WO2011034811A1 - Short rna mimetics - Google Patents
Short rna mimetics Download PDFInfo
- Publication number
- WO2011034811A1 WO2011034811A1 PCT/US2010/048597 US2010048597W WO2011034811A1 WO 2011034811 A1 WO2011034811 A1 WO 2011034811A1 US 2010048597 W US2010048597 W US 2010048597W WO 2011034811 A1 WO2011034811 A1 WO 2011034811A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- strand
- nucleotides
- rna
- short
- base pairs
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
- C07H21/02—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with ribosyl as saccharide radical
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
- C12N2310/141—MicroRNAs, miRNAs
Definitions
- the present invention relates to synthetic oligonucleotides that mimic the function of short RNAs such as, for example, microRNAs or short interfering RNAs.
- miRNAs and short interfering RNAs (siRNAs) regulate gene expression through a process termed RNA interference (RNAi).
- Mature miRNAs and siRNAs comprise a guide strand that is partially complementary to a target nucleic acid and an anti-guide or passenger strand that is complementary to the guide strand.
- RISC RNA-induced silencing complex
- the guide strand base pairs with the target nucleic acid, which is then silenced by degradation and/or inhibition of translation.
- RISC RNA-induced silencing complex
- Off-targeting may be mediated by erroneous entry of the passenger strand into RISC.
- RISC erroneous entry of the passenger strand into RISC.
- An oligonucleotide of the invention comprises a duplex region comprising a first strand whose sequence has at least about 90% sequence identity with a specific short RNA and a second strand whose sequence has at least about 60% complementarity to the first strand.
- the duplex region comprises a bulge of one to four unpaired nucleotides in the second strand, wherein the bulge is located between any adjacent two of the six nucleotides located near the 3' end of the duplexed region of the second strand.
- Another aspect of the present invention encompasses a kit for mimicking the function of a specific short RNA.
- the kit comprises at least one oligonucleotide, wherein the oligonucleotide comprises a first strand whose sequence has at least about 90% sequence identity with the specific short RNA and a second strand whose sequence has at least about 60% complementarity to the first strand.
- the second strand comprises an insertion of one to four nucleotides near its 3' end such that upon base pairing between the first strand and the second strand to form a duplex region there is a bulge of unpaired nucleotides in the second strand, wherein the bulge is located between any adjacent two of the six nucleotides located near the 3' end of the duplexed region of the second strand.
- a further aspect of the present invention provides a method for specifying an oligonucleotide that mimics the function of a specific short RNA.
- the method comprises specifying a first strand whose sequence has at least about 90% sequence identity with the specific short RNA; and specifying a second strand whose sequence has at least about 60% complementarity to the first strand, wherein the second strand comprises an insertion of one to four nucleotides near its 3' end such that when the first strand base pairs with the second strand to form a duplex region there is a bulge of unpaired nucleotides in the second strand.
- the bulge is located between any adjacent two of the six nucleotides located near the 3' end of the duplexed region of the second strand
- FIG. 1 demonstrates reporter knockdown by miRNA mimetics. Plotted is the relative percent of luciferase reporter activity in cells co-transfected with a particular target reporter nucleic acid sequence and a miRNA mimetic as indicated.
- FIG. 2 shows passenger strand off-target effects. Plotted is the relative percent of luciferase reporter activity in cells co-transfected with a particular target reporter nucleic acid sequence and the miRNA-206 mimetic with different passenger strands as indicated. 100 and -95 refer to the mean percent target sequence complementarity of the mimetic to the passenger strand.
- FIG. 3 illustrates passenger strand off-target effects. Plotted is the relative percent of luciferase reporter activity in cells co-transfected with a particular target reporter nucleic acid sequence and the miRNA-101 mimetic with different passenger strands as indicated. 100 and -95 refer to the mean percent target sequence complementarity of the mimetic to the passenger strand.
- FIG. 4 demonstrates guide strand loading. Plotted is the relative percent of luciferase reporter activity in cells co-transfected with a particular target reporter nucleic acid sequence and the miRNA-206 or miRNA-101 mimetic as indicated.
- FIG. 5 illustrates the efficacy of miRNA mimetics having different designs or structures. Plotted is the relative percent of luciferase reporter activity in cells co-transfected with a particular target reporter nucleic acid sequence and miRNA- 206 or miRNA-101 mimetic as indicated.
- a synthetic oligonucleotide of the invention comprises a guide strand and a complementary passenger strand having an unpaired insertion, such that when the two strands base pair to form a duplex there is an unpaired bulge in the passenger strand.
- the bulge in the passenger strand helps ensure that the guide strand is incorporated into RISC because the bulge weakens base pairing at that end of the duplex, facilitating loading into the complex from the nearest 5'-end.
- the invention also provides methods for specifying oligonucleotides that mimic the function of specific short RNAs with high specificity, as well as kits comprising the oligonucleotides of the invention.
- One aspect of the present invention comprises synthetic
- RNAs include microRNAs (miRNAs), short interfering RNAs (siRNAs), small activating RNAs (saRNAs), short sense transcripts, short antisense transcripts, short non-coding transcripts, repeat associated siRNAs (rasiRNAs), transacting siRNAs (tsiRNAs), Piwi interacting RNAs (piRNAs), and 21 -U RNAs.
- miRNAs microRNAs
- siRNAs short interfering RNAs
- siRNAs small activating RNAs
- rasiRNAs small activating RNAs
- tsiRNAs transacting siRNAs
- piRNAs Piwi interacting RNAs
- 21 -U RNAs 21 -U RNAs.
- short RNA refers to mature or fully processed short RNAs.
- the short RNA may be exogenous to the cell in which it functions.
- the short RNA may be endogenous to the cell in which it functions, i.e., it is transcribed from the genome.
- Endogenous short RNAs may be found in microbes, fungi, plants, invertebrates (e.g., nematodes, fruit flies, and the like), and vertebrates (e.g., frogs, zebrafish, rodents, and mammals such as companion animals, zoo animals, and humans).
- RNA interference RNA interference pathway
- short RNAs may be double stranded, they typically function as single-stranded entities (i.e., base pair with a target nucleic acid).
- Short RNAs are generally less than about 100 nucleotides in length, and more preferably about 50 or fewer nucleotides in length.
- the short RNA may be about 50, 45, 40, 35, 34, 33, 32, 31 , 30, 29, 28, 27, 26, 25, 24, 23, 22, 21 , 20, 19, 18, 17, 16, 15, 14, 13, or 12 nucleotides in length.
- the short RNA may range from 15 nucleotides to 35 nucleotides in length.
- the short RNA may range from 20 nucleotides to 24 nucleotides in length.
- the short RNA may range from 21 nucleotides to 23 nucleotides in length.
- the synthetic oligonucleotides of the invention comprise a duplex region in which one of the strands comprises an unpaired bulge.
- the duplex region of the oligonucleotide comprises a first strand whose sequence has at least about 90% sequence identity with a specific short RNA.
- the specific short RNA may be a miRNA, a siRNA, a saRNAs, a short sense transcript, a short antisense transcript, a short non-coding transcript, a rasiRNA, a tsiRNA, a piRNA, or a 21 -U RNA.
- the specific short RNA may be a miRNA or a siRNA.
- the sequence of the first strand may be about 90%, 91 %, 92%, 93%, 94%, 95%, 95%, 97%, 98%, or 99% identical to the specific short RNA. In another embodiment, the sequence of the first strand may be essentially identical to the specific short RNA.
- the duplex region of the oligonucleotide also comprises a second strand whose sequence has at least about 60% complementarity to the first strand.
- the sequence of the second strand may have about 60%, 62%, 64%, 66%, 68%, 70%, 72%, 74%, 76%, 78%, 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, or 96% complementarity to the first strand.
- the length of the duplex region of the oligonucleotide can and will vary. In general, length of the duplex region ranges from about 10 base pairs to about 50 base pairs in length. In various embodiments, the length of the duplex region of the oligonucleotide may range from about 12 base pairs to about 40 base pairs, from about 15 base pairs to about 35 base pairs, from about 18 base pairs to about 30 base pairs, or from about 20 base pairs to about 24 base pairs. In exemplary embodiments, the duplex region of the oligonucleotide may be 20 base pairs, 21 base pairs, or 22 base pairs in length.
- the second strand also comprises an insertion of one to four nucleotides near its 3' end such that upon base pairing between the first strand and the second strand to form the duplex region, there is a bulge of unpaired nucleotides in the second strand.
- the stability of the duplex is reduced as the length of the insertion (or bulge) is increased.
- the insertion (or bulge) in the second strand may comprise three or four nucleotides.
- the insertion (or bulge) in the second strand may comprise one or two nucleotides.
- the insertion (or bulge) in the second strand may comprise one nucleotide.
- the bulge of unpaired nucleotides in the second strand of the duplex region may be located between any adjacent two of the six nucleotides located near the 3' end of the duplexed region of the second strand.
- the bulge in the second strand may be located between the first and second nucleotides from the 3' end of the duplexed region of the second strand, between the second and third nucleotides from the 3' end of the duplexed region of the second strand, between the third and fourth nucleotides from the 3' end of the duplexed region of the second strand, between the fourth and fifth nucleotides closest to the 3' end of the duplexed region of the second strand, or between the fifth and sixth nucleotides from the 3' end of the duplexed region of the second strand.
- the bulge in the second strand may be located between the third and fourth nucleotides from the 3' end of the duplexed region of the second strand. Without being bound by any particular theory, it is believed that the bulge in that region of the oligonucleotide increases the likelihood that the first strand, which is substantially identical to the specific short RNA, and not the second strand will be integrated into RISC. Thus, off-target effects are reduced or eliminated.
- the second strand may further comprise a capping group at its 5' terminus.
- suitable capping groups include amino groups, methyl groups, acetyl groups, carboxyl groups, carboxymethyl groups, and thiol groups.
- the capping group at the 5' terminus of the second strand may be an amino group.
- the oligonucleotide may further comprise at least one 3' overhang, i.e., a single-stranded portion that extends beyond the duplex region.
- the first strand, the second strand, or both may have a 3' overhang.
- the 3' overhang may range from about one nucleotide to about six nucleotides, or more preferably, from about one nucleotide to about three nucleotides in length.
- the 3' overhang may comprise two nucleotides.
- the nucleotides of the first strand that form the duplex region will be ribonucleotides.
- the first strand comprises an optional 3' overhang
- the 3' overhang may be ribonucleotides or deoxyribonucleotides.
- the entire first stand may comprise ribonucleotides or a combination of ribonucleotides and deoxyribonucleotides.
- the nucleotides of the second strand that form the duplex region may be ribonucleotides, deoxyribonucleotides, or combinations thereof.
- the nucleotides of the second strand may be
- nucleotides of the second strand may be a combination of ribonucleotides and deoxyribonucleotides.
- the nucleotides of the second strand that will form the duplex region and the bulge of the oligonucleotide may be ribonucleotides, while the optional 3' overhang may be deoxyribonucleotides.
- the nucleotides of the bulge may comprise any nitrogenous base.
- the nucleotides of the bulge may comprise pyrimidine bases such as uracil, cytosine, or thymine.
- the bulge may comprise uridine, which is the smallest nucleotide according to the space-filling model.
- the nucleotides of the oligonucleotide may comprise unmodified, modified, or derivatized nitrogenous base moieties and/or unmodified, modified, or derivatized sugar moieties. Additionally, the nucleotides of the oligonucleotide may be nucleotide analogs.
- the heterocyclic base moiety of the nucleotide may be an unmodified purine base (e.g., adenine, guanine, hypoxanthine, or xanthine) or an unmodified pyrimidine base (e.g., cytosine, thymine, or uracil).
- the purine or pyrimidine base moiety may be a derivatized or modified by the replacement or addition of one of more atoms or groups. Examples of suitable modifications include, but are not limited to, alkylation, halogenation, thiolation, amination, amidation, acetylation, and combinations thereof.
- More specific modified bases include, for example, 5-propynyluridine, 5-propynylcytidine, 6-methyladenine, 6-methylguanine, ⁇ , ⁇ ,-dimethyladenine, 2-propyladenine, 2-propylguanine, 2-aminoadenine, 1 - methylinosine, 3-methyluridine, 5-methylcytidine, 5-methyluridine and other nucleotides having a modification at the 5 position, 5-(2-amino)propyl uridine, 5-halocytidine, 5- halouridine, 4-acetylcytidine, 1 -methyladenosine, 2-methyladenosine, 3-methylcytidine, 6-methyluridine, 2-methylguanosine, 7-methylguanosine, 2,2-dimethylguanosine, 5- methylaminoethyluridine, 5-methyloxyuridine, deazanucleotides such as 7-deaza- adenosine, 6-azouridine
- the base moiety may be a standard purine or pyrimidine (i.e., adenine, cytosine, guanine, thymine, and uracil) base.
- the sugar moiety of the nucleotide may be an acyclic sugar or a carbocyclic sugar.
- Suitable examples of an acyclic sugar include, but are not limited to glycerol (which may form a glycerol nucleic acid or GNA), threose (which may form a threose nucleic acid or TNA), erthrulose, erythrose, and so forth.
- Non-limiting examples of suitable carbocyclic sugars include pentoses (such as, arabinose, deoxyribose, lyxose, ribose, xylose, xylulose, etc., and derivatives thereof) and hexoses (such as, galactose, glucose, mannose, etc., and derivatives thereof).
- pentoses such as, arabinose, deoxyribose, lyxose, ribose, xylose, xylulose, etc., and derivatives thereof
- hexoses such as, galactose, glucose, mannose, etc., and derivatives thereof.
- the sugar moiety may be isomeric, i.e., it may be the D-form or the L-form.
- the configuration of the sugar moiety may be alpha (a) or beta ( ⁇ ).
- the sugar moiety may be a ⁇ - D-ribose.
- the sugar moiety of a nucleotide also may comprise a locked nucleic acid (LNA), in which the 2' and 4' carbons, or the 3' and 4' carbons, of the sugar moiety are connected with an extra bridge.
- LNA locked nucleic acid
- the nucleotide may also comprise a sugar analog or substitute, such as a morpholine ring, which may be connected by a phosphorodiamidate linkage to form a morpholino, or a N-(2-aminoethyl)-glycine unit, which may be connected by a peptide bond to form a peptide nucleic acid (PNA).
- the sugar moiety of the nucleotide also may have a substituent at the 2' position or the 3' position of the molecule.
- the substituent may be selected from the group consisting of hydrogen, halogen, -R, -NHR, -NRR 1 , -SR, and -OR, wherein R and R 1 are
- R may be alkyl (such as, e.g., methyl, ethyl, propyl, isopropyl, etc), acyl, alkenyl, or aryl.
- the nucleotides of the oligonucleotide may be connected by phosphorus-containing linkages, non-phosphorus-containing linkages, or combinations thereof.
- suitable phosphorus-containing linkages include, but are not limited to, phosphodiester, phosphorothioate, phosphorodithioate, phosphoramidate, alkylphosphoramidate, aminoalkylphosphoramidate, thionophosphoramidate, alkylphosphonothioate, arylphosphonothioate, thiophosphate, alkyl phosphonate, methylphosphonate, alkylenephosphonate, hydrogen phosphonate, phosphotriester, ethylphosphotriester, thionoalkylphosphotnester, phosphinate, borano phosphate ester, selenophosphate, phosphoroselenoate, phosphorodiselenoate, phosphoropiperazidate, phosphoroanilothioate, and
- Non-limiting examples of suitable non-phosphorus-containing linkages include alkyl, amide, amine, aminoethyl glycine, borontrifluoridate, carbamate, carbonate, cycloalkyl, ether, formacetal, glycol, hydroxylamine, hydrazine ketone, methylenehydrazo, methylenedimethylhydrazo, methyleneimino, methylene(methylimino), methylester, oxime, sulfonamide, sulfone, thioamidate, siloxane, silyl, thioformacetal, and urea linkages.
- the internudeotide linkages may be phosphodiester or phosphorothioate linkages. In an exemplary embodiment, the internudeotide linkages may be
- oligonucleotides of the invention may be synthesized according to standard techniques using phosphoramidite monomers (e.g., Methods in Molecular Biology, Vol 20, Protocols for Oligonucleotides and Analogs, Agrawal, ed., Humana Press, Totowa, N.J ., 1993). (c) preferred embodiments
- the first strand ranges from about 20 to 24 ribonucleotides in length; the second strand ranges from about 21 to 25
- the duplex region of the oligonucleotide ranges from about 20 to 24 base pairs in length with a one nucleotide bulge located between the third and fourth nucleotides from the 3' end of the duplexed region of the second strand.
- the unpaired nucleotide in the bulge is a uridine residue.
- the first strand further comprises a 3' overhang of two nucleotides.
- the specific short RNA is a human miRNA.
- Another aspect of the invention provides methods for specifying an oligonucleotide that mimics the function of a specific short RNA.
- the method comprises specifying a first strand whose sequence has at least about 90% sequence identity with the specific short RNA; and specifying a second strand whose sequence has at least about 60% complementarity to the first strand.
- the second strand comprises an insertion of one to four nucleotides near its 3' end such that when the first strand base pairs with the second strand to form a duplex region there is a bulge of unpaired nucleotides in the second strand, wherein the bulge is located between any adjacent two of the six nucleotides located near the 3' end of the duplexed region of the second strand.
- the two strands form an oligonucleotide that mimics the function of a specific short RNA with minimal off-targeting.
- oligonucleotides of the invention are detailed above in section (I).
- kits for mimicking the function of a specific short RNA comprises at least one
- the oligonucleotide that mimics the function of a specific short RNA.
- the oligonucleotides of the invention are detailed above in section (I).
- the two strands of the oligonucleotide may be provided together in the kit as a duplex. In other embodiments, the two strands of the oligonucleotide may be provided separately in the kit.
- the kit may also comprise nuclease-free water or nuclease-free buffers for diluting the oligonucleotides of the kit.
- the oligonucleotides of the invention may be used to study the biological role of specific short RNAs through gain of function, or to screen for short RNAs that regulate gene function or affect specific cellular pathways or processes (such as, e.g., cell proliferation, differentiation, development, apoptosis, etc.). Additionally, the oligonucleotides of the invention also may be used to identify the target nucleic acids of specific short RNAs, or to evaluate the mechanism and potency of miRNA inhibitors or other short RNA inhibitors.
- oligonucleotides of the invention may be introduced into a cell by any of several well- known techniques such as, for example, electroporation, liposomal or other vesicular delivery systems, direct cell fusion, viral carriers, osmotic shock, application of protein carriers or antibody carriers, and calcium-phosphate mediated transfection.
- an oligonucleotide may be any suitable oligonucleotide.
- receptor mediated endocytotic systems whereupon chemical conjugation to the oligonucleotide may be used to enhance cellular uptake by targeting a specific cell surface receptor include, but are not limited to, galactose, mannose, mannose-6-phosphate, transferrin,
- asialoglycoproteins water soluble vitamins (e.g. transcobolamin, biotin, ascorbic acid, folates, etc.) any pharmacological agent or analog that mimics the binding of a water soluble vitamin, alpha-2 macroglobulins, insulin, epidermal growth factor, or attachment to an antibody against a surface protein of the target cell as in the case of the so-called immunotoxins.
- Chemical conjugation of the oligonucleotide may also include apolar substituents such as hydrocarbon chains or aromatic groups and/or polar substituents such as polyamines to further enhance intracellular uptake.
- Chemical conjugation of the oligonucleotide to an exogenous molecule may be achieved by covalent, ionic or hydrogen bonding either directly or indirectly by a linking group.
- the exogenous molecule may be covalently linked to the oligonucleotide using techniques are well known in the art.
- oligonucleotide are known to those skilled in the medical arts (Avis, K. in Remington's Pharmaceutical Sciences, 1985, pp.1518-1541 , Gennaro, A. R., ed., Mack Publishing Company, Easton, PA). Such methods of administration may include, but are not limited to, surface application, oral, or parenteral routes, injection into joints,
- oligonucleotide includes topical application to such surfaces as skin, eyes, lungs, nasal or oral passages, ears, rectum, vagina, and the like.
- Appropriate means for parenteral administration include 5% dextrose, normal saline, Ringer's solution and Ringer's lactate.
- the oligonucleotide may be stored as a lyophilized powder and reconstituted when needed by addition of an appropriate salt solution.
- acyl denotes the moiety formed by removal of the hydroxy group from the group COOH of an organic carboxylic acid, e.g., RC(O) , wherein R is R 1 , R 1 O- R 1 R 2 N- or R 1 S- R 1 is hydrocarbyl, heterosubstituted hydrocarbyl, or heterocyclo, and R 2 is hydrogen, hydrocarbyl or substituted hydrocarbyl.
- alkyl as used herein describes groups which are preferably lower alkyl containing from one to eight carbon atoms in the principal chain and up to 20 carbon atoms. They may be straight or branched chain or cyclic and include methyl, ethyl, propyl, isopropyl, butyl, hexyl and the like.
- alkenyl as used herein describes groups having at least one carbon-carbon double bond that preferably contain from two to eight carbon atoms in the principal chain and up to 20 carbon atoms. They may be straight or branched chain or cyclic and include ethenyl, propenyl, isopropenyl, butenyl, isobutenyl, hexenyl, and the like.
- aryl as used herein alone or as part of another group denote optionally substituted homocyclic aromatic groups, preferably monocyclic or bicyclic groups containing from 6 to 12 carbons in the ring portion, such as phenyl, biphenyl, naphthyl, substituted phenyl, substituted biphenyl or substituted naphthyl. Phenyl and substituted phenyl are the more preferred aryl.
- halogen or halo as used herein alone or as part of another group refer to chlorine, bromine, fluorine, and iodine.
- the terms “complementary” or “complementarity” refer to the association of double-stranded nucleic acids by base pairing through specific hydrogen bonds.
- the base paring may be standard Watson-Crick base pairing (e.g., 5'-A G T C-3' pairs with the complementary sequence 3'-T C A G-5').
- the base pairing also may be Hoogsteen or reversed Hoogsteen hydrogen bonding.
- Complementarity is typically measured with respect to a duplex region and thus, excludes overhangs, for example.
- Complementarity between two strands of the duplex region may be partial and expressed as a percentage (e.g., 70%), if only some of the base pairs are complementary. The bases that are not complementary are
- Complementarity may also be complete (i.e., 100%), if all the base pairs of the duplex region are complementary.
- hydrocarbon and “hydrocarbyl” as used herein describe organic compounds or radicals consisting exclusively of the elements carbon and hydrogen. These moieties include alkyl, alkenyl, alkynyl, and aryl moieties. These moieties also include alkyl, alkenyl, alkynyl, and aryl moieties substituted with other aliphatic or cyclic hydrocarbon groups, such as alkaryl, alkenaryl and alkynaryl. Unless otherwise indicated, these moieties preferably comprise 1 to 20 carbon atoms.
- off-target refers to any effect other than silencing of the intended target nucleic acid.
- sequence identity refers to the extent in which two nucleotide sequences are invariant, i.e., the two sequences have the same nucleotide at the same position. Sequence identity is generally expressed as a percentage. Two nucleotide sequences that are identical in sequence and length have 100% sequence identity.
- Short RNA refers to RNA molecules that function through RNA interference. Short RNAs are generally less than about 100 nucleotides in length. Non-limiting examples of short RNAs include microRNAs
- miRNAs short interfering RNAs
- siRNAs small activating RNAs
- short sense transcripts short antisense transcripts
- short non-coding transcripts repeat associated siRNAs
- rasiRNAs repeat associated siRNAs
- tsiRNAs transacting siRNAs
- piRNAs Piwi interacting RNAs
- 21 -U RNAs 21 -U RNAs
- substituted hydrocarbyl hydrocarbyl, alkyl, alkenyl, aryl, and heteroaryl moieties, respectively, that are
- substituents include halogen, heterocycio, alkoxy, alkenoxy, aryloxy, hydroxy, protected hydroxy, acyl, acyloxy, nitro, amino, amido, nitro, cyano, ketals, acetals, esters, and ethers.
- microRNA mimetic the insertion in the anti-guide or passenger strand is shaded gray.
- Cells were co-transfected with the fusion vector and the appropriate miRNA mimetic, and relative luciferase activity was monitored as detailed in the manufacture's instruction manual.
- FIG. 1 presents the relative reporter activity in the absence and presence of the miRNA mimetic.
- the mimetics decreased reporter activity from about 25% to more than 80%. These data suggests that all the guide strands from the miRNA mimetics were loaded into RISC and targeted the target sequence within the reporter. Since decreased reporter activity was observed with all the miRNA mimetics (FIG.1 ), these finding suggests that the microRNA mimetic design presented here can be applied to all known small RNA designs.
- the passenger strands had different complementary (e.g., 100% or about 95%) to the target sequence, had different lengths, and/or differed in the presence of the 5' amino group.
- the sequences of the target and passenger strands of the mimetics are shown in Table 2. The targeted region of the target sequence is underlined.
- the miRNA-206 mimetics were co-transfected with the fusion reporter vector (harboring the target sequence GJA1 ) essentially as described in Example 1 .
- miRNA mimetics with different structures were designed and tested for their ability to mimic the miRNA of interest.
- miRNA mimetics were designed with one or two nucleotide inserts (or bulges), mismatched regions, and combinations thereof.
- Table 5 presents the sequences of miRNA mimetics prepared for miR206 (5'-UGGAAUGUAAGGAAGUGUGUGG-3'; SEQ ID NO:39) (the insertions and mismatched regions are shaded gray).
- Table 6 presents sequences of miRNA mimetics prepared for miR101-1 (5'- UACAGUACUGUGAUAACUGAA-3'; SEQ ID NO:58). The silencing effects of the miRNA mimetics were analyzed using the gene fusion reporter assay essentially as described in Example 1 .
- FIG. 5 presents the percentage of reporter activity in the presence of each miRNA mimic.
- miR206L2 comprising a single nucleotide bulge in the passenger strand
- the data from the series of miR101 mimetics revealed that all reduced reporter activity to about the same degree. Therefore, these findings suggest that the L2 passenger strand design (Table 5) had no effect on guide strand loading and can be universally applied to microRNA mimetic designs (Table 1 ) and all known small RNAs. Table 5.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The present invention provides synthetic oligonucleotides that mimic the function of short RNAs such as, for example, microRNAs or short interfering RNAs. In particular, the synthetic oligonucleotides comprise a duplex region comprising an unpaired bulge in one of the strands.
Description
SHORT RNA MIMETICS
FIELD OF THE INVENTION
[0001 ] The present invention relates to synthetic oligonucleotides that mimic the function of short RNAs such as, for example, microRNAs or short interfering RNAs.
BACKGROUND OF THE INVENTION
[0002] MicroRNAs (miRNAs) and short interfering RNAs (siRNAs) regulate gene expression through a process termed RNA interference (RNAi). Mature miRNAs and siRNAs comprise a guide strand that is partially complementary to a target nucleic acid and an anti-guide or passenger strand that is complementary to the guide strand. Upon incorporation of the guide strand into the RNA-induced silencing complex (RISC), the guide strand base pairs with the target nucleic acid, which is then silenced by degradation and/or inhibition of translation. Several synthetic oligonucleotides are available that are able to silence specific target sequences, but they generally tend to also silence unintended targets. This nonspecific silencing is termed off-targeting or off- target effects. Off-targeting may be mediated by erroneous entry of the passenger strand into RISC. There is a need, therefore, for improved synthetic oligonucleotides that mimic the effects of short RNAs with high specificity and minimal off-target effects.
SUMMARY OF THE INVENTION
[0003] Among the various aspects of the present invention is the provision of synthetic oligonucleotides that mimic the function of short RNAs. An oligonucleotide of the invention comprises a duplex region comprising a first strand whose sequence has at least about 90% sequence identity with a specific short RNA and a second strand whose sequence has at least about 60% complementarity to the first strand.
Additionally, the duplex region comprises a bulge of one to four unpaired nucleotides in the second strand, wherein the bulge is located between any adjacent two of the six nucleotides located near the 3' end of the duplexed region of the second strand.
[0004] Another aspect of the present invention encompasses a kit for mimicking the function of a specific short RNA. The kit comprises at least one oligonucleotide, wherein the oligonucleotide comprises a first strand whose sequence has at least about 90% sequence identity with the specific short RNA and a second strand whose sequence has at least about 60% complementarity to the first strand. Additionally, the second strand comprises an insertion of one to four nucleotides near its 3' end such that upon base pairing between the first strand and the second strand to form a duplex region there is a bulge of unpaired nucleotides in the second strand, wherein the bulge is located between any adjacent two of the six nucleotides located near the 3' end of the duplexed region of the second strand.
[0005] A further aspect of the present invention provides a method for specifying an oligonucleotide that mimics the function of a specific short RNA. The method comprises specifying a first strand whose sequence has at least about 90% sequence identity with the specific short RNA; and specifying a second strand whose sequence has at least about 60% complementarity to the first strand, wherein the second strand comprises an insertion of one to four nucleotides near its 3' end such that when the first strand base pairs with the second strand to form a duplex region there is a bulge of unpaired nucleotides in the second strand. Moreover, the bulge is located between any adjacent two of the six nucleotides located near the 3' end of the duplexed region of the second strand
[0006] Other aspects and features of the invention are described in more detail below.
DESCRIPTION OF THE FIGURES
[0007] FIG. 1 demonstrates reporter knockdown by miRNA mimetics. Plotted is the relative percent of luciferase reporter activity in cells co-transfected with a particular target reporter nucleic acid sequence and a miRNA mimetic as indicated.
[0008] FIG. 2 shows passenger strand off-target effects. Plotted is the relative percent of luciferase reporter activity in cells co-transfected with a particular target reporter nucleic acid sequence and the miRNA-206 mimetic with different
passenger strands as indicated. 100 and -95 refer to the mean percent target sequence complementarity of the mimetic to the passenger strand.
[0009] FIG. 3 illustrates passenger strand off-target effects. Plotted is the relative percent of luciferase reporter activity in cells co-transfected with a particular target reporter nucleic acid sequence and the miRNA-101 mimetic with different passenger strands as indicated. 100 and -95 refer to the mean percent target sequence complementarity of the mimetic to the passenger strand.
[0010] FIG. 4 demonstrates guide strand loading. Plotted is the relative percent of luciferase reporter activity in cells co-transfected with a particular target reporter nucleic acid sequence and the miRNA-206 or miRNA-101 mimetic as indicated.
[001 1 ] FIG. 5 illustrates the efficacy of miRNA mimetics having different designs or structures. Plotted is the relative percent of luciferase reporter activity in cells co-transfected with a particular target reporter nucleic acid sequence and miRNA- 206 or miRNA-101 mimetic as indicated.
DETAILED DESCRIPTION
[0012] The present invention provides synthetic oligonucleotides that mimic the function of specific short RNAs with high specificity and with minimal off- target effects. Stated another way, the synthetic oligonucleotides of the invention are short RNA mimetics. In general, a synthetic oligonucleotide of the invention comprises a guide strand and a complementary passenger strand having an unpaired insertion, such that when the two strands base pair to form a duplex there is an unpaired bulge in the passenger strand. The bulge in the passenger strand helps ensure that the guide strand is incorporated into RISC because the bulge weakens base pairing at that end of the duplex, facilitating loading into the complex from the nearest 5'-end. The invention also provides methods for specifying oligonucleotides that mimic the function of specific short RNAs with high specificity, as well as kits comprising the oligonucleotides of the invention.
(I) RNA Mimetic Oligonucleotides
[0013] One aspect of the present invention comprises synthetic
oligonucleotides that mimic the function of short RNAs. Non-limiting examples of suitable short RNAs include microRNAs (miRNAs), short interfering RNAs (siRNAs), small activating RNAs (saRNAs), short sense transcripts, short antisense transcripts, short non-coding transcripts, repeat associated siRNAs (rasiRNAs), transacting siRNAs (tsiRNAs), Piwi interacting RNAs (piRNAs), and 21 -U RNAs. As used herein, the term "short RNA" refers to mature or fully processed short RNAs. The short RNA may be exogenous to the cell in which it functions. Alternatively, the short RNA may be endogenous to the cell in which it functions, i.e., it is transcribed from the genome. Endogenous short RNAs may be found in microbes, fungi, plants, invertebrates (e.g., nematodes, fruit flies, and the like), and vertebrates (e.g., frogs, zebrafish, rodents, and mammals such as companion animals, zoo animals, and humans).
[0014] In general, short RNAs function through RNA interference (RNAi) pathways and may regulate gene expression at several different levels. Those of skill in the art will appreciate that while short RNAs may be double stranded, they typically function as single-stranded entities (i.e., base pair with a target nucleic acid).
[0015] Short RNAs are generally less than about 100 nucleotides in length, and more preferably about 50 or fewer nucleotides in length. In various embodiments, the short RNA may be about 50, 45, 40, 35, 34, 33, 32, 31 , 30, 29, 28, 27, 26, 25, 24, 23, 22, 21 , 20, 19, 18, 17, 16, 15, 14, 13, or 12 nucleotides in length. In one preferred embodiment, the short RNA may range from 15 nucleotides to 35 nucleotides in length. In another preferred embodiment, the short RNA may range from 20 nucleotides to 24 nucleotides in length. In an exemplary embodiment, the short RNA may range from 21 nucleotides to 23 nucleotides in length.
(a) oligonucleotide structure
[0016] In general, the synthetic oligonucleotides of the invention comprise a duplex region in which one of the strands comprises an unpaired bulge. The duplex region of the oligonucleotide comprises a first strand whose sequence has at least
about 90% sequence identity with a specific short RNA. The specific short RNA may be a miRNA, a siRNA, a saRNAs, a short sense transcript, a short antisense transcript, a short non-coding transcript, a rasiRNA, a tsiRNA, a piRNA, or a 21 -U RNA. In preferred embodiments, the specific short RNA may be a miRNA or a siRNA. In some
embodiments, the sequence of the first strand may be about 90%, 91 %, 92%, 93%, 94%, 95%, 95%, 97%, 98%, or 99% identical to the specific short RNA. In another embodiment, the sequence of the first strand may be essentially identical to the specific short RNA.
[0017] The duplex region of the oligonucleotide also comprises a second strand whose sequence has at least about 60% complementarity to the first strand. In various embodiments, the sequence of the second strand may have about 60%, 62%, 64%, 66%, 68%, 70%, 72%, 74%, 76%, 78%, 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, or 96% complementarity to the first strand.
[0018] The length of the duplex region of the oligonucleotide can and will vary. In general, length of the duplex region ranges from about 10 base pairs to about 50 base pairs in length. In various embodiments, the length of the duplex region of the oligonucleotide may range from about 12 base pairs to about 40 base pairs, from about 15 base pairs to about 35 base pairs, from about 18 base pairs to about 30 base pairs, or from about 20 base pairs to about 24 base pairs. In exemplary embodiments, the duplex region of the oligonucleotide may be 20 base pairs, 21 base pairs, or 22 base pairs in length.
[0019] The second strand also comprises an insertion of one to four nucleotides near its 3' end such that upon base pairing between the first strand and the second strand to form the duplex region, there is a bulge of unpaired nucleotides in the second strand. In general, the stability of the duplex is reduced as the length of the insertion (or bulge) is increased. In some embodiments, the insertion (or bulge) in the second strand may comprise three or four nucleotides. In preferred embodiments, the insertion (or bulge) in the second strand may comprise one or two nucleotides. In an exemplary embodiment, the insertion (or bulge) in the second strand may comprise one nucleotide.
[0020] The bulge of unpaired nucleotides in the second strand of the duplex region may be located between any adjacent two of the six nucleotides located near the 3' end of the duplexed region of the second strand. Stated another way, the bulge in the second strand may be located between the first and second nucleotides from the 3' end of the duplexed region of the second strand, between the second and third nucleotides from the 3' end of the duplexed region of the second strand, between the third and fourth nucleotides from the 3' end of the duplexed region of the second strand, between the fourth and fifth nucleotides closest to the 3' end of the duplexed region of the second strand, or between the fifth and sixth nucleotides from the 3' end of the duplexed region of the second strand. In an exemplary embodiment, the bulge in the second strand may be located between the third and fourth nucleotides from the 3' end of the duplexed region of the second strand. Without being bound by any particular theory, it is believed that the bulge in that region of the oligonucleotide increases the likelihood that the first strand, which is substantially identical to the specific short RNA, and not the second strand will be integrated into RISC. Thus, off-target effects are reduced or eliminated.
[0021 ] The second strand may further comprise a capping group at its 5' terminus. Non-limiting examples of suitable capping groups include amino groups, methyl groups, acetyl groups, carboxyl groups, carboxymethyl groups, and thiol groups. In an exemplary embodiment, the capping group at the 5' terminus of the second strand may be an amino group.
[0022] In some embodiments, the oligonucleotide may further comprise at least one 3' overhang, i.e., a single-stranded portion that extends beyond the duplex region. In various embodiments, the first strand, the second strand, or both may have a 3' overhang. The 3' overhang may range from about one nucleotide to about six nucleotides, or more preferably, from about one nucleotide to about three nucleotides in length. In an exemplary embodiment, the 3' overhang may comprise two nucleotides.
(b) oligonucleotide composition
[0023] In general, the nucleotides of the first strand that form the duplex region will be ribonucleotides. However, if the first strand comprises an optional 3' overhang, then the 3' overhang may be ribonucleotides or deoxyribonucleotides. Thus, the entire first stand may comprise ribonucleotides or a combination of ribonucleotides and deoxyribonucleotides. In contrast, the nucleotides of the second strand that form the duplex region may be ribonucleotides, deoxyribonucleotides, or combinations thereof. In one embodiment, the nucleotides of the second strand may be
ribonucleotides. In another embodiment, the nucleotides of the second strand may be a combination of ribonucleotides and deoxyribonucleotides. In an exemplary
embodiment, the nucleotides of the second strand that will form the duplex region and the bulge of the oligonucleotide may be ribonucleotides, while the optional 3' overhang may be deoxyribonucleotides. In general, the nucleotides of the bulge may comprise any nitrogenous base. In exemplary embodiments, the nucleotides of the bulge may comprise pyrimidine bases such as uracil, cytosine, or thymine. In exemplary embodiments, the bulge may comprise uridine, which is the smallest nucleotide according to the space-filling model.
[0024] The nucleotides of the oligonucleotide may comprise unmodified, modified, or derivatized nitrogenous base moieties and/or unmodified, modified, or derivatized sugar moieties. Additionally, the nucleotides of the oligonucleotide may be nucleotide analogs.
[0025] The heterocyclic base moiety of the nucleotide may be an unmodified purine base (e.g., adenine, guanine, hypoxanthine, or xanthine) or an unmodified pyrimidine base (e.g., cytosine, thymine, or uracil). Alternatively, the purine or pyrimidine base moiety may be a derivatized or modified by the replacement or addition of one of more atoms or groups. Examples of suitable modifications include, but are not limited to, alkylation, halogenation, thiolation, amination, amidation, acetylation, and combinations thereof. More specific modified bases include, for example, 5-propynyluridine, 5-propynylcytidine, 6-methyladenine, 6-methylguanine, Ν,Ν,-dimethyladenine, 2-propyladenine, 2-propylguanine, 2-aminoadenine, 1 -
methylinosine, 3-methyluridine, 5-methylcytidine, 5-methyluridine and other nucleotides having a modification at the 5 position, 5-(2-amino)propyl uridine, 5-halocytidine, 5- halouridine, 4-acetylcytidine, 1 -methyladenosine, 2-methyladenosine, 3-methylcytidine, 6-methyluridine, 2-methylguanosine, 7-methylguanosine, 2,2-dimethylguanosine, 5- methylaminoethyluridine, 5-methyloxyuridine, deazanucleotides such as 7-deaza- adenosine, 6-azouridine, 6-azocytidine, 6-azothymidine, 5-methyl-2-thiouridine, other thio bases such as 2-thiouridine and 4-thiouridine and 2-thiocytidine, dihydrouridine, pseudouridine, queuosine, archaeosine, naphthyl and substituted naphthyl groups, any O- and N-alkylated purines and pyrimidines such as N6-methyladenosine, 5- methylcarbonylmethyluridine, uridine 5-oxyacetic acid, pyridine-4-one, pyridine-2-one, phenyl and modified phenyl groups such as aminophenol or 2,4,6-trimethoxy benzene, modified cytosines that act as G-clamp nucleotides, 8-substituted adenines and guanines, 5-substituted uracils and thymines, azapyrimidines, carboxyhydroxyalkyl nucleotides, carboxyalkylaminoalkyl nucleotides, and alkylcarbonylalkylated
nucleotides. In preferred embodiments, the base moiety may be a standard purine or pyrimidine (i.e., adenine, cytosine, guanine, thymine, and uracil) base.
[0026] The sugar moiety of the nucleotide may be an acyclic sugar or a carbocyclic sugar. Suitable examples of an acyclic sugar include, but are not limited to glycerol (which may form a glycerol nucleic acid or GNA), threose (which may form a threose nucleic acid or TNA), erthrulose, erythrose, and so forth. Non-limiting examples of suitable carbocyclic sugars include pentoses (such as, arabinose, deoxyribose, lyxose, ribose, xylose, xylulose, etc., and derivatives thereof) and hexoses (such as, galactose, glucose, mannose, etc., and derivatives thereof). The sugar moiety may be isomeric, i.e., it may be the D-form or the L-form. The configuration of the sugar moiety may be alpha (a) or beta (β). In preferred embodiments, the sugar moiety may be a β- D-ribose.
[0027] The sugar moiety of a nucleotide also may comprise a locked nucleic acid (LNA), in which the 2' and 4' carbons, or the 3' and 4' carbons, of the sugar moiety are connected with an extra bridge. The nucleotide may also comprise a sugar analog or substitute, such as a morpholine ring, which may be connected by a
phosphorodiamidate linkage to form a morpholino, or a N-(2-aminoethyl)-glycine unit, which may be connected by a peptide bond to form a peptide nucleic acid (PNA). The sugar moiety of the nucleotide also may have a substituent at the 2' position or the 3' position of the molecule. The substituent may be selected from the group consisting of hydrogen, halogen, -R, -NHR, -NRR1 , -SR, and -OR, wherein R and R1 are
independently selected from the group consisting of hydrogen, hydrocarbyl, and substituted hydrocarbyl. Preferably, R may be alkyl (such as, e.g., methyl, ethyl, propyl, isopropyl, etc), acyl, alkenyl, or aryl.
[0028] The nucleotides of the oligonucleotide may be connected by phosphorus-containing linkages, non-phosphorus-containing linkages, or combinations thereof. Examples of suitable phosphorus-containing linkages include, but are not limited to, phosphodiester, phosphorothioate, phosphorodithioate, phosphoramidate, alkylphosphoramidate, aminoalkylphosphoramidate, thionophosphoramidate, alkylphosphonothioate, arylphosphonothioate, thiophosphate, alkyl phosphonate, methylphosphonate, alkylenephosphonate, hydrogen phosphonate, phosphotriester, ethylphosphotriester, thionoalkylphosphotnester, phosphinate, borano phosphate ester, selenophosphate, phosphoroselenoate, phosphorodiselenoate, phosphoropiperazidate, phosphoroanilothioate, and phosphoroanilidate linkages. Non-limiting examples of suitable non-phosphorus-containing linkages include alkyl, amide, amine, aminoethyl glycine, borontrifluoridate, carbamate, carbonate, cycloalkyl, ether, formacetal, glycol, hydroxylamine, hydrazine ketone, methylenehydrazo, methylenedimethylhydrazo, methyleneimino, methylene(methylimino), methylester, oxime, sulfonamide, sulfone, thioamidate, siloxane, silyl, thioformacetal, and urea linkages. In preferred
embodiments, the internudeotide linkages may be phosphodiester or phosphorothioate linkages. In an exemplary embodiment, the internudeotide linkages may be
phosphodiester linkages.
[0029] The oligonucleotides of the invention may be synthesized according to standard techniques using phosphoramidite monomers (e.g., Methods in Molecular Biology, Vol 20, Protocols for Oligonucleotides and Analogs, Agrawal, ed., Humana Press, Totowa, N.J ., 1993).
(c) preferred embodiments
[0030] In preferred embodiments, the first strand ranges from about 20 to 24 ribonucleotides in length; the second strand ranges from about 21 to 25
ribonucleotides in length and has a 3' overhang of two deoxyribonucleotides; the duplex region of the oligonucleotide ranges from about 20 to 24 base pairs in length with a one nucleotide bulge located between the third and fourth nucleotides from the 3' end of the duplexed region of the second strand. In an iteration of this embodiment, the unpaired nucleotide in the bulge is a uridine residue. In other iterations of this embodiment, the first strand further comprises a 3' overhang of two nucleotides. In exemplary
embodiments, the specific short RNA is a human miRNA.
(II) Methods for Specifying RNA Mimetic Oligonucleotides
[0031 ] Another aspect of the invention provides methods for specifying an oligonucleotide that mimics the function of a specific short RNA. The method comprises specifying a first strand whose sequence has at least about 90% sequence identity with the specific short RNA; and specifying a second strand whose sequence has at least about 60% complementarity to the first strand. Additionally, the second strand comprises an insertion of one to four nucleotides near its 3' end such that when the first strand base pairs with the second strand to form a duplex region there is a bulge of unpaired nucleotides in the second strand, wherein the bulge is located between any adjacent two of the six nucleotides located near the 3' end of the duplexed region of the second strand. Together the two strands form an oligonucleotide that mimics the function of a specific short RNA with minimal off-targeting. Aspects of the
oligonucleotides of the invention are detailed above in section (I).
(III) Kits
[0032] A further aspect of the present invention encompasses kits for mimicking the function of a specific short RNA. A kit comprises at least one
oligonucleotide that mimics the function of a specific short RNA. The oligonucleotides of the invention are detailed above in section (I). In some embodiments, the two
strands of the oligonucleotide may be provided together in the kit as a duplex. In other embodiments, the two strands of the oligonucleotide may be provided separately in the kit. The kit may also comprise nuclease-free water or nuclease-free buffers for diluting the oligonucleotides of the kit.
(IV) Uses of the Oligonucleotides of the Invention
[0033] Yet another aspect of the present invention provides methods for using the oligonucleotides of the invention. In general, the oligonucleotides of the invention may be used to study the biological role of specific short RNAs through gain of function, or to screen for short RNAs that regulate gene function or affect specific cellular pathways or processes (such as, e.g., cell proliferation, differentiation, development, apoptosis, etc.). Additionally, the oligonucleotides of the invention also may be used to identify the target nucleic acids of specific short RNAs, or to evaluate the mechanism and potency of miRNA inhibitors or other short RNA inhibitors.
[0034] To examine the function of specific short RNAs, the
oligonucleotides of the invention may be introduced into a cell by any of several well- known techniques such as, for example, electroporation, liposomal or other vesicular delivery systems, direct cell fusion, viral carriers, osmotic shock, application of protein carriers or antibody carriers, and calcium-phosphate mediated transfection.
[0035] To facilitate entry into the cell, an oligonucleotide may be
chemically modified to enhance its permeability. Examples of receptor mediated endocytotic systems whereupon chemical conjugation to the oligonucleotide may be used to enhance cellular uptake by targeting a specific cell surface receptor include, but are not limited to, galactose, mannose, mannose-6-phosphate, transferrin,
asialoglycoproteins, water soluble vitamins (e.g. transcobolamin, biotin, ascorbic acid, folates, etc.) any pharmacological agent or analog that mimics the binding of a water soluble vitamin, alpha-2 macroglobulins, insulin, epidermal growth factor, or attachment to an antibody against a surface protein of the target cell as in the case of the so-called immunotoxins. Chemical conjugation of the oligonucleotide may also include apolar substituents such as hydrocarbon chains or aromatic groups and/or polar substituents
such as polyamines to further enhance intracellular uptake. Chemical conjugation of the oligonucleotide to an exogenous molecule may be achieved by covalent, ionic or hydrogen bonding either directly or indirectly by a linking group. Preferably, the exogenous molecule may be covalently linked to the oligonucleotide using techniques are well known in the art.
[0036] Various methods of formulation and administration of the
oligonucleotide are known to those skilled in the medical arts (Avis, K. in Remington's Pharmaceutical Sciences, 1985, pp.1518-1541 , Gennaro, A. R., ed., Mack Publishing Company, Easton, PA). Such methods of administration may include, but are not limited to, surface application, oral, or parenteral routes, injection into joints,
subcutaneous injection, or other pharmaceutical methods of delivery. Surface application of the oligonucleotide includes topical application to such surfaces as skin, eyes, lungs, nasal or oral passages, ears, rectum, vagina, and the like. Appropriate means for parenteral administration include 5% dextrose, normal saline, Ringer's solution and Ringer's lactate. The oligonucleotide may be stored as a lyophilized powder and reconstituted when needed by addition of an appropriate salt solution.
DEFINITIONS
[0037] To facilitate understanding of the invention, several terms are defined below.
[0038] The term "acyl," as used herein alone or as part of another group, denotes the moiety formed by removal of the hydroxy group from the group COOH of an organic carboxylic acid, e.g., RC(O) , wherein R is R1 , R1O- R1R2N- or R1S- R1 is hydrocarbyl, heterosubstituted hydrocarbyl, or heterocyclo, and R2 is hydrogen, hydrocarbyl or substituted hydrocarbyl.
[0039] The term "alkyl" as used herein describes groups which are preferably lower alkyl containing from one to eight carbon atoms in the principal chain and up to 20 carbon atoms. They may be straight or branched chain or cyclic and include methyl, ethyl, propyl, isopropyl, butyl, hexyl and the like.
[0040] The term "alkenyl" as used herein describes groups having at least one carbon-carbon double bond that preferably contain from two to eight carbon atoms in the principal chain and up to 20 carbon atoms. They may be straight or branched chain or cyclic and include ethenyl, propenyl, isopropenyl, butenyl, isobutenyl, hexenyl, and the like.
[0041 ] The term "aryl" as used herein alone or as part of another group denote optionally substituted homocyclic aromatic groups, preferably monocyclic or bicyclic groups containing from 6 to 12 carbons in the ring portion, such as phenyl, biphenyl, naphthyl, substituted phenyl, substituted biphenyl or substituted naphthyl. Phenyl and substituted phenyl are the more preferred aryl.
[0042] The terms "halogen" or "halo" as used herein alone or as part of another group refer to chlorine, bromine, fluorine, and iodine.
[0043] As used herein, the terms "complementary" or "complementarity" refer to the association of double-stranded nucleic acids by base pairing through specific hydrogen bonds. The base paring may be standard Watson-Crick base pairing (e.g., 5'-A G T C-3' pairs with the complementary sequence 3'-T C A G-5'). The base pairing also may be Hoogsteen or reversed Hoogsteen hydrogen bonding.
Complementarity is typically measured with respect to a duplex region and thus, excludes overhangs, for example. Complementarity between two strands of the duplex region may be partial and expressed as a percentage (e.g., 70%), if only some of the base pairs are complementary. The bases that are not complementary are
"mismatched." Complementarity may also be complete (i.e., 100%), if all the base pairs of the duplex region are complementary.
[0044] The terms "hydrocarbon" and "hydrocarbyl" as used herein describe organic compounds or radicals consisting exclusively of the elements carbon and hydrogen. These moieties include alkyl, alkenyl, alkynyl, and aryl moieties. These moieties also include alkyl, alkenyl, alkynyl, and aryl moieties substituted with other aliphatic or cyclic hydrocarbon groups, such as alkaryl, alkenaryl and alkynaryl. Unless otherwise indicated, these moieties preferably comprise 1 to 20 carbon atoms.
[0045] The term "off-target," as used herein, refers to any effect other than silencing of the intended target nucleic acid.
[0046] As used herein, the term "sequence identity" refers to the extent in which two nucleotide sequences are invariant, i.e., the two sequences have the same nucleotide at the same position. Sequence identity is generally expressed as a percentage. Two nucleotide sequences that are identical in sequence and length have 100% sequence identity.
[0047] The term "short RNA" as used herein refers to RNA molecules that function through RNA interference. Short RNAs are generally less than about 100 nucleotides in length. Non-limiting examples of short RNAs include microRNAs
(miRNAs), short interfering RNAs (siRNAs), small activating RNAs (saRNAs), short sense transcripts, short antisense transcripts, short non-coding transcripts, repeat associated siRNAs (rasiRNAs), transacting siRNAs (tsiRNAs), Piwi interacting RNAs (piRNAs), and 21 -U RNAs
[0048] The "substituted hydrocarbyl," "substituted alkyl," "substituted alkenyl," "substituted aryl," and "substituted heteroaryl" moieties described herein are hydrocarbyl, alkyl, alkenyl, aryl, and heteroaryl moieties, respectively, that are
substituted with at least one atom other than carbon, including moieties in which a carbon chain atom is substituted with a hetero atom such as nitrogen, oxygen, silicon, phosphorous, boron, sulfur, or a halogen atom. These substituents include halogen, heterocycio, alkoxy, alkenoxy, aryloxy, hydroxy, protected hydroxy, acyl, acyloxy, nitro, amino, amido, nitro, cyano, ketals, acetals, esters, and ethers.
[0049] When introducing elements of the present invention or the preferred embodiments(s) thereof, the articles "a", "an", "the" and "said" are intended to mean that there are one or more of the elements. The terms "comprising", "including" and
"having" are intended to be inclusive and mean that there may be additional elements other than the listed elements.
[0050] As various changes could be made in the above compounds and processes without departing from the scope of the invention, it is intended that all matter
contained in the above description and in the examples given below, shall be interpreted as illustrative and not in a limiting sense.
EXAMPLES
[0051 ] The following examples detail various embodiment of the invention.
Example 1: Reporter Knockdown by miRNA Mimetics
[0052] The silencing effects of miRNA mimetics, as detailed above, were examined using a gene fusion reporter assay (psiCHECK™, Promega Corp., Madison, Wl). For this, target sequences were subcloned into psiCHECK-2 vectors such that the target sequence was immediately downstream of the translation stop codon of the Renilla luciferase gene, hRluc. Table 1 lists the target sequences and the
corresponding microRNA mimetic (the insertion in the anti-guide or passenger strand is shaded gray). Cells were co-transfected with the fusion vector and the appropriate miRNA mimetic, and relative luciferase activity was monitored as detailed in the manufacture's instruction manual.
[0053] FIG. 1 presents the relative reporter activity in the absence and presence of the miRNA mimetic. The mimetics decreased reporter activity from about 25% to more than 80%. These data suggests that all the guide strands from the miRNA mimetics were loaded into RISC and targeted the target sequence within the reporter. Since decreased reporter activity was observed with all the miRNA mimetics (FIG.1 ), these finding suggests that the microRNA mimetic design presented here can be applied to all known small RNA designs.
Table 1. Tar et Se uences and miRNA Mimetics
Example 2: Passenger Strand Off-Target Effects
[0054] To examine possible off-target effects of the passenger strand, several miRNA-206 mimetics were prepared with different passenger strands. For example, the passenger strands had different complementary (e.g., 100% or about 95%) to the target sequence, had different lengths, and/or differed in the presence of the 5' amino group. The sequences of the target and passenger strands of the mimetics
are shown in Table 2. The targeted region of the target sequence is underlined. The miRNA-206 mimetics were co-transfected with the fusion reporter vector (harboring the target sequence GJA1 ) essentially as described in Example 1 .
[0055] The results are presented in FIG. 2. In general, the passenger strands had off-target effects. The exception was the L2(+amine) miRNA mimetic in which decreased reporter activity via the passenger strand of a miRNA mimetic was reduced when the target/mimetic complementarity was -95%. This reduction was not observed with the siDesign mimetics. These findings suggest that having the extra base within the 3' end of the passenger strand either reduced loading into RISC or affected potential binding to a non-specific target within the human
genome/transcriptome.
Table 2. miRNA-206 Passenger Strand siTargets
Name and Sequence SEQ ID
NO:
206L2-N1
5 ' -UCGAAGAGCCAAAUUCUGUCUCCUUGG-AAUGUAAGGAAGUGUGUGGACACCAAUGGCUU 25 UCUAGAGCU
206L2-DT TTACC|UUACAUUCCUUCACACACC - 5 ' 26
206L2-DT1 TTACClUUACAUUCCUUCACACA- 5 ' 27 si TTACC -UUACAUUCCAACACACACC - 5 ' 28
206L2
5 ' -UCGAAGAGCCAAAUUCUGUCUCCUUGGAAAUGUAAGGAAGUGUGUGGACACCAAUGGCUUUC 29 UAGAGCU
206L2-DT TTACCfuUACAUUCCUUCACACACC - 5 ' 26
206L2-DT1 TTACClUUACAUUCCUUCACACA- 5 ' 27 si TTACC -UUACAUUCCAACACACACC - 5 ' 28
[0056] Similar experiments were performed for miRNA-101 mimetics. The sequences of the target (i.e., MYCN) and the passenger strands of various mimetics are shown in Table 3.
[0057] As seen in FIG. 3, decreased reporter activity via the passenger strand of a miRNA mimetic was reduced with the L2(+amine) miRNA mimetic, when the
target/mimetic complementarity was 100% and -95%. The same reduction was observed for the siDesign(+amine) miRNA mimetic but not to the same extent at the 100% complementarity level with L2(+amine) miRNA mimetic. Once more, these data suggest that having the extra base within the 3' end of the passenger strand either reduced loading into RISC or affected potential binding to a non-specific target within the human genome/transcriptome.
Table 3. miRNA-101 Passenger Strand siTargets
Example 3: Guide Strand Loading
[0058] To examine the specificity of guide strand loading, the mimetics of miRNA-206 or miRNA-101 were co-transfected with a fusion reporter vector carrying a target sequence that was 100% complementary to the corresponding guide strand. Reporter activity was monitored essentially as described in Example 1 . Table 4
presents the sequences of the guide strands and the targets. As shown in FIG. 4, all of the guide strands loaded properly. Therefore, these data suggest that regardless of the passenger strand design used within the mimetic, the guide strand can be loaded into RISC and stimulate or knockdown its corresponding target(s). In this example, knockdown was observed.
Table 4. Guide Strand siTargets
Example 4: Structure of miRNA Mimetics
[0059] Several miRNA mimetics with different structures were designed and tested for their ability to mimic the miRNA of interest. For example, miRNA mimetics were designed with one or two nucleotide inserts (or bulges), mismatched regions, and combinations thereof. Table 5 presents the sequences of miRNA mimetics prepared for miR206 (5'-UGGAAUGUAAGGAAGUGUGUGG-3'; SEQ ID NO:39) (the insertions and mismatched regions are shaded gray). Table 6 presents sequences of miRNA mimetics prepared for miR101-1 (5'- UACAGUACUGUGAUAACUGAA-3'; SEQ ID NO:58). The silencing effects of the miRNA mimetics were analyzed using the gene fusion reporter assay essentially as described in Example 1 .
[0060] FIG. 5 presents the percentage of reporter activity in the presence of each miRNA mimic. Among the series of miR206 mimetics, miR206L2 comprising a single nucleotide bulge in the passenger strand, was the most effective miRNA mimetic. The data from the series of miR101 mimetics revealed that all reduced reporter activity to about the same degree. Therefore, these findings suggest that the L2 passenger strand design (Table 5) had no effect on guide strand loading and can be universally applied to microRNA mimetic designs (Table 1 ) and all known small RNAs.
Table 5. miR206 Mimetics
Name Sequence SEQ ID NO: miR206 5' - CCACAiS CUUCiiUUAimUi?i;CCATT 40
TTGGUGUiilGAAGiiAAUaUA- GGU- 5 ' 41 miR206L1 5' -CCACACACUUCCUUACAUUllCCATT 42
TTGGUGUGUGAAGGAAUGUAA—GGU- 5 ' 43 miR206L1-n 5' - CCACACACUUCIUUAIAUUHICCATT 44
TTGGUGUGUGAAGIAAUIUAA-GGU- 5 ' 43 miR206L2 5' - CCACACACUUCCUUACAUUllCCATT 45
TTGGUGUGUGAAGGAAUGUAA-GGU- 5 ' 43 miR206L2-n 5' - CCACACACUUC|UUA|AUUlCCATT 46
TTGGUGUGUGAAGIAAUIUAA- GGU- 5 ' 43 miR206mm 5' - CCACACACUUCCUUACACiSCCATT 47
TTGGUGUGUGAAGGAAUGUAAGGU- 5 ' 43 miR206mm-n 5' - CCACACACUUCIUUAIA!!CCATT 48
TTGGUGUGUGAAG1AAU|UAAGGU- 5 ' 43
Table 6. miR101- ■1 Mimetics
Name Sequence SEQ ID NO: miR101-1 5 ' -lUCAGUUAUCACAGU|CUG|UlTT 49
TT|AGUCAAUAGUGUCA|GAC-A1-5 ' 50 miR101-2 5 ' -UUCIGUUAUCA|i|GUACiGiUi 51
TTAAGiCAAUAGUllCAUGiC-Al- 5 ' 50 miR101L1 5' -UUCAGUUAUCACAGUACUiliGUATT 52
TTAAGUCAAUAGUGUCAUGA—CAU- 5 ' 50 miR101L1-n 5 ' -UUCAGUUAUCAlllGUACUlllGUATT 53
TTAAGUCAAUAGUilCAUGA-CAU- 5 ' 50 miR101L2 5' -UUCAGUUAUCACAGUACUlGUATT 54
TTAAGUCAAUAGUGUCAUGA- CAU- 5 ' 50 miR101L2-n 5 ' -UUCAGUUAUCAUiiGUACUlGUATT 55
Table 6. miR101-1 Mimetics
Claims
1 . A synthetic oligonucleotide comprising a duplex region comprising a first strand whose sequence has at least about 90% sequence identity with a specific short RNA and a second strand whose sequence has at least about 60% complementarity to the first strand, wherein the duplex region comprises a bulge of one to four unpaired nucleotides in the second strand, the bulge being located between any adjacent two of the first six nucleotides in the second strand.
2. The synthetic oligonucleotide of claim 1 , wherein the specific short RNA is selected from the group consisting of a microRNA, a short interfering RNA, a small activating RNA, a short sense transcript, a short antisense transcript, a short non-coding transcript, a repeat associated short interfering RNA, a transacting short interfering RNA, a Piwi interacting RNA, and a 21 -U RNA.
3. The synthetic oligonucleotide of claim 1 , wherein the bulge is located between the third nucleotide and the fourth nucleotide from the 3' end of the duplexed region of the second strand.
4. The synthetic oligonucleotide of claim 1 , wherein the bulge comprises one or two unpaired nucleotides.
5. The synthetic oligonucleotide of claim 4 wherein the unpaired nucleotides are uridine.
6. The synthetic oligonucleotide of claim 1 , wherein the second strand further comprises a capping group at its 5' terminus.
7. The synthetic oligonucleotide of claim 6 wherein the capping group is an
amino group.
8. The synthetic oligonucleotide of claim 1 , wherein the oligonucleotide further comprises at least one 3' overhang, the overhang comprising from one nucleotide to six nucleotides.
9. The synthetic oligonucleotide of claim 8, wherein the 3' overhang comprises two nucleotides.
10. The synthetic oligonucleotide of claim 1 , wherein the duplex region is from about 10 base pairs to about 50 base pairs in length.
1 1 . The synthetic oligonucleotide of claim 10, wherein the duplex region is from about 15 base pairs to about 35 base pairs in length.
12. The synthetic oligonucleotide of claim 1 1 , wherein the duplex region is from about 18 base pairs to about 30 base pairs in length.
13. The synthetic oligonucleotide of claim 1 , wherein the first strand comprises ribonucleotides or a combination of ribonucleotides and deoxyribonudeotides, and the second strand comprises ribonucleotides, deoxyribonudeotides, or a combination thereof.
14. The synthetic oligonucleotide of claim 1 , wherein the specific short RNA is a microRNA; the first strand comprises ribonucleotides; the second strand comprises ribonucleotides and has a 3' overhang of two
deoxyribonudeotides; the second strand comprises a 5' amino group; the duplex region is from about 18 base pairs to about 30 base pairs in length; the bulge comprises one unpaired nucleotide; and the bulge is located between the third nucleotide and the fourth nucleotide from the 3' end of the duplexed region of the second strand.
15. The synthetic oligonucleotide of claim 14, wherein the bulge comprises
uridine; and the duplex region is from about 20 base pairs to about 24 base pairs in length.
16. The synthetic oligonucleotide of either claim 14 or claim 15, wherein the first strand further comprises a 3' overhang of two nucleotides.
17. A kit for mimicking the function of a specific short RNA, the kit comprising at least one oligonucleotide, wherein the oligonucleotide comprises a first strand whose sequence has at least about 90% sequence identity with the specific short RNA and a second strand whose sequence has at least about 60% complementarity to the first strand; the second strand comprising an insertion of one to four nucleotides near its 3' end such that upon base pairing between the first strand and the second strand to form a duplex region there is a bulge of unpaired nucleotides in the second strand, the bulge being located between any adjacent two of the six nucleotides located near the 3' end of the duplexed region of the second strand.
18. The kit of claim 17, wherein the specific short RNA is selected from the group consisting of a microRNA, a short interfering RNA, a small activating RNA, a short sense transcript, a short antisense transcript, a short non-coding transcript, a repeat associated short interfering RNA, a transacting short interfering RNA, a Piwi interacting RNA, and a 21 -U RNA.
19. The kit of claim 17, wherein the first strand and the second strand of the
oligonucleotide are provided together as a duplex.
20. The kit of claim 17, wherein the first strand and the second strand of the
oligonucleotide are provided separately.
21 . The kit of claim 17, wherein the bulge is located between the third nucleotide and the fourth nucleotide from the 3' end of the duplexed region of the second strand.
22. The kit of claim 17, wherein the bulge comprises one or two unpaired
nucleotides.
23. The kit of claim 22, wherein the nucleotides are uridine.
24. The kit of claim 17, wherein the second strand further comprises a capping group at its 5' terminus.
25. The kit of claim 24, wherein the capping group is an amino group.
26. The kit of claim 17, wherein the oligonucleotide further comprises at least one 3' overhang, the overhang comprising from one nucleotide to six nucleotides.
27. The kit of claim 26, wherein the 3' overhang comprises two nucleotides.
28. The kit of claim 17, wherein the duplex region is from about 10 base pairs to about 50 base pairs in length.
29. The kit of claim 28, wherein the duplex region is from about 18 base pairs to about 30 base pairs in length.
30. The kit of claim 17, wherein the first strand comprises ribonucleotides or a combination of ribonucleotides and deoxyribonucleotides, and the second strand comprises ribonucleotides, deoxyribonucleotides, or a combination thereof.
31 . A method for specifying an oligonucleotide that mimics the function of a
specific short RNA, the method comprising:
a. specifying a first strand whose sequence has at least 90% sequence identity with a specific short RNA; and
b. specifying a second strand whose sequence has at least about 60% complementarity to the first strand, the second strand comprising an insertion of one to four nucleotides near its 3' end such that when the first strand base pairs with the second strand to form a duplex region there is a bulge of unpaired nucleotides in the second strand, the bulge being located between any adjacent two of the six nucleotides located near the 3' end of the duplexed region of the second strand.
32. The method of claim 31 , wherein the specific short RNA is selected from the group consisting of a microRNA, a short interfering RNA, a small activating RNA, a short sense transcript, a short antisense transcript, a short non-coding transcript, a repeat associated short interfering RNA, a transacting short interfering RNA, a Piwi interacting RNA, and a 21 -U RNA.
33. The method of claim 31 , wherein the bulge is located between the third
nucleotide and the fourth nucleotide from the 3' end of the duplexed region of the second strand.
34. The method of claim 31 , wherein the bulge comprises one or two unpaired nucleotides.
35. The method of claim 34, wherein the nucleotides are uridine.
36. The method of claim 31 , wherein the second strand further comprises a
capping group at its 5' terminus.
37. The method of claim 36, wherein the capping group is an amino group.
38. The method of claim 31 , wherein the first strand and/or the second strand further comprise an additional one to six nucleotides at the 3' end, such that at least one 3' overhang forms upon base paring between the first strand and the second strand.
39. The method of claim 38, wherein the 3' overhang comprises two nucleotides.
40. The method of claim 31 , wherein the duplex region is from about 10 base pairs to about 50 base pairs in length.
41 . The method of claim 40, wherein the duplex region is from about 18 base pairs to about 30 base pairs in length.
42. The method of claim 31 , wherein the first strand comprises ribonucleotides or a combination of ribonucleotides and deoxyribonucleotides, and the second strand comprises ribonucleotides, deoxyribonucleotides, or a combination thereof.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US13/496,772 US8796238B2 (en) | 2009-09-17 | 2010-09-13 | Short RNA mimetics |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US24342409P | 2009-09-17 | 2009-09-17 | |
| US61/243,424 | 2009-09-17 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2011034811A1 true WO2011034811A1 (en) | 2011-03-24 |
Family
ID=43758969
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2010/048597 Ceased WO2011034811A1 (en) | 2009-09-17 | 2010-09-13 | Short rna mimetics |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US8796238B2 (en) |
| WO (1) | WO2011034811A1 (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8796238B2 (en) | 2009-09-17 | 2014-08-05 | Sigma-Aldrich Co. Llc | Short RNA mimetics |
| WO2016130589A3 (en) * | 2015-02-10 | 2016-09-15 | Genzyme Corporation | VARIANT RNAi |
| US11603529B2 (en) | 2017-09-22 | 2023-03-14 | Genzyme Corporation | Variant RNAi |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3426781B1 (en) | 2016-03-07 | 2024-06-26 | The United States of America, as represented by The Secretary, Department of Health and Human Services | Micrornas and methods of their use |
| KR20230023612A (en) | 2020-04-02 | 2023-02-17 | 마이레큘, 인크. | Targeted inhibition using engineered oligonucleotides |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070185049A1 (en) * | 2001-05-18 | 2007-08-09 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of histone deacetylase (HDAC) gene expression using short interfering nucleic acid (siNA) |
| US20090042298A1 (en) * | 2004-05-04 | 2009-02-12 | Mdrna, Inc. | Compositions and methods for enhancing delivery of nucleic acids into cells and for modifying expression of target genes in cells |
| US20090136957A1 (en) * | 2007-09-15 | 2009-05-28 | Irena Ivanovska | Methods and compositions for regulating cell cycle progression via the miR-106B family |
Family Cites Families (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2003245455A1 (en) * | 2002-06-13 | 2003-12-31 | Amgen Inc. | Hammerhead ribozymes |
| DE60310944T3 (en) | 2002-08-05 | 2017-08-03 | Silence Therapeutics Gmbh | OTHER NEW FORMS OF INTERFERING RNS MOLECULES |
| US7683036B2 (en) | 2003-07-31 | 2010-03-23 | Regulus Therapeutics Inc. | Oligomeric compounds and compositions for use in modulation of small non-coding RNAs |
| WO2005056761A2 (en) * | 2003-12-05 | 2005-06-23 | Massachusetts Institute Of Technology | REAGENTS AND METHODS FOR IDENTIFICATION OF RNAi PATHWAY GENES AND CHEMICAL MODULATORS OF RNAi |
| EP2302055B1 (en) | 2004-11-12 | 2014-08-27 | Asuragen, Inc. | Methods and compositions involving miRNA and miRNA inhibitor molecules |
| EP3889261A1 (en) | 2007-08-27 | 2021-10-06 | 1Globe Health Institute LLC | Compositions of asymmetric interfering rna and uses thereof |
| JP2012505657A (en) * | 2008-10-15 | 2012-03-08 | ソマジェニックス インク. | Short hairpin RNA for gene expression inhibition |
| US20100249214A1 (en) * | 2009-02-11 | 2010-09-30 | Dicerna Pharmaceuticals | Multiplex dicer substrate rna interference molecules having joining sequences |
| US8796238B2 (en) | 2009-09-17 | 2014-08-05 | Sigma-Aldrich Co. Llc | Short RNA mimetics |
-
2010
- 2010-09-13 US US13/496,772 patent/US8796238B2/en active Active
- 2010-09-13 WO PCT/US2010/048597 patent/WO2011034811A1/en not_active Ceased
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070185049A1 (en) * | 2001-05-18 | 2007-08-09 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of histone deacetylase (HDAC) gene expression using short interfering nucleic acid (siNA) |
| US20090042298A1 (en) * | 2004-05-04 | 2009-02-12 | Mdrna, Inc. | Compositions and methods for enhancing delivery of nucleic acids into cells and for modifying expression of target genes in cells |
| US20090136957A1 (en) * | 2007-09-15 | 2009-05-28 | Irena Ivanovska | Methods and compositions for regulating cell cycle progression via the miR-106B family |
Non-Patent Citations (1)
| Title |
|---|
| "Gene silencing using micro-RNA designed hairpins.", RNA., vol. 8, 2002, pages 842 - 850 * |
Cited By (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8796238B2 (en) | 2009-09-17 | 2014-08-05 | Sigma-Aldrich Co. Llc | Short RNA mimetics |
| US10760079B2 (en) | 2015-02-10 | 2020-09-01 | Genzyme Corporation | Variant RNAi |
| KR20170110149A (en) * | 2015-02-10 | 2017-10-10 | 젠자임 코포레이션 | Mutant RNAi |
| CN107438671A (en) * | 2015-02-10 | 2017-12-05 | 建新公司 | Variant rnai |
| JP2018506304A (en) * | 2015-02-10 | 2018-03-08 | ジェンザイム・コーポレーション | Variant RNAi |
| US10450563B2 (en) | 2015-02-10 | 2019-10-22 | Genzyme Corporation | Variant RNAi |
| WO2016130589A3 (en) * | 2015-02-10 | 2016-09-15 | Genzyme Corporation | VARIANT RNAi |
| CN107438671B (en) * | 2015-02-10 | 2021-05-25 | 建新公司 | variant RNAi |
| JP2021118740A (en) * | 2015-02-10 | 2021-08-12 | ジェンザイム・コーポレーション | Variant RNAi |
| US11781137B2 (en) | 2015-02-10 | 2023-10-10 | Genzyme Corporation | Variant RNAi |
| KR102670852B1 (en) | 2015-02-10 | 2024-05-29 | 젠자임 코포레이션 | Mutant RNAi |
| JP7526710B2 (en) | 2015-02-10 | 2024-08-01 | ジェンザイム・コーポレーション | Variant RNAi |
| US11603529B2 (en) | 2017-09-22 | 2023-03-14 | Genzyme Corporation | Variant RNAi |
| US12331296B2 (en) | 2017-09-22 | 2025-06-17 | Genzyme Corporation | Variant RNAi |
Also Published As
| Publication number | Publication date |
|---|---|
| US20120184726A1 (en) | 2012-07-19 |
| US8796238B2 (en) | 2014-08-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10870850B2 (en) | Chemical modification of short small hairpin RNAs for inhibition of gene expression | |
| EP1871426B1 (en) | Small activating rna molecules and their use | |
| EP1986697B1 (en) | Compositions and methods for inhibiting gene silencing by rna interference | |
| EP3236976B1 (en) | Rna interference agents for p21 gene modulation | |
| US8980855B2 (en) | Minor groove binder (MGB)-oligonucleotide miRNA antagonists | |
| EP2261334B1 (en) | Modified polynucleotides for use in RNA interference | |
| US20050176045A1 (en) | SNP discriminatory siRNA | |
| US20070167384A1 (en) | Modified polynucleotides for use in rna interference | |
| US20140080894A1 (en) | Enhanced biodistribution of oligomers | |
| US20070269889A1 (en) | Stabilized siRNAs as transfection controls and silencing reagents | |
| US20060223777A1 (en) | Highly functional short hairpin RNA | |
| WO2004090105A2 (en) | Modified polynucleotides for use in rna interference | |
| US20110054012A1 (en) | Methods and Compositions for Increasing Gene Expression | |
| US8796238B2 (en) | Short RNA mimetics | |
| US9045751B2 (en) | Modified small activating RNA molecules and methods of use | |
| JP7241098B2 (en) | Anti-fibrosis agent | |
| US20100009451A1 (en) | Compositions and methods for specifically silencing a target nucleic acid |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10817698 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13496772 Country of ref document: US |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 10817698 Country of ref document: EP Kind code of ref document: A1 |




