WO2011000905A1 - Substituted 2-carboxamide cycloamino ureas - Google Patents

Substituted 2-carboxamide cycloamino ureas Download PDF

Info

Publication number
WO2011000905A1
WO2011000905A1 PCT/EP2010/059352 EP2010059352W WO2011000905A1 WO 2011000905 A1 WO2011000905 A1 WO 2011000905A1 EP 2010059352 W EP2010059352 W EP 2010059352W WO 2011000905 A1 WO2011000905 A1 WO 2011000905A1
Authority
WO
WIPO (PCT)
Prior art keywords
methyl
alkyl
amιde
compound
substituted
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2010/059352
Other languages
French (fr)
Inventor
Robin Alec Fairhurst
Pascal Furet
Marc Gerspacher
Robert Mah
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novartis AG
Original Assignee
Novartis AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novartis AG filed Critical Novartis AG
Priority to EP10730435.4A priority Critical patent/EP2448935B1/en
Priority to EA201200086A priority patent/EA201200086A1/en
Priority to CA2766855A priority patent/CA2766855A1/en
Priority to AU2010268019A priority patent/AU2010268019A1/en
Priority to BRPI1015909A priority patent/BRPI1015909A2/en
Priority to MX2012000177A priority patent/MX2012000177A/en
Priority to CN2010800300379A priority patent/CN102471332A/en
Priority to JP2012518092A priority patent/JP2012531456A/en
Publication of WO2011000905A1 publication Critical patent/WO2011000905A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D417/00Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
    • C07D417/14Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing three or more hetero rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/425Thiazoles
    • A61K31/427Thiazoles not condensed and containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4427Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems
    • A61K31/4439Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. omeprazole
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/06Antihyperlipidemics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00Drugs for disorders of the endocrine system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid

Definitions

  • the present invention relates to substituted 2-carboxam ⁇ de cycloammo ureas, as new phosphatidyhnositol (Pl) 3-kinase inhibitor compounds their pharmaceutically acceptable salts, prodrugs thereof and processes for their production
  • This invention also relates to compositions of these compounds, either alone or in combination with at least one additional therapeutic agent, and optionally in combination with a pharmaceutically acceptable carrier
  • This invention still further relates to methods of use of these compounds either alone or in combination with at least one additional therapeutic agent, in the prophylaxis or treatment of a number of diseases, in particular, those mediated by one or more of abnormal activity of growth factors, receptor tyrosine kinases, protein senne/heroine kinases, G protein coupled receptors and phospholipid kinases and phosphatases
  • Phosphatidyhnositol 3-kinases comprise a family of lipid kinases that catalyze the transfer of phosphate to the D-3' position of inositol lipids to produce phospho ⁇ nos ⁇ tol-3- phosphate (PIP), phospho ⁇ nositol-3,4-d ⁇ phosphate (PIPa) and phosphoinos ⁇ tol-3,4,5- t ⁇ phosphate (PIP 3 ) that, in turn, act as second messengers in signaling cascades by docking proteins containing pleckst ⁇ n-homology, FYVE, Phox and other phospholipid-binding domains into a variety of signaling complexes often at the plasma membrane
  • Class 1 A PI3Ks are heterodimers composed of a catalytic p110 subunit (a, ⁇ , ⁇ isoforms) constitutively associated with a regulatory subunit that can be ⁇ 85 ⁇ , p55 ⁇ , p50 ⁇ , p85 ⁇ or p55 ⁇
  • the Class 1 B sub-class has one family member, a heterodtmer composed of a catalytic p110 ⁇ subunit associated with one of two regulatory subunits, p101 or p84 (Fruman et al , Annu Rev Biochem 67481 (1998), Suire et al , Curr Biol 15 566 (2005))
  • the modular domains of the p85/55/50 subunits include Src Homology (SH2) domains that
  • Akt the product of the human homologue of the viral oncogene v-Akt
  • PfP2 and PIP3 recruit Akt, the product of the human homologue of the viral oncogene v-Akt, to the plasma membrane where it acts as a nodal point for many intracellular signaling pathways important for growth and survival
  • Akt the product of the human homologue of the viral oncogene v-Akt
  • Aberrant regulation of PI3K which often increases survival through Akt activation, is one of the most prevalent events in human cancer and has been shown to occur at multiple levels
  • the tumor suppressor gene PTEN which
  • inhibitors of PI3Ks would be of particular value in the treatment of proliferative disease and other disorders
  • Selectivity towards the PI3K ⁇ isoform is desirable, and further desirable properties include improved pharmacokinetic properties and/or chemical stability
  • WO2004/096797 discloses certain thiazole derivatives as inhibitors of PI3 kinase and their use as pharmaceutical
  • WO 2005/021519 also discloses certain thiazole derivatives as inhibitors of PI3 kinase and their use as pharmaceutical
  • the substituted 2-carboxamide cycloamino ureas of the formula I given below have advantageous pharmacological properties and inhibit, for example, the PI3 kinases (phosphatidylmositol 3-kmase)
  • these compounds show selectivity for PI3K alpha versus beta and/or delta and/or gamma subtypes in the biochemical and/or in the cellular assay
  • a further property which is preferably desirable for compounds of formula I includes improved stability, for example, improved chemical stability e g in solid form and/or in buffer solution
  • the compounds of formula I are suitable, for example, to be used in the treatment of diseases depending on the PI3 kinase (in particular PI3K alpha, such as those showing somatic mutation of PIK3CA or germline mutations or somatic mutation of PTEN), especially prolife
  • the present invention provides compounds of formula
  • n 0 or 1
  • n 0 or 1
  • R 1 represents H, halogen, unsubstituted CrC 4 -alkyl or substituted CrC 4 -alkyl,
  • R 2 is independently selected from the group consisting of unsubstituted or substituted
  • R 3 is independently selected from the group consisting of unsubstituted or substituted d-Ca-alkyl, unsubstituted or substituted C r C r alkoxy, unsubstituted or substituted amino, halogen or hydroxy
  • R 4 is independently selected from the group consisting of unsubstituted or substituted Ci-C 8 -alkyl, unsubstituted or substituted Ci ⁇ C 8 -alkoxy, halogen or hydroxy, or
  • R 3 and R 4 form, together with the same or different carbon atom to which they are attached,
  • R s is unsubstituted or substituted heteroaryl
  • Any formula given herein is intended to represent hydrates, solvates, and polymorphs of such compounds, and mixtures thereof Any formula given herein is also intended to represent unlabeled forms as well as isotopically labeled forms of the compounds, lsotoptcally labeled compounds have structures depicted by the formulas given herein except that one or more atoms are replaced by an atom having a selected atomic mass or mass number.
  • isotopes that can be incorporated into compounds of the invention include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorous, fluorine, and chlorine, such as 2 H, 3 H, 11 C, 13 C, 14 C 1 15 N, 31 P, 32 P, 18 F 35 S, 36 CI, 125 I respectively.
  • isotopically labeled compounds of the present invention for example those into which radioactive isotopes such as 3 H, 13 C, and 14 C are incorporated
  • isotopically labeled compounds are useful in metabolic studies (preferably with 14 C), reaction kinetic studies (with, for example 2 H or 3 H), detection or imaging techniques, such as positron emission tomography (PET) or single-photon emission computed tomography (SPECT) including drug or substrate tissue distribution assays, or in radioactive treatment of patients.
  • PET positron emission tomography
  • SPECT single-photon emission computed tomography
  • an 18 F or labeled compound may be particularly preferred for PET or SPECT studies.
  • isotopically labeled compounds of this invention and prodrugs thereof can generally be prepared by carrying out the procedures disclosed in the schemes or in the examples and preparations described below by substituting a readily available isotopically labeled reagent for a ⁇ on-isotopically labeled reagent
  • isotopic enrichment factor means the ratio between the isotopic abundance and the natural abundance of a specified isotope If a substituent in a compound of this invention is denoted deuterium, such compound has an isotopic enrichment factor for each designated deuterium atom of at least 3500 (52.5% deuterium incorporation at each designated deuterium atom), at least 4000 (60% deute ⁇ um incorporation), at least 4500 (67 5% deuterium incorporation), at least 5000 (75% deuterium incorporation), at least 5500 (82
  • salts are preferably the pharmaceutically acceptable salts of compounds of formula (I) if they are carrying salt-forming groups Acids/bases required to form the salts are generally known in the field
  • Halogen denotes fluorine, bromine, chlorine or iodine, in particular fluorine, chlorine Halogen-substituted groups and moieties, such as alkyl substituted by halogen (halogenalkyl) can be mono-, poly- or per-halogenated Hetero atoms are atoms other than carbon and hydrogen, preferably nitrogen (N), oxygen (O) or sulfur (S), in particular nitrogen
  • Alkyl refers to a straight-chain or branched-chain alkyl group, and includes C ⁇ alkyl and C 1 8 aikyl where stated Such alkyi groups include, for example, methyl, ethyl, n- or sso- propyl, n-, fso-, sec- or tert-butyl, n-pentyl, n-hexyl, n-heptyl, n-octyl, with particular preference given to methyl, ethyl, n-propyl, iso-propyi, n-butyl and iso-butyl Alkyt may be unsubstituted or substituted Exemplary substituents include, but are not limited to hydroxy, alkoxy, halogen (especially fluoro), amino, mono- or di-alkyl substituted amino, acetylamino and morpholinyl An example of a substituted alkyhs trifluoromethyl
  • an (alkyl)-cycloalkyl moiety includes geminal-type of substitution pattern, e g 1 -alkyl cycioalkyl, such as 1 -methyl cyclopropyl
  • cycioalkyl as a substituent to alkyl is alkandiyl-cycloaikyl, such as alkandiyl-cyclopropyl, e g -CH 2 - cyclopropyl
  • Ci-C 8 -alkyl is alkyl with from and including 1 up to and including 8 carbon atoms, preferably from and including 1 up to and including 4 carbon atoms (Ci-C 4 -alkyl), and is linear or branched, preferably, lower alkyl is butyl, such as n-butyl, sec-butyl, isobutyl, tert- butyl, propyl, such as n-propyl or isopropyl, ethyl
  • alkyl part of other groups like "alkoxy”, “alkoxyalkyl”, “alkoxycarbonyl”, “alkoxy- carbonylaikyl”, “alkylsulfonyl”, “alkylsulfoxyl”, “alkylamino”, “halogenalkyl” shall have the same meaning as described m the above-mentioned definition of “alkyl” "C 3 .
  • 8 -Cycloalkyr refers to a saturated or partially saturated, monocyclic, fused polycycllc, or spiro polycyclic, carbocycle having from 3 to 8 ring atoms per carbocycle
  • cycioalkyl groups include the following moieties cyclopropyl, cyclobutyl, cyclpentyl and cylclohexyl Cycioalkyl may be unsubstituted or substituted, exemplary substituents are provided in the definition for alkyl
  • Heterocyclyl refers to a heterocyclic radical that is saturated or partially saturated and is preferably a monocyclic or in a broader aspect of the invention bicyclic, tricyclic or spirocyclic ring, and has 3 to 24, more preferably 4 to 16, most preferably 5 to 10 and most preferably 5 or 6 ring atoms, wherein one or more, preferably one to four especially one or two carbon ⁇ ng atoms are replaced by a heteroatom, the bonding ring preferably having 4 to 12, especially 5 to 7 ring atoms
  • Heteroaryl refers to a heterocyclic radical that is unsaturated (in particular maximally unsaturated, eg carrying the highest possible number of conjugated double bonds in the r ⁇ ng(s)), and is preferably a monocyclic or in a broader aspect of the invention bicyclic or tncyclic ring, and has 3 to 24, more preferably 4 to 16, most preferably 5 to 10 and most preferably 5 or 6 ring atoms, wherein one or more, preferably one to four, especially one or two ring atoms are a heteroatom, the bonding ring ( ⁇ e the ring which is bonded to the rest of the molecule) preferably having 4 to 12, especially 5 to 7 ring atoms
  • Treatment includes prophylactic (preventive) and therapeutic treatment as well as the delay of progression of a disease or disorter
  • PI3 kinase mediated diseases are especially such disorders that respond in a beneficial way (e g amelioration of one or more symptoms, delay of the onset of a disease, up to temporary or complete cure from a disease) to the inhibition of a PI3 kinase, especially inhibition of PISKalpha (where the diseases to be treated may include those showing somatic mutation of PIK3CA or germfine mutations or somatic mutation of PTEN)
  • Diseases to be treated include especially proliferative diseases such as tumor diseases, including solid tumors, leukaemias, glioblastoma, breast cancer and prostate cancer may be mentioned) "Salts" (which, what is meant by “or salts thereof” or “or a salt thereof), can be present afone or in mixture with free compound of the formula I and are preferably pharmaceutically acceptable salts
  • Salt-forming groups in a compound of formula (I) are groups or radicals having basic or acidic properties Compounds having at least one basic group
  • Compounds of formula (i) having acidic groups, a carboxy group or a phenolic hydroxy group may form metal or ammonium salts, such as alkali metal or alkaline earth metal salts, e g , sodium, potassium, magnesium or calcium salts, or ammonium salts with ammonia or suitable organic amines, such as tertiary monoamines, e g , triethylamsne or
  • tr ⁇ (2-hydroxyethyl)-am ⁇ ne or heterocyclic bases, e g , ⁇ /-ethyl-p ⁇ pe ⁇ d ⁇ ne or
  • any reference to the free compounds hereinbefore and hereinafter is to be understood as referring also to the corresponding salts, as appropriate and expedient
  • the present invention also relates to pro-drugs of a compound of formula (I) that convert in vivo to the compound of formula (I) as such
  • Any reference to a compound of formula (I) is therefore to be understood as referring also to the corresponding pro-drugs of the compound of formula (I), as appropriate and expedient
  • Combination refers to either a fixed combination tn one dosage unit form, or a kit of parts for the combined administration where a compound of the formula I and a combination partner (e g an other drug as explained below, also referred to as 'therapeutic agent" or "co- agent”) may be administered independently at the same time or separately within time intervals, especially where these time intervals allow that the combination partners show a cooperative, e.g. synergistic effect.
  • co-administration or “combined administration” or the like as utilized herein are meant to encompass administration of the selected combination partner to a single subject in need thereof (e.g. a patient), and are intended to include treatment regimens in which the agents are not necessarily administered by the same route of administration or at the same time.
  • pharmaceutical combination as used herein means a product that results from the mixing or combining of more than one active ingredient and includes both fixed and non-fixed combinations of the active ingredients.
  • fixed combination means that the active ingredients, e.g. a compound of formula I and a combination partner, are both administered to a patient simultaneously in the form of a single entity or dosage.
  • non-fixed combination means that the active ingredients, e.g.
  • a compound of formula I and a combination partner are both administered to a patient as separate entities either simultaneously, concurrently or sequentially with no specific time limits, wherein such administration provides therapeutically effective levels of the two compounds in the body of the patient.
  • cocktail therapy e.g. the administration of three or more active ingredients.
  • the invention relates to a compound of the formula f, in free base form or in salt form, wherein the substituents are as defined herein.
  • the alpha-amide substituent is at the 2- ⁇ osition on the pyrrolidine ring and the stereochemistry is as drawn and the R 4 substituent is at position 3 of the pyrrolidine ring, and each substituent has the defined stereochemistry which is cis- relative to each other.
  • R 1 preferably represents C r C 4 -aikyl, most preferably methyl.
  • R 2 preferably represents CrC 4 -a!kyl, C 1 -C 4 ⁇ IkOXy, di-CrC 4 -alkyl-amino, halogen or
  • R 2 more preferably represents methyl, methoxy, dimethylamino, fluoro or hydroxy.
  • R 2 even more preferably represents methoxy, dimethylamino. fluoro or hydroxy.
  • R 3 preferably represents C 1 -C 4 -HlRyI, C 1 -C 4 -SIkOXy, d ⁇ -CrC 4 -alkyl-am ⁇ n ⁇ , halogen or hydroxy
  • R 3 more preferably represents methyl, methoxy, dimethylamino, fluoro or hydroxy
  • R 3 even more preferably represents methyl, methoxy, dimethylamino, fluoro or hydroxy
  • the R 2 or R 3 group may be attached at the 2-and/or 3- and/or 4- and/or 5- position of the pyrrolidine ring of formula I Most preferably, the R 2 or R 3 group is attached at the 3-post ⁇ on of the pyrrolidine ring, i e on the same carbon which is
  • R 4 preferably represents, hydroxy, d-C ⁇ alkyl or CrC 4 -alkyl substituted by C r C 4 -alkoxy t unsubstituted or substituted ammo, heterocyclyl or heteroaryl
  • R 4 more preferably represents, hydroxy, C r C 4 -alkyl or C ⁇ C ⁇ alkyi substituted by C 1 -C 4 - alkoxy, d ⁇ -CrC 4 -aikyl-am ⁇ no, aeetylamino, morpholinyl or pyridyl
  • R 4 more preferably represents, hydroxy, methyl or methyl substituted by d-C 4 -aIkoxy, d ⁇ - C r C 4 -alkyl-am ⁇ no, aeetylamino, morpholinyl or pyridyl
  • R 4 most preferably represents, hydroxy, methyl, methoxymethyl, dimethylamino-methyl, acetylamino-methyl, morphol ⁇ n-4-ylmethyl or py ⁇ dyl-methyl
  • R 3 and R 4 may form, together with the same or different carbon atom to which they are attached, C 3 -C 8 - cycloalkyl or heterocyclyl, and wherein the compound (1R,2S,5S)-3-aza- b ⁇ cyclo[3 1 0]hexane-2 3-d ⁇ carboxyl ⁇ c acid 2-am ⁇ de 3- ⁇ (5 ⁇ (2-tert-butyl-pyr ⁇ m ⁇ d ⁇ n-4-yl)-4- methyl-th ⁇ azol-2-yl]-am ⁇ de ⁇ is excluded
  • R 4 is independently selected from the group consisting of unsubstituted or substituted CrCg-alkyl unsubstituted or substituted C r C 8 -alkoxy, halogen or hydroxy, or R and R 4 form, together with the same carbon atom to which they are attached, C 3 -C 8 - cycloalkyl, or
  • R 3 and R 4 form, together with the same or different carbon atom to which they are attached, heterocyclyl
  • compounds according to formula I include those wherein the substitutents are defined as for a compound of formula (I), and
  • R 4 is independently selected from the group consisting of unsubstituted or substituted
  • R 3 and R 4 form, together with the same carbon atom to which they are attached, C 3 -C 3 - cycloalkyl or heterocyclyl ⁇ preferably cycloalkyl)
  • R 3 and R 4 form a C 3 -C 8 -cycloalkyl (preferred) or heterocyclyl
  • the R 3 group is attached at the 3-pos ⁇ t ⁇ on of the pyrrolidine ring, i e on the same carbon which is simultaneously substituted by the R 4 group
  • R 5 represents unsubstituted or preferably substituted heteroaryl
  • R 6 more preferably represents unsubstituted heteroaryl or heteroaryi substituted by one substituent selected from the group consisting of
  • CrC 4 -alkyl in particular tert -butyl
  • per-deutero CrC 4 -alkyi molecular weight
  • halo-d-C 4 -alkyl in particular 1-fiuoro-1 -methyl-ethyl, 2, 2,2-t ⁇ fluoro-1,1 -dimethyl-ethyl
  • HCrCralkylJ-Cs-Cercycloalkyl in particular 1-methyl-cyclopropyl
  • halo ⁇ CrC 4 -aikyI)- C 3 -C 6 -cycloalkyl tn particular 1-tr ⁇ fluoromethyl-cyclopropyl
  • di-d-CValkylamino in particular diethylamino
  • dt-(per-deutero d ⁇ -alky ⁇ ammo in particular Cf 10 - diethylamino
  • R 5 more preferably represents heteroaryl selected from the group consisting of pyridyl (especially 4-py ⁇ dyl), pynmidinyl (especially 4-pyr ⁇ m ⁇ d ⁇ nyl), pyrazinyl (especially 2- pyrazinyl) and thiazolyl (especially th ⁇ azol-4-yl),
  • substituent is selected from the group consisting of Ci-C 4 -alkyl (in particular tert -butyl), per-deutero CrC 4 -alkyl (in particular dg-tert-butyl), halo-CrC 4 - alkyl (in particular 1-fluoro-1 -methyl-ethyl, 2,2,2-t ⁇ fluoro-1,1 -dimethyl-ethyl), 1-(C 1 -C 4 - alkyl)-C 3 -C 6 -cycloalkyl (in particular 1-methyl-cyclopropyl), (halo-d-C 4 -alkyl)-C 3 -C ⁇ - cycloalkyl (tn particular i-tnfluoromethyl-cyc ⁇ opropyl), d ⁇ -C 1 -C 4 ⁇ alkylam ⁇ no (in particular diethylamino), d ⁇ -( ⁇ er-deutero C r C 4 -alkyl)
  • R 5 very preferably represents a heteroaryl selected from the group consisting of 2-(1- methyl-cyclopropyl)-py ⁇ d ⁇ n-4-yl, 2-(2 2,2-t ⁇ fluoro-1 ,1-d ⁇ methyl-ethyl)-py ⁇ d ⁇ n-4-yl, 2-(1- fluoro-1-methyl-ethyl)-pyr ⁇ m ⁇ d ⁇ n-4-yl, 2-(1-(t ⁇ fluoromethyl)cyclopropyl)th ⁇ azole-4-yl, 2- d 9 -tert-butyl-pyr ⁇ m ⁇ d ⁇ n-4-yl, 6-tert-butyl-pyrazin-2-yl
  • R 5 very preferably represents in another embodiment a heteroaryi selected from the group consisting of 2-(1-methyl-cyclopropyl)-py ⁇ d ⁇ n-4-yl, 2-(2,2 2-tr ⁇ fluoro-1 1 -dimethyl-ethyl)- py ⁇ d ⁇ n-4-yl 2-(1-fluoro-1-methyl-ethyl)-py ⁇ m ⁇ d ⁇ n-4-yl 2-(1-(t ⁇ fluoromethyl)cyclopropyl) th ⁇ azoie-4-yl, 2-d 9 -tert-butyi-py ⁇ m ⁇ d ⁇ -4-yl, 6-tert-butyl-pyraz ⁇ n-2-yl, 2-tert-butyl-py ⁇ d ⁇ n- 4-yl It is preferred that when R 5 is substituted py ⁇ dyl, e g 4-pyr ⁇ dyl, substituted by at least one substituent (as defined herein above), said substituent is at least at the 2-pos
  • R 5 is substituted py ⁇ midinyl, e g 4-py ⁇ m ⁇ d ⁇ nyl, substituted by at least one substituent (as defined herein above), said substituent is at least at the 2- position of the py ⁇ midinyl group
  • R is substituted pyrazinyl, e g 2-pyraz ⁇ nyl, substituted by at least one substituent (as defined herein above), said substituent is at least at the 6- position of the pyrazinyl group
  • R is substituted thiazole, e g th ⁇ azole-4-yl, substituted by at least one substituent (as defined herein above), said substituent is at least at the 2- position of the thiazole group
  • An embodiment of the present invention includes compounds of the formula I wherein m and/or n are 0
  • Another embodiment of the present invention includes compounds of the formula I wherein m and n are both 0, that is, wherein the pyrrolidine ring is substituted only by the amide at position 2 and the R 4 group at position 3, i e compounds of formula IA
  • a further embodiment of the present invention includes compounds of the formula I wherein m is 0 or 1 and n is 1 In this embodiment, it is preferred that R 3 is bonded at position 3 of the pyrrolidine ring, i e to provide compounds of formula IB:
  • R 2 group is preferably attached at the 4- or 5-pos ⁇ tion (preferably the 4-position) of the pyrrolidine ⁇ ng, thus providing compounds of formula IB'
  • R is CrC ⁇ alkyl, most preferably methyl
  • a further embodiment of the present invention includes compounds of the formula I wherein m is 0 or 1 and n is 1 , wherein R 3 is bonded at position 3 of the pyrrolidine ring, and, together with R 4 forms a C 3 -C 8 -cycloalkyl or heterocyclyl, preferably a C 3 -C 8 -cycloalkyl, in particular cyclopropyl, i e to provide compounds of formula IC
  • substitutents are defined as for a compound of formula (I)
  • the R 2 group is preferably attached at the 4- or 5-pos ⁇ tion (preferably the 4-pos ⁇ t ⁇ on) of the pyrrolidine ring
  • the invention further relates to pharmaceutically acceptable prodrugs of a compound of formula (I), (IA), (IB), (IB') and/or (IC)
  • the invention further relates to pharmaceutically acceptable metabolites of a compound of formula (I), (IA), (IB), (IB') and/or (IC)
  • the invention relates especially to the compounds of the formula (I), (IA), (IB), (IB') and/or (IC) given in the Examples, as well as the methods of manufacture described herein
  • the present invention also relates to processes for the production of a compound of formula (I), (IA), (IB), (IB') and/or (IC)
  • processes for the production of a compound of formula (I), (IA), (IB), (IB') and/or (IC) In principle all known processes which convert two different amines into a corresponding urea derivative are suitable and may be applied by using the respective starting material
  • the invention in particular relates to a process which comprises reacting a compound of formula Il
  • RG represents a reactive group (such as imidazolylcarbonyl) ("method B"), in each case optionally in the presence of a diluent and optionally in the presence of a reaction aid and recovering the resulting compound of formula I in free form or in form of a salt and, optionally converting a compound of the formula I obtainable according to method A or method B into a different compound of the formula I, and/or converting an obtainable salt of a compound of the formula I into a different salt thereof, and/or converting an obtainable free compound of the formula I into a salt thereof, and/or separating an obtainable isomer of a compound of the formula I from one or more different obtainable isomers of the formula I Reaction conditions
  • a compound of formula Ii may be reacted with a compound of formula HIA or HIB in a solvent, e g dimethylformamide, in the presence of a base e g an organic amine, e g t ⁇ ethylamine
  • All reactions may take place in the presence of one or more diluents and/or solvents
  • the starting materials may be used in equimolar amounts, alternatively, a compound may be used in excess, e g to function as a solvent or to shift equilibrium or to generally accelerate reaction rates
  • Reaction aids such as acids, bases or catalysts may be added in suitable amounts, as known in the field, required by a reaction and in line with generally known procedures
  • one or more other functional groups for example carboxy, hydroxy, amino, sutfhydryl or the like are or need to be protected in a starting material as described herein or any other precursor, because they should not take part in the reaction or disturb the reaction, these are such groups as are usually used in the synthesis of peptide compounds, and also of cephalosporins and penicillins, as well as nucleic acid derivatives and sugars Protecting groups are such groups that are no longer present in the final compounds once they are removed, while groups that remain as substituents are not protecting groups in the sense used here which are groups that are added at a starting material or intermediate stage and removed to obtain a final compound Also in the case of conversions of a compound of the formula (I), (IA), (IB), (IB') and/or (IC) into a different compound of the formula (I), (IA), (IB), (IB') and/or (IC), protecting groups may be introduced and removed, if useful or required The protecting groups may already be present in precursors and should
  • a compound of the formula (I), (IA), (IB), (IB') and/or (IC) may be converted into a different compound of the formula (I), (IA), (IB), (IB') and/or (IC)
  • the ammo can be converted into acylamino, e g Ci-Cr-alkanoylamino, by reaction with a corresponding CrC 7 -alkanoylhalogen ⁇ de, e g a corresponding chloride, in the presence of a tertiary nitrogen base, such as triethylamine or pyridine, in the absence or presence of an appropriate solvent, such a methylene chloride, for example at temperatures in the range from -20 to 50 0 C, e g at about room temperature
  • Salts of a compound of formula (I), (IA), (IB), (IB') and/or (IC) with a salt-forming group may be prepared in a manner known per se Acid addition salts of compounds of formula (I), (IA), (IB), (IB') and/or (IC) may thus be obtained by treatment with an acid or with a suitable anion exchange reagent
  • a salt with two acid molecules for example a dihalogenide of a compound of formula (I), (IA) 1 (IB), (IB') and/or (IC)
  • Stereoisomers mixtures e g mixtures of diastereomers, can be separated into their corresponding isomers in a manner known perse by means of suitable separation methods
  • Dia- stereomeric mixtures for example may be separated into their individual diastereomers by means of fractionated crystallization, chromatography, solvent distribution, and similar procedures This separation may take place either at the level of a starting compound or in a compound of formula (I), (IA), (IB), (IB') and/or (IC) itself
  • Enantiomers may be separated through the formation of diastereome ⁇ c salts, for example by salt formation with an enantiomer-pure chiral acid, or by means of chromatography, for example by HPLC, using chromatographic substrates with chiral ligands
  • the starting materials of the formulae Il and III, as well as other starting materials mentioned herein, e g below, can be prepared according to or in analogy to methods that are known in the art, are known in the art and/or are commercially available Insofar as the production of the starting materials is not particularly described, the compounds are either known or may be prepared analogously to methods known in the art, e g in WO 05/021519 or WO04/096797, or as disclosed hereinafter Novel starting materials, as well as processes for the preparation thereof, are likewise an embodiment of the present invention In the preferred embodiments, such starting materials are used and the reaction chosen are selected so as to enable the preferred compounds to be obtained In the starting materials (including intermediates), which may also be used and/or obtained as salts where appropriate and expedient, the substituents are preferably as defined for a compound of the formula (I), (IA), (IB), (IB 1 ) and/or (IC) Pharmaceutical compositions, uses and methods of treatment
  • the present invention also relates to use of the compounds of formula (I), (IA) 1 (IB), (IB') and/or (IC) as disclosed herein as pharmaceuticals
  • the present invention includes in one embodiment compositions comprising a compound of formula (I) (IA), (IB), (IB') and/or (IC), e g for human or veterinary use, e g where inhibition of PI3K is indicated
  • the invention relates to the treatment of cellular proliferative diseases such as tumor (benign or malignant) and/or cancerous cell growth, e g mediated by PI3K Diseases may include those showing somatic mutation of P1K3CA or germline mutations or somatic mutation of PTEN
  • the compounds may be useful in the treatment of human or animal (e g , murine) cancers, including, for example, sarcoma, lung, bronchus, prostate, breast (including sporadic breast cancers and sufferers of Cowden disease), pancreas, gastrointestinal cancer, colon, rectum, colon carcinoma, colorectal adenoma, thyroid, liver, intrahepatic bile duct, hepatocellular, adrenal gland, stomach, gastric, glioma, glioblastoma, endometrial, melanoma, kidney, renal pelvis, urinary bladder, uterine corpus, uterine cervix, vagina, ovary, multiple my
  • myelogenous leukemia chronic myelogenous leukemia, lymphocytic leukemia, myeloid leukemia, brain, oral cavity and pharynx, larynx, small intestine, non-Hodgkin lymphoma, melanoma, villous colon adenoma, a neoplasia, a neoplasia of epithelial character lymphomas, a mammary carcinoma, basal cell carcinoma, squamous cell carcinoma, actinic keratosis, tumor diseases, including solid tumors, a tumor of the neck or head, polycythemia vera, essential thrombocythemia, and myelofibrosis with myeloid metaplasia
  • condition or disorder is selected from the group consisting of an eptdermai hyperproliferatton, prostate hyperplasia a neoplasia, a neoplasia of epithelial character, Cowden syndrome, Lhermitte-Dudos disease or Bannayan- Zonana syndrome, asthma, COPD, ARDS, Loffler's syndrome, eosinophilic pneumonia, parasitic (in particular metazoan) infestation (including tropical eosinophtlia),
  • bronchopulmonary aspergillosis polyarteritis nodosa including Churg-Strauss syndrome
  • eosinophilic granuloma including eosinophil-related disorders affecting the airways occasioned by drug-reaction
  • psoriasis contact dermatitis, atopic dermatitis, alopecia areata
  • erythema multiforme including dermatitis herpetiformis, scleroderma, vitiligo, hypersensitivity angiitis, urticaria, bullous pemphigoid, lupus erythematosus, pemphisus, epidermolysis bullosa acquistta
  • autoimmune haematogical disorders e g haemolytic anaemia, aplastic anaemia, pure red cell anaemia and idiopathic thrombocytopenia
  • systemic lupus erythematosus including Churg-Straus
  • Suitable unit dosage forms for oral administration comprise from ca 0 1 to 500 mg active ingredient
  • the compounds of formula (I) (IA), (IB), (IB') and/or (IC) may be administered by any conventional route, in particular enterally, e g orally, e g in the form of tablets or capsules, or parenterally e g in the form of injectable solutions or suspensions, topically, e g in the form of lotions, gels, ointments or creams, by inhalation, intranasally, or in a suppository form
  • the compounds of formula (I), (IA), (IB), (IB') and/or (IC) may be administered in free form or in pharmaceutically acceptable salt form e g as indicated above Such salts may be prepared in conventional manner and exhibit the same order of activity as the free compounds
  • a method for preventing or treating conditions, disorders or diseases mediated by the activation of the PI3, e g the PI3 kinase alpha enzyme e g such as indicated above, in a subject in need of such treatment comprises administering to said subject an effective amount of a compound of formula (I), (IA), (IB), (IB') and/or (IC) or a pharmaceutically acceptable salt thereof
  • PI3K serves as a second messenger node that integrates parallel signaling pathways
  • trastuzumab Approximately 20-30% of human breast cancers overexpress Her-2/neu-ErbB2, the target for the drug trastuzumab Although trastuzumab has demonstrated durable responses in some patients expressing Her2/neu-ErbB2 only a subset of these patients respond Recent work has indicated that this limited response rate can be substantially improved by the combination of trastuzumab with inhibitors of PI3K or the PI3K/AKT pathway (Chan et al Breast Can Res Treat 91 187 (2005), Woods lgnatoski et al , B ⁇ t J Cancer 82 666 (2000), Nagata et al , Cancer Cell 6 117 (2004))
  • AEE778 an inhibitor of Her-2/neu/ErbB2, VEGFR and EGFR
  • RAD001 an inhibitor of mTOR, a downstream target of Akt
  • Anti-estrogens such as tamoxifen, inhibit breast cancer growth through induction of cell cycle arrest that requires the action of the cell cycle inhibitor p27Kip
  • activation of the Ras-Raf-MAP Kinase pathway alters the phosphorylation status of p27K ⁇ p such that its inhibitory activity in arresting the cell cycle is attenuated, thereby contributing to antt-estrogen resistance
  • Donovan, et al J Biol Chem 27640888 (2001)
  • inhibition of MAPK signaling through treatment with MEK inhibitor reversed the aberrant phosphorylation status of p27 in hormone refractory breast cancer cell lines and in so doing restored hormone sensitivity
  • phosphorylation of p27Kip by Akt also abrogates its role to arrest the cell cycle (Viglietto et al , Nat Med 8 1145 (2002))
  • the present invention provides, in a further aspect, compounds of formulae
  • hematological cancers such as chronic myelogenous leukemia (CML)
  • CML chronic myelogenous leukemia
  • chromosomal translocation is responsible for the constitutiveiy activated BCR-AbI tyrosine kinase
  • imatinib a small molecule tyrosine kinase inhibitor
  • many patients with advanced stage disease respond to imatinib initially, but then relapse later due to resistance-conferring mutations in the AbI kinase domain
  • BCR-AbI employs the Ras-Raf kinase pathway to elicit its effects
  • inhibiting more than one kinase in the same pathway provides additional protection against resistance-conferring mutations
  • the present invention provides the compounds of formulae (I), (IA), (IB), (IB') and/or (IC) for use in combination with at least one additional agent selected from the group of kinase inhibitors, such as Gleevec®, in the treatment of hematological cancers, such as chronic myelogenous leukemia (CML)
  • at least one additional agent selected from the group of kinase inhibitors, such as Gleevec®
  • CML chronic myelogenous leukemia
  • the invention further provides pharmaceutical compositions comprising at least one compound of formula (I), (IA), (IB), (IB') and/or (IC), together with a pharmaceutically acceptable excepient suitable for administration to a human or animal subject, either alone or together with another therapeutic agent, for example another anticancer agent
  • the invention further provides methods of treating human or animal subjects suffering from a cellular proliferative disease, such as cancer
  • the invention thus provides methods of treating a human or animal subject in need of such treatment, comprising administering to the subject a therapeutically effective amount of a compound of formula (I), (IA), (IB), (IB') and/or (IC) either alone or in combination with one or more other therapeutic agents, e g other anticancer agents in particular, compositions will either be formulated together as a combination therapeutic or administered separately
  • Suitable anticancer agents for use with a compound of formula I include, but are not limited to, one or more compounds selected from the group consisting of kinase inhibitors, anti-estrogens, anti androgens, other inhibitors, cancer chemotherapeutic drugs, alkylating agents, chelating agents, biological response modifiers, cancer vaccines, agents for antisense therapy as set forth below
  • Kinase Inhibitors _K ⁇ nase inhibitors for use as anticancer agents in conjunction with a compound of the formula (I) 1 (IA), (IB), (IB') and/or (IC) include inhibitors of Epidermal Growth Factor Receptor (EGFR) kinases such as small molecule quinazolines, for example gefitinib (US 5457105, US 5616582, and US 5770599), ZD-6474 (WO 01/32651), erlotinib (Tarceva®, US 5,747,498 and WO 96/30347), and lapatinib (US 6,727,256 and WO
  • EGFR Epidermal Growth Factor Receptor
  • Vascular Endothelial Growth Factor Receptor (VEGFR) kinase inhibitors including SU-11248 (WO 01/60814), SU 5416 (US 5 883,113 and WO 99/61422), SU 6668 (US 5,883,113 and WO 99/61422), CHIR-258 (US 6,605,617 and US 6,774,237), vatalanib or PTK-787 (US 6,258,812), VEGF-Trap (WO 02/57423), B43-Gen ⁇ ste ⁇ n (WO-09606116), fenretinide (retinoic actd p-hydroxyphenyiamtne) (US 4,323,581), IM-862 (WO 02/62826), bevacizumab or Avastin® (WO 94/10202), KRN-951, 3-[5-(methylsulfonylp ⁇ perad ⁇ ne methyl)- indofyl]-quinolone, AG-13736 and
  • Anti-Estrogens for use in anticancer therapy in conjunction with a compoound of formula (I), (IA) 1 (IB), (IB') and/or (IC) include Selective Estrogen Receptor Modulators (SERMs) including tamoxifen, toremifene, raloxifene, aromatase inhibitors including A ⁇ midex® or anastrozole, Estrogen Receptor Downregulators (ERDs) including Faslodex® or fulvestrant
  • SERMs Selective Estrogen Receptor Modulators
  • ESDs Estrogen Receptor Downregulators
  • Anti-Androgens for use in anticancer therapy in conjunction with a compound of formula (I), (IA), (IB), (IB') and/or (IC) include flutamide, bicalutamide, finasteride, aminoglutethamide, ketoconazole, and corticosteroids
  • _Other inhibitors for use as anticancer agents in conjunction with a compound of formula (I), (IA), (IB), (IB') and/or (IC) include protein farnesyl transferase inhibitors including tipifarnib or R-115777 (US 2003134846 and WO 97/21701), BMS- 214662, AZD-3409, and FTI-277, topoisomerase inhibitors including merbarone and diflomotecan (BN-80915), mitotic kinesin spindle protein (KSP) inhibitors including SB- 743921 and MKI-833, proteasome modulators such as bortezomib or Velcade® (US).
  • protein farnesyl transferase inhibitors including tipifarnib or R-115777 (US 2003134846 and WO 97/21701), BMS- 214662, AZD-3409, and FTI-277
  • topoisomerase inhibitors including merbarone and difl
  • NSAIDs non-steroidal antiinflammatory drugs I
  • cancer Chemotherapeutic Drugs Particular cancer chemotherapeutic agents for use as anticancer agents in conjunction with a compound of formula (I), (IA), (IB), (IB') and/or (IC) include anastrozole (A ⁇ midex®), bicalutamide (Casodex®), bleomycin sulfate
  • doxorubicin hydrochloride Ad ⁇ amycin®, Rubex®
  • etoposide Vepesid®
  • fludarabine phosphate Fludara®
  • 5-fluorourac ⁇ l Adrucil®, Efudex®
  • flutamide Eulexin®
  • tezacitibine Gemcitabine (difluorodeoxy ⁇ tidine), hydroxyurea (Hydrea®), ldarubicin
  • Alkylating Agents for use in conjunction with a compound of formula (I), (IA), (IB), (IB') and/or (IC) include VNP-40101M or cloretizine, oxaliplatin (US 4,169,846,
  • glufosfamide, mafosfamide, etopophos US 5,041 ,424), prednimustine, treosulfan, busulfan, irofluven (acylfulvene), penclomedine, pyrazoloac ⁇ dine (PD-115934), O6-benzylguan ⁇ ne, deciiabine (5-aza-2-deoxycyt ⁇ d ⁇ ne); brostallicin, mitomycin C (MitoExtra), TLK-286 (Telcyta®), temozolomide, trabectedin (US 5,478,932), AP-5280 (Platinate formuiation of Cisplatin), porfiromycin, and clearazide (meclorethamine)
  • Chelating Agents for use in conjunction with a compound of formula (I), (IA), (IB), (IB') and/or (IC) include tetrathiomolybdate (WO 01/60814), RP-697, Chimeric T84 66 (cT84 66), gadofosveset (Vasovist®), deferoxamine, and bleomycin optionally in combination with etectorporation (EPT)
  • H. Biological Response Modifiers such as immune modulators, for use in conjunction with a compound of formula (I), (IA), (IB), (IB') and/or (IC) include staurosp ⁇ ne and macrocycltc analogs thereof, including UCN-01 , CEP-701 and midostaunn (see WO 02/30941 , WO 97/07081 , WO 89/07105, US 5,621,100, WO
  • Cancer Vaccines for use in conjunction with a compound of formula (I), (IA), (IB), (IB 1 ) and/or (IC) include Avicine® (Tetrahedron Lett 26 2269-70 (1974));
  • oregovomab (OvaRex®), Theratope® (STn-KLH) 1 Melanoma Vaccines, Gi-4000 series (Gl- 4014, GI-4015, and GI-4016), which are directed to five mutations in the Ras protein, Gl ⁇ oVax-1 , MelaVax, Advexin® or INGN-201 (WO 95/12660), S ⁇ g/E7/LAMP-1, encoding HPV-16 E7, MAGE-3 Vaccine or M3TK (WO 94/05304), HER-2VAX, ACTIVE, which stimulates T-cells specific for tumors, GM-CSF cancer vaccine, and Listeria monocytogenes- based vaccines
  • J. Antisense Therapy for use in conjunction with a compound of formula (I), (IA), (IB), (IB') and/or (IC) also include antisense compositions, such as AEG-35156 (GEM-640), AP-12009 and AP-11014 (TGF-beta2-spec ⁇ f ⁇ c antisense oligonucleotides), AVI- 4126, AVI-4557, AVI-4472, oblimersen (Genasense®), JFS2, aprinocarsen (WO 97/29780), GTI-2040 (R2 ribonucleotide reductase mRNA antisense oligo) (WO 98/05769), GTI-2501 (WO 98/05769), liposome-encapsulated c-Raf antisense oligodeoxynucleotides (LErafAON) (WO 98/43095), and Sirna-027 (RNAi-based
  • a compound of formula (I), (IA), (IB), (IB') and/or (IC) can also be combined in a
  • bronchiodilatory drugs include anticholinergic or anttmusca ⁇ nic agents, in particular glycopyrrolate, ipratropium bromide oxitropium bromide, and ttotropium bromide, OrM3, aclidinium, CHF5407, GSK233705 and ⁇ -2- adrenoreceptor agonists such as salbutamol, terbutaltne salmeterol, carmoterol, milveterol and, especially, indacaterol and formoterol
  • Co-therapeutic antihistamine drug substances include ceti ⁇ zine hydrochloride clemastine fumarate, promethazine, loratadine, desloratadine diphenhydramine and fexofenadine hydrochloride
  • the invention provides in a further aspect a combination comprising a compound of formula (I) 1 (IA), (IB), (IB') and/or (IC) and one or more compounds that are useful for the treatment of a thrombolytic disease, heart disease, stroke, etc
  • Such compounds include aspirin, a streptokinase, a tissue plasminogen activator, a urokinase, a anticoagulant, antiplatelet drugs (e g, PL-AVIX, clopidogrel bisulfate), a statin (e g , LfPITOR or Atorvastatin calcium), ZOCOR (Simvastatin), CRESTOR (Rosuvastatin), etc ), a Beta blocker (e g , Atenolol), NORVASC (amlodipine besylate), and an ACE inhibitor (e g , lisinopril)
  • the invention provides in a further aspect a combination comprising a compound of formula (I), (IA), (IB), (IB') and/or (IC) and one or more compounds that are useful for the treatment of antihypertension
  • compounds include ACE inhibitors, lipid lowering agents such as statins, LtPITOR (Atorvastatin calcium), calcium channel blockers such as NORVASC (amlodipine besylate)
  • the invention provides in a further aspect a combination comprising a compound of formula (I), (IA), (IB), (IB') and/or (IC) and one or more compounds selected from the group consisting of fibrates, beta-blockers, NEPI inhibitors, Angiotens ⁇ n-2 receptor antagonists and platelet aggregation inhibitors
  • the invention provides in a further aspect a combination comprising a compound of formula (I), (IA), (IB), (IB') and/or (IC) and a compound suitable for the treatment of inflammatory diseases, including rheumatoid arthritis
  • a compound suitable for the treatment of inflammatory diseases including rheumatoid arthritis
  • Such compound may be selected from the group consisting of TNF- ⁇ inhibitors such as ant ⁇ -TNF- ⁇ monoclonal antibodies (such as
  • NSAIDS nonsterodial anti-inflammatory agents
  • diclofenac naproxen
  • flurbiprofen flurbiprofen
  • fenoprofen ketoprofen ibuprofen
  • fenamates mefenamic acid, indomethaci ⁇ , sulindac, apazone, pyrazolones, phenylbutazone
  • aspirin COX-2 inhibitors such as CELEBREX (celecoxib) PREXIGE (lumiracoxib)
  • metalloprotease inhibitors preferably MMP-13 selective inhibitors
  • p2x7 inhibitors ⁇ 2(x ⁇ nh ⁇ b ⁇ tors NEUROTIN 1 pregabaltn, low dose methotrexate, leflunomide
  • the invention provides in a further aspect a combination comprising a compound of formula (I) 1 (IA), (IB), (IB') and/or (IC) and a compound suitable for the treatment of osteoarthritis
  • NSAID's standard non-steroidal antiinflammatory agents
  • piroxicam diclofenac
  • propionic acids such as naproxen, flurbiprofen, fenoprofen, ketoprofen and ibuprofen
  • fenamates such as mefenamic acid, indomethacin, sulindac, apazone, pyrazolones such as phenylbutazone
  • salicylates such as aspirin
  • COX-2 inhibitors such as celecoxib, valdecoxib, lurniracoxib and etoricoxib
  • analgesics and intraarticular therapies such as corticosteroids and hyaluronic acids such as hyal
  • the invention provides in a further aspect a combination comprising a compound of formula (I) 1 (IA), (IB), (IB') and/or (IC) and an antiviral agent and/or an antisepsis compound
  • antiviral agent may be selected from the group consisting of Viracept, AZT, acyclovir and famciclovir
  • antisepsis compound may be selected from the group consisting of Valant
  • the invention provides in a further aspect a combination comprising a compound of formula (I), (IA), (IB), (IB') and/or (IC) and one or more agents selected from the group consisting of CNS agents such as antidepressants (sertraline), anti-Parkinsonian drugs (such as deprenyl, L-dopa, Requip, Mirapex, MAOB inhibitors (such as selegine and rasagiline), comP inhibitors (such as Tasmar), A-2 inhibitors, dopamine reuptake
  • the invention provides in a further aspect a combination comprising a compound of formula (I), (IA), (IB), (IB 1 ) and/or (IC) and one or more anti-Alzheimer's drugs
  • anti-Alzheimer Drug may be selected from the group consisting of donepezil, tacrine, ⁇ 2 ⁇ nh ⁇ b ⁇ tors, NEUROTIN, pregabalm, COX-2 inhibitors, propentofylline or metryfonate
  • the invention provides in a further aspect a combination comprising a compound of formula (I), (IA), (IB), (IB') and/or (IC) and anosteoporosis agents and/or an immunosuppressant agent
  • osteoporosis agents ma be selected from the group consisting of EVISTA (raloxifene hydrochloride), droloxifene, lasofoxifene or fosomax
  • immunosuppressant agents may be selected from the group consisting of FK-506 and rapamy ⁇ n
  • kits that include one or more compound of formula (I) 1 (IA), (IB), (IB') and/or (IC) and a combination partner as disclosed herein are provided
  • Representative kits include a PI3K inhibitor compound (e g , a compound of formula (I) 1 (IA), (IB), (IB') and/or (IC)) and a package insert or other labeling including directions for treating a cellular proliferative disease by administering a PI3K inhibitory amount of the compound(s)
  • the compounds of formula (I), (IA), (IB), (IB') and/or (IC) will be administered in a therapeutically effective amount by any of the accepted modes of administration for agents that serve similar utilities
  • the actual amount of the compound of formula (I), (IA), (IB), (IB') and/or (IC), i e , the active ingredient will depend upon numerous factors such as the severity of the disease to be treated, the age and relative health of the subject, the potency of the compound used, the route and form of administration, and other factors
  • the drug can be administered more than once a day, preferably once or twice a day All of these factors are within the skill of the attending clinician
  • Therapeutically effective amounts of compounds of formulas I may range from about 0 05 to about 50 mg per kilogram body weight of the recipient per day, preferably about 0 1-25 mg/kg/day, more preferably from about 0 5 to 10 mg/kg/day Thus, for administration to a 70 kg person, the dosage range would most preferably be about 35-70 mg
  • compounds of formula (I), (IA), (IB), (IB') and/or (IC) will be administered as pharmaceutical compositions by any one of the following routes oral, systemic (e g , transdermal, intranasal or by suppository), or parenteral (e g , intramuscular, intravenous or subcutaneous) administration
  • systemic e g , transdermal, intranasal or by suppository
  • parenteral e g , intramuscular, intravenous or subcutaneous
  • the preferred manner of administration is oral using a convenient daily dosage regimen that can be adjusted according to the degree of affliction Compositions can take the form of tablets, pills, capsules, semisolids, powders, sustained release formulations, solutions, suspensions, elixirs aerosols, or any other appropriate compositions
  • Another preferred manner for administering compounds of the formula I is inhalation This is an effective method for delivering a therapeutic agent directly to the respiratory tract The choice of formulation depends on various factors such as
  • the compound can be formulated as liquid solution, suspensions, aerosol propellents or dry powder and loaded into a suitable dispenser for administration
  • suitable dispenser for administration
  • MDI metered dose inhalers
  • DPI dry powder inhalers
  • Nebulizer devices produce a stream of high velocity air that causes the therapeutic agents (which are formulated in a liquid form) to spray as a mist that is carried into the patient's respiratory tract MDI's typically are formulation packaged with a compressed gas
  • the device discharges a measured amount of therapeutic agent by compressed gas, thus affording a reliable method of administering a set amount of agent DPI dispenses therapeutic agents in the form of a free flowing powder that can be dispersed tn the patient's inspiratory air-stream during breathing by the device
  • the therapeutic agent is formulated with an excipient such as lactose
  • an excipient such as lactose
  • the inventions also relates to formulations wherein the particle size of a compound of formula I between 10 - 1000 nm, preferably 10 - 400 nm
  • Such pharmaceutical formulations have been developed especially for drugs that show poor bioavailability based upon the principle that bioavailability can be increased by increasing the surface area i e , decreasing particle size
  • U S 4,107,288 describes a pharmaceutical formulation having particles in the size range from 10 to 1 ,000 nm in which the active material is supported on a crosslinked matrix of macr ⁇ molecules
  • U S 5,145,684 describes the production of a pharmaceutical formulation in which the drug substance is pulverized to nanoparticles (average particle size of 400 nm) in the presence of a surface modifier and then dispersed in a liquid medium to give a pharmaceutical formulation that exhibits remarkably high bioavailability
  • the invention provides pharmaceutical compositions comprising a (therapeutically effective amount) of a compound of formula (I), (IA), (IB), (IB') and/or (IC), and at least one pharmaceutically acceptable excipient Acceptable excipients are non-toxic, aid administration, and do not adversely affect the therapeutic benefit of the compound of formula (I), (IA), (IB), (IB') and/or (IC)
  • excipient may be any solid, liquid, semi-solid or in the case of an aerosol composition, gaseous excipient that is generally available to one of skill in the art
  • Solid pharmaceutical excipients include starch, cellulose, talc, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, magnesium stearate, sodium stearate, glycerol monostearate, sodium chloride, dried skim milk and the like
  • Liquid and semisolid excipients may be selected from glycerol, propylene glycol, water, ethanol and various oils, including those of petroleum, animal, vegetable or synthetic origin, e g , peanut oil, soybean oil, mineral oil, sesame oil, etc
  • Preferred liquid carriers, particularly for injectable solutions include water, saline, aqueous dextrose, and glycols
  • Compressed gases may be used to disperse a compound of the formula I in aerosol form Inert gases suitable for this purpose are nitrogen, carbon dioxide, etc Other suitable pharmaceutical excipients and their formulations are described in Remington's
  • the amount of the compound in a formulation can vary within the full range employed by those skilled in the art Typically, the formulation will contain, on a weight percent (wt%) basis, from about 0 01-99 99 wt% of a compound of formula I based on the total formulation, with the balance being one or more suitable pharmaceutical excipients Preferably, the compound is present at a level of about 1-80 wt%
  • the invention further relates to pharmaceutical compositions comprising ( ⁇ e containing or consisting of ) at least one compound of formula (I), (IA), (IB), (IB') and/or (IC) and at least one pharmaceutically acceptable excipient
  • compositions comprising a compound of formula (I) 1 (IA), (IB) (IB 1 ) and/or (IC) in free form or in pharmaceutically acceptable salt form in association with at least one pharmaceutical acceptable excipient (such as a carrier and/or diluent) may be manufactured in conventional manner by mixing the components
  • compositions comprising a compound of formula (I), (IA) (IB), (IB') and/or (IC) in free form or in pharmaceutically acceptable salt form and further comprising a combination partner (either in one dosage unit form or as a kit of parts) in association with at least one pharmaceutical acceptable carrier and/or diluent may be manufactured in conventional manner by mixing with a pharmaceutically acceptable carrier and/or diluent with said active ingredients Consequently, the invention provides in further aspects
  • a combined pharmaceutical composition e g for use in any of the methods described herein, comprising a compound of formula (I), (IA), (IB), (IB') and/or (IC) in free form or pharmaceutically acceptable salt form in association with a pharmaceutically acceptable diluent and/or carrier
  • a combined pharmaceutical composition comprising a compound of formula (I), (IA), (IB), (IB') and/or (IC) in free form or in pharmaceutically acceptable salt form as active ingredient, one or more pharmaceutically acceptable carrier mater ⁇ al(s) and / or diluents and optionally one or more further drug substances
  • Such combined pharmaceutical composition may be in the form of one dosage unit form or as a kit of parts
  • a combined pharmaceutical composition comprising a therapeutically effective amount of a compound of formula (I), (IA), (IB), (IB') and/or (tC) in free form or in
  • a pharmaceutical combination e g a kit, comprising a) a first agent which is a
  • kit may comprise instructions for its administration
  • Step 1.1 lrnidazole-1-carboxylic acid ⁇ 4-methyl-5-[2-(1 ⁇ methyl-cyclopropyl)-pyridtn-4-ylJ- thiazol-2-yl ⁇ -amide
  • Step 1 2 A mixture of 4-methyl-5-[2-(1-methyl-cyctopropyl)-pyndtn-4-yl]-th ⁇ azol-2-ylam ⁇ ne (Step 1 2) (28 5 mmol) and CDI (42 8 mmol) in CH 2 CI 2 (330 mL) was refluxed for 11 h After cooling to rt, the reaction mixture was filtered to afford the title compound as a light green solid Step 1 2 4-Methyi-5-[2-(1 -methyl-cyc!opropyl)-py ⁇ d ⁇ n-4-yl]-thtazol-2-ylam ⁇ ne
  • Step 1 3 N- ⁇ 4-Methyl-5-[2-( 1 -methyl-cyclopropyl)-pyr ⁇ d ⁇ n-4-ylJ-th ⁇ azol-2-yl ⁇ -acetam ⁇ de
  • Step 1 4 4-Bromo-2-(1 -methyl-cyclopropyO-py ⁇ dine
  • Step 1 6 2-(1 -Methyl-cyclopropyO-pyran ⁇ -one
  • Step 1 8 (2S,3R)-3-Methyl-pyrrol ⁇ dine-2-carboxyl ⁇ c acid amide
  • Step 1 9 (2S 3R)-3-Methyl-1-((S)-1-phenyl-ethyl)-pyrrol ⁇ d ⁇ ne-2-carboxyl ⁇ c acid amide
  • Step 5 (2S,3S)-3-(Acetylam ⁇ no-methyl)-pyrroltd ⁇ ne-2-carboxyl ⁇ c a ⁇ d amide
  • Step 5 2 was used instead of (2S,3R)-3-methyl-1-((S)-1-phenyl-ethyl)-pyrrol ⁇ d ⁇ ne-2- carboxylic acid amide Moreover, 10% Pd on charcoal, wet with 50% H2O (Aldrich 330108) was used instead of the dry catalyst
  • Step 5 (2S,3S)-3-(Acetylam ⁇ no-methyl)-1-((S)-1 -phenyi-ethyl)-pyrrol ⁇ d ⁇ ne-2-carboxyt ⁇ c acid amide
  • Step 5 5 Sodium azide (5 34 mmol) was added to a solution of (2S 3R)-3- ⁇ odomethyl-1-((S)-1-phenyl- ethyl)-pyrrol ⁇ d ⁇ ne-2-carboxyl ⁇ c acid methyl ester (Step 5 5) (3 56 mmol) in DMF (30 mL) at rt After 18 h, the reaction mixture was poured onto water and extracted with MTBE (2X) The combined organic phases were washed with brine, dried (Na 2 SO 4 ), filtered and
  • Step 5 (2S,3R)-3-lodomethyl-1-((S)-1-phenyl-ethyl)-pyrrol ⁇ d ⁇ ne-2-carboxyl ⁇ c acid methyl ester
  • Step 7 (2S,3S)-3-Morphol ⁇ n-4-ylmethyl-pyrrol ⁇ d ⁇ ne-2-carboxyl ⁇ c acid amide
  • Step 7 (2S,3S)-3-Morpholin-4-ylmethyl-1 -((S)-1 -phenyl-ethyl)-pyrrol ⁇ d ⁇ ne-2-carboxyl ⁇ c acid amide
  • Step 7 3 (2S,3S)-3-Morphol ⁇ n-4-vlmethvl-1-((S)-1-phenyl-ethvl)-pvrrol ⁇ d ⁇ ne-2-carboxvl ⁇ c acid methyl ester
  • Step 9 1 lm ⁇ dazoie-1-carboxyl ⁇ c acid ⁇ 5-[2-(1-fluoro-1-methyl-ethyi) ⁇ py ⁇ m ⁇ d ⁇ n-4-yl]-4 ⁇ methyl- thtazol-2-yl ⁇ -am ⁇ de
  • Step 9 5-l2-(1-Fiuoro-1-methyl-ethyl)-pyr ⁇ mid ⁇ n-4-yl1-4-methyl-th ⁇ azol-2-ylam ⁇ ne
  • Step 10 1 The title compound was prepared in analogy to the procedure described in Example 1 but ⁇ m ⁇ dazole-1-carboxyl ⁇ c acid [4'-methyl-2-(1-tr ⁇ fluoromethyl-cyclopropyl)-[4 5']b ⁇ th ⁇ azolyl-2'-yl]- amide (Step 10 1) was used instead of ⁇ m ⁇ dazole-1-carboxyl ⁇ c acid ⁇ 4-methyl-5-[2- ⁇ 1 -methyl- cyclopropyl)-pyr ⁇ d ⁇ n ⁇ 4-yl]-th ⁇ azol-2-yl ⁇ -am ⁇ de and (2S,3R)-3-hydroxy-pyrrohd ⁇ ne-2-carboxylic acid amide (described in H Fukushima et al , Biorg Med Chem 2004, 12, 6053, H Ji et al J Med Chem 2006, 49, 6254) was used instead of (2S 3R)-3-methyl-pyrrol ⁇ d ⁇ ne-2-carboxyl ⁇ c acid
  • Step 10 1 lm ⁇ dazole-1-carboxylic acid [4'-methyl-2-(1-tr ⁇ fluoromethyt-cyclopropyl)- [4,5']b ⁇ thiazolyl-2'-yl]-am ⁇ de
  • Step 10 2 4'-Methyl-2-(1-tnfluoromethvl-c ⁇ clopropvl)-f4,5'1brthiazolvl-2'-ylarrnne
  • Step 10 N-f4'-Methvl-2-(1-trifluoromethyl-cvclopropvl)-f4,5']b ⁇ th ⁇ azolvl-2'-yl1-acetarrnde
  • Step 12 1 lm ⁇ dazole-1-carboxyl ⁇ c acid [5-(2-d 9 -tert-butyl-pynm ⁇ d ⁇ n-4-yl)-4-methyl-th ⁇ azol-2-yl]-am ⁇ de (Step 12 1) (222 mg) is added to a stirred solution of (2S,3R)-3-methyl-pyrrol ⁇ d ⁇ ne-2- carboxyhc acid amide (Step 1 8) (95 mg) and Et 3 N (264 ⁇ l) in DMF (3 mL) at rt The reaction mixture was stirred at rt for 56 h, evaporated and crystallized from aqueous MeOH to give the title compound MS (ESI) positive 412 1 (M+H), negative 410 2 (M-H)
  • Step 12 1 lm ⁇ dazole-1-carboxyl ⁇ c acid [5-(2-d 9 -tert-butyl-pyrimidin-4-yl)-4-methyl-thiazol-2- yl]-am ⁇ de
  • Step 12 5-(2-d 9 -tert-Butyl-pyrtm ⁇ d ⁇ n-4-yl)-4-methyl-th ⁇ azol-2-ylam ⁇ ne
  • Step 12 3 dg-2,2-D ⁇ methyl-prop!onam ⁇ d ⁇ ne hydrochloride
  • Step 13 1 lm ⁇ dazole ⁇ 1 -carboxylic acid [5-(6-di ⁇ -d ⁇ ethylarn ⁇ no-pyraz ⁇ n-2-yl)-4-methyl-th ⁇ azol- 2-ylJ-am ⁇ de
  • Step 13 3 N-f5-( ⁇ -din-d ⁇ ethvlam ⁇ no-pvraz ⁇ n-2-vl)-4-methvl-thtazol-2-vl)-acetam ⁇ de
  • Step 14 (2S,3R)-3-Methoxymethyl-pyrrol ⁇ d ⁇ ne-2-carboxyl ⁇ c acid amide
  • P13K KinaseGlo assay 50 nl_ of compound dilutions were dispensed onto black 384-well low volume Non Binding Styrene (NBS) plates (Costar Cat No NBS#3676) L-a- phosphatidyiinositol (PI), provided as 10 mg/ml solution in methanol, was transferred into a glass tube and dried under nitrogen beam It was then resuspended in 3% OctylGlucoside (OG) by vortexing and stored at 4°C
  • the KinaseGlo Luminescent Kinase Assay is a homogeneous HTS method of measuring kinase activity by quantifying the amount of ATP remaining in solution following a kinase reaction
  • the PiSKa, PI3K ⁇ and PI3K ⁇ constructs are fusion of p85 ⁇ iSH2 domain and the respective p110 isoforms.
  • the p85 ⁇ fragment and p110 isoform genes were generated by PCR from first strand cDNA generated by RT-PCR from commercial RNA from placenta, testis and brain as described below.
  • the PI3K ⁇ construct was obtained from Roger Williams lab, MRC Laboratory of Molecular Biology, Cambridge, UK (November, 2003) and is described (Pacold, Michael E.; Sappel, Sabine; Perisic, OIga; Lara-Gonzalez, Samuel; Davis, Colin T.; Walker, Edward H.; Hawkins, Phillip T.; Stephens, Len; Eccleston, John F.; Williams, Roger L. Crystal structure and functional analysis of Ras binding to its effector phosphoinositide 3-kinase gamma. Cell (2000), 103(6), 931-943).
  • Baculovirus BV-1075 The construct for Baculovirus BV-1075 was generated by a three-part ligation comprised of a p85 fragment and a p110 ⁇ fragment cloned into vector pBlueBac4.5, The p85 fragment was derived from plasmid p1661-2 digested with Nhe/Spe. The p110 ⁇ fragment derived from is clone was verified by sequencing and used in a LR410 as a Spel/Hindlll fragment. For the generation of the baculovirus expression vector LR410 the gateway LR reaction to transfer the insert into the Gateway adapted pBlueBac4.5 (Invitrogen) vector was used,.
  • the cloning vector pBlueBac4.5 (Invitrogen) was digested with Nhe/Hindlll. This resulted in the Gonstruct PED 153.8.
  • the p85 component (iSH2) was generated by PCR using ORF 318 (described above) as a template and one forward primer KAC1028 (5'- GCTAGCATGCGAGAATATGATAGAT-TATATGAAG-AATATACC) (SEQ ID NO. 1) and two reverse primers, KAC1029 (S'-GCCTCCACCAC-CTCCGCCTG- GTTTAATGCTGTTCATACGTTTGTC) (SEQ ID NO.
  • the two reverse primers overlap and incorporate the 12x GIy linker and the N- terminal sequence of the p110 ⁇ gene to the Spel site.
  • the 12x GIy linker replaces the single GIy linker in the BV1052 construct.
  • the PCR fragment was cloned into pCR2.1 TOPO (Invitrogen). Of the resulting clones, p1661-2 was determined to be correct by sequencing. This piasmid was digested with Nhe and Spel and the resulting fragment was gel-isolated and purified for sub-cloning.
  • the p110 ⁇ cloning fragment was generated by enzymatic digest of clone LR410 (see above) with Spe I and Hindlll. The Spel site is in the coding region of the p110 ⁇ gene. The resulting fragment was gel-isolated and purified for sub-cloning.
  • the cloning vector, pBiueBac4.5 (Invitrogen) was prepared by enzymatic digestion with Nhe and Hindlll.
  • the cut vector was purified with Qiagen column and then dephosphorylated with Calf Intestine alkaline phosphatase (CIP) (BioLabs). After completion of the CIP reaction the cut vector was again column purified to generate the final vector.
  • CIP Calf Intestine alkaline phosphatase
  • BV949 PCR products for the inter SH2 domain (iSH2) of the p85 Pl3K ⁇ , PI3K ⁇ and PI3K ⁇ subunit and for the full-length p11G ⁇ subunit were generated and fused by overlapping PCR.
  • the iSH2 PCR product was obtained from first strand cDNA generated by RT-PCR from commercial human RNA from placenta, testis and brain (Clontech), initially using primers gwG130-p01 (5 1 -
  • the p110 ⁇ fragment was obtained by PCR using as template a p110 ⁇ clone (from unknown source that was sequence verified) using primers gwG130-p04 (5'- ATTAAACCAGGAGGAGGAGGAGGAGGATGCTT- CAGTTTCATAATGCCTCCTGCT -3') (SEQ ID No. 9) which contains linker sequences and the 5'end of p110 ⁇ and gwG130-p06 (5'- AGCTCCGTGATGGTGATGGTGATGTGCTCCAGATC-TGTAGTCTTTCCGAA- CTGTGTG-3') (SEQ ID No.
  • the p85-iSH2/ p110 ⁇ fusion protein was assembled by an overlapping PCR a reaction of the linkers at the 3'end of the iSH2 fragment and the 5'end of the p110 ⁇ fragment, using the above mentioned gwG130-p03 primer and a primer containing an overlapping Histidine tag and the AttB2 recombination sequences (5 -
  • BV1060 PCR products for the inter SH2 domain (iSH2) of the p85 subunit and for the full-length p110 ⁇ subunit were generated and fused by overlapping PCR.
  • the iSH2 PCR product was generated by using as a template the ORF318 (see above) and the primers gwG130-p03 (5'- GGGACAAG-
  • the p110 ⁇ fragment was obtained from first strand cDNA generated by RT- PCR from commercial human RNA from placenta, testis and brain (Clontech), using initially primers gwG154-pO1 (5'- ATGCCCCCTGGGGTGGACTGCCCCAT-3') (SEQ ID No.
  • the p85-iSH2/ p110 ⁇ fusion protein was assembled in a third PCR reaction by the overlapping linkers at the 3'end of the iSH2 fragment and the 5'end of the p110 ⁇ fragment, using the above mentioned gwG130-p03 primer and a primer containing an overlapping Histidine tag and the Gateway (Invitrogen) AttB2 recombination sequences (5'-GGG- ACCACTTTGTACAAGAAAGCTGGGTTTAA- GCTCCGTGATGGTGATGGTGAGTGCTCC-3') (SEQ ID No. 19).
  • This final product was recombined in a Gateway OR reaction into the donor vector pDONR201 (Invitrogen) to generate the ORF319 entry clone.
  • This clone was verified by sequencing and used in a Gateway LR reaction (Invitrogen) to transfer the insert into the Gateway adapted pBlueBac4.5 (Invitrogen) vector for generation of the baculovirus expression vector LR415.
  • Pi3K ⁇ , PI3K ⁇ and PI3Ky were purified in two chromatographic steps: immobilized metal affinity chromatography (IMAC) on a Ni sepharose resin (GE Healthcare) and gel filtration utilizing a Superdex 200 26/60 column (GE Healthcare). All buffers were chilled to 4 0 C and lysis was performed chilled on ice. Column fractionation was performed at room temperature. All buffers used to purify PI3K ⁇ contained 0.05% Triton X100 in addition to what is described videow.
  • IMAC immobilized metal affinity chromatography
  • frozen cells from 10 L of Tn5 cell culture were resuspended in "Lysis Buffer" 20 rrsM Tris-CI, pH 7,5, 500 mM NaCI, 5% glycerol, 5 mM imidazole, 1 mM NaF, 0.1ug/mL okadaic acid (OAA), 5 mM BME, 1 x Complete protease inhibitor cocktail - EDTA-free (20 tablets/1 L buffer, Roche Applied Sciences), benzonase (25U/ml_ buffer, EMD Biosciences) at a ratio of 1 :6 v/v pellet to Lysis Buffer ratio, and mechanically lysed by dounci ⁇ g 20 strokes using a tight-fitting pestle.
  • Lysis Buffer 20 rrsM Tris-CI, pH 7,5, 500 mM NaCI, 5% glycerol, 5 mM imidazole, 1 mM NaF, 0.1ug/mL ok
  • the lysate was centrifuged at 45,000 g for 30 minutes, and the supernatant was loaded onto a pre-equilibrated IMAC column (3 mL resin/100 mL lysate).
  • the column was washed with 3-5 column volumes of Lysis Buffer, followed by a second wash of 3-5 column volumes with 20 mM Tris-CI, pH 7.5, 500 mM NaCI, 5% glycerol, 45 mM imidazole, 1 mM NaF, 0.1 ⁇ g/mL OAA, 5 mM BME, 1x Complete protease inhibitor cocktail - EDTA-free.
  • Protein was eluted with 20 mM Tris-CI, pH 7.5, 0.5 M NaCI, 5% glycerol, 250 mM imidazole, 1 mM NaF, 0.1 ⁇ g/mL OAA, 5 mM BME, 1x Complete protease inhibitor cocktail - EDTA-free. Pertinent fractions were analyzed by SDS-PAGE and pooled accordingly.
  • the protein was further purified by gel filtration on a Superdex 200 26/60 column equilibrated in 20 mM Tris-CI, pH 7 5, 0 5 M NaCI, 5% glycerol, 1 mM NaF, 5 mM DTT, 1x Complete protease inhibitor cocktati - EDTA-free Pertinent fractions were analyzed by SDS-PAGE and pooled accordingly An equal volume of Dialysis Buffer (20 mM T ⁇ s-CI, pH 7 5, 500 mM NaCI, 50% glycerol, 5 mM NaF, 5 mM DTT) was added to the pool and than dialyzed against Dialysis Buffer two changes (one change overnight) Protein was stored at - 20 0 C
  • PI3K5 was purified in three chromatographic steps immobilized metal affinity chromatography on a Ni Sepharose resin (GE Healthcare), gel filtration utilizing a Superdex 200 26/60 column (GE Healthcare), and finally a ion exchange step on a Q-HP column (GE Healthcare) All buffers were chilled to 4 0 C and lysis was performed chilled on ice Column fractionation was performed at room temperature
  • Buffer A 20 mM Tris-CI, pH 8 2, 5% glycerol, 1 mM NaF 1 0 1 ⁇ g/mL OAA, 5 mM DTT and loaded onto a prepared Q-HP column
  • Buffer B 20 mM T ⁇ s-CI, pH 8 2, 1 M NaCI, 5% glycerol 1 mM NaF 0 1 ug/mL OAA, 5 mM DTT for 3-5 column volumes
  • Buffer B 20 mM T ⁇ s-CI, pH 8 2, 1 M NaCI, 5% glycerol 1 mM NaF 0 1 ug/mL OAA, 5 mM DTT for 3-5 column volumes
  • Buffer B Typically the protein elutes at ⁇ 200 mM NaCI Pertinent fractions were analyzed by SDS-PAGE and pooled accordingly
  • An equal volume of Dialysis Buffer (20 mM Tns-CI, pH 7 5, 500 mM NaCI, 50% glycerol

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Diabetes (AREA)
  • Hematology (AREA)
  • Epidemiology (AREA)
  • Endocrinology (AREA)
  • Obesity (AREA)
  • Oncology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Plural Heterocyclic Compounds (AREA)

Abstract

The present invention relates to compounds of formula (I), and salts thereof, wherein the substituents are as defined in the description, to compositions and use of the compounds in the treatment of diseases ameloriated by inhibition of phosphatidylinositol 3-kinase.

Description

Substituted 2-carboxamide cvcloamino ureas
The present invention relates to substituted 2-carboxamιde cycloammo ureas, as new phosphatidyhnositol (Pl) 3-kinase inhibitor compounds their pharmaceutically acceptable salts, prodrugs thereof and processes for their production This invention also relates to compositions of these compounds, either alone or in combination with at least one additional therapeutic agent, and optionally in combination with a pharmaceutically acceptable carrier This invention still further relates to methods of use of these compounds either alone or in combination with at least one additional therapeutic agent, in the prophylaxis or treatment of a number of diseases, in particular, those mediated by one or more of abnormal activity of growth factors, receptor tyrosine kinases, protein senne/heroine kinases, G protein coupled receptors and phospholipid kinases and phosphatases
Phosphatidyhnositol 3-kinases (PISKs) comprise a family of lipid kinases that catalyze the transfer of phosphate to the D-3' position of inositol lipids to produce phosphoιnosιtol-3- phosphate (PIP), phosphoιnositol-3,4-dιphosphate (PIPa) and phosphoinosιtol-3,4,5- tπphosphate (PIP3) that, in turn, act as second messengers in signaling cascades by docking proteins containing pleckstπn-homology, FYVE, Phox and other phospholipid-binding domains into a variety of signaling complexes often at the plasma membrane
((Vanhaesebroeck et al , Annu Rev Biochem 70 535 (2001), Katso et al , Annu Rev Cell Dev Biol 17 615 (2001 )) Of the two Class 1 PI3Ks, Class 1 A PI3Ks are heterodimers composed of a catalytic p110 subunit (a, β, δ isoforms) constitutively associated with a regulatory subunit that can be ρ85α, p55α, p50α, p85β or p55γ The Class 1 B sub-class has one family member, a heterodtmer composed of a catalytic p110γ subunit associated with one of two regulatory subunits, p101 or p84 (Fruman et al , Annu Rev Biochem 67481 (1998), Suire et al , Curr Biol 15 566 (2005)) The modular domains of the p85/55/50 subunits include Src Homology (SH2) domains that bind phosphotyrosine residues in a specific sequence context on activated receptor and cytoplasmic tyrosine kinases, resulting in activation and localization of Class 1A PISKs Class 1B PI3K is activated directly by G protein-coupled receptors that bind a diverse repertoire of peptide and non-peptide ligands (Stephens et al , Ce// 89 105 (1997)), Katso et al , Annu Rev Cell Dev Biol 17 615-675 (2001)) Consequently, the resultant phospholipid products of class I PI3K link upstream receptors with downstream cellular activities including proliferation, survival, chernotaxis, cellular trafficking, motility, metabolism inflammatory and allergic responses, transcription and translation (Cantley et al , Ce// 64 281 (1991), Escobedo and Williams, Nature 335 85 (1988), Fantt et a! , Ce// 69413 (1992))
In many cases, PfP2 and PIP3 recruit Akt, the product of the human homologue of the viral oncogene v-Akt, to the plasma membrane where it acts as a nodal point for many intracellular signaling pathways important for growth and survival (Fantl et al , Ce// 69 413- 423(1992), Bader et al , Nature Rev Cancer 5 921 (2005), Vtvanco and Sawyer, Nature Rev Cancer 2 489 (2002)) Aberrant regulation of PI3K, which often increases survival through Akt activation, is one of the most prevalent events in human cancer and has been shown to occur at multiple levels The tumor suppressor gene PTEN, which
dephosphorylates phosphoinositides at the 3' position of the inositol ring and in so doing antagonizes PI3K activity, is functionally deleted in a variety of tumors In other tumors, the genes for the p110« isoform, PIK3CA, and for Akt are amplified and increased protein expression of their gene products has been demonstrated in several human cancers Furthermore, mutations and translocation of p85α that serve to up-reguiate the p85-p110 complex have been described in human cancers Finally, somatic missense mutations in PIK3CA that activate downstream signaling pathways have been described at significant frequencies in a wtde diversity of human cancers (Kang at el , Proc Natl Acad Sci USA 102 802 (2005), Samuels et al , Science 304 554 (2004), Samuels et al , Cancer Cell 7 561- 573 (2005)) These observations show that deregulation of phosphoιnosιtol-3 kinase and the upstream and downstream components of this signaling pathway is one of the most common deregulations associated with human cancers and proliferative diseases (Parsons et al , Nature 436792 (2005), Hennessey at el , Nature Rev Drug Disc 4 988-1004 (2005))
In view of the above, inhibitors of PI3Ks would be of particular value in the treatment of proliferative disease and other disorders Selectivity towards the PI3K α isoform is desirable, and further desirable properties include improved pharmacokinetic properties and/or chemical stability
WO2004/096797 discloses certain thiazole derivatives as inhibitors of PI3 kinase and their use as pharmaceutical
WO 2005/021519 also discloses certain thiazole derivatives as inhibitors of PI3 kinase and their use as pharmaceutical It has now been found that the substituted 2-carboxamide cycloamino ureas of the formula I given below have advantageous pharmacological properties and inhibit, for example, the PI3 kinases (phosphatidylmositol 3-kmase) In particular, preferably, these compounds show selectivity for PI3K alpha versus beta and/or delta and/or gamma subtypes in the biochemical and/or in the cellular assay A further property which is preferably desirable for compounds of formula I includes improved stability, for example, improved chemical stability e g in solid form and/or in buffer solution Hence, the compounds of formula I are suitable, for example, to be used in the treatment of diseases depending on the PI3 kinase (in particular PI3K alpha, such as those showing somatic mutation of PIK3CA or germline mutations or somatic mutation of PTEN), especially proliferative diseases such as tumor diseases and leukaemias
In a first aspect, the present invention provides compounds of formula
Figure imgf000004_0001
wherein,
m is 0 or 1 ,
n is 0 or 1 ,
R1 represents H, halogen, unsubstituted CrC4-alkyl or substituted CrC4-alkyl,
R2 is independently selected from the group consisting of unsubstituted or substituted
Ct-Ca-alkyl, unsubstituted or substituted C1-(VaIkOXy, unsubstituted or substituted amino, halogen or hydroxy,
R3 is independently selected from the group consisting of unsubstituted or substituted d-Ca-alkyl, unsubstituted or substituted CrCralkoxy, unsubstituted or substituted amino, halogen or hydroxy, R4 is independently selected from the group consisting of unsubstituted or substituted Ci-C8-alkyl, unsubstituted or substituted Ci~C8-alkoxy, halogen or hydroxy, or
R3 and R4 form, together with the same or different carbon atom to which they are attached,
C3-C8-cycloaikyl or heterocyciyl,
Rs is unsubstituted or substituted heteroaryl,
or a salt, solvate, hydrate or prodrug thereof, and
excluding the compound (1R,2S,5S)-3-aza-bιcyclo[3 1 0]hexane-2,3-dιcarboxylιc acid 2- amιde 3-{[5-(2-tert-butyl-pyrιmsdιn-4-yi)-4-methyl-thiazol-2-yl]~arnιde} The invention may be more fully appreciated by reference to the following description, including the following glossary of terms and the concluding examples As used herein, the terms "including", "containing" and "comprising" are used herein in their open, non-limiting sense Any formula given herein is intended to represent compounds having structures depicted by the structural formula as well as certain variations or forms In particular, compounds of any formula given herein may have asymmetric centers and therefore exist in different stereoisomers forms such as different enantiomeric forms If at least one asymmetrical carbon atom is present in a compound of the formula I, such a compound may exist in optically active form or in the form of a mixture of optical isomers, e g in the form of a racemic mixture Thus an asymmetric carbon atom may be present in the (R)-, (S)- or (Reconfiguration, preferably in the (R)- or (S)-confιguratιon All optica) isomers and their mixtures, including the racemic mixtures, are part of the present invention Thus, any given formula given herein is intended to represent a racemate, one or more enantiomeric forms, one or more diastereomeπc forms, one or more atropisomeric forms, and mixtures thereof Furthermore, certain structures may exist as geometric isomers (e g cis and trans isomers), as tautomers, or as atropisomers For example, substituents at a double bond or a ring may be present in as- (-Z-) or ttans (=E-) form The compounds of the invention may thus be present as mixtures of isomers or preferably as pure isomers, preferably as enantiomer-pure diastereomers or pure enantiomers
Any formula given herein is intended to represent hydrates, solvates, and polymorphs of such compounds, and mixtures thereof Any formula given herein is also intended to represent unlabeled forms as well as isotopically labeled forms of the compounds, lsotoptcally labeled compounds have structures depicted by the formulas given herein except that one or more atoms are replaced by an atom having a selected atomic mass or mass number. Examples of isotopes that can be incorporated into compounds of the invention include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorous, fluorine, and chlorine, such as 2H, 3H, 11C, 13C, 14C1 15N, 31P, 32P, 18F 35S, 36CI, 125I respectively. Various isotopically labeled compounds of the present invention, for example those into which radioactive isotopes such as 3H, 13C, and 14C are incorporated Such isotopically labeled compounds are useful in metabolic studies (preferably with 14C), reaction kinetic studies (with, for example 2H or 3H), detection or imaging techniques, such as positron emission tomography (PET) or single-photon emission computed tomography (SPECT) including drug or substrate tissue distribution assays, or in radioactive treatment of patients. In particular, an 18F or labeled compound may be particularly preferred for PET or SPECT studies. Further, substitution with heavier isotopes such as deuterium (i e., 2H) may afford certain therapeutic advantages resulting from greater metabolic stability, for example increased in vivo half-life or reduced dosage requirements. Isotopically labeled compounds of this invention and prodrugs thereof can generally be prepared by carrying out the procedures disclosed in the schemes or in the examples and preparations described below by substituting a readily available isotopically labeled reagent for a πon-isotopically labeled reagent
Further, substitution with heavier isotopes, particularly deuterium (i.e., 2H or D) may afford certain therapeutic advantages resulting from greater metabolic stability, for example increased in vivo half-life or reduced dosage requirements or an improvement in therapeutic index. It is understood that deuterium in this context is regarded as a substituent in the compound of the formula (I) The concentration of such a heavier isotope, specifically deuterium, may be defined by the isotopic enrichment factor The term "isotopic enrichment factor" as used herein means the ratio between the isotopic abundance and the natural abundance of a specified isotope If a substituent in a compound of this invention is denoted deuterium, such compound has an isotopic enrichment factor for each designated deuterium atom of at least 3500 (52.5% deuterium incorporation at each designated deuterium atom), at least 4000 (60% deuteπum incorporation), at least 4500 (67 5% deuterium incorporation), at least 5000 (75% deuterium incorporation), at least 5500 (82 5% deuterium incorporation), at least 6000 (90% deuterium incorporation), at least 6333 3 (95% deuterium incorporation), at least 6466 7 (97% deuterium incorporation), at least 6600 (99% deuterium incorporation), or at least 6633 3 (99 5% deuterium incorporation) In the compounds of this invention any atom not specifically designated as a particular isotope is meant to represent any stable isotope of that atom Unless otherwise stated, when a position is designated specifically as "H" or "hydrogen", the position is understood to have hydrogen at its natural abundance isotopic composition Accordingly, in the compounds of this invention any atom specifically designated as a deuterium (D) is meant to represent deuterium, for example in the ranges given above When referring to any formula given herein, the selection of a particular moiety from a list of possible species for a specified variable is not intended to define the moiety for the variable appearing elsewhere In other words, where a variable appears more than once, the choice of the species from a specified list is independent of the choice of the species for the same variable elsewhere in the formula (where one or more up to all more general expressions in embodiments characterized as preferred above or below can be replaced with a more specific definition, thus leading to a more preferred embodiment of the invention, respectively)
Where the plural form (e g compounds, salts, pharmaceutical preparations, diseases and the like) is used, this includes the singular (e g a single compound, a single salt, a single pharmaceutical preparation, a single disease, and the like) "A compound" does not exclude that (e g in a pharmaceutical formulation) more than one compound of the formula (I) (or a salt thereof) is present Salts are preferably the pharmaceutically acceptable salts of compounds of formula (I) if they are carrying salt-forming groups Acids/bases required to form the salts are generally known in the field
The following general definitions shall apply in this specification, unless otherwise specified
Halogen (or halo) denotes fluorine, bromine, chlorine or iodine, in particular fluorine, chlorine Halogen-substituted groups and moieties, such as alkyl substituted by halogen (halogenalkyl) can be mono-, poly- or per-halogenated Hetero atoms are atoms other than carbon and hydrogen, preferably nitrogen (N), oxygen (O) or sulfur (S), in particular nitrogen
"Alkyl" refers to a straight-chain or branched-chain alkyl group, and includes C^alkyl and C1 8aikyl where stated Such alkyi groups include, for example, methyl, ethyl, n- or sso- propyl, n-, fso-, sec- or tert-butyl, n-pentyl, n-hexyl, n-heptyl, n-octyl, with particular preference given to methyl, ethyl, n-propyl, iso-propyi, n-butyl and iso-butyl Alkyt may be unsubstituted or substituted Exemplary substituents include, but are not limited to hydroxy, alkoxy, halogen (especially fluoro), amino, mono- or di-alkyl substituted amino, acetylamino and morpholinyl An example of a substituted alkyhs trifluoromethyl Cycioalkyl may also be a substituent to alkyl An example of such a case is the moiety (alkyl)-cycloalkyl, such as (alkyl)-cyclopropyl or (atkyl)-cyclobutyl, e g methyl-cyclopropyl or methyl-cyclobuty! A more specific example of an (alkyl)-cycloalkyl moiety includes geminal-type of substitution pattern, e g 1 -alkyl cycioalkyl, such as 1 -methyl cyclopropyl Another example of cycioalkyl as a substituent to alkyl is alkandiyl-cycloaikyl, such as alkandiyl-cyclopropyl, e g -CH2- cyclopropyl Ci-C8-alkyl is alkyl with from and including 1 up to and including 8 carbon atoms, preferably from and including 1 up to and including 4 carbon atoms (Ci-C4-alkyl), and is linear or branched, preferably, lower alkyl is butyl, such as n-butyl, sec-butyl, isobutyl, tert- butyl, propyl, such as n-propyl or isopropyl, ethyl or preferably methyl
Each alkyl part of other groups like "alkoxy", "alkoxyalkyl", "alkoxycarbonyl", "alkoxy- carbonylaikyl", "alkylsulfonyl", "alkylsulfoxyl", "alkylamino", "halogenalkyl" shall have the same meaning as described m the above-mentioned definition of "alkyl" "C3.8-Cycloalkyr refers to a saturated or partially saturated, monocyclic, fused polycycllc, or spiro polycyclic, carbocycle having from 3 to 8 ring atoms per carbocycle Illustrative examples of cycioalkyl groups include the following moieties cyclopropyl, cyclobutyl, cyclpentyl and cylclohexyl Cycioalkyl may be unsubstituted or substituted, exemplary substituents are provided in the definition for alkyl
"Heterocyclyl" refers to a heterocyclic radical that is saturated or partially saturated and is preferably a monocyclic or in a broader aspect of the invention bicyclic, tricyclic or spirocyclic ring, and has 3 to 24, more preferably 4 to 16, most preferably 5 to 10 and most preferably 5 or 6 ring atoms, wherein one or more, preferably one to four especially one or two carbon πng atoms are replaced by a heteroatom, the bonding ring preferably having 4 to 12, especially 5 to 7 ring atoms The heterocyclic radical (heterocyclyl) may be unsubstituted or substituted by one or more, especially 1 to 3, substituents independently selected from the group consisting of alky), or the substituents defined above for substituted alkyl and / or from one or more of the following substituents oxo (=0), thiocarboπyl (=S), ιmιno(=NH), imtno- lower alkyl Further, heterocyclyl is especially a heterocyclyl radical selected from the group consisting of oxiranyl, aztridinyl, 1 ,2-oxathιolanyl, tetrahydrofuryl, tetrahydropyranyl, pyrrolinyl, pyrroiidinyl, piperidinyl, piperazinyl, morpholinyl, thiomorpholinyl, (S-oxo or S1S- dιoxo)-thιomorpholιnyl, azepanyl, diazepanyl, especially 1 ,4-dιazepanyl, tetrahydroquinolyl, tetrahydrotsoquinolyi, decahydroquinolyl, octahydroisoquinolyl, isochromanyl, chromanyl and 2,3-dιnydro-benzo[1 ,4]dιoxin-6-yl, each of these radicals being unsubstituted or substituted by one or more, preferably up to three, substituents selected from those mentioned above and/or from one or more of the following substituents oxo (=O), thiocarbonyl (=S), ιmιno(=NH), imino-lower alkyl
"Heteroaryl" refers to a heterocyclic radical that is unsaturated (in particular maximally unsaturated, eg carrying the highest possible number of conjugated double bonds in the rιng(s)), and is preferably a monocyclic or in a broader aspect of the invention bicyclic or tncyclic ring, and has 3 to 24, more preferably 4 to 16, most preferably 5 to 10 and most preferably 5 or 6 ring atoms, wherein one or more, preferably one to four, especially one or two ring atoms are a heteroatom, the bonding ring (ι e the ring which is bonded to the rest of the molecule) preferably having 4 to 12, especially 5 to 7 ring atoms The heteroaryl radical may be unsubstituted or substituted by one or more, especially 1 to 3, substituents independently selected from the group consisting of alkyl or the substituents defined above for substituted alkyl and / or from one or more of the following substituents oxo (=0), thiocarbonyl (=S), imιno(=NH), imino-lower alkyl, and, for nitrogen containing heteroaryls, including N-oxides thereof Further, heteroaryl is especially a heteroaryl radical selected from the group consisting of azirinyl thienyl {= thiophenyl), furanyl, pyranyl, thiopyranyl, thian- threnyl, isobenzofuranyl benzofuranyl, chromenyl, 2H-pyrrolyl, pyrrolyl, imidazolyl, imidaz- olidinyl, benzimidazolyl, pyrazolyl, pyrazinyl, pyrazoiidinyl, thiazolyl, isothiazolyl, dithiazolyl, oxazolyl, isoxazolyl, pyridyl, pyπmidinyl, pyridazinyl, indolizinyl, isoindolyl, 3H-ιndolyl, indolyl, benzimidazolyl, cumaryl, indazolyl tπazolyl, tetrazolyl, puπnyl, 4H-quιnolιzιnyl, isoquinolyl, quinolyl, dibenzofuranyl, benzothiophenyl, dibenzothiophenyl, phthalazinyl, naphthyridinyl, quinoxalyl, quinazoltnyl, quinazolinyl, cinnolinyl pteridtnyl, carbazolyl, beta-carboltnyl, phenanthπdinyl, acridinyl, peπmidmyl, phenanthrolinyl, furazanyi, phenazinyl, phenothiaztnyl, phenoxazinyl, chromenyl and benzo[1 ,3]dιoxol-5-yl, each of these radicals being un- substituted or substituted by one or more, preferably up to three, substituents selected from those mentioned above aryl and/or from one or more of the following substituents oxo (=0), thiocarbonyl (=S), ιmιno(=NH), immo-lower alkyl and, for nitrogen containing heteroaryls, including N-oxides thereof
"Treatment" includes prophylactic (preventive) and therapeutic treatment as well as the delay of progression of a disease or disorter
'PI3 kinase mediated diseases" (especially PI3K alpha mediated diseases) are especially such disorders that respond in a beneficial way (e g amelioration of one or more symptoms, delay of the onset of a disease, up to temporary or complete cure from a disease) to the inhibition of a PI3 kinase, especially inhibition of PISKalpha (where the diseases to be treated may include those showing somatic mutation of PIK3CA or germfine mutations or somatic mutation of PTEN) Diseases to be treated include especially proliferative diseases such as tumor diseases, including solid tumors, leukaemias, glioblastoma, breast cancer and prostate cancer may be mentioned) "Salts" (which, what is meant by "or salts thereof" or "or a salt thereof), can be present afone or in mixture with free compound of the formula I and are preferably pharmaceutically acceptable salts Salt-forming groups in a compound of formula (I) are groups or radicals having basic or acidic properties Compounds having at least one basic group or at least one basic radical, e g , amino, a secondary amino group not forming a peptide bond or a pyπdyl radical, may form acid addition salts, e g , with inorganic acids, such as hydrochloric actd, sulfuric acid or a phosphoric acid, or with suitable organic carboxylic or sulfonic acids, e g , aliphatic mono- or di-carboxylic acids, such as tπfluoroacetic acid, acetic actd, propionic acid, glycolic acid, succinic acid, maleic acid, fumaric acid, hydroxymaleic acid, malic acid, tartaric acid, citric acid or oxalic acid, or ammo acids, such as arginine or lysine, aromatic carboxylic acids, such as benzoic acid, 2-phenoxy-benzoιc acid, 2-acetoxy-benzoic acid, salicylic acid, 4-amιnosalιcylιc acid, aromatic-aliphatic carboxylic acids, such as mandelic acid or cinnamic acid heteroaromatic carboxylic acids, such as nicotinic acid or isonicotinic acid, aliphatic sulfonic acids, such as methane-, ethane- or 2-hydroxyethanesulfonιc acid, or aromatic sulfonic acids, e g , benzene-, p-toluene- or naphthalene-2-sulfonic acid When several basic groups are present mono- or poly-acid addition salts may be formed
Compounds of formula (i) having acidic groups, a carboxy group or a phenolic hydroxy group, may form metal or ammonium salts, such as alkali metal or alkaline earth metal salts, e g , sodium, potassium, magnesium or calcium salts, or ammonium salts with ammonia or suitable organic amines, such as tertiary monoamines, e g , triethylamsne or
trι(2-hydroxyethyl)-amιne, or heterocyclic bases, e g , Λ/-ethyl-pιpeπdιne or
Λ/,Λf-dιmethylpιperazιne Mixtures of salts are possible
Compounds of formula (I) having both acidic and basic groups can form internal salts
For isolation or purification purposes it is also possible to use pharmaceutically unacceptable salts, for example picrates or perchlorates For therapeutic use, only pharmaceutically acceptable salts or free compounds are employed (where applicable in the form of pharmaceutical preparations), and these are therefore preferred In view of the close relationship between the novel compounds in free form and those in the form of their salts, including those salts that can be used as intermediates, for example in the purification or identification of the novel compounds, any reference to the free compounds hereinbefore and hereinafter is to be understood as referring also to the corresponding salts, as appropriate and expedient
Compounds of the present invention may also form solvates and hydrates, and as such any reference to a compound of formula (I) is therefore to be understood as referring also to the corresponding solvate and/or hydrate of the compound of formula (I)1 as appropriate and expedient
The present invention also relates to pro-drugs of a compound of formula (I) that convert in vivo to the compound of formula (I) as such Any reference to a compound of formula (I) is therefore to be understood as referring also to the corresponding pro-drugs of the compound of formula (I), as appropriate and expedient Combination refers to either a fixed combination tn one dosage unit form, or a kit of parts for the combined administration where a compound of the formula I and a combination partner (e g an other drug as explained below, also referred to as 'therapeutic agent" or "co- agent") may be administered independently at the same time or separately within time intervals, especially where these time intervals allow that the combination partners show a cooperative, e.g. synergistic effect. The terms "co-administration" or "combined administration" or the like as utilized herein are meant to encompass administration of the selected combination partner to a single subject in need thereof (e.g. a patient), and are intended to include treatment regimens in which the agents are not necessarily administered by the same route of administration or at the same time. The term "pharmaceutical combination" as used herein means a product that results from the mixing or combining of more than one active ingredient and includes both fixed and non-fixed combinations of the active ingredients. The term "fixed combination" means that the active ingredients, e.g. a compound of formula I and a combination partner, are both administered to a patient simultaneously in the form of a single entity or dosage. The term "non-fixed combination" means that the active ingredients, e.g. a compound of formula I and a combination partner, are both administered to a patient as separate entities either simultaneously, concurrently or sequentially with no specific time limits, wherein such administration provides therapeutically effective levels of the two compounds in the body of the patient. The latter also applies to cocktail therapy, e.g. the administration of three or more active ingredients.
In preferred embodiments, which are preferred independently, collectively or in any combination or sub-combination, the invention relates to a compound of the formula f, in free base form or in salt form, wherein the substituents are as defined herein.
As shown in formula I, the alpha-amide substituent is at the 2-ρosition on the pyrrolidine ring and the stereochemistry is as drawn and the R4 substituent is at position 3 of the pyrrolidine ring, and each substituent has the defined stereochemistry which is cis- relative to each other.
R1 preferably represents CrC4-aikyl, most preferably methyl.
R2 preferably represents CrC4-a!kyl, C1-C4^IkOXy, di-CrC4-alkyl-amino, halogen or
hydroxy.
R2 more preferably represents methyl, methoxy, dimethylamino, fluoro or hydroxy.
R2 even more preferably represents methoxy, dimethylamino. fluoro or hydroxy. R3 preferably represents C1-C4-HlRyI, C1-C4-SIkOXy, dι-CrC4-alkyl-amιnα, halogen or hydroxy
R3 more preferably represents methyl, methoxy, dimethylamino, fluoro or hydroxy
R3 even more preferably represents methyl, methoxy, dimethylamino, fluoro or hydroxy
If present (i e m=1 and/or n=1 ) the R2 or R3 group may be attached at the 2-and/or 3- and/or 4- and/or 5- position of the pyrrolidine ring of formula I Most preferably, the R2 or R3 group is attached at the 3-postιon of the pyrrolidine ring, i e on the same carbon which is
simultaneously substituted by the R4 group
R4 preferably represents, hydroxy, d-C^alkyl or CrC4-alkyl substituted by CrC4-alkoxyt unsubstituted or substituted ammo, heterocyclyl or heteroaryl
R4 more preferably represents, hydroxy, CrC4-alkyl or C^C^alkyi substituted by C1-C4- alkoxy, dι-CrC4-aikyl-amιno, aeetylamino, morpholinyl or pyridyl
R4 more preferably represents, hydroxy, methyl or methyl substituted by d-C4-aIkoxy, dι- CrC4-alkyl-amιno, aeetylamino, morpholinyl or pyridyl
R4 most preferably represents, hydroxy, methyl, methoxymethyl, dimethylamino-methyl, acetylamino-methyl, morpholιn-4-ylmethyl or pyπdyl-methyl As noted above, compounds according to formula I are provided wherein R3 and R4 may form, together with the same or different carbon atom to which they are attached, C3-C8- cycloalkyl or heterocyclyl, and wherein the compound (1R,2S,5S)-3-aza- bιcyclo[3 1 0]hexane-2 3-dιcarboxylιc acid 2-amιde 3-{(5~(2-tert-butyl-pyrιmιdιn-4-yl)-4- methyl-thιazol-2-yl]-amιde} is excluded
Compounds according to formula I include those wherein the substitutents are defined as for a compound of formula (I), and
R4 is independently selected from the group consisting of unsubstituted or substituted CrCg-alkyl unsubstituted or substituted CrC8-alkoxy, halogen or hydroxy, or R and R4 form, together with the same carbon atom to which they are attached, C3-C8- cycloalkyl, or
R3 and R4 form, together with the same or different carbon atom to which they are attached, heterocyclyl
In a further, alternative, compounds according to formula I include those wherein the substitutents are defined as for a compound of formula (I), and
R4 is independently selected from the group consisting of unsubstituted or substituted
CrCg-alkyl, unsubstituted or substituted d-C8-alkoxy, halogen or hydroxy, or
R3 and R4 form, together with the same carbon atom to which they are attached, C3-C3- cycloalkyl or heterocyclyl ^preferably cycloalkyl)
Thus, when R3 and R4 form a C3-C8-cycloalkyl (preferred) or heterocyclyl, it is preferred that the R3 group is attached at the 3-posιtιon of the pyrrolidine ring, i e on the same carbon which is simultaneously substituted by the R4 group
R5 as noted above, represents unsubstituted or preferably substituted heteroaryl,
substituted by one or more, preferably one moiety independently selected from the group consisting of halogen, hydroxy, cyano, nitro, d-Cr-alkyl, per-deutero d-C/-aIkyl, C3-C12-cycloalkyl, (d-CraikylJ-Cs-drcycloalkyl, (halo-d-d-alkyQ-Cs-da-cydoalkyl, amino-d-Cralkyl, halo-CrC7-alkyl, N-Ci-C7-alkanoyiamιno~CrC7-alkyl, N-C1-C7- alkanesulfonyl-amino-d-Cy-alkyl, pyrrolidino-d-Cr-alkyl, oxo- pyrrolidino-d-Cr-alkyl, d-C7-alkanesu!fιnyl, d-C7-alkanesulfonyl, d-Cr-alkoxy, amino, N-mono- or N,N-dι- (d-CT-alkyO-amino, N-mono- or N,N-dι-(per-deutero CrC7-alkyl)-amino, N-mono- or N,N~dι-(d-C7-cycloalkyl)-amιno
Figure imgf000014_0001
pyrroltdino, oxo-pyrrolidino, piperidino, pιperazιn-1-yl, 4-(d-C7-atkyl, d^-alkoxy-d-Cr-alkyl, halo-d-Cr-alkyl or C3-C10-cycloalkyl)-piperaz!n-1-yl, Ηamino-d-Cr-alkyO-piperazin-i-yl, 4-[N-mono- or N,N-dι-(Ci-C7-alkylamιno)-Ci-C7-alkyl]-pιperazιn-1-yl, morpholino, thiomorpholino, S- oxo- or S,S-dιoxothιomorpholιno CrC7-alkanesulfonylamιno, carbamoyl, N-mono- or N,N-dι-(CrCralkyl, CrC7-alkoxy-CrC7-alkyl, amιno-CrC7-alkyl and/or (N'-mono- or
N',N'-dι-(C1-C7-alkyl)-amιno-Ci-C7-alkyl)-carbamoyt, pyrrohdιn-1-carbonyl pιperιdιn-1- carbonyl, ptperazιn-1-carbonyl, Φ-Cd-CralkylJpϊperazin-i-carbonyl, morpholιn-1- carbonyl thιomorpholιn-1-carbonyl, S-oxo- or S,S-dioxothiorrsorpholin~1-carbonyl sulfo, CrCj-alkanesulfoπyl, d-Cy-alkanesulfinyl sulfamoyl, N-mono- or N,N-dι-(CrC7-alkyl)- sulfamoyl, morpholinosulfonyl, thiomorpholinosulfonyl, thtazoiyl
R6 more preferably represents unsubstituted heteroaryl or heteroaryi substituted by one substituent selected from the group consisting of
CrC4-alkyl (in particular tert -butyl), per-deutero CrC4-alkyi (m particular cfe-tert-butyl), halo-d-C4-alkyl (in particular 1-fiuoro-1 -methyl-ethyl, 2, 2,2-tπfluoro-1,1 -dimethyl-ethyl), HCrCralkylJ-Cs-Cercycloalkyl (in particular 1-methyl-cyclopropyl), (halo~CrC4-aikyI)- C3-C6-cycloalkyl (tn particular 1-trιfluoromethyl-cyclopropyl), di-d-CValkylamino (in particular diethylamino), dt-(per-deutero d^-alky^ammo (in particular Cf10- diethylamino)
R5 more preferably represents heteroaryl selected from the group consisting of pyridyl (especially 4-pyπdyl), pynmidinyl (especially 4-pyrιmιdιnyl), pyrazinyl (especially 2- pyrazinyl) and thiazolyl (especially thιazol-4-yl),
wherein said substituent is selected from the group consisting of Ci-C4-alkyl (in particular tert -butyl), per-deutero CrC4-alkyl (in particular dg-tert-butyl), halo-CrC4- alkyl (in particular 1-fluoro-1 -methyl-ethyl, 2,2,2-tπfluoro-1,1 -dimethyl-ethyl), 1-(C1-C4- alkyl)-C3-C6-cycloalkyl (in particular 1-methyl-cyclopropyl), (halo-d-C4-alkyl)-C3-Cβ- cycloalkyl (tn particular i-tnfluoromethyl-cycϊopropyl), dι-C1-C4~alkylamιno (in particular diethylamino), dι-(ρer-deutero CrC4-alkyl)amιno (in particular c/,0-dιethylamιno)
R5 very preferably represents a heteroaryl selected from the group consisting of 2-(1- methyl-cyclopropyl)-pyπdιn-4-yl, 2-(2 2,2-tπfluoro-1 ,1-dιmethyl-ethyl)-pyπdιn-4-yl, 2-(1- fluoro-1-methyl-ethyl)-pyrιmιdιn-4-yl, 2-(1-(tπfluoromethyl)cyclopropyl)thιazole-4-yl, 2- d9-tert-butyl-pyrιmιdιn-4-yl, 6-tert-butyl-pyrazin-2-yl
R5 very preferably represents in another embodiment a heteroaryi selected from the group consisting of 2-(1-methyl-cyclopropyl)-pyπdιn-4-yl, 2-(2,2 2-trιfluoro-1 1 -dimethyl-ethyl)- pyπdιn-4-yl 2-(1-fluoro-1-methyl-ethyl)-pyπmιdιn-4-yl 2-(1-(tπfluoromethyl)cyclopropyl) thιazoie-4-yl, 2-d9-tert-butyi-pyπmιdιπ-4-yl, 6-tert-butyl-pyrazιn-2-yl, 2-tert-butyl-pyπdιn- 4-yl It is preferred that when R5 is substituted pyπdyl, e g 4-pyrιdyl, substituted by at least one substituent (as defined herein above), said substituent is at least at the 2-posιtιon of the pyπdyl group
It is preferred that when R5 is substituted pyπmidinyl, e g 4-pyπmιdιnyl, substituted by at least one substituent (as defined herein above), said substituent is at least at the 2- position of the pyπmidinyl group
It is preferred that when R is substituted pyrazinyl, e g 2-pyrazιnyl, substituted by at least one substituent (as defined herein above), said substituent is at least at the 6- position of the pyrazinyl group
It is preferred that when R is substituted thiazole, e g thιazole-4-yl, substituted by at least one substituent (as defined herein above), said substituent is at least at the 2- position of the thiazole group
An embodiment of the present invention includes compounds of the formula I wherein m and/or n are 0 Another embodiment of the present invention includes compounds of the formula I wherein m and n are both 0, that is, wherein the pyrrolidine ring is substituted only by the amide at position 2 and the R4 group at position 3, i e compounds of formula IA
Figure imgf000016_0001
wherein the substitutents are defined as for a compound of formula (I) A further embodiment of the present invention includes compounds of the formula I wherein m is 0 or 1 and n is 1 In this embodiment, it is preferred that R3 is bonded at position 3 of the pyrrolidine ring, i e to provide compounds of formula IB:
Figure imgf000017_0001
wherein the substituents are defined as for a compound of formula (I).
In compounds according to formula IB1 when m is 1 (i e. R2 is present), the R2 group is preferably attached at the 4- or 5-posιtion (preferably the 4-position) of the pyrrolidine πng, thus providing compounds of formula IB'
Figure imgf000017_0002
In formulae IB or IB', preferably, R is CrC^alkyl, most preferably methyl A further embodiment of the present invention includes compounds of the formula I wherein m is 0 or 1 and n is 1 , wherein R3 is bonded at position 3 of the pyrrolidine ring, and, together with R4 forms a C3-C8-cycloalkyl or heterocyclyl, preferably a C3-C8-cycloalkyl, in particular cyclopropyl, i e to provide compounds of formula IC
Figure imgf000018_0001
wherein the substitutents are defined as for a compound of formula (I)
In compounds according to formula IC, when m is 1 (ι e R2 is present), the R2 group is preferably attached at the 4- or 5-posιtion (preferably the 4-posιtιon) of the pyrrolidine ring
The invention further relates to pharmaceutically acceptable prodrugs of a compound of formula (I), (IA), (IB), (IB') and/or (IC) The invention further relates to pharmaceutically acceptable metabolites of a compound of formula (I), (IA), (IB), (IB') and/or (IC)
The invention relates especially to the compounds of the formula (I), (IA), (IB), (IB') and/or (IC) given in the Examples, as well as the methods of manufacture described herein
The present invention also relates to processes for the production of a compound of formula (I), (IA), (IB), (IB') and/or (IC) In principle all known processes which convert two different amines into a corresponding urea derivative are suitable and may be applied by using the respective starting material
Thus, the invention in particular relates to a process which comprises reacting a compound of formula Il
Figure imgf000019_0001
wherein the substituents are as defined above, either with a compound of formula IHA
Figure imgf000019_0002
wherein the substituents are as defined above, in the presence of an activating agent ("method A") or with a compound of formula IHB
Figure imgf000019_0003
wherein R1 is as defined above, RG represents a reactive group (such as imidazolylcarbonyl) ("method B"), in each case optionally in the presence of a diluent and optionally in the presence of a reaction aid and recovering the resulting compound of formula I in free form or in form of a salt and, optionally converting a compound of the formula I obtainable according to method A or method B into a different compound of the formula I, and/or converting an obtainable salt of a compound of the formula I into a different salt thereof, and/or converting an obtainable free compound of the formula I into a salt thereof, and/or separating an obtainable isomer of a compound of the formula I from one or more different obtainable isomers of the formula I Reaction conditions
The process may be performed according to methods known in the art, or as dtsclosed below in the Examples For example a compound of formula Ii may be reacted with a compound of formula HIA or HIB in a solvent, e g dimethylformamide, in the presence of a base e g an organic amine, e g tπethylamine
Where temperatures are given hereinbefore or hereinafter, "about" has to be added, as minor deviations from the numeric values given, e g variations of ±10 %, are typically tolerable
All reactions may take place in the presence of one or more diluents and/or solvents The starting materials may be used in equimolar amounts, alternatively, a compound may be used in excess, e g to function as a solvent or to shift equilibrium or to generally accelerate reaction rates
Reaction aids, such as acids, bases or catalysts may be added in suitable amounts, as known in the field, required by a reaction and in line with generally known procedures
Protecting groups
If one or more other functional groups, for example carboxy, hydroxy, amino, sutfhydryl or the like are or need to be protected in a starting material as described herein or any other precursor, because they should not take part in the reaction or disturb the reaction, these are such groups as are usually used in the synthesis of peptide compounds, and also of cephalosporins and penicillins, as well as nucleic acid derivatives and sugars Protecting groups are such groups that are no longer present in the final compounds once they are removed, while groups that remain as substituents are not protecting groups in the sense used here which are groups that are added at a starting material or intermediate stage and removed to obtain a final compound Also in the case of conversions of a compound of the formula (I), (IA), (IB), (IB') and/or (IC) into a different compound of the formula (I), (IA), (IB), (IB') and/or (IC), protecting groups may be introduced and removed, if useful or required The protecting groups may already be present in precursors and should protect the functional groups concerned against unwanted secondary reactions, such as acylations, ethen- fications, esterifications, oxidations, solvolysis, and similar reactions It is a characteristic of protecting groups that they lend themselves readily i e without undestred secondary reactions, to removal, typically by acetolysis, protonolysis, solvolysis, reduction, photolysis or also by enzyme activity, for example under conditions analogous to physiological conditions, and that they are not present in the end-products The specialist knows, or can easily establish, which protecting groups are suitable with the reactions mentioned above and below
The protection of such functional groups by such protecting groups, the protecting groups themselves, and their removal reactions are described for example in standard reference works, such as J F W McOmie, "Protective Groups in Organic Chemistry", Plenum Press, London and New York 1973, in T W Greene, "Protective Groups in Organic Synthesis", Third edition, Wiley, New York 1999, in "The Peptides", Volume 3 (editors E Gross and J Meienhofer), Academic Press, London and New York 1981, in "Methoden der organischen Chemie" (Methods of organic chemistry), Houben VVeyl, 4th edition Volume 15/1, Georg Thieme Verlag, Stuttgart 1974, in H -D Jakubke and H Jescheit, "Aminosauren, Peptide, Proteine" (Amino acids, peptides, proteins), Verlag Chernie, Weinheim, Deerfteld Beach, and Basel 1982, and in Jochen Lehmann, "Chemie der Kohlenhydrate Monosaccharide und Deπvate" (Chemistry of carbohydrates monosaccharides and derivatives), Georg Thieme Verlag, Stuttgart 1974
Optional Reactions and Conversions
A compound of the formula (I), (IA), (IB), (IB') and/or (IC) may be converted into a different compound of the formula (I), (IA), (IB), (IB') and/or (IC)
In a compound of the formula (I)1 (IA), (IB), (IB') and/or (IC) wherein a substrtuent carries an amino or amino-d-Cy-alkyl substituent, the ammo can be converted into acylamino, e g Ci-Cr-alkanoylamino, by reaction with a corresponding CrC7-alkanoylhalogenιde, e g a corresponding chloride, in the presence of a tertiary nitrogen base, such as triethylamine or pyridine, in the absence or presence of an appropriate solvent, such a methylene chloride, for example at temperatures in the range from -20 to 50 0C, e g at about room temperature
Salts of a compound of formula (I), (IA), (IB), (IB') and/or (IC) with a salt-forming group may be prepared in a manner known per se Acid addition salts of compounds of formula (I), (IA), (IB), (IB') and/or (IC) may thus be obtained by treatment with an acid or with a suitable anion exchange reagent A salt with two acid molecules (for example a dihalogenide of a compound of formula (I), (IA)1 (IB), (IB') and/or (IC)) may also be converted into a salt with one acid molecule per compound (for example a monohalogenide), this may be done by heating to a mett, or for example by heating as a solid under a high vacuum at elevated temperature, for example from 130 to 1700C, one molecule of the acid being expelled per molecule of a compound of formula (I), (IA), (IB), (IB') and/or (IC) Salts can usually be converted to free compounds, e g by treating with suitable basic compounds, for example with alkali metal carbonates, alkali metal hydrogencarbonates, or alkali metal hydroxides, typically potassium carbonate or sodium hydroxide
Stereoisomers mixtures, e g mixtures of diastereomers, can be separated into their corresponding isomers in a manner known perse by means of suitable separation methods Dia- stereomeric mixtures for example may be separated into their individual diastereomers by means of fractionated crystallization, chromatography, solvent distribution, and similar procedures This separation may take place either at the level of a starting compound or in a compound of formula (I), (IA), (IB), (IB') and/or (IC) itself Enantiomers may be separated through the formation of diastereomeπc salts, for example by salt formation with an enantiomer-pure chiral acid, or by means of chromatography, for example by HPLC, using chromatographic substrates with chiral ligands
It should be emphasized that reactions analogous to the conversions mentioned herein may also take place at the level of appropriate intermediates (and are thus useful in the preparation of corresponding starting materials)
Starting materials
The starting materials of the formulae Il and III, as well as other starting materials mentioned herein, e g below, can be prepared according to or in analogy to methods that are known in the art, are known in the art and/or are commercially available Insofar as the production of the starting materials is not particularly described, the compounds are either known or may be prepared analogously to methods known in the art, e g in WO 05/021519 or WO04/096797, or as disclosed hereinafter Novel starting materials, as well as processes for the preparation thereof, are likewise an embodiment of the present invention In the preferred embodiments, such starting materials are used and the reaction chosen are selected so as to enable the preferred compounds to be obtained In the starting materials (including intermediates), which may also be used and/or obtained as salts where appropriate and expedient, the substituents are preferably as defined for a compound of the formula (I), (IA), (IB), (IB1) and/or (IC) Pharmaceutical compositions, uses and methods of treatment
The present invention also relates to use of the compounds of formula (I), (IA)1 (IB), (IB') and/or (IC) as disclosed herein as pharmaceuticals The present invention includes in one embodiment compositions comprising a compound of formula (I) (IA), (IB), (IB') and/or (IC), e g for human or veterinary use, e g where inhibition of PI3K is indicated
In one embodiment, the invention relates to the treatment of cellular proliferative diseases such as tumor (benign or malignant) and/or cancerous cell growth, e g mediated by PI3K Diseases may include those showing somatic mutation of P1K3CA or germline mutations or somatic mutation of PTEN In particular, the compounds may be useful in the treatment of human or animal (e g , murine) cancers, including, for example, sarcoma, lung, bronchus, prostate, breast (including sporadic breast cancers and sufferers of Cowden disease), pancreas, gastrointestinal cancer, colon, rectum, colon carcinoma, colorectal adenoma, thyroid, liver, intrahepatic bile duct, hepatocellular, adrenal gland, stomach, gastric, glioma, glioblastoma, endometrial, melanoma, kidney, renal pelvis, urinary bladder, uterine corpus, uterine cervix, vagina, ovary, multiple myeloma, esophagus, a leukaemia, acute
myelogenous leukemia, chronic myelogenous leukemia, lymphocytic leukemia, myeloid leukemia, brain, oral cavity and pharynx, larynx, small intestine, non-Hodgkin lymphoma, melanoma, villous colon adenoma, a neoplasia, a neoplasia of epithelial character lymphomas, a mammary carcinoma, basal cell carcinoma, squamous cell carcinoma, actinic keratosis, tumor diseases, including solid tumors, a tumor of the neck or head, polycythemia vera, essential thrombocythemia, and myelofibrosis with myeloid metaplasia
In other embodiments, the condition or disorder (e g PI3K-medιated) is selected from the group consisting of an eptdermai hyperproliferatton, prostate hyperplasia a neoplasia, a neoplasia of epithelial character, Cowden syndrome, Lhermitte-Dudos disease or Bannayan- Zonana syndrome, asthma, COPD, ARDS, Loffler's syndrome, eosinophilic pneumonia, parasitic (in particular metazoan) infestation (including tropical eosinophtlia),
bronchopulmonary aspergillosis polyarteritis nodosa (including Churg-Strauss syndrome), eosinophilic granuloma, eosinophil-related disorders affecting the airways occasioned by drug-reaction, psoriasis, contact dermatitis, atopic dermatitis, alopecia areata, erythema multiforme, dermatitis herpetiformis, scleroderma, vitiligo, hypersensitivity angiitis, urticaria, bullous pemphigoid, lupus erythematosus, pemphisus, epidermolysis bullosa acquistta, autoimmune haematogical disorders (e g haemolytic anaemia, aplastic anaemia, pure red cell anaemia and idiopathic thrombocytopenia), systemic lupus erythematosus,
polychondritis, scleroderma, Wegener granulomatosis, dermatomyositis, chronic active hepatitis, myasthenia gravis, Steven-Johnson syndrome, idiopathic sprue, autoimmune inflammatory bowel disease (e g ulcerative colitis and Crohn's disease), endocrine opthalmopathy, Grave's disease, sarcoidosis, alveolitis, chronic hypersensitivity pneumonitis, multiple sclerosis, primary biliary cirrhosis, uveitis (anterior and posterior), interstitial lung fibrosis, psoriatic arthritis, glomerulonephritis, cardiovascular diseases, atherosclerosis, hypertension, deep venous thrombosis, stroke, myocardial infarction, unstable angina, thromboembolism, pulmonary embolism, thrombolytic diseases, acute arterial ischemia, peripheral thrombotic occlusions, and coronary artery disease, reperfusion injuries, retinopathy, such as diabetic retinopathy or hyperbaric oxygen-induced retinopathy, and conditions characterized by elevated intraocular pressure or secretion of ocular aqueous humor, such as glaucoma
For the above uses the required dosage will of course vary depending on the mode of administration, the particular condition to be treated and the effect desired In general, satisfactory results are indicated to be obtained systemically at daily dosages of from about 0 03 to 10 0 mg/kg per body weight An indicated daily dosage in the larger mammal, e g humans, is in the range from about 0 5 mg to about 1 g, conveniently administered, for example, in divided doses up to four times a day or in retard form Suitable unit dosage forms for oral administration comprise from ca 0 1 to 500 mg active ingredient
The compounds of formula (I) (IA), (IB), (IB') and/or (IC) may be administered by any conventional route, in particular enterally, e g orally, e g in the form of tablets or capsules, or parenterally e g in the form of injectable solutions or suspensions, topically, e g in the form of lotions, gels, ointments or creams, by inhalation, intranasally, or in a suppository form
The compounds of formula (I), (IA), (IB), (IB') and/or (IC) may be administered in free form or in pharmaceutically acceptable salt form e g as indicated above Such salts may be prepared in conventional manner and exhibit the same order of activity as the free compounds
Consequently, the invention also provides
« a method for preventing or treating conditions, disorders or diseases mediated by the activation of the PI3, e g the PI3 kinase alpha enzyme e g such as indicated above, in a subject in need of such treatment, which method comprises administering to said subject an effective amount of a compound of formula (I), (IA), (IB), (IB') and/or (IC) or a pharmaceutically acceptable salt thereof
■ use of a compound of formula (I), (IA)1 (IB), (IB') and/or (IC), in free form or in a
pharmaceutically acceptable salt form as a pharmaceutical, e g in any of the methods as indicated herein
• a compound of the formula (I)1 (IA), (IB), (IB') and/or (IC) in free form or in
pharmaceutically acceptable salt form for use as pharmaceutical, e g in any of the methods as indicated herein, in particular for the use in one or more
phosphatidylinosrtol 3-kιnase mediated diseases
the use of a compound of formula (I), (IA), (IB), (IB') and/or (IC) in free form or in
pharmaceutically acceptable salt form in any of the methods as indicated herein, in particular for the treatment of one or more phosphatidylinositol 3-kιnase mediated diseases
• the use of a compound of formula (I), (IA), (IB), (IB') and/or (IC) in free form or in
pharmaceutically acceptable salt form in any of the methods as indicated herein, in particular for the manufacture of a medicament for the treatment of one or more phosphatidylinosito! 3-kinase mediated diseases
PI3K serves as a second messenger node that integrates parallel signaling pathways, evidence is emerging that the combination of a PI3K inhibitor with inhibitors of other pathways will be useful in treating cancer and proliferative diseases in humans
Approximately 20-30% of human breast cancers overexpress Her-2/neu-ErbB2, the target for the drug trastuzumab Although trastuzumab has demonstrated durable responses in some patients expressing Her2/neu-ErbB2 only a subset of these patients respond Recent work has indicated that this limited response rate can be substantially improved by the combination of trastuzumab with inhibitors of PI3K or the PI3K/AKT pathway (Chan et al Breast Can Res Treat 91 187 (2005), Woods lgnatoski et al , Bπt J Cancer 82 666 (2000), Nagata et al , Cancer Cell 6 117 (2004))
A variety of human malignancies express activitating mutations or increased levels of Her1/EGFR and a number of antibody and small molecule inhibitors have been developed against this receptor tyrosine kinase including tarceva, gefitinib and erbitux However, while EGFR inhibitors demonstrate anti-tumor activity in certain human tumors (e g , NSCLC), they fail to increase overall patient survival in all patients with EGFR-expressing tumors This may be rationalized by the fact that many downstream targets of Her1/EGFR are mutated or deregulated at high frequencies in a variety of malignancies, including the PI3K/Akt pathway For example, gefitinib inhibits the growth of an adenocarcinoma cell line in in vitro assays Nonetheless, sub-clones of these cell lines can be selected that are resistant to gefitinib that demonstrate increased activation of the PI3/Akt pathway Down-regulation or inhibition of this pathway renders the resistant sub-clones sensitive to gefitinib (Kokubo et al , Brit J Cancer 92 1711 (2005)) Furthermore, in an in vitro model of breast cancer with a cell line that harbors a PTEN mutation and over-expresses EGFR inhibition of both the PI3K/AM pathway and EGFR produced a synergistic effect (She et al , Cancer Cell 8 287-297(2005)) These results indicate that the combination of gefitinib and PI3K/Akt pathway inhibitors would be an attractive therapeutic strategy in cancer
The combination of AEE778 (an inhibitor of Her-2/neu/ErbB2, VEGFR and EGFR) and RAD001 (an inhibitor of mTOR, a downstream target of Akt) produced greater combined efficacy that either agent alone in a glioblastoma xenograft model (Goudar et al , MoI Cancer Ther 4 101-112 (2005))
Anti-estrogens, such as tamoxifen, inhibit breast cancer growth through induction of cell cycle arrest that requires the action of the cell cycle inhibitor p27Kip Recently, it has been shown that activation of the Ras-Raf-MAP Kinase pathway alters the phosphorylation status of p27Kιp such that its inhibitory activity in arresting the cell cycle is attenuated, thereby contributing to antt-estrogen resistance (Donovan, et al, J Biol Chem 27640888 (2001)) As reported by Donovan et al , inhibition of MAPK signaling through treatment with MEK inhibitor reversed the aberrant phosphorylation status of p27 in hormone refractory breast cancer cell lines and in so doing restored hormone sensitivity Similarly, phosphorylation of p27Kip by Akt also abrogates its role to arrest the cell cycle (Viglietto et al , Nat Med 8 1145 (2002)) Accordingly, the present invention provides, in a further aspect, compounds of formulae (I), (IA), (IB), (IB') and/or (IC) for use in the treatment of hormone dependent cancers, such as breast and prostate cancers By this use, it is aimed to reverse hormone resistance commonly seen in these cancers with conventional anticancer agents
In hematological cancers, such as chronic myelogenous leukemia (CML), chromosomal translocation is responsible for the constitutiveiy activated BCR-AbI tyrosine kinase The afflicted patients are responsive to imatinib, a small molecule tyrosine kinase inhibitor, as a result of inhibition of AbI kinase activity However, many patients with advanced stage disease respond to imatinib initially, but then relapse later due to resistance-conferring mutations in the AbI kinase domain In vitro studies have demonstrated that BCR-AbI employs the Ras-Raf kinase pathway to elicit its effects In addition, inhibiting more than one kinase in the same pathway provides additional protection against resistance-conferring mutations
Accordingly, in another aspect, the present invention provides the compounds of formulae (I), (IA), (IB), (IB') and/or (IC) for use in combination with at least one additional agent selected from the group of kinase inhibitors, such as Gleevec®, in the treatment of hematological cancers, such as chronic myelogenous leukemia (CML) By this use, it is aimed to reverse or prevent resistance to said at least one additional agent
Because activation of the PI3K/Akt pathway drives cell survival, inhibition of the pathway in combination with therapies that drive apoptosis in cancer cells, including radiotherapy and chemotherapy, will result in improved responses (Ghobπal et al , CA Cancer J Clin 55 178- 194 (2005)) As an example, combination of PI3 kinase inhibitor with carboplatin demonstrated synergistic effects in both in vitro proliferation and apoptosis assays as well as in in vivo tumor efficacy in a xenograft model of ovarian cancer (Westfall and Skinner, Mol Cancer Ther 4 1764-1771 (2005)) In addition to cancer and proliferative diseases, there is accumulating evidence that inhibitors of Class 1A and 1B PI3 kinases would be therapeutically useful in others disease areas The inhibition of p110β, the PI3K isoform product of the PIK3CB gene, has been shown to be involved in shear-induced platelet activation (Jackson et al , Nature Medicine 11 507-514 (2005)) Thus, a PI3K inhibitor that inhibits p110β would be useful as a single agent or in combination in antithrombotic therapy The isoform p110δ, the product of the PIK3CD gene, is important in B cell function and differentiation (Clayton et al , J Exp Med 196 753-763 (2002)), T-cell dependent and independent antigen responses (Jou et al , MoI Cell Biol 22 8580-8590 (2002)) and mast cell differentiation (Alt et al , Nature 431 1007- 1011 (2004)) Thus, it is expected that p1108-ιnbibιtors would be useful in the treatment of B-cell driven autoimmune diseases and asthma Finally, the inhibition of p110γ, the isoform product of the PI3KCG gene, results in reduced T1 but not B cell, response (Retf et al , J Immunol 173 2236-2240 (2004)) and its inhibition demonstrates efficacy in animal models of autoimmune diseases (Camps et al , Nature Medicine 11 936-943 (2005), Barber et al , Nature Medicine 11 933-935 (2005))
The invention further provides pharmaceutical compositions comprising at least one compound of formula (I), (IA), (IB), (IB') and/or (IC), together with a pharmaceutically acceptable excepient suitable for administration to a human or animal subject, either alone or together with another therapeutic agent, for example another anticancer agent
The invention further provides methods of treating human or animal subjects suffering from a cellular proliferative disease, such as cancer The invention thus provides methods of treating a human or animal subject in need of such treatment, comprising administering to the subject a therapeutically effective amount of a compound of formula (I), (IA), (IB), (IB') and/or (IC) either alone or in combination with one or more other therapeutic agents, e g other anticancer agents in particular, compositions will either be formulated together as a combination therapeutic or administered separately Suitable anticancer agents for use with a compound of formula I include, but are not limited to, one or more compounds selected from the group consisting of kinase inhibitors, anti-estrogens, anti androgens, other inhibitors, cancer chemotherapeutic drugs, alkylating agents, chelating agents, biological response modifiers, cancer vaccines, agents for antisense therapy as set forth below
A. Kinase Inhibitors _Kιnase inhibitors for use as anticancer agents in conjunction with a compound of the formula (I)1 (IA), (IB), (IB') and/or (IC) include inhibitors of Epidermal Growth Factor Receptor (EGFR) kinases such as small molecule quinazolines, for example gefitinib (US 5457105, US 5616582, and US 5770599), ZD-6474 (WO 01/32651), erlotinib (Tarceva®, US 5,747,498 and WO 96/30347), and lapatinib (US 6,727,256 and WO
02/02552), Vascular Endothelial Growth Factor Receptor (VEGFR) kinase inhibitors, including SU-11248 (WO 01/60814), SU 5416 (US 5 883,113 and WO 99/61422), SU 6668 (US 5,883,113 and WO 99/61422), CHIR-258 (US 6,605,617 and US 6,774,237), vatalanib or PTK-787 (US 6,258,812), VEGF-Trap (WO 02/57423), B43-Genιsteιn (WO-09606116), fenretinide (retinoic actd p-hydroxyphenyiamtne) (US 4,323,581), IM-862 (WO 02/62826), bevacizumab or Avastin® (WO 94/10202), KRN-951, 3-[5-(methylsulfonylpιperadιne methyl)- indofyl]-quinolone, AG-13736 and AG-13925, pyrrolo[2,1-f][1,2,4]tπazιnes, ZK-304709, Veglin®, VMDA-3601, EG-004, CEP-701 (US 5,621,100), CandS (WO 04/09769), Erb2 tyrosine kinase inhibitors such as pertuzumab (WO 01/00245), trastuzumab, and rituximab, Akt protein kinase inhibitors, such as RX-0201 , Protein Kinase C (PKC) inhibitors, such as LY-317615 (WO 95/17182), and perifosine (US 2003171303), Raf/Map/MEK/Ras kinase inhibitors including sorafenib (BAY 43-9006), ARQ-350RP, LErafAON, BMS-354825 AMG- 548, and others disclosed in WO 03/82272, Fibroblast Growth Factor Receptor (FGFR) kinase inhibitors, Cell Dependent Kinase (CDK) inhibitors, including CYC-202 or roscovitine (WO 97/20842 and WO 99/02162), Platelet-Derived Growth Factor Receptor (PDGFR) kinase inhibitors such as CHIR-258, 3G3 mAb, AG-13736, SU-11248 and SU6668, and Bcr- AbI kinase inhibitors and fusion proteins such as STI-571 or Gleevec® (imatinib)
8. Anti-Estrogens:_Estrogen-targetιng agents for use in anticancer therapy in conjunction with a compoound of formula (I), (IA)1 (IB), (IB') and/or (IC) include Selective Estrogen Receptor Modulators (SERMs) including tamoxifen, toremifene, raloxifene, aromatase inhibitors including Aπmidex® or anastrozole, Estrogen Receptor Downregulators (ERDs) including Faslodex® or fulvestrant
C. Anti-Androgens:_Androgen-targetιng agents for use in anticancer therapy in conjunction with a compound of formula (I), (IA), (IB), (IB') and/or (IC) include flutamide, bicalutamide, finasteride, aminoglutethamide, ketoconazole, and corticosteroids
D. Other Inhibitors:_Other inhibitors for use as anticancer agents in conjunction with a compound of formula (I), (IA), (IB), (IB') and/or (IC) include protein farnesyl transferase inhibitors including tipifarnib or R-115777 (US 2003134846 and WO 97/21701), BMS- 214662, AZD-3409, and FTI-277, topoisomerase inhibitors including merbarone and diflomotecan (BN-80915), mitotic kinesin spindle protein (KSP) inhibitors including SB- 743921 and MKI-833, proteasome modulators such as bortezomib or Velcade® (US
5,780,454), XL-784, and cyclooxygenase 2 (COX-2) inhibitors including non-steroidal antiinflammatory drugs I (NSAIDs)
E. Cancer Chemotherapeutic Drugs: Particular cancer chemotherapeutic agents for use as anticancer agents in conjunction with a compound of formula (I), (IA), (IB), (IB') and/or (IC) include anastrozole (Aπmidex®), bicalutamide (Casodex®), bleomycin sulfate
(Blenoxane®), busulfan (Myleran®), busulfan injection (Busulfex®), capecitabine (Xeloda®), NΦpentoxycarbonyl-S-deoxy-S-fluorocytidine, carboplatin (Parapiatin®), carmustine
(BiCNU®), chlorambucil (Leukeran®), cisplatin (Platinol®), cladπbine (Leustatin®), cyclophosphamide (Cytoxan® or Neosar®), cytarabine, cytosine arabinoside (Cytosar-U®), cytarabine liposome injection (DepoCyt®), dacarbazine (DTIC-Dome®), dactinomycin (Actinomycm D, Cosmegan), daunorubicin hydrochloride (Cerubidine®), daunorubicin citrate liposome injection (DaunoXome®), dexamethasone, docetaxel (Taxotere®, US
2004073044), doxorubicin hydrochloride (Adπamycin®, Rubex®), etoposide (Vepesid®), fludarabine phosphate (Fludara®), 5-fluorouracιl (Adrucil®, Efudex®), flutamide (Eulexin®), tezacitibine, Gemcitabine (difluorodeoxyαtidine), hydroxyurea (Hydrea®), ldarubicin
(Idamycin®), ifosfamtde (IFEX®), irinotecan (Camptosar®), L-asparaginase (ELSPAR®), leucovorin calcium, melphalan (Alkeran®), 6-mercaptopuπne (Puπnethol®), methotrexate (Folex®), mttoxantrone (Novantrone®), mylotarg, paclitaxel (Taxol®), phoenix (Yttπum9Q/MX- DTPA), pentostatin, polifeprosan 20 with carmustine implant (Gliadel®), tamoxifen citrate (Nolvadex®), teniposide (Vumon®), 6-thιoguanine, thiotepa, tirapazamine (Tirazone®), topotecan hydrochloride for injection (Hycamptin®), vinblastine (Velban®), vincristine (Oncovin®), and vinorelbine (Navelbine®)
F. Alkylating Agents :_Alkylatιng agents for use in conjunction with a compound of formula (I), (IA), (IB), (IB') and/or (IC) include VNP-40101M or cloretizine, oxaliplatin (US 4,169,846,
WO 03/24978 and VVO 03/04505), glufosfamide, mafosfamide, etopophos (US 5,041 ,424), prednimustine, treosulfan, busulfan, irofluven (acylfulvene), penclomedine, pyrazoloacπdine (PD-115934), O6-benzylguanιne, deciiabine (5-aza-2-deoxycytιdιne); brostallicin, mitomycin C (MitoExtra), TLK-286 (Telcyta®), temozolomide, trabectedin (US 5,478,932), AP-5280 (Platinate formuiation of Cisplatin), porfiromycin, and clearazide (meclorethamine)
G. Chelating Agents;_Chelatιng agents for use in conjunction with a compound of formula (I), (IA), (IB), (IB') and/or (IC) include tetrathiomolybdate (WO 01/60814), RP-697, Chimeric T84 66 (cT84 66), gadofosveset (Vasovist®), deferoxamine, and bleomycin optionally in combination with etectorporation (EPT)
H. Biological Response Modifiers:_Bιologιcal response modifiers, such as immune modulators, for use in conjunction with a compound of formula (I), (IA), (IB), (IB') and/or (IC) include staurospπne and macrocycltc analogs thereof, including UCN-01 , CEP-701 and midostaunn (see WO 02/30941 , WO 97/07081 , WO 89/07105, US 5,621,100, WO
93/07153, WO 01/04125, WO 02/30941 , WO 93/08809, WO 94/06799, WO 00/27422, WO 96/13506 and WO 88/07045), squalamine (WO 01/79255), DA-9601 (WO 98/04541 and US 6,025,387), alemtυzumab, interferons (e.g IFN-a, IFN-b etc ), interleukins, specifically IL-2 or aldesleukin as well as IL-1, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, and active biological variants thereof having amino acid sequences greater than 70% of the native human sequence, altretamine (Hexalen®), SU 101 or leflunomide (WO 04/06834 and US 6,331 ,555), imidazoquinolines such as resiquimod and imiquimod (US 4,689,338, 5,389,640, 5,268,376, 4,929,624, 5,266,575, 5,352,784, 5,494,916, 5,482,936, 5,346,905, 5,395,937, 5,238,944, and 5,525,612), and SMIPs, including benzazoles, anthraquinones, thiosemicarbazones, and tryptanthrins (WO 04/87153, WO 04/64759, and WO 04/60308) f. Cancer Vaccines:_Antιcancer vaccines for use in conjunction with a compound of formula (I), (IA), (IB), (IB1) and/or (IC) include Avicine® (Tetrahedron Lett 26 2269-70 (1974));
oregovomab (OvaRex®), Theratope® (STn-KLH)1 Melanoma Vaccines, Gi-4000 series (Gl- 4014, GI-4015, and GI-4016), which are directed to five mutations in the Ras protein, GlιoVax-1 , MelaVax, Advexin® or INGN-201 (WO 95/12660), Sιg/E7/LAMP-1, encoding HPV-16 E7, MAGE-3 Vaccine or M3TK (WO 94/05304), HER-2VAX, ACTIVE, which stimulates T-cells specific for tumors, GM-CSF cancer vaccine, and Listeria monocytogenes- based vaccines
J. Antisense Therapy:_Anticancer agents for use in conjunction with a compound of formula (I), (IA), (IB), (IB') and/or (IC) also include antisense compositions, such as AEG-35156 (GEM-640), AP-12009 and AP-11014 (TGF-beta2-specιfιc antisense oligonucleotides), AVI- 4126, AVI-4557, AVI-4472, oblimersen (Genasense®), JFS2, aprinocarsen (WO 97/29780), GTI-2040 (R2 ribonucleotide reductase mRNA antisense oligo) (WO 98/05769), GTI-2501 (WO 98/05769), liposome-encapsulated c-Raf antisense oligodeoxynucleotides (LErafAON) (WO 98/43095), and Sirna-027 (RNAi-based therapeutic targeting VEGFR- 1 mRNA)
A compound of formula (I), (IA), (IB), (IB') and/or (IC) can also be combined in a
pharmaceutical composition with bronchiodilatory or antihistamine drugs substances Such bronchiodilatory drugs include anticholinergic or anttmuscaπnic agents, in particular glycopyrrolate, ipratropium bromide oxitropium bromide, and ttotropium bromide, OrM3, aclidinium, CHF5407, GSK233705 and β-2- adrenoreceptor agonists such as salbutamol, terbutaltne salmeterol, carmoterol, milveterol and, especially, indacaterol and formoterol Co-therapeutic antihistamine drug substances include cetiπzine hydrochloride clemastine fumarate, promethazine, loratadine, desloratadine diphenhydramine and fexofenadine hydrochloride
The invention provides in a further aspect a combination comprising a compound of formula (I)1 (IA), (IB), (IB') and/or (IC) and one or more compounds that are useful for the treatment of a thrombolytic disease, heart disease, stroke, etc Such compounds include aspirin, a streptokinase, a tissue plasminogen activator, a urokinase, a anticoagulant, antiplatelet drugs (e g, PL-AVIX, clopidogrel bisulfate), a statin (e g , LfPITOR or Atorvastatin calcium), ZOCOR (Simvastatin), CRESTOR (Rosuvastatin), etc ), a Beta blocker (e g , Atenolol), NORVASC (amlodipine besylate), and an ACE inhibitor (e g , lisinopril)
The invention provides in a further aspect a combination comprising a compound of formula (I), (IA), (IB), (IB') and/or (IC) and one or more compounds that are useful for the treatment of antihypertension Such compounds include ACE inhibitors, lipid lowering agents such as statins, LtPITOR (Atorvastatin calcium), calcium channel blockers such as NORVASC (amlodipine besylate)
The invention provides in a further aspect a combination comprising a compound of formula (I), (IA), (IB), (IB') and/or (IC) and one or more compounds selected from the group consisting of fibrates, beta-blockers, NEPI inhibitors, Angiotensιn-2 receptor antagonists and platelet aggregation inhibitors
The invention provides in a further aspect a combination comprising a compound of formula (I), (IA), (IB), (IB') and/or (IC) and a compound suitable for the treatment of inflammatory diseases, including rheumatoid arthritis Such compound may be selected from the group consisting of TNF-α inhibitors such as antι-TNF-α monoclonal antibodies (such as
REMICADE, CDP-870) and D2E7 (HUMIRA) and TNF receptor immunoglobulin fusion molecules (such as ENBREL), IL-1 inhibitors, receptor antagonists or soluble IL-1Rα(e g KINERET or ICE inhibitors), nonsterodial anti-inflammatory agents (NSAIDS) piroxicam, diclofenac, naproxen, flurbiprofen, fenoprofen, ketoprofen ibuprofen, fenamates, mefenamic acid, indomethaciπ, sulindac, apazone, pyrazolones, phenylbutazone, aspirin COX-2 inhibitors (such as CELEBREX (celecoxib) PREXIGE (lumiracoxib)) metalloprotease inhibitors (preferably MMP-13 selective inhibitors), p2x7 inhibitors, α2(xιnhιbιtors NEUROTIN1 pregabaltn, low dose methotrexate, leflunomide, hydrσxyxchloroquine, d- penicillamine, auraπofin or parenteral or oral gold
The invention provides in a further aspect a combination comprising a compound of formula (I)1 (IA), (IB), (IB') and/or (IC) and a compound suitable for the treatment of osteoarthritis Such compound may be selected from the group consisting of standard non-steroidal antiinflammatory agents (hereinafter NSAID's) such as piroxicam, diclofenac, propionic acids such as naproxen, flurbiprofen, fenoprofen, ketoprofen and ibuprofen, fenamates such as mefenamic acid, indomethacin, sulindac, apazone, pyrazolones such as phenylbutazone, salicylates such as aspirin, COX-2 inhibitors such as celecoxib, valdecoxib, lurniracoxib and etoricoxib, analgesics and intraarticular therapies such as corticosteroids and hyaluronic acids such as hyalgan and synvisc
The invention provides in a further aspect a combination comprising a compound of formula (I)1 (IA), (IB), (IB') and/or (IC) and an antiviral agent and/or an antisepsis compound Such antiviral agent may be selected from the group consisting of Viracept, AZT, acyclovir and famciclovir Such antisepsis compound may be selected from the group consisting of Valant The invention provides in a further aspect a combination comprising a compound of formula (I), (IA), (IB), (IB') and/or (IC) and one or more agents selected from the group consisting of CNS agents such as antidepressants (sertraline), anti-Parkinsonian drugs (such as deprenyl, L-dopa, Requip, Mirapex, MAOB inhibitors (such as selegine and rasagiline), comP inhibitors (such as Tasmar), A-2 inhibitors, dopamine reuptake inhibitors, NMDA antagonists, Nicotine agonists, Dopamine agonists, and inhibitors of neuronal nitric oxide synthase)
The invention provides in a further aspect a combination comprising a compound of formula (I), (IA), (IB), (IB1) and/or (IC) and one or more anti-Alzheimer's drugs Such anti-Alzheimer Drug may be selected from the group consisting of donepezil, tacrine, α2διnhιbιtors, NEUROTIN, pregabalm, COX-2 inhibitors, propentofylline or metryfonate
The invention provides in a further aspect a combination comprising a compound of formula (I), (IA), (IB), (IB') and/or (IC) and anosteoporosis agents and/or an immunosuppressant agent Such osteoporosis agents ma be selected from the group consisting of EVISTA (raloxifene hydrochloride), droloxifene, lasofoxifene or fosomax Such immunosuppressant agents may be selected from the group consisting of FK-506 and rapamyαn
In another aspect of the preferred embodiments, kits that include one or more compound of formula (I)1 (IA), (IB), (IB') and/or (IC) and a combination partner as disclosed herein are provided Representative kits include a PI3K inhibitor compound (e g , a compound of formula (I)1 (IA), (IB), (IB') and/or (IC)) and a package insert or other labeling including directions for treating a cellular proliferative disease by administering a PI3K inhibitory amount of the compound(s)
In general, the compounds of formula (I), (IA), (IB), (IB') and/or (IC) will be administered in a therapeutically effective amount by any of the accepted modes of administration for agents that serve similar utilities The actual amount of the compound of formula (I), (IA), (IB), (IB') and/or (IC), i e , the active ingredient, will depend upon numerous factors such as the severity of the disease to be treated, the age and relative health of the subject, the potency of the compound used, the route and form of administration, and other factors The drug can be administered more than once a day, preferably once or twice a day All of these factors are within the skill of the attending clinician Therapeutically effective amounts of compounds of formulas I may range from about 0 05 to about 50 mg per kilogram body weight of the recipient per day, preferably about 0 1-25 mg/kg/day, more preferably from about 0 5 to 10 mg/kg/day Thus, for administration to a 70 kg person, the dosage range would most preferably be about 35-70 mg per day
In general, compounds of formula (I), (IA), (IB), (IB') and/or (IC) will be administered as pharmaceutical compositions by any one of the following routes oral, systemic (e g , transdermal, intranasal or by suppository), or parenteral (e g , intramuscular, intravenous or subcutaneous) administration The preferred manner of administration is oral using a convenient daily dosage regimen that can be adjusted according to the degree of affliction Compositions can take the form of tablets, pills, capsules, semisolids, powders, sustained release formulations, solutions, suspensions, elixirs aerosols, or any other appropriate compositions Another preferred manner for administering compounds of the formula I is inhalation This is an effective method for delivering a therapeutic agent directly to the respiratory tract The choice of formulation depends on various factors such as the mode of drug
administration and bioavailability of the drug substance For delivery via inhalation the compound can be formulated as liquid solution, suspensions, aerosol propellents or dry powder and loaded into a suitable dispenser for administration There are several types of pharmaceutical inhalation devices-nebulizer inhalers, metered dose inhalers (MDI) and dry powder inhalers (DPI) Nebulizer devices produce a stream of high velocity air that causes the therapeutic agents (which are formulated in a liquid form) to spray as a mist that is carried into the patient's respiratory tract MDI's typically are formulation packaged with a compressed gas Upon actuation, the device discharges a measured amount of therapeutic agent by compressed gas, thus affording a reliable method of administering a set amount of agent DPI dispenses therapeutic agents in the form of a free flowing powder that can be dispersed tn the patient's inspiratory air-stream during breathing by the device In order to achieve a free flowing powder, the therapeutic agent is formulated with an excipient such as lactose A measured amount of the therapeutic agent is stored in a capsule form and is dispensed with each actuation
The inventions also relates to formulations wherein the particle size of a compound of formula I between 10 - 1000 nm, preferably 10 - 400 nm Such pharmaceutical formulations have been developed especially for drugs that show poor bioavailability based upon the principle that bioavailability can be increased by increasing the surface area i e , decreasing particle size For example, U S 4,107,288 describes a pharmaceutical formulation having particles in the size range from 10 to 1 ,000 nm in which the active material is supported on a crosslinked matrix of macrαmolecules U S 5,145,684 describes the production of a pharmaceutical formulation in which the drug substance is pulverized to nanoparticles (average particle size of 400 nm) in the presence of a surface modifier and then dispersed in a liquid medium to give a pharmaceutical formulation that exhibits remarkably high bioavailability Both documents are included by reference
In a further aspect, the invention provides pharmaceutical compositions comprising a (therapeutically effective amount) of a compound of formula (I), (IA), (IB), (IB') and/or (IC), and at least one pharmaceutically acceptable excipient Acceptable excipients are non-toxic, aid administration, and do not adversely affect the therapeutic benefit of the compound of formula (I), (IA), (IB), (IB') and/or (IC) Such excipient may be any solid, liquid, semi-solid or in the case of an aerosol composition, gaseous excipient that is generally available to one of skill in the art
Solid pharmaceutical excipients include starch, cellulose, talc, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, magnesium stearate, sodium stearate, glycerol monostearate, sodium chloride, dried skim milk and the like
Liquid and semisolid excipients may be selected from glycerol, propylene glycol, water, ethanol and various oils, including those of petroleum, animal, vegetable or synthetic origin, e g , peanut oil, soybean oil, mineral oil, sesame oil, etc Preferred liquid carriers, particularly for injectable solutions, include water, saline, aqueous dextrose, and glycols Compressed gases may be used to disperse a compound of the formula I in aerosol form Inert gases suitable for this purpose are nitrogen, carbon dioxide, etc Other suitable pharmaceutical excipients and their formulations are described in Remington's
Pharmaceutical Sciences, edited by E W Martin (Mack Publishing Company, I8th ed , I990) The amount of the compound in a formulation can vary within the full range employed by those skilled in the art Typically, the formulation will contain, on a weight percent (wt%) basis, from about 0 01-99 99 wt% of a compound of formula I based on the total formulation, with the balance being one or more suitable pharmaceutical excipients Preferably, the compound is present at a level of about 1-80 wt% The invention further relates to pharmaceutical compositions comprising (ι e containing or consisting of ) at least one compound of formula (I), (IA), (IB), (IB') and/or (IC) and at least one pharmaceutically acceptable excipient
Pharmaceutical compositions comprising a compound of formula (I)1 (IA), (IB) (IB1) and/or (IC) in free form or in pharmaceutically acceptable salt form in association with at least one pharmaceutical acceptable excipient (such as a carrier and/or diluent) may be manufactured in conventional manner by mixing the components
Combined pharmaceutical compositions comprising a compound of formula (I), (IA) (IB), (IB') and/or (IC) in free form or in pharmaceutically acceptable salt form and further comprising a combination partner (either in one dosage unit form or as a kit of parts) in association with at least one pharmaceutical acceptable carrier and/or diluent may be manufactured in conventional manner by mixing with a pharmaceutically acceptable carrier and/or diluent with said active ingredients Consequently, the invention provides in further aspects
a combined pharmaceutical composition, e g for use in any of the methods described herein, comprising a compound of formula (I), (IA), (IB), (IB') and/or (IC) in free form or pharmaceutically acceptable salt form in association with a pharmaceutically acceptable diluent and/or carrier
a combined pharmaceutical composition comprising a compound of formula (I), (IA), (IB), (IB') and/or (IC) in free form or in pharmaceutically acceptable salt form as active ingredient, one or more pharmaceutically acceptable carrier materιal(s) and / or diluents and optionally one or more further drug substances Such combined pharmaceutical composition may be in the form of one dosage unit form or as a kit of parts
» a combined pharmaceutical composition comprising a therapeutically effective amount of a compound of formula (I), (IA), (IB), (IB') and/or (tC) in free form or in
pharmaceutically acceptable salt form and a second drug substance, for simultaneous or sequential administration
• a method as defined above comprising co-administration, e g concomitantly or in
sequence, of a therapeutically effective non-toxic amount of a compound of formula (I) (IA), (IB), (IB') and/or (IC) or a pharmaceutically acceptable salt thereof, and at least a second drug substance, e g as indicated above
» a pharmaceutical combination, e g a kit, comprising a) a first agent which is a
compound of formula (I), (IA), (IB), (IB') and/or (IC) as disclosed herein, in free form or in pharmaceutically acceptable salt form, and b) at least one co-agent, e g as indicated above, whereby such kit may comprise instructions for its administration
The following examples of compounds formula (I), (IA), (IB), (IB') and/or (IC) illustrate the invention without limiting the scope thereof Methods for preparing such compounds are described Temperatures are measured in degrees Celsius Unless otherwise indicated, the reactions take place under an argon atmosphere at rt and the MS are obtained with ESI The following HPLC and LC-MS methods are used in the preparation and analysis of the Intermediates and Examples HPLC (Method A)
System Agilent 1100 Seπes
Column HP Hypersit BDS C18 4 x 125 mm, 5 micron
Temperature 25°C
Eluent A H2O1 containing 0 1% v/v TFA
Eluent B acetonitπle, containing 0 1% v/v TFA
Gradient 10% -» 100% B in 5 mm, 2 5 min with 100% B, then -> 10% B in 1 mm
Flow Rate 1 5 mL/min
Detection UV 215 nm
HPLC (Method B)
System Agilent 1100 Series
Column Macherey-Nagel Nucleosil 100-3 C18HD, 4 x 125 mm, 3 micron
Temperature 300C
Eluent A H2O, containing 0 1 % v/v TFA
Eluent B acetonitπle, containing 0 1 % v/v TFA
Gradient 2% -» 100% B in 7 mm, 2 mm with 100% B, then -» 2% B in 1 mm
Flow Rate 1 0 mL/min
Detection- UV 215 nm
LC-MS (Method A)
System Waters Acquity UPLC with Waters Micromass ZQ 2000 ESI+/-
Column Acquity HSS T3 C18, 2 1 x 50 mm, 1 8 micron
Temperature 50 "C
Eluent A H2O, containing 0 05% v/v HCOOH and 3 75 mM ammonium acetate
Eluent B acetonitrile, containing 0 04% HCOOH
Gradient 2% -> 98% B in 4 3 mm, 0 7 mm with 98% B, then -> 2% B in 0 1 mm and 0 9 mm with 2% B
Flow Rate 1 0 mL/min
LC-MS (Method B)
System Agilent 1100 Series, MS G1946D
Column Symmetry C8, 2 1 x 50mm, 3 5 micron
Eluent A H2O, containing 0 1% v/v HCOOH Eiuent B acetonitπle, containing 0 1% v/v HCOOH
Gradient 0 - 3 3 mm 5% to 95% of B
Flow rate 1 0 mL/min LC-MS (Method C)
System Waters Acquity UPLC
Column Acquity HSS T3 C18, 2 1 x 50 mm, 1 8 micron
Eluent A H2O, containing 0 05% v/v HCOOH and 0 05% ammonium acetate
Eluent B acetonitrile, containing 0 04% HCOOH
Gradient 2% -> 98% B in 1 7 mm, 045 mm with 98% B, then -> 2% B in 0 04 mm
Flow Rate 1 2 ml/mm
LC-MS (Method D)
System Waters Aquity UPLC, MS Waters AQ Detector
Column Aquity HSS, 1 8 μm 2 1 x 50mm, 3/pk
Eluent A H2O1 containing 0 1% v/v HCOOH
Eluent B acetonitrile, containing 0 1 % v/v HCOOH
Gradient 0 - 1 5 mm 10% to 95% of B, then 1 mm 95% B
Flow Rate 1 2 mL/min
ESI-MS
Instrument Micromass Platform Il
Eluent 15% v/v methanol in water containing 0 2% v/v of a 25% ammonium hydroxide solution
Flow rate 0 05 mL/min
In the following examples, the abbreviations given below are used
atm atmosphere
CDI 1 ,1'-carbonyidιιmιdazole
CH2CI2 dichloromethane
DCE 1 2-dιchloroethane
DMF N,N-dιmethylformamιde
DMSO dimethyl sulfoxide
Et2O diethyl ether EtOAc ethyl acetate
EtOH ethanol
Et3N tnethylamine
eq equivalent(s)
h hour(s)
Hex hexanes
HPLC High Performance Liquid Chromatography
HV high vacuum
LC-MS liquid chromatography coupled with mass spectrometry
LiHMDS lithium bιs(tπmethylsι!yl)amιde
MeOH methanol
mL mιllιlιter(s)
min mιnute(s)
MS-ESI electrospray ionisation mass spectrometry
MTBE methyl tert-butyl ether
MW microwave
Rf ratio of fronts in TLC
rt room temperature
TFA trifluoroacetic acid
THF tetrahydrofuran
TLC thin layer chromatography
tR retention time
UV ultraviolet
Example 1 (2S, (3R)-3-Methyl-pyrrolιdιne-1,2-dιcarboxylιc acid 2-amιde 1-({4-m< methy!-cyclopropyl)-pyrιdιn-4-yl]-thιazol~2-yl}-amιde)
Figure imgf000041_0001
NH1OH
Figure imgf000041_0003
LlHMDS, THF
Figure imgf000041_0002
Figure imgf000041_0004
Sttsp i S
Figure imgf000041_0005
Example 1
Step 1 1
EtaN (0.53 mmol) was added to a mixture of imidazole-1-carboxyIic acid {4-methyl-5-[2-(1- methyl~cyclopropyl)-pyridin-4-yi]-thiazol-2-yi}-amide (Step 1.1) (0.177 mmol) and (2S,3R)-3- methyl-pyrrolidine-2-carboxylic acid amide (Step 1.8) (0.194 mmol) in DMF (1 mL) at it After stirring for 20 h, the reaction mixture was concentrated. The residue was purified using a RediSep® silica gel column followed by trituration with EtOAc to afford the title compound as a white solid. HPLC: tR = 4.27 min (method B); LC-MS: tR= 1.34 min, [M+H]+400 (method A); TLC: Rf = 0.12 (95:5 CH2CI2/Me0H); 1H-NMR (ds-DMSO, 600 MHz): 10.92 (br s, 1H), 8.41 (d, 1H), 7.38 (br s, 1 H), 7.28 (s, 1H), 7.16 (d, 1H), 6.98 (br s, 1H), 4.15 (m, 1H), 3.69 (m, 1 H), 3.37 (m, 1H), 2.40 (s, 3H), 2.36 (m, 1H), 1.95 (m, 1H), 1.69 (m, 1H), 1.48 (s, 3H), 1.18 (m, 2H), 0.98 (d, 3H)1 0.80 (m, 2H).
Step 1.1: lrnidazole-1-carboxylic acid {4-methyl-5-[2-(1~methyl-cyclopropyl)-pyridtn-4-ylJ- thiazol-2-yl}-amide
Figure imgf000041_0006
A mixture of 4-methyl-5-[2-(1-methyl-cyctopropyl)-pyndtn-4-yl]-thιazol-2-ylamιne (Step 1 2) (28 5 mmol) and CDI (42 8 mmol) in CH2CI2 (330 mL) was refluxed for 11 h After cooling to rt, the reaction mixture was filtered to afford the title compound as a light green solid Step 1 2 4-Methyi-5-[2-(1 -methyl-cyc!opropyl)-pyπdιn-4-yl]-thtazol-2-ylamιne
Figure imgf000042_0001
A mixture of N-{4-methyl-5-[2-(1-methyl-cyclopropyl)-pyπdιn-4-yl]-thiazol-2-yl}-acetamιde (Step 1 3) (34 8 mmol), a 6N aqueous solution of HCI (53 mL) and EtOH (265 mL) was stirred for 5 h at 85°C, cooled to rt and then concentrated The residue was slowly diluted with a saturated solution of NaHCOs and then extracted with EtOAc (3X) The combined organic phases were successively washed with a saturated solution of NaHCO3 and brine dried (Na2SO4), filtered and concentrated The residue was triturated with CH2Cl2 and then filtered to afford the title compound as a yellow-green solid HPLC t.R = 3 55 mm (method B), LC-MS tR= 1 03 mm, [M+Hf 246, TLC R, = 026 (1 2 Hex/EtOAc)
Step 1 3 N-{4-Methyl-5-[2-( 1 -methyl-cyclopropyl)-pyrιdιn-4-ylJ-thιazol-2-yl}-acetamιde
Figure imgf000042_0002
A mixture of 2-acetamιdo-4-methylthιazσle [7336-51-8] (604 mmol), cesium carbonate (110 mmol), tπ-teff-butylphosphmium tetrafluoroborate (10 99 mmol), palladium (II) acetate (5 49 mmol) and 4-bromo-2-(1~methyl-cyciopropyl)-pyπdιne (Step 1 4) (54 9 mmol) in DMF (230 mL) was stirred for 3 5 h at 1000C After cooling to rt, the reaction mixture was filtered and then concentrated The residue was diluted with a saturated solution of NaHCO3 and extracted with EtOAc (3X) The combined organic phases were successively washed with a saturated solution of NaHCO3 and brine, dried (Na2SO4), filtered and concentrated The residue was purified using a RediSep® silica gel column to afford the title compound as a paie yellow solid HPLC tR = 4 37 mm (method B), LC-MS tR= 1 47 mm, [M+H]+288, TLC Rf = 0 26 (1 2 Hex/EtOAc)
Step 1 4 4-Bromo-2-(1 -methyl-cyclopropyO-pyπdine
Figure imgf000043_0001
A mixture of 2-(1-methyl-cyclopropyl)-1 H-pyπdιn~4-one (Step 1 5) (13 4 mmol) and POBr3 (14 74 mmoi) was stirred for 15 mm at 85°C and then 15 mm at 1200C After cooltng slightly, the reaction mixture was poured into a saturated solution of NaHCO3 and extracted with CH2Ci2 (2X) The combined organic phases were washed with a saturated solution of NaHCO3, dried (Na2SO4), filtered and concentrated The residue was purified by silica gel column chromatography to afford the title compound as a brown oil HPLC tR = 4 11 mm (method B)1 LC-MS tR= 2 39 mm, [M+Hf 212/214, TLC Rf = 0 31 (CH2CI2)
Step 1 5 2-(1-Methyl-cyclopropyl)-1 H-pyπdιn-4-one
Figure imgf000043_0002
A mixture of 2-(1-methyl-cyclopropyi)~pyran-4-one (Step 1 6) (66 6 mmol) and a 28-30% aqueous solution of ammonium hydroxide (182 mL) was stirred for 1 h at 65°C After cooling to rt, the reaction mixture was decanted to remove a dark brown solid and then
concentrated The residue was diluted with MeOH and re-concentrated (3X) to afford the title compound as a brown-orange solid HPLC tR = 3 56 mm (method B), LC-MS tR= 0 87 mm, [M+Hf 151 , TLC Rf = 0 18 (9 1 CH2CI2/Me0H)
Step 1 6 2-(1 -Methyl-cyclopropyO-pyran^-one
Figure imgf000043_0003
A mixture of (1Z,4E)-1-hydroxy-5-methoxy-1-(1-methyl-cyclopropyl)-penta-1,4-dιen-3-one one (Step 1 7) (111 mmol) and TFA (221 mmol) in toluene (175 mL) was stirred for 15 5 h at rt and then concentrated The residue was purified using a RediSep® silica gel column to afford the title compound as a white solid LC-MS tR = 1 48 mm, [M+H]+ 151 , TLC Rf = 0 26 (EtOAc) Step 1 7 (IZ^EJ-i-Hydroxy-δ-methoxy-i^i-methyl-cyclopropyO-penta-i ,4-dιen~3-one
Figure imgf000044_0001
LiHMDS (1 M in THF, 845 mmol) was added dropwise to a solution of trans-4-methoxy-3- buten-2-one [51731-17-0] (845 mmol) in THF (2 L) at -78°C After stirring for 15 mm, a solution of i-methyl-cyclopropanecarbonyl chloride [16480-05-0] (407 mmol) in THF (100 mL) was added The resulting mixture was allowed to warm to rt over 2 5 h and then quenched by addition of a saturated solution of NH4CI The mixture was extracted with Et2O (2X) The combined organic phases were successively washed with a saturated solution of NaHCO3 and brine, dried (Na2SO4), filtered and concentrated The residue was purified by silica gel column chromatography to afford the title compound as a yellow solid ESI-MS [M+H]+ 183, TLC Rf = 0 29 (9 1 Hex/EtOAc)
Step 1 8 (2S,3R)-3-Methyl-pyrrolιdine-2-carboxylιc acid amide
Figure imgf000044_0002
A mixture of (2S,3R)-3-methyl-1-((S)~1-phenyl-ethyl)-pyrrolιdine-2-carboxylιc acid amide (Step 1 9) (4 76 mmol) and 10% Pd on charcoal (0 947 mmol) in MeOH (20 mL) was hydrogenated for 46 h at rt The reaction mixture was then filtered through a Fluoropore Membrane Filter (0 2 μm FG) and evaporated The residue was dissolved in CH2CI2 and evaporated to dryness to afford the title compound as a white solid ESI-MS [M+Hf 129, TLC R, = 0 10 (1 3 Hex/EtOAc)
Step 1 9 (2S 3R)-3-Methyl-1-((S)-1-phenyl-ethyl)-pyrrolιdιne-2-carboxylιc acid amide
Figure imgf000044_0003
Tnmethytalurrnnum in toluene (2 M, 6 46 rnmol) was added dropwise to a mixture of NH4CI (6 47 mmol) in toluene (3 2 mL) at 0 °C with the formation of methane gas The reaction mixture was allowed to warm to rt, stirred for a further 15 mm and then slowly treated with (2S,3R)-3-methyl-1-((S)-1-phenyl-ethyl)-pyrrolιdιne-2-carboxy!ιc acid methyl ester (prepared as described in Tet Lett 1997, 38, 85-88) (6 47 mmol) After stirring for 56 h, the mixture was cooled to 0°C, quenched with 1M HCi and then washed with CH2Ct2 (3X) The aqueous phase was basified with a saturated solution of NaHCO3 and extracted with CH2CI2 (3X) The combined organic layers were dried (Na2SO4), filtered and concentrated The residue was purified using a RediSep® silica gel column to afford the title compound as a colorless oil ESI-MS [M+Hf 233, HPLC tR 2 35 mm (method A)
Example 2 (2S,3R)-3-Methyl-pyrrolιdιne-1 !2-dιcarboxylιc acid 2-amrde 1-({4-methyl-5-[2~ (2,2,2-trιfluoro-1 ,1-dιmethyl-ethyl)-pyrιdιn-4-yl]-thιazol-2-yl}-amιde)
Figure imgf000045_0001
The title compound was prepared in analogy to the procedure described in Example 1 but in Step 1 7, 3,3,3-trιfluoro-2,2-dιmethyl-propιonyl chloride (Step 2 1) was used instead of 1- methyl-cyclopropanecarbonyl chloride
The title compound was obtained as a white solid HPLC tR = 5 16 mm (method B). LC-MS tR= 2 29 mm, [M+H]+456 (method A), TLC R, = 0 17 (95 5 CH2CI2ZMeOH), 1H-NMR (dβ- DMSO, 600 MHz) 10 98 (br s, 1H)1 8 59 (d, 1H), 7 54 (s, 1H), 7 40 (d, 1H), 7 39 (br s, 1H), 6 98 (br s, 1H), 4 15 (m, 1H), 3 69 (m, 1H), 3 37 (m, 1H), 2 40 (s, 3H), 2 36 (m, 1H), 1 95 (m, 1H), 1 69 (m, 1H), 1 81 (s, 6H), 0 97 (d, 3H)
Step 2 1 3,3,3-Trιfluoro-2,2-dιmethyl-propιonyl chloride
COC,
CF>
DMF (3 drops) was added to a solution of 3,3 34rιfluorα-2,2-dιmethyl-propιonιc acid
[889940-13-0] (179 mmol) in CH2CI2 (160 mL) at rt Slowly added a solution of oxalyl chloride (197 mmol) in CH2CI2 (20 mL) After stirring for 14 h, the reaction mixture was carefully evaporated (500 mbar, 33°C) to afford the title compound (volatile') as a yellow solution Example 3 (rac)-3,3-Dιmethyl-pyrrGlιclιne-1 2-dιcarboxylic actd 2-amide 1-({4-methyl-5-[2-(1- methyl-cyclopropyI)-pyπdιn-4-yl]-thιazol-2-yl}-amide)
Figure imgf000046_0001
The title compound was prepared in analogy to the procedure described in Example 1 but (rac)-3,3-dιmethyl-pyrrolιdιne-2-carboxyltc acid amide (prepared as described in J Org Chem , 2008, 73, 3946-3949) was used instead of {2S,3R)-3-methyl-pyrrolιdιne-2-carboxylιc acid amide
The title compound was obtained as a yellow solid HPLC tR = 2 90 mm (method A), LC-MS tR= 1 32 mm, [M+H]+414 (method A), TLC R, = 0 17 (9 1 CH2Cl2/Me0H), 1H-NMR (dβ-
DMSO, 600 MHz) 10 97 (br s, 1 H)1 843 (d, 1 H), 7 39 (m 2H), 7 31 (br s, 1 H), 6 97 (m, 1 H), 3 82 (m, 1H), 3 65 (m, 1H), 346 (m, 1 H), 2 43 (s, 3H), 1 86 (m, 1H), 1 62 (m, 1H), 1 48 (S1 3H), 1 19 (m, 2H), 1 04 (s, 3H), 0 99 (s, 3H)1 0 85 (m, 2H) Example 4 (rac)-3,3-Dιmethyl~pyrrolidιne~1 2-dιcarboxylιc acid 2-amιde 1 -({4-methyl-5-[2- (2,2,2-tπfluoro-i 1-d!methyi-ethyi)-pyπdιn-4-yl]-thιazo!-2-yl}-amide)
Figure imgf000046_0002
The title compound was prepared in analogy to the procedure described in Example 2 but (rac)-3,3-dimethyi-pyrrolιdιne-2-carboxylιc acid amide (prepared as described in J Org Chem 2008, 73, 3946-3949) was used instead of (2S,3R)-3-methyl-pyrrolιdιne-2-carboxylιc acid amide
The title compound was obtained as a yellow solid HPLC tR = 5 38 mm (method B), LC-MS tR= 2 12 mm, [M+H]+470 (method A), TLC R, = 0 12 (9 1 CH2CI2/Me0H), 1H-NMR (dβ- DMSO, 600 MHz) 10 93 (br s 1H), 8 58 (d, 1H), 7 54 (s, 1H), 7 39 (d, 1 H)1 7 39 (br s 1 H) 6 97 (br s, 1 H), 3 82 (m, 1H), 3 65 (m, 1 H), 3 46 (m, 1H), 2 39 (s, 3H), 1 86 (m, 1H), 1 61 (m, 1H), 1 59 (s, 6H), 1 04 (s, 3H), 1 00 (s, 3H)
Example 5 (2S,3S)-3-(Acetylamιno-methyf)-pyrrolιdιne-1I2-dιcarboxyt!c acid 2-amιde 1-({4- methyi-5-[2-( 1 -methyI-cyclopropyl)-pyrιdιn-4-yl]-thιazol-2-yl}-amιde)
Figure imgf000047_0001
The title compound was prepared in analogy to the procedure described in Example 1 but {2S,3S)-3-(acetylamιno-methyl)-pyrroiιdine-2-carboxylic acid amide (Step 5 1) was used instead of (2S,3R}-3-methyl-pyrrolidιne-2-carboxylιc acid amide
The title compound was obtained as a white solid HPLC IR = 4 00 mm (method B), LC-MS tR= 1 04 mm, [M+H]+457 (method A), TLC Rf = 0 17 (9 1 CHjCIz/MeOH), 1H-NMR (d8- DMSO, 600 MHz) 10 96 (br s, 1H), 8 42 (d, 1H), 7 80 (br s, 1H), 7 49 (br s, 1H), 7 29 (s, 1 H), 7 17 (d, 1H), 7 10 (br s, 1H), 4 25 (m, 1H), 3 72 (m, 1H), 3 37 (m, 1H), 3 23 (m, 1H), 2 92 (m, 1H), 2 41 (s, 3H), 2 39 (m, 1H), 2 00 (m, 1H), 1 82 (s, 3H), 1 73 (m, 1H), 1 49 (s, 3H), 1 19 (m, 2H), 0 81 (m, 2H)
Step 5 1 (2S,3S)-3-(Acetylamιno-methyl)-pyrroltdιne-2-carboxylιc aαd amide
Figure imgf000047_0002
The title compound was prepared in analogy to the procedure described in Step 1 8 but (2S,3S)-3-(acetylamιno-methyl)-1-((S)-1-phenyl-ethyl)-pyrrolιdιne-2-carboxylιc acid amide
(Step 5 2) was used instead of (2S,3R)-3-methyl-1-((S)-1-phenyl-ethyl)-pyrrolιdιne-2- carboxylic acid amide Moreover, 10% Pd on charcoal, wet with 50% H2O (Aldrich 330108) was used instead of the dry catalyst
The title compound was obtained as an off-white solid ESI-MS [M+Hf 186, TLC Rf = 0 08 (200 20 1 CH2CI2/MeOH/conc NH4OH)
Step 5 2 (2S,3S)-3-(Acetylamιno-methyl)-1-((S)-1 -phenyi-ethyl)-pyrrolιdιne-2-carboxytιc acid amide
Figure imgf000048_0001
Thioacetic acid (2 312 mmol) was added to (2S,3S)-3-azιdomethyl-1-((S)-1-phenyl-ethyl)- pyrroiιdιne-2-carboxylic acid amide {Step 5 3) (0 578 mmol) at rt with the formation of nitrogen gas After stirring for 16 h, the reaction mixture was diluted with Et2O, the solids were removed by filtration and the filtrate was concentrated The residue was purified by silica gel column chromatography to afford the title compound as a light yellow oil (thiol odor) HPLC tR = 3 71 mm (method B), LC-MS tR= 0 64 mm, [M+H]+290, TLC Rf = 0 38 (200 20 1 CH2CI2/MeOH/conc NH4OH) Step 5 3 {2S,3S)-3-Azιdomethy(-1-((S)-1-phenyl-ethyl)-pyrrolidιne-2-carboxylιc acid amide
Figure imgf000048_0002
The title compound was prepared in analogy to the procedure described in Step 1 9 but
(2S,3S)-3-azιdomethyl-1-((S)-1-phenyl-ethyl)-pyrrolιdιne-2-carboxylιc acid methyl ester (Step
54) was used instead of (2S,3R)-3-methyl-1-((S)-1-phenyl-ethyl)-pyrrolιdιne-2-carboxyhc acid methyl ester Moreover, a 1 1 saturated solution of NaHCOs/saturated solution of
Rochelle's salt was used for the basification and the basified aqueous layer was extracted exhaustively with THF
The title compound was obtained as a yellow oil HPLC tR = 2 50 mm (method A), ESI-MS
[M+Hf 274, TLC R, = 0 26 (3 1 Hex/EtOAc)
Step 54 (2S,3S)-3-Azιdomethyl-1-((S)-1-phenyl-ethyl)-pyrrolιdιne-2-carboxylιc acid methyl ester
Figure imgf000048_0003
Sodium azide (5 34 mmol) was added to a solution of (2S 3R)-3-ιodomethyl-1-((S)-1-phenyl- ethyl)-pyrrolιdιne-2-carboxylιc acid methyl ester (Step 5 5) (3 56 mmol) in DMF (30 mL) at rt After 18 h, the reaction mixture was poured onto water and extracted with MTBE (2X) The combined organic phases were washed with brine, dried (Na2SO4), filtered and
concentrated The residue was purified using a RediSep® silica gel column to to afford the title compound as a brown oil HPLC tR = 3 26 mm (method A), ESI-MS [M+H]+ 289
Step 5 5 (2S,3R)-3-lodomethyl-1-((S)-1-phenyl-ethyl)-pyrrolιdιne-2-carboxylιc acid methyl ester
Figure imgf000049_0001
A solution of [but~3-enyl-((S)-1-phenyi~ethyl)~amιno]-acetιc acid methyl ester [432555-77-6] (20 22 mmol) in THF (10 mL) was slowly added to a solution of lithium dnsopropylamide (24 26 mmol) in 1 2 hexanes/THF (30 mL) at -780C The reaction mixture was warmed to 00C, stirred for 1 h and then re-cooled to -780C A solution of ztnc bromide (50 5 mmoi) in Et2O (40 mL) was added and the reaction mixture was then warmed to rt After stirring for 1 h, the mixture was cooled to 00C and iodine (22 24 mmol) was added in portions The reaction mixture was stirred at 0°C for 2 h and at rt for another 2 h, diluted with Et2O and then successively washed with a saturated solution of Na2S2O3 and a saturated solution of NH4CI The aqueous layers were each back-extracted with Et2O The combined organic phases were dried (Na2SO4), filtered and concentrated The residue was purified by silica gel column chromatography to afford the title compound as a red oil HPLC tR = 3 46 mm (method A), ESI-MS [M+H]+ 374
Example 6 (2S,3S)-3-(Acetylamιno-methyl)-pyrrolιdιne-1 ,2-dιcarboxylιc acid 2-amιde 1-({4- methyl-5-[2-(2,2,2-trιfiuoro-1 ,1-dιmethyl-ethyI)-pyπdιn-4-yl]-thιazol-2-yl}-amtde)
Figure imgf000049_0002
The title compound was prepared in analogy to the procedure described in Example 2 but (2S 3S)-3-(acetylamιno-methyf)-ρyrrolfdιne-2-carboxylic acid amide (Step 5 1) was used instead of (2S,3R)-3-methyl-pyrrolιdιne-2-carboxylιc acid amide The title compound was obtained as a white solid HPLC tR = 4 73/4 78 mm (method B), LC- MS tR= 1 81 mm, [M+Hf 513 (method A), TLC Rf = 0 17 (9 1 CH2CI2/Me0H), 1H-NMR (de- DMSO, 600 MHz) 11 05 (br s, 1H), 8 59 (d 1H), 7 80 (br s, 1H), 7 55 (s, 1H)1 7 49 (br s, 1H), 7 40 (m, 1H), 7 10 (br s, 1H), 4 25 (m, 1H), 3 72 (m, 1H), 3 39 (m, 1H)1 3 23 (m, 1H), 2 92 (m, 1H), 2 41 (s, 3H), 2 39 (m, 1H), 2 00 (m, 1H), 1 82 (s, 3H), 1 72 (m, 1H), 1 61 (s, 6H)
Example 7 (2S,3S)-3-Morpholιn-4-ylmethyl-pyrrolidιne-1,2-dιcarboxylιc acid 2-amιde 1-({4- methyl-5-[2-(1-methyl-cyclopropyl)-pyrιdm-4-yl]4hιazol-2~yl}~arnιde)
Figure imgf000050_0001
The title compound was prepared in analogy to the procedure described in Example 1 but
(2S,3S)-3-morpholin-4-ylmethyl-pyrrolιdtne-2-carboxylιc acid amide (Step 7 1) was used instead of (2S,3R)-3-methyl-pyrrolιdιne-2-carboxylιc acid amide
The title compound was obtained as a pale yellow solid HPLC tR = 2 39 mm (method A), LC-MS tR= 0 90 mm, [M+H]+485 (method A), TLC R, = 0 09 (19 1 CH2CI2/MeOH), 1H-NMR
(de-DMSO, 600 MHz) 10 90 (br s, 1H), 841 (d, 1H), 7 35 (br s, 1H), 7 29 (s, 1H), 7 17 (d,
1 H), 7 02 (br s, 1 H), 4 26 (br s, 1 H), 3 69 (m, 1 H), 3 58 (m, 4H), 3 40 (m, 1 H), 2 58 (m, 1 H),
241 (s, 3H), 2 38 (m, 4H), 2 35 (m, 1H), 2 17 (m, 1H), 2 00 (m, 1H), 1 75 (m, 1H), 1 49 (s, 3H), 1 19 (m, 2H), 0 81 (m, 2H)
Step 7 1 (2S,3S)-3-Morpholιn-4-ylmethyl-pyrrolιdιne-2-carboxylιc acid amide
Figure imgf000050_0002
The title compound was prepared in analogy to the procedure described in Step 1 8 but (2S,3S)-3-morpholm-4-ylmethyl-1-((S)-1-phenyl-ethyl)-pyrrolιdιne-2-carboxyhc acid amide (Step 7 2) was used instead of (2S,3R)-3-methyl-1-((S)-1-phenyi-ethyl)-pyrrolιdιne-2- carboxylic actd amide Moreover, 10% Pd on charcoal, wet with 50% H2O (Aldπch 330108) was used instead of the dry catalyst
The title compound was obtained as a colorless oil ESI-MS [M+Hf 214, TLC Rf = 0 14 (200 20 1 CH2CI2/MeOH/conc NH4OH)
Step 7 2 (2S,3S)-3-Morpholin-4-ylmethyl-1 -((S)-1 -phenyl-ethyl)-pyrrolιdιne-2-carboxylιc acid amide
Figure imgf000051_0001
The title compound was prepared in analogy to the procedure described in Step 1 9 but (2S 3S)-3-morpholιn-4-ylmethyl-1-({S)-1-phenyl-ethyl)-pyrrolιdιne-2-carboxylιc actd methyl ester (Step 7 3) was used instead of (2S 3R)-3-methyl-1-((S)-1-phenyl-ethyl)~pyrrolιdιne-2- carboxyltc acid methyl ester Moreover, the basified aqueous layer was extracted exhaustively with THF instead of CH2CI2
The title compound was obtained as a yellow oil HPLC tR = 2 18 mm (method A), ESI-MS [M+H]+ 318
Step 7 3 (2S,3S)-3-Morpholιn-4-vlmethvl-1-((S)-1-phenyl-ethvl)-pvrrolιdιne-2-carboxvlιc acid methyl ester
Figure imgf000051_0002
A mixture of(2S,3R)-3-ιodomethyl-1-((S)-1-phenyl-ethyl)-pyrrolιdιne-2-carboxylιc acid methyl ester (Step 5 5) (7 07 mmol), K2CO3 (21 22 rnmol) and morpholine (10 61 mrnol) in acetonitrile (24 mL) was stirred at 50°C for 62 h The reaction mixture was poured onto ice water and extracted with EtOAc (3X) The combined organic layers were successively washed with water and brine, dried (Na2SO,*), filtered and concentrated The residue was purified using a RediSep® silica gel column to afford the title compound as a yellow oil HPLC tR = 2 56 mm (method A), ESI-MS [M+Hf 333 Example 8 (2S,3S)-3-Morpholm-4-ylmethyl-pyrrolidine-1 ,2-dicarboxylic acid 2-amιde 1-({4- methyl-5-[2-(2,2,2-tπfluoro-1l1-dimethyl-ethyl}-pyrιdin-4-yi}-thiazol-2-yl}-arτnde)
Figure imgf000052_0001
The title compound was prepared in analogy to the procedure described in Example 2 but (2S,3S)-3-morphotιn-4-ylmethyl-pyrrolιdιne-2-carboxy!ιc acid amide (Step 7 1) was used instead of (2S,3R)-3-methyl-pyrrolιdιne-2-carboxylιc acid amide
The title compound was obtained as a yellow foam HPLC t« = 4 81 mm (method B), LC-MS tR= 1 53 mm, [M+Hf 541 (method A), TLC R, = 0 22 (9 1 CH2CI2ZMeOH), 1H-NMR (d8- DMSO, 600 MHz) 11 02 (br s, 1 H), 8 60 (d, 1 H), 7 55 (s, 1 H), 7 41 (d, 1 H), 7 36 (br s, 1 H), 7 03 (br s, 1H), 4 26 (m, 1H), 3 69 (m, 1H), 3 58 (m, 4H), 3 41 (m, 1H), 2 58 (m, 1H), 2 41 (s, 3H)1 2 38 (m, 4H), 2 35 (m, 1H), 2 17 (m, 1 H), 2 01 (m, 1 H), 1 75 (m, 1H), 1 61 (s, 6H)
Example 9 (2S,3R)-3-Methyl-pyrrolιdιne-1,2-dιcarboxylιc acid 2-amsde 1-({5-[2-(1-fluoro-1- methyl-ethyl)~pyπmιdιn~4-y!]-4-methyl-thιazol-2-yl}-arnιde)
Figure imgf000052_0002
The title compound was prepared in analogy to the procedure described in Example 1 but ιmιdazote-1-carboxylιc acid {5-[2-(1-fluoro-1-methyl-ethyl)-pyrιmιdιn-4-yl]-4-methyMhtazol-2- yl}-amιde (Step 9 1) was used instead of ιmιdazole-1-carboxylιc acid {4-methyl-5-[2-(1- methyl-cyclopropyl)-pyrιdin-4-yl]-thιazol-2-yl}-amιde LC-MS tR = 1 53 mm, M+H = 407 0 (method B)1 1H-NMR (d6-DMSO, 600 13 MHz) 11 (s, br, 1H) 8 7 (s, 1H), 7 5 (s, 1H), 7 35 (s, 1H), 6 95 (s, 1H) 4 15 (s, 1H)1 3 65 (m, 1H), 34 (m, 1H), 2 6 (s, 3H), 2 3 (m, 1 H), 1 95 (m, 1H), 1 75 (s, 3H), 1 7 (s, 3H), 1 7 (s, 3H), 1 7 (m, 1H), 0 95 (d, 3H)
Step 9 1 lmιdazoie-1-carboxylιc acid {5-[2-(1-fluoro-1-methyl-ethyi)~pyπmιdιn-4-yl]-4~methyl- thtazol-2-yl}-amιde
Figure imgf000053_0001
CDI (0 10 g) was added to a stirred solution of 5-[2-(1-fluoro-1-methyf-ethyl)-pyrimιdιn-4-yl]- 4-methyl-thιazoi-2-ylamιne (Step 9 2) (0 15 g) in CH2Cl2 {4 mL) at rt The reaction mixture was then stood for 56 h at 25°C and the title compound isolated by filtration
Step 9 2 5-l2-(1-Fiuoro-1-methyl-ethyl)-pyrιmidιn-4-yl1-4-methyl-thιazol-2-ylamιne
Figure imgf000053_0002
A mixture of AT-[5-{(E)-3-dimethylamino-acryloyl)-4-methyl-thiazol-2-yl]-W,/V-dimethyl- formamidine [507487-90-3] (2 1 g), 2-fluoro-2-methylpropιonamιdιne (1 7 g prepared by an analogous procedure to that described for Example 1 in EP 0227415 ) and 2- methoxyethanol (3 8 mL) was stirred at rt for 30 mm NaOH (0 3 g) was added and the mixture stirred at 125°C for 2 h After cooling to rt, water was added and the mixture evaporated to dryness and purified by normal phase chromatography on silica gel eluting with CH2CI2 MeOH cone NH4OH 97 5 2 0 5 to give the title compound
Example 10 (2S,3R)-3-Hydroxy-pyrrolιdιne-1,2-dιcarboxy(ιc acid 2-amιde 1-{[4'-methyl-2-(1- tπfluoromethyl-cyclopropyl)-[4,5']bιthιazolyl-2'-yl]-amιde}
Figure imgf000053_0003
The title compound was prepared in analogy to the procedure described in Example 1 but ιmιdazole-1-carboxylιc acid [4'-methyl-2-(1-trιfluoromethyl-cyclopropyl)-[4 5']bιthιazolyl-2'-yl]- amide (Step 10 1) was used instead of ιmιdazole-1-carboxylιc acid {4-methyl-5-[2-{1 -methyl- cyclopropyl)-pyrιdιn~4-yl]-thιazol-2-yl}-amιde and (2S,3R)-3-hydroxy-pyrrohdιne-2-carboxylic acid amide (described in H Fukushima et al , Biorg Med Chem 2004, 12, 6053, H Ji et al J Med Chem 2006, 49, 6254) was used instead of (2S 3R)-3-methyl-pyrrolιdιne-2-carboxylιc acid amide LC-MS tR =1 78 min, M+H = 462 O1 M-H = 460 0 (method B), 1H-NMR (d6- DMSO, 600 13 MHz) 10 8 (s, br, 1H) 7 6 (s, 1H), 7 1 (s, br, 1H), 6 9 (s, br, 1H), 5 15 (s, 1H)1 44 (s, 1H), 4 2 (s, br, 1H), 3 6 (m, 1H), 3 40 (m, 1H), 2 4 (s, 3H), 1 9 (m, 1H) 1 7 (m, 1H), 1 6 (s, 1H), 1 52 (s 2H)
Step 10 1 lmιdazole-1-carboxylic acid [4'-methyl-2-(1-trιfluoromethyt-cyclopropyl)- [4,5']bιthiazolyl-2'-yl]-amιde
CDI (0 13 g) was added to a stirred solution of 4'-methyl-2~(1-trιfluoromethyI-cycIopropyl)- [4,5']bιthιazolyl-2'~ylamιne (Step 10 2) (0 16 g) in CH2Ci2 (5 mL) at rt The reaction mixture was then stood for 3 h at 25°C and the title compound isolated by filtration
Step 10 2 4'-Methyl-2-(1-tnfluoromethvl-cγclopropvl)-f4,5'1brthiazolvl-2'-ylarrnne
Figure imgf000054_0002
HCI {1 17 g 32% aqueous solution) was added to a solution of N-[4'-methyl-2-(1- trιfluoromethyl-cyclopropyl)-[4,5'3bιthιazolyf-2'-yl]-acetamιde (Step 10 3) (0 18 g) in EtOH (10 mL) and the reaction mixture heated at reflux for 7 h The cooled reaction mixture was partitioned between EtOAc and aqueous NaHCO3 solution, the organic layers dπed over Na2SO4 and evaporated to give the title compound MS (ESI) positive 306 1 (M+H), negative 304 1 (M-H)
Step 10 3 N-f4'-Methvl-2-(1-trifluoromethyl-cvclopropvl)-f4,5']bιthιazolvl-2'-yl1-acetarrnde
Figure imgf000054_0003
To a solution of Λ/-[5-(2-bromo-acetyl}-4-methyt-thιazol-2-yl3-acetamide (0 29 g, prepared as described in WO 2005/068444) in MeOH (15 mL) at rt was added 1 -tπfluoromethyl- cyclopropanecarbothioic acid amide [871913-36-9] (0 20 g) and
ammoniumphosphomolybdate (0 15 g) After stirring 18 h at rt, the reaction mixture was partitioned between EtOAc and water, the organic layers dried over Na2SO4 and evaporated to give the crude product Purification by flash chromatography with an eluent of 1% MeOH in CH2Cl2 gave the title compound MS (ESI) positive 348 1 (M+H), negative 346 1 (M-H)
Example 11 (2S,3R)~3-Methyl-pyrrolιdιne-1,2-dιcarboxylic acid 2-amιde 1-{[4'-methyI-2-(1- tπfluoromethyl-cyc!opropyl)-[4,5']bιthiazolyl-2'-yI]-amιde}
Figure imgf000055_0001
lmιdazole-1-carboxyhc acid [4'-methyl-2-(1-tπfluoromethyl-cyclopropyl)-{4,5']bιthιazolyl-2'-yl]- amide (Step 10 1) (20 mg) is added to a stirred solution of (2S,3R)-3-methyl-pyrrolιdine-2- carboxylic acid amide (Step 1 8) (9 mg) and Et3N (21 μl) in DMF (0 5 mL) at rt The reaction mixture was stirred at rt for 56 h, evaporated and crystallized from aqueous MeOH to give the title compound LC-MS tR = 1 90 mm, M+H = 460 0, M-H = 458 0 (method B), 1H-NMR (dβ-DMSO, 600 13 MHz) 10 75 (s, br, 1H) 7 62 (s, 1H)1 7 35 (s, br, 1H), 6 95 (s, br, 1H), 4 15 (S1 br, 1H), 3 65 (m, 1 H), 3 35 (m, 1H)1 2 4 (s, 3H), 2 35 (m, 1H), 1 9 (m, 1H), 1 7 (m, 1H), 1 52 (s, 1H), 1 50 (s, 2H), 0 95 (d, 3H)
Example 12 (2S,3R)-3-Methyl-pyrrolιdιne-1 ,2-dιcarboxyltc acid 2-amιde 1-{[5-(2-d9-tert-butyl- pyrιmιdιn-4-yl)-4-methyl-thιazol-2-yl]-amιde}
Figure imgf000055_0002
lmιdazole-1-carboxylιc acid [5-(2-d9-tert-butyl-pynmιdιn-4-yl)-4-methyl-thιazol-2-yl]-amιde (Step 12 1) (222 mg) is added to a stirred solution of (2S,3R)-3-methyl-pyrrolιdιne-2- carboxyhc acid amide (Step 1 8) (95 mg) and Et3N (264 μl) in DMF (3 mL) at rt The reaction mixture was stirred at rt for 56 h, evaporated and crystallized from aqueous MeOH to give the title compound MS (ESI) positive 412 1 (M+H), negative 410 2 (M-H)
Step 12 1 lmιdazole-1-carboxylιc acid [5-(2-d9-tert-butyl-pyrimidin-4-yl)-4-methyl-thiazol-2- yl]-amιde
Figure imgf000056_0001
CDI(O 77 g) was added to a stirred solution of 5-(2-d9-tert-butyl-pyπmιdin-4-yl)-4-methyl- thιazol-2-ylamιne (Step 12 2) (1 11 g) in DMF (4 3 mL) at rt The reaction mixture was then stood for 18 h at 25°C and the title compound isolated by filtration
Step 12 2 5-(2-d9-tert-Butyl-pyrtmιdιn-4-yl)-4-methyl-thιazol-2-ylamιne
Figure imgf000056_0002
Powdered NaOH (3 71 g) was added to a solution of N'-[5-(3-dιmethylamιno-acryloyl)-4- methyl-thιazol-2-yl]-N,N-dιmethyl-formamιdιne [507487-90-3] (5 51 g) and d9-2,2-dιmethyf- propionamidine hydrochloride (Step 12 3) (4 50 g) in 2-methoxyethanol (41 mL) and the mixture heated at 125°C for 1 h with stirring The reaction mixture was cooled, water added, and the crude product isolated by filtration The crude product was purified by preparative HPLC and the fractions containing the title compound partitioned between CH2CI2 and aqueous NaHCO3 The title compound was obtained as a yellow solid after evaporation of the dried CH2CI2 layers LC-MS tR = 1 12 mm, M+H 258 4
Step 12 3 dg-2,2-Dιmethyl-prop!onamιdιne hydrochloride
Figure imgf000057_0001
A 2M solution of trtmethylalumintum in toluene (61 mL) was added dropwise to a suspension of ammonium chloride (6 53 g) in toluene (46 mL) with ice bath cooling The reaction mixture was stirred for 4 h at rt and dg-2,2-dιmethyl-propιonιc acid butyl ester (Step 12 4) (6 3 g) added After heating at 8GX for 4 days, the reaction mixture was cooied to 00C and MeOH (200 mL} was carefully added dropwise After stirring and sonication for 1 h at rt, the reaction mixture was filtered through Hyflo, washing with MeOH1 and the filtrate was evaporated to give the titie compound as an off-white solid Step 124 ds~2,2-Dιmethyl-propιonιc acid butyl ester
Figure imgf000057_0002
dg-tert-Butylchloπde (5 0 g) was added portionwise to a suspension of magnesium (1 50 g) in THF (20 mL), activated with a catalytic amount of iodine, over 1 h with heating as required to maintain a steady reflux The reaction mixture was then heated for a further 1 h to ensure complete Gπgnard formation The above Gπgnard solution was then added dropwise to a solution of ιmιdazole-1-carboxylιc acid butyl ester (7 5 g, prepared as descπbed by T Werner and A G M Barrett, J Org Chetn 2006, 71 , 4302-4304 ) in THF (40 mL) cooled with an ice bath The reaction mixture was stirred for 18 h at rt, (200 mL) was added, the mixture filtered through Hyflo, the filtrate extracted with Et2O and the Et2O layers dried over Na2SO4 and evaporated to give the tile compound
Example 13 (2S,3R)-3-Methyl-pyrrolιdιne-1,2-dιcarboxylιc acid 2-amιde 1-{[5-(6- d10- dιethylamιno-pyrazιn-2-yl)-4-rnethyl-thιazol-2-yl]-arnιde}
Figure imgf000058_0001
lmιdazole-1 -carboxylic acid [5-(6-dio-diethylamino-pyrazin-2-yl)-4-methyl-thiazol-2-yt]-amide (Step 13 1} (19 mg) was added to a stirred solution of (2S,3R)-3-methyl-pyrrolιdιne-2- carboxylic acid amide (Step 1 8) (9 mg) and Et3N (21 μl) in DMF (0 5 ml) at rt The reaction mixture was stirred at rt for 56 h, water (1 ml.) was added and the title compound collected by filtration MS (ESI) positive 428 1 (M+H), negative 426 2 (M-H)
Step 13 1 lmιdazole~1 -carboxylic acid [5-(6-diø-dιethylarnιno-pyrazιn-2-yl)-4-methyl-thιazol- 2-ylJ-amιde
Figure imgf000058_0002
CDI (78 mg) was added to a solution of 5~(6-d10~dιethylamιno-pyrazιn-2-yl)-4-rnethyl-thiazol- 2-ylamιne (Step 13 2) (121 mg) in DMF (2 mL) at rt and stood for 3 5 h at rt The reaction mixture was filtered, washing with CH2CI2, to give the title compound Step 13 2 5-(6-d10-dιethylamιno-pyraztn-2-yl)-4-methyl-thιazol-2-ylamιne
Figure imgf000058_0003
Concentrated HCI (0 4 mL) was added to N-[5-(β-d10-dιethylamιno-pyrazιn-2-yl)-4-methyl- thιazol-2-yl]-acetamιde (Step 13 3) (140 mg) in EtOH (9 ml) at rt and the mixture heated at reflux for 40 h The cooled reaction mixture was evaporated neutralized with aqueous NaHCO3 and extracted with 10% MeOH in CH2CI2 The combined organic extracts were dπed over Na2SO4 and evaporated to give the title compound LC-MS tR = 1 17 mm, M+H 2744 (method A)
Step 13 3 N-f5-(β-din-dιethvlamιno-pvrazιn-2-vl)-4-methvl-thtazol-2-vl)-acetamιde
Figure imgf000059_0001
Argon was bubbled through a mixture of 2-dto-dιethylammo-6-chlαropyrazιπe (Step 13 4) (293 mg), 2-acetamtdo-4-methylthιazole (300 mg), palladium acetate (24 mg), tri-tert- butylphosphonium tetrafuoroborate (61 mg) and cesium carbonate (1 02 g) in DIVIF (3 mL) at rt for 5 mm The reaction mixture was heated in a sealed vial under an argon atmosphere for 45 mm at 1500C in a Biotage Initiator™ microwave apparatus, filtered and purified by preparative HPLC Fractions containing the title compound were combined and evaporated to remove acetonitrile and the title compound obtained as a beige solid by filtration LC-MS tR = 1 68 mm, M+H 316 3 (method A) Step 134 2~d10-diethylamino-6-chloropyrazine
Figure imgf000059_0002
d10-Diethylamine (0 5 g) was added to a stirred mixture of 2,6-dιchloropyrazιne [4774-14-5] (0 93 g) and potassium carbonate (1 41 g) in acetonitrile (4 mL) at rt The reaction mixture was then heated at 55°C for 60 h, cooled, water added and extracted with CH2CI2 The combined organic extracts were dried over Na2SO4, evaporated and purified by normal phase chromatography, eluent CH2CI2, to give the title compound LC-MS tR = 2 10 mm, M+H 196 4 and 1984 (method A)
Example 14 (2S,3R)-3-Methoxymethyl-pyrrolιdιne-1 ,2-dιcarboxylιc acid 2-amιde 1-({4- methyl-5-[2-(2,2,2-trιfluoro-1 1-dιmethyl-ethyl)-pyridιn-4-yl]-thιazol-2-yl}-amide)
Figure imgf000060_0001
The title compound was prepared in analogy to the procedure described in Example 2 but (2S,3R)-3-methoxymethyI-pyrrolidme-2-carboxylic acid amide (Step 14 1) was used instead of (2S,3R)-3-methyl-pyrro!ιdιne-2-carboxylιc acid amide
The title compound was obtained as a white solid HPLC tR = 3 18 mm (method A), LC-MS tR= 1 88 mm, [M+Hf 486 (method A), TLC Rf = 0 14 (19 1 CH2CI2/MeOH), 1H-NMR (d6- DMSO, 600 MHz) 10 97 (br s, 1H), 8 60 (d, 1H), 7 55 (br s, 1H)1 7 41 (d, 1H), 7 39 (br s, 1 H), 7 04 (br s, 1H), 4 2δ (br s, 1H), 373 (m, 1H), 3 45 (m, 1H)1 3 40 (m, 1H), 3 24 (s, 3H), 3 16 (m, 1H), 2 50 (m, 1H), 2 42 (s, 3H), 2 02 (m, 1H), 1 77 (m, 1H), 1 61 (s, 6H)
Step 14 1 (2S,3R)-3-Methoxymethyl-pyrrolιdιne-2-carboxylιc acid amide
Figure imgf000060_0002
The title compound was prepared in analogy to the procedure described in Step 1 8 but (2S,3R)-3-methoxymethyi-1 ~((S)-1 -phenyl-ethyi)-pyrrolιdιne-2-carboxylιc acid amide (Step 14 2) was used instead of (2S,3R)-3-methyl-1-((S)-1 -phenyl-ethyl)-pyrrolιdιne-2- carboxylic acid amide Moreover, 10% Pd on charcoal, wet with 50% H2O (Aldrich 330108) was used instead of the dry catalyst
The title compound was obtained as a white solid ESI-MS [M+H]+ 159 Step 14 2 (2S,3R)-3-Methoxymethyl-1 -((S)- 1 -phenyl-ethyl)-pyrro!ιdιne-2-carboxylιc acid amide
Figure imgf000060_0003
The title compound was prepared in analogy to the procedure described in Step 1 9 but (2S,3R)-3-methoxymethyl-1-((S)-1-phenyl-ethyl)-pyrrolιdιne-2-carboxylιc acid methyl ester (Step 14 3) was used instead of (2S,3R)-3-methyl-1-((S)-1-pheny!-ethyI)-pyrrotιdιne-2- carboxylic acid methyl ester Moreover, the bastfied aqueous layer was extracted
exhaustively with THF instead of CH2Ci2
The title compound was obtained as a yellow oil HPLC tR = 2 35 mm (method A), LC-MS tR= o 47 mm, [M+H]+263 (method C), TLC Rf = 0 05 (1 1 Heptanes/EtOAc)
Step 14 3 (2S,3R)-3-Methoxvmethyl-1-((S)-1-phenvl-ethyl)-pyrrolιdιne-2-carboxvlιc acid methyl ester
Figure imgf000061_0001
A mixture of (3aR,6aS)-1-((S)-1-phenyl-ethyl)-hexahydro-furo[3,4-b]pyrrol-6-one [805246-48- 4] (17 05 mmol), KOH (71 60 mmol) and iodomethane (68 20 mmol) in toluene (79 mL) was stirred at 800C for 1 5 h The reaction mixture was cooled to rt and partitioned between water and MTBE The aqueous layer was extracted with MTBE (3X) The combined organic layers were dried (Na2SO4), filtered and concentrated The residue was purified by silica gel column chromatography to afford the title compound as a yellow oil HPLC tR = 2 98 mm (method A), LC-MS tR= 0 69 mm, [M+Hf278 (method C), TLC Rf = 0 25 (1 3 Heptanes/EtOAc)
Example 15 (2S,3S)-3-Dιmethylamιnornethyl-pyrrolιdιne-1,2-dιcarboxylιc acid 2-amιde 1-({4- methyl-5-[2-(2l2l2-trif)uoro-1 ,1-dimethyl-ethyi)-pyrtdin-4-yl]-thiazol-2-yl}-amide)
Figure imgf000061_0002
The title compound was prepared in analogy to the procedure described in Example 2 but (2S,3S)-3-dιmethy!amιnomethyl-pyrrolιdιne-2-carboxylιc acid amide (Step 15 1) was used instead of (2S,3R)-3-methyl-pyrrolιdιne-2-carboxylic acid amide
The title compound was obtained as a yellow solid HPLC tR = 4 71 mtn (method B), LC-MS tR= 1 58 mm, [M+H]+499 (method A), TLC Rf = 0 08 (4 1 CH2CI2/Me0H) 1H-NMR (db- DMSO, 600 MHz) 10 99 (br s, 1 H)1 8 60 (d, 1 H), 7 55 (br s, 1 H), 7 41 (d, 1 H), 7 40 (br s,
1 H), 7 04 (br s, 1 H), 4 25 (br s, 1 H)1 3 69 (m, 1 H), 341 (m, 1 H) 2 51 (m, 1 H) 2 41 (s, 3H)
2 32 (m, 1H), 2 17 (m, 1H), 2 17 (s, 6H), 2 01 (m, 1H), 1 72 (m, 1 H), 1 61 (s 6H) Step 15 1 (2S 3S)-3-Dιmethyiamιnomethyi~pyrrolidιne-2-carboxylιc acid amide
Figure imgf000062_0001
The title compound was prepared in analogy to the procedure described in Step 1 8 but (2S,3S)-3-d)methylamιnomethyl-1-{(S)-1-phenyI-ethyl)-pyrrolιdιne-2-carboxylιc acid amide (Step 152) was used instead of (2S,3R)-3-methyf-1-((S)-1-phenyl-ethyl)~pyrrolιdine-2- carboxylic acid amide Moreover, the hydrogenation was performed under 4 bar pressure The title compound was obtained as a yellow oil ESI-MS [M+H]* 172 Step 15 2 (2S,3S)-3-Dimethvlaminomethvl-1-((S)-1-phenvl-ethvl)-pyrrolidine-2-carboxvlic acid amide
Figure imgf000062_0002
A mixture of (2S,3S}-3-aminomethyl-1-({S)-1-phenyl-ethyl)-pyrrol(dιne-2-carboxylιc acid amide (Step 15 3) (0 418 mmol), sodium cyanoborohydπde (2 86 mmol) and 37% aqueous formaldehyde (2 14 mmol) in MeOH (3 3 mt_) was stirred at 55°C for 16 h The reaction mixture was cooled to rt and concentrated The residue was purified using a RediSep® silica gel column to afford the title compound as a white foam HPLC tR 3 59 mm (method B), LC- MS tR= 0 86 mm, [M+H]+276 (method A), TLC R, = 0 13 (9 1 CH2CI2/MeOH) Step 15 3 (2S,3S)-3~Amιnomethyl~1-((S)-1-phenyl-ethyl)-pyrrolιdιne-2~carboxylιc acid amide
Figure imgf000062_0003
A mixture of (2S,3S)-3-azιdomethyl-1-((S)-1-phenyl-ethyl)-pyrrolιdιne-2-carboxylιc acid amide (Step 5 3) (0 723 mmol) and tπphenylphosphine (0 867 mmol) in THF (3 mL) was stirred at rt for 25 h The reaction mixture was concentrated to afford the crude title compound as a light brown solid HPLC tR 3 53 mm (method B)1 ESI-MS [M+H]+ 248 Example 16 (2S,3R)-3-MethyI-pyrroltdιne-1 ,2-ciicarboxyiiC acid 2-amιde 1-{[5-(24ert-butyl- pyπdιn-4-yl)-4-methyI-thιazol-2-yl]-amιde}
Figure imgf000063_0001
The title compound was prepared from commercially available (Combi-Phos) 4-bromo~2-tert- butyl-pyπdine (instead of 4-bromo-2-(1-methyl-cyclopropyl)-pyrιdιne) using synthetic methodology as described for the preparation of Example 1
LC-MS tR = 045 mm, M+H = 402 3, M-H = 400 2 (method D) 1H-NMR (d6-DMSO, 400 MHz) 8495 (d, 1H), 7 34 (s, 2H), 7 205 (d, 1H), 6 95 (bs, 1H), 4 15 (m, 1 H), 3 68 (dd, 1H), 3 37 (m, 1H), 2 39 (s, 3H), 2 37 (m, 1H), 1 95 (m, 1 H), 1 68 (m, 1H)1 1 32 (s, 9H), 0 965 (d, 3H)
Efficiency as PI3 kinase inhibitors
P13K KinaseGlo assay 50 nl_ of compound dilutions were dispensed onto black 384-well low volume Non Binding Styrene (NBS) plates (Costar Cat No NBS#3676) L-a- phosphatidyiinositol (PI), provided as 10 mg/ml solution in methanol, was transferred into a glass tube and dried under nitrogen beam It was then resuspended in 3% OctylGlucoside (OG) by vortexing and stored at 4°C The KinaseGlo Luminescent Kinase Assay (Promega, Madison/WI, USA) is a homogeneous HTS method of measuring kinase activity by quantifying the amount of ATP remaining in solution following a kinase reaction
5 μL of a mix of Pi/OG with the PI3K subtype were added (Table 1) Kinase reactions were started by addition of 5 μl of ATP-mix containing in a final volume 10 μL 10 mM TRIS-HCI pH 7 5, 3mM MgCI2, 50 mM NaCI1 0 05% CHAPS, 1mM DTT and 1 μM ATP and occurred at room temperature Reactions were stopped with 10 μl of KinaseGlo and plates were read 10 mtns later in a Synergy2 reader using an integration time of 0 1 seconds per well 2 5 μM of a pan-class 1 PI3 kinase inhibitor (standard) was added to the assay plates to generate the 100% inhibition of the kinase reaction and the 0% inhibition was given by the solvent vehicle (90% DMSO in water) The standard was used as a reference compound and included in all assay plates in the form of 16 dilution points in duplicate Table 1 PI3Ks by KinaseGlo: assay conditions and reagent protocol
Figure imgf000064_0001
Cloning of PI3Ks
The PiSKa, PI3Kβ and PI3Kδ constructs are fusion of p85α iSH2 domain and the respective p110 isoforms. The p85α fragment and p110 isoform genes were generated by PCR from first strand cDNA generated by RT-PCR from commercial RNA from placenta, testis and brain as described below. The PI3Kγ construct was obtained from Roger Williams lab, MRC Laboratory of Molecular Biology, Cambridge, UK (November, 2003) and is described (Pacold, Michael E.; Suire, Sabine; Perisic, OIga; Lara-Gonzalez, Samuel; Davis, Colin T.; Walker, Edward H.; Hawkins, Phillip T.; Stephens, Len; Eccleston, John F.; Williams, Roger L. Crystal structure and functional analysis of Ras binding to its effector phosphoinositide 3-kinase gamma. Cell (2000), 103(6), 931-943).
PI3Kα constructs and proteins
PI3Kα wt BV1075 p85iSH2{461 -568)-GGGGGGGGGGGG-p110α(21 -1068)-His
BV1075: The construct for Baculovirus BV-1075 was generated by a three-part ligation comprised of a p85 fragment and a p110α fragment cloned into vector pBlueBac4.5, The p85 fragment was derived from plasmid p1661-2 digested with Nhe/Spe. The p110α fragment derived from is clone was verified by sequencing and used in a LR410 as a Spel/Hindlll fragment. For the generation of the baculovirus expression vector LR410 the gateway LR reaction to transfer the insert into the Gateway adapted pBlueBac4.5 (Invitrogen) vector was used,. The cloning vector pBlueBac4.5 (Invitrogen) was digested with Nhe/Hindlll. This resulted in the Gonstruct PED 153.8. The p85 component (iSH2) was generated by PCR using ORF 318 (described above) as a template and one forward primer KAC1028 (5'- GCTAGCATGCGAGAATATGATAGAT-TATATGAAG-AATATACC) (SEQ ID NO. 1) and two reverse primers, KAC1029 (S'-GCCTCCACCAC-CTCCGCCTG- GTTTAATGCTGTTCATACGTTTGTC) (SEQ ID NO. 2) and KAC1039 (5'- TACTAGTC-CGCCTCCAC-CACCTCCGCCTCCACCACCTCCGCC) (SEQ ID NO. 3). The two reverse primers overlap and incorporate the 12x GIy linker and the N- terminal sequence of the p110α gene to the Spel site. The 12x GIy linker replaces the single GIy linker in the BV1052 construct. The PCR fragment was cloned into pCR2.1 TOPO (Invitrogen). Of the resulting clones, p1661-2 was determined to be correct by sequencing. This piasmid was digested with Nhe and Spel and the resulting fragment was gel-isolated and purified for sub-cloning.
The p110α cloning fragment was generated by enzymatic digest of clone LR410 (see above) with Spe I and Hindlll. The Spel site is in the coding region of the p110α gene. The resulting fragment was gel-isolated and purified for sub-cloning. The cloning vector, pBiueBac4.5 (Invitrogen) was prepared by enzymatic digestion with Nhe and Hindlll. The cut vector was purified with Qiagen column and then dephosphorylated with Calf Intestine alkaline phosphatase (CIP) (BioLabs). After completion of the CIP reaction the cut vector was again column purified to generate the final vector. A three-part ligation was performed using Roche Rapid ligase and the vendor specifications. The final piasmid was verified by sequencing.
Kinase domain.
Protein sequence of BV 1075:
1 MREYDRLYEE YTRTSOEIQM KRTAIEAFNE TIKTFEEQCQ TQERYSKEYI EKFKREGNEK 61 EIQR1MHNYD KLKSRISEII DSRRRLEEDL KKQAAEYREI DKRMNSTKPG GGGGGGGGGG
121 GLVECLLPNG MIVTLECLRE ATLITIKHSL FKEARKYPLH QLLQDESSYI FVSVTQEAER
182 EEFPDETRRL CDLRLFQPFL KVIEPVGNRE KKILNREIGF AIGMPVCEFD MVKDPEVQDF
241 RRNILNVCKE AVDLRDLNSP HSRAMYVYPP NVESSPELPK HIYNKLDKGQ IIWIWVIVS
301 PNNDKQKYTL KINHDCVPEQ VIAEAIRKKT KSMLLSSEQL KLCVLEYQGK YILKVCGCDE 361 YFLEKYPLSQ YKYIRSCIML GRMPNLMLMA KESLYSQT)PM nCFTMPSYSR RISTATPYMN
421 GETSTKSLWV INSALRIKIL CATYVNVNIR DTDKIYVRTG IYHGGEPLCD NVNTQRVPCS
481 NPRWNEWLNY DIYIPDLPRA ARLCLSICSV KGRKGAKEEH CPLAWGNINL FDYTDTLVSG
541 KMALNLWPVP HGLEDLLNPI GVTGSNPNKE TPCLRLEFDW FSSWKFPDM SVJEEHANWS 60J VSREAGFSYS HAGLSMRLAR DNELRENDKE QLKAISTRDP LSEITEQEKD FLWSHRHYCV
661 TIPEILPKLL LSVKWNSRDE VAQMYCLVKD WPPIKPEQAM ELLDCNYPDP MVRGFAVRCL
721 EKYLTDDKLS QYLIQLVQVL KYEQYLDNIiL VRFIiLKKALT NQRIGHFFFW HLKSEMHNKT
781 VSQRFGLLLE SYCRACGMYL KHLNRQVEAM EKLINLTDIL KQEKKDETQK VQMKFLVEQM 841 RRPDFMDALQ GFLSPLNPAH QLGNLRLEEC RIMSSAKRPL WIrNWENPDIM SELLFQMNEI
901 IFKNGDDLRQ DMLTLQIIRI MENIWQNQGL DLRMLPYGCL SIGDCVGLIE WRNSHTIMQ
961 IQCKGGLKGA LQFNSHTLHQ WLKDKNKGET YDAAIDLFTR SCAGYCVATF ILGTGDRHNS
1021 NIMVKDDGQL FHIDFGHFLD HKKKKFGYKR RRVPFVLTQD FLIVISKGAQ ECTKTREFER
1081 FQEMCYKAYL AIRQHANLFI NLFSMMLGSG MPELQSFDDI AYIRKTLALD KTEQEALEYF 1141 MKQMNDAHEG GHTTKMDWIF HTIKQHALNE LGGAHHHHHH (SEQ ID NO. 4}
Pi3Kβ constructs and proteins
PI3Kβ BV949 p85iSH2(461-N58K-568}-GGGGGG-p110β(2-1070)-His
BV949: PCR products for the inter SH2 domain (iSH2) of the p85 Pl3Kα, PI3Kβ and PI3Kδ subunit and for the full-length p11Gβ subunit were generated and fused by overlapping PCR. The iSH2 PCR product was obtained from first strand cDNA generated by RT-PCR from commercial human RNA from placenta, testis and brain (Clontech), initially using primers gwG130-p01 (51-
CGAGAATATGATAGATTATATGAAGAAT-3') (SEQ ID No. 5) and gwG130-p02 (5'- TGGTπ-AATGCTGπCATACGTTTGTCAAT-31) (SEQ ID No. 6). Subsequently, in a secondary PCR reaction Gateway recombination AttB1 sites and linker sequences were added at the 5'end and 3'end of the p85 iSH2 fragment respectively, using primers gwG130-p03 (δ'-GGGACAAGTT-
TGTACAAAAAAGCAGGCTACGAAGGAGATATACATATGCGAGAATATGATAGAT
TATATGAAGAAT-3') (SEQ ID No. 7) and gwG130-p05 (51- ACTGAAGCATCCTCCTC-CTCCTCCT-
CCTGGTTTAATGCTGTTCATACGTTTGTC-3") (SEQ ID No. 8). The p110β fragment was obtained by PCR using as template a p110β clone (from unknown source that was sequence verified) using primers gwG130-p04 (5'- ATTAAACCAGGAGGAGGAGGAGGAGGATGCTT- CAGTTTCATAATGCCTCCTGCT -3') (SEQ ID No. 9) which contains linker sequences and the 5'end of p110β and gwG130-p06 (5'- AGCTCCGTGATGGTGATGGTGATGTGCTCCAGATC-TGTAGTCTTTCCGAA- CTGTGTG-3') (SEQ ID No. 10) which contains sequences of the 3'end of p110-β fused to a Histidine tag. The p85-iSH2/ p110β fusion protein was assembled by an overlapping PCR a reaction of the linkers at the 3'end of the iSH2 fragment and the 5'end of the p110β fragment, using the above mentioned gwG130-p03 primer and a primer containing an overlapping Histidine tag and the AttB2 recombination sequences (5 -
GGGACCACTTTGTACAAGAAAGCTGGGTTTAAGCTCCGTGATGGTGATGGTGA TGTGCTCC-31) (SEQ ID No. 11). This final product was recombined in a Gateway (Invitrogen) OR reaction into the donor vector pDONR201 (Invitrogen) to generate the ORF253 entry clone. This clone was verified by sequencing and used in a Gateway LR reaction (Invitrogen) to transfer the insert into the Gateway adapted pBlueBac4.5 (Invitrogen) vector for generation of the baculovirus expression vector LR280, This LR280 has an amino acid mutation in the p85 sequence.
Kinase domain.
Protein sequence of BV949*
1 MREYDRLYEE YTRTSQEIQM KRTAIEAFNE TIKIFEEQCQ TQERYSKEYX KKFKRKGKEK
61 EIQRIMHNYD KLKSRISEII DSRRRLEEDL KKQAAEYREI DKRMNSIKPG GGGGGCFSFI
121 MPPAMADILD IWAVDSQIAS DGSJ PVDFLL PTGIYIQLEV PREATISYIK QMLWKQVHNY
181 PMFKfLLMDID SYMFACVNQT AVfEELEDET RRLCDVRPFL PVLKLVTRSC DPGEKLDSKI 241 GVLIGKGLHE FDSLKDPEVN EFRRKMRKFS EEKILSLVGL SWMDWLKQTY PPEHEPSIPE
301 NLEDKLYGGK LIVAVHFENC QDVFSFQVSP NMKPIKVNEL AIQKRLTIHG KEDEVSPYDY
361 VLQVSGRVEY VFGDHPLIQF QYIRNCVMNR ALPHFILVEC CKIKKMYEQE MIAIEAAINR
421 NSSNLPLPLP PKKTRIISHV WEMNNPFQIV LVKGNKLNTE ETVKVHVRAG LFHGTELLCK
481 TIVSSEVSGK NDHIWNEPLE FDINICDLPR MARLCFAVYA VLDKVKTKKS TKTINPSKYQ S4i i ΓRKAGKVHY PVAWVNΓMVF DFKGQLRTGD IILHSWSSFP DELEEMLNPM GTVQTNPYTE
601 NATALHVKFP SNKKQPYYYP PFDKIIEKAA ETASSDSANV SSRGGKKFLP VLKHILDRDP
661 LSQLCFNEMD LIWTLRQDCP BIFPQSLPKL LLSIKKNKLE DVAQLQALLQ IWPKLPPREA
721 LELLDFNYPD QYVREYAVGC LRQMSDEELS QYLLQLVQVL KYEPFLDCAL SRFLLERALG
/83 IsIRRIGQFLFW IILRSEVHIPA VSVQFGVTLE AYCRGSVGHM KVLSKQVEAL NKLKTLNSLI 841 KLNAVKLNRA KGREAMHTCL KQSAYREALS DLQSPLNPCV ILSELYVEKC KYMDSKMKPL
901 WLVYNNKVFG EDSVGVIFKN GDDLRQDMLT LQMLRLMDLL WKEAGLDLRM LPYGCLATGD
961 RSGLIKWST SETIADIQLN SSNVAAAAAF NKDALI1NWLK EYNSGDDLDR AIEEFTLSCA
1021 GYCVASYVT/G TGDRHSDIITM VKKTGQT,FHI DFGHILGNFK SKFGIKRERV PFILTYDFIH
1081 VIQQGKTGNT EKFGRFRQCC EDAYLILRRH GNLFITLFAL MTJTAGLPELT SVKDTQYLKD 1141 SLALGKSEEE ALKQFKQKFD EALRESWTTK VNWMAHTVRK DYRSGAHHHH HhGA (SEQ
ID No.12) Kinase domain.
PI3Kγ construct and protein
Figure imgf000068_0001
Construct obtained from Roger Williams lab, MRC Laboratory of Molecular Biology, Cambridge, UK (November, 2003). Description of the construct in (Pacold, Michael E,; Suire, Sabine; Perisic, Olga; Lara-Gonzalez, Samuel; Davis, Colin T.; Walker, Edward H.; Hawkins, Phillip T.; Stephens, Len; Eccleston, John F.; Williams, Roger L. Crystal structure and functional analysis of Ras binding to its effector
phosphoinositide 3-kinase gamma. Cell (2000), 103(6), 931-943). Constructs lacking the N-terminal 144 aa.
Protein sequence of BV950:
1 MSEESQAFQR QT1TATiTGYDV TDVSNVHDDE 1,SFTRRGLVT PRMAEVASRD PKLYAMHPWV
61 TSKPLPEYLW KKIANNCIFI VIHRSTTSQT IKVSPDDTPG AILQSFPTKM AKKKSLMDIP
121 ESQSRQDFVL RVCGRDEYLV GETPIKNPQW VRHCLKWGEE IHWLDTPPD PALDEVRKEE
181 WPLVDDCTGV TGYHEQLT]H GKDHESVFTV SLWϋCDRKFR VKTRGTDIPV LPRNTDLTVF 241 VFANIQHGQQ VLCQRRTSPK PFTEEVLWiW WLEFSIKIKD LPKGALLNLQ IYCGKAPALS 301 SKASAESPSS ESKGKVRLLY YVKLLLIDHR FLLRRGEYVL HMWQISGKGE DQGSFNADKL 361 TSATWPDKEN SMSiSILLDN YCHPiALPKH QPTPDPEGDR VRAHMPNQLR KQLKAI IATD 421 PLNPLTAEDK ELLWHFRYES LKHPKAYPKL FSSVKWGQQE IVAKTYQLLA RREVWDQSAL 481 DVGLTMQLLD CNFSDENVRA lAVQKLLSLE DDDVLHYLLQ LVQAVKFEPY HDRALARFLI, b41 KRGLRNKRIG HFLFWFLRSE lAQSRHYQQR FAVILEAYLR GCGTAMLHi)F TQQVQVIEML 601 QKVTLϋlKSL SAEKYDVSSQ VI SQLKQKLE NLQNSQLPES FRVPYDPGLK AGALATEKCK 663 VMASKKKPLW LEFKCADPTA LSNETIGIIF KHGDDLRQDM L1LQ1LR1MB SIWETESLDL 721 CLLPYGCIST GDKIGMIEIV KDATTIAKtQ QSTVGNTGAF KDEVLNHWLK EKSPTEEKFQ 781 AAVERFVYSC AGYCVATFVL GlGDRHNDNl MITETGNLFH IDFGHILGNY KSFLG1NKER 841 VPFVLTPDFL FVMGTSGKKT SPKFQKFQDI CVKAYLALRH HTNLLIILFS MMLMTGMPQL 901 TSKEDIEYIR DALTVGKNEE DAKKYFLDQI EVCRDKGWTV QFNWFLHLVL GIKQGEKHSA
961 HKHHHH (SEQ ID No. 13) PI3Kδ construct and protein
Figure imgf000068_0002
BV1060: PCR products for the inter SH2 domain (iSH2) of the p85 subunit and for the full-length p110δ subunit were generated and fused by overlapping PCR. The iSH2 PCR product was generated by using as a template the ORF318 (see above) and the primers gwG130-p03 (5'- GGGACAAG-
TTTGTACAAAAAAGCAGGCTACGAAGGAGATATACATATGC- GAGAATATGATAGATTATATGAAGAAT-3') (SEQ ID No. 7) and gwG154-pO4 (5'- TCCTCCTCCT-CCTCCTCCTGGTTTAATGCTGTTCATACGTTTGTC-S') (SEQ ID No. 14). The p110δ fragment was obtained from first strand cDNA generated by RT- PCR from commercial human RNA from placenta, testis and brain (Clontech), using initially primers gwG154-pO1 (5'- ATGCCCCCTGGGGTGGACTGCCCCAT-3') (SEQ ID No. 15) and gwG154-pO2 (δ'-CTACTGCCTGT-TGTCTTTGGACACGT-S1) (SEQ ID No. 16). in a subsequent PCR reaction linker sequences and a Histidine tag was added at the 5'end and 3'end of the p110δ fragment respectively, using primers gw154-pO3 (5'-ATTAAACCAGGAGGAGGAGGAGGAGGACCCCCTGGGGTGGAC- TGCCCCATGGA-3') (SEQ ID No. 17) and gwG154-pO6 (51- AGCTCCGTGATGGTGATGGTGAT-GTGCT- CCCTGCCTGTTGTCTTTGGACACGTTGT-3') (SEQ ID No. 18).The p85-iSH2/ p110δ fusion protein was assembled in a third PCR reaction by the overlapping linkers at the 3'end of the iSH2 fragment and the 5'end of the p110δ fragment, using the above mentioned gwG130-p03 primer and a primer containing an overlapping Histidine tag and the Gateway (Invitrogen) AttB2 recombination sequences (5'-GGG- ACCACTTTGTACAAGAAAGCTGGGTTTAA- GCTCCGTGATGGTGATGGTGAGTGCTCC-3') (SEQ ID No. 19). This final product was recombined in a Gateway OR reaction into the donor vector pDONR201 (Invitrogen) to generate the ORF319 entry clone. This clone was verified by sequencing and used in a Gateway LR reaction (Invitrogen) to transfer the insert into the Gateway adapted pBlueBac4.5 (Invitrogen) vector for generation of the baculovirus expression vector LR415.
Protein sequence of BV1060:
1 14REYDRIJYEE YTRTSQΞIQM KRTAIEAFNE TIKIFEEQCQ TQERYSKEYI EKFKREGNEK
61 EIQRIMHNYD KLKSRISEir DSRRRLEEDL KKQAAEYREI DKRMNSTKPG GGGGGPPGVD
121 CPMEFWTKEE NQSWVDFLL PTGVYLNFPV SRNAMLSTIK QLLWHRΛQYΞ PLFHMLSGPE 181 AYVFTCINQT AEQQELΞDEQ RRLCDVQPFL PVLRLVAREG DRVKKLINSQ ISLLIGKGLH
241 EFDSLCDPEV NDFRAKMCQF CEEAAARRQQ LGWEAWLQYS FPLQLEPSAQ TWGPGTLRLP
301 NRALLVNVKF EGSEESKTFQ VSTKDVPLAL MACALRKKAT VFRQPLVEQ? EDYTLQVNGR
361 HEYLYGSYPL CQFQYICSCL HSGLTPHLTM VHSSSILAMR DEQSKPAPQV QKPRAKPPPI 421 PAKKPSSVSL WSLEQPFRIE LIQGSKVNAD ERMKLWQAG LFHGKΈMLCK TVSSSEVSVC
481 SEPWJKQRLE FDINICDLPR KARLCFALYA VIEKAKKARS TKKKSKKADC PIAWANLMLF
541 DYKDQLKTGE RCLYMWPSVP DEKGELLNPT GTVRSNPNTD SAAALLICLP EVAPHPVΎYP
601 ALEKILELGR HSECVHVTEE EQLQLREILE RRGSGELYEH EKDLWKLRH EVQEHFPEAL 661 ARLLLVTKWN KHEDVAQMLY LLCSWPELPV LSALELLDFS FPDCHVGSFA IKSLRKLTDD
721 ELFQYLLQLV QVLKYESYLD CELTKFLLDR ALANRKIGHF LFWHLRSEJOi VPSVALRFGL
781 TLEAYCRGST HHMKVLMKQG EALSKLKALN DFVKLSSQKT PKPQTKELΪ-IH LCMRQEAYLE
841 ALSHLQSPLD PSTLLAEVCV EQCTFMDSKM KPLWIMYSNE EAGSGGSVGI IFKNGDDLRQ
901 DMLTLQMIQL MDVLWKQEGL DLRMTPYGCL PTGDRTGLIE WLRSDTlAN IQLNKSNMAA 961 TAAFNKDALL NWLKSKNPGE ALDRAIEEFT LSCAGYCVAT YVLGIGDRHS DNIMIRESGQ
1021 LFHIDFGHFL GNFKTKFGIN RERVPFILTY DFVHVIQQGK TNNSEKFERF RGYCERAYTl
1081 LRRHGLLFLH LFALMRAAGL PELSCSKDIQ YLKDSLALGK TEEEALKHFR VKFNEALRES
1141 WKTKVNWLAH NVSKDNRQEL GGAHHHHHH (SEQ ID NO. 20)
Purification of P13Kct, PI3Kβ and PI3Kγ constructs
Pi3Kα, PI3Kβ and PI3Ky were purified in two chromatographic steps: immobilized metal affinity chromatography (IMAC) on a Ni sepharose resin (GE Healthcare) and gel filtration utilizing a Superdex 200 26/60 column (GE Healthcare). All buffers were chilled to 40C and lysis was performed chilled on ice. Column fractionation was performed at room temperature. All buffers used to purify PI3Kβ contained 0.05% Triton X100 in addition to what is described beiow.
Typically frozen cells from 10 L of Tn5 cell culture were resuspended in "Lysis Buffer" 20 rrsM Tris-CI, pH 7,5, 500 mM NaCI, 5% glycerol, 5 mM imidazole, 1 mM NaF, 0.1ug/mL okadaic acid (OAA), 5 mM BME, 1 x Complete protease inhibitor cocktail - EDTA-free (20 tablets/1 L buffer, Roche Applied Sciences), benzonase (25U/ml_ buffer, EMD Biosciences) at a ratio of 1 :6 v/v pellet to Lysis Buffer ratio, and mechanically lysed by dounciπg 20 strokes using a tight-fitting pestle. The lysate was centrifuged at 45,000 g for 30 minutes, and the supernatant was loaded onto a pre-equilibrated IMAC column (3 mL resin/100 mL lysate). The column was washed with 3-5 column volumes of Lysis Buffer, followed by a second wash of 3-5 column volumes with 20 mM Tris-CI, pH 7.5, 500 mM NaCI, 5% glycerol, 45 mM imidazole, 1 mM NaF, 0.1μg/mL OAA, 5 mM BME, 1x Complete protease inhibitor cocktail - EDTA-free. Protein was eluted with 20 mM Tris-CI, pH 7.5, 0.5 M NaCI, 5% glycerol, 250 mM imidazole, 1 mM NaF, 0.1μg/mL OAA, 5 mM BME, 1x Complete protease inhibitor cocktail - EDTA-free. Pertinent fractions were analyzed by SDS-PAGE and pooled accordingly. The protein was further purified by gel filtration on a Superdex 200 26/60 column equilibrated in 20 mM Tris-CI, pH 7 5, 0 5 M NaCI, 5% glycerol, 1 mM NaF, 5 mM DTT, 1x Complete protease inhibitor cocktati - EDTA-free Pertinent fractions were analyzed by SDS-PAGE and pooled accordingly An equal volume of Dialysis Buffer (20 mM Tπs-CI, pH 7 5, 500 mM NaCI, 50% glycerol, 5 mM NaF, 5 mM DTT) was added to the pool and than dialyzed against Dialysis Buffer two changes (one change overnight) Protein was stored at - 200C
Purification of PI3Kδ
PI3K5 was purified in three chromatographic steps immobilized metal affinity chromatography on a Ni Sepharose resin (GE Healthcare), gel filtration utilizing a Superdex 200 26/60 column (GE Healthcare), and finally a ion exchange step on a Q-HP column (GE Healthcare) All buffers were chilled to 40C and lysis was performed chilled on ice Column fractionation was performed at room temperature
Typically frozen cells from 10 L of Tn5 cell culture were resuspended in "Lysis Buffer" 20 mM Tπs-CI, pH 7 5, 500 mM NaCI, 5% glycerol, 5 mM imidazole, 1 mM NaF, 0 1 μg/mL okadaic acid (OAA), 5 mM BME, 1 x Complete protease inhibitor cocktail - EDTA-free (20 tablets/1 L buffer, Roche Applied Sciences), benzonase (25U/mL lysis buffer, EMD Biosciences) at a ratio of 1 10 v/v pellet to Lysis Buffer ratio, and mechanically lysed by douncing 20 strokes using a tight-fitting pestle The lysate was centrifuged at 45,000 g for 30 minutes, and the supernatant was loaded onto a pre-equiiibrated IMAC column (5 mL resιn/100 mL lysate) The column was washed with 3-5 column volumes of Lysis Buffer, followed by a second wash of 3-5 column volumes with 20 mM Tris-CI, pH 7 5, 500 mM NaCI, 5% glycerol, 40 mM imidazole, 1 mM NaF, 0 1ug/mL OAA, 5 mM BME1 1 x Complete protease inhibitor cocktail - EDTA-free Protein was eluted with 20 mM Tπs-CI, pH 7 5, 500 mM NaCl, 5% glycerol, 250 mM imidazole, 1 mM NaF, 0 1 μg/mL OAA, 5 mM BME, 1 x Complete protease inhibitor cocktail - EDTA-free Pertinent fractions were analyzed by SDS-PAGE and pooled accordingly The protein was further purified by gel filtration on a Superdex 200 equilibrated in 20 mM Tπs-CI, pH 7 5, 500 mM NaCI, 5% glycerol, 1 mM NaF, 0 1ug/mL OAA 5 mM DTT, 1 x Complete protease inhibitor cocktail - EDTA-free Pertinent fractions were analyzed by SDS-PAGE and pooled accordingly These fractions were diluted 1 10 v/v poo! volume to buffer ratio with Buffer A" 20 mM Tris-CI, pH 8 2, 5% glycerol, 1 mM NaF1 0 1 μg/mL OAA, 5 mM DTT and loaded onto a prepared Q-HP column After sample loading is completed we wash with Buffer A and 5% Buffer B" 20 mM Tπs-CI, pH 8 2, 1 M NaCI, 5% glycerol 1 mM NaF 0 1 ug/mL OAA, 5 mM DTT for 3-5 column volumes We elute the protein using a 5%-30% gradient of Buffer B Typically the protein elutes at ~200 mM NaCI Pertinent fractions were analyzed by SDS-PAGE and pooled accordingly An equal volume of Dialysis Buffer (20 mM Tns-CI, pH 7 5, 500 mM NaCI, 50% glycerol, 1 mM NaF, 0 1μg/mL OAA, 5 mM DTT) was added to the pooi and then dialyzed against Dialysis Buffer two changes (one change overnight) Protein was stored at -2O0C
The following results were obtained using the above described assays The selectivity factors for the PI3K beta, gamma and delta isoforms were calculated by dividing the respective IC50 value by the PI3Kalpha IC5O value
Figure imgf000072_0001
n d = not done

Claims

A compound of formula i
Figure imgf000073_0001
wherein,
m is O or i,
n is O or i,
R1 represents H, halogen, unsubstituted C-ι-C4-alkyl or substituted Ci-C4-alkyls
R2 ss independently selected from the group consisting of unsubstituted or substituted CrCa-alkyl, unsubstituted or substituted CrC3-alkoxy, unsubstituted or substituted amino, halogen or hydroxy,
R3 is independently selected from the group consisting of unsubstituted or substituted CrCg-alkyl, unsubstituted or substituted Ci-C8-alkoxy, unsubstituted or substituted amino, halogen or hydroxy,
R4 is independently selected from the group consisting of unsubstttuted or substituted
Ci-C8-alkyl, unsubstituted or substituted d-Cβ-alkoxy, halogen or hydroxy, or R3 and R4 form, together with the same or different carbon atom to which they are attached,
C3-Ca-cycloalkyi or heterocyclyl,
R5 is unsubstituted or substituted heteroaryl,
or a salt thereof, and
excluding the compound (IR^S.SS^S-aza-bicycloβ 1 0Jhexane-2,3-dιcarboxyiιc acid 2- amide 3-{[5-(2-tert-butyl-pyrιmιdιn-4-yl)-4-methyl-thιazol-2-ylJ-amιde}
2 A compound according to Claim 1 , wherein
R2 represents CrC4-alkyl, CrC4-alkoxy( di-C1-C4-alkyl-amιno, halogen or hydroxy, or a salt thereof 3 A compound according to to any preceding claim, wherein
R3 represents C-rC4-alkyl, d-d-alkoxy, dι-C1-C4-alkyl-amino, halogen or hydroxy, or a salt thereof
4 A compound according to any preceding claim, wherein
R4 is independently selected from the group consisting of unsubstituted or substituted C,-C8-alkyl, unsubstituted or substituted Ci-C8-alkoxy, halogen or hydroxy, or
R3 and R4 form, together with the same carbon atom to which they are attached, C3-C8- cycloalkyl, or
R3 and R4 form, together with the same or different carbon atom to which they are attached, heterocyclyl
5 A compound according to any preceding claim, wherein
R4 is independently selected from the group consisting of unsubstituted or substituted d-Ca-alkyl unsubstituted or substituted Ci-C8-alkoxy, halogen or hydroxy, or
R3 and R4 form, together with the same carbon atom to which they are attached, C3-C8- cycloaikyl or heterocyclyl
6 A compound according to any preceding claim, wherein,
R5 represents unsubstituted or substituted heteroaryl,
substituted by one or more moiety independently selected from the group consisting of halogen, hydroxy, cyano, nitro, d-C7-alkyl, per-deutero d-Cz-alkyl, C3~C12-cycloalkyl, (d-C7-alkyi)-C3-d2-cycloalkyl, (halo-CrC7-aikyl)-C3-Ci2-cycloalkyl, amino-d-Cr-alkyf, halo-Ci-C7-alkyl, N-d-Cr-alkanoylamino-d-Cr-alkyl, N-CrC7-alkanesulfonyl-amιno-Cr C7-alkyl, pyrrolidino-CrCy-alkyl, oxo- pyrrolidino-d-Cz-alkyl, d-C7-alkanesulfιnyl, C1- C7-aikanesulfonyl, d-C7-alkoxy, amino, N-mono- or N,N-dι-(CrC7-alkyl)-amtno, N- mono- or N,N-dι-(per-deutero d-C7-aikyl)-amιno, N-mono- or N1N^i-(C1-C7- cycloalkyl)-amιno d-C7-alkanoylamιno, pyrrolidino, oxo-pyrrolidino, pipeπdino, pιperazιn-1-yl, 4-(d-C7-alkyl, Ci-C7-alkoxy-d-C7-alkyl, haio-CrC7-alkyl or C3-C10- cycloalkyl)-pιperazιn-1-yl, 4-(amιno-Ci-C7-alkyl)-pιperazιn-1-yl, 4-[N-mono- or N,N-di- (CrCralkylaminoJ-d-CralkylJ-piperazin-i-yl, morpholino, thiomorpholino, S-oxo- or S,S-dιoxothιomorpholιno, CrC7-alkanesulfonylamιno, carbamoyl, N-mono- or N,N-dι- (CrCz-alkyl, CrCT-alkoxy-CrCy-alkyl, amιno-CrC7-alkyl and/or (N"~rnono- or N',N'-dι- (CrC7-alkyl)-amιno-Ci-C7-alkyl)-carbamoyl, pyrrolιdιn-1-carbonyl, pιperidin-1-carbonyl, pιperazιn-1-carbonyi, 4-(C1-C7-alkyl)piperaztn~1~carbonyl, morpholin-1-carbonyl, thιomorpholιn-1-carbonyl, S-oxo- or S.S-dioxothiomorphoIin-i-carbonyl, sulfo, C1-C7- alkanesulfonyl, Ci-C7-alkanesulfιnyl, sulfamoyl, N-mono- or N.N-di-CCt-Cr-alkyl)- sulfamoyl, morpholinosulfonyl, thiomorpholinosulfonyl, thtazoiyl
7 A compound according to any preceding ciaim wherein,
R5 represents heteroaryl selected from the group consisting of pyπdyl, pyrimidinyl, pyrazinyl and thiazolyl, each independently substituted by one substituent selected from the group consisting of Ci~C4-alkyl, per-deutero C1-C4-alkyl, halo-CrC4-atkyl, 1- (CrC4-alkyl)-C3-C8-cycloalkyl, (halo-CrC4-alkyl)-C3-Ce-cycloalkyl, di-CrC^alkylamtno, di-(per-deutero Ci ~C4-alkyl)amιno 8 A compound according to any preceding claim, wherein,
m is 0 or 1 and n is 1
9 A compound according to claim 1 selected from (2S,3R)-3-Methyl-pyrrohdιne-
1 ,2-dιcarboxylιc acid 2-amιde 1 -({4-methyl-5-[2-(1 -methyl-cyclopropylj-pyπdin-φ-ylj-thiazol-^- yi}-amιde),
(2S,3R)-3-Methyi-pyrrolιdιne-1 ,2-dιcarboxylιc acid 2-amιde 1-({4-methyl-5-[2-(2l2,2- trιfluoro-1 , 1 -dιmethyl-ethyl)-pyrιdιn-4-yi]-thιazol~2-yl}-arnιde),
(racJ-S.S-Dirnethyl-pyrrolidine-i ^-dicarboxylic acid 2-amιde 1-({4-methyl-5-[2-(1- methyl-cyclopropyl)-pyrιdιn-4-yl]-thtazol-2-yl}-amide),
(racJ-S.S-Dimethyl-pyrrolidine-i^-dicarboxylic acid 2-amιde 1-({4-methyl-5-[2-(2,2,2- tπfluoro-1 ,1-dιmethyl-ethyl)-pyrιdιn-4-yl]-thιazol-2-yl}-amιde),
{2S,3S)-3-(Acetylamino-methyt)-pyrrolιdιne-1 ,2-dιcarboxylιc acid 2-amιde 1-({4-methyl- 5-t2-(1-methyl-cyclopropyl)-pyrιdιn-4-yl]-thιazol-2-yl}-amιde},
(2S,3S)-3-(Acetylamιno-methyl)-pyrroltdιne-1,2-dιcarboxylιc acid 2-amιde 1 -({4-methyl- 5-[2-{2,2,2-trιfluoro-1 , 1 -dιmethyl-ethyl)-pyrιdιn-4-yl]-thιazol-2-yl}-amιde),
(2S,3S)-3-Morpholιn-4-ylmethyl-pyrrolιdιne-1,2-dιcarboxylιc acid 2-amιde 1-({4-methyl- 5-[2-(1-methyl-cyclopropyl)-pyrιdιn-4-yl]-thιazol-2-yi}-amιde),
(2S,3S)-3-Morpholιn-4-ylmethyl-pyrrolιdιne-1,2-dιcarboxylιc acid 2-amide 1-({4-methyl- 5-[2-(2,2,2-trifluoro-1 ,1-dιmethyl-ethyl)-pyrιdιn-4-yl]-thιazol-2-yl}-amιde), (2S 3R)-3-Methyl-pyrrolidιne-1 ,2-dιcarboxylic acid 2-amιde 1-({5-[2-(1-fiuoro-1-methyl- ethyl)-pyrιmιdιn-4-yl]-4-methyl-thιa20l-2-yl}-amιde)(
(2S,3R)-3-Hydroxy-pyrrofιdιne-1,2-dtcarboxyiιc acid 2-amide 1-{[4'-methyl-2-(1- tπfluoromethyl-cyciopropyl)-[4,5']bιthιazotyl-2'-yl]-amιde}
(2S,3R)-3-Methyl-pyrrol!dιne-1 ,2-dιcarboxylιc acid 2-amide 1-{[4'-methyl-2-(1- tπfluoromethyl-cyclopropyl)-t4,5']bιthiazolyl-2'-yl]-amιde},
(2S,3R)-3-Methyl-pyrrolιdιne-1 ,2-dιcarboxytιc acid 2-amιde 1-{[5-(2-dβ-tert-butyl- pyπmidιn-4-yl)-4-methyl-thιazol-2-yl]-amιde},
(2S,3R)-3-Methyl-pyrrolιdιne-1,2-dιcarboxylιc acid 2-amιde 1-{[5-(6- d10-dιethylamιno- pyrazin-2-yl)~4-methyl-thiazol-2-yl]-amide},
(2S,3R)-3-Methoxymethy!-pyrroIidine-1,2-dicarboxylic acid 2-amιde 1 -({4-methyt-5-[2- (2,2,2-tπfluoro-1,1-dιmethyi-ethyi)-pyrιdιn-4-yl]-thιazol-2-yl}-amιde),
(2S>3S)-3-Dιmethylamιnomethyl-pyrrolidιne-1 ,2-dιcarboxylιc acid 2-amιde 1-({4-methyl~ 5-[2-(2,2,2-trιfIuoro-1 , 1 -dimethyl-ethyO-pyπdin^-yll-thiazol^-ylJ-amide),
(2S,3R)-3-Methyl-pyrrolιdιne-1 ,2-dιcarboxylιc acid 2-amιde 1-{[5-(2-tert-butyf-pyπdιn-4- yl)-4-methyI-thιazol-2-yl]-amide}
10 A pharmaceutical composition comprising a compound of formula (I), according to any of Claims 1 to 9, or a pharmaceutically acceptable salt thereof, and optionally a further therapeutic agent, together with a pharmaceutically acceptable carrier
11 A compound of the formula (I), according to any one of Claims 1 to 9, or
pharmaceutically acceptable salt thereof, for use in the treatment of a lipid and/or protein kinase dependent disease
12 Use of a compound of formula (I), according to any one of Claims 1 to 9, or a
pharmaceutically acceptable salt thereof, for the preparation of a pharmaceutical composition for use in the treatment of a lipid and/or protein kinase dependent disease
13 A method of treatment of a disease that responds to inhibition of a lipid and/or protein kinase, which comprises administering a prophylactically or therapeutically effective amount of a compound of formula (I) according to any one of Claims 1-9, or a pharmaceutically acceptable salt thereof, to a warm-blooded animal, in need of such treatment A compound for use according to Claim 11 , or the use of a compound according to claim 12, or a method of treatment according to claim 13, wherein the disease is a lipid kinase dependent disease dependent on a Class I PI3K A compound for use according to Claim 11 , or the use of a compound according to claim 12, or a method of treatment according to claim 13, wherein the disease is a lipid kinase dependent disease dependent on a Class I PI3K selected from the group consisting of PI3Kaipha, PI3Kbeta, PI3Kdelta, PI3Kgarnma A compound for use according to Claim 11 , or the use of a compound according to claim 12, or a method of treatment according to claim 13, wherein the disease is a proliferative disease, a benign or malignant tumor, a cancer selected from sarcoma, lung, bronchus, prostate, breast (including sporadic breast cancers and sufferers of Cowden disease), pancreas, gastrointestinal cancer, colon, rectum, colon carcinoma, colorectal adenoma, thyroid, liver, intrahepatic bile duct, hepatocellular, adrenal gland, stomach, gastric, glioma, glioblastoma, endometrial, melanoma, kidney, renal pelvis, urinary bladder, uterine corpus, uterine cervix, vagina, ovary, multiple myeloma, esophagus, a leukaemia, acute myelogenous leukemia, chronic myelogenous leukemia, lymphocytic leukemia, myeloid leukemia, brain, a carcinoma of the brain, oral cavity and pharynx, larynx, small intestine, non-Hodgkin lymphoma, melanoma, villous colon adenoma, a neoplasia, a neoplasia of epithelial character, lymphomas, a mammary carcinoma, basal cell carcinoma squamous cell carcinoma, actinic keratosis, tumor diseases, including solid tumors, a tumor of the neck or head, polycythemia vera, essential thrombocythemia, and myelofibrosis with myeloid metaplasia
PCT/EP2010/059352 2009-07-02 2010-07-01 Substituted 2-carboxamide cycloamino ureas Ceased WO2011000905A1 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
EP10730435.4A EP2448935B1 (en) 2009-07-02 2010-07-01 Substituted 2-carboxamide cycloamino ureas
EA201200086A EA201200086A1 (en) 2009-07-02 2010-07-01 SUBSTITUTED 2-CARBOXAMIDES OF CYCLOAMINOM CEAMS
CA2766855A CA2766855A1 (en) 2009-07-02 2010-07-01 Substituted 2-carboxamide cycloamino ureas
AU2010268019A AU2010268019A1 (en) 2009-07-02 2010-07-01 Substituted 2-carboxamide cycloamino ureas
BRPI1015909A BRPI1015909A2 (en) 2009-07-02 2010-07-01 2-carboxamide cycloamino substituted ureas
MX2012000177A MX2012000177A (en) 2009-07-02 2010-07-01 Substituted 2-carboxamide cycloamino ureas.
CN2010800300379A CN102471332A (en) 2009-07-02 2010-07-01 Substituted 2-carboxamide cyclic semicarbazides
JP2012518092A JP2012531456A (en) 2009-07-02 2010-07-01 Substituted 2-carboxamide cycloaminoureas

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US27002909P 2009-07-02 2009-07-02
US61/270,029 2009-07-02

Publications (1)

Publication Number Publication Date
WO2011000905A1 true WO2011000905A1 (en) 2011-01-06

Family

ID=42727680

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2010/059352 Ceased WO2011000905A1 (en) 2009-07-02 2010-07-01 Substituted 2-carboxamide cycloamino ureas

Country Status (14)

Country Link
US (1) US8293753B2 (en)
EP (1) EP2448935B1 (en)
JP (1) JP2012531456A (en)
KR (1) KR20120092552A (en)
CN (1) CN102471332A (en)
AR (1) AR077367A1 (en)
AU (1) AU2010268019A1 (en)
BR (1) BRPI1015909A2 (en)
CA (1) CA2766855A1 (en)
EA (1) EA201200086A1 (en)
MX (1) MX2012000177A (en)
TW (1) TW201105666A (en)
UY (1) UY32747A (en)
WO (1) WO2011000905A1 (en)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014114928A1 (en) 2013-01-23 2014-07-31 Astrazeneca Ab Chemical compounds
JP2015532927A (en) * 2012-09-20 2015-11-16 ノバルティス アーゲー Combination medicine comprising phosphatidylinositol 3-kinase inhibitor and aromatase inhibitor
WO2017046394A1 (en) 2015-09-17 2017-03-23 Astrazeneca Ab Novel biomarkers and methods of treating cancer
WO2024089272A1 (en) * 2022-10-28 2024-05-02 Institut National De La Sante Et De La Recherche Medicale New inhibitors of phosphatidylinositol 3-kinase
US12152033B2 (en) 2013-03-01 2024-11-26 Incyte Corporation Use of pyrazolopyrimidine derivatives for the treatment of PI3K-δ related disorders
EP4643858A1 (en) * 2024-04-29 2025-11-05 Institut National de la Santé et de la Recherche Médicale Methods and pharmaceutical composition for the treatment of uterine disease
US12478616B2 (en) 2018-10-05 2025-11-25 Sloan-Kettering Institute For Cancer Research PI3K inhibitors and uses thereof

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AR044519A1 (en) * 2003-05-02 2005-09-14 Novartis Ag DERIVATIVES OF PIRIDIN-TIAZOL AMINA AND PIRIMIDIN-TIAZOL AMINA
KR20100093129A (en) * 2007-12-20 2010-08-24 노파르티스 아게 Thiazole derivatives used as pi 3 kinase inhibitors
EP2852661A1 (en) 2012-05-23 2015-04-01 F. Hoffmann-La Roche AG Compositions and methods of obtaining and using endoderm and hepatocyte cells
CN116239591B (en) * 2023-02-14 2025-09-23 嘉兴大学 A (4R)-sulfonylamino-L-prolinamide compound, preparation method, application and pharmaceutical combination thereof
CN116987072A (en) * 2023-07-27 2023-11-03 武汉呈瑞生物医药科技有限公司 Compounds and their applications

Citations (77)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4107288A (en) 1974-09-18 1978-08-15 Pharmaceutical Society Of Victoria Injectable compositions, nanoparticles useful therein, and process of manufacturing same
US4169846A (en) 1976-09-06 1979-10-02 Kenji Inagaki Cis-platinum (ii) complex of trans-l-1,2-diaminocyclohexane
US4323581A (en) 1978-07-31 1982-04-06 Johnson & Johnson Method of treating carcinogenesis
EP0227415A2 (en) 1985-12-23 1987-07-01 Imperial Chemical Industries Plc Pyrimidine derivatives
US4689338A (en) 1983-11-18 1987-08-25 Riker Laboratories, Inc. 1H-Imidazo[4,5-c]quinolin-4-amines and antiviral use
WO1988007045A1 (en) 1987-03-09 1988-09-22 Kyowa Hakko Kogyo Co., Ltd. Derivatives of physiologically active substance k-252
WO1989007105A1 (en) 1988-02-04 1989-08-10 Kyowa Hakko Kogyo Co., Ltd. Staurosporin derivatives
US4929624A (en) 1989-03-23 1990-05-29 Minnesota Mining And Manufacturing Company Olefinic 1H-imidazo(4,5-c)quinolin-4-amines
US5041424A (en) 1987-08-04 1991-08-20 Bristol-Myers Company Epipodophyllotoxin glucoside 4'-phosphate derivatives
US5145684A (en) 1991-01-25 1992-09-08 Sterling Drug Inc. Surface modified drug nanoparticles
WO1993007153A1 (en) 1991-10-10 1993-04-15 Schering Corporation 4'-(n-substituted-n-oxide)staurosporine derivatives
WO1993008809A1 (en) 1991-11-08 1993-05-13 The University Of Southern California Compositions containing k-252 compounds for potentiation of neurotrophin activity
US5238944A (en) 1988-12-15 1993-08-24 Riker Laboratories, Inc. Topical formulations and transdermal delivery systems containing 1-isobutyl-1H-imidazo[4,5-c]quinolin-4-amine
US5266575A (en) 1991-11-06 1993-11-30 Minnesota Mining And Manufacturing Company 2-ethyl 1H-imidazo[4,5-ciquinolin-4-amines
US5268376A (en) 1991-09-04 1993-12-07 Minnesota Mining And Manufacturing Company 1-substituted 1H-imidazo[4,5-c]quinolin-4-amines
WO1994005304A1 (en) 1992-08-31 1994-03-17 Ludwig Institute For Cancer Research Isolated nonapeptide derived from mage-3 gene and presented by hla-a1, and uses thereof
WO1994006799A1 (en) 1992-09-21 1994-03-31 Kyowa Hakko Kogyo Co., Ltd. Thrombocytopenia remedy
WO1994010202A1 (en) 1992-10-28 1994-05-11 Genentech, Inc. Vascular endothelial cell growth factor antagonists
US5352784A (en) 1993-07-15 1994-10-04 Minnesota Mining And Manufacturing Company Fused cycloalkylimidazopyridines
US5389640A (en) 1991-03-01 1995-02-14 Minnesota Mining And Manufacturing Company 1-substituted, 2-substituted 1H-imidazo[4,5-c]quinolin-4-amines
US5395937A (en) 1993-01-29 1995-03-07 Minnesota Mining And Manufacturing Company Process for preparing quinoline amines
WO1995012660A2 (en) 1993-10-29 1995-05-11 Board Of Regents, The University Of Texas System Recombinant p53 adenovirus methods and compositions
WO1995017182A1 (en) 1993-12-23 1995-06-29 Eli Lilly And Company Protein kinase c inhibitors
US5457105A (en) 1992-01-20 1995-10-10 Zeneca Limited Quinazoline derivatives useful for treatment of neoplastic disease
US5478932A (en) 1993-12-02 1995-12-26 The Board Of Trustees Of The University Of Illinois Ecteinascidins
US5482936A (en) 1995-01-12 1996-01-09 Minnesota Mining And Manufacturing Company Imidazo[4,5-C]quinoline amines
US5494916A (en) 1993-07-15 1996-02-27 Minnesota Mining And Manufacturing Company Imidazo[4,5-C]pyridin-4-amines
WO1996006116A1 (en) 1994-08-19 1996-02-29 Regents Of The University Of Minnesota Immunoconjugates comprising tyrosine kinase inhibitors
WO1996013506A1 (en) 1994-10-26 1996-05-09 Cephalon, Inc. Protein kinase inhibitors for treatment of neurological disorders
US5525812A (en) 1993-12-07 1996-06-11 The United States Of America As Represented By The United States Department Of Energy Retractable pin dual in-line package test clip
WO1996030347A1 (en) 1995-03-30 1996-10-03 Pfizer Inc. Quinazoline derivatives
WO1997007081A2 (en) 1995-08-11 1997-02-27 Yale University Glycosylated indolocarbazole synthesis
US5621100A (en) 1992-07-24 1997-04-15 Cephalon, Inc. K-252a derivatives for treatment of neurological disorders
WO1997020842A1 (en) 1995-12-01 1997-06-12 Centre National De La Recherche Scientifique (C.N.R.S.) Novel purine derivatives having, in particular, antiproliferative properties, and biological uses thereof
WO1997021701A1 (en) 1995-12-08 1997-06-19 Janssen Pharmaceutica N.V. Farnesyl protein transferase inhibiting (imidazol-5-yl)methyl-2-quinolinone derivatives
WO1997029780A1 (en) 1996-02-14 1997-08-21 Isis Pharmaceuticals, Inc. Methoxyethoxy oligonucleotides for modulation of protein kinase c expression
WO1998004541A1 (en) 1996-07-25 1998-02-05 Dong A Pharmaceutical Co., Ltd. Gastroprotective flavone/flavanone compounds with therapeutic effect on inflammatory bowel disease
WO1998005769A2 (en) 1996-08-02 1998-02-12 Genesense Technologies, Inc. Antitumor antisense sequences directed against r1 and r2 components of ribonucleotide reductase
US5747498A (en) 1996-05-28 1998-05-05 Pfizer Inc. Alkynyl and azido-substituted 4-anilinoquinazolines
US5770599A (en) 1995-04-27 1998-06-23 Zeneca Limited Quinazoline derivatives
US5780454A (en) 1994-10-28 1998-07-14 Proscript, Inc. Boronic ester and acid compounds
WO1998043095A1 (en) 1997-03-21 1998-10-01 Georgetown University Liposomes containing oligonucleotides
WO1999002162A1 (en) 1997-07-12 1999-01-21 Cancer Research Campaign Technology Limited Cyclin dependent kinase inhibiting purine derivatives
US5883113A (en) 1995-06-07 1999-03-16 Sugen, Inc. 3-(4'-Bromobenzylindenyl)-2-indolinone and analogues thereof for the treatment of disease
WO1999061422A1 (en) 1998-05-29 1999-12-02 Sugen, Inc. Pyrrole substituted 2-indolinone protein kinase inhibitors
WO2000027422A2 (en) 1998-11-06 2000-05-18 Biogen, Inc. Methods and compositions for treating or preventing peripheral neuropathies
WO2001000245A2 (en) 1999-06-25 2001-01-04 Genentech, Inc. HUMANIZED ANTI-ErbB2 ANTIBODIES AND TREATMENT WITH ANTI-ErbB2 ANTIBODIES
WO2001004125A1 (en) 1999-07-13 2001-01-18 Kyowa Hakko Kogyo Co., Ltd. Staurosporin derivatives
WO2001032651A1 (en) 1999-11-05 2001-05-10 Astrazeneca Ab Quinazoline derivatives as vegf inhibitors
US6258812B1 (en) 1997-02-13 2001-07-10 Novartis Ag Phthalazines with angiogenesis inhibiting activity
WO2001060814A2 (en) 2000-02-15 2001-08-23 Sugen, Inc. Pyrrole substituted 2-indolinone protein kinase inhibitors
WO2001079255A1 (en) 2000-04-12 2001-10-25 Genaera Corporation A process for the preparation of 7.alpha.-hydroxy 3-aminosubstituted sterols using intermediates with an unprotected 7.alpha.-hydroxy group
US6331555B1 (en) 1995-06-01 2001-12-18 University Of California Treatment of platelet derived growth factor related disorders such as cancers
WO2002002552A1 (en) 2000-06-30 2002-01-10 Glaxo Group Limited Quinazoline ditosylate salt compounds
WO2002030941A2 (en) 2000-10-06 2002-04-18 Bristol-Myers Squibb Company Topoisomerase inhibitors
WO2002057423A2 (en) 2001-01-16 2002-07-25 Regeneron Pharmaceuticals, Inc. Isolating cells expressing secreted proteins
WO2002062826A1 (en) 2001-02-07 2002-08-15 Vadim Viktorovich Novikov Method for producing peptides
WO2003004505A1 (en) 2001-07-02 2003-01-16 Debiopharm S.A. Oxaliplatin active substance with a very low content of oxalic acid
WO2003024978A1 (en) 2001-09-18 2003-03-27 Postech Foundation Inclusion compound comprising cucurbituril derivatives as host molecule and pharmaceutical composition comprising the same
US20030134846A1 (en) 2001-10-09 2003-07-17 Schering Corporation Treatment of trypanosoma brucei with farnesyl protein transferase inhibitors
US6605617B2 (en) 2000-09-11 2003-08-12 Chiron Corporation Quinolinone derivatives
US20030171303A1 (en) 2002-02-19 2003-09-11 Gallop Mark A. Methods for synthesis of prodrugs from 1-acyl-alkyl derivatives and compositions thereof
US6621100B2 (en) 2000-10-27 2003-09-16 The Ohio State University Polymer-, organic-, and molecular-based spintronic devices
WO2003082272A1 (en) 2002-03-29 2003-10-09 Chiron Corporation Substituted benzazoles and use thereof as raf kinase inhibitors
WO2004006834A2 (en) 2002-07-15 2004-01-22 Unitech Pharmaceuticals, Inc. Leflunomide analogs for treating rheumatoid arthritis
WO2004009769A2 (en) 2002-07-24 2004-01-29 The Trustees Of The University Of Pennsylvania COMPOSITIONS AND METHODS FOR siRNA INHIBITION OF ANGIOGENESIS
US20040073044A1 (en) 2002-05-10 2004-04-15 Sharma Arun Prakash Anticancer taxanes such as paclitaxel, docetaxel and their structural analogs, and a method for the preparation thereof
US6727256B1 (en) 1998-01-12 2004-04-27 Smithkline Beecham Corporation Bicyclic heteroaromatic compounds as protein tyrosine kinase inhibitors
WO2004060308A2 (en) 2002-12-27 2004-07-22 Chiron Corporation Thiosemicarbazones as anti-virals and immunopotentiators
WO2004064759A2 (en) 2003-01-21 2004-08-05 Chiron Corporation Use of tryptanthrin compounds for immune potentiation
WO2004087153A2 (en) 2003-03-28 2004-10-14 Chiron Corporation Use of organic compounds for immunopotentiation
WO2004096797A1 (en) 2003-05-02 2004-11-11 Novartis Ag Inhibitors of phosphatidylinositol 3-kinase
WO2005021519A2 (en) 2003-08-28 2005-03-10 Novartis Ag 5-phenyl-4-methyl-thiazol-2-yl-amine derivatives as inhibitors of phosphatidylinositol 3 kinase enzymes (pi3) for the treatment of inflammatory airway diseases
WO2005068444A2 (en) 2004-01-12 2005-07-28 Applied Research Systems Ars Holding N.V. Thiazole derivatives and use thereof
WO2007115930A1 (en) * 2006-04-06 2007-10-18 Boehringer Ingelheim International Gmbh Thiazolyldihydroindazoles
US20090163469A1 (en) * 2007-12-20 2009-06-25 Novartis Ag Organic Compounds
WO2009080705A2 (en) * 2007-12-20 2009-07-02 Novartis Ag Bis-thiazole derivatives, process for their preparation and their use as medicaments

Family Cites Families (40)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4649146A (en) * 1983-01-31 1987-03-10 Fujisawa Pharmaceutical Co., Ltd. Thiazole derivatives and pharmaceutical composition comprising the same
DE3703435A1 (en) 1987-02-05 1988-08-18 Thomae Gmbh Dr K NEW THIAZOLES, MEDICINAL PRODUCTS CONTAINING THESE COMPOUNDS AND METHOD FOR THE PRODUCTION THEREOF
EP0373226B1 (en) 1988-04-15 1994-06-15 Taiho Pharmaceutical Company, Limited Carbamoyl-2-pyrrolidinone compounds
WO1998027108A2 (en) 1996-12-16 1998-06-25 Fujisawa Pharmaceutical Co., Ltd. New amide compounds and their use as nitric oxide synthase inhibitors
US6187797B1 (en) * 1996-12-23 2001-02-13 Dupont Pharmaceuticals Company Phenyl-isoxazoles as factor XA Inhibitors
ATE257703T1 (en) 1997-10-27 2004-01-15 Takeda Chemical Industries Ltd 1,3-THIAZOLES AS ADENOSINE A3 RECEPTOR ANTAGONISTS FOR THE TREATMENT OF ASTHMA, ALLERGIES AND DIABETES
FR2777908B1 (en) 1998-04-24 2000-12-08 Agronomique Inst Nat Rech CLONING AND EXPRESSION OF THE BETA-GLUCOSIDASE GENE OF FUNGAL ORIGIN BGII
IL147182A0 (en) * 1999-06-30 2002-08-14 Interleukin Genetics Inc Diagnostics and therapeutics for diseases associated with an il-1 inflammatory haplorype
BR0013899A (en) * 1999-09-10 2003-07-08 Merck & Co Inc A compound, pharmaceutical composition, processes for treating or preventing cancer, a disease in which angiogenesis is implicated, retinal vascularization, diabetic retinopathy, age-related macular degeneration, inflammatory diseases, tyrosine-dependent disease or conditions. kinase, bone-associated pathologies, and processes for producing a pharmaceutical composition, and for reducing or preventing tissue damage following a cerebral ischemic event
AU2001242629B2 (en) 2000-03-29 2005-08-11 Cyclacel Limited 2-substituted 4-heteroaryl-pyrimidines and their use in the treatment of proliferative disorders
EP1415987B1 (en) 2000-10-20 2007-02-28 Eisai R&D Management Co., Ltd. Nitrogenous aromatic ring compounds as anti cancer agents
DE60208630T2 (en) 2001-05-11 2006-08-17 Pfizer Products Inc., Groton Thiazole derivatives and their use as cdk inhibitors
EA007717B1 (en) * 2001-08-13 2006-12-29 Янссен Фармацевтика Н.В. 2-amino-4,5-trisubstituted thiazolyl derivatives
US7265134B2 (en) 2001-08-17 2007-09-04 Merck & Co., Inc. Tyrosine kinase inhibitors
ATE349443T1 (en) * 2001-09-28 2007-01-15 Cyclacel Ltd N-(4-(4-METHYLTHIAZOLE-5-YL)PYRIMIDINE-2-YL)-N-PHENYLAMINES AS ANTIPROLIFERATIVE COMPOUNDS
AR038703A1 (en) 2002-02-28 2005-01-26 Novartis Ag DERIVATIVES OF 5-PHENYLTIAZOL AND USE AS AN INHIBITOR OF QUINASA P I 3
JP2006514684A (en) * 2002-10-30 2006-05-11 バーテックス ファーマシューティカルズ インコーポレイテッド Compositions useful as Rock and other protein kinases
EP1567487A4 (en) 2002-11-15 2005-11-16 Bristol Myers Squibb Co Open chain prolyl urea-related modulators of androgen receptor function
GB0305152D0 (en) 2003-03-06 2003-04-09 Novartis Ag Organic compounds
US20060218641A1 (en) 2003-04-24 2006-09-28 Koninklijke Philips Electronics, N.V. Class-based content transfer between devices
MXPA06002567A (en) 2003-09-06 2006-09-04 Vertex Pharma Modulators of atp-binding cassette transporters.
SE0402735D0 (en) 2004-11-09 2004-11-09 Astrazeneca Ab Novel compounds
DE102005024157A1 (en) 2005-05-23 2006-11-30 Amedo Gmbh needle positioning
AU2006251157B2 (en) 2005-05-24 2011-09-01 Merck Serono Sa Thiazole derivatives and use thereof
US7655446B2 (en) 2005-06-28 2010-02-02 Vertex Pharmaceuticals Incorporated Crystal structure of Rho-kinase I kinase domain complexes and binding pockets thereof
DE102005048072A1 (en) 2005-09-24 2007-04-05 Bayer Cropscience Ag Thiazoles as fungicides
RU2008128453A (en) 2005-12-12 2010-01-20 Дженелабс Текнолоджис, Инк. (Us) COMPOUND OF N- (5-MEMORY ARIL) AMIDES, PHARMACEUTICAL COMPOSITION WITH ANTIVIRAL ACTIVITY BASED ON THEM, METHOD FOR TREATING OR PREVENTING VIRAL INFECTION WITH THEIR HELP AND METHOD
GB0525671D0 (en) 2005-12-16 2006-01-25 Novartis Ag Organic compounds
AU2007206860A1 (en) 2006-01-23 2007-07-26 Laboratoires Serono S.A. Thiazole derivatives and use thereof
PE20070978A1 (en) * 2006-02-14 2007-11-15 Novartis Ag HETEROCICLIC COMPOUNDS AS INHIBITORS OF PHOSPHATIDYLINOSITOL 3-KINASES (PI3Ks)
GB0610243D0 (en) 2006-05-23 2006-07-05 Novartis Ag Organic compounds
US20080058654A1 (en) * 2006-09-06 2008-03-06 Hun-Yuan Ke Manometer with indication label
JP2010510246A (en) 2006-11-21 2010-04-02 スミスクライン ビーチャム コーポレーション Amide antiviral compounds
WO2008124000A2 (en) 2007-04-02 2008-10-16 Ligand Pharmaceuticals Incorporated Thiazole derivatives as androgen receptor modulator compounds
GB0707087D0 (en) * 2007-04-12 2007-05-23 Piramed Ltd Pharmaceutical compounds
US9242933B2 (en) 2007-05-25 2016-01-26 AbbVie Deutschland GmbH & Co. KG Heterocyclic compounds as positive modulators of metabotropic glutamate receptor 2 (mGlu2 receptor)
US20090004140A1 (en) 2007-06-26 2009-01-01 Yao-Ling Qiu 4-substituted pyrrolidine as anti-infectives
AU2008275891B2 (en) 2007-07-19 2013-10-10 H.Lundbeck A/S 5-membered heterocyclic amides and related compounds
UA104147C2 (en) * 2008-09-10 2014-01-10 Новартис Аг PYROLIDINDICARBONIC ACID DERIVATIVE AND ITS APPLICATION IN THE TREATMENT OF PROLIFERATIVE DISEASES
ES2432671T3 (en) * 2009-07-02 2013-12-04 Novartis Ag 2-carboxamide cycloamine ureas useful as PI3K inhibitors

Patent Citations (82)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4107288A (en) 1974-09-18 1978-08-15 Pharmaceutical Society Of Victoria Injectable compositions, nanoparticles useful therein, and process of manufacturing same
US4169846A (en) 1976-09-06 1979-10-02 Kenji Inagaki Cis-platinum (ii) complex of trans-l-1,2-diaminocyclohexane
US4323581A (en) 1978-07-31 1982-04-06 Johnson & Johnson Method of treating carcinogenesis
US4689338A (en) 1983-11-18 1987-08-25 Riker Laboratories, Inc. 1H-Imidazo[4,5-c]quinolin-4-amines and antiviral use
EP0227415A2 (en) 1985-12-23 1987-07-01 Imperial Chemical Industries Plc Pyrimidine derivatives
WO1988007045A1 (en) 1987-03-09 1988-09-22 Kyowa Hakko Kogyo Co., Ltd. Derivatives of physiologically active substance k-252
US5041424A (en) 1987-08-04 1991-08-20 Bristol-Myers Company Epipodophyllotoxin glucoside 4'-phosphate derivatives
WO1989007105A1 (en) 1988-02-04 1989-08-10 Kyowa Hakko Kogyo Co., Ltd. Staurosporin derivatives
US5238944A (en) 1988-12-15 1993-08-24 Riker Laboratories, Inc. Topical formulations and transdermal delivery systems containing 1-isobutyl-1H-imidazo[4,5-c]quinolin-4-amine
US4929624A (en) 1989-03-23 1990-05-29 Minnesota Mining And Manufacturing Company Olefinic 1H-imidazo(4,5-c)quinolin-4-amines
US5145684A (en) 1991-01-25 1992-09-08 Sterling Drug Inc. Surface modified drug nanoparticles
US5389640A (en) 1991-03-01 1995-02-14 Minnesota Mining And Manufacturing Company 1-substituted, 2-substituted 1H-imidazo[4,5-c]quinolin-4-amines
US5268376A (en) 1991-09-04 1993-12-07 Minnesota Mining And Manufacturing Company 1-substituted 1H-imidazo[4,5-c]quinolin-4-amines
US5346905A (en) 1991-09-04 1994-09-13 Minnesota Mining And Manufacturing Company 1-substituted 1H-imidazo-[4,5-C]quinolin-4-amines
WO1993007153A1 (en) 1991-10-10 1993-04-15 Schering Corporation 4'-(n-substituted-n-oxide)staurosporine derivatives
US5266575A (en) 1991-11-06 1993-11-30 Minnesota Mining And Manufacturing Company 2-ethyl 1H-imidazo[4,5-ciquinolin-4-amines
WO1993008809A1 (en) 1991-11-08 1993-05-13 The University Of Southern California Compositions containing k-252 compounds for potentiation of neurotrophin activity
US5457105A (en) 1992-01-20 1995-10-10 Zeneca Limited Quinazoline derivatives useful for treatment of neoplastic disease
US5616582A (en) 1992-01-20 1997-04-01 Zeneca Limited Quinazoline derivatives as anti-proliferative agents
US5621100A (en) 1992-07-24 1997-04-15 Cephalon, Inc. K-252a derivatives for treatment of neurological disorders
WO1994005304A1 (en) 1992-08-31 1994-03-17 Ludwig Institute For Cancer Research Isolated nonapeptide derived from mage-3 gene and presented by hla-a1, and uses thereof
WO1994006799A1 (en) 1992-09-21 1994-03-31 Kyowa Hakko Kogyo Co., Ltd. Thrombocytopenia remedy
WO1994010202A1 (en) 1992-10-28 1994-05-11 Genentech, Inc. Vascular endothelial cell growth factor antagonists
US5395937A (en) 1993-01-29 1995-03-07 Minnesota Mining And Manufacturing Company Process for preparing quinoline amines
US5494916A (en) 1993-07-15 1996-02-27 Minnesota Mining And Manufacturing Company Imidazo[4,5-C]pyridin-4-amines
US5352784A (en) 1993-07-15 1994-10-04 Minnesota Mining And Manufacturing Company Fused cycloalkylimidazopyridines
WO1995012660A2 (en) 1993-10-29 1995-05-11 Board Of Regents, The University Of Texas System Recombinant p53 adenovirus methods and compositions
US5478932A (en) 1993-12-02 1995-12-26 The Board Of Trustees Of The University Of Illinois Ecteinascidins
US5525812A (en) 1993-12-07 1996-06-11 The United States Of America As Represented By The United States Department Of Energy Retractable pin dual in-line package test clip
WO1995017182A1 (en) 1993-12-23 1995-06-29 Eli Lilly And Company Protein kinase c inhibitors
WO1996006116A1 (en) 1994-08-19 1996-02-29 Regents Of The University Of Minnesota Immunoconjugates comprising tyrosine kinase inhibitors
WO1996013506A1 (en) 1994-10-26 1996-05-09 Cephalon, Inc. Protein kinase inhibitors for treatment of neurological disorders
US5780454A (en) 1994-10-28 1998-07-14 Proscript, Inc. Boronic ester and acid compounds
US5482936A (en) 1995-01-12 1996-01-09 Minnesota Mining And Manufacturing Company Imidazo[4,5-C]quinoline amines
WO1996030347A1 (en) 1995-03-30 1996-10-03 Pfizer Inc. Quinazoline derivatives
US5770599A (en) 1995-04-27 1998-06-23 Zeneca Limited Quinazoline derivatives
US6331555B1 (en) 1995-06-01 2001-12-18 University Of California Treatment of platelet derived growth factor related disorders such as cancers
US5883113A (en) 1995-06-07 1999-03-16 Sugen, Inc. 3-(4'-Bromobenzylindenyl)-2-indolinone and analogues thereof for the treatment of disease
WO1997007081A2 (en) 1995-08-11 1997-02-27 Yale University Glycosylated indolocarbazole synthesis
WO1997020842A1 (en) 1995-12-01 1997-06-12 Centre National De La Recherche Scientifique (C.N.R.S.) Novel purine derivatives having, in particular, antiproliferative properties, and biological uses thereof
WO1997021701A1 (en) 1995-12-08 1997-06-19 Janssen Pharmaceutica N.V. Farnesyl protein transferase inhibiting (imidazol-5-yl)methyl-2-quinolinone derivatives
WO1997029780A1 (en) 1996-02-14 1997-08-21 Isis Pharmaceuticals, Inc. Methoxyethoxy oligonucleotides for modulation of protein kinase c expression
US5747498A (en) 1996-05-28 1998-05-05 Pfizer Inc. Alkynyl and azido-substituted 4-anilinoquinazolines
US6025387A (en) 1996-07-25 2000-02-15 Dong A Pharmaceutical Co., Ltd. Gastroprotective flavone/flavanone compounds with therapeutic effect on inflammatory bowel disease
WO1998004541A1 (en) 1996-07-25 1998-02-05 Dong A Pharmaceutical Co., Ltd. Gastroprotective flavone/flavanone compounds with therapeutic effect on inflammatory bowel disease
WO1998005769A2 (en) 1996-08-02 1998-02-12 Genesense Technologies, Inc. Antitumor antisense sequences directed against r1 and r2 components of ribonucleotide reductase
US6258812B1 (en) 1997-02-13 2001-07-10 Novartis Ag Phthalazines with angiogenesis inhibiting activity
WO1998043095A1 (en) 1997-03-21 1998-10-01 Georgetown University Liposomes containing oligonucleotides
WO1999002162A1 (en) 1997-07-12 1999-01-21 Cancer Research Campaign Technology Limited Cyclin dependent kinase inhibiting purine derivatives
US6727256B1 (en) 1998-01-12 2004-04-27 Smithkline Beecham Corporation Bicyclic heteroaromatic compounds as protein tyrosine kinase inhibitors
WO1999061422A1 (en) 1998-05-29 1999-12-02 Sugen, Inc. Pyrrole substituted 2-indolinone protein kinase inhibitors
WO2000027422A2 (en) 1998-11-06 2000-05-18 Biogen, Inc. Methods and compositions for treating or preventing peripheral neuropathies
WO2001000245A2 (en) 1999-06-25 2001-01-04 Genentech, Inc. HUMANIZED ANTI-ErbB2 ANTIBODIES AND TREATMENT WITH ANTI-ErbB2 ANTIBODIES
WO2001004125A1 (en) 1999-07-13 2001-01-18 Kyowa Hakko Kogyo Co., Ltd. Staurosporin derivatives
WO2001032651A1 (en) 1999-11-05 2001-05-10 Astrazeneca Ab Quinazoline derivatives as vegf inhibitors
WO2001060814A2 (en) 2000-02-15 2001-08-23 Sugen, Inc. Pyrrole substituted 2-indolinone protein kinase inhibitors
WO2001079255A1 (en) 2000-04-12 2001-10-25 Genaera Corporation A process for the preparation of 7.alpha.-hydroxy 3-aminosubstituted sterols using intermediates with an unprotected 7.alpha.-hydroxy group
WO2002002552A1 (en) 2000-06-30 2002-01-10 Glaxo Group Limited Quinazoline ditosylate salt compounds
US6605617B2 (en) 2000-09-11 2003-08-12 Chiron Corporation Quinolinone derivatives
US6774237B2 (en) 2000-09-11 2004-08-10 Chiron Corporation Quinolinone derivatives
WO2002030941A2 (en) 2000-10-06 2002-04-18 Bristol-Myers Squibb Company Topoisomerase inhibitors
US6621100B2 (en) 2000-10-27 2003-09-16 The Ohio State University Polymer-, organic-, and molecular-based spintronic devices
WO2002057423A2 (en) 2001-01-16 2002-07-25 Regeneron Pharmaceuticals, Inc. Isolating cells expressing secreted proteins
WO2002062826A1 (en) 2001-02-07 2002-08-15 Vadim Viktorovich Novikov Method for producing peptides
WO2003004505A1 (en) 2001-07-02 2003-01-16 Debiopharm S.A. Oxaliplatin active substance with a very low content of oxalic acid
WO2003024978A1 (en) 2001-09-18 2003-03-27 Postech Foundation Inclusion compound comprising cucurbituril derivatives as host molecule and pharmaceutical composition comprising the same
US20030134846A1 (en) 2001-10-09 2003-07-17 Schering Corporation Treatment of trypanosoma brucei with farnesyl protein transferase inhibitors
US20030171303A1 (en) 2002-02-19 2003-09-11 Gallop Mark A. Methods for synthesis of prodrugs from 1-acyl-alkyl derivatives and compositions thereof
WO2003082272A1 (en) 2002-03-29 2003-10-09 Chiron Corporation Substituted benzazoles and use thereof as raf kinase inhibitors
US20040073044A1 (en) 2002-05-10 2004-04-15 Sharma Arun Prakash Anticancer taxanes such as paclitaxel, docetaxel and their structural analogs, and a method for the preparation thereof
WO2004006834A2 (en) 2002-07-15 2004-01-22 Unitech Pharmaceuticals, Inc. Leflunomide analogs for treating rheumatoid arthritis
WO2004009769A2 (en) 2002-07-24 2004-01-29 The Trustees Of The University Of Pennsylvania COMPOSITIONS AND METHODS FOR siRNA INHIBITION OF ANGIOGENESIS
WO2004060308A2 (en) 2002-12-27 2004-07-22 Chiron Corporation Thiosemicarbazones as anti-virals and immunopotentiators
WO2004064759A2 (en) 2003-01-21 2004-08-05 Chiron Corporation Use of tryptanthrin compounds for immune potentiation
WO2004087153A2 (en) 2003-03-28 2004-10-14 Chiron Corporation Use of organic compounds for immunopotentiation
WO2004096797A1 (en) 2003-05-02 2004-11-11 Novartis Ag Inhibitors of phosphatidylinositol 3-kinase
WO2005021519A2 (en) 2003-08-28 2005-03-10 Novartis Ag 5-phenyl-4-methyl-thiazol-2-yl-amine derivatives as inhibitors of phosphatidylinositol 3 kinase enzymes (pi3) for the treatment of inflammatory airway diseases
WO2005068444A2 (en) 2004-01-12 2005-07-28 Applied Research Systems Ars Holding N.V. Thiazole derivatives and use thereof
WO2007115930A1 (en) * 2006-04-06 2007-10-18 Boehringer Ingelheim International Gmbh Thiazolyldihydroindazoles
US20090163469A1 (en) * 2007-12-20 2009-06-25 Novartis Ag Organic Compounds
WO2009080705A2 (en) * 2007-12-20 2009-07-02 Novartis Ag Bis-thiazole derivatives, process for their preparation and their use as medicaments
WO2009080694A1 (en) * 2007-12-20 2009-07-02 Novartis Ag Thiazole derivatives used as pi 3 kinase inhibitors

Non-Patent Citations (44)

* Cited by examiner, † Cited by third party
Title
ALI ET AL., NATURE, vol. 431, 2004, pages 1007 - 1011
BADER ET AL., NATURE REV. CANCER, vol. 5, 2005, pages 921
BARBER ET AL., NATURE MEDICINE, vol. 11, 2005, pages 933 - 935
BREAST CAN. RES. TREAT., vol. 91, 2005, pages 187
CAMPS ET AL., NATURE MEDICINE, vol. 11, 2005, pages 936 - 943
CANTLEY, CELL, vol. 64, 1991, pages 281
CLAYTON ET AL., J. EXP. MED., vol. 196, 2002, pages 753 - 763
DONOVAN ET AL., J. BIOL. CHEM., vol. 276, 2001, pages 40888
ESCOBEDO; WILLIAMS, NATURE, vol. 335, 1988, pages 85
FANTL ET AL., CELL, vol. 69, 1992, pages 413
FANTL ET AL., CELL, vol. 69, 1992, pages 413 - 423
FRUMAN ET AL., ANNU REV BIOCHEM, vol. 67, 1998, pages 481
GHOBRIAL ET AL., CA CANCER J. CLIN, vol. 55, 2005, pages 178 - 194
GOUDAR ET AL., MOL. CANCER. THER, vol. 4, 2005, pages 101 - 112
H JI ET AL., J. MED CHEM., vol. 49, 2006, pages 6254
H. FUKUSHIMA ET AL., BIORG. MED CHEM., vol. 12, 2004, pages 6053
HENNESSEY, NATURE REV. DRUP DISC., vol. 4, 2005, pages 988 - 1004
J. ORG CHEM., vol. 73, 2008, pages 3946 - 3949
J. ORG. CHEM., vol. 73, 2008, pages 3946 - 3949
JACKSON ET AL., NATURE MEDICINE, vol. 11, 2005, pages 507 - 514
JOU ET AL., MOL. CELL, BIOL., vol. 22, 2002, pages 8580 - 8590
KANG, PROC. NATL. ACAD. SCI. USA, vol. 102, 2005, pages 802
KATSO ET AL., ANNU. REV. CELL DEV. BIOL., vol. 17, 2001, pages 615
KATSO ET AL., ANNU. REV., CELL DEV. BIOL., vol. 17, 2001, pages 615 - 675
KOKUBO ET AL., BRIT. J. CANCER, vol. 92, 2005, pages 1711
NAGATA ET AL., CANCER CELL, vol. 6, 2004, pages 117
PACOLD, MICHAEL E.; SUIRE, SABINE; PERISIC, OLGA; LARA-GONZALEZ, SAMUEL; DAVIS, COLIN T.; WALKER, EDWARD H.; HAWKINS, PHILLIP T.;: "Crystal structure and functional analysis of Ras binding to its effector phosphoinositide 3-kinase gamma", CELL, vol. 103, no. 6, 2000, pages 931 - 943
PACOLD, MICHAEL E.; SUIRE, SABINE; PERISIC, OLGA; LARA-GONZALEZ, SAMUEL; DAVIS, COLIN T.; WALKER, EDWARD H.; HAWKINS, PHILLIP T.;: "Crystal structure and functional analysis of Ras binding to its effector phosphonositide 3-kinase gamma", CELL, vol. 103, no. 6, 2000, pages 931 - 943
PARSONS ET AL., NATURE, vol. 436, 2005, pages 792
REIF ET AL., J. IMMUNOL., vol. 173, 2004, pages 2236 - 2240
ROGER WILLIAMS, LAB. MRC LABORATORY OF MOLECULAR BIOLOGY, November 2003 (2003-11-01)
SAMUELS ET AL., CANCER CELL, vol. 7, 2005, pages 561 - 573
SAMUELS ET AL., SCIENCE, vol. 304, 2004, pages 554
SHE ET AL., CANCER CELL, vol. 8, 2005, pages 287 - 297
STEPHENS ET AL., CELL, vol. 89, 1997, pages 105
SUIRE ET AL., CURRO. BIOL., vol. 15, 2005, pages 566
T. WERNER; A.G.M. BARRETT, J. ORG. CHEM., vol. 71, 2006, pages 4302 - 4304
TET. LEIT., vol. 38, 1997, pages 85 - 88
TETRAHEDRON LETT, vol. 26, 1974, pages 2269 - 70
VANHAESEBROECK ET AL., ANNU. REV BIOCHEM, vol. 70, 2001, pages 535
VIGLIETTO ET AL., NAT MED., vol. 8, 2002, pages 1145
VIVANCO; SAWYER, NATURE REV CANCER, vol. 2, 2002, pages 489
WESTFALL; SKINNER, MOT. CANCER THER, vol. 4, 2005, pages 1764 - 1771
WOODS LGNATOSKI ET AL., BRIT. J. CANCER, vol. 82, 2000, pages 666

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2015532927A (en) * 2012-09-20 2015-11-16 ノバルティス アーゲー Combination medicine comprising phosphatidylinositol 3-kinase inhibitor and aromatase inhibitor
WO2014114928A1 (en) 2013-01-23 2014-07-31 Astrazeneca Ab Chemical compounds
US9156831B2 (en) 2013-01-23 2015-10-13 Astrazeneca Ab Chemical compounds
US9657008B2 (en) 2013-01-23 2017-05-23 Astrazeneca Ab Chemical compounds
US12152033B2 (en) 2013-03-01 2024-11-26 Incyte Corporation Use of pyrazolopyrimidine derivatives for the treatment of PI3K-δ related disorders
WO2017046394A1 (en) 2015-09-17 2017-03-23 Astrazeneca Ab Novel biomarkers and methods of treating cancer
US12478616B2 (en) 2018-10-05 2025-11-25 Sloan-Kettering Institute For Cancer Research PI3K inhibitors and uses thereof
WO2024089272A1 (en) * 2022-10-28 2024-05-02 Institut National De La Sante Et De La Recherche Medicale New inhibitors of phosphatidylinositol 3-kinase
EP4643858A1 (en) * 2024-04-29 2025-11-05 Institut National de la Santé et de la Recherche Médicale Methods and pharmaceutical composition for the treatment of uterine disease
WO2025228907A1 (en) * 2024-04-29 2025-11-06 Institut National De La Sante Et De La Recherche Medicale Methods and pharmaceutical composition for the treatment of uterine disease

Also Published As

Publication number Publication date
TW201105666A (en) 2011-02-16
UY32747A (en) 2011-01-31
EP2448935A1 (en) 2012-05-09
JP2012531456A (en) 2012-12-10
US20110003818A1 (en) 2011-01-06
CA2766855A1 (en) 2011-01-06
MX2012000177A (en) 2012-02-28
US8293753B2 (en) 2012-10-23
CN102471332A (en) 2012-05-23
AU2010268019A1 (en) 2012-01-19
EA201200086A1 (en) 2012-07-30
EP2448935B1 (en) 2015-06-24
BRPI1015909A2 (en) 2019-09-24
AR077367A1 (en) 2011-08-24
KR20120092552A (en) 2012-08-21

Similar Documents

Publication Publication Date Title
US8293753B2 (en) Substituted 2-carboxamide cycloamino ureas
DK2331537T3 (en) 1 - ((5-Heteroarylthiazol-2-yl) aminocarbonyl) pyrrolidine-2-carboxamide derivatives as phosphatidylinositol-3-kinase (PI3K) inhibitors useful in the treatment of proliferation disorders
EP2240475B1 (en) Thiazole derivatives used as pi 3 kinase inhibitors
EP2238134A2 (en) Bis-thiazole derivatives, process for their preparation and their use as medicaments
EP2448946B1 (en) 2-carboxamide cycloamino ureas useful as pi3k inhibitors
HK1156305B (en) 1-((5-heteroarylthiazol-2-yl)aminocarbonyl)pyrrolidine-2-carboxamide derivatives as phosphatidylinositol 3-kinase (pi3k) inhibitors useful in the treatment of proliferative diseases

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201080030037.9

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10730435

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2010730435

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2010268019

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 10080/DELNP/2011

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 2766855

Country of ref document: CA

Ref document number: 2012518092

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: MX/A/2012/000177

Country of ref document: MX

ENP Entry into the national phase

Ref document number: 2010268019

Country of ref document: AU

Date of ref document: 20100701

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20127002827

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 201200086

Country of ref document: EA

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: PI1015909

Country of ref document: BR

ENP Entry into the national phase

Ref document number: PI1015909

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20111230