WO2011007004A1 - Treatment of infections - Google Patents
Treatment of infections Download PDFInfo
- Publication number
- WO2011007004A1 WO2011007004A1 PCT/EP2010/060357 EP2010060357W WO2011007004A1 WO 2011007004 A1 WO2011007004 A1 WO 2011007004A1 EP 2010060357 W EP2010060357 W EP 2010060357W WO 2011007004 A1 WO2011007004 A1 WO 2011007004A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- recombinant
- fibrinogen binding
- protein
- amino acid
- fragment
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/305—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Micrococcaceae (F)
- C07K14/31—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Micrococcaceae (F) from Staphylococcus (G)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
Definitions
- the present invention relates to a recombinant fibrinogen binding protein clumping factor A (CIfA) variant or fragment thereof wherein the ability to bind fibrinogen compared to the non-mutated protein or fragment thereof is altered.
- the present invention also relates to improved microbial antigen vaccines, pharmaceutical compositions, immunogenic compositions and antibodies comprising the recombinant fibrinogen binding protein clumping factor A (CIfA) variant or fragment thereof and their use in the treatment of microbial infections, particularly those of bacterial origin, including Staphylococcal origin.
- MDR Multiple drug resistance
- Staphylococci are Gram-positive bacteria of spherical shape, usually arranged in grape-like irregular clusters. Some are members of the normal flora of the skin and mucous membranes of humans, others cause suppuration, abscess formation, a variety of pyogenic infections, and even fatal septicaemia. Pathogenic staphylococci often hemolyze blood, coagulate plasma, and produce a variety of extracellular enzymes and toxins.
- Staphylococcus has at least 30 species.
- the three main species of clinical importance are Staphylococcus aureus, Staphylococcus epidermidis, and Staphylococcus saprophytics.
- Staphylococcus aureus is coagulase-positive, which differentiates it from the other species.
- S. aureus is a major pathogen for humans. Almost every person has some type of S. aureus infection during a lifetime, ranging in severity from food poisoning or minor skin infections to severe life-threatening infections.
- the coagulase-negative staphylococci are normal human flora which sometimes cause infection, often associated with implanted devices, especially in very young, old and immunocompromised patients. Approximately 75% of the infections caused by coagulase-negative staphylococci are due to S. epidermidis. Infections due to Staphylococcus warneri, Staphylococcus hominis, and other species are less common.
- S. saprophytics is a relatively common cause of urinary tract infections in young women. Staphylococci produce catalase, which differentiates them from the streptococci. S. lugdunensis is also relevant in a clinical and is present in approximately 5 to 10% of cases of infective endocarditis.
- S. aureus colonization of the articular cartilage, of which collagen is a major component, within the joint space appears to be an important factor contributing to the development of septic arthritis. Hematogenously acquired bacterial arthritis remains a serious medical problem. This rapidly progressive and highly destructive joint disease is difficult to eradicate. Typically, less than 50% of the infected patients fail to recover without serious joint damage. S. aureus is the predominant pathogen isolated from adult patients with hematogenous and secondary osteomyelitis.
- Staphylococcus bacteria such as S. aureus are a major cause of infection.
- Initial localized infections of wounds or indwelling medical devices can lead to more serious invasive infections such as septicaemia, osteomyelitis, mastitis and endocarditis.
- plastic and metal surfaces become coated with host plasma and matrix proteins such as fibrinogen and fibronectin shortly after implantation.
- This ability of S. aureus and other staphylococcal bacteria to adhere to these proteins is essential to the initiation of infection.
- Vascular grafts, intravenous catheters, artificial heart valves, and cardiac assist devices are thrombogenic and prone to bacterial colonization. Of the staphylococcal bacteria, S. aureus is generally the most damaging pathogen of such infections.
- MSCRAMMs microbial surface components recognizing adhesive matrix molecules
- ECM extracellular matrix
- MSCRAMMs are found in many gram positive pathogens and their amino acid sequences are related, they have similar modular design and common binding domain organization. MSCRAMMs on the bacterial cell surface and ligands within the host tissue interact in a lock and key fashion resulting in the adherence of bacteria to the host. Adhesion is often required for bacterial survival and helps bacteria evade host defence mechanisms and antibiotic challenges. Once the bacteria have successfully adhered and colonized host tissues, their physiology is dramatically altered and damaging components such as toxins and enzymes are secreted. Moreover, the adherent bacteria often produce a biofilm and quickly become resistant to the killing effect of most antibiotics.
- MSCRAMMs that recognize a variety of matrix proteins. Ligand- binding sites in MSCRAMMs appear to be defined by relatively short contiguous stretches of amino acid sequences (motifs). Because a similar motif can be found in several different species of bacteria, it appears as though these functional motifs are subjected to interspecies transfer (Patti and Hook, Cur Opin Cell Biol, 6:752-758, 1994). In addition, a single MSCRAMM can sometimes bind several ECM ligands. MSCRAMMs can mediate infection by binding to proteins including Fibrinogen (Fg) and/or Fibronectin (Fn) etc. Fibrinogen and Fibronectin are proteins found in blood plasma and play key roles in hemostasis and coagulation.
- Fg Fibrinogen
- Fn Fibronectin
- Fibrinogen is composed of six polypeptide chains, two Aa, two B ⁇ and two ⁇ -chains.
- the C- terminal part of the ⁇ -chain is biologically important and interacts with the platelet integrin during platelet adherence and aggregation. It is this region which is also targeted by Staphylococcus aureus resulting in Fibrinogen-dependant cell clumping and tissue adherence.
- Staphylococcus aureus has several surface expressed proteins which stimulate platelet activation and aggregation.
- the Staphylococcus aureus MSCRAMM proteins include but are not limited to the following:
- Fibrinogen binding protein clumping factor A (CIfA);
- Fibrinogen binding protein clumping factor B (CIfB);
- Fibronectin-fibrinogen binding protein A FnBPA
- Fibronectin-fibrinogen binding protein B FnBPB
- Table 1 below outlines a selection of various Staphylococcus aureus cell wall-anchored surface proteins.
- Protein A (Spa) 508 Immunoglobulin, von Willebrand LPETG A
- Clumping factor A 933 Fibrinogen.complement factor I LPDTG A
- Clumping factor B 913 Fibrinogen, cytokeratin 10 LPETG A
- SasD 241 Unknown LPAAG A
- SasE/lsdA 354 Heme' LPKTG A
- IsdC 227 Heme NPQTN B a aa protein length in amino acids.
- Clumping factor A was the first Fibrinogen ⁇ -chain-binding S. aureus adhesin identified.
- Clumping factor A (ClfA)is a surface located protein of Staphylococcus aureus.
- CIfA is an important virulence factor of S. aureus. It contributes to the pathogenesis of septic arthritis and endocarditis.
- CIfA contains a 520 amino acid N-terminal A domain (the Fibrinogen Binding Region), which comprises three separately folded subdomains N1 , N2 and N3.
- the A domain is followed by a serine-aspartate dipeptide repeat region and a cell wall- and membrane-spanning region, which contains the LPDTG-motif for sortase-promoted anchoring to the cell wall.
- CIfA is present in practically all S. aureus strains (Peacock SJ, Moore CE, Justice A, Kantzanou M, Story L, Mackie K, O ' Neill G, Day NPJ (2002) Virulent combinations of adhesin and toxin genes in natural populations of Staphylococcus aureus. Infect lmmun 70:4987-4996).
- CIfA is a virulence factor for induction of septic arthritis in mice (Josefsson E., Hartford O., O'Brien L, Patti JM, Foster T (2001) Protection against experimental Staphylococcus aureus arthritis by vaccination with clumping factor A, a novel virulence determinant. J Infect Dis
- CIfA The Staphylococcus aureus fibrinogen binding protein CIfA has been isolated and characterized and is the subject of, for example, US Patent Nos. 6, 008, 341 and 6,177,084.
- CIfA and CIfB have an identical structural (3D) organization and approximately 27% amino acid identity.
- FnBPA has an approximately 25% amino acid identity to CIfA.
- Veronate® a donor-selected staphylococcal human immune globulin intravenous (IGIV) targeting CIfA and SdrG, performed poorly in phase III clinical trials and was withdrawn from trials. It is currently being re-evaluated to determine whether it is a viable treatment for Staphylococcal infections.
- the present invention is directed to providing an improved recombinant fibrinogen binding protein clumping factor A (CIfA), ideally for use in the therapy of bacterial infections.
- CIfA fibrinogen binding protein clumping factor A
- a recombinant fibrinogen binding protein clumping factor A (CIfA) or fragment thereof comprising at least part of the fibrinogen binding region, wherein amino acid residue D 321 or an amino acid adjacent to D 321 is mutated and the recombinant protein has reduced ability or lacks the ability to non-covalently bind fibrinogen compared to the non-mutated protein or fragment thereof.
- CIfA fibrinogen binding protein clumping factor A
- a recombinant fibrinogen binding protein clumping factor A (CIfA) or fragment thereof according to the invention for use in therapy.
- a recombinant fibrinogen binding protein, or fragment thereof, of the invention for use in the treatment or prophylaxis of microbial infections, including sepsis, septic arthritis and/or endocarditis, preferably caused by Staphylocci.
- a fourth aspect of the invention there is provided the use of the recombinant protein, or fragment thereof, of the invention in the manufacture of a medicament for the treatment or prophylaxis of a microbial infection, preferably caused by Staphylocci.
- a method of inducing an immune response in a patient comprising administering to the patient a recombinant protein, or fragment thereof, of the invention.
- a method of treating a patient having a microbial infection comprising administering a recombinant protein or fragment thereof, or vaccine comprising the recombinant protein or fragment thereof of the invention to a patient in need thereof.
- nucleic acid construct a nucleic acid construct, fusion protein, expression vector or host cell expressing the recombinant protein, or fragment thereof, of the invention.
- a vaccine comprising the recombinant protein, or fragment thereof, of the invention.
- an antibody raised against the recombinant protein, or fragment thereof, of the invention preferably in the form of a hyperimmune serum.
- an immunogenic pharmaceutical composition comprising the recombinant protein, or fragment thereof, of the invention, and a pharmaceutically acceptable adjuvant.
- an immunogenic composition comprising the step of adding the pharmaceutically acceptable excipient to the recombinant protein, or fragment thereof, of the invention.
- the terms "adhesin”, “MSCRAMM” and “cell-wall anchored proteins” will be understood to be interchangeable and cover all microbial derived ligand binding proteins. Ideally, these proteins bind fibrinogen, heme or haemoglobin, haptoglobin-haemoglobin, haemin, collagen and other such ligands.
- the term "MSCRAMM-like” proteins are intended to cover proteins or adhesins which have related amino acid sequences, similar modular design and/or common/similar binding domain organization to such MSCRAMM proteins, such as lsd proteins. Ideally, the MSCRAMM-like proteins have similar binding domain organization/modular design.
- MSCRAMM-like proteins may have at least 50%, preferably 60%, preferably 75%, more preferably 85%, even more preferably 95%, still more preferably 99% or more amino acid sequence identity with the MSCRAMM proteins. Any reference herein to MSCRAMM will be understood to be interchangeable with recombinant fibrinogen binding protein clumping factor A (CIfA).
- CIfA fibrinogen binding protein clumping factor A
- micro-organism includes but is not limited to organisms including bacteria, fungi, viruses, yeasts and/or moulds.
- immunologically effective amount covers those amounts which are capable of stimulating a B cell and/or T cell response.
- the improved recombinant fibrinogen binding protein clumping factor A or fragment thereof of the invention has reduced ability or lacks the ability to non-covalently bind fibrinogen compared to the wild type or non-mutated protein. It will also be understood that the recombinant fibrinogen binding protein clumping factor A fragment has substantially the same immunogenic activity as the full length protein. In this manner the fragment is capable of eliciting an immune response similar to that of the full length protein. It will also be understood that recombinant fibrinogen binding protein clumping factor A or fragment thereof is mutated or altered i.e. undergoes a nucleotide or amino acid substitution, insertion, deletion or addition at the residue of interest or adjacent to the residue of interest. The term "adjacent" is intended to cover an amino acid residue immediately adjacent or at a distance of 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids either side (N-or C-terminal) to the amino acid of interest.
- the MSCRAMM protein of the invention is a recombinant fibrinogen binding protein clumping factor A (CIfA) or fragment thereof comprising at least part of the fibrinogen binding region, wherein amino acid residue D 32I is substituted with tyrosine (D 32 iY) and the recombinant protein has reduced ability or lacks the ability to non- covalently bind fibrinogen, for use in therapy.
- CIfA fibrinogen binding protein clumping factor A
- Fibrinogen binding can be readily measured using conventional techniques used in the .Examples. We have found that the recombinant fibrinogen binding protein clumping factor A (CIfA) variant or fragment thereof of the invention has an altered ability to bind fibrinogen compared to a non-mutated or wild-type protein or fragment thereof.
- CIfA fibrinogen binding protein clumping factor A
- amino acid residues 221 to 559, covering the N2 and N3 regions, of CIfA play an important part in the binding to fibrinogen and are the minimal fibrinogen binding region.
- mutation of amino acid residues in this region results in an expressed protein which can be recognized by the host immune defences but lacks fibrinogen binding and hence, reduces the associated virulence.
- This region (the 339 amino acid fibrinogen binding domain) of CIfA has a specific 3D structure, a so-called DE-variant IgG fold, and is the minimum Fg-binding truncate which if altered (via substitution or deletion etc) can provide an improved therapy.
- the alteration to result in the loss of fibrinogen binding activity may take place by substitution, addition or insertion or deletion at either the nucleotide or amino acid level.
- the substitution negatively affects the 3D structure (e.g. of the so-called DE-variant IgG fold) of the protein or fragment so it can no longer bind fibrinogen.
- the nucleotide or amino acid substitution reduces the non-covalent interaction with fibrinogen, preferably by preventing ligand binding to the hydrophobic pocket separating N2 and N3 of Region A of the fibrinogen binding protein.
- the latching peptide region corresponding to amino acids 532 to 538 may be altered by substitution or deleted to prevent ligand binding.
- a truncate/fragment lacking the latching peptide region and optionally the remainder of the C- terminal protein residues, i.e. lacking amino acid residues 532 to 559, may be used.
- the fibrinogen /-chain peptide-binding site is located in a hydrophobic groove at the junction between N2 and N3 of CIfA.
- CIfA is a 993 amino acid protein, comprising a 520 amino acid fibrinogen binding domain (from amino acids 40 to 559).
- This fibrinogen binding domain is the N Terminal A domain comprising subregions N1 , N2 and N3.
- the entire fibrinogen region spanning N1 to N3 from amino acid 40 to amino acid 559 may be used in the invention.
- a truncate of the N1 to N3 region may be used, e.g. 221 to 559 (the minimal fibrinogen binding region), 221 to 531 (the minimal fibrinogen region without the latching peptide and following residues) etc.
- subregions N2 and N3, the minimal fibrinogen binding region may be used which correspond to amino acid residues 221 to 559.
- a fragment of these subregions may be used.
- the recombinant protein, or fragment thereof of the invention has reduced or lacks the ability to non-covalently bind its host ligand due to altered dock, lock and latching. One or more of the dock, lock or latching steps may be altered.
- the non-covalent binding that takes place during binding, via Dock, Lock and Latching (DLL), of the MSCRAMM or MSCRAMM-like protein (i.e. CIfA) to its ligand may be reduced or prevented.
- the minimal ligand binding domain comprises Region A subregions N1 to N3, specifically subregions N2 and N3 which comprise a variant Dev-lgG Ig fold.
- the variant Dev-lgG Ig fold is new variant of the immunoglobulin motif also called the DE-variant. It is postulated that a hydrophobic pocket formed between the two DEv-IgG domains of ClfA/B is the ligand-binding site for the fibrinogen ⁇ -chain. Essentially, the ligand binds to the hydrophobic groove separating N2 and N3.
- the unfolded peptide component of the ligand inserts into the groove located between the N2 and N3 subdomains.
- the latching peptide at the C-terminus of subdomain N3 undergoes a conformational change and inserts between two beta strands in subdomain N2, thus, locking the ligand in place.
- mutagenic substitution of residues Tyr256, Pro336, Tyr338 and Lys389 in the clumping factor which are proposed to contact the terminal residues 408 AGDV 411 of the fibrinogen y -chain, resulted in proteins with no or markedly reduced affinity for fibrinogen.
- the complete ligand binding protein, the ligand binding domain, the minimal ligand binding domain or a fragment thereof may be used.
- the use of truncated proteins of the ligand binding protein such as the ligand binding domain, the minimal ligand binding domain, or the use of fragments thereof is advantageous for ease of manufacture and overcoming other problems such as unwanted cleavage of the protein.
- the latching peptide, present in the minimal ligand binding domain may be deleted/removed or altered.
- the latching peptide in CIfA corresponds to Region A amino acids 532 to 538 and in CIfB to Region A amino acids 530-540 (Walsh et al (2004) JBC 279(49): 50691- 50699). These residues may be altered, substituted or removed/deleted in order to prevent the ligand binding to the MSCRAMM via DLL. In this way the DLL "latching" of the MSCRAMM to its ligand is prevented. This "latching" occurs by way of a non-covalant interaction.
- the latching peptide is removed in its entirety along with the remaining Region A C-terminal amino acid residues.
- the latching peptide region only is removed.
- the latching peptide region undergoes amino acid substitution to result in the reduction or prevention of ligand binding/latching.
- alterations in the ligand binding domain may take place at the amino acid level, by amino acid substitution or deletion, using either the full length protein, ligand binding domain, minimal ligand binding domain or fragment thereof.
- proteins or fragments thereof with sufficiently high homology to the ligand binding protein may also be used.
- High homology as defined herein occurs when at least 50%, preferably 60%, preferably 70%, preferably 80%, more preferably 90%, even more preferably 95%, still more preferably 95% to 99%, still more preferably 99% or more of the nucleotides or match over the entire length of the DNA sequence or when used in connection with amino acid sequences when the amino acid sequences are not identical but produce a protein having the same functionality and activity.
- these comments about high homology may also relate to the 3D structure of the protein, i.e. modular binding domain organization.
- the recombinant fibrinogen binding protein may optionally further comprise one or more nucleotide or amino acid residue substitutions, point mutations, insertions, deletions or additions in the fibrinogen binding region.
- the recombinant fibrinogen binding protein CIfA may comprise further amino acid substitutions wherein amino acid residue P 336 and/or Y 338 of the fibrinogen binding Region A is substituted with either serine or alanine to result in (CIfAP 336 S Y 338 A or 1"CIfAP 336 A Y 338 S. Th ⁇ choice of residues was based on the X-ray crystal structure of CIfA and the observation that individual changes to the proline or the tyrosine reduced binding affinity.
- this mutant CIfA protein (rClfA D 321 Y P 336 S Y 338 A and rClf A P 336 A Y 338 S) stimulated an immune response and can be used in the generation of a much more effective vaccine or antibody therapy.
- This substitution may take place in the full length fibrinogen binding protein, the fibrinogen binding region, the minimal fibrinogen binding region, or a fragment thereof.
- the recombinant fibrinogen binding protein clumping factor A (CIfA), or a fragment thereof comprising at least part of the fibrinogen binding region, comprises the amino acid substitutions wherein residue D 321 is substituted with tyrosine, P 336 and/or Y 338 are substituted with either serine and/or alanine.
- N residues N-terminal extension (6 x His tag and additional residues) comprise 6 His residues, followed by GIy and Ser. Additional C terminal residues comprise Lys followed by Leu (other additional N and C terminal residues may be used - depending on the primer used or N/C terminal tags required)
- Additional N residues (6 x His tag and additional residues) comprise 6 His residues, followed by GIy and Ser.
- Additional C terminal residues comprise Arg followed by Ser (other additional N and C terminal residues may be used - depending on the primer used or N/C terminal tags required))
- the recombinant Staphylococcal fibrinogen binding protein comprises the amino acid sequence according to any of SEQ ID Nos. 1 to 3 wherein residue D 321 is substituted with tyrosine (D 3 21Y) and optionally P 336 and/or Y 338 are substituted with either serine and/or alanine, or a fragment thereof.
- the fragment of the recombinant Staphylococcal fibrinogen binding protein comprises the amino acid sequence according to any of SEQ ID No. 4 to SEQ ID No. 11.
- SEQ ID Nos 4 and 5 correspond to the CIfA A domain N1 , N2, N3 only, rClfA D 321 Y P 336 S Y 338 A and rClfA P 336 A Y 338 S respectively as outlined in the table above.
- substitutions in the latch that are defective in the conformational change or beta strand complementation willl also be defective in ligand binding.
- the substitutions are in amino acid residues 532 to 538 which correspond to the latching peptide and affect the ability of the peptide to undergo conformational change, or bind the ligand or both.
- the alteration may comprise removing the amino acid residues 532 to 538 (delta latch peptide) altogether, to give similar results.
- a C-terminal truncation mutant lacking amino acid residues 532 to 559 (including the latching peptide residues) will also effect binding to the ligand.
- the recombinant fibrinogen binding protein may further comprise the amino acid substitution wherein amino acid residues Ala254, Tyr256, Pro336, Tyr338, Ne387, Lys389, Glu526 and/or Val527 are substituted with either Ala or Ser.
- the alteration may be in the form of a deletion, comprising the fibrinogen binding region without the latching peptide sequence (amino acids 532 to 538), to result in a recombinant fibrinogen binding protein without the ability to non-covalently bind fibrinogen.
- amino acid residues 221 to 531 of Region A of CIfA are used, which lack the latching peptide and following C-terminal residues.
- an amino acid substitution in the latching peptide amino acids 532 to 538 which prevents the DLL of the fibrinogen may be contemplated.
- substitution rClfA proteins (whether deletion mutants, substitutions or truncates) reduced virulence and disease outcome, and surprisingly induced less systemic inflammation that the wild type protein.
- the recombinant Staphylococcal fibrinogen binding protein, or fragment thereof, of the invention may be used in therapy, specifically in the treatment of microbial infections, preferably Staphylococci infections such as in the treatment of sepsis, septic arthritis and/or endocarditis or other similar conditions or disease states.
- the fibrinogen binding region of the protein is altered so that it no longer binds fibrinogen. As stated above, the alteration may take place at the nucleotide or amino acid level.
- proteins or fragments thereof with sufficiently high homology to the fibrinogen binding protein may also be used.
- High homology as defined herein occurs when at least 50%, preferably 60%, preferably 70%, preferably 80%, more preferably 90%, even more preferably 95%, still more preferably 95% to 99%, still more preferably 99% of the nucleotides match over the entire length of the DNA sequence or when used in connection with amino acid sequences when the amino acid sequences are not identical but produce a protein having the same functionality and activity. It will be understood that these comments about high homology may also relate to the 3D structure of the protein.
- the complete fibrinogen binding protein, the fibrinogen binding region, the minimal fibrinogen binding region, or a fragment thereof may be used.
- the use of truncated proteins or fragments thereof is advantageous for ease of manufacture and overcoming other problems such as unwanted cleavage of the protein.
- Such fragments should ideally comprise at least part of the fibrinogen binding region of the MSCRAMM.
- the advantages of using a truncated protein or fragment thereof of the, comprising for example one or more subdomains of the ligand-fibrinogen binding region only, relate to the ability to purify the protein at high yields without degradation.
- the CIfA protein fibrinogen binding region comprises 3 subregions, N1 , N2 and N3.
- the immunogenic fragment may comprise subregions N1 , N2 and/or N3 of the CIfA A Region or a fragment thereof.
- the fragment may comprise one or more of subdomains of Region A, N1 , N2 or N3.
- N2 and N3 may be used as this truncate is less likely to undergo proteolysis (a protease cleavage site has been reported between N1 and N2 in CIfA and CIfB) and can be expressed at higher levels in E. coli.
- N2 and N3 are the minimal fibrinogen binding region of CIf proteins.
- this altered fibrinogen binding protein without the ability to bind fibrinogen stimulates a greater immune response upon immunization than the wild type protein which binds to fibrinogen in the normal manner.
- this altered fibrinogen binding protein does not provoke systemic inflammation when expressed by S. aureus, thus, microbial virulence is decreased. Consequently, this altered protein which lacks the ability to bind fibrinogen can be advantageously used in the treatment of microbial infections.
- composition or vaccine comprising such an altered recombinant protein is more effective than a pharmaceutical composition or vaccine comprising the same recombinant protein in an unaltered (wild type) form, such as CIfA, CIfB, SdrG etc.
- the altered protein of the invention may be used in the generation of antibodies, including monoclonal, polyclonal, chimeric, humanized antibodies or fragments thereof, for use in the treatment of such microbial infections.
- Compositions may then be provided which include such antibodies, such as a hyperimmune serum, and these compositions may be used in the treatment of patients infected with Staphylococcus infections.
- the proteins or active fragments thereof may be used to inhibit the binding of Staphylococci to the extra-cellular matrix (ECM) and to prevent/treat Staphylococci infections in a patient.
- ECM extra-cellular matrix
- the proteins or active fragments thereof, and antibodies to the proteins are useful in the treatment of infections from Staphylococcal infections, for the development of vaccines for active or passive vaccination, and when administered as a pharmaceutical composition to a wound or a medical device, both the proteins and antibodies are useful as blocking agents to prevent microbial infection.
- these proteins or fragments thereof may be used in active vaccines, and the antibodies to these proteins in passive vaccines.
- the protein composition may be dispersed in a sterile, isotonic saline solution or other pharmaceutically acceptable adjuvant.
- the vaccine may be a DNA or protein vaccine.
- Immunization may take place by the injection of DNA, protein or antibodies.
- an attenuated live organism that includes and expresses the DNA may be administered.
- the amount of DNA, protein or antibodies that may be administered will depend on several mitigating factors, including dependence on the promoter strength, protein expression and immunogenicity of the expressed gene. These may be altered for each new application to obtain the desired immunologically effective amount required.
- a method of inducing an immune response in an individual and/or treating a patient having a microbial infection comprising administering to the individual a recombinant Staphylococcal fibrinogen binding protein, or fragment thereof comprising at least the fibrinogen binding region, without the ability to bind fibrinogen.
- a vaccine comprising a recombinant Staphylococcal fibrinogen binding protein, or fragment thereof comprising at least part of the fibrinogen binding region, without the ability to bind fibrinogen.
- an immunogenic pharmaceutical composition comprising a recombinant Staphylococcal fibrinogen binding protein, or fragment thereof comprising at least part of the fibrinogen binding region, without the ability to bind fibrinogen and a pharmaceutically acceptable adjuvant.
- the recombinant Staphylococcal fibrinogen binding protein or fragment thereof is derived from S. aureus, S. epidermidis and/or S. lugdunensis.
- Figure 1 shows the severity of arthritis (A), measured as arthritic index, and weight loss (B) in mice inoculated with S. aureus strain Newman, and clfAPYl, clfAPYU, and elf A null mutants.
- A severity of arthritis
- B weight loss
- Figure 2 shows the bacterial growth in kidneys in mice 7-8 days after inoculation with 3.2 x
- Figure 3 shows the survival of mice after inoculation with 5.2, 5.1 or 3.3 x 10 7 cfu of
- N 10 per group from start.
- Figure 4 shows the survival of mice after inoculation with 9.4, 7.9, 10.7 or 9.8 x 10 6 cfu of
- N 15 per group from start.
- Figure 9 shows the severity of arthritis measured as arthritic index in mice immunized with
- Figure 10 gives the nucleotide and amino acid sequence of wild-type CIfA A domain protein
- Figure 11 shows an illustrative representation of the structure of FnBPA, CIfB, CIfA and SdrG proteins.
- Region A is the fibrinogen binding region
- S is the signal sequence
- W is the cell wall spanning domain
- M is the membrane anchor including the LPXTG motif
- + represent positively charged residues
- R is the repeat region.
- CIfA Region A comprises N123 (not shown).
- the BCD region of FnBPA (and the shorter CD region of FnBPB - not shown) binds fibronectin.
- Figure 16 of Example 2 shows the specific antibody responses to recombinant ClfAPY221-559 in serum samples of mice immunized with bovine serum albumin (BSA), recombinant ClfA221-559 (rClfA221-559), or recombinant ClfAPY221-559 (rClfAPY221-559), 9 days after the second booster immunization.
- BSA bovine serum albumin
- rClfA221-559 recombinant ClfAPY221-559
- rClfAPY221-559 recombinant ClfAPY221-559
- Figure 17 of Example 2 shows the specific antibody responses to recombinant ClfA221-
- Figure 19 gives the nucleotide and amino acid sequence of CIfA 40 - SS g D321Y/P336S/Y338A (CIfAPYI).
- Figure 20 gives the nucleotide and amino acid sequence of CIfA 40 - SS g D321Y/P336S/Y338 A including N- and C-terminal extension (CIfAPYI).
- Figure 21 shows the results of Comparative Example 1.
- NMRI mice were obtained from Scanbur BK (Sollentuna, Sweden) and were maintained in the animal facility of the Department of Rheumatology, University of G ⁇ teborg, Sweden. G ⁇ teborg animal experiment ethical board approved the experiments. They were housed up to 10 animals per cage with a 12 h light-dark cycle, and were fed standard laboratory chow and water ad libitum. The animals were 6 to 16 weeks old at the start of the experiments.
- Bacteria were grown on blood agar plates for 48 h, harvested, and kept frozen at -2O 0 C in PBS containing 5% (wt/vol) BSA (Sigma Chemicals) and 10% (vol/vol) dimethyl sulfoxide. Before injection into animals, the bacterial suspensions were thawed, washed in PBS, and adjusted to appropriate cell concentrations. The number of viable bacteria was measured in conjunction with each challenge by cultivation on blood agar plates and counting colonies.
- rClfA 40-559 SEQ ID NO 3
- CIfA D 32I YP 336 SY 338 A may also be referred to as clfAPYI, rclfAPY or rclfAPYI (i.e clfAPYI 40-559) (SEQ ID NO 4) (triple mutant); and
- CIfA P 336 AY 338 S may also be referred to as clfAPYII, rclfAPYII (i.e. clfAPYII 40-559) (SEQ ID NO 5) (double mutant).
- R3 CATTTTCAGGGTCAATAGAAGCGGCCATGGTCAAAGTTGC
- Both pARM and pJH2 were transferred to RN4220 (15) by electroporation and subsequently transduced using phage 85 (16) to S. aureus Newman (14) and LS-1 (11).
- the plasmids were induced to insert into the chromosome and then excise, leaving the mutations in the chromosome of a proportion of transformants, generating Newman clfAPYl, Newman elf APYW, LS-1 clfAPYl and LS-1 clfAPYW.
- Transformants were screened for loss of the plasmid and a loss of fibrinogen-binding activity.
- Integrity of the clfA gene was verified by Southern hybridisation using a clfA probe (data not shown).
- Expression of an immunoreactive protein (CIfAPY) was verified by Western immunoblotting using anti-ClfA region A polyclonal rabbit antiserum (data not shown).
- the mutations were verified by PCR across the KprA-BamH ⁇ fragments from genomic DNA and commercial sequencing of the products.
- the about 700 bases of the elf A gene of strain LS- 1 that were sequenced were identical to the corresponding bases in the Newman elf A gene of strain Newman. Production of Recombinant CIfA and CIfAPY
- His-tagged recombinant CIfA region A, domains N123 (amino acids 40-559), was produced from pCF40 as previously described (17), with an additional polishing step through an anion-exchange column. Plasmid pCF77 PY (6) was used as template to clone c/MPYI domains N123 into pQE30 to generate pCF40PY. Using this plasmid, recombinant CIfAPY was also produced by nickel affinity chromatography and anion exchange chromatograpy, as was described for rClfA. Eluates were dialysed against two changes of PBS before concentration and freeze-drying.
- mice were infected by intravenous injection with 3.5 x 10 6 cfu/mouse of S.aureus strain Newman or with 4.3 x 10 6 cfu/mouse of Newman c/MPYI mutant, both in 200 ⁇ l PBS. Clinical arthritis and weight change was followed until day 7. Mice were sacrificed day 8, kidney growth of bacteria were assessed and serum IL-6 and total IgG levels were measured. Synovitis and bone destruction was studied histologically on the joints of fore and hind legs.
- mice were infected with 5.0 x 10 6 cfu, 6.0 x 10 6 cfu or 4.3 x 10 6 cfu of S.aureus strain Newman, clfAPY ⁇ mutant or Newman clfA::Erm R (clfA null mutant), respectively.
- Clinical arthritis and weight change was followed until day 7.
- Mice were sacrificed day 7, kidney growth of bacteria were assessed and serum IL-6 and total IgG levels were measured. Synovitis and bone destruction was studied histologically on the joints of fore and hind legs.
- mice were infected with 4.7 x 10 6 cfu, 3.2 x 10 6 cfu, 3.9 x 10 6 cfu or 4.8 x 10 6 cfu of S.aureus strain Newman, clfAPY ⁇ mutant, Newman elf APYW mutant or Newman elf A null mutant, respectively.
- Clinical arthritis and weight change was followed until day 7.
- Mice were sacrificed day 8 and kidney growth of bacteria were assessed. The outcome of the experiments 1-3 were very similar, so data were pooled and presented together.
- mice were injected intravenously with 5.2 x 10 7 cfu, 5.1 x 10 7 cfu or 3.3 x 10 7 cfu of S.aureus strain Newman, clfAPYl mutant or elf A null mutant, respectively. Mortality, weight change and clinical arthritis were followed until day 10.
- mice were infected with 9.4 x 10 6 cfu, 7.9 x 10 6 cfu, 10.7 x 10 6 cfu or 9.8 x 10 6 cfu of S.aureus strain LS-1 , LS-1 clfAPYl mutant, LS-1 clfAPYW mutant, or LS-1 elf A null mutant, respectively. Mortality, clinical arthritis and weight change was followed until day 16.
- One knee joint per mouse was injected with 2.4 x 10 4 cfu, 2.4 x 10 4 cfu, or 3.4 x 10 4 cfu of strain Newman wildtype, clfAPYl mutant or elf A knockout mutant, respectively, in 20 ⁇ l PBS.
- N 10 per group. Mice were sacrificed 3 days later, and the knee joints were collected for histopathological examination.
- mice per group were infected by i.v. injection of 4.0 x 10 6 cfu/mouse for induction of septic arthritis, or by 2.3 x 10 7 cfu/mouse for induction of sepsis.
- Clinical arthritis, weight change and mortality were followed for 11 and 15 days, respectively.
- Bacterial growth in kidneys was assessed in the septic arthritis experiment.
- the clinical evaluation was performed in a blinded manner. Each limb was inspected visually. The inspection yielded a score of 0 to 3 (0, no swelling and erythema; 1 , mild swelling and/or erythema; 2, moderate swelling and/or erythema; 3 marked swelling and/or erythema).
- the arthritic index was constructed by adding the scores from all four limbs of an animal. The overall condition of each mouse was also examined by assessing signs of systemic inflammation, i.e., weight decrease, reduced alertness, and ruffled coat. In cases of severe systemic infection, when a mouse was judged too ill to survive another 24 h, it was killed by cervical dislocation and considered dead due to sepsis. Histological examination
- Histological examination of joints was performed using a modification (8) of a previously described method (18).
- Kidneys were aseptically dissected, kept on ice, homogenised, serially diluted in PBS and spread on blood agar plates. After 24 h of incubation in 37°C the number of cfu per kidney pair was determined.
- Serum samples from immunized mice were obtained 9 days after the second booster immunization.
- the serum specific antibody response against rClfA and rClfAPY was measured by ELISA.
- Microplates (96-well; Nunc) were coated with 5 ⁇ g/ml of recombinant protein in PBS. Blocking agent, serum samples, biotinylated antibodies, and ExtrAvidin-proxidase were all diluted in PBS.
- the assay was run according to a previous description (8). All serum samples were diluted 1 :20000, and antibody response was monitored as absorbance at 405 nm.
- Amino acids (D321 , P336 and/or Y338) that are known to be required for fibrinogen binding by CIfA were altered by allelic exchange to create mutants of strains Newman and LS1 that expressed a non-fibrinogen-binding CIfA protein on the cell surface.
- the level of expression and integrity of the protein was measured by Western blotting which established that there was good expression of the mutant proteins on the bacterial surface and expressed protein was the right size.
- the ability of Newman wild-type and Newman elf A D 32I Y, P 336 S Y 338 A (clfAPY ⁇ ) to provoke septic arthritis was investigated.
- Septic arthritis was induced by intravenous inoculation of 3.5 x 10 6 to 5.0 x 10 6 colony-forming units (cfu) and 3.2 x 10 6 to 6.0 x 10 6 cfu of Newman wild-type and the clfAPYl mutant, respectively.
- the development of arthritis was studied clinically for 7 days.
- the clfAPY ⁇ mutant provoked significantly less severe arthritis than the wild-type strain over the entire experimental period (P > 0.001 , Fig. 1 A).
- the frequency of arthritis was lower for Newman clfAPYl at most time points (Fig. 6).
- CIfA is involved in the development of arthritis by mechanisms that do not involve fibrinogen binding.
- a CIfA deletion mutant lacking the CIfA protein was compared to mutants expressing the modified non-fibrinogen binding CIfA protein.
- mice that were infected with 4.3 x 10 6 to 4.8 x 10 6 cfu of elf A null mutant developed arthritis in a manner not different from the clfAPYl and elf APYU mutant infected mice (Fig. 1 A). The frequency of arthritis was also indistinguishable (Fig. 6).
- mice infected with the Newman wild-type strain lost up to about 30% of their body weight during the experimental period.
- the Newman clfA null mutant had an intermediate effect on the weight loss, causing significantly less than the wild-type strain, but significantly more than the clfAPYi and elf APYW mutant strains (P ⁇ 0.02 in most cases, Fig. 1 B).
- the serum levels of IL-6 were analyzed at day 7- 8 of infection.
- the pattern of IL-6 expression was similar to weight changes.
- Newman wild-type evoked high levels of serum IL-6 (4.8 (2.8, 5.7) ng/ml)
- the Newman clfAPYi mutant evoked considerably lower IL-6 (0.2 (0.07, 2.4) ng/ml, P ⁇ 0.0001)
- mice on day 7-8 of infection There was a significantly lower increase of IgG levels in both the Newman clfAPYi- and Newman clfA null mutant-infected groups as compared to mice infected with the wild-type strain (3.1 (1.2, 4.9); 2.3 (1.0, 2.6); and 6.4 (5.0, 11.0), respectively (median, interquartile range); P ⁇ 0.0003). There were no significant differences between the two mutant groups. The mortality was 17% in the Newman wild type-infected mice, 0% in the Newman elf APW and clfAPYW mutant groups and 30% in the Newman clfA null mutant group.
- mice were infected with 5.2 x 10 7 cf u of Newman wild type, 5.1 x 10 7 cfu of the Newman clfAPY ⁇ mutant and 3.3 x 10 7 cfu of the Newman clfA null mutant.
- mice were infected with 5.2 x 10 7 cf u of Newman wild type, 5.1 x 10 7 cfu of the Newman clfAPY ⁇ mutant and 3.3 x 10 7 cfu of the Newman clfA null mutant.
- Within 5 days all wild-type infected mice were dead, but only one C/ ⁇ 4PYI mutant mouse out of ten were dead after 10 days of infection (P ⁇ 0.0001 , Fig. 3).
- Mice infected with the clfA null mutant also survived a significantly shorter time than the clfAPY ⁇ mutant- infected mice (P ⁇ 0.0001 , Fig. 3).
- mice challenged with the clfA null mutant developed significantly more arthritis than the clfAPYl mutant group, while at the same time they lost significantly more weight (Fig. 7 and 8).
- the survival of the mice is prolonged if the CIfA molecule is expressed, as long as it lacks fibrinogen binding properties.
- Newman wild- type, Newman clfAPY ⁇ or Newman clfA null were injected directly into a knee joint of mice, thereby by-passing the systemic compartment.
- Synovitis including polymorphonuclear infiltration of the joint cavity, and bone destruction was studied by histology 3 days later.
- the mice received 2.4 x 10 4 cfu of wild-type, 2.4 x 10 4 cfu of the clfA null mutant, or 3.4 x 10 4 cfu of clfAPY ⁇ mutant in one knee.
- the synovitis and the polymorphonuclear infiltration histologic index in the joint cavity was 0.25 (0, 3.0) for knees infected with wild-type, 2.38 (0.25, 3.0) for the clfA null mutant and 0.25 (0, 0.25) for the clfAPY ⁇ mutant (median, interquartile range).
- the clfAPYl, clfAPYU and elf A null mutations were transduced to the TSST-1 expressing S. aureus strain LS-1.
- Mice were challenged with 9.4 x 10 6 cfu of LS-1 wild-type, 7.9 x 10 6 cfu of LS-1 clfAPY ⁇ , 10.7 x 10 6 cfu of LS-1 elf APYW, or 9.4 x 10 6 cfu of the LS-1 elf A null mutant. Sepsis was studied by following the survival rate.
- mice challenged with the wild-type strain were alive while 90% of the mice challenged with the clfAPYl mutant and elf A null mutant groups and 80% mice infected with the ctf APYIl mutant were alive (Fig. 4).
- Fibrinogen mediated inhibition of neutrophil phagocytosis by CIfA could explain at least in part the more pronounced virulence of wildtype S. aureus compared to the clfAPY mutants. Binding of fibrinogen to CIfA could decrease opsonophagocytosis by neutrophils by reducing opsonin deposition or access to opsonins by neutrophil receptors. Alternatively bound fibrinogen might block the binding of an unknown protective host factor to S. aureus. Another option is that the fibrinogen - CIfA interaction promotes bacterial passage from blood vessel into the tissue or promotes colonization in tissues.
- the clfA knockout mutant protected against septic death to the same degree as the clfAPY mutation in S. aureus strain LS-1 , but protected less, if at all, in strain Newman.
- the overall impact of CIfA expression on bacterial virulence could differ between different S. aureus strains depending on the level of expression and the presence of other virulence factors.
- rClfA A region truncate comprising N2 and N3 (rClfA 221-559)
- mice were immunized with rClfA 221-559, rClfAPYI 221-559 or BSA in accordance with the protocol of Example 1.
- Second booster immunization with 30 ⁇ g of protein in physiologic saline in incomplete Freund ' s adjuvant was performed on day 12. Second booster immunization was done day 22. On day 31 the mice were bled and sera were frozen for later analysis of antibody responses.
- Serum samples from immunized mice were obtained 9 days after the second booster immunization.
- the serum specific antibody response against rClfA221-559 and rClfAPYI221-559 was measured by ELISA.
- Microplates (96-well; Nunc) were coated with 5 ⁇ g/ml of recombinant protein in PBS. Blocking agent, serum samples, biotinylated antibodies, and ExtrAvidin-proxidase were all diluted in PBS.
- the assay was run according to a previous description (8). All serum samples were diluted 1 :5000, 1 :20000, 1 :80000 and 1 :320000, and antibody response was monitored as absorbance at 405 nm.
- the antibody response was measured by absorbance in an ELISA-assay, as per Example 1 , with four different serum dilutions. The data obtained was very similar to the data in the Example 1.
- Example 1 The protocols outlined in Example 1 were followed in this example which utilized the following construct: - rClfA 221 -531 (i.e. rClf A A region truncate comprising N2 and N3 amino acids 220-
- mice There were 15 female NMRI mice in the group who were 8 weeks old at start of experiment.
- the above construct was used for immunization.
- the mice were immunized with the above truncate in accordance with the protocol of Example 1.
- rClfA221-531 was dissolved in PBS and emulsified 1 :1 in Freund ' s complete adjuvant. Two hundred ⁇ l of the emulsion containing 0.79 nmol of protein was injected s.c. on day 0. First booster immunization with 0.79 nmol of protein in physiologic saline in incomplete Freund ' s adjuvant was performed on day 12. Second booster immunization was done day 22. On day 31 the mice were bled and sera were frozen for later analysis of antibody responses. Specific antibodies - ELiSA
- Serum samples from immunized mice were obtained 9 days after the second booster immunization.
- the serum levels of specific antibodies was measured by ELISA.
- Microplates (96- well; Nunc) were coated with 4.6 ⁇ g/ml of rClfA221-531 protein which is equimolar to 5 ⁇ g/ml of rClfA221-559 and rClfAPYI221-559 from Examples 1 and 2.
- Blocking agent, serum samples, biotinylated antibodies, and ExtrAvidin-proxidase were all diluted in PBS. The assay was run according to a previous description (8). All serum samples were diluted 1 :5000, 1 :20000, 1 :80000 and 1 :320000, and antibody response was monitored as absorbance at 405 nm.
- the antibody response was measured by absorbance in an ELISA-assay, as per Example 1. It was found that rClfA221-531 immunization gave rise to an immune response, measured as a specific antibody response ( Figure 18).
- a HiT rap Chelating HP column (GE Healthcare) was charged with 150 mM Ni 2+ and equilibrated with binding buffer. The cleared lysate was applied to the column and the column was then washed with binding buffer. Bound protein was eluted with a continuous linear gradient of imidazole (5 - 100 mM) in 0.5 M NaCI, 20 mM Tris-HCI (pH 7.9).
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Veterinary Medicine (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Gastroenterology & Hepatology (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Rheumatology (AREA)
- Heart & Thoracic Surgery (AREA)
- Physical Education & Sports Medicine (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Pain & Pain Management (AREA)
- Cardiology (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
Description
Claims
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA2768485A CA2768485C (en) | 2009-07-16 | 2010-07-16 | Treatment of staphylococci infections using recombinant fibrinogen binding protein clumping factor a |
| US13/384,234 US9353160B2 (en) | 2009-07-16 | 2010-07-16 | Method of prophlactically treating infection using a recombinant fibrinogen binding protein clumping factor A (ClfA) or fragment thereof |
| EP10734982.1A EP2453915B1 (en) | 2009-07-16 | 2010-07-16 | Treatment of infections |
| ES10734982.1T ES2625979T3 (en) | 2009-07-16 | 2010-07-16 | Infection treatment |
| AU2010272505A AU2010272505B2 (en) | 2009-07-16 | 2010-07-16 | Treatment of infections |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| IE2009/0549 | 2009-07-16 | ||
| IE20090549 | 2009-07-16 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2011007004A1 true WO2011007004A1 (en) | 2011-01-20 |
Family
ID=42562487
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2010/060357 Ceased WO2011007004A1 (en) | 2009-07-16 | 2010-07-16 | Treatment of infections |
Country Status (6)
| Country | Link |
|---|---|
| US (1) | US9353160B2 (en) |
| EP (1) | EP2453915B1 (en) |
| AU (1) | AU2010272505B2 (en) |
| CA (1) | CA2768485C (en) |
| ES (1) | ES2625979T3 (en) |
| WO (1) | WO2011007004A1 (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012035508A2 (en) | 2010-09-15 | 2012-03-22 | Spinomix S.A. | Method for separating target molecules or particles from fibrinogen-containing samples including blood components |
| WO2013030378A1 (en) | 2011-09-01 | 2013-03-07 | Novartis Ag | Adjuvanted formulations of staphylococcus aureus antigens |
| US8568735B2 (en) | 2009-06-22 | 2013-10-29 | Wyeth Llc | Immunogenic compositions of Staphylococcus aureus antigens |
| US9090677B2 (en) | 2009-07-15 | 2015-07-28 | Genentech, Inc. | Gram-positive bacteria specific binding compounds |
| WO2019121926A1 (en) | 2017-12-21 | 2019-06-27 | Glaxosmithkline Biologicals Sa | Immunogenic composition |
| EP3777884A1 (en) | 2019-08-15 | 2021-02-17 | GlaxoSmithKline Biologicals S.A. | Immunogenic composition |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2015359503B2 (en) * | 2014-12-10 | 2019-05-09 | Glaxosmithkline Biologicals Sa | Method of treatment |
| US10738338B2 (en) | 2016-10-18 | 2020-08-11 | The Research Foundation for the State University | Method and composition for biocatalytic protein-oligonucleotide conjugation and protein-oligonucleotide conjugate |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6008341A (en) | 1994-08-22 | 1999-12-28 | The Provost, Fellows And Scholars Of The College Of The Holy And Undivided Trinity Of Queen Elizabeth Near Dublin | S. aureus fibrinogen binding protein gene |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU4810600A (en) | 1999-04-28 | 2000-11-10 | Provost, Fellows And Scholars Of The College Of The Holy And Undivided Trinity Of Queen Elizabeth Near Dublin, The | Method of inhibiting leukocyte adhesion to fibrinogen |
| CA2351018A1 (en) | 2001-07-09 | 2003-01-09 | Universite De Sherbrooke | Dna vaccine against staphylococcus aureus |
| JP2008502363A (en) | 2004-05-21 | 2008-01-31 | ワイス | Staphylococcus aureus modified fibronectin binding protein |
| SG188102A1 (en) | 2008-01-31 | 2013-03-28 | Trinity College Dublin | Treatment of microbial infections |
-
2010
- 2010-07-16 CA CA2768485A patent/CA2768485C/en not_active Expired - Fee Related
- 2010-07-16 EP EP10734982.1A patent/EP2453915B1/en active Active
- 2010-07-16 AU AU2010272505A patent/AU2010272505B2/en not_active Ceased
- 2010-07-16 ES ES10734982.1T patent/ES2625979T3/en active Active
- 2010-07-16 WO PCT/EP2010/060357 patent/WO2011007004A1/en not_active Ceased
- 2010-07-16 US US13/384,234 patent/US9353160B2/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6008341A (en) | 1994-08-22 | 1999-12-28 | The Provost, Fellows And Scholars Of The College Of The Holy And Undivided Trinity Of Queen Elizabeth Near Dublin | S. aureus fibrinogen binding protein gene |
| US6177084B1 (en) | 1994-08-22 | 2001-01-23 | The Provost, Fellows And Scholars Of The College Of The Holy And Undivided Trinity Of Queen Elizabeth Near Dublin | S. aureusfibrinogen binding protein |
Non-Patent Citations (32)
| Title |
|---|
| BREMELL T; ABDE NOUR A; TARKOWSKI A: "Histopathological and serological progression of experimental Staphylococcus aureus arthritis", INFECT IMMUN, vol. 60, 1992, pages 2976 - 2985 |
| BREMELL T; LANGE S; YACOUB A; RYDEN C; TARKOWSKI A: "Experimental Staphylococcus aureus arthritis in mice", INFECT IMMUN, vol. 59, 1991, pages 2615 - 2623 |
| CHAMBERS, H.F., CLIN MICROBIOL REV, vol. 1, 1988, pages 173 |
| DEIVANAYAGAM C C S ET AL: "A novel variant of the immunoglobulin fold in surface adhesins of Staphylococcus aureus: Crystal structure of the fibrinogen-binding MSCRAMM, clumping factor A", EMBO JOURNAL, OXFORD UNIVERSITY PRESS, SURREY, GB LNKD- DOI:10.1093/EMBOJ/CDF619, vol. 21, no. 24, 16 December 2002 (2002-12-16), pages 6660 - 6672, XP002523689, ISSN: 0261-4189 * |
| DEIVANAYAGAM CCS; WANN ER; CHEN W; CARSON M; RAJASHANKAR KR; HÖÖK M; NARAYANA SVL: "A novel variant of the immunoglobulin fold in surface adhesins of Staphylococcus aureus: crystal structure of the fibrinogen-binding MSCRAMM, clumping factor A", THE EMBO JOURNAL, vol. 21, 2002, pages 6660 - 6672 |
| DUTHIE ES; LORENZ LL: "Staphylococcal coagulase: mode of action and antigenicity", J GEN MICROBIOL, vol. 6, 1952, pages 95 - 107 |
| HARTFORD O M ET AL: "Identification of residues in the Staphylococcus aureus fibrinogen-binding MSCRAMM clumping factor A (ClfA) that are important for ligand binding.", THE JOURNAL OF BIOLOGICAL CHEMISTRY 26 JAN 2001 LNKD- PUBMED:11044451, vol. 276, no. 4, 26 January 2001 (2001-01-26), pages 2466 - 2473, XP002597989, ISSN: 0021-9258 * |
| HIGGINS J; LOUGHMAN A; VAN KESSEL KPM; VAN STRIJP JAG; FOSTER TJ: "Clumping factor A of Staphylococcus aureus inhibits phagocytosis by human polymorphonuclear leukocytes", FEMS MICROBIOL LETT, vol. 258, 2006, pages 290 - 296 |
| JOSEFSSON E.; HARTFORD O.; O'BRIEN L; PATTI JM; FOSTER T: "Protection against experimental Staphylococcus aureus arthritis by vaccination with clumping factor A, a novel virulence determinant", J INFECT DIS, vol. 184, 2001, pages 1572 - 1580 |
| JOSEFSSON ELISABET ET AL: "Fibrinogen binding sites P336 and Y338 of clumping factor A are crucial for Staphylococcus aureus virulence", PLOS ONE, PUBLIC LIBRARY OF SCIENCE, SAN FRANCISCO, CA, US LNKD- DOI:10.1371/JOURNAL.PONE.0002206, vol. 3, no. 5, 1 May 2008 (2008-05-01), pages E2206, XP002523693, ISSN: 1932-6203 * |
| KREISWIRTH BN; L6FDAHL S; BETLEY MJ; O'REILLY M; SCHLIEVERT PM; BERGDOLL MS; NOVICK RP: "The toxic shock syndrome exotoxin structural gene is not detectably transmitted by a prophage", NATURE, vol. 305, 1983, pages 709 - 712 |
| LOUGHMAN A; FITZGERALD JR; BRENNAN MP; HIGGINS J; DOWNER R; COX D; FOSTER TJ: "Roles of fibrinogen, immunoglobulin and complement in platelet activation promoted by Staphylococcus aureus clumping factor A", MOL MICROBIO, vol. 57, 2005, pages 804 - 818 |
| LOUGHMAN A; FITZGERALD JR; BRENNAN MP; HIGGINS J; DOWNER R; COX D; FOSTER TJ: "Roles of fibrinogen, immunoglobulin and complement in platelet activation promoted by Staphylococcus aureus clumping factor A", MOL MICROBIOL, vol. 57, 2005, pages 804 - 818 |
| MANCINI G; CARBONARA AO; HEREMANS JF: "Immunochemical quantitation of antigens by single radial immunodiffusion", IMMUNOCHEMISTRY, vol. 2, 1965, pages 235 - 254 |
| MCDEVITT D; FRANCOIS P; VAUDAUX P; FOSTER TJ: "Molecular characterization of the clumping factor (fibrinogen receptor) of Staphylococcus aureus", MOL MICROBIOL, vol. 11, 1994, pages 237 - 248 |
| MCDEVITT D; NANAVATY T; HOUSE-POMPEO K; BELL E; TURNER N; MCENTIRE L; FOSTER T; H66K M: "Characterization of the interaction between the Staphylococcus aureus clumping factor (CIfA) and fibrinogen", EUR J BIOCHEM, vol. 247, 1997, pages 416 - 424 |
| MCDEVITT D; NANAVATY T; HOUSE-POMPEO K; BELL E; TURNER N; MCENTIRE L; FOSTER T; HÖÖK M: "Characterization of the interaction between the Staphylococcus aureus clumping factor (CIfA) and fibrinogen", EUR J BIOCHEM, vol. 247, 1997, pages 416 - 424 |
| MULLIGAN, M.E. ET AL., AM J MED, vol. 94, 1993, pages 313 |
| O'BRIEN L; KERRIGAN SW; KAW G.; HOGAN M.; PENAD6S J.; LITT D.; FITZGERALD D.J.; FOSTER T.J.; COX D.: "Multiple mechanisms for the activation of human platelet aggregation by Staphylococcus aureus: roles for the clumping factors ClfA and ClfB, the serine-aspartate repeat protein SdrE and protein A", MOL MICROBIOL, vol. 44, 2002, pages 1033 - 1044 |
| O'BRIEN L; KERRIGAN SW; KAW G.; HOGAN M.; PENADÉS J.; LITT D.; FITZGERALD D.J.; FOSTER T.J.; COX D.: "Multiple mechanisms for the activation of human platelet aggregation by Staphylococcus aureus: roles for the clumping factors ClfA and ClfB, the serine-aspartate repeat protein SdrE and protein A", MOL MICROBIOL, vol. 44, 2002, pages 1033 - 1044 |
| O'CONNELL D P ET AL: "The fibrinogen-binding MSCRAMM (clumping factor) of Staphylococcus aureus has a Ca2+-dependent inhibitory site.", THE JOURNAL OF BIOLOGICAL CHEMISTRY 20 MAR 1998 LNKD- PUBMED:9506984, vol. 273, no. 12, 20 March 1998 (1998-03-20), pages 6821 - 6829, XP002597988, ISSN: 0021-9258 * |
| O'CONNELL DP; NANAVATY T; MCDEVITT D; GURUSIDDAPPA S; HÖÖK M; FOSTER TJ: "The fibrinogen-binding MSCRAMM (clumping factor) of Staphylococcus aureus has a Ca2++- dependent inhibitory site", J BIOL CHEM, vol. 273, 1998, pages 6821 - 6829 |
| PALMQVIST N; FOSTER T; FITZGERALD R; JOSEFSSON E; TARKOWSKI A: "Fibronectin-binding proteins and fibrinogen-binding clumping factors play distinct roles in staphylococcal arthritis and systemic inflammation", J INF DIS, vol. 191, 2005, pages 791 - 798 |
| PALMQVIST N; PATTI JM; TARKOWSKI A; JOSEFSSON E: "Expression of staphylococcal clumping factor A impedes macrophage phagocytosis", MICROB INFECT, vol. 6, 2004, pages 188 - 195 |
| PATTI, J. ET AL., ANN REV MICROBIOL, vol. 48, 1994, pages 585 - 617 |
| PATTI, J.; HOOK, M., CUR OPIN CELL BIOL., vol. 6, 1994, pages 752 - 758 |
| PATTI; HOOK, CUR OPIN CELL BIOL, vol. 6, 1994, pages 752 - 758 |
| PEACOCK SJ; MOORE CE; JUSTICE A; KANTZANOU M; STORY L; MACKIE K; O'NEILL G; DAY NPJ: "Virulent combinations of adhesin and toxin genes in natural populations of Staphylococcus aureus", INFECT IMMUN, vol. 70, 2002, pages 4987 - 4996 |
| SAKINIENE E; BREMELL T; TARKOWSKI A: "Addition of corticosteroids to antibiotic treatment ameliorates the course of experimental Staphylococcus aureus arthritis", ARTHRITIS RHEUMATISM, vol. 39, 1996, pages 1596 - 1605 |
| SAKINIENE E; BREMELL T; TARKOWSKI A: "Complement depletion aggravates Staphylococcus aureus septicaemia and septic arthritis", CLIN EXP IMMUNOL, vol. 115, 1999, pages 95 - 102 |
| VERDRENGH M; TARKOWSKI A: "Role of neutrophils in experimental septicemia and septic arthritis induced by Staphylococcus aureus", INFECT IMMUN, vol. 65, 1997, pages 2517 - 2521 |
| WALSH ET AL., JBC, vol. 279, no. 49, 2004, pages 50691 - 50699 |
Cited By (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8889145B2 (en) | 2009-06-22 | 2014-11-18 | Wyeth Llc | Immunogenic compositions of Staphylococcus aureus antigens |
| US9114105B2 (en) | 2009-06-22 | 2015-08-25 | Wyeth Llc | Immunogenic compositions of Staphylococcus aureus antigens |
| US8568735B2 (en) | 2009-06-22 | 2013-10-29 | Wyeth Llc | Immunogenic compositions of Staphylococcus aureus antigens |
| US9927428B2 (en) | 2009-07-15 | 2018-03-27 | Genentech, Inc. | Gram-positive bacteria specific binding compounds |
| US9090677B2 (en) | 2009-07-15 | 2015-07-28 | Genentech, Inc. | Gram-positive bacteria specific binding compounds |
| US9266943B2 (en) | 2009-07-15 | 2016-02-23 | Genentech, Inc. | Gram-positive bacteria specific binding compounds |
| US9399673B2 (en) | 2009-07-15 | 2016-07-26 | Genentech, Inc. | Gram-positive bacteria specific binding compounds |
| US9458228B2 (en) | 2009-07-15 | 2016-10-04 | Genentech, Inc. | Gram-positive bacteria specific binding compounds |
| US9688745B2 (en) | 2009-07-15 | 2017-06-27 | Genentech, Inc. | Gram-positive bacteria specific binding compounds |
| EP3067431A1 (en) | 2010-09-15 | 2016-09-14 | Debiopharm International S.A. | Device for separating target molecules or particles from fibrinogen-containing samples including blood components |
| US9689881B2 (en) | 2010-09-15 | 2017-06-27 | Spinomix S.A. | Method for separating target molecules or particles from fibrinogen-containing samples including blood components |
| WO2012035508A2 (en) | 2010-09-15 | 2012-03-22 | Spinomix S.A. | Method for separating target molecules or particles from fibrinogen-containing samples including blood components |
| WO2013030378A1 (en) | 2011-09-01 | 2013-03-07 | Novartis Ag | Adjuvanted formulations of staphylococcus aureus antigens |
| WO2019121926A1 (en) | 2017-12-21 | 2019-06-27 | Glaxosmithkline Biologicals Sa | Immunogenic composition |
| EP3777884A1 (en) | 2019-08-15 | 2021-02-17 | GlaxoSmithKline Biologicals S.A. | Immunogenic composition |
| WO2021028402A1 (en) | 2019-08-15 | 2021-02-18 | Glaxosmithkline Biologicals Sa | Immunogenic composition |
Also Published As
| Publication number | Publication date |
|---|---|
| ES2625979T3 (en) | 2017-07-21 |
| AU2010272505A1 (en) | 2012-02-02 |
| CA2768485C (en) | 2018-12-04 |
| EP2453915A1 (en) | 2012-05-23 |
| CA2768485A1 (en) | 2011-01-20 |
| US9353160B2 (en) | 2016-05-31 |
| AU2010272505B2 (en) | 2015-09-17 |
| US20120244189A1 (en) | 2012-09-27 |
| EP2453915B1 (en) | 2017-04-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11512118B2 (en) | Treatment of microbial infections | |
| CA2768485C (en) | Treatment of staphylococci infections using recombinant fibrinogen binding protein clumping factor a | |
| Nilsson et al. | Vaccination with a recombinant fragment of collagen adhesin provides protection against Staphylococcus aureus-mediated septic death. | |
| Götz | Staphylococci in colonization and disease: prospective targets for drugs and vaccines | |
| AU2013252888B2 (en) | Compositions and methods related to antibodies that neutralize coagulase activity during Staphylococcus aureus disease | |
| CN104768572B (en) | Staphylococcus coagulase antigen and method of use | |
| US20160074497A1 (en) | Staphylococcus live cell vaccines | |
| AU2012216332B8 (en) | Treatment of microbial infections | |
| Provenza et al. | Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin‐binding adhesins fibronectin‐binding protein A and fibronectin‐binding protein B from Staphylococcus aureus | |
| HK1152650A (en) | Treatment of microbial infections | |
| HK1152650B (en) | Treatment of microbial infections | |
| da Silva Lopes | Staphylococcus aureus escapes killing from extracellular histones through plasminogen binding and activation by staphylokinase or tissue plasminogen activator | |
| Cheng | Molecular mechanisms of Staphylococcus aureus infection and immunity |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10734982 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2010272505 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2768485 Country of ref document: CA |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REEP | Request for entry into the european phase |
Ref document number: 2010734982 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2010734982 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2010272505 Country of ref document: AU Date of ref document: 20100716 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13384234 Country of ref document: US |

