WO2011051466A1 - Anti-idiotypic fibronectin-based binding molecules and uses thereof - Google Patents

Anti-idiotypic fibronectin-based binding molecules and uses thereof Download PDF

Info

Publication number
WO2011051466A1
WO2011051466A1 PCT/EP2010/066503 EP2010066503W WO2011051466A1 WO 2011051466 A1 WO2011051466 A1 WO 2011051466A1 EP 2010066503 W EP2010066503 W EP 2010066503W WO 2011051466 A1 WO2011051466 A1 WO 2011051466A1
Authority
WO
WIPO (PCT)
Prior art keywords
idiotypic
polypeptide
antibody
polypeptides
antigen
Prior art date
Application number
PCT/EP2010/066503
Other languages
French (fr)
Inventor
Andreas Loew
Jasbir Sagoo
Original Assignee
Novartis Ag
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novartis Ag filed Critical Novartis Ag
Publication of WO2011051466A1 publication Critical patent/WO2011051466A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/78—Connective tissue peptides, e.g. collagen, elastin, laminin, fibronectin, vitronectin or cold insoluble globulin [CIG]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
    • C07K16/1018—Orthomyxoviridae, e.g. influenza virus
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2318/00—Antibody mimetics or scaffolds
    • C07K2318/20—Antigen-binding scaffold molecules wherein the scaffold is not an immunoglobulin variable region or antibody mimetics

Definitions

  • Molecules capable of specific binding to a desired target epitope are of enormous importance as both therapeutics and medical diagnostic tools.
  • a well known example of this class of molecules is the monoclonal antibody.
  • Antibodies can be selected that bind specifically and with high affinity to almost any structural epitope.
  • an anti-idiotypic antibody that is directed against antigen combining sites of primary antibody (Abl)
  • Abs2 antigen combining sites of primary antibody
  • An anti-idiotypic antibody will not contain the nominal antigen, thus avoiding any undesirable adverse effects associated with use of that antigen as an immunogen.
  • monoclonal antibodies and anti-idiotypic antibodies have a number of shortcomings.
  • classical antibodies and and anti-idiotypic are large and complex molecules. They have a heterotetramenc structure comprising two light chains and two heavy chains connected together by both inter and intra disulphide linkages.
  • This structural complexity precludes easy expression of antibodies in simple prokaryotic systems and requires that antibodies are produced in more elaborate (and expensive) mammalian cell systems.
  • the large size of antibodies also limits their therapeutic effectiveness since they are often unable to efficiently penetrate certain tissue spaces.
  • therapeutic antibodies because they possess an Fc region, occasionally trigger undesired effector cell function and/or clotting cascades.
  • the present invention provides biologically active peptide mimetics based on a fibronectin type III (Fn3) scaffold that specifically bind to a target antigen and, thus, can be used in a broad variety of therapeutic and diagnostic applications.
  • the anti-idiotypic Fn3 polypeptides generated, structurally and/or functionally, mimic antigenic determinants. They serve as surrogate antigens for therapeutic and diagnostic purposes, e.g. antibodies or Fn3-based binding molecules. Such an approach is especially useful when the antigen is infectious, toxic, or where the availability of antigen is limiting, e.g., difficult to isolate and purify.
  • the anti-idiotypic Fn3 polypeptides themselves can also serve as antigens to produce anti-anti-idiotypic Fn3 polypeptides.
  • the invention pertains to an anti-idiotypic Fn3 polypeptide that binds to an antibody which binds to a target antigen.
  • the anti-idiotypic Fn3 polypeptide comprises at least two adjacent Fn ⁇ -strand domain sequences selected from the group of A-G with a loop region sequence linked between adjacent ⁇ -strand domain sequences.
  • the loop region sequence is selected from the group of loops AB, BC, CD, DE, EF, and FG.
  • At least one loop region sequence comprises an antigen mimic sequence that binds to the antibody. Competition assays can be used to test the anti-idiotypic Fn3 polypeptides.
  • the anti-idiotypic Fn3 polypeptide further comprises a half life extender molecule such as antibody Fc regions, Human Serum Albumin (HSA) (or portions thereof), polyethylene glycol (PEG) and/or polypeptides which bind to the aforementioned proteins or other serum proteins with increased half-life, such as, e.g., transferrin.
  • HSA Human Serum Albumin
  • PEG polyethylene glycol
  • Any one of the fourteen domains of Fn3 can be used in accordance with the invention, and in particular the tenth domain of human Fn3 (10Fn3).
  • amino acid residues surrounding the loop regions may also be used to generate anti-idiotypic Fn3 polypeptides.
  • the invention pertains to an anti-anti-idiotypic fibronectin type III (Fn3) polypeptide which binds to an anti-idiotypic Fn3 polypeptide.
  • the anti- idiotypic Fn3 polypeptide comprises at least two adjacent Fn ⁇ -strand domain sequences selected from the group of A-G with a loop region sequence linked between adjacent ⁇ - strand domain sequences, the loop region sequence being selected from the group of loops AB, BC, CD, DE, EF, and FG; wherein at least one loop region sequence comprises an antigen mimic sequence that binds to an antibody which binds to a target antigen.
  • the invention pertains to a method of producing an anti- idiotypic Fn3 polypeptide with at least two adjacent Fn ⁇ -strand domain sequences selected from the group of A-G with a loop region sequence linked between adjacent ⁇ -strand domain sequences.
  • the method involves providing an antibody against a target antigen; exposing the antibody to a yeast display library expressing Fn3 polypeptides; and enriching for Fn3 polypeptides that comprise an antigen mimic sequence which binds to the antibody, wherein the antigen mimic sequence is present in a loop region sequence selected from the group of loops AB, BC, CD, DE, EF, and FG.
  • compositions comprising the anti- idiotypic Fn3 polypeptides or anti-anti-idiotypic Fn3 polypeptides formulated with a suitable carrier. Accordingly, in another aspect, the invention pertains to pharmaceutical compositions comprising an therapeutically effective amount of either an anti-idiotypic Fn3 polypeptide, or an anti-anti-idiotypic Fn3 polypeptide and a pharmaceutically acceptable carrier.
  • the anti-idiotypic Fn3 or anti-anti-idiotypic Fn3 polypeptides of the invention can be used in a variety of therapeutic and diagnostic applications including, but not limited to, applications that antibodies can be used in. Such applications include, for example, treatment and diagnosis of autoimmune diseases, cancers and infectious diseases.
  • the anti-idiotypic Fn3 polypeptides of the invention can be based on wild- type Fn3 sequences, (e.g., human Fn3 having the amino acid sequence shown in SEQ ID NO:l) as well as modified versions of such wild type sequences.
  • Figure 1 shows a ribbon diagram of a Fn3-based binding molecule with loop and framework residues constituting the ligand binding surfaces highlighted.
  • Figure 2 depicts a schematic showing the top and bottom loop faces of Fn3.
  • Figures 3 a and b shows a schematic showing how to generate anti-idiotypic
  • Figure 4 shows a schematic showing how to generate anti-anti-idiotypic Fn3 polypeptides.
  • Figure 5 depicts the HA anti-idiotypic Fn3 polypeptides showing the loop regions with the HA antigen mimic sequence.
  • Figure 6 shows the Biacore affinity binding graph of a HA anti-idiotypic Fn3 polypeptide binding to an anti-HA monoclonal antibody.
  • antibody refers to an intact antibody or an antigen binding fragment (i.e., "antigen-binding portion") or single chain (i.e., light or heavy chain) thereof.
  • An intact antibody is a glycoprotein comprising at least two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds.
  • Each heavy chain is comprised of a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region.
  • the heavy chain constant region is comprised of three domains, CHI, CH2 and CH3.
  • Each light chain is comprised of a light chain variable region (abbreviated herein as VL) and a light chain constant region.
  • the light chain constant region is comprised of one domain, CL.
  • the VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR).
  • CDR complementarity determining regions
  • FR framework regions
  • Each VH and VL is composed of three CDRs and four FRs arranged from amino- terminus to carboxy- terminus in the following order: FRl, CDRl, FR2, CDR2, FR3, CDR3, FR4.
  • the variable regions of the heavy and light chains contain a binding domain that interacts with an antigen.
  • the constant regions of the antibodies may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system.
  • antigen binding portion of an antibody refers to one or more fragments of an intact antibody that retain the ability to specifically bind to a given antigen (e.g., HA).
  • Antigen binding functions of an antibody can be performed by fragments of an intact antibody.
  • binding fragments encompassed within the term "antigen binding portion" of an antibody include a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CHI domains; an F(ab)2 fragment, a bivalent fragment comprising two Fab fragments (generally one from a heavy chain and one from a light chain) linked by a disulfide bridge at the hinge region; an Fd fragment consisting of the VH and CHI domains; an Fv fragment consisting of the VL and VH domains of a single arm of an antibody ; a single domain antibody (dAb) fragment (Ward et al., 1989 Nature 341 :544-546), which consists of a VH domain; and an isolated complementarity determining region (CDR).
  • Fab fragment a monovalent fragment consisting of the VL, VH, CL and CHI domains
  • F(ab)2 fragment a bivalent fragment comprising two Fab fragments (generally one from a heavy chain and one from a light
  • the two domains of the Fv fragment, VL and VH are coded for by separate genes, they can be joined, using recombinant methods, by an artificial peptide linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv); see, e.g., Bird et al., 1988 Science 242:423-426; and Huston et al., 1988 Proc. Natl. Acad. Sci.
  • scFv single chain Fv
  • Such single chain antibodies include one or more "antigen binding portions" of an antibody. These antibody fragments are obtained using conventional techniques known to those of skill in the art, and the fragments are screened for utility in the same manner as are intact antibodies.
  • Antigen binding portions can also be incorporated into single domain antibodies, maxibodies, minibodies, intrabodies, diabodies, triabodies, tetrabodies, v-NAR and bis-scFv (see, e.g., Hollinger and Hudson, 2005, Nature Biotechnology, 23, 9, 1 126- 1 136).
  • Antigen binding portions can be incorporated into single chain molecules comprising a pair of tandem Fv segments (VH-CH1 -VH-CH1) which, together with complementary light chain polypeptides, form a pair of antigen binding regions (Zapata et al., 1995 Protein Eng. 8(10): 1057- 1062; and U.S. Pat. No. 5,641,870).
  • human monoclonal antibody refers to an antibody displaying a single binding specificity that has variable regions in which both the framework and CDR regions are derived from human sequences.
  • the human monoclonal antibody is produced by a hybridoma that includes a B cell obtained from a transgenic nonhuman animal (e.g., a transgenic mouse having a genome comprising a human heavy chain transgene and a light chain transgene) fused to an immortalized cell.
  • recombinant human antibody includes any human antibody that is prepared, expressed, created or isolated by recombinant means, such as an antibody isolated from an animal (e.g., a mouse) that is transgenic or transchromosomal for human immunoglobulin genes or a hybridoma prepared therefrom; an antibody isolated from a host cell transformed to express the human antibody, e.g., from a transfectoma; an antibody isolated from a recombinant, combinatorial human antibody library; and an antibody prepared, expressed, created or isolated by any other means that involve splicing of all or a portion of a human immunoglobulin gene sequences to another DNA sequence.
  • an animal e.g., a mouse
  • transgenic or transchromosomal for human immunoglobulin genes or a hybridoma prepared therefrom
  • an antibody isolated from a host cell transformed to express the human antibody e.g., from a transfectoma
  • Such recombinant human antibodies have variable regions in which the framework and CDR regions are derived from human germline immunoglobulin sequences.
  • such recombinant human antibodies can be subjected to in vitro mutagenesis (or, when an animal transgenic for human Ig sequences is used, in vivo somatic mutagenesis) and thus the amino acid sequences of the VH and VL regions of the recombinant antibodies are sequences that, while derived from and related to human germline VH and VL sequences, may not naturally exist within the human antibody germline repertoire in a human.
  • isotype refers to the antibody class (e.g., IgM, IgE,
  • IgG such as IgGl or IgG4 that is encoded by the heavy chain constant region gene.
  • idiotype refers to part of a variable region of an antibody that is unique for each antibody type.
  • single chain antibody refers to an antigen binding portion of a light chain variable region and an antigen binding portion of a heavy chain variable region, joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form
  • scFv single chain Fv
  • camelid nanobody refers to a region of camelid antibody which is the small single variable domain devoid of light chain and that can be obtained by genetic engineering to yield a small protein having high affinity for a target, resulting in a low molecular weight antibody-derived protein. See WO07042289 and U.S. patent number 5,759,808 issued June 2, 1998; see also Stijlemans, B. et al., 2004.
  • telomere binding' refers to the ability of an anti-idiotypic Fn3 polypeptides to bind to a target with an affinity of at least 1 x 10 "6 M, and/or bind to a target with an affinity that is at least two-fold, (preferably at least 10 fold), greater than its affinity for a nonspecific antigen at room temperature under standard physiological salt and pH conditions, as measured by surface plasmon resonance.
  • Fibronectin type III domain refers to a wild-type Fn3 domain from any organism, as well as chimeric Fn3 domains constructed from beta strands from two or more different Fn3 domains.
  • naturally occurring Fn3 domains have a beta-sandwich structure composed of seven beta-strands, referred to as A, B, C, D, E, F, and G, linked by six loops, referred to as AB, BC, CD, DE, EF, and FG loops (See e.g., Bork and Doolittle, Proc. Natl. Acad. Sci. U.S.A 89:8990, 1992; Bork et al, Nature Biotech. 15:553, 1997; Meinke et al., J. Bacteriol.
  • the Fn3 domain is from the tenth Fn3 domain of human Fibronectin ( 10 Fn3) (SEQ. ID. NO: 1).
  • VSDVPRDLEWAATPTSLLI SWDAPAV VRYYRI YGETGGNS PVQEFTVPGSKS TATI SGL KPGVDY I VYAVTGRGDS PAS SKPI S I YRTEI (SEQ ID NO: 1)
  • target antigen refers to an antigen or epitope recognized by anti- idiotypic Fn3 polypeptides of the invention.
  • Targets include, but are not limited to, epitopes present on proteins, peptides, carbohydrates, and/or lipids.
  • antigen mimic sequence refers to an amino acid sequence that emulate antigenic determinants and thus serves as a surrogate antigen.
  • the antigen mimic sequence resembles the antigen at the molecular level and/or a structural level to elicit a desired response.
  • anti-idiotypic Fn3 polypeptide refers to a Fn3 polypeptide molecule that binds to an antibody which binds to a target antigen.
  • the Fn3 domain of the anti-idiotypic Fn3 polypeptide has been altered to contain one or more antigen mimic sequence(s) that bind to the antibody of the target antigen.
  • the antigen mimic sequence is essentially a molecular and/or structural mimic or the target antigen.
  • one or more of the top BC, DE, and/or FG loops are altered compared to the corresponding wild-type Fn3 domain to contain the antigen mimic sequence(s) that bind to the antibody of the target antigen.
  • one or more of the bottom AB, CD and/or EF loops are altered compared to the corresponding wild-type Fn3 domain to contain antigen mimic sequence(s) that bind to the antibody of the target antigen.
  • one or more of the bottom AB, CD or EF loops and one or more of the top BC, DE and FG loops are altered compared to the corresponding wild-type Fn3 domain to contain antigen mimic sequence(s) that bind to the antibody of the target antigen.
  • the anti-idiotypic Fn3 polypeptide can be used as a surrogate antigen to produce antibodies or antigen binding molecules.
  • the anti-idiotypic Fn3 polypeptide can also be used as a surrogate antigen to produce other Fn3-based binding molecules such as anti-anti-idiotypic Fn3 polypeptides.
  • anti-anti-idiotypic Fn3 polypeptide refers to a Fn3 polypeptide molecule which binds to an anti-idiotypic Fn3 polypeptides.
  • the anti-idiotypic Fn3 polypeptide acts as a surrogate antigen to generate an anti- anti-idiotypic Fn3 polypeptide.
  • the anti-anti-idiotypic Fn3 polypeptide is essentially a binding molecule against the surrogate antigen.
  • non-Fn3 moiety refers to a biological or chemical entity that imparts additional functionality to a molecule to which it is attached.
  • the non-Fn3 moiety is a polypeptide, e.g., human serum albumin (HSA), or a chemical entity, e.g., polyethylene gycol (PEG) which increases the half-life of the Fn3- based binding molecule in vivo.
  • HSA human serum albumin
  • PEG polyethylene gycol
  • non-natural amino acid residue refers to an amino acid residue that is not present in the naturally occurring (wild-type) Fn3 domain. Such non-natural amino acid residues can be introduced by substitution of naturally occurring amino acids, and/or by insertion of non-natural amino acids into the naturally occurring amino acid Fn3 sequence. The non-natural amino acid residue also can be incorporated such that a desired functionality is imparted to the Fn3-based binding molecule, for example, the ability to link a functional moiety (e.g., PEG).
  • a functional moiety e.g., PEG
  • polyethylene glycol or “PEG” refers to a polyalkylene glycol compound or a derivative thereof, with or without coupling agents or derviatization with coupling or activating moieties.
  • the present invention provides anti-idiotypic Fn3 polypeptides that specifically bind to an antibody of a target antigen.
  • the invention provides for anti-idiotypic Fn3 polypeptides in which at least one or more of the top BC, DE, and/or FG loop regions, and/or at least one or more of the bottom AB, CD, EF loop regions comprises an antigen mimic sequence that binds to the antibody of the target antigen.
  • anti- idiotypic Fn3 polypeptides can be attached to a half-life extender such as Human Serum Albumin (HSA) to generate anti-idiotypic Fn3 polypeptides with an improved half life and stability.
  • HSA Human Serum Albumin
  • the anti-idiotypic Fn3 polypeptides can be engineered such that the top loops bind to an antibody of a target antigen and the bottom loops bind to a half-life extender. In another embodiment, the anti-idiotypic Fn3 polypeptides can be engineered such that the bottom loops bind to an antibody of a target antigen and the top loops bind to a half-life extender.
  • the anti-idiotypic Fn3 polypeptides can be used in a variety of therapeutic and diagnostic applications, much like other binding molecules, such as antibodies. Antibodies or other Fn3 -based binding molecules can be produced using these anti-idiotypic Fn3 polypeptides as surrogate antigens.
  • the present invention also provides for anti-anti-idiotypic Fn3 polypeptides that specifically bind to an anti-idiotypic Fn3 polypeptide.
  • the anti-idiotypic Fn3 polypeptide acts as a surrogate antigen and the anti-anti-idiotypic Fn3 polypeptide as a binding molecule against the surrogate antigen.
  • the anti-idiotypic Fn3 polypeptide is the surrogate HA antigen
  • the anti-anti-idiotypic Fn3 polypeptide is the equivalent of a surrogate anti-HA antibody.
  • the anti-idiotypic Fn3 polypepties generated may mimic antigenic determinants and may thus serve as surrogate antigens for therapeutic and diagnostic purposes, e.g. for applications where the availability of antigen is limiting.
  • Applications include competitive immunoassays or direct serological assays.
  • Advantages of using "internal image" anti-idiotypic antibodies instead of conventional antigens include ease of production, safety of use in cases where the antigen is toxic or hazardous for other reasons, ease of purification, established methods for the attachment of label, and possibilities for the attachment to a solid support without loss of immunoreactivity.
  • the invention provides anti-idiotypic Fn3 polypeptides which are altered compared to the wild-type Fn3 domain (e.g., in the bottom and/or top loop regions) to have one or more antigen mimic sequence(s) that binds to an antibody of the target antigen.
  • the anti-idiotypic Fn3 polypeptides use the bottom AB, CD, EF loops comprising one or more antigen mimic sequence(s) to bind to an antibody of the target antigen.
  • the anti- idiotypic Fn3 polypeptides use the top BC, DE, FG loops comprising one or more antigen mimic sequence(s) to bind to an antibody of the target antigen.
  • anti-HA antibodies against the HA antigen can be used to generate HA anti-idiotypic Fn3 polypeptides that comprise at least one HA antigen mimic sequence in at least one loop region.
  • This anti-idiotypic Fn3 polypeptide with the HA antigen mimic sequence can bind the anti-HA antibody.
  • This anti-idiotypic Fn3 polypeptide with the HA antigen mimic sequence also acts as a surrogate HA antigen, against which anti-anti -idiotypic Fn3 polypeptides can be made.
  • the invention provides an anti-idiotypic
  • the anti- idiotypic Fn3 polypeptide comprises at least two adjacent Fn ⁇ -strand domain sequences selected from the group of A-G with a loop region sequence linked between adjacent ⁇ - strand domain sequences.
  • the loop region sequence is selected from the group of loops AB, BC, CD, DE, EF, and FG; and at least one loop region sequence comprises an antigen mimic sequence that binds to the antibody.
  • the wild type Fn3 domain is a human Fn3 domain, e.g., human 10 Fn3 (SEQ ID NO:l).
  • the invention provides anti-anti-idiotypic Fn3 polypeptides that bind to the anti-idiotypic Fn3 polypeptides.
  • the anti-idiotypic Fn3 polypeptides act as surrogate antigens and the anti-anti-idiotypic Fn3 polypeptides is a binding molecule against the surrogate antigen.
  • the invention provides a library of anti-idiotypic Fn3 polypeptides, which can be used to identify anti-idiotypic Fn3 polypeptide which binds to an antibody of a particular desired target antigen.
  • the library comprises anti-idiotypic Fn3 polypeptides, each of which contains at least one antigen mimic sequence in one or more of AB, BC, CD, DE, EF, FG loop regions compared to a wild-type Fn3 domain, such as the human 10 Fn3 (SEQ ID NO: l).
  • Library diversity can be generated by, for example, random mutagenesis, "walk though mutagenesis, or "look through mutagenesis of one or more of the disclosed residues in SEQ ID NO: l (7,195,880; 6,951,725; 7,078, 197; 7,022,479; 5,922,545;
  • Nucleic acids encoding the library of anti -idiotypic Fn3 polypeptide or variants thereof, described herein can be constructed using art recognized methods including, but not limited to, PCR-based or enzyme-mediate genetic engineering, ab initio DNA or RNA synthesis, and/or cassette mutagenesis.
  • Suitable targets for anti-idiotypic Fn3 polypeptides include, but are not limited to, a cellular receptor, a cellular receptor ligand, a bacteria, a virus., or chemokines.
  • the target is involved in a human disease, e.g., an autoimmune disease, cancer, or an infectious disease. 1. Targets involved in Human Autoimmune and Inflammatory Response
  • the inventions pertains to anti-idiotypic Fn3 polypeptides capable of binding to targets involved in autoimmune and inflammatory responses which include, but are not limited to, C5, CCL1 (1-309), CCL1 1 (eotaxin), CCL13 (mcp-4), CCL15 (MIP-Id), CCL16 (HCC-4), CCL17 (TARC), CCL18 (PARC), CCL19, CCL2 (mcp-1), CCL20 (MIP-3a), CCL21 (MIP-2), CCL23 (MPIF-1), CCL24 (MPIF-2/eotaxin-2), CCL25 (TECK), CCL26, CCL3 (MIP-la), CCL4 (MIP-lb), CCL5 (RANTES), CCL7 (mcp-3), CCL8 (mcp-2), CXCL1, CXCL10 (IP-10), CXCL11(1-TAC/IP- 9), CXCL12 (SDF1), CXCL13,
  • IRAK2, MYD88, NCK2, TNFAIP3, TRADD TRAF1 , TRAF2, TRAF3, TRAF4, TRAF5, TRAF6, ACVR1, ACVR1B, ACVR2, ACVR2B, ACVRL1 , CD28, CD3E, CD3G, CD3Z, CD69, CD80, CD86, CNR1, CTLA4, CYSLTR1, FCER1A, FCER2, FCGR3A, GPR44, HAVCR2, OPRD1, P2RX7, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, BLR1, CCL1, CCL2, CCL3, CCL4, CCL5, CCL7, CCL8, CCL1, CCL13, CCL15, CCL16, CCL17, CCL18, CCL19, CCL20, CCL21 , CCL22, CCL23, CCL24, CCL25, CCRl , CCR2, CCR3, CCR4, CCR5, CCR6,
  • Allergic asthma is characterized by the presence of eosinophilia, goblet cell metaplasia, epithelial cell alterations, airway hyperreactivity (AHR), and Th2 and Thl cytokine expression, as well as elevated serum IgE levels. It is now widely accepted that airway inflammation is the key factor underlying the pathogenesis of asthma, involving a complex interplay of inflammatory cells such as T cells, B cells, eosinophils, mast cells and macrophages, and of their secreted mediators including cytokines and chemokines.
  • Corticosteroids are the most important anti -inflammatory treatment for asthma today, however their mechanism of action is non-specific and safety concerns exist, especially in the juvenile patient population. The development of more specific and targeted therapies is therefore warranted. There is increasing evidence that IL-13 in mice mimics many of the features of asthma, including AHR, mucus hypersecretion and airway fibrosis,
  • IL-13 has been implicated as having a pivotal role in causing pathological responses associated with asthma.
  • the development of anti-IL-13 monoclonal antibody therapy to reduce the effects of IL-13 in the lung is an exciting new approach that offers considerable promise as a novel treatment for asthma.
  • mediators of differential immunological pathways are also involved in asthma pathogenesis, and blocking these mediators, in addition to IL- 13, may offer additional therapeutic benefit.
  • target pairs include, but are not limited to, IL-13 and a pro-inflammatory cytokine, such as tumor necrosis factor-a (TNF-a).
  • TNF-a tumor necrosis factor-a
  • TNF-a may amplify the inflammatory response in asthma and may be linked to disease severity (McDonnell, et al., Progress in Respiratory Research (2001), 31(New Drugs for Asthma, Allergy and COPD), 247-250.). This suggests that blocking bothIL-13 and TNF-a may have beneficial effects, particularly in severe airway disease.
  • Animal models such as OVA-induced asthma mouse model, where both inflammation and AHR can be assessed, are known in the art and may be used to determine the ability of various anti-idiotypic Fn3 polypeptides to treat asthma.
  • Animal models for studying asthma are disclosed in Coffman, et al., Journal of Experimental Medicine (2005), 201(12), 1875-1879; Lloyd, et al., Advances in Immunology (2001), 77, 263-295; Boyce et al., Journal of Experimental Medicine (2005), 201(12), 1869-1873; and Snibson, et al., Journal of the British Society for Allergy and Clinical Immunology (2005), 35(2), 146-52.
  • the inventions pertains to anti-idiotypic Fn3 polypeptides capable of binding to targets involved in asthma which include, but are not limited to, CSFl (MCSF), CSF2 (GM-CSF), CSF3 (GCSF), FGF2, IFNA1 , IFNB1, IFNG, histamine and histamine receptors, ILIA, ILIB, IL2, IL3, IL4, IL5, IL6, IL7, IL8, IL9, IL10, ILl 1, IL12A, IL12B, IL13, IL14, IL15, IL16, IL17, ILl 8, IL19, ITLG, PDGFB, IL2RA, IL4R, IL5RA, IL8RA, IL8RB, IL12RB1 , IL12RB2, IL13RA1, IL13RA2, IL18R1, TSLP, CCL1, CCL2, CCL3, CCL4, CCL5, CCL7,
  • RA Rheumatoid arthritis
  • cytokines including TNF, chemokines, and growth factors are expressed in diseased joints.
  • the inventions pertains to anti-idiotypic Fn3 polypeptides capable of binding to targets involved in RA which include, but are not limited to, TNF, IL- 12, IL-15, IL-17, IL-18, IL-23, IL-lbeta and MIF.
  • the immunopathogenic hallmark of SLE is the polyclonal B cell activation, which leads to hyperglobulinemia, autoantibody production and immune complex formation.
  • the fundamental abnormality appears to be the failure of T cells to suppress the forbidden B cell clones due to generalized T cell dysregulation.
  • B and T-cell interaction is facilitated by several cytokines such as IL- 10 as well as co-stimulatory molecules such as CD40 and CD40L, B7 and CD28 and CTLA4, which initiate the second signal.
  • the inventions pertains to anti-idiotypic Fn3 polypeptides capable of binding to targets involved in SLE which include, but are not limited to, B cell targeted therapies: CD-20, CD-22, CD- 19, CD28, CD4, CD80, HLA-DRA, IL10, IL2, IL4,
  • TNFRSF5 TNFRSF6, TNFSF5, TNFSF6, BLR1, HDAC4, HDAC5, HDAC7A, HDAC9, ICOSL, IGBP1, MS4A1, RGS1, SLA2, CD81 , IFNB1, IL10, TNFRSF5, TNFRSF7, TNFSF5, AICDA, BLNK, GALNAC4S-6ST, HDAC4, HDAC5, HDAC7A, HDAC9, IL10, IL11, IL4, INHA, INHBA, KLF6, TNFRSF7, CD28, CD38, CD69, CD80, CD83, CD86, DPP4, FCER2, IL2RA, TNFRSF8, TNFSF7, CD24, CD37, CD40, CD72, CD74, CD79A, CD79B, CR2, IL1R2, ITGA2, ITGA3, MS4A1, ST6GAL1, CD1C, CHST10, HLA-A, HLA-DRA, and NT5E.; co- stimul
  • SLE is considered to be a Th-2 driven disease with documented elevations in serum IL-4, IL-6, IL-10.
  • the compositions of the invention capable of binding one or more targets selected from the group consisting of IL-4, IL-6, IL- 10, IFN- ⁇ , and TNF-a are also contemplated. SLE can be tested in a number of lupus preclinical models (see Peng SL (2004) Methods Mol Med.; 102:227-72).
  • MS Multiple sclerosis
  • MBP myelin basic protein
  • MS is a disease of complex pathologies, which involves infiltration by CD4+ and CD8+ T cells and of response within the central nervous system.
  • Expression in the CNS of cytokines, reactive nitrogen species and costimulator molecules have all been described in MS.
  • immunological mechanisms that contribute to the development of autoimmunity.
  • IL- 12 is a proinflammatory cytokine that is produced by APC and promotes differentiation of Thl effector cells.
  • IL-12 is produced in the developing lesions of patients with MS as well as in EAE-affected animals.
  • interference in IL-12 pathways effectively prevents EAE in rodents, and that in vivo neutralization of IL- 12p40 using a anti-IL-12 mAb has beneficial effects in the myelin-induced EAE model in common marmosets.
  • TWEAK is a member of the TNF family, constitutively expressed in the central nervous system (CNS), with pro-inflammatory, proliferative or apoptotic effects depending upon cell types. Its receptor, Fnl4, is expressed in CNS by endothelial cells, reactive astrocytes and neurons. TWEAK and Fnl4 mRNA expression increased in spinal cord during experimental autoimmune encephalomyelitis (EAE).
  • EAE experimental autoimmune encephalomyelitis
  • Anti-TWEAK antibody treatment in myelin oligodendrocyte glycoprotein (MOG) induced EAE in C57BL/6 mice resulted in a reduction of disease severity and leukocyte infiltration when mice were treated after the priming phase.
  • MOG myelin oligodendrocyte glycoprotein
  • the inventions pertains to anti-idiotypic Fn3 polypeptides capable of binding to targets involved in MS which include, but are not limited to, IL-12, TWEAK, IL-23, CXCL13, CD40, CD40L, IL-18, VEGF, VLA4, TNF, CD45RB, CD200, IFNgamma, GM-CSF, FGF, C5, CD52, and CCR2.
  • targets involved in MS include, but are not limited to, IL-12, TWEAK, IL-23, CXCL13, CD40, CD40L, IL-18, VEGF, VLA4, TNF, CD45RB, CD200, IFNgamma, GM-CSF, FGF, C5, CD52, and CCR2.
  • Several animal models for assessing the usefulness of the molecules to treat MS are known in the art (see Steinman L, et al., (2005) Trends Immunol. 26(11):565-71 ; Lublin F D. ; et al.
  • the pathophysiology of sepsis is initiated by the outer membrane components of both gram-negative organisms (lipopolysaccharide [LPS], lipid A, endotoxin) and gram- positive organisms (lipoteichoic acid, peptidoglycan). These outer membrane components are able to bind to the CD 14 receptor on the surface of monocytes. By virtue of the recently described toll-like receptors, a signal is then transmitted to the cell, leading to the eventual production of the proinflammatory cytokines tumor necrosis factor-alpha (TNF-alpha) and interleukin-1 (IL-I).
  • TNF-alpha tumor necrosis factor-alpha
  • IL-1 interleukin-1
  • cytokines especially tumor necrosis factor (TNF) and interleukin (IL)-l, have been shown to be critical mediators of septic shock. These cytokines have a direct toxic effect on tissues; they also activate phospholipase A2. These and other effects lead to increased concentrations of platelet-activating factor, promotion of nitric oxide synthase activity, promotion of tissue infiltration by neutrophils, and promotion of neutrophil activity.
  • TNF tumor necrosis factor
  • IL interleukin
  • the inventions pertains to anti-idiotypic Fn3 polypeptides capable of binding to targets involved in sepsis which include, but are not limited to, TNF, 1-1 , MIF, IL-6, IL-8, IL-18, IL-12, IL-23, FasL, LPS, Toll-like receptors, TLR-4, tissue factor, MIP-2, ADORA2A, CASP1, CASP4, IL10, IL1B, NFKB1, PROC, TNFRSF1A, CSF3, IL10, IL1B, IL6, ADORA2A, CCR3, IL10, IL1B, IL1RN, MIF, NFKB1, PTAFR, TLR2, TLR4, GPR44, HMOX1, midkine, IRAKI, NFKB2, SERPINA1, SERPINE1, and TREM1.
  • targets involved in sepsis include, but are not limited to, TNF, 1-1 , MIF, IL-6, IL-8, IL-18
  • Chronic neurodegenerative diseases are usually age-dependent diseases characterized by progressive loss of neuronal functions (neuronal cell death, demyelination), loss of mobility and loss of memory. Emerging knowledge of the mechanisms underlying chronic neurodegenerative diseases (e.g. Alzheimer's disease disease) show a complex etiology and a variety of factors have been recognized to contribute to their development and progression e.g. age, glycemic status, amyloid production and multimerization,
  • AGE advanced glycation-end products
  • RAGE receptor for AGE
  • neuroinflammation including release of inflammatory cytokines and chemokines, neuronal dysfunction and microglial activation.
  • the inventions pertains to anti-idiotypic Fn3 polypeptides capable of binding to targets involved in chronic neurodegenerative disease such as Alzheimers which include, but are not limited to, any mediator, soluble or cell surface, implicated in AD pathogenesis e.g AGE (SI 00 A, amphoterin), pro-inflammatory cytokines (e.g. IL-1), chemokines (e.g. MCP 1), molecules that inhibit nerve regeneration (e.g. Nogo, RGM A), molecules that enhance neurite growth (neurotrophins).
  • AGE Sesibstructive fibroblasts
  • chemokines e.g. MCP 1
  • RGM A nerve regeneration
  • neurotrophins neurotrophins
  • the efficacy of the polypeptides of the invention can be validated in pre-clinical animal models such as the transgenic mice that over-express amyloid precursor protein or RAGE and develop
  • the polypeptides of the invention can also be employed other neurodegenerative diseases such as Parkinson's disease.
  • Alpha-Synuclein is involved in Parkinson's pathology and thus a suitable target.
  • SCI spinal cord injury
  • Most spinal cord injuries are contusion or compression injuries and the primary injury is usually followed by secondary injury mechanisms (inflammatory mediators e.g. cytokines and chemokines) that worsen the initial injury and result in significant enlargement of the lesion area, sometimes more than 10-fold.
  • secondary injury mechanisms inflammatory mediators e.g. cytokines and chemokines
  • These primary and secondary mechanisms in SCI are very similar to those in brain injury caused by other means e.g. stroke.
  • MP methylprednisolone
  • Such factors are the myelin-associated proteins NogoA, OMgp and MAG, RGM A, the scar-associated CSPG (Chondroitin Sulfate Proteoglycans) and inhibitory factors on reactive astrocytes (some semaphorins and ephrins).
  • CSPG Chodroitin Sulfate Proteoglycans
  • inhibitory factors on reactive astrocytes some semaphorins and ephrins.
  • neurite growth stimulating factors like neurotrophins, laminin, LI and others.
  • This ensemble of neurite growth inhibitory and growth promoting molecules may explain that blocking single factors, like NogoA or RGM A, resulted in significant functional recovery in rodent SCI models, because a reduction of the inhibitory influences could shift the balance from growth inhibition to growth promotion.
  • the inventions pertains to anti-idiotypic Fn3 polypeptides capable of binding to targets involved in neural regeneration which include, but are not limited to, NgR, RGM A NogoA, MAG, OMGp, RGM B, CSPGs aggrecan, midkine, neurocan, versican, phosphacan, Te38, TNF-a, Troy, Nogo66 (Nogo), Lingo, semaphorins, ephrins, soluble A-b, pro-inflammatory cytokines (e.g. IL-1), chemokines (e.g. MIP la), molecules that inhibit nerve regeneration.
  • targets involved in neural regeneration include, but are not limited to, NgR, RGM A NogoA, MAG, OMGp, RGM B, CSPGs aggrecan, midkine, neurocan, versican, phosphacan, Te38, TNF-a, Troy, Nogo66 (Nogo), Lingo, semaphorins, eph
  • Antibodies may exert antitumor effects by inducing apoptosis, redirected cytotoxicity, interfering with ligand-receptor interactions, or preventing the expression of proteins that are critical to the neoplastic phenotype.
  • antibodies can target components of the tumor microenvironment, perturbing vital structures such as the formation of tumor-associated vasculature.
  • Antibodies can also target receptors whose ligands are growth factors, such as the epidermal growth factor receptor. The antibody thus inhibits natural ligands that stimulate cell growth from binding to targeted tumor cells.
  • antibodies may induce an anti-idiotype network, complement-mediated cytotoxicity, or antibody-dependent cellular cytotoxicity (ADCC).
  • the inventions pertains to anti-idiotypic Fn3 polypeptides capable of binding to targets involved in oncological disorders which include, but are not limited to, IGF1, IGF2; IGF 1/2, Erb2B,VEGFR, EGFR,CD20, CD3, CD138, CD20, CD38, CD20, CD38, CD138, CD40, CD20, CD138, CD40, CD38, CD40, CD52, CD20, CD19, CD3, CD4, CD8, BMP6, IL12A, ILI A, IL1B, IL2, IL24, INHA, TNF, TNFSF10, BMP6, EGF, FGF1 , FGF10, FGF1 1 , FGF12, FGF13, FGF14, FGF16, FGF17, FGF18, FGF19, FGF2, FGF20, FGF21, FGF22, F
  • thrombospondin-1 TIE (Tie-1), TNFRSF6 (Fas), TNFSF6 (FasL), TOP2A (topoisomerase Iia), TP53, AZGP1 (zinc-a-glycoprotein), BPAG1 (plectin), CD N1A (p21Wapl/Cipl), CLDN7 (claudin-7), CLU (clusterin), ERBB2 (Her-2), FGF 1 , FLRTl (fibronectin), GABRP (GABAa), GNAS1, ID2, ITGA6 (a6 integrin), ITGB4 (b 4 integrin), LF5 (GC Box BP), RT19 (Keratin 19), KRTHB6 (hair-specific type II keratin), MACMARCKS, T3 (metallothionectin-III), UC1 (mucin), PTGS2 (COX-2), RAC2 (p21Rac2), S100A2, SCGB1D2 (lip
  • the invention provides conjugates comprising an anti- idiotypic Fn3 polypeptide, anti-anti-idiotypic Fn3 polypeptide, or molecules generated therefrom linked to one or more non-Fn3 moieties.
  • non-Fn3 moieties can, for example, impart additional functional or physiochemical properties to the anti-idiotypic Fn3 polypeptide or anti-anti-idiotypic Fn3 polypeptide.
  • the anti-idiotypic Fn3 polypeptide or anti-anti-idiotypic Fn3 polypeptide is linked or fused to an antibody Fc domain (or a portion thereof).
  • Fc domains e.g., the Fc domain of IgGl
  • conjugates have increased circulating half-lives, due to the ability of Fc to bind to FcRn, which serves a critical function in IgG homeostasis, protecting molecules bound to it from catabolism.
  • anti-idiotypic Fn3 polypeptide or an anti-anti- idiotypic Fn3 polypeptide is fused to one or more human serum albumin (HSA)
  • HSA a protein of 585 amino acids in its mature form, is responsible for a significant proportion of the osmotic pressure of serum and also functions as a carrier of endogenous and exogenous ligands.
  • albumin as a carrier molecule and its inert nature are desirable properties for use as a carrier and transporter of
  • polypeptides in vivo The use of albumin as a component of an albumin fusion protein as a carrier for various proteins has been suggested in WO 93/15199, WO 93/15200, and EP 413 622.
  • the molecules of the present invention by genetically or chemically fusing or conjugating the molecules of the present invention to albumin, or a fragment (portion) or variant of albumin or a molecule capable of binding HSA (an "anti-HS A binder") that is sufficient to stabilize the protein and/or its activity, the molecule is stabilized to extend the shelf-life, and/or to retain the molecule's activity for extended periods of time in solution, in vitro and/or in vivo.
  • HSA an "anti-HS A binder”
  • Fusion of albumin to another protein may be achieved by genetic
  • a suitable host is then transformed or transfected with the fused nucleotide sequences, so arranged on a suitable plasmid as to express a fusion polypeptide.
  • the expression may be effected in vitro from, for example, prokaryotic or eukaryotic cells, or in vivo e.g. from a transgenic organism. Additional methods pertaining to HSA fusions can be found, for example, in WO 2001077137 and WO 200306007, incorporated herein by reference.
  • the expression of the fusion protein is performed in mammalian cell lines, for example, CHO cell lines.
  • polypeptide conjugates of the present invention include an anti-idiotypic Fn3 polypeptides or an anti-anti-idiotypic Fn3 polypeptide linked to a non-Fn3 -based binding molecule, e.g., another peptide or protein (e.g., an antibody or ligand for a receptor), to generate a molecule that binds to at least two different binding sites or target molecules.
  • a non-Fn3 -based binding molecule e.g., another peptide or protein (e.g., an antibody or ligand for a receptor)
  • the anti-idiotypic Fn3 polypeptides or an anti-anti-idiotypic Fn3 polypeptide conjugates of the present invention can be prepared by linking the constituent molecules using methods known in the art.
  • the constituent molecules can be chemically linked using a variety of coupling or cross-linking agents can be used for covalent conjugation.
  • cross-linking agents examples include protein A, carbodiimide, N- succinimidyl-S-acetyl-thioacetate (SAT A), 5,5'-dithiobis(2-nitrobenzoic acid) (DTNB), o- phenylenedimaleimide (oPDM), N-succinimidyl-3-(2-pyridyldithio)propionate (SPDP), and sulfosuccinimidyl 4-(N-maleimidomethyl) cyclohaxane- 1-carboxylate (sulfo-SMCC) (see e.g., Karpovsky et al. (1984) J. Exp. Med.
  • Preferred conjugating agents are SATA and sulfo-SMCC, both available from Pierce Chemical Co. (Rockford, IL).
  • the constituent molecules can be encoded in the same vector and expressed as a single protein in a host cell.
  • Methods for producing such fusion proteins are described, for example, in U.S. Patent Number 5,260,203; U.S. Patent Number
  • the invention provides anti-idiotypic Fn3 polypeptides or an anti-anti-idiotypic Fn3 polypeptide that are conjugated to polyethylene glycol (PEG), for example, to increase the biological (e.g. , serum) half-life of the molecule.
  • PEG polyethylene glycol
  • Methods for PEGylating proteins are well known in the art.
  • the Fn3 -based binding molecule can be reacted with a PEG moiety, such as a reactive ester or aldehyde derivative of PEG, under conditions in which one or more PEG groups become attached to the molecule.
  • PEGylation moiety includes a polyalkylene glycol compound or a derivative thereof, with or without coupling agents or derivatization with coupling or activating moieties (e.g., with thiol, triflate, tresylate, azirdine, oxirane, or preferably with a maleimide moiety, e.g. , PEG- maleimide).
  • polyalkylene glycol compounds include, but are not limited to, maleimido monomethoxy PEG, activated PEG polypropylene glycol, but also charged or neutral polymers of the following types: dextran, colominic acids, or other carbohydrate based polymers, polymers of amino acids, and biotin derivatives.
  • the choice of the suitable functional group for the PEG derivative is based on the type of available reactive group on the molecule or molecule that will be coupled to the PEG.
  • typical reactive amino acids include lysine, cysteine, histidine, arginine, aspartic acid, glutamic acid, serine, threonine, tyrosine.
  • the N-terminal amino group and the C -terminal carboxylic acid can also be used.
  • the pegylation is carried out via an acylation reaction or an alkylation reaction with a reactive PEG molecule (or an analogous reactive water-soluble polymer).
  • a reactive PEG molecule or an analogous reactive water-soluble polymer.
  • polyethylene glycol is intended to encompass any of the forms of PEG that have been used to derivatize other proteins, such as mono (CI -C IO) alkoxy- or aryloxy-polyethylene glycol or polyethylene glycol-maleimide. Methods for pegylating proteins are known in the art and can be applied to the present invention.
  • the molecules of the invention can be engineered to include at least one cysteine amino acid or at least one non-natural amino acid to facilitate pegylation.
  • the fusion can be radioactively labeled and used in a radioimmunoassay (RIA) (see, for example, Weintraub, B., Principles of Radioimmunoassays, Seventh Training Course on Radioligand Assay Techniques, The Endocrine Society, March, 1986, which is incorporated by reference herein).
  • RIA radioimmunoassay
  • the radioactive isotope can be detected by such means as the use of a ⁇ -counter or a scintillation counter or by autoradiography.
  • anti-idiotypic Fn3 polypeptides or other anti-anti-idiotypic Fn3 polypeptide conjugates of the present invention include an anti-idiotypic Fn3 polypeptides or an anti-anti-idiotypic Fn3 polypeptide linked to a tag ⁇ e.g., biotin) or a chemical ⁇ e.g., an immunotoxin or chemo therapeutic agent).
  • a tag e.g., biotin
  • a chemical ⁇ e.g., an immunotoxin or chemo therapeutic agent include cytotoxic agent which is any agent that is detrimental to ⁇ e.g., kills
  • Examples include taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, Udocaine, propranolol, and puromycin and analogs or homologs thereof.
  • Therapeutic agents also include, for example, antimetabolites ⁇ e.g., methotrexate, 6-mercaptopurine, 6- thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating agents ⁇ e.g.,
  • Other examples of therapeutic cytotoxins that can be conjugated to Fn3-based binding molecule of the invention include duocarmycins, calicheamicins, maytansines and auristatins, and derivatives thereof.
  • Cytotoxins can be conjugated to the molecules of the invention using linker technology available in the art.
  • linker types that have been used to conjugate a cytotoxin include, but are not limited to, hydrazones, thioethers, esters, disulfides and peptide-containing linkers.
  • a linker can be chosen that is, for example, susceptible to cleavage by low pH within the lysosomal compartment or susceptible to cleavage by proteases, such as proteases preferentially expressed in tumor tissue such as cathepsins (e.g., cathepsins B, C, D).
  • cathepsins e.g., cathepsins B, C, D
  • the anti-idiotypic Fn3 polypeptides or anti-anti-idiotypic Fn3 polypeptides of the present invention also can be conjugated to a radioactive isotope to generate cytotoxic radiopharmaceuticals, also referred to as radioimmunoconjugates.
  • radioactive isotopes that can be conjugated to anti-idiotypic Fn3 polypeptides or anti-anti-idiotypic Fn3 polypeptides for use diagnostically or therapeutically include, but are not limited to, iodine 13 indium 1 1 ', yttrium 90 and lutetium 177 .
  • radioimmunoconjugates are established in the art. Examples of radioimmunoconjugates are commercially available, including ibritumomab, tiuxetan, and tositumomab, and similar methods can be used to prepare radioimmunoconjugates using the molecules of the invention.
  • the anti-idiotypic Fn3 polypeptide or anti-anti-idiotypic Fn3 polypeptide conjugates of the invention can be used to modify a given biological response, and the drug moiety is not to be construed as limited to classical chemical therapeutic agents.
  • the drug moiety may be a protein or polypeptide possessing a desired biological activity.
  • Such proteins may include, for example, an enzymatically active toxin, or active fragment thereof, such as abrin, ricin A, pseudomonas exotoxin, or diphtheria toxin; a protein such as tumor necrosis factor or interferon- ⁇ ; or, biological response modifiers such as, for example, lymphokines, interleukin- 1 ("IL-1 "), interleukin-2 ("IL-2”), interleukin-6 (“IL-6”), granulocyte macrophage colony stimulating factor (“GM-CSF”), granulocyte colony stimulating factor (“G-CSF”), or other growth factors.
  • IL-1 interleukin-1
  • IL-2 interleukin-2
  • IL-6 interleukin-6
  • GM-CSF granulocyte macrophage colony stimulating factor
  • G-CSF granulocyte colony stimulating factor
  • Anti-idiotypic Fn3 polypeptides or anti-anti-idiotypic Fn3 polypeptides of the present invention also can be modified by hesylation, which utilizes hydroxyethyl starch ("HES") derivatives linked to drug substances in order to modify the drug characteristics.
  • HES hydroxyethyl starch
  • HES is a modified natural polymer derived from waxy maize starch which is metabolized by the body's enzymes. This modification enables the prolongation of the circulation half-life by increasing the stability of the molecule, as well as by reducing renal clearance, resulting in an increased biological activity.
  • HESylation potentially alters the immunogenicity or allergenicity. By varying different parameters, such as the molecular weight of HES, a wide range of HES drug conjugates can be customized.
  • DE 196 28 705 and DE 101 29 369 describe possible methods for carrying out the coupling of hydroxyethyl starch in anhydrous dimethyl sulfoxide (DMSO) via the corresponding aldonolactone of hydroxyethyl starch with free amino groups of hemoglobin and amphotericin B, respectively. Since it is often not possible to use anhydrous, aprotic solvents specifically in the case of proteins, either for solubility reasons or else on the grounds of denaturation of the proteins, coupling methods with HES in an aqueous medium are also available.
  • DMSO dimethyl sulfoxide
  • Anti-idiotypic Fn3 polypeptides or anti-anti-idiotypic Fn3 polypeptides of the invention also can be modified via sugar residues.
  • Methods for modifying sugar residues of proteins or glycosylating proteins are known in the art (see, for example, Borman (2006) Chem. & Eng. News 84(36): 13-22 and Borman (2007) Chem. & Eng. News 85: 19-20) and can be applied to the molecules of the present invention.
  • anti-idiotypic Fn3 polypeptides or anti-anti- idiotypic Fn3 polypeptides of the invention can be made that have an altered type of glycosylation, such as a hypofucosylated pattern having reduced amounts of fucosyl residues or anti-idiotypic Fn3 polypeptides or anti-anti-idiotypic Fn3 polypeptides having increased bisecting GlcNac structures.
  • Such carbohydrate modifications can be accomplished by, for example, expressing the anti-idiotypic Fn3 polypeptide or anti-anti-idiotypic Fn3 polypeptide in a host cell with altered glycosylation machinery.
  • Cells with altered glycosylation machinery have been described in the art and can be used as host cells in which to express recombinant anti-idiotypic Fn3 polypeptides or anti-anti-idiotypic Fn3 polypeptides of the invention to thereby produce anti-idiotypic Fn3 polypeptides or anti- anti-idiotypic Fn3 polypeptides of the invention with altered glycosylation.
  • EP 1,176,195 by Hang et al. describes a cell line with a functionally disrupted FUT8 gene, which encodes a fucosyl transferase, such that antibodies expressed in such a cell line exhibit hypofucosylation.
  • PCT Publication WO 03/035835 by Presta describes a variant CHO cell line, Lecl3 cells, with reduced ability to attach fucose to Asn(297)-linked carbohydrates, also resulting in hypofucosylation of antibodies expressed in that host cell (see also Shields, R.L. et al., 2002 J. Biol. Chem. 277:26733-26740). Methods to produce polypeptides with human-like glycosylation patterns have also been described by
  • Anti-idiotypic Fn3 Polypeptides or anti-anti-idiotypic Fn3 polypeptides of the invention having one or more amino acid or nucleotide modifications can be generated by a variety of known methods. Typically, such anti-idiotypic Fn3 -based polypeptides are produced by recombinant methods. Moreover, because of the degeneracy of the genetic code, a variety of nucleic acid sequences can be used to encode each desired molecule.
  • Exemplary art recognized methods for making a nucleic acid molecule encoding an amino acid sequence variant of a starting molecule include, but are not limited to, preparation by site-directed (or oligonucleotide-mediated) mutagenesis, PCR
  • Site-directed mutagenesis is a preferred method for preparing substitution variants. This technique is well known in the art (see, e.g., Carter et al Nucleic Acids Res. 13:4431-4443 (1985) and Kunkel et al, Proc. Natl. Acad. Sci. U.S.A 82:488 (1987)).
  • the parent DNA is altered by first hybridizing an oligonucleotide encoding the desired mutation to a single strand of such parent DNA. After hybridization, a DNA polymerase is used to synthesize an entire second strand, using the hybridized oligonucleotide as a primer, and using the single strand of the parent DNA as a template. Thus, the oligonucleotide encoding the desired mutation is incorporated in the resulting double-stranded DNA.
  • PCR mutagenesis is also suitable for making amino acid sequence variants of the starting molecule. See Higuchi, in PCR Protocols, pp.177-183 (Academic Press, 1990); and Vallette et ⁇ , Nuc. Acids Res. 17:723-733 (1989). Briefly, when small amounts of template DNA are used as starting material in a PCR, primers that differ slightly in sequence from the corresponding region in a template DNA can be used to generate relatively large quantities of a specific DNA fragment that differs from the template sequence only at the positions where the primers differ from the template.
  • the starting material is the plasmid (or other vector) comprising the starting polypeptide DNA to be mutated.
  • the codon(s) in the parent DNA to be mutated are identified.
  • the plasmid DNA is cut at these sites to linearize it.
  • oligonucleotide encoding the sequence of the DNA between the restriction sites but containing the desired mutation(s) is synthesized using standard procedures, wherein the two strands of the oligonucleotide are synthesized separately and then hybridized together using standard techniques.
  • This double-stranded oligonucleotide is referred to as the cassette.
  • This cassette is designed to have 5' and 3' ends that are compatible with the ends of the linearized plasmid, such that it can be directly ligated to the plasmid.
  • This plasmid now contains the mutated DNA sequence.
  • the desired amino acid sequence encoding a polypeptide variant of the molecule can be determined, and a nucleic acid sequence encoding such amino acid sequence variant can be generated synthetically.
  • Fn3 polypeptides of the invention may further be modified such that they vary in amino acid sequence (e.g., from wild-type), but not in desired activity.
  • additional nucleotide substitutions leading to amino acid substitutions at "non-essential" amino acid residues may be made to the protein
  • a nonessential amino acid residue in a molecule may be replaced with another amino acid residue from the same side chain family.
  • a string of amino acids can be replaced with a structurally similar string that differs in order and/or composition of side chain family members, i.e., a conservative substitutions, in which an amino acid residue is replaced with an amino acid residue having a similar side chain, may be made.
  • Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
  • basic side chains e.g., lysine, arginine, histidine
  • acidic side chains e.g., aspartic acid
  • the present invention contemplates other modifications of the starting molecule amino acid sequence in order to generate functionally equivalent molecules. For example, one may delete one or more amino acid residues. Generally, no more than one to about ten residues will be deleted according to this embodiment of the invention.
  • the anti-idiotypic Fn3 polypeptides comprising one or more amino acid deletions will preferably retain at least about 80%, and preferably at least about 90%, and most preferably at least about 95%, of the starting polypeptide molecule.
  • Fn3 domain or anti-idiotypic Fn3 polypeptide functionality may introduce at least one amino acid residue (e.g. one to two amino acid residues and generally no more than ten residues) into the molecule.
  • amino acid substitutions are performed on an Fn3 domain to include cysteine or other non-natural amino acid suitable for conjugating a moiety to the anti-idiotypic Fn3 polypeptide or anti-anti-idiotypic Fn3 polypeptide using well- known conjugating methods.
  • the invention relates to specific amino acid variants of anti-idiotypic Fn3 polypeptides with Fn3 scaffold, wherein one or more serine amino acid residues are substituted by cysteine or a non-natural amino acid.
  • Serine amino acid residues that can substituted include, but are not limited to Ser 1432, Ser 1436, Ser 1458, Ser 1475, and Ser 1504.
  • amino acid positions of the Fn3 scaffold that can be substituted include, but are not limited to, V1426, LI 434, T1473 and T1486.
  • Non- naturally occurring amino acids can be substituted into the Fn3 scaffold using, for example, Ambrex technology (See e.g., US 7,045,337; 7,083,970).
  • a variety of screening assays can be employed to identify anti-idiotypic Fn3 polypeptides or anti-anti-idiotypic Fn3 polypeptides of the invention. Essentially any in vitro or in vivo screening method that selects for binding to an antibody of a desired antigen can be used.
  • the anti-idiotypic Fn3 polypeptides are displayed on the surface of a cell, virus or bacteriophage and subject to selection using immobilized antibody of a antigen. Suitable methods of screening are described in U.S. patent numbers 7,063,943; 6,699,658; 7,063,943 and 5866344. Such surface display may require the creation of fusion proteins of the anti-idiotypic Fn3 polypeptides with a suitable protein normally present on the outer surface of a cell, virus or bacteriophage. Suitable proteins from which to make such fusions are well known in the art.
  • the anti-idiotypic Fn3 polypeptides are screened using an in vitro phenotype- genotype linked display such as ribosome or polysome display.
  • an in vitro phenotype- genotype linked display such as ribosome or polysome display.
  • Screening methods may involve one or more in vitro or in vivo affinity maturation steps. Any affinity maturation approach can be employed that results in amino acid changes in the Fn3 domain that improve the binding of the the anti-idiotypic Fn3 polypeptides to the antibody of a desired antigen. These amino acid changes can, for example, be achieved via random mutagenesis, "walk though mutagenesis, and "look through mutagenesis. Such mutagenesis can be achieved by using, for example, error-prone PC , "mutator” strains of yeast or bacteria, incorporation of random or defined nucleic acid changes during ab inito synthesis of all or part of a anti-idiotypic Fn3 polypeptide or anti- anti-idiotypic Fn3 polypeptide.
  • affinity maturation and/or mutagenesis are described, for example, in U.S. Patent Numbers 7,195,880; 6,951,725; 7,078,197; 7,022,479; 5,922,545; 5,830,721 ; 5,605,793, 5,830,650; 6,194,550; 6,699,658; 7,063,943; 5866344 and Patent Cooperation Treaty publication WO06023144.
  • affinity maturation methods may further require that the stringency of the antigen-binding screening assay is increased to select for the anti -idiotypic Fn3 polypeptides with improved affinity for the antibody of the target antigen.
  • Art recognized methods for increasing the stringency of a protein-protein interaction assay can be used here.
  • one or more of the assay conditions are varied (for example, the salt concentration of the assay buffer) to reduce the affinity of the anti-idiotypic Fn3 polypeptides for the antibody of the desired antigen.
  • the length of time permitted for the anti-idiotypic Fn3 polypeptides to bind to the antibody of the desired antigen is reduced.
  • a salt concentration of the assay buffer for example, the salt concentration of the assay buffer
  • the anti-idiotypic Fn3 polypeptides are first allowed to bind to a desired immobilized antibody of the antigen.
  • a specific concentration of non- immobilized antibody of the antigen is then added which serves to compete for binding with the immobilized antibody of the antigen such that the anti-idiotypic Fn3 polypeptides with the lowest affinity for antibody of the antigen are eluted from the immobilized antigen resulting in selection of anti-idiotypic Fn3 polypeptides with improved antigen binding affinity.
  • the stringency of the assay conditions can be further increased by increasing the concentration of non-immobilized antibody of the antigen is added to the assay.
  • Screening methods of the invention may also require multiple rounds of selection to enrich for one or more anti-idiotypic Fn3 polypeptides with improved antibody binding.
  • at each round of selection further amino acid mutation are introduced into the anti-idiotypic Fn3 polypeptides.
  • the stringency of binding to the desired antigen is increased to select for anti- idiotypic Fn3 polypeptides with increased affinity for an antibody of the antigen.
  • competition assays with a target peptide can be employed in which the anti-idiotypic Fn3 polypeptide is compared with an antibody against the target antigen.
  • an anti-HA-Fn3 and anti-HA antibody these two molecules can be tested in the presence of increasing amount of HA-Peptide to show that binding of the anti-HA-Fn3 is diminished in a concentration dependent manner.
  • the anti-idiotypic Fn3 polypeptide can be added in increasing amounts to show activation/inhibition of the receptor.
  • the anti-idiotypic Fn3 polypeptides of the invention are typically produced by recombinant expression. Nucleic acids encoding the molecules are inserted into expression vectors. The DNA segments encoding the molecules are operably linked to control sequences in the expression vector(s) that ensure their expression. Expression control sequences include, but are not limited to, promoters (e.g., naturally-associated or heterologous promoters), signal sequences, enhancer elements, and transcription termination sequences. Preferably, the expression control sequences are eukaryotic promoter systems in vectors capable of transforming or transfecting eukaryotic host cells. Once the vector has been incorporated into the appropriate host, the host is maintained under conditions suitable for high level expression of the nucleotide sequences, and the collection and purification of the crossreacting the anti-idiotypic Fn3 polypeptides.
  • promoters e.g., naturally-associated or heterologous promoters
  • signal sequences e.g., enhancer elements
  • expression vectors are typically replicable in the host organisms either as episomes or as an integral part of the host chromosomal DNA.
  • expression vectors contain selection markers (e.g., ampicillin-resistance, hygromycin-resistance, tetracycline resistance or neomycin resistance) to permit detection of those cells transformed with the desired DNA sequences (see, e.g., Itakura et ah, U.S. Patent 4,704,362).
  • E. coli is one prokaryotic host particularly useful for cloning the
  • polynucleotides e.g., DNA sequences
  • Other microbial hosts suitable for use include bacilli, such as Bacillus subtilis, and other enterobacteriaceae, such as Salmonella, Serratia, and various Pseudomonas species.
  • yeast Other microbes, such as yeast, are also useful for expression.
  • Saccharomyces and Pichia are exemplary yeast hosts, with suitable vectors having expression control sequences (e.g. , promoters), an origin of replication, termination sequences and the like as desired.
  • Typical promoters include 3-phosphoglycerate kinase and other glycolytic enzymes.
  • Inducible yeast promoters include, among others, promoters from alcohol dehydrogenase, isocytochrome C, and enzymes responsible for methanol, maltose, and galactose utilization.
  • mammalian tissue culture may also be used to express and produce the polypeptides of the present invention (e.g., polynucleotides encoding immunoglobulins or fragments thereof). See Winnacker, From Genes to Clones, VCH Publishers, N.Y., N.Y. (1987).
  • Eukaryotic cells are actually preferred, because a number of suitable host cell lines capable of secreting heterologous proteins (e.g., intact immunoglobulins) have been developed in the art, and include CHO cell lines, various COS cell lines, HeLa cells, 293 cells, myeloma cell lines, transformed B-cells, and hybridomas.
  • Expression vectors for these cells can include expression control sequences, such as an origin of replication, a promoter, and an enhancer (Queen et a!., Immunol. Rev. 89:49 (1986)), and necessary processing information sites, such as ribosome binding sites, RNA splice sites, polyadenylation sites, and transcriptional terminator sequences.
  • Preferred expression control sequences are promoters derived from immunoglobulin genes, SV40, adenovirus, bovine papilloma virus, cytomegalovirus and the like. See Co et al., J.
  • coding sequences can be incorporated in transgenes for introduction into the genome of a transgenic animal and subsequent expression in the milk of the transgenic animal (see, e.g., Deboer et al., U.S. 5,741,957, Rosen, U.S. 5,304,489, and Meade et al., U.S. 5,849,992).
  • Suitable transgenes include coding sequences for light and/or heavy chains in operable linkage with a promoter and enhancer from a mammary gland specific gene, such as casein or beta lactoglobulin.
  • the vectors containing the polynucleotide sequences of interest and expression control sequences can be transferred into the host cell by well-known methods, which vary depending on the type of cellular host. For example, chemically competent prokaryotic cells may be briefly heat-shocked, whereas calcium phosphate treatment, electroporation, lipofection, biolistics or viral-based transfection may be used for other cellular hosts. (See generally Sambrook et ah, Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Press, 2nd ed., 1989).
  • transgenic animals can be microinjected into fertilized oocytes, or can be incorporated into the genome of embryonic stem cells, and the nuclei of such cells transferred into enucleated oocytes.
  • the anti-idiotypic Fn3 polypeptides of the present invention can be purified according to standard procedures of the art, including ammonium sulfate precipitation, affinity columns, column chromatography, HPLC purification, gel
  • compositions e.g., a pharmaceutical composition, containing one or a combination of anti-idiotypic Fn3 polypeptides, anti-anti-idiotypic Fn3 polypeptides (or variants, fusions, and conjugates thereof), formulated together with a pharmaceutically acceptable carrier.
  • Pharmaceutical compositions of the invention also can be administered in combination therapy, i.e., combined with other agents.
  • the combination therapy can include a composition of the present invention with at least one or more additional therapeutic agents, such as anti -inflammatory agents, anti-cancer agents, and chemotherapeutic agents.
  • compositions of the invention can also be administered in conjunction with radiation therapy. Co-administration with other anti-idiotypic Fn3 polypeptides or anti-anti-idiotypic Fn3 polypeptides ate also encompassed by the invention.
  • pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible.
  • the carrier is suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal or epidermal administration (e.g., by injection or infusion).
  • the active compound i.e., antibody, bispecific and multispecific molecule, may be coated in a material to protect the compound from the action of acids and other natural conditions that may inactivate the compound.
  • a "pharmaceutically acceptable salt” refers to a salt that retains the desired biological activity of the parent compound and does not impart any undesired toxicological effects (see e.g., Berge, S.M., et al. (1977) J. Pharm. Sci. 66:1-19).
  • Examples of such salts include acid addition salts and base addition salts.
  • Acid addition salts include those derived from nontoxic inorganic acids, such as hydrochloric, nitric, phosphoric, sulfuric,
  • Base addition salts include those derived from alkaline earth metals, such as sodium, potassium, magnesium, calcium and the like, as well as from nontoxic organic amines, such as ⁇ , ⁇ '- dibenzylethylenediamine, N-methylglucamine, chloroprocaine, choline, diethanolamine, ethylenediamine, procaine and the like.
  • a composition of the present invention can be administered by a variety of methods known in the art. As will be appreciated by the skilled artisan, the route and/or mode of administration will vary depending upon the desired results.
  • the active compounds can be prepared with carriers that will protect the compound against rapid release, such as a controlled release formulation, including implants, transdermal patches, and microencapsulated delivery systems.
  • Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Many methods for the preparation of such formulations are patented or generally known to those skilled in the art. See, e.g., Sustained and Controlled Release Drug Delivery Systems, J.R. Robinson, ed., Marcel Dekker, Inc., New York, 1978.
  • the compound may be administered to a subject in an appropriate carrier, for example, liposomes, or a diluent.
  • an appropriate carrier for example, liposomes, or a diluent.
  • Pharmaceutically acceptable diluents include saline and aqueous buffer solutions.
  • Liposomes include water-in-oil-in- water CGF emulsions as well as conventional liposomes (Strejan et al. (1984) J. Neuroimmunol. 7:27).
  • Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • the use of such media and agents for pharmaceutically active substances is known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the pharmaceutical compositions of the invention is contemplated. Supplementary active compounds can also be incorporated into the compositions.
  • compositions typically must be sterile and stable under the conditions of manufacture and storage.
  • the composition can be formulated as a solution, microemulsion, liposome, or other ordered structure suitable to high drug concentration.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • isotonic agents for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition.
  • Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, monostearate salts and gelatin.
  • Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by sterilization microfiltration.
  • dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above.
  • a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum drying and freeze- drying (lyophilization) that yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • Dosage regimens are adjusted to provide the optimum desired response (e.g., a therapeutic response). For example, a single bolus may be administered, several divided doses may be administered over time or the dose may be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation.
  • the anti-idiotypic Fn3 polypeptides of the invention may be administered once or twice weekly by
  • Dosage unit form refers to physically discrete units suited as unitary dosages for the subjects to be treated; each unit contains a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.
  • the specification for the dosage unit forms of the invention are dictated by and directly dependent on (a) the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding such an active compound for the treatment of sensitivity in individuals.
  • antioxidants examples include: (1) water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like; (2) oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, and the like; and (3) metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.
  • water soluble antioxidants such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like
  • oil-soluble antioxidants such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), le
  • formulations of the present invention include those suitable for oral, nasal, topical (including buccal and sublingual), rectal, vaginal and/or parenteral administration.
  • the formulations may conveniently be presented in unit dosage form and may be prepared by any methods known in the art of pharmacy.
  • the amount of active ingredient which can be combined with a carrier material to produce a single dosage form will vary depending upon the subject being treated, and the particular mode of administration.
  • the amount of active ingredient which can be combined with a carrier material to produce a single dosage form will generally be that amount of the composition which produces a therapeutic effect. Generally, out of one hundred per cent, this amount will range from about 0.001 per cent to about ninety percent of active ingredient, preferably from about 0.005 per cent to about 70 per cent, most preferably from about 0.01 per cent to about 30 per cent.
  • Formulations of the present invention which are suitable for vaginal administration also include pessaries, tampons, creams, gels, pastes, foams or spray formulations containing such carriers as are known in the art to be appropriate.
  • Dosage forms for the topical or transdermal administration of compositions of this invention include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches and inhalants.
  • the active compound may be mixed under sterile conditions with a pharmaceutically acceptable carrier, and with any preservatives, buffers, or propellants which may be required.
  • parenteral administration and “administered parenteral ly” as used herein means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion.
  • aqueous and nonaqueous carriers examples include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate.
  • polyols such as glycerol, propylene glycol, polyethylene glycol, and the like
  • vegetable oils such as olive oil
  • injectable organic esters such as ethyl oleate.
  • Proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
  • compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of presence of microorganisms may be ensured both by sterilization procedures, supra, and by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption such as aluminum monostearate and gelatin.
  • adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of presence of microorganisms may be ensured both by sterilization procedures, supra, and by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include
  • the compounds of the present invention are administered as pharmaceuticals, to humans and animals, they can be given alone or as a pharmaceutical composition containing, for example, 0.001 to 90% (more preferably, 0.005 to 70%, such as 0.01 to 30%) of active ingredient in combination with a pharmaceutically acceptable carrier.
  • the compounds of the present invention which may be used in a suitable hydrated form, and/or the pharmaceutical compositions of the present invention, are formulated into pharmaceutically acceptable dosage forms by conventional methods known to those of skill in the art.
  • compositions of the present invention may be varied so as to obtain an amount of the active ingredient which is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient.
  • the selected dosage level will depend upon a variety of pharmacokinetic factors including the activity of the particular compositions of the present invention employed, or the ester, salt or amide thereof, the route of administration, the time of administration, the rate of excretion of the particular compound being employed, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular compositions employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts.
  • a physician or veterinarian having ordinary skill in the art can readily determine and prescribe the effective amount of the pharmaceutical composition required. For example, the physician or veterinarian could start doses of the compounds of the invention employed in the
  • a suitable daily dose of a compositions of the invention will be that amount of the compound which is the lowest dose effective to produce a therapeutic effect. Such an effective dose will generally depend upon the factors described above. It is preferred that administration be intravenous, intramuscular, intraperitoneal, or subcutaneous, preferably administered proximal to the site of the target. If desired, the effective daily dose of therapeutic compositions may be administered as two, three, four, five, six or more sub- doses administered separately at appropriate intervals throughout the day, optionally, in unit dosage forms. While it is possible for a compound of the present invention to be administered alone, it is preferable to administer the compound as a pharmaceutical formulation (composition).
  • compositions can be administered with medical devices known in the art.
  • a therapeutic composition of the invention can be administered with a needleless hypodermic injection device, such as the devices disclosed in U.S. Patent Nos. 5,399,163, 5,383,851, 5,312,335, 5,064,413,
  • the molecules of the invention can be formulated to ensure proper distribution in vivo.
  • the blood-brain barrier excludes many highly hydrophilic compounds.
  • the therapeutic compounds of the invention cross the BBB (if desired)
  • they can be formulated, for example, in liposomes.
  • liposomes For methods of manufacturing liposomes, see, e.g., U.S. Patents 4,522,811 ; 5,374,548; and 5,399,331.
  • the liposomes may comprise one or more moieties which are selectively transported into specific cells or organs, thus enhance targeted drug delivery (see, e.g., V.V. Ranade (1989) J Clin. Pharmacol. 29:685).
  • Exemplary targeting moieties include folate or biotin (see, e.g., U.S. Patent 5,416,016 to Low et al.) mannosides (Umezawa et al, (1988) Biochem. Biophys. Res. Commim. 153: 1038); antibodies (P.G. Bloeman et al. (1995) FEBS Lett. 357: 140; M. Owais et al. (1995) Antimicrob. Agents Chemother. 39:180); surfactant protein A receptor (Briscoe et al. (1995) Am. J. Physiol. 1233: 134), different species of which may comprise the formulations of the inventions, as well as components of the invented molecules; pl20 (Schreier et al. (1994) J Biol. Chem. 269:9090); see also K.
  • biotin see, e.g., U.S. Patent 5,416,016 to Low et al.
  • mannosides U
  • the therapeutic compounds of the invention are formulated in liposomes; in a more preferred embodiment, the liposomes include a targeting moiety.
  • the therapeutic compounds in the liposomes are delivered by bolus injection to a site proximal to the tumor or infection.
  • the composition must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.
  • the ability of a compound to inhibit cancer can be evaluated in an animal model system predictive of efficacy in human tumors.
  • this property of a composition can be evaluated by examining the ability of the compound to inhibit, such inhibition in vitro by assays known to the skilled practitioner.
  • a therapeutically effective amount of a therapeutic compound can decrease tumor size, or otherwise ameliorate symptoms in a subject.
  • One of ordinary skill in the art would be able to determine such amounts based on such factors as the subject's size, the severity of the subject's symptoms, and the particular composition or route of administration selected.
  • the composition must be sterile and fluid to the extent that the composition is deliverable by syringe.
  • the carrier can be an isotonic buffered saline solution, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof.
  • Proper fluidity can be maintained, for example, by use of coating such as lecithin, by maintenance of required particle size in the case of dispersion and by use of surfactants.
  • the active compound when suitably protected, as described above, the compound may be orally administered, for example, with an inert diluent or an assimilable edible carrier.
  • the anti-idiotypic Fn3 polypeptides or anti-anti-idiotypic Fn3 polypeptides described herein may be constructed to bind any antigen, antibody to the antigen, or target of interest. Such targets include, but are not limited to, cluster domains, cell receptors, cell receptor ligands, growth factors, interleukins, protein allergens, bacteria, or viruses.
  • the anti-idiotypic Fn3 polypeptides or anti-anti-idiotypic Fn3 polypeptides described herein may also be modified to have increased stability and half-life, as well as additional functional moieties. Accordingly, these molecules may be employed in place of antibodies in all areas in which antibodies are used, including in the research, therapeutic, and diagnostic fields. In addition, because these molecules possess solubility and stability properties superior to antibodies, the antibody mimics described herein may also be used under conditions which would destroy or inactivate antibody molecules.
  • these molecules can be administered to cells in culture, e.g. in vitro or ex vivo, or in a subject, e.g., in vivo, to treat, prevent or diagnose a variety of disorders.
  • subject as used herein in intended to includes human and non-human animals.
  • Non-human animals includes all vertebrates, e.g., mammals and non-mammals, such as non-human primates, sheep, dogs, cats, cows, horses, chickens, amphibians, and reptiles.
  • the anti-idiotypic Fn3 polypeptides are administered together with another agent, the two can be administered in either order or simultaneously.
  • the anti-idiotypic Fn3 polypeptides, anti-anti-idiotypic Fn3 polypeptides (and variants, fusions, and conjugates thereof) of the invention can be used to detect levels of the target bound by the molecule. This can be achieved, for example, by contacting a sample (such as an in vitro sample) and a control sample with the molecule under conditions that allow for the formation of a complex between the molecule and the target(s). Any complexes formed between the molecule and the target (s) are detected and compared in the sample and the control. For example, standard detection methods, well- known in the art, such as ELISA, FACS, and flow cytometric assays, can be performed using the compositions of the invention.
  • kits comprising the compositions (e.g., anti-idiotypic Fn3 polypeptides, anti-anti-idiotypic Fn3 polypeptides, variants, fusions, and conjugates thereof) of the invention and instructions for use.
  • the kit can further contain a least one additional reagent, or one or more additional the anti-idiotypic Fn3 polypeptides or anti-anti-idiotypic Fn3 polypeptides of the invention.
  • Kits typically include a label indicating the intended use of the contents of the kit. The term label includes any writing, or recorded material supplied on or with the kit, or which otherwise accompanies the kit.
  • the anti-idiotypic Fn3 polypeptides, anti-anti-idiotypic Fn3 polypeptides of the present invention may be employed in all areas of the research, therapeutic, and diagnostic fields.
  • Exemplary diseases/disorders which can be treated using the anti-idiotypic Fn3 polypeptides or anti-anti-idiotypic Fn3 polypeptides of the present invention (and variants, fusions, and conjugates thereof) include autoimmune disorders, cancers, infections, and other pathogenic indications.
  • the anti-idiotypic Fn3 polypeptides or anti-anti-idiotypic Fn3 polypeptides of the invention can be used to ameliorate or treat various diseases which include, but are not limited to, rheumatoid arthritis, osteoarthritis, juvenile chronic arthritis, septic arthritis, Lyme arthritis, psoriatic arthritis, reactive arthritis, spondyloarthropathy, systemic lupus erythematosus, Crohn's disease, ulcerative colitis, inflammatory bowel disease, insulin dependent diabetes mellitus, thyroiditis, asthma, allergic diseases, psoriasis, dermatitis scleroderma, graft versus host disease, organ transplant rejection, acute or chronic immune disease associated with organ transplantation, sarcoidosis, atherosclerosis, disseminated intravascular coagulation, Kawasaki's disease, Grave's disease, nephrotic syndrome, chronic fatigue syndrome, Wegener's granulomatosis, Henoch-Scho
  • polyglandular deficiency type I and polyglandular deficiency type II Schmidt's syndrome, adult (acute) respiratory distress syndrome, alopecia, alopecia greata, seronegative arthopathy, arthropathy, Reiter's disease, psoriatic arthropathy, ulcerative colitic arthropathy, enteropathic synovitis, chlamydia, yersinia and salmonella associated arthropathy, spondyloarthopathy, atheromatous disease/arteriosclerosis, atopic allergy, autoimmune bullous disease, pemphigus vulgaris, pemphigus foliaceus, pemphigoid, linear IgA disease, autoimmune haemolytic anaemia, Coombs positive haemolytic anaemia, acquired pernicious anaemia, juvenile pernicious anaemia, myalgic encephalitis/Royal Free Disease, chronic mucocutaneous candidiasis, giant cell arteritis, primary s
  • immunodeficiency common variable hypogammaglobulinaemia
  • dilated cardiomyopathy female infertility, ovarian failure, premature ovarian failure, fibrotic lung disease, cryptogenic fibrosing alveolitis, post-inflammatory interstitial lung disease, interstitial pneumonitis, connective tissue disease associated interstitial lung disease, mixed connective tissue disease associated lung disease, systemic sclerosis associated interstitial lung disease, rheumatoid arthritis associated interstitial lung disease, systemic lupus erythematosus associated lung disease, dermatomyositis/polymyositis associated lung disease, Sjogren's disease associated lung disease, ankylosing spondylitis associated lung disease, vasculitic diffuse lung disease, haemosiderosis associated lung disease, drug-induced interstitial lung disease, fibrosis, radiation fibrosis, bronchiolitis obliterans, chronic eosinophilic pneumonia, lymphocytic infiltrative
  • hypoparathyroidism acute immune disease associated with organ transplantation, chronic immune disease associated with organ transplantation, osteoarthrosis, primary sclerosing cholangitis, psoriasis type 1, psoriasis type 2, idiopathic leucopaenia, autoimmune neutropaenia, renal disease NOS, glomerulonephritides, microscopic vasulitis of the kidneys, lyme disease, discoid lupus erythematosus, male infertility idiopathic or NOS, sperm autoimmunity, multiple sclerosis (all subtypes), sympathetic ophthalmia, pulmonary hypertension secondary to connective tissue disease, Goodpasture's syndrome, pulmonary manifestation of polyarteritis nodosa, acute rheumatic fever, rheumatoid spondylitis, Still's disease, systemic sclerosis, Sjorgren's syndrome, Takayasu's disease/arteritis, autoimmune
  • GBS group B streptococci
  • mental disorders e.g., depression and schizophrenia
  • Th2 Type and Thl Type mediated diseases acute and chronic pain (different forms of pain)
  • cancers such as lung, breast, stomach, bladder, colon, pancreas, ovarian, prostate and rectal cancer and hematopoietic malignancies (leukemia and lymphoma), Abetalipoprotemia, Acrocyanosis, acute and chronic parasitic or infectious processes, acute leukemia, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), acute or chronic bacterial infection, acute pancreatitis, acute renal failure, adenocarcinomas, aerial ectopic beats, AIDS dementia complex, alcohol-induced hepatitis, allergic conjunctivitis, allergic contact dermatitis, allergic rhinitis, allograft rejection, alpha- 1 -antitrypsin deficiency, amyotroph
  • hypersensitivity reactions aordic and peripheral aneuryisms, aortic dissection, arterial hypertension, arteriosclerosis, arteriovenous fistula, ataxia, atrial fibrillation (sustained or paroxysmal), atrial flutter, atrioventricular block, B cell lymphoma, bone graft rejection, bone marrow transplant (BMT) rejection, bundle branch block, Burkitt's lymphoma, Burns, cardiac arrhythmias, cardiac stun syndrome, cardiac tumors, cardiomyopathy,
  • cardiopulmonary bypass inflammation response cartilage transplant rejection, cerebellar cortical degenerations, cerebellar disorders, chaotic or multifocal atrial tachycardia, chemotherapy associated disorders, chromic myelocytic leukemia (CML), chronic alcoholism, chronic inflammatory pathologies, chronic lymphocytic leukemia (CLL), chronic obstructive pulmonary disease (COPD), chronic salicylate intoxication, colorectal carcinoma, congestive heart failure, conjunctivitis, contact dermatitis, cor pulmonale, coronary artery disease, Creutzfeldt- Jakob disease, culture negative sepsis, cystic fibrosis, cytokine therapy associated disorders, Dementia pugilistica, demyelinating diseases, dengue hemorrhagic fever, dermatitis, dermatologic conditions, diabetes, diabetes mellitus, diabetic ateriosclerotic disease, Diffuse Lewy body disease, dilated congestive cardiomyopathy, disorders of the
  • metabolic/idiopathic migraine headache, mitochondrial multi. system disorder, mixed connective tissue disease, monoclonal gammopathy, multiple myeloma, multiple systems degenerations (Mencel Dejerine-Thomas Shi-Drager and Machado- Joseph), myasthenia gravis, mycobacterium avium intracellular, mycobacterium tuberculosis, myelodyplastic syndrome, myocardial infarction, myocardial ischemic disorders, nasopharyngeal carcinoma, neonatal chronic lung disease, nephritis, nephrosis, neurodegenerative diseases, neurogenic I muscular atrophies, neutropenic fever, non-hodgkins lymphoma, occlusion of the abdominal aorta and its branches, occulsive arterial disorders, okt3 therapy,
  • orchitis/epidydimitis, orchitis/vasectomy reversal procedures organomegaly, osteoporosis, pancreas transplant rejection, pancreatic carcinoma, paraneoplastic syndrome/hypercalcemia of malignancy, parathyroid transplant rejection, pelvic inflammatory disease, perennial rhinitis, pericardial disease, peripheral atherlo sclerotic disease, peripheral vascular disorders, peritonitis, pernicious anemia, Pneumocystis carinii pneumonia, pneumonia, POEMS syndrome (polyneuropathy, organomegaly, endocrinopathy, monoclonal gammopathy, and skin changes syndrome), post perfusion syndrome, post pump syndrome, post-MI cardiotomy syndrome, preeclampsia, Progressive supranucleo Palsy, primary pulmonary hypertension, radiation therapy, Raynaud's phenomenon and disease, Raynoud's disease, Refsum's disease, regular narrow QRS tachycardia, renovascular hypertension
  • autoimmune conditions include, but are not limited to, the following: multiple sclerosis and other demyelinating diseases; rheumatoid arthritis; inflammatory bowel disease; systemic lupus erythematosus; Type I diabetes; inflammatory skin disorders; Sjogren's Syndrome; and transplant rejection.
  • cancers in which the anti-idiotypic Fn3 polypeptides or anti-anti-idiotypic Fn3 polypeptides of the invention can be used include, but are not limited to, the following: lung; breast; prostate; bladder; melanoma; non-Hodgkin lymphoma; colon and rectal; pancreatic; endometrial; kidney; skin (non-melanoma); leukemia; and thyroid.
  • infections in which the anti-idiotypic Fn3 polypeptides or anti-anti-idiotypic Fn3 polypeptides of the invention can be used include, but are not limited to, the following: cellular, fungal, bacterial, and viral.
  • Example 1 Preparation of HA Enriched Anti-idiotypic Fibronectin Molecules.
  • This example demonstrates the procedure required to prepare fibronectin molecules enriched for HA.
  • 10Fn3 yeast library cells were thawed on ice and grow overnight in 1 L of SDCAA media (SDCAA media- Dissolve 20 g dextrose, 6.7 g Difco yeast nitrogen base, 5 g Bacto casmino acids, 5.4 g Na 2 HP0 4 and 8.56 g NaH 2 P0 4 H 2 0 in deionized H 2 0 to a volume of one liter and sterilize by filtration) in incubator shaker set at 30°C for 24 hours until an optical density an OD of 1 at 620 is 2 x 10 7 cells per mL was attained.
  • the cells were passaged 10 10 cells at least twice down to an OD of 0.5 - 1 in fresh SDCAA media, pelleting cells each time at 2500 g for 5 minutes.
  • 5 x 10 9 cells were centrifuges and the pellet resuspended in fresh SGCAA media to an OD of 0.6.
  • Cells were Induced for 24-48 hrs in 20°C incubator shaker.
  • 5 x 10 9 cells were centrifuged and the cell pellet resuspend in 1 mL of PBSM buffer. 100 uL of anti-HA microbeads were added to the suspension and the sample incubated on ice for 1 hour.
  • PBSM was added to bring up sample to 60 mL, and split between two 50 mL Falcon tubes- this is to avoid overwhelming the separation columns (capacity is about 5 x 10 9 cells).
  • the cells were analyzed using the AutoMACS, initially run on the 'Clean' program.
  • the rack was loaded onto machine, with two tubes containing labelled cells, two empty 50 mL falcon tubes to collect negative cells and two empty 15 mL Falcon tubes to collect positive cells.
  • the 'Possel S' protocol was selected to allow for a slower, more sensitive separation.
  • Plasmid purification was completed using the Qiagen Mini- prep kit. The plasmid was run on E-gel to verify plasmid rescue.
  • DNA was transform into TOP TEN electro-competent cells according to the Invitrogen protocol, using the 0.1 cm cuvettes. 1 mL of SOC medium was immediately added. The mixture was transfered to an 1.5 mL eppendorf tube and shaken at 37 ° C for 1 hour. The cell mixture was then plated out on LB carbenicillin plates and incubated overnight at 37°C. 48 colonies were stamped on duplicate LB-carb plates and sequenced. The results were analyzed for enrichment towards HA peptide appearing in loops of 10Fn3.
  • Figure 5 shows sequences displaying HA anti-idiotypic sequences
  • the PCR reaction was run on E-gel to verify reaction.
  • the desired band was cut from gel and purified with MinElute gel extraction kit.
  • Library inserts and pET-45b vector with Sail and Sacl vectors were digested according to NEB high fidelity protocol. The digests were cleaned with MinElute reaction cleanup kit.
  • a ligation was set up using a T4 DNA ligase kit and protocol provided. Ligation was conducted by incubating in 16°C water bath overnight, followed by heat inactivation at 65 ° C for ten minutes. The ligation mix was transformed into ACELLA cells following the Edge Bio protocol using 0.1 cm cuvettes.
  • the King Fisher system was used to purify the proteins from each well of the plate.
  • the deck was set up with elution plate (96 well plate with 150 uL/well elution buffer), two wash plates (96 well block with 1.2 mL/well wash buffer), and beads (96 well block with 500 uL bead wash containing MagneHis beads, Promega).
  • the elution plates were tested in duplicate using sandwich ELISA by coating wells of MaxiSorp plates with capture anti-S-tag antibody at a concentration of 1 ⁇ g/ ⁇ L, 1 ⁇ . per well in carbonate buffer. The plates were incubated at room temperature for 2 hours, or 4 ° C overnight. After incubation, the plates were washed 3-6 times with 300 uL PBS-tween buffer. The plates were blocked plate with 300 uL/well PBS + 5% BSA, incubated 2 hours at room temperature, and washed 3-6 times with 300 uL PBS-tween buffer. 90 uL/well of PBS was added to each well.
  • Fn3-based binding molecules can purified from a large scale expression of the molecule, following procedure outlined by Graslund et at, (Graslund et at Nature Methods (2008) 5, 135 - 146). Starter cultures of freshly streaked colonies were used to inoculate 10 mL Minimal Media containing 25 ug/ml Carbenicillin and incubated overnight at 37°C at 175 rpm. The following morning, 10 ml of the starter culture was used to inoculated into 1 litre of Teriffic Broth media with 100 ug/ml Carbenicillin in a 2.8 L Fembach shake flask.
  • lysis buffer 0.1 M sodium phosphate, pH 8.0, 1.0 M NaCl, 20 mM imidazole, 10% (v/v) glycerol, 1 mM TCEP, and 20 units/ml 15 Benzonase
  • 1 mg/ml lysozyme was added to the cell suspension and after incubation for 30 min on ice, the suspension was lysed by pressure using a microfluidizer at 1500psi and the pH readjusted to 8.0.
  • Anti-polyHistidine monoclonal antibody (R&D Systems # MAB050) was immobilized on a CM5 Biacore chip (GE Healthcare # BR- 1006-68) by standard amine coupling . Briefly, HBS-N pH 7.4 (0.01 M HEPES, 0.15 M Nacl ) was used as the assay running buffer. Anti-polyHistidine monoclonal antibody was diluted to a final
  • Fnl 0 EW31 the anti-HA anti-idiotypic fibronectin was diluted to a concentration of 50uM in HBS-N buffer and passed over FC1 and 2 for 60 seconds at 30ul/min and allowed to stabilize for 60 seconds.
  • Fnl0_EW31 was determined by subtracting the RU obtained from FC1 from FC2. The average captured Fnl0_EW31 for all runs was 339.4 +/- 13.9 RU. Affinity analysis of anti-HA monoclonal antibody to surface bound FnlO_EW31, the anti- HA anti-idiotypic fibronectin
  • Anti-HA monoclonal antibody (Miltenyi Biotec #130-091-122) was diluted in HBS-N buffer at various concentrations and passed over FC1 and 2 for 60 seconds at a flow rate of 30ul/min following the capture of Fn 10 EW31 on the chip surface. The antibody was then allowed to dissociate for 240 seconds so that kinetic data could be obtained. Following each concentration of the anti-HA monoclonal antibody, the chip surface was regenerated by the addition of 3M MgCl for 30 seconds at a flow rate of 30ul/min. The chip was then allowed to stabilize for 120 seconds prior to the next
  • Fnl 0 EW31 capture and anti-HA affinity run.
  • a blank sample containing no anti-HA antibody was run as a negative control and one concentration (50nM) of the anti-HA antibody was run twice to ensure run to run reliability.
  • Surface bound steady state affinity of the anti-HA antibody to the captured Fnl0_EW31 was determined using the Biacore T100 Evaluation software.
  • Figure 6 shows the results from the Biacore affinity analysis demonstrating that Fnl0_EW31 ,the anti-HA anti-idiotypic fibronectin binds to anti-HA monoclonal antibody in a dose dependant manner. This data clearly demonstrates that anti-idiotypic Fn3 polypeptides can be generated against a target antigen and that these anti-idiotypic Fn3 polypeptides are functional in binding assays.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Virology (AREA)
  • Zoology (AREA)
  • Toxicology (AREA)
  • Communicable Diseases (AREA)
  • Pulmonology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention provides anti-idiotypic fibronectin type III (Fn3) polypeptides that bind to an antibody of a target antigen using an antigen mimic sequence present in one or more loop regions. The anti-idiotypic Fn3 polypeptides of the invention can be used to generate or bind half-life extender molecules such as Human Serum Albumin (HSA), for improved half life and stability. The invention also provides methods for generating, screening and using the anti-idiotypic Fn3 polypeptides in a variety of therapeutic and diagnostic applications.

Description

ANTMDIOTYPIC FIBRONECTIN-BASED BINDING MOLECULES
AND USES THEREOF
Cross-Reference to Related Applications
[001 ] This application claims benefit of U.S. Application Serial Number
61/257,172 filed November 2, 2009, the disclosures of which are hereby incorporated by reference.
Background of the Invention
[002] Molecules capable of specific binding to a desired target epitope are of enormous importance as both therapeutics and medical diagnostic tools. A well known example of this class of molecules is the monoclonal antibody. Antibodies can be selected that bind specifically and with high affinity to almost any structural epitope.
[003] In addition, internal image determinants have been used. By means of monoclonal antibody technology, a protective antibody (Abl) to an antigen can be produced. The particular antibody (Abl ) can be purified and subsequently used as an immunogen to elicit an anti-idiotypic antibody (Ab2) which may be an internal image of the original antigen. As predicted by the Jerne "network" theory (Jeme, N. K. 1974. Towards a network theory of the immune system. Ann. Inst. Pasteur. Immun. 125C: 373-389), immunization with an anti-idiotypic antibody (Ab2) that is directed against antigen combining sites of primary antibody (Abl), may elicit a humoral immune response specific for the nominal antigen, resulting in an anti-anti-idiotypic antibody. An anti-idiotypic antibody will not contain the nominal antigen, thus avoiding any undesirable adverse effects associated with use of that antigen as an immunogen.
[004] However, monoclonal antibodies and anti-idiotypic antibodies have a number of shortcomings. For example, classical antibodies and and anti-idiotypic are large and complex molecules. They have a heterotetramenc structure comprising two light chains and two heavy chains connected together by both inter and intra disulphide linkages. This structural complexity precludes easy expression of antibodies in simple prokaryotic systems and requires that antibodies are produced in more elaborate (and expensive) mammalian cell systems. The large size of antibodies also limits their therapeutic effectiveness since they are often unable to efficiently penetrate certain tissue spaces. In addition, therapeutic antibodies, because they possess an Fc region, occasionally trigger undesired effector cell function and/or clotting cascades. [005] Accordingly there is a need in the art for alternative binding molecules capable of specific binding to a desired target with high affinity and specificity.
Summary of the Invention
[006] The present invention provides biologically active peptide mimetics based on a fibronectin type III (Fn3) scaffold that specifically bind to a target antigen and, thus, can be used in a broad variety of therapeutic and diagnostic applications. The anti-idiotypic Fn3 polypeptides generated, structurally and/or functionally, mimic antigenic determinants. They serve as surrogate antigens for therapeutic and diagnostic purposes, e.g. antibodies or Fn3-based binding molecules. Such an approach is especially useful when the antigen is infectious, toxic, or where the availability of antigen is limiting, e.g., difficult to isolate and purify. The anti-idiotypic Fn3 polypeptides themselves can also serve as antigens to produce anti-anti-idiotypic Fn3 polypeptides.
[007] Accordingly, in one aspect, the invention pertains to an anti-idiotypic Fn3 polypeptide that binds to an antibody which binds to a target antigen. The anti-idiotypic Fn3 polypeptide comprises at least two adjacent Fn β-strand domain sequences selected from the group of A-G with a loop region sequence linked between adjacent β-strand domain sequences. The loop region sequence is selected from the group of loops AB, BC, CD, DE, EF, and FG. At least one loop region sequence comprises an antigen mimic sequence that binds to the antibody. Competition assays can be used to test the anti-idiotypic Fn3 polypeptides.
[008] In one embodiment, the anti-idiotypic Fn3 polypeptide further comprises a half life extender molecule such as antibody Fc regions, Human Serum Albumin (HSA) (or portions thereof), polyethylene glycol (PEG) and/or polypeptides which bind to the aforementioned proteins or other serum proteins with increased half-life, such as, e.g., transferrin. Any one of the fourteen domains of Fn3 can be used in accordance with the invention, and in particular the tenth domain of human Fn3 (10Fn3). Furthermore, amino acid residues surrounding the loop regions may also be used to generate anti-idiotypic Fn3 polypeptides.
[009] In another aspect, the invention pertains to an anti-anti-idiotypic fibronectin type III (Fn3) polypeptide which binds to an anti-idiotypic Fn3 polypeptide. The anti- idiotypic Fn3 polypeptide comprises at least two adjacent Fn β-strand domain sequences selected from the group of A-G with a loop region sequence linked between adjacent β- strand domain sequences, the loop region sequence being selected from the group of loops AB, BC, CD, DE, EF, and FG; wherein at least one loop region sequence comprises an antigen mimic sequence that binds to an antibody which binds to a target antigen.
[0010] In another aspect, the invention pertains to a method of producing an anti- idiotypic Fn3 polypeptide with at least two adjacent Fn β-strand domain sequences selected from the group of A-G with a loop region sequence linked between adjacent β-strand domain sequences. The method involves providing an antibody against a target antigen; exposing the antibody to a yeast display library expressing Fn3 polypeptides; and enriching for Fn3 polypeptides that comprise an antigen mimic sequence which binds to the antibody, wherein the antigen mimic sequence is present in a loop region sequence selected from the group of loops AB, BC, CD, DE, EF, and FG.
[0011 ] Also provided by the invention are compositions comprising the anti- idiotypic Fn3 polypeptides or anti-anti-idiotypic Fn3 polypeptides formulated with a suitable carrier. Accordingly, in another aspect, the invention pertains to pharmaceutical compositions comprising an therapeutically effective amount of either an anti-idiotypic Fn3 polypeptide, or an anti-anti-idiotypic Fn3 polypeptide and a pharmaceutically acceptable carrier.
[0012] The anti-idiotypic Fn3 or anti-anti-idiotypic Fn3 polypeptides of the invention can be used in a variety of therapeutic and diagnostic applications including, but not limited to, applications that antibodies can be used in. Such applications include, for example, treatment and diagnosis of autoimmune diseases, cancers and infectious diseases. The anti-idiotypic Fn3 polypeptides of the invention can be based on wild- type Fn3 sequences, (e.g., human Fn3 having the amino acid sequence shown in SEQ ID NO:l) as well as modified versions of such wild type sequences.
[0013] Other features and advantages of the invention will be apparent from the following detailed description and claims.
Brief Description of the Drawings
[0014] Figure 1 shows a ribbon diagram of a Fn3-based binding molecule with loop and framework residues constituting the ligand binding surfaces highlighted.
[0015] Figure 2 depicts a schematic showing the top and bottom loop faces of Fn3.
[0016] Figures 3 a and b shows a schematic showing how to generate anti-idiotypic
Fn3 polypeptides.
[0017] Figure 4 shows a schematic showing how to generate anti-anti-idiotypic Fn3 polypeptides. [0018] Figure 5 depicts the HA anti-idiotypic Fn3 polypeptides showing the loop regions with the HA antigen mimic sequence.
[0019] Figure 6 shows the Biacore affinity binding graph of a HA anti-idiotypic Fn3 polypeptide binding to an anti-HA monoclonal antibody.
Detailed Description of the Invention
[0020] In order to provide a clear understanding of the specification and claims, the following definitions are conveniently provided below. Definitions
[0021] As used herein the term "antibody" as used herein refers to an intact antibody or an antigen binding fragment (i.e., "antigen-binding portion") or single chain (i.e., light or heavy chain) thereof. An intact antibody is a glycoprotein comprising at least two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds. Each heavy chain is comprised of a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region. The heavy chain constant region is comprised of three domains, CHI, CH2 and CH3. Each light chain is comprised of a light chain variable region (abbreviated herein as VL) and a light chain constant region. The light chain constant region is comprised of one domain, CL. The VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR). Each VH and VL is composed of three CDRs and four FRs arranged from amino- terminus to carboxy- terminus in the following order: FRl, CDRl, FR2, CDR2, FR3, CDR3, FR4. The variable regions of the heavy and light chains contain a binding domain that interacts with an antigen. The constant regions of the antibodies may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system.
[0022] As used herein the term "antigen binding portion" of an antibody, as used herein, refers to one or more fragments of an intact antibody that retain the ability to specifically bind to a given antigen (e.g., HA). Antigen binding functions of an antibody can be performed by fragments of an intact antibody. Examples of binding fragments encompassed within the term "antigen binding portion" of an antibody include a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CHI domains; an F(ab)2 fragment, a bivalent fragment comprising two Fab fragments (generally one from a heavy chain and one from a light chain) linked by a disulfide bridge at the hinge region; an Fd fragment consisting of the VH and CHI domains; an Fv fragment consisting of the VL and VH domains of a single arm of an antibody ; a single domain antibody (dAb) fragment (Ward et al., 1989 Nature 341 :544-546), which consists of a VH domain; and an isolated complementarity determining region (CDR).
[0023] Furthermore, although the two domains of the Fv fragment, VL and VH, are coded for by separate genes, they can be joined, using recombinant methods, by an artificial peptide linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv); see, e.g., Bird et al., 1988 Science 242:423-426; and Huston et al., 1988 Proc. Natl. Acad. Sci.
85:5879-5883). Such single chain antibodies include one or more "antigen binding portions" of an antibody. These antibody fragments are obtained using conventional techniques known to those of skill in the art, and the fragments are screened for utility in the same manner as are intact antibodies.
[0024] Antigen binding portions can also be incorporated into single domain antibodies, maxibodies, minibodies, intrabodies, diabodies, triabodies, tetrabodies, v-NAR and bis-scFv (see, e.g., Hollinger and Hudson, 2005, Nature Biotechnology, 23, 9, 1 126- 1 136).
[0025] Antigen binding portions can be incorporated into single chain molecules comprising a pair of tandem Fv segments (VH-CH1 -VH-CH1) which, together with complementary light chain polypeptides, form a pair of antigen binding regions (Zapata et al., 1995 Protein Eng. 8(10): 1057- 1062; and U.S. Pat. No. 5,641,870).
[0026] As used herein the term "human monoclonal antibody" refers to an antibody displaying a single binding specificity that has variable regions in which both the framework and CDR regions are derived from human sequences. In one embodiment, the human monoclonal antibody is produced by a hybridoma that includes a B cell obtained from a transgenic nonhuman animal (e.g., a transgenic mouse having a genome comprising a human heavy chain transgene and a light chain transgene) fused to an immortalized cell.
[0027] As used herein the term "recombinant human antibody", as used herein, includes any human antibody that is prepared, expressed, created or isolated by recombinant means, such as an antibody isolated from an animal (e.g., a mouse) that is transgenic or transchromosomal for human immunoglobulin genes or a hybridoma prepared therefrom; an antibody isolated from a host cell transformed to express the human antibody, e.g., from a transfectoma; an antibody isolated from a recombinant, combinatorial human antibody library; and an antibody prepared, expressed, created or isolated by any other means that involve splicing of all or a portion of a human immunoglobulin gene sequences to another DNA sequence. Such recombinant human antibodies have variable regions in which the framework and CDR regions are derived from human germline immunoglobulin sequences. In certain embodiments, however, such recombinant human antibodies can be subjected to in vitro mutagenesis (or, when an animal transgenic for human Ig sequences is used, in vivo somatic mutagenesis) and thus the amino acid sequences of the VH and VL regions of the recombinant antibodies are sequences that, while derived from and related to human germline VH and VL sequences, may not naturally exist within the human antibody germline repertoire in a human.
[0028] As used herein the term "isotype" refers to the antibody class (e.g., IgM, IgE,
IgG such as IgGl or IgG4) that is encoded by the heavy chain constant region gene.
[0029] As used herein the term "idiotype" refers to part of a variable region of an antibody that is unique for each antibody type.
[0030] As used herein the term "single chain antibody" refers to an antigen binding portion of a light chain variable region and an antigen binding portion of a heavy chain variable region, joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form
monovalent molecules (known as single chain Fv (scFv); see e.g., Bird et al. (1988) Science 242:423-426; and Huston et al. (1988) Proc. Natl. Acad. Sci. U.S.A 85:5879-5883).
[0031 ] As used herein the term "camelid nanobody" refers to a region of camelid antibody which is the small single variable domain devoid of light chain and that can be obtained by genetic engineering to yield a small protein having high affinity for a target, resulting in a low molecular weight antibody-derived protein. See WO07042289 and U.S. patent number 5,759,808 issued June 2, 1998; see also Stijlemans, B. et al., 2004.
Engineered libraries of camelid antibodies and antibody fragments are commercially available, for example, from Ablynx, Ghent, Belgium. As with other antibodies of non- human origin, an amino acid sequence of a camelid antibody can be altered recombinantly to obtain a sequence that more closely resembles a human sequence, i.e., the nanobody can be "humanized". Thus the natural low antigenicity of camelid antibodies to humans can be further reduced.
[0032] As used herein the term "specific binding'" or "specifically binds to" refers to the ability of an anti-idiotypic Fn3 polypeptides to bind to a target with an affinity of at least 1 x 10"6 M, and/or bind to a target with an affinity that is at least two-fold, (preferably at least 10 fold), greater than its affinity for a nonspecific antigen at room temperature under standard physiological salt and pH conditions, as measured by surface plasmon resonance.
[0033] As used herein the term "Fibronectin type III domain" or "Fn3 domain" refers to a wild-type Fn3 domain from any organism, as well as chimeric Fn3 domains constructed from beta strands from two or more different Fn3 domains. As is known in the art, naturally occurring Fn3 domains have a beta-sandwich structure composed of seven beta-strands, referred to as A, B, C, D, E, F, and G, linked by six loops, referred to as AB, BC, CD, DE, EF, and FG loops (See e.g., Bork and Doolittle, Proc. Natl. Acad. Sci. U.S.A 89:8990, 1992; Bork et al, Nature Biotech. 15:553, 1997; Meinke et al., J. Bacteriol.
175: 1910, 1993; Watanabe et al, J. Biol. Chem. 265: 15659, 1990; Mai e/ al, 1992; Leahy et ai, 1992; Dickinson et al, 1994; U.S. patent 6,673,901 ; Patent Cooperation Treaty publication WO/03104418; and, US patent application 2007/0082365, the entire teachings of which are incorporated herein by reference). Three loops are at the top of the domain (the BC, DE and FG loops) and three loops are at the bottom of the domain (the AB, CD and EF loops) (see Figure 1). In a particular embodiment, of the invention, the Fn3 domain is from the tenth Fn3 domain of human Fibronectin (10Fn3) (SEQ. ID. NO: 1).
VSDVPRDLEWAATPTSLLI SWDAPAV VRYYRI YGETGGNS PVQEFTVPGSKS TATI SGL KPGVDY I VYAVTGRGDS PAS SKPI S I YRTEI (SEQ ID NO: 1)
[0034] The term "target antigen" refers to an antigen or epitope recognized by anti- idiotypic Fn3 polypeptides of the invention. Targets include, but are not limited to, epitopes present on proteins, peptides, carbohydrates, and/or lipids.
[0035] As used herein the term "antigen mimic sequence" refers to an amino acid sequence that emulate antigenic determinants and thus serves as a surrogate antigen.
Furthermore, the antigen mimic sequence resembles the antigen at the molecular level and/or a structural level to elicit a desired response.
[0036] As used herein the term "anti-idiotypic Fn3 polypeptide" refers to a Fn3 polypeptide molecule that binds to an antibody which binds to a target antigen. The Fn3 domain of the anti-idiotypic Fn3 polypeptide has been altered to contain one or more antigen mimic sequence(s) that bind to the antibody of the target antigen. The antigen mimic sequence is essentially a molecular and/or structural mimic or the target antigen. In one embodiment, one or more of the top BC, DE, and/or FG loops are altered compared to the corresponding wild-type Fn3 domain to contain the antigen mimic sequence(s) that bind to the antibody of the target antigen. In another embodiment, one or more of the bottom AB, CD and/or EF loops are altered compared to the corresponding wild-type Fn3 domain to contain antigen mimic sequence(s) that bind to the antibody of the target antigen. In yet another embodiment, one or more of the bottom AB, CD or EF loops and one or more of the top BC, DE and FG loops are altered compared to the corresponding wild-type Fn3 domain to contain antigen mimic sequence(s) that bind to the antibody of the target antigen.
[0037] The anti-idiotypic Fn3 polypeptide can be used as a surrogate antigen to produce antibodies or antigen binding molecules. The anti-idiotypic Fn3 polypeptide can also be used as a surrogate antigen to produce other Fn3-based binding molecules such as anti-anti-idiotypic Fn3 polypeptides.
[0038] As used herein the term "anti-anti-idiotypic Fn3 polypeptide" refers to a Fn3 polypeptide molecule which binds to an anti-idiotypic Fn3 polypeptides. For the sake of illustration, the anti-idiotypic Fn3 polypeptide acts as a surrogate antigen to generate an anti- anti-idiotypic Fn3 polypeptide. Thus, the anti-anti-idiotypic Fn3 polypeptide is essentially a binding molecule against the surrogate antigen.
[0039] The term "non-Fn3 moiety" refers to a biological or chemical entity that imparts additional functionality to a molecule to which it is attached. In a particular embodiment, the non-Fn3 moiety is a polypeptide, e.g., human serum albumin (HSA), or a chemical entity, e.g., polyethylene gycol (PEG) which increases the half-life of the Fn3- based binding molecule in vivo.
[0040] The term "non-natural amino acid residue" refers to an amino acid residue that is not present in the naturally occurring (wild-type) Fn3 domain. Such non-natural amino acid residues can be introduced by substitution of naturally occurring amino acids, and/or by insertion of non-natural amino acids into the naturally occurring amino acid Fn3 sequence. The non-natural amino acid residue also can be incorporated such that a desired functionality is imparted to the Fn3-based binding molecule, for example, the ability to link a functional moiety (e.g., PEG).
[0041] The term "polyethylene glycol" or "PEG" refers to a polyalkylene glycol compound or a derivative thereof, with or without coupling agents or derviatization with coupling or activating moieties.
Overview
[0042] The present invention provides anti-idiotypic Fn3 polypeptides that specifically bind to an antibody of a target antigen. The invention provides for anti-idiotypic Fn3 polypeptides in which at least one or more of the top BC, DE, and/or FG loop regions, and/or at least one or more of the bottom AB, CD, EF loop regions comprises an antigen mimic sequence that binds to the antibody of the target antigen. In one embodiment, anti- idiotypic Fn3 polypeptides can be attached to a half-life extender such as Human Serum Albumin (HSA) to generate anti-idiotypic Fn3 polypeptides with an improved half life and stability. In another embodiment, the anti-idiotypic Fn3 polypeptides can be engineered such that the top loops bind to an antibody of a target antigen and the bottom loops bind to a half-life extender. In another embodiment, the anti-idiotypic Fn3 polypeptides can be engineered such that the bottom loops bind to an antibody of a target antigen and the top loops bind to a half-life extender. The anti-idiotypic Fn3 polypeptides can be used in a variety of therapeutic and diagnostic applications, much like other binding molecules, such as antibodies. Antibodies or other Fn3 -based binding molecules can be produced using these anti-idiotypic Fn3 polypeptides as surrogate antigens.
[0043] The present invention also provides for anti-anti-idiotypic Fn3 polypeptides that specifically bind to an anti-idiotypic Fn3 polypeptide. In this instance, the anti-idiotypic Fn3 polypeptide acts as a surrogate antigen and the anti-anti-idiotypic Fn3 polypeptide as a binding molecule against the surrogate antigen. For the sake of illustration, if the original antigen is HA, the original antibodies are anti-HA antibodies, then the anti-idiotypic Fn3 polypeptide is the surrogate HA antigen, and the anti-anti-idiotypic Fn3 polypeptide is the equivalent of a surrogate anti-HA antibody.
[0044] The anti-idiotypic Fn3 polypepties generated may mimic antigenic determinants and may thus serve as surrogate antigens for therapeutic and diagnostic purposes, e.g. for applications where the availability of antigen is limiting. Applications include competitive immunoassays or direct serological assays. Advantages of using "internal image" anti-idiotypic antibodies instead of conventional antigens include ease of production, safety of use in cases where the antigen is toxic or hazardous for other reasons, ease of purification, established methods for the attachment of label, and possibilities for the attachment to a solid support without loss of immunoreactivity. Anti-idiotypic Fn3 Polypeptides and Anti-Anti-idiotvpic Fn3 Polypeptides
[0045] In one aspect, the invention provides anti-idiotypic Fn3 polypeptides which are altered compared to the wild-type Fn3 domain (e.g., in the bottom and/or top loop regions) to have one or more antigen mimic sequence(s) that binds to an antibody of the target antigen. In one embodiment, the anti-idiotypic Fn3 polypeptides use the bottom AB, CD, EF loops comprising one or more antigen mimic sequence(s) to bind to an antibody of the target antigen. In another embodiment, the anti- idiotypic Fn3 polypeptides use the top BC, DE, FG loops comprising one or more antigen mimic sequence(s) to bind to an antibody of the target antigen. For the sake of illustration only and as shown in the Examples, anti-HA antibodies against the HA antigen, can be used to generate HA anti-idiotypic Fn3 polypeptides that comprise at least one HA antigen mimic sequence in at least one loop region. This anti-idiotypic Fn3 polypeptide with the HA antigen mimic sequence can bind the anti-HA antibody. This anti-idiotypic Fn3 polypeptide with the HA antigen mimic sequence also acts as a surrogate HA antigen, against which anti-anti -idiotypic Fn3 polypeptides can be made.
[0046] Accordingly, in one embodiment, the invention provides an anti-idiotypic
Fn3 polypeptide that binds to an antibody which binds to a target antigen, where the anti- idiotypic Fn3 polypeptide comprises at least two adjacent Fn β-strand domain sequences selected from the group of A-G with a loop region sequence linked between adjacent β- strand domain sequences. The loop region sequence is selected from the group of loops AB, BC, CD, DE, EF, and FG; and at least one loop region sequence comprises an antigen mimic sequence that binds to the antibody. In particular embodiment the wild type Fn3 domain is a human Fn3 domain, e.g., human 10Fn3 (SEQ ID NO:l).
[0047] In another aspect, the invention provides anti-anti-idiotypic Fn3 polypeptides that bind to the anti-idiotypic Fn3 polypeptides. The anti-idiotypic Fn3 polypeptides act as surrogate antigens and the anti-anti-idiotypic Fn3 polypeptides is a binding molecule against the surrogate antigen.
[0048] In another aspect, the invention provides a library of anti-idiotypic Fn3 polypeptides, which can be used to identify anti-idiotypic Fn3 polypeptide which binds to an antibody of a particular desired target antigen. In one embodiment, the library comprises anti-idiotypic Fn3 polypeptides, each of which contains at least one antigen mimic sequence in one or more of AB, BC, CD, DE, EF, FG loop regions compared to a wild-type Fn3 domain, such as the human 10Fn3 (SEQ ID NO: l).
[0049] Library diversity can be generated by, for example, random mutagenesis, "walk though mutagenesis, or "look through mutagenesis of one or more of the disclosed residues in SEQ ID NO: l (7,195,880; 6,951,725; 7,078, 197; 7,022,479; 5,922,545;
5,830,721 ; 5,605,793, 5,830,650; 6,194,550; 6,699,658; 7,063,943; 5,866,344 and Patent Cooperation Treaty publication WO06023144). [0050] Nucleic acids encoding the library of anti -idiotypic Fn3 polypeptide or variants thereof, described herein can be constructed using art recognized methods including, but not limited to, PCR-based or enzyme-mediate genetic engineering, ab initio DNA or RNA synthesis, and/or cassette mutagenesis.
[0051] Suitable targets for anti-idiotypic Fn3 polypeptides include, but are not limited to, a cellular receptor, a cellular receptor ligand, a bacteria, a virus., or chemokines. In a particular embodiment the target is involved in a human disease, e.g., an autoimmune disease, cancer, or an infectious disease. 1. Targets involved in Human Autoimmune and Inflammatory Response
[0052] Many proteins have been implicated in general autoimmune and
inflammatory responses. In one aspect, the inventions pertains to anti-idiotypic Fn3 polypeptides capable of binding to targets involved in autoimmune and inflammatory responses which include, but are not limited to, C5, CCL1 (1-309), CCL1 1 (eotaxin), CCL13 (mcp-4), CCL15 (MIP-Id), CCL16 (HCC-4), CCL17 (TARC), CCL18 (PARC), CCL19, CCL2 (mcp-1), CCL20 (MIP-3a), CCL21 (MIP-2), CCL23 (MPIF-1), CCL24 (MPIF-2/eotaxin-2), CCL25 (TECK), CCL26, CCL3 (MIP-la), CCL4 (MIP-lb), CCL5 (RANTES), CCL7 (mcp-3), CCL8 (mcp-2), CXCL1, CXCL10 (IP-10), CXCL11(1-TAC/IP- 9), CXCL12 (SDF1), CXCL13, CXCL14, CXCL2, CXCL3, CXCL5 (ENA-78/LIX), CXCL6 (GCP-2), CXCL9, IL13, IL8, CCL13 (mcp-4), CCRl, CCR2, CCR3, CCR4, CCR5, CCR6, CCR7, CCR8, CCR9, CX3CR1 , IL8RA, XCR1 (CCXCR1), IFNA2, IL10, IL13, IL17C, ILIA, IL1B, IL1F10, IL1F5, IL1F6, IL1F7, IL1F8, IL1F9, IL22, IL5, IL8, IL9, LTA, LTB, MIF, SCYEl (endothelial Monocyte-activating cytokine), SPPl , TNF, TNFSF5, IFNA2, IL10RA, IL10RB, IL13, IL13RA1, IL5RA, IL9, IL9R, ABCF1, BCL6, C3, C4A, CEBPB, CRP, ICEBERG, IL 1 Rl , IL 1 RN, IL8RB, LTB4R, TOLLIP, FADD, IRAKI ,
IRAK2, MYD88, NCK2, TNFAIP3, TRADD, TRAF1 , TRAF2, TRAF3, TRAF4, TRAF5, TRAF6, ACVR1, ACVR1B, ACVR2, ACVR2B, ACVRL1 , CD28, CD3E, CD3G, CD3Z, CD69, CD80, CD86, CNR1, CTLA4, CYSLTR1, FCER1A, FCER2, FCGR3A, GPR44, HAVCR2, OPRD1, P2RX7, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, BLR1, CCL1, CCL2, CCL3, CCL4, CCL5, CCL7, CCL8, CCL1, CCL13, CCL15, CCL16, CCL17, CCL18, CCL19, CCL20, CCL21 , CCL22, CCL23, CCL24, CCL25, CCRl , CCR2, CCR3, CCR4, CCR5, CCR6, CCR7, CCR8, CCR9, CX3CL1 , CX3CR1 , CXCL1, CXCL2, CXCL3, CXCL5, CXCL6, CXCL10, CXCL1 1, CXCL12, CXCL13, CXCR4, GPR2, SCYEl , SDF2, XCL1 , XCL2, XCR1, AMH, AMHR2, BMPR1A, BMPR1B, BMPR2, C19orfl 0 (IL27w), CER1 , CSF1 , CSF2, CSF3, DKFZp451J01 18, FGF2, GFI1, IFNAl, IFNBl, IFNG, IGFl, ILIA, ILIB, IL1R1, IL1R2, IL2, IL2RA, IL2RB, IL2RG, IL3, IL4, IL4R, IL5, IL5RA, IL6, IL6R, IL6ST, IL7, IL8, IL8RA, 18RB, IL9, IL9R, IL10, IL10RA, IL10RB, IL1 1, IL1 IRA, IL12A, IL12B, IL12RB1, IL12RB2, IL13, IL13RA1, IL13RA2, IL15, IL15RA, IL16, IL17, IL17R, IL18, IL18R1, IL19, IL20, KITLG, LEP, LTA, LTB, LTB4R, LTB4R2, LTBR, MIF, NPPB, PDGFB, TBX21 , TDGF1, TGFA, TGFB1, TGFB1 I1, TGFB2, TGFB3, TGFB1, TGFBR1 , TGFBR2, TGFBR3, TH1L, TNF, TNFRSF1A, TNFRSF1B, TNFRSF7, TNFRSF8, TNFRSF9, TNFRSF11A, TNFRSF21, TNFSF4, TNFSF5, TNFSF6, TNFSF1 1, VEGF, ZFP 2, and RNF110 (ZNF144).
2. Targets Involved in Asthma
[0053] Allergic asthma is characterized by the presence of eosinophilia, goblet cell metaplasia, epithelial cell alterations, airway hyperreactivity (AHR), and Th2 and Thl cytokine expression, as well as elevated serum IgE levels. It is now widely accepted that airway inflammation is the key factor underlying the pathogenesis of asthma, involving a complex interplay of inflammatory cells such as T cells, B cells, eosinophils, mast cells and macrophages, and of their secreted mediators including cytokines and chemokines.
Corticosteroids are the most important anti -inflammatory treatment for asthma today, however their mechanism of action is non-specific and safety concerns exist, especially in the juvenile patient population. The development of more specific and targeted therapies is therefore warranted. There is increasing evidence that IL-13 in mice mimics many of the features of asthma, including AHR, mucus hypersecretion and airway fibrosis,
independently of eosinophilic inflammation (Finotto et al., International Immunology (2005), 17(8), 993-1007; Padilla et al., Journal of Immunology (2005), 174(12), 8097-8105).
[0054] IL-13 has been implicated as having a pivotal role in causing pathological responses associated with asthma. The development of anti-IL-13 monoclonal antibody therapy to reduce the effects of IL-13 in the lung is an exciting new approach that offers considerable promise as a novel treatment for asthma. However other mediators of differential immunological pathways are also involved in asthma pathogenesis, and blocking these mediators, in addition to IL- 13, may offer additional therapeutic benefit. Such target pairs include, but are not limited to, IL-13 and a pro-inflammatory cytokine, such as tumor necrosis factor-a (TNF-a). TNF-a may amplify the inflammatory response in asthma and may be linked to disease severity (McDonnell, et al., Progress in Respiratory Research (2001), 31(New Drugs for Asthma, Allergy and COPD), 247-250.). This suggests that blocking bothIL-13 and TNF-a may have beneficial effects, particularly in severe airway disease.
[0055] Animal models such as OVA-induced asthma mouse model, where both inflammation and AHR can be assessed, are known in the art and may be used to determine the ability of various anti-idiotypic Fn3 polypeptides to treat asthma. Animal models for studying asthma are disclosed in Coffman, et al., Journal of Experimental Medicine (2005), 201(12), 1875-1879; Lloyd, et al., Advances in Immunology (2001), 77, 263-295; Boyce et al., Journal of Experimental Medicine (2005), 201(12), 1869-1873; and Snibson, et al., Journal of the British Society for Allergy and Clinical Immunology (2005), 35(2), 146-52. In addition to routine safety assessments of these target pairs specific tests for the degree of immunosuppression may be warranted and helpful in selecting the best target pairs (see Luster et al., Toxicology (1994), 92(1-3), 22943; Descotes, et al., Developments in biological standardization (1992), 77 99-102; Hart et al., Journal of Allergy and Clinical Immunology (2001 ), 108(2), 250-257).
[0056] In one aspect, the inventions pertains to anti-idiotypic Fn3 polypeptides capable of binding to targets involved in asthma which include, but are not limited to, CSFl (MCSF), CSF2 (GM-CSF), CSF3 (GCSF), FGF2, IFNA1 , IFNB1, IFNG, histamine and histamine receptors, ILIA, ILIB, IL2, IL3, IL4, IL5, IL6, IL7, IL8, IL9, IL10, ILl 1, IL12A, IL12B, IL13, IL14, IL15, IL16, IL17, ILl 8, IL19, ITLG, PDGFB, IL2RA, IL4R, IL5RA, IL8RA, IL8RB, IL12RB1 , IL12RB2, IL13RA1, IL13RA2, IL18R1, TSLP, CCL1, CCL2, CCL3, CCL4, CCL5, CCL7, CCL8, CCL13, CCL17, CCL18, CCL19, CCL20, CCL22, CCL24, CX3CL1, CXCL1, CXCL2, CXCL3, XCL1, CCR2, CCR3, CCR4, CCR5, CCR6, CCR7, CCR8, CX3CR1, GPR2, XCR1, FOS, GATA3, JA 1, JA 3, STAT6, TBX21, TGFB1, TNFSF6, YY1, CYSLTR1, FCER1A, FCER2, LTB4R, TB4R2, LTBR, and Chitinase.
3. Targets Involved in Rheumatoid Arthritis
[0057] Rheumatoid arthritis (RA), a systemic disease, is characterized by a chronic inflammatory reaction in the synovium of joints and is associated with degeneration of cartilage and erosion of juxta-articular bone. Many pro-inflammatory cytokines including TNF, chemokines, and growth factors are expressed in diseased joints. Systemic
administration of anti-TNF antibody or sTNFR fusion protein to mouse models of RA was shown to be anti-inflammatory and joint protective. Clinical investigations in which the activity of TNF in RA patients was blocked with intravenously administered infliximab (Harriman G, Harper L K, Schaible T F. 1999 Summary of clinical trials in rheumatoid arthritis using infliximab, an anti-TNFalpha treatment. Ann Rheum Dis 58 Suppl 1 :161-4.), a chimeric anti-TNF monoclonal antibody (mAB), has provided evidence that TNF regulates IL-6, IL-8, MCP-1, and VEGF production, recruitment of immune and inflammatory cells into joints, angiogenesis, and reduction of blood levels of matrix metalloproteinases-1 and-3. A better understanding of the inflammatory pathway in rheumatoid arthritis has led to identification of other therapeutic targets involved in rheumatoid arthritis. Promising treatments such as interleukin-6 antagonists (MRA), CTLA4Ig (abatacept, Genovese Mc et al 2005 Abatacept for rheumatoid arthritis refractory to tumor necrosis factor alpha inhibition. N Engl J. Med. 353: 1 1 14-23.), and anti-B cell therapy (rituximab, Okamoto H, Kamatani N. 2004 Rituximab for rheumatoid arthritis. N Engl J. Med. 351 :1909) have already been tested in randomized controlled trials over the past year. Other cytokines have been identified and have been shown to be of benefit in animal models, including
interleukin-15, interleukin-17, and interleukin-18, and clinical trials of these agents are currently under way. In one aspect, the inventions pertains to anti-idiotypic Fn3 polypeptides capable of binding to targets involved in RA which include, but are not limited to, TNF, IL- 12, IL-15, IL-17, IL-18, IL-23, IL-lbeta and MIF.
4. Targets Involved in SLE
[0058] The immunopathogenic hallmark of SLE is the polyclonal B cell activation, which leads to hyperglobulinemia, autoantibody production and immune complex formation. The fundamental abnormality appears to be the failure of T cells to suppress the forbidden B cell clones due to generalized T cell dysregulation. In addition, B and T-cell interaction is facilitated by several cytokines such as IL- 10 as well as co-stimulatory molecules such as CD40 and CD40L, B7 and CD28 and CTLA4, which initiate the second signal. These interactions together with impaired phagocytic clearance of immune complexes and apoptotic material, perpetuate the immune response with resultant tissue injury. In one aspect, the inventions pertains to anti-idiotypic Fn3 polypeptides capable of binding to targets involved in SLE which include, but are not limited to, B cell targeted therapies: CD-20, CD-22, CD- 19, CD28, CD4, CD80, HLA-DRA, IL10, IL2, IL4,
TNFRSF5, TNFRSF6, TNFSF5, TNFSF6, BLR1, HDAC4, HDAC5, HDAC7A, HDAC9, ICOSL, IGBP1, MS4A1, RGS1, SLA2, CD81 , IFNB1, IL10, TNFRSF5, TNFRSF7, TNFSF5, AICDA, BLNK, GALNAC4S-6ST, HDAC4, HDAC5, HDAC7A, HDAC9, IL10, IL11, IL4, INHA, INHBA, KLF6, TNFRSF7, CD28, CD38, CD69, CD80, CD83, CD86, DPP4, FCER2, IL2RA, TNFRSF8, TNFSF7, CD24, CD37, CD40, CD72, CD74, CD79A, CD79B, CR2, IL1R2, ITGA2, ITGA3, MS4A1, ST6GAL1, CD1C, CHST10, HLA-A, HLA-DRA, and NT5E.; co- stimulatory signals: CTLA4 or B7.1/B7.2; inhibition of B cell survival: BlyS, BAFF; Complement inactivation: C5; Cytokine modulation: the key principle is that the net biologic response in any tissue is the result of a balance between local levels of proinflammatory or anti-inflammatory cytokines (see Sfikakis P P et al 2005 Curr Opin Rheumatol 17:550-7). SLE is considered to be a Th-2 driven disease with documented elevations in serum IL-4, IL-6, IL-10. The compositions of the invention capable of binding one or more targets selected from the group consisting of IL-4, IL-6, IL- 10, IFN-α, and TNF-a are also contemplated. SLE can be tested in a number of lupus preclinical models (see Peng SL (2004) Methods Mol Med.; 102:227-72).
5. Targets Involved in Multiple Sclerosis
[0059] Multiple sclerosis (MS) is a complex human autoimmune-type disease with a predominantly unknown etiology. Immunologic destruction of myelin basic protein (MBP) throughout the nervous system is the major pathology of multiple sclerosis. MS is a disease of complex pathologies, which involves infiltration by CD4+ and CD8+ T cells and of response within the central nervous system. Expression in the CNS of cytokines, reactive nitrogen species and costimulator molecules have all been described in MS. Of major consideration are immunological mechanisms that contribute to the development of autoimmunity. In particular, antigen expression, cytokine and leukocyte interactions, and regulatory T-cells, which help balance/modulate other T-cells such as Thl and Th2 cells, are important areas for therapeutic target identification.
[0060] IL- 12 is a proinflammatory cytokine that is produced by APC and promotes differentiation of Thl effector cells. IL-12 is produced in the developing lesions of patients with MS as well as in EAE-affected animals. Previously it was shown that interference in IL-12 pathways effectively prevents EAE in rodents, and that in vivo neutralization of IL- 12p40 using a anti-IL-12 mAb has beneficial effects in the myelin-induced EAE model in common marmosets.
[0061 ] TWEAK is a member of the TNF family, constitutively expressed in the central nervous system (CNS), with pro-inflammatory, proliferative or apoptotic effects depending upon cell types. Its receptor, Fnl4, is expressed in CNS by endothelial cells, reactive astrocytes and neurons. TWEAK and Fnl4 mRNA expression increased in spinal cord during experimental autoimmune encephalomyelitis (EAE). Anti-TWEAK antibody treatment in myelin oligodendrocyte glycoprotein (MOG) induced EAE in C57BL/6 mice resulted in a reduction of disease severity and leukocyte infiltration when mice were treated after the priming phase.
[0062] In one aspect, the inventions pertains to anti-idiotypic Fn3 polypeptides capable of binding to targets involved in MS which include, but are not limited to, IL-12, TWEAK, IL-23, CXCL13, CD40, CD40L, IL-18, VEGF, VLA4, TNF, CD45RB, CD200, IFNgamma, GM-CSF, FGF, C5, CD52, and CCR2. Several animal models for assessing the usefulness of the molecules to treat MS are known in the art (see Steinman L, et al., (2005) Trends Immunol. 26(11):565-71 ; Lublin F D.; et al., (1985) Springer Semin Immunopathol. 8(3): 197-208; Genain C P, et al., (1997) J Mol Med. 75(3): 187-97; Tuohy V K, et al.,
(1999) J Exp Med. 189(7): 1033-42; Owens T, et al., (1995) Neurol Clin.l3(l):51-73; and 't Hart B A, et al., (2005) J Immunol 175(7):4761-8.
6. Targets Involved in Sepsis
[0063] The pathophysiology of sepsis is initiated by the outer membrane components of both gram-negative organisms (lipopolysaccharide [LPS], lipid A, endotoxin) and gram- positive organisms (lipoteichoic acid, peptidoglycan). These outer membrane components are able to bind to the CD 14 receptor on the surface of monocytes. By virtue of the recently described toll-like receptors, a signal is then transmitted to the cell, leading to the eventual production of the proinflammatory cytokines tumor necrosis factor-alpha (TNF-alpha) and interleukin-1 (IL-I). Overwhelming inflammatory and immune responses are essential features of septic shock and play a central part in the pathogenesis of tissue damage, multiple organ failure, and death induced by sepsis. Cytokines, especially tumor necrosis factor (TNF) and interleukin (IL)-l, have been shown to be critical mediators of septic shock. These cytokines have a direct toxic effect on tissues; they also activate phospholipase A2. These and other effects lead to increased concentrations of platelet-activating factor, promotion of nitric oxide synthase activity, promotion of tissue infiltration by neutrophils, and promotion of neutrophil activity.
[0064] In one aspect, the inventions pertains to anti-idiotypic Fn3 polypeptides capable of binding to targets involved in sepsis which include, but are not limited to, TNF, 1-1 , MIF, IL-6, IL-8, IL-18, IL-12, IL-23, FasL, LPS, Toll-like receptors, TLR-4, tissue factor, MIP-2, ADORA2A, CASP1, CASP4, IL10, IL1B, NFKB1, PROC, TNFRSF1A, CSF3, IL10, IL1B, IL6, ADORA2A, CCR3, IL10, IL1B, IL1RN, MIF, NFKB1, PTAFR, TLR2, TLR4, GPR44, HMOX1, midkine, IRAKI, NFKB2, SERPINA1, SERPINE1, and TREM1. The efficacy of the polypeptide of the invention for sepsis can be assessed in preclinical animal models known in the art (see Buras J A, et al.,(2005) Nat Rev Drug Discov. 4(10):854-65 and Calandra T, et al., (2000) Nat Med. 6(2): 164-70). 7. Targets Involved in Neurological Disorders
7.1. Neurodegenerative Diseases
[0065] Chronic neurodegenerative diseases are usually age-dependent diseases characterized by progressive loss of neuronal functions (neuronal cell death, demyelination), loss of mobility and loss of memory. Emerging knowledge of the mechanisms underlying chronic neurodegenerative diseases (e.g. Alzheimer's disease disease) show a complex etiology and a variety of factors have been recognized to contribute to their development and progression e.g. age, glycemic status, amyloid production and multimerization,
accumulation of advanced glycation-end products (AGE) which bind to their receptor RAGE (receptor for AGE), increased brain oxidative stress, decreased cerebral blood flow, neuroinflammation including release of inflammatory cytokines and chemokines, neuronal dysfunction and microglial activation. Thus these chronic neurodegenerative diseases represent a complex interaction between multiple cell types and mediators. Treatment strategies for such diseases are limited and mostly constitute either blocking inflammatory processes with non-specific anti-inflammatory agents (eg corticosteroids, COX inhibitors) or agents to prevent neuron loss and/or synaptic functions. These treatments fail to stop disease progression. Recent studies suggest that more targeted therapies such as antibodies to soluble A-b peptide (including the A-b oligomeric forms) can not only help stop disease progression but may help maintain memory as well. These preliminary observations suggest that specific therapies targeting more than one disease mediator (e.g. A-b and a pro- inflammatory cytokine such as TNF) may provide even better therapeutic efficacy for chronic neurodegenerative diseases than observed with targeting a single disease mechanism (e.g. soluble A-balone) (see C. E. Shepherd, et al, Neurobiol Aging. 2005 Oct. 24; Nelson R B., Curr Pharm Des. 2005; 1 1 :3335; William L. Klein.; Neurochem Int. 2002 ; 41 :345; Michelle C Janelsins, et al., J Neuroinflammation. 2005 ; 2:23; Soloman B., Curr Alzheimer Res. 2004; 1 : 149; Igor Klyubin, et al., Nat Med. 2005; 11 :556-61 ; Arancio 0, et al., EMBO Journal (2004) 1-10; Bornemann K D, et al., Am J Pathol. 2001 ; 158:63; Deane R, et al., Nat Med. 2003; 9:907-13; and Eliezer Masliah, et al., Neuron. 2005; 46:857).
[0066] In one aspect, the inventions pertains to anti-idiotypic Fn3 polypeptides capable of binding to targets involved in chronic neurodegenerative disease such as Alzheimers which include, but are not limited to, any mediator, soluble or cell surface, implicated in AD pathogenesis e.g AGE (SI 00 A, amphoterin), pro-inflammatory cytokines (e.g. IL-1), chemokines (e.g. MCP 1), molecules that inhibit nerve regeneration (e.g. Nogo, RGM A), molecules that enhance neurite growth (neurotrophins). The efficacy of the polypeptides of the invention can be validated in pre-clinical animal models such as the transgenic mice that over-express amyloid precursor protein or RAGE and develop
Alzheimer's disease-like symptoms. The polypeptides of the invention can also be employed other neurodegenerative diseases such as Parkinson's disease. Alpha-Synuclein is involved in Parkinson's pathology and thus a suitable target.
7.2 Neuronal Regeneration and Spinal Cord Injury
[0067] Despite an increase in knowledge of the pathologic mechanisms, spinal cord injury (SCI) is still a devastating condition and represents a medical indication characterized by a high medical need. Most spinal cord injuries are contusion or compression injuries and the primary injury is usually followed by secondary injury mechanisms (inflammatory mediators e.g. cytokines and chemokines) that worsen the initial injury and result in significant enlargement of the lesion area, sometimes more than 10-fold. These primary and secondary mechanisms in SCI are very similar to those in brain injury caused by other means e.g. stroke. No satisfying treatment exists and high dose bolus injection of methylprednisolone (MP) is the only used therapy within a narrow time window of 8 h post injury. This treatment, however, is only intended to prevent secondary injury without causing any significant functional recovery. It is heavily criticized for the lack of
unequivocal efficacy and severe adverse effects, like immunosuppression with subsequent infections and severe histopathological muscle alterations. No other drugs, biologies or small molecules, stimulating the endogenous regenerative potential are approved, but promising treatment principles and drug candidates have shown efficacy in animal models of SCI in recent years. To a large extent the lack of functional recovery in human SCI is caused by factors inhibiting neurite growth, at lesion sites, in scar tissue, in myelin as well as on injury- associated cells. Such factors are the myelin-associated proteins NogoA, OMgp and MAG, RGM A, the scar-associated CSPG (Chondroitin Sulfate Proteoglycans) and inhibitory factors on reactive astrocytes (some semaphorins and ephrins). However, at the lesion site not only growth inhibitory molecules are found but also neurite growth stimulating factors like neurotrophins, laminin, LI and others. This ensemble of neurite growth inhibitory and growth promoting molecules may explain that blocking single factors, like NogoA or RGM A, resulted in significant functional recovery in rodent SCI models, because a reduction of the inhibitory influences could shift the balance from growth inhibition to growth promotion. However, recoveries observed with blocking a single neurite outgrowth inhibitory molecule were not complete. To achieve faster and more pronounced recoveries either blocking two neurite outgrowth inhibitory molecules e.g Nogo and RGM A, or blocking an neurite outgrowth inhibitory molecule and enhancing functions of a neurite outgrowth enhancing molecule e.g Nogo and neurotrophins, or blocking a neurite outgrowth inhibitory molecule e.g. Nogo and a pro-inflammatory molecule e.g. TNF, may be desirable (see McGee A W, et al., Trends Neurosci. 2003; 26: 193; Marco Domeniconi, et al., J Neurol Sci. 2005; 233:43; Milan Makwanal, et al., FEBS J. 2005; 272:2628; Barry J. Dickson, Science. 2002; 298:1959; Felicia Yu Hsuan Teng, et al., J Neurosci Res. 2005; 79:273; Tara Karnezis, et al., Nature Neuroscience 2004; 7, 736; Gang Xu, et al., J.
Neurochem.2004; 91; 1018).
[0068] In one aspect, the inventions pertains to anti-idiotypic Fn3 polypeptides capable of binding to targets involved in neural regeneration which include, but are not limited to, NgR, RGM A NogoA, MAG, OMGp, RGM B, CSPGs aggrecan, midkine, neurocan, versican, phosphacan, Te38, TNF-a, Troy, Nogo66 (Nogo), Lingo, semaphorins, ephrins, soluble A-b, pro-inflammatory cytokines (e.g. IL-1), chemokines (e.g. MIP la), molecules that inhibit nerve regeneration.
8. Targets Involved in Oncological Disorders
[0069] Monoclonal antibody therapy has emerged as an important therapeutic modality for cancer (von Mehren M, et al 2003 Monoclonal antibody therapy for cancer. Annu Rev Med.; 54:343-69). Antibodies may exert antitumor effects by inducing apoptosis, redirected cytotoxicity, interfering with ligand-receptor interactions, or preventing the expression of proteins that are critical to the neoplastic phenotype. In addition, antibodies can target components of the tumor microenvironment, perturbing vital structures such as the formation of tumor-associated vasculature. Antibodies can also target receptors whose ligands are growth factors, such as the epidermal growth factor receptor. The antibody thus inhibits natural ligands that stimulate cell growth from binding to targeted tumor cells.
Alternatively, antibodies may induce an anti-idiotype network, complement-mediated cytotoxicity, or antibody-dependent cellular cytotoxicity (ADCC). In one aspect, the inventions pertains to anti-idiotypic Fn3 polypeptides capable of binding to targets involved in oncological disorders which include, but are not limited to, IGF1, IGF2; IGF 1/2, Erb2B,VEGFR, EGFR,CD20, CD3, CD138, CD20, CD38, CD20, CD38, CD138, CD40, CD20, CD138, CD40, CD38, CD40, CD52, CD20, CD19, CD3, CD4, CD8, BMP6, IL12A, ILI A, IL1B, IL2, IL24, INHA, TNF, TNFSF10, BMP6, EGF, FGF1 , FGF10, FGF1 1 , FGF12, FGF13, FGF14, FGF16, FGF17, FGF18, FGF19, FGF2, FGF20, FGF21, FGF22, FGF23, FGF3, FGF4, FGF5, FGF6, FGF7, FGF8, FGF9, GRP, IGF1 , IGF2, IL12A, ILIA, IL1B, IL2, INHA, TGFA, TGFB1, TGFB2, TGFB3, VEGF, CDK2, EGF, FGF10, FGF18, FGF2, FGF4, FGF7, IGF1 , IGF 1 R, IL2, VEGF, BCL2, CD164, CDKN1A, CDKN1B, CD N1 C, CDKN2A, CDKN2B, CDKN2C, CDKN3, GNRH1 , IGFBP6, ILIA, IL1 B, ODZ1, PAWR, PLG, TGFBIII , AR, BRCA1, CD 3, CDK4, CD 5, CDK6, CD 7, CDK9, E2F1, EGFR, ENOl, ERBB2, ESR1, ESR2, IGFBP3, IGFBP6, IL2, INSL4, MYC, NOX5, NR6A1 , PAP, PCNA, PRKCQ, PRKD1, PRL, TP53, FGF22, FGF23, FGF9, IGFBP3, IL2, INHA, KL 6, TP53, CHGB, GNRH1, IGF1, IGF2, INHA, INSL3, INSL4, PRL, KL 6, SHBG, NR1D1 , NR1H3, NR1 I3, NR2F6, NR4A3, ESR1, ESR2, NR0B1 , NR0B2, NR1D2, NR1H2, NR1H4, NR1I2, NR2C1, NR2C2, NR2E1 , NR2E3, NR2F1 , NR2F2, NR3C1 , NR3C2, NR4A1, NR4A2, NR5A1, NR5A2, NR6A1, PGR, RARB, FGF1, FGF2, FGF6, L 3, KRT1, APOC1, BRCA1, CHGA, CHGB, CLU, COL1A1, COL6A1, EGF, ERBB2, ERK8, FGF1, FGF10, FGF11, FGF13, FGF14, FGF16, FGF17, FGF18, FGF2, FGF20, FGF21, FGF22, FGF23, FGF3, FGF4, FGF5, FGF6, FGF7, FGF8, FGF9, GNRHl , IGF1, IGF2, IGFBP3, IGFBP6, IL12A, ILIA, IL1B, IL2, IL24, INHA, INSL3, INSL4, KLK10, LK12, L 13, L 14, LK15, KL 3, KLK4, L 5, KLK6, L 9, MMP2, MMP9, MSMB, NTN4, ODZ1, PAP, PLAU, PRL, PSAP, SERPINA3, SHBG, TGFA, TIMP3, CD44, CDH1, CDH10, CDH19, CDH20, CDH7, CDH9, CDH1, CDHIO, CDH13, CDH18, CDH19, CDH20, CDH7, CDH8, CDH9, ROB02, CD44, ILK, ITGA1, APC, CD164, COL6A1, MTSSl , PAP, TGFBIII, AGR2, AIGl, AKAPl, AKAP2, CANTl, CAV1, CDH12, CLDN3, CLN3, CYB5, CYC1, DAB21P, DES, DNCL1, ELAC2, EN02, EN03, FASN, FLJ12584, FLJ25530, GAGEB1, GAGEC1, GGT1, GSTP1 , HIP1,
HUMCYT2A, IL29, K6HF, ΚΑΠ , KRT2A, MIB1, PARTI, PATE, PCA3, PIAS2,
PIK3CG, PPID, PR1 , PSCA, SLC2A2, SLC33A1 , SLC43A1 , STEAP, STEAP2, TPM1 , TPM2, TRPC6, ANGPT1, ANGPT2, ANPEP, ECGF1 , EREG, FGF1 , FGF2, FIGF, FLT1, JAGl, KDR, LAMA5, NRPl, NRP2, PGF, PLXDCl, STABl, VEGF, VEGFC, ANGPTL3, BAIl , COL4A3, IL8, LAMA5, NRPl , NRP2, STABl , ANGPTL4, PECAMl , PF4, PROK2, SERPINF1, TNFAIP2, CCL1 1, CCL2, CXCL1 , CXCL10, CXCL3, CXCL5, CXCL6, CXCL9, IFNA1 , IFNB1, IFNG, IL1B, IL6, MDK, EDG1 , EFNA1, EFNA3, EFNB2, EGF, EPHB4, FGFR3, HGF, IGF1, ITGB3, PDGFA, TEK, TGFA, TGFB1, TGFB2, TGFBR1 , CCL2, CDH5, COL18A1, EDG1, ENG, ITGAV, ITGB3, THBS1, THBS2, BAD, BAG1, BCL2, CCNA1, CCNA2, CCND1 , CCNE1, CCNE2, CDH1 (E-cadherin), CDKN1B (p27Kipl), CD N2A (pl6IN 4a), COL6A1, CTNNB1 (b-catenin), CTSB (cathepsin B), ERBB2 (Her-2), ESR1, ESR2, F3 (TF), FOSL1 (FRA-1), GATA3, GSN (Gelsolin), IGFBP2, IL2RA, IL6, IL6R, IL6ST (glycoprotein 130), ITGA6 (a6 integrin), JUN, L 5, RT19, MAP2 7 (c-Jun), M I67 ( i-67), NGFB (NGF), NGFR, NME1 (NM23A), PGR, PLAU (uPA), PTEN, SERPINB5 (maspin), SERPINE1 (PAI-1), TGFA, THBS1
(thrombospondin-1), TIE (Tie-1), TNFRSF6 (Fas), TNFSF6 (FasL), TOP2A (topoisomerase Iia), TP53, AZGP1 (zinc-a-glycoprotein), BPAG1 (plectin), CD N1A (p21Wapl/Cipl), CLDN7 (claudin-7), CLU (clusterin), ERBB2 (Her-2), FGF 1 , FLRTl (fibronectin), GABRP (GABAa), GNAS1, ID2, ITGA6 (a6 integrin), ITGB4 (b 4 integrin), LF5 (GC Box BP), RT19 (Keratin 19), KRTHB6 (hair-specific type II keratin), MACMARCKS, T3 (metallothionectin-III), UC1 (mucin), PTGS2 (COX-2), RAC2 (p21Rac2), S100A2, SCGB1D2 (lipophilin B), SCGB2A1 (mammaglobin 2), SCGB2A2 (mammaglobin 1), SPRR1B (Sprl), THBS1, THBS2, THBS4, and TNFAIP2 (B94).
Conjugates of Anti-idiotypic Fn3 polypeptides or Anti-Anti-Idiotvpic Fn3 Polypeptides
[0070] In another aspect the invention provides conjugates comprising an anti- idiotypic Fn3 polypeptide, anti-anti-idiotypic Fn3 polypeptide, or molecules generated therefrom linked to one or more non-Fn3 moieties. Such non-Fn3 moieties can, for example, impart additional functional or physiochemical properties to the anti-idiotypic Fn3 polypeptide or anti-anti-idiotypic Fn3 polypeptide. In one embodiment, the anti-idiotypic Fn3 polypeptide or anti-anti-idiotypic Fn3 polypeptide is linked or fused to an antibody Fc domain (or a portion thereof). Methods for fusing molecules to Fc domains, e.g., the Fc domain of IgGl, are known in the art (see, e.g., U.S. 5,428,130). Such conjugates have increased circulating half-lives, due to the ability of Fc to bind to FcRn, which serves a critical function in IgG homeostasis, protecting molecules bound to it from catabolism.
[0071] In another embodiment, anti-idiotypic Fn3 polypeptide or an anti-anti- idiotypic Fn3 polypeptide is fused to one or more human serum albumin (HSA)
polypeptides, or a portion thereof. HSA, a protein of 585 amino acids in its mature form, is responsible for a significant proportion of the osmotic pressure of serum and also functions as a carrier of endogenous and exogenous ligands. The role of albumin as a carrier molecule and its inert nature are desirable properties for use as a carrier and transporter of
polypeptides in vivo. The use of albumin as a component of an albumin fusion protein as a carrier for various proteins has been suggested in WO 93/15199, WO 93/15200, and EP 413 622. The use of N-terminal fragments of HSA for fusions to polypeptides has also been proposed (EP 399 666). Accordingly, by genetically or chemically fusing or conjugating the molecules of the present invention to albumin, or a fragment (portion) or variant of albumin or a molecule capable of binding HSA (an "anti-HS A binder") that is sufficient to stabilize the protein and/or its activity, the molecule is stabilized to extend the shelf-life, and/or to retain the molecule's activity for extended periods of time in solution, in vitro and/or in vivo.
[0072] Fusion of albumin to another protein may be achieved by genetic
manipulation, such that the DNA coding for HSA, or a fragment thereof, is joined to the DNA coding for the protein. A suitable host is then transformed or transfected with the fused nucleotide sequences, so arranged on a suitable plasmid as to express a fusion polypeptide. The expression may be effected in vitro from, for example, prokaryotic or eukaryotic cells, or in vivo e.g. from a transgenic organism. Additional methods pertaining to HSA fusions can be found, for example, in WO 2001077137 and WO 200306007, incorporated herein by reference. In a specific embodiment, the expression of the fusion protein is performed in mammalian cell lines, for example, CHO cell lines.
[0073] Other anti-idiotypic Fn3 polypeptides or an anti-anti-idiotypic Fn3
polypeptide conjugates of the present invention include an anti-idiotypic Fn3 polypeptides or an anti-anti-idiotypic Fn3 polypeptide linked to a non-Fn3 -based binding molecule, e.g., another peptide or protein (e.g., an antibody or ligand for a receptor), to generate a molecule that binds to at least two different binding sites or target molecules.
[0074] The anti-idiotypic Fn3 polypeptides or an anti-anti-idiotypic Fn3 polypeptide conjugates of the present invention can be prepared by linking the constituent molecules using methods known in the art. For example, the constituent molecules can be chemically linked using a variety of coupling or cross-linking agents can be used for covalent conjugation. Examples of cross-linking agents include protein A, carbodiimide, N- succinimidyl-S-acetyl-thioacetate (SAT A), 5,5'-dithiobis(2-nitrobenzoic acid) (DTNB), o- phenylenedimaleimide (oPDM), N-succinimidyl-3-(2-pyridyldithio)propionate (SPDP), and sulfosuccinimidyl 4-(N-maleimidomethyl) cyclohaxane- 1-carboxylate (sulfo-SMCC) (see e.g., Karpovsky et al. (1984) J. Exp. Med. 160: 1686; Liu, MA et al. (1985) Proc. Natl. Acad. Sci. U.S.A 82:8648). Other methods include those described in Paulus (1985) Behring Ins. Mitt. No. 78, 1 18-132; Brennan et al. (1985) Science 229:81-83), and Glennie et al. (1987) J. Immunol. 139: 2367-2375). Preferred conjugating agents are SATA and sulfo-SMCC, both available from Pierce Chemical Co. (Rockford, IL).
[0075] Alternatively, the constituent molecules can be encoded in the same vector and expressed as a single protein in a host cell. Methods for producing such fusion proteins are described, for example, in U.S. Patent Number 5,260,203; U.S. Patent Number
5,455,030; U.S. Patent Number 4,881 ,175; U.S. Patent Number 5,132,405; U.S. Patent Number 5,091 ,513; U.S. Patent Number 5,476,786; U.S. Patent Number 5,013,653; U.S. Patent Number 5,258,498; and U.S. Patent Number 5,482,858.
[0076] In yet another embodiment, the invention provides anti-idiotypic Fn3 polypeptides or an anti-anti-idiotypic Fn3 polypeptide that are conjugated to polyethylene glycol (PEG), for example, to increase the biological (e.g. , serum) half-life of the molecule. Methods for PEGylating proteins are well known in the art. For example, the Fn3 -based binding molecule can be reacted with a PEG moiety, such as a reactive ester or aldehyde derivative of PEG, under conditions in which one or more PEG groups become attached to the molecule. The term "PEGylation moiety", "polyethylene glycol moiety", or "PEG moiety" includes a polyalkylene glycol compound or a derivative thereof, with or without coupling agents or derivatization with coupling or activating moieties (e.g., with thiol, triflate, tresylate, azirdine, oxirane, or preferably with a maleimide moiety, e.g. , PEG- maleimide). Other appropriate polyalkylene glycol compounds include, but are not limited to, maleimido monomethoxy PEG, activated PEG polypropylene glycol, but also charged or neutral polymers of the following types: dextran, colominic acids, or other carbohydrate based polymers, polymers of amino acids, and biotin derivatives.
[0077] The choice of the suitable functional group for the PEG derivative is based on the type of available reactive group on the molecule or molecule that will be coupled to the PEG. For proteins, typical reactive amino acids include lysine, cysteine, histidine, arginine, aspartic acid, glutamic acid, serine, threonine, tyrosine. The N-terminal amino group and the C -terminal carboxylic acid can also be used.
[0078] Preferably, the pegylation is carried out via an acylation reaction or an alkylation reaction with a reactive PEG molecule (or an analogous reactive water-soluble polymer). As used herein, the term "polyethylene glycol" is intended to encompass any of the forms of PEG that have been used to derivatize other proteins, such as mono (CI -C IO) alkoxy- or aryloxy-polyethylene glycol or polyethylene glycol-maleimide. Methods for pegylating proteins are known in the art and can be applied to the present invention. See for example, WO 2005056764, U.S.7,045,337, U.S.7,083,970, U.S.6,927,042, EP 0 154 316 by Nishimura et al. and EP 0 401 384 by Ishikawa et al. The molecules of the invention can be engineered to include at least one cysteine amino acid or at least one non-natural amino acid to facilitate pegylation.
[0079] Binding of the anti-idiotypic Fn3 polypeptides or other anti-anti -idiotypic Fn3 polypeptide conjugates to their specific targets can be confirmed by various assays, for example, the fusion can be radioactively labeled and used in a radioimmunoassay (RIA) (see, for example, Weintraub, B., Principles of Radioimmunoassays, Seventh Training Course on Radioligand Assay Techniques, The Endocrine Society, March, 1986, which is incorporated by reference herein). The radioactive isotope can be detected by such means as the use of a γ-counter or a scintillation counter or by autoradiography.
[0080] Other anti-idiotypic Fn3 polypeptides or other anti-anti-idiotypic Fn3 polypeptide conjugates of the present invention include an anti-idiotypic Fn3 polypeptides or an anti-anti-idiotypic Fn3 polypeptide linked to a tag {e.g., biotin) or a chemical {e.g., an immunotoxin or chemo therapeutic agent). Such chemicals include cytotoxic agent which is any agent that is detrimental to {e.g., kills) cells. Examples include taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, Udocaine, propranolol, and puromycin and analogs or homologs thereof. Therapeutic agents also include, for example, antimetabolites {e.g., methotrexate, 6-mercaptopurine, 6- thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating agents {e.g.,
mechlorethamine, thioepa chlorambucil, melphalan, carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines {e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics {e.g., dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC)), and anti-mitotic agents {e.g., vincristine and vinblastine). Other examples of therapeutic cytotoxins that can be conjugated to Fn3-based binding molecule of the invention include duocarmycins, calicheamicins, maytansines and auristatins, and derivatives thereof.
[0081 ] Cytotoxins can be conjugated to the molecules of the invention using linker technology available in the art. Examples of linker types that have been used to conjugate a cytotoxin include, but are not limited to, hydrazones, thioethers, esters, disulfides and peptide-containing linkers. A linker can be chosen that is, for example, susceptible to cleavage by low pH within the lysosomal compartment or susceptible to cleavage by proteases, such as proteases preferentially expressed in tumor tissue such as cathepsins (e.g., cathepsins B, C, D). For further discussion of types of cytotoxins, linkers and methods for conjugating therapeutic agents, see also Saito, G. et al. (2003) Adv. Drug Deliv. Rev.
55: 199-215; Trail, P.A. et al. (2003) Cancer Immunol. Immunother. 52:328-337; Payne, G. (2003) Cancer Cell 3:207-212; Allen, T.M. (2002) Nat. Rev. Cancer 2:750-763; Pastan, I. and Kreitman, R. J. (2002) Curr. Opin. Investig Drugs 3: 1089-1091 ; Senter, P.D. and Springer, CJ. (2001) Adv. Drug Deliv. Rev. 53:247-264.
[0082] The anti-idiotypic Fn3 polypeptides or anti-anti-idiotypic Fn3 polypeptides of the present invention also can be conjugated to a radioactive isotope to generate cytotoxic radiopharmaceuticals, also referred to as radioimmunoconjugates. Examples of radioactive isotopes that can be conjugated to anti-idiotypic Fn3 polypeptides or anti-anti-idiotypic Fn3 polypeptides for use diagnostically or therapeutically include, but are not limited to, iodine13 indium1 1 ', yttrium90 and lutetium177. Methods for preparing
radioimmunoconjugates are established in the art. Examples of radioimmunoconjugates are commercially available, including ibritumomab, tiuxetan, and tositumomab, and similar methods can be used to prepare radioimmunoconjugates using the molecules of the invention.
[0083] The anti-idiotypic Fn3 polypeptide or anti-anti-idiotypic Fn3 polypeptide conjugates of the invention can be used to modify a given biological response, and the drug moiety is not to be construed as limited to classical chemical therapeutic agents. For example, the drug moiety may be a protein or polypeptide possessing a desired biological activity. Such proteins may include, for example, an enzymatically active toxin, or active fragment thereof, such as abrin, ricin A, pseudomonas exotoxin, or diphtheria toxin; a protein such as tumor necrosis factor or interferon-γ; or, biological response modifiers such as, for example, lymphokines, interleukin- 1 ("IL-1 "), interleukin-2 ("IL-2"), interleukin-6 ("IL-6"), granulocyte macrophage colony stimulating factor ("GM-CSF"), granulocyte colony stimulating factor ("G-CSF"), or other growth factors.
[0084] Techniques for conjugating such therapeutic moiety are well known and can be applied to the molecules of the present invention, see, e.g., Arnon et al, "Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy", in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.), pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al, "Antibodies For Drug Delivery", in Controlled Drug Delivery (2nd Ed.), Robinson et al. (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe, "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review", in Monoclonal Antibodies '84: Biological And Clinical Applications, Pinchera et al. (eds.), pp. 475-506 (1985); "Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy", in Monoclonal Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.), pp. 303-16 (Academic Press 1985), and Thorpe et al., "The Preparation And Cytotoxic
Properties Of Antibody-Toxin Conjugates", Immunol. Rev., 62: 1 19-58 (1982).
[0085] Anti-idiotypic Fn3 polypeptides or anti-anti-idiotypic Fn3 polypeptides of the present invention also can be modified by hesylation, which utilizes hydroxyethyl starch ("HES") derivatives linked to drug substances in order to modify the drug characteristics. HES is a modified natural polymer derived from waxy maize starch which is metabolized by the body's enzymes. This modification enables the prolongation of the circulation half-life by increasing the stability of the molecule, as well as by reducing renal clearance, resulting in an increased biological activity. Furthermore, HESylation potentially alters the immunogenicity or allergenicity. By varying different parameters, such as the molecular weight of HES, a wide range of HES drug conjugates can be customized.
[0086] DE 196 28 705 and DE 101 29 369 describe possible methods for carrying out the coupling of hydroxyethyl starch in anhydrous dimethyl sulfoxide (DMSO) via the corresponding aldonolactone of hydroxyethyl starch with free amino groups of hemoglobin and amphotericin B, respectively. Since it is often not possible to use anhydrous, aprotic solvents specifically in the case of proteins, either for solubility reasons or else on the grounds of denaturation of the proteins, coupling methods with HES in an aqueous medium are also available. For example, coupling of hydroxyethyl starch which has been selectively oxidized at the reducing end of the chain to the aldonic acid is possible through the mediation of water-soluble carbodiimide EDC (l-ethyl-3-(3-dimethyl- aminopropyl)carbodiimide) (PCT EP 02/02928). Additional hesylation methods which can be applied to the present invention are described, for example, in U.S. 20070134197, U.S. 20060258607, U.S. 20060217293, U.S. 20060100176, and U.S.20060052342.
[0087] Anti-idiotypic Fn3 polypeptides or anti-anti-idiotypic Fn3 polypeptides of the invention also can be modified via sugar residues. Methods for modifying sugar residues of proteins or glycosylating proteins are known in the art (see, for example, Borman (2006) Chem. & Eng. News 84(36): 13-22 and Borman (2007) Chem. & Eng. News 85: 19-20) and can be applied to the molecules of the present invention.
[0088] Additionally or alternatively, anti-idiotypic Fn3 polypeptides or anti-anti- idiotypic Fn3 polypeptides of the invention can be made that have an altered type of glycosylation, such as a hypofucosylated pattern having reduced amounts of fucosyl residues or anti-idiotypic Fn3 polypeptides or anti-anti-idiotypic Fn3 polypeptides having increased bisecting GlcNac structures. Such carbohydrate modifications can be accomplished by, for example, expressing the anti-idiotypic Fn3 polypeptide or anti-anti-idiotypic Fn3 polypeptide in a host cell with altered glycosylation machinery. Cells with altered glycosylation machinery have been described in the art and can be used as host cells in which to express recombinant anti-idiotypic Fn3 polypeptides or anti-anti-idiotypic Fn3 polypeptides of the invention to thereby produce anti-idiotypic Fn3 polypeptides or anti- anti-idiotypic Fn3 polypeptides of the invention with altered glycosylation. For example, EP 1,176,195 by Hang et al. describes a cell line with a functionally disrupted FUT8 gene, which encodes a fucosyl transferase, such that antibodies expressed in such a cell line exhibit hypofucosylation. PCT Publication WO 03/035835 by Presta describes a variant CHO cell line, Lecl3 cells, with reduced ability to attach fucose to Asn(297)-linked carbohydrates, also resulting in hypofucosylation of antibodies expressed in that host cell (see also Shields, R.L. et al., 2002 J. Biol. Chem. 277:26733-26740). Methods to produce polypeptides with human-like glycosylation patterns have also been described by
EP1297172B1 and other patent families originating from Glycofi.
Methods for Generating Anti-idiotypic Fn3 Polypeptides or
Anti-Anti-Idiotypic Fn3 Polypeptides
1) Nucleic Acid and Amino Acid Alterations
[0089] Anti-idiotypic Fn3 Polypeptides or anti-anti-idiotypic Fn3 polypeptides of the invention having one or more amino acid or nucleotide modifications (e.g., alterations) can be generated by a variety of known methods. Typically, such anti-idiotypic Fn3 -based polypeptides are produced by recombinant methods. Moreover, because of the degeneracy of the genetic code, a variety of nucleic acid sequences can be used to encode each desired molecule.
[0090] Exemplary art recognized methods for making a nucleic acid molecule encoding an amino acid sequence variant of a starting molecule include, but are not limited to, preparation by site-directed (or oligonucleotide-mediated) mutagenesis, PCR
mutagenesis, and cassette mutagenesis of an earlier prepared DNA encoding the molecule.
[0091] Site-directed mutagenesis is a preferred method for preparing substitution variants. This technique is well known in the art (see, e.g., Carter et al Nucleic Acids Res. 13:4431-4443 (1985) and Kunkel et al, Proc. Natl. Acad. Sci. U.S.A 82:488 (1987)).
Briefly, in carrying out site-directed mutagenesis of DNA, the parent DNA is altered by first hybridizing an oligonucleotide encoding the desired mutation to a single strand of such parent DNA. After hybridization, a DNA polymerase is used to synthesize an entire second strand, using the hybridized oligonucleotide as a primer, and using the single strand of the parent DNA as a template. Thus, the oligonucleotide encoding the desired mutation is incorporated in the resulting double-stranded DNA.
[0092] PCR mutagenesis is also suitable for making amino acid sequence variants of the starting molecule. See Higuchi, in PCR Protocols, pp.177-183 (Academic Press, 1990); and Vallette et αί, Nuc. Acids Res. 17:723-733 (1989). Briefly, when small amounts of template DNA are used as starting material in a PCR, primers that differ slightly in sequence from the corresponding region in a template DNA can be used to generate relatively large quantities of a specific DNA fragment that differs from the template sequence only at the positions where the primers differ from the template.
[0093] Another method for preparing variants, cassette mutagenesis, is based on the technique described by Wells et al. , Gene 34:315-323 ( 1985). The starting material is the plasmid (or other vector) comprising the starting polypeptide DNA to be mutated. The codon(s) in the parent DNA to be mutated are identified. There must be a unique restriction endonuclease site on each side of the identified mutation site(s). If no such restriction sites exist, they may be generated using the above-described oligonucleotide -mediated mutagenesis method to introduce them at appropriate locations in the starting polypeptide DNA. The plasmid DNA is cut at these sites to linearize it. A double-stranded
oligonucleotide encoding the sequence of the DNA between the restriction sites but containing the desired mutation(s) is synthesized using standard procedures, wherein the two strands of the oligonucleotide are synthesized separately and then hybridized together using standard techniques. This double-stranded oligonucleotide is referred to as the cassette. This cassette is designed to have 5' and 3' ends that are compatible with the ends of the linearized plasmid, such that it can be directly ligated to the plasmid. This plasmid now contains the mutated DNA sequence.
[0094] Alternatively, or additionally, the desired amino acid sequence encoding a polypeptide variant of the molecule can be determined, and a nucleic acid sequence encoding such amino acid sequence variant can be generated synthetically.
[0095] It will be understood by one of ordinary skill in the art that the anti -idiotypic
Fn3 polypeptides of the invention may further be modified such that they vary in amino acid sequence (e.g., from wild-type), but not in desired activity. For example, additional nucleotide substitutions leading to amino acid substitutions at "non-essential" amino acid residues may be made to the protein For example, a nonessential amino acid residue in a molecule may be replaced with another amino acid residue from the same side chain family. In another embodiment, a string of amino acids can be replaced with a structurally similar string that differs in order and/or composition of side chain family members, i.e., a conservative substitutions, in which an amino acid residue is replaced with an amino acid residue having a similar side chain, may be made.
[0096] Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
[0097] Aside from amino acid substitutions, the present invention contemplates other modifications of the starting molecule amino acid sequence in order to generate functionally equivalent molecules. For example, one may delete one or more amino acid residues. Generally, no more than one to about ten residues will be deleted according to this embodiment of the invention. The anti-idiotypic Fn3 polypeptides comprising one or more amino acid deletions will preferably retain at least about 80%, and preferably at least about 90%, and most preferably at least about 95%, of the starting polypeptide molecule.
[0098] One may also make amino acid insertion variants, which retain the original
Fn3 domain or anti-idiotypic Fn3 polypeptide functionality. For example, one may introduce at least one amino acid residue (e.g. one to two amino acid residues and generally no more than ten residues) into the molecule.
[0099] In one embodiment, amino acid substitutions are performed on an Fn3 domain to include cysteine or other non-natural amino acid suitable for conjugating a moiety to the anti-idiotypic Fn3 polypeptide or anti-anti-idiotypic Fn3 polypeptide using well- known conjugating methods. In particular, the invention relates to specific amino acid variants of anti-idiotypic Fn3 polypeptides with Fn3 scaffold, wherein one or more serine amino acid residues are substituted by cysteine or a non-natural amino acid. Serine amino acid residues that can substituted include, but are not limited to Ser 1432, Ser 1436, Ser 1458, Ser 1475, and Ser 1504. Other amino acid positions of the Fn3 scaffold that can be substituted include, but are not limited to, V1426, LI 434, T1473 and T1486. Non- naturally occurring amino acids can be substituted into the Fn3 scaffold using, for example, Ambrex technology (See e.g., US 7,045,337; 7,083,970).
2) Screening Assays for Identifying Anti-ldiotypic or Anti-Anti-ldiotypic Fn3
Polypeptides
[00100] A variety of screening assays can be employed to identify anti-idiotypic Fn3 polypeptides or anti-anti-idiotypic Fn3 polypeptides of the invention. Essentially any in vitro or in vivo screening method that selects for binding to an antibody of a desired antigen can be used.
[00101] In one embodiment, the anti-idiotypic Fn3 polypeptides are displayed on the surface of a cell, virus or bacteriophage and subject to selection using immobilized antibody of a antigen. Suitable methods of screening are described in U.S. patent numbers 7,063,943; 6,699,658; 7,063,943 and 5866344. Such surface display may require the creation of fusion proteins of the anti-idiotypic Fn3 polypeptides with a suitable protein normally present on the outer surface of a cell, virus or bacteriophage. Suitable proteins from which to make such fusions are well known in the art.
[00102] In another embodiment, the anti-idiotypic Fn3 polypeptides are screened using an in vitro phenotype- genotype linked display such as ribosome or polysome display. Such methods of "molecular evolution" are well known in the art (see for example U.S. patent number 6,194,550 and 7,195,880).
[00103] Screening methods may involve one or more in vitro or in vivo affinity maturation steps. Any affinity maturation approach can be employed that results in amino acid changes in the Fn3 domain that improve the binding of the the anti-idiotypic Fn3 polypeptides to the antibody of a desired antigen. These amino acid changes can, for example, be achieved via random mutagenesis, "walk though mutagenesis, and "look through mutagenesis. Such mutagenesis can be achieved by using, for example, error-prone PC , "mutator" strains of yeast or bacteria, incorporation of random or defined nucleic acid changes during ab inito synthesis of all or part of a anti-idiotypic Fn3 polypeptide or anti- anti-idiotypic Fn3 polypeptide. Methods for performing affinity maturation and/or mutagenesis are described, for example, in U.S. Patent Numbers 7,195,880; 6,951,725; 7,078,197; 7,022,479; 5,922,545; 5,830,721 ; 5,605,793, 5,830,650; 6,194,550; 6,699,658; 7,063,943; 5866344 and Patent Cooperation Treaty publication WO06023144. Such affinity maturation methods may further require that the stringency of the antigen-binding screening assay is increased to select for the anti -idiotypic Fn3 polypeptides with improved affinity for the antibody of the target antigen. Art recognized methods for increasing the stringency of a protein-protein interaction assay can be used here. In one embodiment, one or more of the assay conditions are varied (for example, the salt concentration of the assay buffer) to reduce the affinity of the anti-idiotypic Fn3 polypeptides for the antibody of the desired antigen. In another embodiment, the length of time permitted for the anti-idiotypic Fn3 polypeptides to bind to the antibody of the desired antigen is reduced. In another embodiment, a
competitive binding step is added to the protein-protein interaction assay. For example, the anti-idiotypic Fn3 polypeptides are first allowed to bind to a desired immobilized antibody of the antigen. A specific concentration of non- immobilized antibody of the antigen is then added which serves to compete for binding with the immobilized antibody of the antigen such that the anti-idiotypic Fn3 polypeptides with the lowest affinity for antibody of the antigen are eluted from the immobilized antigen resulting in selection of anti-idiotypic Fn3 polypeptides with improved antigen binding affinity. The stringency of the assay conditions can be further increased by increasing the concentration of non-immobilized antibody of the antigen is added to the assay.
[00104] Screening methods of the invention may also require multiple rounds of selection to enrich for one or more anti-idiotypic Fn3 polypeptides with improved antibody binding. In one embodiment, at each round of selection further amino acid mutation are introduced into the anti-idiotypic Fn3 polypeptides. In another embodiment, at each round of selection the stringency of binding to the desired antigen is increased to select for anti- idiotypic Fn3 polypeptides with increased affinity for an antibody of the antigen.
[00105] To test for molecular mimicry, competition assays with a target peptide can be employed in which the anti-idiotypic Fn3 polypeptide is compared with an antibody against the target antigen. For example, with an anti-HA-Fn3 and anti-HA antibody, these two molecules can be tested in the presence of increasing amount of HA-Peptide to show that binding of the anti-HA-Fn3 is diminished in a concentration dependent manner. Using the same anaology for functional assay (e.g. receptor activation/inhibiton assay initiated by binding of the peptide), the anti-idiotypic Fn3 polypeptide can be added in increasing amounts to show activation/inhibition of the receptor.
3) Methods of Manufacture
[00106] The anti-idiotypic Fn3 polypeptides of the invention are typically produced by recombinant expression. Nucleic acids encoding the molecules are inserted into expression vectors. The DNA segments encoding the molecules are operably linked to control sequences in the expression vector(s) that ensure their expression. Expression control sequences include, but are not limited to, promoters (e.g., naturally-associated or heterologous promoters), signal sequences, enhancer elements, and transcription termination sequences. Preferably, the expression control sequences are eukaryotic promoter systems in vectors capable of transforming or transfecting eukaryotic host cells. Once the vector has been incorporated into the appropriate host, the host is maintained under conditions suitable for high level expression of the nucleotide sequences, and the collection and purification of the crossreacting the anti-idiotypic Fn3 polypeptides.
[00107] These expression vectors are typically replicable in the host organisms either as episomes or as an integral part of the host chromosomal DNA. Commonly, expression vectors contain selection markers (e.g., ampicillin-resistance, hygromycin-resistance, tetracycline resistance or neomycin resistance) to permit detection of those cells transformed with the desired DNA sequences (see, e.g., Itakura et ah, U.S. Patent 4,704,362).
[00108] E. coli is one prokaryotic host particularly useful for cloning the
polynucleotides (e.g., DNA sequences) of the present invention. Other microbial hosts suitable for use include bacilli, such as Bacillus subtilis, and other enterobacteriaceae, such as Salmonella, Serratia, and various Pseudomonas species.
[00109] Other microbes, such as yeast, are also useful for expression. Saccharomyces and Pichia are exemplary yeast hosts, with suitable vectors having expression control sequences (e.g. , promoters), an origin of replication, termination sequences and the like as desired. Typical promoters include 3-phosphoglycerate kinase and other glycolytic enzymes. Inducible yeast promoters include, among others, promoters from alcohol dehydrogenase, isocytochrome C, and enzymes responsible for methanol, maltose, and galactose utilization.
[001 10] In addition to microorganisms, mammalian tissue culture may also be used to express and produce the polypeptides of the present invention (e.g., polynucleotides encoding immunoglobulins or fragments thereof). See Winnacker, From Genes to Clones, VCH Publishers, N.Y., N.Y. (1987). Eukaryotic cells are actually preferred, because a number of suitable host cell lines capable of secreting heterologous proteins (e.g., intact immunoglobulins) have been developed in the art, and include CHO cell lines, various COS cell lines, HeLa cells, 293 cells, myeloma cell lines, transformed B-cells, and hybridomas. Expression vectors for these cells can include expression control sequences, such as an origin of replication, a promoter, and an enhancer (Queen et a!., Immunol. Rev. 89:49 (1986)), and necessary processing information sites, such as ribosome binding sites, RNA splice sites, polyadenylation sites, and transcriptional terminator sequences. Preferred expression control sequences are promoters derived from immunoglobulin genes, SV40, adenovirus, bovine papilloma virus, cytomegalovirus and the like. See Co et al., J.
Immunol. 148: 1149 (1992).
[00111] Alternatively, coding sequences can be incorporated in transgenes for introduction into the genome of a transgenic animal and subsequent expression in the milk of the transgenic animal (see, e.g., Deboer et al., U.S. 5,741,957, Rosen, U.S. 5,304,489, and Meade et al., U.S. 5,849,992). Suitable transgenes include coding sequences for light and/or heavy chains in operable linkage with a promoter and enhancer from a mammary gland specific gene, such as casein or beta lactoglobulin.
[001 12] The vectors containing the polynucleotide sequences of interest and expression control sequences can be transferred into the host cell by well-known methods, which vary depending on the type of cellular host. For example, chemically competent prokaryotic cells may be briefly heat-shocked, whereas calcium phosphate treatment, electroporation, lipofection, biolistics or viral-based transfection may be used for other cellular hosts. (See generally Sambrook et ah, Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Press, 2nd ed., 1989). Other methods used to transform mammalian cells include the use of polybrene, protoplast fusion, liposomes, electroporation, and microinjection (see generally, Sambrook et al., supra). For production of transgenic animals, transgenes can be microinjected into fertilized oocytes, or can be incorporated into the genome of embryonic stem cells, and the nuclei of such cells transferred into enucleated oocytes.
[00113] Once expressed, the anti-idiotypic Fn3 polypeptides of the present invention can be purified according to standard procedures of the art, including ammonium sulfate precipitation, affinity columns, column chromatography, HPLC purification, gel
electrophoresis and the like (see generally Scopes, Protein Purification (Springer- Verlag, N.Y., (1982)). Substantially pure molecules of at least about 90 to 95% homogeneity are preferred, and 98 to 99% or more homogeneity most preferred, for pharmaceutical uses.
Compositions
[001 14] The anti-idiotypic Fn3 polypeptides or anti-anti-idiotypic Fn3 polypeptides of the present invention have in vivo therapeutic utilities. Accordingly, the present invention also provides compositions, e.g., a pharmaceutical composition, containing one or a combination of anti-idiotypic Fn3 polypeptides, anti-anti-idiotypic Fn3 polypeptides (or variants, fusions, and conjugates thereof), formulated together with a pharmaceutically acceptable carrier. Pharmaceutical compositions of the invention also can be administered in combination therapy, i.e., combined with other agents. For example, the combination therapy can include a composition of the present invention with at least one or more additional therapeutic agents, such as anti -inflammatory agents, anti-cancer agents, and chemotherapeutic agents.
[001 15] The pharmaceutical compositions of the invention can also be administered in conjunction with radiation therapy. Co-administration with other anti-idiotypic Fn3 polypeptides or anti-anti-idiotypic Fn3 polypeptides ate also encompassed by the invention.
[001 16] As used herein, "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. Preferably, the carrier is suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal or epidermal administration (e.g., by injection or infusion). Depending on the route of administration, the active compound, i.e., antibody, bispecific and multispecific molecule, may be coated in a material to protect the compound from the action of acids and other natural conditions that may inactivate the compound.
[001 17] A "pharmaceutically acceptable salt" refers to a salt that retains the desired biological activity of the parent compound and does not impart any undesired toxicological effects (see e.g., Berge, S.M., et al. (1977) J. Pharm. Sci. 66:1-19). Examples of such salts include acid addition salts and base addition salts. Acid addition salts include those derived from nontoxic inorganic acids, such as hydrochloric, nitric, phosphoric, sulfuric,
hydrobromic, hydroiodic, phosphorous and the like, as well as from nontoxic organic acids such as aliphatic mono- and dicarboxylic acids, phenyl-substituted alkanoic acids, hydroxy alkanoic acids, aromatic acids, aliphatic and aromatic sulfonic acids and the like. Base addition salts include those derived from alkaline earth metals, such as sodium, potassium, magnesium, calcium and the like, as well as from nontoxic organic amines, such as Ν,Ν'- dibenzylethylenediamine, N-methylglucamine, chloroprocaine, choline, diethanolamine, ethylenediamine, procaine and the like.
[001 18] A composition of the present invention can be administered by a variety of methods known in the art. As will be appreciated by the skilled artisan, the route and/or mode of administration will vary depending upon the desired results. The active compounds can be prepared with carriers that will protect the compound against rapid release, such as a controlled release formulation, including implants, transdermal patches, and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Many methods for the preparation of such formulations are patented or generally known to those skilled in the art. See, e.g., Sustained and Controlled Release Drug Delivery Systems, J.R. Robinson, ed., Marcel Dekker, Inc., New York, 1978.
[001 19] To administer a compound of the invention by certain routes of
administration, it may be necessary to coat the compound with, or co-administer the compound with, a material to prevent its inactivation. For example, the compound may be administered to a subject in an appropriate carrier, for example, liposomes, or a diluent. Pharmaceutically acceptable diluents include saline and aqueous buffer solutions.
Liposomes include water-in-oil-in- water CGF emulsions as well as conventional liposomes (Strejan et al. (1984) J. Neuroimmunol. 7:27).
[00120] Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. The use of such media and agents for pharmaceutically active substances is known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the pharmaceutical compositions of the invention is contemplated. Supplementary active compounds can also be incorporated into the compositions.
[00121] Therapeutic compositions typically must be sterile and stable under the conditions of manufacture and storage. The composition can be formulated as a solution, microemulsion, liposome, or other ordered structure suitable to high drug concentration. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, monostearate salts and gelatin.
[00122] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by sterilization microfiltration.
Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze- drying (lyophilization) that yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
[00123] Dosage regimens are adjusted to provide the optimum desired response (e.g., a therapeutic response). For example, a single bolus may be administered, several divided doses may be administered over time or the dose may be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation. For example, the anti-idiotypic Fn3 polypeptides of the invention may be administered once or twice weekly by
subcutaneous injection or once or twice monthly by subcutaneous injection.
[00124] It is especially advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the subjects to be treated; each unit contains a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the invention are dictated by and directly dependent on (a) the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding such an active compound for the treatment of sensitivity in individuals.
[00125] Examples of pharmaceutically-acceptable antioxidants include: (1) water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like; (2) oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, and the like; and (3) metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.
[00126] For the therapeutic compositions, formulations of the present invention include those suitable for oral, nasal, topical (including buccal and sublingual), rectal, vaginal and/or parenteral administration. The formulations may conveniently be presented in unit dosage form and may be prepared by any methods known in the art of pharmacy. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will vary depending upon the subject being treated, and the particular mode of administration. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will generally be that amount of the composition which produces a therapeutic effect. Generally, out of one hundred per cent, this amount will range from about 0.001 per cent to about ninety percent of active ingredient, preferably from about 0.005 per cent to about 70 per cent, most preferably from about 0.01 per cent to about 30 per cent.
[00127] Formulations of the present invention which are suitable for vaginal administration also include pessaries, tampons, creams, gels, pastes, foams or spray formulations containing such carriers as are known in the art to be appropriate. Dosage forms for the topical or transdermal administration of compositions of this invention include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches and inhalants. The active compound may be mixed under sterile conditions with a pharmaceutically acceptable carrier, and with any preservatives, buffers, or propellants which may be required.
[00128] The phrases "parenteral administration" and "administered parenteral ly" as used herein means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion.
[00129] Examples of suitable aqueous and nonaqueous carriers which may be employed in the pharmaceutical compositions of the invention include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
[00130] These compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of presence of microorganisms may be ensured both by sterilization procedures, supra, and by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption such as aluminum monostearate and gelatin.
[00131] When the compounds of the present invention are administered as pharmaceuticals, to humans and animals, they can be given alone or as a pharmaceutical composition containing, for example, 0.001 to 90% (more preferably, 0.005 to 70%, such as 0.01 to 30%) of active ingredient in combination with a pharmaceutically acceptable carrier.
[00132] Regardless of the route of administration selected, the compounds of the present invention, which may be used in a suitable hydrated form, and/or the pharmaceutical compositions of the present invention, are formulated into pharmaceutically acceptable dosage forms by conventional methods known to those of skill in the art.
[00133] Actual dosage levels of the active ingredients in the pharmaceutical compositions of the present invention may be varied so as to obtain an amount of the active ingredient which is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient. The selected dosage level will depend upon a variety of pharmacokinetic factors including the activity of the particular compositions of the present invention employed, or the ester, salt or amide thereof, the route of administration, the time of administration, the rate of excretion of the particular compound being employed, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular compositions employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts. A physician or veterinarian having ordinary skill in the art can readily determine and prescribe the effective amount of the pharmaceutical composition required. For example, the physician or veterinarian could start doses of the compounds of the invention employed in the
pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved. In general, a suitable daily dose of a compositions of the invention will be that amount of the compound which is the lowest dose effective to produce a therapeutic effect. Such an effective dose will generally depend upon the factors described above. It is preferred that administration be intravenous, intramuscular, intraperitoneal, or subcutaneous, preferably administered proximal to the site of the target. If desired, the effective daily dose of therapeutic compositions may be administered as two, three, four, five, six or more sub- doses administered separately at appropriate intervals throughout the day, optionally, in unit dosage forms. While it is possible for a compound of the present invention to be administered alone, it is preferable to administer the compound as a pharmaceutical formulation (composition).
[00134] Therapeutic compositions can be administered with medical devices known in the art. For example, in a preferred embodiment, a therapeutic composition of the invention can be administered with a needleless hypodermic injection device, such as the devices disclosed in U.S. Patent Nos. 5,399,163, 5,383,851, 5,312,335, 5,064,413,
4,941,880, 4,790,824, or 4,596,556. Examples of well-known implants and modules useful in the present invention include: U.S. Patent No, 4,487,603, which discloses an implantable micro-infusion pump for dispensing medication at a controlled rate; U.S. Patent
No. 4. ,486, 194, which discloses a therapeutic device for administering medicants through the skin; U.S. Patent No. 4,447,233, which discloses a medication infusion pump for delivering medication at a precise infusion rate; U.S. Patent No. 4,447,224, which discloses a variable flow implantable infusion apparatus for continuous drug delivery; U.S. Patent No. 4,439,196, which discloses an osmotic drug delivery system having multi-chamber compartments; and U.S. Patent No. 4,475, 196, which discloses an osmotic drug delivery system. Many other such implants, delivery systems, and modules are known to those skilled in the art.
[00135] In certain embodiments, the molecules of the invention can be formulated to ensure proper distribution in vivo. For example, the blood-brain barrier (BBB) excludes many highly hydrophilic compounds. To ensure that the therapeutic compounds of the invention cross the BBB (if desired), they can be formulated, for example, in liposomes. For methods of manufacturing liposomes, see, e.g., U.S. Patents 4,522,811 ; 5,374,548; and 5,399,331. The liposomes may comprise one or more moieties which are selectively transported into specific cells or organs, thus enhance targeted drug delivery (see, e.g., V.V. Ranade (1989) J Clin. Pharmacol. 29:685). Exemplary targeting moieties include folate or biotin (see, e.g., U.S. Patent 5,416,016 to Low et al.) mannosides (Umezawa et al, (1988) Biochem. Biophys. Res. Commim. 153: 1038); antibodies (P.G. Bloeman et al. (1995) FEBS Lett. 357: 140; M. Owais et al. (1995) Antimicrob. Agents Chemother. 39:180); surfactant protein A receptor (Briscoe et al. (1995) Am. J. Physiol. 1233: 134), different species of which may comprise the formulations of the inventions, as well as components of the invented molecules; pl20 (Schreier et al. (1994) J Biol. Chem. 269:9090); see also K.
einanen; M.L. Laukkanen (1994) FEBS Lett. 346: 123; JJ. illion; U. Fidler (1994)
Imm nomethods 4:273. In one embodiment of the invention, the therapeutic compounds of the invention are formulated in liposomes; in a more preferred embodiment, the liposomes include a targeting moiety. In a most preferred embodiment, the therapeutic compounds in the liposomes are delivered by bolus injection to a site proximal to the tumor or infection. The composition must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.
[00136] The ability of a compound to inhibit cancer can be evaluated in an animal model system predictive of efficacy in human tumors. Alternatively, this property of a composition can be evaluated by examining the ability of the compound to inhibit, such inhibition in vitro by assays known to the skilled practitioner. A therapeutically effective amount of a therapeutic compound can decrease tumor size, or otherwise ameliorate symptoms in a subject. One of ordinary skill in the art would be able to determine such amounts based on such factors as the subject's size, the severity of the subject's symptoms, and the particular composition or route of administration selected.
[00137] The composition must be sterile and fluid to the extent that the composition is deliverable by syringe. In addition to water, the carrier can be an isotonic buffered saline solution, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by use of coating such as lecithin, by maintenance of required particle size in the case of dispersion and by use of surfactants. In many cases, it is preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol or sorbitol, and sodium chloride in the composition. Long-term absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate or gelatin.
[00138] When the active compound is suitably protected, as described above, the compound may be orally administered, for example, with an inert diluent or an assimilable edible carrier.
Therapeutic and Diagnostic Applications
[00139] The anti-idiotypic Fn3 polypeptides or anti-anti-idiotypic Fn3 polypeptides described herein may be constructed to bind any antigen, antibody to the antigen, or target of interest. Such targets include, but are not limited to, cluster domains, cell receptors, cell receptor ligands, growth factors, interleukins, protein allergens, bacteria, or viruses. The anti-idiotypic Fn3 polypeptides or anti-anti-idiotypic Fn3 polypeptides described herein may also be modified to have increased stability and half-life, as well as additional functional moieties. Accordingly, these molecules may be employed in place of antibodies in all areas in which antibodies are used, including in the research, therapeutic, and diagnostic fields. In addition, because these molecules possess solubility and stability properties superior to antibodies, the antibody mimics described herein may also be used under conditions which would destroy or inactivate antibody molecules.
[00140] For example, these molecules can be administered to cells in culture, e.g. in vitro or ex vivo, or in a subject, e.g., in vivo, to treat, prevent or diagnose a variety of disorders. The term "subject" as used herein in intended to includes human and non-human animals. Non-human animals includes all vertebrates, e.g., mammals and non-mammals, such as non-human primates, sheep, dogs, cats, cows, horses, chickens, amphibians, and reptiles. When the anti-idiotypic Fn3 polypeptides are administered together with another agent, the two can be administered in either order or simultaneously.
[00141] In one embodiment, the anti-idiotypic Fn3 polypeptides, anti-anti-idiotypic Fn3 polypeptides (and variants, fusions, and conjugates thereof) of the invention can be used to detect levels of the target bound by the molecule. This can be achieved, for example, by contacting a sample (such as an in vitro sample) and a control sample with the molecule under conditions that allow for the formation of a complex between the molecule and the target(s). Any complexes formed between the molecule and the target (s) are detected and compared in the sample and the control. For example, standard detection methods, well- known in the art, such as ELISA, FACS, and flow cytometric assays, can be performed using the compositions of the invention.
[00142] Also within the scope of the invention are kits comprising the compositions (e.g., anti-idiotypic Fn3 polypeptides, anti-anti-idiotypic Fn3 polypeptides, variants, fusions, and conjugates thereof) of the invention and instructions for use. The kit can further contain a least one additional reagent, or one or more additional the anti-idiotypic Fn3 polypeptides or anti-anti-idiotypic Fn3 polypeptides of the invention. Kits typically include a label indicating the intended use of the contents of the kit. The term label includes any writing, or recorded material supplied on or with the kit, or which otherwise accompanies the kit.
[00143] As described above, the anti-idiotypic Fn3 polypeptides, anti-anti-idiotypic Fn3 polypeptides of the present invention may be employed in all areas of the research, therapeutic, and diagnostic fields. Exemplary diseases/disorders which can be treated using the anti-idiotypic Fn3 polypeptides or anti-anti-idiotypic Fn3 polypeptides of the present invention (and variants, fusions, and conjugates thereof) include autoimmune disorders, cancers, infections, and other pathogenic indications. [00144] The anti-idiotypic Fn3 polypeptides or anti-anti-idiotypic Fn3 polypeptides of the invention can be used to ameliorate or treat various diseases which include, but are not limited to, rheumatoid arthritis, osteoarthritis, juvenile chronic arthritis, septic arthritis, Lyme arthritis, psoriatic arthritis, reactive arthritis, spondyloarthropathy, systemic lupus erythematosus, Crohn's disease, ulcerative colitis, inflammatory bowel disease, insulin dependent diabetes mellitus, thyroiditis, asthma, allergic diseases, psoriasis, dermatitis scleroderma, graft versus host disease, organ transplant rejection, acute or chronic immune disease associated with organ transplantation, sarcoidosis, atherosclerosis, disseminated intravascular coagulation, Kawasaki's disease, Grave's disease, nephrotic syndrome, chronic fatigue syndrome, Wegener's granulomatosis, Henoch-Schoenlein purpurea, microscopic vasculitis of the kidneys, chronic active hepatitis, uveitis, septic shock, toxic shock syndrome, sepsis syndrome, cachexia, infectious diseases, parasitic diseases, acquired immunodeficiency syndrome, acute transverse myelitis, Huntington's chorea, Parkinson's disease, Alzheimer's disease, stroke, primary biliary cirrhosis, hemolytic anemia, malignancies, heart failure, myocardial infarction, Addison's disease, sporadic,
polyglandular deficiency type I and polyglandular deficiency type II, Schmidt's syndrome, adult (acute) respiratory distress syndrome, alopecia, alopecia greata, seronegative arthopathy, arthropathy, Reiter's disease, psoriatic arthropathy, ulcerative colitic arthropathy, enteropathic synovitis, chlamydia, yersinia and salmonella associated arthropathy, spondyloarthopathy, atheromatous disease/arteriosclerosis, atopic allergy, autoimmune bullous disease, pemphigus vulgaris, pemphigus foliaceus, pemphigoid, linear IgA disease, autoimmune haemolytic anaemia, Coombs positive haemolytic anaemia, acquired pernicious anaemia, juvenile pernicious anaemia, myalgic encephalitis/Royal Free Disease, chronic mucocutaneous candidiasis, giant cell arteritis, primary sclerosing hepatitis, cryptogenic autoimmune hepatitis, Acquired Immunodeficiency Disease Syndrome, Acquired
Immunodeficiency Related Diseases, Hepatitis B, Hepatitis C, common varied
immunodeficiency (common variable hypogammaglobulinaemia), dilated cardiomyopathy, female infertility, ovarian failure, premature ovarian failure, fibrotic lung disease, cryptogenic fibrosing alveolitis, post-inflammatory interstitial lung disease, interstitial pneumonitis, connective tissue disease associated interstitial lung disease, mixed connective tissue disease associated lung disease, systemic sclerosis associated interstitial lung disease, rheumatoid arthritis associated interstitial lung disease, systemic lupus erythematosus associated lung disease, dermatomyositis/polymyositis associated lung disease, Sjogren's disease associated lung disease, ankylosing spondylitis associated lung disease, vasculitic diffuse lung disease, haemosiderosis associated lung disease, drug-induced interstitial lung disease, fibrosis, radiation fibrosis, bronchiolitis obliterans, chronic eosinophilic pneumonia, lymphocytic infiltrative lung disease, postinfectious interstitial lung disease, gouty arthritis, autoimmune hepatitis, type-1 autoimmune hepatitis (classical autoimmune or lupoid hepatitis), type-2 autoimmune hepatitis (anti-L M antibody hepatitis), autoimmune mediated hypoglycaemia, type B insulin resistance with acanthosis nigricans,
hypoparathyroidism, acute immune disease associated with organ transplantation, chronic immune disease associated with organ transplantation, osteoarthrosis, primary sclerosing cholangitis, psoriasis type 1, psoriasis type 2, idiopathic leucopaenia, autoimmune neutropaenia, renal disease NOS, glomerulonephritides, microscopic vasulitis of the kidneys, lyme disease, discoid lupus erythematosus, male infertility idiopathic or NOS, sperm autoimmunity, multiple sclerosis (all subtypes), sympathetic ophthalmia, pulmonary hypertension secondary to connective tissue disease, Goodpasture's syndrome, pulmonary manifestation of polyarteritis nodosa, acute rheumatic fever, rheumatoid spondylitis, Still's disease, systemic sclerosis, Sjorgren's syndrome, Takayasu's disease/arteritis, autoimmune thrombocytopaenia, idiopathic thrombocytopaenia, autoimmune thyroid disease, hyperthyroidism, goitrous autoimmune hypothyroidism (Hashimoto's disease), atrophic autoimmune hypothyroidism, primary myxoedema, phacogenic uveitis, primary vasculitis, vitiligo acute liver disease, chronic liver diseases, alcoholic cirrhosis, alcohol- induced liver injury, choleosatatis, idiosyncratic liver disease, Drug-Induced hepatitis, Non-alcoholic
Steatohepatitis, allergy and asthma, group B streptococci (GBS) infection, mental disorders (e.g., depression and schizophrenia), Th2 Type and Thl Type mediated diseases, acute and chronic pain (different forms of pain), and cancers such as lung, breast, stomach, bladder, colon, pancreas, ovarian, prostate and rectal cancer and hematopoietic malignancies (leukemia and lymphoma), Abetalipoprotemia, Acrocyanosis, acute and chronic parasitic or infectious processes, acute leukemia, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), acute or chronic bacterial infection, acute pancreatitis, acute renal failure, adenocarcinomas, aerial ectopic beats, AIDS dementia complex, alcohol-induced hepatitis, allergic conjunctivitis, allergic contact dermatitis, allergic rhinitis, allograft rejection, alpha- 1 -antitrypsin deficiency, amyotrophic lateral sclerosis, anemia, angina pectoris, anterior horn cell degeneration, anti cd3 therapy, antiphospholipid syndrome, anti-receptor
hypersensitivity reactions, aordic and peripheral aneuryisms, aortic dissection, arterial hypertension, arteriosclerosis, arteriovenous fistula, ataxia, atrial fibrillation (sustained or paroxysmal), atrial flutter, atrioventricular block, B cell lymphoma, bone graft rejection, bone marrow transplant (BMT) rejection, bundle branch block, Burkitt's lymphoma, Burns, cardiac arrhythmias, cardiac stun syndrome, cardiac tumors, cardiomyopathy,
cardiopulmonary bypass inflammation response, cartilage transplant rejection, cerebellar cortical degenerations, cerebellar disorders, chaotic or multifocal atrial tachycardia, chemotherapy associated disorders, chromic myelocytic leukemia (CML), chronic alcoholism, chronic inflammatory pathologies, chronic lymphocytic leukemia (CLL), chronic obstructive pulmonary disease (COPD), chronic salicylate intoxication, colorectal carcinoma, congestive heart failure, conjunctivitis, contact dermatitis, cor pulmonale, coronary artery disease, Creutzfeldt- Jakob disease, culture negative sepsis, cystic fibrosis, cytokine therapy associated disorders, Dementia pugilistica, demyelinating diseases, dengue hemorrhagic fever, dermatitis, dermatologic conditions, diabetes, diabetes mellitus, diabetic ateriosclerotic disease, Diffuse Lewy body disease, dilated congestive cardiomyopathy, disorders of the basal ganglia, Down's Syndrome in middle age, drug-induced movement disorders induced by drugs which block CNS dopamine receptors, drug sensitivity, eczema, encephalomyelitis, endocarditis, endocrinopathy, epiglottitis, epstein-barr virus infection, erythromelalgia, extrapyramidal and cerebellar disorders, familial hematophagocytic lymphohistiocytosis, fetal thymus implant rejection, Friedreich's ataxia, functional peripheral arterial disorders, fungal sepsis, gas gangrene, gastric ulcer, glomerular nephritis, graft rejection of any organ or tissue, gram negative sepsis, gram positive sepsis, granulomas due to intracellular organisms, hairy cell leukemia, Hallerrorden-Spatz disease, hashimoto's thyroiditis, hay fever, heart transplant rejection, hemachromatosis, hemodialysis, hemolytic uremic syndrome/thrombolytic thrombocytopenic purpura, hemorrhage, hepatitis (A), His bundle arrythmias, HIV infection/HIV neuropathy, Hodgkin's disease, hyperkinetic movement disorders, hypersensitity reactions, hypersensitivity pneumonitis, hypertension, hypokinetic movement disorders, hypothalamic-pituitary-adrenal axis evaluation, idiopathic Addison's disease, idiopathic pulmonary fibrosis, antibody mediated cytotoxicity, Asthenia, infantile spinal muscular atrophy, inflammation of the aorta, influenza a, ionizing radiation exposure, iridocyclitis/uveitis/optic neuritis, ischemia-reperfusion injury, ischemic stroke, juvenile rheumatoid arthritis, juvenile spinal muscular atrophy, Kaposi's sarcoma, kidney transplant rejection, legionella, leishmaniasis, leprosy, lesions of the corticospinal system, lipedema, liver transplant rejection, lymphederma, malaria, malignamt Lymphoma, malignant histiocytosis, malignant melanoma, meningitis, meningococcemia,
metabolic/idiopathic, migraine headache, mitochondrial multi. system disorder, mixed connective tissue disease, monoclonal gammopathy, multiple myeloma, multiple systems degenerations (Mencel Dejerine-Thomas Shi-Drager and Machado- Joseph), myasthenia gravis, mycobacterium avium intracellular, mycobacterium tuberculosis, myelodyplastic syndrome, myocardial infarction, myocardial ischemic disorders, nasopharyngeal carcinoma, neonatal chronic lung disease, nephritis, nephrosis, neurodegenerative diseases, neurogenic I muscular atrophies, neutropenic fever, non-hodgkins lymphoma, occlusion of the abdominal aorta and its branches, occulsive arterial disorders, okt3 therapy,
orchitis/epidydimitis, orchitis/vasectomy reversal procedures, organomegaly, osteoporosis, pancreas transplant rejection, pancreatic carcinoma, paraneoplastic syndrome/hypercalcemia of malignancy, parathyroid transplant rejection, pelvic inflammatory disease, perennial rhinitis, pericardial disease, peripheral atherlo sclerotic disease, peripheral vascular disorders, peritonitis, pernicious anemia, Pneumocystis carinii pneumonia, pneumonia, POEMS syndrome (polyneuropathy, organomegaly, endocrinopathy, monoclonal gammopathy, and skin changes syndrome), post perfusion syndrome, post pump syndrome, post-MI cardiotomy syndrome, preeclampsia, Progressive supranucleo Palsy, primary pulmonary hypertension, radiation therapy, Raynaud's phenomenon and disease, Raynoud's disease, Refsum's disease, regular narrow QRS tachycardia, renovascular hypertension, reperfusion injury, restrictive cardiomyopathy, sarcomas, scleroderma, senile chorea, Senile Dementia of Lewy body type, seronegative arthropathies, shock, sickle cell anemia, skin allograft rejection, skin changes syndrome, small bowel transplant rejection, solid tumors, specific arrythmias, spinal ataxia, spinocerebellar degenerations, streptococcal myositis, structural lesions of the cerebellum, Subacute sclerosing panencephalitis, Syncope, syphilis of the cardiovascular system, systemic anaphalaxis, systemic inflammatory response syndrome, systemic onset juvenile rheumatoid arthritis, T-cell or FAB ALL, Telangiectasia, thromboangitis obliterans, thrombocytopenia, toxicity, transplants, trauma/hemorrhage, type III hypersensitivity reactions, type IV hypersensitivity, unstable angina, uremia, urosepsis, urticaria, valvular heart diseases, varicose veins, , vasculitis, venous diseases, venous thrombosis, ventricular fibrillation, viral and fungal infections, vital encephalitis/aseptic meningitis, vital-associated hemaphagocytic syndrome, Wernicke-Korsakoff syndrome, Wilson's disease, xenograft rejection of any organ or tissue, (see Peritt et al. PCT publication No. WO2002097048A2, Leonard et al, PCT publication No. W09524918 Al , and Salfeld et al., PCT publication No. WO00/56772A1).
[00145] Specific examples of autoimmune conditions in which the anti-idiotypic Fn3 polypeptides or anti-anti-idiotypic Fn3 polypeptides of the invention can be used include, but are not limited to, the following: multiple sclerosis and other demyelinating diseases; rheumatoid arthritis; inflammatory bowel disease; systemic lupus erythematosus; Type I diabetes; inflammatory skin disorders; Sjogren's Syndrome; and transplant rejection.
[00146] Specific examples of cancers in which the anti-idiotypic Fn3 polypeptides or anti-anti-idiotypic Fn3 polypeptides of the invention can be used include, but are not limited to, the following: lung; breast; prostate; bladder; melanoma; non-Hodgkin lymphoma; colon and rectal; pancreatic; endometrial; kidney; skin (non-melanoma); leukemia; and thyroid.
[00147] Specific examples of infections in which the anti-idiotypic Fn3 polypeptides or anti-anti-idiotypic Fn3 polypeptides of the invention can be used include, but are not limited to, the following: cellular, fungal, bacterial, and viral.
[00148] The present invention is further illustrated by the following examples which should not be construed as further limiting. The contents of all figures and all references, patents and published patent applications cited throughout this application are expressly incorporated herein by reference. Exemplification
Example 1: Preparation of HA Enriched Anti-idiotypic Fibronectin Molecules.
[00149] This example demonstrates the procedure required to prepare fibronectin molecules enriched for HA. 10Fn3 yeast library cells were thawed on ice and grow overnight in 1 L of SDCAA media (SDCAA media- Dissolve 20 g dextrose, 6.7 g Difco yeast nitrogen base, 5 g Bacto casmino acids, 5.4 g Na2HP04 and 8.56 g NaH2P04 H20 in deionized H20 to a volume of one liter and sterilize by filtration) in incubator shaker set at 30°C for 24 hours until an optical density an OD of 1 at 620 is 2 x 107 cells per mL was attained. The cells were passaged 1010 cells at least twice down to an OD of 0.5 - 1 in fresh SDCAA media, pelleting cells each time at 2500 g for 5 minutes. 5 x 109 cells were centrifuges and the pellet resuspended in fresh SGCAA media to an OD of 0.6. Cells were Induced for 24-48 hrs in 20°C incubator shaker. 5 x 109 cells were centrifuged and the cell pellet resuspend in 1 mL of PBSM buffer. 100 uL of anti-HA microbeads were added to the suspension and the sample incubated on ice for 1 hour. PBSM was added to bring up sample to 60 mL, and split between two 50 mL Falcon tubes- this is to avoid overwhelming the separation columns (capacity is about 5 x 109 cells).
[00150] The cells were analyzed using the AutoMACS, initially run on the 'Clean' program. The rack was loaded onto machine, with two tubes containing labelled cells, two empty 50 mL falcon tubes to collect negative cells and two empty 15 mL Falcon tubes to collect positive cells. The 'Possel S' protocol was selected to allow for a slower, more sensitive separation.
[00151] Positive cells were centrifuged at 2500 g for 5 mins and the cell pellet resuspended in 10 mL SDCAA with 10 mL/lL penecillin streptomycin solution, in a 50 mL flacon tube. The cells were incubated in a 30°C incubator shaker overnight. In the morning, the cell media was replaced with with 50 mL SDCAA plus pen-strep in a 250 mL glass flask. The process was repeated for at least 3 rounds of cell separation. The cells were then allowed to grow to an OD of ~4. 15 mL of cells were pelleted and resuspend in 500 uL buffer PI from Qiagen mini-prep kit. 500 uL of glass beads were added and the mixture vortexed at high speed for 5 minutes. The mixture was spun down at 200 g for 5 minutes and the supernatant removed. Plasmid purification was completed using the Qiagen Mini- prep kit. The plasmid was run on E-gel to verify plasmid rescue.
[00152] DNA was transform into TOP TEN electro-competent cells according to the Invitrogen protocol, using the 0.1 cm cuvettes. 1 mL of SOC medium was immediately added. The mixture was transfered to an 1.5 mL eppendorf tube and shaken at 37°C for 1 hour. The cell mixture was then plated out on LB carbenicillin plates and incubated overnight at 37°C. 48 colonies were stamped on duplicate LB-carb plates and sequenced. The results were analyzed for enrichment towards HA peptide appearing in loops of 10Fn3.
[00153] Figure 5 shows sequences displaying HA anti-idiotypic sequences
(underlined) in all three top loop regions of fibronectin. These results show that the loop regions of fibronectin consistently produce a sequence in each of the loop regions against the anti-HA tag attached to the bead. During various rounds of selection, the sequence consistently enriches in the BC, DE, or FG loop regions.
[00154] The same methodology was used to generate libraries of the bottom loops, AB, CD, and EF and to enrich for HA anti-idiotypic sequences.
Example 2: Verification of HA Enrichment of Anti-idiotypic Fibronectin Molecules
[00155] To confirm HA sequence enrichment in the loop regions of fibronectin, primers from IDT designed to PC 10Fn3 out of the purified plasmid were used.
Primer sequences
forward- AAAGAGCTCGGTGGTTCTGCTAGCATG (SEQ ID NO: 19) reverse- TTTGTCG ACCC CCTGG A AGT AG AGGTTC (SEQ ID NO: 20) [00156] The PCR reaction was set up using Accuprime supermix and protocol.
Provided. The PCR reaction was run on E-gel to verify reaction. The desired band was cut from gel and purified with MinElute gel extraction kit. Library inserts and pET-45b vector with Sail and Sacl vectors were digested according to NEB high fidelity protocol. The digests were cleaned with MinElute reaction cleanup kit. A ligation was set up using a T4 DNA ligase kit and protocol provided. Ligation was conducted by incubating in 16°C water bath overnight, followed by heat inactivation at 65°C for ten minutes. The ligation mix was transformed into ACELLA cells following the Edge Bio protocol using 0.1 cm cuvettes. 1 mL of SOC medium was added to each transformation, transferred to 1.5 mL eppendorf tubes, and incubated in 37°C incubator shaker for 1 hour. The transformations were plated out on LB-carb plates, and incubated overnight at 37°C. The QPix colony picker was used to in-occulate in dublicates 1.2 ml square well 96 well plates containing 0.5 ml auto -induction media and minimal media each. The plates were covered with porous air seals to allow for oxygen exchange and incubated in 37°C incubator, shaking at 900 rpm. The auto-induced plates were pelleted at 2000 rpm for 15 minutes, and the media discarded. The pellets were frozen in -80°C for at least 30 minutes. 450 uL of lysis buffer was added to each well containing the frozen pellets, and the plates shaken at 900 rpm to lyse.
[00157] To purify the proteins from each well of the plate, the King Fisher system was used. The deck was set up with elution plate (96 well plate with 150 uL/well elution buffer), two wash plates (96 well block with 1.2 mL/well wash buffer), and beads (96 well block with 500 uL bead wash containing MagneHis beads, Promega).
[00158] The elution plates were tested in duplicate using sandwich ELISA by coating wells of MaxiSorp plates with capture anti-S-tag antibody at a concentration of 1 μg/μL, 1 ΟΟμΙ. per well in carbonate buffer. The plates were incubated at room temperature for 2 hours, or 4°C overnight. After incubation, the plates were washed 3-6 times with 300 uL PBS-tween buffer. The plates were blocked plate with 300 uL/well PBS + 5% BSA, incubated 2 hours at room temperature, and washed 3-6 times with 300 uL PBS-tween buffer. 90 uL/well of PBS was added to each well. 10 uL elute from each elution plate from the King Fisher purification was transferred into duplicate MaxiSorp plates, and incubated at room temperature for one hour. The plates were then washed 3-6 times with 300 uL PBS- tween buffer. Following the wash, 100 uL/well anti-HA HRP conjugated detection antibody (Abacam) was added at a 1/5000 dilution in PBS, and incubated for one hour at room temperature. After incubation, the plates were washed 6 times with 300 uL PBS-tween buffer. To develop the plates, 100 uL/well TMB was added to each well and incubated for 10 minutes on shaker. The reaction was stopped with 100 uL/well IN HCl, and read in plate reader at 405 nm.
Example 3: Preparation of Anti-Idiotypic Fibronectin Molecules.
[00159] To illustrate the reproducibility of the methods described above for other proteins, a similar procedure was used to examine for enrichment of a sequence to anti-Flag (DYKDDDDK) (SEQ ID NO: 21), anti-S-tag (KETAAAKFERQHMDS) (SEQ ID NO: 22), and anti-V5 (GKPIPNPLLGLDST) (SEQ ID NO: 23) antibodies. Biotinylated target antibodies were immobilized on magnetic streptavidin beads from Miltenyi (cat. No. 130- 048-102) and incubated in the presence of the yeast library expressing fibronectin molecules according to the above protocol. Example 4: Purification of FnlO_EW31 (anti-HA anti-idiotypic fibronectin, SEQ ID NO: 17)
[00160] Fn3-based binding molecules can purified from a large scale expression of the molecule, following procedure outlined by Graslund et at, (Graslund et at Nature Methods (2008) 5, 135 - 146). Starter cultures of freshly streaked colonies were used to inoculate 10 mL Minimal Media containing 25 ug/ml Carbenicillin and incubated overnight at 37°C at 175 rpm. The following morning, 10 ml of the starter culture was used to inoculated into 1 litre of Teriffic Broth media with 100 ug/ml Carbenicillin in a 2.8 L Fembach shake flask.
[00161 ] The cells were incubated at 37°C at 175 rpm until an optical density at 600 nm (OD600) 10 of 1-1.5 was reached. The temperature of the culture was then lowered to 30°C, and a final concentration of 1 raM IPTG was added to the culture for induction; this will continue to shake at 175 rpm overnight. The cells were harvested by centrifugation at 4500 x g for 10 min. The cells were weighed, and 1 volume (v/w) of lysis buffer (0.1 M sodium phosphate, pH 8.0, 1.0 M NaCl, 20 mM imidazole, 10% (v/v) glycerol, 1 mM TCEP, and 20 units/ml 15 Benzonase) was added. 1 mg/ml lysozyme was added to the cell suspension and after incubation for 30 min on ice, the suspension was lysed by pressure using a microfluidizer at 1500psi and the pH readjusted to 8.0.
[00162] The lysate was spun for 30 minutes at 16000 g and 1 ml Ni-NTA resin was added to the supernatant. Binding was performed by slowly rotating the supernatent in a 250 ml conical vial at 4°C for 30 minutes. The resin was collected in a 20 ml disposable column and washed five times with loading buffer (0.05 M sodium phosphate, pH 8.0, 0.5 M NaCl, 20 mM imidazole, 5% (v/v) glycerol, 0.5 raM TCEP) followed by a wash with 20%
Isopropanol and again with loading buffer buffer. The bound protein was eluted with elution buffer (0.05 M sodium phosphate, pH 8.0, 0.5 M NaCl, 0.5 M imidazole, 5% (v/v) glycerol, 0.5 mM TCEP). Peak fractions were identified by SDS-PAGE.
Example 5: Biacore Affinity Analysis of Anti-HA Mab (Miltenyi Biotec) to
FnlO_EW31
[00163] Affinity of an anti-HA monoclonal antibody to the Fnl0_EW31 , the anti-HA anti-idiotypic fibronectin, was determined using a Biacore surface plasmon resonance assay.
Immobilization of anti-polyHistidine monoclonal antibody to CMS Biacore
[00164] Anti-polyHistidine monoclonal antibody (R&D Systems # MAB050) was immobilized on a CM5 Biacore chip (GE Healthcare # BR- 1006-68) by standard amine coupling . Briefly, HBS-N pH 7.4 (0.01 M HEPES, 0.15 M Nacl ) was used as the assay running buffer. Anti-polyHistidine monoclonal antibody was diluted to a final
concentration of 50ug/ml in 10 mM acetate buffer pH 4.75. Activation of the chip surface was accomplished by by flowing over a 50:50 mixture of l-ethyl-3-(3-dimethylamino- propyl)carbodiimide hydrochloride (EDC) and N-hyroxysuccinimide (NHS) for 8 minutes at a rate of 1 Oul/minute. The diluted was then anti-polyhistidine antibody was then bound to the second activated flow cell (FC2) CM5 chip surface for 8 minutes at 1 Oul/min. Blocking of the unoccupied chip sites was then performed by flowing ethanolamine-HCL pH 8.5 over the chip for 8 minutes at 1 Oul/min. The amount of immobilized Anti-polyHistidine monoclonal antibody was determined to be 10653 resonance units (RU). A blank immobilization in which no antibody was added was preformed on flow cell 1 (FC1).
Capture of 6xHis tagged FnlO EW31the anti-HA anti-idiotypic fibronectin
[00165] Fnl 0 EW31 , the anti-HA anti-idiotypic fibronectin was diluted to a concentration of 50uM in HBS-N buffer and passed over FC1 and 2 for 60 seconds at 30ul/min and allowed to stabilize for 60 seconds. The amount (RU) of captured
Fnl0_EW31 was determined by subtracting the RU obtained from FC1 from FC2. The average captured Fnl0_EW31 for all runs was 339.4 +/- 13.9 RU. Affinity analysis of anti-HA monoclonal antibody to surface bound FnlO_EW31, the anti- HA anti-idiotypic fibronectin
[00166] Anti-HA monoclonal antibody (Miltenyi Biotec #130-091-122) was diluted in HBS-N buffer at various concentrations and passed over FC1 and 2 for 60 seconds at a flow rate of 30ul/min following the capture of Fn 10 EW31 on the chip surface. The antibody was then allowed to dissociate for 240 seconds so that kinetic data could be obtained. Following each concentration of the anti-HA monoclonal antibody, the chip surface was regenerated by the addition of 3M MgCl for 30 seconds at a flow rate of 30ul/min. The chip was then allowed to stabilize for 120 seconds prior to the next
Fnl 0 EW31 capture and anti-HA affinity run. A blank sample containing no anti-HA antibody was run as a negative control and one concentration (50nM) of the anti-HA antibody was run twice to ensure run to run reliability. Surface bound steady state affinity of the anti-HA antibody to the captured Fnl0_EW31 was determined using the Biacore T100 Evaluation software.
[00167] Figure 6 shows the results from the Biacore affinity analysis demonstrating that Fnl0_EW31 ,the anti-HA anti-idiotypic fibronectin binds to anti-HA monoclonal antibody in a dose dependant manner. This data clearly demonstrates that anti-idiotypic Fn3 polypeptides can be generated against a target antigen and that these anti-idiotypic Fn3 polypeptides are functional in binding assays.
[00168] Collectively, these results show that the methods of the invention can be used to generate ant-idiotypic fibronectin scaffold mimetic peptides that can be used as therapeutic molecules.
Equivalents
[00169] Those skilled in the art will recognize or be able to ascertain, using no more than routine experimentation, many equivalents of the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.
[00170] The contents of any patents, patent applications, and references cited throughout this specification are hereby incorporated by reference in their entireties.

Claims

Claims
1. An anti-idiotypic fibronectin type III (Fn3) polypeptide which binds to an antibody that binds to a target antigen, wherein the anti-idiotypic Fn3 polypeptide comprises at least two adjacent Fn β-strand domain sequences selected from the group of A-G with a loop region sequence linked between adjacent β-strand domain sequences, the loop region sequence being selected from the group of loops AB, BC, CD, DE, EF, and FG; wherein at least one loop region sequence comprises an antigen mimic sequence that binds to the antibody.
2. The anti-idiotypic Fn3 polypeptide of claim 1, further comprising a half-life extender.
3. The anti-idiotypic Fn3 polypeptide of claim 2, wherein the half-life extender is selected from the group consisting of an antibody Fc region. Human Serum Albumin (HSA) and polyethylene glycol (PEG).
4. The anti-idiotypic Fn3 polypeptide of claim 1 , wherein the domain of Fn3 is any domain selected from the group consisting of a 1 to a 14th domain.
5. The anti-idiotypic Fn3 polypeptide of claim 1, wherein the fibronectin is a 10th domain of fibronectin type III. (10Fn3).
6. An anti-anti-idiotypic fibronectin type III (Fn3) polypeptide which binds to an anti-idiotypic Fn3 polypeptide, wherein the anti-idiotypic Fn3 polypeptide comprises at least two adjacent Fn β-strand domain sequences selected from the group of A-G with a loop region sequence linked between adjacent β-strand domain sequences, the loop region sequence being selected from the group of loops AB, BC, CD, DE, EF, and FG; wherein at least one loop region sequence comprises an antigen mimic sequence that binds to an antibody which binds to a target antigen.
7. The anti-idiotypic Fn3 polypeptide of claim 6, further comprising a half-life extender.
8. The anti-idiotypic Fn3 polypeptide of claim 7, wherein the half-life extender is selected from the group consisting of an antibody Fc region, Human Serum Albumin (HSA) and polyethylene glycol (PEG).
9. The anti-idiotypic Fn3 polypeptide of claim 6, wherein the domain of Fn3 is any domain selected from the group consisting of a 1 to a 14th domain.
10. The anti-idiotypic Fn3 polypeptide of claim 9, wherein the fibronectin is a 10th domain of fibronectin type III. (10Fn3).
11. A method of producing an anti-idiotypic Fn3 polypeptide with at least two adjacent Fn β-strand domain sequences selected from the group of A-G with a loop region sequence linked between adjacent β-strand domain sequences, comprising: providing an antibody against a target antigen; exposing the antibody to a yeast display library expressing Fn3 polypeptides; and enriching for Fn3 molecules that comprise an antigen mimic sequence which binds to the antibody, wherein the antigen mimic sequence is present in a loop region sequence selected from the group of loops AB, BC, CD, DE, EF, and FG.
12. A pharmaceutical composition comprising an therapeutically effective amount of an anti-idiotypic Fn3 polypeptide of any of the preceding claims and a pharmaceutically acceptable carrier.
13. A pharmaceutical composition comprising an therapeutically effective amount of an anti-anti-idiotypic Fn3 polypeptide of any of the preceding claims and a pharmaceutically acceptable carrier.
14. A method of treating a subject for a disease selected from the group consisting of an autoimmune disease, a cancer, and an infectious disease, the method comprising administering to the subject the anti-idiotypic Fn3 polypeptide, or composition of any of the preceding claims.
15. A method of treating a subject for a disease selected from the group consisting of an autoimmune disease, a cancer, and an infectious disease, the method comprising administering to the subject the anti-anti-idiotypic Fn3 polypeptide, or composition of any of the preceding claims.
16. A method of detecting a protein in a sample comprising labeling the anti- idiotypic Fn3 polypeptide of any of the preceding claims, contacting the labeled anti- idiotypic Fn3 polypeptide with the sample, and detecting complex formation between the anti-idiotypic Fn3 polypeptide with the protein.
17. A method of detecting a protein in a sample comprising labeling the anti- idiotypic Fn3 polypeptide of any of the preceding claims, contacting the labeled anti- idiotypic Fn3 polypeptide with the sample, and detecting complex formation between the anti-anti-idiotypic Fn3 polypeptide with the protein.
PCT/EP2010/066503 2009-11-02 2010-10-29 Anti-idiotypic fibronectin-based binding molecules and uses thereof WO2011051466A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US25717209P 2009-11-02 2009-11-02
US61/257,172 2009-11-02

Publications (1)

Publication Number Publication Date
WO2011051466A1 true WO2011051466A1 (en) 2011-05-05

Family

ID=43530406

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2010/066503 WO2011051466A1 (en) 2009-11-02 2010-10-29 Anti-idiotypic fibronectin-based binding molecules and uses thereof

Country Status (1)

Country Link
WO (1) WO2011051466A1 (en)

Cited By (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012158678A1 (en) 2011-05-17 2012-11-22 Bristol-Myers Squibb Company Methods for maintaining pegylation of polypeptides
WO2012158739A1 (en) 2011-05-17 2012-11-22 Bristol-Myers Squibb Company Improved methods for the selection of binding proteins
WO2013055745A3 (en) * 2011-10-11 2013-08-01 Medimmune, Llc Cd40l-specific tn3-derived scaffolds and methods of use thereof
WO2013067029A3 (en) * 2011-10-31 2013-08-15 Bristol-Myers Squibb Company Fibronectin binding domains with reduced immunogenicity
US8728483B2 (en) 2008-05-22 2014-05-20 Bristol-Myers Squibb Company Multivalent fibronectin based scaffold domain proteins
WO2014126884A1 (en) 2013-02-12 2014-08-21 Bristol-Myers Squibb Company High ph protein refolding methods
WO2014126871A1 (en) 2013-02-12 2014-08-21 Bristol-Myers Squibb Company Tangential flow filtration based protein refolding methods
US8853154B2 (en) 2012-09-13 2014-10-07 Bristol-Myers Squibb Company Fibronectin based scaffold domain proteins that bind to myostatin
WO2014165093A2 (en) 2013-03-13 2014-10-09 Bristol-Myers Squibb Company Fibronectin based scaffold domains linked to serum albumin or a moiety binding thereto
US8969289B2 (en) 2010-05-03 2015-03-03 Bristol-Myers Squibb Company Serum albumin binding molecules
US9017655B2 (en) 2008-11-24 2015-04-28 Bristol-Myers Squibb Company Bispecific EGFR/IGFIR binding molecules
WO2015143156A1 (en) 2014-03-20 2015-09-24 Bristol-Myers Squibb Company Stabilized fibronectin based scaffold molecules
US9234028B2 (en) 2008-02-14 2016-01-12 Bristol-Myers Squibb Company Targeted therapeutics based on engineered proteins that bind EGFR
US9328157B2 (en) 2003-12-05 2016-05-03 Bristol-Myers Squibb Company Inhibitors of type 2 vascular endothelial growth factor receptors
WO2016086036A2 (en) 2014-11-25 2016-06-02 Bristol-Myers Squibb Company Methods and compositions for 18f-radiolabeling of biologics
US9469676B2 (en) 2011-04-13 2016-10-18 Bristol-Myers Squibb Company Fc fusion proteins comprising novel linkers or arrangements
US9562089B2 (en) 2010-05-26 2017-02-07 Bristol-Myers Squibb Company Fibronectin based scaffold proteins having improved stability
WO2017210335A1 (en) 2016-06-01 2017-12-07 Bristol-Myers Squibb Company Imaging methods using 18f-radiolabeled biologics
WO2018204617A1 (en) * 2017-05-03 2018-11-08 Bristol-Myers Squibb Company Stable formulations of fibronectin based scaffold domain proteins that bind to myostatin
US10221232B2 (en) 2006-11-22 2019-03-05 Bristol-Myers Squibb Company Methods of treating cancer by administering IGF-IR binding molecules
US10442851B2 (en) 2014-03-20 2019-10-15 Bristol-Myers Squibb Company Serum albumin-binding fibronectin type III domains
US10766946B2 (en) 2015-09-23 2020-09-08 Bristol-Myers Squibb Company Fast-off rate serum albumin binding fibronectin type III domains
US10787498B2 (en) 2013-02-06 2020-09-29 Bristol-Myers Squibb Company Fibronectin type III domain proteins with enhanced solubility
WO2021174045A1 (en) 2020-02-28 2021-09-02 Bristol-Myers Squibb Company Radiolabeled fibronectin based scaffolds and antibodies and theranostic uses thereof
US11447538B2 (en) 2013-02-01 2022-09-20 Bristol-Myers Squibb Company Fibronectin based scaffold proteins
CN117143224A (en) * 2023-10-26 2023-12-01 广州暨南大学医药生物技术研究开发中心有限公司 Recombinant human fibronectin truncated peptide and preparation method and application thereof
RU2826189C2 (en) * 2011-10-11 2024-09-05 Виела Байо, Инк. CD40L-SPECIFIC FRAMEWORK STRUCTURES DERIVED FROM Tn3, AND METHODS OF USE THEREOF

Citations (74)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4439196A (en) 1982-03-18 1984-03-27 Merck & Co., Inc. Osmotic drug delivery system
US4447233A (en) 1981-04-10 1984-05-08 Parker-Hannifin Corporation Medication infusion pump
US4447224A (en) 1982-09-20 1984-05-08 Infusaid Corporation Variable flow implantable infusion apparatus
US4475196A (en) 1981-03-06 1984-10-02 Zor Clair G Instrument for locating faults in aircraft passenger reading light and attendant call control system
US4486194A (en) 1983-06-08 1984-12-04 James Ferrara Therapeutic device for administering medicaments through the skin
US4487603A (en) 1982-11-26 1984-12-11 Cordis Corporation Implantable microinfusion pump system
US4522811A (en) 1982-07-08 1985-06-11 Syntex (U.S.A.) Inc. Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides
EP0154316A2 (en) 1984-03-06 1985-09-11 Takeda Chemical Industries, Ltd. Chemically modified lymphokine and production thereof
US4596556A (en) 1985-03-25 1986-06-24 Bioject, Inc. Hypodermic injection apparatus
US4704362A (en) 1977-11-08 1987-11-03 Genentech, Inc. Recombinant cloning vehicle microbial polypeptide expression
US4790824A (en) 1987-06-19 1988-12-13 Bioject, Inc. Non-invasive hypodermic injection device
US4881175A (en) 1986-09-02 1989-11-14 Genex Corporation Computer based system and method for determining and displaying possible chemical structures for converting double- or multiple-chain polypeptides to single-chain polypeptides
US4941880A (en) 1987-06-19 1990-07-17 Bioject, Inc. Pre-filled ampule and non-invasive hypodermic injection device assembly
EP0399666A1 (en) 1989-04-29 1990-11-28 Delta Biotechnology Limited Fusion proteins containing N-terminal fragments of human serum albumin
EP0401384A1 (en) 1988-12-22 1990-12-12 Kirin-Amgen, Inc. Chemically modified granulocyte colony stimulating factor
EP0413622A1 (en) 1989-08-03 1991-02-20 Rhone-Poulenc Sante Albumin derivatives with therapeutic functions
US5013653A (en) 1987-03-20 1991-05-07 Creative Biomolecules, Inc. Product and process for introduction of a hinge region into a fusion protein to facilitate cleavage
US5064413A (en) 1989-11-09 1991-11-12 Bioject, Inc. Needleless hypodermic injection device
US5091513A (en) 1987-05-21 1992-02-25 Creative Biomolecules, Inc. Biosynthetic antibody binding sites
US5132405A (en) 1987-05-21 1992-07-21 Creative Biomolecules, Inc. Biosynthetic antibody binding sites
WO1993015199A1 (en) 1992-01-31 1993-08-05 Rhone-Poulenc Rorer S.A. Novel biologically active polypeptides, preparation thereof and pharmaceutical composition containing said polypeptides
WO1993015200A1 (en) 1992-01-31 1993-08-05 Rhone-Poulenc Rorer S.A. Antithrombotic polypeptides as antagonists of the binding of vwf to platelets or to subendothelium
US5258498A (en) 1987-05-21 1993-11-02 Creative Biomolecules, Inc. Polypeptide linkers for production of biosynthetic proteins
US5260203A (en) 1986-09-02 1993-11-09 Enzon, Inc. Single polypeptide chain binding molecules
US5304489A (en) 1987-02-17 1994-04-19 Genpharm International, Inc. DNA sequences to target proteins to the mammary gland for efficient secretion
US5312335A (en) 1989-11-09 1994-05-17 Bioject Inc. Needleless hypodermic injection device
US5374548A (en) 1986-05-02 1994-12-20 Genentech, Inc. Methods and compositions for the attachment of proteins to liposomes using a glycophospholipid anchor
US5383851A (en) 1992-07-24 1995-01-24 Bioject Inc. Needleless hypodermic injection device
US5399331A (en) 1985-06-26 1995-03-21 The Liposome Company, Inc. Method for protein-liposome coupling
US5416016A (en) 1989-04-03 1995-05-16 Purdue Research Foundation Method for enhancing transmembrane transport of exogenous molecules
US5428130A (en) 1989-02-23 1995-06-27 Genentech, Inc. Hybrid immunoglobulins
WO1995024918A1 (en) 1994-03-14 1995-09-21 Genetics Institute, Inc. Use of il-12 and il-12 antagonists in the treatment of autoimmune diseases
US5476786A (en) 1987-05-21 1995-12-19 Creative Biomolecules, Inc. Biosynthetic antibody binding sites
US5605793A (en) 1994-02-17 1997-02-25 Affymax Technologies N.V. Methods for in vitro recombination
US5641870A (en) 1995-04-20 1997-06-24 Genentech, Inc. Low pH hydrophobic interaction chromatography for antibody purification
DE19628705A1 (en) 1996-07-08 1998-01-15 Fresenius Ag New oxygen transport agents, hemoglobin-hydroxyethyl starch conjugates containing them, processes for their preparation and their use as blood substitutes
US5741957A (en) 1989-12-01 1998-04-21 Pharming B.V. Transgenic bovine
US5759808A (en) 1992-08-21 1998-06-02 Vrije Universiteit Brussel Immunoglobulins devoid of light chains
US5830650A (en) 1990-04-05 1998-11-03 Roberto Crea Walk-through mutagenesis
US5849992A (en) 1993-12-20 1998-12-15 Genzyme Transgenics Corporation Transgenic production of antibodies in milk
US5866344A (en) 1991-11-15 1999-02-02 Board Of Regents, The University Of Texas System Antibody selection methods using cell surface expressed libraries
WO1999020656A1 (en) * 1997-10-21 1999-04-29 Centro De Inmunologia Molecular (Cim) Anti-idiotype monoclonal antibodies, their use in active immunotherapy of malignant tumors and compositions containing them
US5922545A (en) 1993-10-29 1999-07-13 Affymax Technologies N.V. In vitro peptide and antibody display libraries
WO2000056772A1 (en) 1999-03-25 2000-09-28 Knoll Gmbh Human antibodies that bind human il-12 and methods for producing
US6194550B1 (en) 1990-08-02 2001-02-27 Larry Gold Systematic polypeptide evolution by reverse translation
WO2001077137A1 (en) 2000-04-12 2001-10-18 Human Genome Sciences, Inc. Albumin fusion proteins
EP1176195A1 (en) 1999-04-09 2002-01-30 Kyowa Hakko Kogyo Co., Ltd. Method for controlling the activity of immunologically functional molecule
US20020019517A1 (en) * 1997-06-12 2002-02-14 Shohei Koide Artifical antibody polypeptides
DE10060686A1 (en) * 2000-12-07 2002-06-13 Prehm Peter New anti-idiotypic antibody against antibodies of rheumatic immune complexes, useful for treatment and diagnosis of rheumatic autoimmune diseases
WO2002082089A2 (en) * 2001-04-03 2002-10-17 Immune Network Ltd. Anti-idiotypic antibody and its use in diagnosis and therapy of hepatitis c virus related diseases
WO2002097048A2 (en) 2001-05-30 2002-12-05 Centocor, Inc. ANTI-p40 IMMUNOGLOBULIN DERIVED PROTEINS, COMPOSITIONS, METHODS AND USES
WO2003006007A1 (en) 2001-07-11 2003-01-23 Research & Innovation Soc.Coop. A R.L. Use of compounds as functional antagonists to the central cannabinoid receptors
DE10129369C1 (en) 2001-06-21 2003-03-06 Fresenius Kabi De Gmbh Water soluble antibiotic in the form of a polysaccharide conjugate containing an aminosugar
WO2003035835A2 (en) 2001-10-25 2003-05-01 Genentech, Inc. Glycoprotein compositions
WO2003104418A2 (en) 2002-06-06 2003-12-18 Research Corporation Technologies, Inc. Reconstituted polypeptides
US6699658B1 (en) 1996-05-31 2004-03-02 Board Of Trustees Of The University Of Illinois Yeast cell surface display of proteins and uses thereof
WO2005056764A2 (en) 2003-12-05 2005-06-23 Compound Therapeutics, Inc. Inhibitors of type 2 vascular endothelial growth factor receptors
US6927042B2 (en) 2002-10-16 2005-08-09 The Scripps Research Institute Glycoprotein synthesis
US6951725B2 (en) 2001-06-21 2005-10-04 Compound Therapeutics, Inc. In vitro protein interaction detection systems
EP1297172B1 (en) 2000-06-28 2005-11-09 Glycofi, Inc. Methods for producing modified glycoproteins
WO2006023144A2 (en) 2004-07-06 2006-03-02 Bioren Inc. Look-through mutagenesis for developing altered polypeptides with enhanced properties
US20060052342A1 (en) 2002-12-04 2006-03-09 Klaus Sommermeyer Aldonic acid esters, methods for producing the same, and methods for producing pharmaceutical active ingredients coupled to polysaccharides or polysaccharide derivatives on free amino groups
US7022479B2 (en) 2000-01-24 2006-04-04 Compound Therapeutics, Inc. Sensitive, multiplexed diagnostic assays for protein analysis
US20060100176A1 (en) 2003-01-23 2006-05-11 Klaus Sommermeyer Carboxylic acid diesters, methods for the production thereof and methods for the production of pharmaceutical active substances coupled to free amino groups with polysaccharide or polysaccharide derivatives
US7045337B2 (en) 2001-04-19 2006-05-16 The Scripps Research Institute In vivo incorporation of unnatural amino acids
US7063943B1 (en) 1990-07-10 2006-06-20 Cambridge Antibody Technology Methods for producing members of specific binding pairs
US7078197B2 (en) 1999-07-27 2006-07-18 Compound Therapeutics, Inc. Peptide acceptor ligation methods
US20060217293A1 (en) 2002-03-06 2006-09-28 Michele Orlando Coupling low-molecular substances to a modified polysaccharide
US20060258607A1 (en) 2005-04-08 2006-11-16 Noxxon Pharma Ag Ghrelin binding nucleic acids
US7195880B2 (en) 1998-12-02 2007-03-27 Adnexus Therapeutics, Inc. DNA-protein fusions and uses thereof
US20070082365A1 (en) 1998-12-10 2007-04-12 Adnexus Therapeutics, Inc. Protein scaffolds for antibody mimics and other binding proteins
WO2007042289A2 (en) 2005-10-11 2007-04-19 Ablynx N.V. Nanobodies™ and polypeptides against egfr and igf-ir
US20070134197A1 (en) 2004-03-11 2007-06-14 Wolfram Eichner Conjugates of hydroxyalkyl starch and a protein, prepared by reductive amination
WO2008093280A2 (en) * 2007-01-30 2008-08-07 Pomona Biotechnologies Llc Anti-idiotype monoclonal antibodies as mimotopes of the hiv gp120 antigen

Patent Citations (80)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4704362A (en) 1977-11-08 1987-11-03 Genentech, Inc. Recombinant cloning vehicle microbial polypeptide expression
US4475196A (en) 1981-03-06 1984-10-02 Zor Clair G Instrument for locating faults in aircraft passenger reading light and attendant call control system
US4447233A (en) 1981-04-10 1984-05-08 Parker-Hannifin Corporation Medication infusion pump
US4439196A (en) 1982-03-18 1984-03-27 Merck & Co., Inc. Osmotic drug delivery system
US4522811A (en) 1982-07-08 1985-06-11 Syntex (U.S.A.) Inc. Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides
US4447224A (en) 1982-09-20 1984-05-08 Infusaid Corporation Variable flow implantable infusion apparatus
US4487603A (en) 1982-11-26 1984-12-11 Cordis Corporation Implantable microinfusion pump system
US4486194A (en) 1983-06-08 1984-12-04 James Ferrara Therapeutic device for administering medicaments through the skin
EP0154316A2 (en) 1984-03-06 1985-09-11 Takeda Chemical Industries, Ltd. Chemically modified lymphokine and production thereof
US4596556A (en) 1985-03-25 1986-06-24 Bioject, Inc. Hypodermic injection apparatus
US5399331A (en) 1985-06-26 1995-03-21 The Liposome Company, Inc. Method for protein-liposome coupling
US5374548A (en) 1986-05-02 1994-12-20 Genentech, Inc. Methods and compositions for the attachment of proteins to liposomes using a glycophospholipid anchor
US4881175A (en) 1986-09-02 1989-11-14 Genex Corporation Computer based system and method for determining and displaying possible chemical structures for converting double- or multiple-chain polypeptides to single-chain polypeptides
US5260203A (en) 1986-09-02 1993-11-09 Enzon, Inc. Single polypeptide chain binding molecules
US5455030A (en) 1986-09-02 1995-10-03 Enzon Labs, Inc. Immunotheraphy using single chain polypeptide binding molecules
US5304489A (en) 1987-02-17 1994-04-19 Genpharm International, Inc. DNA sequences to target proteins to the mammary gland for efficient secretion
US5013653A (en) 1987-03-20 1991-05-07 Creative Biomolecules, Inc. Product and process for introduction of a hinge region into a fusion protein to facilitate cleavage
US5091513A (en) 1987-05-21 1992-02-25 Creative Biomolecules, Inc. Biosynthetic antibody binding sites
US5476786A (en) 1987-05-21 1995-12-19 Creative Biomolecules, Inc. Biosynthetic antibody binding sites
US5132405A (en) 1987-05-21 1992-07-21 Creative Biomolecules, Inc. Biosynthetic antibody binding sites
US5258498A (en) 1987-05-21 1993-11-02 Creative Biomolecules, Inc. Polypeptide linkers for production of biosynthetic proteins
US5482858A (en) 1987-05-21 1996-01-09 Creative Biomolecules, Inc. Polypeptide linkers for production of biosynthetic proteins
US4941880A (en) 1987-06-19 1990-07-17 Bioject, Inc. Pre-filled ampule and non-invasive hypodermic injection device assembly
US4790824A (en) 1987-06-19 1988-12-13 Bioject, Inc. Non-invasive hypodermic injection device
EP0401384A1 (en) 1988-12-22 1990-12-12 Kirin-Amgen, Inc. Chemically modified granulocyte colony stimulating factor
US5428130A (en) 1989-02-23 1995-06-27 Genentech, Inc. Hybrid immunoglobulins
US5416016A (en) 1989-04-03 1995-05-16 Purdue Research Foundation Method for enhancing transmembrane transport of exogenous molecules
EP0399666A1 (en) 1989-04-29 1990-11-28 Delta Biotechnology Limited Fusion proteins containing N-terminal fragments of human serum albumin
EP0413622A1 (en) 1989-08-03 1991-02-20 Rhone-Poulenc Sante Albumin derivatives with therapeutic functions
US5312335A (en) 1989-11-09 1994-05-17 Bioject Inc. Needleless hypodermic injection device
US5064413A (en) 1989-11-09 1991-11-12 Bioject, Inc. Needleless hypodermic injection device
US5741957A (en) 1989-12-01 1998-04-21 Pharming B.V. Transgenic bovine
US5830650A (en) 1990-04-05 1998-11-03 Roberto Crea Walk-through mutagenesis
US7063943B1 (en) 1990-07-10 2006-06-20 Cambridge Antibody Technology Methods for producing members of specific binding pairs
US6194550B1 (en) 1990-08-02 2001-02-27 Larry Gold Systematic polypeptide evolution by reverse translation
US5866344A (en) 1991-11-15 1999-02-02 Board Of Regents, The University Of Texas System Antibody selection methods using cell surface expressed libraries
WO1993015199A1 (en) 1992-01-31 1993-08-05 Rhone-Poulenc Rorer S.A. Novel biologically active polypeptides, preparation thereof and pharmaceutical composition containing said polypeptides
WO1993015200A1 (en) 1992-01-31 1993-08-05 Rhone-Poulenc Rorer S.A. Antithrombotic polypeptides as antagonists of the binding of vwf to platelets or to subendothelium
US5383851A (en) 1992-07-24 1995-01-24 Bioject Inc. Needleless hypodermic injection device
US5399163A (en) 1992-07-24 1995-03-21 Bioject Inc. Needleless hypodermic injection methods and device
US5759808A (en) 1992-08-21 1998-06-02 Vrije Universiteit Brussel Immunoglobulins devoid of light chains
US5922545A (en) 1993-10-29 1999-07-13 Affymax Technologies N.V. In vitro peptide and antibody display libraries
US5849992A (en) 1993-12-20 1998-12-15 Genzyme Transgenics Corporation Transgenic production of antibodies in milk
US5830721A (en) 1994-02-17 1998-11-03 Affymax Technologies N.V. DNA mutagenesis by random fragmentation and reassembly
US5605793A (en) 1994-02-17 1997-02-25 Affymax Technologies N.V. Methods for in vitro recombination
WO1995024918A1 (en) 1994-03-14 1995-09-21 Genetics Institute, Inc. Use of il-12 and il-12 antagonists in the treatment of autoimmune diseases
US5641870A (en) 1995-04-20 1997-06-24 Genentech, Inc. Low pH hydrophobic interaction chromatography for antibody purification
US6699658B1 (en) 1996-05-31 2004-03-02 Board Of Trustees Of The University Of Illinois Yeast cell surface display of proteins and uses thereof
DE19628705A1 (en) 1996-07-08 1998-01-15 Fresenius Ag New oxygen transport agents, hemoglobin-hydroxyethyl starch conjugates containing them, processes for their preparation and their use as blood substitutes
US6673901B2 (en) 1997-06-12 2004-01-06 Research Corporation Technologies, Inc. Artificial antibody polypeptides
US20020019517A1 (en) * 1997-06-12 2002-02-14 Shohei Koide Artifical antibody polypeptides
WO1999020656A1 (en) * 1997-10-21 1999-04-29 Centro De Inmunologia Molecular (Cim) Anti-idiotype monoclonal antibodies, their use in active immunotherapy of malignant tumors and compositions containing them
US7195880B2 (en) 1998-12-02 2007-03-27 Adnexus Therapeutics, Inc. DNA-protein fusions and uses thereof
US20070082365A1 (en) 1998-12-10 2007-04-12 Adnexus Therapeutics, Inc. Protein scaffolds for antibody mimics and other binding proteins
WO2000056772A1 (en) 1999-03-25 2000-09-28 Knoll Gmbh Human antibodies that bind human il-12 and methods for producing
EP1176195A1 (en) 1999-04-09 2002-01-30 Kyowa Hakko Kogyo Co., Ltd. Method for controlling the activity of immunologically functional molecule
US7078197B2 (en) 1999-07-27 2006-07-18 Compound Therapeutics, Inc. Peptide acceptor ligation methods
US7022479B2 (en) 2000-01-24 2006-04-04 Compound Therapeutics, Inc. Sensitive, multiplexed diagnostic assays for protein analysis
WO2001077137A1 (en) 2000-04-12 2001-10-18 Human Genome Sciences, Inc. Albumin fusion proteins
EP1297172B1 (en) 2000-06-28 2005-11-09 Glycofi, Inc. Methods for producing modified glycoproteins
DE10060686A1 (en) * 2000-12-07 2002-06-13 Prehm Peter New anti-idiotypic antibody against antibodies of rheumatic immune complexes, useful for treatment and diagnosis of rheumatic autoimmune diseases
WO2002082089A2 (en) * 2001-04-03 2002-10-17 Immune Network Ltd. Anti-idiotypic antibody and its use in diagnosis and therapy of hepatitis c virus related diseases
US7083970B2 (en) 2001-04-19 2006-08-01 The Scripps Research Institute Methods and compositions for the production of orthogonal tRNA-aminoacyl tRNA synthetase pairs
US7045337B2 (en) 2001-04-19 2006-05-16 The Scripps Research Institute In vivo incorporation of unnatural amino acids
WO2002097048A2 (en) 2001-05-30 2002-12-05 Centocor, Inc. ANTI-p40 IMMUNOGLOBULIN DERIVED PROTEINS, COMPOSITIONS, METHODS AND USES
US6951725B2 (en) 2001-06-21 2005-10-04 Compound Therapeutics, Inc. In vitro protein interaction detection systems
DE10129369C1 (en) 2001-06-21 2003-03-06 Fresenius Kabi De Gmbh Water soluble antibiotic in the form of a polysaccharide conjugate containing an aminosugar
WO2003006007A1 (en) 2001-07-11 2003-01-23 Research & Innovation Soc.Coop. A R.L. Use of compounds as functional antagonists to the central cannabinoid receptors
WO2003035835A2 (en) 2001-10-25 2003-05-01 Genentech, Inc. Glycoprotein compositions
US20060217293A1 (en) 2002-03-06 2006-09-28 Michele Orlando Coupling low-molecular substances to a modified polysaccharide
WO2003104418A2 (en) 2002-06-06 2003-12-18 Research Corporation Technologies, Inc. Reconstituted polypeptides
US6927042B2 (en) 2002-10-16 2005-08-09 The Scripps Research Institute Glycoprotein synthesis
US20060052342A1 (en) 2002-12-04 2006-03-09 Klaus Sommermeyer Aldonic acid esters, methods for producing the same, and methods for producing pharmaceutical active ingredients coupled to polysaccharides or polysaccharide derivatives on free amino groups
US20060100176A1 (en) 2003-01-23 2006-05-11 Klaus Sommermeyer Carboxylic acid diesters, methods for the production thereof and methods for the production of pharmaceutical active substances coupled to free amino groups with polysaccharide or polysaccharide derivatives
WO2005056764A2 (en) 2003-12-05 2005-06-23 Compound Therapeutics, Inc. Inhibitors of type 2 vascular endothelial growth factor receptors
US20070134197A1 (en) 2004-03-11 2007-06-14 Wolfram Eichner Conjugates of hydroxyalkyl starch and a protein, prepared by reductive amination
WO2006023144A2 (en) 2004-07-06 2006-03-02 Bioren Inc. Look-through mutagenesis for developing altered polypeptides with enhanced properties
US20060258607A1 (en) 2005-04-08 2006-11-16 Noxxon Pharma Ag Ghrelin binding nucleic acids
WO2007042289A2 (en) 2005-10-11 2007-04-19 Ablynx N.V. Nanobodies™ and polypeptides against egfr and igf-ir
WO2008093280A2 (en) * 2007-01-30 2008-08-07 Pomona Biotechnologies Llc Anti-idiotype monoclonal antibodies as mimotopes of the hiv gp120 antigen

Non-Patent Citations (96)

* Cited by examiner, † Cited by third party
Title
"Monoclonal Antibodies For Cancer Detection And Therapy", 1985, ACADEMIC PRESS, article "Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy", pages: 303 - 16
"Sustained and Controlled Release Drug Delivery Systems", 1978, MARCEL DEKKER, INC.
ALLEN, T.M., NAT. REV. CANCER, vol. 2, 2002, pages 750 - 763
ARANCIO 0 ET AL., EMBO JOURNAL, 2004, pages 1 - 10
ARNON ET AL.: "Monoclonal Antibodies And Cancer Therapy", 1985, ALAN R. LISS, INC., article "Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy", pages: 243 - 56
BARRY J. DICKSON, SCIENCE, vol. 298, 2002, pages 1959
BERGE, S.M. ET AL., J. PHARM. SCI., vol. 66, 1977, pages 1 - 19
BIRD ET AL., SCIENCE, vol. 242, 1988, pages 423 - 426
BLOOM L ET AL: "FN3: a new protein scaffold reaches the clinic", DRUG DISCOVERY TODAY, ELSEVIER, RAHWAY, NJ, US, vol. 14, no. 19-20, 1 October 2009 (2009-10-01), pages 949 - 955, XP026653685, ISSN: 1359-6446, [retrieved on 20090702], DOI: DOI:10.1016/J.DRUDIS.2009.06.007 *
BORK, NATURE BIOTECH., vol. 15, 1997, pages 553
BORK; DOOLITTLE, PROC. NATL. ACAD. SCI. U.S.A, vol. 89, 1992, pages 8990
BORMAN, CHEM. & ENG. NEWS, vol. 84, no. 36, 2006, pages 13 - 22
BORMAN, CHEM. & ENG. NEWS, vol. 85, 2007, pages 19 - 20
BORNEMANN K D ET AL., AM J PATHOL., vol. 158, 2001, pages 63
BOYCE ET AL., JOURNAL OF EXPERIMENTAL MEDICINE, vol. 201, no. 12, 2005, pages 1869 - 1873
BRENNAN ET AL., SCIENCE, vol. 229, 1985, pages 81 - 83
BRISCOE ET AL., AM. J PHYSIOL., vol. 1233, 1995, pages 134
BURAS J A ET AL., NAT REV DRUG DISCOV., vol. 4, no. 10, 2005, pages 854 - 65
C. E. SHEPHERD ET AL., NEUROBIOL AGING., 24 October 2005 (2005-10-24)
CALANDRA T ET AL., NAT MED., vol. 6, no. 2, 2000, pages 164 - 70
CARTER ET AL., NUCLEIC ACIDS RES., vol. 13, 1985, pages 4431 - 4443
CO ET AL., J IMMUNOL., vol. 148, 1992, pages 1149
COFFMAN ET AL., JOURNAL OF EXPERIMENTAL MEDICINE, vol. 201, no. 12, 2005, pages 1875 - 1879
DEANE R ET AL., NAT MED., vol. 9, 2003, pages 907 - 13
DESCOTES ET AL., DEVELOPMENTS IN BIOLOGICAL STANDARDIZATION, vol. 77, 1992, pages 99 - 102
ELIEZER MASLIAH ET AL., NEURON, vol. 46, 2005, pages 857
FELICIA YU HSUAN TENG ET AL., J NEUROSCI RES., vol. 79, 2005, pages 273
FINOTTO ET AL., INTERNATIONAL IMMUNOLOGY, vol. 17, no. 8, 2005, pages 993 - 1007
GANG XU ET AL., J. NEUROCHEM., vol. 91, 2004, pages 1018
GENAIN C P ET AL., J MOL MED., vol. 75, no. 3, 1997, pages 187 - 97
GENOVESE MC ET AL.: "Abatacept for rheumatoid arthritis refractory to tumor necrosis factor alpha inhibition", N ENGL J. MED., vol. 353, 2005, pages 1114 - 23, XP055087310, DOI: doi:10.1056/NEJMoa050524
GLENNIE ET AL., J IMMUNOL., vol. 139, 1987, pages 2367 - 2375
GRASLUND ET AL., NATURE METHODS, vol. 5, 2008, pages 135 - 146
HARRIMAN G; HARPER L K; SCHAIBLE T F: "Summary of clinical trials in rheumatoid arthritis using infliximab, an anti-TNFalpha treatment", ANN RHEUM DIS, vol. 58, no. 1, 1999, pages 161 - 4, XP055101148
HART B A ET AL., J IMMUNOL, vol. 175, no. 7, 2005, pages 4761 - 8
HART ET AL., JOURNAL OF ALLERGY AND CLINICAL IMMUNOLOGY, vol. 108, no. 2, 2001, pages 250 - 257
HELLSTROM ET AL.: "Controlled Drug Delivery", 1987, MARCEL DEKKER, INC., article "Antibodies For Drug Delivery", pages: 623 - 53
HIGUCHI: "PCR Protocols", 1990, ACADEMIC PRESS, pages: 177 - 183
HOLLINGER; HUDSON, NATURE BIOTECHNOLOGY, vol. 23, no. 9, 2005, pages 1126 - 1136
HUSTON ET AL., PROC. NATL. ACAD. SCI. U.S.A, vol. 85, 1988, pages 5879 - 5883
HUSTON ET AL., PROC. NATL. ACAD. SCI., vol. 85, 1988, pages 5879 - 5883
IGOR KLYUBIN ET AL., NAT MED., vol. 11, 2005, pages 556 - 61
J.J. KILLION; I.J. FIDLER, LMMUNOMETHODS, vol. 4, 1994, pages 273
JEME, N. K.: "Towards a network theory of the immune system", ANN. INST. PASTEUR. IMMUN., vol. 125C, 1974, pages 373 - 389, XP008031831
K. KEINANEN; M.L. LAUKKANEN, FEBS LETT., vol. 346, 1994, pages 123
KARPOVSKY ET AL., J. EXP. MED., vol. 160, 1984, pages 1686
KOIDE A ET AL: "The fibronectin type III domain as a scaffold for novel binding proteins", JOURNAL OF MOLECULAR BIOLOGY, LONDON, GB, vol. 284, no. 4, 11 December 1998 (1998-12-11), pages 1141 - 1151, XP004455886, ISSN: 0022-2836, DOI: DOI:10.1006/JMBI.1998.2238 *
KOIDE AKIKO ET AL: "Monobodies: antibody mimics based on the scaffold of the fibronectin type III domain", METHODS IN MOLECULAR BIOLOGY, HUMANA PRESS INC, NJ, US, vol. 352, 1 January 2007 (2007-01-01), pages 95 - 109, XP009102789, ISSN: 1064-3745 *
KUNKEL ET AL., PROC. NATL. ACAD. SCI. U.S.A, vol. 82, 1987, pages 488
LIU, MA ET AL., PROC. NATL. ACAD SCI. U S.A, vol. 82, 1985, pages 8648
LLOYD ET AL., ADVANCES IN IMMUNOLOGY, vol. 77, 2001, pages 263 - 295
LUBLIN F D. ET AL., SPRINGER SEMIN IMMUNOPATHOL, vol. 8, no. 3, 1985, pages 197 - 208
LUSTER ET AL., TOXICOLOGY, vol. 92, no. 1-3, 1994, pages 22943
M. OWAIS ET AL., ANTIMICROB. AGENTS CHEMOTHER., vol. 39, 1995, pages 180
MARCO DOMENICONI ET AL., J NEUROL SCI., vol. 233, 2005, pages 43
MCDONNELL ET AL., PROGRESS IN RESPIRATORY RESEARCH, vol. 31, 2001, pages 247 - 250
MCGEE A W ET AL., TRENDS NEUROSCI., vol. 26, 2003, pages 193
MEHREN M ET AL.: "Monoclonal antibody therapy for cancer", ANNU REV MED., vol. 54, 2003, pages 343 - 69, XP008030292, DOI: doi:10.1146/annurev.med.54.101601.152442
MEINKE ET AL., J. BACTERIOL., vol. 175, 1993, pages 1910
MICHELLE C JANELSINS ET AL., J NEUROINFLAMMATION, vol. 2, 2005, pages 23
MILAN MAKWANAL ET AL., FEBS J., vol. 272, 2005, pages 2628
NELSON R B., CURR PHARM DES., vol. 11, 2005, pages 3335
OKAMOTO H; KAMATANI N: "Rituximab for rheumatoid arthritis", N ENGL J. MED., vol. 351, 2004, pages 1909, XP008076291, DOI: doi:10.1056/NEJM200410283511820
OWENS T ET AL., NEUROL CLIN., vol. L3, no. 1, 1995, pages 51 - 73
P.G. BLOEMAN ET AL., FEBS LETT., vol. 357, 1995, pages 140
PADILLA ET AL., JOURNAL OF IMMUNOLOGY, vol. 174, no. 12, 2005, pages 8097 - 8105
PASTAN, I.; KREITMAN, R. J., CURR. OPIN. INVESTIG. DRUGS, vol. 3, 2002, pages 1089 - 1091
PAULUS, BEHRING INS. MITT., 1985, pages 118 - 132
PAYNE, G., CANCER CELL, vol. 3, 2003, pages 207 - 212
PENG SL, METHODS MOL MED., vol. 102, 2004, pages 227 - 72
QUEEN ET AL., IMMUNOL. REV., vol. 89, 1986, pages 49
SAITO, G. ET AL., ADV. DRUG DELIV. REV., vol. 55, 2003, pages 199 - 215
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR PRESS
SCHREIER ET AL., J BIOL. CHEM., vol. 269, 1994, pages 9090
SENTER, P.D.; SPRINGER, C.J., ADV. DRUG DELIV. REV., vol. 53, 2001, pages 247 - 264
SFIKAKIS P P ET AL., CURR OPIN RHEUMATOL, vol. 17, 2005, pages 550 - 7
SHIELDS, R.L. ET AL., J. BIOL. CHEM., vol. 277, 2002, pages 26733 - 26740
SKERRA ET AL: "Alternative non-antibody scaffolds for molecular recognition", CURRENT OPINION IN BIOTECHNOLOGY, LONDON, GB, vol. 18, no. 4, 14 September 2007 (2007-09-14), pages 295 - 304, XP022244962, ISSN: 0958-1669, DOI: DOI:10.1016/J.COPBIO.2007.04.010 *
SNIBSON ET AL., JOURNAL OF THE BRITISH SOCIETY FOR ALLERGY AND CLINICAL IMMUNOLOGY, vol. 35, no. 2, 2005, pages 146 - 52
SOLOMAN B., CURR ALZHEIMER RES., vol. 1, 2004, pages 149
STEINMAN L ET AL., TRENDS IMMUNOL., vol. 26, no. 11, 2005, pages 565 - 71
STREJAN ET AL., J NEUROIMMUNOL., vol. 7, 1984, pages 27
TARA KARNEZIS ET AL., NATURE NEUROSCIENCE, vol. 7, 2004, pages 736
THORPE ET AL.: "Monoclonal Antibodies '84: Biological And Clinical Applications", 1985, article "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review", pages: 475 - 506
THORPE ET AL.: "The Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates", IMMUNOL. REV., vol. 62, 1982, pages 119 - 58, XP001179872, DOI: doi:10.1111/j.1600-065X.1982.tb00392.x
TRAIL, P.A. ET AL., CANCER IMMUNOL. IMMUNOTHER., vol. 52, 2003, pages 328 - 337
TUOHY V K ET AL., J EXP MED., vol. 189, no. 7, 1999, pages 1033 - 42
UMEZAWA ET AL., BIOCHEM. BIOPHYS. RES. COMMUN., vol. 153, 1988, pages 1038
VALLETTE ET AL., NUC. ACIDS RES., vol. 17, 1989, pages 723 - 733
WARD ET AL., NATURE, vol. 341, 1989, pages 544 - 546
WATANABE, J. BIOL. CHEM., vol. 265, 1990, pages 15659
WEINTRAUB, B.: "Principles of Radioimmunoassays, Seventh Training Course on Radioligand Assay Techniques", THE ENDOCRINE SOCIETY, March 1986 (1986-03-01)
WELLS ET AL., GENE, vol. 34, 1985, pages 315 - 323
WILLIAM L. KLEIN, NEUROCHEM INT., vol. 41, 2002, pages 345
WINNACKER: "From Genes to Clones", 1987, VCH PUBLISHERS
ZAPATA ET AL., PROTEIN ENG., vol. 8, no. 10, 1995, pages 1057 - 1062

Cited By (88)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9328157B2 (en) 2003-12-05 2016-05-03 Bristol-Myers Squibb Company Inhibitors of type 2 vascular endothelial growth factor receptors
US9862758B2 (en) 2003-12-05 2018-01-09 Bristol-Myers Quibb Company Inhibitors of type 2 vascular endothelial growth factor receptors
US10995131B2 (en) 2003-12-05 2021-05-04 Bristol-Myers Squibb Company Libraries of modified fibronectin type III tenth domain-containing polypeptides
US11149077B2 (en) 2006-11-22 2021-10-19 Bristol-Myers Squibb Company Targeted therapeutics based on engineered proteins for tyrosine kinases receptors, including IGF-IR
US10221232B2 (en) 2006-11-22 2019-03-05 Bristol-Myers Squibb Company Methods of treating cancer by administering IGF-IR binding molecules
US10781247B2 (en) 2008-02-14 2020-09-22 Bristol-Myers Squibb Company Targeted therapeutics based on engineered proteins that bind EGFR
US9234028B2 (en) 2008-02-14 2016-01-12 Bristol-Myers Squibb Company Targeted therapeutics based on engineered proteins that bind EGFR
US9920108B2 (en) 2008-02-14 2018-03-20 Bristol-Myers Squibb Company Targeted therapeutics based on engineered proteins that bind EGFR
US9902762B2 (en) 2008-05-22 2018-02-27 Bristol-Myers Squibb Company Multivalent fibronectin based scaffold domain proteins
US10774130B2 (en) 2008-05-22 2020-09-15 Bristol-Myers Squibb Company Method of treating cancer by administering multivalent fibronectin based scaffold domain proteins
US8728483B2 (en) 2008-05-22 2014-05-20 Bristol-Myers Squibb Company Multivalent fibronectin based scaffold domain proteins
US9771411B2 (en) 2008-11-24 2017-09-26 Bristol-Myers Squibb Company Method of treating cancer by administering EGFR and EGFR/IGFIR binding molecules
US10183987B2 (en) 2008-11-24 2019-01-22 Bristol-Myers Squibb Company Polynucleotides encoding bispecific EGFR/IGF-IR binding molecules
US10954286B2 (en) 2008-11-24 2021-03-23 Bristol-Myers Squibb Company Bispecific EGFR/IGFIR binding molecules
US9017655B2 (en) 2008-11-24 2015-04-28 Bristol-Myers Squibb Company Bispecific EGFR/IGFIR binding molecules
US10934572B2 (en) 2010-05-03 2021-03-02 Bristol-Myers Squibb Company Serum albumin binding molecules
US8969289B2 (en) 2010-05-03 2015-03-03 Bristol-Myers Squibb Company Serum albumin binding molecules
US9540424B2 (en) 2010-05-03 2017-01-10 Bristol-Myers Squibb Company Serum albumin binding molecules
US10221438B2 (en) 2010-05-03 2019-03-05 Bristol-Myers Squibb Company Serum albumin binding molecules
US11161893B2 (en) 2010-05-26 2021-11-02 Bristol-Myers Squibb Company Fibronectin based scaffold proteins having improved stability
US9562089B2 (en) 2010-05-26 2017-02-07 Bristol-Myers Squibb Company Fibronectin based scaffold proteins having improved stability
US10273286B2 (en) 2010-05-26 2019-04-30 Bristol-Myers Squibb Company Fibronectin based scaffold proteins having improved stability
US9469676B2 (en) 2011-04-13 2016-10-18 Bristol-Myers Squibb Company Fc fusion proteins comprising novel linkers or arrangements
US10214579B2 (en) 2011-04-13 2019-02-26 Bristol-Myers Squibb Company Fc fusion proteins comprising novel linkers or arrangements
WO2012158739A1 (en) 2011-05-17 2012-11-22 Bristol-Myers Squibb Company Improved methods for the selection of binding proteins
US10898538B2 (en) 2011-05-17 2021-01-26 Bristol-Myers Squibb Company Methods for maintaining pegylation of polypeptides
US11913137B2 (en) 2011-05-17 2024-02-27 Bristol-Myers Squibb Company Methods for the selection of binding proteins
US11060085B2 (en) 2011-05-17 2021-07-13 Bristol-Myers Squibb Company Methods for the selection of binding proteins
US10150962B2 (en) 2011-05-17 2018-12-11 Bristol-Myers Squibb Company Methods for the selection of binding proteins
EP3318880A1 (en) 2011-05-17 2018-05-09 Bristol-Myers Squibb Company Improved methods for the selection of binding proteins
US9347058B2 (en) 2011-05-17 2016-05-24 Bristol-Myers Squibb Company Methods for the selection of binding proteins
WO2012158678A1 (en) 2011-05-17 2012-11-22 Bristol-Myers Squibb Company Methods for maintaining pegylation of polypeptides
US11104720B2 (en) 2011-10-11 2021-08-31 Viela Bio, Inc. Nucleic acids encoding a Tn3 scaffold comprising a CD40L-specific monomer subunit
US11555062B2 (en) 2011-10-11 2023-01-17 Viela Bio, Inc. Methods of administering a composition comprising a Tn3 scaffold and a CD40L-specific monomer
US10000553B2 (en) 2011-10-11 2018-06-19 Viela Bio, Inc. CD40L-specific TN3-derived scaffolds and methods of use thereof
RU2826189C2 (en) * 2011-10-11 2024-09-05 Виела Байо, Инк. CD40L-SPECIFIC FRAMEWORK STRUCTURES DERIVED FROM Tn3, AND METHODS OF USE THEREOF
WO2013055745A3 (en) * 2011-10-11 2013-08-01 Medimmune, Llc Cd40l-specific tn3-derived scaffolds and methods of use thereof
CN108948196A (en) * 2011-10-11 2018-12-07 米迪缪尼有限公司 Bracket and its application method derived from CD40L- specificity T N3-
RU2704992C2 (en) * 2011-10-11 2019-11-01 МЕДИММЬЮН, ЭлЭлСи CD40L-SPECIFIC CARCASS STRUCTURES DERIVED FROM Tn3, AND METHODS FOR USE THEREOF
US9416170B2 (en) 2011-10-31 2016-08-16 Bristol-Myers Squibb Company Fibronectin binding domains with reduced immunogenicity
WO2013067029A3 (en) * 2011-10-31 2013-08-15 Bristol-Myers Squibb Company Fibronectin binding domains with reduced immunogenicity
CN104053670A (en) * 2011-10-31 2014-09-17 百时美施贵宝公司 Fibronectin binding domains with reduced immunogenicity
US9522951B2 (en) 2011-10-31 2016-12-20 Bristol-Myers Squibb Company Fibronectin binding domains with reduced immunogenicity
US10604556B2 (en) 2011-10-31 2020-03-31 Bristol-Myers Squibb Company Fibronectin binding domains with reduced immunogenicity
US9765132B2 (en) 2011-10-31 2017-09-19 Bristol-Myers Squibb Company Fibronectin binding domains with reduced immunogenicity
US11279751B2 (en) 2011-10-31 2022-03-22 Bristol-Myers Squibb Company Fibronectin binding domains with reduced immunogenicity
US10464995B2 (en) 2011-10-31 2019-11-05 Bristol-Myers Squibb Company Fibronectin binding domains with reduced immunogenicity
US11408093B2 (en) 2011-10-31 2022-08-09 Bristol-Myers Squibb Company Fibronectin binding domains with reduced immunogenicity
US11813315B2 (en) 2012-09-13 2023-11-14 Bristol-Myers Squibb Company Fibronectin based scaffold domain proteins that bind to myostatin
US10406212B2 (en) 2012-09-13 2019-09-10 Bristol-Myers Squibb Company Fibronectin based scaffold domain proteins that bind to myostatin
US8993265B2 (en) 2012-09-13 2015-03-31 Bristol-Myers Squibb Company Fibronectin based scaffold domain proteins that bind to myostatin
US10245302B2 (en) 2012-09-13 2019-04-02 Bristol-Myers Squibb Company Fibronectin based scaffold domain proteins that bind to myostatin
US9493546B2 (en) 2012-09-13 2016-11-15 Bristol-Myers Squibb Company Fibronectin based scaffold domain proteins that bind to myostatin
US9662373B2 (en) 2012-09-13 2017-05-30 Bristol-Myers Squibb Company Fibronectin based scaffold domain proteins that bind to myostatin
US8853154B2 (en) 2012-09-13 2014-10-07 Bristol-Myers Squibb Company Fibronectin based scaffold domain proteins that bind to myostatin
US8933199B2 (en) 2012-09-13 2015-01-13 Bristol-Myers Squibb Company Fibronectin based scaffold domain proteins that bind to myostatin
US11447538B2 (en) 2013-02-01 2022-09-20 Bristol-Myers Squibb Company Fibronectin based scaffold proteins
US10787498B2 (en) 2013-02-06 2020-09-29 Bristol-Myers Squibb Company Fibronectin type III domain proteins with enhanced solubility
US11512124B2 (en) 2013-02-06 2022-11-29 Bristol-Myers Squibb Company Fibronectin type III domain proteins with enhanced solubility
EP3617220A1 (en) 2013-02-12 2020-03-04 Bristol-Myers Squibb Company High ph protein refolding methods
EP3744728A1 (en) 2013-02-12 2020-12-02 Bristol-Myers Squibb Company Tangential flow filtration based protein refolding methods
US10065987B2 (en) 2013-02-12 2018-09-04 Bristol-Myers Squibb Company High pH protein refolding methods
US10183967B2 (en) 2013-02-12 2019-01-22 Bristol-Myers Squibb Company Tangential flow filtration based protein refolding methods
US11053278B2 (en) 2013-02-12 2021-07-06 Bristol-Myers Squibb Company Tangential flow filtration based protein refolding methods
EP3299378A1 (en) 2013-02-12 2018-03-28 Bristol-Myers Squibb Company High ph protein refolding methods
WO2014126871A1 (en) 2013-02-12 2014-08-21 Bristol-Myers Squibb Company Tangential flow filtration based protein refolding methods
US11345722B2 (en) 2013-02-12 2022-05-31 Bristol-Myers Squibb Company High pH protein refolding methods
WO2014126884A1 (en) 2013-02-12 2014-08-21 Bristol-Myers Squibb Company High ph protein refolding methods
WO2014165093A2 (en) 2013-03-13 2014-10-09 Bristol-Myers Squibb Company Fibronectin based scaffold domains linked to serum albumin or a moiety binding thereto
EP3647322A1 (en) 2014-03-20 2020-05-06 Bristol-Myers Squibb Company Stabilized fibronectin based scaffold molecules
US10442851B2 (en) 2014-03-20 2019-10-15 Bristol-Myers Squibb Company Serum albumin-binding fibronectin type III domains
WO2015143156A1 (en) 2014-03-20 2015-09-24 Bristol-Myers Squibb Company Stabilized fibronectin based scaffold molecules
US11203630B2 (en) 2014-03-20 2021-12-21 Bristol-Myers Squibb Company Serum albumin-binding fibronectin type III domains
US11407815B2 (en) 2014-03-20 2022-08-09 Bristol-Myers Squibb Company Stabilized fibronectin based scaffold molecules
US10450363B2 (en) 2014-03-20 2019-10-22 Bristol-Myers Squibb Company Stabilized fibronectin based scaffold molecules
WO2016086036A2 (en) 2014-11-25 2016-06-02 Bristol-Myers Squibb Company Methods and compositions for 18f-radiolabeling of biologics
EP4218832A2 (en) 2014-11-25 2023-08-02 Bristol-Myers Squibb Company Methods and compositions for 18f-radiolabeling of the fibronectin type (iii) domain
US11434275B2 (en) 2015-09-23 2022-09-06 Bristol-Myers Squibb Company Fast-off rate serum albumin binding fibronectin type III domains
US10766946B2 (en) 2015-09-23 2020-09-08 Bristol-Myers Squibb Company Fast-off rate serum albumin binding fibronectin type III domains
WO2017210335A1 (en) 2016-06-01 2017-12-07 Bristol-Myers Squibb Company Imaging methods using 18f-radiolabeled biologics
IL270233B1 (en) * 2017-05-03 2023-10-01 Bristol Myers Squibb Co Stable formulations of fibronectin based scaffold domain proteins that bind to myostatin
IL270233B2 (en) * 2017-05-03 2024-02-01 Bristol Myers Squibb Co Stable formulations of fibronectin based scaffold domain proteins that bind to myostatin
WO2018204617A1 (en) * 2017-05-03 2018-11-08 Bristol-Myers Squibb Company Stable formulations of fibronectin based scaffold domain proteins that bind to myostatin
AU2018261154B2 (en) * 2017-05-03 2024-05-02 Bristol-Myers Squibb Company Stable formulations of fibronectin based scaffold domain proteins that bind to myostatin
CN110621302A (en) * 2017-05-03 2019-12-27 百时美施贵宝公司 Stable formulations of fibronectin based scaffold domain proteins that bind myostatin
WO2021174045A1 (en) 2020-02-28 2021-09-02 Bristol-Myers Squibb Company Radiolabeled fibronectin based scaffolds and antibodies and theranostic uses thereof
CN117143224A (en) * 2023-10-26 2023-12-01 广州暨南大学医药生物技术研究开发中心有限公司 Recombinant human fibronectin truncated peptide and preparation method and application thereof
CN117143224B (en) * 2023-10-26 2024-01-30 广州暨南大学医药生物技术研究开发中心有限公司 Recombinant human fibronectin truncated peptide and preparation method and application thereof

Similar Documents

Publication Publication Date Title
WO2011051466A1 (en) Anti-idiotypic fibronectin-based binding molecules and uses thereof
US20230220080A1 (en) Fabs-in-tandem immunoglobulin and uses thereof
US10266608B2 (en) Fabs-in-tandem immunoglobulin and uses thereof
US20170218091A1 (en) Monovalent binding proteins
WO2017011342A1 (en) Igm-or-ige-modified binding proteins and uses thereof
US20130115215A1 (en) Domain insertion immunoglobulin
US9856319B2 (en) Monovalent binding proteins
EP3512875A2 (en) Multimers, tetramers&octamers
CN106471117A (en) Produce heteromultimeric albumen using mammalian cell
CN110248958A (en) Polymer, the tetramer and eight aggressiveness

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10771753

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10771753

Country of ref document: EP

Kind code of ref document: A1