WO2011008535A1 - Production of fatty alcohols with fatty alcohol forming acyl-coa reductases (far) - Google Patents

Production of fatty alcohols with fatty alcohol forming acyl-coa reductases (far) Download PDF

Info

Publication number
WO2011008535A1
WO2011008535A1 PCT/US2010/040368 US2010040368W WO2011008535A1 WO 2011008535 A1 WO2011008535 A1 WO 2011008535A1 US 2010040368 W US2010040368 W US 2010040368W WO 2011008535 A1 WO2011008535 A1 WO 2011008535A1
Authority
WO
WIPO (PCT)
Prior art keywords
far
seq
fatty
enzyme
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2010/040368
Other languages
French (fr)
Inventor
Robert Mcdaniel
Behnaz Behrouzian
Louis Clark
Douglas Hattendorf
Fernando Valle
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Codexis Inc
Original Assignee
Codexis Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=43411858&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2011008535(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Codexis Inc filed Critical Codexis Inc
Priority to BRPI1013277A priority Critical patent/BRPI1013277A2/en
Priority to CA2766585A priority patent/CA2766585C/en
Priority to RU2012102900/10A priority patent/RU2012102900A/en
Priority to EP10800295.7A priority patent/EP2449124B1/en
Priority to CN201080029116.8A priority patent/CN102471781B/en
Publication of WO2011008535A1 publication Critical patent/WO2011008535A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C—CHEMISTRY; METALLURGY
    • C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
    • C10L—FUELS NOT OTHERWISE PROVIDED FOR; NATURAL GAS; SYNTHETIC NATURAL GAS OBTAINED BY PROCESSES NOT COVERED BY SUBCLASSES C10G OR C10K; LIQUIFIED PETROLEUM GAS; USE OF ADDITIVES TO FUELS OR FIRES; FIRE-LIGHTERS
    • C10L1/00—Liquid carbonaceous fuels
    • C10L1/02—Liquid carbonaceous fuels essentially based on components consisting of carbon, hydrogen, and oxygen only
    • C10L1/026—Liquid carbonaceous fuels essentially based on components consisting of carbon, hydrogen, and oxygen only for compression ignition
    • C—CHEMISTRY; METALLURGY
    • C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
    • C10L—FUELS NOT OTHERWISE PROVIDED FOR; NATURAL GAS; SYNTHETIC NATURAL GAS OBTAINED BY PROCESSES NOT COVERED BY SUBCLASSES C10G OR C10K; LIQUIFIED PETROLEUM GAS; USE OF ADDITIVES TO FUELS OR FIRES; FIRE-LIGHTERS
    • C10L1/00—Liquid carbonaceous fuels
    • C10L1/04—Liquid carbonaceous fuels essentially based on blends of hydrocarbons
    • C—CHEMISTRY; METALLURGY
    • C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
    • C10L—FUELS NOT OTHERWISE PROVIDED FOR; NATURAL GAS; SYNTHETIC NATURAL GAS OBTAINED BY PROCESSES NOT COVERED BY SUBCLASSES C10G OR C10K; LIQUIFIED PETROLEUM GAS; USE OF ADDITIVES TO FUELS OR FIRES; FIRE-LIGHTERS
    • C10L1/00—Liquid carbonaceous fuels
    • C10L1/10—Liquid carbonaceous fuels containing additives
    • C10L1/14—Organic compounds
    • C10L1/18—Organic compounds containing oxygen
    • C10L1/19—Esters ester radical containing compounds; ester ethers; carbonic acid esters
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0008—Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6436—Fatty acid esters
    • C12P7/649—Biodiesel, i.e. fatty acid alkyl esters
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00—Technologies for the production of fuel of non-fossil origin
    • Y02E50/10—Biofuels, e.g. bio-diesel

Definitions

  • Diesel fuel is any fuel used in diesel engines and includes both petrodiesel and biodiesel.
  • Petrodiesel is a specific fractional distillate of fossil fuel oil. It is comprised of about 75% saturated hydrocarbons and 25% aromatic hydrocarbons.
  • Biodiesel is not derived from petroleum but from vegetable oil or animal fats and contains long chain alkyl esters. Biodiesel is made by the transesterification of lipids (e.g., spent vegetable oil from fryers or seed oils) with an alcohol and burns cleaner than petrodiesel. Biodiesel can be used alone or mixed with petrodiesel in any amount for use in modern engines.
  • lipids e.g., spent vegetable oil from fryers or seed oils
  • Kerosene is a combustible hydrocarbon that is also a specific fractional distillate of fossil fuel and contains hydrocarbons having 6 to 16 carbon atoms. Kerosene has a heat of combustion comparable to that of petrodiesel and is widely used in jet fuel to power jet engines and for heating in certain countries. Kerosene-based fuels can also be burned with liquid oxygen and used as rocket fuel (e.g., RP-I).
  • Fuels such as biodiesel, that are made from animal or vegetable products burn cleaner than petroleum-derived fuels and do not produce a net increase in greenhouse gases. Furthermore, they are a sustainable energy source and have the potential to reduce the United States' reliance on imported petroleum-based products. However, there is a concern that using land to produce fuel crops rather than food crops will contribute to world hunger.
  • Fatty acids are the principle component of cell membranes and are used by nearly all organisms as a primary source of energy storage.
  • Fatty alcohols are the reduction products of fatty acids and, like fatty acids, can be produced enzymatically by cultured cells. Fatty alcohols can be reacted with acids to form ester compositions similar to those present in biodiesel fuel, or reduced to form kerosene-like compositions, or hydrocarbon compositions similar to petrodiesel.
  • Enzymes that convert fatty acyl- thioester substrates e.g., fatty acyl-CoA or fatty acyl-ACP
  • fatty alcohol forming acyl-CoA reductases or fatty acyl reductases FARs
  • PCT Publication No. WO 2007/136762 discloses genetically engineered microorganisms for the production of fatty acid derivatives and methods of their use.
  • PCT Publication No. WO 2009/140695 discloses compositions comprising cyanobacterial genes encoding enzymes involved in hydrocarbon biosynthesis and methods of using then in the production of aldehydes and alcohols.
  • Schirmer, 2009, Current Opinion in Microbiology 12:274-281 describes the fermentative and nonfermentative metabolism of heterotrophic microorganisms used in the production of fuel-like molecules, biocatalysts that convert metabolic intermediates into fuel-like molecules, and the parameters that govern the cost effective production of such fuel-like molecules.
  • FAR fatty acyl reductase
  • Moto et al. (2003) Proc. Nat'lAcad. Sci USA 100(16):9156-9161 discloses the isolation and characterization of a FAR enzyme from the silk moth Bombyx mori
  • these FAR enzymes could be expressed in heterologous hosts as a means of producing a non-petroleum-based, renewable source of fatty alcohols or derivative compositions for use in biofuels.
  • heterologous hosts such as E. coli and yeast
  • the yields of fatty alcohols obtained have been insufficient for certain applications.
  • only a small fraction of the produced fatty alcohols are secreted by the microorganisms, increasing substantially the cost of purification.
  • the present disclosure provides isolated fatty acyl reductase (FAR) enzymes, nucleic acids encoding the FAR enzymes, recombinant microorganisms engineered to express the FAR enzymes, methods of producing fatty alcohols and other compositions utilizing the FAR enzymes and/or recombinant microorganisms, and compositions comprising and/or that are derived from the fatty alcohols.
  • FAR fatty acyl reductase
  • FAR_Ocs Bermanella marisrubri RED65
  • FAR enzymes that are especially suitable for the production of fatty alcohols may be identified using Hidden Markov Models
  • HMMs which identify proteins by similarity to patterns found in pre-complied sets of protein sequences.
  • the patterns inherent in each pre-complied set are encapsulated in HMMs. It is the HMM for a given sequence set that defines a protein domain or protein family. Using this technique it is possible to classify portions of a given protein sequence that share common domains with previously-identified suitable FAR enzymes. See, e.g., http://pfam.sanger.ac.uk/.
  • the HMMs are used to identify NAD binding domains and/or sterile domains.
  • the present disclosure provides isolated FAR enzymes derived from or obtained from marine bacteria, such as marine
  • the FAR enzyme is isolated directly from the marine gammaproteobacteria in which it occurs naturally.
  • the FAR enzyme and/or a function fragment is isolated from a heterologous host microorganism engineered to express the FAR enzyme or functional fragment.
  • the present invention relates to a FAR enzyme and functional fragment thereof derived or obtained from M. algicola strain DG893.
  • the FAR enzyme or functional fragment thereof has an amino acid sequence that is at least 30 % identical, at least 75% identical, at least 80% identical and at least 90% identical to SEQ ID NO: 2 or a functional fragment thereof.
  • the isolated FAR enzyme has an amino acid sequence that is identical to SEQ ID NO: 2.
  • the present invention relates to a FAR enzyme and functional fragment thereof derived or obtained from a strain of Oceanohacter.
  • the FAR enzyme is obtained or derived from Oceanobacter strain RED65 and has an amino acid sequence that is at least 30 % identical, at least 75% identical, at least 80% identical, and at least 90% identical to SEQ ID NO: 6.
  • the isolated FAR enzyme has an amino acid sequence that is identical to SEQ ID NO: 6.
  • the present disclosure provides polynucleotides encoding a marine gammaproteobacterial FAR enzyme, or functional fragment thereof, as described above.
  • the polynucleotide can be a DNA or RNA, and can be single-stranded or double-stranded. It can be isolated from a naturally occurring microorganism, or prepared wholly or partially via synthetic means.
  • the nucleic acid sequence encodes a fatty acyl-CoA reductase (FAR) enzyme comprising an amino acid sequence having at least 30% sequence identity to SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 14 or functional fragments thereof.
  • FAR fatty acyl-CoA reductase
  • the nucleic acid encodes a FAR enzyme comprising at least 75% sequence identity (that is at least 75%, at least 80%, at least 90%, at least 95% and even 100% sequence identity) to SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 14 or a functional fragment thereof.
  • a vector comprises the nucleic acid encoding the FAR enzyme.
  • the polynucleotide encoding the FAR enzyme or functional fragment thereof is operably linked to a promoter, and optionally, to other control sequences and elements that control expression.
  • the vector is designed or selected so as to remain distinct from the genome of the host microorganism (for example, a plasmid) or to integrate into the genome of the host microorganism for example by either homologous recombination or site-specific integration.
  • the codons of the portion of the construct encoding the FAR enzyme or functional fragment are optimized for expression in a particular host microorganism.
  • the present disclosure provides recombinant microorganisms engineered to express a heterologous marine gammaproteobacterial FAR gene, or a functional fragment thereof, as described herein.
  • recombinant host cells include bacteria, filamentous fungi and yeast.
  • bacteria are E. coli.
  • the yeast is an oleaginous yeast.
  • the oleaginous yeast is Y. Hpolytica.
  • the yeast is S. cerevisiae.
  • the microorganisms are wild-type microorganisms. In other aspects, the microorganisms are genetically modified.
  • the genetically modified microorganism further over expresses a gene encoding a protein that increases the rate at which the microorganism produces the substrate of a FAR enzyme, i.e., a fatty acyl-thioester substrate.
  • the enzyme encoded by the over expressed gene is directly involved in fatty acid synthesis.
  • the enzyme encoded by the over expressed gene is selected from a fatty acid synthase, an acyl-ACP thioesterase, a fatty acyl-CoA synthase and an acetyl-CoA carboxylase.
  • the protein encoded by the over expressed gene is endogenous to the microorganism. In other embodiments, the protein encoded by the over expressed gene is heterologous to the microorganism.
  • the present disclosure provides methods of producing compositions comprising fatty alcohols and/or acid esters and/or alkanes and/or alkenes derived from the fatty alcohols.
  • the fatty alcohols are produced in a cell-free system where a FAR enzyme as described above is provided with a fatty acyl-thioester substrate and necessary cofactors under suitable conditions of temperature, pH and ionic strength for a time sufficient to produce fatty alcohols.
  • fatty alcohols are produced by a recombinant host cell comprising a heterologous gene encoding a FAR enzyme described above.
  • the host cell is cultured in an aqueous nutrient medium comprising an assimilable carbon source under conditions suitable for production of fatty alcohols.
  • the recombinant host cell is a bacterium or yeast.
  • the yeast is an oleaginous yeast.
  • the bacterium is E. coli and the yeast is selected from S. cerevisiae and Y. lipolytica.
  • the fatty alcohols are produced by a recombinant host cell comprising a heterologous gene encoding a FAR enzyme and one or more proteins that increase the rate at which the recombinant host cell produces the acyl- thioester substrate for FAR.
  • the one or more proteins are directly involved in fatty acid biosynthesis.
  • the one or more proteins are selected from a fatty acid synthase, an acyl-ACP thioesterase, a fatty acyl- CoA synthase and an acetyl-CoA carboxylase.
  • the fatty alcohols produced by the recombinant microorganisms are secreted from the cells into the aqueous nutrient medium.
  • the methods described herein include a step of isolating the fatty alcohols.
  • the invention relates to a method of producing a fatty alcohol composition
  • a method of producing a fatty alcohol composition comprising culturing a recombinant microorganism in a suitable culture medium wherein the recombinant microorganism comprises a gene encoding a heterologous fatty acyl reductase (FAR) enzyme having at least 30% sequence identity to SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 14 or a functional fragment thereof and allowing expression of said gene wherein said expression results in the production of a composition of fatty alcohols.
  • the method further comprises isolating the produced fatty alcohols.
  • the methods described herein produce at least about 0.5 g/L of fatty alcohols, also at least 5g/L and even at least 15 g/L of fatty alcohols.
  • the invention relates to a method of producing a fatty alcohol composition by an acyl-CoA independent pathway comprising culturing a recombinant E.co ⁇ i in a nutrient medium under suitable conditions, wherein said recombinant E.coli comprises a nucleic acid sequence encoding a heterologous fatty acyl- CoA reductase (FAR) enzyme comprising an amino acid sequence having at least 75% (such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97% and even 100%) sequence identity to SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 14 or functional fragments thereof; allowing expression of said FAR; and producing a fatty alcohol composition.
  • FAR heterologous fatty acyl- CoA reductase
  • the recombinant microorganism engineered to express a FAR encompassed by the invention is a bacterium and particularly an E.coli comprising an inactivated or silenced endogenous fatty acyl-CoA synthetase fadD gene.
  • the recombinant E. coli will comprise an inactivated or silenced endogenous short chain fatty acyl-CoA synthetase fadK gene.
  • both genes will be inactivated or silenced.
  • the present disclosure provides for fatty alcohol compositions produced by a method described above.
  • the fatty alcohol composition is produced in a cell-free system.
  • the fatty alcohol composition is produced by a recombinant host cell, hi particular embodiments, the compositions comprise fatty alcohols with saturated, unsaturated, linear, branched or cyclic hydrocarbon chains.
  • the compositions comprise saturated fatty alcohols and/or monounsaturated fatty alcohols.
  • the present disclosure provides for compositions comprising alkanes and/or alkenes derived by reducing the fatty alcohol compositions described herein.
  • the reduction reaction is carried out chemically.
  • the reduction reaction is carried out using a microorganism that has a biosynthetic pathway for reducing fatty alcohols.
  • the compositions produced by reduction of fatty alcohols comprise substantially all alkanes and/or alkenes.
  • the compositions comprise a mixture of fatty alcohols and alkanes and/or alkenes derived there from.
  • the present disclosure provides for fuel compositions comprising fatty alcohols and/or acid esters and/or alkanes and/or alkenes derived there from.
  • the fatty alcohol compositions produced by the methods described above are used directly in fuel compositions.
  • the fatty alcohols are reacted with a carboxylic acid to produce acid esters for use as biodiesel fuel compositions.
  • the fatty alcohols are reacted with a reducing agent to produce alkanes and/or alkenes.
  • the fatty alcohols undergo esterifcation to form fatty esters.
  • the alkanes and/or alkenes derived from the fatty alcohol compositions are used as components of jet fuel compositions. In other embodiments, the alkanes and/or alkenes derived are used as components of rocket fuel. In still other embodiments, alkanes and/or alkenes derived from the fatty alcohol compositions are used as components of petrodiesel-like fuel compositions.
  • FIG. 1 shows the replicative Y. lipolytica vector pCEN411 (approximately
  • Arsl8 is an autonomous replicating sequence isolated from Y. lipolytica chromosomal DNA.
  • FIG. 2 shows a codon optimized polynucleotide sequence (SEQ ID NO: 1) encoding a FAR enzyme of Marinobacter algicola strain DG893 having the amino acid sequence shown in FIG. 6 (SEQ ID NO: 2).
  • FIG. 3 shows a codon optimized polynucleotide sequence (SEQ ID NO: 3) encoding a FAR enzyme of Marinobacter algicola strain DG893 having the amino acid sequence shown in FIG. 6 (SEQ ID NO: 4) and optimized for expression in Y. lipolytica.
  • FIG. 4 shows a codon optimized polynucleotide sequence (SEQ ID NO: 5) encoding a FAR enzyme of Oceanobacter sp. .strain RED65 having the amino acid sequence shown in FIG. 7 (SEQ ID NO: 6).
  • FIG. 5 shows a codon optimized polynucleotide sequence (SEQ ID NO: 7) encoding a FAR enzyme of Oceanobacter sp. strain RED65 having the amino acid sequence shown in FIG. 7 (SEQ ID NO: 8) and optimized for expression in Y. Hpolytica.
  • FIG. 6 shows the amino acid sequence of a FAR polypeptide of
  • the amino acid sequence (SEQ ID NO: 2) encoded by the polynucleotide sequence of SEQ ID NO: 1 is identical to the amino acid sequence (SEQ ID NO: 4) encoded by the polynucleotide sequence of SEQ ID NO: 3. While it is understood that both SEQ ID NO: 2 and SEQ ID NO: 4 are identical and interchangeable, reference will generally be made to SEQ ID NO: 2 in this disclosure.
  • FIG. 7 shows the amino acid sequence of a FAR polypeptide of
  • the amino acid sequence (SEQ ID NO: 6) encoded by the polynucleotide sequence of SEQ ID NO: 5 is identical to the amino acid sequence (SEQ ID NO: 8) encoded by the polynucleotide sequence of SEQ ID NO: 7. While it is understood that both SEQ ID NO: 6 and SEQ ID NO: 8 are identical and interchangeable reference will generally be made to SEQ ID NO: 6 in this disclosure.
  • the amino acid sequence of SEQ ID NO: 2 and the amino acid sequence of SEQ ID NO: 6 are about 47% identical.
  • FIG. 8 shows a codon optimized polynucleotide sequence (SEQ ID NO: 9) encoding a FAR polypeptide (SEQ ID NO: 10) from the silk moth B. mori.
  • FIG. 9 shows the amino acid sequence (SEQ ID NO: 10 and SEQ ID NO:
  • FIG. 10 shows a codon optimized polynucleotide sequence (SEQ ID NO:
  • FIG. 11 shows a codon optimized polynucleotide sequence (SEQ ID NO:
  • FIG. 12 shows the amino acid sequence of a FAR polypeptide of
  • Marinobacter aquaeolei (SEQ ID NO: 14).
  • the amino acid sequence of M. aquaeolei (SEQ ID NO: 14) has about 78% sequence identity to the amino acid sequence of M. algicola DG893 (SEQ ID NO: 2).
  • FIG. 13 depicts biosynthetic pathways for fatty alcohol production via a) an acyl-CoA dependent pathway utilizing fatty acyl-ACP and fatty acyl-CoA
  • the present disclosure provides FAR enzymes, recombinant host cells comprising a nucleic acid encoding a heterologous FAR enzyme, processes for the biosynthesis of fatty alcohols including the conversion of fatty acyl-thioester complexes (such as fatty acyl-CoA substrates and fatty acyl-ACP substrates) to fatty alcohols, and compositions comprising fatty alcohols produced by the biosynthetic methods.
  • fatty acyl-thioester complexes such as fatty acyl-CoA substrates and fatty acyl-ACP substrates
  • FAR denotes fatty acyl reductase or fatty alcohol forming acyl-CoA reductase
  • ACP denotes acyl carrier protein
  • CoA denotes coenzyme A
  • TE denotes thioesterase
  • FAS denotes fatty acid synthase
  • FACR denotes fatty acyl-CoA reductase
  • FACS denotes fatty acyl-CoA synthase (synthetase) and acyl-CoA synthase (synthetase) as used interchangeably herein
  • ACC denotes acetyl-CoA carboxylase.
  • Fatty alcohol forming acyl-CoA reductase or "fatty acyl reductase” as used interchangeably herein refers to an enzyme that catalyzes the reduction of a fatty acyl-CoA, a fatty acyl- ACP, or other fatty acyl thioester complex to a fatty alcohol, which is linked to the oxidation of NAD(P)H to NAD(P) + , as shown in Scheme I:
  • R represents a C 8 to C24 saturated, unsaturated, linear, branched or cyclic hydrocarbon
  • R 1 represents CoA, ACP or other fatty acyl thioester substrates.
  • CoA is a non-protein acyl carrier group factor (or moiety) involved in the synthesis and oxidation of fatty acids.
  • ACP is a polypeptide or protein subunit of fatty acid synthase used in the synthesis of fatty acids.
  • FARs are distinct from FACRs. FACRs reduce only fatty acyl-CoA intermediates to fatty aldehydes and require an additional oxidoreductase enzyme to generate the corresponding fatty alcohol.
  • Fatty aldehyde as used herein refers to a saturated or unsaturated aliphatic aldehyde and reference is made to FIG. 13, wherein R is as defined above.
  • fatty acid refers to a compound of formula III:
  • fatty alcohol refers to an aliphatic alcohol of the formula (II) wherein R is as defined above.
  • Saturated or unsaturated fatty alcohols can be described as "Ca:b-OH", wherein “a” is an integer that represents the total number of carbon atoms in the fatty alcohol and “b” is an integer that refers to the number of double bonds in carbon chain.
  • Unsaturated fatty acids or fatty alcohols can be referred to as "cis ⁇ x " or
  • fatty acyl-thioester or "fatty acyl-thioester complex” refers to a compound of formula (I), wherein a fatty acyl moiety is covalently linked via a thioester linkage to a carrier moiety.
  • Fatty acyl-thioesters are substrates for the FAR enzymes described herein.
  • fatty acyl-CoA refers to a compound of formula (I) wherein R 1 is Coenzyme A.
  • fatty acyl- ACP refers to a compound of formula (I) wherein Rj is acyl carrier protein.
  • acyl-CoA independent pathway refers to the production of fatty alcohols by the direct enzymatic conversion of fatty acyl- ACP substrates to fatty alcohols and does not involve the use of free fatty acids or fatty acyl-CoA intermediates.
  • This biosynthetic pathway differs from a) the fatty acyl-CoA dependent pathway which converts fatty acyl-ACP directly to fatty acyl CoA via an acyl-transfer reaction, such as in yeast, and b) the fatty acyl-CoA dependent pathway which converts fatty acyl-ACP to fatty acyl-CoA via a free fatty acid intermediate, such as in bacteria and reference is made to FIG. 13.
  • the acyl-CoA independent pathway has the advantage of bypassing the step of form a fatty acyl-CoA substrate from free fatty acid, which requires the use of ATP. Therefore, the acyl-CoA independent pathway may use less energy than the acyl- CoA dependent pathway that utilizes a free fatty acid intermediate.
  • Conversion refers to the enzymatic conversion of the substrate to the corresponding product.
  • Percent conversion refers to the percent of the substrate that is reduced to the product within a period of time under specified conditions.
  • the "enzymatic activity” or “activity” of a polypeptide can be expressed as “percent conversion” of the substrate to the product.
  • polynucleotides and polypeptides are determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which may also contain gaps to optimize the alignment) for alignment of the two sequences.
  • the percentage may be calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (including positions where one of the sequences has a gap) and
  • the percentage may be calculated by determining the number of positions at which either the identical nucleic acid base or amino acid residue occurs in both sequences or a nucleic acid base or amino acid residue is aligned with a gap to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity.
  • Alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith and Waterman, 1981, Adv. Appl. Math. 2:482, by the homology alignment algorithm of Needleman and Wunsch, 1970, J. MoI. Biol. 48:443, by the search for similarity method of Pearson and Lipman, 1988, Proc. Natl. Acad. Sci. USA 85:2444, by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the GCG Wisconsin Software Package), or by visual inspection (see generally, Current Protocols in Molecular Biology, F. M. Ausubel et ah, eds., Current Protocols, a joint venture between Greene Publishing Associates, Inc.
  • BLAST and BLAST 2.0 algorithms which are described in Altschul et ah, 1990, J. MoI. Biol. 215: 403-410 and Altschul et al., 1977, Nucleic Acids Res. 3389-3402, respectively.
  • Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information website.
  • This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive- valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as, the neighborhood word score threshold (Altschul et al, supra). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased.
  • Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always ⁇ 0).
  • M forward score for a pair of matching residues; always >0
  • N penalty score for mismatching residues; always ⁇ 0.
  • a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached.
  • the BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.
  • the BLASTP program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff and Henikoff, 1989, Proc Natl Acad Sci USA 89:10915).
  • Exemplary determination of sequence alignment and % sequence identity can employ the BESTFIT or GAP programs in the GCG Wisconsin Software package (Accelrys, Madison WI), using default parameters provided.
  • Reference sequence refers to a defined sequence used as a basis for a sequence comparison.
  • a reference sequence may be a subset of a larger sequence, for example, a segment of a full-length gene or polypeptide sequence.
  • a reference sequence is at least 20 nucleotide or amino acid residues in length, at least 25 residues in length, at least 50 residues in length, or the full length of the nucleic acid or polypeptide.
  • two polynucleotides or polypeptides may each (1) comprise a sequence ⁇ i.e., a portion of the complete sequence) that is similar between the two sequences, and (2) may further comprise a sequence that is divergent between the two sequences, sequence comparisons between two (or more) polynucleotides or polypeptide are typically performed by comparing sequences of the two polynucleotides over a "comparison window" to identify and compare local regions of sequence similarity.
  • Comparison window refers to a conceptual segment of at least about 20 contiguous nucleotide positions or amino acids residues wherein a sequence may be compared to a reference sequence of at least 20 contiguous nucleotides or amino acids and wherein the portion of the sequence in the comparison window may comprise additions or deletions (i.e., gaps) of 20 percent or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.
  • the comparison window can be longer than 20 contiguous residues, and includes, optionally 30, 40, 50, 100, or longer windows.
  • Constant amino acid substitutions or mutations refer to the interchangeability of residues having similar side chains, and thus typically involves substitution of the amino acid in the polypeptide with amino acids within the same or similar defined class of amino acids.
  • conservative mutations do not include substitutions from a hydrophilic to hydrophilic, hydrophobic to hydrophobic, hydroxyl-containing to hydroxyl-containing, or small to small residue, if the conservative mutation can instead be a substitution from an aliphatic to an aliphatic, non-polar to non- polar, polar to polar, acidic to acidic, basic to basic, aromatic to aromatic, or constrained to constrained residue.
  • A, V, L, or I can be conservatively mutated to either another aliphatic residue or to another non-polar residue. Table 1 below shows exemplary conservative substitutions.
  • Non-conservative substitution refers to substitution or mutation of an amino acid in the polypeptide with an amino acid with significantly differing side chain properties. Non-conservative substitutions may use amino acids between, rather than within, the defined groups listed above.
  • a non-conservative mutation affects (a) the structure of the peptide backbone in the area of the substitution (e.g., proline for glycine) (b) the charge or hydrophobicity, or (c) the bulk of the side chain.
  • “Deletion” refers to modification to the polypeptide by removal of one or more amino acids from the reference polypeptide.
  • Deletions can comprise removal of 1 or more amino acids, 2 or more amino acids, 5 or more amino acids, 10 or more amino acids, 15 or more amino acids, or 20 or more amino acids, up to 10% of the total number of amino acids, or up to 20% of the total number of amino acids making up the reference enzyme while retaining enzymatic activity and/or retaining the improved properties of an engineered enzyme.
  • Deletions can be directed to the internal portions and/or terminal portions of the polypeptide.
  • the deletion can comprise a continuous segment or can be discontinuous.
  • the term “deletion” is also used to refer to a DNA modification in which one or more nucleotides or nucleotide base-pairs have been removed, as compared to the corresponding reference, parental or "wild type" DNA.
  • Insertions refers to modification to the polypeptide by addition of one or more amino acids to the reference polypeptide.
  • the modification comprises insertions of one or more amino acids to the naturally occurring polypeptide as well as insertions of one or more amino acids to other modified polypeptides.
  • Insertions can be in the internal portions of the polypeptide, or to the carboxy or amino terminus. Insertions as used herein include fusion proteins as is known in the art. The insertion can be a contiguous segment of amino acids or separated by one or more of the amino acids in the naturally occurring polypeptide.
  • insertion is also used to refer to a DNA modification in which or more nucleotides or nucleotide base-pairs have been inserted, as compared to the corresponding reference, parental or "wild type" DNA.
  • "Different from” or “differs from” with respect to a designated reference sequence refers to difference of a given amino acid or polynucleotide sequence when aligned to the reference sequence. Generally, the differences can be determined when the two sequences are optimally aligned. Differences include insertions, deletions, or substitutions of amino acid residues in comparison to the reference sequence.
  • the phrase "derived from" a particular organism refers to a wild-type polynucleotide or polypeptide that originates in the organism and to mutant and variants thereof that either originate in the organism or are produced by human manipulation of the wild-type polynucleotide or polypeptide.
  • “Functional fragment” as used herein refers to a polypeptide that has an amino-terminal and/or carboxy-terminal deletion, but where the remaining amino acid sequence is identical to the corresponding positions in the sequence and that retains substantially all of the activity of the full-length polypeptide.
  • Functional fragments can comprise up to 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99% of the full-length polypeptide.
  • Endogenous polynucleotide, gene, promoter or polypeptide refers to any polynucleotide, gene, promoter or polypeptide that originates in a particular host cell.
  • a polynucleotide, gene, promoter or polypeptide is not endogenous to a host cell if it has been removed from the host cell, subjected to laboratory manipulation, and then reintroduced into a host cell.
  • Heterologous polynucleotide, gene, promoter or polypeptide refers to any polynucleotide, gene, promoter or polypeptide that is introduced into a host cell that is not normally present in that cell, and includes any polynucleotide, gene, promoter or polypeptide that is removed from the host cell and then reintroduced into the host cell.
  • “Inactive” or “inactivated” in reference to a gene refers to a gene having at least one function that is impaired. Genes can be inactivated in a variety of ways known in the art, including but not limited to insertion of a mobile genetic element (e.g., a transposon); deletion of all or part of the gene, such that the gene product is not made, or is truncated and is non-functional; mutation of the gene such that the gene product is not made, or is truncated and is non-functional; deletion or mutation of one or more control elements that control expression of the gene such that the gene product is not made; and the like. In certain embodiments genes can ne inactivated by methods other than genetic modification, for example, by gene silencing at the transcriptional level or at the post- transcriptional level using for example RNAi.
  • a mobile genetic element e.g., a transposon
  • deletion of all or part of the gene such that the gene product is not made, or is truncated and is non-
  • Recombinant host cell refers to a cell into which has been introduced a heterologous polynucleotide, gene, promoter, e.g., an expression vector, or to a cell having a heterologous polynucleotide or gene integrated into the genome.
  • Naturally-occurring or “wild-type” refers to the form found in nature.
  • a naturally occurring or wild-type polypeptide or polynucleotide sequence is a sequence present in an organism that can be isolated from a source in nature and which has not been intentionally modified by human manipulation.
  • a wild-type organism refers to an organism that has not been intentionally modified by human manipulation.
  • Codon optimized refers to changes in the codons of the polynucleotide encoding a protein to those preferentially used in a particular organism such that the encoded protein is efficiently expressed in the organism of interest.
  • the genetic code is degenerate in that most amino acids are represented by several codons, called “synonyms” or “synonymous” codons, it is well known that codon usage by particular organisms is nonrandom and biased towards particular codon triplets. This codon usage bias may be higher in reference to a given gene, genes of common function or ancestral origin, highly expressed proteins versus low copy number proteins, and the aggregate protein coding regions of an organism's genome.
  • the genetic code is degenerate in that most amino acids are represented by several codons, called “synonyms” or “synonymous” codons, it is well known that codon usage by particular organisms is nonrandom and biased towards particular codon triplets. This codon usage bias may be higher in reference to a given gene
  • polynucleotides encoding enzymes may be codon optimized for optimal production from the host organism selected for expression.
  • Preferred, optimal, high codon usage bias codons refers interchangeably to codons that are used at higher frequency in the protein coding regions than other codons that code for the same amino acid.
  • the preferred codons may be determined in relation to codon usage in a single gene, a set of genes of common function or origin, highly expressed genes, the codon frequency in the aggregate protein coding regions of the whole organism, codon frequency in the aggregate protein coding regions of related organisms, or combinations thereof. Codons whose frequency increases with the level of gene expression are typically optimal codons for expression.
  • codon frequency e.g., codon usage, relative synonymous codon usage
  • codon preference in specific organisms, including multivariate analysis, for example, using cluster analysis or correspondence analysis, and the effective number of codons used in a gene
  • Codon usage tables are available for a growing list of organisms (see for example, Wada et al., 1992, Nucleic Acids Res. 20:2111-2118;
  • nucleic acid sequences actually known to encode expressed proteins e.g., complete protein coding sequences-CDS
  • expressed sequence tags ESTs
  • predicted coding regions of genomic sequences see for example, Mount, D., Biomformatics: Sequence and Genome Analysis, Chapter 8, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., 2001; Uberbacher, E. C, 1996, Methods Enzymol. 266:259-281; Tiwari et al., 1997, Comput. Appl. Biosci.
  • “Expression” as used herein may include any step involved in the production of the FAR polypeptides including but not limited to transcription and translation.
  • Control sequence is defined herein to include all components, which are necessary or advantageous for the expression of a polypeptide of the present disclosure.
  • Each control sequence may be native or foreign to the nucleic acid sequence encoding the polypeptide.
  • Such control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence, and transcription terminator.
  • the control sequences include a promoter, and transcriptional and translational stop signals.
  • the control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the nucleic acid sequence encoding a polypeptide.
  • operably linked and “operably associated” are defined herein as a configuration in which a control sequence is appropriately placed at a position relative to the coding sequence of the DNA sequence such that the control sequence directs the expression of a polynucleotide and/or polypeptide.
  • Promoter sequence is a nucleic acid sequence that is recognized by a host cell for expression of the coding region.
  • the control sequence may comprise an appropriate promoter sequence.
  • the promoter sequence contains transcriptional control sequences, which mediate the expression of the polypeptide.
  • the promoter may be any nucleic acid sequence which shows transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either endogenous or heterologous to the host cell.
  • transformed or “transformation” used in reference to a cell means a cell has a non-native nucleic acid sequence integrated into its genome or as a plasmid that is maintained through multiple generations.
  • the present disclosure provides FAR enzymes derived from or obtained from gammaproteobacteria (such as marine gammaproteobacteria) and/or functional fragments thereof having FAR activity, hi some embodiments, the FAR enzyme is isolated directly from the gammaproteobacteria in which it occurs naturally. In some embodiments, the FAR enzyme and/or a function fragment is isolated from a heterologous host microorganism engineered to express the FAR enzyme or functional fragment. The FAR enzyme and/or functional fragment can be derived or obtained from virtually any genus of marine gammaproteobacteria.
  • the FAR enzyme for use in the methods disclosed herein is endogenous to a marine bacterium, i.e., a bacterium mined from a marine environment. In various embodiments, the FAR enzyme for use in the methods disclosed herein is endogenous to an organism other than a marine bacterium.
  • the FAR enzyme and/or functional fragment can be derived or obtained from a gammaproteobacterium of the order Alteromonadales. In some embodiments, the FAR enzyme and/or functional fragment can be derived from or obtained from the Alteromonadales family Alteromonadaceae. In certain embodiments, the FAR enzyme and/or functional fragment can be derived from or obtained from an Alteromonadaceae genus such as but not limited to the Alteromonadaceae genus
  • the FAR enzyme and/or functional fragment can be derived from the Marinobacter species algicola.
  • the FAR enzyme and/or functional fragment can be derived from or obtained from the M. algicola species strain DG893.
  • the FAR enzyme for use in the methods disclosed herein is from the marine bacterium Marinobacter algicola (e.g., M. algicola) DG893 (SEQ ID NO: 2) ("FAR_Maa").
  • the FAR enzyme and/or functional fragment is derived or obtained from a species of Marinobacter including, but not limited to, a species selected from M. algicola, M. alkaliphilus, M. aquaeolei, M. arcticus, M. bryozoorum, M. daepoensis, M. excellens, M. flavimaris, M. guadonensis, M.
  • hydrocarbonoclasticus M. koreenis, M. lipolyticus, M. Htoralis, M. lutaoensis, M.
  • the FAR enzyme is derived or obtained from
  • M. algicola strain DG893 and has an amino acid sequence that is at least 30 % identical, at least 50% identical, at least 60% identical, at least 70% identical, at least 75%, at least 80% identical, at least 85% identical, at least 90% identical, at least 93% identical at least 95% identical, at least 97% identical and/or at least 98% identical to SEQ ID NO: 2 or a functional fragment thereof.
  • the isolated FAR enzyme has an amino acid sequence that is identical to SEQ ID NO: 2.
  • the FAR enzyme is derived or obtained from
  • Marinobacter aquaeolei has an amino acid sequence that is at least 30 % identical, at least 50% identical, at least 60% identical, at least 70% identical, at least 75%, at least 80% identical, at least 85% identical, at least 90% identical, at least 93% identical, at least 95% identical, at least 97% identical and/or at least 98% identical to SEQ ID NO: 14 or a functional fragment thereof.
  • the isolated FAR enzyme has an amino acid sequence that is identical to SEQ ID NO: 14.
  • the isolated FAR enzyme and/or functional fragment is obtained or derived from a marine bacterium selected from the group of Meptuniibacter caesariensis species strain MED92, Reinekea sp. strain MED297, Marinomonas sp. strain MED 121, unnamed gammaproteobacterium strain HTCC2207 and Marinobacter sp. strain ELB 17 and equivalents and synonymous species thereof.
  • the FAR enzyme and/or functional fragment can be derived or obtained from a gammaproteobacterium of the order Oceanospirillilales. In some embodiments, the FAR enzyme and/or functional fragment can be derived from or obtained from the Oceanospirillilales family Oceanospirillaceae. In certain embodiments, the FAR enzyme and/or functional fragment can be derived from or obtained from a Oceanospirillaceae genus, such as but not limited to Oceanobacter.
  • the FAR enzyme and/or iiinctional fragment can be derived from or obtained from the Oceanobacter species strain RED65 and has an amino acid sequence that is at least 30 % identical, at least 50% identical, at least 60% identical, at least 70% identical, at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 93% identical, at least 95% identical, at least 97% identical and/or at least 98% identical to SEQ ID NO: 6 or a functional fragment thereof.
  • the FAR enzyme for use in the methods disclosed herein comprises or consists of a sequence having 100% identity to the sequence of SED ID NO: 6
  • the isolated FAR enzyme or functional fragment is obtained or derived from Oceanobacter 5.000ii. In still other specific embodiments, the isolated FAR enzyme or functional fragment is obtained or derived from Oceanobacter strain WH099.
  • the FAR enzyme is from a marine bacterium and is selected from the group consisting of FAR Hch ( Hahella chejuensis KCTC 2396 GenBank YP_436183.1); FARJVIac (from marine actinobacterium strain PHSC20C1), FARJVC (JCVI_ORF_1096697648832, GenBank Accession No.
  • FAR_Fer JCVI_SCAF_1101670217388; from a marine bacterium found at a depth of 12m in an upwelling in the area of Fernandina Island, the Galapagos Islands, Ecuador
  • FAR Key JCVI_SCAF_1097205236585, from a marine bacterium found at a depth of 1.7m off the coast of Key West Florida
  • FAR_Gal FAR_Gal
  • the FAR enzyme is isolated or derived from the marine bacterium FAR GaI.
  • the FAR enzyme or functional fragment is isolated or derived from an organism selected from the group consisting of Vitis vinifera (GenBank Accession No. CAO22305.1 or CAO67776.1), Desulfatibacillum alkenivorans (GenBank Accession No. NZ_ABII01000018.1), Stigmatella aurantiaca (NZ_AAMD01000005.1) and Phytophthora ramorum (GenBank AccessionNo.:
  • a FAR enzyme or functional fragment thereof that is especially suitable for the production of fatty alcohols is identified by the presence of one or more domains, which are found in proteins with FAR activity.
  • the one or more domains is identified by multiple sequence alignments using hidden Markov models ("HMMs") to search large collections of protein families, for example, the Pfam collection available at http://pfam.sanger.ac.uk/. See R.D. Finn et al. (2008) Nucl. Acids Res. Database Issue 36:D281-D288.
  • HMMs hidden Markov models
  • NAD_binding_4 domain is found near the N-terminus of the putative FAR enzyme.
  • the sterile domain is found near the C-terminus of the putative FAR enzyme.
  • a FAR enzyme for use in the methods described herein is identified by the presence of at least one NAD_binding_4 domain near the N-terminus and the presence of at least one sterile domain near the C-terminus.
  • the NAD_binding_4 domain of the putative FAR enzyme has an amino acid sequence that is at least 10%, such as at least 15%, such as at least 20%, such as at least 25%, such as at least 30%, such as at least 35%, such as at least 40%, such as at least 45%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 85%, such as at least 90% or more identical to the amino acid sequence of a known NAD_binding_4 domain. See, e.g., Aarts MG et al. (1997) Plant J. 12:615-623.
  • the sterile domain of the putative FAR enzyme has an amino acid sequence that is at least 10%, such as at least 15%, such as at least 20%, such as at least 25%, such as at least 30%, such as at least 35%, such as at least 40%, such as at least 45%, such as at least 50% or more identical to the amino acid sequence of a known sterile domain. See id.
  • the NAD_binding_4 domain of the putative FAR enzyme has an amino acid sequence that is at least 10%, such as at least 15%, such as at least 20%, such as at least 25%, such as at least 30%, such as at least 35%, such as at least 40%, such as at least 45%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 85%, such as at least 90% or more identical to the amino acid sequence of one or more example polypeptides that form the definition of the NAD_binding_4 Pfam domain (PF07993).
  • the sterile domain of the putative FAR enzyme has an amino acid sequence that is at least 10%, such as at least 15%, such as at least 20%, such as at least 25%, such as at least 30%, such as at least 35%, such as at least 40%, such as at least 45%, such as at least 50% or more identical to the amino acid sequence of one or more example polypeptides that form the definition of the sterile Pfam domain (PF03015).
  • the NAD_binding_4 domain or the sterile domain of the putative FAR enzyme is identified by an E-value of Ixl0 "4 or less, such as an E- value of 1x10 "5 , such as an E- value of 1x10 " 10 , such as an E-value of IxIO "15 , such as an E-value of IxIO "20 , such as an E-value of IxIO "25 , such as an E-value of IxIO "30 or lower.
  • E-value of Ixl0 "4 or less such as an E- value of 1x10 "5 , such as an E- value of 1x10 " 10 , such as an E-value of IxIO "15 , such as an E-value of IxIO "20 , such as an E-value of IxIO "25 , such as an E-value of IxIO "30 or lower.
  • E-value of Ixl0 "4 or less such as an E- value of 1x10 "5 , such as an
  • E-value is the number of hits that would be expected to have a score equal or better than a particular hit by chance alone. Accordingly, the E-value is a criterion by which the significance of a database search hit can be evaluated. See, e.g.,
  • FAR enzymes described herein have not previously been recognized as FAR enzymes because of the low homology of the FAR coding sequences to the sequences coding for proteins with known FAR activity, such as the FAR enzymes from S. chinensis ((FAR Sim); GenBank Accession no. AAD38039.1;
  • the FAR enzyme for use in the disclosed methods of producing fatty alcohols is endogenous to a marine bacterium and has an amino acid sequence having less than about 35% sequence identity to the amino acid sequence of a known FAR enzyme, such as those described above.
  • the FAR enzyme for use in the methods disclosed herein is endogenous to a marine bacterium and has an amino acid sequence having less than about 33% sequence identity, such as less than 31% sequence identity, such as less than about 29% sequence identity, such as less than about 27% sequence identity, such as less than about 25% sequence identity, such as less than about 23% sequence identity, even such as less than about 22% sequence identity to the amino acid sequence of a polypeptide previously recognized as possessing FAR enzyme activity.
  • the FAR enzyme for use in the disclosed methods of producing fatty alcohols is endogenous to an organism selected from the group consisting Vitis vinifera, Desulfatibacittum alkenivorans, Stigmatella aurantiaca, and Phytophthora ramorum and has an amino acid sequence having less than about 65% sequence identity to the amino acid sequence of a known FAR enzyme, such as those described above.
  • the FAR enzyme for use in the methods disclosed herein is endogenous to a marine bacterium and has an amino acid sequence having less than about 60% sequence identity, such as less than 55% sequence identity, such as less than about 50% sequence identity, such as less than about 45% sequence identity, such as less than about 40% sequence identity, such as less than about 35% sequence identity, even such as less than about 34% sequence identity, such as less than about 33% sequence identity, such as less than about 32% sequence identity, such as less than about 31% sequence identity, such as less than about 30% sequence identity to the amino acid sequence of a polypeptide previously recognized as possessing FAR enzyme activity.
  • sequence identity having less than about 60% sequence identity, such as less than 55% sequence identity, such as less than about 50% sequence identity, such as less than about 45% sequence identity, such as less than about 40% sequence identity, such as less than about 35% sequence identity, even such as less than about 34% sequence identity, such as less than about 33% sequence identity, such as less than about 32% sequence identity, such as less than about 31% sequence identity,
  • the FAR enzyme endogenous to Marinobacter algicola DG893 for use in the methods disclosed herein is the full-length polypeptide having the amino acid set forth in SEQ ID NO: 2.
  • the full- length FAR enzyme has an amino acid sequence that is at least about 75% identical, such as at least about 80% identical, such as at least about 85% identical, such as at least about 90% identical, such as at least about 91%, such as at least about 92%, such as at least about 93%, such as at least about 94%, such as at least about 95%, such as at least about 96%, such as at least about 97%, such as at least about 98%, such as at least about 99% identical to the sequence set forth in SEQ ID NO: 2.
  • the amino acid sequence is less than 100% identical to that shown in SEQ ID NO: 2, all amino acid substitutions are conservative.
  • the FAR enzyme endogenous to M. algicola
  • DG893 for use in the methods disclosed herein is a functional fragment of the full-length polypeptide, the amino acid sequence of which is set forth in SEQ ID NO: 2.
  • the amino acid sequence of the functional fragment is at least about 70%, such as at least about75%, such as at least about 80%, such as at least about 90%, such as at least about 91%, such as at least about 92%, such as at least about 93%, such as at least about 94%, such as at least about 95%, such as at least about 96%, such as at least about 97%, such as at least about 98%, such as at least about 99% identical to the amino acid sequence of the corresponding region of SEQ ID NO: 2.
  • the FAR enzyme endogenous to Marinobacter aquaeolei for use in the methods disclosed herein is the full-length polypeptide having the amino acid set forth in SEQ ID NO: 14.
  • the full-length FAR enzyme has an amino acid sequence that is at least about 75% identical, such as at least about 75% identical, such as at least about 80% identical, such as at least about 85% identical, such as at least about 90% identical, such as at least about 91%, such as at least about 92%, such as at least about 93%, such as at least about 94%, such as at least about 95%, such as at least about 96%, such as at least about 97%, such as at least about 98%, such as at least about 99% identical to the sequence set forth in SEQ ID NO: 14.
  • the amino acid sequence is less than 100% identical to that shown in SEQ ID NO: 14, all amino acid substitutions are conservative.
  • the FAR enzyme endogenous to M. aquaeolei for use in the methods disclosed herein is a functional fragment of the full-length
  • the amino acid sequence of the functional fragment is at least about 70%, such as at least about75%, such as at least about 80%, such as at least about 90%, such as at least about 91%, such as at least about 92%, such as at least about 93%, such as at least about 94%, such as at least about 95%, such as at least about 96%, such as at least about 97%, such as at least about 98%, such as at least about 99% identical to the amino acid sequence of the corresponding region of SEQ ID NO: 14.
  • the FAR enzyme endogenous to Oceanobacter sp.
  • the FAR enzyme has an amino acid sequence that is at least about 75% identical, such as at least 80% identical, such as at least about 85% identical, such as at least about 90% identical, such as at least about 91%, such as at least about 92%, such as at least about 93%, such as at least about 94%, such as at least about 95%, such as at least about 96%, such as at least about 97%, such as at least about 98%, such as at least about 99% identical to the sequence set forth in SEQ ID NO: 6.
  • the sequence identity is less than 100%, all amino acid substitutions are conservative.
  • the FAR enzyme endogenous to Oceanobacter sp. RED65 for use in the methods disclosed herein is a functional fragment of the full- length polypeptide, the amino acid sequence of which is set forth in SEQ ID NO: 6.
  • the functional fragment has an amino acid sequence that is at least about 70%, such as at least about 75%, such as at least about 80%, such as at least about 90%, such as at least about 91%, such as at least about 92%, such as at least about 93%, such as at least about 94%, such as at least about 95%, such as at least about 96%, such as at least about 97%, such as at least about 98%, such as at least about 99% identical to the amino acid sequence of the corresponding region of SEQ ID NO: 6.
  • the present disclosure provides polynucleotides encoding a FAR enzyme, or functional fragment thereof, as described above.
  • the polynucleotide can be a DNA or RNA, and can be single-stranded or double-stranded.
  • the polynucleotide can be isolated from a naturally occurring microorganism, or prepared wholly or partially via synthetic means.
  • the polynucleotide is a construct designed to provide for expression of the encoded FAR enzyme or functional fragment in a host microorganism.
  • the FAR enzyme or the specific or functional fragment encoded by the polynucleotide construct may be endogenous or heterologous to the host microorganism.
  • the availability of a polypeptide sequence of a specific FAR enzyme provides a description of all polynucleotides capable of encoding the polypeptide of known sequence because of the known correspondence of particular codons and the amino acids they encode.
  • the degeneracy of the genetic code is used to produce a large number of polynucleotides that encode the gamma proteobacterial FAR polypeptides described herein.
  • the codons AGA, AGG, CGA, CGC, CGG, and CGU all encode the amino acid arginine (R).
  • the codon can be altered to any of the corresponding codons described above without altering the encoded polypeptide.
  • the polynucleotides that encode the FAR enzymes described herein are codon optimized for expression in a recombinant host cells.
  • polynucleotides that encode the FAR enzymes described herein are codon optimized for expression in bacteria, yeast or filamentous fungi. In various embodiments, the polynucleotides that encode the FAR enzymes described herein are codon optimized for expression in oleaginous yeast. In certain specific embodiments, the polynucleotides that encode the FAR enzymes are codon optimized for expression in E. coli, S. cerevisiae or Y. lipolytica.
  • the present disclosure provides an isolated nucleic acid encoding a FAR enzyme from a marine bacterium.
  • the nucleic acid encodes a FAR enzyme having an amino acid sequence that is at least about 75% identical, at least about 80% identical, such as at least about 85% identical, such as at least about 90% identical, such as at least about 91%, such as at least about 92%, such as at least about 93%, such as at least about 94%, such as at least about 95%, such as at least about 96%, such as at least about 97%, such as at least about 98%, such as at least about 99% identical to the sequence set forth in SEQ ID NO: 2.
  • the nucleic acid encodes a FAR enzyme having an amino acid sequence that is at least about 75% identical, at least about 80% identical, such as at least about 85% identical, such as at least about 90% identical, such as at least about 91%, such as at least about 92%, such as at least about 93%, such as at least about 94%, such as at least about 95%, such as at least about 96%, such as at least about 97%, such as at least about 98%, such as at least about 99% identical to the sequence set forth in SEQ ID NO: 14.
  • the nucleic acid encodes a FAR enzyme having an amino acid sequence that is at least about 75% identical, such as at least 80% identical, such as at least about 85% identical, such as at least about 90% identical, such as at least about 91%, such as at least about 92%, such as at least about 93%, such as at least about 94%, such as at least about 95%, such as at least about 96%, such as at least about 97%, such as at least about 98%, such as at least about 99% identical to the sequence set forth in SEQ ID NO: 6.
  • the present disclosure provides DNA constructs, vectors and polynucleotides encoding FAR enzymes for expression in heterologous recombinant host cells.
  • the DNA constructs, vectors and polynucleotides comprise a sequence that encodes a FAR enzyme endogenous to a marine bacterium.
  • the DNA constructs, vectors and polynucleotides comprise a sequence that encodes a FAR enzyme endogenous to a Marinobacter species.
  • the DNA constructs, vectors and polynucleotides comprise a sequence that encodes a FAR enzyme endogenous to an Oceanobacter species.
  • the DNA constructs, vectors and polynucleotides comprise a sequence that encodes a FAR enzyme endogenous to M. algicola DG893 or M. aquaeolei. In other particular embodiments, the DNA constructs, vectors and polynucleotides comprise a sequence that encodes a FAR enzyme endogenous to Oceanobacter sp.
  • the polynucleotide is a codon optimized polynucleotide, such as a polynucleotide having at least 90% (at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% and even 100%) sequence identity to SEQ ID NOs: 1, 3, 5, 7 or 13.
  • the DNA constructs, vectors and polynucleotides comprise a sequence that encodes the full length FAR polypeptide encompassed by the invention
  • the DNA construct, vector or polynucleotide comprises a sequence that encodes a full length FAR endogenous to a Marinobacter strain.
  • the strain is M. algicola DG893 and in other embodiments the strain is a M. aquaeolei.
  • the DNA constructs, vectors and polynucleotides comprise a sequence that encodes a functional fragment of the FAR polypeptide of M. algicola DG893 or a M, aquaeolei.
  • the DNA constructs, vectors and polynucleotides comprise a sequence that encodes the full length FAR polypeptide endogenous to Oceanobacter sp. RED65. In some embodiments, the DNA constructs, vectors and polynucleotides comprise a sequence that encodes a functional fragment of the FAR polypeptide of Oceanobacter sp. RED65.
  • the DNA constructs, vectors and polynucleotides comprise a sequence that encodes a full-length FAR polypeptide endogenous to M.
  • algicola DG893 having an amino acid sequence that is at least about 75% identical, such as at least 80% identical, such as at least about 85% identical, such as at least about 90% identical, such as at least about 91%, such as at least about 92%, such as at least about 93%, such as at least about 94%, such as at least about 95%, such as at least about 96%, such as at least about 97%, such as at least about 98%, such as at least about 99% identical to the amino acid sequence set forth in SEQ ID NO: 2.
  • the DNA constructs, vectors and polynucleotides comprise a sequence that encodes a functional fragment of the FAR enzyme having an amino acid sequence that is at least about 80% identical, such as at least about 85% identical, such as at least about 90% identical, such as at least about 91%, such as at least about 92%, such as at least about 93%, such as at least about 94%, such as at least about 95%, such as at least about 96%, such as at least about 97%, such as at least about 98%, such as at least about 99% identical to the amino acid sequence of the corresponding region of SEQ ID NO: 2.
  • the DNA constructs, vectors and polynucleotides comprise a sequence that encodes a full-length FAR polypeptide endogenous to M. aquaeolei having an amino acid sequence that is at least about 75% identical, such as at least 80% identical, such as at least about 85% identical, such as at least about 90% identical, such as at least about 91%, such as at least about 92%, such as at least about 93%, such as at least about 94%, such as at least about 95%, such as at least about 96%, such as at least about 97%, such as at least about 98%, such as at least about 99% identical to the amino acid sequence set forth in SEQ ID NO: 14.
  • the DNA constructs, vectors and polynucleotides comprise a sequence that encodes a functional fragment of the FAR enzyme having an amino acid sequence that is at least about 80% identical, such as at least about 85% identical, such as at least about 90% identical, such as at least about 91%, such as at least about 92%, such as at least about 93%, such as at least about 94%, such as at least about 95%, such as at least about 96%, such as at least about 97%, such as at least about 98%, such as at least about 99% identical to the amino acid sequence of the corresponding region of SEQ ID NO: 14.
  • the DNA constructs, vectors and polynucleotides comprise a sequence that encodes a full-length FAR polypeptide endogenous to
  • Oceanobacter sp. RED65 having an amino acid sequence that is at least about 80% identical, such as at least about 85% identical, such as at least about 90% identical, such as at least about 91%, such as at least about 92%, such as at least about 93%, such as at least about 94%, such as at least about 95%, such as at least about 96%, such as at least about 97%, such as at least about 98%, such as at least about 99% identical to the amino acid sequence set forth in SEQ ID NO: 6.
  • the DNA constructs, vectors and polynucleotides comprise a sequence that encodes a functional fragment of the FAR enzyme that has an amino acid sequence that is at least about 80% identical, such as at least about 85% identical, such as at least about 90% identical, such as at least about 91%, such as at least about 92%, such as at least about 93%, such as at least about 94%, such as at least about 95%, such as at least about 96%, such as at least about 97%, such as at least about 98%, such as at least about 99% identical to the amino acid sequence of the corresponding region of SEQ ID NO: 6.
  • the present disclosure provides DNA constructs, vectors and polynucleotides encoding FAR enzymes endogenous to a marine bacterium, wherein the FAR enzyme is selected from the group consisting of FAR Mac (from marine actinobacterium species PHSC20C1), FAR_JVC
  • JCVI_ORF_1096697648832 GenBank Accession No. EDD40059.1; from a marine metagenome
  • FAR Fer JCVI_SCAF_1101670217388; from a marine bacterium found at a depth of 12m in an upwelling in the area of Fernandina Island, the Galapagos Islands, Ecuador
  • FAR Key JCVI_SCAF_1097205236585, from a marine bacterium found at a depth of 1.7m off the coast of Key West Florida
  • FAR_Gal FAR_Gal
  • the present disclosure provides DNA constructs, vectors and polynucleotides encoding FAR enzymes endogenous to a marine bacterium selected from the group consisting of M. alkaliphilus, M. aquaeolei, M.
  • the present disclosure provides DNA constructs, vectors and polynucleotides encoding a FAR enzyme endogenous to an organism selected from the group consisting of Vitis vinifera, Desulfatibacillum alkenivorans, Stigmatella aurantiaca and Phytophthora ramorum.
  • the polynucleotide of the invention encodes a FAR enzyme encompassed by the invention and comprises a nucleic acid comprising at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, and at least 99% sequence identity with SEQ ID NOs: 1, 3, 5, 7, or 13 and hybridizes with SEQ ID NOs: 1, 3, 5, 7, or 13.
  • Nucleic acids "hybridize” when they associate, typically in solution. Nucleic acids hybridize due to a variety of well- characterized physico-chemical forces, such as hydrogen bonding, solvent exclusion, base stacking and the like.
  • nucleic acid hybridization wash conditions in the context of nucleic acid hybridization experiments, such as Southern and Northern hybridizations, are sequence dependent, and are different under different environmental parameters. An extensive guide to the hybridization of nucleic acids is found in Tijssen, 1993, "Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes," Part I, Chapter 2 (Elsevier, New York), which is incorporated herein by reference.
  • low to very high stringency conditions are defined as follows: prehybridization and hybridization at 42°C in 5xSSPE, 0.3% SDS, 200 ⁇ g/ml sheared and denatured salmon sperm DNA, and either 25% formamide for low stringencies, 35% formamide for medium and medium- high stringencies, or 50% formamide for high and very high stringencies, following standard Southern blotting procedures.
  • the carrier material is finally washed three times each for 15 minutes using 2xSSC, 0.2% SDS at least at 50°C (low stringency), at least at 55°C (medium stringency), at least at 6O 0 C (medium-high stringency), at least at 65 °C (high stringency), and at least at 70°C (very high stringency).
  • 2xSSC 0.2% SDS at least at 50°C (low stringency), at least at 55°C (medium stringency), at least at 6O 0 C (medium-high stringency), at least at 65 °C (high stringency), and at least at 70°C (very high stringency).
  • heterologous recombinant host cells as described herein are operably linked to a promoter, and optionally, to other control sequences.
  • Suitable promoters include constitutive promoters, regulated promoters, and inducible promoters.
  • Appropriate promoter sequences can be obtained from genes encoding extracellular or intracellular polypeptides which are either endogenous or heterologous to the host cell. Methods for the isolation, identification and manipulation of promoters of varying strengths are available in or readily adapted from the art. See e.g., Nevoigt et al. (2006) Appl. Environ. Microbiol. 72:5266-5273, the disclosure of which is herein incorporated by reference in its entirety.
  • the DNA constructs, vectors and polynucleotides are suitable for expression of a heterologous FAR enzyme in bacteria.
  • suitable promoters for directing transcription of the nucleic acid constructs of the present disclosure include the promoters obtained from the E. coli lac operon,
  • Streptomyces coelicolor agarase gene (dagA), Bacillus subtilis levansucrase gene (sacB), Bacillus licheniformis alpha-amylase gene (amyL), Bacillus stear other moph ⁇ lus maltogenic amylase gene (amyM), Bacillus amyloliquefaciens alpha-amylase gene (amyQ), Bacillus licheniformis penicillinase gene (penP), Bacillus subtilis xylA and xylB genes, Bacillus megaterium promoters, and prokaryotic beta- lactamase gene (Villa- Kamaroff et al, Proc. Natl Acad.
  • the DNA constructs, vectors and polynucleotides are suitable for expression of a heterologous FAR enzyme in yeast. In certain embodiments, the DNA constructs, vectors and polynucleotides are suitable for expression of a heterologous FAR enzyme in oleaginous yeast. In various embodiments, the DNA constructs, vectors and polynucleotides are suitable for expression of a heterologous FAR enzyme in the oleaginous yeast Y. lipolytica. In certain embodiments, the DNA constructs, vectors and polynucleotides are suitable for expression of a heterologous FAR enzyme in S. cerevisiae.
  • suitable promoters for directing transcription of the nucleic acid constructs of the present disclosure include, but are not limited to, an enolase (ENO- 1_ gene) promoter, a galactokinase (GALl) promoter, an alcohol dehyrogenase/glyceraldehyde-3- phosphate dehydrogenase (ADH2/GAP) promoter, a translation elongation factor EF-I alpha (TEFl) promoter as well as those described by Romanos et al. (1992) Yeast 8:423- 488.
  • promoters include the TEFl promoter and an RPS7 promoter.
  • suitable promoters for directing the transcription of the nucleic acid constructs of the present disclosure include promoters obtained from the genes for Aspergillus oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid stable alpha-amylase, Aspergillus niger or Aspergillus awamori glucoamylase (glaA),
  • Rhizomucor miehei lipase Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Aspergillus nidulans acetamidase, and Fusarium oxysporum trypsin-like protease (WO 96/00787), as well as the NA2-tpi promoter (a hybrid of the promoters from the genes for Aspergillus niger neutral alpha-amylase and Aspergillus oryzae triose phosphate isomerase), and mutant, truncated, and hybrid promoters thereof.
  • NA2-tpi promoter a hybrid of the promoters from the genes for Aspergillus niger neutral alpha-amylase and Aspergillus oryzae triose phosphate isomerase
  • promoters useful for directing the transcription of the nucleotide constructs of the present invention in a filamentous fungal host cell are promoters such as cbhl, cbh2, egll, egl2, pepA, hfbl, hfb2, xynl, amy, and glaA (Nunberg et al., MoI. Cell Biol., 4:2306 -2315 (1984), Boel et al., EMBO J 3:1581-1585 ((1984) and EPA 137280).
  • an expression vector optionally contains a ribosome binding site (RBS) for translation initiation, and a transcription terminator, such as PinIL
  • RBS ribosome binding site
  • PinIL transcription terminator
  • the vector also optionally includes appropriate sequences for amplifying expression, e.g., an enhancer.
  • the polynucleotides useful for expressing heterologous FAR enzymes in recombinant host cells are operably linked to other control sequences, including but not limited to, a transcription terminator sequence, a signal sequence that when translated directs the expressed polypeptide into the secretory pathway of the recombinant host cell, and a polyadenylation sequence (eukaryotes).
  • control sequences including but not limited to, a transcription terminator sequence, a signal sequence that when translated directs the expressed polypeptide into the secretory pathway of the recombinant host cell, and a polyadenylation sequence (eukaryotes).
  • a recombinant expression vector can be any vector, e.g., a plasmid or a virus, which can be manipulated by recombinant DNA techniques to facilitate expression of a heterologous FAR enzyme in a recombinant host cell.
  • the expression vectors is integrated into the chromosome of the
  • the expression vector is an extra chromosomal replicative DNA molecule, e.g., a linear or closed circular plasmid, that is found either in low copy number (e.g., from about 1 to about 10 copies per genome equivalent) or in high copy number (e.g., more than about 10 copies per genome equivalent), hi various embodiments, the expression vector includes a selectable marker, such as a gene that confers antibiotic resistance (e.g., ampicillin, kanamycin, chloramphenicol or tetracycline resistance) to the recombinant host organism that comprises the vector.
  • antibiotic resistance e.g., ampicillin, kanamycin, chloramphenicol or tetracycline resistance
  • Expression vectors which, in certain embodiments, are useful for expressing FAR enzymes as disclosed herein are commercially available, e.g., from Sigma-Aldrich Chemicals, St. Louis MO and Stratagene, LaJolla CA.
  • suitable expression vectors are plasmids which are derived from pBR322 (Gibco BRL), pUC (Gibco BRL), pREP4, pCEP4 (Invitrogen) or pPoly (Lathe et al, 1987, Gene 57:193-201).
  • the present disclosure provides a plasmid for expression of heterologous genes in E. co ⁇ i.
  • Expression vector pCKl 10900 which comprises a Pl 5 A origin of replication (Pl 5 A ori), lac a CAP binding site, a lac promoter, a T7 ribosomal binding site (T7glO RBS) and a chloramphenicol resistance gene (camR).
  • Pl 5 A ori Pl 5 A origin of replication
  • lac lac
  • CAP binding site a lac promoter
  • T7glO RBS T7 ribosomal binding site
  • cameraR chloramphenicol resistance gene
  • the present disclosure provides an autonomous replicating plasmid for expression of heterologous genes in Yarrowia, and particularly in Y. lipolytica.
  • This plasmid vector (pCEN411; FIG. 1) was engineered with cassettes for expression of a gene encoding resistance to hygromycin (HygB R ) and for expression of a FAR gene optimized for Y. lipolytica.
  • expression of each gene is independently regulated by a strong, constitutive promoter isolated from Y. lipolytica: pTEFl for FAR expression and pRPS7 for HygB R expression.
  • pTEFl for FAR expression
  • pRPS7 for HygB R expression.
  • expression vectors as described herein are adapted for over expression of genes encoding enzymes other than FAR that are directly involved in fatty acid biosynthesis.
  • the over expressed gene encodes a protein selected from a fatty acid synthase (FAS), an acyl-ACP thioesterase (TE), a fatty acyl-CoA synthase (FACS) and an acetyl-CoA carboxylase (ACC).
  • FES fatty acid synthase
  • TE acyl-ACP thioesterase
  • FACS fatty acyl-CoA synthase
  • ACC acetyl-CoA carboxylase
  • the expression vector encoding the FAR enzyme and the expression vector encoding a second enzyme are separate nucleic acids.
  • the heterologous FAR enzyme and the second enzyme are encoded on the same expression vector, and expression of each enzyme is independently regulated by a different promoter.
  • introduction of the DNA construct or vector of the present invention into a host cell can be effected by calcium phosphate transfection, DEAE- Dextran mediated transfection, electroporation, or other common techniques (See Davis et al., 1986, Basic Methods in Molecular Biology, which is incorporated herein by reference).
  • the present invention also provides a method for producing a recombinant host cell, wherein the method comprises: (a) providing a nucleic acid construct of the present invention, wherein the nucleic acid construct comprises a polynucleotide encoding a FAR polypeptide as described herein; and (b) transforming a host cell with the nucleic acid construct to produce a recombinant cell.
  • the host cell will be a bacterial cell and in other particular embodiments the host cell will be a yeast cell.
  • the present disclosure provides recombinant microorganisms engineered to express a heterologous FAR enzyme, or functional fragment thereof, as described herein.
  • the present disclosure provides recombinant microorganisms engineered to express a heterologous FAR enzyme from a marine gammaproteobacterium, or functional fragment thereof, as described herein for the production of fatty alcohols from fatty acyl-ACP substrates.
  • the present disclosure provides recombinant microorganisms engineered to express a heterologous FAR enzyme from an organism selected from the group consisting of Vitis vinifera, Desulfatibacillum alkenivorans, Stigmatella aurantiaca and
  • the FAR enzyme can be expressed in the host cell in which it is found naturally. In various embodiments, the FAR enzyme can be expressed in a heterologous host cell. In particular, when expressed in heterologous host cells described herein, the FAR enzymes are capable of generating high yields of total and secreted fatty alcohols from fatty acyl-ACP substrates.
  • the heterologous host cells useful for expressing the FAR enzymes described herein are selected from bacteria, yeast or filamentous fungi.
  • the yeast is an oleaginous yeast.
  • microorganisms useful as recombinant host cells are wild-type microorganisms.
  • microorganisms useful as recombinant host cells are genetically modified.
  • "genetically modified" microorganisms include microorganisms having one or more endogenous genes removed, microorganisms having one or more endogenous genes with reduced expression compared to the parent or wild- type microorganism, or microorganisms having one or more genes over expressed compared to the parent or wild-type microorganism, hi certain embodiments, the one or more genes that are over expressed are endogenous to the microorganism. In some embodiments, the one or more genes that are over expressed are heterologous to the microorganism.
  • the genetically modified microorganism comprises an inactivated or silenced endogenous gene that codes for a protein involved in the biosynthesis of fatty acyl-CoA substrates.
  • the inactive or silenced gene encodes a fatty acyl-ACP thioesterase or a fatty acyl- CoA synthetase (FACS).
  • the host cell is a prokaryotic cell.
  • Suitable prokaryotic cells include gram positive, gram negative and gram- variable bacterial cells.
  • host cells include, but are not limited to, species of a genus selected from the group consisting of Agrobacterium, Alicyclobacillus, Anabaena, Anacystis, Acinetobacter, Acidothermus, Arthrobacter, Azobacter, Bacillus,
  • Methylobacterium Methylobacterium, Mycobacterium, Neisseria, Pantoea,
  • Pseudomonas Prochlorococcus, Rhodobacter, Rhodopseudomonas, Rhodopseudomonas, Roseburia, Rhodospir ⁇ lum, Rhodococcus, Scenedesmun, Streptomyces, Streptococcus, Synechooccus, Synechocystis, Saccharomonospora, Staphylococcus, Serratia,
  • the host cell is a species of a genus selected from the group consisting of Agrobacterium, Arthrobacter, Bacillus,
  • Lactobacillus Mycobacterium, Pantoea, Rhodococcus, Streptomyces and Zymomonas.
  • the recombinant host cell is an industrial bacterial strain.
  • the bacterial host cell is a species of the genus Bacillus, e.g., B. thuringiensis, B. anthracis, B. megaterium, B. subtilis, B. lentus, B. circulans, B. pumilus, B. lautus, B.coagulans, B. brevis, B.firmus, B. alkaophius, B. licheniformis, B. clausii, B. stearothermophilus, B. halodurans and B. amyloliquefaciens.
  • the host cell is a species of the genus Bacillus and is selected from the group consisting of B. subtilis, B. pumilus, B. licheniformis, B. clausii, B.
  • the bacterial host cell is a species of the genus
  • the bacterial host cell is a species of the genus
  • Pantoea e.g., P. citrea or P. agglomerans.
  • the bacterial host cell is a species of the genus
  • Streptomyces e.g., S. ambofaciens, S. achromogenes, S. avermitilis, S. coelicolor, S. aureofaciens, S. aureus, S. fungicidicus, S. griseus or S. lividans.
  • the bacterial host cell is a species of the genus
  • Zymomonas e.g., Z mobilis or Z. lipolytica.
  • the bacterial host cell is a species of the genus
  • Rhodococcus e.g. R. opacus.
  • the bacterial host cell is a species of the genus
  • E. coli is a wild-type bacterium.
  • the wild-type E. coli bacterial strain useful in the processes described herein is selected from, but not limited to, strain W3110, strain MGl 655 and strain BW25113.
  • the E. co /us genetically modified examples include, but are not limited to, genetically modified E. coli found in the Keio Collection, available from the National BioResource Project at NBRP E. coli, Microbial Genetics Laboratory, National Institute of Genetics 1111 Yata, Mishima, Shizuoka, 411-8540 Japan (www at
  • the genetically modified E.coli comprises an inactivated or silenced endogenous fadD gene, which codes for an acyl-CoA synthetase protein.
  • the genetically modified E.coli comprises an inactivated of silenced endogenous fadK gene, which codes for an endogenous short-chain acyl-CoA synthetase.
  • the genetically modified E. coli comprises an inactivated or silenced endogenous fadD gene and an inactivated or silenced endogenous fadK gene.
  • the genetically modified E.coli comprises an endogenous fadD gene that has reduced expression compared to the parent or wild-type strain.
  • the genetically modified E.coli comprises an endogenous fadK. gene that has reduced expression compared to the parent or wild-type strain.
  • the recombinant host cell is a yeast.
  • the yeast host cell is a species of a genus selected from the group consisting of Candida, Hansenula, Saccharomyces, Schizosaccharomyces, Pichia, Kluyveromyces, and Yarrowia.
  • the yeast host cell is a species of a genus selected from the group consisting of Saccharomyces, Candida, Pichia and Yarrowia.
  • the yeast host cell is selected from the group consisting of Hansenula polymorpha, Saccharomyces cerevisiae, Saccaromyces carlsbergensis, Saccharomyces diastaticus, Saccharomyces norbensis, Saccharomyces kluyveri, Schizosaccharomyces pombe, Pichia pastoris, Pichia finlandica, Pichia trehalophila, Pichia ferniemtans, Pichia kodamae, Pichia membranaefaciens, Pichia opuntiae, Pichia thermotolerans, Pichia salictaria, Pichia quercuum, Pichia pijperi, Pichia stipitis, Pichia methano ⁇ ica, Pichia angusta, Kluyveromyces lactis, Candida albicans, Candida krusei, Candida ethanolic and Yarrowia lipolytica
  • the yeast host cell is a wild-type cell.
  • the wild-type yeast cell strain is selected from, but not limited to, strain BY4741, strain FLlOOa, strain INVSCl, strain NRRL Y-390, strain NRRL Y-1438, strain NRRL YB-1952, strain NRRL Y-5997, strain NRRL Y-7567, strain NRRL Y-1532, strain NRRL YB-4149 and strain NRRL Y-567.
  • the yeast host cell is genetically modified. Examples of genetically modified yeast useful as recombinant host cells include, but are not limited to, genetically modified yeast found in the Open Biosystems collection found at
  • the recombinant host cell is an oleaginous yeast.
  • Oleaginous yeasts are organisms that accumulate lipids such as tri-acyl glycerols.
  • Examples of oleaginous yeast include, but are not limited to, organisms selected from the group consisting of Yarrowia lipolytica, Yarrowia paralipolytica, Candida revkaufi, Candida pulcherrima, Candida tropicalis, Candida utilis, Candida curvata D, Candida curvata R, Candida diddensiae, Candida boldinii, Rhodotorula glutinous, Rhodotorula graminis, Rhodotorula mucilaginosa, Rhodotorula minuta, Rhodotorula bacarum, Rhodosporidium toruloides, Cryptococcus (terricolus) albidus var.
  • Cryptococcus laurentii Trichosporon pullans, Trichosporon cutaneum, Trichosporon cutancum, Trichosporon pullulans, Lipomyces starkeyii, Lipomyces lipoferus, Lipomyces tetrasporus, Endomycopsis vernalis, Hansenula ciferri, Hansenula saturnus, and
  • the oleaginous yeast is Y. lipolytica.
  • Yarrowia lipolytica strains include, but are not limited to, DSMZ 1345, DSMZ 3286, DSMZ 8218, DSMZ 70561, DSMZ 70562, DSMZ 21175, and also strains available from the Agricultural Research Service (NRRL) such as but not limited to NRRL YB-421, NRRL YB-423, NRRL YB-423-12 and NRRL YB-423-3.
  • NRRL Agricultural Research Service
  • the oleaginous yeast is a wild-type organism. In other embodiments, the oleaginous yeast is genetically modified.
  • the recombinant host cell is a filamentous fungus.
  • the filamentous fungal host cell is a species of a genus selected from the group consisting of Achlya, Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Cephalosporium, Chrysosporium, Cochliobolus,
  • the filamentous fungal host cell is an Aspergillus species, a Chrysosporium species, a Corynascus species, a Fusarium species, a Humicola species, a Myceliophthora species, a Neurospora species, a Penicillum species, a Tolypocladium species, a Tramates species, or Trichoderma species.
  • the Trichoderma species is selected from T. longibrachiatum, T. viride, Hypocrea jecorina and T. reesei; the Aspergillus species is selected from A. awamori, A. fumigatus, A. japonicus, A.
  • the Chrysosporium species is C. lucknowense
  • the Fusarium species is selected from F.graminum, F. oxysporum and F. venenatum;
  • Myceliophthora species is M. thermophilics; the Neurospora species is N. crassa; the Humicola species is selected from H. insolens, H. grisea, and H. lanuginosa; the Penicillum species is selected from P. purpurogenum, P. chrysogenum, and P.
  • Thielavia species is T. terrestris
  • Trametes species is selected from T. villosa and T. versicolor.
  • the filamentous fungal host is a wild-type organism. In other embodiments, the filamentous fungal host is genetically modified.
  • recombinant host cells for use in the methods described herein are derived from strains of Escherichia coli, Bacillus,
  • Saccharomyces, Streptomyces and Yarrowia Saccharomyces, Streptomyces and Yarrowia.
  • recombinant host cells which are useful in the practice of the present disclosure include prokaryotic and eukaryotic cells which are readily accessible from a number of culture collections, e.g., the American Type Culture Collection (ATCC), Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ) (German Collection of Microorganisms and Cell Culture), Centraalbureau Voor Schimmelcultures (CBS), and Agricultural Research Service Patent Culture Collection, Northern Regional Research Center (NRRL).
  • ATCC American Type Culture Collection
  • DSMZ Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
  • CBS Centraalbureau Voor Schimmelcultures
  • NRRL Northern Regional Research Center
  • the recombinant microorganism over expresses a gene that encodes a FAR enzyme.
  • the FAR enzyme is endogenous to the microorganism. In other embodiments, the FAR enzyme is heterologous to the microorganism.
  • the recombinant microorganism over expresses a gene that encodes one or more proteins other than a FAR enzyme.
  • the one or more over expressed protein increases the rate at which the recombinant cell produces the acyl-thioester FAR substrate, e.g., the compound of formula (I) shown above.
  • the one or more over expressed genes encodes a protein directly involved in fatty acid biosynthesis.
  • the one or more over expressed genes encode a protein selected from a fatty acid synthase (FAS), an acyl-ACP thioesterase (TE), a fatty acyl-CoA synthase (FACS) and an acetyl- CoA carboxylase (ACC).
  • the over expressed gene is endogenous to the microorganism. In other embodiments, the over expressed gene is heterologous to the microorganism.
  • Fatty acid synthase refers to an enzyme or enzyme complex that catalyzes the conversion of acetyl-CoA and malonyl-CoA units to fatty acyl-ACP as set forth in Scheme II, and reference is also made to Fig. 13:
  • the FAS is composed of more than one distinct enzymatic activity.
  • the distinct enzymatic activities reside in separate polypeptides.
  • the separate polypeptides form one or more protein complexes.
  • acyl-ACP thioesterase refers to an enzyme that catalyzes the cleavage of acyl-ACP to form a fatty acid, as shown in Scheme III and reference is also made to Fig.13, wherein R has the same meaning as set forth above:
  • FACS refers to an enzyme that catalyzes the formation of the covalent complex between the acyl portion of the fatty acid and Coenzyme A as shown below in Scheme IV, wherein R has the same meaning as set forth above:
  • acetyl-CoA carboxylase refers to an enzyme that catalyzes the conversion of acetyl-CoA to malonyl-CoA as shown below in Scheme V:
  • FIG. 13 illustrates the biosynthetic pathways for fatty alcohol formation.
  • FAR enzymes can act directly on fatty acyl-CoA substrates to form fatty alcohols.
  • the present inventors have discovered that the amount of fatty alcohols produced in certain microorganisms comprising a gene encoding a FAR encompassed by the invention and lacking a functional endogenous fatty acyl-CoA synthetase (FACS) is comparable to the amount of fatty alcohol produced by the microorganism that has a functional endogenous FACS gene.
  • FACS functional endogenous fatty acyl-CoA synthetase
  • FAR enzymes such as marine gammaproteobacterium FAR enzymes
  • FAR enzymes as described herein catalyze the biosynthesis of fatty alcohols from fatty acyl- ACP substrates via an acyl-CoA independent pathway in lieu of, or in addition to, using fatty acyl-CoA substrates.
  • the present disclosure relates to the use of a FAR enzyme as described herein, e.g., a FAR enzyme from a marine bacterium, for producing a fatty alcohol composition.
  • a FAR enzyme as described herein, e.g., a FAR enzyme from a marine bacterium, for producing a fatty alcohol composition.
  • FAR enzymes described herein utilized fatty acyl-ACP substrates instead of or in addition to, fatty acyl-CoA substrates provided for more efficient methods for producing fatty alcohol.
  • hosts such as E. coli which convert fatty acyl-ACP to fatty acyl-CoA via free fatty acids, the formation of fatty acyl- CoA complexes requires ATP.
  • acyl-CoA independent pathway because production of fatty alcohols by FAR enzymes (e.g., marine bacterial FAR enzymes) from fatty acyl-ACP as described herein bypasses this step, less energy is used to form the fatty alcohol compositions.
  • FAR enzymes e.g., marine bacterial FAR enzymes
  • the present inventors' discovery of the mechanism of action of FARs as encompassed by the invention further allows for the production of fatty alcohols in recombinant cells that do not produce fatty acyl-CoA substrates or that produce low levels of the acyl-CoA substrates compared to wild-type or parent microorganisms.
  • fatty alcohols can be produced by a recombinant microorganism that lacks a functional endogenous enzyme involved in the biosynthesis of fatty acyl-CoA substrates.
  • fatty alcohols can be produced by a recombinant microorganism that express a gene encoding a FAR enzyme described herein and that lacks a gene encoding a fatty acyl-CoA synthetase (FACS) and/or a gene encoding a fatty acyl-ACP thioesterase (TE).
  • FACS fatty acyl-CoA synthetase
  • TE fatty acyl-ACP thioesterase
  • the present disclosure provides for a mechanism of action for the production of fatty alcohols by an acyl-CoA independent pathway, wherein certain FAR enzymes encompassed by the invention may act on fatty acyl-ACP substrates in lieu of, or in addition to, acting on fatty acyl-CoA substrates, to produce fatty alcohols.
  • the FAR enzymes from as encompassed by the invention herein including but not limited to FAR enzymes from Marinobacter species, such as Marinobacter species algicola (DG893) and Marinobacter aquaeolei, and Oceanobacter species strain RED65 or functional fragments thereof can produce levels of fatty alcohols in the absence of, or in the presence of low levels of fatty acyl-CoA substrates, which were thought to be the main substrates of FAR enzymes that are comparable to the levels of fatty alcohols produced in the presence of normal levels of fatty acyl-CoA substrates.
  • Marinobacter species such as Marinobacter species algicola (DG893) and Marinobacter aquaeolei
  • Oceanobacter species strain RED65 or functional fragments thereof can produce levels of fatty alcohols in the absence of, or in the presence of low levels of fatty acyl-CoA substrates, which were thought to be the main substrates of FAR enzymes that are comparable to the levels of fatty alcohols produced in the presence of normal levels of fatty
  • the invention relates to a recombinant host cell comprising a nucleic acid encoding a FAR enzyme according to the invention and an inactivated or silenced endogenous fatty acyl-ACP thioesterase gene, an inactivated or silenced endogenous fatty acyl-CoA synthetase gene or both, hi some embodiments, the recombinant microorganisms provided herein above do not produce detectable levels of fatty acyl-CoA substrates and in other embodiments the recombinant microorganisms produce reduced levels of fatty acyl-CoA substrates as compared to wild- type cells.
  • fatty alcohols are produced by an acyl-CoA independent pathway comprising culturing a recombinant bacterial cells under suitable culture conditions, wherein the recombinant bacterial cell comprises a gene encoding a heterologous FAR polypeptide encompassed by the invention and wherein the
  • recombinant bacterial cell comprises one or more endogenous polynucleotides that have been inactivated or silenced selected from afadD gene, which codes for an acyl-CoA synthetase protein, afadK gene, which codes for an endogenous short-chain acyl-CoA synthetase or both; allowing expression of the gene encoding the heterologous FAR enzyme and producing fatty alcohols by the conversion of fatty acyl-ACP substrates.
  • afadD gene which codes for an acyl-CoA synthetase protein
  • afadK gene which codes for an endogenous short-chain acyl-CoA synthetase or both
  • the recombinant host cell is an E.coli cell.
  • the FAR enzymes are derived from Marinobacter algicola (DG893), Marinobacter aquaeolei, and Oceanobacter species strain RED65 or functional fragments thereof.
  • the FAR enzyme for use in the methods disclosed herein has an amino acid that has an amino acid sequence that is at least about 75% identical, at least about 80% identical, such as at least about 85% identical, such as at least about 90% identical, such as at least about 91%, such as at least about 92%, such as at least about 93%, such as at least about 94%, such as at least about 95%, such as at least about 96%, such as at least about 97%, such as at least about 98%, such as at least about 99% identical to the sequence set forth in SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 14, or functional fragments thereof.
  • fatty alcohols can be produced in cell-free systems.
  • a FAR enzyme as described herein is provided with a substrate and all necessary cofactors to carry out the production of a fatty alcohol from a fatty acyl-thioesterase substrate.
  • fatty alcohols can be produced by recombinant microorganisms that express a heterologous FAR enzyme as described herein.
  • fatty alcohols can be produced by recombinant microorganisms that express a heterologous FAR enzyme and one or more proteins other than a FAR enzyme.
  • the fatty alcohols produced by the recombinant microorganisms are secreted into the nutrient medium. In other
  • the fatty alcohols produced by the recombinant microorganisms are extracted from the microorganisms.
  • the present disclosure relates to the use of a FAR enzyme as described herein, e.g., a FAR enzyme from a marine gamma proteobacterium, for producing a fatty alcohol composition in a cell-free system.
  • the FAR enzyme is provided with a substrate, e.g., a fatty acyl-thioester of the formula (I) and NAD(P)H under suitable conditions of temperature, pH, and ionic strength and time sufficient for the production of a fatty alcohol composition.
  • the FAR enzyme is provided with a composition of a fatty acid, Coenzyme A, ATP,
  • NAD(P)H NAD(P)H
  • a fatty acyl-CoA synthase under suitable conditions of temperature, pH and ionic strength and time sufficient for production of the fatty acyl-CoA substrate of the FAR enzyme by the fatty acyl-CoA synthase and for production of a fatty alcohol composition from the fatty acyl-CoA substrate.
  • a fatty alcohol composition is produced by a recombinant host cell comprising a heterologous gene encoding a FAR enzyme as described above, which is cultured in an aqueous nutrient medium comprising an assimilable source of carbon under conditions suitable for production of a fatty alcohol composition.
  • the fatty alcohol is produced by a recombinant host cell comprising a heterologous gene encoding a FAR enzyme as described above and the recombinant host cell comprises an inactivated or silenced gene selected from an acyl-ACP thioesterase and a fatty acyl-CoA synthetase.
  • the recombinant host cell is a bacterium.
  • the bacterium is E. coll
  • the recombinant host cell is a yeast.
  • the yeast is S. cerevisiae.
  • the yeast is an oleaginous yeast.
  • the oleaginous yeast is Y. Hpolytica,
  • a fatty alcohol composition is produced by a recombinant host cell comprising a heterologous gene encoding a FAR enzyme from a marine bacterium and which over expresses a gene encoding one or more proteins that increases the rate at which the recombinant host cell produces the acyl-thioester FAR substrate, e.g., the compound of formula (I) above.
  • the one or more over expressed genes encode a protein directly involved in fatty acid biosynthesis.
  • the one or more over expressed genes encode a protein selected from a fatty acid synthase (FAS), an acyl-ACP thioesterase (TE), a fatty acyl- CoA synthase (FACS) and an acetyl-CoA carboxylase (ACC).
  • FAS fatty acid synthase
  • TE acyl-ACP thioesterase
  • FACS fatty acyl- CoA synthase
  • ACC acetyl-CoA carboxylase
  • Culturing or “cultivation” refers to growing a population of microbial cells under suitable conditions in a liquid or solid medium. In particular embodiments, culturing refers to the fermentative bioconversion of a substrate to an end-product.
  • the aqueous nutrient medium is a "rich medium" comprising complex sources of nitrogen, salts, and carbon, such as YP medium, comprising 10 g/L of peptone and 10 g/L yeast extract of such a medium.
  • the aqueous nutrient medium comprises a mixture of Yeast Nitrogen Base (Difco) supplemented with an appropriate mixture of amino acids, e.g. SC medium.
  • the amino acid mixture lacks one or more amino acids, thereby imposing selective pressure for maintenance of an expression vector within the recombinant host cell.
  • Fermentation of the recombinant host cell comprising a heterologous FAR gene for production of fatty alcohols is carried out under suitable conditions and for a time sufficient for production of fatty alcohols.
  • Conditions for the culture and production of cells including bacterial and yeast cells, are readily available.
  • Cell culture media in general are set forth in Atlas and Parks (eds.) The Handbook of Microbiological Media (1993) CRC Press, Boca Raton, FL, which is incorporated herein by reference.
  • cells expressing the heterologous FAR genes as described herein are grown under batch or continuous fermentations conditions.
  • Classical batch fermentation is a closed system, wherein the compositions of the medium is set at the beginning of the fermentation and is not subject to artificial alternations during the fermentation.
  • a variation of the batch system is a fed-batch fermentation which also finds use in the present invention. In this variation, the substrate is added in increments as the fermentation progresses.
  • Fed-batch systems are useful when catabolite repression is likely to inhibit the metabolism of the cells and where it is desirable to have limited amounts of substrate in the medium. Batch and fed-batch fermentations are common and well known in the art.
  • Continuous fermentation is an open system where a defined fermentation medium is added continuously to a bioreactor and an equal amount of conditioned medium is removed simultaneously for processing.
  • Continuous fermentation generally maintains the cultures at a constant high density where cells are primarily in log phase growth.
  • Continuous fermentation systems strive to maintain steady state growth conditions. Methods for modulating nutrients and growth factors for continuous fermentation processes as well as techniques for maximizing the rate of product formation are well known in the art of industrial microbiology.
  • fermentations are carried out a temperature within the range of from about 10°C to about 60 0 C, from about 15 0 C to about 50 0 C, from about 20 0 C to about 45°C, and from about 25°C to about 40 0 C.
  • the fermentation is carried out at a temperature of from about 28°C and also from about 30 0 C.
  • the fermentation is carried out for a period of time within the range of from about 8 hours to 240 hours, from about 8 hours to about 168 hours, from about 16 hours to about 144 hours, from about 16 hours to about 120 hours, or from about 24 hours to about 72 hours.
  • thermostable host cells may be used.
  • fermentations may be carried out at higher temperatures.
  • the fermentation will be carried out at a pH in the range of 4 to 8, in the range of 4.5 to 7.5, in the range of 5 to 7, and also in the range of 5.5 to 6.5.
  • Carbon sources useful in the aqueous fermentation medium or broth of the disclosed process in which the recombinant microorganisms are grown are those assimilable by the recombinant host strain.
  • Assimilable carbon sources are available in many forms and include renewable carbon sources and the cellulosic and starch feedstock substrates obtained there from. Such examples include for example monosaccharides, disaccharides, oligosaccharides, saturated and unsaturated fatty acids, succinate, acetate and mixtures thereof.
  • Further carbon sources include, without limitation, glucose, galactose, sucrose, xylose, fructose, glycerol, arabinose, mannose, raffinose, lactose, maltose, and mixtures thereof.
  • fermentable sugars is used interchangeably with the term “assimilable carbon source”.
  • fermentation is carried out with a mixture of glucose and galactose as the assimilable carbon source.
  • fermentation is carried out with glucose alone to accumulate biomass, after which the glucose is substantially removed and replaced with an inducer, e.g., galactose for induction of expression of one or more heterologous genes involved in fatty alcohol production.
  • fermentation is carried out with an assimilable carbon source that does not mediate glucose repression, e.g., raffinose, to accumulate biomass, after which the inducer, e.g., galactose, is added to induce expression of one or more heterologous genes involved in fatty alcohol production.
  • an assimilable carbon source that does not mediate glucose repression, e.g., raffinose
  • the inducer e.g., galactose
  • the assimilable carbon source is from cellulosic and starch feedstock derived from but not limited to, wood, wood pulp, paper pulp, grain, corn stover, corn fiber, rice, paper and pulp processing waste, woody or herbaceous plants, fruit or vegetable pulp, distillers grain, grasses, rice hulls, wheat straw, cotton, hemp, flax, sisal, corn cobs, sugar cane bagasse, switch grass and mixtures thereof.
  • the present disclosure relates to methods of producing a fatty alcohol composition
  • methods of producing a fatty alcohol composition comprising culturing a recombinant host cell comprising a gene expressing a heterologous FAR enzyme in an aqueous nutrient medium comprising an assimilable source of carbon under conditions in which a fatty alcohol composition of produced, and isolating the fatty alcohols.
  • At least 10%, such as at least 20%, such as at least 25%, such as at least 30%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90% of the fatty alcohols produced by the methods described herein are secreted into the culture medium.
  • the recombinant microorganism is E.coli, Yarrowia ⁇ e.g., Y. lipolytic ⁇ ) or Saccharomyces ⁇ e.g., S. cerevisiae) at least 25% and also at least 50% of the fatty alcohols produced by the methods encompassed by the invention will be secreted into the culture medium.
  • fatty alcohols produced by the methods of the invention are further recovered or isolated.
  • Recovery or isolating the produced fatty alcohols refers to substantially separating the fatty alcohols from other components of the culture medium or fermentation process.
  • Recovery or isolation may be by solvent extraction of the aqueous nutrient medium with a suitable water immiscible solvent. Extraction may occur simultaneously with fatty alcohol production and extraction may be continuous. Phase separation followed by solvent removal provides the fatty alcohol which may then be further purified and fractionated using methods and equipment known in the art.
  • the secreted fatty alcohols coalesce to form a water immiscible phase that can be directly separated from the aqueous nutrient medium either during the fermentation or after its completion.
  • less than 60%, less than about 50%, such as less than about 40%, such as less than about 30%, such as less than about 20%, such as less than about 10% of the fatty alcohols produced by the methods described herein are secreted from the recombinant host cells.
  • at least about 30%, such as at least about 40%, such as at least about 45%, such as at least about 50%, such as at least about 60%, such as at least about 65%, such as at least about than 70%, such as at least about 75%, such as a least about 80%, such as at least about 85%, such as at least about 90% of the fatty alcohols produced by the methods described herein are secreted from the recombinant host cells.
  • fatty alcohols are isolated by separating the cells from the aqueous nutrient medium, for example by centrifugation, resuspension and extraction of the fatty alcohols from the recombinant host cells using an organic solvent or solvent mixture. Suitable protocols for recovering fatty alcohols from recombinant host cells and/or culture medium are known to the skilled artisan.
  • fatty alcohols may be recovered by first lysing the cells to release the fatty alcohols and then extracting the fatty alcohol from the lysate using conventional means. Reference is also made to Yeast Protocols Handbook, (2009) Clontech Laboratories, Inc. A Takara Bio Company, Mt. View CA 94043 and PNAS 2003 Vol. 100, 16:9156- 9161.
  • the present disclosure relates to fatty alcohol compositions produced by recombinant host cells comprising a gene encoding any one of the FAR enzymes as encompassed by the invention and described hereinabove.
  • the FAR enzyme is derived from a Marinobacter or
  • the FAR enzyme is derived from a Marinobacter species selected from, but not limited to, M. algicola DG893, M. alkaliphilus, M. aquaeoli, M. arcticus, M. bryozoorum, M.
  • the FAR enzyme is obtained from a marine bacterium selected from the group consisting of Meptuniibacter caesariensis species strain MED92, Reinekea sp. strain MED297, Marinomonas sp.
  • the FAR enzyme is derived from or endogenous to an Oceanobacter species selected from, but not limited to, Oceanobacter spielii and Oceanobacter strain WH099.
  • the compositions produced by the methods described herein comprise both saturated and unsaturated fatty alcohols.
  • the unsaturated fatty alcohols are monounsaturated fatty alcohols, hi some embodiments, the fatty alcohol compositions comprise both saturated and unsaturated fatty alcohols, and the amount of unsaturated fatty alcohols is less than about 30%, such as less than about 20%, such as less than about 10%, such as less than about 5%, such as less than about 1% of the fatty alcohols present in the composition.
  • the amount of unsaturated fatty alcohols is less than about 30%, such as less than about 20%, such as less than about 10%, such as less than about 5%, such as less than about 1% of the fatty alcohols present in the composition.
  • the fatty alcohol compositions comprise both saturated and unsaturated fatty alcohols, and the amount of saturated fatty alcohols is less than about 30%, such as less than about 20%, such as less than about 10%, such as less than about 5%, such as less than about 1% of the fatty alcohols present in the composition.
  • the fatty alcohol compositions produced by the methods described herein comprise one or more alcohols selected from the group consisting of 1-octanol (C8:0), 1-decanol (C10:0), 1-dodecanol (C12:0), 1-tetradecanol (C14:0), 1-hexadecanol (C16:0), 1-octadecanol (C18:0), 1-icosanol (C20:0), 1-docosanol, 1-tetracosanol, cis ⁇ 9 - 1-hexadecanol, and cis ⁇ ⁇ -l-octadecanol.
  • C8 to C20 fatty alcohols comprise at least about
  • ClO to Cl 8 fatty alcohols comprise about 80%, such as at least about 85%, such as at least about 90%, such as at least about 92%, such as at least about 95%, such as at least about 97%, such as at least about 99% by weight of the total isolated fatty alcohols.
  • ClO to Cl 8 fatty alcohols comprise about 80%, such as at least about 85%, such as at least about 90%, such as at least about 92%, such as at least about 95%, such as at least about 97%, such as at least about 99% by weight of the total isolated fatty alcohols.
  • C 14 to Cl 8 fatty alcohols comprise about 80%, such as at least about 85%, such as at least about 90%, such as at least about 92%, such as at least about 95%, such as at least about 97%, such as at least about 99% by weight of the total isolated fatty alcohols. It is understood that a reference to a "Cx fatty alcohol” includes both saturated and unsaturated fatty alcohols having "x" carbon atoms.
  • C16 to Cl 8 fatty alcohols comprise at least about
  • the Cl 6 to Cl 8 fatty alcohols are saturated. In other embodiments the Cl 6 to Cl 8 fatty alcohols are a mixture of saturated and unsaturated fatty alcohols.
  • the amount of fatty alcohols produced by the methods described herein comprise saturated and/or unsaturated C8 to C24 alcohols produced by a recombinant host cell comprising a heterologous gene encoding a FAR as described herein in a range of about 10 mg/L to about 50 g/L of aqueous nutrient medium, such as in a range of about 10 mg/L to about 5 g/L, such as in a range of about 10 mg/L to about 2g/L of medium by routine modification of culturing conditions.
  • the amount of fatty alcohols produced by the methods described herein is at least about 0.5 g/L, such as at least about 1 g/L, such as at least about 1.5 g/L, such as at least about 2.0 g/L, such as at least about 2.5 g/L, such as at least about 3 g/L, such as at least about 3.5 g/L, such as at least about 4 g/L, such as at least about 4.5 g/L, such as at least about 5 g/L, such as at least about 10 g/L of medium.
  • the amount of fatty alcohols produced by the methods described herein is at least about 20 g/L, such as at least about 30 g/L, such as at least about 40 g/L, such as at least about 50 g/L of medium.
  • the recombinant is at least about 20 g/L, such as at least about 30 g/L, such as at least about 40 g/L, such as at least about 50 g/L of medium.
  • the recombinant is at least about 20 g/L, such as at least about 30 g/L, such as at least about 40 g/L, such as at least about 50 g/L of medium.
  • the recombinant is at least about 20 g/L, such as at least about 30 g/L, such as at least about 40 g/L, such as at least about 50 g/L of medium.
  • microorganism comprising a gene encoding FAR enzyme as encompassed by the invention is E.coli, Yarrowia lipolytica or Saccharomyces cerevisiae and the amount of fatty alcohol produced is at least 1.0 g/L, at least 5.0 g/L, at least 10 g/L, at least 15 g/L, at least 20 g/L, at least 25 g/L and at least 30 g/L of medium.
  • the amount of fatty alcohols produced by the methods described herein is in the range of about 100 mg/g to about 5 g/g of dry cell weight. In other embodiments, the amount of fatty alcohols produced by the methods described herein is in the range of about 1 g/g to about 4 g/g of dry cell weight, such as in the range of about 2 g/g to about 3 g/g of dry cell weight by routine modification of culturing conditions.
  • the amount of fatty alcohols produced by the methods described herein is in the range of about 10% to about 20% of dry cell weight, such as in the range of about 20% to about 30% of dry cell weight, such as in the range of about 30% to about 40% of dry cell weight, such as in the range of about 40% to about 50% of dry cell weight, such as in the in range of about 50% to about 60% of dry cell weight, such as in the range of about 60% to about 70% of dry cell weight, such as in the range of about 70% to about 80% of dry cell weight by routine modification of culturing conditions.
  • Fatty alcohol compositions produced by the methods described herein may also include fatty acid derived components, such as but not limited to esters (e.g. acetate and waxes) and fatty acids.
  • the fatty alcohol compositions produced by the methods described herein are subjected to reduction to produce alkanes and/or alkenes having the same carbon chain length as the fatty alcohol starting materials.
  • the hydroxyl group of an alcohol is a poor leaving group, and therefore, in principle a chemical moiety that binds to the oxygen atom of the hydroxyl group to make it a better leaving group can be used to reduce the fatty alcohols described herein.
  • reduction of fatty alcohols can be carried out chemically, for example, by a Barton deoxygenation (or Barton-McCombie deoxygenation), a two-step reaction in which the alcohol is first converted to a methyl xanthate or thioimidazoyl carbamate, and the xanthate or thioimidazoyl carbamate is reduced with a tin hydride or trialkylsilane reagent under radical conditions to produce the alkane and/or alkene.
  • a Barton deoxygenation or Barton-McCombie deoxygenation
  • a two-step reaction in which the alcohol is first converted to a methyl xanthate or thioimidazoyl carbamate, and the xanthate or thioimidazoyl carbamate is reduced with a tin hydride or trialkylsilane reagent under radical conditions to produce the alkane and/or alkene.
  • reduction of fatty alcohols to the corresponding alkanes and/or alkenes can be accomplished using a microorganism that has a
  • the microorganism is a bacterium.
  • the bacterium is Vibrio fur nissii strain Ml .
  • the fatty alcohol compositions produced by the methods described herein are contacted with the appropriate microorganism for reduction to alkanes and/or alkenes.
  • the fatty alcohol compositions produced by the methods described herein are contacted with membrane fractions from the appropriate microorganism so that the reduction is carried out in a cell free system. See e.g., Park (2005) J. Bacteriol. 187(4): 1426-1429.
  • alkanes and/or alkenes produced by the reduction of fatty alcohols described herein are isolated from the reaction mixture and unreduced fatty alcohol starting materials to produce a composition that comprises substantially all alkanes and/or alkenes.
  • the alkanes and/or alkenes produced by the reduction of fatty alcohols described herein and the unreacted fatty alcohol starting materials are isolated from the reaction mixture to produce a composition comprising alkanes and/or alkenes and fatty alcohols.
  • the resulting compositions comprise at least about
  • 60% alkanes and/or alkenes such as at least about 70% alkanes and/or alkenes, such as at least about 80% alkanes and/or alkenes, such as at least about 85% alkanes and/or alkenes, such as at least about 90% alkanes and/or alkenes, such as at least about 92% alkanes and/or alkenes, such as at least about 95% alkanes and/or alkenes, such as at least about 96% alkanes and/or alkenes, such as at least about 97% alkanes and/or alkenes, such as at least about 98% alkanes and/or alkenes, such as at least about 99% alkanes and/or alkenes by weight of the composition after reduction.
  • compositions comprise at least about
  • 10% alkanes and/or alkenes such as at least about 20% alkanes and/or alkenes, such as at least about 30% alkanes and/or alkenes, such as at least about 40% alkanes and/or alkenes, such as at least about 50% alkanes and/or alkenes by weight of the composition after reduction.
  • compositions produced by the methods described herein comprise one or more alkanes selected from the group consisting of octane, decane, dodecane, tetradecane, hexadecane, octadecane, icosane, docosane, and tetracosane.
  • compositions produced by the methods described herein comprise one or more alkenes selected from the group consisting of octane, decene, dodecene, tetradecene, hexadecene, octadecene, icosene, docosene, and tetracosene.
  • C8 to C20 alkanes and/or alkenes comprise at least about 80%, such as at least about 85%, such as at least about 90%, such as at least about 92%, such as at least about 95%, such as at least about 97%, such as at least about 99% by weight of the total alkanes and/or alkenes in the composition.
  • ClO to Cl 8 alkanes and/or alkenes comprise about 80%, such as at least about 85%, such as at least about 90%, such as at least about 92%, such as at least about 95%, such as at least about 97%, such as at least about 99% by weight of the total alkanes and/or alkenes in the composition.
  • alkanes and/or alkenes having particular carbon chain lengths can be isolated from longer and/or shorter alkanes and/or alkenes, for example by HPLC.
  • alkane and/or alkene compositions that are suitable, e.g., for use in jet fuels comprise ClO to C14 alkanes and/or alkenes.
  • alkane and/or alkene compositions that are suitable, e.g., for use in diesel fuels comprise alkanes and/or alkenes that have 16 or more carbons (e.g., Cl 6 or longer- chain alkanes and/or alkenes).
  • the fatty alcohol compositions described herein and compounds derived there from can be used as components of fuel compositions.
  • the fatty alcohol compositions produced by the methods described above can be used directly in fuel compositions.
  • the fatty alcohols can be reacted with a carboxylic acid to produce acid esters.
  • the acid esters are used as components of biodiesel fuel compositions.
  • the fatty alcohols are reacted with a reducing agent to produce alkanes and/or alkenes.
  • alkanes and/or alkenes derived from the fatty alcohol compositions are used as components of jet fuel compositions.
  • alkanes and/or alkenes derived from fatty alcohol compositions are used as components of rocket fuel. In still other embodiments, alkanes and/or alkenes derived from the fatty alcohol compositions are used as components in petrodiesel-like fuel compositions.
  • the fuel compositions comprise an alkane and/or alkene derived from the fatty alcohol compositions described herein.
  • the alkanes and/or alkenes have from 6 to 16 carbons and the fuel composition is a kerosene-like fuel composition.
  • the kerosene- like fuel compositions are included in jet fuel compositions.
  • the kerosene-like fuel compositions are included in various grades of jet fuel, including but not limited to, grades Avtur, Jet A, Jet A-I, Jet B, JP-4, JP-5, JP-7 and JP-8.
  • the kerosene-like fuel compositions are included in fuel compositions for heating.
  • the kerosene-like fuel compositions derived from the fatty alcohol compositions described above are burned with liquid oxygen to provide rocket fuel.
  • the kerosene-like fuel compositions are used in RP-I rocket fuel.
  • the alkanes and/or alkenes derived from the fatty alcohol compositions described herein are used in fuel compositions that are similar to petrodeisel fuel compositions, e.g., that contain saturated and aromatic hydrocarbons.
  • the fuel compositions comprise only alkanes and/or alkenes derived from the fatty alcohol compositions described herein.
  • the fuel compositions comprise alkanes and/or alkenes derived from the fatty alcohol
  • compositions described herein mixed with other components such as petrodiesel fuel.
  • the fatty alcohols are further processed with a carboxylic acid to form acid esters.
  • Esterification reactions of fatty alcohols are well- known in the art.
  • the transesterification reaction is carried out in the presence of a strong catalyst, e.g., a strong alkaline such as sodium hydroxide.
  • the reaction is carried out enzymatically using an enzyme that catalyzes the conversion of fatty alcohols to acid esters, such as lipoprotein lipase. See, e.g., Tsujita et ⁇ /. (1999) J Biochem. 126(6):1074-1079.
  • the acid esters are used as biodiesel fuel without being mixed with other components.
  • the fatty acid esters are mixed with other components, such as petrodiesel fuel.
  • fatty alcohols, or acid esters or alkanes and/or alkenes derived there from are combined with other fuels or fuel additives to produce compositions having desired properties for their intended use.
  • Exemplary fuels and fuel additives for particular applications are well-known in the art.
  • Exemplary fuels which can be combined with the compositions described herein include, but are not limited to, traditional fuels such as ethanol and petroleum-based fuels.
  • Exemplary fuel additives which can be combined with the compositions described herein include, but are not limited to, cloud point lowering additives, surfactants, antioxidants, metal deactivators, corrosion inhibitors, anti-icing additives, anti-wear additives, deposit-modifying additives and octane enhancers.
  • Wild-type B. mori, M. algicola DG893, and Oceanobacter sp. RED65 fatty acyl reductase (FAR) genes were designed for expression in E. co ⁇ i, S. cerevisiae, and Y. Hpolytica based on the reported amino acid sequences (B. mori FAR: Moto et al. (2003) Proc. Nat'lAcad. Sci. 100:9156-61; Reiser (1997) GenBank accession number BAC79425.1; M. algicola DG893 FAR: GenBank genome accession number
  • M. aquaeolei FAR gene having GenBank accession number YP 959486 was codon optimized for expression in E.coli, Codon optimization was performed using an algorithm as described in Example 1 of WO2008/042876, incorporated herein by reference in its entirety. Input codon usage information for the algorithm was either a hybrid of E. coli, S. cerevisiae, and Y. Hpolytica usages, or the codon usage for the individual organisms.
  • the genes were synthesized by Genscript (Piscataway, NJ) with flanking restriction sites for cloning into E.coli vector pCK 110900 described in US Patent Publication No. 2006/0195947. Nucleotide sequences for S/?I restriction sites were added to the 5' end and the 3' end of the gene as well as to the t7gl ⁇ RBS in front of the ATG start codon.
  • the genes were provided in the vector pUC57 by Genscript (Piscataway, NJ) and the sequences verified by DNA sequencing.
  • the sequences of the codon optimized genes for recombinant host cells for M. algicola DG893 FAR, M. aquaeolei, Oceanobacter sp. RED65 FAR, and B. mori FAR are set forth respectively in SEQ ID NOs: 1 and 3 for FAR_Maa, SEQ ID NO: 13 for FAR_Maq, SEQ ID NOs: 5 and 7 for FAR Osc and SEQ ID NO: 11 for B.
  • Example 2 Expression and activity of FARs in E. coli a. Construction of vectors to express FARs in E. coli
  • E. coli host strains comprising a plasmid containing a heterologous gene encoding either the B. mori, M. algicola DG893, M. aquaeolei or Oceanobacter sp. RED65 fatty acyl-CoA reductase, were grown in Luria Bertani Broth (LB) medium supplemented with 1% glucose and 30 ⁇ g/mL chloramphenicol (CAM), for approximately 16-18 hours (overnight) at 30°C, 200 rpm. A 5% inoculum was used to initiate fresh 50 mL 2xYT Broth culture supplemented with 30 ⁇ g/mL CAM and 0-0.4% glucose.
  • LB Luria Bertani Broth
  • CAM chloramphenicol
  • the culture was incubated in a shaker for 2.5 hours at 30°C and 200 rpm to an OD 6O0 of about 0.6 to about 0.8, at which point expression of the heterologous FAR was induced with isopropyl- ⁇ -D-thiogalactoside (IPTG) (1 mM final concentration).
  • IPTG isopropyl- ⁇ -D-thiogalactoside
  • a 400 ⁇ L sample was taken off the top organic layer, evaporated under a nitrogen stream and the residue was derivatized with 100 ⁇ L iV,O-Bis(trimethylsilyl)trifluoroacetamide) (BSTFA) at 37°C for 1 hour, and then diluted with 100 ⁇ L of heptanes before analysis by GC-FID or GC-MS.
  • BSTFA iV,O-Bis(trimethylsilyl)trifluoroacetamide
  • 0.5 mL of the culture medium (after removal of cells by centrifugation) was also extracted with 1 mL methyl t- butyl ether for 1 hr.
  • the organic phase was either analyzed directly by GC-FID or GC- MS or derivatized with BSTFA as described above before analysis.
  • a 1 ⁇ L sample was analyzed by GC-FID with the split ratio 1:10 using the following conditions: GC-6890N from Agilent Technologies equipped with FID detector and HP-5 column (length 30 m, LD. 0.32 mm, film 0.25 urn).
  • GC method start at 100 0 C, increase the temperature with a rate of 25°C/min to 246 0 C and hold for 1.96 min. Total run time, 7.8 min.
  • a The relative amounts of each fatty alcohol component are expressed as a % of the total fatty alcohols detected via GC-FID.
  • Fatty alcohols include: C12:0 (1-dodecanol), no C12:l (1-dodecenol) was detected, C14:0 (1-tetradecanol), no C14:l (1-tetradecenol) was detected, C16:l (cis ⁇ 9 -l-hexadecenol), C16:0 (1- hexahecanol), C18:l (cis ⁇ ⁇ -l-octadecenol), 18:0 (1-octadecanol).
  • ND not detected
  • coli BW25113 AfadE equipped with plasmid containing M. algicola DG893 (as described in Example 2b) to a starting optical density at 600 nm (OD 6 oo) of 0.8 to 1.0.
  • the inoculum was grown in a shake flask containing TB (BD, Franklin Lakes, NJ); 0.4% glycerol (Sigma Chemical Co., St. Louis, MO), and 30 ⁇ g/ml chloroamphenicol (Sigma Chemical Co., St. Louis, MO) at 30°C and 250 rpm until OD600 reached around 5.0.
  • the fermentor was agitated at 400-1000 rpm and air supplied at 1.0 L/min to maintain a minimum dissolved oxygen level of 30% of saturation.
  • the pH of the culture was controlled at 7.0 initially by addition of mixture of 14% v/v ammonium hydroxide and 10% w/v sodium hydroxide.
  • the base for pH control was switched to 20% w/v sodium hydroxide when ammonium concentration in the broth reached 1.5— 2.0 g/L.
  • the expression of M. algicola DG893 FAR was induced by addition of isopropyl- ⁇ -D-thiogalactoside (IPTG) (Sigma Chemical Corp., St. Louis, MO) to a final concentration of 1 niM.
  • IPTG isopropyl- ⁇ -D-thiogalactoside
  • Growth of the culture and production of fatty alcohol were maintained by addition of a feed solution containing 500 g/L glucose.
  • Example 3 Expression and activity of FAR enzymes in various E. coli strains a. Construction of vectors to express FARs in various E. coli strains
  • BW25113 parent and knock-out strains (AfadE and AfadD, AfadK) derived from
  • coli BW25113 strains comprising a plasmid containing a heterologous gene encoding either M. ⁇ lgicol ⁇ DG893 or Oce ⁇ nob ⁇ cter sp. RED65 fatty acyl reductase (FAR), were grown on Luria Bertani (LB) medium supplements with 1% glucose and 30 ⁇ g/ml chloramphenicol (CAM) for approximately 16 - 18 hours (overnight) at 30°C, 200 rpm. A 5% inoculums was used to initiate fresh 50 mL LB culture supplemented with 30 ⁇ g/mL CAM.
  • LB Luria Bertani
  • CAM chloramphenicol
  • the culture was incubated for 2.5 hrs at 30°C and 200 rpm to an OD600 of 0.6 - 0.8, at which point expression of the heterologous FAR gene was induced with isopropyl- ⁇ -D- thiogalactoside (IPTG) (1 mM final concentration). Incubation was continued for about 24 hours under the same conditions.
  • IPTG isopropyl- ⁇ -D- thiogalactoside
  • Extraction and quantitation of fatty alcohols were performed as described in Example 2b except the use of following GC method: start at 8O 0 C for 3 mins, increase the temperature at a rate of 50°C/min to 200 0 C, then increase the temperature at a rate of 10°C/min to 27O 0 C and finally, increase at 20°C/min to 300 0 C and hold for 5 min (total rum time 18.8 min).
  • Fatty alcohols include: 15 - 17% C14:0 (1-tetradeconal), approximately 38% C16:l (cis ⁇ M- hexadeconal), 23 - 24% C16:0 (1-hexacecanol), 21 - 22% C18:l (cis ⁇ n -l-octadeconal), 0 - 1% C18:0
  • Fatty alcohols include: 0 - 2% C14:0 (1-tetradeconal), 2 - 10% C16:l (as ⁇ -1-hexadeconal), 32 - 36% C16:0 (1-hexacecanol), 56 - 62% C18:l (as ⁇ ⁇ -l-octadeconal), 0 - 1% C18:0 (1-octadecanol).
  • LC- MS/MS was performed in a negative mode using parameters described in Table 4. All fatty acyl-CoA standards were obtained from Sigma (St. Louis, MO).
  • Fatty acyl-CoA production was estimated using both internal and external standards.
  • Fatty acyl-CoAs detected by LC-MS/MS include: 11-16% C14:0 (tetradecanoyl-CoA), 2 - 11% C14: 1 (tetradecenoyl- CoA), 28 - 31% C16:l (cis ⁇ 9 -l-hexadecenoyl-CoA), 14-26% C16:0 (hexadecanoyl-CoA), 14 - 20% C18:l (cis ⁇ n -octadecenoyl-CoA),9-15% C18:0 (octadecanoyl-CoA).
  • Example 4 Expression and activity of FARs in S. cerevisiae
  • the FAR genes were PCR amplified and cloned downstream of the TEFl promoter with BamHl and Sail sites into pCEN318 to create pCEN319 (B. mori FAR), pCEN328 (M. algicola DG896 FAR), and pCEN333 (Oceanobacter sp. RED65 FAR).
  • pCEN318 was constructed by replacing the KanMX gene of p427-TEF (Sunrise Science Products, San Diego, CA) with the hygromycin resistance gene.
  • AU FAR plasmids were transformed into S. cerevisiae FLlOO by routine transformation methods.
  • b In vivo activity of FARs in recombinant S. cerevisiae using shake flasks
  • the recombinant S. cerevisiae strains comprising a plasmid containing a heterologous gene encoding either the B. mori, M. algicola DG893 or Oceanobacter sp. RED65 FAR were inoculated into 5 ml of YPD containing 200 ⁇ g/mL hygromycin, grown at 30° C for 48 hours (OD ⁇ 8-10). Approximately 2.5 ml were subcultured into 50 ml of YPD media (2Ox dilution) containing 200 ⁇ g/mL hygromycin and grown in a shaker at 30° C and 250 rpm for 96 hours.
  • each fatty alcohol component is expressed as a % of the total fatty alcohols detected using via GC-FID or GC-MS.
  • Endogenous fatty alcohols include: C14:0 (1- tetradecanol), C16:0 (1-hexahecanol), and 18:0 (1-octadecanol). No unsaturated fatty alcohols were detected.
  • Example 5 Expression and activity of FAR enzymes in Yarrowia lipolytica a. Construction of vectors to express FARs in Yarrowia lipolytica
  • telomeres hygromycin and phleomycin (HygB(R) or BIe(R), respectively) (named plasmid pCEN354). Expression of each cassette was independently regulated by a strong, constitutive promoter isolated from Y. lipolytica: pTEFl for BIe(R) expression and pRPS7 for HygB(R) expression. Plasmid pCEN354 was used to assemble Y. lipolytica expression plasmids. Using "restriction free cloning" methodology, the FAR gene was inserted into pCEN354 to provided plasmid pCEN411 ( Figure 1).
  • heterologous gene expression is under control of the constitutive TEFl promoter.
  • the Hy gB R gene allows for selection in media containing hygromycin.
  • Arsl8 is an autonomous replicating sequence isolated from Y. lipolytica genomic DNA.
  • the resulting plasmid was transformed into Y. lipolytica 1345 obtained from the German Resource Centre for Biological Material (DSMZ) using routine transformation methods [(Madzak, C. et al. (2003) Yarrowia lipolytica. In G. Gellissen (Ed.), Production of Recombinant Proteins Novel Microbial and Eukaryotic Expression Systems (p 163-189).].
  • the recombinant Y. lipolytica strain comprising plasmid containing a heterologous gene encoding M. algicola DG893 FAR, was inoculated in 200 mL YPD media containing 8% glucose and 500 ⁇ g/mL hygromycin. The cultures were grown at 30° C to an OD600 of 4-7. Cells were then harvested by centrifugation and washed with 20 ml of 50 mM Tris-HCl pH 7.5. Extraction and identification of intra- and extra-cellular fatty alcohols were performed as described in Example 2b. Under the conditions tested 14 mg/L of 1-hexadecanol was detected. Secreted fatty alcohols were not detected.
  • Fatty alcohols include: 30% C16:0 (1- hexahecanol), 56% 18:0 (1-octadecanol) and 12% C18:l (cw ⁇ 9 -l-octadecenol).
  • Y. Hpolytica strain (YL1415) for production of fatty alcohols was identified from a library of UV-mutagenized strains defective in growth on media with hexadecane as the sole carbon source.
  • YL1415 strain showed 7- 10-fold increase in fatty alcohol titer and a significant reduction in the rate of degradation of exogenous 1-hexadecanol in YPD media containing 8% glucose and 500 ⁇ g/mL hygromycin compared to that detected from Y. Hpolytica 1345.
  • M. algicola DG893 FAR was improved in the YL1415 strain by integrating the M. algicola DG893 FAR gene at random locations in the genome by non-homologous recombination.
  • An integration cassette consisting of M. algicola FAR under control of the TEF promoter and the HygBR gene under control of the RPS promoter was amplified from pCEN411 using primers 411-F1 (AGAGACCGGGTTGGCGG) (SEQ ID NO: 17) and 411 -Rl (CATTTGCCATTCGTAACGCTG) (SEQ ID NO: 18).
  • Transformation of YL 1415 with this integration cassette yielded a library of hygromycin-resistant strains with FAR integrated at various locations in the Y.
  • Hpolytica genome [(Madzak, C. et al. (2003) Yarrowia Hpolytica. In G. Gellissen (Ed.), Production of Recombinant Proteins Novel Microbial and Eukaryotic Expression Systems (p 163-189)].
  • This collection of strains with integrated M. algicola DG893 FAR in the YL1415 UV mutant strain was grown in 96-well Axygen 96-well plates containing 250 ⁇ L YPD supplemented with the total of 2% glucose and 500 ⁇ g/mL hygromycin. Plates were incubated in a Kuhner shaker for approximately 40-48 hours at 30°C, 200 rpm and 85% relative humidity.
  • the cell cultures were diluted by transferring 50 ⁇ L of overnight grown cultures into the Axygen 96-well plates containing 250 ⁇ L YPD supplemented with the total of 2% glucose and 500 ⁇ g/mL hygromycin. The plates were incubated for approximately 24-28 hours in a Kuhner shaker under the similar conditions. 20 ⁇ L of the cell cultures were then transferred into deep 96-well plates containing 380 ⁇ L YPD supplemented with the total of 8% glucose and 500 ⁇ g/mL hygromycin. The Ppates were incubated for approximately 22-26 hours under similar conditions. Cells were collected by centrifugation for 10 minutes at 3500 rpm.
  • algicola FAR integrant strains with up to ⁇ 5x improvement in total fatty alcohol production (-0.5-1 g/L) compared to plasmid-based expression were identified.
  • Fatty alcohols include: 70-80% C16:0 (l-hexahecanol), 10-15% 18:0 (1-octadecanol) and 10-15% C18:l ⁇ pis ⁇ 9 -l-octadecenol).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Emergency Medicine (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

Methods of producing fatty alcohols from recombinant host cells comprising genes encoding heterologous fatty acyl-CoA reductase (FAR) enzymes are described including FAR enzymes and functional fragments thereof derived from marine bacterium and particularly marine gamma proteobacterium such as Marinobacter and Oceanobacter, as well as polynucleotides encoding the FAR enzymes and vectors and host cells comprising the same.

Description

PRODUCTION OF FATTY ALCOHOLS WITH FATTY ALCOHOL FORMING
ACYL-COA REDUCTASES (FAR)
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims benefit of provisional application No. 61/221 ,934 filed June 30, 2009 and provisional application No. 61/315,380 filed March 18, 2010, the entire contents of which are incorporated herein by reference.
REFERENCE TO SEQUENCE LISTING
[0002] The "Sequence Listing" submitted electronically concurrently herewith pursuant to 37 C.F.R. § 1.821 in a computer readable form (CRF) via file name CX3- 017US-ST25.txt is incorporated herein by reference. The electronic copy of the Sequence Listing was created June 28, 2010, and the size on disk is 82 Kbytes.
BACKGROUND
[0003] Diesel fuel is any fuel used in diesel engines and includes both petrodiesel and biodiesel. Petrodiesel is a specific fractional distillate of fossil fuel oil. It is comprised of about 75% saturated hydrocarbons and 25% aromatic hydrocarbons.
Biodiesel is not derived from petroleum but from vegetable oil or animal fats and contains long chain alkyl esters. Biodiesel is made by the transesterification of lipids (e.g., spent vegetable oil from fryers or seed oils) with an alcohol and burns cleaner than petrodiesel. Biodiesel can be used alone or mixed with petrodiesel in any amount for use in modern engines.
[0004] Kerosene is a combustible hydrocarbon that is also a specific fractional distillate of fossil fuel and contains hydrocarbons having 6 to 16 carbon atoms. Kerosene has a heat of combustion comparable to that of petrodiesel and is widely used in jet fuel to power jet engines and for heating in certain countries. Kerosene-based fuels can also be burned with liquid oxygen and used as rocket fuel (e.g., RP-I).
[0005] Reliance on petroleum-derived fuels has depleted the supply of natural resources and has required increased reliance on imported gasoline and diesel products. In addition, the burning of petroleum-based fuels has increased the amount of greenhouse gasses (e.g., carbon dioxide and methane) in the atmosphere that is contributing to the gradual warming of the earth's climate.
[0006] Fuels, such as biodiesel, that are made from animal or vegetable products burn cleaner than petroleum-derived fuels and do not produce a net increase in greenhouse gases. Furthermore, they are a sustainable energy source and have the potential to reduce the United States' reliance on imported petroleum-based products. However, there is a concern that using land to produce fuel crops rather than food crops will contribute to world hunger.
[0007] Fatty acids are the principle component of cell membranes and are used by nearly all organisms as a primary source of energy storage. Fatty alcohols are the reduction products of fatty acids and, like fatty acids, can be produced enzymatically by cultured cells. Fatty alcohols can be reacted with acids to form ester compositions similar to those present in biodiesel fuel, or reduced to form kerosene-like compositions, or hydrocarbon compositions similar to petrodiesel. Enzymes that convert fatty acyl- thioester substrates (e.g., fatty acyl-CoA or fatty acyl-ACP) to fatty alcohols are commonly referred to as fatty alcohol forming acyl-CoA reductases or fatty acyl reductases ("FARs").
[0008] PCT Publication No. WO 2007/136762 discloses genetically engineered microorganisms for the production of fatty acid derivatives and methods of their use.
[0009] PCT Publication No. WO 2009/140695 discloses compositions comprising cyanobacterial genes encoding enzymes involved in hydrocarbon biosynthesis and methods of using then in the production of aldehydes and alcohols.
[0010] Steen et al, 2010, Nature 463 :559 - 563 discloses the engineering of E. coli to produce specific fatty esters, fatty alcohols and waxes directly from simple sugars.
[0011] Schirmer, 2009, Current Opinion in Microbiology 12:274-281 describes the fermentative and nonfermentative metabolism of heterotrophic microorganisms used in the production of fuel-like molecules, biocatalysts that convert metabolic intermediates into fuel-like molecules, and the parameters that govern the cost effective production of such fuel-like molecules.
[0012] U.S. Patent No. 5,370,996 and Metz et al. (2000) Plant Physiology
122:635-644 disclose isolation and characterization of a fatty acyl reductase (FAR) enzyme from the desert shrub Simmondsia chinensis, more commonly known as jojoba.
[0013] Moto et al. (2003) Proc. Nat'lAcad. Sci USA 100(16):9156-9161 discloses the isolation and characterization of a FAR enzyme from the silk moth Bombyx mori,
[0014] Reiser et al. (1997) J Bacteriol. 179(9):2969-2975 discloses the isolation and characterization of a fatty acyl CoA reductase enzyme from the wax ester producing bacterium Acinetobacter calcoaceticus that reduces a fatty acyl-CoA substrate with chain lengths from C 14 to C22 to the corresponding fatty aldehyde, requiring a dehydrogenase enzyme for conversion of the fatty aldehyde to the fatty alcohol.
[0015] In theory, these FAR enzymes could be expressed in heterologous hosts as a means of producing a non-petroleum-based, renewable source of fatty alcohols or derivative compositions for use in biofuels. However, when expressed in heterologous hosts such as E. coli and yeast, the yields of fatty alcohols obtained have been insufficient for certain applications. In addition, at most, only a small fraction of the produced fatty alcohols are secreted by the microorganisms, increasing substantially the cost of purification.
[0016] Accordingly, there remains a need in the art for enzymes such as FAR enzymes that can be used to efficiently produce fatty alcohols for use in industrial applications such as, but not limited to applications in the food industry, cosmetic industry, medical industry, and fuels industry.
SUMMARY
[0017] The present disclosure provides isolated fatty acyl reductase (FAR) enzymes, nucleic acids encoding the FAR enzymes, recombinant microorganisms engineered to express the FAR enzymes, methods of producing fatty alcohols and other compositions utilizing the FAR enzymes and/or recombinant microorganisms, and compositions comprising and/or that are derived from the fatty alcohols. The various inventions described herein are based, in part, on the inventors' surprising discovery that certain genera of the class of gammaproteobacteria found in seawater contain FAR enzymes that are capable of generating high yields of total and secreted fatty alcohols when expressed in heterologous cells.
[0018] In particular, the present inventors have discovered that Marinobacter species algicola (strain DG893) ("FAR_Maa"), Marinobacter aquaeolei VT8
("FAR_Maq"), and Oceanobacter species strain RED65 (recently reclassified as
Bermanella marisrubri RED65) ("FAR_Ocs") possess FAR enzymes capable of producing approximately 150- to 400-times more total fatty alcohol, respectively, than FAR enzymes from B. mori, when expressed in an E. coli host. Significantly greater yields of fatty alcohols are also achieved in yeast. Based on this surprising discovery, it is expected that other genera of marine bacteria and particularly marine
gammaproteobacteria will likewise contain FAR enzymes that are especially suitable for the production of fatty alcohols, especially when expressed in heterologous host microorganisms. In certain embodiments, FAR enzymes that are especially suitable for the production of fatty alcohols may be identified using Hidden Markov Models
("HMMs"), which identify proteins by similarity to patterns found in pre-complied sets of protein sequences. The patterns inherent in each pre-complied set are encapsulated in HMMs. It is the HMM for a given sequence set that defines a protein domain or protein family. Using this technique it is possible to classify portions of a given protein sequence that share common domains with previously-identified suitable FAR enzymes. See, e.g., http://pfam.sanger.ac.uk/. In certain embodiments, the HMMs are used to identify NAD binding domains and/or sterile domains.
[0019] Accordingly, in one aspect the present disclosure provides isolated FAR enzymes derived from or obtained from marine bacteria, such as marine
gammaproteobacteria, and/or functional fragments thereof having FAR activity. In some embodiments, the FAR enzyme is isolated directly from the marine gammaproteobacteria in which it occurs naturally. In some embodiments, the FAR enzyme and/or a function fragment is isolated from a heterologous host microorganism engineered to express the FAR enzyme or functional fragment.
[0020] In another aspect, the present invention relates to a FAR enzyme and functional fragment thereof derived or obtained from M. algicola strain DG893. In one embodiment, the FAR enzyme or functional fragment thereof has an amino acid sequence that is at least 30 % identical, at least 75% identical, at least 80% identical and at least 90% identical to SEQ ID NO: 2 or a functional fragment thereof. In another specific embodiment, the isolated FAR enzyme has an amino acid sequence that is identical to SEQ ID NO: 2.
[0021] In a further aspect, the present invention relates to a FAR enzyme and functional fragment thereof derived or obtained from a strain of Oceanohacter. In one specific embodiment, the FAR enzyme is obtained or derived from Oceanobacter strain RED65 and has an amino acid sequence that is at least 30 % identical, at least 75% identical, at least 80% identical, and at least 90% identical to SEQ ID NO: 6. In another specific embodiment, the isolated FAR enzyme has an amino acid sequence that is identical to SEQ ID NO: 6.
[0022] In an additional aspect, the present disclosure provides polynucleotides encoding a marine gammaproteobacterial FAR enzyme, or functional fragment thereof, as described above. The polynucleotide can be a DNA or RNA, and can be single-stranded or double-stranded. It can be isolated from a naturally occurring microorganism, or prepared wholly or partially via synthetic means. In one embodiment, the nucleic acid sequence encodes a fatty acyl-CoA reductase (FAR) enzyme comprising an amino acid sequence having at least 30% sequence identity to SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 14 or functional fragments thereof. In other embodiments, the nucleic acid encodes a FAR enzyme comprising at least 75% sequence identity (that is at least 75%, at least 80%, at least 90%, at least 95% and even 100% sequence identity) to SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 14 or a functional fragment thereof. In some embodiments of this aspect, a vector comprises the nucleic acid encoding the FAR enzyme. In some embodiments, the polynucleotide encoding the FAR enzyme or functional fragment thereof is operably linked to a promoter, and optionally, to other control sequences and elements that control expression. In some embodiments, the vector is designed or selected so as to remain distinct from the genome of the host microorganism (for example, a plasmid) or to integrate into the genome of the host microorganism for example by either homologous recombination or site-specific integration. In a specific embodiment, the codons of the portion of the construct encoding the FAR enzyme or functional fragment are optimized for expression in a particular host microorganism.
[0023] In one more aspect, the present disclosure provides recombinant microorganisms engineered to express a heterologous marine gammaproteobacterial FAR gene, or a functional fragment thereof, as described herein. In some embodiments, recombinant host cells include bacteria, filamentous fungi and yeast. In particular embodiments, bacteria are E. coli. In other particular embodiments, the yeast is an oleaginous yeast. In certain embodiments, the oleaginous yeast is Y. Hpolytica. In still other particular embodiments, the yeast is S. cerevisiae. In certain aspects, the microorganisms are wild-type microorganisms. In other aspects, the microorganisms are genetically modified.
[0024] In certain specific embodiments, the genetically modified microorganism further over expresses a gene encoding a protein that increases the rate at which the microorganism produces the substrate of a FAR enzyme, i.e., a fatty acyl-thioester substrate. In certain embodiments, the enzyme encoded by the over expressed gene is directly involved in fatty acid synthesis. In particular embodiments, the enzyme encoded by the over expressed gene is selected from a fatty acid synthase, an acyl-ACP thioesterase, a fatty acyl-CoA synthase and an acetyl-CoA carboxylase. In some embodiments, the protein encoded by the over expressed gene is endogenous to the microorganism. In other embodiments, the protein encoded by the over expressed gene is heterologous to the microorganism.
[0025] In yet another aspect, the present disclosure provides methods of producing compositions comprising fatty alcohols and/or acid esters and/or alkanes and/or alkenes derived from the fatty alcohols. In certain embodiments, the fatty alcohols are produced in a cell-free system where a FAR enzyme as described above is provided with a fatty acyl-thioester substrate and necessary cofactors under suitable conditions of temperature, pH and ionic strength for a time sufficient to produce fatty alcohols. In various embodiments, fatty alcohols are produced by a recombinant host cell comprising a heterologous gene encoding a FAR enzyme described above. In these embodiments, the host cell is cultured in an aqueous nutrient medium comprising an assimilable carbon source under conditions suitable for production of fatty alcohols. In certain specific embodiments, the recombinant host cell is a bacterium or yeast. In various embodiments, the yeast is an oleaginous yeast. In particular embodiments, the bacterium is E. coli and the yeast is selected from S. cerevisiae and Y. lipolytica.
[0026] In some embodiments, the fatty alcohols are produced by a recombinant host cell comprising a heterologous gene encoding a FAR enzyme and one or more proteins that increase the rate at which the recombinant host cell produces the acyl- thioester substrate for FAR. In some embodiments, the one or more proteins are directly involved in fatty acid biosynthesis. In certain particular embodiments, the one or more proteins are selected from a fatty acid synthase, an acyl-ACP thioesterase, a fatty acyl- CoA synthase and an acetyl-CoA carboxylase. In some aspects, the fatty alcohols produced by the recombinant microorganisms are secreted from the cells into the aqueous nutrient medium. In certain embodiments, the methods described herein include a step of isolating the fatty alcohols.
[0027] In an additional aspect, the invention relates to a method of producing a fatty alcohol composition comprising culturing a recombinant microorganism in a suitable culture medium wherein the recombinant microorganism comprises a gene encoding a heterologous fatty acyl reductase (FAR) enzyme having at least 30% sequence identity to SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 14 or a functional fragment thereof and allowing expression of said gene wherein said expression results in the production of a composition of fatty alcohols. In some embodiments of this aspect, the method further comprises isolating the produced fatty alcohols. In particular embodiments, the methods described herein produce at least about 0.5 g/L of fatty alcohols, also at least 5g/L and even at least 15 g/L of fatty alcohols.
[0028] In yet another aspect, the invention relates to a method of producing a fatty alcohol composition by an acyl-CoA independent pathway comprising culturing a recombinant E.coϊi in a nutrient medium under suitable conditions, wherein said recombinant E.coli comprises a nucleic acid sequence encoding a heterologous fatty acyl- CoA reductase (FAR) enzyme comprising an amino acid sequence having at least 75% (such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97% and even 100%) sequence identity to SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 14 or functional fragments thereof; allowing expression of said FAR; and producing a fatty alcohol composition.
[0029] In yet a further aspect, the recombinant microorganism engineered to express a FAR encompassed by the invention is a bacterium and particularly an E.coli comprising an inactivated or silenced endogenous fatty acyl-CoA synthetase fadD gene. In other embodiments, the recombinant E. coli will comprise an inactivated or silenced endogenous short chain fatty acyl-CoA synthetase fadK gene. In still other embodiments, both genes will be inactivated or silenced.
[0030] In yet another aspect, the present disclosure provides for fatty alcohol compositions produced by a method described above. In some embodiments, the fatty alcohol composition is produced in a cell-free system. In other embodiments, the fatty alcohol composition is produced by a recombinant host cell, hi particular embodiments, the compositions comprise fatty alcohols with saturated, unsaturated, linear, branched or cyclic hydrocarbon chains. In certain embodiments, the compositions comprise saturated fatty alcohols and/or monounsaturated fatty alcohols.
[0031] In still other aspects, the present disclosure provides for compositions comprising alkanes and/or alkenes derived by reducing the fatty alcohol compositions described herein. In certain embodiments, the reduction reaction is carried out chemically. In other embodiments, the reduction reaction is carried out using a microorganism that has a biosynthetic pathway for reducing fatty alcohols. In certain embodiments, the compositions produced by reduction of fatty alcohols comprise substantially all alkanes and/or alkenes. In other embodiments, the compositions comprise a mixture of fatty alcohols and alkanes and/or alkenes derived there from.
[0032] In yet another aspect, the present disclosure provides for fuel compositions comprising fatty alcohols and/or acid esters and/or alkanes and/or alkenes derived there from. In certain embodiments, the fatty alcohol compositions produced by the methods described above are used directly in fuel compositions. In various embodiments, the fatty alcohols are reacted with a carboxylic acid to produce acid esters for use as biodiesel fuel compositions. In other embodiments, the fatty alcohols are reacted with a reducing agent to produce alkanes and/or alkenes. In certain embodiments, the fatty alcohols undergo esterifcation to form fatty esters. In some embodiments, the alkanes and/or alkenes derived from the fatty alcohol compositions are used as components of jet fuel compositions. In other embodiments, the alkanes and/or alkenes derived are used as components of rocket fuel. In still other embodiments, alkanes and/or alkenes derived from the fatty alcohol compositions are used as components of petrodiesel-like fuel compositions.
BRIEF DESCRIPTION OF THE FIGURES
[0033] FIG. 1 shows the replicative Y. lipolytica vector pCEN411 (approximately
9065 bp) containing cassettes encoding hygromycin (HygB) resistance and FAR expression. Arsl8 is an autonomous replicating sequence isolated from Y. lipolytica chromosomal DNA.
[0034] FIG. 2 shows a codon optimized polynucleotide sequence (SEQ ID NO: 1) encoding a FAR enzyme of Marinobacter algicola strain DG893 having the amino acid sequence shown in FIG. 6 (SEQ ID NO: 2).
[0035] FIG. 3 shows a codon optimized polynucleotide sequence (SEQ ID NO: 3) encoding a FAR enzyme of Marinobacter algicola strain DG893 having the amino acid sequence shown in FIG. 6 (SEQ ID NO: 4) and optimized for expression in Y. lipolytica. [0036] FIG. 4 shows a codon optimized polynucleotide sequence (SEQ ID NO: 5) encoding a FAR enzyme of Oceanobacter sp. .strain RED65 having the amino acid sequence shown in FIG. 7 (SEQ ID NO: 6).
[0037] FIG. 5 shows a codon optimized polynucleotide sequence (SEQ ID NO: 7) encoding a FAR enzyme of Oceanobacter sp. strain RED65 having the amino acid sequence shown in FIG. 7 (SEQ ID NO: 8) and optimized for expression in Y. Hpolytica.
[0038] FIG. 6 shows the amino acid sequence of a FAR polypeptide of
Marinobacter algicola strain DG893. The amino acid sequence (SEQ ID NO: 2) encoded by the polynucleotide sequence of SEQ ID NO: 1 is identical to the amino acid sequence (SEQ ID NO: 4) encoded by the polynucleotide sequence of SEQ ID NO: 3. While it is understood that both SEQ ID NO: 2 and SEQ ID NO: 4 are identical and interchangeable, reference will generally be made to SEQ ID NO: 2 in this disclosure.
[0039] FIG. 7 shows the amino acid sequence of a FAR polypeptide of
Oceanobacter sp. .strain RED65. The amino acid sequence (SEQ ID NO: 6) encoded by the polynucleotide sequence of SEQ ID NO: 5 is identical to the amino acid sequence (SEQ ID NO: 8) encoded by the polynucleotide sequence of SEQ ID NO: 7. While it is understood that both SEQ ID NO: 6 and SEQ ID NO: 8 are identical and interchangeable reference will generally be made to SEQ ID NO: 6 in this disclosure. The amino acid sequence of SEQ ID NO: 2 and the amino acid sequence of SEQ ID NO: 6 are about 47% identical.
[0040] FIG. 8 shows a codon optimized polynucleotide sequence (SEQ ID NO: 9) encoding a FAR polypeptide (SEQ ID NO: 10) from the silk moth B. mori.
[0041] FIG. 9 shows the amino acid sequence (SEQ ID NO: 10 and SEQ ID NO:
12) of a FAR polypeptide from the silk moth B. mori.
[0042] FIG. 10 shows a codon optimized polynucleotide sequence (SEQ ID NO:
11) encoding a FAR enzyme of B. mori having the amino acid sequence shown in SEQ ID NO: 12 and optimized for expression in 7. Hpolytica. [0043] FIG. 11 shows a codon optimized polynucleotide sequence (SEQ ID NO:
13) encoding a FAR enzyme of Marinobacter aquaeolei having the amino acid sequence shown in SEQ ID NO: 14.
[0044] FIG. 12 shows the amino acid sequence of a FAR polypeptide of
Marinobacter aquaeolei (SEQ ID NO: 14). The amino acid sequence of M. aquaeolei (SEQ ID NO: 14) has about 78% sequence identity to the amino acid sequence of M. algicola DG893 (SEQ ID NO: 2).
[0045] FIG. 13 depicts biosynthetic pathways for fatty alcohol production via a) an acyl-CoA dependent pathway utilizing fatty acyl-ACP and fatty acyl-CoA
intermediates and b) an acyl-CoA independent pathway utilizing fatty acyl-ACP intermediates but not a fatty acyl-CoA intermediate, wherein "R" as used in the compound formulas is a C 8 to C24 saturated, unsaturated, linear, branched or cyclic hydrocarbon.
DETAILED DESCRIPTION
[0046] The present disclosure provides FAR enzymes, recombinant host cells comprising a nucleic acid encoding a heterologous FAR enzyme, processes for the biosynthesis of fatty alcohols including the conversion of fatty acyl-thioester complexes (such as fatty acyl-CoA substrates and fatty acyl-ACP substrates) to fatty alcohols, and compositions comprising fatty alcohols produced by the biosynthetic methods.
Definitions:
[0047] Unless defined otherwise, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Generally, the nomenclature used herein and the laboratory procedures of cell culture, molecular genetics, organic chemistry, analytical chemistry and nucleic acid chemistry described below are those well known and commonly employed in the art.
[0048] As used herein, the following terms are intended to have the following meanings: The following abbreviations are used herein: "FAR" denotes fatty acyl reductase or fatty alcohol forming acyl-CoA reductase; "ACP" denotes acyl carrier protein; "CoA" denotes coenzyme A; "TE" denotes thioesterase;"FAS" denotes fatty acid synthase; "FACR" denotes fatty acyl-CoA reductase; "FACS" denotes fatty acyl-CoA synthase (synthetase) and acyl-CoA synthase (synthetase) as used interchangeably herein; and "ACC" denotes acetyl-CoA carboxylase.
[0049] "Fatty alcohol forming acyl-CoA reductase" or "fatty acyl reductase" as used interchangeably herein refers to an enzyme that catalyzes the reduction of a fatty acyl-CoA, a fatty acyl- ACP, or other fatty acyl thioester complex to a fatty alcohol, which is linked to the oxidation of NAD(P)H to NAD(P)+, as shown in Scheme I:
Figure imgf000013_0001
(I ) (H )
Scheme I
wherein "R" represents a C 8 to C24 saturated, unsaturated, linear, branched or cyclic hydrocarbon, and "R1" represents CoA, ACP or other fatty acyl thioester substrates. CoA is a non-protein acyl carrier group factor (or moiety) involved in the synthesis and oxidation of fatty acids. "ACP" is a polypeptide or protein subunit of fatty acid synthase used in the synthesis of fatty acids. FARs are distinct from FACRs. FACRs reduce only fatty acyl-CoA intermediates to fatty aldehydes and require an additional oxidoreductase enzyme to generate the corresponding fatty alcohol. "Fatty aldehyde" as used herein refers to a saturated or unsaturated aliphatic aldehyde and reference is made to FIG. 13, wherein R is as defined above.
[0050] The term "fatty acid" as used herein refers to a compound of formula III:
Figure imgf000014_0001
(III) wherein "R" is as defined above. Saturated or unsaturated fatty acids can be described as "Ca:b", wherein "a" is an integer that represents the total number of carbon atoms and "b" is an integer that refers to the number of double bonds in the carbon chain.
[0051] The term "fatty alcohol" as used herein refers to an aliphatic alcohol of the formula (II) wherein R is as defined above. Saturated or unsaturated fatty alcohols can be described as "Ca:b-OH", wherein "a" is an integer that represents the total number of carbon atoms in the fatty alcohol and "b" is an integer that refers to the number of double bonds in carbon chain.
[0052] Unsaturated fatty acids or fatty alcohols can be referred to as "cis Δx" or
"trans Δx" wherein "cis" and "trans" refer to the carbon chain configuration around the double bond and "x" indicates the number of the first carbon of the double bond, wherein carbon 1 is the carboxylic acid carbon of the fatty acid or the carbon bound to the -OH group of the fatty alcohol.
[0053] The term "fatty acyl-thioester" or "fatty acyl-thioester complex" refers to a compound of formula (I), wherein a fatty acyl moiety is covalently linked via a thioester linkage to a carrier moiety. Fatty acyl-thioesters are substrates for the FAR enzymes described herein.
[0054] The term "fatty acyl-CoA" refers to a compound of formula (I) wherein R1 is Coenzyme A.
[0055] The term "fatty acyl- ACP" refers to a compound of formula (I) wherein Rj is acyl carrier protein.
[0056] The phrase "acyl-CoA independent pathway" refers to the production of fatty alcohols by the direct enzymatic conversion of fatty acyl- ACP substrates to fatty alcohols and does not involve the use of free fatty acids or fatty acyl-CoA intermediates. This biosynthetic pathway differs from a) the fatty acyl-CoA dependent pathway which converts fatty acyl-ACP directly to fatty acyl CoA via an acyl-transfer reaction, such as in yeast, and b) the fatty acyl-CoA dependent pathway which converts fatty acyl-ACP to fatty acyl-CoA via a free fatty acid intermediate, such as in bacteria and reference is made to FIG. 13.
[0057] The acyl-CoA independent pathway has the advantage of bypassing the step of form a fatty acyl-CoA substrate from free fatty acid, which requires the use of ATP. Therefore, the acyl-CoA independent pathway may use less energy than the acyl- CoA dependent pathway that utilizes a free fatty acid intermediate.
[0058] "Conversion" refers to the enzymatic conversion of the substrate to the corresponding product. "Percent conversion" refers to the percent of the substrate that is reduced to the product within a period of time under specified conditions. Thus, the "enzymatic activity" or "activity" of a polypeptide can be expressed as "percent conversion" of the substrate to the product.
[0059] "Percentage of sequence identity," "percent identity" and "percentage homology" are used interchangeably herein to refer to comparisons among
polynucleotides and polypeptides, and are determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which may also contain gaps to optimize the alignment) for alignment of the two sequences. The percentage may be calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (including positions where one of the sequences has a gap) and
multiplying the result by 100 to yield the percentage of sequence identity. Alternatively, the percentage may be calculated by determining the number of positions at which either the identical nucleic acid base or amino acid residue occurs in both sequences or a nucleic acid base or amino acid residue is aligned with a gap to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. Those of skill in the art appreciate that there are many established algorithms available to align two sequences and that different methods may give slightly different results.
[0060] Alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith and Waterman, 1981, Adv. Appl. Math. 2:482, by the homology alignment algorithm of Needleman and Wunsch, 1970, J. MoI. Biol. 48:443, by the search for similarity method of Pearson and Lipman, 1988, Proc. Natl. Acad. Sci. USA 85:2444, by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the GCG Wisconsin Software Package), or by visual inspection (see generally, Current Protocols in Molecular Biology, F. M. Ausubel et ah, eds., Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley & Sons, Inc., (1995 Supplement) (Ausubel)). The Clustral (Chenna R., Sugawara H., Koike T., Lopez R., Gibson T.J., Higgins D. G., Thompson J.D., (2003) Multiple sequence alignment with the Clustral series of programs, Nucleic Acids Res., 31, 3497 - 3500.) and T-Coffee (T-COFFEE: A novel method for multiple sequence alignments. Notredame, Higgins, Heringa, JMB 302 (205 -217) 2000 software packages may also be used to align sequences.
[0061] Examples of algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et ah, 1990, J. MoI. Biol. 215: 403-410 and Altschul et al., 1977, Nucleic Acids Res. 3389-3402, respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information website. This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive- valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as, the neighborhood word score threshold (Altschul et al, supra). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased.
Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) of 10, M=5, N=-4, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff and Henikoff, 1989, Proc Natl Acad Sci USA 89:10915). Exemplary determination of sequence alignment and % sequence identity can employ the BESTFIT or GAP programs in the GCG Wisconsin Software package (Accelrys, Madison WI), using default parameters provided.
[0062] "Reference sequence" refers to a defined sequence used as a basis for a sequence comparison. A reference sequence may be a subset of a larger sequence, for example, a segment of a full-length gene or polypeptide sequence. Generally, a reference sequence is at least 20 nucleotide or amino acid residues in length, at least 25 residues in length, at least 50 residues in length, or the full length of the nucleic acid or polypeptide. Since two polynucleotides or polypeptides may each (1) comprise a sequence {i.e., a portion of the complete sequence) that is similar between the two sequences, and (2) may further comprise a sequence that is divergent between the two sequences, sequence comparisons between two (or more) polynucleotides or polypeptide are typically performed by comparing sequences of the two polynucleotides over a "comparison window" to identify and compare local regions of sequence similarity. [0063] "Comparison window" refers to a conceptual segment of at least about 20 contiguous nucleotide positions or amino acids residues wherein a sequence may be compared to a reference sequence of at least 20 contiguous nucleotides or amino acids and wherein the portion of the sequence in the comparison window may comprise additions or deletions (i.e., gaps) of 20 percent or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The comparison window can be longer than 20 contiguous residues, and includes, optionally 30, 40, 50, 100, or longer windows.
[0064] "Conservative" amino acid substitutions or mutations refer to the interchangeability of residues having similar side chains, and thus typically involves substitution of the amino acid in the polypeptide with amino acids within the same or similar defined class of amino acids. However, as used herein, conservative mutations do not include substitutions from a hydrophilic to hydrophilic, hydrophobic to hydrophobic, hydroxyl-containing to hydroxyl-containing, or small to small residue, if the conservative mutation can instead be a substitution from an aliphatic to an aliphatic, non-polar to non- polar, polar to polar, acidic to acidic, basic to basic, aromatic to aromatic, or constrained to constrained residue. Further, as used herein, A, V, L, or I can be conservatively mutated to either another aliphatic residue or to another non-polar residue. Table 1 below shows exemplary conservative substitutions.
Table 1 : Conservative Substitutions
Figure imgf000018_0001
[0065] "Non-conservative substitution" refers to substitution or mutation of an amino acid in the polypeptide with an amino acid with significantly differing side chain properties. Non-conservative substitutions may use amino acids between, rather than within, the defined groups listed above. In one embodiment, a non-conservative mutation affects (a) the structure of the peptide backbone in the area of the substitution (e.g., proline for glycine) (b) the charge or hydrophobicity, or (c) the bulk of the side chain.
[0066] "Deletion" refers to modification to the polypeptide by removal of one or more amino acids from the reference polypeptide. Deletions can comprise removal of 1 or more amino acids, 2 or more amino acids, 5 or more amino acids, 10 or more amino acids, 15 or more amino acids, or 20 or more amino acids, up to 10% of the total number of amino acids, or up to 20% of the total number of amino acids making up the reference enzyme while retaining enzymatic activity and/or retaining the improved properties of an engineered enzyme. Deletions can be directed to the internal portions and/or terminal portions of the polypeptide. In various embodiments, the deletion can comprise a continuous segment or can be discontinuous. The term "deletion" is also used to refer to a DNA modification in which one or more nucleotides or nucleotide base-pairs have been removed, as compared to the corresponding reference, parental or "wild type" DNA.
[0067] "Insertion" refers to modification to the polypeptide by addition of one or more amino acids to the reference polypeptide. In some embodiments, the modification comprises insertions of one or more amino acids to the naturally occurring polypeptide as well as insertions of one or more amino acids to other modified polypeptides. Insertions can be in the internal portions of the polypeptide, or to the carboxy or amino terminus. Insertions as used herein include fusion proteins as is known in the art. The insertion can be a contiguous segment of amino acids or separated by one or more of the amino acids in the naturally occurring polypeptide. The term "insertion" is also used to refer to a DNA modification in which or more nucleotides or nucleotide base-pairs have been inserted, as compared to the corresponding reference, parental or "wild type" DNA.
[0068] "Different from" or "differs from" with respect to a designated reference sequence refers to difference of a given amino acid or polynucleotide sequence when aligned to the reference sequence. Generally, the differences can be determined when the two sequences are optimally aligned. Differences include insertions, deletions, or substitutions of amino acid residues in comparison to the reference sequence.
[0069] As used herein in the context of a polypeptide or polynucleotide, the phrase "derived from" a particular organism refers to a wild-type polynucleotide or polypeptide that originates in the organism and to mutant and variants thereof that either originate in the organism or are produced by human manipulation of the wild-type polynucleotide or polypeptide.
[0070] "Functional fragment" as used herein refers to a polypeptide that has an amino-terminal and/or carboxy-terminal deletion, but where the remaining amino acid sequence is identical to the corresponding positions in the sequence and that retains substantially all of the activity of the full-length polypeptide. Functional fragments can comprise up to 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99% of the full-length polypeptide.
[0071] "Endogenous" polynucleotide, gene, promoter or polypeptide refers to any polynucleotide, gene, promoter or polypeptide that originates in a particular host cell. A polynucleotide, gene, promoter or polypeptide is not endogenous to a host cell if it has been removed from the host cell, subjected to laboratory manipulation, and then reintroduced into a host cell.
[0072] "Heterologous" polynucleotide, gene, promoter or polypeptide refers to any polynucleotide, gene, promoter or polypeptide that is introduced into a host cell that is not normally present in that cell, and includes any polynucleotide, gene, promoter or polypeptide that is removed from the host cell and then reintroduced into the host cell.
[0073] "Inactive" or "inactivated" in reference to a gene refers to a gene having at least one function that is impaired. Genes can be inactivated in a variety of ways known in the art, including but not limited to insertion of a mobile genetic element (e.g., a transposon); deletion of all or part of the gene, such that the gene product is not made, or is truncated and is non-functional; mutation of the gene such that the gene product is not made, or is truncated and is non-functional; deletion or mutation of one or more control elements that control expression of the gene such that the gene product is not made; and the like. In certain embodiments genes can ne inactivated by methods other than genetic modification, for example, by gene silencing at the transcriptional level or at the post- transcriptional level using for example RNAi.
[0074] "Recombinant host cell" refers to a cell into which has been introduced a heterologous polynucleotide, gene, promoter, e.g., an expression vector, or to a cell having a heterologous polynucleotide or gene integrated into the genome.
[0075] "Naturally-occurring" or "wild-type" refers to the form found in nature.
For example, a naturally occurring or wild-type polypeptide or polynucleotide sequence is a sequence present in an organism that can be isolated from a source in nature and which has not been intentionally modified by human manipulation. A wild-type organism refers to an organism that has not been intentionally modified by human manipulation.
[0076] "Codon optimized" refers to changes in the codons of the polynucleotide encoding a protein to those preferentially used in a particular organism such that the encoded protein is efficiently expressed in the organism of interest. Although the genetic code is degenerate in that most amino acids are represented by several codons, called "synonyms" or "synonymous" codons, it is well known that codon usage by particular organisms is nonrandom and biased towards particular codon triplets. This codon usage bias may be higher in reference to a given gene, genes of common function or ancestral origin, highly expressed proteins versus low copy number proteins, and the aggregate protein coding regions of an organism's genome. In some embodiments, the
polynucleotides encoding enzymes may be codon optimized for optimal production from the host organism selected for expression.
[0077] "Preferred, optimal, high codon usage bias codons" refers interchangeably to codons that are used at higher frequency in the protein coding regions than other codons that code for the same amino acid. The preferred codons may be determined in relation to codon usage in a single gene, a set of genes of common function or origin, highly expressed genes, the codon frequency in the aggregate protein coding regions of the whole organism, codon frequency in the aggregate protein coding regions of related organisms, or combinations thereof. Codons whose frequency increases with the level of gene expression are typically optimal codons for expression. A variety of methods are known for determining the codon frequency (e.g., codon usage, relative synonymous codon usage) and codon preference in specific organisms, including multivariate analysis, for example, using cluster analysis or correspondence analysis, and the effective number of codons used in a gene (See GCG Codon Preference, Genetics Computer Group Wisconsin Package; CodonW, John Peden, University of Nottingham; Mclnerney, J. O, 1998, Biomformatics 14:372-73; Stenico et al., 1994, Nucleic Acids Res. 222437-46; Wright, F., 1990, Gene 87:23-29). Codon usage tables are available for a growing list of organisms (see for example, Wada et al., 1992, Nucleic Acids Res. 20:2111-2118;
Nakamura et al., 2000, Nucl. Acids Res. 28:292; Duret, et al., supra; Henaut and Danchin, "Escherichia coli and Salmonella," 1996, Neidhardt, et al. Eds., ASM Press, Washington D. C, p. 2047-2066), all of which are incorporated herein by reference. The data source for obtaining codon usage may rely on any available nucleotide sequence capable of coding for a protein. These data sets include nucleic acid sequences actually known to encode expressed proteins (e.g., complete protein coding sequences-CDS), expressed sequence tags (ESTs), or predicted coding regions of genomic sequences (see for example, Mount, D., Biomformatics: Sequence and Genome Analysis, Chapter 8, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., 2001; Uberbacher, E. C, 1996, Methods Enzymol. 266:259-281; Tiwari et al., 1997, Comput. Appl. Biosci.
13:263-270), all of which are incorporated herein by reference.
[0078] "Expression" as used herein may include any step involved in the production of the FAR polypeptides including but not limited to transcription and translation.
[0079] "Control sequence" is defined herein to include all components, which are necessary or advantageous for the expression of a polypeptide of the present disclosure. Each control sequence may be native or foreign to the nucleic acid sequence encoding the polypeptide. Such control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence, and transcription terminator. At a minimum, the control sequences include a promoter, and transcriptional and translational stop signals. The control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the nucleic acid sequence encoding a polypeptide.
[0080] "Operably linked" and "operably associated" are defined herein as a configuration in which a control sequence is appropriately placed at a position relative to the coding sequence of the DNA sequence such that the control sequence directs the expression of a polynucleotide and/or polypeptide.
[0081] "Promoter sequence" is a nucleic acid sequence that is recognized by a host cell for expression of the coding region. The control sequence may comprise an appropriate promoter sequence. The promoter sequence contains transcriptional control sequences, which mediate the expression of the polypeptide. The promoter may be any nucleic acid sequence which shows transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either endogenous or heterologous to the host cell.
[0082] As used herein the term "transformed" or "transformation" used in reference to a cell means a cell has a non-native nucleic acid sequence integrated into its genome or as a plasmid that is maintained through multiple generations.
[0083] It should be noted that the indefinite articles "a" and "an" and the definite article "the" are used in the present application to mean one or more unless the context clearly dictates otherwise. Further, the term "or" is used in the present application to mean the disjunctive "or" and the conjunctive "and". FAR Enzymes Useful in the Methods of the Disclosure:
[0084] In one aspect the present disclosure provides FAR enzymes derived from or obtained from gammaproteobacteria (such as marine gammaproteobacteria) and/or functional fragments thereof having FAR activity, hi some embodiments, the FAR enzyme is isolated directly from the gammaproteobacteria in which it occurs naturally. In some embodiments, the FAR enzyme and/or a function fragment is isolated from a heterologous host microorganism engineered to express the FAR enzyme or functional fragment. The FAR enzyme and/or functional fragment can be derived or obtained from virtually any genus of marine gammaproteobacteria. In certain embodiments, the FAR enzyme for use in the methods disclosed herein is endogenous to a marine bacterium, i.e., a bacterium mined from a marine environment. In various embodiments, the FAR enzyme for use in the methods disclosed herein is endogenous to an organism other than a marine bacterium.
[0085] In certain embodiments, the FAR enzyme and/or functional fragment can be derived or obtained from a gammaproteobacterium of the order Alteromonadales. In some embodiments, the FAR enzyme and/or functional fragment can be derived from or obtained from the Alteromonadales family Alteromonadaceae. In certain embodiments, the FAR enzyme and/or functional fragment can be derived from or obtained from an Alteromonadaceae genus such as but not limited to the Alteromonadaceae genus
Marinobacter. In certain specific embodiments, the FAR enzyme and/or functional fragment can be derived from the Marinobacter species algicola. In a particular embodiment, the FAR enzyme and/or functional fragment can be derived from or obtained from the M. algicola species strain DG893. In some specific embodiments, the FAR enzyme for use in the methods disclosed herein is from the marine bacterium Marinobacter algicola (e.g., M. algicola) DG893 (SEQ ID NO: 2) ("FAR_Maa").
[0086] In some embodiments, the FAR enzyme and/or functional fragment is derived or obtained from a species of Marinobacter including, but not limited to, a species selected from M. algicola, M. alkaliphilus, M. aquaeolei, M. arcticus, M. bryozoorum, M. daepoensis, M. excellens, M. flavimaris, M. guadonensis, M.
hydrocarbonoclasticus, M. koreenis, M. lipolyticus, M. Htoralis, M. lutaoensis, M.
maritimus, M. sediminum, M, squalenivirans and M. vinifirmus and equivalent and synonymous species thereof.
[0087] In one specific embodiment, the FAR enzyme is derived or obtained from
M. algicola strain DG893 and has an amino acid sequence that is at least 30 % identical, at least 50% identical, at least 60% identical, at least 70% identical, at least 75%, at least 80% identical, at least 85% identical, at least 90% identical, at least 93% identical at least 95% identical, at least 97% identical and/or at least 98% identical to SEQ ID NO: 2 or a functional fragment thereof. In another specific embodiment, the isolated FAR enzyme has an amino acid sequence that is identical to SEQ ID NO: 2.
[0088] In one specific embodiment, the FAR enzyme is derived or obtained from
Marinobacter aquaeolei and has an amino acid sequence that is at least 30 % identical, at least 50% identical, at least 60% identical, at least 70% identical, at least 75%, at least 80% identical, at least 85% identical, at least 90% identical, at least 93% identical, at least 95% identical, at least 97% identical and/or at least 98% identical to SEQ ID NO: 14 or a functional fragment thereof. In another specific embodiment, the isolated FAR enzyme has an amino acid sequence that is identical to SEQ ID NO: 14.
[0089] In various embodiments, the isolated FAR enzyme and/or functional fragment is obtained or derived from a marine bacterium selected from the group of Meptuniibacter caesariensis species strain MED92, Reinekea sp. strain MED297, Marinomonas sp. strain MED 121, unnamed gammaproteobacterium strain HTCC2207 and Marinobacter sp. strain ELB 17 and equivalents and synonymous species thereof.
[0090] In various embodiments, the FAR enzyme and/or functional fragment can be derived or obtained from a gammaproteobacterium of the order Oceanospirillilales. In some embodiments, the FAR enzyme and/or functional fragment can be derived from or obtained from the Oceanospirillilales family Oceanospirillaceae. In certain embodiments, the FAR enzyme and/or functional fragment can be derived from or obtained from a Oceanospirillaceae genus, such as but not limited to Oceanobacter. In a particular embodiment, the FAR enzyme and/or iiinctional fragment can be derived from or obtained from the Oceanobacter species strain RED65 and has an amino acid sequence that is at least 30 % identical, at least 50% identical, at least 60% identical, at least 70% identical, at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 93% identical, at least 95% identical, at least 97% identical and/or at least 98% identical to SEQ ID NO: 6 or a functional fragment thereof. In another specific embodiment, the FAR enzyme for use in the methods disclosed herein comprises or consists of a sequence having 100% identity to the sequence of SED ID NO: 6
("FAR_Ocs"). In other specific embodiments, the isolated FAR enzyme or functional fragment is obtained or derived from Oceanobacter kriegii. In still other specific embodiments, the isolated FAR enzyme or functional fragment is obtained or derived from Oceanobacter strain WH099.
[0091] In various embodiments, the FAR enzyme is from a marine bacterium and is selected from the group consisting of FAR Hch ( Hahella chejuensis KCTC 2396 GenBank YP_436183.1); FARJVIac (from marine actinobacterium strain PHSC20C1), FARJVC (JCVI_ORF_1096697648832, GenBank Accession No. EDD40059.1; from a marine metagenome), FAR_Fer (JCVI_SCAF_1101670217388; from a marine bacterium found at a depth of 12m in an upwelling in the area of Fernandina Island, the Galapagos Islands, Ecuador), FAR Key (JCVI_SCAF_1097205236585, from a marine bacterium found at a depth of 1.7m off the coast of Key West Florida), and FAR_Gal
(JCVI_SCAF_1101670289386, at a depth of 0.1m at Isabella Island, Galapagos Islands, Ecuador). Approximate sequence identity to M. algicola DG893 (FAR Maa) and Oceanobacter sp. RED65 (FAR_Ocs) is given in the table below.
Figure imgf000026_0001
Figure imgf000027_0001
[0092] In one particular embodiment, the FAR enzyme is isolated or derived from the marine bacterium FAR GaI. In other embodiments, the FAR enzyme or functional fragment is isolated or derived from an organism selected from the group consisting of Vitis vinifera (GenBank Accession No. CAO22305.1 or CAO67776.1), Desulfatibacillum alkenivorans (GenBank Accession No. NZ_ABII01000018.1), Stigmatella aurantiaca (NZ_AAMD01000005.1) and Phytophthora ramorum (GenBank AccessionNo.:
AAQXOlOOl 105.1).
[0093] In certain embodiments, a FAR enzyme or functional fragment thereof that is especially suitable for the production of fatty alcohols is identified by the presence of one or more domains, which are found in proteins with FAR activity. In various embodiments, the one or more domains is identified by multiple sequence alignments using hidden Markov models ("HMMs") to search large collections of protein families, for example, the Pfam collection available at http://pfam.sanger.ac.uk/. See R.D. Finn et al. (2008) Nucl. Acids Res. Database Issue 36:D281-D288.
[0094] In certain embodiments, the one or more protein domains by which FAR enzymes are identified belongs to a family of NAD binding domains found in the male sterility proteins of arabidopsis and drosophila, as well as in the fatty acyl reductase enzyme from the jojoba plant (JJFAR). See Aarts MG et al (1997) Plant J. 12:615-623. This family of binding domains is designated "NAD_binding_4" (PF07993; see http://pfam.sanger.ac.uk/family?acc=PF07993). In various embodiments, the
NAD_binding_4 domain is found near the N-terminus of the putative FAR enzyme. In various embodiments, the one or more protein domains by which enzymes with FAR activity are identified belongs to a family of domains known as a "sterile" domain (PF03015; see http://pfam.sanger.ac.uk/family?acc=PF03015), which are also found in the male sterility proteins of Arabidopsis species and a number of other organisms. See Aarts MG et al. (1997) Plant J. 12:615-623. hi particular embodiments, the sterile domain is found near the C-terminus of the putative FAR enzyme. In certain specific embodiments, a FAR enzyme for use in the methods described herein is identified by the presence of at least one NAD_binding_4 domain near the N-terminus and the presence of at least one sterile domain near the C-terminus.
[0095] In certain embodiments, the NAD_binding_4 domain of the putative FAR enzyme has an amino acid sequence that is at least 10%, such as at least 15%, such as at least 20%, such as at least 25%, such as at least 30%, such as at least 35%, such as at least 40%, such as at least 45%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 85%, such as at least 90% or more identical to the amino acid sequence of a known NAD_binding_4 domain. See, e.g., Aarts MG et al. (1997) Plant J. 12:615-623. In various embodiments, the sterile domain of the putative FAR enzyme has an amino acid sequence that is at least 10%, such as at least 15%, such as at least 20%, such as at least 25%, such as at least 30%, such as at least 35%, such as at least 40%, such as at least 45%, such as at least 50% or more identical to the amino acid sequence of a known sterile domain. See id.
[0096] In some embodiments, the NAD_binding_4 domain of the putative FAR enzyme has an amino acid sequence that is at least 10%, such as at least 15%, such as at least 20%, such as at least 25%, such as at least 30%, such as at least 35%, such as at least 40%, such as at least 45%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 85%, such as at least 90% or more identical to the amino acid sequence of one or more example polypeptides that form the definition of the NAD_binding_4 Pfam domain (PF07993). In certain embodiments, the sterile domain of the putative FAR enzyme has an amino acid sequence that is at least 10%, such as at least 15%, such as at least 20%, such as at least 25%, such as at least 30%, such as at least 35%, such as at least 40%, such as at least 45%, such as at least 50% or more identical to the amino acid sequence of one or more example polypeptides that form the definition of the sterile Pfam domain (PF03015). In various embodiments, the NAD_binding_4 domain or the sterile domain of the putative FAR enzyme is identified by an E-value of Ixl0"4or less, such as an E- value of 1x10"5, such as an E- value of 1x10" 10, such as an E-value of IxIO"15, such as an E-value of IxIO"20, such as an E-value of IxIO"25, such as an E-value of IxIO"30 or lower. As used herein, the term E-value
(expectation value) is the number of hits that would be expected to have a score equal or better than a particular hit by chance alone. Accordingly, the E-value is a criterion by which the significance of a database search hit can be evaluated. See, e.g.,
http://pfam.sanger.ac.uk/help;
http://www.csb.yale.edu/userguides/seq/hrnmer/docs/node5.html.
[0097] The FAR enzymes described herein have not previously been recognized as FAR enzymes because of the low homology of the FAR coding sequences to the sequences coding for proteins with known FAR activity, such as the FAR enzymes from S. chinensis ((FAR Sim); GenBank Accession no. AAD38039.1;
gi|5020215|gb|AAD38039.1|AF149917_l acyl CoA reductase [Simmondsia chinensis] - Plant Physiol. 2000 Mar;122(3):635-44. Purification of a jojoba embryo fatty acyl- coenzyme A reductase and expression of its cDNA in high erucic acid rapeseed; Metz JG, Pollard MR, Anderson L, Hayes TR, Lassner MW. PMID: 10712526), B. mori ((FAR Bom); GenBank Accession no. BAC79425.1; gi|33146307|dbj|BAC79425.1| fatty-acyl reductase [Bombyx mori]; Proc Natl Acad Sci USA 2003 Aug 5;100(16):9156-61. Epub 2003 JuI 18. Pheromone gland-specific fatty-acyl reductase of the silkmoth, Bombyx mori. Moto K, Yoshiga T, Yamamoto M, Takahashi S, Okano K, Ando T, Nakata T, Matsumoto S. PMID: 12871998), Ar abidopsis thaliana (GenBank Accession no.
DQ446732.1 or NMJ 15529.1; gi|91806527|gb|DQ446732.1| Λrαtøφp,sw thaliana clone pENTR221-At3g44560; gi|l 8410556|refjNM_ll 5529. l\ Arabidopsis thaliana male sterility protein, putative (AT3G56700); Plant Physiol. 2009 May 15;166(8):787-96. Epub 2008 Dec 4. Functional expression of five Arabidopsis fatty acyl-CoA reductase genes in Escherichia coli. Doan TT, Carlsson AS, Hamberg M, Bϋlow L, Stymne S, Olsson P. PMID: 19062129) or Ostrinia scapulalis (GenBank Accession no.
EU817405.1; gi|210063138|gb|EU817405.1| Ostrinia scapulalis FAR-like protein XIII; Insect Biochem. MoI Biol. 2009 Feb;39(2):90-5. Epub 2008 Oct 26 Pheromone-gland- specific fatty-acyl reductase in the adzuki bean borer, Ostrinia scapulalis (Lepidoptera: Crambidae) Antony B, Fujii T, Moto K, Matsumoto S, Fukuzawa M, Nakano R, Tatsuki S, Ishikawa Y.).
[0098] In certain embodiments, the FAR enzyme for use in the disclosed methods of producing fatty alcohols is endogenous to a marine bacterium and has an amino acid sequence having less than about 35% sequence identity to the amino acid sequence of a known FAR enzyme, such as those described above. In various embodiments, the FAR enzyme for use in the methods disclosed herein is endogenous to a marine bacterium and has an amino acid sequence having less than about 33% sequence identity, such as less than 31% sequence identity, such as less than about 29% sequence identity, such as less than about 27% sequence identity, such as less than about 25% sequence identity, such as less than about 23% sequence identity, even such as less than about 22% sequence identity to the amino acid sequence of a polypeptide previously recognized as possessing FAR enzyme activity.
[0099] In various embodiments, the FAR enzyme for use in the disclosed methods of producing fatty alcohols is endogenous to an organism selected from the group consisting Vitis vinifera, Desulfatibacittum alkenivorans, Stigmatella aurantiaca, and Phytophthora ramorum and has an amino acid sequence having less than about 65% sequence identity to the amino acid sequence of a known FAR enzyme, such as those described above. In various embodiments, the FAR enzyme for use in the methods disclosed herein is endogenous to a marine bacterium and has an amino acid sequence having less than about 60% sequence identity, such as less than 55% sequence identity, such as less than about 50% sequence identity, such as less than about 45% sequence identity, such as less than about 40% sequence identity, such as less than about 35% sequence identity, even such as less than about 34% sequence identity, such as less than about 33% sequence identity, such as less than about 32% sequence identity, such as less than about 31% sequence identity, such as less than about 30% sequence identity to the amino acid sequence of a polypeptide previously recognized as possessing FAR enzyme activity. [0100] In certain embodiments, the FAR enzyme endogenous to Marinobacter algicola DG893 for use in the methods disclosed herein is the full-length polypeptide having the amino acid set forth in SEQ ID NO: 2. In various embodiments, the full- length FAR enzyme has an amino acid sequence that is at least about 75% identical, such as at least about 80% identical, such as at least about 85% identical, such as at least about 90% identical, such as at least about 91%, such as at least about 92%, such as at least about 93%, such as at least about 94%, such as at least about 95%, such as at least about 96%, such as at least about 97%, such as at least about 98%, such as at least about 99% identical to the sequence set forth in SEQ ID NO: 2. In certain preferred embodiments, where the amino acid sequence is less than 100% identical to that shown in SEQ ID NO: 2, all amino acid substitutions are conservative.
[0101] In various embodiments, the FAR enzyme endogenous to M. algicola
DG893 for use in the methods disclosed herein is a functional fragment of the full-length polypeptide, the amino acid sequence of which is set forth in SEQ ID NO: 2. In certain embodiments, the amino acid sequence of the functional fragment is at least about 70%, such as at least about75%, such as at least about 80%, such as at least about 90%, such as at least about 91%, such as at least about 92%, such as at least about 93%, such as at least about 94%, such as at least about 95%, such as at least about 96%, such as at least about 97%, such as at least about 98%, such as at least about 99% identical to the amino acid sequence of the corresponding region of SEQ ID NO: 2.
[0102] In certain embodiments, the FAR enzyme endogenous to Marinobacter aquaeolei for use in the methods disclosed herein is the full-length polypeptide having the amino acid set forth in SEQ ID NO: 14. In various embodiments, the full-length FAR enzyme has an amino acid sequence that is at least about 75% identical, such as at least about 75% identical, such as at least about 80% identical, such as at least about 85% identical, such as at least about 90% identical, such as at least about 91%, such as at least about 92%, such as at least about 93%, such as at least about 94%, such as at least about 95%, such as at least about 96%, such as at least about 97%, such as at least about 98%, such as at least about 99% identical to the sequence set forth in SEQ ID NO: 14. hi certain preferred embodiments, where the amino acid sequence is less than 100% identical to that shown in SEQ ID NO: 14, all amino acid substitutions are conservative.
[0103] In various embodiments, the FAR enzyme endogenous to M. aquaeolei for use in the methods disclosed herein is a functional fragment of the full-length
polypeptide, the amino acid sequence of which is set forth in SEQ ID NO: 14. In certain embodiments, the amino acid sequence of the functional fragment is at least about 70%, such as at least about75%, such as at least about 80%, such as at least about 90%, such as at least about 91%, such as at least about 92%, such as at least about 93%, such as at least about 94%, such as at least about 95%, such as at least about 96%, such as at least about 97%, such as at least about 98%, such as at least about 99% identical to the amino acid sequence of the corresponding region of SEQ ID NO: 14.
[0104] In certain embodiments, the FAR enzyme endogenous to Oceanobacter sp.
RED65 for use in the methods disclosed herein is the full-length polypeptide having the amino acid set forth in SEQ ID NO: 6. In various embodiments, the FAR enzyme has an amino acid sequence that is at least about 75% identical, such as at least 80% identical, such as at least about 85% identical, such as at least about 90% identical, such as at least about 91%, such as at least about 92%, such as at least about 93%, such as at least about 94%, such as at least about 95%, such as at least about 96%, such as at least about 97%, such as at least about 98%, such as at least about 99% identical to the sequence set forth in SEQ ID NO: 6. In certain preferred embodiments, where the sequence identity is less than 100%, all amino acid substitutions are conservative.
[0105] In various embodiments, the FAR enzyme endogenous to Oceanobacter sp. RED65 for use in the methods disclosed herein is a functional fragment of the full- length polypeptide, the amino acid sequence of which is set forth in SEQ ID NO: 6. In certain embodiments, the functional fragment has an amino acid sequence that is at least about 70%, such as at least about 75%, such as at least about 80%, such as at least about 90%, such as at least about 91%, such as at least about 92%, such as at least about 93%, such as at least about 94%, such as at least about 95%, such as at least about 96%, such as at least about 97%, such as at least about 98%, such as at least about 99% identical to the amino acid sequence of the corresponding region of SEQ ID NO: 6.
Nucleic Acids for Expression of FAR Enzymes:
[0106] In another aspect, the present disclosure provides polynucleotides encoding a FAR enzyme, or functional fragment thereof, as described above. The polynucleotide can be a DNA or RNA, and can be single-stranded or double-stranded. The polynucleotide can be isolated from a naturally occurring microorganism, or prepared wholly or partially via synthetic means. In some embodiments, the polynucleotide is a construct designed to provide for expression of the encoded FAR enzyme or functional fragment in a host microorganism. The FAR enzyme or the specific or functional fragment encoded by the polynucleotide construct may be endogenous or heterologous to the host microorganism.
[0107] In various aspects of the disclosure, the availability of a polypeptide sequence of a specific FAR enzyme provides a description of all polynucleotides capable of encoding the polypeptide of known sequence because of the known correspondence of particular codons and the amino acids they encode. In certain embodiments, the degeneracy of the genetic code is used to produce a large number of polynucleotides that encode the gamma proteobacterial FAR polypeptides described herein. Thus, for example, the codons AGA, AGG, CGA, CGC, CGG, and CGU all encode the amino acid arginine (R). Thus, at every position in the nucleic acids of the invention where an arginine is specified by a codon, the codon can be altered to any of the corresponding codons described above without altering the encoded polypeptide. In some embodiments, the polynucleotides that encode the FAR enzymes described herein are codon optimized for expression in a recombinant host cells. In particular embodiments, the
polynucleotides that encode the FAR enzymes described herein are codon optimized for expression in bacteria, yeast or filamentous fungi. In various embodiments, the polynucleotides that encode the FAR enzymes described herein are codon optimized for expression in oleaginous yeast. In certain specific embodiments, the polynucleotides that encode the FAR enzymes are codon optimized for expression in E. coli, S. cerevisiae or Y. lipolytica.
[0108] In certain embodiments, the present disclosure provides an isolated nucleic acid encoding a FAR enzyme from a marine bacterium. In some embodiments, the nucleic acid encodes a FAR enzyme having an amino acid sequence that is at least about 75% identical, at least about 80% identical, such as at least about 85% identical, such as at least about 90% identical, such as at least about 91%, such as at least about 92%, such as at least about 93%, such as at least about 94%, such as at least about 95%, such as at least about 96%, such as at least about 97%, such as at least about 98%, such as at least about 99% identical to the sequence set forth in SEQ ID NO: 2. In some embodiments, the nucleic acid encodes a FAR enzyme having an amino acid sequence that is at least about 75% identical, at least about 80% identical, such as at least about 85% identical, such as at least about 90% identical, such as at least about 91%, such as at least about 92%, such as at least about 93%, such as at least about 94%, such as at least about 95%, such as at least about 96%, such as at least about 97%, such as at least about 98%, such as at least about 99% identical to the sequence set forth in SEQ ID NO: 14. In other embodiments, the nucleic acid encodes a FAR enzyme having an amino acid sequence that is at least about 75% identical, such as at least 80% identical, such as at least about 85% identical, such as at least about 90% identical, such as at least about 91%, such as at least about 92%, such as at least about 93%, such as at least about 94%, such as at least about 95%, such as at least about 96%, such as at least about 97%, such as at least about 98%, such as at least about 99% identical to the sequence set forth in SEQ ID NO: 6.
[0109] In various embodiments, the present disclosure provides DNA constructs, vectors and polynucleotides encoding FAR enzymes for expression in heterologous recombinant host cells. In certain embodiments, the DNA constructs, vectors and polynucleotides comprise a sequence that encodes a FAR enzyme endogenous to a marine bacterium. In some embodiments, the DNA constructs, vectors and polynucleotides comprise a sequence that encodes a FAR enzyme endogenous to a Marinobacter species. In various embodiments, the DNA constructs, vectors and polynucleotides comprise a sequence that encodes a FAR enzyme endogenous to an Oceanobacter species. In some particular embodiments, the DNA constructs, vectors and polynucleotides comprise a sequence that encodes a FAR enzyme endogenous to M. algicola DG893 or M. aquaeolei. In other particular embodiments, the DNA constructs, vectors and polynucleotides comprise a sequence that encodes a FAR enzyme endogenous to Oceanobacter sp.
RED65. In some particular embodiments, the polynucleotide is a codon optimized polynucleotide, such as a polynucleotide having at least 90% (at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% and even 100%) sequence identity to SEQ ID NOs: 1, 3, 5, 7 or 13.
[0110] In certain embodiments, the DNA constructs, vectors and polynucleotides comprise a sequence that encodes the full length FAR polypeptide encompassed by the invention, hi some embodiments, the DNA construct, vector or polynucleotide comprises a sequence that encodes a full length FAR endogenous to a Marinobacter strain. In some embodiments the strain is M. algicola DG893 and in other embodiments the strain is a M. aquaeolei. In other embodiments, the DNA constructs, vectors and polynucleotides comprise a sequence that encodes a functional fragment of the FAR polypeptide of M. algicola DG893 or a M, aquaeolei. In various embodiments, the DNA constructs, vectors and polynucleotides comprise a sequence that encodes the full length FAR polypeptide endogenous to Oceanobacter sp. RED65. In some embodiments, the DNA constructs, vectors and polynucleotides comprise a sequence that encodes a functional fragment of the FAR polypeptide of Oceanobacter sp. RED65.
[0111] In certain embodiments, the DNA constructs, vectors and polynucleotides comprise a sequence that encodes a full-length FAR polypeptide endogenous to M.
algicola DG893 having an amino acid sequence that is at least about 75% identical, such as at least 80% identical, such as at least about 85% identical, such as at least about 90% identical, such as at least about 91%, such as at least about 92%, such as at least about 93%, such as at least about 94%, such as at least about 95%, such as at least about 96%, such as at least about 97%, such as at least about 98%, such as at least about 99% identical to the amino acid sequence set forth in SEQ ID NO: 2. [0112] In some embodiments, the DNA constructs, vectors and polynucleotides comprise a sequence that encodes a functional fragment of the FAR enzyme having an amino acid sequence that is at least about 80% identical, such as at least about 85% identical, such as at least about 90% identical, such as at least about 91%, such as at least about 92%, such as at least about 93%, such as at least about 94%, such as at least about 95%, such as at least about 96%, such as at least about 97%, such as at least about 98%, such as at least about 99% identical to the amino acid sequence of the corresponding region of SEQ ID NO: 2.
[0113] In certain embodiments, the DNA constructs, vectors and polynucleotides comprise a sequence that encodes a full-length FAR polypeptide endogenous to M. aquaeolei having an amino acid sequence that is at least about 75% identical, such as at least 80% identical, such as at least about 85% identical, such as at least about 90% identical, such as at least about 91%, such as at least about 92%, such as at least about 93%, such as at least about 94%, such as at least about 95%, such as at least about 96%, such as at least about 97%, such as at least about 98%, such as at least about 99% identical to the amino acid sequence set forth in SEQ ID NO: 14.
[0114] In some embodiments, the DNA constructs, vectors and polynucleotides comprise a sequence that encodes a functional fragment of the FAR enzyme having an amino acid sequence that is at least about 80% identical, such as at least about 85% identical, such as at least about 90% identical, such as at least about 91%, such as at least about 92%, such as at least about 93%, such as at least about 94%, such as at least about 95%, such as at least about 96%, such as at least about 97%, such as at least about 98%, such as at least about 99% identical to the amino acid sequence of the corresponding region of SEQ ID NO: 14.
[0115] In various embodiments, the DNA constructs, vectors and polynucleotides comprise a sequence that encodes a full-length FAR polypeptide endogenous to
Oceanobacter sp. RED65 having an amino acid sequence that is at least about 80% identical, such as at least about 85% identical, such as at least about 90% identical, such as at least about 91%, such as at least about 92%, such as at least about 93%, such as at least about 94%, such as at least about 95%, such as at least about 96%, such as at least about 97%, such as at least about 98%, such as at least about 99% identical to the amino acid sequence set forth in SEQ ID NO: 6.
[0116] In some embodiments, the DNA constructs, vectors and polynucleotides comprise a sequence that encodes a functional fragment of the FAR enzyme that has an amino acid sequence that is at least about 80% identical, such as at least about 85% identical, such as at least about 90% identical, such as at least about 91%, such as at least about 92%, such as at least about 93%, such as at least about 94%, such as at least about 95%, such as at least about 96%, such as at least about 97%, such as at least about 98%, such as at least about 99% identical to the amino acid sequence of the corresponding region of SEQ ID NO: 6.
[0117] In still other embodiments, the present disclosure provides DNA constructs, vectors and polynucleotides encoding FAR enzymes endogenous to a marine bacterium, wherein the FAR enzyme is selected from the group consisting of FAR Mac (from marine actinobacterium species PHSC20C1), FAR_JVC
(JCVI_ORF_1096697648832, GenBank Accession No. EDD40059.1; from a marine metagenome), FAR Fer (JCVI_SCAF_1101670217388; from a marine bacterium found at a depth of 12m in an upwelling in the area of Fernandina Island, the Galapagos Islands, Ecuador), FAR Key (JCVI_SCAF_1097205236585, from a marine bacterium found at a depth of 1.7m off the coast of Key West Florida), and FAR_Gal
(JCVI_SCAF_1101670289386, at a depth of 0.1m at Isabella Island, Galapagos Islands, Ecuador).
[0118] In still other embodiments, the present disclosure provides DNA constructs, vectors and polynucleotides encoding FAR enzymes endogenous to a marine bacterium selected from the group consisting of M. alkaliphilus, M. aquaeolei, M.
arcticus, M. bryozoorum, M. daepoensis, M. excellens, M. flavimaris, M. guadonensis, M. hydrocarbonoclasticus, M. koreenis, M. lipolyticus, M. litoralis, M. lutaoensis, M.
maritimus, M. sediminum, M. squalenivirans, M. vinifirmus, Meptuniibacter caesariensis species strain MED92, Reimkea sp. strain MED297, Marinomonas sp. strain MED121, unnamed gammaproteobacterium strain HTCC2207, Marinobacter sp. strain ELB 17, Oceanobacter kriegii, and Oceanobacter strain WH099.
[0119] In yet other embodiments, the present disclosure provides DNA constructs, vectors and polynucleotides encoding a FAR enzyme endogenous to an organism selected from the group consisting of Vitis vinifera, Desulfatibacillum alkenivorans, Stigmatella aurantiaca and Phytophthora ramorum.
[0120] In some embodiments, the polynucleotide of the invention encodes a FAR enzyme encompassed by the invention and comprises a nucleic acid comprising at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, and at least 99% sequence identity with SEQ ID NOs: 1, 3, 5, 7, or 13 and hybridizes with SEQ ID NOs: 1, 3, 5, 7, or 13. Nucleic acids "hybridize" when they associate, typically in solution. Nucleic acids hybridize due to a variety of well- characterized physico-chemical forces, such as hydrogen bonding, solvent exclusion, base stacking and the like. As used herein, the term "stringent hybridization wash conditions" in the context of nucleic acid hybridization experiments, such as Southern and Northern hybridizations, are sequence dependent, and are different under different environmental parameters. An extensive guide to the hybridization of nucleic acids is found in Tijssen, 1993, "Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes," Part I, Chapter 2 (Elsevier, New York), which is incorporated herein by reference. For polynucleotides of at least 100 nucleotides in length, low to very high stringency conditions are defined as follows: prehybridization and hybridization at 42°C in 5xSSPE, 0.3% SDS, 200 μg/ml sheared and denatured salmon sperm DNA, and either 25% formamide for low stringencies, 35% formamide for medium and medium- high stringencies, or 50% formamide for high and very high stringencies, following standard Southern blotting procedures. For polynucleotides of at least 100 nucleotides in length, the carrier material is finally washed three times each for 15 minutes using 2xSSC, 0.2% SDS at least at 50°C (low stringency), at least at 55°C (medium stringency), at least at 6O0C (medium-high stringency), at least at 65 °C (high stringency), and at least at 70°C (very high stringency). [0121] The polynucleotides encoding FAR enzymes for expression in
heterologous recombinant host cells as described herein are operably linked to a promoter, and optionally, to other control sequences. Suitable promoters include constitutive promoters, regulated promoters, and inducible promoters. Appropriate promoter sequences can be obtained from genes encoding extracellular or intracellular polypeptides which are either endogenous or heterologous to the host cell. Methods for the isolation, identification and manipulation of promoters of varying strengths are available in or readily adapted from the art. See e.g., Nevoigt et al. (2006) Appl. Environ. Microbiol. 72:5266-5273, the disclosure of which is herein incorporated by reference in its entirety.
[0122] In certain embodiments, the DNA constructs, vectors and polynucleotides are suitable for expression of a heterologous FAR enzyme in bacteria. For bacterial host cells, suitable promoters for directing transcription of the nucleic acid constructs of the present disclosure, include the promoters obtained from the E. coli lac operon,
Streptomyces coelicolor agarase gene (dagA), Bacillus subtilis levansucrase gene (sacB), Bacillus licheniformis alpha-amylase gene (amyL), Bacillus stear other mophϊlus maltogenic amylase gene (amyM), Bacillus amyloliquefaciens alpha-amylase gene (amyQ), Bacillus licheniformis penicillinase gene (penP), Bacillus subtilis xylA and xylB genes, Bacillus megaterium promoters, and prokaryotic beta- lactamase gene (Villa- Kamaroff et al, Proc. Natl Acad. ScI USA 75: 3727-3731(1978)), as well as the tac promoter (DeBoer et al, Proc. Natl Acad. Sd. USA 80: 21-25(1993)). Additional promoters include trp promoter, phage lambda PL, T7 promoter, promoters found at PromEC (http://margalit.huji.ac.il/promec/index.html) and the like. Promoters suitable for use in the present disclosure are described in "Useful proteins from recombinant bacteria" in Scientific American 242:74-94 (1980); and in Sambrook et al (2001)
Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, New York.
[0123] In various embodiments, the DNA constructs, vectors and polynucleotides are suitable for expression of a heterologous FAR enzyme in yeast. In certain embodiments, the DNA constructs, vectors and polynucleotides are suitable for expression of a heterologous FAR enzyme in oleaginous yeast. In various embodiments, the DNA constructs, vectors and polynucleotides are suitable for expression of a heterologous FAR enzyme in the oleaginous yeast Y. lipolytica. In certain embodiments, the DNA constructs, vectors and polynucleotides are suitable for expression of a heterologous FAR enzyme in S. cerevisiae. For yeast host cells, suitable promoters for directing transcription of the nucleic acid constructs of the present disclosure are known to the skilled artisan and include, but are not limited to, an enolase (ENO- 1_ gene) promoter, a galactokinase (GALl) promoter, an alcohol dehyrogenase/glyceraldehyde-3- phosphate dehydrogenase (ADH2/GAP) promoter, a translation elongation factor EF-I alpha (TEFl) promoter as well as those described by Romanos et al. (1992) Yeast 8:423- 488. hi other embodiments, promoters include the TEFl promoter and an RPS7 promoter.
[0124] For filamentous fungal host cells, suitable promoters for directing the transcription of the nucleic acid constructs of the present disclosure include promoters obtained from the genes for Aspergillus oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid stable alpha-amylase, Aspergillus niger or Aspergillus awamori glucoamylase (glaA),
Rhizomucor miehei lipase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Aspergillus nidulans acetamidase, and Fusarium oxysporum trypsin-like protease (WO 96/00787), as well as the NA2-tpi promoter (a hybrid of the promoters from the genes for Aspergillus niger neutral alpha-amylase and Aspergillus oryzae triose phosphate isomerase), and mutant, truncated, and hybrid promoters thereof. Examples of suitable promoters useful for directing the transcription of the nucleotide constructs of the present invention in a filamentous fungal host cell are promoters such as cbhl, cbh2, egll, egl2, pepA, hfbl, hfb2, xynl, amy, and glaA (Nunberg et al., MoI. Cell Biol., 4:2306 -2315 (1984), Boel et al., EMBO J 3:1581-1585 ((1984) and EPA 137280).
[0125] In various embodiments, an expression vector optionally contains a ribosome binding site (RBS) for translation initiation, and a transcription terminator, such as PinIL The vector also optionally includes appropriate sequences for amplifying expression, e.g., an enhancer.
[0126] In various embodiments, the polynucleotides useful for expressing heterologous FAR enzymes in recombinant host cells are operably linked to other control sequences, including but not limited to, a transcription terminator sequence, a signal sequence that when translated directs the expressed polypeptide into the secretory pathway of the recombinant host cell, and a polyadenylation sequence (eukaryotes). The choice of appropriate control sequences for use in the polynucleotide constructs of the present disclosure is within the skill in the art and in various embodiments is dependent on the recombinant host cell used and the desired method of recovering the fatty alcohol compositions produced.
[0127] The instant disclosure further relates to recombinant expression vectors for use in the methods described herein. A recombinant expression vector can be any vector, e.g., a plasmid or a virus, which can be manipulated by recombinant DNA techniques to facilitate expression of a heterologous FAR enzyme in a recombinant host cell. In certain embodiments, the expression vectors is integrated into the chromosome of the
recombinant host cell and comprises one or more heterologous genes operably linked to one or more control sequences useful for production of a FAR enzyme. In other embodiments, the expression vector is an extra chromosomal replicative DNA molecule, e.g., a linear or closed circular plasmid, that is found either in low copy number (e.g., from about 1 to about 10 copies per genome equivalent) or in high copy number (e.g., more than about 10 copies per genome equivalent), hi various embodiments, the expression vector includes a selectable marker, such as a gene that confers antibiotic resistance (e.g., ampicillin, kanamycin, chloramphenicol or tetracycline resistance) to the recombinant host organism that comprises the vector.
[0128] Expression vectors which, in certain embodiments, are useful for expressing FAR enzymes as disclosed herein are commercially available, e.g., from Sigma-Aldrich Chemicals, St. Louis MO and Stratagene, LaJolla CA. In some embodiments, examples of suitable expression vectors are plasmids which are derived from pBR322 (Gibco BRL), pUC (Gibco BRL), pREP4, pCEP4 (Invitrogen) or pPoly (Lathe et al, 1987, Gene 57:193-201).
[0129] In certain embodiments, the present disclosure provides a plasmid for expression of heterologous genes in E. coϊi. Expression vector pCKl 10900, which comprises a Pl 5 A origin of replication (Pl 5 A ori), lac a CAP binding site, a lac promoter, a T7 ribosomal binding site (T7glO RBS) and a chloramphenicol resistance gene (camR). This expression vector is depicted in Figure 3 of U.S. Patent Publication No.
2006/0195947, which is incorporated herein by reference in its entirety.
[0130] In particular embodiments, the present disclosure provides an autonomous replicating plasmid for expression of heterologous genes in Yarrowia, and particularly in Y. lipolytica. This plasmid vector (pCEN411; FIG. 1) was engineered with cassettes for expression of a gene encoding resistance to hygromycin (HygBR) and for expression of a FAR gene optimized for Y. lipolytica. In these embodiments, expression of each gene is independently regulated by a strong, constitutive promoter isolated from Y. lipolytica: pTEFl for FAR expression and pRPS7 for HygBR expression. When this plasmid was transformed into Y. lipolytica, it conferred resistance to hygromycin and directed expression of FAR. This plasmid can be further modified for expression of heterologous genes useful for fatty alcohol production in yeast, inter alia, Y. lipolytica.
[0131] In some embodiments, expression vectors as described herein are adapted for over expression of genes encoding enzymes other than FAR that are directly involved in fatty acid biosynthesis. In particular embodiments, the over expressed gene encodes a protein selected from a fatty acid synthase (FAS), an acyl-ACP thioesterase (TE), a fatty acyl-CoA synthase (FACS) and an acetyl-CoA carboxylase (ACC). In some
embodiments, the expression vector encoding the FAR enzyme and the expression vector encoding a second enzyme {e.g., an FAS, TE, FACS or ACC) are separate nucleic acids. In other embodiments, the heterologous FAR enzyme and the second enzyme are encoded on the same expression vector, and expression of each enzyme is independently regulated by a different promoter. [0132] Methods, reagents and tools for transforming host cells described herein, such as bacteria, yeast (including oleaginous yeast) and filamentous fungi are known in the art. General methods, reagents and tools for transforming, e.g., bacteria can be found, for example, in Sambrook et al (2001) Molecular Cloning; A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, New York. Methods, reagents and tools for transforming yeast are described in "Guide to Yeast Genetics and Molecular Biology," C. Guthrie and G. Fink, Eds., Methods in Enzymology 350 (Academic Press, San Diego, 2002). Methods, reagents and tools for transforming Y. lipolytica are found in "Yarrowia lipolytica," C. Madzak, J.M. Nicaud and C. Gaillardin in "Production of Recombinant Proteins. Novel Microbial and Eucaryotic Expression Systems," G. Gellissen, Ed. 2005. In some embodiments, introduction of the DNA construct or vector of the present invention into a host cell can be effected by calcium phosphate transfection, DEAE- Dextran mediated transfection, electroporation, or other common techniques (See Davis et al., 1986, Basic Methods in Molecular Biology, which is incorporated herein by reference). The present invention also provides a method for producing a recombinant host cell, wherein the method comprises: (a) providing a nucleic acid construct of the present invention, wherein the nucleic acid construct comprises a polynucleotide encoding a FAR polypeptide as described herein; and (b) transforming a host cell with the nucleic acid construct to produce a recombinant cell. In particular embodiments, the host cell will be a bacterial cell and in other particular embodiments the host cell will be a yeast cell.
Recombinant Microorganisms for Production of Fatty Alcohols:
[0133] In yet another aspect, the present disclosure provides recombinant microorganisms engineered to express a heterologous FAR enzyme, or functional fragment thereof, as described herein. In certain particular aspects, the present disclosure provides recombinant microorganisms engineered to express a heterologous FAR enzyme from a marine gammaproteobacterium, or functional fragment thereof, as described herein for the production of fatty alcohols from fatty acyl-ACP substrates. In other embodiments, the present disclosure provides recombinant microorganisms engineered to express a heterologous FAR enzyme from an organism selected from the group consisting of Vitis vinifera, Desulfatibacillum alkenivorans, Stigmatella aurantiaca and
Phytophthora ramorum. In certain embodiments, the FAR enzyme can be expressed in the host cell in which it is found naturally. In various embodiments, the FAR enzyme can be expressed in a heterologous host cell. In particular, when expressed in heterologous host cells described herein, the FAR enzymes are capable of generating high yields of total and secreted fatty alcohols from fatty acyl-ACP substrates.
[0134] In various embodiments, the heterologous host cells useful for expressing the FAR enzymes described herein are selected from bacteria, yeast or filamentous fungi. In certain embodiments, the yeast is an oleaginous yeast.
[0135] In certain embodiments, microorganisms useful as recombinant host cells are wild-type microorganisms.
[0136] In various embodiments, microorganisms useful as recombinant host cells are genetically modified. As used herein, "genetically modified" microorganisms include microorganisms having one or more endogenous genes removed, microorganisms having one or more endogenous genes with reduced expression compared to the parent or wild- type microorganism, or microorganisms having one or more genes over expressed compared to the parent or wild-type microorganism, hi certain embodiments, the one or more genes that are over expressed are endogenous to the microorganism. In some embodiments, the one or more genes that are over expressed are heterologous to the microorganism.
[0137] In certain embodiments, the genetically modified microorganism comprises an inactivated or silenced endogenous gene that codes for a protein involved in the biosynthesis of fatty acyl-CoA substrates. In particular embodiments, the inactive or silenced gene encodes a fatty acyl-ACP thioesterase or a fatty acyl- CoA synthetase (FACS).
[0138] In some embodiments, the host cell is a prokaryotic cell. Suitable prokaryotic cells include gram positive, gram negative and gram- variable bacterial cells. In certain embodiments, host cells include, but are not limited to, species of a genus selected from the group consisting of Agrobacterium, Alicyclobacillus, Anabaena, Anacystis, Acinetobacter, Acidothermus, Arthrobacter, Azobacter, Bacillus,
Bifidobacterium, Brevibacterium, Butyrivibrio, Buchnera, Campestris, Camplyobacter, Clostridium, Corynebacterium, Chromatium, Coprococcus, Cyanobacteria, Escherichia, Enterococcus, Enterobacter, Erwinia, Fusobacterium, Faecalibacterium, Francisella, Flavobacterium, Geobacillus, Haemophilus, Helicobacter, Klebsiella, Lactobacillus, Lactococcus, Ilyobacter, Micrococcus, Microbacterium, Mesorhizobium,
Methylobacterium, Methylobacterium, Mycobacterium, Neisseria, Pantoea,
Pseudomonas, Prochlorococcus, Rhodobacter, Rhodopseudomonas, Rhodopseudomonas, Roseburia, Rhodospirϊϊlum, Rhodococcus, Scenedesmun, Streptomyces, Streptococcus, Synechooccus, Synechocystis, Saccharomonospora, Staphylococcus, Serratia,
Salmonella, Shigella, Thermoanaerobacterium, Tropheryma, Tularensis, Temecula, Thalassiosira, Thermosynechococcus, Thermococcus, Ureaplasma, Xanthomonas, Xylella, Yersinia and Zymomonas. In particular embodiments, the host cell is a species of a genus selected from the group consisting of Agrobacterium, Arthrobacter, Bacillus,
Clostridium, Corynebacterium, Escherichia, Erwinia, Geobacillus, Klebsiella,
Lactobacillus, Mycobacterium, Pantoea, Rhodococcus, Streptomyces and Zymomonas.
[0139] In certain embodiments, the recombinant host cell is an industrial bacterial strain. Numerous bacterial industrial strains are known and suitable for use in the methods disclosed herein, hi some embodiments, the bacterial host cell is a species of the genus Bacillus, e.g., B. thuringiensis, B. anthracis, B. megaterium, B. subtilis, B. lentus, B. circulans, B. pumilus, B. lautus, B.coagulans, B. brevis, B.firmus, B. alkaophius, B. licheniformis, B. clausii, B. stearothermophilus, B. halodurans and B. amyloliquefaciens. In particular embodiments, the host cell is a species of the genus Bacillus and is selected from the group consisting of B. subtilis, B. pumilus, B. licheniformis, B. clausii, B.
stearothermophilus, B. megaterium and B. amyloliquefaciens.
[0140] In some embodiments the bacterial host cell is a species of the genus
Erwinia, e.g., E. uredovora, E. carotovora, E. ananas, E. herbicola, E. punctata or E. terreus. [0141] In other embodiments the bacterial host cell is a species of the genus
Pantoea, e.g., P. citrea or P. agglomerans.
[0142] In still other embodiments, the bacterial host cell is a species of the genus
Streptomyces, e.g., S. ambofaciens, S. achromogenes, S. avermitilis, S. coelicolor, S. aureofaciens, S. aureus, S. fungicidicus, S. griseus or S. lividans.
[0143] In further embodiments, the bacterial host cell is a species of the genus
Zymomonas, e.g., Z mobilis or Z. lipolytica.
[0144] In further embodiments, the bacterial host cell is a species of the genus
Rhodococcus, e.g. R. opacus.
[0145] In particular embodiments, the bacterial host cell is a species of the genus
Escherichia, e.g., E. coli. In certain embodiments, the E. coli is a wild-type bacterium. In various embodiments, the wild-type E. coli bacterial strain useful in the processes described herein is selected from, but not limited to, strain W3110, strain MGl 655 and strain BW25113. In other embodiments, the E. co /us genetically modified. Examples of genetically modified E. coli useful as recombinant host cells include, but are not limited to, genetically modified E. coli found in the Keio Collection, available from the National BioResource Project at NBRP E. coli, Microbial Genetics Laboratory, National Institute of Genetics 1111 Yata, Mishima, Shizuoka, 411-8540 Japan (www at
shigen.nig.ac.jp/ecoli/strain/top/top.jsp).
[0146] In particular embodiments, the genetically modified E.coli comprises an inactivated or silenced endogenous fadD gene, which codes for an acyl-CoA synthetase protein. In other embodiments the genetically modified E.coli comprises an inactivated of silenced endogenous fadK gene, which codes for an endogenous short-chain acyl-CoA synthetase. In still other embodiments, the genetically modified E. coli comprises an inactivated or silenced endogenous fadD gene and an inactivated or silenced endogenous fadK gene. In other embodiments, the genetically modified E.coli comprises an endogenous fadD gene that has reduced expression compared to the parent or wild-type strain. In various embodiments, the genetically modified E.coli comprises an endogenous fadK. gene that has reduced expression compared to the parent or wild-type strain.
[0147] In certain embodiments, the recombinant host cell is a yeast. In various embodiments, the yeast host cell is a species of a genus selected from the group consisting of Candida, Hansenula, Saccharomyces, Schizosaccharomyces, Pichia, Kluyveromyces, and Yarrowia. hi particular embodiments, the yeast host cell is a species of a genus selected from the group consisting of Saccharomyces, Candida, Pichia and Yarrowia.
[0148] In various embodiments, the yeast host cell is selected from the group consisting of Hansenula polymorpha, Saccharomyces cerevisiae, Saccaromyces carlsbergensis, Saccharomyces diastaticus, Saccharomyces norbensis, Saccharomyces kluyveri, Schizosaccharomyces pombe, Pichia pastoris, Pichia finlandica, Pichia trehalophila, Pichia ferniemtans, Pichia kodamae, Pichia membranaefaciens, Pichia opuntiae, Pichia thermotolerans, Pichia salictaria, Pichia quercuum, Pichia pijperi, Pichia stipitis, Pichia methanoϊica, Pichia angusta, Kluyveromyces lactis, Candida albicans, Candida krusei, Candida ethanolic and Yarrowia lipolytica and synonyms or taxonomic equivalents thereof.
[0149] In certain embodiments, the yeast host cell is a wild-type cell. In various embodiments, the wild-type yeast cell strain is selected from, but not limited to, strain BY4741, strain FLlOOa, strain INVSCl, strain NRRL Y-390, strain NRRL Y-1438, strain NRRL YB-1952, strain NRRL Y-5997, strain NRRL Y-7567, strain NRRL Y-1532, strain NRRL YB-4149 and strain NRRL Y-567. In other embodiments, the yeast host cell is genetically modified. Examples of genetically modified yeast useful as recombinant host cells include, but are not limited to, genetically modified yeast found in the Open Biosystems collection found at
http://www.openbiosystems.com/GeneExpression/Yeast/YKO/. See Winzeler et al. (1999) Science 285:901-906.
[0150] In other embodiments, the recombinant host cell is an oleaginous yeast.
Oleaginous yeasts are organisms that accumulate lipids such as tri-acyl glycerols. Examples of oleaginous yeast include, but are not limited to, organisms selected from the group consisting of Yarrowia lipolytica, Yarrowia paralipolytica, Candida revkaufi, Candida pulcherrima, Candida tropicalis, Candida utilis, Candida curvata D, Candida curvata R, Candida diddensiae, Candida boldinii, Rhodotorula glutinous, Rhodotorula graminis, Rhodotorula mucilaginosa, Rhodotorula minuta, Rhodotorula bacarum, Rhodosporidium toruloides, Cryptococcus (terricolus) albidus var. albidus, Cryptococcus laurentii, Trichosporon pullans, Trichosporon cutaneum, Trichosporon cutancum, Trichosporon pullulans, Lipomyces starkeyii, Lipomyces lipoferus, Lipomyces tetrasporus, Endomycopsis vernalis, Hansenula ciferri, Hansenula saturnus, and
Trigonopsis variables. In particular embodiments, the oleaginous yeast is Y. lipolytica. In certain embodiments, Yarrowia lipolytica strains include, but are not limited to, DSMZ 1345, DSMZ 3286, DSMZ 8218, DSMZ 70561, DSMZ 70562, DSMZ 21175, and also strains available from the Agricultural Research Service (NRRL) such as but not limited to NRRL YB-421, NRRL YB-423, NRRL YB-423-12 and NRRL YB-423-3.
[0151] In certain embodiments, the oleaginous yeast is a wild-type organism. In other embodiments, the oleaginous yeast is genetically modified.
[0152] In yet other embodiments, the recombinant host cell is a filamentous fungus. In certain embodiments, the filamentous fungal host cell is a species of a genus selected from the group consisting of Achlya, Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Cephalosporium, Chrysosporium, Cochliobolus,
Corynascus, Cryphonectria, Cryptococcus, Coprinus, Coriolus, Diplodia, Endothis, Fusarium, Gibberella, Gliocladium, Humicola, Hypocrea, Myceliophthora, Mucor, Neurospora, Penicillium, Podospora, Phlebia, Piromyces, Pyricularia, Rhizomucor, Rhizopus, Schizophyllum, Scytalidium, Sporotrichum, Talaromyces, Thermoascus, Thielavia, Trametes, Tolypocladium, Trichoderma, Verticillium, Volvariella, and teleomorphs, synonyms or taxonomic equivalents thereof.
[0153] In some embodiments, the filamentous fungal host cell is an Aspergillus species, a Chrysosporium species, a Corynascus species, a Fusarium species, a Humicola species, a Myceliophthora species, a Neurospora species, a Penicillum species, a Tolypocladium species, a Tramates species, or Trichoderma species. In other embodiments, the Trichoderma species is selected from T. longibrachiatum, T. viride, Hypocrea jecorina and T. reesei; the Aspergillus species is selected from A. awamori, A. fumigatus, A. japonicus, A. nidulans, A. niger, A. aculeatus, A. foetidus, A. oryzae, A. sojae, and A. kawachi; the Chrysosporium species is C. lucknowense; the Fusarium species is selected from F.graminum, F. oxysporum and F. venenatum; the
Myceliophthora species is M. thermophilics; the Neurospora species is N. crassa; the Humicola species is selected from H. insolens, H. grisea, and H. lanuginosa; the Penicillum species is selected from P. purpurogenum, P. chrysogenum, and P.
verruculosum; the Thielavia species is T. terrestris; and the Trametes species is selected from T. villosa and T. versicolor.
[0154] In some embodiments, the filamentous fungal host is a wild-type organism. In other embodiments, the filamentous fungal host is genetically modified.
[0155] In certain particular embodiments, recombinant host cells for use in the methods described herein are derived from strains of Escherichia coli, Bacillus,
Saccharomyces, Streptomyces and Yarrowia.
[0156] In various embodiments, recombinant host cells which are useful in the practice of the present disclosure include prokaryotic and eukaryotic cells which are readily accessible from a number of culture collections, e.g., the American Type Culture Collection (ATCC), Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ) (German Collection of Microorganisms and Cell Culture), Centraalbureau Voor Schimmelcultures (CBS), and Agricultural Research Service Patent Culture Collection, Northern Regional Research Center (NRRL).
[0157] In various embodiments, the recombinant microorganism over expresses a gene that encodes a FAR enzyme. In some embodiments, the FAR enzyme is endogenous to the microorganism. In other embodiments, the FAR enzyme is heterologous to the microorganism. [0158] In certain embodiments, the recombinant microorganism over expresses a gene that encodes one or more proteins other than a FAR enzyme. In various
embodiments, the one or more over expressed protein increases the rate at which the recombinant cell produces the acyl-thioester FAR substrate, e.g., the compound of formula (I) shown above. In some embodiments, the one or more over expressed genes encodes a protein directly involved in fatty acid biosynthesis. In particular embodiments, the one or more over expressed genes encode a protein selected from a fatty acid synthase (FAS), an acyl-ACP thioesterase (TE), a fatty acyl-CoA synthase (FACS) and an acetyl- CoA carboxylase (ACC). In some embodiments, the over expressed gene is endogenous to the microorganism. In other embodiments, the over expressed gene is heterologous to the microorganism.
[0159] "Fatty acid synthase (FAS)" refers to an enzyme or enzyme complex that catalyzes the conversion of acetyl-CoA and malonyl-CoA units to fatty acyl-ACP as set forth in Scheme II, and reference is also made to Fig. 13:
Figure imgf000050_0001
Scheme II wherein R has the same meaning as set forth above in the definitions. In certain embodiments, the FAS is composed of more than one distinct enzymatic activity. In various embodiments, the distinct enzymatic activities reside in separate polypeptides. In some embodiments, the separate polypeptides form one or more protein complexes.
[0160] The term "acyl-ACP thioesterase (TE)" refers to an enzyme that catalyzes the cleavage of acyl-ACP to form a fatty acid, as shown in Scheme III and reference is also made to Fig.13, wherein R has the same meaning as set forth above:
O TE O
R/\s. A^CP
?^\ς- r *- R^OH + ACP-SH
Scheme III
[0161] "FACS" refers to an enzyme that catalyzes the formation of the covalent complex between the acyl portion of the fatty acid and Coenzyme A as shown below in Scheme IV, wherein R has the same meaning as set forth above:
Figure imgf000051_0001
ATP ADP + Pi
Scheme IV
[0162] The term "acetyl-CoA carboxylase (ACC)" refers to an enzyme that catalyzes the conversion of acetyl-CoA to malonyl-CoA as shown below in Scheme V:
Figure imgf000051_0002
Scheme V
Synthesis of Fatty Alcohols by an Acyl-CoA Independent Pathway:
[0163] FIG. 13 illustrates the biosynthetic pathways for fatty alcohol formation.
FAR enzymes can act directly on fatty acyl-CoA substrates to form fatty alcohols.
However, as described in more detail herein, the present inventors have discovered that the amount of fatty alcohols produced in certain microorganisms comprising a gene encoding a FAR encompassed by the invention and lacking a functional endogenous fatty acyl-CoA synthetase (FACS) is comparable to the amount of fatty alcohol produced by the microorganism that has a functional endogenous FACS gene. Referring to FIG. 13, a recombinant microorganism that lacks a functional FACS gene does not catalyze the formation of fatty acyl-CoA substrates from fatty acids. Accordingly, the present inventors have posited that FAR enzymes (such as marine gammaproteobacterium FAR enzymes) as described herein catalyze the biosynthesis of fatty alcohols from fatty acyl- ACP substrates via an acyl-CoA independent pathway in lieu of, or in addition to, using fatty acyl-CoA substrates.
[0164] In certain embodiments, the present disclosure relates to the use of a FAR enzyme as described herein, e.g., a FAR enzyme from a marine bacterium, for producing a fatty alcohol composition. The discovery that FAR enzymes described herein utilized fatty acyl-ACP substrates instead of or in addition to, fatty acyl-CoA substrates provided for more efficient methods for producing fatty alcohol. In hosts, such as E. coli which convert fatty acyl-ACP to fatty acyl-CoA via free fatty acids, the formation of fatty acyl- CoA complexes requires ATP. Thus, in the acyl-CoA independent pathway because production of fatty alcohols by FAR enzymes (e.g., marine bacterial FAR enzymes) from fatty acyl-ACP as described herein bypasses this step, less energy is used to form the fatty alcohol compositions. The present inventors' discovery of the mechanism of action of FARs as encompassed by the invention further allows for the production of fatty alcohols in recombinant cells that do not produce fatty acyl-CoA substrates or that produce low levels of the acyl-CoA substrates compared to wild-type or parent microorganisms.
Accordingly fatty alcohols can be produced by a recombinant microorganism that lacks a functional endogenous enzyme involved in the biosynthesis of fatty acyl-CoA substrates. Thus in some aspects, fatty alcohols can be produced by a recombinant microorganism that express a gene encoding a FAR enzyme described herein and that lacks a gene encoding a fatty acyl-CoA synthetase (FACS) and/or a gene encoding a fatty acyl-ACP thioesterase (TE).
[0165] Thus, in some embodiments, the present disclosure provides for a mechanism of action for the production of fatty alcohols by an acyl-CoA independent pathway, wherein certain FAR enzymes encompassed by the invention may act on fatty acyl-ACP substrates in lieu of, or in addition to, acting on fatty acyl-CoA substrates, to produce fatty alcohols. In some embodiments of this aspect, the FAR enzymes from as encompassed by the invention herein including but not limited to FAR enzymes from Marinobacter species, such as Marinobacter species algicola (DG893) and Marinobacter aquaeolei, and Oceanobacter species strain RED65 or functional fragments thereof can produce levels of fatty alcohols in the absence of, or in the presence of low levels of fatty acyl-CoA substrates, which were thought to be the main substrates of FAR enzymes that are comparable to the levels of fatty alcohols produced in the presence of normal levels of fatty acyl-CoA substrates. In further embodiments of this aspect, the invention relates to a recombinant host cell comprising a nucleic acid encoding a FAR enzyme according to the invention and an inactivated or silenced endogenous fatty acyl-ACP thioesterase gene, an inactivated or silenced endogenous fatty acyl-CoA synthetase gene or both, hi some embodiments, the recombinant microorganisms provided herein above do not produce detectable levels of fatty acyl-CoA substrates and in other embodiments the recombinant microorganisms produce reduced levels of fatty acyl-CoA substrates as compared to wild- type cells.
[0166] In one preferred embodiment, fatty alcohols are produced by an acyl-CoA independent pathway comprising culturing a recombinant bacterial cells under suitable culture conditions, wherein the recombinant bacterial cell comprises a gene encoding a heterologous FAR polypeptide encompassed by the invention and wherein the
recombinant bacterial cell comprises one or more endogenous polynucleotides that have been inactivated or silenced selected from afadD gene, which codes for an acyl-CoA synthetase protein, afadK gene, which codes for an endogenous short-chain acyl-CoA synthetase or both; allowing expression of the gene encoding the heterologous FAR enzyme and producing fatty alcohols by the conversion of fatty acyl-ACP substrates.
[0167] In certain embodiments, the recombinant host cell is an E.coli cell. In some embodiments of this aspect, the FAR enzymes are derived from Marinobacter algicola (DG893), Marinobacter aquaeolei, and Oceanobacter species strain RED65 or functional fragments thereof. In certain embodiments, the FAR enzyme for use in the methods disclosed herein has an amino acid that has an amino acid sequence that is at least about 75% identical, at least about 80% identical, such as at least about 85% identical, such as at least about 90% identical, such as at least about 91%, such as at least about 92%, such as at least about 93%, such as at least about 94%, such as at least about 95%, such as at least about 96%, such as at least about 97%, such as at least about 98%, such as at least about 99% identical to the sequence set forth in SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 14, or functional fragments thereof.
Methods of Producing Fatty Alcohols and Compositions of Fatty Alcohols:
[0168] In various aspects of the present disclosure, fatty alcohols can be produced in cell-free systems. In certain embodiments, a FAR enzyme as described herein is provided with a substrate and all necessary cofactors to carry out the production of a fatty alcohol from a fatty acyl-thioesterase substrate. In certain aspects, fatty alcohols can be produced by recombinant microorganisms that express a heterologous FAR enzyme as described herein. In particular aspects, fatty alcohols can be produced by recombinant microorganisms that express a heterologous FAR enzyme and one or more proteins other than a FAR enzyme. In some embodiments, the fatty alcohols produced by the recombinant microorganisms are secreted into the nutrient medium. In other
embodiments, the fatty alcohols produced by the recombinant microorganisms are extracted from the microorganisms.
[0169] In certain embodiments, the present disclosure relates to the use of a FAR enzyme as described herein, e.g., a FAR enzyme from a marine gamma proteobacterium, for producing a fatty alcohol composition in a cell-free system. In some embodiments, the FAR enzyme is provided with a substrate, e.g., a fatty acyl-thioester of the formula (I) and NAD(P)H under suitable conditions of temperature, pH, and ionic strength and time sufficient for the production of a fatty alcohol composition. In some embodiments, the FAR enzyme is provided with a composition of a fatty acid, Coenzyme A, ATP,
NAD(P)H, and a fatty acyl-CoA synthase under suitable conditions of temperature, pH and ionic strength and time sufficient for production of the fatty acyl-CoA substrate of the FAR enzyme by the fatty acyl-CoA synthase and for production of a fatty alcohol composition from the fatty acyl-CoA substrate.
[0170] In certain embodiments of the present disclosure, a fatty alcohol composition is produced by a recombinant host cell comprising a heterologous gene encoding a FAR enzyme as described above, which is cultured in an aqueous nutrient medium comprising an assimilable source of carbon under conditions suitable for production of a fatty alcohol composition. In some embodiments, the fatty alcohol is produced by a recombinant host cell comprising a heterologous gene encoding a FAR enzyme as described above and the recombinant host cell comprises an inactivated or silenced gene selected from an acyl-ACP thioesterase and a fatty acyl-CoA synthetase.
[0171] In various embodiments, the recombinant host cell is a bacterium. In particular embodiments, the bacterium is E. coll In other embodiments, the recombinant host cell is a yeast. In particular embodiments, the yeast is S. cerevisiae. In certain embodiments, the yeast is an oleaginous yeast. In certain particular embodiments, the oleaginous yeast is Y. Hpolytica,
[0172] In various embodiments, a fatty alcohol composition is produced by a recombinant host cell comprising a heterologous gene encoding a FAR enzyme from a marine bacterium and which over expresses a gene encoding one or more proteins that increases the rate at which the recombinant host cell produces the acyl-thioester FAR substrate, e.g., the compound of formula (I) above. In some embodiments, the one or more over expressed genes encode a protein directly involved in fatty acid biosynthesis. In particular embodiments, the one or more over expressed genes encode a protein selected from a fatty acid synthase (FAS), an acyl-ACP thioesterase (TE), a fatty acyl- CoA synthase (FACS) and an acetyl-CoA carboxylase (ACC).
[0173] "Culturing" or "cultivation" refers to growing a population of microbial cells under suitable conditions in a liquid or solid medium. In particular embodiments, culturing refers to the fermentative bioconversion of a substrate to an end-product.
Culturing media are well known and individual components of such culture media are available from commercial sources, e.g., under the Difco™ and BBL™ trademarks. In one non-limiting example, the aqueous nutrient medium is a "rich medium" comprising complex sources of nitrogen, salts, and carbon, such as YP medium, comprising 10 g/L of peptone and 10 g/L yeast extract of such a medium.
[0174] In other non-limiting embodiments, the aqueous nutrient medium comprises a mixture of Yeast Nitrogen Base (Difco) supplemented with an appropriate mixture of amino acids, e.g. SC medium. In particular aspects of this embodiment, the amino acid mixture lacks one or more amino acids, thereby imposing selective pressure for maintenance of an expression vector within the recombinant host cell.
[0175] Fermentation of the recombinant host cell comprising a heterologous FAR gene for production of fatty alcohols is carried out under suitable conditions and for a time sufficient for production of fatty alcohols. Conditions for the culture and production of cells, including bacterial and yeast cells, are readily available. Cell culture media in general are set forth in Atlas and Parks (eds.) The Handbook of Microbiological Media (1993) CRC Press, Boca Raton, FL, which is incorporated herein by reference.
Additional information for cell culture is found in available commercial literature such as the Life Science Research Cell Culture Catalogue (1998) from Sigma- Aldrich, Inc (St Louis, MO) ("Sigma-LSRCCC") and, for example, The Plant Culture Catalogue and supplement (1997) also from Sigma-Aldrich, Inc (St Louis, MO) ("Sigma-PCCS"), all of which are incorporated herein by reference.
[0176] In some embodiments, cells expressing the heterologous FAR genes as described herein are grown under batch or continuous fermentations conditions. Classical batch fermentation is a closed system, wherein the compositions of the medium is set at the beginning of the fermentation and is not subject to artificial alternations during the fermentation. A variation of the batch system is a fed-batch fermentation which also finds use in the present invention. In this variation, the substrate is added in increments as the fermentation progresses. Fed-batch systems are useful when catabolite repression is likely to inhibit the metabolism of the cells and where it is desirable to have limited amounts of substrate in the medium. Batch and fed-batch fermentations are common and well known in the art. Continuous fermentation is an open system where a defined fermentation medium is added continuously to a bioreactor and an equal amount of conditioned medium is removed simultaneously for processing. Continuous fermentation generally maintains the cultures at a constant high density where cells are primarily in log phase growth. Continuous fermentation systems strive to maintain steady state growth conditions. Methods for modulating nutrients and growth factors for continuous fermentation processes as well as techniques for maximizing the rate of product formation are well known in the art of industrial microbiology.
[0177] In some embodiments, fermentations are carried out a temperature within the range of from about 10°C to about 600C, from about 150C to about 500C, from about 200C to about 45°C, and from about 25°C to about 400C. In a particular aspect, the fermentation is carried out at a temperature of from about 28°C and also from about 300C. In other embodiments, the fermentation is carried out for a period of time within the range of from about 8 hours to 240 hours, from about 8 hours to about 168 hours, from about 16 hours to about 144 hours, from about 16 hours to about 120 hours, or from about 24 hours to about 72 hours. It will be understood that, in certain embodiments where thermostable host cells are used, fermentations may be carried out at higher temperatures. In other embodiments, the fermentation will be carried out at a pH in the range of 4 to 8, in the range of 4.5 to 7.5, in the range of 5 to 7, and also in the range of 5.5 to 6.5.
[0178] Carbon sources useful in the aqueous fermentation medium or broth of the disclosed process in which the recombinant microorganisms are grown are those assimilable by the recombinant host strain. Assimilable carbon sources are available in many forms and include renewable carbon sources and the cellulosic and starch feedstock substrates obtained there from. Such examples include for example monosaccharides, disaccharides, oligosaccharides, saturated and unsaturated fatty acids, succinate, acetate and mixtures thereof. Further carbon sources include, without limitation, glucose, galactose, sucrose, xylose, fructose, glycerol, arabinose, mannose, raffinose, lactose, maltose, and mixtures thereof. In some embodiments, the term "fermentable sugars" is used interchangeably with the term "assimilable carbon source". In one aspect, fermentation is carried out with a mixture of glucose and galactose as the assimilable carbon source. In another aspect, fermentation is carried out with glucose alone to accumulate biomass, after which the glucose is substantially removed and replaced with an inducer, e.g., galactose for induction of expression of one or more heterologous genes involved in fatty alcohol production. In still another aspect, fermentation is carried out with an assimilable carbon source that does not mediate glucose repression, e.g., raffinose, to accumulate biomass, after which the inducer, e.g., galactose, is added to induce expression of one or more heterologous genes involved in fatty alcohol production. In some preferred embodiments, the assimilable carbon source is from cellulosic and starch feedstock derived from but not limited to, wood, wood pulp, paper pulp, grain, corn stover, corn fiber, rice, paper and pulp processing waste, woody or herbaceous plants, fruit or vegetable pulp, distillers grain, grasses, rice hulls, wheat straw, cotton, hemp, flax, sisal, corn cobs, sugar cane bagasse, switch grass and mixtures thereof.
[0179] In various embodiments, the present disclosure relates to methods of producing a fatty alcohol composition comprising culturing a recombinant host cell comprising a gene expressing a heterologous FAR enzyme in an aqueous nutrient medium comprising an assimilable source of carbon under conditions in which a fatty alcohol composition of produced, and isolating the fatty alcohols.
[0180] In certain embodiments of the disclosed processes, at least 10%, such as at least 20%, such as at least 25%, such as at least 30%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90% of the fatty alcohols produced by the methods described herein are secreted into the culture medium. In particular embodiments, when the recombinant microorganism is E.coli, Yarrowia {e.g., Y. lipolyticά) or Saccharomyces {e.g., S. cerevisiae) at least 25% and also at least 50% of the fatty alcohols produced by the methods encompassed by the invention will be secreted into the culture medium.
[0181] In various embodiments, fatty alcohols produced by the methods of the invention are further recovered or isolated. Recovery or isolating the produced fatty alcohols refers to substantially separating the fatty alcohols from other components of the culture medium or fermentation process. Recovery or isolation may be by solvent extraction of the aqueous nutrient medium with a suitable water immiscible solvent. Extraction may occur simultaneously with fatty alcohol production and extraction may be continuous. Phase separation followed by solvent removal provides the fatty alcohol which may then be further purified and fractionated using methods and equipment known in the art. In other aspects of the disclosure, the secreted fatty alcohols coalesce to form a water immiscible phase that can be directly separated from the aqueous nutrient medium either during the fermentation or after its completion.
[0182] In some embodiments, less than 60%, less than about 50%, such as less than about 40%, such as less than about 30%, such as less than about 20%, such as less than about 10% of the fatty alcohols produced by the methods described herein are secreted from the recombinant host cells. In some embodiments, at least about 30%, such as at least about 40%, such as at least about 45%, such as at least about 50%, such as at least about 60%, such as at least about 65%, such as at least about than 70%, such as at least about 75%, such as a least about 80%, such as at least about 85%, such as at least about 90% of the fatty alcohols produced by the methods described herein are secreted from the recombinant host cells. In certain embodiments, fatty alcohols are isolated by separating the cells from the aqueous nutrient medium, for example by centrifugation, resuspension and extraction of the fatty alcohols from the recombinant host cells using an organic solvent or solvent mixture. Suitable protocols for recovering fatty alcohols from recombinant host cells and/or culture medium are known to the skilled artisan. In some embodiments, fatty alcohols may be recovered by first lysing the cells to release the fatty alcohols and then extracting the fatty alcohol from the lysate using conventional means. Reference is also made to Yeast Protocols Handbook, (2009) Clontech Laboratories, Inc. A Takara Bio Company, Mt. View CA 94043 and PNAS 2003 Vol. 100, 16:9156- 9161.
[0183] In some embodiments, the present disclosure relates to fatty alcohol compositions produced by recombinant host cells comprising a gene encoding any one of the FAR enzymes as encompassed by the invention and described hereinabove. In some particular embodiments, the FAR enzyme is derived from a Marinobacter or
Oceanobacter species of gammaproteobacterium. In some embodiments, the FAR enzyme is derived from a Marinobacter species selected from, but not limited to, M. algicola DG893, M. alkaliphilus, M. aquaeoli, M. arcticus, M. bryozoorum, M.
daepoensis, M. excellens, M. flavimaris, M. guadonensis, M. hydrocarbonoclasticus, M. koreenis, M. lipolyticus, M. litoralis, M, lutaoensis, M. maritimus, M. sediminum, M. squalenivirans and M. vinifirmus. In various embodiments, the FAR enzyme is obtained from a marine bacterium selected from the group consisting of Meptuniibacter caesariensis species strain MED92, Reinekea sp. strain MED297, Marinomonas sp. strain MED 121, unnamed gammaproteobacterium strain HTCC2207 and Marinobacter sp. strain ELB 17. In some specific embodiments, the FAR enzyme is derived from or endogenous to an Oceanobacter species selected from, but not limited to, Oceanobacter kriegii and Oceanobacter strain WH099.
[0184] In various embodiments, the compositions produced by the methods described herein comprise both saturated and unsaturated fatty alcohols. In certain embodiments, the unsaturated fatty alcohols are monounsaturated fatty alcohols, hi some embodiments, the fatty alcohol compositions comprise both saturated and unsaturated fatty alcohols, and the amount of unsaturated fatty alcohols is less than about 30%, such as less than about 20%, such as less than about 10%, such as less than about 5%, such as less than about 1% of the fatty alcohols present in the composition. In other
embodiments, the fatty alcohol compositions comprise both saturated and unsaturated fatty alcohols, and the amount of saturated fatty alcohols is less than about 30%, such as less than about 20%, such as less than about 10%, such as less than about 5%, such as less than about 1% of the fatty alcohols present in the composition.
[0185] In some typical embodiments, the fatty alcohol compositions produced by the methods described herein comprise one or more alcohols selected from the group consisting of 1-octanol (C8:0), 1-decanol (C10:0), 1-dodecanol (C12:0), 1-tetradecanol (C14:0), 1-hexadecanol (C16:0), 1-octadecanol (C18:0), 1-icosanol (C20:0), 1-docosanol, 1-tetracosanol, cis Δ9- 1-hexadecanol, and cis Δπ-l-octadecanol. [0186] In typical embodiments, C8 to C20 fatty alcohols comprise at least about
80%, such as at least about 85%, such as at least about 90%, such as at least about 92%, such as at least about 95%, such as at least about 97%, such as at least about 99% by weight of the total isolated fatty alcohols. In certain embodiments, ClO to Cl 8 fatty alcohols comprise about 80%, such as at least about 85%, such as at least about 90%, such as at least about 92%, such as at least about 95%, such as at least about 97%, such as at least about 99% by weight of the total isolated fatty alcohols. In certain embodiments, C 14 to Cl 8 fatty alcohols comprise about 80%, such as at least about 85%, such as at least about 90%, such as at least about 92%, such as at least about 95%, such as at least about 97%, such as at least about 99% by weight of the total isolated fatty alcohols. It is understood that a reference to a "Cx fatty alcohol" includes both saturated and unsaturated fatty alcohols having "x" carbon atoms.
[0187] In various embodiments, C16 to Cl 8 fatty alcohols comprise at least about
80%, such as at least about 85%, such as at least about 90%, such as at least about 91%, such as at least about 92%, such as at least about 93%, such as at least about 94%, such as at least about 95%, such as at least about 96%, such as at least about 97%, such as at least about 98%, such as at least about 99% by weight of the total isolated fatty alcohols. In certain embodiments, the Cl 6 to Cl 8 fatty alcohols are saturated. In other embodiments the Cl 6 to Cl 8 fatty alcohols are a mixture of saturated and unsaturated fatty alcohols.
[0188] In certain embodiments, the amount of fatty alcohols produced by the methods described herein comprise saturated and/or unsaturated C8 to C24 alcohols produced by a recombinant host cell comprising a heterologous gene encoding a FAR as described herein in a range of about 10 mg/L to about 50 g/L of aqueous nutrient medium, such as in a range of about 10 mg/L to about 5 g/L, such as in a range of about 10 mg/L to about 2g/L of medium by routine modification of culturing conditions. In particular embodiments, the amount of fatty alcohols produced by the methods described herein is at least about 0.5 g/L, such as at least about 1 g/L, such as at least about 1.5 g/L, such as at least about 2.0 g/L, such as at least about 2.5 g/L, such as at least about 3 g/L, such as at least about 3.5 g/L, such as at least about 4 g/L, such as at least about 4.5 g/L, such as at least about 5 g/L, such as at least about 10 g/L of medium. In various embodiments, the amount of fatty alcohols produced by the methods described herein is at least about 20 g/L, such as at least about 30 g/L, such as at least about 40 g/L, such as at least about 50 g/L of medium. In particular embodiments, the recombinant
microorganism comprising a gene encoding FAR enzyme as encompassed by the invention is E.coli, Yarrowia lipolytica or Saccharomyces cerevisiae and the amount of fatty alcohol produced is at least 1.0 g/L, at least 5.0 g/L, at least 10 g/L, at least 15 g/L, at least 20 g/L, at least 25 g/L and at least 30 g/L of medium.
[0189] In some embodiments, the amount of fatty alcohols produced by the methods described herein is in the range of about 100 mg/g to about 5 g/g of dry cell weight. In other embodiments, the amount of fatty alcohols produced by the methods described herein is in the range of about 1 g/g to about 4 g/g of dry cell weight, such as in the range of about 2 g/g to about 3 g/g of dry cell weight by routine modification of culturing conditions.
[0190] In certain embodiments, the amount of fatty alcohols produced by the methods described herein is in the range of about 10% to about 20% of dry cell weight, such as in the range of about 20% to about 30% of dry cell weight, such as in the range of about 30% to about 40% of dry cell weight, such as in the range of about 40% to about 50% of dry cell weight, such as in the in range of about 50% to about 60% of dry cell weight, such as in the range of about 60% to about 70% of dry cell weight, such as in the range of about 70% to about 80% of dry cell weight by routine modification of culturing conditions. Fatty alcohol compositions produced by the methods described herein may also include fatty acid derived components, such as but not limited to esters (e.g. acetate and waxes) and fatty acids.
Methods of Producing Alkane and/or Alkene Compositions:
[0191] In various embodiments, the fatty alcohol compositions produced by the methods described herein are subjected to reduction to produce alkanes and/or alkenes having the same carbon chain length as the fatty alcohol starting materials. Without being bound by any particular theory, the hydroxyl group of an alcohol is a poor leaving group, and therefore, in principle a chemical moiety that binds to the oxygen atom of the hydroxyl group to make it a better leaving group can be used to reduce the fatty alcohols described herein.
[0192] Any method known in the art can be used to reduce the fatty alcohols present in the compositions described herein. In some embodiments, reduction of fatty alcohols can be carried out chemically, for example, by a Barton deoxygenation (or Barton-McCombie deoxygenation), a two-step reaction in which the alcohol is first converted to a methyl xanthate or thioimidazoyl carbamate, and the xanthate or thioimidazoyl carbamate is reduced with a tin hydride or trialkylsilane reagent under radical conditions to produce the alkane and/or alkene. See JJ. Li, C. Limberakis, D.A. Pflum Modern Organic Synthesis in the Laboratory (Oxford University Press, 2007) at pp. 81-83.
[0193] In some embodiments, reduction of fatty alcohols to the corresponding alkanes and/or alkenes can be accomplished using a microorganism that has a
biosynthetic pathway for reducing fatty alcohols. In certain embodiments, the microorganism is a bacterium. In specific embodiments, the bacterium is Vibrio fur nissii strain Ml . In some embodiments, the fatty alcohol compositions produced by the methods described herein are contacted with the appropriate microorganism for reduction to alkanes and/or alkenes. hi other embodiments, the fatty alcohol compositions produced by the methods described herein are contacted with membrane fractions from the appropriate microorganism so that the reduction is carried out in a cell free system. See e.g., Park (2005) J. Bacteriol. 187(4): 1426-1429.
[0194] In certain embodiments, alkanes and/or alkenes produced by the reduction of fatty alcohols described herein are isolated from the reaction mixture and unreduced fatty alcohol starting materials to produce a composition that comprises substantially all alkanes and/or alkenes. In some embodiments, the alkanes and/or alkenes produced by the reduction of fatty alcohols described herein and the unreacted fatty alcohol starting materials are isolated from the reaction mixture to produce a composition comprising alkanes and/or alkenes and fatty alcohols. [0195] In certain embodiments, the resulting compositions comprise at least about
60% alkanes and/or alkenes, such as at least about 70% alkanes and/or alkenes, such as at least about 80% alkanes and/or alkenes, such as at least about 85% alkanes and/or alkenes, such as at least about 90% alkanes and/or alkenes, such as at least about 92% alkanes and/or alkenes, such as at least about 95% alkanes and/or alkenes, such as at least about 96% alkanes and/or alkenes, such as at least about 97% alkanes and/or alkenes, such as at least about 98% alkanes and/or alkenes, such as at least about 99% alkanes and/or alkenes by weight of the composition after reduction.
[0196] In other embodiments, the resulting compositions comprise at least about
10% alkanes and/or alkenes, such as at least about 20% alkanes and/or alkenes, such as at least about 30% alkanes and/or alkenes, such as at least about 40% alkanes and/or alkenes, such as at least about 50% alkanes and/or alkenes by weight of the composition after reduction.
[0197] In some typical embodiments, the compositions produced by the methods described herein comprise one or more alkanes selected from the group consisting of octane, decane, dodecane, tetradecane, hexadecane, octadecane, icosane, docosane, and tetracosane. In other typical embodiments, the compositions produced by the methods described herein comprise one or more alkenes selected from the group consisting of octane, decene, dodecene, tetradecene, hexadecene, octadecene, icosene, docosene, and tetracosene.
[0198] In typical embodiments, C8 to C20 alkanes and/or alkenes comprise at least about 80%, such as at least about 85%, such as at least about 90%, such as at least about 92%, such as at least about 95%, such as at least about 97%, such as at least about 99% by weight of the total alkanes and/or alkenes in the composition. In certain embodiments, ClO to Cl 8 alkanes and/or alkenes comprise about 80%, such as at least about 85%, such as at least about 90%, such as at least about 92%, such as at least about 95%, such as at least about 97%, such as at least about 99% by weight of the total alkanes and/or alkenes in the composition. [0199] In certain embodiments, alkanes and/or alkenes having particular carbon chain lengths can be isolated from longer and/or shorter alkanes and/or alkenes, for example by HPLC. In certain embodiments, alkane and/or alkene compositions that are suitable, e.g., for use in jet fuels, comprise ClO to C14 alkanes and/or alkenes. In other embodiments, alkane and/or alkene compositions that are suitable, e.g., for use in diesel fuels comprise alkanes and/or alkenes that have 16 or more carbons (e.g., Cl 6 or longer- chain alkanes and/or alkenes).
Fuel compositions:
[0200] In certain embodiments, the fatty alcohol compositions described herein and compounds derived there from can be used as components of fuel compositions. In certain embodiments, the fatty alcohol compositions produced by the methods described above can be used directly in fuel compositions. In various embodiments, the fatty alcohols can be reacted with a carboxylic acid to produce acid esters. In particular embodiments, the acid esters are used as components of biodiesel fuel compositions. In other embodiments, the fatty alcohols are reacted with a reducing agent to produce alkanes and/or alkenes. In some embodiments, alkanes and/or alkenes derived from the fatty alcohol compositions are used as components of jet fuel compositions. In other embodiments, alkanes and/or alkenes derived from fatty alcohol compositions are used as components of rocket fuel. In still other embodiments, alkanes and/or alkenes derived from the fatty alcohol compositions are used as components in petrodiesel-like fuel compositions.
[0201] In some embodiments, the fuel compositions comprise an alkane and/or alkene derived from the fatty alcohol compositions described herein. In certain embodiments, the alkanes and/or alkenes have from 6 to 16 carbons and the fuel composition is a kerosene-like fuel composition. In various embodiments, the kerosene- like fuel compositions are included in jet fuel compositions. In particular embodiments, the kerosene-like fuel compositions are included in various grades of jet fuel, including but not limited to, grades Avtur, Jet A, Jet A-I, Jet B, JP-4, JP-5, JP-7 and JP-8. In other embodiments, the kerosene-like fuel compositions are included in fuel compositions for heating. In still other embodiments, the kerosene-like fuel compositions derived from the fatty alcohol compositions described above are burned with liquid oxygen to provide rocket fuel. In particular embodiments, the kerosene-like fuel compositions are used in RP-I rocket fuel.
[0202] In some embodiments, the alkanes and/or alkenes derived from the fatty alcohol compositions described herein are used in fuel compositions that are similar to petrodeisel fuel compositions, e.g., that contain saturated and aromatic hydrocarbons. In certain embodiments, the fuel compositions comprise only alkanes and/or alkenes derived from the fatty alcohol compositions described herein. In other embodiments, the fuel compositions comprise alkanes and/or alkenes derived from the fatty alcohol
compositions described herein mixed with other components, such as petrodiesel fuel.
[0203] In certain embodiments, the fatty alcohols are further processed with a carboxylic acid to form acid esters. Esterification reactions of fatty alcohols are well- known in the art. In certain embodiments, the transesterification reaction is carried out in the presence of a strong catalyst, e.g., a strong alkaline such as sodium hydroxide. In other embodiments, the reaction is carried out enzymatically using an enzyme that catalyzes the conversion of fatty alcohols to acid esters, such as lipoprotein lipase. See, e.g., Tsujita et α/. (1999) J Biochem. 126(6):1074-1079. In various embodiments, the acid esters are used as biodiesel fuel without being mixed with other components. In certain embodiments, the fatty acid esters are mixed with other components, such as petrodiesel fuel.
[0204] In certain embodiments, fatty alcohols, or acid esters or alkanes and/or alkenes derived there from, are combined with other fuels or fuel additives to produce compositions having desired properties for their intended use. Exemplary fuels and fuel additives for particular applications are well-known in the art. Exemplary fuels which can be combined with the compositions described herein include, but are not limited to, traditional fuels such as ethanol and petroleum-based fuels. Exemplary fuel additives which can be combined with the compositions described herein include, but are not limited to, cloud point lowering additives, surfactants, antioxidants, metal deactivators, corrosion inhibitors, anti-icing additives, anti-wear additives, deposit-modifying additives and octane enhancers.
EXAMPLES
[0205] Various features and embodiments of the disclosure are provided in the following representative examples of the disclosure are provided in the following representative examples, which are intended to illustrative and not limiting.
Example 1 - Gene Acquisition
[0206] Wild-type B. mori, M. algicola DG893, and Oceanobacter sp. RED65 fatty acyl reductase (FAR) genes were designed for expression in E. coϊi, S. cerevisiae, and Y. Hpolytica based on the reported amino acid sequences (B. mori FAR: Moto et al. (2003) Proc. Nat'lAcad. Sci. 100:9156-61; Reiser (1997) GenBank accession number BAC79425.1; M. algicola DG893 FAR: GenBank genome accession number
NZ_ABCP01000001.1; and Oceanobacter sp RED65 FAR: GenBank genome accession number NZ_AAQH01000001.1). M. aquaeolei FAR gene having GenBank accession number YP 959486 was codon optimized for expression in E.coli, Codon optimization was performed using an algorithm as described in Example 1 of WO2008/042876, incorporated herein by reference in its entirety. Input codon usage information for the algorithm was either a hybrid of E. coli, S. cerevisiae, and Y. Hpolytica usages, or the codon usage for the individual organisms. The genes were synthesized by Genscript (Piscataway, NJ) with flanking restriction sites for cloning into E.coli vector pCK 110900 described in US Patent Publication No. 2006/0195947. Nucleotide sequences for S/?I restriction sites were added to the 5' end and the 3' end of the gene as well as to the t7glθ RBS in front of the ATG start codon.
5' ACAATCTGGATCCGGCCAGCCTGGCCATAAGGAGATATACAT (SEQ ID NO: 15) and 3' TAATGAGGCCAAACTGGCCGTCGACACCAGTATG (SEQ ID NO: 16).
The genes were provided in the vector pUC57 by Genscript (Piscataway, NJ) and the sequences verified by DNA sequencing. The sequences of the codon optimized genes for recombinant host cells for M. algicola DG893 FAR, M. aquaeolei, Oceanobacter sp. RED65 FAR, and B. mori FAR are set forth respectively in SEQ ID NOs: 1 and 3 for FAR_Maa, SEQ ID NO: 13 for FAR_Maq, SEQ ID NOs: 5 and 7 for FAR Osc and SEQ ID NO: 11 for B. mori and the corresponding polypeptide sequences are set forth respectively in SEQ ID NOs: 2 and 4 for FARJVIaa, SEQ ID NO: 14 for FARJVlaq, SEQ ID NOs: 6 and 8 for FAR Osc and SEQ ID NO: 12 for B. mori.
Example 2 - Expression and activity of FARs in E. coli a. Construction of vectors to express FARs in E. coli
[0207] The FAR genes were cloned into the vector pCKl 10900 (shown in Figure
3 of US Patent Publication No. 2006/0195947) under the control of a lac promoter using the Sfi I restriction sites. The expression vector also contained the Pl 5a origin of replication and the chloramphenicol resistance gene. The resulting plasmids were introduced into E. coli BW25113 (AfadE) (Baba et al, Molecular Systems Biology, 2006 doi : 10,1038/msb4100050, Article Number: 2006.0008) using routine transformation methods.
b. In vivo activity of FARs in recombinant E. coli using shake flasks
[0208] Recombinant E. coli host strains comprising a plasmid containing a heterologous gene encoding either the B. mori, M. algicola DG893, M. aquaeolei or Oceanobacter sp. RED65 fatty acyl-CoA reductase, were grown in Luria Bertani Broth (LB) medium supplemented with 1% glucose and 30 μg/mL chloramphenicol (CAM), for approximately 16-18 hours (overnight) at 30°C, 200 rpm. A 5% inoculum was used to initiate fresh 50 mL 2xYT Broth culture supplemented with 30 μg/mL CAM and 0-0.4% glucose. The culture was incubated in a shaker for 2.5 hours at 30°C and 200 rpm to an OD6O0 of about 0.6 to about 0.8, at which point expression of the heterologous FAR was induced with isopropyl-β-D-thiogalactoside (IPTG) (1 mM final concentration).
Incubation was continued for about 16 hours (overnight) under the same conditions. Cells were collected by centrifugation for 10 minutes at 6000 rpm in F15B-8x50C rotor. The cell pellets were resuspended in 0.5 mL of 6.7% Na2SO4 and then extracted with 1 mL of isopropanol:methyl t-butyl ether (4/6 ratio) for 2 hrs. The extract was centrifuged and analyzed either directly by GC-FID or GC-MS or derivatized with BSTFA before analysis. For derivatization, a 400 μL sample was taken off the top organic layer, evaporated under a nitrogen stream and the residue was derivatized with 100 μL iV,O-Bis(trimethylsilyl)trifluoroacetamide) (BSTFA) at 37°C for 1 hour, and then diluted with 100 μL of heptanes before analysis by GC-FID or GC-MS. 0.5 mL of the culture medium (after removal of cells by centrifugation) was also extracted with 1 mL methyl t- butyl ether for 1 hr. The organic phase was either analyzed directly by GC-FID or GC- MS or derivatized with BSTFA as described above before analysis. In addition, 0.5 mL of the cell culture (before removal of cells by centrifugation) was directly extracted with 1 mL of isopropanol:hexane (4:6 ratio) for 2 hrs. The organic phase was either analyzed directly by GC-FID or GC-MS or derivatized with BSTFA as described above before analysis.
[0209] A 1 μL sample was analyzed by GC-FID with the split ratio 1:10 using the following conditions: GC-6890N from Agilent Technologies equipped with FID detector and HP-5 column (length 30 m, LD. 0.32 mm, film 0.25 urn). GC method: start at 1000C, increase the temperature with a rate of 25°C/min to 2460C and hold for 1.96 min. Total run time, 7.8 min. Under the above GC conditions the approximate retention times (min) of produced fatty alcohols and acids are as follows: 5.08, C14:0-OH; 5.40; C14:0-OOH; 5.74, C16:1-OH; 5.93, C16:0-OH; 6.11, C16:0-OOMe (internal standard); 6.16, C16:l- OOH; 6.29, C16:0-OOH; 6.80, C18:1-OH; 6.90, C18:0-OH; 7.3, C18:0- and C18:1-OOH. Under the conditions tested, expression of the B. mori, M. algicola DG893 and
Oceanobacter sp. RED65, FARs in E. coli BW25113 ΔfadE resulted production of fatty alcohols (see Table 2). Identification of individual fatty alcohol was done by comparison to commercial standards (Sigma Chemical Company, 6050 Spruce St. Louis, MO 63103). In addition the total production of fatty alcohols by FAR_Maq was similar to that obtained from FARJViaa (M algicola DG893) and produced fatty alcohols include C14:0 (2.5%), C16:l(10%), C16:0 (34%), C18:l(53%) and C18:0 (0.5%).
Table 2
Fatty alcohol profile exhibited by recombinant E. coli BW25113 ΔfadE
host cells over expressing heterologous FAR genes
Figure imgf000070_0001
a: The relative amounts of each fatty alcohol component are expressed as a % of the total fatty alcohols detected via GC-FID. Fatty alcohols include: C12:0 (1-dodecanol), no C12:l (1-dodecenol) was detected, C14:0 (1-tetradecanol), no C14:l (1-tetradecenol) was detected, C16:l (cis Δ9-l-hexadecenol), C16:0 (1- hexahecanol), C18:l (cis Δπ-l-octadecenol), 18:0 (1-octadecanol). ND: not detected,
b: Enzyme productivity was estimated using both internal and external standards. c. In vivo activity of FARs in recombinant E. coli using fermentors
[0210] In an aerated, agitated stirred tank fermentor, 1.0 L of growth medium containing 11.28 g/L 5x M9 minimal salts (BD, Franklin Lakes, NJ); 2 g/L yeast extract (BD, Franklin Lakes, NJ); 3 g/L glucose (Sigma Chemical Co., St. Louis, MO); 2 niM MgSO4 (Sigma Chemical Co., St. Louis, MO); 0.1 niM CaCl2 (Sigma Chemical Co., St. Louis, MO); and 30 μg/ml chloramphenicol (Sigma Chemical Co., St. Louis, MO) was brought to a temperature of 3O0C. The fermentor was inoculated with a late exponential culture of E. coli BW25113 AfadE equipped with plasmid containing M. algicola DG893 (as described in Example 2b) to a starting optical density at 600 nm (OD6oo) of 0.8 to 1.0. The inoculum was grown in a shake flask containing TB (BD, Franklin Lakes, NJ); 0.4% glycerol (Sigma Chemical Co., St. Louis, MO), and 30 μg/ml chloroamphenicol (Sigma Chemical Co., St. Louis, MO) at 30°C and 250 rpm until OD600 reached around 5.0. The fermentor was agitated at 400-1000 rpm and air supplied at 1.0 L/min to maintain a minimum dissolved oxygen level of 30% of saturation. The pH of the culture was controlled at 7.0 initially by addition of mixture of 14% v/v ammonium hydroxide and 10% w/v sodium hydroxide. The base for pH control was switched to 20% w/v sodium hydroxide when ammonium concentration in the broth reached 1.5— 2.0 g/L. After the culture reached an OD600 of 5.0, the expression of M. algicola DG893 FAR was induced by addition of isopropyl-β-D-thiogalactoside (IPTG) (Sigma Chemical Corp., St. Louis, MO) to a final concentration of 1 niM. Growth of the culture and production of fatty alcohol were maintained by addition of a feed solution containing 500 g/L glucose. Addition of glucose (6 g/L per pulse) was triggered whenever pH reached 7.2. Culture was then grown for another 135-140 hours at 3O0C. 3 g/L yeast extract shots were added at 55 and 95 hours. Samples were taken at different time points for analysis. Extraction and quantification of fatty alcohols were performed as described in Example 2b. Under the conditions tested, total production and secretion of fatty alcohols were estimated to be ~ 12-15 and 9-13 g/L, respectively.
Example 3 - Expression and activity of FAR enzymes in various E. coli strains a. Construction of vectors to express FARs in various E. coli strains
[0211] The FAR genes were cloned into the vector pCKl 10900-1 (shown in
Figure 3 of U.S. Patent Publication No. 2006/0195947) under the control of a lac promoter as described above. The resulting plasmids were introduced into E.coli
BW25113 parent and knock-out strains (AfadE and AfadD, AfadK) derived from
BW25113 (Baba et al, Molecular Systems Biology (2006) doi: 10.1038/msb4100050, Article No. 2006.0008; Morgan-Kiss et al., J. Biol. Chem. (2004), 279: 37324-37333 and Campbell, et al., Molecular Microbiology (2003), 47(3): 793-805) by routine transformation methods. b. In vivo activity of FARs in various recombinant E.coli strains using shake flasks [0212] Recombinant E. coli BW25113 strains (parent, AfadE, AfadD,and AfαdK knock-outs) comprising a plasmid containing a heterologous gene encoding either M. αlgicolα DG893 or Oceαnobαcter sp. RED65 fatty acyl reductase (FAR), were grown on Luria Bertani (LB) medium supplements with 1% glucose and 30 μg/ml chloramphenicol (CAM) for approximately 16 - 18 hours (overnight) at 30°C, 200 rpm. A 5% inoculums was used to initiate fresh 50 mL LB culture supplemented with 30 μg/mL CAM. The culture was incubated for 2.5 hrs at 30°C and 200 rpm to an OD600 of 0.6 - 0.8, at which point expression of the heterologous FAR gene was induced with isopropyl-β-D- thiogalactoside (IPTG) (1 mM final concentration). Incubation was continued for about 24 hours under the same conditions. Extraction and quantitation of fatty alcohols were performed as described in Example 2b except the use of following GC method: start at 8O0C for 3 mins, increase the temperature at a rate of 50°C/min to 2000C, then increase the temperature at a rate of 10°C/min to 27O0C and finally, increase at 20°C/min to 3000C and hold for 5 min (total rum time 18.8 min). Under the above GC conditions the approximate retention times (mins) of produced fatty alcohols and acids were as follows: 6.90, C12:0-OH; 8.04, C14:0-OH; 8.42, d27-C14:0-OOH (internal standard); 8.53, C14:0-OOH; 9.11, C16:1-OH; 9.23, C16:0-OH; 9.68, C16:1-OOH; 9.80, C16:0-OOH; 10;46, C18:1-OH; 10.57, C18:0-OH; 11.10, C18:1-OOH, and 11.25, C18:0-OOH.
Identification of individual fatty alcohol was done by comparison to commercial standards (Sigma Chemical Company, St Louis, MO 63103). Under the conditions tested, expression of the M. algicola DG893 and Oceanobacter sp. RED65 FAR in E.coli BW25113 and the corresponding ΔfadD, AfadE and ΔfadK strains resulted in production of fatty alcohols (Tables 3a and 3b). Typical shake flask titer for E.coli BW25113 expressing M. algicola DG893 and Oceanobacter sp. RED65 FARs was 100 - 200 mg/L. Since both FARs are able to produce significant amounts of fatty alcohols in the absence of the fadD smdfadK acyl-CoA synthetases in E.coli, these FARs are able to reduce non acyl-CoA substrates.
Table 3A
Fatty alcohol profile exhibited by recombinant E.coli host cells expressing a heterologous M. algicola FAR gene
Figure imgf000072_0001
a: Fatty alcohols include: 15 - 17% C14:0 (1-tetradeconal), approximately 38% C16:l (cis ΔM- hexadeconal), 23 - 24% C16:0 (1-hexacecanol), 21 - 22% C18:l (cis Δn-l-octadeconal), 0 - 1% C18:0
(1-octadecanol).
b: Data obtained from evaluation of strains in microtiter plates. Table 3B
Fatty alcohol profile exhibited by recombinant E.coli host cells expressing a heterologous Oceanobacter sp. RED65 FAR
Figure imgf000073_0001
a: Fatty alcohols include: 0 - 2% C14:0 (1-tetradeconal), 2 - 10% C16:l (as Δ -1-hexadeconal), 32 - 36% C16:0 (1-hexacecanol), 56 - 62% C18:l (as Δπ-l-octadeconal), 0 - 1% C18:0 (1-octadecanol). c. Extraction and quantitation of acyl-CoAs from E. coli strains
[0213] Strains were grown as described above in Example 3b. 10 OD60O units of cells were resuspended in 0.6 ml of ice-cold freshly made extraction buffer (100 mM KH2PO4, pH 4.9:isopropanol, 1 :1), containing 200 ng/mL C17:0-CoA (heptadecanoyl- CoA) as an internal standard, and 0.6 ml of acetonitrile. The cell suspension was vortexed for 5 minutes and centrifuged at 4 0C and 14,000 rpm for 20 minutes. The supernatant was collected and evaporated under a nitrogen stream. The dry residue was resuspended in 200 μl of isopropanol/1 mM acetic acid (4:1) and centrifuged as described above. Supernatant was transferred into a glass vial, and 10 μl was injected into an LC- MS system (AB Sciex 5500 QTRAP) equipped with a Zorbax Extend Cl 8, 4.6 mm x 50 mm, 18 μm analytical column. HPLC separation was conducted using a binary gradient with 10% acetonitrile/90% water containing 0.1% NH4OH (A) and acetonitrile containing 0.1% NH4OH (B) at flow rate 0.5 mL/min. The chromatographic conditions were as follows: 0-1 min 5% solvent B, 1-7 min linear gradient to 95% solvent B, 7-9 min 95% solvent B, The post equilibrium time was 2.5 min. Total run time was 11.5 minutes. LC- MS/MS was performed in a negative mode using parameters described in Table 4. All fatty acyl-CoA standards were obtained from Sigma (St. Louis, MO).
Table 4
MS parameters for determination of fatty acyl-CoAs
Figure imgf000074_0001
[0214] Relative fatty-acyl-CoA concentrations of different E. coli strains are shown in Table 5. Results indicate that disruption of AfadD significantly reduces the intracellular concentration of acyl-CoAs. In this example the level of acyl-CoA is reduced by ~8 fold in E. coli BW25113 AfadD containing M. algicola DG893 FAR compared to the strain without the deletion. However, fatty alcohol production, as reported above, is not substantially affected. Therefore, M. algicola DG893 FAR appears to be capable of reducing non-Co A substrates, most likely acyl-ACPs, to fatty alcohols.
Table 5
Fatty acyl-CoA profile exhibited by recombinant E. coli cells with and without expressing a heterologous M. algicola DG893 FAR
Figure imgf000074_0002
a: Fatty acyl-CoA production was estimated using both internal and external standards. Fatty acyl-CoAs detected by LC-MS/MS include: 11-16% C14:0 (tetradecanoyl-CoA), 2 - 11% C14: 1 (tetradecenoyl- CoA), 28 - 31% C16:l (cis Δ9-l-hexadecenoyl-CoA), 14-26% C16:0 (hexadecanoyl-CoA), 14 - 20% C18:l (cis Δn-octadecenoyl-CoA),9-15% C18:0 (octadecanoyl-CoA).
Example 4 - Expression and activity of FARs in S. cerevisiae a. Construction of vectors to express FARs in S. cerevisiae [0215] The FAR genes were PCR amplified and cloned downstream of the TEFl promoter with BamHl and Sail sites into pCEN318 to create pCEN319 (B. mori FAR), pCEN328 (M. algicola DG896 FAR), and pCEN333 (Oceanobacter sp. RED65 FAR). pCEN318 was constructed by replacing the KanMX gene of p427-TEF (Sunrise Science Products, San Diego, CA) with the hygromycin resistance gene. AU FAR plasmids were transformed into S. cerevisiae FLlOO by routine transformation methods. b. In vivo activity of FARs in recombinant S. cerevisiae using shake flasks
[0216] The recombinant S. cerevisiae strains comprising a plasmid containing a heterologous gene encoding either the B. mori, M. algicola DG893 or Oceanobacter sp. RED65 FAR were inoculated into 5 ml of YPD containing 200 μg/mL hygromycin, grown at 30° C for 48 hours (OD ~8-10). Approximately 2.5 ml were subcultured into 50 ml of YPD media (2Ox dilution) containing 200 μg/mL hygromycin and grown in a shaker at 30° C and 250 rpm for 96 hours. Cell cultures were centrifuged at -3000-4000 rpm (F15B-8X50C rotor) for 10 minutes, the supernatant was separated from cells. The pellets were washed with 20 ml of 50 mM Tris-HCl pH 7.5. Extraction and analysis of fatty alcohols were performed as described in Example 2b. Under the conditions tested, expression of B. mori, M. algicola DG893 and Oceanobacter sp. RED65 FAR genes in S. cerevisiae FLlOO resulted in the production of fatty alcohols as shown in Table 6.
Table 6
Fatty Alcohol profile exhibited by recombinant S. cerevisiae FLlOO host cells over- expressing the heterologous FAR enzyme genes
Figure imgf000075_0001
a: The relative amounts of each fatty alcohol component are expressed as a % of the total fatty alcohols detected using via GC-FID or GC-MS. Endogenous fatty alcohols include: C14:0 (1- tetradecanol), C16:0 (1-hexahecanol), and 18:0 (1-octadecanol). No unsaturated fatty alcohols were detected.
b: Enzyme productivity was estimated using internal and external standards.
Example 5 - Expression and activity of FAR enzymes in Yarrowia lipolytica a. Construction of vectors to express FARs in Yarrowia lipolytica
[0217] An autonomous replicating plasmid for expression of genes in Y. lipolytica was engineered with two antibiotic selection marker cassettes for resistance to
hygromycin and phleomycin (HygB(R) or BIe(R), respectively) (named plasmid pCEN354). Expression of each cassette was independently regulated by a strong, constitutive promoter isolated from Y. lipolytica: pTEFl for BIe(R) expression and pRPS7 for HygB(R) expression. Plasmid pCEN354 was used to assemble Y. lipolytica expression plasmids. Using "restriction free cloning" methodology, the FAR gene was inserted into pCEN354 to provided plasmid pCEN411 (Figure 1). In pCEN411, heterologous gene expression is under control of the constitutive TEFl promoter. The Hy gB R gene allows for selection in media containing hygromycin. Arsl8 is an autonomous replicating sequence isolated from Y. lipolytica genomic DNA. The resulting plasmid was transformed into Y. lipolytica 1345 obtained from the German Resource Centre for Biological Material (DSMZ) using routine transformation methods [(Madzak, C. et al. (2003) Yarrowia lipolytica. In G. Gellissen (Ed.), Production of Recombinant Proteins Novel Microbial and Eukaryotic Expression Systems (p 163-189).].
b. In vivo activity of heterologous M. algicola FAR in recombinant Y. lipolytica using shake flasks
[0218] The recombinant Y. lipolytica strain comprising plasmid containing a heterologous gene encoding M. algicola DG893 FAR, was inoculated in 200 mL YPD media containing 8% glucose and 500 μg/mL hygromycin. The cultures were grown at 30° C to an OD600 of 4-7. Cells were then harvested by centrifugation and washed with 20 ml of 50 mM Tris-HCl pH 7.5. Extraction and identification of intra- and extra-cellular fatty alcohols were performed as described in Example 2b. Under the conditions tested 14 mg/L of 1-hexadecanol was detected. Secreted fatty alcohols were not detected. Using 8% glycerol as carbon source, the total production and secretion of fatty alcohols was estimated to be ~ 0.8 and 0.2 g/L, respectively. Fatty alcohols include: 30% C16:0 (1- hexahecanol), 56% 18:0 (1-octadecanol) and 12% C18:l (cw Δ9-l-octadecenol). c. In vivo activity of integrated M. algicola FAR in Y. Hpolytica genome using 96- well microtiter plates
[0219] An improved Y. Hpolytica strain (YL1415) for production of fatty alcohols was identified from a library of UV-mutagenized strains defective in growth on media with hexadecane as the sole carbon source. When transformed with pCEN411, YL1415 strain showed 7- 10-fold increase in fatty alcohol titer and a significant reduction in the rate of degradation of exogenous 1-hexadecanol in YPD media containing 8% glucose and 500 μg/mL hygromycin compared to that detected from Y. Hpolytica 1345.
Expression of M, algicola DG893 FAR was improved in the YL1415 strain by integrating the M. algicola DG893 FAR gene at random locations in the genome by non-homologous recombination. An integration cassette consisting of M. algicola FAR under control of the TEF promoter and the HygBR gene under control of the RPS promoter was amplified from pCEN411 using primers 411-F1 (AGAGACCGGGTTGGCGG) (SEQ ID NO: 17) and 411 -Rl (CATTTGCCATTCGTAACGCTG) (SEQ ID NO: 18).
[0220] Transformation of YL 1415 with this integration cassette yielded a library of hygromycin-resistant strains with FAR integrated at various locations in the Y.
Hpolytica genome [(Madzak, C. et al. (2003) Yarrowia Hpolytica. In G. Gellissen (Ed.), Production of Recombinant Proteins Novel Microbial and Eukaryotic Expression Systems (p 163-189)]. This collection of strains with integrated M. algicola DG893 FAR in the YL1415 UV mutant strain was grown in 96-well Axygen 96-well plates containing 250 μL YPD supplemented with the total of 2% glucose and 500 μg/mL hygromycin. Plates were incubated in a Kuhner shaker for approximately 40-48 hours at 30°C, 200 rpm and 85% relative humidity. The cell cultures were diluted by transferring 50 μL of overnight grown cultures into the Axygen 96-well plates containing 250 μL YPD supplemented with the total of 2% glucose and 500 μg/mL hygromycin. The plates were incubated for approximately 24-28 hours in a Kuhner shaker under the similar conditions. 20 μL of the cell cultures were then transferred into deep 96-well plates containing 380 μL YPD supplemented with the total of 8% glucose and 500 μg/mL hygromycin. The Ppates were incubated for approximately 22-26 hours under similar conditions. Cells were collected by centrifugation for 10 minutes at 3500 rpm. Cell pellets were then resuspended in 400 μL of nitrogen limitation media (1.7 g/L yeast nitrogen base, 1.4 g/L (NKi)2SO4, 30 g/L glucose) containing 500 μg /mL Hygromycin and incubated for 22-26 hours in a Kuhner shaker at 30°C, 200 rpm and 85% relative humidity. The cell cultures were then extracted with 1 mL of isopropanol:hexane (4:6 ratio) for 2 hrs. The extracts were centrifuged and the upper organic phase was transferred into polypropylene 96-well plates. Samples were then analyzed using GC-FID method as described in Example 2b. Under the conditions tested, M. algicola FAR integrant strains with up to ~5x improvement in total fatty alcohol production (-0.5-1 g/L) compared to plasmid-based expression were identified. Fatty alcohols include: 70-80% C16:0 (l-hexahecanol), 10-15% 18:0 (1-octadecanol) and 10-15% C18:l {pis Δ9-l-octadecenol).
[0221 ] All publications, patents, patent applications and other documents cited in this application are hereby incorporated by reference in their entireties for all purposes to the same extent as if each individual publication, patent, patent application or other document were individually indicated to be incorporated by reference for all purposes.
[0222 ] While various specific embodiments have been illustrated and described, it will be appreciated that various changes can be made without departing from the spirit and scope of the invention(s).

Claims

WHAT IS CLAIMED IS:
1. A method of producing a fatty alcohol composition comprising:
a) culturing a recombinant microorganism in a suitable culture medium, wherein the recombinant microorganism comprises a gene encoding a heterologous fatty acyl reductase (FAR) enzyme having at least 75% sequence identity (at least 80%, at least 85%, at least 90%, and at least 95% sequence identity) to SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 14 or a functional fragment thereof, and
b) allowing expression of said gene, wherein said expression results in the production of a composition of fatty alcohols.
2. The method according to claim 1, wherein the FAR enzyme has at least 85%
sequence identity (at least 90% and at least 95% sequence identity) to SEQ ID NO: 2 or functional fragments thereof.
3. The method according to claim 1, wherein the FAR enzyme has at least 85%
sequence identity (at least 90% and at least 95% sequence identity) to SEQ ID NO: 6 or functional fragments thereof.
4. The method according to claim 1, wherein the FAR enzyme has at least 85%
sequence identity (at least 90% and at least 95% sequence identity) to SEQ IDNO: 14 or functional fragments thereof.
5. The method according to claim 1, wherein the FAR enzyme comprises the
sequence of SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 14 or functional fragments thereof.
6. The method according to claim 1, wherein the FAR enzyme consists of the
sequence of SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 14 or functional fragments thereof.
7. A method of producing a fatty alcohol composition comprising:
a) culturing a recombinant microorganism in a suitable culture medium, wherein the recombinant microorganism comprises a gene encoding a heterologous fatty acyl reductase (FAR) enzyme having at least 30% sequence identity to SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 14 or a functional fragment thereof, and
b) allowing expression of said gene, wherein said expression results in the production of a composition of fatty alcohols.
8. The method according to any one of claims 1 - 7, wherein the produced fatty alcohols include C12 - Cl 8 fatty alcohols.
9. The method according to any one of claims 1 - 8, wherein the produced fatty alcohols include a mixture of at least two of C14:0, C16:0, C18:0, C16:l and Cl 8:1 fatty alcohols.
10. The method according to claims 8 or 9, wherein at least 25 % of the produced fatty alcohols are secreted.
11. The method according to claim 10, wherein at least 50% of the produced fatty alcohols are secreted.
12. The method according to any one of claims 1 - 11, wherein the recombinant
microorganism produces at least 0.5 g/L of fatty alcohol.
13. The method according to claim 12, wherein the recombinant microorganism
produces at least 5 g/L of fatty alcohols.
14. The method according to claim 13, wherein the recombinant microorganism
produces at least 15 g/L of fatty alcohol.
15. The method according to any one of claims 1 - 14, wherein the recombinant
microorganism is a bacterium, a yeast, a filamentous fungus or an algae.
16. The method according to claim 15, wherein the recombinant microorganism is an E.coli.
17. The method according to claim 16, wherein the recombinant E.coli further
comprises an inactivated or silenced endogenous fatty acyl-ACP thioesterase gene, an inactivated or silenced endogenous fatty acyl-CoA synthetase gene or both.
18. The method according to claim 15, wherein the yeast is a strain of Yarrowia, Candida, Pichia or Saccharomyces.
19. The method according any one of claims 1 - 18 further comprising isolating the composition of fatty alcohols.
20. A composition comprising the isolated fatty alcohols produced according to the method of claim 19.
21. The method according to any one of claims 1 - 18, wherein the gene encoding the FAR comprises a codon optimized nucleic acid sequence.
22. The method according to claim 21, wherein the nucleic acid sequence is a
sequence having at least 70% sequence identity (at least 80%, at least 85%, at least 90%, at least 95% sequence identity to SEQ ID NOs: 1, 3, 5, 7, or 13.
23. The method according to claims 21 or 22, wherein the nucleic acid sequence is integrated into the chromosome of the recombinant microorganism.
24. The method according to claims 21 or 22, wherein the nucleic acid is present on a vector.
25. The method according to any one of claims 1 - 18, wherein the culturing
conditions comprise a temperature in the range of 2O0C to 450C; a pH in the range of 5 to 7, a time period in the range of 16 hours to 144 hours; and an assimilable carbon source comprising fermentable sugars obtained from a cellulosic feedstock.
26. The method according to any one of claims 1 - 18, wherein the fatty alcohol is produced by an acyl-CoA independent pathway.
27. The method according to any one of claims 1 - 20 further comprising reducing the fatty alcohol composition to yield an alkane composition.
28. A fuel composition comprising the alkanes produced according to the method of claim 27.
29. The method according to any one of claims 1 - 20 further comprising
esterification of the fatty alcohol composition to produce fatty esters.
30. A fuel composition comprising the fatty esters produced according to the method of claim 29.
31. An isolated nucleic acid sequence encoding a fatty acyl-CoA reductase (FAR) enzyme comprising an amino acid sequence having at least 30% sequence identity to SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 14 or functional fragments thereof.
32. The isolated nucleic acid of claim 31 , wherein the FAR enzyme has at least 80% sequence identity (at least 85%, at least 90%, at least 95% sequence identity) to SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 14 or a functional fragment thereof.
33. The isolated nucleic acid of claim 32, wherein the FAR enzyme has at least 90% sequence identity to SEQ ID NO: 2 or a functional fragment thereof.
34. The isolated nucleic acid of any one of claims 31 - 33, wherein the polynucleotide is codon optimized for expression in E.coli.
35. The isolated nucleic acid of any one of claims 31 - 33, wherein the polynucleotide is codon optimized for expression in yeast.
36. The isolated nucleic acid of claim 35, wherein the polynucleotide is codon
optimized for expression in Yarrowia or Saccharomyces.
37. The isolated nucleic acid of claim 32 wherein the nucleic acid sequence is a
sequence having at least 70% sequence identity (at least 75%, at least 80%, at least 85%, at least 90%, at least 95% sequence identity) to SEQ ID NO: 1, 3, 5, 7, or 13.
38. A vector comprising the nucleic acid of any one of claims 31 - 37.
39. A host cell transformed with the vector of claim 38.
40. An isolated fatty acyl reductase (FAR) enzyme comprising an amino acid
sequence that is at least 30% identical to SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 14 or a functional fragment thereof.
41. The isolated FAR enzyme of claim 40, wherein the FAR enzyme comprises an amino acid sequence that is at least 75% identical (at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 97% identical, at least 99% identical) to SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 14 or a functional fragment thereof.
42. The isolated FAR enzyme of claim 41, wherein the FAR enzyme comprises an amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 14 or a functional fragment thereof.
43. An isolated fatty alcohol forming acyl Co-A reductase (FAR) enzyme endogenous to a marine bacterium.
44. The FAR enzyme of claim 43 which is selected from the group consisting of a FAR enzyme from a Marinobacter species, a FAR enzyme from an Oceanobacter species, FAR_Mac, FAR JVC, FAR Fer, FARJcey and FAR GaI.
45. A recombinant microorganism comprising a nucleic acid encoding a heterologous fatty acyl reductase (FAR) enzyme of any one of claims 40 - 42.
46. The recombinant microorganism of claim 45 which is selected from a bacterium, a filamentous fungus, a yeast or an algae.
47. The recombinant microorganism of claims 45 or 46 wherein the nucleic acid
encoding the FAR enzyme comprises a sequence having at least 70%
sequence identity (at least 75%, at least 80%, at least 85%, at least 90%, and at least 95% sequence identity) to SEQ ID NOs: 1, 3, 5, 7, or 13.
PCT/US2010/040368 2009-06-30 2010-06-29 Production of fatty alcohols with fatty alcohol forming acyl-coa reductases (far) Ceased WO2011008535A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
BRPI1013277A BRPI1013277A2 (en) 2009-06-30 2010-06-29 production of fatty alcohols from recombinant host cells and their uses
CA2766585A CA2766585C (en) 2009-06-30 2010-06-29 Production of fatty alcohols with fatty alcohol forming acyl-coa reductases (far)
RU2012102900/10A RU2012102900A (en) 2009-06-30 2010-06-29 PRODUCTION OF FAT ALCOHOLS USING THE FORMING FAT ALCOHOL Acyl-COA-REDUCTASES (FAR)
EP10800295.7A EP2449124B1 (en) 2009-06-30 2010-06-29 Production of fatty alcohols with fatty alcohol forming acyl-coa reductases (far)
CN201080029116.8A CN102471781B (en) 2009-06-30 2010-06-29 Fatty alcohol production by fatty alcohol-forming acyl-CoA reductase (FAR)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US22193409P 2009-06-30 2009-06-30
US61/221,934 2009-06-30
US31538010P 2010-03-18 2010-03-18
US61/315,380 2010-03-18

Publications (1)

Publication Number Publication Date
WO2011008535A1 true WO2011008535A1 (en) 2011-01-20

Family

ID=43411858

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2010/040368 Ceased WO2011008535A1 (en) 2009-06-30 2010-06-29 Production of fatty alcohols with fatty alcohol forming acyl-coa reductases (far)

Country Status (7)

Country Link
US (3) US8216815B2 (en)
EP (1) EP2449124B1 (en)
CN (1) CN102471781B (en)
BR (1) BRPI1013277A2 (en)
CA (1) CA2766585C (en)
RU (1) RU2012102900A (en)
WO (1) WO2011008535A1 (en)

Cited By (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012006114A2 (en) 2010-06-28 2012-01-12 Codexis, Inc. Fatty alcohol forming acyl reductases (fars) and methods of use thereof
WO2013024111A1 (en) 2011-08-15 2013-02-21 Evonik Degussa Gmbh Biotechnological synthesis process of organic compounds with the aid of an alkl gene product
WO2013024114A2 (en) 2011-08-15 2013-02-21 Evonik Degussa Gmbh Biotechnological synthesis process of omega-functionalized carbon acids and carbon acid esters from simple carbon sources
CN102952818A (en) * 2011-08-26 2013-03-06 中国科学院青岛生物能源与过程研究所 Construction body and method for improving fatty alcohol yield in cyanobacteria
US8394614B2 (en) 2008-10-23 2013-03-12 Matrix Genetics, Llc Modified photosynthetic microorganisms for producing triglycerides
WO2013049423A1 (en) 2011-09-27 2013-04-04 Synthetic Genomics, Inc. Production and secretion of fatty acids and fatty acid derivatives
WO2013096082A1 (en) * 2011-12-20 2013-06-27 Codexis, Inc. Fatty alcohol forming acyl reductase (far) variants and methods of use
US8835137B2 (en) 2008-12-23 2014-09-16 Matrix Genetics, Llc Modified photosynthetic microorganisms with reduced glycogen and their use in producing carbon-based products
US8962299B2 (en) 2012-02-29 2015-02-24 Exxonmobil Research And Engineering Company Four-gene pathway for wax ester synthesis
US8975061B2 (en) 2011-06-30 2015-03-10 Exxonmobil Research And Engineering Company Regulation of toxin and antitoxin genes for biological containment
US8980613B2 (en) 2010-04-06 2015-03-17 Matrix Genetics, Llc Modified photosynthetic microorganisms for producing lipids
US9157103B2 (en) 2010-12-23 2015-10-13 Shell Oil Company Gene disruptants producing fatty acyl-CoA derivatives
JP2015534831A (en) * 2012-11-09 2015-12-07 キャリスタ, インコーポレイテッド Compositions and methods for biological production of fatty acid derivatives
US9512447B2 (en) 2012-12-14 2016-12-06 Codexis, Inc. Modified native beta-ketoacyl-ACP synthases and engineered microorganisms
US9650655B2 (en) 2012-07-20 2017-05-16 Codexis, Inc. Production of fatty alcohols from engineered microorganisms
US9714437B2 (en) 2012-04-20 2017-07-25 Codexis, Inc. Production of fatty alcohols from engineered microorganisms
US12252513B2 (en) 2018-07-16 2025-03-18 Lumen Bioscience, Inc. Thermostable phycobiliproteins produced from recombinant arthrospira
US12447202B2 (en) 2018-05-17 2025-10-21 Lumen Bioscience, Inc. Arthrospira platensis oral vaccine delivery platform
US12503682B2 (en) 2019-07-03 2025-12-23 Lumen Bioscience, Inc. Arthrospira platensis non-parenteral therapeutic delivery platform

Families Citing this family (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011155799A2 (en) * 2010-06-10 2011-12-15 한국과학기술원 Mutant microorganism having a hydrocarbon-generating ability and method for producing hydrocarbon using same
CN102719467A (en) * 2012-07-09 2012-10-10 武汉大学 Method for biosynthesizing fatty alcohol by using fatty acyl ACP (acyl carrier protein) reductase
MY195138A (en) 2012-10-15 2023-01-11 Genomatica Inc Microorganisms and Methods for Production of Specific Length Fatty Alcohols and Related Compounds
US20160052846A1 (en) * 2012-11-09 2016-02-25 Codexis, Inc. Method of demulsifying and purifying organic products from an emulsion
EP2970869A4 (en) 2013-03-14 2016-08-03 Codexis Inc Low-phosphate repressible promoter
US9850512B2 (en) 2013-03-15 2017-12-26 The Research Foundation For The State University Of New York Hydrolysis of cellulosic fines in primary clarified sludge of paper mills and the addition of a surfactant to increase the yield
RU2539744C1 (en) * 2013-09-17 2015-01-27 Федеральное государственное унитарное предприятие "Государственный научно-исследовательский институт генетики и селекции промышленных микроорганизмов" (ФГУП "ГосНИИгенетика") Yeasts of genus yarrowia, having ability to accumulate intracellularly fatty acid esters, and method of microbiological synthesis of such esters
US20160222419A1 (en) * 2013-09-18 2016-08-04 The Governors Of The University Of Alberta Genetically engineered saccharomyces cerevisiae and yarrowia lipolytica and production of fatty alcohols
US9708630B1 (en) 2013-10-08 2017-07-18 Wisconsin Alumni Research Foundation Cells and methods for producing fatty alcohols
WO2015077752A1 (en) 2013-11-25 2015-05-28 Genomatica, Inc. Methods for enhancing microbial production of specific length fatty alcohols in the presence of methanol
US9951363B2 (en) 2014-03-14 2018-04-24 The Research Foundation for the State University of New York College of Environmental Science and Forestry Enzymatic hydrolysis of old corrugated cardboard (OCC) fines from recycled linerboard mill waste rejects
BR112016028904A8 (en) 2014-06-09 2021-05-04 Stepan Co laundry detergent, liquid, powder, paste, granule, tablet, molded solid, water soluble sheet, water soluble sachet, capsule, or water soluble cocoon and method
US10487342B2 (en) 2014-07-11 2019-11-26 Genomatica, Inc. Microorganisms and methods for the production of butadiene using acetyl-CoA
CN105462905A (en) * 2014-09-02 2016-04-06 中国科学院过程工程研究所 Microorganism gene modification method, genetically engineered bacteria for producing higher aliphatic alcohol and higher aliphatic hydrocarbon and application of genetically engineered bacteria
ES2579384B1 (en) * 2015-02-10 2017-07-07 Neol Biosolutions, S.A. Production of fatty alcohols
EP3317413A1 (en) * 2015-06-30 2018-05-09 Evonik Degussa GmbH A method of producing alcohols
EP3376859B1 (en) 2015-11-18 2021-01-06 Provivi, Inc. Microorganisms for the production of insect pheromones and related compounds
WO2018213554A1 (en) 2017-05-17 2018-11-22 Provivi, Inc. Microorganisms for the production of insect pheromones and related compounds
JP7194960B2 (en) 2018-04-24 2022-12-23 国立大学法人高知大学 Fatty alcohol-synthesizing bacteria and method for producing fatty alcohol
WO2020181091A1 (en) 2019-03-05 2020-09-10 Bp Corporation North America Inc. Fatty acyl-acp reductases and their uses

Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0137280A1 (en) 1983-08-31 1985-04-17 Cetus Oncology Corporation Recombinant fungal cellobiohydrolases
US5370996A (en) 1991-02-22 1994-12-06 Calgene, Inc. Fatty acyl reductases
WO1996000787A1 (en) 1994-06-30 1996-01-11 Novo Nordisk Biotech, Inc. Non-toxic, non-toxigenic, non-pathogenic fusarium expression system and promoters and terminators for use therein
US20030097686A1 (en) * 1990-03-16 2003-05-22 Calgene, Inc. Plant seed oils
US6828475B1 (en) * 1994-06-23 2004-12-07 Calgene Llc Nucleic acid sequences encoding a plant cytoplasmic protein involved in fatty acyl-CoA metabolism
US20060195947A1 (en) 2003-08-11 2006-08-31 Codexis, Inc. Ketoreductase polypeptides and related polynucleotides
WO2007136762A2 (en) 2006-05-19 2007-11-29 Ls9, Inc. Production of fatty acids and derivatives thereof
WO2008042876A2 (en) 2006-10-02 2008-04-10 Codexis, Inc. Compositions and methods for producing stereoisomerically pure statins and synthetic intermediates therefor
US20090148918A1 (en) * 2007-06-01 2009-06-11 Solazyme, Inc. Glycerol Feedstock Utilization for Oil-Based Fuel Manufacturing
WO2009140695A1 (en) 2008-05-16 2009-11-19 Ls9, Inc. Methods and compositions for producing hydrocarbons

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100203614A1 (en) * 2009-02-12 2010-08-12 Utah State University Fatty aldehyde reductase
WO2011019858A1 (en) 2009-08-11 2011-02-17 Synthetic Genomics, Inc. Microbial production of fatty alcohols
EP2585587B1 (en) * 2010-06-28 2017-08-09 Codexis, Inc. Fatty alcohol forming acyl reductases (fars) and methods of use thereof

Patent Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0137280A1 (en) 1983-08-31 1985-04-17 Cetus Oncology Corporation Recombinant fungal cellobiohydrolases
US20030097686A1 (en) * 1990-03-16 2003-05-22 Calgene, Inc. Plant seed oils
US5370996A (en) 1991-02-22 1994-12-06 Calgene, Inc. Fatty acyl reductases
US6828475B1 (en) * 1994-06-23 2004-12-07 Calgene Llc Nucleic acid sequences encoding a plant cytoplasmic protein involved in fatty acyl-CoA metabolism
WO1996000787A1 (en) 1994-06-30 1996-01-11 Novo Nordisk Biotech, Inc. Non-toxic, non-toxigenic, non-pathogenic fusarium expression system and promoters and terminators for use therein
US20060195947A1 (en) 2003-08-11 2006-08-31 Codexis, Inc. Ketoreductase polypeptides and related polynucleotides
WO2007136762A2 (en) 2006-05-19 2007-11-29 Ls9, Inc. Production of fatty acids and derivatives thereof
WO2008042876A2 (en) 2006-10-02 2008-04-10 Codexis, Inc. Compositions and methods for producing stereoisomerically pure statins and synthetic intermediates therefor
US20090148918A1 (en) * 2007-06-01 2009-06-11 Solazyme, Inc. Glycerol Feedstock Utilization for Oil-Based Fuel Manufacturing
WO2009140695A1 (en) 2008-05-16 2009-11-19 Ls9, Inc. Methods and compositions for producing hydrocarbons

Non-Patent Citations (59)

* Cited by examiner, † Cited by third party
Title
"Current Protocols", 1995, GREENE PUBLISHING ASSOCIATES, INC. AND JOHN WILEY & SONS, INC., article "Current Protocols in Molecular Biology"
"Life Science Research Cell Culture Catalogue", 1998, SIGMA- ALDRICH, INC
"Methods in Enzymology", 2002, ACADEMIC PRESS, article "Guide to Yeast Genetics and Molecular Biology", pages: 350
"The Handbook ofmicrobiological Media", 1993, CRC PRESS
"The Plant Culture Catalogue", 1997, SIGMA-ALDRICH, INC
"Useful proteins from recombinant bacteria", SCIENTIFIC AMERICAN, vol. 242, 1980, pages 74 - 94
"Yeast Protocols Handbook", 2009, CLONTECH LABORATORIES, INC. A TAKARA BIO COMPANY
AARTS MG ET AL., PLANT J., vol. 12, 1997, pages 615 - 623
ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 410
ALTSCHUL ET AL., NUCLEIC ACIDS RES., 1977, pages 3389 - 3402
BABA ET AL., MOLECULAR SYSTEMS BIOLOGY, 2006
BOEL ET AL., EMBO J, vol. 3, 1984, pages 1581 - 1585
C. MADZAK; J.M. NICAUD; C. GAILLARDIN: "Production of Recombinant Proteins. Novel Microbial and Eucaryotic Expression Systems", 2005
CAMPBELL ET AL., MOLECULAR MICROBIOLOGY, vol. 47, no. 3, 2003, pages 793 - 805
CHENNA R.; SUGAWARA H.; KOIKE T.; LOPEZ R.; GIBSON T.J.; HIGGINS D.G.; THOMPSON J.D.: "Multiple sequence alignment with the Clustral series of programs", NUCLEIC ACIDS RES., vol. 31, 2003, pages 3497 - 3500, XP002316493, DOI: doi:10.1093/nar/gkg500
DATABASE UNIPROT 24 July 2007 (2007-07-24), "ABCP01000001, 512 amino acid sequence", XP003027092, accession no. EMBL Database accession no. A6EVI7 *
DAVIS ET AL., BASIC METHODS IN MOLECULAR BIOLOGY, 1986
DEBOER ET AL., PROC. NATL ACAD. SCI. USA, vol. 80, 1993, pages 21 - 25
HENAUT; DANCHIN ET AL.: "Escherichia coli and Salmonella", 1996, ASM PRESS, pages: 2047 - 2066
HENIKOFF; HENIKOFF, PROC NATL ACAD SCI USA, vol. 89, 1989, pages 10915
INSECT BIOCHEM. MOL BIOL., vol. 39, no. 2, 26 October 2008 (2008-10-26), pages 90 - 5
J.J. LI; C. LIMBERAKIS; D.A. PFLUM: "Modern Organic Synthesis in the Laboratory", 2007, OXFORD UNIVERSITY PRESS, pages: 81 - 83
LATHE ET AL., GENE, vol. 57, 1987, pages 193 - 201
MADZAK, C. ET AL.: "Production of Recombinant Proteins Novel Microbial and Eukaryotic Expression Systems", 2003, article "Yarrowia lipolytica", pages: 163 - 189
MCINERNEY, J. 0, BIOINFORMATICS, vol. 14, 1998, pages 372 - 73
METZ ET AL., PLANT PHYSIOLOGY, vol. 122, 2000, pages 635 - 644
MORGAN-KISS ET AL., J. BIOL. CHEM., vol. 279, 2004, pages 37324 - 37333
MOTO ET AL., PROC. NAT'L ACAD. SCI USA, vol. 100, no. 16, 2003, pages 9156 - 9161
MOTO ET AL., PROC. NAT'L ACAD. SCI., vol. 100, 2003, pages 9156 - 61
MOUNT, D.: "Bioinformatics: Sequence and Genome Analysis", 2001, COLD SPRING HARBOR LABORATORY PRESS
NAKAMURA ET AL., NUCL. ACIDS RES., vol. 28, 2000, pages 292
NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443
NEVOIGT ET AL., APPL. ENVIRON. MICROBIOL., vol. 72, 2006, pages 5266 - 5273
NOTREDAME; HIGGINS; HERINGA: "T-COFFEE: A novel method for multiple sequence alignments", JMB, vol. 302, 2000, pages 205 - 217, XP004469125, DOI: doi:10.1006/jmbi.2000.4042
NUNBERG ET AL., MOL. CELL BIOL., vol. 4, 1984, pages 2306 - 2315
PARK, J. BACTERIOL., vol. 187, no. 4, 2005, pages 1426 - 1429
PEARSON; LIPMAN, PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 2444
PLANT PHYSIOL., vol. 122, no. 3, March 2000 (2000-03-01), pages 635 - 44
PLANT PHYSIOL., vol. 166, no. 8, 4 December 2008 (2008-12-04), pages 787 - 96
PNAS, vol. 100, no. 16, 2003, pages 9156 - 9161
PROC NATL ACAD SCI USA, vol. 100, no. 16, 18 July 2003 (2003-07-18), pages 9156 - 61
R.D. FINN ET AL., NUCL. ACIDS RES. DATABASE, vol. 36, 2008, pages D281 - D288
REISER ET AL., J. BACTERIOL., vol. 179, no. 9, 1997, pages 2969 - 2975
ROMANOS ET AL., YEAST, vol. 8, 1992, pages 423 - 488
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 2001, COLD SPRING HARBOR LABORATORY PRESS
SCHIRMER, CURRENT OPINION IN MICROBIOLOGY, vol. 12, 2009, pages 274 - 281
See also references of EP2449124A4
SMITH; WATERMAN, ADV. APPL. MATH., vol. 2, 1981, pages 482
STEEN ET AL., NATURE, vol. 463, 2010, pages 559 - 563
STENICO ET AL., NUCLEIC ACIDS RES., 1994, pages 222437 - 46
TIJSSEN: "Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes", 1993, ELSEVIER
TIWARI ET AL., COMPUT. APPL. BIOSCI., vol. 13, 1997, pages 263 - 270
TSUJITA ET AL., J. BIOCHEM., vol. 126, no. 6, 1999, pages 1074 - 1079
UBERBACHER, E. C., METHODS ENZYMOL., vol. 266, 1996, pages 259 - 281
VILLA-KAMAROFF ET AL., PROC. NATL ACAD. SCI. USA, vol. 75, 1978, pages 3727 - 3731
WADA ET AL., NUCLEIC ACIDS RES., vol. 20, 1992, pages 2111 - 2118
WAHLEN ET AL., APPLIED ENVIRONMENTAL MICROBIOLOGY, vol. 75, 2009, pages 2758 - 2764
WINZELER ET AL., SCIENCE, vol. 285, 1999, pages 901 - 906
WRIGHT, F., GENE, vol. 87, 1990, pages 23 - 29

Cited By (31)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8394614B2 (en) 2008-10-23 2013-03-12 Matrix Genetics, Llc Modified photosynthetic microorganisms for producing triglycerides
US8394621B2 (en) 2008-10-23 2013-03-12 Matrix Genetrics, LLC Modified photosynthetic microorganisms for producing triglycerides
US9029120B2 (en) 2008-10-23 2015-05-12 Matrix Genetics, Llc Modified photosynthetic microorganisms for producing triglycerides
US8835137B2 (en) 2008-12-23 2014-09-16 Matrix Genetics, Llc Modified photosynthetic microorganisms with reduced glycogen and their use in producing carbon-based products
US8980613B2 (en) 2010-04-06 2015-03-17 Matrix Genetics, Llc Modified photosynthetic microorganisms for producing lipids
WO2012006114A2 (en) 2010-06-28 2012-01-12 Codexis, Inc. Fatty alcohol forming acyl reductases (fars) and methods of use thereof
US9163221B2 (en) 2010-06-28 2015-10-20 Codexis, Inc. Fatty alcohol forming acyl reductases (FARs) and methods of use thereof
US8574878B2 (en) 2010-06-28 2013-11-05 Behnaz Behrouzian Fatty alcohol forming acyl reductases (FARs) and methods of use thereof
EP2585587A4 (en) * 2010-06-28 2014-09-03 Codexis Inc Fatty alcohol forming acyl reductases (fars) and methods of use thereof
US9738912B2 (en) 2010-12-23 2017-08-22 Shell Oil Company Gene disruptants producing fatty acyl-CoA derivatives
US9157103B2 (en) 2010-12-23 2015-10-13 Shell Oil Company Gene disruptants producing fatty acyl-CoA derivatives
US8975061B2 (en) 2011-06-30 2015-03-10 Exxonmobil Research And Engineering Company Regulation of toxin and antitoxin genes for biological containment
DE102011110946A1 (en) 2011-08-15 2016-01-21 Evonik Degussa Gmbh Biotechnological synthesis of omega-functionalized carboxylic acids and carboxylic acid esters from simple carbon sources
WO2013024111A1 (en) 2011-08-15 2013-02-21 Evonik Degussa Gmbh Biotechnological synthesis process of organic compounds with the aid of an alkl gene product
WO2013024114A2 (en) 2011-08-15 2013-02-21 Evonik Degussa Gmbh Biotechnological synthesis process of omega-functionalized carbon acids and carbon acid esters from simple carbon sources
DE102011110945A1 (en) 2011-08-15 2013-02-21 Evonik Degussa Gmbh Biotechnological synthesis of organic compounds with alkIL gene product
CN102952818A (en) * 2011-08-26 2013-03-06 中国科学院青岛生物能源与过程研究所 Construction body and method for improving fatty alcohol yield in cyanobacteria
CN102952818B (en) * 2011-08-26 2016-03-02 中国科学院青岛生物能源与过程研究所 For improving construct and the method for fatty alcohol yield in cyanobacteria
WO2013049423A1 (en) 2011-09-27 2013-04-04 Synthetic Genomics, Inc. Production and secretion of fatty acids and fatty acid derivatives
US9017975B2 (en) 2011-09-27 2015-04-28 Synthetic Genomics, Inc. Production and secretion of fatty acids and fatty acid derivatives
US8921090B2 (en) 2011-09-27 2014-12-30 Exxonmobil Research And Engineering Company Acyl-ACP wax ester synthases
WO2013096082A1 (en) * 2011-12-20 2013-06-27 Codexis, Inc. Fatty alcohol forming acyl reductase (far) variants and methods of use
US9447436B2 (en) 2011-12-20 2016-09-20 Codexis, Inc. Production of saturated fatty alcohols from engineered microorganisms
US8962299B2 (en) 2012-02-29 2015-02-24 Exxonmobil Research And Engineering Company Four-gene pathway for wax ester synthesis
US9714437B2 (en) 2012-04-20 2017-07-25 Codexis, Inc. Production of fatty alcohols from engineered microorganisms
US9650655B2 (en) 2012-07-20 2017-05-16 Codexis, Inc. Production of fatty alcohols from engineered microorganisms
JP2015534831A (en) * 2012-11-09 2015-12-07 キャリスタ, インコーポレイテッド Compositions and methods for biological production of fatty acid derivatives
US9512447B2 (en) 2012-12-14 2016-12-06 Codexis, Inc. Modified native beta-ketoacyl-ACP synthases and engineered microorganisms
US12447202B2 (en) 2018-05-17 2025-10-21 Lumen Bioscience, Inc. Arthrospira platensis oral vaccine delivery platform
US12252513B2 (en) 2018-07-16 2025-03-18 Lumen Bioscience, Inc. Thermostable phycobiliproteins produced from recombinant arthrospira
US12503682B2 (en) 2019-07-03 2025-12-23 Lumen Bioscience, Inc. Arthrospira platensis non-parenteral therapeutic delivery platform

Also Published As

Publication number Publication date
CN102471781B (en) 2015-03-18
BRPI1013277A2 (en) 2016-10-11
US8574877B2 (en) 2013-11-05
RU2012102900A (en) 2013-08-10
US20140099686A1 (en) 2014-04-10
US20110000125A1 (en) 2011-01-06
CN102471781A (en) 2012-05-23
US20130040352A1 (en) 2013-02-14
US8216815B2 (en) 2012-07-10
US8883467B2 (en) 2014-11-11
EP2449124A4 (en) 2013-04-10
CA2766585C (en) 2016-03-01
EP2449124A1 (en) 2012-05-09
CA2766585A1 (en) 2011-01-20
EP2449124B1 (en) 2015-05-27

Similar Documents

Publication Publication Date Title
US8883467B2 (en) Production of fatty alcohols with fatty alcohol forming acyl-CoA reductases (FAR)
US9157103B2 (en) Gene disruptants producing fatty acyl-CoA derivatives
US8574878B2 (en) Fatty alcohol forming acyl reductases (FARs) and methods of use thereof
EP2432890B1 (en) Engineered biosynthesis of fatty alcohols
US20150259714A1 (en) Systems and methods for production of mixed fatty esters
WO2009042950A1 (en) Reduction of the toxic effect of impurities from raw materials by extractive fermentation
US20110146142A1 (en) Systems and methods for production of mixed fatty esters
WO2010127318A2 (en) Product of fatty acid esters from biomass polymers
KR20140033378A (en) Genetically engineered microorganisms that metabolize xylose
US20140357727A1 (en) Fatty alcohol forming acyl reductase (far) variants and methods of use
US20160362710A9 (en) Systems and methods for production of mixed fatty esters
US20160052846A1 (en) Method of demulsifying and purifying organic products from an emulsion

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201080029116.8

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10800295

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2010800295

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2766585

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 9937/CHENP/2011

Country of ref document: IN

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2012102900

Country of ref document: RU

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: PI1013277

Country of ref document: BR

REG Reference to national code

Ref country code: BR

Ref legal event code: B01E

Ref document number: PI1013277

Country of ref document: BR

REG Reference to national code

Ref country code: BR

Ref legal event code: ERR

Ref document number: PI1013277

Country of ref document: BR

Free format text: FOI ANULADA A PUBLICACAO 1.5 DA RPI 2373 DE 28/06/2016 POR TER SIDO INDEVIDA.

REG Reference to national code

Ref country code: BR

Ref legal event code: B01E

Ref document number: PI1013277

Country of ref document: BR

ENP Entry into the national phase

Ref document number: PI1013277

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20111222