WO2011046972A2 - Compositions and methods for suppressing primer interactions - Google Patents

Compositions and methods for suppressing primer interactions Download PDF

Info

Publication number
WO2011046972A2
WO2011046972A2 PCT/US2010/052387 US2010052387W WO2011046972A2 WO 2011046972 A2 WO2011046972 A2 WO 2011046972A2 US 2010052387 W US2010052387 W US 2010052387W WO 2011046972 A2 WO2011046972 A2 WO 2011046972A2
Authority
WO
WIPO (PCT)
Prior art keywords
primer dimer
primer
pdi
nucleic acid
amplification
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2010/052387
Other languages
French (fr)
Other versions
WO2011046972A3 (en
Inventor
Benjamin Schroeder
Michael Wenz
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Life Technologies Corp
Original Assignee
Life Technologies Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Life Technologies Corp filed Critical Life Technologies Corp
Publication of WO2011046972A2 publication Critical patent/WO2011046972A2/en
Publication of WO2011046972A3 publication Critical patent/WO2011046972A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6848Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction

Definitions

  • the present disclosure generally provides compositions, methods and kits for reducing unwanted primer interactions (e.g., primer dimer structure formation). More specifically, the disclosure provides for compositions, methods and kits for reducing non-specific side products and/or interactions resulting from primer dimer formation prior to or during amplification of target nucleic acids.
  • compositions, methods and kits for use in primer- mediated nucleic acid amplification for example, in polymerase chain reactions (PCR).
  • PCR polymerase chain reactions
  • PCR is an example of a nucleic acid amplification method that can provide a highly sensitive means for detecting the presence of target nucleic acids by selective amplification of a target nucleic acid sequence.
  • a significant problem with nucleic acid amplifications such as PCR is the generation of non-specific amplification products.
  • One example of a non-specific amplification process that can be problematic in PCR reactions is "primer dimer" amplification.
  • Primer dimer formation during primer-mediated reactions is one of the most common pitfalls in assay development for a wide range of applications, including those involving Real Time PCR, solid phase amplification and sequencing.
  • primer dimers lead to the amplification of non-specific products ("artifacts") as a result of two or more primers closely interacting during a nucleic acid amplification reaction, such as PCR.
  • primer dimer interactions can result when, for example, the 3' terminal region of a primer has some degree of complementarity with itself or another primer.
  • Such primers can then hybridize to one another to form primer dimers. This phenomenon can occur even in the absence or prior to the addition of any nucleic acid template.
  • primer dimer artifacts can prevent or reduce amplification of true nucleic acid targets, especially at low input copy number.
  • Primer dimer artifacts can also contribute to poor sequence data at the beginning of a sequence trace, where both the primer dimer and target amplicon sequences overlap.
  • primer-dimer formation can also be problematic during any assay that employs double-stranded DNA binding dyes, such as SYBR ® GREEN. During these types of assays, non-specific primer dimer products can react with such dyes resulting in a false positive fluorescent signal that can typically only be resolved by melting curve analysis.
  • primer dimer amplicon generation is the depletion of the overall number of primers resulting in reduced sensitivity or even a failure to amplify the intended target nucleic acid.
  • the addition of a large excess of primers during PCR reactions allows even weak complementarity at the 3' terminal region to result in primer dimer amplicons.
  • primer dimers can hinder or prevent the amplification of the desired target, even when using all applicable rules for appropriate primer design. Consequently, there is a need to develop reagents and methods that suppress primer dimer formation in amplification reactions such as PCR.
  • Primer dimers Template-independent amplification artifacts, commonly referred to as primer dimers, are a widely observed phenomenon. In demanding amplification applications, such as single molecule PCR, primer dimers can be especially vexing because of the high number of cycles required to amplify a single template molecule. Artifacts such as primer dimers can often out-compete the amplification of the desired target, preventing successful single molecule amplification.
  • Several methods for primer dimer reduction and/or prevention have been described in the literature, including using hot-start polymerase, using primers containing modified nucleotides, using primers containing identical 5' tails, and performing PAP (pyrophosphorolysis activated polymerization).
  • hot-start methods can be effective in reducing primer dimers, for very demanding applications, such as single molecule PCR
  • the use of hot-start alone may not completely eliminate primer dimer artifacts.
  • additional primer dimer reduction methods can be used in addition to hot-start.
  • Such methods typically rely on redesigning individual primer sequences or incorporating non-natural bases into primers which is highly sequence dependent, and often requires extensive trial and error testing to find an effective design. Adding identical 5' tails increases the primer length and therefore cost, and may not be compatible with some downstream applications.
  • PAP methods also require the use of expensive modified primers and unusual reaction conditions, including a non-standard polymerase.
  • a novel primer dimer reducing compound or additive has been discovered that can suppress the formation of unwanted PCR amplification side reaction products. It has been found, surprisingly, that the presence of unrelated primer' dimer inhibitor polynucleotides in PCR amplification reactions can suppress the formation of primer dimers. In some embodiments, for example, 5' nuclease probes were found to be effective for primer dimer reduction even when the primer dimer inhibitor polynucleotide sequences were completely unrelated to the amplicon sequence of interest.
  • the present teachings provide for the unexpected and surprising observation that inclusion of an otherwise unrelated and undesirable polynucleotide-containing compounds, such as those containing 5' nuclease probes, in a PCR reaction can suppress the formation of unwanted primer dimer side products.
  • compositions for amplifying a nucleic acid sequence of interest may comprise at least one primer pair (e.g., a 5' and a 3' primer capable of hybridizing to the nucleic acid sequence of interest and initiating amplification thereof), a DNA polymerase (e.g., a thermostable DNA polymerase), other reagents required for amplification of the nucleic acid sequence of interest, and a primer dimer inhibitor (PDI) compound in an amount sufficient to suppress the formation of primer dimers between different primers (e.g., each primer of a primer pair).
  • primer pair e.g., a 5' and a 3' primer capable of hybridizing to the nucleic acid sequence of interest and initiating amplification thereof
  • a DNA polymerase e.g., a thermostable DNA polymerase
  • PDI primer dimer inhibitor
  • compositions are part of reaction mixtures that may be used to amplify the nucleic acid of interest while also suppressing primer dimer formation in amplification reactions.
  • reaction mixtures typically comprises at least one amplification primer pair suitable for amplifying a nucleic acid sequence of interest, and at least one PDI compound .
  • the reaction mixture may be, comprise and / or be prepared from, for example, a "master mix.”
  • master mixes may include, for example, TaqMan Environmental Master Mix 2.0 (e.g., Invitrogen Cat. No. 4396838), High Capacity RNA-to-cDNA Master Mix (e.g., Invitrogen Cat. No.
  • Fast SYBR ® Green Master Mix e.g., Invitrogen Cat. No. 4385612
  • TaqMan ® Universal Master Mix II e.g., Invitrogen Cat. No. 4440038 or 4440043
  • TaqMan ® Fast Advanced Master Mix e.g., Invitrogen Cat. No. 4444556
  • TaqMan ® Genotyping Master Mix e.g., Invitrogen Cat. No. 4371355
  • TaqMan ® Fast Virus 1 -Step Master Mix e.g., Invitrogen Cat. No. 4444436
  • GeneAmp Fast PCR Master Mix e.g., Invitrogen Cat. No.
  • Power SYBR ® GreenPCR Master Mix e.g., Invitrogen Cat. No. 4367659
  • Power SYBR ® Green RNA-to-CTTM Master Mix e.g., Invitrogen Cat. No. 4389986
  • SYBR ® Green PCR Master Mix e.g., Invitrogen Cat. No. 4309155
  • Platinum ® PCR SuperMix e.g., Invitrogen Cat. Nos. 1 1306081 , 10790020
  • AccuPrimeTM SuperMix e.g., Invitrogen Cat. Nos. 12342028, 12341020, 12344040
  • Platinum ® Blue PCR SuperMix e.g., Invitrogen Cat. Nos.
  • PCR SuperMix e.g., Invitrogen Cat. No. 10572063
  • RELITM SSO HLA-DRB 1 Taq Mastermix e.g., Invitrogen Cat. No. 82022
  • Other suitable master mixes available in the art are also contemplated herein as would be understood by one of skill in the art.
  • the PDI may comprise, for example, a polynucleotide having the structure (N) n -X, wherein N is any nucleotide (e.g., adenosine (A), cytosine (C), guanine (G), thymine (T), inosine (I), universal nucleotide, and / or combinations thereof), n is the number of nucleotides (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, and so on, or at least 2), and X comprises a blocker moiety.
  • N any nucleotide
  • A cytosine
  • C cytosine
  • G guanine
  • T thymine
  • I inosine
  • X comprises a blocker moiety.
  • X is typically fixably attached to the 3' or 5' end of the PDI.
  • X typically comprises a minor groove binder (MGB), as described in more detail below.
  • MGB minor groove binder
  • X may further comprise a quencher moiety (e.g., a non-fluorescent quencher or dark quencher (DQ)) and / or a reporter dye (e.g., as described herein).
  • the nucleotide sequence of the PDI polynucleotide is typically unrelated to said nucleic acid sequence of interest, and may be significantly non-complementary to said nucleic acid sequence of interest (e.g., less than 50 percent homologous to said nucleic acid sequence of interest being amplified in the reaction). PDIs are further described below.
  • the method typically comprises amplifying a nucleic acid sequence of interest in the presence of at least one amplification primer pair suitable for amplifying said nucleic acid sequence of interest and a PDI of a type and in an amount suitable for suppressing primer dimer formation, carrying out an amplification reaction, and then quantifying amplification of said nucleic acid sample using a detector probe such as those described herein.
  • the detector probe may be, for example, a DNA binding dye (e.g., such as those described herein).
  • the detector probe may be a Taqman probe.
  • methods for suppressing primer dimer formation in a nucleic acid amplification reaction typically comprising performing a nucleic acid amplification reaction in the presence of a PDI in an amount sufficient to suppress primer dimer formation, wherein said PDI comprises at least one PDI polynucleotide of between, for example, two to thirty nucleotides in length and a blocker moiety.
  • the presence of the PDI compound within an amplification reaction will suppress the formation of primer-dimers without (e.g., significantly) decreasing the efficiency of the amplification reaction.
  • the efficiency of an amplification reaction (or "amplification efficiency") using a reaction mixture (e.g., based on a master mix) with and without one or more PDI compounds should be similar except that the formation of primer-dimers is suppressed in the presence of the PDI compound.
  • amplification efficiency may be measured relative to the C, value (e.g., 0.8 to 1.2 times the C t value of the reaction without PDI compound (see, e.g., Example 1).
  • amplification efficiency may be affected by, for example, sample quality (e.g., purity, presence of reaction inhibitors, and the like) and / or sequence (e.g., G/C content, mismatches, and the like). This is typically true regardless of the type of amplification reaction being used.
  • sample quality e.g., purity, presence of reaction inhibitors, and the like
  • sequence e.g., G/C content, mismatches, and the like.
  • amplicon the product of PCR amplification of DNA
  • Ligation Chain Reaction products are instead referred to as "LCR products” and / or "ligation products”.
  • primers are utilized but in other methods, such as LCR, ligation probes and the like may be utilized. It is known that both PCR and LCR may function through exponential amplification and / or linear amplification.
  • methods for suppressing primer dimer formation in a nucleic acid amplification reaction comprising amplifying a nucleic acid sequence of interest in the presence of at least one amplification primer pair suitable for amplifying said nucleic acid sequence of interest and a primer dimer inhibitor compound (PDI), the PDI comprising at least one polynucleotide and a minor groove binding (MGB) moiety are provided.
  • the PDI may comprise a polynucleotide (Or oligonucleotide) having the structure (N)n-X, wherein N represents the same or different nucleotides, n is 2-30, and X is the MGB.
  • N may be one (a homopolymer) or more (a heteropolymer) of adenosine (A), cytosine (C), guanine (G), thymine (T), and inosine (I).
  • N is at least 4, at least 8, or at least 16.
  • the MGB may be 3- ⁇ [3-(pyrrolo[4,5-e]indolin-7-ylcarbonyl)pyrrolo[4,5-e]indolin-7- yl]carbonyl ⁇ pyrrolo[3,2-e]indoline-7-carboxylic acid (DPI 3 ).
  • the MGB may be 6-(6-(3,6,7,8-tetrahydropyrrolo[3,2-e]indole-2-carbonyl)-3,6,7,8-tetrahydropyrrolo[3,2-e]indole- 2-carbonyl)-3,6,7,8-tetrahydropyrrolo[3,2-e]indole-2-carboxylic acid.
  • the amplification reaction is the polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • the presence of the PDI in the amplification reaction does not negatively affect amplification efficiency.
  • the nucleic acid is amplified from a reaction mixture and the PDI is present therein at a concentration of at least about 4 uM (e.g., 8 uM).
  • the nucleotide sequence of the polynucleotide portion of the PDI may, in some instances, not be significantly complementary to either the nucleic acid sequence of interest or either primer of the primer pair.
  • the methods further comprise quantifying the amplification reaction using a detector probe such as a DNA binding dye and / or a detectable label.
  • the detector probe may also be a Taqman ® probe, and / or amplification and / or detection may be accomplished using a Taqman ® system.
  • the amplification reaction is carried out in the presence of a detergent (e.g., CHAPS, n-Dodecyl-b-D-maltoside, SDS, TRITON® X-100, Tween-20 and/or ZWITTERGENT ® ).
  • a detergent e.g., CHAPS, n-Dodecyl-b-D-maltoside, SDS, TRITON® X-100, Tween-20 and/or ZWITTERGENT ®.
  • the method suppresses primer dimmer formation by at least about 10% as determined by comparing the amount of a primer dimer product in an amplification reaction containing the PDI to the amount of a primer dimer product in a control amplification reaction lacking the PDI.
  • the PDI may be used as a crude preparation or may be semi-purified or purified (e.g., HPLC-purified, which may be optionally desalted).
  • the amplification reaction occurs upon a solid support
  • FIG. 1 shows dissociation curves (top) and a gel image (bottom) for PCR reactions. Each dissociation curve portrays an overlay of 12 replicates. PCR reactions were carried out in the presence of 100 pg genomic DNA (gDNA) or controls containing no template (NTC). In the gel image, positions for bands representing PCR amplicons, primer dimers (PD), and unutilized primers are indicated.
  • PCR reaction employed a different master mix as indicated: POWER SYBR® Green PCR mix ("A”); POWER SYBR® Green RNA-to-CT® 1 -Step Kit (“B”); or POWER SYBR® Green RNA-to-CT® 1 -Step Kit plus 10 uM of primer dimer inhibitor (PDI) compound 5'- (I) 16 (MGB-DQ)-3' (“C").
  • A POWER SYBR® Green PCR mix
  • B POWER SYBR® Green RNA-to-CT® 1 -Step Kit
  • PDI primer dimer inhibitor
  • FIG. 2A shows dissociation curves for one exemplary primer pair (PP #33) using POWER SYBR® Green RNA-to-CT® 1-Step Kit master mix and different concentrations (as indicated) of the PDI compound 5'-(i)i6(MGB-DQ)-3' .
  • Dissociation curves at each concentration are shown for 12 reactions containing 100 pg gDNA or 12 reactions containing no template (NTC).
  • NTC reactions primer dimer formation is completely suppressed starting at 8 uM PDI and higher (except a single reaction that exhibited primer dimers at 10 uM).
  • primer dimers were observed in all 12 replicates at 0 uM PDI (smaller peak under NTC peak) which disappeared starting at 2 uM PDI and higher.
  • FIG. 3 shows dissociation curves for 3 exemplary primer pairs (PP #3, #5, #6) in the absence of any PDI ("(I) 0 ”) or in the presence of PDI compound 5'-(I) n (MGB-DQ)-3', where n equals 8, 16, or 24. Primer dimer peaks are indicated by an arrow.
  • FIG. 5 shows dissociation curves for one exemplary primer pair (PP #1 1) using RNA-to- CT® 1-Step Kit master mix alone (“A"), negative controls (elution buffer added; "B”), or RNA-to- CT® 1 -Step Kit master mix plus MGB-DQ ("C").
  • A RNA-to- CT® 1-Step Kit master mix alone
  • B negative controls
  • C RNA-to- CT® 1 -Step Kit master mix plus MGB-DQ
  • peaks to the left indicate dissociation of primer dimers observed in wells with no template (NTC) while the peaks to the right indicate dissociation of the amplicons in wells containing 100 pg gDNA.
  • FIG. 6 shows dissociation curves for 4 exemplary primer pairs (PP #14, #19, #6, and #12) using POWER SYBR® Green RNA-to-CT® 1-Step Kit master mix alone ("A”); or with the addition of 10 uM of PDI 5'-(I) 16 (MGB-DQ)-3' ("B”); or PDI 5'-(I), 6 (TEG)-3' ("C”).
  • the addition of 5'-(I)i 6 (TEG)-3' suppressed PD formation, but not to the same degree as adding 5'-(I) ) 6 (MGB- DQ)-3' (similar effect for PP#14, almost as good with PP#19, not as good with PP# 6).
  • both PDI compounds had little affect on reducing PD in NTC reactions; while both compounds similarly suppressed PD formation in reactions containing gDNA (indicated by both arrows in "A”). Also note that the peak heights in the dissociation curves that contained 5'-(I)i 6 (TEG)-3' (C") were as high as in "A” (containing no added compound). The peak heights in "B” were generally lower compared to "A” and "C” indicating a possible reduction in PCR efficiency using these primers with the addition of PDI 5'-(I)i 6 (MGB-DQ)-3' .
  • FIG. 7 shows dissociation curves for 4 exemplary primer pairs (PP #14, #19, #6, and #12) using POWER SYBR® Green RNA-to-CT® 1 -Step Kit master mix alone ("A") or with 10 uM of PDI 5'-(I) l6 (MGB-DQ)-3' ("B”); of PDI 5'-(A) l 6 (MGB-DQ)-3' ("C”); of PDI 5'-(C)
  • All tested compounds e.g., those containing nucleotides I, A, C, or T
  • FIG. 8 shows dissociation curves for 3 exemplary primer pairs (PP #6, #9, and #1 1) using POWER SYBR® Green RNA-to-CT® 1-Step Kit mix alone ("A") or with 10 uM of PDI 5'-
  • FIG. 9 shows dissociation curves for 3 exemplary primer pairs (PP #6, #9, and #11) using POWER SYBR® Green RNA-to-CT® 1-Step Kit mix alone ("A") or with 10 uM of PDI 5'-
  • FIG. 10 depicts the sequence of the pZO 10 target nucleic acid.
  • FIG. 11 shows the effect of PDI polynucleotides comprising reporter dyes.
  • FIG. 12 shows the affect of PDI polynucleotides having sequences unrelated to the target nucleic acid sequence.
  • FIG. 13 shows the effect of PDIs on PD formation of bisulfite-specific primers.
  • nucleotide or “nucleotide base” refer to a nucleoside phosphate. It includes, but is not limited to, a natural nucleotide, a synthetic nucleotide, a modified nucleotide, or a surrogate replacement moiety or universal nucleotide (e.g., inosine).
  • the nucleoside phosphate may be a nucleoside monophosphate, a nucleoside diphosphate or a nucleoside triphosphate.
  • the sugar moiety in the nucleoside phosphate may be a pentose sugar, such as ribose, and the phosphate esterification site may correspond to the hydroxyl group attached to the C-5 position of the pentose sugar of the nucleoside.
  • a nucleotide may be, but is not limited to, a deoxyribonucleoside triphosphate (dNTP) or a ribonucleoside triphosphate (NTP).
  • dNTP deoxyribonucleoside triphosphate
  • NTP ribonucleoside triphosphate
  • the nucleotides may be represented using alphabetical letters (letter designation).
  • A denotes adenosine (i.e., a nucleotide containing the nucleobase, adenine), C denotes cytosine, G denotes guanosine, T denotes thymidine, U denotes uracil, and I denotes inosine.
  • N represents any nucleotide (e.g., N may be any of A, C, G, T U, or I).
  • Naturally occurring and synthetic analogs may also be used, including for example hypoxanthine, 2-aminoadenine, 2-thiouracil, 2-thiothymine, 5-N 4 ethencytosine, 4- aminopyrrazolo[3,4-dJpyrimidine and 6-amino-4-hydroxy[3,4-d]pyrimidine, among others.
  • the nucleotide units of the oligonucleotides may also have a cross-linking function (e.g. an alkylating agent).
  • oligonucleotide or “polynucleotide” refers to an oligomer of nucleotide or derivatives thereof.
  • the oligomers may be DNA, RNA, or analogues thereof (e.g., phosphorothioate analogue).
  • the oligomers may also include modified bases, and/or backbones (e.g., modified phosphate linkage or modified sugar moiety).
  • Non-limiting examples of synthetic backbones that confer stability and/or other advantages to the oligomers may include phosphorothioate linkages, peptide nucleic acid, locked nucleic acid (Singh, et al.
  • Oligonucleotides may be any length "n.”
  • n may be any of 1 , 2, 4, 6, 8, 12, 16, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40 etc. number of nucleotides.
  • the polynucleotide structure (N) n represents an oligonucleotide consisting of n number of nucleotides N (e.g., (I) 8 is representative of an oligonucleotide having the sequence or (A)i 2 is representative of an oligonucleotide having the sequence AAAAAAAAAAAA).
  • Other types of oligonucleotides or polynucleotides may also be suitable for use as would be understood to one of skill in the art from this disclosure.
  • nucleic acid refers to polymers of nucleotides or derivatives thereof.
  • target nucleic acid refers to a nucleic acid that is desired to be amplified in a nucleic acid amplification reaction.
  • the target nucleic acid comprises a nucleic acid template.
  • sequence refers to a nucleotide sequence of an oligonucleotide or a nucleic acid.
  • sequence a nucleotide sequence of an oligonucleotide or a nucleic acid.
  • reaction mixture refers to the combination of reagents or reagent solutions, which are used to carry out a chemical analysis or a biological assay.
  • the reaction mixture comprises all necessary components to carry out a nucleic acid (DNA) synthesis/amplification reaction.
  • such reaction mixtures may include at least one amplification primer pair suitable for amplifying a nucleic acid sequence Of interest and at least one PDI compound (e.g., a polynucleotide).
  • a suitable reaction mixture may also include a "master mix" containing the components (e.g., typically not including the primer pair) needed to perform an amplification reaction. The master mix may be combined with one or more PDIs to form a reaction mixture.
  • Other embodiments of reaction mixtures are also contemplated herein as would be understood by one of skill in the art.
  • reagent solution or “solution suitable for performing a DNA synthesis reaction” refer to any or all solutions, which are typically used to perform an amplification reaction or DNA synthesis. They include, but are not limited to, solutions used in DNA amplification methods, solutions used in PCR amplification reactions, or the like.
  • the solution suitable for DNA synthesis reaction may comprise buffer, salts, and/or nucleotides. It may further comprise primers and / or DNA templates to be amplified.
  • One or more reagent solutions are typically included in the reactions mixtures or master mixes described herein.
  • primer refers to a short linear oligonucleotide that hybridizes to a target nucleic acid sequence (e.g., a DNA template to be amplified) to prime a nucleic acid synthesis reaction.
  • the primer may be a RNA oligonucleotide, a DNA oligonucleotide, or a chimeric sequence (e.g., comprising RNA and DNA).
  • the primer may contain natural, synthetic, or modified nucleotides. Both the upper and lower limits of the length of the primer are empirically determined.
  • the lower limit on primer length is the minimum length that is required to form a stable duplex upon hybridization with the target nucleic acid under nucleic acid amplification reaction conditions. Very short primers (usually less than 3 nucleotides long) do not form thermodynamically stable duplexes with target nucleic acid under such hybridization conditions.
  • the upper limit is often determined by the possibility of having a duplex formation in a region other than the pre-determined nucleic acid sequence in the target nucleic acid.
  • suitable primer lengths are in the range of about any of, for example, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, (and so on) nucleotides long.
  • primer dimer refers generally to unwanted intermolecular interactions between at least two primers (e.g., self-dimers and cross-dimers).
  • nonspecific amplification products can form when two primers interact during the annealing and / or extension phase of PCR, followed by extension of the 3'-end of one or both primers with the other primer acting as a template.
  • oligonucleotides are utilized in an amplification reaction that are significantly non-complementary to any other oligonucleotide or nucleic acid in the reaction mixture.
  • the term "significantly non-complementary" can refer to less than 50 percent homologous, less than 40 percent homologous, less than 30 percent homologous, less than 20 percent homologous, less than 10 percent homologous, and / or less than 5 percent homologous.
  • the term "percent homologous” typically refers to the sequence of a first nucleotide sequence as it compares to a second nucleotide sequence, in both or either composition (e.g., the total amount of each type of nucleotide within an oligonucleotide) and / or order (e.g., the order in which each appears (5' to 3') in the nucleotide sequence).
  • nucleotide sequence of the olionucleotide portion of a PDI compound may be significantly non-complementary to any other nucleotide sequence of a reaction mixture.
  • an "unrelated PDI polynucleotide” may refer to the oligonucleotide portion of a PDI compound wherein the oligonucleotide portion is significantly non-complementary to any other oligonucleotide or polynucleotide (e.g., nucleotide sequence of interest) in a reaction mixture.
  • PDI PDI or PDI compound
  • PDIs can comprise "primer dimer inhibitor polynucleotides” or "PDI polynucleotides.”
  • Some PDI polynucleotides may comprise a minor groove binder (MGB).
  • Some PDI polynucleotides may further comprise a quencher moiety, such as a non-fluorescent or dark quencher (DQ).
  • a Black Hole Quencher ® (e.g., BHQ ® -0, -1 , -2, -3 (Biosearch Technologies)) may also be suitable for use as described herein.
  • PDIs or PDI polynucleotides that comprise MGB and DQ can be referred to as "MGB-DQ" or "PDI-MGB-DQ.”
  • Other PDIs or PDI polynucleotides may further comprise reporter dyes (such as PET, ISfED, VIC, or FAM (e.g., 5-FAM)).
  • Such PDIs or PDI polynucleotides can be referred to, for example, (as in the case for FAM comprising PDIs) as "FAM-MGB-DQ” or “PDI-FAM-MGB-DQ” or (as in the case for PET comprising PDIs) as "PET-MGB-DQ” or “PDI-PET-MGB-DQ.”
  • blocker refers generally to a modification on an oligonucleotide sequence such as a probe and/or primer which renders it incapable of extension by a polymerase, for example, when hybridized to its complementary sequence in a PCR reaction.
  • blocker moieties include modifications of the ribose ring 3'-OH of the oligonucleotide, which prevents addition of further bases to the '3-end of the oligonucleotide sequence a polymerase. Such '3-OH modifications are well known in the art. (See, e.g., Josefsen, M., et al., Molecular and Cellular Probes, 23 (2009):201-223, the disclosure of which is incorporated by reference in its entirety).
  • MGB MGB group
  • MGB moiety refers to a minor groove binder.
  • An MGB may be a molecule that binds within the minor groove of double stranded DNA.
  • MGB moieties may have a strong preference for A-T (adenine and thymine) rich regions of the B form of double stranded DNA. Nevertheless, MGB compounds which would show preference to C-G (cytosine and guanine) rich regions are also theoretically possible. Therefore, oligonucleotides comprising a radical or moiety derived from minor groove binder molecules having preference for C-G regions are also within the scope of the present invention.
  • Oligonucleotides described herein typically include a plurality of nucleotide units, a 3'- end and a 5'-end, and a minor groove binder moiety covalently attached to at least one of said nucleotides.
  • the MGB is typically attached to the oligonucleotide through a linking group comprising a chain of no more than 15 atoms (see below).
  • the MGB moiety is typically a radical of a molecule having a molecular weight of approximately 150 to approximately 2000 daltons which molecule binds in a non-intercalating manner into the minor groove of double stranded DNA, RNA or hybrids thereof with an association constant greater than approximately 10 3 M " 1 .
  • Some MGBs are capable of binding within the minor groove of double stranded DNA with an association constant of 10 3 M " ' or greater. However, some MGBs bind to the high affinity sites of double stranded DNA with an association constant of the magnitude of 10 7 to 10 9 M “1 . This type of binding can be detected by well-established spectrophotometric methods such as ultraviolet (UV) and nuclear magnetic resonance (NMR) spectroscopy and also by gel electrophoresis. Shifts in UV spectra upon binding of a minor groove binder molecule and NMR spectroscopy utilizing the "Nuclear Overhauser" (NOSEY) effect are particularly well known and useful techniques for this purpose.
  • UV ultraviolet
  • NMR nuclear magnetic resonance
  • an MGB group When conjugated to the 3' end of an oligonucleotide, an MGB group can function as non- extendable blocker moiety.
  • Various MGBs are known in the art. Synthesis methods and/or sources for such MGBs are also well known in the art. (See, e.g., U.S. Patent Nos. 5,801 ,155; 6,492,346; 6,084,102; 6,486,308; 6,727,356; Wemmer, et al. Curr. Op. Struct. Biol.
  • the term "PDI-MGB,” “MGB polynucleotide,” “(N) n -MGB” is an oligonucleotide sequence and/or probe further attached to a minor groove binder moiety.
  • PDI compounds e.g., MGB polynucleotides and the like
  • exemplary conjugates may be represented by Formula I:
  • group including the linking group which covalently binds the minor groove binder moiety to the oligonucleotide through no more than 15 atoms; W 2 is absent or is
  • R, -(HN--Y, -CO) whenever Yi represents a 5-membered ring having two double bonds and 0 to 3 heteroatoms selected from the group consisting of N, S and O, the NH and CO groups are attached respectively to two ring carbons which are separated by one ring atom from one another, the ring atom positioned between said two ring carbons is substituted only with H or is unsubstituted, each of the remaining ring atoms may be optionally substituted with 1 , 2 or 3 R 3 groups;
  • Y 2 is a ring system consisting of a 6-membered aromatic ring condensed with a 5-membered ring having one double bond, the condensed ring system having 0 to 3 heteroatoms selected from the group consisting of N, S and O
  • each of the R 6 N and CO groups is attached to a ring carbon which is in a different ring of the condensed ring system, and which is the second ring atom, respectively, from one common bridgehead ring atom, the CO and NR 6 groups thereby positioning 2 non- bridgehead ring atoms between themselves on one side and 3 non-bridgehead ring atoms on the other side of the condensed ring system, the two non-bridgehead ring atoms on the one side being optionally substituted with an R 7 group, the three non-bridgehead ring atoms on the other side of the condensed ring system being optionally substituted with an R 3
  • Y 4 is a 6-membered aromatic ring having 0 to 3 N heteroatoms, and where each of the CO and NH groups is attached to a ring carbon, said ring carbons being in 1 ,4 position relative to one another in each ring, two ring atoms not occupied by the CO or NH groups on either one of the two sides of the 6-membered ring being optionally substituted with an R 3 group, the two ring atoms not occupied on the other side of the 6 membered ring being optionally substituted with an R 7 group;
  • Ri and R 2 independently are H,
  • n represents the desired number of peptide residues (e.g., 1 to 50).
  • the compounds (MGBs) may be joined to an oligonucleotide through either the free amino or tBoc groups thereof.
  • Exemplary compounds of formula (b) may include the ring structure shown below (e.g., see DPI 3 described below):
  • R may be H or CH 3 (including, for example dimers, trimers, and tetramers thereof (e.g., Boger, et al. J. Org. Chem. 52(8): 1521-1530 (1987) (incorporated herein by reference in its entirety)),
  • Suitable compounds may include, for example, 3- ⁇ [3-(pyrrolo[4,5-e]indolin-7- ylcarbonyl)pyrrolo[4,5-e]indolin-7-yl]carbonyl ⁇ pyrrolo[3,2-e]indoline-7-carboxylic acid (DPI3) as described in, for example, U.S. Pat. Nos. 6,486,308B2 and 6,727,356, which are hereby incorporated by reference in their entirety).
  • DPI3 3- ⁇ [3-(pyrrolo[4,5-e]indolin-7- ylcarbonyl)pyrrolo[4,5-e]indolin-7-yl]carbonyl ⁇ pyrrolo[3,2-e]indoline-7-carboxylic acid (DPI3) as described in, for example, U.S. Pat. Nos. 6,486,308B2 and 6,727,356, which are hereby incorporated by reference in their entirety).
  • MGBs in addition to those described above may also be suitable for use in the methods described herein.
  • MGB moieties include, for example, the naturally occurring compounds netropsin, distamycin, lexitropsin, mithramycin, chromomycin A 3 , olivomycin, anthramycin, sibiromycin, as well as further related antibiotics and synthetic derivatives.
  • Certain bisquartemary ammonium heterocyclic compounds such as pentamidine, stilbamidine and berenil, CC-1065 and related pyrroloindole and indole polypeptides, Hoechst 33258, 4'-6-diamidino-2-phenylindole (DAPI) as well as a number of oligopeptides consisting of naturally occurring or synthetic amino acids may also be suitable MGBs.
  • DAPI 4'-6-diamidino-2-phenylindole
  • MGBs may also be suitable for use as described herein, as would be understood by one of skill in the art.
  • a linking group of, for example, 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, but typically not more than 15 atoms, may be used to join the oligonucleotide portion of the conjugate to the minor groove binder moiety.
  • the minor groove binder moiety is covalently attached to either the 3' or 5' end of the oligonucleotide but it may also be attached at an intermediate position (e.g., to the heterocyclic base of a nucleotide in intermediate position).
  • the linking group may be derived from a bifunctional molecule (e.g., an amine functionality attached to the 5' phosphate of the oligonucleotide and carbonyl group (CO) attached to an amino group of the MGB moiety).
  • the linking group may also be derived from an amino alcohol linked to the 3' phosphate of the oligonucleotide while the amino function is linked to a carbonyl group of the MGB moiety.
  • Yet another possible linkage utilizes an amino-alcohol attached to the 3'-phosphate of the oligonucleotide with an ester linkage and an aminocarboxylic acid linked in a peptide bond to the carbonyl group of the MGB.
  • Exemplary linking groups may include, for example, -HN(CH 2)m CO, 0(CH 2)m CO and (CH 2)m CH(OH)(CH 2)m NHCO(CH 2)m NH, where m is an integer providing that separates the MGB by a suitable number of atoms (see above) from the oligonuleotide (e.g., -0(CH 2)6 NH, -OCH 2 CH(OH)CH 2 NHCOCH 2 CH 2 NH and ⁇ HN(CH 2)5 CO).
  • Other linkers may also be suitable, as would be understood by one of skill in the art.
  • the minor groove binder moiety may also carry additional functions, as long as those functions do not interfere with minor groove binding ability of the MGB.
  • a reporter group e.g., a detector probe or label
  • the reporter group may be part of the MGB itself.
  • certain PDI compounds may comprise an MGB, a linker, and a dark quencher, as shown below:
  • detector probe refers to any of a variety of signaling molecules indicative of amplification.
  • SYBR GREEN and other DNA-binding dyes are detector probes.
  • Such detector probes may comprise or may be, for example, nucleic acid intercalating agents or non-intercalating agents.
  • an intercalating agent is an agent or moiety capable of non-covalent insertion between stacked base pairs of a double-stranded nucleic acid molecule.
  • a non-intercalating agent is one that does not insert into the double-stranded nucleic acid molecule.
  • the nucleic acid binding agent may produce a detectable signal directly or indirectly.
  • the signal may be detectable directly using, for example, fluorescence and / or absorbance, or indirectly using, for example, any moiety or ligand that is detectably affected by proximity to double-stranded nucleic acid is suitable such as a substituted label moiety or binding ligand attached to the nucleic acid binding agent. It is typically necessary for the nucleic acid binding agent to produce a detectable signal when bound to a double-stranded nucleic acid that is distinguishable from the signal produced when that same agent is in solution or bound to a single-stranded nucleic acid.
  • intercalating agents such as ethidium bromide fluoresce more intensely when intercalated into double-stranded DNA than when bound to single-stranded DNA, RNA, or in solution (see, e.g., U.S. Pat. Nos. 5,994,056; 6, 171 ,785; and / or 6,814,934).
  • actinomycin D fluoresces red fluorescence. when bound to single-stranded nucleic acids, and green when bound to double-stranded nucleic acids.
  • the photoreactive psoralen 4-aminomethyle- 4-5'8-trimethylpsoralen has been reported to exhibit decreased absorption at long wavelengths and fluorescence upon intercalation into double-stranded DNA (Johnson et al. Photochem. & Photobiol., 33:785-791 (1981).
  • U.S. Pat. No. 4,257,774 describes the direct binding of fluorescent intercalators to DNA (e.g., ethidium salts, daunomycin, mepacrine and acridine orange, 4'6-diamidino-a-phenylindole).
  • Non-intercalating agents e.g., minor groove binders as described herein such as Hoechst 33258, distamycin, netropsin
  • Hoechst 33258 Searle, et al. Nuc. Acids Res. 18(13):3753-3762 (1990)
  • Minor groove binders are described in more detail elsewhere herein.
  • DNA binding dyes are available to one of skill in the art and may be used alone or in combination with other agents and / or components of an assay system.
  • Exemplary DNA binding dyes may include, for example, acridines (e.g., acridine orange, acriflavine), actinomycin D (Jain, et al. J. Mol. Biol. 68:21 (1972)), anthramycin, BOBOTM- l , BOBOTM-3, BO-PROTM- l , cbromomycin, DAPI (Kapuseinski, et al. Nuc. Acids Res.
  • acridines e.g., acridine orange, acriflavine
  • actinomycin D Jain, et al. J. Mol. Biol. 68:21 (1972)
  • anthramycin BOBOTM- l , BOBOTM-3, BO-PROTM- l
  • cbromomycin DA
  • SYBR ® Green II SYTOX blue, SYTOX green, SYTO® 43, SYTO® 44, SYTO® 45, SYTOX® Blue, TO-PRO®- l , SYTO® 1 1 , SYTO® 13, SYTO® 15, SYTO® 16, SYTO® 20, SYTO® 23, thiazole orange (Aldrich Chemical Co., Milwaukee, Wis.), TOTOTM-3, YO-PRO®-l, and YOYO®-3 (Molecular Probes, Inc., Eugene, OR), among others.
  • SYBR ® Green I see, e.g., U.S. Pat. Nos.
  • one or more detectable labels and / or quenching agents may be attached to one or more primers, probes (e.g., detector probe), and / or PDIs.
  • the detectable label may emit a signal when free or when bound to one of the target nucleic acids.
  • the detectable label may also emit a signal when in proximity to another detectable label.
  • Detectable labels may also be used with quencher molecules such that the signal is only detectable when not in sufficiently close proximity to the quencher molecule.
  • the assay system may cause the detectable label to be liberated from the quenching molecule.
  • Any of several detectable labels may be used to label the primers and probes used in the methods described herein.
  • the detectable label may be attached to a probe, which may be incorporated into a primer, or may otherwise bind to amplified target nucleic acid (e.g., a detectable nucleic acid binding agent such as an intercalating or non-intercalating dye).
  • a detectable nucleic acid binding agent such as an intercalating or non-intercalating dye.
  • Exemplary detectable labels include, for instance, a fluorescent dye or fluorphore (e.g., a chemical group that can be excited by light to emit fluorescence or phosphorescence), "acceptor dyes” capable of quenching a fluorescent signal from a fluorescent donor dye, and the like.
  • a fluorescent dye or fluorphore e.g., a chemical group that can be excited by light to emit fluorescence or phosphorescence
  • acceptor dyes capable of quenching a fluorescent signal from a fluorescent donor dye
  • Suitable detectable labels may include, for example, fluoresceins (e.g., 5-carboxy-2,7-dichlorofluorescein; 5-Carboxyfluorescein (5-FAM); 5-HAT (Hydroxy Tryptamine); 5-Hydroxy Tryptamine (HAT); 6-JOE; 6-carboxyfluorescein (6-FAM); FITC; 6-carboxy- l ,4-dichloro-2',7'-dichlorofluorescein (TET); 6-carboxy- l ,4-dichloro-2',4 ⁇ 5', T- tetrachlorofluorescein (HEX); 6-carboxy-4',5'-dichloro-2', 7 '-dimethoxy fluorescein (JOE); ); Alexa fluors (e.g., 350, 405, 430, 488, 500, 514, 532, 546, 555, 568, 594, 610, 6
  • EGFP blue fluorescent protein
  • BFP blue fluorescent protein
  • EBFP EBFP2
  • Azurite mKalamal
  • cyan fluorescent protein e.g., ECFP, Cerulean, CyPet
  • yellow fluorescent protein e.g., YFP, Citrine, Venus, YPet
  • FRET donor/acceptor pairs e.g., fluorescein/tetramethylrhodamine, IAEDANS/fluorescein, EDANS/dabcyl, fluorescein/fluorescein, BODIPY FL/BODIPY FL, Fluorescein/QSY7 and QSY9
  • LysoTracker and LysoSensor e.g., LysoTracker Blue DND-22, LysoTracker Blue- White DPX, LysoTracker Yellow HC -123, LysoTracker Green DND-26, LysoTracker Red DND-99, LysoSensor
  • detector probes can be sequence-based (also referred to herein as "locus-specific detector probe"), for example 5' nuclease probes. Such probes may comprise one or more detectable labels.
  • detector probes are known in the art, for example (TaqMan probes described herein (See also U.S. Patent No. 5,538,848 (incorporated herein by reference in its entirety)) various stem- loop molecular beacons (See, e.g., U.S. Patent Nos. 6, 103,476 and 5,925,517 and Tyagi and Kramer, 1996, Nature Biotechnology 14:303-308), stemless or linear beacons (See, e.g., WO 99/21881 ; U.S. Pat. No.
  • PNA Molecular Beacons TM See, e.g., U.S. Patent Nos. 6,355,421 and 6,593,091
  • linear PNA beacons See, e.g., Kubista et al., 2001 , SPIE 4264:53-58
  • non-FRET probes See, e.g., U.S. Patent No. 6, 150,097
  • Sunrise ® /Amplifluor ® probes U.S. Patent No. 6,548,250
  • stem-loop and duplex ScorpionTM probes Solinas et al., 2001 , Nucleic Acids Research 29:E96 and U.S. Patent No.
  • HybProbes Cardullo, et al. PNAS 85:8790-8794 (1988)
  • MGB Alert www.nanogen.com
  • Q-PNA Fiandaca, et al. Genome Res. 1 1 :609-61 1 (2001)
  • Plexor www.Promega.com
  • LUX primers Nazarenko, et al. Nucleic Acids Res. 30:e37 (2002)
  • DzyNA primers Toddd, et al. Clin. Chem. 46:625-630 (2000)).
  • Detector probes can also comprise black hole quenchers (Biosearch), Iowa Black (IDT), QSY quencher (Molecular Probes), and Dabsyl and Dabcel sulfonate/carboxylate Quenchers (Epoch).
  • Detector probes can also comprise two probes, wherein for example a fluor is on one probe, and a quencher on the other, wherein hybridization of the two probes together on a target quenches the signal, or wherein hybridization on a target alters the signal signature via a change in fluorescence.
  • Exemplary systems may also include FRET, salicylate / DTPA ligand systems (see, e.g., Oser et al. Angew. Chem. Int. Engl.
  • Detector probes can also comprise sulfonate derivatives of fluorescein dyes with SO3 instead of the carboxylate group, phosphoramidite forms of fluorescein, phosphoramidite forms of CY5 (available for example from Amersham). All references cited above are hereby incorporated herein by reference in their entirety.
  • the terms “amplification,” “nucleic acid amplification,” or “amplifying” refer to the production of multiple copies of a nucleic acid template, or the production of multiple nucleic acid sequence copies that are complementary to the nucleic acid template.
  • the amplification reaction may be a polymerase-mediated extension reaction such as, for example, a polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • any of the known amplification reactions may be suitable for use as described herein.
  • amplifying which typically refers to an "exponential" increase in target nucleic acid is being used herein to describe both linear and exponential increases in the numbers of a select target sequence of nucleic acid.
  • amplification reaction mixture may refer to an aqueous solution comprising the various reagents used to amplify a target nucleic acid. Such reactions may also be performed using solid supports (e.g., an array). The reactions may also be performed in single or multiplex format as desired by the user. These reactions typically include enzymes, aqueous buffers, salts, amplification primers, target nucleic acid, and nucleoside triphosphates. Depending upon the context, the mixture can be either a complete or incomplete amplification reaction mixture.
  • the method used to amplify the target nucleic acid may be any available to one of skill in the art. Any in vitro means for multiplying the copies of a target sequence of nucleic acid may be utilized.
  • PCR the nucleic acid amplification reaction
  • the PDI compounds should be effective in other types of nucleic acid amplification reactions, including both polymerase-mediated amplification reactions (such as HDA, RPA, and RCA), as well as ligase-mediated amplification reactions (such as LDR, LCR, and gap-versions of each), and combinations of nucleic acid amplification reactions such as LDR and PCR (see for example U.S. Patent 6,797,470).
  • the "PDI compounds" in the present methods can be of sufficient breadth to include suppression of unwanted side products in amplification reactions lacking primers per se.
  • the PDI compounds of the present teachings are contemplated for use in various ligation-mediated reactions, where for example ligation probes are employed as opposed to PCR primers.
  • Additional exemplary methods include polymerase chain reaction (PCR; see, e.g., U.S. Patent Nos. 4,683,202; 4,683,195; 4,965,188; and / or 5,035,996), isothermal procedures (using one or more RNA polymerases (see, e.g., WO 2006/081222), strand displacement (see, e.g., U.S. Pat.
  • Amplification efficiency may refer to any product that may be quantified to determine copy number (e.g., the term may refer to a PCR amplicon, an LCR ligation product, and / or similar product). Whether a particular PDI functions as desired with a particular primer pair may be determined by carrying out at least two separate amplification reactions using at least two primers (e.g., a primer pair) in each reaction, each reaction being carried out in the absence and presence, respectively, of a PDI compound and optionally in the presence or absence of template nucleic acid (e.g., gDNA), and quantifying amplification of said primer pair(s) (e.g., by gel electrophoresis, using a detector probe, etc.). Various concentrations or combinations of PDI compounds may also be tested in separate reaction mixtures to determine the effect on amplification efficiency.
  • Exemplary methods for amplifying nucleic acids include, for example, polymerase- mediated extension reactions.
  • the polymerase-mediated extension reaction can be the polymerase chain reaction (PCR).
  • the nucleic acid amplification reaction is a multiplex reaction.
  • Exemplary methods for amplifying and detecting nucleic acids suitable for use as described herein is commercially available as TaqMan ® (see, e.g., U.S. Pat. Nos. 4,889,818; 5,079,352; 5,210,015; 5,436,134; 5,487,972; 5,658,751 ; 5,210,015; 5,487,972; 5,538,848; 5,618,71 1 ; 5,677, 152; 5,723,591 ; 5,773,258; 5,789,224; 5,801 , 155; 5,804,375; 5,876,930; 5,994,056; 6,030,787; 6,084,102; 6, 127, 155; 6, 171 ,785; 6,214,979; 6,258,569; 6,814,934; 6,821 ,727; 7,141 ,377; and / or 7,445,900, all of which are hereby incorporated herein by reference in their entirety).
  • TaqMan assays are typically earned out by performing nucleic acid amplification on a target polynucleotide using a nucleic acid polymerase having 5'-3' nuclease activity, a primer capable of hybridizing to said target polynucleotide, and an oligonucleotide probe capable of hybridizing to said target polynucleotide 3' relative to said primer.
  • the oligonucleotide probe typically includes a detectable label (e.g., a fluorescent reporter molecule) and a quencher molecule capable of quenching the fluorescence of said reporter molecule.
  • the detectable label and quencher molecule are part of a single probe.
  • the polymerase digests the probe to separate the detectable label from the quencher molecule.
  • the detectable label e.g., fluorescence
  • detection of the label corresponds to the occurrence of nucleic acid amplification (e.g., the higher the signal the greater the amount of amplification).
  • Variations of TaqMan ® assays e.g., LNATM spiked TaqMan ® assay are known in the art and would be suitable for use in the methods described herein.
  • probes in displacement hybridization methods (see, e.g., Morrison et al. Anal. Biochem., 18:231-244 (1989); and / or Li, et al. Nucleic Acids Res., 30(2,e5) (2002)).
  • the probe typically includes two complementary oligonucleotides of different lengths where one includes a detectable label and the other includes a quencher molecule. When not bound to a target nucleic acid, the quencher suppresses the signal from the detectable label. The probe becomes ' detectable upon displacement hybridization with a target nucleic acid. Multiple probes may be used, each containing different detectable labels, such that multiple target nucleic acids may be queried in a single reaction.
  • Additional exemplary methods for amplifying and detecting target nucleic acids suitable for use as described herein involve "molecular beacons", which are single-stranded hairpin shaped oligonucleotide probes. In the presence of the target sequence, the probe unfolds, binds and emits a signal (e.g., fluoresces).
  • a signal e.g., fluoresces
  • a molecular beacon typically includes at least four components: 1 ) the "loop", an 18-30 nucleotide region which is complementary to the target sequence; 2) two 5-7 nucleotide “stems” found on either end of the loop and being complementary to one another; 3) at the 5' end, a detectable label; and 4) at-the 3' end, a quencher dye that prevents the detectable label from emitting a single when the probe is in the closed loop shape (e.g., not bound to a target nucleic acid).
  • the "stem” portion of the beacon separates out resulting in the probe hybridizing to the target.
  • Other types of molecular beacons are also known and may be suitable for use in the methods described herein.
  • Molecular beacons may be used in a variety of assay systems.
  • One such system is nucleic acid sequence-based amplification (NASBA ), a single step isothermal process for amplifying RNA to double stranded DNA without temperature cycling.
  • a NASBA reaction typically requires avian myeloblastosis virus (AMV), reverse transcriptase (RT), T7 RNA polymerase, RNase H, and two oligonucleotide primers.
  • AMV avian myeloblastosis virus
  • RT reverse transcriptase
  • T7 RNA polymerase T7 RNA polymerase
  • RNase H reverse transcriptase
  • oligonucleotide primers two oligonucleotide primers.
  • the amplified target nucleic acid may be detected using a molecular beacon.
  • Other uses for molecular beacons are known in the art and would be suitable for use in the methods described herein.
  • Scorpion primers are bi-functional molecules in which a primer is covalently linked to the probe, along with a detectable label (e.g., a fluorophore) and a quencher. In the presence of a target nucleic acid, the detectable label and the quencher separate which leads to an increase in signal emitted from the detectable label.
  • a primer used in the amplification reaction includes a probe element at the 5' end along with a "PCR blocker” element (e.g., a hexethylene glycol (HEG) monomer (Whitcombe, et al. Nat. Biotech.
  • the probe typically includes a self-complementary stem sequence with a detectable label at one end and a quencher at the other.
  • the primer hybridizes to the target and extension occurs due to the action of polymerase.
  • the Scorpion system may be used to examine and identify point mutations using multiple probes that may be differently tagged to distinguish between the probes. Using PCR as an example, after one extension cycle is complete, the newly synthesized target region will be attached to the same strand as the probe. Following the second cycle of denaturation and annealing, the probe and the target hybridize.
  • the hairpin sequence then hybridizes to a part of the newly produced PCR product. This results in the separation of the detectable label from the quencher and causes emission of the signal.
  • Other uses for molecular beacons are known in the art and would be suitable for use in the methods described herein.
  • the nucleic acid polymerases that may be employed in the disclosed nucleic acid amplification reactions may be a prokaryotic, fungal, viral, bacteriophage, plant, or eukaryotic nucleic acid polymerase.
  • DNA polymerase refers to an enzyme that synthesizes a DNA strand de novo using a nucleic acid strand as a template.
  • DNA polymerase uses an existing DNA or RNA as the template for DNA synthesis and catalyzes the polymerization of deoxyribonucleotides alongside the template strand, which it reads. The newly synthesized DNA strand is complementary to the template strand.
  • DNA polymerase can add free nucleotides only to the 3'-hydroxyl end of the newly forming strand. It synthesizes oligonucleotides via transfer of a nucleoside monophosphate from a deoxyribonucleoside triphosphate (dNTP) to the 3'-hydroxyl group of a growing oligonucleotide chain. This results in elongation of the new strand in a 5' to 3' direction. Since DNA polymerase can only add a nucleotide onto a pre-existing 3'-OH group, to begin a DNA synthesis reaction, the DNA polymerase needs a primer to which it can add the first nucleotide.
  • dNTP deoxyribonucleoside triphosphate
  • Suitable primers may comprise oligonucleotides of RNA or DNA, or chimeras thereof (e.g., RNA/DNA chimerical primers).
  • the DNA polymerases may be a naturally occurring DNA polymerases or a variant of natural enzyme having the above-mentioned activity. For example, it may include a DNA polymerase having a strand displacement activity, a DNA polymerase lacking 5' to 3' exonuclease activity, a DNA polymerase having a reverse transcriptase activity, or a DNA polymerase having an endonuclease activity.
  • Suitable nucleic acid polymerases may also comprise holoenzymes, functional portions of the holoenzymes, chimeric polymerase, or any modified polymerase that can effectuate the synthesis of a nucleic acid molecule.
  • a DNA polymerase may also include a polymerase, terminal transferase, reverse transcriptase, telomerase, and / or polynucleotide phosphorylase.
  • Non-limiting examples of polymerases may include, for example, T7 DNA polymerase, eukaryotic mitochondrial DNA Polymerase ⁇ , prokaryotic DNA polymerase I, II, III, rv, and / or V; eukaryotic polymerase ⁇ , ⁇ , ⁇ , ⁇ , ⁇ , ⁇ , and / or ⁇ ; ⁇ . coli DNA polymerase I; E. coli DNA polymerase III alpha and / or epsilon subunits; E. coli polymerase IV, E. coli polymerase V; T. aquaticus DNA polymerase I; B.
  • thermostable DNA polymerases include Taq, Pfu, and VentTM DNA polymerases, any genetically engineered DNA polymerases, such as those having reduced or insignificant 3' to 5' exonuclease activity (e.g., SuperscriptTM DNA polymerase), or any derivatives and fragments thereof.
  • Other nucleic acid polymerases may also be suitable as would be understood by one of skill in the art.
  • the present teachings generally provide compositions, methods and kits for suppressing primer dimer formation in nucleic acid amplification reactions. More specifically, the present disclosure provides compositions, methods and kits involving PDI compounds. In the present teachings, the disclosed PDI compounds can be added to amplification reactions in an amount sufficient to prevent primer dimer formation.
  • the present disclosure provides compositions for amplifying at least one nucleic acid sequence of interest comprising at least one primer pair, wherein the primer pair is able to hybridize to the nucleic acid sequence(s) of interest; and a PDI compound.
  • the compositions may further comprise a DNA polymerase and/or a solution of reagents able to allow amplification of the nucleic acid sequence of interest.
  • the DNA polymerase is thermostable (e.g., Taq polymerase).
  • the present disclosure provides reaction mixtures for amplifying a nucleic acid sequence of interest.
  • the reaction mixtures comprise a PDI compound in an amount capable of inhibiting primer dimer formation in the reaction.
  • the reaction mixtures can further comprise at least one amplification primer pair suitable for amplifying the nucleic acid sequence(s) of interest.
  • the reaction mixtures can further comprise a DNA polymerase and/or a solution of reagents able to allow amplification of the nucleic acid sequence of interest.
  • the DNA polymerase is thermostable (e.g., Taq polymerase).
  • the compositions and/or reaction mixtures can further comprise a detergent.
  • Some examples of such detergents may include (but are not limited to) CHAPS, n- Dodecyl-b-D-maltoside, sodium dodecyl sulphate (SDS), TRITON ® X-15, TRITON ® X-35, TRITON ® X-45, TRITON ® X-100, TRITON ® X-102, TRITON ® X-1 14, TRITON ® X-165, TRITON ® X-305, TRITON ® X-405, TRITON ® X-705, Tween-20 and/or ZWITTERGENT ® .
  • detergents may also be suitable, as may be determined by one of skill in the art (see, e.g., U.S. Pub. No. 2008/0145910; U.S. Pub. No. 2008/0064071 ; U.S. Pat. No. 6,242,235; U.S. Pat. No. 5,871 ,975; and U.S. Pat. No. 6,127, 155 for exemplary detergents; all of which are hereby incorporated herein by reference in their entirety.)
  • the present disclosure provides methods for reducing primer dimer formation using a PDI compound in an amount able to reduce primer dimer formation.
  • the disclosed methods for reducing primer dimer formation comprise amplifying a nucleic acid sequence of interest in the presence of: (i) at least one amplification primer pair suitable for amplifying the nucleic acid sequence of interest; and (i) a PDI compound.
  • the disclosed methods for reducing primer dimer formation comprise amplifying a nucleic acid sequence of interest in the presence of: (i) at least one amplification primer pair suitable for amplifying the nucleic acid sequence of interest; and (i) at least one (e.g., one or more) PDI compound(s).
  • the present disclosure provides methods for amplifying a nucleic acid sequence of interest, comprising contacting a nucleic acid sequence of interest with at least one primer pair suitable for amplifying the nucleic acid sequence of interest; and one or more PDI compounds in an amount sufficient to suppress primer dimer formation.
  • the methods can further comprise a step of amplifying the nucleic acid sequence of interest.
  • the present disclosure provides methods of suppressing primer dimer formation in a nucleic acid amplification reaction comprising performing a nucleic acid amplification reaction in the presence of one or more PDI compounds in an amount sufficient to suppress primer dimer formation.
  • the PDI compound is typically included in an amount sufficient to suppress primer-dimer formation such that amplification efficiency is not decreased.
  • the disclosed methods can further comprise a step of quantifying amplification of the nucleic acid sequence of interest by use of a detector probe.
  • the detector probe can be a DNA binding dye (e.g., SYBR Green).
  • the detector probe can be a 5' nuclease probe.
  • the 5' nuclease probe is sequence-specific.
  • the detector probe is designed according to the methods and principles described in U.S. Patent No. 6,727,356 (the disclosure of which is incorporated by reference in its entirety).
  • the detector probe is a Taqman® probe. Additional probes and assays that may be suitable for use in the methods described herein are discussed above.
  • the concentration of the PDI compound is at least 200 nM. In some embodiments, the concentration of the PDI compound is at least 500 nM. In some embodiments, the concentration of the PDI compound is at least 2 uM. In some embodiments, the concentration of the PDI compound is at least 4 uM. In some embodiments, the concentration of the PDI compound is at least 8 uM. In some embodiments, the concentration of the PDI compound is at least 10 uM. In some embodiments, the concentration of the PDI compound is at least 12 uM.
  • the concentration of the PDI compound is 250 nM to 20 uM; 1 uM to 16 uM; 4 uM to 14 uM; 6 uM to 12 uM; or 8 uM to 10 uM.
  • the concentration of the PDI compound is at least any of 250 nM, 500 nM, 1 uM, 1.5 uM, 2 uM, 2.5 uM, 3 uM, 3.5 uM, 4 uM, 4.5 uM, 5 uM, 5.5 uM, 6 uM, 6.5 uM, 7 uM, 7.5 uM, 8 uM, 8.5 uM, 9 uM, 9.5 uM, or 10 uM. In some embodiments, the concentration of the PDI compound is about any of 2 uM, 4 uM, 6 uM, or 8 uM.
  • concentration of a PDI is typically made with respect to the final concentration thereof within a reaction mixture in which the amplification procedure is carried out and / or a master mix (e.g., that may be diluted to such a concentration). Other concentrations may also be suitable, as may be determined by one of skill in the art using the assay systems described herein.
  • the PDI compound is part of a master mix.
  • the master mix is POWER SYBR® Green RNA-to-CT® 1 -Step Kit (Applied Biosystems) master mix (e.g., Invitrogen Cat. No. 4368577).
  • the master mix may comprise water, a buffer, magnesium chloride, a mixture of deoxy-nucleoside triphosphates, random hexamers, one or more RNase inhibitors, and a polymerase.
  • the POWER SYBR® Green RNA-to-CT® 1 -Step Kit contains an RT Reaction Mix comprising 10X reverse transcriptase (RT) buffer (e.g., a 10X stock solution diluted to I X in the reaction mixture), 25 mM MgCl 2 (e.g., used at 5.5 mM in the reaction mixture), a mixture of deoxy-nucleoside triphosphates (e.g., a 2.5 mM stock solution diluted to 500 mM in the reaction mixture), random hexamers (e.g., oligo d(T) i6 or sequence-specific reverse primers, a 50 uM stock solution diluted to 2.5 uM in the reaction mixture), one or more RNase inhibitors (e.g., a 20 U/L stock solution diluted to 0.4 U/ ⁇ in the reaction mixture), and MultiScribe Reverse Transcriptase (e.g., a 50 U L stock solution diluted to 1.25 U/ ⁇ in RT
  • the master mix can comprise a detergent, such as those described herein.
  • a detergent such as those described herein.
  • Some examples of such detergents include but are not limited to CHAPS, n-Dodecyl-b-D-maltoside, SDS, TRITON® X-100, Tween-20 and/or ZWITTERGENT®.
  • Other master mixes, optionally including detergents, may also be suitable, as may be determined by one of skill in the art.
  • the PDI compound comprises a blocker moiety such as a minor groove binder (MGB).
  • the primer dimer compound further comprises a quencher moiety, such as a non-fluorescent quencher or dark quencher (DQ) moiety.
  • the primer dimer compound further comprises a reporter dye, such as FAM (e.g., 5- FAM), VIC, PET, or NED.
  • FAM e.g., 5- FAM
  • VIC e.g., VIC
  • PET e.g., PET
  • NED e.g., NED
  • Suitable DNA binding dyes, reporter molecules, and the like are described herein and others may also be available to one of skill in the art.
  • the PDI compound comprises a primer dimer inhibitory polynucleotide.
  • the PDI polynucleotide has the structure (N) compassion-X, wherein N is any nucleotide, n is the number of nucleotides and X comprises a blocker moiety.
  • N can be adenosine (A), cytosine (C), guanine (G), or thymine (T).
  • N can be a universal nucleotide (such as inosine (I)).
  • n is at least 2..
  • n can be 2-30 nucleotides, 4-28 nucleotides, 6- 24 nucleotides, 8-20 nucleotides, or 10-18 nucleotides. In some embodiments, n may be any of 2, 4, 6, 8, 12, 16, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, or 40, for example.
  • the polynucleotide e.g., oligonucleotide
  • the polynucleotide structure (N) represents an oligonucleotide consisting of n number of nucleotides N (e.g., (I) 8 is representative of an oligonucleotide having the sequence or (A)
  • the optimal length of the oligonucleotide may relate to a particular primer pair. For example, for some primer pairs, an oligonucleotide having n as 8 may be optimal (e.g., as for primer pairs 3 and 5 in Example 1) while for others n may be anywhere from 8 to 28 (e.g., as for primer pair 6 in Example 1 ).
  • a PDI e.g., containing an oligonucleotide of 2, 4, 6, 8, 12, 16, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, or 40 nucleotides
  • Methods for determining the activity, including the optimal activity, of a particular PDI are described herein (although other methods known to those of skill in the art may alternatively or also be used).
  • X is located at the 3' end of the PDI polynucleotide (e.g., PDI compound), for example at the 3'-OH.
  • the blocker moiety of X is a minor groove binder (such as MGB).
  • the blocker moiety is methylene glycol (TEG).
  • X further comprises a quencher moiety, such as a non- fluorescent quencher or dark quencher (DQ) moiety.
  • the PDI polynucleotide e.g., PDI compound
  • the reporter dye can be FAM (e.g., 5-FAM), VIC, NED or PET.
  • these reporter dyes and/or labels are located at the 5' end of the PDI polynucleotide (e.g., PDI compound).
  • PDI polynucleotide e.g., PDI compound.
  • particular types of PDI compounds and methods for preparing the same are known to those of skill in the art (e.g., U.S. Patent Nos. 5,801 , 155; 6,492,346; 6,084, 102; 6,486,308; 6,727,356; Wemmer, et al. Curr. Op. Struct. Biol. 7:355-361 ( 1997); Walker, et al.
  • the PDI compound and/or primer dimer inhibitory polynucleotide are HPLC-purified. In other embodiments, the PDI compound and/or primer dimer inhibitory polynucleotide are crude or unpurified. In some other embodiments, the primer dimer compound and/or primer dimer inhibitory polynucleotide is desalted prior to use.
  • the structure of the primer dimer inhibitory polynucleotide can be, for example, 5'-(I) 2 .3 0 (MGB)-3' .
  • the structure of the PDI polynucleotides can be, for example, 5'-(I)2-3o(MGB-DQ)-3 ⁇
  • the MGB moiety of the PDI compound may be as described herein.
  • the primer dimer inhibitory polynucleotide (e.g., PDI compound) is a 5' nuclease probe.
  • the PDI polynucleotide (e.g., PDI compound) is designed according to the methods and principles described in U.S. Patent No. 6,727,356 (the disclosure of which is incorporated by reference in its entirety).
  • the PDI polynucleotide (e.g., PDI compound) is a Taqman® probe.
  • the nucleotide sequence of PDI polynucleotide can be unrelated to the target nucleic acid sequence and/or the sequences of the at least one primer pair used for amplification.
  • the sequence of the PDI polynucleotide e.g., PDI compound
  • the sequence of the PDI polynucleotide is less than 50 percent homologous, less than 40 percent homologous, less than 30 percent homologous, less than 20 percent homologous, less than 10 percent homologous, less than 5 percent homologous, or 0% homologous to the target nucleic acid sequence and/or the sequence of the at least one primer pair.
  • such polynucleotides may be considered "significantly non-complementary". Additional, similar embodiments are described elsewhere in this disclosure.
  • reducing the presence of primer dimers is by at least 10 percent relative to the amount of primer dimers found in a control reaction lacking a PDI compound.
  • the present teachings provide for reducing the presence of primer dimers by at least 20 percent relative to the amount of primer dimers found in a control reaction lacking a PDI compound. In some embodiments, the present teachings provide for reducing the presence of primer dimers by at least 30 percent relative to the amount of primer dimers found in a control reaction lacking a PDI compound. In some embodiments, the present teachings provide for reducing the presence of primer dimers by at least 40 percent relative to the amount of primer dimers found in a control reaction lacking a PDI compound. In some embodiments, the present teachings provide for reducing the presence of primer dimers by at least 50 percent relative to the amount of primer dimers found in a control reaction lacking a PDI compound.
  • the present teachings provide for reducing the presence of primer dimers by at least 60 percent relative to the amount of primer dimers found in a control reaction lacking a PDI compound. In some embodiments, the present teachings provide for reducing the presence of primer dimer by at least 70 percent relative to the amount of primer dimers found in a control reaction lacking a PDI compound. In some embodiments, the present teachings provide for reducing the presence of primer dimers by at least 80 percent relative to the amount of primer dimers found in a control reaction lacking a PDI compound. In some embodiments, the present teachings provide for reducing the presence of primer dimers by at least 90 percent relative to the amount of primer dimers found in a control reaction lacking a PDI compound.
  • the present teachings provide for reducing the presence of primer dimers by at least 95 percent relative to the amount of primer dimers found in a control reaction lacking a PDI compound. Such reductions can be measured, for example, by comparing the intensity of primer dimer products in a reaction containing the PDI, and comparing it with the amount of primer dimer products in a reaction lacking the PDI compound. In some embodiments, comparison of primer dimer products can be performed by assaying the intensity of a band on a gel and/or by melting curve analysis.
  • kits comprising a PDI and at least one PCR primer pair, wherein the PDI compound comprises a PDI polynucleotide that is not significantly complementary to any of the sequences of an amplicon resulting from a PCR reaction employing the primers contained in the kit.
  • the kit can comprise a polymerase, such as a thermostable polymerase.
  • the kit can comprise dNTPs.
  • the primer inhibitor compound e.g., one or more PDIs
  • a master mix such as a PCR master mix.
  • Such a PCR master mix can contain any of primers, a suitable detector probe (for example a double-stranded DNA binding dye such as SYBR GREEN ® or a sequence-based detector probe such as a TAQMAN probe), dNTPs, polymerase, and/or buffer.
  • the PCR master mix may also comprise one or more PDIs.
  • the master mix can further comprise a detergent.
  • Some examples of such detergents may include (but are not limited to) CHAPS, n-Dodecyl-b-D-maltoside, SDS, TRITON ® X-100, Tween-20 and/or ZWITTERGENT ® .
  • kits designed to expedite performing certain methods.
  • kits serve to expedite the performance of the methods of interest by assembling two or more components used in carrying out the methods.
  • kits may contain components in pre-measured unit amounts to minimize the need for measurements by end-users.
  • kits may include instructions for performing one or more methods of the present teachings.
  • the kit components are optimized to operate in conjunction with one another.
  • the kit components are contained in plurality of different containers.
  • Such polynucleotides can be found, for example, in U.S. Patent 7,160,996, U.S. Patent 7,109,312, U.S. Patent 7,019, 129, as well as U.S. Patent 6,727,356, as well as U.S. Patent Application 10/897,583.
  • Target sequences used in the following assays were chosen for their biological importance in HIV infection (Identification of Host Proteins Required for HIV Infection Through a Functional Genomic Screen, Abraham L. Brass, et al., Science 319, 921 (2008)).
  • Primer pairs specific to the chosen target sequences were designed using a proprietary primer parameter design program (TaqPipe v0.97; Applied Biosystems).
  • a target T m of 62°C was chosen for each primer using the nearest neighbor calculations by Santa Lucia with a maximum amplicon size of 350 base pairs.
  • Design parameters were set to design primer pairs that would fall into different primer dimer scoring bins as indicated below.
  • a primer dimer screening tool (zPCR3P; Applied Biosystems) was used to determine the propensity of various primer pairs to form primer-dimers.
  • the tool aligned primer pairs with each other and assigned a score for potential primer dimer formation based on their nucleotide compositions. The scores were binned into high or low potential primer dimer forming pairs and those with the higher bin scores were chosen for further evaluation.
  • a total of 304 primer pairs were tested for their ability to amplify target sequences. Of these, 291 primer pairs were confirmed to amplify a product under all conditions tested. The 291 primer pairs able to produce amplicons were then tested for their ability to form primer dimers in PCR reactions comprising either POWER SYBR® Green PCR master mix (Applied Biosystems, PN 4367659) or POWER SYBR® Green RNA-to-CT® 1-Step Kit master mix (Applied Biosystems, PN 4389986).
  • PCR reaction mixtures using the indicated proprietary master mixes contained 9 ⁇ _, total. Each reaction mixture further contained 1 1 1 nM primers. For each primer pair that was tested, 12 reactions using 100 pg genomic DNA (gDNA) as the template and 12 control reactions containing no template DNA ("no template controls" (NTC)) were analyzed. PCR reactions were performed on Applied Biosystems ABI PRISM 7900, using the following cycling program: to 95°C for 12 minutes; 95°C, 1 minute; 62°C, 1 minute; 72°C, 30 seconds; 95°C, 15 seconds; 95°C, 15 seconds; 60°C, 15 seconds; and, 95°C, 15 seconds.
  • PCR reaction mixtures contained POWER SYBR® Green RNA-to-CT® 1 -Step Kit master mix alone (Mix 2) or POWER SYBR® Green RNA-to-CT® 1 -Step Kit master mix plus 10 uM of PDI 5'-(I), 6 (MGB-DQ)-3' (or (Mix 3). It was surprisingly discovered that adding 10 uM of PDI 5'-(I)i6(MGB-DQ)-3' to Mix 2 further suppressed PD formation. As shown in Table 2 and Fig.
  • the PDI concentrations tested included 0, 2, 4, 6, 8, 10, 15, and 20 uM of 5'-(I)i 6 (MGB- DOJ-3' .
  • All showed primer dimer formation with POWER SYBR® Green RNA-to-CT® 1-Step Kit master mix alone.
  • 12 reactions comprising 100 pg gDNA template, and 12 reactions with NTC were analyzed.
  • primer dimer formation was observed in all 72 reactions containing 100 pg of gDNA template in the absence of the PDI compound.
  • primer dimer formation was completely suppressed at 2 uM of the PDI compound.
  • no primer dimer formation inhibition was observed at all concentrations tested.
  • (MGB-DQ) was eluted from a column support by soaking in 80% TBA (tert-butyl amine), 10% EtOH, 10% water. The eluate was dried down and reconstituted in IxTE. As a control, a similar aliquot of 80% TBA (tert-butyl amine), 10% EtOH, 10% water was dried down and reconstituted in IxTE.
  • Four primer pairs were tested using POWER SYBR® Green RNA-to-CT® 1 -Step Kit master mix. For each primer pair, 2 reactions containing 100 pg gDNA and 6 NTC reactions were analyzed.
  • PDI Polynucleotides Comprising Other Blocker Moieties Can Suppress PD Formation [00104]
  • POWER SYBR® Green RNA-to-CT® 1 - Step Kit master mix with compounds of the nature 5'-(I) i6(TEG)-3' were tested in comparison to the PDI 5'-(I)i 6 (MGB-DQ)-3 ⁇
  • Four primer pairs were tested (PP #14, #19, #6 and #12). For each primer pair, 2 reactions containing 100 pg gDNA and 6 NTC reactions were analyzed.
  • this PDI polynucleotide sequence was not complementary to the primers or the target pZOlO, yet still suppressed primer dimer formation, reducing the 1 1 out of 20 NTC reactions that amplified without addition of PDI to zero out of 20 amplifications with PDI (Fig. 12).
  • rev GCAGGAAACAGCTATGACCTCTCTCTTCAAATAACCTAAAAAC
  • MLHl GTGTAAAACGACGGCCAGTTTTTTTTAGGAGTGAAGGAGGTTA
  • rev GCAGGAAACAGCTATGACCCCCAAAAAAAACAAAATAAAAATC.
  • These primer are specific for bisulfite converted human gDNA, and were tailed with M13-fwd and M13-rev sequences. Reactions contained 200 nM of each primer; I X SYBR green master mix; and 0 or 250 nM of a 5'-FAM-(N) n (MGB-DQ)-3' PDI polynucleotide. Cycling conditions were 95°C 10m, 5x [95°C 15 seconds, 60°C for 2 minutes, 72°C for 3 minutes], 45x [95°C for 15 seconds, 65°C for 1 minutes, 72°C for 3 minutes].

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present disclosure generally provides compositions, methods and kits for reducing unwanted primer interactions (e.g., primer dimer structure formation). More specifically, the disclosure provides for compositions, methods and kits for reducing non-specific side products and/or interactions resulting from primer dimer formation prior to or during amplification of target nucleic acids.

Description

COMPOSITIONS AND METHODS FOR SUPPRESSING PRIMER INTERACTIONS RELATED APPLICATIONS
[0001 ] This application claims priority to U.S. Ser. Nos. 61/250,850 filed October 12, 2009; 61/253,044 filed October 19, 2009, and 61/258,465 filed November 5, 2009, all of which are hereby incorporated by reference in their entirety.
FIELD
[0002] The present disclosure generally provides compositions, methods and kits for reducing unwanted primer interactions (e.g., primer dimer structure formation). More specifically, the disclosure provides for compositions, methods and kits for reducing non-specific side products and/or interactions resulting from primer dimer formation prior to or during amplification of target nucleic acids.
BACKGROUND
[0003] The present teachings relate to compositions, methods and kits for use in primer- mediated nucleic acid amplification, for example, in polymerase chain reactions (PCR).
[0004] Detecting the presence of target nucleic acids plays an important role in a variety of applications in diverse fields, including: medical diagnostics, forensic science and genetic analysis. PCR is an example of a nucleic acid amplification method that can provide a highly sensitive means for detecting the presence of target nucleic acids by selective amplification of a target nucleic acid sequence.
[0005] A significant problem with nucleic acid amplifications such as PCR is the generation of non-specific amplification products. One example of a non-specific amplification process that can be problematic in PCR reactions is "primer dimer" amplification. Primer dimer formation during primer-mediated reactions is one of the most common pitfalls in assay development for a wide range of applications, including those involving Real Time PCR, solid phase amplification and sequencing.
[0006] Oftentimes, primer dimers lead to the amplification of non-specific products ("artifacts") as a result of two or more primers closely interacting during a nucleic acid amplification reaction, such as PCR. Primer dimer interactions can result when, for example, the 3' terminal region of a primer has some degree of complementarity with itself or another primer. Such primers can then hybridize to one another to form primer dimers. This phenomenon can occur even in the absence or prior to the addition of any nucleic acid template.
[0007] The formation of primer dimers can lead to the generation of primer dimer-based products that can in turn act as templates for further non-specific amplicon production. As a consequence, such primer dimer artifacts can prevent or reduce amplification of true nucleic acid targets, especially at low input copy number. Primer dimer artifacts can also contribute to poor sequence data at the beginning of a sequence trace, where both the primer dimer and target amplicon sequences overlap. Generally speaking, primer-dimer formation can also be problematic during any assay that employs double-stranded DNA binding dyes, such as SYBR® GREEN. During these types of assays, non-specific primer dimer products can react with such dyes resulting in a false positive fluorescent signal that can typically only be resolved by melting curve analysis.
[0008] One specific outcome of primer dimer amplicon generation is the depletion of the overall number of primers resulting in reduced sensitivity or even a failure to amplify the intended target nucleic acid. To complicate the problem, the addition of a large excess of primers during PCR reactions allows even weak complementarity at the 3' terminal region to result in primer dimer amplicons. In the extreme case of single molecule PCR amplification, primer dimers can hinder or prevent the amplification of the desired target, even when using all applicable rules for appropriate primer design. Consequently, there is a need to develop reagents and methods that suppress primer dimer formation in amplification reactions such as PCR.
SUMMARY
[0009] Template-independent amplification artifacts, commonly referred to as primer dimers, are a widely observed phenomenon. In demanding amplification applications, such as single molecule PCR, primer dimers can be especially vexing because of the high number of cycles required to amplify a single template molecule. Artifacts such as primer dimers can often out-compete the amplification of the desired target, preventing successful single molecule amplification. Several methods for primer dimer reduction and/or prevention have been described in the literature, including using hot-start polymerase, using primers containing modified nucleotides, using primers containing identical 5' tails, and performing PAP (pyrophosphorolysis activated polymerization).
[0010] While the use of hot-start methods can be effective in reducing primer dimers, for very demanding applications, such as single molecule PCR, the use of hot-start alone may not completely eliminate primer dimer artifacts. In such cases, additional primer dimer reduction methods can be used in addition to hot-start. Such methods typically rely on redesigning individual primer sequences or incorporating non-natural bases into primers which is highly sequence dependent, and often requires extensive trial and error testing to find an effective design. Adding identical 5' tails increases the primer length and therefore cost, and may not be compatible with some downstream applications. PAP methods also require the use of expensive modified primers and unusual reaction conditions, including a non-standard polymerase. Thus, there is a continued need in the field to develop improved compositions and methods for reducing primer dimer formation during amplification-based reactions.
[0011 ] As disclosed herein, a novel primer dimer reducing compound or additive has been discovered that can suppress the formation of unwanted PCR amplification side reaction products. It has been found, surprisingly, that the presence of unrelated primer' dimer inhibitor polynucleotides in PCR amplification reactions can suppress the formation of primer dimers. In some embodiments, for example, 5' nuclease probes were found to be effective for primer dimer reduction even when the primer dimer inhibitor polynucleotide sequences were completely unrelated to the amplicon sequence of interest. Thus, the present teachings provide for the unexpected and surprising observation that inclusion of an otherwise unrelated and undesirable polynucleotide-containing compounds, such as those containing 5' nuclease probes, in a PCR reaction can suppress the formation of unwanted primer dimer side products.
[0012] In some embodiments, one or more compositions for amplifying a nucleic acid sequence of interest are provided. Such compositions may comprise at least one primer pair (e.g., a 5' and a 3' primer capable of hybridizing to the nucleic acid sequence of interest and initiating amplification thereof), a DNA polymerase (e.g., a thermostable DNA polymerase), other reagents required for amplification of the nucleic acid sequence of interest, and a primer dimer inhibitor (PDI) compound in an amount sufficient to suppress the formation of primer dimers between different primers (e.g., each primer of a primer pair). In some embodiments, such compositions are part of reaction mixtures that may be used to amplify the nucleic acid of interest while also suppressing primer dimer formation in amplification reactions. Such reaction mixtures typically comprises at least one amplification primer pair suitable for amplifying a nucleic acid sequence of interest, and at least one PDI compound . The reaction mixture may be, comprise and / or be prepared from, for example, a "master mix." Exemplary master mixes may include, for example, TaqMan Environmental Master Mix 2.0 (e.g., Invitrogen Cat. No. 4396838), High Capacity RNA-to-cDNA Master Mix (e.g., Invitrogen Cat. No. 4390777), Fast SYBR® Green Master Mix (e.g., Invitrogen Cat. No. 4385612), TaqMan® Universal Master Mix II (e.g., Invitrogen Cat. No. 4440038 or 4440043), TaqMan® Fast Advanced Master Mix (e.g., Invitrogen Cat. No. 4444556), TaqMan® Genotyping Master Mix (e.g., Invitrogen Cat. No. 4371355), TaqMan® Fast Virus 1 -Step Master Mix (e.g., Invitrogen Cat. No. 4444436), GeneAmp Fast PCR Master Mix (e.g., Invitrogen Cat. No. 4359187), Power SYBR® GreenPCR Master Mix (e.g., Invitrogen Cat. No. 4367659), Power SYBR® Green RNA-to-CT™ Master Mix (e.g., Invitrogen Cat. No. 4389986), SYBR® Green PCR Master Mix (e.g., Invitrogen Cat. No. 4309155), Platinum® PCR SuperMix (e.g., Invitrogen Cat. Nos. 1 1306081 , 10790020), AccuPrime™ SuperMix (e.g., Invitrogen Cat. Nos. 12342028, 12341020, 12344040), Platinum® Blue PCR SuperMix (e.g., Invitrogen Cat. Nos. 12580031 , 12580015), PCR SuperMix (e.g., Invitrogen Cat. No. 10572063), RELITM SSO HLA-DRB 1 Taq Mastermix (e.g., Invitrogen Cat. No. 82022), and the like. Other suitable master mixes available in the art are also contemplated herein as would be understood by one of skill in the art.
[0013] The PDI may comprise, for example, a polynucleotide having the structure (N)n-X, wherein N is any nucleotide (e.g., adenosine (A), cytosine (C), guanine (G), thymine (T), inosine (I), universal nucleotide, and / or combinations thereof), n is the number of nucleotides (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, and so on, or at least 2), and X comprises a blocker moiety. In such embodiments, X is typically fixably attached to the 3' or 5' end of the PDI. X typically comprises a minor groove binder (MGB), as described in more detail below. X may further comprise a quencher moiety (e.g., a non-fluorescent quencher or dark quencher (DQ)) and / or a reporter dye (e.g., as described herein). The nucleotide sequence of the PDI polynucleotide is typically unrelated to said nucleic acid sequence of interest, and may be significantly non-complementary to said nucleic acid sequence of interest (e.g., less than 50 percent homologous to said nucleic acid sequence of interest being amplified in the reaction). PDIs are further described below.
[0014] Also provided are methods for reducing primer dimer formation during amplification reactions. The method typically comprises amplifying a nucleic acid sequence of interest in the presence of at least one amplification primer pair suitable for amplifying said nucleic acid sequence of interest and a PDI of a type and in an amount suitable for suppressing primer dimer formation, carrying out an amplification reaction, and then quantifying amplification of said nucleic acid sample using a detector probe such as those described herein. The detector probe may be, for example, a DNA binding dye (e.g., such as those described herein). In some embodiments, the detector probe may be a Taqman probe. In certain embodiments, methods for suppressing primer dimer formation in a nucleic acid amplification reaction are provided, the methods typically comprising performing a nucleic acid amplification reaction in the presence of a PDI in an amount sufficient to suppress primer dimer formation, wherein said PDI comprises at least one PDI polynucleotide of between, for example, two to thirty nucleotides in length and a blocker moiety.
[0015] Typically, the presence of the PDI compound within an amplification reaction will suppress the formation of primer-dimers without (e.g., significantly) decreasing the efficiency of the amplification reaction. For instance, the efficiency of an amplification reaction (or "amplification efficiency") using a reaction mixture (e.g., based on a master mix) with and without one or more PDI compounds should be similar except that the formation of primer-dimers is suppressed in the presence of the PDI compound. The efficiency of two or more amplification reactions are considered similar where, for instance, inclusion of the PDI compound does not increase or decrease amplification of the desired products by more than about any of 10, 15, 20, 25, 30, 35, 40, 45, or 50 percent as compared to an amplification reaction in the absence of the PDI compound (e.g., a control reaction). In some embodiments, amplification efficiency may be measured relative to the C, value (e.g., 0.8 to 1.2 times the Ct value of the reaction without PDI compound (see, e.g., Example 1). It is understood in the art that amplification efficiency may be affected by, for example, sample quality (e.g., purity, presence of reaction inhibitors, and the like) and / or sequence (e.g., G/C content, mismatches, and the like). This is typically true regardless of the type of amplification reaction being used. For example, the product of PCR amplification of DNA is typically referred to as an "amplicon". In contrast, the Ligation Chain Reaction products are instead referred to as "LCR products" and / or "ligation products". In PCR, primers are utilized but in other methods, such as LCR, ligation probes and the like may be utilized. It is known that both PCR and LCR may function through exponential amplification and / or linear amplification.
[0016] In some embodiments, methods for suppressing primer dimer formation in a nucleic acid amplification reaction, said method comprising amplifying a nucleic acid sequence of interest in the presence of at least one amplification primer pair suitable for amplifying said nucleic acid sequence of interest and a primer dimer inhibitor compound (PDI), the PDI comprising at least one polynucleotide and a minor groove binding (MGB) moiety are provided. The PDI may comprise a polynucleotide (Or oligonucleotide) having the structure (N)n-X, wherein N represents the same or different nucleotides, n is 2-30, and X is the MGB. In certain embodiments, N may be one (a homopolymer) or more (a heteropolymer) of adenosine (A), cytosine (C), guanine (G), thymine (T), and inosine (I). In some embodiments, N is at least 4, at least 8, or at least 16. In certain embodiments, the MGB may be 3-{ [3-(pyrrolo[4,5-e]indolin-7-ylcarbonyl)pyrrolo[4,5-e]indolin-7- yl]carbonyl }pyrrolo[3,2-e]indoline-7-carboxylic acid (DPI3). In other embodiments, the MGB may be 6-(6-(3,6,7,8-tetrahydropyrrolo[3,2-e]indole-2-carbonyl)-3,6,7,8-tetrahydropyrrolo[3,2-e]indole- 2-carbonyl)-3,6,7,8-tetrahydropyrrolo[3,2-e]indole-2-carboxylic acid. In some instances, the amplification reaction is the polymerase chain reaction (PCR). Typically, the presence of the PDI in the amplification reaction does not negatively affect amplification efficiency. In some embodiments, the nucleic acid is amplified from a reaction mixture and the PDI is present therein at a concentration of at least about 4 uM (e.g., 8 uM). The nucleotide sequence of the polynucleotide portion of the PDI may, in some instances, not be significantly complementary to either the nucleic acid sequence of interest or either primer of the primer pair. In some embodiments, the methods further comprise quantifying the amplification reaction using a detector probe such as a DNA binding dye and / or a detectable label. The detector probe may also be a Taqman® probe, and / or amplification and / or detection may be accomplished using a Taqman® system. In some embodiments, the amplification reaction is carried out in the presence of a detergent (e.g., CHAPS, n-Dodecyl-b-D-maltoside, SDS, TRITON® X-100, Tween-20 and/or ZWITTERGENT®). In certain embodiments, the method suppresses primer dimmer formation by at least about 10% as determined by comparing the amount of a primer dimer product in an amplification reaction containing the PDI to the amount of a primer dimer product in a control amplification reaction lacking the PDI. The PDI may be used as a crude preparation or may be semi-purified or purified (e.g., HPLC-purified, which may be optionally desalted). In some embodiments, the amplification reaction occurs upon a solid support and may optionally be in a multiplex format.
BRIEF DESCRIPTION OF THE DRAWINGS
[0017] The skilled artisan will understand that the drawings described below are for illustration purposes only. The drawings are not intended to limit the scope of the present teachings in any way. [0018] FIG. 1 shows dissociation curves (top) and a gel image (bottom) for PCR reactions. Each dissociation curve portrays an overlay of 12 replicates. PCR reactions were carried out in the presence of 100 pg genomic DNA (gDNA) or controls containing no template (NTC). In the gel image, positions for bands representing PCR amplicons, primer dimers (PD), and unutilized primers are indicated. Each PCR reaction employed a different master mix as indicated: POWER SYBR® Green PCR mix ("A"); POWER SYBR® Green RNA-to-CT® 1 -Step Kit ("B"); or POWER SYBR® Green RNA-to-CT® 1 -Step Kit plus 10 uM of primer dimer inhibitor (PDI) compound 5'- (I)16(MGB-DQ)-3' ("C").
[0019] FIG. 2A shows dissociation curves for one exemplary primer pair (PP #33) using POWER SYBR® Green RNA-to-CT® 1-Step Kit master mix and different concentrations (as indicated) of the PDI compound 5'-(i)i6(MGB-DQ)-3' . Dissociation curves at each concentration are shown for 12 reactions containing 100 pg gDNA or 12 reactions containing no template (NTC). In NTC reactions, primer dimer formation is completely suppressed starting at 8 uM PDI and higher (except a single reaction that exhibited primer dimers at 10 uM). In gDNA containing reactions, primer dimers were observed in all 12 replicates at 0 uM PDI (smaller peak under NTC peak) which disappeared starting at 2 uM PDI and higher.
[0020] FIG. 2B shows the number of wells for NTC reactions from Fig. 2A that exhibit primer dimer formation using different concentrations of PDI compound 5'-(I) i6(MGB-DQ)-3'. (Total possible wells was 192 (=16 primer pairs x 12 NTC reactions)).
[0021 ] FIG. 3 shows dissociation curves for 3 exemplary primer pairs (PP #3, #5, #6) in the absence of any PDI ("(I)0") or in the presence of PDI compound 5'-(I)n(MGB-DQ)-3', where n equals 8, 16, or 24. Primer dimer peaks are indicated by an arrow. [0022] FIG. 4 shows Ct values for 10 exemplary primer pairs (PP #1 -10) with no compound added ("(I)0") or various PDI 5'-(I)n(MGB-DQ)-3' compounds of increasing length (e.g., n=4, 8, 12, 16, 20, 24, or 28 nucleotides). The higher the Ct value, the lower the PCR efficiency.
[0023] FIG. 5 shows dissociation curves for one exemplary primer pair (PP #1 1) using RNA-to- CT® 1-Step Kit master mix alone ("A"), negative controls (elution buffer added; "B"), or RNA-to- CT® 1 -Step Kit master mix plus MGB-DQ ("C"). In the representative dissociation curves, peaks to the left indicate dissociation of primer dimers observed in wells with no template (NTC) while the peaks to the right indicate dissociation of the amplicons in wells containing 100 pg gDNA.
[0024] FIG. 6 shows dissociation curves for 4 exemplary primer pairs (PP #14, #19, #6, and #12) using POWER SYBR® Green RNA-to-CT® 1-Step Kit master mix alone ("A"); or with the addition of 10 uM of PDI 5'-(I)16(MGB-DQ)-3' ("B"); or PDI 5'-(I),6(TEG)-3' ("C"). The addition of 5'-(I)i6(TEG)-3' suppressed PD formation, but not to the same degree as adding 5'-(I)) 6(MGB- DQ)-3' (similar effect for PP#14, almost as good with PP#19, not as good with PP# 6). For PP #12, both PDI compounds had little affect on reducing PD in NTC reactions; while both compounds similarly suppressed PD formation in reactions containing gDNA (indicated by both arrows in "A"). Also note that the peak heights in the dissociation curves that contained 5'-(I)i6(TEG)-3' (C") were as high as in "A" (containing no added compound). The peak heights in "B" were generally lower compared to "A" and "C" indicating a possible reduction in PCR efficiency using these primers with the addition of PDI 5'-(I)i6(MGB-DQ)-3' .
[0025] FIG. 7 shows dissociation curves for 4 exemplary primer pairs (PP #14, #19, #6, and #12) using POWER SYBR® Green RNA-to-CT® 1 -Step Kit master mix alone ("A") or with 10 uM of PDI 5'-(I)l6(MGB-DQ)-3' ("B"); of PDI 5'-(A)l 6(MGB-DQ)-3' ("C"); of PDI 5'-(C)|6(MGB- DQJ-3' ("D"), or of PDI 5'-(T)|6(MGB-DQ)-3' ("E"). All tested compounds (e.g., those containing nucleotides I, A, C, or T) showed the same tendency to suppress PD formation. The only exception was in reactions using PP #12, where only compound "D" suppressed PD formation.
[0026] FIG. 8 shows dissociation curves for 3 exemplary primer pairs (PP #6, #9, and #1 1) using POWER SYBR® Green RNA-to-CT® 1-Step Kit mix alone ("A") or with 10 uM of PDI 5'-
(I),6(MGB-DQ)-3' ("B"), of PDI 5'-(PEG)8(MGB-DQ)-3' ("C"), or of PDI 5'-(PEG),6(MGB-DQ)-
3' ("D"). Only the nucleotide-containing PDI compound ("B") showed PD suppression.
[0027] FIG. 9 shows dissociation curves for 3 exemplary primer pairs (PP #6, #9, and #11) using POWER SYBR® Green RNA-to-CT® 1-Step Kit mix alone ("A") or with 10 uM of PDI 5'-
(I)i6(MGB-DQ)-3' HPLC purified ("B"); or crude PDI 5'-(I)16(MGB-DQ)-3' ("C"). Both reactions with PDI compounds (either purified or crude) similarly suppressed PD formation.
[0028] FIG. 10 depicts the sequence of the pZO 10 target nucleic acid.
[0029] FIG. 11 shows the effect of PDI polynucleotides comprising reporter dyes.
[0030] FIG. 12 shows the affect of PDI polynucleotides having sequences unrelated to the target nucleic acid sequence.
[0031 ] FIG. 13 shows the effect of PDIs on PD formation of bisulfite-specific primers. DETAILED DESCRIPTION
[0032] To more clearly and concisely describe and point out the subject matter of the present disclosure, the following definitions are provided for specific terms, which are used in the following description and the appended claims. Throughout the specification, exemplification of specific terms should be considered as non-limiting examples.
[0033] The singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise. Approximating language, as used herein throughout the specification and claims, may be applied to modify any quantitative representation that could permissibly vary without resulting in a change in the basic function to which it is related. Accordingly, a value modified by a term such as "about" is not to be limited to the precise value specified. Where necessary, ranges have been supplied, and those ranges are inclusive of all sub-ranges there between.
[0034] In this disclosure, the use of the singular can include the plural unless specifically stated otherwise or unless, as will be understood by one of skill in the art in light of the present disclosure, the singular is the only functional embodiment. Thus, for example, "a" can mean more than one, and "one embodiment" can mean that the description applies to multiple embodiments. The phrase "and/or" denotes a shorthand way of indicating that the specific combination is contemplated in combination and, separately, in the alternative.
[0035] It will be appreciated that there is an implied "about" prior to the temperatures, concentrations, times, etc. discussed in the present teachings, such that slight and insubstantial deviations are within the scope of the present teachings herein. Also, the use of "comprise", "comprises", "comprising", "contain", "contains", "containing", "include", "includes", and "including" are not intended to be limiting. It is to be understood that both the foregoing general description and detailed description are exemplary and explanatory only and are not restrictive of the invention.
[0036] Unless specifically noted in the above specification, embodiments in the above specification that recite "comprising" various components are also contemplated as "consisting of or "consisting essentially of the recited components; embodiments in the specification that recite "consisting of various components are also contemplated as "comprising" or "consisting essentially of the recited components; and embodiments in the specification that recite "consisting essentially of various components are also contemplated as "consisting of or "comprising" the recited components (this interchangeability does not apply to the use of these terms in the claims).
[0037] As used herein the terms "nucleotide" or "nucleotide base" refer to a nucleoside phosphate. It includes, but is not limited to, a natural nucleotide, a synthetic nucleotide, a modified nucleotide, or a surrogate replacement moiety or universal nucleotide (e.g., inosine). The nucleoside phosphate may be a nucleoside monophosphate, a nucleoside diphosphate or a nucleoside triphosphate. The sugar moiety in the nucleoside phosphate may be a pentose sugar, such as ribose, and the phosphate esterification site may correspond to the hydroxyl group attached to the C-5 position of the pentose sugar of the nucleoside. A nucleotide may be, but is not limited to, a deoxyribonucleoside triphosphate (dNTP) or a ribonucleoside triphosphate (NTP). The nucleotides may be represented using alphabetical letters (letter designation). For example, A denotes adenosine (i.e., a nucleotide containing the nucleobase, adenine), C denotes cytosine, G denotes guanosine, T denotes thymidine, U denotes uracil, and I denotes inosine. N represents any nucleotide (e.g., N may be any of A, C, G, T U, or I). Naturally occurring and synthetic analogs may also be used, including for example hypoxanthine, 2-aminoadenine, 2-thiouracil, 2-thiothymine, 5-N4 ethencytosine, 4- aminopyrrazolo[3,4-dJpyrimidine and 6-amino-4-hydroxy[3,4-d]pyrimidine, among others. The nucleotide units of the oligonucleotides may also have a cross-linking function (e.g. an alkylating agent).
[0038] As used herein, the term "oligonucleotide" or "polynucleotide" refers to an oligomer of nucleotide or derivatives thereof. The oligomers may be DNA, RNA, or analogues thereof (e.g., phosphorothioate analogue). The oligomers may also include modified bases, and/or backbones (e.g., modified phosphate linkage or modified sugar moiety). Non-limiting examples of synthetic backbones that confer stability and/or other advantages to the oligomers may include phosphorothioate linkages, peptide nucleic acid, locked nucleic acid (Singh, et al. Chem Commum 4:455-456 ( 1998)), xylose nucleic acid, and / or analogues thereof. Oligonucleotides may be any length "n." For example, n may be any of 1 , 2, 4, 6, 8, 12, 16, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40 etc. number of nucleotides. The polynucleotide structure (N)n represents an oligonucleotide consisting of n number of nucleotides N (e.g., (I)8 is representative of an oligonucleotide having the sequence or (A)i2 is representative of an oligonucleotide having the sequence AAAAAAAAAAAA). Other types of oligonucleotides or polynucleotides may also be suitable for use as would be understood to one of skill in the art from this disclosure.
[0039] As used herein, the term "nucleic acid" refers to polymers of nucleotides or derivatives thereof. As used herein, the term "target nucleic acid" refers to a nucleic acid that is desired to be amplified in a nucleic acid amplification reaction. For example, the target nucleic acid comprises a nucleic acid template.
[0040] As used herein, the term "sequence" refers to a nucleotide sequence of an oligonucleotide or a nucleic acid. Throughout the specification, whenever an oligonucleotide/nucleic acid is represented by a sequence of letters, the nucleotides are in 5' to 3' order from left to right. For example, an oligonucleotide represented by a sequence (I)n(A)n wherein n=l , 2, 3, 4 and so on, represents an oligonucleotide where the 5' terminal nucleotide(s) is inosine and the 3' terminal nucleotide(s) is adenosine.
[0041 ] As used herein the term "reaction mixture" refers to the combination of reagents or reagent solutions, which are used to carry out a chemical analysis or a biological assay. In some embodiments, the reaction mixture comprises all necessary components to carry out a nucleic acid (DNA) synthesis/amplification reaction. As described above, such reaction mixtures may include at least one amplification primer pair suitable for amplifying a nucleic acid sequence Of interest and at least one PDI compound (e.g., a polynucleotide). As described above, a suitable reaction mixture may also include a "master mix" containing the components (e.g., typically not including the primer pair) needed to perform an amplification reaction. The master mix may be combined with one or more PDIs to form a reaction mixture. Other embodiments of reaction mixtures are also contemplated herein as would be understood by one of skill in the art.
[0042] As used herein, the terms "reagent solution" or "solution suitable for performing a DNA synthesis reaction" refer to any or all solutions, which are typically used to perform an amplification reaction or DNA synthesis. They include, but are not limited to, solutions used in DNA amplification methods, solutions used in PCR amplification reactions, or the like. The solution suitable for DNA synthesis reaction may comprise buffer, salts, and/or nucleotides. It may further comprise primers and / or DNA templates to be amplified. One or more reagent solutions are typically included in the reactions mixtures or master mixes described herein.
[0043] As used herein, the term "primer" or "primer sequence" refers to a short linear oligonucleotide that hybridizes to a target nucleic acid sequence (e.g., a DNA template to be amplified) to prime a nucleic acid synthesis reaction. The primer may be a RNA oligonucleotide, a DNA oligonucleotide, or a chimeric sequence (e.g., comprising RNA and DNA). The primer may contain natural, synthetic, or modified nucleotides. Both the upper and lower limits of the length of the primer are empirically determined. The lower limit on primer length is the minimum length that is required to form a stable duplex upon hybridization with the target nucleic acid under nucleic acid amplification reaction conditions. Very short primers (usually less than 3 nucleotides long) do not form thermodynamically stable duplexes with target nucleic acid under such hybridization conditions. The upper limit is often determined by the possibility of having a duplex formation in a region other than the pre-determined nucleic acid sequence in the target nucleic acid. Generally, suitable primer lengths are in the range of about any of, for example, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, (and so on) nucleotides long.
[0044] As used herein, the term "primer dimer" refers generally to unwanted intermolecular interactions between at least two primers (e.g., self-dimers and cross-dimers). For example, nonspecific amplification products can form when two primers interact during the annealing and / or extension phase of PCR, followed by extension of the 3'-end of one or both primers with the other primer acting as a template. In certain embodiments, oligonucleotides are utilized in an amplification reaction that are significantly non-complementary to any other oligonucleotide or nucleic acid in the reaction mixture. As used herein, the term "significantly non-complementary" can refer to less than 50 percent homologous, less than 40 percent homologous, less than 30 percent homologous, less than 20 percent homologous, less than 10 percent homologous, and / or less than 5 percent homologous. The term "percent homologous" typically refers to the sequence of a first nucleotide sequence as it compares to a second nucleotide sequence, in both or either composition (e.g., the total amount of each type of nucleotide within an oligonucleotide) and / or order (e.g., the order in which each appears (5' to 3') in the nucleotide sequence). For instance, the nucleotide sequence of the olionucleotide portion of a PDI compound may be significantly non-complementary to any other nucleotide sequence of a reaction mixture. Similarly, an "unrelated PDI polynucleotide" may refer to the oligonucleotide portion of a PDI compound wherein the oligonucleotide portion is significantly non-complementary to any other oligonucleotide or polynucleotide (e.g., nucleotide sequence of interest) in a reaction mixture.
[0045] As used herein, the term "primer dimer inhibitor compound" (e.g., PDI or PDI compound) refers generally to a compound that suppresses the formation of unwanted side products and/or reactions resulting from primer dimer formation. These PDI compounds can be indicated by the shorthand "PDI." In some embodiments, PDIs can comprise "primer dimer inhibitor polynucleotides" or "PDI polynucleotides." Some PDI polynucleotides may comprise a minor groove binder (MGB). Some PDI polynucleotides may further comprise a quencher moiety, such as a non-fluorescent or dark quencher (DQ). A Black Hole Quencher® (e.g., BHQ®-0, -1 , -2, -3 (Biosearch Technologies)) may also be suitable for use as described herein. PDIs or PDI polynucleotides that comprise MGB and DQ can be referred to as "MGB-DQ" or "PDI-MGB-DQ." Other PDIs or PDI polynucleotides may further comprise reporter dyes (such as PET, ISfED, VIC, or FAM (e.g., 5-FAM)). Such PDIs or PDI polynucleotides can be referred to, for example, (as in the case for FAM comprising PDIs) as "FAM-MGB-DQ" or "PDI-FAM-MGB-DQ" or (as in the case for PET comprising PDIs) as "PET-MGB-DQ" or "PDI-PET-MGB-DQ."
[0046] As used herein, the term "blocker" or "blocker moiety" refers generally to a modification on an oligonucleotide sequence such as a probe and/or primer which renders it incapable of extension by a polymerase, for example, when hybridized to its complementary sequence in a PCR reaction. Common examples of blocker moieties include modifications of the ribose ring 3'-OH of the oligonucleotide, which prevents addition of further bases to the '3-end of the oligonucleotide sequence a polymerase. Such '3-OH modifications are well known in the art. (See, e.g., Josefsen, M., et al., Molecular and Cellular Probes, 23 (2009):201-223, the disclosure of which is incorporated by reference in its entirety).
[0047] As used herein, the terms "MGB," "MGB group," or "MBG moiety" refers to a minor groove binder. An MGB may be a molecule that binds within the minor groove of double stranded DNA. Although a general chemical formula for all known MGB compounds may not be stated, these compounds are typically capable of binding in the minor groove of DNA by virtue of a crescent shape three-dimensional structure. MGB moieties may have a strong preference for A-T (adenine and thymine) rich regions of the B form of double stranded DNA. Nevertheless, MGB compounds which would show preference to C-G (cytosine and guanine) rich regions are also theoretically possible. Therefore, oligonucleotides comprising a radical or moiety derived from minor groove binder molecules having preference for C-G regions are also within the scope of the present invention.
[0048] Oligonucleotides described herein typically include a plurality of nucleotide units, a 3'- end and a 5'-end, and a minor groove binder moiety covalently attached to at least one of said nucleotides. The MGB is typically attached to the oligonucleotide through a linking group comprising a chain of no more than 15 atoms (see below). The MGB moiety is typically a radical of a molecule having a molecular weight of approximately 150 to approximately 2000 daltons which molecule binds in a non-intercalating manner into the minor groove of double stranded DNA, RNA or hybrids thereof with an association constant greater than approximately 103 M" 1. Some MGBs are capable of binding within the minor groove of double stranded DNA with an association constant of 103M"' or greater. However, some MGBs bind to the high affinity sites of double stranded DNA with an association constant of the magnitude of 107 to 109 M"1. This type of binding can be detected by well-established spectrophotometric methods such as ultraviolet (UV) and nuclear magnetic resonance (NMR) spectroscopy and also by gel electrophoresis. Shifts in UV spectra upon binding of a minor groove binder molecule and NMR spectroscopy utilizing the "Nuclear Overhauser" (NOSEY) effect are particularly well known and useful techniques for this purpose. Gel electrophoresis detects binding of an MGB to double stranded DNA or fragment thereof, because upon such binding the mobility of the double stranded DNA changes. [0049] When conjugated to the 3' end of an oligonucleotide, an MGB group can function as non- extendable blocker moiety. Various MGBs are known in the art. Synthesis methods and/or sources for such MGBs are also well known in the art. (See, e.g., U.S. Patent Nos. 5,801 ,155; 6,492,346; 6,084,102; 6,486,308; 6,727,356; Wemmer, et al. Curr. Op. Struct. Biol. 7:355-361 (1997); Walker, et al. Biopolymers, 44:323-334 (1997); Zimmer, et al. Prog. Biophys. Molec. Bio. 47:31- 1 12 (1986); Reddy, et al. Pharmacol. Therap., 84: 1 -1 1 1 (1999), the disclosures of which are herein incorporated by reference in their entireties). As used herein, the term "PDI-MGB," "MGB polynucleotide," "(N)n-MGB" (where N is any nucleotide and n is the number of nucleotides) is an oligonucleotide sequence and/or probe further attached to a minor groove binder moiety.
[0050] The synthesis of PDI compounds (e.g., MGB polynucleotides and the like) are described by for example U.S. Pat. No. 6,486,308, which is herein incorporated by reference in its entirety. Exemplary conjugates may be represented by Formula I:
Figure imgf000020_0001
where x is O or S; q is an integer between 3 to 100; R8 is H, OH, alkoxy having 1 to 6 carbons, O— C2 -C6 alkenyl, or F; B is an aglycon selected from a group consisting of a heterocyclic base naturally found in nucleic acids and hypoxanthine, 2-aminoadenine, 2-thiouracil, 2-thiothymine, 5- N4 -ethenocytosine, 4-aminopyrrazolo [3,4-d]pyrimidine, 6-amino-4-hydroxy-[3,4-d]pyrimidine; Wi is H, PO(OH)2 or a salt thereof, or a minor groove binder moiety attached to the 3' or 5' end of said oligonucleotide, the W| group including the linking group which covalently binds the minor groove binder moiety to the oligonucleotide through no more than 15 atoms; W2 is absent or is a minor groove binder moiety attached to one of the aglycons B, the W2 group including the linking group which covalently binds the minor groove binder moiety to said aglycon, or W2 is a cross-linking functionality including a linker arm which covalently binds the cross-linking functionality to said aglycon; wherein the minor groove binder moiety is a radical of a molecule having a molecular weight of approximately 150 to approximately 2000 Daltons that bind in a non-intercalataing manner into the minor groove of double stranded DNA, RNA or hybrids thereof with an association constant greater than approximately 103, with the proviso that at least one of said W| and W2 groups is a minor groove binder moiety; and, wherein further the minor groove binder moiety including the linking group has the formula selected from the group consisting of groups (a), (b), (c), (d) and (e):
R, -(HN--Y, -CO)„ -R2 (a) where Yi represents a 5-membered ring having two double bonds and 0 to 3 heteroatoms selected from the group consisting of N, S and O, the NH and CO groups are attached respectively to two ring carbons which are separated by one ring atom from one another, the ring atom positioned between said two ring carbons is substituted only with H or is unsubstituted, each of the remaining ring atoms may be optionally substituted with 1 , 2 or 3 R3 groups;
R, -(Re N-Y2 -CO)n -R2 (b) where Y2 is a ring system consisting of a 6-membered aromatic ring condensed with a 5-membered ring having one double bond, the condensed ring system having 0 to 3 heteroatoms selected from the group consisting of N, S and O, each of the R6 N and CO groups is attached to a ring carbon which is in a different ring of the condensed ring system, and which is the second ring atom, respectively, from one common bridgehead ring atom, the CO and NR6 groups thereby positioning 2 non- bridgehead ring atoms between themselves on one side and 3 non-bridgehead ring atoms on the other side of the condensed ring system, the two non-bridgehead ring atoms on the one side being optionally substituted with an R7 group, the three non-bridgehead ring atoms on the other side of the condensed ring system being optionally substituted with an R3 group;
R, -(CO-Y3 -NH) )„ -R2 (c) where Y3 is a 6-membered aromatic ring having 0 to 3 N heteroatoms, and where each of the CO and NH groups is attached to a ring carbon, said ring carbons being in 1 ,4 position relative to one another, two ring atoms not occupied by the CO or NH groups on either one of the two sides of the 6-membered ring being optionally substituted with an R3 group, the two ring atoms not occupied on the other side of the 6 membered ring being optionally substituted with an R7 group;
Ri ~(HN~Y4 --HN-CO-Y4 ~CO)p ~R2 (d) where Y4 is a 6-membered aromatic ring having 0 to 3 N heteroatoms, and where each of the CO and NH groups is attached to a ring carbon, said ring carbons being in 1 ,4 position relative to one another in each ring, two ring atoms not occupied by the CO or NH groups on either one of the two sides of the 6-membered ring being optionally substituted with an R3 group, the two ring atoms not occupied on the other side of the 6 membered ring being optionally substituted with an R7 group;
Ri ~(Y5)„ -R2 (e) where Y5 is a ring system consisting of a 6-membered aromatic ring condensed with a 5-membered ring having one double bond, the condensed ring system having 0 to 3 heteroatoms selected from the group consisting of N, S and O, each of the Ri and R2 groups is attached to a ring carbon which is in a different ring of the condensed ring system, and which is the second ring atom, respectively, from one common bridgehead ring atom, the Ri and R2 groups thereby positioning 2 non-bridgehead ring atoms between themselves on one side and 3 non-bridgehead ring atoms on the other side of the condensed ring system, the two non-bridgehead ring atoms on the one side being optionally substituted with an R7 group, the three non-bridgehead ring atoms on the other side of the condensed ring system being optionally substituted with an R3 group; where Ri and R2 independently are H, F, CI, Br, I, NH2, NHR4, N(R4)2, (R4)3 +, OH, -0-, -S-, OR4, SH, SR4, COR4, CONHR4, CON(R4)2, R4, H2 N(CH2)m CO, CONH2, CONHR4, H2 N(CH2)m COO(CH2)m S(CH2)m C6 ¾ NNC6 H4, - HN(CH2)m CO, -CONH-, -CONR4, -HN(CH2)m COO(CH2)m S(CH2)m C6 H4 NNC6 H4, and - (CH2)m CH(OH) (CH2)m NHCO(CH2)m NH-, or one of the Ri and R2 groups is absent; R3 is selected from the group consisting of F, CI, Br, I, NH2, NHR4, N(R4)2, N(R4)3 +, OH, OR4, SH, SR4, COR4, CONHR4, CO CR^ and R4, or the R3 groups may form a 3, 4, 5 or 6 membered ring condensed to the Y| ring; R4 is an alkyl or cycloalkyi group having 1 to 20 carbons, an alkenyl or cycloalkenyl group having 1 to 20 carbons and 1 to 3 double bonds, a carbocyclic aromatic group of no more than 25 carbons, a heterocyclic aromatic group of no more than 25 carbons, a carbocyclic or heterocyclic arylalkyl group of no more than 25 carbons, where R4 may be optionally substituted with 1 , 2 or 3 F, CI, Br, I, NH2, NHR5, N(R5)2, N(R5)3 +, OH, OR5, SH, SR5> COR5, CONHR5, CON(R5)2 or R5 groups; R5 is alkyl of 1 to 6 carbons, R6 is H, alkyl of 1 to 5 carbons, or R6 and R7 jointly form a 4, 5, or 6 membered ring, optionally an—0-,— S— ,— NH— ,— CH3— , or N-lower alkyl group being part of said ring; R7 is F, methyl or ethyl;— CH2— , or— CH2 CH2— ; m is an integer between 1 to 10; n is an integer between 1 to 10; and, p is an integer between 1 to 5. Exemplary compounds of formula (a) may comprise the ring structures:
Figure imgf000024_0001
including, for example,
Figure imgf000024_0002
and / or
Figure imgf000024_0003
where n represents the desired number of peptide residues (e.g., 1 to 50). The compounds (MGBs) may be joined to an oligonucleotide through either the free amino or tBoc groups thereof. Exemplary compounds of formula (b) may include the ring structure shown below (e.g., see DPI3 described below):
Figure imgf000025_0001
including, for example,
Figure imgf000025_0002
where R may be H or CH3 (including, for example dimers, trimers, and tetramers thereof (e.g., Boger, et al. J. Org. Chem. 52(8): 1521-1530 (1987) (incorporated herein by reference in its entirety)),
Figure imgf000025_0003
U.71-184 (Boger, et al., above),
Figure imgf000026_0001
6-(6-(3,6,7,8 efrahydropyrrolo[3,2-e]indole-^^
3,6,7,8-tetrahydropyrrolo[3,2-e]indole-2-carboxylic acid and / or
Figure imgf000026_0002
CDPI3 3-hydroxypropylamide.
Other suitable compounds may include, for example, 3-{ [3-(pyrrolo[4,5-e]indolin-7- ylcarbonyl)pyrrolo[4,5-e]indolin-7-yl]carbonyl }pyrrolo[3,2-e]indoline-7-carboxylic acid (DPI3) as described in, for example, U.S. Pat. Nos. 6,486,308B2 and 6,727,356, which are hereby incorporated by reference in their entirety).
[0051 ] A variety of other MGBs in addition to those described above may also be suitable for use in the methods described herein. Examples of known MGB moieties include, for example, the naturally occurring compounds netropsin, distamycin, lexitropsin, mithramycin, chromomycin A3, olivomycin, anthramycin, sibiromycin, as well as further related antibiotics and synthetic derivatives. Certain bisquartemary ammonium heterocyclic compounds, diarylamidines such as pentamidine, stilbamidine and berenil, CC-1065 and related pyrroloindole and indole polypeptides, Hoechst 33258, 4'-6-diamidino-2-phenylindole (DAPI) as well as a number of oligopeptides consisting of naturally occurring or synthetic amino acids may also be suitable MGBs. A further exemplary selection of suitable MGBs is provided below:
Figure imgf000028_0001
Figure imgf000029_0001
Other MGBs may also be suitable for use as described herein, as would be understood by one of skill in the art.
[0052] A linking group of, for example, 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, but typically not more than 15 atoms, may be used to join the oligonucleotide portion of the conjugate to the minor groove binder moiety. In most embodiments, the minor groove binder moiety is covalently attached to either the 3' or 5' end of the oligonucleotide but it may also be attached at an intermediate position (e.g., to the heterocyclic base of a nucleotide in intermediate position). The linking group may be derived from a bifunctional molecule (e.g., an amine functionality attached to the 5' phosphate of the oligonucleotide and carbonyl group (CO) attached to an amino group of the MGB moiety). The linking group may also be derived from an amino alcohol linked to the 3' phosphate of the oligonucleotide while the amino function is linked to a carbonyl group of the MGB moiety. Yet another possible linkage utilizes an amino-alcohol attached to the 3'-phosphate of the oligonucleotide with an ester linkage and an aminocarboxylic acid linked in a peptide bond to the carbonyl group of the MGB. Exemplary linking groups may include, for example, -HN(CH2)m CO, 0(CH2)mCO and (CH2)mCH(OH)(CH2)mNHCO(CH2)mNH, where m is an integer providing that separates the MGB by a suitable number of atoms (see above) from the oligonuleotide (e.g., -0(CH2)6 NH, -OCH2 CH(OH)CH2 NHCOCH2 CH2 NH and ~HN(CH2)5 CO). Other linkers may also be suitable, as would be understood by one of skill in the art.
[0053] The minor groove binder moiety may also carry additional functions, as long as those functions do not interfere with minor groove binding ability of the MGB. For example, a reporter group (e.g., a detector probe or label), which makes the minor groove binder readily detectable by color, UV spectrum, or other readily discernible physical or chemical characteristic (e.g., a detectable label as described herein), may be covalently attached to the MGB. The reporter group may be part of the MGB itself. For instance, certain PDI compounds may comprise an MGB, a linker, and a dark quencher, as shown below:
Figure imgf000030_0001
MGB-DQ Structures with linkers [0054] As used herein, the term "detector probe" refers to any of a variety of signaling molecules indicative of amplification. For example, SYBR GREEN and other DNA-binding dyes are detector probes. Such detector probes may comprise or may be, for example, nucleic acid intercalating agents or non-intercalating agents. As used herein, an intercalating agent is an agent or moiety capable of non-covalent insertion between stacked base pairs of a double-stranded nucleic acid molecule. A non-intercalating agent is one that does not insert into the double-stranded nucleic acid molecule. The nucleic acid binding agent may produce a detectable signal directly or indirectly. The signal may be detectable directly using, for example, fluorescence and / or absorbance, or indirectly using, for example, any moiety or ligand that is detectably affected by proximity to double-stranded nucleic acid is suitable such as a substituted label moiety or binding ligand attached to the nucleic acid binding agent. It is typically necessary for the nucleic acid binding agent to produce a detectable signal when bound to a double-stranded nucleic acid that is distinguishable from the signal produced when that same agent is in solution or bound to a single-stranded nucleic acid. For example, intercalating agents such as ethidium bromide fluoresce more intensely when intercalated into double-stranded DNA than when bound to single-stranded DNA, RNA, or in solution (see, e.g., U.S. Pat. Nos. 5,994,056; 6, 171 ,785; and / or 6,814,934). Similarly, actinomycin D fluoresces red fluorescence. when bound to single-stranded nucleic acids, and green when bound to double-stranded nucleic acids. And in another example, the photoreactive psoralen 4-aminomethyle- 4-5'8-trimethylpsoralen (AMT) has been reported to exhibit decreased absorption at long wavelengths and fluorescence upon intercalation into double-stranded DNA (Johnson et al. Photochem. & Photobiol., 33:785-791 (1981). For example, U.S. Pat. No. 4,257,774 describes the direct binding of fluorescent intercalators to DNA (e.g., ethidium salts, daunomycin, mepacrine and acridine orange, 4'6-diamidino-a-phenylindole). Non-intercalating agents (e.g., minor groove binders as described herein such as Hoechst 33258, distamycin, netropsin) may also be suitable for use. For example, Hoechst 33258 (Searle, et al. Nuc. Acids Res. 18(13):3753-3762 (1990)) exhibits altered fluorescence with an increasing amount of target. Minor groove binders are described in more detail elsewhere herein.
[0055] Other DNA binding dyes are available to one of skill in the art and may be used alone or in combination with other agents and / or components of an assay system. Exemplary DNA binding dyes may include, for example, acridines (e.g., acridine orange, acriflavine), actinomycin D (Jain, et al. J. Mol. Biol. 68:21 (1972)), anthramycin, BOBO™- l , BOBO™-3, BO-PRO™- l , cbromomycin, DAPI (Kapuseinski, et al. Nuc. Acids Res. 6(1 12): 3519 (1979)), daunomycin, distamycin (e.g., distamycin D), dyes described in U.S. Pat. No. 7,387,887, ellipticine, ethidium salts (e.g., ethidium bromide), fluorcoumanin, fluorescent intercalators as described in U.S. Pat. No. 4,257,774, GelStar® (Cambrex Bio Science Rockland Inc., Rockland, Me.), Hoechst 33258 (Searle and Embrey, 1990, Nuc. Acids Res. 18:3753-3762), Hoechst 33342, homidium, JO-PRO™-l , LIZ dyes, LO-PRO™-l , mepacrine, mithramycin, NED dyes, netropsin, 4'6-diamidino-a-phenylindole, proflavine, POPO™- 1 , POPO™-3, PO-PRO™- l , propidium iodide, ruthenium polypyridyls, S5, SYBR® Gold, SYBR® Green I (U.S. Patent No. 5,436, 134 and 5,658,751), SYBR® Green II, SYTOX blue, SYTOX green, SYTO® 43, SYTO® 44, SYTO® 45, SYTOX® Blue, TO-PRO®- l , SYTO® 1 1 , SYTO® 13, SYTO® 15, SYTO® 16, SYTO® 20, SYTO® 23, thiazole orange (Aldrich Chemical Co., Milwaukee, Wis.), TOTO™-3, YO-PRO®-l, and YOYO®-3 (Molecular Probes, Inc., Eugene, OR), among others. SYBR® Green I (see, e.g., U.S. Pat. Nos. 5,436,134; 5,658,751 ; and / or 6,569,927), for example, has been used to monitor a PCR reactions. Other DNA binding dyes may also be suitable as would be understood by one of skill in the art. [0056] For use as described herein, one or more detectable labels and / or quenching agents may be attached to one or more primers, probes (e.g., detector probe), and / or PDIs. The detectable label may emit a signal when free or when bound to one of the target nucleic acids. The detectable label may also emit a signal when in proximity to another detectable label. Detectable labels may also be used with quencher molecules such that the signal is only detectable when not in sufficiently close proximity to the quencher molecule. For instance, in some embodiments, the assay system may cause the detectable label to be liberated from the quenching molecule. Any of several detectable labels may be used to label the primers and probes used in the methods described herein. As mentioned above, in some embodiments the detectable label may be attached to a probe, which may be incorporated into a primer, or may otherwise bind to amplified target nucleic acid (e.g., a detectable nucleic acid binding agent such as an intercalating or non-intercalating dye). When using more than one detectable label, each should differ in their spectral properties such that the labels may be distinguished from each other, or such that together the detectable labels emit a signal that is not emitted by either detectable label alone. Exemplary detectable labels include, for instance, a fluorescent dye or fluorphore (e.g., a chemical group that can be excited by light to emit fluorescence or phosphorescence), "acceptor dyes" capable of quenching a fluorescent signal from a fluorescent donor dye, and the like. Suitable detectable labels may include, for example, fluoresceins (e.g., 5-carboxy-2,7-dichlorofluorescein; 5-Carboxyfluorescein (5-FAM); 5-HAT (Hydroxy Tryptamine); 5-Hydroxy Tryptamine (HAT); 6-JOE; 6-carboxyfluorescein (6-FAM); FITC; 6-carboxy- l ,4-dichloro-2',7'-dichlorofluorescein (TET); 6-carboxy- l ,4-dichloro-2',4\ 5', T- tetrachlorofluorescein (HEX); 6-carboxy-4',5'-dichloro-2', 7 '-dimethoxy fluorescein (JOE); ); Alexa fluors (e.g., 350, 405, 430, 488, 500, 514, 532, 546, 555, 568, 594, 610, 633, 635, 647, 660, 680, 700, 750); BODIPY fluorophores (e.g., 492/515, 493/503, 500/510, 505/515, 530/550, 542/563, 558/568, 564/570, 576/589, 581/591 , 630/650-X, 650/665-X, 665/676, FL, FL ATP, Fl-Ceramide, R6G SE, TMR, TMR-X conjugate, TMR-X, SE, TR, TR ATP, TR-X SE), coumarins (e.g., 7- amino-4-methylcoumarin, AMC, AMCA, AMCA-S, AMCA-X, ABQ, CPM methylcoumarin, coumarin phalloidin, hydroxycoumarin, CMFDA, methoxycoumarin), calcein, calcein AM, calcein blue, calcium dyes (e.g., calcium crimson, calcium green, calcium orange, calcofluor white), Cascade Blue, Cascade Yellow; Cy™ dyes (e.g., 3, 3.18, 3.5, 5, 5.18, 5.5, 7), cyan GFP, cyclic AMP Fluorosensor (FiCRhR), fluorescent proteins (e.g., green fluorescent protein (e.g., GFP. EGFP), blue fluorescent protein (e.g., BFP, EBFP, EBFP2, Azurite, mKalamal ), cyan fluorescent protein (e.g., ECFP, Cerulean, CyPet), yellow fluorescent protein (e.g., YFP, Citrine, Venus, YPet), FRET donor/acceptor pairs (e.g., fluorescein/tetramethylrhodamine, IAEDANS/fluorescein, EDANS/dabcyl, fluorescein/fluorescein, BODIPY FL/BODIPY FL, Fluorescein/QSY7 and QSY9), LysoTracker and LysoSensor (e.g., LysoTracker Blue DND-22, LysoTracker Blue- White DPX, LysoTracker Yellow HC -123, LysoTracker Green DND-26, LysoTracker Red DND-99, LysoSensor Blue DND- 167, LysoSensor Green DND- 189, LysoSensor Green DND- 153, LysoSensor Yellow/Blue DND-160, LysoSensor Yellow/Blue 10,000 MW dextran), Oregon Green (e.g., 488, 488-X, 500, 514); rhodamines (e.g., 1 10, 123, B, B 200, BB, BG, B extra, 5- carboxytetramethylrhodamine (5-TAMRA), 5 GLD, 6-Carboxyrhodamine 6G, Lissamine, Lissamine Rhodamine B, Phallicidine, Phalloidine, Red, Rhod-2, ROX (6-carboxy-X-rhodamine), 5-ROX (carboxy-X-rhodamine), Sulphorhodamine B can C, Sulphorhodamine G Extra, TAMRA (6- carboxytetramethylrhodamine), Tetramethylrhodamine (TRITC), WT), Texas Red, Texas Red-X, VIC and other labels described in, e.g., US Pub. No. 2009/0197254 (incorporated herein by reference in its entirety), among others as would be known to those of skill in the art. Other detectable labels may also be used (see, e.g., US Pub. No. 2009/0197254 (incorporated herein by reference in its entirety)), as would be known to those of skill in the art. Any of these systems and detectable labels, as well as many others, may be used to detect amplified target nucleic acids.
[0057] Some detector probes can be sequence-based (also referred to herein as "locus-specific detector probe"), for example 5' nuclease probes. Such probes may comprise one or more detectable labels. Various detector probes are known in the art, for example (TaqMan probes described herein (See also U.S. Patent No. 5,538,848 (incorporated herein by reference in its entirety)) various stem- loop molecular beacons (See, e.g., U.S. Patent Nos. 6, 103,476 and 5,925,517 and Tyagi and Kramer, 1996, Nature Biotechnology 14:303-308), stemless or linear beacons (See, e.g., WO 99/21881 ; U.S. Pat. No. 6,485,901 ), PNA Molecular Beacons ™ (See, e.g., U.S. Patent Nos. 6,355,421 and 6,593,091 ), linear PNA beacons (See, e.g., Kubista et al., 2001 , SPIE 4264:53-58), non-FRET probes (See, e.g., U.S. Patent No. 6, 150,097), Sunrise®/Amplifluor® probes (U.S. Patent No. 6,548,250), stem-loop and duplex Scorpion™ probes (Solinas et al., 2001 , Nucleic Acids Research 29:E96 and U.S. Patent No. 6,589,743), bulge loop probes (U.S. Patent No. 6,590,091), pseudo knot probes (U.S. Patent No. 6,589,250), cyclicons (U.S. Patent No. 6,383,752), MGB Eclipse™ probe (Epoch Biosciences), hairpin probes (U.S. Patent No. 6,596,490), peptide nucleic acid (PNA) light- up probes (Svanvik, et al. Anal Biochem 281 :26-35 (2001 )), self-assembled nanoparticle probes, ferrocene-modified probes described, for example, in U.S. Patent No. 6,485,901 ; Mhlanga et al., 2001 , Methods 25:463-471 ; Whitcombe et al., 1999, Nature Biotechnology. 17:804-807; Isacsson et al., 2000, Molecular Cell Probes. 14:321 -328; Svanvik et al., 2000, Anal Biochem. 281 :26-35; Wolffs et al., 2001 , Biotechniques 766:769-771 ; Tsourkas et al., 2002, Nucleic Acids Research. 30:4208-4215; Riccelli et al., 2002, Nucleic Acids Research 30:4088-4093; Zhang et al., 2002 Shanghai. 34:329-332; Maxwell et al., 2002, J. Am. Chem. Soc. 124:9606-9612; Broude et al., 2002, Trends Biotechnol. 20:249-56; Huang et al., 2002, Chem Res. Toxicol. 15: 1 18-126; and Yu et al., 2001 , J. Am. Chem. Soc 14: 1 1 155-1 1 161 ; QuantiProbes (www.qiagen.com), HyBeacons (French, et al. Mol. Cell. Probes 15:363-374 (2001 )), displacement probes (Li, et al. Nucliec Acids Res. 30:e5 (2002)), HybProbes (Cardullo, et al. PNAS 85:8790-8794 (1988)), MGB Alert (www.nanogen.com), Q-PNA (Fiandaca, et al. Genome Res. 1 1 :609-61 1 (2001)), Plexor (www.Promega.com), LUX primers (Nazarenko, et al. Nucleic Acids Res. 30:e37 (2002)), DzyNA primers (Todd, et al. Clin. Chem. 46:625-630 (2000)). Detector probes can also comprise black hole quenchers (Biosearch), Iowa Black (IDT), QSY quencher (Molecular Probes), and Dabsyl and Dabcel sulfonate/carboxylate Quenchers (Epoch). Detector probes can also comprise two probes, wherein for example a fluor is on one probe, and a quencher on the other, wherein hybridization of the two probes together on a target quenches the signal, or wherein hybridization on a target alters the signal signature via a change in fluorescence. Exemplary systems may also include FRET, salicylate / DTPA ligand systems (see, e.g., Oser et al. Angew. Chem. Int. Engl. 29(10): 1 167 ( 1990)), displacement hybridization, homologous probes, and / or assays described in EP 070685 and / or U.S. Pat. No. 6,238,927. Detector probes can also comprise sulfonate derivatives of fluorescein dyes with SO3 instead of the carboxylate group, phosphoramidite forms of fluorescein, phosphoramidite forms of CY5 (available for example from Amersham). All references cited above are hereby incorporated herein by reference in their entirety.
[0058] As used herein, the terms "amplification," "nucleic acid amplification," or "amplifying" refer to the production of multiple copies of a nucleic acid template, or the production of multiple nucleic acid sequence copies that are complementary to the nucleic acid template. The amplification reaction may be a polymerase-mediated extension reaction such as, for example, a polymerase chain reaction (PCR). However, any of the known amplification reactions may be suitable for use as described herein. The term "amplifying" which typically refers to an "exponential" increase in target nucleic acid is being used herein to describe both linear and exponential increases in the numbers of a select target sequence of nucleic acid. The term "amplification reaction mixture" may refer to an aqueous solution comprising the various reagents used to amplify a target nucleic acid. Such reactions may also be performed using solid supports (e.g., an array). The reactions may also be performed in single or multiplex format as desired by the user. These reactions typically include enzymes, aqueous buffers, salts, amplification primers, target nucleic acid, and nucleoside triphosphates. Depending upon the context, the mixture can be either a complete or incomplete amplification reaction mixture. The method used to amplify the target nucleic acid may be any available to one of skill in the art. Any in vitro means for multiplying the copies of a target sequence of nucleic acid may be utilized. These include linear, logarithmic, and / or any other amplification method. While any of the present teachings may generally discuss PCR as the nucleic acid amplification reaction, it is expected that the PDI compounds should be effective in other types of nucleic acid amplification reactions, including both polymerase-mediated amplification reactions (such as HDA, RPA, and RCA), as well as ligase-mediated amplification reactions (such as LDR, LCR, and gap-versions of each), and combinations of nucleic acid amplification reactions such as LDR and PCR (see for example U.S. Patent 6,797,470). Accordingly, as used herein the "PDI compounds" in the present methods can be of sufficient breadth to include suppression of unwanted side products in amplification reactions lacking primers per se. For example, the PDI compounds of the present teachings are contemplated for use in various ligation-mediated reactions, where for example ligation probes are employed as opposed to PCR primers. Additional exemplary methods include polymerase chain reaction (PCR; see, e.g., U.S. Patent Nos. 4,683,202; 4,683,195; 4,965,188; and / or 5,035,996), isothermal procedures (using one or more RNA polymerases (see, e.g., WO 2006/081222), strand displacement (see, e.g., U.S. Pat. No. RE39007E), partial destruction of primer molecules (see, e.g., WO2006087574)), ligase chain reaction (LCR) (see, e.g., Wu, et al., Genomics 4: 560-569 (1990)), and / or Barany, et al. PNAS USA 88: 189-193 (1991)), Qp RNA replicase systems (see, e.g., WO/1994/016108), RNA transcription-based systems (e.g., TAS, 3SR), rolling circle amplification (RCA) (see, e.g., U.S. Pat. No. 5,854,033; U.S. Pub. No. 2004/265897; Lizardi et al. Nat. Genet. 19: 225-232 (1998); and / or Baner et al. Nucleic Acid Res., 26: 5073- 5078 ( 1998)), and strand displacement amplification (SDA) (Little, et al. Clin Chem 45:777-784 ( 1999)), among others. These systems, along with the many other systems available to the skilled artisan, may be suitable for use in amplifying target nucleic acids for use as described herein.
[0059] "Amplification efficiency" may refer to any product that may be quantified to determine copy number (e.g., the term may refer to a PCR amplicon, an LCR ligation product, and / or similar product). Whether a particular PDI functions as desired with a particular primer pair may be determined by carrying out at least two separate amplification reactions using at least two primers (e.g., a primer pair) in each reaction, each reaction being carried out in the absence and presence, respectively, of a PDI compound and optionally in the presence or absence of template nucleic acid (e.g., gDNA), and quantifying amplification of said primer pair(s) (e.g., by gel electrophoresis, using a detector probe, etc.). Various concentrations or combinations of PDI compounds may also be tested in separate reaction mixtures to determine the effect on amplification efficiency.
[0060] Exemplary methods for amplifying nucleic acids include, for example, polymerase- mediated extension reactions. For instance, the polymerase-mediated extension reaction can be the polymerase chain reaction (PCR). In other embodiments, the nucleic acid amplification reaction is a multiplex reaction.
[0061 ] Exemplary methods for amplifying and detecting nucleic acids suitable for use as described herein is commercially available as TaqMan® (see, e.g., U.S. Pat. Nos. 4,889,818; 5,079,352; 5,210,015; 5,436,134; 5,487,972; 5,658,751 ; 5,210,015; 5,487,972; 5,538,848; 5,618,71 1 ; 5,677, 152; 5,723,591 ; 5,773,258; 5,789,224; 5,801 , 155; 5,804,375; 5,876,930; 5,994,056; 6,030,787; 6,084,102; 6, 127, 155; 6, 171 ,785; 6,214,979; 6,258,569; 6,814,934; 6,821 ,727; 7,141 ,377; and / or 7,445,900, all of which are hereby incorporated herein by reference in their entirety). TaqMan assays are typically earned out by performing nucleic acid amplification on a target polynucleotide using a nucleic acid polymerase having 5'-3' nuclease activity, a primer capable of hybridizing to said target polynucleotide, and an oligonucleotide probe capable of hybridizing to said target polynucleotide 3' relative to said primer. The oligonucleotide probe typically includes a detectable label (e.g., a fluorescent reporter molecule) and a quencher molecule capable of quenching the fluorescence of said reporter molecule. Typically, the detectable label and quencher molecule are part of a single probe. As amplification proceeds, the polymerase digests the probe to separate the detectable label from the quencher molecule. The detectable label (e.g., fluorescence) is monitored during the reaction, where detection of the label corresponds to the occurrence of nucleic acid amplification (e.g., the higher the signal the greater the amount of amplification). Variations of TaqMan® assays (e.g., LNA™ spiked TaqMan® assay) are known in the art and would be suitable for use in the methods described herein.
[0062] Another exemplary system suitable for use as described herein utilizes double-stranded probes in displacement hybridization methods (see, e.g., Morrison et al. Anal. Biochem., 18:231-244 (1989); and / or Li, et al. Nucleic Acids Res., 30(2,e5) (2002)). In such methods, the probe typically includes two complementary oligonucleotides of different lengths where one includes a detectable label and the other includes a quencher molecule. When not bound to a target nucleic acid, the quencher suppresses the signal from the detectable label. The probe becomes' detectable upon displacement hybridization with a target nucleic acid. Multiple probes may be used, each containing different detectable labels, such that multiple target nucleic acids may be queried in a single reaction.
[0063] Additional exemplary methods for amplifying and detecting target nucleic acids suitable for use as described herein involve "molecular beacons", which are single-stranded hairpin shaped oligonucleotide probes. In the presence of the target sequence, the probe unfolds, binds and emits a signal (e.g., fluoresces). A molecular beacon typically includes at least four components: 1 ) the "loop", an 18-30 nucleotide region which is complementary to the target sequence; 2) two 5-7 nucleotide "stems" found on either end of the loop and being complementary to one another; 3) at the 5' end, a detectable label; and 4) at-the 3' end, a quencher dye that prevents the detectable label from emitting a single when the probe is in the closed loop shape (e.g., not bound to a target nucleic acid). Thus, in the presence of a complementary target, the "stem" portion of the beacon separates out resulting in the probe hybridizing to the target. Other types of molecular beacons are also known and may be suitable for use in the methods described herein. Molecular beacons may be used in a variety of assay systems. One such system is nucleic acid sequence-based amplification (NASBA ), a single step isothermal process for amplifying RNA to double stranded DNA without temperature cycling. A NASBA reaction typically requires avian myeloblastosis virus (AMV), reverse transcriptase (RT), T7 RNA polymerase, RNase H, and two oligonucleotide primers. After amplification, the amplified target nucleic acid may be detected using a molecular beacon. Other uses for molecular beacons are known in the art and would be suitable for use in the methods described herein.
[0064] The Scorpion system is another exemplary assay format that may be used in the methods described herein. Scorpion primers are bi-functional molecules in which a primer is covalently linked to the probe, along with a detectable label (e.g., a fluorophore) and a quencher. In the presence of a target nucleic acid, the detectable label and the quencher separate which leads to an increase in signal emitted from the detectable label. Typically, a primer used in the amplification reaction includes a probe element at the 5' end along with a "PCR blocker" element (e.g., a hexethylene glycol (HEG) monomer (Whitcombe, et al. Nat. Biotech. 17: 804-807 (1999)) at the start of the hairpin loop. The probe typically includes a self-complementary stem sequence with a detectable label at one end and a quencher at the other. In the initial amplification cycles (e.g., PCR), the primer hybridizes to the target and extension occurs due to the action of polymerase. The Scorpion system may be used to examine and identify point mutations using multiple probes that may be differently tagged to distinguish between the probes. Using PCR as an example, after one extension cycle is complete, the newly synthesized target region will be attached to the same strand as the probe. Following the second cycle of denaturation and annealing, the probe and the target hybridize. The hairpin sequence then hybridizes to a part of the newly produced PCR product. This results in the separation of the detectable label from the quencher and causes emission of the signal. Other uses for molecular beacons are known in the art and would be suitable for use in the methods described herein.
[0065] The nucleic acid polymerases that may be employed in the disclosed nucleic acid amplification reactions may be a prokaryotic, fungal, viral, bacteriophage, plant, or eukaryotic nucleic acid polymerase. As used herein, the term "DNA polymerase" refers to an enzyme that synthesizes a DNA strand de novo using a nucleic acid strand as a template. DNA polymerase uses an existing DNA or RNA as the template for DNA synthesis and catalyzes the polymerization of deoxyribonucleotides alongside the template strand, which it reads. The newly synthesized DNA strand is complementary to the template strand. DNA polymerase can add free nucleotides only to the 3'-hydroxyl end of the newly forming strand. It synthesizes oligonucleotides via transfer of a nucleoside monophosphate from a deoxyribonucleoside triphosphate (dNTP) to the 3'-hydroxyl group of a growing oligonucleotide chain. This results in elongation of the new strand in a 5' to 3' direction. Since DNA polymerase can only add a nucleotide onto a pre-existing 3'-OH group, to begin a DNA synthesis reaction, the DNA polymerase needs a primer to which it can add the first nucleotide. Suitable primers may comprise oligonucleotides of RNA or DNA, or chimeras thereof (e.g., RNA/DNA chimerical primers). The DNA polymerases may be a naturally occurring DNA polymerases or a variant of natural enzyme having the above-mentioned activity. For example, it may include a DNA polymerase having a strand displacement activity, a DNA polymerase lacking 5' to 3' exonuclease activity, a DNA polymerase having a reverse transcriptase activity, or a DNA polymerase having an endonuclease activity.
[0066] Suitable nucleic acid polymerases may also comprise holoenzymes, functional portions of the holoenzymes, chimeric polymerase, or any modified polymerase that can effectuate the synthesis of a nucleic acid molecule. Within this disclosure, a DNA polymerase may also include a polymerase, terminal transferase, reverse transcriptase, telomerase, and / or polynucleotide phosphorylase. Non-limiting examples of polymerases may include, for example, T7 DNA polymerase, eukaryotic mitochondrial DNA Polymerase γ, prokaryotic DNA polymerase I, II, III, rv, and / or V; eukaryotic polymerase α, β, γ, δ, ε, η, ζ, ι, and / or κ; Ε. coli DNA polymerase I; E. coli DNA polymerase III alpha and / or epsilon subunits; E. coli polymerase IV, E. coli polymerase V; T. aquaticus DNA polymerase I; B. stearothermophilus DNA polymerase I; Euryarchaeota polymerases; terminal deoxynucleotidyl transferase (TdT); S. cerevisiae polymerase 4; translesion synthesis polymerases; reverse transcriptase; and / or telomerase. Non-limiting examples of suitable thermostable DNA polymerases that may be used include Taq, Pfu, and Vent™ DNA polymerases, any genetically engineered DNA polymerases, such as those having reduced or insignificant 3' to 5' exonuclease activity (e.g., Superscript™ DNA polymerase), or any derivatives and fragments thereof. Other nucleic acid polymerases may also be suitable as would be understood by one of skill in the art.
[0067] The present teachings generally provide compositions, methods and kits for suppressing primer dimer formation in nucleic acid amplification reactions. More specifically, the present disclosure provides compositions, methods and kits involving PDI compounds. In the present teachings, the disclosed PDI compounds can be added to amplification reactions in an amount sufficient to prevent primer dimer formation.
[0068] In one aspect, the present disclosure provides compositions for amplifying at least one nucleic acid sequence of interest comprising at least one primer pair, wherein the primer pair is able to hybridize to the nucleic acid sequence(s) of interest; and a PDI compound. In some embodiments the compositions may further comprise a DNA polymerase and/or a solution of reagents able to allow amplification of the nucleic acid sequence of interest. In some instances the DNA polymerase is thermostable (e.g., Taq polymerase).
[0069] In another aspect, the present disclosure provides reaction mixtures for amplifying a nucleic acid sequence of interest. In some embodiments the reaction mixtures comprise a PDI compound in an amount capable of inhibiting primer dimer formation in the reaction. In some embodiments the reaction mixtures can further comprise at least one amplification primer pair suitable for amplifying the nucleic acid sequence(s) of interest. In some embodiments, the reaction mixtures can further comprise a DNA polymerase and/or a solution of reagents able to allow amplification of the nucleic acid sequence of interest. In some instances the DNA polymerase is thermostable (e.g., Taq polymerase). < [0070] In some embodiments, the compositions and/or reaction mixtures can further comprise a detergent. Some examples of such detergents may include (but are not limited to) CHAPS, n- Dodecyl-b-D-maltoside, sodium dodecyl sulphate (SDS), TRITON® X-15, TRITON® X-35, TRITON® X-45, TRITON® X-100, TRITON® X-102, TRITON® X-1 14, TRITON® X-165, TRITON® X-305, TRITON® X-405, TRITON® X-705, Tween-20 and/or ZWITTERGENT®. Other detergents may also be suitable, as may be determined by one of skill in the art (see, e.g., U.S. Pub. No. 2008/0145910; U.S. Pub. No. 2008/0064071 ; U.S. Pat. No. 6,242,235; U.S. Pat. No. 5,871 ,975; and U.S. Pat. No. 6,127, 155 for exemplary detergents; all of which are hereby incorporated herein by reference in their entirety.)
[0071] In another aspect, the present disclosure provides methods for reducing primer dimer formation using a PDI compound in an amount able to reduce primer dimer formation. In one embodiment, the disclosed methods for reducing primer dimer formation comprise amplifying a nucleic acid sequence of interest in the presence of: (i) at least one amplification primer pair suitable for amplifying the nucleic acid sequence of interest; and (i) a PDI compound. In other embodiments, the disclosed methods for reducing primer dimer formation comprise amplifying a nucleic acid sequence of interest in the presence of: (i) at least one amplification primer pair suitable for amplifying the nucleic acid sequence of interest; and (i) at least one (e.g., one or more) PDI compound(s). In yet another aspect, the present disclosure provides methods for amplifying a nucleic acid sequence of interest, comprising contacting a nucleic acid sequence of interest with at least one primer pair suitable for amplifying the nucleic acid sequence of interest; and one or more PDI compounds in an amount sufficient to suppress primer dimer formation. In some embodiments, the methods can further comprise a step of amplifying the nucleic acid sequence of interest. Thus, in yet another aspect, the present disclosure provides methods of suppressing primer dimer formation in a nucleic acid amplification reaction comprising performing a nucleic acid amplification reaction in the presence of one or more PDI compounds in an amount sufficient to suppress primer dimer formation. The PDI compound is typically included in an amount sufficient to suppress primer-dimer formation such that amplification efficiency is not decreased.
[0072] In some embodiments, the disclosed methods can further comprise a step of quantifying amplification of the nucleic acid sequence of interest by use of a detector probe. In some embodiments the detector probe can be a DNA binding dye (e.g., SYBR Green). In other embodiments the detector probe can be a 5' nuclease probe. In some embodiments the 5' nuclease probe is sequence-specific. In some exemplary embodiments, the detector probe is designed according to the methods and principles described in U.S. Patent No. 6,727,356 (the disclosure of which is incorporated by reference in its entirety). In some exemplary embodiments, the detector probe is a Taqman® probe. Additional probes and assays that may be suitable for use in the methods described herein are discussed above.
[0073] In some embodiments, the concentration of the PDI compound is at least 200 nM. In some embodiments, the concentration of the PDI compound is at least 500 nM. In some embodiments, the concentration of the PDI compound is at least 2 uM. In some embodiments, the concentration of the PDI compound is at least 4 uM. In some embodiments, the concentration of the PDI compound is at least 8 uM. In some embodiments, the concentration of the PDI compound is at least 10 uM. In some embodiments, the concentration of the PDI compound is at least 12 uM. In some embodiments, the concentration of the PDI compound is 250 nM to 20 uM; 1 uM to 16 uM; 4 uM to 14 uM; 6 uM to 12 uM; or 8 uM to 10 uM. In some embodiments, the concentration of the PDI compound is at least any of 250 nM, 500 nM, 1 uM, 1.5 uM, 2 uM, 2.5 uM, 3 uM, 3.5 uM, 4 uM, 4.5 uM, 5 uM, 5.5 uM, 6 uM, 6.5 uM, 7 uM, 7.5 uM, 8 uM, 8.5 uM, 9 uM, 9.5 uM, or 10 uM. In some embodiments, the concentration of the PDI compound is about any of 2 uM, 4 uM, 6 uM, or 8 uM. Reference to the "concentration" of a PDI is typically made with respect to the final concentration thereof within a reaction mixture in which the amplification procedure is carried out and / or a master mix (e.g., that may be diluted to such a concentration). Other concentrations may also be suitable, as may be determined by one of skill in the art using the assay systems described herein.
[0074] In some embodiments, the PDI compound is part of a master mix. In some exemplary embodiments, the master mix is POWER SYBR® Green RNA-to-CT® 1 -Step Kit (Applied Biosystems) master mix (e.g., Invitrogen Cat. No. 4368577). In some embodiments, the master mix may comprise water, a buffer, magnesium chloride, a mixture of deoxy-nucleoside triphosphates, random hexamers, one or more RNase inhibitors, and a polymerase. For instance, the POWER SYBR® Green RNA-to-CT® 1 -Step Kit contains an RT Reaction Mix comprising 10X reverse transcriptase (RT) buffer (e.g., a 10X stock solution diluted to I X in the reaction mixture), 25 mM MgCl2 (e.g., used at 5.5 mM in the reaction mixture), a mixture of deoxy-nucleoside triphosphates (e.g., a 2.5 mM stock solution diluted to 500 mM in the reaction mixture), random hexamers (e.g., oligo d(T) i6 or sequence-specific reverse primers, a 50 uM stock solution diluted to 2.5 uM in the reaction mixture), one or more RNase inhibitors (e.g., a 20 U/L stock solution diluted to 0.4 U/μΙ in the reaction mixture), and MultiScribe Reverse Transcriptase (e.g., a 50 U L stock solution diluted to 1.25 U/μΙ in the reaction mixture). In some embodiments the master mix can comprise a detergent, such as those described herein. Some examples of such detergents include but are not limited to CHAPS, n-Dodecyl-b-D-maltoside, SDS, TRITON® X-100, Tween-20 and/or ZWITTERGENT®. Other master mixes, optionally including detergents, may also be suitable, as may be determined by one of skill in the art. [0075] In some embodiments, the PDI compound comprises a blocker moiety such as a minor groove binder (MGB). In some embodiments, the primer dimer compound further comprises a quencher moiety, such as a non-fluorescent quencher or dark quencher (DQ) moiety. In some embodiments, the primer dimer compound further comprises a reporter dye, such as FAM (e.g., 5- FAM), VIC, PET, or NED. Suitable DNA binding dyes, reporter molecules, and the like are described herein and others may also be available to one of skill in the art.
[0076] In some embodiments, the PDI compound comprises a primer dimer inhibitory polynucleotide. In some embodiments, the PDI polynucleotide has the structure (N)„-X, wherein N is any nucleotide, n is the number of nucleotides and X comprises a blocker moiety. In some embodiments, N can be adenosine (A), cytosine (C), guanine (G), or thymine (T). In other exemplary embodiments, N can be a universal nucleotide (such as inosine (I)). In some embodiments, n is at least 2.. In other embodiments, n can be 2-30 nucleotides, 4-28 nucleotides, 6- 24 nucleotides, 8-20 nucleotides, or 10-18 nucleotides. In some embodiments, n may be any of 2, 4, 6, 8, 12, 16, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, or 40, for example. The polynucleotide (e.g., oligonucleotide) may also comprise a mixture of different nucleotides (e.g., CGCGCATAGGCGGGTTC as in Example 9 or TCAAGTGTTGAAGGAA as in Example 10) or may be prepared as homopolymers (e.g., as in Example 4). The polynucleotide structure (N)„ represents an oligonucleotide consisting of n number of nucleotides N (e.g., (I)8 is representative of an oligonucleotide having the sequence or (A)|2 is representative of an oligonucleotide having the sequence AAAAAAAAAAAA). The optimal length of the oligonucleotide may relate to a particular primer pair. For example, for some primer pairs, an oligonucleotide having n as 8 may be optimal (e.g., as for primer pairs 3 and 5 in Example 1) while for others n may be anywhere from 8 to 28 (e.g., as for primer pair 6 in Example 1 ). As described above, it is important that the PDI suppresses the formation of primer dimmers without decreasing the efficiency of the amplification reaction. Thus, the skilled artisan may need to test various versions of a PDI (e.g., containing an oligonucleotide of 2, 4, 6, 8, 12, 16, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, or 40 nucleotides) to determine the optimal activity for a particular primer pair and / or under particular reaction conditions. Methods for determining the activity, including the optimal activity, of a particular PDI are described herein (although other methods known to those of skill in the art may alternatively or also be used).
[0077] In some embodiments, X is located at the 3' end of the PDI polynucleotide (e.g., PDI compound), for example at the 3'-OH. In some exemplary embodiments, the blocker moiety of X is a minor groove binder (such as MGB). In other embodiments the blocker moiety is methylene glycol (TEG). In some embodiments, X further comprises a quencher moiety, such as a non- fluorescent quencher or dark quencher (DQ) moiety. In other embodiments the PDI polynucleotide (e.g., PDI compound) may further comprise dyes and/or labels (e.g., fluorescent dyes). In some embodiments, the reporter dye can be FAM (e.g., 5-FAM), VIC, NED or PET. In some embodiments, these reporter dyes and/or labels are located at the 5' end of the PDI polynucleotide (e.g., PDI compound). As described above, particular types of PDI compounds and methods for preparing the same are known to those of skill in the art (e.g., U.S. Patent Nos. 5,801 , 155; 6,492,346; 6,084, 102; 6,486,308; 6,727,356; Wemmer, et al. Curr. Op. Struct. Biol. 7:355-361 ( 1997); Walker, et al. Biopolymers, 44:323-334 (1997); Zimmer, et al. Prog. Biophys. Molec. Bio. 47:31 - 1 12 ( 1986); Reddy, et al. Pharmacol. Therap., 84: 1 -1 1 1 ( 1999), all of which are hereby incorporated herein by reference in their entirety). In some embodiments the PDI compound and/or primer dimer inhibitory polynucleotide are HPLC-purified. In other embodiments, the PDI compound and/or primer dimer inhibitory polynucleotide are crude or unpurified. In some other embodiments, the primer dimer compound and/or primer dimer inhibitory polynucleotide is desalted prior to use.
[0078] In some embodiments, the structure of the primer dimer inhibitory polynucleotide (e.g., PDI compound) can be, for example, 5'-(I)2.30(MGB)-3' . In some embodiments, the structure of the PDI polynucleotides (e.g., PDI compound) can be, for example, 5'-(I)2-3o(MGB-DQ)-3\ The MGB moiety of the PDI compound may be as described herein. In some embodiments the primer dimer inhibitory polynucleotide (e.g., PDI compound) is a 5' nuclease probe. In some exemplary embodiments, the PDI polynucleotide (e.g., PDI compound) is designed according to the methods and principles described in U.S. Patent No. 6,727,356 (the disclosure of which is incorporated by reference in its entirety). In some exemplary embodiments, the PDI polynucleotide (e.g., PDI compound) is a Taqman® probe.
[0079] In some embodiments, the nucleotide sequence of PDI polynucleotide (e.g., PDI compound) can be unrelated to the target nucleic acid sequence and/or the sequences of the at least one primer pair used for amplification. For example, the sequence of the PDI polynucleotide (e.g., PDI compound) may be significantly non-complementary to the sequence of the nucleic acid sequence of interest and/or the sequence of the at least one primer pair. In some embodiments the sequence of the PDI polynucleotide (e.g., PDI compound) is less than 50 percent homologous, less than 40 percent homologous, less than 30 percent homologous, less than 20 percent homologous, less than 10 percent homologous, less than 5 percent homologous, or 0% homologous to the target nucleic acid sequence and/or the sequence of the at least one primer pair. As described above, such polynucleotides may be considered "significantly non-complementary". Additional, similar embodiments are described elsewhere in this disclosure. [0080] In some embodiments of the disclosed methods, reducing the presence of primer dimers is by at least 10 percent relative to the amount of primer dimers found in a control reaction lacking a PDI compound. In some embodiments, the present teachings provide for reducing the presence of primer dimers by at least 20 percent relative to the amount of primer dimers found in a control reaction lacking a PDI compound. In some embodiments, the present teachings provide for reducing the presence of primer dimers by at least 30 percent relative to the amount of primer dimers found in a control reaction lacking a PDI compound. In some embodiments, the present teachings provide for reducing the presence of primer dimers by at least 40 percent relative to the amount of primer dimers found in a control reaction lacking a PDI compound. In some embodiments, the present teachings provide for reducing the presence of primer dimers by at least 50 percent relative to the amount of primer dimers found in a control reaction lacking a PDI compound. In some embodiments, the present teachings provide for reducing the presence of primer dimers by at least 60 percent relative to the amount of primer dimers found in a control reaction lacking a PDI compound. In some embodiments, the present teachings provide for reducing the presence of primer dimer by at least 70 percent relative to the amount of primer dimers found in a control reaction lacking a PDI compound. In some embodiments, the present teachings provide for reducing the presence of primer dimers by at least 80 percent relative to the amount of primer dimers found in a control reaction lacking a PDI compound. In some embodiments, the present teachings provide for reducing the presence of primer dimers by at least 90 percent relative to the amount of primer dimers found in a control reaction lacking a PDI compound. In some embodiments, the present teachings provide for reducing the presence of primer dimers by at least 95 percent relative to the amount of primer dimers found in a control reaction lacking a PDI compound. Such reductions can be measured, for example, by comparing the intensity of primer dimer products in a reaction containing the PDI, and comparing it with the amount of primer dimer products in a reaction lacking the PDI compound. In some embodiments, comparison of primer dimer products can be performed by assaying the intensity of a band on a gel and/or by melting curve analysis.
[0081] In another aspect, the present teachings provide kits comprising a PDI and at least one PCR primer pair, wherein the PDI compound comprises a PDI polynucleotide that is not significantly complementary to any of the sequences of an amplicon resulting from a PCR reaction employing the primers contained in the kit. In some embodiments, the kit can comprise a polymerase, such as a thermostable polymerase. In some embodiments, the kit can comprise dNTPs. In some embodiments, the primer inhibitor compound (e.g., one or more PDIs) is included in a master mix, such as a PCR master mix. Such a PCR master mix can contain any of primers, a suitable detector probe (for example a double-stranded DNA binding dye such as SYBR GREEN® or a sequence-based detector probe such as a TAQMAN probe), dNTPs, polymerase, and/or buffer. The PCR master mix may also comprise one or more PDIs. In some embodiments, the master mix can further comprise a detergent. Some examples of such detergents may include (but are not limited to) CHAPS, n-Dodecyl-b-D-maltoside, SDS, TRITON® X-100, Tween-20 and/or ZWITTERGENT®.
[0082] In certain embodiments, the present teachings also provide kits designed to expedite performing certain methods. In some embodiments, kits serve to expedite the performance of the methods of interest by assembling two or more components used in carrying out the methods. In some embodiments, kits may contain components in pre-measured unit amounts to minimize the need for measurements by end-users. In some embodiments, kits may include instructions for performing one or more methods of the present teachings. In certain embodiments, the kit components are optimized to operate in conjunction with one another. In certain embodiments, the kit components are contained in plurality of different containers.
[0083] While the presently described embodiments may teach and/or the following examples may employ the use of commercially available TAQMAN® MGB-DQ probes from Applied Biosystems as the PDI compound, it will be appreciated that any of a variety of analogous PDI probes and/or polynucleotides with related moieties can be employed as a matter of routine experimentation. Such compounds suitable for use as PDI compounds contemplated by the present teachings, and their methods of synthesis, can be any of a variety of PDI polynucleotides having the structure (N)n-X, where N is any nucleotide, n is the number of nucleotides, and X comprises a blocker moiety. Such polynucleotides can be found, for example, in U.S. Patent 7,160,996, U.S. Patent 7,109,312, U.S. Patent 7,019, 129, as well as U.S. Patent 6,727,356, as well as U.S. Patent Application 10/897,583.
[0084] The section headings used herein are for organizational purposes only and are not to be construed as limiting the described subject matter in any way.
[0085] All references cited herein, including patents, patent applications, papers, text books, and the like, and the references cited therein, to the extent that they are not already, are hereby incorporated by reference in their entirety. In the event that one or more of the incorporated literature and similar materials differs from or contradicts this application; including but not limited to defined terms, term usage, described techniques, or the like, this application controls.
[0086] The foregoing description details certain preferred embodiments of the invention and describes the best mode contemplated by the inventors. It will be appreciated, however, that no matter how detailed the foregoing may appear in text, the invention may be practiced in many ways and the invention should be construed in accordance with the claims and any equivalents thereof. [0087] Having now provided the foregoing description, the same will be more clearly understood by reference to the following examples, which are included herewith for the purposes of illustration only and are not intended to be limiting.
EXAMPLES
[0088] Target sequences used in the following assays were chosen for their biological importance in HIV infection (Identification of Host Proteins Required for HIV Infection Through a Functional Genomic Screen, Abraham L. Brass, et al., Science 319, 921 (2008)).
[0089] Primer pairs specific to the chosen target sequences were designed using a proprietary primer parameter design program (TaqPipe v0.97; Applied Biosystems). A target Tm of 62°C was chosen for each primer using the nearest neighbor calculations by Santa Lucia with a maximum amplicon size of 350 base pairs. Design parameters were set to design primer pairs that would fall into different primer dimer scoring bins as indicated below.
[0090] A primer dimer screening tool (zPCR3P; Applied Biosystems) was used to determine the propensity of various primer pairs to form primer-dimers. The tool aligned primer pairs with each other and assigned a score for potential primer dimer formation based on their nucleotide compositions. The scores were binned into high or low potential primer dimer forming pairs and those with the higher bin scores were chosen for further evaluation.
[0091 ] The various primers designed according to the parameters described above and used in the examples discussed below are listed in Table 1.
Figure imgf000054_0001
Figure imgf000055_0001
Figure imgf000056_0001
Figure imgf000057_0001
Figure imgf000058_0001
Figure imgf000059_0001
Figure imgf000060_0001
Figure imgf000061_0001
Figure imgf000062_0001
Figure imgf000063_0001
Figure imgf000064_0001
Figure imgf000065_0001
Example 1
PD Formation Varies Depending on the PCR Master Mix
[0092] A total of 304 primer pairs (see Table 1 ) were tested for their ability to amplify target sequences. Of these, 291 primer pairs were confirmed to amplify a product under all conditions tested. The 291 primer pairs able to produce amplicons were then tested for their ability to form primer dimers in PCR reactions comprising either POWER SYBR® Green PCR master mix (Applied Biosystems, PN 4367659) or POWER SYBR® Green RNA-to-CT® 1-Step Kit master mix (Applied Biosystems, PN 4389986).
[0093] PCR reaction mixtures using the indicated proprietary master mixes contained 9 μΙ_, total. Each reaction mixture further contained 1 1 1 nM primers. For each primer pair that was tested, 12 reactions using 100 pg genomic DNA (gDNA) as the template and 12 control reactions containing no template DNA ("no template controls" (NTC)) were analyzed. PCR reactions were performed on Applied Biosystems ABI PRISM 7900, using the following cycling program: to 95°C for 12 minutes; 95°C, 1 minute; 62°C, 1 minute; 72°C, 30 seconds; 95°C, 15 seconds; 95°C, 15 seconds; 60°C, 15 seconds; and, 95°C, 15 seconds.
[0094] As shown in Table 2, when POWER SYBR® Green PCR master mix (Mix 1 ) was used in the reactions, 179/291 (61.5%) of the primer pairs showed primer dimer formation in the NTC reactions, while 32 of those 179 primer pairs formed primer dimers in reactions containing 100 pg of template gDNA. When using POWER SYBR® Green RNA-to-CT® 1 -Step Kit master mix (Mix 2), only 67/291 (22%) of the primer pairs showed primer dimer formation in the NTC reactions, while 16 of those 67 primer pairs formed primer dimers in reactions containing 100 pg of gDNA template. Mix 2 was far superior over Mix 1 in suppressing primer dimer (PD) formation.
Example 2
Addition of a PDI to a Master Mix Further Reduces Primer Dimer Formation.
[0095] The effectiveness of primer dimer suppression in PCR reactions further comprising various PDI compounds (PDIs) was tested. This was done using the same 291 primer pairs and PCR reaction conditions described above. PCR reaction mixtures contained POWER SYBR® Green RNA-to-CT® 1 -Step Kit master mix alone (Mix 2) or POWER SYBR® Green RNA-to-CT® 1 -Step Kit master mix plus 10 uM of PDI 5'-(I),6(MGB-DQ)-3' (or (Mix 3). It was surprisingly discovered that adding 10 uM of PDI 5'-(I)i6(MGB-DQ)-3' to Mix 2 further suppressed PD formation. As shown in Table 2 and Fig. 1, the number of primer pairs able to form primer dimers in NTC reactions with the addition of 10 uM of PDI 5'-(I)i6(MGB-DQ)-3' (Mix 3) was further reduced to 13/291 (4.5%) as compared to samples containing POWER SYBR® Green RNA-to-CT® 1 -Step Kit master mix alone (Mix 2). Moreover, only 2 of those 13 primer pairs formed primer dimers in reactions containing 100 pg of gDNA template. There was only a modest decrease in amplification efficiency for amplification reactions performed using Mix 3. Table 2*
Figure imgf000067_0001
*A total of 304 primer pairs were tested. Of those, 291 primer pairs amplified with all 3 mixes (95.7%). Mix 1 : Power SYBR GreenPCR Master Mix; Mix 2: Power SYBR® Green RNA-to-CT™ 1 -Step Kit; Mix 3: Power SYBR® Green RNA-to-CT™ 1-Step Kit + 10 uM PDI 5'-(I)i6(MGB- DQ)-3' .
Example 3
Effect of PDI Concentration on PD Formation
[0096] Sixteen primer pairs selected from the original 291 primer pairs (above) were tested using POWER SYBR® Green RNA-to-CT® 1-Step Kit master mix containing different concentrations of the PDI compound comprising the polynucleotide: 5'-(I)i6(MGB-DQ)-3' (or
DQ)-3'). The PDI concentrations tested included 0, 2, 4, 6, 8, 10, 15, and 20 uM of 5'-(I)i6(MGB- DOJ-3' . Of the 16 primer pairs selected, all showed primer dimer formation with POWER SYBR® Green RNA-to-CT® 1-Step Kit master mix alone. For each of the 16 primer pairs tested, 12 reactions comprising 100 pg gDNA template, and 12 reactions with NTC were analyzed.
[0097] As shown in Fig. 2A and 2B, at 0 uM, 91.1 % of all possible NTC reactions showed primer dimer formation. While at 2 uM PDI very little change in primer dimer formation was observed, significant primer dimer suppression was observed at concentrations of 4 uM PDI and higher. A plateau was observed at 8 uM PDI where only 43.2% of all possible NTC reactions showed primer dimer formation.
[0098] For six of the tested primer pairs, primer dimer formation was observed in all 72 reactions containing 100 pg of gDNA template in the absence of the PDI compound. For 5/6 of the tested primer pairs, primer dimer formation was completely suppressed at 2 uM of the PDI compound. For 1/6 of the tested primer pairs, no primer dimer formation inhibition was observed at all concentrations tested.
[0099] There was only little change in PCR efficiency; the average decrease in PCR efficiency was 1.2 Ct values at 4 uM of the PDI compound and higher. Q values were determined/visualized by 7900 HT Sequence Detection Systems v 2.3 (Applied Biosystems).
Example 4
Effect of PDI Polynucleotide Length on PD Formation
[00100] Ten primer pairs selected from the original 291 primer pairs (above) were tested using POWER SYBR® Green RNA-to-CT® 1-Step Kit master mix containing the PDI compound: 5'- (I)n(MGB-DQ)-3\ where n equals 4, 8, 12, 16, 20, 24, or 28 nucleotides. All compounds tested were at 10 uM. For each primer pair, 2 reactions containing 100 pg gDNA template, and 6 NTC reactions were analyzed.
[00101] As shown in Fig. 3, for two of the primer pairs tested (PP #3 and #5), primer dimer inhibition was more efficient when a short compound (e.g., 5'-(I)8(MGB-DQ)-3') was used. For another primer pairs (PP #6), primer dimer inhibition was equally efficient with 5'-(I)n(MGB-DQ)- 3', where n= 8 to 28. [00102] As Fig. 4 shows, there was a significant effect on PCR efficiency as a function of PDI compound length when inosine was used. In control reactions where no PDI compound was added ("(I)0")> each primer pair showed a differing degree of PCR efficiency as expressed by the Ct value. When the compound 5-(I)4(MGB-DQ)-3' ("(I)4") was added to the reaction mix, PCR was inhibited for all primer pairs tested. When using 5'-(I)8(MGB-DQ)-3' ("(I)8") as the PDI compound, PCR efficiency was recovered in a primer pair-dependent manner, and was generally similar to the PCR efficiency as that for control reactions when using 5'-(I)12(MGB-DQ)-3' ("(I)i2") as the PDI compound.
Example 5
Reduced PCR Efficiency May Be Attributed to MGB.
[00103] To test if (MGB-DQ) by itself is capable of suppressing primer dimer formation, (MGB- DQ) was eluted from a column support by soaking in 80% TBA (tert-butyl amine), 10% EtOH, 10% water. The eluate was dried down and reconstituted in IxTE. As a control, a similar aliquot of 80% TBA (tert-butyl amine), 10% EtOH, 10% water was dried down and reconstituted in IxTE. Four primer pairs were tested using POWER SYBR® Green RNA-to-CT® 1 -Step Kit master mix. For each primer pair, 2 reactions containing 100 pg gDNA and 6 NTC reactions were analyzed. For all 4 primer pairs, similar to what is shown for PP #1 1 (Fig. 5), PCR was completely inhibited when (MGB-DQ) was added ("C). It was noteworthy that PDI 5'-(I)4(MGB-DQ)-3' which has a short inosine-tail in addition to the (MGB-DQ) moiety also completely inhibited PCR.
Example 6
PDI Polynucleotides Comprising Other Blocker Moieties Can Suppress PD Formation. [00104] To test if blocking the 3'end of inosine-containing primers comprising a different blocker moiety (e.g., TEG) can suppress primer dimer formation, POWER SYBR® Green RNA-to-CT® 1 - Step Kit master mix with compounds of the nature 5'-(I) i6(TEG)-3' were tested in comparison to the PDI 5'-(I)i6(MGB-DQ)-3\ Four primer pairs were tested (PP #14, #19, #6 and #12). For each primer pair, 2 reactions containing 100 pg gDNA and 6 NTC reactions were analyzed.
[00105] As shown in Fig. 6, for PP #14 and PP.#19, primer dimer inhibition with TEG-containing polynucleotides' was comparable to those using polynucleotides with MGB-DQ as the blocking moiety (compare "B" with "C"). With PP #6 some reduction was observed with the TEG-containing polynucleotides. For PP #12 primer dimer formation was not affected in the NTC reactions, but primer dimers observed in the reactions containing gDNA template ("A"; both arrows) were eliminated with TEG and (MGB-DQ)-containihg polynucleotides. Note that PCR efficiency was more reduced with (MGB-DQ)-containing polynucleotides (compare "B" with "A" peak height for wells containing gDNA) than the polynucleotides containing TEG (compare "B" with "C").
Example 7
Homopolymers of I, A, T, C Are Equally Efficient at Suppressing PD Formation.
[00106] To test if homopolymers of the nature of 5'-(N)i5(MGB-DQ)-3' where N represents A, T, or C nucleotides are as effective as homopolymers of 5'-(I)i6(MGB-DQ)-3', POWER SYBR® Green RNA-to-CT® 1 -Step Kit master mix comprising the indicated compounds were used. Four primer pairs were tested (PP #6, PP #12, PP #14, and PP #19). For each primer pair, 2 reactions containing 100 pg gDNA and 6 NTC reactions were analyzed. (Note that homopolymers consisting of G were not tested due to synthesis difficulties of stretches with G >5.) [00107] As Fig. 7 shows, homopolymers comprising A, C, or T nucleotides were equally as effective as a homopolymer comprising I. In fact, when using primer pair PP #12, only the homoplymer consisting of 5'-(C)i6-(MGB-DQ)-3' suppressed primer dimer formation, whereas all other tested compounds did not.
[00108] As a follow up, an experiment was performed where I, C, T or A were replaced with a non-base = PEG. The following compounds were tested 5'-(PEG)n(MGB-DQ)-3' with n=8 or 16. POWER SYBR® Green RNA-to-CT® 1 -Step Kit master mix with the indicated compounds were tested. Three primer pairs were tested (PP#6, PP#9, PP#1 1 ). For each primer pair, 2 reactions containing 100 pg gDNA and 6 NTC reactions were analyzed. As Fig. 8 shows, while reactions containing 5'-(I)i6(MGB-DQ)-3' showed suppression in primer dimer formation in NTC controls ("B"), no primer dimer suppression was seen either with 5'-(PEG)8(MGB-DQ)-3' ("C"), or 5'- (PEG),6(MGB-DQ)-3' ("D").
Example 8
Crude and HPLC-purified PDI Compounds Work Equally Well to Suppress PD Formation.
[00109] It was explored if a crude (unpurified) PDI compound comprising the polynucleotide 5'- (I)i6(MGB-DQ)-3' ( or was as efficient in suppressing primer dimer formation as an HPLC-purified compound. To test this, POWER SYBR® Green RNA-to-CT® 1 - Step Kit master mix with the indicated compounds were tested. 3 primer pairs were tested (PP #6, #9, and #1 1 ). For each primer pair, 2 reactions containing 100 pg gDNA and 6 NTC reactions were analyzed. It was found that PDI compounds comprising crude and HPLC purified polynucleotides performed equally well at suppressing primer dimer formation (Fig. 9). Example 9
Other PDI Polynucleotides Comprising Reporter Dyes are able to Suppress PD Formation.
[00110] PCR reactions contained: I X SYBR Green Master mix commercially available from Applied Bioysystems, 200 nM each primers 70B and 70E (70B = CCCGTCGCCTTATCGCTGGGAAATCA, 70E = ATCGCATGGTAGTGCCCAAACGCTCA, all sequences shown 5' to 3'), and either no template, or as a positive control, template pZOlO (Fig. 10), which is predicted to produce a 339 bp amplicon with 70B and 70E primers. Two different PCR cycling conditions were used, one with a 1 minute extension, and the other with a 10 minute extension. The longer extension time is known from previous experiments to generate more primer dimer. Cycling conditions were 95°C lOmin, 50 cycles [95°C for 15 sec, 70°C for 10 min]. Reactions were supplemented with nothing, or 250 nM 5'-(PET-2)CGCGCATAGGCGGGTTC(MGB-DQ)-3\ or 250 nM 5 ' -(NED)CGCGCATAGGCGGGTTC(MGB-DQ)-3 ' . Ten replicate NTC reactions were run. As expected, going from 1 minute extension to 10 minutes increased the amount of NTC primer dimer generated with SYBR green alone from 0 out of 10 reactions to 10 out of 10 reaction amplifying primer dimer (Fig. 11). However, the addition of the BDI compound, labeled either with NED or PET-2, resulted in the elimination of primer dimer under the 10 minute extension conditions in all 10 NTC reactions. In all cases, the positive control, containing pZOlO template, amplified, as shown by the reported Ct values. At 1 minute extension, the PDI compounds appeared to inhibit the amplification of the control, but this was not seen in the 10 minute extension reactions.
Example 10
Other PDI Polynucleotides Having Sequences Unrelated to the Target Nucleic Acid Sequence are able to Suppress PD Formation [00111 ] The 10 minute extension experiment described in Example 9 was repeated, along with the testing of the PDI compound 5'-FAM-(N)n(MGB-DQ)-3' (or 5'- (FAM)TCAAGTGTTGAAGGAA(MGB-DQ)-3') also at 250nM. In this experiment 20 replicate NTC reactions were performed. Of note, this PDI polynucleotide sequence was not complementary to the primers or the target pZOlO, yet still suppressed primer dimer formation, reducing the 1 1 out of 20 NTC reactions that amplified without addition of PDI to zero out of 20 amplifications with PDI (Fig. 12).
Example 11
PDI Compounds are able to Suppress PD Formation of Bisulfite-specific Primers
[00112] The 5'-FAM-(N)n(MGB-DQ)-3' compound (as in Example 10) was tested for suppression of primer dimer formation with two different primer sets, FMR 1 (fwd=TGTAAAACGACGGCCAGTTGAGTGTATTTTTGTAGAAATGGG,
rev=GCAGGAAACAGCTATGACCTCTCTCTTCAAATAACCTAAAAAC) and MLHl (fwd=GTGTAAAACGACGGCCAGTTTTTTTTAGGAGTGAAGGAGGTTA,
rev=GCAGGAAACAGCTATGACCCCCAAAAAAAACAAAATAAAAATC). These primer are specific for bisulfite converted human gDNA, and were tailed with M13-fwd and M13-rev sequences. Reactions contained 200 nM of each primer; I X SYBR green master mix; and 0 or 250 nM of a 5'-FAM-(N)n(MGB-DQ)-3' PDI polynucleotide. Cycling conditions were 95°C 10m, 5x [95°C 15 seconds, 60°C for 2 minutes, 72°C for 3 minutes], 45x [95°C for 15 seconds, 65°C for 1 minutes, 72°C for 3 minutes]. Again, the unrelated PDI compound eliminated primer dimer formation (Fig. 13). Eight out of twenty replicate MLHl NTC reactions and five out of twenty FMR 1 NTC reactions amplified without PDI, while zero out of 18 NTC reactions with PDI amplified with either primer set, demonstrating the ability of the PDI compound to suppress primer dimers.
Example 12
[00113] Other experiments were also performed to better elucidate the primer dimer suppression effect.
[00114] One set of experiments illustrated that omission of a reporter dye from Taqman®-based PDI polynucleotide(s) could be performed, and the primer dimer suppression effect retained.
[00115] Another set of experiments illustrated that inclusion of only a minor groove binding moiety without quencher or any additional nucleotides, (e.g., Hoechst 33258), in the PCR reactions failed to provide a primer dimer suppression effect.
[00116] Another set of experiments illustrated that PCRs lacking detergents showed a decreased ability to suppress primer dimer formation.
[00117] Another set of experiments illustrated that the primer dimer suppression could be achieved in a PCR reaction using a 5'-FAM-(N)n(MGB-DQ)-3' PDI compound in which a single molecule of target was amplified.
[00118] Finally, another set of experiments using POWER SYBR ® Green PCR Master Mix (Applied Biosystems PN 4367659) and POWER SYBR ® Green RNA-to-CT ® 1 -Step Kit (Applied Biosystems PN 4389986) illustrated the desirability of using MGB-DQ compounds containing 8 inosines, though suppression was still observed with up to 28 inosines. Additionally, these experiments demonstrated the desirability of a concentration of MGB-DQ inosine compounds equal to or greater than 8 micromolar, in particular 8- 10 micromolar.

Claims

CLAIMS What is claimed is:
1. A reaction mixture that inhibits primer dimer formation, said mixture comprising at least one amplification primer pair suitable for amplifying a nucleic acid sequence of interest, and a primer dimer inhibitor compound (PDI).
2. The reaction mixture of claim 1, wherein said reaction mixture comprises a master mix.
3. The reaction mixture of claim 2, wherein said master mix is Power SYBR® Green RNA-to- CT™ Master Mix.
4. The reaction mixture of any of claims 1-3, wherein said PDI comprises at least one primer dimer inhibitor polynucleotide.
5. The reaction mixture of claim 4, wherein said primer dimer inhibitor polynucleotide is of the structure (N)n-X, wherein N is any nucleotide, n is the number of nucleotides and X comprises a blocker moiety.
6. The reaction mixture of claim 5, wherein N is A, C, G, or T.
7. The reaction mixture of claim 5, wherein N is inosine (I).
8. The reaction mixture of any of claims 5-7, wherein n is at least 2.
9. The reaction mixture of any of claims 5-8, wherein n is 2-30.
10. The reaction mixture of claim 5, wherein X is at the 3' end of said primer dimer inhibitor polynucleotide.
11. The reaction mixture of any of claims 5-10, wherein X comprises a minor groove binder (MGB).
12. The reaction mixture of claim 11, wherein X further comprises a quencher moiety.
13. The reaction mixture of claim 12, wherein said quencher moiety is a non-fluorescent quencher or dark quencher (DQ).
14. The reaction mixture of claim 1, further comprising a DNA polymerase.
15. The reaction mixture of claim 14, wherein said DNA polymerase is thermostable.
16. The reaction mixture of claim 4, wherein said sequence of said primer dimer inhibitor polynucleotide is unrelated to said nucleic acid sequence of interest.
17. The reaction mixture of claim 16, wherein said primer dimer inhibitor polynucleotide is significantly non-complementary to said nucleic acid sequence of interest.
18. The reaction mixture of claim 17, wherein said primer dimer inhibitor polynucleotide is less than 50 percent homologous to said nucleic acid sequence of interest.
19. A composition for amplifying a nucleic acid sequence of interest, said composition comprising:
a) at least one primer pair, wherein said primers are able to hybridize to said nucleic acid sequence of interest;
b) a DNA polymerase;
c) a solution of reagents able to allow amplification of said nucleic acid sequence of interest; and
d) a primer dimer inhibitor compound in an amount able to suppress said primer dimer formation of said primer pair.
20. The composition of claim 19, wherein said primer dimer inhibitor compound comprises a at least one primer dimer inhibitor polynucleotide.
21. The composition of claim 19, wherein said primer dimer inhibitor polynucleotide is of the structure (N)n-X.
22. The composition of claim 21, wherein N is A, C, G, or T.
23. The composition of claim 21, wherein N is inosine (I).
24. The composition of any of claims 21-23, wherein n is at least 2.
25. The composition of any of claims 21-24, wherein n is 2-30.
26. The composition of any of claims 21-25, wherein X is a blocker moiety.
27. The composition of claim 26, wherein blocker moiety is MGB.
28. The composition of claim 19, wherein said DNA polymerase is thermostable.
29. The composition of claim 20, wherein the sequence of said primer dimer inhibitor polynucleotide is unrelated to said nucleic acid sequence of interest.
30. A method for reducing primer dimer formation, said method comprising:
a) amplifying a nucleic acid sequence of interest in the presence of:
(i) at least one amplification primer pair suitable for amplifying said nucleic acid sequence of interest; and
(i) a primer dimer inhibitor compound (PDI);
and
(b) quantifying amplification of said nucleic acid sample by use of a detector probe.
31. The method of claim 30, wherein said primer dimer inhibitor compound comprises at least one primer dimer inhibitor polynucleotide.
32. The method of claim 30, wherein said primer dimer inhibitor polynucleotide is of the structure (N)n-X.
33. The method of claim 32, wherein N is A, C, G, or T.
34. The method of claim 32, wherein N is inosine.
35. The method of any of claims 32-34, wherein n is at least 2.
36. The method of any of claims 32-35, wherein n is 2-30.
37. The method of any of claims 32-36, wherein X is a blocker moiety.
38. The method of claim 37, wherein blocker moiety is MGB.
39. The method of claim 30, wherein said PDI comprises a blocker moiety.
40. The method of claim 38, where said blocker moiety is MGB.
41. The method of claim 38, wherein said PDI further comprises a non-fluorescent quencher or dark quencher (DQ) moiety.
42. The method of claim 30, wherein said detector probe is a DNA binding dye.
43. The method of claim 30, wherein said detector probe is a Taqman probe.
44. A method for reducing primer dimer formation using a primer dimer inhibitor compound in an amount able to reduce primer dimer formation.
45. A method for amplifying a nucleic acid sequences of interest, comprising:
(a) contacting said nucleic acid sequences of interest with:
(i) a plurality of different amplification primer pairs suitable for amplifying said nucleic acid sequence of interest; and
(ii) a primer dimer inhibitor compound; and
(b) amplifying said nucleic acid sequence of interest.
46. The method of claim 45, wherein said primer dimer inhibitor compound comprise at least one primer dimer inhibitor polynucleotide.
47. The method of claim 45, wherein said primer dimer inhibitor polynucleotide is unrelated to said nucleic acid sequence of interest.
48. A method of suppressing primer dimer formation in a nucleic acid amplification reaction comprising: (a) performing a nucleic acid amplification reaction in the presence of a primer dimer inhibitor compound in an amount sufficient to suppress primer dimer formation, wherein said primer dimer inhibitor compound comprises;
(i) at least one primer dimer inhibitor polynucleotide between two to thirty nucleotides in length; and
(ii) a blocker moiety.
49. The method of claim 48, wherein said primer dimer inhibitor compound further comprises a dark quencher (DQ) moiety.
50. The method of claim 48, wherein said primer dimer inhibitor compound further comprises a reporter dye.
51. The method of claim 48, wherein said blocker moiety is located at the 3' end of said primer dimer inhibitor compound.
52. The method of claim 48, wherein said blocker moiety is a minor groove binder (MGB).
53. The method of claim 48, wherein said primer dimer inhibitor compound comprises eight nucleotides.
54. The method of claim 48, wherein said nucleotides are universal nucleotides.
55. The method of claim 54, wherein said universal nucleotides are inosines.
56. The method of claim 48, wherein said nucleotides are a mixture of at least one of A, G, C, and/or T.
57. The method of claim 48, wherein said nucleic acid amplification reaction is a polymerase- mediated extension reaction.
58. The method of claim 57, wherein said polymerase-mediated extension reaction is a PCR.
59. The method of claim 57, wherein said polymerase-medicated extension reaction is a multiplex reaction.
60. The method of claim 48, wherein said primer dimer inhibitor compound is at a concentration of 200 nM to 20 μΜ.
61. The method of claim 48, wherein said reaction occurs in the presence of a detergent.
62. The method of claim 61, wherein said detergent is selected from the group consisting of CHAPS, n-Dodecyl-b-D-maltoside, SDS, TRITON® X-100, Tween-20 and/or ZWITTERGENT®.
63. The method of claim 48, wherein said suppressing is by at least 10 percent relative to the amount of primer dimer artifacts found in a control reaction lacking said primer dimer inhibitor compound.
64. The method of claim 63, wherein said suppressing is measured by comparing the amount of a primer dimer product in a reaction containing said primer dimer inhibitor compound, and comparing it to the amount of a primer dimer product in a reaction lacking said primer dimer inhibitor compound.
65. The method of claim 48, wherein said primer dimer inhibitor compound is HPLC-purified.
66. The method of claim 48, wherein said primer dimer inhibitor compound is crude.
67. The method of claim 48, wherein said primer dimer inhibitor compound is desalted prior to use.
68. A method for suppressing primer dimer formation in a nucleic acid amplification reaction, said method comprising amplifying a nucleic acid sequence of interest in the presence of at least one amplification primer pair suitable for amplifying said nucleic acid sequence of interest and a primer dimer inhibitor compound (PDI), the PDI comprising at least one polynucleotide and a minor groove binding (MGB) moiety.
69. The method of claim 68, wherein said primer dimer inhibitor polynucleotide is of the structure (N)n-X, wherein N represents the same or different nucleotides, n is 2-30, and X is the MGB.
70. The method of claim 69, wherein N is selected from the group consisting of adenosine (A), cytosine (C), guanine (G), thymine (T), and inosine (I).
71. The method of claim 70, wherein N is inosine.
72. The method of claim 70 wherein n is at least 4.
73. The method of claim 72 wherein n is at least 8.
74. The method of claim 73 wherein n is at least 16.
75. The method of claim 70 wherein n is at least 4 and N is inosine (I).
76. The method of claim 75 wherein n is at least 8 and N is inosine (I).
77. The method of claim 76 wherein n is at least 16 and N is inosine (I).
78. The method of claim 77 wherein the polynucleotide is a heteropolymer.
79. The method of claim 69 wherein the polynucleotide is a homopolymer.
80. The method of claim 68 wherein the MGB is 3-{ [3-(pyrrolo[4,5-e]indolin-7- ylcarbonyl)pyrrolo[4,5-e]indolin-7-yl]carbonyl}pyrrolo[3,2-e]indoline-7-carboxylic acid (DPI3).
81. The method of claim 68 wherein the amplification reaction is the polymerase chain reaction (PCR).
82. The method of claim 68 wherein the presence of the PDI in the amplification reaction does not negatively affect amplification efficiency.
83. The method of claim 68 wherein the nucleic acid is amplified from a reaction mixture and the PDI is present therein at a concentration of at least about 4 uM.
84. The method of claim 83 wherein the nucleic acid is amplified from a reaction mixture and the PDI is present therein at a concentration of about 8 uM.
85. The method of claim 68 wherein the nucleotide sequence of the polynucleotide is not complementary to either the nucleic acid sequence of interest or either primer of the primer pair.
86. The method of claim 1 further comprising quantifying the amplification reaction using a detector probe.
87. The method of claim 68, wherein said detector probe is a Taqman® probe.
88. The method of claim 86 wherein the detector probe is a DNA binding dye.
89. The method of claim 88 wherein the DNA binding dye is selected from the group consisting of acridine, acridine orange, acriflavine, actinomycin D, anthramycin, BOBO™-l, BOBO™-3, BO- PRO™-!, cbromomycin, DAPI, daunomycin, distamycin, distamycin D, ellipticine, an ethidium salt, ethidium bromide, fluorcoumanin, a fluorescent intercalator, GelStar®, Hoechst 33258, Hoechst 33342, homidium, JO-PRO™- 1, LIZ dyes, LO-PRO™-l, mepacrine, mithramycin, NED dyes, netropsin, 4'6-diamidino-a-phenylindole, proflavine, POPO™-l, POPO™-3, PO-PRO™-l, propidium iodide, ruthenium polypyridyls, S5, SYBR® Gold, SYBR® Green I, SYBR® Green II, SYTOX blue, SYTOX green, SYTO® 43, SYTO® 44, SYTO® 45, SYTOX® Blue, TO-PRO®-l, SYTO® 11, SYTO® 13, SYTO® 15, SYTO® 16, SYTO® 20, SYTO® 23, thiazole orange, TOTO™-3, YO-PRO®-l, and YOYO®-3.
90. The method of claim 68 wherein the PDI comprises a detectable label.
91. The method of claim 90 wherein the detectable label is selected from the group consisting of a fluoroscein; 5-carboxy-2,7-dichlorofluorescein; 5-Carboxyfluorescein (5-FAM); 5-HAT (Hydroxy Tryptamine); 5-Hydroxy Tryptamine (HAT); 6-JOE; 6-carboxyfluorescein (6-FAM); FITC; 6- carboxy- 1 ,4-dichloro-2 ' ,7 ' -dichlorofluorescein (TET) ; 6-carboxy- 1 ,4-dichloro-2' ,4 ' ,5 ' ,7 ' -tetra- chlorofluorescein (HEX); 6-carboxy-4',5'-dichloro-2', 7'-dimethoxyfhiorescein (JOE); an Alexa fluor; an Alexa fluor selected from the group consisting of 350, 405, 430, 488, 500, 514, 532, 546, 555, 568, 594, 610, 633, 635, 647, 660, 680, 700, and 750); a BODIPY fluorophore; a BODJPY fluorophore selected from the group consisting of 492/515, 493/503, 500/510, 505/515, 530/550, 542/563, 558/568, 564/570, 576/589, 581/591, 630/650-X, 650/665-X, 665/676, FL, FL ATP, FI- Ceramide, R6G SE, TMR, TMR-X conjugate, TMR-X, SE, TR, TR ATP, and TR-X SE; a coumarin; 7-amino-4-methylcoumarin; AMC; AMCA; AMCA-S; AMCA-X; ABQ; CPM methylcoumarin; coumarin phalloidin; hydroxycoumarin; CMFDA; methoxycoumarin; calcein; calcein AM; calcein blue; a calcium dye; calcium crimson; calcium green; calcium orange; calcofluor white; Cascade Blue; Cascade Yellow; a Cy™ dyes; a Cy™ dye selected from the group consisting of 3, 3.18, 3.5, 5, 5.18, 5.5, 7; cyclic AMP Fluorosensor (FiCRhR); a fluorescent protein; a fluorescent protein selected from the group consisting of green fluorescent protein (GFP), cyan GFP, enhanced GFP; a blue fluorescent protein (BFP); a blue fluorescent protein selected from the group consisting of EBFP, EBFP2, Azurite, and mKalamal; cyan fluorescent protein (CFP); a CFP selected from the group consisting of ECFP, Cerulean, and CyPet; yellow fluorescent protein (YFP); a YFP selected from the group consisting of Citrine; Venus, and YPet), a FRET donor/acceptor pairs; a FRET donor/acceptor pair selected from the group consisting of fluorescein/tetramethylrhodamine, IAEDANS/fluorescein, EDANS/dabcyl, fluorescein/fluorescein, BODIPY FL/BODIPY FL, Fluorescein/QSY7 and QSY9; a LysoTracker compound; a LysoSensor compound; LysoTracker Blue DND-22; LysoTracker Blue- White DPX; LysoTracker Yellow HCK- 123; LysoTracker Green DND-26; LysoTracker Red DND-99; LysoSensor Blue DND-167; LysoSensor Green DND-189; LysoSensor Green DND-153; LysoSensor Yellow/Blue DND-160; LysoSensor Yellow/Blue 10,000 MW dextran; an Oregon Green; an Oregon Green selected from the group consisting of 488, 488-X, 500, and 514; a rhodamine; a rhodamine selected from the group consisting of 110, 123, B, B 200, BB, BG, B extra, 5-carboxytetramethylrhodamine (5-TAMRA), 5 GLD, 6-Carboxyrhodamine 6G, Lissamine, Lissamine Rhodamine B, Phallicidine, Phalloidine, Red, Rhod-2, ROX (6-carboxy-X-rhodamine), 5-ROX (carboxy-X-rhodamine), Sulphorhodamine B can C, Sulphorhodamine G Extra, TAMRA (6-carboxytetramethylrhodamine), Tetramethylrhodamine (TRITC), and WT; Texas Red; Texas Red-X; and, VIC
92. The method of claim 68, wherein the amplification reaction is carried out in the presence of a detergent.
93. The method of claim 92 wherein the detergent is selected from the group consisting of CHAPS, n-Dodecyl-b-D-maltoside, SDS, TRITON® X-100, Tween-20 and/or ZWITTERGENT®.
94. The method of claim 68 wherein primer dimmer formation is suppressed by at least 10% as determined by comparing the amount of a primer dimer product in an amplification reaction containing the PDI to the amount of a primer dimer product in a control amplification reaction lacking the PDI.
95. The method of claim 68 wherein the PDI is crude.
96. The method of claim 68 wherein the PDI is HPLC -purified.
97. The method of claim 68 wherein the PDI is desalted prior to use.
98. The method of claim 68 wherein the amplification reaction occurs upon a solid support.
99. The method of claim 68 wherein the amplification reaction is in a multiplex format.
PCT/US2010/052387 2009-10-12 2010-10-12 Compositions and methods for suppressing primer interactions Ceased WO2011046972A2 (en)

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US25085009P 2009-10-12 2009-10-12
US61/250,850 2009-10-12
US25304409P 2009-10-19 2009-10-19
US61/253,044 2009-10-19
US25846509P 2009-11-05 2009-11-05
US61/258,465 2009-11-05

Publications (2)

Publication Number Publication Date
WO2011046972A2 true WO2011046972A2 (en) 2011-04-21
WO2011046972A3 WO2011046972A3 (en) 2011-09-22

Family

ID=43876833

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2010/052387 Ceased WO2011046972A2 (en) 2009-10-12 2010-10-12 Compositions and methods for suppressing primer interactions

Country Status (1)

Country Link
WO (1) WO2011046972A2 (en)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015012363A1 (en) * 2013-07-24 2015-01-29 日本碍子株式会社 Method for detecting target nucleic acid
US8980333B2 (en) 2011-06-08 2015-03-17 Life Technologies Corporation Development of novel detergents for use in PCR systems
WO2017007586A1 (en) * 2015-07-07 2017-01-12 Pillar Biosciences Inc. Method for reducing primer-dimer amplification
WO2017201239A1 (en) * 2016-05-18 2017-11-23 Integrated Nano-Technologies, Inc. Method for detection of a pcr product
WO2018124665A1 (en) * 2016-12-29 2018-07-05 Seegene, Inc. . Method for reducing primer dimer formation and increasing amplification efficiency
US10378050B2 (en) 2011-06-08 2019-08-13 Life Technologies Corporation Polymerization of nucleic acids using proteins having low isoelectric points
US10683539B2 (en) 2013-10-25 2020-06-16 Life Technologies Corporation Compounds for use in PCR systems and applications thereof

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5801155A (en) * 1995-04-03 1998-09-01 Epoch Pharmaceuticals, Inc. Covalently linked oligonucleotide minor grove binder conjugates
US6300075B1 (en) * 1999-02-03 2001-10-09 Ortho-Clinical Diagnostics, Inc Enhancement of the specificity of nucleic acid amplification by carrier nucleic acid
US7517978B1 (en) * 2004-04-14 2009-04-14 Applied Biosystems, Llc Modified oligonucleotides and applications thereof
JP2006254784A (en) * 2005-03-17 2006-09-28 Institute Of Physical & Chemical Research Methods for reducing non-specific amplification from primer dimers

Cited By (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11365443B2 (en) 2011-06-08 2022-06-21 Life Technologies Corporation Polymerization of nucleic acids using proteins having low isoelectric points
US10378050B2 (en) 2011-06-08 2019-08-13 Life Technologies Corporation Polymerization of nucleic acids using proteins having low isoelectric points
US9493414B2 (en) 2011-06-08 2016-11-15 Life Technologies Corporation Development of novel detergents for use in PCR systems
US12241119B2 (en) 2011-06-08 2025-03-04 Life Technologies Corporation Polymerization of nucleic acids using proteins having low isoelectric points
US11697841B2 (en) 2011-06-08 2023-07-11 Life Technologies Corporation Development of novel detergents for use in PCR systems
US10202639B2 (en) 2011-06-08 2019-02-12 Life Technologies Corporation Development of novel detergents for use in PCR systems
US8980333B2 (en) 2011-06-08 2015-03-17 Life Technologies Corporation Development of novel detergents for use in PCR systems
US10676785B2 (en) 2011-06-08 2020-06-09 Life Technologies Corporation Development of novel detergents for use in PCR systems
JP5967785B2 (en) * 2013-07-24 2016-08-10 日本碍子株式会社 Target nucleic acid detection method
WO2015012363A1 (en) * 2013-07-24 2015-01-29 日本碍子株式会社 Method for detecting target nucleic acid
US11479814B2 (en) 2013-10-25 2022-10-25 Life Technologies Corporation Compounds for use in PCR systems and applications thereof
US10683539B2 (en) 2013-10-25 2020-06-16 Life Technologies Corporation Compounds for use in PCR systems and applications thereof
CN106795569A (en) * 2015-07-07 2017-05-31 上海真固生物科技有限公司 The method for reducing primer dimer amplification
KR20180027557A (en) * 2015-07-07 2018-03-14 필러 바이오사이언시스 인코포레이티드 Method for reducing primer-dimer amplification
CN106795569B (en) * 2015-07-07 2017-12-05 上海真固生物科技有限公司 The method for reducing primer dimer amplification
JP2017521999A (en) * 2015-07-07 2017-08-10 ピラー バイオサイエンシズ インコーポレイティド Methods for reducing primer dimer amplification
US9605305B2 (en) 2015-07-07 2017-03-28 Pillar Biosciences Inc. Method for reducing primer-dimer amplification
KR102625365B1 (en) 2015-07-07 2024-01-15 필러 바이오사이언시스 인코포레이티드 Method for reducing primer-dimer amplification
WO2017007586A1 (en) * 2015-07-07 2017-01-12 Pillar Biosciences Inc. Method for reducing primer-dimer amplification
WO2017201239A1 (en) * 2016-05-18 2017-11-23 Integrated Nano-Technologies, Inc. Method for detection of a pcr product
EP3562958A4 (en) * 2016-12-29 2020-08-19 Seegene, Inc. PROCESS FOR REDUCING PRIMER-DIMER FORMATION AND INCREASING THE AMPLIFICATION EFFICIENCY
EP4001428A1 (en) * 2016-12-29 2022-05-25 Seegene, Inc. Method for reducing primer dimer formation and increasing amplification efficiency
WO2018124665A1 (en) * 2016-12-29 2018-07-05 Seegene, Inc. . Method for reducing primer dimer formation and increasing amplification efficiency
EP4293127A3 (en) * 2016-12-29 2024-03-13 Seegene, Inc. Method for reducing primer dimer formation and increasing amplification efficiency

Also Published As

Publication number Publication date
WO2011046972A3 (en) 2011-09-22

Similar Documents

Publication Publication Date Title
US12241119B2 (en) Polymerization of nucleic acids using proteins having low isoelectric points
US9416405B2 (en) Compositions, methods and kits for enhancing PCR specificity
US20230100065A1 (en) Compounds for use in pcr systems and applications thereof
US20240182958A1 (en) Novel compositions, methods and kits for real time polymerase chain reaction (pcr)
US20230212662A1 (en) Development of novel detergents for use in pcr systems
WO2011046972A2 (en) Compositions and methods for suppressing primer interactions

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10823968

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10823968

Country of ref document: EP

Kind code of ref document: A2