WO2011090297A2 - 항－ｍｄｍ２를 발현하는 인간 성체줄기세포 및 그의 용도 - Google Patents

항－ｍｄｍ２를 발현하는 인간 성체줄기세포 및 그의 용도 Download PDF

Info

Publication number
WO2011090297A2
WO2011090297A2 PCT/KR2011/000329 KR2011000329W WO2011090297A2 WO 2011090297 A2 WO2011090297 A2 WO 2011090297A2 KR 2011000329 W KR2011000329 W KR 2011000329W WO 2011090297 A2 WO2011090297 A2 WO 2011090297A2
Authority
WO
WIPO (PCT)
Prior art keywords
cells
human
stem cell
phe
stem cells
Prior art date
Application number
PCT/KR2011/000329
Other languages
English (en)
French (fr)
Other versions
WO2011090297A3 (ko
Inventor
박국인
김일선
Original Assignee
연세대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 연세대학교 산학협력단 filed Critical 연세대학교 산학협력단
Publication of WO2011090297A2 publication Critical patent/WO2011090297A2/ko
Publication of WO2011090297A3 publication Critical patent/WO2011090297A3/ko

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0618—Cells of the nervous system
    • C12N5/0623—Stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/10—Fusion polypeptide containing a localisation/targetting motif containing a tag for extracellular membrane crossing, e.g. TAT or VP22
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/70—Enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341—Use of virus, viral particle or viral elements as a vector
    • C12N2710/10343—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • the present invention relates to human adult stem cells expressing peptide inhibitors that inhibit the binding of MDM2 protein to p53 protein and a pharmaceutical composition comprising the same. More specifically, the present invention relates to human adult enjoyed cells transformed to express (preferably secrete) peptide inhibitors that inhibit binding of MDM2 protein to p53 protein, a tumor cell death inducer, and a pharmaceutical composition comprising the same. will be.
  • neural stem cells have been reported to have plasticity of differentiation that can differentiate not only into neurons but also into various other types of cells or tissues.
  • neural stem cell research is still in the early stages of the world, so a lot of basic research is required and various problems must be solved for actual clinical application.
  • transplantation of neural stem cells into the living body should be characterized by the engraftment, migration, differentiation, external gene expression and integration of the host nervous system into the donor cells, and differentiated neurons in the host nervous system appropriate neuroconjugation, neuronal connections and functional Improvements should be made.
  • p53 tumor suppressor protein is an important regulator of cell cycle progression, apoptosis, and aging.
  • p53-mediated transcriptional activation or inhibition occurs in the target gene.
  • p53 regulates cell division in DNA damaged cells and repairs DNA damage, thereby maintaining the genetic stability of the cells.
  • p53 also plays a role in promoting cell survival through cell glucose metabolism, autophagy, and antioxidant activity.
  • Intracellular activity of p53 is fully regulated by steady-state levels and post-transcript ional modification.
  • p53 is inhibited by the E3 ligase activity of the murine double minute 2 (MDM2) protein.
  • MDM2 murine double minute 2
  • Inhibiting the E3 ligase activity of MDM2 or interfering with the interaction of p53 with MDM2 raises the level of p53 in a stabilized state and promotes apoptosis of cells.
  • Methods to inhibit the interaction of MDM2 with p53 have emerged as important targets in the control of tumor cell death (Ce // Cycle 7: 971 (2008); Nature 3: 102 (2003); Nature Reviews 7: 979 (2008) )).
  • transformed human adult stem cells prepared by introducing nucleic acid molecules encoding peptide inhibitors that inhibit binding of MDM2 protein to p53 protein in human adult stem cells (most preferably human neural stem cells) are basically
  • the present invention was completed by confirming that not only have stem cell characteristics, but also increase the intracellular activity of p53 and exert various pharmacological effects such as the treatment of cancer through mechanisms such as apoptosis.
  • Another object of the present invention to provide a pharmaceutical composition for the prevention or treatment of hyperproliferative disease.
  • the present invention provides human adult enjoyment cells comprising a nucleic acid molecule encoding a peptide inhibitor that inhibits the binding of MDM2 protein to p53 protein.
  • the present inventors have inhibited the blockade of p53 by MDM2 protein to increase the intracellular activity of p53 to provide a cell therapy that can exhibit various pharmacological effects Efforts have been made to develop.
  • transformed human adult stem cells prepared by introducing nucleic acid molecules encoding peptide inhibitors that inhibit binding of MDM2 protein to p53 protein in human adult stem cells (most preferably human neural stem cells) are basically It was confirmed that not only have stem cell characteristics, but also increase the intracellular activity of p53 and exert various pharmacological effects such as the treatment of cancer through mechanisms such as apoptosis.
  • peptide inhibitor that inhibits the binding of a murine double minute 2 (MDM2) protein to a p53 protein is abbreviated to "anti-MDM2" or "aMDM2".
  • the peptide inhibitor that inhibits the binding of the MDM2 protein to the aMDM2, ie, the p53 protein can be used without limitation so long as it inhibits the binding of the MDM2 protein to the p53 protein to stabilize the p53 protein.
  • Many peptide inhibitors are known in the art to which the present invention pertains, for example, WO 96/02642, European Patent No. 958305, US Patent Publication No. 2001-18511, US Patent Publication No. 2005-277764 and US Patent. No. 6013786. Said documents are incorporated herein by reference.
  • the aMDM2 may include a peptide represented by the following general formula I, general formula II, general formula ⁇ , general formula IV or general formula V as a minimum sequence:
  • a aal and A aa2 are independently of each other Gly, Ala, Val, Ser, Tyr, Pro, Asp, Glu, Thr, Met, He, Leu, Phe, His, Lys, Arg, Cys, Asn , Gin or Trp;
  • a aal , A aa4 and A aa5 are each independently Gly, Ala, Val,
  • a aa2 is Arg, His, Glu, Asp, Cys or Ser (preferably Glu or Asp, more preferably Asp),
  • a aa3 is His, Phe or Tyr,
  • a aa6 is Phe, Gin or Leu;
  • a aa ⁇ Pro, Leu, Glu , and Cys, Gin, A aa2, A aa3, A aa6 and A aa7 is Gly, Ala, Val, Ser, Tyr, Pro, Thr, Met, lie, Leu, Phe, Arg, Cy as , Asn or Gin, A aa4 is Arg, His, Glu, Asp, Cys or Ser, A aa5 is His, Phe or Tyr, A aa8 is Phe, Gin or Leu; ⁇
  • a aar 8r Met lie, Thr, Arg, Ala or Ser
  • a aa2 is Arg, His, Glu, Asp, Cys or Ser
  • a aa3 is His, Phe or Tyr
  • a aa4 is Glu, Thr, Ala , Phe or Ser
  • a aa5 is Gin, Thr, Ala, Asp or Gly
  • a aa6 is Phe, Gin or Leu;
  • a aa i is Arg, Asn, Ala, Thr or Val
  • 32 is Met, He, Thr, Arg, Ala or Ser
  • a aa3 is Arg, His, Glu, Asp, Cys or Ser
  • 34 is His, Phe or Tyr
  • a aa5 is Glu, Thr, Ala, Phe or Ser
  • a aa6 is Gin, Thr, Ala, Asp or Gly
  • ⁇ 7 is Phe, Gin or Leu.
  • the aMDM2 used in the present invention may be a functional commodity of the above-described aMDM2 sequence of p53.
  • the functional equivalents refer to peptides exhibiting substantially equivalent physiological activity as aMDM2 of the present invention as a result of the addition, substitution or deletion of amino acids.
  • Equivalent bioactivity refers to an activity that competitively binds to the binding site of MDM2 to which p53 binds, thereby increasing the level of intracellular p53 that does not bind to MDM2, thereby inducing the death of abnormal cells such as tumor cells. do.
  • the functional equivalent is at least 70%, preferably at least 80%, more preferably at least 90% of the peptides represented by Formula I, Formula I, Formula II, Formula IV or Formula V.
  • peptides having homology for example 70), 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% , Peptides having sequence homology of 98% 99%, 100%.
  • the functional equivalent may be the result of the addition, substitution or deletion of some of the amino acid sequences of Formula I, Formula I, Formula II, Formula IV or Formula V.
  • Substitution of amino acids in the above is preferably a conservative substitution.
  • conservative substitutions of naturally occurring amino acids are as follows: aliphatic amino acids (Gly, Ala, Pro), hydrophobic amino acids (lie, Leu, Val), aromatic amino acids (Phe, Tyr, Trp), acidic amino acids (Asp , Glu), basic amino acids (His, Lys, Arg, Gin, Asn) and sulfur containing amino acids (Cys, Met).
  • the functional equivalents also include variants in which some of the amino acid sequences of the peptides represented by Formula I, Formula I, Formula II, Formula IV, or Formula V are deleted. Deletion or substitution of these amino acids is preferably located in a region not directly related to the physiological activity of the peptides of the invention.
  • a modification in which some amino acids are added to the terminal or both ends of the peptide represented by the general formula 1 ′ General Formula, General Formula II, General Formula IV, or General Formula V, or a sequence is added.
  • the scope of functional equivalents of the present invention also includes peptide derivatives in which some chemical structures of the peptides are modified while maintaining the basic backbone of the peptides and their physiological activity. For example, to alter the stability, shelf life, volatility or solubility of the peptides of the invention. This includes structural changes.
  • sequence homology and homogeneity of the amino acid residue of the candidate sequence for the amino acid sequence of the aMDM2 peptide of the present invention after aligning the amino acid sequence of the aMDM2 peptide of the present invention with the candidate sequence for comparison and introducing a gap It is defined as a percentage. If necessary, conservative substitutions as part of sequence homogeneity are not considered in order to obtain maximum percentage sequence identity.
  • the N-terminus, C-terminus or internal elongation, deletion or insertion of the aMDM2 peptide of the present invention is not to be construed as a sequence affecting sequence homology or homology.
  • sequence identity can be determined by common standard methods used to compare similar portions of the amino acid sequences of two peptides.
  • Computer programs such as BLAST or FASTA align the two peptides so that each amino acid is optimally matched (along the full length of one or two sequences or along the predicted portion of one or two sequences).
  • the program provides a default opening penalty and a default gap penalty and can be used in conjunction with a computer program PAM25CK standard scoring matrix Dayhoff et al. , in Atlas of Protein Sequence and Structure, vol 5, supp 3, 1978).
  • percentage homogeneity can be calculated as follows. The total number of identical matches is multiplied by 100 and then the sum of the length of the longer sequence in the matched span and the number of gaps introduced into the longer sequence to align the two sequences. Divide.
  • Phe-A aal -Glu-Leu- Trp (A aa i is Gly, Ala, Val, Ser, Tyr, Pro, Asp, Glu, Thr, Met, He, Leu , Phe, His, Lys, Arg, Cys, Asn, Gin or Trp), Thr-Phe-Ser-Asp-Leu-Trp, Thr-Phe- Ser-Gly-Leu-Trp, G 1 nG 1 u-Thr -Phe- Ser -Asp-Leu-Tr p-Ly s -Leu-Leu-Pr o ( A 3 ⁇ 4 3 ⁇ 4 Jl 1), G 1 nG 1 u-Thr _Phe_Ser _Asp— Leu ⁇ Tr p_Ly s_Leu_Leu ⁇ Pr G 1 u_Asn or G u u ⁇ Pr o_Pr o_
  • the length of the peptides of the general formulas is generally 5-50 amino acid residues, preferably 5-40 amino acid residues, more preferably 6-35 amino acid residues, more preferably 6-30 amino acid residues, Even more preferably 6-28 amino acid residues.
  • the aMDM2 has an amino acid sequence represented by SEQ ID NO: 2 or an amino acid sequence represented by SEQ ID NO: 1.
  • the «MDM2 has an amino acid sequence represented by SEQ ID NO: 1.
  • Nucleic acid molecule encoding the «MDM2 of the present invention is the formula I, formula I,
  • the nucleic acid molecule encoding ffMDM2 of the present invention may have a nucleotide sequence encoding a peptide consisting of an amino acid sequence represented by SEQ ID NO: 2 or an amino acid sequence represented by SEQ ID NO: 1, and even more preferably May have a nucleotide sequence encoding a peptide consisting of the amino acid sequence represented by SEQ ID NO: 1, and most preferably may have a nucleotide sequence represented by SEQ ID NO: 3.
  • the nucleic acid may have a nucleotide sequence disclosed in GenBank Accession No. NM_000546, NM_001126113 or NM_001126114, but is not limited thereto.
  • Nucleic acid encoding the «MDM2 can be prepared by genetic recombination methods known in the art (Sambro i, Fritsch and Maniatis, Molecular Cloning, A laboratory Manual, Cold Spring Harbor laboratory press (1989); John Wiley and Sons, Short Protocols in Molecular Biology (1992). For example, there are techniques for PCR amplification, chemical synthesis, or preparation of cDNA sequences to amplify nucleic acids from genomes.
  • Adult stem cells used in the present invention refers to stem cells appearing at the stage in which each organ of the embryo is formed or in the adult stage as the development process progresses, and its differentiation ability is generally limited to cells constituting specific tissues.
  • Adult stem cells may be derived from the group consisting of breast, bone marrow, umbilical cord blood, blood, liver, skin, gastrointestinal tract, placenta, and uterus.
  • Human adult stem cells of the present invention are human neural stem cells capable of differentiating into neurons, human hematopoietic stem cells capable of differentiating into blood cells, human mesenchymal stem cells capable of differentiating into bone, cartilage, fat, muscle, etc.
  • Human liver stem cells capable of differentiating into
  • the human adult stem cells are human neural stem cells.
  • Neural stem cells are primordial cells that exist mainly in the nervous system. They exhibit self-renew, which continues to proliferate in immature and undifferentiated states, and are multipotency of differentiation that differentiates into neurons and glia. Is defined as a cell.
  • Neural stem cells exist in various anatomical regions throughout the fetal nervous system of mammals, including humans. Recently, neural stem cells exist not only in the fetus but also in the adult nervous system. Throughout life, neural stem cells continue to proliferate in specific areas of the brain. Creating new neurons. In addition, it has been reported that neural stem cells have plasticity of differentiation that can be differentiated not only into neurons but also into various other types of cells or tissues.
  • the human neural stem cells are preferably derived from the brain of a human fetus.
  • the brain may be any one selected from the group consisting of brain, liver, midbrain, cerebellum, soft water, pontoon and spinal cord, preferably derived from the brain.
  • the human neural stem cells may be purchased and used commercially, or may be prepared by culturing cells obtained from a natural aborted and dead human fetal brain tissue in a medium containing neural stem cell growth factor (Example 1 ).
  • the neural stem cell growth factor may be used bFGF (fibroblast growth factor-basic), LIF (leukemia inhibitory factor) and heparin (heparin).
  • the human neuroenjoyment cell used in the present invention is "HNSC 01" of Accession No. KCTC 11370BP.
  • Human neural stem cells secreting aMDM2 according to the present invention show no cytotoxicity and continue to proliferate and grow undifferentiated on plates (see FIG. 7).
  • the neural stem cells of the present invention express the neural stem cell markers, such as nestin or vimentin, in more than 99% of cells, and are capable of differentiating into neural cells such as neuronal cells, oligodendrocytes and astrocytes. (See FIG. 3).
  • aMDM2 When co-culture of human neural stem cell medium and tumor cells secreting aMDM2 according to the present invention induces apoptosis of tumor cells (see FIG. 13).
  • a tumor animal model eg, a human glioblastoma brain tumor animal model
  • they engraft and distribute in a manner of specifically enclosing the boundary of the primary mass in vivo and infiltrating into the mass.
  • neural stem cells of the present invention can differentiate into neurons or glial cells in the transplanted tumor site to replace and regenerate nerve cells damaged by the tumor.
  • the neural stem cells of the present invention secrete ffMDM2, causing apoptosis of surrounding tumor cells in vivo, thereby reducing tumor volume and consequently increasing the survival rate of animal models (see FIG. 18). On the other hand, it does not cause any special damage to normal brain tissue.
  • Human adult stem cells comprising a nucleic acid molecule encoding aMDM2 of the present invention can be prepared by introducing a nucleic acid encoding aMDM2 into human adult stem cells.
  • ffMDM2-encoding nucleic acids can be injected into cells according to a variety of transformation methods known in the art, such as naked DNA, directly injected into cells and methods using liposomes (eg, Lipofectamine) or methods using vectors. Can be.
  • transformation of human adult stem cells using «MDM2 ⁇ encoding nucleic acid is carried out using a vector, for example, comprising the steps of: (a) inserting a nucleic acid encoding aMDM2 into an expression vector; And (b) introducing the expression vector into human stem cells.
  • the construct for the expression of aMDM2-encoding nucleic acid contained in the vector further comprises a secretory signal sequence, a protein transduction domain or a combination thereof.
  • human neural stem cells secreting aMDM2 can be prepared by a preparation method comprising the following steps: (a) encoding a secretion signal sequence, an HIV derived protein transduction domain and aMDM2 Preparing a recombinant viral vector comprising a DNA construct to which nucleic acids are sequentially linked; (b) transfecting said recombinant viral vector into a virus producing cell line to produce an aMDM2 expressing recombinant virus; And (c) infecting human neural stem cells with the aMDM2 expressing recombinant virus.
  • the nucleic acid encoding the «MDM2 may be operably linked to an expression control sequence and inserted into an expression vector.
  • expression control sequence refers to a DNA sequence that controls the expression of a nucleic acid sequence operably linked in a particular host cell.
  • regulatory sequences include a promoter for initiating transcription, any operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosomal binding site, and a sequence regulating termination of transcription and translation.
  • a promoter bound to a nucleic acid encoding aMDM2 is preferably capable of regulating the transcription of «MDM2 gene by operating in animal cells, more preferably mammalian cells, and is always desired at all times.
  • a constitutive promoter can be used to induce the expression of a gene, such as the CMV promoter, CAG promoter (Hitoshi Niwa et al., Gene, 108: 193-199 (1991); Monahan et al., Gene Therapy, 7: 24-30 (2000)), CaMV 35S promoter (Ode 11 et al., Nature 313: 810-812 (1985)), Rsyn7 promoter (US Patent Application Serial No.
  • a CAG promoter is used as a promoter.
  • the CAG promoter is a modified CMV promoter and cytomegalovirus Immediately early inhyeon books (cytomegalovirus immediate-early enhancer), chicken ⁇ - actin promoter (chicken / S-actin promoter) , a chimeric intron (chimeric intron), aekson Kexon 1) and rabbit globin gene (rabbit ⁇ -globin gene) It consists of a portion of exon 2 (Hitoshi Niwa et al., Gene, 108: 193-199 (1991); Monahan et al., Gene Therapy, 7: 24-30 (2000)).
  • CAG promoter of such a known configuration and sequence was not suitable for adenovirus production, the present inventors modified it to be suitable for production with adenovirus.
  • the CAG promoter used in the present invention was inserted into a commercial vector pShuttle vector through the following process. Cytomegalovirus immediate-early enhancer, chicken; 8-actin promoter and rabbit ⁇ -globin terminator (rabbit / 9-) from the commercial vector TriEX-1.1 Neo DNA vector Each globin terminator was cloned and inserted into a commercial vector pShuttle vector to produce a vector with a CAG promoter modified to be suitable for adenovirus production.
  • the expression construct used in the present invention comprises a poly-aninylation sequence, for example, a plastic field hormone terminator, an SV40 derived poly adenylation sequence or a rabbit / 9 actin terminator can be used. have.
  • aMDM2 expressed in human adult stem cells acts inside the cytoplasm of tumor cells, a structure for moving the expressed protein into the cytoplasm is essential.
  • PTD protein transduction domain
  • the protein transfer domain is not only itself but also other kinds of oligonucleotides, peptides, It refers to oligopeptides composed of several amino acid residues that can introduce high molecular organic compounds such as proteins and oligosaccharides into cells without requiring additional receptors or energy.
  • the protein delivery domain is not particularly limited, but the transduction site of HIV-1 TAT, an oligopeptide consisting of 5-12 arginine residues, an oligopeptide consisting of 5-12 lysine residues, a PEP-1 peptide, ANTP, VP22 protein and the like can be used (Morris et al., Nat Biotechnol, 19: 1173- 1175 (2001); Schwarze et al., Trends Cell Biol, 10: 290-295 (2000); Vives et al. J) Biol Chem 272: 16010-16017 (1997).
  • the PTD may be used without limitation as long as it is known in the art, and preferably, TAT PTD (YGRKKRRQRRR) of HIV-1 (YGRKKRRQRRR), an oligopeptide consisting of 9 arginine residues, and 10 lysine residues. Oligopeptides and PEP-1 peptides (KETWWETWTEWSQPKKKRKV) can be used selected from the group (Yang et al., FEBS Letters, 532: 36-44 (2002); Vives et al., J. Biol. Chem. 272: 16010-16017 (1997); Nagahara et al., Nature Med., 4: 1449-1452 (1998).
  • the transduction site of the HIV-1 Tat is characterized in that it has a signal to open the lipid barrier (lipid barrier) of the cell to penetrate.
  • the hydrophobic domain of the PEP-1 peptide combines with the hydrophobic portion of the protein to penetrate, thereby increasing the efficiency of targeting to the cell membrane, and the hydrophilic domain plays a role of facilitating migration into the cytoplasm.
  • aMDM2 is expressed in human adult stem cells and then secreted out of cells to enter the cytoplasm of tumor cells, it is preferable to connect a secret ion signal sequence to a nucleotide encoding TAT_aMDM2.
  • the secretion signal sequence is preferably linked upstream of the TAT-crMDM2.
  • the secretion signal sequence is an Ig c-chain leader, semen RNase (seminal)
  • RNase secretion signal sequence SEC2 sequence (N-terminal 28 amino acids of human fibrillin ⁇ 1), FIB ⁇ 3 ⁇ 4 (nucleotides 208-303 derived from rat f ibronectin mRNA sequence) or a signal peptide of FGF-4, but is not limited thereto.
  • SEC2 sequence N-terminal 28 amino acids of human fibrillin ⁇ 1
  • FIB ⁇ 3 ⁇ 4 nucleotides 208-303 derived from rat f ibronectin mRNA sequence
  • FGF-4 signal peptide of FGF-4
  • FIB ⁇ 3 ⁇ 4 amino acid peptide of FGF-4
  • FIB ⁇ 3 ⁇ 4 amino acid derived from rat f ibronectin mRNA sequence
  • FGF-4 signal peptide of FGF-4
  • it may be an Ig c- chain leader.
  • the Ig c-chain leader may preferably have a nucleotide sequence represented by SEQ ID NO
  • the Ig / c-chain leader After secretion out of the cell, the Ig / c-chain leader is an unnecessary part, so it is more effective to cut it.
  • the secretory signal sequence preferably has a characteristic that is cleaved when secreted out of the cell without having a signal cleavage site or a special signal cleavage site therein.
  • the Ig / c-chain leader in the secretion signal sequence is truncated between the last 20 and 21st amino acids when secreted out of the cell even without a special signal cleavage sequence.
  • a DNA construct in which a nucleic acid encoding a secretion signal sequence, TAT and aMDM2 is sequentially connected is a general cloning known in the art including PCR amplification, cleavage of DNA using restriction enzymes, ligation, transformation, and the like. It can manufacture by a method.
  • the expression vector refers to a plasmid, viral vector or other medium known in the art that can insert a nucleic acid encoding a structural gene and can express the nucleic acid in a host cell.
  • a viral vector Preferably a viral vector.
  • plasmid mammalian expression plasmids known in the art may be used.
  • pRK5 European Patent No. 307,247
  • PSV16B International Patent Publication No. 91/08291
  • pVL1392 pVL1392
  • the nucleic acid delivery method using the plasmid vector is a method of delivering plasmid DNA directly to human cells, which can be used by a person approved by the FDA (Nabel, EG, et al., Science, 249: 1285-1288 ( 1990)).
  • Plasmid DNA has the advantage of being able to be homogeneously purified, unlike viral vectors.
  • the viral vectors include, but are not limited to, retrovirus vectors, adenovirus vectors, herpes virus vectors, abipoxvirus vectors, lentiviral vectors, and the like.
  • the retroviral vector is designed so that all of the viral genes have been removed or altered so that non-viral proteins are made in cells infected by the viral vector.
  • the main advantages of retroviral vectors for gene therapy are to deliver large quantities of genes into cloned cells, to accurately integrate genes transferred into cellular DNA, and to not cause continuous infection after gene transfection (Miller, AD, Nature). , 357: 455-460 (1992).
  • Non-retroviral vectors include adenoviruses as mentioned above (Rosenfeld et al., Cell, 68: 143-155 (1992); Jaffe et al., Nature Genetics, 1: 372-378 (1992) Lemarchand et al., Proc. Natl. Acad. Sci. USA, 89: 6482-6486 (1992).
  • adenoviruses The main advantage of adenoviruses is the ability to carry large amounts of DNA fragments (36kb genome) and to infect non-replicating cells with very high titers.
  • Herpes viruses can also be useful for human gene therapy (Wolfe, JH, et al., Nature Genetics, 1: 379-384 (1992)).
  • suitable known viral vectors can be used in the present invention. Preferably it can be inserted into the adenovirus vector.
  • a method for producing an adenovirus which is one of the recombinant expression vectors of the present invention, is a method known in the art, for example, co-adapted to BJ5183 Escherichia coli together with an adenoviral backbone vector such as pAdEasy-l (Stratagene).
  • an adenoviral backbone vector such as pAdEasy-l (Stratagene).
  • the producing cell line can be used, for example 293 cells, which are adenovirus producing cell lines, can be used when an adenovirus vector is used.
  • Methods of making such adenoviruses are well documented in the literature (Benihoud, K., Yeh, P. and Perricaudet, M., Curr Opin Biotechnol 10 (5): 440-7 (1999); Berkner, KL, Biotechniques, 6 (7): 616-29 (1988); He, TC, Zhou, S., da Costa, LT, Yu, J., Kinzler, W.
  • Expression vectors comprising nucleic acids according to the present invention are methods known in the art, such as, but not limited to, transient transfect ions, microinjection, transduction, cell fusion, scab phosphate Precipitation, liposome-mediated transfect ion, DEAE dextran-mediated transfect ion, polybrene-mediated transfect ion, electroinvasion It can be introduced into neural stem cells by electroporation, gene gun, and other known methods for introducing nucleic acids into cells (Wu et al., J. Bio. Chew., 267: 963-967 ( 1992); Wu and Wu, J. Bio. Chew., 263: 14621-14624 (1988)).
  • human neural apoptosis cells As a method for infecting adenovirus with human neural stem cells, preferably, human neural apoptosis cells (HFT13 cells) are plated in growth factor-containing N 2 medium and viral particles corresponding to an appropriate MOKmultiplicity of infection after 1 hour. Can be added to the medium to infect the cells.
  • the virus was stored in -80 ° C bundling with 4% sucrose complete solution (10 mM Tris pH8.0, 2 mM MgCl 2 , 4 sucrose in dd3 ⁇ 40). Depending on the titer and M () I approximately less than 50 ⁇ viral solution is added per ml of cell medium.
  • the cells may be washed once with N2 medium to remove the virus, followed by the culturing of the stem cells by adding the growth factor-containing N2 medium.
  • Human neural stem cells secreting aMDM2 according to the present invention can be proliferated and cultured according to methods known in the art.
  • Neuronal cells of the present invention are cultured in a culture medium supporting the survival or proliferation of the desired cell type. It is often desirable to use cultures that provide nutrition with free amino acids instead of serum. It is preferable to supplement the culture medium with additives developed for continuous culture of neurons. For example, there are N2 and B27 additives available from Gibco. It is preferable to replace the medium while observing the state of the medium and the cells during the culture.
  • neural stem cells it is preferable to carry out subculture when neural stem cells continue to proliferate and aggregate to form neurospheres. Passage can be done approximately every seven to eight days.
  • Preferred culture method of neural stem cells according to the present invention is as follows. Add N2 or B27 additive (Gibco), neural stem cell proliferation-producing cytokines (e.g. bFGF, EGF, LIF, etc.) and heparin to certain media (eg DMEM / F-12 or Neurobasal medium) of known composition do. Generally no serum is added. Neural stem cells are proliferated and cultured in the form of neurospheres in the medium. Change the half of the medium to a new one every 3-4 days.
  • the neural stem cells of the present invention can be differentiated into a variety of neurons according to conventional methods known in the art. Differentiation is generally carried out in a culture environment that contains a nutrient broth without the addition of neural stem cell proliferation-inducing cytokines to the cell medium and with the addition of an appropriate substrate or differentiation reagent.
  • Suitable substrates are suitable for positively coated solid surfaces such as poly—L-lysine and polyornithine.
  • the substrate may be coated with extracellular matrix components such as fibronectin and laminin. Other acceptable extracellular matrices include Matrigel.
  • Other suitable are combinatorial substrates in which poly-L-lysine is combined with fibronectin, laminin, or a combination thereof.
  • Suitable differentiation reagents include various types of growth factors such as epidermal growth factor (EGF), transforming growth factor a (TGF-ff), and any form of fibroblast growth factor (FGF-4,
  • EGF epidermal growth factor
  • TGF-ff transforming growth factor a
  • FGF-4 fibroblast growth factor
  • FGF-8 and bFGF platelet-derived growth factor (PDGF), insulin-like growth factor (IGF-1, etc.), high levels of insulin, bone morphogenic proteins (particularly BMP-2 and BMP-4), retinic acid (RA) And ligands for receptors complexed with gpl30 (eg, LIF, CNTF, and IL-6).
  • PDGF platelet-derived growth factor
  • IGF-1 insulin-like growth factor
  • RA retinic acid
  • ligands for receptors complexed with gpl30 eg, LIF, CNTF, and IL-6.
  • the neural stem cells of the present invention can be cryopreserved according to methods known in the art for long-term storage. Common cryopreservation is to continue subculture and obtain an even number of neural stem cells to break down the neurospheres using mechanical methods or trypsin to form single cell suspensions. Thereafter, the cell suspension was mixed with a cryopreservation solution consisting of 20-50% fetal bovine serum (Gibco), 10-15% DMSO (Sigma) and cell medium, and placed in a freezing vial (NUNC). Busy. Cells mixed in the cryopreservation solution immediately stored at 4 ° (:
  • cryopreserved neural stem cells of the present invention can be thawed according to methods known in the art.
  • thawing frozen cells immerse the frozen glass bottle in a 37 ° C constant temperature bath and shake slowly.
  • the cell suspension is transferred to a conical tube containing neural stem cell medium, which has already been warmed to 37 ° C. Transfer all cell suspensions and centrifuge to remove supernatant. The precipitated cell pellet is carefully suspended with neural stem cell medium. Transfer the cell suspension to a 60 mm cell culture plate. Subsequently, neural stem cell proliferation-induced cytokines are added to the medium, followed by incubation in a 37 ° C, 5% C0 2 incubator.
  • the present invention provides a pharmaceutical composition for the prevention or treatment of hyperproliferative disease containing human adult stem cells secreting the aMDM2 transformed with a nucleic acid encoding aMDM2 to provide.
  • the pharmaceutical composition of the present invention can be used for killing of hyperproliferative cells, reconstituting and / or regenerating living tissue in vivo in humans in need thereof.
  • a method for preventing or treating hyperproliferative disease comprising administering the pharmaceutical composition to a subject in need.
  • treatment includes alleviation of symptoms, reduction of the extent of disease, maintenance of disease that does not worsen, delay of disease progression, improvement or reduction of disease state, partial or complete remission. .
  • Treatment can also mean increased survival compared to the expected survival if untreated.
  • Treatment includes simultaneously prophylactic measures in addition to therapeutic means. Cases in need of treatment include those already with the disease and cases in which the disease should be prevented.
  • the alleviation of the disease is an improvement in the clinical manifestations of the disease or the improvement of the disease in comparison with the untreated situation. The trend is delayed or prolonged.
  • Treatment typically involves administering adult stem cells of the present invention for the death or tissue regeneration of hyperproliferative cells.
  • Human adult stem cells secreting aMDM2 according to the present invention are administered by direct transplantation or migration to a desired tissue site, inducing the death of hyperproliferative cells or reconstructing or regenerating functionally deficient sites.
  • human neural stem cells secreting aMDM2 of the present invention depending on the disease to be treated, are directly transplanted into the milk tissue or intramenoral region of the central nervous system. Transplantation is performed using single cell suspensions or small aggregates of 1 ⁇ 10 5 -1.5 ⁇ 10 5 cell densities per ⁇ (US Pat. No. 5, 968, 829).
  • Human neural stem cells secreting aMDM2 may be supplied in the form of a pharmaceutical composition for administration into a human.
  • the pharmaceutical composition of the present invention may further comprise a pharmaceutically acceptable carrier.
  • the term 'pharmaceutically acceptable' refers to a cell or human exposed to the composition, which is not toxic.
  • the carrier may be used without limitation as long as it is known in the art such as buffers, preservatives, analgesics, solubilizers, isotonic agents, stabilizers, bases, excipients, lubricants, preservatives and the like.
  • compositions of the present invention can be prepared according to techniques commonly used in the form of various formulations.
  • injectables can be prepared in the form of unit dose ampoules or multiple dose inclusions.
  • the formulations may be in the form of solutions, suspensions, syrups or emulsions in oils or aqueous media, or may be in the form of axes, powders, granules, powders, granules, tablets, or capsules, and may further comprise dispersants or stabilizers.
  • dispersants or stabilizers for general principles of pharmaceutical formulation of pharmaceutical compositions according to the present invention, reference can be made to several documents (W. Sheridan and G.
  • composition may be packaged in a suitable container according to the indicated instructions for the desired purpose, for example for the treatment of tumors in vivo and for the reconstitution of tissue damaged by the tumor.
  • Suitable dosages of the pharmaceutical compositions of the present invention may vary depending on factors such as the formulation method, mode of administration, age, weight, sex, morbidity, food, time of administration, route of administration, rate of excretion and response sensitization of the patient. It may be prescribed. Preferred dosages of the pharmaceutical compositions of the invention are 10 1 — 10 10 cells per person on an adult basis.
  • Hyperproliferative diseases to which the pharmaceutical compositions of the present invention may be applied include, for example, tumors, cancer, hypergammaglobulinemia, lymphoproliferative diseases, dyslipidemia, purpura, sarcoidosis, Sezary Syndrome, foot Waldenstron, macroglobulinemia, Gaucher's disease or histiocytosis, but is not necessarily limited thereto.
  • the pharmaceutical composition of the present invention may preferably be used for the prevention or treatment of a tumor or cancer
  • the tumor or cancer is glioma, meningioma, pituitary adenoma, medulloblastoma, metastatic brain tumor, auditory neuroma, prostate cancer, malignant nodules Including, but not limited to, melanoma and neuroblastoma.
  • the glioma includes an astrocytoma, an oligodendrocyte, an astrocytoma, a polymorphic glioma.
  • malignant brain tumors such as glioblastoma multiforme among gliomas are practically incurable despite extensive surgical resection, adjuvant radiation and chemotherapy, and usually die, resulting in a very poor prognosis (Black et al. , Cancer of the Nervous System, Blackwel 1, Oxford (1997); Surawicz et al., J. Neurooncol., 40: 151 (1998).
  • compositions of the present invention may most preferably be used as highly adjuvant therapeutics for the complete treatment of malignant brain tumors, such as glioblastoma multiforme.
  • the treatment method using the pharmaceutical composition of the present invention can be used in combination with other treatment methods known in the art, such as chemotherapy treatment, radiation therapy, surgical surgery, drug administration and the like. In addition, it can be used as adjuvant therapy for other treatment methods for tumors.
  • human neural stem cells are transplanted into the central nervous system and then reacted to signals expressed at brain tumor sites to engraft and distribute specifically to brain tumor sites, and when administered systemically through intravenous injection, other than the central nervous system. It has been shown to migrate specifically to non-neurologic tumors, ie prostate cancer, malignant melanoma and neuroblastoma, which occurred in the area (Brown et al., Human Gene Therapy, 14: 1777 (2003)). Therefore, the pharmaceutical composition of the present invention can be effectively used for the treatment of non-neurologic tumors such as prostate cancer, malignant melanoma, neuroblastoma and other malignant tumors that occur not only in brain tumors but also systemically.
  • non-neurologic tumors such as prostate cancer, malignant melanoma, neuroblastoma and other malignant tumors that occur not only in brain tumors but also systemically.
  • the present invention is based on the effect of the present invention as described above of the tumor comprising the administration of an effective amount of human neural stem cells transformed with a nucleic acid encoding ffMDM2, aMDM2 secreted to an individual in need thereof Provide a method of treatment.
  • the term "effective amount” refers to the amount of the neuronal stem cells of the present invention exhibiting an effect of treating a tumor in the subject to be administered.
  • Neural stem cells of the present invention can be administered until the desired effect is derived from the effects described above, can be administered by various routes according to methods known in the art, preferably parenteral administration such as topical administration .
  • the present invention provides human neural stem cells comprising a nucleic acid encoding aMDM2 and a pharmaceutical composition for treating cancer comprising the same.
  • Human neural stem cells comprising a nucleic acid encoding aMDM2 of the present invention does not induce cytotoxicity, but secretes aMDM2 in vivo and induces apoptosis of abnormal cells. It can be usefully used for prevention or treatment.
  • Figure 1 is a result of observing the growth and growth form of human neural stem cells derived from various brain tissues under a microscope.
  • HFT13 Brain Stem-derived Neural Stem Cells
  • HFD13 neural stem cells derived from hepatic brain
  • HFM13 mesenchymal stem cells
  • HFC13 Neural Stem Cells from Cerebellum
  • Figure 2 is a graph comparing the growth curve of human neural stem cells derived from various brain tissues.
  • Figure 3 is a result of observing the differentiation pattern of human neural stem cells isolated in the present invention using various markers under a microscope.
  • Figure 4 is the result of confirming the tumor production by hemaroxylin and CM-Dil staining in human glioblastoma animal model prepared by transplanting U87MG cells.
  • L-ITR left inverted terminal repeat
  • R-ITR right inverted terminal repeat
  • Ig / c -chain leader secretion signal sequence
  • Ad5 left / right arm homology sequence required for homologous recombination with pAdEasy_l, the backbone vector
  • FIG. 7 shows PCR results of investigation of contamination of wild-type adenoviruses from recombinant adenoviruses produced from aMDM2 expression-expression recombinant adenovirus vectors.
  • lane 3 Ad MDM2 (E1A Primer) lane 4: AdaMDM2-LacZ (E1A Primer) lane 5: AdaMDM2 ( ⁇ 2 Primer) lane 6: AdaMDM2-LacZ ( ⁇ 2 Primer)
  • FIG. 9 shows the results of the growth of human neural stem cells infected with aMDM2 expressing recombinant virus (Adff MDM2).
  • 10 is a result of investigating the viability of human neural stem cells infected with aMDM2 expressing recombinant virus (AdffMDM2) by CCK-8 assay.
  • FIG. 11 shows the results of apoptosis of human glioma cell line (U87MG, U373MG) co-cultured with human neural stem cell culture infected with ffMDM2 expressing recombinant virus (AdaMDM2).
  • FIG. 12 shows aMDM2 (p53) expressed in human neural stem cells infected with aMDM2 expressing recombinant virus (AdffMDM2) by IP / Western blot analysis.
  • Figure 13 shows the results of immunohistochemical staining of aMDM2 (p53) expressed in human neural stem cells infected with aMDM2 expressing recombinant virus (AdaMDM2).
  • 14 shows the distribution of transplanted neuronal stem cells in ⁇ galactosidase immunohistochemical staining in an animal model transplanted with glioblastoma (U87MG) and human neural stem cells infected with aMDM2 and LacZ expressing recombinant virus (hNSCs-AdaMDM2—LacZ). The result is.
  • FIG. 16 shows an aMDM2 expressed in transplanted neural stem cells in an animal model transplanted with glioblastoma (U87MG) and human neural stem cells (hNSCs-Ac MDM2-LacZ) infected with aMDM2 and LacZ-expressing recombinant virus. Tumor cell death was confirmed by active caspase-3 immunohistochemical staining.
  • FIG. 17 shows control animal model and glioblastoma (U87MG, U373MG) transplanted with glioblastoma (U87MG, U373MG) and vehicle and «MDM2 and LacZ expression recombinant Comparison of tumor size reduction in animal models implanted with virus-infected human neural stem cells (hNSCs-AdaMDM2-LacZ).
  • hNSCs-AdaMDM2-LacZ virus-infected human neural stem cells
  • FIG. 18 is a control animal model transplanted with glioblastoma (U87MG) and vehicle and animal model transplanted with glioblastoma (U87MG) and human neural stem cells (hNSCs-Ac MDM2-LacZ) infected with c? MDM2 and LacZ expressing recombinant virus This is a comparison of survival in Esau.
  • Each separated brain tissue was placed in a petri dish, cut to about lx 1 mm 3, and the sections were centrifuged at 950 rpm for 3 minutes to remove supernatant. The tissue was again washed with H—H complete solution, and the centrifugation was repeated three times. Remove all supernatant after the last centrifugation and mix well with remaining tissue by adding 0.1% trypsin (Gibco) 2 i and DNase I (Roche, 1 rag / dO), 37 ° C, 5%
  • the reaction was repeated for 30 minutes in a C0 2 incubator. After 30 minutes serum-containing medium (DMEM + 10% FBS + lx penici 1 P ⁇ / streptomycin / fungizone) (both from Gibco) was added 3 mi. Serologic pipettes (Falcon) were used to slowly break down the tissue and dissociate to single cell level. Then, after removing the supernatant by centrifugation, the cell pellet (pellet) was washed with HH complete solution. After centrifugation again, the supernatant was removed.
  • serum-containing medium DMEM + 10% FBS + lx penici 1 P ⁇ / streptomycin / fungizone
  • N2 medium D-MEM / F-12 [98% volume (v) / volume (v)) + N2 supplement [1% v / v] +
  • Pen ici 11 in / St ept omyc in [1% v / v] were all added by GIBCO) 10 and slowly mixed.
  • About 4 ⁇ 10 6 ⁇ 6 ⁇ 10 6 cells were transferred to a tissue culture treated 100 mm plate, Corning.
  • N2 medium 5 was added. At the same time 20 ng / m £ bFGF, 10 ng / mt LIF and 8 g / mt heparin were added and incubation continued. Medium exchange was performed every 3-4 days while observing the state of the medium and cells. At this time, only about half of the medium was replaced with fresh medium and growth factors were added together.
  • the supernatant was removed by centrifugation. Cells were resuspended with N2 medium 3 ⁇ and then crushed with serum pipette until neurospheres dissociated into single cells. After measuring the cell number, the cell suspension containing about 4 ⁇ 10 6 to 6 ⁇ 10 6 cells was transferred to a new cell culture plate containing some of the existing medium, and insufficient N 2 medium was added to give a total of 10 medium. . And 20 ng / ml bFGF, 10 ng / mt LIF and 8 ⁇ g / ml heparin was added, and then cultured in a 5% C0 2 incubator.
  • HNSC 01 human neural stem cell line
  • Example ⁇ 1-3> some cells were cryopreserved when a number of neural stem cells were obtained by continuing subculture. Cryopreservation was carried out in the following manner: Neurospheres treated with 0.05% trypsin / EDTA (Gibco) and trypsin inhibitor in turn were crushed and transferred to 15 mi tubes as cell passage. Cells were washed by addition of HH complete solution 8 II ⁇ . The supernatant was removed by centrifugation.
  • Cells were gently resuspended by adding the prepared 4 ° C cryopreservation solution (N2 medium [40% v / v] + FBS [50% v / v] + DMS0 [10 v / v, Sigma]) to the cell pellet. .
  • the cell suspension was aliquoted in 1.8 to one freezing vial (NUNC).
  • NUNC freezing vial
  • Cells contained in one 10 mm cell culture plate were dispensed into 3-4 frozen vials. Then, it was transferred to a -70 ° C. bin in a ice bucket, and after 24 hours, it was transferred to a liquid nitrogen tank for long-term storage.
  • the frozen glass bottles were immersed in a 37 ° C thermostat and slowly shaken.
  • the cell suspension was transferred to a conical tube containing N2 medium 10 previously warmed to 37 ° C.
  • the supernatant was removed by centrifugation.
  • the cell pellet was carefully suspended with 5 mi of N2 medium and transferred to 60 mm 3 cell culture plates. Thereafter, 20 ng / rni bFGF, 10 ng / mi LIF, and 8 ug / ml heparin were added to the plates, and then cultured in a 37 ° C., 5% CO 2 incubator.
  • Example 2 In Vitro Characterization of Human Neural Stem Cells
  • Example 1 the neural stem cells, which were isolated and cultured from various anatomical regions of the human central nervous system and grown in the state of neurospheres, were transferred to 100 mm cell culture plates, each of 4 ⁇ 10 6, and grown for 50 days. As a result, neural stem cells showed exponential growth (see FIG. 2). Among them, the number of cells in hepatocyte-derived neurospheres (HFD13 cells) increased about 1,850 times compared to the number of cells at the beginning of culture, and in the case of tumor-derived neurons (HFT13 cells), about 1,035 times increased.
  • HFD13 cells hepatocyte-derived neurospheres
  • HFT13 cells tumor-derived neurons
  • HFC13 cells cerebellum-derived neurospheres
  • HMM13 cells midbrain-derived neurospheres
  • HFS13 cells spinal cord-derived neurospheres
  • the brain, liver, cerebellum, midbrain and spinal cord-derived neurospheres were passaged at 42 (about 1 year), 36 ( Long term cultures were possible up to about 11 months), 30 (about 9 months), 10 (about 6 months) and 15 (about 7 months).
  • No particular cell morphological changes or growth rate changes were observed in each passage.
  • all cells showed normal primary cell growth that died after aging (results not shown).
  • each neurosphere was cryopreserved in liquid nitrogen for a long time and thawed again, and then cultured in the same manner to continue to proliferate or differentiate in vitro without changing cell growth characteristics (results not shown).
  • the normal 46, XY karyotype was shown, and the normal chromosome karyotype even in the long-term passage (result not shown).
  • Neurospheres proliferating in vitro were stained by immunohistochemistry.
  • Neurospheres 10 Transfer to poly-L-lysine (Sigma) coated chamber slide (NUNC) and incubated for 1 day. Once neurospheres adhered to the bottom of the slide, the medium was removed and washed once with cold IX PBS. Cells were fixed by treatment with 4% paraformaldehyde (in Pipes buf fer) (Sigma) for 10 minutes. After washing three times with 1XPBS, the cells were blocked with blocking solution (5% bovine serum alburain [BSA, Sigma] + 3% normal goat serum [NGS, Vector] + 0.3% Triton X-100 [Sigma] in PBS) for 1 hour at room temperature.
  • BSA bovine serum alburain
  • NGS Normal goat serum
  • Vector 0.3% Triton X-100 [Sigma] in PBS
  • anti-human specific Nest in antibody 1: 200, diluted in carrier solution (3% NGS + 0.3% Triton X-100 in PBS) Chemicon) or anti-menten antibody (ant i-Vimentin antibody, 1:80, Sigma) was added and reacted overnight at 4 ° C. After washing the cells three times with 1XPBS again, the diluted secondary antibody (species specific secondary ant i bodies conjugated with fluorescein, 1: 200, Vector) was added to the carrier solution and reacted for 1 hour at 37 ° C. After washing three times with 1XPBS, mounting medium (mounting media,
  • HFT13 cells cerebellum derived neurospheres
  • the diluted secondary antibody (specific secondary antibodies conjugated with fluorescein, 1: 200, Vector) was added to the carrier solution for 1 hour at 37 ° C. Reacted. lx to PBS
  • the mounting medium (Vector) was dropped on the cells and the cover glass was covered.
  • Epi fluorescent microscope, Olympus
  • human neural stem cells differentiated into various neurons and expressed various neurotransmitters. It showed pluripotency (see FIG. 3B). More specifically, the expression of early neuronal marker TUJ1 was observed in all human neural stem cells derived from each anatomical position of the central nervous system. This shows that the neural stem cells can differentiate into neuronal cells. In addition, early expression of early oligodendrocyte marker 04 was generally low, indicating that a small number of neural stem cells differentiated into oligodendrocytes.
  • GFAP-expressing cells known as markers of astrocytic cells (astrocytes) are neural stem cells or radial glial cells thereof. All human neural stem cells from each anatomical location of the central nervous system have been shown to express GFAP. In particular, GFAP expression rate of HFT13 cells was significantly higher at 80% and 90-95% at early and late passages, respectively, and increased as passage continued.
  • human neural stem cells cultured in the present invention expressed various neurotransmitters during differentiation, in particular GABA and glutamate were expressed in almost all cells.
  • human neural stem cells cultured in the present method expresses only a small number of cells choline acetyltransferase (choline AT) and tyrosine hydrase (TH) under differentiation conditions, and thus do not differentiate well into dopaminergic or cholinergic neurons. Seemed.
  • Example 3 Culture of Human Glioblastoma and Establishment of Human Glioblastoma Animal Model
  • Subculture was performed every 2 days with 0.05% trypsin / EDTA for 2 minutes 30 seconds. After the last subculture, U87MG or U373MG cells were treated with trypsin / EDTA to make single cell suspensions. The suspension was centrifuged at 950 rpm for 3 minutes to remove supernatant. Cells were resuspended by adding lx PBS 5 containing 20 g / CM-DiI (Cell Tracker, Molecular Probes) to the cell pellet. The cells were then stained with CM-DH by reacting for 3 minutes at 37 ° C and 10 minutes on ice.
  • CM-DiI Cell Tracker, Molecular Probes
  • Athymic nude mice (nu / nu; female) (central test animals) of 6-8 weeks old were treated with xylazine, 0.1 mg / 10 g of body weight (Bay Korea) and ketamine (Ket amine, 0.5 mg / 10 g of body weight).
  • the median skin of the head was disinfected and incised with 703 ⁇ 4 alcohol.
  • the head was fixed to a stereotaxic apparatus. After marking the location of the right striatum, the skull was drilled with 0.5 mm forward from Brema, 2.0 mm to the right side, 3 mm deep, and 1 mm drill bar.
  • CM-Dil-labeled tumor cell suspension prepared in Example ⁇ 3-1> was placed in a Hamilton syringe. remind After the syringes were fixed to the stereotactic device, tumor cell suspensions 2-5 ⁇ were slowly implanted into the striatum at this location using a micro injection pump (Storting). After transplantation, the cells were stabilized for 3 minutes. Again, the syringe needle was slowly removed over three minutes. The surgical site was disinfected and sutured with iodine ointment. Mice were stabilized on 37 ° C warm pads until anesthesia awoke. To prevent infection, cephazoline (cepazolin, 50 mg / kg / day, Yuhan Corporation) was diluted in distilled water for 3 days after surgery, and the mice were injected subcutaneously.
  • cephazoline cephazoline
  • mice were fixed with 4% paraformaldehyde (in Pipes buffer) three weeks after cell transplantation and brains were extracted.
  • the extracted brain was cryosectioned at 16 m and stained with hematoxylin (Vector). Thereafter, the tumors labeled with CM-Dil were observed under a microscope.
  • a very large tumor was formed in the right striatum of the mouse when 118 ⁇ cells were transplanted (FIG. 4), and a tumor was formed in the striatum even when the U373MG cells were transplanted.
  • FIG. 4 Preparation of gMDM2 Expression Recombinant Adenovirus
  • CMV i ediately early enhancer CMV ie enhancer, taken from the pTriEX-1.1 Neo DNA (Novagen) vector at the MCSO iltiple cloning site of pShuttle vector (Stratagene) to use recombinant adenovirus with CAG promoter.
  • the rabbit-globin terminator was first cloned between 5 / I and Bgl of the pShuttle vector in the following manner.
  • pTriEX-1.1 Rabbit from Neovector The globin terminator was obtained by PCR using Pfu polymerase (Takara).
  • the primers (CRTGAGATCMTTCTCTAGCCAAT) of SEQ ID NO: 5 and the reverse primer (GGATCCTTACATATGGGCATATGT) of SEQ ID NO: 6 include? I and MI restriction enzyme sequences for cloning into the pShuttle vector.
  • the CMV immediate early enhancer and chicken-actin promoter portions were then cloned into the pShuttle vector containing the rabbit-globin terminator as follows.
  • the modified pTriEX-1.1 neo vector was cut with Fsel and subjected to polymerization with Klenow flakes.
  • a blunt end was made and cut again with ⁇ 1) ⁇ to obtain the CMV immediate early enhancer and chicken / 5_actin promoter portion.
  • IRES and LacZ were cloned into the pShuttle-CAG vector in the following manner.
  • IRES and LacZ fragments from pShuttle-IRES-hrGFP and pShuttle-CMV-LacZ (Stratagene) vectors were obtained by PCR using pfu polymerase.
  • the primers used to obtain IRES (the forward primer of SEQ ID NO: 7 (GCGGCCGCAAATMTAATAGCMTTCCT) and the reverse primer of SEQ ID NO: 8 (TCTAGATGGTTGTGGCCATTATCA) contain the ⁇ 3 ⁇ 4 ⁇ restriction enzyme sequence in front of the IRES for cloning into the pShuttle-CAG vector.
  • SEQ ID NO: 7 GCGGCCGCAAATMTAATAGCMTTCCT
  • TCTAGATGGTTGTGGCCATTATCA TCTAGATGGTTGTGGCCATTATCA
  • PCR reaction was denatured for 5 min at 95 ° C; 30 cycles of denaturation at 94 ° C. for 30 seconds, annealing at 56 ° C. for 30 seconds and extension at 72 ° C. for 30 seconds; At 72 ° C
  • the amplified PCR product was cloned into pGEM-T easy vector (Promega, Wisconsin, USA) (pGEM-T easy-IRES).
  • the primers used to obtain LacZ (the forward primer of SEQ ID NO: 9 (tctagaatggtcgttttacaacgtcg) and the reverse primer of tctagattatttttgacaccagaccaac) of SEQ ID NO: 10 contain the bal restriction enzyme sequence in front of LacZ for cloning with IRES, pShuttle-CAG For cloning with the vector, it contains the 3 ⁇ 4I restriction enzyme sequence behind LacZ.
  • PCR reaction was initially denatured at 95 ° C.
  • the amplified PCR product was cloned into pGEM-T easy vector (Promega, Wisconsin, USA) (pGEM-T easy-LacZ).
  • the pGEM-T easy-1 RES vector was cut into I and 5 / I, and the pGEM-T easy-LacZ vector was cut into 3 ⁇ 4al and Xho I and ligation (pGEM-T easy-IRES-LacZ).
  • the pGEM-T easy-IRES-LacZ vector was cut with Notl and I to obtain IRES and LacZ moieties.
  • pShutt le_CAG_IRES-LacZ was completed by ligation of the product obtained by cleaving the pShuttle-CAG vector with Notl and 3 ⁇ 4? I and the above IRES and LacZ moieties.
  • ⁇ 4-2> Preparation of aMDM2 Expression Recombinant Vector A nucleotide sequence corresponding to the 12 amino acid sequence (SEQ ID NO: 1: QETFSDLWKLLP (? # 2)) of the MDM2 binding site of human p53 (SEQ ID NO: 3: caggaaacattttcagacc tatggaaactacttcct) was synthesized.
  • a protein transduction domain consisting of 11 amino acids derived from HIV, TAT; YGRKK RQR R; SEQ ID NO: 11
  • the nucleotide sequence that complements it is as follows: tat ggacgaaagaaacggaggcaacgt agacgcgga; SEQ ID NO: 12. Synthetic oligomers that will complementarily bind after combining by adding the //?
  • Each synthesized oligomer was dissolved in a high concentration of STE complete solution (10 niM Tris-HCl pH 8.0, 50 mM NaCl, 1 mM EDTA) at a concentration of 6 / g / l. After mixing each one of the 2 1, put in a bath at 94 ° C. The heating was turned off and cooled to room temperature. Thereafter, a double-stranded oligomer comprising an Ig c-chain leader that induces extracellular secretion of the protein was cloned into a pSecTag2A vector (Invitrogen).
  • the pSecTag2A vector was cut with HindYi and 3 ⁇ 4 I restriction enzymes, and the Ig c-chain leader-TAT-aMDM2 construct was completed by ligation of the TAT-linked "MDM2 fragment and the pSecTag2A vector.
  • PCR was used as a template of the pSecTag2A vector containing the TAT-aMDM2 prepared above as the forward primer of SEQ ID NO: 15 and (AGATCTGCCACCATGGAGACA) reverse primer (GTCGACTTMGGMGTAGTTTCC) SEQ ID NO: 16, PCR reaction was 94 ° C Initial denaturation for 3 minutes; 35 cycles of denaturation at 94 ° C. for 30 seconds, annealing at 53 ° C. for 30 seconds and extension at 72 ° C. for 30 seconds; At 72 ° C
  • T easy-Ig c-TAT-aMDM2 vector was digested with 5 / I restriction enzyme and then Ig / c-
  • TAT-aMDM2 fragment was inserted into pShuttle-CAG and pShutt le_CAG-IRES_LacZ, which are the adenovirus shuttle vectors prepared in Example ⁇ 4-1>, and were inserted into 'pShuU le—CAG-Ig / c ⁇
  • TAT-aMDM2 pShuttle-CAG-Ig / c-TAT-aMDM2-IRES-LacZ '(FIG. 5 and FIG. 6).
  • AdaMDM2 or Ada MDM2-LacZ prepared pShuUle-CAG-Ig / c-TAT—ffffl) M2 or pShutt le_CAG_Ig / c-TAT— «MDM2-IRES-LacZ was digested with 3 ⁇ 4e restriction enzymes and then adenovirus backbone vector (adenoviral backbone vector) Co-introduction to BJ5183 Stratagene with pAdEasy-l (Stratagene) induced homologous recombination between the two vectors (pAdCAG-Ig / c-TAT— “MDM2 or pAdCAG—Ig / c -TAT- aMDM2-IRES-LacZ) .E. coli transformation was
  • the pAdCAG-Ig / c-TAT-aMDM2 or pAdCAG-Ig / c -TAT-aMDMS-IRES-LacZ thus obtained was digested with 73 ⁇ 4cl restriction enzymes and then transfected into 293A cells (Invitrogen, CA), an adenovirus producing cell line ( transfect ion) to amplify the virus.
  • the recombinant virus (AdaMDM2 or AdaMDM2-LacZ) produced was produced at 10 ° C at 80,000 rpm.
  • Cesium chloride ultracentr i fugat m was performed for 6 hours to obtain pure separation. After dialysis (Pierce, Rockford, IL, USA) in 43 ⁇ 4 sucrose buffer (10 mM Tris pH8.0, 2 mM MgCl 2 , 4% sucrose in dd3 ⁇ 40), filtered with a 0.4 ⁇ ⁇ ⁇ filter before use. Store at 70 ° C.
  • TCIDsoCTissue Culture Infectious Dose 50, QBiogene test was performed using 293A cells to quantify the AdiMDM2 recombinant virus prepared above. 293A cells were plated in 96 well plates (NUNC) and serially diluted Each virus was infected. After one week, the number of infected wells was added to calculate the TCID 50 value using the KABER statistical method (TCID 50 reference; QBiogene, CA, USA.AdenoVator application cat manuals).
  • the TCID 50 value of the recombinant virus was IX 10 10 to 10X10 10 on average.
  • PCR was performed by synthesizing primers from the internal sequence of E1 gene of wild-type adenovirus removed in the recombinant adenovirus.
  • the genome of each recombinant virus was obtained by phenol / ethanol precipitation after breaking the virus particles with lysis buffer (0.1% SDS, 10 mM Tris pH7.4, 1 mM EDTA).
  • sequence primer 17 (ATTCmCCCACCCTTAAGCC) sequence primer (amplifying the E1 gene of wild-type adenovirus) was used to determine whether the wild-type adenovirus was contaminated.
  • PCR was performed using PCR primers of SEQ ID NO: 15 and SEQ ID NO: 16 to detect the target gene, TAT-aMDM2, to identify the genome of the recombinant adenovirus extracted. .
  • PCR reaction was denatured at 94 ° C for 3 min; 30 cycles at 94 ° C. 35 cycles of denaturation, annealing at 53 ° C. for 40 seconds and extension at 45 ° C.
  • the 293A cell genome was used as a positive control.
  • the 293A cell genome was obtained by phenol / ethanol precipitation after cell breakdown with digestion buffer (0.5% SDS, 100 mM NaCl, 10 mM Tris-Cl, 25 mM EDTA). PCR reaction results were confirmed by 2% agarose gel electrophoresis.
  • AdaMDM2 virus induced the death of human glioma cells
  • various glioma cells were infected with the virus.
  • mitochondrial dehydrogenase activity assay (Cel 1 Counting Kit— 8 [CCK-8 assay], Dojindo Laboratories , Tokyo, Japan)
  • CCK-8 assay mitochondrial dehydrogenase activity assay
  • the CCK-8 solution was treated in each well, and after 2 hours, the absorbance was measured at 450 nm with a microplate reader, and the blank control was a well treated with only the CCK-8 solution in the culture medium.
  • Virus-free glioma cell culture groups were expressed as 100% cell viability groups, each experimental group was tested with three wells, and the same experiment was repeated three times to obtain an average value.
  • a CCK-8 assay was performed. 5 x 10 4 HFT13 cells 96 well with growth factor-containing N2 medium 100 ⁇ Plates were plated in each well. After 1 hour, 0, 2, 5, 10, 15, 30 M0I of AdaMDM2 virus particles were directly added to the medium to infect the cells. infection
  • AdaMDM2 infected cells showed an average of 99.5 ⁇ 2.1 (mean mean SEM)% at 2 M0I and 59.6 at 79.6 ⁇ ⁇ .Th, 10 MC) I at 5 M () I, when virus-infected HFT13 cell growth averaged 100%.
  • CAG promoter inhibited the growth and growth of human neural stem cells according to the expression level of "MDM2, but the cell growth was not significantly inhibited in low M infected cells.
  • Example ⁇ 5-1> aMDM2 expression in HFT13 cells infected with AdaMDM2 was confirmed by immunohistochemical analysis.
  • anti-mouse immunoglobulin G-FITC (Vector) was reacted with the carrier solution at 1: 180 in the carrier solution at 1: 180 and reacted at 37 ° C for 1 hour. Thereafter, the cells were washed in the same manner as described above, and then mounted in a mounting medium (Vector) for fluorescence microscopy to which DAPI was added. HFT13 cells without virus infection were used as controls. As observed under fluorescence microscope (BX51, Olympus), p53 stained very strongly in Ad «MDM2 virus infected cells, whereas p53 stained very weakly in uninfected cells (see FIG. 11).
  • the virus-infected human neural stem cells were found to express aMDM2 well when compared with cells not infected with a large amount of p53 staining.
  • Example ⁇ 5-3> IP / Western Blot Analysis of ffMDM2 Derived from Human Neural Stem Cells Infected with aMDM2 Expression Recombinant Adenovirus
  • a (? MDM2 expressing MDM2 expressed in HFT13 cells infected with? Precipitation / Western blot analysis confirmed that 1.5 ⁇ 10 6 HFT13 cells were plated in each well of a 6 well plate with 1 ml of growth factor-containing N2 medium, 1 hour later, 0, 5, 10 M0I of AdaMDM2 virus particles. Each cell directly into the medium Infected.
  • the virus-produced human neural stem cells were confirmed to express aMDM2 well when compared with cells not infected with a large amount of p53 staining.
  • Example 6 Apoptosis Analysis of Human Glioblastoma by Human Neural Stem Cells Infected with ⁇ 2 Expression Recombinant Adenovirus
  • ⁇ 6-1> Apoptosis Analysis of Human Glioblastoma by Human Neural Stem Cells Infected with aMDM2 Expression Recombinant Adenovirus
  • GMDM2 and LacZ Expression in Glioblastoma Animal Models Transplantation of Human Neural Stem Cells and Analysis of External Gene Expression, Engraftment, Distribution, Migration and Differentiation of Donor Cells in Vivo
  • Human neural stem cells infected with AdaMDM2-LacZ virus were transplanted into animal models of human glioblastoma cells to investigate the expression, engraftment, distribution, migration and differentiation of exogenous genes in donor cells in vivo.
  • non-thymus nude mice 6-6 week old non-thymus nude mice were implanted into the right striatum, and 10 days later, non-thymus nude mice were analyzed.
  • Non-thymus nude mice of Example ⁇ 7-1> were fixed with 4% paraformaldehyde (in 0.1M Pipes buffer), and brains were extracted. The extracted brain was immersed in 30% sucrose (in PBS). After 1-2 days at 4 ° C cryoprotection (cryoprotection), and was cut to 16 ⁇ . The brain tissue sections were treated with anti-galactosidase antibodies (1: 500; MP
  • Biomedicals were stained by immunohistochemistry according to the method described in Example ⁇ 2-2>.
  • LacZ-expressing (green) donor cells showed engraftment and distribution in the form of infiltrating into the mass surrounding the boundary of CM-Dil-labeled (red) primary mass formed on the right striatum of the animal (Fig. 14 A-H).
  • LacZ-expressing neural stem cells transplanted into tumor animal models were specifically migrated to tumor sites that migrated not only to the primary mass but also to the surrounding third ventricle at a distance (I-L in FIG. 14).
  • transplanted cells expressed human nestin (green), a marker of immature neural stem cells, indicating that some of the transplanted donor cells existed in an undifferentiated state (HI of FIG. 15).
  • very few LacZ-expressing donor cells expressed early neural markers TUJ1 and PanNF (green) at the tumor site and showed differentiation into neuronal cells (JM in FIG. 15).
  • human neural stem cells expressing aMDM2 and LacZ are transplanted to the intracranial striatum of the glioblastoma model animal and remain as undifferentiated neural stem cells, but some donor cells have a short period of 10 days after transplantation. It has been shown to be able to regenerate neuronal parts of host animals that have been destroyed by masses by differentiating into neurons and glial cells at or within the boundaries of the masses.
  • Example ⁇ 7-2> were stained by immunohistochemistry using anti-active caspase-3 (1: 200; BD Pharmingen) according to the method described in Example ⁇ 2-2>. .
  • B, F, J in Fig. 16 were observed and DAPI staining (blue) showing the density by staining the nuclei of cells.
  • C, G in FIG. 16 The density of the cells inside the mass was significantly reduced.
  • Example ⁇ 3-2> In order to quantitatively determine the extent of tumor size reduction after transplantation of human neural stem cells expressing aMDM2 by CAG promoter, tumor cells and tumor cells in the right striatum of non-thymus nude mice, as in Example ⁇ 3-2>.
  • Human neural stem cells expressing aMDM2 were transplanted together.
  • the transplanted nerve stem cells were prepared as follows. Human neural stem cells cultured in the neurosphere state were plated in a single cell state in a new culture plate treated with 0.05% trypsin / EDTA (Gibco) 3 days before transplantation. After 1 hour, the desired virus was infected with each neural stem cell.
  • Neural stem cells transplanted into the brain tumor model are as follows. 10 MW of AdaMDM2-
  • cryoprotection After 1-2 days at 4 ° C cryoprotection (cryoprotection), and was cut to 16 kPa. Each brain tissue section spacing on the slide was 96 izm each. The brain tissues were then stored at -20 ° C until stained. Slide in IX PBS
  • the mean tumor volume of the control group in the animal model of U87MG glioblastoma was 0.375 ⁇ 3
  • the mean tumor volume of the experimental group transplanted with aMDM2 expressing neural stem cells was 0.002 mm 3
  • the mean tumor volume of the control group was 0.046 ⁇ 3
  • the mean tumor volume of the experimental group transplanted with the neural stem cells expressing «MDM2 was 0.021 mm 3
  • the tumor volume of the control group was converted to 100%
  • the tumor volume of the aMDM2 expressing cell transplant group was U87MG transplanted. 0.5 ⁇ 0.03% (mean ⁇ SEM) in animal model, 46.7 ⁇ in U373MG transplanted animal model
  • the experimental animals were observed for at least 120 days.
  • the body weight of the test animal was reduced by more than 20% for one week, as in Example 8, after fixing with 4% paraformaldehyde (in 0.1M Pipes buffer), the brain was extracted and counted as the death date.
  • the average survival day of the control group was 52 days, whereas the average survival day of the experimental group was 142 days.
  • it was observed that most of the transplanted brains occupy the masses (results not shown).

Abstract

본 발명은 항-MDM2를 암호화하는 핵산을 포함하는 인간의 신경줄기세포 및 이를 포함한 암 치료용 약제학적 조성물을 제공한다. 본 발명의 항-MDM2를 암호화하는 핵산을 포함하는 인간의 신경줄기세포는 세포독성을 유발하지 않으면서, 생체 내에서 항-MDM2를 분비하여 비정상 세포의 아폽토시스를 유발하므로 암 등 세포과다증식 질환의 예방 또는 치료에 유용하게 사용될 수 있다.

Description

【명세서】
【발명의 명칭】
항 -MDM2를 발현하는 인간 성체줄기세포 및 그의 용도 【기술분야】
본 발명은 p53 단백질에 대한 MDM2 단백질의 결합을 억제하는 펩타이드 억제제를 발현하는 인간의 성체줄기세포 및 이를 포함하는 약제학적 조성물에 관한 것이다. 보다 상세하게는 종양세포 사멸 유도물질인 p53 단백질에 MDM2 단백질이 결합하는 것을 억제하는 펩타이드 억제제를 발현하도록 (바람직하게는, 분비하도록) 형질전환된 인간 성체즐기세포 및 이를 포함하는 약제학적 조성물에 관한 것이다.
【배경기술】
현재 신경계질환에 대한 수많은 새로운 치료약물, 단백질 및 신경영양인자들이 검색되고， 생체 내외에서 치료 효과와 신경보호 작용의 평가 등을 통하여 다양한 치료법이 활발히 개발되고 있으나 아직 가시화된 성과는 별로 없다. 실제 임상적으로 손상된 신경조직을 보호하고 재생시키는 특별한 치료법은 없는 실정이다. 난치성 신경계 질환의 치료를 위해서는 상기 치료약물 및 신경영양인자와 같은 '소분자 (small molecules)'의 개발만으로는 층분하지 않고， 이미 사멸하였거나 기능부전을 보이는 신경세포를 대체하여 신경재생을 유도하는 세포치료가 필수적이다.
따라서 최근에 줄기세포학이 발전하면서 기존 유전자 치료의 안전성과 효율성의 문제점， 그리고 1차 태아조직 또는 세포 사용의 한계점을 극복하고 인체에 대한 새로운 세포 및 유전자 치료를 가능케 하는 최상의 대안으로 인간 신경줄기세포에 대한 연구와 치료적 적용이 부각되고 있다. 신경줄기세포는 신경세포뿐만 아니라 다양한 다른 종류의 세포 또는 조직으로도 분화될 수 있는 분화의 유연성 (plasticity)을 가지고 있음이 보고되었다. 최근에 이러한 신경줄기세포를 이용한 줄기세포의 증식과 분화기전 및 신경계 발달에 관한 기초연구뿐만 아니라 한번 손상되면 재생되지 않는다고 알려져 있는 난치성 종양， 특히 신경계질환에서 신경줄기세포의 생물학적 특성을 이용하여 새로운 세포 및 유전자 치료의 가능성에 대한 관심이 증대하고 있다.
그러나 현재 신경줄기세포 연구는 아직 전 세계적으로 태동기여서 많은 기초적인 연구가 필요하고 실제 임상적용을 위해서는 여러 문제들이 해결되어야 한다. 특히， 생체 내로의 신경줄기세포의 이식 시 공여세포의 생착， 이주, 분화， 외부 유전자 발현 및 숙주 신경계에 통합되는 기전이 규명되어야 하고， 분화된 신경세포가 숙주 신경계에서 적절한 신경접합， 신경연결 및 기능적 개선을 이루는지 확인되어야 한다 .
한편, p53 종양 억제 단백질은 세포 주기 진행， 아폼토시스， 노화의 중요한 조절자이다. 세포에 다양한 스트레스 요인이 작용하면 타겟 유전자에 p53-매개 전사 활성화 또는 억제가 일어난다. 이러한 작용으로 p53은 DNA 손상이 일어난 세포에서 세포 분열을 조절하고, DNA 손상을 복구하여 세포의 유전적 안정성을 유지한다. 종양 억제자로써의 역할 이외에 p53은 세포의 포도당 대사， 오토파지， 항산화 작용 등을 통해 세포의 생존을 촉진하는 역할도 갖는다.
p53의 세포내 활성은 정상상태 수준과 전사 후 변형 (post-transcript ional modification)에 의해 완벽하게 조절 받는다. 외부 스트레스가 없는 상황에서 p53은 MDM2(murine double minute 2) 단백질의 E3 리가아제 활성에 의해 억제된다. MDM2의 E3 리가아제 활성을 억제시키거나, MDM2와 p53의 상호작용을 방해하면 안정화 상태의 p53 수준이 높아져， 세포의 아픕토시스가 촉진된다. MDM2와 p53의 상호작용을 억제하는 방법이 종양세포 사멸의 조절에 중요한 타겟으로 부각되고 있다 (Ce// Cycle 7:971(2008); Nature 3:102(2003); Nature Reviews 7:979(2008)). 본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
【발명의 상세한 설명】
【기술적 과제】
본 발명자들은 MDM2 단백질에 의한 p53의 기능 차단을 억제하여 p53의 세포내 활성을 증가시켜 다양한 약리학적 효능을 발휘할 수 있는 세포치료제를 개발하고자 노력하였다. 그 결과， 인간 성체줄기세포 (가장 바람직하게는 인간 신경줄기세포)에 p53 단백질에 대한 MDM2 단백질의 결합을 억제하는 펩타이드 억제제를 코딩하는 핵산분자를 도입시켜 제조된 형질전환된 인간 성체줄기세포는 기본적으로 줄기세포로서의 특성을 가질 뿐만 아니라 p53의 세포 내 활성을 증가시켜 아픕토시스 등과 같은 기전을 통하여 암의 치료 등과 같은 다양한 약리학적 효능을 발휘한다는 것을 확인함으로써 본 발명을 완성하게 되었다.
따라서 본 발명의 목적은 항 -MDM2를 발현하는 인간 성체줄기세포를 제공하는 데 있다.
본 발명의 다른 목적은 과다증식 질환 (hyperproliferative disease)의 예방 또는 치료용 약제학적 조성물을 제공하는 데 있다. 본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명， 청구범위 및 도면에 의해 보다 명확하게 된다.
【기술적 해결방법】
본 발명의 일 양태에 따르면， 본 발명은 p53 단백질에 대한 MDM2 단백질의 결합을 억제하는 펩타이드 억제제를 코딩하는 핵산분자를 포함하는 인간 성체즐기세포를 제공한다. 본 발명자들은 MDM2 단백질에 의한 p53의 기능 차단을 억제하여 p53의 세포내 활성을 증가시켜 다양한 약리학적 효능을 발휘할 수 있는 세포치료제를 개발하고자 노력하였다. 그 결과， 인간 성체줄기세포 (가장 바람직하게는 인간 신경줄기세포)에 p53 단백질에 대한 MDM2 단백질의 결합을 억제하는 펩타이드 억제제를 코딩하는 핵산분자를 도입시켜 제조된 형질전환된 인간 성체줄기세포는 기본적으로 줄기세포로서의 특성을 가질 뿐만 아니라 p53의 세포 내 활성을 증가시켜 아폼토시스 등과 같은 기전을 통하여 암의 치료 등과 같은 다양한 약리학적 효능을 발휘한다는 것을 확인하였다.
본 명세서에서 용어 "p53 단백질에 대한 MDM2(murine double minute 2) 단백질의 결합을 억제하는 펩타이드 억제제 "는 "항 -MDM2"또는 "aMDM2"로 축약되어 사용된다.
상기 aMDM2, 즉 p53 단백질에 대한 MDM2 단백질의 결합을 억제하는 펩타이드 억제제는 MDM2 단백질이 p53 단백질에 결합하는 것을 방해하여 p53 단백질을 안정화시키는 것이라면 제한 없이 사용될 수 있다. 본 발명이 속하는 기술분야에서 상기 펩타이드 억제제는 다수가 알려져 있는데 예를 들어， W0 96/02642, 유럽특허 제 958305호, 미국공개특허 제 2001-18511호， 미국공개특허 제 2005-277764호 및 미국특허 제 6013786호가 있다. 상기 문헌들은 본 명세서에 참조로 삽입된다.
본 발명의 바람직한 구현예에 따르면， 상기 aMDM2는 하기 일반식 I， 일반식 II， 일반식 Π, 일반식 IV 또는 일반식 V로 표시되는 펩타이드를 최소 서열로 포함할 수 있다:
일반식 I
Phe-Aaai-Aaa2-Leu-Trp
상기 일반식 I에서, Aaal 및 Aaa2는 서로 독립적으로 Gly, Ala, Val, Ser, Tyr , Pro, Asp, Glu, Thr , Met , He, Leu, Phe, His, Lys, Arg, Cys, Asn, Gin 또는 Trp이다;
일반식 I Pheᅳ Aaaiᅳ Aaa2_Aaa3_Tr p_Aaa4_Aaa5ᅳ Aaa6
상기 일반식 표에서, Aaal, Aaa4 및 Aaa5은 서로 독립적으로 Gly, Ala, Val,
Ser, Tyr, Pro, Thr, Met, He,. Leu, Phe, Arg, Cys, Asn또는 Gin이고, Aaa2는 Arg, His, Glu, Asp, Cys 또는 Ser (바람직하게는， Glu 또는 Asp이며， 보다 바람직하게는 Asp이다)， Aaa3는 His, Phe또는 Tyr이며, Aaa6은 Phe, Gin또는 Leu이고;
일반식 HI
Aaal_Aaa2_Phe-Aaa3_Aaa4_Aaa5_ rp-Aaa6_Aaa7_Aaa8
Aaa^ Pro, Leu, Glu, Cys 또는 Gin이고， Aaa2, Aaa3, Aaa6 및 Aaa7은 Gly, Ala, Val, Ser, Tyr, Pro, Thr, Met, lie, Leu, Phe, Arg, Cys, Asn 또는 Gin이며， Aaa4는 Arg, His, Glu, Asp, Cys 또는 Ser이고， Aaa5는 His, Phe 또는 Tyr이며， Aaa8은 Phe, Gin또는 Leu이고; ·
일반식 IV
Phe-Aaa厂 Aaa2-Aaa3-Trp-Aaa4-Aaa5-Aaa6
Aaar8r Met, lie, Thr, Arg, Ala 또는 Ser이고， Aaa2는 Arg, His, Glu, Asp, Cys 또는 Ser이고， Aaa3는 His, Phe 또는 Tyr이며， Aaa4는 Glu, Thr, Ala, Phe 또는 Ser이고, Aaa5는 Gin, Thr, Ala, Asp또는 Gly이며， Aaa6은 Phe, Gin또는 Leu이고;
일반식 V
Aaal_Phe-Aaa2_Aaa3_Aaa4_Trp-Aaa5_Aaa6-Aaa7
Aaai은 Arg, Asn, Ala, Thr 또는 Val이고, 32은 Met, He, Thr, Arg, Ala 또는 Ser이고， Aaa3는 Arg, His, Glu, Asp, Cys 또는 Ser이고, 34는 His, Phe 또는 Tyr이며， Aaa5는 Glu, Thr, Ala, Phe 또는 Ser이고， Aaa6는 Gin, Thr, Ala, Asp 또는 Gly이며, ^7는 Phe, Gin또는 Leu이다.
본 발명에서 이용되는 aMDM2는 p53의 상기한 aMDM2 서열의 기능적 동둥물일 수 있다. 상기 기능적 동등물이란， 아미노산의 부가, 치환 또는 결실의 결과, 본 발명의 aMDM2와 실질적으로 동등한 생리활성을 나타내는 펩타이드를 말한다ᅳ 상기에서 '동등한 생리활성'이란 p53이 결합하는 MDM2의 결합위치에 경쟁적으로 결합하여, MDM2와 결합하지 않은 세포내 p53 레벨을 증가시켜 종양세포 등의 비정상 세포의 사멸을 유도하는 활성을 의미한다.
상기 기능적 동등물이란 상기 일반식 I， 일반식 I， 일반식 II， 일반식 IV 또는 일반식 V로 표시되는 펩타이드와 적어도 70% 이상， 바람직하게는 80% 이상， 보다 바람직하게는 90% 이상의 서열상동성 (즉， 동일성)을 갖는 펩타이드를 말하며， 예를 들면, 70), 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% 99%, 100%의 서열 상동성을 갖는 펩타이드를 포함한다.
상기 기능적 동등물은 상기 일반식 I, 일반식 I， 일반식 Π, 일반식 IV 또는 일반식 V의 아미노산 서열 중 일부가 부가, 치환 또는 결실의 결과 생성될 것일 수 있다. 상기에서 아미노산의 치환은 바람직하게는 보존적 치환이다. 천연에 존재하는 아미노산의 보존적 치환의 예는 다음과 같다: 지방족 아미노산 (Gly, Ala, Pro), 소수성 아미노산 (lie, Leu, Val), 방향족 아미노산 (Phe, Tyr, Trp), 산성 아미노산 (Asp, Glu), 염기성 아미노산 (His, Lys, Arg, Gin, Asn) 및 황 함유 아미노산 (Cys, Met). 또한 상기 기능적 동등물에는 상기 일반식 I， 일반식 I， 일반식 Π, 일반식 IV 또는 일반식 V로 표시되는 펩타이드의 아미노산 서열 중 일부가 결실된 변형체도 포함된다. 상기 아미노산의 결실 또는 치환은 바람직하게는 본 발명의 펩타이드의 생리활성에 직접적으로 관련되지 않은 영역에 위치해 있다. 아울러， 상기 일반식 1ᅳ일반식 표， 일반식 II， 일반식 IV 또는 일반식 V로 표시되는 펩타이드의 말단 또는 양 말단, 또는 서열 내에 몇몇의 아미노산이 부가된 변형체도 포함된다. 또한 본 발명의 기능적 동등물의 범위에는 본 발명에 따른 펩타이드의 기본 골격 및 이의 생리 활성을 유지하면서 펩타이드의 일부 화학 구조가 변형된 펩타이드 유도체도 포함된다. 예를 들어, 본 발명의 펩타이드의 안정성， 저장성, 휘발성 또는 용해도 둥을 변경시키기 위한 구조변경이 이에 포함된다.
본 명세서에서 서열 상동성 및 동질성은 본 발명의 aMDM2 펩타이드의 아미노산 서열과 비교 대상의 후보서열을 정렬하고 갭 (gaps)을 도입한 후 본 발명의 aMDM2 펩타이드의 아미노산 서열에 대한 후보서열의 아미노산 잔기의 백분율로서 정의된다. 필요한 경우， 최대 백분율 서열 동질성을 수득하기 위하여 서열 동질성의 부분으로서 보존적 치환은 고려하지 않는다. 또한， 본 발명의 aMDM2 펩타이드의 N-말단， C-말단 또는 내부 신장， 결손 또는 삽입은 서열 동질성 또는 상동성에 영향을 주는 서열로서 해석되지 않는다. 또한, 상기 서열 동질성은 두 개의 펩타이드의 아미노산 서열의 유사한 부분을 비교하기 위해 사용되는 일반적인 표준 방법에 의해 결정할 수 있다. BLAST 또는 FASTA와 같은 컴퓨터 프로그램은 두 개의 펩타이드를 각각의 아미노산이 최적으로 매칭되도록 정렬한다 (하나 또는 두 서열의 전장서열을 따라 또는 하나 또는 두 서열의 예측된 부분을 따라). 상기 프로그램은 디폴트 오프닝 페널티 (default opening penalty) 및 디폴트 갭 페널티 (default gap penalty)를 제공하며 컴퓨터 프로그램과 함께 연계되어 사용될 수 있는 PAM25CK표준 스코링 매트릭스 Dayhoff et al . , in Atlas of Protein Sequence and Structure, vol 5， supp 3, 1978)와 같은 스코링 매트릭스를 제공한다. 예를 들어， 백분율 동질성은 다음과 같이 계산할 수 있다. 일치하는 서열 (identical matches)의 총 수에 100을 곱한 다음 대웅되는 스팬 (matched span) 내의 보다 긴 서열의 길이와 두 서열을 정렬하기 위해 보다 긴 서열 내로 도입된 갭 (gaps)의 수의 합으로 나눈다.
상기 일반식 I， 일반식 I， 일반식 II， 일반식 IV 또는 일반식 V로 표시되는 펩타이드의 종래 문헌 (예컨대， Picksley et al. , Oncogene 9:2523- 2529(1994)； W0 96/02642； 및 유럽특허 제 958305호)에 개시된 것으로서， MDM2가 p53에 결합하는 것을 억제하는펩타이드이다.
상기 일반식 I의 펩타이드의 바람직한 구현예는, Phe-Aaal-Glu-Leu- Trp(Aaai은 Gly, Ala, Val, Ser, Tyr, Pro, Asp, Glu, Thr, Met, He, Leu, Phe, His, Lys, Arg, Cys, Asn, Gin 또는 Trp이다)， Thr-Phe-Ser-Asp-Leu-Trp , Thr-Phe- Ser-Gly-Leu-Trp, G 1 n-G 1 u-Thr -Phe-Ser -Asp-Leu-Tr p-Ly s -Leu-Leu-Pr o ( A ¾ ¾ Jl 1) , G 1 n-G 1 u-Thr _Phe_Ser _Asp— Leuᅳ Tr p_Ly s_Leu_Leuᅳ Pr으 G 1 u_Asn 또는 Gl uᅳ Pr o_Pr o_Leuᅳ Ser-Gln—Glu-Thr-Phe-Ser-Asp-Leu-Trp— Lys-Leu를 최소서열로 포함한다.
상기 일반식들의 펩타이드의 길이는 일반적으로 5-50 아미노산 잔기이고, 바람직하게는 5—40 아미노산 잔기， 보다 바람직하게는 6-35 아미노산 진「기, 보다 더 바람직하게는 6-30 아미노산 잔기， 보다 더욱 더 바람직하게는 6-28 아미노산 잔기이다.
본 발명의 보다 바람직한 구현예에 따르면， 상기 aMDM2는 서열번호 2로 표시되는 아미노산 서열 또는 서열번호 1로 표시되는 아미노산서열을 갖는다.
본 발명의 가장 바람직한 구현예에 따르면， 상기 «MDM2는 서열번호 1로 표시되는 아미노산 서열을 갖는다.
본 발명의 «MDM2를 코딩하는 핵산분자는 상기 일반식 I， 일반식 I， 일반식
Π, 일반식 IV 또는 일반식 V로 표시되는 펩타이드를 암호화하는 염기서열을 가질 수 있으며， 보다 바람직하게는 aMDM2의 기능적 동등물을 암호화하는 염기서열을 가질 수 있다. 보다 더 바람직하게는 본 발명의 ffMDM2를 코딩하는 핵산분자는 서열번호 2로 표시되는 아미노산 서열 또는 서열번호 1로 표시되는 아미노산 서열로 이루어진 펩타이드를 암호화하는 염기서열을 가질 수 있고， 보다 더욱 더 바람직하게는 서열번호 1로 표시되는 아미노산 서열로 이루어진 펩타이드를 암호화하는 염기서열을 가질 수 있으며, 가장 바람직하게는 서열번호 3으로 표시되는 염기서열을 가질 수 있다. 이외에도 상기 핵산은 GenBank 등록번호 NM_000546, NM_001126113 또는 NM_001126114에 개시되어 있는 염기서열을 가질 수 있으며， 이에 제한되는 것은 아니다.
상기 «MDM2를 암호화하는 핵산은 당업계에 공지된 유전자 재조합 방법에 의하여 제조될 수 있다 (Sambro이 i, Fritsch and Maniatis, Molecular Cloning, A laboratory Manual , Cold Spring Harbor laboratory press (1989)； John Wiley and Sons, Short Protocols in Molecular Biology (1992)). 예컨대， 지놈으로부터 핵산을 증폭시키기 위한 PCR 증폭， 화학적 합성법 또는 cDNA 서열을 제조하는 기술이 있다.
본 발명에 사용되는 성체줄기세포란 발생과정이 진행되어 배아의 각 장기가 형성되는 단계 혹은 성체단계에서 나타나는 줄기세포를 의미하며， 그 분화능이 일반적으로 특정 조직을 구성하는 세포로만 한정된다. 성체줄기세포는 유방， 골수, 제대혈， 혈액， 간, 피부， 위장관， 태반， 및 자궁 둥으로 구성된 군에서 유래할 수 있다. 본 발명의 인간 성체줄기세포는 신경세포로 분화할 수 있는 인간 신경줄기세포, 혈액세포로 분화할 수 있는 인간 조혈모세포， 뼈， 연골, 지방， 근육 등으로 분화할 수 있는 인간 중간엽 줄기세포， 간세포로 분화할 수 있는 인간 간줄기세포일 수 있다.
본 발명의 바람직한 구현예에서 상기 인간 성체줄기세포는 인간 신경줄기세포이다. 신경줄기세포란 주로 신경계에 존재하는 원시세포로서 미성숙， 미분화된 상태로 계속 증식하는 자가 갱신 (self-renew)을 보이고， 신경원세포 (neuron) 및 신경교세포 (glia)로 분화하는 분화의 다능성 (multipotency)을 보이는 세포로 정의된다. 신경줄기세포는 인간을 포함한 포유동물의 태아 신경계 전반에 걸쳐 다양한 해부학적 부위에서 존재하고， 최근에는 태아뿐만 아니라 성체의 신경계에서도 신경줄기세포가 존재하며, 일생을 통하여 신경줄기세포는 뇌의 특정 부위에서 계속 증식하면서 새로운 신경세포를 생성한다. 이외에도 신경줄기세포는 신경세포뿐만 아니라 다양한 다른 종류의 세포 또는 조직으로도 분화될 수 있는 분화의 유연성 (plasticity)을 가지고 있음이 보고되었다.
본 발명의 보다 바람직한 구현예에서 상기 인간의 신경줄기세포는 바람직하게는 인간 태아의 뇌로부터 유래한 것이다. 상기 뇌는 종뇌， 간뇌， 중뇌， 소뇌， 연수， 뇌교 및 척수로 이루어진 군에서 선택되는 어느 하나일 수 있으며， 바람직하게는 종뇌로부터 유래한 것일 수 있다. 상기 인간의 신경줄기세포는 상업적으로 판매되는 것을 구입하여 사용할 수도 있고， 자연 유산되어 사망한 인간 태아의 뇌 조직으로부터 얻은 세포를 신경줄기세포 성장인자가 첨가된 배지에서 배양하여 제조할 수 있다 (실시예 1). 상기 신경줄기세포 성장인자는 bFGF( fibroblast growth factor-basic), LIF( leukemia inhibitory factor) 및 헤파린 (heparin)을 사용할 수 있다. 바람직하게는 20 ng/ml bFGF, 10 ng/ml LIF 및 8 βg/mi 헤파린을 사용할 수 있다. 본 발명의 가장 바람직한 구현예에 따르면， 본 발명에 이용되는 인간의 신경즐기세포는 기탁번호 KCTC 11370BP의 "HNSC 01"이다. 본 발명에 따른 aMDM2를 분비하는 인간의 신경줄기세포는 세포독성을 나타내지 않으며， 플레이트 상에서 계속 미분화상태로 증식 및 성장한다 (도 7 참조).
본 발명의 신경줄기세포는 99% 이상의 세포에서 신경줄기세포 표지인자인 네스틴 (nestin) 또는 비멘틴 (vimentin)을 발현하고， 신경원세포， 희소돌기아세포 및 성상세포와 같은 신경세포로 분화할 수 있는 능력을 가진다 (도 3 참조). 본 발명에 따른 aMDM2를 분비하는 인간의 신경줄기세포 배지와 종양세포를 공동 배양하는 경우 종양세포의 세포사멸을 유도한다 (도 13 참조). 또한 본 발명의 신경줄기세포를 종양 동물모델 (예: 인간 교모세포종 뇌종양 동물 모델)에 이식한 경우 생체 내에서 원발성 종괴의 경계부위를 특이적으로 포위하여 종괴 내부로 침윤하는 양상으로 생착 및 분포하며, 주위 신경조직으로 전이되는 종양세포를 따라 특이적으로 이주하여 속발성 종괴에도 생착 및 분포한다. 또한 본 발명의 신경줄기세포의 일부는 이식된 종양부위에서 신경원 또는 교세포로 분화하여 종양으로 손상된 신경세포를 대체 및 재생할 수 있다. 특히 본 발명의 신경줄기세포는 ffMDM2를 분비하여 생체 내에서 주위의 종양세포의 아픕토시스를 유발하고， 이에 따라 종양 용적의 감소를 일으키며 결과적으로 동물모델의 생존율을 높인다 (도 18 참조). 반면, 정상 뇌신경 조직에는 특별한 손상을 유발하지 않는다. 본 발명의 aMDM2를 코딩하는 핵산분자를 포함하는 인간 성체줄기세포는 aMDM2를 암호화하는 핵산을 인간의 성체줄기세포에 도입하여 제조될 수 있다. 예를 들어, ffMDM2-암호화 핵산은 당업계에 공지된 다양한 형질전환 방법, 예컨대 naked DNA를 직접 세포에 주입할 수 있고 리포좀 (예컨대， Lipofectamine)을 이용한 방법 또는 백터를 이용한 방법에 따라 세포에 주입할 수 있다.
바람직하게는， «MDM2ᅳ암호화 핵산을 이용한 인간 성체줄기세포의 형질전환은 백터를 이용하여 실시하며, 예컨대 하기의 단계를 포함한다: (a) aMDM2를 암호화하는 핵산을 발현 백터에 삽입시키는 단계; 및 (b) 상기 발현 백터를 인간성체줄기세포에 도입하는 단계.
본 발명의 바람직한 구현예에 따르면， 백터에 포함되는 aMDM2-암호화 핵산의 발현을 위한 컨스트럭트는 분비 신호 서열， 단백질 형질도입도메인 또는 이의 조합을 추가적으로 포함한다.
예를 들어， 본 발명에 따른 aMDM2를 분비하는 인간의 신경줄기세포는 하기의 단계를 포함하는 제조방법에 의하여 제조될 수 있다: (a) 분비 신호 서열, HIV 유래 단백질 형질도입 도메인 및 aMDM2를 암호화하는 핵산이 순차적으로 연결된 DNA 구조물 (construct)을 포함하는 재조합 바이러스 백터를 제조하는 단계; (b) 상기 재조합 바이러스 백터를 바이러스 생산 세포주에 형질감염시켜 aMDM2 발현 재조합 바이러스를 제조하는 단계; 및 (c) 상기 aMDM2 발현 재조합 바이러스로 인간의 신경줄기세포를 감염시키는 단계.
상기의 aMDM2를 분비하는 인간의 신경줄기세포 제조방법을 더욱 구체적으로 살펴보면 다음과 같다.
상기 «MDM2를 암호화하는 핵산은 발현 조절서열에 작동가능하게 연결되어 발현 백터 내에 삽입될 수 있다. 상기에서 '작동 가능하게 연결된다 (operably linked to)'는 것은 하나의 핵산 단편이 다른 핵산 단편과 결합되어 그의 기능 또는 발현이 다른 핵산 단편에 의해 영향을 받는 것을 말한다. 또한, '발현 조절 서열 (expression control sequence)'이란 특정한 숙주 세포에서 작동 가능하게 연결된 핵산 서열의 발현을 조절하는 DNA 서열을 의미한다. 그러한 조절 서열은 전사를 개시하기 위한 프로모터， 전사를 조절하기 위한 임의의 오퍼레이터 서열 , 적합한 mRNA 리보좀 결합 부위를 코딩하는 서열 및 전사 및 해독의 종결을 조절하는 서열을 포함한다.
본 발명에 있어서， aMDM2를 암호화하는 핵산에 결합된 프로모터는, 바람직하게는 동물세포， 보다 바람직하게는 포유동물 세포에서 작동하여 «MDM2 유전자의 전사를 조절할 수 있는 것으로, 모든 시간대에 상시적으로 목적 유전자의 발현을 유도하는 프로모터 (constitutive promoter)를 사용할 수 있으며 , 그 예로는 CMV 프로모터， CAG 프로모터 (Hitoshi Niwa et al. , Gene, 108:193-199(1991); Monahan et al., Gene Therapy, 7:24-30(2000)), CaMV 35S 프로모터 (Ode 11 et al . , Nature 313:810-812(1985))， Rsyn7 프로모터 (미국특허출원 제 08/991, 601호)， 라이스 액틴 (rice act in) 프로모터 (McElroy et al . , Plant Cell 2:163-171(1990))， 유비퀴틴 프로모터 (Christ ensen et al., Plant Mol. Biol. 12:619—632(1989)), ALS 프로모터 (미국 특허출원 제 08/409,297), 아데노바이러스 후기 프로모터， 백시니아 바이러스 7.5K 프로모터， SV40 프로모터 , HSV의 tk 프로모터 , RSV 프로모터， EF1 알파 프로모터， 메탈로티오닌 프로모터， 베타 -액틴 프로모터， 인간 IL-2 유전자의 프로모터， 인간 IFN 유전자의 프로모터， 인간 IL-4 유전자의 프로모터， 인간 림포특신 유전자의 프로모터 및 인간 GM-CSF 유전자의 프로모터를 포함하나, 이에 한정되는 것은 아니다. 이외에도 미국특허 제 5, 608,149호, 제 5, 608, 144호, 제 5,604,121호, 거 15,569,597호， 제 5,466,785호, 제 5,399,680호, 제 5，268，463호 및 제 5， 608, 142호에 개시된 프로모터들을 모두 사용할 수 있다.
본 발명의 구체적인 일 실시예에 따르면， 프로모터로서 CAG 프로모터를 사용한다. CAG 프로모터는 변형된 CMV 프로모터의 일종으로 시토메갈로바이러스 즉시 초기 인현!서 (cytomegalovirus immediate-early enhancer) , 닭 ^—액틴 프로모터 (chicken /S-actin promoter) , 키메릭 인트론 (chimeric intron) , 액손 Kexon 1) 과 토끼 글로빈 유전자 (rabbit ^-globin gene)의 엑손 2(exon 2)의 일부분으로 구성된다 (Hitoshi Niwa et al . , Gene, 108： 193-199(1991)； Monahan et al., Gene Therapy, 7:24-30(2000)). 이와 같은 공지된 구성 및 서열의 CAG 프로모터로는 아데노바이러스 제작에 적합하지 않았기 때문에 본 발명자는 이를 아데노바이러스와 제작에 적합하도록 변형하여 사용하였다. 이를 상세히 설명하면， 본 발명에서 사용한 CAG 프로모터는 다음과 같은 과정을 통해 상용백터인 pShuttle 백터에 삽입되었다. 상용백터인 TriEX-1.1 Neo DNA 백터로부터 시토메갈로바이러스 즉시 초기 인헨서 (cytomegalovirus immediate- early enhancer), 닭 ；8ᅳ액틴 프로모터 (chicken ?-actin promoter) 및 토끼 βᅳ 글로빈 종결자 (rabbit /9-globin terminator)를 각각 클로닝하고 이를 상용백터인 pShuttle 백터에 각각 삽입하여 아데노바이러스 제작에 적합하도록 변형된 CAG 프로모터를 가진 백터를 제작하였다. 여기에 상용백터인 pShuttle-IRES-hrGFP- 1와 pShuttle-QiV -LacZ(Stratagene) 백터로부터 IRES 및 LacZ를 추가적으로 클로닝하여 CAG프로모터를 가지며， LacZ를 발현하는 백터를 추가로 제작하였다. 본 발명의 바람직한 구현예에 따르면， 본 발명에 이용되는 발현 컨스트럭트는 폴리 아네닐화 서열을 포함하며， 예를 들어 소성장 호르몬 터미네이터, SV40 유래 폴리 아데닐화 서열 또는 토끼 /9 액틴 터미네이터가 이용될 수 있다.
한편， 인간 성체줄기세포에서 발현된 aMDM2는 종양세포의 세포질 내부에서 작용하므로, 발현된 단백질이 세포질 내로 이동하도록 하는 구조가 필수적이다. 이를 위해서 단백질 형질도입 도메인 (protein transduction domain, PTD)을 aMDM2를 암호화하는 핵산의 상류 (upstream)에 연결하는 것이 바람직하다. 상기 단백질 전달 도메인은 자신뿐만 아니라 다른 종류의 올리고뉴클레오티드， 펩티드， 단백질 및 올리고당과 같은 고분자 유기화합물을 별도의 수용체나 에너지를 필요로 하지 않고 세포 내로 도입시킬 수 있는 수 개의 아미노산 잔기로 구성되어 있는 올리고펩티드를 말한다. 본 발명에서 상기 단백질 전달 도메인으로는 특별히 한정되지는 않으나 HIV— 1 TAT의 형질도입부위 , 5-12개의 아르기닌 잔기로 이루어진 올리고펩티드， 5-12개의 라이신 잔기로 이루어진 올리고펩티드， PEP-1 펩티드， ANTP, VP22 단백질 등을 사용할 수 있다 (Morris et al. , Nat Biotechnol, 19:1173- 1175(2001)； Schwarze et al . , Trends Cell Biol, 10:290-295(2000); Vives et al . J Biol Chem 272:16010-16017(1997)). 상기 PTD는 당업계에 공지된 것이라면 제한 없이 사용할 수 있으며， 바람직하게는 HIV-l(human immunodeficiency virus type 1)의 TAT PTD(YGRKKRRQRRR) , 9개의 아르기닌 잔기로 이루어진 올리고펩티드， 10개의 라이신 잔기로 이루어진 올리고펩티드 및 PEP-1 펩티드 (KETWWETWTEWSQPKKKRKV)로 이루어진 그룹 중에서 선택된 것을 사용할 수 있다 (Yang et al .， FEBS Letters, 532:36-44(2002)； Vives et al . , J. Biol. Chem. 272:16010-16017(1997); Nagahara et al. , Nature Med. , 4:1449-1452(1998)).
상기 HIV-1 Tat의 형질도입부위는 침투하고자 하는 세포의 지질막 (lipid barrier)을 여는 신호를 가지고 있는 것을 특징으로 한다. 상기 PEP-1 펩티드의 소수성 도메인은 침투할 단백질의 소수성 부분과 결합한 후 세포막에 타겟팅 (targeting)하는 효율을 높여주고 친수성 도메인은 세포질내로의 이동을 용이하게 하는 역할을 담당한다.
또한 aMDM2는 인간 성체줄기세포에서 발현된 후 세포 밖으로 분비되어야 종양세포의 세포질 내로 들어갈 수 있으므로， 분비 신호 서열 (secret ion signal sequence)을 TAT_aMDM2를 암호화하는 뉴클레오티드에 연결하는 것이 바람직하다. 이 때 분비 신호 서열은 상기 TAT-crMDM2의 상류에 연결되는 것이 바람직하다. 상기 분비 신호 서열은 Ig c- 체인 리더 (chain leader), 정액 RNase(seminal
RNase)의 분비 신호 서열, SEC2 서열 (N-terminal 28 amino acids of human fibrillinᅳ 1)， FIB Ή ¾ (nucleotides 208-303 derived from rat f ibronectin mRNA sequence) 또는 FGF-4의 시그널 펩티드일 수 있으며， 이에 제한되는 것은 아니다. 바람직하게는 Ig c- 체인 리더일 수 있다. 상기 Ig c- 체인 리더는 바람직하게는 서열번호 4로 표시되는 염기서열 (atggagacagacacactcctgctatg ggtactgctgctctgggttccaggttccactggtgac)을 가질 수 있다. 세포 밖으로 분비된 후 상기 Ig/c- 체인 리더는 불필요한 부분이므로 절단이 되는 것이 보다 효과적이다. 상기 분비 신호 서열은 그 내부에 신호 절단 부위 (signal cleavage site)를 가지거나 또는 특별한 신호 절단 부위를 가지지 않아도 세포 밖으로 분비될 때 절단되는 특성을 갖는 것이 바람직하다. 상기 분비 신호 서열 중 Ig/c- 체인 리더는 특별한 신호 절단 서열이 없어도 세포 밖으로 분비되면 마지막 20번 및 21번째 아미노산 사이가 잘려진다. 즉， 5'-atg gag aca gac aca etc ctg cta tgg gta ctg ctg etc tgg gtt cca ggt tec act ggt gac— 3' 서열에서 마지막 ggt 와 gac-3' 사이가 잘려진다.
이와 같이 분비 신호 서열， TAT 및 aMDM2를 암호화하는 핵산이 순차적으로 연결된 DNA 구조물은 PCR 증폭， 제한효소를 이용한 DNA의 절단， 라이게이션 (ligation), 형질전환 등을 포함하는 당업계에 공지된 일반적인 클로닝 방법으로 제조할 수 있다.
또한 본 발명에서 '발현 백터'라 함은 구조유전자를 암호화하는 핵산이 삽입될 수 있고， 숙주 세포 내에서 상기 핵산을 발현할 수 있는 당분야에 공지된 플라스미드， 바이러스 백터 또는 기타 매개체를 의미한다. 바람직하게는 바이러스 백터일 수 있다.
상기 플라스미드로는 당업계에 공지된 포유동물 발현 플라스미드를 사용할 수 있다. 예를 들면， 이에 한정되지는 않으나 pRK5(유럽특허 제 307,247호)， PSV16B (국제특허공개 제 91/08291호) 및 pVL1392(PharMingen) 등이 대표적이다. 이러한 플라스미드 백터를 이용한 핵산 전달 방법은 사람 세포에 직접적으로 플라스미드 DNA를 전달하는 방법으로서， FDA로부터 승인받은 사람에게 사용할 수 있는 방법이다 (Nabel, E. G.， et al . , Science, 249： 1285-1288(1990)) . 플라스미드 DNA는 바이러스 백터와는 달리 균질하게 정제될 수 있는 장점이 있다. 또한 상기 바이러스 백터로는, 이에 제한되지는 않으나, 레트로바이러스 백터， 아데노바이러스 백터， 허피스 바이러스 백터， 아비폭스바이러스 백터， 렌티바이러스 백터 등이 있다. 상기 레트로바이러스 백터는 바이러스 유전자가 모두 제거되었거나 또는 변경되어 비-바이러스 단백질이 바이러스 백터에 의해 감염된 세포 내에서 만들어지도록 제작된 것이다. 유전자 요법을 위한 레트로바이러스 백터의 주요 장점은 다량의 유전자를 복제세포 내에 전달하고， 세포 DNA 내로 전달된 유전자를 정확하게 통합하며, 유전자 형질 감염 후 연속적인 감염이 유발되지 않는 것이다 (Miller, A.D. , Nature, 357:455-460(1992)). FDA에서 인증 받은 레트로바이러스 백터는 PA317 암포트로픽 레트로바이러스 패키지 세포를 이용하여 제조한 것이다 (Miller, A.D. and But ti more, C. , Molec. Cell Biol., 6:2895-2902(1986)). 비-레트로바이러스 백터로는 상기에서 언급한 바와 같은 아데노바이러스가 있다 (Rosenfeld et al .， Cell, 68:143-155(1992)； Jaffe et al . , Nature Genetics, 1:372-378(1992); Lemarchand et al., Proc. Natl. Acad. Sci. USA, 89:6482-6486(1992)). 아데노바이러스의 주요 장점은 다량의 DNA 단편 (36kb 게놈)을 운반하고， 매우 높은 역가로 비 -복제세포를 감염시킬 수 있는 능력이 있다는 것이다. 또한， 허피스 바이러스도 사람 유전자 요법을 위해 유용하게 사용될 수 있다 (Wolfe, J. H. , et al., Nature Genetics, 1:379- 384(1992)). 이외에도, 공지된 적절한 바이러스 백터가 본 발명에 사용될 수 있다. 바람직하게는 아데노바이러스 백터에 삽입될 수 있다.
본 발명의 재조합 발현백터의 하나인 아데노바이러스를 제조하는 방법은 당업계에 공지된 방법， 예를 들어 pAdEasy-l(Stratagene)과 같은 아데노바이러스성 백본 백터 (adenoviral backbone vector)와 함께 BJ5183 대장균에 공동도입하여 상기 두 백터 간의 동종 재조합 (homologous recombination)을 유도하고， 이를 293A 세포와 같은 아데노바이러스 생산 세포주에서 증폭하여 본 발명의 재조합 발현백터인 아데노바이러스를 제조할 수 있으나 이에 한정되는 것은 아니다. 상기 바이러스 생산 세포주는 사용한 바이러스 백터에 해당하는 바이러스를 생산하는 세포주를 사용할 수 있으며， 예컨대 아데노바이러스 백터를 사용한 경우에는 아데노바이러스 생산 세포주인 293 세포를 사용할 수 있다. 이와 같은 아데노바이러스를 제조하는 방법은 여러 문헌에 잘 나타나 있다 (Benihoud, K. , Yeh, P. and Perricaudet, M. , Curr Opin Biotechnol 10(5) :440-7(1999)； Berkner , K. L., Biotechniques, 6(7) :616-29(1988) ; He, T. C. , Zhou, S. , da Costa, L. T.， Yu, J., Kinzler, . W. et al . , Proc Natl Acad Sci U.S.A., 95(5)： 2509- 14(1998)； Hanahan, D. , J Mol Biol, 166(4) :557-80(1983)； Jerpseth, B. , Callahan, M. and Greener , A. , Strategies 10(2) :37-38(1997)； Bullock, W. 0. , Fernandez, J. M. and Short , J. M.， Biotechniques 5(4) :376-378(1987)； Ausubel, F. M. , Brent , R. , Kingston, R. E. , Moore, D. D. , Seidman, J. G. et al., Current Protocols in Molecular Biology (1987)； John Wiley and Sons , New York', Graham, F. L. , Smiley, J. , Russell, W. C. and Nairn, R. , J Gen Virol 36(1) :59-74(1977)； Tollefson, A. E., Hermiston, T. W. and Wold, W. S. M.， Methods in Molecular Medicine 21:1-9(1998)).
본 발명에 따른 핵산을 포함하는 발현 백터는 당업계에 공지된 방법， 예를 들어 이에 한정되지는 않으나, 일시적 형질감염 (transient transfect ion) , 미세주사， 형질도입 (transduction), 세포융합， 칼슴 포스페이트 침전법, 리포좀 매개된 형질감염 (liposome-mediated transfect ion) , DEAE 텍스트란 -매개 형질감염 (DEAE Dextran-mediated transfect ion) , 폴리브렌-매개된 형질감염 (polybrene—mediated transfect ion) , 전기침공법 (electroporation) , 유전자 총 (gene gun) 및 세포 내로 핵산을 유입시키기 위한 다른 공지의 방법에 의해 신경줄기세포 내로 도입할 수 있다 (Wu et al. , J. Bio. Chew. , 267： 963- 967(1992)； Wu and Wu, J. Bio. Chew. , 263:14621-14624(1988)).
아데노바이러스를 인간의 신경줄기세포에 감염시키는 방법으로 바람직하게는， 인간 신경즐기세포 (HFT13 세포)를 성장인자 함유 N2 배지에 플레이팅하고， 1시간 후에 적정 MOKmultiplicity of infection)에 해당하는 바이러스성 입자를 배지에 첨가하여 세포를 감염시키는 방법을 사용할 수 있다. 이때 바이러스는 4% 수크로즈 완층용액 (10 mM Tris pH8.0, 2 mM MgCl2, 4 sucrose in dd¾0)과 함께 -80°C 넁동고에 보관된 상태이며， 줄기세포에 감염시킬 때 만들어진 바이러스의 titer 및 M()I에 따라 대략 세포배지 1 ml 당 50 ^ 미만의 바이러스 용액이 첨가된다. 감염 24시간 후 바이러스를 제거하기 위해 N2 배지로 세포를 1회 세척하고， 성장인자 함유 N2 배지를 첨가하여 줄기세포를 계속 배양하는 방법에 의해 수행될 수 있다. 본 발명에 따른 aMDM2를 분비하는 인간의 신경줄기세포는 당업계에 공지된 방법에 따라 증식 및 배양될 수 있다. 본 발명의 신경즐기세포는 목적 세포 타입의 생존 또는 증식을 뒷받침하는 배양액 내에서 배양된다. 종종 혈청 대신 자유 아미노산으로 영양을 공급하는 배양액을 사용하는 것이 바람작하다. 신경세포의 지속적인 배양을 위해 개발된 첨가제를 배양액에 보층하는 것이 바람직하다. 예컨대， Gibco 사에서 시판되는 N2 및 B27 첨가제가 있다. 배양시 배지와 세포의 상태를 관찰하면서 배지를 교환해 주는 것이 바람직하다. 또한 신경줄기세포가 계속 증식하여 서로 뭉쳐서 신경구 (neurospheres)를 형성하면 계대배양을 실시하는 것이 바람직하다. 계대배양은 약 7— 8일 마다 실시할 수 있다. 본 발명에 따른 신경줄기세포의 바람직한 배양 방법은 다음과 같다. 배양액의 조성이 알려져 있는 특정 배지 (예: DMEM/F-12 또는 Neurobasal 배지 둥)에 N2 또는 B27 첨가제 (Gibco), 신경줄기세포 증식유발 사이토카인 (예: bFGF, EGF, LIF 등)과 헤파린을 첨가한다. 일반적으로 혈청은 첨가하지 않는다. 상기 배지에서 신경줄기세포를 신경구 형태로 증식 배양한다. 3-4일에 한번씩 배지의 반 정도를 새로운 배지로 갈아준다. 세포수가 늘어나면 7-8일마다 기계적 방법 또는 트립신 (0.05% trypsin/EDTA, Gibco)을 이용하여 세포를 해리시킨다. 이후， 세포 부유액을 새로운 플레이트에 플레이팅하고 상기 조성의 배지에서 계속하여 증식 배양시킨다 (Gage et al. PNAS, 92(11) :879(1995)； McKay. , Science, 276:66(1997)； Gage. , Science, 287:1433(2000); Snyder et al . Nature, 374:367(1995)； Weiss et al. Trends Neurosci. , 19:387(1996)).
또한 본 발명의 신경줄기세포는 당업계에 공지된 통상적인 방법에 따라 각종 신경세포로 분화될 수 있다. 일반적으로 분화는 세포배지에 신경줄기세포 증식유발 사이토카인은 첨가하지 않고 적절한 기질 또는 분화 시약이 첨가되는 영양 배양액을 함유하는 배양 환경에서 실행한다. 적절한 기질은， 양전하로 코팅된 고체 표면， 예를 들면 폴리— L-라이신 및 폴리오르니틴이 적합하다. 기질은 세포외 매트릭스 성분， 일례로 피브로넥틴 및 라미닌으로 코팅 가능하다. 기타 허용되는 세포외 매트릭스는 매트리겔 (Matrigel)을 포함한다. 기타 적절한 것은, 폴리 -L-라이신을 피브로넥틴， 라미닌， 또는 이들의 흔합물과 흔합한 조합 기질이다.
적당한 분화 시약은 다양한 종류의 성장 인자, 예를 들면, 표피 성장 인자 (EGF), 전환성장인자 a(TGF-ff ), 임의의 형태의 섬유아세포 성장인자 (FGF-4,
FGF-8 및 bFGF), 혈소판 유래 성장인자 (PDGF), 인슐린 유사 성장인자 (IGF-1 등), 고농도의 인슐린, 골형성 단백질 (특히， BMP-2 및 BMP-4), 레틴산 (RA) 및 gpl30과 복합하는 수용체에 대한 리간드 (예: LIF, CNTF 및 IL-6)이 있으며， 이에 제한되는 것은 아니다.
또한 본 발명의 신경줄기세포는 장기간 보관을 위하여 당업계에 공지된 방법에 따라 동결보관할 수 있다. 일반적인 동결보관은 계대배양을 계속하여 층분한 숫자의 신경줄기세포를 획득하면 기계적 방법 또는 트립신을 이용하여 신경구를 잘게 부수어 단일 세포 현탁액을 만든다. 이후, 20-50% 태아우혈청 (fetal bovine serum, Gibco), 10-15% DMSO(Sigma) 및 세포 배지로 이루어진 동결 보관액에 상기 세포 현탁액을 흔합하여 동결 유리병 (freezing vial, NUNC)에 분주한다. 동결 보관액에 흔합한 세포는 즉시 4° (：에 보관한 상태에서 -
70°C의 넁동고로 옮기고， 최소 24시간 후에 액체질소탱크로 옮겨 장기 보관한다 (Gage et al . PNAS, 92(11) :879(1995) ; McKay. , Science, 276:66(1997); Gage. , Science, 287:1433(2000); Snyder et al. Nature, 374:367(1995)； Weiss et al . Trends Neurosci . , 19:387(1996).
아울러 동결보관된 본 발명의 신경줄기세포는 당업계에 공지된 방법에 따라 해동할 수 있다. 동결 보관된 세포를 녹일 때는 동결 유리병을 37°C 항온 수조에 담가 천천히 흔든다. 동결 유리병에 있는 세포가 절반정도 녹았을 때 미리 37°C로 데워져 있는， 신경줄기세포 배지가 들어있는 코니컬 튜브에 상기 세포 현탁액을 옮기기 시작한다. 세포 현탁액을 모두 옮기고 원심 분리하여 상층액을 제거한다. 침전되어 있는 세포 펠렛을 신경줄기세포 배지로 조심스럽게 부유시킨다. 세포 현탁액을 60 mm 세포 배양 플레이트에 옮긴다. 이후， 신경줄기세포 증식유발 사이토카인을 배지에 첨가하고 계속하여 37°C, 5% C02 배양기에서 배양한다.
본 발명의 다른 양태에 따르면， 본 발명은 aMDM2를 암호화하는 핵산으로 형질전환 된, 상기 aMDM2를 분비하는 인간의 성체줄기세포를 함유하는 과다증식 질환 (hyperproliferative disease)의 예방 또는 치료용 약제학적 조성물을 제공한다. 본 발명의 약제학적 조성물은 이를 필요로 하는 인간의 생체 내에서 과다증식 세포의 사멸， 생체 조직의 재구성 및 /또는 재생에 사용될 수 있다.
본 발명의 또 다른 양태에 따르면 본 발명의 다른 양태에 따르면， 상기 약제학적 조성물을 필요로 하는 대상 (subject)에 투여하는 단계를 포함하는 과다증식 질환 (hyperproliferative disease)의 예방 또는 치료방법을 제공한다. 상기에서 '치료 (treatment)'는 증상의 완화， 질환 정도의 감소， 악화되지 않는 질환의 유지， 질환진행의 지연, 질환 상태의 개선 또는 완화 (palliation), 일부 또는 완전한 완화 (remission)를 포함한다. 또한 치료는 치료를 받지 않은 경우 예상되는 생존율과 비교하여 증가된 생존을 의미할 수 있다. 치료는 치료적 수단 이외에 예방적 수단을 동시에 포함한다. 치료가 필요한 경우는 질환을 이미 가지고 있는 경우와 질환이 예방되어야 하는 경우를 포함한다. 질병의 완화는 치료받지 않는 상황과 비교하여 원하지 않는 질병의 임상양상의 호전이나 질병의 추이가 지연되거나 연장되는 경우이다. 전형적으로 치료는 과다증식 세포의 사멸 또는 조직재생을 위해 본 발명의 성체줄기세포를 투여하는 경우를 포함한다.
본 발명에 따른 aMDM2를 분비하는 인간의 성체줄기세포는 원하는 조직 부위로 직접 이식하거나 이동하는 방식으로 투여되어, 과다증식 세포의 사멸을 유도하거나， 기능적으로 결핍된 부위를 재구성하거나 재생한다. 예컨대， 치료될 질환에 따라 본 발명의 aMDM2를 분비하는 인간의 신경줄기세포를 중추신경계의 유조직 또는 수막강내 부위로 직접 이식한다. 이식은 단세포 현탁액 또는 ^ 당 1X 105-1.5X 105 세포 밀도의 작은 집합체를 이용하여 수행한다 (미국특허 제 5, 968, 829호).
본 발명에 따른 aMDM2를 분비하는 인간의 신경줄기세포는 인간 내로의 투여를 위해 약제학적 조성물의 형태로 공급될 수 있다. 본 발명의 약제학적 조성물에는 약제학적으로 허용되는 담체를 추가로 포함할 수 있다. 상기 '약제학적으로 허용되는'이란 상기 조성물에 노출되는 세포나 인간에게 독성이 없는 것을 말한다. 상기 담체는 완충제, 보존제， 무통화제， 가용화제， 등장제， 안정화제， 기제， 부형제， 윤활제， 보존제 등 당업계에 공지된 것이라면 제한없이 사용할 수 있다.
본 발명의 약제학적 조성물은 각종 제형의 형태로 통용되는 기법에 따라 제조될 수 있다. 예컨대， 주사제의 경우에는 단위 투약 앰플 또는 다수회 투약 포함제 형태로 제조할 수 있다. 제형은 오일 또는 수성 매질 중의 용액， 현탁액， 시럽제 또는 유화액 형태이거나， 액스제， 산제， 과립제, 분말제， 과립제， 정제， 또는 캅셀제 형태일 수 있으며， 분산제 또는 안정화제를 추가적으로 포함할 수 있다. 본 발명에 따른 약제학적 조성물의 의약 제형의 일반적인 원리에 대해서는 여러 문헌을 참고할 수 있다 (W. Sheridan 및 G. Morstyn amp, Cell Therapy: Stem Cell Transplant a t ion, Gene Therapy, and Cellular Immunotherapy, Cambridge University Press (1996)； E. D. Ball 및 J. Lister amp, Hematopoietic Stem Cell Therapy, P. Law, Churchill Livingstone (2000)). 본 발명의 약제학적 조성물은 원하는 목적， 예를 들면 생체 내 종양의 치료 및 종양으로 손상된 조직의 재구성을 위해 표기된 지시에 따라 적당한 용기 내에 포장될 수 있다.
본 발명의 약제학적 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 환자의 연령， 체중， 성별， 병적 상태， 음식, 투여 시간， 투여 경로， 배설 속도 및 반응 감웅성과 같은 요인들에 의해 다양하게 처방될 수 있다. 본 발명의 약제학적 조성물의 바람직한 투여량은 성인 기준으로 1인당 101— 1010 세포이다.
본 발명의 약제학적 조성물이 적용될 수 있는 과다증식 질환 (hyperproliferative disease)으로는 예컨대 종양， 암， 고감마글로불린혈증， 림프증식성 질환， 이상단백혈증, 자반병, 유육종증, 세자리 증후군 (Sezary Syndrome), 발덴스트론 (Waldenstron) , 매크로글로불린혈증， 고셔병 (Gaucher ' s disease) 또는 조직구증식증가 있으며， 반드시 이에 제한되는 것은 아니다.
본 발명의 약제학적 조성물은 바람직하게는 종양 또는 암의 예방 또는 치료를 위해 사용될 수 있으며， 상기 종양 또는 암은 신경교종， 뇌수막종, 뇌하수체선종, 수아세포종， 전이성 뇌종양, 청신경초종， 전립선암, 악성 혹색종 및 신경아세포종을 포함하며， 반드시 이에 제한되는 것은 아니다.
상기 신경교종은 성상세포종， 핍돌기교종， 상의세포종， 다형성 신경교모세포종 등을 포함한다. 특히， 신경교종 중 다형성 신경교모세포종 (glioblastoma multiforme)과 같은 악성 뇌종양은 광범위한 수술적 절제， 보조적 방사선 및 화학요법에도 불구하고 실제적으로 완치가 불가능하며 대개는 사망하게 되어 예후가 극히 불량하다 (Black et al., Cancer of the Nervous System, Blackwel 1 , Oxford (1997)； Surawicz et al., J. Neurooncol . , 40:151(1998)). 이렇게 예후가 불량한 요인으로는 신경교종 세포들은 침윤성이 극히 높아 전체 정상 뇌 조직에 걸쳐 광범위하게 이주하는 특성이 있으며， 원발성 종괴 (primary tumor mass) 부위에서 원거리까지 전이가 일어나 '종양 위성체 (tumor satellites)'를 형성하기 때문에 원발성 종양 자체를 수술적으로 절제하고 다른 보조치료를 병행한다고 하여도 쉽게 수술 후 재발한다. 그러므로 원발성 종괴 부위뿐만 아니라 전이된 위성종양 병변을 표적으로 하는 치료법 개발이 성공적인 치료와 예후의 개선을 위하여 필수적이다. 따라서, 본 발명의 약제학적 조성물은 가장 바람직하게는 다형성 신경교모세포종 (glioblastoma multiforme)과 같은 악성 뇌종양의 완전한 치료를 위한 매우 보조 치료제로서 사용될 수 있다. 즉， 본 발명의 약제학적 조성물을 이용한 치료 방법은 당업계에 공지된 다른 치료 방법， 예컨대， 화학요법 치료법， 방사선 치료법， 외과적 수술법， 약물 투여법 등과 함께 사용될 수 있다. 이외에도 종양에 대한 다른 치료 방법에 대한 보조 치료법 (adjuvant therapy)으로도 사용될 수 있다.
또한 인간의 신경줄기세포는 중추신경계에 이식된 후 뇌종양 부위에서 발현되는 신호에 반웅하여 뇌종양 부위로 특이적으로 이주하여 생착 및 분포할 뿐만 아니라, 정맥주사를 통하여 전신적으로 투여되었을 경우 중추신경계 이외의 다른 부위에서 발생한 비신경계 종양 즉, 전립선암， 악성 흑색종 및 신경아세포종 부위에도 특이적으로 이주하여 생착함을 보였다 (Brown et al. , Human Gene Therapy, 14:1777(2003)). 따라서, 본 발명의 약제학적 조성물은 뇌종양뿐만 아니라 전신에 발생하는 전립선암, 악성 혹색종， 신경아세포종 및 기타 악성 종양 등의 비신경계 종양의 치료에도 효과적으로 사용될 수 있다.
아울러， 본 발명은 상기와 같은 본 발명의 효과를 바탕으로 ffMDM2를 암호화하는 핵산으로 형질전환된， aMDM2를 분비하는 인간의 신경줄기세포를 이를 필요로 하는 개체에 유효한 양으로 투여하는 것을 포함하는 종양의 치료 방법을 제공한다.
본 발명에서 '유효한 양'이라 함은 본 발명의 신경줄기세포가 투여 대상인 개체 내에서 종양을 치료하는 효과를 나타내는 양을 말하며， 상기
'개체 (subject)'란 포유동물, 특히 인간을 포함하는 동물을 의미한다. 상기 개체는 치료가 필요한 환자 (patient)일 수 있다. 본 발명의 신경줄기세포는 상기 기재한 효과 중에서 원하는 효과가 도출될 때까지 투여될 수 있으며， 당업계에 공지된 방법에 따라 다양한 경로로 투여될 수 있으며, 바람직하게는 국소투여와 같은 비경구 투여이다. 【유리한 효과】
본 발명의 특징 및 이점을 요약하면 다음과 같다:
( i ) 본 발명은 aMDM2를 암호화하는 핵산을 포함하는 인간의 신경줄기세포 및 이를 포함한 암 치료용 약제학적 조성물을 제공한다.
(ii) 본 발명의 aMDM2를 암호화하는 핵산을 포함하는 인간의 신경줄기세포는 세포독성을 유발하지 않으면서， 생체 내에서 aMDM2를 분비하여 비정상 세포의 아폼토시스를 유발하므로 암 등 세포과다증식 질환의 예방 또는 치료에 유용하게 사용될 수 있다.
【도면의 간단한 설명】
도 1은 다양한 뇌조직으로부터 유래한 인간 신경줄기세포의 증식 및 성장 형태를 현미경으로 관찰한 결과이다.
HFT13: 종뇌 유래 신경줄기세포
HFD13: 간뇌 유래 신경줄기세포
HFM13: 중뇌 유래 신경줄기세포
HFC13: 소뇌 유래 신경줄기세포
도 2는 다양한 뇌조직으로부터 유래한 인간 신경줄기세포의 성장 곡선을 비교하여 나타낸 그래프이다.
도 3은 여러 가지 마커를 이용하여 본 발명에서 분리한 인간 신경줄기세포의 분화 양상을 현미경으로 관찰한 결과이다.
도 4는 U87MG 세포를 이식하여 제조한 인간 신경교모세포종 동물 모델에서 종양의 생성을 헤마록실린 및 CM-Dil 염색으로 확인한 결과이다.
도 5 내지 6은 본 발명에서 사용한 ffMDM2 발현 재조합 아데노바이러스 백터의 개열지도와 ffMDM2 및 LacZ를 동시에 발현하는 재조합 아데노바이러스 백터의 개열지도를 나타낸 것이다. kanamycin: 카나마이신 내성 유전자
L-ITR: 좌 반전 말단 반복부 (left inverted terminal repeat)
R-ITR: 우 반전 말단 반복부 (right inverted terminal repeat)
ES: 인캡시데이션 시그널 (Encapsidation Signal)
Ig/c -chain leader: 분비 신호 서열
TAT: 단백질 전달 도메인
Ad5 left/right arm homology: 백본 백터인 pAdEasy_l과 homologous recombination하기 위해 필요한서열
pBR322 ori : 개시점 도 7은 aMDM2 발현 발현 재조합 아데노바이러스 백터로부터 생산된 재조합 아데노바이러스에서 야생형 아데노바이러스의 오염여부를 조사한 PCR 결과를 나타낸 것이다.
M ： 사이즈 마커 (size marker)
lane 1： 음성대조군 (E1A프라이머)
lane 2： 293A (양성대조군， E1A프라이머)
lane 3 ： Ad MDM2 (E1A프라이머) lane 4 ： AdaMDM2-LacZ (E1A 프라이머) lane 5 ： AdaMDM2 (αΜΜ2 프라이머) lane 6 ： AdaMDM2-LacZ (αΜΜ2 프라이머)
도 8은 MDM2 발현 재조합 바이러스 (Ac ?MDM2)에 감염된 각종 뇌종양 세포주의 생존도를 CCK-8 어세이로 조사한 결과이다.
도 9는 aMDM2 발현 재조합 바이러스 (Adff MDM2)에 감염된 인간 신경줄기세포의 성장을 조사한 결과이다. 도 10은 aMDM2 발현 재조합 바이러스 (AdffMDM2)에 감염된 인간 신경줄기세포의 생존도를 CCK-8 어세이로 조사한 결과이다.
도 11은 ffMDM2 발현 재조합 바이러스 (AdaMDM2)에 감염된 인간 신경줄기세포 배양액과 공동 배양한 인간 신경교모세포종 세포주 (U87MG, U373MG)의 세포사멸을 조사한 결과이다.
도 12는 aMDM2 발현 재조합 바이러스 (AdffMDM2)에 감염된 인간 신경줄기세포에서 발현되는 aMDM2(p53)를 IP/웨스턴 블롯 분석으로 확인한 결과이다.
도 13은 aMDM2 발현 재조합 바이러스 (AdaMDM2)에 감염된 인간 신경줄기세포에서 발현되는 aMDM2(p53)를 면역조직화학 염색으로 확인한 결과이다. 도 14는 신경교모세포종 (U87MG)과 aMDM2 및 LacZ 발현 재조합 바이러스에 감염된 인간 신경줄기세포 (hNSCs-AdaMDM2— LacZ)를 이식한 동물모델에서， 이식된 신경줄기세포의 분포를 ^-galactosidase 면역조직화학 염색으로 확인한 결과이다. 도 15는 신경교모세포종 (U87MG)과 aMDM2 및 LacZ 발현 재조합 바이러스에 감염된 인간 신경줄기세포 (hNSCs-AdaMDM2-LacZ)를 이식한 동물모델에서， 이식된 신경줄기세포의 분화양상을 다양한 항체를 이용한 면역조직화학 염색으로 확인한 결과이다ᅳ 도 16은 신경교모세포종 (U87MG)과 aMDM2 및 LacZ 발현 재조합 바이러스에 감염된 인간 신경줄기세포 (hNSCs-Ac ?MDM2-LacZ)를 이식한 동물모델에서， 이식된 신경줄기세포에서 발현된 aMDM2에 의한 종양세포의 사멸을 active caspase-3 면역조직화학 염색으로 확인한 결과이다.
도 17은 신경교모세포종 (U87MG, U373MG)과 vehicle을 이식한 대조군 동물모델과 신경교모세포종 (U87MG, U373MG)과 «MDM2 및 LacZ 발현 재조합 바이러스에 감염된 인간 신경줄기세포 (hNSCs-AdaMDM2-LacZ)를 이식한 동물모델에서의 종양크기의 감소정도를 비교한 결과이다.
도 18은 신경교모세포종 (U87MG)과 vehicle을 이식한 대조군 동물모델과 신경교모세포종 (U87MG)과 c?MDM2 및 LacZ 발현 재조합 바이러스에 감염된 인간 신경줄기세포 (hNSCs-Ac ?MDM2-LacZ)를 이식한 동물모델에서의 생존정도를 비교한 결과이다.
【발명의 실시를 위한 형태】
이하， 실시예를 통하여 본 발명을 더욱 상세히 설명 하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서， 본 발명의 요지 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자에게 있어서 자명할 것이다. 실시예
실시예 1: 인간신경줄기세포의 분리 및 배양
<1-1>뇌조직의 분리
세브란스병원 IRB( Institution Review Board)의 승낙을 받은 후， 보건복지부의 생명윤리법안과 과학기술부 세포웅용연구사업단 윤리위원회의 연구지침 및 신촌 세브란스 병원의 인체조직 연구관리 지침을 따라 임신 13주에 자연 유산되어 사망한 태아의 사체를 사전에 보호자의 동의서를 받고 획득하였다. 태아 사체를 멸균된 차가운 H— H 완층용액 (Hanks' balanced salt solution, lx
[GIBC0]+HEPES, 10 mM [GIBCO] in dd¾0, pH 7.4)으로 세척하고， 현미경 하에서 중추신경계만 해부하였다. 이후， 뇌척수막과 혈관을 모두 제거하고 종뇌， 간뇌, 중뇌， 소뇌, 연수와 뇌교， 그리고 척수 부위의 조직을 각각 따로 분리하였다.
분리된 각 뇌 조직을 패트리 디쉬 (petri dish)에 담고, 약 lx 1隱 크기로 절단하고， 이 절편을 950 rpm에서 3분 동안 원심분리하여 상층액을 제거하였다. 조직을 다시 H— H 완층용액으로 세척하고， 상기 원심분리를 3회 반복 수행하였다. 마지막 원심분리를 수행한 후 상층액을 모두 제거하고， 남은 조직에 0.1% 트립신 (Gibco) 2 i 과 DNase I (Roche, 1 rag/dO을 첨가하여 잘 흔합하고， 37°C , 5%
C02 배양기에서 30분간 반웅시켰다. 30분 후 혈청 함유 배지 (DMEM+10% FBS+lx penici 1 Πη/streptomycin/fungizone) (모두 Gibco 제품)를 3 mi 첨가하였다. 혈청 피펫 (serologic pipette, Falcon)으로 천천히 조직을 잘게 부수기 시작하여 단일세포 수준까지 해리시켰다. 이후， 원심분리를 하여 상층액을 제거한 후， 세포 펠렛 (pellet)을 H-H 완층용액으로 세척하였다. 그리고 다시 원심분리를 한 후， 상층액을 제거하였다.
<1-2>신경줄기세포로의 증식
상기 실시예 <1_1>을 통해 얻어진 각 뇌조직의 세포 펠렛에 N2 배지 (D- MEM/F-12 [98% volume(v)/volume(v)]+N2 supplement [1% v/ v] +Pen i c i 11 i n/St r ept omyc i n [1% v/v] 모두 GIBCO 제품) 10 을 첨가하여 천천히 흔합하였다. 약 4X106-6X106개의 세포를 조직배양 처리 100 隱 플레이트 (tissue culture treated 100 mm plate, Corning)에 옮겼다. 신경줄기세포 성장인자로 20 ng/i bFGF( recombinant human fibroblast growth factor-basic , R & D), 10 ng/m£ LIF( recombinant human leukemia inhibitory factor, Sigma) 및 8 jug/τηί 헤파린 (Sigma)을 각각 첨가하여 좌우앞뒤로 잘 흔든 후, 37°C, 5% C02 배양기에서 배양하였다. 24시간 후， 5 의 배지를 버리고, 새로운
N2 배지 5 를 첨가하였다. 동시에 20 ng/m£ bFGF, 10 ng/mt LIF 및 8 g/mt 헤파린을 첨가하고, 계속하여 배양하였다. 배지 교환은 배지와 세포의 상태를 관찰하면서 3-4일마다 수행하였다. 이 때 약 절반 정도의 배지만을 새 배지로 교환하고 성장인자를 함께 첨가하였다.
<1-3>계대배양 상기 실시예 <1-2>를 통해 미분화된 신경줄기세포가 계속 증식하여 서로 뭉쳐져 세포덩어리, 즉 신경구 (neurospheres)를 형성하면서 자라기 시작하면 (도 1)ᅳ 7-8일마다 계대배양을 실시하였다. 계대배양은 다음과 같은 방법으로 실시하였다: 세포 배양 플레이트에서 배지를 모두 제거하였다. 세포에 0.05% 트립신 /EDTA(T/E, Gibco) 2 를 처리하고， 37°C , 5% C02 배양기에서 2분 30초간 반웅시켰다. 이후， 트립신의 작용을 중단시키기 위하여 트립신 저해제 (T/I, Soybean, Sigma, 1 mg/m^) 2.5 m£를 첨가하여 잘 흔합하였다. 세포 현탁액을 15 코니컬 튜브 (cornical tube, Falcon)에 옮겼다. 원심분리를 하여 상층액을 제거하였다. 세포를 N2 배지 3 ^로 재부유시킨 다음， 신경구가 단일세포로 해리될 때까지 혈청 피펫으로 잘게 부쉈다. 세포수를 측정한 후， 약 4X106 ~ 6X106개의 세포를 포함하고 있는 세포 현탁액을 기존의 배지가 일부 포함되어 있는 새로운 세포 배양 플레이트에 옮기고， 부족한 N2 배지를 첨가하여 총 10 의 배지가 되게 하였다. 그리고 20 ng/ml bFGF, 10 ng/mt LIF 및 8 μg/ml 헤파린을 첨가한 후， 계속하여 5% C02 배양기에서 배양하였다.
상기 과정을 통하여 구축된 인간 신경줄기세포주들 중에서， 한 개의 신경줄기세포주를 "HNSC 01"이라 명명하고， 기탁기관 한국생명공학연구원에 2008년
7월 24일자로 기탁하고 기탁번호 KCTC 11370BP을 부여받았다.
<1一4>동결보관 (cryopreservation)
상기 실시예 <1-3〉에 기재된 방법에 따라 계대배양을 계속하여 층분한 수의 신경줄기세포를 획득하면 일부 세포는 동결보관하였다. 동결보관은 다음과 같은 방법으로 수행하였다: 세포 계대배양시와 같이 0.05% 트립신 /EDTA(Gibco)와 트립신 저해제를 차례대로 처리한 신경구를 잘게 부수어 15 mi 튜브에 모두 옮겼다. H-H 완층용액 8 II ^를 첨가하여 세포를 세척하였다. 원심분리하여 상층액을 제거하였다. 세포 펠렛에 미리 준비한 4°C 동결보관 용액 (N2 배지 [40% v/v]+FBS [50% v/v]+DMS0[10 v/v, Sigma])을 첨가하여 부드럽게 세포를 재부유시켰다. 세포 현탁액을 1개의 동결 유리병 (freezing vial, NUNC)에 1.8 씩 분주하였다. 10 mm 세포 배양 플레이트 1개에 들어있는 세포를 3-4개의 동결 유리병으로 분주하였다. 이후， 아이스 버킷 (ice bucket)에 보관한 상태에서 -70°C의 넁동고로 옮겼으며， 24시간 후에 다시 액체질소탱크로 옮겨 장기 보관하였다.
<1-5> 동결보관된 세포의 해동
동결보관된 세포를 해동시킬 때는 동결 유리병을 37°C 항온수조에 담가 천천히 흔들었다. 세포가 절반정도 해동되었을 때 세포 현탁액을 미리 37°C로 데워진 N2 배지 10 가 담겨져 있는 코니컬 튜브에 옮겼다. 원심분리를 하여 상층액을 제거하였다. 세포 펠렛을 N2 배지 5 mi 로 조심스럽게 부유시켜 60 画 세포배양 플레이트에 옮겼다. 이후， 플레이트에 20 ng/rni bFGF, 10 ng/mi LIF 및 8 ug/ml 헤파린을 첨가한 후， 37°C, 5% C02 배양기에서 배양하였다. 세포가 신경구를 형성하면서 자라면 다시 상기 실시예 <1-3>에 기재된 방법에 따라 계대배양을 하였다. 대개 10일 정도 지나면 10 mm 세포 배양 플레이트에 옮길 수 있을 만큼 자라게 된다. 실시예 2: 인간신경줄기세포의 생체 외 특성 분석
<2-1>세포 증식의 특성 비교 조사
상기 실시예 1에서 인간 중추신경계의 다양한 해부학적 부위로부터 분리 .배양되어 신경구 상태로 자라는 신경줄기세포들을 각각 4X106개씩 100 mm 세포 배양 플레이트에 옮겨 50일 동안 증식시켰다. 그 결과, 신경줄기세포들은 지수함수적인 성장을 보였다 (도 2 참조). 그 중에서， 간뇌 유래 신경구 (HFD13 세포)의 경우에는 세포수가 배양 초기의 세포수에 비해 약 1，850배 증가하였고， 종뇌 유래 신경구 (HFT13 세포)의 경우에는 약 1，035배 증가하였다. 그 외 소뇌 유래 신경구 (HFC13 세포)， 중뇌 유래 신경구 (HFM13 세포) 및 척수 유래 신경구 (HFS13 세포)는 각각 약 453， 19 및 12배 증가한 것으로 나타났다 상기 결과로부터 임신 13주 인간 태아의 전뇌, 즉 간뇌와 종뇌에서 추출된 신경줄기세포들은 빠른 속도로 증식하는 반면， 중뇌 및 척수에서 추출된 신경즐기세포들은 천천히 성장하였고， 소뇌 유래 줄기세포의 성장속도는 그들의 중간 정도임을 확인하였다. 상기 각 뇌 조직의 신경구들을 7-10일 마다 한번씩 분할하여 계속 계대배양한 결과, 종뇌， 간뇌, 소뇌， 중뇌 및 척수 유래 신경구들은 각각 계대배양 횟수 (passage number) 42(약 1년), 36(약 11개월), 30(약 9개월), 10(약 6개월) 및 15(약 7개월)까지 장기적 배양이 가능하였다. 각 계대배양 과정에서 특별한 세포의 형태학적 변화 및 성장속도의 변화 등이 관찰되지 않았으며， 최종적으로 모든 세포는 노화과정을 거쳐 사멸하는 정상 원발성 세포 성장형태를 보였다 (결과 미도시). 또한 각 신경구들을 액체질소에 장기간 동결보관한 후 다시 해동시켜서 동일한 방법으로 배양하여도 세포 성장 특성의 변화 없이 시험관 내에서 계속 증식 또는 분화할 수 있음도 확인하였다 (결과 미도시). 본 발명의 신경줄기세포의 염색체 검사 결과, 정상 46， XY의 핵형을 보였고， 장기 계대배양시에도 정상 염색체 핵형을 보였다 (결과 미도시).
<2-2>신경줄기세포의 표식인자를 이용한 면역조직화학분석
생체 외에서 증식하고 있는 신경구들을 면역조직화학법으로 염색하였다. 신경구들을 10
Figure imgf000033_0001
폴리 -L-라이신 (poly-L-lysine, Sigma)이 코팅된 챔버 슬라이드 (NUNC)에 옮겨 1일간 배양하였다. 신경구가 상기 슬라이드 바닥에 부착하면， 배지를 제거하고， 차가운 IX PBS로 1회 세척하였다. 4% 파라포름알데하이드 (in Pipes buf fer)(Sigma)를 10분간 처리하여 세포를 고정하였다. 이후, 1XPBS로 3회 세척한 후， 세포를 블록킹 용액 (blocking solution, 5% bovine serum alburain[BSA, Sigma ]+3% normal goat serum [NGS, Vector ]+0.3% Triton X-100 [Sigma] in PBS)에서 1시간 동안 실온에서 반웅시켰다. 이후 캐리어 용액 (carrier solution, 3% NGS+0.3% Triton X-100 in PBS)에 희석한 항 -인간 특이적 네스틴 항체 (anti-human specific Nest in antibody, 1:200, Chemicon) 또는 항-비멘틴 항체 (ant i -Vimentin antibody, 1:80， Sigma)를 첨가하여 4°C에서 하룻밤 동안 반웅시켰다. 다시 세포를 1XPBS로 3회 세척한 후， 상기 캐리어 용액에 희석한 2차 항체 (species specific secondary ant i bodies conjugated with fluorescein, 1:200， Vector)를 넣고 37°C에서 1시간 동안 반웅시켰다. 1XPBS로 3회 세척한 후， 세포에 마운팅 배지 (mounting media,
Vector)를 떨어뜨리고 오버 글래스 (cover glass)를 덮었다. 이후, 형광 현미경 (epi fluorescent microscope, 01卿 us)으로 관찰하였다. 그 결과， 99% 이상의 세포가 신경줄기세포의 표식인자인 네스틴 또는 비멘틴을 발현함을 확인하였다. 종뇌 유래 신경구 (HFT13 세포)의 결과를 대표적으로 도 3A에 나타내었다.
<2-3>분화형태 분석
신경구를 형성하면서 증식하는 인간 신경즐기세포의 분화형태를 면역조직화학법으로 조사하였다. 각 신경구에 0.05% 트립신 /EDTA(Gibco)를 처리하여 단일 세포현탁액으로 제조하고, 10 g/mi 폴리 -L-라이신 (poly-L-lysine, Sigma)이 코팅된 8 웰 챔버 슬라이드에 옮겼다. 이후， 성장인자가 함유되지 않은 N2 배지에서 1주일 동안 배양시켰다. 그 결과， 세포들은 플레이트 바닥에 부착되어 분화된 신경세포 형태를 보였다. 배지를 제거하고， 차가운 IX PBS로
1회 세척하였다. 4% 파라포름알데하이드 (in Pipes buf fer)(Sigma)를 10분간 처리하여 세포를 고정하였다. 이후， IX PBS로 3회 세척한 후， 블록킹 용액 (blocking solution, 5% bovine serum albumin[BSA, Sigma ]+3% normal goat serum [NGS, Vector ]+0.3% Triton X-100 [Sigma] in PBS)에서 1시간 동안 실온에서 반웅시켰다. 이후 캐리어 용액 (carrier solution, 3% NGS+0.3% Triton X-100 in PBS)에 각 비율로 회석한 다양한 1차 항체 (표 1)를 첨가하여 4°C에서 하룻밤 동안 반웅시켰다. 【표 1】 .
인간 신경줄기세포의 분화 형태 분석에 사용한 1차 항체
Figure imgf000035_0001
1차 항체를 처리한 세포를 다시 IX PBS로 3회 세척한 후， 상기 캐리어 용액에 희석한 2차 항체 (specific secondary antibodies conjugated with fluorescein, 1:200， Vector)를 첨가하여 37°C에서 1시간 반응시켰다. lx PBS로
3회 세척한 후, 세포에 마운팅 배지 (mounting media, Vector)를 떨어뜨리고 커버 글래스 (cover glass)를 덮었다 . 이푸, 형광 현미경 (epi fluorescent microscope, Olympus)으로 관찰하였다.
그 결과， 줄기세포가 추출된 중추신경계의 해부학적 위치 및 계대배양 횟수에 따라 약간의 차이를 보였으나, 분화조건에서 인간 신경줄기세포는 각종 신경세포로 분화하고， 다양한 신경전달물질을 발현하여 분화의 다능성을 보였다 (도 3B 참조). 보다 구체적으로 살펴보면， 중추 신경계의 각 해부학적 위치에서 유래한 모든 인간 신경줄기세포에서 초기 신경 마커 (early neuronal marker)인 TUJ1의 발현이 관찰되었다. 이는 상기 신경줄기세포가 신경원세포로 분화할 수 있음을 보여주는 것이다. 또한 초기 회소돌기아교세포 마커 (early oligodendrocyte marker)인 04의 경우에는 대체적으로 그 발현율이 낮게 나타나 신경줄기세포의 소수가 희소돌기아교세포로 분화함을 보였다.
최근 신경교세포의 일종인 성상세포 (astrocyte)의 표식인자로 알려진 GFAP를 발현하는 세포가 신경줄기세포 또는 이의 일종인 방사상 교세포 (radial glial cells)임이 보고 되었다. 중추 신경계의 각 해부학적 위치에서 유래한 모든 인간 신경줄기세포가 GFAP를 발현하는 것으로 나타났다. 특히， HFT13 세포의 GFAP 발현율은 초기 및 후기 계대배양시 각각 80% 및 90-95%로 상당히 높게 나타났으며， 계대배양이 지속될수록 증가함을 보였다.
한편， 본 발명에서 배양된 인간 신경줄기세포는 분화시 다양한 신경전달물질을 발현하였는데， 특히 GABA 및 글루타메이트는 거의 모든 세포에서 발현되었다. 또한 본 방법에서 배양된 인간 신경줄기세포는 분화조건 하에서 단지 극소수의 세포만 콜린 아세틸트랜스퍼라제 (콜린 AT) 및 티로신 하이드를라제 (TH)를 발현하여 도파민성 또는 콜린성 신경세포로는 잘 분화하지 않음을 보였다. 실시예 3: 인간신경교모세포종 배양 및 인간신경교모세포종 동물모델 확립
<3-1> 인간신경교모세포종 배양
ATCCCAmerican Type Culture Col lection)에서 구입한 인간 다형성 신경교모세포종의 일종인 U87MG 세포주를 10% FBS와 lx
P/S(penici 11 in/streptomycin; Gibco)가 첨가된 RPMI 1640 배지 (Gibco)에서 배양하였다. 또 다른 인간 신경교모세포종의 일종인 U373MG 세포주 (ATCC)는 10% FBS와 lx P/S가 첨가된 DMEM 배지 (Gibco)에서 배양하였다. 이들 세포는 매 3-
4일마다 0.05% 트립신 /EDTA를 2분 30초간 처리하여 계대배양하였다. 마지막 계대배양 후， U87MG 또는 U373MG 세포에 트립신 /EDTA를 처리하여 단일세포 현탁액을 만들었다. 상기 현탁액을 950 rpm에서 3분간 원심분리하여 상층액을 제거하였다. 세포 펠렛에 20 g/ CM-DiI(Cell Tracker , Molecular Probes)를 함유하는 lx PBS 5 를 첨가하여 세포를 재부유시켰다. 이후 37°C에서 3분ᅳ 그리고 얼음 위에서 10분간 반응시켜 세포를 CM-DH로 염색시켰다. 원심분리를 하여 얻은 세포 펠렛을 lx PBS 10 로 다시 재부유시키고 다시 3회 원심분리하여 남아 ¾는 CM-Dil를 제거하였다. 이후， 세포수를 lx 105 U87MG cells/2 μί 또는
6x 105 U373MG cells/5 로 조정하여 세포를 lx PBS로 재부유시켰다. 이와 같이 제조된 세포 현탁액은 생체 내 이식 전까지 얼음에 보관하였다.
<3-2> 인간신경교모세포종 동물모델 확립
6-8 주령의 비흉선 누드 마우스 (Athymic nude mice, nu/nu; female) (중앙실험동물)를 자일라진 (Xylazine, 0.1 mg/10 g of body weight) (바이엘코리아) 및 케타민 (Ket amine, 0.5mg/10g of body weight) (유한양행)으로 마취시켰다. 두부의 정중앙 피부를 70¾ 알코올로 소독하고 절개하였다. 두부를 정위 장치 (stereotaxic apparatus)에 고정시켰다. 오른쪽 선조체 (corpus striatum) 부위에 위치를 표시한 후 브레그마 (Bregma)로부터 전방으로 0.5 瞧， 오른쪽 측방으로 2.0誦, 깊이 3 腿), 1 隱 드릴 바 (drill bar)로 두개골에 구멍을 뚫었다. 이후， 상기 실시예 <3-1>에서 준비된 CM-Dil 표지 종양세포 현탁액을 헤밀톤 실린지 (Hemilton syringe)에 담았다. 상기 실린지를 상기 정위 장치에 고정시킨 후， 미세주입 펌프 (micro injection pump, Stoelting)를 이용하여 종양세포 현탁액 2~5 ^를 1 /분의 속도로 천천히 상기 위치의 선조체 부위에 이식하였다. 이식이 끝난 후 3분간 안정화시켰다. 다시 3분에 걸쳐 천천히 실린지 바늘을 꺼냈다. 수술부위는 요오드 연고로 소독하고 봉합하였다. 마우스는 마취가 깰 때까지 37°C 웜 패드 (warm pad)에서 안정화시켰다. 감염 예방을 위해 수술 후 3일간 세파졸린 (cepazolin, 50 mg/kg/day, 유한양행)을 증류수에 희석하여 이를 상기 마우스에 피하 주사하였다.
인간 신경교모세포종 동물모델 확립을 확인하기 위해， 세포이식 수술 3주일 후 상기 마우스를 4% 파라포름알데하이드 (in Pipes buffer)로 고정하고 뇌를 적출하였다. 적출된 뇌를 16 m로 동결절단 (cryosection)하여 헤마록실린 (hematoxylin, Vector)으로 염색하였다. 이후， 현미경 하에서 CM- Dil로 표지된 종양을 관찰하였다. 그 결과， 118 \ 세포를 이식한 경우 마우스의 우측 선조체에 매우 큰 종양이 형성되었으며 (도 4)， U373MG 세포를 이식한 경우에도 선조체에 종양이 형성되었다. 실시예 4: gMDM2발현 재조합 아데노 바이러스 제작
<4-1> CAG프로모터를 포함하는 변형된 pShuttle 백터의 제작
CAG 프로모터를 가지는 재조합 아데노바이러스를 이용하기 위하여 pShuttle 백터 (Stratagene)의 MCSO iltiple cloning site)에 pTriEX-1.1 Neo DNA(Novagen) 백터로부터 가져온 CMV 즉시초기 인헨서 (CMV i瞧 ediately early enhancer； CMV ie enhancer), 닭 ^ -액틴 프로모터 (；9 -act in promoter), 토끼 -글로빈 종결자 ( globin terminator), pShut 11 e-I ES-hrGFP-1 (St rat agene ) 백터에서 가져온 IRES, pShuttle-CMV-LacZ에서 가져온 LacZ를 클로닝해서 pShuttle-CAG 또는 pShuttle- CAG-IRES-LacZ 백터를 만들었다. 이를 상세히 설명하면 다음과 같다.
먼저 토끼 —글로빈 종결자를 pShuttle 백터의 5 /I과 Bgl 사이에 다음과 같은 방법으로 클로닝하였다. pTriEX-1.1 네오 백터 (Novagen)로부터 토끼 -글로빈 종결자 부분을 Pfu 중합효소 (Takara)를 이용한 PCR을 통하여 얻었다. 이때 사용한 프라이머 (서열번호 5의 정방향 프라이머 (CTCGAGATCMTTCTCTAGCCAAT) 및 서열번호 6의 역방향 프라이머 (GGATCCTTACATATGGGCATATGT)는 pShuttle 백터로의 클로닝을 위하여 ?I과 MI제한효소 서열을 포함하고 있다. PCR 반응은
95°C에서 5분간 초기 변성; 94°C에서 45초간 변성， 55°C에서 45초간 어닐링 및
72°C에서 30초간 신장 (extension)의 35 사이클; 및 72°C에서 7분간 최종 신장으로 수행하였다. 증폭된 PCR 산물을 pGEM-T Easy 백터 (Promega, Wisconsin, USA)에 클로닝하였다. 토끼 -글로빈 종결자가 삽입된 pGEM-T easy 백터는 ¾?I과
BanRl 으로 절단하고, pShuttle 백터는 Sail , /Π로 절단하여 각각의 산물을 연결 (ligation)하였다. 이때 53/1과 /?oI , ¾ 1I와 fe/¾H I은 각각 상보적인 웅집말단 (compatible cohesive end)으로써 서로 연결 (ligation)이 가능하고 연결 (ligation)된 백터는 각각의 제한효소 자리를 잃는다. 이렇게 하여 토끼 β- 글로빈 종결자를 포함한 pShuttle 백터 (pShuttle-rabbit β globin terminator)를 클로닝하였다.
그 다음으로 토끼 -글로빈 종결자를 포함한 pShuttle 백터에 CMV 즉시초기 인헨서와 닭 -액틴 프로모터 부분을 다음과 같은 방법으로 클로닝하였다. 닭 —액틴 프로모터와 pTriEX-1.1 네오 백터의 MCS 사이에 존재하는 Pacl 제한효소 부위를 제거하기 위해 우선 ¾cl으로 pTriEX-1.1 Neo 백터를 자른후 클레나우 조각 (Klenow fragment； Takara)을 이용해 블런트 엔드를 만들었다. 이를 Smal으로 다시 절단한 후 자가 연결 (self ligation)을 수행하여 Pacl 제한효소 부위가 없어진 변형된 pTriEX-1.1 네오 백터를 얻었다. 상기의 변형된 pTriEX-1.1 네오 백터를 Fsel으로 절단 후 클레나우 조각으로 중합반응을 수행하여 블런트 엔드를 만들고 다시 Χ1 )Ι으로 절단하여 CMV 즉시초기 인헨서와 닭 /5_액틴 프로모터 부분을 얻었다. 앞서 만들어진 토끼 ^ᅳ글로빈 종결자를 포함한 pShuttle 백터를 Kpnl과 ΧΙωΙ으로 절단하여 얻은 산물과 상기 CMV 즉시초기 인¾서와 닭 -액틴 프로모터 부분을 연결 (ligation)하여, CMV 즉시초기 인헨서， 닭 액틴 프로모터와 토끼 -글로빈 종결자를 포함한 pShuttle 백터 (pShuttle-
CAG)를 완성하였다.
상기 pShuttle-CAG 백터에 다음의 방법으로 IRES와 LacZ를 클로닝하였다. pShuttle-IRES-hrGFP와 pShuttle-CMV-LacZ(Stratagene) 백터에서 IRES 및 LacZ 부분을 pfu 중합효소를 이용한 PCR을 통하여 얻었다. 먼저 IRES를 얻기 위해 사용한 프라이머 (서열번호 7의 정방향 프라이머 (GCGGCCGCAAATMTAATAGCMTTCCT) 및 서열번호 8의 역방향 프라이머 (TCTAGATGGTTGTGGCCATTATCA))는 pShuttle-CAG 백터로의 클로닝을 위하여 IRES 앞쪽에 Λ¾ Ι제한효소 서열을 포함하고 있으며，
LacZ와의 클로닝을 위하여 IRES뒤쪽에 bal제한효소 서열을 포함하고 있다. PCR 반웅은 95°C에서 5분간 초기 변성; 94°C에서 30초간 변성, 56°C에서 30초간 어닐링 (annealing) 및 72°C에서 30초간 신장 (extension)의 30 사이클; 및 72°C에서
7분간 최종 신장으로 수행하였다. 증폭된 PCR산물을 pGEM-T easy 백터 (Promega, Wisconsin, USA)에 클로닝하였다 (pGEM—T easy-IRES) . 다음으로 LacZ를 얻기 위해 사용한 프라이머 (서열번호 9의 정방향 프라이머 (tctagaatggtcgttttacaacgtcg) 및 서열번호 10의 역방향 프라이머 (tctagattatttttgacaccagaccaac))는 IRES와의 클로닝을 위하여 LacZ 앞쪽에 bal제한효소 서열을 포함하고 있으며 , pShuttle-CAG 백터와의 클로닝을 위하여 LacZ뒤쪽에 ¾?I제한효소 서열을 포함하고 있다. PCR 반웅은 95°C에서 5분간 초기 변성; 94°C에서 30초간 변성, 57°C에서 30초간 어닐링 (annealing) 및 72°C에서 2분간 신장 (extension)의 30 사이클; 및 72°C에서 7분간 최종 신장으로 수행하였다. 증폭된 PCR 산물을 pGEM-T easy 백터 (Promega, Wisconsin, USA)에 클로닝하였다 (pGEM-T easy-LacZ). pGEM-T easy- 1 RES 백터를 I과 5 /I으로 절단하고， pGEM-T easy-LacZ 백터를 ¾al과 Xho I으로 절단하여 연결 (ligation )하였다 (pGEM-T easy-IRES-LacZ) . pGEM-T easy-IRES-LacZ 백터를 Notl 과 I 으로 절단하여 IRES와 LacZ 부분을 얻었다. pShuttle-CAG 백터를 Notl 및 ¾?I으로 절단하여 얻은 산물과 위의 IRES와 LacZ 부분을 연결 (ligation)하여， pShutt le_CAG_IRES-LacZ를 완성하였다.
<4-2> aMDM2 발현 재조합 백터 제작 인간 p53의 MDM2 결합부위의 12개 아미노산 서열 (서열번호 1: QETFSDLWKLLP (?讓2)에 해당하는 염기서열 (서열번호 3: caggaaacattttcagacc tatggaaactacttcct)을 올리고 합성하였다. 이때, 신경줄기세포에서 발현되어 세포 밖으로 분비된 본 발명의 aMDM2가 목적세포의 세포막을 통과하여 세포질 내부로 들어갈 수 있도록 하기 위해, HIV에서 유래된 11개 아미노산으로 이루어진 단백질 형질도입 도메인 (protein transduction domain, TAT; YGRKK RQR R; 서열번호 11)을 aMDM2의 N-terminal에 Gly 아미노산을 추가하여 연결하였다. 이에 상웅하는 뉴클레오타이드 서열은 다음과 같다: tat ggacgaaagaaacggaggcaacgt agacgcgga; 서열번호 12. 상보적으로 결합할 합성 올리고머를 결합한 후 PSecTag2A 백터 (Invitrogen)에 클로닝 하기 위해 을리고의 양단에 절단된 //?/ΠΙ와 서열을 추가하였다. 또한 0RF를 맞추기 위해 와 ΤΑΤ서열 사이에 염기서열 하나 (a)를 추가하였다. 이렇게 하여 각각 79개의 염기서열로 이루어진 상보 올리고머를 합성하였다. ( agctt at at ggacgaaagaaacggaggcaacgt agacgcggacaggaaacat ttt cagacc
tatggaaactacttcctc; 서열번호 13， tcgagaggaagtagtttccataggtctgaaaatgtttcctgt ccgcgtctacgttgcctccgtttctttcgtccatata;서열번호 14； Bioneer , 대전) 상기에서 합성된 올리고머를 어닐링하여 이중쇄 올리고머를 만드는 과정은 다음과 같다. 합성된 올리고머 각각을 고농도의 STE 완층액 (10 niM Tris-HCl pH 8.0， 50 mM NaCl, 1 mM EDTA)에 6//g/ l의 농도로 녹였다. 이것을 각각 2 1씩 섞어준 후， 94°C의 욕조에 넣은 뒤 가열을 끄고 실온까지 식혔다. 이후， 단백질의 세포 밖 분비를 유도하는 Ig c-체인 리더를 포함하는 이중쇄 올리고머를 pSecTag2A 백터 (Invitrogen)에 클로닝 하였다. pSecTag2A 백터를 HindYi 와 ¾ I 제한효소로 자르고， TAT와 연결된 "MDM2 단편과 pSecTag2A 백터를 연결 (ligation)하여 Ig c-체인 리더- TAT-aMDM2 컨스트럭트를 완성하였다.
완성된 Ig c-체인 리더- TAT-aMDM2 컨스트럭트를 아데노바이러스 shuttle 백터로 클로닝하기 위하여 상기 구조물의 양 말단에 와 53/1 제한효소 서열을 PCR로 연결하였다. 이 때 PCR은 상기에서 제작한 TAT-aMDM2가 포함된 pSecTag2A 백터를 주형으로 하여 서열번호 15의 정방향 프라이머 및 (AGATCTGCCACCATGGAGACA) 서열번호 16의 역방향 프라이머 (GTCGACTTMGGMGTAGTTTCC)를 사용하였으며， PCR 반웅은 94°C에서 3분간 초기 변성; 94°C에서 30초간 변성, 53°C에서 30초간 어닐링 (annealing) 및 72°C에서 30초간 신장 (extension)의 35 사이클; 및 72°C에서
10분간 최종 신장으로 수행되었다. 증폭된 PCR 산물을 pGEM-T easy 백터 (Promega)에 클로닝하였다 (pGEM_T easy-Ig/c_TAT-aMDM2) . 이 후, 상기 pGEM-
T easy-Ig c-TAT-aMDM2 백터를 와 5 /I제한 효소로 절단한 후 하여 Ig/c-
TAT-aMDM2 단편을 실시예 <4-1>에서 제작한 아데노바이러스 shuttle백터인 pShuttle-CAG와 pShutt le_CAG-IRES_LacZ에 삽입하였으며, 이를 'pShuU le—CAG-Ig/c -
TAT-aMDM2, pShuttle-CAG-Ig/c-TAT-aMDM2-IRES-LacZ'라고 명명하였다 (도 5 및 도 6 참조).
<4-3> aMDM2 발현 재조합 아데노바이러스 (AdaMDM2 또는 Ada MDM2-LacZ) 제조 상기에서. 제조한 pShuUle-CAG-Ig/c-TAT— ffffl)M2 또는 pShutt le_CAG_Ig /c - TAT— «MDM2-IRES-LacZ를 ¾e I제한효소로 절단한 후, 아데노바이러스성 백본 백터 (adenoviral backbone vector)인 pAdEasy-l(Stratagene)과 함께 BJ5183 대장균 (Stratagene)에 공동도입하여 상기 두 백터 간의 동종 재조합 (homologous recombination)을 유도하였다 (pAdCAG-Ig/c-TAT— "MDM2 또는 pAdCAG—Ig/c -TAT- aMDM2-IRES-LacZ). 대장균의 형질전환은 유전자 도입기 (Gene Pulser, 2.5 kV,
25/ F, 200 Q )(Bio-Rad, Hercules, CA, USA)를 이용한 전기천공법에 의하여 수행하였다.
이렇게 얻은 pAdCAG-Ig/c-TAT-aMDM2 또는 pAdCAG-Ig/c -TAT-aMDMS-IRES- LacZ를 7¾cl제한 효소로 절단한 후， 아데노바이러스 생산 세포주인 293A 세포 (Invitrogen, CA)에 형질감염 (transfect ion)하여 바이러스를 증폭시켰다. 생산된 재조합 바이러스 (AdaMDM2 또는 AdaMDM2-LacZ)는 80,000 rpm으로 10°C에서
6시간 동안 염화세슘 초원심분리 (cesium chloride ultracentr i fugat m)를 수행하여 순수분리하였다. 이후， 4¾ 수크로즈 완충용액 (10 mM Tris pH8.0, 2 mM MgCl2, 4% sucrose in dd¾0)에서 투석 (Pierce, Rockford, IL, USA)한 후 0.4 μ\α 여과기로 여과하여 사용 전까지 -70°C에 보관하였다.
<4-4> TCID50 테스트
상기에서 제조된 Adi?MDM2 재조합 바이러스를 정량하기 위해 293A 세포를 이용하여 TCIDsoCTissue Culture Infectious Dose 50， QBiogene) 테스트를 하였다. 293A 세포를 96 웰 플레이트 (NUNC)에 플레이팅하고， 연속 희석한 재조합 바이러스를 각각 감염시켰다. 1주일 후 감염된 웰 수를 더하여 KABER 통계법 (TCID 50 reference; QBiogene, CA, USA. AdenoVator appl i cat ions manual)으로 TCID50값을 계산하였다.
그 결과, 재조합 바이러스의 TCID50 값이 평균적으로 IX 1010 내지 10X1010
PFU/ 인 것으로 나타나 아데노바이러스 백터가 잘 제작되었음을 알 수 있었다.
<4-5>야생형 아데노바이러스의 오염 여부 확인
AdaMDM2또는 AdaMDM2-LacZ 재조합 바이러스에서 야생형 아데노바이러스의 오염여부를 확인하기 위해， 상기 재조합 아데노바이러스에서는 제거된 야생형 아데노바이러스의 E1 유전자의 내부 서열로부터 프라이머를 합성하여 PCR을 수행하였다. 먼저， 각 재조합 바이러스의 게놈은 바이러스 입자를 용해 (lysis) 완충용액 (0.1% SDS, 10 mM Tris pH7.4, 1 mM EDTA)으로 깬 후 페놀 /에탄올 침전법으로 얻었다. 이후, 얻어진 각 게놈을 주형으로 하고 야생형 아데노바이러스의 오염 여부를 확인하기 위하여 서열목록 제 17(mGTGTTACTCATAGCGCGT)서열 및 서열목록 제 18(ATTCmCCCACCCTTAAGCC)서열 프라이머 (야생형 아데노바이러스의 E1 유전자를 증폭함)를 이용하여 PCR을 수행하였으몌 추출한 재조합 아데노바이러스의 게놈을 확인하기 위하여 목적 유전자 (interest gene)인 TAT-aMDM2 유전자를 검출하기 위한 서열목록 제 15서열과 서열목록 제 16서열의 프라이머를 이용하여 PCR수행하였다. PCR 반웅은 94°C에서 3분간 초기 변성 ; 94°C에서 30초간 .변성 , 53°C에서 40초간 어닐링 (annealing) 및 72°C에서 45초간 신장 (extension)의 35 사이클; 및 72°C에서 10분간 최종 신장으로 수행되었다. 이 때 293A 세포 게놈을 양성 대조군으로 하였다. 상기 293A 세포 게놈은 다이제스쳔 (digestion) 완충액 (0.5% SDS, 100 mM NaCl , 10 mM Tris-Cl, 25 mM EDTA)으로 세포를 깬 후 페놀 /에탄올 침전 방법으로 얻었다. PCR 반웅 결과는 2%아가로스 겔 전기영동으로 확인하였다. 그 결과, 도 7에서 보는 바와 같이, 293A 세포에서는 340 bp의 E1 유전자가 검출되었으나 (lane 2), AdaMDM2 또는 AdaMDM2-LacZ 재조합 바이러스 게놈에서는 검출되지 않았으며 (lane 3, 4)， 목적 유전자 (TAT_aMDM2: 192 bp)가 검출되어 (lane
4, 5) 추출한 재조합 바이러스 게놈임을 확인하였다. 이로써 제작한 재조합 바이러스는 야생형 아데노바이러스에 오염되지 않았음을 확인하였다.
<4-6> aMDM2 발현 재조합 아데노바이러스에 감염된 다양한 인간 신경교종 세포의 세포사멸 분석
AdaMDM2 바이러스가 인간 신경교종 세포의 사멸을 유도하는지 확인하기 위해, 여러 가지 신경교종 세포에 바이러스를 감염하였다.
U87MG, U373MG, hGM-20070329(연세의료원)， GBM2(서울대학교), GBM3 세포 (서울대학교) IX 104개를 각각의 배지 100 ^와 함께 96 웰 플레이트에 플레이팅하였다. 1시간 후， 0， 2， 5, 10， 15 M(3I의 Ad«MDM2 바이러스 입자를 각각 배지에 직접 넣어 세포를 감염시켰다. 감염 24시간 후 바이러스를 제거하기 위해 각각의 배지 100 로 1회 세척하고， 배지 100 에서 계속 배양하였다. 7일 후 세포사멸 정도를 정량화하기 위해， 미토콘드리아 디하이드로게나제 활성 어세이 (mitochondrial dehydrogenase activity assay) (Cel 1 Counting Kit— 8 [CCK-8 assay] , Dojindo Laboratories, Tokyo, Japan)를 수행하였다. CCK-8 용액 를 각 웰에 처리하고， 2시간 후 마이크로플레이트 리더로 450 nm에서 흡광도를 측정하였다. 블랭크 대조군은 배양액에 CCK-8 용액만을 처리한 웰로 하였고， 바이러스 첨가하지 않은 신경교종 세포 배양군을 100% 세포 생존군으로 표현하였다. 각각의 실험군은 3개의 웰로 실험하였고， 동일 실험을 3회 반복하여 평균값을 구하였다. 바이러스 비 감염 신경교종 세포 성장을 평균 100%로 하였을 때， 5， 10， 15 MOKMultiplicity of Infection)의 AdaMDM2 바이러스 감염 평균 67.31 士 0.24， 44.51 土 0.60， 52.80 土 0.30(mean 土 SEM)%, U373MG 는 85.83 土 1.26, 69.12 士 2.88， 60.86 土 0.56%, hGM-20070327는 66.56 土 0.62， 58.99 土 0.42， 29.91 土 0.21%， GBM2는 20.41 土 0.21， 13.41 土 0.12， 10.92 土 0.05%， GBM3는 42.68 土 0.20， 23.90 士 0.10， 17.04 士 0.09%의 생존도 (viabi 1 ity)를 보였다 (도 8 참조). 이로써 제작된 AdaMDM2 바이러스가 다양한 신경교종 세포에서 세포사멸을 일으킬 수 있음을 확인하였다. 실시예 5: gMDM2에 대한 인간신경줄기세포의 반웅 조사
<5-1> aMDM2 발현 재조합 아데노바이러스에 감염된 인간 신경줄기세포의 증식 및 성장 분석
Ad«MDM2 재조합 바이러스에 감염된 인간 신경줄기세포가 정상적으로 증식 및 성장하는지를 관찰하였다.
HFT13 세포 5 X 105개를 성장인자가 포함된 N2 배지 (D— MEM/F-12 [98% volume(v)/volume(v)]+N2 supplement [1% v/v]+Penici 11 in/Streptomycin [1% v/v]； 모두 GIBCO 제품) 0.5 와 함께 12 웰 배양 디쉬의 각 웰에 플레이팅하였다. 한 시간 후, 0， 0.3, 3， 30 M()I의 AdffMDM2 바이러스 입자를 각각 배지에 직접 넣어 세포를 감염시켰다. 감염 24시간 후 바이러스를 제거하기 위해 3 N2 배지로 1회 세척하고， 성장인자가 포함된 1.5 mi N2 배지에서 계속 배양하였다. 배양 5일 후 세포는 각각에서 신경구를 형성하면서 증식 및 성장하는 것이 관찰되었다. 바이러스 비 감염 대조군에 비하여 신경구 형성 및 성장속도는 둔화되어 있었으나， 급속도로 일어나는 세포 사멸은 관찰되지 않았다 (도 9 참조).
이후， aMDM2 발현 재조합 아데노바이러스의 감염이 인간 신경줄기세포의 증식 및 성장에 미치는 영향을 정량적으로 분석하기 위해, CCK-8 어세이를 수행하였다. HFT13 세포 5x 104개를 성장인자 함유 N2 배지 100 ^와 함께 96 웰 플레이트 각 웰에 플레이팅하였다. 1시간 후， 0, 2， 5， 10， 15， 30 M0I의 AdaMDM2 바이러스 입자를 각각 배지에 직접 넣어 세포를 감염시켰다. 감염
24시간 후 바이러스를 제거하기 위해 N2 배지 100 로 1회 세척하고， 성장인자 함유 N2 배지 에서 계속 배양하였다. 7일 후 CCK-8 용액 10 ^를 처리하고，
2시간 후 마이크로플레이트 리더로 450 nm에서 흡광도를 측정하였다. 블랭크 대조군은 배양액에 CCK-8 용액만을 처리한 웰로 하였고， 바이러스 첨가하지 않은 HFT13 세포 배양군을 100% 세포 생존군으로 표현하였다. 각각의 실험군은 3개의 웰로 실험하였고， 동일 실험을 3회 반복하여 평균값을 구하였다. 바이러스 비감염 HFT13 세포 성장을 평균 100%로 하였을 때， AdaMDM2 감염 세포는 2 M0I에서 평균 99.5 土 2.1(mean 士 SEM)%, 5 M()I에서 79.6 士 \.Th, 10 MC)I에서 59.7 土
1.0%， 15 M()I에서 51.7 土 0.9% 및 30 Μ()Ι에서 56.8 土 1.97%의 생존도 (viability)를 보였다 (도 10 참조).
상기 결과들로부터 CAG 프로모터에 의한 "MDM2의 발현정도에 따라 인간 신경줄기세포의 증식과 성장을 저해하는 효과가 있으나, 낮은 M 로 감염된 세포에서는 세포의 성장이 크게 저해되지 않음을 확인하였다.
<5-2> aMDM2 발현 재조합 아데노바이러스에 감염된 인간 신경줄기세포의 면역조직화학 분석
상기 실시예 <5-1〉에서 AdaMDM2를 감염시킨 HFT13 세포에서의 aMDM2 발현을 면역조직화학 분석으로 확인하였다. HFT13 세포 IX 105개를 성장인자 함유 N2 배지 400^와 함께 폴리 -L-라이신 (poly-L-lysine, PLL)이 코팅된 8 웰 챔버 슬라이드 (PLL-coated 8-well chamber slide)의 각. 웰에 플레이팅하였다. 이후， 상기 실시예 <5— 1>과 동일한 방법으로 5 M()I의 AdaMDM2 바이러스를 감염시켰다. 바이러스 감염 4일 후 배지를 제거하고， 차가운 IX PBS로 1회 세척하였다. 이후, 차가운 4% 파라포름알데하이드 (in Pipes buffer)로 실온에서 15분간 세포를 고정하였다. IX PBS로 세 차례 세척하고, 블록킹 용액 (3% bovine serum albumin[BSA, Sigma] +10% normal horse serum[NHS, Vector ]+0.3% Triton X— 100 [Sigma] in PBS)에 실온에서 한 시간 방치하였다. 항 -인간 p53 항체 (1:400; Abeam)를 carrier 용액 (3% normal horse serum[NHS, Vector ]+0.3% Triton X-100 [Sigma] in PBS)에 희석하여 세포에 처리하고 4°C에서 하루 동안 반웅시켰다. 세포를 상기와 동일하게 세척하였다. 이후, 항-마우스 면역글로불린 G-FITC(anti-mouse immunoglobulin G-FITC, Vector)를 상기 캐리어 용액에 1:180으로 회석하여 세포에 처리하고 37°C에서 1시간 반웅시켰다. 이후, 세포를 상기와 동일하게 세척한 후， DAPI가 첨가된 형광현미경용 마운팅 (mounting) 배지 (Vector)로 마운팅하였다. 바이러스를 감염시키지 않은 HFT13 세포를 대조군으로 하였다. 형광현미경 (BX51, Olympus)하에서 관찰한 결과, Ad«MDM2 바이러스 감염된 세포에서는 p53이 매우 강하게 염색된 반면, 감염되지 않은 세포에서는 p53이 매우 약하게 염색되었다 (도 11 참조).
이로써 제작된 바이러스에 감염된 인간 신경줄기세포는 바이러스에 감염되지 않은 세포와 비교했을 때 많은 양의 p53염색이 확인되어 aMDM2를 잘 발현하고 있을을 확인하였다.
<5-3> aMDM2 발현 재조합 아데노바이러스에 감염된 인간 신경줄기세포에서 유래한 ffMDM2의 IP/Western Blot 분석 상기 실시예 <5-1>에서 A( ?MDM2를 감염시킨 HFT13 세포에서 발현하는 «MDM2를 면역침전 /웨스턴 블롯 분석으로 확인하였다. HFT13 세포 1.5x 106개를 성장인자 함유 N2 배지 1 ml 함께 6 웰 플레이트 각 웰에 플레이팅하였다. 1시간 후， 0， 5， 10 M0I의 AdaMDM2 바이러스 입자를 각각 배지에 직접 넣어 세포를 감염시켰다. 감염 24시간 후 바이러스를 제거하기 위해 N2 배지 3 ml로 1회 세척하고， 성장인자 함유 N2 배지 2 ml에서 계속 배양하였다. 3일 후 세포 배양액을 3,000rpm에서 3분간 원심분리하여 얻은 상층액을 실험에 사용하였다. 다이나비드 면역침전 키트 (invitrogen)와 항 -인간 p53 항체 (Abeam)를 이용하여 세포 밖으로 분비된 ffMDM2를 면역 침전하여 농축시켰다. 샘플은 16%트리신 SDS-
PAGE 겔에서 전기영동하고, 0. 皿 니트로샐를로스 막으로 이전하였다. TBS- T(20mM Tris-HCI, pH7.4, 150mM NaCl , 0.05% Tween 20)로 만든 5% 탈지 우유에서 한 시간 동안 블로킹하고， 항 -인간 p53 항체 (Abeam, l^g/ml)를 4°C에서 밤새 반웅하였다. 이차항체는 홀스래디쉬 페록시다제 -접합 항-마우스 IgG Jackson I醒 unoresearch Laboratories, 1:20， 000)를 이용하고， 수퍼시그날 웨스트 피코 기질 (Thermo scientific)로 탐지하였다. 그 결과， AdaMDM2 바이러스 감염된 세포에서는 p53이 바이러스 농도에 비례하여 증가하는 양상으로 탐지되었다 (도 12 참조).
이로써 제작된 바이러스에 감염된 인간 신경줄기세포는 바이러스에 감염되지 않은 세포와 비교했을 때 많은 양의 p53염색이 확인되어 aMDM2를 잘 발현하고 있음을 확인하였다.
실시예 6: ΜΡΜ2 발현 재조합 아데노바이러스에 감염된 인간 신경줄기세포에 의한 인간신경교모세포종의 세포사멸 분석
<6-1> aMDM2 발현 재조합 아데노바이러스에 감염된 인간신경줄기세포에 의한 인간 신경교모세포종의 세포사멸 분석
AdaMDM2 재조합 바이러스에 감염된 인간 신경줄기세포에서 분비되는 aMDM2가 인간 신경교모세포종 세포의 사멸을 유도하는지 확인하기 위해， 각 바이러스에 감염된 신경줄기세포 배양액과 신경교모세포종 세포주의 공동 배양을 실시하였다.
먼저， HFT13 세포 5X 105개를 6 웰 플레이트 디쉬의 각 웰에 배지와 함께 플레이팅하였다. 1시간 후， 0， 2, 5, 10, 15， 30 M()I의 AdaMDM2 바이러스 입자를 각각 다른 웰의 세포배지에 직접 넣어 세포를 감염시켰다. 24시간 후， 세포를 N2 배지 3 로 세척하고， 성장인자 함유 N2 배지 3 에서 3일간 계속 배양하였다. 세포 배양액을 1000 rpm에서 3분간 원심분리하였다. 한편, U87MG와 U373MG 세포 5x 104개를 24 웰 플레이트 디쉬의 각 웰에 배지와 함께 플레이팅하였다. 24시간 동안 배양한 후， 종양세포의 배지를 제거하고 상기 준비된 다양한 M()I의 바이러스에 감염된 신경줄기세포 배양액 각각을 각 웰 당 1 씩 첨가하고， 배지를 2일마다 교환하며 7일 동안 배양하여 종양세포의 사멸여부를 관찰하였다. 그 결과, AdffMDM2에 감염된 HFT13 세포의 배지와 공동 배양된 U87MG와
U373MG 세포에서 세포사멸을 보였으며, Μ()Ι가 높아짐에 따라 더 많은 세포 사멸을 보였다 (결과 미도시). 이러한 세포사멸 정도를 정량화하기 위해， CCK-8 assay 어세이를 수행하였다. U87MG와 U373MG세포 lx 104개를 배지 와 함께 96 웰 플레이트의 각 웰에 플레이팅하였다. 24 시간 후 실험군 및 대조군의 배지를 처리하였다. 2일마다 배지를 교환하며 7일간 배양한 후 각 웰에 10 ^의 수용성 테트라졸리움 염 (water—soluble tetrazol ium salt)- 캐리어 (electron carrier)인 1—메^ ~시
PMS가 회석되어 있는 CCK-8 용액을 첨가하였다. 2시간 후 마이크로 리더를 이용하여 450 nm에서 흡광도를 측정하였다. 이 때 블탱크 대조군은 세포 배지에 CCK-8 용액만 처리한 웰로 하였고， 바이러스에 감염되지 않은 HFT13 세포 배양배지를 처리한 군을 100% 생존으로 표현하였다. 모든 실험을 동일한 조건에서 3회 반복하여 평균값을 얻었다. 그 결과， U87MG 세포는 2， 5， 10， 15， 30 M()I의 AdffMDM2 재조합 바이러스에 감염된 HFT13 세포 배지에서 각각 평균 9.67 土 0.04(mean士 SEM)¾>, 11.07 土 0.10%, 7.84 士 0.11%, 7.12 土 0.11%， 5.44 土 0.09%의 생존도 (viability)를 보였다. U373MG 세포에서도 많은 세포가 사멸하는 것을 관찰하였는데， 2， 5， 10， 15, 30 MW의 AdaMDM2 재조합 바이러스에 감염된 HFT13 세포 배지에서 각각 34.09 土 0.45%, 36.83 土 0.36%， 23.50 土 0.58%， 17.08 士
0.60%, 11.22 土 0.45>의 생존도 (viabi 1 ity)를 보였다 (도 13 참조). 이로써 AdaMDM2에 감염된 인간신경줄기세포에서 유래한 aMDM2에 의해 인간 신경교모세포종의 세포사멸이 잘 일어남올 확인하였으며， 특히 매우 낮은 M0I에 감염된 인간 신경줄기세포에서 유래한 aMDM2만으로도 세포사멸이 매우 잘 일어남을 관찰하였다. <실시예 7>
신경교모세포종 동물모델에 gMDM2 및 LacZ 발현 인간 신경줄기세포 이식 및 생체 내에서 공여세포의 외부 유전자 발현, 생착， 분포, 이주 및 분화 분석
AdaMDM2-LacZ 바이러스에 감염된 인간 신경줄기세포를 인간 신경교모세포종 동물모델에 이식하여 공여세포의 생체 내에서 외부유전자의 발현정도， 생착, 분포， 이주 및 분화형태를 조사하였다.
<7-1> MDM2 및 LacZ 발현 인간신경줄기세포의 이식 신경구 상태로 배양하던 인간 신경줄기세포를 이식 3일 전 0.05% 트립신 /EDTA(Gibco)를 처리하여 새 배양 플레이트에서 단일세포 상태로 플레이팅하였다. 1시간이 지난 후 10 M()I의 AdaMDM2-LacZ 바이러스를 세포에 감염시켰다. 24시간 후 N2 배지로 세포를 1회 세척하고， 성장인자 첨가된 N2 배지에서 2일간 더 배양하였다. 이식을 위하여 0.05% 트립신 /EDTA(Gibco)를 처리하여 단일세포로 만들었다. 이후， H-H 완충용액으로 3회 세척하였다. 0.05%트립판 블루 (Gibco)로 세포를 염색하고， 이식할 때까지 얼음에 보관하였다.
CM-Dil로 표지된 U87MG(2x 105cel ls/2/ )세포와 10 M()I의 AdaMDM2-LacZ 바이러스에 감염된 인간 신경줄기세포 (2x 105cells/2 를 섞어서， 실시예 <3-
2>에서와 같이 6-8 주령의 비흉선 누드 마우스의 오른쪽 선조체에 이식하였으며, 10일 후 비흉선 누드 마우스를 분석하였다.
<7-2>공여세포의 생체 내 상태 분석
상기 실시예 <7-1>의 비흉선 누드 마우스를 4% 파라포름알데하이드 (in 0.1M Pipes buffer)로 고정한 후, 뇌를 적출하였다. 적출된 뇌를 30 % 수크로스 (in PBS)에 침지시켰다. 4°C에서 1-2일간 보관하여 동결보호 (cryoprotection)하고， 16 卿로 동결절단 하였다. 상기 뇌 조직 절편을 항 - -galactosidase 항체 (1:500; MP
Biomedicals)를 이용하여 상기 실시예 <2-2>에 기재된 방법대로 면역조직화학법으로 염색하였다. 그 결과， LacZ 발현 (녹색) 공여세포는 동물의 우측 선조체에 형성된 CM-Dil로 표지된 (빨강색) 원발성 종괴의 경계부위를 둘러싸고 종괴 내부로 침윤하는 양상으로 생착 및 분포함을 보여주었다 (도 14의 A- H 참조). 또한 종양 동물모델 내로 이식된 LacZ 발현 신경줄기세포는 원발성 종괴 뿐만 아니라 주위의 제 3뇌실까지 원거리로 전이된 종괴 부위로 특이적으로 이주하여 종양세포 주위에 생착 됨을 보였다 (도 14의 I-L).
<7-3>면역조직화학분석
공여세포의 분화상태를 평가하기 위해， 다양한 신경세포의 표식인자 항체를 이용하여 면역형광염색법을 실시하였다. 상기 실시예 <7-1>의 비흉선 누드 마우스의 선조체에 형성된 종괴 (빨강색)의 경계부위를 둘러싼 형태로 생착된 LacZ 발현 공여세포 (파랑색)는 종괴 부위에서 GFAP (초록색)를 발현하여 성상세포로 분화됨을 보였고 (도 15의 A-E), 일부 이식세포는 종괴 내부에서 신경원세포의 표식인자인 NeuN을 발현하여 신경원세포로 분화함을 보였다 (도 15의 F-G). 또한 일부 이식세포는 미성숙 신경줄기세포의 표식인자인 인간 네스틴 (초록색)을 발현하였으며， 이는 이식된 공여세포의 일부가 미분화된 상태로 존재함을 나타내는 것이다 (도 15의 H-I). 극소수의 LacZ 발현 공여세포는 종괴 부위에서 초기 신경 마커인 TUJ1 및 PanNF (초록색)를 발현하여， 신경원세포로 분화함을 보였다 (도 15의 J-M).
상기 결과는 aMDM2 및 LacZ를 발현하는 인간 신경줄기세포가 신경교모세포종 모델동물의 두개 내 선조체 부위에 이식되어 아직 많은 수에서 미분화된 신경줄기세포로 남아있으나， 일부 공여세포는 이식 후 10일 정도의 짧은 기간 동안 종괴의 경계부위 또는 내부에서 신경원 및 신경교세포로 분화하여 종괴로 파괴된 숙주 동물의 신경세포 일부를 재생할 수 있는 가능성을 보여주었다.
<7-4>항 -활성 캐스파제 -3 염색
이식된 공여세포에서 발현되는 aMDM2가 종괴 부위에서 종양세포의 사멸을 유도하는지 확인하기 위하여， 아픕토시스 시에 발현하는 활성 캐스파제 (active caspase)-3를 염색하였다. 상기 실시예 <7-2>의 뇌 조직 절편을 항 -활성 캐스파제 -3(1 :200; BD Pharmingen)를 이용하여 상기 실시예 <2-2>에 기재된 방법대로 면역조직화학법으로 염색하였다. 그 결과， 종괴 내부에서 활성 캐스파제ᅳ 3를 발현하며 사멸을 보이는 세포 (초록색)가 많이 관찰되었고 (도 16의 B,F,J), 세포의 핵을 염색하여 밀도를 보여주는 DAPI염색 (파랑색)에서 종괴 내부 세포의 밀도가 현저히 감소된 것으로 나타났다 (도 16의 C,G).
상기 실시예에서 얻은 결과들로부터 , AdaMDM2-LacZ에 감염된 인간 신경줄기세포를 뇌종양 동물모델에 이식한 경우， 원발성 종괴의 경계부위를 특이적으로 둘러싸고 종괴 내부로 공여세포가 침투하는 양상을 보이며， 주위 신경조직으로 전이되는 종양세포를 따라 밀착되어 역시 특이적으로 이주함을 보임을 확인하였다. 또한 AdaMDM2-LacZ에 감염된 인간 신경줄기세포가 생체 내에서 aMDM2를 잘 발현하여 종양세포의 사멸을 유도하고， 손상된 신경세포를 재생함으로써, 원발성, 속발성 또는 전이된 난치성 뇌종양 치료에 사용될 수 있음을 확인하였다. 실시예 8: 신경교모세포종 동물모델에 ffMDM2 발현 인간 신경줄기세포의 이식 후 종양 크기의 감소
CAG프로모터에 의해 aMDM2를 발현하는 인간 신경줄기세포의 이식 후 종양크기의 감소 정도를 정량적으로 알아보기 위하여， 상기 실시예 <3-2>에서와 같이, 비흉선 누드 마우스의 오른쪽 선조체 부위에 종양세포와 aMDM2를 발현하는 인간 신경줄기세포를 함께 이식하였다. 이때 이식한 인경 신경줄기세포는 다음과 같이 준비하였다. 신경구 상태로 배양하던 인간 신경줄기세포를 이식 3일 전 0.05% 트립신 /EDTA(Gibco)를 처리하여 새 배양 플레이트에서 단일세포 상태로 플레이팅하였다. 1시간이 지난 후 목적하는 바이러스를 각각의 신경줄기세포에 감염시켰다. 24시간 후 N2 배지로 세포를 1회 세척하고， 성장인자 첨가된 N2 배지에서 2일간 더 배양하였다. 이식을 위하여 0.0 트립신 /EDTA(Gibco)를 처리하여 단일세포로 만들었다. 이후, H-H 완충용액으로 3회 세척하였다. 0.05% 트립판 블루로 세포를 염색하고， 이식할 때까지 얼음에 보관하였다.
뇌종양모델에 이식한 신경줄기세포는 다음과 같다. 10 MW의 AdaMDM2-
LacZ 바이러스에 감염된 인간 신경줄기세포 (IX 105cells/2 (U87MG와 함께 이식한 경우), 6x 105cells/4^(U373MG와 함께 이식한 경우))를 종양세포와 섞어서 이식하였으며 (U87MG(n=7), U373MG(n=ll))， 대조군에서는 부형제 (H-H buffer)
2~4 ^와 종양세포를 섞어서 이식하였다 (U87MG(n=7), U373MG(n=8)) . 14일 후， 모든 실험군 및 대조군에서 평균 종양용적을 다음과 같이 측정하였다. 평균 종양용적을 정량적으로 평가하기 위하여 실험군과 대조군에서 종양을 포함하는 모든 슬라이드를 헤마특실린으로 염색한 후， 종양크기를 메타모르프 이미징 시스템 (MetaMorph Imaging System, Universal Imaging Corporation, PA, USA)을 통해 측정하였다. 이식 14일 후， 실험동물 (마우스)을 4% 파라포름알테하이드 (in 0.1M Pipes buffer)로 고정한 후， 뇌를 적출하였다. 적출된 뇌를 30 % 수크로스 (in PBS)에 침지시켰다. 4°C에서 1-2일간 보관하여 동결보호 (cryoprotection)하고， 16 皿로 동결 절단하였다. 슬라이드에 놓인 각 뇌 조직 절편 간격은 각각 96 izm이었다. 이후, 뇌 조직을 염색할 때까지 -20°C에 보관하였다. 슬라이드를 IX PBS에서
20분간 침수시키고 헤마록실린 용액에서 4분간 염색하였다. 이후, 흐르는 물에 슬라이드를 세척하고, 글리세를 마운팅 배지로 마운팅하였다. 염색한 후 종괴 부위를 포함하는 슬라이드를 명시야 현미경 하에서 100X 배율로 사진을 찍었다. 메타모르프 이미징 시스템을 이용하여 종괴 부위 영역을 지정하고， 지정된 영역의 픽샐 (pixel) 수를 면적으로 환산하였으며， 조직 절편의 두께 (96 j i)를 곱하여 최종 종괴의 부피를 측정하였다ᅳ 모든 실험군 및 대조군에서 이를 수행하여 평균값을 비교 분석하였다. 그 결과， U87MG 신경교모세포종 동물모델에서 대조군의 평균 종양용적은 0.375 睡 3 인 반면， aMDM2를 발현하는 신경줄기세포를 함께 이식한 실험군의 평균 종양용적은 0.002 mm3 이었다. 또한 U373MG 신경교모세포종 동물모델에서 대조군의 평균 종양용적은 0.046 隱 3 인 반면， «MDM2를 발현하는 신경줄기세포를 함께 이식한 실험군의 평균 종양용적은 0.021 mm3 이었다. 대조군의 종양용적을 100% 로 환산한 결과, aMDM2 발현 세포 이식군의 종양용적은 U87MG 이식 동물모델에서 0.5 土 0.03%(mean土 SEM), U373MG 이식 동물모델에서 46.7 土
5.60%(mean土 SEM) 이었다 (두 실험군 모두 대조군과 비교하여， < 0.01； Kruskal-
Wallis test). 따라서 aMDM2 발현 신경줄기세포를 이식하는 경우 대조군에 비교하여 효과적으로 뇌종양 용적을 감소시켰다 (도 17 참조).
실시예 9: 신경교모세포종 동물모델에 gMDM2 발현 인간 신경줄기세포의 이식 후 생존의 증가
CAG프로모터에 의해 aMDM2를 발현하는 인간 신경줄기세포의 이식 후 동물모델의 생존증가를 확인하기 위하여， 상기 실시예 8에서와 같이, 비흉선 누드 마우스의 오른쪽 선조체 부위에 종양세포와 aMDM2를 발현하는 인간 신경줄기세포를 함께 이식하였다.
10 M()I의 AdaMDM2-LacZ 바이러스에 감염된 인간 신경즐기세포(1 <10^6113/2^)를 U87MG(lx 105cel ls/2 )와 섞어서 이식하였으며 (n=5), 대조군에서는 부형제 (H-H buffer) 2/^와 종양세포를 섞어서 이식하였다 (n=9).
상기 실험 동물은 120일 이상 동안 관찰되었다. 실험동물의 체중이 일주일 사이 20% 이상 감소한 경우 실시예 8에서와 같이 4% 파라포름알데하이드 (in 0.1M Pipes buffer)로 고정한 후, 뇌를 적출하였으며 이를 사망일로 계산하였다. 그 결과, U87MG 신경교모세포종 동물모델에서 대조군의 평균 생존일은 52일인 반면， 실험군의 평균 생존일은 142일 이었다. 사망한 실험 실험 동물의 뇌를 헤마록실린 염색 하에서 관찰한 결과, 이식한 뇌의 대부분을 종괴가 차지하고 있는 것을 관찰하였다 (결과 미도시). 실험군의 동물들은 142일 관찰시까지 사망이 관찰되지 않았고， 이들을 상기 실시예 8에서와 같이 뇌를 적출 한 후 헤마록실린 염색하에서 이식 부위를 관찰한 결과 종괴가 발견되지 않았다 (결과 미도시). 생존 함수는 카플란-마이어 (Kaplan-Meier) 생존분석으로 나타내었으며， 생존자료의 후반부， 초반부 및 전 기간의 통계적 유의성을 확인하는 로그 탱크 (Rog rank), 브레스로우 (Breslow), 타론 -웨어 (Tar one-Ware) 테스트에서 모두 *p < 0.01을 보임으로써， aMDM2를 발현하는 신경줄기세포의 이식에 의한 뇌종양 실험동물의 생존 증가가 유의함을 확인하였다 (도 18 참조). 이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바， 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서， 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.
【수탁번호】
기탁기관명 ： 한국생명공학연구원
수탁번호 ： KCTC11370
수탁일자 ： 20080724
부다테스트 조^
^제 서식
규칙 7: 1에 ≤i .t
원기 ^에 대한 수
To; '박국안
대^ ¾국 서들시 서대물추 성^동 250 연세.대학교 의：라대학 io†:라교실: 438호 (120-752
Figure imgf000058_0001

Claims

【청구의 범위】
【청구항 1】
p53 단백질에 대한 MDM2(murine double minute 2) 단백질의 결합을 억제하는 펩타이드 억제제를 코딩하는 핵산분자를 포함하는 인간 성체줄기세포.
【청구항 2]
제 1 항에 있어서， 상기 펩타이드 억제제는 하기 일반식 I， 일반식 II， 일반식 I， 일반식 W 또는 일반식 V로 표시되는 펩타이드를 최소서열로 포함하는 것을 특징으로 하는 인간 성체줄기세포:
일반식 I
Phe-Aaai-Aaa2-Leu-Trp
상기 일반식 I에서， Aaal 및 Aaa2는 서로 독립적으로 Gly, Ala, Val, Ser, Tyr , Pro, Asp, Glu, Thr , Met , lie, Leu, Phe, His, Lys, Arg, Cys, Asn, Gin 또는 Trp이다;
일반식 I
Pheᅳ Aaai"Aaa2ᅳ Aaa3_Trpᅳ Aaa4_Aaa5_Aaa6
상기 일반식 I에서, Aaal, Aaa4 및 Aaa5은 서로 독립적으로 Gly, Ala, Val,
Ser, Tyr, Pro, Thr, Met, He, Leu, Phe, Arg, Cys, Asn또는 Gin이고， ^ 는 Arg, His, Glu, Asp, Cys 또는 Ser이며， Aaa3는 His, Phe 또는 Tyr이며， Aaa6은 Phe, Gin 또는 Leu이고;
일반식 Π
Aaa厂 Aaa2— Phe_Aaa3_Aaa4— Aaa5_Trp-Aaa6_Aaa7_Aaa8
Aaar Pro, Leu, Glu, Cys 또는 Gin이고， Aaa2, Aaa3, Aaa6 및 Aaa7은 Gly, Ala,
Val, Ser, Tyr, Pro, Thr, Met, lie, Leu, Phe, Arg, Cys, Asn 또는 Gin이며，
Aaa4는 Arg, His, Glu, Asp, Cys 또는 Ser이고， Aaa5는 His, Phe 또는 Tyr이며, Aaa8은 Phe, Gin또는 Leu이고;
일반식 W
Phe-Aaal-Aaa2-Aaa3-Trp-Aaa4-Aaa5-Aaa6
Aaar8: Met, He, Thr, Arg, Ala 또는 Ser이고， Aaa2는 Arg, His, Glu, Asp, Cys 또는 Ser이고， Aaa3는 His, Phe 또는 Tyr이며， Aaa4는 Glu, Thr, Ala, Phe 또는 Ser이고， Aaa5는 Gin, Thr, Ala, Asp또는 Gly이며， Aaa6은 Phe, Gin또는 Leu이고;
일반식 V
Aaal-Phe-Aaa2~Aaa3"Aaa4- rp-Aaa5~Aaa6_Aaa7
Aaar8: Arg, Asn, Ala, Thr 또는 Val이고, Aaa2은 Met, lie, Thr, Arg, Ala 또는 Ser이고, Aaa3는 Arg, His, Glu, Asp, Cys 또는 Ser이고， Aaa4는 His, Phe 또는 Tyr이며， Aaa5는 Glu, Thr, Ala, Phe 또는 Ser이고， Aaa6는 Gin, Thr, Ala, Asp 또는 Gly이며， 37는 Phe, Gin또는 Leu이다.
【청구항 3】
제 2 항에 있어서, 상기 펩타이드 억제제는 상기 일반식 I로 표시되는 펩타이드를 최소 서열로 포함하는 것을 특징으로 하는 인간 성체줄기세포.
【청구항 4]
제 3 항에 있어서， 상기 펩타이드 억제제는 서열목록 게 1서열 또는 제 2서열의 아미노산 서열을 가지는 것을 특징으로 하는 인간 성체줄기세포.
【청구항 5】
제 1 항에 있어서, 상기 펩타이드 억제제를 코딩하는 핵산분자는 바이러스 백터에 탑재되어 인간 성체줄기세포에 형질전환된 것을 특징으로 하는 인간 성체줄기세포.
【청구항 6】
제 5 항에 있어서， 상기 바이러스 백터는 레트로바이러스 백터， 아데노바이러스 백터, 허피스 바이러스 백터， 아비폭스바이러스 백터 또는 렌티바이러스 백터인 것을 특징으로 하는 인간 성체줄기세포.
【청구항 7】
제 1 항에 있어서， 상기 펩타이드 억제제는 분비신호서열이 추가적으로 결합되어 있고 상기 인간 성체줄기세포는 상기 펩타이드 억제제를 분비하는 것을 특징으로 하는 인간 성체줄기세포.
【청구항 8】
제 1 항에 있어서， 상기 펩타이드 억제제는 PTD(protein transduction domain)이 추가적으로 결합되어 있는 것을 특징으로 하는 인간 성체줄기세포.
【청구항 9]
제 1 항에 있어서, 상기 펩타이드 억제제 코딩 핵산분자는 CAG 프로모터에 의해 발현 조절되는 것을 특징으로 하는 인간 성체줄기세포.
[청구항 10】
제 1 항에 있어서， 상기 인간 성체줄기세포는 인간 신경줄기세포， 인간 간엽줄기세포， 인간 연골줄기세포， 인간 조혈줄기세포 또는 인간 간줄기세포인 것을 특징으로 하는 인간 성체줄기세포.
【청구항 Π]
제 1 항에 있어서， 상기 인간 성체줄기세포는 인간 신경줄기세포인 것을 특징으로 하는 인간 성체줄기세포.
【청구항 12] 제 1 항 내지 제 11 항 중 어느 한 항의 인간 성체줄기세포를 포함하는 과다증식 질환 (hyperproliferative disease)의 예방 또는 치료용 약제학적 조성물.
【청구항 13】
제 12 항에 있어서, 상기 과다증식 질환은 종양， 암， 고감마글로불린혈증, 림프증식성 질환， 이상단백혈증， 자반병, 유육종증， 세자리 증후군 (Sezary Syndrome) , 발덴스트론 (Waldenstron)， 매크로글로불린혈증, 고셔병 (Gaucher ' s disease) 또는 조직구증식증인 것을 특징으로 하는 약제학적 조성물.
【청구항 14】
제 13 항에 있어서， 상기 과다증식 질환은 종양 또는 암인 것을 특징으로 하는 약제학적 조성물.
【청구항 15】
제 14 항에 있어서， 상기 종양 또는 암은 신경교종, 뇌수막종， 뇌하수체선종， 수아세포종， 전이성 뇌종양， 청신경초종， 전립선암， 악성 혹색종 및 신경아세포종으로 이루어진 군에서 선택되는 어느 하나인 것을 특징으로 하는 약제학적 조성물.
【청구항 16]
제 1 항 내지 제 n 항 중 어느 한 항의 인간 성체줄기세포를 포함하는 약제학적 조성물을 필요로 하는 대상 (subject)에 투여하는 단계를 포함하는 과다증식 질환 (hyperproHferative disease)의 예방 또는 치료방법.
PCT/KR2011/000329 2010-01-21 2011-01-17 항－ｍｄｍ２를 발현하는 인간 성체줄기세포 및 그의 용도 WO2011090297A2 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020100005723A KR101220516B1 (ko) 2010-01-21 2010-01-21 항－ｍｄｍ２를 발현하는 인간 성체줄기세포 및 그의 용도
KR10-2010-0005723 2010-01-21

Publications (2)

Publication Number Publication Date
WO2011090297A2 true WO2011090297A2 (ko) 2011-07-28
WO2011090297A3 WO2011090297A3 (ko) 2011-12-29

Family

ID=44307376

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2011/000329 WO2011090297A2 (ko) 2010-01-21 2011-01-17 항－ｍｄｍ２를 발현하는 인간 성체줄기세포 및 그의 용도

Country Status (2)

Country Link
KR (1) KR101220516B1 (ko)
WO (1) WO2011090297A2 (ko)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8859723B2 (en) 2010-08-13 2014-10-14 Aileron Therapeutics, Inc. Peptidomimetic macrocycles
US8889632B2 (en) 2007-01-31 2014-11-18 Dana-Farber Cancer Institute, Inc. Stabilized p53 peptides and uses thereof
US8927500B2 (en) 2012-02-15 2015-01-06 Aileron Therapeutics, Inc. Peptidomimetic macrocycles
US8987414B2 (en) 2012-02-15 2015-03-24 Aileron Therapeutics, Inc. Triazole-crosslinked and thioether-crosslinked peptidomimetic macrocycles
US9096684B2 (en) 2011-10-18 2015-08-04 Aileron Therapeutics, Inc. Peptidomimetic macrocycles
US9604919B2 (en) 2012-11-01 2017-03-28 Aileron Therapeutics, Inc. Disubstituted amino acids and methods of preparation and use thereof
US10023613B2 (en) 2015-09-10 2018-07-17 Aileron Therapeutics, Inc. Peptidomimetic macrocycles as modulators of MCL-1
US10253067B2 (en) 2015-03-20 2019-04-09 Aileron Therapeutics, Inc. Peptidomimetic macrocycles and uses thereof
US10301351B2 (en) 2007-03-28 2019-05-28 President And Fellows Of Harvard College Stitched polypeptides
US10471120B2 (en) 2014-09-24 2019-11-12 Aileron Therapeutics, Inc. Peptidomimetic macrocycles and uses thereof
US10905739B2 (en) 2014-09-24 2021-02-02 Aileron Therapeutics, Inc. Peptidomimetic macrocycles and formulations thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996002642A1 (en) * 1994-07-20 1996-02-01 University Of Dundee INTERRUPTION OF BINDING OF MDM2 AND p53 PROTEIN AND THERAPEUTIC APPLICATION THEREOF

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996002642A1 (en) * 1994-07-20 1996-02-01 University Of Dundee INTERRUPTION OF BINDING OF MDM2 AND p53 PROTEIN AND THERAPEUTIC APPLICATION THEREOF

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
CHENE ET AL.: 'Inhibition of the p53-MDM2 interaction: targeting a protein-protein interface' MOLECULAR CANCER RESEARCH vol. 2, 2004, pages 20 - 28 *
MENG ET AL.: 'Brain transplantation of genetically engineered human neural stem cells globally corrects brain lesions in the mucopolysaccharidosis Type VII Mouse' JOURNAL OF NEUROSCIENCE RESEARCH vol. 74, 2003, pages 266 - 277 *

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9527896B2 (en) 2007-01-31 2016-12-27 Dana-Farber Cancer Institute, Inc. Stabilized p53 peptides and uses thereof
US8889632B2 (en) 2007-01-31 2014-11-18 Dana-Farber Cancer Institute, Inc. Stabilized p53 peptides and uses thereof
US10301351B2 (en) 2007-03-28 2019-05-28 President And Fellows Of Harvard College Stitched polypeptides
US9957299B2 (en) 2010-08-13 2018-05-01 Aileron Therapeutics, Inc. Peptidomimetic macrocycles
US8859723B2 (en) 2010-08-13 2014-10-14 Aileron Therapeutics, Inc. Peptidomimetic macrocycles
US10308699B2 (en) 2011-10-18 2019-06-04 Aileron Therapeutics, Inc. Peptidomimetic macrocycles
US9522947B2 (en) 2011-10-18 2016-12-20 Aileron Therapeutics, Inc. Peptidomimetic macrocycles
US9096684B2 (en) 2011-10-18 2015-08-04 Aileron Therapeutics, Inc. Peptidomimetic macrocycles
US10213477B2 (en) 2012-02-15 2019-02-26 Aileron Therapeutics, Inc. Peptidomimetic macrocycles
US8987414B2 (en) 2012-02-15 2015-03-24 Aileron Therapeutics, Inc. Triazole-crosslinked and thioether-crosslinked peptidomimetic macrocycles
US10227380B2 (en) 2012-02-15 2019-03-12 Aileron Therapeutics, Inc. Triazole-crosslinked and thioether-crosslinked peptidomimetic macrocycles
US8927500B2 (en) 2012-02-15 2015-01-06 Aileron Therapeutics, Inc. Peptidomimetic macrocycles
US9505804B2 (en) 2012-02-15 2016-11-29 Aileron Therapeutics, Inc. Peptidomimetic macrocycles
US9845287B2 (en) 2012-11-01 2017-12-19 Aileron Therapeutics, Inc. Disubstituted amino acids and methods of preparation and use thereof
US9604919B2 (en) 2012-11-01 2017-03-28 Aileron Therapeutics, Inc. Disubstituted amino acids and methods of preparation and use thereof
US10669230B2 (en) 2012-11-01 2020-06-02 Aileron Therapeutics, Inc. Disubstituted amino acids and methods of preparation and use thereof
US10471120B2 (en) 2014-09-24 2019-11-12 Aileron Therapeutics, Inc. Peptidomimetic macrocycles and uses thereof
US10905739B2 (en) 2014-09-24 2021-02-02 Aileron Therapeutics, Inc. Peptidomimetic macrocycles and formulations thereof
US10253067B2 (en) 2015-03-20 2019-04-09 Aileron Therapeutics, Inc. Peptidomimetic macrocycles and uses thereof
US10023613B2 (en) 2015-09-10 2018-07-17 Aileron Therapeutics, Inc. Peptidomimetic macrocycles as modulators of MCL-1

Also Published As

Publication number Publication date
KR101220516B1 (ko) 2013-01-10
WO2011090297A3 (ko) 2011-12-29
KR20110085765A (ko) 2011-07-27

Similar Documents

Publication Publication Date Title
KR101220516B1 (ko) 항－ｍｄｍ２를 발현하는 인간 성체줄기세포 및 그의 용도
US11944642B2 (en) Compositions of functional mitochondria and uses thereof
US7998472B2 (en) CD34 stem cell-related methods and compositions
Cho et al. Enhancement of MSC adhesion and therapeutic efficiency in ischemic heart using lentivirus delivery with periostin
US20110190730A1 (en) Methods of inducing pluripotency involving oct4 protein
KR101702629B1 (ko) 체세포로부터 혈관 전구 세포로의 직접교차분화 유도용 조성물 및 이의 용도
WO2008120832A1 (en) Human neural stem cell secreting a smac, preparation method and use thereof
US8895303B2 (en) Method of cell culture and method of treatment comprising a vEPO protein variant
EP2714896B1 (en) An adult stem cell line introduced with hepatocyte growth factor gene and neurogenic transcription factor gene with basic helix-loop-helix motif and uses thereof
Schofield et al. Tumour suppression associated with expression of human insulin-like growth factor II
KR100814066B1 (ko) Ｔｒａｉｌ을 분비하는 인간의 신경줄기세포, 이의제조방법 및 용도
CN113018424B (zh) Cst1在预防和/或治疗肝脏免疫失调疾病中的应用
KR100808269B1 (ko) Ｃａｇ 프로모터를 포함하는 아데노바이러스용 재조합 셔틀벡터
CA2558436A1 (en) Method of proliferating precursor cells
RU2720376C1 (ru) Генотерапевтический ДНК-вектор на основе генотерапевтического ДНК-вектора VTvaf17, несущий целевой ген, выбранный из группы генов IL11, LIF, DICER, HOXA10, WT1, для повышения уровня экспрессии этих целевых генов, способ его получения и применения, штамм Escherichia coli SCS110-AF/VTvaf17-IL11, или Escherichia coli SCS110-AF/VTvaf17-LIF, или Escherichia coli SCS110-AF/VTvaf17-DICER, или Escherichia coli SCS110-AF/VTvaf17-HOXA10, или Escherichia coli SCS110-AF/VTvaf17-WT1, несущий генотерапевтический ДНК-вектор, способ его получения, способ производства в промышленных масштабах генотерапевтического ДНК-вектора
KR20090056968A (ko) Ｓｍａｃ을 분비하는 인간 신경줄기세포, 이의 제조방법 및용도
Kojima et al. Gene transfer to sperm and testis: future prospects of gene therapy for male infertility
US20020031493A1 (en) Recombinant adenoviruses coding for glial-derived cell neurotrophic factor (gdnf)
KR100492017B1 (ko) 인간 간엽줄기 세포를 이용한 항암치료방법
WO2017167209A1 (zh) 分泌trail的间充质干细胞及其治疗脑瘤的用途
CN116648456A (zh) 制备具有增加的植入能力的干细胞的方法
KR20180079033A (ko) Igf-1 및 il-10을 분비하는 세포, 및 이의 용도
Lin et al. A Plasmid vector encoding functional human keratinocyte growth factor gene in vitro—Functional human KGF gene expression in vitro
Qiu et al. A Plasmid vector encoding functional human keratinocyte growth factor gene in vitro
JPH08508014A (ja) オリゴデンドログリア増殖因子およびその利用法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11734846

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11734846

Country of ref document: EP

Kind code of ref document: A2