WO2011065677A2 - 암 치료용 약학 조성물 - Google Patents
암 치료용 약학 조성물 Download PDFInfo
- Publication number
- WO2011065677A2 WO2011065677A2 PCT/KR2010/007600 KR2010007600W WO2011065677A2 WO 2011065677 A2 WO2011065677 A2 WO 2011065677A2 KR 2010007600 W KR2010007600 W KR 2010007600W WO 2011065677 A2 WO2011065677 A2 WO 2011065677A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- sequence
- sirna
- flj25416
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/711—Natural deoxyribonucleic acids, i.e. containing only 2'-deoxyriboses attached to adenine, guanine, cytosine or thymine and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/50—Physical structure
- C12N2310/53—Physical structure partially self-complementary or closed
- C12N2310/531—Stem-loop; Hairpin
Definitions
- the present invention binds complementarily to the FLJ25416 transcript (mRNA) sequencing and inhibits the expression of FLJ25416 in the cell (small interfering RNA), antisense RNA ntisense RNA that inhibits the expression of FLJ25416, and / or FLJ 2 It relates to a pharmaceutical composition for treating cancer comprising DNA (Deoxyr ibonucleic acid) encoding shRNA (short hairpin RNA) that inhibits the expression of 5416.
- mRNA FLJ25416 transcript
- small interfering RNA small interfering RNA
- shRNA short hairpin RNA
- the FLJ25416 gene (NCBI GenBank Access No .: ⁇ _145018) is a gene for hypothetical protein and has been known to be related to cancer recently (Korean Patent Publication No. 10—2009-0060183).
- RNAi Ribonucleic acid mediated interference
- mRNA transcript Ribonucleic acid mediated interference
- siRNA drugs using ribonucleic acid mediated interference
- protein and antibody drugs have difficulty in production due to complex manufacturing processes
- siRNAs are relatively easy to mass-produce due to the ease of synthesis and separation and purification, and have higher storage stability than protein drugs due to the characteristics of nucleic acid materials. have.
- unlike conventional drugs it is known to have several advantages, such as being able to antagonize specific molecular targets only.
- the first consideration in the treatment with siRNA is to select the optimal sequence having the largest activity in the target base sequence.
- the efficiency of ribonucleic acid mediated interference is known to have a significant effect on the specific binding site to the target transcript.
- siRNA determined by in silico method using computer algorithm can effectively inhibit target ribonucleic acid in real cells and in vivo.
- siRNA Although the requirement for siRNA to complementarily bind to target transcripts is undermined, several factors have yet to be identified, such as ribonucleic acid and protein stability, intracellular location, and the status of proteins involved in ribonucleic acid-mediated interference. Are known to be involved in determining the efficiency of ribonucleic acid mediated interference phenomena. Therefore, it is necessary to perform a technique for selecting a target sequence per transcript of a gene and selecting a sequence of optimal positions having excellent expression suppression efficacy among these candidate groups.
- An object of the present invention is to bind complementary to the FLJ25416 transcript (mRNA) sequencing to inhibit the expression of FLJ25416 in the cell (sinan interfering RNA), antisense RNA, and / or shRNA (short hairpin) It is to provide a pharmaceutical composition for treating cancer comprising DNA (Deoxyribonucleic acid) encoding RNA and the same.
- mRNA FLJ25416 transcript
- shRNA short hairpin
- the present invention relates to a small interfering ribonucleic acid (SIRNA), FLJ25416, which binds to the FLJ25416 transcript (mRNA transcript) sequence of SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 7 to complement the expression of FLJ25416 in cells.
- SIRNA small interfering ribonucleic acid
- SIRNA small interfering ribonucleic acid
- FLJ25416 which binds to the FLJ25416 transcript (mRNA transcript) sequence of SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 7 to complement the expression of FLJ25416 in cells.
- mRNA transcript FLJ25416 transcript sequence of SEQ ID NO: 3, SEQ ID NO: 5, or SEQ
- the siRNA in the composition of the present invention may include only one s iR A to selectively bind to only one sequence position of the transcript (mRNA) of FLJ25416, and may include two or more siRNAs to target at one or more sequence positions. It may also include.
- siRNA having a sense sequence of SEQ ID NO: 13 and an antisense sequence of SEQ ID NO: 14 siRNA having a sense sequence of SEQ ID NO: 17 and an antisense sequence of SEQ ID NO: 18, and a sense sequence of SEQ ID NO: 21, and At least one siRNA having an antisense sequence of SEQ ID NO: 22.
- the term 'siRNA' refers to rapid degradation by nucleic acid enzymes in vivo. It includes a structurally modified siRNA to prevent.
- siRNA has a double-stranded structure, which is relatively more stable than single-stranded ribonucleic acid or antisense oligonucleotide. You can. Methods of structural modification of siRNA to ensure that it is stable and resistant to easy degradation are well known to those skilled in the art.
- the siRNA may be structurally modified, preferably the siRNA is a siRNA that is structurally modified by at least one selected from a 2'_0_ methyl modification, a 2'-F modification, an amino modification, or a cholester conjugate. .
- the 2'-0_methyl formula means modified to contain methoxy group instead of hydroxyl group at 2 'position of ribose, and the 2'-F formula is fluorine instead of hydroxyl group at 2' position of ribose. It means what was modified to contain group.
- the amino modification means that the nucleosilamino group is substituted in the 5 'hydroxyl group of the sense sequence in the siRNA sequence, the cholester conjugate is a cholester to the 5' hydroxyl group of the sense sequence in the siRNA sequence It means conjugated. Modification of these siRNAs increases the stability of the enzymes present in the cell and may increase the affinity for the target niRNAs. It can also increase intracellular delivery.
- Ribonucleic acid is stabilized with resistance to nucleases by structural modification by the chemical modification method, etc., and increases the pharmacokinetic residence time in vivo and increases its effectiveness.
- the antisense RNA may include only one antisense RNA so as to selectively bind to only one sequence position of the transcript (mRNA) of FU25416, and may include two or more antisense RNAs to target at one or more sequence positions. You may.
- antisense RNA examples include antisense RNA having a sequence of SEQ ID NO: 14, At least one selected from an antisense RA having a sequence of SEQ ID NO: 18, and an antisense RNA having a sequence of SEQ ID NO: 22.
- the term 'antisense RNA' refers to a single-stranded RNA consisting of antisense sequences, wherein the antisense oligonucleotide binds to the target and stops expression at the transcriptional, translational, or splicing stage by the DNA or RNA target. It has been proposed to prevent the expression of the encoded protein. Structurally modified antisense RNA to prevent rapid degradation by nucleases in vivo. One skilled in the art can synthesize and modify the antisense RNA in a desired manner using methods known in the art (European Journal of Biochemistry. 2003; 270: 1628-1644. Methods Enzymo 1.2000: 313, 3-45. ).
- the DNA encoding the shRNA may include only one DNA to selectively bind to only one sequence position of the transcript (m NA) of FLJ25416, and may include two or more targets to target more than one sequence position. It may also contain DNA.
- the term 'shRNA' is a single-stranded RNA having a length of 45 to 70 nucleic acids having a short hairpin generated in the cell, and is converted into siRNA by intracellular Dicer to show an R Ai effect.
- Designing and synthesizing DNA having a structure in which a sense sequence and an antisense sequence of siRNA sequences are connected by 3-10 base linkers (loop sequences) and cloning the plasmid vector or shRNA are retroviruses lentiviruses and Insert into adenovirus and use.
- nucleic acid delivery system In addition to structural modifications, a safe and efficient delivery system is required to increase the intracellular delivery efficiency of nucleic acid materials such as siRNA.
- siRNA, antisense RNA, DNA, shRNA encoded by the DNA of the present invention may be included in the composition with a nucleic acid delivery system (nucleic acid delivery system).
- Nucleic acid carriers for delivering nucleic acid substances such as siRNA into cells can be largely divided into viral and non-viral vectors. The most widely used is This is due to the high efficiency and long duration of delivery to the viral vector.
- retroviral vectors, adenoviral vectors, and adeno-associated viral vectors are mainly used.
- Nonviral vectors have low toxicity and immune response, can be repeatedly administered, easy to form complexes with ribonucleic acid, and easy to mass-produce.
- ligands specific to diseased cells or tissues are conjugated to non-viral vectors to enable long-term cell selective nucleic acid delivery.
- nucleic acid carriers can significantly enhance the transport efficiency of the desired nucleic acid in the animal cell and can be delivered to any animal cell depending on the purpose of use of the nucleic acid to be delivered.
- the nucleic acid carrier may be at least one selected from cationic liposomes or cationic polymers.
- Nucleic acid carriers in the compositions of the present invention having a formulation of cationic liposomes, cationic polymers, etc. have a positive charge, and thus are electrostatically bonded by a simple mix by positive charge of the nucleic acid carrier and negative ionic charge of the nucleic acid such as siRNA. By forming a complex between the nucleic acid carrier and the nucleic acid.
- siRNA small hairpin RNA
- shRNA small hairpin RNA
- US Patent Publication Nos. 20040106567 and 20040086884 describe many expressions as well as delivery mechanisms including viral vectors, nonviral vectors, liposome delivery vehicles, plasmid injection systems, artificial viral envelopes, and polylysine conjugates. It provides a constructor / vector.
- composition of the present invention may further comprise a pharmaceutically acceptable carrier.
- suitable pharmaceutically acceptable carriers include, for example, one or more water, saline, phosphate buffered saline, textine, glycerol, ethanol as well as combinations thereof.
- Such compositions may be formulated to provide fast release, or sustained or delayed release of the active ingredient after administration.
- the siRNA of the present invention or a complex of siRNA with a nucleic acid carrier can be introduced into cells for the treatment of cancer.
- the introduction of the siRNA of the present invention or a complex of the siRNA and the nucleic acid carrier in the cell inhibits the expression of FLJ25416 involved in the generation of cancer, thereby killing the cancer cells.
- the cancer is preferably at least one selected from lung cancer, cervical cancer, colon cancer, stomach cancer, and liver cancer (see Korean Patent Publication No. 10-2009-0060183).
- the expression of FLJ25416, which is a target protein, is selectively reduced or the mutation of the target gene is modified to overload FLJ25416.
- the cancer caused by the expression can be treated.
- the therapeutically effective amount of the siRNA, antisense RNA, shRNA coding DNA or a complex of each nucleic acid and nucleic acid carrier means an amount required for administration in order to expect a cancer therapeutic effect. Therefore, the type of disease, the severity of the disease, the type of nucleic acid administered, the type of dosage form, the age of the patient, the weight, general health, sex and diet, the time of administration, the route of administration and the duration of treatment, the chemotherapy drug used simultaneously, etc. It can be adjusted according to various factors including the drug.
- composition or siRNA, antisense RNA, and / or shRNA encoding DNA of the present invention may be intravenous, intraarterial, intraperitoneal, intramuscular, intraarterial, intraperitoneal, sternum, transdermal, nasal, inhaled, topical, rectal, oral Or via the intraocular or intradermal route.
- Adults can be administered at a dose of 0.01 ng / kg to 100 rag / kg, for example, once daily, based on siRNA, antisense RNA and shRNA.
- siRNAs of the present invention that bind to complementary to the FLJ25416 transcript (mRNA) sequences of SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 7 to inhibit the expression of FLJ25416 in cells according to the following examples
- SiRNA having a sense sequence of SEQ ID NO: 13 and an antisense sequence of SEQ ID NO: 14 siRNA having a sense sequence of SEQ ID NO: 17 and an antisense sequence of SEQ ID NO: 18, and an siRNA having a sense sequence of SEQ ID NO: 21 and an antisense sequence of SEQ ID NO: 22 has been shown to effectively inhibit the expression of FLJ25416 in particular.
- SEQ ID NO: 14 SEQ ID NO: 18, or SEQ ID NO: 22, which is capable of complementarily binding to the FLJ25416 transcript (mRNA) nucleotide sequence of SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 7 similarly to the siRNA
- Each of the antisense RNAs can also effectively inhibit the expression of FLJ25416, DNA having a nucleotide sequence of SEQ ID NO: 28 encoding a shRNA comprising a sequence of SEQ ID NO: 13 and a sequence of SEQ ID NO: 14, and a sequence and sequence of SEQ ID NO: 17
- a DNA having a nucleotide sequence of SEQ ID NO: 29 encoding a shRNA comprising a sequence of SEQ ID NO: 18, and a nucleotide sequence of SEQ ID NO: 30 encoding a shRNA comprising a sequence of SEQ ID NO: 21 and a sequence of SEQ ID NO: 22 DNA can be converted into RNA in cells to effectively inhibit the expression of FL
- the present invention also inhibits FLJ25416 expression and sense sequence of SEQ ID NO: 13 And siR A having an antisense sequence of SEQ ID NO: 14.
- the invention also provides an siRNA that inhibits FLJ25416 expression and has a sense sequence of SEQ ID NO: 17 and an antisense sequence of SEQ ID NO: 18.
- the invention also provides an siRNA that inhibits FLJ25416 expression and has a sense sequence of SEQ ID NO: 21 and an antisense sequence of SEQ ID NO: 22.
- the present invention also provides antisense RNA that inhibits FLJ25416 expression and has the sequence of SEQ ID NO: 14.
- the invention also provides antisense RNA that inhibits FLJ25416 expression and has a sequence of SEQ ID NO: 18.
- the present invention also provides antisense RNA that inhibits FLJ25416 expression and has the sequence of SEQ ID NO: 22.
- the present invention also provides a DNA having a nucleotide sequence of SEQ ID NO: 28 encoding a shRNA that inhibits FLJ25416 expression.
- the present invention also provides a DNA having a nucleotide sequence of SEQ ID NO: 29 encoding a shRNA that inhibits FU25416 expression.
- the present invention also provides a DNA having a nucleotide sequence of SEQ ID NO: 30 encoding a shRNA that inhibits FLJ25416 expression.
- the siRNA of the present invention may be structurally modified by 2'-0-methyl modification, 2'-F modification, amino modification, or cholesterol conjugate, and may be used in composition with a nucleic acid carrier.
- the present invention also provides the use of siRNA for the preparation of an anticancer agent comprising siRNA, antisense RNA, and / or shRNA coding DNA included in the compositions of the invention described above.
- the present invention also provides a method for introducing a siRNA, antisense RNA, deoxyr ibonucleic acid (DNA) encoding shRNA (short hairpin RNA), shRNA encoded by the DNA, and / or a composition described above into a cell of a subject. It provides a cancer treatment method comprising a.
- Cancer treatment in the present invention includes the prevention and suppression of cancer.
- the FLJ25416 transcript may have a nucleotide sequence of SEQ ID NO: 27 or one or more bases in which the base sequence is deleted, substituted and / or inserted.
- RNAi ribonucleic acid mediated interference
- Figure 1 is an electrophoresis picture showing the results of confirming the effect of inhibiting the expression of FLJ25416 transcripts mediated by siRNA, an embodiment of the present invention in human lung cancer cell line A549.
- Figure 2 is a lung cancer cell line photograph showing the extent of cell growth inhibited by the FLJ25416 expression inhibitory siRNA of the present invention.
- Figure 3 is a photogram showing the degree of inhibition of expression of FLJ25416 transcript by concentration upon treatment of the composition of an embodiment of the present invention.
- Figure 4 is a graph showing the degree of cancer cell growth inhibition by FLJ25416 expression inhibitory siRNA according to an embodiment of the present invention by time zone.
- FIG. 5 is a diagram showing the effect of inhibiting cell growth in cervical cancer cell lines by the structural modified siRNA of an embodiment of the present invention.
- siRNA is an embodiment of the present invention, into a lung cancer cell line.
- Figure 7 is a graph showing the degree of cellular intestinal inhibition after transfection of cervical cancer cells siRNA which is an embodiment of the present invention.
- FIG. 8 is a graph showing the degree of inhibition of FLJ25416 gene expression when the structural siRNA of the embodiment of the present invention is treated in cancer cell lines and normal cell lines.
- FIG. 9 is a graph showing the rate of cell growth inhibition according to the concentration of siRNA in an embodiment of the present invention when treated in lung cancer cell lines.
- 10 is a graph showing the rate of cell growth inhibition according to the concentration of the siRNA that is an embodiment of the present invention in normal cell lines.
- 11 is a graph showing the change in the cell cycle of the lung cancer cell line treated with siRNA, an embodiment of the present invention over time.
- FIG. 12 is a graph showing the change in cell cycle of the cervical cancer cell line treated with siRNA as an embodiment of the present invention over time.
- FIG. 13 and FIG. 14 are graphs showing changes in tumor size according to the passage of time when siRNA, which is an embodiment of the present invention, is administered to a female model nude mouse.
- Target sequence candidate groups to which siRNA can bind in the transcript of FLJ25416 were designed.
- Table 1 is a candidate group of target sequences of siRNA.
- RNA synthesized an RNA of a desired length is repeated by repeating a series of processes of deblocking, coupling, oxidation and capping on a solid support to which nucleotides are attached. A semi-flour containing was obtained.
- RNA Synthesis was carried out using a polygen DNA / RNA Synthesizer using a solid resin and after completion of the synthesis
- the ammonia: ethanol (3: 1) mixed solution was treated with silver to separate the solid resin and the base protecting group was also removed. After drying, the solution was treated with TBAF to deprotect the 2'-TBDMS group, and the solution was applied to HPLC, RNA was isolated and applied to the MALDI-T0F mass spectrophotometer to confirm that it was compatible with the sequence to be synthesized. Confirmed. Then, by combining the sense and antisense RNA strands, each of the desired double-stranded siRNA was prepared.
- siScram (scrambled siRNA) was prepared in the same manner and used as a negative control.
- the siScram is an siRNA for a sequence that has no homology with a human gene, and has no effect on cell proliferation.
- the sequences of the 8 siRNA candidate groups and the sequences of siScram are shown in Tables 2 and 3.
- Example 3 Preparation of a Composition Comprising FLJ25416 Expression-Inhibiting siRNA and Cationic Liposomes Eight complexes of the FLJ25416 expression-inhibiting siRNA synthesized in Example 2 and a cationic liposome delivering the same were prepared.
- HiPerFect transfection Reagents are cationic liposomes.
- QIAGEN The Netherlands
- the composite composition with cationic liposomes was prepared in the same manner for siScram.
- Lung cancer cell line A549 cell line (Seoul National University Cell Line Bank) was cultured with 70% confluency.
- a complex composition of 8 FLJ25416 expression inhibitory siRNAs prepared in Example 3 and a cationic liposome was added to the cultured lung cancer cell lines.
- the final concentration of siRNA contained in the culture medium was adjusted to 50 nM. These were slowly mixed by pipetting and left for 20 minutes at room temperature, and the complexes thus prepared were added to a well plate and incubated for 72 hours in a C0 2 cell incubator at 37 ° C.
- RNA Ribonucleic acid
- Trizol reagent Invitrogen, Carlsbad, CA, USA
- this ribonucleic acid is replaced with a one-step RT-PCR PreMix kit (iNtR0N Biotechnology, INC).
- the sequences of FLJ25416 specific primers used for polymerase chain reaction were 5-cagaagccctattgtatctgg_3 (N-terminal primer), 5-ct tgcagcagt tgtgtgt t acgaa-3 (C-terminal primer).
- 1 to 2 show the results of the FLJ25416 expression inhibitory siRNA mediated FLJ25416 transcript expression inhibitory efficacy in human lung cancer cell line A549.
- 1 is a representative electrophoresis picture showing the expression level of the FLJ25416 transcript
- Figure 2 is a picture taken the degree of cell growth inhibition of cells. 1 and 2, NT is a control group not treated with siRNA, SC is a negative control siScram treatment group, 3-1 to 3-8 shows a complex treatment group from Examples 3-1 to 3-8.
- GPDH ' refers to the standard gene for determining the difference in gene expression with Glyceraldehyde 3-phosphate dehydrogenase
- the control group (NT) was untreated group, the expression of the FLI25416 transcript was observed, the negative control group (SC) was the scrambled siRNA treatment group showed no change in the expression of the FLJ25416 transcript compared to the control group, and the complex treatment group of Examples 3-1 to 3-8 compared with the control group.
- Various expression inhibition effects were shown. Among them, the expression of FLJ25416 transcript was significantly decreased in the complex treatment group of Examples 3-3 and 3-7 (FIG. 1).
- FIG. Figure 3 is a routine photograph showing the degree of inhibition of expression of FLJ25416 transcripts by concentration in the complex treatment group of Examples 3-1, 3-3, 3-5, 3-7.
- 0 nM represents an untreated group
- SC represents a negative control group
- GAPDH represents a standard gene for determining the difference in gene expression with glyceraldehyde 3 phosphate dehydrogenase.
- the complex treatment group of 3-3, 3-5, 3-7 has excellent mRNA knockdown effect even at 5 nM.
- Example 6 Evaluation of cancer cell growth inhibitory effect of FLJ25416 expression inhibitory siRNA over time
- the degree of cell growth inhibition was measured by time.
- the experimental method is specifically as follows.
- Lung cancer cell line A549 cell line (Seoul National University Cell Line Bank) was cultured with 70% confluency.
- a complex composition of 8 FLJ25416 expression inhibitory siRNAs prepared in Example 3 and a cationic liposome was added to the cultured lung cancer cell lines.
- the final concentration of siRNA contained in the culture medium was adjusted to 50nM. These were slowly mixed by pipetting and left for 20 minutes at room temperature, and the complexes thus prepared were added to a well plate and incubated for 72 hours in a C0 2 cell incubator at 37 ° C.
- the cells were stained with SRB (Sulfur rhodamine, Sigma Co.) and the growth inhibition of cancer cells by siRNA was examined by measuring the number of cells stained with SRB.
- SRB analysis method is as follows. 4% Formaldehyde was added to the plate for culturing the cells, and the cells were fixed at room temperature for 30 minutes, and then washed three times with distilled water and dried. 0.43 ⁇ 4) SRB (sulforhodamine B) (Sigma, S-9012) solution (1% acetic acid solution) is added to the fixed cells and stained for 30 minutes at room temperature.
- FIG. Figure 4 is a graph showing the extent of cancer cell growth inhibition by FLJ25416 expression inhibition siRNA by time zone.
- cancer cell growth inhibition was increased with time, and in the 3-5 complex treatment group, cell growth inhibition was 25.5% when treated for 72 hours.
- the complex treatment group of 3-7 28.4% at 24 hours, 29.4% at 48 hours, and 37.8% at 72 hours were found to have high cell growth inhibitory effects.
- the siRNA of Example 2-7 contained in the composition of Example 3-7 most effectively inhibited cell growth.
- Example 7 Preparation of a Modified SiRNA and a Composition Comprising the SiRNA and Cationic Liposomes
- Modified siRNA was synthesized as follows by performing structural modification on siRNA, which is siRNA having a large effect of inhibiting cancer cell growth.
- Structural modification was carried out by Samchully Pharmaceutical (Korea). Specifically, (1) Cholesterol conjugated siRNA introducing cholester group at 5 'position introduced cholesterol group at 5' position of sense sequence, and (2) 2'- In the case of 0-Me siRNA, 2'_0_Me was introduced into purine nucleosdie of sense and antisense sequences, and (3) Amino modi f icat ion which introduced amino group at 5 'position introduced amino group at 5' position of sense sequence. 4) In the case of 2'-F siRNA, 2'-F was introduced into all pyrimidines of the sense and antisense sequences. Example 2-7 by modifying the structure of siRNA as described above to prepare a structural modification siRNA ⁇ 7 (l) ⁇ 7 (4) ⁇ . Detailed sequence information is as follows.
- Example 8 Confirmation of in vitro effects of structurally modified siRNA
- Each of the compositions comprising the structurally modified siRNA (5 nM) (Examples 7-1 to 7-4) and the compositions comprising the siRNAs of Example 2-7 (Example 3-7) were designated as HeLa cell line (life)
- the bioresearch center of the Institute of Biotechnology, purchased KRIBB) was added to a siRNA concentration of 5 nM and transfected, and the cell morphology was observed under a microscope.
- the same procedure was used for the scrambled siRNA-containing composition prepared in Example 3.
- FIG. 5 is a diagram showing the effect of cell growth inhibition in uterine cancer cell lines by structurally modified siRNA. As shown in FIG. 5, the cells were killed by the structural siRNA. That is, the effect of inhibiting cell growth was confirmed when amino modification, cholesterol, and fluorine groups were added.
- FIGS. 6 and 7 are graphs showing the degree of cell growth inhibition of structurally modified siRNAs by concentrations for lung cancer cell line (A549) and uterine cancer cell line (HeLa), respectively, where 'SC' represents a scrambled siRNA treatment group as a negative control group.
- the structurally modified siRNA shows a growth inhibitory effect on cancer cell lines in a concentration-dependent manner, and also shows an effect at a siRNA concentration of 0.5 nM.
- the structural modification siRNA-containing composition (part 3) by Amino modification showed an excellent effect.
- Example 7-3 Normal cell line 0VI38; American Type Culture Collection (ATCC). # CCL-75) and uterine cancer cell line (HeLa) were added to the composition prepared in the same manner as in Example 7-3 (siRNA 0.5nM) and transfected, and then the mRNA reduction of FLJ25416 was measured by real-time PCR. of Analyzed through.
- Real i 'time PCR was performed using Quantace's SensiMix One-Step Kit (QT205-01) and was performed according to the manufacturer's method.
- Specific primer sequences used in real-time PCR were N-terminal primers (5'-gtgaccaagcacttcgagttt-3 ') and C-terminal primers (5'-gtgaccaagcacttcgagtt ⁇ 3').
- FIG. 8 is a graph showing the degree of inhibition of FLJ25416 gene expression by structurally modified siRNA in cancer cell lines and normal cell lines, scramble refers to the scrambled siRNA treatment group.
- the y-axis of Figure 8 shows the relative FU25416 mRNA amount changed according to siRNA treatment by correcting the cone with GAPDH mRNA amount.
- siRNAs at concentrations of 0.1, 0.25, and 0.5 nM were used for lung cancer cell lines, and 10, 20, and 50 nM siRNAs were used for normal cell line WI38.
- the cells were stained with SRB (Sulfur rhodamine, Sigma Co.) and the growth inhibition of cancer cells by siRNA was examined by measuring the number of cells stained with SRB.
- SRB sulfur rhodamine
- FIGS. 9 and 10 are graphs showing the rate of cell growth inhibition by siRNA concentration in cancer cell line (A549) and normal cell line (WI38), respectively.
- SC in the graph means scrambled siRNA treatment group.
- Example 3-7 siRNA 5nM
- siRNA 5nM siRNA 5nM
- siRNA 5nM siScram-containing composition
- FACS Fluorescence Activated Cell Sorter
- FIGS. 11 and 12 are graph showing the change in cell cycle over time for lung cancer cell line (A549)
- Figure 12 is a graph showing the change in cell cycle over time for cervical cancer cell line (HeLa).
- G2 / M, S, Gl, and sub G1 represent cell cycles, and sub G1 represents apoptosis. As the ratio of cells corresponding to sub Gl increases, cell death increases. .
- the ratio of cells corresponding to sub-Gl during the treatment of the composition of Example 3-7 and the amino modification structural siRNA-containing composition (Example 7-3) increased over time. It can be seen that apoptosis increases.
- the amino-modified structural siRNA-containing composition (Example 3) has a greater sub-Gl ratio than before structural modification, so that the modified siRNA is expected to exhibit better anticancer activity in cells.
- RNA was synthesized in the same manner as the synthesis of antisense synthesized during siRNA preparation of Example 2, but RNAs (13-l to 13-3) were synthesized to have the sequences of SEQ ID NOs: 14, 18, and 22, respectively. .
- Example 14 Design and Preparation of DNA Encoding shRNAs
- DNA encoding the shRNA sequence linked to the loop sequence of SEQ ID NOs: 13 and 14 of Table 2 DNA encoding the shRNA sequence linked to the loop sequence of SEQ ID NOs: 17 and 18, sequence of SEQ ID NO: 21 and 22 is the loop sequence DNA encoding the linked shRNA was designed and prepared by the following method.
- nucleotide sequence of SEQ ID NO: 28 having a loop sequence (GAGCTC) between the DNA nucleotide sequences corresponding to SEQ ID NO: 13 and SEQ ID NO: 14 of Table 2 corresponds to the DNA sequence complementary thereto, SEQ ID NO: 17, and SEQ ID NO: 18
- the oligonucleotide was prepared after designing a nucleotide sequence of 30 and its complementary DNA sequence (Bionia, Korea
- the retrovirus adenovirus can be used to show the RNAi effect in cells (Korean Patent Publication No. 10-2009-0060183).
- SiRNA, antisense RNA and / or shRNA complementary to the nucleotide sequence of the FLJ25416 transcript (mRNA) of the present invention inhibit the expression of FLJ25416, which is commonly expressed in cancer cells by ribonucleic acid mediated interference (RNAi).
- RNAi ribonucleic acid mediated interference
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Epidemiology (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
본 발명은 서열번호 3, 서열번호 5, 또는 서열번호 7의 FLJ25416 전사체(mRNA) 염기서열에 상보적으로 결합하여 세포 내에서 FLJ25416의 발현을 억제하는 siRNA(small interfering RNA), FLJ25416의 발현을 억제하는 안티센스 RNA(antisense RNA), 및 FLJ25416의 발현을 억제하는 shRNA(short hairpin RNA)를 암호화하는 DNA(Deoxyribonucleic acid) 중에서 선택된 하나 이상을 포함하는 암치료용 약학 조성물을 제공한다. 본 발명의 FLJ25416 전사체(mRNA transcript)의 염기서열에 상보적인 siRNA, 안티센스RNA 및 shRNA는 암세포에 발현되는 것으로 알려진 FLJ25416의 발현을 억제하여 암세포를 사멸시키므로 본 발명의 조성물은 신규한 항암제로 이용될 수 있다.
Description
【명세서】
【발명의 명칭】
암 치료용 약학 조성물
【기술분야】
본 발명은 FLJ25416 전사체 (mRNA) 염기서열에 상보적으로 결합하여 세포 내 에서 FLJ25416의 발현을 억제하는 siRNA(small interfering RNA), FLJ25416의 발현 을 억제하는 안티센스 RNA ntisense RNA), 및 /또는 FLJ25416의 발현을 억제하는 shRNA( short hairpin RNA)를 암호화하는 DNA(Deoxyr ibonucleic acid)를 포함하는 암 치료용 약학 조성물에 관한 것이다.
【배경기술】
FLJ25416 유전자 (NCBI GenBank Access No.: 丽_145018)는 가상적인 단백질 (hypothetical protein)에 대한 유전자로서, 최근 암과 관련되어 있음이 알려졌다( 대한민국 특허공개공보 제 10— 2009-0060183호).
리보핵산 매개 간섭현상 (RNAi)은 siR A가 상보적인 서열을 가지는 전사체 (mRNA transcript)에 특이적으로 결합하여 해당 전사체를 분해하여 특정 단백질의 발현을 억제하는 현상이다. 최근 이 리보핵산 매개 간섭현상이 기존의 화학 합성 의약 개발에서 발생되는 문제의 해결책을 제시하면서 전사체 수준에서 특정 단백질 의 발현올 선택적으로 억제하여 각종 질병 치료제ᅳ 특히 종양 치료제 개발에 이용 하려는 연구가 진행되고 있다. 분자량이 작은 화학 약물 (small molecule chemical drugs)의 경우 특정한 단백질 표적에 최적확되기까지 오랜 동안의 개발 기간 및 개 발 비용이 소요되는 반면, 리보핵산 매개 간섭현상을 이용한 siRNA 의약의 가장 큰 장점은 의약화가 불가능 (non-druggable)한 표적 물질을 포함한 모든 단백질 표적에 대하여 최적화돤 선도 물질 (lead compound)의 개발이 신속히 진행될 수 있다는 것 이다. 단백질이나 항체 약물이 복잡한 제조공정으로 생산의 어려움을 겪는데 반해 siRNA 등은 합성 및 분리정제의 용이성으로 대량생산이 비교적 쉽고, 핵산 소재의 특징상 단백질 의약보다 보관상 안정성 (stability)이 높은 장점이 있다. 또한 기존 의 약물과는 달리 특정 분자 표적에 오직 길항작용만 할 수 있다는 점 등 여러 장 점을 갖는 것으로 알려져 있다.
siRNA 등을 이용한 치료에서 가장 먼저 고려되어야 할 점은 목표로 하는 염 기서열에서 가장 큰 활성을 가지는 최적의 서열을 선정하는 것이다. 리보핵산 매개 간섭현상의 효율은 표적이 되는 전사체에의 특정 결합부위가 큰 영향을 주는 것으 로 알려져 있다. 지난 수 년 간의 데이터베이스를 바탕으로 단지 전사체에 결합만
하는 것이 아니라 실제로 표적 리보핵산의 발현을 억제하는 siRNA의 서열위치를 디 자인할 수 있는 알고리즘이 개발되어 이용자들에게 제공되고 있다. 그러나 컴퓨터 알고리즘을 이용하여 in silico 방법으로 결정된 siRNA가 실제 세포 및 생체중에서 표적 리보핵산을 효과적으로 억제할 수 있다고는 말할 수 없다. siRNA가 표적 전사 체와 상보적으로 결합할 수 있는 요구 사항이 층족된다 하더라도 리보핵산과 단백 질의 안정성 및 세포내 위치, 리보핵산 매개 간섭현상에 관여하는 단백질들의 상태 등 이 밖에도 아직 규명되지 않은 여러 요소들이 리보핵산 매개 간섭현상의 효율을 결정하는데 관여한다는 것이 알려져 있다. 따라서 한 유전자의 전사체당 여러 개의 표적 서열위치를 선정하여 이들 후보군중 발현 억제 효능이 우수한 최적위치의 서 열을 발굴하는 기술이 표적 단백질에 대해 수행되는 것이 필요하다.
【발명의 상세한 설명】
【기술적 과제】
본 발명의 목적은 FLJ25416 전사체 (mRNA) 염기서열에 상보적으로 결합하여 세포 내에서 FLJ25416의 발현을 억제하는 siRNA(sinan interfering RNA), 안티센스 RNA(anti sense RNA), 및 /또는 shRNA(short hairpin RNA)를 암호화하는 DNA( Deoxyribonucleic acid)와 그를 포함하는 암 치료용 약학 조성물을 제공하고자 하는 것이다. ' 【기술적 해결방법】
본 발명은 서열번호 3, 서열번호 5, 또는 서열번호 7의 FLJ25416 전사체 (mRNA transcript) 염기서열에 상보적으로 결합하여 세포 내에서 FLJ25416의 발현 을 억제하는 siRNA(small interfering ribonucleic acid), FLJ25416의 발현을 억 제하는 안티센스 RNA(antisense ribonucleic acid), 및 FLJ25416의 발현을 억제하는 shRNA( short hairpin ribonucleic acid)를 암호화하는 DNA(Deoxyr i bonuc 1 ei c acid) 중에서 선택된 하나 이상을 포함하는 암 치료용 약학 조성물을 제공한다.
본 발명의 조성물 중 siRNA는 FLJ25416의 전사체 (mRNA)의 하나의 서열위치에 만 선택적으로 결합이 가능하도록 siR A 한가지만 포함할 수도 있으며 한군데 이상 의 서열위치에 표적이 가능하도록 2 이상의 siRNA를 포함할 수도 있다.
상기 siRNA의 바람직한 예는 서열번호 13의 센스 서열 및 서열번호 14의 안 티센스 서열을 갖는 siRNA, 서열번호 17의 센스 서열 및 서열번호 18의 안티센스 서열을 갖는 siRNA, 및 서열번호 21의 센스 서열 및 서열번호 22의 안티센스 서열 을 갖는 siRNA 중에서 선택된 하나 이상이다.
본 발명에 있어서, 용어 'siRNA'는 생체내 핵산 분해효소에 의한 빠른 분해
를 막기 위해 구조변형된 siRNA를 포함한다. 당업자는 당해 기술 분야에 공지된 방 법을 이용하여 원하는 방식대로 상기 siRNA를 합성하고 변형시킬 수' 있다. (Andreas Henschel , Frank Buchholzl and Bianca Habermann (2004) DEQOR: a web- based tool for the design and quality control of siRNAs. Nucleic Acids Research 32(Web Server Issue) :W113—W120 참조). siRNA는 이중나선 구조를 가지므 로, 단일나선 구조의 리보핵산이나 안티센스 올리고핵산 (antisense oligonucleotide)보다는 상대적으로 안정한 구조이지만 생체내 핵산 분해효소에 의 해 빠르게 분해되기 때문에 구조변형을 통해 분해 속도를 감소시킬 수 있다. siRNA 가 쉽게 분해되지 않도록 안정하고 저항적이도록 하기 위한 siRNA의 구조변형 방법 은 당업자에게 잘 알려져 있다.
상기 siRNA는 구조변형된 것일 수 있으며, 바람직하게는 상기 siRNA는 2'_0_ 메틸 수식, 2'-F 수식, 아미노 수식, 또는 콜레스테를 컨쥬게이트 중에서 선택된 하나 이상에 의해 구조변형된 형태의 siRNA이다.
상기 2'-0_메틸 수식은 리보스의 2' 위치에 하이드록실기 대신에 메톡시기를 함유하도록 수식한 것을 의미하고, 상기 2'-F 수식은 리보스의 2' 위치에 하이드록 실기 대신에 불소기를 함유하도록 수식한 것을 의미한다. 상기 아미노 수식은 siRNA 서열중 센스서열의 5' 하이드록실기에 핵실아미노기가 치환되도록 수식한 것 을 의미하며, 상기 콜레스테를 컨쥬게이트는 siRNA 서열중 센스서열의 5' 하이드록 실기에 콜레스테를이 컨쥬게인션된 것을 의미한다. 이러한 siRNA의 변형은 세포내 에서 존재하는 분해효소에 대한 안정성을 증가시키며 타겟 niRNA에 대한 친화성도 높일 수 있다. 또한 세포내 전달성도 높일 수 있다. siRNA의 면역반웅도 이러한 modification을 통하여 줄일 수 있음이 보고되었다 (참고논문: RNA 2006, 12, pi 197, RNA 2003, 9, P1034, AAC 2009, 53, p3952, Nature 2004, 432, P173, Oligonucleotides 2007, 17, p445).
상기 화학적 수식 방법 등에 의한 구조변형에 의해 리보핵산이 핵산분해효소 에 저항성을 갖고 안정화되며, 생체 내에서 약물동력학적 (pharmacokinetic)인 체류 시간의 증대 및 유효성 등을 높이게 된다.
본 발명의 조성물 중 안티센스 RNA는 FU25416의 전사체 (mRNA)의 하나의 서열 위치에만 선택적으로 결합이 가능하도록 안티센스 RNA 한가지만 포함할 수도 있으며 한군데 이상의 서열위치에 표적이 가능하도록 2 이상의 안티센스 RNA를 포함할 수도 있다.
상기 안티센스 RNA의 바람직한 예는 서.열번호 14의 서열을 갖는 안티센스 RNA,
서열번호 18의 서열을 갖는 안티센스 R A, 및 서열번호 22의 서열올 갖는 안티센스 RNA중에서 선택된 하나 이상이다.
본 발명에 있어서, 용어 '안티센스 RNA'는 안티센스 서열로 이루어진 단일가 닥 RNA를 의미하며, 안티센스 올리고뉴클레오타이드는 타겟에 결합하고 전사, 번역 또는 스플라이성의 단계에서 발현을 멈추게 함으로써 DNA 또는 RNA 타겟에 의해 인 코드된 단백질의 발현을 막기 위해 제안되었다. 생체내 핵산 분해효소에 의한 빠른 분해를 막기 위해 구조변형된 안티센스 RNA를 포함한다. 당업자는 당해 기술 분야에 공지된 방법을 이용하여 원하는 방식대로 상기 안티센스 RNA를 합성하고 변형시킬 수 있다 (European Journal of Biochemistry. 2003; 270: 1628-1644. Methods Enzymo 1.2000: 313, 3-45. 참조).
본 발명의 조성물 중 shRNA를 암호화하는 DNA는 FLJ25416의 전사체 (m NA)의 하나의 서열위치에만 선택적으로 결합이 가능하도록 DNA 한가지만 포함할 수도 있 으며 한군데 이상의 서열위치에 표적이 가능하도록 2 이상의 DNA를 포함할 수도 있 다.
상기 DNA의 바람직한 예는 서열번호 13의 서열과 서열번호 14의 서열을 포함 하는 shRNA를 암호화하는 서열번호 28의 염기서열을 갖는 DNA, 서열번호 17의 서열 과 서열번호 18의 서열을 포함하는 shRNA를 암호화하는 서열번호 29의 염기서열을 갖는 DNA, 및 서열번호 21의 서열과 서열번호 22의 서열을 포함하는 shRNA를 암호 화하는 서열번호 30의 염기서열을 갖는 DNA 증에서 선택된 하나 이상이다.
본 발명에 있어서, 용어 'shRNA'는 세포 내에서 생성되는 짧은 머리핀 구조 (short hairpin)를 가지는 45 내지 70 핵산의 길이의 단일가닥의 RNA로 세포 내 Dicer에 의해 siRNA로 전환되어 R Ai 효과를 나타낸다. siRNA 염기서열의 센스 서 열과 안티센스 서열이 3-10개의 염기 링커 (루프 서열)로 연결된 구조의 DNA를 디자 인 하여 합성한 후 프라스미드 백터에 클로닝하거나 또는 shRNA를 레트로바이러스 인 렌티바이러스 (lentivirus) 및 아데노바이러스 (adenovirus)에 삽입하여 사용한 다.
구조변형 외에, siRNA와 같은 핵산 물질의 세포 내 전달 효율을 높이기 위해 서는 안전하고 효율적인 전달 시스템이 요구되어진다. 이를 위해, 본 발명의 siRNA, 안티센스 RNA, DNA, 상기 DNA에 의해 암호화된 shRNA 등은 핵산 전달체 (nucleic acid delivery system)와 함께 조성물 내에 포함될 수 있다.
세포 내로 siRNA와 같은 핵산 물질을 전달하기 위한 핵산 전달체는 크게 바 이러스성 백터와 비바이러스성 백터로 구분할 수 있다. 가장 널리 이용되는 것은
바이러스 백터 (viral vector)로 전달 효율이 높고 지속 시간이 길기 때문이다. 여 러 가지의 바이러스백터 중 레트로바이러스 백터 (retroviral vector), 아데노바이 러스 백터 (adenoviral vector), 아데노 부속 바이러스 백터 (adeno—associated viral vector) 등이 주요하게 사용되고 있다. 비바이러스 백터 (nonviral vector)는 독성과 면역 반웅이 작고, 반복적으로 투여가 가능하며, 리보핵산과의 복합체 형성 이 간편하고, 대량 생산이 용이하다. 또한, 질환 세포나 조직부위에 특이적 리간드 를 비바이러스성 백터에 접합하여, 장기세포 선택적 핵산 전달을 가능하게 한다. 비바이러스성 백터로서는 리포좀, 양이온성 고분자를 비롯하여, 미셀, 에멀젼, 나 노입자 등의 다양한 제형이 사용될 수 있다. 핵산 전달체는 동물 세포 내에 목적 하는 핵산의 수송 효율을 현저히 증강시킬 수 있으며 전달하고자 하는 핵산의 사용 목적에 따라 어떤 동물 세포로도 핵산 전달이 가능하다.
상기 핵산 전달체는 바람직하게 양이온성 리포좀 또는 양이온성 고분자 중에 서 선택된 하나 이상일 수 있다.
양이온성 리포좀, 양이온성 고분자 등의 제형을 갖는 본 발명의 조성물 중 핵산 전달체는 양하전을 띠므로, 핵산 전달체의 양하전과 siRNA와 같은 핵산의 음 이온성 하전에 의해 단순한 흔합 (mix)에 의해 정전기 결합을 함으로써 핵산 전달체 와 핵산 간의 복합체를 형성할 수 있다.
siRNA, 안티센스 RNA 또는 shRNA (small hairpin RNA)를 포함한 발현 컨스트 럭트 /백터의 제조는 당분야에 공지된 방법을 이용할 수 있다. 예를 들어, 미국 특 허 공개공보 게 20040106567호 및 제 20040086884호에는 바이러스성 백터, 비바이러 스성 백터, 리포솜 전달 운반체, 플라스미드 주입 시스템, 인공 바이러스 엔벨로프 및 폴리라이신 컨쥬게이트를 포함한 전달 메커니즘뿐만 아니라 많은 발현 컨스트럭 트 /백터를 제공하고 있다.
본 발명의 조성물은 약제학적으로 허용되는 담체를 추가적으로 포함할 수 있 다. 적당한 약제학적으로 허용되는 담체는 예를 들어 하나 이상의 물, 식염수, 인 산 완충 식염수, 텍스트린, 글리세를, 에탄올뿐만 아니라 이들의 조합을 포함한다. 이러한 조성물은 투여 후 활성 성분의 빠른 방출, 또는 지속적이거나 지연된 방출 을 제공하도록 제제화될 수 있다.
본 발명의 siRNA 또는 siRNA와 핵산 전달체와의 복합체는 암의 치료를 위해 세포 내로 도입될 수 있다. 하기 실시예에서 확인할 수 있는 바와 같이, 본 발명의 siRNA 또는 siRNA와 핵산 전달체와의 복합체를 세포 내에 도입하게 되면 암의 생성 에 관여하는 FLJ25416의 발현이 억제되어 암세포가 사멸하게 된다.
상기 암은 바람직하게는 폐암, 자궁경부암, 대장암, 위암, 및 간암 중에서 선택된 하나 이상이다 (대한민국 특허공개공보 제 10-2009-0060183호 참조).
본 발명의 조성물을 통해 in vivo 또는 ex vivo 상에서 세포 내부로 목적하 는 핵산을 도입하게 되면 표적 단백질인 FLJ25416의 발현을 선택적으로 감소시키거 나 표적 유전자에 생긴 변이를 수정하는 역할을 하여 FLJ25416의 과다 발현으로 발 생되는 암을 치료할 수 있게 된다.
본 발명에서, 상기 siRNA, 안티센스 RNA, shRNA 암호화 DNA또는 각각의 핵산 과 핵산 전달체의 복합체의 치료상 유효량은 암 치료 효과를 기대하기 위하여 투여 에 요구되는 양을 의미한다. 따라서, 질환의 종류, 질환의 중증도, 투여되는 핵산 의 종류, 제형의 종류, 환자의 연령, 체중, 일반 건강 상태, 성별 및 식이, 투여 시간, 투여 경로 및 치료 기간, 동시 사용되는 화학 항암제 등의 약물을 비롯한 다 양한 인자에 따라 조절될 수 있다. 본 발명의 조성물 또는 siRNA, 안티센스 RNA, 및 /또는 shRNA 암호화 DNA는 정맥내, 동맥내, 복강내, 근육내, 동맥내, 복강내, 흉골 내, 경피, 비측내, 흡입, 국소, 직장, 경구, 안구내 또는 피내 경로를 통해 통상적 인 방식으로 투여할 수 있다. 성인에게 siRNA, 안티센스 RNA, shRNA 기준으로 각각 예컨대 1일 1회 투여시 0.01ng/kg~100rag/kg의 용량으로 투여할 수 있다.
하기 실시예를 통해 밝혀진 바에 따르면 서열번호 3, 서열번호 5, 또는 서열 번호 7의 FLJ25416 전사체 (mRNA) 염기서열에 상보적으로 결합하여 세포 내에서 FLJ25416의 발현을 억제하는 본 발명의 siRNA 중에서도 서열번호 13의 센스 서열 및 서열번호 14의 안티센스 서열을 갖는 siRNA, 서열번호 17의 센스 서열 및 서열 번호 18의 안티센스 서열을 갖는 siRNA, 및 서열번호 21의 센스 서열 및 서열번호 22의 안티센스 서열을 갖는 siRNA가 특히 FLJ25416의 발현을 효과적으로 억제하는 것으로 확인되었다. 상기 siRNA와 동일하게 서열번호 3, 서열번호 5, 또는 서열번 호 7의 FLJ25416 전사체 (mRNA) 염기서열에 상보적으로 결합할 수 있는 서열번호 14, 서열번호 18, 또는 서열번호 22의 서열을 각각 갖는 안티센스 RNA 역시 FLJ25416의 발현을 효과적으로 억제할 수 있으며, 서열번호 13의 서열과 서열번호 14의 서열을 포함하는 shRNA를 암호화하는 서열번호 28의 염기서열을 갖는 DNA, 서열번호 17의 서열과 서열번호 18의 서열을 포함하는 shRNA를 암호화하는 서열번 호 29의 염기서열을 갖는 DNA, 및 서열번호 21의 서열과 서열번호 22의 서열을 포 함하는 shRNA를 암호화하는 서열번호 30의 염기서열을 갖는 DNA는 세포 내에서 RNA 로 전환되어 FLJ25416의 발현을 효과적으로 억제할 수 있다.
따라서 본 발명은 또한 FLJ25416 발현을 억제하고 서열번호 13의 센스 서열
및 서열번호 14의 안티센스 서열을 갖는 siR A를 제공한다.
본 발명은 또한 FLJ25416 발현을 억제하고 서열번호 17의 센스 서열 및 서열 번호 18의 안티센스 서열을 갖는 siRNA를 제공한다.
본 발명은 또한 FLJ25416 발현을 억제하고 서열번호 21의 센스 서열 및 서열 번호 22의 안티센스 서열을 갖는 siRNA를 제공한다.
본 발명은 또한 FLJ25416 발현을 억제하고 서열번호 14의 서열을 갖는 안티 센스 RNA를 제공한다.
본 발명은 또한 FLJ25416 발현을 억제하고 서열번호 18의 서열을 갖는 안티 센스 RNA를 제공한다.
본 발명은 또한 FLJ25416 발현을 억제하고 서열번호 22의 서열을 갖는 안티 센스 RNA를 제공한다.
본 발명은 또한 FLJ25416 발현을 억제하는 shRNA를 암호화하는 서열번호 28 의 염기서열을 갖는 DNA를 제공한다.
본 발명은 또한 FU25416 발현을 억제하는 shRNA를 암호화하는 서열번호 29 의 염기서열을 갖는 DNA를 제공한다.
본 발명은 또한 FLJ25416 발현을 억제하는 shRNA를 암호화하는 서열번호 30 의 염기서열을 갖는 DNA를 제공한다.
본 발명의 siRNA는 2'-0-메틸 수식 , 2'-F 수식, 아미노 수식, 또는 콜레스테 롤 컨쥬게이트에 의해 구조변형된 것일 수 있으며, 핵산전달체와 함께 조성물 상태 로 이용될 수 있다.
본 발명은 또한 상기 기재한 본 발명의 조성물에 포함되는 siRNA, 안티센스 RNA, 및 /또는 shRNA 암호화 DNA를 포함하는 항암제의 제조를 위한 siRNA의 용도를 제공한다.
본 발명은 또한 상기 기재한 본 발명의 siRNA, 안티센스 RNA, shRNA (short hairpin RNA)를 암호화하는 DNA(Deoxyr ibonucleic acid), 상기 DNA에 의해 암호화 된 shRNA 및 /또는 조성물을 대상체의 세포 내로 도입하는 단계를 포함하는 암 치료 방법을 제공한다.
본 발명에 있어서 암 치료는 암의 예방 및 억제를 포함한다.
본 발명에 있어서, FLJ25416 전사체는 서열번호 27의 염기서열 또는 상기 염 기서열 중 하나 이상의 염기가 결실, 치환 및 /또는 삽입된 염기서열을 가질 수 있 다.
【유리한 효과】
본 발명의 FLJ25416 전사체 (mRNA)의 염기서열에 상보적인 siRNA, 안티센스 RNA 및 /또는 shRNA는 리보핵산 매개 간섭현상 (RNA-inediated interference, RNAi)에 의해 암세포에 공통적으로 발현되는 FLJ25416의 발현을 억제하여 암세포를 사멸시 키므로, 본 발명의 조성물은 우수한 항암제로 이용될 수 있다.
【도면의 간단한 설명】
도 1은 본 발명의 실시예인 siRNA에 의해 매개된 FLJ25416 전사체 발현 억제 효능을 사람의 폐암 세포주인 A549에서 확인한 결과를 보여주는 전기영동 사진이 다.
도 2는 본 발명의 실시예인 FLJ25416 발현 억제 siRNA에 의해 세포성장이 억 제된 정도를 보여주는 폐암 세포주 사진이다.
도 3은 본 발명의 실시예인 조성물 처리시 농도별 FLJ25416 전사체의 발현 억제정도를 나타내는 정기영동 사진이다.
도 4는 본 발명의 실시예인 FLJ25416 발현 억제 siRNA에 의한 암세포성장 억 제 정도를 시간대별로 나타낸 그래프이다.
도 5는 본 발명의 실시예인 구조 변형 siRNA에 의한 자궁경부암 세포주에서 의 세포성장억제 효과를 나타낸 그림이다.
도 6은 본 발명의 실시예인 siRNA를 폐암세포주에 형질주입(^ 3£6^1011)한 후, 세포성장 억제정도를 나타낸 그래프이다.
도 7은 본 발명의 실시예인 siRNA를 자궁경부암세포에 형질주입한 후 세포성 장 억제정도를 나타낸 그래프이다.
도 8은 본 발명의 실시예인 구조변형 siRNA를 암세포주와 정상세포주에 처리 시 FLJ25416 유전자 발현 억제 정도를 나타낸 그래프이다.
도 9는 본 발명의 실시예인 siRNA를 폐암세포주에 처리시 농도에 따른 세포 성장 억제 비율을 나타낸 그래프이다.
도 10은 본 발명의 실시예인 siRNA를 정상세포주에 처리시 농도에 따른 세포 성장 억제 비율을 나타낸 그래프이다.
도 11은 본 발명의 실시예인 siRNA를 처리한 폐암세포주의 시간별 세포주기 변화를 나타낸 그래프이다.
도 12는 본 발명의 실시예인 siRNA를 처리한 자궁경부암세포주의 시간별 세 포주기변화를 나타낸 그래프이다.
도 13과 도 14는 본 발명의 실시예인 siRNA를 암모델누드마우스에 투여시 시 간경과에 따른 종양크기 변화를 나타낸 그래프이다.
【발명의 실시를 위한 형태】
본 발명의 이점 및 특징, 그리고 그것들을 달성하는 방법은 상세하게 후술되 어 있는 실시예들을 참조하면 명확해질 것이다. 그러나 본 발명은 이하에서 개시 되는 실시예들에 한정되는 것이 아니라 서로 다른 다양한 형태로 구현될 것이며, 단지 본 실시예들은 본 발명의 개시가 완전하도록 하고, 본 발명이 속하는 기술 분 야에서 통상의 지식을 가진 자에게 발명의 범주를 완전하게 알려주기 위해 제공되 는 것이며, 본 발명은 청구항의 범주에 의해 정의될 뿐이다.
[실시예]
실시예 1. FLJ25416 발현 억제용 siR A가 결합할 수 있는 타겟 염기서열 후 보군의 디자인
FLJ25416의 전사체에서 siRNA가 결합할 수 있는 타겟 염기서열 후보군을 디 자인하였다.
먼저. 원하는 염기서열에 대한 siRNA 디자인 프로그램{대한민국 특허출원 제 10-2008-0009813호의 알고리즘, 한국생명공학연구원 (KRIBB)}을 사용하여, 서열번호 27의 FLJ25416 mRNA서열 (Homo sa iens chromosome 11 open reading frame 82 (Cllorf82), mRNA; NCBI GenBank No. NM_145018)에서 siRNA가 결합할 수 있는 타겟 염기서열을 디자인하였다.
표 1은 siRNA의 타겟 염기서열의 후보군이다.
표 1. FLJ25416에서 siRNA가 결합할 수 있는 목표 염기서열 후보군
서염버호 표적서염 염기서염
1 814 - 832 cagaacagaaagtccatct
2 319 - 337 gat acaactcagaat ctat
3 880 - 898 gat t cat ggagcct t gt 11
4 983 - 1000 gtcatcatgaaattggagt
5 2673 - 2691 ctat cat ttccct gat caa
6 1548ᅳ 1566 agtagaggctgtctctgta
7 1153 - 1171 cagaagagatctgcatgtt
8 260 - 278 ccactggt ttgcacaggt a
실시예 2. FU25416 발현 억제용 siRNA 후보군의 제조
실시예 1에서 디자인한 타겟 염기서열에 결합할 수 있는 작은 간섭리보핵산
8종을 표 2의 서열을 갖도록 삼천리제약 (SamchuUy Pharmaceuticals, Seoul , Korea) 에 의뢰하여 제조하였다. 표 2에 선택된 서열의 19개 을리고뉴클레오타이드의 이중 리보핵산쇄의 센스와 안티센스 염기서열 각각의 단쇄 3' 끝에 2염기 (TT)가 매달린 구조로 하여 합성하였다. 구체적으로, RNA 합성기를 사용하여, 뉴클레오티드가 부 착된 고형지지체 상에서, 차단제거 (deblocking), 결합 (coupling), 산화 (oxidat ion) 및 캐핑 (capping)으로 이루어지는 일련의 과정을 반복하여 원하는 길이의 RNA를 포 함하는 반웅물을 수득하였다. 합성은 고체상수지를 이용하여 자동합성기 (Polygene DNA/RNA Synthesizer)를 이용하여 합성하였으며 합성이 완료된 후 고체상 수지를
암모니아:에탄올 (3:1) 혼합용액을 가은처리하여 고체상 수지와 분리하고 염기 보호 기도 제거하였다. 이 용액을 건조시킨 후 TBAF을 처리하여 2 '-TBDMS기를 탈보호하 고 이 용액을 HPLC에 적용하여, RNA를 분리하고 이를 MALDI-T0F 질량 흡광분석기에 적용하여, 합성하고자 하는 염기서열과 부합하는지 확인하였다. 그런 다음, 센스와 안티센스 RNA가닥을 결합시켜서, 목적하는 이중가닥 siRNA를 각각 제조하였다. 또한, siScram(scrambled siRNA)를 동일한 방법으로 제조하여 음성대조군으 로 사용하였다. 상기 siScram은 사람의 유전자와 homology가 없는 시뭔스에 대한 siRNA로, 세포의 증식에 아무런 영향을 주지 못한다. 8종의 siRNA 후보군의 서열과 siScram의 서열은 표 2와 표 3에 나타내었다.
표 2. FLJ25416 발현 억제용 siRNA의 염기서열 후보군
표 3. siScram서열
실시예 3. FLJ25416 발현 억제용 siRNA와 양이은성 리포좀을 포함하는 조성물 제조 실시예 2에서 합성 제조한 8종의 FLJ25416 발현 억제용 siRNA와 이를 전달해 주는 양이온성 리포좀과의 복합체를 제조하였다.
먼저, 양이온성 리포좀인 트랜스펙션 시약 (HiPerFect transfection Reagents
QIAGEN, 네델란드)올 실시예 2의 8종의 FLJ25416 발현 억제용 siRNA와 각각 흔합하 여 상온에서 20분간 유지시켜 siRNA 및 양이온성 리포좀과의 복합체 조성물 (3-1 ~ 3-8)을 제조하였다. 또한, siScram에 대하여도 동일한 방법으로 양이온성 리포좀과 의 복합체 조성물을 제조하였다. 실시예 4. 역전사 중합효소 연쇄반응을 이용한 FLJ25416 발현 억제 siRNA의 FLJ25416 전사체 발현 억제 효능평가
FLJ25416에 대한 siRNA함유 조성물이 암세포사멸에 미치는 효과를 평가하기 위하여 역전사 중합효소 연쇄반웅을 이용하여 하기와 같은 과정으로 실험을 수행하 였다.
폐암세포주인 A549 세포주 (서울대 세포주은행)를 70% 컨플루언시로 배양하였 다. 상기 배양된 폐암세포주에 실시예 3에서 제조한 8종의 FLJ25416 발현억제용 siRNA와 양이온성 리포좀과의 복합체 조성물을 각각 첨가하였다. 배양배지에 포함 된 siRNA의 최종 농도는 50 nM이 되도록 조절하였다. 이들을 서서히 피펫팅 (pipetting)하여 흔합한 후 실온에서 20분간 방치하고 이렇게 제조된 복합체를 웰 플레이트에 첨가하여 37°C의 C02 세포배양기에서 72시간 동안 배양하였다.
24시간 후 Trizol 시약 (Invitrogen, Carlsbad, CA, USA)을 사용하여 세포내 에 존재하는 전체 리보핵산 (RNA)을 분리하고 이 리보핵산은 one-step RT-PCR PreMix kit(iNtR0N Biotechnology, INC)를 사용하여 상보성 디옥시리보핵산 (cDNA) 으로 역전사 하였다. 중합효소연쇄반응을 위해 사용한 FLJ25416에 특이적인 프라이 머의 서열은 5-cagaagccctattgtatctgg_3 (N-말단 프라이머), 5- ct tgcagcagt tgt tgt t acgaa-3 (C-말단 프라이머)이었다.
도 1~2는 FLJ25416 발현 억제 siRNA에 의해 매개된 FLJ25416 전사체 발현 억 제 효능을 사람의 폐암 세포주인 A549에서 확인한 결과를 보여준다. 도 1은 FLJ25416 전사체의 발현 정도를 보여주는 대표적인 전기영동 사진이고, 도 2는 세 포주의 세포성장 억제 정도를 촬영한 사진이다. 도 1~2에서, NT는 siRNA를 처리하 지 않은 대조군, SC는 음성대조군인 siScram 처리군, 3-1 내지 3-8은 실시예 3-1 부터 3-8까지의 복합체 처리군을 나타낸다. 또한, "GAPDH' '는 Glyceraldehyde 3- phosphate dehydrogenase로 유전자 발현의 차이를 판단하기 위한 표준유전자를 의 미한다. 대조군 (NT)은 미처리군으로 FLI25416 전사체의 발현이 관찰되었고, 음성대 조군 (SC)은 scrambled siRNA 처리군으로서 FLJ25416 전사체의 발현에 대조군에 비 하여 변화가 없었고, 실시예 3-1내지 3-8의 복합체 처리군은 대조군과 비교했을 때
다양한 발현 억제 효능을 나타내었다. 이 중 실시예 3-3, 3-7의 복합체 처리군에서 FLJ25416 전사체의 발현이 유의성 있게 감소하였다 (도 1). 또한, 실시예 3-3, 3-5, 3-7의 복합체 처리군에서 암세포 성장 억제 효과가 나타났다 (도 2). 실시예 5. siRNA농도에 따른 역전사 중합효소 연쇄반웅을 이용한 FLJ25416 발현 억제 siRNA의 FLJ25416 전사체 발현 억제 효능평가
배양배지에 포함된 siRNA의 최종 농도를 각각 5nM, 20nM이 되도록 조절한 것 과, 37°C의 C02 세포배양기에서 48시간 동안 배양한 것을 제외하고, 실시예 4와 동일하게 실시하였다. 그 결과를 도 3에 나타내었다. 도 3은 실시예 3-1, 3—3, 3- 5, 3-7의 복합체 처리군에서 농도별 FLJ25416 전사체의 발현 억제정도를 나타내는 정기영동 사진이다. 도 3에서 0 nM은 미처리군을 나타내며, SC는 음성대조군으로 scrambled siRNA 처리군, GAPDH는 Glycer aldehyde 3一 phosphate dehydrogenase로 유 전자 발현의 차이를 판단하기 위한 표준유전자를 의미한다. 그 결과, 3-3, 3-5, 3- 7의 복합체 처리군이 5nM에서도 mRNA 넉다운 효과가 뛰어난 것을 확인하였다. 실시예 6. 시간에 따른 FLJ25416 발현 억제 siRNA의 암세포성장 억제효과평가
FLJ25416에 대한 siRNA 함유 조성물이 암세포성장 억제 효과를 평가하기 위 하여 SRB(Sulforhodamine B) assay를 이용하여, 세포성장 억제정도를 시간대별로 측정하였다. 실험방법은 구체적으로 다음과 같다.
폐암세포주인 A549 세포주 (서울대 세포주은행)를 70% 컨플루언시로 배양하였 다. 상기 배양된 폐암세포주에 실시예 3에서 제조한 8종의 FLJ25416 발현억제용 siRNA와 양이온성 리포좀과의 복합체 조성물을 각각 첨가하였다. 배양배지에 포함 된 siRNA의 최종 농도는 50nM이 되도록 조절하였다. 이들을 서서히 피펫팅 (pipetting)하여 흔합한 후 실온에서 20분간 방치하고 이렇게 제조된 복합체를 웰 플레이트에 첨가하여 37°C의 C02 세포배양기에서 72시간 동안 배양하였다.
세포를 SRB (Sulfur rhodamine, Sigma Co.)로 염색하고 siRNA에 의한 암세포 의 성장저해를 SRB로 염색된 세포수 변화 측정을 통해 조사하였다. SRB 분석방법은 아래와 같다. 세포를 배양하는 플레이트에 4% Formaldehyde를 넣어 상온에서 30분 간 세포를 고정시킨 후 증류수로 3회 씻어 말린다. 0.4¾) SRB(sulforhodamine B)(Sigma, S-9012) 용액 (1% acetic acid 용액)을 고정된 세포에 넣어 상온에서 30 분간 염색한다. 1% acetic acid 용액으로 세포를 3회 세척한 후, 10 mM Tris-HCl (ρΗΙΟ.5) 용액을 넣어 염색된 세포를 용해시키고, 540 nm 파장에서 흡광도를 측정
1 하여 siRNA 처리에 의한 상대적인 세포의 성장 저해 정도를 비교한다.
그 결과를 도 4에 나타내었다. 도 4는 FLJ25416 발현 억제 siRNA에 의한 암 세포성장 억제 정도를 시간대별로 나타낸 그래프이다. 도 4에서 보는 바와 같이 시 간경과에 따라 암세포성장 억제정도가 증가하며 , 3-5 복합체 처리군에서는 72시간 처리시 25.5% 로 세포 성장 억제 효과가 있었다. 3-7의 복합체 처리군에서는 24시 간에 28.4%, 48시간에 29.4%, 72시간 경과시 37.8%의 세포성장 억제 효과가 높게 나타났다. 본 실험 결과로 실시예 3-7 조성물에 포함된 실시예 2-7의 siRNA가 세포 성장을 가장 효과적으로 억제함을 확인하였다. 실시예 7. 구조변형 siRNA(modified siRNA) 및 상기 siRNA와 양이은성리포좀을 포 함하는 조성물 제조
암세포성장 억제 효과가 큰 siRNA인 실시예 2-7 siRNA를 대상으로 구조변형 을 수행하여 다음과 같이 modified siRNA를 합성하였다.
구조변형은 삼천리제약 (대한민국)에서 실시하였으며, 구체적으로 (1) 5'위 치에 콜레스테를기를 도입하는 Cholesterol conjugated siRNA는 센스서열의 5'위치 에 콜레스테롤기를 도입하였고, (2) 2'-0-Me siRNA의 경우 센스 및 안티센스서열 의 purine nucleosdie 에 2'_0_Me을 모두 도입하였으며 (3) 5'위치에 아미노기를 도입하는 Amino modi f icat ion은 센스서열의 5'위치에 아미노기를 도입하였다 (4) 2'-F siRNA의 경우 센스와 안티센스 서열의 모든 pyrimidine에 2'-F를 도입하였다. 위와 같이 실시예 2-7 siRNA의 구조를 변형하여 구조변형 siRNA{7(l) ~ 7(4)}를 제 조하였다. 자세한서열 정보는 아래와 같다.
상기 각각의 구조변형 siRNA를 이용하여 양이온성 리포좀과의 복합체 조성물 (7-1 ~ 7-4)을 실시예 3.과 동일한 방법으로 제조하였다. 실시예 8. 구조변형 siRNA의 in vitro 효과 확인
구조변형 siRNA (5 nM)를 포함하는 조성물 (실시예 7-1 ~ 7-4), 실시예 2-7의 siRNA를 포함하는 조성물 (실시예 3-7) 각각을 자궁암세포주인 HeLa 세포주 (생명공 학연구원 바이오평가센터, KRIBB 구입)에 siRNA농도가 5nM이 되도록 첨가하여 형질 주입 (transfection)한 후, 세포 형태를 현미경으로 관찰하였다. 대조를 위해 실시 예 3.에서 제조한 scrambled siRNA 포함 조성물에 대하여도 동일한 방법으로 실시 하였다.
그 결과를 도 5에 나타내었다. 도 5는 구조 변형 siRNA에 의한 자궁암 세포 주에서의 세포성장억제 효과를 나타낸 도이다. 도 5에서 보는 바와 같이 구조변형 siRNA에 의해 세포가 사멸됨을 확인하였다. 즉, 아미노 변형, 콜레스테를 및 불소 기를 붙인 경우에 세포 성장 억제 효과를 확인하였다.
또한, 구조변형된 siRNA의 농도에 따른 세포성장 억제 정도를 알아보기 위해 다음과 같이 실험하였다. 구조변형 siRNA를 포함하는 조성물 (실시예 7-1 - 7-3)과 실시예 2-7의 siRNA를 포함하는 조성물 (실시예 3-7) 각각을 siRNA농도가 5 nM이 되 도톡 폐암세포주 (A549)와 자궁암세포주 (HeLa)에 첨가하여 형질주입하고, 72시간 후 세포성장 억제 정도를 SRB(Sulforhodamine B) assay를 이용하여 측정하였다. 즉, 세포를 SRB (Sulfur rhodamine, Sigma Co.)로 염색하고 siRNA에 의한 암세포의 성 장저해를 실시예 6의 SRB 분석과 동일한 방법으로 세포 성장 저해 효과를 조사하 였다.
그 결과를 도 6과 도 7에 나타내었다. 도 6와 도 7은 각각 폐암세포주 (A549) 와 자궁암세포주 (HeLa)에 대한 농도별 구조변형 siRNA의 세포성장 억제 정도를 나 타낸 그래프로, 'SC'는 음성대조군으로 scrambled siRNA처리군을 나타낸다.
그 결과, 구조변형 siRNA는 농도의존적으로 암세포주의 성장억제효과를 나타 내며, siRNA 농도 0.5nM에서도 효과를 나타냄을 알 수 있다. 특히 Amino modification법에 의한 구조변형 siRNA 함유 조성물 (그 3)이 우수한 효과를 나타내 었다. 실시예 9. 구조변형 siRNA의 FLJ25416유전자 발현 억제 효과 확인
구조변형 siRNA의 암세포주와 정상세포주에 대한 FLJ25416유전자 발현 억제 효과를 하기 방법으로 확인하였다.
정상세포주 0VI38; ATCC (American Type Culture Collection). #CCL-75)와 자 궁암세포주 (HeLa)에 각각 실시예 7-3과 동일한 방법으로 제조한 조성물 (siRNA 0.5nM)을 첨가하여 형질주입한 후, FLJ25416의 mRNA 감소정도를 Real-time PCR을
통해 분석하였다.
Real iᅳ time PCR은 Quantace사의 SensiMix One-Step Kit(QT205-01)를 사용하 였으며, 제조사의 제시된 방법에 따라 수행하였다. Real-Time PCR에서 사용한 특이 적 프라이머 서열은 N-말단 프라이머 (5'-gtgaccaagcacttcgagttt-3' )과 C-말단 프라 이머 (5'—gtgaccaagcacttcgagtt一 3' )이었다.
그 결과를 도 8에 나타내었다. 도 8은 암세포주와 정상세포주에서 구조변형 siRNA에 의한 FLJ25416 유전자 발현 억제 정도를 나타낸 그래프로, scramble은 scrambled siRNA처리군을 의미한다. 도 8의 y축은 콘트를 GAPDH mRNA 양으로 보정 하여 siRNA 처리에 따른 변화된 상대적인 FU25416 mRNA 양을 나타낸 것이다.
그 결과, 정상세포주와 암세포주 모두에서 구조변형 siRNA에 의해 FLJ25416 유전자 발현이 억제됨을 확인하였다. 실시예 10. FLJ25416 발현 억제 siRNA의 세포성장 억제 효과 학인
구조변형 siRNA의 암세포주와 정상세포주에 대한 세포성장 억제 효과를 확인 하기 위해 실시예 4의 방법대로 siRNA를 처리하고 SRB assay 분석 실험을 하기와 같이 수행하였다. 암세포주로 폐암세포주에 0.1, 0.25, 0.5 nM 농도의 siRNA를 사 용하였고, 정상세포주인 WI38에는 10, 20, 50 nM의 siRNA를 사용하여 농도에 따른 세포주의 성장 저해 효과를 비교하였다.
세포를 SRB (Sulfur rhodamine, Sigma Co.)로 염색하고 siRNA에 의한 암세포 의 성장저해를 SRB로 염색된 세포수 변화 측정을 통해 조사하였다.
그 결과를 도 9와 도 10에 나타내었다. 도 9와 도 10은 각각 암세포주 (A549) 와 정상세포주 (WI38)에서 siRNA 농도별 세포성장 억제 비율을 나타낸 그래프이다. 그래프에서 SC는 scrambled siRNA처리군을 의미한다.
그 결과, 정상세포주에서 siRNA 20nM, 50nM 농도에서 최대 15% 세포성장 억 제효과를 나타낸 반면, 암세포주에서는 저농도 (0.25nM)에서도 효과적으로 세포성장 이 억제됨을 알 수 있고 특히 아미노기 도입한 siRNA-amino는 0.1 nM에서도 활성을 나타내었다.
실시예 9와 10의 결과로부터 정상세포주에서 유전자 발현 감소가 세포성장억 제효과에 주는 영향에 비해, 암세포주에서 큰 영향을 주는 것을 알 수 있다. 상기 결과로부터 FLJ25416 발현 억제 siRNA는 정상세포주에 비해 암세포주에 특이적으로 세포성장을 억제하는 효과가 있을 것으로 보인다. 또한, 5'위치에 아미노기를 도입 하는 Amino modi fi cat ion법에 의한 구조변형 siRNA 함유 조성물 (실시예 7-3)이 항
암 활성이 좋을 것으로 판단된다. 실시예 11. 구조변형 siRNA의 암세포주 사멸효과 확인
폐암세포주 (A549; 서울대 세포주은행)와 자궁경부암 세포주 (HeLa: KRIBB 바 이오활성평가센터, 세포주은행)에 대하여 실시예 3-7의 조성물 (siRNA 5nM), 실시예 7-3의 조성물 (siRNA 5nM), 실시예 3에서 제조한 siScram 함유 조성물 (siRNA 5nM)을 처리한 후, 시간에 따른 cell cycle 변화를 FACS(Fluorescence Activated Cell Sorter) 분석법으로 하기와 같이 수행하였다.
폐암 세포주와 자궁경부암 세포주에 siRNA (scram, 3-7, 7-3)를 각각 5 nM 처리한 후 시간 경과에 따라 세포를 취해 PKpropidium iodide)를 사용하여 염색체
TM
DNA를 염색한 후, DNA 함량을 분석하는 FACScan (Becton, Dickinson and company)을 이용하여 세포 주기를 확인하였다.
그 결과를 도 11과 12에 나타내었다. 도 11은 폐암세포주 (A549)에 대한 시간 별 세포주기변화를 나타낸 그래프이며, 도 12는 자궁경부암 세포주 (HeLa)에 대한 시간별 세포주기변화를 나타낸 그래프이다.
도 11과 12에서 G2/M, S, Gl, sub G1는 세포주기를 나타내고, 그 중 sub G1 은 세포사멸기를 나타내는 것으로, sub Gl에 해당하는 세포의 비율이 클수록ᅤ 세포 사멸이 증가함을 나타낸다.
상기 결과로부터 실시예 3-7의 조성물과 아미노 수식 구조변형 siRNA 함유 조성물 (실시예 7-3) 처리시 sub-Gl에 해당하는 세포의 비율이 시간이 지남에 따라 증가하는 것으로부터, 시간에 따라 세포사멸이 증가함을 알 수 있다. 또한, 아미노 수식 구조변형 siRNA 함유 조성물 (실시예 그 3) 처리시 구조변형 전에 비해 sub-Gl 비율이 더 크므로, 구조변형 siRNA가 세포 내에서 더 좋은 항암활성을 나타낼 것으 로 보인다. 실시예 12. FLJ25416 발현억제 siRNA에 의한 in />O에서 항암 효과 확인
FLJ25416 유전자의 발현을 억제시키는 siRNA가 in 에서 항암 효과를 나 타내는 것을 확인하기 위해 A549 폐암모델 누드마우스를 사용하여 하기와 같이 실 험하였다ᅳ 폐암 세포주 (A549 ) 5X106 세포를 lOOul Hanks' Balanced salt solution(HBSS)으로 부유하여 생후 7~8주된 누드마우스 (오리엔트)의 복벽에 피하주 사하였다. 종양세포 이식 후 약 10-14일경, 종양의 크기가 약 50-70 隱 3 정도 성장
1 하면, 누드마우스를 네군으로 나누어 한 군은 음성대조군으로 하고, 나머지 세 군 에 대하여는 각각 실시예 그 3의 조성물을 siRNA 기준으로 0.1mg/kg, 0.5mg/kg, 1.0mg/kg 용량으로 하여 이를 간격으로 5회 종양 내에 직접 투여한 후, 이를 간격 으로 종양의 크기를 측정하였다. 음성대조군에는 PBS(Phosphate Buffered Saline) 를 투여하였다ᅳ 그 결과를 도 13과 도 14에 나타내었다. 도 13과 도 14는 실시예
7-3의 조성물 투여군별 투여기간에 따른 종양크기 변화를 나타낸 그래프이다. 도 13과 도 14에서 'PBS'는 PBS 투여군을 의미하고, 1 siF7-amino'는 실시예 7-3의 조 성물 투여군을 의미한다. 16일간 관찰한 결과 실시예 7(3)의 siRNA 0.5mg/kg 투여 한 군에서 종양의 크기가 자라지 않았고, 1.0mg/kg 투여한 군에서 15일째 종양의 크기가 초기보다 감소함을 알 수 있다. 또한, 34일 경과시까지 측정한 결과 농도의 존적으로 종양의 성장을 억제함을 알 수 있다. 0.1 mg/kg 투여한 군에서 28.1%, 0.5 mg/kg 투여한 군에서 56.5%, 1.0mg/kg 투여한 군에서 69.6% 종양이 감소하였 다. 따라서, 본 발명의 siRNA가 탁월한 항종양 효과를 가짐을 알 수 있다. 실시예 13. 안티센스 RNA의 제조
실시예 2의 siRNA 제조 중 합성된 안티센스의 합성과 동일한 방법으로 RNA를 합성하되, 각각 표 2의 서열번호 14, 18, 22의 서열을 갖도록 RNA(13-l~13-3)를 합 성하였다. 실시예 14. shRNA를 암호화하는 DNA의 디자인 및 제조
표 2의 서열번호 13과 14의 서열이 루프서열로 연결된 shRNA를 암호화하는 DNA, 서열번호 17과 18의 서열이 루프서열로 연결된 shRNA를 암호화하는 DNA,서열 번화 21과 22의 서열이 루프서열로 연결된 shRNA를 암호화하는 DNA를 하기 방법으 로 디자인하고 제조하였다.
구체적으로, 표 2의 서열번호 13과 서열번호 14에 해당하는 DNA 염기서열 사 이에 루프서열 (GAGCTC)을 갖는 서열번호 28의 염기서열과 이에 상보적인 DNA 서열, 서열번호 17 과 서열번호 18에 해당하는 DNA 염기서열 사이에 루프서열 (GAGCTC)을 갖는 서열번호 29의 염기서열과 이에 상보적인 DNA 서열, 서열번호 21과 서열번호 22에 해당하는 DNA 염기서열 사이에 루프서열 (GAGCTC)을 갖는 서열번호 30의 염기 서열과 이에 상보적인 DNA 서열을 디자인 한 후 해당 올리고뉴클레오타이드를 제조 하였다 ((주 )바이오니아, 대한민국
각 쌍의 상보적인 DNA 올리고를 붙인 후 레트로바이러스인 아데노바이러스
(adenovirus) 방법으로 세포 내에서 RNAi 효과를 나타내도록 할 수 있다 (대한민국 특허공개공보 게 10-2009-0060183호).
【산업상 이용가능성】
본 발명의 FLJ25416 전사체 (mRNA)의 염기서열에 상보적인 siRNA, 안티센스 RNA 및 /또는 shRNA는 리보핵산 매개 간섭현상 (RNA-mediated interference, RNAi)에 의해 암세포에 공통적으로 발현되는 FLJ25416의 발현을 억제하여 암세포를 사멸시 키므로, 본 발명의 조성물은 우수한 항암제로 이용될 수 있어 산업상 이용가능성을 갖는다.
Claims
【청구의 범위】
【청구항 11
서열번호 3, 서열번호 5, 또는 서열번호 7의 FLJ25416 전사체 (mRNA transcript) 염기서열에 상보적으로 결합하여 세포 내에서 FLJ25416의 발현을 억제 하는 siRNA, FLJ25416의 발현을 억제하는 안티센스 RNA, 및 FLJ25416의 발현을 억 제하는 shRNA를 암호화하는 DNA 중에서 선택된 하나 이상을 포함하는 암치료용 약 학 조성물.
【청구항 2】
게 1항에 있어서, 상기 siRNA는
서열번호 13의 센스 서열 및 서열번호 14의 안티센스 서열을 갖는 siRNA, 서열번호 17의 센스 서열 및 서열번호 18의 안티센스 서열을 갖는 siRNA, 및 서열번호 21의 센스 서열 및 서열번호 22의 안티센스 서열을 갖는 siRNA 중 에서 선택된 하나 이상인 조성물.
【청구항 3]
게 1항에 있어서, 상기 안티센스 RNA는
서열번호 14의 서열을 갖는 안티센스 RNA,
서열번호 18의 서열을 갖는 안티센스 RNA, 및
서열번호 22의 서열을 갖는 안티센스 RNA 중에서 선택된 하나 이상인 조성 물
【청구항 4]
게 1항에 있어서, 상기 DNA는
서열번호 28의 염기서열을 갖는 DNA,
서열번호 29의 염기서열을 갖는 DNA, 및
서열번호 30의 염기서열을 갖는 DNA 중에서 선택된 하나 이상인 조성물.
【청구항 5】
제 1항에 있어서, 상기 siRNA는 2'-0—메틸 수식, 21— F 수식, 아미노 수식 , 또 는 콜레스테를 컨쥬게이트 중에서 선택된 하나 이상에 의해 구조변형된 형태의 것 인 조성물.
【청구항 6]
거 U항 내지 제 5항 중 어느 한 항에 있어서, 상기 조성물은 핵산 전달체를 추 가로 포함하는 조성물.
【청구항 7]
제 6항에 있어서, 상기 핵산 전달체는 양이온성 리포좀 또는 양이온성 고분자 중에서 선택된 하나 이상인 조성물.
[청구항 8】
제 1항 내지 제 5항 중 어느 한 항에 있어서, 상기 암치료는 폐암, 자궁경부 암, 대장암, 위암, 및 간암 중에서 선택된 하나 이상의 암을 치료하는 것인 조성
【청구항 9]
FLJ25416 발현을 억제하고 서열번호 13의 센스 서열 및 서열번호 14의 안티 센스 서열을 갖는 siRNA.
【청구항 10]
FLJ25416 발현을 억제하고, 서열번호 17의 센스 서열 및 서열번호 18의 안티 센스 서열을 갖는 siRNA.
【청구항 11]
FLJ25416 발현을 억제하고, 서열번호 21의 센스 서열 및 서열번호 22의 안티 센스 서열을 갖는 siRNA.
【청구항 12]
FLJ25416 발현을 억제하고, 서열번호 14의 서열을 갖는 안티센스 RNA.
【청구항 13]
FLJ25416 발현을 억제하고, 서열번호 18의 서열을 갖는 안티센스 RNA.
【청구항 14]
FLJ25416 발현을 억제하고, 서열번호 22의 서열을 갖는 안티센스 RNA.
【청구항 15】
FLJ25416 발현을 억제하는 shRNA를 암호화하는 서열번호 28의 염기서열을 갖 는 DNA.
【청구항 16]
FLJ25416 발현을 억제하는 shRNA를 암호화하는 서열번호 29의 염기서열을 갖 는 DNA.
【청구항 17】
FLJ25416 발현을 억제하는 shRNA를 암호화하는 서열번호 30의 염기서열을 갖 는 DNA.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US13/512,583 US8846630B2 (en) | 2009-11-30 | 2010-11-01 | Pharmaceutical composition for treating cancer |
| US14/476,459 US9217149B2 (en) | 2009-11-30 | 2014-09-03 | Pharmaceutical composition for treating cancer |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020090116727A KR101168726B1 (ko) | 2009-11-30 | 2009-11-30 | 암 치료용 약학 조성물 |
| KR10-2009-0116727 | 2009-11-30 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US13/512,583 A-371-Of-International US8846630B2 (en) | 2009-11-30 | 2010-11-01 | Pharmaceutical composition for treating cancer |
| US14/476,459 Division US9217149B2 (en) | 2009-11-30 | 2014-09-03 | Pharmaceutical composition for treating cancer |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2011065677A2 true WO2011065677A2 (ko) | 2011-06-03 |
| WO2011065677A3 WO2011065677A3 (ko) | 2011-11-03 |
Family
ID=44067041
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2010/007600 Ceased WO2011065677A2 (ko) | 2009-11-30 | 2010-11-01 | 암 치료용 약학 조성물 |
Country Status (3)
| Country | Link |
|---|---|
| US (2) | US8846630B2 (ko) |
| KR (1) | KR101168726B1 (ko) |
| WO (1) | WO2011065677A2 (ko) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101168726B1 (ko) | 2009-11-30 | 2012-07-30 | 한국생명공학연구원 | 암 치료용 약학 조성물 |
| WO2019022586A2 (ko) * | 2017-07-28 | 2019-01-31 | 주식회사 레모넥스 | 간암의 예방 또는 치료용 약학적 조성물 |
| KR102532779B1 (ko) | 2017-09-08 | 2023-05-16 | 한국생명공학연구원 | Ddias 억제제 및 사멸 수용체 리간드를 포함하는 암의 예방 또는 치료용 조성물 |
| CN113215162B (zh) * | 2021-06-02 | 2023-08-22 | 山西医科大学 | 降低铝致Aβ1-42表达水平的干扰RNA及其应用 |
Family Cites Families (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040106567A1 (en) | 1999-09-07 | 2004-06-03 | Hagstrom James E. | Intravascular delivery of non-viral nucleic acid |
| EP1272630A2 (en) | 2000-03-16 | 2003-01-08 | Genetica, Inc. | Methods and compositions for rna interference |
| AU2003295600A1 (en) * | 2002-11-14 | 2004-06-15 | Dharmacon, Inc. | Functional and hyperfunctional sirna |
| US20060035815A1 (en) | 2004-05-04 | 2006-02-16 | Nastech Pharmaceutical Company Inc. | Pharmaceutical compositions for delivery of ribonucleic acid to a cell |
| WO2005116204A1 (ja) * | 2004-05-11 | 2005-12-08 | Rnai Co., Ltd. | Rna干渉を生じさせるポリヌクレオチド、および、これを用いた遺伝子発現抑制方法 |
| CA2619533C (en) * | 2005-08-17 | 2014-02-04 | Bioneer Corporation | Sirna-hydrophilic polymer conjugates for intracellular delivery of sirna and method thereof |
| KR20080044909A (ko) | 2005-09-08 | 2008-05-21 | 나스텍 파마수티컬 컴퍼니 인코포레이티드 | 세포 내로 리보핵산의 전달을 위한 약학 조성물 |
| JP5625143B2 (ja) | 2007-06-20 | 2014-11-19 | 独立行政法人産業技術総合研究所 | モータリンsiRNAを含む癌治療剤 |
| US8486905B2 (en) | 2007-12-06 | 2013-07-16 | Korea Research Institute Of Bioscience And Biotechnology | Use of FLJ25416 gene |
| KR20090083804A (ko) | 2008-01-30 | 2009-08-04 | 한국생명공학연구원 | 표적 아형 mRNA의 선택적 발현 억제를 위한 siRNA서열을 선정하는 방법 |
| KR101051435B1 (ko) | 2008-10-22 | 2011-07-22 | 한국생명공학연구원 | 대장암 관련 마커를 이용한 대장암 진단 키트 및 이를 이용한 대장암 진단 방법 |
| KR101168726B1 (ko) | 2009-11-30 | 2012-07-30 | 한국생명공학연구원 | 암 치료용 약학 조성물 |
-
2009
- 2009-11-30 KR KR1020090116727A patent/KR101168726B1/ko active Active
-
2010
- 2010-11-01 WO PCT/KR2010/007600 patent/WO2011065677A2/ko not_active Ceased
- 2010-11-01 US US13/512,583 patent/US8846630B2/en active Active
-
2014
- 2014-09-03 US US14/476,459 patent/US9217149B2/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| US9217149B2 (en) | 2015-12-22 |
| US20130028957A1 (en) | 2013-01-31 |
| US20140371300A1 (en) | 2014-12-18 |
| US8846630B2 (en) | 2014-09-30 |
| KR101168726B1 (ko) | 2012-07-30 |
| KR20110060209A (ko) | 2011-06-08 |
| WO2011065677A3 (ko) | 2011-11-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107075515B (zh) | C/EBPα组合物和使用方法 | |
| JP2023158214A (ja) | Hif2αの遺伝子発現を阻害する組成物及び方法 | |
| EP4183882A1 (en) | Stabilized hnf4a sarna compositions and methods of use | |
| CA2946407A1 (en) | Multiple targeted rnai for the treatment of cancers | |
| WO2008087642A2 (en) | Nucleic acid constructs and methods for specific silencing of h19 | |
| KR20150006742A (ko) | 간암 연관 유전자 특이적 siRNA, 그러한 siRNA를 포함하는 이중나선 올리고 RNA 구조체 및 이를 포함하는 암 예방 또는 치료용 조성물 | |
| EP3134528A1 (en) | Multiple targeted rnai for the treatment of cancers | |
| US20240167022A1 (en) | Template directed immunomodulation for cancer therapy | |
| US9217149B2 (en) | Pharmaceutical composition for treating cancer | |
| JP2014504501A (ja) | Hif1αの発現を阻害するsiRNAおよびこれを含む抗癌組成物 | |
| JP5406024B2 (ja) | Bcl−XL特異的siNAを用いる癌治療法 | |
| TW201038278A (en) | Rnai molecule for thymidylate synthase and use thereof | |
| CN107709561B (zh) | 修饰的siRNA及含有该修饰的siRNA的药物组合物 | |
| Yin et al. | Asymmetric siRNA targeting the bcl-2 gene inhibits the proliferation of cancer cells in vitro and in vivo | |
| US20130259926A1 (en) | BI-FUNCTIONAL shRNA TARGETING MESOTHELIN AND USES THEREOF | |
| CN105176999A (zh) | 抑制survivin基因表达的双链siRNA、其应用及包含其的表达质粒及传递体 | |
| KR20210121079A (ko) | 종양 치료를 위한 올리고뉴클레오티드 분자 및 그의 이용 | |
| JP7525578B2 (ja) | C/EBPα小分子活性化RNA組成物 | |
| JP2013039036A (ja) | HIF−2αの発現を抑制する核酸 | |
| WO2025166047A1 (en) | Composition and method for preventing or treating influenza | |
| CN119563025A (zh) | 一种抑制LP(a)基因表达的dsRNA分子及其应用 | |
| JP2004350607A (ja) | テロメレース阻害剤 | |
| WO2025252159A1 (zh) | 调控LPA表达的dsRNA分子 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10833489 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13512583 Country of ref document: US |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 10833489 Country of ref document: EP Kind code of ref document: A2 |


