WO2011090664A1 - Method of detecting nucleic acids - Google Patents
Method of detecting nucleic acids Download PDFInfo
- Publication number
- WO2011090664A1 WO2011090664A1 PCT/US2010/061580 US2010061580W WO2011090664A1 WO 2011090664 A1 WO2011090664 A1 WO 2011090664A1 US 2010061580 W US2010061580 W US 2010061580W WO 2011090664 A1 WO2011090664 A1 WO 2011090664A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- target nucleic
- primer
- sequence
- oligonucleotide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
- C12Q1/683—Hybridisation assays for detection of mutation or polymorphism involving restriction enzymes, e.g. restriction fragment length polymorphism [RFLP]
Definitions
- the present invention relates to methods for detecting target nucleic acids.
- Detection, quantitation and analysis of polymorphic loci is useful for a variety of reasons, including identification of individuals (e.g., for paternity testing and in forensic science), for organ-transplant donor-recipient matching, for genetic and infectious disease diagnosis, disease prognosis, pre-natal counseling and the study of oncogenic mutations. Many of these applications depend on the discrimination of single-base differences, often at a multiplicity of loci. In many instances, numerous different nucleic acid samples are compared and catalogued.
- polymorphisms in specific nucleic acid sequences can be accomplished by a variety of methods. For example, restriction-fragment-length- polymorphism detection based on allele-specific restriction-endonuclease cleavage, hybridization with allele-specific oligonucleotide probes including immobilized
- oligonucleotides or oligonucleotide arrays allele-specific PCR, mismatch-repair detection (MRD), binding of MutS protein, denaturing-gradient gel electrophoresis (DGGE), single- strand-conformation-polymorphism detection, RNAase cleavage at mismatched base-pairs, chemical or enzymatic cleavage of heteroduplex DNA, allele specific primer extension, genetic bit analysis (GBA), the oligonucleotide-ligation assay (OLA), allele-specific ligation chain reaction (LCR), gap-LCR, radioactive and/or fluorescent DNA sequencing using standard procedures well known in the art, and peptide nucleic acid (PNA) assays are all methods that may be employed to detect nucleic acids.
- MRD mismatch-repair detection
- DGGE denaturing-gradient gel electrophoresis
- RNAase cleavage at mismatched base-pairs chemical or en
- Disclosed herein are methods for the detection of target nucleic acids in a sample including the steps of target capture onto a solid support, primer extension, restriction endonuclease cleavage, ligation of a detectably labeled oligonucleotide onto the captured target sequence, and detection of the labeled target nucleic acid.
- the methods may be used to detect mutations, allelic variants, or other sequence variations in target nucleic acids.
- the invention provides a method for detecting a target nucleic acid by: (a) capturing the target nucleic acid on a solid support; (b) contacting the captured target nucleic acid with a primer; (c) performing a primer extension reaction to form a captured double-stranded product; (d) cleaving the double-stranded product with a restriction endonuclease; (e) hybridizing a detectably-labeled, double-stranded oligonucleotide to the captured, cleaved double-stranded product to form a labeled target nucleic acid; and (f) detecting the labeled target nucleic acid.
- the target nucleic acid is amplified prior to step (a). If the target nucleic acid obtained from a sample is RNA, it may be reverse transcribed prior to or in conjunction with amplification.
- the amplification reaction uses at least one amplification primer that introduces a restriction endonuclease site into the amplified target nucleic acid.
- the target nucleic acid may be captured on the solid support by any suitable means including, for example, by hybridization to a support-bound oligonucleotide.
- the support-bound oligonucleotide is fully complementary to the 3 ' terminus of the target nucleic acid, or a region near the 3' terminus.
- Other exemplary capture methods include the use of a binding pair (e.g., antibody/antigen, biotin/avidin, etc.).
- the primer extension reaction uses an allele-specific primer including, for example, a primer capable of distinguishing among single nucleotide polymorphisms (SNPs) in a target nucleic acid.
- SNPs single nucleotide polymorphisms
- the restriction endonuclease cleaves the double-stranded primer extension product to create an asymmetrical terminus.
- the detectably-labeled oligonucleotide has an asymmetrical terminus which is complementary to that of the primer extension product following endonuclease digestion, and the two are hybridized.
- the detectably-labeled oligonucleotide is ligated (e.g., using a ligase) to the primer extension product.
- the detectable label is biotin which is optionally detected using a fluorescently-labeled anti-biotin antibody, or fluorescently- labeled avidin or streptavidin.
- sample is used in its broadest sense.
- a sample may include a bodily tissue or a bodily fluid including but not limited to blood (or a fraction of blood such as plasma or serum), lymph, mucus, tears, urine, and saliva.
- a sample may include an extract from a cell, a chromosome, organelle, or a virus.
- a sample may comprise DNA (e.g., genomic DNA), RNA (e.g., mRNA), and cDNA, any of which may be amplified to provide amplified nucleic acid.
- a sample may include nucleic acid in solution or bound to a substrate (e.g., as part of a microarray).
- a sample may comprise material obtained from an environmental locus (e.g. , a body of water, soil, and the like) or material obtained from a fomite (i.e., an inanimate object that serves to transfer pathogens from one host to another).
- hybridize or “specifically hybridize” refers to a process where two complementary nucleic acid strands anneal to each other under appropriately stringent conditions. Hybridizations are typically conducted with probe-length nucleic acid molecules. Nucleic acid hybridization techniques are well known in the art. See, e.g., Sambrook, et ah, 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, Plainview, N.Y. Those skilled in the art understand how to estimate and adjust the stringency of hybridization conditions such that sequences having at least a desired level of complementarity will stably hybridize, while those having lower
- nucleic acid refers broadly to segments of a chromosome, segments or portions of DNA, cDNA, and/or RNA. Nucleic acid may be derived or obtained from an originally isolated nucleic acid sample from any source (e.g., isolated from, purified from, amplified from, cloned from, or reverse transcribed from sample DNA or R A).
- rare nucleic acid refers to a nucleic acid that is in low abundance relative to the abundance of the most common nucleic acids in a sample.
- a rare nucleic acid will represent less than 10%, less than 5%, or less than 1% of the most common nucleic acid in the sample.
- oligonucleotide refers to a polymer composed of deoxyribonucleotides, ribonucleotides or any combination thereof and may optionally include synthetic nucleobase substitutes (e.g., acyclic bases, locked nucleic acids, etc.).
- the oligonucleotides used herein may be any length that is suitable or convenient for the intended purpose and may be single or double stranded. Double stranded oligonucleotides may have blunt ends (symmetrical), sticky ends (asymmetrical), or a combination of the two.
- oligonucleotides used as primers are typically single stranded and about 10, 15, 20, 25, 30, 35, 40, or 50 nucleotides in length or more.
- the oligonucleotides used to label the primer extension product, as described herein are typically double stranded, have at least one asymmetrical end (preferably fully complementary to an asymmetrical end on the primer extension product), and are about 10, 15, 20, 25, 30, 40, 50, 75, 100, 150, or 200 nucleotides in length or more.
- An oligonucleotide is "specific" for a nucleic acid if the oligonucleotide has at least 50% sequence identity with a portion of the nucleic acid when the oligonucleotide and the nucleic acid are aligned.
- An oligonucleotide that is specific for a nucleic acid is one that, under the appropriate hybridization or washing conditions, is capable of hybridizing to the target of interest and not substantially hybridizing to nucleic acids which are not of interest. Higher levels of sequence identity are preferred and include at least 75%, at least 80%, at least 85%), at least 90%>, at least 95% and more preferably at least 98%> sequence identity.
- stringency is used in reference to the conditions of temperature, ionic strength, and the presence of other compounds, under which nucleic acid hybridizations are conducted. With high stringency conditions, nucleic acid base pairing will occur only between nucleic acids that have sufficiently long segment with a high frequency of complementary base sequences.
- High stringency generally refers to conditions that permit hybridization of only those nucleic acid sequences that form stable hybrids in 0.018M NaCl at 65 °C.
- High stringency conditions can be provided, for example, by hybridization in 50% formamide, 5X Denhardt's solution, 5X SSC (saline sodium citrate) 0.2% SDS (sodium dodecyl sulphate) at 42 °C, followed by washing in 0. IX SSC, and 0.1 % SDS at 65 °C.
- Moderate stringency refers to conditions equivalent to hybridization in 50% formamide, 5X Denhardt's solution, 5X SSC, 0.2% SDS at 42 °C, followed by washing in 0.2X SSC, 0.2%) SDS, at 65 °C.
- Low stringency refers to conditions equivalent to
- a "primer” for amplification is an oligonucleotide that specifically anneals to a target or marker nucleotide sequence.
- the 3' nucleotide of the primer should be identical to the target or marker sequence at a corresponding nucleotide position for optimal primer extension by a polymerase.
- a "forward primer” is a primer that anneals to the anti-sense strand of dsDNA.
- a “reverse primer” anneals to the sense-strand of dsDNA.
- allele is any one of a number of alternative forms at a given locus (position) on a chromosome.
- An allele may be used to indicate one form of a polymorphism, for example, a biallelic SNP may have possible alleles A and B.
- An allele may also be used to indicate a particular combination of alleles of two or more SNPs in a given gene or chromosomal segment.
- an allele refers to one specific form of a genetic sequence (such as a gene) within a cell, an individual or within a population, the specific form differing from other forms of the same gene in the sequence of at least one, and frequently more than one, variant sites within the sequence of the gene. The sequences at these variant sites that differ between different alleles are termed "variances,"
- polymorphisms or “mutations.”
- locus a human possesses two alleles, one inherited from one parent and one from the other parent, for example one from the mother and one from the father.
- An individual is “heterozygous” at a locus if it has two different alleles at that locus.
- An individual is “homozygous” at a locus if it has two identical alleles at that locus.
- Mutations e.g., allelic differences
- an allele specific primer is meant a primer that hybridizes to a target sequence and is modified (i.e., extended) in an allele specific manner.
- an allele specific primer includes a 3 ' nucleotide complementary to the "mutant" SNP of a target sequence. If the allele-specific primer is used to interrogate a the wild-type sequence, the 3 ' nucleotide of the primer will not hybridize to the wild-type template (the primer and the template are mismatched at this position), thereby preventing primer extension. However, if the allele specific primer hybridizes to the mutant sequence including the SNP, the allele-specific primer is fully complementary at its 3' end and primer extension can occur under extension conditions.
- FIG. 1 is a schematic diagram of one of the signal amplification methods disclosed herein.
- FIG. 1 A shows a solid support, such as a bead, having an immobilized capture nucleic acid (indicated by the short segment attached at one end to the bead).
- a target nucleic acid of interest containing a SNP (SNP indicated by the gap in the target nucleic acid) is captured on the bead via the capture nucleic acid, wherein the target nucleic acid has been amplified using an amplification primer which introduces a non-naturally-occurring restriction enzyme cutting site indicated by the lightly shaded region of the target nucleic acid (located at the farthest end from the bead).
- the PCR amplification step is not shown.
- FIG. 1 A shows the hybridization to the target nucleic acid of an allele-specific primer (e.g., specific for the SNP of interest) and the resulting primer extension product indicated by the dashed lower line.
- FIG. IB shows that the double-stranded product resulting from the single primer extension reaction is cleaved using a restriction endonuclease specific for the non-naturally-occurring restriction enzyme cutting site introduced during target amplification (prior to capture).
- FIG 1C shows the resulting substrate-bound double stranded product following restriction enzyme digestion as having an asymmetric (sticky) end.
- FIG ID shows that the detectable signal from a single captured target nucleic acid may be amplified by hybridizing a double stranded oligonucleotide with complementary sticky ends having multiple detectable labels (biotin) to the asymmetric end.
- biotin-labeled oligonucleotide may be detected using a labeled anti-biotin antibody (e.g., an antibody labeled with phytoerythrin (PE)).
- PE phytoerythrin
- the disclosed methods are particularly useful for specifically detecting and amplifying the detectable signal associated with a rare target nucleic acid.
- the method involves capturing the target nucleic acid onto a solid support such as a bead, performing an allele-specific primer extension reaction using the captured target as template, cleaving the primer extension product using a restriction endonuclease preferably to generate a specific, "sticky end", ligating a labeled oligonucleotide to the "sticky end,” and detecting the detectable label.
- the target nucleic acid is amplified prior to capture on a solid support.
- the amplification reaction is used to introduce a nucleotide sequence, which encodes a restriction endonuclease site, into the amplicon.
- the introduced endonuclease site is cleaved to provide the sticky end complementary to the sticky end of the labeled oligonucleotide.
- the methods and compositions of this invention may be used to detect mutations, including SNPs, in target nucleic acids.
- the target nucleic acids may be obtained from any convenient source including, for example, biological samples (e.g., body fluids such as blood, serum, plasma, saliva, etc.), tissue samples (e.g., biopsy samples), and isolated cells (e.g., lymphocytes)) obtained from an individual, environmental samples, cell cultures, etc.
- the nucleic acids may be from any organism of interest including mammals (e.g., humans), bacteria, and viruses.
- the nucleic acid (DNA or R A) may be isolated from the sample according to any methods well known to those of skill in the art.
- Biological samples may be obtained by standard procedures and may be used immediately or stored, under conditions appropriate for the type of biological sample, for later use. [0025] Methods of obtaining test samples are well known to those of skill in the art and include, but are not limited to, aspirations, tissue sections, drawing of blood or other fluids, surgical or needle biopsies, and the like.
- the test sample may be obtained from an individual or patient.
- the test sample may be a cell-containing liquid or a tissue.
- Samples may include, but are not limited to, amniotic fluid, biopsies, blood, blood cells, bone marrow, fine needle biopsy samples, peritoneal fluid, amniotic fluid, plasma, pleural fluid, saliva, semen, serum, tissue or tissue homogenates, frozen or paraffin sections of tissue. Samples may also be processed, such as sectioning of tissues, fractionation, purification, or cellular organelle separation.
- the sample may be collected or concentrated by centrifugation and the like.
- the cells of the sample may be subjected to lysis, such as by treatments with enzymes, heat, surfactants, ultrasonication, or a combination thereof.
- the lysis treatment is performed in order to obtain a sufficient amount of nucleic acid derived from the individual's cells to detect using polymerase chain reaction.
- target nucleic acids may be isolated from an acellular bodily fluid.
- Methods of plasma and serum preparation are well known in the art. Either "fresh" blood plasma or serum, or frozen (stored) and subsequently thawed plasma or serum may be used. Frozen (stored) plasma or serum should optimally be maintained at storage conditions of -20 to -70°C until thawed and used. "Fresh” plasma or serum should be refrigerated or maintained on ice until used, with nucleic acid (e.g., RNA, DNA or total nucleic acid) extraction being performed as soon as possible. Exemplary methods are described below.
- nucleic acid e.g., RNA, DNA or total nucleic acid
- Blood can be drawn by standard methods into a collection tube, typically siliconized glass, either without anticoagulant for preparation of serum, or with EDTA, sodium citrate, heparin, or similar anticoagulants for preparation of plasma. If preparing plasma or serum for storage, although not an absolute requirement, is that plasma or serum is first fractionated from whole blood prior to being frozen. This reduces the burden of extraneous intracellular RNA released from lysis of frozen and thawed cells which might reduce the sensitivity of the amplification assay or interfere with the amplification assay through release of inhibitors to PCR such as porphyrins and hematin.
- Frsh plasma or serum may be fractionated from whole blood by centrifugation, using gentle centrifugation at 300-800 times gravity for five to ten minutes, or fractionated by other standard methods. High centrifugation rates capable of fractionating out apoptotic bodies should be avoided. Since heparin may interfere with RT- PCR, use of heparinized blood may require pretreatment with heparanase, followed by removal of calcium prior to reverse transcription. Imai, H., et al., J. Virol. Methods 36:181- 184, (1992). Thus, EDTA is a suitable anticoagulant for blood specimens in which PCR amplification is planned.
- the nucleic acid to be amplified may be from a biological sample such as an organism, cell culture, tissue sample, and the like.
- the biological sample can be from a subject which includes any animal, preferably a mammal.
- a preferred subject is a human, which may be a patient presenting to a medical provider for diagnosis or treatment of a disease.
- the biological sample may be obtained from a stage of life such as a fetus, young adult, adult, and the like.
- RNA extraction Various methods of extraction are suitable for isolating the DNA or RNA. Suitable methods include phenol and chloroform extraction. See Maniatis et al., Molecular Cloning, A Laboratory Manual, 2d, Cold Spring Harbor Laboratory Press, page 16.54 (1989).
- RNA may be extracted from patient blood/bone marrow samples using MagNA Pure LC mRNA HS kit and Mag NA Pure LC Instrument (Roche Diagnostics Corporation, Roche Applied Science, Indianapolis, IN).
- Nucleic acid extracted from tissues, cells, plasma or serum can be amplified using nucleic acid amplification techniques well know in the art. Many of these amplification methods can also be used to detect the presence of mutations simply by designing oligonucleotide primers or probes to interact with or hybridize to a particular target sequence in a specific manner.
- these techniques can include the polymerase chain reaction (PCR), reverse transcriptase polymerase chain reaction (RT-PCR), nested PCR, ligase chain reaction. See Abravaya, K., et al, Nucleic Acids Research, 23:675-682, (1995), branched DNA signal amplification, Urdea, M.
- RNA reporters S., et al, AIDS, 7 (suppl 2):S11-S 14, (1993), amplifiable RNA reporters, Q-beta replication, transcription-based amplification, boomerang DNA amplification, strand displacement activation, cycling probe technology, isothermal nucleic acid sequence based amplification (NASBA).
- NASBA isothermal nucleic acid sequence based amplification
- RNA to cDNA Some methods employ reverse transcription of RNA to cDNA. As noted, the method of reverse transcription and amplification may be performed by previously published or recommended procedures, which referenced publications are incorporated herein by reference in their entirety.
- Various reverse transcriptases may be used, including, but not limited to, MMLV RT, RNase H mutants of MMLV RT such as Superscript and Superscript II (Life Technologies, GIBCO BRL, Gaithersburg, Md.), AMV RT, and thermostable reverse transcriptase from Thermus Thermophilus .
- RNA extracted from plasma or serum is the protocol adapted from the Superscript II Preamplification system (Life Technologies, GIBCO BRL, Gaithersburg, Md.; catalog no. 18089-011), as described by Rashtchian, A., PCR Methods Applic, 4:S83-S91, (1994).
- PCR is a technique for making many copies of a specific template DNA sequence.
- the reaction consists of multiple amplification cycles and is initiated using a pair of primer sequences that hybridize to the 5' and 3' ends of the sequence to be copied.
- the amplification cycle includes an initial denaturation, and typically up to 50 cycles of annealing, strand elongation and strand separation (denaturation).
- the DNA sequence between the primers is copied.
- Primers can bind to the copied DNA as well as the original template sequence, so the total number of copies increases exponentially with time.
- PCR can be performed as according to Whelan, et al, J of Clin Micro, 33(3):556-561(1995).
- a PCR reaction mixture includes two specific primers, dNTPs, approximately 0.25 U of Taq polymerase, and lx PCR Buffer.
- LCR is a method of DNA amplification similar to PCR, except that it uses four primers instead of two and uses the enzyme ligase to ligate or join two segments of DNA. LCR can be performed as according to Moore et al., J Clin Micro, 36(4): 1028-1031 (1998). Briefly, an LCR reaction mixture contains two pair of primers, dNTP, DNA ligase and DNA polymerase representing about 90 ⁇ , to which is added 100 ⁇ of isolated nucleic acid from the target organism. Amplification is performed in a thermal cycler ⁇ e.g. , LCx of Abbott Labs, Chicago, IL).
- TAS is a system of nucleic acid amplification in which each cycle is comprised of a cDNA synthesis step and an RNA transcription step.
- a sequence recognized by a DNA-dependent RNA polymerase ⁇ i.e., a polymerase-binding sequence or PBS
- PBS polymerase-binding sequence
- an RNA polymerase is used to synthesize multiple copies of RNA from the cDNA template.
- TAS DNA-dependent RNA transcription can result in 10-1000 copies for each copy of cDNA template.
- TAS can be performed according to Kwoh et al, PNAS, 86: 1173-7 (1989). Briefly, extracted RNA is combined with TAS amplification buffer and bovine serum albumin, dNTPs, NTPs, and two oligonucleotide primers, one of which contains a PBS. The sample is heated to denature the RNA template and cooled to the primer annealing temperature. Reverse transcriptase (RT) is added the sample incubated at the appropriate temperature to allow cDNA elongation.
- RT reverse transcriptase
- RNA polymerase is added and the sample is incubated at 37°C for approximately 25 minutes for the synthesis of RNA. The above steps are then repeated.
- both RT and RNA polymerase are added following a 1 minute 100°C denaturation followed by an RNA elongation of approximately 30 minutes at 37°C.
- TAS can be also be performed on solid phase as according to Wylie et al., J Clin Micro, 36(12):3488-3491 (1998). In this method, nucleic acid targets are captured with magnetic beads containing specific capture primers.
- the beads with captured targets are washed and pelleted before adding amplification reagents which contains amplification primers, dNTP, NTP, 2500 U of reverse transcriptase and 2500 U of T7 RNA polymerase.
- amplification reagents which contains amplification primers, dNTP, NTP, 2500 U of reverse transcriptase and 2500 U of T7 RNA polymerase.
- a 100 ⁇ TMA reaction mixture is placed in a tube, 200 ⁇ oil reagent is added and
- NASBA is a transcription-based amplification method which amplifies RNA from either an RNA or DNA target.
- NASBA is a method used for the continuous amplification of nucleic acids in a single mixture at one temperature.
- avian myeloblastosis virus (AMV) reverse transcriptase, RNase H and T7 RNA polymerase are used. This method can be performed as according to Heim, et ah, Nucleic Acids Res., 26(9):2250-2251 (1998).
- an NASBA reaction mixture contains two specific primers, dNTP, NTP, 6.4 U of AMV reverse transcriptase, 0.08 U of Escherichia coli Rnase H, and 32 U of T7 RNA polymerase.
- the amplification is carried out for 120 min at 41 °C in a total volume of 20 ⁇ .
- a variety of amplification enzymes are well known in the art and include, for example, DNA polymerase, RNA polymerase, reverse transcriptase, Q-beta replicase, thermostable DNA and RNA polymerases. Because these and other amplification reactions are catalyzed by enzymes, in a single step assay the nucleic acid releasing reagents and the detection reagents should not be potential inhibitors of amplification enzymes if the ultimate detection is to be amplification based.
- Amplification methods suitable for use with the present methods include, for example, strand displacement amplification, rolling circle amplification, primer extension preamplification, or degenerate oligonucleotide PCR (DOP). These methods of amplification are well known in the art and each described briefly below.
- PCR is used to amplify a target or marker sequence of interest.
- the skilled artisan is capable of designing and preparing primers that are
- the length of the amplification primers depends on several factors including the nucleotide sequence identity and the temperature at which these nucleic acids are hybridized or used during in vitro nucleic acid amplification. The considerations necessary to determine a preferred length for an amplification primer of a particular sequence identity are well-known to a person of ordinary skill. For example, the length of a short nucleic acid or oligonucleotide can relate to its hybridization specificity or selectivity.
- the target nucleic acid naturally contains a restriction endonuclease cutting site which is located 5 ' to the mutation of interest (which will be later analyzed) in the target nucleic acid amplification product.
- the target nucleic acid may be amplified without further modification.
- an amplification primer may include two regions: a complementary region and a non-complementary region.
- the complementary region comprises the 3' portion of the primer, which hybridizes to the target sequence.
- the non-complementary region comprises the 5' portion of the primer, and does not hybridize to the target sequence.
- the primer is extended from its 3 ' end to form an amplicon comprising: 1) the non-complementary region of the primer, 2) the complementary region of the primer and 3) the complement of the target sequence.
- the non-complementary region is amplified along with the target sequence resulting in an amplicon population including the additional 5 ' non-complementary sequence(s).
- a restriction endonuclease site is incorporated into the non-complementary region of an amplification primer, resulting in an amplicon which includes the target sequence and the non-complementary region that comprises the restriction endonuclease site.
- a capture sequence is incorporated into the non- complementary region of an amplification primer, resulting in an amplicon which includes the target sequence and a sequence complementary to a capture oligonucleotide, which can be bound to a solid support (e.g., a bead).
- a first primer includes a capture sequence in the non-complementary region and a second primer includes a restriction endonuclease sequence in the non-complementary region.
- the amplicon generated using the first and second primer includes (from 3 ' to 5') a sequence which will hybridize to a capture oligonucleotide (see below), the target sequence and a restriction endonuclease site.
- solid support any material that is appropriate for or can be modified to be appropriate for the attachment of nucleic acid sequences.
- substrates include, but are not limited to, unmodified and modified or functionalized glass, plastics (including acrylics, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethanes, TeflonTM, etc.), polysaccharides, nylon or nitrocellulose, ceramics, resins, silica or silica-based materials including silicon and modified silicon, carbon, metals, inorganic glasses, plastics, optical fiber bundles, and a variety of other polymers. Magnetic beads and high throughput microtiter plates can also be used.
- composition and geometry of the solid support vary with its use and may include glat surfaces, wells of a plate, tubes, or beads. In some embodiments, supports comprising microspheres or beads are used. By “microspheres” or “beads” or “particles” is meant small discrete particles.
- the composition of the beads will vary, depending on the material used to form the bead and the method of synthesis.
- Suitable bead compositions include those used in peptide, nucleic acid and organic moiety synthesis, including, but not limited to, plastics, ceramics, glass, polystyrene, methylstyrene, acrylic polymers, paramagnetic materials, thoria sol, carbon graphited, titanium dioxide, latex or cross-linked dextrans such as Sepharose, cellulose, nylon, cross-linked micelles and Teflon.
- the beads are LuminexTM beads.
- the beads need not be spherical; irregular particles may be used.
- the beads may be porous, thus increasing the surface area of the bead available for assay.
- the bead sizes range from nanometers, i.e. 100 nm, to millimeters, i.e. 1 mm, with beads from about 0.2 micron to about 200 microns being preferred, and from about 0.5 to about 5 micron being particularly preferred, although in some embodiments smaller beads may be used.
- the target sequence may be captured onto a solid support by any convenient method.
- complementary oligonucleotides (capture nucleic acids) are linked to the solid support and are used to capture, via hybridization, the target nucleic acid as depicted in FIG 1 A.
- the target nucleic acid includes a sequence such as poly-A or poly-T and the capture oligonucleotide sequence includes the complement.
- the capture oligonucleotide may be linked to the solid support (e.g., a LuminexTM bead) by methods well known in the art.
- the capture oligonucleotides may include amino, AcryditeTM, or thiol modification and may be covalently linked to the solid support via activated carboxylate groups or succinimidyl esters (amino modified oligonucleotides), alkylating reagents such as an iodoacetamide or maleimide (thiol-modified oligonucleotides), or thoiethers (Acrydite-modified oligonucleotides).
- the target nucleic acids may be modified to contain one member of a binding pair and the solid substrate contain the other binding pair member.
- biotin may be attached to the target nucleic acid which is subsequently captured on the solid support by immobilized
- Solid supports e.g., glass or silicon surfaces
- Oligonucleotides modified with amine groups can be immobilized onto such coatings.
- primer extension reaction As illustrated in FIG 1 , following target nucleic acid capture on the solid support, a single primer extension reaction is performed and the reaction products are not melted (separated).
- the primer extension reaction should be specific for the target nucleic acid of interest.
- a target-specific primer is used and is the basis for distinguishing between the target nucleic acid and other closely related but non-target species.
- oligonucleotide primers specific for alternative alleles i.e., allele-specific primer extension (ASPE)
- AZA allele-specific primer extension
- allele-specific primers Such oligonucleotides which detect single nucleotide variations in target sequences may be referred to by such terms as "allele-specific primers”.
- allele-specific primers The design and use of allele- specific primers for analyzing polymorphisms is described in, e.g., Mutation Detection A Practical Approach, ed. Cotton et al.
- a primer may be designed to hybridize to a segment of target DNA such that the SNP aligns with either the 3' most end of the primer. The result is that the primer only efficiently primes an extension reaction of an allelic form to which the primer exhibits perfect complementarity at the 3 -most nucleotide (Gibbs, 1989, Nucleic Acid Res., 17:2427-2448). The single-base mismatch at the 3 '-most nucleotide prevents amplification or substantially reduces priming efficiency (see, e.g., WO 93/22456).
- the methods disclosed herein include the use of restriction enzymes to cleave a nucleic acid sample.
- a restriction enzyme recognizes a specific nucleotide sequence of four to eight nucleotides and cuts the nucleic acid at a site within or a specific distance from the recognition sequence.
- the restriction enzyme EcoRI recognizes the sequence GAATTC and will cut a DNA molecule between the G and the first A.
- the length of the recognition sequence is roughly proportional to the frequency of occurrence of the site in the genome.
- restriction endonucleases cleave the polynucleotide at the appropriate recognition sequence and leave an asymmetrical terminus, that is, an overhang of one strand of the sequence, often termed "sticky end.”
- Other restriction endonucleases have a cleavage recognitions sequence which leaves “blunt ends.” While a restriction endonuclease which results in a sticky end is optimal in some restriction endonucleases
- blunt end restriction endonucleases may also be used.
- Numerous restriction endonucleases are well known in the art and are commercially available (e.g., for a description of many restriction enzymes and their recognition sites and optimal buffer conditions see e.g., J. Sambrook and T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press (2001); New England BioLabs Catalog; Promega Corporation catalog, each of which is incorporated by reference).
- a short, exemplary, non-limiting list of restriction endonucleases which result in a "sticky end" is provided in the table below. For the cases in which a restriction endonuclease cutting site must be engineered into the target nucleic acid, any convenient cutting may be used.
- a cutting is used which is not present in the target nucleic acid in order to avoid inappropriate cleavage of the primer extension product.
- a restriction enzyme site is used which is not normally found in the genome of the organism from which the target nucleic acid is drawn.
- "sticky ends" resulting from restriction endonuclease cleavage may be converted to blunt-ends via a nucleotide polymerase "fill-in” reaction.
- a nucleotide polymerase "fill-in” reaction Any number of well known polymerase enzymes in conjunction with deoxyribonucleotides may be used; such fill-in reactions are well known in the art (see e.g., J. Sambrook and T.
- the product is labeled using a oligonucleotide having one or more detectable labels.
- the oligonucleotide is double-stranded and has one asymmetrical (sticky) end that is fully complementary to the asymmetrical end resulting from endonuclease digestion, such that the oligonucleotide specifically hybridizes to the primer extension product.
- the oligonucleotide contains 2, 3, 4, 5, 7, 10, 15, 20, or more individual detectable labels.
- Suitable oligonucleotides are 10, 15, 20, 25, 30, 40, 50, 75, 100, 150, 200, or more nucleotides in length.
- the oligonucleotide may be ligated to the primer extension product or may be left unligated, but hybridized.
- Non- limiting methods include the use of T4 DNA Ligase which catalyzes the formation of a phosphodiester bond between juxtaposed 5' phosphate and 3' hydroxyl termini in duplex DNA or RNA with blunt and sticky ends; Taq DNA Ligase which catalyzes the formation of a phosphodiester bond between juxtaposed 5' phosphate and 3' hydroxyl termini of two adjacent oligonucleotides which are hybridized to a complementary target DNA; E.
- coli DNA ligase which catalyzes the formation of a phosphodiester bond between juxtaposed 5 '-phosphate and 3 '-hydroxyl termini in duplex DNA containing cohesive ends; and T4 RNA ligase which catalyzes ligation of a 5' phosphoryl-terminated nucleic acid donor to a 3' hydroxyl-terminated nucleic acid acceptor through the formation of a 3'->5' phosphodiester bond
- substrates include single-stranded RNA and DNA as well as
- labels are chemical or biochemical moieties useful for labeling a nucleic acid.
- Labels include fluorescent agents, chemiluminescent agents, chromogenic agents, quenching agents, radionuclides, enzymes, substrates, cofactors, inhibitors, magnetic particles, electrochemiluminescent labels, ligands having specific binding partners, or any other labels that can interact with each other to enhance, alter, or diminish a signal.
- Labelels or “reporter molecules” are capable of generating a measurable signal and may be covalently or noncovalently joined to an oligonucleotide.
- the oligonucleotide is labeled with one or more biotin molecules which may be detected using a labeled anti-biotin antibody, a labeled avidin moiety, or a labeled strepavidin moiety.
- the labels can be attached to the nucleotides, including non-natural bases, or oligonucleotides directly or indirectly by a variety of techniques. Depending upon the precise type of label used, the label can be located at the 5' or 3' end of the oligonucleotide, located internally in the oligonucleotide sequence, or attached to spacer arms extending from the reporter and having various sizes and compositions.
- oligonucleotides containing functional groups e.g., thiols or primary amines
- functional groups e.g., thiols or primary amines
- Factor V Leiden A region of genomic Factor V nucleic acid containing two potential mutation sites is as follows:
- the first stretch of lower case bases represents sequences from intron 9, while the second stretch of lower case bases represents sequence from intron 10.
- the capitalized bases are sequences from exon 10 with the first bold R being position 1628 and the second bold R being position 1691 (the Factor V Leiden position).
- An R indicates either a G or A, while the wild-type Factor V would have a G at both of these positions.
- Standard nucleic acid isolation techniques can be used to isolate genomic DNA from white blood cells.
- genomic DNA can be precipitated by ethyl alcohol and re-dissolved in TE buffer (10 mM Tris, 1 mM EDTA, pH 8.0).
- TE buffer 10 mM Tris, 1 mM EDTA, pH 8.0.
- concentration of genomic DNA from each patient may vary, but a concentration generally around 50 mg/ ⁇ would be adequate for the methods described herein.
- Amplification primers can be designed using methods and software well known in the art (e.g., PRIME (by GCG); Primer3 available on-line from the Whitehead Institute; GeneFisher; xprimer; WebPrimer; EMBL Primer Design, also available on-line) to amplify the region of the Factor V gene which includes either one or both of the mutations.
- One of the primers can be designed to include a restriction endonuclease cleavage site at its 5 ' end that is not present in the region of the Factor V gene to be amplified.
- the EcoRI restriction endonuclease site (G*AATC) is incorporated into the primer.
- the other of the primers is designed to include a sequence complementary to a capture oligonucleotide linked to a solid support.
- the capture sequence is poly-G and the solid support includes oligonucleotides including poly-C.
- the target DNA is amplified using methods and equipment well known in the art.
- the amplified product which will include (5' to 3') the Eco RI restriction endonuclease site, the target Factor V site, and a capture site (e.g., poly G or poly C), can then be denatured for capture onto solid support.
- LuminexTM beads linked to capture oligonucleotides which are complementary to one end of the amplified target oligonucleotides (the capture end, versus the restriction endonuclease end), are used to capture one of the denatured, amplified target strands which includes the target Factor V site and the restriction endonuclease site.
- An allele specific primer can be designed to include sequence 5' to 1628 or 5' to 1691 of Factor V and include a 3' nucleotide complementary to the Factor V Leiden mutant base (i.e., complementary to either an A or a T).
- a single round of a primer extension reaction is then carried out according to methods well known in the art. If the mutant Factor V Leiden sequence is present in the captured target, then a double-stranded product which includes both the Factor V Leiden mutant sequence and the restriction endonuclease site will be generated. If the captured sequence does not include the Factor V Leiden mutation, no extension will occur and the captured sequence will remain single stranded.
- the double-stranded product is exposed to the restriction endonuclease Eco RI in appropriate buffer and temperature conditions optimized for enzyme function (e.g., 50 mM Tris-HCl (pH 7.5 at 37°C), 10 mM MgCl 2 , 100 mM NaCl, 0.02% Triton X-100 and 0.1 mg/ml BSA; incubate at 37°C).
- the restriction enzyme will cleave only the double-stranded extension product (i.e., including the Factor V Leiden mutation) and will not cleave the single stranded "wild-type" Factor V sequence.
- the restriction enzyme is removed from the reaction mixtures (e.g., by washing) and the cleaved target nucleic acid is contacted, under hybridization conditions, with a biotin labeled, double- stranded oligonucleotide. At least one end of the labeled, double-stranded oligonucleotide is compatible with the "sticky end" of the captured target nucleic acid formed by Eco RI cleavage, allowing the compatible sticky ends of the oligonucleotide and the target to hybridize.
- ligase is then added to the reaction mixtures under conditions well known in the art, and the labeled oligonucleotide is then ligated to the target.
- the biotin labeled target is then detected using a phycoerythrin (PE)-labeled anti- biotin antibody.
- PE fluorescence is detected using flow cytometry.
- a three nucleotide deletion which codes for phenylalanine in exon 10 of the cystic fibrosis gene, is associated with cystic fibrosis.
- the mutation known as delta F508, is present in over 90% of individuals diagnosed with cystic fibrosis.
- the nucleotide sequence of a region of the wild-type cystic fibrosis gene is shown below.
- the three nucleotides which are deleted in the F508 mutant are in bold and underlined.
- Sample preparation can be performed as described above in Example 1. That is, genomic DNA isolated from blood or tissue samples using standard nucleic acid isolation techniques can be precipitated by ethyl alcohol and re-dissolved in TE buffer (10 mM Tris, 1 mM EDTA, pH 8.0).
- Amplification primers can be designed using methods well known in the art to amplify the region of the cystic fibrosis gene which includes the F508 mutation (see e.g., Experimental Example LB above).
- One of the primers is designed to include a restriction endonuclease cleavage site at its 5' end that is not present in the CFTR gene.
- the Hind III restriction endonuclease site (A*AGCTT; SEQ ID NO.: 15) is incorporated into the primer.
- one of the primers is designed to include a sequence complementary to a capture oligonucleotide linked to a solid support.
- the capture sequence is poly-G and the solid support includes oligonucleotides including poly-C.
- the target DNA is amplified using methods and equipment well known in the art.
- the amplified product which will include (5' to 3') the Hind III restriction endonuclease site, the target F508 site, and a capture site (e.g., poly G or poly C), can then be denatured for capture onto solid support.
- LuminexTM beads linked to capture oligonucleotides which are complementary to one end of the amplified target oligonucleotides (the capture end, versus the restriction endonuclease end), are used to capture one of the denatured, amplified target strands which includes the target F508 sequence and the restriction endonuclease site.
- Allele-specific primer extension is used to capture one of the denatured, amplified target strands which includes the target F508 sequence and the restriction endonuclease site.
- An allele specific primer can be designed to include a 3' nucleotide sequence that will not hybridize to the wild-type cystic fibrosis nucleotide sequence at the F508 position, but will hybridize to the 508 mutant.
- the 3' region of the allele-specific primer includes the sequence CACCAAT-3' (SEQ ID NO.: 16) for detection of the deletion mutant (i.e., excludes nucleotides complementary to the three nucleotides of the deletion mutant).
- the wildtype allele is detected using an allele-specific primer having a 3 '-terminus including the sequence CACCAAG-3' (SEQ ID NO.: 17).
- a single round of a primer extension reaction is then carried out according to methods well known in the art. If the F508 mutant sequence is present in the captured target, then a double-stranded product which includes both the F508 mutant sequence and the Hind III restriction endonuclease site will be generated. If the captured sequence does not include the F508 mutation, no extension will occur and the captured sequence will remain single stranded.
- the double-stranded product is exposed to the restriction endonuclease Hind III in appropriate buffer and temperature conditions optimized for enzyme function (e.g., 10 mM Tris-HCl, 50 mM NaCl, 10 mM MgCl 2 , 1 mM Dithiothreitol, pH 7.9 at 25°C).
- the restriction enzyme will cleave only the double-stranded extension product (i.e., including the F508 mutation) and will not cleave the single stranded "wild-type" cystic fibrosis sequence.
- the restriction enzyme is removed from the reaction mixtures (e.g., by washing) and the cleaved target nucleic acid is contacted, under hybridization conditions, with a fluorescently labeled, double-stranded oligonucleotide as described above for Factor V. At least one end of the labeled, double-stranded oligonucleotide is compatible with the "sticky end" of the captured target nucleic acid formed by Hind III cleavage, allowing the compatible sticky ends of the oligonucleotide and the target to hybridize.
- the fluorescently labeled target is then detected by methods and equipment well known in the art.
- the fluorescent label is detected using flow cytometry.
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Disclosed herein are methods for the labeling and/or detection of target nucleic acids. The methods utilize a unique combination of molecular techniques, including nucleic acid capture onto a solid support, allele-specific primer extension, restriction endonuclease cleavage and ligation of a labeled, double-stranded oligonucleotide onto the captured target sequence. Some methods include amplification of the target sequence and incorporation of a unique restriction site into the target amplicon.
Description
METHOD OF DETECTING NUCLEIC ACIDS
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims benefit of U.S. Provisional Application No. 61/291 ,306, filed December 30, 2009.
FIELD OF THE INVENTION
[0002] The present invention relates to methods for detecting target nucleic acids.
BACKGROUND OF THE INVENTION
[0003] Detection, quantitation and analysis of polymorphic loci is useful for a variety of reasons, including identification of individuals (e.g., for paternity testing and in forensic science), for organ-transplant donor-recipient matching, for genetic and infectious disease diagnosis, disease prognosis, pre-natal counseling and the study of oncogenic mutations. Many of these applications depend on the discrimination of single-base differences, often at a multiplicity of loci. In many instances, numerous different nucleic acid samples are compared and catalogued.
[0004] The detection of polymorphisms in specific nucleic acid sequences can be accomplished by a variety of methods. For example, restriction-fragment-length- polymorphism detection based on allele-specific restriction-endonuclease cleavage, hybridization with allele-specific oligonucleotide probes including immobilized
oligonucleotides or oligonucleotide arrays, allele-specific PCR, mismatch-repair detection (MRD), binding of MutS protein, denaturing-gradient gel electrophoresis (DGGE), single- strand-conformation-polymorphism detection, RNAase cleavage at mismatched base-pairs, chemical or enzymatic cleavage of heteroduplex DNA, allele specific primer extension, genetic bit analysis (GBA), the oligonucleotide-ligation assay (OLA), allele-specific ligation chain reaction (LCR), gap-LCR, radioactive and/or fluorescent DNA sequencing using standard procedures well known in the art, and peptide nucleic acid (PNA) assays are all methods that may be employed to detect nucleic acids.
SUMMARY OF THE INVENTION
[0005] Disclosed herein are methods for the detection of target nucleic acids in a sample including the steps of target capture onto a solid support, primer extension, restriction endonuclease cleavage, ligation of a detectably labeled oligonucleotide onto the captured target sequence, and detection of the labeled target nucleic acid. The methods may be used to detect mutations, allelic variants, or other sequence variations in target nucleic acids.
[0006] In one aspect, the invention provides a method for detecting a target nucleic acid by: (a) capturing the target nucleic acid on a solid support; (b) contacting the captured target nucleic acid with a primer; (c) performing a primer extension reaction to form a captured double-stranded product; (d) cleaving the double-stranded product with a restriction endonuclease; (e) hybridizing a detectably-labeled, double-stranded oligonucleotide to the captured, cleaved double-stranded product to form a labeled target nucleic acid; and (f) detecting the labeled target nucleic acid.
[0007] Optionally, the target nucleic acid is amplified prior to step (a). If the target nucleic acid obtained from a sample is RNA, it may be reverse transcribed prior to or in conjunction with amplification. In one embodiment, the amplification reaction uses at least one amplification primer that introduces a restriction endonuclease site into the amplified target nucleic acid.
[0008] The target nucleic acid may be captured on the solid support by any suitable means including, for example, by hybridization to a support-bound oligonucleotide. Preferably, the support-bound oligonucleotide is fully complementary to the 3 ' terminus of the target nucleic acid, or a region near the 3' terminus. Other exemplary capture methods include the use of a binding pair (e.g., antibody/antigen, biotin/avidin, etc.).
[0009] In one embodiment, the primer extension reaction uses an allele-specific primer including, for example, a primer capable of distinguishing among single nucleotide polymorphisms (SNPs) in a target nucleic acid.
[0010] In another embodiment, the restriction endonuclease cleaves the double-stranded primer extension product to create an asymmetrical terminus. In this embodiment, the
detectably-labeled oligonucleotide has an asymmetrical terminus which is complementary to that of the primer extension product following endonuclease digestion, and the two are hybridized. Optionally, the detectably-labeled oligonucleotide is ligated (e.g., using a ligase) to the primer extension product. In other embodiments, the detectable label is biotin which is optionally detected using a fluorescently-labeled anti-biotin antibody, or fluorescently- labeled avidin or streptavidin.
[0011] As used herein, the term " sample" is used in its broadest sense. A sample may include a bodily tissue or a bodily fluid including but not limited to blood (or a fraction of blood such as plasma or serum), lymph, mucus, tears, urine, and saliva. A sample may include an extract from a cell, a chromosome, organelle, or a virus. A sample may comprise DNA (e.g., genomic DNA), RNA (e.g., mRNA), and cDNA, any of which may be amplified to provide amplified nucleic acid. A sample may include nucleic acid in solution or bound to a substrate (e.g., as part of a microarray). A sample may comprise material obtained from an environmental locus (e.g. , a body of water, soil, and the like) or material obtained from a fomite (i.e., an inanimate object that serves to transfer pathogens from one host to another).
[0012] As used herein, the term "hybridize" or "specifically hybridize" refers to a process where two complementary nucleic acid strands anneal to each other under appropriately stringent conditions. Hybridizations are typically conducted with probe-length nucleic acid molecules. Nucleic acid hybridization techniques are well known in the art. See, e.g., Sambrook, et ah, 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, Plainview, N.Y. Those skilled in the art understand how to estimate and adjust the stringency of hybridization conditions such that sequences having at least a desired level of complementarity will stably hybridize, while those having lower
complementarity will not. For examples of hybridization conditions and parameters, see, e.g., Sambrook, et ah, 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, Plainview, N.Y.; Ausubel, F. M. et al. 1994, Current Protocols in Molecular Biology. John Wiley & Sons, Secaucus, N.J.
[0013] As used herein, "nucleic acid" refers broadly to segments of a chromosome, segments or portions of DNA, cDNA, and/or RNA. Nucleic acid may be derived or obtained
from an originally isolated nucleic acid sample from any source (e.g., isolated from, purified from, amplified from, cloned from, or reverse transcribed from sample DNA or R A).
[0014] As used herein, "rare nucleic acid" refers to a nucleic acid that is in low abundance relative to the abundance of the most common nucleic acids in a sample. For example, a rare nucleic acid will represent less than 10%, less than 5%, or less than 1% of the most common nucleic acid in the sample.
[0015] As used herein, the term "oligonucleotide" refers to a polymer composed of deoxyribonucleotides, ribonucleotides or any combination thereof and may optionally include synthetic nucleobase substitutes (e.g., acyclic bases, locked nucleic acids, etc.). The oligonucleotides used herein may be any length that is suitable or convenient for the intended purpose and may be single or double stranded. Double stranded oligonucleotides may have blunt ends (symmetrical), sticky ends (asymmetrical), or a combination of the two. For example, oligonucleotides used as primers (primers for amplification or other primer extension reactions) are typically single stranded and about 10, 15, 20, 25, 30, 35, 40, or 50 nucleotides in length or more. The oligonucleotides used to label the primer extension product, as described herein, are typically double stranded, have at least one asymmetrical end (preferably fully complementary to an asymmetrical end on the primer extension product), and are about 10, 15, 20, 25, 30, 40, 50, 75, 100, 150, or 200 nucleotides in length or more.
[0016] An oligonucleotide is "specific" for a nucleic acid if the oligonucleotide has at least 50% sequence identity with a portion of the nucleic acid when the oligonucleotide and the nucleic acid are aligned. An oligonucleotide that is specific for a nucleic acid is one that, under the appropriate hybridization or washing conditions, is capable of hybridizing to the target of interest and not substantially hybridizing to nucleic acids which are not of interest. Higher levels of sequence identity are preferred and include at least 75%, at least 80%, at least 85%), at least 90%>, at least 95% and more preferably at least 98%> sequence identity.
[0017] As used herein the term "stringency" is used in reference to the conditions of temperature, ionic strength, and the presence of other compounds, under which nucleic acid hybridizations are conducted. With high stringency conditions, nucleic acid base pairing will
occur only between nucleic acids that have sufficiently long segment with a high frequency of complementary base sequences.
[0018] Exemplary hybridization conditions are as follows. High stringency generally refers to conditions that permit hybridization of only those nucleic acid sequences that form stable hybrids in 0.018M NaCl at 65 °C. High stringency conditions can be provided, for example, by hybridization in 50% formamide, 5X Denhardt's solution, 5X SSC (saline sodium citrate) 0.2% SDS (sodium dodecyl sulphate) at 42 °C, followed by washing in 0. IX SSC, and 0.1 % SDS at 65 °C. Moderate stringency refers to conditions equivalent to hybridization in 50% formamide, 5X Denhardt's solution, 5X SSC, 0.2% SDS at 42 °C, followed by washing in 0.2X SSC, 0.2%) SDS, at 65 °C. Low stringency refers to conditions equivalent to
hybridization in 10%> formamide, 5X Denhardt's solution, 6X SSC, 0.2%> SDS, followed by washing in IX SSC, 0.2% SDS, at 50 °C.
[0019] As used herein, a "primer" for amplification is an oligonucleotide that specifically anneals to a target or marker nucleotide sequence. The 3' nucleotide of the primer should be identical to the target or marker sequence at a corresponding nucleotide position for optimal primer extension by a polymerase. As used herein, a "forward primer" is a primer that anneals to the anti-sense strand of dsDNA. A "reverse primer" anneals to the sense-strand of dsDNA.
[0020] The term "allele" as used herein is any one of a number of alternative forms at a given locus (position) on a chromosome. An allele may be used to indicate one form of a polymorphism, for example, a biallelic SNP may have possible alleles A and B. An allele may also be used to indicate a particular combination of alleles of two or more SNPs in a given gene or chromosomal segment. In other words, an allele refers to one specific form of a genetic sequence (such as a gene) within a cell, an individual or within a population, the specific form differing from other forms of the same gene in the sequence of at least one, and frequently more than one, variant sites within the sequence of the gene. The sequences at these variant sites that differ between different alleles are termed "variances,"
"polymorphisms," or "mutations." At each autosomal specific chromosomal location or "locus" a human possesses two alleles, one inherited from one parent and one from the other parent, for example one from the mother and one from the father. An individual is
"heterozygous" at a locus if it has two different alleles at that locus. An individual is "homozygous" at a locus if it has two identical alleles at that locus. Mutations (e.g., allelic differences) may be the result of deletions, insertions, inversions, substitutions, or a combination of these, and may involve one or more than one nucleotide base.
[0021] By "allele specific primer" is meant a primer that hybridizes to a target sequence and is modified (i.e., extended) in an allele specific manner. For example, in some embodiments an allele specific primer includes a 3 ' nucleotide complementary to the "mutant" SNP of a target sequence. If the allele-specific primer is used to interrogate a the wild-type sequence, the 3 ' nucleotide of the primer will not hybridize to the wild-type template (the primer and the template are mismatched at this position), thereby preventing primer extension. However, if the allele specific primer hybridizes to the mutant sequence including the SNP, the allele-specific primer is fully complementary at its 3' end and primer extension can occur under extension conditions.
BRIEF DESCRIPTION OF THE DRAWINGS
[0022] FIG. 1 is a schematic diagram of one of the signal amplification methods disclosed herein. FIG. 1 A shows a solid support, such as a bead, having an immobilized capture nucleic acid (indicated by the short segment attached at one end to the bead). A target nucleic acid of interest containing a SNP (SNP indicated by the gap in the target nucleic acid) is captured on the bead via the capture nucleic acid, wherein the target nucleic acid has been amplified using an amplification primer which introduces a non-naturally-occurring restriction enzyme cutting site indicated by the lightly shaded region of the target nucleic acid (located at the farthest end from the bead). The PCR amplification step is not shown. Also shown in FIG 1 A is the hybridization to the target nucleic acid of an allele-specific primer (e.g., specific for the SNP of interest) and the resulting primer extension product indicated by the dashed lower line. FIG. IB shows that the double-stranded product resulting from the single primer extension reaction is cleaved using a restriction endonuclease specific for the non-naturally-occurring restriction enzyme cutting site introduced during target amplification (prior to capture). FIG 1C shows the resulting substrate-bound double stranded product following restriction enzyme digestion as having an asymmetric (sticky) end. FIG ID shows that the detectable signal from a single captured target nucleic acid may be amplified by
hybridizing a double stranded oligonucleotide with complementary sticky ends having multiple detectable labels (biotin) to the asymmetric end. As illustrated, the biotin-labeled oligonucleotide may be detected using a labeled anti-biotin antibody (e.g., an antibody labeled with phytoerythrin (PE)).
DETAILED DESCRIPTION
[0023] Disclosed herein are methods for the detection and/or labeling of target nucleic acids. The disclosed methods are particularly useful for specifically detecting and amplifying the detectable signal associated with a rare target nucleic acid. Generally, the method involves capturing the target nucleic acid onto a solid support such as a bead, performing an allele-specific primer extension reaction using the captured target as template, cleaving the primer extension product using a restriction endonuclease preferably to generate a specific, "sticky end", ligating a labeled oligonucleotide to the "sticky end," and detecting the detectable label. In some embodiments, the target nucleic acid is amplified prior to capture on a solid support. In other embodiments, the amplification reaction is used to introduce a nucleotide sequence, which encodes a restriction endonuclease site, into the amplicon. The introduced endonuclease site is cleaved to provide the sticky end complementary to the sticky end of the labeled oligonucleotide.
Sample Collection and Preparation
[0024] The methods and compositions of this invention may be used to detect mutations, including SNPs, in target nucleic acids. The target nucleic acids may be obtained from any convenient source including, for example, biological samples (e.g., body fluids such as blood, serum, plasma, saliva, etc.), tissue samples (e.g., biopsy samples), and isolated cells (e.g., lymphocytes)) obtained from an individual, environmental samples, cell cultures, etc. The nucleic acids may be from any organism of interest including mammals (e.g., humans), bacteria, and viruses. The nucleic acid (DNA or R A) may be isolated from the sample according to any methods well known to those of skill in the art. Biological samples may be obtained by standard procedures and may be used immediately or stored, under conditions appropriate for the type of biological sample, for later use.
[0025] Methods of obtaining test samples are well known to those of skill in the art and include, but are not limited to, aspirations, tissue sections, drawing of blood or other fluids, surgical or needle biopsies, and the like. The test sample may be obtained from an individual or patient. The test sample may be a cell-containing liquid or a tissue. Samples may include, but are not limited to, amniotic fluid, biopsies, blood, blood cells, bone marrow, fine needle biopsy samples, peritoneal fluid, amniotic fluid, plasma, pleural fluid, saliva, semen, serum, tissue or tissue homogenates, frozen or paraffin sections of tissue. Samples may also be processed, such as sectioning of tissues, fractionation, purification, or cellular organelle separation.
[0026] If necessary, the sample may be collected or concentrated by centrifugation and the like. The cells of the sample may be subjected to lysis, such as by treatments with enzymes, heat, surfactants, ultrasonication, or a combination thereof. The lysis treatment is performed in order to obtain a sufficient amount of nucleic acid derived from the individual's cells to detect using polymerase chain reaction. Alternatively, target nucleic acids may be isolated from an acellular bodily fluid.
[0027] Methods of plasma and serum preparation are well known in the art. Either "fresh" blood plasma or serum, or frozen (stored) and subsequently thawed plasma or serum may be used. Frozen (stored) plasma or serum should optimally be maintained at storage conditions of -20 to -70°C until thawed and used. "Fresh" plasma or serum should be refrigerated or maintained on ice until used, with nucleic acid (e.g., RNA, DNA or total nucleic acid) extraction being performed as soon as possible. Exemplary methods are described below.
[0028] Blood can be drawn by standard methods into a collection tube, typically siliconized glass, either without anticoagulant for preparation of serum, or with EDTA, sodium citrate, heparin, or similar anticoagulants for preparation of plasma. If preparing plasma or serum for storage, although not an absolute requirement, is that plasma or serum is first fractionated from whole blood prior to being frozen. This reduces the burden of extraneous intracellular RNA released from lysis of frozen and thawed cells which might reduce the sensitivity of the amplification assay or interfere with the amplification assay through release of inhibitors to PCR such as porphyrins and hematin. "Fresh" plasma or serum may be fractionated from whole blood by centrifugation, using gentle centrifugation at 300-800 times gravity for five to
ten minutes, or fractionated by other standard methods. High centrifugation rates capable of fractionating out apoptotic bodies should be avoided. Since heparin may interfere with RT- PCR, use of heparinized blood may require pretreatment with heparanase, followed by removal of calcium prior to reverse transcription. Imai, H., et al., J. Virol. Methods 36:181- 184, (1992). Thus, EDTA is a suitable anticoagulant for blood specimens in which PCR amplification is planned.
Nucleic Acid Extraction and Amplification
[0029] The nucleic acid to be amplified may be from a biological sample such as an organism, cell culture, tissue sample, and the like. The biological sample can be from a subject which includes any animal, preferably a mammal. A preferred subject is a human, which may be a patient presenting to a medical provider for diagnosis or treatment of a disease. The biological sample may be obtained from a stage of life such as a fetus, young adult, adult, and the like.
[0030] Various methods of extraction are suitable for isolating the DNA or RNA. Suitable methods include phenol and chloroform extraction. See Maniatis et al., Molecular Cloning, A Laboratory Manual, 2d, Cold Spring Harbor Laboratory Press, page 16.54 (1989).
Numerous commercial kits also yield suitable DNA and RNA including, but not limited to, QIAamp™ mini blood kit, Agencourt Genfind™, Roche Cobas® Roche MagNA Pure® or phenol: chloroform extraction using Eppendorf Phase Lock Gels®, and the NucliSens extraction kit (Biomerieux, Marcy l'Etoile, France). In other methods, mRNA may be extracted from patient blood/bone marrow samples using MagNA Pure LC mRNA HS kit and Mag NA Pure LC Instrument (Roche Diagnostics Corporation, Roche Applied Science, Indianapolis, IN).
[0031] Nucleic acid extracted from tissues, cells, plasma or serum can be amplified using nucleic acid amplification techniques well know in the art. Many of these amplification methods can also be used to detect the presence of mutations simply by designing oligonucleotide primers or probes to interact with or hybridize to a particular target sequence in a specific manner. By way of example, but not by way of limitation, these techniques can include the polymerase chain reaction (PCR), reverse transcriptase polymerase chain reaction
(RT-PCR), nested PCR, ligase chain reaction. See Abravaya, K., et al, Nucleic Acids Research, 23:675-682, (1995), branched DNA signal amplification, Urdea, M. S., et al, AIDS, 7 (suppl 2):S11-S 14, (1993), amplifiable RNA reporters, Q-beta replication, transcription-based amplification, boomerang DNA amplification, strand displacement activation, cycling probe technology, isothermal nucleic acid sequence based amplification (NASBA). See Kievits, T. et al, J Virological Methods, 35:273-286, (1991), Invader Technology, or other sequence replication assays or signal amplification assays. These methods of amplification each described briefly below and are well-known in the art.
[0032] Some methods employ reverse transcription of RNA to cDNA. As noted, the method of reverse transcription and amplification may be performed by previously published or recommended procedures, which referenced publications are incorporated herein by reference in their entirety. Various reverse transcriptases may be used, including, but not limited to, MMLV RT, RNase H mutants of MMLV RT such as Superscript and Superscript II (Life Technologies, GIBCO BRL, Gaithersburg, Md.), AMV RT, and thermostable reverse transcriptase from Thermus Thermophilus . For example, one method, but not the only method, which may be used to convert RNA extracted from plasma or serum to cDNA is the protocol adapted from the Superscript II Preamplification system (Life Technologies, GIBCO BRL, Gaithersburg, Md.; catalog no. 18089-011), as described by Rashtchian, A., PCR Methods Applic, 4:S83-S91, (1994).
[0033] PCR is a technique for making many copies of a specific template DNA sequence. The reaction consists of multiple amplification cycles and is initiated using a pair of primer sequences that hybridize to the 5' and 3' ends of the sequence to be copied. The amplification cycle includes an initial denaturation, and typically up to 50 cycles of annealing, strand elongation and strand separation (denaturation). In each cycle of the reaction, the DNA sequence between the primers is copied. Primers can bind to the copied DNA as well as the original template sequence, so the total number of copies increases exponentially with time. PCR can be performed as according to Whelan, et al, J of Clin Micro, 33(3):556-561(1995). Briefly, a PCR reaction mixture includes two specific primers, dNTPs, approximately 0.25 U of Taq polymerase, and lx PCR Buffer.
[0034] LCR is a method of DNA amplification similar to PCR, except that it uses four primers instead of two and uses the enzyme ligase to ligate or join two segments of DNA. LCR can be performed as according to Moore et al., J Clin Micro, 36(4): 1028-1031 (1998). Briefly, an LCR reaction mixture contains two pair of primers, dNTP, DNA ligase and DNA polymerase representing about 90 μΐ, to which is added 100 μΐ of isolated nucleic acid from the target organism. Amplification is performed in a thermal cycler {e.g. , LCx of Abbott Labs, Chicago, IL).
[0035] TAS is a system of nucleic acid amplification in which each cycle is comprised of a cDNA synthesis step and an RNA transcription step. In the cDNA synthesis step, a sequence recognized by a DNA-dependent RNA polymerase {i.e., a polymerase-binding sequence or PBS) is inserted into the cDNA copy downstream of the target or marker sequence to be amplified using a two-domain oligonucleotide primer. In the second step, an RNA polymerase is used to synthesize multiple copies of RNA from the cDNA template.
Amplification using TAS requires only a few cycles because DNA-dependent RNA transcription can result in 10-1000 copies for each copy of cDNA template. TAS can be performed according to Kwoh et al, PNAS, 86: 1173-7 (1989). Briefly, extracted RNA is combined with TAS amplification buffer and bovine serum albumin, dNTPs, NTPs, and two oligonucleotide primers, one of which contains a PBS. The sample is heated to denature the RNA template and cooled to the primer annealing temperature. Reverse transcriptase (RT) is added the sample incubated at the appropriate temperature to allow cDNA elongation.
Subsequently T7 RNA polymerase is added and the sample is incubated at 37°C for approximately 25 minutes for the synthesis of RNA. The above steps are then repeated. Alternatively, after the initial cDNA synthesis, both RT and RNA polymerase are added following a 1 minute 100°C denaturation followed by an RNA elongation of approximately 30 minutes at 37°C. TAS can be also be performed on solid phase as according to Wylie et al., J Clin Micro, 36(12):3488-3491 (1998). In this method, nucleic acid targets are captured with magnetic beads containing specific capture primers. The beads with captured targets are washed and pelleted before adding amplification reagents which contains amplification primers, dNTP, NTP, 2500 U of reverse transcriptase and 2500 U of T7 RNA polymerase. A 100 μΐ TMA reaction mixture is placed in a tube, 200 μΐ oil reagent is added and
amplification is accomplished by incubation at 42°C in a waterbath for one hour.
[0036] NASBA is a transcription-based amplification method which amplifies RNA from either an RNA or DNA target. NASBA is a method used for the continuous amplification of nucleic acids in a single mixture at one temperature. For example, for RNA amplification, avian myeloblastosis virus (AMV) reverse transcriptase, RNase H and T7 RNA polymerase are used. This method can be performed as according to Heim, et ah, Nucleic Acids Res., 26(9):2250-2251 (1998). Briefly, an NASBA reaction mixture contains two specific primers, dNTP, NTP, 6.4 U of AMV reverse transcriptase, 0.08 U of Escherichia coli Rnase H, and 32 U of T7 RNA polymerase. The amplification is carried out for 120 min at 41 °C in a total volume of 20 μΐ.
[0037] In a related method, self-sustained sequence-replication (3SR) reaction, isothermal amplification of target DNA or RNA sequences in vitro using three enzymatic activities: reverse transcriptase, DNA-dependent RNA polymerase and Escherichia coli ribonuclease H. This method may be modified from a 3 -enzyme system to a 2-enzyme system by using human immunodeficiency virus (HIV)-l reverse transcriptase instead of avian myeloblastosis virus (AMV) reverse transcriptase to allow amplification with T7 RNA polymerase but without E. coli ribonuclease H. In the 2-enzyme 3SR, the amplified RNA is obtained in a purer form compared with the 3 -enzyme 3SR (Gebinoga & Oehlenschlager Eur J Biochem, 235:256-261, 1996).
[0038] A variety of amplification enzymes are well known in the art and include, for example, DNA polymerase, RNA polymerase, reverse transcriptase, Q-beta replicase, thermostable DNA and RNA polymerases. Because these and other amplification reactions are catalyzed by enzymes, in a single step assay the nucleic acid releasing reagents and the detection reagents should not be potential inhibitors of amplification enzymes if the ultimate detection is to be amplification based. Amplification methods suitable for use with the present methods include, for example, strand displacement amplification, rolling circle amplification, primer extension preamplification, or degenerate oligonucleotide PCR (DOP). These methods of amplification are well known in the art and each described briefly below.
[0039] In suitable embodiments, PCR is used to amplify a target or marker sequence of interest. The skilled artisan is capable of designing and preparing primers that are
appropriate for amplifying a target or marker sequence. The length of the amplification
primers depends on several factors including the nucleotide sequence identity and the temperature at which these nucleic acids are hybridized or used during in vitro nucleic acid amplification. The considerations necessary to determine a preferred length for an amplification primer of a particular sequence identity are well-known to a person of ordinary skill. For example, the length of a short nucleic acid or oligonucleotide can relate to its hybridization specificity or selectivity.
Introduction of Restriction Endonuclease Cutting Sites
[0040] In one embodiment, the target nucleic acid naturally contains a restriction endonuclease cutting site which is located 5 ' to the mutation of interest (which will be later analyzed) in the target nucleic acid amplification product. In this embodiment, the target nucleic acid may be amplified without further modification.
[0041] However, it is frequently the case that no convenient restriction endonuclease cutting site naturally exists in the target nucleic acid, relative to the mutation site of interest. In this embodiment, a restriction endonuclease cutting site may be artificially introduced during the amplification reaction which may be done using standard techniques. For example, an amplification primer may include two regions: a complementary region and a non-complementary region. In some embodiments, the complementary region comprises the 3' portion of the primer, which hybridizes to the target sequence. The non-complementary region comprises the 5' portion of the primer, and does not hybridize to the target sequence. In the first round of amplification, the primer is extended from its 3 ' end to form an amplicon comprising: 1) the non-complementary region of the primer, 2) the complementary region of the primer and 3) the complement of the target sequence. In the second and subsequent rounds of amplification, the non-complementary region is amplified along with the target sequence resulting in an amplicon population including the additional 5 ' non-complementary sequence(s). In some embodiments, a restriction endonuclease site is incorporated into the non-complementary region of an amplification primer, resulting in an amplicon which includes the target sequence and the non-complementary region that comprises the restriction endonuclease site. In other embodiments, a capture sequence is incorporated into the non- complementary region of an amplification primer, resulting in an amplicon which includes the target sequence and a sequence complementary to a capture oligonucleotide, which can be
bound to a solid support (e.g., a bead). In further embodiments, a first primer includes a capture sequence in the non-complementary region and a second primer includes a restriction endonuclease sequence in the non-complementary region. The amplicon generated using the first and second primer includes (from 3 ' to 5') a sequence which will hybridize to a capture oligonucleotide (see below), the target sequence and a restriction endonuclease site.
Solid Supports
[0042] By "solid support" is meant any material that is appropriate for or can be modified to be appropriate for the attachment of nucleic acid sequences. As will be appreciated by those in the art, the number of possible substrates is very large. Possible substrates include, but are not limited to, unmodified and modified or functionalized glass, plastics (including acrylics, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethanes, Teflon™, etc.), polysaccharides, nylon or nitrocellulose, ceramics, resins, silica or silica-based materials including silicon and modified silicon, carbon, metals, inorganic glasses, plastics, optical fiber bundles, and a variety of other polymers. Magnetic beads and high throughput microtiter plates can also be used.
[0043] The composition and geometry of the solid support vary with its use and may include glat surfaces, wells of a plate, tubes, or beads. In some embodiments, supports comprising microspheres or beads are used. By "microspheres" or "beads" or "particles" is meant small discrete particles. The composition of the beads will vary, depending on the material used to form the bead and the method of synthesis. Suitable bead compositions include those used in peptide, nucleic acid and organic moiety synthesis, including, but not limited to, plastics, ceramics, glass, polystyrene, methylstyrene, acrylic polymers, paramagnetic materials, thoria sol, carbon graphited, titanium dioxide, latex or cross-linked dextrans such as Sepharose, cellulose, nylon, cross-linked micelles and Teflon. In some embodiments, the beads are Luminex™ beads.
[0044] The beads need not be spherical; irregular particles may be used. In addition, the beads may be porous, thus increasing the surface area of the bead available for assay. The bead sizes range from nanometers, i.e. 100 nm, to millimeters, i.e. 1 mm, with beads from
about 0.2 micron to about 200 microns being preferred, and from about 0.5 to about 5 micron being particularly preferred, although in some embodiments smaller beads may be used.
[0045] The target sequence may be captured onto a solid support by any convenient method. In one embodiment, complementary oligonucleotides (capture nucleic acids) are linked to the solid support and are used to capture, via hybridization, the target nucleic acid as depicted in FIG 1 A. In some embodiments, the target nucleic acid includes a sequence such as poly-A or poly-T and the capture oligonucleotide sequence includes the complement. The capture oligonucleotide may be linked to the solid support (e.g., a Luminex™ bead) by methods well known in the art. For example, the capture oligonucleotides may include amino, Acrydite™, or thiol modification and may be covalently linked to the solid support via activated carboxylate groups or succinimidyl esters (amino modified oligonucleotides), alkylating reagents such as an iodoacetamide or maleimide (thiol-modified oligonucleotides), or thoiethers (Acrydite-modified oligonucleotides). In other embodiments, the target nucleic acids may be modified to contain one member of a binding pair and the solid substrate contain the other binding pair member. For example, biotin may be attached to the target nucleic acid which is subsequently captured on the solid support by immobilized
Streptavidin. Solid supports (e.g., glass or silicon surfaces) may be treated with amino silane to provide a layer of epoxides or primary amines. Oligonucleotides modified with amine groups can be immobilized onto such coatings.
Primer Extension Reactions on Captured Target Nucleic Acids
[0046] As illustrated in FIG 1 , following target nucleic acid capture on the solid support, a single primer extension reaction is performed and the reaction products are not melted (separated). The primer extension reaction should be specific for the target nucleic acid of interest. Typically, a target-specific primer is used and is the basis for distinguishing between the target nucleic acid and other closely related but non-target species.
[0047] For analyzing SNPs and other variant nucleic acids, it may be appropriate to use oligonucleotide primers specific for alternative alleles (i.e., allele-specific primer extension (ASPE)). Such oligonucleotides which detect single nucleotide variations in target sequences may be referred to by such terms as "allele-specific primers". The design and use of allele-
specific primers for analyzing polymorphisms is described in, e.g., Mutation Detection A Practical Approach, ed. Cotton et al. Oxford University Press, 1998; Saiki et al., Nature, 324: 163-166 (1986); Dattagupta, EP235J26; and Saiki, WO 89/11548. In one embodiment, a primer may be designed to hybridize to a segment of target DNA such that the SNP aligns with either the 3' most end of the primer. The result is that the primer only efficiently primes an extension reaction of an allelic form to which the primer exhibits perfect complementarity at the 3 -most nucleotide (Gibbs, 1989, Nucleic Acid Res., 17:2427-2448). The single-base mismatch at the 3 '-most nucleotide prevents amplification or substantially reduces priming efficiency (see, e.g., WO 93/22456).
Restriction Endonucleases
[0048] The methods disclosed herein include the use of restriction enzymes to cleave a nucleic acid sample. In general, a restriction enzyme recognizes a specific nucleotide sequence of four to eight nucleotides and cuts the nucleic acid at a site within or a specific distance from the recognition sequence. For example, the restriction enzyme EcoRI recognizes the sequence GAATTC and will cut a DNA molecule between the G and the first A. The length of the recognition sequence is roughly proportional to the frequency of occurrence of the site in the genome.
[0049] Many different restriction enzymes are known and appropriate restriction enzymes can be selected for a desired result. For example, some restriction endonucleases cleave the polynucleotide at the appropriate recognition sequence and leave an asymmetrical terminus, that is, an overhang of one strand of the sequence, often termed "sticky end." Other restriction endonucleases have a cleavage recognitions sequence which leaves "blunt ends." While a restriction endonuclease which results in a sticky end is optimal in some
embodiments, blunt end restriction endonucleases may also be used. Numerous restriction endonucleases are well known in the art and are commercially available (e.g., for a description of many restriction enzymes and their recognition sites and optimal buffer conditions see e.g., J. Sambrook and T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press (2001); New England BioLabs Catalog; Promega Corporation catalog, each of which is incorporated by reference). A short, exemplary, non-limiting list of restriction endonucleases which result in a "sticky end" is provided in the table below. For
the cases in which a restriction endonuclease cutting site must be engineered into the target nucleic acid, any convenient cutting may be used. In preferred embodiments, a cutting is used which is not present in the target nucleic acid in order to avoid inappropriate cleavage of the primer extension product. In other embodiments, a restriction enzyme site is used which is not normally found in the genome of the organism from which the target nucleic acid is drawn.
TABLE 1: Exemplary
restriction endonucleases
Nucleic Acid Fill-in Reactions
[0050] In some embodiments, "sticky ends" resulting from restriction endonuclease cleavage may be converted to blunt-ends via a nucleotide polymerase "fill-in" reaction. Any number of well known polymerase enzymes in conjunction with deoxyribonucleotides may be used; such fill-in reactions are well known in the art (see e.g., J. Sambrook and T.
Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press (2001)).
Primer Extension Product Labeling
[0051] Following digestion of the immobilized primer extension product with the restriction endonuclease, the product is labeled using a oligonucleotide having one or more detectable labels. In preferred embodiments, the oligonucleotide is double-stranded and has one asymmetrical (sticky) end that is fully complementary to the asymmetrical end resulting from endonuclease digestion, such that the oligonucleotide specifically hybridizes to the primer extension product. Preferably, the oligonucleotide contains 2, 3, 4, 5, 7, 10, 15, 20, or more individual detectable labels. Suitable oligonucleotides are 10, 15, 20, 25, 30, 40, 50, 75, 100, 150, 200, or more nucleotides in length. The oligonucleotide may be ligated to the primer extension product or may be left unligated, but hybridized.
Ligation Reactions
[0052] Methods of ligation will be known to those of skill in the art and are described, for example in J. Sambrook and T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press (2001). Non- limiting methods include the use of T4 DNA Ligase which catalyzes the formation of a phosphodiester bond between juxtaposed 5' phosphate and 3' hydroxyl termini in duplex DNA or RNA with blunt and sticky ends; Taq DNA Ligase which catalyzes the formation of a phosphodiester bond between juxtaposed 5' phosphate and 3' hydroxyl termini of two adjacent oligonucleotides which are hybridized to a complementary target DNA; E. coli DNA ligase which catalyzes the formation of a phosphodiester bond between juxtaposed 5 '-phosphate and 3 '-hydroxyl termini in duplex DNA containing cohesive ends; and T4 RNA ligase which catalyzes ligation of a 5' phosphoryl-terminated nucleic acid donor to a 3' hydroxyl-terminated nucleic acid acceptor through the formation of a 3'->5' phosphodiester bond, substrates include single-stranded RNA and DNA as well as
dinucleoside pyrophosphates.
Detectable Labels
[0053] As used herein, "labels" are chemical or biochemical moieties useful for labeling a nucleic acid. "Labels" include fluorescent agents, chemiluminescent agents, chromogenic agents, quenching agents, radionuclides, enzymes, substrates, cofactors, inhibitors, magnetic particles, electrochemiluminescent labels, ligands having specific binding partners, or any
other labels that can interact with each other to enhance, alter, or diminish a signal. "Labels" or "reporter molecules" are capable of generating a measurable signal and may be covalently or noncovalently joined to an oligonucleotide. In some embodiments, the oligonucleotide is labeled with one or more biotin molecules which may be detected using a labeled anti-biotin antibody, a labeled avidin moiety, or a labeled strepavidin moiety.
[0054] The labels can be attached to the nucleotides, including non-natural bases, or oligonucleotides directly or indirectly by a variety of techniques. Depending upon the precise type of label used, the label can be located at the 5' or 3' end of the oligonucleotide, located internally in the oligonucleotide sequence, or attached to spacer arms extending from the reporter and having various sizes and compositions. Using commercially available phosphoramidite reagents, one can produce oligonucleotides containing functional groups (e.g., thiols or primary amines) at either terminus, for example by the coupling of a phosphoramidite dye to the 5' hydroxyl of the 5' base by the formation of a phosphate bond, or internally, via an appropriately protected phosphoramidite, and can label them using protocols well known to those of skill in the art.
EXAMPLES
[0055] The Experimental Examples described below are provided to aid the reader in understanding the methods disclosed herein, and are not intended to be limiting.
Example 1 : Detection of a the Factor V Leiden mutation
[0056] A well known point mutation in Factor V is associated with thrombosis. Briefly, Factor V is a polypeptide involved in the coagulation cascade. Normally, activated protein C deactivates Factor V to regulate the cascade of coagulation events. One particular mutant form of Factor V, known as Factor V Leiden, contains a single point mutation (G 1691 A) that renders the polypeptide resistant to activated protein C. The Factor V Leiden mutation is found in almost every ethnic group. For example, about 5-7% of the individuals of European or Scandinavian ancestry are carriers. In addition, about 1-2% of the population of other ancestries are carriers. Over 20% of patients with thrombosis are carriers.
[0057] A region of genomic Factor V nucleic acid containing two potential mutation sites is as follows:
ttatttattatcatgaaataactttgcaaatgaaaacaattttgaatatattttctttcaGGCAGGAACAACACCATG- ATCAGAGCAGTTCAACCAGGGGAAACCTATACTTATAAGTGGAACATCTTAGAG TTTGATGAACCCACAGAAAATGATGCCCAGTGCTTAACAAGACCATACTACAGT GACGTGGACATCATGARAGACATCGCCTCTGGGCTAATAGGACTACTTCTAATCT GTAAGAGCAGATCCCTGGACAGGCRAGGAATACAGgtattttgtccttgaagtaacctttcagaaattc tgagaatttcttctggctagaacatgttaggtctcctggctaaataatggggcatccttcaagagaacagtaattgtcaagtagtccttttta gcaccagtgtgataacatttattcttttttttttttgtct (SEQ ID NO. : 13). The first stretch of lower case bases represents sequences from intron 9, while the second stretch of lower case bases represents sequence from intron 10. The capitalized bases are sequences from exon 10 with the first bold R being position 1628 and the second bold R being position 1691 (the Factor V Leiden position). An R indicates either a G or A, while the wild-type Factor V would have a G at both of these positions.
A. Sample preparation
[0058] Standard nucleic acid isolation techniques (e.g., AGTC Kit™.; Analytic Genetics Testing Center) can be used to isolate genomic DNA from white blood cells. For example, for each patient, genomic DNA can be precipitated by ethyl alcohol and re-dissolved in TE buffer (10 mM Tris, 1 mM EDTA, pH 8.0). The concentration of genomic DNA from each patient may vary, but a concentration generally around 50 mg/μΐ would be adequate for the methods described herein.
B. Amplification primer design
[0059] Amplification primers can be designed using methods and software well known in the art (e.g., PRIME (by GCG); Primer3 available on-line from the Whitehead Institute; GeneFisher; xprimer; WebPrimer; EMBL Primer Design, also available on-line) to amplify the region of the Factor V gene which includes either one or both of the mutations. One of the primers can be designed to include a restriction endonuclease cleavage site at its 5 ' end that is not present in the region of the Factor V gene to be amplified. In this example, the EcoRI restriction endonuclease site (G*AATC) is incorporated into the primer. In addition,
the other of the primers is designed to include a sequence complementary to a capture oligonucleotide linked to a solid support. Here, the capture sequence is poly-G and the solid support includes oligonucleotides including poly-C.
C. Amplification reaction and denaturation
[0060] Once the genomic DNA has been isolated, the target DNA is amplified using methods and equipment well known in the art. The amplified product, which will include (5' to 3') the Eco RI restriction endonuclease site, the target Factor V site, and a capture site (e.g., poly G or poly C), can then be denatured for capture onto solid support.
D. Capture onto solid support
[0061] Luminex™ beads, linked to capture oligonucleotides which are complementary to one end of the amplified target oligonucleotides (the capture end, versus the restriction endonuclease end), are used to capture one of the denatured, amplified target strands which includes the target Factor V site and the restriction endonuclease site.
E. Allele-specific primer extension
[0062] An allele specific primer can be designed to include sequence 5' to 1628 or 5' to 1691 of Factor V and include a 3' nucleotide complementary to the Factor V Leiden mutant base (i.e., complementary to either an A or a T). A single round of a primer extension reaction is then carried out according to methods well known in the art. If the mutant Factor V Leiden sequence is present in the captured target, then a double-stranded product which includes both the Factor V Leiden mutant sequence and the restriction endonuclease site will be generated. If the captured sequence does not include the Factor V Leiden mutation, no extension will occur and the captured sequence will remain single stranded.
F. Restriction endonuclease cleavage
[0063] Once the primer extension reaction is completed, the double-stranded product is exposed to the restriction endonuclease Eco RI in appropriate buffer and temperature conditions optimized for enzyme function (e.g., 50 mM Tris-HCl (pH 7.5 at 37°C), 10 mM MgCl2, 100 mM NaCl, 0.02% Triton X-100 and 0.1 mg/ml BSA; incubate at 37°C). The
restriction enzyme will cleave only the double-stranded extension product (i.e., including the Factor V Leiden mutation) and will not cleave the single stranded "wild-type" Factor V sequence.
G. Ligation of double-stranded label
[0064] Upon completion of the restriction endonuclease cleavage reaction, the restriction enzyme is removed from the reaction mixtures (e.g., by washing) and the cleaved target nucleic acid is contacted, under hybridization conditions, with a biotin labeled, double- stranded oligonucleotide. At least one end of the labeled, double-stranded oligonucleotide is compatible with the "sticky end" of the captured target nucleic acid formed by Eco RI cleavage, allowing the compatible sticky ends of the oligonucleotide and the target to hybridize. Optionally, ligase is then added to the reaction mixtures under conditions well known in the art, and the labeled oligonucleotide is then ligated to the target.
H. Detection
[0065] The biotin labeled target is then detected using a phycoerythrin (PE)-labeled anti- biotin antibody. PE fluorescence is detected using flow cytometry.
Example 2: Detection of the F508 mutation in the cystic fibrosis gene
[0066] A three nucleotide deletion, which codes for phenylalanine in exon 10 of the cystic fibrosis gene, is associated with cystic fibrosis. The mutation, known as delta F508, is present in over 90% of individuals diagnosed with cystic fibrosis. The nucleotide sequence of a region of the wild-type cystic fibrosis gene is shown below. The three nucleotides which are deleted in the F508 mutant are in bold and underlined.
1501 gctggatccactggagcaggcaagacttcacttctaatgatgattatgggagaactggag 1561 ccttcagagggtaaaattaagcacagtggaagaatttcattctgttctcagttttcctgg 1621 attatgcctggcaccattaaagaaaatatcatctttggtgtttcctatgatgaatataga 1681 tacagaagcgtcatcaaagcatgccaactagaagaggacatctccaagtttgcagagaaa
1741 gacaatatagttcttggagaaggtggaatcacactgagtggaggtcaacgagcaagaatt
1801 tctttagcaagagcagtatacaaagatgctgatttgtatttattagactctccttttgga
(SEQ ID NO.: 14)
A. Sample preparation
[0067] Sample preparation can be performed as described above in Example 1. That is, genomic DNA isolated from blood or tissue samples using standard nucleic acid isolation techniques can be precipitated by ethyl alcohol and re-dissolved in TE buffer (10 mM Tris, 1 mM EDTA, pH 8.0).
B. Amplification primer design
[0068] Amplification primers can be designed using methods well known in the art to amplify the region of the cystic fibrosis gene which includes the F508 mutation (see e.g., Experimental Example LB above). One of the primers is designed to include a restriction endonuclease cleavage site at its 5' end that is not present in the CFTR gene. In this example, the Hind III restriction endonuclease site (A*AGCTT; SEQ ID NO.: 15) is incorporated into the primer. In addition, one of the primers is designed to include a sequence complementary to a capture oligonucleotide linked to a solid support. Here, the capture sequence is poly-G and the solid support includes oligonucleotides including poly-C.
C. Amplification reaction and denaturation
[0069] Once the genomic DNA has been isolated, the target DNA is amplified using methods and equipment well known in the art. The amplified product, which will include (5' to 3') the Hind III restriction endonuclease site, the target F508 site, and a capture site (e.g., poly G or poly C), can then be denatured for capture onto solid support.
D. Capture onto solid support
[0070] Luminex™ beads, linked to capture oligonucleotides which are complementary to one end of the amplified target oligonucleotides (the capture end, versus the restriction endonuclease end), are used to capture one of the denatured, amplified target strands which includes the target F508 sequence and the restriction endonuclease site.
E. Allele-specific primer extension
[0071] An allele specific primer can be designed to include a 3' nucleotide sequence that will not hybridize to the wild-type cystic fibrosis nucleotide sequence at the F508 position, but will hybridize to the 508 mutant. For example, in some embodiments, the 3' region of the allele-specific primer includes the sequence CACCAAT-3' (SEQ ID NO.: 16) for detection of the deletion mutant (i.e., excludes nucleotides complementary to the three nucleotides of the deletion mutant). Alternatively, the wildtype allele is detected using an allele-specific primer having a 3 '-terminus including the sequence CACCAAG-3' (SEQ ID NO.: 17). A single round of a primer extension reaction is then carried out according to methods well known in the art. If the F508 mutant sequence is present in the captured target, then a double-stranded product which includes both the F508 mutant sequence and the Hind III restriction endonuclease site will be generated. If the captured sequence does not include the F508 mutation, no extension will occur and the captured sequence will remain single stranded.
F. Restriction endonuclease cleavage
[0072] Once the primer extension reaction is completed, the double-stranded product is exposed to the restriction endonuclease Hind III in appropriate buffer and temperature conditions optimized for enzyme function (e.g., 10 mM Tris-HCl, 50 mM NaCl, 10 mM MgCl2, 1 mM Dithiothreitol, pH 7.9 at 25°C). The restriction enzyme will cleave only the double-stranded extension product (i.e., including the F508 mutation) and will not cleave the single stranded "wild-type" cystic fibrosis sequence.
G. Hybridization of the double-stranded label
[0073] Upon completion of the Hind III restriction endonuclease cleavage reaction, the restriction enzyme is removed from the reaction mixtures (e.g., by washing) and the cleaved target nucleic acid is contacted, under hybridization conditions, with a fluorescently labeled, double-stranded oligonucleotide as described above for Factor V. At least one end of the labeled, double-stranded oligonucleotide is compatible with the "sticky end" of the captured target nucleic acid formed by Hind III cleavage, allowing the compatible sticky ends of the oligonucleotide and the target to hybridize.
H. Detection
[0074] The fluorescently labeled target is then detected by methods and equipment well known in the art. Here, the fluorescent label is detected using flow cytometry.
[0075] It will be readily apparent to one skilled in the art that varying substitutions and modifications may be made to the methods disclosed herein without departing from the scope and spirit of the disclosure. The methods illustratively described herein suitably may be practiced in the absence of any element or elements, limitation or limitations which is not specifically disclosed herein. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention that in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the methods. Thus, it should be understood that although the present methods have been illustrated by specific embodiments and optional features, modification and/or variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of these methods.
[0076] All references, patents, and/or applications cited in the specification are incorporated by reference in their entireties, including any tables and figures, to the same extent as if each reference had been incorporated by reference in its entirety individually.
Claims
1. A method for detecting a target nucleic acid comprising:
(a) capturing the target nucleic acid on a solid support;
(b) contacting the captured target nucleic acid with a primer;
(c) performing a primer extension reaction to form a captured double-stranded product;
(d) cleaving the double-stranded product with a restriction endonuclease;
(e) hybridizing a detectably-labeled, double-stranded oligonucleotide to the
captured, cleaved double-stranded product to form a labeled target nucleic acid; and
(f) detecting the labeled target nucleic acid.
2. The method of claim 1 , comprising amplifying the target nucleic acid prior to step (a).
3. The method of claim 2, wherein the amplification reaction comprises a primer that introduces a restriction endonuclease site into the amplified target nucleic acid.
4. The method of claim 1, wherein the target nucleic acid is captured by hybridization to an oligonucleotide bound to the solid support.
5. The method of claim 1, wherein the primer extension reaction comprises the use of an allele-specific primer.
6. The method of claim 1, wherein the target nucleic acid comprises a polymorphism.
7. The method of claim 6, wherein the polymorphism comprises a single nucleotide polymorphism.
8. The method of claim 1, wherein the cleaved double-stranded product has an asymmetrical terminus.
9. The method of claim 8, wherein the detectably-labeled oligonucleotide is ligated to the asymmetrical terminus.
10. The method of claim 1, wherein the double-stranded oligonucleotide comprises at least ten detectable labels.
11. The method of claim 1 , wherein the detectable label comprises biotin.
12. The method of claim 11, wherein the detectably-labeled oligonucleotide comprises a plurality of biotin molecules.
13. The method of claim 1, wherein the solid support comprises a bead.
14. The method of claim 12, wherein the biotin molecules of the detected using and avidin- fluorescent moiety conjugate or a streptavidin-fluorescent moiety conjugate.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US29130609P | 2009-12-30 | 2009-12-30 | |
| US61/291,306 | 2009-12-30 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2011090664A1 true WO2011090664A1 (en) | 2011-07-28 |
Family
ID=44307124
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2010/061580 Ceased WO2011090664A1 (en) | 2009-12-30 | 2010-12-21 | Method of detecting nucleic acids |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2011090664A1 (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040058349A1 (en) * | 2001-10-01 | 2004-03-25 | Jeffrey Van Ness | Methods for identifying nucleotides at defined positions in target nucleic acids |
| US20050142581A1 (en) * | 2003-09-04 | 2005-06-30 | Griffey Richard H. | Microrna as ligands and target molecules |
| US20060110754A1 (en) * | 1999-04-12 | 2006-05-25 | Nanogen, Inc. | Amplification and separation of nucleic acid sequences using strand displacement amplification and bioelectronic microchip technology |
| US7247428B2 (en) * | 2001-04-23 | 2007-07-24 | Dana-Farber Cancer Institute, Inc. | Methods for rapid screening of polymorphisms, mutations and methylation |
| US20090305249A1 (en) * | 2008-05-07 | 2009-12-10 | Quest Diagnostics Investments Incorporated | Method of detecting cyp2a6 gene variants |
-
2010
- 2010-12-21 WO PCT/US2010/061580 patent/WO2011090664A1/en not_active Ceased
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060110754A1 (en) * | 1999-04-12 | 2006-05-25 | Nanogen, Inc. | Amplification and separation of nucleic acid sequences using strand displacement amplification and bioelectronic microchip technology |
| US7247428B2 (en) * | 2001-04-23 | 2007-07-24 | Dana-Farber Cancer Institute, Inc. | Methods for rapid screening of polymorphisms, mutations and methylation |
| US20040058349A1 (en) * | 2001-10-01 | 2004-03-25 | Jeffrey Van Ness | Methods for identifying nucleotides at defined positions in target nucleic acids |
| US20050142581A1 (en) * | 2003-09-04 | 2005-06-30 | Griffey Richard H. | Microrna as ligands and target molecules |
| US20090305249A1 (en) * | 2008-05-07 | 2009-12-10 | Quest Diagnostics Investments Incorporated | Method of detecting cyp2a6 gene variants |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11085041B2 (en) | Library preparation of tagged nucleic acid | |
| US9909179B2 (en) | Single-cell nucleic acid analysis | |
| JP3715657B2 (en) | Methods for subtractive hybridization and difference analysis | |
| CN109511265B (en) | A method for improving sequencing through strand identification | |
| US20120028310A1 (en) | Isothermal nucleic acid amplification methods and compositions | |
| JP2005508599A (en) | Nucleic acid amplification method | |
| CN101128604A (en) | Method for performing direct enzymatic reactions involving nucleic acid molecules | |
| AU2004304765A1 (en) | Nucleic acid amplification methods | |
| WO2016106111A1 (en) | Methods and reagents for reverse-transcription polymerase chain reaction | |
| US10822645B1 (en) | Methods and reagents for reverse-transcription polymerase chain reaction | |
| US20260043073A1 (en) | Ambient temperature nucleic acid amplification and detection | |
| JP2002233379A (en) | Nucleic acid amplification method | |
| WO2011090664A1 (en) | Method of detecting nucleic acids | |
| KR20240037181A (en) | Nucleic acid enrichment and detection | |
| KR20230124636A (en) | Compositions and methods for highly sensitive detection of target sequences in multiplex reactions | |
| WO2023107682A1 (en) | Methods for the detection of a nucleic acid | |
| HK40034054A (en) | Library preparation of tagged nucleic acid using single tube add-on protocol | |
| JP2022521209A (en) | Improved Nucleic Acid Target Concentration and Related Methods | |
| HK1231918B (en) | Library preparation of tagged nucleic acid using single tube add-on protocol | |
| HK1231918A1 (en) | Library preparation of tagged nucleic acid using single tube add-on protocol | |
| JP2004523221A (en) | Genotyping using partially complementary probes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10844230 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 10844230 Country of ref document: EP Kind code of ref document: A1 |
