since generally more nucleic acid fragments become detect¬ able in the background of other fragments. Ultimately, such a method may facilitate the determination of rare genomes, or parts thereof, within a sample of abundant genomes. The method can further reduce the complexity of transcriptomic samples to such a degree that rare transcripts can be detected within the main competing signal of all other, possibly highly abundant transcripts. It is possible to measure quantitatively sequences and fragments thereof from the very rare to the highly abundant ones .
In particular the present invention provides for improved handling and sorting of nucleic acids contained in a pool of nu¬ cleic acids, e.g. for sorting or labelling purposes depending on a common nucleic acid feature of individual nucleic acids of the pool. In particular the present invention facilitates the sepa¬ ration of nucleic acids, each sharing said common nucleic acid feature into different subpools. Such a nucleic acid feature can e.g. be a shared sequence portion as will be elaborated more in detail below.
Central to the present invention is that in random or se¬ quence independent cutting steps each nucleic acid molecule will be cut differently. This means that each nucleic acid molecule having the same sequence (being e.g. of a completely identical sequence or sharing a identical sequence portion) will be cut differently, thus resulting in a pool of different and very di¬ verse fragments, sharing the same parent nucleic acid sequence. These fragments may have overlapping portions to fragments of different cutting events. In fact, this is an important crite¬ rion for sequence alignment if no prior sequence information is available to facilitate the alignment of sequence portions to a joined sequence. On the other hand, this random fragmenting se-
quence diversity greatly increases complexity of the sum of all fragments that have to be handled and eventually be sequenced. The present invention now reduces this complexity and helps to assign and sort the fragments into different subpools comprising a common nucleic acid feature. This is done by the amplification step, wherein fragments with the same parent nucleic acid se¬ quence are divided into different subpools depending on the com¬ mon nucleic acid feature. Of course not all fragments have to be sorted, e.g. for sequence determination approaches it is possi¬ ble and also sufficient to only use a fraction, e.g. sequences or nucleic acid fragments of a defined length. Thus, it is also possible to only amplify and process a fraction of all frag¬ ments .
Usually during random fragmenting many diverse fragments are obtained. This diversity is still represented to some extend in the divided subpools - but of course with reduced complexity. The subpools thus usually contain a multitude of different frag¬ ments, at least more than one. Thus, the present invention can also be defined as a method for the reduction of the complexity of nucleic acid pool (s) , comprising
• providing a sample with one or more nucleic acid molecules,
• cutting the nucleic acid molecules by a random and/or se¬ quence independent cutting step thereby obtaining a pool of nucleic acid fragments,
• amplifying at least a fraction of said fragments, and where¬ in the amplified fragments, or during amplifying of said fragments the fragments of said fraction, are divided into different subpools, and wherein the fragments of each sub- pool all share the same nucleic acid feature and a subpool comprises more than one fragment. The subpools may comprise many diverse fragments such as at least 2, 3, 4, 5, 6, 7,
8, 9, 10, 20, 30, 40, 50 or more different fragments - of course all sharing the same nucleic acid feature.
The invention can also be used to improve the alignment of large numbers of individual sequencing reads to determine the sequence of nucleic acids and/or their copy number. Preferably the inventive method further comprises determining the sequences of the fragments for one or more subpools, further preferably comprising processing the sequences of a first sub-pool by aligning sequences or partial sequences of the fragments of the
first sub-pool and join neighboring or overlapping sequences thereby obtaining a joined sequence, and optionally repeating the processing steps for one or more further subpools, wherein the sequences of the fragments of each further subpool are aligned and joined with the sequences of fragments and/or joined sequences of all previously processed subpool sequences, until a continuous sequence of at least one nucleic acid molecule of the sample is obtained.
When the length of the fragments of one or more subpools is above the length of the reads that are generated during the se¬ quencing run, it is preferred that reads are also generated from within the fragments. Therefore the fragments of one or more subpools can be cut sequence dependent or independent by any means known to the art, or partial copies can be generated from such fragments that are sequenced. In another embodiment only partial sequences are generated during the sequencing run it¬ self, e.g. by random priming each of the individual fragments of a subpool to start the sequencing. Therefore partial sequences of fragments of one or more subpools are generated. The align¬ ment or assembly greatly benefits from first aligning or assem¬ bling (joining) such partial sequences within a subpool. There¬ fore the present invention also encompasses an embodiment where¬ in the fragments of at least one subpool are further cut, op¬ tionally sequence dependent or sequence independent, preferably into fragments of from 10 to 5000, more preferred 12 to 1000, further preferred of from 15 to 500 or 17 to 100 nucleotides length .
In preferred embodiments of the present invention the nu¬ cleic acid molecules are DNA molecules, in particular genomic DNA. It is further possible that the nucleic acid molecules are RNA, in particular RNA transcripts like mRNA, but also siRNA, snoRNA or microRNA. However, in preferred embodiments the nucleic acid molecules are large enough to yield a fragment size of at least 50, at least 80 or at least 100, at least 1,000 or at least 10,000 nucleotides.
Nucleic acids are linear polymers of single nucleotides. These molecules carry genetic information (see triplet code) or form structures which fulfill other functions in the cell (e.g. regulation) . The nucleic acids which are related to this inven¬ tion are deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) .
The genome is the inheritable information encoded in DNA (or, for some viruses, RNA) . The genome includes genes and non-coding sequences. Genomics is the study of the genomes of organisms.
The transcriptome is the set of all RNA molecules, or "tran¬ scripts," produced in cells. Unlike the genome, which is roughly fixed for a given cell line, the transcriptome varies with the kind of cell, tissue, organ and the stage of development. It can alter with external environmental conditions. Because it in¬ cludes all RNA transcripts in the cell, the transcriptome re¬ flects the genes that are being actively expressed at any given time, and it includes degradation phenomena such as transcrip¬ tional attenuation. Transcriptomics is the study of transcripts, also referred to as expression profiling.
The core principles of the method is similar for the analy¬ sis of genomic and transcriptomic data.
Genomic DNA is characterized through one or a few long mole¬ cules (chromosomes) . This disclosed method describes how random¬ ized sheared DNA can be sorted into a series of different sub- pools e.g. via termini selective amplification. Afterwards, the subpools are processed and sequenced.
The subpooling of transcript pools can be achieved through subpools with different additional information content. The gained benefits depend on the chosen methods.
A "nucleic acid molecule" according to the present invention shall be understood as a molecule having a certain sequence, shared by other nucleic acid molecules. In particular since the present invention aims at reducing the complexity of a pool of different cutting events (random fragmentation) , the present invention aims at sorting and analyzing different cutting events of identical sequences comprised in nucleic acid molecules. This means that in the sample with one or more nucleic acid molecules multiple copies of said sequences are present. Such samples can e.g. comprise multiple copies of the same nucleic acid, comprise one nucleic acid with multiple copies of said sequence or mix¬ tures thereof. The nucleic acid molecules of the present inven¬ tion, in particular the common sequences thereof, may have an average nucleotide length. The nucleotide length as well as the copy number directly correlate with the complexity of the nu¬ cleic acid pool to be processed by the present invention. In a particular preferred embodiment a sufficient common nucleic acid
feature is selected to facilitate a suitable complexity reduc¬ tion. E.g. the number of subpools, each comprising at least one fragment, is created and a number of nucleic acid molecules in the sample times the fraction of the amplified fragments (the portion, e.g. percentage, of the fragments that are amplified from the original pool of nucleic acid fragments after the cut¬ ting step) . In another embodiment it is preferred that a com¬ bined length of the fragments of at least one subpool is less than the average nucleotide length of the nucleic acid molecules (e.g. the sequence repeats of the randomly cut nucleic acid of the sample) . It is particular beneficial if the size of the sub- pools is sufficiently small to allow an easier sequence determi¬ nation and following sequence alignment procedure, in particular if the copy number of the original sample of the analyzed se¬ quence is quite large.
The original sample can e.g. be a sample of cellular nucleic acid molecules as obtained after isolation, e.g. a sample of 1,000 diploid cells from one organism leads to 2,000 genome cop¬ ies, which are all differently cut, or the sample may comprise nucleic acid molecules as obtained after e.g. PCR or any other amplification. The inventive segregation step for dividing the fragments of the amplified fraction into different subpools, systematically reduces the amounts of the fragments to be ana¬ lysed and thus the complexity of the system. In preferred em¬ bodiments the numbers of subpools comprising at least one of the fragments is greater than the number of nucleic acid molecules in the sample and /or lower than the total amount of fragments per nucleic acid molecule in the sample.
To select the fraction of amplified fragments - or likewise for dividing (also referred to as segregation) fragments into different subpools during or after amplification, nucleic acid properties as distinctive nucleic acid feature which are di¬ rectly or indirectly sequence related can be exploited. Such properties are for example the affinity to adsorbing materials like various column materials (e.g. silica gel) or the solubil¬ ity in the presence of salts, polymers or other additives. In such indirect sequence related segregation the required informa¬ tion on the sample nucleic acids is limited, e.g. precipitation depends predominantly on length, the GC-content and secondary structures. The distinctive nucleic acid feature can be an ad¬ sorption or solubility property. Such properties and/or nucleic
or solubility property. Such properties and/or nucleic acid size are preferably used to (optionally) select a fraction to be am¬ plified .
Alternatively or in addition, subpools or fractions can be generated through methods which utilize distinctive sequence in¬ formation like i) partial internal or terminal sequences or ii) nucleic acid size. Preferably such sequence portions are used to divide fragments into subpools.
i) Using distinctive sequences is the most powerful segrega¬ tion tool. E.g. a distictive nucleic acid feature can be a par¬ tial sequence of the nucleic acids or their fragments stemming from the template nucleic acid molecules such as RNA or cDNA or (genomic) DNA (portions) . The distinctive sequence can be a sin¬ gle nucleotide type (e.g. selected from A, T, U, G or C) or more at a specific position within the nucleic acids or fragments to be segregated. E.g. nucleotides can be segregated for the pres¬ ence of one or more nucleotide types or sequences at either the 5' or 3 ' terminus or in a given distance from said terminus. On one hand an array of hybridization probes, which covers one or more sequence possibilities of said distinctive portion of the nucleic acid, can be used to create subpools. Even if subpools contain different nucleic acid fragments and some nucleic acid fragments will be present in several subpools, such a segrega¬ tion approach already reduces the complexity of the original pool. After collecting all reads preferably the alignment algo¬ rithm ensures, that all nucleic acids display at least one sub- pool specific sequence.
Segregation by selecting for a distinctive nucleic acid fea¬ ture like a distinctive sequence can be performed by either se¬ lecting such nucleic acids or fragments with the distinctive se¬ quence or by specifically amplifying nucleic acids or fragments with said distinctive sequence and further utilizing these am- plificates in the inventive method.
A preferred segregation method uses the sequence information of both termini, thus start and end site of the nucleic acid fragments. After termini-specific amplification and if the re¬ dundancy in the sequence specificity is zero (no mismatch al¬ lowed) , then all subpools contain amplificates , e.g. PCR prod¬ ucts, with exactly those termini. Hence, subpools can contain several transcripts but each transcript can only be presented in
one subpool. By this means, the complexity of the alignment pro¬ cedure is largely reduced.
ii) The nucleic acid size can be exploited to segregate the nu¬ cleic acid according to the number of nucleotides per transcript via electrophoresis techniques (gel or capillary electrophore¬ sis) , or other methods. The later alignment of the different reads per subpool can benefit from the boundary condition of a certain rather narrow size range.
It is also possible to first divide the nucleic acids into subpools due to a common nucleic acid feature and then perform the cutting step without or with the preferred further division of the fragments. Everything mentioned herein for dividing nu¬ cleic acids also applies for dividing the fragments and vice- versa .
The step of dividing a fragment into different subpools can be performed by any known means. This division is generally a qualitative division that leads to a quantitative reduction of the total number of fragments in each subpool. This means that substantially all fragments of a certain kind (sequence) are segregated into one particular subpool. "Substantially" means that a high efficiency of this division is preferred, e.g. about at least 90 %, 95% or 99%, in particular preferred 99.9 % of the fragments of one kind are segregated. "Dividing" as used herein also refers to specifically amplifying the fragments of one kind so that the segregated fragments (in total) constitute at least about 90 %, 95 %, 99 % or at least 99.9 % of the fragments of the subpool. In preferred embodiments this division step, also referred to as segregation step, can be in a sequence dependent manner or sequence independently. Likewise, selecting a fraction of the fragments for amplification can be sequence dependent or sequence independent. As mentioned above, sequence independent means include separation according to physical parameters like absorption or solubility. Sequence dependent means include seg¬ regation by a size of the fragments or for a specificity for certain sequence portions.
The phrase "comprising" shall be understood in the meaning of "having at least the following elements..." and is therefore open and does not exclude additional limitations. According to the invention each subpool comprises fragments with a common nu¬ cleic acid feature. This means that a subpool may comprise more
than one, e.g. two, three, four or more, fragments with differ¬ ent nucleic acid features. Dividing (or also referred to as seg¬ regating) during or after amplification thus means that e.g. the fragments of more than one common nucleic acid feature can be selected or amplified for a given subpool (subpool mixture) . The inventive complexity reduction can be achieved by performing the inventive selection for certain nucleic acid features, even if performed simultaneously. An example of obtaining subpool mix¬ tures in one step according to the present invention is e.g. by multiplex PCR, using primers selecting for more than one nucleic acid features in one reaction. However, although there is suffi¬ cient complexity reduction in the generation of subpool mix¬ tures, it is preferred that a subpool contains the fragments with one common nucleic acid feature used in the dividing or segregation step. Also preferred is when subpooling excludes the complete (undivided) pool of all nucleic acid molecule frag¬ ments .
In preferred embodiments of the present invention the step of dividing the fragments comprises selecting one or more frag¬ ment (s) with a common nucleic acid feature, preferably the pres¬ ence of the same one or more nucleic acid type(s), selected from A, T, U, G or C at the same position for each subpool. In a particular preferred embodiment of the present invention the nu¬ cleic acid feature used for segregation is a given nucleotide type, preferably selected from any one of A, T, U, G, C, at a certain position in the fragment, preferably the position being within 100 nucleotides from either the 5' or 3 ' terminus of the fragments. Such methods that select for one specific
nucleotides, e.g. to obtain a full length sequence source, are disclosed in the WO 2007/062445 (incorporated herein by
reference) . A nucleotide or nucleotide sequence used for
segregation may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more, e.g. up to 20 or up to 100 nucleotides. According to the present invention it is possible to amplify or select for specific fragments in a segregation step by using, e.g. a primer, which is specific for e.g. one end (either the 3' or 5 ' end) of the nucleic acid and containing one or more further nucleotides specificities which act to segregate the fragments according to the complementary nucleotides after a universal sequence portion on the primer. Such universal sequence portions, that allow a primer to hybridize specifically at the ends of nucleic acid
at the ends of nucleic acid fragments, can be introduced artifi¬ cially e.g. by ligating oligonucleotides to the ends of all fragments after the fragmentation step. Of course two different universal sequences can be used, one specifying a 5' and one specifying a 3' end. Another method to introduce universal se¬ quence portions is to copy the pool of fragments by primer ex¬ tension using primers, that have on their 5' end the universal sequence portion and on their 3' end random nucleotides, such as random hexamers or nonamers that can randomly hybridize to frag¬ ments of the pool. In RNA analysis for instance such an approach can be used to introduce such a universal sequence during re¬ verse transcription. In the segregation step the primers have a universal sequence portion, that is complementary to the ends, preferably ether to the 5' or 3' ends, of all fragments, and ad¬ ditional nucleotides that are selective for the next 1 to 100, preferably 1 to 10 nucleotides, e.g. the next 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. By using wobble nucleotides in the selective part of said primers it is also possible to select for specific nucleotides after these ends. Preferably the specific distinguishing nucleotides are within the first 100 nucleotides from either the 5' or 3 ' terminus of the fragment. It is of course also possible to use primers to select any internal re¬ gion used to divide the fragments in the segregation step.
The same principle mentioned above for primers of course also applies for oligonucleotide probes which can be specific for such a distinguishing nucleotide type.
In cases where a universal sequence (e.g. of a linker) is present or has been introduced to allow for a primer to hybrid¬ ize, the term terminal nucleotides or the word termini or termi¬ nal specifies nucleotides or sequence portions (ether 5' and/or 3' ) that are next to, and exclude, these universal sequence por¬ tions. These universal sequence portions can be added artifi¬ cially as linkers or be a common hybridizing region mentioned above. Other universal sequences which are not used as nucleic acid feature in the segregation step can be natural repeat re¬ gions such as a poly-A tail of mRNA (or the corresponding poly-T stretch in its cDNA) . Preferably, if a fragment contains such tails, a nucleic acid feature adjacent to the universal sequence is selected for segregation.
Preferably, the fragments are selected for common nucleo-
tides within the 10 nucleotides next to the 5' and/or 3' termi¬ nus, preferably for one or more common 5' and/or 3 ' terminal nu¬ cleotide types.
These primers or probes preferably are used in combination with primers or probes which are selected for a different nu¬ cleic acid feature. Such primers can e.g. be used separately or sequentially to generate subpools specific for nucleic acid fea¬ ture. Such primers or oligonucleotides used in a combination (i.e. "primer matrix") can e.g. be primers which have a universal part and a distinguishing part wherein the distinguishing part is e.g. A in the first primer, T in the second primer, G in the third primer and C in the fourth primer. Preferably, more than one nucleotide is used as the nucleic acid feature and the combination can e.g. be primers or oligonucleotide probes ending with AA, AT, AG, AC, TA, TT, TG, TC, GA, GT, GG, GC, CA, CT, CG, or CC (with the complementary nucleotides being distinctive nu¬ cleic acid features at a certain position in the fragments as criteria to separate the subpools) . In a further preferred em¬ bodiment the nucleic acid feature contains 3 or more, e.g. 4, 5, 6, 7, 8, or more specific nucleotide types. Of course, due to the random nature of fragment generation, it is usually not nec¬ essary to determine all possible subpools. It can be sufficient to only select 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12, seldom more, subpools after such a sequence dependent (or independent) segregation. Preferably 1% to 75% of the subpools are used for sequencing, preferably 5% to 50%. In a further preferred embodi¬ ment combinations of primers are oligonucleotides selecting for distinguishing nucleotides at both the 5' and/or 3' terminus, e.g. using both primers or probes being specific for the two or more 5' nucleotides and the two or more 3' nucleotides.
As mentioned above it is also possible to select for inter¬ nal regions wherein it is also possible to use a combination of such a primer pair which selects for two nucleotide types on each side of the amplificate.
Usually, the samples used for the inventive method contain potentially diverse nucleic acid molecules of different origins or different sequence in diverse concentration ranges. These factors contribute to the complexity of the sample. Furthermore, fragmentation, usually of all nucleic acids, to provide short molecules suitable for NGS increases diversity and complexity of
the sample pool. Modern sequencing approaches however, always contain a random factor which sequences are further processed. In particular next generation sequencing relates to generating sequence portions, called reads of small sequence fractions in the range of about 10 to several 100 nucleotides (nts) or even up to 500 nts, usually in the range of about 30 nts. In complex samples this has always the drawback that the transcript or ge¬ nomic fragments of low concentration may be not sequenced in a parallel run in favour of fragments from transcripts or genomes of high copy numbers.
The invention concerns the preparation of nucleic acids suitable for downstream NGS . It is applicable for high- throughput sequencing of genomic and transcriptomic information. It provides major improvements for the unambiguous alignment of said reads.
It is also possible to ligate or join fragments to each oth¬ er prior to sequencing - in particular if the fragments have been labeled to identify the fragment sequence in the ligated product. It is preferred that such joined fragments are inter¬ spersed by different sequence stretches that allow sequencing primers to prime consecutive rounds of sequencing.
The general principle is to reduce the complexity of a pool of nucleic acid fragments by sequencing smaller segregated por¬ tions after the inventive division into smaller portions called subpools. In a preferred embodiment all subpools together con¬ tain the whole information to be analyzed of the original pool. There are three main factors that contribute to the complexity of nucleic acid pools.
The first factor is determined by the combined length of the individual different sequences. Because the sequence is encoded through 4 bases (T and U are considered to represent the same information) the complexity increases with the variation, equal to the length to the power of four. However, sequences contain redundant information like repeats or any other kind of order. The total value of information is quantifiable using e.g. Shan¬ non's information theory. While the raw information can only be deciphered through sequencing, the complexity which is intro¬ duced through repeats can be reduced by segregating the individ¬ ual fragments before sequencing.
The second factor is determined by the number of different
sequences within a sample. The complexity increases with the number of permutations, therefore with the factorial of differ¬ ent sequences. Two sequences have two possibilities to arrange, three sequences have six possibilities and so forth.
The third factor is the difference in copy numbers and to lesser degree the amount of precognition about these differ¬ ences, e.g. if it is known that the difference is in the order of 1/1,000. Each different sequence belongs to a group which is characterized of having one particular copy number. The level of distribution of these groups determines the complexity which is introduced through concentration differences.
The inventive segregation can help to distinguish different nucleic acids of the original sample pool or of the fragments. This segregation step can also be repeated once or more. Repeti¬ tion herein shall not be interpreted that additional segregation steps have to be performed after the first segregation step - which is of course one option - but also relates to preforming one or more segregation steps simultaneously. Thus, one or more subpools are generated and in each subpool specific nucleic ac¬ ids are present (or enriched) which share a common feature and all other nucleic acids without that shared distinctive nucleic acid feature can be excluded from each pool (or at least are not enriched, e.g. by amplification).
These factors contribute directly to the difficulty of de¬ termining the correct sequence and concentration of all and in particular rare molecules within a sample. The general principle of the present invention is the constituting of subpools where these factors can be controlled, and simultaneously the complex¬ ity of the pool reduced, before reads are generated. Thus, the method simplifies the in-line sequence alignment to provide joined sequences.
The genome contains one or several long DNA molecules (Chro¬ mosomes) . In general, the genome is one very long word written with four letters. To be able to sequence this long word smaller portions are necessary. The pool of fragments is divided into subpools. One way of creating a pool of polynucleotides is using one or more restriction enzymes to cut all copies of a genome (e.g. 1,000). In diploid eukaryotic cells two different genomic molecules for each chromosome pair contribute to the DNA pool. For example, if a genome has 109 nucleotides (1Gb) and restric-
tion enzyme (s) would cut 1,000 genomes on average after lOkb, then one pool with 100,000 different polynucleotides would be created with each polynucleotide being present 1,000 times too.
If only one restriction enzyme is used then the assembly the full length sequence is not possible because no overlaps occur for defining the order of the fragments. Therefore, at least 2 pools of the same DNA have to be cut, each with another restric¬ tion enzyme, and sequenced in order to assemble the full length sequence of the Genome (or Chromosomes) . Therefore segregating strategies that depend on specific amplification (PCR) will cov¬ er only parts of the original pool. In most cases more than 2 pools of the same DNA must be processed through restriction en¬ zymes, subpooled and sequenced to assemble a genome.
Therefore according to the present invention the cutting step is random and/or sequence independent, preferably by physi¬ cal means, in particular preferred by sonication, shearing or elevated temperatures. This results in different fragments stem¬ ming from the same nucleic acid sequence. A fragment is consid¬ ered a nucleic acid portion of shorter length than the complete nucleic acid molecule from which it is derived. In preferred em¬ bodiments the nucleic acid molecules are cut into fragments of from 10 to 200 000 nucleotides length, preferably of from 50 to 100 000 nucleotides length. Any ranges therein are of course al¬ so possible. The nucleic acid molecules can e.g. be cut into fragments of at least 10, at least 20, at least 30, at least 40, at least 50 nucleotides were up to 200 000 up to 150 000, up to 120 000, up to 100 000, up to 80 000, up to 70 000, up to 60 000, up to 50 000, up to 40 000, up to 30 000, up to 20 000, up to 10 000, up to 8000, up to 6000, up to 5000, up to 4000, up to 3000, up to 2000, up to 1000 nucleotides length. Subpools can be created through randomly cutting a DNA sample into fragments of approximate length, e.g. lOkb (kilobases) . Such cutting can be for instance a shearing process. For example, each of 1,000 ge¬ nomes present in one sample would be cut into 100,000 polynu¬ cleotides of lOkb (kilobases) length creating a pool of 108 different polynucleotides.
If those random 108 polynucleotides are segregated into 1,000 subpools, each would contain on average 100,000 of the lOkb polynucleotides, on average one complete 1Gb genome. No re¬ duction in complexity would have been achieved because each
short read must still be aligned to the 1Gb.
In contrast, if the segregation would have been carried out into 10,000 subpools then the complexity of the alignment proc¬ ess of short read fragments within each subpool would be 10-fold reduced. Because, the sequences of the subpools are dispersed evenly throughout the genomes each subpool would contain only 10,000 of the lOkb polynucleotides thus 1/10 of the 1Gb genomic sequence .
To achieve complexity reduction according to the present in¬ vention the number of subpools is preferably higher than the number of nucleic acid molecules in the sample. The amount of subpools that are needed for the same level of complexity reduc¬ tion is direct proportional to the number of nucleic acid mole¬ cules. "A nucleic acid" relates to all molecules with a given sequence, i.e. a nucleic acid of the sample as well a s all its copies obtained during amplification. According to this aspect the present invention provides a method for the reduction of the complexity of nucleic acid pool (s) , comprising
• providing a sample with one or more nucleic acid molecules,
• cutting the nucleic acid molecules by a random and/or se¬ quence independent cutting step thereby obtaining a pool of nucleic acid fragments,
• amplifying one or more fragments of said nucleic acid mole¬ cules, wherein the one or more fragments constitute at least a fraction of all fragments of the nucleic acid mole¬ cules, and wherein the one or more fragments of said frac¬ tion are divided into different subpools, each subpool com¬ prising at least one fragment,
wherein the number of subpools comprising at least one of the fragments is greater than the number of nucleic acid molecules in the sample times said fraction, and wherein the fragments of each subpool comprise a common nucleic acid feature. Of course, all preferred embodiments as described above or below also apply to this method. In principle the number of subpools should be greater than the number of different nucleic acid molecules. Of course, if only a fraction of the nucleic acid molecules is used (e.g. only a band of 9kb to llkb as shown in the examples below) then the number of subpools may be reduced to achieve the same complexity reduction. The fraction (e.g. a certain percentage) of processed nucleic acids thus is a factor in the equation to
determine a suitable number of subpools.
As example, starting with 1,000 genomes of 1Gb and requiring a complexity reduction per subpool of 100, then 100,000 subpools must be created, each subpool containing on average only one thousand (1,000) lOkb polynucleotides. Fortunately, not all sub- pools must be sequenced to cover the whole genome. In this exam¬ ple only little more than 100 subpools are required to have a higher than zero probability of seeing just enough tiny overlaps to be able to assemble the full length genome.
If i) the (e.g. lOkb) fragments are randomly distributed and ii) the selection of the subpools was randomly chosen, then an ordinary probability function describes the chances of reading new sequences compare to reading sequences, or part thereof, which were already read before. To have a probability of close to one (>0.999) of reading once the entire genome, about 800 subpools need to be sequenced, with, 8x fold coverage.
Therefore, the complexity reduction is preferably not achieved through cutting the genome with restriction enzymes, but limiting the number of nucleic acid molecules in a subpool of fragments. Creating a number of subpools which is higher than the number of nucleic acid molecules within the starting pool of nucleic acids, the complexity within each subpool will be re¬ duced .
The core of the invention is dividing or segregating nucleic acids to reduce the complexity of the task in aligning sequenc¬ ing reads and foremost the ambiguity of doing so. Of course, in reality the challenge depends on many different aspects of the real natural system many of which relate to stochastic effects.
E.g. the segregation of a sequence entity after fragmenta¬ tion into n equal subpools increases the uniqueness of the alignment of shorter sequence about n-fold, which depends on the degree of order within the sequence database and how the segre¬ gation occurred a mammalian genome has a total DNA of approxi¬ mately 2.7xl09 bp (e.g. "laboratory mouse" 2,716,965,481 bp. In case of a completely random sequence with the same size 12 bp long reads can have 412 (1.678><107) permutations if all four base-pairs are equally often represented. If every base-pair in the sequence is the start of a new permutation than the sequence can present 2.7χ109 - 11 ~ 2.7><109 permutations each permutation appears in average 161 times in such a genome.
As a consequence, the alignment of a random 12 bp sequence (rl2bp) does not give a unique hit, instead a multi-alignment to 161 positions. The chance to align a particular read to the cor¬ rect position is as little as 1/161 and de facto none.
If the genome is divided into 256 subpools, then each con¬ tains 1.054xl07 bp. The subpools may hold signatures like chemi¬ cal identifier e.g. each fragment starting with a certain nucleotide type or sequence, lateral information in the sequencing machine or others. If the distribution obliges a Poisson- distribution, then the probability to find a certain number k of 12bp read sequences in one subpool calculates to:
Therefore, a 12bp read is not in 53% of the subpools, once in 34%, twice in 11% and three times in 2%, and so forth. The ratio 34/11/2 determines the probability to align a 12bp read unique¬ ly, to two or even 3 positions respectively.
However, the genetic information is not random, it contains a high degree of order. The bioinformatics survey of the mouse genome revealed that in 25-bp sequence fragments 80% are unique, 6% occur 2-10 times and 14% more than 10 times. The benefit of the inventive dividing segregating concerns those 20% which were not unique mapable before, 32-bp long sequence fragments in¬ crease the unique mapable window in the genome by just 5 %, to 85 ~~o .
In other words, if reads are too short (for example, much shorter than 25bp) , then, statistically, they must, have many re¬ peats within the total sequence. If reads are reaching the length of close to 25bp, than the statistically the uniqueness will become large enough to provide a very specific signature. However, such motives could have been copied during evolution and now the average length of the copied units determines the next significant reading length benchmark. If the read length crosses that length (e.g. 180 bp) most of those remaining reads will become objective assignable.
The value of alignment, quality does not scale linear with the percentage coverage. That the last few percent are the hard-
est to obtain and the most valuable when attempting to determine the "whole" genomic sequence. The inventive approach specifi¬ cally increases the chance of those remaining portions to pro¬ vide full length sequences.
In preferred embodiments of the present invention sample comprises at least two, preferably at least 3 even more prefera¬ bly at least 4, e.g. 5, 6, 7, 8, 9, 10 or more, at least 20, at least 50, at least 100, at least 1000 or at least 10 000 nucleic acid molecules. In further preferred embodiments of the inven¬ tion sample comprises at least 2, 4, 5, 6, 7, 8, 9, 10 or more, at least 20, at least 50, at least 100, at least 1000 or at least 10 000 different nucleic acid molecules of different ori¬ gin .
In preferred embodiments the fragments are divided into sub- pools wherein at least 10% of all subpools comprise the average amount of fragments of all subpools +/- 50%. By employing a suitable segregation method for the given sample to divide the fragments evenly into the subpools the complexity reduction method is sufficiently used. Of course, further subpools may ex¬ ist wherein fewer fragments are present, e.g. even empty sub- pools without any fragment of the original pool which can be used as control reference. In preferred embodiments at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40% of all subpools comprise the average amount of frag¬ ments of all subpools +/- 50%. This error margin of +/- 50% is in preferred embodiment up to +/- 50%, up to +/- 45%, up to +/- 40%, up to +/- 35%, up to +/- 30%, up to +/- 25%, up to +/- 20%.
In a further embodiment the fragments are divided in sub- pools wherein at least 10% of a subpool containing 6, 4, 3 or 2 or less fragments, preferably 1 fragment. Such a high dilution is in particular favorable for fragments that would be hard to assemble if further fragments would be present from the original pool .
In a further preferred embodiment the step of dividing the fragments comprises specifically amplifying the fragments from the original pool of nucleic acid fragments. In particular, the amplification is performed by nucleotide extension from a primer, preferably by PCR, in particular preferred wherein the am¬ plification is performed by using primers which select for at least one, preferably at least two, in particular at least two
adjacent, different nucleotides or at least three or more dis¬ tinguishing nucleotides as described above after an unspecific primer portion whereby fragments are amplified which comprise the selected nucleotide as the nucleic acid feature specific for a subpool.
Fragments of different subpools may e.g. be distinguished by spatial separation or by attaching a subpool specific label to each fragment of a given subpool. It is then possible to distin¬ guish fragments of different subpools during determining nucleo¬ tide sequences of fragments of combined pools. Alternatively nu¬ cleotide sequences of separate pools with or without attaching a label can be determined. This allows assigning fragment se¬ quences to a subpool depending on a subpool-specific label and overlapping sequences with other fragments, thereby reducing complexity while determining the sequence of the nucleic acids.
Thus, in preferred embodiment subpool-specific labels or identifier are attached to the fragments. When fragments are further cut or partially copied of course also molecules that are derived from such subpool fragments can be labeled or iden¬ tifiers can be attached. The subpool-specific labels can be nu¬ cleotides, which are preferably co-determined during sequence determination .
In further preferred embodiments the fragments, but also the nucleic acids in another step, of the original pool are divided into at least 2, preferably at least 3, at least 4, at least 5, at least 6, at least 7, at least 8 subpools during the segrega¬ tion step, which fragments each share a different nucleotide characteristic for each subpool.
In preferred embodiments primers or probes used for select¬ ing fragments in the segregation step are preferably immobilized on a solid surface, in particular a microarray or chip. The same type of segregation as described above for the distinguishing the nucleic acids can also be performed for distinguishing dif¬ ferent fragments during the sequencing step.
The step of dividing the fragments into different subpools of course does not mean that each subpool has to be occupied, i.e. comprises one of the fragments. It is also possible that some of the subpools may remain empty, e.g. can be reference subpools. The dividing step, or segregation step is not neces¬ sarily absolute but can be relative. It also relates to dividing
fragments through selective enrichment, i.e. amplification while non-selected fragments remain not amplified but still remain in the subpool sample.
In a further preferred embodiment of the present invention the number of occupied subpools is at least 5 times, preferably at least 10 times even more preferred at least 25 times, i.e. at least 30 times, at least 40 times, at least 50 times, at least 80 times, at least 100 times, at least 200 times, at least 300 times the number of nucleic acid molecules in the sample, in particular if these nucleic acid molecules are of a different sequence. The inventive method greatly benefits from increasing the amount of subpools in order to facilitate the alignment step of nucleic acid fragments that would align to multiple site of the original nucleic acid molecule, e.g. the genome. In pre¬ ferred embodiments, the fragmented sample comprises at least one such sequence fragment that cannot be uniquely aligned.
As mentioned above it is possible to obtain the complete nu¬ cleic acid sequence after sequencing only one subpool and align¬ ing, or joining the fragment sequences thereof. In preferred em¬ bodiments at least 2, at least 3, at least 4, at least 5, at least 8, at least 10, at least 12, at least 15, at least 20, at least 25, at least 30, at least 40, at least 45, at least 50, at least 60, at least 80, at least 100, at least 120 subpools are determined .
In further preferred embodiments the sequences of the frag¬ ments and/or joined sequences are aligned by determining common overlaps or by alignment to a template sequence when joining the sequences of neighbouring fragment sequences. It is both possi¬ ble to obtain the joined complete sequence by either using a template, e.g. from a common nucleotide sequence data base and align the sequenced fragments to this template. On the other hand it is possible to join the sequences by determining over¬ lapping sequences, e.g. of fragments which are cut in a differ¬ ent fashion and provide the connection information of 3 ' and 5 ' ends of different fragments.
It is a goal to sequence at least one nucleic acid molecule of the sample. Preferably at least 2, at least 4, at least 6, at least 8, at least 10, at least 15, at least 20, at least 30, at least 40, at least 100 or at least 150 nucleic acid molecules are sequenced.
In order to determine the sequence of the inventive frag¬ ments any common method known in the art is possible. Preferred sequencing methods comprise amplifying the fragments, or ampli¬ fying portions of these fragments and detecting each nucleotide type on each position with a label, a florescent nucleotide. Am¬ plification sequencing approaches can e.g. be automated as on a chip or micro array or on beads.
In preferred embodiments the sample comprises at least 2 nu¬ cleic acid molecules with the same sequence, which are prefera¬ bly cut at different sites thereby providing different frag¬ ments. In this case overlaps are obtained which can be used to join the sequences. Obtaining fragments which are cut at differ¬ ent sites can be e.g. by random, sequence independent cutting or by cutting using sequence independent endonucleases .
In preferred embodiments a sample comprises at least 2 nu¬ cleic acid molecules of different sequences, in particular of different origins or at different concentrations.
The present invention further illustrated by the following figures and examples without being limited thereto.
Figures :
Fig. 1: coverage of a nucleic acid sequence by different fragment sizes.
Fig. 2: General fragmentation and subpooling workflow, restricting the fragments of a polynucleotide sample to a certain number of subpools.
Fig. 3: Application of the general principle in a Next gen¬ eration sequencing experiment.
The general workflow outlined here is as also used in Exam¬ ple 1.
Here, in step 6 each subpool contains three classes of frag¬ ments .
a) fragments that contain the LI (linker 1) sequence. These se¬ quences downstream of the LI sequence (or LI sequence part) de¬ pict the 5' start of the original fragments of step 3.
b) fragments that contain neither LI nor L2 (linker 2) sequences (or L1-, L2 sequence parts) . These fragments and their reads are from within the original fragments of step 3.
c) fragments that contain L2 (linker 2) sequences. The sequence
upstream of the L2 sequence (or L2 sequence part) depict the 3' end of the original fragments of step 3.
The knowledge of the start and end sequences aids the assembly in step 9 as start and end sites of the fragments are defined.
The contig building of step 9 can be further advanced by as¬ sembling the contigs of step 9 (and the remaining reads) between the different subpools.
Examples :
Example 1: Reducing the complexity of a DNA sample
For a general outline of the workflow see also fig 3.
DNA was extracted from a sample containing 3 x 105 human diploid cells. The DNA in the sample was fragmented to an average frag¬ ment size of lOkb by sonication.
The fragments were dephosphorylated on their 5' ends by al¬ kaline phosphatase (to inhibit selfligation of the fragments in the following first ligation step) . The fragments were briefly denatured at 95°C and rapidly cooled on ice to provide single strands. Then a 5' phosphorylated single stranded Linker (L2rc; reverse complement to a L2 sequence) was ligated to the 3' -OH end of the fragments by T4 RNA ligase. After that the L2rc linked fragments were phosphorylated on their 5' end by polynu¬ cleotide kinase and a second Linker (LI) was ligated to the 5'- phosphate end of the L2rc linked fragments by T4 RNA ligase. Now about 1% of all fragments were ligated to the LI and L2rc linker representing a DNA content equivalent to about 3 x 103 cells.
The ligated fragments were size separated through electro¬ phoresis in an 0,5% agarose gel. Ligated fragments in the size range of 9-llkb are cut out of the gel and purified. This frac¬ tion represents a DNA content equivalent to about 1,5 x 102 cells .
The 9-llkb fraction was amplified by long PCR using the LI and L2 sequences as primers to generate about lOOng of PCR prod¬ ucts .
In a segregating PCR, primers that contain the universal LI and L2 sequences and on their 3' end a number of n selective nu¬ cleotides can reduce the complexity of the sample by a factor of 4n, were n was the combined number of selective nucleotides of both primers. To be able to reduce the complexity of 1,5 x 102
cells below one haploid genome 4n must be greater than 3 x 102. Therefore n must be at least 5. When n was 7, the complexity was reduced by a factor of about 54, or in other words each subpool would represent about l/54th of a haploid genome equivalent.
Therefore a segregating PCR was carried out to create the subpools for a set A. 70 subpools of a 16.384 subpool matrix (47) were created by 70 individual PCR reactions containing each one of 70 possible primer combinations of 7 primers with Ll-NNN (Ll- ACA, -TAC, -CTT, -GAT, -CAA, -TTG, -AGT) and 10 primer with L2-NNNN (L2-CACA, -GTAC, -GCTT, -CGAT, -GCAA, -CTTG, -CAGT , -AGCT, -TCTG, -TACG) . Set B consisted of a single sample that was amplified in a non- segregating PCR by using LI and L2 primers only. In each PCR reaction 27pg of DNA was amplified to about 500ng.
The samples were then prepared for next generation sequenc¬ ing on an Illumina Genome Analyzer II. Each of the PCR samples was fragmented into fragments which are on average 200-600 bp long. Linkers (L3, L4rc) were ligated to the ends of the frag¬ ments, which are used to bind the samples to the flow cell, al¬ low for cluster generation and enable the hybridization of a sequencing primer to start the sequencing run. In addition for samples of set A each L3 linker contained a subpool specific se¬ quence tag (barcode) to assign each sequencing read. Linker ligated fragments in a size range of 200-600 bp were size selected for sequencing. The 70 barcoded samples of set A were loaded on¬ to 2 channels of the flow cell by pooling 35 samples per chan¬ nel. The single sample of set B was loaded onto 2 channels of a second flow cell. After cluster generation on a cBot Instrument (Illumina Inc., USA), a 76 bp sequencing run was carried out on a GenomeAnalyzer II (Illumina Inc.) for each flow cell. About 15 millon reads were generated per channel.
The reads of set A were segregated into the respective sub- pools according to the different channels and according to the different barcodes (sequence tags) . In a first assembly contigs were built by first aligning reads within each subpool and then assembling contigs and remaining reads within all subpools to¬ gether. In comparison, in a second assembly of set A contigs were built neglecting the sub-pool information. The average con- tig length of the first assembly was longer when contig building was done within each subpool first, compared to the second as¬ sembly, where the reads were not separated into subpools. In a
third assembly contigs were built using reads of set B. In com¬ parison the third assembly resulted in shorter contings than the second or the first assembly.
Therefore a larger portion of the genome could be assembled when segregation was carried out. In addition in the first alignment in the majority of the cases contigs will come from one of the two haploid genomes allowing to distinguish between maternal or paternally derived sequences.
Example 2: Reducing the complexity of an mRNA sample
mRNA was extracted from a sample containing 12.000 human cells that contain on average about 0,6 pg mRNA. 3,6 ng of mRNA could be recovered and was fragmented to an average fragment size of 100 bases.
A reverse transcription was carried out using random hexam- ers and reverse transcriptase to copy the cleaved mRNA fragments into cDNA. Second strand synthesis was carried out to remove the mRNA strand and synthesize a replacement strand to generate dou¬ ble stranded cDNA. cDNA ends were blunted by T4 DNA polymerase and Klenow DNA polymerase. Next an "A" base was added to the 3' end of the dsDNA fragments to create a single nucleotide over¬ hang. Adapters (L5-L1-T and L6-L2-T) with a 3' "T" base overhang were then ligated to the fragments. Ligation products were size separated through gel electrophoresis. Ligates in the size range of 200 ( +/- 25) bases were cut out of the gel and purified. This yields ligates with an cDNA insert content equivalent to an mRNA content of about 50 cells.
Adapter ligated cDNA was amplified by PCR using L5 and L6 sequences as primers to generate about 500ng of PCR products.
Next two sets of samples were created. For set A the sample was segregated into n subpools and set B (where a single nonseg- regating PCR was carried out) was analysed as a control.
In principle set A was created using primers that contain the universal LI and L2 sequences and on their 3' end a number of n selective nucleotides, that can reduce the complexity of the sample by a factor of 4n, were n was the combined number of se¬ lective nucleotides of both primers. To be able to segregate the transcripts of 50 cells with a cellular copy number below 30 in¬ to different subpools, 4n must be greater than 50 x 30. Therefore n must be at least 6. When n was 8, each subpool has a 1/43
chance containing a transcript with a copy number below 30.
Therefore a segregating PCR was carried out to create sub- pools. 22 subpools of a 65.536 subpool matrix (48) are created by 22 individual PCR reactions containing each one of 22 possible primer combinations of 22 primers with Ll-NNNN and 22 primers with L2-NNNN. In each PCR reaction 27pg of DNA was amplified to about 500ng.
Set B consists of a single control sample that was amplified in a non segregating PCR, using primers that contain only the universal LI and L2 sequences.
The samples are then prepared for next generation sequencing on an Illumina Genome Analyzer II. Linkersequences (L3, L4) are added to the ends of the PCR products by 10 cycles of PCR using L3-L1 and L4-L2 primers, which are used to bind the samples to the flow cell, allow for cluster generation and enable the hybridization of a sequencing primer to start the sequencing run. The 22 samples of set A were loaded onto one channels of the flow cell by pooling the 22 samples per channel. Into a second channel the single sample of set B was loaded.
After cluster generation on a cBot Instrument (Illumina Inc., USA), a 36 bp sequencing run was carried out on a Ge- nomeAnalyzer II (Illumina Inc.) . About 15 million reads were generated per channel.
When analyzing the sequencing data sets, set A contained reads that are not part of set B. These reads represent low copy number transcripts. Therefore set A encompassed low copy number reads that cannot be detected without segregation.
Example 3: Reducing the complexity of an mRNA sample
mRNA was extracted from a sample containing 24.000 human cells that contain on average about lpg mRNA. 12ng of mRNA could be recovered and was fragmented to an average fragment size of 400 bases .
The fragments were dephosphorylated on their 5' ends by al¬ kaline phosphatase (to inhibit selfligation of the fragments in the following first ligation step) . The fragments were denatured at 92°C for 30seconds and rapidly cooled on ice to melt any sec¬ ondary structure. Then a 5' phosphorylated single stranded Link¬ er (L2rc+L6rc; 50nts) was ligated to the 3' -OH end of the frag¬ ments by T4 RNA ligase. After that the L2rc+L6rc linked frag-
ments were phosphorylated on their 5' end by polynucleotide ki¬ nase and a second Linker (L5+L1 ; 50nts) was ligated to the 5'- phosphate end of the L2rc+L6rc linked fragments by T4 RNA li- gase. Now about 1% of all fragments were ligated to the L5+L1 and L2rc+L6rc linker representing about 120pg of mRNA that was equivalent to the mRNA content of about 120 cells.
A reverse transcription was carried out copying 120pg of li¬ gated mRNA fragments using a primer that contains L6 (reverse complement to L6rc) to generate cDNA.
120pg of cDNA was amplified by PCR using the L5 and L6 as primers to generate about 500ng of PCR products.
The PCR products are size separated through electrophoresis in an 6~6 polyacrylamid gel. Amplified fragments in the size range of about 475-525 bases were cut out of the gel and puri¬ fied .
In a segregating PCR, primers that contain the universal LI and L2 sequences and on their 3' end a number of n selective nu¬ cleotides can reduce the complexity of the sample by a factor of 4n, were n was the combined number of selective nucleotides of both primers. To be able to reduce the complexity of 120 cells below the mRNA content of one cell 4n must be greater than 120. Therefore n must be at least 4. When n was 7, the complexity was reduced by a factor of about 136, or in other words each subpool would represent about l/136th of the mRNA content equivalent of a single cell.
A segregating PCR was carried out to create the subpools of a set A. 70 subpools of a 16.384 subpool matrix (47) are created by 70 individual PCR reactions containing each one of 70 possi¬ ble primer combinations of 7 primers with Ll-NNN (Ll-ACA, -TAC, - CTT, -GAT, -CAA, -TTG, -AGT) and 10 primer with L2-NNNN (L2-CACA, - GTAC, -GCTT, -CGAT, -GCAA, -CTTG, -CAGT, -AGCT, -TCTG, -TACG) . Set B consisted of a single sample that was amplified in a nonsegre- gating PCR by using LI and L2 primers only. In each PCR reaction 27pg of DNA was amplified to about 500ng.
The samples were then prepared for next generation sequenc¬ ing on an Illumina Genome Analyzer II. Each of the PCR samples was fragmented into fragments which are on average lOObp long. Adapters (50bp) were ligated to the ends of the fragments, which are used to bind the samples to the flow cell, allow for cluster generation and enable the hybridization of a sequencing primer
to start the sequencing run. In addition each adapter-pair contained a subpool specific sequence tag (barcode) to assign each sequencing read. Adapter ligated fragments in a size range of 175-225 bp were size selected for sequencing. The 70 barcoded samples were loaded onto 2 channels of the flow cell by pooling 35 samples per channel. After cluster generation on a cBot Instrument (Illumina Inc., USA), a 36 bp sequencing run is carried out on a GenomeAnalyzer II (Illumina Inc.) . About 15 million reads are generated per channel.
The reads of set A were segregated into the respective sub- pools according to the different channels and according to the different barcodes (sequence tags) . In a first assembly contigs were built by first aligning reads within each subpool and then assembling contigs and remaining reads within all subpools to¬ gether. In comparison, in a second assembly of set A contigs were built neglecting the sub-pool information. The average con- tig length of the first assembly was longer when contig building was done within each subpool first, compared to the second as¬ sembly, where the reads were not separated into subpools. In a third assembly contigs were built using reads of set B. In com¬ parison the third assembly resulted in shorter contigs than the second or the first.
Therefore longer mRNA sequences can be assembled using segrega¬ tion.
Example 4 : Improved sequence alignment
The inventive method divides a pool of random fragments into different subpools. This greatly enhances the alignment and as¬ sembly of short reads, such as they are returned by next genera¬ tion sequencing platforms. In this example a simple model pool of fragments (160-305 bases long) is used to show the difference between an alignment of reads (4 bases long) within the whole pool of fragments and when such an alignment is done within each separate subpool. Ten random sequences between 160 and 305 were generated using a Random Letter Sequence Generator
(http://www.dave-reed.com/Nifty/randSeq.html) and arranged in a data base, e.g. because of the small size it could be done in a spreadsheet, assembling the fragments of the model pool. All randomized numbers (e.g. fragment identifier) were generated us¬ ing a randomizer.
Table 1: Short randomized sequences used as pool model. fragment length seguence
CATTACGTCCATATGAGTTCACGGTCCCTTGAACTTTTATGGTAGGTGG- TAGGCTCGGCGAATCTAGCTTTGGAGCTTCGCCGGACTCAACAAGGTAAGGAGGAG- CATCGCTCTCTCGACCACTCAAGACGGGATA AC GTGTCAAGGAGATAATCGGAAC-
1 202 TA C AGAATCCAGCTCGCCGAAATCGTCAGGCGA
CTAGCTTCGGTGTCATCCCGGAAGGCCCACGTTGTGCGGCAATACTAGAGATAAAAGCGG- CAAAGCTAACACCGAAAGCCTATACTGGCTACCCGTCTCGTTCGGTGGCACTAACTA- GACTCCTCATCAGGCATAGGTGACCGCTCGCTCTCGTGCCAAGGTCTCCCGAGACTTCCGAGA-
2 242 TAGTAATAAC GAACA GGAGACCGG A G AAGC ACA CAA G GGGCGAAACGAAC
CGTTCCGGCCTGAAGCTCGGGGATCCGGCCCCCCCCTAACTTCGCTTTCTCAAAC-
GTACAAATCAACCTTACTCGCATGCAGTAGATCTGCTTTGGGCCGTATCACACCTTCGGCTT-
GCCGTAAACCTGAATAGCAAATGCGGGAGGGAC CCGTAATG GG-
GAA AC AAACACATC CCGGGAGCACAA CCGCCACTCAACACGGG CC -
3 275 GGTGCGTCTCATGCAA C CAGTGATGGGATAC GGCAGGGATATC
CAGCCCGGACGCACTGAGATGATACGTGTTGAACCGGCCTTCACTGTATATTATGCTCAC- GAGCCCTAGA CATCAAAAAACAGGTACAC CTCATCCTGACTATACAGC CAG- TCATCCTACGATGGGAATCTAGAGCCCATAGACATATATGAGCACACTACTC GG- TAACATCTC GTCACATACA CGCCAATCTGAATCC CTGACAGCCAG-
4 297 CTCATGATCCAACAC AAGGA AGCA ACGGGGCGGGAGGAGAATCGAATACTCGCCCACCGTC
ACTGGAGAGCACCGAACATACTCCTAGCCCGGGATGACAATGTCCTAACGCCACCCAC-
TAAGGGTAAGGCTCTAA GGAAGGTAGTCCAAATACGCTCCATGAC-
GAGCTTCGCTCTCAAGGCTCGCAGTCAGAACGTATCGAC-
TATGCGACTCTAA CCAAACCCAGAACCTGAGCGAGGCAGTCG AG AATGACGC - GCCGAGAGAACAGTAAAGGAG C CGATGAGGTACTAC-
5 305 GACATTCACATGTGTCATGGGTCGGTTAAGCATCTGCGTGATTGATTCCGGGGGGGTGTT
CAGCAGG CGCA A A CAAAAGGGAAAGCCAGC CGCC AGACG CG CAA GG- TAGGTACTTTAATTTTTAGAGGGGCTTCCCCATGCTTTTGGAGATTGGCCTATCGGTAGTGAG- GATACCGGCCTCCACGCTGCGTGATGAGCACAATCATTGTTCTCGGAGACGGAGGACCCG- GAAGGTAACGAGCCCAAAGG CA CA ACCA A AGGGCGTAAC-
6 297 CTCATTTAGCGCGACTGACGTGCAAGGGGCATCCGACCTGCGAGGAAGGGGCCTTGGCTCTGTAGGATATAAT
TATCGAAAGCCCTAAGGATTTTTTTTGGGGAATCGATTGTGTTAAGCAGGGAC-
GGC CAAAA CGTCTAATAAGA CTCTGGCCA ACCCTAACAGCGCCATACTCTATA-
GACGCACGCCTACCTTAGGCGCCTCCCGTCCCCGGATCCGAGCTCCCAAAACCCAGCGAC-
CTCTTCATGCTAAGGACTTCATTTGGACCCGTCAGGCACTGCTCCATGAAGAACGACATGAG-
7 275 GA GGAG A AAAGGC AACAC GTAGCGCCACCG
8 242 GTGTCGTAACTGAGCGATACAGAACGACGCTGAGTCATCGAGGCAAATGCGTCCACCCGCAC-
CTGCGCATCCCATACAAGGTGGCACAACTTAGTAGGACTTATATGCGGACTTCACCGGTACGA-
GAAGAGTTGAAGACTAAATTATGACGTGACAAACGAAAGAGTAAAACAACATGCG-
TAGCTCTTCATGAAGCGGCAGAGCAAACCTTGATTAAACCCCTTGATTGGCAACACTACACG
CGGTTACCCGGCGTTAGGCCTATGTACCGCCCGACGTACTTGCTAGGGGTCATACTACCGAC- GATCCCTGCTAACAAAGAACAGTACCGGCTTTCCTTAACTACTCAGTGCTACTAAAACTAG- CATGAGGGTTGAGATCATCTCATCCAGTTGGGTCCAGCGCATGATTAATTGCTTTACTCG-
9 202 CACTTTAATTCGGCTTCTA
GGAGGCACGACGAGTATCTAGTGTCTGCACGGGACTCCGGAGGACATTCCCTACAAGTTAC-
CGGCGTCAGTAGCAGCAAGACTGGTCTGTCTACCCCTGCCTGACAAAGTCTTTCTTGGAT-
10 160 TTCGGACCGAAACTCGGCCCAACATGCCATTGGCCATAT
First, the fragments were ordered into 16 (4x4) different subpools according to their terminal bases (tab. 3) .
Because one particular pool of fragments (all reads align to the blue print) is selected and any reading errors are excluded, a simple alignment algorithm (simple search function which provides the number of sequence matches) could be used to probe the fragment pool. It selects all reads that have a perfect k-mer
match to the reference sequence ( transcriptome) . So, 24 permuta¬ tions of 4bp reads (without any base repeats like AATG) were
taken and aligned, once against the entire model pool of frag¬ ments (tab. 2) and once against the segregated fragments within each subpool(tab. 3) . The number of unique hits is shown in both tables in the right column.
Table 2: Compilation of number of possible 4bp read alignments to the entire pool of fragments. None of the reads aligns
uniquely .
24 peikmui3tiijri r ads tc 4bp witltout re eats unique fragment ATCt. ATCfi AGTC AGCT ACTG ACGT TAGC TACG 1GA£ TG A TCAG TCGA GMC GACT GTAC CTCA SCAT GCTA CATS AG1 CTAG US CGAT CGTA hits
1 0 0 3 0 I I 1 0 0 1 1 0 I 0 I 0 0 0 1 0 0 0
1 0 0 0 3 2 1 I 0 t 0 1 0 0 0 :i 1 1 0 3 ί 0 0
5 3 0 0 3 0 1 I 0 0 2 1 0 7 1 1 0 1 0 2 0 2 0 *
4 3. J i ί ί 1 I i. 0 1 3 1 1 1 J 1 0 3. 2 4 1 o
5 t J 3 t 1 I y 3 0 1 0 £ 1 2 1 0 3 3 I 3 1 1
6 3. 3 0 1 3. 2 i 0 3. I 0 0 0 I i 3 0 1 0 1 3 0 1
7 t 2 0 3 2 0 I 0 0 0 1 2 1 1 0 1 0 I 3 0 0 0 1 0
S 3 5 1 3. 1 i 1 2 0 0 1 0 i 1 3 ! 0 1 0 0 2 1 J
9 0 0 0 0 0 3. i. 0 0 0 1 0 0 5 3 2 3 0 1 1
JO 3. 0 5 0 3. 0 I 0 i. 1 1 ϋ 0 2 0 3 0 0 1 3 1 :i Q 0
>er ( i )1 9 6 u 9 10 )0 4 s 6 14 s 12 10 7 3S 11 u 12 5 9
Table 3: Compilation of number of possible 4bp read alignments
to fragments segregated into 16 subpools according to the termi¬ nal nucleotides of the fragments. When the alignment is done within each subpool 69 of 224 reads align uniquely to a frag¬ ment .
i : 1 1 2 3 0 1 2 0 2 1 2 1 0 3 3 1 13
1 0 0 1 0 1 0 1 1 1 0 2 0 1 0 0 1 1 1 0 0
3 1 1 1 2 0 0 1 0 1 1 0 2 0 0 2 1 2 o 3 0 3 0 2 2 1 0 o 2 3 3 3 3 2 3 3 0 1 5
1 2 1 1 1 2 1 1 1 14 4 4 3 3 2 3 4 2 3 3 3 4 4 4
This example experiment shows, that
i) none of the 24 probed reads gave one unique hit when try¬ ing to align reads to the entire pool of fragments. The number of total hits was 224. The most unique read aligned matched 4 different fragments.
ii) After segregation into 7 subpools, here according to the molecule ends (first and last nucleotide) , 69 (31%) of the reads could already be aligned uniquely.
Even without having a blue print the same principle applies. In the first case none of the investigated reads will belong to a unique position in the pool, whereas 31% of the reads will have one unique position in their host subpool.
Claims
1. Method for the reduction of the complexity of nucleic acid pool (s) , comprising
• providing a sample with one or more nucleic acid molecules,
• cutting the nucleic acid molecules by a random and/or se¬ quence independent cutting step thereby obtaining a pool of nucleic acid fragments,
• amplifying at least a fraction of said fragments, and where¬ in the amplified fragments, or during amplifying of said fragments the fragments of said fraction, are divided into different subpools, and wherein the fragments of each sub- pool all share the same nucleic acid feature and a subpool comprises more than one fragment.
2. Method for the reduction of the complexity of nucleic acid pool (s) , comprising
• providing a sample with one or more nucleic acid molecules,
• cutting the nucleic acid molecules by a random and/or se¬ quence independent cutting step thereby obtaining a pool of nucleic acid fragments,
• amplifying one or more fragments of said nucleic acid mole¬ cules, wherein the one or more fragments constitute at least a fraction of all fragments of the nucleic acid mole¬ cules, and wherein the amplified or amplifying one or more fragments of said fraction are divided into different sub- pools, and wherein the fragments of each subpool comprise a common nucleic acid feature.
3. The method of claim 1 or 2, characterized in that the cut¬ ting step by physical means, in particular preferred by sonica- tion, shearing or elevated temperature.
4. The method of claim , 2 or 3, characterized in that the sam¬ ple comprises at least two, preferably at least three, even more preferred at least four, nucleic acid molecules.
5. The method of any one of claims 1 to 4, characterized in that the nucleic acid molecules are cut into fragments of from 10 to 200000 nucleotides length, preferably of from 50 to 100000 nucleotides length.
6. The method of any one of claims 1 to 5, characterized in that the fragments are divided into subpools wherein at least 10% of all subpools comprise the average amount of fragments of all subpools +/-50%.
7. The method of any one of claims 1 to 6, characterized in that the number of occupied subpools is at least 5 times, pref¬ erably at least 10 times, even more preferred at least 25 times, the number of nucleic acid molecules in the sample.
8. The method of any one of claims 1 to 7, characterized in that the step of dividing the fragments comprises selecting fragments with a common nucleic acid feature, preferably the presence of the same one or more nucleic acid type(s), selected from A, G, T, U, or C, at the same position, for each subpool, wherein preferably selecting comprises amplifying fragments with the nucleic acid feature.
9. The method of claim 8, characterized in that the fragments are selected for common nucleotides within the 10 nucleotides next to the 5' and/or 3' terminus, preferably for one or more common 5' and/or 3' terminal nucleotide types.
10. The method of any one of claims 1 to 9, characterized in that the fragments of at least one subpool are further cut, op¬ tionally sequence dependent or sequence independent, preferably into fragments of from 10 to 5000, more preferred 12 to 1000, further preferred of from 15 to 500 or 17 to 100 nucleotides length .
11. The method of any one of claims 1 to 10, characterized in that the sequences of fragments of at least one, preferably at least two, preferably at least three, subpools are determined.
12. The method of claim 11, further comprising processing the sequences or partial sequences of a first sub-pool by aligning sequences of the fragments of the first sub-pool and join neigh¬ bouring or overlapping sequences thereby obtaining a joined se- quence, and optionally repeating the processing steps for one or more further subpools, wherein the sequences of the fragments of each further subpool are aligned and joined with the sequences of fragments and/or joined sequences of all previously processed subpool sequences, until a continuous sequence of at least one nucleic acid molecule of the sample is obtained,
wherein preferably the sequences of the fragments and/or joined sequences are aligned by determining common overlaps or by alignment to a template sequence and joining the sequences of neighbouring fragment sequences.
13. The method of any one of claims 1 to 12, characterized in that the sample comprises at least two nucleic acid molecules with the same sequence, which are preferably cut at different sites thereby providing different fragments.
14. The method of any one of claims 1 to 13, characterized in that the sample comprises at least two nucleic acid molecules with different sequences.
15. The method of any one of claims 1 to 14, comprising label¬ ling the fragments with a subpool-specific identifier prior to determining their sequence.
16. Method for the reduction of the complexity of nucleic acid pool (s) , comprising
• providing a sample with one or more nucleic acid molecules,
• cutting the nucleic acid molecules by a random and/or se¬ quence independent cutting step thereby obtaining a pool of nucleic acid fragments,
• amplifying one or more fragments of said nucleic acid mole¬ cules, wherein the one or more fragments constitute at least a fraction of all fragments of the nucleic acid mole¬ cules, and wherein the one or more fragments of said frac¬ tion are divided into different subpools, each subpool com¬ prising at least one fragment,
wherein the number of subpools comprising at least one of the fragments is greater than the number of nucleic acid mole¬ cules in the sample times said fraction, and wherein the fragments of each subpool comprise a common nucleic acid feature,
preferably further defined as in any one of claims 3 to 15.
17. Method for the reduction of the complexity of nucleic acid pool (s) , comprising
• providing a sample with one or more nucleic acid molecules,
• cutting the nucleic acid molecules by a random and/or se¬ quence independent cutting step thereby obtaining a pool of nucleic acid fragments,
• amplifying at least a fraction of said fragments, and where¬ in the amplified fragments or during amplifying of said fragments, the fragments of said fraction are divided into different subpools, and wherein the fragments of each sub- pool all share the same nucleotide type at the same posi¬ tion from either terminus as common nucleic acid feature and a subpool comprises more than one fragment,
preferably further defined as in any one of claims 3 to 13.
Priority Applications (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US13/522,951 US9334532B2 (en) | 2010-02-03 | 2011-02-02 | Complexity reduction method |
CA2788583A CA2788583A1 (en) | 2010-02-03 | 2011-02-02 | Complexity reduction method |
EP11702031.3A EP2531610B1 (en) | 2010-02-03 | 2011-02-02 | Complexitiy reduction method |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP10152498A EP2354243A1 (en) | 2010-02-03 | 2010-02-03 | Complexity reduction method |
EP10152498.1 | 2010-02-03 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2011095501A1 true WO2011095501A1 (en) | 2011-08-11 |
WO2011095501A8 WO2011095501A8 (en) | 2011-11-10 |
Family
ID=42104419
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/EP2011/051442 WO2011095501A1 (en) | 2010-02-03 | 2011-02-02 | Complexitiy reduction method |
Country Status (4)
Country | Link |
---|---|
US (1) | US9334532B2 (en) |
EP (2) | EP2354243A1 (en) |
CA (1) | CA2788583A1 (en) |
WO (1) | WO2011095501A1 (en) |
Cited By (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2015067796A1 (en) * | 2013-11-08 | 2015-05-14 | Cartagenia N.V. | Genetic analysis method |
US9618474B2 (en) | 2014-12-18 | 2017-04-11 | Edico Genome, Inc. | Graphene FET devices, systems, and methods of using the same for sequencing nucleic acids |
US9857328B2 (en) | 2014-12-18 | 2018-01-02 | Agilome, Inc. | Chemically-sensitive field effect transistors, systems and methods for manufacturing and using the same |
US9859394B2 (en) | 2014-12-18 | 2018-01-02 | Agilome, Inc. | Graphene FET devices, systems, and methods of using the same for sequencing nucleic acids |
US10006910B2 (en) | 2014-12-18 | 2018-06-26 | Agilome, Inc. | Chemically-sensitive field effect transistors, systems, and methods for manufacturing and using the same |
US10020300B2 (en) | 2014-12-18 | 2018-07-10 | Agilome, Inc. | Graphene FET devices, systems, and methods of using the same for sequencing nucleic acids |
US10429342B2 (en) | 2014-12-18 | 2019-10-01 | Edico Genome Corporation | Chemically-sensitive field effect transistor |
US10811539B2 (en) | 2016-05-16 | 2020-10-20 | Nanomedical Diagnostics, Inc. | Graphene FET devices, systems, and methods of using the same for sequencing nucleic acids |
Families Citing this family (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101862756B1 (en) | 2010-07-09 | 2018-05-30 | 세르겐티스 비.브이. | 3-D genomic region of interest sequencing strategies |
ES2686043T3 (en) | 2011-09-16 | 2018-10-16 | Lexogen Gmbh | Method for preparing a library of nucleic acid molecules |
WO2014129894A1 (en) * | 2013-02-19 | 2014-08-28 | Cergentis B.V. | Sequencing strategies for genomic regions of interest |
CN105063208B (en) * | 2015-08-10 | 2018-03-06 | 北京吉因加科技有限公司 | A kind of target dna low frequency mutation enrichment sequence measurement to dissociate in blood plasma |
NL2022043B1 (en) * | 2018-11-21 | 2020-06-03 | Akershus Univ Hf | Tagmentation-Associated Multiplex PCR Enrichment Sequencing |
Citations (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0534858A1 (en) | 1991-09-24 | 1993-03-31 | Keygene N.V. | Selective restriction fragment amplification : a general method for DNA fingerprinting |
WO2006137734A1 (en) | 2005-06-23 | 2006-12-28 | Keygene N.V. | Improved strategies for sequencing complex genomes using high throughput sequencing technologies |
WO2007062445A1 (en) | 2005-11-29 | 2007-06-07 | Lexogen Gmbh | Polynucleotide amplification |
WO2007073171A2 (en) | 2005-12-22 | 2007-06-28 | Keygene N.V. | Improved strategies for transcript profiling using high throughput sequencing technologies |
WO2008093098A2 (en) | 2007-02-02 | 2008-08-07 | Illumina Cambridge Limited | Methods for indexing samples and sequencing multiple nucleotide templates |
WO2009073629A2 (en) | 2007-11-29 | 2009-06-11 | Complete Genomics, Inc. | Efficient shotgun sequencing methods |
WO2009116863A2 (en) | 2008-03-17 | 2009-09-24 | Expressive Research B.V. | Expression-linked gene discovery |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DE19518505A1 (en) * | 1995-05-19 | 1996-11-21 | Max Planck Gesellschaft | Procedure for gene expression analysis |
US20050100911A1 (en) * | 2003-08-06 | 2005-05-12 | Perlegen Sciences, Inc. | Methods for enriching populations of nucleic acid samples |
-
2010
- 2010-02-03 EP EP10152498A patent/EP2354243A1/en not_active Withdrawn
-
2011
- 2011-02-02 CA CA2788583A patent/CA2788583A1/en not_active Abandoned
- 2011-02-02 EP EP11702031.3A patent/EP2531610B1/en active Active
- 2011-02-02 US US13/522,951 patent/US9334532B2/en active Active
- 2011-02-02 WO PCT/EP2011/051442 patent/WO2011095501A1/en active Application Filing
Patent Citations (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0534858A1 (en) | 1991-09-24 | 1993-03-31 | Keygene N.V. | Selective restriction fragment amplification : a general method for DNA fingerprinting |
WO2006137734A1 (en) | 2005-06-23 | 2006-12-28 | Keygene N.V. | Improved strategies for sequencing complex genomes using high throughput sequencing technologies |
WO2007062445A1 (en) | 2005-11-29 | 2007-06-07 | Lexogen Gmbh | Polynucleotide amplification |
WO2007073171A2 (en) | 2005-12-22 | 2007-06-28 | Keygene N.V. | Improved strategies for transcript profiling using high throughput sequencing technologies |
WO2008093098A2 (en) | 2007-02-02 | 2008-08-07 | Illumina Cambridge Limited | Methods for indexing samples and sequencing multiple nucleotide templates |
WO2009073629A2 (en) | 2007-11-29 | 2009-06-11 | Complete Genomics, Inc. | Efficient shotgun sequencing methods |
WO2009116863A2 (en) | 2008-03-17 | 2009-09-24 | Expressive Research B.V. | Expression-linked gene discovery |
Cited By (12)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2015067796A1 (en) * | 2013-11-08 | 2015-05-14 | Cartagenia N.V. | Genetic analysis method |
CN105874081A (en) * | 2013-11-08 | 2016-08-17 | 卡塔吉尼亚股份有限公司 | Genetic analysis method |
US9618474B2 (en) | 2014-12-18 | 2017-04-11 | Edico Genome, Inc. | Graphene FET devices, systems, and methods of using the same for sequencing nucleic acids |
US9857328B2 (en) | 2014-12-18 | 2018-01-02 | Agilome, Inc. | Chemically-sensitive field effect transistors, systems and methods for manufacturing and using the same |
US9859394B2 (en) | 2014-12-18 | 2018-01-02 | Agilome, Inc. | Graphene FET devices, systems, and methods of using the same for sequencing nucleic acids |
US10006910B2 (en) | 2014-12-18 | 2018-06-26 | Agilome, Inc. | Chemically-sensitive field effect transistors, systems, and methods for manufacturing and using the same |
US10020300B2 (en) | 2014-12-18 | 2018-07-10 | Agilome, Inc. | Graphene FET devices, systems, and methods of using the same for sequencing nucleic acids |
US10429381B2 (en) | 2014-12-18 | 2019-10-01 | Agilome, Inc. | Chemically-sensitive field effect transistors, systems, and methods for manufacturing and using the same |
US10429342B2 (en) | 2014-12-18 | 2019-10-01 | Edico Genome Corporation | Chemically-sensitive field effect transistor |
US10494670B2 (en) | 2014-12-18 | 2019-12-03 | Agilome, Inc. | Graphene FET devices, systems, and methods of using the same for sequencing nucleic acids |
US10607989B2 (en) | 2014-12-18 | 2020-03-31 | Nanomedical Diagnostics, Inc. | Graphene FET devices, systems, and methods of using the same for sequencing nucleic acids |
US10811539B2 (en) | 2016-05-16 | 2020-10-20 | Nanomedical Diagnostics, Inc. | Graphene FET devices, systems, and methods of using the same for sequencing nucleic acids |
Also Published As
Publication number | Publication date |
---|---|
EP2354243A1 (en) | 2011-08-10 |
US9334532B2 (en) | 2016-05-10 |
EP2531610B1 (en) | 2018-03-21 |
CA2788583A1 (en) | 2011-08-11 |
US20120289412A1 (en) | 2012-11-15 |
EP2531610A1 (en) | 2012-12-12 |
WO2011095501A8 (en) | 2011-11-10 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP2531610B1 (en) | Complexitiy reduction method | |
DK2002017T3 (en) | High-capacity detection of molecular markers based on restriction fragments | |
EP2513333B1 (en) | Restriction enzyme based whole genome sequencing | |
JP6110297B2 (en) | Combination sequence barcodes for high-throughput screening | |
EP1910563B1 (en) | Improved strategies for sequencing complex genomes using high throughput sequencing technologies | |
EP3555305B1 (en) | Method for increasing throughput of single molecule sequencing by concatenating short dna fragments | |
US8975028B2 (en) | Method for the identification of the clonal source of a restriction fragment | |
US20140336058A1 (en) | Method and kit for characterizing rna in a composition | |
AU2010329825B2 (en) | RNA analytics method | |
WO2018057779A1 (en) | Compositions of synthetic transposons and methods of use thereof | |
CN114207229A (en) | Flexible and high throughput sequencing of target genomic regions | |
US20180100180A1 (en) | Methods of single dna/rna molecule counting | |
US20210095339A1 (en) | Diagnostic and/ or Sequencing Method and Kit | |
CN116685696A (en) | Method for sequencing polynucleotide fragments from both ends |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 11702031 Country of ref document: EP Kind code of ref document: A1 |
|
WWE | Wipo information: entry into national phase |
Ref document number: 13522951 Country of ref document: US |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2011702031 Country of ref document: EP |
|
ENP | Entry into the national phase |
Ref document number: 2788583 Country of ref document: CA |
|
NENP | Non-entry into the national phase |
Ref country code: DE |