WO2011034895A1 - Compositions, methods and uses for nucleotide analogues - Google Patents

Compositions, methods and uses for nucleotide analogues Download PDF

Info

Publication number
WO2011034895A1
WO2011034895A1 PCT/US2010/048894 US2010048894W WO2011034895A1 WO 2011034895 A1 WO2011034895 A1 WO 2011034895A1 US 2010048894 W US2010048894 W US 2010048894W WO 2011034895 A1 WO2011034895 A1 WO 2011034895A1
Authority
WO
WIPO (PCT)
Prior art keywords
triphosphate
diaza
dna
nucleic acid
tctp
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2010/048894
Other languages
French (fr)
Inventor
Robert D. Kuchta
Gudrun Stengel
Milan Urban
Byron W. Purse
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Colorado Boulder
University of Colorado Denver
Original Assignee
University of Colorado Boulder
University of Colorado Denver
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Colorado Boulder, University of Colorado Denver filed Critical University of Colorado Boulder
Publication of WO2011034895A1 publication Critical patent/WO2011034895A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H19/00Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof
    • C07H19/02Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof sharing nitrogen
    • C07H19/04Heterocyclic radicals containing only nitrogen atoms as ring hetero atom
    • C07H19/23Heterocyclic radicals containing two or more heterocyclic rings condensed among themselves or condensed with a common carbocyclic ring system, not provided for in groups C07H19/14 - C07H19/22
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H19/00Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof
    • C07H19/02Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof sharing nitrogen
    • C07H19/24Heterocyclic radicals containing oxygen or sulfur as ring hetero atom
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]

Definitions

  • Embodiments herein report methods, compositions and uses for nucleotide analogues. Embodiments also generally report methods, compositions and uses of nucleotide analogues for generating detectible nucleic acid sequences. In certain embodiments, compositions and methods herein report synthesis of nucleic acid sequences of use for detection, amplification, and/or diagnosis. Certain embodiments report compositions and methods for amplification of target molecules. In other embodiments, compositions, methods and uses concern generating and using fluorescent cytosine analogues.
  • nucleic acids with detectible markers or agents.
  • Some applications for these labeled molecules include the visualization of PCR products, the analysis of base mutations, transcription and gene expression, in situ hybridization and four-color sequencing.
  • tagged nucleotides can serve as analytical tools for example, for diagnosis or treatment of medical conditions, nucleotide cytochemistry and RNA aptamer development.
  • compositions herein report generating highly fluorescent nucleic acids using nucleoside triphosphate analogues.
  • Embodiments included herein also generally report methods, compositions and uses of nucleotide analogues for generating detectible nucleic acid sequences.
  • compositions and methods herein concern synthesis of traceable nucleic acid sequences of use for detection, amplification, and diagnosis.
  • Certain embodiments relate to compositions and methods for amplification of target molecules.
  • compositions, methods and uses concern generating and using fluorescent cytosine analogues.
  • Some embodiments herein concern generating tagged ribonucleotide analogues.
  • ribonucleotide analogues can be used as substrates for generating R A having a detectible nucleotide.
  • Other embodiments concern uses for tagged or detectible DNA molecules using deoxyribonucleotide analogues incorporated into the molecules of interest.
  • compositions and methods disclosed herein can be used to generate detectible nucleic acid molecules using novel agents disclosed herein in combination with various polymerases and/or other reagents.
  • a large detectible probe may be generated using compositions and methods disclosed herein.
  • a large probe can be 100 bases or greater; 200 bases or greater or more.
  • Detectible probes generated herein may be used for a variety of purposes including, but not limited to, experimental purposes (e.g. isolating or tracking target molecules), medical diagnosis, disease prognosis, disease staging (e.g. cancer or other disease), labeling and detection based on specificity of the probe and/or labeling and detection based on non-specific uses of large probes.
  • Some embodiments concern applications for target molecules that include, but are not limited to, visualization of amplification products, analysis of base mutations, transcription and gene expression, in situ hybridization and four-color sequencing.
  • tagged nucleotides can serve as analytical tools including, but not limited to, diagnosis or treatment of medical conditions, nucleotide cytochemistry and RNA aptamer development. DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
  • Figs. 1A-D represent comparisons between different DNA polymerases and different denaturation conditions.
  • Figs. 2 A and 2B represent electrophoretic gel analysis of PCR reactions catalyzed by a polymerase at different mixing ratios of cytosine and cytosine analogues.
  • Figs. 3A and 3B represent electrophoretic gel analysis of time courses for primer elongation past tCo-G and G-tCo base pairs.
  • FIGs. 4A and 4B illustrate dequenching of fluorescence upon enzymatic digestion of PCR products.
  • Fig. 5 illustrates a gel shift assay demonstrating modulation in molecular mass
  • Fig. 6 represents an exemplary electrophoresis gel demonstrating incorporation of a tagged ribonucleotide.
  • Fig. 7 represents an exemplary electrophoresis gel demonstrating competitive incorporation of ribonucleotides.
  • Fig. 8 represents an exemplary electrophoresis gel demonstrating competitive incorporation of ribonucleotides at various concentrations.
  • Figs. 9 A and 9B represent large fluorescent RNA generated by transcription in the presence of CTP and tCTP at different concentrations. 9A and 9B represent nucleotides generated from two different sources.
  • Tagged nucleotides can be useful analytical tools that can include, but are not limited to, diagnosis or treatment of medical conditions, cytochemistry and tagging aptamers. Certain embodiments concern fluorescent DNA of high molecular weight as a tool for studying physical properties of DNA, DNA-RNA interactions and DNA-protein interactions. Other embodiments concern generating tagged RNA molecules of use as analytical tools as well as research purposes. In addition, tagged nucleic acid molecules can play an important role in modern biotechnology for DNA sequencing, analysis and detection. While several DNA polymerases were previously found capable of incorporating large numbers of dye-linked nucleotides into primed DNA templates, the amplification of the resulting densely labeled DNA strands by PCR (polymerase chain reaction) has been problematic.
  • nucleic acid molecules e.g. single-stranded, double-stranded
  • RNA/DNA hybrid nucleic acid/protein or peptide molecules of use in biological methods.
  • methods herein concern incorporating fluorescent analogues into DNA molecules.
  • methods may include PCR reactions using cytosine analogues.
  • Cytosine analogues may include, but are not limited to, 5 '-triphosphate of 1, 3-diaza-2-oxo-phenoxazine (tCo), (l,3-diaza-2-oxo-thiazine) triphosphate (d(tC)TP) and/or 1,3- diaza-2-oxophenothiazine-ribose-5 '-triphosphate (tCTP).
  • one or more cytosine analogues may be used to generate a labeled nucleic acid molecule of interest.
  • Co is a fluorescent cytosine analogue that absorbs and emits light at about 365 and about 460 nm, respectively.
  • amplification products were fluorescent enough to visualize them in a gel by excitation with long UV light, thus eliminating the need for staining.
  • one or more DNA polymerases known in the art may be used to generate an amplified product.
  • Deep Vent polymerase can be used alone or in combination in a reaction to generate amplified products. Because tCo can substitute for cytosine, for example, as a structurally similar molecule, labeling with these modified molecules can be less invasive than labeling with dye- linked nucleotides or radio label-linked nucleotides. Some embodiments relate to generating nucleic acid molecules suited for biophysical studies.
  • compositions and methods can include one or more analogues to dCTP or CTP alone or incombination with control dCTP and/or CTP.
  • Some embodiments can include different ratios of analogues to dCTP or CTP in compositions and methods disclosed herein.
  • ratios of analogues contemplated herein may include, but are not limited to 1 : 1, 1 : 1.5, 1 : 1.67, 1 :2, 1:3, 1 :4, 1 :5, 1 :6, 1 :7, 1 :8 etc.
  • Other ratios may include 1 : 19, 1 :29, 1 :39 or other predetermined ratio for a composition contemplated herein.
  • some ratios may include more analogue than control dCTP or CTP depending on the conditions.
  • traceable agents such as fluorescent probes can serve many purposes.
  • fluorescent probes can serve as a environmentally friendly alternative to for example, radioactive markers.
  • they can offer a range of physical properties that have inspired novel technologies for nucleic acid analysis.
  • fluorescent probes can be used for real-time reaction probes in order to generate large quantities of labeled nucleic acids capable of being turned off or on due to for example, distance from a quenching agent or interruption in the sequence with an
  • fluorescent probes can serve as PCR probes that have been designed to switch between bright and dark states (detectable and undetectable states) in response to distance dependent fluorescent quenching or to intercalation of dyes into duplex DNA, R A or hybrid molecules (e.g. R A/DNA, PCA or other hybrid molecules).
  • methods can be used for detection of single nucleotide polymorphisms that exploit spectral sensitivity of certain fluorescent probes to a specific base context.
  • fluorescent probes can be used as a less invasive method for assessing a medical condition in a subject than for example, using a radioactive indicator.
  • single molecule sequencing includes replacing one, two, three or all four nucleobases up to 100 % of the molecule by a fluorescent reporter in order to create a color-coded (e.g. fluorescent) nucleic acid sequence (e.g. DNA, RNA).
  • a color-coded DNA sequence can be generated and then can be read backwards by digestion (e.g. exonuclease digestion) or forward by stepwise DNA synthesis.
  • Some embodiments include other methods in molecular biology that can take advantage of fluorescent markers for generating detectible nucleic acid molecules.
  • compositions and methods herein can include visualization of nucleic acid amplification products, analysis of base mutations, transcription and gene expression, in situ hybridization, and four-color DNA sequencing.
  • nucleic acid synthesis methods may be used where a denaturation step of about high temperatures are included which can result in no loss of enzyme activity and generation of highly fluorescent probes detectible by excitation/visualization, (e.g excitation at 365 nm). In accordance with these embodiments, no staining is required for detection of the highly fluorescent probe.
  • highly fluorescent molecules generated by compositions and methods disclosed herein may be used in disease diagnosis, progression and prognosis in a subject. In accordance with these methods, other more invasive techniques may be avoided as well as avoiding the use of potentially carcinogenic agents/dyes.
  • B family polymerases can include, but are not limited to, DNA polymerase a, DNA polymerase ⁇ , DNA polymerase ⁇ , RB 69 DNA polymerase, DNA polymerase II (e.g. E. coli and other eubacteria), herpes DNA polymerase, T4 DNA polymerase, Phi29 DNA polymerase, Tgo DNA polymerase (thermostable), Pfu DNA polymerase (thermostable), Vent DNA polymerase, Deep vent DNA polymerase and other polymerases known in the art.
  • B family DNA polymerases are defined by a series of conserved amino acid sequences. A B family DNA polymerase may contain all or a subset of these sequences. In certain embodiments,
  • compositions and methods disclosed herein can include one or more polymerases in a given nucleic acid synthesis reaction.
  • one polymerase may catalyze a reaction more readily than another.
  • Vent DNA polymerase may be used under conditions where other polymerases may not perform as efficiently or effectively.
  • Other compositions and methods disclosed herein may use two or more polymerases in order to induce synthesis of a nucleic acid sequence relative to a composition with only one polymerase.
  • a Family Polymerases A Family Polymerases
  • compositions including one or more
  • a Family polymerases can contain both replicative and repair polymerases. Replicative members from this family can include, but are not limited to, T7 DNA polymerase, as well as the eukaryotic mitochondrial DNA Polymerase ⁇ among others. Repair polymerases can include, but are not limited to, E. coli DNA pol I, Thermus aquaticus pol I (e.g. heat-resistant enzyme Taq DNA Polymerase), Bacillus
  • reagent formulations are disclosed that may be more suited for use with one or more polymerases versus other reagent formulations.
  • Other embodiments may include reagent supplementation or substitution depending, for example, on the polymerase chosen for a particular target nucleic acid synthesis.
  • betaine may be replaced in sequencing reactions under certain synthesis conditions.
  • a reagent combination used in the presence of the DNA polymerase Taq may include dtCoTP at various concentration ratios with control dCTPs and/or dtCTPs in the presence of one or more of manganese chloride (MnCl 2 ) and magnesium chloride. (MgCl 2 ).
  • nucleic acid synthesis compositions can include betaine without manganese chloride in a reaction having Taq polymerase and at least one fluorescent nucleotide to produce a target nucleic acid sequence.
  • embodiments may include various DMSO concentrations, alone or in combination with one or more of betaine, MnCl 2 and MgCl 2 or other reagent, in nucleic acid synthesis compositions such as those used in PCR reactions or other synthesis methods known in the art.
  • nucleic acid synthesis compositions may be void of glycerol in the presence of one or more polymerases.
  • nucleic acid synthesis compositions using Taq polymerase may contain betaine as one reagent at
  • RNA cytochemistry may be used by introducing fluorescent RNA into cells using, for example, microinjection or in vivo hybridization of fluorescent nucleic acids to endogenous RNAs.
  • a transit path of the labeled RNA can be visualized.
  • visualization may be by fluorescent microscopy or other fluorescent detecting device.
  • DNA, RNA or hybrid aptamers, short nucleic acids that bind ligands with high affinity and specificity, can be generated using tagged or labeled nucleotides disclosed herein. Aptamers are comparable to antibodies.
  • RNA aptamers have been used in diagnostic assays, including, but not limited to, ELISA, Western blotting, microarrays, capillary electrophoresis and flow cytometry.
  • fluorescent RNA aptamers can be synthesized to various lengths by direct solid-phase synthesis.
  • the fiuor can be attached to a terminal position to avoid potential negative effects of internal labeling on the aptamer activity.
  • approaches have been developed to attach an additional RNA domain to the aptamer of interest, such as malachite green, which becomes fluorescent in response to ligand binding.
  • labeling of longer RNA can be accomplished enzymatically by transcription with an RNA polymerase such as, T7 RNA polymerase, in the presence of fluorescent ribonucleotides or of initiator nucleotides, such as guanosine monophosphothioate.
  • an RNA polymerase such as, T7 RNA polymerase
  • fluorescent ribonucleotides or of initiator nucleotides, such as guanosine monophosphothioate can results in site-specific modification of the 5 '-end of the molecule that can be rendered fluorescent via subsequent coupling to a fluorescent dye.
  • methods herein concern incorporating fluorescent analogues into other RNA molecules.
  • methods may include reactions capable of incorporating a ribonucleotide analogue into a nucleic acid molecule.
  • an RNA analogue l,3-diaza-2-oxophenothiazine-ribose-5 '-triphosphate (tCTP) may be used.
  • tCTP is a fluorescent cytosine analogue that absorbs and emits light at about 365 and about 460 nm, respectively.
  • amplification products can be fluorescent enough to visualize them in a gel by excitation with long UV light, thus eliminating the need for staining.
  • RNA polymerase can be used in a reaction to generate amplified products. Because tCTP can substitute structurally for cytosine, this labeling method can be less invasive than labeling with dye-linked nucleotides and therefore produces nucleic acid molecules suited for biophysical studies.
  • RNPs RNA polymerases
  • RNPs can include, but are not limited to, T7 RNA polymerase, RNA polymerase I, RNA polymerase II, RNA polymerase III and any other RNA polymerase known in the art.
  • isolated nucleic acids can be used for generating nucleic acid sequences.
  • Isolated nucleic acid may be derived from genomic RNA, genomic DNA, or complementary DNA (cDNA) of use in some embodiments herein.
  • isolated nucleic acids such as chemically or enzymatically synthesized DNA, may be of use for probes, primers and/or labeled detection oligonucleotides.
  • a "nucleic acid sequence” can include single-stranded and double-stranded molecules, as well as DNA, RNA, chemically modified nucleic acids and nucleic acid analogues. It is contemplated that a nucleic acid may be of 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94,
  • a nucleic acid sequence can be about 10 nucleotides or more, or 20 nucleotides or more, or 30 nucleotides or more, or 40 nucleotides or larger.
  • a nucleic acid sequence may be 200 bases or longer (e.g. for generating a highly fluorescent probe).
  • a large fluorescent probe may be generated using compositions and methods disclosed herein where detection may be by UV excitation/ visualization for rapid identification.
  • Nucleic acid sequences may be made by any method known in the art, for example using standard recombinant methods, synthetic techniques, or combinations thereof.
  • the nucleic acids may be cloned, amplified, or otherwise constructed, for example, incorporating cytosine analogues described herein.
  • Isolated nucleic acids may be obtained from tissue samples or other sources using any number of cloning methodologies known in the art.
  • oligonucleotide probes which selectively hybridize, under stringent conditions, to the nucleic acids of a tissue sample. Methods for construction of nucleic acid libraries are known and any such known methods may be used.
  • RNA or cDNA may be screened for the presence of an identified genetic element of interest using a probe based upon one or more sequences.
  • Various degrees of stringency of hybridization may be employed in the assay. As the conditions for hybridization become more stringent, a greater degree of complementarity between the probe and the target may be needed for duplex formation to occur.
  • the degree of stringency may be controlled by temperature, ionic strength, pH and/or the presence of a partially denaturing solvent such as formamide.
  • the stringency of hybridization can be conveniently varied by changing the
  • complementarity (sequence identity) required for detectable binding can vary in accordance with the stringency of the hybridization medium and/or wash medium.
  • the degree of complementarity can optimally be about 100 percent; but in other embodiments, sequence variations in the RNA may result in ⁇ 100% complementarity, ⁇ 90% complimentarity probes, ⁇ 80% complimentarity probes, ⁇ 70% complimentarity probes or lower depending upon the conditions.
  • primers may be compensated for by reducing the stringency of the hybridization and/or wash medium.
  • High stringency conditions for nucleic acid hybridization are well known in the art.
  • conditions may comprise low salt and/or high temperature conditions, such as provided by about 0.02 M to about 0.15 M NaCl at temperatures of about 50°C to about 70°C.
  • Other exemplary conditions are disclosed in the following Examples. It is understood that the temperature and ionic strength of a desired stringency are determined in part by the length of the particular nucleic acid(s), the length and nucleotide content of the target sequence(s), the charge composition of the nucleic acid(s), and by the presence or concentration of formamide, tetramethylammonium chloride or other solvent(s) in a hybridization mixture.
  • Nucleic acids may be completely complementary to a target sequence or may exhibit one or more mismatches.
  • Nucleic acid sequences of interest may also be amplified using a variety of known amplification techniques.
  • target nucleic acid sequences may be generated that are traceable using one or more traceable nucleotide.
  • PCR polymerase chain reaction
  • PCR and other in vitro amplification methods may also be useful, for example, to clone nucleic acid sequences, to make nucleic acids to use as probes for detecting the presence of a target nucleic acid in samples, for nucleic acid sequencing, or for other purposes.
  • embodiments include, Rolling circle amplification, NEAR, developed by Ionian Technologies, Recombinase Polymerase Amplification, developed by TwistDx or other techniques known in the art.
  • Isolated nucleic acids may be prepared by direct chemical synthesis by methods such as the phosphotriester method, or using an automated synthesizer. Chemical synthesis generally produces a single stranded oligonucleotide. This may be converted into double stranded DNA by hybridization with a complementary sequence or by polymerization with a DNA polymerase using the single strand as a template. Nucleic acid sequences having cytosine analogues may be generated using isolated sequences as a template for generating a high density fluorescent molecule.
  • kits contemplated herein may include compositions for generating high density fluorescent nucleic acids, hybrid nucleic acid molecules, nucleic acid- protein or nucleic acid-peptide. Contemplated herein are methods for making and using a kit for analysis of or generation of such molecules.
  • the kits can include one or more containers.
  • one or more reagents may be part of a kit. Any of the kits will generally include at least one vial, test tube, flask, bottle, syringe or other container, into which compositions, may be preferably and/or suitably aliquoted.
  • Kits herein may also include an apparatus for analyzing or assessing presence of an end molecule, for example detecting or analyzing a high density fluorescent molecule produced by a kit.
  • a kit may contain one or more fluorescent cytosine or cytosine nucleotides disclosed herein. Some kits may contain one or more control samples.
  • Vent exo- and Taq pol to produce a 560 base pair long PCR fragment in the presence of various mixing ratios of dtCoTP and dCTP were compared.
  • the gene amplified codes for the beta chain of human hemoglobin and has a GC content of 53 %.
  • the template was chosen arbitrarily without consideration of the exact base sequence.
  • the PCR samples were denatured at 95°C for 45 sec. Figs.
  • FIG. 1 A and B illustrate agarose gels of the PCR products obtained with Taq and Deep Vent pol as increasing amounts of dCTP were replaced by dtCoTP.
  • the gels were exposed on a 365 nm trans-illuminator to detect the tCo emission. At this wavelength, the DNA ladder or the positive control containing only 200 ⁇ dCTP were not visible however, the PCR products obtained in the presence of moderate to high dtCoTP concentrations were clearly visible. Reactions catalyzed by Taq pol did not result in PCR product for dtCoTP concentration > 10 ⁇ , whereas Deep Vent pol tolerated dtCoTP concentrations up to 50 ⁇ .
  • Deep Vent polymerase was capable of replacing about 50 % of all cytosines with analogue, tCo, or about 60% or more assuming dCTP and dtCoTP were incorporated with equal efficiency, and that the reactions are limited by the melting temperature of the resulting PCR product rather than by the substrate specificity of this pol over a wide range of dtCoTP concentrations.
  • PCR products were not obtained when more than 10% of the total amount of dCTP was replaced by dtCoTP.
  • nucleic acid synthesis methods may be used where a denaturation step of about 99 degrees Celsius is included which can result in no loss of enzyme activity and generation of highly fluorescent probes detectible by excitation/visualization, (e.g excitation at 365 nm). In accordance with these embodiments, no staining is required for detection of the highly fluorescent probe, saving time and money.
  • highly fluorescent molecules generated by compositions and methods disclosed herein may be used in disease diagnosis and prognosis in a subject. In accordance with these methods, other more invasive techniques may be avoided as well as avoiding the use of potentially carcinogenic agents/dyes.
  • PCR reaction with Taq pol may have reduced efficiency. Although both pols insert dGTP across from tCo fairly specifically, they do it with more or less impaired efficiency. While Deep Vent pol forms the G-tCo base pair ⁇ 20-times less efficiently than the G-C pair, the difference is ⁇ 100-times for Taq pol. This suggests that the extension times lengthen significantly when DNA with high tCo density is copied.
  • inferior performance of Taq pol may be explained by the enzyme's preference for incorporating the nucleotide analogue, which is followed by subsequent pausing, and paired with the inability to translate tCo when encountered in the template.
  • DNAse I is a non-specific endonuclease that randomly cleaves DNA to release di, tri and longer oligonucleotides. Exonuclease I removes mononucleotides from single-stranded DNA in 3 '-5 ' direction. Fig.
  • FIG. 4A illustrates that substantial dequenching occurs and that it scales with increasing labeling density of the PCR products. That the labeling density really increases with increasing concentrations of free dtCoTP in the PCR reactions is confirmed by the upward shift of the PCR products in native polyacrylamide gels (Fig. 5). The mass increase may be attributed to the fact that tCo is heavier than C. In this example, the amount of dequenching peaks at 250 % for the PCR products generated in the presence of 75 ⁇ dtCoTP. Dequenching is less pronounced for the reaction with 100 ⁇ dtCoTP, suggesting, among other reasons, that the enzymes are less efficient at digesting densely tCo labeled DNA.
  • the well base stacked fluorescent base analogue 2-aminopurine is strongly quenched in duplex DNA by photoinduced electron transfer from guanine, whereas electron transfer to the poorly stacked fluorophore ethenoadenine is about 10-times worse.
  • the absence of photoinduced electron transfer from guanine to tCo despite the tight base stacking of tCo possibly indicates that tCo has a higher oxidation potential than guanine.
  • thermophilic pols show a trend for misinserting dtCoTP across a template A (Table 1). Deep Vent polymerizes dTTP 10-times more efficiently than dtCoTP across from A, whereas Taq pol prefers dTTP only by a factor of 3 (Table 1).
  • PCR reactions rely on the use of an extremely thermostable B family DNA polymerase, Deep Vent exo-, which allows conducting the PCR reactions with a denaturation step at 99 °C without loss of enzyme activity.
  • the resulting DNA fragments are highly fluorescent and can be visualized in a gel by excitation at 365 nm, thus obviating the need for staining of the DNA bands with cancerogenic DNA intercalating dyes.
  • Figs. 1A-1D illustrates a comparison between different DNA polymerases and different denaturation conditions.
  • the PCR products obtained after 40 cycles were analyzed by agarose gel electrophoresis and the DNA bands were either visualized by excitation at 365 nm (top rows) or by staining with ethidium bromide (bottom rows).
  • Figs. 3A-3B represent gel electrophoretic analysis of time courses for primer elongation past tCo-G and G-tCo base pairs.
  • FIGs. 4 A and 4B illustrate dequenching of tCo fluorescence upon enzymatic digestion of PCR products.
  • PCR products were gel purified and treated with a mixture of DNAse I and Exonuclease I.
  • Fig. 5 illustrates a gel shift assay demonstrating the increase in molecular mass of the PCR product as tCo substitutes for cytosine.
  • Table 1 Relative catalytic efficiency for the incorporation of dtCoTP across G and A
  • Taq DNA pol was purchased from Invitrogen, Deep Vent exo- pol from New England Bio labs, DNAse I was from New England Bio labs, Exonuclease I from USB Affimetrix.
  • the PCR primers and other oligonucleotides were synthesized by Integrated DNA Technology and the plasmid coding for the globin protein is available and was a provided here.
  • the reactions contained the reaction buffers and Mg2+ concentrations recommended by the suppliers of the DNA polymerases.
  • Deep Vent exo- pol 10 mM KCl, 10 mM (NH 4 )2S0 4 , 20 mM Tris-HCl pH 8.8, 2 mM MgS0 4 , 0.1 % Triton X-100.
  • Taq pol 20 mM Tris-HCl pH 8.4, 50 mM KCl, 1.5 mM MgCl 2 .
  • the reactions contained 200 ⁇ of each dNTP, 500 nM forward and reverse primer, 140 ng template and either 1 unit Deep Vent pol or 2.5 units Taq pol.
  • step 3 The sum of dtCoTP and dCTP concentration always equaled 200 ⁇ .
  • the total volume of each PCR reaction was 50 ⁇ .
  • a standard temperature protocol for reactions containing 15 % glycerol was as follows: Step 1 : 94 °C/4 min; step 2: 95 °C/45 sec; step 3: 52 °C/30 sec; step 4: 73 °C/2 min; step 5: 99 °C/45 sec; step 6: 55 °C/30 sec; step 7: 73°C/2 min; go to step 5: 40-times; final elongation: 73 °C/20 min.
  • the lower annealing temperature (step 3) was used in the first cycle to account for the lower melting temperature of tCo-free DNA.
  • the reactions were performed using an Eppendorf Mastercycler.
  • the PCR reactions were analyzed using mini 1.2 % standard agarose gels with 0.5 x TAE buffer. The gels were either exposed at 365 nm or at 254 nm after staining of the DNA bands with ethidium bromide.
  • fluorescence dequenching the excitation wavelength was set to 345 nm, the emission to 460 nm.
  • DNA primers were 5'- 32 P-labeled using T4 polynucleotide kinase (New England Biolab) and [ ⁇ - 32 ⁇ ] ⁇ .
  • the labeled primer was gel- purified and annealed to the appropriate template strands.
  • the total reaction volume was either 5 or 10 ⁇ ⁇ .
  • Polymerization was initiated by mixing equal volumes of reaction mixture and enzyme followed by incubation at 37°C.
  • the enzyme concentrations used for the determination of the Michaelis-Menten parameters Vmax and KM were 0.0125 units ⁇ L Taq pol and 0.0005 units ⁇ L Deep Vent pol, respectively.
  • primer elongation was performed with a series of dNTP concentrations and all reactions were stopped after the same amount of time, such that primer extension was below 20% for all dNTP concentrations.
  • gel loading buffer 90 % formamide with 50 mM EDTA
  • DeepVent pol were removed from the master mix after 5, 10, 20 and 30 min and quenched with two volumes of 90 % formamide with 50 mM EDTA. Analysis of the reaction products was conducted by denaturing gel electrophoresis as described above.
  • a fluorescent ribonucleotide analogue l,3-diaza-2- oxophenothiazine-ribose-5 '-triphosphate was synthesized and tested as a substrate for T7 RNA polymerase (T7 RNAP) in transcription reactions, a convenient route for generating RNA in vitro.
  • T7 RNA polymerase incorporates tCTP with about a 2- fold higher catalytic efficiency than CTP and efficiently polymerizes additional NTPs onto the tC.
  • T7 RNA polymerase does not incorporate tCTP with the same ambivalence opposite guanine and adenine with which DNA polymerases incorporate the analogous dtCTP. While several DNA polymerases discriminated against a d(tC-A) base pair only by factors ⁇ 10, discrimination factors of 40 and 300 for tCTP-A base pair formation by T7 RNA polymerase operating in the elongation and initiation mode, respectively were observed. These catalytic properties make T7 RNA polymerase advantageous for synthesizing large fluorescent RNA, as demonstrated by generating an 800 nucleotide RNA, in which every cytosine was replaced with tC.
  • T7 RNA polymerase T7 RNA polymerase
  • Transcription of DNA by T7 RNA polymerase takes place in two phases, initiation and elongation.
  • T7 RNAP binds tightly to the promoter sequence via its N-terminal promoter binding domain, opens the DNA duplex and feeds the template into the active site.
  • ribonucleotide synthesis frequently results in abortive RNA products that do not exceed 8-10 bases.
  • dtCTP is a good substrate for several A and B family DNA polymerases. The analogue is incorporated with high catalytic efficiency opposite a template guanine, but also to a significant extent opposite a template adenine.
  • the DNA polymerases efficiently extended a d(tC-G) base pair, whereas d(tC-A) base pairs primarily resulted in chain termination.
  • Ambivalence of dtCTP incorporation may be due to the propensity of N 4 -substituted cytidine analogues for forming the imino-tautomer, which is isosteric to thymine (Chart 1).
  • PCR polymerase chain reactions
  • a lower percentage of the C's were replaced with dtC in these experiments.
  • T7 RNAP Catalytic efficiency of tCTP incorporation by T7 RNAP was assessed using synthetic DNA templates of defined sequence, using for example templates which contained a unique G or A either within the initiation region or at a remote site. Both in the elongation and initiation mode, T7 RNAP polymerized tCTP with high catalytic efficiency across from a template G. Notably, T7 RNAP appears to be more discriminative against tC-A mismatches than DNA polymerases are against d(tC-A) mismatches. To demonstrate the merit of tCTP for RNA labeling, large, 100% tC-labeled RNA were produced by transcribing an 800 base pair DNA sequence, using tCTP in place of CTP.
  • Chart 1 illustrates base pairing of the tC amino and the tC imino tautomer.
  • tCTP incorporation opposite a template guanine was used to incorporate nucleotide analogues because it possesses different catalytic properties during the initiation and elongation phases of RNA synthesis.
  • tCTP was examined during both phases by using two different synthetic DNAs. Both DNAs consisted of the 18 nucleotide (nt) T7 promotor hybridized to a complementary 37 nt DNA template (Fig. 6). Transcription usually starts at the underlined C and proceeds in 3 '-to -5' direction along a template.
  • DNA 1 was employed, which exhibited a unique guanine 12 bases away from the start site of transcription.
  • DNA 2 featured a unique guanine at position only four nucleotides from the start site, directing tCTP incorporation to the initiation region. It was necessary to start the templating region with CCT instead of CCC to avoid slippage of T7 RNAP during initiation, which can result in non-sense poly-G ribonucleotides of different lengths.
  • Fig. 6 represents a comparison of the lengths of the RNA products obtained in transcription reactions using T7 RNAP and different combinations of NTPs and labeled nucleotides.
  • T7 RNAP In the presence of only GTP and ATP (lanes 2 and 2'), transcription terminated as T7 RNAP reached the single template guanines of DNA 1 and DNA 2, respectively, and the length of the products verifies that transcription starts indeed at the underlined C.
  • T7 RNAP produces a large amount of abortive GA dinucleotide when transcribing DNA 2, as revealed by RNA labeling with [a- 32 P]ATP in the presence of only ATP and GTP (Fig. 6, lane 9).
  • RNA transcript that contains U instead of the correct C migrates distinctly different from the RNA exhibiting tC at this position. Omitting UTP from the reaction mixture in the presence of CTP or tCTP, respectively (Fig. 6, lanes 6 and 7), lead to almost complete abortion of transcription at the unique A of DNAl . In both reactions only ⁇ 7% of the corresponding abortive RNA transcripts were extended. Employing DNA2, the reaction containing ATP, GTP and CTP lead to 1 1 % extension past the unique template A (lane 6'), whereas it was 26 % for the reaction containing tCTP (lane 7') ⁇ Thus, T7 RNAP used neither ATP, GTP, CTP nor tCTP effectively to bypass the template adenine. This result suggests that T7 RNAP base pairs tCTP less
  • Fig. 6 illustrates incorporation of tCTP by T7 RNA polymerase operating either in the initiation or elongation mode. Transcription starts at the underlined C and proceeds in the 3'-to-5 ' direction. All reactions contained 0.2 units/ ⁇ T7 RNAP, 1 ⁇ DNA and 0.4 mM of each of the indicated NTPs. All RNA products are visualized based on the incorporation of [a- 32 P]GTP, except for lanes 1 and 3, where [a- 32 P]ATP was used instead, together with ATP and GTP. Lane 2 displays a poly-G ladder, which was generated as described in the experimental section.
  • Fig. 7 illustrates competitive incorporation of CTP and tCTP across from G. All reactions contained 0.2 units/ ⁇ T7 RNAP, 1 ⁇ DNA and 0.4 mM [a- 32 P]GTP and 0.4 mM ATP. The [CTP]-to-[tCTP] ratio was systematically varied as indicated below the lanes and the reactions products were analyzed after incubating for lh. The very left lane shows the no enzyme control, the poly-G ladder is located in the middle between the two reactions series.
  • tC imino tautomer is a templating effect, for example, the alignment of tC with a templating adenine induces the imino tautomer to minimize the free energy of base pairing via hydrogen bonding.
  • Such an inductive effect could be powerful if the templating and the incoming base were aligned in one plane, as in duplex DNA.
  • the X-ray structure of the open ternary T7 RNAP-DNA-NTP complex captures an interaction of the incoming nucleotide with the templating base at a putative preinsertion site that has not been observed in other open ternary polymerase -DNA-dNTP complexes so far, including BF polymerase, RB69, Taq polymerase and T7 DNA polymerase.
  • the incoming NTP binds to the fingers domain (which forms the roof of the active site in the closed ternary complex) and makes hydrogen bonding contacts with the templating base prior to entering the active site, without for example, the steric constraint of the active site and with a slight out of plane tilt.
  • T7 RNAP has a mechanism to screen for base complementarity at the preinsertion site, which may contribute to selectivity.
  • the open ternary complex of Taq polymerase however captures the incoming nucleotide bound in the active site (the insertion site), while the templating base is occluded from interactions with the incoming nucleotide.
  • Two studies confirmed that the closure of the fingers domain and the alignment of the templating base with the incoming base are both fast steps on the reaction coordinate of nucleotide polymerization by Klenow fragment. This suggests that Klenow is in fast equilibrium between the open and closed conformation and that it screens for base complementarity at the insertion site after formation of Watson-Crick hydrogen bonds between incoming dNTP and a templating base.
  • T7 RNAP has a mechanism to reject the incoming tCTP at the preinsertion site, whereas Klenow allows dtCTP access to the insertion site where electronic constraints and planar base stacking facilitate the formation of the imino tautomer, which is then accepted due to its resemblance to a T-A base pair.
  • tC labeling of large RNA The generation of full length products on DNA1-4 in assays containing ATP, GTP, UTP, and tCTP suggested that it should be possible to use tCTP and T7 RNAP to generate highly fluorescent RNA.
  • T7 RNAP To present T7 RNAP with another challenge and to demonstrate the merit of tCTP incorporation for fluorescent labeling of large RNA transcripts, about 800 nucleotides of a Borellia miyamotoi flaggellin protein gene were transcribed in the presence of tCTP. Formation of full length RNA requires T7 RNAP to incorporate 3 consecutive tCTPs at 6 different positions.
  • RNA transcripts obtained at different mixing ratios of tCTP and CTP and separated by agarose gel electrophoresis As described recently for tCo labeled PCR products, tCo being a fluorescent oxo-ortholog of tC, it is possible to visualize the nucleic acids based on the tC fluorescence only, thus obviating the need for ethidium bromide staining.
  • Fluorescent 890 nucleotide RNA was obtained at all tCTP/CTP ratios tested, from a ratio of 1/15 to the point of full substitution of CTP with tCTP.
  • the same reaction conditions were used to transcribe a catalytic RNA, the 207 nucleotide long E. coli riboswitch for vitamin B12 (Fig. 9B).
  • RNA transcripts For both RNA transcripts, increasing the tC content led to slightly faster migration of the product RNA, and the overall yield was slightly diminished. The slightly faster migration could indicate premature termination at a specific site, or more likely, the RNA adopts a folded structure due to the increased hydrophobicity of the tC as compared to C. Despite the lower RNA yield at high tC labeling density, T7 RNAP transcription in the presence of tCTP is unexpectedly efficient.
  • Fig. 8 represents incorporation of UTP and tCTP across from a template A. All reactions contained 0.2 units/ ⁇ T7 RNAP, 1 ⁇ DNA4, 0.4 mM GTP, 0.4 mM ATP, some ⁇ x- [ 32 P]-GTP and increasing concentrations of UTP (left side) or tCTP (right side). Each reaction was stopped after 1 h. The UTP and tCTP concentrations, respectively, were as follows: 1, 5, 10, 25, 50, 100, 200 ⁇ .
  • Figs. 9A and 9B represent large fluorescent RNA generated by transcription in the presence of CTP and tCTP at different concentrations.
  • the top row shows the agarose gel exposed by UV light prior to staining with ethidium bromide (EtBr).
  • the CTP and tCTP concentrations are provided below the imageimages.
  • the reaction in lane 1 reactions next to the marker contained DNA template, pimers, enzyme but no CTP or tCTP, the control in lane 2 contained all four natural NTPs but no template.
  • Table 4 Kinetic parameters for the insertion of tCTP and UTP opposite adenine.
  • V max /K M for the incorporation of UTP into DNA X, divided by V max /K M for the incorporation of tCTP into DNA X.
  • the base analogue tC combines several properties that make it an attractive candidate for the design of regulatory and catalytic RNAs: as with other N 4 -substituted cytosine analogues it likely engages in variable hydrogen bonding patterns depending on its tautomerization state, it stabilizes DNA-RNA and DNA-DNA duplexes, and it is fluorescent and traceable within the limits of its fluorescence quantum yield. It is possible that this base analogue may be used for producing functionally expanded nucleic acid libraries (e.g. R A or DNA libraries) using T7 transcription combined with selection processes such as SELEX or other selection process.
  • functionally expanded nucleic acid libraries e.g. R A or DNA libraries
  • RNA polymerase and RNAse OutTM were from Invitrogen.
  • Synthetic oligonucleotides were purchased from Integrated DNA Technology and the DNA sample used for transcription of the Borrelia miyamotoi gene (locus D3777, region 354-1241; Gen Bank 43777) was provided and PCR amplified to introduce the T7 promotor.
  • Synthesis of tCTP was performed using the known synthesis of the l,3-diaza-2-oxophenothiazine nucleobase, Vorbruggen's silyl-Hilbert- Johnson
  • reaction mixture was heated at reflux for 2.5 hours, the allowed to cool to room temperature.
  • the reaction mixture was then poured into 5% NaHC0 3 solution (100 ml), and extracted with CH 2 C1 2 (2 x 100 ml). After drying over anhydrous Na 2 S0 4 , the solvent was removed by rotary evaporation and the product was purified by flash chromatography (5% hexanes in EtOAc), yielding the product as a yellow oil (395 mg, 91%), which was found to consist of only the desired ⁇ anomer.
  • tC-ribonucleoside triphosphate [00093] tC-ribonucleoside triphosphate.
  • tC (30 mg, 0.09 mmol) was dissolved in trimethyl phosphate (0.5 mL) under argon and cooled on ice.
  • POCl 3 (9 uL, 1.1 equivalent) in trimethyl phosphate (0.05 mL) was added dropwise and the mixture was stirred for 2 h while warming up to room temperature.
  • Tributylammonium pyrophosphate (0.6 g, 1.1 mmol, 12 equivalents) in DMF (1 mL) was added followed by several droplets of tributyl amine.
  • T7 transcription of synthetic oligonucleotides 20 transcription reactions contained 1 ⁇ DNA construct, 0.4 mM of each NTP, 5 mM DTT, [a- 32 P]GTP, commercial reaction buffer (40 mM Tris-HCl pH 8, 8 mM MgCl 2 , 2 mM spermidine, 25 mM NaCl) and 0.2 units/ ⁇ ⁇ T7 RNA polymerase.
  • the DNA constructs were prepared by hybridizing the T7 promotor (5'-TAA TAC GAC TCA CTA TAG-3' SEQ ID NO.
  • RNA products were separated by denaturing gel electrophoresis (20 % polyacrylamide, 8 M urea gels) and visualized using phosphorimagery.
  • fractioncTP being the amount of RNA extended by CTP
  • (k ca t/K M )tcTP the catalytic efficiency for tCTP incorporation
  • (k cat /KM)cTP the catalytic efficiency for CTP incorporation.
  • the kinetic parameters for tCTP incorporation across from A were measured under standard conditions. Assays contained 1 ⁇ DNA 3 or DNA 4, 0.4 mM ATP, 0.4 mM GTP, some a-[ 32 P]-GTP and either: 1, 5, 10, 25, 50, 100, 200 ⁇ UTP or 1, 5, 10, 25, 50, 100, 200 ⁇ tCTP. Reaction time was 1 hour.
  • RNA extended beyond 11 nucleotides was determined, in case of DNA 4, the percentage of RNA extended beyond 3 nucleotides was quantified.
  • the percentage of extended RNA was plotted versus the UTP or tCTP concentration and the Michaelis-Menten parameters were derived by non-linear curve fitting.
  • RNAse out 20 transcription reactions contained 1 ⁇ , PCR amplified DNA template, 0.4 mM ATP, 0.4 mM GTP, 0.4 mM UTP, 5 mM DTT, 0.6 units/ ⁇ _, RNAse out, commercial reaction buffer (40 mM Tris-HCl pH 8, 8 mM MgCl 2 , 2 mM spermidine, 25 mM NaCl) and 2 units/ ⁇ _, T7 RNA polymerase.
  • commercial reaction buffer 40 mM Tris-HCl pH 8, 8 mM MgCl 2 , 2 mM spermidine, 25 mM NaCl
  • CTP and tCTP were added to match the following concentrations: 400 ⁇ CTP, no tCTP; 375 ⁇ CTP, 25 ⁇ tCTP; 350 ⁇ CTP, 50 ⁇ tCTP; 300 ⁇ CTP, 100 ⁇ tCTP; 200 ⁇ CTP, 200 ⁇ tCTP; 100 ⁇ CTP, 300 ⁇ tCTP; no CTP, 400 ⁇ tCTP.
  • the samples were incubated for 1 hour, mixed with gel loading buffer (10 % ficoll 400, 10 % glycerol, 1 x TBE) and the RNA was separated using an 1.2 % agarose gel. The gels were exposed on an UV transilluminator prior to and after staining with ethidium bromide.
  • nucleic acid sequences may be synthesized using Taq polymerase for the PCR by modifying reaction conditions. Two sets of conditions were developed that allow Taq polymerase to work well in PCR. In one example, betaine was not present in the reaction mix. It was discovered that Taq works in the presence of 25uM dtCoTP, 175uM dCTP, 200uM of the other three dNTPs, 3.5mM MgC12 and 0.5mM MnC12. Standard PCR cycles may be used, or even better do the denaturation step at 97C for 20 sec. One key ingredient was to include the MnCl 2 .
  • dtCoTP and dNTPs can vary the ratio of dtCoTP and dNTPs or use dtCTP in various ratios.
  • other PCR reagent compositions can include Co 2 in the metals, but in certain cases Mn 2 worked more efficiently as a catalyst in the reaction.
  • Other exemplary methods may include using 1 M betaine in a nucleic acid sequence synthesizing reaction.
  • Mn+2 was not needed when betaine was present in the PCR reaction.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Embodiments herein report compositions, methods and uses for cytosine triphosphate analogues. In some embodiments, cytosine triphosphate analogues can be used for generating high density fluorescent nucleic acid sequences for a variety of uses.

Description

COMPOSITIONS, METHODS AND USES FOR NUCLEOTIDE
ANALOGUES
RELATED APPLICATIONS
[0001] The present application claims the benefit under 35 U.S.C. § 119(e) of U.S. Provisional Patent Application Serial Nos. 61/242,579, filed September 15, 2009 and 61/262,054 filed November 17, 2009, which are incorporated herein by reference in their entirety for all purposes.
FEDERALLY FUNDED RESEARCH
[0002] Embodiments of the present invention were supported in part by grant numbers
GM54194 and A159764 awarded by the National Institutes of Health. The U.S. government has certain rights to the referenced invention.
FIELD
[0003] Embodiments herein report methods, compositions and uses for nucleotide analogues. Embodiments also generally report methods, compositions and uses of nucleotide analogues for generating detectible nucleic acid sequences. In certain embodiments, compositions and methods herein report synthesis of nucleic acid sequences of use for detection, amplification, and/or diagnosis. Certain embodiments report compositions and methods for amplification of target molecules. In other embodiments, compositions, methods and uses concern generating and using fluorescent cytosine analogues.
BACKGROUND
[0004] Many methods in molecular biology rely on the possibility to label nucleic acids with detectible markers or agents. Some applications for these labeled molecules include the visualization of PCR products, the analysis of base mutations, transcription and gene expression, in situ hybridization and four-color sequencing. In addition, tagged nucleotides can serve as analytical tools for example, for diagnosis or treatment of medical conditions, nucleotide cytochemistry and RNA aptamer development. SUMMARY
[0005] Some embodiments herein report generating highly fluorescent nucleic acids using nucleoside triphosphate analogues. Embodiments included herein also generally report methods, compositions and uses of nucleotide analogues for generating detectible nucleic acid sequences. In certain embodiments, compositions and methods herein concern synthesis of traceable nucleic acid sequences of use for detection, amplification, and diagnosis. Certain embodiments relate to compositions and methods for amplification of target molecules. In other embodiments, compositions, methods and uses concern generating and using fluorescent cytosine analogues.
[0006] Some embodiments herein concern generating tagged ribonucleotide analogues. In accordance with these embodiments, ribonucleotide analogues can be used as substrates for generating R A having a detectible nucleotide. Other embodiments concern uses for tagged or detectible DNA molecules using deoxyribonucleotide analogues incorporated into the molecules of interest. In yet other embodiments, compositions and methods disclosed herein can be used to generate detectible nucleic acid molecules using novel agents disclosed herein in combination with various polymerases and/or other reagents.
[0007] In certain embodiments, a large detectible probe may be generated using compositions and methods disclosed herein. In accordance with these embodiments, a large probe can be 100 bases or greater; 200 bases or greater or more. Detectible probes generated herein may be used for a variety of purposes including, but not limited to, experimental purposes (e.g. isolating or tracking target molecules), medical diagnosis, disease prognosis, disease staging (e.g. cancer or other disease), labeling and detection based on specificity of the probe and/or labeling and detection based on non-specific uses of large probes.
[0008] Some embodiments concern applications for target molecules that include, but are not limited to, visualization of amplification products, analysis of base mutations, transcription and gene expression, in situ hybridization and four-color sequencing. In addition, tagged nucleotides can serve as analytical tools including, but not limited to, diagnosis or treatment of medical conditions, nucleotide cytochemistry and RNA aptamer development. DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
Brief Description of the Figures
[0009] The following drawings form part of the present specification and are included to further demonstrate certain embodiments of the present invention. The embodiments may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
[00010] Figs. 1A-D represent comparisons between different DNA polymerases and different denaturation conditions.
[00011] Figs. 2 A and 2B represent electrophoretic gel analysis of PCR reactions catalyzed by a polymerase at different mixing ratios of cytosine and cytosine analogues.
[00012] Figs. 3A and 3B represent electrophoretic gel analysis of time courses for primer elongation past tCo-G and G-tCo base pairs.
[00013] Figs. 4A and 4B illustrate dequenching of fluorescence upon enzymatic digestion of PCR products.
[00014] Fig. 5 illustrates a gel shift assay demonstrating modulation in molecular mass of
PCR products as a cytosine analogue substitutes for cytosine.
[00015] Fig. 6 represents an exemplary electrophoresis gel demonstrating incorporation of a tagged ribonucleotide.
[00016] Fig. 7 represents an exemplary electrophoresis gel demonstrating competitive incorporation of ribonucleotides.
[00017] Fig. 8 represents an exemplary electrophoresis gel demonstrating competitive incorporation of ribonucleotides at various concentrations. [00018] Figs. 9 A and 9B represent large fluorescent RNA generated by transcription in the presence of CTP and tCTP at different concentrations. 9A and 9B represent nucleotides generated from two different sources.
DETAILED DESCRIPTION
[00019] In the following sections, various exemplary compositions and methods are described in order to detail various embodiments of the invention. It will be obvious to one skilled in the art that practicing the various embodiments does not require the employment of all or even some of the details outlined herein, but rather that concentrations, times, temperature and other details may be modified through routine experimentation. In some cases, well known methods or components have not been included in the description.
[00020] In accordance with embodiments of the present invention, there may be employed conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Second Edition 1989, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.; Animal Cell Culture, R. I. Freshney, ed., 1986).
[00021] Tagged nucleotides can be useful analytical tools that can include, but are not limited to, diagnosis or treatment of medical conditions, cytochemistry and tagging aptamers. Certain embodiments concern fluorescent DNA of high molecular weight as a tool for studying physical properties of DNA, DNA-RNA interactions and DNA-protein interactions. Other embodiments concern generating tagged RNA molecules of use as analytical tools as well as research purposes. In addition, tagged nucleic acid molecules can play an important role in modern biotechnology for DNA sequencing, analysis and detection. While several DNA polymerases were previously found capable of incorporating large numbers of dye-linked nucleotides into primed DNA templates, the amplification of the resulting densely labeled DNA strands by PCR (polymerase chain reaction) has been problematic.
[00022] Some embodiments herein report methods for high density labeling of nucleic acid molecules (e.g. single-stranded, double-stranded), hybrid nucleic acid molecules of
RNA/DNA, hybrid nucleic acid/protein or peptide molecules of use in biological methods. In certain embodiments, methods herein concern incorporating fluorescent analogues into DNA molecules. In accordance with these embodiments, methods may include PCR reactions using cytosine analogues. Cytosine analogues may include, but are not limited to, 5 '-triphosphate of 1, 3-diaza-2-oxo-phenoxazine (tCo), (l,3-diaza-2-oxo-thiazine) triphosphate (d(tC)TP) and/or 1,3- diaza-2-oxophenothiazine-ribose-5 '-triphosphate (tCTP). Certain embodiments disclosed herein concern using one or more of these cytosine analogues in compositions and/or synthesis methods disclosed herein. In accordance with some of these embodiments, one or more cytosine analogues may be used to generate a labeled nucleic acid molecule of interest. Co is a fluorescent cytosine analogue that absorbs and emits light at about 365 and about 460 nm, respectively. In some embodiments, using these molecules, amplification products were fluorescent enough to visualize them in a gel by excitation with long UV light, thus eliminating the need for staining. In some embodiments, one or more DNA polymerases known in the art may be used to generate an amplified product. In accordance with these embodiments, Deep Vent polymerase can be used alone or in combination in a reaction to generate amplified products. Because tCo can substitute for cytosine, for example, as a structurally similar molecule, labeling with these modified molecules can be less invasive than labeling with dye- linked nucleotides or radio label-linked nucleotides. Some embodiments relate to generating nucleic acid molecules suited for biophysical studies.
[00023] In certain embodiments, compositions and methods can include one or more analogues to dCTP or CTP alone or incombination with control dCTP and/or CTP. Some embodiments can include different ratios of analogues to dCTP or CTP in compositions and methods disclosed herein. In accordance with these embodiments, ratios of analogues contemplated herein may include, but are not limited to 1 : 1, 1 : 1.5, 1 : 1.67, 1 :2, 1:3, 1 :4, 1 :5, 1 :6, 1 :7, 1 :8 etc. Other ratios may include 1 : 19, 1 :29, 1 :39 or other predetermined ratio for a composition contemplated herein. In addition, some ratios may include more analogue than control dCTP or CTP depending on the conditions.
Figure imgf000007_0001
[00024] In certain embodiments, traceable agents such as fluorescent probes can serve many purposes. In accordance with these embodiments, fluorescent probes can serve as a environmentally friendly alternative to for example, radioactive markers. In addition, they can offer a range of physical properties that have inspired novel technologies for nucleic acid analysis. In certain embodiments, fluorescent probes can be used for real-time reaction probes in order to generate large quantities of labeled nucleic acids capable of being turned off or on due to for example, distance from a quenching agent or interruption in the sequence with an
intercalation agent. In some embodiments, fluorescent probes can serve as PCR probes that have been designed to switch between bright and dark states (detectable and undetectable states) in response to distance dependent fluorescent quenching or to intercalation of dyes into duplex DNA, R A or hybrid molecules (e.g. R A/DNA, PCA or other hybrid molecules). In certain embodiments, methods can be used for detection of single nucleotide polymorphisms that exploit spectral sensitivity of certain fluorescent probes to a specific base context. In addition, fluorescent probes can be used as a less invasive method for assessing a medical condition in a subject than for example, using a radioactive indicator. Some embodiments herein include introducing single-molecule DNA sequencing schemes using agents described herein, which can accelerate the pace of genomic research. In accordance with these embodiments, single molecule sequencing includes replacing one, two, three or all four nucleobases up to 100 % of the molecule by a fluorescent reporter in order to create a color-coded (e.g. fluorescent) nucleic acid sequence (e.g. DNA, RNA). In certain embodiments, a color-coded DNA sequence can be generated and then can be read backwards by digestion (e.g. exonuclease digestion) or forward by stepwise DNA synthesis. [00025] Some embodiments include other methods in molecular biology that can take advantage of fluorescent markers for generating detectible nucleic acid molecules. In certain embodiments, compositions and methods herein can include visualization of nucleic acid amplification products, analysis of base mutations, transcription and gene expression, in situ hybridization, and four-color DNA sequencing.
[00026] In other embodiments, nucleic acid synthesis methods may be used where a denaturation step of about high temperatures are included which can result in no loss of enzyme activity and generation of highly fluorescent probes detectible by excitation/visualization, (e.g excitation at 365 nm). In accordance with these embodiments, no staining is required for detection of the highly fluorescent probe. In some embodiment, highly fluorescent molecules generated by compositions and methods disclosed herein may be used in disease diagnosis, progression and prognosis in a subject. In accordance with these methods, other more invasive techniques may be avoided as well as avoiding the use of potentially carcinogenic agents/dyes.
B Family Polymerases
[00027] Certain embodiments disclosed herein describe methods and compositions using polymerases to generate modified nucleic acid sequences. Some embodiments include B family polymerases. B family polymerases can include, but are not limited to, DNA polymerase a, DNA polymerase δ, DNA polymerase ε, RB 69 DNA polymerase, DNA polymerase II (e.g. E. coli and other eubacteria), herpes DNA polymerase, T4 DNA polymerase, Phi29 DNA polymerase, Tgo DNA polymerase (thermostable), Pfu DNA polymerase (thermostable), Vent DNA polymerase, Deep vent DNA polymerase and other polymerases known in the art. B family DNA polymerases are defined by a series of conserved amino acid sequences. A B family DNA polymerase may contain all or a subset of these sequences. In certain embodiments,
compositions and methods disclosed herein can include one or more polymerases in a given nucleic acid synthesis reaction. In some embodiments, one polymerase may catalyze a reaction more readily than another. In accordance with these embodiments, Vent DNA polymerase may be used under conditions where other polymerases may not perform as efficiently or effectively. Other compositions and methods disclosed herein may use two or more polymerases in order to induce synthesis of a nucleic acid sequence relative to a composition with only one polymerase. A Family Polymerases
[00028] Other embodiments can include methods and compositions including one or more
A Family polymerases for synthesis of target nucleic acid molecules having a fluorescent probe or other nucleic acid molecules disclosed herein. A Family polymerases can contain both replicative and repair polymerases. Replicative members from this family can include, but are not limited to, T7 DNA polymerase, as well as the eukaryotic mitochondrial DNA Polymerase γ among others. Repair polymerases can include, but are not limited to, E. coli DNA pol I, Thermus aquaticus pol I (e.g. heat-resistant enzyme Taq DNA Polymerase), Bacillus
stearothermophilus pol I and other polymerases.
[00029] In certain embodiments, reagent formulations are disclosed that may be more suited for use with one or more polymerases versus other reagent formulations. Other embodiments may include reagent supplementation or substitution depending, for example, on the polymerase chosen for a particular target nucleic acid synthesis. In some embodiment, betaine may be replaced in sequencing reactions under certain synthesis conditions. In accordance with these embodiments, a reagent combination used in the presence of the DNA polymerase Taq may include dtCoTP at various concentration ratios with control dCTPs and/or dtCTPs in the presence of one or more of manganese chloride (MnCl2) and magnesium chloride. (MgCl2). Some embodiments can include betaine without manganese chloride in a reaction having Taq polymerase and at least one fluorescent nucleotide to produce a target nucleic acid sequence. Yet other embodiments may include various DMSO concentrations, alone or in combination with one or more of betaine, MnCl2 and MgCl2 or other reagent, in nucleic acid synthesis compositions such as those used in PCR reactions or other synthesis methods known in the art. In some embodiments, nucleic acid synthesis compositions may be void of glycerol in the presence of one or more polymerases. In certain embodiments, nucleic acid synthesis compositions using Taq polymerase may contain betaine as one reagent at
concentrations appropriate for a synthesis reaction, but not glycerol.
RNA
[00030] In some embodiments, RNA cytochemistry may be used by introducing fluorescent RNA into cells using, for example, microinjection or in vivo hybridization of fluorescent nucleic acids to endogenous RNAs. In accordance with these embodiments, a transit path of the labeled RNA can be visualized. In certain embodiments, visualization may be by fluorescent microscopy or other fluorescent detecting device. In other embodiments, DNA, RNA or hybrid aptamers, short nucleic acids that bind ligands with high affinity and specificity, can be generated using tagged or labeled nucleotides disclosed herein. Aptamers are comparable to antibodies. Detectible aptamers have been used in diagnostic assays, including, but not limited to, ELISA, Western blotting, microarrays, capillary electrophoresis and flow cytometry. In certain embodiments, fluorescent RNA aptamers can be synthesized to various lengths by direct solid-phase synthesis. For example, the fiuor can be attached to a terminal position to avoid potential negative effects of internal labeling on the aptamer activity. In some embodiments, to reduce or exclude potential issues of dye interference, approaches have been developed to attach an additional RNA domain to the aptamer of interest, such as malachite green, which becomes fluorescent in response to ligand binding. In other embodiments, labeling of longer RNA can be accomplished enzymatically by transcription with an RNA polymerase such as, T7 RNA polymerase, in the presence of fluorescent ribonucleotides or of initiator nucleotides, such as guanosine monophosphothioate. The latter can results in site-specific modification of the 5 '-end of the molecule that can be rendered fluorescent via subsequent coupling to a fluorescent dye.
[00031] In other embodiments, methods herein concern incorporating fluorescent analogues into other RNA molecules. In accordance with these embodiments, methods may include reactions capable of incorporating a ribonucleotide analogue into a nucleic acid molecule. For example, an RNA analogue, l,3-diaza-2-oxophenothiazine-ribose-5 '-triphosphate (tCTP) may be used. tCTP is a fluorescent cytosine analogue that absorbs and emits light at about 365 and about 460 nm, respectively. Using RNA analogues, amplification products can be fluorescent enough to visualize them in a gel by excitation with long UV light, thus eliminating the need for staining. In some embodiments, RNA polymerase can be used in a reaction to generate amplified products. Because tCTP can substitute structurally for cytosine, this labeling method can be less invasive than labeling with dye-linked nucleotides and therefore produces nucleic acid molecules suited for biophysical studies. R A Polymerases
[00032] Some embodiments can include RNA polymerases (RNPs) of use for example, to incorporate fluorescent analogues in nucleic acid sequences disclosed herein. RNPs can include, but are not limited to, T7 RNA polymerase, RNA polymerase I, RNA polymerase II, RNA polymerase III and any other RNA polymerase known in the art.
Nucleic Acids
[00033] In various embodiments, isolated nucleic acids can be used for generating nucleic acid sequences. Isolated nucleic acid may be derived from genomic RNA, genomic DNA, or complementary DNA (cDNA) of use in some embodiments herein. In other embodiments, isolated nucleic acids, such as chemically or enzymatically synthesized DNA, may be of use for probes, primers and/or labeled detection oligonucleotides.
[00034] A "nucleic acid sequence" can include single-stranded and double-stranded molecules, as well as DNA, RNA, chemically modified nucleic acids and nucleic acid analogues. It is contemplated that a nucleic acid may be of 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, about 1 10, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190, about 200, about 210, about 220, about 230, about 240, about 250, about 275, about 300, about 325, about 350, about 375, about 400, about 425, about 450, about 475, about 500, about 525, about 550, about 575, about 600, about 625, about 650, about 675, about 700, about 725, about 750, about 775, about 800, about 825, about 850, about 875, about 900, about 925, about 950, about 975, about 1000, about 1 100, about 1200, about 1300, about 1400, about 1500, about 1750, about 2000 or greater nucleotide bases in length, up to a full length protein encoding or regulatory genetic element. In certain embodiments, a nucleic acid sequence can be about 10 nucleotides or more, or 20 nucleotides or more, or 30 nucleotides or more, or 40 nucleotides or larger. In certain embodiments, a nucleic acid sequence may be 200 bases or longer (e.g. for generating a highly fluorescent probe). In accordance with these embodiments, a large fluorescent probe may be generated using compositions and methods disclosed herein where detection may be by UV excitation/ visualization for rapid identification.
Construction of Nucleic Acids
[00035] Nucleic acid sequences may be made by any method known in the art, for example using standard recombinant methods, synthetic techniques, or combinations thereof. In some embodiments, the nucleic acids may be cloned, amplified, or otherwise constructed, for example, incorporating cytosine analogues described herein.
Recombinant Methods for Constructing Nucleic Acids
[00036] Isolated nucleic acids may be obtained from tissue samples or other sources using any number of cloning methodologies known in the art. In some embodiments, oligonucleotide probes which selectively hybridize, under stringent conditions, to the nucleic acids of a tissue sample. Methods for construction of nucleic acid libraries are known and any such known methods may be used.
Nucleic Acid Screening and Isolation
[00037] RNA or cDNA may be screened for the presence of an identified genetic element of interest using a probe based upon one or more sequences. Various degrees of stringency of hybridization may be employed in the assay. As the conditions for hybridization become more stringent, a greater degree of complementarity between the probe and the target may be needed for duplex formation to occur. The degree of stringency may be controlled by temperature, ionic strength, pH and/or the presence of a partially denaturing solvent such as formamide. For example, the stringency of hybridization can be conveniently varied by changing the
concentration of formamide within the range up to and about 50%. The degree of
complementarity (sequence identity) required for detectable binding can vary in accordance with the stringency of the hybridization medium and/or wash medium. In certain embodiments, the degree of complementarity can optimally be about 100 percent; but in other embodiments, sequence variations in the RNA may result in <100% complementarity, <90% complimentarity probes, <80% complimentarity probes, <70% complimentarity probes or lower depending upon the conditions. In certain examples, primers may be compensated for by reducing the stringency of the hybridization and/or wash medium.
[00038] High stringency conditions for nucleic acid hybridization are well known in the art. For example, conditions may comprise low salt and/or high temperature conditions, such as provided by about 0.02 M to about 0.15 M NaCl at temperatures of about 50°C to about 70°C. Other exemplary conditions are disclosed in the following Examples. It is understood that the temperature and ionic strength of a desired stringency are determined in part by the length of the particular nucleic acid(s), the length and nucleotide content of the target sequence(s), the charge composition of the nucleic acid(s), and by the presence or concentration of formamide, tetramethylammonium chloride or other solvent(s) in a hybridization mixture. Nucleic acids may be completely complementary to a target sequence or may exhibit one or more mismatches.
Nucleic Acid Amplification
[00039] Nucleic acid sequences of interest may also be amplified using a variety of known amplification techniques. In certain embodiments, target nucleic acid sequences may be generated that are traceable using one or more traceable nucleotide. For instance, polymerase chain reaction (PCR) technology or other amplification technique may be used to amplify target sequences directly from a target RNA or cDNA sample. PCR and other in vitro amplification methods may also be useful, for example, to clone nucleic acid sequences, to make nucleic acids to use as probes for detecting the presence of a target nucleic acid in samples, for nucleic acid sequencing, or for other purposes. Some other techniques that can be of use for some
embodiments include, Rolling circle amplification, NEAR, developed by Ionian Technologies, Recombinase Polymerase Amplification, developed by TwistDx or other techniques known in the art.
Synthetic Methods for Constructing Nucleic Acids
[00040] Isolated nucleic acids may be prepared by direct chemical synthesis by methods such as the phosphotriester method, or using an automated synthesizer. Chemical synthesis generally produces a single stranded oligonucleotide. This may be converted into double stranded DNA by hybridization with a complementary sequence or by polymerization with a DNA polymerase using the single strand as a template. Nucleic acid sequences having cytosine analogues may be generated using isolated sequences as a template for generating a high density fluorescent molecule.
Kits
[00041] In certain embodiments, a kit contemplated herein may include compositions for generating high density fluorescent nucleic acids, hybrid nucleic acid molecules, nucleic acid- protein or nucleic acid-peptide. Contemplated herein are methods for making and using a kit for analysis of or generation of such molecules. The kits can include one or more containers. In addition, one or more reagents may be part of a kit. Any of the kits will generally include at least one vial, test tube, flask, bottle, syringe or other container, into which compositions, may be preferably and/or suitably aliquoted. Kits herein may also include an apparatus for analyzing or assessing presence of an end molecule, for example detecting or analyzing a high density fluorescent molecule produced by a kit. In certain embodiments, a kit may contain one or more fluorescent cytosine or cytosine nucleotides disclosed herein. Some kits may contain one or more control samples.
EXAMPLES
[00042] The following examples are included to illustrate various embodiments. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent techniques discovered to function well in the practice of the claimed methods, compositions and apparatus. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes may be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
Example 1
[00043] PCR reactions under optimized denaturation conditions. First, the ability of Deep
Vent exo- and Taq pol to produce a 560 base pair long PCR fragment in the presence of various mixing ratios of dtCoTP and dCTP were compared. The gene amplified codes for the beta chain of human hemoglobin and has a GC content of 53 %. The template was chosen arbitrarily without consideration of the exact base sequence. As previously described, the reactions were largely performed under standard conditions, using 200 μΜ of each dNTP, with [dtCoTP] + [dCTP] = 200 μΜ in cases where dtCoTP substituted for dCTP. In initial experiments, the PCR samples were denatured at 95°C for 45 sec. Figs. 1 A and B illustrate agarose gels of the PCR products obtained with Taq and Deep Vent pol as increasing amounts of dCTP were replaced by dtCoTP. Before staining of the gels with ethidium bromide, the gels were exposed on a 365 nm trans-illuminator to detect the tCo emission. At this wavelength, the DNA ladder or the positive control containing only 200 μΜ dCTP were not visible however, the PCR products obtained in the presence of moderate to high dtCoTP concentrations were clearly visible. Reactions catalyzed by Taq pol did not result in PCR product for dtCoTP concentration > 10 μΜ, whereas Deep Vent pol tolerated dtCoTP concentrations up to 50 μΜ.
[00044] In other methods, failure of PCR reactions at relatively low dtCoTP concentrations did not agree with previous kinetics study of the Klenow fragment and human pol a. Those polymerases inserted dtCoTP with higher efficiency than dCTP and they were even able to polymerize past tCo repeats, (previously presented). Presence of a single tCo-G base pair can increase the melting temperature of a 10 base pair duplex on average by 3 °C, and hence the accumulation of tCo may stabilize the DNA to an unusual degree. Therefore, the denaturation step was focused on as a possible cause for the outcome of the reactions. Repeating the reactions using a denaturation step at 99 °C/45 sec, PCR products up to dtCoTP concentrations of 75-100 μΜ (Fig. 1C) were obtained. While prolonging the denaturation step had no effect on the product distribution, further optimization was observed in the PCR reactions by adding 15 % glycerol, a molecule that is known to lower the melting temperature of DNA (Fig. ID). The addition of other chemicals of this type, such as formamide and dimethylsulfoxide, had a similar effect on the yield of the reactions (data not shown).
[00045] In certain compositions and methods, Deep Vent polymerase was capable of replacing about 50 % of all cytosines with analogue, tCo, or about 60% or more assuming dCTP and dtCoTP were incorporated with equal efficiency, and that the reactions are limited by the melting temperature of the resulting PCR product rather than by the substrate specificity of this pol over a wide range of dtCoTP concentrations. In case of Taq pol however, PCR products were not obtained when more than 10% of the total amount of dCTP was replaced by dtCoTP. In other embodiments, nucleic acid synthesis methods may be used where a denaturation step of about 99 degrees Celsius is included which can result in no loss of enzyme activity and generation of highly fluorescent probes detectible by excitation/visualization, (e.g excitation at 365 nm). In accordance with these embodiments, no staining is required for detection of the highly fluorescent probe, saving time and money. In some embodiment, highly fluorescent molecules generated by compositions and methods disclosed herein may be used in disease diagnosis and prognosis in a subject. In accordance with these methods, other more invasive techniques may be avoided as well as avoiding the use of potentially carcinogenic agents/dyes.
[00046] Variation of the number of amplification cycles. In it contemplated that it is possible to obtain PCR product by only amplifying the original template but not the tCo modified amplification product {e.g., linear PCR). The product yield would be low because every amplification cycle may only double the amount of starting template. However, conventional PCR can potentially double the total amount of DNA strands with every cycle, which causes the amount of amplification product to grow exponentially until the reaction mixture is depleted of primer DNA, dNTPs or the polymerase loses activity. Depending on the amount of starting template, PCR reactions typically level off after 30 - 40 cycles. To explore if the dtCoTP containing PCR reactions match this exponential pattern, the amount of DNA product obtained after 10, 20, 30 and 40 cycles was examined, using different mixing ratios of dtCoTP and dCTP (Fig. 3). As long as primer strands are abundant, the amount of PCR product should increase significantly with the number of PCR cycles. Fig. 2 illustrates the amount of product increased dramatically between 10 and 20 cycles, whereas little or no change was observed between 30 and 40 cycles. In one observation, dependence on the number of amplification cycles is similar for reactions with and without dtCoTP, suggesting that tCo-containing DNA is replicated with similar efficiency as unlabeled DNA. It appears that both the original template and the labeled DNA fragments are amplified to a similar extent.
[00047] Kinetic parameters for dtCoTP incorporation by Taq and Deep Vent pol and templating properties of tCo were analyzed. Next the kinetic parameters were determined for the incorporation of dtCoTP and dCTP across a template G by Taq and Deep Vent pol in competitive primer extension assays. Knowing the relative catalytic efficiencies would i) allow us to approximate the tCo labeling density of the PCR product at a given ratio of free dtCoTP and dCTP and ii) possibly explain why Taq pol performs worse in the PCR reactions.
[00048] According to the relative catalytic efficiencies listed in Table 1 , Deep Vent pol is
1.5-times more likely to choose dtCoTP over dCTP. Thus, at the highest dtCoTP/dCTP ratio (5/3) that produces PCR product (Fig. 1 D), around 71 % of the C's should be substituted by tCo. Taq pol prefers the nucleotide analogue even by a factor of 7.7. However, although Taq pol incorporates dtCoTP efficiently at first, significant pausing is observed at the primer + 2 position when all nucleotides are present to copy the template (Fig. 3 and Table 3). By contrast Deep Vent pol reads through a tC-G base pair just as well as through a C-G base pair.
[00049] Examination of the templating properties of tCo reveals one more reason why the
PCR reaction with Taq pol may have reduced efficiency. Although both pols insert dGTP across from tCo fairly specifically, they do it with more or less impaired efficiency. While Deep Vent pol forms the G-tCo base pair ~20-times less efficiently than the G-C pair, the difference is ~100-times for Taq pol. This suggests that the extension times lengthen significantly when DNA with high tCo density is copied.
[00050] In these examples, inferior performance of Taq pol may be explained by the enzyme's preference for incorporating the nucleotide analogue, which is followed by subsequent pausing, and paired with the inability to translate tCo when encountered in the template.
Example 2
[00051] In another exemplary method, fluorescence quenching of tCo in duplex DNA was examined. Collision quenching is a common phenomenon for dyes that are tethered to DNA via carbon chains because the flexibility of the linkers allows the dyes to contact each other at high labeling density. Because the emission of most fluorescent base analogues is strongly quenched in an unmodified DNA duplex, very little is known about possible quenching mechanisms that may operate between identical fluorescent base analogues in a duplex. The base analogue tCo can be used to study quenching mechanisms, which may be mediated through the base stack of duplex DNA, because its fluorescence quantum yield is remarkably stable and fluctuates marginally in proximity to the natural bases. As a consequence, any fluorescence quenching observed originates from cross-interaction and/or interference of tCo molecules with each other. To find out if tCo is subject to self-quenching, a mixture of DNAse I and Exonuc lease I was used to degrade PCR products and the fluorescence change after enzyme addition as a function of time was monitored (Fig. 4 A). DNAse I is a non-specific endonuclease that randomly cleaves DNA to release di, tri and longer oligonucleotides. Exonuclease I removes mononucleotides from single-stranded DNA in 3 '-5 ' direction. Fig. 4A illustrates that substantial dequenching occurs and that it scales with increasing labeling density of the PCR products. That the labeling density really increases with increasing concentrations of free dtCoTP in the PCR reactions is confirmed by the upward shift of the PCR products in native polyacrylamide gels (Fig. 5). The mass increase may be attributed to the fact that tCo is heavier than C. In this example, the amount of dequenching peaks at 250 % for the PCR products generated in the presence of 75 μΜ dtCoTP. Dequenching is less pronounced for the reaction with 100 μΜ dtCoTP, suggesting, among other reasons, that the enzymes are less efficient at digesting densely tCo labeled DNA. Overall the quenching is remarkably high, even at dtCoTP concentrations that are expected to result in low labeling densities. For example, at 25 μΜ dtCoTP only between 1/8-1/4 of all natural C's should be replaced by tCo and yet, all tCo's are quenched by 50 % on average. Neglecting the possibility of collision quenching due to coiling of the DNA strands, this suggests the existence of DNA-mediated long distance quenching. The assumption of such a mechanism is plausible as many examples of DNA-mediated electron transfer are known today that are contingent on proper base stacking of the probe. In one example, the well base stacked fluorescent base analogue 2-aminopurine is strongly quenched in duplex DNA by photoinduced electron transfer from guanine, whereas electron transfer to the poorly stacked fluorophore ethenoadenine is about 10-times worse. The absence of photoinduced electron transfer from guanine to tCo despite the tight base stacking of tCo possibly indicates that tCo has a higher oxidation potential than guanine.
[00052] In other examples, possible mutagenic properties of tCo were examined.
Recently, Klenow and DNA pol a base-pair tCo were reported as almost ambivalently with G and A, whether tCo is located in the primer or in the template strand. This observation was interpreted as an indication for the existence of the imino tautomer of tCo, since this form is isosterical to T and as such would be capable of forming a Watson-Crick base pair with A. Consistent with these results, both thermophilic pols show a trend for misinserting dtCoTP across a template A (Table 1). Deep Vent polymerizes dTTP 10-times more efficiently than dtCoTP across from A, whereas Taq pol prefers dTTP only by a factor of 3 (Table 1). At the high dTTP concentrations used in the PCR reactions (200 μΜ) the risk of Deep Vent pol synthesizing tCo-A mismatches is low. However, it cannot be entirely excluded at high dtCoTP concentrations and the failure of the PCR reactions at full substitution of dCTP with dtCoTP may well be due to tCo-A mismatches rather than due to the inability of Deep Vent pol to read through tC-G repeats. For instance, at a dtCoTP/dTTP ratio of 1/2, around 5 % of all T-A base pairs would be mutated to tCo-A base pairs, which is equivalent to ~7 errors in a 560 nt single strand.
[00053] In contrast to Klenow and DNA pol a, Deep Vent and Taq pol discriminate clearly against dATP when tCo is in a templating position, whereby both pols prefer the insertion of dGTP over the insertion of dATP by a factor of ~ 25 (Table 2). This suggests that the active site of these enzymes exhibits a feature that does not allow the A-tCo base pair to align in Watson-Crick geometry, such as stringent amino acid contacts to the major groove face of the templating base. In any circumstance, formation of A-tCo base pairs is probably not a mechanism that contributes to the negative outcome of PCR reactions.
[00054] Other examples concern methods for incorporation of the fluorescent nucleotide analogue dtCoTP into large DNA fragments by means of PCR. PCR reactions rely on the use of an extremely thermostable B family DNA polymerase, Deep Vent exo-, which allows conducting the PCR reactions with a denaturation step at 99 °C without loss of enzyme activity. The resulting DNA fragments are highly fluorescent and can be visualized in a gel by excitation at 365 nm, thus obviating the need for staining of the DNA bands with cancerogenic DNA intercalating dyes.
[00055] In addition, these labeling methods are expected to have low impact on DNA solubility, on the mechanical properties of DNA in terms of bending, coiling and viscosity and on the ability of proteins to interact with DNA site-specifically or by linear diffusion along the DNA duplex. [00056] Figs. 1A-1D illustrates a comparison between different DNA polymerases and different denaturation conditions. The PCR products obtained after 40 cycles were analyzed by agarose gel electrophoresis and the DNA bands were either visualized by excitation at 365 nm (top rows) or by staining with ethidium bromide (bottom rows). A) Taq pol. Denaturation at 95 °C/ 45 sec. B) Deep Vent pol. Denaturation at 95 °C/45 sec. C) Deep Vent pol. Denaturation at 99 °C/ 45 sec. and D) Deep Vent pol. Denaturation in the presence of 15 % glycerol at 99 °C /45 sec.
[00057] Figs. 2A and 2B represent electrophoretic gel analysis of PCR reactions catalyzed by Deep Vent pol at different mixing ratios of dCTP and dtCoTP. Reactions were performed using either 10 or 20 amplification cycles. The top row displays the PCR fragments prior to staining with ethidium bromide; visualization is accomplished by exciting incorporated tCo at λ = 365 nm. All reactions were performed in the presence of 15 % glycerol, using denaturation at 99 °C/45 sec.
[00058] Figs. 3A-3B represent gel electrophoretic analysis of time courses for primer elongation past tCo-G and G-tCo base pairs.
[00059] Figs. 4 A and 4B illustrate dequenching of tCo fluorescence upon enzymatic digestion of PCR products. PCR products were gel purified and treated with a mixture of DNAse I and Exonuclease I. A) Time course of fluorescence dequenching as DNA is broken down into tri-, di- and mononucleotides. PCR reactions were carried out using the dtCoTP concentration indicated in the figure. B) Representative fluorescence spectra of the DNA fragment obtained with 75 μΜ dtCoTP before (blue line) and after treatment with the enzyme cocktail (blue line with dots).
[00060] Fig. 5 illustrates a gel shift assay demonstrating the increase in molecular mass of the PCR product as tCo substitutes for cytosine. Table 1 : Relative catalytic efficiency for the incorporation of dtCoTP across G and A
Figure imgf000021_0003
Figure imgf000021_0001
Table 2: Kinetic parameters for the insertion of natural dNTPs across tCo
Figure imgf000021_0004
Table 3: Efficiency of polymerization past tCo-G and G-tCo base pairs
Figure imgf000021_0002
Table 3, cont.
Figure imgf000022_0001
Table 4: Quantum yields of tCo-containing oligonucleotides.
Figure imgf000022_0002
a The quantum yield standard was quinine sulfate in 0.1 M H2SO4 (QY = 0.55). Measurements were performed in 0.5 x phosphate buffered saline at room temperature and the data show the average of three independent measurements. [00061] Materials and Enzymes. Unlabeled dNTPs were from Invitrogen and P-labeled NTPs from Perkin Elmer Life Sciences. The l,3-diaza-2-oxo-phenoxazine nucleoside was synthesized according to Matteucci et al. and converted into the 5 '-triphosphate following the procedure by Ludwig. The concentration of dtCoTP was determined based on the absorption of tCo at 260 nm (stCo = 11,000 M"1 cm 1). Taq DNA pol was purchased from Invitrogen, Deep Vent exo- pol from New England Bio labs, DNAse I was from New England Bio labs, Exonuclease I from USB Affimetrix. The PCR primers and other oligonucleotides were synthesized by Integrated DNA Technology and the plasmid coding for the globin protein is available and was a provided here.
[00062] PCR reactions and analysis. The 560 bp DNA fragment coding for the beta chain of human hemoglobin was amplified using the following primers:
5'GTACGGTGGGAGGTCTATAT 3' (forward primer) (SEQ ID NO:l)
5'ACCACTTTCTGATAGGCAGC 3' (reverse primer) (SEQ ID NO:2).
[00063] The reactions contained the reaction buffers and Mg2+ concentrations recommended by the suppliers of the DNA polymerases. For Deep Vent exo- pol: 10 mM KCl, 10 mM (NH4)2S04, 20 mM Tris-HCl pH 8.8, 2 mM MgS04, 0.1 % Triton X-100. For Taq pol: 20 mM Tris-HCl pH 8.4, 50 mM KCl, 1.5 mM MgCl2. In addition, the reactions contained 200 μΜ of each dNTP, 500 nM forward and reverse primer, 140 ng template and either 1 unit Deep Vent pol or 2.5 units Taq pol. The sum of dtCoTP and dCTP concentration always equaled 200 μΜ. The total volume of each PCR reaction was 50 μί. A standard temperature protocol for reactions containing 15 % glycerol was as follows: Step 1 : 94 °C/4 min; step 2: 95 °C/45 sec; step 3: 52 °C/30 sec; step 4: 73 °C/2 min; step 5: 99 °C/45 sec; step 6: 55 °C/30 sec; step 7: 73°C/2 min; go to step 5: 40-times; final elongation: 73 °C/20 min. The lower annealing temperature (step 3) was used in the first cycle to account for the lower melting temperature of tCo-free DNA. The reactions were performed using an Eppendorf Mastercycler. The PCR reactions were analyzed using mini 1.2 % standard agarose gels with 0.5 x TAE buffer. The gels were either exposed at 365 nm or at 254 nm after staining of the DNA bands with ethidium bromide.
[00064] Analysis of PCR products by native gel electrophoresis. To monitor the increase in molecular mass of the PCR products due to incorporation of increasing dtCoTP
concentrations, we repeated the PCR reactions using 32P-labeled forward and reverse primers. Aliquots of the PCR reactions were mixed with 6x gel loading buffer (40 % sucrose) and loaded onto a 7 % polyacrylamide, lx TBE gel. The gel was dried and the DNA bands visualized by phosphor imaging.
[00065] Enzymatic digest of PCR products. 10 μΐ^ οΐ each PCR reaction were analyzed on a 1.2 % agarose gel, the DNA bands were visualized by long UV excitation and the bands of interest excised. The excised DNA bands were subsequently worked up using a QiaQuick gel extraction kit (Qiagen), resulting in 30 solution of DNA in 10 mM Tris-HCl pH 8. 10 of this solution were added to 110 1 x DNAse buffer (10 mM Tris-HCl pH 7.6, 2.5 mM MgCl2 and 0.5 mM CaCl2). DNA degradation was initiated by addition of lunit DNAse I and 10 units Exonuclease I at room temperature. Using a steady-state fluorimeter (Quantamaster from Photon Technology International), fluorescence emission spectra was recorded before and after DNA digestion using an excitation wavelength of 345 nm. To measure the time courses of
fluorescence dequenching the excitation wavelength was set to 345 nm, the emission to 460 nm.
Determination of kinetic parameters
[00066] 5'-Labeling of primer strands. DNA primers were 5'-32P-labeled using T4 polynucleotide kinase (New England Biolab) and [γ-32Ρ]ΑΤΡ. The labeled primer was gel- purified and annealed to the appropriate template strands.
[00067] Polymerization assays. All assays were conducted using 0.5 μΜ 5'- 32 P- primer/template and between 0.3 and 300 μΜ natural or analogue dNTP, depending on the particular assay. Four different primer/template sequences were used: The reaction buffers were 10 mM KC1, 10 mM (NH4)2S04, 20 mM Tris-HCl pH 8.8, 2 mM MgS04, 0.1 % Triton X-100 and 0.05 mg/ml bovine serum albumin for Deep Vent exo- pol, and 20 mM Tris-HCl pH 8.4, 50 mM KC1, 1.5 mM MgCl2 and 0.05 mg/ml bovine serum albumin for Taq pol. The total reaction volume was either 5 or 10 μΐ^. Polymerization was initiated by mixing equal volumes of reaction mixture and enzyme followed by incubation at 37°C. The enzyme concentrations used for the determination of the Michaelis-Menten parameters Vmax and KM were 0.0125 units^L Taq pol and 0.0005 units^L Deep Vent pol, respectively. To obtain a Michaelis-Menten curve primer elongation was performed with a series of dNTP concentrations and all reactions were stopped after the same amount of time, such that primer extension was below 20% for all dNTP concentrations. To stop the reactions two volumes gel loading buffer (90 % formamide with 50 mM EDTA) were added. The extension products were separated by denaturing gel
electrophoresis (20 % polyacrylamide, 8 M urea) and analyzed by phosphor imaging (Typhoon scanner, Molecular Dynamics). The parameters Vmax and KM were obtained by plotting the amount of primer extension as a function of dNTP concentration and subsequent non-linear curve fitting of the data points using the Michaelis-Menten equation.
[00068] Competitive single nucleotide extension assays. To measure the competitive insertion of dCTP and dtCoTP across G, assays contained DNAG and in total 100 μΜ dNTP. The mixing ratio of dCTP and dtCoTP was varied in steps of 10 μΜ, i. e. 10 μΜ dCTP and 90 μΜ dtCoTP, 20 μΜ dCTP and 80 μΜ dtCoTP etc. Deep Vent pol was employed at a concentration of 0.001 units^L, Taq pol at 0.05 units^L and the reaction mixtures were stopped after 5 and 10 minutes, respectively. After quantifying the fraction of primer that had been extended by tCo or by C, the relative kcat/KM values were determined graphically using the following equation: 1 [dtCoTP] , with fraction dNTP being the amount of fractiondNTP [dCTP]
Figure imgf000025_0001
primer extended by C in this case. Analogous experiments were performed with DNAA and mixtures of dtCoTP and dTTP.
[00069] Read through assays. The reactions contained 0.5 μΜ of the designated [ P]- primer/template, 25 μΜ of each dNTP and 0.0125 units^L Taq pol or 0.0005 units^L
DeepVent pol, respectively. 2 μΐ, aliquots were removed from the master mix after 5, 10, 20 and 30 min and quenched with two volumes of 90 % formamide with 50 mM EDTA. Analysis of the reaction products was conducted by denaturing gel electrophoresis as described above.
[00070] DNA(A) 5'-TCCATATCACAT (SEQ ID NO: 17)
3 '-AGGTATAGTGTAACTCTTATCATCT (SEQ ID NO: 18)
DNA(C) 5 '-TCCATATCACAT (SEQ ID NO: 17)
3'AGGTATAGTGTACTTCTTATCTATCT (SEQ ID NO: 19) DNA(G) 5 CCATATCACAT (SEQ ID NO: 17)
3 '-AGGTATAGTGTAGCTCTTATCTATCT (SEQ ID NO: 20)
DNA (tCo) 5 'TCCATATCACAT (SEQ ID NO: 17)
3 '-AGGTATAGTGTA (tCo) ATCTTATCTATCT (SEQ ID NO: 21)
Example 3
[00071] In another exemplary method, a fluorescent ribonucleotide analogue l,3-diaza-2- oxophenothiazine-ribose-5 '-triphosphate (tCTP) was synthesized and tested as a substrate for T7 RNA polymerase (T7 RNAP) in transcription reactions, a convenient route for generating RNA in vitro. When transcribing a guanine, T7 RNA polymerase incorporates tCTP with about a 2- fold higher catalytic efficiency than CTP and efficiently polymerizes additional NTPs onto the tC. Unexpectedly, T7 RNA polymerase does not incorporate tCTP with the same ambivalence opposite guanine and adenine with which DNA polymerases incorporate the analogous dtCTP. While several DNA polymerases discriminated against a d(tC-A) base pair only by factors < 10, discrimination factors of 40 and 300 for tCTP-A base pair formation by T7 RNA polymerase operating in the elongation and initiation mode, respectively were observed. These catalytic properties make T7 RNA polymerase advantageous for synthesizing large fluorescent RNA, as demonstrated by generating an 800 nucleotide RNA, in which every cytosine was replaced with tC. ((also see: Stengel, G., Urban, M., Purse, B. W., and Kuchta, R. D. (2009) "Incorporation of the Fluorescent Nucleotide Analogue tCTP by T7 RNA Polymerase" (Submitted to Analytical Chemistry), incorporated herein by reference in its entirety).
[00072] In one method, site-specific incorporation of l,3-diaza-2-oxophenothiazine- ribose-5 '-triphosphate (tCTP) opposite guanine in transcription reactions with T7 RNA polymerase (T7 RNAP) was performed. Transcription of DNA by T7 RNA polymerase takes place in two phases, initiation and elongation. During the initiation phase, T7 RNAP binds tightly to the promoter sequence via its N-terminal promoter binding domain, opens the DNA duplex and feeds the template into the active site. In this mode, ribonucleotide synthesis frequently results in abortive RNA products that do not exceed 8-10 bases. Subsequently, T7 RNAP releases the promoter sequence and enters the elongation mode. Transcription becomes highly pro cessive and efficiently produces full length transcripts. [00073] tC is a tricyclic cytosine analogue that absorbs light at 375 nm (ε375 = 4,000 M" cm"1) and fluoresces intensely in single- and double-stranded DNA at 505 nm (φΡ = 0.2). dtCTP is a good substrate for several A and B family DNA polymerases. The analogue is incorporated with high catalytic efficiency opposite a template guanine, but also to a significant extent opposite a template adenine. The DNA polymerases efficiently extended a d(tC-G) base pair, whereas d(tC-A) base pairs primarily resulted in chain termination. Ambivalence of dtCTP incorporation may be due to the propensity of N4-substituted cytidine analogues for forming the imino-tautomer, which is isosteric to thymine (Chart 1). Despite the somewhat mutagenic properties of dtCTP, large fluorescent DNA were produced in polymerase chain reactions (PCR). However, a lower percentage of the C's were replaced with dtC in these experiments.
[00074] Catalytic efficiency of tCTP incorporation by T7 RNAP was assessed using synthetic DNA templates of defined sequence, using for example templates which contained a unique G or A either within the initiation region or at a remote site. Both in the elongation and initiation mode, T7 RNAP polymerized tCTP with high catalytic efficiency across from a template G. Notably, T7 RNAP appears to be more discriminative against tC-A mismatches than DNA polymerases are against d(tC-A) mismatches. To demonstrate the merit of tCTP for RNA labeling, large, 100% tC-labeled RNA were produced by transcribing an 800 base pair DNA sequence, using tCTP in place of CTP.
Figure imgf000027_0001
tC amino
tautomer
[00075] Chart 1 illustrates base pairing of the tC amino and the tC imino tautomer.
[00076] tCTP incorporation opposite a template guanine. In one example, T7 RNAP was used to incorporate nucleotide analogues because it possesses different catalytic properties during the initiation and elongation phases of RNA synthesis. Here, tCTP was examined during both phases by using two different synthetic DNAs. Both DNAs consisted of the 18 nucleotide (nt) T7 promotor hybridized to a complementary 37 nt DNA template (Fig. 6). Transcription usually starts at the underlined C and proceeds in 3 '-to -5' direction along a template. To study tCTP incorporation while T7 RNAP operates in the elongation mode, DNA 1 was employed, which exhibited a unique guanine 12 bases away from the start site of transcription. DNA 2 featured a unique guanine at position only four nucleotides from the start site, directing tCTP incorporation to the initiation region. It was necessary to start the templating region with CCT instead of CCC to avoid slippage of T7 RNAP during initiation, which can result in non-sense poly-G ribonucleotides of different lengths.
[00077] Fig. 6 represents a comparison of the lengths of the RNA products obtained in transcription reactions using T7 RNAP and different combinations of NTPs and labeled nucleotides. In the presence of only GTP and ATP (lanes 2 and 2'), transcription terminated as T7 RNAP reached the single template guanines of DNA 1 and DNA 2, respectively, and the length of the products verifies that transcription starts indeed at the underlined C. Oddly, T7 RNAP produces a large amount of abortive GA dinucleotide when transcribing DNA 2, as revealed by RNA labeling with [a-32P]ATP in the presence of only ATP and GTP (Fig. 6, lane 9). Reactions carried out in the presence of all four natural NTPs produced full length products (20 nucleotides long) with both DNA constructs (lanes 3 and 3'), and so did the reactions in which CTP was fully substituted by tCTP (lanes 4 and 4'). The RNA transcripts containing tC clearly shifted upward relative to the transcript exhibiting C at the same position, indicating a larger size of tC compared to C in the molecules. To test if UTP can be misinserted opposite G, transcription of DNAl and 2 was performed in the presence of GTP, ATP and UTP (lanes 5 and 5 '). For DNA 1 , a significant amount of G-U mismatch was formed leading to full length product, whereas transcription terminated opposite the unique template G of DNA2. However, the RNA transcript that contains U instead of the correct C migrates distinctly different from the RNA exhibiting tC at this position. Omitting UTP from the reaction mixture in the presence of CTP or tCTP, respectively (Fig. 6, lanes 6 and 7), lead to almost complete abortion of transcription at the unique A of DNAl . In both reactions only ~7% of the corresponding abortive RNA transcripts were extended. Employing DNA2, the reaction containing ATP, GTP and CTP lead to 1 1 % extension past the unique template A (lane 6'), whereas it was 26 % for the reaction containing tCTP (lane 7')· Thus, T7 RNAP used neither ATP, GTP, CTP nor tCTP effectively to bypass the template adenine. This result suggests that T7 RNAP base pairs tCTP less
ambivalently than expected based on the previous study of dtCTP incorporation by DNA polymerases.
[00078] Further, Fig. 6 illustrates incorporation of tCTP by T7 RNA polymerase operating either in the initiation or elongation mode. Transcription starts at the underlined C and proceeds in the 3'-to-5 ' direction. All reactions contained 0.2 units/μΐ T7 RNAP, 1 μΜ DNA and 0.4 mM of each of the indicated NTPs. All RNA products are visualized based on the incorporation of [a-32P]GTP, except for lanes 1 and 3, where [a-32P]ATP was used instead, together with ATP and GTP. Lane 2 displays a poly-G ladder, which was generated as described in the experimental section.
[00079] Competition between tCTP and CTP. To measure the relative catalytic efficiency of tCTP incorporation versus the catalytic efficiency of CTP incorporation,
(kcat/KM)tcTp (kcat KM)cTP, transcription reactions were carried out in the presence of a fixed concentrations of GTP and ATP, and varying ratios of tCTP and CTP. The omission of UTP facilitated the quantification of the reaction products by stopping the polymerase at the unique template A, thus avoiding the challenge of electrophoretically separating a large number of longer RNA transcripts with differing migration characteristics. The slower migration of products containing tC or C using gel electrophoresis (Fig. 7). Using equation 1, the
(kcat/KM)tcTp (kcat KM)cTP was determined to be 2.3+0.1 and 2.5+0.1 for tCTP incorporation in the elongation and initiation modes, respectively. Other studies that used T7 RNAP for the incorporation of unnatural nucleotides reported drastic differences for the elongation and initiation mode. For instance, T7 RNAP cannot introduce the uridine analogue thieno[3, 4- d]pyrimidine nucleotide closer than 7 bases to the promoter.
[00080] Fig. 7 illustrates competitive incorporation of CTP and tCTP across from G. All reactions contained 0.2 units/μΐ T7 RNAP, 1 μΜ DNA and 0.4 mM [a-32P]GTP and 0.4 mM ATP. The [CTP]-to-[tCTP] ratio was systematically varied as indicated below the lanes and the reactions products were analyzed after incubating for lh. The very left lane shows the no enzyme control, the poly-G ladder is located in the middle between the two reactions series.
[00081] tCTP incorporation opposite a template adenine. Next, the ability of T7 RNAP to discriminate against a tC-A mismatch was more closely analyzed. Although no tC-A mismatch formations transcribing DNA 1 and DNA 2 were observed, experiments were conducted to ensure that this was not a result of the base sequence, where A succeeded G by only 1 nucleotide. In addition, these reactions contained tCTP, and T7 RNAP polymerizes tCTP more efficiently than CTP. Thus, the lack of detectable incorporation of tC across from A might have resulted from tC incorporation at the immediately preceding position. Therefore the transcription reactions were repeated using DNA 3 and DNA 4 (Fig. 8), which exhibit unique adenines at the same position where DNA 1 and 2 exhibited guanine. Unexpectedly, transcription reactions containing ATP, GTP, tCTP and DNA 3 or DNA 4, respectively, produced some full length RNA transcripts, whereas reactions containing only ATP and GTP did not. Thus, T7 RNAP synthesized tC-A mismatches in this base context, suggesting that the proximity of the tC-G base pair to the template A in DNA 1 and 2 and/or sequence effects made the formation of the tC-A base pair less favorable with these DNAs. Kinetic parameters were determined for the formation of the U-A and tC-A base pairs by performing the transcription reactions with increasing UTP or tCTP concentrations, respectively, while ATP and GTP were kept at a constant high
concentration (Fig. 8). Michaelis Menten parameters were derived from plots of the percentage of RNA extended beyond 11 (DNA 3) and beyond 3 nucleotides (DNA 4), respectively, versus the UTP or tCTP concentration (Table 4). The experiments yielded a discrimination factor of 40 for the formation of a tC-A base pair when T7 RNAP is in the elongation mode and a factor of 300 for the initiation mode. Thus, T7 RNAP discriminates significantly better against a tC-A mismatch than DNA polymerases do against a d(tC-A) mismatch.
[00082] Previously, discrimination factors of 7 and 6, respectively, were measured for the formation of a d(tC-A) base pair by human DNA polymerase a and Klenow fragment. This observation was rationalized by proposing that tC is in rapid equilibrium between its amino and imino tautomer. The amino tautomer is competent to base pair with guanine, and the imino tautomer, being isosteric to thymine, would base pair with adenine (Chart 1). The observation that the structurally related pyrimidine analogue tetrafluorophenoxazine binds with equal affinity to G and A, as judged based on the melting temperatures of the corresponding DNA duplexes, supports the existence of tautomerism in this type of tricycle. If this tautomeric equilibrium operates and hydrogen bonding is a general determinant for nucleotide selection, DNA and RNA polymerases should polymerize such substrates with similar ambivalence.
[00083] For example, it has been observed for the cytidine analogue P (3,4-dihydro-
6H,8H-pyrimido[4,5-c][l,2]oxazin-2-one). For the P base, the ratio of the imino to amino form is 11 : 1. The relative catalytic efficiencies for the incorporation of dPTP opposite A versus G by Klenow fragment match this number, 11 : 1. Although the exact kinetic parameters are not available, it was reported that T7 RNAP preferentially inserts PTP opposite A, not G, suggesting that the tautomeric form also plays a role during nucleotide selection by T7 RNAP. One possibility to explain the superior discrimination of T7 RNAP against tC-A base pairs is that occurrence of the tC imino tautomer is a templating effect, for example, the alignment of tC with a templating adenine induces the imino tautomer to minimize the free energy of base pairing via hydrogen bonding. Such an inductive effect could be powerful if the templating and the incoming base were aligned in one plane, as in duplex DNA. The X-ray structure of the open ternary T7 RNAP-DNA-NTP complex captures an interaction of the incoming nucleotide with the templating base at a putative preinsertion site that has not been observed in other open ternary polymerase -DNA-dNTP complexes so far, including BF polymerase, RB69, Taq polymerase and T7 DNA polymerase. In T7 RNAP, the incoming NTP binds to the fingers domain (which forms the roof of the active site in the closed ternary complex) and makes hydrogen bonding contacts with the templating base prior to entering the active site, without for example, the steric constraint of the active site and with a slight out of plane tilt. Thus, T7 RNAP has a mechanism to screen for base complementarity at the preinsertion site, which may contribute to selectivity. The open ternary complex of Taq polymerase however captures the incoming nucleotide bound in the active site (the insertion site), while the templating base is occluded from interactions with the incoming nucleotide. Two studies confirmed that the closure of the fingers domain and the alignment of the templating base with the incoming base are both fast steps on the reaction coordinate of nucleotide polymerization by Klenow fragment. This suggests that Klenow is in fast equilibrium between the open and closed conformation and that it screens for base complementarity at the insertion site after formation of Watson-Crick hydrogen bonds between incoming dNTP and a templating base. Taken together this suggest that T7 RNAP has a mechanism to reject the incoming tCTP at the preinsertion site, whereas Klenow allows dtCTP access to the insertion site where electronic constraints and planar base stacking facilitate the formation of the imino tautomer, which is then accepted due to its resemblance to a T-A base pair.
[00084] tC labeling of large RNA. The generation of full length products on DNA1-4 in assays containing ATP, GTP, UTP, and tCTP suggested that it should be possible to use tCTP and T7 RNAP to generate highly fluorescent RNA. To present T7 RNAP with another challenge and to demonstrate the merit of tCTP incorporation for fluorescent labeling of large RNA transcripts, about 800 nucleotides of a Borellia miyamotoi flaggellin protein gene were transcribed in the presence of tCTP. Formation of full length RNA requires T7 RNAP to incorporate 3 consecutive tCTPs at 6 different positions. To allow for T7 transcription, the gene fragment was PCR amplified using a primer that introduced the T7 promotor sequence into the final product. Fig. 9A illustrates RNA transcripts obtained at different mixing ratios of tCTP and CTP and separated by agarose gel electrophoresis. As described recently for tCo labeled PCR products, tCo being a fluorescent oxo-ortholog of tC, it is possible to visualize the nucleic acids based on the tC fluorescence only, thus obviating the need for ethidium bromide staining.
Fluorescent 890 nucleotide RNA was obtained at all tCTP/CTP ratios tested, from a ratio of 1/15 to the point of full substitution of CTP with tCTP. To demonstrate the generality of the labeling method, the same reaction conditions were used to transcribe a catalytic RNA, the 207 nucleotide long E. coli riboswitch for vitamin B12 (Fig. 9B).
[00085] For both RNA transcripts, increasing the tC content led to slightly faster migration of the product RNA, and the overall yield was slightly diminished. The slightly faster migration could indicate premature termination at a specific site, or more likely, the RNA adopts a folded structure due to the increased hydrophobicity of the tC as compared to C. Despite the lower RNA yield at high tC labeling density, T7 RNAP transcription in the presence of tCTP is unexpectedly efficient.
[00086] Fig. 8 represents incorporation of UTP and tCTP across from a template A. All reactions contained 0.2 units/μΐ T7 RNAP, 1 μΜ DNA4, 0.4 mM GTP, 0.4 mM ATP, some <x- [32P]-GTP and increasing concentrations of UTP (left side) or tCTP (right side). Each reaction was stopped after 1 h. The UTP and tCTP concentrations, respectively, were as follows: 1, 5, 10, 25, 50, 100, 200 μΜ.
[00087] Figs. 9A and 9B represent large fluorescent RNA generated by transcription in the presence of CTP and tCTP at different concentrations. The top row shows the agarose gel exposed by UV light prior to staining with ethidium bromide (EtBr). The CTP and tCTP concentrations are provided below the imageimages. The reaction in lane 1 reactions next to the marker contained DNA template, pimers, enzyme but no CTP or tCTP, the control in lane 2 contained all four natural NTPs but no template. A) 890 nucleotide RNA obtained from transcription of the Borrelia miyamotoi flagellin protein gene. B) 207 nucleotide long B12 riboswitch of E. coli. Table 4: Kinetic parameters for the insertion of tCTP and UTP opposite adenine.
NTP DNA X VMAX (SD) KM (SD) Vmax/KM Discrimination*
% extension [μΜ] % extension
min μΜ■ min
tCTP DNA 3 2.66 (0.1) 1.7 (0.5) 1.6 41
UTP DNA 3 3.29 (0.01) 0.05 (0.01) 66 1
tCTP DNA 4 1.4 (0.4) 108 (56) 0.01 300
UTP DNA 4 3 (0.1) 1.0 (0.2) 3 1
* Discrimination is defined as Vmax/KM for the incorporation of UTP into DNA X, divided by Vmax/KM for the incorporation of tCTP into DNA X.
[00088] Methods for synthesis of fluorescent ly labeled RNA was demonstrated based on incorporation of fluorescent cytidine analogue tCTP by T7 RNA polymerase in transcription reactions. Compared to the insertion of dtCTP by DNA polymerases, tCTP insertion by T7 RNAP may be more precise; the enzyme can discriminate between tC-G and tC-A base pairs to avoid U -> C mutations during transcription. The base analogue tC combines several properties that make it an attractive candidate for the design of regulatory and catalytic RNAs: as with other N4-substituted cytosine analogues it likely engages in variable hydrogen bonding patterns depending on its tautomerization state, it stabilizes DNA-RNA and DNA-DNA duplexes, and it is fluorescent and traceable within the limits of its fluorescence quantum yield. It is possible that this base analogue may be used for producing functionally expanded nucleic acid libraries (e.g. R A or DNA libraries) using T7 transcription combined with selection processes such as SELEX or other selection process.
Materials and Enzymes
[00089] Unlabeled NTPs were obtained from Invitrogen and 32P-labeled NTPs from
Perkin Elmer Life Sciences. T7 RNA polymerase and RNAse Out™ were from Invitrogen.
Synthetic oligonucleotides were purchased from Integrated DNA Technology and the DNA sample used for transcription of the Borrelia miyamotoi gene (locus D3777, region 354-1241; Gen Bank 43777) was provided and PCR amplified to introduce the T7 promotor.
[00090] Synthesis of tCTP. Synthesis of tCTP was performed using the known synthesis of the l,3-diaza-2-oxophenothiazine nucleobase, Vorbruggen's silyl-Hilbert- Johnson
ribonucleoside synthesis, and the Ludwig method for triphosphate preparation. All reagents and dry solvents were purchased at high purity from commercial suppliers and used without further purification.
[00091] 2,3,5-tri-O-acetyl-tC-ribonucleoside. The tC nucleobase (200 mg, 0.92 mmol) was suspended in anhydrous CH3CN (10 ml), and N,O-bis(trimethylsilyl)acetamide (350 μΐ, 1.42 mmol) was added. The reaction mixture was heated at reflux under N2 for 20 min, then allowed to cool to room temperature. l,2,3,5-tetra-O-acetyl- ?-D-ribofuranose (300 mg, 0.94 mmol) and trimethylsilyl trifluoromethanesulfonate (210 μΐ, 1.17 mmol) were added. The reaction mixture was heated at reflux for 2.5 hours, the allowed to cool to room temperature. The reaction mixture was then poured into 5% NaHC03 solution (100 ml), and extracted with CH2C12 (2 x 100 ml). After drying over anhydrous Na2S04, the solvent was removed by rotary evaporation and the product was purified by flash chromatography (5% hexanes in EtOAc), yielding the product as a yellow oil (395 mg, 91%), which was found to consist of only the desired β anomer. 1H NMR (500 MHz, CDC13) 5 = 9.27 (br s, 1H, NH), 7.33 (s, 1H), 7.09 (m, 2H), 6.94 (m, 2H), 6.15 (d, J = 4.4 Hz, 1H), 5.35 (q, J= 4.5 Hz, 1H), 5.32 (m, 1H), 4.38 (d, J= 1.3 Hz, 3H), 2.22 (s, 3H, OAc), 2.10 (s, 3H, OAc), 2.09 (s, 3H, OAc) ppm. 13C NMR (100 MHz, CDC13) δ = 170.4, 169.7, 169.2, 160.5, 154.5, 135.4, 133.1, 127.9, 126.1, 125.0, 118.5, 116.3, 98.2, 88.3, 79.8, 73.7, 69.9, 63.0, 21.1, 20.6, 20.6 ppm. HRMS for C21H22N3O8S [M + H] calcd: 476.1128, found: 47.1131 (error = +1.9 ppm).
[00092] tC-ribonucleoside. 2,3,5-tri-O-acetyl-tC-ribonucleoside (340 mg, 0.715 mmol) was dissolved in dry MeOH (3 ml) under N2, and NaOMe (25 wt. % in MeOH, 25 μΐ) was added. After stirring for one hour at room temperature, acetic acid (100 μΐ) was added, and the solvent removed by rotary evaporation. The crude product was suspended in water (5 ml), filtered, and dried in a dessicator, yielding the pure product as a yellow solid (203 mg, 81%). 1H NMR (400 MHz, DMSO-d6) δ= 10.43 (br s, 1H, NH), 7.95 (s, 1H), 7.07 (m, 2H), 6.93 (m, 2H), 5.73 (d, J= 2.5 Hz, 1H), 5.36 (d, J= 3.2 Hz, 1H), 5.18 (t, J= 4.5 Hz, 1H), 5.01 (d, J= 2.5 Hz, 1H), 3.95 (s, 2H, OH), 3.84 (s, 1H, OH), 3.70 (m, 1H), 3.56 (m, 1H) ppm. 13C NMR (100 MHz, DMSO-de) δ= 159.5, 154.0, 136.2, 135.7, 127.4, 126.0, 124.0, 116.9, 115.9, 94.3, 89.4, 84.1, 74.2, 68.9, 60.0 ppm. HRMS for Ci5Hi6N305S [M + Na] calcd: 372.0625, found: 372.0622 (error = -0.8 ppm).
[00093] tC-ribonucleoside triphosphate. tC (30 mg, 0.09 mmol) was dissolved in trimethyl phosphate (0.5 mL) under argon and cooled on ice. POCl3 (9 uL, 1.1 equivalent) in trimethyl phosphate (0.05 mL) was added dropwise and the mixture was stirred for 2 h while warming up to room temperature. Tributylammonium pyrophosphate (0.6 g, 1.1 mmol, 12 equivalents) in DMF (1 mL) was added followed by several droplets of tributyl amine. The mixture was stirred another 3 h at room temperature and then poured into 0.1 M triethylammonium bicarbonate (TEAB, 100 mL). The solvents (except DMF) were removed under vacuo, the product was redissolved in water (150 mL), purified on a TEAB equilibrated ion-exchange column
(Sephadex-DEAE A-25, Sigma Aldrich); using a 0 to 1 M TEAB gradient for elution. Fractions were individually spotted on a MALDI plate with THAP as the matrix and triphosphate fractions were identified by their MALDI- peak (negative ion mode). This procedure was repeated until tetraphosphate (formed as a by-product) was fully removed. Fractions were collected and lyophilized, yielding 5.3 mg tCTP (yield = 13 %). MS (MALDI, neg.): 588 (M _1) calcd 588. 31P NMR (400 MHz, D20): - 9.9 (bs, 2P, gamma-P and alpha-P), -22.5 (bm, IP, beta-P).
[00094] T7 transcription of synthetic oligonucleotides. 20 transcription reactions contained 1 μΜ DNA construct, 0.4 mM of each NTP, 5 mM DTT, [a-32P]GTP, commercial reaction buffer (40 mM Tris-HCl pH 8, 8 mM MgCl2, 2 mM spermidine, 25 mM NaCl) and 0.2 units/ μΐ^ T7 RNA polymerase. The DNA constructs were prepared by hybridizing the T7 promotor (5'-TAA TAC GAC TCA CTA TAG-3' SEQ ID NO. 22) to one of the following DNA templates: 3'-ATT ATG CTG AGT GAT ATC CTT CTC CTT CGC ACC TCT C-5' (DNA 1, SEQ ID NO. 23), 3'-ATT ATG CTG AGT GAT ATC CTG CAC CTT CCT TCC TCT C-5' (DNA 2, SEQ ID NO. 24), 3'-ATT ATG CTG AGT GAT ATC CTT CTC CTT CAC TCC TCT C-5 ' (DNA 3, SEQ ID NO. 25), 3'-ATT ATG CTG AGT GAT ATC CTA CTC CTT CCT TCC TCT C-5 ' (DNA 4, SEQ ID NO. 26, see Figs. 6 and 7). For single time points, the reaction was incubated for 30 or 60 min and stopped with a 2-fold excess of formamide. The RNA products were separated by denaturing gel electrophoresis (20 % polyacrylamide, 8 M urea gels) and visualized using phosphorimagery.
[00095] To produce a poly-G ribonucleotide ladder, a standard transcription reaction was carried out using only 0.4 mM GTP, [a-32P]GTP, 0.2 units/ μΕ T7 RNA polymerase and 1 μΜ DNA template 3'-ATT ATG CTG AGT GAT ATC CCTT CTC CTT CGC ACC TCT C-5 ' (SEQ ID NO. 27).
[00096] The competitive incorporation of tCTP and CTP across from G was tested in standard assays (see above), this time containing 1 μΜ DNA 1 or DNA 2, 0.4 mM ATP, 0.4 mM GTP, [a-32P]GTP and one of the following: 400 μΜ CTP, no tCTP; 375 μΜ CTP, 25 μΜ tCTP; 350 μΜ CTP, 50 μΜ tCTP; 300 μΜ CTP, 100 μΜ tCTP; 250 μΜ CTP, 150 μΜ tCTP; 200 μΜ CTP, 200 μΜ tCTP; 150 μΜ CTP, 250 μΜ tCTP; 100 μΜ CTP, 300 μΜ tCTP; no CTP, 400 μΜ tCTP. The reactions were allowed to proceed for 1 hour and stopped and analyzed as described above. The relative catalytic activity of tCTP and CTP incorporation was determined using equation 1 :
fraction L
Figure imgf000036_0001
with fractioncTP being the amount of RNA extended by CTP, (kcat/KM)tcTP the catalytic efficiency for tCTP incorporation and (kcat/KM)cTP the catalytic efficiency for CTP incorporation. [00097] The kinetic parameters for tCTP incorporation across from A were measured under standard conditions. Assays contained 1 μΜ DNA 3 or DNA 4, 0.4 mM ATP, 0.4 mM GTP, some a-[32P]-GTP and either: 1, 5, 10, 25, 50, 100, 200 μΜ UTP or 1, 5, 10, 25, 50, 100, 200 μΜ tCTP. Reaction time was 1 hour. When DNA 3 was used, the percentage of RNA extended beyond 11 nucleotides was determined, in case of DNA 4, the percentage of RNA extended beyond 3 nucleotides was quantified. The percentage of extended RNA was plotted versus the UTP or tCTP concentration and the Michaelis-Menten parameters were derived by non-linear curve fitting.
[00098] Generation of long, fluorescent RNAs. 20 transcription reactions contained 1 μΐ, PCR amplified DNA template, 0.4 mM ATP, 0.4 mM GTP, 0.4 mM UTP, 5 mM DTT, 0.6 units/ μΙ_, RNAse out, commercial reaction buffer (40 mM Tris-HCl pH 8, 8 mM MgCl2, 2 mM spermidine, 25 mM NaCl) and 2 units/ μΙ_, T7 RNA polymerase. CTP and tCTP were added to match the following concentrations: 400 μΜ CTP, no tCTP; 375 μΜ CTP, 25 μΜ tCTP; 350 μΜ CTP, 50 μΜ tCTP; 300 μΜ CTP, 100 μΜ tCTP; 200 μΜ CTP, 200 μΜ tCTP; 100 μΜ CTP, 300 μΜ tCTP; no CTP, 400 μΜ tCTP. The samples were incubated for 1 hour, mixed with gel loading buffer (10 % ficoll 400, 10 % glycerol, 1 x TBE) and the RNA was separated using an 1.2 % agarose gel. The gels were exposed on an UV transilluminator prior to and after staining with ethidium bromide.
Example 4
Taq Polymerase
[00099] In other methods, nucleic acid sequences may be synthesized using Taq polymerase for the PCR by modifying reaction conditions. Two sets of conditions were developed that allow Taq polymerase to work well in PCR. In one example, betaine was not present in the reaction mix. It was discovered that Taq works in the presence of 25uM dtCoTP, 175uM dCTP, 200uM of the other three dNTPs, 3.5mM MgC12 and 0.5mM MnC12. Standard PCR cycles may be used, or even better do the denaturation step at 97C for 20 sec. One key ingredient was to include the MnCl2. In addition, one can vary the ratio of dtCoTP and dNTPs or use dtCTP in various ratios. In addition, other PCR reagent compositions can include Co 2 in the metals, but in certain cases Mn 2 worked more efficiently as a catalyst in the reaction.
[000100] Other exemplary methods may include using 1 M betaine in a nucleic acid sequence synthesizing reaction. In this example, Mn+2 was not needed when betaine was present in the PCR reaction.
[000101] Another set of conditions that gave some target nucleic acid sequence product in a PCR reaction included, but was not limited to, DMSO in the reaction. In certain methods, it was demonstrated that conditions containing glycerol were unable to form any product nucleic acid sequences. Glycerol and betaine are normally thought to do the same thing in PCR (lower the Tm of the DNA), but in this case that does not seem to be true.
The foregoing discussion of the invention has been presented for purposes of illustration and description. The foregoing is not intended to limit the invention to the form or forms disclosed herein. Although the description of the invention has included description of one or more embodiments and certain variations and modifications, other variations and modifications are within the scope of the invention, e.g., as may be within the skill and knowledge of those in the art, after understanding the present disclosure. It is intended to obtain rights which include alternative embodiments to the extent permitted, including alternate, interchangeable and/or equivalent structures, functions, ranges or steps to those claimed, whether or not such alternate, interchangeable and/or equivalent structures, functions, ranges or steps are disclosed herein, and without intending to publicly dedicate any patentable subject matter.

Claims

WHAT IS CLAIMED IS:
1. A nucleic acid sequence composition comprising one or more fluorescent cytosine triphospate analogues, l- -D-(l,3-diaza-2-oxo-thiazine)-2'-deoxyribofuranosyl triphosphate (d(tC)TP), l- -D-(l,3-diaza-2-oxo-phenoxazine)-2'-deoxyribofuranosyl triphosphate (d(tCo)TP) and l,3-diaza-2-oxophenothiazine-ribose-5 '-triphosphate (tCTP).
2. The nucleic acid sequence composition of claim 1, wherein the composition comprises a mixture of one or more fluorescent cytosine analogues and dCTP.
3. A method of generating a nucleic acid sequence comprising one or more fluorescent cytosine triphospate analogues comprising:
introducing one or more fluorescent cytosine triphospate analogues comprising Ι-β-D- (l,3-diaza-2-oxo-thiazine)-2'-deoxyribofuranosyl triphosphate (d(tC)TP), l- -D-(l,3-diaza-2- oxo-phenoxazine) -2 '-deoxyribofuranosyl triphosphate (d(tCo)TP) and l,3-diaza-2- oxophenothiazine-ribose-5 '-triphosphate (tCTP) to a composition of nucleotides; and
introducing a polymerase to the composition.
4. The method of claim 3, further comprising denaturing a target at a temperature above 95.0 degrees Celsius.
5. The method of claim 3, wherein the polymerase comprises a DNA polymerase.
6. The method of claim 3, wherein the polymerase comprises an R A polymerase.
7. The method of claim 3, wherein the nucleotides comprise a predetermined ratio of cytosine triphosphate to cytosine triphosphate analogue.
8. The method of claim 3, wherein the nucleic acid sequence comprises a nucleic acid sequence having modulated fluorescence compared to a control nucleic acid sequence.
9. A method of using a nucleic acid sequence comprising one or more fluorescent analogues comprising:
generating a nucleic acid sequence capable of associating with a target molecule wherein the nucleic acid sequence comprises one or more fluorescent analogues of l-P-D-(l,3-diaza-2- oxo-thiazine)-2'-deoxyribofuranosyl triphosphate (d(tC)TP), l-P-D-(l,3-diaza-2-oxo- phenoxazine) -2'-deoxyribofuranosyl triphosphate (d(tCo)TP) and l,3-diaza-2- oxophenothiazine-ribose-5 '-triphosphate (tCTP);
allowing the nucleic acid sequence having the one or more fluorescent analogues to associate with the target molecule; and
detecting the nucleic acid sequence having the one or more fluorescent analogues.
10. A composition for generating high density fluorescent nucleic acid sequences
comprising;
at least one cytosine analogue comprising l-P-D-(l,3-diaza-2-oxo-thiazine)-2'- deoxyribofuranosyl triphosphate (d(tC)TP), l-P-D-(l,3-diaza-2-oxo-phenoxazine) -2'- deoxyribofuranosyl triphosphate (d(tCo)TP) and l,3-diaza-2-oxophenothiazine-ribose-5'- triphosphate (tCTP); and
a polymerase.
11. The composition of claim 10, further comprising manganese (II) chloride.
12. The composition of claim 10, further comprising betaine.
13. A composition for generating high density fluorescent nucleic acid sequences
comprising;
at least one cytosine analogue comprising l- -D-(l,3-diaza-2-oxo-thiazine)-2'- deoxyribofuranosyl triphosphate (d(tC)TP), l- -D-(l,3-diaza-2-oxo-phenoxazine) -2'- deoxyribofuranosyl triphosphate (d(tCo)TP) and l,3-diaza-2-oxophenothiazine-ribose-5'- triphosphate (tCTP); and
Deep Vent DNA polymerase or T7 RNA polymerase.
14. A kit comprising,
at least one container of polymerase;
a nucleotide composition; and
at least one cytosine triphospate analogue comprising l-P-D-(l,3-diaza-2-oxo-thiazine)- 2'-deoxyribofuranosyl triphosphate (d(tC)TP), l- -D-(l,3-diaza-2-oxo-phenoxazine) -2'- deoxyribofuranosyl triphosphate (d(tCo)TP) and l,3-diaza-2-oxophenothiazine-ribose-5'- triphosphate (tCTP).
15. The kit of claim 14, further comprising betaine.
16. A kit comprising,
at least one container of a composition comprising at least one cytosine analogue comprising l- -D-(l,3-diaza-2-oxo-thiazine)-2'-deoxyribofuranosyl triphosphate (d(tC)TP), 1-β- D-(l,3-diaza-2-oxo-phenoxazine) -2'-deoxyribofuranosyl triphosphate (d(tCo)TP) and 1,3-diaza- 2-o xophenothiazine-ribose-5 '-triphosphate (tCTP); and
at least one container of Deep Vent DNA polymerase or T7 R A polymerase.
17. A method of generating a nucleic acid sequence comprising one or more fluorescent cytosine triphospate analogues comprising:
introducing one or more fluorescent cytosine triphospate analogues comprising Ι-β-D- (l,3-diaza-2-oxo-thiazine)-2'-deoxyribofuranosyl triphosphate (d(tC)TP), l- -D-(l,3-diaza-2- oxo-phenoxazine) -2 '-deoxyribofuranosyl triphosphate (d(tCo)TP) and l,3-diaza-2- oxophenothiazine-ribose-5 '-triphosphate (tCTP) to a composition of nucleotides; and
introducing Taq polymerase to the composition in the presence of manganese (II) chloride.
PCT/US2010/048894 2009-09-15 2010-09-15 Compositions, methods and uses for nucleotide analogues Ceased WO2011034895A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US24257909P 2009-09-15 2009-09-15
US61/242,579 2009-09-15
US26205409P 2009-11-17 2009-11-17
US61/262,054 2009-11-17

Publications (1)

Publication Number Publication Date
WO2011034895A1 true WO2011034895A1 (en) 2011-03-24

Family

ID=43758986

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2010/048894 Ceased WO2011034895A1 (en) 2009-09-15 2010-09-15 Compositions, methods and uses for nucleotide analogues

Country Status (1)

Country Link
WO (1) WO2011034895A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021260107A1 (en) 2020-06-25 2021-12-30 Stealth Labels Biotech Ab Fluorescent cytosine analogues and their application in transcription and translation

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020119455A1 (en) * 1997-02-12 2002-08-29 Chan Eugene Y. Methods and products for analyzing polymers
US20040054162A1 (en) * 2001-10-30 2004-03-18 Hanna Michelle M. Molecular detection systems utilizing reiterative oligonucleotide synthesis
US20090155856A1 (en) * 2007-08-15 2009-06-18 Hayato Miyoshi Nucleic acid amplification method

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020119455A1 (en) * 1997-02-12 2002-08-29 Chan Eugene Y. Methods and products for analyzing polymers
US20040054162A1 (en) * 2001-10-30 2004-03-18 Hanna Michelle M. Molecular detection systems utilizing reiterative oligonucleotide synthesis
US20090155856A1 (en) * 2007-08-15 2009-06-18 Hayato Miyoshi Nucleic acid amplification method

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
STENGEL G. ET AL: "Ambivalent Incorporation of the Fluorescent Cytosine Analogues tC and tCo by Human DNA Polymerase alpha and Klenow Fragment", BIOCHEMISTRY, vol. 48, no. 31, 6 July 2009 (2009-07-06), pages 7547 - 7555 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021260107A1 (en) 2020-06-25 2021-12-30 Stealth Labels Biotech Ab Fluorescent cytosine analogues and their application in transcription and translation
US20230219995A1 (en) * 2020-06-25 2023-07-13 Stealth Labels Biotech Ab Fluorescent cytosine analogues and their application in transcription and translation
JP2023533484A (en) * 2020-06-25 2023-08-03 ステルス・レイベルズ・バイオテック・アクチエボラグ Fluorescent cytosine analogues and their application to transcription and translation

Similar Documents

Publication Publication Date Title
CN114250278B (en) Methods, compositions and kits for capturing, detecting and quantifying small RNAs
CA2877368C (en) Kit for isothermal dna amplification starting from an rna template
US7807376B2 (en) Modified oligonucleotides and applications thereof
ES2700606T3 (en) Use of modified deoxynucleoside triphosphates in their bases to improve the detection of nucleic acids
US7759470B2 (en) Labeling reagent
EP2689031B1 (en) Functionalized 3-alkynyl pyrazolopyrimidine analogues as universal bases and methods of use
JP2003507024A (en) Polymerase extension at the 3 &#39;end of the PNA-DNA chimera
CN101384729A (en) solid phase sequencing
WO2002002817A2 (en) Multipartite high-affinity nucleic acid probes
Stengel et al. Incorporation of the fluorescent ribonucleotide analogue tCTP by T7 RNA polymerase
US20140004509A1 (en) Kit for isothermal dna amplification starting from an rna template
JP3970816B2 (en) Fluorescent hybridization probe that lowers background
US9777319B2 (en) Method for isothermal DNA amplification starting from an RNA template
US7408051B2 (en) Modified oligonucleotides and applications thereof
CN101671672B (en) Polyanion for improved nucleic acid amplification
JP2008535518A (en) 3 &#39;modified oligonucleotides containing pseudoisocytosine nucleobase derivatives and their application as primers or probes
WO2011034895A1 (en) Compositions, methods and uses for nucleotide analogues
US7759469B2 (en) Labeling reagent
US7906639B2 (en) Oligonucleotides having a 2′-O,4′-C-ethylene nucleotide in the third position of the 3′-end
JP4453910B2 (en) Gene polymorphism detection method
JP2004238353A (en) 5-position substituted pyrimidine deoxynucleotide derivative and nucleic acid synthesis method using the same
Ren Enzymatic synthesis of chemically modified DNA for analytical and diagnostic applications
KR20100103193A (en) Oligonucleotides for detection of dandruff-associated the yeasts of the genus malassezia
JP2007224013A (en) Unnatural base

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10817741

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10817741

Country of ref document: EP

Kind code of ref document: A1