WO2011050319A2 - Inhibiting the deleterious effect of anthracyclines - Google Patents
Inhibiting the deleterious effect of anthracyclines Download PDFInfo
- Publication number
- WO2011050319A2 WO2011050319A2 PCT/US2010/053842 US2010053842W WO2011050319A2 WO 2011050319 A2 WO2011050319 A2 WO 2011050319A2 US 2010053842 W US2010053842 W US 2010053842W WO 2011050319 A2 WO2011050319 A2 WO 2011050319A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- zak
- anthracycline
- inhibitor
- subject
- cancer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
- A61K31/4164—1,3-Diazoles
- A61K31/4178—1,3-Diazoles not condensed 1,3-diazoles and containing further heterocyclic rings, e.g. pilocarpine, nitrofurantoin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
- A61K31/4406—Non condensed pyridines; Hydrogenated derivatives thereof only substituted in position 3, e.g. zimeldine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/506—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
Definitions
- This application relates to methods that can be used to inhibit or treat deleterious effects of anthracycline administration (such as cardiomyopathy), as well as compositions and kits that can be used for such methods.
- anthracycline administration such as cardiomyopathy
- Anthracyclines are a class of drugs used in cancer chemotherapy to treat a wide range of cancers, including hematologic and solid tumors, such as leukemias, lymphomas, breast, uterine, ovarian, bladder, and lung cancers.
- anthracyclines can cause considerable deleterious side effects.
- patients receiving doxorubicin frequently present with acute side effects such as fatigue, nausea/vomiting, pain, sleep disturbances, cachexia and depression.
- patients may develop cardiomyopathy, which can lead to life-threatening congestive heart failure. Cardiomyopathy frequently correlates with the total amount of administered drug.
- anthracyclines Several mechanisms for the chemotherapeutic actions of anthracyclines have been proposed, including: (a) intercalation into DNA, leading to inhibition of macromolecular synthesis; (b) generation of reactive oxygen species (ROS), leading to DNA damage or lipid peroxidation; and (c) inhibition of topoisomerase II, followed by DNA damage.
- ROS reactive oxygen species
- Anthracycline-mediated apoptotic cell death is likely a response to one or more of these upstream actions.
- anthracyclines have proven effective in the treatment of cancers, the clinical efficacy of these compounds is limited by both acute and chronic complications. For example, production of oxygen radicals has been proposed for anthracycline -mediated cardiotoxicity.
- daunorubicin epirubicin, idarubicin, valrubicin, aclarubicin, amrubicin, pirarubicin and zorubicin. Therefore, methods are needed for reducing these side effects.
- Methods are provided for inhibiting or treating cardiomyopathy (such as anthracyc line-induced cardiomyopathy) in subjects previously treated with, being treated with or soon to be treated with an anthracycline.
- the method includes selecting a subject previously treated with, being treated with or soon to be treated with the anthracycline and administering to the subject a therapeutically effective amount of an inhibitor of zipper sterile-alpha- motif kinase (ZAK) activity, thereby treating or inhibiting the cardiomyopathy in the subject.
- ZAK zipper sterile-alpha- motif kinase
- Methods are also provided for increasing the tolerable amount of an anthracycline that a subject can receive, by inhibiting or treating the cardiotoxic effects of the anthracycline.
- the method includes selecting a subject for treatment with or being treated with the anthracycline and administering to the subject a therapeutically effective amount of an inhibitor of ZAK activity, thereby increasing a subject's tolerable amount of an anthracycline by inhibiting or treating the cardiotoxic effects of the anthracycline.
- the method includes selecting a subject with a cancer that responds to toxic doses of an anthracycline and co-administering to the subject a dose of anthracycline that is considered cardiotoxic to the subject and a therapeutically effective amount of an inhibitor of ZAK activity sufficient to counteract the cardiotoxic effects of the anthracycline, thereby treating or inhibiting the cancer in subject with a cancer that responds to cardiotoxic doses of an anthracycline, without the cardiotoxic effects of the anthracycline.
- Exemplary cancers that can be treated with these methods include leukemia (such as acute myelogenous leukemia or chronic myelogenous leukemia), bladder cancer, breast cancer, stomach cancer, lung cancer, ovarian cancer, thyroid cancer, soft tissue sarcoma, multiple myeloma, Bacille Calmette-Guerin (BCG)-refractory carcinoma in situ, neuroblastoma, gastric cancer or lymphoma (such as Hodgkin's lymphoma).
- leukemia such as acute myelogenous leukemia or chronic myelogenous leukemia
- bladder cancer such as breast cancer, stomach cancer, lung cancer, ovarian cancer, thyroid cancer, soft tissue sarcoma, multiple myeloma, Bacille Calmette-Guerin (BCG)-refractory carcinoma in situ, neuroblastoma, gastric cancer or lymphoma (such as Hodgkin's lymphoma).
- BCG Bacille Calmette-Guerin
- compositions that include both a therapeutically effective amount of an inhibitor of ZAK activity and a therapeutically effective amount of an anthracycline.
- Such compositions can also include pharmaceutically acceptable carriers, such as those suitable for intravenous (iv) administration.
- kits that include both an inhibitor of ZAK activity and an anthracycline, for example in a single container or in separate containers.
- anthracyclines that can be used with the disclosed methods, compositions, and kits include doxorubicin, daunorubicin, epirubicin, idarubicin, valrubicin, aclarubicin, amrubicin, pirarubicin and zorubicin or combinations thereof.
- Exemplary inhibitors of ZAK activity that can be used with the disclosed methods, compositions, and kits include small molecule inhibitors of ZAK activity (such as one or more of sorafenib, imatinib, gefinitib, lapatinib, dasatinib, nilotinib, temsirolimus, erlotinib, AST-487 or DHP-2), an inhibitory RNA that inhibits the expression of ZAK protein, or an antibody that specifically binds ZAK.
- small molecule inhibitors of ZAK activity such as one or more of sorafenib, imatinib, gefinitib, lapatinib, dasatinib, nilotinib, temsirolimus, erlotinib, AST-487 or DHP-2
- an inhibitory RNA that inhibits the expression of ZAK protein
- an antibody that specifically binds ZAK such as one or more of sorafenib, imatini
- FIGS. 1A-1D are digital images of Western blots, cells and a graph showing the effect of ZAK knockdown on doxorubicin-induced apoptosis, activation of SAPKs, and inhibition of protein synthesis.
- FIG. 1A is an electronic image of Western blots of HaCaT cells that were exposed to leucine zipper containing kinase ZAK (ZAK)-specific siRNA (zak) or scrambled siRNA (scr) prior to treatment for 24 hours with vehicle or doxorubicin (5, 25 or 50 ⁇ ), using the methods as described in EXAMPLE 9. Lysates were collected and subjected to SDS-PAGE followed by western blot analysis with the antibodies indicated.
- FIG. 1A is an electronic image of Western blots of HaCaT cells that were exposed to leucine zipper containing kinase ZAK (ZAK)-specific siRNA (zak) or scrambled siRNA (scr) prior to treatment for 24 hours with
- IB is an electronic image of HaCaT cells grown on glass coverslips that were exposed to scrambled siRNA (i and iii) or ZAK-specific siRNA (ii and iv) prior to treatment for 24 hours with vehicle (i and ii) or 25 ⁇ doxorubicin (iii and iv). Cells were exposed to bisbenzimide to examine fluorescent nuclear staining as described in EXAMPLE 9.
- FIG. 1C is an electronic image of Western blots of HaCaT cells that were exposed to scrambled siRNA (scr) or ZAK-specific siRNA (zak) sequence #1 from FIG. 1A or sequence #2 prior to treatment for 24 hours with vehicle or 25 ⁇ doxorubicin, as described in EXAMPLE 9.
- FIG. ID is a graph of the results of HaCaT cells that were treated in triplicate for 6, 12 or 24 hours with either vehicle or 1, 2.5, 10 or 25 ⁇ of doxorubicin. Cells were pulse-labeled with [ 3 H] -leucine for the final 30 minutes of treatment.
- FIGS. 2A-2C are electronic images of Western blots and a graph showing the inhibition of doxorubicin-induced activation of SAPKs by pretreatment with emetine.
- FIG. 2A is an electronic image of a Western blot of HaCaT cells that were pretreated with vehicle (ii) or emetine (100 ⁇ g/mL; i and iii) for 30 minutes prior to stimulation with doxorubicin (0.5 mM; ii and iii) for 15, 30, 60 or 120 minutes. Lysates were collected and submitted to SDS-PAGE, followed by Western blot analysis with the antibodies as indicated.
- FIG. 2B is a graph of the results of HaCaT cells that were treated in triplicate for 1, 2, 3 or 4 hours with vehicle or 0.5 mM doxorubicin. Cells were pulse-labeled with [ 3 H]-leucine for the final 30 minutes of treatment.
- FIG. 2C is an electronic image of a Western blot of HaCaT cells that were pretreated with vehicle (ii) or emetine (100 ⁇ g/mL; i and iii) for 30 minutes prior to stimulation as indicated with CdC12 (100 ⁇ ; ii and iii) for 15, 30, 60 or 120 minutes. Lysates were collected and subjected to SDS-PAGE, followed by Western blot analysis with the antibodies as indicated.
- FIGS. 3A-3C are electronic images of Western blots showing the effect of inhibitors on doxorubicin- and daunorubicin-induced apoptosis and activation of SAPKs.
- HaCaT cells were pretreated for 30 minutes with vehicle or inhibitors.
- FIG. 3A is an electronic image of a Western blot of HaCaT cells pretreated with vehicle (C), sorafenib (S; 1 ⁇ ), or nilotinib (N; 1 ⁇ ) for 30 minutes, followed by treatment with doxorubicin (10 or 25 ⁇ ) for 24 hours.
- C vehicle
- S sorafenib
- N nilotinib
- FIG. 3B is an electronic image of a Western blot of HaCaT cells pretreated with vehicle (C), sorafenib (S; 1 ⁇ ), or nilotinib (N; 1 ⁇ ) for 30 minutes, followed by treatment with daunorubicin (2.5, 10 or 25 ⁇ ) for 24 h.
- FIG. 3C is an electronic image of a Western blot of HaCaT cells pretreated with vehicle (C), SB 203580 (SB; 10 ⁇ ), SP 600125 (SP; 20 ⁇ ), both (SB SP), or zVAD-fmk (Z; 25 ⁇ ) for 30 minutes, followed by treatment with doxorubicin (25 ⁇ ) for 24 hours.
- FIGS. 4A and 4B are digital images of Western bots showing the effect of ZAK knockdown, sorafenib or nilotinib on doxorubicin- induced apoptosis in HeLa cells. Following exposure to 10 or 25 ⁇ doxorubicin, HeLa cell lysates were collected and subjected to SDS-PAGE, followed by Western blot analysis with the antibodies as indicated.
- FIG. 4A is a digital image of a Western blot of cells pretreated with vehicle (C), sorafenib (S; 1 ⁇ ), or nilotinib (N; 1 ⁇ ) for 30 minutes, followed by treatment with doxorubicin for 24 hours.
- FIG. 4B is a digital image of a Western blot of cells that were exposed to scrambled siRNA (scr) or ZAK- specific siRNA (zak) as described in EXAMPLE 9, followed by treatment for 24 hours with vehicle or doxorubicin.
- scr scrambled siRNA
- zak ZAK- specific siRNA
- FIGS. 5A-5D are digital images of Western blots showing the effect of inhibition of ZAK, p38 MAPK or JNK on doxorubicin induced degradation or modification of ZAK.
- FIG. 5A is a digital image of a Western blot of HaCaT cells that were exposed to 25 ⁇ doxorubicin and were harvested at 4 hour intervals. Lysates were subjected to SDS-PAGE, followed by Western blot analysis with the antibodies as indicated.
- FIG. 5B is a digital image of a Western blot of HaCaT cells that were exposed to 25 ⁇ doxorubicin. Eight hours later, 5 ⁇ MG-132 or vehicle was added to the corresponding wells.
- FIG. 5C is a digital image of a Western blot analysis with ZAK antibody on cell lysates from FIG. 3A.
- FIG. 5D is a digital image of a Western blot analysis with ZAK antibody on cell lysates from FIG. 3C.
- sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand.
- sequence Listing is submitted as an ASCII text file entitled Sequence_Listing.txt with size 12,056 bytes and created on October 20, 2010, which is incorporated by reference herein.
- SEQ ID NO: 1 is an exemplary human ZAK nucleic acid sequence.
- SEQ ID NO: 2 is an exemplary human ZAK amino acid sequence.
- SEQ ID NOS: 3-6 are exemplary ZAK shRNAs that can be used in the methods disclosed herein.
- SEQ ID NOS: 7-9 are exemplary ZAK siRNAs that can be used in the methods disclosed herein.
- SEQ ID NO: 10 is an exemplary control siRNA.
- an inhibitor includes single or plural inhibitors and can be considered equivalent to the phrase “at least one inhibitor.”
- the term “comprises” means “includes.”
- “comprising an inhibitor” means “including an inhibitor” without excluding other elements.
- Administer To provide or give a subject an agent, such as an anthracycline or an inhibitor of ZAK activity, by any effective route.
- An exemplary route of administration includes, but is not limited to, injection (such as subcutaneous, intramuscular, intradermal, intraperitoneal, intravenous (iv) or intra-arterial), transdermal, topical, parenteral, oral, nasal, or inhalation, among others.
- Anthracycline A class of drugs used in cancer chemotherapy derived from
- Streptomyces bacteria such as Streptomyces peucetius var. caesius. These compounds are commonly used to treat a wide range of cancers, including leukemias, lymphomas, and breast, uterine, ovarian, bladder, and lung cancers. However, these compounds can cause heart damage (cardiotoxicity), which limits their usefulness considerably.
- anthracyclines include but are not limited to: daunorubicin ((8S,10S)-8-acetyl-10-[(2S,4S,5S,6S)-4-amino-5-hydroxy-6-methyl-oxan-2-yl]oxy- 6,8,1 l-trihydroxy-l-methoxy-9,10-dihydro-7H-tetracene-5,12-dione; CAS Number 20830-81-3); doxorubicin ((8S,10S)-10-(4-amino-5-hydroxy-6-methyl-tetrahydro-2H- pyran-2-yloxy)-6,8,l l-trihydroxy-8-(2-hydroxyacetyl)-l-methoxy-7,8,9,10- tetrahydrotetracene-5,12-dione; CAS Number 23214-92-8); epirubicin (10-(4-amino- 5-hydroxy-6-methyl-oxan-2-yl) oxy
- idarubicin ((15,35)-3-acetyl-3,5,12-trihydroxy-6,l l-dioxo-l ,2,3,4,6,l l- hexahydrotetracen-l-yl 3-amino-2,3,6-trideoxo-a-L-/_yxo-hexopyranoside; CAS Number 58957-92-9); valrubicin (2-oxo-2-[(25',45')-2,5,12-trihydroxy-7-methoxy- 6,l l-dioxo-4-( ⁇ 2,3,6-trideoxy-3-[(trifluoroacetyl)amino]hexopyranosyl ⁇ oxy)- 1 ,2,3,4,6,1 l-hexahydrotetracen-2-yl]ethyl pentanoate; CAS Number 56124-62-0), aclarubicin (Methyl (lR,2 ?,45)-4
- Antibody A polypeptide ligand including at least a light chain or heavy chain immunoglobulin variable region, which specifically binds an epitope of an antigen (for example, a ZAK epitope).
- an antigen for example, a ZAK epitope.
- the term “specifically binds” refers to, with respect to an antigen, the preferential association of an antibody or other ligand, in whole or part, with this polypeptide, such as ZAK.
- a specific binding agent, such as an antibody binds substantially only to a defined target. It is recognized that a minor degree of non-specific interaction may occur between a molecule, such as a specific binding agent, and a non-target polypeptide. Nevertheless, specific binding can be distinguished as mediated through specific recognition of the antigen.
- selectively reactive antibodies bind antigen, they can do so with low affinity. Specific binding typically results in greater than 2-fold, such as greater than 5 -fold, greater than 10-fold, or greater than 100-fold increase in amount of bound antibody or other ligand (per unit time) to a polypeptide, as compared to a non-target polypeptide.
- immunoassay formats are appropriate for selecting antibodies specifically immunoreactive with a particular protein.
- solid-phase ELISA immunoassays are routinely used to select monoclonal antibodies specifically immunoreactive with a protein. See Harlow & Lane, Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New York (1988), for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity.
- Antibodies can be composed of a heavy and a light chain, each of which has a variable region, termed the variable heavy (VH) region and the variable light (VL) region. Together, the VH region and the VL region are responsible for binding the antigen recognized by the antibody.
- VH variable heavy
- VL variable light
- a scFv protein is a fusion protein in which a light chain variable region of an immunoglobulin and a heavy chain variable region of an immunoglobulin are bound by a linker, while in dsFvs, the chains have been mutated to introduce a disulfide bond to stabilize the association of the chains.
- the term also includes recombinant forms such as chimeric antibodies (for example, humanized murine antibodies), heteroconjugate antibodies (such as, bispecific antibodies). See also, Pierce Catalog and Handbook, 1994-1995 (Pierce Chemical Co., Rockford, IL); Kuby, Immunology, 3rd Ed., W.H. Freeman & Co., New York, 1997.
- a “monoclonal antibody” is an antibody produced by a single clone of B -lymphocytes or by a cell into which the light and heavy chain genes of a single antibody have been transfected.
- Monoclonal antibodies are produced by methods known to those of skill in the art, for instance by making hybrid antibody-forming cells from a fusion of myeloma cells with immune spleen cells. These fused cells and their progeny are termed "hybridomas.”
- Monoclonal antibodies include humanized monoclonal antibodies.
- Double- stranded DNA has two strands, a 5' -> 3' strand, referred to as the plus strand, and a 3' -> 5' strand (the reverse complement), referred to as the minus strand. Because RNA polymerase adds nucleic acids in a 5' -> 3' direction, the minus strand of the DNA serves as the template for the RNA during transcription. Thus, the RNA formed will have a sequence complementary to the minus strand and identical to the plus strand (except that U is substituted for T).
- Antisense molecules are molecules that are specifically hybridizable or specifically complementary to either RNA or the plus strand of DNA.
- Sense molecules are molecules that are specifically hybridizable or specifically complementary to the minus strand of DNA.
- Antigene molecules are either antisense or sense molecules directed to a dsDNA target.
- an antisense molecule is designed to target (for example to repress the expression) ZAK, for example using the nucleic acid sequences of ZAK set forth in the accompanying sequence listing or that are publically available (for example from GenBank or EMBL).
- Binding or stable binding (of an oligonucleotide): An oligonucleotide binds or stably binds to a target nucleic acid if a sufficient amount of the oligonucleotide forms base pairs or is hybridized to its target nucleic acid, to permit detection of that binding, for example the binding of an oligonucleotide to the nucleic acid sequence of ZAK, for example an inhibitory RNA of ZAK.
- Binding can be detected by either physical or functional properties of the target:oligonucleotide complex. Binding between a target and an oligonucleotide can be detected by any procedure known to one skilled in the art, including both functional and physical binding assays.
- Physical methods of detecting the binding of complementary strands of DNA or RNA are well known in the art, and include such methods as DNase I or chemical footprinting, gel shift and affinity cleavage assays, Northern blotting, dot blotting and light absorption detection procedures.
- one method that is widely used involves observing a change in light absorption of a solution containing an oligonucleotide (or an analog) and a target nucleic acid at 220 to 300 nm as the temperature is slowly increased. If the oligonucleotide or analog has bound to its target, there is a sudden increase in absorption at a characteristic temperature as the oligonucleotide (or analog) and target disassociate from each other, or melt.
- T m temperature at which 50% of the oligomer is melted from its target.
- T m temperature at which 50% of the oligomer is melted from its target.
- T m temperature at which 50% of the oligomer is melted from its target.
- T m temperature at which 50% of the oligomer is melted from its target.
- T m temperature at which 50% of the oligomer is melted from its target.
- T m temperature
- T m a higher (T m ) means a stronger or more stable complex relative to a complex with a lower (T m )- Cancer: A malignant tumor characterized by abnormal or uncontrolled cell growth. Other features often associated with cancer include metastasis, interference with the normal functioning of neighboring cells, release of cytokines or other secretory products at abnormal levels and suppression or aggravation of inflammatory or immunological response, invasion of surrounding or distant tissues or organs, such as lymph nodes, etc.
- Metalastatic disease refers to cancer cells that have left the original
- Cardiomyopathy Deterioration of the function of the myocardium, for example, due to treatment with an anthracycline. Subjects with cardiomyopathy can be at risk of arrhythmia and/or sudden cardiac death.
- Cardiotoxic An agent is cardiotoxic if when administered to a subject (for example at a therapeutic dose) causes damage to the heart muscle. The heart becomes weaker and is not as efficient in pumping and therefore circulating blood.
- Cardiotoxicity can be detected by EKG changes and arrhythmias, or as a
- Chemotherapy In cancer treatment, chemotherapy refers to the
- chemotherapeutic agents include any chemical agent with therapeutic usefulness in the treatment of cancer.
- chemotherapeutic agents include anthracyclines, such doxorubicin, daunorubicin, epirubicin, idarubicin, valrubicin, aclarubicin, amrubicin, pirarubicin and zorubicin.
- chemotherapeutic agents can be found for example in Slapak and Kufe, Principles of Cancer Therapy, Chapter 86 in Harrison's Principles of Internal Medicine, 14th edition; Perry et al , Chemotherapy, Ch. 17 in Abeloff, Clinical Oncology 2nd ed., 2000 Churchill Livingstone, Inc; Baltzer and Berkery. (eds):
- a chemotherapeutic agent of use in a subject can decrease a sign or a symptom of a cancer, or can reduce, stop or reverse the progression, metastasis and/or growth of a cancer, and/or can reduce tumor mass.
- Complementarity and percentage complementarity Molecules with complementary nucleic acids form a stable duplex or triplex when the strands bind, (hybridize), to each other by forming Watson-Crick, Hoogsteen or reverse Hoogsteen base pairs. Stable binding occurs when an oligonucleotide remains detectably bound to a target nucleic acid sequence under the required conditions.
- Complementarity is the degree to which bases in one nucleic acid strand base pair with the bases in a second nucleic acid strand. Complementarity is conveniently described by percentage, such as the proportion of nucleotides that form base pairs between two strands or within a specific region or domain of two strands. For example, if 10 nucleotides of a 15-nucleotide oligonucleotide form base pairs with a targeted region of a DNA molecule, that oligonucleotide is said to have 66.67% complementarity to the region of DNA targeted.
- an inhibitory RNA is complementary to a nucleic acid sequence of ZAK, such as SEQ ID NO: 1.
- Contacting Placement in direct physical association including both in solid or liquid form. Contacting can occur in vivo, for example by administering an agent to a subject.
- Administration is the introduction of a composition, such as a composition containing one or more of an inhibitor of an anthracycline activity and an inhibitor of ZAK activity, into a subject by a chosen route. For example, if the chosen route is intravenous, the composition is administered by introducing the composition into a vein of the subject.
- DNA deoxyribonucleic acid
- DNA is a long chain polymer that comprises the genetic material of most living organisms (some viruses have genes comprising ribonucleic acid (RNA)).
- the repeating units in DNA polymers are four different nucleotides, each of which comprises one of the four bases, adenine, guanine, cytosine and thymine bound to a deoxyribose sugar to which a phosphate group is attached.
- Triplets of nucleotides (referred to as codons) code for each amino acid in a polypeptide, or for a stop signal.
- codon is also used for the corresponding (and complementary) sequences of three nucleotides in the mRNA into which the DNA sequence is transcribed.
- any reference to a DNA molecule is intended to include the reverse complement of that DNA molecule. Except where single- strandedness is required by the text herein, DNA molecules, though written to depict only a single strand, encompass both strands of a double- stranded DNA molecule. Thus, a reference to the nucleic acid molecule that encodes ZAK, or a fragment thereof, encompasses both the sense strand and its reverse complement. Thus, for instance, it is appropriate to generate probes or primers from the reverse complement sequence of the disclosed nucleic acid molecules.
- nucleic acid consists of nitrogenous bases that are either pyrimidines (cytosine (C), uracil (U), and thymine (T)) or purines (adenine (A) and guanine (G)). These nitrogenous bases form hydrogen bonds between a pyrimidine and a purine, and the bonding of the pyrimidine to the purine is referred to as "base pairing.” More specifically, A will hydrogen bond to T or U, and G will bond to C.
- oligonucleotide refers to the base pairing that occurs between two distinct nucleic acid sequences or two distinct regions of the same nucleic acid sequence.
- an oligonucleotide can be complementary to a ZAK encoding mRNA, a ZAK encoding DNA, or a ZAK encoding dsDNA.
- oligonucleotide and “specifically complementary” are terms that indicate a sufficient degree of complementarity such that stable and specific binding occurs between the oligonucleotide (or it' s analog) and the DNA or RNA target.
- the oligonucleotide or oligonucleotide analog need not be 100% complementary to its target sequence to be specifically hybridizable.
- An oligonucleotide or analog is specifically hybridizable when binding of the oligonucleotide or analog to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA, and there is a sufficient degree of complementarity to avoid non-specific binding of the oligonucleotide or analog to non-target sequences under conditions where specific binding is desired, for example under physiological conditions in the case of in vivo assays or systems. Such binding is referred to as specific
- Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the hybridization method of choice and the composition and length of the hybridizing nucleic acid sequences. Generally, the temperature of hybridization and the ionic strength (especially the Na + concentration) of the hybridization buffer will determine the stringency of hybridization, though waste times also influence stringency. Calculations regarding hybridization conditions required for attaining particular degrees of stringency are discussed by Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989, chapters 9 and 11.
- Hybridization 5x SSC at 65°C for 16 hours
- Inhibiting or treating a disease Inhibiting the full development of a disease condition, for example, in a subject who is at risk for a disease such cancer, or cardiomyopathy.
- Treatment refers to a therapeutic intervention that ameliorates a sign or symptom of a disease or pathological condition after it has begun to develop.
- the term “ameliorating,” with reference to a disease or pathological condition, refers to any observable beneficial effect of the treatment.
- the beneficial effect can be evidenced, for example, by a delayed onset of clinical symptoms of the disease in a susceptible subject, a reduction in severity of some or all clinical symptoms of the disease, a slower progression of the disease, a reduction in the number of metastases, an improvement in the overall health or well-being of the subject, or by other clinical or physiological parameters associated with a particular disease.
- a "prophylactic" treatment is a treatment administered to a subject who does not exhibit signs of a disease or exhibits only early signs for the purpose of decreasing the risk of developing pathology.
- Inhibit To reduce to a measurable extent. For example to reduce enzymatic activity. In some examples, the kinase activity of a ZAK is inhibited. In some examples, the cardiotoxic effects of an anthracycline is inhibited.
- Kinase An enzyme that catalyzes the transfer of a phosphate group from one molecule to another. Kinases play a role in the regulation of cell proliferation, differentiation, metabolism, migration, and survival.
- a "tyrosine kinase” transfers phosphate groups to a hydroxyl group of a tyrosine in a polypeptide.
- a kinase is a ZAK.
- Receptor protein tyrosine kinases contain a single polypeptide chain with a transmembrane segment. The extracellular end of this segment contains a high affinity ligand-binding domain, while the cytoplasmic end comprises the catalytic core and the regulatory sequences.
- Non-receptor tyrosine kinases such as ZAK
- ZAK can be located in the cytoplasm as well as in the nucleus. They exhibit distinct kinase regulation, substrate phosphorylation, and function.
- a "preferential" inhibition of a kinase refers to decreasing activity of one kinase, such as ZAK, more than inhibiting the activity of a second kinase, such as a mitogen-activated protein kinase (MAPK) or another kinase.
- ZAK mitogen-activated protein kinase
- Oligonucleotide is a plurality of joined nucleotides joined by native phosphodiester bonds, between about 6 and about 300 nucleotides in length.
- An oligonucleotide analog refers to moieties that function similarly to oligonucleotides but have non-naturally occurring portions.
- oligonucleotide analogs can contain non-naturally occurring portions, such as altered sugar moieties or inter-sugar linkages, such as a phosphorothioate
- oligodeoxynucleotide oligodeoxynucleotide.
- Functional analogs of naturally occurring polynucleotides can bind to RNA or DNA, and include peptide nucleic acid (PNA) molecules.
- PNA peptide nucleic acid
- Particular oligonucleotides and oligonucleotide analogs can include linear sequences up to about 200 nucleotides in length, for example a sequence (such as ZAK DNA or RNA) that is at least 6 bases, for example at least 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100 or even 200 bases long, or from about 6 to about 50 bases, for example about 10-25 bases, such as 12, 15 or 20 bases.
- a sequence such as ZAK DNA or RNA
- compositions and formulations suitable for pharmaceutical delivery of the compositions disclosed herein such as compositions that include a ZAK inhibitor and/or anthracycline).
- parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle.
- pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle.
- physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like
- solid compositions such as powder, pill, tablet, or capsule forms
- conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate.
- compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
- non-toxic auxiliary substances such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
- Polypeptide Any chain of amino acids, regardless of length or post- translational modification (such as glycosylation, methylation, ubiquitination, phosphorylation, or the like).
- a polypeptide is a ZAK polypeptide.
- a polypeptide has an amino terminal (N-terminal) end and a carboxy terminal (C-terminal) end.
- Polypeptide is used interchangeably with peptide or protein, and is used to refer to a polymer of amino acid residues.
- a “residue” refers to an amino acid or amino acid mimetic incorporated in a polypeptide by an amide bond or amide bond mimetic.
- Sequence identity/similarity The identity/similarity between two or more nucleic acid sequences, or two or more amino acid sequences, is expressed in terms of the identity or similarity between the sequences. Sequence identity can be measured in terms of percentage identity; the higher the percentage, the more identical the sequences are. Homologs or orthologs of nucleic acid or amino acid sequences possess a relatively high degree of sequence identity/similarity when aligned using standard methods.
- BLAST Basic Local Alignment Search Tool
- NCBI National Center for Biological Information
- blastp blastn
- blastx blastx
- tblastn tblastx
- Additional information can be found at the NCBI web site.
- Homologs and variants of a ZAK protein are typically characterized by possession of at least 50% sequence identity counted over the full length alignment with the amino acid sequence of a native protein ⁇ e.g., SEQ ID NO: 2) using the
- NCBI Blast 2.0 gapped blastp set to default parameters.
- the Blast 2 sequences function is employed using the default BLOSUM62 matrix set to default parameters, (gap existence cost of 11, and a per residue gap cost of 1).
- the alignment should be performed using the Blast 2 sequences function, employing the PAM30 matrix set to default parameters (open gap 9, extension gap 1 penalties).
- Proteins with even greater similarity to the reference sequences will show increasing percentage identities when assessed by this method, such as at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 2.
- homologs and variants When less than the entire sequence is being compared for sequence identity, homologs and variants will typically possess at least 75% sequence identity over short windows of 10-20 amino acids, and may possess sequence identities of at least 85% or at least 90% at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% depending on their similarity to the reference sequence. Methods for determining sequence identity over such short windows are described at the NCBI website. One of skill in the art will appreciate that these sequence identity ranges are provided for guidance only; it is entirely possible that strongly significant homologs could be obtained that fall outside of the ranges provided.
- the number of matches is determined by counting the number of positions where an identical nucleotide or amino acid residue is present in both sequences.
- Subjects that can be treated using the methods provided herein include mammalian subjects, such as a veterinary (e.g., mice, dogs, cats, rabbits, monkeys) or human subject.
- Therapeutically effective amount The quantity of a composition, such as a ZAK inhibitor, sufficient to achieve a desired effect in a subject being treated. For instance, this can be the amount necessary to inhibit cardiomyopathy associated with anthracycline administration.
- a dosage When administered to a subject, a dosage will generally be used that will achieve target concentrations that have been shown to achieve in vitro and/or in vivo inhibition of or to measurably alter outward symptoms of a cardiac toxicity.
- Tolerable amount An amount of a theraputic agent, such as an
- anthracycline that can be administered to a subject without significant deleterious side effects.
- it can be an amount of an anthracycline administered to a subject having a tumor that is responsive to the anthracycline that is not cardiotoxic (e.g. , does not cause cardiomyopathy).
- ZAK Zipper sterile-alpha- motif kinase
- MLK7 mixed lineage kinase 7
- SAM sterile-alpha motif
- a ZAK nucleic acid sequence has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 1, and retains ZAK biological activity.
- a ZAK protein sequence has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 2, and retains ZAK biological activity.
- a "ZAK inhibitor” inhibits the signaling of ZAK protein, for example by inhibiting the kinase activity of ZAK.
- exemplary ZAK inhibitors are antibodies that specifically bind ZAK, siRNAs, shRNAs, ribozymes, antisense molecules, and small molecule kinase inhibitors, such as, sorafenib (4-[4-[[4-chloro-3- (trifluoromethyl)phenyl]carbamoylamino]phenoxy]-N-methyl-pyridine-2- carboxamide) (NEXAVAR®), imatinib (GLEEVEC®), gefinitib (IRESSA®), lapatinib (TYKERB®), dasatinib (SPRYCEL®), nilotinib (4-methyl-N-[3-(4-methyl- lH-imidazol-l-yl)- 5-(trifluoromethyl)phenyl]-3- [(4-pyridin-3-ylpyr
- ZAK is a MAP3K whose activation has been tied to stimulation of JNK and p38 MAPK.
- ZAK is uniquely required for transduction of signals that are generated by toxins and cellular stressors that act by perturbing the peptidyl transferase center of 28S rRNA, such as anthrocyclins.
- doxorubicin dependent phosphorylation could be inhibited by siRNA knockdown of ZAK demonstrating that inhibition of ZAK activity could be used to counteract the doxorubicin-induced activation of SAPKs and suppressed the doxorubicin-induced apoptosis that occurs in cardiomyopathy induced by anthrocyclin treatment, such as treatment with doxorubicin, daunorubicin, epirubicin, idarubicin, valrubicin, aclarubicin, amrubicin, pirarubicin and zorubicin.
- inactivation of ZAK by reduction of ZAK expression can be used to inhibit and/or treat anthrocyclin induced side effects, such as cardiomyopathy.
- ZAK inhibitors such as the small molecule kinase inhibitors sorafenib and nilotinib, were each as effective as siRNA-mediated ZAK knockdown, indicating that small molecule inhibitors of ZAK can be used to inhibit and/or treat anthrocyclin induced side effects, such as cardiomyopathy.
- compositions and kits that can be used for such methods.
- Methods of inhibiting or treating cardiomyopathy in a subject who has been treated, is being treated, or will soon be treated with an anthracycline are provided.
- the method includes selecting a subject who has been treated, is being treated, or will soon be treated with one or more anthracyclines. Examples of such subjects are those having or had a cancer that is responsive to anthracycline treatment.
- the method can further include administering a therapeutically effective amount of an inhibitor of ZAK activity to the selected subject, thereby treating or inhibiting the cardiomyopathy in the subject.
- the subject may have an anthracyc line-induced cardiomyopathy due to current or previous treatment with an anthracycline, or be a risk for developing anthracycline-induced cardiomyopathy due to expected subsequent treatment with anthracycline.
- daunorubicin hydrochloride 45 mg/m2/day iv on days 1 , 2, and 3 of the first course and on days 1, 2 of subsequent courses and cytosine arabinoside 100 mg/m2/day iv infusion daily for 7 days for the first course and for 5 days for subsequent courses.
- daunorubicin hydrochloride 45 mg/m2/day iv on days 1 , 2, and 3 of the first course and on days 1, 2 of subsequent courses
- cytosine arabinoside 100 mg/m2/day iv infusion daily for 7 days for the first course and for 5 days for subsequent courses.
- hydrochloride 30 mg/m2/day iv on days 1 , 2, and 3 of the first course and on days 1 , 2 of subsequent courses AND cytosine arabinoside 100 mg/m2/day iv infusion daily for 7 days for the first course and for 5 days for subsequent courses.
- daunorubicin hydrochloride 25 mg/m2 iv on day 1 every week, vincristine 1.5 mg/m2 iv on day 1 every week, prednisone 40 mg/m2 PO daily.
- the daunorubicin hydrochloride dosage calculation should be based on weight (1 mg/kg) instead of body surface area.
- daunorubicin hydrochloride 45 mg/m2/day iv on days 1 , 2, and 3 AND vincristine 2 mg iv on days 1, 8, and 15; prednisone 40 mg/m2/day PO on days 1 through 22, then tapered between days 22 to 29; L-asparaginase 500 IU/kg/day x 10 days iv on days 22 through 32.
- doses exceeding 550 mg/m2 there is an increased incidence of drug-induced congestive heart failure.
- Standard doses of doxorubicin include the following: doxorubicin at 60 to 75 mg/m2 as a single intravenous injection administered at 21 -day intervals.
- the lower dosage can be given to patients with inadequate marrow reserves due to old age, or prior therapy, or neoplastic marrow infiltration.
- the most commonly used dosage of doxorubicin is 40 to 60 mg/m2 given as a single intravenous injection every 21 to 28 days.
- the probability of developing impaired myocardial function is estimated to be 1 to 2% at a total cumulative dose of 300 mg/m2 of doxorubicin, 3 to 5% at a dose of 400 mg/m2, 5 to 8% at a dose of 450 mg/m2 and 6 to 20% at a dose of 500 mg/m2 given in a schedule of a bolus injection once every 3 weeks.
- LVEF left ventricular ejection fraction
- Standard doses of epirubicin include the following: Epirubicin injection is administered to patients by intravenous infusion. Epirubicin is given in repeated 3- to 4-week cycles. The total dose of epirubicin may be given on Day 1 of each cycle or divided equally and given on Days 1 and 8 of each cycle. The recommended starting dose of epirubicin is 100 to 120 mg/m2. Consideration can be given to administration of lower starting doses (75-90 mg/m2) for heavily pretreated patients, patients with pre-existing bone marrow depression, or in the presence of neoplastic bone marrow infiltration.
- Standard doses of idarubicin include the following: Idarubicin HC1 injection 12 mg/m2 daily for 3 days by slow (10 to 15 minutes) intravenous injection in combination with cytarabine.
- the cytarabine may be given as 100 mg/m2 daily by continuous infusion for 7 days or as cytarabine 25 mg/m2 intravenous bolus followed by cytarabine 200 mg/m2 daily for 5 days continuous infusion.
- a second course may be administered.
- idarubicin HC1 a dose reduction of idarubicin HC1 should be considered, idarubicin HC1 should not be administered if the bilirubin level exceeds 5 mg%
- Standard doses of valrubicin include the following: administration
- Standard doses of aclarubicin include the following: administration by infusion, an initial dosage of 175-300 mg/m2 over 3 to 7 consecutive days, for example 80- 100 mg/m2 daily for 3 days or 25 mg/m2 daily for seven days.
- the maintenance dosage is typically treatments of 25 mg/m2 given as a single infusion every 3 to 4 weeks.
- Standard doses of amrubicin include the following: administration by iv at 25- 60 mg/m2/day for three consecutive days at three-week intervals, for example, to treat small cell lung cancer.
- Standard doses of pirarubicin include the following: administration by iv at 10-45 mg/m 2 /day for three days every four weeks, for example, to treat advanced bladder cancer.
- Standard doses of zorubicin include the following: administration by iv at 10-
- anthracycline-induced cardiotoxic effects could be reduced or eliminated (e.g., reduced by at least 10%, at least 20%, at least 40%, at least 50%, at least 60%, at least 75%, at least 80%, at least 90%, at least 95%, or at least 98%, as compared to the absence of administration of a ZAK inhibitor) by administration of a ZAK inhibitor.
- anthracycline doses could be increased by at least 10%, at least 15%, at least 30%, at least 40%, at least 50%, at least 75%, at least 100%, or at least 200% relative to the typical doses listed above or known to those of ordinary skill in the art for each anthracycline.
- administration of a ZAK inhibitor may permit administration of daunorubicin at doses greater than 45 mg/m2/day iv, such as at least 50 mg/m2/day iv, at least 75 mg/m2/day iv, at least 90 mg/m2/day iv, at least 120 mg/m2/day iv, such as 50-90 mg/m2/day iv, or 50 to 70 mg/m2/day iv; administration of doxorubicin at doses greater than 40 to 75 mg/m2 iv, such as at least 80 mg/m2 iv, at least 120 mg/m2 iv, at least 150 mg/m2 iv, at least 170 mg/m2 iv, for example 80 - 200 mg/m2 iv, 80 - 160 mg/m2 iv, or 80 - 100 mg/m2 iv; administration of epirubicin at doses greater than 100 to 120 mg/m2 iv, such as at least 130 mg/m2 iv;
- the anthrocyclin is administered more frequently than the recommended dosage.
- a subject is selected who is or will be treated with an anthracycline and the selected subject is administered a therapeutically effective amount of an inhibitor of ZAK activity, thereby increasing a subject's tolerable amount of an anthracycline by inhibiting or treating the cardiotoxic effects of the anthracycline.
- the disclosed methods further include administering the anthracycline, for example at a therapeutic dose.
- one or more anthracyc lines are administered at a therapeutic dose of daunorubicin hydrochloride 30 mg/m2/day iv or daunorubicin at doses greater than 45 mg/m2/day iv, such as at least 50 mg/m2/day iv, at least 75 mg/m2/day iv, at least 90 mg/m2/day iv, at least 120 mg/m2/day iv, such as 50-90 mg/m2/day iv, or 50 to 70 mg/m2/day iv;
- the disclosure also provides methods for treating or inhibiting cancer that responds to cardiotoxic doses of an anthracycline without the cardiotoxic effects of the anthracycline.
- the method can include selecting a subject with a cancer that responds to toxic doses of an anthracycline (such as doses that cause cardiomyopathy) and co-administering to the selected subject a cardiotoxic dose of the anthracycline and a therapeutically effective amount of an inhibitor of ZAK activity sufficient to counteract the cardiotoxic effects of the anthracycline.
- Such methods treat or inhibit the cancer in a subject (such as reduce the volume or size of the tumor, or reduce metastasis of the tumor, for example by at least 20%, at least 40%, at least 50%, at least 75%, at least 80%, at least 90% or at least 95%, relative to the absence of the anthracycline) without the significant cardiotoxic effects of the anthracycline (for example, reduce the cardiotoxic effects by at least 20%, at least 40%, at least 50%, at least 75%, at least 80%, at least 90% or at least 95%, relative to the absence of the inhibitor of ZAK activity).
- Cancers include malignant tumors that are characterized by abnormal or uncontrolled cell growth. Patients treated with anthracycline and inhibitor of ZAK activity using the methods provided herein may have cancer, or have had a cancer treated in the past (e.g., treated with surgical resection, chemotherapy, radiation therapy). Exemplary cancers that can benefit from the methods, compositions, and kits provided herein include a cancer that responds to treatment with the
- anthracycline such as cancers of the heart (e.g. , sarcoma (angiosarcoma,
- fibrosarcoma rhabdomyosarcoma, liposarcoma
- myxoma rhabdomyoma, fibroma, lipoma and teratoma
- lung e.g. , bronchogenic carcinoma (squamous cell, undifferentiated small cell, undifferentiated large cell, adenocarcinoma), alveolar (bronchiolar) carcinoma, bronchial adenoma, sarcoma, lymphoma, chondromatous hamartoma, mesothelioma); gastrointestinal tract (e.g.
- esophagus squamous cell carcinoma, adenocarcinoma, leiomyosarcoma, lymphoma), stomach (carcinoma, lymphoma, leiomyosarcoma), pancreas (ductal adenocarcinoma, insulinoma, glucagonoma, gastrinoma, carcinoid tumors, vipoma), small bowel (adenocarcinoma, lymphoma, carcinoid tumors, Karposi's sarcoma, leiomyoma, hemangioma, lipoma, neurofibroma, fibroma), large bowel (adenocarcinoma, tubular adenoma, villous adenoma, hamartoma, leiomyoma), genitourinary tract (e.g.
- kidney adenocarcinoma, Wilm's tumor, nephroblastoma, lymphoma, leukemia
- bladder and urethra squamous cell carcinoma, transitional cell carcinoma, adenocarcinoma
- adenocarcinoma, sarcoma testis (seminoma, teratoma, embryonal carcinoma, teratocarcinoma, choriocarcinoma, sarcoma, interstitial cell carcinoma, fibroma, fibroadenoma, adenomatoid tumors, lipoma), liver (e.g. , hepatoma (hepatocellular carcinoma), cholangiocarcinoma, hepatoblastom, angiosarcoma, hepatocellular adenoma, hemangioma), bone (e.g. , osteogenic sarcoma (osteosarcoma),
- fibrosarcoma malignant fibrous histiocytoma, chondrosarcoma, Ewing's sarcoma, malignant lymphoma (reticulum cell sarcoma), multiple myeloma, malignant giant cell tumor, chordoma, osteochronfroma (osteocartilaginous exostoses), benign chondroma, chondroblastoma, chondromyxofibroma, osteoid osteoma and giant cell tumors), nervous system (e.g.
- skull osteoma, hemangioma, granuloma, xanthoma, osteitis deformans
- meninges meningioma, meningiosarcoma, gliomatosis
- brain astrocytoma, medulloblastoma, glioma, ependymoma, germinoma (pinealoma), glioblastoma multiforme, oligodendroglioma, schwannoma, retinoblastoma, congenital tumors
- spinal cord gynecological cancers (e.g.
- uterus endometrial carcinoma
- cervix cervical carcinoma, pre-tumor cervical dysplasia
- ovaries ovarian carcinoma, serous cystadenocarcinoma, mucinous cystadenocarcinoma, endometrioid tumors, celioblastoma, clear cell carcinoma, unclassified carcinoma, granulosa-thecal cell tumors, Sertoli-Leydig cell tumors, dysgerminoma, malignant teratoma), vulva (squamous cell carcinoma, intraepithelial carcinoma, adenocarcinoma, fibrosarcoma, melanoma), vagina (clear cell carcinoma, squamous cell carcinoma, botryoid sarcoma, embryonal rhabdomyosarcoma, fallopian tubes (carcinoma)), hematologic cancers (e.g.
- blood myeloid leukemia (acute and chronic), acute lymphoblastic leukemia, chronic lymphocytic leukemia, myeloproliferative diseases, multiple myeloma, myelodysplastic syndrome), Hodgkin's disease, non-Hodgkin's lymphoma (malignant lymphoma)), skin (e.g. , malignant melanoma, basal cell carcinoma, squamous cell carcinoma, Karposi's sarcoma, moles, dysplastic nevi, lipoma, angioma, dermatofibroma, keloids, psoriasis), and adrenal glands (e.g. ,
- the cancer is one or more of leukemia (such as acute myelogenous leukemia or chronic myelogenous leukemia), bladder cancer, breast cancer, stomach cancer, lung cancer, ovarian cancer, thyroid cancer, soft tissue sarcoma, multiple myeloma, Bacille Calmette-Guerin (BCG)-refractory carcinoma in situ, neuroblastoma, gastric cancer or lymphoma (such as Hodgkin's lymphoma).
- leukemia such as acute myelogenous leukemia or chronic myelogenous leukemia
- bladder cancer such as acute myelogenous leukemia or chronic myelogenous leukemia
- breast cancer such as acute myelogenous leukemia or chronic myelogenous leukemia
- stomach cancer such as chronic myelogenous leukemia
- lung cancer ovarian cancer
- thyroid cancer such as multiple myeloma
- BCG Bacille Calmette-Guerin
- Anthracyclines that can be used in the methods, compositions, and kits provided herein include doxorubicin, daunorubicin, epirubicin, idarubicin, valrubicin, aclarubicin, amrubicin, pirarubicin and zorubicin or a combination thereof.
- Appropriate dosages can be administered as described above.
- standard or even amounts greater than the standard anthracycline dosage can be administered to a subject receiving a ZAK inhibitor.
- anthracyclines are administered iv.
- Inhibitors of ZAK activity that can be used in the methods, compositions, and kits provided herein include small molecule inhibitors of ZAK activity, inhibitory RNAs (such as siRNA or shRNA) that inhibit the expression of ZAK protein, an antibody that specifically binds ZAK, or combinations thereof.
- small molecule inhibitor of ZAK activity can be used, such as one or more of sorafenib, imatinib, gefinitib, lapatinib, dasatinib, nilotinib, temsirolimus, erlotinib, AMG-708, AST-487 or DHP-2.
- ZAK antibodies that significantly reduce ZAK activity can be generated using routine methods. For example, polyclonal and monoclonal antibodies can be generated. In addition, ZAK antibodies are commercially available (e.g., ZAK antibody ab57318 from abeam, Cambridge, MA or MCA3852Z from AbD Serotec, Raleigh, NC).
- RNAi inhibitory RNAs
- RNAi molecules include siRNAs, shRNAs, antisense molecules, ribozymes, and triple helix molecules.
- RNAi molecules Methods of designing and making RNAi molecules are known in the art.
- the term "antisense” refers to a nucleic acid capable of hybridizing to a portion of a RNA sequence (such as ZAK mRNA) by virtue of some sequence complementarity.
- Antisense nucleic acids can be oligonucleotides that are double-stranded or single- stranded, RNA or DNA or a modification or derivative thereof, which can be directly administered or can be produced intracellularly by transcription of exogenous, introduced sequences.
- Antisense nucleic acids range from about 6 to about 100 nucleotides in length.
- Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA.
- Ribozyme molecules include one or more sequences complementary to a ZAK mRNA and include the well-known catalytic sequence responsible for mRNA cleavage (see U.S. Pat. No. 5,093,246).
- a ribozyme gene directed against ZAK can be delivered to a subject endogenously (where the ribozyme coding gene is transcribed intracellularly) or exogenously (where the ribozymes are introduced into a cell, for example by transfection). Methods describing endogenous and exogenous delivery are provided in Marschall et al.
- siRNA Short interfering or interrupting RNA
- ZAK ZAK RNA
- Short hairpin RNAs can also be used to decrease or inhibit ZAK expression.
- shRNAs Short hairpin RNAs
- Huang et al. J. Biomed. Sci. 2009; 16(1): 11
- shRNA-F 36 nucleotides
- shRNA-R 41 nucleotides
- the oligonucleotides used for shRNA were as follows: ZAK460iF (GATCCGCCTCTCGGTTCCATAACCATTTCAAGAGAA; SEQ ID NO: 3), ZAK460iR
- shRNAs can be expressed in a cell using an expression vector (such as pCDNA-HU6) with a desired promoter, such as human U6 promoter, to decrease ZAK expression.
- an expression vector such as pCDNA-HU6 with a desired promoter, such as human U6 promoter, to decrease ZAK expression.
- compositions such as therapeutic or pharmaceutical compositions, are provided that include a therapeutically effective amount of an anthracycline, such as doxorubicin, daunorubicin, epirubicin, idarubicin, valrubicin, aclarubicin, amrubicin, pirarubicin and zorubicin (exemplary doses provided above) and a therapeutically effective amount of an inhibitor of ZAK activity.
- an anthracycline such as doxorubicin, daunorubicin, epirubicin, idarubicin, valrubicin, aclarubicin, amrubicin, pirarubicin and zorubicin (exemplary doses provided above) and a therapeutically effective amount of an inhibitor of ZAK activity.
- an anthracycline such as doxorubicin, daunorubicin, epirubicin, idarubicin, valrubicin, aclarubicin, amrubicin
- anthracycline and/or the inhibitors of ZAK activity are desirable to prepare as a pharmaceutical composition appropriate for the intended application, for example to inhibit or treat a cellular proliferative disorder. Accordingly, methods for making a medicament or pharmaceutical composition containing an anthracycline and/or an inhibitor of ZAK activity are included herein.
- Anthracyclines and/or inhibitors of ZAK activity can be prepared for administration alone or with other active ingredients, such as other chemotherapeutics.
- an anthracycline and an inhibitor of ZAK activity are administered to a subject, the administration can be concurrent or sequential. Sequential administration can be separated by any amount of time, so long as the desired affect is achieved. Multiple administrations of the compositions described herein are also contemplated.
- compositions including an anthracycline and/or an inhibitor of ZAK activity can be administered to subjects by a variety of routes. This includes oral, nasal (such as intranasal), ocular, buccal, enteral, intravitral, or other mucosal (such as rectal or vaginal) or topical administration. Alternatively, administration will be by orthotopic, intradermal subcutaneous, intramuscular, parentral intraperitoneal, or iv injection routes. Such pharmaceutical compositions are usually administered as pharmaceutically acceptable compositions that include physiologically acceptable carriers, buffers or other excipients.
- preparation of a pharmaceutical composition entails preparing a pharmaceutical composition that is essentially free of pyrogens, as well as any other impurities that could be harmful to humans or animals.
- Anthracycline and/or an inhibitors of ZAK activity may be included in pharmaceutical compositions
- anthracyclines and/or the inhibitor of ZAK activity can be combined with various pharmaceutically acceptable additives, as well as a base or vehicle for dispersion of the compound.
- Desired additives include, but are not limited to, pH control agents, such as arginine, sodium hydroxide, glycine, hydrochloric acid, citric acid, and the like.
- the composition is a liquid
- the tonicity of the formulation as measured with reference to the tonicity of 0.9% (w/v) physiological saline solution taken as unity, is typically adjusted to a value at which no substantial, irreversible tissue damage will be induced at the site of administration.
- the tonicity of the solution is adjusted to a value of about 0.3 to about 3.0, such as about 0.5 to about 2.0, or about 0.8 to about 1.7.
- Anthracyclines and/or the inhibitor of ZAK activity can be dispersed in a base or vehicle, which can include a hydrophilic compound having a capacity to disperse the compound, and any desired additives.
- the base can be selected from a wide range of suitable compounds, including but not limited to, copolymers of polycarboxylic acids or salts thereof, carboxylic anhydrides (for example, maleic anhydride) with other monomers (for example, methyl (meth)acrylate, acrylic acid and the like), hydrophilic vinyl polymers, such as polyvinyl acetate, polyvinyl alcohol, polyvinylpyrrolidone, cellulose derivatives, such as hydroxymethylcellulose, hydroxypropylcellulose and the like, and natural polymers, such as chitosan, collagen, sodium alginate, gelatin, hyaluronic acid, and nontoxic metal salts thereof.
- a biodegradable polymer is selected as a base or vehicle, for example, polylactic acid, poly(lactic acid-glycolic acid) copolymer, polyhydroxybutyric acid, poly (hydroxybutyric acid-glycolic acid) copolymer and mixtures thereof.
- synthetic fatty acid esters such as polyglycerin fatty acid esters, sucrose fatty acid esters and the like can be employed as vehicles.
- Hydrophilic polymers and other vehicles can be used alone or in combination, and enhanced structural integrity can be imparted to the vehicle by partial crystallization, ionic bonding, cross-linking and the like.
- the vehicle can be provided in a variety of forms, including fluid or viscous solutions, gels, pastes, powders, and microspheres.
- the anthracycline and/or the inhibitor of ZAK activity can be combined with the base or vehicle according to a variety of methods, and release of the compound can be by diffusion, disintegration of the vehicle, or associated formation of water channels.
- the compound is dispersed in microcapsules (microspheres) or nanocapsules (nanospheres) prepared from a suitable polymer, for example, isobutyl 2- cyanoacrylate (see, for example, Michael et al., J. Pharmacy Pharmacol. 43: 1-5, 1991), and dispersed in a biocompatible dispersing medium, which yields sustained delivery and biological activity over a protracted time.
- the anthracycline and/or the inhibitor of ZAK activity can alternatively contain as pharmaceutically acceptable vehicles substances as required to approximate physiological conditions, such as pH adjusting and buffering agents, tonicity adjusting agents, wetting agents and the like, for example, sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, and
- triethanolamine oleate for solid compositions, conventional nontoxic pharmaceutically acceptable vehicles can be used which include, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like.
- compositions for administering the anthracycline and/or the inhibitor of ZAK activity can also be formulated as a solution, microemulsion, or other ordered structure suitable for high concentration of active ingredients.
- the vehicle can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, and the like), and suitable mixtures thereof.
- polyol for example, glycerol, propylene glycol, liquid polyethylene glycol, and the like
- Proper fluidity for solutions can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of a desired particle size in the case of dispersible formulations, and by the use of surfactants.
- isotonic agents for example, sugars, polyalcohols, such as mannitol and sorbitol, or sodium chloride in the composition.
- Prolonged absorption of the compound can be brought about by including in the composition an agent which delays absorption, for example, monostearate salts and gelatin.
- ZAK antibodies may be provided in lyophilized form and rehydrated with sterile water before administration, although they are also provided in sterile solutions of known concentration. In some examples, the antibody solution is then added to an infusion bag containing 0.9% sodium chloride, USP, and typically administered at a dosage of from 0.5 to 15 mg/kg of body weight.
- an infusion bag containing 0.9% sodium chloride, USP, and typically administered at a dosage of from 0.5 to 15 mg/kg of body weight.
- Antibodies can be administered by slow infusion, rather than in an intravenous push or bolus.
- a higher loading dose is administered, with subsequent, maintenance doses being administered at a lower level. For example, an initial loading dose of 4 mg/kg may be infused over a period of some 90 minutes, followed by weekly maintenance doses for 4-8 weeks of 2 mg/kg infused over a 30 minute period if the previous dose was well tolerated.
- the pharmaceutical compositions can be administered to the subject in a single bolus delivery, via continuous delivery (for example, continuous transdermal, mucosal or intravenous delivery) over an extended time period, or in a repeated administration protocol (for example, by an hourly, daily or weekly, repeated administration protocol).
- the therapeutically effective dosage of the compound can be provided as repeated doses within a prolonged prophylaxis or treatment regimen that will yield clinically significant results to alleviate one or more symptoms or detectable conditions associated with a targeted disease or condition as set forth herein.
- Suitable models in this regard include, for example, murine, rat, porcine, feline, non-human primate, and other accepted animal model subjects known in the art.
- effective dosages can be determined using in vitro models (for example, immunologic and histopathologic assays). Using such models, only ordinary calculations and adjustments are required to determine an appropriate concentration and dose to administer a therapeutically effective amount of an anthracycline or an inhibitor of ZAK activity.
- the appropriate dose will vary depending on the characteristics of the subject, for example, whether the subject is a human or non-human, the age, weight, and other health considerations pertaining to the condition or status of the subject, the mode, route of administration, and number of doses, and whether the pharmaceutical composition includes both an anthracycline and an inhibitor of ZAK activity, time and route of administration, other drugs or treatments being administered concurrently, as well as the specific pharmacology of the therapeutic compositions for eliciting the desired activity or biological response in the subject.
- Dosage regimens can be adjusted to provide an optimum prophylactic or therapeutic response.
- a therapeutically effective amount is also one in which any toxic or detrimental side effects of the compound and/or other biologically active agent is outweighed in clinical terms by therapeutically beneficial effects.
- a non-limiting range for a therapeutically effective amount of an inhibitor of an anthracycline or an inhibitor of ZAK activity within the methods and formulations of the disclosure is about 0.0001 ⁇ g/kg body weight to about 10 mg/kg body weight per dose, such as about 0.0001 ⁇ g/kg body weight to about 0.001 ⁇ g/kg body weight per dose, about 0.001 ⁇ g/kg body weight to about 0.01 ⁇ g/kg body weight per dose, about 0.01 ⁇ g/kg body weight to about 0.1 ⁇ g/kg body weight per dose, about 0.1 ⁇ g/kg body weight to about 10 ⁇ g/kg body weight per dose, about 1 ⁇ g/kg body weight to about 100 ⁇ g/kg body weight per dose, about 100 ⁇ g/kg body weight to about 500 ⁇ g/kg body weight per dose, about 500 ⁇ g/kg body weight per dose to about 1000 ⁇ g/kg body weight per dose, or about 1.0 mg/kg body weight per dose to about 10 mg/kg body weight per dose.
- ZAK inhibitory RNAs such as antisense molecules, siRNAs and shRNAs are administered locally (e.g., to a tumor) or administered systemically.
- RNAi molecules can be administered systemically in a liposomal formulation (such as encapsulated in stable nucleic acid lipid particles comprising synthetic cholesterol, l,2-distearoyl-sn-glycero-3-phosphocholine, PEG- cDMA, and l,2-dilinoleyloxy-3-(N,N-dimethyl)aminopropane, for example using the method of Zimmermann et al.
- siRNA molecules can be administered as part of a wrapsome, using the methods described in Yagi et al. (Cancer Res 69(16):6531-8, 2009, herein incorporated by reference).
- RNAi molecules are encapsulated (such as in a wrapsome or lipid) and administered by intravenous injection at doses of 0.1 to 10 mg/kg, such as 0.5 to 10 mg/kg, 1 to 5 mg/kg, or 1 to 2.5 mg/kg, such as 1 or 2 mg/kg.
- small molecule inhibitors of ZAK such as sorafenib, imatinib, gefinitib, lapatinib, dasatinib, nilotinib, erlotinib, AMG-708, AST-487 are administered locally (e.g., to a tumor) or administered systemically.
- sorafenib can be administered PO 100 to 1000 mg (such as PO 400 mg) twice daily; imatinib can be administered PO 100 to 2000 mg (such as PO 400 to 800 mg, for example 400, 600, or 800 mg) twice daily; gefinitib can be administered orally 100 to 1000 mg (such as 250 or 500 mg orally) once daily; lapatinib can be administered orally 250 to 3000 mg (such as 1250 mg orally) once daily on days 1 through 21 continuously (for example in combination with capecitabine); dasatinib can be administered PO 25 to 1000 mg (such as PO 70, 100 or 140 mg) once daily; nilotinib can be administered PO 100 to 1000 mg (such as PO 400 mg) once or twice daily; erlotinib can be administered PO 10 to 500 mg (such as PO 50, 100, or 150 mg) daily; AMG-708 can be administered orally 1 to 1000 mg (such as 10 to 500 mg) daily; AST-487 can be administered orally 1 to 1000 mg (such as 10
- compositions that include an anthracycline or an inhibitor of ZAK activity can be delivered by way of a pump (see Langer, supra; Sefton, CRC Crit. Ref. Biomed. Eng. 14:201, 1987; Buchwald et al , Surgery 88:507, 1980; Saudek et al , N. Engl. J. Med. 321 :574, 1989) or by continuous subcutaneous infusions, for example, using a mini-pump. An intravenous bag solution can also be employed. One factor in selecting an appropriate dose is the result obtained, as measured by the methods disclosed here, as are deemed appropriate by the practitioner. Other controlled release systems are discussed in Langer ⁇ Science 249: 1527-33, 1990).
- a pump is implanted (for example see U.S. Patent Nos.
- Implantable drug infusion devices are used to provide patients with a constant and long-term dosage or infusion of a therapeutic agent. Such device can be categorized as either active or passive.
- Active drug or programmable infusion devices feature a pump or a metering system to deliver the agent into the patient's system.
- An example of such an active infusion device currently available is the Medtronic SYNCHROMEDTM
- Passive infusion devices in contrast, do not feature a pump, but rather rely upon a pressurized drug reservoir to deliver the agent of interest.
- An example of such a device includes the Medtronic ISOMEDTM.
- sustained-release systems include suitable polymeric materials (such as, semi-permeable polymer matrices in the form of shaped articles, for example films, or mirocapsules), suitable hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, and sparingly soluble derivatives (such as, for example, a sparingly soluble salt).
- suitable polymeric materials such as, semi-permeable polymer matrices in the form of shaped articles, for example films, or mirocapsules
- suitable hydrophobic materials for example as an emulsion in an acceptable oil
- ion exchange resins for example as an emulsion in an acceptable oil
- sparingly soluble derivatives such as, for example, a sparingly soluble salt.
- Sustained-release compositions can be administered orally, parenterally,
- Sustained-release matrices include polylactides (U.S. Patent No. 3,773,919, EP 58,481), copolymers of L-glutamic acid and gamma-ethyl-L-glutamate (Sidman et al, Biopolymers 22:547-556, 1983, poly(2- hydroxyethyl methacrylate)); (Langer et al, J. Biomed. Mater. Res.15:167-277, 1981; Langer, Chem. Tech. 12:98-105, 1982, ethylene vinyl acetate (Langer et al, Id.) or poly-D-(-)-3-hydroxybutyric acid (EP 133,988).
- polylactides U.S. Patent No. 3,773,919, EP 58,481
- copolymers of L-glutamic acid and gamma-ethyl-L-glutamate (Sidman et al, Biopolymers 22:5
- Polymers can be used for ion-controlled release.
- Various degradable and nondegradable polymeric matrices for use in controlled drug delivery are known in the art (Langer, Accounts Chem. Res. 26:537, 1993).
- the block copolymer, polaxamer 407 exists as a viscous yet mobile liquid at low temperatures but forms a semisolid gel at body temperature. It has shown to be an effective vehicle for formulation and sustained delivery of recombinant interleukin-2 and urease (Johnston et al, Pharm. Res. 9:425, 1992; and Pec, /. Parent. Sci. Tech. 44(2):58, 1990).
- hydroxyapatite has been used as a microcarrier for controlled release of proteins (Ijntema et al, Int. J. Pharm. 112:215, 1994).
- liposomes are used for controlled release as well as drug targeting of the lipid- capsulated drug (Betageri et al, Liposome Drug Delivery Systems, Technomic Publishing Co., Inc., Lancaster, PA, 1993).
- Numerous additional systems for controlled delivery of therapeutic proteins are known (for example, U.S. Patent No. 5,055,303; U.S. Patent No. 5,188,837; U.S. Patent No. 4,235,871; U.S. Patent No.
- kits that include one or more ZAK inhibitors and one or more anthracyclines.
- the inhibitor of ZAK activity and the anthracycline can be in the same or in separate containers.
- the ZAK and the anthracycline are lyophilized, and reconstituted before administration to a subject.
- Kits can optionally include other agents, such as pharmaceutically acceptable carriers, other chemotherapeutic agents, instructions, and the like.
- the kit includes (for example, in a separate container) an antibody that can be used to detect the efficacy on ZAK by Western blotting.
- Doxorubicin-induced MAPK activation and apoptosis are decreased after siRNA-mediated knockdown of ZAK
- Ribotoxic stressors are characterized by their ability to activate JNK and p38
- MAPK through inhibition of protein synthesis.
- ZAK a MAP3K
- ZAK a MAP3K
- ZAK a MAP3K
- doxorubicin activates JNK and p38 MAPK
- HaCaT cells were exposed to varying concentrations of doxorubicin and detected the increased phosphorylation of JNK and p38 MAPK by immunoblotting against an antibody specific for the phosphorylated form of JNK and p38 MAPK. Phosphorylation of these MAPKs was detected 24 hours after addition of doxorubicin (5 to 50 mM; FIG. 1A).
- siRNA directed against the 5' portion of ZAK mRNA was used. SiRNA-mediated knockdown of ZAK strongly suppressed the phosphorylation of JNK and p38 MAPK, as determined in cells that harvested 24 hours after the addition of doxorubicin (FIG. 1A). Interestingly, the knockdown of ZAK decreased also the basal phosphorylation of p38 MAPK (FIG. 1A).
- doxorubicin induces apoptosis both in vivo and in vitro.
- ZAK poly ADP- ribose polymerase
- PARP poly ADP- ribose polymerase
- caspase-3 from procaspase to p20/pl9 and pi 7 subunits
- siRNA-mediated knockdown of ZAK using sequence #2 also suppressed the doxorubicin-induced phosphorylation of JNK and p38 MAPK.
- siRNA-mediated knockdown of ZAK using sequence #2 suppressed the doxorubicin-induced cleavage of PARP, although not as effectively as sequence #1. For this reason, sequence #1 was used in subsequent studies.
- doxorubicin inhibits protein synthesis
- HaCaT cells were exposed to doxorubicin (1 to 25 mM) for varying times (6, 12, or 24 hours), at which times cells were exposed to [ 3 H] -leucine for 30 minutes.
- Exposure to doxorubicin at concentrations of 2.5 mM or greater resulted in a progressive decrease in the incorporation of [ 3 H]-leucine (FIG. IB).
- Cells treated with 2.5 mM doxorubicin decreased incorporation of [ 3 H]-leucine to approximately 35% by the end of 24 hours; treatment with 10 and 25 mM reduced levels of [ 3 H] -leucine incorporation to below 10% at 24 hours.
- Continuous examination of cells by microscopy demonstrated insignificant cell detachment, even 24 hours after addition of doxorubicin.
- Emetine blocks MAPK activation after a high dose of doxorubicin
- Transduction by ribotoxic stressors of signals that lead to activation of SAPKs requires that the ribosomes be involved in protein synthesis at the time that cells are exposed to the stressor.
- Blockade of protein synthesis by fast-acting inhibitors such as emetine prior to the exposure of cells to ribotoxic stressors, prevents transduction of the signal(s) that lead to activation of JNK and p38 MAPK.
- Inhibitors of ZAK block doxorubicin-induced apoptosis and MAPK activation in
- a goal in cancer chemotherapy is to reduce collateral damage in normal tissues and organs.
- the administration of effective doses of doxorubicin to cancer patients is frequently limited by the potential for development of cardiotoxicity and other adverse responses. Identification of agents that could selectively suppress the destruction of normal tissue by doxorubicin may permit the administration of larger or more frequent doses of doxorubicin to cancer patients.
- agents ImM were administered to HaCaT cells 30 minutes prior to treatment with doxorubicin (lOmM or 25mM) for 24 hours.
- doxorubicin LOmM or 25mM
- ZAK inhibitors block daunorubicin-induced apoptosis and MAPK activation in
- Daunorubicin is an anthracycline that is considered to act by similar mechanisms as doxorubicin, but shows less potent antitumor activity.
- HaCaT cells were pretreated with sorafenib or nilotinib (ImM) followed by daunorubicin (2.5, 10, 25 mM) for 24 hour. Similar to the studies with daunorubicin (2.5, 10, 25 mM)
- Inhibitors of JNK or p38 partially block doxorubicin-induced apoptosis in
- ZAK is a MAP3K that has been shown to induce the phosphorylation of p38 MAPK and JNK.
- SB 203580 (10 mM), SP 600125 (20mM), or both in combination were administered to HaCaT cells 30 minutes prior to treatment with 25 mM doxorubicin for 24 hours.
- the presence of either inhibitor or a combination of resulted in diminished cleavage of PARP and caspase-3, indicating that JNK and p38-MAPK participated to an extent in doxorubicin-mediated apoptosis.
- zVAD-fmk doxorubicin-induced apoptosis was completely inhibited (FIG. 3C).
- ZAK inhibitors and ZAK siRNA do not block doxorubicin-induced apoptosis in
- HeLa cells were pretreate with sorafenib or nilotinib (1 mM) followed by doxorubicin (10 mM or 25 mM) for 24 hours.
- sorafenib and nilotinib failed to reduce PARP or caspase-3 cleavage in HeLa cells (FIG. 4A).
- doxorubicin failed to increase the phosphorylation of JNK and p38 MAPK, perhaps because the basal levels of these phosphorylated SAPKs were already elevated in the absence of an inducer.
- ZAK-targeting siRNAs were used. SiRNA-mediated knockdown of ZAK slightly reduced doxorubicin-mediated cleavage of PARP and caspase-3 in HeLa cells (FIG. 4B), indicating that the pro-apoptotic actions of doxorubicin in these cells was mediated in part through activation of ZAK.
- ZAK has two different isoforms, ZAK-a and ZAK-b.
- ZAK-a has an apparent molecular weight of 91 kDa.
- ZAK-b is a shorter species of ZAK (51 kDa) because it lacks several exons in the coding region and, compared to ZAK-a, has a distinct C- terminus.
- CIP calf intestinal phosphatase
- MG-132 an inhibitor of proteasomal degradation was utilized.
- the presence of the MG-132 compound did not affect the disappearance of the 91 kDa ZAK-a band, suggesting that its disappearance was not proteasome dependent (FIG. 5B).
- the higher molecular weight bands above ZAK-b increased in intensity in the presence of the MG-132 compound, suggesting that these bands undergo proteasome-mediated degradation after doxorubicin treatment.
- sorafenib and nilotinib could prevent the doxorubicin-induced changes in ZAK
- HaCaT cells were pretreated with sorafenib or nilotinib (1 mM) followed by doxorubicin (10 or 25 mM) for 24 hours.
- sorafenib or nilotinib (1 mM) followed by doxorubicin (10 or 25 mM) for 24 hours.
- the presence of either inhibitor prevented both the disappearance of ZAK-a and the appearance of the higher molecular weight bands above ZAK-b, suggesting that the degradation of ZAK-a and the appearance of higher molecular weight bands above ZAK-b are coupled to the activation of ZAK (FIG. 5C).
- Antibodies and other reagents Antibodies against the phosphorylated forms of ERK, JNK, p38 and against active caspase-3 were obtained from Cell Signaling Technology® (Danvers, MA). Antibodies against PARP (H-250), JNK1 (FL), and p38 were obtained from Santa Cruz Biotechnology® (Santa Cruz, CA). Doxorubicin, daunorubicin, bisbenzimide, CdC12, and emetine were obtained from Sigma- Aldrich® (St. Louis, MO). SB 203580, SP 600125, MG-132 and zVAD-fmk were purchased from EMD Chemicals (Gibbstown, NJ).
- siRNA oligonucleotides (sequence: CAA CAC GGA CAU CAU ACG ATT (SEQ ID NO: 10)), ZAK siRNA oligonucleotides, and ZAK#2 siRNA oligonucleotides (sequence: UGU UCA ACU CCU AAC UGC GTT (SEQ ID NO: 7)) were synthesized by the Research Core Facility at Oregon Health & Science University, Portland, OR. Sorafenib and nilotinib were obtained from LC Laboratories® (Woburn, MA). [ 3 H]-leucine was obtained from PerkinElmer® (Waltham, MA).
- siRNA knockdown of ZAK HaCaT or HeLa cells were grown to 70% confluency and treated in Dulbecco modified Eagle medium/10% fetal bovine serum (FBS). ZAK or scrambled (scr) control siRNA were transfected, after titration of siRNA concentration was performed, at 50 nM siRNA per well using
- DharmaFECT® 4 (Dharmacon®, Lafayette, CO) according to the manufacturer's instructions. After 72 hours (HaCaT) or 48 hours (HeLa), complete medium was removed and the cells were serum deprived for 1 hour prior to addition of doxorubicin or vehicle (deionized water) for 24 hours, at the indicated doses, prior to the harvest of cell lysates. Cell lysates were subjected to immunoblotting.
- Fluorescent nuclear staining HaCaT cells were plated on coverslips and exposed to siRNA for 72 hours, followed by exposure to 25 ⁇ doxorubicin or vehicle (deionized water) for 24 hours. Cells were fixed in 100% methanol for 5 minutes at 4°C and exposed to 10 ⁇ g/mL bisbenzimide. Images were captured by a Leica DFC350 FX camera attached to a Leica DM IRE2 microscope.
- HaCaT cells were grown in 12- well tissue culture plates. Treatments were performed in leucine-free/serum-free Dulbecco's Modified Eagle Medium (DMEM), for the indicated times and doses of doxorubicin. For the final 30 minutes of doxorubicin exposure prior to harvesting, cells were pulse-labeled with 1 ⁇ [3H]-leucine in 1 ml DMEM. Ten percent trichloroacetic acid was added to terminate incorporation.
- DMEM leucine-free/serum-free Dulbecco's Modified Eagle Medium
- Immunoblotting Equal numbers of HaCaT or HeLa cells were plated, serum deprived for 30 minutes, treated, and lysed in 2X electrophoresis sample buffer (ESB) lysis buffer in preparation for immunoblotting. Equal volumes of the cell lysates were separated on a 10% or 13% (for caspase-3 antibody) denaturing polyacrylamide gel in the presence of sodium dodecyl sulfate and were transferred onto polyvinylidene difluoride membranes according to standard laboratory procedures. Membranes were incubated with the indicated antibodies and the corresponding horseradish peroxidase - conjugated secondary antibodies; signals were detected by using enhanced chemiluminescence.
- ESD electrophoresis sample buffer
- HaCaT cells were serum deprived and then pretreated for 0.5 h with 100 ⁇ g/ml emetine or vehicle (DMSO), followed by treatment with 0.5 mM doxorubicin, 100 ⁇ CdC12, or vehicle (deionized water) for the indicated times. Cells were harvested at various times and subjected to immunoblotting.
- Serum-deprived HaCaT or HeLa cells were pretreated for 0.5 hours with sorafenib (1 ⁇ ), nilotinib (1 ⁇ ), SB 203580 (10 ⁇ ), SP 600125 (20 ⁇ ), zVADfmk (25 ⁇ ) or vehicle (DMSO). At 12 hours an additional dose of equal amount was added to each well.
- Cells were treated with the indicated doses of doxorubicin (10 or 25 ⁇ ), daunorubicin (2.5, 10 or 25 ⁇ ), or vehicle (deionized water) for 24 hours, harvested, and subjected to immunoblotting.
- Doxorubicin time course HaCaT cells were serum deprived and treated with 25 ⁇ doxorubicin or vehicle (deionized water) in four-hour increments from 4-24 hours. Cell lysates were subjected to immunoblotting.
- HaCaT cells were serum deprived and treated with 25 mM of doxorubicin or vehicle (deionized water). Eight hours after addition of doxorubicin, 5 ⁇ MG-132 or vehicle (DMSO) was added to the corresponding wells. Treatment continued for 12 hours for a total of 20 hours of doxorubicin treatment then cells were harvested and subjected to immunoblotting.
- doxorubicin a proteosome inhibitor
- ZAK activity inhibitors such as AMN-107 (a tyrosine kinase inhibitor (Bcr-Abl inhibitor) with a high affinity for ZAK inhibition, also referred to as nilotinib), can be determined by in vitro and in vivo studies.
- AMN-107 a tyrosine kinase inhibitor (Bcr-Abl inhibitor) with a high affinity for ZAK inhibition, also referred to as nilotinib
- nilotinib tyrosine kinase inhibitor
- ⁇ -107 or other ZAK inhibitor to reduce or inhibit the death of these cells following administration of doxorubicin is then determined, for example using the methods described herein, including the methods described in Examples 1, 2 and9. It is expected that the addition of ⁇ -107 (or other ZAK inhibitor) to cells pre-treated with doxorubicin will reduce or inhibit the death of the cells in response to doxorubicin.
- mice Animal studies in mice can be used to demonstrate that ⁇ -107 or other
- ZAK inhibitor can prevent or reduce organ toxicity (such as cardiomyopathy) in response to doxorubicin.
- Doxorubicin (40 to 200 mg/m2) is administered to mice iv in the presence or absence of 10 to500 mg ⁇ -107. Subsequently, the effect of ⁇ -107 or other ZAK inhibitor on doxorubicin organ toxicity is determined , for example by inflammatory responses and cell death (e.g., apoptosis). It is expected that administration of ⁇ -107 to mice treated with doxorubicin will reduce or inhibit organ toxicity (such as cardiomyopathy) in response to doxorubicin.
- the mice have a cancer that is responsive to doxorubicin.
- mice having a cancer such as lung cancer or a leukemia
- doxorubicin 40 to 200 mg/m2
- ⁇ - 107 or other ZAK inhibitor such as 10 to 500 mg
- the dose of doxorubicin is elevated relative to "normal" doses currently used to treat patients with cancer.
- the effect of ⁇ -107 or other ZAK inhibitor on doxorubicin organ toxicity is determined, for example by inflammatory responses and cell death (e.g., apoptosis). It is expected that administration of ⁇ -107 or other ZAK inhibitor to mice treated with doxorubicin will reduce or inhibit organ toxicity (such as cardiomyopathy) in response to elevated doses of doxorubicin.
- organ toxicity such as cardiomyopathy
- This example describes methods that can be used to treat a subject having a particular disease or condition that can be treated by the combination of a ZAK inhibitor and an anthracycline.
- a therapy can be used alone, or in combination with other therapies (such as the administration of other chemotherapeutic agents).
- the method includes screening a subject having or thought to have a particular disease or condition treatable by the combination of a ZAK inhibitor and an anthracycline to identify those subjects that can benefit from administration of the a ZAK inhibitor and an anthracycline.
- Subjects of an unknown disease status or condition can be examined to determine if they have disease or condition treatable by a combination of a ZAK inhibitor and an anthracycline.
- the subject can be administered a therapeutic amount of a ZAK inhibitor and an anthracycline.
- the ZAK inhibitor can be administered at doses of 0.0001 ⁇ g/kg body weight to about 10 mg/kg body weight per dose, such as 0.0001 ⁇ g/kg body weight - 0.001 ⁇ g/kg body weight per dose, 0.001 ⁇ g/kg body weight - 0.01 ⁇ g/kg body weight per dose, 0.01 ⁇ g/kg body weight - 0.1 ⁇ g/kg body weight per dose, 0.1 ⁇ g/kg body weight - 10 ⁇ g/kg body weight per dose, 1 ⁇ g/kg body weight - 100 ⁇ g/kg body weight per dose, 100 ⁇ g/kg body weight - 500 ⁇ g/kg body weight per dose, 500 ⁇ g/kg body weight per dose - 1000 ⁇ g/kg body weight per dose, or 1.0 mg/kg body weight per dose - 10 mg/kg body weight per dose.
- the particular dose can be determined by a skilled clinician.
- the anthracycline such as doxorubicin, daunorubicin, epirubicin, idarubicin, valrubicin, clarubicin, amrubicin, pirarubicin and zorubicin, can be administered at doses or between about 10 mg/m2/day iv 10 about 250 mg/m2/day iv, such as about 10 mg/m2/day iv, 20 mg/m2/day iv, 30 mg/m2/day iv, 10 mg/m2/day iv 40 mg/m2/day iv, about 50 mg/m2/day iv, about 75 mg/m2/day iv, about 90 mg/m2/day iv, about 120 mg/m2/day iv, such as 10-90 mg/m2/day iv, or 50 to 70 mg/m2/day iv.
- the ZAK inhibitor and the anthracycline can be administered in several doses, for example continuously, daily, weekly, or monthly.
- the administration can concurrent or sequential.
- the mode of administration can be any used in the art.
- the amount of the ZAK inhibitor and the anthracycline administered to the subject can be determined by a clinician, and may depend on the particular subject treated. Specific exemplary amounts are provided herein (but the disclosure is not limited to such doses).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Epidemiology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Cardiology (AREA)
- Heart & Thoracic Surgery (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Urology & Nephrology (AREA)
- Vascular Medicine (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
Abstract
This application provides methods that can be used to inhibit or treat deleterious effects of anthracycline administration (such as cardiomyopathy), as well as compositions and kits that can be used for such methods. For example, such methods can include administration of an inhibitor of ZAK activity to prevent or treat cardiotoxic effects of anthracycline, for example in a subject having a cancer responsive to anthracycline.
Description
INHIBITING THE DELETERIOUS EFFECT OF ANTHRACYCLINES
CROSS REFERNCE TO RELATED APPLICATION
This application claims the benefit of the earlier filing date of U.S. Provisional Application No. 60/254,533, filed October 23, 2009, which is incorporated herein by reference in its entirety.
STATEMENT OF GOVERNMENT SUPPORT
This invention was made with United States Government support under grants AI 1059335 and DK079419, awarded by the National Institutes of Health. The Government has certain rights in the invention.
FIELD
This application relates to methods that can be used to inhibit or treat deleterious effects of anthracycline administration (such as cardiomyopathy), as well as compositions and kits that can be used for such methods.
BACKGROUND
Anthracyclines are a class of drugs used in cancer chemotherapy to treat a wide range of cancers, including hematologic and solid tumors, such as leukemias, lymphomas, breast, uterine, ovarian, bladder, and lung cancers. However, anthracyclines can cause considerable deleterious side effects. For example, patients receiving doxorubicin frequently present with acute side effects such as fatigue, nausea/vomiting, pain, sleep disturbances, cachexia and depression. In addition, patients may develop cardiomyopathy, which can lead to life-threatening congestive heart failure. Cardiomyopathy frequently correlates with the total amount of administered drug.
Several mechanisms for the chemotherapeutic actions of anthracyclines have been proposed, including: (a) intercalation into DNA, leading to inhibition of macromolecular synthesis; (b) generation of reactive oxygen species (ROS), leading to DNA damage or lipid peroxidation; and (c) inhibition of topoisomerase II, followed by DNA damage. Anthracycline-mediated apoptotic cell death is likely a response to
one or more of these upstream actions. While anthracyclines have proven effective in the treatment of cancers, the clinical efficacy of these compounds is limited by both acute and chronic complications. For example, production of oxygen radicals has been proposed for anthracycline -mediated cardiotoxicity. These side effects considerably limit the usefulness of anthracyclines, such as doxorubicin,
daunorubicin, epirubicin, idarubicin, valrubicin, aclarubicin, amrubicin, pirarubicin and zorubicin. Therefore, methods are needed for reducing these side effects.
SUMMARY
Methods are provided for inhibiting or treating cardiomyopathy (such as anthracyc line-induced cardiomyopathy) in subjects previously treated with, being treated with or soon to be treated with an anthracycline. In particular examples, the method includes selecting a subject previously treated with, being treated with or soon to be treated with the anthracycline and administering to the subject a therapeutically effective amount of an inhibitor of zipper sterile-alpha- motif kinase (ZAK) activity, thereby treating or inhibiting the cardiomyopathy in the subject.
Methods are also provided for increasing the tolerable amount of an anthracycline that a subject can receive, by inhibiting or treating the cardiotoxic effects of the anthracycline. In particular examples, the method includes selecting a subject for treatment with or being treated with the anthracycline and administering to the subject a therapeutically effective amount of an inhibitor of ZAK activity, thereby increasing a subject's tolerable amount of an anthracycline by inhibiting or treating the cardiotoxic effects of the anthracycline.
Methods for treating or inhibiting a cancer that responds to cardiotoxic doses of an anthracycline without the cardiotoxic effects of the anthracycline are provided. In particular examples, the method includes selecting a subject with a cancer that responds to toxic doses of an anthracycline and co-administering to the subject a dose of anthracycline that is considered cardiotoxic to the subject and a therapeutically effective amount of an inhibitor of ZAK activity sufficient to counteract the cardiotoxic effects of the anthracycline, thereby treating or inhibiting the cancer in subject with a cancer that responds to cardiotoxic doses of an anthracycline, without the cardiotoxic effects of the anthracycline. Exemplary cancers that can be treated
with these methods include leukemia (such as acute myelogenous leukemia or chronic myelogenous leukemia), bladder cancer, breast cancer, stomach cancer, lung cancer, ovarian cancer, thyroid cancer, soft tissue sarcoma, multiple myeloma, Bacille Calmette-Guerin (BCG)-refractory carcinoma in situ, neuroblastoma, gastric cancer or lymphoma (such as Hodgkin's lymphoma).
Also provided are pharmaceutical compositions that include both a therapeutically effective amount of an inhibitor of ZAK activity and a therapeutically effective amount of an anthracycline. Such compositions can also include pharmaceutically acceptable carriers, such as those suitable for intravenous (iv) administration. This disclosure also provides kits that include both an inhibitor of ZAK activity and an anthracycline, for example in a single container or in separate containers.
Exemplary anthracyclines that can be used with the disclosed methods, compositions, and kits include doxorubicin, daunorubicin, epirubicin, idarubicin, valrubicin, aclarubicin, amrubicin, pirarubicin and zorubicin or combinations thereof. Exemplary inhibitors of ZAK activity that can be used with the disclosed methods, compositions, and kits include small molecule inhibitors of ZAK activity (such as one or more of sorafenib, imatinib, gefinitib, lapatinib, dasatinib, nilotinib, temsirolimus, erlotinib, AST-487 or DHP-2), an inhibitory RNA that inhibits the expression of ZAK protein, or an antibody that specifically binds ZAK.
The foregoing and other features of the disclosure will become more apparent from the following detailed description, which proceeds with reference to the accompanying figures. BRIEF DESCRIPTION OF THE DRAWINGS
FIGS. 1A-1D are digital images of Western blots, cells and a graph showing the effect of ZAK knockdown on doxorubicin-induced apoptosis, activation of SAPKs, and inhibition of protein synthesis. FIG. 1A is an electronic image of Western blots of HaCaT cells that were exposed to leucine zipper containing kinase ZAK (ZAK)-specific siRNA (zak) or scrambled siRNA (scr) prior to treatment for 24 hours with vehicle or doxorubicin (5, 25 or 50 μΜ), using the methods as described in EXAMPLE 9. Lysates were collected and subjected to SDS-PAGE followed by
western blot analysis with the antibodies indicated. FIG. IB is an electronic image of HaCaT cells grown on glass coverslips that were exposed to scrambled siRNA (i and iii) or ZAK-specific siRNA (ii and iv) prior to treatment for 24 hours with vehicle (i and ii) or 25 μΜ doxorubicin (iii and iv). Cells were exposed to bisbenzimide to examine fluorescent nuclear staining as described in EXAMPLE 9. FIG. 1C is an electronic image of Western blots of HaCaT cells that were exposed to scrambled siRNA (scr) or ZAK-specific siRNA (zak) sequence #1 from FIG. 1A or sequence #2 prior to treatment for 24 hours with vehicle or 25 μΜ doxorubicin, as described in EXAMPLE 9. Lysates were collected and subjected to SDS-PAGE followed by western blot analysis with the antibodies indicated. FIG. ID is a graph of the results of HaCaT cells that were treated in triplicate for 6, 12 or 24 hours with either vehicle or 1, 2.5, 10 or 25 μΜ of doxorubicin. Cells were pulse-labeled with [3H] -leucine for the final 30 minutes of treatment.
FIGS. 2A-2C are electronic images of Western blots and a graph showing the inhibition of doxorubicin-induced activation of SAPKs by pretreatment with emetine. FIG. 2A is an electronic image of a Western blot of HaCaT cells that were pretreated with vehicle (ii) or emetine (100 μg/mL; i and iii) for 30 minutes prior to stimulation with doxorubicin (0.5 mM; ii and iii) for 15, 30, 60 or 120 minutes. Lysates were collected and submitted to SDS-PAGE, followed by Western blot analysis with the antibodies as indicated. FIG. 2B is a graph of the results of HaCaT cells that were treated in triplicate for 1, 2, 3 or 4 hours with vehicle or 0.5 mM doxorubicin. Cells were pulse-labeled with [3H]-leucine for the final 30 minutes of treatment. FIG. 2C is an electronic image of a Western blot of HaCaT cells that were pretreated with vehicle (ii) or emetine (100 μg/mL; i and iii) for 30 minutes prior to stimulation as indicated with CdC12 (100 μΜ; ii and iii) for 15, 30, 60 or 120 minutes. Lysates were collected and subjected to SDS-PAGE, followed by Western blot analysis with the antibodies as indicated.
FIGS. 3A-3C are electronic images of Western blots showing the effect of inhibitors on doxorubicin- and daunorubicin-induced apoptosis and activation of SAPKs. HaCaT cells were pretreated for 30 minutes with vehicle or inhibitors.
Twelve hours later an additional dose of inhibitor was added to each well. Twenty- four hours after the addition of doxorubicin or daunorubicin, lysates were collected
and subjected to SDSPAGE followed by Western blot analysis with the antibodies as indicated. FIG. 3A is an electronic image of a Western blot of HaCaT cells pretreated with vehicle (C), sorafenib (S; 1 μΜ), or nilotinib (N; 1 μΜ) for 30 minutes, followed by treatment with doxorubicin (10 or 25 μΜ) for 24 hours. FIG. 3B is an electronic image of a Western blot of HaCaT cells pretreated with vehicle (C), sorafenib (S; 1 μΜ), or nilotinib (N; 1 μΜ) for 30 minutes, followed by treatment with daunorubicin (2.5, 10 or 25 μΜ) for 24 h. FIG. 3C is an electronic image of a Western blot of HaCaT cells pretreated with vehicle (C), SB 203580 (SB; 10 μΜ), SP 600125 (SP; 20 μΜ), both (SB SP), or zVAD-fmk (Z; 25 μΜ) for 30 minutes, followed by treatment with doxorubicin (25 μΜ) for 24 hours.
FIGS. 4A and 4B are digital images of Western bots showing the effect of ZAK knockdown, sorafenib or nilotinib on doxorubicin- induced apoptosis in HeLa cells. Following exposure to 10 or 25 μΜ doxorubicin, HeLa cell lysates were collected and subjected to SDS-PAGE, followed by Western blot analysis with the antibodies as indicated. FIG. 4A is a digital image of a Western blot of cells pretreated with vehicle (C), sorafenib (S; 1 μΜ), or nilotinib (N; 1 μΜ) for 30 minutes, followed by treatment with doxorubicin for 24 hours. At 12 hours an additional dose of vehicle or inhibitors was added to each well. FIG. 4B is a digital image of a Western blot of cells that were exposed to scrambled siRNA (scr) or ZAK- specific siRNA (zak) as described in EXAMPLE 9, followed by treatment for 24 hours with vehicle or doxorubicin.
FIGS. 5A-5D are digital images of Western blots showing the effect of inhibition of ZAK, p38 MAPK or JNK on doxorubicin induced degradation or modification of ZAK. FIG. 5A is a digital image of a Western blot of HaCaT cells that were exposed to 25 μΜ doxorubicin and were harvested at 4 hour intervals. Lysates were subjected to SDS-PAGE, followed by Western blot analysis with the antibodies as indicated. FIG. 5B is a digital image of a Western blot of HaCaT cells that were exposed to 25 μΜ doxorubicin. Eight hours later, 5 μΜ MG-132 or vehicle was added to the corresponding wells. Treatment continued for an additional 12 hours, at which time cells were harvested. Lysates were subjected to SDS-PAGE, followed by Western blot analysis with the antibodies as indicated. FIG. 5C is a digital image of a Western blot analysis with ZAK antibody on cell lysates from FIG.
3A. FIG. 5D is a digital image of a Western blot analysis with ZAK antibody on cell lysates from FIG. 3C.
SEQUENCE LISTING
The nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. The Sequence Listing is submitted as an ASCII text file entitled Sequence_Listing.txt with size 12,056 bytes and created on October 20, 2010, which is incorporated by reference herein.
SEQ ID NO: 1 is an exemplary human ZAK nucleic acid sequence.
SEQ ID NO: 2 is an exemplary human ZAK amino acid sequence.
SEQ ID NOS: 3-6 are exemplary ZAK shRNAs that can be used in the methods disclosed herein.
SEQ ID NOS: 7-9 are exemplary ZAK siRNAs that can be used in the methods disclosed herein.
SEQ ID NO: 10 is an exemplary control siRNA. DETAILED DESCRIPTION
J. Terms
Unless otherwise noted, technical terms are used according to conventional usage. Definitions of common terms in molecular biology can be found in Benjamin Lewin, Genes VII, published by Oxford University Press, 1999; Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994; and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995; and other similar references.
As used herein, the singular forms "a," "an," and "the," refer to both the singular as well as plural, unless the context clearly indicates otherwise. For example, the term "an inhibitor" includes single or plural inhibitors and can be considered equivalent to the phrase "at least one inhibitor."
As used herein, the term "comprises" means "includes." Thus, "comprising an inhibitor" means "including an inhibitor" without excluding other elements.
Although many methods and materials similar or equivalent to those described herein can be used, particular suitable methods and materials are described below. In case of conflict, the present specification, including explanations of terms, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
To facilitate review of the various embodiments of the disclosure, the following explanations of terms are provided:
Administer: To provide or give a subject an agent, such as an anthracycline or an inhibitor of ZAK activity, by any effective route. An exemplary route of administration includes, but is not limited to, injection (such as subcutaneous, intramuscular, intradermal, intraperitoneal, intravenous (iv) or intra-arterial), transdermal, topical, parenteral, oral, nasal, or inhalation, among others.
Anthracycline: A class of drugs used in cancer chemotherapy derived from
Streptomyces bacteria (such as Streptomyces peucetius var. caesius). These compounds are commonly used to treat a wide range of cancers, including leukemias, lymphomas, and breast, uterine, ovarian, bladder, and lung cancers. However, these compounds can cause heart damage (cardiotoxicity), which limits their usefulness considerably.
Exemplary anthracyclines include but are not limited to: daunorubicin ((8S,10S)-8-acetyl-10-[(2S,4S,5S,6S)-4-amino-5-hydroxy-6-methyl-oxan-2-yl]oxy- 6,8,1 l-trihydroxy-l-methoxy-9,10-dihydro-7H-tetracene-5,12-dione; CAS Number 20830-81-3); doxorubicin ((8S,10S)-10-(4-amino-5-hydroxy-6-methyl-tetrahydro-2H- pyran-2-yloxy)-6,8,l l-trihydroxy-8-(2-hydroxyacetyl)-l-methoxy-7,8,9,10- tetrahydrotetracene-5,12-dione; CAS Number 23214-92-8); epirubicin (10-(4-amino- 5-hydroxy-6-methyl-oxan-2-yl) oxy-6,8,1 l-trihydroxy-8-(2-hydroxyacetyl)- 1- methoxy-9,10-dihydro-7H-tetracene-5,12-dione; CAS Number 56420-45-2);
idarubicin ((15,35)-3-acetyl-3,5,12-trihydroxy-6,l l-dioxo-l ,2,3,4,6,l l- hexahydrotetracen-l-yl 3-amino-2,3,6-trideoxo-a-L-/_yxo-hexopyranoside; CAS Number 58957-92-9); valrubicin (2-oxo-2-[(25',45')-2,5,12-trihydroxy-7-methoxy- 6,l l-dioxo-4-({2,3,6-trideoxy-3-[(trifluoroacetyl)amino]hexopyranosyl}oxy)-
1 ,2,3,4,6,1 l-hexahydrotetracen-2-yl]ethyl pentanoate; CAS Number 56124-62-0), aclarubicin (Methyl (lR,2 ?,45)-4-[(2R,55,6¾-4-dimelhylamino-5-[(25,45,55,65)-4- hydroxy-6-methyl-5-[(2/?,65')-6-methyl-5-oxooxan-2-yl]oxyoxan-2-yl]oxy-6- methyloxan-2-yl]oxy -2-ethyl-2,5,7-trihydroxy-6,l l-dioxo-3,4-dihydro-lH-tetracene- 1-carboxylate; CAS Number 57576-44-0), amrubicin ((75',95')-9-Acetyl-9-amino-7- [(25',45',5/?)-4,5-dihydroxyoxan-2-yl]oxy-6,l l-dihydroxy-8,10-dihydro-7H-tetracene- 5,12-dione; CAS Number 110267-81-7), pirarubicin ((35)-3-glycoloyl-3,5,12- trihydroxy-10-methoxy-6,l l-dioxo-1,2,3,4,6,11-hexahydrotetracen-l-yl 3-amino- 2,3,6-trideoxy-4-0-[(2/?)-tetrahydro-2H-pyran-2-yl]-a-L-/_yxo-hexopyranoside; CAS Number 72496-41-4) and zorubicin (N'-((l£)-l-{(25',45')-4-[(3-amino-2,3,6-trideoxy- a-L-lyxo- hexopyranosyl)oxy]-2,5,12-trihydroxy-7-methoxy-6,l 1-dioxo- 1,2,3,4,6,11- hexahydrotetracen-2-yl}ethylidene)benzohydrazide; CAS Number 54083-22-6).
Antibody: A polypeptide ligand including at least a light chain or heavy chain immunoglobulin variable region, which specifically binds an epitope of an antigen (for example, a ZAK epitope). The term "specifically binds" refers to, with respect to an antigen, the preferential association of an antibody or other ligand, in whole or part, with this polypeptide, such as ZAK. A specific binding agent, such as an antibody, binds substantially only to a defined target. It is recognized that a minor degree of non-specific interaction may occur between a molecule, such as a specific binding agent, and a non-target polypeptide. Nevertheless, specific binding can be distinguished as mediated through specific recognition of the antigen. Although selectively reactive antibodies bind antigen, they can do so with low affinity. Specific binding typically results in greater than 2-fold, such as greater than 5 -fold, greater than 10-fold, or greater than 100-fold increase in amount of bound antibody or other ligand (per unit time) to a polypeptide, as compared to a non-target polypeptide.
A variety of immunoassay formats are appropriate for selecting antibodies specifically immunoreactive with a particular protein. For example, solid-phase ELISA immunoassays are routinely used to select monoclonal antibodies specifically immunoreactive with a protein. See Harlow & Lane, Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New York (1988), for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity.
Antibodies can be composed of a heavy and a light chain, each of which has a variable region, termed the variable heavy (VH) region and the variable light (VL) region. Together, the VH region and the VL region are responsible for binding the antigen recognized by the antibody. This includes intact immunoglobulins and the variants and portions of them well known in the art, such as Fab' fragments, F(ab)'2 fragments, single chain Fv proteins ("scFv"), and disulfide stabilized Fv proteins ("dsFv"), that specifically bind the antigen. A scFv protein is a fusion protein in which a light chain variable region of an immunoglobulin and a heavy chain variable region of an immunoglobulin are bound by a linker, while in dsFvs, the chains have been mutated to introduce a disulfide bond to stabilize the association of the chains. The term also includes recombinant forms such as chimeric antibodies (for example, humanized murine antibodies), heteroconjugate antibodies (such as, bispecific antibodies). See also, Pierce Catalog and Handbook, 1994-1995 (Pierce Chemical Co., Rockford, IL); Kuby, Immunology, 3rd Ed., W.H. Freeman & Co., New York, 1997.
A "monoclonal antibody" is an antibody produced by a single clone of B -lymphocytes or by a cell into which the light and heavy chain genes of a single antibody have been transfected. Monoclonal antibodies are produced by methods known to those of skill in the art, for instance by making hybrid antibody-forming cells from a fusion of myeloma cells with immune spleen cells. These fused cells and their progeny are termed "hybridomas." Monoclonal antibodies include humanized monoclonal antibodies.
Antisense, Sense, and Antigene: Double- stranded DNA (dsDNA) has two strands, a 5' -> 3' strand, referred to as the plus strand, and a 3' -> 5' strand (the reverse complement), referred to as the minus strand. Because RNA polymerase adds nucleic acids in a 5' -> 3' direction, the minus strand of the DNA serves as the template for the RNA during transcription. Thus, the RNA formed will have a sequence complementary to the minus strand and identical to the plus strand (except that U is substituted for T).
Antisense molecules are molecules that are specifically hybridizable or specifically complementary to either RNA or the plus strand of DNA. Sense molecules are molecules that are specifically hybridizable or specifically
complementary to the minus strand of DNA. Antigene molecules are either antisense or sense molecules directed to a dsDNA target.
In some embodiments an antisense molecule is designed to target (for example to repress the expression) ZAK, for example using the nucleic acid sequences of ZAK set forth in the accompanying sequence listing or that are publically available (for example from GenBank or EMBL).
Binding or stable binding (of an oligonucleotide): An oligonucleotide binds or stably binds to a target nucleic acid if a sufficient amount of the oligonucleotide forms base pairs or is hybridized to its target nucleic acid, to permit detection of that binding, for example the binding of an oligonucleotide to the nucleic acid sequence of ZAK, for example an inhibitory RNA of ZAK.
Binding can be detected by either physical or functional properties of the target:oligonucleotide complex. Binding between a target and an oligonucleotide can be detected by any procedure known to one skilled in the art, including both functional and physical binding assays.
Physical methods of detecting the binding of complementary strands of DNA or RNA are well known in the art, and include such methods as DNase I or chemical footprinting, gel shift and affinity cleavage assays, Northern blotting, dot blotting and light absorption detection procedures. For example, one method that is widely used, because it is so simple and reliable, involves observing a change in light absorption of a solution containing an oligonucleotide (or an analog) and a target nucleic acid at 220 to 300 nm as the temperature is slowly increased. If the oligonucleotide or analog has bound to its target, there is a sudden increase in absorption at a characteristic temperature as the oligonucleotide (or analog) and target disassociate from each other, or melt.
The binding between an oligomer and its target nucleic acid is frequently characterized by the temperature (Tm) at which 50% of the oligomer is melted from its target. A higher (Tm) means a stronger or more stable complex relative to a complex with a lower (Tm)- Cancer: A malignant tumor characterized by abnormal or uncontrolled cell growth. Other features often associated with cancer include metastasis, interference with the normal functioning of neighboring cells, release of cytokines or other
secretory products at abnormal levels and suppression or aggravation of inflammatory or immunological response, invasion of surrounding or distant tissues or organs, such as lymph nodes, etc. "Metastatic disease" refers to cancer cells that have left the original tumor site and migrate to other parts of the body for example via the bloodstream or lymph system.
Cardiomyopathy: Deterioration of the function of the myocardium, for example, due to treatment with an anthracycline. Subjects with cardiomyopathy can be at risk of arrhythmia and/or sudden cardiac death.
Cardiotoxic: An agent is cardiotoxic if when administered to a subject (for example at a therapeutic dose) causes damage to the heart muscle. The heart becomes weaker and is not as efficient in pumping and therefore circulating blood.
Cardiotoxicity can be detected by EKG changes and arrhythmias, or as a
cardiomyopathy leading to congestive heart failure (sometimes presenting many years after treatment).
Chemotherapy: In cancer treatment, chemotherapy refers to the
administration of one or more agents (chemotherapeutic agents) to kill or slow the reproduction of rapidly multiplying cells, such as tumor or cancer cells. In a particular example, chemotherapy refers to the administration of one or more agents to significantly reduce the number of tumor cells in the subject, such as by at least about 50%. "Chemotherapeutic agents" include any chemical agent with therapeutic usefulness in the treatment of cancer. In some examples, chemotherapeutic agents include anthracyclines, such doxorubicin, daunorubicin, epirubicin, idarubicin, valrubicin, aclarubicin, amrubicin, pirarubicin and zorubicin.
Examples of chemotherapeutic agents can be found for example in Slapak and Kufe, Principles of Cancer Therapy, Chapter 86 in Harrison's Principles of Internal Medicine, 14th edition; Perry et al , Chemotherapy, Ch. 17 in Abeloff, Clinical Oncology 2nd ed., 2000 Churchill Livingstone, Inc; Baltzer and Berkery. (eds):
Oncology Pocket Guide to Chemotherapy, 2nd ed. St. Louis, Mosby-Year Book, 1995; Fischer Knobf, and Durivage (eds): The Cancer Chemotherapy Handbook, 4th ed. St. Louis, Mosby-Year Book, 1993). A chemotherapeutic agent of use in a subject, such as an anthracycline, can decrease a sign or a symptom of a cancer, or
can reduce, stop or reverse the progression, metastasis and/or growth of a cancer, and/or can reduce tumor mass.
Complementarity and percentage complementarity: Molecules with complementary nucleic acids form a stable duplex or triplex when the strands bind, (hybridize), to each other by forming Watson-Crick, Hoogsteen or reverse Hoogsteen base pairs. Stable binding occurs when an oligonucleotide remains detectably bound to a target nucleic acid sequence under the required conditions.
Complementarity is the degree to which bases in one nucleic acid strand base pair with the bases in a second nucleic acid strand. Complementarity is conveniently described by percentage, such as the proportion of nucleotides that form base pairs between two strands or within a specific region or domain of two strands. For example, if 10 nucleotides of a 15-nucleotide oligonucleotide form base pairs with a targeted region of a DNA molecule, that oligonucleotide is said to have 66.67% complementarity to the region of DNA targeted. In some examples, an inhibitory RNA is complementary to a nucleic acid sequence of ZAK, such as SEQ ID NO: 1.
A thorough treatment of the qualitative and quantitative considerations involved in establishing binding conditions that allow one skilled in the art to design appropriate oligonucleotides for use under the desired conditions is provided by Beltz et al. Methods Enzymol 100:266-285, 1983, and by Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989.
Contacting: Placement in direct physical association including both in solid or liquid form. Contacting can occur in vivo, for example by administering an agent to a subject. "Administration" is the introduction of a composition, such as a composition containing one or more of an inhibitor of an anthracycline activity and an inhibitor of ZAK activity, into a subject by a chosen route. For example, if the chosen route is intravenous, the composition is administered by introducing the composition into a vein of the subject.
DNA (deoxyribonucleic acid): DNA is a long chain polymer that comprises the genetic material of most living organisms (some viruses have genes comprising ribonucleic acid (RNA)). The repeating units in DNA polymers are four different nucleotides, each of which comprises one of the four bases, adenine, guanine,
cytosine and thymine bound to a deoxyribose sugar to which a phosphate group is attached. Triplets of nucleotides (referred to as codons) code for each amino acid in a polypeptide, or for a stop signal. The term codon is also used for the corresponding (and complementary) sequences of three nucleotides in the mRNA into which the DNA sequence is transcribed.
Unless otherwise specified, any reference to a DNA molecule is intended to include the reverse complement of that DNA molecule. Except where single- strandedness is required by the text herein, DNA molecules, though written to depict only a single strand, encompass both strands of a double- stranded DNA molecule. Thus, a reference to the nucleic acid molecule that encodes ZAK, or a fragment thereof, encompasses both the sense strand and its reverse complement. Thus, for instance, it is appropriate to generate probes or primers from the reverse complement sequence of the disclosed nucleic acid molecules.
Hybridization: Oligonucleotides and their analogs hybridize by hydrogen bonding, which includes Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary bases. Generally, nucleic acid consists of nitrogenous bases that are either pyrimidines (cytosine (C), uracil (U), and thymine (T)) or purines (adenine (A) and guanine (G)). These nitrogenous bases form hydrogen bonds between a pyrimidine and a purine, and the bonding of the pyrimidine to the purine is referred to as "base pairing." More specifically, A will hydrogen bond to T or U, and G will bond to C. "Complementary" refers to the base pairing that occurs between two distinct nucleic acid sequences or two distinct regions of the same nucleic acid sequence. For example, an oligonucleotide can be complementary to a ZAK encoding mRNA, a ZAK encoding DNA, or a ZAK encoding dsDNA.
"Specifically hybridizable" and "specifically complementary" are terms that indicate a sufficient degree of complementarity such that stable and specific binding occurs between the oligonucleotide (or it' s analog) and the DNA or RNA target. The oligonucleotide or oligonucleotide analog need not be 100% complementary to its target sequence to be specifically hybridizable. An oligonucleotide or analog is specifically hybridizable when binding of the oligonucleotide or analog to the target DNA or RNA molecule interferes with the normal function of the target DNA or
RNA, and there is a sufficient degree of complementarity to avoid non-specific binding of the oligonucleotide or analog to non-target sequences under conditions where specific binding is desired, for example under physiological conditions in the case of in vivo assays or systems. Such binding is referred to as specific
hybridization.
Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the hybridization method of choice and the composition and length of the hybridizing nucleic acid sequences. Generally, the temperature of hybridization and the ionic strength (especially the Na+ concentration) of the hybridization buffer will determine the stringency of hybridization, though waste times also influence stringency. Calculations regarding hybridization conditions required for attaining particular degrees of stringency are discussed by Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989, chapters 9 and 11.
The following is an exemplary set of hybridization conditions and is not limiting:
Very High Stringency (detects sequences that share at least 90% identity) Hybridization: 5x SSC at 65°C for 16 hours
Wash twice: 2x SSC at room temperature (RT) for 15 minutes each
Wash twice: 0.5x SSC at 65°C for 20 minutes each
High Stringency (detects sequences that share at least 80% identity)
Hybridization: 5x-6x SSC at 65°C-70°C for 16-20 hours
Wash twice: 2x SSC at RT for 5-20 minutes each
Wash twice: lx SSC at 55°C-70°C for 30 minutes each
Low Stringency (detects sequences that share at least 50% identity)
Hybridization: 6x SSC at RT to 55°C for 16-20 hours
Wash at least twice: 2x-3x SSC at RT to 55°C for 20-30 minutes each.
Inhibiting or treating a disease: Inhibiting the full development of a disease condition, for example, in a subject who is at risk for a disease such cancer, or
cardiomyopathy. "Treatment" refers to a therapeutic intervention that ameliorates a sign or symptom of a disease or pathological condition after it has begun to develop. The term "ameliorating," with reference to a disease or pathological condition, refers to any observable beneficial effect of the treatment. The beneficial effect can be evidenced, for example, by a delayed onset of clinical symptoms of the disease in a susceptible subject, a reduction in severity of some or all clinical symptoms of the disease, a slower progression of the disease, a reduction in the number of metastases, an improvement in the overall health or well-being of the subject, or by other clinical or physiological parameters associated with a particular disease. A "prophylactic" treatment is a treatment administered to a subject who does not exhibit signs of a disease or exhibits only early signs for the purpose of decreasing the risk of developing pathology.
Inhibit: To reduce to a measurable extent. For example to reduce enzymatic activity. In some examples, the kinase activity of a ZAK is inhibited. In some examples, the cardiotoxic effects of an anthracycline is inhibited.
Kinase: An enzyme that catalyzes the transfer of a phosphate group from one molecule to another. Kinases play a role in the regulation of cell proliferation, differentiation, metabolism, migration, and survival. A "tyrosine kinase" transfers phosphate groups to a hydroxyl group of a tyrosine in a polypeptide. In some examples, a kinase is a ZAK.
Receptor protein tyrosine kinases (PTKs) contain a single polypeptide chain with a transmembrane segment. The extracellular end of this segment contains a high affinity ligand-binding domain, while the cytoplasmic end comprises the catalytic core and the regulatory sequences.
Non-receptor tyrosine kinases, such as ZAK, can be located in the cytoplasm as well as in the nucleus. They exhibit distinct kinase regulation, substrate phosphorylation, and function.
A "preferential" inhibition of a kinase refers to decreasing activity of one kinase, such as ZAK, more than inhibiting the activity of a second kinase, such as a mitogen-activated protein kinase (MAPK) or another kinase.
Oligonucleotide: An oligonucleotide is a plurality of joined nucleotides joined by native phosphodiester bonds, between about 6 and about 300 nucleotides in
length. An oligonucleotide analog refers to moieties that function similarly to oligonucleotides but have non-naturally occurring portions. For example, oligonucleotide analogs can contain non-naturally occurring portions, such as altered sugar moieties or inter-sugar linkages, such as a phosphorothioate
oligodeoxynucleotide. Functional analogs of naturally occurring polynucleotides can bind to RNA or DNA, and include peptide nucleic acid (PNA) molecules.
Particular oligonucleotides and oligonucleotide analogs can include linear sequences up to about 200 nucleotides in length, for example a sequence (such as ZAK DNA or RNA) that is at least 6 bases, for example at least 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100 or even 200 bases long, or from about 6 to about 50 bases, for example about 10-25 bases, such as 12, 15 or 20 bases.
Pharmaceutically acceptable carriers: The pharmaceutically acceptable carriers of use are conventional. Remington 's Pharmaceutical Sciences, by E.W. Martin, Mack Publishing Co., Easton, PA, 19th Edition, 1995, describes compositions and formulations suitable for pharmaceutical delivery of the compositions disclosed herein (such as compositions that include a ZAK inhibitor and/or anthracycline).
In general, the nature of the carrier will depend on the particular mode of administration being employed. For instance, parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle. For solid compositions (such as powder, pill, tablet, or capsule forms), conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. In addition to biologically neutral carriers, pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
Polypeptide: Any chain of amino acids, regardless of length or post- translational modification (such as glycosylation, methylation, ubiquitination, phosphorylation, or the like). In one embodiment, a polypeptide is a ZAK polypeptide. A polypeptide has an amino terminal (N-terminal) end and a carboxy terminal (C-terminal) end. "Polypeptide" is used interchangeably with peptide or
protein, and is used to refer to a polymer of amino acid residues. A "residue" refers to an amino acid or amino acid mimetic incorporated in a polypeptide by an amide bond or amide bond mimetic.
Sequence identity/similarity: The identity/similarity between two or more nucleic acid sequences, or two or more amino acid sequences, is expressed in terms of the identity or similarity between the sequences. Sequence identity can be measured in terms of percentage identity; the higher the percentage, the more identical the sequences are. Homologs or orthologs of nucleic acid or amino acid sequences possess a relatively high degree of sequence identity/similarity when aligned using standard methods.
Methods of alignment of sequences for comparison are well known in the art. Various programs and alignment algorithms are described in: Smith & Waterman, Adv. Appl. Math. 2:482, 1981 ; Needleman & Wunsch, /. Mol. Biol. 48:443, 1970; Pearson & Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988; Higgins & Sharp, Gene, 73:237-44, 1988; Higgins & Sharp, CABIOS 5: 151-3, 1989; Corpet et al , Nuc. Acids Res. 16: 10881-90, 1988; Huang et al. Computer Appls. in the Biosciences 8, 155-65, 1992; and Pearson et al , Meth. Mol. Bio. 24:307-31 , 1994. Altschul et al , J. Mol. Biol. 215:403-10, 1990, presents a detailed consideration of sequence alignment methods and homology calculations.
The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al. , J.
Mol. Biol. 215:403-10, 1990) is available from several sources, including the National Center for Biological Information (NCBI, National Library of Medicine, Building 38A, Room 8N805, Bethesda, MD 20894) and on the Internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn, and tblastx. Blastn is used to compare nucleic acid sequences, while blastp is used to compare amino acid sequences. Additional information can be found at the NCBI web site.
Homologs and variants of a ZAK protein are typically characterized by possession of at least 50% sequence identity counted over the full length alignment with the amino acid sequence of a native protein {e.g., SEQ ID NO: 2) using the
NCBI Blast 2.0, gapped blastp set to default parameters. For comparisons of amino acid sequences of greater than about 30 amino acids, the Blast 2 sequences function is
employed using the default BLOSUM62 matrix set to default parameters, (gap existence cost of 11, and a per residue gap cost of 1). When aligning short peptides (fewer than around 30 amino acids), the alignment should be performed using the Blast 2 sequences function, employing the PAM30 matrix set to default parameters (open gap 9, extension gap 1 penalties). Proteins with even greater similarity to the reference sequences will show increasing percentage identities when assessed by this method, such as at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 2. When less than the entire sequence is being compared for sequence identity, homologs and variants will typically possess at least 75% sequence identity over short windows of 10-20 amino acids, and may possess sequence identities of at least 85% or at least 90% at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% depending on their similarity to the reference sequence. Methods for determining sequence identity over such short windows are described at the NCBI website. One of skill in the art will appreciate that these sequence identity ranges are provided for guidance only; it is entirely possible that strongly significant homologs could be obtained that fall outside of the ranges provided.
Once aligned, the number of matches is determined by counting the number of positions where an identical nucleotide or amino acid residue is present in both sequences. The percent sequence identity is determined by dividing the number of matches either by the length of the sequence set forth in the identified sequence, or by an articulated length (such as 100 consecutive nucleotides or amino acid residues from a sequence set forth in an identified sequence), followed by multiplying the resulting value by 100. For example, a nucleic acid sequence that has 1166 matches when aligned with a test sequence having 1554 nucleotides is 75.0 percent identical to the test sequence (1166÷1554*100=75.0). The percent sequence identity value is rounded to the nearest tenth. For example, 75.11, 75.12, 75.13, and 75.14 are rounded down to 75.1, while 75.15, 75.16, 75.17, 75.18, and 75.19 are rounded up to 75.2. The length value will always be an integer. One indication that two nucleic acid molecules are closely related is that the two molecules hybridize to each other under stringent conditions.
Subject: Subjects that can be treated using the methods provided herein include mammalian subjects, such as a veterinary (e.g., mice, dogs, cats, rabbits, monkeys) or human subject.
Therapeutically effective amount: The quantity of a composition, such as a ZAK inhibitor, sufficient to achieve a desired effect in a subject being treated. For instance, this can be the amount necessary to inhibit cardiomyopathy associated with anthracycline administration. When administered to a subject, a dosage will generally be used that will achieve target concentrations that have been shown to achieve in vitro and/or in vivo inhibition of or to measurably alter outward symptoms of a cardiac toxicity.
Tolerable amount: An amount of a theraputic agent, such as an
anthracycline, that can be administered to a subject without significant deleterious side effects. For example, it can be an amount of an anthracycline administered to a subject having a tumor that is responsive to the anthracycline that is not cardiotoxic (e.g. , does not cause cardiomyopathy).
Zipper sterile-alpha- motif kinase (ZAK): A kinase also known as mixed lineage kinase 7 (MLK7). The kinase is a member of the MAPKKK family of signal transduction molecules and encodes a protein with an N-terminal kinase catalytic domain, followed by a leucine zipper motif and a sterile-alpha motif (SAM). This magnesium-binding protein forms homodimers and is located in the cytoplasm. ZAK activities include mediating gamma radiation induced signaling, which leads to cell cycle arrest upon exposure to gamma radiation.
Examples of human amino acid sequences of ZAK can be found at
GENBANK® Accession Nos. NP_057737 and NP_598407, which are incorporated herein by reference as available October 23, 2009. Examples of human nucleic acid sequences of ZAK can be found at GENBANK® Accession Nos. NM_016653 and NM_133646, which are incorporated herein by reference as available October 23, 2009. In one example, a ZAK nucleic acid sequence has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 1, and retains ZAK biological activity. In one example, a ZAK protein sequence has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at
least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 2, and retains ZAK biological activity.
A "ZAK inhibitor" inhibits the signaling of ZAK protein, for example by inhibiting the kinase activity of ZAK. Exemplary ZAK inhibitors are antibodies that specifically bind ZAK, siRNAs, shRNAs, ribozymes, antisense molecules, and small molecule kinase inhibitors, such as, sorafenib (4-[4-[[4-chloro-3- (trifluoromethyl)phenyl]carbamoylamino]phenoxy]-N-methyl-pyridine-2- carboxamide) (NEXAVAR®), imatinib (GLEEVEC®), gefinitib (IRESSA®), lapatinib (TYKERB®), dasatinib (SPRYCEL®), nilotinib (4-methyl-N-[3-(4-methyl- lH-imidazol-l-yl)- 5-(trifluoromethyl)phenyl]-3- [(4-pyridin-3-ylpyrimidin-2-yl) aminojbenzamide) (TASIGNA®), erlotinib (TARCEVA®), AMG-708, AST-487 (1- [4-(4-ethyl-piperazin-l-ylmethyl)-3-trifluoromethyl-phenyl]-3-[4-(6-methylamino- pyrimidin-4-yloxy)-phenyl]-urea) or DHP-2 ((-[3-fluoro-4-aminophenyl-(4-(2- pyridin-2-yl-5,6-dihydro-4H-pyrrolo[l,2-b]pyrazol-3-yl))]-quinoline).
//. Description of Several Embodiments
A. Introduction
ZAK (MLK7) is a MAP3K whose activation has been tied to stimulation of JNK and p38 MAPK. Of the large number of MAP3Ks, ZAK is uniquely required for transduction of signals that are generated by toxins and cellular stressors that act by perturbing the peptidyl transferase center of 28S rRNA, such as anthrocyclins.
As disclosed herein, clinically relevant dosages of the chemotherapeutic anthrocyclin doxorubicin induced the phosphorylation of p38 MAPK and JNK. This doxorubicin dependent phosphorylation could be inhibited by siRNA knockdown of ZAK demonstrating that inhibition of ZAK activity could be used to counteract the doxorubicin-induced activation of SAPKs and suppressed the doxorubicin-induced apoptosis that occurs in cardiomyopathy induced by anthrocyclin treatment, such as treatment with doxorubicin, daunorubicin, epirubicin, idarubicin, valrubicin, aclarubicin, amrubicin, pirarubicin and zorubicin. Thus, inactivation of ZAK by reduction of ZAK expression, for example using siRNA knockdown, can be used to inhibit and/or treat anthrocyclin induced side effects, such as cardiomyopathy.
It is also disclosed herein that ZAK inhibitors, such as the small molecule kinase inhibitors sorafenib and nilotinib, were each as effective as siRNA-mediated ZAK knockdown, indicating that small molecule inhibitors of ZAK can be used to inhibit and/or treat anthrocyclin induced side effects, such as cardiomyopathy.
Based on these results, methods of treating (such as preventing, reducing, or inhibiting) cardiotoxicity due to anthracyclines, such as doxorubicin, daunorubicin, epirubicin, idarubicin, valrubicin, aclarubicin, amrubicin, pirarubicin and zorubicin, by administration of an agent that inhibits ZAK activity are provided herein. Also provided are compositions and kits that can be used for such methods.
B. Methods of Treatment
Methods of inhibiting or treating cardiomyopathy in a subject who has been treated, is being treated, or will soon be treated with an anthracycline are provided. In particular examples, the method includes selecting a subject who has been treated, is being treated, or will soon be treated with one or more anthracyclines. Examples of such subjects are those having or had a cancer that is responsive to anthracycline treatment. The method can further include administering a therapeutically effective amount of an inhibitor of ZAK activity to the selected subject, thereby treating or inhibiting the cardiomyopathy in the subject. For example, the subject may have an anthracyc line-induced cardiomyopathy due to current or previous treatment with an anthracycline, or be a risk for developing anthracycline-induced cardiomyopathy due to expected subsequent treatment with anthracycline.
Methods are also provided for increasing a subject's tolerable amount of an anthracycline by inhibiting or treating the cardiotoxic effects of the anthracycline. For example, standard doses of daunorubicin include the following: For patients under age 60, daunorubicin hydrochloride 45 mg/m2/day iv on days 1 , 2, and 3 of the first course and on days 1, 2 of subsequent courses and cytosine arabinoside 100 mg/m2/day iv infusion daily for 7 days for the first course and for 5 days for subsequent courses. For patients 60 years of age and above, daunorubicin
hydrochloride 30 mg/m2/day iv on days 1 , 2, and 3 of the first course and on days 1 , 2 of subsequent courses AND cytosine arabinoside 100 mg/m2/day iv infusion daily for 7 days for the first course and for 5 days for subsequent courses. In pediatric acute
lymphocytic leukemia, daunorubicin hydrochloride 25 mg/m2 iv on day 1 every week, vincristine 1.5 mg/m2 iv on day 1 every week, prednisone 40 mg/m2 PO daily. In children less than 2 years of age or below 0.5 m2 body surface area, it has been recommended that the daunorubicin hydrochloride dosage calculation should be based on weight (1 mg/kg) instead of body surface area. For adult acute lymphocytic leukemia daunorubicin hydrochloride 45 mg/m2/day iv on days 1 , 2, and 3 AND vincristine 2 mg iv on days 1, 8, and 15; prednisone 40 mg/m2/day PO on days 1 through 22, then tapered between days 22 to 29; L-asparaginase 500 IU/kg/day x 10 days iv on days 22 through 32. In adults, at cumulative doses exceeding 550 mg/m2, there is an increased incidence of drug-induced congestive heart failure.
Standard doses of doxorubicin include the following: doxorubicin at 60 to 75 mg/m2 as a single intravenous injection administered at 21 -day intervals. The lower dosage can be given to patients with inadequate marrow reserves due to old age, or prior therapy, or neoplastic marrow infiltration. When used in combination with other chemotherapy drugs, the most commonly used dosage of doxorubicin is 40 to 60 mg/m2 given as a single intravenous injection every 21 to 28 days. The probability of developing impaired myocardial function, based on a combined index of signs, symptoms and decline in left ventricular ejection fraction (LVEF) is estimated to be 1 to 2% at a total cumulative dose of 300 mg/m2 of doxorubicin, 3 to 5% at a dose of 400 mg/m2, 5 to 8% at a dose of 450 mg/m2 and 6 to 20% at a dose of 500 mg/m2 given in a schedule of a bolus injection once every 3 weeks.
Standard doses of epirubicin include the following: Epirubicin injection is administered to patients by intravenous infusion. Epirubicin is given in repeated 3- to 4-week cycles. The total dose of epirubicin may be given on Day 1 of each cycle or divided equally and given on Days 1 and 8 of each cycle. The recommended starting dose of epirubicin is 100 to 120 mg/m2. Consideration can be given to administration of lower starting doses (75-90 mg/m2) for heavily pretreated patients, patients with pre-existing bone marrow depression, or in the presence of neoplastic bone marrow infiltration. The probability of developing clinically evident congestive heart failure is estimated as approximately 0.9% at a cumulative dose of 550 mg/m2, 1.6% at 700 mg/m2, and 3.3% at 900 mg/m2.
Standard doses of idarubicin include the following: Idarubicin HC1 injection 12 mg/m2 daily for 3 days by slow (10 to 15 minutes) intravenous injection in combination with cytarabine. The cytarabine may be given as 100 mg/m2 daily by continuous infusion for 7 days or as cytarabine 25 mg/m2 intravenous bolus followed by cytarabine 200 mg/m2 daily for 5 days continuous infusion. In patients with unequivocal evidence of leukemia after the first induction course, a second course may be administered. Administration of the second course should be delayed in patients who experience severe mucositis, until recovery from this toxicity has occurred, and a dose reduction of 25% is recommended. In patients with hepatic and/or renal impairment, a dose reduction of idarubicin HC1 should be considered, idarubicin HC1 should not be administered if the bilirubin level exceeds 5 mg%
Standard doses of valrubicin include the following: administration
intravesically 800 mg once a week for 6 weeks, for example, to treat bladder cancer.
Standard doses of aclarubicin include the following: administration by infusion, an initial dosage of 175-300 mg/m2 over 3 to 7 consecutive days, for example 80- 100 mg/m2 daily for 3 days or 25 mg/m2 daily for seven days. The maintenance dosage is typically treatments of 25 mg/m2 given as a single infusion every 3 to 4 weeks.
Standard doses of amrubicin include the following: administration by iv at 25- 60 mg/m2/day for three consecutive days at three-week intervals, for example, to treat small cell lung cancer.
Standard doses of pirarubicin include the following: administration by iv at 10-45 mg/m2/day for three days every four weeks, for example, to treat advanced bladder cancer.
Standard doses of zorubicin include the following: administration by iv at 10-
45 mg/m2/day for three days every four weeks, for example, to treat acute myeloid leukaemia.
However, the doses listed above for human patients could be better tolerated, or even increased, if the anthracycline-induced cardiotoxic effects could be reduced or eliminated (e.g., reduced by at least 10%, at least 20%, at least 40%, at least 50%, at least 60%, at least 75%, at least 80%, at least 90%, at least 95%, or at least 98%, as compared to the absence of administration of a ZAK inhibitor) by administration of a
ZAK inhibitor. For example, anthracycline doses could be increased by at least 10%, at least 15%, at least 30%, at least 40%, at least 50%, at least 75%, at least 100%, or at least 200% relative to the typical doses listed above or known to those of ordinary skill in the art for each anthracycline. For example, administration of a ZAK inhibitor may permit administration of daunorubicin at doses greater than 45 mg/m2/day iv, such as at least 50 mg/m2/day iv, at least 75 mg/m2/day iv, at least 90 mg/m2/day iv, at least 120 mg/m2/day iv, such as 50-90 mg/m2/day iv, or 50 to 70 mg/m2/day iv; administration of doxorubicin at doses greater than 40 to 75 mg/m2 iv, such as at least 80 mg/m2 iv, at least 120 mg/m2 iv, at least 150 mg/m2 iv, at least 170 mg/m2 iv, for example 80 - 200 mg/m2 iv, 80 - 160 mg/m2 iv, or 80 - 100 mg/m2 iv; administration of epirubicin at doses greater than 100 to 120 mg/m2 iv, such as at least 130 mg/m2 iv, at least 150 mg/m2 iv, at least 200 mg/m2 iv, at least 250 mg/m2 iv, for example 130 - 300 mg/m2 iv, 130 - 200 mg/m2 iv, or 130 - 150 mg/m2 iv; administration of idarubicin at doses greater than 12 mg/m2 iv, such as at least 14 mg/m2 iv, at least 15 mg/m2 iv, at least 24 mg/m2 iv, at least 40 mg/m2 iv, for example 14 - 48 mg/m2 iv, 15 - 40 mg/m2 iv, or 14 - 20 mg/m2 iv; administration of valrubicin at doses greater than 800 mg intravesically such as at least 900 mg intravesically, at least 1200 mg intravesically, at least 1500 mg intravesically, at least 1800 mg intravesically, for example 900 - 3000 mg intravesically, 900 - 1800 mg intravesically, or 900 - 1200 mg intravesically; administration of aclarubicin at doses greater than 300 mg/m2 over 3 to 7 consecutive days, for example greater than 100 mg/m2 daily for 3 days or greater 25 mg/m2 daily for seven days, such as at least 125 mg/m2 daily for 3 days, at least greater than 150 mg/m2 daily for 3 days, at least greater than 170 mg/m2 daily for 3 days, at least greater than 200 mg/m2 daily for 3 days, at least greater than 250 mg/m2 daily for 3 days, at least greater than 300 mg/m2 daily for 3 days, at least greater than 50 mg/m2 daily for 7 days, at least greater than 75 mg/m2 daily for 7 days, at least greater than 100 mg/m2 daily for 7 days, or at least greater than 150 mg/m2 daily for 7 days; administration of amrubicin at doses greater than 60 mg/m2/day for three consecutive days at three-week intervals, such as at least greater than 75 mg/m2/day, at least greater than 100 mg/m2/day, at least greater than 150 mg/m2/day, at least greater than 200 mg/m2/day, or at least greater than 250 mg/m2/day; administration of pirarubicin at greater than 45 mg/m2/day for three days
every four weeks, such as at least greater than 50 mg/m2/day, at least greater than 75 mg/m2/day, at least greater than 100 mg/m2/day, at least greater than 150 mg/m2/day, at least greater than 200 mg/m2/day, or at least greater than 250 mg/m2/day, administration of zorubicin at greater than 45 mg/m2/day for three days every four weeks, such as at least greater than 50 mg/m2/day, at least greater than 75 mg/m2/day, at least greater than 100 mg/m2/day, at least greater than 150 mg/m2/day, at least greater than 200 mg/m2/day, or at least greater than 250 mg/m2/day. In some examples, the anthrocyclin is administered more frequently than the recommended dosage. In some examples, a subject is selected who is or will be treated with an anthracycline and the selected subject is administered a therapeutically effective amount of an inhibitor of ZAK activity, thereby increasing a subject's tolerable amount of an anthracycline by inhibiting or treating the cardiotoxic effects of the anthracycline.
In some examples, the disclosed methods further include administering the anthracycline, for example at a therapeutic dose. In one example, one or more anthracyc lines are administered at a therapeutic dose of daunorubicin hydrochloride 30 mg/m2/day iv or daunorubicin at doses greater than 45 mg/m2/day iv, such as at least 50 mg/m2/day iv, at least 75 mg/m2/day iv, at least 90 mg/m2/day iv, at least 120 mg/m2/day iv, such as 50-90 mg/m2/day iv, or 50 to 70 mg/m2/day iv;
doxorubicin at 60 to 75 mg/m2 iv or doxorubicin at doses greater than 40 to 75 mg/m2 iv, such as at least 80 mg/m2 iv, at least 120 mg/m2 iv, at least 150 mg/m2 iv, at least 170 mg/m2 iv, for example 80 - 200 mg/m2 iv, 80 - 160 mg/m2 iv, or 80 - 100 mg/m2 iv; epirubicin at 100 to 120 mg/m2 iv or epirubicin at doses greater than 100 to 120 mg/m2 iv, such as at least 130 mg/m2 iv, at least 150 mg/m2 iv, at least 200 mg/m2 iv, at least 250 mg/m2 iv, for example 130 - 300 mg/m2 iv, 130 - 200 mg/m2 iv, or 130 - 150 mg/m2 iv; idarubicin HC1 12 mg/m2 iv or idarubicin at doses greater than 12 mg/m2 iv, such as at least 14 mg/m2 iv, at least 15 mg/m2 iv, at least 24 mg/m2 iv, at least 40 mg/m2 iv, for example 14 - 48 mg/m2 iv, 15 - 40 mg/m2 iv, or 14 - 20 mg/m2 iv; valrubicin intravesically at 800 mg or valrubicin at doses greater than 800 mg intravesically such as at least 900 mg intravesically, at least 1200 mg intravesically, at least 1500 mg intravesically, at least 1800 mg intravesically, for example 900 - 3000 mg intravesically, 900 - 1800 mg intravesically, or 900 - 1200
mg intravesically clarubicin at d 300 mg/m2 over 3 to 7 consecutive days, for example at least 100 mg/m2 daily for 3 days or greater 25 mg/m2 daily for seven days, such as at least 125 mg/m2 daily for 3 days, at least greater than 150 mg/m2 daily for 3 days, at least greater than 170 mg/m2 daily for 3 days, at least greater than 200 mg/m2 daily for 3 days, at least greater than 250 mg/m2 daily for 3 days, at least greater than 300 mg/m2 daily for 3 days, at least greater than 50 mg/m2 daily for 7 days, at least greater than 75 mg/m2 daily for 7 days, at least greater than 100 mg/m2 daily for 7 days, or at least greater than 150 mg/m2 daily for 7 days; amrubicin at greater than 60 mg/m2/day for three consecutive days at three-week intervals, such as at least greater than 75 mg/m2/day, at least greater than 100 mg/m2/day, at least greater than 150 mg/m2/day, at least greater than 200 mg/m2/day, or at least greater than 250 mg/m2/day; pirarubicin at greater than 45 mg/m2/day for three days every four weeks, such as at least greater than 50 mg/m2/day, at least greater than 75 mg/m2/day, at least greater than 100 mg/m2/day, at least greater than 150 mg/m2/day, at least greater than 200 mg/m2/day, or at least greater than 250 mg/m2/day, zorubicin at greater than 45 mg/m2/day for three days every four weeks, such as at least greater than 50 mg/m2/day, at least greater than 75 mg/m2/day, at least greater than 100 mg/m2/day, at least greater than 150 mg/m2/day, at least greater than 200 mg/m2/day, or at least greater than 250 mg/m2/day.
The disclosure also provides methods for treating or inhibiting cancer that responds to cardiotoxic doses of an anthracycline without the cardiotoxic effects of the anthracycline. For example, the method can include selecting a subject with a cancer that responds to toxic doses of an anthracycline (such as doses that cause cardiomyopathy) and co-administering to the selected subject a cardiotoxic dose of the anthracycline and a therapeutically effective amount of an inhibitor of ZAK activity sufficient to counteract the cardiotoxic effects of the anthracycline. Such methods treat or inhibit the cancer in a subject (such as reduce the volume or size of the tumor, or reduce metastasis of the tumor, for example by at least 20%, at least 40%, at least 50%, at least 75%, at least 80%, at least 90% or at least 95%, relative to the absence of the anthracycline) without the significant cardiotoxic effects of the anthracycline (for example, reduce the cardiotoxic effects by at least 20%, at least
40%, at least 50%, at least 75%, at least 80%, at least 90% or at least 95%, relative to the absence of the inhibitor of ZAK activity).
Cancers include malignant tumors that are characterized by abnormal or uncontrolled cell growth. Patients treated with anthracycline and inhibitor of ZAK activity using the methods provided herein may have cancer, or have had a cancer treated in the past (e.g., treated with surgical resection, chemotherapy, radiation therapy). Exemplary cancers that can benefit from the methods, compositions, and kits provided herein include a cancer that responds to treatment with the
anthracycline, such as cancers of the heart (e.g. , sarcoma (angiosarcoma,
fibrosarcoma, rhabdomyosarcoma, liposarcoma), myxoma, rhabdomyoma, fibroma, lipoma and teratoma), lung (e.g. , bronchogenic carcinoma (squamous cell, undifferentiated small cell, undifferentiated large cell, adenocarcinoma), alveolar (bronchiolar) carcinoma, bronchial adenoma, sarcoma, lymphoma, chondromatous hamartoma, mesothelioma); gastrointestinal tract (e.g. , esophagus (squamous cell carcinoma, adenocarcinoma, leiomyosarcoma, lymphoma), stomach (carcinoma, lymphoma, leiomyosarcoma), pancreas (ductal adenocarcinoma, insulinoma, glucagonoma, gastrinoma, carcinoid tumors, vipoma), small bowel (adenocarcinoma, lymphoma, carcinoid tumors, Karposi's sarcoma, leiomyoma, hemangioma, lipoma, neurofibroma, fibroma), large bowel (adenocarcinoma, tubular adenoma, villous adenoma, hamartoma, leiomyoma), genitourinary tract (e.g. , kidney (adenocarcinoma, Wilm's tumor, nephroblastoma, lymphoma, leukemia), bladder and urethra (squamous cell carcinoma, transitional cell carcinoma, adenocarcinoma), prostate
(adenocarcinoma, sarcoma), testis (seminoma, teratoma, embryonal carcinoma, teratocarcinoma, choriocarcinoma, sarcoma, interstitial cell carcinoma, fibroma, fibroadenoma, adenomatoid tumors, lipoma), liver (e.g. , hepatoma (hepatocellular carcinoma), cholangiocarcinoma, hepatoblastom, angiosarcoma, hepatocellular adenoma, hemangioma), bone (e.g. , osteogenic sarcoma (osteosarcoma),
fibrosarcoma, malignant fibrous histiocytoma, chondrosarcoma, Ewing's sarcoma, malignant lymphoma (reticulum cell sarcoma), multiple myeloma, malignant giant cell tumor, chordoma, osteochronfroma (osteocartilaginous exostoses), benign chondroma, chondroblastoma, chondromyxofibroma, osteoid osteoma and giant cell tumors), nervous system (e.g. , skull (osteoma, hemangioma, granuloma, xanthoma,
osteitis deformans), meninges (meningioma, meningiosarcoma, gliomatosis), brain (astrocytoma, medulloblastoma, glioma, ependymoma, germinoma (pinealoma), glioblastoma multiforme, oligodendroglioma, schwannoma, retinoblastoma, congenital tumors), spinal cord (neurofibroma, meningioma, glioma, sarcoma)), gynecological cancers (e.g. , uterus (endometrial carcinoma), cervix (cervical carcinoma, pre-tumor cervical dysplasia), ovaries (ovarian carcinoma, serous cystadenocarcinoma, mucinous cystadenocarcinoma, endometrioid tumors, celioblastoma, clear cell carcinoma, unclassified carcinoma, granulosa-thecal cell tumors, Sertoli-Leydig cell tumors, dysgerminoma, malignant teratoma), vulva (squamous cell carcinoma, intraepithelial carcinoma, adenocarcinoma, fibrosarcoma, melanoma), vagina (clear cell carcinoma, squamous cell carcinoma, botryoid sarcoma, embryonal rhabdomyosarcoma, fallopian tubes (carcinoma)), hematologic cancers (e.g. , blood (myeloid leukemia (acute and chronic), acute lymphoblastic leukemia, chronic lymphocytic leukemia, myeloproliferative diseases, multiple myeloma, myelodysplastic syndrome), Hodgkin's disease, non-Hodgkin's lymphoma (malignant lymphoma)), skin (e.g. , malignant melanoma, basal cell carcinoma, squamous cell carcinoma, Karposi's sarcoma, moles, dysplastic nevi, lipoma, angioma, dermatofibroma, keloids, psoriasis), and adrenal glands (e.g. ,
neuroblastoma). In a specific example, the cancer is one or more of leukemia (such as acute myelogenous leukemia or chronic myelogenous leukemia), bladder cancer, breast cancer, stomach cancer, lung cancer, ovarian cancer, thyroid cancer, soft tissue sarcoma, multiple myeloma, Bacille Calmette-Guerin (BCG)-refractory carcinoma in situ, neuroblastoma, gastric cancer or lymphoma (such as Hodgkin's lymphoma).
Anthracyclines that can be used in the methods, compositions, and kits provided herein include doxorubicin, daunorubicin, epirubicin, idarubicin, valrubicin, aclarubicin, amrubicin, pirarubicin and zorubicin or a combination thereof.
Appropriate dosages can be administered as described above. For example, standard or even amounts greater than the standard anthracycline dosage can be administered to a subject receiving a ZAK inhibitor. In particular examples, anthracyclines are administered iv.
Inhibitors of ZAK activity that can be used in the methods, compositions, and kits provided herein include small molecule inhibitors of ZAK activity, inhibitory
RNAs (such as siRNA or shRNA) that inhibit the expression of ZAK protein, an antibody that specifically binds ZAK, or combinations thereof. For example, small molecule inhibitor of ZAK activity can be used, such as one or more of sorafenib, imatinib, gefinitib, lapatinib, dasatinib, nilotinib, temsirolimus, erlotinib, AMG-708, AST-487 or DHP-2.
As the protein sequence of ZAK is known (e.g., see SEQ ID NO: 1), ZAK antibodies that significantly reduce ZAK activity can be generated using routine methods. For example, polyclonal and monoclonal antibodies can be generated. In addition, ZAK antibodies are commercially available (e.g., ZAK antibody ab57318 from abeam, Cambridge, MA or MCA3852Z from AbD Serotec, Raleigh, NC).
As the nucleic acid sequence of ZAK is known (e.g., see SEQ ID NO: 2), inhibitory RNAs (RNAi) can be generated using routine methods that significantly reduce or inhibit the expression of ZAK protein. Exemplary RNAi molecules include siRNAs, shRNAs, antisense molecules, ribozymes, and triple helix molecules.
Methods of designing and making RNAi molecules are known in the art. Generally, the term "antisense" refers to a nucleic acid capable of hybridizing to a portion of a RNA sequence (such as ZAK mRNA) by virtue of some sequence complementarity. Antisense nucleic acids can be oligonucleotides that are double-stranded or single- stranded, RNA or DNA or a modification or derivative thereof, which can be directly administered or can be produced intracellularly by transcription of exogenous, introduced sequences. Antisense nucleic acids range from about 6 to about 100 nucleotides in length. Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. The mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by a endonucleolytic cleavage. Ribozyme molecules include one or more sequences complementary to a ZAK mRNA and include the well-known catalytic sequence responsible for mRNA cleavage (see U.S. Pat. No. 5,093,246). A ribozyme gene directed against ZAK can be delivered to a subject endogenously (where the ribozyme coding gene is transcribed intracellularly) or exogenously (where the ribozymes are introduced into a cell, for example by transfection). Methods describing endogenous and exogenous delivery are provided in Marschall et al. (Cell Mol. Neurobiol. 14:523-38, 1994). Short interfering or interrupting RNA (siRNA) is
a double-stranded RNA that can induce sequence-specific post-transcriptional gene silencing, thereby decreasing or even inhibiting gene expression. In some examples, siRNA molecules specific for ZAK are about 19-23 nucleotides in length, such as at least 21 nucleotides, for example at least 23 nucleotides. Exemplary ZAK siRNA sequences are provided in SEQ ID NOS: 7, 8, and 9
CCUCAAGUCAAGAAACGUUdTdT, SEQ ID NO: 8;
AACGUUUCUUGACUUGCGGdTdT, SEQ ID NO: 9). Short hairpin RNAs (shRNAs ) can also be used to decrease or inhibit ZAK expression. For example, Huang et al. (J. Biomed. Sci. 2009; 16(1): 11) describe the following method for making ZAK shRNA molecules. Two oligonucleotides, shRNA-F (36 nucleotides) and shRNA-R (41 nucleotides), were synthesized, each of which consisted of a 19- nucleotide stem sequence. The oligonucleotides used for shRNA were as follows: ZAK460iF (GATCCGCCTCTCGGTTCCATAACCATTTCAAGAGAA; SEQ ID NO: 3), ZAK460iR
(AGCTTAAAAAGCCTCTCGGTTCCATAACCATTCTCTTGAAA; SEQ ID NO: 4), ZAK1712iF (GATCCGCCAGTGGTTAGATACTCTGATTCAAGAGAT; SEQ ID NO: 5), ZAK1712iR
(AGCTTAAAAAGCCAGTGGTTAGATACTCTGATCTCTTGAAT; SEQ ID NO: 6). These shRNAs can be expressed in a cell using an expression vector (such as pCDNA-HU6) with a desired promoter, such as human U6 promoter, to decrease ZAK expression.
C. Pharmaceutical Compositions and Modes of Administration
Compositions, such as therapeutic or pharmaceutical compositions, are provided that include a therapeutically effective amount of an anthracycline, such as doxorubicin, daunorubicin, epirubicin, idarubicin, valrubicin, aclarubicin, amrubicin, pirarubicin and zorubicin (exemplary doses provided above) and a therapeutically effective amount of an inhibitor of ZAK activity.
It is desirable to prepare the anthracycline and/or the inhibitors of ZAK activity as a pharmaceutical composition appropriate for the intended application, for example to inhibit or treat a cellular proliferative disorder. Accordingly, methods for making a medicament or pharmaceutical composition containing an anthracycline
and/or an inhibitor of ZAK activity are included herein. Anthracyclines and/or inhibitors of ZAK activity can be prepared for administration alone or with other active ingredients, such as other chemotherapeutics.
When an anthracycline and an inhibitor of ZAK activity are administered to a subject, the administration can be concurrent or sequential. Sequential administration can be separated by any amount of time, so long as the desired affect is achieved. Multiple administrations of the compositions described herein are also contemplated.
Pharmaceutical compositions including an anthracycline and/or an inhibitor of ZAK activity can be administered to subjects by a variety of routes. This includes oral, nasal (such as intranasal), ocular, buccal, enteral, intravitral, or other mucosal (such as rectal or vaginal) or topical administration. Alternatively, administration will be by orthotopic, intradermal subcutaneous, intramuscular, parentral intraperitoneal, or iv injection routes. Such pharmaceutical compositions are usually administered as pharmaceutically acceptable compositions that include physiologically acceptable carriers, buffers or other excipients.
Typically, preparation of a pharmaceutical composition (for example, for use as a medicament or in the manufacture of a medicament) entails preparing a pharmaceutical composition that is essentially free of pyrogens, as well as any other impurities that could be harmful to humans or animals. Anthracycline and/or an inhibitors of ZAK activity may be included in pharmaceutical compositions
(including therapeutic and prophylactic formulations), which are typically combined together with one or more pharmaceutically acceptable vehicles or carriers and, optionally, other therapeutic ingredients.
To formulate the pharmaceutical compositions, anthracyclines and/or the inhibitor of ZAK activity can be combined with various pharmaceutically acceptable additives, as well as a base or vehicle for dispersion of the compound. Desired additives include, but are not limited to, pH control agents, such as arginine, sodium hydroxide, glycine, hydrochloric acid, citric acid, and the like. In addition, local anesthetics (for example, benzyl alcohol), isotonizing agents (for example, sodium chloride, mannitol, sorbitol), adsorption inhibitors (for example, Tween 80), solubility enhancing agents (for example, cyclodextrins and derivatives thereof), stabilizers (for example, serum albumin), and reducing agents (for example, glutathione) can be
included. When the composition is a liquid, the tonicity of the formulation, as measured with reference to the tonicity of 0.9% (w/v) physiological saline solution taken as unity, is typically adjusted to a value at which no substantial, irreversible tissue damage will be induced at the site of administration. Generally, the tonicity of the solution is adjusted to a value of about 0.3 to about 3.0, such as about 0.5 to about 2.0, or about 0.8 to about 1.7.
Anthracyclines and/or the inhibitor of ZAK activity can be dispersed in a base or vehicle, which can include a hydrophilic compound having a capacity to disperse the compound, and any desired additives. The base can be selected from a wide range of suitable compounds, including but not limited to, copolymers of polycarboxylic acids or salts thereof, carboxylic anhydrides (for example, maleic anhydride) with other monomers (for example, methyl (meth)acrylate, acrylic acid and the like), hydrophilic vinyl polymers, such as polyvinyl acetate, polyvinyl alcohol, polyvinylpyrrolidone, cellulose derivatives, such as hydroxymethylcellulose, hydroxypropylcellulose and the like, and natural polymers, such as chitosan, collagen, sodium alginate, gelatin, hyaluronic acid, and nontoxic metal salts thereof. Often, a biodegradable polymer is selected as a base or vehicle, for example, polylactic acid, poly(lactic acid-glycolic acid) copolymer, polyhydroxybutyric acid, poly (hydroxybutyric acid-glycolic acid) copolymer and mixtures thereof. Alternatively or additionally, synthetic fatty acid esters such as polyglycerin fatty acid esters, sucrose fatty acid esters and the like can be employed as vehicles. Hydrophilic polymers and other vehicles can be used alone or in combination, and enhanced structural integrity can be imparted to the vehicle by partial crystallization, ionic bonding, cross-linking and the like. The vehicle can be provided in a variety of forms, including fluid or viscous solutions, gels, pastes, powders, and microspheres.
The anthracycline and/or the inhibitor of ZAK activity can be combined with the base or vehicle according to a variety of methods, and release of the compound can be by diffusion, disintegration of the vehicle, or associated formation of water channels. In some circumstances, the compound is dispersed in microcapsules (microspheres) or nanocapsules (nanospheres) prepared from a suitable polymer, for example, isobutyl 2- cyanoacrylate (see, for example, Michael et al., J. Pharmacy Pharmacol. 43: 1-5, 1991),
and dispersed in a biocompatible dispersing medium, which yields sustained delivery and biological activity over a protracted time.
The anthracycline and/or the inhibitor of ZAK activity can alternatively contain as pharmaceutically acceptable vehicles substances as required to approximate physiological conditions, such as pH adjusting and buffering agents, tonicity adjusting agents, wetting agents and the like, for example, sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, and
triethanolamine oleate. For solid compositions, conventional nontoxic pharmaceutically acceptable vehicles can be used which include, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like.
Pharmaceutical compositions for administering the anthracycline and/or the inhibitor of ZAK activity can also be formulated as a solution, microemulsion, or other ordered structure suitable for high concentration of active ingredients. The vehicle can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, and the like), and suitable mixtures thereof. Proper fluidity for solutions can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of a desired particle size in the case of dispersible formulations, and by the use of surfactants. In many cases, it will be desirable to include isotonic agents, for example, sugars, polyalcohols, such as mannitol and sorbitol, or sodium chloride in the composition. Prolonged absorption of the compound can be brought about by including in the composition an agent which delays absorption, for example, monostearate salts and gelatin.
ZAK antibodies may be provided in lyophilized form and rehydrated with sterile water before administration, although they are also provided in sterile solutions of known concentration. In some examples, the antibody solution is then added to an infusion bag containing 0.9% sodium chloride, USP, and typically administered at a dosage of from 0.5 to 15 mg/kg of body weight. Considerable experience is available in the art in the administration of antibody drugs, which have been marketed in the U.S. since the approval of RITUXA ® in 1997. Antibodies can be administered by slow infusion, rather than in an intravenous push or bolus. In one example, a higher loading dose is administered, with subsequent, maintenance doses being administered
at a lower level. For example, an initial loading dose of 4 mg/kg may be infused over a period of some 90 minutes, followed by weekly maintenance doses for 4-8 weeks of 2 mg/kg infused over a 30 minute period if the previous dose was well tolerated.
For prophylactic and therapeutic purposes, the pharmaceutical compositions can be administered to the subject in a single bolus delivery, via continuous delivery (for example, continuous transdermal, mucosal or intravenous delivery) over an extended time period, or in a repeated administration protocol (for example, by an hourly, daily or weekly, repeated administration protocol). The therapeutically effective dosage of the compound can be provided as repeated doses within a prolonged prophylaxis or treatment regimen that will yield clinically significant results to alleviate one or more symptoms or detectable conditions associated with a targeted disease or condition as set forth herein.
Determination of effective dosages in this context is typically based on animal model studies followed up by human clinical trials and is guided by administration protocols that significantly reduce the occurrence or severity of targeted disease symptoms or conditions in the subject. Suitable models in this regard include, for example, murine, rat, porcine, feline, non-human primate, and other accepted animal model subjects known in the art. Alternatively, effective dosages can be determined using in vitro models (for example, immunologic and histopathologic assays). Using such models, only ordinary calculations and adjustments are required to determine an appropriate concentration and dose to administer a therapeutically effective amount of an anthracycline or an inhibitor of ZAK activity.
The appropriate dose will vary depending on the characteristics of the subject, for example, whether the subject is a human or non-human, the age, weight, and other health considerations pertaining to the condition or status of the subject, the mode, route of administration, and number of doses, and whether the pharmaceutical composition includes both an anthracycline and an inhibitor of ZAK activity, time and route of administration, other drugs or treatments being administered concurrently, as well as the specific pharmacology of the therapeutic compositions for eliciting the desired activity or biological response in the subject. Dosage regimens can be adjusted to provide an optimum prophylactic or therapeutic response.
A therapeutically effective amount is also one in which any toxic or detrimental side effects of the compound and/or other biologically active agent is outweighed in clinical terms by therapeutically beneficial effects. A non-limiting range for a therapeutically effective amount of an inhibitor of an anthracycline or an inhibitor of ZAK activity within the methods and formulations of the disclosure is about 0.0001 μg/kg body weight to about 10 mg/kg body weight per dose, such as about 0.0001 μg/kg body weight to about 0.001 μg/kg body weight per dose, about 0.001 μg/kg body weight to about 0.01 μg/kg body weight per dose, about 0.01 μg/kg body weight to about 0.1 μg/kg body weight per dose, about 0.1 μg/kg body weight to about 10 μg/kg body weight per dose, about 1 μg/kg body weight to about 100 μg/kg body weight per dose, about 100 μg/kg body weight to about 500 μg/kg body weight per dose, about 500 μg/kg body weight per dose to about 1000 μg/kg body weight per dose, or about 1.0 mg/kg body weight per dose to about 10 mg/kg body weight per dose.
In particular examples, ZAK inhibitory RNAs, such as antisense molecules, siRNAs and shRNAs are administered locally (e.g., to a tumor) or administered systemically. For example, RNAi molecules can be administered systemically in a liposomal formulation (such as encapsulated in stable nucleic acid lipid particles comprising synthetic cholesterol, l,2-distearoyl-sn-glycero-3-phosphocholine, PEG- cDMA, and l,2-dilinoleyloxy-3-(N,N-dimethyl)aminopropane, for example using the method of Zimmermann et al. (Nature 441 : 111 -4, 2006) or administered systemically as part of a complex with a variety of liposomes or cationic polymers or as a chemical conjugate to peptides, aptamers or antibodies as well as other formulations. For example, siRNA molecules can be administered as part of a wrapsome, using the methods described in Yagi et al. (Cancer Res 69(16):6531-8, 2009, herein incorporated by reference). In one example, RNAi molecules are encapsulated (such as in a wrapsome or lipid) and administered by intravenous injection at doses of 0.1 to 10 mg/kg, such as 0.5 to 10 mg/kg, 1 to 5 mg/kg, or 1 to 2.5 mg/kg, such as 1 or 2 mg/kg.
In particular examples, small molecule inhibitors of ZAK, such as sorafenib, imatinib, gefinitib, lapatinib, dasatinib, nilotinib, erlotinib, AMG-708, AST-487 are administered locally (e.g., to a tumor) or administered systemically. For example,
sorafenib can be administered PO 100 to 1000 mg (such as PO 400 mg) twice daily; imatinib can be administered PO 100 to 2000 mg (such as PO 400 to 800 mg, for example 400, 600, or 800 mg) twice daily; gefinitib can be administered orally 100 to 1000 mg (such as 250 or 500 mg orally) once daily; lapatinib can be administered orally 250 to 3000 mg (such as 1250 mg orally) once daily on days 1 through 21 continuously (for example in combination with capecitabine); dasatinib can be administered PO 25 to 1000 mg (such as PO 70, 100 or 140 mg) once daily; nilotinib can be administered PO 100 to 1000 mg (such as PO 400 mg) once or twice daily; erlotinib can be administered PO 10 to 500 mg (such as PO 50, 100, or 150 mg) daily; AMG-708 can be administered orally 1 to 1000 mg (such as 10 to 500 mg) daily; AST-487 can be administered orally 1 to 1000 mg (such as 10 to 500) daily.
Therapeutic compositions that include an anthracycline or an inhibitor of ZAK activity can be delivered by way of a pump (see Langer, supra; Sefton, CRC Crit. Ref. Biomed. Eng. 14:201, 1987; Buchwald et al , Surgery 88:507, 1980; Saudek et al , N. Engl. J. Med. 321 :574, 1989) or by continuous subcutaneous infusions, for example, using a mini-pump. An intravenous bag solution can also be employed. One factor in selecting an appropriate dose is the result obtained, as measured by the methods disclosed here, as are deemed appropriate by the practitioner. Other controlled release systems are discussed in Langer {Science 249: 1527-33, 1990).
In one example, a pump is implanted (for example see U.S. Patent Nos.
6,436,091 ; 5,939,380; and 5,993,414). Implantable drug infusion devices are used to provide patients with a constant and long-term dosage or infusion of a therapeutic agent. Such device can be categorized as either active or passive.
Active drug or programmable infusion devices feature a pump or a metering system to deliver the agent into the patient's system. An example of such an active infusion device currently available is the Medtronic SYNCHROMED™
programmable pump. Passive infusion devices, in contrast, do not feature a pump, but rather rely upon a pressurized drug reservoir to deliver the agent of interest. An example of such a device includes the Medtronic ISOMED™.
In particular examples, therapeutic compositions are administered by sustained-release systems. Suitable examples of sustained-release systems include suitable polymeric materials (such as, semi-permeable polymer matrices in the form
of shaped articles, for example films, or mirocapsules), suitable hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, and sparingly soluble derivatives (such as, for example, a sparingly soluble salt). Sustained-release compositions can be administered orally, parenterally,
intracistemally, intraperitoneally, topically (as by powders, ointments, gels, drops or transdermal patch), or as an oral or nasal spray. Sustained-release matrices include polylactides (U.S. Patent No. 3,773,919, EP 58,481), copolymers of L-glutamic acid and gamma-ethyl-L-glutamate (Sidman et al, Biopolymers 22:547-556, 1983, poly(2- hydroxyethyl methacrylate)); (Langer et al, J. Biomed. Mater. Res.15:167-277, 1981; Langer, Chem. Tech. 12:98-105, 1982, ethylene vinyl acetate (Langer et al, Id.) or poly-D-(-)-3-hydroxybutyric acid (EP 133,988).
Polymers can be used for ion-controlled release. Various degradable and nondegradable polymeric matrices for use in controlled drug delivery are known in the art (Langer, Accounts Chem. Res. 26:537, 1993). For example, the block copolymer, polaxamer 407 exists as a viscous yet mobile liquid at low temperatures but forms a semisolid gel at body temperature. It has shown to be an effective vehicle for formulation and sustained delivery of recombinant interleukin-2 and urease (Johnston et al, Pharm. Res. 9:425, 1992; and Pec, /. Parent. Sci. Tech. 44(2):58, 1990). Alternatively, hydroxyapatite has been used as a microcarrier for controlled release of proteins (Ijntema et al, Int. J. Pharm. 112:215, 1994). In yet another aspect, liposomes are used for controlled release as well as drug targeting of the lipid- capsulated drug (Betageri et al, Liposome Drug Delivery Systems, Technomic Publishing Co., Inc., Lancaster, PA, 1993). Numerous additional systems for controlled delivery of therapeutic proteins are known (for example, U.S. Patent No. 5,055,303; U.S. Patent No. 5,188,837; U.S. Patent No. 4,235,871; U.S. Patent No.
4,501,728; U.S. Patent No. 4,837,028; U.S. Patent No. 4,957,735; and U.S. Patent No. 5,019,369; U.S. Patent No. 5,055,303; U.S. Patent No. 5,514,670; U.S. Patent No. 5,413,797; U.S. Patent No. 5,268,164; U.S. Patent No. 5,004,697; U.S. Patent No. 4,902,505; U.S. Patent No. 5,506,206; U.S. Patent No. 5,271,961; U.S. Patent No. 5,254,342; and U.S. Patent No. 5,534,496).
D. Kits
The disclosure also provides kits that include one or more ZAK inhibitors and one or more anthracyclines. The inhibitor of ZAK activity and the anthracycline can be in the same or in separate containers. In some examples, the ZAK and the anthracycline are lyophilized, and reconstituted before administration to a subject. Kits can optionally include other agents, such as pharmaceutically acceptable carriers, other chemotherapeutic agents, instructions, and the like. In one example, the kit includes (for example, in a separate container) an antibody that can be used to detect the efficacy on ZAK by Western blotting.
///. Examples
EXAMPLE 1
Doxorubicin-induced MAPK activation and apoptosis are decreased after siRNA-mediated knockdown of ZAK
Ribotoxic stressors are characterized by their ability to activate JNK and p38
MAPK through inhibition of protein synthesis. In many cell types, ZAK, a MAP3K, is required for ribotoxic stressors to be capable of activating the MAPKs, through which these kinases modulate the transcription of downstream genes. In order to determine whether doxorubicin activates JNK and p38 MAPK, HaCaT cells were exposed to varying concentrations of doxorubicin and detected the increased phosphorylation of JNK and p38 MAPK by immunoblotting against an antibody specific for the phosphorylated form of JNK and p38 MAPK. Phosphorylation of these MAPKs was detected 24 hours after addition of doxorubicin (5 to 50 mM; FIG. 1A). To determine whether ZAK is required for doxorubicin to induce the phosphorylation of JNK and p38 MAPK, siRNA directed against the 5' portion of ZAK mRNA was used. SiRNA-mediated knockdown of ZAK strongly suppressed the phosphorylation of JNK and p38 MAPK, as determined in cells that harvested 24 hours after the addition of doxorubicin (FIG. 1A). Interestingly, the knockdown of ZAK decreased also the basal phosphorylation of p38 MAPK (FIG. 1A).
Similar to other cancer chemotherapeutic agents, doxorubicin induces apoptosis both in vivo and in vitro. To determine whether the pro-apoptotic effects of doxorubicin are regulated through activation of ZAK, the cleavage of poly ADP-
ribose polymerase (PARP) (from 116 kDa to 89 kDa) and caspase-3 (from procaspase to p20/pl9 and pi 7 subunits) was determined. These cleavage products are frequently employed as indicators of apoptosis. Knockdown of ZAK suppressed the doxorubicin-induced cleavage of both PARP and caspase-3 in HaCaT cells (FIG. 1A).
To investigate the effects of knockdown of ZAK on doxorubicin-mediated cell death by morphological criteria, HaCaT cells were analyzed after staining with a nuclear fluorescent dye, bisbenzimide (FIG. IB). Cells transfected with either scrambled (FIG. IB i) or ZAK-specific (FIG. IB ii) siRNA, but not treated with doxorubicin, demonstrated similar morphological features with the majority of the cells displaying uniform nuclear staining. A minority population in both groups displayed spontaneous apoptosis, manifested by brightly-fluorescent pyknotic or karyorrhetic nuclei (FIG. IB i and ii, arrowheads). These basal levels of apoptosis were attributed to the 24 hours of serum-deprivation. HaCaT cells transfected with scrambled siRNA and treated with doxorubicin (25 μΜ for 24 hours) displayed extensive post-apoptotic secondary necrosis, characterized by massive loss of normal cell- and nuclear morphology, decreased cellular chromatin content and the appearance of ring-like chromatin aggregates adjacent to the plasma membrane/cell borders (FIG. IB iii, arrows). Extracellular release of chromatin was evident in some areas as localized, pericellular increase of background fluorescence. In contrast, cells transfected with ZAK-specific siRNA and treated with doxorubicin (25 μΜ for 24 hours) displayed markedly preserved normal cell- and nuclear morphologies (FIG. IB iv).
To ensure that the ZAK siRNA did not produce off-target effects, an additional sequence of siRNA directed against the 5 ' portion of ZAK mRNA (FIG. 1 C) was used. SiRNA-mediated knockdown of ZAK using sequence #2 (SEQ ID NO: 7) also suppressed the doxorubicin-induced phosphorylation of JNK and p38 MAPK. Additionally, siRNA-mediated knockdown of ZAK using sequence #2 (SEQ ID NO: 7) suppressed the doxorubicin-induced cleavage of PARP, although not as effectively as sequence #1. For this reason, sequence #1 was used in subsequent studies.
EXAMPLE 2
Doxorubicin-induced inhibition of protein translation measured by incorporation of [3H] -leucine
To determine if doxorubicin inhibits protein synthesis, HaCaT cells were exposed to doxorubicin (1 to 25 mM) for varying times (6, 12, or 24 hours), at which times cells were exposed to [3H] -leucine for 30 minutes. Exposure to doxorubicin at concentrations of 2.5 mM or greater resulted in a progressive decrease in the incorporation of [3H]-leucine (FIG. IB). Cells treated with 2.5 mM doxorubicin decreased incorporation of [3H]-leucine to approximately 35% by the end of 24 hours; treatment with 10 and 25 mM reduced levels of [3H] -leucine incorporation to below 10% at 24 hours. Continuous examination of cells by microscopy demonstrated insignificant cell detachment, even 24 hours after addition of doxorubicin.
EXAMPLE 3
Emetine blocks MAPK activation after a high dose of doxorubicin
Transduction by ribotoxic stressors of signals that lead to activation of SAPKs requires that the ribosomes be involved in protein synthesis at the time that cells are exposed to the stressor. Blockade of protein synthesis by fast-acting inhibitors such as emetine, prior to the exposure of cells to ribotoxic stressors, prevents transduction of the signal(s) that lead to activation of JNK and p38 MAPK. For example,
Iordanov, et al. (Mol. Cell. Biol. 17:3373-81, 1997) demonstrated that emetine blocked protein synthesis in less than 1 minute after the addition to cells. To determine whether prior treatment of HaCaT cells with emetine would block the activation of JNK and p38 MAPK, cells were exposed to emetine or vehicle prior to the addition of doxorubicin. A high concentration of doxorubicin (0.5 mM) was used to induce the rapid phosphorylation of JNK and p38 MAPK. Doxorubicin induced the phosphorylation of JNK and p38 MAPK at 2 hours, but not at 1 hour or earlier (FIG. 2A). Addition of emetine prior to the exposure to doxorubicin completely blocked the phosphorylation of JNK and p38 MAPK FIG. 2A). Doxorubicin suppressed the incorporation of [3H]-leucine by 50% at 1 hour and completely at 2 hours. A similar study was performed using CdCl2, which is not a ribotoxic stressor and leads to the activation of JNK and p38 MAPK through other mechanisms. In
contrast to doxorubicin, the phosphorylation of JNK and p38 MAPK was not suppressed by emetine (FIG. 2C). These studies indicate that emetine blocks MAPK activation after a high dose of doxorubicin. EXAMPLE 4
Inhibitors of ZAK block doxorubicin-induced apoptosis and MAPK activation in
HaCaT cells
A goal in cancer chemotherapy is to reduce collateral damage in normal tissues and organs. The administration of effective doses of doxorubicin to cancer patients is frequently limited by the potential for development of cardiotoxicity and other adverse responses. Identification of agents that could selectively suppress the destruction of normal tissue by doxorubicin may permit the administration of larger or more frequent doses of doxorubicin to cancer patients. A small molecule kinase inhibitor with a high binding affinity for ZAK is nilotinib (Novartis, Kd=3nM), which also inhibits breakpoint cluster region-abelson (BCR-ABL) and is currently in clinical use for treatment of chronic myelogenous leukemia.
To determine whether sorafenib or nilotinib would inhibit downstream actions of ZAK, agents (ImM) were administered to HaCaT cells 30 minutes prior to treatment with doxorubicin (lOmM or 25mM) for 24 hours. The presence of either inhibitor strongly suppressed doxorubicin-induced phosphorylation of JNK and p38 MAPK (FIG. 3A). Just as in HaCaT cells exposed to ZAK siRNA, exposure of these cells to sorafenib or nilotinib decreased the basal phosphorylation of p38 MAPK (FIG. 3A). Sorafenib and nilotinib also reduced the cleavage of PARP and caspase-3, suggesting that doxorubicin-mediated apoptosis was also suppressed.
EXAMPLE 5
ZAK inhibitors block daunorubicin-induced apoptosis and MAPK activation in
HaCaT cells
Daunorubicin is an anthracycline that is considered to act by similar mechanisms as doxorubicin, but shows less potent antitumor activity. To determine whether the inhibition of ZAK effects daunorubicin-induced apoptosis and MAPK activation, HaCaT cells were pretreated with sorafenib or nilotinib (ImM) followed
by daunorubicin (2.5, 10, 25 mM) for 24 hour. Similar to the studies with
doxorubicin, the presence of either inhibitor strongly suppressed daunorubicin- induced phosphorylation of JNK and p38 MAPK (FIG. 3B). Sorafenib and nilotinib also reduced the cleavage of PARP and caspase-3, indication that daunorubicin- mediated apoptosis was also suppressed. This result demonstrates that ZAK inhibitors can inhibit the deleterious effects of anthracyclines in general.
EXAMPLE 6
Inhibitors of JNK or p38 partially block doxorubicin-induced apoptosis in
HaCaT cells
ZAK is a MAP3K that has been shown to induce the phosphorylation of p38 MAPK and JNK. To determine whether suppression of JNK or p38 MAPK would inhibit doxorubicin-induced apoptosis, SB 203580 (10 mM), SP 600125 (20mM), or both in combination were administered to HaCaT cells 30 minutes prior to treatment with 25 mM doxorubicin for 24 hours. The presence of either inhibitor or a combination of resulted in diminished cleavage of PARP and caspase-3, indicating that JNK and p38-MAPK participated to an extent in doxorubicin-mediated apoptosis. In the presence of a pancaspase inhibitor, zVAD-fmk, doxorubicin-induced apoptosis was completely inhibited (FIG. 3C).
EXAMPLE 7
ZAK inhibitors and ZAK siRNA do not block doxorubicin-induced apoptosis in
HeLa cells
To determine whether ZAK inhibitors would reduce cell death in a cancerous cell line HeLa cells were pretreate with sorafenib or nilotinib (1 mM) followed by doxorubicin (10 mM or 25 mM) for 24 hours. In contrast to their ability to suppress PARP and caspase-3 cleavage in HaCaT cells, sorafenib and nilotinib failed to reduce PARP or caspase-3 cleavage in HeLa cells (FIG. 4A). In HeLa cells, doxorubicin failed to increase the phosphorylation of JNK and p38 MAPK, perhaps because the basal levels of these phosphorylated SAPKs were already elevated in the absence of an inducer. Nevertheless, the phosphorylation of SAPKs was suppressed by sorafenib and nilotinib, suggesting that the inhibitors were capable of suppressing ZAK in these
cells. These data suggest that the elevated endogenous activity of ZAK in HeLa cells may be responsible for the increased basal phosphorylation of JNK and p38 MAPK.
To determine whether ZAK siRNA would reduce doxorubicin-mediated apoptosis in HeLa cells, ZAK-targeting siRNAs were used. SiRNA-mediated knockdown of ZAK slightly reduced doxorubicin-mediated cleavage of PARP and caspase-3 in HeLa cells (FIG. 4B), indicating that the pro-apoptotic actions of doxorubicin in these cells was mediated in part through activation of ZAK.
EXAMPLE 8
Doxorubicin- induced alterations of ZAK protein
ZAK has two different isoforms, ZAK-a and ZAK-b. ZAK-a has an apparent molecular weight of 91 kDa. ZAK-b is a shorter species of ZAK (51 kDa) because it lacks several exons in the coding region and, compared to ZAK-a, has a distinct C- terminus. When HaCaT or HeLa cells were treated with doxorubicin and
immunoblotted for ZAK, the ZAK-a band decreased in intensity (FIG 1 A and FIG. 4B). In addition, bands of slightly higher molecular weight appeared above the 51 kDa ZAK-b band (FIG. 1 A * and FIG. 4B *).
To determine the kinetics of the disappearance of the ZAK-a band and the appearance of slightly higher molecular weight bands above ZAK-b, 25 mM of doxorubicin were added to HaCaT cells and the cells harvested at 4-hour intervals up to 24 hours for immunoblotting with ZAK Ab. The higher molecular weight bands above ZAK-b appeared 8 hours after doxorubicin treatment and increased in intensity thereafter. The disappearance of the 91 kDa ZAK-a began 16 hours after doxorubicin treatment (FIG. 5A).
To determine if the doxorubicin-induced disappearance of the ZAK-a band and the appearance of the higher molecular weight bands above ZAK-b were due to phosphorylation, lysates were exposed to calf intestinal phosphatase (CIP). The presence of CIP did not alter the disappearance or appearance of the ZAK bands, indicating that neither was a result phosphorylation. Immunoblotting with phospho- p38 confirmed the efficacy of the phosphatase treatment.
To determine if the doxorubicin-induced changes in the two ZAK isoforms could result from ubiquitin- mediated proteolysis, MG-132 an inhibitor of proteasomal
degradation was utilized. The presence of the MG-132 compound did not affect the disappearance of the 91 kDa ZAK-a band, suggesting that its disappearance was not proteasome dependent (FIG. 5B). By contrast, the higher molecular weight bands above ZAK-b increased in intensity in the presence of the MG-132 compound, suggesting that these bands undergo proteasome-mediated degradation after doxorubicin treatment.
To determine if the multi-kinase inhibitors, sorafenib and nilotinib, could prevent the doxorubicin-induced changes in ZAK, HaCaT cells were pretreated with sorafenib or nilotinib (1 mM) followed by doxorubicin (10 or 25 mM) for 24 hours. The presence of either inhibitor prevented both the disappearance of ZAK-a and the appearance of the higher molecular weight bands above ZAK-b, suggesting that the degradation of ZAK-a and the appearance of higher molecular weight bands above ZAK-b are coupled to the activation of ZAK (FIG. 5C). To determine whether suppressing the phosphorylation of JNK or p38 MAPK would inhibit doxorubicin- induced degradation or modification of the ZAK isoforms, SB 203580 (lOmM), SP 600125 (20mM), or a combination of the two was administered to HaCaT cells 30 minutes prior to treatment with 25 mM doxorubicin for 24 hours. The presence of either inhibitor or a combination of both did not prevent the disappearance of ZAK-a or the appearance of the higher molecular weight bands albove ZAK-b (FIG. 5D), suggesting that the ZAK-mediated activation of JNK or p38 MAPK did not act retrogradely to cause the disappearance of ZAK-a or the appearance of the higher molecular weight bands above ZAK-b.
EXAMPLE 9
Materials and Methods
The following materials and methods were used in EXAMPLES 1-8.
Antibodies and other reagents: Antibodies against the phosphorylated forms of ERK, JNK, p38 and against active caspase-3 were obtained from Cell Signaling Technology® (Danvers, MA). Antibodies against PARP (H-250), JNK1 (FL), and p38 were obtained from Santa Cruz Biotechnology® (Santa Cruz, CA). Doxorubicin, daunorubicin, bisbenzimide, CdC12, and emetine were obtained from Sigma- Aldrich® (St. Louis, MO). SB 203580, SP 600125, MG-132 and zVAD-fmk were purchased
from EMD Chemicals (Gibbstown, NJ). Scrambled siRNA oligonucleotides (sequence: CAA CAC GGA CAU CAU ACG ATT (SEQ ID NO: 10)), ZAK siRNA oligonucleotides, and ZAK#2 siRNA oligonucleotides (sequence: UGU UCA ACU CCU AAC UGC GTT (SEQ ID NO: 7)) were synthesized by the Research Core Facility at Oregon Health & Science University, Portland, OR. Sorafenib and nilotinib were obtained from LC Laboratories® (Woburn, MA). [3H]-leucine was obtained from PerkinElmer® (Waltham, MA).
siRNA knockdown of ZAK: HaCaT or HeLa cells were grown to 70% confluency and treated in Dulbecco modified Eagle medium/10% fetal bovine serum (FBS). ZAK or scrambled (scr) control siRNA were transfected, after titration of siRNA concentration was performed, at 50 nM siRNA per well using
DharmaFECT® 4 (Dharmacon®, Lafayette, CO) according to the manufacturer's instructions. After 72 hours (HaCaT) or 48 hours (HeLa), complete medium was removed and the cells were serum deprived for 1 hour prior to addition of doxorubicin or vehicle (deionized water) for 24 hours, at the indicated doses, prior to the harvest of cell lysates. Cell lysates were subjected to immunoblotting.
Fluorescent nuclear staining: HaCaT cells were plated on coverslips and exposed to siRNA for 72 hours, followed by exposure to 25 μΜ doxorubicin or vehicle (deionized water) for 24 hours. Cells were fixed in 100% methanol for 5 minutes at 4°C and exposed to 10 μg/mL bisbenzimide. Images were captured by a Leica DFC350 FX camera attached to a Leica DM IRE2 microscope.
Measurement of protein synthesis via [3H] -leucine incorporation: HaCaT cells were grown in 12- well tissue culture plates. Treatments were performed in leucine-free/serum-free Dulbecco's Modified Eagle Medium (DMEM), for the indicated times and doses of doxorubicin. For the final 30 minutes of doxorubicin exposure prior to harvesting, cells were pulse-labeled with 1 μθ [3H]-leucine in 1 ml DMEM. Ten percent trichloroacetic acid was added to terminate incorporation. Following thorough rinsing with water, 88% formic acid was added to solubilize the trichloroacetic acid-insoluble proteins and the samples were counted in a liquid scintillation counter. In each study, three wells were used per point.
Immunoblotting: Equal numbers of HaCaT or HeLa cells were plated, serum deprived for 30 minutes, treated, and lysed in 2X electrophoresis sample buffer (ESB)
lysis buffer in preparation for immunoblotting. Equal volumes of the cell lysates were separated on a 10% or 13% (for caspase-3 antibody) denaturing polyacrylamide gel in the presence of sodium dodecyl sulfate and were transferred onto polyvinylidene difluoride membranes according to standard laboratory procedures. Membranes were incubated with the indicated antibodies and the corresponding horseradish peroxidase - conjugated secondary antibodies; signals were detected by using enhanced chemiluminescence.
Trials with emetine: HaCaT cells were serum deprived and then pretreated for 0.5 h with 100 μg/ml emetine or vehicle (DMSO), followed by treatment with 0.5 mM doxorubicin, 100 μΜ CdC12, or vehicle (deionized water) for the indicated times. Cells were harvested at various times and subjected to immunoblotting.
Treatment with inhibitors: Serum-deprived HaCaT or HeLa cells were pretreated for 0.5 hours with sorafenib (1 μΜ), nilotinib (1 μΜ), SB 203580 (10 μΜ), SP 600125 (20 μΜ), zVADfmk (25 μΜ) or vehicle (DMSO). At 12 hours an additional dose of equal amount was added to each well. Cells were treated with the indicated doses of doxorubicin (10 or 25 μΜ), daunorubicin (2.5, 10 or 25 μΜ), or vehicle (deionized water) for 24 hours, harvested, and subjected to immunoblotting.
Doxorubicin time course: HaCaT cells were serum deprived and treated with 25 μΜ doxorubicin or vehicle (deionized water) in four-hour increments from 4-24 hours. Cell lysates were subjected to immunoblotting.
Treatment with MG-132, a proteosome inhibitor: HaCaT cells were serum deprived and treated with 25 mM of doxorubicin or vehicle (deionized water). Eight hours after addition of doxorubicin, 5 μΜ MG-132 or vehicle (DMSO) was added to the corresponding wells. Treatment continued for 12 hours for a total of 20 hours of doxorubicin treatment then cells were harvested and subjected to immunoblotting.
EXAMPLE 10
In vitro and in vivo methods for testing other ZAK inhibitors
The effects of other known or suspected ZAK activity inhibitors, such as AMN-107 (a tyrosine kinase inhibitor (Bcr-Abl inhibitor) with a high affinity for ZAK inhibition, also referred to as nilotinib), can be determined by in vitro and in vivo studies. For example, the effects on JNK and p38 MAPK activation, on
induction of apoptosis, and on expression of inflammatory genes following administration of an anthracycline (such as doxorubicin) can be performed.
Normal and cancer cell lines available from American type Culture Collection (ATCC), including a pseudo-normal cardiomyocyte cell line, are incubated in the presence of 5, 25, or 50 μΜ doxorubicin for 24 hours. Subsequently, 1 to 100 μΜ AMN- 107 (4-methyl-N-[3-(4-methyl- lH-imidazol)-5-(trifluoromethyl)phenyl]-3-(3- pyridinyl)-2pyridinyl] amino] benzamide, hydrochloride) or other ZAK inhibitor is added to the cells and incubated for 2 to 48 hours, such as 24 hours. As a control, no ΑΜΝ-107 or other ZAK inhibitor is added. The ability of ΑΜΝ-107 or other ZAK inhibitor to reduce or inhibit the death of these cells following administration of doxorubicin is then determined, for example using the methods described herein, including the methods described in Examples 1, 2 and9. It is expected that the addition of ΑΜΝ-107 (or other ZAK inhibitor) to cells pre-treated with doxorubicin will reduce or inhibit the death of the cells in response to doxorubicin.
Animal studies in mice can be used to demonstrate that ΑΜΝ-107 or other
ZAK inhibitor can prevent or reduce organ toxicity (such as cardiomyopathy) in response to doxorubicin. Doxorubicin (40 to 200 mg/m2) is administered to mice iv in the presence or absence of 10 to500 mg ΑΜΝ-107. Subsequently, the effect of ΑΜΝ-107 or other ZAK inhibitor on doxorubicin organ toxicity is determined , for example by inflammatory responses and cell death (e.g., apoptosis). It is expected that administration of ΑΜΝ-107 to mice treated with doxorubicin will reduce or inhibit organ toxicity (such as cardiomyopathy) in response to doxorubicin.
In some examples, the mice have a cancer that is responsive to doxorubicin. For example, mice having a cancer (such as lung cancer or a leukemia) are administered doxorubicin (40 to 200 mg/m2) iv in the presence or absence of ΑΜΝ- 107 or other ZAK inhibitor (such as 10 to 500 mg). In some examples, the dose of doxorubicin is elevated relative to "normal" doses currently used to treat patients with cancer. Subsequently, the effect of ΑΜΝ-107 or other ZAK inhibitor on doxorubicin organ toxicity is determined, for example by inflammatory responses and cell death (e.g., apoptosis). It is expected that administration of ΑΜΝ-107 or other ZAK inhibitor to mice treated with doxorubicin will reduce or inhibit organ toxicity (such as cardiomyopathy) in response to elevated doses of doxorubicin.
EXAMPLE 11
Treatment of Subjects
This example describes methods that can be used to treat a subject having a particular disease or condition that can be treated by the combination of a ZAK inhibitor and an anthracycline. Such a therapy can be used alone, or in combination with other therapies (such as the administration of other chemotherapeutic agents).
In particular examples, the method includes screening a subject having or thought to have a particular disease or condition treatable by the combination of a ZAK inhibitor and an anthracycline to identify those subjects that can benefit from administration of the a ZAK inhibitor and an anthracycline. Subjects of an unknown disease status or condition can be examined to determine if they have disease or condition treatable by a combination of a ZAK inhibitor and an anthracycline.
The subject can be administered a therapeutic amount of a ZAK inhibitor and an anthracycline. The ZAK inhibitor can be administered at doses of 0.0001 μg/kg body weight to about 10 mg/kg body weight per dose, such as 0.0001 μg/kg body weight - 0.001 μg/kg body weight per dose, 0.001 μg/kg body weight - 0.01 μg/kg body weight per dose, 0.01 μg/kg body weight - 0.1 μg/kg body weight per dose, 0.1 μg/kg body weight - 10 μg/kg body weight per dose, 1 μg/kg body weight - 100 μg/kg body weight per dose, 100 μg/kg body weight - 500 μg/kg body weight per dose, 500 μg/kg body weight per dose - 1000 μg/kg body weight per dose, or 1.0 mg/kg body weight per dose - 10 mg/kg body weight per dose. However, the particular dose can be determined by a skilled clinician.
The anthracycline, such as doxorubicin, daunorubicin, epirubicin, idarubicin, valrubicin, clarubicin, amrubicin, pirarubicin and zorubicin, can be administered at doses or between about 10 mg/m2/day iv 10 about 250 mg/m2/day iv, such as about 10 mg/m2/day iv, 20 mg/m2/day iv, 30 mg/m2/day iv, 10 mg/m2/day iv 40 mg/m2/day iv, about 50 mg/m2/day iv, about 75 mg/m2/day iv, about 90 mg/m2/day iv, about 120 mg/m2/day iv, such as 10-90 mg/m2/day iv, or 50 to 70 mg/m2/day iv. The ZAK inhibitor and the anthracycline can be administered in several doses, for example continuously, daily, weekly, or monthly. The administration can concurrent or sequential.
The mode of administration can be any used in the art. The amount of the ZAK inhibitor and the anthracycline administered to the subject can be determined by a clinician, and may depend on the particular subject treated. Specific exemplary amounts are provided herein (but the disclosure is not limited to such doses).
In view of the many possible embodiments to which the principles of the disclosure may be applied, it should be recognized that the illustrated embodiments are only examples of the disclosure and should not be taken as limiting the scope of the disclosure. Rather, the scope of the disclosure is defined by the following claims. I therefore claim as my invention all that comes within the scope and spirit of these claims.
Claims
1. A method of inhibiting or treating cardiomyopathy in a subject previously treated with, being treated with or soon to be treated with an anthracycline, comprising:
selecting a subject previously treated with, being treated with, or soon to be treated with the anthracycline; and
administering to the subject a therapeutically effective amount of an inhibitor of ZAK activity, thereby treating or inhibiting the cardiomyopathy in the subject.
2. The method of claim 1, wherein the cardiomyopathy is an
anthracyc line-induced cardiomyopathy and the subject is one who is or has been treated with an anthracycline.
3. A method of increasing a subject's tolerable amount of an
anthracycline by inhibiting or treating the cardiotoxic effects of the anthracycline, comprising:
selecting a subject for treatment with or being treated with the anthracycline; and
administering to the subject a therapeutically effective amount of an inhibitor of ZAK activity, thereby increasing a subject's tolerable amount of an anthracycline by inhibiting or treating the cardiotoxic effects of the anthracycline.
4. The method of anyone of claims 1-3, further comprising administering the anthracycline.
5. The method of any one of claims 1-4, wherein the subject has a cancer that responds to treatment with the anthracycline.
6. A method for treating or inhibiting cancer in a subject with a cancer that responds to cardiotoxic doses of an anthracycline without the cardiotoxic effects of the anthracycline, the method comprising: selecting a subject with a cancer that responds to toxic doses of an
anthracycline; and
co-administering to the subject,
a) a dose of the anthracycline that is considered cardiotoxic to the subject; and
b) a therapeutically effective amount of an inhibitor of ZAK activity, wherein the therapeutically effective amount of the inhibitor of ZAK activity is an amount of the inhibitor of ZAK activity sufficient to counteract the cardiotoxic effects of the anthracycline,
thereby treating or inhibiting the cancer in subject with a cancer that responds to cardiotoxic doses of an anthracycline, without the cardiotoxic effects of the anthracycline.
7. The method of anyone of claims 1-6, wherein the anthracycline is doxorubicin, daunorubicin, epirubicin, idarubicin, valrubicin, aclarubicin, amrubicin, pirarubicin and zorubicin or a combination thereof.
8. The method of anyone of claims 5-7, wherein the cancer is one or more of leukemia, bladder cancer, breast cancer, stomach cancer, lung cancer, ovarian cancer, thyroid cancer, soft tissue sarcoma, multiple myeloma, Bacille Calmette- Guerin (BCG)-refractory carcinoma in situ, neuroblastoma, gastric cancer or lymphoma.
9. The method of claim 8, wherein the lymphoma is Hodgkin's lymphoma.
10. The method of claim 8, wherein the leukemia is acute myelogenous leukemia or chronic myelogenous leukemia.
11. The method of any one of claims 1-10, wherein the inhibitor of ZAK activity is one or more of a small molecule inhibitor of ZAK activity, an inhibitory RNA that inhibits the expression of ZAK protein, or an antibody that specifically binds ZAK.
12. The method of claim 11, wherein the inhibitor of ZAK activity is the small molecule inhibitor of ZAK activity.
13. The method claim 12, wherein the small molecule is one or more of sorafenib, imatinib, gefinitib, lapatinib, dasatinib, nilotinib, temsirolimus, erlotinib, AMG-708, AST-487 or DHP-2.
14. The method of claim 11, wherein the inhibitor of ZAK activity is the inhibitory RNA that inhibits the expression of ZAK protein.
15. The method of claim 14, wherein the inhibitory RNA comprises the nucleic acid sequence according to SEQ ID NO: 3, 4, 5, 6, 7, 8, or 9.
16. A pharmaceutical composition comprising a therapeutically effective amount of an inhibitor of ZAK activity and a therapeutically effective amount of an anthracycline.
17. A kit comprising:
a ZAK inhibitor; and
an anthracycline.
18. The kit of claim 17, wherein the inhibitor of ZAK activity and the anthracycline are in separate containers.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US25453309P | 2009-10-23 | 2009-10-23 | |
| US61/254,533 | 2009-10-23 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2011050319A2 true WO2011050319A2 (en) | 2011-04-28 |
| WO2011050319A3 WO2011050319A3 (en) | 2011-09-29 |
Family
ID=43900998
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2010/053842 Ceased WO2011050319A2 (en) | 2009-10-23 | 2010-10-22 | Inhibiting the deleterious effect of anthracyclines |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2011050319A2 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015164294A1 (en) * | 2014-04-22 | 2015-10-29 | The Feinstein Institute For Medical Research | Treatment of solid tumors by inhibiting mrk/zak |
| EP4467139A1 (en) * | 2023-05-25 | 2024-11-27 | Universidad de Murcia | Zak alpha kinase (map3k20) inhibitors for use in the treatment of anemia |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE3070457D1 (en) * | 1979-10-02 | 1985-05-15 | Ciba Geigy Ag | Combinatory compositions for use in a method for enhancing the activity of antibiotics, antibiotic preparations having enhanced activity and process for their production |
| AU1770299A (en) * | 1997-12-23 | 1999-07-19 | Nycomed Imaging As | Nitric oxide releasing chelating agents and their therapeutic use |
| US6048736A (en) * | 1998-04-29 | 2000-04-11 | Kosak; Kenneth M. | Cyclodextrin polymers for carrying and releasing drugs |
| WO2005118833A2 (en) * | 2004-06-01 | 2005-12-15 | Bayer Healthcare Ag | Diagnostics and therapeutics for diseases associated with sterile-alpha motif and leucine zipper containing kinase (zak) |
-
2010
- 2010-10-22 WO PCT/US2010/053842 patent/WO2011050319A2/en not_active Ceased
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015164294A1 (en) * | 2014-04-22 | 2015-10-29 | The Feinstein Institute For Medical Research | Treatment of solid tumors by inhibiting mrk/zak |
| US10144723B2 (en) | 2014-04-22 | 2018-12-04 | The Feinstein Institute For Medical Research | Treatment of solid tumors by inhibiting MRK/ZAK |
| EP4467139A1 (en) * | 2023-05-25 | 2024-11-27 | Universidad de Murcia | Zak alpha kinase (map3k20) inhibitors for use in the treatment of anemia |
| WO2024240822A1 (en) * | 2023-05-25 | 2024-11-28 | Universidad De Murcia | Zak alpha kinase (map3k20) inhibitors for use in the treatment of anemia |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2011050319A3 (en) | 2011-09-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP2025011138A (en) | Compounds and methods for modulating angiotensinogen expression | |
| JP6833705B2 (en) | Compounds and methods for regulating TMPRSS6 expression | |
| TW202132568A (en) | Methods and compositions for treating an angiotensinogen- (agt-) associated disorder | |
| JP7003044B2 (en) | Treatment of angiogenesis-related diseases with RNA complexes targeting ANGPT2 and PDGFB | |
| WO2016106405A1 (en) | Rna interference compositions and methods for malignant tumors | |
| TW201420594A (en) | Modulation of androgen receptor expression | |
| ZA200407649B (en) | Antisense IAP nucleobase oligomers and uses thereof | |
| EP3384028B1 (en) | Monocarboxylate transporter 4 (mct4) antisense oligonucleotide (aso) inhibitors for use as therapeutics in the treatment of cancer | |
| CA3075205A1 (en) | Stabilized hnf4a sarna compositions and methods of use | |
| EP2520651A2 (en) | Sirna for inhibiting c-met expression and an anti-cancer composition comprising the same | |
| CN104302768A (en) | Rnai agents to treat beta-catenin related diseases | |
| JP2018533956A (en) | Treatment of age-related macular degeneration using RNA complexes targeting MyD88 or TLR3 | |
| BR112021015323A2 (en) | MALAT1 EXPRESSION MODULATORS | |
| EP4097234A1 (en) | Antisense oligonucleotide targeting linc00518 for treating melanoma | |
| WO2012091496A2 (en) | siRNA FOR INHIBITION OF Hif1α EXPRESSION AND ANTICANCER COMPOSITION CONTAINING THE SAME | |
| CN105555279B (en) | MicroRNA inhibition for treatment of sepsis | |
| EP3833397A1 (en) | Compositions and agents against nonalcoholic steatohepatitis | |
| WO2011050319A2 (en) | Inhibiting the deleterious effect of anthracyclines | |
| JP7431728B2 (en) | Regulators of ENaC expression | |
| US20250197859A1 (en) | Compositions and methods for the treatment of angiopoietin like 7 (angptl7) related diseases | |
| EP3294887A1 (en) | Mirna compositions for the treatment of mature b-cell neoplasms | |
| US20250161347A1 (en) | Methods and compositions for treating non-alcoholic fatty liver disease | |
| US20230407297A1 (en) | Bioengineered wnt5a therapeutics for advanced cancers | |
| US20110039909A1 (en) | Methods and materials for reducing gli2 expression | |
| KR20180051862A (en) | Pharmaceutical Composition for Preventing or Treating Ovarian Cancer having Anti-cancer Drug Resistance |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10825782 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 10825782 Country of ref document: EP Kind code of ref document: A2 |